Development of marker-free transgenic sorghum ... - Plant Sciences

Plant Cell Tiss Organ Cult (2009) 99:97–108DOI 10.1007/s11240-009-9580-4ORIGINAL PAPERDevelopment of marker-free transgenic sorghum [Sorghumbicolor (L.) Moench] using standard binary vectors with baras a selectable markerLu Lu Æ Xingrong Wu Æ Xiaoyan Yin ÆJonathan Morrand Æ Xinlu Chen Æ William R. Folk ÆZhanyuan J. ZhangReceived: 19 February 2009 / Accepted: 24 July 2009 / Published online: 9 August 2009Ó Springer Science+Business Media B.V. 2009Abstract We report an Agrobacterium-mediated transformationsystem that can generate marker-free transgenicsorghum [Sorghum bicolor (L.) Moench] from a public line[P898012] using standard binary vectors with bar as aselectable marker. Eight co-cultivation conditions wereexamined for their effect on transformation. The averagetransformation frequencies were 0.4 and 0.7% for pZY101-TC2 and pZY101-SKRS, respectively, derived from binaryvector pZY102 and containing bar and target gene(s) inseparate T-DNA regions. A low selection pressure(2.5 mg l -1 DL-phosphinothrithin, PPT) was deployedduring callus induction in combination with rapid selectionto generate plants from 80 independent events, all but threeof which were fertile and set seed. PCR and Southernanalyses showed that 36 out of 80 events contained bothbar and the target gene(s) (an average co-transformationfrequency of 45%). Seedlings of the T1 generation transmittedT-DNAs with target gene(s) and bar gene independently,generating a fraction of progeny with only thetarget gene(s).L. Lu X. Wu J. Morrand W. R. FolkDepartment of Biochemistry, University of Missouri,Columbia, MO 65211, USAX. Yin X. Chen Z. J. Zhang (&)Plant Transformation Core Facility, Division of Plant Sciences,University of Missouri, 1-31 Agriculture Building,Columbia, MO 65211, USAe-mail: zhangzh@missouri.eduPresent Address:X. WuEdenspace System Corporation, 1500 Hayes Drive,Manhattan, KS 66502-5068, USAKeywords Sorghum bicolor Agrobacterium bar Binary vector Marker-free TransformationIntroductionMicroprojectile bombardment and Agrobacteriumtumefaciens-mediated DNA delivery are the primary methodsused for sorghum transformation. Casas et al. (1993,1997) first reported regenerated transgenic sorghum plantsvia particle bombardment. Thereafter, several laboratories(Zhu et al. 1998; Able 1998; Able et al. 2001; Emani et al.2002; Tadesse et al. 2003; Girijashankar et al. 2005)reported utilizing particle bombardment to deliver genes ofinterest into sorghum; however, the low transformationefficiency and tendency to introduce multiple copies representserious impediments to the development of plantsintended for breeding programs. A. tumefaciens-mediatedtransformation of sorghum was first reported by Zhao et al.(2000) employing ‘‘super-binary’’ vectors with bar as aselectable marker. This approach achieved an averagetransformation efficiency of 2.1% with the introduction ofthe high-lysine protein gene HT12 through two unlinkedT-DNA cassettes, leading to marker-free transgenic sorghumprogeny in one of five co-transformed events (Zhao et al.2003). Subsequently, other selectable marker genes havebeen used in sorghum transformation: Carvalho et al.(2004) developed three transgenic sorghum events throughthe use of a ‘‘super-binary’’ vector with hpt (hygromycinphosphotransferase gene) as a selectable marker. Howeet al. (2006) reported 37 transgenic events generated fromtwo sorghum genotypes, with frequencies ranging from 0.3to 4.5% using npt II as a selectable marker and an A.tumefaciens strain carrying disarmed Ti plasmidpTiKPSF2. Nguyen et al. (2007) recovered 15 transgenic123

98 Plant Cell Tiss Organ Cult (2009) 99:97–108sorghum events from 300 immature embryos using animproved protocol employing a standard binary vector(with hpt as the selectable marker), cold pre-treatedimmature embryos and activated charcoal. Four additionalstudies (Gurel et al. 2009; Jeoung et al. 2002; Gao et al.2005a, b) used positive selectable markers (i.e. the Escherichiacoli phosphomannose isomerase (pmi) gene and thegreen fluorescent protein gene (gfp). Recently, heat treatmentof immature embryos prior to infection with A.tumefaciens has been used (Gurel et al. 2009).Although each of these studies has contributed to sorghumtransformation, none have enabled production oflarge numbers of marker-free transgenic sorghum plantsusing standard binary vectors. In the present study, wedescribe the use of standard binary vectors with bar as aselectable marker and the sorghum public line P898012 toestablish a rapid and reproducible A. tumefaciens-mediatedtransformation system that generates large numbers oftransgenic sorghum events and marker-free progeny insegregating generations.Materials and methodsVectors and bacterial strainsThe binary vector pZY102 with the GUS-intron gene(Zeng et al. 2004) (http://plantsci.missouri.edu/muptcf/pzy101.html) was used to evaluate transformation parameters.Two vectors containing an altered tRNA lys and asorghum lysyl tRNA synthetase (Wu et al. unpublished)were also constructed and employed: the pBluescript vectorwas digested with KpnI and Ecl136II to remove theKpnI and Ecl136II (SacI) sites. Each fragment was ligatedwith an adaptor incorporating two ScaI sites and a singleBglII site, respectively, to generate the shuttle vector, SBSpBS.An intermediate binary vector, Bin19(-), was firstgenerated by removing a 2,047-bp fragment between Pme Iand ClaI sites from Bin19 vector (Frisch et al. 1995). Thetwo restriction sites were then filled in with Klenowpolymerase fragment and ligated and inserted into the BglIIsite of SBS-pBS, generating pSBS19(-). The altered tRNAgene (TC2) or sorghum lysyl tRNA synthetase (SKRS)gene fragments were inserted into the HindIII-KpnI siteof SBS19(-), generating SBS-TC2 and SBS19-SKRS,respectively. The ScaI fragment from SBS-TC2 or SBS19-SKRS containing T-DNA left and right border region wasthen inserted into the Sca I site of the standard binaryvector pZY101(Vega et al. 2008) that contains the bar geneas a selectable marker to generate vectors pZY101-TC2(Fig. 1a) and pZY101-SKRS (Fig. 1b), respectively. Thethree vectors, pZY102, pZY101-TC2 and pZY101-SKRSwere mobilized into A. tumefaciens strain EHA101(Hood et al. 1986) and their integrity within A. tumefacienswas confirmed by restriction enzyme digestion.Plant materialsThe public sorghum line P898012 was used for all transformationexperiments. All plants (except for those used inexperiments L73-L79, which were grown in the field duringthe summer) were grown in greenhouses at the Universityof Missouri, Columbia, Missouri, with day/nighttemperatures of 26/21°C, a photoperiod of 16 h light/8 hdark, in 3-gal pots containing Promix soil mixed with 2 oz.of Osmocote (14-14-14). About 32–35 days after planting,2 oz. of iron sulfate and 2 oz. of Osmocote (18-6-12) weremixed with the top portion of the soil of each pot; the soilmoisture and plants were checked daily and watered asneeded. Embryos were isolated from immature panicles,11–14 days after pollination.TransformationThe procedure reported here is based on the work of Zhaoet al. (2000) and Cai et al. (2002). Table 1 summarizesthe general procedure, cultivation periods and formulationof the media. A key modification was the use of lowlevels of glufosinate-ammonium (DL-phosphinothrithin,PPT, Aventis CropScience) at a concentration of2.5 mg l -1 in combination with a shortened selectionperiod (4–8 weeks). Other modifications included: (1) cocultivationmedium (TM) was overlaid with a piece ofsterile filter paper, (2) reduction of MS salts to 2.15 g l -1in the infection medium (IM) and TM, (3) addition ofPVPP to final concentrations of 1 or 0.5% in all mediumpreparation, with the exception of IM, (4) Trans-Zeatinribosidesubstitution for zeatin in shooting medium (SM),(5) elimination of selection agent in SM, and (6) no useof PHI-V (extended selection medium, CM with PPT10 mg l -1 , instead) or PHI-W (regeneration medium, CMsupplemented with kinetin 0.5 mg l -1 ; Zhao et al. 2000).Briefly, A. tumefaciens strain EHA101 harboring standardbinary vector was clonally isolated from a -80°C glycerolstock onto an AB minimal medium (Chilton et al.1974) plate containing appropriate antibiotics. The platewas incubated at 28°C for 3 days until single coloniesdeveloped. This master plate was used on a weekly basisfor up to a month. For the inoculation, a single colonywas streaked out onto YEP (5 g l -1 yeast extract,10 g l -1 peptone, 5 g l -1 NaCl, and pH 7.0) containingthe same antibiotics as the AB plate. The YEP plate wasthen incubated at 20°C for 2–3 days until bacterial coloniesdeveloped fully. A. tumefaciens colonies were thentaken from the YEP plate, suspended in 5 ml of IM123

Plant Cell Tiss Organ Cult (2009) 99:97–108 99Fig. 1 Schematic presentation of the T-DNA of the transformationconstructs pZY101-TC2 (a) and pZY101-SKRS (b). RB and LB,T-DNA right and left borders; Tvsp soybean vegetative storageprotein gene terminator; bar bialaphos resistance gene; TEV-35S,CaMV35S promoter with upstream tobacco etch virus (TEV)translational enhancer; 5606-7388 of Bgl II, the Bgl II fragment frombinary vector Bin19(-); tRNA Lys (CUG) (UUG): Arabidopisis thalianatRNA Lys (CTG) (TTG) gene sequence; CZ19 B1, maize 19KDazein; SKRS, sorghum lysyl tRNA synthetase gene sequence with Flagepitope added for affinity chromatographyTable 1 Procedure, cultivation period and medium formulationsProcedure Media CultureperiodMedium formulationsInfection IM 5 min MS salts 2.15 g l -1 ; nicotinic acid 0.5 mg l -1 ; pyridoxine HCl 0.5 mg l -1 ; thiamine HCl 1.0 mg l -1 ;myo-inositol 0.10 g l -1 ; vitamin assay casamino acids 1.0 g l -1 ; 2,4-D 1.5 mg l -1 ; sucrose68.5 g l -1 ; glucose 36.0 g l -1 ; acetosyringone 100 lM added before use; adjust pH to 5.2 w/KOHand filter-sterilizeCo-cultivation TM 3–5 days MS salts 2.15 g l -1 ; MES 0.50 g l -1 ; L-proline 0.70 g l -1 ; nicotinic acid 0.50 mg l -1 ; pyridoxineHCl 0.50 mg l -1 ; thiamine HCl 1.0 mg l -1 ; myo-inositol 0.1 g l -1 ; ascorbic acid 10 