TRENDS IN BIOSCIENCES JOURNAL

Print : ISSN 0974-8431
Online : ISSN 0976-2485
Trends
in
Biosciences
www.trendsinbiosciences.com
Volume 3 Number 2 December, 2010
Online version available at
www.indianjournals.com
Dheerpura Society for Advancement of Science
and Rural Development

International Advisory Board
Trends in Biosciences
(A Biannual Scientific Journal)
www.trendsinbiosciences.com
Dr. A. Coomans, Ex-Professor, State University of Ghent, Belgium
Dr. Randy Gaugler, Director, Centre for Vector Biology, Rutgers University, USA
Dr. S.B. Sharma, Director Plant Security, South Perth, Australia
Dr. Zahoor Ahmad, Professor Jubail Industrial College, Saudi Arabia
Advisory Board
Dr. G.N. Qazi, Vice Chancellor, Jamia Hamdard University, New Delhi
Dr. N. Nadarajan , Director, Indian Institute of Pulses Research (IIPR), Kanpur
Dr. Seema Wahab, Advisor, Department of Biotechnology, New Delhi
Dr. Masood Ali, Ex-Director, Indian Institute of Pulses Research (IIPR), Kanpur
Dr. I. Ahmad, Director, Department of Science & Technology, New Delhi
Editor in Chief: Dr. S.S. Ali, Emeritus Scientist, Indian Institute of Pulses Research (IIPR), Kanpur
Associate Editors
Dr. B.B. Singh, Assistant Director General (Oil Seed & Pulses) ICAR, New Delhi
Dr. S. K. Agarwal, Principal Lentil Breeder, ICARDA, Aleppo, Syria
Dr. H.S. Gaur, Dean & Director (Education) IARI, New Delhi
Dr. N.P. Singh, Coordinator, AICRP Chickpea, IIPR, Kanpur
Dr. Raman Kapoor, Head, Dept. of Biotechnology, Indian Sugarcane Research Institute, Lucknow
Dr. S.K. Jain, Coordinator, AICRP Nematode, IARI, New Delhi
Dr. Sanjeev Gupta, Principal Scientist (Plant Breeding), IIPR, Kanpur
Mr. Naimuddin, Sr. Scientist (Plant Pathology), IIPR, Kanpur
Dr. Mohd. Ovais, Ex-Professor, Barkatullah University, Bhopal, M.P.
Dr. Rashid Pervez, Sr. Scientist, Indian Institute of Spices Research, Khozicod, Kerala
Dr. Shamsa Arif (English editor), Barkatullah University, Bhopal, M.P.
Trends in Biosciences abstracted in CABI abstract, U.K.
Annual Subscription Rates for 2011:
Version
INDIAN
in Rs./issue
Individual Institutional Single article
FOREIGN
in US$/issue
INDIAN
in Rs.
FOREIGN
in US$
INDIAN
in Rs.
FOREIGN
in US$
*Print /Number 350 50 2100 200 50 10
**Online 700 50 2100 200 150 25
*Payment must be made through Demand Draft/e-banking payable to State Bank of India, Kalyanpur Branch, (Branch code
01962, IFSC : SBIN0001962) Kanpur, U.P. India, in favour of account number 10298389921 along with manuscript and send to
Dr. S.S. Ali, Editor in Chief, H- 1312, VIP Lane, Satyam Vihar, Avas Vikas No.1, Kalyanpur, Kanpur- 208 018, U.P. India. In case of
outstation cheque an extra amount of Rs. 50/- may be paid as clearance cheque. For e-banking add Rs. 25/- (contact:
ss_ali@rediffmail.com). For institutions/Govt. organizations DD should be in favour of ‘Trends in Biosciences’.
**For online authentication by indianjournals.com is required for access. For online subscription payment must be made in
favour of indianjournals.com payable at New Delhi through DD or Cheque, add Rs. 50 for non Delhi cheque and send to B-9, A-
Block, Shopping Complex, Naraina Vihar, Ring Road, New Delhi 110 028, India (contact : info@indianjournals.com)

Print : ISSN 0974-8431
Online : ISSN 0976-2485
Trends
in
Biosciences
www.trendsinbiosciences.com
Volume 3 Number 2 December, 2010
Online version available at
www.indianjournals.com
Dheerpura Society for Advancement of Science
and Rural Development
Branch Office : Kanpur (U.P.) 208 018, India

Dheerpura Society for Advancement of Science and Rural Development
(Reg. No. 01/01/01/16715/06)
The Dheerpura Society for Advancement of Science and Rural Development was founded on 28 July, 2006 with the following
objectives
1. To promote research and development in agriculture, life sciences through publishing journal, organizing seminars etc.
2. To make people environmental conscious
3. To work for human development in society
4. To work for uplifting of rural masses and their development
Membership
Membership to the society is open to all individuals / institutions interested in society’s objective by becoming ordinary
life, institutional, corporate members against payment of membership fee.
Membership fee Indian (Rs.) Foreign (US$)
Ordinary (Annual) 600 100
Life member 10,000 1,000
Institutional 15,000 1,500
Corporate member 20,000 2,000
Renewal of annual subscription should be done in January each year; if the subscription is not received by 15 February, the
membership would stand cancelled. Membership fee should be drawn in favour of A/c No. 10298389921, State Bank of India,
Kalyanpur branch (code 01962, IFSC : SBIN0001962), Kanpur on the following address. In case of out station cheque an extra
amount of Rs. 50/- may be paid as clearance cheque. For e-banking add Rs. 25/-. For Institutes/Govt. Organizations subscrition
fee should be drawn in favour of Dheerpura Society for Advancement and Rural Development, State Bank of India, Kalyanpur
Branch, Kanpur (U.P.).
Dr S.S. Ali
H-1312, VIP Lane, Satyam Vihar,
Awas Vikas No.1, Kalyanpur, Kanpur 208 018 (U.P.), India
Ph. 0512-2571571, 09919388690
Email: ss_ali@rediffmail.com

MINI REVIEW
1. An Overview of Antimicrobial and Antioxidant Activities of Phytoplankton 97-101
B. Bharathiraja, J. Jayamuthunagai, S. Sivarathnakumar, R. Selvaraj, M. Jayakumar and M. Chandran
RESEARCH PAPERS
2. Molecular Marker Analysis on Genetic Variation in Domesticated Silkworm 102-105
K.A. Murugesh, S. Mohankumar and C.A. Mahalingam
3. Studies on Molecular Diversity in Maize Inbreds Using SSR Markers 106-109
Astha Gupta and A.K. Singh
4. Heterosis for Grain Yield and Quality Traits in Durum Wheat (Triticum durum Desf.) Under Late Sown 110-111
Condition
R.A. Gami, C.J. Tank, S.S. Patel, S.V. Burungale and C.G. Patel
5. Molecular Characterization of Steinernema masoodi, S. seemae and Other Indian Isolates of 112-116
Steinernema spp.
S.S. Ali, Riyaz Andrabi, V. Verma, Ruchika, Azra Shaheen, Rashid Pervez and Sobia Ali
6. Detection of Mungbean Yellow Mosaic India Virus in Kharif Pulses and Some Weeds 117-119
Minakshi Mishra, Mansi Sachan, Mohd. Akram and Naimuddin
7. Effect of Relative Humidity on Growth of Clinically Isolated Three Candida spp. 120-122
Ch. Tanushree Das, Ritarani Das and R.C. Mohanty
8. Molecular Diversity Analysis of Chickpea Genotypes belonging to Nodulating Groups 123-126
Preeti Verma, R.S. Waldia and A.K. Chhabra
9. Genetic Divergence in Mungbean Under Two Environments 127-129
G. Roopa Lavanya, Rashmi Jain and Anshul Srivastava
10. Effect of Curd Size on Seed Yield and Seed Quality Parameters of Cauliflower (Brassica oleracea 130-132
var. botrytis L.)
Hemant Khulbe, Prabha Shankar Shukla, Deepa Khulbe and Shambhoo Prasad
11. Polymerase Chain Reaction Based Detection of Dolichos Yellow Mosaic Virus Infecting Dolichos 133-134
Sobia Ali and Rais Ahmad
12. Non-Hierarchical Euclidean Cluster Analysis in Mungbean 135-136
Rashmi Singh, Hasmat Ali and Varun Pathak
Trends in Biosciences
Volume 3 No. 2 December, 2010
CONTENTS
13. Bisphenol-A Induced Changes in Enzymes Activities (GOT, GPT, ACP and ALP) in Liver and Kidney of 137-139
Freshwater Fish Cirrhinus mrigala (Ham.)
Sarita Murmu, Manohar Rao Gawande and Vinoy K. Shrivastava
14. Genetic Analysis for Grain Yield and Quality Parameter in Durum Wheat (Triticum durum Desf.) 140-142
under Late Sown Condition
R.A. Gami, C.J. Tank, R.M. Chauhan, H.N. Patel and S.V. Burungale

15. Gamma Rays Induced Mutation in Soybean [Glycine max (L.) Merrill] 143-146
Mudasir Hafiz Khan, Sunil Dutt Tyagi and S.A. Dar
16. Plant Parasitic Nematodes Associated with Banana Crops (Musa AAA) in District Patiala, Punjab, India 147-148
Harpreet Kaur, Harjinder Kaur and Neelam Kumari
17. Cytotoxic Effects of Methyl Methane Sulphonate in Two Varieties of Capsicum annuum L. 149-151
Mohd Gulfishan, Ainul Haq Khan and Iram Fatma Jafri
18. Productivity Evaluation and Nitrogen Dynamics in Rice (Oryza sativa)-Wheat (Triticum aestivum L) 152-155
Cropping System as Influenced by Crotalaria juncea Green Manuring
Ajay Kumar, H.K. Patro, Debiprasad Dash, B.S. Mahapatra and D.K. Shukla
19. Population Fluctuation of Aphid, Aphis gossypii and Predatory Coccinellid Beetle on Brinjal Aphid with 156-158
Reference to its Relation with Weather Factors in Western Plain Zone of Uttar Pradesh
G.N. Tiwari, C.S. Prasad and Lok Nath
20. Evaluation of New Combination Product Spirotetramat 12% + Imidacloprid 36% - 480 SC against 159-160
Sucking Pests of Cotton
J.K. Patel, I.S. Patel and G.M. Patel
21. Andalin as An Effective Insect Growth Inhibitor against Spodoptera litura (Fabricius) (Lepidoptera: 161-163
Noctuidae)
Iram Khan and Ayesha Qamar
22. Relative Performance of Spilarctia obliqua Walker (Lepidoptera : Arctiidae) on Certain Plants of Labiatae 164-165
S.C. Srivastava
23. Amino Acid Variability in Coat Protein Gene of Mungbean Yellow Mosaic India Virus Infecting Pulse Crops 166-168
Mansi Sachan, Minakshi Mishra, Naimuddin and Mohd. Akram
24. Combining Ability for Maturity, Morphological and Yield Related Traits in Maize (Zea mays L.) 169-173
Asif, M. Iqbal, F.A. Nehvi, H.Qadri and S.A. Dar
25. Comparative Efficacy of Some Biopesticides and Insecticides against Diamondback Moth, 174-175
Plutella xylostella (L.) on Cabbage in Allahabad, U.P.
Ankush Raut and Sobita Simon
26. Efficacy of Combined Action of Garlic Extract and Mint Oil Volatiles Against Rice-moth, Corcyra 176-180
cephalonica (Stainton) (Lepidoptera : Pyralidae)
P.H. Pathak, Arpita Pandey and Sangita Pandey
27. Genetic Divergence in Lentil (Lens culnaris Medik) 181-183
S. D. Tyagi, M. H. Khan and S. A. Dar
28. Comparative Biology of Sorghum Stem Borer, Chilo partellus (Swinhoe) (Lepidoptera: Pyralidae) on 184-186
Different Sorghum Genotypes/Cultivars
N.P. Chavan, N.B. Rote, M.B. Patel and S.V. Shinde
29. Study on Genetic and Seed Quality Parameters in Horsegram Genotypes under Mid Hills of North Western 187-189
Himalaya
Prabha Shankar Shukla, Rajendra Prasad and Sambhoo Prasad
30. Effect of Neem Seed Kernel Powder on Infestation of Bruchids, Callosobruchus maculatus (Fabr.) and 190-191
Callosobruchus chinensis (Linn.) in Stored Grains of Legumes
B.S. Azad, S.P. Srivastava and Alok Kumar Pandey
31. Shelf Life of Cellulolytic Fungi and Bacteria in Different Carrier Materials 192-193
Deepti Bhagat, Mina D. Koche and R.W.Ingle

32. Development of Bio-Intensive Pest Management (BIPM) Module for Bt Cotton in North Gujarat 194-196
J.K. Patel, M.V. Vekaria and I.S. Patel
33. Detoxification of Triazophos Using Fungal Species Rhizopus oligosporus from Cotton Soils of 197-203
Andhra Pradesh
P. Udaya Sri, K.R.S. Sambasiva Rao and K.M. Subbu Rathinam
34. Study on Infection Intensity and Changes in Total Protein Content in Tissues of Channa punctatus 204-205
Infected with Helminth Parasites
Krishna Singh and Amit Srivastava
35. Status of Stem Rot of Vanilla Incited by Fusarium oxysporium f.sp.vanillae in Karnataka 206-207
B. Gangadhara Naik, Muhammad Saifulla, B.Manjunath and P.S.Prasad
36. Efficacy of Spinosad and Neem Products Against Shoot and Fruit Borer (Leucinodes orbonalis Guen.) 208-209
of Brinjal (Solanum melongena L.)
Anoorag, R. Tayde and Sobita Simon
37. Prevalence of Helminth Parasites of Goats and Sheep in Bhognipur Area of Kanpur, U.P. 210-211
Siddiqua Bano
38. Grasserie Disease Incidence on Silkworm and Development of Botanical Based Management Strategy 212-215
C.A. Mahalingam, K.A. Murugesh and R. Shanmugam
39. Toxicity Study of Ethanolic Extract of Parthenium hysterophorus in Rats 216-219
Veena, B. Kushwaha and Shivani Maurya
40. Pollen Diversity in Apis cerena and its Quantification in Different Ecological Habitats in Karnataka 220-221
A. Nagarathna and M.S. Reddy
41. Photocycloaddition of Furochromenethylthiourea and Oleic Acid Methyl Ester 222-224
Jawaid Iqbal, Anamika Gupta, Waseem Ahmad and M. Rehan Zaheer
42. Genotypic Identification of Lentil (Lens culinaris) using Electrophoresis Technique 225-227
Anuradha Singh, Mohammad Shahid and R.P. Vyas
43. Two Novel Additions to Meliola Fr. and Some Additional Records of Foliicolous Fungi from Mahabaleshwar 228-229
D.P. Singh and T.P. Mall
44. Farmers Participatory Approach for Sustainable Cotton Production Through Integrated Pest Management 230-231
A.S. Yadav, P.N. Tripathi, R.C. Sharma and Pradhuman Singh
SHORT COMMUNICATIONS
45. In vivo Production and Infectivity of Oscheius amsactae (Ali, et al., 2007) on Four Agriculturally Important 232-233
Insect Pests
S.S. Ali, M. Asif, P. Duraimurugan, M.H. Akhtar, Rashid Pervez, Azra Shaheen and Imran Ahmad
46. Correlation Between Insect Predators and Their Host Insects in Cotton Crop 234
J.K. Patel, M.V. Vekaria and I.S. Patel
47. Screening of Rhizospheric Soil Samples for Mycorrhizae and Study of Its Phosphatase Activity and Effect 235-236
on Ragi [Elucine crocana] Plant
Savanta V. Raut and Kamakshi Bhat
48. Correlation of Insect Pests and Natural Enemies with Weather Parameters in Bt Cotton 237-238
J.K. Patel, M.V. Vekaria and I.S. Patel

Trends in Biosciences 3 (2): 97-101, 2010
MINI REVIEW
An Overview of Antimicrobial and Antioxidant Activities of Phytoplankton
B. BHARATHIRAJA 1 , J. JAYAMUTHUNAGAI 2 , S. SIVARATHNAKUMAR 1 , R. SELVARAJ 1 ,
M. JAYAKUMAR 3 AND M. CHANDRAN 4
1
Department of Biotechnology, Anna Bioresearch Foundation, Arunai Engineering College, Tiruvannamalai,
Tamil Nadu, 606 603.
2
Centre for Biotechnology, Anna University, Chennai 600 025.
3
Department of Chemical Engg & Biotechnology, AMACE,, Kancheepuram 604 410
4
Department of Bbiotechnology,Veltech Engineering college,Avadi,Chennai.
email: btrbio@gmail.com
ABSTRACT
The research on pharmacology and clinical therapeutics using
phytoplankton has lead to the discovery of numerous drugs.
These drugs have entered international pharmacopeias based
on the study of ethnopharmacology and traditional medicine.
Bacterial pathogenicity was studied using Anti Quorum
Sensing (compounds extracted from various plant sources) and
Quorum sensing (bacterial intercellular communication). Plant
species procured from various origins were evaluated and
studied for antimicrobial and antioxidant activity. Biden pilosa,
Psidium guajava, Dorstenia angusticorins, Achromanes difformis,
Cleome rutidosperma, Cymbopogen citrates were found to possess
the above mentioned activity. This review encompasses the key
aspects of antimicrobial and antioxidant activity of
phytoplankton involved in drug discovery.
Key words
Antimicrobial activity, antioxidant activity,
pharmacology, phytoplankton, quorum sensing.
Although no new major antimicrobial drugs has been
developed from plants, innumerable studies have generated
data showing antimicrobial properties of medicinal plants (Ellof,
1998, 1999) whether for traditional use validation or drug
discovery, purpose, previous studies have focused on the
anti microbial potential of medicinal plants (Cowan, 1999;
Wallace, 2004). Since a large number of system affecting
pathogenicity are controlled by QS, interrupting this
communication system can render the pathogenic bacteria
non virulent (Zhang and Dong, 2004). Quorum is population
dependent phenomenon first characterized in 1970’s in
luminescent marine species of vibrio (Nealson, et al., 1970;
Hastings and Greenberg, 1999). QS systems are ubiquitous in
bacteria, and have been found to regulate diverse cellular
functions including luminescence, biofilm formation and
antibiotic production, virulence factor expression, pigment
production and motility (Whitehead, et al., 2001; Fuqua and
Greenberg, 2002). In QS, small signaling molecules called auto
inducers mediate the ability to sense the size of a bacterial
population (Eberhard, et al., 1981). Auto inducers are
constantly produced and received at a basal level by bacterial
cells. With high population density, there is a surplus of such
Dr. B. Bharathiraja presently working
as Assistant Professor, Department of
Biotechnology, Arunai Engineering
College Tiruvannamalai Tamil Nadu. He
has done B.E. (Chem) and M.Tech. in
Industrail Biotechnology from
Annamalai University and Diploma in Industrial safety
also from Annamalai University. He worked as lecturer
in Biotechnology at Sri Nandanam College of
Engineering and Technology, Tirupattur. He handled a
project of TNSCST a programme of Govt. of India. He
is a ISTE life member. He has published 11 research
papers in international repute journals.
Dr. J. Jayamuthunagai serving as
Assistant Professor at Centre for
Biotechnology, Anna University
Chennai, Chennai. She has done
B.Tech. (Chemical Engineering) from
Dr. Navalar Nedunchezian College of
Engineering, Tholudur, Madras University, M.E.
(Chemical) from, Annamalai University, Annamalai
Nagar and also DCE (Diploma in Chemical Engineering)
from Ayyapa Polytechnic, Ayvathakuti. She has
published seven research papers in international repute
journals.
molecules in the environment (Hastings and Greenberg, 1999).
These molecules then interact with a transcriptional
regulator to activate expression of genes involved in light
production in luminescent vibrio species (Fuqua, et al., 1994).
Several signaling molecules have been identified (Zhang and
Dong, 2005), the best characterized being the acyl homo serine
lactones (AHLs) in gram negative bacteria (Eberhard, et al.,
1981). Anti QS activity has also been shown in a number of
southern Florida seaweeds (Cumberbatch, 2000) and a few
terrestrial plants (Teplitski, et al., 2000; Gao, et al., 2003).
Essential oil of plants is of growing interest both in industry
and scientific research because of their anti bacterial, anti
fungal and anti oxidant properties which make them useful as

9 8 Trends in Biosciences 3 (2), 2010
natural additives in foods (Pattnaik, 1997). The plant essential
oil and their extract have had a great usage in folk medicine,
food flavoring, fragrance and pharmaceutical industries
(Kusmenoglu, et al., 1995).
Phenylpropanoids glucosides, polyacetylene,
diterpenes, flavanoids and flavone glycosides have been
identified as bioactive compounds or components from Biden
pilosa Linx. var. Radiata (Chiang, et al., 2004). These
compounds were suggested to be involved in the anti oxidant
(Chiang, et al., 2004), antibacterial and anti microbial activities
(Rabe and Staden, 1997). Dortenia that comprises of 170 tropical
species is recognized as a rich source of secondary metabolite
such as steroids benzofuran derivatives, styrene and
triterpenoids (Franke, et al., 2001; Abegaz, et al., 2002). The
anti microbial properties of essential oils have been recognized
for many years (Hammer, et al., 1999; Cosentino, et al., 1999;
Daferera, et al., 2000). There are reports of the active principle
of essential oil from various plants with antibacterial or anti
fungal activities (Hinou, et al., 1989; Hammerschmidt, et al.,
1993; Carson and Riley, 1995).
The analysis of ethno botanical studies revealed that
more than 100 species are used traditionally. If one accepts
that the more effective treatment, the information is likely
passed on, this analysis allows building a species priority
rank order that relates to the perceived effectiveness (Trotter,
1981; Etkin, 1994).
A diversity of extract from Eugenia uniflora was
subjected to antimicrobial analysis with positive results
against aspergillus species, Bacillus species, Shigella species
and S.aureus (Fadeyi and Akpan, 1989; Adebajo, et al., 1989;
El-shabrawy, 1995) and also specifically methanol extract is
active against Bacillus species and S.aureus (Adebajo, et al.,
1989).Extract of Leonurus sibiricus were found inactive against
Bacillus subtilis (Woo, et al., 19), S.aureus (Mitscher, et al.,
1972), ethanol extracts of Malva slyvestris are active against
B.subtilis (Izzo, et al., 1995). But different extract did not show
antimicrobial activity and the gram negative bacteria E.coli
and yeast Candida albicans are not inhibited by any of the
methanol extract. Hence, research of Florida medicinal plants
has shown anti quorum sensing activity in only a few higher
plants and seaweed (Manefield, et al., 1999; Teplitski, et al.,
2000; Fray, 2002; Gao, et al., 2003). The active species were
effective at inhibiting QS in all biomonitor strains, it can be
assumed that the responsible compounds have multiple or
broad spectrum effects. The preliminary screen provided some
insight as to the effect of preparation on activity, something
not often accounted for in medicinal plants studies. Leaves
with excessive microbial colonization resulted in false positive
results. So an anti quorum sensing effect was seen only in
macerated leaves, suggesting that these compounds are not
secreted on the leaf surface. It has also been used against
diarrhea, syphilis and gonorrhea (Morton, 1981; Nellis, 1994).
Bucida buceras is also used for syphilis and gonorrhea
(Morton, 1981). The essential oil of Callistemon viminalis
has anti helminthic properties (Garg and Kasera, 1982).
Extract of Melaleuca species are used against a number
of skin and repository conditions in Bahamas, Puerto rico and
Indo China (Morton, 1981; Duke, 1985) and oil of Melaleuca
alternifolia is used as a antimicrobial agents (Hammer, et al.,
1996; Halcon and Milkus, 2004). Some compounds of medicinal
plants may contribute to anti QS effect. These compounds
also seen distinct from those produced in bacteria and
Table 1.
Essential oil components of fresh leaves and
flowers of Biden pilosa (adapted from F. Deba, et
al., 2008)
Components RI a Peak area %
Leaves Flowers
Acetal 815 0.03 0.09
Cis-3-Hexen-1-ol 854 0.10 - b
-Pinene 930 0.99 5.97
Camphene 947 0.02 0.06
-Phellandrene 971 0.01 0.15
-Pinene 975 0.07 0.39
-Myrcene 988 0.29 1.54
Cis-3-Hexenyl acetate 1005 0.77 -
3-Carene 1006 - 0.65
m-Cymol 1024 0.08 0.11
Limonene 1029 0.34 2.12
-trans-Ocimene 1036 0.55 1.64
-cis-Ocimene 1047 1.45 1.46
γ-Terpinene 1059 - 0.05
-Linalool 1100 0.43 0.09
(4E,6Z)-2,6-Dimethyl-2,4,6-octatriene 1129 0.24 0.70
trans-Verbenol 1144 - 0.11
Cis-Verbenol 1148 0.11 0.18
4-Terpineol 1183 0.15 0.41
p-Cymen-8-ol 1198 0.26 0.35
Bornyl acetate 1287 0.15 0.18
Elixene 1313 0.25 0.32
-Cubebene 1318 0.17 0.21
Ylangene 1326 0.13 0.13
Τ-Muurolene 1329 1.01 0.78
-Bourbonene 1332 1.10 0.99
-Elemene 1333 1.00 0.67
-Bergamotene 1341 0.12 0.07
-Caryophyllene 1345 10.9 5.1
-Cubebene 1348 2.23 1.77
-Farnesene 1353 0.72 0.29
-Caryophyllene 1357 1.55 1.00
(+)-Epi-bicyclosesquiphellandrene 1358 0.27 0.25
Isoledene 1362 0.67 0.47
τ-Cadiene 1365 7.82 6.13
-Bisabolene 1372 0.31 0.03
-Gurjuene 1375 0.44 0.24
(-)--Cadiene 1376 0.82 0.23
2,5,9-Trimethylcycloundeca-4,8-dienone 1387 0.82 0.16
trans-Nerolidol 1388 0.39 0.13
Ent-spathulenol 1396 0.33 0.18
Caryophyllene oxide 1398 1.47 1.03
Megastigmatrienone 1444 5.35 2.04
Diphenylenemethane 1450 1.94 1.77

BHARATHIRAJA et al., An Overview of Antimicrobial and Antioxidant Activities of Phytoplankton 9 9
Table 2. Antimicrobial activities (adapted from G. Coelho de Souza, et al., 2000)
Crude methanolic extract Staphlococcus
aureus
Staphlococcus
epidermidis
Escherichia
coli
Bacillus
subtilis
Micrococcus
luteus
Candida
albicans
Saccharomyces
cerevisiae
Alternanthera brasiliana R R R R R R R
Bauhinia forficata R R R R R R R
Chaptalia nutans R R R + R R R
Cordia monosperma R R R ++ R R ++
Cordia curassavica R R R R R R R
Coronopus didymus R R R R R R R
Echinodorus grandiflorus R R R + + R R
Eugenia uniflora + R R + +++ R R
Leonurus sibiricus R R R ++ R R R
Luehea divaricata R R R R + R R
Malva sylvestris R R R R R R +
Ocotea odorifera R R R + + R +
Parapiptadenia rigida ++ ++ R ++ +++ R R
Plantago australis R R R R R R R
Pulchea sagittalis R R R R + R R
Psidium catleyanum R + R ++ ++ R R
Senna neglecta R R R + R R R
Smilax campestris R R R R R R R
Chloranphenicol (40g/ml) + ++ ++ +++ ++++ O O
Nystatin (0.3mg/ml) O O O O O ++++ ++++
R, resistant; 8-11mm, +; 11.1-16mm, ++; 16.1-20mm, +++; 20.1-26mm, ++++; Chloranphenicol (40mg/ml), ++++; Nystatin (0.3mg/ml), water and
methanol; O, not performed.
seaweed. The only known anti QS compounds from higher
organisms are structural mimics (Manefield, et al., 1999, 2002).
Among identified compound, â-caryophyllene is well known
for its anti inflammatory and local anesthetic activities
(Ghelardini, et al., 2001). This compound is also used in spice
blends, soap, detergents, creams, lotions and is widely used
in food products and beverages (Skold, et al., 2006). He also
reported that some essential oils rich in non-phenolic
compounds also have antioxidant potentials (El-Massry, et
al., 2002). The antioxidant effect of essential oils depends not
only on the same temperature but also on many factors such
as their structural features, character of the lipid synthesis
and on binding of the fatty acid.
The water extract obtained from B.pilosa showed
moderate antimicrobial activity against all micro organisms.
Monoterpene hydrocarbons and oxygenated monoterpenes
in the extract are able to destroy cellular integrity and thereby
inhibit respiration and ion transport processes. This is
supported by the information on the effects of differential oil
compounds on outer membrane permeability in gram negative
bacteria (Helander, et al., 1998) and Sesquiterpene â-
caryophyllene also plays a vital role in plant defense (Ulubelen,
et al., 1994). The antibacterial activity of oil in B.pilosa is due
to the presence of high concentration of â- caryophyllene
(Ulubelen, et al., 1994). The volatile oil consists of complex
mixtures of numerous components and it might give rise to
fungal activities. Possible synergistic and antagonistic effects
of compounds play an important role in fungal inhibition. The
essential oil from medicinal plant exhibited antibacterial,
antifungal and antioxidant activities. Monoterpenes found in
this essential oil may act as a radical scavenging agent. The
essential oil which contain monoterpenes hydrocarbons,
oxygenated monoterpenes, sesqiterpenes have greater
antioxidative properties (Tepe, et al., 2004) owing to strong
anti fungal and protective features exhibited in antioxidant
test. Essential oil and aqueous extract of B.pilosa could be
considered as a natural herbal source that can be freely used
in food and pharmaceutical industry. The extract of P.guajava
contains pharmacologically active substances with
antidiarrhoeal properties, revealed in their inhibitory effect on
gastrointestinal propulsion. Flavanoids from herbal drugs can
reach the small intestine without being processed and are
then metabolized by the intestinal micro flora in the large
intestine. Extract of crushed rhizome of H.coronarium is
containing 1, 8 Cincole, â-pinene, á-pinene whereas major
constituents of fresh rhizome are 1, 8 Cincole (41%) and â-
pinene (10%). It is noted that the fresh oil showed more activity
than the oil from dried rhizome. 1, 8 Cincole have great anti
microbial effect on Candida species than when they are studied
independently (Viljoen, et al., 2003) inactivity of 1, 8 Cincole
against gram positive bacteria has also been reported (Nakatsu,
et al., 2000). Monoterpenes are considered as broad spectrum
molecules with antimicrobial activities, especially anti bacterial
and anti fungal effects.
The molecular groups with the strongest antibacterial
action are also reported to be active on fungi and the anti
fungal activities of alcohols and sesquiterpenic lactones are
well known (Larrondo, et al., 1995; Mangena and Muyima,
1999). The phytochemical screening revealed the presence of
alkaloids, phenols, polyphenol, saponins, triterpenes,
anthraquinones, coumarins and steroids.Many compounds
from those chemical groups are found to possess antimicrobial

100 Trends in Biosciences 3 (2), 2010
activity. Chemical composition of fraction explains the
differences in their inhibitory properties. (Bruneton, 1999;
Cowan, 1999). Minimal microbicidal concentration results also
confirm the selectivity and the high microbial activity of the
tested compounds (Mims, et al., 1993). Though numerous
researches have documented the effectiveness of flavanoids
against a wide range of gram positive bacteria as well as fungi
(Cowan, 1999) and Dorstenia angusticornis represents
potential sources of antimicrobial drug in the treatment of
infectious diseases. Other plants called Garcinia mangostana
showed the greatest antimicrobial effect. The Minimal
Inhibitory Concentration (MIC) values against both organisms
are 0.039mg/ml and Minimal Bactericidal Concentration are
0.039mg/ml and 0.156mg/ml against Propionibacterium and
Staphylococcus epidermidis respectively. The plant extracts
are further analyzed by TLC and the assay for bioautography
demonstrated strong inhibition of extract. The clear zones are
located in separate places on the TLC plates, suggesting that
more than one compound possess an antimicrobial effect.
The active antimicrobial fraction is subjected to Silica gel
column using hexane and diethyl acetate (1:2) as eluting
solvent, yielding the active compounds. The active
compounds called Mangostin are identified based on the
spectral evidence and by comparison of NMR data with the
reported data (Mahabusarakam, et al., 1987). Mangostin is a
Xanthone derivative produced by Guttiferos. Xanthone and
its derivative have activities against Staphylococcus aureus
and Methicillin resistant Staphylococcus aureus (Munekazu,
et al., 1996)
Ethno pharmacological studies differ from natural
products pharmacology in several ways, including the results
should be meaningful for traditional uses. The presence of
active antimicrobial constituents in essential oil from
phytoplankton is in accordance with the usage of plant parts.
LITERATURE CITED
Abegaz, B.M., Ngadjui, B.T., Dongo, E., Bezabih, M.T. 2002. Chemistry
of the genus Dortenia. Current Organic Chemistry, 4: 1079-1090.
Adebajo, A.C., Oloki, K.J., Aladesanmi, A.J. 1989. Antimicrobial activity
of the leaf extract of Eugenia uniflora. Phytotherapy Research,
36: 258-259.
Bruneton, J. 1999. Pharmacognosie: Phytochimie, Plantes Médicinales,
third ed. Tec & Doc, Paris, pp.1120.
Carson, C.F., Riley, T.V. 1995. Antimicrobial activity of the major
components of the essential oil of Melaleuca alternifolia. Journal
of applied Bacteriology, 74: 264-269.
Chiang, Y.M., Chuang, D.Y., Wang, S.Y., Kuo, Y.H., Tsai, P.W. and
Shyur, L.F. 2004. Metabolite profiling and chemopreventive
bioactivity of plant extract from Bidens pilosa. Journal of
Ethnopharmacology, 95: 409-419.
Coelho de Souza, G., Haas, A.P.S., Poser, G.L.V., Elisabet Sky, E. 2004,
Farmácias caseiras comunitarias domunicipio de Maquine (RS), Uma
avaliacão etnofarmacolõ. Revista Brasileira de Plantas Medicinais
(in press).
Cosentino, S., Tuberoso, C.I.G., Pisano, B. 1999. In vitro antimicrobial
activity and chemical composition of Sardinian thymus essential
oils. Literature of Applied Microbiology, 29: 130-135.
Cowan, M.M. 1999. Plant products as antimicrobial agents. Clinical
Microbiological Reviews, 12: 564-582.
Cumberbatch, A. 2002. Characterization of the anti-quorum sensing
activity exhibited by marine microalgae of South Florida. In:
Undergraduate Honors Thesis Mathee, K. (Mentor). Florida
International University.
Daferera, D.J., Ziogas, B.N., Polissiou, M.G. 2000. GC-MS analysis of
essential oils of some Greek aromatic plants and their fungi toxicity
on Penicillium digitatum. Journal of Agricultural Food Chemistry,
48: 2576-2581.
Duke, J.A. 1985. CRC Handbook of Medicinal Herbs. CRC Press, Boca
Raton, FL.
Eberhard, A., Burlingame, A.L., Eberhard, C., Kenyon, G.L., Nealson,
K.H., Oppenheimer, N.J. 1981. Structural identification of
autoinducer of Photobacterium fischeri luciferase. Biochemistry,
163: 2444-2449.
Ellof, J.N. 1998. Which extractant should be used for the screening and
isolation of antimicrobial components from plants? Journal of
Ethnopharmacology, 60: 1-8.
Ellof, J.N. 1999. It is possible to use herbarium specimens to screen for
antibacterial components in some plants. Journal of
Ethnopharmacology, 67: 355-360.
El-Massry, K. F., El-Ghorab, A.H. and Farouk, A. 2002. Antioxidant
activity and volatile components of Egyptian Artemisia judaica L.
Food Chemistry, 79: 331-336.
El-Shabrawy, A.O. 1995. Essential oil composition and tannin contents
of the leaves of Eugenia uniflora L. grown in Egypt. Bulletin of the
Faculty of Pharmacy Cairo University, 33: 17-21.
Etkin, N. 2001. Perspective in Ethnopharmacology: Forging a closer
link between biosciences and traditional empirical knowledge. Journal
of Ethnopharmacology, 76: 177-182.
Fadeyi, M.O., Akpan, U.E. 1989. Antibacterial activities of the leaf
extracts of Eugenia uniflora Linn. (synonym Stenocalyx michelli
Linn.) Myrtaceae. Phytotherapy Research, 3: 154-155.
Franke, K., Porzel, A., Massoud, M., Adam, G., Schmidt, J. 2001.
Furanocoumarins from Dorstenia gigas. Phytochemistry, 56: 611-
621.
Fray, R.G. 2002. Altering plant-microbe interaction through artificially
manipulating bacterial quorum sensing. Annals of Botany, 89: 245-
253.
Fuqua, C., Greenberg, E.P. 2002. Listening in on bacteria: acylhomoserine
lactone signaling. Nature Reviews Molecular and
Cellular Biology, 3: 685-695.
Fuqua, W.C., Winans, S.C., Greeberg, E.P. 1994. Quorum sensing in
bacteria: the LuxR-LuxI family of cell density-responsive
transcriptional regulators. Journal of Bacteriology, 176: 269-275.
Gao, M., Teplitski, M., Robinson, J.B., Bauer, W.D. 2003. Production
of substances by Medicago truncatula that affect bacterial quorum
sensing. The American Phytopathological Society, 16: 827-834.
Garg, S.C., Kasera, H.L. 1982. Antihelminthic activity of the essential
oil of Callistemon viminalis. Fitoterapia, 53: 179-181.
Ghelardini, C., Galeotti, N., Mannellia, L.D.C., Mazzanti, G., and
Bartolini, A. 2001. Local anesthetic activity of â-caryophyllene.
IL Farmaco, 56: 387-389.

BHARATHIRAJA et al., An Overview of Antimicrobial and Antioxidant Activities of Phytoplankton 101
Halcon, L., Milkus, K. 2004. Staphylococcus aureus and wounds: a
review of tea tree oil as a promising antimicrobial. American Journal
of Infection Control, 32: 402-408.
Hammer K.A., Carson, C.F., Riley, T.V. 1996. Susceptibility of transient
and commensal skin flora to the essential oil of Melaleuca alternifolia
(tea tree oil). American Journal of Infection Control, 24: 186-189.
Hammer K.A., Carson, C.F., Riley, T.V. 1999. Antimicrobial activity
of essential oils and other plant extracts. Journal of Applied
Microbiology, 86: 985-990.
Hammerschmidt, F.J., Clark, A.M., Soliman, F.M., EI-Kashoury, E.S.,
Abdel Kawy, F.J., EI-Fishawy, A.M. 1993. Chemical composition
of antimicrobial activity of essential oils of Jasonia candicans and
Jasonia Montana. Planta Med., 59: 68-70.
Hastings, J.W., Greenberg, E.P. 1999. Quorum Sensing: the explanation
of a curious phenomenon reveals a common characteristic of
bacteria. Journal of Bacteriology, 181: 2667-2668.
Helander, I.M., Alakomi, H.L., Latva-Kala, K., Mattiala-Sandholm,
T., Pol, 1. Smid, E.J. 1998. Characterization of the action of selected
essential oils components on Gram negative bacteria. Journal of
Agricultural and Food Chemistry, 46: 3590-3595.
Hinou, J., Harvala, C., Philianos, S. 1989. Polyphenolic substances of
Cynara scolymus L. leaves. Ann Pharm Fr, 47: 95-98.
Izzo, A.A., Di Carlo, G., Biscardi, D., De Fusco, R., Mascolo, N., Borrelli,
F., Capasso, F., Faulo, M.P., Autoare, G. 1995. Biological screening
of Italian medicinal plants for antibacterial activity. Phytotherapy
Research, 9: 281-286.
Kusmenoglu, S., Baser, K.H.C., Ozek, T. 1995. Constituent of essential
oils from the Hulls of Pistacia Vera L. Journal of Essential Oil
Research, 7: 441-442.
Larrondo JV, Agut M, Calvo-Torras MA. 1995. Antimicrobial activity
of essences from Labiates. Microbios, 82(332): 171-172.
Mahabusarakam, W., Wiriyachitra, P., Taylor, W.C. 1987. Chemical
constitutents of Garcinia mangostana. Journal of Natural Products,
50: 474-478.
Manefield, M., De Nys, R., Kumar, N., Read, R., Givskov, M., Steinberg,
P., Kjelleberg, S. 1999. Evidence that halogenated furanones from
Delisea pulchra inhibit acylated homoserine lactone (AHL)-
mediated gene expression by displacing the AHL signal from its
receptor protein. Microbiology, 145: 283-291.
Manefield, M., Rasmussen, T.B., Henzter, M., Andersen, J.B., Steinberg,
P., Kjelleberg, S., Givskov, M. 2002. Halogenated furanones inhibit
quorum sensing through accelerated LuxR turnover. Microbiology,
148: 1119-1127.
Mangena T, Muyima NY. 1999. Comparative evaluation of the
antimicrobial activities of essential oils of Artemisia afra, Pteronia
incana and Rosmarinus officinalis on selected bacteria and yeast
strains. Lett Appl Microbiol. 28: 291-296.
Mims, C.A., Playfair, J.H.L., Roitt, I.M., Wakelin, D., Williams, R.
1993. Antimicrobials and chemotherapy (eds., Mims, C.A., et. al.,).
Medical Microbiology Review, 35: 1-34.
Mitscher, L.A., Leu, R.P., Bathala M.S., Wu, W., Beal, J.L. 1972.
Antimicrobial agents from higher plants. I. Introduction, rationale
and methodology. Lloydia, 35: 157-166.
Morton, J.F. 1981. Atlas of Medicinal Plants of Middle America: Bahamas
to Yucatan. Charles C. Thomas publisher, Springfield, IL.
Munekazu, I., Hideki, T., Toshiyuki, T., Fujio, A., Yasuko, K., Ryoyu,
S., Ken-Ichi, M. 1996. Antibacterial activity of xanthones from
gutiferaeous plants against methicillin-resistant Staphylococcus
aureus. Journal of Pharmacy and Pharmacology, 48: 861-865.
Nakatsu T, Lupo At, Chinn JW, Kang RKL. 2000. Biological activity
of essential oils and their constituents. Stud. Nat. Prod. Chem., 21:
571-631.
Nealson, K.H., Platt, T., Hastings, J.W. 1970. Cellular control of the
synthesis and activity of the bacterial luminescent system. Journal
of Bacteriology, 104: 313-322.
Nellis, D.W., 1994. Seashore plants of South Florida and the Caribbean.
Pineapple Press, Sarasota, FL.
Pattnaik, S., Subramanyam, V.R., Bapaji, M., Kole, C.R. 1997.
Antibacterial and antifungal activity of aromatic constituent of
essential oils. Microbiol., 89: 39-46.
Rabe, T., and Staden, J. V. 1997. Antibacterial activity of South African
plants used for medicinal purpose. Journal of Ehtnopharmacology,
56: 81-87.
Schimdt, E., Jirovetz, L., Buchbauer, G., et al. 2005. Antimicrobial
testing and gas chromatographic analysis of aroma chemicals.
Journal of essential oil bearing plants, 8: 99-106.
Sköld, M., Karlberg, A.T., Matura, M., and Börje, A. 2006. The fragrance
chemical â-caryophyllene-air oxidation and skin sensitization. Food
and Chemical Toxicology, 44: 538-545.
Tepe, B., Donmez, E., Unlu, M., Candan, F., Daferera, D., Vardar-Unlu,
G. 2004. Anti bacterial and anti oxidative activities of the essential
oils and methanol extracts of Salvia cryptantha (Montbret Aucher
ex Benth.) and Salvia multicaulis (Vahl). Food Chemistry, 84: 519-
525.
Teplitski, M., Robinson, J.B., Bauer, W.D. 2000. Plants secrete substances
that mimic bacterial N-acyl homoserine lactose signal activities
and affect population density-dependent behaviors in associated
bacteria. Molecular Plant Microbe Interaction, 13: 637-648.
Trotter, R.T., 1981. Remedios caseros: Mexican American home
remedies and community health problems. Social Science and
Medicine, 15B: 107-114.
Ulubelen, A., Topcu, G., Eris, C., Sönmez, U., Kartal, M., Kurucu, S.
1994. Terpenoids from Salvia sclarea. Phytochemistry, 36: 971-
974.
Viljoen, A., van Vuuren, S., Ernst, E. 2003. Osmitopsis asteriscoides
(Asteraceae) – the antimicrobial activity and essential oil
composition of a Cape-Dutch remedy. Journal of
Ethnopharmacology, 88: 137-143.
Whitehead, N.A., Barnard, A.M., Slater, H., Simpson, N.J., Salmond,
G.P. 2001. Quorum-sensing in Gram negative bacteria. FEMS
Microbiologial Reviews, 25: 365-404.
Woo, W.S., lee, E.B., Han, B.H. 1979. Biological evaluation of Korean
medicinal plants. III. Archives of Pharmacology Research, 2: 127-
131.
Zhang, L.H., Dong, Y.H. 2004. Quorum sensing and signal interference:
diverse implications. Molecular Microbiology, 53: 1563-1571.
Recieved on 16.2.2010 Accepted on 9.10.2010

102 Trends in Biosciences 3 (2): 102-105, 2010 Trends in Biosciences 3 (2), 2010
Molecular Marker Analysis on Genetic Variation in Domesticated Silkworm
K.A. MURUGESH, S. MOHANKUMAR* AND C.A. MAHALINGAM
Department of Sericulture, CPPS, TNAU, Coimbatore 03
*Department of Plant Molecular Biology and Biotechnology, CPMB, TNAU, Coimbatore 03
e-mail: camahalingam@yahoo.com, murugeshka2002@yahoo.co.in
ABSTRACT
Among the primers used for ISSR analyses, the primer ISSR2
and ISSR3 generated highest number of fragments. All the
primers exhibited 100 per cent polymorphism across 30
silkworm races analysed. The similarity coefficients ranged
from 0.33 to 1.00. Of the pairwise combinations, NB7 and
Kollegal Jawan showed the lowest similarity index (0.33),
whereas the highest similarity index was recorded between
C.nichi and P4D3 (1.00), followed by CSR3 and CSR2xCSR4
(0.98). The mean similarity index was 0.68. There was distinct
grouping between the multivoltine and bivoltine races when
grouped with marker generated by ISSR PCR. The 2D diagram
of the PCA analysis of the markers generated by the different
ISSR primers helped to visualize the two major clusters which
included the multivoltines and bivoltines separately. The
grouping of bivoltines in the PCA analysis clearly showed higher
similarity among bivoltines as compared to the multivoltines.
Superiority over the parents (Pure Mysore and CSR2) with
regard to biological parameters was found with F 1
.
Key words
ISSR marker, domesticated silkworm, multivoltines,
bivoltines
The domesticated silkworm, Bombyx mori L. is the wellstudied
lepidopteran species. After the discovery of restriction
endonucleases and the polymerase chain reaction (PCR),
molecular markers were developed and used as powerful tool
in analyzing the phylogeny, evolution, ecology and population
dynamics of insects (Symondson and Liddell, 1996). Recent
advances in silkworm genome provide tools and techniques
which, coupled with conventional breeding will help silkworm
geneticists and breeders to improve strains. A wide array of
DNA marker techniques is available for genetic studies. All
DNA markers reflect differences in DNA sequences. Major
applications of these DNA markers in silkworms include
diversity analysis, mapping genes and marker assisted
selection (Nagaraju and Goldsmith, 2002). Selection of parental
strains for cross-breeding programme based on genetic
distance determined by DNA marker evaluation facilitates the
development of new silkworm races.
MATERIALS AND METHODS
The multivoltine and bivoltine silkworm races used for
the study were given in Table 4, 5. The DNA was extracted
from head and thorax of individual moths and DNA pattern in
the gel was documented using a gel documentation system. A
total of five ISSR primers were used for amplifying the genomic
DNA. The sequence and the details of the primers used are
given in the Table 1. Amplification was done using a PTC
Thermal Cycler programmed for initial denaturation at 94ºC
for 5 min, 40 cycles of 1 min denaturation at 94ºC, 1 min
annealing at respective temperatures and 2 min extension at
72ºC and final extension of 5 min at 72ºC and then at 4ºC till
storage.
The PCR products were electrophoresed in a 4 per cent
denaturing poly acrylamide gel electrophoresis (PAGE) and
resolved by silver staining procedure (Panaud, et al., 1996).
The bands were scored with the presence of bands as (1) and
absence of bands (0) and missing band as (3).
The data obtained by scoring the ISSR profiles of
different primers individually were subjected to cluster
analysis. Similarity matrix was constructed using Jaccard’s
(Jaccard, 1908) coefficient for ISSR. The similarity values were
used for cluster analysis. Sequential agglomerative hierarchical
non-overlapping (SAHN) clustering was done using
unweighted pair group method with arithmetic averages
(UPGMA) method. Data analysis was done using NTSYS pc
version 2.02 (Rohlf, 1998).
Based on molecular diversity, one parent from
multivoltine and another from bivoltine were selected and the
crosses were made. The observations on various biological
parameters and yield related parameters expressed at F 1
generation were recorded and F 1
genetic profile was verified
along with parents using ISSR marker. Analysis of variance of
different observations made on the treatments was performed
and means were compared by the least significant difference
(Gomez and Gomez, 1984).
RESULTS AND DISCUSSION
The results of the ISSR analyses are represented in Table
2, Figs. 3 and 4, and Figs. 1 and 2. All the five ISSR primers used
in the study produced unambiguous markers. Among the
primers used for ISSR analysis, the primer ISSR2 generated
highest number of fragments (Fig. 1). All the primers exhibited
100 per cent polymorphism across 30 silkworm races analyzed.
The similarity index values obtained for each pairwise
comparison among the 30 races is given in the Table 2. The
similarity coefficients ranged from 0.33 to 1.00. Of the pairwise
combinations, NB7 and Kollegal Jawan showed the lowest
similarity index (0.33), where as the highest similarity index was
recorded between C. nichi and P4D3 (1.00), followed by CSR3
and CSR2xCSR4 (0.98). The mean similarity index was 0.68.

MURUGESH et al., Molecular Marker Analysis on Genetic Variation in Domesticated Silkworm 103
Table 1.
Primer
List of ISSR primers used for genetic diversity
analysis
Sequence
ISSR01 (GA) 9-A
ISSR02 (GA) 9-C
ISSR03 (GA) 9-T
ISSR04 CCCGGATCC(GA) 9
ISSR05 CCCGGATCC(CT) 9
The different races were broadly grouped into two clusters
namely cluster A (18 – bivoltines) and cluster B (12 – multivoltines).
There was distinct grouping between the multivoltine and
bivoltine races when grouped with marker generated by ISSR
PCR. Cluster A is further divided into two broad clusters Aa
(NB18 and CSR4x CSR2) and Ab with other 16 bivoltines. Among
the subcluster Ab, B1 stood alone from the rest and CSR2xCSR4
and CSR3 had the maximum similarity values.
Multivoltines in cluster B were broadly grouped into
two clusters Bb (Kolar gold, PA12 and Pure Mysore), and all
the other multivoltines grouped in the other cluster Ba. Cluster
Ba was further divided into two subclusters and C. nichi and
P4D3 showed the maximum similarity index values (Fig. 1).
The 2D diagram of the PCA analysis of the markers generated
by the different ISSR primers also indicated similar results
and helped to visualize the two major clusters which included
the multi and bivoltines separately. The grouping of bivoltines
in the PCA analysis clearly showed higher similarity among
bivoltines as compared to the multivoltines (Fig. 2).
CSR4 x CSR2 was distinctly different from CSR2 among
the bivoltines even though CSR2 was one of the parents in
the crossbreed. This indicates the genetic distinctness of
crossbreeds. Among multivoltines, Pure Mysore and Hosa
Mysore had lower genetic similarity. It might be because of
Hosa Mysore derived from Pure Mysore. The grouping of
Table 2.
Table 3.
Similarity index values among 30 silkworm races using 5 inter-simple sequence repeats
M1 M2 M3 M4 M5 M6 M7 M8 M9 M10 M11 M12 B1 B2 B3 B4 B5 B6 B7 B8 B9 B10 B11 B12 B13 B14 B15 B16 B17 B18
M1 1.00
M2 0.88 1.00
M3 0.93 0.86 1.00
M4 0.92 0.93 0.93 1.00
M5 0.88 0.92 0.89 0.96 1.00
M6 0.89 0.87 0.96 0.91 0.93 1.00
M7 0.83 0.94 0.83 0.90 0.92 0.88 1.00
M8 0.87 0.90 0.87 0.92 0.93 0.91 0.96 1.00
M9 0.85 0.91 0.86 0.88 0.89 0.87 0.97 0.96 1.00
M10 0.87 0.90 0.87 0.92 0.92 0.91 0.96 1.00 0.96 1.00
M11 0.82 0.89 0.86 0.85 0.86 0.87 0.94 0.93 0.97 0.93 1.00
M12 0.86 0.85 0.90 0.89 0.90 0.94 0.90 0.94 0.90 0.94 0.92 1.00
B1 0.40 0.39 0.40 0.38 0.36 0.39 0.39 0.39 0.40 0.39 0.41 0.41 1.00
B2 0.42 0.40 0.39 0.39 0.36 0.36 0.39 0.39 0.40 0.39 0.39 0.37 0.87 1.00
B3 0.39 0.40 0.37 0.38 0.37 0.37 0.39 0.38 0.38 0.38 0.38 0.39 0.89 0.92 1.00
B4 0.38 0.34 0.36 0.35 0.37 0.36 0.37 0.38 0.38 0.38 0.37 0.38 0.85 0.89 0.90 1.00
B5 0.38 0.35 0.35 0.35 0.36 0.36 0.36 0.36 0.37 0.36 0.38 0.37 0.88 0.88 0.89 0.92 1.00
B6 0.34 0.33 0.34 0.33 0.34 0.35 0.35 0.35 0.36 0.35 0.37 0.36 0.91 0.85 0.90 0.89 0.93 1.00
B7 0.38 0.35 0.37 0.38 0.38 0.36 0.38 0.39 0.39 0.39 0.38 0.38 0.83 0.90 0.89 0.88 0.88 0.91 1.00
B8 0.35 0.37 0.34 0.37 0.38 0.36 0.40 0.38 0.38 0.38 0.37 0.38 0.85 0.86 0.93 0.90 0.90 0.93 0.92 1.00
B9 0.37 0.33 0.36 0.34 0.34 0.35 0.36 0.35 0.36 0.35 0.36 0.35 0.87 0.90 0.88 0.91 0.91 0.95 0.93 0.91 1.00
B10 0.38 0.34 0.36 0.35 0.37 0.36 0.37 0.38 0.38 0.38 0.38 0.40 0.85 0.86 0.87 0.93 0.93 0.93 0.88 0.90 0.91 1.00
B11 0.37 0.36 0.36 0.37 0.35 0.33 0.37 0.36 0.38 0.36 0.38 0.36 0.88 0.92 0.90 0.90 0.90 0.89 0.92 0.87 0.88 0.87 1.00
B12 0.39 0.41 0.36 0.39 0.38 0.35 0.40 0.38 0.39 0.38 0.39 0.37 0.84 0.82 0.86 0.83 0.88 0.85 0.83 0.85 0.81 0.83 0.85 1.00
B13 0.36 0.34 0.35 0.33 0.34 0.36 0.36 0.36 0.37 0.36 0.38 0.37 0.91 0.89 0.90 0.93 0.96 0.96 0.88 0.90 0.95 0.93 0.90 0.85 1.00
B14 0.38 0.37 0.36 0.35 0.35 0.34 0.38 0.37 0.39 0.37 0.40 0.38 0.90 0.90 0.92 0.92 0.95 0.91 0.87 0.88 0.90 0.92 0.92 0.90 0.95 1.00
B15 0.34 0.33 0.34 0.33 0.34 0.35 0.35 0.35 0.36 0.35 0.37 0.36 0.91 0.85 0.90 0.89 0.93 1.00 0.91 0.93 0.95 0.93 0.89 0.85 0.96 0.91 1.00
B16 0.35 0.33 0.36 0.34 0.33 0.34 0.35 0.34 0.36 0.34 0.36 0.36 0.90 0.87 0.88 0.88 0.91 0.98 0.93 0.91 0.96 0.91 0.91 0.84 0.95 0.90 0.98 1.00
B17 0.39 0.40 0.37 0.38 0.39 0.37 0.42 0.42 0.43 0.42 0.42 0.40 0.85 0.83 0.88 0.87 0.90 0.90 0.85 0.87 0.85 0.90 0.87 0.92 0.90 0.92 0.90 0.88 1.00
B18 0.37 0.36 0.37 0.35 0.36 0.38 0.36 0.36 0.37 0.36 0.38 0.38 0.38 0.90 0.83 0.88 0.88 0.95 0.94 0.86 0.88 0.89 0.88 0.88 0.80 0.80 0.81 0.88 0.92 1.00
B1 CSR2 B6 NB7 B11 CSR4 B16 CSR3 M1 Pure Mysore M6 Kolar Gold M11 CB5
B2 SH6 B7 P5 B12 NB18 B17 CSR4xCSR2 M2 Kollegal jawan M7 Nistari M12 Hosa Mysore
B3 CSR18 B8 CSR6 B13 PAM101 B18 CA2 M3 PA12 M8 C.nichi
B4 CC1 B9 PAM111 B14 YS3 M4 Sarupat M9 Mysore Princess
B5 CSR19 B10 NB4D2 B15 CSR2xCSR4 M5 Tamil Nadu white M10 P4D3
Comparison of F along with its parents, PM and CSR2 for biological and yield related parameters
Treatment Larval weight
(g)
Cocoon weight
(g)
Pupal weight
(g)
Shell weight
(g)
Hatching
(%)
ERR
(%)
Single filament
length (m)
Denier Amylase content
(µg /100µl/h )
PM 0.941 ± 0.03 0.526 ±0.023 0.406 ±0. 008 0.083 ± 0.003 87.27±1.7 94.99±0.98 306.58 ±4.3 1.04±0.2 1507.07±0.986
CSR2 3.088±0.09 2.491 ±0.004 1.860±0.007 0.556±0.05 91.90±0.94 72.43±0.58 1165.02 ±6.5 3.13±0.03 135.43±1.1091
PMXCSR2 3.055± 0.039 2.5041±0.0039 1.879±0.0036 0.563±0.0032 91.90±0.093 93.60±0.58 1246.05±4.37 3.0320.0032 1496.09±3.779
SEd 0.0803 0.0196 0.0091 0.0051 1.7712 1.0475 13.7699 0.0710 8.235
CD (0.05%) 0.1648 0.0403 0.0186 0.0105 3.8591 2.5633 30.0023 0.1547 20.151

104 Trends in Biosciences 3 (2), 2010
Table 4.
Races
Kolar Gold
Kollegal Jawan
C.nichi
Sarupat
P4D3
PA12
Tamil Nadu White
Hosa Mysore
Mysore Princess
CB5
Nistari
Pure Mysore
Multivoltine silkworm races
Parentage / Source
(PM x NN6D) X S.H
(PM x NN6D) X S.H
J1 X C4
CSGRC, Hosur
CSGRC, Hosur
CSGRC, Hosur
PM X C. nichi
Ae 4 X Pure Mysore
(PM x NN6D) X S.H
CSGRC, Hosur
CSGRC, Hosur
CSGRC, Hosur
bivoltines in the PCA analysis clearly showed higher similarity
among bivoltines as compared to the multivoltines. These
results showed that ISSR markers are useful for fingerprinting
of silkworm races. Although most ISSR loci are dominant rather
than co-dominant, ISSR markers offer several advantages for
genotyping, the major one being the rapid production of a
large number of markers in a cost-effective manner (Nagaraju
and Goldsmith, 2002). Because of these advantages, the ISSR
technique has potential use in silkworm breeding, germplasm
evaluation and genetic mapping. Exploitation of heterosis
played a vital role in increasing silk production to a great
extent (Thangavelu, 1997). In view of this, it is essential to
gather a thorough knowledge on the pedigree of the pure
races in order to determine their genetic background and to
utilize them appropriately in cross breeding programmes to
maximize heterosis (Mano, et al., 1992).
Performance of F 1
hybrid depends upon proper selection
of suitable parents and the nature of genetic divergence
between them. The races Pure Mysore (PM) and CSR2 were
selected as parents and crossed to obtain the F 1
progeny.
Table 5.
Bivoltine silkworm races
Races
Parentage / Source
NB4D2 (Kokko x Seihaku) x (N124 x C 124)
SH6
CSGRC, Hosur
YS3
CSGRC, Hosur
CSR2
Shunrei x Shogetsu
CSR3
BN18 XBCS25 (out crossed with CC1)
CSR4
BN18 x BCS25 (out crossed with NB4D2)
CSR6
Shunrei x Shogetsu
CSR18
B201 x BCS12
CSR19
B201 x BCS12
NB7
Kinshu x Showa
NB18 (Kokko x Seihaku) x (N124 x C 124)
CC1
(KA x NB1) x (NB7 x SPC1)
CA2
(NB7 xSPC2)
PAM101
CSGRC, Hosur
PAM111
CSGRC, Hosur
P5
CSGRC, Hosur
CSR2X4
CSR2X CSR4
CSR4X2
CSR 4X CSR2
Among multivoltines, Pure Mysore, has long history of
adaptability to various climatic conditions in India. Similarly
among bivoltines, CSR2 showed distinct difference from other
bivoltine races as per ISSR analysis was also selected. The
biological and yield related parameters in F 1
and its parents
are presented in Table 3. The larval weight of PM x CSR2 was
3.055 g, whereas PM and CSR2 recorded 0.941 g and 3.088 g,
respectively (Table 3). Cocoon weight of F 1
was higher (2.504
g) than the better parent CSR2 (2.491 g). Similar pattern was
exhibited in shell weight as in cocoon weight. Hatching per
cent of eggs were similar in parents and F 1
. Effective rate of
rearing in F 1
(93.60%) was closer to Pure Mysore (94.99%).
Heterosis was observed in single filament length in F 1.
The
single filament length of F 1
was 1246.05 m, as compared to its
parents PM (306.58 m) and CSR2 (1165 m). PM x CSR2 hybrid
recorded intermediary denier value of 3.032 as compared to
the parents CSR2 (3.13) and Pure Mysore (1.04). The genetic
Fig. 1.
Dendrogram based on Jaccard's similarity index showing
relationship among 12 multivotine and 18 bivoltine races
of silkworm by Unweighted Pair-Group Method with
Arithmatic mean
Fig. 2. Pattern of relationship among 12 multivotine 18
bivoltine races of silkworm by PCA analysis of ISSR
data

MURUGESH et al., Molecular Marker Analysis on Genetic Variation in Domesticated Silkworm 105
Fig. 3.
ISSR profile generated in 12 multivoltine and 18 bivoltine silkworm races using primer ISSR2
LITERATURE CITED
Fig. 4. Confirmation of F1 (PMxCSR2) using ISSR markers
pattern of F1 was verified using ISSR3 and ISSR4 (Plate 2).
Hybrid vigour was noticed in the present study as reported
by Ravindra Singh, et al., 2001.
Gomez, K. A. and Gomez, A. A. 1984. Statistical Procedure for
Agricultural Research, John Wiley and Sons, New York, pp.164.
Jaccard, P. 1908. Nouvelles recherches sur la distribution florale. Bull.
Soc. Vaud. Sci. Nat., 44 : 223-270.
Mano, Y., Nirmal Kumar, S. Basavaraja, H.K.., Mal Reddy, N. and
Datta, R.K. 1992. An index for multiple trait selection for silk
yield improvement in Bombyx mori L., In: Proc. Natl. Conf. Mulb.
Ser. Res., Central Sericultural Research and Training Institute,
Mysore. pp. 116.
Nagaraju, J. and Goldsmith, M. R. 2002. Silkworm genomics - progress
and prospects. Current Science, 83 : 415-425.
Panaud, O., Chen, X.L. and McCouch, S.R. 1996. Development of
microsatellite markers and characterization of simple sequence
length polymorphism (SSLP) in rice (Oryza sativa L.). Mol. Gen.
Genet., 252 : 597-607.
Ravindhra Singh, D., Rao, R., Premalatha, V., Kariappa, B. K., Jayaswal,
K. P. and Datta, R. K. 2001. Evaluation of combining ability in
hybrids between low, medium and high cocoon weight polyvoltine
and bivoltine breeds of silkworm Bombyx mori L. Sericologia, 41
(1) : 57-64.
Rohlf, F.J. 1998. NTSYS-PC: Numerical taxonomy and multivariate
analysis system version 2.0. Department of Ecology and Evolution.
State University of New York. pp.11.
Symondson, W. O. C. and Liddell, J. E. 1996. The Ecology of Agricultural
Pests: Biochemical Approaches, Chapman & Hall, London, pp.218.
Thangavelu, K.1997. Silkworm Breeding in India - An overview. Indian
Silk, 37 (2): 5-13.
Recieved on 25.04.2010 Accepted on 9.10.2010

106 Trends in Biosciences 3 (2): 106-109, 2010 Trends in Biosciences 3 (2), 2010
Studies on Molecular Diversity in Maize Inbreds Using SSR Markers
ASTHA GUPTA* AND A.K. SINGH
Banaras Hindu University, Institute of Agricultural Sciences, Department of Genetics and Plant Breeding,
Varanasi 221 005
e-mail: sucessfulastha33@gmail.com
ABSTRACT
This study was conducted to determine molecular diversity
among twenty maize genotypes using ten simple sequence
repeat (SSR) primer sets. The number of alleles per marker
varied from two to four with average of 2.5 alleles. Bnlg1922
detected maximum of four alleles, while five loci (bnlg1866,
mmc0063, bnlg1046, bnlg1070 and umc1310) revealed three
alleles, three loci (bnlg1523, bnlg1126 and umc1414) detected
two alleles. One primer out of ten viz. phi041 studied failed to
amplify any band and showed monomorphic pattern. The PIC
values of the SSR loci varied from 0.43 (umc1414) to 0.91
(bnlg1070) with mean of 0.70. SSR markers being co-dominant
in nature identified heterozygotes among the twenty inbreds
lines. Out of ten markers, one marker bnlg1523 did not show
any heterozygote, while others detected one to nine
heterozygotes out of twenty inbred lines. The pair wise
similarity was calculated by Jacquard’s similarity coefficients,
which ranged from 0.12 to 0.73 with an average similarity of
0.42.The minimum similarity (0.12) was found between two
pairs, HUZM-356 with HUZM-47 and HUZM-53 with HUZM-
147 which are more diverse. The less diversity and maximum
similarity (0.73) was found between HUZM-147 with HUZM-36
genotype.
Key words
Zea mays, molecular diversity, SSR.
Molecular analysis identified one form of teosinte (Zea
mays ssp. parviglumis) as the progenitor of maize (Doebley,
2004). Maize has 10 chromosomes (2 n=2 x=20).The total
genetic length of these chromosomes is roughly 1500cm. For
improvement of germplasm, it is important to know the extent
of genetic variability present in the germplasm. At present
SSRs are the most promising molecular markers which are
able to identify or differentiate genotypes within a species
(Shah, et al., 2009), SSRs are ubiquitously interspersed in
eukaryotic genomes and can find applications as highly
variable and multiallelic PCR based genetic markers (Brown
and Kresovich, 1996). The application of SSR techniques to
finger print plant species was first reported by Akkaya, et al.,
1992. The present study was carried out in order to molecular
diversity in maize inbreds and their utilization in future
breeding programme.
MATERIALS AND METHODS
In the present investigation the experimental material
used comprised of twenty advance inbred lines of maize (Zea
mays L.) obtained from the All India Co-ordinated Maize
Improvement programme, Department of Genetics and Plant
Breeding, Institute of Agricultural Sciences, Banaras Hindu
University, Varanasi. The genotypes used are listed in the
Table 1.
DNA was isolated from young leaves by Kit method. A
protocol from Chromous Biotech (Cat#:rkt 08A) India Limited
was followed. 100 mg young leaves were taken and washed
them in distilled water, crushed in pestle and mortar with 750
micro litre suspension buffer. 250 micro litre more suspension
buffer was mixed. 750 micro litre final volumes in vial was
taken. One ml lysis buffer was mixed and stored at 65 degree
for 15 min. It was cooled at room temperature. Spun at 10000g
for 3 minutes, supernatant was transferred in fresh vial and
pellet discarded. Now 600 microlitre supernatant was
transferred in to the spin tube. Then spin at 10000g for 3 min
and discarded the material from collection tube and repeated.
Empty column was spun with the collection tube at 10000g for
3 minutes. Spun column was placed in a fresh vial and add 50
microlitre elution buffer (already stored at 65 degree) in to the
spin column. The vial along with the spin column at 65 degree
was kept for 1 minute. After that it was again spun at 10000 g
for 3 minutes and repeated previous two steps. The final
volume of DNA was 100 microlitres. Now DNA sample were
stored at 4 0 C.
All PCR reactions were carried out in 20 µl reaction
containing 2 µl template DNA , 5.0 µl of each primer, 1.2µl of
each dATP, dGTP, dCTP, dTTP, 2.0 µl of 10 X PCR buffer , 0.2
µl of Taq DNA polymerase and 9.6 µl of ddH 2
O. Amplification
conditions were: an initial denaturation step of 5 min at 94°C,
followed by 25-35 cycles each consisting of a denaturation
step of 1 min at 94°C, annealing temperature was variable
according to primer .It is ~ 5 0 C below T m
of primers and an
extension step of 2 min at 72°C. The last cycle was followed
by 10 min extension at 72°C. (Shah, et al., 2009).
All amplification reactions were performed using PCR
system programmable thermocycler. The amplification
products were electrophoresed on 1.5% agarose gel, and
visualized by staining with ethidium bromide under ultraviolet
(U.V) light and photographed using gel documentation
system.
For statistical analysis, every band was considered as a
single locus/allele. The loci were scored as present (1) or absent
(0).Bi-variate 1-0 data matrix was generated. Mean PIC value
was calculated based on PCR values obtained across various

GUPTA and SINGH, Studies on Molecular Diversity in Maize Inbreds Using SSR Markers 107
SSR loci. The PIC values, ranging from ‘0’ (monomorphic) to
‘1’ (very highly discriminative, with many alleles in equal
frequencies) provide an estimate of the discriminatory power
of a marker by taking into account not only the number of
alleles at a locus, but also the relative frequencies of those
alleles in the genotypes under study. UPGMA (Unweighted
Paired Group Method using Arithmetic averages) method and
the wards’ method are the most commonly used methods suited
for various applications. The pair wise similarity was
calculated by Jaccard’s similarity coefficients.
RESULTS AND DISCUSSION
Ten SSR primers identified a total of twenty five alleles
among twenty maize inbred lines. One primer out of ten viz.,
phi041 studied failed to amplify any band and showed
monomorphic pattern. The number of alleles per marker varied
from two to four with average of 2.5 alleles. Bnlg1922 detected
maximum of four alleles, while five loci (bnlg1866, mmc0063,
bnlg1046, bnlg1070 and umc1310 ) revealed three alleles, three
loci (bnlg1523, bnlg1126 and umc1414 ) detected two alleles.
The PIC values of the SSR loci varied from 0.43 (umc1414) to
0.91 (bnlg1070) with mean of 0.70. Majority of primers
(bnlg1070, bnlg1523, mmc 0063, bnlg1126, bnlg1046, bnlg1866,
bnlg1922, umc1310) gave rise to very high PIC values (more
than 0.7), while umc1414, give low PIC value (Table 2). SSR
markers being co-dominant in nature identified heterozygotes
among the lines. Out of ten markers investigated, one marker
bnlg1523 did not show any heterozygotes, while others
detected one to nine heterozygotes out of twenty inbred
lines. Total 30 heterozygotes out of twenty inbred lines
investigated with an average of 3.0 heterozygotes per marker.
The pair wise genetic similarity was calculated by Jaccard’s
similarity coefficients, which ranged from 0.12 to 0.73 with an
average similarity of 0.42. The minimum genetic similarity (0.12)
was found between two pairs, HUZM 356 (12) with HUZM
47(2) and HUZM 53 (20) with HUZM 147 (4) followed by
HUZM 356 (12) with HUZM 36 (1). The maximum similarity
(0.73) was found between HUZM 147 (4) with HUZM 36 (1)
and followed by HUZM 53 (20) with HKI 1344 (15), V 994-
-27 (19) with HUZM 655 (13) and HUZM 350-1 (11) with HUZM
47(2) shows 0.71 similarity. Agglomerative hierarchical
Table 1.
List of inbred lines used in experiment
S. No. Inbred lines Source
1. HUZM 36 PI03011F2-3-5-6-1-BBB-B Bulk
2. HUZM 47 P502C2-185-3-4-1-3-B-B-B
3. HUZM 88 HUM 242(Local)X Suwan 1F2
4. HUZM 147 PHS 4705(W)
5. HUZM 175-2 BIO 9681
6. HUZM 211-1 R 9702
7. HUZM 246 BH 3447
8. HUZM 253-1 HKH 1211(Y)
9. HUZM 253-2 HKH 1211(Y)
10. HUZM 329 VIPL 1806
11. HUZM 350-1 XP 0105
12. HUZM 356 L 134
13. HUZM 655 JH 31050
14. HKI 193-1 Karnal
15. HKI 1344 Karnal
16. HUZM 343 VC2 (Jaunpur local) X Dewaki F2
17. HUZM 368 Bio 9681XVCI
18. V 994- -14 V 994
19. V 994- -27 V 994
20. HUZM 53 1S02X1381WA
classification based on Jaccard’s similarity coefficient put the
twenty lines in nine main clusters. Cluster I and cluster II
represents the biggest cluster with 6 genotypes, followed by
cluster IV, represents two genotypes HUZM 88 and HUZM
356. Cluster III, V, VI, VII, VIII and IX are monogenotypic with
genotype HUZM 175-2, V 994- -27, HUZM 655, V 994- -14,
HKI 1344 and HUZM 53 respectively. Cluster I is subdividing
in to three clusters like cluster Ia had two genotypes HUZM
147, HUZM 36, cluster Ib with HUZM 253-1, HUZM 368
genotypes and cluster Ic had HUZM 211-1 and 193-1
genotypes, respectively. Similarly cluster II also subdivided
into IIa, shows HUZM 47 and HUZM 350-1 genotype, IIb
with HUZM 253-2 and HUZM 343, IIc with HUZM 329 and
HUZM 246 genotype respectively.
The average number of alleles (2.5) detected per locus
in the study was lower than the earlier reports of Warburton,
et al., 2002 and Patto, et al., 2004 who reported an average of
4.9 and 5.3 alleles using 85 and 80 SSR loci, respectively.
However, the estimated value of 2.5 is close to the findings of
Bantte and Prasanna, 2003 and Legesse, et al., 2007 who
recorded 3.25 and 3.85 alleles using 36 and 27 polymorphic
Table 2.
Bin location, repeat type, allele number and PIC values of SSR loci.
S.No. SSR Locus Bin location Repeat No. of Alleles PIC No. of Heterozygotes No. of polymorphic band
1. bnlg1866 1.03 (AG)11 3 0.83 2 3
2. mmc0063 2.00 (CA)16 (TA)6 (CA)2 3 0.87 4 3
3. bnlg1523 3.03 AG(17) 2 0.83 0 2
4. bnlg1126 4.03 AG(20) 2 0.83 6 1
5. bnlg1046 5.03 AG(39) 3 0.84 1 3
6. bnlg1922 6.05 (AG)17 4 0.76 9 3
7. bnlg1070 7.03 AG(15) 3 0.91 1 3
8. umc1414 8.01 (GCTA)4 2 0.43 2 2
9. umc1310 9.06 (GCG)5 3 0.71 5 3
10. phi041* 10.00 AGCC 0 0.00 0 0
Total 25 - 30 -
Mean 2.5 0.70 3.0 -
PIC= Polymorphism information content, *= not used in the calculation

108 Trends in Biosciences 3 (2), 2010
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 M
(Where, 1=HUZM 36, 2= HUZM 47, 3= HUZM 88, 4= HUZM 147, 5= HUZM 175-2, 6= HUZM 211-1, 7= HUZM 211-1,
8= HUZM 253-1, 9= HUZM 253-2, 10= HUZM 329, 11= HUZM 350-1, 12= HUZM 356, 13= HUZM 655, 14=HKI 193-1 ,
15= HKI 1344, 16= HKI 1344,17= HUZM 368, 18= V 994-14, 19= V 994-27, 20= HUZM 53.)
Fig. 1. PCR amplification of twenty maize genotype using primer bnlg1922
SSR loci, respectively. Detecting the lower number of alleles
per locus may be attributed towards the use of screening
technique followed in different studies.
Di-nucleotide SSR loci, bnlg1922 identified the largest
number of allele four with the PIC values of 0.76. Smith, et al.,
1997 have reported that di-repeat SSR loci reveal higher
number of alleles, but sometime they also produce additional
stutter bands. This probably may be one of the causes for the
high allele numbers and PIC values. However, all di-nucleotide
repeats like bnlg1523, bnlg1866, mmc0063, bnlg1046, bnlg1070,
bnlg1126 and umc1414 did not give more than 3 alleles. This is
in contrary with the observations made by Enoki, et al., 2002
and Legesse, et al., 2007. The mean PIC value (0.70) determined
in the study is higher than findings of Xu, et al., 2004 and
Legesse, et al., 2007 who reported average PIC values of 0.62
and 0.58, respectively. In the current study, some inbred lines
revealed more than one band during amplification, which has
been interpreted as heterozygotes as the SSR markers are codominant
in nature. Molecular analysis revealed a very high
level of diversity among the lines. This clearly indicates high
genetic variability among the lines. High variability in maize
inbred lines has also reported by Legesse, et al., 2007. The
dendogram constructed using the UPGMA clustering
algorithm fit well with the similarity matrix with high cophenetic
correlation. The pair wise genetic similarity was calculated by
Jaccard’s coefficients, which ranged from 0.12 to 0.73 with an
Table 3.
Estimation of Jaccard’s similarity coefficient among twenty maize genotypes
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
1 1.00
2 0.33 1.00
3 0.24 0.23 1.00
4 0.73 0.45 0.34 1.00
5 0.43 0.21 0.23 0.56 1.00
6 0.22 0.37 0.34 0.47 0.33 1.00
7 0.26 0.16 0.42 0.45 0.56 0.34 1.00
8 0.34 0.45 0.44 0.34 0.45 0.56 0.43 1.00
9 0.38 0.67 0.32 0.24 0.62 0.33 0.32 0.41 1.00
10 0.23 0.23 0.21 0.48 0.34 0.45 0.22 0.34 0.23 1.00
11 0.14 0.71 0.34 0.23 0.56 0.71 0.23 0.23 0.45 0.42 1.00
12 0.13 0.12 0.39 0.29 0.67 0.23 0.43 0.56 0.46 0.56 0.56 1.00
13 0.32 0.34 0.63 0.34 0.45 0.40 0.22 0.21 0.18 0.23 0.34 0.19 1.00
14 0.45 0.67 0.43 0.45 0.34 0.22 0.45 0.32 0.41 0.34 0.16 0.33 0.45 1.00
15 0.23 0.43 0.27 0.56 0.45 0.39 0.46 0.45 0.25 0.15 0.29 0.32 0.53 0.24 1.00
16 0.58 0.65 0.16 0.51 0.56 0.23 0.35 0.43 0.37 0.26 0.41 0.27 0.58 0.44 0.37 1.00
17 0.39 0.43 0.19 0.23 0.14 0.56 0.65 0.54 0.45 0.26 0.18 0.24 0.17 0.47 0.32 0.43 1.00
18 0.33 0.42 0.33 0.16 0.54 0.29 0.62 0.17 0.19 0.58 0.34 0.37 0.56 0.37 0.41 0.45 0.21 1.00
19 0.17 0.56 0.45 0.45 0.45 0.37 0.17 0.14 0.26 0.42 0.43 0.33 0.71 0.61 0.22 0.23 0.38 0.29 1.00
20 0.16 0.23 0.42 0.12 0.18 0.35 0.58 0.26 0.44 0.57 0.45 0.23 0.23 0.38 0.71 0.36 0.53 0.47 0.45 1.00

GUPTA and SINGH, Studies on Molecular Diversity in Maize Inbreds Using SSR Markers 109
average similarity of 0.42. The minimum genetic similarity (0.12)
was found between two pairs, HUZM 356 with HUZM 47 and
HUZM 53 with HUZM 147 followed by HUZM 356 with HUZM
36. The maximum similarity (0.73) was found between HUZM
147 with HUZM 36 with HUZM 47 shows 0.71 similarity.
Cluster I and cluster II shows the biggest cluster both with 6
genotypes, followed by cluster IV, represents two genotypes
HUZM 88 and HUZM 356. Cluster III, V, VI, VII, VIII and IX
are monogenotypic
Molecular analysis revealed a very high level of diversity
among the lines, which ranged between 0.12 and 0.73 with an
average of 0.42. This clearly indicates high genetic variability
present among the lines. The present study indicates that the
twenty inbred lines were grouped into nine clusters in which
cluster I and cluster II are the large cluster both contain six
genotypes. Genotype HUZM 147, HUZM 36, HUZM 253-1,
HUZM 368, HUZM 211-1 and HKI 193-1 are grouped in same
cluster I and HUZM 47, HUZM 350-1, HUZM 253-2, HUZM
343, HUZM 329, HUZM 246 in cluster II respectively, followed
by cluster IV, had two genotype (HUZM 88, HUZM 356) while
Cluster III (HUZM 175-2) , V (V 994- -27), VI(HUZM 655), VII
(V 994- -14), VIII (HKI 1344), and IX (HUZM 53) are
monogenotypic at molecular level.The minimum similarity
(0.12) was found between two pairs, HUZM 356 with HUZM
47 and HUZM 53 with HUZM 147 which are more diverse.
The less diversity and maximum similarity (0.73) was found
between HUZM 147 with HUZM 36 genotype.
LITERATURE CITED
Akkaya, M.S., Bhagual, A.A. duel Cregan, P.B. 1992. Longth
Polymonphisms of simple sequence repeat DNA in soybean.
Genetics, 132: 1131-1139.
Bantte, K. and Prasanna, B.M. 2003. Simple sequences repeat
polymorphism in quality protein maize (QTL) lines. Euphytica,
129:337-344.
Brown, S.M. and Kresovich, S. 1996. Molecular characterization for
plant genetic resources conservation. In: genome Mapping in Plants
(ed. A.H. Paterson, R.G. Landes), New York, pp.85-93.
Doebley, J. 2004. The genetics of maize evolution. Annu. Rev. Genet.,
38:37-59,
Enoki, H., Sato, H. and Koinuma, K. 2002. SSR analysis of genetic
diversity among maize inbred lines adapted to cold regions of Japan.
Theor. Appl. Genet., 104:1270-1278.
Legesse, B.W., Myburg, A.A. Pixley, K.V. and Botha, A.M. 2007. Genetic
diversity of African Maize inbred lines revealed by SSR markers.
Hereditas, 144:10-17.
Patto, M.C.V., Satovic, Z., Pego, S. and Feveriero, P. 2004. Assessing
the genetic diversity of portugese maize germplasm using
microsatellite markers. Euphytica, 137(1):63-72.
Shah Zamarud, Iqbal Munir, Shahid Ali, Arshad Iqbal, Mumlaz, Rabnawaz,
Swat, Z.A. 2009. Genetic diversity of Pakistani maize genotypes
using chromosomes specificsimple sequence repeat (SSR) primer
sets, African Journal of Biotechnology, 8(3): 375-377.
Smith, J.S.C., Chin, E.C.L., Shu, H., Smith, O.S., Wall, S.J., Senior,
M.L., Mitcell, S.E., Kresovich, S. and Ziegle, J. 1997. An evaluation
of the utility of SSR loci as molecular markers in maize (Zea mays
L.): comparison with data from RFLPs and pedigree. Theor. Appl.
Genet., 95:163-173.
Warburton, M.L., Xianchun, X., Crossa, J. 2002. Genetic
characterization of CIMMYT inbred maize lines and open pollinated
populations using large scale fingerprinting methods. Crop Sci., 42:
1832-1840.
Xu, S.X., Liu, J. and Liu, G.S. 2004. The use of SSRs for predicting the
hybrid yield and yield heterosis in 15 key inbred lines of Chinese
maize. Hereditas., 141:207-215.
Recieved on 25.10.2010 Accepted on 23.11.2010

110 Trends in Biosciences 3 (2): 110-111, 2010 Trends in Biosciences 3 (2), 2010
Heterosis for Grain Yield and Quality Traits in Durum Wheat (Triticum durum
Desf.) Under Late Sown Condition
R.A. GAMI, C.J. TANK, S.S. PATEL, S.V. BURUNGALE AND C.G. PATEL
Department of Genetics and Plant Breeding, C.P. College of Agriculture, S.D. Agriculture University,
Sardarkrushinagar 385 506 (Gujarat)
e-mail: ramangami@gmail.com
ABSTRACT
Twenty eight crosses combinations were developed by 8 × 8
diallel analysis during rabi 2007-08 and evaluated 28 F 1
’s and 8
parents during rabi 2008-09 under late sown condition. Seven
crosses out of 28 crosses manifested significant positive
heterobeltiosis for grain yield per plant. The range of
heterobeltiosis for grain yield was wide (22.30 % to 82.54 %).
The hybrid GW 02-51 × VDW 99-176 (82.54 %) expressed the
highest heterobeltiosis. The cross combination GW 1139 × GW
1240 expressed highest level of heterosis over better parent
(10.78%) for grain protein.
Key words
Helerosis, wheat, yield, late sown
Heterosis has been successfully exploited both in crosspollinated
and self-pollinated crops. Exploitation of hybrid
vigour through CHA and CGMS based sterility has been
proposed proposition in aestivum wheat for breaking yield
plateau (Mahajan, et al., 1999). One of the aim of present
study was to estimate hybrid vigour to know the genetic makeup
of parents and to create Mendelian variability through
segregation or recombination in advanced generations of the
crosses. The measurement of heterosis over mid parent value
has relatively limited importance and is of more academic
interest than that of practical utility. In practical plant breeding,
the heterosis measured over better parent and popular cultivar
is more realistic and is of more practical importance.
MATERIALS AND METHODS
The eight diverse parental genotypes of durum wheat
and their twenty-eight F1’s (excluding reciprocals). The
parental genotypes viz., GW 02-51, VDW 99-176, RD 1009,
GW1139, GW1239, GW1189, BAWAJI and GW 1240 were
Table 1.
Heterosis in percentage in F 1
hybrid over better parent [BP] for yield and its components in durum wheat under late
sown condition
Sr.
No
Hybrids Grain yield
per plant
(g)
Plant
height
(cm)
No .of
effective
tillers/plant
Length of
main spike
(cm)
Spikelets
per
spike
Grains
per
spike
1000-grain
weight
(g)
Harvest
index
(%)
Grain
protein
(%)
Hectoliter
weight
(g)
1. GW 02-51 X RD 1009 38.47** 12.47** 21.13* 12.14* -6.64 0.25 -18.05** 52.09** 3.05 -7.23**
2. GW 02-51 X VDW 99-176 82.54** 10.83** 14.56 1.54 -13.75** 8.07** 5.36** 114.06** 2.52 -2.39
3. GW 02-51 X GW 1139 7.02 3.46 20.19* 8.57 -14.52** 7.87** -1.78 11.30 5.8 -2.10
4. GW 02-51 X GW 1239 33.69** -1.44 -5.36 12.38* 0.69 4.59 -11.18** 137.12** -0.81 -10.09**
5. GW 02-51 X GW 1189 42.88** -4.12 -4.01 5.86 -6.25 13.24** -30.97** -29.56** -7.44* -1.08
6. GW 02-51 X BAWAJI -26.2** 14.63** -20.52** -1.70 -8.21 6.80* 19.85** 13.86* 4.09 -13.13**
7. GW 02-51 X GW 1240 10.77 -9.14* -18.47* -4.62 -4.85 0.52 30.54** -18.92** -8.52* -6.28**
8. RD 1009 X VDW 99-176 -25.27** 8.38* 1.31 9.61 -2.98 0.01 -15.22** -9.95 1.96 -6.49**
9. RD 1009 X GW 1139 11.02 -0.18 12.51 3.38 -7.42 10.11** 45.95** 79.04** 10.56** -5.19**
10. RD 1009 X GW 1239 -8.50 -2.00 -16.73* -6.33 0.69 -6.28* -22.68** 30.61** 7.31* -11.93**
11. RD 1009 X GW 1189 21.70* -2.01 -6.68 1.29 -6.60 -0.4 34.41** 6.65 1.46 -5.77**
12. RD 1009 X BAWAJI -42.85** 15.85** -29.65** -8.01 -7.68 9.39** 20.91** -43.21** 8.43** -0.91
13. RD 1009 X GW 1240 -30.01** -9.84* -32.62** 5.71 -6.04 -0.14 10.94** -11.20 -7.22* -12.22**
14. VDW 99-176 X GW 1139 -15.61* -1.15 -3.18 -1.10 -1.72 -3.78 -37.76** 3.34 1.44 -8.41**
15. VDW 99-176 X GW 1239 -9.60 -1.16 12.13 6.38 3.78 4.23 -19.81** 73.01** -0.38 -12.26**
16. VDW 99-176 X GW 1189 1.71 -6.07 5.79 3.00 3.09 -6.69* -26.57** -12.58 8.15* -0.59
17. VDW 99-176 X BAWAJI -47.72** 25.09** -13.30* 2.80 -2.23 0.45 -32.65** -53.84** 4.11 -12.81**
18. VDW 99-176 X GW 1240 2.76 -5.29 -6.4 9.29 3.56 -2.30 8.26** -4.68 3.15 -6.84**
19. GW 1139 X GW 1239 9.24 2.92 17.69* 2.86 -7.77 3.28 -1.20 152.02** 0.71 -2.34
20. GW 1139 X GW 1189 9.73 -0.19 -6.93 3.19 -1.54 -1.34 20.81** 81.31** 10.20** -3.04*
21. GW 1139 X BAWAJI -5.48 26.78** -26.36** -3.55 -1.95 14.82** 22.07** -27.42** -1.66 -4.66**
22. GW 1139 X GW 1240 34.03** -6.01 -21.95** -1.10 -2.77 -2.07 24.88** 23.91** 12.29** -6.49**
23. GW 1239 X GW 1189 78.48** -7.87* 8.65 6.01 -3.69 -2.19 8.44** 30.05** -1.67 -1.65
24. GW 1239 X BAWAJI -32.28** 25.93** -37.80** -4.07 -13.40** 13.08** -2.58 6.12 10.59** -3.10*
25. GW 1239 X GW 1240 9.30 -11.35** 0.28 2.53 -13.07** -6.77* -12.28** 33.60** 2.80 -3.43**
26. GW 1189 X BAWAJI -16.63** 3.94 -16.54* -6.95 -12.48** -5.17 47.17** 50.13** 1.22 -7.58**
27. GW 1189 X GW1240 22.31** -9.49* -10.39 -5.38 -7.16 -5.57 -28.73** 46.54** 6.42 -7.24**
28. BAWAJI X GW1240 -24.00** 10.24** -27.19** -6.25 -7.45 13.25** 18.28** -16.7** -6.14* -7.93**
S.Ed ± 0.83 2.30 0.43 0.36 0.76 1.36 0.95 2.02 0.58 0.93
MP = Mid Parent; BP = Better Parent; SP = Standard Parent. * and ** indicates significant at P = 0.05 and P = 0.01 levels, respectively.

