QIAGEN News - Rede Pró-Fauna

QIAGENNews 

Cover Microsatellite analysis of wild boar populations in 

Portugal by multiplex PCR 63 

New The first universal kit for quantitative, real-time, multiplex PCR 59 

New Faster high-throughput manual and automated PCR 

cleanup using the MinElute 96 UF PCR Purification Kit 65 

RNAi optimization and control experiments 66 

Trust QIAGEN plasmid kits — tailor-made for you! 69 

New Simultaneous purification of viral DNA and RNA from serum 

and plasma using the BioRobot M48 workstation 72 

New Accelerate research and discovery using 

comprehensive siRNA sets 

Ultra-high–throughput gene silencing for rapid, 

74 

economical functional genomics studies 76 

New Automated purification of bacterial DNA from primary 

clinical research samples 

Automated purification of anthrax DNA from soil for 

79 

biodefense applications 82 

1027989 10/2004 

3October 

2004 

WWW.QIAGEN.COM

What’s New? 

Editor 

Douglas J. McGarvey, Ph.D. 

Assistant editor 

Jason Smith, Ph.D. 

Writers 

Stephen Archibald, Ph.D. 

Finola Geraghty, Ph.D. 

Simon Liu, Ph.D. 

Douglas J. McGarvey, Ph.D. 

Elizabeth Scanlan, Ph.D. 

Jason Smith, Ph.D. 

Graphics and layout 

Marion Jaschke 

Production management 

Roland Stelzer 

news.editor@qiagen.com 

■ Alexa Fluor ® labeled, non-silencing, negative control siRNA duplexes allow easy monitoring of 

siRNA transfection efficiency and routine RNAi control experiments. Alexa Fluor dyes fluoresce 

longer, and are brighter and more photostable than other currently available dyes. 

Find out how you can use Alexa Fluor labeled siRNA to optimize your RNAi research at 

www.qiagen.com/siRNA . 

■ Validated Library siRNA Duplexes, designed against a wide range of common target genes, 

have been verified for gene silencing efficiency by QIAGEN scientists. Search the online 

database for Validated Library siRNA Duplexes and their corresponding QuantiTect ® Gene 

Expression Assays to combine high levels of gene knockdown and accurate quantitative RT-PCR 

analysis. Find out more about siRNA proven to provide high knockdown efficiency at 

www.qiagen.com/siRNA . 

■ Automated RNA purification for array analysis and other high-yield applications just got easier! 

The new EZ1 RNA Universal Tissue Kit and MagAttract RNA Universal Tissue M48 Kit provide 

automated purification of total RNA from all types of human or animal tissue, 

including difficult-to-lyse fatty and fiber-rich tissues, or cultured cells. The universal-tissue system 

integrates QIAzol lysis and easy automation on the BioRobot EZ1 workstation, for 

1–6 samples, or the BioRobot M48 workstation, for up to 48 samples. Visit 

www.qiagen.com/goto/EZ1RNAUniversal or www.qiagen.com/goto/M48Universal to find 

out more about automated RNA purification from any type of tissue! 

■ DNA purification from large amounts of blood is now quicker and easier using new QIAamp 

DNA Blood Midi and Maxi protocols for vacuum processing. The new QIAvac 24 Plus enables 

parallel processing of up to 24 samples, starting with up to 2 ml (Midi) or 10 ml (Maxi) human 

whole blood. Download the new protocols at www.qiagen.com/goto/QAMidiMaxiVacuum ! 

■ New application packages for the BioRobot M48 workstation provide specialized protocols for 

your research area. Each application package is supplied as a CD-ROM containing automated 

protocols for the workstation. Application packages are currently available for a wide range of 

clinical research areas, including infectious diseases, genotyping, genetic screening, genomic 

research, gene expression, forensics, and pathology. Visit www.qiagen.com/goto/M48 to 

discover the optimized protocols for your applications. 

■ Easy automated purification of virus DNA and RNA on the BioRobot EZ1 workstation is 

coming soon. The EZ1 Virus Mini Kit enables automated, simultaneous purification of viral DNA 

and RNA from 1–6 serum and plasma samples, with high yields for highly sensitive detection. 

Contact QIAGEN Technical Services for more details. 

Cover The European wild boar (Sus scrofa) was declared a protected species in Portugal at 

the end of the 1960s, mainly as a result of African swine fever and overhunting. Since then 

populations have recovered, and the wild boar is common and widespread throughout 

Portugal. Coamplification of several genomic markers using the QIAGEN Multiplex PCR Kit 

allows researchers to study genetic variations and diversity in wild boar populations. See 

page 63 for more information. 

58 www.qiagen.com QIAGEN News 2004 Issue 3

New 

The first universal kit for quantitative, real-time, multiplex PCR 

The QuantiTect ® Multiplex PCR Kit enables accurate real-time quantification of multiple cDNA or genomic DNA targets in a 

pre-optimized and easy-to-handle format. Sequence-specific probes compatible with the kit include TaqMan ® probes and 

dual-labeled probes from Operon Biotechnologies. The kit also provides a complete solution for quantitative, real-time, 

duplex PCR when used together with QuantiTect Gene Expression Assays for target and housekeeping genes. 

Benefits of the QuantiTect Multiplex PCR Kit: 

■ No optimization required — reagents and protocols are pre-optimized 

■ High sensitivity — detection of as few as 10 copies of each target sequence 

■ Reliable quantification — target and reference genes are quantified in the same reaction 

■ Easy handling — ready-to-use master mix is compatible with a wide range of 

real-time block cyclers 

Accurate quantification with minimal handling 

By using state-of-the-art technology to amplify several targets in the same reaction, the kit avoids the 

variability in setting up separate reactions and provides accurate quantification of target and 

reference genes. In addition, pipetting tasks are minimized, valuable samples and reagents are 

conserved, and throughput is increased. 

Pre-optimized reaction conditions 

In contrast to current methods for quantitative, real-time, multiplex PCR, the kit eliminates the need for 

optimization of the concentrations of primers, Mg2+ , and Taq DNA polymerase. The master mix 

supplied with the kit is specifically pre-optimized for quantitative, real-time, multiplex PCR, unlike 

master mixes supplied with quantitative, real-time, non-multiplex PCR kits. The pre-optimized master 

mix ensures that the PCR products in a multiplex reaction are amplified with the same efficiency and 

sensitivity as the PCR products in the corresponding single amplification reactions (Figure 1). 

High specificity and sensitivity is achieved through pre-optimization of the following components 

of the master mix: 

■ QuantiTect Multiplex PCR Buffer: This unique buffer was specifically developed to meet the 

demands of quantitative, real-time, multiplex PCR using sequence-specific probes. An optimized 

combination of KCl and (NH4) 2SO4 promotes a high ratio of specific to nonspecific primer 

binding during each annealing step. In addition, synthetic factor MP, which was developed for 

multiplex PCR, increases the local concentration of primers at the template and stabilizes 

specifically bound primers, allowing efficient primer annealing and extension. These buffer 

components therefore prevent different amplification reactions from affecting each other. 

■ HotStarTaq ® DNA Polymerase: Since this polymerase requires incubation at 95ºC for activation, 

misprimed products and primer–dimers, which can compete for reactants, are not formed 

during reaction setup. Reactions can therefore be set up at room temperature without any risk 

of generating nonspecific artifacts. 

QIAGEN News 2004 Issue 3 www.qiagen.com 59

Superior Performance in Quantitative, Real-Time, Multiplex PCR 

A Duplex PCR, QIAGEN 

B 

Single PCR, QIAGEN 

C Duplex PCR, QIAGEN 

D 

Single PCR, QIAGEN 

Duplex PCR, Supplier AII 

Single PCR, Supplier AII 

Duplex PCR, Supplier AII 

Single PCR, Supplier AII 

Figure 1 Two sequences were amplified either together in duplex PCR or in single PCRs on the ABI PRISM ® 7700. 

The templates were genomic DNA from the Ramos cell line carrying a t(8;14) translocation (template amounts corresponding 

to about 50,000, 5000, 500, 50, or 10 copies of the target region), and 107 copies of a plasmid containing human 

GAPDH cDNA sequence. TaqMan probes labeled with FAM or HEX reporter dye plus BHQ quencher were used. 

A Duplex or single PCRs using the QuantiTect Multiplex PCR Kit; t(8;14) translocation sequence detected. B Duplex or 

single PCRs using reagents from Supplier AII; t(8;14) translocation sequence detected. C Duplex or single PCRs using the 

QuantiTect Multiplex PCR Kit; GAPDH sequence detected. D Duplex or single PCRs using reagents from Supplier AII; 

GAPDH sequence detected. 


Ready-to-run protocols 

The handbook supplied with the kit provides tested protocols for various real-time cyclers as well 

as valuable information on assay design, reporter dye selection, and data analysis (Table 1). 

The protocols provide universal conditions for reaction setup and dependable cycling conditions 

to ensure accurate results the first time. 

Table 1. Comparable Threshold Cycle (C T) Values Between Triplex PCR and Corresponding Single 

Amplification PCRs 

Detection of 

t(8;14) translocation GAPDH cDNA 

NFκB cDNA sequence 

(see first column 

sequence (20 copies) sequence (106 copies) for copy number) 

Triplex PCR with 105 copies of NFκB 34.31 20.37 21.92 

Corresponding single PCRs 34.07 20.54 21.83 





Three templates were coamplified in a triplex PCR: 10 6 copies of a linearized plasmid containing human GAPDH cDNA 

sequence; 140 pg of genomic DNA from the Ramos cell line carrying a t(8;14) translocation (approximately 20 copies of 

the target sequence); and 10 5 , 10 4 , or 10 3 copies of a plasmid containing human NFκB cDNA sequence. This simulates 

detection of high, low, and variable amounts of target genes in a single sample. These templates were also amplified in 

single PCRs. TaqMan probes labeled with FAM, HEX, or Bodipy ® TMR reporter dye plus BHQ quencher were used. 

Reactions were performed using the ABI PRISM 7900. 

