September 2009 - Wadsworth Center

More documents

Recommendations

Info

Y-4 Candida zeylanoidesSource: Nail / UrineScoring:No. LaboratoriesReferee Laboratories with correct ID: 10Laboratories with correct ID: 51Laboratories with incorrect ID: 1(Candida sake) (1)Clinical Significance: Candida zeylanoides is a relatively rare pathogen in humans. Inimmunocompromised patients, C. zeylanoides causes fungemia, endocarditis, and arthritis. Inimmunocompetent patients, it causes skin and nail infections.Ecology: C. zeylanoides is comopolitan, found in water, meat, and on human body.Laboratory Diagnosis:1. Culture – On Sabouraud’s dextrose agar after 7 days at 25°C, colony was smooth, cream-colored,butyrous raised (Figure 19).2. Microscopic morphology – On corn meal agar with Tween 80, C. zeylanoides forms longpseudohyphae, with verticillate, ovoid blastoconidia (Figure 20). Blastoconidia are produced inwhorls around the pseudohyphae. Cells fusiform (spindle-shaped).3. Differentiation from other yeasts – C. zeylanoides does not ferment any carbohydrates, grows at 37°C,grows on media containing cycloheximide, and assimilates limited carbohydrates.4. In vitro susceptibility testing – C. zeylanoides is susceptible to amphotericin B and to the commonlyused azoles.5. Molecular tests – Multiplex PCR using ITS1 and ITS2 was reported for rapid detection andidentification of yeast strains.The identity of the test isolate was confirmed in the Mycology PTP program by sequencing of itsITS1 and ITS2 rDNA. The sequences are deposited in GenBank under the accession numbersAY382331and AY382337, respectively.ATCC 7351 (AF335930)NRRL 1774 (AY382331)1 50TCCGTAGGTG AACCTGCGGA AGGATCATTA CAGTATTCTT TTGCCAGCGCTCCGTAGGTG AACCTGCGGA AGGATCATTA CAGTATTCTT TTGCCAGCGC51 100TTAATTGCGC GGCGAAAAAC CTTACACACT ATGTTTTTTT GATTTGAAACTTAATTGCGC GGCGAAAAAC CTTACACACT ATGTTTTTTT GATTTGAAAC101 150TTTTGCTTTG GTCTGACTTA GAAATGAGTT GGGCCAAAGG TTTTATACTATTTTGCTTTG GTCTGACTTA GAAATGAGTT GGGCCAAAGG TTTTATACTA151 200AAACTTCAAT TTTATTATTG AATTGTTAAT TAATTATATT GTCAATTTGTAAACTTCAAT TTTATTATTG AATTGTTAAT TAATTATATT GTCAATTTGT201 250TGATTAAATT CAAAAATCTT CAAAACTTTC AACAACGGAT CTCTTGGTTCTGATTAAATT CAAAAATCTT CAAAACTTTC AACAACGGAT CTCTTGGTTC40
251TCGCATCGAT GAAGAACGCA GCTCGCATCGAT GAAGAACGCA GCAlignment of primary sequences of the ITS1 regions of C. zeylanoides ATCC 7351 and PT specimen C. zeylanoides NRRL1774. GenBank (http://www.ncbi.nlm.nih.gov/Genbank/index.html) accession numbers are in parentheses.ATCC 7351T (AF218976)NRRL 1774 (AY382337)1 50GCATCGATGA AGAACGCAGC GAAATGCGAT AAGTAATATG AATTGCAGATGCATCGATGA AGAACGCAGC GAAATGCGAT AAGTAATATG AATTGCAGAT51 100TTTCGTGAAT CATCGAATCT TTGAACGCAC ATTGCGCCCT ATGGTATTCCTTTCGTGAAT CATCGAATCT TTGAACGCAC ATTGCGCCCT ATGGTATTCC101 150ATAGGGCATG CCTGTTTGAG CGTCATTTCT CTCTCAAATC TTCGGATTTGATAGGGCATG CCTGTTTGAG CGTCATTTCT CTCTCAAATC TTCGGATTTG151 200GTTTTGAGTG ATACTCTTAG TCAGACTAAG CGTTTGCTTG AAATGTATTGGTTTTGAGTG ATACTCTTAG