mg l -1 ; 2,4-D1.5 mg l -1 ; sucrose 20.0 g l -1 ; glucose 10.0 g l -1 ; PVPP 10.0 g l -1 ; agar 8.0 g l -1 , and;acetosyringone 100 lM added before use; pH 5.8Resting RM 4 days MS salts 4.3 g l -1 ; MES 0.50 g l -1 ; nicotinic acid 0.50 mg l -1 ; pyridoxine HCl 0.50 mg l -1 ;thiamine HCl 1.0 mg l -1 ; myo-inositol 0.1 g l -1 ; ascorbic acid 10 mg l -1 ; asparagines 150 mg l -1 ;coconut water 100 ml l -1 ; 2,4-D 2.0 mg l -1 ; sucrose 30.0 g l -1 ; carbenicillin 100 mg l -1 ;PVPP 10.0 g l -1 ; Phytagel TM 2.5 g l -1 ; pH 5.8Callus induction CM 4–8 weeks MS salts 4.3 g l -1 ; MES 0.50 g l -1 ; nicotinic acid 0.50 mg l -1 ; pyridoxine HCl 0.50 mg l -1 ;thiamine HCl 1.0 mg l -1 ; myo-inositol 0.1 g l -1 ; 2,4-D 1.5 mg l -1 ; sucrose 30.0 g l -1 ; carbenicillin100 mg l -1 ; glufosinate-ammonium 2.5 mg l -1 ; PVPP 10.0 g l -1 ; Phytagel TM 2.5 g l -1 ; pH 5.8Shooting SM 2–8 weeks MS salts 4.3 g l -1 ; myo-inositol 0.1 g l -1 ; nicotinic acid 0.5 mg l -1 , thiamine HCl 0.1 mg l -1 ,pyridoxine. HCl 0.5 mg l -1 , glycine 2.0 mg l -1 , zeatin-riboside 0.5 mg l -1 , sucrose 60.0 g l -1 ,IAA 1.0 mg l -1 , ABA 0.1 lM; carbenicillin 100 mg l -1 ; TDZ 0.1 mg l -1 ; PVPP 10.0 g l -1 ;agar 8.0 g l -1 ; pH 5.6Rooting ZM 2–4 weeks MS salts 2.15 g l -1 ; myo-inositol 0.1 g l -1 ; thiamine HCl 0.1 mg l -1 , pyridoxine HCl 0.5 mg l -1 ;glycine 2.0 mg l -1 , nicotinic acid 0.5 mg l -1 ; sucrose 20.0 g l -1 ; Phytagel TM 2.5 g l -1 ;PVPP 5.0 g l -1 ; pH 5.6MS salt and vitamins are described as Murashige and Skoog (1962); acetosyringone, 3 0 ,5 0 -dimethoxy-4 0 -hydroxyacetophenone; 2,4-D, 2,4-dichlorophenoxyacetic acid. All media and chemicals were purchased from Sigma–Aldrich (St Louis, MO, USA)DTT dithiothreitol, IAA indoleacetic acid, ABA abscisic acid, TDZ thidiazuron, PVPP polyvinylpolypyrrolidonemedium (in a 15 ml tube) with cell density ofOD 550 = 0.3–0.4, used to inoculate sorghum immatureembryos for 5 min. The embryos were then transferredonto the top of filter paper placed over the TM withscutella facing up. The plates were wrapped with parafilmand incubated at 25°C in the dark for 3–5 days,depending on the severity of browning of the embryos(Fig. 2a).123

100 Plant Cell Tiss Organ Cult (2009) 99:97–108Fig. 2 Sorghum transformation, plantlet regeneration, GUS assayand leaf-painting analysis of transgenic events. a Embryos wereco-cultivated with Agrobacterium on TM for 3–5 days; b Resting onRM for additional 4 days; c Callus induction under selection pressure,herbicide-tolerance calli developed from some embryos on CM;d Shoot formation on SM; e After 2–3 weeks of being transferredonto ZM, shoots began rooting; f and g Putative transgenic plants (youngand adult) were in greenhouse; h GUS assay of embryogenic calli;i leaf painting showing susceptible response of wild-type leaves (lefttwo leaf strips) and resistance of transgenic leaves (right two strips)The embryos were transferred onto resting medium(RM) for another 4 days at 28°C in the dark (Fig. 2b) andthen transferred weekly onto freshly made callus inductionmedium (CM) with PPT 2.5 mg l -1 , incubated at 28°C for4–8 weeks (Fig. 2c). Herbicide-tolerant calli can be maintainedon CM, but untransformed calli eventually die. Oncesomatic embryogenic cells developed from transformedcalli, they were transferred onto shooting medium (SM)(Fig. 2d). Shoots (2–5 cm long) were separated and transferredinto plastic boxes (898910 cm) containing rootingmedium (ZM), and maintained at 25°C under a photoperiodof 16 h light and 8 h dark; the shoots later developed into8–10 cm tall plantlets with healthy roots (Fig. 2e). Theywere then transferred into pots containing Promix soil mixedwith Osmocote (18-6-12) in the greenhouse (Fig. 2f and g).GUS assay and leaf painting using libertyÒTo verify the expression of GUS gene, calli and plant tissueswere assayed with histochemical X-Gluc staining at 37°Cfor 24 h (Fig. 2h; Jefferson et al. 1987). The X-Gluc solutionfor staining target tissues contained: 0.1 M NaPO 4 ,pH7.0; 1.0 mM K 3 [Fe(CN) 6 ]; 10 mM EDTA; 2 mM X-Gluc;0.1% (v/v) Triton-100; 20% (v/v) methanol anhydrate.123

Plant Cell Tiss Organ Cult (2009) 99:97–108 101To confirm the functional expression of the bar gene,500 mg l -1 Liberty Ò was applied with a cotton applicatoronto the leaves of young plants (with 4–5 leaves) grown ina growth chamber at day/night temperatures 26/21°C and aphotoperiod of 16 h light/8 h dark. Plants that did notexhibit necrosis at 5 days were scored as herbicide resistant(Fig. 2i).Polymerase chain reaction analysisPCR analysis was used for quick screening of the presenceof trans-genes in all T0 and randomly chosen T1 generations.Young healthy leaf tissue was collected from herbicideresistant plantlets that had been transferred into soil.RED-Extract-N-AmpTM Plant PCR Kit (Sigma) was usedfor DNA extraction and amplification. The primer pairs forPCR were: for bar gene, forward (fwd)-bar (5 0 GTCTGCACCATCGTCAACC) and reverse (rev)-bar (5 0 GAAGTCCAGCTGCCAGAAAC); for tRNA lys , fwd-tRNA (5 0 