New assays for quantitative, real-time, multiplex PCR 

The kit is compatible with the expanding range of QuantiTect Gene Expression Assays, including 

the new assays for housekeeping genes. Since the new housekeeping gene assays use a distinct 

reporter dye, they can be combined in duplex PCR with other QuantiTect Assays that use FAM 

labeled QuantiProbes. The combination of QuantiTect Assays with the QuantiTect Multiplex PCR Kit 

provides a complete solution for accurate quantitative real-time duplex PCR of target and reference 

genes (Figure 2). 

High Performance Using QuantiTect Gene Expression Assays 

FAM Detection (EGR1) Yakima Yellow Detection (PGK) 

Figure 2 Variable amounts of human EGR1 sequence (50, 

5, or 0.5 ng of cDNA from the 293 human cell line) mixed 

with constant amounts of human PGK sequence (10 6 copies 

of a synthetic nucleic acid containing the target sequence) 

were amplified. Duplex PCR and single PCRs of each 

template mixture were performed in duplicate using the 

QuantiTect Multiplex PCR Kit in combination with the 

QuantiTect Gene Expression Assay for EGR1, which uses a 

FAM labeled QuantiProbe, and for PGK, which uses a 

Yakima Yellow labeled QuantiProbe. The amplification plots 

of the duplex and single reactions are overlaid to 

demonstrate identical CT values between the 2 types of PCR. 

Reactions were performed using the ABI PRISM 7900. 


Ordering Information 

Compatibility with many real-time cyclers 

The kit is compatible with most real-time cyclers that use a 96- or 

384-well block (Table 2). The master mix contains ROX dye, enabling 

the kit to be used with real-time cyclers that require ROX dye as passive 

reference dye, such as ABI Sequence Detection Systems. For other realtime 

cyclers or for assays that use probes labeled with Texas Red ® , ROX, 

or other equivalent dye, a kit containing master mix without ROX dye is 

also available. 

Table 2. Real-Time Cyclers Compatible with the QuantiTect Multiplex 

PCR Kit 

Conclusion 

Compatible with master mix containing 

Real-time cycler ROX dye No ROX dye 

ABI PRISM 7900 ✔ – 

ABI PRISM 7700* ✔ – 

ABI PRISM 7000 ✔ – 

iCycler † ✔ ✔ 

Rotor-Gene 3000 † ✔ ✔ 

Mx4000 ®† ✔ ✔ 

Mx3000P † ✔ ✔ 

DNA Engine Opticon ® 2 ‡ ✔ ✔ 

Smart Cycler ® II † ✔ ✔ 

* Certain limitations with triplex assays due to the instrument itself. 

† Duplex and triplex assays possible with master mix containing ROX dye; 4-plex assays 

also possible with master mix containing no ROX dye. 

‡ Only duplex assays possible with this instrument. 

Using the QuantiTect Multiplex PCR Kit, accurate results in quantitative, 

real-time, multiplex PCR can be achieved with the minimum of effort. 

Product Contents Cat. no. 

QuantiTect Multiplex For 200 x 50 µl reactions: 3 x 1.7 ml QuantiTect 204543 

PCR Kit (200) Multiplex PCR Master Mix, RNase-Free Water 

QuantiTect Multiplex For 1000 x 50 µl reactions: 25 ml QuantiTect 204545 

PCR Kit (1000) Multiplex PCR Master Mix, RNase-Free Water 

The supplied master mix contains ROX dye. A QuantiTect Multiplex PCR Kit without ROX dye in the master mix is available; please inquire. 

Visit www.qiagen.com/goto/qmpcr to get quantitative, multiplex PCR without the 

pre-optimization! 


Cover 

Microsatellite analysis of wild boar populations in Portugal by 

multiplex PCR 

Luís Souto*, E. Ferreira, and C. Fonsecat † 

*Center for Cell Biology (CBC) † Centre for Environmental and Marine Studies (CESAM) Department of Biology, 

Universidade de Aveiro, Aveiro, Portugal 

Microsatellite analysis is a widely used tool in the study of genetic variation within populations. Our laboratory is currently 

undertaking a genetic study of European wild boar (Sus scrofa) populations in Portugal. Using the QIAGEN ® Multiplex PCR 

Kit we were able, without any reaction optimization, to successfully detect multiple genomic markers from blood samples 

taken from wild boar. This is in contrast to a “homemade” method, which failed to produce results in multiplex reactions. 

Materials and methods 

DNA was extracted from 34 wild boar blood samples collected in 

several locations throughout Portugal. Four dinucleotide microsatellite 

STR markers — SW1701, SW2535, SW828, and SW1517— were 

chosen from a panel of pig genome markers (US Pig Genome Mapping 

Coordination Program). PCR primers for the respective loci were synthesized 

and fluorescently labeled with FAM (SW1701 and SW2535) or 

HEX (SW828 and SW1517). The functionality of primers was 

confirmed in singleplex PCRs using DNA isolated from wild boar blood 

samples as template. Singleplex and “homemade” multiplex reactions 

contained 0.2 µM each primer, 200 µM each dNTP, 1.5 mM MgCl2, 1 unit Taq DNA polymerase, and 5 µl template DNA solution. Cycling 

conditions were denaturation for 45 seconds at 94°C, annealing for 

60 seconds at 58°C, and extension for 60 seconds at 72°C. PCRs were 

performed using 26 or 30 cycles. 

Multiplex PCRs performed using the QIAGEN Multiplex PCR Kit 

contained 1x QIAGEN Multiplex Master Mix, 0.2 µM each primer, and 

10 µl template DNA solution. Cycling conditions were as recommended 

in the protocol for amplification of microsatellite loci in the QIAGEN 

Multiplex PCR Handbook. After an initial activation of HotStarTaq ® DNA 

Polymerase by incubation for 15 minutes at 95°C, cycling conditions 

were denaturation for 45 seconds at 94°C, annealing for 90 seconds at 

58°C, and extension for 60 seconds at 72°C. After 26 or 32 cycles, a 

final extension step of 30 minutes at 60°C was performed. 

Amplicons were analyzed using an ABI PRISM ® 310 sequence analyzer. 

A 1 µl aliquot of each PCR was loaded together with 30 µl deionized 

formamide and 0.5 µl ROX-labeled size standards. Electropherograms 

were analyzed using ABI PRISM GeneScan ® analysis software. 

Efficient Multiplex PCR Amplification of 

Genomic Markers 

Figure 1 Electropherograms of multiplex PCR of sample 

J-134 carried out using A QIAGEN Multiplex PCR Kit or 

B “homemade” method. Peaks from the respective locus 

are labeled. Blue peaks are FAM-labeled amplicons and 

green peaks are HEX-labeled amplicons. Red peaks are 

ROX-labeled size standards. 

QIAGEN News 2004 Issue 3 www.qiagen.com 63 

A 

B


Table 1. Selected Results of Multiplex PCR from the Respective Loci of Wild Boar and Domestic Pig 

Blood Samples 

Size of amplicons (base pairs) 

Sample reference Geographical SW1701 SW2535 SW1517 SW828 

number origin (FAM label) (FAM label) (HEX label) (HEX label) 

J-6 Mértola 90, 114 186, 186 144, 144 211, 211 

J-17 Góis 114, 122 176, 190 134, 134 217, 221 

J-25 Ansião 122, 126 176, 186 134, 138 221, 221 

J-51 Alfândega da Fé 108, 124 186, 186 134, 142 211, 221 

J-57 Carrazeda de Ansiáes 108, 124 186, 190 142, 148 211, 221 

J-115 Coruche 108, 114 192, 212 134, 134 211, 221 

J-129 Idanha-a-Nova 110, 122 186, 186 136, 136 221, 221 

J-134 Silves 114, 120 186, 186 134, 144 211, 221 

J-160 Domestic pig 106, 126 188, 188 116, 144 221, 221 

Results 

Using the primers designed for this study, all 4 markers could be detected in singleplex 

experiments. However, in a typical multiplex experiment using the “homemade” method described 

above, only single markers could be detected with low sensitivity. In contrast, multiplex PCR using 

the QIAGEN Multiplex PCR Kit typically enabled efficient amplification and accurate sizing of both 

alleles from all 4 markers (see Table 1, Figure 1). The efficiency of the amplification is reflected in 

the high signal intensities obtained for amplicons from all 4 loci (Figure 1A). 

The presence of stutter peaks is not unusual in the analysis of dinucleotide repeats, and their 

presence did not affect correct genetic typing of samples, as all allele sizes were in agreement with 

those obtained in singleplex control experiments. 

Conclusions 

■ The design of multiplex PCR assays used for analysis of several markers usually requires 

extensive optimization. Using the QIAGEN Multiplex PCR Kit, satisfactory results were obtained 

using the supplied protocol with no optimization. 

■ This robustness increases the speed and convenience of genetic typing, especially where 

multiple markers or high numbers of samples are being analyzed. 


QIAGEN Multiplex For 100 x 50 µl multiplex PCR reactions: 206143 

PCR Kit (100)* 2x QIAGEN Multiplex PCR Master Mix 

(providing a final concentration of 3 mM MgCl 2, 

3 x 0.85 ml), 5x Q-Solution (1 x 2.0 ml), 

RNase-free water (2 x 1.7 ml) 

* Larger size available; please inquire. 


Coming Soon 

Faster high-throughput manual and automated PCR cleanup using 

the MinElute ® 96 UF PCR Purification Kit 

The MinElute 96 UF PCR Purification Kit provides fast, high-throughput PCR purification, in a simple manual or fully 

automated procedure (see flowchart). An optimized ultrafiltration membrane delivers fast flow rates and high, reproducible 

recovery, even of smaller DNA fragments (Figure 1). The advanced plates in the kit are designed to allow final elution 

volumes as low as 20 µl in the manual procedure, delivering highly concentrated, purified DNA in just 13 minutes. A purple 

O-ring in each well allows researchers to see eluates more easily and pipet more accurately. 

