prevalence of toxigenic bacteria in some egyptian food abstract ...

PROCEEDING OF FIFTH SCIENTIFIC ENVIRONMENTAL CONFERENCE, 2010, ZAGAZIG UNI., 107 - 124PREVALENCE OF TOXIGENIC BACTERIA IN SOME EGYPTIANFOODNadia Mohamed Awny, Azza A. M. Abou Zeid and Mohamed Ahmed AbdoBotany Department, Faculty of Science, Zagazig University.ABSTRACTThirty three food samples representing seven different food products were collectedfrom the market in Sharkia Governorate. The food samples were investigated for theirbacterial burden including total mesophilic bacteria, spore formers, Staphylococcus aureusand Bacillus cereus using specific and selective nutrient media. Total mesophilic countsranged between 2.2x10 6 to1x10 9 cfu/g, spore forming bacteria were 5.6x10 2 to 2x10 4 cfu/g.Bacilli related to cereus group were detected in all tested food samples (100%) and S. aureusin 4 food samples (12.12%). Thirty six spore forming strains were chosen from MYP andBaird Parker’s agar plates and differentiated into different species using staining andbiochemical tests according to key of Bergey's manual. B. cereus was the most frequentspecies (19 isolates) representing 53 % of total isolated bacteria. Four strains isolated fromBaird Parker's agar medium were coagulase positive and confirmed as S. aureus.The identified strains were screened for their virulence factors using agar diffusionmethod. B. cereus strains CH, GT1, LB3 and G8 were found to be the most potent isolates.Also, the four S. aureus showed nearly equal potency concerning the investigated virulencefactors.The cellular protein profile of the eight potent food borne pathogenic bacteria showedsome similarities and differences between the examined strains. B. cereus strains CH and GT1showed about 90% similarity while GT1 and LB3 showed highest difference (80%) in theoccurring protein bands. Meanwhile, S. aureus S, S1 &S2 were more related as they showedabout 80% similar protein bands.Separation of extracellular proteins of the four examined B. cereus strains using SDS-PAGE revealed the presence of protein bands with molecular weights between 30 and 53 kDasuspected as hemolytic enterotoxins. Also, protein bands having molecular weights between22 and 33 kDa were observed in three strains (S1, S2 &S3) of examined S. aureus strains.Using multiplex PCR technique, two pairs of primers (FHblC and RHblC) and (FCytK andR2Cytk) were used to detect the toxin genes (hblC and cytK) in suspected toxic B. cereusstrains and five pairs namely:( SEA-3 & SEA-4);(SEB-1SEB-2.); (SEC-5SEC-6); (SED-1SED-2) and (SEE-1 SEE-2) were used to detect the five enterotoxins in S. aureus strains .The multiplex PCR amplification allowed rapid detection and identification of enterotoxingenes in food borne bacteria.Key words: Food borne pathogens, S. aureus, Bacillus cereus, virulence factors, SDS-PAGE, protein profile,PCR, enterotoxin genes, agarose gel electrophoresis.INTRODUCTIONExtracellular proteins of pathogenic bacteria are main contributors of pathogenesisand are indisputably involved in bacterial virulence. These proteins have a range of biologicalfunctions ranging from host cell toxicity to more suitable alterations of the host cell for thebenefit of the invader (Wooldridge, 2009).The virulence factors of pathogenic bacteria are divided into several groups on thebasis of the mechanism of virulence and function. Of the important ones are secretaryproteins such as toxins and enzymes (Wu et al., 2008).

108PREVALENCE OF TOXIGENIC BACTERIA IN SOME EGYPTIAN FOODAmong these pathogenic bacteria are genus Bacillus and Staphylococcus which causea wide variety of diseases through production of their toxins on several substrates, amongthese substrates "food" and this resulting in "food poisoning".Bacillus cereus, as spore former and gram positive bacilli, is able to survive andproliferate in a wide range of environment, including soil, water and many types of processedfood such as herbs, spices, milk, meat, raw and cooked vegetables, boiled or fried rice, vanillasauce, custards, soups, ice cream and cereals (Mckillip, 2000; Granum 2001; Kotiranta etal., 2000 and Lindback et al., 2004). Numerous worldwide studies have reported on theimportance of B. cereus as a cause of food poisoning outbreaks but less causative agent ofdiarrhea (Kotiranta et al., 2000). Bacillus cereus causes diarrheal and emetic food poisoningand a variety of typically necrotic non gastro-intestinal infections (Beecher and Macmillan,1990; Drobniewski, 1993; Beecher and Wong, 2000b; Granum and Baird-Parker, 2000;Mckillip, 2000; Callegan et al., 2002& Schoeni and Wong, 2005). Among the manypotential virulence factors of B. cereus, Haemolysin BL (HBL) is a unique and potent threecomponentpore-forming toxin consisting of three distinct proteins, namely bindingcomponent (B), lytic component (L 1 ) and lytic component (L 2 ) (Beecher and Macmillan,1991 & Beecher and Wong, 1994b).Staphylococcus aureus is Gram +ve facultative anaerobic, non-spore former,coagulase positive cocci. Staphylococcal food poisoning is caused by the ingestion of foodcontaining pre-formed toxins secreted by the bacteria. These are known as Staphylococcalenterotoxins, and 8 serologically distinct types (A, B, C1, C2, C3, D, E, and F) have so farbeen recognized. Enterotoxin F has now been shown to be identical biochemical to toxicshock syndrome toxin 1 (TSST-1) which produces toxic shock syndrome commonlyassociated with the use of tampons during menstruation (Doyle, 1989). The staphylococcalenterotoxins are responsible for the symptoms associated with staphylococcal food poisoning(Kenny et al., 1993; Matsunaga et al., 1993 and Llewelyn and Cohen, 2002). The disease ischaracterized by symptoms including nausea, vomiting, abdominal cramps and diarrhealasting from 24 to 48 h and the complete recovery usually occurs within 1–3 days. Theenterotoxin genes however are not uniformly distributed among S. aureus. Dinges et al.(2000) and Boerema et al.( 2006) reported the potency of SEs.SEA is the most common enterotoxin recovered from food poisoning outbreaksBalaban and Rasooly (2000) and it is known that 59% of staphylococcal food poisoningoutbreaks are caused by SEA to SEE (Bergdoll, 1989).Food-borne diseases are mainly caused by pathogenic bacteria which are eithertransmitted to humans from the animal reservoir or which contaminate the food process line.Detection and isolation of pathogenic bacteria from food are often difficult due to the highnumber of contaminating and indigenous bacteria and a low number of the pathogenicbacteria of concern. In order to obtain even a modest sensitivity, most traditional isolationmethods include a selective enrichment and some-times a pre-enrichment step, both of whichare labor and time consuming.There is, consequently, scope for improvement of detection and isolation methods,especially with respect to the time needed to produce a diagnosis. The last 20 to 30 years haveseen many developments in techniques and also the dawning of technologies, which werepredicted to change ways of detecting pathogenic bacteria in food. Several reviews have dealtwith the use of DNA- probes and the PCR-technique in food microbiology (Hill, 1996; Hilland Keasler, 1991; Olsen et al., 1995; Wolcott, 1991). Based on the wide use that thetechniques quickly were put to for research purposes, the reviews unanimously praise thepotential of these techniques to overcome some of the inherent problems in detection andisolation of bacterial pathogens from food (Olsen, 2000).

