Isolation and identification of bacteria and fungi from ... - ictp

ARTICLE IN PRESS 

International Biodeterioration & Biodegradation 56 (2005) 58–68 

www.elsevier.com/locate/ibiod 

Isolation and identification of bacteria and fungi from 

cinematographic films 

C.Abrusci a , A.Martín-Gonza´ lez a , A.Del Amo b , F.Catalina c, , J.Collado d , G.Platas d 

a Departamento de Microbiología III, Facultad de Biología, Universidad Complutense de Madrid, José Antonio Novais, 2, 28040-Madrid, Spain 

b Filmoteca Española, Magdalena 10, 28012-Madrid, Spain 

c Departamento de Fotoquímica de Polímeros, Instituto de Ciencia y Tecnología de Polímeros, C.S.I.C, Juan de la Cierva 3, 28006-Madrid, Spain 

d Centro de Investigación Básica, Merck Research Laboratories, Merck Sharp and Dohme de España, Josefa Valcárcel, 38, 28027 Madrid, Spain 

Received 22 December 2004; received in revised form 15 April 2005; accepted 5 May 2005 

Abstract 

Bacteria and fungi present in black and white cinematographic film samples from Spanish archives in Madrid, Barcelona and 

Gran Canaria were isolated and identified.All samples studied were contaminated.Fourteen strains of bacteria were isolated. 

Preliminary characterization was carried out by morphological and biochemical-physiological methods, using different commercial 

assays depending on the bacterial nature.Five species of Staphylococcus, viz. S. epidermidis, S. hominis, S. lentus, S. haemolyticus 

and S. lugdunensis, and five species of Bacillus, viz. B. amyloliquefaciens, B. subtilis, B. megaterium, B. pichinotyi and B. pumilus, were 

identified, together with Sphingomonas paucimobilis, Kocuria kristinae and Pasteurella haemolytica.Seventeen strains of filamentous 

fungi and one yeast, Cryptococcus albidus, were isolated and identified by microsatellite-primed PCR and rDNA sequencing.The 

fungal strains present in the films consisted of four strains of Aspergillus viz. A. ustus, A. nidulans var.nidulans, A. versicolor, seven 

Penicillium chrysogenum strains, as well as, Alternaria alternata, Cladosporium cladosporioides, Mucor racemosus, Phoma glomerata 

and Trichoderma longibrachiatum.Only seven bacterial strains were able to degrade gelatin (binder in photographic emulsions), in 

contrast to the fungal isolates, all of which liquefied gelatin, with the exception of the yeast Cryptococcus albidus.Most of the 

microorganisms that were found colonizing the cinematographic films show resistance to adverse environmental conditions. 

r 2005 Elsevier Ltd.All rights reserved. 

Keywords: Cinematographic film; Fungi; Bacteria; Biodeterioration; Biodegradation; Historic and cultural heritage; Film preservation 

1. Introduction 

Cinematographic films form an important part of the 

historic and cultural heritage, since they have particular 

artistic, historical and ethnological values conferred by 

our society.Like other more traditional works of art, 

such as, paintings, sculptures, masonry, books, etc., 

cinematographic materials require adequate conservation 

conditions in order to prevent their biodeterioration. 

A photographic film is composed of three generic 

components: a plastic support, an image-forming 

Corresponding author.Tel.: +34 91 5622900; fax: +34 91 5644853. 

E-mail address: fcatalina@ictp.csic.es (F. Catalina). 

material (black and white images are formed by metallic 

silver particles and colour images are made of colour 

dyes) and a binder that is commonly based on gelatin. 

The last two components are the main materials of the 

photographic emulsion layer.During cinematographic 

history, several supports have been used to manufacture 

professional motion-picture films: cellulose nitrate (CN, 

from 1889 to 1950), cellulose triacetate (CTA, from 1948 

to 2000) and polyethylene tereftalate (from 1990s to the 

present), so that cellulose triacetate constitutes the bulk 

of the film collections today.It is estimated that there 

are approx.1.5 million roll-cans in Spain, including 

those held in private laboratories and cinematographic 

companies and in national and regional public archives. 

Filmoteca Espan˜ ola has the responsibility for the 

0964-8305/$ - see front matter r 2005 Elsevier Ltd.All rights reserved. 

doi:10.1016/j.ibiod.2005.05.004


C. Abrusci et al. / International Biodeterioration & Biodegradation 56 (2005) 58–68 59 

conservation and preservation of 430,000 roll-cans that 

constitute an important and irreplaceable historical and 

cultural heritage. 

The image stability depends on both intrinsic factors, 

e.g. the nature of the polymer base, and extrinsic factors, 

e.g. environmental conditions. Archivists have encountered 

the problem of film deterioration caused by 

inappropriate storage conditions of temperature and 

moisture.Many efforts have focused on the decrease of 

the physical damage caused by the ‘‘vinegar syndrome’’ 

in cellulose acetate-based films (Catalina and Del Amo, 

1999) and the fading of colour dyes.In contrast, there is 

a lack of knowledge about the contamination by 

bacteria and fungi in cinematographic archives and its 

influence on film stability.Studies on microbial contamination 

of cinematographic films stored in archives 

are scant and have been reviewed by Abrusci et al. 

(2004a).The main work has been done by Opela (1992) 

and involved the analysis of cellular concentration and 

the identification of the principal fungal contaminants in 

the air, on floors, in cans and on cinematographic films 

in two different archives of the Slovak Republic.As in 

other studies of indoor habitats, the results indicated 

that certain environmental conditions, such as, air flow, 

temperature, movement of personnel, etc., had a crucial 

effect on microbial concentrations in the diverse places 

analyzed.The fungal biodiversity was higher in the air 

than in the surface of the films, biodiversity being 

limited in archives, with filamentous species in the 

genera Penicillium and Aspergillus being the predominant 

micromycetes (Opela, 1992). Aspergillus and 

Penicillium have been reported as the most frequently 

found micromycetes in indoor air and buildings from 

cold and temperate climate regions (Frisvad and Gravesen, 

1994; Hyva¨ rinen et al., 2002).These fungi are 

considered to be primary colonizers, since they are 

capable of growing at a w o0:8, although many species 

have the optimum for growth at a w values close to 1 

(Nielsen, 2003).Other genera of fungi (Alternaria, 

Cladosporium, Phoma, etc.) are secondary colonizers, 

because they require a w values at least between 0.8 and 

0.9 (Nielsen, 2003).The presence of spores and/or 

vegetative cells of microorganisms on the surface of 

materials indicate the possibility of future biodegradation 

or biodeterioration.However, colonization or 

microbial growth on a material almost always results 

in biodeterioration of the material.There are different 

ways in which microorganisms can compromise the 

structure and function of polymeric materials (Flemming, 

1998).For instance, they can produce pigmentation 

or degrade of one or more compounds.In other 

cases, they can hydrate, and as well as causing fouling, 

they may penetrate into the polymeric material.These 

mechanisms of biodeterioration occur when microorganisms 

are metabolically active and growing, but 

although the environment contains an extremely rich 

variety of microorganisms, usually only a few of the 

microorganisms isolated from a substrate are responsible 

for damaging it. 