TCAGACTAAG CGTTTGCTTG AAATGTATTG201 250GCATGAGTGG TACTAGATAG TGCTGAACTG TTTCAATGTA TTAGGTTTATGCATGAGTGG TACTAGATAG TGCTGAACTG TTTCAATGTA TTAGGTTTAT251 300CCAACTCGTT GACCAGTATA GTATTTGTTT ATTACACAGG CTCGGCCTTACCAACTCGTT GACCAGTATA GTATTTGTTT ATTACACAGG CTCGGCCTTA301 350CAACAACAAA CAAAGTTTGA CCTCAAATCA GGTAGGACTA CCCGCTGAACCAACAACAAA CAAAGTTTGA CCTCAAATCA GGTAGGACTA CCCGCTGAAC351TTAAGCATAT CAATAAGCGG AGGATTAAGCATAT CAATAAGCGG AGGAAlignment of primary sequences of the ITS2 regions of C. zeylanoides ATCC 7351T and PT specimen C. zeylanoides NRRL1774. GenBank (http://www.ncbi.nlm.nih.gov/Genbank/index.html) accession numbers are in parentheses.Comments: One laboratory reported this specimen as Candida sake, which does not grow on the mediacontaining cycloheximide.Further Reading:1. Bisbe, J., Vilardell, J., Valls, M., Moreno, A., Brancos, M., and Andreu, J. 1987. Transient fungemiaand Candida arthritis due to Candida zeylanoides. European J. Clin. Micobiol. 6: 668-669.2. Crozier, W.J. 1993. Two cases of onychomycosis due to Candida zeylanoides. Australasian J.Dermatology. 34: 23-25.3. Fujita, S.I., Senda, Y., Nakaguchi, S., and Hashimoto, T. 2001. Multiplex PCR using internaltranscribed spacer 1 and 2 regions for rapid detection and identification of yeast strains. J. Clin.Microbiol. 39: 3617-22.41
Page 2 and 3: Dr. Vishnu Chaturvedi, DirectorDr.
Page 4 and 5: Schedule of 2010 Mycology PT Mailou
Page 6 and 7: ANSWER KEYMycology - GeneralSpecime
Page 8 and 9: TEST STATISTICSGeneralYeastOnlyAnti
Page 10 and 11: 4. Pfaller, M.A., Messer, S.A., Boy
Page 12 and 13: M-2 Aspergillus terreusSource: Bron
Page 15 and 16: A. B.Figure 3. (A) Seven-day-old, p
Page 17 and 18: vitro antifungal resistance within
Page 19 and 20: M-4 Aspergillus clavatusSource: Bon
Page 21 and 22: A. B.Figure 7. (A) Five-day-old, Gr
Page 23 and 24: 51 100TAGCGCGCAG GCCGGAGGCT GGCCCCC
Page 25 and 26: A. B.Figure 9. (A) Nine-day-old, wh
Page 27 and 28: 1. Abdel-Hafez AI and el-Sharouny,
Page 29 and 30: YEAST DESCRIPTIONSY-1 Candida albic
Page 31 and 32: Further Reading:1. Bartie, K.L., Wi
Page 33 and 34: Y-2 Candida dubliniensisSource: Spu
Page 35 and 36: Alignment of primary sequence of th
Page 37 and 38: Y-3 Candida lipolyticaSource: Tissu
Page 39: Figure 17. Seven-day-old, white to
Page 43 and 44: Figure 19. Seven-day-old, colony cr
Page 45 and 46: 201 250ATCTCTTGGC TCTCGCATCG ATGAAG
Page 47 and 48: Figure 21. Seven-day-old, mucoid, s
Page 49 and 50: 4. Lee, J.S., Shin, J.H., Kim, M.N.
Page 51 and 52: ANTIFUNGAL SUSCEPTIBILITY TESTING F
Page 53 and 54: Table 5. Distribution of Interpreta
Page 55 and 56: susceptibility testing for molds al
Page 57 and 58: Further Reading:1. Barry, A.L., Pfa
Page 59 and 60: DIRECT DETECTION (CRYPTOCOCCUS NEOF
Page 61 and 62: Table 6. Summary of quantitative as
Page 63 and 64: 26. Murray, P.R., Baron, E.J., Pfal

September 2009 - Wadsworth Center

Create successful ePaper yourself

Delete template?

Save as template?