Isolation and identification of bacteria and fungi from ... - ictp

More documents

Recommendations

Info

ARTICLE IN PRESS C. Abrusci et al. / International Biodeterioration & Biodegradation 56 (2005) 58–68 61 2.5. PCR reactions, microsatellite primed PCR and rDNA amplifications and sequence in fungi DNA extraction was performed by the methodology described by Pela´ ez et al.(1996).Mycelium was removed from the agar plate with a razor blade, fragmented and suspended in 1 ml lysis buffer (50 mM EDTA, pH 8.5, 0.2% SDS) and heat-shock treated at 75 1C for 30 min. After centrifugation in a Biofuge 13 (Heraeus) at 15,000 rpm and supernatant was adjusted to a final concentration of 0.3 M potassium acetate and chilled for 1 h in ice.After a second centrifugation step, the supernatant was mixed with 2 volumes absolute ethanol to precipitate the DNA, which was dissolved in TE buffer.The DNA concentration obtained using this procedure ranged from 0.01 to 0.1 mgml 1 . The amplification of both internal transcribed spacers (ITS1 and ITS2) and the 5.8S gene of these isolates was performed using primers 18S-3 (5 0 TTACGTCCC TGCCCTTTGTACA3 0 ) and NL1R, inverse to NL1 (O’Donnell, 1993) (5 0 CTTTTCCTCCGCTTATTGATA TCG3 0 ), following standard procedures (40 cycles of 30 s at 93 1C, 30 s at 531C and 2 min at 72 1C) with Taq DNA polymerase (Q-bioGene) following the procedures recommended by the manufacturer.Amplification products (0.1 mgml 1 ) were sequenced using the Bigdye Terminators version 1.1 (Applied Biosystems, Norwalk CT, USA) following the procedures recommended by the manufacturer.For all the amplification products, each strand was sequenced with the same primers used for the initial amplification.Separation of the reaction products by electrophoresis was performed in an ABI PRISM 3700 DNA Analyzer (Applied Biosystems). Partial sequences were assembled manually, and a consensus sequence was generated.Comparison of the DNA sequences was performed with in-house DNA databases and GenBank using the FASTA application. Microsatellite primed PCR was performed as described by Bills et al.(1999) using primer (GTG) 5 and following standard procedures (40 cycles of 30 s at 93 1C, 30 s at 53 1C and 2 min at 72 1C) with Taq DNA polymerase (Q-bioGene) following the procedures recommended by the manufacturer.The DNA fragments were separated on a ready-to-use 1.2% agarose E-gel (Invitrogen), with a 100-base pair ladder for comparison. 2.6. Gelatin hydrolysis test With the bacteria, two gelatin assays were performed, a Petri dish and a tube tests.The fungal strains were tested using the latter assay.In the Petri dish test, the isolate was streaked out on TSA medium supplemented with gelatin (5 g L 1 ).After incubation for 24–48 h at 37 1C, 5 ml Frazier’s reagent was poured over each culture plate, and the presence of a transparent halo around the microorganism taken as an indication of the positive hydrolysis.The tube test was only applied as confirmation of positive Petri dish test results.In this second procedure, each strain was used to inoculate by needle puncture gelatin medium in a test-tube.The medium of a solution of 120 g gelatin, 5 g gelatinpeptone and 3 g pure beef extract in 1 L distilled water that remains fluid at temperatures over 35 1C.The inoculated tubes were incubated under test for 14 days at the appropriate temperature for the microorganism. The tubes were then acclimated at 4 1C and gelatin hydrolysis evidenced by medium drop-down (liquefaction) when the test-tube was inverted. 2.7. Scanning electron microscopy For the characterization of strains by environmental scanning electron microscopy (ESEM), a PHILIPS model XL30 with EDAX X-ray analyzer was used. Samples were examined employing an environmental control in the ‘‘wet’’ mode of microscope operation (Go´ mez-Varga, 2004), under which conditions conventional EM preparation techniques are unnecessary.A water-cooled Peltier stage was employed to keep the sample at approximately 2 1C, within a chamber environment of water vapour at a pressure of 5 torr (pressure interval of this mode 4–10 torr).For examination of some samples under dry conditions, the samples were coated with approx.3 nm of gold/palladium using a Polaron SC 7640 sputter coater. 