Nadia Mohamed Awny; Azza A. M. Abou Zeid and Mohamed Ahmed Abdo 109PCR-based techniques are used increasingly in food-microbiology research as they arewell developed and when applied as culture confirmation tests, they are reliable, fast andsensitive. PCR methods offer a sensitive and specific detection of pathogens and candiscriminate virulent bacteria from avirulent members of the same species as well (Olsen,2000). In the last 10 years, many authors have proposed the use of PCR for the detection offood-borne pathogens to replace the time-consuming culture-based classical techniques(Gravet et al., 1999 and Miethke et al., 1992). They are rapid, easy to handle, sensitive andspecific and therefore constitute very valuable tools for routine applications.Several pathogens can be detected simultaneously in one step by multiplex PCR. Suchmultiplex methods of relevance to food microbiology have been used to detect variants offood borne pathogens with special concern to enterotoxic strains of S. aureus and B. cereus(Becker et al., 1998; Pinto et al., 2005; Guinebretiere et al., 2006 and Ngamwongsatit etal., 2008). Such methods show the potential for practical every day use of PCR methods infood microbiology.Aim of WorkThe aim of this study was to evaluate the proteolytic activity of certain food bornebacteria contaminating different food products collected from the Egyptian market withrespect to their virulence factors including extracellular degrading enzymes and enterotoxins.Using quick, specific and reliable molecular techniques in characterizing and typingtoxigenic food borne strains was a main goal in this study.MATERIALS AND METHODSCollection of samplesReplicates of seven different food samples (Beef luncheon, defated Karish cheese,Koshary, Raw milk, Double cream cheese, Turkish cheese and raw meat) were collectedrandomly from different localities in Sharkia Governorate.The food samples were transformed in sterile containers within few hours to theBacteriology laboratory at Botany Department- Faculty of Science- Zagazig University underaseptic conditions.Microbiological analysis25gs of each food samples were homogenized in 225ml of sterile saline solution(0.85%NaCl). Decimal dilutions up to 10 -8 were prepared to enumerate total mesophilicbacteria (cfu/g) using pour plate technique and tryptone soya agar (TSA) medium, total sporeforming bacteria (cfu/g) (food homogenates placed in water bath at 75 o C for 20 minutes)using pour plate technique and TSA medium.B. cereus and S. aureus were enumerated and isolated by surface spread of 0.1mlaliquots on surface of mannitol yolk polymxin agar (MYP) and Baird Parker agar media,respectively. All the media used in the present investigation were prepared as described in themanuals of Difco (1994) and Oxoid (1990).Identification of bacteriaSuspected colonies growing on specific media (MYP agar and Baird Parker agar) werepicked, purified and identified according to procedures recommended by APHA (1992) andFDA (2001) using Bergey 's Manual of Systematic Bacteriology (Krieg and Holt, 1984);Rhodehamel and Harmon (2001) and Todar (2005).

110PREVALENCE OF TOXIGENIC BACTERIA IN SOME EGYPTIAN FOODDetermination of virulence factorsProduced hemolysin, lecithinase and protease enzymes were determined using agarwell diffusion assay according to Reinheimer et al. (1990) and Misra and Kuila (1992).Wells in blood agar, egg yolk agar and casein agar plates were filled with 40ul aliquots offilter-sterilized (0.45µm pore size) bacterial cultures filtrates. Plates were incubated at desiredtemperature for 24 h.Molecular Biology StudiesDetermination of cellular and extracellular protein patterns using SDS-PAGE techniqueaccording to Laemmli (1970) and LKB Application note (1977).The examined bacterial strains were grown in 50ml Tryptone Soya Broth (TSB) at30 o C for 24 hours. Bacterial cells were harvested by centrifugation and the filtrates wereseparated for further extraction of extracellular proteins. Bacterial pellets were washed twiceusing sterile bi-distilled water. The bacterial pellets were sonicated, re-suspended in steriledistilled water and centrifuged. The precipitated cellular proteins were then separated and resuspendedin phosphate buffer pH 7.The supernatants separated by centrifugation were concentrated100 times using 70% saturated(NH 4 ) 2 . SO 4 . The precipitated extracellular proteins were re-suspended in phosphate bufferpH 7. 100μl of each cellular and extracellular protein preparations were mixed with 50μl oftreatment buffer separately and boiled in a water bath for 5 minutes then injected into thewells of the prepared polyacrylamide gel. The molecular weights of separated proteins weredetermined by electrophoresis compared with marker proteins having molecular weightsranging between 14 to 116 kDa after staining with commasie blue. The molecular weights ofseparated proteins were determined by electrophoresis compared with marker proteins havingmolecular weights ranging between 14 to 116 kDa after staining with commasie blue.DNA extraction for multiplex- PCRDNA templates of the tested bacterial cultures were prepared from 4-hours cultures grown inTSB at 30 o C separately according to the method described by Ngamwongsatit et al. (2008).Specific multiplex PCR amplification conditions for Staphylococcus aureus enterotoxinsgenes sea, seb, sec, sed & see according to Pinto et al. (2005).PCR amplifications were conducted in a solution containing 1XPCR buffer (10mMTris–HCl, pH 8.8; 1.5mM MgCl 2 ,50 mM KCl,0.1% Triton X-100), 100 mM of each dNTP,1mM of each primer and 0.5U of thermostable DNA polymerase (DyNAzyme II DNApolymerase, Fin enzymes Oy,Finland) and 5 μl of DNA template, in a final volume of 50μl.Amplification conditions were: 5 min at 94 o C, 35 cycles of 30 s at 94 o C,45 s at thecorresponding annealing temperature and 45 s at 72 o C and a final extension of 10 min at 72o C. PCR products (15 ml) were electrophoresed through 2% agarose gel in TAE buffer(40mM Tris–acetate,pH 8.0; 1mM Na 2 EDTA). Amplicons sizes were estimated using 100bpDNA ladder (Amersham, USA) run on the same gel.The oligonucleotides used in this work, their sequences, target positions and size ofamplification fragments are summarized in the following tabulation according to (Pinto et al.,2005) :