In cinematographic films, the organic components 

mentioned previously can be considered as potential 

carbon sources for growth of microorganisms, if 

environmental conditions are adequate.Gelatin, the 

binder of the photographic emulsion, is the most 

biodegradable of the substrates.It is composed of high 

molecular weight polypeptides derived from collagen, 

and the most widely used photographic gelatin is type-B, 

obtained by basic pre-treatment of bones (Abrusci et al., 

2004b).Many prokaryotic and eukaryotic microorganisms 

exhibit proteolytic capacity, so they are able to 

degrade gelatin. Stickley (1986) studied by viscometry 

the biodegradation of 5% aqueous gelatin solutions at 

37 1C using single strains of Bacillus and Pseudomonas. 

In both cases, reduced viscosity was detected after 24 h. 

In a more detailed study, Abrusci et al.(2004c) 

viscosimetrically analysed the biodegradation of type-B 

gelatin (Bloom 225) by bacteria isolated from cinematographic 

films, and noted that temperature is a very 

important factor affecting rate of biodegradation 

(Abrusci et al., 2004c). 

As for film base materials, a large number of studies 

have been carried out on biodegradation of cellulose 

acetates (CA) by both bacteria and fungi.The degree of 

hydroxyl substitution (acetylation) has been found to be 

a factor with a strong influence on biodegradation, those 

CA with a higher degree of acetylation being more 

resistant to microbial attack (Buchanan et al., 1993; 

Nelson et al., 1993; Sakai et al., 1996).According to 

Sakai et al.(1996), CA biodegradation is mediated by 

the cooperative action of esterase(s), lipase(s) and 

cellulase(s).These studies were carried out adding pure 

cultures of identified species (Samios et al., 1997; Nelson 

et al., 1993) or using mixed populations such as those 

included in compost (Gu et al., 1993b).The cellulose 

triacetate used in the photographic industry has a degree 

of substitution of approx.2.7.Hence, its resistance to 

biodegradation should be much higher than the other 

components of the film.In fact, it has been reported that 

microorganisms attack the organic part of the film 

emulsion especially at R.H. 460% ða w 40:6Þ (Gordon, 

1983).In tropical climates fungal growth is a special 

problem, but it is also possible to detect these troublesome 

growths during the summer in temperate zones 

with high relative humidity. 

Owing to the risk of biodeterioration of cinematographic 

film in the Spanish archives, we isolated and 

identified bacteria and fungi from selected samples of 

cinematographic films collected in different archives. 

The identification studies in organisms from black and 

white cinematographic films are presented here, along 

with an analysis of the ability of these isolates to 

hydrolyse the gelatinous component of films.

60 


C. Abrusci et al. / International Biodeterioration & Biodegradation 56 (2005) 58–68 

2. Materials and methods 

2.1. Cinematographic film samples 

Film samples from collections at Barcelona, Madrid 

and Gran Canaria archives were supplied by Filmoteca 

Espan˜ ola.The sampling and transport of the samples 

were carried out under aseptic conditions.The films 

supplied appeared to be in good condition. 

2.2. Isolation of microorganisms from cinematographic 

films 

The isolation procedure for all samples was performed 

in a laminar-flow chamber and manual operations 

were carried out using sterile disposable gloves. 

From each cinematographic sample, two or three pieces 

were placed on trypticase-soya-agar (TSA), for heterotrophic 

bacteria, and Sabouraud-glucose-agar (SAB) 

supplemented with choramphenicol for fungi.Petri 

dishes were incubated at 30 1C for 1–2 weeks.Cultures 

were observed daily under a stereoscopic microscope to 

check the presence of bacterial colonies and/or fungal 

mycelium (Fig.1). 

2.3. Characterization of bacteria 

Each bacterial strain isolated from the film samples 

was cultured on TSA either at 30 or 37 1C for 48 h. 

Replicates were made and preserved at 4 1C or 80 1C 

using TSB liquid medium supplemented with glycerol. 

Gram- and simple staining were performed using 

exponential TSA cultures, and oxidase and catalase tests 

made.Acid production from glucose and sucrose on OF 

basal medium, growth on Simmons citrate agar, and 

starch and gelatin hydrolysis, were tested.In all Grampositive 

(and some Gram-negative strains), the ability to 

form spores was tested by examining 24-, 48- and 72-h, 

and 1-week cultures on TSA, as well as the Schaeffer- 

Fulton specific stain (Forbes et al., 2002).Morphological 

characters were examined under differential interference 

contrast (Nomarski) and phase contrast using a 

Zeiss Laboval 4 optical microscope. 

Fig.1.One-week Petri dish cultures at 30 1C showing on left 

microfungi P. chrysogenum (upper) and A. alternata (lower), and on 

right B. subtilis developing from fragments of film. 

After the preliminary morphological and physiological 

characterization as used by Oppong et al.(2000), 

bacterial strains were identified employing commercial 

identification kits.Depending on the bacterial nature, 

different commercial assays were employed such us API 

20 NE, API 20E, API 50 CHB and API STAPH.The 

preparation and inoculation procedures followed the 

recommendations of the manufacturer (BioMerieux 

Espan˜ a S.A.), with the strains being incubated at 30 1C 

for 24 h.The numeric profiles obtained were compared 

with a bacterial database using the commercial software 

APILAB from BioMerieux.Simultaneously, additional 

diagnostic tests were made with some bacterial strains, 

such as growth on McConkey or mannitol salt agar and 

coagulase and lysostaphin tests. 