GAMI et al., Heterosis for Grain Yield and Quality Traits in Durum Wheat (Triticum durum Desf.) Under Late sown condition 111
selected from germplasm maintained at Main Wheat Research
Station, Vijapur, (North Gujarat), during rabi, 2007-08 to create
a diallel set. The complete sets of 36 genotypes (eight parents
+ 28 hybrids) were evaluated in randomized block design (RBD)
with three replication. The experimental material raised in
second week of December 2008-09. The observations were
recorded from randomly selected five competitive individual
plants viz., plant height (cm), number of effective tillers per
plant, length of main spike (cm), spikelets per spike, grains per
spike, 1000-grain weight(g), grain yield per plant, harvest
index(%), grain protein (%) and hectoliter weight (g). The
heterosis over batter parent was estimated based on formulae
given by Fonseca and Patterson, 1968.
RESULTS AND DISCUSSION
The degree of heterosis was varied from cross to cross
for all the characters. For any one trait certain crosses
expressed considerable high heterosis while it was low in other
crosses suggesting the selection of parents has an important
bearing on performance of any cross. Out of 28 crosses 7
crosses manifested heterobeltiosis for grain yield per plant.
The range of heterobeltiosis for grain yield was wide (22.30 %
to 82.54 %) the hybrids GW 02-51 x VDW 99-176 recorded
highest heterobeltiosis (82.54) (Table 1). Medium to high
heterobeltiosis for grain yield in durum wheat under late sown
condition has been reported by Singh and Prasad, 2001,
Sharma and Sain, 2005 and Sharma, et al., 2003.
Total five crosses manifested desirable heterobeltiosis
over better parent for plant height. The cross combination
GW 1239 x GW 1240 (-11.35) recorded highest desirable
heterosis over better parent for this trait. Three hybrids evinced
significant positive heterobeltiosis for numbers of effective
tillers per plant and cross GW 02-51 x RD 1009 expressed
highest heterobeltiosis (21.13 %) for this trait. The cross
combination GW 02-51 x GW 1239 recorded highest heterosis
over better parent (12.38%) for length of main spike. For harvest
index heterobeltiosis ranged between (-53.54 % to 152.02 %).
The hybrid GW 1139 x GW 1239 expressed highest
heterobeltiosis (152.02 %).
Significant positive heterosis over better parent for was
recorded in cross GW 1139 x GW 1240 (12.39 %) followed by
cross GW 1239 x BAWAJI (10.59 %). For hectoliter weight
none of the cross combination expressed desirable
heterobeltiosis.
A comparative study of most heterotic crosses for grain
yield per plant (Table 2) revealed that the hybrid GW 02-51 x
VDW 99-176 expressed the highest heterobeltiosis for grain
yield per plant along with yield contributing characters like
plant height and harvest index.
Table 2.
Sr.
No.
Comparative study of heterotic crosses in durum
wheat
Hybrids
1. GW 02-51 x VDW 99-176
2. GW 1239 x GW 1189
3. GW 02-51 x GW 1189
4. GW 02-51 x RD 1009
5. GW 1139 x GW 1240
Figure in the parentheses indicated per se performance for grain yield
per plant.
*, ** indicates significant at P = 0.05 and P = 0.01 levels, respectively.
P H : Plant height
SL : Length of main spike
E T : Number of effective tillers per plant
GS : Grains per spike
T W : 1000-grain weight
HI : Harvest index
GP : Grain protein
H W : Hectoliter weight
LITERATURE CITED
Heterobeltiosis
(%)
82.54**
(15.27)
78.48**
(16.06)
42.88**
(11.43)
38.47**
(13.41)
34.03**
(14.74)
Useful and significant
heterobeltiosis for
component trait
GS, TW, HI
PH, TW, HI
GS,
ET, SL, HW, , HI
TW, GS, HI
Fonseca, S. and Patterson, F.L. 1968. Hybrid vigour in seven parent
diallel cross in common winter wheat (Triticum aestivum L.). Crop
Sci., 8: 85-95.
Mahajan, V.; Nagarajan, S. and Srivastava, M. 1999. Commercial
heterosis in wheat and overview. RACHIS Newsl., 18(2): 13.
Sharma, S.N., Sain, R.S. and Sharma, R.K. 2003. Genetic analysis of
flag area in durum, wheat over environment. Wheat information
service, 96: 5-10.
Sharma, S.N.and Sain, R.S. 2005. Estimation of components of heterosis
for harvest index in durum wheat under normal and late plantings.
Crop Improv., 32(2): 137-142.
Singh, B.D. and Prasad, K.K. 2001. Heterosis for quantitative traits in
late sown wheat. Journal of Applied Biology, 11(1/2):1-5.
Recieved on 21-04-2010 Accepted on 11-07-2010

112 Trends in Biosciences 3 (2): 112-116, 2010 Trends in Biosciences 3 (2), 2010
Molecular Characterization of Steinernema masoodi, S. seemae and Other Indian
Isolates of Steinernema spp.
S.S. ALI 1 , RIYAZ ANDRABI 2 , V. VERMA 2 , RUCHIKA 2 , AZRA SHAHEEN 1 RASHID PERVEZ 1 AND
SOBIA ALI 3
1
Indian Institute of Pulses Research, Kanpur 208 024
2
Regional Research Laboratory, Jammu, Jammu & Kashmir
3
Integeral University, Kursi Road, Lucknow, (U.P.)
e-mail: ss_ali@rediffmail.com
ABSTRACT
Molecular characterization, studies on Steinernema masoodi,
S. seemae, S. carpocapsae (Jammu strain) S. carpocapsae
(Lucknow strain) have been carried out through analysis of
18S ITS ribosomal RNA genes. The RFLP analysis was carried
out, each PCR product were digested with one of the series of
17 restriction enzymes. The digested DNAs loaded on 1.5%
agarose gel, separated by electrophoresis at 130 V for 3 h, stained
with ethidium bromide, visualised and photographed under
UV light. For S. masoodi and S. seemae DNA sequence didn’t
show any homology with any DNA sequence of other EPN data
base and 12% agarose gel exhibiting ITS band amplicule of
both the species different from S. abbasi, S. tami and S.
carpocapsae and other species in a public domain and it confirms
that both are new species at molecular level The dendogram
showing phylogenic position of Lucknow strain of S. carpocapsae
has generated by alignment of ribosomal gene sequences to
other strains of Steinernema indicated that Jammu strain is
close to S. carpocapsae Accn No. AY 171262, DG302092, AY171283,
AY17032 while Lucknow strain comes close to strain A11-AY23
while it is different from the closely linked group S. backanense
Acc. No. AY487918 and S. sasonense Acc. No. AY487919.Pair wise
matrix of ribosomal gene sequence of the different isolates
showing the phylogenetic position of strain which indicate that
both the strains can be separated by divergence position. The
DNA sequences of ~350 bases thus obtained were compared
with the sequences present in the public domain (Gene Bank)
for homology studies by BLASTN program. A dendrogram and
distance matrix was prepared by using the Clustal W program
of DNASTAR software (Lasergene, USA) which shows the
phylogenetic position, in case of S. carpocapsae.
Key words
Steinernema masoodi, S. seemae, S. carpocapsae,
molecular characterization, DNA, entomopathogenic
nematode
During survey of EPN in Uttar Pradesh state, a number
of Steinernematid nematodes have been isolated. On the basis
of morphology and cross hybridization Steinernema masoodi
and S. seemae have been identified as new species. (Ali, et
al., 2005). Currently many isolates of known species of
Steinernema have been identified (Hussaini, et al., 2008, Walia,
et al., 2006) and still many identified isolates from diverse
morphological and geographical localities have yet to be fully
characterized in India. Although data on morphometrics and
cross breeding test are very authentic and reliable in applying
the biological species concept, still using molecular evidence
e.g. random amplified polymorphic DNA (RAPD), restriction
fragment length polymorphism (RFLP) can also provide
additional support and valuable complementry tools.
Nucleotide sequence data have been used to delimit nematode
species and although this approach has only recently been
applied in Nematology for their evaluationary history (Nadler,
1992, Adams, 1998, Blaxter, et al., 1998). Sequence based
studies of Steinernema have been limited (Liu, et al., 1997).
S. masoodi, S. seemae, and S. carpocapsae (Lucknow
strain) were baited out from soil samples collected from various
districts of U.P. and were described on the basis of
morphological characters (Ali, et al., 2005), however an attempt
was made in this study to identify these species and isolates
through molecular characterization.
MATERIALS AND METHODS
Emtomopathogenic nematodes were taken from nuclear
culture of S. masoodi, S. seemae, S. carpocapsae (Lucknow
strain) while S. carpocapsae (Jammu strain) was obtained from
Regional Research Laboratory Jammu, S. abbbasi, S. glaseri
and S. tami from Project Directorate of Biological Control,
Bangalore, S. thermophilum (now S. abbasi) from IARI, New
Delhi and maintained in the laboratory on the last instar larvae
(Dutky, et al., 1964) in BOD incubated at 25 o C, and third stage
infective juvenile (IJs) were obtained within seven days after
emerging from insect cadaver.
In this study, S. seemae and S. masoodi were compared
with other relevant and available species: S. carpocapsae, S.
tami, S. glaseri and S. abbasi.
DNA was separately extracted from each nematodes.
For each isolate, a specimen was cut in 8 ml of worm lysis
buffer [500 mM KCl, 100mM Tris-Cl (pH 8.3), 15 mM MgCl 2
, 10
mM DTT, 4.5% Tween 20, 0.1% gelatin] on ice. The nematode
fragments were transferred in 4 ml of the buffer to an Eppendorf
tube to which 5 ml of dd. H 2
O and 1 ml of proteinase K (600
mg/ml) were added. After freezing (-70 o C for 1 h), the tubes
were incubated at 65 o C for 1 h, and then at 95 o C for 10 minutes.

ALI et al., Molecular Characterization of Steinernema masoodi, S. seemae and Other Indian Isolates of Steinernema spp. 113
After centrifugation (1 minute; 13000 g) of the tubes, 10
ml of the DNA suspension were added to a PCR reaction
mixture containing 4 ml 10× PCR buffer, 1 ml MgCl 2
(25 mM), 1
ml dNTP mixture (10 mM each), 0.2 ml (500 mM) of each primer,
1.5UTaq polymerase and 33.3 ml dd. H 2
O to make final volume
of 50 ml. Primers 18S (5’TTGATTACGTCCCTGCCCTTT3’) and
26S (5’TTTCACTCGCCG TTACTAAGG3’) as described by
Vrain, et al., 1992 were used in the PCR reaction. Amplifications
were carried out using a PTC-100 thermocycler which was
preheated at 92 o C for 2 min. followed by 35 cycles of 92 o C for
30 s, 54 o C for 30 s and 72 o C for 2 min. Ramping time was about
10 min per cycle. After DNA amplification, 5 ml product was
loaded on a 1% agarose gel for DNA checking. After
electrophoresis, the DNA was visualised and photographed
under UV light. The remainder was stored at –20 o C.
Five ml of each PCR product were digested with one of
a series of 17 restriction enzymes [Alu I, Cfo I, Pst I, Bsiz I,
Mva I, Hind III, Pvu II, Xba I, Dde I, Hinf I, Rsa I, EcoR I, Msp
I, Sal I, Hae III, Kpn I, Nde II, 100 bp DNA ladder] in buffer
stipulated by the manufacturer. The digested DNA was loaded
on a 1.5% agarose gel, separated by electrophoresis at 130 V
for 3 h, stained with ethidium bromide, visualised and
photographed under UV light.
Molecular characterization of the two new species viz.,
Steinernema masoodi, S. seemae, and S. carpocapsae
(Lucknow strain) and S. carpocapsae (Jammu strain) was done
by analysis of the 18S ITS ribosomal RNA genes by picking
100 to 500 specimens and of each species from nuclear culture
were pooled and used for DNA extraction. The genomic DNA
extraction was carried out adopting Madani, et al., 2004
method. Primers 5’ GTTTCCGTAGGTGAACCTGC 3’ and 5’
ATATGCTTAAGTTCAGCGGGT 3’ were used to amplify the
ribosomal genes of the nematodes. The PCR conditions used
were initial denaturation at 94 o C for 4 min followed by 35
cycles of 94 o C for 1 min; 55 o C for 1 min. 30 sec; 72 o C for 2 min.
and a final extension of 72 o C for 7 min. The 50 µl reaction
mixture contained 1 Í PCR buffer, 200 µM each dNTP, 1.5 mM
MgCl 2
, 25 pmol of each primer, 1-10 ng of DNA and 2.5 U of
Taq DNA polymerase. 5 µl of the amplified product was run
on 1% (w/v) agarose gel for determination of molecular weight
and visualization of the product. The amplified products were
purified by Microcon columns (Millipore, USA) and
sequenced with the help of ABI Prism 310 Genetic Analyzer
(ABI, USA) as per the instructions of the manufacturer using
the Big Dye Terminator sequencing kit v. 2.0. The DNA
sequences of ~350 bases thus obtained were compared with
the sequences present in the public domain (Gene Bank) for
homology studies by BLASTN program. A dendrogram and
distance matrix was prepared by using the Clustal W program
of DNASTAR software (Lasergene, USA) which shows the
phylogenetic position, in case of S. carpocapsae.
RESULTS AND DISCUSSION
Steinernema seemae
S. seemae (Ali, et al., 2005) is unique in having 4-5 times
larger body size of the first generation giant females which
coil spirally upon fixation than its normal females and infective
juveniles tail with pointed tip. It can be differentiated from
S.carpocapsae in the absence of mucron on male tail, larger
Fig. 1(a).Amplified products of ribosomal genes of S.
carpocapsae Lucknow strain (AL3) and S. carpocapsae
Jammu strain (AL6)
Fig. 1.(b) NematodeDNA amplification
(Al2 = S. masoodi, Al4 = S. seemae,
Al6 = S. carpocapsae Jammu strain,
Al8 = unidentified Oscheius sp.

114 Trends in Biosciences 3 (2), 2010
Fig. 2.
females and spicules head being larger than wide. Its females
can be separated from S. abbasi in having larger body length,
absence of mucron on male tail, smaller spicules and different
shape of the gubernaculum. S. seemae yielded no progeny
when cross hybridization with S.abbasi, S.carpocapsae, S.
thermophilum (now synonymised with S.abbasi) and
S.masoodi (Ali, et al., 2005).
DNA sequence
AGGATCTATGTGCGGAGCATTGACCTGATGCTC
GTACTTAGCACGCTCCCAACACAACTAACGGCT
AACGATTGGCGTCTGGTGGGTTGCCGAGCAGG
ATGTGCCTGATGTCCGTGACCGCAGTTGAGGCT
CCCAAATACGCATACTGTCCTGCTTAGTTCGGC
AGGGTTTTTTTTGCGCAGACTTATGAGTCCCCG
GCCTGGGGATCGCCAATCAAAAAACTCCTCTAA
CGAA
3.5
ITS region amplified near 900bp of nematode lysate
Lane 1: S. carpocapsae (Jammu strain)
Lane 2: 1 kb ladder 5 ml lysate
Lane 3: 8 ml lysate
Lane 4: 10 ml lysate
Fig. 3.
1.2 % agarose gel showing ITS band amplification with
different nematode isolates Lysates
Lane 1 100 bp DNA ladder
Lane 2, 3: S. tami
Lane 4, 5: S. masoodi
Lane 6, 7: S. carpocapsae (Jammu strain)
Lane 8, 9: S. seemae
Lane 10: S. abbasi
Lanes 1 and 2 represent two different annealing
temperatures used for each sample
This DNA sequence doesn’t show any homology with
any DNA sequence of other EPN database and 12% agarose
gel exhibiting ITS band amplicule of S. seemae different from
S. abbasi. S.tami, S.carpocapsae and S.masoodi (Fig. 3)It is a
new species in public domain and it confirms that it is a new
species at molecular level.
Steinernema masoodi
Based on morphological and morphometric characters
S. carpocapsae Acc. No. AY171282
S. carpocapsae Acc. No. DQ302092
S. carpocapsae Acc. No. AY171283
S. carpocapsae SGIB Acc. No. AY170334
S. carpocapsae strain A11 Acc. No. AY23
AL6
AL3
S. backanense Acc. No. AY487918
S. sasonense Acc. No. AY487919
S. eapokense Acc. No. AY487921
S. cumgarense Acc. No. AY487920
S. guangdongense Acc. No. AY170339
Fig. 4.
2
Nucleotide Substitutions (x100)
Dendrogram showing the phylogenetic position of S. carpocapsae Lucknow strain (AL3) and S. carpocapsae Jammu strain
(AL6) as generated by alignment of ribosomal gene sequences with other strains of Steinernema
0

ALI et al., Molecular Characterization of Steinernema masoodi, S. seemae and Other Indian Isolates of Steinernema spp. 115
AL3
AL6
S. backanense Acc. No. AY487918
S. sasonense Acc. No. AY487919
S. carpocapsae Acc. No. AY171282
S. carpocapsae Acc. No. AY171283
S. carpocapsae Acc. No. DQ302092
S. carpocapsae SGIB Acc. No. AY170334
S. carpocapsae strain A11 Acc. No. AY23
S. cumgarense Acc. No. AY487920
S. eapokense Acc. No. AY487921
S. guangdongense Acc. No. 170339
Fig. 5.
Pairwise distance matrix of ribosomal gene sequences of different EPN isolates Al 3= S. carpocapsae (Lucknow strain),
Al 6= S. carpocapsae (Jammu strain)
S.masoodi (Ali, et al., 2005) was characterized by having small
body size, presence of perioral disc, absence of mucron in
male tail and in being reproductively isolated from S. abbasi,
S. thermophilum (now S. abbasi), S.carpocapsae and
S.seemae. S.masoodi come close to S.abbasi but differ from it
in having lesser number of genital papillae, smaller body
size,lesser ‘a’ value, greater ‘b’ value and ‘c’ values and lesser
D% value (Ali, et al., 2005).
DNA sequence
TCCACGAGTGCACTTGCTCTCGCTCTAGACTAG
AACTGGACGCCGAAGCGCAGCAGCTCGACTAA
TCAGAACTCTCTGTTAGTAGTACAACCAACCCT
GAACCAGACGTGCCACAGGGTTTTTTTTGAGCG
GGGGGGGTTGGAAATGAAAATGACGCCGACGC
TTTCGGATAGTTCCCTTGAATGTGTGTATCTCC
ACGCAGAGTGCAGGAGTGAACGTCGTTCGCTA
ACTTGGGGAGGTAGCGCTTCTG
The above DNA sequence database doesn’t show any
homology with any DNA sequence in public domain which
shows it is to be a distinct and new species at molecular level.of
other EPNs. It is a new species and described as Steinernema
masoodi. 1.2% agrose gel showing ITS band amplication of S.
masoodi with S. tami and S.carpocapsae (100 bp DNA line) at
different annealing temperature used for each group (Fig.3).
Steinernema carpocapsae
Steinernema carpocapsae (Wiser 1950) Wouts, Mracek,
Gerdin and Bedding 1982 which was isolated originally from
Cydia pomonella from Czechoslavakia was also recovered
from Lucknow, U.P., India. Molecular characterization of S.
carpocapsae (Lucknow strain) and S. carpocapsae (Jammu
strain) was also compared. They have shown 90% homology
with original S. carpocapsae. Molecular characterization of
both the strains was done by analysis of 18S ITS ribosomal
RNA which are as follows. Amplification products of both the
strain also have shown in Fig. 1,2.
DNA sequence
Steinernema carpocapsae (Jammu strain)
CCCTCAATTGAACATACTAACAGATAAAAACCT
GTTAGTGCCATTTGCGTTCAAAATTTTAGCGCT
CAATATGTCTGCAATTCACGCCAAATAACGGTT
TTTGCCCCGTTTTTCATCGACCTACGAACCGAG
TGATCCACCGATAAGACTTGATAAATTAAAAAA
TGCATCAACCGAGTGACACAATTATCGAAACAA
AA
Shows 99% homology with Steinernema carpocapsae
ribosomal gene
DNA sequence
Steinernema carpocapsae (Lucknow strain)
CATTGTTATCTAAGCGTTTCGTCGTTTCTTGAA
TGCTTAGTGATGAGAATTAAAGAGGTTTGCTGA
CTCGCCATTCTTTGATTGCTAACAAAAACGTTT
TGTTTCGATAATTGTGTCACTCGTTGATGCATT
TTTTAATTATCAAGTCTTATCGGTGGATCACTC
GGTTCGTAGGTCGATGAAAAACGGGGCAAAAA
CCGTTATTTGGCGTGAATTGCAGACATATTGAG
CGCTAAAATTTTGAACGCAAATGGCACTAACAG
GTTTTTATCTGTTAGTATGTTCAATTGAGGGTC
TTTTGACTAGAATCTGGCAATCGGCTGTGATTG
CTTTTTTCGGTAACCTACTTT
Shows 99% homology with Steinernema carpocapsae
amplified product of ribosomal genes of S. carpocapsae

116 Trends in Biosciences 3 (2), 2010
Lucknow strain and S. carpocapsae Jammu strain (Fig. a, b, 2,
3) where ITS region amplified near 900 bp of nematode lysoli
using S. carpocapsae Jasmmu strain at 5, 8, 10 µl Crystal.
The dendogram showing phylogenic position of S.
carpocapsae (Lucknow strain) has generated by alignment
of ribosomal gene sequences to other strains of Steinernema
indicated that Jammu strain is close to S. carpocapsae Accn
No. AY 171262, DG302092, AY171283, AY17032 while Lucknow
strain comes close to strain A11-AY23 while it is different
from the closely linked group S. backanense Acc. No.
AY487918 and S. sasonense Acc. No. AY487919 (Fig. 4).
Pair wise matrix of ribosomal gene sequence of the
different isolates showing the phylogenetic position of strain
which indicate that both the strains can be separated by
divergence position (Table 5)
ACKNOWLEDGMENT
The authors express their gratitude to Dr. Masood Ali,
Director, Indian Institute of Pulses Research, Kanpur and Dr.
G.N. Qazi, Director Regional Research laboratory, Jammu for
providing all the facilities used in this study.
LITERATURE CITED
Adams, 1998. Species concepts and the evaluationary paradigm in
modern Nematology. Journal of Nematology, 30: 1-21.
Ali, S.S., Shaheen, A., Pervez, R., Hussain, M.A. 2005. Steinernema
masoodi sp. n. and S. seemae sp. n. (Nematoda: Rhabditida:
Steinernematidae) from India. International Journal of Nematology,
15(1): 89–99.
Blaxter, M.L., DE Ley, P., Garey, J.R., Liu, L.X., Scheldemann, P.,
Vierstraete, A., Vanfletteren, J.R., Mackey, L.Y., Dorris, M., Frisse,
L.M., Vidla, J.T., Thomas, W.K. 1998. A molecular evolutionary
framework for the phylum Nematoda. Nature, 392: 71-75.
Dutky, S.R., Thompson, J.V., Cantwell, G.E. 1964. A technique for the
mass propagation of the DD-136 nematode. Journal of Insect
Pathology, 6: 417–422.
Hussaini, S.S., Shakeela, V., Sankaranarayanan, C. 2008. Bioefficacy
and progeny production of some entomopathogenic nematode
isolates against lepidopteran insect pest. Trends in Biosciences,
2(1): 13-17.
Liu, J., Berry, R.E., Moldenk, A.F. 1997. Phylogenetic relationship of
entomopathogenic nematodes (Heterorhabditidae and
Steinernematidae) inferred from partial 18S rNA gene sequences.
Journal of Invertebrate Pathology, 69: 246–252.
Madani, M., Vovlas, N., Castillo, P., Subbotin, S.A., Moens, M. 2004.
Molecular characterization of cyst nematode species (Heterodera
spp.) from the Mediterranean basin using RFLPs and sequences of
ITS-rDNA. Journal of Phytopathology, 152: 229–234.
Nadler, S.A. 1992. Phylogeny of some ascaridoid nematodes inferred
from comprises of 18S and 28S r RNA sequences. Molecular Biology
and Evaluation, 9: 932-944.
Vrain, T.C., Wakarchuk, D.A., Levesque, A.C., Hamilton, R.J. 1992.
Intraspecific rDNA restriction fragment length polymorphism in
the Xiphinema americanum group. Fundamental and Applied
Nematology, 15: 563-573.
Walia, K.K., Walia, R.K., Bajaj, H.K. 2006. Occurrence, host range,
pathogenicity and population buildup of Steinernema pakistansis
Shihur et al.,2001 (Nematoda: Rhabditidia). International Journal
of Nematology, 16(2): 164-168.
Wouts, W., Mracek, M.Z., Gardin, S., Bedding, R.A. 1982. Neoaplectana
Steiner, 1929, a junior synonyms of Steinernema Travassos, 1927
(Nematoda: Rhabditida). Systematic Parasitology, 4: 147-154.
Recieved on 26.06.2009 Accepted on 29.10.2010

Trends in Biosciences 3 (2): 117-119, 2010
Detection of Mungbean Yellow Mosaic India Virus in Kharif Pulses and Some Weeds
MINAKSHI MISHRA*, MANSI SACHAN*, MOHD. AKRAM AND NAIMUDDIN
Division of Crop Protection, Indian Institute of Pulses Research, Kanpur 208 024
*Department of Biotechnology, Dayanand Girl’s Post Graduate College, CSJM University, Kanpur
e-mail: minakshi.mishra25@yahoo.com
ABSTRACT
Three pulse crops (mungbean, urdbean and pigeon pea) and
three weeds (Acalypha indica, Croton bonplantianum and
Clerodendron sp.) showing characteristic symptoms of yellow
mosaic disease were screened to detect the Mungbean yellow
mosaic India virus through PCR using virus specific primers,
namely AC2-F- AGCTAATGACCCCTAAATTAT /AC2-R-
GAGTACTTGGATGAAGAGAAC; AC3-F- TTATGATTCGATA
TTGAATTAATTA /AC3-R- CTGAAGTGTGGGTGTAGCTAT
and AC4-F-CAAATTACAATTTAAGTTATG / AC4-R-
ACTTCTAGCCTTGTCAACACCAG. All the primers pairs viz.,
AC2-F/AC2-R, AC3-F/AC3-R and AC4-F/AC4-R amplified the
targeted DNA fragments, ~480 bp, ~450 bp and ~500 bp,
respectively only from diseased samples of mungbean, urdbean
and pigeon pea. Samples from weeds showing yellow mosaic
gave negative results. This indicated that the yellow mosaic
disease in these weeds was caused by some other viruses and
they are not host of MYM IV and do not have any role in the
epidemiology of the MYMIV in kharif pulses at Kanpur.
Key words
Pulses, MYMIV, PCR, detection, weeds
Diseases are the major biological factors which constrain
the productivity of these pulse crops. Yellow mosaic disease
(YMD) affects five important pulse crops, blackgram,
mungbean, french bean, pigeon pea and soybean, causes an
annual yield loss of about $ 300 million (Varma, et al., 1992).
Four species of whitefly-transmitted geminiviruses (genus
Begomovirus, family Geminiviridae): Mungbean yellow mosaic
virus, Mungbean yellow mosaic India virus, Dolichos yellow
mosaic virus and Horsegram yellow mosaic virus are known
to cause yellow mosaic disease in different pulse crops in
different parts of the country. Depending on the severity of
the disease the yield penalty may reach up to cent per cent
(Basak, et al., 2004).
Weeds play a great role in the epidemiology of plant
viruses, and they may be primary sources of viruses in
spreading of plant diseases (Kazinczi, et al., 2002, 2004). Many
reports have demonstrated that weeds serve as reservoir or
alternative hosts for begomovirus survival and spread
(Gilbertson, et al., 1991; Bedford, et al., 1998). In north India
weeds such as Acalypha indica and Croton bonplantianum
are common during kharif season, were found to be affected
with yellow mosaic disease, the symptoms indicative of
geminivirus infection. Clerodendron sp. a plant very
commonly used as hedge was also found to show (yellow
mosaic leaf deformation) symptoms that are also known to be
affected by geminiviruses. In the present study attempts has
been made to detect MYMIV in three pulse crops (mungbean,
urdbean and pigeon pea) and two weeds (Acalypha indica
and Croton bonplantianum) and one hedge (Clerodendron
sp.) and find out whether any of these weeds acts as reservoir
of MYMIV.
MATERIALS AND METHODS
The healthy and diseased (showing characteristic
symptoms of yellow mosaic disease) samples of weeds
(Acalypha indica, Croton bonplantianum and clerodendron
sp.) and pulse crops (Mungbean, Urdbean, Pigeon pea) were
collected from IIPR Field and brought to the laboratory. Total
DNA was extracted from all the healthy and diseased samples
of weeds and pulse crops, using CTAB method. 100 mg of
leaves was ground in a pre-chilled and sterilized mortar with
liquid nitrogen. The powdered tissue was transferred to a
microcentrifuge tube containing 500 µl CTAB buffer (2%
CTAB, 2% PVP, 1M Tris-pH 8.0, 5 M NaCl, 0.5 M EDTA) with
2% â Mercaptoethanol added just prior to use. Sample was
incubated for 1 hour at 55 0 C and sample was mixed with 500 µl
of chloroform/Isoamyl alcohol (24:1) and centrifuged at 12000
rpm for 10 min. The supernatant (400 µl)was transferred to a
1.5 ml microcentrifuge tube containing 32 µl of 7.5 M
Ammonium Acetate and 233.28 µl of Isopropanol, and kept in
freezer for 15 min.Mixture was centrifuged at 12000 rpm for 5
min. The pellet was washed with 70% and 95% Ethanol by
centrifugation at 12000 rpm for 2 min, air dried and dissolved
in 100 µl TE buffer (1M Tris- pH 8.0, 0.5 M EDTA) and allowed
to resuspend for 1 hrs at 55 0 C and stored at -20 0 C. The extracted
DNA was analyzed by 1% agarose gel in 1 x TAE and the gel
was viewed in gel documentation system (Syngene) to confirm
the presence of DNA.
Three set of primer pairs were used to detect MYMIV in
weeds and pulse crops. All the three primer pairs were specific
for MYMIV, namely AC2-F- AGCTAATGACCCCTAAATTAT
/AC2-R- GAGTACTTGGATGAAGAGAAC; AC3-F-
TTATGATTCGATATTGAATTAATTA /AC3-R- CTGAAGT
GTGGGTGTAGCTAT and AC4-F- CAAATTACAATTT
AAGTTATG /AC4-R- ACTTCTAGCCTTGTCAACACCAG.
DNA extracted from healthy and diseased leaves were
used as template for PCR. PCR was performed by adding 2 µl
of the DNA extract to 23 µl of PCR master mix containing 12.5
µl dream Taq, 1 µl of each forward and reverse primers (50
pmol/ µl) and 8.5 µl nuclease free water, a total of 25 µl of PCR

118 Trends in Biosciences 3 (2), 2010
mix for each sample. The thermal conditions consisted of an
initial denaturation step at 94 0 C for 3 min, followed by 35 cycles
of denaturation at 94 0 C for 30 sec, annealing at 49 0 C for 30 sec
for primer pairs AC2F/AC2R; 48 0 C for 30 sec for primer pair
AC3F/AC3R and AC4F/AC4R and extension at 72 0 C for 1 min,
and then one step of final elongation at 72 0 C for 10 min. PCR
amplified products were analyzed by 1% agarose gel
electrophoresis at 50 V for 45 min and stained with ethidium
bromide. The size of amplicons was determined using 1 kb
DNA ladder (fermentas). The gel was visualized under gel
documentation system and photographed.
(Malathi and John, 2008). Although the samples of diseased
Croton bonplantianum, Clerodendron sp., Acalypha indica
were showing yellow mosaic symptoms but MYMIV was not
detected in any of these weeds and the yellow mosaic disease
in weeds was caused by some other viruses and they do not
serve as reservoir or alternate hosts of MYMIV.
RESULTS AND DISCUSSION
Diseased samples of mungbean, urdbean and pigeon
pea were found to show chlorotic spots on leaves later these
yellow spots enlarge and the leaves turn completely yellow.
On pigeon pea, bright yellow patches on leaves without leaf
distortion were observed by Williams, et al., 1968. Symptoms
similar to yellow mosaic disease were observed in weeds and
were suspected for the presence of MYMIV. The leaves of
Clerodendron sp. were found to show yellow spots and
deformation. Acalypha indica and Croton bonplantianum
were found to show yellow and green patches on the leaves.
Yellow streak symptoms in Brachiaria ramosa, mild yellowing
and severe puckering of leaves in Xanthium strumarium and
curling of leaves in Cosmos bipinnatus were recorded by Nene,
1973 and Rathi, 1972. Aiyanathan and Chandrasekaran, 1998
claimed transmission of YMV isolate from mungbean to the
weed Croton sparsiflorus. They also showed whitefly
transmission of the virus associated with yellow mosaic
disease of Acalypha indica, yellow vein mosaic disease of C.
sparsiflorus and Eclipta alba.
DNA was successfully isolated from diseased as well as
healthy leaves of mungbean, urdbean, pigeon pea, Acalypha
indica, Croton bonplantianum and Clerodendron sp. using
CTAB method. Gel analysis of PCR products revealed positive
results with diseased samples of mungbean, urdbean and
pigeon pea and amplified a targeted DNA fragment of ~480 bp
(Fig. 1) using AC2-F/AC2-R primer pair specific to MYMIV.
Gel analysis of PCR products also revealed positive
results with diseased samples of mungbean, urdbean and
pigeon pea and amplified a targeted DNA fragment of ~450 bp
using AC3-F/AC3-R primer pair specific to MYMIV(Fig. 2).
Similarly another gel analysis of PCR products also
revealed positive results with diseased samples of mungbean,
urdbean and pigeon pea and amplified a targeted DNA
fragment of ~500 bp using AC4-F/AC4-R primer pair specific
to MYMIV (Fig. 3).
Results of PCR indicated that yellow mosaic disease of
mungbean, urdbean and pigeon pea is caused by same virus
i.e. MYMIV. MYMIV, infection has been reported in C. cajan,
G. max, P. vulgaris, V. aconitifolia, V. radiata, V. mungo
Fig. 1.
Fig. 2.
Fig. 3.
PCR amplification of MYMIV using AC2-F/R primer
pair. 1kb DNA ladder (lane1), Amplified products of
healthy Croton (lane2), diseased Croton (lane3), healthy
Acalypha (lane4), diseased Acalypha (lane5), healthy
Clerodendron (lane6), diseased Clerodendron (lane7),
healthy Mungbean (lane8), diseased Mungbean (lane9),
healthy Urdbean (lane10), diseased Urdbean (lane11),
healthy Pigeon pea (lane12), diseased Pigeon pea
(lane13).
PCR amplification of MYMIV using AC3-F/R primer
pair. 1kb DNA ladder(lane1), Amplified products of
healthy Croton (lane2), diseased Croton (lane3), healthy
Acalypha (lane4), diseased Acalypha (lane5), healthy
Clerodendron (lane6), diseased Clerodendron (lane7),
healthy Mungbean (lane8), diseased Mungbean (lane9),
healthy Urdbean (lane10), diseased Urdbean (lane11),
healthy Pigeon pea (lane12), diseased Pigeon pea
(lane13).
PCR amplification of MYMIV using AC4-F/R primer
pair. 1kb DNA ladder(lane1), Amplified products of
healthy Croton (lane2), diseased Croton (lane3), healthy
Acalypha (lane4), diseased Acalypha (lane5), healthy
Clerodendron (lane6), diseased Clerodendron (lane7),
healthy Mungbean (lane8), diseased Mungbean (lane9),
healthy Urdbean (lane10), diseased Urdbean (lane11),
healthy Pigeon pea (lane12), diseased Pigeon pea
(lane13).

MISHRA et. al., Detection of Mungbean Yellow Mosaic India Virus in Kharif Pulses and Some Weeds 119
LITERATURE CITED
Aiyanathan, K.E.A. and Chandrasekaran, A. 1998. Studies on weed
hosts of Mungbean yellow mosaic virus. Indian J. Virol., 14: 125-
126.
Basak, J., Kundagrami, S., Ghose, T.K and Pal, A. 2004. Development
of Yellow Mosaic Virus (YMV) resistance linked DNA marker in
Vigna mungo from populations segregating for YMV-reaction. Mol.
Breed., 14: 375-383.
Bedford, I. D., Kelly, A., Banks, G. K., Briddon, R. W., Cenis, J. L and
Markham, P.G. 1998. Solanum nigrum: an indigenous weed
reservoir for a tomato yellow leaf curl geminivirus in southern
Spain. European Journal of Plant Pathology, 104:221-222.
Gilbertson, R. L., Hidayat, S. H., Martine, R. T., Leong, S. A., Faria, J.
C., Morales, F. and Maxwell, D.P. 1991. Differentiation of bean
infecting geminiviruses by nucleic acid hybridization probes and
aspects of bean golden mosaic in Brazil. Plant Disease, 75: 336-
342.
Kazinczi, G., Horvath, J., Takacs, A. and Pribek, D. 2002. Biological
decline of Solanum nigrum L. due to tobacco mosaic tobamovirus
(TMV) infection. II. Germination, seed transmission, seed viability
and seed production. Acta Phytopathologica et Entomologica
Hungarica, 37: 329-333.
Kazinczi, G., Horvath, J., Takacs, A., Gaborjanyi, R., Beres, I. 2004.
Experimental and natural weed host-virus relations.
Communications of Applied Biological Science, 69: 53-60.
Malathi, V. G. and Priya John, 2008. Geminiviruses Infecting Legumes,
In: Characterization, Diagnosis and Management of Plant viruses,
Vol. 3: Vegetable and Pulse Crops (eds. P. Govind, P. Rao, Lava
Kumar and J. Ramon Holguin-Pena) Stadium Press LLC, Texas,
USA, pp. 97-123.
Nene, Y. L. 1973. Viral diseases of warm weather pulse crops in India.
Plant Dis. Rep., 57: 463-467.
Rathi, Y.P.S. 1972. Mungbean yellow mosaic virus: Host range and
relationship with the vector, Bemisia tabaci Genn. Ph.D. Thesis,
G.B. Pant University of Agriculture and Technology, Pantnagar,
U.P., India. pp.1-93.
Varma, A., Dhar, A. K. and Mandal, B. 1992. MYMV transmission and
control in India; In: Mungbean yellow mosaic disease (eds. S.K.
Green and D. Kim) Asian Vegetable Research and Development
Centre, Taiwan, pp.8-27.
Williams, F.J., Grewal, J.S. and Amin, K.S. 1968. Serious and new diseases
of pulse crops in India in 1966. Plant Dis. Reptr., 52: 300-304.
Recieved on 30.10.2010 Accepted on 28.11.2010

120 Trends in Biosciences 3 (2): 120-122, 2010 Trends in Biosciences 3 (2), 2010
Effect of Relative Humidity on Growth of Clinically Isolated Three Candida spp.
CH. TANUSHREE DAS, RITARANI DAS AND R.C. MOHANTY.
Post Graduate Department of Applied & Industrial Microbiology, Department of Botany, Utkal University,
Bhubaneswar 751 004, Orissa
e-mail: tanushree_das@live.com, das.ritarani@yahoo.com
ABSTRACT
Speciation of Candida species isolates from clinical specimen
are described and its necessity is emphasized. A high water
content in the substrate is almost a prerequisite for
establishment of fungal growth and as a rule, dispersion spores
are not produced unless the surrounding atmosphere has a
relative humidity approaching 100%. In the present report it
has been observed that C.albicans adversely affected by midrange
relative humidity ( 60%) where as no such adversity was observed
in C.parapsilosis and C.tropicalis with a slightest change of growth
in the middle range of relative humidity.
Key words
Speciation, Candida spp., relative humidity, growth
Fungi have been recognized as causative agents of
human disease earlier than bacteria. Candida causing favus
and thrush had been described as early as in 1839. The
demonstration of Mackenzie, 1971 stated that C. albicans
are killed by relatively short exposure to levels of moderate
humidity. In nature, cells of C. albicans exist endogenously
within vertebrate hosts at anatomical sites which are at or
near total saturation. RH susceptibility test may be exploring
the relationship between RH or survival of filamentous strains
of C. albicans and C. tropicalis, which have been considered
by some authors Brown – Thomsen, 1961.
MATERIALS AND METHODS
Candida spp. from urine, sputum, pus, blood, throatswab,
stool and high vaginal swab of patients attending to
S.C.B.Medical College, Cuttack was isolated by the
conventional methods using bacteriological media
(MacConkey agar and blood agar) as Candida is able to grow
in such media while carrying out the bacteriological analysis.
Then identification up to species level was made using
chromagar Candida tube test. All the species identified by
this method were reconfirmed by using other conventional
methods.
Smears were made from the collected urine, sputum, pus,
blood, throat-swab, stool and high vaginal swab of patients.
Gram stained smears were used to look for presence of gram
positive budding yeast cells with pseudohyphae. The suitable
samples were cultured on plain Sabouraud’s Dextrose Agar
(SDA) and also in chromagar. Both plates and slants were
incubated for 48hr at room temperature (25±1°C - 35±1°C) to
look for growth to cream coloured pasty colonies on SDA
plates and light blue coloured colonies on chromagar slants
suggestive of Candida tropicalis.
A single colony was inoculated in human serum and
incubated at 37±1º C. After 2-4 hours, wet mount was prepared
and examined under the microscope to look for the presence
of germ tube. The absence of microscopically visible germtubes
within this time is indicative of non-albicans Candida. All
Candida isolates were tested for the production of
chlamydospores in corn meal agar with Tween 80. The Candida
spp. was inoculated in corn meal agar (CMA) and then
incubated at 25±1ºC. After 72 hours, the plates were examined
under microscope for the presence of chlamydospores.
Chlamydospore formation is generally associated with
C.albicans.
All Candida isolates were subjected to carbohydrate
fermentation test. Carbohydrate solutions used were 6%
solution of glucose, maltose, lactose and sucrose with basal
media. Sugar tests were performed in beef extract broth with
bromothynol blue indicator and 1% final concentration of the
respective sugars, means for species identification (Gray and
Glenn,1970).
These were prepared from 9cm glass petridishes. The
required RH was obtained by adding appropriate mixture of
glycerin and distilled water (Mackenzie , 1971). Each chamber
consists of two bottom portions of glass petridishes, one
inverted on top of the other. They were rendered air and
water tight by sealing the junctions with parafilm. A portion
of glass tubing (3cm broad by 1.5cm high) placed within the
chamber served as a support for the test material and prevented
contact with the 15mL of RH solution in the base of the
chamber. A disc of heavy filter paper placed within the lids
of chambers maintained at 100% RH effectively minimized
disruption of test layers of cells by preventing the formation
and fall of water drops from the lower surfaces of the lids.
The range of RH values studied was 10% to 100%, at 10%
intervals.
Chambers were maintained at 25°C. Fresh RH solutions
were prepared before each trial and discarded immediately
after use. All glassware was clean and sterile prior to use.
R.H. solutions were not sterilized.
The primary objective of these studies was to determine
the effect of varying R H on the viability of individual Candida
spp. By careful counts and appropriate dilutions with sterile

DAS et al., Effect of Relative Humidity on Growth of Clinically Isolated Three Candida spp. 121
distilled water, cell densities of about 200/10mL were prepared.
After being shaken to ensure uniform distribution, sufficient
cell suspension was pipette into a sterile memberane filter
assembly (Millipore Corp.) to cover the 50mm memberane
completely and to permit the eventual deposition of cells 200
individual yeast cultures on its surface after negative pressure
filtration.
After filtration, the membrane was removed from the
assembly with sterile forceps, transferred to an RH chamber,
and maintained at 25°C for 48 hrs. it was then transferred to
the surface of a Sabouraud agar plate and incubated at 37°C
for 2 to 3 days. Viable cells developed into visible colonies
which were counted and recorded.
The experiment for the effect of relative humidity was
conducted and analyzed as a factorial experiment with three
replications in a completely randomized design. The results
were presented as the means with SEM (Standard error of the
mean).
RESULTS AND DISCUSSION
The expected results of speciation tests for Candida,
including the sugars used for fermentation and for general
tests, are listed in Table 1 and 2. Based on these criteria, the
three Candida spp. were identified as Candida albicans,
Candida parapsilosis and Candida tropicalis. It has been
the impression of clinicians that patients infected by Candida
other than C.albicans were not in life-threatening situations
and therefore less concern was given to these infections.
Louria, et al., 1967 indicated that C.tropicalis and perhaps
other Candida species cause severe and fatal infections. From
a clinical point of view, this means that all Candida isolates
from patients should be speciated with the tests which are
readily available and easy to perform.
Table 1.
Name of organism
Candida albicans
Candida parapsilosis
Candida tropicalis
Table 2.
Presumptive identification of Candida spp. on
Hicrome Candida agar
Colour of the Colony
Light green
White
Light blue
Bio-chemical tests for the clinically important
Candida spp.
Yeast species GTT Glucose Maltose Sucrose Blastoconidia
Candida albicans + AG AG - +
Candida parapsilosis - AG - - +
Candida tropicalis - AG AG AG +
humidity, growth of C.parapsilosis and C.tropicalis remained
the same both 10 % and 100 % R.H. (Table 3).
Table 3.
Effect of 48hrs of exposure to different relative
humidity (R.H.) on survival of Candida spp.
( 200 ×10 5 CFU/ml )
Relative
humidity
Candida
albicans
Candida
parapsilosis
Candida
tropicalis
10 193± 2.16 196 ± 2.49 195 ± 2.05
20 164 ± 2.62 193 ± 2.83 191.33 ± 2.33
30 139.66 ± 3.78 174.33 ± 2.37 173.66 ± 2.68
40 95.66 ± 2.88 167.33 ± 1.91 158 ± 2.16
50 85 ± 2.51 156.66 ± 1.91 147.33 ± 2.25
60 34.33 ± 1.52 151.66 ± 1.19 145.66 ± 2.76
70 58.33 ± 1.96 142.33 ± 1.66 152.33 ± 1.9
80 154 ± 2.94 166.33 ± 2.13 163.33 ± 2.42
90 188 ± 3.4 188.33 ± 2.88 193.33 ± 2.23
100 194 ± 2.16 196 ± 2.87 196 ± 2.05
Candida spp. are the most frequent opportunistic fungal
infection of humans. Although antifungal resistance in
C.albicans is less frequent than in other species , an increasing
number of resistance strains are emerging . The major virulence
factors of C.albicans are proteinase secretion, hyphal
formation , adhesion and phenotypic switching (Odds , 1988).
C.albicans a dimorphic fungus is able to grow in yeast and
hyphal forms depending on environmental condition. The
other two never remain in dimorphic form.
In the present report it has been observed that virtually
all cells maintained at 10% and 100% RH had survived but
C.albicans was adversely affected by 60% RH. That means
midrange humidities were lethal to C.albicans (Fig. 1). Even
the cells of C.albicans after 48hrs incubation in 60% RH
failed to develop colonies when transfered to the medium. No
such deleterious effect was observed either in C.parapsilosis
or C.tropicalis. The adverse effect of midrange R.H. on
C.albicans may be due the failure of cell to readjust to the
R.H. stress where as growth of C.albicans at 100% R.H. may
No. of Colonies
The findings showed C.albicans adversely affected by
levels of relative humidity. Mid range relative humidity 60%
was inhibitory to C.albicans ( 34.33 ± 1.52 number of colonies)
as compaired to C.parapsilosis ( 151.66 ± 1.19 number of
colonies) and C.tropicalis ( 145.66 ± 2.76 number of colonies).
No such adversity was observed in these two species with a
slightest change of growth in the middle range of relative
Fig. 1.
Relative humidity
Effect of 48hrs of exposure to different relative
humidity (R.H.) on survival of Candida spp.

122 Trends in Biosciences 3 (2), 2010
be due to metabolic readjustment due to dehydration. The
ability of C.parapsilosis and C.tropicalis to withstand a wide
range of R.H. may be due to genetic potential of the two
species. The findings are in consistent with the conclusions
reached by Marples, 1966.
ACKNOWLEDGMENT
The authors like to express thanks to the Lab personnels
of S.C.B. Medical College & Hospital, Cuttack and Head
Department of Applied & Industrial Microbiology, Utkal
University for co-opration in the study.
LITERATURE CITED
Brown-Thomsen, J. 1961. Reverse variations between Candida albicans
and Candida tropicalis. Acta Pathol. Microbiol. Scand, 66:143-
144.
Gray, W.P. and Glenn, P.R. 1970. Laboratory methods in basic
Mycology-In Bailey & Scott’s Dignostic Microbiology (3 rd edn.).
pp.266-269.
Louria, D.B., Blevins, A., Armstrong, D., Burdick, R. and Lieberman,
P. 1967. Fungemia caused by “nonpathogenic” yeasts. Arch
international Medicine, 119:247-252.
Mackenzie, D.W. 1971. Effect of relative humidity on survival of
Candida albicans and other yeasts. Applied Microbiology, 22(4):
678-682.
Mackey, J.P. and Sandys, G.H. 1966. Diagnosis of urinary infections.
British Medical Journal, 1:1173.
Marples, M.J. 1966. Some observations on the ecology of Candida
albicans, a potential mammalian pathogen. Proc. N.Z. Ecol. Soc.,
13: 29-34.
Odds, F.C. 1988. Candida and candidiasis. 2 nd ed. Baillere Tindal. London.
United Kingdom. pp.42-59.
Recieved on 09.10.2010 Accepted on 27.11.2010

Trends in Biosciences 3 (2): 123-126, 2010
Molecular Diversity Analysis of Chickpea Genotypes belonging to Nodulating
Groups
PREETI VERMA 1 , R.S. WALDIA AND A.K. CHHABRA
Department of Plant Breeding, College of Agriculture, CCSHAU, Hisar 125 004, Haryana
1
ARS (Under MPUAT, Udaipur), Ummedganj, Kota 324 001, Rajasthan
e-mail: preetiarskota2005@hotmail.com
ABSTRACT
Six chickpea genotypes belonging to three nodulating groups
along with their 4 F 1
’s were used to assess the genetic diversity
using RAPD markers. Twenty eight (28) out of 34 primers
screened were polymorphic. These primers generated 181 bands.
Out of these, 88% bands were polymorphic. This study showed
genotype as well as nodulation specific unique RAPD markers.
Among these genotypes genetic similarity indices ranged from
0.419 to 0.872 indicating ample amount of genetic variation.
The clustering pattern had six major groups among which nonnodulating,
medium nodulating and high nodulating parents
were grouped into three distinct clusters. Based on the RAPD
data the F 1
’s grouped in distinct clusters. Morphological
variation for nodulation showed corollary with their molecular
diversity thus describing that the RAPD markers may be
efficiently used for making desirable selection for nodulation
behavior in chickpea.
Key words
Chickpea, diversity, nodulation, RAPD
Chickpea (Cicer arietinum L.) is a self pollinated diploid
(2n=2x=16) annual grain legume grown extensively throughout
the Indian sub-continent, countries of North Africa, West Asia
and the Mediterranean region. The major reasons for the low
productivity of cultivated chickpea is due to limited genetic
variation in the available germplasm, its sexual incompatibility
with other Cicer wild types in natural interspecific crosses,
loss of primitive cultivars and its wild and weedy relatives
and genetic vulnerability to abiotic and biotic stresses (Singh,
et al., 2002).
Since the genetic improvement of a crop species
depends on the nature and extent of variability available for
manipulation, assessment of germplasm resources of cultivated
chickpea to generate information on genetic diversity of yield
contributing traits including nodulation and on genetic
relationships is an important component in breeding
programme. Genotypic differences in nodulation and nitrogen
fixation of chickpea are known (Rupela and Dart, 1980) and
can be exploited further. Since a good measure of genetic
variability is present for BNF (biological nitrogen fixation)
traits, breeding legume host plants for increased BNF appears
to be feasible.
Cultivated chickpea has shown low genetic
polymorphism based on morphological characters, seed
protein profile, isozyme studies (Muehlbauer and Singh, 1987;
Ahmad, et al., 1992; Kazan, et al., 1993; Gaur and Slinkard,
1991) and RFLP analysis (Udupa, et al., 1993).
RAPD markers have been extensively used as genetic
markers for assessment of genetic diversity, cultivar
identification and gene tagging (Devos and Gale, 1992; Gupta
and Gopalakrishna, 2008). In most cases, data on genetic
similarity obtained by RAPD analysis matched with the
genotypic classification based on morphological and
agronomic traits.
Keeping this view, the present study was conducted to
determine the extent of genetic variability among morphophysiologically
diverse chickpea genotypes at molecular level
and to identify the DNA markers for nodulation.
MATERIALS AND METHODS
The plant materials comprised of 6 genotypes viz.,
ICC4918 (Non-nodulating), ICC4993 (Non-nodulating), H96-
99 (Medium nodulating), HC-1 (Medium nodulating), HC-2
(High nodulating), HC-3 (High nodulating) and 4 F 1
’s viz.,
ICC4918 x HC-2, ICC 4918 x HC-3, ICC 4993 x HC-2, ICC 4993 x
HC-3 derived from crossing between non-nodulating and
high-nodulating genotypes. The crossing was conducted at
Pulses Section, Department of Plant Breeding, CCSHAU, Hisar
during rabi 2004-05. Above genotypes were chosen on the
basis of several criteria including suitability, morphological
diversity and their importance in chickpea breeding
programme.
Total genomic DNA was extracted from 2-3 week old
seedlings using CTAB method (Saghai-Maroof, et al., 1984).
DNA concentration was measured visually on agarose gels
and quantified by UV spectrophotometer.
Thirty four random decamer primers (Operon
Technologies, USA) were used for the amplification of RAPD
markers. PCR was carried out in 20 µl reaction volume
containing 50 çg of genomic DNA, 1 unit of TaqDNA
polymerase, 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 0.1% Triton-
X-100, 2mM MgCl 2
, 100 µm of each dNTPs and 0.2 µM of
primer. Amplification was carried out in a thermocycler
programmed with an initial strand separation at 94 o C for 5 min.
and 45 cycles at 94 o C for 1 min. (denaturation), 40 o C for 1 min.
(annealing), 72 o C for 3 min. (extension) followed by a final

124 Trends in Biosciences 3 (2), 2010
extension step of 15 min. at 72 o C.
Amplification products were electrophoresed in 1.5%
agarose gel and detected by staining with ethidium bromide
and visualized by illumination under UV light. Standard
molecular weight marker (Lambda DNA EcoRI + Hind III) was
also used in each electrophoretic run. Special care was taken
to eliminate variations in DNA concentration and other PCR
components and to ensure consistent reaction conditions and
thermal profiles during amplification. Bands with the same
mobility were considered as identical fragments, receiving
equal values, regardless of their staining intensity. When
multiple bands in a region were difficult to resolve, data for
that region of the gel was not included in the analysis.
The amplified bands were scored as one (present) and
zero (absent). A data matrix of 1’s and 0’s was prepared from
the 181 bands scored. Data were used for similarity based
analysis using the programme of NTSYS-PC. Jaccard’s
similarity coefficient was used to construct UPGMA
(unweighted pair group method with arithmetic average) based
dendrogram to reveal the genetic relatedness among the
genotypes.
RESULTS AND DISCUSSION
Out of the thirty four decamer nucleotide primers used
for RAPD analysis, 28 primers showed amplification, all of
which were polymorphic. Unamplified primers may have
special requirements for amplification in terms of PCR reagents
or temperature profile. Weeden, et al., 1992 and Ahmad, 1999
also reported variation in the efficiency of primer amplification.
In wheat, Devos and Gale, 1992 found that the optimal
concentration of DNA template differed with the primer used.
They also speculated that the efficiency of a primer
amplification varied as a result of the absence of suitable
priming sites in the genomic DNA. Consequently, PCR
parameters should ideally be adjusted for primer to optimize
the amplification.
The 28 polymorphic primers showing amplification
generated a total of 181 bands, out of which 160 bands were
polymorphic and 21 bands generated by 7 primers were
monomorphic (Table 1). Varying number of bands were
amplified in different species. The number of bands for each
primer varied from 2 (OPB-18 and OPH-11) to 16 (OPC-08).
Identification of plant cultivar has become increasingly
important with the requirement of Plant Breeders Rights (PBR)
to demonstrate distinctness, uniformity and stability (DUS)
for each new cultivar. Traditionally, cultivar identification has
relied on morphological and agronomic characteristics of plant
materials. Although there is substantial intra-specific variation
in vegetative traits in chickpea especially leaf, floral and fruit
characters, it is difficult to distinguish genotypes on their
Table 1. Random primers showing polymorphism among chickpea genotypes and selected F 1
’s
Primers
Sequence
(5' 3')
No. of genotypes
amplified
Total
bands
No. of monomorhpic
bands
No. of polymorphic
bands
%
polymorphism
OPA-02 TGCCGAGCTG 10 13 7 6 46.15
OPA-04 AATCGGGCTG 9 6 0 6 100.00
OPA-06 GGTCCCTGAC 5 5 0 5 100.00
OPB-05 TGCGCCCTTC 10 7 4 3 42.85
OPB-18 CCACAGCAGT 10 2 1 1 50.00
OPC-02 GTGAGGCGTC 10 5 1 4 80.00
OPC-05 GATGACCGCC 10 9 0 9 100.00
OPC-06 GAACGGACTC 6 5 0 5 100.00
OPC-07 GTCCCGACGA 7 5 0 5 100.00
OPC-08 TGGACCGGTG 10 16 0 16 100.00
OPC-09 CTCACCGTCC 10 12 2 10 83.33
OPC-12 TGTCATCCCC 5 5 0 5 100.00
OPC-18 TGAGTGGGTG 8 10 0 10 100.00
OPD-02 GGACCCAACC 10 12 0 12 100.00
OPD-05 TGAGCGGACA 8 4 0 4 100.00
OPD-07 TTGGCACGGG 5 6 0 6 100.00
OPD-08 GTGTGCCCCA 10 9 5 4 44.44
OPD-10 GGTCTACACC 6 5 0 5 100.00
OPD-19 CTGGGGACTT 7 6 0 6 100.00
OPG-02 GGCACTGAGG 6 4 0 4 100.00
OPG-08 TCACGTCCAC 7 8 0 8 100.00
OPG-20 TCTCCCTCAG 1 4 0 4 100.00
OPH-11 CTTCCGCAGT 2 2 0 2 100.00
OPH-15 AATGGCGCAG 10 6 1 5 83.33
OPH-20 GGGAGACATC 8 6 0 6 100.00
OPI-08 TTTGCCCGGT 6 3 0 3 100.00
OPO-06 CCACGGGAAG 6 8 0 8 100.00
OPQ-07 CCCCGATGGT 8 4 0 4 100.00
Total 181 21 160 88.39 (mean)

Verma et al., Molecular Diversity Analysis of Chickpea Genotypes belonging to Nodulating Groups 125
external morphology alone because phenology and
morphological characteristics may not be significantly distinct
and usually require growing plants to full maturity prior to
classification. Further, these phenotypic characters are
generally influenced by environmental factors and the growth
stage of the plant. In view of this, cultivar identification based
on molecular markers becomes important.
In the present study, no single primer was able to
discriminate all the cultivars. However, amplifications by
different primers were informative and produced a cultivar
specific pattern. Certain genotype specific bands were
identified i.e. these were found in specific genotype (present
in only one genotype but absent in the remaining genotypes).
Seventeen primers showed polymorphism specific to a
particular genotype. These bands could be used for species
identification purposes. A total of twenty nine unique DNA
bands were found among all the genotypes across all the
primers analysed (Table 2). These unique bands could be used
to distinguish the cultivars from the other cultivars, if these
Table 2.
Unique DNA fragments for different chickpea
genotypes and selected F 1
’s
Primer Genotype/F 1’s Unique band (MW)
OPA-04 ICC 4918 x HC-3 1300 bp (+)
OPA-06 ICC 4993 x HC-2 2040 bp (+), 1904 bp (+), 1375 bp (+)
OPC-02 ICC 4918
ICC 4993
889 bp (-),
150 bp (-)
OPC-06 ICC 4993 x HC-2 550 bp (+)
OPC-07 HC-2 564 bp (+)
OPC-08 ICC 4993 x HC-2 1590 bp (+)
OPC-09 ICC 4918 630 bp (+), 297 bp (-)
OPC-12 IC 4993 x HC-2 2040 bp (+), 1904 bp (+), 1375 bp (+),
OPD-02 H 96-99 2785 bp (+), 2765 bp (+), 564 bp (-)
OPD-05 HC-1 1400 bp (+)
OPD-10 ICC 4993 x HC-3 750 bp (+)
OPD-19 ICC 4993 x HC-3 1375 bp (+), 1161 bp (+)
OPG-02 ICC 4993 x HC-2 1161 bp (+)
OPG-20 ICC 4993 x HC-3 1350 bp (+), 564 bp (+), 500 bp (+), 400
bp (+)
OPH-11 ICC 4918 x HC-3 880 bp (+)
OPH-15 IC 4918 x HC-2 600 bp (+)
OPO-06 ICC 4918 280 bp (+)
loci can be proven to be homozygous by examining several
plants from each of the cultivars.
In addition to the above primers, three primers (OPC-05,
OPC-09 and OPD-08) generated unique DNA bands specific
to a particular nodulating group of chickpea (Table 3). OPC-05
and OPC-09 amplified a unique band in each of the medium
nodulating genotypes (H 96-99 and HC-1) of 400 bp and 1584
bp, respectively, while OPD-08 amplified a fragment of 800 bp
only in high nodulating genotypes i.e. in HC-2 and HC-3.
Since these unique bands are genotype specific, so can be
used in identification and registration in the national gene
banks. Identification of such desirable linkages would help in
marker assisted breeding of chickpea. Specific bands in these
primers (OPC-05, OPC-09, and OPD-08) can be converted to
sequence characterized amplified regions (SCARs) which can
be useful for getting nodulation specific profiles.
Table 3.
Unique bands distinguishing chickpea nodulating
groups
Primer Band (MW) Group distinguished Genotypes
OPC-05 400 bp (+) Medium nodulating H96-99 and HC-1
OPC-09 1584 bp (+) Medium nodulating H96-99 and HC-1
OPD-08 800 bp (+) High nodulating HC-2 and HC-3
The similarity index values ranged from 0.419 to 0.872
depicting considerable genetic variability among the
genotypes (Table 4). Two genotypes HC-1 and HC-3 displayed
highest genetic similarity (0.872) followed by HC-2 and HC-3
(0.834) while ICC 4993 and ICC 4993 x HC-2 were least similar
(0.419).
Cluster analysis was performed to generate a dendrogram
showing overall genetic relatedness among Cicer species.
Six distinct clusters were identified. The first cluster comprised
of both of the non-nodulating genotypes ICC 4918 and ICC
4993. The F 1
crosses formed a distinct group from their parents.
The F 1
crosses between non-nodulating desi and highnodulating
desi genotypes (ICC 4918 x HC-2) and (ICC 4918 x
HC-3) fell in the same group and formed the second cluster.
This was not unexpected since these genotypes were closely
related in their pedigree. The F 1
cross between non-nodulating
Table 4.
Similarity index values (generated using RAPD data) among various chickpea genotypes and selected F 1
’s differing
for nodulation
1 2 3 4 5 6 7 8 9 10
1 1.00 0.77 0.66 0.59 0.65 0.66 0.66 0.68 0.50 0.67
2 1.00 0.61 0.70 0.72 0.72 0.72 0.64 0.41 0.66
3 1.00 0.74 0.72 0.71 0.45 0.50 0.60 0.55
4 1.00 0.75 0.87 0.59 0.44 0.53 0.54
5 1.00 0.83 0.61 0.51 0.49 0.55
6 1.00 0.61 0.48 0.58 0.53
7 1.00 0.77 0.49 0.67
8 1.00 0.55 0.74
9 1.00 0.53
10 1.00
1: ICC4918; 2: ICC4993; 3: H96-99; 4: HC-1; 5: HC-2; 6: HC-3; 7: ICC4918 x HC-2; 8: ICC 4918 x HC-3; 9: ICC 4993 x HC-2; 10: ICC 4993 x
HC-3

126 Trends in Biosciences 3 (2), 2010
kabuli and high nodulating desi genotypes (ICC 4993 x HC-3)
formed the third group. A medium nodulating genotype (H 96-
99) formed the fourth cluster. Two high nodulating genotypes
(HC-2 and HC-3) clustered with another medium nodulating
genotype (HC-1) formed the fifth group. HC-1, HC-2 and HC-
3 with the parentage of (F 61 x L 550), (S 208 x E 100 Ym) and (L
550 x E 100 Y m) respectively, grouped together, one parent
being common in them. The most conspicuous was the F 1
cross ICC 4993 x HC-2 which did not cluster with any of the
genotypes and was the most distantly placed having only
52% similarity with the rest of the genotypes.
Even though clustering does not always strictly follow
morphological classification but morphological characters like
presence or absence of nodulation seems to have high
influence on clustering. The clustering pattern of dendrogram
showed a corollary with their nodulation behaviour i.e. high
nodulating in one group, medium in another and non nodulating
in another. There was clear correlation between clustering of
genotypes and their nodulation behaviour. Large genetic
distances were observed between genetically different
varieties suggesting that it was clearly possible to detect
relatively more polymorphism by random amplification. These
findings corroborate the earlier studies of Ahmad (1999) in
chickpea, grouping nine different Cicer taxa into four different
clusters. Singh, et al., 2002 grouped 23 chickpea genotypes
into two major clusters using RAPD.
In the present study, the estimate of genetic distance
measures and the clustering obtained by UPGMA have
depicted the extent of genetic relatedness among annual Cicer
species and their relationships. Genetic variation at the DNA
level is of prime importance in grouping genotypes to different
heterotic groups which can be of great relevance in assessing
combining ability and developing maximum heterosis
(Ratnaparkhe, et al., 1995). Promising parents for hybridization
can then be constituted. The phylogenetic grouping of
genotypes differing in their nodulating behaviour shows the
efficiency of RAPD technique in the present study.
Diversity analysis including parents and F 1
’s will help
to select diverse segregants that can be used in hybridization
programme to generating more genetic variability , by
following two way or three way crosses among F 1
’s. The
unique bands obtained in this research can be eluted from the
gel, sequenced and compared with the available database like
BLAST search centre. If any fragment or part of the fragment
matches with any available gene in chickpea or any other
organism, it may be cloned and transferred in desirable genetic
backgrounds to develop useful transgenics. Alternatively,
these fragments can be used markers for QTL detections and
can also be used as probes to fish out related genes from
different crop species or organisms.
ACKNOWLEDGEMENT
The first author gratefully acknowledges Indian Council
of Agricultural Research (ICAR) for providing her financial
assistance in terms of Senior Research Fellowship during the
period of study.
LITERATURE CITED
Ahmad, F.1999. Random amplified polymorphic DNA (RAPD) analysis
reveals genetic relationships among the annual Cicer species. Theor.
Appl. Genet., 98: 657-663.
Devos, K.M. and Gale, M.D. 1992. The use of random amplified
polymorphic DNA markers in wheat. Theor. Appl. Genet., 84: 567–
572.
Gaur, P.M. and Slinkard, A.E. 1991. New Isozyme Markers for Chickpea.
International Chickpea Newsletter, 23: 5-8.
Gupta, S. K. and Gopalakrishna, T. 2008. Molecular markers and their
application in grain legumes breeding. J. of Legume Research. 21(1):
1-14.
Kazan, K., Muehlbauer, F.J., Weeden, N.F. and Ladizinsky, G. 1993.
Inheritance and linkage relationships of morphological and isozyme
loci in chickpea (Cicer arietinum L.). Theor. Appl. Genet. 86: 417-
426.
Muehlbauer, F.J. and Singh, K.B. 1987. Genetics of chickpea. In: The
Chickpea (eds. Saxena, M.C. and Singh, K.B) CAB Int. Publication.
pp. 99–126.
Murray, M.G. and Thompson, W.F. 1980. Rapid isolation of high
molecular weight plant DNA. Nucleic Acids Res., 8: 4321-4325.
Ratnaparkhe, M.B., Gupta, V.S., Murthy, Ven M.R. and Ranjekar, P.K.
1995. Genetic fingerprinting of pigeonpea (Cajanus cajan (L.)
Millsp.) and its wild relatives using RAPD markers. Theor. Appl.
Genet., 91: 893-898.
Rupela, O.P. and Dart, P.J. 1980. Research on symbiotic nitrogen
fixation by chickpea at ICRISAT. In: Proceedings International
Workshop on Chickpea. Improvement, ICRISAT, Patancheru, A.P.,
India, pp. 161-167.
Saghai – Maroof, M.A., Soliman, K.M., Jorgensen, R.A. and Allard,
R.W. 1984. Ribosomal DNA spacer length polymorphisms in barley;
Mendelian inheritance, chromosomal location and population
dynamics. Proc. Natl. Acad. Sci. USA, 81: 8014–8018.
Singh, R. P., Durga, C., Singhal, V. and Randhawa, G. 2002. Analysis of
genetic diversity in Cicer arietinum L. using random amplified
polymorphic DNA markers. J. Plant Biochem. Biotech., 11: 109-
112.
Udupa, S.M., Sharma, Anuradha, Sharma, R.P. and Pai, R.A. 1993.
Narrow genetic variability in Cicer arietinum L. as revealed by
RFLP analysis. J. Plant Biochem. Biotech., 2: 83-86.
Weeden, N.F., Timmerman, G.M., Hemmat, M., Kneen, B.E. and
Lodhi, M.A.1992. Inheritance and reliability of RAPD markers.
In: Application of RAPD technology to plant breeding. Crop Science
Society of America, Madison, Wis. pp. 12–17.
Recieved on 31.10.2010 Accepted on 15.11.2010

Trends in Biosciences 3 (2): 127-129, 2010
Genetic Divergence in Mungbean Under Two Environments
G. ROOPA LAVANYA 1 , RASHMI JAIN AND ANSHUL SRIVASTAVA
1
Department of Genetics and Plant Breeding, Allahabad School of Agriculture, Sam Higginbottom Institute
of Agriculture, Technology and Sciences, Allahabad 211 007, Uttar Pradesh
e-mail: lavanya.roopa@gmail.com
ABSTRACT
An experiment was conducted with an objective to study genetic
diversity available in mungbean germplasm for the
identification of genetically diverse and agronomical superior
accessions. The mungbean genotypes were distributed into five
and six clusters based on Euclidean distances under two
environments, respectively. Cluster IV evolved as a major cluster
in one environment and III and IV as large cluster in other
environment. Distribution of genotypes into different clusters,
suggested the presence of substantial genetic divergence among
the germplasm. Inter cluster distance was found maximum
between clusters I and II during kharif, 2005 and I and VI or I
and IV during zaid, 2006. The crosses between parents with
maximum genetic divergence are generally the most responsive
for genetic improvement in mungbean. Mean performance of
different clusters were variable, suggesting wide range of
differences between clusters.
Key words
Mungbean, genetic divergence, cluster distance
In self pollinated crops like mungbean (Vigna radiata
L. Wilczek), it is important to select divergent parents for
hybridization to achieve desirable segregants through
selection in the advanced breeding generations. For this, it is
important to know the nature and magnitude of genetic
diversity present in the germplasm collection of the crop. The
more diverse the parents, the greater will be the chance of
obtaining heterotic combinations and broad spectrum of
variability in segregating generations (Arunachalam, 1981). A
number of studies on genetic divergence have been conducted
on mungbean with varying number of genotypes under a
specific environment or at a specific location. Diverse parents
can not be selected based on previous work done. Keeping in
view the above perspectives, the present experiment was
designed to assess the magnitude of genetic divergence
among mungbean genotypes to know their behaviour under
different environments/ seasons.
MATERIALS AND METHODS
The experiment was conducted during kharif, 2005 and
zaid, 2006 at Field Experimentation Center, Department of
Genetics and Plant Breeding, SHIATS, Allahabad comprising
25 mungbean genotypes. All genotypes in both environments
were planted in randomized complete block design with three
replications of plot size 1x1 m 2 with 30cm and 10cm inter- and
intra- row spacing, respectively. Five randomly selected
competitive plants of each genotype of each replication were
taken under both environments for recording observations
on 11 morphological characters viz., days to 50% flowering,
plant height (cm), number of primary branches, number of
clusters plant -1 , number of pods cluster -1 , number of pods
plant -1 , number of seeds pod -1 , pod length (cm), days to
maturity, 100-seed weight (g) and seed yield plant -1 (g).
Recommended cultural practices and plant protection
measures were followed to raise a healthy crop. The data on
days to 50% flowering and maturity were recorded on plot
basis. The environment-wise data was subjected to
multivariate analysis as suggested by Mahalanobis, 1936
separately and genotypes were grouped into different clusters
based on Euclidean distances by non- hierarchical cluster
analysis (Spark, 1973).
RESULTS AND DISCUSSION
In the present study, genotypes were grouped into five
clusters during kharif and six clusters during zaid, 2006 (Table
1). Cluster IV comprised 10 genotypes, evolving the largest
cluster, followed by clusters III and V with five genotypes
each and cluster II comprised four genotypes while, cluster I
emerged as mono genotypic and constituting only one
genotype i.e., KM5 165 during kharif, 2005. Clusters III and
IV comprised six genotypes each, evolving the large clusters,
followed by clusters I and II with five genotypes each and
cluster V comprised two genotypes, while cluster VI emerged
as mono genotypic and constituting only one genotype i.e.,
KM5 175 during zaid, 2006 (Table 1).
Distribution of genotypes into different clusters,
suggested the presence of substantial genetic divergence
among the genotypes and indicated that this material may
serve as good source for selecting the diverse parents for
hybridization programme aimed at isolating desirable
recombinants for seed yield as well as other characters (Raje
and Rao, 2001). The grouping of genotypes originating from
different eco-geographical regions into one cluster could be
attributed to frequent exchange of breeding material and
operation of similar forces of natural and artificial selection
resulting in perpetuation, adaptation and stabilization of similar
genotypes (Murty and Arunachalam, 1966). The perusal of
clustering pattern of the genotypes clearly revealed the lack
of relationship between geographic distribution and genetic

