Interleukin-33 Induces Expression of Adhesion Molecules and ...

Interleukin-33 Induces Expression of Adhesion Molecules and Inflammatory 

Activation in Human Endothelial Cells and in Human Atherosclerotic Plaques 

Svitlana Demyanets, Viktoria Konya, Stefan P. Kastl, Christoph Kaun, Sabine 

Rauscher, Alexander Niessner, Richard Pentz, Stefan Pfaffenberger, Kathrin Rychli, 

Christof E. Lemberger, Rainer de Martin, Akos Heinemann, Ihor Huk, Marion Gröger, 

Gerald Maurer, Kurt Huber and Johann Wojta 

Arterioscler Thromb Vasc Biol 2011, 31:2080-2089: originally published online July 

7, 2011 

doi: 10.1161/ATVBAHA.111.231431 

Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association. 

7272 Greenville Avenue, Dallas, TX 72514 

Copyright © 2011 American Heart Association. All rights reserved. Print ISSN: 1079-5642. Online 

ISSN: 1524-4636 

The online version of this article, along with updated information and services, is 

located on the World Wide Web at: 

http://atvb.ahajournals.org/content/31/9/2080 

Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular 

Biology is online at 

http://atvb.ahajournals.org//subscriptions/ 

Permissions: Permissions & Rights Desk, Lippincott Williams & Wilkins, a division of Wolters 

Kluwer Health, 351 West Camden Street, Baltimore, MD 21202-2436. Phone: 410-528-4050. Fax: 

410-528-8550. E-mail: 

journalpermissions@lww.com 

Reprints: Information about reprints can be found online at 

http://www.lww.com/reprints 

Downloaded from 

http://atvb.ahajournals.org/ at Bibliothek der MedUniWien (IX0000096057) on September 2, 2011

Data Supplement (unedited) at: 

http://atvb.ahajournals.org/http://atvb.ahajournals.org/content/suppl/2011/07/07/ATVBAHA.111.23143 

1.DC1.html 

Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular 

Biology is online at 

http://atvb.ahajournals.org//subscriptions/ 

Permissions: Permissions & Rights Desk, Lippincott Williams & Wilkins, a division of Wolters 

Kluwer Health, 351 West Camden Street, Baltimore, MD 21202-2436. Phone: 410-528-4050. Fax: 

410-528-8550. E-mail: 

journalpermissions@lww.com 

Reprints: Information about reprints can be found online at 

http://www.lww.com/reprints 



Interleukin-33 Induces Expression of Adhesion Molecules 

and Inflammatory Activation in Human Endothelial Cells 

and in Human Atherosclerotic Plaques 

Svitlana Demyanets, Viktoria Konya, Stefan P. Kastl, Christoph Kaun, Sabine Rauscher, 

Alexander Niessner, Richard Pentz, Stefan Pfaffenberger, Kathrin Rychli, Christof E. Lemberger, 

Rainer de Martin, Akos Heinemann, Ihor Huk, Marion Gröger, Gerald Maurer, 

Kurt Huber, Johann Wojta 

Objective—Interleukin (IL)-33 is the most recently described member of the IL-1 family of cytokines and it is a ligand of 

the ST2 receptor. While the effects of IL-33 on the immune system have been extensively studied, the properties of this 

cytokine in the cardiovascular system are much less investigated. 

Methods/Results—We show here that IL-33 promoted the adhesion of human leukocytes to monolayers of human 

endothelial cells and robustly increased vascular cell adhesion molecule-1, intercellular adhesion molecule-1, 

endothelial selectin, and monocyte chemoattractant protein-1 protein production and mRNA expression in human 

coronary artery and human umbilical vein endothelial cells in vitro as well as in human explanted atherosclerotic 

plaques ex vivo. ST2-fusion protein, but not IL-1 receptor antagonist, abolished these effects. IL-33 induced 

translocation of nuclear factor-�B p50 and p65 subunits to the nucleus in human coronary artery endothelial cells 

and human umbilical vein endothelial cells and overexpression of dominant negative form of I�B kinase 2 or I�B� 

in human umbilical vein endothelial cells abolished IL-33-induced adhesion molecules and monocyte chemoattractant 

protein-1 mRNA expression. We detected IL-33 and ST2 on both protein and mRNA level in human 

carotid atherosclerotic plaques. 

Conclusion—We hypothesize that IL-33 may contribute to early events in endothelial activation characteristic for the 

development of atherosclerotic lesions in the vessel wall, by promoting adhesion molecules and proinflammatory 

cytokine expression in the endothelium. (Arterioscler Thromb Vasc Biol. 2011;31:2080-2089.) 

Key Words: leukocyte adhesion � endothelial cells � IL-33 � ST2 � atherosclerosis 

Cardiovascular disease is the leading cause of death in 

Western societies. 1 Among cardiovascular pathologies 

atherosclerosis is thought to be the principal contributor 

to cardiovascular morbidity and mortality. Atherosclerosis 

is now generally thought to be a chronic 

inflammatory disorder. 2–4 Leukocyte trafficking from 

bloodstream to tissue is important for rapid leukocyte 

accumulation at sites of inflammatory response or tissue 

injury. Thus it is evident that leukocyte extravasation is 

considered a key event in the pathogenesis of atherosclerosis. 

In fact, endothelial dysfunction, a hallmark in the 

early development of atherosclerosis is, besides impaired 

vasomotor function of the vessel wall, characterized by 

increased adhesiveness of the activated or injured endo- 

thelium for leukocytes at the site of developing and 

progressing atherosclerotic lesions. 5 The process of leukocyte 

extravasation comprises a complex multistep cascade 

that is orchestrated by a tightly coordinated sequence of 

adhesive interactions of the leukocytes with vessel wall 

endothelial cells. Endothelial cells express an array of 

adhesion molecules that control processes such as leukocyte 

rolling along and attachment to the endothelium and 

transmigration of leukocytes into areas of inflammation. 6 

These leukocyte-endothelial interactions require the regulated 

expression of various adhesion molecules by endothelial 

cells such as intercellular adhesion molecule-1 

(ICAM-1), vascular cell AM-1 (VCAM-1) and endothelial 

selectin (E-selectin). 7 Several studies have demonstrated 

Received on: August 13, 2010; final version accepted on: June 25, 2011. 

From the Department of Internal Medicine II (S.D., S.P.K., C.K., A.N., R.P., S.P., K.R.,G.M., J.W.), Medical University of Vienna, Vienna, Austria, 

Institute of Experimental and Clinical Pharmacology (V.K., A.H.), Medical University of Graz, Graz, Austria, Ludwig Boltzmann Cluster for 

Cardiovascular Research (S.P.K., J.W.), Vienna, Austria, Skin and Endothelium Research Division (SERD), Department of Dermatology (S.R., M.G.), 

Medical University of Vienna, Vienna, Austria, Core Facility Imaging (S.R., M.G.), Medical University of Vienna, Vienna, Austria, Department of 

Vascular Biology and Thrombosis Research (C.E.L., R.d.M.), Medical University of Vienna, Vienna, Austria, Department of Surgery (I.H.), Medical 

University of Vienna, Vienna, Austria, 3rd Medical Department for Cardiology and Emergency Medicine (K.H.), Wilhelminen Hospital, Vienna, Austria. 

Correspondence to Johann Wojta, Department of Internal Medicine II, Medical University of Vienna, Waehringer Guertel 18–20, A-1090 Vienna, 

Austria. E-mail johann.wojta@meduniwien.ac.at 

© 2011 American Heart Association, Inc. 

Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org DOI: 10.1161/ATVBAHA.111.231431 


http://atvb.ahajournals.org/ at Bibliothek 2080der 

MedUniWien (IX0000096057) on September 2, 2011

that these endothelial cell adhesion molecules are upregulated 

by inflammatory mediators such as interleukin-1 

(IL-1) or tumor necrosis factor-� (TNF-�) and that their 

expression is increased in atherosclerotic lesions. 8–11 In 

addition to this process, chemokines such as monocyte 

chemoattractant protein-1 (MCP-1) attract activated leukocytes 

to the inflammatory site. 12 

Interleukin-33 (IL-33) is the most recently described 

member of the IL-1-family of cytokines, and it is a ligand 

of the ST2 receptor. 13 According to the present knowledge, 

it is suggested that IL-33 is specifically released during 

necrotic cell death, which is thought to be associated with 

tissue damage during infection or trauma, but kept intracellular 

during apoptosis. 14,15 Because of these properties, 

IL-33 was proposed to act as “alarmin,” as an endogenous 

“danger” signal to alert the immune system after infection 

or injury. 14,16 Consequently, most studies investigating the 

biological role of IL-33 focus on its immunomodulatory 

functions. Thus, it was shown that IL-33 is involved in 

polarization of T-cells toward the T helper type 2 (Th2) 

cell phenotype as well as in activation of mast cells, 

basophils, eosinophils, and natural killer cells. 13,17–19 IL-33 

enhances adhesion, survival, and cytokine production of 

human mast cells, eosinophils, and basophils. 19–22 Furthermore, 

IL-33 was shown to be involved in the modulation of 

inflammation as it can promote rheumatic and airway 

inflammatory diseases, anaphylactic shock, and inflammatory 

and fibrotic disorders of the gastro-intestinal tract. 23,24 

While the effects of IL-33 on the immune system have 

been extensively studied, 18,19 the properties of this cytokine 

in the cardiovascular system are much less investigated. 

25,26 IL-33 and ST2 receptor are expressed in human 

vein endothelial cells and in coronary artery endothelium, 

as well as in the thoracic aorta of apolipoprotein 

E-deficient (ApoE �/� ) mice. 27–29 In such mice, IL-33 was 

also shown to inhibit the progression of high-fat dietinduced 

atherosclerosis and the accumulation of foam cells 

in the lesion. 28,30 In human endothelial cells, however, IL-33 

was shown to induce inflammatory activation as evidenced by 

increased vascular permeability, the increased production of 

inflammatory cytokines, and the stimulation of angiogenesis. 27,31 

In this article, we provide evidence for yet another aspect 

of inflammatory activation of human endothelial cells by 

IL-33 by showing that this cytokine, which we found to be 

expressed in human atherosclerotic tissue, stimulates adhesion 

of leukocytes to the endothelium under both static and 

flow conditions and upregulates the expression of the adhesion 

molecules ICAM-1, VCAM-1, and E-selectin and of the 

chemokine MCP-1 in human endothelial cells in vitro. 

Furthermore, we demonstrate that the latter effects of IL-33 

are also operative in explanted human atherosclerotic plaque 

tissue ex vivo. 

Methods 

Cell Culture 

Human umbilical vein endothelial cells (HUVEC) were isolated 

from fresh umbilical cords. Human coronary artery endothelial 

cells (HCAEC) were isolated from pieces of coronary arteries 

obtained from patients undergoing heart transplantation. Such 

Demyanets et al IL-33 Induces Adhesion Molecules in Endothelial Cells 2081 

endothelial cells were isolated by mild collagenase treatment, 

characterized and cultivated as described. 32 For some experiments, 

HCAEC (Lonza, Verviers, Belgium) were used; cells were 

maintained in EGM-2 MV Bullet kit medium (Lonza) with 5% 

fetal calf serum (Lonza). 

Isolation of Human Polymorph-Nuclear 

Leukocytes and Monocytes 

Human polymorph-nuclear leukocytes (PMNL; 99% neutrophils 

and less than 1% eosinophils) were isolated from heparinized 

(100 U/mL) peripheral venous blood of healthy donors as 

described. 33 For details, please see supplemental material, 

available online at http://atvb.ahajournals.org. Human monocytes 

were isolated from peripheral blood mononuclear cells by negative 

magnetic selection according to manufacturer’s instructions 

(Monocyte Isolation Kit II, MACS, Miltenyi Biotec, Bergisch 

Gladbach, Germany). The purity of the monocyte preparation 

was 97%. 