The MinElute 96 UF PCR Purification Kit offers: 

■ Minimal elution volumes — high DNA concentrations in as little as 20 µl 

■ Fast, cost-effective procedure — well suited for high-throughput projects 

■ Fully automatable processing — walkaway processing on BioRobot ® 

workstations and other SBS-compatible automated systems (Figure 2) 

■ High, reproducible recovery — for fragments >100 bp 

Efficient, high-throughput PCR cleanup 

PCR products are loaded into the wells of ultrafiltration plates and a 

vacuum is applied. While small molecules such as primers, salts, and 

unincorporated nucleotides run through the membrane, PCR products 

≥100 bp are retained. Purified PCR products are eluted directly from the 

surface of the membrane in small volumes (as little as 20 µl in the manual 

procedure), leading to highly concentrated eluates. Purified DNA 

fragments are ready for direct use in all applications, including sequencing, 

microarray analysis, ligation, and restriction digestion. 

MinElute 96 UF PCR Purification Plates conform to SBS (Society for 

Biomolecular Screening) standards and offer two convenient handling 

options. Plates can be processed manually using a commercial vacuum 

manifold (e.g., QIAvac Multiwell, cat. no. 9014579) or on the BioRobot 

3000 or 8000 or other automated workstations (Figure 2). 

Walkaway Processing 



MinElute 96 UF PCR 4 MinElute 96 UF PCR Purification Plates 28051 

Purification Kit (4)* 

* Larger kit sizes available: please inquire. 

Figure 2 Automated processing on the BioRobot 3000 

workstation. 

Efficient Purification of Concentrated DNA 

m Q M III M Q M III M m 

– 500 bp 

– 100 bp 

Figure 1 DNA fragments (100 bp and 500 bp) were 

purified using either MinElute 96 UF PCR Purification Plates 

(Q) or ultrafiltration-based kits from other suppliers (Supplier 

MIII and Supplier M). Aliquots (5 µl) of the eluate were 

analyzed by agarose-gel electrophoresis. m: markers. 


RNAi optimization and control experiments 

Christian Korfhage, Peter Hahn, Andreas Meier, Gesa Niemann, Wolfgang Bielke, and Dirk Löffert 

QIAGEN GmbH, Hilden, Germany 

Important factors in the success of RNAi studies are optimization of transfection and performance of suitable control 

experiments that prevent artifactual effects being wrongly interpreted. In this study, we demonstrate that the RNAi 

Human/Mouse Control Kit, used with QuantiTect ® Gene Expression Assays for downstream analysis, allows convenient 

siRNA transfection optimization and control experiments in both human and mouse cells. 

Alexa Fluor Label Allows 

Easy Monitoring of Transfection 

Figure 1 HeLa S3 cells were transfected with Alexa Fluor 

488 labeled, non-silencing control siRNA using RNAiFect 

Reagent. Transfection efficiency was determined using 

fluorescence microscopy 24 hours after transfection. 

QuantiTect Gene Expression Assays Provide 

Highly Sensitive Quantitative RT-PCR Results 

6 

5 

4 

3 

2 

1 

0 

HeLa S3 

NIH/3T3 

1 10 

ng total RNA 

100 

Figure 2 Total RNA from untransfected HeLa S3 and 

NIH/3T3 cells was used in quantitative RT-PCR analysis 

with the human and mouse MAPK1 Gene Expression 

Assays. Standard curves show CT values obtained from 

RNA dilutions normalized against CT values obtained using 

100 ng total RNA. 

Convenient optimization of transfection and positivecontrol 

experiments 

The RNAi Human/Mouse Control Kit includes a non-silencing Alexa Fluor ® 

488 labeled siRNA for transfection optimization. The long duration of Alexa 

Fluor fluorescence, and its intensity in cells transfected with low siRNA concentrations, 

mean that it is very useful for optimization of RNAi experiments. 

A validated siRNA targeted against a sequence common to both the 

human and mouse MAPK1 gene is also provided in the kit. The protein 

kinase MAPK1 (also called Erk2 and MAPK2) is highly expressed in a 

wide variety of human and mouse cell types. The MAPK1 siRNA almost 

eliminates MAPK1 expression in human and mouse cells making it a 

highly suitable positive control. RNAiFect Transfection Reagent provides 

high siRNA transfection efficiency and is also included in the control kit. 

Accurate analysis of knockdown efficiency 

Quantitative, real-time RT-PCR is frequently used to analyze the results of 

gene silencing experiments. QuantiTect Gene Expression Assays are an 

expanding range of functionally validated primer–probe sets that are 

ready to use for optimal results in quantitative, real-time RT-PCR on the 

majority of real-time cyclers. The assays comprise two gene-specific 

primers and a dual-labeled QuantiProbe in a 10x Assay Mix. Optimal 

results are guaranteed when QuantiTect Gene Expression Assays are 

used in combination with QuantiTect Probe Kits. All QuantiTect Assays 

can be used for one-step RT-PCR using the QuantiTect Probe RT-PCR Kit, 

or two-step RT-PCR using the QuantiTect Probe PCR Kit. The assays and 

kits have been optimized and validated to ensure high PCR efficiency 

and accurate quantification of as few as 10 copies of template. Primers 

are designed to cross exon-exon boundaries, so that only RNA 

sequences are amplified and detected. 


Non-silencing and positive-control siRNA duplexes from the RNAi 

Human/Mouse Control Kit were transfected into HeLa S3, HEK 293, or 

NIH/3T3 cells. Transfection efficiency of the Alexa Fluor labeled 


non-silencing siRNA was examined by fluorescence microscopy. RNA 

was purified using the RNeasy ® Mini Kit. MAPK1 knockdown using the 

positive control siRNA was determined using MAPK1-specific QuantiTect 

Gene Expression Assays. The QuantiTect Hs_MAPK1 Assay and the 

QuantiTect Mm_Mapk1 Assay, for human and mouse respectively, were 

used with the QuantiTect Probe RT-PCR Kit for one-step RT-PCR or with 

Omniscript ® Reverse Transcriptase and the QuantiTect Probe PCR Kit for 

two-step RT-PCR. 

Results 

Transfection of Alexa Fluor 488 labeled, non-silencing siRNA allowed 

determination of transfection efficiency by fluorescence microscopy 

(Figure 1). The transfection efficiency in HeLa S3 cells was close to 

100%. The Alexa Fluor 488 fluorophore is brighter and more 

photostable than other fluorescent labels. It is tolerant of pH changes 

within a wide range, making it very stable in living cells. 

The QuantiTect Assays for MAPK1 were used to generate standard 

curves using dilutions of RNA purified from untransfected HeLa S3 and 

NIH/3T3 cells respectively (Figure 2). Linear standard curves show that 

QuantiTect Gene Expression Assays are highly sensitive and accurate, as 

∆CT values correlate closely to RNA amount used. 

Human and mouse cell lines transfected with MAPK1 siRNA were 

analyzed for gene silencing efficiency using the QuantiTect Assays for 

MAPK1. One-step or two-step RT-PCR was carried out on either the ABI 

GeneAmp ® 5700 or ABI PRISM ® 7700 real-time cycler (Figure 3). High 

levels of MAPK1 mRNA knockdown were achieved, showing that the 

MAPK1 siRNA is a highly suitable positive control for gene silencing in 

both human and mouse cells. QuantiTect Gene Expression Assays 

provided accurate results for both one-step and two-step RT-PCR, and with 

both real-time cyclers. This demonstrates the flexibility of QuantiTect 

Gene Expression Assays for use with different real-time cyclers and 

reaction setups. 

Conclusions 

■ The RNAi Human/Mouse Control Kit and QuantiTect Gene 

Expression Assays for human and mouse MAPK1 can be used as 

integrated tools for gene silencing and downstream RT-PCR analysis. 

These tools can be routinely used as controls for both the transfection 

and downstream analysis stages of RNAi experiments. 

■ Standard curves generated using RNA dilutions show that QuantiTect 

Gene Expression Assays are highly accurate and sensitive. 

■ QuantiTect Gene Expression Assays provided optimal results for both 

one- and two-step RT-PCR on different real-time cyclers. 

Quantitative Real-Time RT-PCR Shows 

MAPK1 Knockdown 


A 

Relative MAPK1 mRNA expression (%) 

B 

Relative MAPK1 mRNA expression (%) 

120 

100 

80 

60 

40 

20 

0 

120 

100 

80 

60 

40 

20 

0 

HeLa S3 

Control 

One-step, ABI PRISM 7700 

Two-step, ABI PRISM 7700 

Two-step, GeneAmp 5700 

NIH/3T3 

HEK 293 

Figure 3 A Human cell lines HeLa S3 and HEK 293 and 

B mouse cell line NIH/3T3 cells were transfected with nonsilencing 

control siRNA or siRNA targeted against MAPK1 

mRNA using RNAiFect Reagent. After 48 hours, one-step 

or two-step quantitative, real-time RT-PCR analysis was 

carried out using the appropriate QuantiTect Gene 

Expression Assay and the indicated real-time cycler.