Nadia Mohamed Awny; Azza A. M. Abou Zeid and Mohamed Ahmed Abdo 111Oligonucleotides used for multiplex PCR amplification of S. aureus enterotoxins genesTargetgene Primer Size in bp Primer sequence(5'-3')T o CLocationwithingenesPoduct sizein bpseasebsecsedseeSEA-3SEA-4SEB-1SEB-2SEC-5SEC-6SED-1SED-2SEE-1SEE-221222020212020202020CCTTTGGAAACGGTTAAAACGTCTGAACCTTCCCATCAAAAACTCGCATCAAACTGACAAACGGCAGGTACTCTATAAGTGCCGAACTAGACATAAAAGCTAGGCATTCTTTGTTGTAAGGTGGCTAGTTTGGTAATATCTCCTTAATGCTATATCTTATAGGGTAGATAAAGTTAAAAAACAAGCTAACTTACCGTGGACCCTTC60625860585654525460487–507592–613 127634–6531088–1110 478670–690913–894 244354–373652–671 317491–510640–659 170Specific multiplex PCR amplification conditions for B. cereus enterotoxins genes hblCand cytK according to Nagamwongsatit et al. (2008):The multiplex PCR amplification was performed in a final volume of 20ul containing5μl of DNA templates with final concentration 1X PCR buffer (10mM Tris-HCl pH 8.3 and50 mM KCl), 1.5mM MgCl2, 200μM of each dNTP, 5U Taq DNA polymerase and 0.4μMhlbC primer & 0.2μM cytK primer. The oligonucleotides used in this work, theire sequences,target positions and size of amplification fragments are summarized in the followingtabulation according to ( Nagamwongsatit et al., 2008) :Primers used for multiplex PCR amplification of B.cereus entrotoxins genesTargetgenehblCcytKPrimerFHblCRHblCFCytKR2CytKSizeinbp19202020Primer sequence (5'—3') T o C Productsize in bpCCTATCAATACTCTCGCAATTTCCTTTGTTATACGCTGCCGACGTCACAAGTTGTAACACGTGTGTAAATACCCCAGTT54565858conc(uM)695 0.4565 0.2Reactions were carried out with the following cycling conditions: initial denaturationat 95 o C for 5 min, followed by30 cycles of 94 o C for 45 sec, annealing at 54&56 o C for 1 minin case of hblC and at 58 o C in case of cytK, elongation at 72 o C for 2 min and final extensionat72 o C for 5 min.Amplicons were separated on 1.5% agarose gel and sizes were estimated using 100bpDNA ladder (Amersham, USA) run on the same gel.All multiplex PCR reactions were carried out in a GeneAmp PCR System 9700 (PEApplied Biosystems, Norwalk,CT, USA) thermal cycler.Primers used in this study were synthesized by Metabion International AG, Lena-Christ-Strasse 44/I, Deutschland.RESULTS AND DISCUSSIONContaminated food is a real threat to human welfare. Food-borne diseases are mainlycaused by pathogenic bacteria which are either transmitted to humans from the animalreservoir or which contaminate the food process line. Bacillus cereus and Staphylococcusaureus currently attracted increasing attention due to their capability of producing a range ofenterotoxins and tissue degrading enzymes (Lund and Granum, 1997, Klotz et al., 2003, DoCarmo et al. 2004 and Schoeni and Wong, 2005).

