Introduction to NGS technologies - Bioinformatics and Genomics ...
Introduction to NGS technologies - Bioinformatics and Genomics ...
Introduction to NGS technologies - Bioinformatics and Genomics ...
You also want an ePaper? Increase the reach of your titles
YUMPU automatically turns print PDFs into web optimized ePapers that Google loves.
Next Generation Sequencing<br />
SOLID 12Gbp per round<br />
…when expressed in the<br />
proper moment <strong>and</strong> place...<br />
>protein kunase<br />
acctgttgatggcgacagggactgtatgct<br />
gatctatgctgatgcatgcatgctgactact<br />
gatgtgggggctattgacttgatgtctatc...<br />
.<br />
Genes in the<br />
DNA...<br />
…which can be different<br />
because of the variability.<br />
10 million SNPs<br />
…whose final<br />
effect configures<br />
the phenotype...<br />
A typical tissue is<br />
expressing among<br />
5,000 <strong>and</strong> 10,000<br />
genes<br />
…code for<br />
proteins...<br />
That undergo posttranslational<br />
modifications, somatic<br />
recombination...<br />
100K-500K proteins<br />
From genotype Data <strong>to</strong><br />
phenotype.<br />
≠<br />
Information<br />
(in the functional post-genomics<br />
scenario)<br />
…whose structures account for function...<br />
…conforming complex<br />
interaction networks...<br />
Each protein has an<br />
average of 8 interactions<br />
…in cooperation<br />
with other<br />
proteins…
Change language