RNAi Human/Mouse RNAiFect Reagent, siRNA Suspension Buffer, Buffer EC-R, 301698 

Control Kit MAPK1 siRNA, non-silencing labeled control siRNA 

QuantiTect Gene For 100 x 50 µl reactions (for use in a 96-well plate or Inquire 

Expression Assays (100) single tubes) or 250 x 20 µl reactions (for use in a 

384-well plate or single capillaries): 0.5 ml 10x QuantiTect 

Assay Mix (dyes available: FAM) 

QuantiTect Hs_MAPK1 For 100 x 50 µl reactions (for use in a 96-well plate or 241400 

Assay (100) single tubes) or 250 x 20 µl reactions ( for use in a 



QuantiTect Mm_Mapk1 For 100 x 50 µl reactions (for use in a 96-well plate or 241401 

Assay (100) single tubes) or 250 x 20 µl reactions ( for use in a 



QuantiTect Probe For 200 x 50 µl reactions: 3 x 1.7 ml QuantiTect Probe 204443 

RT-PCR Kit (200) RT-PCR Master Mix (providing a final concentration of 

4 mM MgCl2), 100 µl QuantiTect RT Mix, 2 x 2.0 ml 

RNase-free water 

QuantiTect Probe For 200 x 50 µl reactions: 3 x 1.7 ml QuantiTect Probe 204343 

PCR Kit (200) PCR Master Mix (providing a final concentration of 

4 mM MgCl2), 2 x 2.0 ml RNase-free water 

RNeasy Mini Kit (50)* 

Related products 

50 RNeasy Mini Spin Columns, Collection Tubes 

(1.5 ml and 2 ml), RNase-free Reagents and Buffers 

74104 

Neg. Control siRNA, 5 nmol Alexa Fluor 488 labeled duplex siRNA with no 1022563 

Alexa Fluor 488 significant homology to any known mammalian gene; 

for use as a non-silencing control in RNAi experiments 










HPP Grade siRNA siRNA purified to >90% t available with a range of 

modifications including Alexa Fluor dyes 

– 

Tag·100 Antibody, 100 µg mouse anti-Tag·100 antibody that recognizes 34680 

BSA-free (100 µg) endogenous mammalian MAPK1 

RNAiFect Transfection RNAiFect Reagent and buffer, for up to 170 transfections 301605 

Reagent (1 ml) ‡ in 24-well plates; up to 500 transfections in 96-well plates 

* RNeasy kits are also available on micro, midi, maxi, and 96-well formats; please inquire. 

† Available in guaranteed yields of 20 and 40 nmol. Also available in 96-well plates; please inquire. 

‡ Larger sizes available; please inquire. 


Trust QIAGEN ® plasmid kits — tailor-made for you! 

Since not all your applications are the same, QIAGEN offers a range of plasmid kits designed specifically for your needs: 

from mini- to gigapreps and from convenient manual formats and walkaway automated procedures to contract plasmid 

production services. 

Using QIAGEN’s new application-based kit classification system and 

selection guide, it is now easier than ever to select the optimal plasmid 

kit for your specific application. Optimize your plasmid preps using the 

tear-out selection guide accompanying this article or by visiting our 

online selection guide at www.qiagen.com/goto/plasmid . QIAGEN’s 

extensive range of plasmid kits has been organized into 4 application 

grades: 

■ Sequencing Grade 

■ Molecular Biology Grade 

■ Transfection Grade 

■ Advanced Transfection Grade 

Sequencing Grade 

Sequencing Grade DNA is suitable for a range of DNA screening 

applications including sequencing, PCR, restriction analysis, and 

transformation. High-throughput sequencing and screening applications 

require fast, streamlined, and economic DNA purification. QIAGEN 

produces a number of reliable plasmid kits — automatable on BioRobot ® 

systems — to suit your high-throughput needs. These kits include 

cost-effective DirectPrep ® 96 Kits for standard plasmid purification and 

R.E.A.L. ® Prep 96 Kits for standard plasmid and BAC purification. 

Molecular Biology Grade 

Molecular Biology Grade DNA is suitable for low- or medium-throughput 

sequencing projects and more demanding high-throughput applications. 

DNA prepared using QIAprep ® Kits is suitable for all basic molecular 

biology applications, including cloning, in vitro transcription/translation, 

and transfection of robust cells. Plasmid DNA is highly purified by 

selective adsorption to a silica membrane. QIAprep Kits, which are 

recommended by many core sequencing facilities, are available in a 

range of formats from spin columns to 96-well manual and 

BioRobot automated formats for low-, medium-, and high-throughput 

requirements. 

Sequencing Grade DNA 

GCCTGCA GGT CGACTCTAGA GGATCCCCGGGTACCGAGCT 

CGAATTCGTA ATCATGTCAT A GCTGTTTCCTGTGTGAAAT 

TGTTATCC GCTCACAATTCCACACAACATA 

CGAGCCGGAAGCATAA 

AGTG 

10 20 30 40 50 60 70 80 90 100 110 120 

GTAA AGCCTGGGG 

TGCC TAATGAGTGAGCTA 

ACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAG 

TCGGG AAACCTGTCGTGCCAGCTGCATTAAT 

GAATCGGCCAACG 

CGCGGG 

140 150 160 170 180 190 200 210 220 230 240 

GG AG AGGCGGTTTGCGTATTGGGCGCTC 

TTCCGCTTCC 

TCGCTCACTG 

ACTCGCTGCGCTC 

GGTCGTTCGGCTGCGGCG 

AGCGGTATCAGC 

TCACTCAAAGGCGGTAATACGGTTATCCA 

260 270 280 290 300 310 320 330 340 350 360 

CAGAATCAGGGGATAACGCAG 

GAA AGAACATGTGAGCAA 

AAGGCCAGCAA 

AAGGCCAGGAACC 

GTAAAAAG GCCGCGTTGCTGG 

CGTTTT TCCATAGGCTCCGCCC 

CCC TGACGAGCATCA 

CA 

380 390 400 410 420 430 440 450 460 470 480 490 

AAAAATCGA CGCTCAAGTC AGAGGTGGCGAAACC 

CGACA GG ACTATAAAGATACCAGGCGTTTCCCCCT 

GGAAGCTCCC TCGTGCGCTC TCCTGTTCCGACCCTGCCGCTTACCGG 

ATACC 

TGTCCGC 

500 510 520 530 540 550 560 570 580 590 600 610 

CCTT TCTCCCTTCGGGAAGCGT 

GG CGCTTTCT CATAGCTCAC GCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGT 

GTGCACGAACCCCCCG 

TTCA GCCCGACCGC TGCGCC T 

630 640 650 660 670 680 690 700 710 720 730 740 

TTATCCGGTAACTA 

TCGTCTT GAGTCC 

AACCCGGTAAGACACGA 

CTTATCGCCACTGG 

CAGCAG CCACTGG TAACAGGATTAGC 

AGAGCGAGGTATGTA 

GGCGG TGCTACAGAG TTCTTG 

750 760 770 780 790 800 810 820 830 840 850 860 

Figure 1 Typical fluorescent capillary sequencing result 

obtained with plasmid DNA purified using the DirectPrep 

96 BioRobot Kit and the BioRobot 8000. Plasmid pUC19 

was sequenced using BigDye terminator v. 3.1 chemistry 

in a cycle sequencing reaction on an ABI PRISM ® 3700 

DNA Analyzer. The sequencing reaction was purified using 

the DyeEx ® 96 Kit (QIAGEN, cat. no. 63181). 

Molecular Biology Grade DNA 

Figure 2 Restriction analysis of pBluescript ® DNA purified 

with the QIAprep Spin Miniprep Kit. Digestion with the 

indicated enzymes (1–5 units) was carried out on 1 µg 

plasmid DNA. M: lambda–HindIII. 


M 

Undigested 

AluI 

BamHI 

BglI 

EcoRI 

HindIII 

HinfI 

HpaII 

KpnI 

MboII 

PstI 

PvuII 

RsaI 

SmaI 

TaqI 

XbaI 

M

Transfection Grade DNA 

Figure 3 Expression of green fluorescent protein (GFP) in 

HeLa cells. Cells were cotransfected in 6-well plates with 

β-galactosidase and GFP reporter plasmids using PolyFect ® 

Transfection Reagent and the HeLa cell protocol. Expression 

was visualized by fluorescence microscopy 2 days posttransfection. 

Advanced Transfection Grade DNA 

Figure 4 Cortical neurons 24 hours after transfection with a 

plasmid encoding GFP. Cells were stained with anti-MAP2 

primary antibodies and Cy ® 3-labeled secondary antibodies 

and the images superimposed. Cells were transfected in a 

96-well format using 0.3 µg of plasmid DNA and 2 µl of 

TransMessenger ® Reagent per well. 

Transfection Grade 

Although it is possible to use Molecular Biology Grade DNA to transfect 

robust cells, for reliable, consistent results with most cell types, we 

recommend using Transfection Grade DNA. QIAGEN anion-exchange 

chromatography delivers Transfection Grade DNA with significantly 

lower levels of endotoxins (i.e., bacterial lipopolysaccharides) and other 

contaminants than Molecular Biology Grade DNA. Transfection Grade 

DNA is suitable for the majority of demanding applications (e.g., 

transfection and in vitro transcription). All DNA scales are included in the 

trusted QIAGEN Plasmid Kit range, from mini- to gigapreps. For even 

faster purification the HiSpeed ® range of kits enable midi- and maxi-scale 

plasmid DNA preps without centrifugation. For medium-throughput and 

automatable high-throughput applications, QIAGEN offers the QIAwell ® 

Ultra miniprep range of kits. 

Advanced Transfection Grade 

Advanced Transfection Grade DNA is suited for the most demanding 

applications (e.g., transfection into sensitive or primary cells, 

microinjection, vector-based gene silencing, in vivo gene transfer, and 

research on gene therapy or vaccination). Plasmid DNA is purified using 

anion-exchange chromatography to the highest possible standard. An 

additional, integrated, incubation step removes bacterial endotoxins, 

which can interfere with gene transfer experiments. QIAGEN EndoFree ® 

Kits provide Advanced Transfection Grade DNA in maxi, mega, and 

giga formats. The Ultrapure 100 Column and QIAGEN Plasmid Prep 

Service provide even larger quantities of plasmid DNA. Based on the 

same QIAGEN anion-exchange technology, pAlliance manufacturing 

service (www.pAlliance.com) provides CGMP plasmid manufacturing for 

clinical applications in gene therapy and genetic vaccination. 

QIAGEN’s plasmid DNA grading system and new selection guide make 

it easy for you to select the right plasmid kit for your application. Coupled 

with QIAGEN’s expert sales team and unrivaled technical support, this 

makes QIAGEN the best choice for all your plasmid prep requirements. 

Choose from QIAGEN’s trusted range of 

plasmid kits using our new online selection guide at 

www.qiagen.com/goto/plasmid/ . 