112PREVALENCE OF TOXIGENIC BACTERIA IN SOME EGYPTIAN FOODThe prevalence of toxigenic stains of B. cereus and S. aureus has been extensivelyreported in different starchy foods such as vegetables, puddings, sauces, milk, dairy products,cereals, infant cereal formulas fried and cooked rice and meat products, salads, salmon,meatball, pork entrails, pasteurized egg, ready to serve dishes and cakes (Agata et al., 2002;Schneider et al., 2004; Duc et al., 2005; Pinto et al., 2005; Shaheen et al., 2006; King et al.,2007; Svensson et al., 2007 and US FDA/CFSAN, 2007). Thus it was important to evaluatethe food safety of different food products widely distributed and sold in Egypt.Table(1): Distribution of bacterial load among food samplesFood product1-BeefluncheonNo. ofsamplesTotal mesophilic(37 O C)Cfu/gmTotal sporeformers (75 O C)Cfu/gmB.cereus Group(MYP)agarCfu/gmS. aureusBaird Parker agarCfu/gm1 2.4x10 8 1.7x10 3 1.4x10 2 -2 4x10 8 3x10 3 1.2x10 2 -3 6.5x10 8 2.8x10 3 1x10 2 -4 7x10 7 1.4x10 3 3x10 2 -2-Karish1 2.3x10 8 1.1x10 3 1.6x10 2 -cheese2 9x10 8 6.4x10 3 1x10 2 -(defated3 6.8x10 8 2.1x10 3 1.3x10 2 -cheese)4 1x10 9 7.3x10 3 3.3x10 2 -5 6x10 8 3.9x10 3 2x10 2 -3-Koshary 1 2.6x10 6 3.2x10 3 5x10 -2 3.7x10 6 1.5x10 3 7x10 -3 2x10 7 4.7x10 3 3x10 2 -4 1.2x10 7 3.3x10 3 2.7x10 2 -5 1x10 8 1.4x10 4 1.4x10 2 -4-Raw milk 1 2.8x10 6 5.6x10 2 4x10 -2 4x10 8 2.8x10 3 6x10 2 -5-Doublecream cheese6-Turkishcheese3 5.7x10 7 1.6x10 3 4.2x10 2 -4 6.3x10 6 3.3x10 2 3x10 -5 2.2x10 6 1,3x10 2 5x10 -1 3.3x10 7 1.6x10 4 2.7x10 2 2x10 22 5x10 6 6.4x10 3 1.2x10 2 3x10 23 5.8x10 6 1.5x10 3 3x10 2 -4 3x10 7 2x10 3 1.1x10 2 -1 5.2x10 7 8.8x10 3 4x10 2 4x10 22 9.7x10 6 2.2x10 3 1.8x10 2 2x10 23 8.1x10 6 3x10 3 2x10 2 -4 3.9x10 7 1.7x10 3 1.1x10 2 -5 7.4x10 7 4x10 3 5x10 2 -7-Raw meat 1 2.8x10 8 2x10 4 6x10 2 -2 6.6x10 8 9.3x10 3 4.8x10 2 -Total%3 4.6x10 8 1.8x10 4 3.3x10 3 -4 5.8x10 8 5.9x10 3 2x10 2 -5 3.2x10 8 3.8x10 3 1.7x10 2 -33 100% 100% 100% 12.12%Data in table (1) shows the prevalence and frequency of B. cereus and S. aureusamong tested food samples. Suspected colonies were counted and isolated using manitol eggyolk polymxin agar (MYP) and Baird Parker agar media, respectively. Identification of 19isolates related to B. cereus group and 4 isolates to S. aureus were further on confirmedaccording to key of Bergey. Thereafter, the identified isolates were screened for theircapability of producing some virulence factors namely: hemolysin, licithinase and proteaseenzymes(table 2) using well agar diffusion assay as zone diameters (mm) on blood agar, egg

Nadia Mohamed Awny; Azza A. M. Abou Zeid and Mohamed Ahmed Abdo 113yolk agar and casein agar plates, respectively. B. cereus strains 1, 2, 3&4 and S. aureus strains5,6,7&8 were chosen as the most potent strains concerning their virulence factors.Table (2): Test for virulence factors of toxic bacterial isolatesNo. CodeZone in (mm)Identification Lecithinase Haemolysin (Beta) Proteinase (Casein)1 G 8 B.cereus 29 40 312 LB 3 B.cereus 40 37 313 K 2 B.cereus 31 25 284 L 4 B.cereus 30 28 285 LB 5 B.cereus 22 19 186 LB 6 B.cereus 28 23 217 GT 1 B.cereus 31 27 428 GT 3 B.cereus 25 28 219 M 5 B.cereus 23 31 2810 G 4 B.cereus 26 32 2711 M 2 B.cereus 32 21 3212 M 6 B.cereus 27 23 3413 M 8 B.cereus 26 28 2614 L 3 B.cereus 12 31 1815 G 5 B.cereus 13 33 2116 CH B.cereus 36 31 3817 M 7 B.cereus 33 30 3318 L 6 B.cereus 30 25 2119 G 2 B.cereus 13 11 1320 S S. aureus 30 33 2821 S1 S. aureus 21 30 2322 S3 S. aureus 34 23 2423 S3 S. aureus 31 28 31Bacillus cereus strains were observed to produce an emetic and diarrhoealenterotoxins beside other virulence factors including phospholipase protease and hemolysins,one of which cereolysin is a thiol activated hemolysin. These virulence factors may becontributed to enteric and non enteric diseases ( Drobniewski, 1993). B. cereus emetic toxinhas been associated with life threatening acute conditions such as fulminant liver failure andrhabdomylosis (Mahler et al., 1997 and Yokoyama et al., 1999). This toxin is unique amongenterotoxins since it is resistant to proteolytic degradation, pH extremes and elevatedtemperatures surviving 121 o C for 90 minutes (Granum and Lund, 1997). Lund et al. (2000)reported for the first time that the cytotoxic gene cytK of B. cereus (a clinical isolate) was theonly cause of severe food poisoning out break that killed three people. They also reported thatCytK toxin had necrotic and hemolytic action and was completely different from other B.cereus enterotoxins.Staphylococcus aureus produces one or more toxins simultaneously. Classically, SEs havebeen divided into five major serological types (SEA, SEB, SEC, SED, and SEE) on the basisof their antigenic properties (Su and Wong, 1997), SEA is the most common enterotoxinrecovered from food poisoning outbreaks (Balaban and Rasooly, 2000) and it is known that59% of staphylococcal food poisoning outbreaks are caused by SEA to SEE (Bergdoll, 1989).Staphylococcal food poisoning (SFP), a form of enteritis, is intoxication rather than a diseaseresulting from ingestion of food contaminated with preformed staphylococcal enterotoxins(Bergdoll et al. 1974). Symptoms of SFP usually occur within 1-6 hrs after the food intakeand are characterized by nausea, vomiting, abdominal cramps and diarrhoea. These symptomsusually subside in 1-3 days but the patient remains sick for 7-10 days due to the result of toxicshock (Jett et al. 1994; Do Carmo et al. 2004).SDS-PAGE which being a common technique used for analysis of complex mixturesof proteins is considered a suitable tool for studying gene expression and fingerprinting of