2.4. Isolation and characterization of fungi 

For isolation of micromycetes, film samples were 

incubated on potato-dextrose-agar (PDA) at 28 1C or 

30 1C for 1–2 weeks.Replicates were preserved at 4 1Cor 

80 1C in PD broth medium supplemented with 10% 

glycerol. 

The following media were used for characterization: 

(a) malt extract agar (MEA) composed of malt 

extract (Difco) 20 g, peptone 1 g, glucose 20 g, agar 

20 g, distilled water 1 L; (b) Czapek yeast extract agar 

(CYA) composed of K 2 HPO 4 1 g, Czapek concentrate 

10 ml, yeast extract (Difco) 5 g, Sucrose 30 or 200 g, agar 

15 g, distilled water 1 L; (c) 25% glycerol nitrate agar 

(G25N) composed of K 2 HPO 4 0.75 g, Czapek concentrate 

7.5 ml, yeast extract 3.7 g, glycerol, analytical grade 

250 g, agar 12 g, distilled water 750 ml; (d) potato-carrotagar 

(PCA) composed of shredded potato 20 g, shredded 

carrot 20 g, agar 20 g, distilled water 1 L; and (e) PDA 

(Difco).Czapek concentrate contained: NaNO 3 30 g, 

KCl 5 g, MgSO 4 .7H 2 O 5 g, FeSO 4 .7H 2 O 0.1 g ZnSO 4 .7 

H 2 O 0.1 g, CuSO 4 .5H 2 O 0.05 g, distilled water 100 ml. 

Seven-day cultures on MEA, CYA (with either 3% or 

20% sucrose), and G25N were used for identification of 

Aspergillus and Penicillium species, based on the 

procedures described by Pitt (2000) and Klich (2001). 

The other strains were cultured on PDA and PCA for 21 

days at 22 1C and 80% R.H. and then subjected to cycles 

of NUV wavelength light exposure-darkness (12 h each) 

at room temperature for at least 14 days to stimulate 

sporulation.Morphological analysis of the isolates was 

carried out with a Leitz Diaplan microscope, equipped 

with differential interference contrast optics.The fungal 

isolates were identified to species (Aspergillus and 

Penicillium) or generic level. 

The yeast isolate was identified on the basis of 

metabolic/physiological features using the API 20C- 

AUX kit (BioMerieux Espan˜ a, S.A.), and simple crystal 

violet staining was used for observing cell size and 

shape.



2.5. PCR reactions, microsatellite primed PCR and 

rDNA amplifications and sequence in fungi 

DNA extraction was performed by the methodology 

described by Pela´ ez et al.(1996).Mycelium was removed 

from the agar plate with a razor blade, fragmented and 

suspended in 1 ml lysis buffer (50 mM EDTA, pH 8.5, 

0.2% SDS) and heat-shock treated at 75 1C for 30 min. 

After centrifugation in a Biofuge 13 (Heraeus) at 

15,000 rpm and supernatant was adjusted to a final 

concentration of 0.3 M potassium acetate and chilled for 

1 h in ice.After a second centrifugation step, the 

supernatant was mixed with 2 volumes absolute ethanol 

to precipitate the DNA, which was dissolved in TE 

buffer.The DNA concentration obtained using this 

procedure ranged from 0.01 to 0.1 mgml 

1 . 

The amplification of both internal transcribed spacers 

(ITS1 and ITS2) and the 5.8S gene of these isolates 

was performed using primers 18S-3 (5 0 TTACGTCCC 

TGCCCTTTGTACA3 0 ) and NL1R, inverse to NL1 

(O’Donnell, 1993) (5 0 CTTTTCCTCCGCTTATTGATA 

TCG3 0 ), following standard procedures (40 cycles of 30 s 

at 93 1C, 30 s at 531C and 2 min at 72 1C) with Taq DNA 

polymerase (Q-bioGene) following the procedures recommended 

by the manufacturer.Amplification products 

(0.1 mgml 

1 ) were sequenced using the Bigdye 

Terminators version 1.1 (Applied Biosystems, Norwalk 

CT, USA) following the procedures recommended by 

the manufacturer.For all the amplification products, 

each strand was sequenced with the same primers used 

for the initial amplification.Separation of the reaction 

products by electrophoresis was performed in an ABI 

PRISM 3700 DNA Analyzer (Applied Biosystems). 

Partial sequences were assembled manually, and a 

consensus sequence was generated.Comparison of the 

DNA sequences was performed with in-house DNA 

databases and GenBank using the FASTA application. 

Microsatellite primed PCR was performed as described 

by Bills et al.(1999) using primer (GTG) 5 

and following standard procedures (40 cycles of 30 s 

at 93 1C, 30 s at 53 1C and 2 min at 72 1C) with Taq 

DNA polymerase (Q-bioGene) following the procedures 

recommended by the manufacturer.The DNA fragments 

were separated on a ready-to-use 1.2% agarose 

E-gel (Invitrogen), with a 100-base pair ladder for 

comparison. 

2.6. Gelatin hydrolysis test 

With the bacteria, two gelatin assays were performed, 

a Petri dish and a tube tests.The fungal strains were 

tested using the latter assay.In the Petri dish test, the 

isolate was streaked out on TSA medium supplemented 

with gelatin (5 g L 1 ).After incubation for 24–48 h at 

37 1C, 5 ml Frazier’s reagent was poured over each 

culture plate, and the presence of a transparent halo 

around the microorganism taken as an indication of the 

positive hydrolysis.The tube test was only applied as 

confirmation of positive Petri dish test results.In this 

second procedure, each strain was used to inoculate by 

needle puncture gelatin medium in a test-tube.The 

medium of a solution of 120 g gelatin, 5 g gelatinpeptone 

and 3 g pure beef extract in 1 L distilled water 

that remains fluid at temperatures over 35 1C.The 

inoculated tubes were incubated under test for 14 days 

at the appropriate temperature for the microorganism. 

The tubes were then acclimated at 4 1C and gelatin 

hydrolysis evidenced by medium drop-down (liquefaction) 

when the test-tube was inverted. 