QIAprep Spin 50 QIAprep Spin Columns, Reagents, Buffers, 27104 

Miniprep Kit (50)* Collection Tubes (2 ml) 

QIAprep 96 Turbo TurboFilter 96 and QIAprep 96 Plates; Flat-Bottom 27191 

Miniprep Kit (4)* † Blocks and Lids, Reagents, Buffers, 

Collection Microtubes (1.2 ml), Caps 

DirectPrep 96 4 DirectPrep 96 Plates, Buffers, Flat-Bottom Blocks 27361 

MiniPrep Kit (4) † and Lids, AirPore Tape Sheets, Tape Pads, 

Elution Microtubes RS, Caps 

R.E.A.L. Prep 96 4 QIAfilter 96 Plates, Square-Well Blocks, Tape Pads, 26171 

Plasmid Kit (4)* † Reagents, Buffers 

QIAwell 96 Ultra 4 of each: QIAfilter 96, QIAwell 96, and 16191 

Plasmid Kit (4) † QIAprep 96 Plates; Reagents, Buffers, 

Collection Microtubes (1.2 ml), Caps 

HiSpeed Plasmid 25 HiSpeed Midi Tips, 25 QIAfilter Midi Cartridges, 12643 

Midi Kit (25) 25 QIAprecipitator Midi Modules plus Syringes, 

Reagents, Buffers 

HiSpeed Plasmid 10 HiSpeed Maxi Tips, 10 QIAfilter Maxi Cartridges, 12662 

Maxi Kit (10)* 10 QIAprecipitator Maxi Modules plus Syringes, 

Reagents, Buffers 

QIAfilter Plasmid 25 QIAGEN-tip 100, Reagents, Buffers, 12243 

Midi Kit (25)* ‡ 25 QIAfilter Midi Cartridges 

QIAfilter Plasmid 10 QIAGEN-tip 500, Reagents, Buffers, 12262 

Maxi Kit (10)* ‡ 10 QIAfilter Maxi Cartridges 

QIAGEN Plasmid 25 QIAGEN-tip 20, Reagents, Buffers 12123 

Mini Kit (25)* ‡ 


Midi Kit (25)* ‡ 


Maxi Kit (10)* ‡ 

EndoFree Plasmid 10 QIAGEN-tip 500, Reagents, 12362 

Maxi Kit (10) ‡ 10 QIAfilter Maxi Cartridges, Endotoxin-free Buffers 

Ultrapure 100 Column § Column (44 mm x 250 mm) containing QIAGEN 11100 

Anion-Exchange Resin; for preparation of up to 

100 mg plasmid DNA 

* Larger kit sizes available, please inquire. 

† BioRobot kit formats available, please inquire. 

‡ Mega and Giga kit formats available, please inquire. 

$ Ultrapure 100 Buffer Set (cat. no. 11500) required. 


New 

Simultaneous purification of viral DNA and RNA from serum and 

plasma using the BioRobot ® M48 workstation 

The MagAttract ® Virus Mini M48 Kit provides a fully automated procedure for simultaneous purification of viral DNA and 

RNA from serum and plasma for highly sensitive detection in downstream assays. The kit can be used to purify nucleic acids 

from a broad range of DNA and RNA viruses for life science applications. 

Detected (%) 

100 

75 

50 

25 

High Sensitivity for Reliable Detection 

M48/400 

R/1000 

R/200 

0 

0 40 80 

Virus titer (IU/ml) 

120 160 

Figure 1 Serial dilutions from a negative plasma pool 

spiked with an international standard of a typical DNA 

virus were processed in replicates of 24, using the 

MagAttract Virus Mini M48 Kit with a 400 µl input volume 

(M48/400), or using automated kits from Supplier R with a 

1000 µl (R/1000) or 200 µl (R/200) input volume. 

Samples were analyzed by real-time duplex PCR with an 

internal control. The vertical lines show the 95% hit rate, 

at which detection by PCR can be expected with a 95% 

probability. 

Table 1. No Detectable Cross-Contamination 

Positive samples Negative samples 

Run 1 

Positive detection 24 0 

Negative detection 

Run 2 

0 24 

Positive detection 24 0 

Negative detection 0 24 

Negative and positive (10 7 copies/ml armored RNA) 

plasma samples arranged in alternating sequence on the 

BioRobot M48 worktable were purified using the 

MagAttract Virus Mini M48 Kit and analyzed by real-time 

RT-PCR. Mean C T value for positive samples was 29.9. 

Samples with C T > 60 were regarded as negative. 

The MagAttract Virus Mini M48 Kit provides: 

■ High sensitivity — high yields even with low viral titers for highly 

sensitive detection 

■ No detectable cross-contamination — from up to 48 samples 

containing RNA or DNA viruses 

■ Linear yields — efficient purification over a range of viral titers 

■ Walkaway processing — for ease of use and efficient workflows 

High sensitivity with low viral titers 

The MagAttract Virus Mini M48 Kit enables highly sensitive detection of 

a broad range of DNA and RNA viruses. The automated procedure gives 

more sensitive detection for the amount of starting material than other 

automated systems (Figure 1). Yields are linear, allowing accurate 

quantitative analysis for both low and high viral titers. 

No detectable cross-contamination 

Accurate detection requires cross-contamination–free processing to avoid 

false positives. The MagAttract Virus Mini M48 Kit provides parallel 

purification of 48 samples on the BioRobot M48 workstation with 

no detectable cross-contamination (as shown in Table 1), making it 

well-suited for purification of both high and low levels of viral nucleic 

acids from the same set of samples. 

Walkaway processing with high reproducibility 

Fully automated processing on the BioRobot M48 workstation provides 

highly reproducible purification, with minimal sample-to-sample or 

day-to-day variation (Figure 2). Walkaway purification of 48 samples 

requires only 15–20 minutes setup time, allowing quick turnaround and 

flexible processing. 


Visit www.qiagen.com/goto/virusM48 to discover how automated 

viral nucleic acid purification can improve your research! 


Highly Reproducible Purification 

A DNA virus 

Day 1 

Day 2 

Day 3 

B 

C T value 

40 

30 

20 

10 

0 6 12 18 24 

Sample 

Figure 2 A negative plasma pool was spiked on each of 3 days with a typical DNA or RNA virus. Viral nucleic acids were purified from 24 aliquots (400 µl each) 

of each pool using the MagAttract Virus Mini M48 Kit, with elution in a volume of 125 µl. Pools were spiked with 105 copies/ml of a typical DNA virus. 

Purified viral DNA (10 µl of each eluate) was analyzed by real-time PCR using the QuantiTect ® SYBR ® Green PCR Kit, and CT values are shown for 24 samples on 

each day. Pools were spiked with 104 A 

B 

copies/ml of a typical RNA virus. Purified viral RNA (10 µl of each eluate) was analyzed by real-time RT-PCR using the 

QuantiTect Probe RT-PCR Kit, and CT values are shown for 24 samples on each day. 


MagAttract Virus Mini M48 For 192 virus nucleic acid preps: MagAttract 955336 

Kit (192) Suspension B and RNase-Free Reagents and Buffers 

BioRobot M48 Robotic workstation for automated purification of 9000708 

nucleic acids using MagAttract M48 kits; computer, 

installation, 1 year warranty on parts and labor 


C T value 

40 

30 

20 

10 

RNA virus 

Day 1 

Day 2 

Day 3 

0 6 12 18 24 

Sample

New 

Accelerate research and discovery using comprehensive siRNA sets 

QIAGEN ® Human Library siRNA Sets provide hundreds of pre-designed, highly potent siRNA duplexes that are ready to use 

for RNAi screening of complete families or classes of genes. The large number of carefully selected genes targeted by Human 

Library siRNA Sets enables comprehensive yet detailed study of entire biochemical pathways or processes. 

Human Library siRNA Sets provide: 

■ Accelerated research and discovery — extensive gene coverage for 

efficient screening of entire gene families 

■ Cost-effective RNAi screening — optimally designed, pre-synthesized 

siRNA sets allow economical, rapid high-throughput studies 

■ The Golden Guarantee of 100% satisfaction — effective gene knockdown 

with satisfaction guaranteed, or free redesign and replacement 

■ Highly potent siRNA generated using the world’s best siRNA design 

algorithm — the HiPerformance design algorithm is integrated with a 

proprietary homology analysis tool for optimal siRNA design 

Sets are currently available for the study of kinases (646 genes), G protein-coupled receptors 

(471 genes), and apoptosis-related factors (418 genes). QIAGEN scientists use the most up-to-date 

public databases to develop content for Human Library siRNA Sets, including the National Center 

for Biotechnology Information (NCBI), Ensembl, Swiss-Prot, the UCSC Genome browser, and 

InterPro (European Bioinformatics Institute). Human Library siRNA Sets offer the widest coverage of 

gene families available at the time of design. Two highly potent, high-purity siRNA duplexes are 

supplied for each gene target. Each plate also includes control wells that contain a scrambled 

non-silencing siRNA and an siRNA directed against GFP, and empty wells for customer-defined 

controls (e.g., positive controls or mock transfections in the absence of siRNA). Complete, 

restriction-free sequence information is provided at no extra cost. 

Custom siRNA Set 

With Custom siRNA Sets, researchers are free to choose which genes they wish to target. Duplexes 

in Custom siRNA Sets come with the Golden Guarantee of 100% satisfaction, are designed using 

the same cutting-edge algorithm as Human Library siRNA Sets, and also offer: 

■ Flexibility and scalability — target the specific type and number of genes that your research 

requires 

World’s most advanced siRNA design generates highly potent siRNA 

All siRNA duplexes in Human Library and Custom siRNA Sets are designed using the revolutionary 

HiPerformance design algorithm licensed from Novartis Pharmaceuticals. This algorithm is based 

on the largest independent study of siRNA functionality to date, in which the gene silencing 

efficiency was analyzed for over 3300 duplexes directed against 33 targets. The HiPerformance 

design algorithm is integrated with a proprietary homology analysis tool and a comprehensive 

gene database, delivering siRNA that provides maximum gene silencing efficiency with minimal 

off-target effects. The efficacy of the algorithm has been proven by analysis of hundreds of siRNA 

duplexes directed against multiple genes (Figure 1). 