CCGCATGCATGTATAAGTGTGTCGGAACTGG) and trev-RNA (5 0 TGCTGCAGGTTTGACTAACTAACGGGGTTGTTG); for the SKRS gene, three pairs of primers for promoter,coding and terminator regions of SKRS gene,respectively, were used for screening; pair 1, fwd-CZ19-565 (5 0 TGTGGACAATACCGAGAGGA) and rev-flag (5 0CATGATGCTTGTCATCGTCGTCCTTGTAGTC); pair2: fwd-flag (5 0 CATGGACTACAAGGACGACGATGACAAGCAT) and rev-E12-418 (5 0 TGTAAGCTTCTCCCCATTGC); pair 3, fwd-CZ19-5(5 0 ATACTGCAGTTGCCTCCTTATGCTCCTTG) and rev-CZ19-3 (5 0 ATGCGGCCGCGAATTCGATTCTTCCCATTTC. Thermal cycling conditionsincluded 45 s at 94°C for denaturalization, 1 min at58°C for annealing and 1 min at 72°C for extension with29 cycles.Southern blot analysisSouthern blot analysis (Southern 1975) was used to confirmthe integration and stable inheritance of transgene inserts.Genomic DNA was extracted from sorghum leaf tissuesusing a modified CTAB-based protocol (Dellaporta et al.1983). Twenty-five microgram of DNA were digested witha single restriction enzyme, which cuts once within one ortwo T-DNA regions, dependent on the T-DNA regions thattransgenic events carried. The digested genomic DNA wasfractionated on a 1.0% agarose gel prior to transfer to aZeta-ProbeÒ GT nylon membrane (Bio-Rad, CA, USA).DNA was fixed to the membrane by UV cross-linking.Hybridization and washing conditions followed the Zeta-ProbeÒ GT manufacturer’s instructions and were at 65°C.The bar-TEV (from vector pZY101) and TC2 or SKRS(genes of interest) were used to generate a 32 P-labeledprobe by random primer synthesis incorporating 32 P-dATPutilizing the Prime-it Ò II kit (Stratagene, USA).Statistical analysisThe SAS (version 9.1) GLM (General Linear Model)program was used for variance analysis. Mean comparisonswere made using LSD at a = 0.01 level. The 2 -test wasused to test the goodness-of-fit of progeny segregation.Transformation frequency (%) was determined by thenumber of independent fertile transgenic sorghum eventsdivided by the total number of embryos inoculated. Eachindependent event was defined by its herbicide resistanceand PCR-positive plants whose transgene integrations andtransmittance were further confirmed by different bandingpatterns in Southern blot analysis and by a segregationanalysis using PCR, respectively. The frequency of independentcallus lines was calculated by the number of herbicideresistant callus lines obtained from differentembryos divided by the total number of embryosinoculated.ResultsTransformation with pZY102High quality immature embryos were harvested from plantsgrown with a modified greenhouse care procedure thatrequired little labor and which provided consistent plantmaterials (see ‘‘Materials and methods’’). A. tumefaciensstrain EHA101 carrying a standard binary vector (pZY102),which harbors the bar gene as a plant selectable marker andthe GUS-intron gene as a reporter, was used to evaluatetransformation parameters. Several different co-cultivationconditions were tested for improvement of T-DNA delivery(Table 2). These conditions included: Treatments I-3 and I-5, TM combined with 3 and 5 days co-cultivation periods,respectively; II-3 and II-5, TM supplemented with L-cysteine(0.40 g l -1 ) and DTT (0.31 g l -1 ) and co-cultivationfor 3 or 5 days; III-3, and III-5, TM supplemented withPVPP (10 g l -1 ) combined with co-cultivation periods of 3and 5 days; IV-3 and IV-5, TM supplemented with L-cysteine(0.40 g l -1 , DTT 0.31 g l -1 ) and PVPP (10 g l -1 ), forco-cultivation periods of 3 and 5 days. Following selection,a total of 104 herbicide-tolerant callus lines that expressedGUS were obtained. Frequencies of callus lines obtained atthis stage ranged from 0.21 to 4.55%. Treatment III-5exhibited the highest efficiency, followed by treatments I-3,III-3, and I-5.Statistical analysis indicates that treatments I and III aresuperior to treatments II and IV, at either 3 or 5 days.Taking into consideration that browning happened during123

Plant Cell Tiss Organ Cult (2009) 99:97–108 103Table 3 Transformation with pZY101-TC2ExperimentcodeNumber ofembryosinoculated(NE)Number ofindependentcallus lines (NC)Frequency ofindependent calluslines (NC/NE) (%)Number of independent calluslines regenerating at least oneshoot (NS)Number ofindependent eventsin greenhouse (NP)Transformationefficiency (NP/NE) (%)L22 241 2 0.8 1 1 0.4L23 687 20 2.9 3 3 0.4L73 250 6 2.4 1 1 0.4L77 176 11 6.3 2 1 0.6Total 1,354 39 2.9 7 6 0.4Table 4 Transformation with pZY101-SKRSExperimentcodeNumber ofembryosinoculatedNumber ofindependent calluslines (NC)Frequency of independentcallus lines (NC/NE) (%)Number ofindependentshoots (NS)Number ofindependent plantlines (NP)Transformationfrequency (NP/NE)(%)L25 403 11 2.7 4 2 0.5L31 308 13 4.2 5 4 1.3L36 351 3 0.9 2 1 0.3L41 1,133 8 0.7 2 2 0.2L42 774 6 0.8 2 1 0.1L49 560 10 1.8 1 1 0.2L50 543 10 1.8 3 2 0.4L51 490 5 1.0 1 1 0.2L57 355 2 0.6 2 1 0.3L58 231 1 0.4 1 1 0.4L61 1,166 78 6.7 45 39 3.3L62 1,103 2 0.2 2 2 0.2L63 423 2 0.5 1 1 0.2L73 327 6 1.8 1 1 0.3L74 245 6 2.4 1 1 0.4L75 403 19 4.7 3 3 0.7L77 172 16 9.3 5 4 2.3L79 140 2 