2.7. Scanning electron microscopy 

For the characterization of strains by environmental 

scanning electron microscopy (ESEM), a PHILIPS 

model XL30 with EDAX X-ray analyzer was used. 

Samples were examined employing an environmental 

control in the ‘‘wet’’ mode of microscope operation 

(Go´ mez-Varga, 2004), under which conditions conventional 

EM preparation techniques are unnecessary.A 

water-cooled Peltier stage was employed to keep the 

sample at approximately 2 1C, within a chamber 

environment of water vapour at a pressure of 5 torr 

(pressure interval of this mode 4–10 torr).For examination 

of some samples under dry conditions, the samples 

were coated with approx.3 nm of gold/palladium using 

a Polaron SC 7640 sputter coater. 

3. Results and discussion 

3.1. Characterization and identification of the bacterial 

isolates 

A total of 14 bacterial strains were isolated from films 

stored in the three archives, most being Gram-positive 

(Table 1).The rod-like bacteria isolated exhibited 

motility and were oxidase- and catalase-positive; they 

all produced exopolymers.In their identification, the 

percentage of similarity showed values of 97.3–99.9% 

for all, except for Staphylococcus haemolyticus (90.1%), 

Bacillus amyloliquefaciens (88.1), B. subtilis and Pasteurella 

haemolytica (86.5%). The Gram-positive rods were 

identified as four different species of Bacillus.Strain M2, 

isolated from the Madrid archive, corresponds to B. 

pichinotyi (AF 519460), which was first isolated from 

tropical rice soils (Sneath, 1986).This strain has at least 

two features that differ from the other Bacillus spp: the 

Gram stain was always positive and endospore formation 

was not observed.Two strains of B. megaterium 

were characterized; one from Gran Canaria and the 

other from Barcelona.Both isolates produced abundant 

exopolymers and poly b-hydroxybutyrate granules.

62 



Table 1 

Archives, samples, type of base, identification and strain codes of the isolated microorganisms form cinematographic films 

Archive Sample Base Identification Strain code 

Barcelona B1 CTA Alternaria alternata HB1 

B2 CTA Staphylococcus epidermidis B2 

Aspergillus ustus 

HB2 

B3 CTA Bacillus amyloliquefaciens B3BA 

Bacillus subtilis 

B3BS 

Cladosporium cladosporioides 

HB3A 

B4 CTA Sphingomonas paucimobilis B4A 

Staphylococcus hominis 

B4C 

Penicillium chrysogenum 

HB41B 

Alternaria alternata 

HB41N 

B5 CN Staphylococcus lentus B5 

B6 CTA Penicillium chrysogenum HB6 

Cryptococcus albidus 

LB6 

B7 CN Bacillus megaterium B7 


HB7 

Gran Canaria GC1 CTA Pasteurella haemolytica GC1A 

Staphylococcus lugdunensis 

GC1B 


HGC1 

GC2 CTA Trichoderma longibrachiatum HGC2 

Bacillus megaterium 

GC2 

Aspergillus ustus 

HGC2B 

GC3 CTA Aspergillus versicolor HGC3 


HGC3B 

Phoma glomerata 

HGC3N 

LV a CTA Penicillium chrysogenum HLV1 

Madrid M2 CTA Bacillus pichinotyi M2 

M3 CTA Staphylococcus haemolyticus M3 

Aspergillus nidulans var. nidulans 

HM3 

M4 CTA Kocuria kristinae M4 

Mucor racemosus 

HM4 

M5 CTA Bacillus pumilus M5 

MI CTA Penicillium chrysogenum HMI 

CTA: Cellulose triacetate base; CN: cellulose nitrate base. 

a LV sample was a fragment of a roll-can. 

Also, there were six different strains of Gram-positive 

cocci with cells in chains (B2 and B4C), tetrads 

(M4) or individual cells (B5, GC1B and M3).None 

showed motility and all were catalase-positive.Only two 

Gram-negative rods were isolated (Table 1).They were 

oxidase and catalase positive, and were identified 

as P. haemolytica and Sphingomonas paucimobilis. 

These cocci were identified as Staphylococcus, with the 

exception of the pigmented strain M4 that corresponds 

to yellow pigment producer Kocuria kristinae. 

The main habitats and morphological/physiological 

characteristics of the bacterial isolates are of relevance in 

explaining the potential causes of contamination of the 

films.Members of the genus Staphylococcus are widespread 

in nature.Owing to their ubiquity and adaptability, 

they are major inhabitants of the skin, skin 

glands and mucous membranes of humans, other 

mammals and birds (Kloos et al., 1992).They are 

especially resistant to desiccation.At least one of the 

cocci, S. epidermidis, found in the cinematographic films 

produced slime (Me´ ndez-Vilas et al., 2004; Go¨ tz and 

Peters, 2000). S. epidermidis and S. hominis are two of 

the most prevalent and persistent bacteria on human 

skin (Schleifer and Kloos, 1975; Kloos and Schleifer, 

1975), S. haemolyticus is usually found in smaller 

populations and the main habitat of S. lugdunensis is 

the human nasal cavity where S. haemolyticus can be 

also found (Kloos et al., 1992).Most environments 

contain transient, small populations of staphylococci, 

many of them probably disseminated by humans or 

animals.Mammalian skin is also considered the primary 

habitat of K. kristinae and related micrococci (Cordero 

and Zumalacarregui, 2000). 

The more interesting of the two Gram-negative 

rods isolated is S. paucimobilis, it is widespread in 

nature owing to its physiological and metabolic versatility 

(Azeredo and Oliveira, 2000), most strains produce 

an extracellular polysaccharide involved in biofilm



formation (Jin et al., 2003), which has been associated 

with biodeterioration processes (Azeredo and Oliveira, 

2000). Bacillus spp.of course are ubiquitous, owing to 

their wide range of physiological characteristics and 

ability to degrade a wide range of substrates (Claus and 

Berkeley, 1986), and the majority of them produce 

endospores that are very resistant to environmental 

extremes, antibiotics, disinfectants and other chemicals 

and, are easily disseminated. 