Relative mRNA expression (%) 

150 

120 

90 

60 

30 

Increased siRNA Potency through Advanced Design 

0 

0 20 


40 60 80 100 

Duplex number 

HiPerformance algorithm 

Tuschl guidelines 

70% knockdown 

90% knockdown 

Figure 1 100 siRNA duplexes against different targets were 

designed using either the HiPerformance design algorithm 

or Tuschl guidelines and transfected into HeLa S3 cells 

using RNAiFect Transfection Reagent. Knockdown efficiency 

was determined by quantitative, real-time RT-PCR. Results 

for each algorithm are presented in order of decreasing 

knockdown efficiency and independent of target. 


Human GPCR 942 HPP Grade siRNA duplexes targeting 471 G protein-coupled 1027092 

siRNA Set (2 nmol) receptors, two duplexes per gene. 2 nmol of each duplex, 

supplied in 96-well plates. Each plate includes non-silencing 

and GFP-22 siRNA controls. 

Human Kinase 1292 HPP Grade siRNA duplexes targeting 646 kinase and 1027091 

siRNA Set (2 nmol) kinase-associated genes, two HPP Grade duplexes per gene. 

2 nmol of each duplex, supplied in 96-well plates. Each plate 

includes non-silencing and GFP-22 siRNA controls. 

Human Apoptosis 836 HPP Grade siRNA duplexes targeting 418 apoptosis-related 1027093 

siRNA Set (2 nmol) genes, two HPP Grade duplexes per gene. 2 nmol of each 

duplex, supplied in 96-well plates. Each plate includes 

non-silencing and GFP-22 siRNA controls. 

Custom siRNA Set, Set of 96 HPP Grade siRNA duplexes targeting 48 1027094 

96-well plate customer-specified genes, two HPP Grade duplexes per gene. 

(5 nmol)* 5 nmol of each duplex, supplied in 96-well plates. 

For an up-to-date list of siRNA sets available, go to www.qiagen.com/siRNA . 

Related product 

2-for-Silencing Two HPP Grade siRNA duplexes (20 nmol), 1022562 

siRNA Duplexes custom-designed by QIAGEN 

* Also available in 20 nmol and in tubes; please inquire. 


Ultra-high–throughput gene silencing for rapid, economical 

functional genomics studies 

Janette Nowakowski and Kurt Herrenknecht 

Evotec Technologies GmbH, Düsseldorf, Germany 

A major challenge of the post-genomic era is to decipher the role of genes identified by the human genome project with 

unknown function. The use of RNAi in cultured mammalian cells has become a powerful tool for functional genomics, 

especially when combined with high-throughput technologies. Here we describe an approach for ultra-high–throughput gene 

silencing of a G protein-coupled receptor (GPCR) using HPP Grade siRNA duplexes and RNAiFect Transfection Reagent 

from QIAGEN, with the Opera high-speed confocal imaging reader, and high-throughput cell-seeding and liquid-handling 

stations from Evotec Technologies. 

The Opera Confocal Fluorescence 

Microplate Reader 

Figure 1 The Opera microplate reader allows automated 

confocal high-throughput fluorescence imaging and is 

compatible with all microplate types from 96 to 2080 wells. 

Figure 2 CHO cells that constitutively express the 

ETAR–GFP fusion protein were visualized using the Opera 

reader. A Unstimulated cells with the ETAR–GFP protein 

localized in the membrane; B Cells 3 hours after 

stimulation with endothelin-1 show ETAR–GFP protein 

localized in endosomes. The cell nuclei and cytoplasm 

were stained with Syto59 and are colored red. 

High-throughput screening using RNAi 

Down-regulation or knockout of a gene of interest is a highly effective 

approach for the study of gene function. RNAi allows rapid and 

economical gene knockdown and has become the method of choice for 

functional genomics research and transcriptome-wide high-throughput 

analysis. We describe a high-throughput RNAi approach using a 

functional assay for a GPCR (endothelin A) and Evotec Technologies’ 

ultra-high–throughput screening technology. The receptor used in this 

study was a fusion protein of the endothelin A receptor (ETAR) and 

enhanced green fluorescent protein (GFP) that was constitutively 

expressed in CHO cells, allowing receptor expression to be monitored 

with the Opera confocal fluorescence microplate reader from Evotec 

Technologies (Figure 1). 

Application of RNAi screening to pathway analysis 

Endothelin A receptor is a GPCR that recognizes endothelin-1 as its 

natural ligand. Endothelin-1 activation of the endothelin A receptor is 

involved in a variety of biological effects including smooth muscle 

contraction, cardiac inotropism, hormone and cytokine production, and 

regulation of mitogenesis. Binding of endothelin-1 to the endothelin A 

receptor induces rapid endocytosis of the receptor (1). The receptor 

Monitoring Fluorescence Shows Endothelin A Receptor Endocytosis 

A B 


subsequently dissociates from endothelin-1 and is either recycled back to the cell surface (2) or 

degraded. High-throughput RNAi techniques can be combined with monitoring of endocytosis 

using a fluorescent marker, for the identification of genes involved in the internalization process 

(Figure 2). Similarly, the combination of RNAi techniques with any appropriate assay can be used 

for screening large numbers of genes potentially involved in cellular processes. 


HPP (High-Performance Purity) Grade siRNA duplexes from QIAGEN were targeted against either 

the ETAR or the GFP portion of the ETAR–GFP fusion protein. The target sequences of the siRNA 

duplexes were: ETAR siRNA 5'-AACGCGCTGATAGCCAGTCTT-3', GFP-22 siRNA 

5'-CGGCAAGCTGACCCTGAAGTTCAT-3'. The sequence of the non-silencing siRNA duplex was 

5'-AATTCTCCGAACGTGTCACGT-3'. siRNA transfections were performed in 96-well or 1536-well 

microplates using RNAiFect Transfection Reagent. For transfections in 96-well plates 4 x 103 CHO 

cells were seeded per well and allowed to adhere overnight. Cells were transfected with 0.25 µg, 

0.5 µg, 0.75 µg, 1 µg, 1.5 µg, or 2 µg siRNA and after 48 hours plates were analyzed on the 

Opera imaging reader. Experiments in 1536-well plates were carried out using Evotec 

Technologies’ ultra-high–throughput cell seeding and liquid handling stations. Three hundred CHO 

cells were seeded per well and allowed to adhere overnight. Cells were transfected with 0.05 µg 

GFP-22 siRNA or non-silencing control siRNA. Cells were analyzed 48 hours after transfection. 

Plates were read on the Opera imaging reader and the degree of receptor silencing was quantified 

by an Opera inherent image analysis algorithm that focuses on membrane fluorescence intensity. 

Results 

Fluorescence Imaging Shows Effective Gene Silencing 

Untransfected 0.25 µg siRNA 

1.0 µg siRNA 

The gene silencing efficiency of siRNA duplexes targeted against the ETAR–GFP fusion protein was 

tested by transfection of ETAR or GFP-22 siRNA duplexes into cells in 96-well plates. The transfection 

efficiency was close to 100%. Effective knockdown of the fusion protein was achieved with as little 

as 0.25 µg siRNA per well irrespective of whether the ETAR or the GFP-22 siRNA was used 

(Figures 3 and 4). 

For experiments in 1536-well plates, cells were transfected with GFP-22 siRNA or non-silencing 

control siRNA. High-throughput transfection and gene silencing in 1536-well plates was highly 

efficient and reproducible, with very little variability across the plate and only small variations in 

single-well data (Figure 5). These results clearly demonstrate that RNAi can be used for automated 

large-scale gene silencing applications such as screening siRNA libraries for drug discovery or 

pathway analysis. 

Figure 3 Transfection of 

siRNA targeted against the 

GFP portion of the fusion 

protein resulted in effective 

knockdown as shown by 

fluorescence imaging. 

Effective silencing was 

achieved with as little as 

0.25 µg siRNA. 


A 

B 

Highly Efficient Knockdown Effective High-Throughput Knockdown in 1536-Well Plates 

Figure 4 Transfection of siRNA targeted against A the GFP 

portion or B the ETAR portion of the fusion protein resulted 

in effective knockdown as shown by fluorescence imaging. 

Effective silencing was achieved with siRNA amounts 

ranging from 0.25 to 2 µg. Control transfections were 

carried out with medium only, buffer only, siRNA only, and 

RNAiFect Reagent only. Transfections were carried out in 

96-well plates. 


Figure 5 Ultra-high–throughput RNAi screening using GFP-22 siRNA in 1536-well plates 

resulted in effective knockdown with very low variability across the plate as shown by 

membrane fluorescence imaging. Non-silencing control siRNA was also transfected. 

Conclusions 

■ HPP Grade siRNA Duplexes, cell seeding and liquid handling stations, 

and the Opera imaging reader were successfully used for highthroughput 

gene silencing of endothelin A. 

■ RNAiFect Transfection Reagent provided high transfection efficiencies of 

close to 100%, even when cells were transfected in a 1536-well format. 

■ The results demonstrate how an assay, such as fluorescent monitoring 

of endocytosis with the Opera imaging reader, can be combined with 

cost-effective, high-throughput RNAi screening for highly efficient 

functional genomics research. 

References 

1. Chun, M., Lin, H.Y., Henis, Y.I., and Lodish, H.F. (1995) Endothelin-induced Endocytosis 

of Cell Surface ETA Receptors. J Biol Chem, 270, 10855. 

2. Wang J, Chiou W.J., Gagne G.D., and Wu-Wong J.R. (2000) Internalization of type-A 

endothelin receptor. J Cardiovasc Pharmacol, 36(5 Suppl 1):S61. 


HPP Grade siRNA (20 nmol)* siRNA purified to >90% – 

GFP-22 siRNA (5 nmol) 5 nmol GFP-22 siRNA; for use as a positive (silencing) 1022064 

control for green fluorescent protein 

Negative Control 5 nmol duplex siRNA with no significant homology to 1022076 

siRNA (5 nmol) any known mammalian gene; for use as a non-silencing 

control in RNAi experiments 

RNAiFect Transfection RNAiFect Reagent and buffer, for up to 170 transfections 301605 

Reagent (1 ml) † in 24-well plates; up to 500 transfections in 96-well plates 

Find out more about Evotec technologies’ solutions for high-throughput RNAi at www.evotec-technologies.com . 

