Tour-de-Force

Tour-de-ForceInterplay between mitochondria and cellcycle progressionA research program proposed bySCI 332 Advanced Molecular Cell BiologyDepartment of SciencesUniversity College UtrechtDecember 2007

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Author’s PageProject 1: Regulation of Cell Cycle Progression Through Mitochondrial ROS ProductionS.E. BoschH.T. CaylakK.K. DijkstraN.C. FrenkelD.D.J.J. van HooijdonkJ.C. MostertProject 2: Checking the Checkpoint: Understanding the Influence of AMPKA.M. AlbersL.M. HamerslagE. KhalilH.M. MelseM. SilanikoveM.J.K. StolteJ. WalkProject 3: Mitochondrial Biogenesis during the Cell CycleB.B.F. EidhofI. FlamentS.L. GilesJ. GunkelW.P. van KlinkenJ.A.J.M. PijnenburgProject 4: Mitofusin 2 and the Cell CycleJ. ClausS.J.H. DiederenL. HussaartsS. KampsA. MoussaA. SchierenbergSCI 332 Advanced Molecular Cell Biology Research Proposal 2

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Table of ContentsAuthor’s page 2Acknowledgements 4General introduction 5Project 1: Regulation of Cell Cycle Progression Through Mitochondrial ROS Production 9Introduction 10Background 11Research Proposal 16Conclusion 30Proposed Costs 32Proposed Timeline 33References 34Project 2: Checking the Checkpoint: Understanding the Influence of AMPK 36Introduction 37Background 38Research Proposal 43Proposed Costs 52Proposed Timeline 52Conclusion 53References 54Project 3: Mitochondrial Biogenesis during the Cell Cycle 57Introduction 58Background 59Research Proposal 64Proposed Costs 69Proposed Timeline 69Discussion 70References 71Project 4: Mitofusin 2 and the Cell Cycle 73Introduction 74Background & Research Proposal 77Discussion 89Proposed Costs 90Proposed Timeline 90Acknowledgements 91References 92General Conclusion 94Appendix A 95Appendix B 102Appendix C 111Appendix D 112Appendix E 116SCI 332 Advanced Molecular Cell Biology Research Proposal 3

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007AcknowledgementsThe Advanced Cell Biology class of the 2007 Fall semester would like to express their gratitude to, aboveall, their instructors Dr. F.A.C. Wiegant and Prof. Dr. J. Boonstra for their time, patience, advice, feedbackand support throughout the course.Furthermore, we would like to express our thanks to the jury members, who were willing to invest theirtime in assessing our research proposal.We would also like to thank J.A. Post of Utrecht University, P. Smith of the Bio Currents Research Center,F. Srienc of the Biotechnology Institute of the University of Minnesota, L.H.K. Defize of Utrecht University,M. Koster of Utrecht University, M. Lewis of Santa Cruz Biotechnologies, C. Scheler of ProteomeFactory,S. Otternberg of Thermo Scientific Pierce Protein Research Products, J. Talhouk of Biovision and B. Chenof Abnova for all their kindness and their assistance in providing us with valuable information and adviceon our research proposal.SCI 332 Advanced Molecular Cell Biology Research Proposal 4

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007General Introduction: A Tour always has a StartThis research proposal is aimed at linking two of the most important cellular processes: cell cycleprogression and mitochondrial activity. Firstly, an introduction into the topic will be provided as to explainthese crucial process after which the relevance of linking the two will be put forward. The four projectswithin this program all explore different aspects of the link between the cell cycle and mitochondria. Withinthis introduction the essence of the four projects is provided.The Cell Cycle and the MitochondriaSelf-reproduction is perhaps the most fundamental characteristic of life. Self-reproduction in cellsis accomplished through growth and division into separate daughter cells. The division of cells must be aclosely regulated mechanism to ensure equality among progeny cells, and it is regulated by controlledprogression through the cell cycle (figure 1). In general, the cell cycle can be said to consist of four phases.In S-phase, the DNA replicates so that in cell division both daughter cells will receive the same, complete,genomic information. In M-phase (mitosis) the actual division takes place, involving first nuclear divisionand then the actual cell division. In between, there are two resting phases, named G1 and G2, in whichcell growth takes place. Cells can pause in the G1 phase by going into the G0 phase, which means thatthey stop progressing through the cell cycle. This cell cycle arrest can be reversible (quiescence) orirreversible (senescence), as is the case in certain differentiated cell types. Additionally, variouscheckpoints, that control progression from one phase to another, ensure that various standards have beenreached before continuation is wished for.Figure 1 The different phases of thecell cycle.Source: Mitosis: Mitosis and the Cell DivisionCycle;http://www.phschool.com/science/biology_place/biocoach/mitosisisg/cellcyc.htmlThe abovementioned checkpoints ensure optimal conditions for cell cycle progression. The firstcheckpoint in animal cells that one encounters during an imaginary tour through the cell cycle is therestriction point. This checkpoint controls G1 to S succession, through the evaluation of growth factoravailability, DNA damage and energy levels. By continuation of the imaginary tour, one will pass by thecheckpoints in the middle of S phase and in the end of G2 phase, which mainly function to evaluate DNAdamage. In addition, the G2 checkpoint ensures that mitosis is only realized after full replication of theDNA. Lastly, the spindle assembly checkpoint in late M phase monitors the alignment of chromosomes onthe mitotic spindle, such that distribution will be equal over progeny cells.Transition through the various checkpoints discussed above is influenced by many differentfactors, the most important ones being the Cyclins and the Cyclin-dependant kinases, which directly allowphase arrest or succession. Different Cyclins interact with more or less Cyclin-specific Cdk’s, althoughthere is evidence for partial redundancy. Different Cyclin-Cdk complexes are associated with differentphases of the cell cycle. Cyclins and Cdk’s, and moreover the formation of their complexes, is notfunctional by itself, but rather influenced through various pathways. Therefore, the cell cycle might beregulated by various intrinsic and extrinsic factors.SCI 332 Advanced Molecular Cell Biology Research Proposal 5