Adhesion Assay for PMNL and Monocytes Under 

Static and Flow Conditions 

PMNL adhesion to HCAEC or HUVEC under static conditions was 

measured as described. 33 PMNL or monocyte adhesion to HCAEC 

under flow conditions was performed using Venaflux platform 

(Cellix, Dublin, Ireland). 34–36 For details, please see online supplemental 

material. 

Tissue Sampling 

Atherosclerotic plaques were collected from 35 patients undergoing 

carotid endarterectomy. All subjects were Caucasian and did not 

suffer from acute infection or autoimmune or neoplastic disease. For 

details, please see online supplemental material. The study has been 

reviewed and approved by the Ethic Committee of the Medical 

University of Vienna, Austria, and all study subjects gave informed 

consent. 

Treatment of Cells 

HCAEC and HUVEC were incubated in minimum essential 

medium (M199; Sigma) containing 1.25% fetal calf serum 

(Lonza) without or with recombinant human IL-33 (R&D Systems, 

Minneapolis, MN) at concentrations between 100 ng/mL 

and 0.01 ng/mL for time periods between 1 and 48 hours. For 

soluble receptor inhibition experiments, IL-33 (1 ng/mL) was 

incubated with recombinant human ST2/IL-1 R4 Fc chimera 

(sST2-Fc; 5 �g/mL, R&D Systems) for 15 minutes at 37°C before 

addition to the cells for 24 hours, as described previously. 37 In 

addition, recombinant human immunoglobulin G 1 Fc (IgG 1-Fc; 5 

�g/mL, R&D Systems) was used as an isotype control. In order to 

determine whether the action of IL-33 is dependent on IL-1 effect, 

HUVEC were cultured for 6 hours in the presence of IL-33 (100 

ng/mL) or recombinant human IL-1� (200 U/mL; R&D Systems) 

with or without IL-1 receptor antagonist (IL-1Ra) (10 �g/mL; 

R&D Systems). This concentration of IL-1Ra was shown previously 

to inhibit IL-1�-induced ICAM-1 and VCAM-1 expression 

in HUVEC. 38 In additional experiments, the cells were preincubated 

for 1 hour with the mitogen-activated protein/extracellular 

signal-regulated kinase (MEK) inhibitor U0126 (Promega, Madison, 

WI), or the phosphatidylinositol 3-kinase (PI3K) inhibitor 

LY-294002 (Calbiochem/Merck, Darmstadt, Germany) at the 

indicated concentrations that were similar to concentrations used 

by us and others in in vitro studies with endothelial cells. 39–42 

Thereafter, the cells were treated with IL-33 at a concentration of 

100 ng/mL for 24 hours (for ICAM-1, VCAM-1, MCP-1 measurement) 

or 4 hours (for E-selectin determination). TNF-� 

(Roche Diagnostics, Indianapolis, IN) at 10 pM was used as a 

positive control in our experiments. The culture supernatants were 

collected followed by removal of cell debris by centrifugation and 



2082 Arterioscler Thromb Vasc Biol September 2011 

stored at �80°C until used. The total cell number was counted 

with a hemocytometer after trypsinization. 

Flow Cytometry 

ICAM-1, VCAM-1, and E-selectin expressions at the cell surface 

were measured by means of flow cytometry (FACS Canto II, Becton 

Dickinson, Franklin Lakes, NJ). For details, please see online 

supplemental material. 

Antigen Determination 

MCP-1, IL-6, and IL-8 antigen in cell culture supernatants or in 

supernatants from stimulated explanted atherosclerotic plaque tissue 

was measured by specific ELISAs using monoclonal antibodies (all 

from Bender MedSystems, Vienna, Austria). 

Total RNA Purification and cDNA Preparation 

mRNA was isolated using High Pure RNA Tissue Kit (Roche). 

Reverse transcription was performed using Transcriptor First Strand 

cDNA Synthesis Kit (Roche). For details, please see online supplemental 

material. 

RealTime Polymerase Chain Reaction 

RealTime-PCR was performed using LightCycler� TaqMan� Master 

(Roche) according to the manufacturer’s instructions. For details, 

please see online supplemental material. 

Nuclear Extraction and Analysis of 

NF-�B/DNA Binding 

Preparation of nuclear extracts was performed using a Nuclear 

Extract Kit (Active Motif, Rixensart, Belgium) according to the 

manufacturer’s instructions. For details, please see online supplemental 

material. 

NF-�B Translocation Staining 

HCAEC were treated with fresh M199 containing 1.25% fetal calf 

serum without or with 1, 10, or 100 ng/mL IL-33 for 1 hour and 

staining for NF-�B p50 and p65 subunits was performed. For details, 

please see online supplemental material. 

Immunofluorescence Analysis of IL-33 and ST2 in 

Human Atherosclerotic Tissue 

Human carotid endatherectomy tissues were fixed in 4% formaldehyde 

and embedded in paraffin. Sections (5 �m) were deparaffinized 

according to standard procedure and then boiled for 

antigen retrieval in citrate buffer (DAKO North America, Inc, 

CA). The following primary antibodies were used: mouse monoclonal 

antibody anti-IL33 (clone Nessy-1, 1:1000 dilution; Alexis 

Biochemicals, Enzo Life Sciences AG, Lausen, Switzerland), 

rabbit polyclonal antibody anti-ST2 (IL1RL1) (1:100 dilution; 

Sigma), and rabbit polyclonal antibody anti-von Willebrand 

factor (1:500 dilution; Dako). For details, please see online 

supplemental material. 

Adenoviral Infection 

HUVEC were infected with adenoviral vectors for overexpression 

of I�B� (AdV-I�B�) or for overexpression of a mutant dominant 

negative I�B kinase 2 (AdV-dnIKK2), respectively, as described 

previously. 43,44 For details, please see online supplemental 

material. 

Statistical Analysis 

ANOVA followed by Bonferroni-Holm multiple comparisons correction 

was carried out for experiments having more than 2 experimental 

groups. Dunnett’s post-hoc test was used to compare treated 

groups with the reference untreated group. Normally distributed data 

were analyzed with t tests in case of 2 groups. Mean concentrations 

of the respective protein for each plaque before and after stimulation 

with IL-33 were compared using Wilcoxon signed-rank test for 

nonparametric distribution. For mRNA correlation, a Spearman 

correlation for nonparametric variables was calculated using SPSS 

16.0 (SPSS, Chicago, IL). Values are expressed as mean�SD. 

Values of P�0.05 were considered significant. 

Results 

IL-33 Promotes Adhesion of Human Leukocytes to 

the Monolayer of Endothelial Cells 

When HCAEC were pretreated with 100 ng/mL IL-33 for 4 

hours, an increase in the number of PMNL adhering to the 

endothelial cell monolayer was seen already 5, 15, and, more 

prominently, 30 minutes after the addition of PMNL as 

compared to untreated control (Figure 1A and 1B). Similar 

results were also observed with HUVEC (control 5 minutes 

2.4�1.7; IL-33 5 minutes 8.4�3.7, P�0.05; control 15 

minutes 4.8�2.3; IL-33 15 minutes 14.2�5.9, P�0.05; 

control 30 minutes 5.2�2.6; IL-33 30 minutes 42.4�15.7, 

P�0.05; values represent numbers of PMNL per 5�10 5 

square (sq) microns and are given as mean�SD of 5 

pictures, respectively). 

Under flow conditions (0.5 dyne/cm 2 for 2 minutes and 20 

seconds at 37°C), IL-33 at concentrations of 10 ng/mL and 100 

ng/mL induced statistically significant (P�0.05) adhesion of 

both PMNL and monocytes to monolayers of HCAEC (Figure 

1C and 1D). TNF-� at 10 pM, used as a positive control, also 

significantly increased adhesion of both PMNL (control 8�4, 

TNF-� 107�26, P�0.05) and monocytes (control 4�2, 

TNF-� 10�1, P�0.05) to HCAEC under flow condition. To 

address which adhesion molecules might mediate the PMNL 

adhesion, we also performed additional experiments with 

blocking antibodies against E-selectin, ICAM-1, and 

VCAM-1 alone, or with all three blocking antibodies together. 

E-selectin and VCAM-1 antibodies significantly 

(P�0.05) reduced PMNL adhesion to HCAEC monolayers 

which had been activated by 10 ng/mL of IL-33 (Figure 1E 

and 1F). ICAM-1 antibody also reduced IL-33–mediated 

PMNL adhesion, however, to a lesser extent than E-selectin 

or VCAM-1 antibodies (Figure 1E and 1F). If all 3 antibodies 

were applied simultaneously, IL-33-induced PMNL adhesion 

was reduced to the level of untreated endothelial cells (Figure 

1E and 1F). Please see, also, respective movies in the 

supplemental data. 

IL-33 Stimulates VCAM-1, ICAM-1, E-Selectin, 

and MCP-1 Expression in Human Endothelial 

Cells via ST2 Receptor and in IL-1-, MEK-, and 

PI3K-Independent Manner 

When HUVEC were treated with IL-33 at concentrations from 

0.01 to 100 ng/mL for 4, 16, 24, and 48 hours, a concentrationdependent 

upregulation of ICAM-1, VCAM-1, and MCP-1 

protein production was observed at all time points (Figure 2A, B, 

D). E-selectin expression was also significantly increased in 

these cells, however, only after 4 hours of incubation (Figure 

2C). TNF-� at 10 pM induced upregulation of these adhesion 

molecules and MCP-1 with similar kinetics in HUVEC 

(ICAM-1 [mean fluorescence intensity, MFI], control: 4 hours, 

185�9; 16 hours, 239�3; 24 hours, 209�14; 48 hours, 169�9; 

TNF-�: 4 hours, 638�107; 16 hours, 2594�42; 24 hours, 

2028�160; 48 hours, 1061�49. VCAM-1 [MFI], control: 4 



Figure 1. Interleukin (IL)-33 promotes adhesion of human leukocytes 

to monolayers of endothelial cells. A, Confluent monolayers of human 

coronary artery endothelial cells (HCAEC) were preincubated for 4 

hours with IL-33 (100 ng/mL). HBSS (1.0 mL) containing 1�10 6 /mL 

PMNL was then added to the endothelial cell monolayer for 5, 15, and 

30 minutes. Respective photomicrographs are shown. B, Adhesion of 

polymorph-nuclear leukocytes (PMNL) to monolayers of HCAEC was 

determined as described in “Methods.” Experiments were performed 

twice. Values represent numbers of PMNL per 5�10 5 square (sq) 

microns and are given as mean�SD of 10 pictures, respectively. Original 

magnification �100. *P�0.05 compared to control. C, HCAEC 

were grown on VenaEC biochips and preincubated for 4 hours with 

IL-33 (10 or 100 ng/mL). Endothelial monolayers were then superfused 

with suspensions of 3x10 6 /mL PMNL or monocytes at 0.5 

dyne/cm 2 for 2 minutes and 20 seconds at 37°C using Venaflux 

Nanopump. Part of the respective photomicrographs is shown. D, 

Adhesion of PMNL or monocytes to monolayers of HCAEC was 

determined as described in “Methods.” Experiments were performed 

4 times, and 10 images were made at each experiment. Values represent 

numbers of PMNL or monocytes per 5�10 5 sq microns and are 

given as mean�SD of 40 pictures, respectively. Original magnification 

�100. *P�0.05 compared to control for PMNL. §P�0.05 compared 

to control for monocytes. E, Endothelial cell layers were preincubated 

for 4 hours with or without 10 ng/mL of IL-33. Afterward, the cells 

were incubated with blocking antibodies for E-selectin, vascular cell 

adhesion molecule-1 (VCAM-1), intercellular adhesion molecule-1 

(ICAM-1) (10 �g/mL each), or all three antibodies together (5 �g/mL 

each), or with an isotype matched control antibody at the same concentrations 

for 15 minutes at 37°C followed by superfusion with suspensions 

of 3�10 6 /mL PMNL at 0.5 dyne/cm 2 for 2 minutes and 20 

seconds at 37°C. Part of the respective photomicrographs is shown. 