128 Trends in Biosciences 3 (2), 2010
Table 1.
Table 2.
Intra-(diagonal) and inter-cluster average distances (D 2 ) in mungbean
Cluster No. Environ. I II III IV V VI
I
E 1 0.000 62.489 12.285 19.865 38.963 ---
E 2 193391 25.948 42.980 72.458 66.462 82.386
II
E 1 3.244 37.921 12.103 29.008 ---
E 2 10.805 21.459 32.823 28.042 52.665
III
E 1 3.157 8.105 22.534 ---
E 2 13.727 17.079 26.571 49.001
IV
E 1 5.364 14.183 ---
E 2 8.529 18.897 43.885
V
E 1 3.717 ---
E 2 9.136 29.772
VI E 2 0.000
Table 3.
Cluster
No.
I
II
III
IV
Distribution of mungbean genotypes into different clusters
Cluster No. Environment Number of genotypes
Genotypes included
I
E 1 1 KM5 165
E 2 5 KM5 179, KM5 152, KM5 160, IPRM 90, PS 16
II
E 1 4 KM5 160, KM5 152, PDM 1, PDM 54,
E 2 5 KM5 173, KM5 183, KM5 168, PDM 1, ML 131
III
E 1 5 KM5 173, KM5 180, KM5 182, PS 16, IPRM 90,
E 2 6 KM5 174, KM5 189, KM5 191, KM5 156, SAMRAT, ML 5
IV
E 1 10 KM5 179, KM5 155, KM5 174, KM5 168, KM5 191, KM5 156, KM5 175, KM5 183, HUM 1,
ML 131
E 2 6 KM5 180, KM5 182, KM5 155, KM5 186, PDM 54, HUM 1
V
E 1 5 KM5 186, KM5 189, KM5 183, SAMRAT, ML 5
E 2 2 KM5 153, KM5 165
VI E 2 1 KM5 175
Clusters mean values for 11 characters in mungbean
Environ. Days to
50%
flowering
Plant
height
(cm.)
Primary
branches
plant -1
No. of
clusters
plant -1
No. of
pods
cluster -1
No. of
pods
plant -1
No. of
seeds
pod -1
Pod
length
(cm.)
Days
to
maturity
100-seed
weight
(g.)
Seed yield
plant -1
(g.)
E 1 41.67 44.00 1.33 7.00 3.66 25.00 11.33 8.33 62.00 4.00 11.33
E 2 43.33 55.15 1.45 5.78 4.13 31.67 11.67 8.80 66.56 3.77 8.21
E 1 46.17 72.55 2.77 2.39 1.88 6.33 12.00 7.83 66.00 4.67 3.61
E 2 42.11 50.37 1.25 6.37 4.15 32.00 11.00 8.16 64.56 3.39 7.97
E 1 42.22 58.11 1.59 4.18 3.77 22.59 12.22 8.00 62.22 4.78 13.00
E 2 41.58 45.49 1.11 6.55 4.50 24.33 11.92 10.04 64.33 4.48 10.29
E 1 43.88 62.48 2.14 4.32 2.73 16.63 12.00 8.46 62.25 4.50 8.76
E 2 40.08 40.50 1.31 6.25 4.62 23.17 11.42 10.05 63.00 4.67 8.06
E 1 41.67 58.26 1.63 2.85 1.92 9.40 12.67 9.78 62.00 5.33 6.28
V
E 2 42.66 37.45 1.84 6.78 4.16 23.50 11.33 8.50 63.17 4.03 9.74
VI E 2 40.33 34.33 1.67 8.89 4.11 30.33 12.33 8.33 69.00 3.97 9.69
divergence as the distribution of accessions into various
clusters was fairly random (Swamy and Reddy, 2004 and
Bhattacharya and Laxmi, 2005). Therefore, selection of parents
for hybridization should be based on genetic diversity rather
than geographic distribution.
The intra- and inter-cluster average distances among
five clusters during kharif, 2005 and zaid, 2006 were variable
(Table 2). The maximum intra-cluster distance (D 2 ) was
registered for cluster IV (5.364) whereas maximum inter-cluster
distance (D 2 ) was found between clusters I and II (62.489).
The maximum intra-cluster distance (D 2 ) was registered for
cluster I (19.391) whereas maximum inter-cluster distance (D 2 )
was found between clusters I and VI (82.386). Clusters with
maximum inter cluster distance were found to be highly
divergent groups. Hence inter cluster distance must be taken
into consideration while selecting the parents for a
hybridization programme. Clusters with maximum inter cluster
distance were found to be highly divergent groups.
Mean performance of different clusters revealed wide
range of differences between clusters (Table 3). During kharif,
2005, cluster I recorded high mean performance for number of
clusters plant -1 , number of pods cluster -1 , number of pods
plant -1 and seed yield plant -1 . Further, cluster I included
genotypes of short stature and showed earliness to days to
50% flowering and maturity. Cluster II comprised the
genotypes of high plant stature and late maturity while cluster
III showed early maturity and high mean performance for
number of pods cluster -1 , number of pods plant -1 , 100 seed

LAVANYA et. al., Genetic Divergence in Mungbean Under Two Environments 129
weight and seed yield plant -1 . Cluster V registered high mean
performance for number of seeds pod -1 , pod length and 100
seed weight with earliness in flowering and maturity. The
factors responsible for differentiation of intra- and inter-cluster
levels were different in different environments as indicated
by cluster means of various characters (Patil, et al., 2003).
During zaid, 2006, cluster I and II recorded high mean
performance for number of pods plant -1 while cluster III showed
high mean performance for number of seeds pod -1 , 100 seed
weight and seed yield plant -1 . The genotypes included in
cluster III had maximum 100 seed weight along with earliness
in days to 50% flowering and maturity. Cluster IV registered
high seed yield plant -1 along with earliness in maturity and
short plant stature. The shortest plant height was recorded
for cluster VI with high mean performance for number of
clusters plant -1 , number of seeds pod -1 and seed yield plant -1 .
LITERATURE CITED
Arunachalam, V. 1981. Genetic distance in plant breeding. Indian
Journal of Genetics and Plant Breeding, 41(2): 226-236.
Bhattacharya, A. and Laxhmi, V. 2005. Genetic diversity in mungbean
for phonological, physiological and yield forming traits. Legume
Research, 28(1): 1-6.
Mahalanobis, P.C. 1936. On the generalized distance in statistic. In :
Proceedings of National Institute of Sciences, India, 2: 49-55.
Murty, B.R. and Arunachalam V. 1966. The nature and divergence in
relation to breeding systems in some crop plants. Indian Journal of
Genetics and Plant Breeding, 26: 188-198.
Patil, B.L., Hegde, V.S. and Salimath, P.M. 2003. Studies on genetic
divergence over stress and non stress environment in mungbean
(Vigna radiata L. Wilczek). Indian Journal of Genetics and Plant
Breeding, 63(1): 77-78.
Raje, R.S. and Rao, S.K. 2001. Genetic diversity in germplasm collection
of mungbean (Vigna radiata L. Wilczek). Indian Journal of Genetics
and Plant Breeding, 61(1): 50-52.
Spark, D.N. 1973. Euclidean cluster analysis. Algorithm Applied
Statistics, 22: 126-130.
Swamy, A.A. and Reddy, G.L.K. 2004. Genetic divergence and heterosis
studies in mungbean (Vigna radiata L. Wilczek). Indian Journal of
Genetics and Plant Breeding, 27(2): 115-118.
Recieved on 06.10.2010 Accepted on 12.11.2010

130 Trends in Biosciences 3 (2): 130-132, 2010 Trends in Biosciences 3 (2), 2010
Effect of Curd Size on Seed Yield and Seed Quality Parameters of Cauliflower
(Brassica oleracea var. botrytis L.)
HEMANT KHULBE, PRABHA SHANKAR SHUKLA, DEEPA KHULBE AND SHAMBHOO PRASAD
Department of Seed Science and Technology, GBPUA&T, Hill Campus, Ranichauri, Tehri Garhwal
e-mail: p.s.shukla@rediffmail.com
ABSTRACT
The seed production of cole crop is profitable enterprise in the
country. Public as well as private sector companies playing an
important role in production of cole crop vegetable seeds but to
obtain the optimum production of quality seeds the knowledge
of economic yield and quality of seeds is very essential. The
various curd size of the variety i.e. Pusa Snowball K-1 has a
direct effect on seed yield and quality parameters in cauliflower.
A wide spectrum of variation in respect of seed yield contributing
characters and seed vigour parameters among various curd size
was noticed. it can be concluded that among the treatments
extra large curd size showed maximum potential for seed yield
while, extra large and medium curd size were promising for
seed quality parameters.
Key words
Cauliflower, curd size, seed vigour, germination, seed
yield
Cauliflower (Brassica deracea var. botrytis L.) holds an
important position among the vegetable crops and there is a
great demand of this vegetable throughout the year, but the
production of cauliflower is poor due to non availability of
quality seed of recommended varieties. High quality seeds is
essential and desirable to ensure good crop establishment for
many field crops; one of the main problem observed in the
field i.e. poor seedling stand establishment which is influenced
by seed quality, adverse climatic conditions and poor field
management. Cole crops are most vulnerable among cross
pollinated crops due to the problem of requirement of
satisfactory isolation distance. To maintain optimum isolation
distance is one of the major constraints faced by the seed
production of cauliflower as out-crossing between varieties
can take place. According to Kanwar, et al., 2000 reported that
the increasing germination per cent, 1000-seed weight and
yield per hectare with increasing head compactness in
cabbage. Kanwar, et al., 2001 reported the early flowering,
high seed yield and high germination per cent were recoded
with the heavy head weight class. The present investigation
is study to know the effect of curd size on seed quality.
MATERIALS AND METHODS
The field experiment was conducted during rabi season
of 2006-07 at research block of the Department of Seed Science
and Technology, G.B. Pant University of Agriculture and
Technology, Hill Campus, Ranichauri, Tehri Garhwal,
Uttarakhand. The planting material used in the present study
was cauliflower cv. Pusa Snowball K-1. The experiment was
laid out in a complete randomized block disign with four
replications. Curd size used as a treatment and its classification
done on the basis of curd diameter i.e. very small, small, medium,
large and extra large. The diameter of all the curds was taken
in two directions at maturity and diameter was calculated by
averaging these values of each treatment. Curd diameter of 0
to 7.0 cm was taken as very small, 7.0 to 14.0 cm as small, 14.1
to 21.0 cm was treated as a medium curd size, 21.1 to 28 cm
were used as a large curd size while, more than 28 cm as a extra
large curd size. After classification of curd size hundred seeds
of each curd size were placed in wet filter paper in petriplates
for 10 days according to Association of Official Seed Analyst
(AOSA), 1993 with the addition of water 25 times the paper
weight and placed at 25 ±1 0 C in seed germinator. The first
count was calculated after 5 th days of start of germination
while, standard germination was counted after 10 days of start
test. After 10 days ten seedlings selected randomly and its
root, shoot and seedling length was measured with the help
of meter scale. Fresh weight was taken after measuring seedling
length and dry weight were taken after drying at 80 ± 1 0 C for
4h. Seedlings vigour index I was calculated according to
formula i.e. standard germination multiply with seedling length
while seedling vigour index II was calculated with the formula
standard germination multiply with seedling dry weight.
Analysis of variance in the laboratory data were carried out
using SAS software (SAS, 1996) and least significance
difference (LSD= 0.05 %) values were indicated for comparison
RESULTS AND DISCUSSION
High quality seed is basic requirement to ensure good
crop establishment. Poor crop establishment is the main
problem largely influence by seed quality parameters. In the
present study different curd size of cauliflower showed
significant difference with days to curd initiation, 1000-seed
weight, seed yield per plant, number of siliqua per plant, first
count, standard germination, and seedling length along with
seed viability while, reset of the characters showed non
significant difference with curd size. Results revealed that all
the characters influence by curd size (Table 1). Curd diameter
is an important yield component showed highest yield in extra
large curd size. The data revealed that the maximum days (132.5
days) to curd initiation were observed in very small curd size

KHULBE et. al., Effect of Curd Size on Seed Yield and Seed Quality Parameters of Cauliflower 131
while, minimum days of curd initiation was recorded in medium
curd size i.e. 126.9 days. In the mountain farming late maturity
constitutes a major criterion in raising the cauliflower crops
and late curd initiation may be due to prolonged low
temperature and light coupled with medium snow fall during
cropping period. The physiological activities of plant growth
and development could have been affected because of low
soil and air temperature. Similar findings were reported by
Bhutia and Ram, 1980 in cauliflower and Kanwar, et al., 2001
and Kanwar and Singh, 2001 in cabbage.
Significantly maximum days to stalk initiation were
observed in small curd size while, minimum was recorded in
large curd size. Days to stalk initiation varied from 152.35 to
160.55 days. However, significant difference were observed
in case of height of stalk at maturity, statistically highest stalk
length at maturity were recorded at very small curd size i.e.
55.24 cm. This finding is lined with the findings of Chatterjee
and Som, 1990 and Chatterjee, 2006 in cauliflower. Number of
primary branches was recorded maximum in case of medium
curd size i.e. 10.50 while, minimum number of primary branches
(7.25) were found in very small curd size. However, maximum
numbers of secondary branches (48.20) were observed in extra
large curd size and minimum numbers of secondary branches
(29.20) were recorded in case of small curd size. Significant
effect of curd size on number of siliqua per plant and number
of seed per siliqua were observed and it is noticed that these
two parameters may be positively correlated to the seed yield
per plant. Statistically higher number of siliqua per plant (386.0)
and number of seed per siliqua (10.56) was recorded in extra
large and medium curd size respectively while, minimum
number of siliqua per plant and minimum number of seed per
siliqua in case of very small curd size i.e. 159.60 and 8.40
respectively. The results are supported by the similar findings
Table 1.
of Singh, et al., 2000 in cabbage and Jana, 2004 in cauliflower.
Different curd size significantly affected the 1000-seed
weight and seed yield per plant and statistically higher value
of 1000-seed weight (3.81 g) was recorded in small curd size
while, lowest value for 1000-seed weight (3.30 g) was recorded
for large curd size. In present study it is noticed that seed
yield per plant increasing with increasing curd size and
statistically maximum seed yield per plant (Table 1). Seed yield
per plant was affected by various yield contributing characters
and its increasing with increasing curd size might be due to
the proper utilization of accumulates which were conserved
by plant. These findings are in conformity with the findings
of Singh, et al., 2005 in cauliflower.
Maximum first count was recorded at medium curd size
i.e. 83.89 per cent while, minimum first count were observed at
very small curd size which is 76.65 per cent but, standard
germination per cent was recorded maximum (89.50) in the
small curd size while it is minimum in the large curd size (85.39).
Similar pattern was recorded in seed viability, which is range
from 98.50 per cent to 95.90 per cent. Maximum seed viability
was found at extra large curd size while, minimum seed viability
was found in case of very small curd size. This finding is in
the conformity of the Strydom, 1998 in cauliflower. There is
significance difference was observed in seedling length with
curd size, seedling length varied from 12.54 cm to 12.98 cm
which is at par with all the treatments (Table 1). Maximum
seedling length was recorded at medium curd size (5.79 cm)
and minimum seedling length was observed at very small curd
size (5.30 cm). Maximum shoot length was found at very small
curd size i.e. 7.48 cm where as minimum shoot length was
observed at medium curd size i.e. 6.87 cm. Such type results
were also reported by Kanwar, et al., 2001 in cabbage. Maximum
Mean performance of curd size of different seed yield and quality contributing characters of cauliflower
Sl. No. Treatments (Characters) Very small Small Medium Large Extra large GM CD (0.05%) CV (%)
1 Curd diameter (cm) 6.39 12.03 18.13 24.87 29.77 18.24 0.62 2.23
2 Days to curd initiation 132.50 132.30 126.90 129.15 130.15 130.20 6.00 2.99
3 Days to stalk initiation 157.25 160.55 154.10 152.35 156.40 156.13 5.84 2.42
4 Height of stalk at maturity (cm) 55.74 63.31 71.70 71.65 72.77 67.03 3.73 3.62
5 Number of primary branches 7.25 7.50 10.50 9.00 9.15 8.68 0.76 5.71
6 Number of secondary branches 31.55 29.20 39.10 40.30 48.20 37.67 5.79 9.98
7 Number of siliqua per plant 159.60 190.05 266.00 308.05 386.00 262.06 19.80 4.90
8 Number of seed per siliqua 8.40 9.37 10.56 10.11 9.61 9.61 0.91 6.15
9 1000-seed weight (g) 3.72 3.81 3.42 3.30 3.55 3.55 0.13 2.38
10 Seed yield per plant (g) 5.03 6.80 9.60 10.26 8.93 8.93 1.02 7.44
11 First count (%) 76.65 78.80 83.89 81.10 80.45 80.45 3.52 2.90
12 Standard germination (%) 87.30 89.50 87.90 85.39 87.30 87.30 2.72 2.07
13 Root length (cm) 5.30 5.50 5.79 5.50 5.52 5.52 0.43 5.26
14 Shoot length (cm) 7.48 7.36 6.87 7.06 7.32 7.22 0.56 3.77
15 Seedling length (cm) 12.98 12.86 12.67 12.54 12.79 12.76 0.68 3.57
16 Seedling fresh weight (g) 0.320 0.299 0.321 0.320 0.324 0.317 0.30 6.47
17 Seedling dry weight (g) 0.056 0.062 0.058 0.059 0.062 0.059 0.63 7.01
18 Tetrazolium test (T z) 95.90 97.50 98.20 97.60 98.50 97.02 1.25 0.85
19 Electrical conductivity of seeds (dsm) 0.284 0.256 0.308 0.334 0.304 0.297 0.15 33.77
20 Vigour index I 568.97 575.38 559.38 535.64 550.90 558.17 29.5 3.50
21 Vigour index II 2.47 2.77 2.56 2.52 2.67 2.59 6.00 7.98

132 Trends in Biosciences 3 (2), 2010
seedling fresh weight was recorded at extra large curd size
(0.324 g) while, minimum seedling fresh weight was recorded
at very small curd size i.e. 0.299 g ; and other hand seedling
dry weight were found 0.056 g which is the minimum while
small as well as extra large curd size have maximum seedling
dry weight i.e. 0.062 g which is at par with all the treatments.
Fresh and dry weight of seedling and germination along with
seedling growth and dry weight are reflected in terms of vigour
index I and II respectively. Maximum seedling vigour index I
as well as vigour index II was recorded in case of small curd
size i.e. 575.38 and 2.77 respectively while, minimum vigour
index I with vigour index II was observed at large as well as
very small curd size respectively. This finding is in agreements
with the findings of Roy, et al., 1997. The present investigation
with different curd size of cauliflower for seed yield and quality
parameters may be concluded that the medium and extra large
curd size was promising for seed yield and quality parameters.
However, the farmer’s point of view it is suggested that the
small as well as very small curd size can be used for vegetable
purpose and medium and extra large curd size is suitable for
seed yield and quality of cauliflower.
LITERATURE CITED
AOSA. 1993. Rules for seed testing seeds. Journal Seed Technology,
4(3): 11a-11d.
Bhutia, K.G. and Ram, H.H. 1980. Path-coefficient analysis of
morphological traits with seed yield in tropical cauliflower. South
Indian Horticulture, 28(4): 147-149.
Chatterjee, R. and Som, G. 1990. Effect of sowing date on curd
production and seed yield of cauliflower. Vegetable Science, 17(1):
66-69.
Chatterjee, R. 2006. Effect of transplanting dates and spacing on seed
yield and quality of cauliflower cv. Pusa early synthetic. Seed
Research, 34(1): 104-106.
Jana, J.C. 2004. Effect of micronutrients on yield and quality of
cauliflower seeds. Seed Research, 32(1): 98-100.
Kanwar, H.S. and Singh, R. 2001. Head replanting time for cabbage seed
production under dry temperate zone of Himachal Pradesh.
Vegetable Science, 28(2): 177-178.
Kanwer, H.S., Kohli, U.K., Thakur, M.C. and Singh, R. 2001. Effect of
head weight on seed production of cabbage cv. Pride of India.
Horticulture Journal, 14(3): 48-50.
Kanwer, H.S., Kohli, U.K. and Singh, R. 2000. Effect of head
compactness on bolting and seed yield of cabbage. Vegetable Science,
27(2): 203-204.
Roy, A., Paul, S.R. and Sharma, R.N. 1997. Effect of seed size and
storage on germination and vigour in pigeonpea. Indian Journal of
Pulses Research, 10(1): 131-133.
SAS, Institute. 1996. SAS/ISTA user’s guid, version 6. 12 SAS Institute,
cary, NC.
Singh, B., Singh, A.K., Pandey, S. and Rai, M. 2005. Effect of curd
cutting techniques at different curd stage on seed production in
Indian cauliflower. Vegetable Science, 32: 180-181.
Singh, R.C., Biswas, V.R., Arya, M.C., Metha, J.S. and Kumar, N. 2000.
Effect of plant population and dates of transplanting on seed yield
of cabbage. Indian Journal of Agriculture Science, 70(6): 405-
406.
Strydom, A. 1998. Comparison of seed vigour tests for cabbage. Seed
Science Technology, 26: 5769-585.
Recieved on 06.10.2010 Accepted on 27.11.2010

Trends in Biosciences 3 (2): 133-134, 2010
Polymerase Chain Reaction Based Detection of Dolichos Yellow Mosaic Virus
Infecting Dolichos
SOBIA ALI* AND RAIS AHMAD
*Department of Biotechnology, Integral University, Kursi Road, Lucknow
Biotechnology Research Foundation, Kanpur 208 024
e-mail: soobiaali@rediffmail.com, rais_12_09@live.com
ABSTRACT
A survey was conducted at Vegetable Farm of Chandra Shekhar
Azad University of Agriculture and Technology, Kanpur during
Feb- March 2010 to know the occurrence of DoYMV. The infected
sample showing characteristic yellow mosaic symptoms include
faint chlorotic specks on leaf lamina, which later develop into
bright yellow mosaic patches with small island of green tissue,
mottling and leaf distortion were observed and collected to
diagnose the causal virus. Four set of primers (DAC1-F 5’
GTG CGT GAA TCC GTC ATT TCG 3’/ DAC1-R 5’ ATA CAC
CGA TGA CGT GGC AAT 3’; DAC2-F 5’ ATA CAT ATT CGC
AAC CGC GTA 3’/ DAC2-R 5’ CCA CGT TCG TCC TAT AAA
GAG 3’; DAC3-F 5’ GCA ACC GCG TAA TAC ATT GTT 3’/
DAC3-R 5’AAC GAT TCG GCG TAA GCG AAT 3; DAC4-F 5’
CTC AGA TTG TGG TAC TGG AAC 3’ / DAC4-R 5’ AAG AAG
CTC TCG AGC AAC TGT 3’ /DAV2-F 5’ GCT CCG TGG AGT
CTT ATT TAG 3’/DAV2-R 5’ ATG GTA CAT CGC GTG AAC
GAT 3’ specific to DYMV used for the diagnosis of the causal
virus infecting dolichos. All the four primers gave positive
amplification of targeted DNA fragments indicated the dolichos
plant showing yellow mosaic symptoms were infected with
DoYMV at Kanpur.
Key words
DoYMV, PCR, detection, CTAB, primer
Dolichos (Lablab purpureus L. (Sweet) known as
Dolichos bean, Hyacinth bean, Field bean or Sem is one of the
most ancient crops among cultivated plants and is a native to
India or south-east Asia. Since the 1950s cultivation of
dolichos in India has been affected by dolichos yellow mosaic
disease (Capoor and Varma, 1950) and the casual agent of the
disease was first identified as a geminivirus belongs to the
genus begomovirus based on electron microscopy (Raj, et
al., 1988) the virus was named as Dolichos yellow mosaic
virus (DoYMV) and was shown transmitted by the whitefly
Bemisia tabaci and has only DNA A component as genetic
material (Maruthi, et al., 2005).
The genus Begomovirus contains more than 200
species. They are plant viruses that as a group have a very
wide host range, infecting dicotyledonous plants. Worldwide
they are responsible for a large amount of economic damage
to many important crops such as sem, tomatoes, beans,
squash, cassava and cotton. Similar yellow mosaic symptom
have also been recorded on several other crop in India (Varma
and Malathi, 2003) including french bean (Phaseolus vulgaris
L.) (Maramorosch and Muniyappa, 1981), peanut (Arachis
hypogae L.) (Sudhakar Rao, et al.,), mungbean (Vigna mungo
L.) (Nariani, 1960), Soybean (glycine max Merrill) (Singh, et
al., 1971) the causal agent(s) of some of these disease were
characterized albeit recently but their relation ship with
DoYMV was not reported. Complete DNA-A components of
DoYMV isolates from Mysore and Bangalore, south India,
were sequenced, but several attempts to identify DNA-B and
DNA-â were unsuccessful (Maruthi, et al., 2006,). This study
is aimed to design DoYMV specific primers for detection of
the virus and their validation.
MATERIALS AND METHODS
The healthy and diseased (showing characteristic
symptoms of yellow mosaic disease) samples of dolichos was
collected from Vegetable Farm of Chandra Shekhar Azad
University of Agriculture and Technology, Kanpur during Feb-
March, 2010 and brought to the laboratory for the confirmation
of the causative virus associated with these samples.
The primers were designed using the already available
sequence data of DoYMV (AY309241) downloaded from NCBI
domain. Each primer has 21 bases with 40-50% GC content.
DNA was extracted from the dolichos leaf sample by the CTAB
method 100 mg of leaves was grind in a mortar and pestle
containing 500 µl CTAB buffer (2% CTAB, 2% PVP, 1M TrispH
8.0, 5 M NaCl, 0.5 M EDTA) with 2% â Mercaptoethanol
added just prior to use. The mixture was transferred to 1.5 ml
tubes and incubated at 65 o C for 15 minutes after that added
equal volume of chloroform; isoamylalcohol [24:1] and mixed
properly and centrifuged (RM-12 C, REMI) at 12000 rpm for 10
minutes. The supernatant was transferred to fresh tube and
added 0.6 ml of isopropanol. The tube was kept at room
temperature for 2 minutes then centrifuged at 12000 rpm for 5
minutes. The supernatant was carefully drained out and
washed the pellet with 70% alcohol. Let the pellet dried; added
200µl triple distilled water and stored at -20 o C. The extracted
DNA was analyzed by 1% agarose gel in 1 x TAE and the gel
was viewed in UV transilluminator (MX-1280-01,Medox Bio)
to confirm the presence of DNA.
DNA extracted from healthy and diseased leaves were
used as template for PCR. PCR (TE Thermal Cycler, BenchTop
lab Systems) was performed by adding 4 µl of the DNA extract
to 25 µl of Dream Taq Green PCR master mix (Fermentas), 1 µl

134 Trends in Biosciences 3 (2), 2010
Fig. 1.
Table 1.
Symptoms of yellow mosaic on filed infected dolichos
leaf
Fig. 2.
Details of the primers used for detection of DoYMV infecting Dolichos
Detection of DoYMV using specific primer pairs. 1kb
DNA ladder (lane1), diseased dolichos samples, lane 2-
DAC1F/DAC1R, lane 3-DAC2F/DCA2R, lane
4- DAC3F/DAC3R, lane5-DAC4F/DAC4R, lane
6- DAV1F/DAV1R, Lane 7-DAV2F/DAV2R and lane
8-healthy dolichos
S.N. Primer ID Sequence 5’…3’ Annealing
temperature
Expected size of amplified DNA
fragments
1 DAC1F GTG CGT GAA TCC GTC ATT TCG
60 0 C 1100 bp
DAC1R ATA CAC CGA TGA CGT GGC AAT
2 DAC2 F ATA CAT ATT CGC AAC CGC GTA
58 0 C 500 bp
DAC2R CCA CGT TCG TCC TAT AAA GAG
3 DAC3 F GCA ACC GCG TAA TAC ATT GTT
58 0 C 380 bp
DAC3R AAC GAT TCG GCG TAA GCG AAT
4 DAC4 F CTC AGA TTG TGG TAC TGG AAC
59 0 C 390 bp
DAC4R TGTAAG AAG CTC TCG AGC AAC
5 DAV2 F GCT CCG TGG AGT CTT ATT TAG
60 0 C 400 bp
DAV2R ATG GTA CAT CGC GTG AAC GAT
6 DAV1F
DAV1R
59 0 C
of each forward and reverse primers (20 pmol/ µl) and 21 µl
nuclease free water, a total of 50 µl of PCR mix for each sample.
The thermal conditions consisted of an initial denaturation
step at 94 0 C for 3 min., followed by 35 cycles of denaturation
at 94 0 C for 30 sec., annealing at 58-60 0 C (Table 1) for 30 sec. for
primer pairs and extension at 72 0 C for 1 min, and then one step
of final elongation at 72 0 C for 10 min. PCR amplified products
were analyzed by 1% agarose gel electrophoresis at 50 V for
40 min. and stained with ethidium bromide. The size of
amplicons was determined using 1 kb DNA ladder (fermentas).
The gel was visualized and photographed.
RESULTS AND DISCUSSION
Faint chlorotic specks on leaf lamina, which later develop
into bright yellow mosaic patches with Small Island of green
tissues, were observed on dolichos plants. Almost similar
type of symptoms were reported by (Capoor and Varma, 1950).
DNA was successfully isolated from diseased as well as
healthy leaves of dolichos using CTAB method. This DNA
was used as template in PCR. Total six sets of primer were
designed and used for the detection of DoYMV infecting
dolichos (Table 1). Out of six set primers only five sets
(DAC1F/DAC1R; DAC2F/DAC2R; DAC3F/DAC3R; DAC4/
DAC4R; DAV1F/DAV1R and DAV2F/DAV2R) primer pairs
specific to DYMV gave the positive amplification of the
targeted DNA fragments from the diseased dolichos samples
in PCR (Figure 1). Primer pair DAV1F/DVA1R could not
produced any band in PCR from any of the samples tested.
LITERATURE CITED
Capoor, S.P., Verma, P.M. 1950. New virus disease of Dolichos lablab.
Current Science, 19: 242-249.
Maruthi, M. N., Rekha, A. R., Govindappa, M. R., Colvin, J. and
Muniyappa, V. 2006. A distinct begomovirus causes Indian dolichos
yellow mosaic disease. Plant Pathology, 55: 290. doi: 10.1111/
j.1365-3059.2005.01299.x
Nariani, T. K. 1960. Mungbean Yellow Mosaic Virus. Indian Phytopath.,
13: 24.
Varma, A. and Malathi, V. G. 2003. Emerging geminivirus problems: A
serious threat to crop production. Annals of Applied Biology,
142: 145–164. doi: 10.1111/j.1744-7348.2003.tb00240.x
Recieved on 15.09.2010 Accepted on 19.10.2010

Trends in Biosciences 3 (2): 135-136, 2010
Non-Hierarchical Euclidean Cluster Analysis in Mungbean
RASHMI SINGH, HASMAT ALI* AND VARUN PATHAK*
Banaras Hindu University, Varanasi
*Indian Institute of Pulses Research, Kanpur
ABSTRACT
Two hundred and ten accessions of mungbean were evaluated
for genetic variability. Principal component and nonhierarchical
Euclidean cluster analysis were used to compare
accessions. Wide diversity was observed among the germplasm
of different attributes. Accessions were grouped into 8 clusters.
There is no parallelism between genetic diversity and
geographical origin of accessions.
Key words
Mungbean, cluster analysis, germplasm
The selection of parents based on information on genetic
diversity is desirable for successful breeding programme. The
use of diverse parents gives better opportunities to a breeder
for selection and development of superior varieties. Estimation
of genetic divergence through the use of cluster analysis has
been suggested (Arunachalam, 1981). In view of above, an
attempt has been made inter alia to facilitate an inventory of
what is available in the germplasm collection and, therefore
help to determine which released varieties are of value.
MATERIALS AND METHODS
A total of two hundred and ten accessions were grown
at Banaras Hindu University, Varanasi, in a single-replicate
augmented design with two intermittent checks, namely Meha,
and Narendra M 1 during kharif, seasons (2008 and 2009).
Each plot consisted of four rows of 5 m length. Rows were
spaced 30 cm apart and interplant distance was 15 cm. The
crop was raised adopting standard cultural practices. Data on
metric and qualitative traits were recorded. The 10 distinct
traits viz., days to 50% flowering, plant height (cm), number of
primary branches, number of clusters per plant, number of
pods per plant, number of seeds per pod, pod length (cm),
100-seed weight (g), days to maturity and yield per plant (g)
were analysed in augmented block design to get adjusted
mean values (Peterson, 1985). The correlation matrix between
the observed characteristics was determined and principal
component analysis was carried out as suggested by Hotelling,
1933 and Mardia, 1971, to transform the interdependent
variables into a set of independent variables. The principal
component scores were used for non hierarchical Euclidean
cluster analysis (Beale, 1969; Spark, 1973).
RESULTS AND DISCUSSION
Treatment mean squares were highly significant for all
the attributes indicating presence of sufficient genetic
variation among genotypes.
Eight well characterized groups (A to H) of mungbean
accessions were derived on the basis of similarity in
morphological characters from the non-hierarchical Euclidean
cluster analysis. The cluster F (52 accessions) contains the
maximum number of genotypes while cluster C (11 accessions)
have minimum number. These well characterized groups were
obtained by transforming the metric attributes into a single
index of similarity in the form of principal components, which
yielded 8 eigen vectors and eigen roots. The first five principal
components calculated by using standard variables accounted
for 24.06%, 20.16%, 15.19%, 12.72% and 9.04% of the variation,
respectively (Total = 81.17%). (Table 1)
Average distance of clusters from cluster centroids
ranged from 1.225 to 2.062. It was maximum in cluster A and
minimum in cluster D. Therefore, utilizing the cultivars from
these cluster in hybridization programme may result in the
putative transgressive segregants. So for as inter-cluster
distance is concerned, cluster B and E centriods were the
farthest (3.461) from each other. These observed distances
reflect the genetic diversity in cultivars and their linkage with
respect to one another. Further, not much association was
Table 1.
Eigen vectors of 8 standardized variables for the
first four principal components
Variables
Principal Component
1 2 3 4 5
1 - 0.037 - 0.216 0.329 0.146 0.129
2 0.133 0.184 - 0.184 - 0.0185 0.427
3 - 0.127 - 0.129 0.284 0.357 0.156
4 0.116 0.467 0.107 - 0.124 0.048
5 0.462 0.012 - 0.141 - 0.004 - 0.161
6 - 0.181 0.425 0.117 0.118 0.154
7 0.098 0.286 0.416 0.120 - 0.215
8 0.147 0.414 - 0.165 - 0.015 0.189
1 = Days to 50% flowering, 2 = Plant height (cm), 3 = Number of
primary branches, 4 = Number of clusters per plant, 5 = Number of pods
per plant, 6 = Number of seeds per pod, 7 = Pod length (cm), 8 = 100-
seed weight (g), 9 = Days to maturity, 10 = Yield per plant (g)
Table 2. Promising donors for quantitative attributes of 210
accessions of mungbean
Character
Promising accessions
Plant height (8 cm) LM 1598, LM 1494, ML 170, CN 8082
No. of seed/pod (>12 ) STV 2624, IC 325853, PLM 364, LM
109, M 23
100 seed wt. (> 4.5 g/100 seed
weight)
NSM 040, M 24, G 1, CN 8078, CN
9039, MN 1

136 Trends in Biosciences 3 (2), 2010
found between genetic diversity and geographical origin of
accessions under study. The genotypes of the same region
were distributed in more than one cluster as also the cultivars
of heterogeneous origin were grouped in the same cluster.
Thus there was no parallelism between genetic and
geographical diversity. (Griffing and Lindstorm, 1954).
The potential donors for quantitative attributes are
presented in Table 2. The accessions included in a particular
group exhibited more or less similar characteristics but differed
from those included in other groups. Selecting genotypes
from these groups and using them in hybridization would
prove fruitful in mungbean improvement programme.
LITERATURE CITED
Arumachalam, V. 1981. Genetic distance in plant breeding. Indian J.
Genet., 41: 226-236.
Beale, E.M.L. 1969. Euclidean cluster analysis. 37 th session of the
International statistical Institute, U.K.
Griffing, B. and Lindstorm, E. W. 1954. Multivatiate analysis divergence
in wheat. Agronomy Journal, 46:545-52
Hotelling, H. 1933. Analysis of a complex of statistical variables into
principal components. Journal of Educational Psychology, 24:417-
4 1
Mardia, K. V. 1971. The effect of non normality on some multivariate
test and robust to non-normality in the liner model. Biomerika,
58:105-21
Peterson, R.G. 1985. Augmented design for preliminary yield traits.
Arachis, Barley & Triticale Newsletter (ICARDA), 4: 27-32
Spark, D. N. 1973. Euclidean cluster analysis algorithm. Allpied
Statistics, 22: 126-30
Recieved on 24.05.2010 Accepted on 20.06.2010

Trends in Biosciences 3 (2): 137-139, 2010
Bisphenol-A Induced Changes in Enzymes Activities (GOT, GPT, ACP and ALP) in
Liver and Kidney of Freshwater Fish Cirrhinus mrigala (Ham.)
SARITA MURMU 1 , MANOHAR RAO GAWANDE 2 AND VINOY K. SHRIVASTAVA 2
1
Department of Zoology, S.S.L.N.T. Mahila College, Dhanbad, Vinoba Bhave University Hazaribagh
(Jharkhand) 2 Endocrinology Lab. Department of Biosciences Barkatullah University, Bhopal 462 026 (M.P.)
e-mail: sarita08_09@yahoo.com
ABSTRACT
20 freshwater fishes Cirrhinus mrigala weighing 50±5 g were
divided into 2 groups of five each. 1 st group received fish diet
only and served as control, while, 2 nd group exposed with
Bisphenol-A (2mg/l) and the enzyme activities i.e. GOT, GPT,
ACP and ALP levels in liver and kidney were quantified on the
16 th and 31 st day. GOT level showed more significant increase
in liver and kidney after 30 days of Bisphenol-A exposure.
However, the hepatic and renal GPT levels were also increased
significantly throughout the experiment as compared to control.
ACP, ALP level were elevated significantly in the liver and
kidney after 15 and 30 days of Bisphenol-A exposures. The
effects were more prominent in later part of the experiment.
This suggests that the Bisphenol-A impairs functional activities
of liver and kidney of Cirrhinus mrigala by altering the enzyme
activities. These effects are dose and duration dependent.
Key words
Bisphenol-A, liver, kidney, enzyme activities, cirrhinus
mrigala
Bisphenol-A (BPA), a high production volume chemical
used to make polycarbonate plastic, epoxy resins, and other
chemicals (Bond, et.al., 1980; Krishnan, et.al., 1993). Bisphenol
A is commonly detected in environment (Pedersen and
Lindholst, 1999; Staples, et.al., 2000) and in food products
(Brotons, et.al., 1995). Bisphenol-A moderately soluble in
water. Bisphenol-A may enter the environment as dust
particles, during production, processing or final use of the
product.Besides this, it also enter the environment during
handling, loading and unloading, heating, as accidental spills
or releases. Bi A number of studies revealed that BPA, is a
environmental disruptor and it has an estrogenic activity on
nearly all classes of vertebrates (Krishnan, et.al., 1993;
Maruyama, et.al., 1999). Bisphenol-A effects on Eggproducing
cells in male testis, reduced testis growth rates,
female reproductive tracts, increased liver size, increased levels
of vitellogenin (egg protein), disrupt young brain etc. In animals
BPA can bring changes in estrogen sensitive organs or cells
(Soderholm and Mariotti, 1999). BPA conjugates with
glucuronic acid in liver microsomes (Yokota, et. al., 1999;
Snyder, et. al., 2000). BPA causes toxicity in multiple organ
systems such as the kidney, liver, spleen and pancreas
(Atkinson and Roy, 1995). The effects of Bisphenol-A on some
enzyme activities were estimated in liver and kidney of
freshwater fish Cirrhinus mrigala.
MATERIALS AND METHODS
20 fishes Cirrhinus mrigala weighing 50 ± 5 g were
acclimated in the laboratory condition prior to initiation of the
experiment in the month of December and January. The fishes
were divided into 2 groups of ten each. Group 1 st received fish
diet only and serve as control and while group 2 nd exposed
with Bisphenol-A (2mg/l) for 15 and 30 days. Five fishes from
each group were sacrificed on 16 th and 31 st and their liver and
kidney were dissected out quickly, weighed and homogenated
in ice cold 0.25 M sucrose solution. Supernatant were used
for enzyme activities by adopting the appropriate
methodology. The glutamate oxaloacetate transaminase
(GOT), and glutamate pyruvate transaminase (GPT); (Reitman
Frankel, 1957), while, Acid Phosphatase and Alkaline
Phosphatase estimation (ALP) content were done (Bergmeyer,
et al., 1963). The “P” value was calculated by student’t’ test.
The comparision of the control data vs. treated was statistically
analyzed by using’t’ test to established the validity of the
investigation.
RESULTS AND DISCUSSION
Fishes (Cirrhinus mrigala) treated with Bisphenol-A
changed the colour of the fish skin. Besides this, fishes exposed
with Bisphenol-A showed insignificantly increased in their
body weight as compared to control (Fig. 1). It has been also
observed that fish exposed with a Bisphenol A 2mg/l up to 15
and 30 days showed alteration in enzyme activities i.e. GOT,
GPT, ACP and ALP levels. GOT level showed more significant
increase in liver and kidney after 30 days of Bisphenol-A
exposures. However, the hepatic and renal GPT levels were
increased significant throughout the experiment as compared
to control group (Figs. 2 and 4). ACP, ALP level were also
elevated significantly in liver and kidney after 15 days and 30
days of Bisphenol-A exposure (Figs. 3 and 5).
The liver is the largest mass of glandular tissue in the
body, while kidneys play the most important part in the
excretion of nitrogenous wastes and maintaining the water
salt balance (homeostasis) in the body (Khanna, 1998). Amino
transferase in serum/tissues can be increased by one of the
two mechanisms either the enzyme is activated or the
apoenzyme itself is increased. Activities of the serum enzymes
like GOT, GPT, and ALP represent the functional status of the
liver. Liver is the richest sources of both GOT and GPT are

138 Trends in Biosciences 3 (2), 2010
Fig. 1.
Body weight (g) of Cirrhinus mrigala after Bisphenol-
A exposures.
Fig. 4.
Glutamate oxaloacetate transaminase (GOT), Glutamate
pyruvate transaminase (GPT) mIU/ml concentration in
kidney of Cirrhinus mrigala after Bisphenol-A
exposures.
Fig. 2.
Glutamate oxaloacetate transaminase (GOT), Glutamate
pyruvate transaminase (GPT) mIU/ml concentration in
liver of Cirrhinus mrigala of Bisphenol-A exposures.
Fig. 3.
Acid phosphatase (ACP), Alkaline phosphatase (ALP)
mIU/ml concentration in liver of Cirrhinus mrigala
after Bisphenol-A exposures.
used as sensitive indicator of liver damage. (Ozaki, et.al., 1995).
Any damage to the liver cells will result in the increase of
both these enzymes (Cole and Bradley, 1973).The increase in
quantity usually reflects the severity of hepatic damage
(Ginsberg 1970).When any of these organs are damage, the
serum GOT levels rises in proportion to the severity of
damage. Besides this, increase in serum activities of GPT
consider liver specific enzymes in rat are use as markers of
hepatocellular necrosis or increased cell membrane
permeability (Travlos, et.al., 1996). In our study, it has been
observed the Bisphenol-A significantly increased the GOT
Fig. 5. Acid Phosphatase (ACP), Alkaline Phosphatase (ALP)
mIU/ml concentration in kidney of Cirrhinus mrigala
after Bisphenol-A exposures.
Values are mean ± SEM of 5 fishes.
*Significantly values (P < 0.05) from control vs experiment by
student ‘t’ test.
**Significantly values (P < 0.01) from control vs experiment by
student ‘t’ test.
***Significantly values (P < 0.001) from control vs experiment
by student ‘t’ test.
and GPT enzymes activities level in liver and kidney after 15
and 30 days exposures as compare to control group. The
effects were more prominent in later part of experiment. This
indicate that Bisphenol-A induced necrosis in hepatic and
renal system which alter functional activities.
Acid phosphatase belongs to the class of enzymes called
hydrolases and they are characterized by their ability to
hydrolyse a large variety of organic phosphatase esters with
the formation of an alcohol and a phosphate ion. Alteration in
the enzyme activity is due to adverse effect of xenobiotics on
the cell and its organells (Ram and Satyanesan, 1985; Jana,
et.al., 1985). Alkaline phosphatase, a brush border enzyme
mediates membrane transport. It is known to be involved in a

MURMU et. al., Bisphenol-A Induced Changes in Enzymes Activities (GOT, GPT, ACP and sALP) in Liver 139
variety of metabolic activities such as permeability (Seth, et.al.,
1969) growth and cell differentiation (Lobel and Levy, 1968)
protein synthesis and gonadal maturation (Shaffi, et.al., 1974)
and steroid ogenesis. Alkaline phosphatase elevated in liver
diseases portal cirrhosis is associated with minimal increase
in ALP which is not as high as that with post necrotic cirrhosis
(Wert and Zimmerman, 1959 and Mussar, et.al., 1966), striking
elevations of plasma ALP are usually confined to patients
with cholestatic disorders and is due to increase and is due to
both an increased synthesis and reduced bilary excretion of
ALP (Kaplan, 1986). In this study, increased ACP and ALP
enzymes activities level in both the tissues liver and kidney
after 15 and 30 days exposures donates that Bisphenol-A
modulate the functional activities of liver and kidney in
Cirrhinus mrigala and effects was dose and duration
dependent.
ACKNOWLEDGEMENT
Authors are thankful to Prof. Meenakshi Benerjee, Head
Department of Biosciences, for providing infrastructure
facilities in the Department.
LITERATURE CITED
Atkinson, A. and Roy, D. 1995. In vitro conversion of environment
estrogenic chemical Bisphenol-A to DNA binding metabolite (s).
Biochem. Biophys. Res. Commun., 210: 424-433.
Bergmeyer, H.U., Bernt, E. and Hess, B. 1963. Lactate dehydrogenase,in
methods of enzymatic analysis. (ed. H.U. Bergmeuyer). London:
Academic Press, 2: 735.
Bond, G.P., McGinnis, P.M., Cheever, K.L., Harris, S.J., Platnick, H.B.
and Neimeier, R.W. 1980. Proceedings 19th Annual Meeting of the
Society of Toxicology, Washington, DC, pp. 69.
Brotons, J.A., Olea-Serrano, M.F, Villalobos, M., Pedraza, V. and Olea,
N. 1995. Xenoestrogens released from lacquer coatings in food
cans. Environ. Health Perspect., 103: 608-612.
Cole, G.W. and Bradley. 1973. Hospital admission laboratory profile
interpretation. The SGOT and SLDH-SGOT ratio used for the
diagnosis of hepatic disease. Hum. Pathol., 4: 85.
Ginsberg, A.L. 1970. Very high levels of SGOT and LDH in patients
with extrahepatic bilary tract obstruction. Am. J. Digest. Dis., 15:
803.
Jana, S., Sahana, S.S., Choudhuri, M.A., and Choudhuri, D.K. 1985.
Effect of mercury on inorganic phosphorous and activities of acid
and alkaline pyrophosphatases in fresh water fish Clarias batrachus.
Environment and ecology, 3:2.
Kaplan, M.M. 1986. Serum alkaline phosphatase another piece is added
to the puzzle. Hepatology, 6 : 526-528.
Khanna, S.S. 1998. Excretion and Osmoregulation. An Introduction to
fishes, 4 th edn. Indian University Press and Central Book Depot.
Allahabad, pp.258-269.
Krishnan, A.V., Starhis, P., Permuth, S.F., Tokes, I. and Feldman, D.
1993. Bisphenol-A: An estrogenic substances is releasd fom
polycarbonated flasks during autoclaving. Endocrinology,
132:2279-2286.
Lobel, B.L. and Levy, E. 1968. Enzymic correlates of development,
secretary function and regression of follicle and corpora lutea in
the bovin ovary. Acta Endocrinol. Suppl., 59:1.
Maruyama, S., Fujimoto, N., Yin H. and Ito, A. 1999. Growth stimulation
of a pituitary cell line MtT/E-2 by environmental estrogens in
vitro and in vivo. Endocrine J., 46: 513-520.
Mussar, A.W., Orsigoza, C., Vagquez, M., and Riddick, J. 1966.
Correlation of serum enzymes and morphology alterations of the
liver. Amer. J. Clin. Path., 46:82.
Ozaki, M., Fuchinove, S., Trearasoda, S., and Ota,K. 1995. The in vivo
cytoprotection of ascorbic acid against ischemia reoxygenation
injury of rat liver. Arch. Biochem. Biphys., 318: 439-445.
Pedersen, S.N. and Lindholst, C. 1999. Quantification of the
xenoestrogens 4 tert- octlyphenol and Bisphenol-A in water and in
fish tissue based on micro assisted extraction, solid-phase extraction
and liquid chromatography- mass spectrometry. J. chromat., 864:17-
24.
Ram, R.N. and Satyanesan, A.G. 1985. Mercuric chloride, cythion and
ammonium sulfate induced changes in the brain, liver and ovarian
alkaline phosphatase content in the fish Channa punctatus.
Environment and Ecology, 3:283-268.
Reitman, S., and Frankel, S.A. 1957. A calorimetric method for the
determination of serum glautamate oxaloacetate and glutamate
pyruvate transaminase. An . J. Clin. Pathol. K., 28: 56-63.
Seth, J.S., Tewari, H.B. and Sood, P.P. 1969. On the distribution pattern
of alkaline phosphatase activities and their functional significance
amongest the spinal ganglion cells of squirrel. Acta. Neuro. Belga,
69: 51-57.
Shaffi, S.A., Jafri, A.K. and Khawaja, D.K. 1974. Alkaline phosphatase
activity in the ovary of cat fish Clarias batrachus during maturation.
Curr. Sci., 43: 51-52.
Soderholm, K.J. and Mariotti, A. 1999. BIS-GMA- base resins in
dentistry. Are they safe ? J. American Dental Assoc., 130: 201-
209.
Staples, C.A., Dron, P.B., Klecka, G.M., O’Block, S.T., Branson, D.R.
and Harris, L.R. 2000. Bisphenol-A concentration in receiving
waters near US manufactureing and processing facilities .
Chemospher, 40:521-525.
Snyder, R.W., Maness, S.C., Gaido, K.W., Welch, F., Sumner, S.C.J., and
Fennell, T.R. 2000. Metabolism and disposition of Bisphenol-A in
female rats. Toxicol. Appl. Pharmacol., 168: 225-234.
Travlos, G.S., Morris, R.W., Elewell, M.R., Duke, A., Rosenblum, S.,
Thompson, M.B. 1996. Frequency and relationship of clinical
chemistry and liver and kidney histopathology findings in 13 week
toxicity study in rats, Toxicology, 107: 17-29.
Wert, M. and Zemmerman, H.J. 1959. Serum enzymes in hepatic
disease. Med. Clin. Amer., 43: 371.
Yokota, H., Iwano, H., Endo, M., Koyabashi, T., Inoue, H., Ikushiro,
S., and Yuasa, A. 1999. Glucuronidation of the environmental
estrogen Bisphenol-A an isoform of UDP- glucuronosyltransfarase,
UGT2B1, in the rat liver. Biochem. J., 340: 405-409.
Recieved on 25.10.2010 Accepted on 28.11.2010

140 Trends in Biosciences 3 (2): 140-142, 2010 Trends in Biosciences 3 (2), 2010
Genetic Analysis for Grain Yield and Quality Parameter in Durum Wheat (Triticum
durum Desf.) under Late Sown Condition
R.A. GAMI, C.J. TANK, R.M. CHAUHAN, H.N. PATEL AND S.V. BURUNGALE
Department of Genetics and Plant Breeding, C.P. College of Agriculture, S.D. Agriculture University,
Sardarkrushinagar 385 506 (Gujarat)
e-mail: ramangami@gmail.com
ABSTRACT
Combining ability analysis was carried out in 8x8 parental
diallel progenies for grain yield and its components traits in
durum wheat. General combining ability and specific combining
ability variances were highly significant for all the characters
suggested importance of both additive as well as non-additive
type of gene action in the inheritance of characters. The
magnitude of the non-additive genetic variance was higher than
additive variance for all the characters except plant height and
length of main spike. The parent BAWAJI was good general
combiners for all the characters except plant height. For grain
yield per plant, the crosses GW 02-51 x VDW 99-176, GW 1239
x GW 1189 and GW 02-51 x RD 1009 recorded the highest sca
effects. The cross GW 1139 x GW 1240 expressed highest sca
effects for grain protein and hectoliter weight.
Key words
Combining ability, diallel, grain yield, grain protein,
hectoliter weight
Wheat (Triticum spp.) is an important staple food crop
in India next to rice. It is widely cultivated food crop known
for its remarkable adaptation to a wide range of environment.
Triticum durum Desf. (Macaroni wheat) is the second most
important wheat species grown in India. The lines, which
perform well in combination, are eventually of great importance
to the plant breeders. Hence, investigation on general and
specific combining ability would give very useful information.
The present investigation aims on identification of superior
parents, cross combination and evaluation of type of gene
action for grain yield and as well as their respective
components.
MATERIALS AND METHODS
Genetic material for the present investigation comprised
of eight diverse parental lines of durum wheat namely, GW
02-51, VDW 99-176, RD 1009, GW1139, GW1239, GW1189,
BAWAJI and GW 1240 along with their all possible F 1
(excluding reciprocals) were grown at Main Wheat Research
Station, Vijapur, (north Gujarat), under late sowing condition
(second week of December), in the year of 2008-09. The
material were grown in randomized block design (RBD) with
three replications. All recommended agronomic practices along
with plant protection measures were followed. Combining
ability analysis was carried out according to the procedure
given by Griffing, 1956a as per Method 2 and Model I.
RESULTS AND DISCUSSION
Analysis of variance for combining ability (Table 1)
showed that general and specific combining ability variances
were highly significant for all the characters suggested
importance of both additive and non-additive type of gene
action in the inheritance of characters. Similar results evincing
importance of both additive and non-additive variances in
wheat under late sown condition has been reported by Sharma,
et al., 2003, Dhadhal and Dobariya, 2006 and Joshi and Sharma,
2006. A comparisons of relative magnitude of general and
specific combining ability variances indicated that nonadditive
genetic effects were predominant in the control of all
the character except plant height and length of main spike. As
observed in the present study the predominant role of nonadditive
gene action in the inheritance of grain yield in wheat
under late sown condition was reported by Celliers, et al.,
1999.
Table 1.
Source of
variation
Analysis of variance for combining ability for various characters in durum wheat under late sown condition
d.f. Grain yield
per plant
(g)
Plant
height
(cm)
1000-grains
weight
(g)
Number of
effective tillers
per plant
*and** indicates significant at P = 0.05 and P = 0.01 levels, respectively.
Length of
main spike
(cm)
Spikelets
per spike
Grains per
spike
Harvest
Index
Grain
Protein
Hectoliter
weight
GCA 7 7.86** 165.11** 37.68** 0.31** 1.15** 0.80* 19.84** 155.51** 1.43** 13.86**
SCA 28 5.40** 12.77** 88.45** 0.40** 0.15** 0.59** 6.86** 88.26** 0.81** 8.66**
Error 70 0.34 2.65 0.45 2.65 0.07 0.29 0.92 2.04 0.17 0.43
2 GCA 0.25 15.20 -5.08 -0.01 0.10 0.02 1.30 6.73 0.06 0.52
2 SCA 5.05 10.12 87.99 0.31 0.08 0.31 5.93 86.22 0.64 8.23
2 GCA/
2 SCA
0.05 1.51 -0.06 -0.03 1.23 0.07 0.22 0.08 0.10 0.06

Table 2.
GAMI et al., Genetic analysis for grain yield and quality parameter in durum wheat (Triticum durum Desf.) 141
Estimation of general combining ability (GCA) effects associated with each parental genotype under late sown
condition
Sr. Parents Grain yield 1000-grains Plant Number of Length of Spikelets per Grains per Harvest Grain Hectoliter
No.
per plant weight height effective tillers main spike spike spike Index protein weight
(g) (g) (cm) per plant (cm)
1. GW 02-51 0.39* -3.58** 0.44 0.02 0.13 -0.18 2.22** -2.25** -0.24* -1.53**
2. RD 1009 -0.92** -0.47** -0.46 -0.35** -0.002 0.13 -0.68* -4.13** 0.26* -1.39**
3. VDW 99-176 -1.57** -1.84** -2.16** 0.22* 0.13 0.16 -0.60* -6.42** 0.24* -0.55**
4. GW 1139 1.12** 1.45** -0.16 -0.03 -0.16* 0.02 0.09 0.49 0.06 -0.35
5. GW 1239 -0.21 1.63** -0.53 -0.01 -0.26** -0.43** 0.03 1.85** 0.16 -0.51**
6. GW 1189 0.15 0.51* -2.70* -0.02 -0.22** -0.12 -2.03** 5.01** -0.47** 0.99**
7. BAWAJI 0.91** 2.21** 9.39** 0.20* 0.72** 0.52** 1.82** 3.69** 0.53** 0.40*
8. GW 1240 0.10 0.09 -3.84** -0.04 -0.33** -0.11 -0.85** 1.76** -0.54** 1.91**
S.E.(gi)± 0.17 0.20 0.48 0.09 0.08 0.16 0.28 0.42 0.12 0.19
*and** indicates significant at P = 0.05 and P = 0.01 levels, respectively.
Table 3.
Sca effects of three best crosses along with per se performance and gca combination for each traits under late sown
condition
Characters Hybrids sca gca per se performance (Rank)
Grain yield per plant GW 02-51 x VDW 99-176 5.35** A x P 15.27 (2)
GW 1239 x GW 1189 5.06** A x A 16.06 (1)
GW 02-51 x RD 1009 2.88** A x P 13.41 (-)
Plant height GW 1189 x BAWAJI -4.83** G x P 64.44 (-)
GW 1239 x GW 1240 -3.59** A x G 54.63 (2)
RD 1009 x GW 1240 -3.29** A x G 55.00 (-)
Number of effective tillers per plant GW 02-51 x RD 1009 1.09** A x P 6.06 (2)
GW 1139 x GW 1239 0.89** A x A 6.14 (1)
RD 1009 x GW 1139 0.76** P x A 5.67 (-)
Length of main spike GW 02-51 x GW 1239 0.66** A x P 7.87 (-)
VDW 99-176 x BAWAJI 0.50* A x G 8.68 (1)
GW 02-51 x RD 1009 0.48* A x A 7.95 (-)
Spikelets per spike GW 02-51 x GW 1239 1.40** A x P 16.11 (3)
RD 1009 x GW 1239 1.09* A x P 16.11 (3)
- - - -
Grains per spike GW 02-51 x GW 1189 6.24** G x P 52.09 (-)
BAWAJI x GW 1240 4.35** G x P 50.96 (3)
GW 1139 x BAWAJI 3.95** A x G 51.51 (2)
1000-grain weight GW 1189 x BAWAJI 16.26** G x G 51.27 (-)
RD 1009 x GW 1189 12.89** P x G 61.90 (2)
GW 02-51 x VDW 99-176 12.84** P x P 53.18 (-)
Harvest idex GW 1189 x BAWAJI 16.09** G x G 53.61 (2)
GW 1139 x GW 1189 15.74** A x G 50.07 (1)
GW 1139 x GW 1239 14.20** A x G 45.36 (-)
Grain protein GW 1139 x GW 1240 1.43** A x P 19.34 (-)
GW 1239 x BAWAJI 1.38** A x G 20.47 (1)
VDW 99-176 x GW 1189 1.31** P x P 19.47 (-)
Hectoliter weight GW 1139 x GW 1240 4.74** P x G 74.69 (-)
GW 1239 x GW 1240 3.03** P x P 71.88 (-)
RD 1009 x VDW 99-176 2.19** P x G 73.57 (-)
G = Good; A = Average; P = Poor.
*,** indicates significant at P = 0.05 and P = 0.01 levels, respectively.
Estimates of gca effects (Table 2) indicated that parent
BAWAJI was good general combiners for all the characters
except plant height. Thus the parental line BAWAJI holds
promise for genetic improvement of durum wheat. The parental
line GW 02-51 was good general combiners for grain yield per
plant and grains per spike. The standard parent GW 1139 was
average general combiners for grain yield per plant, it’s
components trait and also quality components.
Three best crosses selected on the basis of sca effects
for each of the characters are presented in Table 3. A perusal
of data revealed that none of the crosses had high ranking
sca effects for all the characters. the sca for most of the
characters where accompanied by top ranking per se
performance also indicating predominant role of non-additive
gene effects in expression of grain yield and its components.
For grain yield per plant, it was observed that the crosses
GW 02-51 x VDW 99-176 and GW 1239 x GW 1189 expressed
top ranking sca for grain yield recorded the highest sca effects

142 Trends in Biosciences 3 (2), 2010
were also top ranking in per se performance and they involved
average x poor and average x average gca of the parents. The
cross GW 1139 x GW 1240 expressed highest sca effects for
grain protein and hectoliter weight.
Wheat being a self-pollinated crop, the exploitation of
heterosis is not feasible. However, the cross combinations
with high sca, which involve at least one good general
combiner, could throw up desirable transgressive segregants
if the additive genetic system present in the good combiner
and complementary epistatic effects act in the same direction
to maximize the desirable plant attributes (Iqbal Singh, 1998).
LITERATURE CITED
Celliers, P.R., Labuschane, M.T. and Devencer. 1999. Combining ability
effects some wheat cultivars at two different temperature levels.
South Africa J. plant and Soil, 16 (1): 15-17.
Dhadhal, B.A. and Dobariya, K.L. 2006. Combining ability analysis
over environments for grain yield and its components in bread
wheat (Triticum aestivum L.). National Journal of Plant
Improvement, 8(2): 172-173.
Griffing, B. 1956a. Concept of general and specific combining
ability in relation to diallel cross system. Aust. J. Biol. Sci., 9 : 463-
493.
Iqbal Singh. 1998. Combining ability through diallel analysis in bread
wheat. Haryana Agric. Univ. J. Res., 28: 145- 149.
Joshi, S.K. and Sharma, S. N. 2006. Combining ability analysis for yield
and yield contributing characters in spring wheat under late sown
environment. Crop Improv., 33(2): 131-136.
Sharma, S.N., Sain, R.S. and Sharma, R.K. 2003. Genetic analysis of
flag area in durum, wheat over environment. Wheat information
service No. 96: 5-10.
Recieved on 21.04.2010 Accepted on 10.07.2010

Trends in Biosciences 3 (2): 143-146, 2010
Gamma Rays Induced Mutation in Soybean [Glycine max (L.) Merrill]
MUDASIR HAFIZ KHAN 1* , SUNIL DUTT TYAGI 2 AND S.A. DAR 3
1
Department of Agronomy, SKUAST-K, Shalimar, Srinagar (J&K), India
2
Department of Plant Breeding and Genetics, Kisan (PG) College, Simbhaoli (U.P.)
3
Pulse Research Sub Station, SKUAST-K, Habak
*e-mail: kmudasirhafiz@yahoo.com, drmhkhan8@gmail.com
ABSTRACT
In radio-sensitivity studies, there were significant differences
between all soybean characters when different doses of gamma
rays viz., 15, 30, 45, 60, 75, 90 and 105 kR were applied. The
mean values for germination, root length, shoot length and
number of secondary roots were lower than those of their
respective controls, associated with an increase in the doses of
gamma rays. Heat treatments (60°C for 12 h) were particularly
effective at higher doses (60–90 kR) than cold and untreated
treatments by protecting the seed populations against radiation
damage. In the two cultivars tested, i.e. ‘Pusa 16’ and ‘PK 1042’,
reduced germination was associated with an increase in the
dose of mutagen in all three treatment groups. Varietal
differences for germination, root length, shoot length, number
of secondary roots and root shoot ratio were also observed in all
the doses of gamma rays. A similar trend was also noticed for
survival, seedling length and recovery index.
Key words
Cold treatment, heat treatment, EMS, quantitative
traits
Soybean [Glycine max (L.) Merrill] is the world’s most
important oil seed and grain legume crop (Pavadai and
Dhanavel, 2005). According to Pavadai and Dhanavel, 2004;
41 mutant cultivars were soybean releases. A great majority of
mutant varieties (64%) were developed by the use of gamma
(ã) rays (Ahloowalia, et al., 2004). Among the chemical
mutagens, ethyl methane sulphonate (EMS) is reported to be
the most effective and powerful mutagen (Solanki and Phogat,
2005). In plants, EMS usually causes point mutations
(Okagaki, et al., 1991). Khatri, et al., 2005 reported that ã rays
and EMS could be fruitfully applied to develop new varieties
with high yield and other improved agronomic traits.
The potential of induced mutations in widening the
genetic diversity is now an established fact in soybean.
Mutation breeding in soybean has been successfully used
for improving yielding ability, earliness, resistance to diseases
and insect pests, quality traits (Wang, et al., 2003; Atak, et al.,
2004), adaptability, plant growth and habit and resistance to
shattering (Wang and Yu, 1988). Some of the useful results of
radiation-induced mutations in soybean are the development
of varieties like Shilajeet, Alankar, PK 262, etc. The present
investigation was, therefore, initiated to study the effect of ã
rays on some quantitative traits at different doses in two
soybean cultivars. Pusa 16 and PK 1042 were the two cultivars
selected to improve the growth characteristics of high potential
cultivars in newly adapted environments.
MATERIALS AND METHODS
The present study consisted of two experiments. In the
first, the seeds of two cultivars of soybean viz., Pusa 16 and
PK 1042 were subjected to 15, 30 and 45 kR ã rays and were
grown in petridishes in the laboratory along with their
respective controls. In the second experiment, the seeds were
subjected to 15, 30, 45, 60, 75, 90 and 105 kR supplied at 60 kR/
sec at the Nuclear Research Laboratory, IARI, New Delhi. The
experiment was categorized into the following treatment
groups.
1. Untreated seeds (irradiation treatments 0-105 Kr);
2. Post-irradiation heat treatment (60°C for 12 h);
3. Post-irradiation cold treatment (0°C for 12 h).
The experiment was a randomized block design with three
replications each having 60 seeds per treatment at the Research
Farm of Kisan (PG.) College, Simbhaoli, Ghaziabad. Seedling
emergence was assessed 5 days after sowing. Survival and
plant height were measured 15 days after germination. The
statistical analysis was done as described by Cochran and
Cox, 1963. ‘Recovery index’ was calculated by the following
formula (Santos, 1965): Recovery index = survival % × seedling
height
RESULTS AND DISCUSSION
Data on irradiation treatments of ã rays are presented in
Table 1 and their corresponding analysis of variance is
presented in Table 2. With increasing doses of ã rays, a
significant reduction was observed in germination, root length,
shoot length and number of secondary roots. In both cultivars
the percentage germination decreased with an increase in the
dose of ã rays. In Pusa 16, the percentage germination at 15
kR was the same as that of the control treatment, while in PK
1042 there was a drastic reduction in the percentage germination
at 15 kR (13.04%) in comparison to the control. At higher
doses of ã rays i.e. 45 kR, the percentage germination of Pusa
16 and PK 1042 was 73.33 and 76.66%, respectively. Both
cultivars showed shorter roots in all treatments compared to
the control (Fig. 1) with the exception of the 15 kR treatment in
Pusa 16, which showed a marginal increase in root length

144 Trends in Biosciences 3 (2), 2010
(1.47 cm) over the control (1.33 cm).
The shoot length in the control population of Pusa 16
and PK 1042 was 2.97 and 2.90 cm, respectively. The
percentage decrease in shoot length at 45 kR over the control
was 28.28 and 50.68% for Pusa 16 and PK 1042, respectively.
The secondary roots of both cultivars were variably sensitive
to the mutagen. Pusa 16 was less affected than PK 1042 at all
doses of ã rays. The number of secondary roots in the control
population was 3.33 and 3.67 for Pusa 16 and PK 1042,
respectively, while at 45 kR there was drastic reduction in the
number of secondary roots in PK 1042 (1.67) compared to
Pusa 16 (2.33). The 15 kR dose of ã rays in Pusa 16 exhibited
the same number of secondary roots as were observed in the
control population.
Post-irradiation heat treatment was more effective than
cold treatments in protecting Pusa 16 and PK 1042 against
radiation damage (Tables 3, 4). Post-irradiation cold treatment
was effective at some lower levels of irradiation but no definite
trend could be noticed as for heat treatments (Tables 3, 4). In
general, a decreasing trend was seen in percentage germination
with an increase in the dose of ã rays. Pusa 16 also exhibited
a higher percentage germination compared to PK 1042 at higher
doses i.e. 60 to 90 kR in all three treatment groups. In contrast
to this PK 1042 showed higher percentage germination at lower
doses i.e. 0 to 30 kR of ã rays.
Table 1.
Table 2.
Source
Post-irradiation heat treatment effectively reduced
Germination and seedling after irradiation
treatments in two genotypes of soybean
Characters
Radiation treatment (kR)
Control 15 30 45
Pusa 16
Germination (%) 93.33 93.33 86.66 73.33
Root length (cm) 1.33 1.47 1.10 1.07
No. of secondary roots 3.33 3.33 3.00 2.33
Shoot length (cm) 2.94 2.50 2.47 2.13
Root shoot ratio 1:2.23 1:1.70 1:2.25 1:1.99
PK 1042
Germination (%) 96.66 83.33 80.00 76.66
Root length (cm) 1.50 1.47 1.23 1.03
No. of secondary roots 3.67 3.00 2.67 1.67
Shoot length (cm) 2.90 2.83 2.67 1.43
Root shoot ratio 1:1.93 1:1.95 1:2.17 1:1.38
Analysis of variance for morphological attributes
in two genotypes of soybean
d.f.
Germination
(%)
*= significant at 1%, ** = significant at 5%
Mean squares
Root
length
(cm)
Number of
secondary
roots
Shoot
length
(cm)
Treatment 7 223.21 0.11 1.23 0.78
Variety 1 4.17 0.13 0.38 0.01
Dose 3 145.83** 0.24** 2.49** 1.48**
Interaction 3 112.50 0.01 0.23 0.33
Error 6 1600.00 0.05 0.88 0.17
Fig. 1.
Root length characteristics in mutagen treated soybean
(A) Mutagen treated PK 1042 (B) Mutagen treated
Pusa 16 (C) PK 1042 control (D) Pusa 16 control
seedling mortality (Table 3). It can be seen that at higher doses
(90 and 105 kR), the percentage survival increased
considerably due to heat treatments although at lower doses
(0 to 60 kR), the effect was not equally conspicuous. Post
irradiation cold treatment did not produce comparable effect
at some higher doses. It can be observed from the data that
post irradiated heat treatment are also effective in seedling
length as more seedling length was noticed in heat treated
populations as compared to control and cold treated
populations. The increase in the dose of ã rays was associated
with the decrease in the seedling length.
During the present study, in comparison to the control,
a reduction in germination, root length, shoot length and
number of secondary roots were noticed in all the mutagenic
treatments of ã rays in both the genotypes except germination
and number of secondary roots at 15 kR in Pusa 16, where the
mean values were found similar as observed in control
treatment. It was also noticed that reduction/decrease was
dose dependent. This reduction due to ã rays may be attributed
to disturbances in cells causing chromosomal damages. The
reduced growth may further be attributed to auxin destruction,
changes in ascorbic acid content and physiological and
biochemical disturbances (Gunchel and Sparrow, 1954; Singh,
1974; Usuf and Nair, 1974). The analysis of variance (Table 2)
showed that for all the studied characters the dose differed,
while no such difference for any character was found between
the varieties. The analysis of variance (Table 2) showed that

KHAN et al., Gamma rays induced mutation in soybean [Glycine max (L.) Merrill] 145
Table 3. Effect of post-irradiation heat and cold treatments on germination per cent, seedling length and survival in Pusa 16
genotype of soybean
Treatment
Heat treatment Cold treatment Untreated
Germination
(%)
Seedling
length (cm)
Survival
(%)
Germination
(%)
Seedling
length (cm)
Survival
(%)
Germination
(%)
Seedling
length (cm)
Survival
(%)
Control 77.40 7.92 95.20 80.10 7.86 96.10 86.60 7.95 97.60
79.10 8.01 92.20 82.20 7.72 93.40 88.60 7.80 94.60
15 kR 74.40 7.70 93.10 73.50 7.06 88.60 75.20 7.42 94.50
76.90 7.79 93.60 78.40 7.41 90.60 77.60 7.35 90.10
30 kR 68.60 6.94 88.20 69.10 6.72 81.50 66.50 6.62 87.40
72.20 7.00 95.40 76.60 6.62 91.10 74.20 6.47 92.10
45 kR 66.40 6.20 90.10 63.20 5.73 86.40 64.10 5.86 83.20
73.20 6.86 86.20 68.40 6.01 84.10 70.50 6.37 82.40
60 kR 68.40 5.75 82.20 61.30 5.29 78.60 62.10 5.43 82.20
65.40 6.53 83.10 62.40 5.72 77.41 66.80 5.93 79.90
90 kR 56.40 4.08 75.60 48.20 3.86 50.20 52.10 3.98 54.40
54.20 4.86 68.20 46.10 5.01 56.60 50.20 4.90 50.60
105 kR 34.50 3.34 52.60 25.60 3.24 36.10 30.20 3.66 40.40
39.60 3.90 50.60 29.10 3.15 44.40 26.10 3.42 42.10
Note: First row indicates Pusa-16 and Second row indicates PK-1042.
Table 4.
Effect of post-irradiation heat and cold treatments
on recovery index in two genotypes of soybean
Treatment Heat treatment Cold treatment Untreated
Pusa 16 PK 1042 Pusa 16 PK 1042 Pusa 16 PK 1042
Control 753.98 738.52 721.04 755.34 775.92 737.88
15 kR 716.87 729.14 671.35 625.52 701.19 662.24
30 kR 612.11 667.80 603.08 547.68 578.59 595.89
45 kR 558.62 591.33 505.44 495.07 487.55 524.89
60 kR 472.65 542.64 442.73 415.79 446.35 473.81
90 kR 308.45 331.45 283.57 193.77 216.51 247.94
105 kR 175.68 197.34 139.86 116.96 147.86 143.98
for all the studied characters the dose differed, while no such
difference for any character was found between the genotypes.
The variety x dose interaction was also found significant for
all the characters. Similar results were also reported by Mehetre
and Mahajan, 1996; Fe, et al., 2000 in soybean and by Kumar
and Sinha, 2003 in lentil.
Santos, 1965 used a post irradiation heat treatment in
mungbean, where the seeds were kept at 80°C for 24 hs and
found that post irradiation heat treatment produced greater
protection by way of increased survival per cent, plant height,
and recovery index. Results obtained in the present study i.e.
the more effectiveness of heat treatment as compared to cold
treated and untreated populations especially at higher doses
largely agree with those of Santos, 1965, although the seedling
length did not increase in the heat treated populations in ‘Pusa
16’.
The effectiveness of heat relative to cold treatment may
be due to the differences in moisture level brought about by
heat treatment. Reduced moisture content of seeds due to
heat treatment leads to poor availability of free ions resulting
in reduced production of H 2
O 2
, the intermediate product, which
is believed to be largely responsible for much of the mutagenic
effect and reduced injury. The results revealed that with
increasing doses of gamma rays, there was significant
reduction in germination, root length, shoot length and number
of secondary roots. The two cultivars were found to have
varied mutagen sensitivity in number of secondary roots.
Pusa 16 was found to be less affected than PK 1042 at all the
doses of gamma rays. Thus, on the basis of above findings, it
may be suggested that with the application of post irradiation
treatments (particularly heat), radiation induced injuries may
be minimized and a higher frequency of different types of
mutations with wide spectrum can be obtained.
LITERATURE CITED
Ahloowalia, B.S., Maluszynski, M. and Nichterlein, K. 2004. Global
impact of mutation derivedvarieties. Euphytica, 135: 187-204
Atak, C., Alikamanoglu, S., Acýk, L. and Canbolat, Y. 2004. Induced of
plastid mutations in soybean plant (Glycine max L. Merrill) with
gamma radiation and determination with RAPD. Mutation Research,
556: 35-44
Cochran, W.B. and Cox, M. 1963 Experimental designs. Asia Publishing
House, New Delhi. pp. 611.
Fe, C-de-la., Romero, M., Ortiz, R. and Ponce, M. 2000. Soybean seed
radio-sensibility to 60 Co gamma rays. Cultivos Tropicales, 21(2):43-
4 7
Gunchel, J.E. and Sparrow, A.H. 1954. Aberrant growth in plants by
ionizing radiations. Brookhaven Symposium Biology, 6: 252-279
Khatri, A., Khan, I.A., Siddiqui, M.A., Raza, S. and Nizamani, G.S.
2005. Eualuation of high yielding mutants of Brassica juncea cv.
5-9 developed through gamma rays and EMS. Pakistan J. Botany,
37(2): 279-284.
Kumar, R. and Sinha, R.P. 2003. Mutagenic sensitivity of lentil
genotypes. Journal of Applied Biology, 13(1/2): 1-5.
Mehetre, S.S. and Mahajan, C.R. 1996. Effects of different doses of
gamma rays on germination and survival of soybean (Glycine max.
L. Merrill). Indian Journal of Agricultural Research, 30(3-4): 186-
190.
Okagaki, R.J., Neffer, M.G. and Wessler, S.R. 1991. A deletion common
to two independently derived waxy mutations of maize. Genetics,

146 Trends in Biosciences 3 (2), 2010
127: 425-431
Padavai, P. and Dhanavel, D. 2004. Effect of EMS, DES and Colchicine
treatment in soybean. Crop Research, 28(1, 2 & 3): 118-120.
Padavai, P. and Dhanavel, D. 2005. Effect of gamma rays on yield and
its components in soybean [Glycine max. (L.) Merrill var. CO-1].
Crop Research, 30(3): 459-461.
Santos, I.S. 1965. Induction of mutations in Mung bean (Phaseolus
aureus Roxb.) and genetic studies of some of the mutants. In Induced
Mutations in Plants. IAEA Vienna, pp.169-179.
Singh, B.B. 1974. Radiation induced changes in catalase, lipase and
ascorbic acid of safflower seeds during germination. Radiation.
Botany, 14: 195-199.
Solanki, I.S. and Phogat, D.S. 2005. Chlorophyll mutation induction
and mutagenic effectiveness and efficiency in macrosperma lentil
(Lens culinaris Medik.). National Journal of Plant Improvement,
7(2): 81-84.
Usuf, K.K. and Nair, P.M. 1974. Effect of gamma irradiation on the
indole acetic acid synthesizing system and its significance in sprout
inhibition of potatoes. Radiation. Botany, 14: 251-256.
Wang, L.Z., Wang, L., Zhao, R.J., Pei, Y.L., Fu, Y.Q., Yan, Q.S. and Li,
Q. 2003. Combining radiation mutation techniques with
biotechnology for soybean breeding. International Atomic Energy
Agency Technical Documents, 1369: 107-115.
Wang, P.Y. and Yu, B.S. 1988. Preliminary study on gamma-rays chronic
radiation for growing plants in soybean. Soybean Genetics
Newsletter, 18: 82-85.
Recieved on 30.10.2010 Accepted on 28.11.2010

Trends in Biosciences 3 (2): 147-148, 2010
Plant Parasitic Nematodes Associated with Banana Crops (Musa AAA) in District
Patiala, Punjab, India
HARPREET KAUR*, HARJINDER KAUR AND NEELAM KUMARI
Department of Zoology, Punjabi University, Patiala 147 002, Punjab
*e-mail: harpreet_bimbra@yahoo.com; harpeet-9cc@yahoo.co.in
ABSTRACT
Seven plant parasitic nematode species were identified in root
and soil of banana orchards (Musa AAA- Cavendish sub group)
‘Grand Nain’ in the Shekhpura village in district Patiala,
Punjab, India. They were Meloidogyne incognita, M. javanica,
Hoplolaimus chambus, Rotylenchulus reniformis, Pratylenchus
coffeae, Longidorous siddiqii and a free living nematodes
Thornenema sp. A total of 720 samples of root and rhizospheric
soil from 10 fields were collected and examined. All the samples
were infested with plant parasitic nematodes. H. chambus was
the most common and widely distributed species showed 63.8%
incidence with relative frequency of 25.9%, M. incognita was
the next common species with root gall index ranging from 4 to
5. 500 samples showed mixed infestations and the most common
combination was H. chambus + M. incognita + M. javanica + L.
siddiqii (13.8%).
Key words
Musa AAA, distribution, survey, rhizosphere,
nematodes
Bananas are a staple food and one of the world’s most
important fruit crop. It is fourth - ranked agricultural crop in
the world and first among fruits. The banana crop is prone to
infestation by wide variety of plant parasitic nematodes.
According to the review by Charles, 1989 more than 132
species belonging to 54 genera have been isolated from the
adventitious root system of Musa sp. cultivated throughout
the world. Of these, 33 genera and more than half of the
reported species have been recorded from various parts of
India. Among the major nematode pests infesting the Musa
crop are the Radopholus similis, Helicotylenchus sp.,
Pratylenchus sp. and Heterodera sp. are relatively more
important. The other nematodes of importance are
Meloidogyne sp., Rotylenchulus reniformis and Hoplolaimus
sp. There are many reports of yield losses in banana due to
plant parasitic nematodes in Kerala 46.76% (Sosamma, et al.,
1979) and in Karnatka 31.61% (Parvatha Reddy, et al., 1992).
Therefore, a study involving survey was undertaken for the
first time to assess the incidence and frequency of occurrence
of various plant parasitic nematodes associated with banana
in district Patiala, Punjab, India.
MATERIALS AND METHODS
A total 720 soil and root samples were collected from
rhizosphere of the banana plants. 250 g of soil and roots (5g)
from each sample was processed for the isolation of
nematodes. Nematodes were extracted using Baermann funnel,
sieving and decanting methods (Baermann, 1917; Cobb, 1918).
The number of nematodes recovered from soil and roots of
each sample was determined. Juveniles in the infested roots
were stained and roots were cut into 1cm pieces, immersed in
water, macerated by homoginiser and counted. Root galls due
to Meloidogyne was rated on a scale of 0 to 5. The perineal
patterns of mature females of Meloidogyne sp. were prepared
(Zarina and Shahid, 2002). Frequency and relative frequency
of occurrence of various nematodes were calculated by the
method given by Norton, 1978.
RESULTS AND DISCUSSION
During the present investigation 720 root and
rhizospheric soil samples from banana (Musa AAA) were
examined and 100% infestation was observed. Five plant
parasitic nematode species recorded were: Hoplolaimus
chambu, Meloidogynes incognita, M. javanica, Pratylenchus
coffeae and Rotylenchulus reniformis and two dorylaimids
were: Longidorus siddiqii and Thornenema sp. (Table 1). The
frequency of plant parasitic nematodes showed that H.
chambus was most frequently encountered species with
relative frequency of 25.9%, followed by M. incognita and M.
javanica. Roots showed extensive necrosis and galling with
infective second stage juveniles, adult males and females of
M. incognita and M. javanica with 100% and 75% galls
respectively. Out of two dorylaimid species Longidorus
siddiqii was more common than Thornenema sp. which
occurred only twice. Out of 720 samples studied 500 samples
showed mixed infestations therefore percentage incidence was
found to be 69.4% (Table 2). The most common combination
of mixed infestation was H. chambus + M. incognita + M.
javanica + L. siddiqii (13.8%), followed by M. incognita + M.
javanica + R. reniformis + H. chambus (11.1%) and H. chambus
+ L. siddiqi (8.3%).
Present findings revealed that H. chambus, the lance
nematode is the most common species infecting banana
orchards of district Patiala, Punjab. Earlier, three species of
Hoplolaimus have been reported from India , H. galeatus
Prasad, et al., 1964 from Delhi, H. chambus Jairajpuri, et al.,
1973 from Chamba and H. senihorstei Mukherjee and Das
Gupta, 1983 from west Bengal. M. incognta, the root knot
nematode has been found as the second most common