114PREVALENCE OF TOXIGENIC BACTERIA IN SOME EGYPTIAN FOODliving organisms (Smith, 1997 and Wong and Hancock, 2000). In this study, total cellularproteins of selected virulent strains of B. cereus (GT1, CH, LB3 & G8) and S. aureus(S, S1,S2 & S3) were extracted and then fractionated by means of polyacrylamide gelelectrophoresis. The electrophoretic separation verifying protein patterns of selected strainsrevealed protein bands with molecular weights ranging between 33 to 108 kDa in case of B.cereus strains and between 17 to 220 kDa in case of S. aureus (Photo 1). Using gel proanalyzer the gel photo had been analyzed and revealed varying similarity percentages withinB. cereus strains between 20 to 90% and between 63.2 to 82.4% in S. aureus ). Also,difference in number of separated cellular protein bands in the investigated strains wasobserved (fig1). B. cereus GT1 showed 9 protein bands while B. cereus G8 showed only 7bands. Concerning S. aureus strains S & S3 showed 19 bands and strains S1 & S2 17bands.Photo(1): Polyacrylamide gel electrophoresis showing the cellular protein pattern of virulent isolates.M: protein marker (mixture of 7 purified proteins with mol. wt. 116,97.4,66.2,37.6,28.5,18.4 and 14 kDa.Lanes (1,2,3 &4): B.cereus strainsGH, GT1, LB3, G8. and lanes (5,6,7,&8) :S.aureus strains S, S1, S2, S3.Table(3): Similarity percentage betweenselected B. cereus strainsTable(4):Similarity percentage betweenselected S. aureus strainsStrains S S1 S2 S3S 100 80 73.7 63.2S1 80 100 84.2 68.4S2 82.4 82.4 100 70.1S3 63.2 68.4 63.2 100Strains CH GT1 LB3 G8CH 100 89 33.3 44.4GT1 90 100 20 40LB3 30 20 100 20G8 57.1 57.1 28.6 100

Nadia Mohamed Awny; Azza A. M. Abou Zeid and Mohamed Ahmed Abdo 115MarkerB. cereus(CH)B. cereus(GT1)B. cereus(LB3)B. cereus(G8)S. aureus(S)S. aureus(S1)S. aureus(S2)S. aureus(S3)Fig (1): Pro-analysis of separated cellular protein bands of the eighttoxigenic strains on acrylamide gel showing their intensities andmolecular weights compared with marker protein (6.8-214kDa).

116PREVALENCE OF TOXIGENIC BACTERIA IN SOME EGYPTIAN FOODPhoto(2): Polyacrylamide gel electrophoresis showing the protein pattern of cell free filtrates of the selected toxigenic isolates.M: protein marker (mixture of 7 purified proteins with mol. wt. 116,97.4,66.2,37.6,28.5,18.4 and 14 kDa.Lanes (1,2,3 &4): B.cereus strainsCH, GT1,LB3 & G8 and lanes (5,6,7,&8) :S.aureus strains S, S1, S2, S3.Table(5): Similarity percentage betweenselected B. cereus strainsStrains CH GT1 LB3 G8CH 100 80 60 60GT1 80 100 80 60LB3 43 57 100 71.4G8 50 50 83.3 100Table(6): Similarity percentage betweenselected S. aureus strainsStrains S S1 S2 S3S 100 100 66.7 66.7S1 75 100 50 50S2 50 50 100 50S3 50 50 50 100Also, the pro-analysis of the extracellular protein bands of the tested isolates revealedvarying similarity between the virulent strains ranging between50 to 83.3% in B. cereus andbetween 50 to 75% in S. aureus (tables5&6). Photo (2) showed obvious protein bands in lanes1,2,3&4 having molecular weights (19.26, 30.24, 33.98, 53.44 & 72.59 kDa) ; (19.6, 30. 12,33, 75, 35.53 & 53.19 kDa); (22.11, 30. 03, 33,67, 35.08, 43.24, 53.14 & 234.36 kDa)&(19.63,22.77, 30. 93, 33,53, 43.23 & 234.36 kDa); in case of B. cereus strains CH,GT1,LB3&G8, respectively. Meanwhile S. aureus strains S, S1, S2&S3 possessedextracellular proteins with molecular weights (43.23, 93.486& 234.36kDa); (22.82, 43.54,53.676& 234.36kDa); (22.67, 33.21, 43.57 & 92.19kDa) & (30.39, 33.31, 43.74 &234.36kDa), respectively.Beecher and MacMillan (1990&1991) reported that molecular weights of B. cereusenterotoxin proteins were 35, 36 and 45 kDa for binding protein B, lytic protein L1 (HBLD)and lytic protein L2 (HBLC), respectively. Beecher and Wong (1994) also found that themolecular weight of B component was 37.8kDa, L1 was 38.5kDa and L2 was 43.2kDa.Schoeni and Wong (1999) reported that the three components isolated from prototype strainof B. cereus F837/76 have molecular weights of 37.5, 38.2 and 43.5 kDa, respectively. Theyalso added that an individual strain could produce single or multiple bands of eachcomponent. They observed two bands (38&42kDa) for B protein, two L1proteins(38&41kDa) and two L2 proteins (both 43kDa) in a soil isolate encoded S1C strain.

Nadia Mohamed Awny; Azza A. M. Abou Zeid and Mohamed Ahmed Abdo 117MarkerB. cereus(..)B. cereus(..)B. cereus(..)B. cereus(..)S. aureus(..)S. aureus(..)S. aureus(..)S. aureus(..)Fig(2): Pro-analysis of separated extra-cellular protein bands of theeight toxigenic strains on acrylamide gel showing their intensitiesand molecular weights compared with marker protein (6.8-214kDa).Concerning S. aureus, the toxic shock causing SEs are single chain polypeptideshaving a molecular weight ranging from 27-29 kDa. SEs can withstand boiling temperaturefor several minutes, extremes of pH (3-11) and protease digestion by gastric enzymes

118PREVALENCE OF TOXIGENIC BACTERIA IN SOME EGYPTIAN FOOD(Soriano et al., 2002). Twenty different types of SEs, viz., SEA through SEE, SEG throughSER and SEU have already been discovered, however, only a few of the toxin serotypes arefrequently associated with food poisoning outbreaks (Martin et al., 2004; Smyth et al., 2005and Fernández et al., 2006).M 1 2 3 4695bp565bpPhoto(3): Agarose gel showing the PCR amplicons resulting from amplification of enterotoxins genes hblCand cytK using FHblC & RHblC and FCytk & R2Cytk primers. Lane M is 100bp DNA ladder marker;lanes 1,2,3&4 DNA amplicons of B. cereus G8,LB3 ,GT13&CH respectively. The gel reveals presence ofboth enterotoxin genes (hblC &cytK) in strainsGT1, LB3 & G8.Multiplex PCR technique has been recently used for rapid detection anddiscrimination of enterotoxins genes in B. cereus (Guinebretiere et al., 2006 andNagmwongsatit et al., 2008); and for direct detection of food contamination withenterotoxigenic B. cereus as well (Ombui et al. 2008).Ngmwongsatit et al. (2008) have developed and evaluated group of new primerswhich were highly efficient in detecting the toxin genes in 100% of their tested B. cereus andB. thuringensis strains. Thus, it could be expected that the presence of either genes is anindication for the presence of the whole operon.In this study the primers designed by Ngmwongsatit et al. (2008) were used underspecific multiplex PCR conditions, previously mentioned in materials and methods, to detectpresence of the enterotoxin genes (hblC &cytK) in tested strains. Photo (3) revealed presenceof amplified DNA fragments of the two toxin genes in three strains of B. cereus (CH, GT1 &G8) in one quick step. The toxin genes hblC & cytK predicted molecular sizes of 695 & 565bp, respectively.