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007The generation of metabolic activity, mainly enabled by the mitochondria, is a major activity of allcells. Most energy in the cell is obtained from oxydative phosphorylation within the mitochondria. Duringoxidative phosphorylation, electrons stemming from NADH and FADH2 combine with oxygen. Theelectron transport chain uses the energy released from oxidation/reduction reactions to firstly produce aproton gradient across the inner mitochondrial membrane. In the process of chemiosmosis, protons flowback across the membrane in order to produce ATP from ADP (Figure 2).Figure 2 Oxidative Phosphorylationcreates energy through the electrontransport chain and chemiosmosisSource: Oxidation-Reduction Reactions andProton Pumping in Oxidative Phosphorylation;http://www.chemistry.wustl.edu/~courses/genchem/Tutorials/Cytochrome/ProtonPump.htmAs the mitochondria are the main suppliers of energy within the cell, and all cellular processesrequire energy, it naturally follows that mitochondrial activity has great influence on the cell as a whole.Furthermore, as a byproduct of oxidative phosphorylation, radical oxygen species are produced that havegreat impact within the cell as well. Through the production of these molecules, mitochondria are believedto also have a regulative influence on cell cycle progression.Mitochondria have been shown to be very dynamic organelles. They are known to fuse and divideagain, and it remains relatively unclear what the function of these processes is. The most popularhypothesis at this moment is that the fusion and fission of mitochondria ensures that the mitochondrialgenetic information is distributed evenly over all mitochondria, which might be necessary after mutations.Additionally, various mitochondrial proteins are transcribed in the nucleus. Furthermore, cell cycleproteins have been proven to affect the mitochondria directly in several ways. Therefore it is believed thatthe cell cycle and cell cycle progression highly influence mitochondrial activity, morphology and biogenesis.Cell cycle and mitochondrial activity: making the linkAccording to the widely accepted principle of endosymbiosis, mitochondria started off as onesingle bacterium that was taken up by another, larger, cell. This makes mitochondria remarkableorganelles having their own genetic information and being able to divide independently from their host cell.However, over the course of time, the bacterium and the larger cell have been becoming increasinglydependent of each other. Nowadays, in animal cells, mitochondria still have their own genetic system,although not all mitochondrial proteins are encoded by this internal genome. Mitochondria therefore arehighly influenced by the general transcription of proteins in the nucleus, and communication is known totake place between the nucleus and mitochondria. Because of their extraordinary origin, thiscommunication between the nucleus and mitochondria is a very important example of the creativity ofevolution. It clearly demonstrates how systems evolved to form a better functioning system. It has beenproposed that the two regulate each other’s activity in various ways. This research proposal aims to give amore complete overview of the communication between two of the most important cellular aspects: thecell cycle, allowing the cell grow and to divide, and the mitochondria, once an organism itself.This research proposal focuses on the various regulative influences that the mitochondria have onthe cell cycle and cell cycle progression. Additionally, several propositions are made on the regulative roleSCI 332 Advanced Molecular Cell Biology Research Proposal 6