148 Trends in Biosciences 3 (2), 2010
Table 1.
Table 2.
Frequency of occurrence and population density
of different species of plant parasitic nematodes
associated with banana
Names of the
Nematode
Frequency
(%)
Relative Frequency
(%)
Root gall
index
H. chambus 63.8 25.9 -
M. javanica 40.9 16.6 4.0
L. siddiqii 41.6 16.9 -
R. reniformis 30.5 12.3 -
P. coffeae 11.1 4.5 -
Mixed infestation of plant parasitic nematodes from
soil and roots of banana (Musa AAA)
Sr.
No.
Mixed infestations
% age of
infestation
1. H.chambus+M.incognita+M.javanica
13.8
+L.siddiqii
2. M.incognita+M.javanica+R.reniformis
11.1
+H.chambus
3. H.chambus+L.siddiqii 8.3
4. H.chambus+L.siddiqii+P.coffeae 5.5
5. H.chambus+M.brachyuris+R.reniformis
2.7
+ Thornenema sp.
6. M.incognita+M.javanica+P.coffeae 2.7
7. H.chambus+M.incognita+M.javanica
2.7
+R.reniformis+L.siddiqii
8. H.chambus+M.brachyuris+R.reniformis
2.7
+ L.siddiqii
9. H.chambus+P.coffeae+R.reniform 2.7
10. H.chambus+R.reniform+L.siddiqii 2.7
11. H.chambus+M.brachyuris+L.siddiqii 2.7
12. H.chambus+M.brachyuris 2.7
13. M.incognita+M.javanica+L.siddiqii 2.7
14. H.chambus+M.incognita+M.javanica
2.7
+R.reniformis.
15. H.chambus+M.incognita+M.javanica
+Thornenema sp.
2.7
No. of positive samples = 720
Total no. of mixed infestation cases = 500
Percentage of mixed infestation = 69.4%
nematode infesting root system of banana followed by M.
javanica. Waele and Davide, 1998 M. incognita and M.
javanica are the most common and widely distributed
pathogens of banana and plantains. In the present study P.
coffeae showed 11.1% of incidence. P. coffeae caused serious
damage to banana crops in India, Cuba, Costa Rica and Ivory
Coast. Siddiqi, 1964, Stoyanov, 1967, Volkers Gamboa, 1988
and Adiko, 1988. Rotylenchulus reniformis, a reniform
nematode, a sedentary semiendoparasite showed 30.5%
incidence while. Mukherjee and Das, 1983 also reported it as
the most common species of banana plantains in west Bengal.
LITERATURE CITED
Adiko, A. 1988. Plant Parasitic Nematodes Associated with Plantain,
Musa paradisiaca (AAB) in the Ivory Coast. Revue de Nematologie,
11: 109-113.
Baermann, G. 1917. Eine einfache methode zur affindung von
ankylostomum-(Nematoden) –larven in erdprobem. Geneesk
Tijdschr Ned-Indie, 57: 131-137.
Charles, J. S. K. 1998. Nematode Pests of Banana, In: Nematode
Diseases in Plants,(ed. Trivedi, P. C.) CBS Publishers and
Distributors, New Delhi, pp.288-309.
Cobb, N.A. 1918. Estimating the nema population of the soil. Agric.
Tech. Circ. Bur. Pl. Ind. U. S. Dep. Agric., 1: 48.
Jairajpuri, M. S.; Baqri, Q. H. and Ahmad, S. 1973. Nematodes of high
altitudes in India. II. Studies on the genus Tridontus Khera, 1965
with notes on the Synonymy of genus Syedella Suryawanshi, 1971
(Diplogasteridal). Nematologica, 19: 69-74.
Mukherjee, B. and Das Gupta, M. K. 1983. Community analysis of
nematodes associated with Banana populations in the Hooghly
district, West Bengal. Nematologia Mediterranea, 11: 43-48.
Norton, D. 1978. Ecology of plant parasitic nematodes. Interscience
Publications. John-Willey and Sons, New York.
Prasad, S. K., Das Gupta, D. R. and Mukhopadhyaya, M. C. 1964.
Nematodes Associated with Commercial Crops in North India and
Host range of Meloidogyne javanica. Indian Journal of Entomology,
26: 438-46.
Parvatha Reddy, P.; Khan, R. M. and Rao, M. S. 1992. Crop loss
estimation in banana due to the burrowing nematode- Radopholus
similis. Golden Jubile Sympos. on Optimization of Productivity
and Utilization of Banana, (Abstr.) pp.61.
Sosamma, V. K., Sundararaju, P. and Koshy, P. K. 1979. Effect of
Radopholus similis on Banana. Indian Journal of Nematology, 9:
27-31.
Stoyanov, D. 1967. Especies de Nematodes Parasitos del plantana en
cuba Y possibilidadeo de control. Revta Agriculture Cuba, 1: 9-47.
Siddiqi, M. R. 1964. Studies on nematode root rot of citrus in Uttar
Pradesh, India. Proceedings 2001. Society of Calcutta, 2: 73-74.
Volkers, E. E. L. and Ganboa, A. 1988. Nematodes on Plantain. Boletin
informative manego integrado de plagas No., 7: 3-4.
Waele,D.D and Davide R.G.1998. The root- knot nematodes of Banana.
Musa Pest Fact, International Network for the improvement of
Banana and Plantain (INIBAP), Parc Scientifique Agropolis II, 34
397 Montpellier cedex 5, France. Sheet No. 3.
Zarina, B. and Shahid, S. S.2002. New hosts of root-knot nematode in
Pakistan. Asian Journal of Plant Science, 1(4): 417.
Recieved on 28.05.2010 Accepted on 30.06.2010

Trends in Biosciences 3 (2): 149-151, 2010
Cytotoxic Effects of Methyl Methane Sulphonate in Two Varieties of Capsicum
annuum L.
MOHD GULFISHAN*, AINUL HAQ KHAN AND IRAM FATMA JAFRI
Laboratory of Cytogenetics and Mutation Breeding, Dept. of Botany, Aligarh Muslim, University,
Aligarh 202 002
e-mail: fishan02@rediffmail.com
ABSTRACT
Seeds of Capsicum annuum L. var. Pusa jwala and G4 were
treated with varying concentrations (0.01%, 0.02%, 0.03%,
0.04% and 0.05%) of methyl methane sulphonate (MMS) and
their effect on different stages of meiosis has been studied in
M 1
generation. Various types of meiotic abnormalities and
reduction in chiasma frequency were the characteristics of
cytotoxicity induced by MMS observed in treated populations.
The highest percentage of chromosomal aberration was
recorded at the highest concentration of the mutagen. However,
MMS treatments were found to be more effective in inducing
meiotic abnormalities and reduction in chiasma frequency in
var. G4 as compared to var. Pusa jwala. Moreover, a positive
relationship between increasing concentrations of MMS and
reduction in chiasma frequency in treated population was also
observed. Taking the percentage of meiotic abnormalities and
reduction in chiasma frequency as an index of sensitivity of
genotype to MMS, var. G4 was found to be more sensitive than
var. Pusa jwala.
Key words
Capsicum annuum, chiasma frequency, meiotic
aberrations, MMS
Chilli (Capsicum annuum L.) is a major spice yielding
crop plant. Analysis of cytotoxic potential of a substance by
investigating the induction of chromosomal alterations
represents an effective method to quantify the cytotoxicity
induced by the substance. Therefore, investigation on meiotic
aberrations and their genetic consequences forms an integral
part of most of mutation studies. They also provide a
considerable clue to asses the sensitivity of plant for different
mutagens. In the present study the cytotoxic effects of MMS
on the gametic cell of two varieties of Capsicum annuum
were tested in terms of cytological abnormalities and changes
in chiasma frequency at metaphase-I stage.
MATERIALS AND METHODS
The seeds of Capsicum annuum L. var. Pusa jwala and
G4 obtained from IARI, New Delhi, were treated with different
concentrations i.e., (0.01, 0.02, 0.03, 0.04 and 0.05%) of MMS.
The seeds were washed thoroughly in running tap water and
excess of moisture was blotted off and then sown in earthen
pots to raise M 1
generation. The controls were maintained
separately. After 35 days, the seedlings were transplanted in
the experimental field. For meiotic studies, young flower buds
from 30-40 randomly selected M 1
plants were fixed in freshly
prepared Carnoy’s fixative (Absolute alcohol, Chloroform and
acetic acid in 6:3:1 ratio) for 24 h, washed and preserved in
70% alcohol. Anthers were squashed in 2% acetocarmine and
slides were made permanent through butyl-alcohol series.
Microphotographs were taken by using X30 Olympus
Research Photomicroscope.
RESULTS AND DISCUSSION
Meiosis was perfectly normal in the control plants
showing 12 bivalent at diakinesis. However, a number of
meiotic abnormalities were recorded in the plants raised from
the seeds treated with different concentrations of MMS. The
most frequent aberrations were univalents, multivalents,
stickiness, precocious separation, stray bivalent, laggards,
bridges, and disturbed polarity, In addition to the above
mentioned aberrations cytomixis was also noticed in some
PMCs in a very low frequency. Although the types of meotic
abnormalities were more or less similar in all the treatments, a
significant difference in the frequency of cell showing specific
abnormalities in the two varieties was recorded. The frequency
of various meiotic aberrations in each treatments along with
the total percentage of abnormal PMCs has been summarized
in Table 1. A dose dependent increase in the meiotic aberrations
was observed in both the varieties. The maximum frequency
of aberrations was recorded in the plants obtained by treating
the seeds with the highest concentration of MMS. The most
common abnormalities at metaphase I/II were multivalents,
and stickiness of chromosomes while lagging chromosomes
were found frequently at anaphase I/II. At telophase I/II the
dominant abnormality was micronuclei. It is clear from the
observations that DES caused more chromosomal damage in
var. G4 than Pusa jwala. A dose dependent decrease in chiasma
frequency per cell and per bivalents was recorded in treated
plants (Table 2).
The frequency of chromosomal aberrations and
reduction in chiasma frequency during the present
investigation clearly revealed that MMS is a potent mutagen
for Capsicum annuum. Stickiness among chromosomes was
the most common abnormality recorded at metaphase I/II.
Bivalents were found clumped in single or different groups at
metaphase I due to stickiness which may be due to
depolymerisation of nucleic acids caused by mutagen or due
to partial dissociation of nucleo-proteins and alterations in

150 Trends in Biosciences 3 (2), 2010
Table 1. Abnormalities (%) at different stages of meiosis induced by (MMS) in Capsicum annuuum L. var. Pusa jwala and G4
Table 2.
Treatment
Effect of MMS on chiasma frequency at
metaphase-I in M 1
generation of Capsicum
annuum L. var. Pusa jawala and G 4
.
Var. Pusa jawala Var. G 4
No. of No. of
chaisma per chiasma per
bivalent cell
No. of
chiasma per
cell
No. of
chaisma per
bivalent
Control 18.65 1.55 17.50 1.45
MMS (%)
0.01 18.15 1.51 16.85 1.40
0.02 17.70 1.47 16.20 1.35
0.03 17.30 1.43 15.60 1.30
0.04 16.60 1.38 15.25 1.27
0.05 15.80 1.31 14.45 1.20
their pattern of organization. Jayabalan and Rao, 1987
suggested that stickiness of chromosomes might be due to
disturbances in cyto-chemically balanced reactions in the
nucleic acids. The occurrence of univalents and multivalents
at metaphase I has been reported in various plants like barley
(Kumar and Singh, 2003) in lentil Reddy and Annadurai, 1992.
Mutagen induced structural changes in chromosomes might
be responsible for the failure of pairing among homologous
chromosomes and hence the occurrence of univalents.
Precocious chromosome migration to the poles may have been
resulted from spindle disfunction or precocious chiasma
terminalization at diakinesis or metaphase-I (Kumar and Rai,
2007).
Unequal separation of chromosomes at anaphase I/II,
observed in the present study, may be due to occurrence of
multivalents and failure of chromosomes to segregate equally.
Kumar and Singh, 2003 attributed it to the random movement
of univalents to any one of the poles. Presence of laggards
may be attributed to the inability of multivalents to separate
properly (Bhat, et al., 2005). The formation of chromatin bridges
might be due the failure of chiasmata in a bivalent to terminalize
and the chromosome get stretched between the poles (Saylor
and Smith, 1966), According to Tarar and Dnyansagar, 1980,
the presence of chromatin bridges without fragments may be
due to restitution or the fragments getting entangled or
attached with normal chromatids of chromosomes. Generally,
laggards and non-oriented bivalents may produce micronuclei
at telophase if they fail to reach the poles in time to be included
in the main nucleus or irregular chromosome segregation at
meiosis I and II could be the result of the non-oriented
bivalents formed due to spindle dysfunctioning or may be
due to the formation of univalents at diakinesis or metaphase-
I, which shows an inability to congregate on the equatorial
plate resulting in the formation of micronuclei and abnormal
pollen grains (Koduru and Rao, 1981). Chiasma frequency
was variable in the populations treated with different
concentrations of the mutagens, however, reduction in
chaisma frequency was dose dependent. A considerable
decrease in chiasma frequency showed the prominent effect
of MMS on chromosomes. Rees, 1955 showed that crossing

MOHD GULFISHAN et. al., Cytotoxic Effects of Methyl Methane Sulphonate in Two Varieties of Capsicum annuum L. 151
over and chiasma formation are under genetic control. Goud,
1976 in wheat, Sree Ramulu, 1973 in Sorghum. Sadanadam
and Subhash, 1984 in Capsicum have also reported the
reduction in chiasma frequency due to mutagens induced
structural changes. In the present investigation reduction in
chaisma frequency may be attributed to the nature and potency
of mutagen and to the underlying factors such as complex
structural changes or to the nature of the genes responsible
for chiasma formation.
The present observations have shown varying
responses of genomes of these two varities to MMS. The
genome of var. G4 was found to be more sensitive than the
genome of var. Pusa jwala as the chromosomal abnormalities
and reduction in chiasma frequency were higher in var. G4
with similar doses of MMS in var. Pusa jwala.
LITERATURE CITED
Bhat, T.A., Khan, A.H., Parveen, S. and Ganai, F. 2005b. Clastogenic
effect of EMS and MMS in Vicia faba L., J. Cytol. Genne., 6: 117-
122.
Goud, J.V. 1967. Chromosme aberration induced by radiation and
chemicals. Genet. Iber, 19: 143-156
Jayabalan, N., Rao, G.R. 1987. Gamma radiation induced cytological
abnormalities in Lycopersicon esculentum mill var. pusa ruby
Cytologia, 52: 1-4.
Koduru, P.K.R. and Rao, M.K. 1981. Cytogenetics of synaptic mutants
in higher plants. Theor. Appl. Genet., 59: 197-1214.
Kumar, G., Rai, P.K. 2007. EMS induced karyomorphological variations
in maize. (Zea mays L.) inbreds. Turk. J. Biol., 31: 187-195.
Kumar, G., Singh, V. 2003. Comparative analysis of meiotic abnormalities
induced by Gamma rays and EMS in barley. J. Ind. Bot Soc., 82:
19-22
Reddy, V.R.K. and Annadurai, M. 1992. Cytological effects of different
mutagens in lentil (Lens culinaris Medik). Cytologia, 57: 213-216.
Rees, H. 1955. Genotypic control of chromosomes behaviour in rye
inbred lines. Heredity, 9: 93-116
Sadanandam, A., Subhash, K. 1984. Effect of chemical mutagens on
chiasma frequency in Capsicum annuum L. Cytologia, 49: 415-
419.
Sree Ramulu, K. 1973. A comparison on the effect of radiation and
chemical mutagens on chromosome association and chiasma
frequency in diploid Sorghum. Cytologia., 38: 615-621.
Saylor, L.G. and Smith, B.N. 1966. Meiotic irregularities in species of
interspecific hybrids in Pisum. An. J. Bot., 53: 453-468.
Tarar, J.L. and Dnyansagar, V.R. 1980 .Comparison of ethyl methane
sulphonate and radiation induced meiotic abnormalities in Turnera
ulmifolia Linn. var. angustifolia Wild. Cytologia, 45: 221-231.
Recieved on 15.10.2010 Accepted on 25.11.2010

152 Trends in Biosciences 3 (2): 152-155, 2010 Trends in Biosciences 3 (2), 2010
Productivity Evaluation and Nitrogen Dynamics in Rice (Oryza sativa)-Wheat
(Triticum aestivum L) Cropping System as Influenced by Crotalaria juncea Green
Manuring
AJAY KUMAR 1 , H.K. PATRO 2* DEBIPRASAD DASH 3 , B.S. MAHAPATRA 4 AND D.K. SHUKLA 5
1
KVK Gaina Aincholi, Pithoragarh, 262 530. 2 OUA&T, Bhubaneshwar. 3 KVK, Balasore, Orissa. 4 Department
of Agronomy, G.B. Pant University of Agriculture and Technology, Pantnagar, Uttarakhand,
263 145. 5 Fertilizer Association of India, New Delhi 110 067
e-mail: pranati_hkp@hotmail.com
ABSTRACT
A field experiment was conducted during 2001-2002 and 2002 -
2003 on the mollisols of Crop Research Station at Pantnagar
University to find out the effect of green manuring with
Sunhemp (Crotalaria juncea) on productivity, soil microbial
nitrogen, wet soil ammoniacal nitrogen, organic carbon, total
and mineralizable nitrogen status of soil in rice-wheat cropping
system. Crotalaria green manuring at 60 days stage resulted
in 5746 and 5663 kg rice yield /ha in 2001-02 and 2002-03,
respectively. Application of 150 kg N/ha to rice resulted in yield
of 6385 and 6521 in 2001-02 and 2002-03, respectively. The
wheat yield due to Crotalaria juncea green manuring was 3792
and 3818 in 2001-02 and 2002-03, respectively. Application of 75
and 150 kg N/ha to wheat crop resulted an increase in grain
yield of wheat by 36.8 and 106.2% during 2001-02 and 44.6 and
105.7 during 2002-03 over no green manure treatment
respectively. Crotalaria green manuring after 60 days of sowing
resulted in 64.07 and 70.44 kg soil microbial biomass nitrogen
( SMB-N) at 30 days after transplanting stage, while at harvest
of rice the amount was 40.78 and 41.11 kg /ha in 2001-02 and
2002-03, respectively. At harvest of wheat the SMB-N was 42.41
and 42.73 kg/ha in 2001-02 and 2002-03, respectively. The wet
soil ammonical nitrogen decreased with the age of rice crop
and highest (44.2 and 45.9 in 2001-02 and 2002-03) was recorded
due to application of 150 kg N/ha at 30 days after transplanting
stage.
Key words
Crotalaria juncea, green manuring, rice, wheat,
microbial biomass nitrogen
Rice-wheat cropping system is the back bone of food
security which covers an area of about 11 million hectare and
contributes about 31 per cent of total cereal production of the
country (Hegde, 1998). It is an intensive cropping system and
removes 400 to 600 kg NPK /ha/yr of which nitrogen alone
accounts for 200 to 300 kg/ ha/yr (Paikaray, et al., 2001). Over
the past four decades, farmers have become increasingly
dependent on chemical source of nitrogen for obtaining higher
yields of rice and wheat.
The unabated use of chemical fertilizers in last four
decades has led to decline in the use of cover crops and
organic manures. This practice of continuous use of high
analysis chemical fertilizers and that too in imbalanced from is
adversely affecting the sustainability of agricultural
production and causing environmental pollution.
There is renewed interest in crop residues, green
manures and other organic manures as source of soil organic
matter and nutrients for crops especially nitrogen. As regards
to nitrogen dynamics, significant changes in organic N
fractions (95-98% of total soil N) occur in soil during flooding
(rice crop) and drainage (wheat crop) cycles of rice-wheat
system. The magnitude of ammonium-N formation during rice
growth stages under submerged conditions is mainly
dependent on the soil and the rate of applied nitrogen and
organic matter content of the soil.
The green biomass potential, dry matter accumulation
and nitrogen contribution of Crotalaria juncea has been
reported to be higher than traditionally grown Sesbania
aculeata (Kolar, et al., 1993). Therefore, proper understanding
of N dynamics of native as well as applied N in rice-wheat
system is essential for better scheduling of fertilizer N and
sustaining the productivity.
MATERIALS AND METHODS
The field experiment was conducted from 2001-2002 to
2002-2003 to evaluate the effect of integrated use of fertilizer
nitrogen with, Crotalaria juncea green manure incorporation
before rice crop and its effect on wheat under varying levels
of nitrogen application. The experiment during both the years
was carried out in C-3 block of Crop Research Centre of the
G.B. Pant University of Agriculture and Technology, Pantnagar.
The soil of the experimental plot was classified as Beni silty
clay loam under the order mollisol, having pH 7.3, organic
carbon 0.805%, available nitrogen 238 kg/ha, total nitrogen
0.089 %, available phosphorus 19.9 kg/ha, available potassium
150 kg/ha, and soil microbial biomass nitrogen 21.0 kg/ha.
The experiment was laid out in a split-split plot design
keeping Crotalaria juncea green manuring in main plot, level
of nitrogen applied to rice in sub-plot and level of nitrogen to
wheat in sub-sub-plot with three replications during both the
years. The sowing and incorporation of green manure and
wheat was done by tractor driven implements.
Measurements of soil microbial biomass N (SMB-N),

KUMAR et. al., Productivity Evaluation and Nitrogen Dynamics in Rice (Oryza sativa)-Wheat (Triticum aestivum L) 153
was done after fumigation of soil samples with chloroform for
24 hr and extraction by 0.5M K 2
SO 4
as described by Brookes,
et al., 1985. Wet soil NH 4
+
-N was determined by Indophenol
blue colour method (Keeney and Nelson, 1982).
RESULTS AND DISCUSSION
The Crotalaria juncea green manuring at 60 days after
sowing (DAS) resulted in significant increase in filled spikelets/
panicle of rice during both the years compared to the rice
grown in summer fallow plots. Application of 75 and 150 kg N/
ha to rice crop resulted in successive significant increase in
filled spikelets /panicle during both the years. Crotalaria
juncea green manuring at 60 days (Crotalaria 60) resulted in
significant increase in 1000 grain weight during both the years
of experimentation. Application of 150 kg N/ha being at par
with 75 kg N/ha resulted in significant increase in 1000 grain
weight in 2001-02, whereas in 2002-03 levels of nitrogen had
no significant differences on 1000 grain weight. Similar
increase in yield attributing character due to incorporation of
green manure has been reported by Patro, 2002, and
Mahapatra, et.al., 2005.
Rice grain yield was maximum with Crotalaria 60 DAS
and minimum with summer fallow during both the years. C.
juncea incorporated at 60 days resulted in 5.74 tonnes/ha of
rice yield which was higher by 1.09, 2.12 tonnes/ha in 2001-02
and 0.76, 1.87 tonnes/ha during 2002-03 over C. juncea
incorporated at 45 days and summer fallow respectively (Table
1). This was due to extended supply of available nitrogen and
higher available nitrogen status in the soil. Per cent increase
in grain yield due to 75 and 150 kg N /ha over control was 48.7
and 108.3 during 2001-2002 and 48.3 and 106.9 during 2001-
2002, respectively. The integrated supply of nitrogen through
green manure and fertilizer nitrogen leads to higher grain yield,
similar findings of increase in grain yield has been reported
by Mahapatra, et al., 2005.
Rice straw yield with Crotalaria 60 was significantly
higher as compared to Crotalaria 45 and fallow treatments
during both the years. Per cent increase in straw yield due to
Crotalaria 60 green manure was 13.7 and 34.7 in 2001-2002
and 9.1 and 37.4 in 2002-2003 over Crotalaria 45 and fallow,
respectively (Table 1). The major effect of green manure is
undoubtly due to its nitrogen contribution, organic matter
added and availability of nutrients other than nitrogen.
Wheat grain yield was maximum in Crotalaria green manured
plots and minimum in fallow plots during both the years (Table
1). Per cent increase in grain yield of wheat due to Crotalaria
60 over Crotalaria-45 and fallow treatments, were 15.4 and
38.8 in 2001-2002 and 11.0 and 34.5 in 2002-2003, respectively.
Similar response due to residual effect of green manuring to
wheat yield was to the tune of 11.6 and 10.6 per cent in sandy
soil Ludhiana and clay loam soil, Pantnagar respectively (Kolar,
et al., 1993; Patro, 2002).
Increasing levels of nitrogen to rice up to 150 kg N/ha
brought significant improvement in wheat grain yield during
both the years. Application of 75 and 150 kg N/ha to wheat
crop showed an increase in grain yield of wheat by 36.8 and
106.2 per cent during 2001-2002; and 44.6 and 105.7 per cent
during 2002-2003 over control, respectively. Response to per
kg of nitrogen applied at 75 and 150 kg N/ha level was 10.9
and 20.5 kg grain during 2001-2002, and 13.3 and 18.3 kg grain
during 2002-2003, respectively.
Soil microbial biomass nitrogen (SMB-N), is the amount of
nitrogen extracted by 0.5 m K 2
SO 4
after fumigation with
Table 1.
Yield attributing characters of rice, and grain and straw yield of rice and wheat as influenced by Crotalaria green
manuring
Crotalaria juncea green
manuring
Filled
spiklets/panicle
1000 Grain weight
(g)
Grain yield
(kg/ha)
Straw yield
(kg/ha)
Wheat grain yield
(kg/ha)
Wheat straw yield
(kg/ha)
01-02 02-03 01-02 02-03 01-02 02-03 01-02 02-03 01-02 02-03 01-02 02-03
No green manuring
(Fallow)
82.1 86.5 29.34 29.39 3618 3785 5599 5587 2732 2839 3748 3926
45 DAS 91.9 101.0 29.85 30.25 4648 4895 6633 7038 3285 3439 4300 4559
60 DAS 100.1 104.8 30.35 30.94 5743 5663 7542 7678 3792 3818 4784 5035
SEm ± 1.79 2.75 0.21 0.37 73 94 155 59 34.4 61.7 21.8 51.4
CD (5%) 6.99 10.75 0.82 1.44 285 368 607 232 134.6 241.4 83.3 200.8
N levels to rice (kg/ha)
0 78.7 82.9 28.37 29.36 3065 3151 5051 5204 2997 30.71 3911 4177
75 92.4 99.4 29.93 30.31 4558 4672 6580 6785 3245 3306 4212 4390
150 103.0 110.0 31.25 31.91 6385 6521 8143 8315 3567 3719 4711 4955
SEm ± 1.76 2.14 0.27 0.88 79 59 74 106 46.6 23.1 35.3 53.5
CD (5%) 5.41 6.59 0.82 NS 244 181 229 326 143.4 71.3 108.9 164.8
N levels to wheat (kg/ha)
0 2214 2242 3114 3312
75 3029 3241 4138 4467
150 4565 4614 5581 5742
SEm ± 48.8 52.4 30.1 53.6
CD (5%) 140.1 156.4 86.2 153.6

154 Trends in Biosciences 3 (2), 2010
chloroform. The microbial biomass nitrogen serves as a
potential source of mineralizable nitrogen which can be used
by plants. SMB-N gradually declined with time and reached
minimum at rice harvest during both the years. Crotalaria 60
resulted in 64.7 and 70.4 kg/ha SMB-N at 30 DAT stage, 58.6
and 60.4 at 60 DAT stage, 51.8 and 49.8 at 90 DAT and 40.8
and 41.1 at harvest of rice and it was significantly higher than
fallow treatment at all the stages during 2001-02 and 2002-03
respectively (Table 2). SMB-N increased significantly with
increase in nitrogen levels up to 150 kg/ha at all stages of rice
growth during both the years. Similar findings on SMB-N
have been reported by Ocio, et al., 1991.
At harvest of wheat Crotalaria 60 resulted in
significantly higher SMB-N over Crotalaria 45 and fallow
treatment during both the years. Application of 150 kg N/ha
to wheat resulted in 13.8, 43.4 and 13.9, 43.5 % increase in
SMB-N over 75 kg N/ha and no nitrogen use in 2001-02 and
2002-03 respectively (Table 2).
Crotalaria 60 recorded significantly higher soil NH 4+
- N than
fallow treatment at all the stages of growth during both the
years (Table 2). The increase in wet soil NH 4+
-N due to 150 kg
N/ha over 75 kg N/ha and no nitrogen use was 30.0 and 82.6
per cent in 2001-2002 and 39.9 and 131.9 per cent in 2002-2003,
respectively. This is in conformity with findings of Mahapatra
and Sharma, 1996.
Soil organic carbon content was 0.805 (0-20 cm depth) and
0.620 (20-40 cm depth) at the initiation of the experiment.
Application of green manure resulted in significantly higher
organic carbon content over fallow at both soil depths (Table
3). Application of 150 kg N/ha to rice resulted in significantly
higher organic carbon content over fallow treatment after
wheat harvest at both soil depths during both the years.
Nitrogen levels up to 150 kg N/ha applied to wheat resulted in
significantly higher organic carbon content in soil after wheat
harvest at both soil depths during both the years.
Total soil nitrogen content at the start of the experiment was
2004 (0.0894 %) and 1715 (0.0765 %) kg/ha at 0-20 and 20-40
cm soil depth, respectively (Table 3). Total soil nitrogen content
increased over initial value at both the soil depth during both
the years after rice harvest due to Crotalarioa 45 and
Crotalaria 60 green manuring. Application of 150 kg N/ha to
rice increased the total soil nitrogen over initial value at harvest
of rice at both soil depths during both the years. Application
of nitrogen to wheat up to 150 kg/ha recorded significantly
higher total soil nitrogen at 0-20 and 20-40 cm soil depth during
both the years.
Soil available nitrogen was 238 and 198 kg/ha at 0-20 and 20-
40 cm depth at the initiation of the experiment, respectively
(Table 3). Incorporation of Crotalaria 60 green manure to rice
significantly increased the soil available nitrogen over fallow
treatment, at both the soil depth during both the years at
harvest of rice. After wheat harvest Crotalaria 60 showed
significant increase in soil available nitrogen as compared to
Crotalarioa 45 and fallow treatment at both soil depths during
both the years (Table 3). Application of nitrogen to rice crop
resulted in significant increase in available nitrogen but
additive effect over initial value was observed in 0-20 cm soil
depths at 150 kg N/ha to rice during both the years. Nitrogen
levels to wheat increased the available nitrogen but, positive
effect over initial value at both depths where found only when
150 kg N/ha was applied to wheat in both the years.
Table 2.
Soil microbial biomass nitrogen and wet soil ammonical nitrogen as influenced by Crotalaria green manuring and
fertilizer nitrogen
Crotalaria juncea
green manuring
Soil Microbial Biomass Nitrogen (kg/ha)
Rice
Wheat
Wet Soil Ammonical Nitrogen in Rice soil
(kg/ha)
30DAT 60DAT 90DAT Harvest Harvest 30DAT 60DAT 90DAT
01-02 02-03 01-02 02-03 01-02 02-03 01-02 02-03 01-02 02-03 01-02 02-03 01-02 02-03 01-02 02-03
No green manuring
(Fallow)
20.77 21.78 20.11 20.56 17.33 17.22 16.44 16.44 19.52 19.48 27.9 26.1 21.8 28.0 26.8 21.8
45 DAS 52.22 62.22 49.67 53.44 45.22 44.22 36.00 35.89 36.97 37.09 35.8 30.9 25.9 36.3 31.7 27.0
60 DAS 64.67 70.44 58.56 60.44 51.00 49.78 40.78 41.11 42.41 42.73 38.8 33.7 28.1 40.2 34.3 29.4
SEm ± 1.90 2.13 2.56 1.30 1.54 0.63 1.42 2.31 1.09 1.09 1.34 1.09 0.80 1.66 1.14 0.69
CD (5%) 7.43 8.33 10.02 5.09 6.04 2.48 5.57 9.04 4.25 4.25 5.25 4.23 3.14 6.51 4.46 2.72
N levels to Rice (kg/ha)
0 39.22 42.44 35.00 36.89 31.22 30.67 25.78 24.00 31.66 31.76 24.2 18.2 15.2 24.0 18.1 16.8
75 48.77 56.67 43.78 46.11 38.89 37.89 31.78 32.33 32.35 32.26 34.0 30.2 26.4 34.7 31.9 27.0
150 56.67 59.33 49.56 51.44 43.44 42.67 35.67 37.11 35.00 35.18 44.2 42.2 34.1 45.9 42.8 34.4
SEm ± 1.29 1.10 2.69 0.58 1.44 0.54 1.29 2.33 0.96 0.97 1.24 1.36 1.09 0.73 1.08 0.69
CD (5%) 3.99 3.50 8.30 1.79 4.44 1.67 4.00 7.18 2.97 2.99 3.82 4.18 3.26 2.24 3.34 2.14
N levels to wheat (kg/ha)
0 26.77 26.88
75 33.73 33.86
150 38.40 38.56
SEm ± 1.07 1.08
CD (5%) 3.08 3.11

Table 3.
KUMAR et. al., Productivity Evaluation and Nitrogen Dynamics in Rice (Oryza sativa)-Wheat (Triticum aestivum L) 155
Soil organic carbon, total nitrogen and available-nitrogen, in 0-20 cm and 20-40 cm soil depth as influenced by
Crotalaria green manuring and fertilizer nitrogen
Crotalaria juncea green
Organic carbon (%) Total nitrogen (kg/ha) Available nitrogen (kg/ha)
manuring and soil depth 01-02 02-03 01-02 02-03 01-02 02-03
(cm) Rice Wheat Rice Wheat Rice Wheat Rice Wheat Rice Wheat Rice Wheat
No green manuring
0-20 cm
0.805 0.799 0.806 0.789 1992 1976 1988 1970 212.9 215.7 205.3 206.7
20-40 cm 0.625 0.624 0.614 0.618 1667 1680 1677 1675 181.0 175.6 174.7 167.7
45 DAS 0-20 cm 0.834 0.831 0.841 0.823 2022 2025 2024 2027 233.0 233.0 232.2 235.7
20-40 cm 0.654 0.651 0.655 0.651 1749 1721 1750 1723 194.9 190.4 195.6 192.7
60 DAS 0-20 cm 0.848 0.845 0.855 0.853 2066 2061 2077 2074 243.7 255.1 247.8 257.2
20-40 cm 0.661 0.663 0.664 0.671 1779 1752 1796 1763 204.9 207.4 203.9 211.1
SEm ± 0-20 cm 0.0056 0.006 0.0076 0.005 14 14 16 14 3.2 2.8 5.8 2.9
20-40 cm 0.0037 0.005 0.0049 0.004 20 12 13 12 2.9 2.3 4.4 2.6
CD (5%) 0-20 cm 0.0217 0.023 0.0299 0.021 55 56 62 56 12.5 10.9 22.6 11.3
20-40 cm 0.014 0.019 0.019 0.017 77 48 52 48 11.2 9.2 17.2 9.9
N levels to Rice (kg/ha) and soil depth (cm)
0 0-20 cm 0.802 0.819 0.804 0.818 1979 1983 1981 1981 227.5 226.5 198.0 225.6
20-40 cm 0.626 0.641 0.625 0.642 1639 1686 1644 1684 173.1 184.8 168.3 184.0
75 0-20 cm 0.831 0.824 0.838 0.823 2011 2017 2013 2021 247.0 234.9 226.2 233.7
20-40 cm 0.647 0.645 0.648 0.647 1749 1715 1763 1718 191.2 192.1 182.4 190.9
150 0-20 cm 0.854 0.832 0.861 0.828 2089 2061 2095 2069 279.9 240.2 261.1 240.4
20-40 cm 0.665 0.652 0.670 0.650 1807 1752 1816 1759 216.4 196.6 213.3 196.0
SEm ± 0-20 cm 0.0049 0.031 0.0091 0.004 13 11 10 11 5.0 2.3 5.6 2.4
20-40 cm 0.0047 0.003 0.0063 0.003 12 10 31 10 3.9 1.9 5.4 2.0
CD (5%) 0-20 cm 0.015 0.010 0.028 0.011 41 35 32 35 15.4 6.9 17.4 7.3
20-40 cm 0.014 0.008 0.019 0.009 37 30 95 30 12.0 6.0 16.6 6.2
N levels to wheat (kg/ha) and soil depth (cm)
0 0-20 cm 0.797 0.796 1953 1953 207.9 206.3
20-40 cm 0.622 0.624 1660 1660 169.0 167.4
75 0-20 cm 0.827 0.824 2012 2016 227.2 226.3
20-40 cm 0.648 0.647 1710 1714 185.3 226.3
150 0-20 cm 0.851 0.850 2097 2102 266.5 267.1
20-40 cm 0.667 0.669 1783 1787 219.2 219.6
SEm ± 0-20 cm 0.004 0.004 16 16 3.7 3.7
20-40 cm 0.004 0.004 14 14 3.2 3.2
CD (5%) 0-20 cm 0.012 0.012 46 46 10.6 10.6
20-40 cm 0.010 0.010 40 39 9.1 9.2
LITERATURE CITED
Brookes, P.C.; Landman, A.; Pruden, G. and Jenkrison, D.S. 1985.
Chloroform fumigation and release of soil nitrogen: a rapid direct
extraction method for measuring microbial biomass nitrogen in
soil. Soil Biology and Biochemistry, 17: 837-842.
Hegde, D.M. 1998. Effect of integrated nutrient supply on crop
productivity and soil fertility in rice (Oryza sativa)-wheat (Triticum
aestivum) system in semi-arid and humid ecosystems. Indian Journal
of Agronomy, 43(1): 7-12.
Keeney, D.R. and Nelson, D.W. 1982. Nitrogen–inorganicforms. In:
Metrhods of soil analysis. Part II (eds. A.L. Page; R.H. Miller and
D.R. Keeney), American Society of Agronomy. Inc. Soil Science
Society of America Inc. Madison, Wisconsin, USA. pp. 643-698.
Kolar, J.S.; Grewal, H.S. and Singh, B. 1993. Nitrogen substitution and
higher productivity of a rice-wheat cropping system through green
manuring. Tropical Agriculture (Trinidad), 70(4): 301-304.
Mahapatra,B.S.; Kumar, A.; Mishra, A.; Kumar, R. and Pareek R.P.
2005. Soil fertility and productivity in rice (Oryza sativa) – wheat
(Triticum aestivium) cropping system as influenced by sunhemp
(Crotalaria juncea) green manuring. Indian Journal of Agricultural
Sciences, 75(10): 636-9
Mahapatra, B.S. and Sharma, G.L. 1996. Contribution of Sesbania
species to yield and nitrogen nutrition in low land rice. Indian
Journal of Agronomy, 41: 226-229
Ocio, J.A., Martinez, J. and Brookes, P.C. 1991. Contribution of straw
derived N to total microbial biomass N following incorporation of
cereal straw to soil. Soil Biology and Biochemistry, 23: 655-659.
Paikaray, R.K.; Mahapatra, B.S. and Sharma, G.L. 2001. Integrated
nitrogen management in rice (Oryza sativa)-wheat (Triticum
aestivum) cropping system. Indian Journal of Agronomy, 46(4):
592-600.
Patro, H.K. 2002. Integrated nitrogen management in rice–wheat
cropping system. Ph.D. Thesis, G.B. Pant University of Agriculture
and Technology, Pantnagar.
Recieved on 07.10.2010 Accepted on 17.11.2010

156 Trends in Biosciences 3 (2): 156-158, 2010 Trends in Biosciences 3 (2), 2010
Population Fluctuation of Aphid, Aphis gossypii and Predatory Coccinellid Beetle on
Brinjal Aphid with Reference to its Relation with Weather Factors in Western Plain
Zone of Uttar Pradesh
G.N. TIWARI, C.S. PRASAD* AND LOK NATH
Department of Entomology, Sardar Vallabhbhai Patel Uni. of Agric. and Tech., Meerut (U.P.)
*e-mail: csprasad23@gmail.com
ABSTRACT
A study to asses the population fluctuation of aphid, Aphis
gossypii and predatory coccinellid beetle with reference to its
relation with weather factors on brinjal at S.V.P. Uni. of Agric.
& Tech., Meerut, U.P. during 2005-06 and 2006-07. The
maximum population 356.0 aphids/3 leaves in 42 nd SW during
2005-06 and 407.18 aphids/3 leaves in 45 th SW during 2006-07
were recorded, respectively. The sunshine hours showed
significant positive correlation with aphid population while,
RH showed negative correlation during first year. However,
next year all the weather parameters showed non-significant
negative correlation. The highest population of Coainella
septempunctata was recorded 3.7 beetles/ plant during 47 th SW
in 2005-06 and 3.4 beetles/plant during 2006-07 in 46 th SW. The
average RH showed negative correlation, while sunshine hours
showed positive correlation with Coccinella population. Another
coccinellid beetle, Coainella sexmaculata population was
recorded highest in 45 th SW (4.2 beetles/plant) in 2005-06 and
46 th SW during 2006-07. Minimum temperature and average
RH showed negative correlation while sunshine hours showed
positive correlation with Coainella sexmaculata population.
Key words
Population fluctuation, aphid, coccinella
Brinjal (Solanum melongena) is one of the most and
popular solanaceous vegetable crop of India and south Asia.
It occupies about 8.45% of the total area under vegetables in
India (Patnaik, et al., 2004). Being high in economic values,
now-a-day’s cultivation of brinjal is becoming menace to the
farmers because of attack of different insect pests at various
stages of its growth, which act as limiting factors in its
successful cultivation. Number of insect pest has been
reported on brinjal at various stages of the growth and fruiting
stages. The cotton aphid, Aphis gossypii Glover (Homoptera:
Aphididae), is a cosmopolitan species widely distributed in
tropical, subtropical and warm temperate regions. It is a
worldwide pest of many plant species including cotton,
cucurbits, citrus, coffee, vegetables i.e. eggplant, okra, sweet
pepper etc. (Blackman and Eastop, 1984). A. gossypii recorded
as a sap sucking insect and causing damage in vegetative
stage of brinjal. Both nymph and adult suck the cell sap from
the leaves and tender shoots. Coccinellids or ladybird beetles
are considered the most important enemies of aphids and in
different parts of the world have been effectively utilized for
integrated control of several aphid pests (Brown, 2004). The
coccinellid beetle is an important predator causes natural
suppression of insect pest of brinjal particularly summer crop
(Ghosh, 1999). The predator C. sexmaculata in terai region of
West Bengal was found active throughout the year (Ghosh,
et al., 2007).
MATERIALS AND METHODS
The present experiment was conducted at CRC of the
S.V.P. Uni. of Agric. & Tech., Meerut, U.P. Thirty day’s old
seedling of Pusa Uttam variety was planted in ten separate
plots each measuring 5 X 4 m. The spacing between rows and
between plants was 75 and 60 cm, respectively. The
observations on populations of aphid were recorded on the 3
leaves of plant and predatory coccinellid beetles were
recorded at weekly intervals on randomly selected 10 plants
of brinjal. Multiple correlation studies were carried out to asses
the seasonal incidence and population fluctuation of aphid
and predatory coccinellid beetle of brinjal in relation to abiotic
factors i.e., temperature (max. and min.), RH, rainfall and
sunshine hours.
Relationship between pest complex of brinjal and
meteorological variables were worked out using simple
correlation analysis. Simple correlation coefficient analyses
were done using following formula (Gomez and Gomez, 1984):
r
X
X Y
XY –
N
X
Y
2
2
–
Y –
N
r = Correlation coefficient between X & Y
X = population of aphid and predatory coccinellid beetle in
number
Y = Meteorological parameters
N = Number of observations
RESULTS AND DISCUSSION
Aphid, Aphis. gossypii (Glov.)
The A. gossypii appeared (Table. 1) in 35 th SW during
2005-06 and the population was recorded of 0.38 aphid/3leaves
N

TIWARI et al., Population fluctuation of aphid, Aphis gossypii and predatory coccinellid beetle on brinjal aphid 157
while, in year 2006-07 the appearance of aphids were recorded
for the first time in 33 rd SW, and the level of the population at
this stage was 0.50 aphid/3 leaves. The population increased
gradually and reached its maximum of 356.0 aphids/3 leaves in
42 nd SW at a temperature range of 17.6-30.6 ºC and R.H. 68.2
per cent during 2005-06 and 407.18 aphids/3 leaves in 45 th SW
at a temperature range of 15.8-28.3 ºC and R.H. 68.9 per cent
during 2006-07 were recorded. Correlation studies (Table 2)
between weekly mean population of aphid and important
weather parameters i.e. sunshine hours showed significant
positive correlation of coefficient (r =0.41531) and RH showed
significant negative correlation of coefficient (r =-0.41707)
during first year, while during second year all the weather
parameters i.e. temperature, R.H., rainfall and sunshine hours
showed non-significant negative correlation with aphid
population. Similar associations of this insect pest with abiotic
factors were also supported (Mall, et al., 1992; Prasad and
Logiswaran, 1997 and Ghosh, et al., 2004).
Table 1.
Table 2.
*0.388
Predatory coccinellid beetle
(a) Coccinella septempunctata L.
Population of Aphis gossypii and predatory coccinellid beetles in brinjal ecosystem
The appearance of this natural enemy was noticed first
time in 33 rd SW and confined its feeding on aphid, A. gossypii
during both the years. The population of beetle showed an
increasing trend and reached to its maximum of 3.7 beetles/
plant in 47 th SW during 2005-06 at a temperature range of 10.8-
27.4 ºC and 61.1% RH, while in second year the maximum
population of 3.4 beetles/plant was recorded in 46 th SW at a
temperature range of 13.7-28.2 ºC and 59.2% RH During the
first year minimum temperature and average RH with pest
population showed negative correlation of coefficient
(r =-0.44384 and -0.49669), whereas sunshine hour showed
positive correlation (r =0.46517) with coccinellid population.
Average RH with natural enemies population showed
significant negative coefficient of correlation (r =-0.40587)
during second year. These findings are supported by (Grewal,
1998 and Ghosh, et al., 2007).
SW
A. gossypii C. septempunctata C. sexmaculata
2005-06 2006-07 2005-06 2006-07 2005-06 2006-07
30 00 00 00 00 00 00
31 00 00 00 00 00 00
32 00 00 00 00 0.15 0.10
33 00 0.50 0.10 0.15 0.20 0.20
34 00 1.31 0.15 0.25 0.25 0.10
35 0.38 2.67 0.30 0.20 0.25 0.40
36 0.50 3.42 0.55 0.45 0.45 0.52
37 1.66 6.71 0.85 0.95 0.67 0.75
38 6.34 25.73 1.15 1.20 1.05 1.25
39 42.73 56.46 1.50 1.75 1.25 1.45
40 95.08 98.21 2.05 2.20 1.65 1.80
41 207.00 136.75 2.45 2.55 1.77 1.50
42 356.00 203.39 2.75 2.90 1.95 2.10
43 267.86 268.63 2.85 3.05 2.25 2.25
44 241.50 383.43 2.95 2.98 2.67 3.25
45 280.10 407.18 3.05 2.99 3.05 3.20
46 196.30 301.31 3.20 3.75 4.25 3.35
47 156.30 216.67 3.75 3.56 3.75 3.77
48 105.78 121.36 2.80 2.95 3.07 2.95
49 88.43 71.61 2.50 2.35 2.45 2.05
50 32.79 45.07 2.06 1.85 1.25 1.10
51 4.11 5.71 1.57 1.06 0.65 0.47
52 0.31 0.16 0.75 0.35 0.10 0.15
01 00 00 00 0.10 00 00
02 00 00 00 00 00 00
Insect species
Aphis gossypii
Correlation coefficient between aphid and predatory coccinellid beetle population and weather factors during
2005-06 and 2006-07.
Coccinella septempunctata
Chilominuus sexmaculata
Year
Weather parameters
Max temp. Min temp. Av temp. Av RH Rainfall Sunshine hrs
2005-06 0.04957 -0.20795 -0.11203 -0.41707 -0.27605 0.41531
2006-07 -0.01924 -0.17776 -0.11258 -0.12187 -0.22329 -0.19248
2005-06 -0.19011 -0.44384 -0.35285 -0.49669 -0.21765 0.46517
2006-07 -0.05733 -0.28522 -0.19186 -0.40587 -0.33735 -0.08680
2005-06 -0.13517 -0.38075 -0.29123 -0.55957 -0.20052 0.50010
2006-07 -0.03956 -0.24825 -0.16275 -0.34761 -0.30467 -0.07032

158 Trends in Biosciences 3 (2), 2010
Fig. 1. Population of A. gossypii on brinjal during 2005-06
Fig. 2.
Population of C. septempunctata on brinjal during
LITERATURE CITED
Fig. 3. Population of C. sexmaculata on brinjal during 2005-06
Another species of the ladybird beetle C. sexmaculata
was first time appeared in 32 nd SW during first year and 33 rd
SW during second year. The maximum population of this
insect was recorded 4.2 beetles/plant in 45 th SW during 2005-
06 at a temperature range of 13.1-28.7 ºC and 55.4% RH, while
4.2 beetles/plant in 46 th SW during 2006-07 at a temperature
range of 13.7-28.2ºC and 59.2% RH Minimum temperature and
average RH showed negative coefficient of correlation
(r =-0.38075 and -0.55957) with C. sexmaculata while sunshine
hour showed significant positive coefficient of correlation
(r =0.50010) during first year. These findings are closely
conformity with the findings of (Grewal, 1988 and Ghosh, et
al., 2007).
The results clearly showed that population of coccinellid
beetles in brinjal were found in varying in number during
experimental period, but in very low number during severe
winter months.
Blackman, R.L. and Eastop, V.F. 1984. Aphids on the World’s Crops:
An Identification Guide. John Wiley and Sons, Chichester. pp. 466.
Brown, M.N. 2004. Role of aphid predator guild in controlling spirea
aphid populations on apple in West Virginia, USA. Biological
Control, 29: 189-198.
Ghosh, S.K. 1999. Studies on the pest constraints of brinjal and their
management under terai region of West Bengal. Ph. D. Thesis.
Bidhan Chandra Krishi Vishwavidyalaya, West Bengal.
Ghosh, S.K.; Laskar, N. and Senapati, S.K. 2004. Seasonal fluctuation
of Aphis gossypii Glov. on brinjal and field evaluation of some
pesticide against A. gossypii under terai region of West Bengal.
Indian Journal of Agriculture Research, 38(3): 171-77.
Ghosh, S.K.; Laskar, N. and Senapati, S.K. 2007. Seasonal incidence of
predator Menochilus sexmaculatus (Ber.) on brinjal and harmful
effects of insecticides on the predator. Indian Journal of Agriculture
Research, 41(2): 102-106.
Gomez, A.; Kwanchai and Gomez, A. Arturo. 1984. Statistical procedures
for agricultural research, (II Ed), (An International Rice Research
Institute Book). A Weley Interscience Publication to the Willing
and Sons. Newyark.
Grewal, J.S. 1988. Seasonal fluctuation in population of Epilachna
vigintioctopunctata on brinjal (Solanum melongena) crop. Bulletin
of Entomology, 29(1): 73-75.
Mall, N.P.; Pandey, R.S.; Singh, S.V.; and Singh, A.K. 1992. Seasonal
incidence of insect-pests and estimation of the losses caused by
shoot and fruit borer on brinjal. Indian Journal of Entomology,
54(5): 241-247.
Patnaik, H.P., Mohapatra, L.N. and Maity, B.K. 2004. Effectiveness
of thiomethoxam 25 WG against the insect pest of brinjal under
field condition. Journal of Plant Protection and Environment,
1(1&2): 39.
Prasad, G.S. and Logiswaran, G. 1997. Influence of weather factors on
population fluctuation of insect pests on brinjal at Madurai, Tamil
Nadu. Indian Journal of Entomology, 59(4): 385-388.
Recieved on 26.10.2010 Accepted on 22.11.2010

Trends in Biosciences 3 (2): 159-160, 2010
Evaluation of New Combination Product Spirotetramat 12% + Imidacloprid 36% -
480 SC against Sucking Pests of Cotton
J.K. PATEL, I.S. PATEL AND G.M. PATEL
Department of Entomology, C.P. College of Agriculture, S.D. Agricultural University, Sardarkrushinagar
385 506.
e-mail: dr.ispatel@gmail.com
ABSTRACT
The results revealed that the treatment of spirotetramat 12%
+ imidacloprid 36% - 480 SC @ 625 ml per ha was found most
effective against sucking pest complex of hybrid cotton.
Spirotetramat 12% + imidacloprid 36% - 480 SC @ 750 ml per
ha and spirotetramat 150 OD @ 600 ml per ha were considered
next effective treatments in minimizing population of sucking
pests of cotton. Maximum seed cotton yield was achieved in
spirotetramat 12% + imidacloprid 36% - 480 SC @ 625 ml per
ha (1917 Kg/ha). It was closely followed by spirotetramat 150
OD @ 600 ml per ha (1704 Kg/ha) and imidacloprid 200 SL
@ 900 ml per ha (1613 Kg/ha).
Key words
Aphid, jassid, thrips, whitefly, cotton, bioefficacy
In India, cotton is grown in an area of 91.58 lakh ha with
a production of 315 lakh bales (CCI, 2008). The productivity
of cotton in India is lowest with 462 kg ha -1 as against world
average of 642 kg ha -1 (Khadi, 2007). Insect pests are major
limiting factor attributed to low yield of cotton. Among these,
16 species of insects are of major importance resulting in an
annual loss of 50-60 per cent of total production (Anonymous,
1996). Various insecticides of different groups are used
frequently for the control of cotton pests right from sowing to
harvesting. It has caused several environmental pollution
problem. In this situation, combination of two insecticides
with different mode of action offer great scope as they maintain
high toxicity to insects at lower doses and are avoid the
development of resistance to particular insecticides as
conventional group of insecticides. Attempt was therefore
been made to assess the bioefficacy of newer chemical
molecules against sucking pests in cotton crop.
MATERIALS AND METHODS
A field trial on testing of spirotetramat 12% + imidacloprid
36%-480 SC against sucking pests of cotton was conducted
at Agronomy Instructional Farm, C.P. College of Agriculture,
S.D. Agricultural University, S.K. Nagar during Kharif, 2007-
08 to 2008-09. The cotton crop was sown with the onset of
monsoon in the randomized block design. The variety was
grown in four replication with eight treatments measuring 6 m
x 4.5 m and five plants were randomly selected and tagged in
each treatment.
The population of sucking pests viz., aphid, jassid, thrips
and whitefly was recorded from top, middle and bottom leaves
of plant at three, five and seven days after each application of
the pesticides. From this, the periodical mean population of
pests was analyzed following suitable statistical procedure.
Seed cotton yield was recorded from net plot and yield was
converted to kg/ha.
RESULTS AND DISCUSSION
Based on two years pooled mean, Year x Treatment
interaction was found significant indicating influence of
seasonal factors on efficacy of various treatments.
Spirotetramat 12% + imidacloprid 36% - 480 SC @ 625 ml
per ha proved most effective in reducing the aphid population
(4.68 aphids/leaf). However, it was at par with imidacloprid
200 SL @ 900 ml per ha and spirotetramat 12% + imidacloprid
36% - 480 SC @ 750 ml per ha (6.00 and 6.30 aphids/leaf),
respectively (Table 1).
Based on two years pooled mean, Year X Treatment
interaction was significant indicating variation in treatment
efficacy over years due to season effect with regard to fassed.
Among the different treatments, spirotetramat 12% +
imidacloprid 36% - 480 SC @ 625 ml per ha proved most
effective treatment in reducing the leaf hopper population
(2.53 leaf hoppers/leaf). It was significantly superior than all
the treatments. Spirotetramat 12% + imidacloprid 36% - 480
SC @ 750 ml per ha ranked second effective treatments in
reducing leaf hopper population i.e. 3.24 leaf hoppers/leaf
(Table 1).
Based on two years pooled mean, the results revealed
that Year x Treatment interaction was significant over both
the years. Among the different treatments, spirotetramat 12%
+ imidacloprid 36% - 480 SC @ 625 ml per ha proved effective
in reducing the thrips population (3.26 thrips/leaf). It was at
par with spirotetramat 150 OD @ 600 ml per ha (3.81 thrips/
leaf) over rest of the treatments (Table 1).
Year X Treatment interaction was significant over both
the years. Among the different treatments, spirotetramat 12%
+ imidacloprid 36% - 480 SC @ 625 ml per ha had minimum
whitefly population (2.68 whiteflies/leaf) which was at par with
spirotetramat 12% + imidacloprid 36% - 480 SC @ 750 ml per
ha (4.00 whiteflies/leaf) and spirotetramat 12% + imidacloprid
36% - 480 SC @ 500 ml per ha (4.08 whiteflies/leaf) (Table 1).

160 Trends in Biosciences 3 (2), 2010
Table 1.
Treatments
Evaluation of new combination product Spirotetramat 12% + Imidacloprid 36% - 480 SC against sucking pests of
cotton
1. Spirotetramat 12% +
imidacloprid 36% - 480 SC @
500 ml / ha
2. Spirotetramat 12% +
imidacloprid 36% - 480 SC @
625 ml / ha
3. Spirotetramat 12% +
imidacloprid 36% - 480 SC @
750 ml / ha
4. Spirotetramat 150 OD @ 600
ml / ha
5. Imidacloprid 200 SL @ 900
ml / ha
6. Profenophos 50 EC @ 1250
ml / ha
7. Thiamethoxam 25 WG @ 600
ml / ha
Figures in parentheses are retransformed value
** Pooled mean of two years
Mean numbers of sucking pests/ leaf**
Aphids/leaf Leaf hoppers/leaf Thrips /leaf Whiteflies/leaf
1 st spray 2 nd spray 3 rd spray 1 st spray 2 nd spray 3 rd spray 1 st spray 2 nd spray 3 rd spray 1 st spray 2 nd spray 3 rd spray
2.47 2.87 2.69 1.90 2.02 1.95 2.49 2.79 2.57 1.82 1.93 2.02
(5.83) (8.23) (7.23) (3.61) (4.84) (3.80) (6.20) (7.78) (6.60) (2.58) (3.72) (4.08)
1.79
(2.99)
2.53
(6.40)
2.26
(4.85)
2.57
(6.60)
2.54
(6.45)
2.66
(7.07)
8. Untreated (Control) 3.75
(14.06)
Table 2.
2.34
(5.47)
2.60
(6.76)
2.27
(4.68)
2.51
(6.30)
1.54
(1.89)
1.72
(2.95)
The phytotoxic effect of spirotetramat 12% + imidacloprid
36% - 480 SC at 500, 625 and 750 ml/ha did not show any
phytotoxic effect like leaf tip injury, wilting, vein clearing,
necrosis, hyponasty and epinesty. Vinothkumar, et al., 2010
also found similar results in combination product
Flubendiamide + Thiacloprid 480 SC in cotton crop.
Perusal of the result (Table 2) revealed that all the
treatments under study were significantly superior over control
with respect to seed cotton yield. Maximum seed cotton yield
was achieved in spirotetramat 12% + imidacloprid 36% - 480
1.75
(3.06)
1.98
(3.45)
1.55
(2.53)
1.80
(3.24)
2.03
(3.98)
2.34
(5.47)
2.26
(4.71)
2.61
(6.81)
1.90
(3.26)
2.44
(5.95)
1.37
(1.94)
1.71
(2.93)
1.68
(2.82)
1.84
(3.38)
1.66
(2.68)
2.00
(4.00)
2.71
(7.34)
2.52
(6.35)
1.95
(3.80)
2.12
(4.49)
2.06
(4.24)
2.35
(5.52)
2.63
(7.01)
2.01
(3.81)
1.71
2.92
1.93
(3.72)
2.30
(5.29)
2.65 2.47 2.14 2.18 2.47 2.56 2.60 2.49 2.12 1.99 2.29
(7.08) (6.10) (4.57) (4.75) (6.10) (6.55) (6.76) (6.20) (4.49) (3.96) (5.24)
2.69 2.76 2.27 2.24 2.31 2.62 2.72 2.71 2.21 2.40 2.44
(7.23) (7.61) (5.15) (5.01) (5.33) (6.93) (7.39) (7.34) (4.88) (5.76) (5.95)
2.65 2.75 2.15 2.28 2.30 2.66 2.71 2.71 2.26 2.38 2.59
(7.02) (7.56) (4.62) (5.19) (5.29) (7.07) (7.34) (7.34) (5.10) (5.66) (6.70)
3.73 3.66 2.95 2.87 3.07 3.58 3.54 3.38 2.85 2.94 3.12
(13.91) (13.39) (8.70) (8.23) (9.42) (12.81) (12.53) (11.42) (8.12) (8.64) (9.73)
Y 0.023 0.024 0.019 0.011 0.11 0.010 0.011 0.020 0.016 0.11 0.014 0.014
T 0.132 0.089 0.089 0.181 0.179 0.257 0.181 0.106 0.140 0.209 0.176 0.223
Y x T 0.064 0.067 0.054 0.032 0.030 0.027 0.032 0.058 0.045 0.032 0.040 0.039
Y 0.63 0.066 0.054 0.032 0.073 0.027 0.011 0.058 0.42 0.031 0.039 0.038
T 0.521 0.298 0.299 0.174 0.206 0.211 0.29 0.334 0.470 0.299 0.144 0.566
Y x T 0.179 0.187 0.152 0.090 0.085 0.76 0.035 0.163 0.128 0.089 0.111 0.109
CV% 7.07 7.17 5.94 5.46 4.17 3.66 6.38 6.28 5.15 5.92 5.53 4.93
Effect of different combination treatments on seed
cotton yield
Treatments
Yield (Kg/ha)
2007-08 2008-09 Mean
1. Spirotetramat 12% + imidacloprid
1090 1511 1301
36% - 480 SC @ 500 ml / ha
2. Spirotetramat 12% + imidacloprid
1668 2182 1925
36% - 480 SC @ 625 ml / ha
3. Spirotetramat 12% + imidacloprid
1121 1641 1381
36% - 480 SC @ 750 ml / ha
4. Spirotetramat 150 OD @ 600 ml / ha 1498 2010 1704
5. Imidacloprid 200 SL @ 900 ml / ha 1367 1859 1613
6. Profenophos 50 EC @ 1250 ml / ha 1225 1579 1402
7. Thiamethoxam 25 WG @ 600 ml / ha 1023 1497 1263
8. Untreated (Control) 654 971 812
T 68.7 82.4 74.5
Y x T 109.00
Y
T 197.21 242.2 216.8
Y x T
NS
CV% 11.22 13.65 12.43
SC @ 625 ml per ha (1917 Kg/ha). It was closely followed by
spirotetramat 150 OD @ 600 ml per ha (1704 Kg/ha) (Table 2).
It was at par with imidacloprid 200 SL @ 900 ml per ha (1613
Kg/ha). Untreated control plot recorded the lowest seed cotton
yield (812 Kg/ha). In other treatments, yield varied from 1263
to 1402 Kg/ha. The seed cotton yield was also recorded high
in combination product Ampligo 150 ZC than
Lambdacyhalothrine alone (Murali, et al., 2009).
The Year X Treatment interaction was non significant
which indicated that differences in seed cotton yield among
different treatments were consistent over years.
LITERATURE CITED
Anonymous, 1996. Annual Progress Report of All India Co-ordinated
Cotton Improvement Project, Surat. pp.14-18.
CCI, 2008. National cotton scenario. Cotton Corporation of India
@www.cotcrop.gov.in/current.asp#cotton.pbs.
Khadi, B.M. 2007. Qualitative, quantitative change. The Hindu Survey
of Indian Agriculture, pp.115-118.
Murali, Baskaram, R.K., Suresh, K., Rajavel, D.S. and Palanisamy, N.
2009. Evaluation of bioefficacy of Ampligo 150 ZC against cotton
bollworm. Pestology, Vol. 33(4): 23-25.
Vinothkumar, B., Kumaran, N., Kubendra, D. and Kuttalam. 2010.
Bioefficacy of Flubendiamide + Thiacloprid 480 SC against insect
pests of tomato. Pestology, 34(1): 44-48.
Received on 02.02.2010 Accepted on 12.06.2010

Trends in Biosciences 3 (2): 161-163, 2010
Andalin as An Effective Insect Growth Inhibitor against Spodoptera litura (Fabricius)
(Lepidoptera: Noctuidae)
IRAM KHAN AND AYESHA QAMAR*
Section of Entomology, Department of Zoology, Aligarh Muslim University, Aligarh 202 002, (U.P.)
*email: ayesha.zoology@gmail.com
ABSTRACT
Laboratory studies were conducted to evaluate the efficacy of a
chitin synthesis inhibitor, Andalin (Flucycloxuron) on the
development and mortality of Spodoptera litura (Fabricius).
Freshly moulted 6 th instar larvae were topically treated with 2
µl of six concentrations (0.1%, 0.05%, 0.025%, 0.01%, 0.005%
and 0.0025%) of Andalin in solvent acetone. All the six
concentrations of Andalin were found to be toxic against S.
litura in either causing mortality or malformation during
development. Larval mortality, inhibition of ecdysis, formation
of larval-pupal mosaics, pupal mortality and non-viable adults
were the important morphogenetic abnormalities observed. The
LC 50
and LC 90
values of Andalin against sixth instar larvae of S.
litura after 24 hrs of the treatment were found to be 0.42% and
0.79% respectively. Thus, Andalin being an effective insect
growth and metamorphosis inhibitor could be included in the
integrated programmes for the management of S. litura and
other insect pests.
Key words
Andalin, flucycloxuron, spodoptera litura,
morphogenetic effects.
Cotton leafworm, Spodoptera litura is traditionally a
pest of cauliflower and cabbage crops in Punjab but in recent
years it has caused damage to cotton crop in the northern
zone of India. It is also sporadically recorded on castor,
groundnut, tomato, sunflower, etc. Insect growth regulators
(IGRs) which act as chitin synthesis inhibitors (CSIs) or
juvenile hormone analogs have been regarded as excellent
integrated control insecticides because of their specificity to
target pests and their general safety to vertebrates, molluscs
and plants (Wilkinson, et al., 1978; Deakle and Bradly, 1984).
The chitin synthesis inhibitor Benzoyl-Phenyl-Urea (BPU)
prevent the molting process by inhibiting chitin synthesis,
thereby causing abnormal endocuticular deposition and
abortive moulting. Among the chitin synthesis inhibitors, BPUs
(or acylureas) are gaining importance in insect pest control
because their effects can easily be monitored with chemical
analyses and anti-tumour activity in animal tests (Mayer, et
al., 1984). Moreover, they are relatively harmless to natural
enemies (Furlong, et al., 1994). The purpose of the present
work was to assess the lethal activity and morphogenetic
effects of chitin synthesis inhibitor Flucycloxuron (Andalin)
against dangerous agricultural pest, the cotton leafworm, S.
litura.
MATERIALS AND METHODS
5 th instar larvae were sorted out and maintained in
separate jars. They moulted to 6 th instar after 2-3 days. The
newly moulted 6 th instar larvae were then treated with different
concentrations of Andalin.
Six concentrations of Andalin viz., 0.1%, 0.05%, 0.025%,
0.01%, 0.005%, 0.0025% were prepared from 1% stock solution
of Andalin by serial dilution in acetone. 2 µl of each
concentrations were topically applied on the dorsal surface
of freshly moulted 6 th instar larvae of S. litura.
After applying each dose of the Andalin topically, larval
mortality after 24 hrs and abnormality regarding moulting and
metamorphosis were recorded. Parallel control in acetone of
the corresponding instars and age was also maintained for
comparison. The data is expressed as Mean±SE based on
four replicates. The data so obtained was subjected to probit
analysis as described by Finney, 1971.
RESULTS AND DISCUSSION
The average number of larvae, pre-pupae and pupae
died by the topical application at different concentrations of
Andalin on the 6 th instar larvae of S. litura (Table 1). At two
higher concentrations (0.1% and 0.05%) of Andalin, 14% and
11% of the larvae died after 24 hrs of the treatment and the
remaining transformed into larvae-pupae mosaic and died at
pre-pupal stage. The regression between concentration
strength and per cent larval mortality yields a positive linear
correlation (y=107.58x+4.215, R²=0.917) (Fig 1). The LC 50
and
LC 90
values of Andalin against 6 th instar larvae of S. litura
were found to be 0.42% and 0.79% respectively (Table 1).
Whereas, at lower concentrations (0.025%, 0.01%, 0.005% and
0.0025%) 8%, 6%, 4% and 3% larval mortality after 24 hrs
occurred and most of them died at pre-pupal stage i.e. during
larvae-pupae moulting. The concentration v/s pre-pupal
mortality shows a linear positive correlation (y=53.238x+95.873,
R²=0.5692) (Fig 2). However, the pupae which were formed at
lower concentrations of Andalin i.e. 0.025%, 0.01%, 0.005%
and 0.0025% failed to transform into adults and died in the
pupal stage only. In contrast, the controlled (acetone) and
untreated larvae showed normal moulting during larvae–
pupae transformation and resulted into normal pupae which
further emerged as adults with all the functional moth
characters.

162 Trends in Biosciences 3 (2), 2010
Table 1.
Larval, pre-pupal and pupal mortality due to application of Andalin on 6 th instar larvae of Spodoptera litura.
Concentrations
(%)
Larval mortality
(Mean±SE)
Values of LC 50
and LC 90
Pre-pupal mortality
(Mean±SE)
Pupae formed
(Mean±SE)
Pupal mortality
(Mean±SE)
Total number of adult
emerged (Mean±SE)
0.1 3.50 ± 0.29 21.5 ± 0.29 Nil - -
0.05 2.75 ± 0.25 22.25 ±0.25 Nil - -
0.025 2.00 ± 0.41 22.75 ± 0.25 0.25 ± 0.25 0.25 ± 0.25 -
0.01 1.50 ± 0.29 0.42% and 0.79% 23.00 ± 0.41 0.50 ± 0.29 0.50 ± 0.29 -
0.005 1.00 ± 0.41 22.75 ± 0.48 1.25 ± 0.25 1.25 ± 0.25 -
0.0025 0.75 ± 0.48 22.75 ± 0.25 1.50 ± 0.29 1.50 ± 0.29 -
Control (Acetone) 1.00 ± 0.41 0.75 ± 0.25 23.25 ± 0.25 0.50± 0.29 22.75 ± 0.48
Untreated 0.25 ± 0.25
0.75 ± 0.48 24.00 ± 0.41 0.25 ± 0.25 23.75 ±0.48
Note: 100 insects treated in 4 replicates of 25 each.
Fig. 1.
Per cent larval mortality at different concentrations of
Andalin on the 6 th instar larvae of Spodoptera litura.
Fig. 2.
Per cent pre-pupal mortality at different concentrations
of Andalin on the 6 th instar larvae of Spodoptera litura.
The deformity during 6 th instar larvae-pupae moulting
with 0.1% Andalin treatment were observed and the resultant
is the intermediate forms which include individuals having
larval characteristics more pronounced. At different
concentrations of Andalin (0.05%, 0.025%, 0.01%, 0.005% and
0.0025%) the insect exhibited morphogenic abnormalities
where some of them transformed into larvae-pupae mosaics
which are characterized by anterior larval portion and posterior
(abdomen) pupal portion. The visible malformation of the
treated larvae includes: head and thoracic legs with larval
characteristics and untanned skin at the dorsal part and rest
of the body was pupal with slightly or completely tanned
ventral part of the body. Some other types of abnormalities
were also seen such as constriction on the first one or two
segments of the abdomen; reduction in the thickness of the
pupal cuticle which is formed at the posterior region. At
concentrations of 0.025%, 0.01%, 0.005% and 0.0025% though
few apparent normal pupae formed but these pupae did not
develop any adult characteristics and remained in the pupal
stage.
Insect growth regulators, more precisely, the chitin
synthesis inhibitors (CSI) interfere with chitin biosynthesis
in insects and have been worked out on a number of species
of insect pests, e.g. flufenoxuron against Locusta migratoria
manilensis (Long, et al., 1999; Zhongren, et al., 2002) and
lufenuron against homopteran Bemisia tabaci and
lepidopteran Helicoverpa armigra (Gogi, et al., 2006). In the
present investigation, six concentrations (0.1%, 0.05%, 0.025%,
0.01%, 0.005% and 0.0025%) of Andalin (Flucycloxuron) were
tested topically on the 6 th instar larvae of S. litura (F.). Different
concentrations resulted in different mortality rate. Bakr, et al.,
2008 reported that Lufenuron exhibited a dose-dependent
mortality against nymphs of Schistocerca gregaria but not
in adults. Furthermore, the lethal effect of Flufenoxuron was
nearly dose-dependent in both nymphs and adults after
treatment of the late-aged last instar nymphs which is in
agreement with the present findings. Flucycloxuron was found
to be most toxic CSI among Diflubenzuron and Halofenozide
against Tenebrio molitor (L.) and it also showed highest
absorption through the cuticle (Soltani, et al., 1993 and Chebira,
et al., 2006). The present work showed that the mortality was
caused by moulting failure of S. litura larvae. On reaching the
pre-pupal stage, larvae suffered from partial mould inhibition
and died as intermediates during their attempt to shed old
cuticle. The direct and latent effects of growth inhibitor
lefenuron and combination of lefenuron/deltanet on the
development of S. littoralis larvae were tested and similar
moulting disturbing results were reported (Rahman, et al.,
2007). Omatsu, et al., 1991 reported the effectiveness of
chlorfluazuron on S. litura larvae at lethal dosage by topical
application, where the treated larvae turned translucent and
then black and split the old cuticle but failed to exuviate which
is somewhat similar to the present findings where Andalin
treated larvae exhibited similar morphogenic abnormalities.