* Available in guaranteed yields of 20 and 40 nmol. Also available in 96-well plates; please inquire. 

† Larger sizes available; please inquire. 


Automated purification of bacterial DNA from primary clinical 

research samples 

A new application package for the BioRobot ® M48 system — the App. Package, M48, Inf. Dis. — provides a fully 

automated protocol for purification of bacterial DNA from primary clinical research samples or bacterial cultures using the 

BioRobot M48 workstation and the MagAttract ® DNA Mini M48 Kit. High-quality genomic and plasmid DNA obtained using 

the bacterial DNA purification protocol is well-suited for use in sensitive downstream applications, such as real-time PCR. 

Separate protocols in the application package enable purification of viral DNA and RNA from serum and plasma 

(see related article on page 72). 

The bacterial protocol in the application package enables: 

■ Purification of high-performance bacterial total DNA — from Gram-negative and Gram-positive 

bacteria 

■ Flexible processing — from primary clinical research samples, such as swabs and body fluids, 

or bacterial cultures and colonies 

■ Efficient DNA purification — for inhibition-free PCR and real-time PCR 

High-performance DNA for sensitive detection 

DNA purified using the bacterial protocol performs well in downstream assays, such as real-time 

PCR for detection of pathogens. Automated DNA purification from urine samples using the 

BioRobot M48 workstation and real-time PCR of Chlamydia trachomatis DNA were compared with 

manual DNA purification and an established, commercial assay (Supplier R). For 130 samples 

tested, in duplicate, the 2 systems gave identical results in all cases (1). DNA purified using the 

automated system performed well in real-time PCR, demonstrating effective removal of PCR 

inhibitors found in urine (Figure 1). 

A 

Fluorescence 

New 

10 

1 

0.1 

0.01 

0.001 

Sensitive and Reproducible PCR Analysis of Samples and Controls 

1 10 20 30 40 50 

Cycle number 

B 

Fluorescence 

10 

1 

0.1 

0.01 

0.001 

1 10 20 30 40 50 

Cycle number 

Figure 1 Amplification of DNA purified from urine samples using the BioRobot M48 workstation and the App. Package, 

M48, Inf. Dis. Representative data are shown for 16 out of 130 samples processed (1). Real-time PCR was performed in 

duplicate to demonstrate reproducibility. A 

5 samples testing positive for C. trachomatis DNA B 11 samples testing negative 

for C. trachomatis genomic DNA, but showing positive amplification of control DNA. (Data kindly provided by S.O. 

Hjelmevoll and M.E. Olsen, The University Hospital of North Norway, Tromsø, Norway; and T. Fossheim, QIAGEN AS, 

Oslo, Norway) 


Table 1. Comparison of Manual and Automated DNA Purification for Quantitative Amplification 

of M. pneumoniae DNA by Real-Time PCR 

Real-time PCR analysis* 

Manual DNA purification Automated DNA purification Automated DNA purification 

Sample and in-house PCR: and real-time PCR: and real-time PCR: 

number Sample type † M. pneumoniae M. pneumoniae control amplicon 

1 NG-swab + + + 

2 NG-swab + + + 

3 NG-swab + + + 

4 NG-swab + + + 

5 NG-swab + + + 

6 NG-swab + + + 

7 NG-fluid + + + 

8 Sputum + + + 

9 Sputum – – + 

10 ET-fluid – – + 

11 Positive control + + + 

12 Negative control – – + 

* + = amplicon detected; – = amplicon not detected. 

Figure 2 Real-time PCR of M. pneumoniae DNA using 

purified DNA representative of purifications from 3 different 

types of respiratory sample containing M. pneumoniae. 

Red: 6 x nasopharyngeal swab; Blue: nasopharyngeal 

fluid; Green: sputum; Yellow: endotracheal fluid; 

Broken lines: 2 x positive control samples isolated with 

Bact_200ul protocol on the BioRobot M48 workstation; 

Gray: negative controls. 

(Data kindly provided by M. Vondracek and K. Fahlander, 

Karolinska University Hospital, Solna, Stockholm, Sweden; 

and T. Fossheim, QIAGEN AS, Oslo, Norway) 

† NG-swab = Nasopharyngeal swab, NG-fluid = Nasopharyngeal fluid, ET-fluid = Endotracheal fluid. 

(Data kindly provided by M. Vondracek and K. Fahlander, Karolinska University Hospital, Solna, Stockholm, Sweden; and 

T. Fossheim, QIAGEN AS, Oslo, Norway) 

Flexible processing of a variety of primary clinical research samples 

The bacterial protocol on the BioRobot M48 workstation enables purification of bacterial DNA 

from different primary clinical research samples, such as swabs and body fluids, as well as 

bacterial cultures and colonies. The procedure enables purification of high-quality bacterial DNA. 

For detection of Mycoplasma pneumoniae DNA in 4 different kinds of respiratory research 

samples, real-time PCR analysis showed identical results for the automated system compared with 

manual DNA purification (Table 1). The automated method provides equivalent sensitivity with less 

hands-on time and a more efficient workflow. 

Normalized fluorescence 

Reliable Amplification of Mycoplasma DNA from Respiratory Samples 

10 0 

10 -1 

10 -2 

0 10 20 30 

80 www.qiagen.com QIAGEN News 2004 Issue 3 

Cycle 

Detection threshold 

40 50

Efficient DNA purification for inhibition-free PCR 

Real-time PCR results (Figures 2 and 3) show that automated DNA purification using the BioRobot 

M48 workstation results in high-performance DNA that is well-suited for sensitive, real-time PCR. 

M. pneumoniae-specific amplicons were detected in all positive samples, but not in negative 

control samples, indicating that purification was free of cross-contamination and that purified DNA 

was not degraded (Figure 3). 

Normalized fluorescence 

Reliable Real-Time PCR Controls Using Inhibitor-Free Purified DNA 

10 0 

10 -1 

10 -2 

0 5 10 15 20 25 30 35 40 45 

Visit www.qiagen.com/goto/BacteriaM48 to discover more about 

automated bacterial DNA purification from clinical research samples! 

References 

1. Hjelmevoll, S.O., Olsen, M.E., and Fossheim, T. (2004) Automated purification of DNA from urine for sensitive PCR of 

Chlamydia trachomatis amplicons. QIAGEN News 2004, e21. 

2. Vondracek, M., Fahlander, K., and Fossheim, T. (2004) Automated purification of mycoplasma DNA from respiratory 

samples. QIAGEN News 2004, e25. 

Related article in this issue 

Simultaneous purification of viral DNA and RNA from serum and plasma using the BioRobot M48 

workstation (page 72) 


Cycle 

Detection threshold 

Figure 3 Internal positive control DNA was amplified 

efficiently from all samples and no significant variation was 

observed in CT values, indicating purified DNA was 

consistently free from PCR inhibitors. Red: nasopharyngeal 

swab samples; Blue: nasopharyngeal fluid; Yellow: 

endotracheal fluid; Green: sputum; Gray: negative controls; 

Broken lines: positive control isolated with Bact_200ul 

protocol on the BioRobot M48 workstation. 

(Data kindly provided by M. Vondracek and K. Fahlander, 

Karolinska University Hospital, Solna, Stockholm, Sweden; 

and T. Fossheim, QIAGEN AS, Oslo, Norway) 


App. Package, M48, Software protocol package for infectious disease 9016145 

Inf. Dis. (CD) applications, v. 2.0, on the BioRobot M48 workstation 

BioRobot M48 Robotic Workstation for automated purification of nucleic 9000708 

acids using MagAttract M48 Kits; Installation, 

1-Year Warranty on parts and labor 

MagAttract DNA Mini For 192 DNA preps: MagAttract Suspension B, 953336 

M48 Kit (192) Buffers, Proteinase K 


Automation 

Automated purification of anthrax DNA from soil for biodefense 

applications 

Anthrax is a serious disease caused by the bacterium Bacillus anthracis. Humans can contract anthrax by exposure to 

infected animal products. Anthrax has been used as a terrorist weapon, for example, in the United States in 2001, when 

22 people were infected by anthrax spores sent through the postal system. Although no military use of anthrax is 

documented, it is suspected that several countries have stockpiled spores at various times for potential military use. Spores 

released by a military research facility in Sverdlovsk, USSR in 1979 led to the largest epidemic of inhalational anthrax in 

the twentieth century. These incidents strongly corroborate the need for reliable and effective detection strategies (e.g., 

molecular diagnosis). When detecting anthrax DNA while assessing the extent of an affected area, it is essential to use an 

efficient procedure for purification of anthrax DNA. 

Reference 

1. Zoll, G., Grote, G., 

Jaske, C., Maatmann, 

I., and Köhne, S. 

(2004) Automated 

purification of anthrax 

DNA from soil for 

biodefense 

applications. QIAGEN 

News 2004, e24. 

A recent QIAGEN News electronic article by Gudrun Zoll and coworkers of the Armed Forces 

Scientific Institute for Protection Technologies, Munster, Germany (1) demonstrates efficient 

automated purification of anthrax DNA from soil samples. The article shows: 

■ Soil contains a number of inhibitors of PCR, which must be efficiently removed by the DNA 

purification method. After a simple pre-treatment procedure, the BioRobot ® EZ1 system enabled 

easy and rapid DNA purification from soil, with efficient removal of contaminants and PCR 

inhibitors. 

■ B. anthracis DNA was successfully amplified in real-time PCR, with detection in all positive 

samples (Figure 1). 

■ This system provides an important tool to combat the use of anthrax in bioterrorism and military 

situations. 