1.4 2 1 0.7L81 280 15 5.4 4 4 1.4L82 284 9 3.2 1 1 0.4L84 266 12 4.5 1 1 0.4Total 9,957 236 2.4 89 74 0.7containing pZY102 displayed blue or dark blue color, butcontrol (calli developed from embryos which were treatedwith IM only instead of A. tumefaciens suspension andthen transferred onto CM without PPT) did not displayGUS staining. Leaf painting results exhibited that allplants of 80 putative transgenic events were resistant toLibertyÒ. The painted areas of the putative transgenicplants faded slightly or without any symptom, butnecrosis occurred with all non-transgenic controls (Fig. 2hand i).Molecular analysis of T0 transgenic plantsAll of the regenerated T0 plants were transplanted to thegreenhouse for seed maturation. The presence of bar andtRNA lys or SKRS genes in the transgenic plants was confirmedby PCR with specific primers. For plants transformedwith pZY101-SKRS, initial PCR screening of thebar gene was carried out with primer pair 1, and thenpositive samples were further screened with other twoprimer pairs to confirm the integrity of SKRS gene.123

104 Plant Cell Tiss Organ Cult (2009) 99:97–108Random samples of these PCR-positive plants were thensubject to Southern analysis. PCR screening of all herbicide-tolerantplants indicated that all regenerated plantscontained the bar gene, a result that was consistent withthose of leaf-painting. This result clearly showed that thereis no escape regardless of herbicide selection schemes.The genomic DNAs of primary transgenic plants (T0)for the Southern blot were digested with Xho I, which cutsonly once within the T-DNA region; thus, the number offragments detected on a Southern blot represents distinctinsertion events and the number of T-DNA insertion loci(Fig. 3a). Eight of the nine randomly sampled eventscontained a single insertion of T-DNA, and one eventcontained multiple insertions. Lanes 6123H, G, and Fappear to represent an identical event, since they exhibitthe same banding pattern.Among the total 80 regenerated independent events thatwe developed, 4 of 6 showed integration of both bar andTC2 and 32 out of 74 showed the integration of both barand SKRS genes in their genomes, with the co-transformationratios of 66.7 and 43.2%, respectively, for anaverage of 45%.Segregation analysis of T1 generationTo confirm stable inheritance and normal segregation oftransgenes and to obtain marker-free transgenic progenyplants from the primary transgenic events, seedlings ofself-pollinated T1 plants from randomly-selected differentT0 events were subjected to Southern blot analysis usingthe gene of interest (TC2 or SKRS) and bar as probes,respectively.TC2 transgenics: Fig. 3b showed Southern blot on threerandomly-selected T1 plants representing three differentevents (2202-3, 2301-1, and 2315-1) and one set of sixprogeny (T1) plants of random event 7706A. The genomicDNA was digested with HindIII which cut only once withinthe first and second T-DNA regions, respectively (Fig. 1a),allowing identification of different and the number ofinsertion sites. The membrane was first hybridized withTC2 probe (KpnI/HindIII fragment; Fig. 3b, top). Thisprobe is expected to hybridize once within the secondT-DNA region. Clearly, all progeny plants except for7706A-3 and 7706A-4 carried TC2 gene with 1–4 insertionsites. The absence of the TC2 gene in 7706A-3 and 7706A-4plants suggested that they are null due to the segregation.The weak bands at around 6.6 and 9.4 kb across all samplesare likely the sorghum genome endogenous sequencessharing certain degree of homology with the TC2 gene,whereas the shifted band locations around these molecularweights indicated the heterogeneous nature of the genomeof this sorghum variety used in transformation. The samemembrane was then stripped and re-probed with bar-TEV(as a XhoI/KpnI fragment) sequence which is expected tohybridize once within the first T-DNA region (Fig. 3b,bottom). Apparently, the absence of band in plants 7706A-2and 7706A-4 suggested that they are marker-free transgenicsince they carry TC2 gene as shown by TC2 probe.The weak band at around 6.6 kb is genome endogenoussequences sharing some homology with bar-TEV probe. Itis also obvious that in most transgenic plant samples theinsertion sites of TC2 and bar cassettes are different,suggesting the independent integration and segregation ofthese two genes located at separate T-DNA regions.SKRS transgenics: The same Southern approach usedfor TC2 was applied to the analysis of 6 randomly-selectedT1 plants derived from six different events and one set ofsix progeny plants of event 3601 (Fig. 3c). The genomicDNA was digested with Sac I which cut once within firstand second T-DNA regions, separately (Fig. 1b). Themembrane was first hybridized with SKRS probe (as SacI/NcoI fragment; Fig. 3c, top). All plants except for 3103-4and 6169-2 carry SKRS gene with 1–4 insertion sites.Plants 3103-4 and 6169-2 are apparently null because ofthe segregation. The two strong bands at around 9 and23 bp across all samples suggested a high degree