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007of cell cycle progression on the mitochondria. Through testing the hypotheses in this research proposal,the understanding of the regulative interaction between mitochondria and the cell cycle will be greatlyenhanced.Firstly, the existence of a metabolic cycle will be discussed. In yeast, a metabolic cycle hasalready been proven to exist, but there are also indications for its existence in mammalian cells. It ishypothesized that a change in mitochondrial activity has an effect on the cell cycle through ROSproduction. There is evidence that certain levels of ROS are necessary for cell proliferation, and someregulators of the cell cycle have been found to act in a redox-dependent manner. Firstly, ROS fluctuationthroughout the cell cycle will be studied. In addition, the relative contribution of mitochondria to ROSproduction will be investigated in comparison with other known ROS producers. Lastly, the influence ofROS on the G2/M phase transition will be investigated in order to establish a clear link on how ROS levelsregulate cell cycle progression. Through performing this research, a strong interaction between the cellcycle and mitochondria through ROS might be indicated.In the second part of this proposal, focus will be placed on the energy checkpoint in G1 phase. Inthis energy checkpoint, AMPK is the protein that will be focused on most. AMPK is an enzyme thatevaluates the ratio of ATP and AMP within the cell, after which cell cycle arrest can be achieved in case ofinsufficient energy levels. The pathways through which high levels of activated AMPK can induce cellcycle arrest will be explored. A link between energy-producing mechanism and cell cycle arrest is aimed tobe better understood, and a direct link between AMPK and energy-producing mechanisms is proposedand studied. Lastly, it will be investigated whether, and how, mitochondrial morphology changes after thecell goes into cell cycle arrest. Through accomplishment of this research proposal, it will be betterunderstood how AMPK functions in the regulative interaction between energy status in the cell and cellcycle arrest.To continue, a research that is mainly focused on the role of the cell cycle for mitochondrialbiogenesis is proposed. Whereas the preceding two proposals are mainly aimed at explaining the effectsand consequences of mitochondrial products on the cell cycle, this research is necessary to improveunderstanding about the dependence of mitochondrial biogenesis on cell cycle progression. The role ofNRF (nuclear respiration factor) is of particular interest as this factor is capable of activating thetranscription of various mitochondrial components. The main aim of this research is to investigate thedynamics of mitochondrial biogenesis during the cell cycle and to understand how induction ofmitochondrial biogenesis by different factors may be coordinated.Lastly, the regulative interaction between mitochondria and cell cycle progression is aimed to beexplained through the activities of another remarkable protein, namely mitofusin2. Mitofusin2 is known forits role in the regulation of mitochondrial fusion and fission, but it has been proposed to have many otherintriguing functions. Mfn2 is interesting as it is a potential target for cell cycle regulation by energyproduction. Therefore, it is explored how Mfn2 levels vary throughout the cell cycle and a possiblemechanism of oxidative phosphorylation maintenance by Mfn2 is proposed. Remarkably, Mfn2 can alsoexist in the cytosol where it has a seemingly contradicting function, namely the potential to induce cellcycle arrest through inhibition of Ras. A possible mechanism of cleavage is proposed throughout whichthe occurrence of both isoforms and their opposing roles might be explained. Furthermore, it will beinvestigated into more detail how cytosolic Mfn2 functions to inhibit Ras. Lastly, the influence of cyclins onMfn2 levels and activity is assessed to round up the circle of regulative interaction between the cell cycleand mitochondria through Mfn2.These four projects, all focusing on the link between the cell cycle and mitochondria, mayit be on very different aspects, are shown in figure 3.SCI 332 Advanced Molecular Cell Biology Research Proposal 7

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 20071ROS2AMPKATP3NRF4Mfn2(C)Mfn2(M)Figure 3 The four projects outlined in this research proposal and their links between the cell cycle andmitochondriaMade by authorsEvidently, figure 3 is far from being complete, as other organelles, locations, proteins andprocesses will be discussed throughout the proposals. Additionally, the manners in which the projects linkin to each other by these additional mechanisms are not shown. Project 1 and 2 both look at cellularmetabolism, project 1 linking this strongly to the cell cycle while project 2 investigates the hypothesizedrelation between metabolism and AMPK. Additionally, both project 2 and 4 look into cell cycle arrest,project 4 via Mfn2 and the Ras pathway, and project 2 via AMPK and p53. The four projects, mitochondriaand the cell cycle and these individual links add up to a complete picture of the interplay between the cellcycle, mitochondrial dynamics, functioning and activity, apoptosis and cellular metabolism – they all addup to this program.Relevance of the topicThroughout this program, various aspects of the interplay between mitochondria and the cell cyclewill be addressed. Throughout performing all proposed research, the interplay will be better understood.The knowledge that will be gained is likely to be relevant to the development of medical therapy, asvarious diseases, such as cancer and Charcot Marie Tooth disease, originate from cell cycle defects ormalfunctioning mitochondria. However, the information by itself will greatly enrich our understanding of thecellular events that form the essence of life, since both the cell cycle and energy production are extremelyimportant processes in the cell. Their link, therefore, will greatly add to our general understanding of thecell.To conclude, it is proposed that the cell cycle is highly influenced by mitochondrial products suchas ROS and ATP, and mitochondria are bound to be influenced by cell cycle progression, so thatprocesses of interplay between the mitochondria and the cell cycle must exist. This program therefore isreferred to as the Tour-the-force. This research proposal could be seen as a tour past many different butimportant aspects of cellular functioning, for which we need two processes most: our cycle, the cell cycle,and our source of energy, provided by the mitochondria. It is hoped that the following research proposalwill provide an energetic tour through the regulative interaction pathways and mechanisms between thecell cycle and mitochondria.SCI 332 Advanced Molecular Cell Biology Research Proposal 8

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Regulation of Cell Cycle Progression ThroughMitochondrial ROS ProductionResearch Proposal byS.E. Bosch, H.T. Caylak, K.K. Dijkstra, N.C. Frenkel, D.D.J.J. van Hooijdonk, J.C. MostertAbstractThere are not many cellular functions that remain in a static mode while the cell is proliferating. Evenmitochondria, the metabolic engines of the cell, are suggested to change their activity during the cell cycle.In yeast, a metabolic cycle has already been proven to exist, but there are also indications for its existencein mammalian cells. The main product of mitochondria is ATP, but mitochondria also significantlycontribute to the production of reactive oxygen species (ROS). In this research proposal, it is hypothesizedthat a change in mitochondrial activity has an effect on the cell cycle through ROS production. There isevidence that certain levels of ROS are necessary for cell proliferation, and some regulators of the cellcycle have been found to act in a redox-dependent manner. However, many things are still unclear. Neverbefore has it been investigated how mitochondrial activity fluctuates throughout an entire mammalian cellcycle. Furthermore, evidence about ROS levels throughout the cell cycle is at times contradictory. In thisresearch, this gap will be filled by establishing fluctuations in mitochondrial activity and ROS levelsthroughout the cell cycle. In a second set of experiments, the relative contribution of mitochondria to ROSproduction will be studied in comparison with other known ROS producers. Lastly, the influence of ROS onthe G2/M phase transition will be investigated in order to establish a clear link on how ROS levels regulatecell cycle progression. As such, this research will be novel in investigating the links between mitochondrialmetabolic activity, ROS and cell cycle progression.SCI 332 Advanced Molecular Cell Biology Research Proposal 9