Nadia Mohamed Awny; Azza A. M. Abou Zeid and Mohamed Ahmed Abdo 119478bp(seb)317bp(sed)244bp(sec)170bp(see)127bp(sea)Photo(4): Agarose gel showing the PCR amplicons resulting from amplification of enterotoxins genes sea,seb, sec-1, sed and see using their specific primers. Lane M is 100bp DNA ladder marker; lanes 1,2,3&4DNA amplicons of S. aureus S,S1,S2&S3 respectively. The gel reveals presence of enterotoxins sea & sedin S. aureus S1 and sed in S. aureus S3.Regarding the enterotoxin genotype, previous studies on S. aureus proved that enterotoxinPCR determinations are in a high agreement (97–100%) with the toxin production as defined byimmunoassays (Fueyo et al., 2001, Letertre et al., 2003 and McLauchlin et al., 2000).Enterotoxin genotyping of tested strains revealed presence of sed gene in both strains S.aureus (S1 & S3) and sea gene in strain (S1) only.Pinto et al. (2005) found a total of 40 (30%) S. aureus food isolates positive for se genes.Among them, the sec genotype was the most frequent (22 strains,20% of total se positive strains) andsea the second more frequent (14 strains, 13%),which is in accordance with the results obtained by(Fueyo et al., 2001 ). Data on enterotoxin genotype confirmed the grouping of strains nuc PCRpositive and se PCR positive in S. aureus clusters.On the basis of these results, we suggest amplification of enterotoxin genes as targetgenes using multiplex PCR test as a rapid and valuable technique that can be applied directlyto single colonies growing on selective plates for a rapid, accurate and unequivocalidentification of B. cereus and S. aureus. It could be implemented as an alternative tophenotypic and immunology-based tests in the routine food microbiological analysis.REFERENCESAgata, N.; Ohta, M. and Yokoyama, K. (2002). Production of Bacillus cereus emetic toxin(cerulide) in various foods. Int. J. Food Microbiol., 73: 23-27.APHA, (1992). Compendium of methods for the microbiological examination ,3rd Edn.,Washington, American Public Health Association.Balaban, N. and Rasooly, A. (2000). Staphylococcal enterotoxins, Int. J. Food Microbiol. 61: 1–10.Becker, K., R. Roth, and G. Peters. (1998). Rapid and specific detection of toxigenicStaphylococcus aureus: use of two multiplex PCR enzyme immunoassays for

120PREVALENCE OF TOXIGENIC BACTERIA IN SOME EGYPTIAN FOODamplification and hybridization of staphylococcal enterotoxin genes, exfoliativetoxin genes, and toxic shock syndrome toxin 1 gene. J. Clin. Microbiol. 36:2548–2553.Beecher, D.J. and Macmillan, J.D. (1990). A novel bicomponent haemolysin from Bacilluscereus. Infect. Immun. 58, 2220–2227.Beecher, D.J. and Macmillan, J.D. (1991). Characterization of the components ofhaemolysin BL from Bacillus cereus. Infect. Immun. 59, 1778–1784.Beecher, D.J. and Wong, A.C.L. (1994). Identification of heamolysin Bl producing Bacilluscereus isolates by a discontinous haemolytic pattern in blood agar. Appl. Environ.Microbial. 60:1646-1651. Bergdoll, M.S. (1989). Staphylococcus aureus, In :M.P. Doyle (Ed.), Foodborne bacterial pathogens, Marcel Dekker, New York, pp.463–523.Beecher, D.J. and Wong, A.C.L. (2000b). Cooperative, synergistic and antagonistic haemolyticinteractions between haemolysin BL, phosphatidylcholine phospholipase C andsphingomyelinase from Bacillus cereus. Microbiology 146, 3033–3039.Bergdoll, M.S. (1989). Staphylococcus aureus. In: Foodborne Bacterial Pathogens (Doyle, M.P.,ed.). Marcel Dekker, Inc., New York, NY, USA, pp. 463-523.Bergdoll, M. S.; Huang, I.Y. and Schantz, E. J. (1974). Chemistry of the staphylococcalenterotoxins. Journal of Agricultural and Food Chemistry, 22(1):9-13.Boerema J.A.; Clemens, R. and Brightwel, G. (2006). Evaluation of molecular methods todetermine enterotoxigenic status and molecular genotype of bovine, ovine, humanand food isolates of Staphylococcus aureus. Int.J. Food Microbiol 107: 192-201.Callegan, M.C.; Cochran, D.C.; Kane, S.T.; Gilmore, M.S.; Gominet, M. and Lereclus,D. (2002). Contribution of membrane-damaging toxins to Bacillusendophthalmitis pathogenesis. Infect. Immun. 70, 5381–5389.Difco, Manual (1994). (10 th ed). Dehydrated culture media reagents for microbial. DIFCOLaboratories. Detroit Michigan 48232 USA.Dinges, M. M.; Orwin, P. M., and Schlievert, P. M. (2000). Exotoxins of Staphylococcusaureus. Clinical Microbiology Review, 13, 16–34.DoCarmo, L. S.; Cummings, C.; Linardi, V. R.; Dias, R. S.; De Souza, J. M.; De Sena,M. J.; Dos Santos, D. A.; Shupp, J. W.; Peres Pereira, R.K. and Jett, M.(2004). A case study of a massive staphylococcal food poisoning incident. FoodBorne Pathogens and Disease, December 2004, vol. 1, no. 4, p. 241-246.Doyle, M.P. (eds) (1989). Food borne bacterial pathogens. Marcel Dekker, New York.Drobniewski, F. (1993). Bacillus cereus and related species. Clin Microbiol Rev. (4): 324-338.Duc, L.H.; Dong, T.C.; Logan, N.A.; Sutherland, A.D.; Taylor, J. and Cutting, S.M.(2005). Cases of emesis associated with bacterial contamination of an infantbreakfast cereal product. Int. J. Food Microbiol., 102: 245-251.FDA, (2001). "Food and Drug Administration", Bacteriological Analytical Manual. E.J.Rhodhehamel and S.M. Harmon, Chapter, 14.FDA/CFSAN, (2007). U.S. Food and Drug Administration. Center for food safety andapplied nutrition. Bacillus cereus and other Bacillus spp. In: "Food BornePathogenic Microorganisms and Natural Toxins Handbook". mow/las/dav/ear.Fernanez, M. M.; De Marzi, M. C.; Berguer, P; Burzyn, D; Langley, R. J.; Piazzon, I ;Mariuzza, R. A. and Malchiodi, E. L (2006). Binding of natural variants ofstaphylococcal superantigens SEG and SEI to TCR and MHC class II molecule.Molecular Immunology. 43( 7):927-938.Fueyo, J.M.; Martin, M.C.; Gonzalez-Hevia, M.A. and Mendoza, M.C. (2001).Enterotoxin production and DNA fingerprinting in Staphylococcus aureus isolated