F, Adhesion of PMNL to monolayers of HCAEC was determined as 

described in “Methods.” Experiments were performed 4 times, and 10 

photos were made at each experiment. Values represent numbers of 

PMNL per 5�10 5 sq microns and are given as mean�SD of 40 pictures, 

respectively. Original magnification �100. *P�0.05 compared to 

control. §P�0.05 compared to IL-33 pretreated cells. 


Figure 2. Effects of interleukin (IL)-33 on intercellular adhesion 

molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM- 

1), endothelial selectin (E-selectin) and monocyte chemoattractant 

protein-1 (MCP-1) protein production by HUVEC and 

HCAEC. Confluent monolayers of HUVEC were incubated for 4 

(224), 16 (�), 24 (X), or 48 hours (�) in the absence or presence 

of IL-33 from 0.01 ng/mL to 100 ng/mL. Confluent monolayers 

of HCAEC were incubated for 4 hours (▫) in the absence or 

presence of IL-33 from 0.01 ng/mL to 100 ng/mL. A, E, ICAM-1, 

B, F, VCAM-1, and C, G, E-selectin expression at the cell surface 

was measured by means of flow cytometry as described in 

“Methods.” D, H, MCP-1 protein was determined in conditioned 

media by ELISA as described in Methods.” Each experiment 

was performed in triplicates. Values are given in mean fluorescence 

intensity (MFI) (A–C, E–G) or in pg/10 4 cells (D, H) and 

represent mean values�SD of 3 different experiments. The overall 

ANOVA comparing different concentrations for each tested 

molecule, and time point remained significant after correction 

for 6 comparisons (ICAM-1, VCAM-1, E-selectin, MCP-1, IL-6, 

IL-8). *P�0.05 compared to control 4 hours; $P�0.05 compared 

to control 16 hours; §P�0.05 compared to control 24 hours; 

#P�0.05 compared to control 48 hours. 

hours, 97�6; 16 hours, 102�6; 24 hours, 91�9; 48 hours, 

110�3; TNF-�: 4 hours, 505�109; 16 hours, 412�50; 24 

hours, 256�2; 48 hours 169�13. E-selectin [MFI], control: 4 

hours, 116�5; 16 hours, 117�2; 24 hours 109�4; 48 hours, 

109�5; TNF-�: 4 hours, 1441�318; 16 hours, 124�14; 24 

hours, 103�3; 48 hours, 139�6. MCP-1 [pg/10 4 cells], control: 

4 hours, 715�59; 16 hours 1039�119; 24 hours 1458�102; 48 

hours 3988�507; TNF-� 4 hours, 11 760�981; 16 hours, 

54 094�7437; 24 hours, 67 730�1463; 48 hours, 85 696� 




8594). In agreement with published data, IL-6 and IL-8 protein 

production was also increased under IL-33 treatment in both 

endothelial cell types (data not shown). 31 

Also in HCAEC, IL-33 treatment dose-dependently increased 

ICAM-1 (Figure 2E), VCAM-1 (Figure 2F), 

E-selectin (Figure 2G), and MCP-1 protein (Figure 2H) after 

4 hours of incubation. 

As IL-33 was shown to exert its effects by binding to 

cell surface T1/ST2, 13 we examined whether incubation 

with the soluble extracellular domain of ST2 coupled to the 

Fc fragment of human IgG 1 (sST2-Fc) could interfere with 

the stimulatory effect of IL-33. Indeed, sST2-Fc, but not 

IgG 1-Fc used as an isotype control, significantly inhibited 

the production of ICAM-1, VCAM-1, E-selectin, and 

MCP-1 protein induced by IL-33 in human endothelial 

cells (Supplemental Figure I). sST2-Fc does not affect 

basal production of any of these proteins (Supplemental 

Figure I). 

IL-33 at a concentration of 100 ng/mL also robustly 

upregulated mRNA specific for ICAM-1, VCAM-1, 

E-selectin and MCP-1 in HUVEC between 1 hour and 9 

hours of incubation with maximal up-regulation between 3 

and 6 hours (please see Supplemental Figure II). Similarly, 

levels of mRNA specific for ICAM-1, VCAM-1, 

E-selectin, and MCP-1 were increased also in HCAEC 

after 9 hours of incubation with 100 ng/mL IL-33 

12.0�5.1-fold, 17.9�4.1-fold, 246.2�51.9-fold, and 

9.4�3.7-fold, respectively. 

We tested also for the effect of IL-33 treatment on IL-1 

expression and found that IL-33 also significantly upregulated 

IL-1 mRNA expression in both HUVEC and HCAEC 

(Supplemental Table I). Maximal upregulation of IL-1 

mRNA was achieved at 6 hours in HUVEC and at 3 hours in 

HCAEC (Supplemental Table I). Since ICAM-1, VCAM-1, 

E-selectin, and MCP-1 production may also depend on the 

autocrine action of IL-1, we determined the role of endogenous 

IL-1 in the production of these biomolecules by IL-33. 

We found no inhibitory effect of IL-1Ra (10 �g/mL) on 

IL-33-induced ICAM-1, VCAM-1, E-selectin, and MCP-1 

mRNA expression in HUVEC. In contrast, when used at the 

same concentration IL-1Ra completely inhibited IL-1�induced 

mRNA expression of these proteins (Supplemental 

Table II). 

As IL-33 was previously shown to activate Erk1/2 31 and 

PI3K/Akt 27 pathways in endothelial cells, we tested in additional 

experiments whether the MEK inhibitor U0126 or 

PI3K inhibitor LY-294002 could modify IL-33-induced 

ICAM-1, VCAM-1, E-selectin, or MCP-1 protein production. 

As shown in Supplemental Table III, neither U0126 at 

concentration 1 �mol/L nor LY-294002 at concentration 

5 �mol/L abrogated IL-33-induced ICAM-1, VCAM-1, 

E-selectin, or MCP-1 proteins. 

As IL-33 is known to exert a Th2 polarizing effect, 13 we 

also investigated the production of the Th2 cytokines IL-4 

and IL-5 and the T regulatory cytokine IL-10 45 in human 

endothelial cells after treatment with IL-33. As shown in 

Supplemental Figure III, IL-33 at 100 ng/mL did not modulate 

the production of IL-4, IL-5, or IL-10 in HCAEC at any 

time point tested (4, 16, and 24 hours). 

IL-33 Induces NF-�B Nuclear Translocation and 

IL-33 Effects on Endothelial Cells 

are NF-�B-Dependent 

As can be seen in Figure 3, IL-33 at 100 ng/mL induced 

statistically significant (P�0.05) nuclear translocation of 

NF-�B subunits p50 (panel A) and p65 (panel B) in human 

endothelial cells 15, 30, and 60 minutes after incubation. In 

HCAEC, IL-33 at 1 ng/mL (panel D), 10 ng/mL (panel E), 

and 100 ng/mL (panel F) induced nuclear translocation of p50 

and p65 as compared to untreated cells (panel C). Adenoviral 

overexpression of dnIKK2 or I�B� in HUVEC abolished the 

IL-33-induced mRNA expression specific for ICAM-1, 

VCAM-1, E-selectin, and MCP-1 as compared to control 

adenovirus (AdV-GFP) (Table). 

IL-33 and ST2 Protein and mRNA Are Expressed 

in Human Atherosclerotic Plaque and 

Recombinant IL-33 Induces a Proadhesive and 

Proinflammatory State in Explanted 

Atherosclerotic Plaque Tissue 

As shown on Figure 4 using fluorescence immunohistochemistry, 

we detect both IL-33 and ST2 protein in human carotid 

endatherectomy specimens. IL-33 protein is expressed by 

endothelial cells as shown by colocalization with von Willebrand 

factor (Figure 4A). Nuclear IL-33 expression and 

membrane-bound ST2 expression was found on the same 

cells (Figure 4B and 4C). Using RealTime-PCR, we detected 

also mRNA specific for IL-33 and ST2 in human carotid 

plaques samples. Moreover, we found a positive correlation 

between IL-33 mRNA and ST2 mRNA expression (r�0.566; 

P�0.044; Figure 4D) in atherosclerotic tissue. In order to 

determine whether the effect of IL-33 on the expression of 

adhesion molecules and MCP-1 seen in vitro is reproducible 

in an ex vivo situation, we treated explanted human carotid 

atherosclerotic plaques with IL-33 for 24 hours (n�12) to 

determine MCP-1, IL-6, and IL-8 protein, or for 6 hours 

(n�7) to assess ICAM-1, VCAM-1, E-selectin, MCP-1, IL-6, 

and IL-8 mRNA. As shown in Figure 5, IL-33 significantly 

increased ICAM-1 mRNA (P�0.018), VCAM-1 mRNA 

(P�0.028), E-selectin mRNA (P�0.018), MCP-1 mRNA 

(P�0.018), and IL-6 mRNA (P�0.018) expression as well as 

MCP-1 protein (P�0.031), IL-6 protein (P�0.00006) and 

IL-8 protein (P�0.003). IL-8 mRNA level also increased. 

However, the difference did not reach statistical significance 

(P�0.063, data not shown). 

Discussion 

Leukocyte interaction with vascular endothelial cells is a 

pivotal event in the inflammatory response characteristic for 

many pathologies including atherosclerosis. 6 Circulating leukocytes 

adhere poorly to healthy endothelium under physiological 

conditions. When the endothelium becomes activated, 

however, it expresses adhesion molecules that bind cognate 

ligands on leukocytes. This switch from a resting, antiadhesive 

to an inflammatory activated, adhesive endothelium is a 

key event in the development of endothelial dysfunction, 

which is considered a hallmark in the early pathogenesis of 



Figure 3. Interleukin (IL)-33 induces NF-�B p50 and p65 subunit nuclear translocation in human coronary artery and umbilical vein endothelial 

cells. Confluent monolayers of human umbilical vein endothelial cells were incubated for 15, 30, or 60 minutes in the absence 

or presence of IL-33 at 100 ng/mL. Preparation of nuclear extracts and quantification of (A) p50 and (B) p65 NF-�B subunits were performed 

as described in “Methods.” Each experiment was performed in triplicates. Values are given as OD492 nm and represent mean 

values�SD of 2 different experiments. C–F, Confluent monolayers of human coronary artery endothelial cells were incubated for 1 hour 

in the absence (C) or presence of IL-33 at 1 (D), 10 (E), or 100 ng/mL (F). p50 (in green), p65 (in red) and nuclei (in blue) staining was 

performed as described in “Methods.” Original magnification �1000. A representative experiment is shown. Experiments were performed 

2 times. 

atherosclerosis. Selectins are involved in the rolling and 

tethering of leukocytes on the vascular wall. ICAM-1 and 

VCAM-1 induce firm adhesion of inflammatory cells at the 

vascular surface. 5,7 Chemokines such as MCP-1 provide a 

Table. AdV-dnIKK2 and AdV-I�B� Inhibited Interleukin-33-Induced 

ICAM-1, VCAM-1, E-Selectin, and MCP-1 mRNA Expressions 

in HUVEC 

ICAM-1 VCAM-1 E-Selectin MCP-1 

No virus 3.4�0.7 9.2�3.8 17.1�0.9 2.5�0.3 

AdV-GFP 5.2�1.0 10.1�1.5 17.2�5.4 2.5�0.01 

AdV-dnIKK2 1.2�0.1 2.8�0.3 9.3�3.7 1.1�0.2 

AdV-I�B� 1.1�0.5 1.6�0.1 4.7�1.5 0.8�0.04 

HUVEC were left uninfected or were infected with a recombinant adenovirus 

expressing dnIKK2 (AdV-dnIKK2), I�B� (AdV-I�B�) or a control adenovirus 

(AdV-GFP) for 4–6 h. 48-h post infection cells were stimulated with 

Interleukin-33 (100 ng/mL) for 6 h whereas control cells were left untreated. 

mRNA was prepared and RealTime-PCR with primers specific for intercellular 

adhesion molecule-1 (ICAM-1), vascular cell AM-1 (VCAM-1), endothelial 

selectin (E-selectin), monocyte chemoattractant protein-1 (MCP-1), and GAPDH 

was performed as described in “Methods.” Each experiment was performed in 

triplicates. Adhesion molecules and MCP-1 mRNA levels were normalized 

according to the respective GAPDH mRNA level. Values are given as x-fold of 

control, which was set as 1 and represent mean values�SD of 2 different 

experiments. The overall ANOVA for each tested molecule remained significant 

after correction for 4 comparisons. 


chemotactic stimulus to the adherent leukocytes, directing 

their diapedesis and migration into the vessel wall. 12 Classical 

inflammatory mediators such as IL-1 and TNF-� were shown 

to induce VCAM-1, ICAM-1, and E-selectin in human 

endothelial cells. 8,9 

Here, we show for the first time that the novel IL-1 

cytokine family member, IL-33, induces rapid adhesion of 

leukocytes to monolayers of human endothelial cells isolated 

from coronary artery and umbilical vein. On further 

analysis, we could show upregulation of the production of 

the adhesion molecules VCAM-1, ICAM-1, E-selectin, 

and the chemokine MCP-1 in these endothelial cells by 

IL-33. The upregulation of these adhesion molecules was 

concentration-dependent with a significant increase seen at 

concentrations between 1 ng/mL and 100 ng/mL of IL-33. 