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007IntroductionThe discovery of the cell cycle and its key regulators, cyclins and cyclin-dependent kinases, has had anenormous impact on cell biology. Many diseases, most notably cancer, are involved with improperregulation of the cell cycle, which has therefore attracted much scientific attention.The cell cycle is not the only cycle. In yeast, there is evidence for a metabolic cycle, where periodsof relatively high rates of (mitochondrial) respiration and periods with more non-respiratory modes ofenergy generation cyclically alternate (Reinke and Gatfield, 2006).Interestingly, this metabolic cycle seems to be coordinated with the cell cycle (Klevecz et al.,2003), and is associated with temporal patterns of gene expression (Chen et al., 2007). This suggests thatthe metabolic cycle might play a role in cell cycle regulation.The yeast metabolic cycle also seemed to be associated with cyclic changes in the cellular redoxstate of the cell (Reinke and Gatfield, 2006). Periods with highly levels of respiration were relativelyoxidized, whereas a reduced state was characterized by more non-respiratory metabolism.The existence of other cycles than the cell cycle has attracted much attention. It has even beensuggested that this redox cycle could underlie and regulate nearly all cyclic processes in the cell, varyingfrom the metabolic cycle to day-night rhythms (Lloyd and Murray, 2007). Since this could possibly providealternative ways of manipulating many cellular processes and new treatments for cancer, the study ofthese cycles is highly relevant.In mammalian cells, there are indications for a metabolic cycle and a redox cycle controlling cell cycleprogression as well. A recent study showed that cyclin D1, an important protein in the regulation of G1/Sphase progression, can modulate NRF-1 levels, a transcription factor controlling expression of manymitochondrial proteins (Wang et al., 2006). This suggests that the cell cycle and metabolism might becoordinated through control of mitochondrial activity.Some of the most interesting oxidants, with high potential for control of other processes arereactive oxygen species. It is quite widely known that high levels of ROS can cause cellular apoptosis(Boonstra and Post, 2004), but more recent studies have also shed light on more subtle effects of ROS onthe cell cycle (reviewed in Menon and Goswami, 2007), such as the finding that ROS are necessary forG 1 /S progression (Havens et al., 2006).Since mitochondria are a major source of ROS, the redox cycle might function as an intermediatebetween the cell cycle and a potential metabolic cycle.Several pieces of the puzzle are missing for the interplay between a metabolic cycle, a redox cycle andthe cell cycle in mammalian cells. In this research, these pieces will be added. Three parts can bedistinguished in this research proposal:1. Metabolic cycleIt is not known whether mitochondrial activity fluctuates in coordination with the mammalian cell cycle.This research will measure mitochondrial activity throughout the cell cycle, and compare it to mitochondrialactivity in quiescent cells. This will allow the characterization of a metabolic cycle in mammalian cells.2. Links between a metabolic cycle and a redox cycleEven though some studies have measured ROS levels throughout the cell cycle, there are contradictionsin the literature (Conour et al., 2004; Havens et al., 2006). In this part, first ROS levels throughout the cellcycle will be measured. Then, it is of interest whether mitochondria are responsible for these changes inROS levels, since mitochondrial contribute for 85% to the cellular superoxide levels (Foster et al., 2006,citing Dröge et al., 2002 and Boveris and Chance, 1973) By using a combination of specific probes, for thefirst time statements can be made about fluctuations in ROS levels mediated by mitochondria.3. Links between a redox cycle and the cell cyclePrevious studies have mainly focused on the effects of ROS on the cell cycle when ROS levels beyondthe physiological range were used. Here, it will be investigated whether the hypothesized more subtlechange in ROS levels throughout the cell cycle is essential for cell cycle progression. It has been foundSCI 332 Advanced Molecular Cell Biology Research Proposal 10