ofhomology of sorghum genomic endogenous sequenceswith the probe. To determine if the bar gene is absent fromany of these plants, the membrane was stripped andhybridized with bar-TEV sequence (Fig. 3c, bottom).Cleary, no marker-free transgenic plants was detected inthis group.PCR screen: To analyze a larger number of samples,seven randomly-selected independent events were examinedby PCR analysis. Figure 4 shows such a PCR analysisusing progeny (T1) plants from T0 event 2202 of pZY101-TC2 as an example. Of the 15 progeny plants (T1) of this T0event, plants 3, 8, 9, 10, 12, 13, and 14 did not segregate inthe T1 generation, plants 1, 5, 6, 7, and 15 segregated foreither bar or tRNA Lys (TC2), and plants 2 and 11 were null.Tables 5 and 6 summarize the segregation data for thetransgenic events carrying the TC2 or SKRS genes,respectively. Three of four independent events exhibited theexpected Mendelian independent segregation ratio of9:3:3:1 for two separate T-DNA insertions of bar and SKRS,and two of three events with independent segregations of barand tRNA lys , and each of these events led to marker-freeprogeny at an average of 3/16. The rest two events inheritedmarker gene and gene(s) of interest in a linkage manner only.DiscussionUsing standard binary vectors, we have developed a rapidand reproducible procedure that yields marker-free transgenicsorghum plants upon segregation. Our method123

Plant Cell Tiss Organ Cult (2009) 99:97–108 105Fig. 3 Southern blot analyses of genomic DNAs from primaryputative transgenic sorghum plants and progeny. a k/HindIII,k/HindIII DNA ladders; 30 and 90 pg, plasmid pZY101- SKRS ashybridization sensitivity and 19 sorghum genome equivalent copynumber control, respectively; WT wild type sorghum; 5010F to6168E, putative primary transgenic events. The 6123H, G, and F werefrom three plants of the same events. Genomic DNA of each sampleas well as the plasmid control DNA were digested with restrictionenzyme XhoI and the membrane was probed with the bar-TEV. b WTwild type sorghum; 2202-3 to 7706A-6, progeny plants of T0 TC2events. Genomic as well as plasmid control DNA was digested withk/HindIII and membrane was probed with TC2 probe (top) orbar-TEV probe (bottom); 19 and 59, 1 and 5 copy genome equivalentcopy number controls using 22 and 110 pg of pZY101-TC2 plasmid,respectively. c WT wild type; 3103-4 to 3601-6, progeny of T0 SKRSevents. Genomic as well as plasmid control DNA was digested withSac I and membrane was probed with SKRS probe (top) orbar-TEVprobe (bottom); 19, 1 copy genome equivalent control using 22 pg ofplasmid SBS19-SKRStherefore improves upon previous transformation methods(Zhao et al. 2000; Cai et al. 2002). An important modificationis the use of PPT at a low concentration (2.5 l -1instead of 5 or 10 mg l -1 ) and a short selection period(4–8 weeks instead of 10–14 weeks) in callus inductionmedium; the procedure also eliminates the selection pressurefrom the shooting medium. In our experiments, highlevels of PPT (5 mg l -1 or 10 mg l -1 ) accelerated productionof phenolic compounds and embryo browning andprevented recovery of transgenic sorghum. The eliminationof PPT from the shooting medium was found to be criticalfor ensuring survival and regeneration of putatively transgenicembryogenic calli. In addition, the decreased durationof selection (4–8 weeks) favors the recovery oftransgenic shoots. This selection period is thus shorter thanthose previously developed for sorghum transformation(Zhao et al. 2000; Cai et al. 2002; Carvalho et al. 2004;Howe et al. 2006).There was no significant difference between a 3-day(I-3) and 5-day (I-5) cocultivation period, although the meanvalue of the latter was higher than the former (Table 2).Addition of antioxidants L-cysteine and DTT (II-3 and II-5)123

106 Plant Cell Tiss Organ Cult (2009) 99:97–108Fig. 4 PCR analysis of T1 sorghum lines showing segregation forbar and tRNA transgenes, respectively. T0 primary event 2202 ofpZY101-TC2; WT wild type; lane numbers 1–15, progeny plants (T1)of the T0 event 2202. Note that plants 3, 8, 9, 10, 12, 13, and 14 arenon-segregated T1, plants 1, 5, 6, 7, and 15 are segregated for eitherbar or tRNA Lys , and plants 2 and 11 are nullcaused significantly reduced transformation as comparedwith I-3 and I-5 treatments (a = 0.01). This negative impactof antioxidants sharply contrasts the positive effects reportedfor maize transformation (Lee et al. 2007; Vega et al.2008). However, PVPP added to culture media was found tobenefit transformation frequency (III-3 and III-5). Apparently,necrosis and browning during the culturing process isdetrimental to both regeneration and transformation. Wealso found that PVPP was superior to PVP in preventingbrowning (data not shown).For sorghum line P898012, it has been reported thattransformation frequencies with field-grown embryos weresignificantly higher than those using greenhouse-grownembryos (Zhao et al. 2000), a characteristic that might berelated to donor plant growth conditions (Carvalho et