In agreement with a recently published study, we found 

that IL-33 also upregulated the inflammatory cytokines 

IL-6 and IL-8 in human endothelial cells. 31 In parallel with 

increased VCAM-1, ICAM-1, E-selectin, and MCP-1 protein 

production, IL-33 caused a marked upregulation of 

specific mRNA for VCAM-1, ICAM-1, E-selectin, and 

MCP-1 in human coronary artery and umbilical vein 

endothelial cells. The effect was specific for IL-33 because 

sST2-Fc but not IgG 1-Fc abrogated these IL-33-induced 

effects in endothelial cells. We also showed that IL-33 




Figure 4. Expression of interleukin (IL)-33 and ST2 in human 

atherosclerotic tissue. A, Staining for IL-33 and von Willebrand 

factor or (B, C) staining for IL-33 and ST2 was performed as 

described in “Methods.” Original magnification �200 (A) or 

�630 (B, C). Representative pictures are shown. Staining was 

representative for 3 different donors. D, RNA was isolated from 

carotid endartherectomy lesions (n�13) and IL-33 mRNA 

and ST2 mRNA and mRNA for GAPDH was determined by 

RealTime-PCR as described in “Methods.” mRNA levels of IL-33 

and ST2 were correlated after adjustment for GAPDH. 

exerted direct proinflammatory properties on human endothelial 

cells without a requirement for intermediate autocrine 

or juxtacrine action of IL-1�, as the natural antagonist 

IL-1Ra, which inhibits IL-1� action by preventing its 

binding to specific receptors, did not inhibit IL-33-induced 

upregulation of ICAM-1, VCAM-1, E-selectin, or MCP-1 

specific mRNA in these cells. We also show that IL-33 

induces nuclear translocation of NF-�B p50 and p65 

subunits in both types of endothelial cells suggesting that 

the effects of IL-33 are mediated via the NF-�B pathway. 

This notion is further supported by our finding that the 

stimulatory effect of IL-33 on adhesion molecule and 

MCP-1 expression is abolished by adenoviral overexpression 

of I�B and dnIKK in these cells. In agreement with 

our observations, IL-33 has been shown to activate NF-�B 

in various other cell types such as mast cells, 13,20,46 

eosinophils, 47 basophils, 18 CD4 � T-cells 48 and rat neonatal 

cardiac myocytes and fibroblasts. 25 Although IL-33 was 

previously shown to activate Erk1/2 and Akt pathways, 27,31 

MEK inhibitor U0126 or PI3K inhibitor LY-294002 did 

not abrogate induction by IL-33 of any of the proteins 

tested in our study. 

Moreover, we found that IL-33 and ST2 are expressed in 

human atherosclerotic carotid tissue on both protein and 

mRNA level. Our study is the first that demonstrated expression 

of both IL-33 and ST2 in human atherosclerotic tissue. 

IL-33 protein is localized to endothelial cells in human 

atherosclerotic tissue. It should be emphasized that a previous 

study demonstrated increased IL-33 expression in the atherosclerotic 

aorta of ApoE �/� mice fed a high-fat diet as 

compared to ApoE �/� mice fed a normal diet and to 

Figure 5. Interleukin (IL)-33 induces a proadhesive and proinflammatory 

state in explanted atherosclerotic plaque tissue ex 

vivo. A–D, F, Fresh carotid endarterectomy samples (n�7) were 

incubated with or without IL-33 at 100 ng/mL for 6 hours and 

(A) intracellularl adhesion molecule-1 (ICAM-1), (B) vascular cell 

adhesion molecule-1 (VCAM-1), (C) endothelial selection 

(E-selectin), (D) monocyte chemoattractant protein-1 (MCP-1) 

and (F) IL-6 mRNA was determined by RealTime-PCR as 

described in “Methods.” E, G, H, Fresh carotid endarterectomy 

samples (n�12) were incubated with or without IL-33 at 100 

ng/mL for 24 hours and E, MCP-1, G, IL-6, and H, IL-8 protein 

in supernatant was measured by specific ELISA as described in 

“Methods.” A–H, Individual values of the respective protein for 

each carotid endarterectomy sample represent the mean value 

of 3 independent measurements. Box plots show median (bold 

black lines), interquartile range (boxes), and values within 1.5 

interquartile ranges from the upper or lower edge of the box 

(whiskers). *P�0.05 compared to control. 

wild-type mice. 28 Here, we describe that in human atherosclerotic 

plaques nuclear IL-33 and membrane-bound ST2 

protein are expressed by the same cells, namely by endothelial 

cells, and that IL-33 mRNA significantly correlates with 

ST2 mRNA expression in carotid atherosclerotic tissue, 

suggesting that both proteins are highly coregulated in this 

tissue. Furthermore, ex vivo treatment of atherosclerotic 

tissue samples with IL-33 increased the expression of 

ICAM-1, VCAM-1, E-selectin, and MCP-1 in these tissue 

specimens. 

Since the discovery of IL-33 in 2005, numerous immunomodulator 

effects of this cytokine were described in 

different cells. IL-33 enhances adhesion and survival of 



mast cells, eosinophils and basophils, as well as release of 

different cytokines from these cells, and is a chemoattractant 

for Th2 cells in vitro. 19–22,49 Furthermore, it was 

shown recently that IL-33 upregulated cell surface expression 

of the adhesion molecule ICAM-1 on eosinophils, but 

it suppressed that of ICAM-3 and L-selectin. 47 In an in 

vivo experimental sepsis model, IL-33 treatment increased 

neutrophil influx into the peritoneal cavity and induced 

more efficient bacterial clearance, which was associated 

with reduced mortality. 50 In a murine model of collageninduced 

arthritis, IL-33 treatment markedly exacerbated 

mononuclear and polymorphonuclear cell infiltration into 

the joint which was associated with disease progression. 51 

Taken together, IL-33 appears to be an important immune 

regulator that plays a role in inflammation, especially in 

the rapid recruitment of certain effector cells into sites of 

ongoing inflammation. 

Compared to these effects of IL-33 on the immune 

system, data on its contribution to cardiovascular pathophysiology 

is scarce. In human endothelial cells, IL-33 

induced inflammatory activation as evidenced by increased 

vascular permeability, increased production of inflammatory 

cytokines, and the stimulation of angiogenesis. 27,31 A 

possible role for IL-33 in the development and progression 

of atherosclerosis is suggested but not well characterized 

yet. IL-33 was shown to be expressed in cells that are 

known to be present in atherosclerotic lesions and to 

activate such cells. 2,3 For example, IL-33 was found in 

coronary artery endothelium, 29 and was shown to induce 

the production of proinflammatory cytokines from human 

mast cells and T-cells and to enhance lipopolysaccharide 

(LPS)-induced TNF-�, IL-6, and IL-1� production from 

macrophages. 24,52,53 It should be noted that recently generated 

IL-33-deficient mice showed a substantially diminished 

LPS-induced systemic inflammatory response. 54 Furthermore, 

IL-33 mRNA expression was found in human 

endothelial cells, coronary artery smooth muscle cells, and 

peripheral blood monocytes and leukocytes. 13,28,29,55 In 

contrast to our data presented here, which suggest a 

detrimental contribution of IL-33 to the early development 

of atherosclerosis, in ApoE �/� mice fed on a high-fat diet 

treatment with IL-33 had reduced atherosclerotic lesions in 

the thoracic aorta via increased IL-5 and oxidized low 

density lipoprotein auto-antibody production as well as by 

decreased macrophage foam cell formation. 28,30 It should 

be noted, however, that in these latter studies, which 

showed antiatherosclerotic effects of long-term administration 

(6 weeks) of IL-33, 1 �g/injection of the cytokine 

was administered into ApoE �/� mice that already had 

developed atherosclerosis. 28,30 IL-33 administration increased 

Th2 cytokines, IL-4, IL-5, and IL-13, and reduced 

the Th1 cytokine IFN-� by lymph node cells in vitro and in 

serum ex vivo. 28 The level of the Th17 cytokine IL-17 was 

not different in lymph node cells between IL-33- and 

PBS-treated animals, and IL-17 and IL-10 serum levels 

were not detectable. Local cytokine expression in the 

vasculature ex vivo was not investigated in this study. 

There is strong evidence supporting a proatherogenic role 

of Th1 cells, whereas a possible contribution of the Th2 


subset in atherosclerotic lesion formation is controversially 

discussed. 45,56 The role of the Th2 pathway in the 

development of atherosclerosis seems to be depending on 

the stage and site of the lesion, and on the experimental 

model. 57 Both anti- and proatherogenic effects of IL-4, another 

prototypical Th2 cytokine, and IL-17, a cytokine produced by 

Th17 cells, were shown in different studies using different 

experimental approaches. 57 It should be noted that Th2 cell 

induction is promoted in severe hyperlipidemia, 58 and under 

these conditions Th2 cytokines could be a target for IL-33 as 

shown in this experimental mouse model of atherosclerosis. 28,30 

These contradictory findings could be also explained on 

the basis of different roles for IL-33 and ST2 in distinct 

ST2-expressing cells. In support of that concept, IL-33 is able 

to enhance the production of the Th1 cytokine IFN-� by 

natural killer cells and invariant cells, 22,59 which are found in 

atherosclerotic lesions and are thought to be involved in the 

pathogenesis of atherosclerosis. 60 It is of interest that in our 

study recombinant human IL-33 at 100 ng/mL did not affect 

the production of the Th2 cytokines IL-4 and IL-5 and the T 

regulatory cytokine IL-10 in human coronary artery endothelial 

cells. 

Upregulation of adhesion molecules and chemokines in 

endothelial cells as shown here by us is, besides an impaired 

vasomotor function, a key event in endothelial dysfunction 

that is considered to be an early hallmark in the pathogenesis 

of atherosclerosis. 2,3 It should also be emphasized that in one 

of the articles mentioned above IL-33 injection into the mice 

enhanced their IL-6 serum levels. 28 IL-6 has been shown to 

contribute to development of atherosclerotic lesions, and its 

serum levels correlate with poor prognosis in humans with 

cardiovascular disease and are an independent predictor of 

sudden death in asymptomatic men. 61–63 Furthermore, it 

should be noted that IL-33 was shown to be associated with 

other human inflammatory pathologies such as rheumatoid 

arthritis, systemic sclerosis, inflammatory bowel disease, 

chronic pancreatitis, asthma, psoriasis, and anaphylactic 

shock. 23,24 However, the mechanisms of the deleterious effects 

of IL-33 in these disorders are not completely understood 

yet. 