Nadia Mohamed Awny; Azza A. M. Abou Zeid and Mohamed Ahmed Abdo 121from human and food samples. Relations between genetic types and enterotoxins.Int. J. Food Microbiol. 67, 139–145.Gravet, A.; Rondeau, M.; Harf-Monteil, C.; Grunenberger, F.; Monteil, H. ; Scheftel, J.M. and Prevost, G. (1999). Predominant Staphylococcus aureus isolated fromantibiotic-associated diarrhea is clinically relevant and produces enterotoxin A andthe bicomponent toxin LukE-LukD. J. Clin. Microbiol.37:4012–4019.Granum, P.E (2001). Bacillus cereus. In: " Food Microbiolog Fundamentals and Frontiers",Doyle, M.P. ( Ed.), pp. 373-381. Washington, DC. USA: ASM press.Granum, P.E. and Baird-Parker, T.C. (2000). Bacillus species. In: Lund, B., Baird-Parker, T.,Gould, G. (Eds.), The microbiological safety and quality of food. AspenPublisher, Gaitherburg, MD, USA, pp. 1029–1039.Granum P.E., Lund T. (1997): Bacillus cereus and its food poisoning toxins. FEMSMicrobiol. Lett. 157, 223–228.Guinebretiere, M.; Fagerlund, A.; Granum, P.E. and Nguyen-The, C. (2006). Rapiddiscrimination of cytK-1 and cytK-2 genes in Bacillus cereus strains by a novelPCR system. FEMS Microbiol. Lett., 59(1): 74-80.Hill, W.E. (1996). The polymerase chain reaction: application for the detection of food bornepathogens. Critical reviews in food science and nutrition. 36:123-173.Hill, W.E.; and Keasler, S.P. (1991): identification of food borne pathogens by nucleic acidhybridization . International journal of food microbiology 12: 67- 76.Hilliard, N.J.; Schelonka, R.L. and Waites, K. (2003). Bacillus cereus bacteremia in apreterm neonate. J Clin Microbiol 41:3441–3444.Jett, M.; Neill, R.; Welch, C.; Boyle, T.; Bernton, E.; Hoover, D.; Lowell, G.; Hunt, R.E.;Chatterjee, S. and Gemski, P. (1994). Identification of staphylococcalenterotoxin B sequences important for induction of lymphocyte proliferation byusing synthetic peptide fragments of toxin. Infection and Immunity. 62(8):3408-3415.Kenny, K.; Reiser, R. F. ; Bastida-Corcucra, F. D. and Norcross, N. L. (1993).Production of enterotoxins and toxic shock syndrome toxin by bovine mammaryisolates of Staphylococcus aureus. J. Clin. Microbiol. 31:706–707.King, N.J.; Whyte, R. and Hudson, J.A. (2007). Presence and significance of Bacilluscereus in dehydrated potatoes. J.Food Prot., 70(2): 514-520.Klotz, M.; Opper, S.; Heeg, K. and Zimmermann, S. (2003). detection of Staphylococcusaureus Enterotoxins A to D by real-time Fluorescence PCR assay. Journal ofclinical microbiology. 41(10): 4683-4687.Kotiranta, A.; Lounatmaa, K. and Haapasalo M. (2000). Epidemiology and pathogenesisof Bacillus cereus infections. Microbiol Infect 2:189–198.Krieg, N.R and Holt, J.G. (1984): Bergey,s Manual of Systematic Bacteriology vol. 1 ,2 .9thed . Baltimore ,pp 1599.Laemmli, U.K. (1970).Cleavage of structural proteins during the assembly of the head ofbacteriophage T4. Nature(London), 227: 680-685.Letertre, C.; Perelle, S.; Dilasser, F. and Fach, P. (2003).Identification of a new putativeenterotoxin SEU encoded by the egc cluster of Staphylococcus aureus. J. Appl.Microbiol. 95:38–43.Lindback, T.; Fagerlund, A.; Rodland, M.S. and Granum, P.E (2004). Characterization ofthe Bacillus cereus Nhe enterotoxin. Microbiology 150:3959–3967.LKB Application note (1997). SDS-PAGE.Llewelyn M, Cohen J (2002). Superantigens: Microbial agents that corrupt immunity. LancetInfect Dis 2: 156-162