KHAN AND QAMAR, Andalin As An Effective Insect Growth Inhibitor Against Spodoptera litura 163
Finally, it is concluded that Andalin treated 6 th instar larvae of
S. litura with different concentrations showed mortality,
moulting abnormality and formation of larvae-pupae mosaic.
Thus, Andalin can be considered as an effective insect growth
regulator in IPM modules for S. litura and other lepidopterans.
ACKNOWLEDGEMENT
The authors are thankful to the Chairman, Department
of Zoology, A.M.U., Aligarh for providing facilities to carry
out the present work.
LITERATURE CITED
Bakr, R.F., Ghoneim, K.S., Al-Dali, A.G., Tanani, M.A. and Bream, A.S.
2008. Lethal efficacy of the chitin synthesis inhibitors flufenoxuron
(cas-101463) and lufenuron (cga-184699) on Schistocerca gregaria
(orthoptera: acrididae). Egyptian Acadamic Journal of Biological
Sciences, 1(1): 1-12.
Chebira, S., Soltani, N., Muylle, S. and Smagghe, G. 2006. Uptake and
distribution of three insect growth regulators-Diflubenzuron,
Flucycloxuron and Halofenozide- in pupae and adults of Tenebrio
molitor (Linnaeus). Phytoparasitica, 34(2): 187-196.
Deakle, J.P. and Bradly, J.R. 1982. Effects of early season applications
of diflubenzuron and azinphosmethyl on population levels of certain
arthropods in cotton fields. Journal of Georgia Entomological
Society, 17: 200-204.
Finney, D.J. 1971. Probit analysis. Cambridge University, London,
pp.333.
Furlong, M.J., Verkerk, H.J. and Wright, D.J. 1994. Differential effects
of the acylurea insect growth regulator, teflubenzuron on the adult
of two endolarval parasitoids of Plutella xylostella, Costesia plutellae
and Diaegma semiclousum. Pesticide Science, 41: 359-364.
Gogi, M.D., Sarfraz, R.M., Dosdall, L.M., Arif, M.J., Keddie, A.B. and
Ashfaq, M. 2006. Effectiveness of two insect growth regulators
against Bemisia tabaci (Gennadius) (Homoptera : Aleyrodidae) and
Helicoverpa armigera (Hubner) (Lepidoptera : Noctuidae) and their
impact on population densities of arthropod predators in cotton in
Pakistan. Pest Management Science, 62(10): 982-990.
Long, Z., Yuhua, Y., Wangpreng, S., Enlin, Z., Feng, D., Zhigeng, X.,
Zhang, L., Yan, Y.H., Su, W.P., Zhu, E.L., Dou, F. and Xie, Z.G.
1999. Integrating application of Nosema locustae and IGR to control
Locusta migratoria manilensis. Chinese Journal of Biological
Control, 15: 57-59.
Mayer, R.T., Netter, K.J., Leising, M.B. and Schactschable, D.O. 1984.
Inhibition of the uptake of nucleosides in cultured Hading-Passey
melanoma cells by diflubenzuron. Toxicology, 30: 1-6.
Omatsu, M., Yoshida, K. and Toki, T. 1991. Development of Malformed
Larvae Induced by a Benzoylphenyl Urea Insecticide, Chlorfuazuron,
in the Common Cutworm Spodoptera Litura (Fab.,) Journal of
Pesticide Science, 16: 189-194.
Rahman, Abdul, S.M., Hegazy, E.M. and Elwey, A.E. 2007. Direct and
latent effects of two chitin synthesis inhibitors to Spodoptera
litorallis larvae. American-Eurasian Journal of Agricultural and
Environmental Ethic, 2(4): 457-464.
Soltani, N., Chebira, S., Delbecque, J. and Delachambre, J. 1993.
Biological activity of Flucycloxuron, a novel benzoylphenylurea
derivate, on Tenebrio molitor (Linnaeus): comparison with
Diflubenzuron and Tiflumuron. Cellular and Molecular Life Sciences,
49(12): 1088-1901.
Wilkinson, J.D., Biever, K.D., Ignoffo, C.M., Pons, W.J., Morrison,
R.K. and Seay, R.S. 1978. Evaluation of diflubenzuron formulations
on selected insect parasitoids and predators. Journal of Georgia
Entomological Society, 13: 227-236.
Zhongren, L., Jinzeng, W., Yuangang, L., Yin, W. and Hong, H. 2002.
Evaluation of toxicity and applicability of several insect growth
regulators for controlling oriental migratory locust. Plant Protection,
28(2):7.
Recieved on 01.09.2010 Accepted on 28.10.2010

164 Trends in Biosciences 3 (2): 164-165, 2010 Trends in Biosciences 3 (2), 2010
Relative Performance of Spilarctia obliqua Walker (Lepidoptera : Arctiidae) on
Certain Plants of Labiatae
S.C. SRIVASTAVA
Department of Zoology, D.B.S. College, Kanpur, (U.P.)
ABSTRACT
Three plants of mint family viz., Mentha viridis, Ocimum
basilicum and Ocimum sanctum were evaluated for their effects
on growth, development, nutrition and reproduction of Spilarctia
obliqua Walker. O. sanctum caused cent per cent mortality within
5 days of the larval period. The toxic factor causing mortality
on this plant may be employed for the control of the insect.
However, M. viridis and O. basilicum supported the development
but they depressed larval survival remarkably; the latter caused
85% mortality. The larval period (21.30 to 30.78 days), pupal
period (9.53 to 12.14 days) and emergence (70.37 to 77.78%)
were affected significantly by them (P< .05) and these were
dependant on growth supporting capacity of these plants.
Key words
Spilarctia, labiatae, mortality
Spilarctia obliqua Walker, a destructive pest of many
valuable crops like pulses, cereals, oil seeds and fibres (Pandey,
et al., 1968 and Nayar, et al., 1976) has also been reported to
infest and thrive on medicinal plants (Mathur, 1962 and Mathur
and Srivastava, 1962) of which some belong to family Labiatae.
These plants are likely to affect the insect’s biological
performance because of their inherent medicinal properties.
However, there is hardly any information about effect of plants
of basil family on the present insect as yet hence this work.
MATERIALS AND METHODS
Eggs of the present insect obtained from the laboratory
culture raised on castor, were kept on moist filter paper for
eclosion. Immediately hatched larvae from these eggs were
used in the investigation. With these larvae, effects of three
plants of Labiatae viz., Mentha viridis, Ocimum basilicum
and Ocimum sanctum on growth, life-cycle, nutrition and
reproduction of S. oblique were carried out under laboratory
conditions (Max. temp. = 31.60ºC + 1.27; Min. temp. = 18.54ºC
+ 2.99 and R.H. = 55.85% + 9.31). Observation pertaining to
growth, development, nutrition (based on dry weight) and
reproduction were carried out as described by Srivastava and
Pandey, 1981. Data, thus obtained were analyzed statistically.
RESULTS AND DISCUSSION
Barring Ocimum sanctum, the remaining test plants viz.,
Mentha viridis and Ocimum basilicum were able to support
the growth. The larva acquired significantly different weights
on 6th, 12th and 18th day in response to rearing on them
(P< .01 as F 1,4
= 9.190, F 1,4
= 18.998 and F 1,4
= 53.376 respectively.
M. viridis continued to be more growth inducing from the
beginning to the end of the observation (Table 1).
The results of showed that O. sanctum was not the least
successful in supporting the development; the larvae reared
on this species died within 5 days. This cent per cent mortality
indicates the presence of toxicity in the plant. Deshmukh, et
al., 1979 had also observed the similar mortality on another
species of basil i.e. Ocimum gratissimum. However, M. viridis
and O. basilicum supported the development but they caused
very high larval mortality; specially the latter one; they reduced
the larval survival upto 45% and 15% respectively. The cent
per cent mortality on O. sanctum and 85% mortality on O
basilicum points to the deadly toxic nature of these plants,
which may be due to the oil present in them because Feinstein,
1955 has reported that the oil obtained from the sweet basil
(O. basilicum) is very affective against mosquito larvae, flies,
Colorado potato beetle and many other insects. The cent per
cent mortality on O. sanctum and very high mortality on sweet
basil can be safely employed for the control of S. obliqua.
The higher mortality (55%) on M. viridis can not be assigned
to the toxicity as larval died on this plant did not show
dehydration (Ingram, 1955 and Singh, 1973). Plausibly this
plant is characterized by some nutritional deficiency or
nutritional imbalance (House, 1969; Barney and Rock, 1975).
Further, the larval period with the above two plants (Table
2) was variable with them (P < .05 as F 1,34
= 6.379). This period
was considerably shorter on M. viridis (21.33 days) them that
on O. basilicum (30.78 days). Moreover, the growth index of
the insect on the former species (2.11) was about four times
that on the latter species (0.49). Like larval period, the pupal
period was also shorter on M. viridis (9.53 days) than that on
O. basilicum (12.14 days) and was affected significantly by
them (P < .05) as F 1,26
= 126.480). The coefficient of correlation
between pupal period and larval period comes to +0.999 and
the same is highly significant (P

Table 2.
SRIVASTAVA, Relative Performance of Spilarctia Obliqua Walker (Lepidoptera : Arctiidae) on Certain Plants of Labiatae 165
Development of Spilarctia obliqua Wlk. on plants of Labiatae
S. Reared on Percentage Av. larval period Growth Percentage of Av. pupal period + Sex-ratio Av. longevity + S.E.
No.
of + S.E. (days) index emergence S.E. (days)
(days)
pupation
Male Female Male Female
1. Mentha viridis 45.00 21.30+0.35 2.11 70.37 09.53+0.16 1.00 0.73 03.00+0.26 35.00+0.31
2. Ocimum basilicum 15.00 30.78+0.26 0.49 77.78 12.14+0.32 1.00 1.33 04.00+0.47 04.50+0.25
3. Ocimum sanctum NIL* NIL NIL NIL NIL 0.00 0.00 NIL NIL
* All larvae died within 5 days.
Table 3.
Effect of plants of Labiatae on reproduction Spilarctia obliqua Wlk.
S.No. Reared on
Av. duration (days) + S.E.
Av. no. of eggs Percentage of Av. incubation
Pre-oviposition Oviposition Post-oviposition per female + hatching + period (days) +
period
period
period
S.E.
S.E.
S.E.
1. Mentha viridis 1.9+0.30 1.4+0.15 0.7+0.15 308.20+24.36 85.37+2.99 6.7+0.14
2. Ocimum basilicum 2.0+0.20 1.6+0.15 0.9+0.16 237.80+19.37 82.88+1.91 7.4+0.21
3. Ocimum sanctum NIL* NIL NIL NIL NIL NIL
*Records not possible due to failure of development.
plant (2.338) was about 4 times the same on M. viridis (0.5380).
On the contrary, the E.C.I. for the latter species (17.49%) was
about 6 times the same for the former species (2.79%). The
A.D. of M. viridis (48.63%) was much higher than that of O.
basilicum (16.10%) and correspondingly, the E.C.D. for the
former (35.96%) was also higher than the latter (17.92).
Likewise, the G.R. was also more with the former species (0.094)
than with the latter species (0.065). Further, the coefficient of
correlation between the weight acquired by larva on 18th day
and their E.C.D. comes to +0.999 and the same is significant at
5% level, suggesting that the weight acquired by the larva is
dependent on the E.C.D. value of the tested plants. But the
plants are certainly good food plants as they exhibit significant
inverse relationship between their C.I. and E.C.I. (r = –0.999,
P< .01) as suggested by SooHoo and Frankel, 1966.
The results showed that the reproductive periods such
as pre-oviposition, oviposition and post-oviposition periods
were not much variable and as per analysis of variance test
they were not affected by them (P > .05) (Table 3). Female
reared on M. viridis and that reared on O. basilicum laid 308.20
and 237.80 eggs respectively but their fecundity was not
affected by them significantly (P> .05 as F 18,1
= 0.555). Likewise,
the hatchability of the eggs in response to rearing on the
aforesaid two plants varied mildly with them (82.88 to 85.37%)
but without any statistical significance (P> .05 as F18,1 = 0.044).
Similarly, the incubation period was also not affected
differently by them (P> .05). These findings of the present
study are in agreement with that of Branson and Ortman, 1967
and Daniels, 1969, according to them the fecundity and fertility
is not affected by alternate food plants.
LITERATURE CITED
Chandel, B.S.; Srivastava, S.C.; Dwivedi, N.D.; Shalini Shukla and Dubey,
A. 2004. Bio-efficacy of certain plants on growth, development,
nutrition and reproducton of Spilarctia obliqua Walker. Nt. J. Life
Sciences, 1(2): 457–460.
Barney, W.P. and Rock, G.C. 1975. Consumption and utilization by the
Mexican bean beetle, Epilechna varivestis (Colepotera :
Coccinellidae) on soybean plants varying levels of resistance. J
Econ. Ent., 68 : 497–501.
Branson, T.F. and Ortman, E.E. 1967. Fertility of western corn root
worm, reared as larvae on alternative hosts. J. Econ. Ent., 60 (2) :
595.
Daniels, N.E. 1969. Alternate hosts of green bug. J. Econ. Ent., 62 (2):
521.
Deshmukh, P.D.; Rathore, Y.S. and Bhattacharya, A.K. 1979. Larval
survival of Diacrisie oblique Walker on several plant species. Indian
J. Ent., 41(1) : 5–12.
Feinstein, L. 1955. Insecticide from plants. In: Insects, the Year Book
of Agriculture, U.S. Dep. Agric., pp. 222-228.
House, H.L. 1969. Effect of different preparations of nutrients on
insects. Entomologia Expl. Appl., 12 : 651-669.
Ingram, R.L. 1955. Water loss form insects treated with pyrethrum.
Ann. Ent. Soc. Amer., 48 : 481–485.
Mathur, A.C. 1962. Food plant spectrum of Diacrisia obliqua Wlk.
(Arctiidae : Lepidoptera). Indian J. Ent., 24 (4) : 286–287.
Mathur, A.C. and Srivastava, J.B. 1962. Insect pests of Mentha. Bull.
Reg. Res. Lab. Jammu (1) : 19-50.
Nayar, K.K., Anantha Krishnan, T.N. and David, B.V. 1976. General
and Applied Entomology. Tata McGraw Hill Publishing Company
Ltd., pp.263.
Pandey, N.D., Yadav, D.R. and Teotia, T.P.S. 1968. Effect of different
food plants on the larval and post-larval development of Diacrisia
obliqua Walker. Indian J. Ent., 30 (3) : 229-234.
Singh, D.R. 1973. Weight loss and water loss in the larvae of Prodenia
litura Fabr. (Lepidoptera : Noctuidae) under the influence of certain
insecticides. Z. Angew. Ent., 74 : 56-61.
SooHoo, C.F. and Frankel, G. 1966. The consumption, digestion and
utilization of food plants by polyphagous insect, Prodenia evidantia
(Cramer) J. Insect Physiol., 12 (6) : 711-730.
Srivastava, S.C. and Pandey, P.N. 1981. Effects of Crucifers on Diacrisia
obliqua Walker (Lepidoptera : Arctiidae). Indian J. Zool., 22(1) :
35-46.
Recieved on 20-1-2010 Accepted on 11-6-2010

166 Trends in Biosciences 3 (2): 166-168, 2010 Trends in Biosciences 3 (2), 2010
Amino Acid Variability in Coat Protein Gene of Mungbean Yellow Mosaic India
Virus Infecting Pulse Crops
MANSI SACHAN * , MINAKSHI MISHRA * , NAIMUDDIN AND MOHD. AKRAM
Division of Crop Protection, Indian Institute of Pulses Research, Kanpur 208 024,
*
Department of Biotechnology, Dayanand Girl’s Post Graduate College, CSJM University, Kanpur;
e-mail: mansi.sachan@gmail.com
ABSTRACT
The coat protein gene (CP) of Mungbean yellow mosaic India
virus (MYMIV) was successfully amplified from four pulse crops
(mungbean, urdbean, cowpea and rajmash) showing yellow
mosaic symptoms using specific primer pair AV1-F- 5’ GTA TTT
GCA (GT)CA (AT)GT TCA 3’ / AV1-R- 5’ AGG DGT CAT TAG
CTT AGC 3’. The complete nucleotide sequence of the coat
protein gene of all the MYMIV isolates had single open reading
frame (ORF) of 774 bp and 257 amino acids. Comparision of
amino acid sequences of CP genes revealed that isolates
understudy had 97-99% sequence homology with known isolate
of MYMIV-Cowpea (AF481865). Variability in amino acids
sequences in the MYMIV isolates understudy with the type
isolate has been observed at 6 positions only. This indicates
that the CP gene of MYMIV is highly conserved though the
gene has been isolated from different pulse crops.
Key words
Pulses, MYMIV, PCR, variability, mungbean, urdbean,
cowpea, rajmash
Pulses belong to the protein-rich group of vegetable
foods and are particularly rich in amino acid lysine (Belhassen,
2005). Pulse crops are being attacked by a number of plant
pathogens causing several diseases. Yellow mosaic disease
is one of the important diseases of pulse crops particularly of
mungbean and urdbean and was first described by (Nariani,
et al., 1960). The yellow mosaic disease in pulse crops is
caused by white-fly transmitted Begomoviruses such as
Mungbean yellow mosaic virus, Mungbean yellow mosaic
India virus, Dolichos yellow mosaic virus and Horsegram
yellow mosaic virus across South Asia (Qazi, et al., 2005).
Coat protein (CP) forms the shell of the geminate particles
that are typical of Begomovirus. It is the basis of serological
detection and identification of begomovirus. CP is needed for
transmission by the white-fly, Bemisia tabaci. It controls virus
transport through the white-fly gut wall into the haemocoele,
where it binds a GroEL analogue, produced by a bacterial
endosymbiont, in a way that may protect virus particles from
degradation. Begomovirus is an outstanding example of a
multifunctional viral protein (Harison, et al., 2002). The amino
acid sequences of the coat protein (CP) of viruses of sub
group III (i.e. White-fly transmitted viruses that infect dicots)
of Geminiviridea are more conserved than the remainder of
the genome. However, a short N-terminal region (60-70 amino
acid) of the CP is more variable than the rest of the CP
sequence. PCR primers based on conserved sequences can
be used to sequence the N-terminal sequences of the CP of
the Geminiviruses; this sequence is sufficient to classify a
virus isolate. A possible taxonomic structure for geminiviruses
is proposed after considering the sequence comparisons and
biological properties (Ilyas, et al., 2010). The present study
was conducted to find out the amino acids variability in CP
gene of MYMIV infecting different pulse crops at a particular
location.
MATERIALS AND METHODS
The healthy and diseased samples (showing
characteristic symptoms of yellow mosaic disease) of pulse
crops (mungbean, urdbean, cowpea and rajmash) were
collected from the research farm of Indian Institute of Pulses
Research, Kanpur and brought to the laboratory for further
processing. Samples of mungbean, urdbean and cowpea were
collected during kharif, 2010 where as rajmash sample was
collected from crop sown in rabi 2009. Total DNA was extracted
from all the healthy and diseased leaves of pulse crops using
CTAB method (Rogers and Bendich, 1988). The extracted DNA
was analyzed by 1% agarose gel in 1X TAE buffer and the gel
was viewed in gel documentation system to confirm the
presence of DNA.
DNA extracted from healthy and diseased samples were
used as template for PCR. The primer pair (AV1-F/5’-GTA TTT
GCA (GT)CA (AT)GT TCA-3’; AV1-R/5’-AGG DGT CAT TAG
CTT AGC-3’) specific to the CP gene of MYMIV was used.
PCR was performed by adding 2 µl of the DNA extract to 23 µl
of PCR mixture containing 12.5 µl dream Taq green master mix,
1 µl of each forward and reverse primer (50pmol/ µl) and 8.5 µl
nuclease free water. The thermal conditions were - an initial
denaturation step at 94 0 C for 2 min and 35 cycles of
denaturation at 94 0 C for 30s, annealing at 54 0 C for 30s and
extension at 72 0 C for 1 min and one step of final extension at
72 0 C for 10 min. PCR amplified products were analysed by 1%
agarose gel electrophoresis at 50 V for 45 min and stained
with ethidium bromide. The size of amplicons was determined
by using 1 kb DNA ladder (Fermentas). The gel was visualized
under gel documentation system and photographed.
The PCR products were sequenced directly through
sequence service provider. The sequences of CP gene were
edited by BioEdit software. Multiple sequence analysis was

Sachan et al., Amino Acid Variability in Coat Protein Gene of Mungbean Yellow Mosaic India Virus Infecting Pulse Crops 167
done with the help of ClustalW (1.81) software programme
whereas sequence phylograms was drawn with the help of
GENEBEE CLUSTALW Software.
RESULTS AND DISCUSSION
PCR products from samples of mungbean, urdbean,
cowpea and rajmash showing yellow mosaic symptoms
(diseased) when analyzed in gel yielded amplicon of ~950 bp
(Fig. 1) indicating involvement of MYMIV whereas no
amplicon was observed in PCR products from healthy plants.
These results indicate that the DNA was successfully isolated
by CTAB method. Results of PCR reveal that there was no
infection by MYMIV in plants that were free from yellow
mosaic symptoms (healthy plants).
Fig. 1.
PCR Amplification of CP gene of MYMIV using AV1-
F/R primer pair. 1 kb DNA ladder (lane M), Amplified
products of healthy mungbean (lane 1), diseased
mungbean (lane 2), healthy urdbean (lane 3), diseased
urdbean (lane 4), healthy cowpea (lane 5), diseased
cowpea (lane 6), healthy rajmash (lane 7), diseased
rajmash (lane 8).
MYMIV-COW
MYMIV-[C]
MYMIV-[M]
MYMIV-[U]
MYMIV-[R]
....|....| ....|....| ....|....| ....|....| ....|....| ....|....|
10 20 30 40 50 60
MPKRTYDTAF STPISNARRR LNFDTPLVLP ASVGGVPTNM KRRRWTNRPM WRKPRFYRLY
MPKRTYDTAF STPISNARRR LNFDTPLVLP ASVGGVPTNM KRRRWTNRPM WRKPRFYRLY
MPKRTYDTAF STPISNARRR LNFDTPLMLP ASAGGVPTNM KRRRWTNRPM WRKPRFYRLY
MPKRTYDTAF STPISNARRR LNFDTPLMLP ASAGGVPTNM KRRRWTNRPM WRKPRFYRLY
MPKRTFDTAF STPISNARRR LNFDTPLMLP ASAGGVPTNM KRRRWTNRPM WRKPRFYRLY
MYMIV-COW
MYMIV-[C]
MYMIV-[M]
MYMIV-[U]
MYMIV-[R]
....|....| ....|....| ....|....| ....|....| ....|....| ....|....|
70 80 90 100 110 120
RSPDVPRGCE GPCKVQSFEQ RHDIAHTGKV ICISDVTRGN GITHRIGKRF CIKSVYVTGK
RSPDVPRGCE GPCKVQSFEQ RHDIAHTGKV ICISDVTRGN GITHRIGKRF CIKSVYITGK
RSPDVPRGCE GPCKVQSFEQ RHDIAHTGKV ICISDVTRGN GITHRIGKRF CIKSVYITGK
RSPDVPRGCE GPCKVQSFEQ RHDIAHTGKV ICISDVTRGN GITHRIGKRF CIKSVYITGK
RSPDVPRGCE GPCKVQSFEQ RHDIAHTGKV ICISDVTRGN GITHRIGKRF CIKSVYITGK
MYMIV-COW
MYMIV-[C]
MYMIV-[M]
MYMIV-[U]
MYMIV-[R]
....|....| ....|....| ....|....| ....|....| ....|....| ....|....|
130 140 150 160 170 180
VWMDENIKSK NHTNTVMFKL CRDRRPFGTP MDFGQVFNMY DNEPSTATVK NDLRDRYQVL
VWMDENIKSK NHTNTVMFKL CRDRRPFGTP MDFGQVFNMY DNEPSTATVK NDLRDRYQVL
VWMDENIKSK NHTNTVMFKL CRDRRPFGTP MDFGQVFNMY DNEPSTATVK NDLRDRYQVL
VWMDENIKSK NHTNTVMFKL CRDRRPFGTP MDFGQVFNMY DNEPSTATVK NDLRDRYQVL
VWMDENIKSK NHTNTVMFKL CRDRRPFGTP MDFGQVFNMY DNEPSTATVK NDLRDRYQVL
MYMIV-COW
MYMIV-[C]
MYMIV-[M]
MYMIV-[U]
MYMIV-[R]
....|....| ....|....| ....|....| ....|....| ....|....| ....|....|
190 200 210 220 230 240
RKFSATVTGG QYACKEQAMA NRFFKVNNYV VYNHQEAAKY ENHTENALLL YMACTHASNP
RKFSATVTGG QYACKEQAMV NRFFKVNNYV VYNHQEAAKY ENHTENALLL YMACTHASNP
RKFNATVTGG QYACKEQAMV NRFFKVNNHV VYNHQEAAKY ENHTENALLL YMACTHASNP
RKFNATVTGG QYACKEQAMV NRFFKVNNYV VYNHQEAAKY ENHTENALLL YMACTHASNP
RKFNATVTGG QYACKEQAMV NRFFKVNNYV VYNHQEAAKY ENHTENALLL YMACTHASNP
Fig. 2.
MYMIV-COW
MYMIV-[C]
MYMIV-[M]
MYMIV-[U]
MYMIV-[R]
....|....| ....|..
250
VYATLKIRIY FYDSILN
VYATLKIRIY FYDSILN
VYATLKIRIY FYDSILN
VYATLKIRIY FYDSILN
VYATLKIRIY FYDSILN
Multiple alignment of amino acids sequences of MYMIV isolates. The total length of deduced amino acid in CP gene of
MYMIV is 257. MYMIV-COW= MYMIV- Cowpea (AF481865), MYMIV-[C]= MYMIV -[Cowpea], MYMIV-
[M]=MYMIV-[Mungbean], MYMIV-[U]= MYMIV-[Urdbean], MYMIV-[R]= MYMIV-[Rajmash]

168 Trends in Biosciences 3 (2), 2010
Table 1.
Variability in CP genes of MYMIV isolates at amino acid level
S. No. Amino acids
Isolates of MYMIV for this study
MYMIV-Cowpea
position # [Cowpea] [Mungbean] [Urdbean] [Rajmash]
(AF481865)
1. 6 Tyrosine Tyrosine Tyrosine Phenylalanine Tyrosine
2. 28 Valine Methionine Methionine Methionine Valine
3. 33 Valine Alanine Alanine Alanine Valine
4. 117 Isoleucine Isoleucine Isoleucine Isoleucine Valine
5. 184 Serine Asparagine Asparagine Asparagine Serine
6. 208 Tyrosine Histidine Tyrosine Tyrosine Tyrosine
#
Length of CP gene is 257 amino acids
MYMIV isolates infecting mungbean, urdbean, cowpea
and rajmash at Kanpur were designated as MYMIV-
[Mungbean], MYMIV-[Urdbean], MYMIV-[Cowpea] and
MYMIV-[Rajmash], respectively. The complete nucleotide
sequence of the coat protein gene of all the MYMIV isolates
had single open reading frame (ORF) of 774 base pairs and
257 amino acids.
Comparison of amino acid sequences of CP genes
revealed that isolates under study had 97-99% sequence
homology with known isolate of MYMIV-Cowpea (AF481865).
Isolate MYMIV-[Cowpea] under study had 99% homology
with MYMIV-Cowpea (AF481865) reported from cowpea earlier
(Malathi, et al., 2003).
The amino acids of CP gene of isolates under study
differed from the isolate of MYMIV Cowpea (AF481865) at 6
positions (Table 1, Fig. 2). In isolates MYMIV-[Mungbean],
MYMIV-[Urdbean] and MYMIV-[Cowpea], amino acid
position 6 is occupied by tyrosine similar to the isolate used
for comparison, where as isolate MYMIV-[Rajmash] has
phenylalanine in this position. Valine in MYMIV-Cowpea
(AF481865) as amino acid no. 28 and 33 were substituted by
methionine and alanine, respectively in MYMIV-[Mungbean],
MYMIV-[Urdbean] and MYMIV-[Rajmash].
Amino acid at position no. 117 is valine in CP gene of
MYMIV-Cowpea (AF481865), whereas this position is
occupied by isoleucine in all the four isolates used in this
study. Similar to CP gene of MYMIV-Cowpae (AF481865),
MYMIV [Cowpea] also has serine as 184 th amino acid, whereas
this position is occupied by asparagines in MYMIV-
[Mungbean], MYMIV-[Urdbean] and MYMIV-[Rajmash]. CP
gene of MYMIV-[Cowpea], MYMIV-[Urdbean] and MYMIV-
[Rajmash] has tyrosine as amino acid no. 208 and in it they
resembled MYMIV-Cowpea (AF481865) unlike CP gene of
MYMIV-[Mungbean] in which this position is occupied by
histidine (Fig. 2).
Thus it is concluded from the present study that the
Coat protein (CP) gene of MYMIV has very less variability in
amino acid sequences of four isolates of MYMIV isolated
from different crops (mungbean, urdbean, rajmash and
cowpea). Harison, et al., 2002 has also reported that the amino
acid sequences of the coat protein (CP) of viruses of sub
group III (i.e. White-fly transmitted viruses that infect dicots)
of Geminiviridea are more conserved than the remainder of
the genome.
LITERATURE CITED
Belhassen, B.B. 2005. Global supply, demand and trade of pulses:
Situation and future prospects. 4 th International Food Legumes
Research Conference held on October, New Delhi, India.
Harrison, B.D., Swanson, M.M. and Fargette. D. 2002. Begomovirus
coat protein: serology, variation and functions. Physiological and
Molecular Plant Pathology, 60: 257-271.
Ilyas, M., Qazi, J., Mansoor, S. and Briddon, R.W. 2010. Genetic diversity
and phylogeography of begomoviruses infecting legumes in
Pakistan. J. Gen. Virol., 91: 2091–2101.
Malathi, V.G., Naghma, A. and Surendranath, B. 2003. Complete
Nucleotide Sequence of DNA-A of Cowpea Golden Mosaic
Geminivirus from India, http://www.ncbi.nlm.nih.gov/nuccore/
21328578.
Nariani, T.K. 1960. Mungbean Yellow Mosaic Virus. Indian Phytopath.,
13: 24.
Rogers, S.O. and Bendich, A.J. 1988. Extraction of DNA from milligram
amounts of fresh, herbarium and mummified plant tissues. Plant
Molecular Biology, 5: 69-76.
Recieved on 30.10.2010 Accepted on 24.11.2010

Trends in Biosciences 3 (2): 169-173, 2010
Combining Ability for Maturity, Morphological and Yield Related Traits in Maize
(Zea mays L.)
ASIF, M. IQBAL, F.A. NEHVI, H.QADRI AND S.A. DAR
Division of Plant Breeding & Genetics, Sher-e-Kashmir University of Agricultural Sciences & Technology of
Kashmir, Shalimar, Srinagar 191121 (J&K)
ABSTRACT
Combining ability analysis for yield and its contributing traits
was carried out in maize (Zea mays L.) by gorwing 45 F 1
’s
generated by crossing fifteen lines with 3-well adapted testers.
The material was generated and evaluated at Karewa Damuder
Maize Research Station Budgam during 2004-05. The analysis
of variance revealed highly significant differences among lines,
testers and line x testers for all traits studied. The estimation
of genetic component of variance indicated higher proportion
of dominance variance for all traits studied except for grain
yield ha -1 and days taken to 50% husk browning. Inbred lines
KDM 334 (yield), KDM 335 (anthesis and silking) and KDM
349 (husk browning, plant height and ear height) recorded
highest gca effects towards desired direction, whereas, KDM
331 × KDM 346 and KDM 336 × KDM 346 were the best specific
cross combinations for early flowering and maturity traits.
Highest specific combining ability for grain yield ha-1 was
recorded in KDM 349 × KDM 346.
Key words
Zea mays, combining ability, yield.
Efforts were made to test the combining ability of various
(Zea mays L.) inbred lines of maize for maturity and yield
related traits to identify the best specific combination showing
early maturity with better yields. The design Line x Tester of
Kempthorne, 1957 has been widely used in maize by several
workers and continues to be applied in quantitative genetic
studies (Joshi, et al., 2002 and Sharma, et al., 2004)
MATERIALS AND METHODS
The experimental material comprised of fifteen inbred
lines of maize (Zea mays L.) viz., KDM 328, KDM 329, KDM
330, KDM 331, KDM 332, KDM 333, KDM 334, KDM 335,
KDM 336, KDM 337, KDM 340, KDM 342, KDM 345, KDM
347 and KDM 349 (used as females); three testers viz., C6,
Super 1 and KDM 346 (used as males) and 45 test cross
progenies developed by crossing 15 lines with 3 testers in a
line x tester fashion of Kempthorne, 1957.Material was
generated in 2004 and subsequently evaluated at K.D.research
station of SKUAST-K during 2005. The design used was RBD
with 3-replications and each progeny was represented by 3-
rows of 5m row length with inter and intra row spacing of 60
and 20 cm respectively. Data was recorded on six traits viz.,
days taken to 50 percent anthesis, days taken to 50 percent
silking, days taken 50 percent husk browning, plant height
(cm), ear height (cm) and grain yield q ha -1 .The data was
analysed as per line x tester procedure of Kempthrone, 1957.
RESULTS AND DISCUSSION
Analysis of variance for combining ability revealed
significant mean squares due to lines, testers, crosses and
parents v/s crosses for all traits indicating substantial
variability in parental lines for these traits (Table 1). The
variance due to general combining ability (gca variance) and
specific combining ability (sca variance) were significant for
all traits, which indicates importance of both additive and non
additive gene action in the inheritance of these traits. These
results are in general agreement with those of Kumar, et al.,
2006 and Lata, et al., 2006. However preponderance of
magnitude of sca effects reveals importance of non additive
gene effects. Higher magnitude of dominance variance for
days taken to 50 per cent anthesis, days taken to 50 per cent
silking, plant height (cm) and ear height (cm) revealed
importance of non additive gene action in the inheritance of
these traits, whereas, for other traits viz., days taken to 50%
husk browning and grain yield ha -1 , inheritance was under
the control of additive gene action. Similar findings were
reported by Spaner, et al., 1996 and Nagda, et al., 1995 for
days to anthesis and days to silk, whereas, the results
contradict the findings of Kanta, et al., 2005 and Lata, et al.,
2006 for plant height (cm), ear height (cm) and grain yield ha -
1
. The degree of dominance was in the range of over dominance
for all traits except for days taken to 50% husk browning and
grain yield ha -1 , where it was in the range of partial dominance.
Estimates of gca effects for different traits is presented
in Table 2. Results reveal that no line was observed to be
good combiner for all the traits. KDM 328, KDM 335, KDM
337, KDM 342 and KDM 349 were observed to be good
combiners for early husk browning. KDM 335 was observed
to be good combiner for all the flowering and maturity. It was
observed that lines showing good combining ability for
flowering were either poor or average combiners for husk
browning , excepting KDM 335.Among the testers, KDM 346
was observed to be good combiner for all traits, but showed
poor combining ability for husk browning.C6 and Super-1 were
observed to be good combiners for husk browning being either
poor or average combiner for flowering traits .Among lines
good combining ability for reduced plant height and ear height
was accompanied with poor combining ability for yield which

170 Trends in Biosciences 3 (2), 2010
was not a case in case of tester KDM 346. Among lines KDM
345 and C6 among testers recorded good combining ability
for greater plant height and grain yield. For grain yield KDM
329, KDM 335, KDM 340, KDM 342, KDM 345 and KDM 347
which showed either poor, good or average combining ability
for other traits were recorded good combiners for grain yield
q ha -1 . Among lines KDM 335, KDM 342 and KDM 347 were
found to be good combiners for early maturity and higher
yields. Similar results for testers were recorded for C6.
Perusal of Table 3 revealed highest sca effects by KDM
331 X KDM 346 for early anthesis (-4.022) and early silking (-
3.622). KDM 336 x KDM 346 also recorded good specific
combining ability for all flowering and maturity traits. Other
crosses viz., KDM 328 X C6, KDM 330 x Super 1, KDM 340 x
C6 and KDM 342 x Super 1, KDM 345 x KDM 346, KDM 347 x
Super 1, KDM 349 x Super 1 and KDM 349 x KDM 346 revealing
good specific combining ability for early maturity showed
average specific combining for flowering traits. Highest
specific cross combinations viz., KDM 331 x KDM 346 and
KDM 336 x KDM 346 involved poor x poor general combiners,
whereas other best specific cross combination for early husk
browning resulted by involving poor x good combiners (KDM
330 x Super 1) average x poor combiners (KDM 345 x KDM
346), good x good (KDM 328 x C6, KDM 347 x Super 1, KDM
349 x Super 1) and good x poor combiners (KDM 349 x KDM
346). Results suggest that involvement of two good combiners
was not necessary. KDM 349 x KDM 346 recorded highest
specific combining ability for grain yield ha -1 (18.52), which
was followed by KDM 333 x KDM 346 (12.99), KDM 342 x C6
(10.82), KDM 328 x Super 1 (10.28), KDM 335 x Super 1 (10.14).
The best specific cross combinations recorded average
combining ability for rest of the traits excepting for days taken
Table 1.
Analysis of variance for combining ability for different traits in maize (Zea mays L.)
Source of variation d.f Days taken to 50%
anthesis
Days taken to 50%
silking
Days taken to 50%
husk browning
Plant height
(cm)
Ear height
(cm)
Grain yield
ha -1 (q)
Line effect 14 31.901** 34.347** 36.425* 1858.717** 992.966* 1283.389**
Tester effect 2 30.688* 32.140* 138.867** 1958.156* 1706.212* 2077.027**
L x T effect 28 8.966** 9.593** 15.454** 549.925** 453.493** 293.868**
Error 88 0.802 0.704 0.607 104.06 196.121 8.689
2 Line 3.455** 3.738** 3.973* 194.961** 88.538* 141.633**
2 Testers 0.664 0.699 3.072* 41.202* 33.557* 45.963*
2 gca 1.129** 1.205** 3.223** 66.828** 42.721* 61.908**
2 L x T (sca) 2.721** 2.963** 4.949** 148.620** 85.790** 95.059**
2 A 2.258 2.410 6.447 133.657 85.442 123.816
2 D 2.721 2.963 4.949 148.620 85.790 95.059
2 A/ 2 D 0.830 0.813 1.302 0.899 0.995 1.302
Degree of Dominance 1.097 1.108 0.876 1.054 1.002 0.876
Total 134 6.297 6.640 9.510 426.802 379.465 233.055
*,** Significant at 5% and 1% levels, respectively
Table 2.
Top ranking cross combinations on the basis of per se performance, sca effects and heterosis for various traits in
maize, related to maturity, morphological and grain yield.
Characters Per se performance Specific cross
Heterotic hybrids over
combinations Mid parent Better parent Standard parent
Days taken to 50% anthesis L 8xT 1, L 3xT 3, L 2xT 3,
L 6xT 3,
L 8xT 2
L 4xT 3, L 8xT 1,
L 3xT 3, L 10xT 1,
L 9xT 3
L 3xT 3, L 8xT 1,
L 2xT 3,L 6xT 3,
L 6xT 2
L 8xT 1, L 3xT 3,
L 8xT 2,L 6xT 2,
L 2xT 3
L 8xT 1, L 3xT 3,
L 2xT 3,L 6xT 3,
L 8xT 2
Days taken to 50% silking L 8xT 1, L 3xT 3,
L 2xT 3,L 6xT 3, L 8xT 2
L 4xT 3, L 8xT 1,
L 3xT 3,L 2xT 3,
L 10xT 1
L 3xT 3, L 8xT 1,
L 6xT 3,L 2xT 3,
L 6xT 2
L 8xT 1, L 3xT 3,
L 8xT 2,L 6xT 3,
L 2xT 3
L 8xT 1, L 3xT 3,
L 2xT 3,L 6xT 3,
L 8xT 2
Days taken to 50% husk browning L 1xT 1, L 15 x T 2,
L 14xT 2,L 12 x T 2, L 3xT 2
Plant height (cm) L 15xT 3, L 15xT 2,
L 7xT 2,L 14xT 3, L 15xT 1
Ear height (cm) L 4xT 2, L 9xT 2,
L 6xT 3,L 15xT 2, L 7xT 3
Grain yield ha - 1 (q) L 12xT 1, L 14xT 3,
L 12xT 3, L 13xT 3 , L 2xT 3
L 1xT 1, L 4xT 3,
L 12xT 2, L 13xT 3,
L 14xT 2
L 14xT 3, L 13xT 3,
L 7xT 2, L 10xT 1,
L 11xT 21
L 1xT 1, L 12xT 2,
L 15xT 2,L 14xT 2,
L 10xT 1
L 1xT 1, L 12xT 2,
L 15xT 2,L 14xT 2,
L 10xT 2
- L 15xT 1, L 15xT 2,
L 7xT 2
L 4xT 2 L 4xT 2 L 4xT 2 L 4xT 2
L 15xT 3, L 13xT 3,
L 6xT 3, L 12xT 1,
L 1xT 2
L 12xT 1, L 14xT 3,
L 6xT 3, L 12xT 3,
L 7xT 2
L 12xT 1, L 8xT 2,
L 14xT 3,L 12xT 3,
L 8xT 1
L 1xT 1, L 15xT 2,
L 14xT 2,L 12xT 2,
L 10xT 2
L 15xT 3, L 15xT 2,
L 7xT 2,L 15xT 1,
L 6xT 3
L 12xT 1, L 14xT 3,
L 12xT 3,L 13xT 3,
L 8xT 1
L 1
-KDM 328, L2-KDM 329,L 3
-KDM330, L 4
-KDM331, L 5
-KDM 332, L 6
-KDM 333, L 7
-KDM 334, L 8
-KDM 335, L 9
-KDM 336, L 10
-KDM 337, L 11
-
KDM 340, L 12
-KDM 342, L 13
-KDM 345, L 14
-KDM 347, L 15
-349.

Iqbal, et al., Combining Ability for Maturity, Morphological and Yield Related Traits in Maize (Zea mays L.) 171
Table 3.
Estimates of specific combining ability effects for different traits in maize (Zea mays L.)
Crosses
Days taken to
50% anthesis
KDM 328 x C6 -1.311
(83.66)
KDM 328 x Sup 1 -1.00
(84.66)
KDM 328 x KDM 346 2.311**
(86.33)
KDM 329 x C6 -0.5333
(82.66)
KDM 329 x Sup 1 1.444*
(85.33)
KDM 329 x KDM 346 -0.911
(81.33)
KDM 330 x C6 2.356**
(86.33)
KDM 330 x Sup 1 0.333
(85.00)
KDM 330 x KDM 346 -2.689**
(80.33)
KDM 331 x C6 2.689**
(92.00)
KDM 331 x Sup 1 1.333*
(91.33)
KDM 331 x KDM 346 -4.022**
(84.33)
KDM 332 x C6 0.911
(85.66)
KDM 332 x Sup 1 -0.444
(85.00)
KDM 332 x KDM 346 -0.467
(83.33)
KDM 333 x C6 1.356*
(84.33)
KDM 333 x Sup 1 -0.667
(83.00)
KDM 333 x KDM 346 -0.689
(81.33)
KDM 334 x C6 -0.089
(85.66)
KDM 334 x Sup 1 -0.111
(86.33)
KDM 334 x KDM 346 -2.00
(85.00)
KDM 335 x C6 -2.7561**
(79.00)
KDM 335 x Super 1 -0.111
(82.33)
KDM 335 x KDM 346 2.867**
(83.66)
KDM 336 x C6 0.578
(86.66)
KDM 336 x Sup 1 0.889
(87.66)
KDM 336 x KDM 346 -1.467**
(83.66)
KDM 337 x C6 -1.533**
(83.66)
KDM 337 x Sup 1 -0.222
(85.66)
KDM 337 x KDM 346 1.756**
(86.00)
Days taken to 50%
silking
-0.830
(86.66)
-1.230*
(86.66)
2.059**
(88.33)
0.948
(87.33)
0.881
(87.66)
-1.830**
(83.33)
2.393**
(89.00)
0.695
(76.66)
-3.052**
(82.33)
2.504**
(94.33)
1.437**
(93.66)
-3.941**
(86.66)
0.504
(88.33)
0.104
(88.33)
-0.607
(86.00)
1.281*
(86.66)
-0.452
(85.33)
-0.830
(83.33)
-0.052
(88.66)
0.215
(89.33)
-0.163
(87.33)
-3.052**
(81.00)
-0.119
(84.33)
3.170**
(86.80)
0.615
(89.66)
0.548
(90.00)
-1.163*
(86.66)
-1.607**
(86.66)
-0.341
(88.33)
1.948**
(89.00)
Days taken to 50%
husk browning
-4.933**
(124.00)
0.667
(128.66)
4.267**
(135.66)
-0.711
(130.66)
-0.778
(129.66)
1.489**
(135.33)
1.622**
(133.00)
-2.111**
(128.33)
0.489
(134.33)
0.511
(136.33)
3.111**
(138.00)
-3.622**
(134.66)
-0.267
(129.66)
0.333
(129.33)
-0.067
(132.33)
-0.822
(129.66)
2.111**
(131.66)
-1.289*
(131.66)
-0.156
(131.33)
0.778
(131.33)
-0.622
(133.33)
-0.822
(129.00)
1.444*
(130.33)
-0.622
(131.66)
0.511
(132.00)
0.778
(131.33)
-1.289*
(132.66)
-0.711
(128.66)
-0.111
(128.33)
0.822
(132.66)
Plant height
(cm)
-10.844
(223.66)
4.600
(234.00)
6.244
(227.66)
-1.400
(222.00)
1.378
(219.66)
0.022
(210.33)
7.933
(232.00)
-0.965
(218.00)
-6.978
(204.00)
13.711*
(245.00)
-13.844*
(212.33)
0.133
(218.33)
-5.178
(234.00)
-7.400
(226.66)
12.578*
(238.66)
8.489
(223.66)
-2.067
(208.00)
-6.422
(195.66)
9.711
(219.33)
-16.178*
(1888.33)
6.467
(203.00)
-3.733
(221.00)
-5.289
(214.43)
9.022
(220.66)
6.378
(226.66)
-6.844
(208.33)
0.467
(207.66)
-15.289*
(222.33)
0.489
(233.00)
14.800*
(239.33)
Ear height
(cm)
-2.752
(146.16)
10.206
(150.16)
-7.454
(129.66)
-4.985
(140.83)
-0.694
(136.16)
5.679
(139.70)
5.415
(151.33)
2.373
(139.33)
-7.787
(126.33)
22.193*
(150.83)
-26.683**
(93.00)
4.490
(121.33)
4.859
(150.83)
-4.350
(132.66)
-0.510
(133.66)
13.137
(142.00)
-2.072
(117.83)
-11.065
(106.00)
9.970
(135.66)
-5.072
(111.66)
-4.899
(109.00)
-7.307
(120.83)
-1.183
(118.00)
8.490
(124.83)
-5.530
(119.66)
-10.739
(105.50)
16.268
(129.66)
-16.630
(124.16)
3.628
(135.46)
13.001
(142.00)
Grain yield ha-1
(q)
-2.105
(61.11)
10.386**
(65.21)
-8.281**
(59.99)
-4.518*
(64.71)
-1.404
(59.43)
5.922*
(80.21)
-0.429
(59.21)
4.302*
(55.55)
-3.873*
(60.82)
5.039**
(50.55)
6.649**
(43.77)
-11.688**
(38.88)
2.220
(49.99)
6.171**
(49.90)
-3.950*
(53.32)
-5.533**
(51.94)
-7.438**
(41.66)
12.991**
(75.54)
-1.420
(65.54)
7.897**
(66.47)
-6.477**
(65.54)
2.870
(79.98)
10.147**
(78.87)
-13.017**
(69.16)
9.079**
(61.38)
-7.257**
(36.66)
-1.821
(55.54)
0.616
(46.47)
6.974**
(44.43)
-7.590**
(43.32)
Continued…..

172 Trends in Biosciences 3 (2), 2010
Table 3.
(Contd..)
Crosses
Days taken to
50% anthesis
Days taken to 50%
silking
Days taken to 50%
husk browning
Plant height
(cm)
Ear height
(cm)
Grain yield ha-1
(q)
KDM 340 x C6 -0.200
(86.33)
0.059
(89.33)
-1.933**
(130.66)
-15.178*
(218.00)
-9.974
(132.83)
7.219**
(75.54)
KDM 340 x Sup 1 -0.889
(86.33)
-1.007
(88.66)
-0.667
(131.00)
8.267
(236.33)
7.481
(141.33)
-3.274
(56.66)
KDM 340 x KDM 346 1.089
(86.66)
0.948
(89.00)
2.600**
(137.66)
6.911
(227.00)
2.490
(133.50)
-3.945*
(69.44)
KDM 342 x C6 0.133
(87.00)
-0.274
(89.33)
1.844**
(131.33)
-7.511
(235.33)
-0.947
(145.66)
10.862**
(88.87)
KDM 342 x Sup 1 -0.556
(87.00)
-0.341
(89.66)
-2.889*
(125.66)
-0.733
(237.00)
6.650
(144.33)
-14.444**
(55.17)
KDM 342 x KDM 346 0.422
(86.33)
0.615
(89.00)
1.044*
(133.00)
8.244
(238.00)
-5.676
(129.16)
3.582
(86.65)
KDM 345 x C6 -0.311
(85.66)
-0.941
(88.33)
1.178*
(131.33)
0.267
(252.00)
0.859
(155.16)
-10.616**
(55.54)
KDM 345 x Sup 1 -0.667
(86.00)
-0.341
(89.33)
1.111*
(130.33)
19.044**
(265.66)
14.317
(159.66)
-3.705*
(54.06)
KDM 345 x KDM 346 0.978
(86.00)
1.281*
(89.33)
-2.289**
(130.33)
-19.13**
(219.33)
-15.176
(127.33)
14.321**
(85.54)
KDM 347 x C6 -0.644
(85.66)
-0.719
(88.33)
2.622**
(131.66)
13.933*
(250.00)
-3.974
(143.33)
-2.035
(75.17)
KDM 347 x Sup 1 0.643
(87.00)
0.119
(89.33)
-2.277**
(125.33)
20.711**
(251.66)
13.817
(152.16)
-3.274
(66.54)
KDM 347 x KDM 346 0.644
(86.00
0.837
(86.00)
0.156
(131.66)
-34.64**
(188.33)
-9.843
(125.66)
5.309**
(87.57)
KDM 349 x C6 -0.644
(86.33)
-0.830
(86.33)
2.067**
(129.00)
-1.289
(193.00)
-4.307
(119.50)
-6.788**
(35.17)
KDM 349 x Sup 1 0.667
(88.33)
0.104
(88.33)
-1.000*
(125.00)
-1.178
(188.00)
-7.683
(107.16)
-11.731**
(21.84)
KDM 349 x KDM 346 0.022
(86.00)
0.726
(86.00)
-1.067*
(128.33)
2.467
(183.66)
11.990
(124.00)
18.519**
(65.54)
SE + Sij +0.517 +0.484 +0.449 +5.889 +8.085 +1.701
SE + Sij – Ski +0.7314 +0.685 +0.636 +8.329 +11.434 +2.406
*’ ** Significant at 5% and 1% levels, respectively. The values in brackets represent mean per se performance
to dry husk where it was a good specific combination. KDM
331x C6 was observed to be a good specific combiner for taller
plant height and ear height whereas, KDM 331 x Super 1 was
observed to be a best specific combination for reduced plant
and ear height. The results are in general agreement with the
findings of Srivastava and Singh, 2003.
The best five cross combinations on the basis of specific
combining ability effects, per se performance and heterosis
for grain yield and its contributing traits are presented in Table
5. Most of the crosses which have significant sca effects
involved high x high, high x low and high x average combining
parents, suggesting that involvement of one good general
combiner appears to be essential to get the better specific
combination. The results are in general agreement with the
findings of Dass, et al., 1997. Chaudhary, et al., 2000 and
Surya and Ganguli, 2004 reported high positive sca effects
along with per se performance for grain yield. Crosses with
good sca and per se performance can be selected to recover
transgressive segregants. This indicated wide diversity in
nicking between the parents to produce good hybrids. A
progeny selection with pedigree method in such crosses may
throw up transgressive segregants leading to development
of good inbreds. Such nicking could be the complementary
expression of hybrid vigour resulting from combining together
of favourable dominant genes or epistasis action of genes as
was stated by Stuber and Moll, 1974. Genotypes with
significant gca effects in desired direction are expected to
transmit genes with desirable effects to their progeny.
A number of parental lines and testers were observed to
possess good general combining ability effects viz., KDM
334, KDM 342 (for yield) and KDM 335, KDM 349 (maturity
and morphological traits). These findings suggest that these
inbred lines may be utilized under hybridization programmes
for improving maize genotypes with respect to earliness and
dwarfness as well as for yield.
LITERATURE CITED
Chaudhary, A.K., Chaudhary, L.B. and Sharma, K.C. 2000. Combining
ability estimates of early generation inbred lines derived from two
maize populations. Indian Journal of Genetics, 60(1) : 55-61.
Dass, S., Ahuja, V.P. and Singh, M. 1997. Combining ability for yield in
maize. Indian Journal of Genetics, 57(1) : 98-100.
Joshi, V.N., Dubey, R.B. and Marker, S. 2002. Combining ability for
polygenic traits in early maturity hybrids of maize (Zea mays L.).

Iqbal, et al., Combining Ability for Maturity, Morphological and Yield Related Traits in Maize (Zea mays L.) 173
Indian Journal of Genetics, 62(4) : 312-315.
Kanta, G., Singh, H.B., Sharma, J.K. and Guleri, G.K. 2005. Heterosis
and combining ability studies for yield and its related traits in maize.
Crop Research, 30 : 221-226.
Kempthorne, O. 1957. An introduction to genetic statistics. John Wiley
and Sons, New York, pp. 468-472.
Kumar, R., Singh, M. and Narwal, M.S. 2006. Combining ability analysis
for grain yield and its contributing traits in maize (Zea mays L.).
National Journal Plant Improvement, 8(1) : 62-66.
Lata, S., Kanta, G., Sharma, J.K. and Dev, J. 2006. Components of
variation, combining ability and heterosis studies for yield and its
related traits in maize. Crop Improvement, 33(2) : 151-55.
Negda, A.K., Vyas, M.C., Dubey, R.B. and Pandiya, N.K. 1995. Heterosis
and combining ability analysis of grain yield and its components in
maize. Crop Research, 10(3) : 297-301.
Sharma, S., Narwal, M.S., Kumar, R. and Dass, S. 2004. Line x tester
analysis in maize (Zea mays L.). Forage Research, 30(1) : 28-30.
Spaner, D., Brathwaste, R.A. and Mather, D.E. 1996. Diallel study of
open pollinated maize varieties in Trinidad. Euphytica, 90 : 65-72.
Srivastava, A. and Singh, I.S. 2003. Heterosis and combining ability for
yield and maturity involving exotic and indigenous inbred lines of
maize. Indian Journal of Genetics, 63(4): 345-346.
Stuber, C.W. and Moll, R.H. 1974. Epistasis in maize (Zea mays L.) Iv.
Crosses among line selected for superior intervariety single cross
performances. Crop Science, 14: 314-316.
Surya, P. and Ganguli, D.K. 2004. Combining ability for various yield
component and characters in maize. J. Res. Bisra. Agric. Univ.,
16: 55-60.
Recieved on 15.09.2010 Accepted on 21.10.2010

174 Trends in Biosciences 3 (2): 174-175, 2010 Trends in Biosciences 3 (2), 2010
Comparative Efficacy of Some Biopesticides and Insecticides against Diamondback
Moth, Plutella xylostella (L.) on Cabbage in Allahabad, U.P.
ANKUSH RAUT* AND SOBITA SIMON
Department of Plant Protection, Sam Higginbottom Institute of Agriculture, Technology and sciences, (Deemedto-be
University), Allahabad 211 007 (U.P.)
e-mail: ankushraut87@gmail.com, sobitasimon@rediffmail.com
ABSTRACT
In order to determine the comparative efficacy of some
biopesticides (Azadirachtin, Bt. kurstaki and spinosad) with
recommended insecticide-quinalphos against diamondback
moth, Plutella xylostella (L.). Field trial was conducted during
rabi season 2009-10 at Allahabad, U.P. The insecticides were
used as per recommended doses along with an untreated
control. Each insecticide was sprayed thrice at 15 days interval.
The larval count per plant was taken day before and 1, 7 and 14
days after each spray. All the insecticides tested significantly
reduced the pest population compared to control. Quinalphos
25 EC @ 1000 ml/ha was the most effective on the basis of pest
population per plant and increase of yield over untreated control.
Key words
Diamondback moth, Plutella xylostella, cabbage,
insecticides
In India, a total of 37 insect pests are reported on
cabbage (Sachin and Gangwar, 1980; Lal, et. al., 2002). In recent
years, Plutella xylostella has become most destructive insect
pest of cruciferous plant throughout the world and annual
cost for its management is estimated to be U.S. $ 1 billion
(Talekar, 1992). Satpathy et al., 2005 noted 50-80 % loss in
marketable cabbage yield due to this pest.
MATERIALS AND METHODS
The trial was conducted in rabi season 2009-10 at
department of Plant Protection, SHIATS, Allahabad (UP). Trial
was laid out in a randomized block design consisting of seven
different insecticides formulations along with one
Table 1.
DAS- Days after spray.
Effect of treatments on population of Diamondback Moth
recommended concentration and thus, the total number of
treatments was eight. Each treatment was replicated thrice in
a plot size of 6 m 2 and cabbage cv. Pride of India was used for
study. After observing a sufficient level of insect population,
spraying was undertaken. Three spray operations were under
to at 15 km days interval. Observations on number of larvae
per plant were recorded before treatment and 1, 7 and 14 days
after each spray from five randomly selected plants. The data
were subjected to statistical analysis. The yield per plot was
also recorded and expressed as tones per hectare.
RESULTS AND DISCUSSION
Quinalphos was found most effective against larval
population of Plutella xylostella followed by spinosad >
azadirachtin 1500 ppm > NSKE 5 % > Btk 750 g/ha >
azadirachtin 300 ppm > Btk 500 g/ha > untreated control at 1,
7 and 14 days after 1 st , 2 nd and 3 rd .
Based on per cent population, it was found that
quinalphos and spinosad were most effective and these
treatments recorded comparatively higher per cent and was
supported population reduction of P. xylostella at all
observational intervals after first, second and third spray.
Effectiveness of quinalphos against diamondback moth
had been reported by Singh, et al., 1976 and 100 % mortality
of larvae within 48 hours of spraying at the dose @ 0.25 kg a.i/
ha was reported and spinosad was found effective which is in
agreement with the result obtained by Jat and Bhardwaj, 2005
and Paliwal and Dadheech, 2001. Dhavan, et al., 2007 observed
Treatment
Per cent reduction in larval
population of DBM 1 st spray
Per cent reduction in larval
population of DBM after 2 nd spray
Percent reduction in larval
population of DBM 3 rd spray
1 DAS 7 DAS 14 DAS 1 DAS 7 DAS 14 DAS 1 DAS 7 DAS 14 DAS
Azadirachtin 300 ppm 22.24 32.61 34.72 20.33 30.17 31.8 19.32 26.17 28.91
Azadirachtin 1500 ppm 30.17 41.88 45.35 32.2 41.69 46.51 34.77 44.95 48.12
Neem seed extract 5% 28.42 37.27 40.46 28.79 36.47 40.16 28.12 37.62 40.16
Bt var. kurstaki (Delfin) 500 g/ha 21.00 30.85 33.91 21.55 30.41 34.31 16.85 23.87 26.09
Bt var. kurstaki (Delfin) 750 g/ha 27.19 36.48 39.68 24.65 33.28 36.61 26.2 34.33 37.05
Spinosad 2.5 SC @ 600 ml/ha 46.61 63.82 69.86 46.23 62.93 69.24 46.83 60.02 65.2
Quinalphos 25EC @ 1000 ml/ha 60.53 76.39 82.05 63.01 77.48 84.03 56.53 74.61 83.34
Untreated control 10.47 14.63 17.57 10.08 14.92 17.06 09.87 12.12 12.24
‘F’ test Sig. Sig. Sig. Sig. Sig. Sig. Sig. Sig. Sig.
SE + 3.02 3.22 2.96 3.84 6.93 5.21 9.87 4.1 4.27
CD at 5% 6.47 6.90 6.35 8.23 14.86 11.17 21.17 8.79 9.15

Table 2.
Treatments
RAUT AND SIMON, Comparative Efficacy of Some Biopesticides and Insecticide against Diamondback Moth 175
Economics and incremental cost benefit ratio of treatments on cabbage yield
Appoximate
cost of
insecticides +
labour (Rs.)
Average
total yield
(q/ha)
Increased
yield over
control
Approximate sale
price
(Rs./q)
Value of
increased
yield/ha
Approximate net
profit
(Rs./ha)
Incremental
cost benefit
ratio
Azadirachtin 300 ppm 1140.00 138.82 41.82 800.00 33,456.00 32,316.00 1:28.34
Azadirachtin 1500 ppm 1590.00 179.78 82.78 800.00 66,224.00 64,634.00 1:40.65
Neem seed extract 5% 1725.00 159.22 62.22 800.00 49,776.00 48,051.00 1:28.11
Bt var. kurstaki (Delfin) 500 g/ha 5040.00 128.93 31.93 800.00 25,544.00 20,504.00 1:4.06
Bt var. kurstaki (Delfin) 750 g/ha 7290.00 151.00 54.00 800.00 43,200.00 35,910.00 1:5.92
Spinosad 2.5 SC 20940.00 216.58 119.58 800.00 95,644.00 74,718.00 1:3.56
Quinalphos 25 EC 1440.00 237.79 140.79 800.00 1,12,632.00 1,11,192.00 1:78.21
Untreated control - 97.00 - 800.00 - - -
(A) Rate of insecticide applied: 1. Azadirachtin 300 ppm-200 Rs./lit; 2. Azadirachtin 1500 ppm- 350 Rs./ha; 3. NSKE 5%- 15 Rs./ Kg; 4. Btk (Delfin)-
3000 Rs./kg; 6. Spinosad 2.5 SC- 850 Rs./75ml ; 7. Quinalphos 25 EC- 300 Rs./lit.; (B) Labour charges 150 Rs./application; (C) Sprayer charges- 30
Rs./day
that spinosad was quite active chemical against insect pest.
Similar, results were also reported by Stanley, et al., 2006.
The data revealed that all the treatments except Btk
(Delfin) 500 g/ha were significantly superior over untreated
control (Table 2). Highest marketable yield (237.79 q/ha) and
maximum net profit (Rs. 1,11,192.00) was recorded from the
plot treated with the quinalphos followed by azadirachtin 1500
ppm, NSKE 5%, Btk. (delfin) 750/ha and azadirachtin 300 ppm,
Btk. (delfin) 500/ha and spinosad recorded the lowest because
of higher price. On the basis of Incremental cost benefit ratio
quinalphos was found to be most economical with 1: 78.21
C:B ratio.
ACKNOWLEDGEMENT
Authors are grateful to Dean and Director of Research
for allotting field for research work at central field of Sam
Higginbottom Institute of Agriculture, Technology and
Sciences, Allahabad.
LITERATURE CITED
Dhavan, A.K., Kumar, A. and Kumar, R. 2007. Relative toxicity of new
insecticides against Spodoptera litura. Ann. Pl. Protec. Sci., 15:
238-239.
Jat, M.C. and Bhardwaj, S.C. 2005. Combined effect of Bacillus
thuringiensis and SINPV with Malathion, decamethrin, and
azadirachtin against larvae of Spodoptera litura on cauliflower.
Ann. Pl. Protec. Sci., 13: 119-122.
Lal, O.P.; Sinha, S.R. and Shrivastava, Y.N. 2002. Evaluation of some
promising insecticides against the mustard aphid, Lipaphis erysimi
Kalt. on cabbage under field condition. Journal of Entomological
Reearch, 26: 169-173.
Paliwal, S. and Dadheech, L.N. 2001. Bioefficacy of spinosad against
the major pests of cauliflower, National Conference on Plant
Protection, (Abastr.) pp. 82.
Sachin, J.N. and Gangwar, S.K. 1980. Vertical distribution of important
pest of cole crops in Meghalaya as influenced by the environmental
factors. Indian J. Ent., 42(3): 414-424.
Satpathy, S.; Akhilesh kumar and Pandey, P.K. 2005. Chlorofenapyr: A
new molecule for diamondback moth (Plutella xylosrela L.)
management in cabbage. Ann. Pl. Protect. Sci., 13 (1): 88-90.
Singh, D., Verma, G.C. and Ramzan, M. 1976. A field evaluation of
some new insecticides against the diamondback moth, Plutella
xylostella. Indian J. Pl. Prot., 4 (1): 1117-1119.
Stanley, J., Chandrasekharan, S., Ragupathy, A. and Sheeba Jasmine, R.
2006. Baseline toxicity of emamectin and spinosad to Spodoptera
litura. Ann. Pl. Protec. Sci., 14: 346-349.
Talekar, N.S. 1992. Management of Diamondback moth and other
cruciferous pests: Proc. 2 nd Intl. workshop. Shanhua, Taiwan. Asian
Vegetable research and Development Center. pp. 603.
Recieved on 27.10.2010 Accepted on 15.11.2010

176 Trends in Biosciences 3 (2): 176-180, 2010 Trends in Biosciences 3 (2), 2010
Efficacy of Combined Action of Garlic Extract and Mint Oil Volatiles Against Ricemoth,
Corcyra cephalonica (Stainton) (Lepidoptera : Pyralidae)
P.H. PATHAK, * ARPITA PANDEY AND SANGITA PANDEY
*Entomology Laboratory, Department of Zoology, D.D.U., Gorakhpur University, Gorakhpur 273 009, Uttar
Pradesh
e-mail: paramhans.pathak@gmail.com, phpddu_gkp@rediffmail.com
ABSTRACT
Exposure of Corcyra cephalonica (Stainton) (Lepidoptera :
pyralidae) eggs to the combined action of Garlic (Allium
sativum ) extract and Mint (Mentha sp.) oil volatiles for 3,6,12
or 24 hours causes a significant reduction of varying degree
in eggs hatchability at 20,40,80 or 160µl volumes of both.
Severe reduction, both in egg output and egg hatchability,
occurred in this pest, when their larvae were exposed to 80
or 160 µl volume of extract and oil. It was observed that
continuous exposure to the volatiles for 30 days has most
significant effect than for first 15 days or from 16 th day for
15 days. When freshly emerged male and females were exposed
to the combined action of garlic extract and mint oil
volatiles, for 3 hours, a significant reduction in eggs laid /
egg hatchability were observed only at 160 µl volumes, while
significant increase in egg yield / egg hatchability were
noticed at 20 , 40 and 80 µl volumes of the both. However, if
the exposure period is increased for 6 hours, a significant
reduction in egg yield / egg hatchability were observed at
various volume of garlic extract and mint oil volatiles.
Glycogen, total lipids, total protein and Total free amino
acids level was reduced significantly, in testes and ovaries of
adults following their exposure to the combined action of
selected volatiles, emanating from 20, 40, 80 or 160 µl of
volume.
Key words
Corcyra cephalonica, reproductive potential, garlic,
mint oil volatiles.
The Rice moth, Corcyra cephalonica (Stainton) is a
major pest of stored grain commodities in the tropics.
Information is available pertaining to specified plant
components effect (Mani et al, 1993; Pathak et al 1994; Ansari
and Krishna, 1987) on the insect reproductive potential and
egg hatchability. However, nothing is known about the
changes that are likely to occur in the post embryonic
development and reproduction in this insect, by the combined
action of volatiles emanating from different sources, during
rearing or breeding. Therefore, it was thought desirable to
ascertain the impact of combined action of garlic (Allium
sativum ) extract and mint (Mentha sp.) oil volatiles on
different stages of C. cephalonica , for a stipulated period,
in terms of eggs laid and their hatchability, with respect to
embryonic development, effect on immature stages, effect
on mating pairs, and their subsequent impact on biochemical
estimation of glycogen, lipids, proteins and free- amino
acids in the gonads of such individuals.
MATERIALS AND METHODS
A rich standard culture of Corcyra cephalonica was
maintained in the laboratory on coarsely ground Jowar
(Sorghum vulgar (L.) Moench) containing 5% powdered
yeast (Mishra and Krishna, 1979). Newborn larvae thus
obtained, were then allowed to develop singly inside
muslin -capped glass vials (20 mm diameter, 50 mm height),
unless otherwise stated, on similar dietary medium into moths
for eventual use as experimental animal in the various tests
included in this study. Garlic ( Allium sativum ) extract was
prepared from the garlic bulb, after six month of their
harvest. The extract was strained through muslin cloth, after
squeezing the crushed material. The oil of mint was purchased
from Eastern Scientific Emporium, Alinagar, Gorakhpur;
manufactured by Camphor and Alloid Chemicals, Barelly.
In this experiment freshly laid eggs (

Pathak et al., Efficacy of Combined Action of Garlic Extract and Mint Oil Volatiles Against Rice-moth 177
insects were not exposed to the oil volatiles. The data procured
from adequately replicated experiments, were then subjected
to suitable statistical analysis (Paterson, 1939).
Testes and ovaries were taken out from laboratory -
reared unmated males and virgin females individuals ,
unexposed (control) / exposed to 20, 40, 80 or 160 µl volume
of garlic extract and mint oil volatiles for 6 hours . The
tissues of gonads, after isolating them from flowed out
haemolymph and other adhered visceral materials, were
subsequently , quickly shifted to separate glass plates for
obtaining their fresh weight. Glycogen was measured,
according to Anthrone method of Van der Vies, 1954. Method
of Folch, et al., 1957 was applied for the extraction of total
lipid, and its quantitative measurement was carried out by
applying the simple charring method of Marsh and
Weinstein, 1966. Total protein was estimated according to
method of Lowery, et al., 1951 and total Free amino acids
(FAA) was measured according to the method of Spies,
1957.
RESULTS AND DISCUSSION
Exposure of C. cephalonica eggs to the combined
action of garlic and mint oil volatiles for the 3 hours, a
Table 1.
Estimates of percent hatchability of eggs laid by
C. cephalonica following their programmed
exposure to different volumes of garlic extract and
mint oil volatiles.
Volume of oils / Percentage hatchability after exposure period
Extract ( in µl ) 3 hrs 6 hrs 12 hrs 24 hrs
0 (Control)
20
40
80
160
Mean
LSD 5%
1%
95.0 a
96.0 a b
92.0 b
87.0 c
80.0 d
90.0
3.3
4.5
95.0 a
95.4 a
92.0 b
83.4 c
77.8 d
88.7
2.9
3.9
95.0 a
92.0 a b
89.8 b
81.2 c
68.4 d
85.2
4.3
5.9
95.0 a
89.4 a
85.8 b
60.2 c
54.0 d
76.8
6.0
8.2
Mean followed by different letters differs significantly with control at
5% or 1% by
Least Significant Difference (LSD) test.
significant reduction in egg hatchability was noticed at 80
or 160 µl only (P

178 Trends in Biosciences 3 (2), 2010
reflect a “carry over” of the deleterious effect of the volatiles
from these oils on the developmental and reproductive
activities in the biology of this pyralid pest Pathak and
Krishna, 1991; Pathak, et al., 1994.
Egg yield during the first 4 days of oviposition by
mated females of Corcyra cephalonica in tests where, both
sexes were exposed to the combined action of garlic extract
and mint oil vapours, for 3 hours, the significant reduction
in eggs laid were observed only at 160 µl volume (P

Pathak et al., Efficacy of Combined Action of Garlic Extract and Mint Oil Volatiles Against Rice-moth 179
combined effect of garlic and mint oil volatiles regimen can
presumably be considered as a reflection of serious
dislocation brought about by such treatment, in the
physiological operations connected with the movement of
lipids, which under normal circumstances, occur from fat
body to ovary via haemolymph for the purpose of
vitellogenesis in the reproductive life of a female insect
(Bhola and Shrivastava, 1986 ; Shrivastava and Krishna,
1992; Dass, et al., 1993).
Total protein level was reduced significantly up to
85.67% , 75.02% , 67.61% and 48.89% of control, in testes
of adult males and up to 76.83% , 69.66%, 50.21% and
32.05% of control level in ovaries of adult females at the
exposure of different volume of garlic and mint oil volatiles
(Table 4). The protein level of testes and ovaries of C.
cephalonica was found to be reduced significantly with
the increasing volume of garlic extract and mint oil volatiles.
The decrease in protein level observed in present
investigation may be due to their degradation and possible
utilization for metabolic purposes . Decreased protein content
might also be attributed to the destruction or necrosis of
cells and consequent impairment in protein synthesis
machinery. The quantity of protein is depends on the rate
of protein synthesis or on the rate of its degradation. The
quantity of protein may also be affected due to impaired
incorporation of amino acids into polypeptide chains
(Rajeshwari Yadav, 2003).
Total free amino acids level was induced significantly
up to 115.38% , 131.74% and 156.35% of control in testes
and up to 118.97%, 161.33% and 199.95% of control, in
ovaries of C. cephalonica after 6 hours exposure to the
combined action of 40 , 80 or 160 µl volume of garlic and
mint oil volatiles ( Table 4 ). It was interesting to notice that
the total free amino acids (FAA ) level in the testes and
ovaries of adult moths, which were exposed in varying
volume of garlic extract and mint oil volatiles for 6 hours,
was found to be increased significantly, unlike glycogen ,
Table 4.
lipids and proteins level with the increasing volume of oils
, except 20 µl volume. The increased FAA level suggests
tissue damage probably due to increased proteolytic
activity under volatiles stress. However, the elevated levels
of total FAA can be utilized for energy production by
feeding them into the TCA cycle through amino transferase
reaction. The increase in the level of FAA can also be
attributed to the synthesis of Amino Acids in addition to
their elevation by protein hydrolysis. A third possibility
for increased FAA level might be due to transamination
and animation of keto acids .The accumulation of FAA can
also be attributed to user use of Amino acids and their
involvements in the maintenance of an acid – base balance
. (Rajeshwari Yadav, 2003).
Drastic reduction in total protein content and
simultaneous elevation in the level of total free amino
acids in these two tissues in the treated individuals of C.
cephalonica exposed to the different volume of said oils
seems to be the consequence of stress induced by such
treatment and suffered by this moth during either of these
two sexes.
It is quite likely to overcome this stress , the insect
uses energy derived from the breakdown of protein
circulating in ovary via haemolymph (Shrivastava and
Krishna , 1992). This clearly shows that the adaptive strategy
by C. cephalonica to tap energy through utilization of
protein is , in a broad sense, comparable to that noticed
in many insects subjected to stress of starvation
(Shrivastava and Krishna, 1992). It may also possible that
combined vapour action of selected volatiles might have
adversely affected the physiological mechanisms associated
with protein synthesis of testes and ovaries resulting in
the accumulation of low content of this chemical
constituent in these tissues. Alternatey, it may be stated that
increment in the total amount of FAA in the gonadal
tissue of treated females is indicative of the degradation
of ovary specific proteins ( Borovsky and Van – Handel ,
Changes in Glycogen level, total Lipids, total Protein and total Free Amino Acids (FAA) level ( in µg / mg) in the testis
and ovaries of adult males and females of C. cephalonica, unexposed (control) /exposed (treated) to the combined
action of garlic extract and mint oil volatiles for 6 hours.
Quantity of oils ( in µl )
Glycogen level Total lipids Total protein Total amino acids
Testis Ovary Testis Ovary Testis Ovary Testis Ovary
0
( Control )
2.17 ± 0.038
(100.00)
1.92 ± 0.037
(100.00)
43.57 ± 0.42
(100.00)
70.08 ± 0.14
(100.00)
35.67 ± 1.00
(100.00)
43.65 ± 1.02
(100.00)
18.65 ± 0.58
(100.00)
21.08 ± 0.53
(100.00)
20
1.69 ± 0.020** 1.20 ± 0.012** 34.87 ± 0.38** 52.39 ± 1.15** 30.56 ± 0.73** 33.54 ± 0.50** 19.39 ± 0.18** 22.72 ± 0.49**
(77.88) (62.50) (80.03) (74.75) (85. 67) (76.83) (103.96) (107.77)
40
1.32 ± 0.016** 0.68 ± 0.025** 30.39 ± 0.55** 35.73 ± 0.69** 26.76 ± 0.51** 30.41 ± 0.71** 21.52 ± 0.47** 25.08 ± 0.89 NS
(60.82) (35.41) (69.74) (50.98) (75.02) (69.66) (115.38) (118.97)
80
1.08 ± 0.033** 0.412 ± 0.014** 25.15 ± 0.47** 27.55 ± 0.82** 24.12 ± 0.74** 21.92 ± 0.45** 24.57 ± 1.00** 34.01 ± 0.87**
(49.76) (21.45) (57.72) (39.31) (67.61) (50.21) (131.74) (161.33)
160
0.926 ± 0.023** 0.20 ± 0.008** 21.25 ± 0.41** 19.52 ± 0.53** 17.44 ± 0.73** 13.99 ± 0.49** 29.16 ± 1.24** 42.15 ± 0.71**
(42.67) (10.41) (48.77) (27.85) (48.89) (32.05) (156.35) (199.95)
· Values are mean ± SE of five replicates, Values in parenthesis are percent change with control taken as 100 percent.
· NS = not significant, *significant (P< 0.05) and **significant (P

180 Trends in Biosciences 3 (2), 2010
1980) . This appear to be yet another type of physiological
adjustment displayed by C. cephalonica in response to
oil vapour stress .
Exposure of adult male and female individuals of C.
cephalonica to the 20 µl volume of garlic extract and mint
oil volatiles significantly elevated the glycogen , lipids ,
proteins and reduced FAA content in the testes and
ovaries of these individuals. It seems that the volatiles
present in the aroma of these oils have stimulated the
physiological mechanism (presumably neuro-endocrinally
based) associated with glycogen, lipid and protein / FAA
synthesis of these tissues – the sites where this activity
nomally occurs (Dass et al. 1993) – resulting in the
accumulation of high titre of glycogen , lipid and protein
or low titre of FAA in these tissues.
The applied significance of these findings lies in the
formulation of appropriate technology from which quantity
of these volatiles can be maintained in population areas ,
particularly in house – holds.
ACKNOWLEDGEMENT
The work is financially supported by University Grants
Commission, New Delhi, from research project No. F. No. 34 –
414/ 2008 (SR) provided to PHP.
LITERATURE CITED
Beenakkers, A.M.T., Vander Horst, J. and Van Marrewijk, W.J.A. 1981.
Role of lipids in energy metabolism. In: (eds R.G.H. Downer)
Energy metabolism in insects, Plenum Press, New York, pp. 53–
100.
Bhola, R. K. and Shrivastava, K. P. 1986. Electrophoretic analysis of
the proteins of haemolymph, fat body and ovaries in the red
cotton bug, Dysdercus koengii (Heteroptera : Pyrrhocoridae )
during the first egg cycle. In: Recent Advances in Insect
Physiology, Morphology and Ecology (eds. Pathak S. C. and
Sahai Y. N.), Today and Tommorow’s Printers and Publishers,
New Delhi, pp. 71-80.
Borovsky, D. and Van Handel, E. 1980. Synthesis of ovary specific
proteins in mosquito. Int. J. Invertebr. Reprod., 2: 153–164.
Dass, I.J. Singh, R.P. and Krishna, S.S. 1993. Postembryonic
developmental schedule and reproduction of Erias vitella (F.)
(Lepidoptera : Noctuidae) under the influence of volatile substances
from yellow oleander flowers (Thevetia peruviana (Pers.),
Apocynaceae). Phytophaga, 5: 69-75.
Downer, R.G.H. 1985. Lipid Metabolism. In: Comprehensive Insect
Physiology Biochemistry and Pharmacology (eds. Kerkut G. A.
and Gilbert L.I.), Pergamon Press, Oxford, Vol. 10, pp. 78-104.
Downer, R.G.H. and Mathews, J. R. 1976. Pattern of lipid distribution
and utilization in insects. Amer. Zool., 16: 733-745.
Feeny, F., Rosenbery, L. and Carter, M. 1983. Chemical aspects of
oviposition behavior in butterflies. In: Herbivorous insects. Host
– seeking behaviour and mechanisms. (ed. S. Ahmad) Academic
Press, New York, pp. 27-76.
Folch, J., Lees, M. and Sloane, Stanley, G.H. 1957. A Simple method
for isolation and purification of total lipids from animal tissues.
Journey of Biological Chemistry, 226: 497 – 507
Gilbert, L. I. and Chino, H. 1974, Transport of lipids in insects . J.
Lipid Res., 15: 439–456.
Harrow, I. D., Quartararo, P., Kent, K. S. and J. G. Hilderbrand. 1983.
Central projections and possible chemosensory function of
neurons in a sensory organ on the labial palp of Manduca sexta.
Soc. Neurosci. (Abstr.), 9: 216.
Krishna, S.S. 1988. Impact of botanicals on the breeding potential
of some insect pests of some malvaceous crops. In : (eds. T. N.
Ananthakrishnan and A. Raman).
Lowry, O. H., Rosebrough, N. J., Farr, A. L. and Radall, R. J. 1951.
Protein measurement with folin phenol reagent. J. Biol. Chem.,
193: 265–275.
Mani, H. C., Pathak , P.H. and Krishna S.S. 1993. Effect of odours
of certain plant oils or leaves on the egg hatchability in C.
cephalonica (Stainton) ( Lepidoptera : Pyralidae) .Annals. of
Entomology, 11(2): 59-65.
Mishra, S. N. and Krishna, S. S. 1979. Influence of some specific time
and age related mating schedules on oviposition and egg
fertility in Corcyra cephalonica Staint. (Lepidoptera : Galleridae).
Entomon, 4: 197-199.
Paterson, D. D.1939. Statistical Technique in Agricultural Research
M.C . Graw- Hill New York.
Pathak, P. H., Gurusubramanian, G. and Krishna, S. S. 1994. Changes in
post - embryonic development and reproduction in Corcyra
cephalonica (Stainton) (Lepidoptera : Pyralidae) as a function of
Eucalyptus and Neem oil vapour action during or on adult. Z.
Ang. Zool., 80: 345-352.
Pathak, P.H. and Krishna, S.S. 1985. Neem seed oil a capable
ingredient to check rice moth reproduction. Z. Ang. ent., 100:
33-35.
Pathak, P.H. and Krishna, S.S. 1986. Reproductive eficiency in Earias
vitella. (F.) (Lepidoptera : Noctuidae) affected by neem oil
vapour. Appl. Ent. Zool., 21(2): 347-348.
Pathak, P.H. and Krishna, S.S. 1991. Postembryonic development and
reproduction in C. cephalonica (Stainton) (Lepidoptera : Pyralidae)
on exposure to eucalyptus and neem oil volatiles. J. Chemical
Ecology, 17(12): 2553-2558.
Piltz. H. 1977. Corcyra cephalonica (Stainton ) : In: (eds. J. Kranz, H.
Schmutterer and W. Koch), Diseases, Pests and Weeds in Tropical
Crops. Verlag Paul Preey, Berlin and Hamburg, pp. 439-440.
Ramamurty, P. S. 1968. Origin and distribution of the scorpian fly
Panorpa communis. J. Insect Physiol., 14: 1325-1330.
Shrivastava, Sudhendu, K. and Krishna, S. S. 1992. Eucalyptus oil odour
treatment effects on biochemistry of some tissues of female nymphs/
adults of Dysdercus koenigii. Insect Sci. Applic., 13(1): 145-149.
Tabashnik, B.E. 1987. Plant secondary compounds as oviposition
deterrants for cabbage butterfly Pieris rapae (Lepidoptera :
Pieridae) . J. Chem. Ecol., 13: 309-316.
Spies, Joseph, R. 1957. Colorimetric procedures for amino acids. In:
(eds. S.P. Colowick and N.O. Kaplan). Methods in Enzymology.
3: 467–471. Academic Press, New York
Van Der Vies, J. 1954. Two methods for the determination of Glycogen
in liver. Biochem. J., 57: 410–416.
Recieved on 11.10.2010 Accepted on 12.11.2010

Trends in Biosciences 3 (2): 181-183, 2010
Genetic Divergence in Lentil (Lens culnaris Medik)
S. D. TYAGI, M. H. KHAN AND S. A. DAR
Department of Plant Breeding and Genetics, Kisan (P.G.) College, Simbhaoli, Ghaziabad, (U.P.)
e-mail: ubaid_dar@rediffmail.com
ABSTRACT
Fifty genotypes of lentil (Lens culnaris Medik) were evaluated
for obtaining information regarding genetic divergence
through Mahalanobsis D 2 statistics analysis. The analysis of
variance revealed significant differences among the genotypes
for all the traits. All the 50 genotypes were grouped into 7 nonoverlapping
clusters. The cluster IV comprised of maximum
number of genotypes (13), while cluster III included only 3
genotypes. The intra-cluster distance ranged from a maximum
of 2.301 for cluster II to a minimum of 1.543 for cluster VII,
while the inter-cluster distances varied from 5.234 (maximum)
between cluster IV and I to 2.654 (minimum) between cluster II
and I. Highly divergent and better performing genotypes L 4598,
L 414, DPL 59, PL 81-18 and L 830 were identified on the basis of
their high cluster mean values and those may be used in
hybridization programmes for the development of high yielding
varieties of lentil.
Key words
Lentil, intra-, inter-cluster distances, genetic
divergence.
The study of genetic diversity among genotypes is
helpful in formulating effective crop breeding strategy. Genetic
divergence has been studied in lentil (Sultana, et. al., 2005)
and various other crops like sugarcane (Kashif and Khan,
2007), wheat (Ashraf, et. al., 2003), oilseeds (Arshad, et. al.,
2003) and legumes (Ghafoor and Ahmad, 2005). In the present
study an attempt was made to select divergent parents for
future use in improvement of lentil.
MATERIALS AND METHODS
The materials for the present investigation comprised
of 50 lentil genotypes of diverse origin which were procured
from NBPGR, New Delhi. The seeds were sown in randomized
complete block design with three replications at the Research
Farm of Kisan (PG), College, Simbhaoli (28 0 N, 51 0 E), Ghaziabad
(UP) during rabi season of 2008-09. Each individual plot
consisted of 2 rows of 3 mt length with 20 cm and 10 cm
spacing between and within rows, respectively. Recommended
doses of fertilizers were applied and all necessary precautions
including irrigation, weed control and pest control
management were followed.
Data were recorded on 11 agronomical characters namely
days to 50% flowering, days to maturity, primary branches
plant -1 , secondary branches plant -1 , number of pods plant -1 ,
plant height (cm), seeds pod -1 , biological yield plant -1 (g), seed
yield plant -1 (g), 100-seed weight (g), and harvest index (%)
from 10 randomly selected plants in each genotype at various
phenophasis of the crop. Days to 50% flowering and days to
maturity were recorded on plot basis. The data were subjected
to multivariate analysis as suggested by Mahalanobis, 1936
and genotypes were grouped into different clusters based on
Tocher’s method Rao, 1952.
RESULTS AND DISCUSSION
The analysis of variance revealed presence of
considerable amount of variability among lentil genotypes
under investigation (Table 1). Substantial amounts of variation
in lentil for different agronomic traits have also been reported
earlier by Rahul, et al., 2007; Sanjeev, et al., 2008 and Kakde,
et al., 2008.
On the basis of D 2 statistics, all the 50 genotypes were
grouped into seven non-overlapping clusters (Table 2). The
pattern of distribution of the genotypes into different clusters
showed considerable genetic divergence. It can be seen from
the table that maximum number of genotypes (13) were
included in cluster IV followed by 8 genotypes in cluster I, 7
genotypes each in cluster II and VI, 6 genotypes each in cluster
V and VII and 3 genotypes in cluster III. The pattern of group
constellation shows that geographical diversity was not related
to the genetic diversity, which may be attributed to the
distribution of different gene constellation into a geographical
region. Genetic diversity among genotypes belonging to the
same geographical region might be due to different adaption
selection criteria, selection pressure and environments (Hair,
et al., 1998)
Table 1.
Analysis of variance for 11 traits of 50 genotypes of lentil
Clusters df Days to
50%
flowering
Days
to
maturity
Primary
branches
plant -1
*, ** = Significant at P= 0.05 & P= 0.001, respectively
Secondary
branches
plant -1
Number of
pods
plant -1
Plant
height
(cm)
Seeds
pod -1
Biological
yield plant -1
(g)
Seed
yield
plant -1
100-seed
weight
(g)
Harvest
index
(%)
Replication 2 61.66 10.50 2.007 1.85 2.00 0.09 0.207 1.89 0.204 0.117 1.79
Genotypes 49 637.34** 868.66** 0.466** 4.48** 800.51** 34.61** 0.111* 79.04** 7.362** 8.384** 41.49*1.66
Error 98 8.87 1.66 0.204 0.40 29.42 1.94 0.102 3.02 0.339 0.053 17.51

182 Trends in Biosciences 3 (2), 2010
The intra- and inter-cluster distance values are given in
Table 3. The intra-cluster distance varied from a maximum of
2.301 for cluster II having 7 genotypes to a minimum of 1.543
for cluster VII having 6 genotypes. This suggested that
genotypes occupying the same cluster have low level of
diversity and selection of parents within the cluster may not
be considered promising for developing good segregants
through hybridization programme. Generally, the genotypes
within a group showed little divergence from each other than
from the genotypes of different groups as has been observed
by Asghar, et al., 2010, Sirohi, et al., 2007, Sultana, et al., 2005,
Kumar, et al., 2004 and Solanki, et al., 2007. Hybridization
among the genotypes of same group may not be fruitful.
Variation within the group may be due to different genetic
make up of the genotypes and different sources of collection
as reported by Bharawadraj, et al., 2001.
The inter-cluster distance varied from 5.234 between
cluster IV and I to 2.654 between cluster II and I. Therefore,
hybridization between lines selected from different clusters is
likely to produce more heterotic hybrids. The relative
divergence of each cluster from other cluster (i.e., inter-cluster
distance) has been of high order and divergence particularly
between the members of cluster IV with members of all other
clusters (Table 3). The large inter-cluster distance between
members of any two clusters indicates that genotypes falling
in such clusters would be more genetically divergent.
Therefore, the crosses between genotypes selected from those
clusters may give desirable transgressive segregants.
The desirable genotypes within the divergent clusters
can be identified on the basis of the mean performance of
individual genotypes within the clusters. The average cluster
means for different characters are presented in Table 4. The
data exhibited that cluster IV and I were divergent from other
clusters as well as among themselves. Cluster IV showed
highest mean values for a number of characters including
primary branches plant -1 , pods plant -1 and second highest
mean values for secondary branches plant -1 , biological yield
plant -1 and seed yield plant -1 . From this cluster L 4598 and L
414 can be selected for these traits. Likewise, cluster I showed
lowest mean values for days to maturity, plant height and
highest mean values for harvest index. From this cluster DPL
59, PL 81-18 and L 830 can be selected for these traits. Thus
hybridization between these identified genotypes (Table 4)
for distant clusters would result in maximum vigour and
highest number of transgressive segregants.
The findings of the present study suggested that the
material involved in this investigation had sufficient amount
of diversity for important agronomic characters. Diversity
between clusters may be exploited in two ways, either by
resorting to hybridization which subsequently would result
into the development of superior lines or by selection of traits
Table 2.
Distribution of 50 genotypes of lentil in different clusters
Clusters Number of genotypes Genotypes included
I 8 L 830, PL 234, K 75, DPL 59, PL 81-18, LC 163-4-1, Pl 81-59, PL 81-53
II 7 L 362, PL 81-10, Pl 81-1, PL 81-611, MC 6, Pusa 4, P 22201
III 3 PKVL 1, L 393, L 412
IV 13 L 308, L 306, L 4676 L 386, L 381, L 4594, L 4148, L 4598, L 4147, L 4596, L 414, L 416, L 310
V 6 L 307, L 4595, L 46-74, L 309, L 4618, L 4620
VI 7 JLS 1, L 4672, L 4671, L 395, PL 81-41, L 1304, PL 81-71
VII 6 L 415, L 4677, L 32225, L 4597, L 4661, L 417
Table 3.
Average inter- and intra distances involving 50 genotypes of lentil
Clusters I II III IV V VI VII
I 1.744
II 2.654 2.301
III 4.191 4.515 1.871
IV 5.234 5.051 4.092 1.618
V 4.162 4.614 4.366 2.776 1.912
VI 3.207 3.865 3.912 4.305 3.099 2.249
VII 5.130 5.131 4.161 3.081 2.966 4.574 1.543
Table 4.
Clusters
Cluster mean values for 11 agro-morphological traits
Days to
50%
flowering
Days
to
maturity
Primary
branches
plant -1
Secondary
branches
plant -1
Number of
pods
plant -1
Plant
height
(cm)
Seeds
pod -1
Biological
yield plant -1
(g)
Seed
yield
plant -1
100-seed
weight
(g)
I 81.17 111.42 2.54 6.04 50.62 26.38 1.33 9.97 3.51 1.77 35.79
II 82.62 111.95 2.67 8.76 67.38 26.29 1.33 10.51 3.34 1.84 32.26
III 61.67 127.00 2.22 5.44 80.78 84.22 1.22 14.93 4.38 3.18 29.34
IV 96.49 147.92 3.10 6.31 81.13 32.03 1.03 19.72 5.98 4.45 30.35
V 90.89 142.39 2.94 5.50 58.83 26.06 1.11 16.27 4.91 5.93 30.22
VI 84.43 132.67 2.76 5.33 48.05 27.38 1.10 10.74 2.83 2.41 26.67
VII 61.28 137.61 3.11 6.06 78.22 26.28 1.00 21.34 6.57 4.94 30.73
Harvest
index
(%)

Tyagi, et al., Genetic Divergence in Lentil (Lens culnaris Medik) 183
related to divergence and using as such. However, the first
approach would be more beneficial.
Also from the above results one can foresee which
genotype is undesirable or otherwise weak in some traits and
can identify the desirable cross combinations. The information
furnished here will be helpful to the breeder in the selection of
superior genotypes which may be directly improved or utilized
as parents in hybridization program for the development of
future varieties as depicted by Sultana, et al., 2005.
LITERATURE CITED
Arshad, M., Bakhsh, A., Zubair, M.and A. Ghafoor. 2003. Genetic
variability and correlation studies in Chickpea (Cicer arietinum
L.). Pak. J. Bot., 35(4): 605-611.
Asghar, M. J., Abbas, G., Shah, T. M. and Atta, B. M. 2010. Study of
genetic diversity in some local and exotic lentil (Lens culinaris
Medik) genotypes. Pak. J. Bot., 42(4): 2681-2690.
Ashraf, M., Qureshi , A.S. and Ghafoor, A. 2003. Genetic diversity in
wheat under different cropecological zones. Pak. J. Bot., 35(4):
597-603.
Bharawadraj, C., Satyavath, C.T. and Subramanyam, D. 2001.
Evaluation of different classificatory analysis methods in some
rice (Oryza sativa L.) collections. Indian J. Agric. Sci., 71(2): 123-
125.
Ghafoor, A. and Ahmad, Z. 2005. Diversity in blackgram (Vigna mungo
(L) Hepper) for Agronomic traits and total seed protein analysis.
Acta Biologica Cracoviensio Series Botanica, 47: 1-7.
Hair, J. F., Anderson, R. E., Tatham, R. L. and Black, W. C. 1998.
Multivariate Data Analysis, 5 th ed. Pruntice-Hall International, IMC.,
London. http://www.icarda.cgiar.org
Kakde, S. S., Jadhav, R. N. and Deshmukh, J. D. 2008. Studies on
genetic variability, heritability and genetic advance in lentil (Lens
culnaris Medik). International Journal of Plant Science, 3(1):
229-232.
Kashif, M. and Khan, F.A. 2007. Divergence in sugarcane (saccharum
officinarum l.) based on yield and quality traits. Pak. J. Bot., 39(5):
1559-1563.
Kumar, R., Sharma, S.K., Malik, B.P.S., Sharma, A. and Sharma, R.
2004. Genetic diversity in lentil (Lens culnaris Medik). Legume
Research, 27(2): 111-114.
Mahalanobis, P.C. 1936. On the generalized distance in statistics. Proc.
Nat. Inst. Sci. India, 2: 49-55.
Rahul, S., Sharma, P. and Brar, J. S. 2007. Genetic studies for physiological
traits and their relationship with seed yield in lentil. Journal of
Food Legume, 20(1): 29-32.
Rao, C.R. 1952. Advanced Statistical Methods in Biometric Research.
John Wiley and Sons Inc. New York, pp. 390.
Sanjeev, K., Srivastava, S. B. I. and Malik, I. P. S. 2008. Genetic variation
and inter-relationship of yield and its component traits in lentil
(Lens culnaris Medik). Legume Research, 31(3): 8-13.
Sirohi, S.P.S., Yadav, R. and Meenakshi, S. 2007. Assaying genetic
divergence for morpho-physiological traits in lentil (Lens culnaris
Medik). Plant Achieves, 7(1): 331-333.
Solanki, I.S. 2007. Divergence analysis in lentil (Lens culnaris Medik).
National Journal of Plant Improvement, 9(2): 123-125.
Sultana, T., Ghafoor, A.and Ashraf, M. 2005. Genetic divergence in
lentil germplasm for botanical descriptors in relation with geographic
origin. Pak. J. Bot., 37(1): 61-69.
Recieved on 28.09.2010 Accepted on 15.11.2010