al.2004). However, in our study the highest transformationefficiency obtained with construct pZY101-SKRS was withgreenhouse-grown embryos. Also, we observed a substantialvariation in transformation frequency among similartreatment conditions, a phenomenon that has beenobserved with other sorghum genotypes (Howe et al.2006). The transformation frequency with P898012embryos harvested from Columbia, Missouri, differedsignificantly from the transformation frequency forembryos harvested in Johnson, Iowa, irrespective of the useof super binary vectors and the same transformation protocol(Zhao Y.Z., personal communication), indicating yetto-be-determinedfeature(s) of the embryos which isimportant for producing transgenic sorghum plants at aconsistently high transformation rate.The first T-DNA used in our transformation contains bargene expression cassette for transgenic recovery of sorghumwhereas the second T-DNA carried a modifiedtRNA lys and sorghum lys1 tRNA synthase elements (TC2or SKRS) for improving lysine content in sorghum seeds(Wu et al. 2007). The co-transformation rates of the twoT-DNA regions seem to vary between the vectors pZY101-TC2 and pZY101-SKRS (66.7 and 43.2%, respectively).However, more number of transformation experimentswould be necessary to determine if this difference is real.Large frequency variances between NC/NE and NP/NEalso occurred with both vectors containing target genes,although a modified SM recipe was used in which PPT wasomitted. The average frequency at the putatively transformedcallus level was 2.9%; it was 0.4% at the T0 plantlevel with vector pZY101-TC2. This indicates that only15% putatively transgenic callus lines regenerated putativetransgenic plantlets (Table 3). With pZY101-SKRS, about29% putative transgenic callus lines regenerated putativelytransgenic plantlets (Table 4). These data imply non-uniformqualities among the herbicide-tolerance callus lines,which arise from either the donor plant or the transgenes.Table 5 Transgenes segregation in progeny (T1) of transgenic sorghum with tRNAlysT0eventsBar?/TC2?T1 Bar TC2Bar?/TC2?Bar?/TC2-Bar-/TC2?Bar-/TC2-v 2(9:3:3:1)P-valuePresence Absence v 2(3:1)P-valuePresence Absence v 2(3:1)P-value2202 16 4 1 4 7.07 0.07 20 5 0.33 0.56 17 8 0.65 0.422301 12 5 5 4 3.95 0.27 17 9 1.28 0.26 17 9 1.28 0.262315 24 0 0 1 n/a n/a 24 1 5.88 0.02 24 1 5.88 0.02Table 6 Transgenes segregation in progeny (T1) of transgenic sorghum with SKRST0 events T1 Bar SKRSBar?/SKRS?Bar?/SKRS?Bar?/SKRS-Bar-/SKRS?Bar-/SKRSv2(9:3:3:1)P-valuePresence Absence v 2(3:1)P-valuePresence Absence v 2(3:1)P-value2506 14 7 2 2 2.80 0.420 21 4 1.08 0.30 16 9 1.61 0.203105 12 3 4 6 13.61 0.004 15 10 2.34 0.13 16 9 1.61 0.204101 17 0 0 9 n/a n/a 17 9 1.28 0.26 17 9 1.28 0.265008 15 6 3 1 1.24 0.740 21 4 1.08 0.30 18 7 0.11 0.74123

Plant Cell Tiss Organ Cult (2009) 99:97–108 107Albino plantlets were detected at a rate of approximately1% after the recovered shoots were moved onto ZM andtransferred to growth chamber with illumination; somerecovered shoots did not readily develop roots. Thesedefects contributed to a lower transformation frequency(NP/NE).The data from progeny segregation analysis revealedthat the majority of co-transformed events transmitted thetwo T-DNAs independently, regardless of the gene ofinterest. This observation suggests that the two T-DNAregions integrated into sorghum genomic loci distant fromeach other, thereby leading to independent segregation inT1 generation. The lack of marker-free transgenic progenyplants in one set of SKRS events may not necessarilyindicate that no marker-free events can be found. Rather,this suggests that a larger number of progeny plants mustbe analysed to identify marker-free transgenic plants. It isalso conceivable that multiple insertions, co-integration ora close link of bar with SKRS may lead to no marker-freein this particular event. This has been verified by PCRscreening (Tables 5, 6).Acknowledgments The authors thank: Scanlon S and other colleaguesfrom Dr. Folk’s lab for their assistance; Z. Zhao, N. Wang, S.Zheng and H. Cline (Pioneer Hi-Bred Intl. Inc.) for helpful suggestionsand for P898012 and Drs. G. Liang and Z. S. Gao (Kansas StateUniversity) for helpful comments; Aventis CropScience (ResearchTriangle Park, NC) for providing glufosinate-ammonium and LibertyÒas generous gifts; Dr. Seth D. Findley (University of Missouri,Columbia, MO) for critical review of the manuscript. All sorghumtransformation experiments were conducted in the Plant TransformationCore Facility at the University of Missouri. Financial supportwas provided by the University of Missouri Agricultural ExperimentStation, the Provost’s office and the University of Missouri Food forthe twenty-first Century Eminence Program.ReferencesAble JA (1998) Transformation of sorghum using the particle inflowgun (PIG). Int Sorghum Millets Newsl 39:98–100Able JA, Rathus C, Godwin ID (2001) The investigation of optimalbombardment parameters for transient and stable transgeneexpression in sorghum. In Vitro Cell Dev