In the photographic film manufacturing process, 

contamination by gelatin-degrading bacteria of the 

genera Bacillus and Pseudomonas has been reported 

(Stickley, 1986).More recently, it has been demonstrated 

that many bacteria can colonize gelatin during 

its production process.In addition to Bacillus, which are 

predominant, non-sporulating bacterial strains identified 

as diverse species in the genera Salmonella, 

Kluyvera, Burkholderia, Pseudomonas, Yersinia, Brevundimonas, 

Enterococcus, Staphylococcus and Streptococcus 

have been found (De Clerck and De Vos, 2002), and 

have the ability to liquefy gelatin. De Clerck et al.(2004) 

reported that in semi-final gelatin extracts almost all 

bacterial contaminants were Bacillus or other related 

endospore formers (Brevibacillus, Geobacillus and Anoxybacillus), 

although Enterobacter sakazakii and Staphylococcus; 

S. epidermidis, S.lugdunensis and S.hominis 

were also identified.These authors concluded that al 

least some spores or vegetative cells were able to resist 

the final UHT treatment used to prevent the potential 

microbial contamination during gelatin manufacture. 

Finally, the other important aspect is the presence of 

bacteria in indoor environments, including archives.It is 

known that vegetative cells or spores of endosporeforming 

bacteria are common contaminants in indoor 

environments, where other genera of bacteria, such as 

Kocuria, Micrococcus, Staphylococcus, Aeromonas and 

Pseudomonas have been isolated most frequently, at 

least in Central and Eastern European countries (Gorny 

and Dutkiewicz, 2002). 

It can therefore be concluded that some cinematographic 

films could have been contaminated during 

manufacture with vegetative cells and especially spores 

of bacteria that perhaps survive the manufacturing 

process.Also, since some species of Staphylococci are 

shed by humans, contamination may be a consequence 

of handling during film copying or during maintenance 

in the archives.Finally, airborne spores or vegetative 

cells in indoor environments, including the archives are 

possible contaminants. 

3.2. Characterization and identification of filamentous 

fungi and yeasts 

A total of 17 strains of filamentous fungi and one 

yeast were isolated from the films (Table 1).The most 

frequent genera isolated (Fig.2) were Alternaria 

(O’Donnell, 1993) Aspergillus (Klich, 2001) and Penicillium. 

Other genera observed were Cladosporium, 

Mucor, Trichoderma and Phoma (Fig.2). 

Comparison of the ITS rDNA sequences of our 

strains with the sequences stored in GenBank or in the 

proprietary fungal DNA databases showed that the 

strain HGC3N was 98% similar to Phoma glomerata 

(AY183371); HGC2 was 100% similar to Trichoderma 

longibranchiatum CBS446.95 (AY328039); HB1 and 

HB41N were 100% similar to Alternaria alternata 

isolate wb571 (AF455406); HB3A 100% similar to 

Cladosporium cladosporioides strain ATCC 200941 

(AF393691); and HM4 100% similar to Mucor racemosus 

CBS 260.68 (AY213659). 

When the two isolates corresponding to A. alternata 

and the seven P. chrysogenum isolates were examined 

using the microsatellite-primed PCR fingerprinting 

technique (Bills et al., 1999), the A. alternata strains 

had the same fingerprint (Fig.3) suggesting that they 

were identical, so the cinematographic films B1 and B4 

were contaminated with the same fungal strain.The 

P. chrysogenum strains were very similar, although the 

profile was only identical in the case of samples B6 and 

B7 from the Barcelona archive indicating a common 

source of P. chrysogenum contamination for the CTA 

and CN films. 

The most frequent fungal contaminants of the films 

were airborne and soil micromycetes which have a 

cosmopolitan distribution and can colonize many kinds 

of surfaces (Florian and Manning, 2000; Lugauskas 

et al., 2003). A. alternata is well adapted to cold 

conditions, with a minimum growth temperature ranging 

from 51 to 0 1C (Domsch et al., 1980). Penicillium 

and Aspergillus spp.are ubiquitous taxa that can 

produce numerous mitospores, or conidia, which are 

easily dispersed by the air.Microorganisms associated 

with the airborne route of exposure and indoor 

environment may produce adverse human health effects 

and therefore, they should be controlled (Gorny and 

Dutkiewicz, 2002). Penicillium, Aspergillus spp.and 

certain species of Alternaria are usually found as 

contaminants or biodeterioration agents in many 

different habitats and materials, including those considered 

as representative of historical and cultural 

heritage.As already mentioned, the only previous study 

about airborne contamination and cinematographic 

films stored in archives was undertaken in the Slovak 

Republic (Opela, 1992), where in the summer months, 

the airborne concentration increased remarkably.Also, 

the microbial diversity in the air of the archives was 

higher than on the stored cinematographic films.In 

both, the taxa more frequently isolated were species of 

Aspergillus, Penicillium and Cladosporium. At least six 

species of filamentous fungi were isolated from the films, 

including A. versicolor, C. cladosporioides, P. frequentens, 

P. lanosum, T. viride and Mucor, all of which have

64 



Fig.2.ESEM micrographs of different genera of fungi isolated from cinematographic films showing their characteristic hyphae and conidia. 

Micrographs by J.D. Go´ mez-Varga.



Fig.3.Microsatellite primed PCR fingerprinting for A. alternata 

strains HB1 (lane 2) and HB41N (3); P. chrysogenum strains HLV1 (5), 

HMI (6), HGC3B (7), HGC1 (8), HB7 (9), HB6 (10) and HB41B (11); 

(4), (12) control, 100 bp ladder. 

oxygen availability.In a previous study (Abrusci et al., 

2004c), it was stated that these gelatinase-positive 

bacterial isolates can degrade photographic grade 

gelatin (Bloom 225) in aqueous solution (37 1C, 

6.67%, w/w) causing progressive viscosity decrease, 

with each species showing a characteristic viscosity 

decrease profile, which changed with temperature.At 

4 1C, only B. amyloliquefaciens, B. subtilis, B. pumilus 

and B. megaterium were able to degrade gelatin aqueous 

solution.Nevertheless, in studies of several industrial 

gelatin production processes (De Clerck and De Vos, 

2002) and semi-final gelatin extracts (De Clerck et al., 

2004), the authors reported that under experimental 

conditions the majority of isolates exhibited gelatinase 

activity. 