Trends in Biosciences 3 (2): 187-189, 2010
Study on Genetic and Seed Quality Parameters in Horsegram Genotypes under Mid
Hills of North Western Himalaya
PRABHA SHANKAR SHUKLA, RAJENDRA PRASAD, AND SAMBHOO PRASAD
Department of Seed Science & Tech., GBPUA&T, Hill Campus, Ranichauri, 249 199, Tehri Garhwal,
Uttarakhand,
e-mail: ps.shukla@rediffmail.com
ABSTRACT
The present investigation was undertaken on 11 genotypes to
identify stable genotypes with better seed quality parameters
which are responsive to mid hill conditions of the north western
Himalaya. The observations were recorded on five randomly
selected plants/seedling in each replication for seventeen field
and laboratory parameters. The highest mean value was
recorded for plant height in genotype PRH 03 followed by PRH
06, highest number of branches in PRH 01, pod length in PRH
6, number of seeds/pod in PRG 7 followed by PRH 10 and VL
Gahat 1, pods/plant, seed yield/plant and seed yield/hectare in
VL Gahat 1 followed by PRH 10.The mean performance of seed
quality parameters were highest for seedling length, seedling
fresh weight in genotype PRG 04 followed by PRH 03, PRH
01.The highest germination per cent and first count were
recorded for PRH 01. Seed yield was associated with pod length,
plant height number of pods/plant and seed yield/plant. The
pod length, plant height and number of seeds/pods were found
to be most important characters for genetic improvement. It
can be concluded that the genotypes PRH 01, PRH 10 along
with VL Gahat 1 can be used in future crossing programme to
develop superior high yielding genotypes.
Key words
Horse gram, genetics, genotypes, heritability, seed
quality
Horsegram (Macrotyloma unifloram Lam.Verde.) is a
popular crop raised in north western Himalaya widely grown
on marginal and degraded land. Very limited information is
available on genetic improvement and seed quality parameters
in horsegram. The present investigation was carried out with
the objective of partitioning the observed variability in seed
vigour traits and seed yield of horse gram germplasm in to
heritable and non-heritable components and estimating the
broad sense heritability with genetic advance expected from
selection as a per cent of mean of a set of seed vigour trails
and seed yield.
MATERIALS AND METHODS
The present investigation was carried out during the
Kharif season in Research Block of Seed Science and
Technology, GBPUA&T, Hill Campus, Ranichauri, Tehri
Garhwal, Uttarakhand. The seeds of local germplasm were
collected from different parts of the Uttarakhand and evaluated
along with check variety VL 7. Seeds of each germplasm were
divided in to two part one part is subjected to field trails and
other part is laboratory trails. The experiment was laid out in a
RBD with three replications and each genotype were grown
in a five row of 2 m length of per replication with a spacing of
30X10 cm. All pre and post stand establishment management
was done as required. Data of five randomly selected plants
of each genotype of each replication were recorded viz., plant
height, number of branches -1 , number of pods -1 , number of
seed pod -1 , pod length, seed yield plant -1 and seed yield ha. -1 .
After harvesting seeds were subjected to laboratory tests
and experiment were laid out to CRD with three replications.
100-seeds were placed between the moist paper towel methods
prescribed by ISTA in 1985. First as well as final count of
germination was counted in 4 th and 8 th days respectively and
ten seedlings were selected randomly from each replication of
each treatment to measured the seedling vigour parameters
i.e. root, shoot as well as seedling length, fresh and dry weight
of seedlings while, vigour index I (standard germination X
seedling length) and vigour index II (standard germination X
seedling dry weight) were calculated as per the methods
suggested by Abdul Baki and Anderson, 1973.
The data on each traits were subjected to analysis of
variance which was used to partition the gross (phenotypic)
variability in to the components due to genetic (hereditary)
and non-genetic (environmental) factors and to estimate the
magnitude of these. Variance components (genotypic,
phenotypic and error of variance) were estimated using the
formula of Wricke and Weber, 1986 and Prasad, et al., 1981 as
follow:
Vg =
[MSG - MSE]
, Vp =
r
[MSG] , Ve =
r
[MSE]
r
Where, MSG, MSE and r are the mean squares of
genotypes, mean squares of error and number of replications
respectively, phenotypic (PCV) and genotypic (GCV)
coefficient of variation were evaluated according to the
method of Burlon, 1952, Johnson, et al., 1955 and Kumar , et
al., 1985 as :
PCV = [ vp/X ] X 100, GCV = [ vg/X ] X 100
Where, Vp, Vg and X are the phenotypic variance,
genotypic variance and grand mean respectively for the

188 Trends in Biosciences 3 (2), 2010
characters under the consideration. Broad sense of heritability
(h 2 B) expressed as the percentage of the ratio of the genotypic
variance (Vg) to the phenotypic variance (Vp) was estimated
on genotypic mean basis as described by Allard, 1999. Genetic
advance (GA) expected and GA as per cent of the mean
assuming selection of the superior of the genotypes were
estimated in accordance with the methods of illustrated by
Fehr, 1987 as under
GA = K (Sp)h 2 B
GA (as per cent of the mean) = (GA/X) X 100
Where, K is a constant (which varies depending upon
the selection intensity and if the latter is 5 % it stand st 2.06)
Sp, is the phenotypic standard deviation (
heritability ratio.
RESULTS AND DISCUSSION
vp ), h 2 B is the
The analysis of variance revealed significant differences
among the genotypes of horse gram for all the studied traits.
This indicated the presence of good amount of genetic
variability and considerable scope for their improvements.
The genotypes showed significant difference in respect
of all the characters studied. A wide range of phenotypic
variation was noticed in plant height, number of pods per
plant, seed yield per hectare. First counts, standard
germination, roots, shoot as well as seedling length, fresh
and dry weight of seedling, vigour indexes I and II. The
estimate of genotypic coefficient of variation and phenotypic
coefficient of variation provide a better comparison of the
characters regarding the extent of genetic variation. The height
phenotypic coefficient of variation was recorded in plant height
(99.20), number of seeds per pod (95.50), 100-seed weight
(80.90), fresh weight (59.00) and dry weight of seedling (51.30)
and vigour index II (59.80). However, the genotypic coefficient
of variation combined genotypic variance with the units of
measurement and the mean of characters. The maximum GCV
were estimated in plant height (79.60), number of seeds per
pod (83.20), pod length (95.50), 100-seed weight (72.40), fresh
weight (53.70) and vigour index II (54.80). Higher and
moderated GCV indicated the worthwhile improvement could
be achieved for such characters through simple selection.
The lower GCV of some characters indicated them to be less
amenable to improvement in the selection (Table 1).
The phenotypic coefficient of variability was generally
higher than genotypic coefficient of variability for all the traits
except pod length. Similar trend was reported by Gupta and
Godawat, 1981, Satapathi, et al., 1987 for linseed, Baye, 2002
for V. galamensis and Venkateshwarlu, 2001 for green gram.
This suggests that environmental effects constitute a major
portion of the total phenotypic variation in some traits. Thus
the selection of superior genotypes based on such traits
would not be effective.
The estimate of heritability in board sense ranged from
53.30 per cent for seedling length to 97.80 per cent for number
of pods per plant. The higher heritability estimates for all the
traits indicated that environmental factors did not greatly
affect phenotypic variation for the traits, rather genetic
constitution of the genotypes responsible for the variations.
This finding is conformity with the findings by Johnson, et
al., 1955 because such characters are mostly controlled by
additive gene action. Genetic advance (GA) as percentage of
mean ranged from 1.04 per cent for seed yield per plant to 9.79
per cent for plant height. The variation in 10 local germplasm
along with check variety in seed vigour and yield traits
suggests that selection for several of these characters may be
Table 1.
Estimates of phenotypic, genotypic, environmental variance, coefficient of variability in broad sence (h 2 ) and genetic
advance in per cent of mean (Ga) under field and controlled condition.
S.
No.
Characters PCV GCV ECV Heritability in Broad
sence (h 2 )
Genetic advance in
% of mean (Ga)
1. Plant height (cm) 99.20 97.60 17.40 96.80 9.79
2. No. of branches per plant 17.40 13.60 10.80 61.20 1.34
3. No. of pods per plant 28.10 27.80 41.30 97.80 6.85
4. No. of seeds per pod 95.50 83.20 46.80 75.90 7.06
5. Pod length (cm) 10.40 95.50 42.10 83.70 9.55
6. Yield/plant (g) 31.17 30.35 7.08 94.83 1.04
7. Yield/Hectare(Kg) 31.04 30.14 7.43 94.27 3.43
8. 100-seeds weight (g) 83.90 72.40 42.20 74.60 3.81
9. First count (%) 26.20 25.60 54.70 95.60 3.54
10. Germination (%) 15.80 15.40 35.90 94.80 2.55
11. Root length (cm) 17.00 16.30 50.10 91.30 5.06
12. Shoot length (cm) 25.20 22.60 11.20 80.20 2.92
13. Seedling length (cm) 19.80 14.40 13.50 53.30 4.49
14. Fresh weight (g) 59.00 53.70 24.40 82.80 4.59
15. Dry weight (g) 51.30 45.10 24.40 77.30 2.49
16. Vigour index I 28.90 23.90 16.30 68.90 7.07
17. Vigour index II 59.80 54.80 24.00 83.90 3.08
PCV = Phenotypic coefficient of variation, GCV = Genotypic coefficient of variation, ECV = Environmental coefficient of variation

Table 2.
Parameters/
Treatment
SHUKLA et al., Study on Genetic and Seed Quality Parameters in Horesegram Genotypes 189
Mean performance of horse gram genotypes of seed quality parameters under laboratory condition
Plant
height
(cm)
No. of No. of
branches pod/
plant
Pod
length
(cm)
No. of
seed/
pod
Seed
yield
/plant
Yield/ha
(kg)
100-
seed
weight
(g)
First Germination
count (%)
Root
length
(cm)
Shoot
length
(cm)
Seedling
length
(cm)
PRH 01 51.73 8.33 14.83 4.96 4.30 1.92 641.10 3.01 81.66 92.66 13.60 6.06 19.66 0.76 0.22 1814.86 21.00
PRH 02 50.09 5.33 12.80 5.06 4.23 1.41 472.21 2.64 78.66 90.00 13.20 5.73 18.93 0.65 0.17 1706.13 15.92
PRH 03 57.70 5.73 15.03 5.43 4.76 2.15 715.66 3.00 85.66 96.66 17.53 6.60 24.13 0.69 0.15 2336.93 15.13
PRH 04 40.46 6.80 10.70 5.43 4.43 1.25 416.66 2.65 84.33 90.00 18.33 6.46 24.80 0.84 0.16 2231.20 14.69
PRH 05 51.30 6.86 09.50 5.00 4.96 1.38 462.21 2.78 74.66 86.00 14.33 5.20 19.53 0.55 0.15 1662.26 12.73
PRH 06 53.30 5.36 07.63 6.50 4.50 1.02 342.21 2.99 36.33 69.00 11.33 6.20 17.53 0.53 0.15 1208.66 10.58
PRH 07 51.90 5.73 09.76 6.00 5.76 1.57 524.42 2.80 40.00 70.66 11.53 7.46 19.00 0.47 0.16 1353.80 11.57
PRH 08 48.66 5.33 08.09 4.83 4.76 1.26 419.99 2.99 73.00 85.00 15.46 8.73 24.20 0.46 0.12 2064.00 10.79
PRH 09 42.13 5.53 11.90 4.90 4.70 1.86 619.99 3.33 44.00 61.66 8.66 5.06 13.73 0.43 0.15 0865.13 09.12
PRH 10 48.00 6.20 14.13 4.93 4.80 2.21 637.21 3.27 55.00 75.00 16.66 7.93 24.26 0.48 0.16 1820.46 12.36
VL 7 48.53 5.86 18.66 5.26 4.86 2.76 921.10 3.05 67.66 85.33 11.93 11.46 24.06 0.64 0.12 2016.23 10.79
GM 49.43 6.09 12.09 5.30 4.73 1.71 561.30 2.95 65.54 82.00 13.87 6.99 20.89 0.59 0.15 1734.51 13.15
CD at 0.01 2.00 1054 1.16 0.51 0.51 0.29 152.48 0.27 18.27 12.21 6.21 2.57 6.95 0.87 0.52 657.98 4.48
CD at 0.05 1.47 1013 0.85 0.38 0.37 0.21 111.79 0.20 13.44 8.98 4.57 1.89 5.11 0.64 0.38 484.11 3.30
CV 1.74 10.88 4.13 4.21 4.65 7.43 11.69 4.04 12.11 6.47 19.46 15.98 14.46 6.42 14.25 16.48 14.81
Fresh
weight
(g)
Dry
weight
(g)
Vigour
index
I
Vigour
index II
effective. However, improvement efficiency is related to
magnitude of GCA, heritability and genetic advance. Higher
value of GCV, heritability and genetic advance is a possibility
of improving the genotypes through direct selection for most
of traits. Overestimation of genetic variation and heritability
are conceivable since the genetic variance include the total
genetic environment interaction variance. The use of is likely
to give a gross overestimation of the genetic advance likely
to be obtained though selection because of the influence of
heterozygosity.
From the present study it is evident that the local
germplasm collection had wide ranged of variability for
different traits coupled with high heritability and genetic
advance for important traits, hence selection is effective for
these traits. Early vigour may be used as one of the selection
criterion in breeding programme for yield improvement.
LITERATURE CITED
Abdul Baki, A. A. and Anderson, J. D. 1973. Vigour determination in
soybean seeds by multiple criteria. Crop Science, 13: 630-633.
Allard, R. W. 1999. Principles of plant breeding. 2 nd ed. New York. John
Wiley and Sons.
Baye, T. 2002. Genotypic and phenotypic variability in Vernomia
galamensis germplasm collected from Eastern Ethiopia. The Journal
of Agricultural Science, 139: 161-198.
Burlon, G. W. 1952. Quantitative inheritance in grasses. Proceeding of
the 6 th International Grassland Congress. 1: 272-283.
Fehr, W. R. 1987. Principles of cultivars developments. Vol. 1, New
York. Macmillan.
Gupta, S. G. and Godawat, S. L. 1981. An analysis of association of
characters of value in breeding linseed. Madras Agricultural Journal,
68: 426-430.
ISTA, 1985. International rules for seed testing. Seed Science and
Technology. 3(2): 299-355.
Johnson, H. W., Robinson, H. F. and Conmatack, R. E. 1955. Estimate
of genetic and environmental variability in soybean. Agronomy
Jounral, 47: 314-318.
Kumar, A., Misra, S. C., Singh, V. P. and Chaahan, B. P. S. 1985.
Variability and correlation studies in triticale. Journal of the
Maharastra Agricultural University, 10: 273-275.
Prasad, S. R., Prakash, R., Sharma, C. M. and Itaque, M. E. 1981.
Genotypic and phenotypic variability in quantitative characters in
oat. Indian Journal of Agricultural Science, 51: 480-482.
Satapathi, D., Misra, R. C. and Dhindas, G. S. 1987. Variability correlation
and path coefficient analysis in linseed. Journal of Oil Seed
Research, 4: 28-30.
Venkateshwarlu, O. 2001. Correlation and path analysis in greengram.
Legum Research, 24: 115-117.
Wricke, H. and Weber, W. E. 1986. Quantitative genetics and selection
in plant breeding. Berlin. Walter De Gruyler and Co.
Recieved on 9.10.2010 Accepted on 12.11.2010

184 Trends in Biosciences 3 (2): 184-186, 2010 Trends in Biosciences 3 (2), 2010
Comparative Biology of Sorghum Stem Borer, Chilo partellus (Swinhoe) (Lepidoptera:
Pyralidae) on Different Sorghum Genotypes/Cultivars
N.P. CHAVAN 1 , N.B. ROTE 2 , M.B. PATEL 1 AND S.V. SHINDE *
1
Department of Agricultural Entomology, N.M. College of Agriculture, Navsari Agricultural University, Navsari,
396 450, (Gujarat)
2
Main Sorghum Research Station, Navsari Agricultural University, Surat, 395 007, Gujarat
*e-mail: santnath@indiatimes.com
ABSTRACT
Laboratory experiment was conducted to study the comparative
biology of C. partellus on 10 different genotypes/cultivars of
sorghum at Department of Agricultural Entomology, N. M.
College of Agriculture, Navsari Agricultural University, Navsari,
Gujarat during the September-November 2003 under laboratory
conditions. The sorghum genotypes were sown at Sorghum
Research Station, Navsari Agricultural University, Navsari
which were used during comparative biology study of C. partellus.
In comparative biology study, the larval length and weight as
well pupal length and weight were recorded maximum on
susceptible genotypes (DJ 6514 and GJ 40) and minimum on
resistant genotypes(IS 18551 and IS 2205), while the larval and
pupal period was recorded as minimum on susceptible genotype
(DJ 6514 and GJ 40) and it was prolonged on resistant
genotypes(IS 18551 and IS 2205). The highest larval mortality
was recorded in resistant genotype IS 18551 (55.55%), while
other genotypes IS 2205, CSV 15, SR 770, SR 2458 and GJ 40
which showed resistant reaction against C. partellus recorded
the larval mortality ranging from 44 to 49 per cent and lowest
larval mortality was observed in susceptible genotype DJ 6514
(27.77%). Among the various genotypes the minimum female
longevity was observed when the larvae reared on IS 18551
(3.54 days), IS 2205 (4.00 days) and SR 2458 (4.00 days). However
the female longevity was maxim when the larvae were reared
on DJ 6514 (5.20 days).
Key words
Comparative biology, sorghum genotypes, Chilo
partellus
Spotted stem borer Chilo partellus (Swinhoe) is the
major important destructive lepidopterous pest of maize and
sorghum in many countries in Asia and Africa (Chatterji, et
al., 1969; Seshu Reddy, 1989). It is native to the India subcontinent,
but has spread from India to Africa is resulting in
the displacement of indigenous stem borers (Kfir, 1990;
Overholt, et al., 1994). In India C. partellus, causes great yield
losses up to 40 % in forage sorghum (Singh, 1997). The per
cent damage or population build up occurs more on preferred
or susceptible variety/cultivar, while the resistant variety/
cultivar generally less damaged/preferred by the pest. In
present experiment, 10 different genotypes/cultivars were
tested for recording the general growth and development of
sorghum stem borer Chilo partellus under laboratory
conditions to study comparative biology of C. partellus and
its response to different sorghum genotypes/cultivars to work
out the resistance or susceptibility status of these genotypes.
MATERIALS AND METHODS
To raise the initial culture of C. partellus in the laboratory
of Department of Agricultural Entomology, N. M. College of
Agriculture, Navsari, large number of C. partellus larvae were
collected from sorghum field of college farm during September-
2003. The collected larvae were reared under laboratory
condition individually in plastic bottle (5.0 x 4.5cm) on fresh
tender pieces of sorghum stem. Every day sufficient amount
of fresh pieces of tender stem were provided to C. partellus
larvae after removing the excreta and partially eaten stem pieces
from the plastic bottles, till the larvae attends pre-pupal stage.
Pupa were kept in separate plastic bottles for adult emergence.
Newly emerged adults from pupa were carefully released in
oviposition jar (20 x 15 cm) which was prepared by covering
inner wall and bottem of glass jar with paper and fresh sorghum
leaves were kept in jar for egg laying of C. partellus. The
adults were provided with 5 % sugar solution dipped cotton
swab as a food source. The open end of the oviposition jar
was covered with muslin cloth and tied rubber bands to avoid
escape of adults. The egg masses on sorghum leaves and
paper laid by C. partellus female were carefully collected and
transferred in hatching jar (20 x 15 cm). Hatching jar was
prepared by filling the glass jar ½ capacity with sand and
desired quantity of water added to maintain inside humidity.
The egg masses laid on paper and leaves were kept in petridish
with tender portion of leaves. Such prepared petridish along
with egg masses kept on moist sand surface in hatching jar
and the open end of jar was closed with finely perforated
polythene with pin holes.
Newly hatched 15 C. partellus larvae were released in
the leaf whorl of the respective genotype of sorghum (GJ-36,
GJ-38, GJ-40, CSV-15, SR-833, SR-770, SR-2458, IS-2205, IS-
18551 and DJ-5614) kept in separate properly labeled plastic
bottles. Three days later, the leaf whorls were dissected and
surviving larvae were counted and transferred to fresh leaf
whorl of respective genotypes/cultivars. C. partellus larvae
were reared on leaf whorls up to 6-8 days and thereafter they
were reared on stem pieces. The sufficient amount of fresh
pieces of tender stem were provided to C. partellus larvae
after removing excreta and partially eaten stem pieces from

Chavan, et al., Comparative Biology of Sorghum Stem Borer, Chilo partellus (Swinhoe) (Lepidoptera: Pyralidae) 185
plastic bottles, till the larvae attend pre-pupal stage. Pupa
were kept in plastic bottles for adult emergence and after
emergence the adults were reared by providing 5 % sugar
solution dipped cotton swab as a food source till there death.
The experiment was conducted using completely
randomized design with three replications. Following
observations on comparative biology of stem borer were
recorded.
RESULTS AND DISCUSSION
Influence of ten different sorghum genotypes/cultivars
on life cycle and different stages of stem borer C. partellus
was studied in detail and the results obtained are presented in
Table 1. The results of mean larval length reveled that the
length of larvae reared on genotype DJ 6541, a susceptible
check was significantly higher than all other tested genotypes/
cultivars.
The minimum larval weight was recorded in the larvae
reared on IS 2205 (0.156 g) which was at par with IS 18551
(0.157 g), GJ 38 (0.161 g) and CSV 15 (0.179 g) and it was
followed by SR 2458 (0.182 g) and SR 833 (0.184 g). the highest
larval weight (0.226 g), was recorded in the case of larvae
reared on DJ 6514, a susceptible check which was found at
par with GJ 40 (0.214 g), GJ 36 (0.210 g) and SR 770 (0.202 g)
which were found to be more preferred by C. partellus as
compared to the genotypes which show resistance reaction
against the pest C. partellus.
The total larval period recorded as maximum when the
larvae were reared on IS 18551 (22.44 days) which was found
as at par with GJ 40 (22.00 days), IS 2205 (21.93 days), SR 770
(21.66 days), CSV 15 (21.63 days) and GJ 38 (21.63 days). The
significantly lower larval period was recorded when the larvae
reared on the susceptible genotype DJ 6514 (16.71 days).
The significantly highest larval mortality (Fig. 1) was
recorded in resistant genotype IS 18551 (55.55%), which was
followed by IS 2205 (49.51%), CSV 15 (48.55%), SR 770
(46.27%), SR 2458 (44.44%) and GJ 40 (44.44%). The lowest
larval mortality was observed in susceptible genotype DJ 6514
(27.77%).
(S Em ± 0.614, C.D.@ 5% =1.812, C.V. % = 2.520)
Fig. 1. Mortality of C. partellus larvae on resistant and
susceptible genotypes of sorghum
The maximum pupal length was recorded of larvae reared
on IS 18551 (11.80 mm) and it was at par with IS 2205 (12.50
mm), SR 2458 (12.70 mm) and GJ 38 (12.70 mm). The other
genotypes in the order of merits were GJ 36(14.40 mm) and SR
770 (14.40 mm). The maximum pupal length was recorded in DJ
6514 (16.00 mm). Singh and Verma, 1988 also found the
maximum pupal length in susceptible genotype HC 136 (12.85
mm) and ICSV 1 (13.15 mm) and minimum pupal length in
resistant genotypes, IS 5469 (10.20 mm) and IS 2205 (10.80
mm), respectively. Sankpal,1994 also revealed that the minimum
pupal length in resistant genotypes, IS 18551 (13.3 mm) and IS
2205 (14.10 mm), while maximum pupal length in susceptible
genotype CSH 1 (17.00 mm).
Significantly lowest pupal weight was recorded when
the larvae were reared on IS 2205 (0.062 g), followed by IS
18551 (0.073 g,) GJ 38 (0.082 g) and GJ 40 (0.088 g). The pupal
weight when reared on SR 2458 (0.095 g), CSV 15 (0.098 g), SR
833 (0.100 g), GJ 36 (0.103 g) and SR 770 (0.104 g) were
Table 1.
Influence of resistant and susceptible genotypes on different stages of C. partellus
Name of genotype/
Larval
Pupal
Mean adult
cultivar
Mean length
(mm)
Mean weight
(g)
Mean larval period
(Days)
Mean length
(mm)
Mean weight
(g)
Mean pupal
period (Days)
female longevity
(Days)
GJ 36 20.80 0.210 21.20 14.40 b * 0.103 d 8.00 ab 4.57 c
GJ 38 18.00 0.161 21.63 12.70 a 0.082 bc 8.07 a 4.66 c
GJ 40 21.20 0.214 22.00 15.40 c 0.088 c 7.90 ab 4.50 c
CSV 15 17.80 0.179 21.63 15.33 bc 0.098 d 6.10 cd 5.00 d
SR 833 18.30 0.184 20.66 15.20 bc 0.100 d 7.53 b 4.50 c
SR 770 20.10 0.202 21.66 14.40 b 0.104 d 6.62 c 4.83 c
SR 2458 18.10 0.182 20.87 12.70 a 0.095 d 8.10 a 4.00 b
IS 2205 15.50 0.156 21.93 12.50 a 0.062 a 8.17 a 4.00 b
IS 18551 (R) 15.60 0.157 22.44 11.80 a 0.073 b 8.22 a 3.54 a
DJ 6514 (S) 22.40 0.226 16.71 16.00 c 0.120 c 5.86 d 5.20 d
S Em ± 0.340 0.008 0.389 0.323 0.003 0.193 0.110
C.D.@ 5% 1.005 0.024 1.149 0.952 0.010 0.568 0.325
C.V. % 3.141 7.641 3.201 3.980 6.584 4.479 4.265
*Figures denoted by same letters are not differing statistically from each other.

186 Trends in Biosciences 3 (2), 2010
significantly higher as compared to the other genotypes.
However the highest pupal weight was recorded when the
larvae were reared on DJ 6514 (0.120 g). These investigations
are in conformity with the findings of Singh and Verma, 1988.
They also found the maximum pupal weight on susceptible
varieties HC 136 and ICSV 1 (86.58 and 87.25 g respectively).
Sankpal, 1994 also reported the maximum pupal weight on
susceptible variety CSH 1 (0.105 g) and minimum on resistant
variety IS 2205 (0.052 g).
Maximum pupal period was recorded when the larvae
reared on IS 18551 (8.22 days), which wsa at par with IS 2205
(8.17 days), SR 2458 (8.10 days), GJ 38 (8.07 days), GJ 36 (8.00
days) and GJ 40 (7.90 days). However the highest pupal period
was recorded when the larvae reared on DJ 6514 (5.86 days), a
susceptible genotype, which was at par with CSV 15 (6.10
days). Sankpal, 1994 also reported the prolonged pupal period
on resistant genotype IS 2205 (5.83 days) and minimum pupal
period on susceptible genotype CSH 1 (6.57 days), which
confirms the present findings.
Among the various genotypes the minimum female
longevity was observed when the larvae reared on IS 18551
(3.54 days), which was followed by IS 2205 (4.00 days) and SR
2458 (4.00 days). The other genotypes recorded the significantly
higher adult longevity. However the female longevity was
maximized when the larvae were reared on DJ 6514 (5.20 days).
Sankpal, 1994 also reported the adult female longevity was
maximum on susceptible genotype CSH 1 (4.99 days) and
minimum on IS 18551 (3.54 days), which confirms the present
findings.
Considering the overall results, it can be stated that,
the development of different stages of sorghum stem borer C.
partellus, was adversely affected, when it feeds on resistant
genotypes like, IS 18551, IS 2205 and CSV 15, which indicating
the existence of antibiosis mechanism among these genotypes
which makes them prominent source of resistance for Chilo
partellus resistance breeding of sorghum.
LITERATURE CITED
Chatterji, S. M., Young, W. R., Sharma, G. C., Sayi, I. V., Chahal, B. S.,
Khare, B. P., Rathore, Y. S. Panwar, V. P. S. and Siddiqui, K. H.
1969. Estimation of loss in yield of maize due to insect pests with
special reference to borers. Indian Journal of Entomology, 31:
109–115
Kfir, R. 1990. Parasites of the spotted stalk borer Chilo partellus
(Lepidoptera: Pyralidae) in South Africa. Entomophaga, 35 : 403-
410
Overholt, W. A., Ogedah, K. and Lammers, P. M. 1994. Distribution
and sampling of Chilo partellus (Lepidoptera: Pyralidae) in maize
and sorghum on the Kenya Coast. Bulletin of Entomological
Research, 84 : 367 – 378
Sankpal, V. B. 1994. Investigations on resistance in sorghum to shoot
fly Atherigona soccata (Rondani) and stem borer Chilo partellus
(Swinhoe). The Ph. D. Thesis GAU, Sardarkrushinagar, Gujarat.
Seshu Reddy, K. V. 1989. Sorghum stem borers in Easter Africa.
International Workshop on Sorghum Stem Borer, Patancheru,
ICRISAT, pp.33–40.
Singh, S. P. 1997. Insect pest management in forage crops. Advanced
Training Course On Insect Pest Management, CCS, HAU, Hisar,
India
Singh, S. P. and Verma, A. N. 1988. Antibiosis mechanism of resistance
to stem borer, Chilo partellus (Swinhoe) in sorghum. Insect Science
and Applications, 9: 579-582
Recieved on 09.10.2010 Accepted on 19.11.2010

190 Trends in Biosciences 3 (2): 190-191, 2010 Trends in Biosciences 3 (2), 2010
Effect of Neem Seed Kernel Powder on Infestation of Bruchids, Callosobruchus
maculatus (Fabr.) and Callosobruchus chinensis (Linn.) in Stored Grains of Legumes
B.S. AZAD, S.P. SRIVASTAVA AND ALOK KUMAR PANDEY
Department of Zoology, D.A.V. College, Kanpur
ABSTRACT
Effect of neem seed kernel powder on population build up of
bruchids, Callosobruchus maculatus and Callosobruchus
chinensis in stored legumes were studied. It was observed that
neem seed kernel powder contains growth inhibitor and
insecticidal properties and effectively control population of
C. maculatus and C. chinensis in stored grains of legumes under
the laboratory condition.
Key words
Bruchids, Callosobruchus maculates, Callosobruchus
chinensis, neem seed kernel, growth inhibitor.
The pulse bruchids, Callosobruchus maculatus and C.
chinensis are one of the most prominent and widely distributed
stored grains pests of legume. Losses to these protein rich
grains due to infestation of bruchids has been reported by
Mookherjee, et al., 1970 and Krishnamurthy, 1975. It is
therefore, essential to protect them from insect attack during
storage. Many synthetic pesticides apparently seems to be
the only solution to control insect pests but their use has to
be restricted for their environmental toxicity, erosion of
beneficial natural enemies, pest resurgence and their residual
effect in food. The neem offers potential for developing safe
biological insecticide/pesticide that can be used in an
integrated pest management strategy.
MATERIALS AND METHODS
Neem seed kernels were shade dried at room temperature
and were grinded in an electric grinder. The grounded material
were passed through the 80 mesh sieve and were mixed
thoroughly with grains of legumes at doses of 1.0, 2.0 and
3.0% w/w and were stored at room temperature. The adult
insects (1-2 days old) were released and the data were recorded
at different intervals to observe the insecticidal effect of neem
seed kernel powder on progeny of the test insects. The insects
were allowed to remain on stored grains of legumes for two
weeks. The recorded data on mortality and reduction in
progeny were subjected to statistical analysis.
RESULTS AND DISCUSSION
The analysis of variance represent the adult mortality
and reduction in subsequent progeny in different treatments
involving type of seed, insecticide and its doses (Table 1). It
imparts a significant activity. Differential effect of insecticide
at different doses on different seeds are highly significant.
This is also evidenced in the second order interaction (seed ´
insecticide ´ dose) is similar in both species of bruchids. The
result base don average value of mortality as well as reduction
in progeny. Azad, et al., 2009 reported the similar result and
found relationship of aboitic and aboitic factor on quantitative
and qualitative losses of different food grain legumes.
Table 1.
Percentage reduction in progeny of Callosobruchus maculatus and C. chinensis due to neem kernel powder in
stored grains of legumes
Seed
3 months
Dose (g/100g)
6 months
Dose (g/100g)
9 months
Dose (g/100g)
12 months
Dose (g/100g)
1 2 3 1 2 3 1 2 3 1 2 3
Callosobruchus maculatus
Pea 100.0 100.0 100.0 100.0 100.0 100.0 86.1 91.5 100.0 74.9 84.0 100.0
Gram 100.0 100.0 100.0 100.0 100.0 100.0 99.9 100.0 100.0 56.5 99.3 100.0
Pigeon pea 98.5 100.0 100.0 100.0 100.0 100.0 66.7 100.0 100.0 65.7 95.8 100.0
Mungbean 96.4 97.2 100.0 84.5 85.5 100.0 83.4 83.8 96.8 -80.2 83.3 95.4
Urdbean 100.0 100.0 100.0 100.0 100.0 100.0 99.9 100.0 100.0 99.9 99.9 100.0
S.F. 3.83 C.D5% 7.9 C.D.1% 10.7
Callosobruchus chinensis
Pea 84.6 96.3 96.3 68.3 87.2 93.9 62.2 67.8 92.2 75.1 86.5 85.6
Gram 88.8 94.4 98.0 93.0 99.5 100.0 86.7 100.0 100.0 72.6 99.0 100.0
Pigeon pea 88.5 100.0 100.0 95.4 99.3 100.0 86.7 100.0 100.0 72.6 99.9 100.0
Mungbean 83.9 98.5 97.8 82.9 93.9 96.8 49.2 78.7 85.3 68.7 78.0 85.6
Lentil 100.0 100.0 100.0 99.5 100.0 100.0 99.9 100.0 100.0 99.9 99.9 100.0
Lathyrus 98.0 97.0 100.0 99.2 99.2 100.0 98.5 100.0 100.0 67.2 91.2 97.2
S.E. 3.51 C.D.5% 8.1 C.D.5% 8.4

Table 2.
AZAD et al., Effect of Neem Seed Kernel Powder on Infestation of Bruchids 191
Per cent reduction in progeny of Callosobruchus maculatus and C. chinensis on stored seed of legumes treated with
neem seed kernel powder
Period
Callosobruchus maculates
Callosobruchus chinensis
months Pea Gram Pigeon pea Mungbean Urdbean Pea Gram Pigeon pea Mungbean Lentil Lathyrus
3 100.0 100.0 99.5 97.8 100.0 92.4 95.1 96.1 93.4 100.0 96.6
6 100.0 100.0 100.0 90.0 100.0 83.1 97.5 98.2 91.2 99.8 99.5
9 92.5 100.0 88.9 88.0 100.0 74.1 95.5 93.5 71.0 100.0 99.5
12 86.3 85.5 87.2 86.3 100.0 82.4 90.3 97.2 78.1 100.0 85.0
S.E. 2.212 C.D5% 4.8 C.D.1% 6.8 S.E. 2.020 C.D.5% 4.3 C.D.1% 6.0
Table 3. Dose (100 g)
1 90.2 89.1 82.7 86.1 100.0 72.5 85.3 89.5 71.2 99.9 89.2
2 93.9 100.0 99.0 87.4 100.0 84.4 99.4 99.3 87.7 100.0 97.1
3 100.0 100.0 110.0 98.1 100.0 92.0 99.5 100.0 91.4 100.0 99.4
S.E. 1.915 C.D.5% 4.4 C.D.1% 6.4 S.E. 1.753 C.D.5% 3.9 C.D.1% 6.3
Seed 94.7 96.4 93.9 90.5 100.0 83.0 94.7 93.3 83.4 99.9 4.1
S.E. 1.106 C.D.5% 3.1 C.D.1% 5.1 S.E. 1.012 C.D.5% 2.6 C.D.1% 4.1
Period
Callosobruchus maculatus
Callosobruchus chinensis
Dose (g/100g)
Dose (g/100g)
(Month) 1 2 3 1 2 3
3 98.9 99.4 100.0 89.5 98.5 98.7
6 96.9 87.1 100.0 89.7 96.5 98.4
9 87.2 95.1 99.4 79.8 90.7 96.2
12 75.4 92.6 99.1 79.2 92.9 94.8
S.E. 1.713 C.D. 5% 4.2 C.D. 1% 5.7 S.E. 1.431 C.D.5% 3.4 C.D. 4.9
The analysis of variance of different treatments of
legumes treated with three doses of neem seed kernel powder
and were stored for various periods resulted a highly
significant effect on reduction in progeny against both the
species of bruchids (Table 2). The first and second order
interaction of seed, doses and period also showed significant
differences. The result based on the average value of
reduction in progeny is as follows. C. maculatus @ 2 g/100g
showed a significant insecticidal and growth inhibitor activity
up to twelve months of storage while 3g/100g was effective in
case of Lathyrus. The highest mortality percentage (97.2%)
up to a time limit of nine months was observed in case of
mungbean and lathyrus with 3g/100g treatment while 3g dose
was effective on the other legumes only for three months,
(Akbar Ali, et al., 2003). Thus it is evident that neem seed
kernel treatment is not equally effective in all hosts of
C.maculatus and C chinensis and seeds of urdbean against
C. maculates and pea and mungbean against C. chinensis
were least protected. The treatments were more effective
against C.maculatus as compared to C.chinensis (Table 1, 2).
Germination of seed treated with all the three doses were
tested after 3,6, 9 and 12 months of storage only as there was
deterioration even at these doses and periods.
A crude preparation of neem seed kernel powder
exhibited anti-ovipositional properties against C.maculatus
for quite long priod of storage and its degree varied with the
species and also with the type of legumes for the same species.
Egg laying by C. chinensis was comparatively less affected
than that of C.maculatus. Among the pulses, mungbean and
to some extent pigeon pea exhibited loss of anti-ovipositional
property more readily. On the other hand urdbean and Lentil
resisted egg laying even up to one year.
Although neem seed kernel powder an indigenous
protectant exhibited very high efficacy against storage pests,
it requires a refined product, based on its active principles
viz., extract of ethanol or chloroform may be developed which
could be suitably formulated and applied uniformly. The crude
product as such imparted putative effect.
ACKNOWLEDGEMENT
The authors are highly thankful to Dr. Y.C.Gupta, Ex-
Professor and Head, Department of Zoology, B.S.A. College,
Mathura for providing facilities and constant encouragement.
LITERATURE CITED
Akbar Ali, R., Sarwar, M. and Tofique, M. 2003. Evaluation of synthetic
and some plant origin insecticides against H.armigera on chick
pea. Pak. J. Biol., 6:496-499.
Azad, B.S., Singh, S.K., Srivastava, S.P.; and Tandon Pankaj. 2009.
Relationship of abiotic and biotic factors on quantitative and
qualitative losses of different food grain legumes. Inernational
Conference on Grain Legumes (I.I.P.R.), February 14-16, Kanpur
India, pp. 327.
Krishnamurthy, K. 1975. Post harvest losses in food grain. Bull. Grain.
Technol., 13: 33-49.
Mookherjee, P.B., Jotwani, M.G., Yadav, T.D. and Sircar, P. 1970.
Studies on the incidence and extent of damage due to insect pests
and stored seed. II, Leguminous and vegetables seeds. Indian J.Ent.,
32: 350-355.
Recieved on 25.10.2010 Accepted on 19.11.2010

206 Trends in Biosciences 3 (2): 206-207, 2010 Trends in Biosciences 3 (2), 2010
Status of Stem Rot of Vanilla Incited by Fusarium oxysporium f.sp.vanillae in
Karnataka
B. GANGADHARA NAIK, MUHAMMAD SAIFULLA, B.MANJUNATH AND P.S.PRASAD
Department of Plant Pathology, University of agricultural Sciences, GKVK, Bangalore 560 065, Karnataka
e-mail: saifullasaifulla@rediffmail.com
ABSTRACT
Vanilla plant is affected by several plant pathogens. Among the
diseases on vanilla, stem rot caused by Fusarium oxysporum f.
sp. vanillae is the most important disease and causing huge
loss to the farmers. Stratified random sampling survey was
conducted during the year 2004-2005 to assess stem rot disease
incidence on vanilla at different places in Karnataka. During
the survey, distribution of stem rot in different districts of
Karnataka and prevalence of various other diseases in vanilla
along with disease incidence was also recorded. Highest disease
incidence of 30 per cent was recorded in new mandli area of
Shimoga and a minimum of 5 per cent in several places with a
mean incidence of 8.40 per cent in southern Karnataka.
Key words
Vanilla, stem rot, Fusarium, survey, Karnataka
The global cultivation of vanilla is estimated to be about
40,846 hectares from which production is about 5,583 metric
tonnes and in India. It is grown in an area of 2,545 hectares
covering Karnataka, Kerala and Tamil Nadu, with the
production of about 100 metric tonnes (Kuruvilla, et al., 2004).
Among the few pathogens causing diseases in vanilla,
Fusarium oxysporum f.sp. vanillae is the most important
pathogen becoming a serious constraint in the successful
cultivation of vanilla.
MATERIALS AND METHODS
Roving survey was conducted in all the three seasons
during 2004-05 covering parts of Shimoga, Chikmagalur,
Hassan, Bangalore, Davangere, Chitradurga, Dakshina
Kannada and Uttar Kannada districts of Karnataka state to
identify the hot spot areas for stem rot of vanilla. During the
survey, stratified random sampling procedure was followed.
In each district, minimum of three and maximum of 27 vanilla
gardens were visited where, it was grown as monocrop,
intercrop as well as in few kitchen gardens and recorded the
prevalence of various diseases in vanilla. However, special
importance was given to the incidence of stem rot disease.
Information was gathered from survey of 65 vanilla
gardens about the cropping system followed and stem rot
incidence in each garden and is summarized hereunder (Table
2).
RESULTS AND DISCUSSION
Stratified random sampling survey was conducted during
the year 2004-2005 to assess stem rot incidence on vanilla at
different places in Karnataka and the survey revealed that,
the highest disease incidence of 30 per cent was recorded in
New Mandli area of Shimoga district and a minimum of 5 per
cent in several places with a mean incidence of 8.40 per cent in
southern Karnataka state.
During the survey it was observed that, vanilla was
mainly grown as an inter crop along with arecanut followed
by as a monocrop in polyhouses and in kitchen gardens. The
only variety cultivated was Vanilla planifolia and it was
observed that, in Shimoga district, the maximum disease
incidence was recorded in New Mandli area (30.0%) followed
Table 1.
: Diseases observed
Occurrence of vanilla diseases in different districts of south Karnataka
District Taluk No. of locations
Diseases observed
surveyed Stem rot Leaf rot Leaf spot Shoot tip rot Bean rot Virus
Shimoga Shimoga, Sagara, Bhadravathi,
27
Thirthahalli,Hosanagara
Chikmagalore Kadur, N.R. Pura,Tarikere,
13 -
Chikmagalore, Birur,Mudigere, Koppa,
Sringeri.
Davanagere Channagiri Honnali 4 - - -
Hassan
Banawara, Arasikere, Hassan,
4 - - -
Saklespur
Chitradurga Holalkere 2 - - -
Dakshina Kannada Puttur, Bantwala, Sullya 5 - -
Bangalore Hosakote, Bangalore 3 - -
Uttar Kannada Siddapura, Mavina kunte 4 - - - -
Total 65
- : Diseases not observed

NAIK et al., Status of Stem Rot of Vanilla Incited by Fusarium oxysporium f. sp. vanillae in Karnataka 207
Table 2.
District
Survey on different types of cropping systems
followed in vanilla and stem rot disease incidence
Place/
locality
Fields
visited
Stem
rot
(%)
Mean
Stem
rot (%)
Cropping
pattern
Shimoga New Mandli 1 30.00 Monocrop
Arakere
Monocrop &
2 15.50
with Areca
M. Hanasavadi 2 15.00 With Areca
Gajanur 1 15.00 With Areca
Hosudi 2 10.00 With Areca
Ashokanagar 1 12.00 With Areca
Ayanur 1 12.00 With Areca
Bidare 1 15.00 Kitchen garden
Sagane
Mono & with
2 20.00
Areca
9.05
Ananda pura 1 12.00 Mono crop
Dummalli 2 10.50 Mono crop
Avinahalli 1 10.00 Kitchen garden
Jog 1 15.00 Mono crop
Bhadravathi
Mono & with
2 17.00
Areca
Holehonnur 2 12.50 With Areca
Thirthahalli
Mono & with
3 16.00
Areca
Hosahalli
Kitchen garden
2 7.50
& with Areca
Davangere Honnali 1 12.00 With Areca
Kammaragatte 1 17.00 With Areca
12.25
Matti 1 10.00 Kitchen garden
Nallur 1 10.00 With Areca
Chikamagalore Agumbe 1 10.00
Shringeri 2 10.00 Mono crop
Chikamagalore 1 6.00 Kitchen garden
Kadur 1 10.00 Mono crop
Birur 1 8.00 Mono crop
Balehonnur 1 10.00 6.46 With Areca
Mudigere 2 12.00 Mono and with
Coffee &
Cardamum
Koppa 2 9.50 With Areca
N.R. Pura 2 8.50 With Areca
Hassan Banavara 2 12.50 Kitchen garden
Arasikere 1 15.00 Mono crop
9.30
Hassan 1 10.00 Kitchen garden
Saklespur 1 9.00
Chitradurga Holalkere 1 12.00 Mono crop
8.50
Chikkajajur 1 5.00 Mono crop
Dakshina Ullal 1 13.00 Mono crop
Kannada Beltangadi 1 9.00 Mono crop
Vitla 1 10.00 9.80 With Areca
Puttur 1 8.00 With Areca
Sulya 1 9.00 Mono crop
Uttar Kannada Mavinagundi 1 10.00 Mono crop
Keerthigadde 1 5.00 7.50 Mono crop
Siddapura 2 15.00 Mono crop
Bangalore Bannerughatta 2 14.50 Mono crop
9.16
Hosakote 1 13.00 Mono crop
Madikeri Suntikoppa 1 5.00 Kitchen garden
Kusalanagar 2 5.50 3.50 Kitchen garden
& with Coffee
Mean 8.40
by Sogane (20.0%) and the minimum incidence of 7.50%, was
recorded in Hosahalli village. However, Shimoga taluk
recorded a mean incidence of 9 per cent.
In Davanagere district, mean per cent stem rot incidence
recorded was 12.25% with a maximum disease incidence of 17
per cent in Kammaraghatta village followed by Honnali
(12.0%). In Chitradurga district maximum of 12 per cent and a
minimum of 5 per cent disease was recorded in Holalkere and
Chikkajajur respectively with a mean per cent stem rot
incidence of 8.5%. In Chickmagalore district, mean per cent
stem rot incidence recorded was 6.46% with a maximum
incidence of 12 per cent in Mudigere followed by 10 per cent
in Balehonnur, Agumbe and Shringeri. However, least
incidence (6.0%) was recorded in Chickmagalore. In Hassan
district, maximum incidence of 15 per cent each was recorded
in Arasikere followed by Banavara (12.5%) with a mean
incidence of 9.3%. In Dakshina Kannada district maximum
incidence of 13 per cent was recorded in Ullal followed by
Vitla (10.0%) with a mean disease incidence of 9.8%. Maximum
incidence of 15.0% was recorded in Siddapura, followed by
Mavinagundi (10.0%) in Uttar Kannada district. In Bangalore
district, mean per cent stem rot incidence recorded was 9.16%
with a maximum incidence of 14.5% was recorded in
Bannerughatta followed by Hosakote area (13.0%). In Madikeri
district, maximum disease incidence of 5.5% was recorded in
Kushala nagar and 5 per cent in Suntikoppa.
Radhika, 2004, reported that, during the field survey
carried out in major vanilla growing districts of Karnataka viz.,
Uttar Kannada, Dakshina Kannada, Madikeri, Chickmagalur,
Davangere, Shimoga and Hassan, fungal diseases like shoot
tip rot, leaf spot/rot, stem rot, basal stem rot and vine rot /wilt
along with mosaic disease were recorded (Table 1).
LITERATURE CITED
Kuruvilla, K. M., Vadivel, V. Radhakrishnan, V.V. and Madhusoodanan,
K.J. 2004. Crop improvement programmes on vanilla. Spice India,
March, pp.39-44,
Radhika, N. S. 2004. Strategies to stem diseases in spices in Karnataka.
Spice India, 1: 49-51.
Recieved on 20.10.2010 Accepted on 25.11.2010

192 Trends in Biosciences 3 (2): 192-193, 2010 Trends in Biosciences 3 (2), 2010
Shelf Life of Cellulolytic Fungi and Bacteria in Different Carrier Materials
DEEPTI BHAGAT, MINA D. KOCHE* AND R.W.INGLE
Department of Plant Pathology, Dr. Panjabrao Deshmukh Krishi Vidhyapeeth, Akola
*email: mdkoche@gmail.com
ABSTRACT
Shelf life of cellulolytic fungi and bacteria (Trichurus spiralis,
Chaetomium globosum, Trichoderma viride, Humicole grisea,
Aspergillus niger and Cellulomonas bibula) in four different
carrier materials viz., talc, lignite, charcoal and fly ash was
determined. The observations on propagules count (cfu/g) were
recorded initially and thereafter at monthly interval for six
months. A decline in the number of propagules was observed
from 30 days onward. After 180 days of storage talc was found as
the best to retain maximum number of viable propagules (T.
spiralis 4.66X10 6 cfu/g, C. globosum 5.0X10 6 cfu/g, T. viride
7.33X10 6 cfu/g , H. grisea 2.33X10 6 cfu/g, A. niger 3.0X10 6 cfu/g
and C. bibula 3.33X10 7 cfu/g). The minimum number of
propagules were recorded in fly ash at 180 days after storage.
Key words
Fungi, bacteria and carrier materials
Delivery of cellulolytic to organic material and soil has
been found to be an effective ecofriendly method for
improvement of soil nutrient and the control of the soil borne
diseases (Chao, et al., 1986). The viability of cellulolytic
microorganisms in the product is reduced during storage,
which ultimately influences the effectivity. With the increasing
interest in developing alternatives to inorganic fertilizers and
other farm inputs, production of such cellulose degrading
organism has becomes the focal point for research and
development. Biomass of cellulose degrading organism need
to be produced in a timely and cost effective way. It must
survive at each processing step such as harvest, formulation,
storage and delivery. Hence, mass production of such potent
cellulolytic microorganisms has gained importance. Hence,
were the suitability of various carriers for the growth of
cellulolytic fungi and bacteria.
MATERIALS AND METHODS
Carriers viz., charcoal, talc, lignite and fly ash were dried
in sun and powdered sieved through 1 mm 2 mesh. Fifty gram
each were filled in polypropylene bags (25 x 30 cm) and tightly
closed and sterilized at 1.05 kg/cm 2 for 30 minutes.
Six cultures viz., Trichoderma viride, Chaetomium
globosum, Trichurus spiralis, Humicola grisea, Aspergillus
niger, and Cellulomonas bibula were grown on potato
dextrose broth and nutrient broth media respectively. Broth
were autoclaved at 1.05 kg/cm 2 for 15 minutes. On cooling, it
was inoculated with 6 mm disc of individual culture separately.
Then these inoculated flasks were incubated at ambient
condition. The flasks were shaked manually every day. The
growth along with the medium was removed and mixed
homogenously in blender and this homogenous inoculum
were mixed with each carrier in 2:1 proportion (i.e. 2 parts
carrier + 1 part liquid culture). Then stored at 27 ± 2°C for
recording cfu count at monthly interval for six months by
serial dilution technique for longevity studies.
RESULTS AND DISCUSSION
Present investigation gives an idea about the suitability
of some carriers. Talc was found best carrier material as it
retained maximum number of propagules T. spiralis
4.66X10 6 cfu/g, C. globosum 5.0X10 6 cfu/g, T. viride
7.33X10 6 cfu/g , H. grisea 2.33X10 6 cfu/g, A. niger 3.0X10 6 cfu/
Table 1.
Effect of different carrier material on the population of Trichurus spiralis and Chaetomium globosum (cfu/g)
Sr. Carrier
Trichurus spiralis (x10 6 ) Chaetomium globosum (x10 6 )
No.
Initial 30
Days
60
Days
90
Days
120
Days
150
Days
180
Days
Initial 30
Days
60
Days
90
Days
120
Days
150
Days
180
Days
1 Lignite 96.66 76.0 38.0 26.33 16.0 9.0 3.0 97.00 78.66 39.33 28.33 17.33 10.33 3.66
2. Charcoal 96.00 73.66 34.0 23.66 14.0 7.0 2.33 96.33 75.0 35.33 25.33 15.0 7.33 2.66
3. Talc 98.00 79.66 41.33 29.66 18.66 13.33 4.66 98.33 81.33 44.0 31.33 21.33 14.0 5.0
4. Flyash 95.33 69.66 30.66 19.0 6.6 1.6 0.00 96.00 70.66 31.66 20.66 7.33 2.33 0.33
Table 2.
Effect of different carrier material on the population of Trichoderma viride and Humicola grisea (cfu/g)
Sr. Carrier
Trichoderma viride (x10 6 ) Humicola grisea (x10 6 )
No.
Initial 30
Days
60
Days
90
Days
120
Days
150
Days
180
Days
Initial 30
Days
60
Days
90
Days
120
Days
150
Days
180
Days
1 Lignite 100.86 83.33 43.33 34.33 20.66 15.33 5.33 94.33 73.33 28.66 17.66 9.33 6.66 1.66
2. Charcoal 100.00 80.0 39.66 30.0 17.33 11.33 4.66 93.66 69.66 26.66 14.66 7.66 6.33 1.33
3. Talc 101.33 86.33 51.33 36.0 24.33 17.33 7.33 95.00 77.0 38.0 21.0 12.66 8.0 2.33
4. Flyash 99.33 74.33 35.33 25.0 9.33 3.66 0.66 93.00 65.33 24.0 10.66 2.66 0.00 0.00

Table 3.
BHAGAT et al., Shelf Life of Cellulolytic Fungi and Bacteria in Different Carrier Materials 193
Effect of different carrier material on the population of Aspergillus niger and Cellulomonas bibula (cfu/g)
Sr. Carrier
Aspergillus niger (x10 6 ) Cellulomonas bibula (x10 7 )
No.
Initial 30
Days
60
Days
90
Days
120
Days
150
Days
180
Days
Initial 30
Days
60
Days
90
Days
120
Days
150
Days
180
Days
1 Lignite 99.33 75.33 33.0 22.0 11.0 7.0 2.33 99.66 75.66 36.33 25.0 14.33 8.0 2.66
2. Charcoal 99.00 73.0 29.66 18.66 8.33 4.33 2.0 99.00 73.33 33.0 20.33 9.0 5.66 2.0
3. Talc 100.66 79.33 40.3 23.66 14.0 10.33 3.0 100.33 79.0 40.66 28.33 16.0 11.0 3.33
4. Flyash 98.66 69.0 28.00 15.0 3.33 1.0 0.00 98.33 70.0 30.33 18.0 4.33 1.33 0.00
g and C. bibula 3.33X10 7 cfu/g upto 180 days of the test fungi
and bacteria. Though there was reduction in cfu when stored
for 180 days, still there was sufficient and requisite viable
population. The efficiency of the talc formulation stored for
different period was almost uniform (Ramkrishnan, et al., 1994).
The result clearly indicate that the formulation can be safely
stored for 180 days. Minimum number of propagules were
recorded in fly ash at 180 days after storage as compared to
the other carriers in all the cultures. But, the population of all
the cultures was well maintained upto 120 days in fly ash.
However, the population decreased drastically after 120 days.
The results may be differed due to environmental conditions
and quality of material where from it procured. Renganathan,
et al., 1995 reported that gypsum followed by talc maintained
sufficient number of cfu after 120 days of storage. Nakeeran,
et al., 1997 standardized the packing and storage conditions
to increase shelf life of talc and vermiculture based formulations
of Trichoderma and reported the product could safely be
stored as talc based formulation in milky white (LDPE) bags at
room temperatures up to 75 days. Prasad, et al., 2002 also
reported that conidial formulation retained optimum amount
of viable propagules (> 10 6 cfu/g) even after 180 days of
storage at room temperature. The results of the present
findings are comparative with that of Das, et al., 2006 who
reported that talc based formulation exhibited gradual declining
trend in multiplication and sporulation of T. harzianum after
30 days onwards.
LITERATURE CITED
Chao, W.L., Nelson, E.B., Harman, G.E. and Hoch, N.C. 1986.
Colonization of rhizosphere by biological control agent applied to
seed. Phytopathology, 76: 60-65
Das, B., Pranab Dutt, B.K. and Sarmah, D.K. 2006. Bio-formulation of
Trichoderma harzianum Rifai for management of soybean stem
rot caused by Rhizoctonia solani Kuhn. J. Biol. Control, 20(1): 57-
64.
Nakeeran, S., Sankar, P. and Jeyarajan, R. 1997. Standardization of
storage condition to increase the self life of Trichoderma
formulation. J. Mycol. Pl. Pathol., 27(1):60-63.
Prasad, R.D., Rangeshawaran, R., Anuroop, C.P. and Phanikumar, P.R.
2002. Bioefficacy and shelf life of conidial and chlamydospore
formulations of Trichoderma harzianum Rifai. J.Biol.Control,
16(2): 145-148.
Ramkrishanan, G., Jeyarajan, R. and Dinakaran, D. 1994. Talc based
formulation of Trichoderma viride for the bio-control of
Macrophomina phasolina. J. Biol.Control, 8(1):41-44.
Renganathan, K.R.,Sridhar and Jeyarajan, R. 1995. Evaluation 0f
gypsum as a carrier in the formulation of Trichoderma viride. J.
Biol. Control, 9(1):61-62.
Recieved on 01.05.2010 Accepted on 02.07.2010

194 Trends in Biosciences 3 (2): 194-196, 2010 Trends in Biosciences 3 (2), 2010
Development of Bio-Intensive Pest Management (BIPM) Module for Bt Cotton in
North Gujarat
J.K. PATEL, M.V. VEKARIA AND I.S. PATEL
Department of Entomology, C.P. College of Agriculture, S.D. Agricultural University, S.K. Nagar 385 506
e-mail. dr.ispatel@gmail.com
ABSTRACT
Based on pooled results it is revealed that Rasi-2 Bt with
insecticidal module proved to be superior in suppressing
sucking pests as well as boll worm pests. It had also achieved
higher yield of cotton (31.31 q/ha). It was, however, at par with
BIPM-II (30.21 q/ha) and BIPM-I (30.06 q/ha). From the economic
point of view and safety to natural enemies, it may be inferred
that Rasi-2 Bt with bio-intensive module is the most promising
and ideal combination followed by Rasi-2 Bt with insecticidal
module and resulted in higher net profits (1: 47.8).
Key words
Bio-intensive, cotton, Bt cotton, sucking pests, cotton
bollworm
Cotton is damaged by 1326 species of insects right from
sowing to maturity in different cotton growing areas of the
world. Among these 16 species are of major importance
resulting in an annual loss of 50-60 per cent of total production
(Anonymous, 1996). Bollworms are the most destructive pests
which cause severe loss in terms of quality and quantity of
cotton. Some times, serious outbreak of the bollworm has
been found to cause loss up to 40 to 50% in yield and even
total failure of the crop. Cotton accounts for consumption of
50% of total pesticides usage in the country worth about Rs.
1600 million. Due to continuous use of insecticides in cotton
crop led several hazardous problems. Attempt was therefore
been made to develop biointensive pest management modules
in Bt cotton.
MATERIALS AND METHODS
A field trial on bio-intensive pest management module
in Bt cotton was conducted at Agronomy Instructional Farm,
C.P. College of Agriculture, S.D. Agricultural University,
Sardarkrushinagar during Kharif, 2008-09. The Rasi-2 Bt was
selected for the study purpose. Crop was sown with the onset
of monsoon in the completely randomized design (CRD). The
variety grown in four modules measuring 20 m x 10 m in each
plot. Seven quadrate each measuring 2.8 m x 1.4 m were made
and in each quadrate five plants were randomly selected and
tagged. The modules tested in cotton crop are as under.
T 1
(BIPM 1) : Border crop of maize (2 line) in cotton,
Interspersing marigold in cotton, Use of neem oil @ 5 %, Bird
perches @ 50/ha, Three release of Trichogramma chilonis @
1.5 lakh/ha/week.
T 2
(BIPM 2) : Border crop of sorghum (2 line) in cotton,
Interspersing castor in cotton, Use of Nikuchhi @ 1 %,
Pheromone trap@ 5 traps/ha each of H. armigera, E. vittella,
P. gossypiella and S. litura, Three release of Trichogramma
chilonis @ 1.5 lakh/ha/week.
T 3
(Chemical module) : Seed treatment of imidacloprid
70 WS @ 7 g/kg of seed, Dimethoate 30 EC 0.03 % and alternate
spray of imidacloprid 200 SL, (Confidor 0.05 %) @ 4 ml/10 lit.
water for sucking pests alone or combined number 10/leaf,
Profenophos 50 EC 0.05 % @ 10 ml/10 lit. water for bollworms,
Triazophos 40 EC @ 25 ml/10 lit. water for whitefly 10 adults/
leaf, Dicofol 18.5 EC @ 15 ml/10 lit. water for 10 mites/leaf.
T 4
Untreated (Control) : The population of sucking pests
viz., aphid, jassid, thrips, whitefly and mite was recorded from
top, middle and lower leaves of plant. Bollworm pests viz.,
American bollworm, spotted bollworm, pink bollworm,
Spodoptera and natural enemies viz., Chrysoperla, lady bird
beetle, big eyed bug, spider and Staphylinid were recorded
from whole plants per quadrate at weekly intervals. From this,
the periodical mean population of pests and natural enemies
data was analyzed. Total yield of seed cotton in each plot was
obtained by totaling yield of all picking of given plot. From
these data, yield of seed cotton quintal per hectare in each
treatment was worked out and then statistically analyzed.
Based on the cost of plant protection and gain yield in each
treatment, protection cost benefit ratio was worked out.
RESULTS AND DISCUSSION
Results revealed that insecticidal module had lowest
aphid population i.e. 3.25 aphids/leaf (Table 1). It was
significantly superior over other treatments. The BIPM-II was
found next best effective treatment (3.90 aphids/leaf).
Significantly higher aphid population was recorded in
untreated control (5.40 aphids/leaf). Similarly insecticidal
module also recorded lowest number of jassid (3.39 jassids/
leaf) and proved to be significantly superior over rest of the
treatments. Thrips population was found lowest in insecticidal
module (2.55 thrips/leaf) which was significantly superior than
all the treatments. BIPM-I was ranked next best treatment,
which had 2.91 thrips/leaf. The untreated control module had
highest population of thrips (5.33 thrips/leaf). It was also
revealed that insecticidal module had lowest population of
whitefly (3.18 whiteflies/leaf). It was significantly superior over

Table 1.
PATEL et al., Development of Bio- Intensive Pest Management (BIPM) Module for Bt Cotton in North Gujarat 195
Mean population of cotton pests in different treatments in Bt cotton.
Treatment
Sucking pests/ leaf Larval population /plant Boll damage (%)
Aphid Jassid Thrips whitefly Mite Spotted Pink Spodoptera Spotted Pink Spodoptera
bollworm
bollworm
BIPM-I 4.22
(2.24)
4.22
(2.08)
2.91
(1.83)
4.19
(1.87)
4.20
(2.08)
1.22
(1.31)
0.71
(1.07)
0.72
(1.07)
6.65
(14.86)
6.50
(16.55)
6.35
(13.88)
BIPM-II 3.90
(2.19)
4.18
(2.07)
3.06
(1.89)
4.49
(2.12)
4.39
(2.15)
1.23
(1.32)
0.70
(1.07)
0.74
(1.08)
6.62
(14.83)
6.39
(14.55)
6.49
(14.65)
Insecticidal
module
3.25
(1.86)
3.39
(1.86)
2.55
(1.51)
3.18
(1.43)
3.67
(1.91)
1.00
(1.18)
0.58
(1.01)
0.64
(1.04)
6.38
(12.89)
5.83
(12.93)
6.19
(13.14)
Untreated
(Control)
5.40
(2.33)
5.16
(3.32)
5.33
(3.33)
6.33
(2.19)
5.51
(2.61)
2.27
(1.66)
0.97
(1.18)
1.04
(1.22)
8.12
(22.62)
7.35
(22.39)
7.47
(22.46)
S.Em (±) 0.110 0.074 0.118 0.150 0.159 0.038 0.018 0.044 0.224 0.401 0.223
CD at 5% 0.308 0.188 0.331 0.421 0.447 0.106 0.048 0.118 0.651 0.442 0.502
CV% 7.07 5.46 5.92 5.53 8.22 7.09 8.69 6.69 9.46 8.96 8.61
*Figures in parentheses are X 0.5 transformed value Figures outside are retransformed value
other modules. The untreated control plots recorded
significantly higher population of whitefly (6.33 whiteflies/
leaf). In case of mite, insecticidal module had lowest
population of mites (3.67 mites/leaf) which was significantly
superior over other modules. The untreated control module
recorded highest mite population (5.51 mites/leaf).
It can be concluded that the insecticidal module is
superior that the other modules. Similar findings were also
reported by Patil, et al., 2002, Kannan, et al., 2004, Anonymous,
2008 and Bombawale, et al., 2004.
Based on pooled value, it was revealed that the
insecticidal module was significantly superior in reducing boll
damage due to Earias vittella (6.38%). The next best treatment
was BIPM-II which had 6.62% boll damage. The pink bollworm
damage was also recorded lowest in insecticidal module
(5.83%). It was significantly superior than all the treatments.
BIPM-II was the next best treatment which had only 6.39%
boll damage. Untreated control module had significantly
highest boll damage (7.35 %). Insecticidal module again
recorded lowest boll damage due to S. litura i.e., 6.19 %, It
was followed by the BIPM-I (6.35 %) and BIPM-II (6.49%).
BIPM-I ranked next best treatment (6.35%). It was not differed
significantly from BIPM-II (6.49%). Among all the treatments,
maximum damage was recorded in untreated control (7.47%).
So far as larval population is concerned, lowest larval
population of Earias recorded in insecticide module (1.00
larvae/plant). It was significantly superior over the other biointensive
module. The BIPM-I was the next best treatment
which had 1.22 larvae/plant. It was at par with BIPM-II (1.23
larvae/plant). Among all the treatments, untreated control
module had highest larval population of Earias (2.27 larvae /
plant). The incidence of pink bollworm was very low. It was
ranged from 0.58 to 0.97 larval /plant. Insecticidal module was
significantly superior over all the treatments (0.58 larval /plant).
It was at par with BIPM-I (0.71 larval/plant). The insecticidal
module had also recorded significantly lowest Spodoptera
larval population i.e. 0.64 larvae/plant, but it was at par with
BIPM-I (0.72 larvae /plant) and BIPM-II (0.74 larvae /plant).
Similar results were also reported by Anonymous, 2008 and
Bombawale, et al., 2004.
Chrysoperla adults were observed significantly more
in BIPM-I (1.68 adults /plant). BIPM-II ranked second
treatment which harbored more number of Chrysoperla (1.66
adults /plant) though it was not differed from control (1.59
adults /plant). While population of Chrysoperla adult was
found lowest in insecticidal module (1.28 adults/plant).
Similarly insecticidal module had lowest population of ladybird
beetle (0.52 adult /plant). BIPM-I had maximum population of
lady bird beetle which (1.36 adults/plant) not differed from
untreated control (1.31 adults/plant). The results further
revealed that BIPM-I ranked first in conserving population of
big eyed bug (1.48 adults/plant). Untreated control had in
1.38 adults/plant. The population of big eyed bug was greatly
hampered by insecticidal modules (0.46 adult /plant), which
was significantly lowest than all the treatments. BIPM-I
treatment ranked first in conserving the population of spiders
in Bt cotton crop i.e. 4.21 spiders/plant. BIPM-II had 3.72
adults/plant which was significantly inferior than BIPM-I but
superior than rest of the treatments. Lowest numbers of spider
was recorded in insecticidal treated plots (0.67 spider/plant),
which was significantly lowest than all the treatments. The
BIPM-II harbored maximum Staphylinid population (1.28
adults/plant), which was not differed from BIPM-I (1.22 adults/
plant). The present findings are closely confirmed with the
findings of Liu, et al., 2003 who reported higher number of
natural enemies in BIPM in Bt and non Bt cultivars as compared
to recommended insecticides schedule.
From the results (Table 2), it can be concluded that the
insecticidal module achieved significantly higher yield of seed
cotton i.e. (31.31 q ha -1 ) However it was at par with BIPM-II
(30.21 q ha -1 ) and BIPM-I (30.06 q ha -1 ). Further, the highest
PCBR was recorded in the treatment of insecticidal module (1:
47.8) followed by BIPM-I (1: 16.1) and BIPM-II (1: 14.4). However,
similar findings were also reported by Baheti, 2007 who reported
maximum seed cotton yield of 14.49 q ha -1 with chemical spray
and was comparable with IPM module (13.44 q ha -1 ).

196 Trends in Biosciences 3 (2), 2010
Table 2.
Treatment
Yield of seed cotton and protection cost benefit
ration (PCBR) in different treatments.
Cotton
yield
(Q/ha)
BIPM-I 30.06 76420 38377 1: 16.1
BIPM-II 30.21 76297 38254 1: 14.4
Insecticidal 31.31 82807 44764 1: 47.8
module
control 14.09 38043 - -
Market price = 2700 Rs./q
Labour charges = 110 Rs. For one spray
LITERATURE CITED
Gross
realization
(Rs./ha)
Net profit
over
untreated
(Rs./ha)
Cost
benefit
ratio
Anonymous. 1996. Annual Progress Report of All India Co-ordinated
Cotton Improvement Project, Surat. pp. 14-18.
Anonymous. 2008. Economic survey of India. @www.
Indiabusiness.nic.in/economy/ ecotton.htm
Bombawale, O.M.; Singh, A.; Sharma, O.P.; Bhosle, B.B.; Lavekar,
R.C.; Dhandapani, A.; Kanwar, V.; Tanwar, R.K.; Rathod, K.S.;
Patange, N.R. and Pawar, V.M. 2004. Performance of Bt cotton
(MECH-162) under Integrated Pest Management in farmer’s
participatory field trial in Nanded district, Central India. Curr. Sci.,
86 (12) : 1628-1632.
Baheti, H.S. 2007. Studies on the pest problems and their management
in Bt cotton in comparison with conventional cotton. Ph.D. Thesis,
Rahuri.
Kannan, M.; Uthamasamy, S. and Mohan, S. 2004. Impact of insecticides
on sucking pests and natural enemy complex of transgenic cotton.
Curr. Sci., 86: 726-729.
Liu, W.X.; Hou, M.L.; Wan, F.H. and Wang, F.L. 2003. Temporal and
spatial niche dynamics of spiders and their control effects on cotton
bollworms in transgenic Bt cotton fields. Entomological knowledge,
40: 160-163.
Patil, S.B.; Udikeri, S.S.; Katageri, I.S.; Khadi, B.M. and Hegde, R.N.
2002. Integrated pest management with genetically modified cotton
hybrids. Proc. Nat. Semi. on “Bt cotton Scenario with special
reference to India’. UAS, Dharwad, Karnataka, India, pp. 91-92.
Recieved on 12.04.2010 Accepted on 21.07.2010

208 Trends in Biosciences 3 (2): 208-209, 2010 Trends in Biosciences 3 (2), 2010
Efficacy of Spinosad and Neem Products Against Shoot and Fruit Borer (Leucinodes
orbonalis Guen.) of Brinjal (Solanum melongena L.)
ANOORAG, R. TAYDE* AND SOBITA SIMON
Department of Plant Protection, School of Agriculture, Sam Higginbottom Institute of Agriculture, Technology
and Sciences, (Deemed-to-be University), Allahabad (U.P.)
e-mail: anuragtayde@gmail.com, sobitasimon@rediffmail.com
ABSTRACT
A field experiment was conducted during kharif, 2009-2010 at
SHIATS, Allahabad (U.P.) to compare the efficacy of insecticides,
Spinosad and neem products against brinjal shoot and fruit
borer, (Leucinodes orbonalis Guen.) which reveled that Spinosad
45 SC @ 0.01 % was found most effective and showed (09.84 %)
shoot infestation, per cent fruit infestation (06.87 % on number
basis and 07.35 % on weight basis) and increasing yield of
brinjal fruit (239.30 q/ha). Whereas, Carbaryl 50 WP @ 0.2%
and Endosulfan 35 EC @ 0.05% were also found effective in
reducing per cent infestation shoot and fruit infestation and
increasing yield. Amongst neem products NSKE 5 % was found
to be superior in terms of efficacy and yield. However, the
increment cost benefit ratio (ICBR) showed that the application
of Quinalphos 25 EC @ 0.05 % was economically most viable
treatment (1:67.86) followed by Endosulfan 35 EC @ 0.05 %
(1:66.19).
Key words
Brinjal, Leucinodes orbonalis, insecticides, efficacy
Brinjal, Solanum melongena is one of the widely used
vegetable crop and is popular in many countries. Amongst
vegetables the brinjal or eggplant is one of the most common,
popular and principal annual vegetable crop grown in all three
seasons usually under irrigated conditions. Brinjal is attacked
by several insect pests. There are about 140 insects species
from about 50 families and 10 insect orders are listed on
eggplant (Vevai, 1970). One of the important insect pest
attacking brinjal in India are Brinjal fruit and shoot borer
(Leucinodes orbonalis Guen.) (Ratual, 1986). It is widely
distributed in Indian sub-continents. The pest is active
throughout the year at places having moderate climate but it
is adversely affected by severe cold. The caterpillar bores
into the young growing shoots, petiole, midrib of the leaves
and fruits leaving no sign of entry. It riddles the plant part,
feeds on the internal tissue causing the plants to fade and
wither resulting into drying and dropping of growing shoots
which is the typical symptom produced. Once the fruit setting
begins, the caterpillar bores into the fruits by entering under
calyx and feeds inside.
Many insecticides have been reported effective against
brinjal pests, the residues on the fruits are quite common
because the brinjal fruits are picked up at a short and frequent
intervals. To overcome such situation, the search of effective
as well as economically safer alternative method is a continues
need. Moreover, several recommended insecticide have been
failing to control the brinjal pests mainly because of
development of resistance.
MATERIALS AND METHODS
The trial was conducted in kharif, season 2009-10 the
department of Plant Protection, SHIATS, Allahabad (U.P.). Trial
was laid out in a randomized block design consisting of seven
different insecticide formulations with one recommended
concentration. Each treatment was replicated thrice on plot
size of 6 m 2 and brinjal cv. neelam was used for study. After
observing a sufficient level of insect population, spraying
was undertaken. Four spray operations were giving at 15 days
interval. Observations on shoot infestation and fruit
infestation were recorded after each spray and tabulated as
average of three replications of five randomly selected plants.
The data were subjected to statistical analysis. The yield per
plot was also recorded.
RESULTS AND DISCUSSION
Spinosad was found to be effective against controlling
the shoot infestation by shoot and fruit borer, L. orbonalis
followed by Carbaryl > Endosulfan > Quinalphos > NSKE >
neem oil > Imidacloprid > Control (Table 1).
As far as fruit infestation was concerned Spinosad
showed the best result in controlling the fruit infestation (on
no. basis and weight basis) and was significant to remaining
treatment followed by other treatments.
The effectiveness of Spinosad against Leucinodes
orbonalis, was reprted by Deshmukh and Bhamare, 2006 who
claimed 08.33 per cent infestation at the dose of Spinosad 50
SP @ 0.01 %, Adiroubane and Ragnuraman, 2008 reported the
per cent reduction of shoot infestation with five foliar sprays
with the per cent reduction of 90.93 % with the recommended
dose of Spinosad 45 SC (225 g a.i./ha).
The data revealed that all the treatments were
significantly superior over untreated control (Table 2). Highest
marketable yield (239.30 q/ha) and maximum net profit
(Rs. 1,03,210.00) was recorded from the plot treated with the
Spinosad followed by Carbaryl, Endosulfan, Quinalphos,
NSKE and neem oil. Imidacloprid recorded the lowest. On the
basis of incremental cost benefit ratio, Quinalphos was found
to be most economical with 1: 67.86 C:B ratio.