Fluorescence 

-1 

-1.5 

-2 

-2.5 

-3 

0 5 10 15 20 

Cycle 

25 

Detection of Anthrax DNA Purified from Soil 

30 35 40 

Bacteria CT value 

108 20 

107 24 

106 27 

105 32 

104 36 

0 negative 

+ 19 

– blank 

Figure 1 Soil samples (0.5 g each) were spiked with the indicated number of inactivated B. anthracis bacteria. Samples 

were treated as described in the online article (1), and DNA was purified using the EZ1 DNA Tissue Kit and the EZ1 DNA 

Tissue Card on the BioRobot EZ1 workstation. Purified DNA was used as a template for real-time PCR using HotStarTaq 

DNA Polymerase on a DNA Engine Opticon cycler, with primers and probes specific for the PA (protective antigen) gene. 

B. anthracis DNA was successfully detected from as few as 10 4 cells (C T = 36). +: Positive control (10 8 bacteria). 

–: Negative control. 

Read the full article online at www.qiagen.com/goto/EZ1anthrax and 

find out more about easy automation for biodefense applications! 


QIA-Hints 

RNA stabilization and purification 

I am going to use an RNeasy ® Protect Kit to purify total RNA from a tissue sample. How should I handle the sample? 

Changes in gene expression and RNA profiles can occur during sample harvest and handling, and during RNA purification. 

These changes can occur very rapidly, within seconds of harvest. RNAlater RNA Stabilization Reagent in RNeasy Protect 

Kits provides immediate stabilization and protection of RNA in biological samples. Once immersed in the reagent, RNA in 

tissue samples is stable for 1 day at 37°C, 7 days at 18 to 25°C, 4 weeks at 2 to 8°C, or for extended periods with archival 

storage at –20 or –80°C. 

What is the difference between a bead mill and a rotor–stator homogenizer? 

Bead mills, such as the TissueLyser from QIAGEN, use the crushing action of solid beads agitated at high speed in the 

presence of the sample. A rotor–stator homogenizer is a high-speed rotor that draws a liquid sample in and forces it out at 

high speed through a narrow aperture. Bead mills and rotor-stator homogenizers share the characteristic of disrupting and 

homogenizing samples. An advantage of the TissueLyser over rotor–stator homogenizers is its capacity for simultaneously 

processing multiple (up to 2 x 96) samples. A rotor–stator homogenizer must be thoroughly cleaned after processing of each 

sample. Simultaneous processing of multiple samples increases reproducibility and prevents cross-contamination. 

How can I homogenize my tissue if I don’t have either of these instruments? 

If neither of these instruments is available, you can disrupt a tissue sample by grinding with a mortar and pestle. However, 

manual disruption with a mortar and pestle only disrupts the sample. Disruption with a mortar and pestle should always be 

followed by a homogenization method using a QIAshredder spin column or passing the material several times through a 

narrow-bore needle. 

Trademarks: QIAGEN ® , QIAprep ® , QIAwell ® , BioRobot ® , DirectPrep ® , DyeEx ® , EndoFree ® , HiSpeed ® , HotStarTaq ® , MagAttract ® , MinElute ® , Omniscript ® , PolyFect ® , QuantiTect ® , QuantiProbe, R.E.A.L. ® , RNAiFect, RNeasy ® , 

TransMessenger ® (QIAGEN Group); ABI PRISM ® , BigDye, GeneScan ® , FAM, ROX (Applera Corporation or its subsidiaries); Alexa Fluor ® , Bodipy ® , SYBR ® (Molecular Probes, Inc.); Cy ® (Amersham Biosciences); DNA 

Engine Opticon ® (MJ Research, Inc.); iCycler (Bio-Rad Laboratories, Inc.); Mx3000P, pBluescript ® (Stratagene, Inc.); Rotor-Gene (Corbett Research); Smart Cycler ® (Cepheid); GeneAmp ® , TaqMan ® (Roche Group); Yakima 

Yellow (Epoch Biosciences). 

QIAGEN robotic systems are not available in all countries; please inquire. BioRobot workstations and QIAGEN kits are intended as general-purpose devices. No claim or representation is intended for their use in identifying 

any specific organism or for a specific clinical use (diagnostic, prognostic, therapeutic, or blood banking). It is the user’s responsibility to validate the performance of BioRobot workstations and QIAGEN kits for any 

particular use, since their performance characteristics have not been validated for any specific organism. BioRobot workstations and QIAGEN kits may be used in clinical diagnostic laboratory systems after the laboratory 

has validated their complete system as required by CLIA ‘88 regulations in the U.S. or equivalents in other countries. 

QIAzol Lysis Reagent is a subject of US Patent No. 5,346,994 and foreign equivalents. 

Purchase of QIAGEN products for PCR containing Taq DNA Polymerase, HotStarTaq DNA Polymerase, or ProofStart DNA Polymerase is accompanied by a limited license to use them in the Polymerase Chain Reaction (PCR) 

process for research and development activities in conjunction with a thermal cycler whose use in the automated performance of the PCR process is covered by the up-front license fee, either by payment to Applied Biosystems 

or as purchased, i.e. an authorized thermal cycler. The PCR process is covered by U.S. Patents 4,683,195 and 4,683,202 and foreign equivalents owned by Hoffmann-La Roche AG. The 5’ nuclease process is covered 

by patents owned by Roche Molecular Systems, Inc. and F. Hoffmann-La Roche Ltd. Patents of third parties in certain countries may cover the process of multiplex PCR or of certain applications. A license may be needed to 

perform patented assays. Patents of third parties in certain countries may cover the process of multiplex PCR or of certain applications. 

QuantiTect Gene Expression Assays and QuantiTect Custom Assays or portions hereof are subject to proprietary rights of Epoch Biosciences, Inc. and are made and sold under license from Epoch under the patents and 

patent applications as may be designated by Epoch from time to time set forth, including one or more of the following: U.S. Patent Nos. 5,801,155, 6,084,102, 6,312,894, 6,426,408, and 6,127,121, and applications 

currently pending. Purchase of this product carries with it a limited, non-transferable, non-exclusive (without the right to resell, repackage, or sublicense) license under U.S. Patent Nos. 6,030,787; 5,723,591; and 5,876,930, 

and corresponding foreign patents. Powered by innovation from Epoch. Manufactured for QIAGEN by Epoch Biosciences. 

siRNA technology licensed to QIAGEN is covered by various patent applications, owned by the Massachusetts Institute of Technology, Cambridge, MA, USA and others. 

The Black Hole Quenchers and BHQ dyes were developed by and licensed from Biosearch Technologies, Novato, CA. These products are sold exclusively for R&D use by the purchaser. They may not be used for clinical 

or diagnostic purposes and they may not be re-sold, distributed, or re-packaged. 

“RNAlater ” is a trademark of AMBION, Inc., Austin, Texas and is covered by various U.S. and foreign patents. 

© 2004 QIAGEN, all rights reserved. 

Australia ■ QIAGEN Pty Ltd ■ Orders 03-9840-9800 ■ Fax 03-9840-9888 ■ Technical 1-800-243-066 

Belgium ■ QIAGEN Benelux B.V. ■ Orders 0800-79612 ■ Fax 0800-79611 ■ Technical 0800-79556 

Canada ■ QIAGEN Inc. ■ Orders 800-572-9613 ■ Fax 800-713-5951 ■ Technical 800-DNA-PREP (800-362-7737) 

France ■ QIAGEN S.A. ■ Orders 01-60-920-920 ■ Fax 01-60-920-925 ■ Technical 01-60-920-930 

Germany ■ QIAGEN GmbH ■ Orders 02103-29-12000 ■ Fax 02103-29-22000 ■ Technical 02103-29-12400 

Italy ■ QIAGEN S.p.A. ■ Orders 02-33430411 ■ Fax 02-33430426 ■ Technical 02-33430414 

Japan ■ QIAGEN K.K. ■ Telephone 03-5547-0811 ■ Fax 03-5547-0818 ■ Technical 03-5547-0811 

Luxembourg ■ QIAGEN Benelux B.V. ■ Orders 8002-2076 ■ Fax 8002-2073 ■ Technical 8002-2067 

The Netherlands ■ QIAGEN Benelux B.V. ■ Orders 0800-0229592 ■ Fax 0800-0229593 ■ Technical 0800-0229602 

Switzerland ■ QIAGEN AG ■ Orders 061-319-30-30 ■ Fax 061-319-30-33 ■ Technical 061-319-30-31 

UK and Ireland ■ QIAGEN Ltd. ■ Orders 01293-422-911 ■ Fax 01293-422-922 ■ Technical 01293-422-999 

USA ■ QIAGEN Inc. ■ Orders 800-426-8157 ■ Fax 800-718-2056 ■ Technical 800-DNA-PREP (800-362-7737) 


Integrated Solutions — Plasmid DNA Purification 

Concentrate on your research — 

trust QIAGEN ® plasmid kits! 

Thousands of researchers trust QIAGEN plasmid kits to let them focus on getting results! 

QIAGEN offers the most comprehensive range of plasmid purification kits: from mini- to gigapreps, 

and from convenient manual formats and walkaway automated procedures to contract plasmid 

DNA production. 

Whatever your downstream application, QIAGEN has the right kit for you! 

■ High-efficiency transfection of sensitive cells using DNA purified by EndoFree ® Plasmid Kits or 

QIAGEN Plasmid Prep Service 

■ Transfection and protein expression using DNA purified with a range of kits, including 

HiSpeed ® Plasmid Kits 

■ All standard laboratory applications using the QIAprep ® range of kits 

■ Streamlined sequencing projects using QIAGEN automated integrated solutions for plasmid 

purification, including new, cost-effective DirectPrep ® 96 Kits 

Discover Choose the more best about QIAGEN gene kit silencing for you at using www.qiagen.com/siRNA! 

our new selection guide, 

see page 69! 

Trademarks: QIAGEN ® , QIAprep ® , DirectPrep ® , EndoFree ® , HiSpeed ® (QIAGEN Group). AppDPLSall0704B1WW 07/2004 © 2004 QIAGEN, all rights reserved. 

High-efficiency primary cell 

transfections 

Reliable high-throughput 

sequencing 

WWW.QIAGEN.COM

QIAGEN News - Rede Pró-Fauna

Create successful ePaper yourself

Delete template?

Save as template?