Biol-Plant 37:341–348Cai T, Pierce DA, Tagliani LA, Zhao ZY (2002) Agrobacteriummediated transformation of sorghum. US Patent 6369298Carvalho CHS, Zehr UB, Gunaratna N, Anderson JM, KononowiczHH, Hodges TK, Axtell JD (2004) Agrobacterium-mediatedtransformation of sorghum: factors that affect transformationefficiency. Genet Mol Biol 27:259–269Casas AM, Kononowicz AK, Zehr UB, Tomes DT, Axtell JD, ButlerLG, Bressan RA, Hasegawa PM (1993) Transgenic plants viamicroprojectile bombardment. Proc Natl Acad Sci USA90:11212–11216Casas AM, Kononowicz AK, Hann TG, Zhang L, Tomes DT, BressanRA, Hasegawa PM (1997) Transgenic plants obtained aftermicroprojectile bombardment of immature inflorescence. InVitro Cell Dev Biol-Plant 33:92–100Chilton MD, Currier TC, Farrand SK, Bendich AJ, Gordon MP,Nester EW (1974) Agrobacterium tumefaciens DNA and PS8bacteriophage DNA not detected in crown gall tumors. Proc NatlAcad Sci USA 71:3672–3676Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation:version 2. Plant Mol Biol Rep 1:19–22Emani C, Sunilkumar G, Rathore KS (2002) Transgene silencing andreactivation in sorghum. Plant Sci 162:181–192Folk WR (2003) How to improve plant protein quality: err on the sideof goodness. ISB News Rep (http://www.isb.vt.edu)Frisch DA, Harris-Haller LW, Yokubaitis NT, Thomas TL, HardinSH, Hall TC (1995) Complete sequence of the binary vector Bin19. Plant Mol Biol 27:405–409Gao ZS, Jararaj J, Muthukrishnan S, Claflin L, Liang GH (2005a)Efficient genetic transformation of Sorghum using a visualscreening marker. Genome 48:321–333Gao ZS, Xie X, Ling Y, Muthukrishnan S, Liang GH (2005b)Agrobacterium tumefaciens-mediated sorghum transformationusing a mannose selection system. Plant Biotechnol J 3:591–599Girijashankar V, Sharma HC, Sharma KK, Swathisree V, Prasad LS,Bhat BV, Royer M, Secundo BS, Narasu ML, Altosaar I,Seetharama N (2005) Development of transgenic sorghum forinsect resistance against the spotted stem borer (Chilo partellus).Plant Cell Rep 24:513–522Gurel S, Gurel E, Kaur R, Wong J, Meng L, Tan HQ, Lemaux PG(2009) Efficient, reproducible Agrobacterium-mediated transformationof sorghum using heat treatment of immature embryos.Plant Cell Rep 28:429–444Hood EE, Helmer GL, Fraley RT, Chilton MD (1986) Thehypervirulence of Agrobacterium tumefaciens A281 is encodedin a region of pTiBo542 outside of T-DNA. J Bacteriol168:1291–1301Howe A, Sato S, Dweikat I, Fromm M, Clemente TE (2006) Rapidand reproducible Agrobacterium-mediated transformation ofsorghum. Plant Cell Rep 25:784–791Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions:glucuronidase as a sensitive and versatile gene fusion marker inhigher plants. EMBO J 6:3901–3907Jeoung JM, Krishnaveni S, Muthukrishnan S, Trick HN, Liang GH(2002) Optimization of sorghum transformation parametersusing genes for green fluorescent protein and b-glucuronidaseas visual markers. Hereditas 137:20–28Lee BK, Kennon AR, Chen X, Jung TW, Ahn BO, Lee JY, Zhang Z(2007) Recovery of transgenic events from two highlyrecalcitrant maize (Zea mays L.) genotypes using Agrobacterium-mediatedstandard-binary-vector transformation. Maydica52:457–469Murashige T, Skoog F (1962) A revised medium for rapid growth andbioassays with tobacco tissue cultures. Physiol Plant 15:473–497Nguyen TV, Thu TT, Claeys M, Angenon G (2007) Agrobacteriummediatedtransformation of sorghum using an improved in vitroregeneration system. Plant Cell Tiss Organ Cult 91:155–164Southern EM (1975) Detection of specific sequences among DNAfragments separated by gel electrophoresis. J Mol Biol 98:503–517Tadesse Y, Sagi L, Swennen R, Jacobs M (2003) Optimization oftransformation condition and production of transgenic sorghum(Sorghum bicolor) via microparticle bombardment. Plant CellTissue Organ Cult 75:1–18Vega J, Yu W, Kennon A, Chen X, Zhang Z (2008) Improvement ofAgrobacterium-mediated transformation in Hi-II maize (Zeamays L.) using standard binary vectors. Plant Cell Rep 27:297–305Wu XR, Kenzior A, Wilmot D, Scanlon S, Chen Z, Topin A, He S,Acevedo A, Folk WR (2007) Altered expression of plant lysyl123

108 Plant Cell Tiss Organ Cult (2009) 99:97–108tRNA synthetase promotes tRNA misacylation and translationalrecoding of lysine. Plant J 50:627–636Zeng P, Vadnais D, Zhang Z, Polacco J (2004) Refined glufosinateselection in Agrobacterium-mediated transformation of soybean[Glycine max (L.) Merr.]. Plant Cell Rep 22:478–482Zhao ZY, Cai T, Tagliani L, Miller M, Wang N, Pang H,Rudert M, Schroeder S, Hondred D, Seltzer J, Pierce D(2000) Agrobacterium-mediated sorghum transformation. PlantMol Biol 44:789–798Zhao ZY, Glassman K, Sewalt V, Wang N, Miller M, Chang S,Thompson T, Catron S, Wu E, Bidney D, Kedebe Y, Jung R(2003) Nutritionally improved transgenic sorghum. In: Vasil IK(ed) Plant biotechnology 2002 and beyond. Proceedings of the10th IAPTC & B Congress. Kluwer Academic Publishers, pp413–416Zhu H, Muthukrishana S, Krishnaveni S, Jeoung JM, Liang GH(1998) Biolistic transformation of sorghum using a rice chitinasegene. J Genet Breed 52:243–252123