In conclusion, we provide evidence for the first time that 

the latest member of the IL-1 cytokine family, the 

“alarmin” IL-33, 14,16 is present in human atherosclerotic 

lesion and stimulates the expression of the adhesion 

molecules ICAM-1, VCAM-1, E-selectin, and the chemokine 

MCP-1 in atherosclerotic tissue ex vivo and in human 

coronary artery and umbilical vein endothelial cells in an 

IL-1, MEK- and PI3K-independent but ST2- and NF-�B– 

dependent manner in vitro. Given the fact that the expression 

of ICAM-1, VCAM-1, E-selectin, and MCP-1 in 

atherosclerotic lesions has been reported to increase during 

atherogenesis and that this expression seems to be directly 

associated with plaque progression, 2,3,10,11 we hypothesize 

that IL-33, by promoting adhesion molecules and proinflammatory 

cytokine expression in the endothelium as well 

as adhesion of blood cells to the endothelium, may 

contribute to early events in endothelial dysfunction characteristic 

for the development of atherosclerotic lesions in 

the vessel wall. 




Sources of Funding 

This work was supported by a grant from the Austrian Science Fund 

to Svitlana Demyanets (FWF-Project number T445-B11) and to 

Akos Heinemann (P22521-B18), by the Start Funding Program of 

the Medical University of Graz to Viktoria Konya (ASO109000101). 

Furthermore, the work was supported by the Association for the 

Promotion of Research in Arteriosclerosis, Thrombosis and Vascular 

Biology. 

None. 

Disclosures 

References 

1. Braunwald E. Shattuck lecture–cardiovascular medicine at the turn of the 

millennium: triumphs, concerns, and opportunities. N Engl J Med. 1997; 

337:1360–1369. 

2. Ross R. Atherosclerosis–an inflammatory disease. N Engl J Med. 1999; 

340:115–126. 

3. Libby P. Inflammation in atherosclerosis. Nature. 2002;420:868–874. 

4. Finn AV, Nakano M, Narula J, Kolodgie FD, Virmani R. Concept of 

vulnerable/unstable plaque. Arterioscler Thromb Vasc Biol. 2010;30: 

1282–1292. 

5. Wagner DD, Frenette PS. The vessel wall and its interactions. Blood. 

2008;111:5271–5281. 

6. Langer HF, Chavakis T. Leukocyte-endothelial interactions in inflammation. 

J Cell Mol Med. 2009;13:1211–1220. 

7. Galkina E, Ley K. Vascular adhesion molecules in atherosclerosis. 

Arterioscler Thromb Vasc Biol. 2007;27:2292–2301. 

8. Libby P, Sukhova G, Lee RT, Galis ZS. Cytokines regulate vascular 

functions related to stability of the atherosclerotic plaque. J Cardiovasc 

Pharmacol. 1995;25 Suppl 2:S9–S12. 

9. Raab M, Daxecker H, Markovic S, Karimi A, Griesmacher A, Mueller 

MM. Variation of adhesion molecule expression on human umbilical vein 

endothelial cells upon multiple cytokine application. Clin Chim Acta. 

2002;321:11–16. 

10. O’Brien KD, McDonald TO, Chait A, Allen MD, Alpers CE. Neovascular 

expression of E-selectin, intercellular adhesion molecule-1, and vascular 

cell adhesion molecule-1 in human atherosclerosis and their relation to 

intimal leukocyte content. Circulation. 1996;93:672–682. 

11. van der Wal AC, Das PK, Tigges AJ, Becker AE. Adhesion molecules on 

the endothelium and mononuclear cells in human atherosclerotic lesions. 

Am J Pathol. 1992;141:1427–1433. 

12. Schober A. Chemokines in vascular dysfunction and remodeling. 

Arterioscler Thromb Vasc Biol. 2008;28:1950–1959. 

13. Schmitz J, Owyang A, Oldham E, Song Y, Murphy E, McClanahan TK, 

Zurawski G, Moshrefi M, Qin J, Li X, Gorman DM, Bazan JF, Kastelein 

RA. IL-33, an interleukin-1-like cytokine that signals via the IL-1 

receptor-related protein ST2 and induces T helper type 2-associated 

cytokines. Immunity. 2005;23:479–490. 

14. Lamkanfi M, Dixit VM. IL-33 raises alarm. Immunity. 2009;31:5–7. 

15. Luthi AU, Cullen SP, McNeela EA, Duriez PJ, Afonina IS, Sheridan C, 

Brumatti G, Taylor RC, Kersse K, Vandenabeele P, Lavelle EC, Martin 

SJ. Suppression of interleukin-33 bioactivity through proteolysis by apoptotic 

caspases. Immunity. 2009;31:84–98. 

16. Moussion C, Ortega N, Girard JP. The IL-1-like cytokine IL-33 is constitutively 

expressed in the nucleus of endothelial cells and epithelial cells 

in vivo: a novel ‘alarmin’? PLoS One. 2008;3:e3331. 

17. Drube S, Heink S, Walter S, Lohn T, Grusser M, Gerbaulet A, Berod L, 

Schons J, Dudeck A, Freitag J, Grotha S, Reich D, Rudeschko O, 

Norgauer J, Hartmann K, Roers A, Kamradt T. The receptor tyrosine 

kinase c-Kit controls IL-33 receptor signaling in mast cells. Blood. 2010; 

115:3899–3906. 

18. Pecaric-Petkovic T, Didichenko SA, Kaempfer S, Spiegl N, Dahinden 

CA. Human basophils and eosinophils are the direct target leukocytes of 

the novel IL-1 family member IL-33. Blood. 2009;113:1526–1534. 

19. Valent P. Interleukin-33: a regulator of basophils. Blood. 2009;113: 

1396–1397. 

20. Iikura M, Suto H, Kajiwara N, Oboki K, Ohno T, Okayama Y, Saito H, 

Galli SJ, Nakae S. IL-33 can promote survival, adhesion and cytokine 

production in human mast cells. Lab Invest. 2007;87:971–978. 

21. Suzukawa M, Koketsu R, Iikura M, Nakae S, Matsumoto K, Nagase H, 

Saito H, Matsushima K, Ohta K, Yamamoto K, Yamaguchi M. 

Interleukin-33 enhances adhesion, CD11b expression and survival in 

human eosinophils. Lab Invest. 2008;88:1245–1253. 

22. Smithgall MD, Comeau MR, Yoon BR, Kaufman D, Armitage R, Smith 

DE. IL-33 amplifies both Th1- and Th2-type responses through its 

activity on human basophils, allergen-reactive Th2 cells, iNKT and NK 

cells. Int Immunol. 2008;20:1019–1030. 

23. Liew FY, Pitman NI, McInnes IB. Disease-associated functions of 

IL-33: the new kid in the IL-1 family. Nat Rev Immunol. 2010;10: 

103–110. 

24. Oboki K, Ohno T, Kajiwara N, Saito H, Nakae S. IL-33 and IL-33 

receptors in host defense and diseases. Allergol Int. 2010;59:143–160. 

25. Sanada S, Hakuno D, Higgins LJ, Schreiter ER, McKenzie AN, Lee RT. 

IL-33 and ST2 comprise a critical biomechanically induced and cardioprotective 

signaling system. J Clin Invest. 2007;117:1538–1549. 

26. Seki K, Sanada S, Kudinova AY, Steinhauser ML, Handa V, Gannon J, 

Lee RT. Interleukin-33 prevents apoptosis and improves survival after 

experimental myocardial infarction through ST2 signaling. Circ Heart 

Fail. 2009;2:684–691. 

27. Choi YS, Choi HJ, Min JK, Pyun BJ, Maeng YS, Park H, Kim J, Kim 

YM, Kwon YG. Interleukin-33 induces angiogenesis and vascular permeability 

through ST2/TRAF6-mediated endothelial nitric oxide production. 

Blood. 2009;114:3117–3126. 

28. Miller AM, Xu D, Asquith DL, Denby L, Li Y, Sattar N, Baker AH, 

McInnes IB, Liew FY. IL-33 reduces the development of atherosclerosis. 

J Exp Med. 2008;205:339–346. 

29. Bartunek J, Delrue L, Van Durme F, Muller O, Casselman F, De Wiest 

B, Croes R, Verstreken S, Goethals M, de Raedt H, Sarma J, Joseph L, 

Vanderheyden M, Weinberg EO. Nonmyocardial production of ST2 

protein in human hypertrophy and failure is related to diastolic load. JAm 

Coll Cardiol. 2008;52:2166–2174. 

30. McLaren JE, Michael DR, Salter RC, Ashlin TG, Calder CJ, Miller AM, 

Liew FY, Ramji DP. IL-33 reduces macrophage foam cell formation. 

J Immunol. 2010;185:1222–1229. 

31. Aoki S, Hayakawa M, Ozaki H, Takezako N, Obata H, Ibaraki N, Tsuru 

T, Tominaga S, Yanagisawa K. ST2 gene expression is proliferationdependent 

and its ligand, IL-33, induces inflammatory reaction in endothelial 

cells. Mol Cell Biochem. 2010;335:75–81. 

32. Wojta J, Zoellner H, Gallicchio M, Hamilton JA, McGrath K. Gammainterferon 

counteracts interleukin-1 alpha stimulated expression of 

urokinase-type plasminogen activator in human endothelial cells in vitro. 

Biochem Biophys Res Commun. 1992;188:463–469. 

33. Zhang WJ, Hufnagl P, Binder BR, Wojta J. Antiinflammatory activity 

of astragaloside IV is mediated by inhibition of NF-kappaB activation 

and adhesion molecule expression. Thromb Haemost. 2003;90: 

904–914. 

34. Philipose S, Konya V, Sreckovic I, Marsche G, Lippe IT, Peskar BA, 

Heinemann A, Schuligoi R. The prostaglandin E2 receptor EP4 is 

expressed by human platelets and potently inhibits platelet aggregation 

and thrombus formation. Arterioscler Thromb Vasc Biol. 2010;30: 

2416–2423. 

35. Choi EY, Chavakis E, Czabanka MA, Langer HF, Fraemohs L, Economopoulou 

M, Kundu RK, Orlandi A, Zheng YY, Prieto DA, Ballantyne 

CM, Constant SL, Aird WC, Papayannopoulou T, Gahmberg 

CG, Udey MC, Vajkoczy P, Quertermous T, Dimmeler S, Weber C, 

Chavakis T. Del-1, an endogenous leukocyte-endothelial adhesion 

inhibitor, limits inflammatory cell recruitment. Science. 2008;322: 

1101–1104. 

36. Konya V, Philipose S, Balint Z, Olschewski A, Marsche G, Sturm EM, 

Schicho R, Peskar BA, Schuligoi R, Heinemann A. Interaction of eosinophils 

with endothelial cells is modulated by prostaglandin EP4 receptors. 

Eur J Immunol. 2011. 

37. Palmer G, Lipsky BP, Smithgall MD, Meininger D, Siu S, Talabot-Ayer 

D, Gabay C, Smith DE. The IL-1 receptor accessory protein (AcP) is 

required for IL-33 signaling and soluble AcP enhances the ability of 

soluble ST2 to inhibit IL-33. Cytokine. 2008;42:358–364. 

38. Kaplanski G, Marin V, Fabrigoule M, Boulay V, Benoliel AM, Bongrand 

P, Kaplanski S, Farnarier C. Thrombin-activated human endothelial cells 

support monocyte adhesion in vitro following expression of intercellular 

adhesion molecule-1 (ICAM-1; CD54) and vascular cell adhesion 

molecule-1 (VCAM-1; CD106). Blood. 1998;92:1259–1267. 

39. Rychli K, Kaun C, Hohensinner PJ, Rega G, Pfaffenberger S, Vyskocil E, 

Breuss JM, Furnkranz A, Uhrin P, Zaujec J, Niessner A, Maurer G, Huber 

K, Wojta J. The inflammatory mediator oncostatin M induces angiopoietin 

2 expression in endothelial cells in vitro and in vivo. J Thromb 

Haemost. 2010;8:596–604. 