All filamentous fungi isolated in this work were able 

to degrade gelatin in the tube test (Table 2), but the 

yeast did not, although other strains of this species have 

been reported as proteolytic (Wade et al., 2003).Unlike 

yeasts, filamentous fungi are very important microbial 

Table 2 

Gelatinase activity of microbial strains (bacteria and fungi) isolated 

and identified from cinematographic films 

Strain Identification Gelatin hydrolysis 

been reported as soil and airborne fungi.The biodiversity 

in that research was therefore different from that in 

our investigation.It might be due to the higher climatic 

differences existing between the Spanish archives, 

especially if we consider that two of them are placed 

in coastal areas where environmental humidity is much 

higher than in Madrid. 

The only yeast isolated was identified as Cryptococcus 

albidus, which has been isolated from air, soils, and a 

range of habitats, as well as from man and other 

mammals (Barnett et al., 2000).Although in general 

terms yeasts cannot survive or develop in habitats with 

low water activity.However, it has been reported that C. 

albidus var. diffluens shows adaptation to extreme low 

humidity (water activity) (Aksenov et al., 1973). 

3.3. Gelatin microbial biodegradation tests 

In cinematographic films, gelatin degradation is a 

highly relevant problem, because it causes the loss of the 

image.Since some microbial contaminants found in our 

film samples were able to grow actively and produce 

severe deterioration of the films, the ability of all the 

microorganisms isolated from cinematographic films to 

degrade gelatin was checked. Table 2.Seven of the 14 

bacterial isolates degraded gelatin in both Petri dish and 

tube hydrolysis tests, six being Bacillus spp.In addition, 

S. lentus hydrolysed gelatin in the Petri dish assay, but 

not in gelatin test tube assay, perhaps owing to the lower 

B3BA Bacillus amyloliquefaciens + 

B7 Bacillus megaterium + 

GC2 Bacillus megaterium + 

M2 Bacillus pichinotyi + 

M5 Bacillus pumilus + 

B3BS Bacillus subtilis + 

M4 Kocuria kristinae 

GC1A Pasteurella haemolytica 

B4A Sphingomonas paucimobilis 

B2 Staphylococcus epidermidis 

M3 Staphylococcus haemolyticus 

B4C Staphylococcus hominis + 

B5 Staphylococcus lentus 

a 

GC1B Staphylococcus lugdunensis 

HB1 Alternaria alternata + 

HGC3 Aspergillus versicolor + 

HM3 Aspergillus nidulans var. nidulans + 

HB2 Aspergillus ustus + 

HGC2B Aspergillus ustus + 

HB3A Cladosporium cladosporioides + 

HM4 Mucor racemosus + 

HB41B Penicillium chrysogenum + 

HB41N Alternaria alternata + 

HB6 Penicillium chrysogenum + 

HB7 Penicillium chrysogenum + 

HMI Penicillium chrysogenum + 

HGC1 Penicillium chrysogenum + 

HGC3B Penicillium chrysogenum + 

HLV1 Penicillium chrysogenum + 

HGC3N Phoma glomerata + 

HGC2 Trichoderma longibrachiatum + 

LB6 Cryptococcus albidus 

+ ¼ positive;— ¼ negative. 

a Negative in tube-test but positive in Petri-dish assay.

66 



Fig.4.Individual film frames (on moist culture medium) showing extreme biodeterioration of the image caused by B. subtilis (left) and 

P. chrysogenum (right). 

agents of biodeterioration; they not only degrade many 

kinds of molecules and materials, but also contribute to 

the formation of biofilms.As well as various bacteria 

(mainly Bacillus, Pseudomonas, Sphingomonas), fungi 

such as Alternaria, Trichoderma, Aspergillus and Penicillium 

have been found to degrade, at least partially, 

certain natural proteinaceus materials, e.g. silk (Seves et 

al., 1998), keratin (Yamamura et al., 2002) and leather 

(Orlita, 2004). 

Of course, neither presence nor absence of gelatinase 

activity in the microbial contaminants isolated from 

Spanish cinematographic film is indicative of inability to 

degrade other components of film.Diverse species of 

bacteria can degrade cellulose triacetate (Buchanan 

et al., 1993; Nelson et al., 1993; Sakai et al., 1996; 

Ishigaki et al., 2000), either in conditions of aerobiosis 

or anaerobiosis and there are also fungal biodegraders 

(Itävaara et al., 1999; Gu et al., 1993a, b).In all these 

studies cellulose triacetate with a higher degree of 

substitution was more resistant to biodegradation 

(Buchanan et al., 1993). 

3.4. Visual observation of cinematographic film 

biodeterioration and microscopic analysis 

Bacterial and fungal growth can usually be observed 

on the emulsion side of film as irregular dull spots.The 

spots increase in size and number when the material is 

left unattended.Eventually, microorganisms can degrade 

the emulsion to the point that it is useless.A 

degree of extreme growth of bacteria and fungi on the 

side of the emulsion is shown in Fig.4. 

Microbial growth can be observed on individual 

frames between loose coils at the beginning of rolls 

of film and also on the margins in the appressed 

coils.Damage to the image is not immediate. 

If the microbial growth is discovered in time it 

is possible to remove it and to prevent recurrence. 

Continued growth causes permanent damage and the 

destruction of gelatin (Fig.5).The cryogenic fracture of 

the film at 77 K under liquid nitrogen gives a transversal 

profile of the gelatin layer where there are hyphae of a 

Penicillium.The surface of the film material is also 

colonized. 

4. Conclusions 

This investigation has provided evidence that 

black and white cinematographic films stored in 

the Spanish archives are contaminated by diverse 

species of bacteria and fungi, and as judged by the 

properties of many of the microbial isolates, particularly 

fungi, microbial colonization might result in severe 

biodeterioration, including aesthetic variation or 

chemical and mechanical degradation.Most microorganisms 

that were isolated can resist environmental 

conditions adverse to microbial life, e.g. desiccation or 

nutrient starvation, and they can adhere to the 

substrates by hyphae or exopolymers.This may give 

rise to biofilm development, increasing the corrosive 

action of microbial metabolic products.In addition, 

some of the microbial contaminants can degrade 

the gelatin and probably other components of the 

films.Therefore, it is crucial that cinematographic 

archives such as museums, historic libraries, etc.have 

a strategy for microbiological quality control of the 

indoor environment in order to prevent, or minimize, 

the potential risk of microbial colonization of the 

materials.