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007that ROS are necessary for G 1 /S transition (Havens et al., 2006). To identify the influence of a redox cycleon the entire cell cycle, this research will focus on the G 2 /M transition.Background InformationThis section will present relevant background information. Three main topics will be discussed. First,information on the metabolic cycle will be presented, which will be followed by a discussion of ROS andthe redox cycle. Lastly, the effects of ROS on the cell cycle will be elaborated on.Existence of a metabolic cycleIt has been shown that there is a cyclic change in metabolic activity in yeast that is coordinated with thecell cycle (Tu et al., 2005; Reinke and Gatfield 2006). A period where metabolism is mainly respiratory isalternated with a period where anaerobic metabolism is prevalent. The entire cycle can be divided intothree parts: an oxidative phase, a reductive/building phase and a reductive/charging phase. In the first,oxidative, phase, respiration, oxidative phosphorylation and ATP production are high, meaning that themitochondria are metabolically active. In the reductive/building phase DNA is replicated and the celldivides, while respiration is greatly reduced. Lastly, in the reductive/charging phase, the cell prepares forthe next respiratory burst through non-respiratory modes of energy and protein degradation (Reinke andGatfield, 2006). This cycle is accompanied by a highly organized transcriptional cycle of genes thatencode for proteins associated with energy production, metabolism and protein synthesis (Tu et al., 2006).The transcription of these nuclear genes involved in mitochondrial metabolism starts right at the end of theoxidative phase (Reinke and Gatfield 2006). This indicates that after the oxidative phase in whichmitochondria are very active, the mitochondria switch to a resting state to rebuild their resources. Theexistence of a metabolic cycle and the accompanied transcriptional cycle in yeast indicates thatmetabolism and cell cycle progression can be closely linked through gene expressionIn mammalian cells, such a metabolic cycle has never been found. However, there are indications thatmitochondria can alternate between metabolic states depending on availability of ADP, substrates foroxidative phosphorylation and oxygen. Such a change in mitochondrial activity can occur in nonproliferatingcells, but there might also be transcriptional regulation of metabolic activity, potentially relatedto the cell cycle. It has been shown that when cyclin D1 is knocked-out there is an increase inmitochondrial activity. This is accompanied by increased activity of NRF-1, a transcription factor controllingmany mitochondrial proteins (Wang et al., 2006; Sakamaki et al., 2006). As cyclin D1 is involved in theG1/S transition, this is another indication that mitochondrial metabolic activity and the cell cycle caninteract.An accurate measure of mitochondrial metabolic activity is oxygen consumption. Mitochondria account forapproximately 90% of the cellular oxygen consumption, meaning that oxygen consumption can be directlyrelated to mitochondrial activity (Boveris et al., 2006; Gnaiger, 2007). In a study in yeast, oxygenmeasurements were used to measure mitochondrial activity throughout the cell cycle (Tu et al., 2006),which led to the identification of the yeast metabolic cycle.Another measure of mitochondrial metabolic activity is the mitochondrial membrane potential. Thispotential is formed by protons that are pumped into the mitochondrial intermembrane space by theelectron transport chain. Subsequently, when protons flow back through its pore, the ATPase uses thisgradient to generate ATP. It has been reported that mitochondrial membrane potential decreases whenthe mitochondria are in a resting state, while it increases in active mitochondria (Boveris et al. 2006).Existence of a redox cycleIn mammalian cells, fluctuations in the intracellular redox state have been proposed to work as a growthregulator during the cell cycle. The cell contains many electron donors and electron receptors, orreductants and oxidants, respectively. Two examples are the NAD(P)H/NAD(P)+ balance, and reactiveoxygen species and their antioxidants. The most accurate description of a redox cycle would be afluctuation in cellular reduction potential, as this takes into account all cellular reductants and oxidants.SCI 332 Advanced Molecular Cell Biology Research Proposal 11

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007However, in this research the focus will lie on the balance between ROS and antioxidants. Therefore, inthis proposal, the definition of the redox cycle is the cyclic fluctuation in the “balance between the levels ofreactive oxygen species (ROS) produced during metabolism and the antioxidant system that scavengesthem” (Menon and Goswami, 2007).ROS are reactive radicals and hydrogen peroxide.Hydrogen peroxide itself is not a radical, but when reactingwith a metal it will form the very reactive and destructivehydroxyl radical. ROS are produced as a side effect ofseveral metabolic pathways. They can extract an electronfrom other compounds, destabilizing them and makingthem inactive or incapable of performing their normalfunction. (Foster et al., 2006, citing Dröge et al., 2002 andBoveris and Chance, 1973) There are several types ofROS, which are described in Table 1.1. However, as thisresearch concerns mitochondrial ROS production, it willfocus on the two ROS produced by mitochondria,hydrogen peroxide and superoxide.Subtypes of ROSStructureHydrogen peroxide H 2 O 2Hydroxyl radical HO .Hypochlorous acidHOCLNitric oxideNOPeroxyl radical ROO .Peroxynitrite anionSuperoxide anionSinglet oxigenTable 1.1: Different types of ROSONOO-. O 2 -1 O 2A redox cycle in mammalian cellsROS levels in different phases of the cell cycle have been measured. Havens and colleagues (2006)found that ROS levels were lowest in G1, increased during S and were highest in G2/M. However, Conourand colleagues (2004) measured ROS levels throughout the cell cycle and did not find significantdifferences between phases. They also measured the balance between the reduced and oxidized form ofglutathione (GSH/GSSG balance). Glutathione (GSH) is a tripeptide, consisting of cysteine, glycine andglutamic acid. It is an important player in the antioxidant system, because it is involved in a reductionreaction with hydrogen peroxide: one hydrogen peroxide react with two GSH molecules to yield two watermolecules and two oxidized glutathiones (GSSGs). This reaction is catalyzed by glutathione peroxidase(GPx). GSSG can be converted back into GSH by glutathione reductase (GR). The ratio betweenGSH/GSSG is an important and often used indicator of the oxidative/reductive state of a cell (Schafer andBuettner, 2001; Conour et al., 2004). According to Conour and colleagues (2004), reduced glutathione(GSH) levels were higher in the G2/M phase compared to the G1 phase, and cells in the S phase showedintermediate GSH levels. This suggests that in the progression from G1 to S to G2/M, less oxidants areproduced, and that therefore the state of the GSH/GSSG buffer shifts to the reduced side. Thiscontradiction needs to be resolved before final conclusions can be drawn.Various producers of ROSAn interesting question is to what extent this redox cycle is linked to mitochondrial function. If ROS levelsdirectly correlate to mitochondrial activity, these observations strongly suggest that mitochondrial activityfluctuates throughout the cell cycle. However, even though mitochondria are the main source of ROS,there are also other contributors, including the NADPH oxidase complex, peroxisomes (through fatty acidmetabolism), cytochrome P450 reductase, xanthine oxidase and myeloperoxidase (Menon and Goswami,2007). Furthermore, a change in redox state might also be regulated independently of ROS production, forexample by a change in the pro-oxidant/anti-oxidant balance.Not all of these are relevant for this research, mainly because some ROS producers are very celltypespecific. Myeloperoxidase, for example, is only present in leukocytes (Daugherty et al., 1994).Xanthine oxidase is only present intracellularly in the endothelial cells of the capillaries in the mammarygland, liver, intestine, heart and lung. (Adachi et al., 1993). For other cell types it is only localizedextracellularly. For superoxide and hydrogen peroxide production within the cell there are just threepossible generators: peroxisomes (Schrader and Fahimi, 2004), mitochondria (Boonstra and Post, 2004)and NADPH oxidase (Dröge, 2002). Furthermore, a change in antioxidant levels or activity can alsoinfluence cellular ROS levels. An overview of the various contributors to ROS levels can be seen in Figure1.1.SCI 332 Advanced Molecular Cell Biology Research Proposal 12