40. Jain S, Gabunia K, Kelemen SE, Panetti TS, Autieri MV. The antiinflammatory 

cytokine interleukin 19 is expressed by and angiogenic for 

human endothelial cells. Arterioscler Thromb Vasc Biol. 2011;31: 

167–175. 

41. Hatipoglu OF, Hirohata S, Cilek MZ, Ogawa H, Miyoshi T, Obika M, 

Demircan K, Shinohata R, Kusachi S, Ninomiya Y. ADAMTS1 is a 

unique hypoxic early response gene expressed by endothelial cells. J Biol 

Chem. 2009;284:16325–16333. 

42. Hermann C, Assmus B, Urbich C, Zeiher AM, Dimmeler S. Insulinmediated 

stimulation of protein kinase Akt: A potent survival signaling 

cascade for endothelial cells. Arterioscler Thromb Vasc Biol. 2000;20: 

402–409. 

43. Oitzinger W, Hofer-Warbinek R, Schmid JA, Koshelnick Y, Binder BR, 

de Martin R. Adenovirus-mediated expression of a mutant IkappaB 

kinase 2 inhibits the response of endothelial cells to inflammatory stimuli. 

Blood. 2001;97:1611–1617. 

44. Wrighton CJ, Hofer-Warbinek R, Moll T, Eytner R, Bach FH, de Martin 

R. Inhibition of endothelial cell activation by adenovirus-mediated 

expression of I kappa B alpha, an inhibitor of the transcription factor 

NF-kappa B. J Exp Med. 1996;183:1013–1022. 

45. Hansson GK, Libby P. The immune response in atherosclerosis: a 

double-edged sword. Nat Rev Immunol. 2006;6:508–519. 

46. Pushparaj PN, Tay HK, H’Ng SC, Pitman N, Xu D, McKenzie A, Liew 

FY, Melendez AJ. The cytokine interleukin-33 mediates anaphylactic 

shock. Proc Natl Acad Sci U S A. 2009;106:9773–9778. 

47. Chow JY, Wong CK, Cheung PF, Lam CW. Intracellular signaling 

mechanisms regulating the activation of human eosinophils by the novel 

Th2 cytokine IL-33: implications for allergic inflammation. Cell Mol 

Immunol. 2010;7:26–34. 

48. Kurowska-Stolarska M, Kewin P, Murphy G, Russo RC, Stolarski B, 

Garcia CC, Komai-Koma M, Pitman N, Li Y, Niedbala W, McKenzie 

AN, Teixeira MM, Liew FY, Xu D. IL-33 induces antigen-specific IL-5� 

T cells and promotes allergic-induced airway inflammation independent 

of IL-4. J Immunol. 2008;181:4780–4790. 

49. Komai-Koma M, Xu D, Li Y, McKenzie AN, McInnes IB, Liew FY. 

IL-33 is a chemoattractant for human Th2 cells. Eur J Immunol. 2007; 

37:2779–2786. 

50. Alves-Filho JC, Sonego F, Souto FO, Freitas A, Verri WA Jr, 

Auxiliadora-Martins M, Basile-Filho A, McKenzie AN, Xu D, Cunha FQ, 

Liew FY. Interleukin-33 attenuates sepsis by enhancing neutrophil influx 

to the site of infection. Nat Med. 2010;16:708–712. 

51. Xu D, Jiang HR, Kewin P, Li Y, Mu R, Fraser AR, Pitman N, Kurowska- 

Stolarska M, McKenzie AN, McInnes IB, Liew FY. IL-33 exacerbates 

antigen-induced arthritis by activating mast cells. Proc Natl Acad Sci 

USA. 2008;105:10913–10918. 


52. Espinassous Q, Garcia-de-Paco E, Garcia-Verdugo I, Synguelakis M, von 

Aulock S, Sallenave JM, McKenzie AN, Kanellopoulos J. IL-33 enhances 

lipopolysaccharide-induced inflammatory cytokine production from 

mouse macrophages by regulating lipopolysaccharide receptor complex. 

J Immunol. 2009;183:1446–1455. 

53. Ohno T, Oboki K, Morita H, Kajiwara N, Arae K, Tanaka S, Ikeda M, 

Iikura M, Akiyama T, Inoue J, Matsumoto K, Sudo K, Azuma M, 

Okumura K, Kamradt T, Saito H, Nakae S. Paracrine IL-33 stimulation 

enhances lipopolysaccharide-mediated macrophage activation. PLoS 

One. 2011;6:e18404. 

54. Oboki K, Ohno T, Kajiwara N, Arae K, Morita H, Ishii A, Nambu A, Abe 

T, Kiyonari H, Matsumoto K, Sudo K, Okumura K, Saito H, Nakae S. 

IL-33 is a crucial amplifier of innate rather than acquired immunity. Proc 

Natl Acad Sci U S A. 2010;107:18581–18586. 

55. Nile CJ, Barksby E, Jitprasertwong P, Preshaw PM, Taylor JJ. Expression 

and regulation of interleukin-33 in human monocytes. Immunology. 2010; 

130:172–180. 

56. Lahoute C, Herbin O, Mallat Z, Tedgui A. Adaptive immunity in atherosclerosis: 

mechanisms and future therapeutic targets. Nat Rev Cardiol. 

2011;8:348–358. 

57. Ait-Oufella H, Taleb S, Mallat Z, Tedgui A. Recent advances on the role 

of cytokines in atherosclerosis. Arterioscler Thromb Vasc Biol. 2011;31: 

969–979. 

58. Zhou X, Paulsson G, Stemme S, Hansson GK. Hypercholesterolemia is 

associated with a T helper (Th) 1/Th2 switch of the autoimmune response 

in atherosclerotic apo E-knockout mice. J Clin Invest. 1998;101: 

1717–1725. 

59. Bourgeois E, Van LP, Samson M, Diem S, Barra A, Roga S, Gombert JM, 

Schneider E, Dy M, Gourdy P, Girard JP, Herbelin A. The pro-Th2 

cytokine IL-33 directly interacts with invariant NKT and NK cells to 

induce IFN-gamma production. Eur J Immunol. 2009;39:1046–1055. 

60. Perrins CJ, Bobryshev YV. Current advances in understanding of immunopathology 

of atherosclerosis. Virchows Arch. 2011;458:117–123. 

61. Huber SA, Sakkinen P, Conze D, Hardin N, Tracy R. Interleukin-6 

exacerbates early atherosclerosis in mice. Arterioscler Thromb Vasc Biol. 

1999;19:2364–2367. 

62. Rauchhaus M, Doehner W, Francis DP, Davos C, Kemp M, Liebenthal C, 

Niebauer J, Hooper J, Volk HD, Coats AJ, Anker SD. Plasma cytokine 

parameters and mortality in patients with chronic heart failure. Circulation. 

2000;102:3060–3067. 

63. Empana JP, Jouven X, Canoui-Poitrine F, Luc G, Tafflet M, Haas B, 

Arveiler D, Ferrieres J, Ruidavets JB, Montaye M, Yarnell J, Morange P, 

Kee F, Evans A, Amouyel P, Ducimetiere P. C-reactive protein, interleukin 

6, fibrinogen and risk of sudden death in European middle-aged 

men: the PRIME study. Arterioscler Thromb Vasc Biol. 2010;30: 

2047–2052. 



Supplemental Material 

Demyanets et al. 

� Supplemental Methods 

� Supplemental Tables I, II, III 

� Supplemental Figures I, II, III 

Supplemental Methods 

Isolation of human polymorph-nuclear leukocytes (PMNL) 

Human polymorph-nuclear leukocytes (PMNL; 99% neutrophils, less than 1% eosinophils) 

were isolated from heparinized (100 U/mL) peripheral venous blood of healthy donors as 

described. 1 Red blood cells were sedimented with 6% dextran (Pharmacia, Uppsala, Sweden) 

in Hank’s balanced salt solution (HBSS; Sigma, St. Louis, MO, USA) for 60 min at room 

temperature, leukocyte-rich plasma was collected and PMNL were then isolated by 

centrifugation, washed and resuspended to 1x10 6 cells/mL in RPMI-1640 (Sigma) with 10 

mmol/L HEPES (Sigma). 

Adhesion assay under static conditions 

PMNL adhesion to HCAEC or HUVEC was measured as described. 1 Briefly, endothelial cells 

were plated in gelatine coated 24-well plates and allowed to grow to confluence. The medium 

was removed and cells were then incubated with 1.0 mL/well of minimum essential medium 

(M199; Sigma) containing 20% fetal calf serum (FCS, Lonza, Verviers, Belgium) with or 

without recombinant human (rh) IL-33 (R&D Systems; Minneapolis, MN). After 4 h of 

incubation the culture supernatant of such treated cells was removed and the cells were gently 

washed three times with M199. 1.0 mL of HBSS containing 1 x 10 6 PMNL was then added to 

the endothelial cell monolayer in each well. The binding phase of the assay was performed at 



37°C in a 5% CO2 atmosphere for 5, 15 and 30 min. Thereafter, the wells were washed with 

HBSS (1.0 mL/well) three times and all wells were examined under microscope in order to 

determine whether loss of endothelial cells had occurred during incubation or washing. An 

Olympus IMT 2 microscope was used for light microscopy with 10x lens with numeric 

apertures of 0.30. A Canon EOS-400 camera was used to acquire images. 

Adhesion assay under flow conditions 

HCAEC (4.3×10 5 /substrate) were grown on VenaEC biochips (Cellix, Dublin, Ireland). After 

reaching confluence (usually within two days) endothelial layers were incubated with fresh 

M199 (Sigma) containing 20% FCS (Lonza) with or without rh IL-33 (10 or 100 ng/mL) for 4 

h. Endothelial monolayers were superfused with suspensions of 3x10 6 /mL PMNL or 

monocytes at 0.5 dyne/cm 2 for 2 min and 20 seconds at 37°C in the OKOLAB H201-T1 

heated cage. PMNL and monocytes were preconditioned in endothelial cells media for 5 min 

at 37°C prior to the flow experiment. In some experiments the endothelial layers were pre- 

incubated with blocking antibodies for E-selectin, VCAM-1, ICAM-1 (10 µg/mL each; R&D 

Systems) or all three antibodies together (5 µg/mL each) or with an isotype matched control 

antibody at the same concentrations for 15 min at 37°C. Cell adhesion was monitored by 

phase contrast on a Zeiss Axiovert 40 CFL microscope and a Zeiss A-Plan 10x/0.25 Ph1 lens, 

using Hamamatsu ORCA-03G digital camera and VenaFlux software (Cellix). Computerized 

image analysis was performed by DucoCell analysis software (Cellix), where adherent cells 

were quantified on each single image. 2-4 

Tissue sampling 

Atherosclerotic plaques were collected from 35 patients undergoing carotid endarterectomy. 

All subjects were Caucasian and did not suffer from acute infection, autoimmune or 

neoplastic disease. The carotid endarterectomy samples for IL-33 mRNA and ST2 mRNA 



analysis (n=13, 85% male, mean age 70 years, 38% symptomatic) were snap-frozen in liquid 

nitrogen in the surgery room and stored at -80°C until RNA extraction. The carotid 

endarterectomy tissue for immunofluorescence analysis (n=3, 67% male, mean age 72 years, 

33% symptomatic) were fixed in 4% formalin and embedded in paraffin. The carotid 

endarterectomy samples (n=19), which were used for culture experiments, were collected in 

sterile tubes with M199 containing 5% FCS. These fresh tissues were cut into small pieces, 

and for each plaque, equal numbers of nonadjacent plaque pieces were randomly distributed 

into wells of a 24-well plate filled with M199 that contained 5% FCS as described 

previously. 5 They were stimulated with 100 ng/mL rh IL-33 for 24 h (n=12, 67% male, mean 

age 65 years, 42% symptomatic) for MCP-1, IL-6 and IL-8 protein determination or for 6 h 

(n=7, 100% male, mean age 69 years, 17% symptomatic) for ICAM-1, VCAM-1, E-selectin, 

MCP-1, IL-6 and IL-8 mRNA measurement. Stimulations were done in triplicates. After 

incubation, tissue was shock-frozen for RNA isolation or culture supernatants were collected 

for further analysis by ELISA. 