3. Results and discussion 3.1. Characterization and identification of the bacterial isolates A total of 14 bacterial strains were isolated from films stored in the three archives, most being Gram-positive (Table 1).The rod-like bacteria isolated exhibited motility and were oxidase- and catalase-positive; they all produced exopolymers.In their identification, the percentage of similarity showed values of 97.3–99.9% for all, except for Staphylococcus haemolyticus (90.1%), Bacillus amyloliquefaciens (88.1), B. subtilis and Pasteurella haemolytica (86.5%). The Gram-positive rods were identified as four different species of Bacillus.Strain M2, isolated from the Madrid archive, corresponds to B. pichinotyi (AF 519460), which was first isolated from tropical rice soils (Sneath, 1986).This strain has at least two features that differ from the other Bacillus spp: the Gram stain was always positive and endospore formation was not observed.Two strains of B. megaterium were characterized; one from Gran Canaria and the other from Barcelona.Both isolates produced abundant exopolymers and poly b-hydroxybutyrate granules.
62 ARTICLE IN PRESS C. Abrusci et al. / International Biodeterioration & Biodegradation 56 (2005) 58–68 Table 1 Archives, samples, type of base, identification and strain codes of the isolated microorganisms form cinematographic films Archive Sample Base Identification Strain code Barcelona B1 CTA Alternaria alternata HB1 B2 CTA Staphylococcus epidermidis B2 Aspergillus ustus HB2 B3 CTA Bacillus amyloliquefaciens B3BA Bacillus subtilis B3BS Cladosporium cladosporioides HB3A B4 CTA Sphingomonas paucimobilis B4A Staphylococcus hominis B4C Penicillium chrysogenum HB41B Alternaria alternata HB41N B5 CN Staphylococcus lentus B5 B6 CTA Penicillium chrysogenum HB6 Cryptococcus albidus LB6 B7 CN Bacillus megaterium B7 Penicillium chrysogenum HB7 Gran Canaria GC1 CTA Pasteurella haemolytica GC1A Staphylococcus lugdunensis GC1B Penicillium chrysogenum HGC1 GC2 CTA Trichoderma longibrachiatum HGC2 Bacillus megaterium GC2 Aspergillus ustus HGC2B GC3 CTA Aspergillus versicolor HGC3 Penicillium chrysogenum HGC3B Phoma glomerata HGC3N LV a CTA Penicillium chrysogenum HLV1 Madrid M2 CTA Bacillus pichinotyi M2 M3 CTA Staphylococcus haemolyticus M3 Aspergillus nidulans var. nidulans HM3 M4 CTA Kocuria kristinae M4 Mucor racemosus HM4 M5 CTA Bacillus pumilus M5 MI CTA Penicillium chrysogenum HMI CTA: Cellulose triacetate base; CN: cellulose nitrate base. a LV sample was a fragment of a roll-can. Also, there were six different strains of Gram-positive cocci with cells in chains (B2 and B4C), tetrads (M4) or individual cells (B5, GC1B and M3).None showed motility and all were catalase-positive.Only two Gram-negative rods were isolated (Table 1).They were oxidase and catalase positive, and were identified as P. haemolytica and Sphingomonas paucimobilis. These cocci were identified as Staphylococcus, with the exception of the pigmented strain M4 that corresponds to yellow pigment producer Kocuria kristinae. The main habitats and morphological/physiological characteristics of the bacterial isolates are of relevance in explaining the potential causes of contamination of the films.Members of the genus Staphylococcus are widespread in nature.Owing to their ubiquity and adaptability, they are major inhabitants of the skin, skin glands and mucous membranes of humans, other mammals and birds (Kloos et al., 1992).They are especially resistant to desiccation.At least one of the cocci, S. epidermidis, found in the cinematographic films produced slime (Me´ ndez-Vilas et al., 2004; Go¨ tz and Peters, 2000). S. epidermidis and S. hominis are two of the most prevalent and persistent bacteria on human skin (Schleifer and Kloos, 1975; Kloos and Schleifer, 1975), S. haemolyticus is usually found in smaller populations and the main habitat of S. lugdunensis is the human nasal cavity where S. haemolyticus can be also found (Kloos et al., 1992).Most environments contain transient, small populations of staphylococci, many of them probably disseminated by humans or animals.Mammalian skin is also considered the primary habitat of K. kristinae and related micrococci (Cordero and Zumalacarregui, 2000). The more interesting of the two Gram-negative rods isolated is S. paucimobilis, it is widespread in nature owing to its physiological and metabolic versatility (Azeredo and Oliveira, 2000), most strains produce an extracellular polysaccharide involved in biofilm
Page 1 and 2: ARTICLE IN PRESS International Biod
Page 3: 60 ARTICLE IN PRESS C. Abrusci et a
Page 7 and 8: 64 ARTICLE IN PRESS C. Abrusci et a
Page 9 and 10: 66 ARTICLE IN PRESS C. Abrusci et a
Page 11: 68 ARTICLE IN PRESS C. Abrusci et a

Isolation and identification of bacteria and fungi from ... - ictp

Create successful ePaper yourself

Delete template?

Save as template?