Fig.5. SEM micrographs of artificially inoculated and incubated film samples showing Penicillium on a gelatin layer (right), and in section produced 

by cryogenic fracture at 77 K under liquid nitrogen penetration of the material by hyphae.Micrographs by J.D.Go´ mez-Varga. 

Acknowledgements 

The authors thank Filmoteca Espan˜ ola (ICAA) and 

the film processing company Fotofilm-Madrid, both 

part of the Consortium for Scientific Collaboration: 

CSIC-UCM-FE-FOTOFILM-Madrid, for their financial 

support. 

References 

Abrusci, C., Allen, N.S., Del Amo, A., Edge, M., Martín-González, 

A., 2004a. Biodegradation of motion picture film stocks. Journal of 

Film Preservation 67, 37–54. 

Abrusci, C., Martín-González, A., Del Amo, A., Catalina, F., Bosch, 

P., Corrales, T., 2004b. Chemiluminescence study of commercial 

type-B gelatins.Journal of Photochemistry and Photobiology A: 

Chemistry 163, 537–546. 

Abrusci, C., Martín-González, A., Del Amo, A., Corrales, T., 

Catalina, F., 2004c. Biodegradation of type-B gelatin by bacteria 

isolated from cinematographic films.A viscosimetric study. 

Polymer Degradation and Stability 86, 283–291. 

Aksenov, S.I., Babyleva, I.P., Golubev, V.I., 1973. On the mechanism 

of adaptation of micro-organisms to conditions of extreme low 

humidity.Life Science and Space Research 11, 55–61. 

Azeredo, J., Oliveira, R., 2000. The role of the exopolymer in the 

attachment of Sphingomonas paucimobilis.Biofoulding 65, 59–67. 

Barnett, J.A., Payne, R.W., Yarrow, D., 2000. Yeast. Characteristics 

and Identification.2nd ed.Cambridge University Press, Cambridge. 

Bills, G.F., Platas G. Peláez, F., Masurekar, P., 1999. Reclassification 

of a pneumocandin-producing anamorph, Glarea lozoyensis gen.et 

sp.nov., previously identified as Zalerion arboricola.Mycological 

Research 103, 179–192. 

Buchanan, C.H., Gardner, R.M., Komarek, R.J., 1993. Aerobic 

biodegradation of cellulose acetate.Journal of Applied Polymer 

Science 74, 1709–1719. 

Catalina, F., Del Amo, A., 1999. Cellulose triacetate motion picture 

film bases.A descriptive analysis and a study of the degradation 

and preservation-related variables.Cuadernos de la Filmoteca 

No.6, FIAF Madrid 99, Ministerio de Educación y Ciencia, 

Madrid. 

Claus, D., Berkeley, R.C.W., 1986. The genus Bacillus.In: Sneath, 

P.H.A., Sharpe, M.E., Holt, J.G. (Eds.), Bergey’s Manual of 

Systematic Bacteriology, vol.2.Williams and Wilkins, Baltimore, 

pp.1105–1139. 

Cordero, M.R., Zumalacarregui, J.M., 2000. Characterization of 

micrococcaceae isolated from salt used for Spanish dry-cured 

ham.Letters in Applied Microbiology 31, 303–306. 

De Clerck, E., De Vos, P., 2002. Study of the bacterial load in a gelatin 

production process, focused on Bacillus and related endospore 

forming genera.Systematic and Applied Microbiology 25, 

611–618. 

De Clerck, E., Vanhoutte, T., Hebb, T., Geerinck, J., Devos, J., De 

Vos, P., 2004. Isolation, characterization and identification of 

bacterial contaminants in semi-final gelatin extracts.Applied and 

Environmental Microbiology 70, 3664–3672. 

Domsch, K.H., Gams, W., Anderson, T.H. (Eds.), 1980. Compendium 

of soil fungi.Academic Press, London. 

Flemming, H.C., 1998. Relevance of biofilms for the biodeterioration 

of surfaces of polymeric materials.Polymer Degradation and 

Stability 59, 309–315. 

Florian, M.L.-E., Manning, L., 2000. SEM analysis of irregular fungal 

fox spots in an 1854 book: population dynamics and species 

identification.International Biodeterioration and Biodegradation 

46, 205–220. 

Forbes, B.A., Sahm, D.F., Weissfeld, A.S., 2002. Bailey and Scott 0 s 

diagnostic microbiology, 11th Ed.Mosby, St.Louis, MO. 

Frisvad, J.C., Gravesen, S., 1994. Penicillium and Aspergillus from 

Danish homes and working places with indoor air problems. 

Identification and mycotoxin determination. In: Samson, R.A., 

Flannigan, B., Flannigan, M.E., Verhoeff, A.P., Adan, O.C.G., 

Hoekstra, E.S. (Eds.), Health implications of fungi in indoor air 

environments.Elsevier, Amsterdam, pp.281–290. 

Go´ mez-Varga, J.D., 2004. Environmental scanning electron microscopy.Revista 

de Pla´ sticos Modernos 87, 51–61 [In Spanish]. 

Gordon, P.L. (Ed.), 1983. Eastman Kodak Report: The Book of Film 

Care.Rochester, NY 

Gorny, R.L., Dutkiewicz, J., 2002. Bacterial and fungal aerosols in 

indoor environment in central and eastern European countries. 

Annals of Agriculture and Environmental Medicine 9, 17–23. 

Go¨ tz, F., Peters, G., 2000. Colonization for medical devices by 

coagulase-negative staphilococci. In: Waldvogel, F.A., Bisno, A.L.

68 



(Eds.), Infections associated with indwelling medical devices. ASM 

Press, Washington, D.C, pp. 55–88. 

Gu, J.-H., Eberiel, D.T., McCarthy, S.P., Gross, R.A., 1993a. 

Cellulose acetate biodegradability upon exposure to simulated 

aerobic composting and anaerobic bioreactor environments. 

Journal of Environmental Polymer Degradation 1, 143–153. 

Gu, J.-H., Eberiel, D.T., McCarthy, S.P., Gross, R.A., 1993b. 

Degradation and mineralization of cellulose acetate in simulated 

thermophilic composting environments.Journal of Environmental 

Polymer Degradation 1, 281–291. 