122PREVALENCE OF TOXIGENIC BACTERIA IN SOME EGYPTIAN FOODLund, T. and Granum, P.E. (1997). Comparison of biological effect of the two differententerobtoxin complexes isolated from three different strains of Bacilus cereus.Microbiology, 143:3329-3336.Mahler, H.; Pasi, A.; Kramer, J.M.; Schulte, P.; Scoging, A.C.; Bar, W. andKrahenbuhl, S. (1997). Fulminant liver failure in association with emetic toxinof Bacillus cerus. New England Journal of Medicine, 336: 1142-1148.Martin, M.C.; Fueyo, J.M.; Gonzalez-Hevia, M.A. and Mendoza, M.C. (2004). Geneticprocedures for identification of enterotoxigenic strains of Staphylococcus aureusfrom three food poisoning outbreaks. International Journal of Food Microbiology.94( 3):279-286.Matsunaga, T., S. Kamata, N. Kakiichi, and A. Uccida. (1993). Characteristics ofStaphylococcus aureus isolated from peracute, acute and chronic bovine mastitis.J. Vet. Med. Sci. 55:297–300.McKillip, J.L. (2000): Prevalence and expression of enterotoxins in B. cereus and other B.spp., a literature review. Antonie van Leeuwenhoek 77, 393–399.McLauchlin, J.; Narayanan, G. L.; Mithani, V. and O’Neill, G. (2000). The detection ofenterotoxins and toxic shock syndrome toxin genes in Staphylococcus aureus bypolymerase chain reaction. J. Food Prot. 63(4):479–488.Miethke, T., C. Wahl, K. Heeg, B. Echtenacher, P. H. Krammer, and H. Wagner. (1992).T cell-mediated lethal shock triggered in mice by the superantigen staphylococcalenterotoxin B: critical role of tumor necrosis factor. J. Exp. Med. 175:91–98.Misra, A.K. and Kuila, R.K. (1992). Use of Bifidobacterium bifidum in the manufacture ofbifidus milk and its antibacterial activity. Lait,72(2): 213-220Ngamwongsatit, P.; Busari, W.; Pianariyanon, P.; Pulsrikarn, C.; Ohba, M.; Assavanig,A and Panbangred, W. (2008). Broad distribution of entertoxin genes (hblCDA,nheABC, cytK, and entFM) among Bacillus thuringiensis and Bacillus cereus asshown by novel primers. International journal of food microbiology. 121:352-356.Olsen, J. E. (2000). DNA-based methods for detection of food-borne bacterial pathogens.Food research international. 33 (3-4):257-266.Olsen, J. E.; Aabo, S.; Rasmussen, O. F. and Rossen, L. (1995). Oligo-nucleotide probesspecific for the genus Salmonella and for S. typhimurium. Letters in AppliedMicrobiology. 20:160-166.Ombui, J.N.; Gitahi, N. and Gicheru, M. (2008). Direct detection of Bacillus cereusenterotoxin genes in food by multiplex polymerase chain reaction. InternationalJournal of Integrative Biology, 2(3):172.Oxoid Manual (1990). Culture media, including in gradients and other laboratory services.Pinto, B; Chenoll, E. and Aznar, R. (2005). Identification and typing of food borneStaphylococcus aureus by PCR-based techniques. Syst. Appl.microbial. 37:4012–4019.Reinheimer, J.A.; Demkow, M.R.; Canditi, M.C. Austr, B. (1990). J.Dairy Technol., 45:5-9.Rhodehamel, E.J. and Harmon, S.M. (2001). Bacteriological Analytical Manual Online.Chapter 14, Bacillus cereus. U.S. FDA, Center for Food Safety & AppliedNutrition.Schneider, K.R.; Parish, M.E.; Goodrich, R.M. and Cookingham, T. (2004). Preventingfood borne illness: Bacillus cereus and Bacillus anthracis. University of Florida,IFAS Extension. FSHNO04-05.http://edis.ifas.ufl.edu.Schoeni, J.L. and Wong, A.C.L. (2005). B. cereus food poisoning and its toxins. J. FoodProt. 68, 636–648.

Nadia Mohamed Awny; Azza A. M. Abou Zeid and Mohamed Ahmed Abdo 123Shaheen, R.; Andersson, M.A.; Apetroaie, C.; Schulz, Ehling-Schulz, Ollilainen, V. andSalkinoja- Salonen, M.S. (2006). Potential of selected infant food formulas forproduction of Bacillus cereus emetic toxin, cerulide. Int. J. Food Microbiol.,107(3): 287-294.Smyth, D. S.; Hartigan, P. J.; Meaney, W. J.; Fitzgerald, J. R.; Deobald, C. F.; Bohach,G. A. and Smyth, . J.(2005). Superantigen genes encoded by the egc cluster andSaPIbov are predominant among Staphylococcus aureus isolates from cows, goats,sheep, rabbits and poultry. Journal of Medical Microbiology. 54(4):401- 411.Soriano, J. M; Font, G; Molto, J. C. and Manes, J. (2002). Enterotoxigenic staphylococciand their toxins in restaurant foods. Trends in Food Science and Technology.13(2):60-67.Su, Y.C., Lee Wong, A. (1997): Current perspectives on detection of staphylococcalenterotoxins. J. Food. Protect. 60, 195–202.Svensson, B.; Monthan, A.; Guinebretiere, H.M.; Nguyen, C. and Christiansson, A.(2007). Toxin production potential and the detection of toxin genes among strainsof Bacillus cereus group isolated along the dairy production chain. InternationalDairy Journal 17:1201-1208.Todar, K. (2005). Textbook of Bacteriology. The Genus Bacillus. Online.Wolcott, M.J. (1991). DNA-based rapid methods for the detection of food borne pathogens.Journal of food protection. 54:387-401.Wooldridge, K. (2009). Secretory mechanisms and role pathogenesis. In: bacterial secretedproteins. Published by Caister Academic Press.U.K.Wu, H. J.; Wang, A. H. J. and Jennings, P. M. (2008). Discovery of virulence factors ofpathogenic bacteria. Current opnion in chemical biology. 12:93-101.Yokoyama, K.; Ito, M.; Agata, N.; Isobe, M.; Shibayama, K.; Horii, T. and Ohta, M.(1999). Pathological effect of synthetic cerulide, an emetic toxin of Bacilluscereus, is reversible in mice. FEMS. Immunol. Med. Microbiol., 24: 115-120.

124PREVALENCE OF TOXIGENIC BACTERIA IN SOME EGYPTIAN FOODBaird Parker’sMYP agaragarG8LB3GT1CHLB3GT!GT1CHS1SS2kDakDaPCR