Table 1.
Table 2.
Tr.
No.
TAYDE and SIMON, Efficacy of Spinosad and Neem Products Against Shoot and Fruit Borer 209
Efficacy of insecticide, Spinosad and neem products against brinjal fruit and shoot borer, Leucinodes orbonalis
Guen.
Treat. Treatments
Shoot infestation Fruit infestation (%)
Yield
Yield
No.
(%) On number basis On weight basis (kg/plot) (q/ha)
T 1 Carbaryl 50 WP @ 0.2% 11.30 (19.59) 09.85 (18.28) 10.42 (18.83) 12.81 (20.97) 213.50
T 2 Imidacloprid 17.8 SL @ 0.004% 19.20 (25.99) 15.68 (23.31) 15.54 (23.21) 08.11 (16.54) 135.16
T 3 Endosulfan 35 EC @ 0.05% 11.78 (20.07) 10.12 (18.54) 10.74 (19.13) 12.38 (20.60) 206.33
T 4 Quinalphos 25 EC @ 0.05% 12.63 (20.79) 10.51 (18.91) 11.46 (19.78) 12.00 (20.26) 200.00
T 5 Spinosad 45 SC @ 0.01% 09.84 (18.26) 06.87 (15.12) 07.35 (15.73) 14.36 (22.26) 239.30
T 6 Neem Oil 1% 14.93 (22.72) 14.55 (22.43) 14.67 (22.53) 10.38 (18.79) 173.00
T 7 Neem Seed Extract 5% 13.58 (21.57) 13.35 (21.43) 14.04 (21.99) 11.22 (19.57) 187.00
T 8 Control 24.01 (29.32) 25.36 (30.20) 24.89 (29.92) 05.83 (13.97) 097.16
S.E. (m) ±
CD at 5 %
*Figures in the parenthesis are arc sine values.
Incremental cost benefit ratio for different treatments
Treatments
Price rate of
insecticide
Rs.
0.10
0.67
Cost of treatments
Cost of
insecticide (4
sprays)
Rs./ha
Labour
charges &
rent of
sprayer
(4 sprays)
Total cost
Rs./ha
(A)
Yield
q/ha
Increase
in yield
over
control
(q/ha)
Value of
increased
yield
(Rs./ha)
(B)
Incrementa
l benefit
(C=B-A)
T 1 Carbaryl 50 WP @ 0.2% 300.00 1200.00 720.00 1920.00 213.50 115.89 86917.50 84997.50 1:44.26
T 2 Imidacloprid 17.8 SL @ 0.004% 150.00 600.00 720.00 1320.00 135.16 38.00 28500.00 27180.00 1:20.59
T 3 Endosulfan 35 EC @ 0.05% 125.00 500.00 720.00 1220.00 206.33 109.17 81877.50 80757.50 1:66.19
T 4 Quinalphos 25 EC 0.05% 100.00 400.00 720.00 1120.00 200.00 102.84 77130.00 76010.00 1:67.86
T 5 Spinosad 45 SC @ 0.01% 666.00 2664.00 720.00 3384.00 239.30 142.14 106605.0 103210.0 1:30.49
T 6 Neem oil 1% 750.00 3000.00 720.00 3720.00 173.00 75.84 56880.00 53160.00 1:14.29
T 7 Neem Seed Extract 5% 375.00 1500.00 720.00 2220.00 187.00 89.84 67380.00 65160.00 1:29.35
T 8 Control -- -- -- -- 097.16 -- -- -- --
0.02
0.34
0.007
0.183
0.45
1.44
--
--
ICBR
(C/A)
ACKNOWLEDGEMENT
We are grateful thanks to Dean of Director of Research
who allotting field for this research work at central field of
Sam Higginbottom Institute of Agriculture, Technology and
Sciences, Allahabad, U.P.
LITERATURE CITED
Adiroubane, D. and Ragnuraman, K. 2008. Plant products and microbial
formulation in the management of brinjal shoot and fruit borer,
Leucinodes orbonalis (Guen.) Journal of Biopesticides, 1(2): 124-
129.
Deshmukh, R.M. and Bhamare, V.K. 2006. Field evaluation of some
insecticides against Brinjal shoot and Fruit borer, Leucinodes
orbonalis Guen. J. Agric. Sci., 2(1): 247-249.
Ratual, H.S. 1986. Losses due to insect pests and vectors in some
vegetable crops. Indian J. Ent., 48(4): 406-412.
Reddy, S.G.E. and Shrinivasa, N. 2005. Efficacy of insecticides against
Brinjal shoot and fruit borer, Leucinodes orbonalis (Guen.).
Pestology, 29(1): ......
Vevai, E.J. 1970. Know your crop, its pests problems and control
brinjal pests. Pesticides, 4(4): 26-35.
Recieved on 27.10.2010 Accepted on 25.11.2010

Trends in Biosciences 3 (2): 197-203, 2010
Detoxification of Triazophos Using Fungal Species Rhizopus oligosporus from Cotton
Soils of Andhra Pradesh
P. UDAYA SRI*, K.R.S. SAMBASIVA RAO* AND K.M. SUBBU RATHINAM#
*Department of Biotechnology, Acharya Nagarjuna University, Nagarjuna Nagar 522 510
#
Department of Zoology, Rajah Serfoji Govt.College, Thanjavur 613 005, Tamil Nadu
*e-mail: pudayasri@gmail.com
ABSTRACT
To overcome the deleterious effects of pesticides, the present
study has made an attempt to isolate the fungal species capable
of degrading organophosphorus pesticides (chlorpyriphos,
malathion and triazophos) that are widely sprayed on cotton
crop in Andhra Pradesh and to develop a model for the control
of pesticide pollution. The isolated species were identified
basing on microscopic structural and growth characterization
studies together with scanning electron microscopy and the
molecular characterization was also done basing on the
sequence analysis of the DNA coding for 18s rRNA of the test
fungal organism. The results may fit the findings of others on
the ability of some fungi to degrade pesticides and introduce
some new information on mineralization of the organic
constituents of pesticides. It was elucidated that the selected
fungal species is an effective biodegrading agent and by
optimizing the different cultural conditions and by using large
scale culture techniques, this fungal species, Rhizopus
oligosporus, can be very effectively used as biodegrading agent
in cotton fields as effective biocleaner and will be an
economically effective microbial process which is an alternative
for control of environmental pollution.
Key words
Pesticides, organophosphates, biodegradation,
environmental pollution.
Cotton is the world’s most important non-food
agricultural commodity, but in India it is one of the important
commercial fiber crops of south India. Cotton is easily damaged
by various sucking pests like jassids, aphids, thrips, whitefly,
redspider, mites, mealy bug and bollworms (Pimentel, 1983).
This accounts for the consumption of more amounts of
insecticides on cotton than any other single crop that is the
reason why cotton growers are always looking for ways to
protect their crops. Pesticides have gained an immense
importance for the very effective control of agricultural pests
which spoils 1/3 rd of food production. The indiscriminate use
of pesticides for pest control has resulted in unprecedented
chemical pollution and simultaneously affecting the non-target
organisms (Kurzel and Cetrulo, 1981; Hayes, 1986). Pesticides
and their residues pose a major problem by their accumulation
in different parts of the globe in general and in different
biological organisms of the food chain in particular (Singh, et
al., 1987). In the light of the importance and essentiality to
overcome the deleterious effects of pesticides, an attempt
has been made in the present study to investigate the
possibility of biodegradation of Triazophos using fungal
species and to develop a model for control of pesticide
pollution.
MATERIALS AND METHODS
A Survey of cotton cultivable area was carried out in
Guntur District of Andhra Pradesh. Soil samples were collected
from different areas by adopting simple random sampling
technique to isolate the pesticide degrading fungi from the
soils where tremendous pesticide consumption had taken
place. Soil samples were collected from Siripuram, Prathipadu,
Chilakaluripet and Amaravathi of Guntur district, which is the
leading district in the cultivation of cotton in Andhra Pradesh.
Information was obtained from farmers regarding the
extensively sprayed pesticides on cotton crop.
The soil samples were collected at a depth of 15 inches
depth from the soil where there was high moisture content,
because the fungi need moisture content for growth. The soil
sample collected was dispensed in the sterile bags and sealed
and the samples were brought to the laboratory and were
added with 1% of the selected insecticide in addition to
controls. After incubation for 4 weeks at 28ºC, soil samples for
isolation of fungi were taken using the dilution plate method.
The isolated fungi were identified using lactophenol cotton
blue staining technique, scanning electron microscopy and
molecular techniques.
Scanning Electron microscopic studies was carried out
by taking 24 h old cultures of test fungi and fixed in 6%
buffered Glutaraldehyde followed by post fixation in Osmium
tetroxide and then dehydrated in increasing concentration of
ethyl alcohol. The samples were mounted on copper stubs
with double sided adhesive tape, coated with gold polaron,
AU/PD sputter-coater and scanned in SEM (Jeol JSM 5600,
Japan) and photographed. The SEM studies were conducted
at Ruska laboratories, Sri Venkateswara Veterinary University,
Rajendranagar, Hyderabad.
The most powerful tool to identify the unknown fungal
species is to sequence the gene (DNA) coding for 18S rRNA,
which is present in the genome of the fungi. The gene coding
for the 18S rRNA is amplified using the Polymerase Chain
Reaction (Mullis, 1990), and the amplified product has been
subjected to sequencing and the sequence obtained has been
compared with the sequence obtained from the Nucleotide

198 Trends in Biosciences 3 (2), 2010
Database of NCBI.
Growth pattern of the strain was studied in potato
dextrose broth, czapekdox broth and sabourauds broth. The
isolated fungal strain was inoculated into the broth and the
culture was incubated at 20 0 C. At every 24hrs interval, growth
was noticed. The growth of the culture in broth is noticed by
taking the spore counts and dry weights at successive time
intervals using the following formula:
Total no. of spores in 5 squares
Formula = —––——————————— × 10 4 spores/cm
5
I + II + III + IV + V
= —–——————— × 10 4 spores/cm
5
The isolated fungal strain was inoculated into the potato
dextrose broth and the culture was incubated at 20 0 C. To assess
the growth at varied pH, the pH was adjusted as 4, 5,6,7,8 and
9. To assess the growth at varied salt concentrations, the salt
concentrations were adjusted as 0%, 0.5%, 5%, 7.5% and 10%.
Then the flasks were autoclaved at 15 lbs pressure for 20
minutes at 121 0 C. To assess the growth at varied temperatures,
the temperatures were adjusted as 25 0 C, 28 0 C, 30 0 C, 35 0 C, 37 0 C,
40 0 C, 45 0 C, 55 0 C and incubated for 4 days. (Aneja, 2003).
The isolated fungal strain was inoculated into the potato
dextrose broth and czapekdox medium and the culture was
incubated at 20 0 C. At every 24hrs interval, growth was noticed.
The growth of the culture in broth is noticed by taking the
spore counts and dry weights at successive time intervals.
The amount of the pesticide residue in the samples was
analyzed through GC technique. Residual pesticide and
pesticide breakdown products extracted from the microbial
degradation studies were quantified by GLC methods, using
Varian- model CP 3800 with a tritium source electron capture
detector and a Tracor model MT-220 with a Melpar flame
photometric detector (pulsated flame photometric detector)
(Ramesh Babu, et al., 2001).
RESULTS AND DISCUSSION
Although it is well established that the microorganisms
are capable of degrading pesticides and present in all types of
environment(s), still environmental pollution is a persistent
problem.
Different soil samples were collected from different
locations of cotton cultivated areas of Guntur District (Table
1). As the soil contain different useful bacterial and fungal
species, in our present investigation, the soil samples from
different areas were screened to identify the various bacterial
and fungal species present in the samples (Table 2). These
soil samples consist of various fungal species of the genus
Aspergillus, Fusarium, Penicillium, Rhizopus, Trichoderma
etc., The fungal isolates were cultured in the presence of the
selected widely used organophosphorus pesticides.
Microscopic structural and growth characterization,
scanning electron microscopic studies and molecular
characterization basing on DNA coding for 18s rRNA
sequences of the test organisms capable to degrade pesticides
were performed and it was concluded that the test fungus is
Rhizopus oligosporus. It is a fungus of the family Mucoraceae.
It produces fluffy, white mycelia which is flat, mealy, chalky
and pulverulent growth. It remains white even after the
sporulation. Germination proceeded in two separable phases:
Phase I (Swelling) and phase II (Germ tube protrusion). The
optimal conditions for germination were 28°C and pH 5.0. It
was observed that the sporangiospores contain insufficient
endogenous carbon for swelling or germination to occur in
distilled water. Initial swelling during phase-I occurred only
could be due to the presence of a suitable carbohydrate.
Subsequent production of germ tubes during phase II required
exogenous sources of both carbon and nitrogen. The
observations noticed were in accordance with the findings of
Richard and Dale, 1984 and Kobayasi, et al., 1992. Basing on
the microscopic observation and culture characteristics, it can
be concluded that the screened and identified species were
confirmed to be Rhizopus oligosporus.
The studies on Rhizopus oligosporus using Scanning
electron microscopy revealed that the isolated species contain
mycelial characters of Rhizopus oligosporus (Fig. 1). The
hyphae are well developed, profusely branched, septate and
hyaline. The cells are multinucleate. The conidiophores are
single or branched arising from vegetative hyphae, bearing
groups/clusters of conidiogenous cells/ phialides, where as
the conidiogenous cells are globose shaped with long rachis.
The scanning electron microscopic studies confirmed
that the screened species were confirmed to be as Rhizopus
oligosporus.
The genomic DNA of the isolated fungal organisms was
subjected for the isolation of DNA coding for 18s rRNA by
using PCR (Fig. 2). The bands were cut and eluted and the
DNA so obtained was subjected for sequencing.
Fig. 1. Scanning Electron Micrograph of Rhizopus oligosporus

SRI et al., Detoxification of Triazophos Using Fungal Species Rhizopus oligosporus from Cotton Soils of Andhra Pradesh 199
Table 1. Survey of Pesticides used in Guntur district, Andhre Pradesh
Sample
Siripuram Prathipadu Chilakaluripet Amaravathi
Pesticide Used Pesticide Used Pesticide Used Pesticide Used
Acetamiprid
Acetamiprid
Alphamethrin
Imidachloprid
Imidachloprid
(pyrethroid)
Quinolphos
Quinolphos
Imidachloprid
Chlorpyrifos
Chlorpyrifos
Quinolphos
Carbomate
Carbomate
Acetamiprid
Spinosyn
Spinosyn
Endosulphon
1 Acephate
(organophosphate)
Carbamate
Pyrethroid group
Monocrotophos
(organophosphate)
2 Spinosyns
Acephate
Pyrethroid group
Monocrotophos
(organophosphate)
3 Monocrotophos
Spinosyns
Carbomate
Acephate
Chlorpyrifos
Endosulphon
Acetamiprid
Cypermethrin
Alphamethrin
Spinosyn
Carbomate
Monocrotophos
Monocrotophos
Acetamiprid
Chlorpyrifos
Endosulphon
Acephate
Acetamiprid
Cypermethrin
Alphamethrin
Spinosyn
Carbomate
Monocrotophos
Monocrotophos
Acetamiprid
Chlorpyrifos
Endosulphon
Acephate
Quinolphos
Carbomate
Acetamiprid
Cypermethrin
Spinosyn
Alphamethrin
Cypermethrin
Carbomate
Spinosyn
4 Monocrotophos
Carbomate
Quinolphos
Pyrethroid group
5 Monocrotophos
Spinosyns
Acephate
Pyrethroid group
Quinolphos
6 Spinosyns
Acephate
Pyrethroid group
Nicotinoids
(Acetamiprid)
7 Spinosyns
Acephate
Chlorpyrifos
Carbomate
8 Acephate
Pyrethroid group
Quinolphos
9 Acetamiprid
Imidachloprid
Pyrethroid group
Monocrotophos
10 Carbomate
Spinosyns
Endosulphon
Quinolphos
Acetamiprid
Imidachloprid
Quinolphos
Monocrotophos
Chlorpyrifos
Monocrotophos
Acetamiprid
Quinolphos
Chlorpyrifos
Carbomate
-------------
Chlorpyrifos
Quinolphos
Spinosyn
Carbomate
Imidachloprid
Acetamiprid
Chlorpyrifos
Carbomate
Acephate
Quinolphos
Acephate
Chlorpyrifos
Monocrotophos
Spinosyn
Carbomate
Acetamiprid
Spinosyn
Acephate
Imidachloprid
Carbomate
Cypermethrin
Monocrotophos
Chlorpyrifos
Acephate
Imidachloprid
Acetamiprid
Imidachloprid
Quinolphos
Monocrotophos
Chlorpyrifos
Monocrotophos
Acetamiprid
Quinolphos
Chlorpyrifos
Carbomate
-------------
Chlorpyrifos
Quinolphos
Spinosyn
Carbomate
Imidachloprid
Acetamiprid
Chlorpyrifos
Carbomate
Acephate
Quinolphos
Acephate
Chlorpyrifos
Monocrotophos
Spinosyn
Carbomate
Acetamiprid
Spinosyn
Acephate
Imidachloprid
Carbomate
Cypermethrin
Monocrotophos
Chlorpyrifos
Acephate
Imidachloprid
Chlorpyrifos
Monocrotophos
Acephate
Quinolphos
Imidachloprid
Monocrotophos
Acephate
Acetamiprid
Spinosyn
Endosulphon
Cypermethrin
Carbomate
Imidachloprid
Chlorpyrifos
Endosulphon
Quinolphos
Acephate
Quinolphos
Chlorpyrifos
Alphamethrin
Acetamiprid
Monocrotophos
Cypermethrin
Quinolphos
Imidachloprid
Monocrotophos
Spinosyn
Quinolphos
Acetamiprid
Cypermethrin
Acephate
Carbomate
Chlorpyrifos
Spinosyn
Alphamethrin
The sequencing analysis of isolated DNA has revealed
that the amplified DNA corresponds to 600 base pairs for
Rhizopus oligosporus. The DNA sequence obtained for the
different isolated fungi is shown below.
The sequences obtained in the present investigation
were subjected to BLAST hit with the sequences of NCBI
database. Basing on the alignment occurred, aligned
sequences at the maximum degree were selected and the
phylogenetic tree was constructed. The phylogenetic tree so
obtained was given below (Fig. 4).
The microscopic structural and growth characterization
studies together with scanning electron microscopic studies
and amply supported by the molecular characterization basing
on the sequence analysis of DNA coding for 18s rRNA of the

200 Trends in Biosciences 3 (2), 2010
Table 2. Microorganisms collected in various soil samples of Guntur district, A.P.
Sample Siripuram Prathipadu Chilakaluripet Amaravathi
1 Aspergillus niger, Bacillus subtilis, Aspergillus Bacillus subtilis, Aspergillus E.coli, Penicillium notatum,
Saccharomyces cerevisiae, flavus, Saccharomyces niger, Trichoderma viride Bacillus subtilis
Fusarium oxysporum
cerevisiae
2 E.coli, Pseudomonas putida, Aspergillus terres, Pseudomonas Bacillus subtilis,
Bacillus subtilis,
Penicillium chrysogenum aeruginosa, Mucor racemosus, Aspergillus niger, Mucor Saccharomyces cerevisiae,
Bacillus subtilis
racemosus,
Rhizopus Fusarium solani, Mucor
microsporus
indicus
3 Bacillus cereus, Fusarium Penicillium chrysogenum, Penicillium chrysogenum, Pseudomonas aeruginosa,
solani, Aspergillus flavus
Fusarium solani, Bacillus
subtilis,
Trichoderma viride
Fusarium oxysporum, Mucor
racemosus.
E.coli,
Fusarium oxysporum
4 Mucor racemosus,
Rhizopus microsporus, E.Coli, E.Coli, Pseudomonas putida, Saccharomyces cerevisiae,
Trichoderma viride, E.Coli Bacillus subtilis, Fusarium Fusarium solani, Rhizopus Mucor indicus, Trichoderma
oxysporum, Pseudomonas putida microsporus Saccharomyces viride
cerevisiae
5 E.coli, Pseudomonas Bacillus cereus, Pseudomonas Pseudomonas putida, Bacillus Bacillus subtilis,
aeruginosa,
aeruginosa,
subtilis,
Mucor indicus, Aspergillus
Rhizopus microsporus, Rhizopus microsporus, Fusarium Fusarium oxysporum, flavus, E.Coli
Aspergillus niger
oxysporum
Aspergillus niger
6 Achromobacter, Bacillus Bacillus subtilis, E.Coli, Bacillus subtilis, E.Coli E.coli,
subtilis,
Aspergillus niger, Pseudomonas Rhizopus microsporus, Rhizopus microsporus,,
Penicillium
notatum, aeruginosa
Penicillium chrysogenum Saccharomyces cerevisiae
Saccharomyces cerevisiae
7 Mioxococcus,
Mucor racemosus, Aspergillus Bacillus subtilis, Micrococcus, E.coli, Pseudomonas putida,
Alternaria solani, Aspergillus flavus, Penicillium chrysogenum Fusarium solani, Mucor Penicillium notatum,
niger,
racemosus
Trichoderma viride
Trichoderma viride
8 Bacillus subtilis, Pseudomonas E.Coli,
Pseudomonas putida, Bacillus Bacillus subtilis, E.coli,
putida,
Rhizopus microsporus, Fusarium subtilis,
Saccharomyces cerevisiae,
Rhizopus stolanifer,
solani
Mucor racemosus, Aspergillus Fusarium solani
Trichoderma viride
terres
9 E.coli,
Bacillus subtilis, Pseudomonas Achromobacter,
Pseudomonas putida,
Aspergillus flavus, Fusarium aeruginosa, Aspergillus flavus Penicillium notatum, Rhizopus Alternaria solani, Fusarium
solani
microsporus, Saccharomyces oxysporum
cerevisiae
10 Pseudomonas aeruginosa, Bacillus subtilis,
Pseudomonas putida, Bacillus cereus, E.coli,
Aspergillus terres
Myxococcus, Penicillium Aspergillus niger, E.Coli Aspergillus flavus, Mucor
notatum
indicus
18S ribosomal RNA gene of Rhizopus oligosporus
GGAAGGATCATTAACTAATGTATTGGCACTTTACTGGGATTTACTTCTCAGTATTGTTTGCTTCTAT
ACTGTGAACCTCTGGCGATGAAGGTCGTAACTGACCTTCGGGAGAGACTCAGGACATATAGGCTAT
AATGGGTAGCTGTTCTGGGGTTTGATCGATGCCAATCAGGATTACCTTTCTTCCTTTGGGAAGGAA
GGTGCCTGGTACCCTTTACCATATACCATGAATTCAGAATTGATATAATAACAACTTTTAACAATGG
ATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCG
TGAATCATCGAGTCTTTGAACGCAGCTTGCACTCTATGGATCTTCTATAGAGTACGCTTGCTTCAGT
ATCATAACCAACCCACACATAAAATTTATGTGGTGATGGACAAGCTCGGTTAAATTTAATTATTATA
CCGATTGTCTAAAATACAGCCTCTTTGTAATTTTCATTAAATTACGAACTACCTAGCCATCGTGCTTT
TTTGGTCCAACCAAAAAACATAATCTAGGGGTTCTGCTAGCCAGCAGATATTTTAATGATCTTTAAC
TATGATCTGAAGTCAAGTGG
test fungal organisms, it was confirmed that the isolated fungi
belongs to Rhizopus oligosporus and further confirmed that
these fungi are capable to degrade the organophosphorus
pesticides. The study was extended to develop an effective
biodegradation model.
From the observations, it was evident that the Potato
Dextrose broth has produced more number of spores followed
by Czapekdox broth and least number of spores was produced
in Sabourauds broth (Table 3).
After inoculation of Rhizopus oligosporus in the potato
dextrose broth, incubated at different temperatures (25 0 C, 28 0 C,
30 0 C, 35 0 C, 37 0 C, 40 0 C, 45 0 C and 55 0 C) for 4 days, maximum
growth was observed at temperatures of 25 0 C, 28 0 C and 30 0 C
whereas minimal growth was observed at temperatures 35 0 C

SRI et al., Detoxification of Triazophos Using Fungal Species Rhizopus oligosporus from Cotton Soils of Andhra Pradesh 201
Table 3. Growth of Test fungi on different media
S.No. Medium
R. oligosporus (Spore count per ml)
1 Potato Dextrose broth 4.74X10 6
2 Czapekdox broth 2.84X10 6
3 Sabourauds broth 0.64X10 6
Table 4.
Effect of physico-chemical parameters
(Temperature, P H and Salt concentration) on the
growth of test fungi
Physico-chemical parameter Varied value Rhizopus oligosporus
Temperature( o C)
25 ++
28 ++
30 ++
35 +
37 +
40 -
45 -
55 -
pH
2.5 -
3.5 -
4.5 +
5.5 ++
6.5 +
7.0 +
7.5 +
8.5 +
9.5 -
Salt concentration (%)
0 +
0.5 +
2.5 +
5 -
7.5 -
10 -
and 37 0 C and there was no growth above temperatures of
40 0 C. This reveals that the optimum temperature for Rhizopus
oligosporus was 25 0 C - 30 0 C (Table 4).
Potato dextrose broth with different pH (2.5, 3.5, 4.5, 5.5,
6.5, 7, 7.5, 8.5, 9.5) was inoculated with Rhizopus oligosporus
and incubated for 7 days. Growth was not observed in the
flasks with pH 2.5, and 3.5. Maximum growth was observed at
Fig. 2. Agarose gel showing Genomic DNA
Well 2: Genomic DNA of Rhizopus oligosporus
Well 4: DNA Ladder
Table 5.
Optimization of media in presence of pesticide
(Triazophos) by Rhizopus oligosporus
Medium
% of degradation
Potato Dextrose Broth 49.07
Czapekdox Broth 33.10
Fig. 3. Agarose gel showing the amplified 18sDNA
Well 3: DNA Ladder
Well 4: Amplified DNA of Rhizopus oligosporus
pH 5.5 and moderate growth was observed at pH 4.5, 6.5, 7.0,
7.5 and 8.5 and no growth was observed at pH 9.5. These
results indicate that the optimum pH for the growth of the
selected fungus at these conditions was 5.5 and moderate
growth in between 6.5 to 8.5 (Table 4).
Growth medium with different salt concentrations (0%,
0.5%, 5%, 7.5% and 10%) were inoculated with Rhizopus
oligosporus and incubated for 7 days. The growth was
observed in all the inoculants of NaCl concentration of 0%,
0.5% and 2.5% where as the growth was not observed in 5%,
7.5% and 10% of NaCl concentration. This gives the
information that the growth possibility for our desired fungi
was upto 2.5% Sodium chloride (NaCl) concentration only
(Table 4).
The degradation capability of selected fungal species,
Rhizopus oligosporus on selected organophosphate
pesticide, Triazophos was confirmed through Gas
chromatography. The biodegradation of Triazophos with the
above selected fungal species for medium composition for
each combination of a particular species and pesticide was
investigated.
Triazophos was degraded to the maximum extent by
Rhizopus oligosporus. In both the media, i.e., Potato Dextrose
broth and Czapekdox medium, similar pattern of degradation
of the respective organophosphate pesticides was noticed. It
was also evident that the maximum percentage of degradation
was seen in potato dextrose broth by the test fungi on the
used organophosphate pesticides (Table.5).
The pesticide residues were extracted from the culture

202 Trends in Biosciences 3 (2), 2010
Fig. 4. Phylogenetic tree of Rhizopus oligosporus
Fig. 5. Gas chromatograph of Triazophos standard
Fig. 6. Gas chromatograph of Triazophos control

SRI et al., Detoxification of Triazophos Using Fungal Species Rhizopus oligosporus from Cotton Soils of Andhra Pradesh 203
an efficient alternative for the control of environmental
pollution as it is screened from the soils with 7-8 years of
cotton growing history and was isolated in presence of the
selected pesticide.
LITERATURE CITED
Fig. 7. Gas chromatograph of Triazophos sample
medium by liquid-liquid extraction method and the analysis of
the pesticide residue samples was carried out by using Gas
chromatography technique.
It was clearly evident that the cotton cultivated soils are
prone for heavy pesticide residues due to the continuous
usage and it is quite possible that these pesticides can enter
into food chain and can cause several deleterious effects even
to human beings. Results of the present study may fit the
findings on the ability of fungi to degrade pesticides and
introduce some new information on mineralization of organic
constituent of pesticides. This will decrease the side effects
of pesticides on the non-target microorganisms that play an
important role in soil fertility. In the light of this, an attempt
has to be made further, to investigate the possibility of
biodegradation of various organophosphorus pesticides using
the fungal isolate Rhizopus oligosporus.
The study elucidated that the selected fungal species
can be employed as effective biodegrading species. By further
optimizing the different culture conditions, the selected fungal
species, Rhizopus oligosporus can be used as an effective
biodegrading agent in cotton fields. Also it was found to be
Alexander M. 1994. Biodegradation and Bioremediation, Academic
Press, San Diego, pp. 139.
Aneja, K.R. 2003. Experiments in Microbiology, Plant Pathology,
Tissue Culture and Mushroom Production Technology; New Age
International Publishers; Third ed. pp.221-240.
Hayes, W.J. 1982. Pesticides Studied in Man. Baltimore, MD: Williams
and Wilkins, Baltimore, pp.49.
Kobayasi S., Okazaki N. and Koseki T. 1992. Purification and
characterization of an antibiotic substance produced from Rhizopus
microsporus, IFO 8631.
Kurzel, R.B., Certrulo, C.L. 1981. The effect of environmental
pollutants on human reproduction, including birth defects. Environ.
Sci. Technol., 15: 626–631.
Mullis, K.B. 1990. The Unusual origin of Polymerase Chain reaction.
Scientific American., April: 36-43.
Pimentel, D. 1983. Effects of pesticides on the environment. 10th
Intl. Congress on Plant Protection. Crydon, U.K. 2: 685-691.
Ramesh Babu, T., Srinivasa Rao, Ch., Narasimha Reddy, K. 2001.
Temperature programmed gas chromatography method for the
determination of pesticide residues. Indian Journal of Plant
Protection, 29(1, 2): 161-164.
Richard D. M. and Dale W. G. 1984. Germination of Rhizopus
microsporus Sporangiospores, Appl Environ Microbiol, 48(6): 1067–
1071.
Singh, V.K., Singh, A., Singh, S.P. 1987. Effect of interaction of
herbicides on chlorophyll and mineral content of rice leaves. J.
Agric. Res., 2: 175–177.
Recieved on 15.08.2010 Accepted on 09.10.2010

204 Trends in Biosciences 3 (2): 204-205, 2010 Trends in Biosciences 3 (2), 2010
Study on Infection Intensity and Changes in Total Protein Content in Tissues of
Channa punctatus Infected with Helminth Parasites
KRISHNA SINGH AND AMIT SRIVASTAVA
Department of Applied Animal Sciences, Babasaheb Bhimrao Ambedkar University, Vidya Vihar, Raebareli
Road, Lucknow (U.P.) 226 025
e-mail: sri_amit77@rediffmail.com
ABSTRACT
Infection with the helminthes parasite can lead to severe
changes in protein content and may result in host mortalities
in commercial fish farming. The nutritive value of fish may be
degraded through the activities of helminthes parasite and their
cysts. The affinity of helminthes parasite to different organs
could result to mechanical pressure which may set up
inflammation, cause the formation of connective tissue and
rupture of host tissue. The present study checks the affinity of
helminthes parasite and their cysts on total protein content in
certain tissues viz; stomach, liver, kidney, pancreas and intestine
of freshwater fish Channa punctatus. The prevalence of infection
of helminthes parasite showed great difference between all
the classes. Among the tested tissues the prevalence of infection
in kidney was found to be maximum whereas, the liver was
found to be least affected as compared to rest of the tissues.
Key words
Helminth parasite, protein, Channa punctatus,
infection, tissues and affinity
A majority of fishes carry heavy infection of parasites,
which cause deterioration in the food value of fish and may
even result in their mortality. Besides, there are a number of
‘helminth parasites’ which are transmitted to men only through
fish. The activities of parasite damage the tissues lining the
wall of intestine, stomach, bile duct, liver, etc and cause
microscopic lesions in the host’s tissue which become the
site for secondary infection by bacteria (Khanum, et al., 2008).
The prevalence of infection of helminthes parasites in
the fish species increased with their standard length and body
weight (Olofintoye, 2006). However, myriad of parasites are
associated with fishes in their natural habitats, where they
cause morbidity, mortality and economic losses in fish
production in the world (Khalil and Thurstom, 1973;
Subashinghe, 1995). One of the most common effects of
parasitism is destruction of the host’s tissues. This may be a
mechanical action when parasite or their larval stages migrate
through or multiply in tissues or organs, or when various
organs of attachment (e.g. head-spines or teeth, claws,
suckers, etc) are inserted into the tissues as anchors. Van Dan
Brock, 1979 revealed that the pathological conditions arising
from parasites infection which lead to serious consequence
especially the nutritive devaluation of the fish.
Channa punctatus is an important member of fresh
water fishes and it is commercially important due to its food
value. This fish prefer to live in muddy waters and streams
and they have adapted to live in stagnant waters (Moyle and
Cech, 1998). It is necessary from a public health viewpoint to
estimate difference source of stress on cultured fish.
Therefore, an attempt has been made during the present work
to study the change in protein content of certain tissues i.e.,
liver, stomach, pancreas, intestine and kidney of Channa
punctatus infected with helminth parasite.
MATERIALS AND METHODS
The fresh water air breathing fish Channa punctatus
were collected from local fish market of Lucknow and brought
to the laboratory in living condition. Total weight and length
of fish species ranged from 27 to 33gm (mean±SEM: 29.90±9.64)
and 14 to 19cm (mean±SEM: 15.7±1.35) were used for the
study. The fishes were sacrificed and opened dorsoventrally
and its internal organs were examined for parasites. The entire
digestive system was removed and placed in a petridish. The
parasites and their cysts were recovered from fish tissue. All
the infected and non-infected tissue was stored in freezer for
protein analysis. The wall of stomach and intestine were
carefully examined for the presence of ulcers, cysts and
burrowing parasites. The content of stomach and intestine
were flushed and solid contents being collected for
examination. After examination, total protein content of various
infected and non-infected tissues homogenate of C. punctatus
were determined by Lowry, et al., 1951 with crystalline Bovine
Serum Albumen (BSA) as a standard solution. A standard
solution of BSA was made and absorbance of blue color was
measured at 750nm against a reagent blank with the help of
Spectrophotometer. Homogenate were prepared in 0.6% saline
solution and centrifuged at 10,000 rpm for 15 minutes. Now
0.1 ml of supernatant was taken and added 5 ml alkaline copper
reagent, 0.5 ml of 1N Folin-ciocalten reagent and then measure
the absorbance against standard solution. The intensity of
blue color is proportional to the amount of protein being
estimated. The value have been expressed as mg/gand
comparative study was made between different tissues viz.;
kidney, pancreas, intestine, stomach and liver. The prevalence
of infection was calculated by dividing the number of infected
fish sample with the total number of examined ones and
expressed as a percentage. Analysis of variance (ONE WAY
ANOVA) statistics and Newman Keul’s Multiple Range Test
were used. Significance was taken at p

SINGH & SRIVASTAVA, Study on Infection Intensity and Changes in Total Protein Content in Tissues 205
RESULTS AND DISCUSSION
There was significant (p

210 Trends in Biosciences 3 (2): 210-211, 2010 Trends in Biosciences 3 (2), 2010
Prevalence of Helminth Parasites of Goats and Sheep in Bhognipur Area of Kanpur,
U.P.
SIDDIQUA BANO
Department of Zoology, A.N.D. College, Kanpur 208 012 (U.P.)
e-mail: siddi.bano@yahoo.com
ABSTRACT
A parasitic investigation carried out in 160 goats and 160 sheep
of aged between 1-2 years in Bhognipur area of Kanpur, U.P.
during the period from Feb. 2000 to Feb. 2005 which revealed
the presence of Avitellina sp., Moniezia sp., Trichuris sp.,
Haemonchus sp., Stongyloides sp., Dicrocoelium sp.,
Oesophagostomum species. Out of 160 goats a total 29.37% and
out of 160 sheep a total 35.62% were positive for these parasites.
Avitellina sp. (6.25%), Moniezia sp. (5.62%), Fasciola sp. (4.37%),
Trichuris sp. (3.75%), Haemonchus sp. (3.12%), Strongyloides sp.
(2.50%), Dicrocoelium sp. (1.87%) and Oesophagostomum sp.
(1.87%) were noted in goats but in sheep Avitellina sp. (7.50%),
Moniezia sp. (6.87%), Fasciola sp. (5.62%), Trichuris sp. (3.12%),
Haemonchus sp., (3.75%), Strongyloides sp. (3.75%), Dicrocoelium
sp. (2.50%) and Oesophagastomum sp. (2.50%) were noted. The
incidence was higher in rainy season and lower in winter
season but moderate in spring and summer season. Overall
the rate of infection was much higher in sheep (35.62%) than
goats (29.37%).
Key words
Helminth parasites, goat and sheep
The helminth parasites infections are localized in nature
and are often related to the particular habitat types (Kennedy,
1975). The helminth parasites infecting livestock have been
studied in various climatic regions of India (Singh, et al., 1993;
Jain, 1993). Based on these findings the present study was
conducted to know the species diversity and rate of infection
of helminth parasites of goats and sheep in Bhognipur area of
Kanpur.
MATERIALS AND METHODS
The post-mortem and microscopic examination of faecal
samples of 160 goats and 160 sheep were conducted during
the period from Feb. 2000 to Feb. 2005 in various seasons viz.,
spring, summer, rainy and winter seasons in Bhognipur area
of Kanpur. The parasites recovered from the infected organs
were morphologically identified as per the key of Soulsby,
1982. Trematoda eggs were identified on the basis of
morphological details described for Fasciola gigantica and
Dicrocoelium dentriticum eggs by Yamaguti, 1975 method.
The faecal samples were examined by direct smear
sedimentation technique and zinc sulphate floation technique
for the presence of egg (Sastry, 2000). Counting of eggs was
done by Mc Master egg counting technique. The seasonal
variations have been also observed in the incidence of helminth
infection in four different season viz., spring (Feb.-April),
summer (May-July), rainy (Aug.-Oct.) and winter (Nov.-Jan.).
RESULTS AND DISCUSSION
Out of 160 goats and sheep, only 47 (29.37%) goats and
57 (35.62%) sheep were found to be positive for eleven kinds
of helminth parasites (Table 1), were two species of trematode
namely, Fasciola gigantica, Dicrocoelium dentriticum, four
species of cestoda viz., Moniezia expansa, M. benedini,
Avitellina centripunctata, A. woodlandi and five species of
nematodes viz., Strongyloides papillaus, Trichuris ovis, T.
globulosa, Oesophagostomum calumbianum, Haemonchus
contortas were encountered in goats and sheep.
The present study indicates that the presence of
helminth infection ranges 29.37% in goats and 35.62% in sheep
with prevalence of eleven species of pathogens in Bhognipur
area of Kanpur. The result revealed that the infection range of
helminth parasites is much higher in sheep than goat. The
No. of goat infected
No. of Goat infected
8
7
6
5
4
3
2
1
0
10
9
8
7
6
5
4
3
2
1
0
Fasciola gigantica
Fasciola gigantica
Dicrocoelium
dentriticum
Dicrocoelium
dentriticum
Moniezia expansa
Moniezia expansa
M. benedini
M. benedini
Avitellina
centripunctata
Avitellina
(a)
Fig. 1. a and b. Number of parasite and their intensity in goats
and sheep infected in Bhognipur. a. Goat and b. Sheep
A. woodlandi
Strongyloides
papillaus
No. of parasite
No. of parasite
centripunctata
A. woodlandi
(b)
Strongyloides
papillaus
Trichuris ovis
Trichuris ovis
T. globulosa
T. globulosa
oesophagostomum
calumbianum
oesophagostomum
calumbianum
Haemonchus
contortus
Haemonchus
contortus

Table 1.
Siddiqua Bano, Prevalence of Helminth Parasites of Goats and Sheep in Bhognipur Area of Kanpur, U.P. 211
Helminth parasite infection of goats and sheep in Bhognipur, Kanpur
S. No. Pathogen
Goats (n = 160) Sheep (n = 160)
No. of infection % infection No. of infection % infection
1. Fasciola gigantica 7 4.37 9 5.62
2. Dicrocoelium dentriticum 3 1.87 4 2.50
3. Moniezia expansa 4 2.50 6 3.75
4. M. benedini 5 3.12 5 3.12
5. Avitellina centripunctata 6 3.57 7 4.37
6. A. woodlandi 4 2.50 5 3.12
7. Strongyloides papillaus 4 2.50 6 3.75
8. Trichuris ovis - - 5 3.12
9. T. globulosa 6 3.75 - -
10. Oesophagostomum calumbianum 3 1.87 4 2.50
11. Haemonchus contortus 5 3.12 6 3.75
percentage of goats and sheep infected with different
parasites are shown in Fig. 1(a),(b). The Fasciola gigantica
is found to be dominant of Avitellina centripunctata and
other parasites in goats. The Trichuris globulosa is followed
by M. benedeni, Haemonchus contortus, M. expansa, A.
woodlandi, Strongyyloides, Dicrocolium dentriticum and
Oesophagastomum columbianum Fig. 1(a). The Fig (b) shows
M. expansa, Strongyloides and Haemonchus contortus were
same prevalent followed by M. benedeni, A. woodlandi, T.
ovis, Dicrocoelium dentriticum and Oesophagostomum in
sheep. These finding corroborates with the observation of
Sharma, 1991 who encountered similar helminth species.
The peak incidence of infestation in our study was
observed during the rainy season (42.5% goats and 40.3%
sheep) and low percentage (10.6% goats and 8.77% sheep) in
winter season. Moderates percentage of infection was
observed in spring (17.0% goat and 17.5% sheep) and in
summer (29.7% goats and 33.3% sheep). The high percentage
of infection during rainy season might be attributed to
contamination of pasture with eggs and larvae at favourable
temperature and humidity. The lowest prevalence was
observed during winter season. It seems probable that the
infective stage of eggs and larvae die at lower temperature.
While in Kashmir, the prevalence of helminth was found to be
fairly high about 54% during winter and lowest (33%) during
summer (Singh, 2001). This difference indicates the adaptability
according ot the climatic conditions existing in different
geographical area.
ACKNOWLEDGEMENT
The authors are grateful to the authorities of slaughter
houses, meat and mutton shopkeepers of Bhognipur area of
Kanpur for their cooperation and help in furnishing necessary
materials and to Department of Zoology, A.N.D. College,
Kanpur for providing required research facilities.
LIETRATURE CITED
Jain, P.C. 1993. Helminth parasites of goats in Madhya Pradesh and
their treatment. Veterinary Mhow, 4(1): 53-57.
Kennedy, C.R. 1975. Ecological animal parasitalogy. Blackwell Scientific
Publications, Oxcford.
Sastry, G.A. 2000. Clinical parasitology In: Veterinary clinical pathology,
Triputa, Tirupati, pp.79-80
Sharma, R.K. 1991. Helminth parasites of some domestic animals in
Bermo Coalfield area. Indian Journal of Helminthology, 43(2):
100-103.
Singh, B.P. 2001. Parasitic infection in farm animals in different
climates. In: Climate in relation to livestock production and health
(eds. Hooda Ok, Meur, S.K., Singh, G., Mahapatra, R.K.), CAS in
veterinary physiology, IVRI, Izatnagar, Bareielly, U.P. pp.36-37.
Singh, R., Sahai, B.N., Ansari, M.Z., Singh, S.K. 1993. Incidence of
common helminthic infections in livestock and poultry. Journal of
Research, Birsa Agricultural University, 5(1): 93-95.
Soulsby, E.J.L. 1982. Helminthes, arthropods and protozoa of
domesticated animals, 7 th edn, ELBS and Bailliere Tindall, London,
pp.809.
Yamaguti, S. 1975. A synoptical review of life histories of digenetic
trematodes of vertebrate with special reference to morphology of
their larva. Kelgoku Pub. Co. Tokyo, pp.410-413.
Recieved on 19.05.2010 Accepted on 28.07.2010

216 Trends in Biosciences 3 (2): 216-219, 2010 Trends in Biosciences 3 (2), 2010
Toxicity Study of Ethanolic Extract of Parthenium hysterophorus in Rats
VEENA, B. KUSHWAHA* AND SHIVANI MAURYA
Department of Zoology, DDU Gorakhpur University, Gorakhpur 273009, Uttar Pradesh
e-mail: vbk2006@sify.com
ABSTRACT
LD 50
of ethanolic extract of Parthenium hysterophorus L. after
oral administration was found to be 676.65 mg/kg body weight
against rats. Tremor, convulsion, diarrhea, labored breathing,
abnormal gait, food avoidance, reduced food consumption,
increase in relative liver weight and decrease in body weight
was observed in rats on exposure to sub lethal dosage of
ethanolic extract of Parthenium hysterophorus. All the
observations were found to be time and dose dependent in both
male and female rats.
Key words
Parthenium hysterophorus, toxicology symptoms,
tremor, convulsion
Parthenium hysterophorus exhibits a wide spectrum of
biological activities, which include cytotoxic, antitumour,
allergic, antimicrobial, antifeedant, phytotoxic and insecticidal
properties (Rodriguez, et al., 1976). Though Parthenium
hysterophorus is reported to have several pharmacological
activities, its toxic effect on the behavior of mammals needs to
be evaluated. Therefore, the present study was designed to
assess LD 50
and effects of ethanolic extract of plant
Parthenium hysterophorus on behavior of rats when exposed
to sub-chronic dosage.
MATERIALS AND METHODS
Healthy adult male and female albino rats weighing
approximately 60-160 g were selected for the experiments. They
were kept in large cage at room temperature 25 o C±5 o C. Rats
were exposed to a photoperiod of 12 hours per day. The rats
were acclimatized to laboratory conditions for 10 days and
fed on rat pellets and water ad libitum. Each rat was weighed
and assigned a number for convenience prior to the onset of
the experiment. Parthenium hysterophorus was collected from
the university campus, D.D.U. Gorakhpur University,
Gorakhpur, Uttar Pradesh, India. Five hundred gram of air dried
aerial parts of P. hysterophorus were grounded into a fine
powder and extracted continuously with 1.5 liter of ethanol
using a soxhelet apparatus for 12 hours. The resulting dark
brown extract was evaporated to dryness in a flash evaporator
at room temperature and the residue was designated as
ethanolic extract of P. hysterophorus (EEPH).
To assess the lethality of ethanolic extract of P.
hysterophorus ten rats were used for each dose. Different
dose of the extract, ranging from 100-1600 mg/kg body weight
was administered orally by gavage (using 1.0 ml syringe) daily
for a period of seven days. Number of surviving animals of
each group was recorded for over seven days. Animals that
did not receive any test substance served as controls. The
dose that brought 50% mortality (LD 50
) was determined using
the software Polo plus version 2.
Sub chronic treatment: Rats were weighed and divided
respective to sex into six groups. One group of each sex of
rats were administered orally a sub lethal dose, 200 mg/kg
body weight and other group, 400 mg/kg body weight of extract
till 28 th day of experiment. All the rats of control group were
given vehicle (solvent) of similar dilution through oral route.
The toxicity signs, developed as a result of oral
administration of the ethanolic extract of P.hysterophorus, were
recorded at 7 th , 14 th , 21 st and 28 th day.
Clinical signs of toxicity; tremors, convulsion, diarrhea
and labored breathing were observed. Food consumed by the
rats under investigation was noted as gram/rat/day. Food
avoidance was also observed. Abnormal gait of the rats was
registered in all the sets, Assessment of body weight and
relative liver weight,Rats were weighed initially and after the
experimental regimen. The relative change in body weight was
determined. The rats were reweighed and sacrificed. The liver
was dissected out from control and sub chronically treated
rats on 7 th , 14 th , 21 st , 28 th days for organ weight. Liver weight
was determined in relation to body weight as relative weight
of liver.
RESULTS AND DISCUSSION
The LD 50
values of different sesquiterpene lactones
range between 3 and 150 mg/kg body weight of test animals
(Narasimhan, et al., 1984). LD 50
of parthenin from P.
hysterophorus is reported to be 42.3 mg/kg body weight when
administered through intravenous route (Narasimhan, et al.,
1984). Crude 50% extract of P. hysterophorus flowers were
found to be toxic to the animals at 1000 mg/kg body weight
dose (Talakal, et al., 1995). The ethanolic extract of P.
hysterophorus was lethal to rats. Fifty percent mortality was
observed with these at dose ranging from 600-850 mg/kg body
weight. LD 50
analysis of ethanolic extract yielded two dose
limits viz., one on the higher side 845.072 mg/kg body weight
and the other on the lower side 512.261 mg/kg body weight.
The LD 50
of ethanolic extract of P. hysterophorus against rats
was found to be 676.647 mg/kg body weight. ‘t’ ratio value
(4.846) greater than 1.6 indicates a significant regression. The
value of heterogeneity factor (0.576) less than 1.0 denotes
that in the replicate tests of random samples the concentration
response lines would fall within 95% confidence limits and

Kushwaha & Maurya, Toxicity Study of Ethanolic Extract of Parthenium hysterophorus in Rats 217
the model fits the data adequately (Table 1). The result of the
present study indicates that the toxicity after oral
administration of ethanolic extract of P. hysterophorus is very
high. Substances with LD 50
value lower than 1000 mg/kg
body weight by the oral route are regarded as highly toxic
(Clarke and Clarke, 1977). The route of exposure of the chemical
seems to be a unique factor in the variation of the toxicity. The
toxic manifestation of intra-muscular administration are more
sever and quick than the oral ones (Hwang and Schanker,
1974).
Table 1.
LD 50
(mg/kg
body weight)
Toxicity of ethanolic extract of plant Parthenium
hysterophorus on rats
Lower limit
(mg/kg
body weight)
Upper limit
(mg/kg
body weight)
‘t’ ratio Heterogeneity
676.647 512.261 845.072 4.846 0.576
Batches of 10 rats were exposed to different doses of above treatment.
Mortality was observed after 7 days. Doses were given orally.
Diarrhea was not observed in control group. In the rats
treated with ethanolic extract of P. hysterophorus, 200 mg/kg
body weight, diarrhea was observed on 14 th , 21 st and 28 th day
from 5 to 15 minute after treatment in both male and female
rats. On exposure to 400 mg/kg body weight of ethanolic extract
of P. hysterophorus diarrhea was observed at 7 th day from 5 to
15 minutes, at 14 th day form 5 to 30 minutes and at 28 th day
from 5 to 60 minutes after treatment in both male and female
rats.
Tremor was not observed in control rats. In treated
groups on exposure to 200 mg/kg body weight of ethanolic
extract of P. hysterophorus tremor was observed at 21 st and
28 th day from 5 to 15 minutes after treatment in both male and
female rats. On exposure to 400 mg/ kg body weight of ethanolic
extract of Parthenium hysterophorus tremor was observed at
14 th day from 5 to 15 minutes, at 21 st day from 5 to 60 minutes
and at 28 th day from 5 to 60 minutes after treatment in both
male and female rats.
Table 2.
Toxic symptoms observed in rats on exposure to
sub-chronic dosage of ethanolic extract of
Parthenium hysterophorus via oral route
Dose (mg/kg Days Toxic symptoms
body weight)
200 7 th Food avoidance
14 th Food avoidance, diarrhea, abnormal gait
21 st Food avoidance, diarrhea, abnormal gait, tremor,
convulsion, labored breathing
28 th Food avoidance, diarrhea, abnormal gait, tremor,
convulsion, labored breathing
400 7 th Food avoidance, diarrhea, abnormal gait
14 th Food avoidance, diarrhea, abnormal gait, tremor,
convulsion
21 st Food avoidance, diarrhea, abnormal gait, tremor,
convulsion, labored breathing
28 th Food avoidance, diarrhea, abnormal gait, tremor,
convulsion, labored breathing
Rats in control group showed no signs of convulsion.
In treated female rats convulsion was observed at 28 th day
from 5 to 15 minutes after 200 mg/kg body weight on exposure
to ethanolic extract of P. hysterophorus while in male rats
convulsion was observed at 21 st day from 5 to 15 minutes and
at 28 th day from 5 to 30 minutes. On 400 mg/kg body weight
exposure to ethanolic extract of Parthenium hysterophorus
convulsion was observed at 14 th and 21 st day from 5 to 30
minutes and both male and female rats showed signs of
convulsion from 5 minutes till they were observed on 28 th day
after the administration of extract.
Labored breathing was not observed in rats of control
group. In both male and female rats exposed to 200 mg/kg
body weight of ethanolic extract of Parthenium hysterophorus
labored breathing was observed at 21 st and 28 th day from 5 to
30 minutes after treatment, while on 400 mg/kg body weight
exposure of extract labored breathing was observed at 21 st
day from 5 to 30 minutes and at 28 th day from 5 minutes and
extended till the animal was observed.
Rats in control group had normal gait. On exposure to
200 mg/kg body weight of ethanolic extract of Parthenium
hysterophorus abnormal gait was observed at 14 th day from 5
to 15 minutes, at 21 st and 28 th day from 5 to 30 minutes, after
treatment in both male and female rats. On exposure to 400
mg/kg body weight of ethanolic extract of Parthenium
hysterophorus abnormal gait was observed at 7 th day from 5
to 15 minutes, at 14 th day from 5 to 30 minutes, at 21 st and 28 th
day from 5 to 180 minutes after treatment in both male and
female rats.
Rats in control group avoided food on 7 th and 14 th day
from 5 to 15 minutes. They were normal and had food
afterwards. Rats both male and female on treatment with 200
mg/kg body weight of extract avoided food during our
observations. Avoidance of food was more in female rats on
21 st and 28 th day in comparison to male rats. Avoidance of
food increased with time in both male and female rats
administered with 400 mg/kg body weight of extract. It was
observed to be maximum on 28 th day during our observation.
A significant (p

218 Trends in Biosciences 3 (2), 2010
Table 3.
Sex of
rats
Effect of different doses of ethanolic extract of
Parthenium hysterophorus on food consumption
(g/day/rat) of treated rats
Day
Control
Rats
Mean±
200 mg/kg body
weight
Mean±
(Change in %)
Treated rats
400 mg/kg body
weight
Mean±
(Change in %)
Female 7 th 14.895±0.542 12.413±0.361** 11.559±0.817**
16.66%
22.39%
14 th 13.070±0.928 10.544±1.107* 9.820±1.043*
19.32%
24.86%
21 st 15.714±1.296 12.774±1.691 9.682±0.493**
26.16%
38.38%
28 th 17.045±0.619 9.282±2.149** 8.214±0.744**
45.54%
51.80%
Male 7 th 24.851±0.564 23.760±1.299** 19.535±0.268**
4.39%
21.39%
14 th 18.817±2.232 15.845±0.824* 14.421±0.437*
15.79%
23.36%
21 st 20.130±0.909 16.700±0.794* 14.960±0.872**
17.03%
25.68%
28 th 19.270±0.279 13.307±0.598** 9.904±0.797**
30.94%
48.60%
*indicates significant (p

Table 5.
Sex of
rats
Kushwaha & Maurya, Toxicity Study of Ethanolic Extract of Parthenium hysterophorus in Rats 219
Effect of different doses of ethanolic extract of Parthenium hysterophorus on liver weight of treated rats.
Day
Liver wt.
Mean
±
Female 7 th 4.678
±0.100
14 th 4.776
±0.067
21 st 5.481
±0.028
28 th 6.405
±0.208
Male 7 th 3.391
±0.183
14 th 3.718
±0.155
21 st 4.034
±0.030
28 th 6.923
±0.214
*indicates significant (p

212 Trends in Biosciences 3 (2): 212-215, 2010 Trends in Biosciences 3 (2), 2010
Grasserie Disease Incidence on Silkworm and Development of Botanical Based
Management Strategy
C.A. MAHALINGAM, K.A. MURUGESH AND R. SHANMUGAM
Department of Sericulture, Centre for Plant Protection Studies, Tamil Nadu Agricultural University,
Coimbatore-03
e-mail: sunmuga152@gmail.com
ABSTRACT
The survey on incidence of grasserie revealed that all technical
service centres (TSC) in western zone of Tamil Nadu were
found to be affected due to grasserie disease. The mean disease
incidence ranged from 31.58 to 4.04 per cent with maximum
(mean) cocoon yield loss at Dharapuram TSC (30.05 kg/ 100
dfls). Dusting with TNAU seri dust followed by Psoralea extract
per os application drastically reduced the larval mortality from
3.28 to 1.35 per cent. Maximum larval weight, cocoon weight,
shell weight, shell ratio and cocoon yield of 3.68 g, 1.74 g, 0.323
g, 18.56 per cent and 78.20 kg/ 100 dfls respectively were
registered in TNAU seri dust + Psoralea extract treated batch.
Subsequent On-Farm Trials confirmed the reduction in larval
mortality and enhancement in economic as well as yield
parameters of silkworm, Bombyx mori L. Higher incremental
cost benefit (ICB) of 2.37 was recorded in the batch treated with
TNAU seri dust and Psoralea.
Key words
Survey, grasserie, mortality, yield loss, TNAU seri
dust, psoralea
Grasserie disease caused by Bombyx mori Nuclear
Polyhedrosis Virus (BmNPV) is a serious constraint in cocoon
production. Indian sericulturalists often encounter complete
crop failures due to viral epizootic. Cocoon loss upto 10 kg/
100 dfls was reported in Tamil Nadu owing to grasserie infection
(Sivaprakasam and Rabindra, 1995). Various repents also
indicated the yield loss of 30 to 40% (Vaidhya, 1960), 20 to
40% (Chitra, et al., 1975), and 42.6% (Savanurmath, et al.,
1992) due to grasserie disease in peninsular India. Several
management methods like feeding with antibiotics (Ueda, et
al., 1955; Baig, et al., 1990), plant products (Manoharan, 1996),
application of papzol (Samson, et al., 1987), disinfection with
aziphor (Venkata Reddy, et al., 1990) are employed for
containing the virus menace. However, the disease incidence
is on increasing trend in the last decade. By keeping this in
mind, an attempt was made to assess the loss in cocoon yield
and devise a botanical based disease management strategies
for higher cocoon productivity.
MATERIALS AND METHODS
A structured questionnaire was prepared and detailed
survey on grasserie disease was carried out in all technical
service centres (TSC) (10 villages/ TSC) of western Tamil Nadu
comprising Coimbatore, Erode and Tirupur districts at monthly
interval for six months continuously to estimate the infection
intensity as well as cocoon crop loss. Per cent disease
incidence due to grasserie was estimated based on gross
pathological symptoms and microscopic examination of
cadaver and cocoon. Based on the survey results, three
disease epidemic areas were identified and further trials were
conducted for devising botanical oriented disease
management technique. Trials were laid out in randomized
block design (RBD) at farmers’ field in Coimbatore, Erode and
Tirupur districts.
Through disinfection with chlorine dioxide was carried
out in all rearing houses selected before conducting the study.
Treatments viz.,TNAU seri dust as bed disinfectant @ 4 kg /
100 dfls (T1), TNAU seri dust followed by Psoralea extract
per os application @ 800 ppm (T2), chalk powder + Psoralea
dust as bed disinfectant @ 1: 4 ratio (T3), Angush as bed
disinfectant (T4) and Vijetha + Psoralea extract per os
application (T5) were imposed and was compared with
untreated control (T6). The silkworm crossbreed, PM x CSR2
@ 25 dfls/ treatment was reared as per the methods suggested
by Krishnaswami, et al., 1973 and each treatment was
replicated thrice. Observations on larval mortality, larval
weight, cocoon weight, shell weight, shell ratio, cocoon yield
(by number and weight) were recorded. The larvae died due
to grasserie were examined using phase contrast microscope.
The survivors were monitored till cocoon formation. The per
cent mortality due to grasserie was worked out using Abbot’s
correction (Abbot, 1925).
Based on previous experimental results, the best
performing management practice was chosen and compared
with the untreated control by laying out On-farm trials (OFTs)
in Coimbatore, Erode and Tirupur districts with three treatments
viz., application of TNAU seri dust as bed disinfectant as per
schedule + per os application of Psoralea extract once during
third instar and untreated control. The data were collected
and analyzed as per the procedure followed by Panse and
Sukhatme, 1957.
RESULTS AND DISCUSSION
The survey revealed that grasserie disease was prevalent
in all Technical Service Centres of Coimbatore, Erode and
Tirupur districts. The mean disease incidence ranged from
4.04 to 31.58 per cent. The maximum incidence of 31.58 per

MAHALINGAM et al., Grasserie Disease Incidence on Silkworm and Development of Botanical Based Management Strategy 213
cent was recorded in Dharapuram TSC followed by 15.99 per
cent in Avinashi TSC of Tirupur district. This is supported by
Sivaprakasam and Rabindra, 1995, who in their two years
(1991-1993) survey concluded similar level of incidence in
western and north western regions of Tamil Nadu.
Survey also indicated that grasserie incidence was
maximum in the month of May (20.55 %) followed by April
(18.07 %) whereas least incidence was observed during
September (2.48 %) (Table 1). Grasserie disease was found to
prevail throughout the year, however the disease was severe
during the summer months (Govindan, et al., 1998). Samson,
et al., 1990 reported that highest incidence of 7.35 and 7.32
per cent was recorded during summer, 1984 and 1985
respectively in Karnataka. These studies fall more or less in
line with the current survey results. High temperature, high
humidity inside the rearing room, and fluctuations in diurnal
temperature and humidity may be the causes for high grasserie
incidence during summer.
Maximum mean cocoon yield loss due to BmNPV was
reported in Dharapuram TSC (30.05 kg) followed in Avinashi
TSC (11.06 kg) of Tirupur district and the minimum mean
cocoon yield loss was reported in Sathiyamangalam TSC (3.99
kg) of Erode district. Yield loss was more during summer
months viz., May (12.90 kg) and April (12.15 kg) and was
minimum during rainy months viz., September (3.40 kg) and
August (6.35 kg) (Table 2). Sivaprakasam, 1994 reported that
there was a cocoon yield loss owing to grasserie outbreak in
Coimbatore, Erode, Salem and Dharmapuri districts. The study
by Govindan, et al., 1998 also supports the present
observations.
There was a significant difference in the larval mortality
among the various treatments. Significantly least mortality of
1.35 per cent was recorded in the treatment T2 (TNAU seri
dust + Psoralea extract per os application) followed by 1.50
per cent in T5 (Vijetha + Psoralea extract per os application).
Highest mortality of 3.28 per cent was recorded in untreated
Table 1.
Table 2.
Grasserie disease incidence (%) and cocoon yield loss (kg) in western zone of Tamil Nadu
Technical Service Centre (TSC) April ‘08 May ‘08 June ‘08 July ‘08 August ‘08 September ‘08 Mean
I. COIMBATORE DISTRICT
Annur 5.70 9.40 3.40 4.20 2.90 1.00 4.43
*(3.10) (3.55) (2.52) (13.68) (2.10) (1.40) (4.39)
Periyanayakkan palayam 5.00 11.67 3.22 9.00 3.01 2.45 5.73
(4.32) (5.50) (7.40) (6.00) (8.05) (3.20) (5.75)
II. ERODE DISTRICT
Manurpalayam 3.00 17.22 2.30 2.83 4.50 1.00 5.14
(3.70) (3.91) (4.20) (7.52) (6.20) (3.00) (4.76)
Kundadam 8.83 6.45 12.00 4.80 4.00 2.50 6.43
(5.20) (18.18) (8.71) (7.40) (2.10) (2.90) (7.42)
Gobichettipalayam 10.20 12.50 1.80 9.60 0.63 1.32 6.01
(3.80) (21.70) (6.40) (6.00) (2.90) (1.50) (7.05)
Sathiyamangalam 3.50 8.35 4.70 3.70 3.80 0.20 4.04
(2.30) (3.00) (4.50) (9.33) (2.80) (2.00) (3.99)
III. TIRUPUR DISTRICT
Avinashi 19.43 29.17 18.50 11.50 10.81 6.50 15.99
(23.34) (18.30) (8.00) (9.50) (4.00) (3.20) (11.06)
Dharapuram 55.41 52.67 32.50 25.00 16.20 7..70 31.58
(53.00) (34.50) (45.92) (20.0) (18.00) (8.90) (30.05)
Udumalpet 11.00 37.50 5.40 12.30 7.10 2.90 12.70
(10.57) (7.50) (9.00) (15.00) (11.00) (4.50) (9.60)
Mean 13.56 20.55 9.31 9.21 5.88 2.84 10.23
(12.15) (12.90) (10.74) (10.49) (6.35) (3.40) (6.23)
*Figures in pararthesis are cocoon yield loss (kg)
Efficacy of botanical based grasserie management practices on silkworm
Treatments Per cent mortality
Economic characters of silkworm
Cocoon yield
Single larval weight (g) Single cocoon weight (g) Single shell weight (g) Shell ratio (%) (Kg/100 dfls)
T 1 2.55 3.58 1.64 0.301 18.35 70.68
T2 1.35 3.68 1.74 0.323 18.56 78.20
T3 2.83 3.57 1.62 0.296 18.27 68.88
T4 3.15 3.56 1.61 0.295 18.32 70.50
T5 1.50 3.65 1.65 0.304 18.42 74.02
T6 3.28 3.54 1.53 0.277 18.10 66.57
SEd 0.299 0.062 0.007 0.014 0.825 3.727
CD (0.05%) 0.56 0.08 0.019 0.035 2.019 9.120

214 Trends in Biosciences 3 (2), 2010
control (T6) (Table 3). This might be due to higher amount of
hydrolysable tannin and phenol present in Psoralea (Keating,
et al., 1990) which could have aggregated the polyhedral
bodies either by POB dissolution and virion release or by
disturbing the cell surface in the recognition site or other
process necessary for infection and replication in the host.
Padma, 2007 reported that application of Psoralea corylifolia
and Plectranthus amboinicus reduced the larval mortality by
24.00 and 25.33 per cent respectively. Application of Psoralea
(Samuel Manohar Raj, 1994), P. amboinicus (Manimegalai and
Chandramohan, 2006) and Vijetha (Datta, et al., 1998) also
brought down the larval mortality by 72.46, 59.78 and 33.20
per cent respectively. These findings support the present
results.
Table 3.
Cost benefit analysis for botanical based grasserie
management practices
S. No. Treatment Added cost*
(Rs.)
Added
return (Rs.)
Incremental Cost
Benefit (ICB)
1. T 1 210 393 1:1.87
2. T 2 230 552 1:2.40
3. T 3 152 231 1:1.52
4. T 4 250 411 1:1.64
5. T 5 230 490 1:2.13
6. T 6 - - -
*Extra cost incurred towards imposition of the treatment
All the treatments aimed towards grasserie management
practices had positive impacts on the economic characters of
silkworm. Maximum larval weight, cocoon weight, shell weight
and shell ratio of 3.68 g, 1.74 g, 0.323 g and 18.56 per cent
respectively were registered in treatment T2 followed by 3.65
g, 1.65 g, 0.304g and 18.42 per cent respectively in T5. These
parameters were found to be statistically superior over the
treatment T6 (3.54 g, 1.53 g, 0.277 g and 18.10 per cent
respectively) (Table 2). This might be due to the fact that the
dusting of bed disinfectant followed by oral application of
botanical which could have aided in enhancing the economic
traits of silkworm by their counteraction against the grasserie
disease. Rajasekharagouda, 1991 reported the application of
petroleum ether extracts of P. corylifolia and T. terrestris
increased the larval weight, cocoon weight, shell weight and
shell ratio of silkworm. Sivaprakasam and Rabindra, 1995
concluded that the application of Resham Keet Oushadh
(RKO) after each moult and feeding of mulberry leaves treated
with aqueous extract of P. corylifolia @ 800 ppm once during
third, fourth and fifth instar of silkworm enhanced the larval
and cocoon parameters. Application of turmeric powder + chalk
Table 4.
Treatment
Effect of Psoralea based grasserie management on silkworm (On-Farm Trials)
Larval
mortality
(%)
Single
cocoon
weight
(g)
powder (1:5) @ 1kg/ 100 dfls thrice significantly increased the
biological and economic parameters of B. mori (Manimegalai,
et al., 2000). These above findings can be corroborated with
the present results.
The results showed that there was an increase in the
cocoon crop yield when compared with untreated control.
Higher cocoon yield of 78.20 kg/ 100 dfls was recorded in the
larval batch treated with TNAU seri dust followed by Psoralea
extract per os application @ 800 ppm (T2) which was found to
be statistically superior over untreated control (66.57 kg/ 100
dfls) (Table 2). The above finding is strengthened by various
earlier studies (Rajasekharagouda, 1991; Samuel Manohar Raj,
1994; Sivaprakasam and Rabindra, 1995; Manimegalai and
Chandramohan, 2006). Cost benefit analysis on grasserie
management with different treatments showed that dusting
of TNAU seri dust + Psoralea extract per os application
recorded highest cost benefit ratio of 1:2.40 followed by Vijetha
+ Psoralea extract per os application with 1: 2.13 (Table 3).
This might be due to the beneficial action of Psoralea and
bed disinfectant. Similar results were obtained by
Savanurmath, et al., 1992 and Samuel Manohar Raj, 1994.
Based on results of previous experiments conducted,
the effective disease management strategy was picked out
and on-farm trials were conducted in nine villages covering
all three districts viz., Coimbatore, Erode and Tirupur. The
results revealed that the larval mortality was drastically
reduced from 0.09 per cent in untreated control to 0.04 per
cent in larval batch treated with TNAU seri dust followed by
Psoralea extract per os application (Table 4). Earlier studies
by Manimegalai and Chandramohan, 2006, Minu James
Thottacherry, 2007 and Padma, 2007 also indicated reduction
in silkworm mortality due to the application of bed disinfectant
followed by botanical formulation.
It is also evident from the experiments that there was an
increase in cocoon weight, shell weight, shell ratio, total yield
of cocoon and ICB by 6.25, 11.11, 11.24, 12.67 per cent and
2.37 respectively when compared with untreated control (Table
4). Sivaprakasam, 1994 reported that application of P.
corylifolia, Caesalpinia coriaria and Acacia suma enhanced
the economic as well as yield parameters of B. mori. This was
further supported by Chitra, et al., 1975 and Manoharan, 1996.
It is concluded that thorough disinfection of rearing
house with chlorine dioxide before initiation of rearing followed
by dusting with TNAU seri dust as bed disinfectant as per
schedule and application of Psoralea extract per os once
Single
shell
weight
(g)
Shell
ratio
(%)
No/ 10000
larvae
Cocoon yield
Kg/ 10000
larvae
Total
yield
(Kg/100
dfls)
TNAU Seri dust + Psoralea extract 0.04 1.70 0.30 18.80 9960 16.90 71.66 1:2.37
Untreated control 0.09 1.60 0.27 16.90 9394 15.90 63.6 -
Per cent increase or decrease over untreated control -125 6.25 11.11 11.24 6.02 6.29 12.67 -
ICB

MAHALINGAM et al., Grasserie Disease Incidence on Silkworm and Development of Botanical Based Management Strategy 215
during third instar is recommended for containing the grasserie
disease in silkworm and simultaneously obtain higher cocoon
productivity.
LITERATURE CITED
Abbot, W.S. 1925. A method of computing the effectiveness of an
insecticide. J. Econ. Entomol., 18 : 225 – 267.
Baig, M., Nataraju, B. and Samson, M.V. 1990. Studies on the effect of
antibiotics on rearing performance and losses due to diseases in
silkworm, Bombyx mori L. Indian J. Seric., 29 (1) : 54 -58.
Chitra, C., Karanath, N.G. and Vasantharajan, V.N. 1975. Diseases of
mulberry silkworm, Bombyx mori L. J. Sci. Ind. Res., 34 (1) : 386
-401.
Datta, R.K., Baig, M., Nataraju, B., Balavenkatasubbiah, M. and
Selvakumar, T. 1998. Vijetha: An effective disinfectant. Indian
Silk, 36 (9) : 12-13.
Govindan, R., Narayanaswamy, T.K. and Devaiah, M.C. 1998. Principles
of Silkworm Pathology, Seri. Scientific Publishers, Bangalore.
pp.420.
Keating, S.T., Yendol, W.G. and Schultz, J.C. 1990. Leaf phenolic
inhibition of gypsy moth nuclear polyhedrosis virus and role of
polyhedral inclusion body aggregation. J. Chem. Ecol., 16 : 1445-
1457.
Krishnaswami, S., Narasimhanna, M.N., Suryanarayanan, S.K. and
Kumararaj, S. 1973. Manuals on Sericulture 2. Silkworm rearing.
Agric. Service Bull., 15 (2) FAO, Rome.
Manimegalai, S. and Chandramohan, N. 2006. Efficacy of botanicals
against the grasserie disease of silkworm, Bombyx mori L.
Sericologia, 46 (1) : 15-23.
Manimegalai, S., Subramanian, A. and Chandramohan, N. 2000. Efficacy
of bed disinfectants and botanicals against grasserie disease of
silkworm, B. mori L. Sericologia, 40 (4) : 585-590.
Manoharan, S. 1996. Evaluation of certain botanicals for the
management of grasserie of Bombyx mori L. M.Sc. (Seri) Thesis,
Tamil Nadu Agricultural University, Coimbatore. pp.78.
Minu James Thottacherry. 2007. Screening and characterization of
plant extracts against grasserie disease of silkworm, Bombyx mori
L. M.Sc. (Biotech.) Thesis, Tamil Nadu Agricultural University,
Coimbatore. pp.64.
Padma, S. 2007. Bioprospecting of plant molecules for the management
of grasserie disease of silkworm, Bomxyx mori L. M.Sc. (Seri.)
Thesis, Tamil Nadu Agricultural University, Coimbatore, India.
pp.105.
Panse, V.C. and Sukhatme, P.V. 1957. Statistical Method for Agricultural
Workers, ICAR, New Delhi. pp.328.
Rajasekharagouda. 1991. Studies on methods to increase silk yield of
Bombyx mori L. Ph.D. Thesis, Tamil Nadu Agricultural University,
Coimbatore, India. pp.242.
Samson, M.V., Baig, M., Sharma, S.D., Balaventakasubbaiah, M.,
Sasidharan, T.D. and Jolly, M.S. 1990. Survey on the relative
incidence of silkworm disease in Karnataka, India. Indian J. Seric.,
29 (2):248-254.
Samson, M.V., Baig, M. and Jolly, M.S. 1987. “Resham Keet Oushadh”–
A prospective bed disinfectant against grasseire and muscardine.
Indian Silk, 25 (11) : 16-18.
Samuel Manohar Raj, K. 1994. Effect of certain botanicals on the
nuclear polyhedrosis virus disease of Bombyx mori Linnaeus. M.Sc.
(Seri.) Thesis, Tamil Nadu Agricultural University, Coimbatore.
pp.78.
Savanurmath, C.J., Basavarajappa, S., Hinchigeri, S.B., Ingalhalli, S.S.,
Singh, K.K. and Sanakal, R.D. 1992. Relative incidence of silkworm
viral disease in agroclimatic zones of Northern Karnataka, National
Conference on Mulberry Sericulture Research, CSR &TI, Mysore,
Dec. pp.123.
Sivaprakasam, N. 1994. Seasonal incidence of Nuclear Polyhedrosis
virus disease of silkworm, Bombyx mori L. and its management.
Ph.D. Thesis, Tamil Nadu Agricultural University, Coimbatore.
pp.115.
Sivaprakasam, N. and Rabindra, R.J. 1995. Incidence of grasserie in
silkworm, Bombyx mori L. in selected district of Tamil Nadu. Indian
J. Seric., 34 (2) : 100-104.
Ueda, K., Okomoto, Y., Sakai, H., Arima, K., Yoshara, H. and Sakagami,
Y. 1995. An antibiotic against silkworm jaundice virus
grasseriomycin, produced by Streptomyces species. J. Antibiotics
Japan Seric. A., 8 : 91-95.
Vaidhya, M.J. 1960. Indian sericulture, problems of modernization,
publicity series 2. Central Silk Board, pp.23.
Venkata Reddy, S., Singh, R.D., Baig, M., Sengupta, K., Girdhar, K. and
Singhal, B.K. 1990. Efficiancy of Asiphor as a bed disinfectant
against incidence of diseases in silkworm, Bombyx mori L. Indian
J Seric., 29 : 147-148.
Recieved on 15.04.10 Accepted on 25.06.2010

220 Trends in Biosciences 3 (2): 220-221, 2010 Trends in Biosciences 3 (2), 2010
Pollen Diversity in Apis cerena and its Quantification in Different Ecological Habitats
in Karnataka
A. NAGARATHNA1 AND M.S. REDDY
Centre for Apiculture Studies, Department of Zoology, Bangalore University, Jnana Bharathi, Bangalore 460 056
1S.R.N. Adarsh College, Banaglore 560 018
e-mail: jenureddy@gmail.com, nagarathnaamresh@rediffmail.com
ABSTRACT
Diversity, visitation frequency, foraging behaviour and
pollination efficiency of honeybees on different crop plants
were studied at different ecological habitats in Karnataka.
Amount of pollen collected at different places on a daily, weekly
and monthly basis were quantified. Majority of the beeds
returning with loads were seen to be collecting pollen only
than nectar or pollen and nectar. As geography, topography and
climate are highly variable from place to place, bee flora is not
available uniformly. Change in the availability of bee flora
seriously affects the beekeeping.
Key words
Diversity, pollen, efficiency, ecology
Recent study on the bee pollination of agricultural crops
in the world shows that hundreds of species in more than 40
plant families are dependant at least partially on bees and
other insects (Southwick, 1995, Kumar et al., 2005). Bee
pollination results not only in the increase of yield of various
oil seeds, but also improves their quality. Panda, et al., 1994a
studied the foraging behaviour of three honeybee species on
5 varieties of niger at Orissa. They found that A. cerana was
the main forager and among Apis species, A. dorsata and A.
cerana were more active in the forenoon while A. florea was
active in the afternoon. Panda, et al., 1994b reported 44.40
percent and 81.30 percent increase in yield of niger due to bee
pollination and open pollination respectively.
The visits of A.cerana to mango flowers gradually
increased from 0600 hrs to 1200 hrs with a peak between 0900
to 1100 hrs decreased from 1400 to 1700 hrs and no visits were
observed after 1800 hrs in February, March in Banaglore.
MATERIALS AND METHODS
The foraging bees returning with the pollen loads were
captured randomly at the hive entrance to collect the pollen
loads (Suryanarayana, et al., 1992). The pollen loads collected
from both the legs with the help of 1 mm camel brush
transformed onto the pre calibrated capsules and electronically
weighed independently. Samples of pollen brought by the
forager bees into the colonies were collected throughout the
day at hourly intervals. The incoming forager bees were caught
by hand by holding the wings. The loads in the two hind legs
were removed onto the clean paper, then the loads were
removed onto the clean paper, then the loads were packed
into two separate packets. Each packet was labeled with data,
viz., the colony number, bee species time and date of collection
for both A.cerana and A. mellifera at different locations.
Quantification of pollen loads was done using the pollen trap.
This is to study the diversity of pollen and to work out its
economics at different loacation in Karnataka.
RESULTS AND DISCUSSION
The amount of pollen was less in the morning and later
increased to reach a peak at 1100 to 1200 and declined
thereafter, again which made an increase between 1600 to 1800
hr. Highest number of pollen foragers was recorded between
1100 to 1300 hr, gradually decreased during mid noon to
increase again by 1600 hr.
Weekly collections of pollen samples during the course
of study in the apiary site Heserghatta village (Table 1) showed
that the highest pollen was collected by the A.cerana foragers
in the month of Spetember and October with a mean of
151.21±5.75g and 143.80±5.59g respectively for A. cerana and
the least was recorded in the month of August with a mean
100.77±3.58g.
Average pollen collection by A.cerana in a
Jnanabharathi village month at the apiary site Jnanabharathi
village (Table 1) showed a lowest mean of 83.91±3.01 g in the
month of January and the highest in the month of September
with a mean value of 114.09±8.99 g.
The amount of pollen collected varied in apiary site
Arkavathi madhuvana village (Table 1) with a mean value
159.66±7.24g which was recorded as the highest in the month
of September and least of 70.05±2.07 g in the month of August.
Thereafter the pollen collection increased during the rest of
the year.
Average pollen collection in a apiary Hannavar village
(Table 1) was recorded the highest collection in the month of
September, 190.39±1.77g and the amount of pollen collection
was almost constant through out the year except for the
months July and August which recorded only 94.19±2.12g
and 97.64±2.34g, respectively.
Mean pollen collection by A.cerana in the apiary site
Bagamandala village (Table 1) showed that western Ghats
had high potential for both pollen and nectar and the mean
amount of pollen collected was highest in the month of

Nagarathna & Reddy, Pollen Diversity in Apis cerena and its Quantification in Different Ecological Habitats in Karnataka 221
Table 1. Weekly average pollen collection by A.cerana in different villages in Karnataka (Mean g)
Month Heserghatta Jnanabharathi Arkavathy Honnavar Bhagamandala Kuntanahalli Shivakote Shivanahalli
madhuvana
Jan 126.93±4.04 83.91±3.01 127.64±2.32 183.05±2.56 196.55±4.02 134.51±3.76 120.54±2.32 123.73±2.73
Feb 121.3±4.26 94.35±4.81 127.68±2.44 185.76±2.48 199.59±3.56 120.74±4.13 120.58±2.36 124.95±2.41
Mar 129.60±4.12 98.09±6.98 127.13±2.84 183.78±2.37 200.68±3.49 121.72±3.17 122.69±2.14 129.2±2.76
Apr 129.60±3.62 103.49±7.19 126.05±2.74 186.01±2.32 203.54±3.74 123.58±2.84 124.19±2.77 132.1±3.13
May 124.31±4.03 107.06±7.62 131.44±2.92 184.72±3.29 201.91±3.36 128.85±2.18 126.31±2.46 140.16±3.18
Jun 121.05±4.77 110.76±8.24 129.5±2.91 136.04±4.36 199.89±2.97 133.93±3.09 134.26±3.16 141.52±4.43
Jul 101.13±3.77 84.03±8.38 95.19±4.08 94.19±2.12 103.75±1.73 71.99±2.13 89.83±2.17 82.03±2.79
Aug 100.77±3.58 90.82±8.23 70.05±2.07 97.64±2.34 92.05±1.38 72.55±2.08 89.13±2.46 78.56±1.93
Sep 151.21±5.75 114.09±8.99 159.66±7.24 190.39±1.77 205.54±4.63 150.65±3.41 190.3±3.71 169.60±3.47
Oct 143.80±5.59 110.08±9.29 137.36±3.43 181.30±6.45 162.65±3.71 126.27±3.17 158.62±1.81 149.45±2.46
Nov 125.20±2.80 112.86±9.69 128.85±5.19 176.44±3.65 159.03±2.89 125.34±3.42 139.02±3.83 133.28±2.93
Dec 117.65±3.83 107.28±9.73 120.66±1.86 180.83±3.561 152.7±3.16 128.86±2.48 132.32±3.14 133.82±3.04
September recording 205.54±4.63g and the lowest with
92.05±1.38g in the month of August. However, the amount of
pollen collected was constant throughout during different
months of the year.
Average pollen collection of A. cerana during different
months of the year at apiary Kantanahalli village (Table 1)
showed a mean of 133.93±3.09g in June and 150.65±3.4g in
September and 134.51±3.76 g in the month of January, however
the least with 71.99±2.13 g and 72.55±2.08g in July and August
respectively.
At the apiary site Shivakote village (Table 1) mean pollen
collection increased from the month of January to June with
120.54±2.32g to 134.26±3.16 g and July-August recorded a
least of 89.83±2.17g and 89.13±2.17g which was the least and
peak was during September which recorded 190.3±3.71 g.
The data in Table 1 is from the apiary site Shivanhalli
village which showed a highest mean of 169.60±3.47g in
September follwed by 149.45±2.46g in October to a least of
78.56±1.93 g in the month of August.
The seasonal variation and foraging efficiency of A.
cerana studied, for a period of two years from January to
December 2006 and 2007, which showed variations in the
amount of pollen and nectar. In rainy season, it was observed
that the worker bees carried less quantity of pollen during
July and August. The amount of pollen carried progressively
increased from August to the end of the season because the
availability of pollen grains. The availability of bee flora was
less during early period of rainy season and therefore collection
was less. The result of the present study in in agreement with
the observations made by Sharma and Gupta, 1996 was
reported less amount of pollen carried by forager bee during
the dearth period. Change in the bee flora seriously affects
the bee keeping practices.
LITERATURE CITED
Kumar Asiam Maiti, Pradeep Kumar Singh and Jogeshwari Singh. 2005.
Floral calendar for beekeeping at the Bichpuri, Agra. Indian Bee J.
67(3 and 4): 156-160.
Panda, P., Sontakke, B.K. and Panda, B. 1994a. Effect of different of
different modes of pollination on yield of sunflower and niger. J.
Sins. Sci., 6: 75-77.
Panda, P., Sontakke, B.K. and Panda, B. 1994b. A Foraging behaviour
of honeybee species on different varieites of niger. J. Ins. Sci., 6:
104-106.
Sharma, H.K. and Gupta, J.K. 1996. Seasonal variation in colours,
weight and crude protein content of pollen loads of hive bees.
Indian Bee J., 58(3): 125-128.
Southwich, E.E. 1995. Inportance of Bees. Am. Bee J., 4: 247-248.
Suryanarayana, M.C., Mohana Rao, G. and Singh, T.S.M.S. 1992. Studies
on the pollen sources for Apis cerana Fab and Apis mellifera L. bees
at Muzaffarpur, Bihar, India. Apidologie., 23: 33-46.
Recieved on 01.10.2010 Accepted on 19.11.2010

222 Trends in Biosciences 3 (2): 222-224, 2010 Trends in Biosciences 3 (2), 2010
Photocycloaddition of Furochromenethylthiourea and Oleic Acid Methyl Ester
JAWAID IQBAL, ANAMIKA GUPTA*, WASEEM AHMAD # , M. REHAN ZAHEER
Department of Chemistry, Aligarh Muslim University, Aligarh 202 002 (U.P.)
*e-mail: waseemahmad86@hotmail.com, anamikagupta08@rediffmail.com
ABSTRACT
In the present study, photoreaction of Furochromenethylthiourea
with oleic acid methyl ester (OAME) was investigated
to seek information parallel to the photobiologically relevant
8-MOP-fatty acid photocycloaddition. Furochromenethylthiourea
and oleic acid methyl ester were dissolved in methanol
and the solution was deaerated by bubbling with nitrogen gas
for about 1 hr and irradiated for 72 hr in a photochemical
reactor. Progress of the reaction was monitored by thin layer
chromatography (chloroform-methanol, 98:2). At the end of
the reaction formation of a number of products was indicated
on TLC. The two major photoproducts were isolated by eluting
with dichloromethane-ethyl ether (1:1, v/v) on a silica column.
The products were identified as 3 and 4 from their spectral
properties.
Key words
Photocycloaddition, furochromenethylthiourea, oleic
acid methyl ester
The naturally occurring furochromones has received
considerable attention, largely because of its vasodilatory,
bronchodilatory properties and of its ability to induce skin
pigmentation upon ultraviolet light treatment of patient
suffering from vitiligo (Kornhauser, et al.,2004).From a
photobiological point of view, furochromones, photosensitizer
show valuable phototoxicity toward various kinds of micro
organisms and also valuable photogenotoxic activity on
various biological substrates (Abdel-Rehman, et al., 2002)
including DNA and fatty acids. Among the significant aspect
of studies required to unveil the underlying molecular
mechanism is the photo interaction of photo sensitizer with
important biological molecule, to identify the product and to
study their particular biological relevance (Bordin, et al., 1991
and Caffieri et al., 1993)
Owing to the similarity of chemical structures and
absorption properties one may expect furochromones and
furocoumarins (psoralens) to exert similar photobiological,
photochemical and phototherapeutic characteristics. Indeed,
both classes of photo sensitizer act through the same basic
mechanisms: dark complexation, triplet formation and
photobinding to DNA (Schimmer, 1997 and Trabalzini, et
al.,1990).
In the present study, photoreaction of Furochromenethylthiourea
with oleic acid methyl ester (OAME) was
investigated to give further insight in to the reactive excited
state and selective photocycloaddition reaction of
furochromenethylthiourea and also seek information parallel
to the photo biologically relevant 8-MOP-fatty acid
photocycloaddition (Benasson, et al., 1983).
MATERIALS AND METHODS
All chemicals used were of analytical grade.
furochromenethyl thiourea was synthesized according to the
method given in literature (Caffieri, et al., 1993). UV spectra
were recorded on shimadzu 160 A instrument. I.R. spectra were
recorded as KBr discs on a Perkin Elmer model spectrum RXI.
1
H-N.M.R and 13 C-N.M.R Spectra were recorded on a Bruker
Avance –DRX -300 Spectrometer using TMS as internal
standard and (CD 3
) 2
CO as solvent .High resolution mass
spectra were determined with a VG-ZAB-BEQ9 spectrometer
at 70 e V ionization voltage. Merck silica gel 60 F 254
plates
were used for analytical TLC; column chromatography was
performed on Merck silica gel 60 (60-120mesh).
Furochromenethylthiourea (100 mg, 0.387Mm) and oleic
acid methylester (514mg, 1.93 Mm) (molar ratio 1:5) were
dissolved in methanol and the solution was deaerated by
bubbling with nitrogen gas for about 1 hr and irradiated for 72
hr in a Rayonet photochemical reactor(The Southern New
England Ultraviolet Co; Model RPR-208 equipped with four
RUL-350 nm fluorescence lamps) for the complete conversion
of reactants. Progress of the reaction was monitored by thin
layer chromatography (chloroform-methanol, 98:2). At the end
of the reaction formation of a number of products was indicated
on TLC. The two major photoproducts were isolated by eluting
with dichloromethane-ethyl ether (1:1, v/v) on a silica column.
The products were identified as 3 and 4 from their spectral
properties.
RESULTS AND DISCUSSION
Irradiation of a deaerated, nitrogen saturated, methanolic
solution of Furochromenethylthiourea (1) and oleic acid
methyl ester (2,OAME) With a light of 350 nm for 72 hr, and
purification of crude product by silica gel column
chromatography afforded two major products 3and 4 in
isolable yields (scheme-1)
The Structures of the photoproducts were characterized
by the spectroscopic methods as described below. The UV
absorption spectra of the photo products, l max
(MeOH) 251,
348 Sh. nm, are very similar to each other and resemble to that
of 4’,5’-dihydrofurochromenethylthiourea indicating that the
4’,5’- double bond of furochromenethylthiourea is saturated
in the photoproducts. IR spectra also indicated the saturation

Iqbal et al., Photocycloaddition of Furochromenethylthiourea and Oleic Acid Methyl Ester 223
of 4’, 5’-double bond on photoproduct formation. The olefinic
C-H stretching bands of furan ring of furochromenethylthiourea
at 3060 and 3100 cm -1 Disappear in the
photoproduct and a characteristic cyclobutane ring
deformation band appeared at 830 cm -1 .Moreover, the carbonyl
stretching band of furochromenethylthiourea at 1642 cm -1 was
intact, indicating that the pyrone double bond of
furochromenethylthiourea was not affected on photoreaction.
Mass spectra of the photoproducts showed molecular ion
peaks of 1:1 adduct of furochromenethylthiourea and OAME
at m/z 440 and its fragments, corresponding to the adducts .
These data suggested that the photoproduct is composed of
furochromenethylthiourea and OAME (1:1), formed by [2ð+2ð]
cycloaddition of 4’, 5’-furyl bond of furochromenethylthiourea
to C=C double bond of OAME.
Both the adducts gave similar 1 H-NM R spectra with
various small shift differences. The spectra showed that there
is a upfield shift of the olefinic protons in the parent furochromenethylthiourea
andOAME; C-4’ and C-5’olefinic protons
at d6.66 and 7.52 shifted to d 3.68 and 4.53; and 9, 10 olefinic
protons at d 5.5 shifted to d 2.46 and 2.35 ppm, indicating that
the adducts are formed on furan side of furochromenethylthiourea.
Assignment of the stereo chemical
configuration on the cyclobutane ring of the photoproducts
was done by considering the observed values of the coupling
constants. Generally J cis
is greater than the J trans
in cyclobutane
systems (Specht, et al., 1984) The coupling constent J 8, 9
of
the doublet in the photoproduct 3 is 6.1 Hz which is greater
than the corresponding coupling constant J 8,9
of 2.1Hz in
photoproduct 4. Thus 3 and 4 were assigned cis –cis and cis-
SCHEMES:
H
N
H 3CC 6H 4
S
H
N
(1 )
O
O
OMe
OMe
O
+
CH 3COOC(CH 2) 7
H
(2)
H
(CH 2) 7CH 3
H
N
H 3CC 6H 4
S
H
N
(5)
O
O
OMe
OMe
O
H H
(CH 2) 7CH 3
(CH 2) 7COOCH 3
H
methanol hv
O
OMe H H
H H
N N
(CH 2) 7CH 3
H 3CC 6H 4
O H H
S
O
(3)
OMe
(CH 2) 7COOCH 3
O
OMe H H
H H
N N
(CH 2) 7CH 3
H 3CC 6H 4
O H H
S
O
OMe
(CH 2) 7COOCH 3
O
H H
OMe
H
N N
(CH 2 ) 7 CH 3
H 3 CC 6 H 4
O H H
hv
F 3 o F*
3 F* + OAME cis [F----OAME]
S
O
exciplex
OMe
(6)
(CH 2 ) 7 COOCH 3
(4)
H
N
H 3CC 6H 4
S
H
N
(3A)
O
O
OMe
O H H
OMe
H H
(CH 2) 7COOCH 3
(CH 2) 7CH 3
H
N
H 3CC 6H 4
S
H
N
O
O
OMe H H
(CH 2) 7COOCH 3
(CH 2) 7CH 3
O H H
OMe
FOAME cis
(3)
FOAME trans
(4)
FOAME cis
FOAME trans
(4A)
scheme-2
scheme-1
Compound 3. Yield 24 mg; mp 212 0 c, UV l max
(MeOH) 251, 348 sh. nm; IR (kBr):830(Cyclobutane) 3234, 3200(NH), 1642 (C=O), 1287
(C=S). HRMS calcd. for C 42
H 58
N 2
O 7
S 734.996 1
H- NMR ((CD 3
) 2
CO) :d 6.14(s,1H,H-3), 4.53 (dd,1H,J=6.5,6.1Hz,H-11),
3.83(s,3H,COOCH 3
),4.01(s,3H,-OCH 3
), 3.68(dd, J=6.5,6.2Hz,1H,H-8), 3.98 (s, 3H,- OCH 3
), 2.46(m,1H,H-10), 2.35(m,1H, H-9), 4.00,
2.10 (2H, 2s, 2NH exchangeable D2O), 2.25-125 (m,(CH 2
)n-OAME,CH 3
-pyrone) , 13 C-NMR ((CD 3
) 2
CO):180.2(C-4), 175.1(COOCH 3
),
162.7(C-2), 159.4(C-6), 153.2(C-13), 148.2(C-15), 134.2(C-14), 119.7(C-7), 111.8 (C-3), 103.5(C-5), 73.9 (C-11),56.4 (C-10), 50.2(COOCH 3
),
40.5(OCH 3
), 37.2(OCH 3
), 32.5-25.1((CH 2
)n-OAME), 21.7(CH 3
), MS m/z = 440.12 (6.5), 439.13(22.7),438.02 (40), 312 (50), 205 (100).
Compound 4. Yield 2I mg; mp 208 0 c UV l max
(Me OH) 251, 348 sh nm IR (KB r) :830(Cyclobutane) 3234, 3200(NH), 1642 (C=O),
1287 (C=S). ((CD 3
) 2
CO) :d 6.11(s,1H,H-3),4.53(dd,1H,J=6.5,6.1Hz,H-11), 3.82(s,3H,COOCH3), 4.01(s,1H,-OCH3), 3.68(dd,
J=6.5,2.1Hz,1H,H-8), 3.98(s,3H,-OCH3), 2.46(m,1H,H-10), 2.35(m,1H,H-9), 4.00, 2.10 (2H, 2s, 2NH exchangeable D2O), 2.25-
125(n(CH 2
)n-OAME,CH 3
–pyrone) 13 C-NMR((CD 3
) 2
CO): 181.2(C-4), 175.7(COOCH 3
), 162.2(C-2), 153.8(C-13), 147.2(C-15), 134.5(C-
14), 119.4(C-7), 112.2(C-3), 102.9(C-5), 74.1(C-11), 51.2(COOCH 3
), 40.7(OCH 3
), 39.3(C-8), 37.7(OCH 3
), 32.5-25.1((CH 2
)n-OAME),
21.7(CH 3
), mass m/z: = 440.12 (6.5), 439.13(22.7),4380.02 (40), 312 (50), 205 (100).