Hyvärinen, A., Melkin, T., Vepsäläinen, A., Nevalainen, A., 2002. 

Fungi and actinobacteria in moisture-damaged building material— 

concentrations and diversity.International Biodeterioration and 

Biodegradation 49, 27–37. 

Ishigaki, T., Sugano, W., Ike, M., Fujita, M., 2000. Enzymatic 

degradation of cellulose acetate plastic by novel degrading 

bacterium Bacillus sp.S2055.Journal of Bioscence and Bioengineering 

90, 400–405. 

Itävaara, M., Siika-aho, M., Viikari, L., 1999. Enzymatic degradation 

of cellulose-based materials.Journal of Environmental Polymer 

Degradation 7, 67–73. 

Jin, H., Lee, H.-K., Shin, M.-K., Kim, S.-K., Kaplan, D.L., Lee, W.L., 

2003.Production of gellan gum by Sphingomonas paucimobilis 

NK2000 with soybean pomace.Biochemical Engineering Journal 

16, 357–360. 

Klich, M.A., 2001. Identification of common Aspergillus species, 

United States Department of Agriculture, Agricultural Research 

Service, Southern Regional Research Center, New Orleans, LA. 

Kloos, W.E., Schleifer, K.-H., 1975. Isolation and characterization of 

staphylococci from human skin.II: Description of four new 

species: Staphylococcus warneri, Staphylococcus capitis, Staphylococcus 

hominis and Staphylococcus simulans.International Journal 

of Systematic Bacteriology 25, 62–79. 

Kloos, W.E., Scheifer, K.-H., Gortz, F., 1992. The genus Staphylococcus.In: 

Ballows, A., Tru¨ per, H.G., Dworkin, H., Harder, W., 

Schleifer, K.-H. (Eds.), The Prokaryotes, second Ed. Springer, New 

York. 

Lugauskas, A., Levinskaité, L., Peciulyté, D., 2003. Micromycetes as 

deterioration agents of polymeric materials.International Biodeterioration 

and Biodegradation 52, 233–242. 

Méndez-Vilas, A., Gallardo-Moreno, A.M., Gonzàlez-Martìn, M.L., 

Calzado-Montero, R., Nuevo, M.J., Bruque, J.M., Pérez-Giraldo, 

C., 2004. Surface characterization of two strains of Staphylococcus 

epidermidis with different slime-production by AFM.Applied 

Surface Science 238, 8–23. 

Nelson, M., McCarthy, S.P., Gross, R.A., 1993. Isolation of a 

Pseudomonas paucimobilis capable of using insoluble cellulose 

acetate as a sole carbon source.Proceedings ACS Division 

Polymeric Materials Science Engineering 67, 139–140. 

Nielsen, K.F., 2003. Mycotoxin production by indoor molds. Fungal 

Genetics and Biology 39, 103–117. 

O’Donnell, K., 1993. Fusarium and its near relatives. In: 

Reynolds, D.R., Taylor, J.W. (Eds.), The fungal holomorph: 

mitotic, meiotic and pleomorphic speciation in fungal 

systematics.u CAB International, Wallingford, UK, pp. 

2225–2233. 

Opela, V., 1992. Fungal and bacterial attack on motion picture film. 

FIAF, Joint Technical Symposium, Session 5, Ottawa, Canada, pp. 

139–144. 

Oppong, D., King, V.M., Zhou, X., Bowen, J., 2000. Cultural and 

biochemical diversity of pink-pigmented bacteria isolated from 

paper mill slimes.Journal of Industrial Microbiology and 

Biotechnology 25, 74–80. 

Orlita, A., 2004. Microbial biodeterioration of leather and its control: 

a review.International Biodeterioration and Biodegradation 53, 

157–163. 

Peláez, F., Platas, G., Collado, J., Diez, M.T., 1996. Intraspecific 

variation in two species of aquatic hyphomycetes assessed by 

RAPD analysis.Mycological Research 100, 831–837. 

Pitt, J., 2000. A laboratory guide to common Penicillium species.Food 

Science Australia, North Ryde, N.S.W., Australia. 

Sakai, K., Yamauchi, T., Nasaku, F., Ohe, T., 1996. Biodegradation of 

cellulose acetate by Neisseria sicca.Bioscience Biotechnology and 

Biochemistry 60, 1617–1677. 

Samios, E., Dart, R.K., Dawkins, J.V., 1997. Preparation, characterization 

and biodegradation studies on cellulose acetates with 

varying degrees of substitution.Polymer 38, 3045–3054. 

Schleifer, K.-H., Kloos, W.E., 1975. Isolation and characterization of 

staphylococci from human skin.I: Amended descriptions of 

Staphylococcus saprophyticus and descriptions of three new species: 

Staphylococcus cohnii, Staphylococcus haemolyticus, and Staphylococcus 

xylosus.International Journal of Systematic Bacteriology 

25, 50–61. 

Seves, A., Romanó, M., Maifreni, T., Sora, S., Ciferri, O., 1998. 

The microbial degradation of silo: a laboratory investigation.International 

Biodeterioration and Biodegradation 42, 

203–211. 

Sneath, P.H.A., 1986. Endospore forming Gram-positive rods and 

cocci. In: Sneath, P.H.A., Sharpe, M.E., Holt, J.G. (Eds.), Bergey’s 

Manual of Systematic Bacteriology, vol.2.Williams and Wilkins, 

Baltimore, pp.1104–1207. 

Stickley, F.L., 1986. The biodegradation of gelatin and its problems in 

the photographic industry.The Journal of Photographic Science 

34, 111–112. 

Wade, W.N., Vasdinnyei, R., Deak, T., Beuchat, L.R., 2003. 

Proteolytic yeast isolated from raw, ripe tomatoes and metal 

association of Geotrichum candidum with Salmonella.International 

Journal of Food Microbiology 86, 101–111. 

Yamamura, S., Morita, Y., Hasan, Q., Rao, S.R., Murakami, Y., 

Yokohama, K., Tamiya, E., 2002. Characterization of a new 

keratin-degrading bacterium isolated from deer fur.Journal of 

Bioscience and Bioengineering 94, 595–600.

Isolation and identification of bacteria and fungi from ... - ictp

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?