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Figure 1.1 Different producers of cellular ROS.ROS production by mitochondriaThe main product of oxidative phospohorylation by mitochondria is ATP. Normally with the help of theelectron transport chain a membrane potential is generated, which enables the ATPase to convert ADPinto ATP. However electrons might leak out of the transport chain occasionally to react with molecularoxygen in respiratory complex I or III. This will result in the generation of superoxide. Then at least part ofthe superoxide is converted within the mitochondria into the less reactive hydrogen peroxide, H 2 O 2, by themanganese superoxide dismutase, SOD2, which is present in mitochondria. Superoxide and hydrogenperoxide both diffuse out of the mitochondria (Boonstra and Post, 2004).ROS production by NADPH oxidaseNADPH oxidase exists in two isomers, one present in normal cells and another in neutrophils andmacrophages. The second isomer, called phagocytic NADPH oxidase, contributes to massive superoxiderelease during the respiratory burst (Dröge, 2002), whereas the first isomer is mainly involved in oxidizingNADPH. Interestingly, some reports suggest that growth factors might activate NADPH oxidase, providinga possible link between cell cycle progression and ROS production (Burch and Heintz, 2005).ROS production by peroxisomesIn peroxisomes, hydrogen peroxide is produced as a side effect of the removal of electrons from variousmetabolites (De Duve and Baudhuin, 1966). The main hydrogen peroxide producing processes within theperoxisomes are the β-oxidation of fatty acids, the enzymatic reactions of flavin oxydases, and thedisproportionation of superoxides. As a defense mechanism, the peroxisomes also contain a repertoire ofdifferent antioxidants. These antioxidants help in retaining the balance between ROS production andscavenging them by peroxisomes.Effect of antioxidants on ROS levelsWithin the cell several antioxidants are produced to prevent the damaging effect of high levels of ROS(Chen et al., 2007). The most influential and important antioxidants are shown in Table 1.2 together withthe corresponding ROS they scavenge. Superoxide dismutases (SOD) convert the very reactivesuperoxide into the less reactive hydrogen peroxide. Furthermore, catalase degrades hydrogen peroxideinto water and oxygen. Hydrogen peroxide itself is not that reactive, but by reacting with a metal it can beconverted into the reactive and toxic hydroxyl radicals. Another very important antioxidant is glutathione(GSH), which can act as a buffer by being oxidized by ROS to GSSG. Glutathione reductase plays a verySCI 332 Advanced Molecular Cell Biology Research Proposal 13

