Isolation and identification of bacteria and fungi from ... - ictp

ARTICLE IN PRESS
C. Abrusci et al. / International Biodeterioration & Biodegradation 56 (2005) 58–68 61
2.5. PCR reactions, microsatellite primed PCR and
rDNA amplifications and sequence in fungi
DNA extraction was performed by the methodology
described by Pela´ ez et al.(1996).Mycelium was removed
from the agar plate with a razor blade, fragmented and
suspended in 1 ml lysis buffer (50 mM EDTA, pH 8.5,
0.2% SDS) and heat-shock treated at 75 1C for 30 min.
After centrifugation in a Biofuge 13 (Heraeus) at
15,000 rpm and supernatant was adjusted to a final
concentration of 0.3 M potassium acetate and chilled for
1 h in ice.After a second centrifugation step, the
supernatant was mixed with 2 volumes absolute ethanol
to precipitate the DNA, which was dissolved in TE
buffer.The DNA concentration obtained using this
procedure ranged from 0.01 to 0.1 mgml
1 .
The amplification of both internal transcribed spacers
(ITS1 and ITS2) and the 5.8S gene of these isolates
was performed using primers 18S-3 (5 0 TTACGTCCC
TGCCCTTTGTACA3 0 ) and NL1R, inverse to NL1
(O’Donnell, 1993) (5 0 CTTTTCCTCCGCTTATTGATA
TCG3 0 ), following standard procedures (40 cycles of 30 s
at 93 1C, 30 s at 531C and 2 min at 72 1C) with Taq DNA
polymerase (Q-bioGene) following the procedures recommended
by the manufacturer.Amplification products
(0.1 mgml
1 ) were sequenced using the Bigdye
Terminators version 1.1 (Applied Biosystems, Norwalk
CT, USA) following the procedures recommended by
the manufacturer.For all the amplification products,
each strand was sequenced with the same primers used
for the initial amplification.Separation of the reaction
products by electrophoresis was performed in an ABI
PRISM 3700 DNA Analyzer (Applied Biosystems).
Partial sequences were assembled manually, and a
consensus sequence was generated.Comparison of the
DNA sequences was performed with in-house DNA
databases and GenBank using the FASTA application.
Microsatellite primed PCR was performed as described
by Bills et al.(1999) using primer (GTG) 5
and following standard procedures (40 cycles of 30 s
at 93 1C, 30 s at 53 1C and 2 min at 72 1C) with Taq
DNA polymerase (Q-bioGene) following the procedures
recommended by the manufacturer.The DNA fragments
were separated on a ready-to-use 1.2% agarose
E-gel (Invitrogen), with a 100-base pair ladder for
comparison.
2.6. Gelatin hydrolysis test
With the bacteria, two gelatin assays were performed,
a Petri dish and a tube tests.The fungal strains were
tested using the latter assay.In the Petri dish test, the
isolate was streaked out on TSA medium supplemented
with gelatin (5 g L 1 ).After incubation for 24–48 h at
37 1C, 5 ml Frazier’s reagent was poured over each
culture plate, and the presence of a transparent halo
around the microorganism taken as an indication of the
positive hydrolysis.The tube test was only applied as
confirmation of positive Petri dish test results.In this
second procedure, each strain was used to inoculate by
needle puncture gelatin medium in a test-tube.The
medium of a solution of 120 g gelatin, 5 g gelatinpeptone
and 3 g pure beef extract in 1 L distilled water
that remains fluid at temperatures over 35 1C.The
inoculated tubes were incubated under test for 14 days
at the appropriate temperature for the microorganism.
The tubes were then acclimated at 4 1C and gelatin
hydrolysis evidenced by medium drop-down (liquefaction)
when the test-tube was inverted.
2.7. Scanning electron microscopy
For the characterization of strains by environmental
scanning electron microscopy (ESEM), a PHILIPS
model XL30 with EDAX X-ray analyzer was used.
Samples were examined employing an environmental
control in the ‘‘wet’’ mode of microscope operation
(Go´ mez-Varga, 2004), under which conditions conventional
EM preparation techniques are unnecessary.A
water-cooled Peltier stage was employed to keep the
sample at approximately 2 1C, within a chamber
environment of water vapour at a pressure of 5 torr
(pressure interval of this mode 4–10 torr).For examination
of some samples under dry conditions, the samples
were coated with approx.3 nm of gold/palladium using
a Polaron SC 7640 sputter coater.
3. Results and discussion
3.1. Characterization and identification of the bacterial
isolates
A total of 14 bacterial strains were isolated from films
stored in the three archives, most being Gram-positive
(Table 1).The rod-like bacteria isolated exhibited
motility and were oxidase- and catalase-positive; they
all produced exopolymers.In their identification, the
percentage of similarity showed values of 97.3–99.9%
for all, except for Staphylococcus haemolyticus (90.1%),
Bacillus amyloliquefaciens (88.1), B. subtilis and Pasteurella
haemolytica (86.5%). The Gram-positive rods were
identified as four different species of Bacillus.Strain M2,
isolated from the Madrid archive, corresponds to B.
pichinotyi (AF 519460), which was first isolated from
tropical rice soils (Sneath, 1986).This strain has at least
two features that differ from the other Bacillus spp: the
Gram stain was always positive and endospore formation
was not observed.Two strains of B. megaterium
were characterized; one from Gran Canaria and the
other from Barcelona.Both isolates produced abundant
exopolymers and poly b-hydroxybutyrate granules.