Flow cytometry 

ICAM-1, VCAM-1 and E-selectin expressions at the cell surface were measured by means of 

flow cytometry (FACS Canto II, Becton Dickinson, Franklin Lakes, NJ, USA). HUVEC and 

HCAEC were gently detached by detachment buffer (25 mM HEPES (Boehringer Mannheim 

GmbH, Germany), 10 mM EDTA (Pierce, Rockford, IL) in Dulbecco’s PBS without calcium 

and magnesium (PAA, Pasching, Austria)). Endothelial cells were incubated for 30 min at 

4°C in dark with primary antibodies against ICAM-1 FITC (mouse anti-human CD54; 

Beckman Coulter, Brea, CA, USA), VCAM-1 (PE-Cy TM 5 mouse anti-human CD106; BD 

Pharmingen, San Jose CA, USA) and E-selectin (PE mouse anti-human CD62E; BD 

Pharmingen) which were diluted 1:40 or with respective isotype-matched control antibodies 

in antibody diluents solution (DAKO North America, Inc., CA, USA; catalogue number 



S3022). After the cells were washed once with PBS and were resuspended in fixative solution 

(FACS flow solution, distilled water, BD CellFix TM ), flow cytometric analysis was performed 

by FACS Diva software (Becton Dickinson). For IL-4, IL-5, IL-10 determination supernatants 

were collected from HCAEC incubated in the absence or presence of 100 ng/ml IL-33 for 4, 

16 and 24 h, respectively. Supernatants were processed per manufacturer`s instruction (BD 

Cytometric Bead Array, Human Th1/Th2 cytokine kit). In detail, 25µl conditioned 

supernatant was added to 25µl mixed beads (each specific for IL-4, IL-5, IL-10) and 25µl PE 

detection reagent. The mixture was incubated for 3 h at room temperature in the dark. The 

beads were washed and analyzed immediately by flow cytometry. Mean fluorescence 

intensities (MFI) for treated endothelial cells were compared to the MFI of unstimulated cells. 

Total RNA purification and cDNA preparation 

Cells were treated as described, supernatants were removed and total cellular RNA was 

isolated using High Pure RNA Isolation Kit (Roche, Basel, Switzerland) according to the 

manufacturer’s instructions. For IL-33 mRNA and ST2 mRNA measurement, three 

representative samples (each 25 mg of wt) were collected from each carotid artery 

lesion.Frozen tissue was homogenized using a ball mill (Retsch, Haan, Germany), and mRNA 

was isolated usingHigh Pure RNA Tissue Kit (Roche). Reverse transcription was performed 

using Transcriptor First Strand cDNA Synthesis Kit (Roche). 

RealTime Polymerase Chain Reaction 

RealTime-PCR was performed using LightCycler® TaqMan® Master (Roche) according to 

the manufacturer’s instructions. Primers were designed using the Roche Universal 

ProbeLibrary Assay Design Centre (http://www.universalprobelibrary.com/): GAPDH 

(forward primer: 5’-agccacatcgctcagacac-3’, reverse primer: 5’-gcccaatacgaccaaatcc-3’, 

UPLprobe #60; Amplicon Size [bp] 66) – ST2 (forward primer: 5’-ttgtcctaccattgacctctacaa-3’, 



everse primer: 5’-gatccttgaagagcctgacaa-3’, UPLprobe #56; Amplicon Size [bp] 75) – IL-33 

(forward primer: 5’-agcaaagtggaagaacacagc-3’, reverse primer: 5’-cttctttggccttctgttgg-3’, 

UPL probe #33, Amplicon Size [bp] 74) – VCAM-1 (forward primer: 5’- 

tgaatctaggaaattggaaaaagg-3’, reverse primer: 5’- tgaatctctggatccttaggaaa -3’, UPLprobe #39; 

Amplicon Size [bp] 69) – ICAM-1 (forward primer: 5’-ccttcctcaccgtgtactgg-3’, reverse 

primer: 5’-agcgtagggtaaggttcttgc-3’, UPLprobe #71; Amplicon Size [bp] 90) – E- 

selectin(forward primer: 5’ accagcccaggttgaatg-3’, reverse primer: 5’- ggttggacaaggctgtgc-3’, 

UPLprobe #86; Amplicon Size [bp] 89) –MCP-1 (forward primer: 5’-ttctgtgcctgctgctcat-3’, 

reverse primer: 5’-ggggcattgattgcatct-3’, UPLprobe #83; Amplicon Size [bp] 73) – IL-6 

(forward primer: 5’-gatgagtacaaaagtcctgatcca-3’, reverse primer: 5’-ctgcagccactggttctgt-3’, 

UPLprobe #40; Amplicon Size [bp] 130) – IL-8 (forward primer: 5’-agacagcagagcacacaagc- 

3’, reverse primer: 5’-atggttccttccggtggt-3’, UPLprobe #72; Amplicon Size [bp] 62). The 

amplification conditions consisted of an initial incubation at 95°C for 10 min, followed by 45 

cycles of 95°C for 10 sec, 63°C for 20 sec and 72°C for 6 sec and a final cooling to 40°C. 

Data was analysed using LightCycler Software Version 3.5 (Roche). 

Nuclear extraction and analysis of NF-κB/DNA binding 

Endothelial cells were incubated for 15, 30 or 60 min in 1.25% FCS with or without rh IL-33 

at a concentration of 100 ng/mL. Preparation of nuclear extracts was performed using a 

Nuclear Extract Kit (Active Motif, Rixensart, Belgium) according to the manufacturer’s 

instructions. Quantitation of p50 and p65 NF-κB subunits in nuclear extracts of such treated 

cells was performed using the ELISA-based TransAM TM NF-κB Family kit (Active Motif, 

Rixensart, Belgium) as described previously. 6 



NF-κB translocation staining 

HCAEC were seeded on Permanox chamber slides (Nunc Inc., Neparville, IL, USA). 

Confluent monolayers were treated with fresh M199 containing 1.25% FCS without or with 1, 

10 or 100 ng/mL IL-33 for 1 h. Monolayers were washed with PBS and fixed with 3.7% 

paraformaldehyde. The cells were washed again and then permeabilized with 0.1% Triton X- 

100 (Sigma) in PBS for 20 min at room temperature, washed in PBS, and blocked with 5% 

bovine serum albumin (BSA; Sigma) in PBS for 30 min. Subsequently, cells were incubated 

for 1 h at room temperature with a goat polyclonal anti-human p50 antibody(Santa Cruz, CA, 

USA) at a dilution of 1:100 or goat IgG (R&D Systems) as an isotype control in diluent 

solution for primary antibody (DAKO, catalogue number S3022). After washing, a 1:200 

dilution of afluorescein (FITC)-conjugated mouse anti-goat antibody (Jackson 

ImmunoResearch Laboratories, West Grove, PA, USA)in diluent solution for secondary 

antibody (DAKO, catalogue number S0809) was incubated with the cells for 1 h at room 

temperature in the dark. After washing, the cells were incubated for 1 h with a rabbit 

polyclonal anti-human NF-κB p65 (Santa Cruz) at 1:100 or rabbit IgG (R&D Systems) 

followed by washing step and 1 h incubation with Texas Red dye-conjugated donkey anti- 

rabbit antibody (Jackson) at 1:200 in the dark.After final washes, cells were mounted using 

Vectashield mounting medium with 4',6-diamidino-2-phenylindole (DAPI;Vector 

Laboratories Inc., Burlingame, CA, USA) and sealed with nail polish. Fluorescence was 

assessed by microscopy with Zeiss Axio Imager.M2 with 100x lens (numeric aperture 0.9) 

with immersion oil (Imersol TM , Zeiss, Oberkochen, Germany) using AxioVision Rel. 4.8 

software. 

Immunofluorescence analysis of IL-33 and ST2 in human atherosclerotic tissue 

Primary antibodies, mouse monoclonal anti-IL33 antibody (clone Nessy-1, 1:1000 dilution; 

Alexia Biochemicals, Enzo Life Sciences AG, Lausen, Switzerland), rabbit polyclonal anti- 



ST2 antibody (IL1RL1) (1:100 dilution; Sigma) and rabbit polyclonal antibody anti-von 

Willebrand factor (1:500 dilution; Dako), were incubated overnight at 4°C. After extensive 

washing in PBS, slides were incubated with secondary antibodies for 2 h at room temperature 

in the dark. Secondary antibodies were Alexa Fluor-488 goat anti-mouse IgG (Invitrogen- 

Molecular Probes), Alexa Fluor-546 goat anti-rabbit IgG (Invitrogen-Molecular Probes) and 

Cy 5 goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories). All antibodies were 

diluted in PBS containing 0.05% Tween-20, 3% BSA for blocking and 0.1% Triton X-100 for 

permeabilization. Nuclear counter staining was performed with DAPI (1µg/mL; Sigma) for 10 

min at room temperature. Tissue sections were analyzed with a confocal laser scanning 

microscope (LSM-700; Carl Zeiss) with 20x lens (numeric aperture 0.8) or 63x lens with oil 

(numeric aperture 1.4) using ZEN 2009 software. Tissue sections of human normal tonsil or 

human colon from Crohn's disease patients, obtained from the Department of Pathology, 

Medical University of Vienna, Austria, were used as a positive control for IL-33 or ST2 

staining, respectively. 7-10 

Adenoviral infection 

To study a potential NF-κB-dependent effect on endothelial cells upon IL-33 stimulation, 

HUVEC were infected with adenoviral vectors for overexpression of IκBα (AdV-IκBα) or for 

overexpression of a mutant dominant negative IκB kinase 2 (AdV-dnIKK2), respectively, as 

described previously. 11, 12 Infection was performed in M199 supplemented with 20% FCS, 

2mM L-glutamine, 100 U/mL penicillin, 100 µg/mL streptomycin, 5 U/mL heparin, and 25 

µg/mL endothelial cell growth supplement (Promocell, Heidelberg, Germany) for 4-6 h with 

the AdV-IκBα, the AdV-dnIKK2 or control adenovirus (AdV-green fluorescent protein 

(GFP)) 13 at a multiplicity of infection of 100. 48 h post infection cells were stimulated with 

IL-33 (100 ng/mL) for 6 h. 



References 

1. Zhang WJ, Hufnagl P, Binder BR, Wojta J. Antiinflammatory activity of astragaloside 

IV is mediated by inhibition of NF-kappaB activation and adhesion molecule 

expression. Thromb Haemost. 2003;90:904-914. 

2. Choi EY, Chavakis E, Czabanka MA, Langer HF, Fraemohs L, Economopoulou M, 

Kundu RK, Orlandi A, Zheng YY, Prieto DA, Ballantyne CM, Constant SL, Aird WC, 

Papayannopoulou T, Gahmberg CG, Udey MC, Vajkoczy P, Quertermous T, 

Dimmeler S, Weber C, Chavakis T. Del-1, an endogenous leukocyte-endothelial 

adhesion inhibitor, limits inflammatory cell recruitment. Science. 2008;322:1101- 

1104. 

3. Philipose S, Konya V, Sreckovic I, Marsche G, Lippe IT, Peskar BA, Heinemann A, 

Schuligoi R. The prostaglandin E2 receptor EP4 is expressed by human platelets and 

potently inhibits platelet aggregation and thrombus formation. Arterioscler Thromb 

Vasc Biol. 2010;30:2416-2423. 