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007important role in bringing the oxidized GSSG back into its reduced form the GSH (Boonstra and Post,2004).Table 1.2: Most important antioxidantsSource: Schrader and Fahimi, 2004Influences of ROS on the cell cycleInterest in ROS as a possible regulator of the cell cycle has increased in the last decade, as the initial viewof ROS being merely an undesired side product of metabolic processes of the cell has lost its credibility(Menon and Goswami, 2007). Several studies have shown that ROS, besides from being toxic to the cellin high concentrations, can be useful in regulation of processes such as apoptosis and proliferation (Rheeet al., 1999). These two opposing effects of ROS might seem contradictory but can easily be explained bydifferent ROS types, levels, localization and exposure time. Indeed, several recent reviews suggest athreshold concept indicating that different ROS levels can have distinct effects on the cell (Menon andGoswami, 2007). Depending on its concentration and exposure time, ROS can have effects ranging fromenhanced proliferation to apoptosis (Boonstra and Post, 2004).It has been suggested that ROS can function as a secondary messenger in signal transductionand play a role in production of signaling molecules (Bae et al., 2000). Moreover, some reports suggestthat ROS can alter a protein, for instance PKC, by directly interacting with its cysteine residues whichcould result in change in activity (Klann et al., 2000).Cell cycle progression pathways influenced by ROSSince ROS can have diverse effects on the cell cycle, it is not surprising that many different processesinvolved in cell cycle regulation have been found to be influenced by ROS (Finkel et al., 2000). Productionof ligand-stimulated ROS activates proteins like mitogen-activated protein kinase (MAPK) (Brar et al.,1999), protein kinase C (PKC) (Junn et al., 2000) and epidermal growth factor (EGF) (Bae et al., 1997),which are all important proteins in control of cell proliferation. Conour and colleagues (2004) usedbioinformatics to identify 92 proteins involved in cell cycle regulation that can possibly be regulated byROS. Ten percent of these proteins function in S phase and twenty percent function in G1 phase, whereashalf of the identified proteins function in G2 and M.Transition from one phase of cell cycle to next is tightly controlled so that cell cycle progression proceedsonly when the cell is ready to continue (Boonstra and Post, 2004). These transitions and successfulprogression through the cell cycle are largely controlled by the activity of cdk-cyclin complexes (Morgan etal., 1997; Nigg et al., 2001). Regulation of cell cycle progression is largely dependent on ubiquitination ofproteins of cdk-cyclin complex (Reed et al., 2003). ROS is reported to influence the ubiquitin pathway.Introduction of hydrogen peroxide decreased the activities of ubiquitin-activating and -conjugatingenzymes (Jahngen-Hodge et al., 1997). It is possible that ROS play a role in regulation of the activity ofthe cdk-complexes by altering ubiquitin pathways.G1/S transition dependency on ROS levelsA recent study by Havens and colleagues (2006) suggested that ROS are required for progression fromG1 to S phase. When ROS levels were decreased by treatment of cells with antioxidants, cells can stillgrow but cell cycle progression is halted. The arrest is shown to be due to decreased cyclin A presence.Cyclin A accumulation in late G1 is essential for the activation of cdk2-cyclin A complex which is essentialfor progression into S phase, because the complex initiates DNA synthesis.Mitotic kinases and progression into M phaseSCI 332 Advanced Molecular Cell Biology Research Proposal 14

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007In the G2/M phase, cyclin A, cyclin B and cyclin D are present. Several studies have shown that cdk1activity is indispensable for transition from G 2 into mitosis. Other mitotic kinase families such as the Pololikekinase family, and the NIMA family have been shown to be active in the transition but their contributionto entry into mitosis is not as well-understood as the contribution of cdk1. Cdk1 knock-out cells couldneither divide nor survive (Harborth et al., 2001). This finding suggests that even if other ckds areupregulated in absence of cdk1, it is not sufficient for progression into M phase.Cdk1 can bind to cyclin types A and B and cells lacking cyclin A or cyclin B cannot enter mitosis.Sanchez et al. (2005) suggest that the cdk2-cyclin A complex is also present in G 2 /M transition; itspresence, however, is not required for cell cycle progression. Cyclin D is also present but cyclin D’sbinding partners cdk4 and cdk6 are not required for transition from G2 to M (Nigg et al., 2001; Morgan etal., 1997). In short, cdk1-cyclin A/B complexes are most obviously essential for the G2/M transition.Cyclin A&B levels are regulated by APC activityIn the study by Havens et al. (2006) decreased cyclin A levels were shown to be due to altered activity ofanaphase-promoting complex (APC) which targets cyclin A for degradation. The exact reason behind thechanged activity of APC has not been identified, but a change in activity of the APC-inhibitor Emi1 isexpected to be the reason (Havens et al., 2006). ROS might either have a direct effect on APC, or canaffect its activity through effects on Emi1.APC is a protein-ubiquitin ligase that conjugates ubiquitin to its substrates targeting it fordegradation by the 26S proteosome. APC plays an essential role in the spindle checkpoint in mitosis.Cyclins A and B are needed for entry into mitosis, but need to be degraded for mitosis to proceed. Levelsof cyclin A and cyclin B, but not of Cyclin D, are regulated by their transcription and by inhibition andactivation of APC. APC has to be bound to its co-factors Cdh1 or Cdc20 to be active. APC is activated inmetaphase and is active in the rest of mitosis. During metaphase and anaphase, APC is bound to Cdc20,to target cyclin A and cyclin B for degradation and thus stimulate exit from mitosis.At the end of anaphase APC is still active but bound to Cdh1. APC stays bound to Cdh1 until lateG1, when it is inhibited by Emi1 activity which phosphorylates Cdh1 causing its dissociation from APC.Emi1 can also phosphorylate Cdc20 preventing its association with APC. Cdc20 is only transcribed at thestart of mitosis and is degraded after anaphase; its regulation is therefore mainly on the level oftranscription. Cdh1 is present throughout the cell cycle and has to be inhibited in late G1 and also in G2/M.In the G 1 /S transition Cdh1 has to be inhibited by phosphorylation so that essential cyclin A canaccumulate. Similar to the G 1 /S transition, Cdh1 has to be phosphorylated by Emi1 in G 2 /M so that cyclinA and cyclin B can accumulate, which is necessary for entry into mitosis (Reed et al., 2003; Zhou et al.,2002; Sudo et al., 2001; Hames et al., 2001). A similar regulation in G 2 /M as in G 1 /S suggests that theG 2 /M transition can also be dependent on ROS levels.SCI 332 Advanced Molecular Cell Biology Research Proposal 15