224 Trends in Biosciences 3 (2), 2010
trans configuration, respectively. The Photoproduct could
not be decided as head to head (HH) or head to tail (HT) from
the present data , because the position of fatty acid side chains
on the cyclobutane ring only have a subtle, uninterpretable
effects on the 1 H-NM R spectra. Hence, alternative structures
3A and 4A for 3 and 4 could not be decided. HH is defined as
shown in structure 3 and 4 in which ‘O’ of the furan and fatty
acid ester side chain are bonded to adjacent corner of the
cyclobutane. In HT stereochemistry these are bonded to
diagonal corners as in 3A and 4A. cis and trans refer to position
of ‘H’ relative to plane of cyclobutane.
The probable mechanism for the formation of 3 and 4
could be through the intermediacy of 1,4-diradicals (5or 6),
which arises from triplet excited state of the
furochromenethylthiourea and ground state of OAME via an
exciplex (scheme-2). starting with OAME, which is cis the 1,4-
diradicals may proceed to ring closure, forming cyclobutane
adducts with cis- stereochemistry. Alternatively, twisting
around the 9, 10-bond of OAME in the diradical intermediate
before ring closure give cyclobutane adduct with trans
configuration.
The photocycloadducts are formed regioselectively on
furanyl 4’, 5’ – double bond of the furochromenethylthiourea
probably due to the localization of excitation energy on the
furanyl 4’, 5’- double bond in the reactive excited state.
Geometric and steric considerations are important in
determining the orientation of the excited triplet and
furochromenethylthiourea and alkenes ground state, which
in turn determines the stereochemical structure of the initial
bond formed to make the diradical. Hence, the lack of formation
of other isomers in isolable yields may be due to the geometric
requirements of exciplex formation. Oleic acid methyl ester is
found in abundance in lipids of many living organisms; hence
the present study may be of biological significance. Further
extensive research will be under taken to explore a detailed
aspect of the furochromenethylthiourea-fatty acid
photochemistry.
LITERATURE CITED
Abdel-Rehman, A., Keshk, E.M., El-Telbani, E.M. 2002. Linearly
fused furochromones by interamolecular enaminone Reactions,
Z.Naturforsch, 57: 557-562.
Benasson, R.V., Land, E.J., Truscott, T.G.1983. Contribution to the
Chemistry of Biology and and Medicine, Pergamon press, New
York, pp. 192.
Bordin, F., Dall’Acqua, F., Guiotto, A. 1991. Angelicins, angular analogs
of psoralens: chemistry, photochemical, photobiological and
phototherapeutic properties Pharmac. Ther, 52: 331.
Caffieri, S., Favretto, D., 1993. UV-A photolysis of khellin: products
and reaction Mechanism, J. Org. Chem. 58: 7059.
Kornhauser, A., Lambert, L.A., Warner, W.G. 2004. Light-induce dermal
toxicity, Dermatotoxicology Informa Healthcare, 6 th edn.
Schimmer, O. 1997. Studies on the photobiological activity of two
naturelly occurring Furochromones, Visnagin and Khellin in
Chlamydomonas reinhardtii, Mutagenesis, 12: 141.
Specht, K.G., Midden, W.R., Chedekel, M.R. 1984. Photocycloaddition
of 4, 5, 8-Trimethyl psoralen and oleic acid methyl ester: product
structures and reaction Mechanism, J. Org. Chem., 54 :4125-
4134.
Trabalzini, L., Martelli, P., Bovalini, L., Dall’Acqua F., Saga, E. 1990.
Photosensitization of DNA of defined Sequence by furochromones,
Khellin and visnagin. Journal of Photochemistry and Photobiology
B. Biology, 7: 317.
Recieved on 30.10.2010 Accepted on 25.11.2010

Trends in Biosciences 3 (2): 225-227, 2010
Genotypic Identification of Lentil (Lens culinaris) using Electrophoresis Technique
ANURADHA SINGH, MOHAMMAD SHAHID AND R.P. VYAS
Department of Seed Science and Technology, C.S. Azad University of Agriculture & Technology, Kanpur 208 002, (U.P.)
e-mail: singhanu1510@gmail.com, mo.shahid@sify.com
ABSTRACT
Lentil (Lens culinaris) genotypes were selected for
identification, namely Asha, DPL 15, DPL 62, IPL 81, JL 3, K 75,
L 4076, LL 147, LL 4147, LL 56, LL 699, PL 234, PL 406, PL 5,
Ranjan and Subrita using SDS PAGE and PAGE using
electrophoresis techniques. Lentil genotypes were
distinguished based on presence and absence of protein bands
at perticular Rm value. SDS PAGE and PAGE gave the good
banding pattern, however, the banding pattern through SDS-
PAGE gave more polymorphism for characterization of lentil
genotypes based on soluble seed protein. Similarly esterase
isozymes at high concentration (12% running gel) showed good
polymorphism. Electo phoretic can be utilized efficiently for
genotypic identification.
Key words
SDS, SDS-PAGE, electrophoresis, isozyme
Identification of crop genotypes is one of the major areas
of interest for plant breeders, plant pathologists, seed
technologists and plant biochemists. Electrophoretic analysis
of protein and /or isozymes analysis of seeds as well as on
other plant parts can be used for varietal distinction. Poly
acrylamide gel electrophoresis (PAGE) offers a biochemical
approach to the evolutionary aspect of plant speciation.
Change in amino acid composition of protein caused due to
mutation result in altered protein structure thereby changing
the rate of migration of polyacrylamide gel. Electrophoretic
methods, being rapid, cheap, eliminate the need to grow plant
to maturity, are used to check the purity of seeds, varietal
identification and to evaluate the genetic diversity (Sammour,
1991)). The present studies are based on a comparison of the
banding patterns of seed storage proteins by PAGE and SDS
PAGE techniques (Litoriya, et al., 2010).
MATERIALS AND METHODS
The present investigation 16 genotypes of lentil namely
Asha, DPL 15, DPL 62, IPL 81, JL 3, K 75, L 4076, LL 147, LL
4147, LL 56, LL 699, PL 234, PL 406, PL 5, Ranjan and Subrita
were taken for the development of their identification key.
The genetically pure nucleus seed were obtained from
C.S.Azad University , Kanpur.
For SDS PAGE the following method was used, about
1g seed are grinded in mortar and pestle after removing the
seed coat and defatted by defatting solution (2:1:1 Chloroform:
Methanol: Acetone) 4 times. The seeds of lentil were extracted
for protein and esterases isozymes with different bio-chemical
solutions. For protein extraction 1ml Tris- glycine extraction
buffer ( pH 8.3) was added to seed powder (0.5g ) of each
genotype and kept at room temperature ( 37°C ) for 24 hours.
The homogenates were centrifuged in refrigerated centrifuge
at 10,000 rpm (4°C) for 15 minutes. The clear supernatant
mixed with gel loading dye (with SDS) was electrophoresed
on 10% polyacrylamide gel (Sambrook, et al., 1989). Decanted
and clear supernatant was used for sample loading.
Similarly by using PAGE method 5g of defatted seed
powder of lentil was taken in eppendorf tube and added 0.5
ml. etraction buffer (0.1 tris HCl buffer, pH 7.5 ) and left it at
room tempareture for two hours. The homogenates were
centrifuged in refrigerated centrifuge at 10,000 rpm (4°C) for
15 minutes. Decanted and clear supernatant was used for
sample loading.
The electrode buffer filled in the lower tank of the
electrophoresis unit. Loaded 5 ml of the sample into the wells
of the polymerized gel. Filled the upper tank with electrode
buffer, and added 2 – 3 drops of bromophenol blue dye
(tracking dye) to the electrode buffer in the upper tank .The
process was terminated after two hours and the gel was remove
from the unit in a staining tray gently. The gel was stained
with 0.1% bromo phenol blue and distilled water. The gel was
destained by using acetic acid and distilled water without
dye.
RESULTS AND DISCUSSION
The results obtained through SDS PAGE method, lentil
genotypes were distingushed based on presence and absence
of protein bands at particular Rm value. The number of bands
presents in each genotypes ranged from 6 to 14 with Rm value
0.18 to 0.97, (Table 1). The minimum 6 bands were observed in
DPL 15; 9 bands in PL 234, IPL 81, JL 3, K 75; LL 699, LL 56,
and L 4016 ; 10 bands in LP 406, ll 147 and LL4147 ; 11 bands
in Asha, Ranjan, DPL 62, and Subrita. Maximum 14 bands
were observed in PL 5. Based on the Rm value, a total numbers
of 25 protein bands at different Rm value were identified. Bands
having Rm value of 0.62 and 0.81 were common in all
genotypes. Presence and absence of bands, which are
identified by their respective, relative mobilities and numbered
in sequence from cathodal origin. According to bands and
their Rm value, band 1 (0.18), band 10 (0.50), band 14 (0.62)
band 18 (0.74) and band 21(0.81) is common in all genotypes;

226 Trends in Biosciences 3 (2), 2010
Table 1.
Band 2(0.25) is present in Asha, IPL 81, JL 3, PL 406 and PL 5;
Band 3 (0.28) present in Asha, IPL 81, JL 3, PL 406 and PL 5;
Band 4 (0.32) present only in Ranjan; Band 5 (0.34) present in
PL 234, Asha, IPL 81, JL3, PL 406 and PL 5; Band 7 (0.71)
present in DPL 62, LL 699, DPL 15, LL 56, L 4016 and L 4147;
Band 9 (0.46) present in PL 5, LL 699, DPL 15, LL 56, L 4016 and
LL 4147; Band 11 (0.53) present in PL 234, PL 5, Ranjan and K
75; Band 12(0.56) present in PL 234, DPL 62, Subrita, LL 147,
LL 699, DPL 15, LL 56, L 4016 and LL 4147; band 13(0.58)
present in only two genotypes Asha and DPL 62; Band 15
(0.68) present in PL 5, Ranjan, DPL 62, Subrita, LL 147, LL 699
and LL 56; Band 16 (0.71) present in Asha, PL 406 and PL 5,
Band 17 (0.72) present in Ranjan, K 75, L 4016 and LL 4147;
Band 19 (0.77) present in Ranjan, DPL 62, Subrita, LL 147;
Band 22 (0.90) present in IPL 81, JL 3, PL 406, Subrita and LL
147; Band 23 (0.95) present in only Ranjan and Band 24 (0.97)
present in Subrita and LL 147. The observations recorded by
Hussain, et al., 1989 in lentil were more or less similar to our
findings.
Table 2.
Protein banding pattern through SDS PAGE in Lentil.
Rm Value
Genotype .18 .25 .28 .32 .34 .37 .41 .44 .46 .50 .53 .56 .58 .62 .68 .71 .72 .74 .77 .79 .81 .88 .90 .95 .97 Total
bands
PL 234 + - - - + + - - - + + + - + - - - + - - + - - - - 9
Asha + + + - + - - - - + - - + + - + - + - - + + - - - 11
IPL 81 + + + - + - - - - + - - - + - - - + - - + - + - - 9
JL3 + + + - + - - - - + - - - + - - - + - - + - + - - 9
PL406 + + + - + - - - - + - - - + - + - + - - + - + - - 10
PL5 + + + - + + - + + + + - - + + + - + - - + - - - - 14
Ranjan + - - + - - - - - + + - - + + - + + + - + - - + - 11
K75 + - - - + - - + - + + - - + - - + + - - + - - - - 9
DPL 62 + - - - - - + + - + - + + + + - - + + - + - - - - 11
Subrita + - - - - - - - - + - + - + + - - + + - + + + - + 11
LL147 + - - - - - - - - + - + - + + - - + + - + + - - + 10
LL 699 + - - - - - - + - + - + - + + - - + - - + + - - - 9
DPL15 + - - - - - - - - + - + - + - - - + - - + - - - - 6
LL56 + - - - - - - + - + - + - + + - - + - - + + - - - 9
L4016 + - - - - - - + - + - + - + - - + + - - + + - - - 9
LL4147 + + - - - - - + - + - + - + - - + + - + + - - - - 10
Protein banding pattern through PAGE in Lentil.
In the PAGE method, the number of protein bands
present in individual genotypes ranged from 5 to 11 with Rm
value 0.15 to 0.97 (Table 2). The minimum 5 bands were
observed in PL 234, and maximum 11 bands were observed in
Asha; 8 bands observed in PL 406, Ranjan, K 75, DPL 62, DPL
15, LL 56 and LL 4147 ; 6 bands observed only in LL699.
According to bands and their Rm value, Band 1 (0.15) absent
only in two genotypes Pl 5 and Ll 699; Band 2(0.24), Band
7(0.56) and Band 9 (0.68) common in all genotypes. Band 3
(0.29) present only in two genotypes, Asha and IPL 81; Band
4 (0.41) absent in two genotypes, Subrita and LL 147; Band 5
(0.50) present only in two genotypes, Asha and IPL 81; B and
6(0.53) present only in two genotypes, Asha and PL 5; Band 8
(0.67) present only in two genotypes, Asha and IPL 81; Band
10 (0.72) present in 6 genotypes, JL 3, Subrita, LL 147, DPL 15,
L 4016 and LL 4147; Band 11 (0.75) present in 5 genotypes,
Subrita, LL 147, DPL 15, L 4016, LL 4147; Band 12 (0.80) present
in 8 genotypes PL 5, DPL 62, DPL 62, Subrita, LL 147, LL 699,
DPL 15, L 4016, LL 4147; Band 13 (0.82) present in 9 genotypes,
Genotype
Rm Value
.15 .24 .29 .41 .05 .53 .56 .67 .68 .72 .75 .80 .82 .85 .91 .94 .97 Total band
PL 234 + + - + - - + - + - - - - - - - - 5
Asha + + + + + + + + + - - - - + - - + 11
IPL 81 + + + + + - + + + - - - - + - - - 9
JL3 + + - + - - + - + + - - + - + - + 9
PL406 + + - + - - + - + - - - + - + - + 8
PL5 - + - + - + + - + - - + - + + - + 9
Ranjan + + - + - - + - + - - - + - + - + 8
K75 + + - + - - + - + - - - + - + - + 8
DPL 62 + + - + - - + - + - - + + - + - - 8
Subrita + + - - - - + - + + + + + - + + - 10
LL147 + + - - - - + - + + + + + - + + - 10
LL 699 - + - + - - + - + - - + - - - + - 6
DPL15 + + - + - - + - + - + + - - - + - 8
LL56 + + - + - - + - + + - - + + - - - 8
L4016 + + - + - - + - + + + + + + - - - 10
LL4147 + + - + - - + - + + + + - - - - - 8

SINGH et al., Genotypic Identification of Lentil (Lens. culinaris) using Electrophoresis Technique 227
JL 3, PL 406, Ranjan, K 75, DPL 62, Subrita, LL 147, LL 56 and
L 4016; Band 14 (0.85) present in 5 genotypes, Asha, IPL 81,
PL 5, LL 56 and L 4016; Band 15 (0.91) present in 8 genotypes
JL 3, PL 406, PL 5, Ranjan, K 75, DPL 62, Subrita and LL 147;
Band 16 (0.94) present in 4 genotypes, Subrita, LL 147, LL 699
and DPL 15 and Band 17 (0.97) present in 6 genotypes, Asha
JL 3, PL 406 Ranjan and K 75.
In the PAGE profile of esterase isozymes, the different
bands which are distinguising the genotypes on the basis of
present and absent of bands at particular Rm value. The
number of bands presents in each genotypes ranged from 6
to 9 with Rm value 0.08 to 0.92 (Table 3). According to total
band present in each genotypes maximum 9 band present in 4
genotypes, Asha, PL 5, K 75 and LL 56; 8 bands present in 6
genotypes, PL 234, Ranjan, LL 147, LL 699, LL 4016 and LL
4147; 7 bands present in 5 genotypes, IPL 81, JL 3, DPL 62,
Subrita, and DPL 15. Minimum 6 bands present only in one
genotypes i.e., PL 406. Based on the Rm value, total 10 band
were identified. According to bands and their Rm value. Band
1(0.08), Band 2 (0.21) Band 4 (0.45), Band 5 (0.50), Band 8
(0.79) present in 8 genotypes, Asha, PL 5, Ranjan, K 75, DPL
Table 3.
Estrase isoenzymes banding pattern through
PAGE in lentil
Rm Value
Genotype .08 .21 .37 .45 .50 .57 .67 .79 .83 .92 Total
band
PL 234 + + - + + - + + + + 8
Asha + + + + + - + + + + 9
IPL 81 + + - + + - + + - + 7
JL3 + + - + + - + + - + 7
PL406 + + - + + - - + - + 6
PL5 + + + + + + + + - + 9
Ranjan + + + + + - + + - + 8
K75 + + + + + + + + - + 9
DPL 62 + + - + + + - + - + 7
Subrita + + - + + + - + - + 7
LL147 + + + + + + - + - + 8
LL 699 + + + + + + - + - + 8
DPL15 + + + + + - - + - + 7
LL56 + + + + + + + + - + 9
L4016 + + - + + + + + - + 8
LL4147 + + - + + + + + - + 8
62, LL 699, DPL 15 and LL 56 Band 6 (0.57) absent in 7
genotypes, PL 234, Asha, IPL 81, JL 3, PL 406, Ranjan, and
DPL 15; Band 7 (0.67) absent in 6 genotypes, PL 406, DPL 62,
Subrita, LL 147, LL 699 and DPL 15; Band 9 (0.83) present in
two genotypes, PL 234 and Asha. The band 10 was present in
all the genotypes.
Anu and Peter, 2003 also studied the analysis of seed
proteins of 29 lines of Capsicum annuum by SDS PAGE which
showed that each genotype was distinct from other. Protein
electroporesis SDS-PAGE to evaluate genetic purity diversity
of different lentil genotypes and concluded that
electrophoretic analysis of seed storage proteins widely
recognized as a technique for genotype identification in the
breeding species. On the basis of result, this can be said that
for characterization of genotypes of lentil, however,
electrophoretic profile of SDS PAGE and PAGE with soluble
seed proteins and esterase isoenzyme were resulted distinct
banding pattern and acts as function of genotypic finger
printing. Therefore, electrophoregram of SDS PAGE and PAGE
was found much better for characterization of genotypes of
lentil.
LITERATURE CITED
Anu, A. and Peter, K.V. 2003. Analysis of seed protein of 29 lines of
Capsicum annuum L. by polyacrylamide gel electrophoresis.
Genetic Resources and Crop Evolution, 50, 239.
Husain, A., Bhushuk, W. and Clark, K.W. 1989. Discrimination of
cultivars of lentil (Lens culinaris Medic) by electrophoresis of seed
proteins. Can. J. Plant Sci., 69: 243-264.
Litoriya N., Kaur, D., Patel, N.J. and Talati, J.G. 2010. Varietal
identification of Chilli (Capsicum annuum L.) by electrophoretic
technique. Indian J. Agric. Biochem., 23(1): 36-40.
Sambrook, J., Fritsch, E.F. and Maniatis, T. 1989. Moleculer cloning:
A Laboretory manual, Cold Spring Harbor, New York.
Sammour, R.H. 1991. Using electrophoretic techniques in varietal
identification, biosystematic analysis, phylogenetic relations and
genetic resources management. Journal of the Islamic Academy of
Sciences, 4(3):221–226.
Recieved on 15.10.2010 Accepted on 25.11.2010

228 Trends in Biosciences 3 (2): 228-229, 2010 Trends in Biosciences 3 (2), 2010
Two Novel Additions to Meliola Fr. and Some Additional Records of Foliicolous
Fungi from Mahabaleshwar
D.P. SINGH AND T.P. MALL
Post Graduate Department of Botany, Kisan P-G College, Bahraich (U.P.) 271 801
e-mail: drtpmall@rediffmail.com
ABSTRACT
During 2008, in Mahabaleshwar Distt. Satara, a survey was
corducted for foliicolous fungi and collected eleven host plants
being parasitized with nine fungi from Wilson point area of
Mahabaleshwar. Adina cardifolia Hook. (Rubiaceae) was found
infected with Cercospora adinina where as Albizzia procera L.
Benth. (Mimosaceae) with Cercospora albiziae; Albizzia sp. with
Pseudocercospora sp.; Flacourtia indica Merrill (Flacourtaceae)
with Meliola sp. Fr.; Gardenia gummifera Linn. (Rubiaceae)
with Stenella sp.; Polygonum chinensis Willd (Polygonaceae)
with Asterina sp.; Polygonum sp. Willd with Cercospora poligoni
and Pseudocercospora poligoni; Syzygium heaneana Wall ex
Duthie (Myrtaceae) with Asterina and Syzygium sp. Linn. with
Alternaria and Meliola sp. All the fungal taxon were indentified
after making microscopic preparations It revealed that all the
hosts and their parasites were new records either from
Mahabaleshwar and Maharashtra.
Key words
Foliicolous fungi, Mahabaleshwar, new record
(Rubiaceae) was found infected with Cercospora adinina
where as Albizzia procera L. Benth. (Mimosaceae) with
Cercospora albiziae; Albizzia sp. with Pseudocercospora
sp.; Flacourtia indica Merrill (Flacourtaceae) with Meliola
sp. Fr.; Gardenia gummifera Linn. (Rubiaceae) with Stenella
sp.; Polygonum chinensis Willd (Polygonaceae) with Asterina
sp.; Polygonum sp. Willd with Cercospora poligoni and
Pseudocercospora poligoni; Syzygium heaneana Wall ex
Duthie (Myrtaceae) with Asterina and Syzygium sp. Linn. with
Alternaria and Meliola sp. A number of collections exhibited
black mildew were encountered which upon critical
examination two new taxa of species rank of genus Meliola
Fr. viz., Meliola syzyginea sp. nov., M. flacourticola sp. nov.
occurring on Syzygium sp. Linn (Myrtaceae; HCIO-48269) and
Flacourtia indica Merrill (Flacourtiaceae; HCIO-48270) were
identified. (Singh and Mall, 2008).
On leaves of Syzygium sp. Meliola kukkeensis has been
reported by Hosagoudar, et al., 2007 which differs from the
The leaves provide a very suitable habitat for the growth
and development of fungal pathogens by providing ample
surface area and nutrient supply. Such leaf inhabiting fungi
are known as foliiocolous and invaded area of the leaf as leaf
spot or leaf lesions. The weeds and forest plants serve as
reservoirs of leaf spot pathogens which on getting opportunity
may spread to agricultural and horticultural plants. Keeping
this view in mind during January, 2008 in Mahabaleshwar,
survey for foliicolous fungi was conducted to know the
occurrence of any fungi present in region.
MATERIALS AND METHODS
During survey infected leaf samples were taken in
separate polythene bags. Suitable mounts of surface scrapping
and free hand cut sections were prepared from infected
portions of the leaf samples; microscopic slides were prepared
in cotton-blue lactophenol mixture. Slides were examined and
camera lucida drawings were made which seems to be new.
Morphotaxonomic determinations of taxa were done with the
help of current literature. Holotypes have been deposited in
HCIO, IARI, New Delhi and all the isotypes/paratypes retained
in the departments herbarium for further reference.
RESULTS AND DISCUSSION
During survey eleven host plants were collected being
parasitized with nine fungi. Adina cardifolia Hook.
Fig. 1.
Meliola syzyginea sp. nov. a. Infected leaf,
b. Appressorium, c. Phialide, d. Apical portion of the
mycelial setae, e. Ascospores.

SINGH AND MALL, Two novel additions to Meliola Fr. and some additional records of foliicolous fungi 229
ACKNOWLEDGEMENT
Authors are thankful to Dr. S.P. Singh Principal, Kisan
P.G. College, Bahraich for providing facilities and to Prof. Kamal
Emeritus Scientist, DST for helpful suggestions and
encouragements.
LITERATURE CITED
Fig. 2.
Meliola syzyginea sp. nov. a. Infected leaf,
b. Appressorium, c. Phialide, d. Apical portion of the
mycelial setae, e. Ascospores.
new species due to its having smaller size of black mildew
colonies, opposite hyphal branching, mycelial setae dentate
to farcate at the tip where as the present fungal species develop
black mildew spots forming velvety covering of 3-4 mm
confluent colony on both surface Meliola sp. has not been
reported hitherto on Flacourtia indica either from
Mahabaleshwar, India or abroad. (Bilgrami, et al., 1981, 1991,
Goos and Hosagoudar, 1998, Hosagoudar and Goos 1990,
Hosagoudar 1996, Hosagoudar, et al., 1997, Hosagoudar and
Abraham, 1998, Hosagoudar, et al., 2007, Jamaluddin, et al.,
2004, Jana, et al., 2005 and Singh and Mall, 2007, 2008).
This species differs from all the known species of Meliola
Fr. This novel addition to Meliola Fr. has thin epiphyllous
non confluent colonies of 2 mm diameter. The critical
examination of the literature reveals that all the host and their
parasites has not been reported hitherto either from
Mahabaleshwar or Maharashtra.
Bilgrami, K.S. Jamaluddin and Rizwi, M.A. 1981. Fungi of India Part-II
Today and Tomorrow’s printers and publishers. New Delhi, pp.
140.
Bilgrami, K.S. Jamaluddin and Rizwi, M.A. 1991. Fungi of India Part-I
List and References. Today and Tomorrow’s printers and publishers.
New Delhi, pp. 778.
Goos, R.D. and Hosagoudar, V.B. 1998. Meliola chennaiana sp. nov.
and some additional recards of fungi from India. Mycotaxon, 68:
41-46.
Hosagoudar, V.B. and Goos, R.D. 1990. Meliolaceous fungi from the
state of Kerala, India-II. The ginus Meliola. Mycotaxon, 37: 217-
272.
Hosagoudar, V.B. 1996. Meliolales of India. Botnical survey of India,
Calcutta, pp. 363.
Hosagoudar, V.B., Abraham, T.K. and Pushpangadan, P. 1997. The
Meliolineae A Supplement. Tropical Botnic Garden and Research
Institute, Palode, Thiruvananthapuram, Kerala, pp. 201.
Hosagoudar, V.B. and Abraham, T.K. 1998. Some interesting
meliolaceous fungi from Kerala. India. J. Mycopath. Res. 36: 95-
102.
Hosagoudar, V.B., Archana, G.R. and Agarwal, D.K. 2007. Meliolates of
Kerala, India-XXV. Indian phytopath. 60(2): 237-243.
Jamaluddin, Goswami, M.G. and Ojha, B.M. 2004. Fungi of India 1989-
2001; scientific Publishers (India), Jodhpur; pp.326.
Jana, T.K., Ghose, S.N. and Das, A.K. 2005. Meliolaceae of Nagaland
(India)- I. J. Mycopathol. Res. 43: 33-40.
Singh, D.P. and Mall, T.P. 2007. Foliicolous Fungi of Medicinal Plants
in North Western Tarai region Uttar Pradesh. Environment
conservation Journal 8(3) 13-16.
Singh, D.P. and Mall, T.P. 2008. Two New Species of Meliola Fr. From
Mahabaleshwar. Annual Meeting of IPS (MEZ) & National
Symposium Advances in Microbial Diversity and Disease
Management for Sustainable Crop Production. College of Forestry
and Hill Agriculture, G.P. Pant Univ. of Ag. & Tech. Hill Campus,
Ranichauri (Abstr.).
Recieved on 30.03.2010 Accepted on 09.10.2010

230 Trends in Biosciences 3 (2): 230-231, 2010 Trends in Biosciences 3 (2), 2010
Farmers Participatory Approach for Sustainable Cotton Production Through
Integrated Pest Management
A.S. YADAV 1 , P.N. TRIPATHI, R.C. SHARMA AND PRADHUMAN SINGH 2
Jawaharlal Nehru Krishi Vishwa Vidyalaya, Krishi Vigyan Kendra, Harda, (M.P.) 461 331
1
JNKVV, Krishi Vigyan Kendra, Harda (M.P.) 461331 2
Krishi Vigyan Kendra, Raisen, Madhya Pradesh
e-mail: asyadav_75@rediffmail.com
ABSTRACT
With an aim of popularization of IPM technology in cotton,
demonstrations were taken up for the two consecutive years
from 2008-09 and 2009-10 in farmers fields. Farmers practice
was served as Non-IPM check. Results revealed that sucking
pests (Aphid, Jassid, Thrips and Whitefly) population was
reduced in IPM practice. Natural enemies (Ladybird beetle,
Chrysoperla and Spider) population was recorded maximum in
IPM practice. The seed cotton yield and net return was quite
high in IPM practice in compared to farmers practice. Plant
protection application was more in farmers practice than IPM.
The overall success in managing pest complex was attributed
to the use of botanical insecticides, pheromone traps, bird
perchers, use of selective insecticides at right time apart from
enhanced biotic potential exerted from parasitoids and
predators.
Key words
Farmers’ participation, sucking pest, IPM, Bt cotton
Cotton is an important fibre crop of global significance,
a loss of about Rs. 3400 million per annum is estimated
due to damage caused by insect pests in cotton crop in
India. In India cotton crop stands first on which insecticide
use is maximum i.e., 44.5% out of total pesticide consumption
in the country; whereas in the world it occupies third position
with respect to pesticide use 10.20% (Pawar, et al., 2003). Area
under cotton cultivation is shrinking due to the uneconomical
productivity. Pest complexity is the major threatening problem
deterring the cotton production. Cotton crop as such is
vulnerable to the attack of many insect pests in all its growth
period. To combat these pests, farmers have relied heavily
upon the chemical protection. Protection through chemicals
although is all right to some extent but indiscriminate usage
lead to several deterious problem. Pest resurgence and
development of resistance by the pest against the insecticides
is the major issue to be enlightened with the use of hazardous
chemical pesticides. Keeping in view the said necessity, large
scale IPM technology demonstrations have been implemented
for two successive years from 2008-09 and 2009-10 in the
farmers’ fields of Harda district of Madhya Pradesh.
MATERIALS AND METHODS
Large scale IPM demonstrations were conducted for
two successive years from 2008-09 and 2009-10 in the farmers’
fields of Khirkiya block of Harda district, Madhya Pradesh
under close supervision of JNKVV, Krishi Vigyan Kendra. Year
wise total area under IPM, villages covered and number of
beneficiary has been furnished in the following table.
The following IPM package was demonstrated- (1) Seed
treated Bt cotton hybrids RCH 2, Ankur 09, Banny, Mallika
with Imidacloprid 70 WS@ 7gm/kg seed (2) Five row of Refugia
around the main crop (3) Trap crop Maize and mary gold
Year Area (ha) No. of farmers Village covered
2008-09 50 100 One whole village
2009-10 25 63 One whole village
Total 75 163 -
(4) Bird perchers were erected @ 20/ha in the field for enhancing
the birds activity (5) Pheromone trap @ 10/ha were fixed in the
field for monitoring the activity of Helicoverpa armigera
(6) Neem oil 1500 ppm and was sprayed as per the
recommendation (7) Need based insecticides were applied as
and when required Farmers method served as a non IPM
method which included 7-10 round of insecticidal applications.
The population of sucking pests was recorded randomly
selected 20 plants per three leaves (top, middle and bottom) at
15 days intervals from each plot. Likewise, the population of
predators was also recorded from 20 plants at 15 days interval.
Mean number of sucking pests and predators was obtained.
Finally, seed cotton yield recorded from IPM and farmers
practice plots was computed along with respective monitory
return and benifit: cost ratio.
RESULTS AND DISCUSSION
Results obtained from two years of demonstrations
presented in Table 1. The mean lowest population of sucking
pests viz., jassids (1.32/leaf), aphids (9.05/leaf), thrips (7.99/
leaf) and whitefly (10.81/leaf) was recorded in IPM plots. On
the contrary, highest population of jassids, aphids, thrips and
whitefly was recorded to the time of 2.13, 13.71, 15.05 and
17.35 per leaf respectively in plots where IPM practice was
not adopted. The higher population of predators recorded
per plant was in IPM plots lady bird beetle 3.39, chrysoperla
1.38 and spider 0.67 per plant before pesticide application
(Table 2). Similarly, the cumulative mean population of lady
bird beetle (2.68/plant), chrysoperla (1.15/plant) and spider
(0.53/plant) was reorded in IPM plots after pesticide
application. In the other hand lower population of predators
was recorded in before pesticide application (1.50, 0.69 and
0.50 per plant) and after pesticide application (0.40, 0.20 and
0.15 per plant) lady bird beetle, chrysoperla and spider
respectively in non IPM plots. The higher seed cotton yield
of 20.34 and 19.35 q/ha was obtained during 2008-09 and
2009-10 with a cumulative mean yield of 19.85 q/ha in IPM
plot. Comparatively lower yield level obtained in non IPM

YADAV et al., Farmers Participatory Approach for Sustainable Cotton Production Through Integrated Pest Management 231
Table 1.
Influence of IPM and non IPM practice on sucking
pests incidence
Year Jassid/leaf Aphid/ leaf Thrips/ leaf Whitefly/ leaf
IPM Farmers IPM Farmers IPM Farmers IPM Farmers
practice practice practice practice
2008-09 1.06 1.96 9.40 13.32 8.93 14.90 10.02 13.84
2009-10 1.58 2.29 8.70 14.10 7.05 15.20 11.60 20.85
Average 1.32 2.13 9.05 13.71 7.99 15.05 10.81 17.35
Table 2.
*FP- Farmers practice
Impact of IPM and non IPM practice on natural
enemy population
Year Before pesticide application After pesticide application
Ladybird Chrysoperla/ Spider/ Lady bird Chrysoperla/ Spider/
beetle/plant plant plant beetle/plant plant plant
IPM FP* IPM FP IPM FP IPM FP IPM FP IPM FP
2008-09 3.02 1.95 1.16 0.72 0.63 0.51 2.30 0.48 0.95 0.19 0.45 0.12
2009-10 3.76 1.05 1.60 0.66 0.70 0.48 3.05 0.32 1.35 0.20 0.60 0.18
Average 3.39 1.50 1.38 0.69 0.67 0.50 2.68 0.40 1.15 0.20 0.53 0.15
plots (16.90 and 15.70 q/ha) during 2008-09 and 2009-10
(Table 3). Overall on an average of 21.80 per cent increase in
yield level was documented in IPM practice over Non- IPM
practice. The average net profit generated over two years
was estimated as Rs 35288.50 per ha and which was far higher
than the profit obtained out of non IPM practice (Rs 21559.50/
ha) (Table 4). Average additional net profit Rs 13629/ha was
recorded in IPM practice over non IPM. Higher net profit
generated in IPM plots was directly connected with the
maximum (average of two years) seed cotton yield of 19.85 q/
ha obtained due to adoption of IPM practice, whereas, average
lower yield of 16.30 q./ha was recorded in non-IPM practice.
Similarly, B:C ratio recorded in IPM plots was quite high i.e.,
2.55 and 2.44 during 2008-09 and 2009-10. On the side, Non-
IPM practice registered low B:C ratio of 1.92 and 1.89 during
2008-09 and 2009-10 due to excessive and non judicious use
of insecticides. Considerable reduction of sucking pest in
IPM plot was attributed to the seed treatment with Imidacloprid
and timely use of botanical insecticides, which gave good
protection to the crop up to 45 days from sucking pests. It
could also be reasoned with higher cumulative effect of
nataural enemies such as coccinellids, chrysoperla, spiders
and other parasitoids whose actively reduced the population
of sucking pests. Surulivelu, et al., 2000 reported Imidacloprid
seed treatment formulation is effective in reducing, aphid and
jassid population. Bt cotton is IPM compatable in so far as it
can reduce the use of sprayed materials and enhance natural
Table 4.
Economic analysis of IPM technology in Bt cotton
2008-09 2009-10 Pooled mean
Particulars
IPM Farmers IPM Farmers Farmers
IPM
practice practice practice
Average yield (q/ha) 20.34 16.90 19.35 15.70 19.85 16.30
Average cost of cultivation 24178 23671 22985 24070 23581.50 23870.50
(Rs/ha)
Average Gross return 61625 45530 56115 45530 58870 45530
(Rs/ha)
Average Net profit (Rs/ha) 37447 21859 33130 21460 35288.5 21659.5
Benefit: cost ratio 2.55 1.92 2.44 1.89 2.50 1.91
Profit of IPM over farmers
practice
15588 - 11670 - 13629 -
Table 3.
Seed cotton yield (q/ha) as influenced by IPM in
farmers fields
Year
Yield (qt./ha)
% increase
IPM Farmers practice over control
2008-09 20.34 16.90 20.36
2009-10 19.35 15.70 23.25
Average 19.85 16.30 21.80
enemy population. Rafee, et al., 2004, recorded the increased
activity of natural enemies like ladybird beetle, chrysoperla
and spiders by using adoption of IPM package. Avoidance of
application of insecticides at the early stage increase the early
build up of natural enemies such as predators like green lace
wing, ladybird beetle and syrphid flies in addtion to spiders
(Rajendran, 2004). Regarding the cost benefit ratio, it was found
that maximum B:C ratio is worked out due to IPM practice in
comparison with non IPM. The higher seed cotton yield and
cost benefit ratio in IPM module reported earliar by Puri, et
al., 2000, Rafee, et al., 2004, Hilli, et al., 2004 and Reddy, et al.,
2004. The IPM technology played significant role in
convincing the farming community from the point of its
effectiveness, reduced usage of pesticides and cost of
production, conservation of natural enemies which ultimately
lead to better cost benefit ratio rather than the yield advantage.
LITERATURE CITED
Hilli, J.S., Sarojani, J.K., Budihal, R.A. and Halagalimath, S.P. 2004.
Adoption of integrated pest management technology in cotton
production in Dharwad district Karnataka state. Proc. International
symposium on Strategies for sustainable cotton production – A
Global vision, UAS, Dharwad, Socio- Economics, 4, pp. 81-82.
Pawar, V.M., Lavekar, R.C., Borikar, P.S. and Bhosale, B.B. 2003. Bt
cotton: weapon to combat bollworms, Souvenir, Recent trends in
pest management, state level seminar, MAU, Parbhani February.
pp. 11-17.
Puri, S.N., Sharma, O.P., Murthy, K.S., Lavekar, R.C., Dandapani, A.
and Kumar, P. 2000. Sustainable pest management suing IPM
technology a real possibility: a case study of Astha (M.S.). Int.
Conference on managing natural resorces for sustainable
Agricticulture production in the 21st century. Extended summaries,
Vol.3 Volunary papers- Resource management. February, New Delhi,
pp. 1175.
Rafee, C.M., Lingappa, S., Patil, B.V., Yenjerappa, S.T., Kalibhavi,
C.M. and Vijayashekhar, K. 2004. Popularisation of IPM technology
in cotton growing Tungabadhra command area of Bellary district.
Proc. International symposium on Strategies for sustainable cotton
production – A Global vision, UAS, Dharwad, Socio- Economics 4,
pp. 93-95.
Rajendran, T.P. 2004. Challenges for management of sap sucking pests
in cotton. Proc. International symposium on Strategies for
sustainable cotton production – A Global Vision, UAS, Dharwad,
Crop protection, 3, pp. 37-41.
Reddy, M., Chardra Sekhar, Reddy, V.K., Siva, Reddy, A.N., Babu, J.S.
and Reddy, T. 2004. Economics of integrated pest management in
farmers field. In: Proc. International symposium on Strategies for
sustainable cotton production – A Global Vision, UAS, Dharwad,
Socio-Economics, 4, pp. 115-116.
Surulivelu, T., Venugopal, K., Kannan, R. and Pandi, V. 2000.
Imidacloprid seed treatment-effect on sucking pests, predators,
plant growth and productivity in cotton. Proceeding World Cotton
Conference-2 Athens, Greece. September, pp. 874-877.
Recieved on 25.09.2010 Accepted on 28.11.2010

232 Trends in Biosciences 3 (2): 232-233, 2010 Trends in Biosciences 3 (2), 2010
SHORT COMMUNICATION
In vivo Production and Infectivity of Oscheius amsactae (Ali, et al., 2007) on Four
Agriculturally Important Insect Pests
S.S. ALI, M. ASIF, P. DURAIMURUGAN, M.H. AKHTAR, RASHID PERVEZ, AZRA SHAHEEN AND
IMRAN AHMAD
Indian Institute of Pulses Research, Kanpur 208 024
e-mail: ss_ali@rediffmail.com, asifkazi9839517160@gmail.com
The infectivity of Oscheius amsactae (Ali, et al., 2007)
was tested against four agriculturally important insect pests
and its invivo production was also done on these pests viz.,
blister beetle, grey weevil, pumpkin beetle and Epilachna sp.
The blister beetle, Mylabris pustulata (Thunberg) (Coleoptera:
Meloidae) adult beetle, eats flowers and cause pod losses in
pigeon pea. Beetles occur in swarms and devour all the floral
parts. A single beetle can destroy as many as 20- 30 flowers a
day. The preferred hosts of the beetle include pigeon pea,
mungbean, urdbean, ricebean, cowpea, groundnut, cotton,
okra and Hibiscus (Durairaj and Senguttuvan, 2003). Second
test insect was grey weevil, Myllocerus sp. (Coleoptera:
Curculionidae), adult weevils starts feeding on the margin of
leaves with irregular cuttings and then proceeds inward making
holes on leaf surfaces. Grubs feed on roots, while adults attack
seedlings as well as grown up plants. The preferred hosts of
the beetle include pigeon pea, mungbean, urdbean, soybean,
and cotton. In soybean, the feeding affects dry weight of
stem and pod size, leading to 10.2 % loss in grain yield (Dey,
2008). Third test insect was pumpkin beetle, Aulacophora
(Raphidopalpa) foveicolls (Coleoptera: Galerucidae) the adult
beetles feeds on leaf and flowers. The grubs feed on the roots,
stem and fruits touching the soil. It is a major pest of cucurbits
and it is also reported to cause damage in mungbean. The last
tested insect was Epilachna sp. (Coleoptera: Coccinellidae)
the adults feed by scrapping the chlorophyll from epidermal
layers of leaves which gets skeletonized and gradually dry
away. It is a major pest of brinjal and it is also reported to
cause damage in mungbean and urdbean. In view of their
economic importance preliminary studies were done on invivo
production and infectivity of Oscheius amsactae (Ali, et al.,
2007) which may be useful for their management through
biological control in future.
Fresh culture of Oscheius amsacate (Ali, et. al., 2007)
were multiplied on the last instar larvae of wax moth, Galleria
mellonella (L.) which were reared on artificial diet (David and
Kurup, 1988). The basic in vivo production method outlined
by Woodering and Kaya, 1988 was followed for multiplication,
storage and quantification of the population of nematodes.
The test insects were collected from the fields and main farm
of Indian Institute of Pulses Research, Kanpur. Test insect
were put on six well plates having filter paper. The Oscheius
amsactae @ 300 IJs was inoculated on the test insects.
Observation on insects mortality were observed at 24 hours’
time interval. Dead insect were put on white trap (White, 1927)
to observe multiplication of EPN on insect body. Experiments
were conducted at room temperature during October and
November under laboratory conditions. The petridishes were
incubated at room temperature. Treatments were arranged in
a complete randomized design with 5 replicates. In untreated
control 0.5 ml of distilled water was used to wet the filter
papers before placing the test insects in the petridishes.
Preliminary studies were conducted to confirm the
infectivity of O. amsactae to the tested insect, dead cadavers
were put on white traps. The emerging nematodes were again
infected to test insect to confirm the Koch’s postulate, which
was found positive.
It was noted that O. amsactae was highly infective to
Epilachna sp. as it brought about 100 % mortality within 48 h
of inoculation. The mortality of grey weevil, red pumpkin beetle
and blister beetle was recorded within 96 h after inoculation.
Nematode (Fig. 1). Multiplication was observed well on their
bodies, and 3400 IJs/cadaver from Epilachna beetle, 800 IJs/
cadaver from red pumpkin beetle have been recovered (Fig.
2). However, very poor IJs emergence from the blister beetle
and grey weevil (100 and 200 IJs/cadaver, respectively) was
recorded and these can be considered as poor host of
Oscheius amsactae. Epilachna beetle can be considered as
Mortality after hrs.
100
90
80
70
60
50
40
30
20
10
0
Fig. 1.
Mortality of insect pest by Oscheius amsactae
Myllocerus sp.
I n s e c t
Aulacophora foveicollis
S p e c i e s
Pathogenicity of Oscheius amsactae against different
insect pests

ALI et al., Invivo Production and Infectivity of Oscheius amsactae (Ali, et al., 2007) 233
Production of IJs ( No.)
3500
3000
2500
2000
1500
1000
Fig. 2.
500
0
Myllocerus sp. M.
pustulala
In vivo mass production of Oscheius amsactae on
different insects pests
very good host and can be used for in vivo multiplication of
O. amsactae. The infestation by Oscheius amsactae of grey
weevil Myllocerus sp., Epilachna sp., red pumpkin beetle,
Aulacophora foveicollis and blister beetle, Mylabris pustulala
through O. amsactae was reported for the first time.
LITERATURE CITED
A.
foveicollis
I n s e c t s S p e c i e s
Epilachna sp.
Ali, S. S., Shaheen, A., and Pervez, R. 2007. Oscheius amsactae sp.n.
(Nematoda: Rhabditida,) new Entomopathogenic nematodes from
Kanpur, Uttar Pradesh, In: National Symposium on Legumes for
Ecological Sustainability: Emerging Challenge and Opportunities,
(Abstr.) Indian Institute of Pulses Research, Kanpur. pp.316.
Durairaj, C and Senguttuvan, T. 2003. Preliminary observations on the
biology of three species of blister beetle genus Mylabris. Madras
Agriculture Journal, 90: 115-118.
Dey, D. 2008. Managing major pests on soybean. Indian Farming, pp.
32-36
David, H. and Kurup, N.K. 1988. Techniques for mass production of
Sturmiopsis inferens Tns.. In: Biocontrol technology for sugarcane
pest management (eds. H. David and S. Easwaramoorthy). Sugarcane
Breeding Institute Publications, Coimbatore, India. pp. 87-92
Kaya H.K. and Gaugler R. 1993. Entomopathogenic nematodes. Annual
Review of Entomology, 38: 181-206.
White, G. F. 1927. A method for obtaining infective nematode larvae
from cultures. Science, 66: 302-303.
Woodring, J.L., and Kaya, H.K. 1988. Steinernematid and
heterorhabditid nematodes: a handbook of biology and techniques.
Southern Cooperative Series Bulletin 331, Arkansas Agricultural
Experiment Station, Arkansas, Fayetteville, pp. 28.
Received on 25.06.2010 Accepted on 29.08.2010

Trends in Biosciences 3 (2): 234, 2010
SHORT COMMUNICATION
Correlation Between Insect Predators and Their Host Insects in Cotton Crop
J.K. PATEL, M.V. VEKARIA AND I.S. PATEL
Department of Entomology, C.P. College of Agriculture, S.D. Agricultural University, Sardarkrushinagar 385 506
e-mail: dr.ispatel@gmail.com
Cotton is one of the important fiber crop extensively
grown in different districts of Gujarat state. Due to large scale
cultivation of this crop sucking and bollworm pests cause
severe damage. These pests cause annual loss to the tune of
50-60 per cent of total production (Anonymous, 1996a). In
nature, they are regulated by several natural enemies. To
conserve potent bioagents, safer insecticides is to be selected
and sprayed judiciously. Before spraying of insecticides peak
activity of bioagents is to be known. Attempt was therefore
been made to find out the relationship between insect
predators and host insects in cotton crop.
Simple correlation between predatory insects, viz., green
lacewing, lady bird beetle, spider, big eyed bug and staphylinid
with their host insects like aphid, jassid, thrips, whitefly, mite,
American bollworm, spotted bollworm, pink bollworm and
spodoptera were worked out by using their periodical mean
populations. The Chrysoperla predator was positively
correlated with aphid population (r = 0.58**) and negatively
correlated with jassid (r = -0.46**) and mite (r = -0.37**) and
their correlation coefficients were highly significant. However,
the chrysopid predator did not exhibit remarkable effect on
correlation coefficients were significant. However, the big eyed
bug did not exhibit remarkable effect on aphid, thrips, mite,
American bollworm and spotted bollworm. However, the
present findings do not agree with earlier results, however, it
does prove the common connotation.
The population of predatory spider was positively
correlated with jassid population (r = 0.38**) and whitefly
population (r = 0.33*) and the correlation coefficient was
significant. The other host insects viz., aphid and American
bollworm were positively correlated with this predators,
although their correlation coefficients were non significant. It
was reported that the positive correlation between spider and
incidence of aphid, jassid and whitefly population
Anonymous, (1999). The Staphylinid predator was positively
correlated with jassid population (r = 0.39**) and Spodoptera
population (r = 0.34**) and their correlation coefficients were
significant. However, the Staphylinid predator did not exhibit
remarkable effect on aphid, thrips, whitefly, mite, American
bollworm and spotted bollworm. However, the present findings
do not agree with earlier results, however, it does prove the
common connotation.
Table 1. Correlation between insect predators and their host insects (n = 31)
Predatory insects
Insect pests
Green lacewing Lady bird beetle Big eyed bug Spider Staphylinid
Aphid 0.582** 0.125 0.128 0.213 0.051
Jassid -0.467** 0.084 0.423** 0.385** 0.394**
Thrips 0.099 0.069 0.186 0.192 0.038
Whitefly 0.134 0.231 0.301* 0.338* 0.093
Mite -0.373** -0.312* 0.133 0.132 0.072
American bollworm 0.071 - 0.114 0.081 0.137
Spotted bollworm 0.036 - 0.037 - 0.025
Pink bollworm - - - - -
Spodoptera - - - - 0.344**
*Significant at 5 per cent level (±0.29); ** Significant at 1 per cent level (±0.34)
whitefly, thrips, American bollworm, spotted bollworm, pink
bollworm, and Spodoptera. It was reported that the positive
correlation between Chrysoperla population and incidence
of aphid pests and negative correlation between Chrysoperla
and jassid population (Anonymous, 2001). The population of
ladybird beetle was negatively correlated with mite population
(r = -0.31*) and the correlation coefficient was significant.
However, the present findings similar with the it was reported
by positive correlation between ladybird beetle and incidence
of aphid, jassid and thrips population and negative correlation
between ladybird beetle and whitefly incidence (Anonymous,
1996b). The big eyed bug was positively correlated with jassid
population (r = 0.42**) and whitefly (r = 0.30*) and their
LITERATURE CITED
Anonymous, 1996a. Annual Progress Report of All India Co-ordinated
Cotton Improvement Project, Surat., pp.14-18.
Anonymous, 1996b. Seasonal abundance of cotton insect pests and
their natural enemies. Central Institute for Cotton Research, Nagpur,
pp. 34.
Anonymous, 1999. Influence of weather factors on cotton pests. Central
Institute for Cotton Research, Nagpur, pp.69.
Anonymous, 2001. Studies on correlationbetween insect predators and
their host insects. Central Institute for Cotton Research, Nagpur,
pp.62.
Recieved on 10.04.2010 Accepted on 26.07.2010

Trends in Biosciences 3 (2): 235-236, 2010
SHORT COMMUNICATION
Screening of Rhizospheric Soil Samples for Mycorrhizae and Study of Its Phosphatase
Activity and Effect on Ragi [Elucine crocana] Plant.
SAVANTA V. RAUT AND KAMAKSHI BHAT
Department of Microbiology, Bhavan’s College, Andheri [W], Mumbai 400 058
e-mail: svrmicro@ yahoo.co.in
Phosphatases are responsible for conversion of
phosphorus esters into inorganic phosphates. Phosphatases
are mainly two types, alkaline phosphatases[ALP] and acidic
phosphatases [ACP]which have been demonstrated by
electrophoresis, biochemical studies. Studies have shown
relation between plant P content and ALP activity within P
content in growth substrate (Podila and Varma, 2005). There
was an increase in proportion of extra radical mycelium with
ALP activity and increase in P content to host roots. In
contrast large proportion of intraradical hyphae showed ACP
activity decreased with the increase in P content in host. This
ACP seems to be involved in hydrolysis of polyphosphate
(Chaudhary, et al., 2002).
Studies indicate that phosphorus is high in legumes
and therefore leguminous plants (Shrivastava, 2004) respond
more mycorrhizal infection then cereals which indirectly
enhances biological nitrogen fixation through increase
phosphorus availability spently in soil with low phosphorus
content. However it has been observed that in natural systems,
there is variance in phosphorus uptake in relation to
colonization by different VAM fungi. Since isolates are found
to differ in phosphorus supply to host plant. Furthermost
isolates can exhibit similar efficiencies in mineral acquisition
in one soil type, while some isolate exhibits different efficiency
in another soil types (Podila and Varma, 2005).
Rhizospheric soil sample 150 g weed from collected, below
the surface of soil adhering to the roots of mostly grasses and
mixed in 200ml.of lukewarm water in large beaker. The
suspension was decanted through series 250um. to 45um.
sieves. The residues obtained on sieves were collected and
observed for sporocarp and spores under microscope at10x
and 45x .
Isolated spores were washed with sterile water with
200ppm. Streptomycin 4 to5 times. The funnel required for
cultivation was prepared by plugging the tube at bottom with
cotton and 1:1 sand: soil mixture was added. Top of funnel
was wrapped with aluminum foil and sterilized for 45 min.at
121 o C at 15 lbs. and cooled. The washed spores were inoculated
at centre at 1cm.deep with 2to3 seeds of ragi. The whole set
after inoculation were put into water.
After growth of ragi seeds, the root sample were
collected and rinsed with water and boiled at 90 o C for 1to 2
hrs.in 10% KOH. The segmented roots were washed in water
and acidified by immersing in 5N HCl for min. the roots
segments was stained in 0.05% trypan blue in lactophenol
and observed under microscope.
Test system containing sterilized sand: soil inoculated
with ragi seeds and mass cultivated VAM spores .While
control without spores. Both systems were maintained in
similar condition, watered regularly. After 45 days of
incubation, plants was harvested and different parameters,
shoot, root length and weight, shoot phosphorus were
studied.
1.0 g of rhizospheric soil treated with 0.25ml. of toluene,
4ml. of MUB[ pH6.5 and pH 11] and 1.0ml.of p-nitrophenyl
phosphate solution made in same buffer and incubated at
37 o C for 1 hrs. After incubation 1 ml. of CaCl 2
and 4 ml. of
NaOH was added. The suspension was filtered and O.D.
measured at 400nm.Amount activity was determined by
standard curve of p-nitrophenol. Enzyme activity is expressed
as amount of p-nitrophenol produced ug /min./ml.
1 g of soil in flask ,pinch of Daco-G-60 and 20ml. of 0.5m
NaHCO 3
solution was added. The flask was further shaken
for an hour. Suspension was filtered. The blank was prepared
without soil.
Shoots were clipped from the soil washed with water
.the dried shoots were digested in 15ml. of HClO 4
and HNO 3
on hot plate . The volume after digestion reduced to 1 ml. and
adjusted to 50ml. with distilled water and used for estimation
5 ml. of extract acidified to pH 5 with 5N H 2
SO 4
and
diluted to 20ml. with distilled water and 4 ml. of reagent B was
added the O.D. was measured at 730nm. After incubation at
30 o C for 10min. Standard curve was prepared with KH 2
PO 4
ranging from 2 to 20ppm. The 11 different VAM spores were
isolated and three different morphological were selected for
mass cultivated by funnel method. The mass cultivated spores
were used for inoculation with ragi seeds. Infectivity of VAM
was observed after 45 days of incubation plant ,roots stained
by Phillip’s Hayman method.
The inoculated plant with VAM shows 67 % colonization
and spore count 150/50gm. of soil. [Fig. 1 and 2] While
uninoculated control did not show infection (Table 1). The
result of effect of VAM on ragi plant revealed that the
biogrowth, shoot, root growth and phosphorus content were
significantly increased over uninoculated control plant

236 Trends in Biosciences 3 (2), 2010
Table 1.
S.N. Treatment
Table 2.
Effect of VAM on vegetative characters of ragi
Shoot
length
cm
Shoot
weight
g
Root
length
cm
Root
weight
g
Analysis of phosphorus and phosphatase activity
of rhizospheric soil
Initial Final Phosphatase
Treatment
available available activity*
P (ppm) P (ppm) ALP ACP
after 45 days (pH 11) (pH6.5)
Inoculated 15.6 2.64 5.82 29.96
with VAM
Uninoculated 15.6 6 0.878 3.62
*Enzyme activity = mcg. of p-nitro phenol produced/min./ml.
Shoot
Phosphorus
ppm
1 Inoculated 33.23 0.336 10.7 0.1367 9.0
with VAM
2 Uninoculated 27.3 0.273 9.86 0.1167 7.73
3 S Em 0.64 0.0088 0.32 0.00176 0.1155
4 C.D. P:0.05 1.3 0.049 0.245 0.022 0.092
A
Fig. 2.
A. VAM infection as observed at 45X. Hyphae of the
spore is shown penetrating root, B. Mycorrhizal
infection in ragi roots as observed under 10X
uninoculated control plant shows much variation (Table 2).
This increase in P of test plant could be due to solubilization
and absorption of Pi present in the soil into extra radical hyphae
by P transporter which is subsequently condensed into
polyphosphate and translocated by cytoplasmic streaming
into the intraradical hyphae and further into the plant.
The phosphatase activity of rhizospheric soil after
harvesting plants, acid phosphatase
[ACP] activity of inoculated shows increase over
uninoculared rhizospheric soil. VAM spores of yellowish
brown, dark brown, black, deep honey colors with variable
shapes, spherical, ovoid, funnel shaped with different
attachments were observed. There are 10 different isolates
belong to genus Glomus. The VAM spores were enumerated
and found to be 150 spores/50gm.of soil. Thus this states that
VAM fungi aids in better growth of the plants. By studying
the mechanism of VAM and selecting the isolates suitable for
increased plant growth, this symbiotic association therefore
can be exploited beneficially in order to reclaim and ameliorate
degraded soil for increased productivity.
B
LITERATURE CITED
Fig. 1.
(Table 1, Fig. 1).
After 45 days of growth the shoot length and the root
length of the plant with VAMF is more than the
control
While difference in initial and after 45 days available
phosphorus content of rhizosperic soil of inoculated and
Chaudhary A.M., Talukder and Deka P.C. 2002. Effect of VAM fungi
on the growth and enzyme activity of Assam Lemon. Indian Journal
of Microbiology, 42:129-139
Podila K. Gopi, Varma A. 2005. Phosphorus metabolism and regulation
in symbiotic fungi. Basic Research and application of Mycorrhizae.
I.K. International Pvt. Ltd. New Delhi, pp.111-139
Podila K. Gopi, Varma A. 2005. Mycorrhizal Diversity. Basic Research
and application of Mycorrhizae. I.K. International Pvt. Ltd. New
Delhi, pp.1-18
Shrivastava S. 2004. Studies on Microbial inoculants for improving soil
fertility, Ph.D. Thesis, University of Mumbai, pp.34-40
Recieved on 05.10.2010 Accepted on 12.11.2010

Trends in Biosciences 3 (2): 237-238, 2010
SHORT COMMUNICATION
Correlation of Insect Pests and Natural Enemies with Weather Parameters in
Bt Cotton
J.K. PATEL, M.V. VEKARIA AND I.S. PATEL
Department of Entomology, C.P. College of Agriculture, S.D. Agricultural University, Sardarkrushinagar 385 506
e-mail: dr.ispatel@gmail.com
Cotton is damaged by 1326 species of insects right from
sowing to maturity in different cotton growing areas of the
world of which 166 species are associated with cotton in India.
Among these, 16 species are of major importance resulting in
an annual loss of 50-60 per cent of total production
(Anonymous, 1996). To find out relationship between pests
and associated bioagents in cotton, a trial was conduced on
cotton.
The population of sucking pests and population of
bioagent was recorded from five plants selected randomly
from 0.20 ha plot of unsprayed cotton. In each plant, three
leaves each from top, bottom and middle portion were selected,
while square and green boll damage by boll worm pest were
recorded periodically from same plant. Thus, collected data
were correlated with weather parameters. Simple correlations
between periodical mean value of different pests as well as
their predatory insects with various weather parameters was
worked out and presented in Table 1.
The correlation study revealed that the aphid population
was negatively correlated with maximum temperature
(r = -0.59**), minimum temperature (r= -0.70**), morning
relative humidity (r = -0.44**), evening relative humidity
(r = -0.38**) and rainfall (r = -0.40**) and all the correlation
coefficient values were significant. However, according to
Patel, et al., 1997 cool and humid weathers were favourable
for fast multiplication of aphids at S.K. Nagar. The correlation
study revealed that the maximum temperature exerted a
significant positive influence on jassid population with
maximum temperature (r = 0.50**), minimum temperature
(r = 0.32*) and wind velocity (r = 0.61**), while correlation
with remaining weather parameters was non significant.
However, the results obtained in present studies are similar
with the results of Patel, et al., 1997. It could be seen from the
correlation coefficient values that evening relative humidity
(r = -0.48**) and rainfall (r = -0.38**), exhibited negative
correlation. While wind velocity (r = 0.68**) exhibited
significant positive correlation with thrips population. More
or less similar results were also obtained by Patel, et al., 1997.
The results indicated that the evening relative humidity (r = -
0.46**) and rainfall (r = -0.37**) exhibited significant negative
correlation. While wind velocity (r = 0.74**) exhibited
significant positive correlation with whitefly population.
However, the present findings was similar with the findings of
Gupta, et al., 1998 who reported that the minimum temperature
and evening relative humidity was positively correlated with
the whitefly population over time Patel, 1999. It could be stated
from the results that the population of mite was positively
correlated with maximum temperature (r = 0.61**), minimum
temperature (0.33*) and wind velocity (r = 0.64**). The
correlation coefficient between mite population and minimum
temperature as well as the remaining weather parameters was
non significant. The present findings of positive influence of
maximum temperature corroborate the findings of by Patel,
1999.
It could be seen from the results that the maximum
temperature (r = 0.37**) and wind velocity (r = 0.66**) had
significant positive influence on multiplication of American
bollworm. However, positive correlation of Helicoverpa with
minimum and maximum temperature was reported by Metho,
et al., 1985 and Patel and Koshiya, 1999. The results of
correlation coefficient between Earias population and weather
parameters revealed that the maximum temperature and
sunshine hours had significant influence on the population
build up of Earias. Among them, minimum temperature (r =
-0.50**), morning relative humidity (r = -0.42**), evening
relative humidity (r = -0.38**) and rainfall (r = -0.33*) had
negative correlation, while wind velocity (r = 0.34**) had
positive influence on the build up of Earias population. The
maximum temperature (r = -0.40**) and minimum temperature
(r = -0.44**) had significant negative correlation with pink
bollworm population. While sunshine hours (r = 0.43**) had
positive significant correlation with weather parameters.
However, morning and evening relative humidity, wind velocity
and rainfall had negative correlation. Similar results were also
reported by Gupta, et al., 1990. The maximum temperature (r =
0.32*), minimum temperature (r = 0.64**), morning relative
humidity (r = 0.45**), evening relative humidity (r = 0.49**)
was positively correlated with Spodoptera population and
their correlation coefficient was significant. Thus, the present
findings are in agreement with the results of Korat and
Lingappa, 1997.
The results revealed significant negative correlation
between the green lacewing and minimum temperature (r =
-0.37**), morning relative humidity (r = -0.30*) and sunshine
hours (r = -0.35**). While wind velocity (r = 0.36**) had
positive significant correlation with green lacewing. The results
revealed significant negative correlation between the ladybird
beetle and maximum temperature (r = -0.53**), minimum

238 Trends in Biosciences 3 (2), 2010
Table 1. Correlation of insect pests and natural enemies with weather parameters in Bt cotton (n = 31)
Insect pests / Natural
Temperature ( o C) Relative humidity (%) Wind velocity Sunshine hours Rainfall
enemies Maximum Minimum Morning Evening (km hr -1 ) (day -1 ) (mm)
Aphid - 0.591** -0.703** -0.442** -0.384** 0.199 0.126 -0.405**
Jassid 0.505** 0.326* 0.223 -0.083 0.617** -0.085 -0.123
Thrips 0.298* -0.274 -0.275 -0.486** 0.683** -0.159 -0.389**
Whitefly 0.244 -0.232 -0.273 -0.469** 0.746** -0.272 -0.372**
Mite 0.615** 0.334* 0.269 -0.062 0.641** -0.151 -0.238
American bollworm 0.373** 0.087 -0.057 -0.178 0.665** -0.214 -0.206
Spotted bollworm -0.252 -0.504** -0.425** -0.381** 0.349** -0.288 -0.331*
Pink bollworm -0.406** -0.445** -0.208 -0.279 -0.267 0.433** -0.184
Spodoptera 0.324* 0.649** 0.454** 0.493** 0.156 -0.104 0.203
Green lacewing 0.115 -0.377** -0.303* -0.284 0.364** -0.358** -0.267
Ladybird beetle -0.533** -0.604** -0.006 -0.328* -0.335* 0.411** -0.235
Spider 0.272 0.163 0.139 -0.053 0.613** -0.107 -0.223
Big eyed bug 0.458** 0.402** 0.213 0.115 0.592** -0.222 -0.174
Staphylinid 0.084 0.494** 0.572** 0.556** -0.031 0.213 0.293*
*Significant at 5 per cent level (± 0.29); **Significant at 1 per cent level (± 0.34).
temperature (r = -0.60**), evening relative humidity (r = -0.32*)
and wind velocity (r = -0.33*). While sunshine hours (r =
0.41**) had positive significant correlation with fluctuation
of ladybird beetle population. The present findings of negative
influence of maximum temperature confirm the findings of
Korat and Lingappa, 1997. Perusal of the correlation
coefficients revealed that no significant correlation existed
between incidence of spider and weather parameters except
wind velocity which had positive significant correlation with
weather parameters (r = 0.61**). Similar findings were also
reported by Allen, 1983 and Rao and Reddy, 1987. The results
indicated that the maximum temperature (r = 0.45**), minimum
temperature (r = 0.40**) and wind velocity (r = 0.59**) had
positive significant correlation with big eyed bug. The results
revealed significant positive correlation between the
Staphylinid and minimum temperature (r = 0.49**), morning
relative humidity (r = 0.57**), evening relative humidity (r =
0.55**) and rainfall (r = 0.29*). Present findings are similar
with the findings of Allen, 1983 and Rao and Reddy, 1987.
LITERATURE CITED
Allen, A.V. 1983. Correlation of natural enemies with weather
parameters on cotton plants in Central Iraq. J. Biol. Sci. Res. Iraq.
17(3): 9-19.
Anonymous, 1996. Annual Progress Report of All India Co-ordinated
Cotton Improvement Project, Surat. pp.14-18.
Gupta, G.P.; Mahapatro, G.K.; Kundu, S.K. and Roshan Lal. 1998. Impact
of abiotic factors on population dynamics of whitefly in cotton.
Indian J. Ent., 60(3): 293-296.
Korat, D.M. and Lingappa, S. 1997. Influence of weather factors on
the pheromone trap catches of cotton bollworm moths. GAU Res.
J., 22(2): 63-67.
Mehto, D.N.; Singh, K.M. and Singh, R.N. 1985. Incidence of insect
pests in Chickpea, Cicer arietinum Linn. Indian J. Ent., 47(2):
117-136.
Patel, M.C. 1999. Correlation studies on effects of weather factors on
the sucking pests of cotton. Indian J. Ent., 10(1): 14-17.
Patel, J.D.; Patel, G.M. and Rote, N.B. 1997. Correlations between
weather parameters and pests of cotton. J. Appl. Zool. Res., 8(2):
119-120.
Patel, C.C. and Koshiya, D.J. 1999. Population dynamics of gram pod
borer, Helicoverpa armigera (Hub.) Hardwick on cotton, pigeon
pea and chickpea. GAU Res. J., 24(2): 62-67.
Rao, V.N. and Reddy, A.S. 1987. Correlation of weather factors with
natural enemies of Nagarjunasagar Project area of Andhra Pradesh.
J. Cott. Res. And Dev., 1(2): 132-134.
Received on 02.03.2010 Accepted on 19.06.2010

BIOTECHNOLOGY RESEARCH FOUNDATION
www.brf.co.in
Society for Advancement of Science and Rural Development
The BRF-K is offering the graduate and post graduate students Hands-on-practical knowledge in biotechnology, life
sciences and pharmacy. In view of practical nature of the subject, this organization has attempted to formulate a series of modules
covering all major techniques of biotechnology, life sciences and pharmacy for practical training and experience for students,
staff members and research scholars.
For B.Tech./ M.Tech./ B.Sc./ M.Sc./ B.Pharma.
BIOTECHNOLOGY / BIOINFORMATICS / MICROBIOLOGY / BIOCHEMISTRY /
BIOSCIENCE / AGRICULTURE / ENVIROMENTAL SCIENCE / GENETICS / LIFE SCIENCE /
HORTICULTURE / VETERINARY / PHARMACY
l Training l Thesis/Dissertation
l Project work l Workshop
l Seminar / Conference l Publication in biannual Scientific Journals Trends in Biosciences
www.trendsinbiosciences.com
l Molecular Characterization l PCR Detection l Advance Molecular Techniques
l
l
l
l
l
l
l
l
l
l
l
l
l
l
TRAINING MODULES
Basic biotechnological techniques
Molecular biology techniques
Advanced molecular techniques
Microbiological techniques
Biochemical techniques
PCR and RT-PCR
Plant pathological techniques
Advanced plant pathological techniques
Plant virological techniques
Culturing of insects
EPN culturing techniques
Nematological techniques
Preparation of media for pathogenes
Pharmacological techniques
PROJECT WORK RELATED SERVICE
MAJOR TOPICS FOR PROJECT/ THESIS DISSERTATION
l
l
l
l
l
l
l
l
l
l
l
l
l
l
l
Diagnosis of pathogens
Identification of nematodes
Molecular characterization of microorganism/pathogens
RAPD analysis of organism
RFLP/AFLP analysis of organism
Gene cloning
DNA fingerprinting of organism
Plant tissue culture
Immune based detection of organism
Genetic diversity of organism
Plant seed health analysis
Biocontrol agents
Biofertilizers
Environmental biotechnology
Recombinant DNA technology
EXECUTIVE DIRECTOR
DR. S.S. ALI
D.Sc. (Belgium), PDF (Australia), FBRS, FISPRD, Emeritus Scientist (CSIR), Former Principal Scientist (ICAR)
LABORATORY ADDRESS
96-97, Lakhanpur, Near C.S.J.M. University, G.T. Road, Kanpur (U.P.) 208 024
Website: www.brf.co.in, www.trendsinbiosciences.com
Ph.: 09919388690, 09696499966, 08009020515
e-mail: brf-k@in.com, ssali.iipr@gmail.com, ss_ali@rediffmail.com
ACCOMODATION AVAILABLE

Subscription Order Form
Name : …………………………………………………………………………..............................................................
Designation : …………………………………………………………………………..............................................................
Organization : …………………………………………………………………………..............................................................
Mailing Address : …………………………………………………………………………..............................................................
City ............................................................................ State .........................................................................................
Pin .............................................................................. Country ...................................................................................
Phone ........................................................................ Moblie .....................................................................................
E-mail ........................................................................ Fax ............................................................................................
Subscripton period January- December (Year)
Annual Subscription Rates for 2011 :
Version
INDIAN
in Rs./issue
Individual Institutional Single article
FOREIGN
in US$/issue
INDIAN
in Rs.
FOREIGN
in US$
INDIAN
in Rs.
FOREIGN
in US$
*Print /Number 350 50 2100 200 50 10
**Online 700 50 2100 200 150 25
I herewith enclosed the DD/Cheque No. .................................................................................................... Dated : .......................................
for an amount of Rs. ......................................................... Drawn on : ................................................................................................... Bank.
Terms and Conditions:
1. Online subscription includes online access
2. Print subscription is volume based where as online subscription is Calendar year based
3. Online subscription includes current subscription + Back Files (for last two years)
4. Please add Rs. 50 for non-Delhi cheque and for non-Kanpur cheque Rs. 40
5. The online subscription should be send To : Print subscription and manuscript should be sent to
indianjournals.com
Dr. S. S. Ali
B-9, Local Shopping Complex, ‘A’ Block Editor in Chief, H- 1312, VIP lane,
Naraina Vihar, Ring Road
Satyam Vihar, Avas Vikas No.1
New Delhi 110 028, India
Kalyanpur, Kanpur- 208 018, U.P. India
Phone: +91-11-45055555, 45055500 Phone (R): +91-512-2571571
Fax: + 91-11-25778876 Mob. 09919388690,
E-mail: info@indianjournals.com
E-mail: ss_ali@rediffmail.com
Kindly Note :
All queries and complaints regarding online access of the journal should be addressed to Indianjournals.com while for print
version to Editor in chief.
For prompt delivery and communication please provide e-mail ID, mobile no. and complete contact details with pincode.

Instruction to the Authors
www.trendsinbiosciences.com
The journal of Trends in Biosciences is essentially devoted to the publication of original research papers on all aspects of
biosciences. All papers and short communication submitted to Trends in Biosciences must be unpublished original works. The
manuscripts in English should be in a finished form and typed on one side of A4 size paper and double spaced throughout with
ample margins. Pages should be numbered consecutively beginning from the title page. Text in any format (tables and figure
included or separately) on CD in MS word with two hard copies or sent through email to ss_ali@rediffmail.com as attached file
(s) is preferred since it saves retyping.
Research Papers: Each full length of research papers should be covered within 1500 words including tables and illustrations.
Short communication should be within 175 words including tables, figures and references, in case of exceeding the limit, payment
has to be made for extra materials by the authors. Correct language is the responsibility of the author. No editing or materials
changes at the proof stage will be permitted. While short communication will have only title, authors name, address and e-mail
followed by text and references. In case of full length paper authors should have the following headings.
Title : The title to be typed in capital and small letters, author names (all capital) and affiliation (capital and small letters with
italics fonts). Give e-mail address in italic fonts also. Manuscript must confirm to the journal style (see latest issue)
ABSTRACT : The abstract should indicate the main findings of the papers and typed in bold, single space. It should be not
more than 150 words. The abstract should be typed before the main text and intended ca. 2cm to the right of it.
Key words : 5-6 key words in italics should be given.
Tables and figures : Table should be descriptive without and references to the text with heading in bold letters. Each table
should be typed on a separate sheet. Figures whether line drawing or graph should be of good quality. Legends to figures should
be given on a separate sheet. Tables and figures should be numbered consequently in Arabic numerals (Table 1., Table 2., Fig.1.,
Fig.2.- 3) can be identified on the back by name (s) of the author(s).
Introduction : This should be brief and related to aim of the study. The review of the literature should be pertinent to the
theme of the paper. Extensive review and unnecessary details of earlier work should be avoided. Heading introduction should not
be written.
MATERIALS AND METHODS : When methods are well known, citation of the standard work is sufficient. All measurement
should be in metric units.
RESULTS AND DISCUSSION : The result should be supported by brief and adequate tables, graphs and charts, wherever
needed.
LITERATURE CITED : In the text, references should be cited as follows: two authors (Ali, and Pervez, 2005), three or more
authors (Gaugler, et al., 2001). All references made in the text must be listed under LITERATURE CITED at the end of the text.
References should be listed alphabetically by the authors, followed by the year of the publication. Journal titles should be cited
in full and in italics, while for books the place of the publication should precede the name of the publisher, Example Strong, D.R.
2002. Population of entomopathogenic nematodes in food webs. In: Entomopathogenic Nematology, (ed.Randy Gaugler) CAB
International, ix + 387. pp. 225-240.
Fox, P.C. and Atkinson, H.J. 1984. Glucose phosphate isomerase polymorphism in field population of the potato cyst
nematode, Globedera rostochiensis and G. pallida. Annals of Applied Biology, 104(1):503-506.
Submission of manuscript : Duplicate copy of manuscript along with soft copy (CD) should be submitted to the Editor in
Chief, Dr. S.S. Ali, H-1312, VIP Lane, Satyam Vihar, Avas Vikas No. 1, Kalyanpur, Kanpur 208 018, India. The text may sent through
e-mail to ss_ali@rediffmail.com. Payment must be made through Demand Draft/e-banking payable to State Bank of India,
Kalyanpur Branch, (Branch code 01962, IFSC : SBIN0001962) Kanpur, U.P. India, in favour of account number 10298389921 along
with manuscript and send to Dr. S. S. Ali, Editor in Chief. For online subscription of journal contact info@indianjournals.com
Copyright : copyright © of all papers published in Trends in Biosciences, acceptance of manuscript for Trends in Biosciences,
automatically transfers the copyright to Trends in Biosciences The use of trade name or a propriety product does not constitute
a guarantee of the product by the author (s) or the society and does not simply its approval to the exclusion of the products that
may be suitable.

army printing press
www.armyprintingpress.com
Lucknow (0522) 2481164