4. Konya V, Philipose S, Balint Z, Olschewski A, Marsche G, Sturm EM, Schicho R, 

Peskar BA, Schuligoi R, Heinemann A. Interaction of eosinophils with endothelial 

cells is modulated by prostaglandin EP4 receptors. Eur J Immunol. 2011. 

5. Niessner A, Sato K, Chaikof EL, Colmegna I, Goronzy JJ, Weyand CM. Pathogen- 

sensing plasmacytoid dendritic cells stimulate cytotoxic T-cell function in the 

atherosclerotic plaque through interferon-alpha. Circulation. 2006;114:2482-2489. 

6. Demyanets S, Pfaffenberger S, Kaun C, Rega G, Speidl WS, Kastl SP, Weiss TW, 

Hohensinner PJ, Dietrich W, Tschugguel W, Bochkov VN, Awad EM, Maurer G, 

Huber K, Wojta J. The estrogen metabolite 17beta-dihydroequilenin counteracts 

interleukin-1alpha induced expression of inflammatory mediators in human 

endothelial cells in vitro via NF-kappaB pathway. Thromb Haemost. 2006;95:107- 

116. 

7. Carriere V, Roussel L, Ortega N, Lacorre DA, Americh L, Aguilar L, Bouche G, 

Girard JP. IL-33, the IL-1-like cytokine ligand for ST2 receptor, is a chromatin- 

associated nuclear factor in vivo. Proc Natl Acad Sci U S A. 2007;104:282-287. 

8. Baekkevold ES, Roussigne M, Yamanaka T, Johansen FE, Jahnsen FL, Amalric F, 

Brandtzaeg P, Erard M, Haraldsen G, Girard JP. Molecular characterization of NF- 

HEV, a nuclear factor preferentially expressed in human high endothelial venules. Am 

J Pathol. 2003;163:69-79. 



9. Sponheim J, Pollheimer J, Olsen T, Balogh J, Hammarstrom C, Loos T, Kasprzycka 

M, Sorensen DR, Nilsen HR, Kuchler AM, Vatn MH, Haraldsen G. Inflammatory 

bowel disease-associated interleukin-33 is preferentially expressed in ulceration- 

associated myofibroblasts. Am J Pathol. 2010;177:2804-2815. 

10. Beltran CJ, Nunez LE, Diaz-Jimenez D, Farfan N, Candia E, Heine C, Lopez F, 

Gonzalez MJ, Quera R, Hermoso MA. Characterization of the novel ST2/IL-33 

system in patients with inflammatory bowel disease. Inflamm Bowel Dis. 

2010;16:1097-1107. 

11. Oitzinger W, Hofer-Warbinek R, Schmid JA, Koshelnick Y, Binder BR, de Martin R. 

Adenovirus-mediated expression of a mutant IkappaB kinase 2 inhibits the response of 

endothelial cells to inflammatory stimuli. Blood. 2001;97:1611-1617. 

12. Wrighton CJ, Hofer-Warbinek R, Moll T, Eytner R, Bach FH, de Martin R. Inhibition 

of endothelial cell activation by adenovirus-mediated expression of I kappa B alpha, 

an inhibitor of the transcription factor NF-kappa B. J Exp Med. 1996;183:1013-1022. 

13. de Martin R, Raidl M, Hofer E, Binder BR. Adenovirus-mediated expression of green 

fluorescent protein. Gene Ther. 1997;4:493-495. 



Supplemental Table I. IL-1 mRNA is up-regulated by IL-33 in HUVEC and HCAEC. 

1 h 3 h 6 h 9 h 24 h 

HUVEC 30.3±7.7* 20.8±0.6* 68.2±15.3* 19.8±0.4* 5.3±0.6* 

HCAEC 3.5±0.7* 7.5±2.2* 6.9±2.6* 5.5±2.9* 3.8±0.8* 

Confluent monolayers of HUVEC or HCAEC were incubated for 1, 3, 6, 9 or 24 h in the 

absence or presence of IL-33 (100 ng/mL). mRNA was prepared and RealTime-PCR with 

primers specific for IL-1 was performed as described in “Methods”. IL-1 mRNA levels were 

normalized according to the respective GAPDH mRNA level. Each experiment was 

performed in triplicates. Values are given as x-fold of control, which was set as 1 and 

represent mean ± SD of 2 different experiments.*p≤0.05 as compared to respective 

unstimulated control. 



Supplemental Table II. IL-1 receptor antagonist does not counteract IL-33-induced 

ICAM-1, VCAM-1, E-selectin and MCP-1 mRNA expressions in HUVEC. 

IL-33 IL-33 + IL-1Ra IL-1β IL-1β+ IL-1Ra 

ICAM-1 55.8±8.7 54.1±5.7 20.3±1.0 0.5±0.1 

VCAM-1 72.6±2.2 76.8±3.1 33.2±5.7 0.3±0.1 

E-selectin 1032.1±99.2 1021.8±17.1 343.3±5.7 0.4±0.1 

MCP-1 73.3±0.7 65.2±9.2 20.4±2.2 1.2±0.1 

Confluent monolayers of HUVEC were incubated for 6 h in the absence or presence of IL-33 

(100 ng/mL) or IL-1β (200 U/mL) with or without IL-1Ra (10 µg/mL). mRNA was prepared 

and RealTime-PCR with primers specific for ICAM-1, VCAM-1, E-selectin and MCP-1 was 

performed as described in “Methods”. Adhesion molecules and MCP-1 mRNA levels were 

normalized according to the respective GAPDH mRNA level. Each experiment was 

performed in triplicates. Values are given as x-fold of control, which was set as 1 and 

represent mean ± SD of 2 different experiments. The overall ANOVA for each tested 

molecule remained significant after correction for 4 comparisons. 



Supplemental Table III. Mitogen-activated protein/extracellular signal regulated kinase 

(MEK) inhibitor U0126 or phosphoinoside-3-kinase (PI3K) inhibitor LY-294002 do not 

abrogate IL-33 induced ICAM-1, VCAM-1, E-selectin or MCP-1 protein in HUVEC. 

Control IL-33 U+IL-33 LY+ IL-33 U LY 

ICAM 297±50 5338±799 4886±959 5354±983 304±61 254±44 

VCAM 177±63 547±81 591±121 318±80 170±56 182±49 

E- 

selectin 

151±33 4214±434 3666±754 4447±857 156±42 143±40 

MCP-1 2565±44 41945±6670 46288±7007 36147±8406 2496±65 2201±78 

Confluent monolayers of HUVEC were pre-incubated for 1 h with the MEK inhibitor U0126 

(U) at 1 µM or the PI3K inhibitor LY-294002 (LY) at 5µM. Thereafter, the cells were treated 

with or without IL-33 at a concentration of 100 ng/mL for 24 h (for ICAM-1, VCAM-1, 

MCP-1 measurement) or 4 h (for E-selectin determination) or left untreated (control). Cells 

were gently detached by detachment buffer and ICAM-1, VCAM-1 and E-selectin 

expressions at the cell surface were measured by means of flow cytometry as described in 

“Methods” and MCP-1 protein was determined in conditioned media by ELISA as described 

in “Methods”. Each experiment was performed in triplicates. Values are given in mean 

fluorescence intensity (MFI) for ICAM-1, VCAM-1, E-selectin or in pg/10 4 cells for MCP-1 

and represent mean values ± SD of 3 different experiments. Post hoc analyses indicated 

significant differences between IL-33 stimulations and controls for each molecule but no 

significant differences between IL-33 stimulations in the presence and absence of the MEK 

inhibitor U0126 or the PI3K inhibitor LY-294002. The overall ANOVA was not affected by 

correction for 4 comparisons. 



Supplemental Figure I 

A 

C 

ICAM-1 (MFI) 

E-selectin (MFI) 

2000 

1600 

1200 

800 

400 

0 

800 

600 

400 

200 

0 

Control 

Control 

IL-33 


IL-33 + ST2-Fc 


Supplemental Figure I. Soluble ST2 fusion protein (sST2-Fc) abolished IL-33 effects in 

human endothelial cells. IL-33 (1 ng/mL) was incubated with rh sST2-Fc (5 µg/mL) or with 

IgG1-Fc (5 µg/mL) for 15 min at 37°C before addition to confluent monolayers of HUVEC 

for 24 h (for ICAM-1, VCAM-1, MCP-1 determination) or 4 h (for E-selectin measurement). 

Cells were gently detached by detachment buffer and (A) ICAM-1, (B) VCAM-1 and (C) E- 

selectin expressions at the cell surface were measured by means of flow cytometry as 

described in “Methods” or (D) MCP-1 protein was determined in conditioned media by 

ELISA as described in “Methods”. Each experiment was performed in triplicates. (A, B, C) 

Values are given in mean fluorescence intensity (MFI) or (D) in pg/10 4 cells and represent 

mean values ± SD of 3 different experiments. The overall ANOVA for each tested molecule 

remained significant after correction for 4 comparisons. 

IL-33 + IgG 


ST2-Fc 

ST2-Fc 

IgG 

IgG 


http://atvb.ahajournals.org/ at Bibliothek der MedUniWien (IX0000096057) on September 2, 2011 

B 

D 

VCAM-1 (MFI) 

MCP-1 (pg/10 4 cells) 

400 

300 

200 

100 

0 

4000 

3000 

2000 

1000 

0 

Control 

Control 







ST2-Fc 

ST2-Fc 

IgG 

IgG

Supplemental Figure II 

A 

C 

ICAM-1 (x-fold control) 

E-selectin (x-fold control) 

200 

160 

120 

80 

40 

0 

1800 

1600 

1400 

1200 

1000 

800 

600 

400 

200 

0 

1h 3h 6h 9h 24h 

IL-33 (100 ng/mL) 

1h 3h 6h 9h 24h 


Supplemental Figure II. Effects of IL-33 on ICAM-1, VCAM-1, E-selectin and MCP-1 

mRNA expression by HUVEC. Confluent monolayers of HUVEC were incubated for 1, 3, 

6, 9 or 24 h in the absence or presence of IL-33 (100 ng/mL). mRNA was prepared and 

RealTime-PCR with primers specific for (A) ICAM-1, (B) VCAM-1, (C) E-selectin or (D) 

MCP-1 was performed as described in “Methods”. Adhesion molecules and MCP-1 mRNA 

levels were normalized according to the respective GAPDH mRNA level. Each experiment 

was performed in triplicates. Values are given as x-fold of control, which was set as 1 and 

represent mean ± SD of 2 different experiments. The overall ANOVA for each tested 

molecule remained significant after correction for 4 comparisons. 

B 

D 

VCAM-1 (x-fold control) 

MCP-1 (x-fold control) 

500 

400 

300 

200 

100 

250 

200 

150 

100 

0 

50 

0 

1h 3h 6h 9h 24h 


1h 3h 6h 9h 24h 




Supplemental Figure III 

A 

C 

IL-4 (pg/mL) 

IL-10 (pg/mL) 

16 

12 

8 

4 

0 

16 

12 

8 

4 

0 

Control 4h 

Control 4h 

IL-33 4h 


Control 16h 

Control 16h 

Supplemental Figure III. IL-33 did not modulate Th2 and T regulatory cytokines in 

HCAEC. Confluent monolayers of HCAEC were incubated for 4, 16, or 24 h in the absence 

or presence of IL-33 (100 ng/mL). Supernatants were processed per manufacturer`s 

instruction as described in "Methods". (A) IL-4, (B) IL-5 and (C) IL-10 were measured by 

means of flow cytometry. Each experiment was performed in triplicates. Values are given in 

pg/mL and represent mean values ± SD of 3 different experiments. The overall ANOVA for 

each tested molecule was ≥0.05. 



Control 24h 

Control 24h 




http://atvb.ahajournals.org/ at Bibliothek der MedUniWien (IX0000096057) on September 2, 2011 

B 

IL-5 (pg/mL) 

6 

4 

2 

0 

Control 4h 


Control 16h 


Control 24h 

IL-33 24h

Interleukin-33 Induces Expression of Adhesion Molecules and ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?