Introduction to NGS technologies - Bioinformatics and Genomics ...

More documents

Recommendations

Info

Genetic Research …code for proteins... Genes in the DNA... …produces the final phenotype >protein kinase acctgttgatggcgacagggactgt atgctgatctatgctgatgcatgcat gctgactactgatgtgggggctattg acttgatgtctatc.... From genotype <strong>to</strong> phenotype. …whose structure accounts for function... …plus the environment...
Genetic Research …code for proteins... Genes in the DNA... …produces the final phenotype >protein kinase acctgttgatggcgacagggactgt atgctgatctatgctgatgcatgcat gctgactactgatgtgggggctattg acttgatgtctatc.... …whose structure accounts for function... From genotype <strong>to</strong> phenotype. …plus the environment... Data is information
Page 1: Introduction to NGS Technologies Ja
Page 6 and 7: The aim: Extracting as much informa
Page 8 and 9: Next Generation Sequencing 600 Gbp
Page 10 and 11: History of DNA Sequencing 1 15 150
Page 12 and 13: Pre & Post-genomic databases EMBL d
Page 14 and 15: Pre & Post-genomic databases EMBL d
Page 17 and 18: Relative throughput of the differen
Page 19 and 20: Basics of the “old” technology
Page 21 and 22: Whole Genome RNA Communities Sanger
Page 23 and 24: Differences between the various pla
Page 25 and 26: Similarities- LOTS of DATA General
Page 27 and 28: 3 main platforms: - Solexa/illumina
Page 29 and 30: Roche 454 pyrosequencing
Page 31 and 32: Roche / 454 : GS FLX • Good for
Page 33 and 34: GS Junior, benchtop
Page 35 and 36: Solexa / illumina From Michael Metz
Page 37 and 38: Solexa / illumina From Debbie Nicke
Page 39 and 40: Illumina-MiSeq 175-245 Mb 4h 1x 36b
Page 41 and 42: SOLiD
Page 43: SOLiD From Michael Metzker, http://
Page 46 and 47: SOLiD_Dibase_Sequencing_and_Color_S
Page 49 and 50: AB SOLiD: Dibase Sequencing AB SOLi
Page 51 and 52: AB SOLiD: Dibase Sequencing AB SOLi
Page 53 and 54:
5500XL SOLiD 200 Gb/run (microbeads
Page 55 and 56:
PacBio From Michael Metzker, http:/
Page 57 and 58:
Ion Torrent $ 50.000 $ 500 /sample
Page 59 and 60:
OXFORD NANOPORE The MinION is a mem
Page 61 and 62:
Basic steps NGS data processing QC
Page 63 and 64:
Basic steps NGS data processing QC
Page 65 and 66:
File formats fastq: sequence data a
Page 67 and 68:
DNA sequencing - 1 • Whole GENOME
Page 69 and 70:
DNA sequencing - 3 • Whole EXOME
Page 71 and 72:
DNA sequencing - 5 • Amplicon seq
Page 73 and 74:
Transcriptomics - 1 • RNA-Seq - S
Page 75 and 76:
Applications of RNAseq Qualitative:
Page 77 and 78:
Advantages of RNAseq? RNAseq microa
Page 79 and 80:
TFBS detection ChIP-Seq - Identific
Page 81 and 82:
Egigenomics - 2 • Methyl-Seq - Cp
Page 83 and 84:
Metagenomics The application of mod
Page 85:
Successful NGStories
Page 91 and 92:
Species composition of metagenomic
Page 93 and 94:
Andalusian Human Genome Sequencing
Page 95 and 96:
SEQUENCING LAB
Page 97 and 98:
High Performance Computing Cluster
Page 99 and 100:
Services at CASEGH
Page 101 and 102:
The MGP Scope and Aims • Medical
Page 103 and 104:
Exome capture • Focus on the Most
Page 105 and 106:
Normalized coverage Exome capture r
Page 107 and 108:
Bioinformatic analysis Primary anal
Page 109 and 110:
New Variation Types
Page 111 and 112:
The principle: comparison of patien
Page 113 and 114:
The principle: comparison of patien
Page 115 and 116:
Filtering with multiple family info
Page 117 and 118:
NGS is revolutionizing how we do ge
Page 119 and 120:
NGS is revolutionizing how we do ge
show all

Introduction to NGS technologies - Bioinformatics and Genomics ...

Create successful ePaper yourself

Delete template?

Save as template?