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Proposed ResearchResearch question 1: Are there cyclic fluctuations in mitochondrial metabolicactivity that are coordinated with the cell cycle?Mitochondrial metabolic activity can be characterized by ATP production, oxygen consumption andmitochondrial membrane potential. Measuring ATP or ADP levels will not provide conclusive evidence onthe state mitochondria are in, since differences in these levels can also be attributed to glycolytic activityand cellular ATP consumption. To investigate whether there are cyclic fluctuations in mitochondrialmetabolic activity, oxygen consumption is a better measure, since mitochondria are the major source ofcellular oxygen consumption and it is directly related to metabolic activity.As a second indication of mitochondrial metabolic activity the mitochondrial membrane potentialwill be measured throughout the cell cycle.Question 1.1: Are there cyclic fluctuations in oxygen consumption by the cell during cell proliferation?The oxygen consumption of a single cell will be measured for the duration of one cell cycle to investigate ifthere are cyclic fluctuations in the amount of oxygen that is used by the cell for its metabolic activity.Although oxygen consumption is fundamental for mitochondrial metabolic activity, it has never beforebeen measured throughout an entire mammalian cell cycle.Oxygen flux into a single cell will be measured with a self-referencing microelectrode throughoutone entire cell cycle in proliferating human fibroblasts and retinal epithelial cells.Experiment 1: Oxygen measurements throughout the cell cycleKnowing exactly at what time the cells are in which phase is important to compare the fluctuations inoxygen consumption with cell cycle progression. Therefore, a large population of cells will besynchronized and it will be determined what phase these cells are in at intervals of two hours for theduration of one entire cell cycle.Human fibroblasts and retinal epithelial cells will be grown in air-saturated medium that containsenough glucose.1. Cell synchronizationCells will be synchronized in mitosis with nocodazole treatment and mitotic shake-off. (see AppendixA) The synchronized cells will be divided over different wells and will be used for either cell phasedetermination or oxygen measurements (see Appendix B1.1 for specific information).2. Cell phase determinationThe cell phase is determined with BrdU pulse-labeling and histone H3 phosphorylation in thesynchronized cells (Appendix A; Appendix B1.2). With BrdU pulse-labeling the onset and offset of theS-phase can be determined while histone H3 phosphorylation shows the onset of M-phase. Thelength of G1 can be calculated as the time between mitotic shake-off and the start of BrdUincorporation. By subtracting the time of the onset of M-phase from the time of the end of BrdUincorporationthe length of G2 can be determined.Measurements will be taken at time intervals of two hours.From this experiment a plot can be made of BrdU-incorporation and histone H3 phosphorylationagainst time and so the lengths of the cell cycle phases can be determined for this culture.To validate the data the experiment (cell synchronization and cell phase determination) will beconducted 5 times in both cell lines.3. Oxygen consumption measurementThe oxygen consumption can be measured real-time in a single cell with a self-referencing electrode.(Appendix A) This is a very accurate amperometric method to measure the analyte flux into a cell in amedium with high background levels of the analyte (Appendix B1.3) (Osbourn et al., 2005).The measurements will be done 5 minutes per hour, throughout one entire cell cycleSCI 332 Advanced Molecular Cell Biology Research Proposal 16

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007In order to correlate the results of oxygen flux at certain time points with cell cycle progression, cellswill be used that are synchronized together with the cells used for cell phase determination. Therefore,oxygen consumption will also be measured in 5 different cells in 5 different wells for 5 cell cycles.Oxygen consumption will also be measured in non-synchronized cells in order to assure thatnocodazole treatment does not influence differences in oxygen consumption. As a second control,oxygen consumption will be measured in quiescent cells (treated as described in Appendix B1). Sucha control is necessary in order to see if the observed fluctuations in mitochondrial metabolic activityare specific for cell cycle progression and do not occur, or occur in a different pattern in quiescentcells.4. Plot dataThe data of oxygen flux into a cell and the cell cycle progression will be plotted against time. This willprovide us with a graph that shows oxygen consumption potential is related to cell cycle progression.Question 1.2: Are there cyclic changes in mitochondrial membrane potential throughout the cell cycle?As a second measure of fluctuations in mitochondrial metabolic activity, the mitochondrial membranepotential will be measured. In previous research the results on how the mitochondrial membrane potentialchanges during a cell cycle are contradictory. Some studies show that the potential is the highest duringG2 and M phase (Martinez-Diez et al., 2006), while other studies show that a high membrane potentialcauses high ROS levels and that these levels are high in G1/ S phase (Lee et al., 2007). Therefore, wewill measure the fluctuations in mitochondrial membrane potential in order to resolve the contradictoryindications from different studies.Experiment 1: JC-1 Dual-emission potential-sensitive probe to measure mitochondrial membrane potentialin single cells1. Cell synchronization and determinationCells will be synchronized as described in Appendix B1.1 and divided over several wells. Persynchronization one well will be used for the membrane potential and the other wells will be used forphase determination (Appendix B1.2).For every cell type synchronization and determination will be done five times.2. Membrane potential measurementThe membrane potential will be measured in the synchronized (but not BrdU-treated) fibroblast andepithelial cells using a JC-1 probe (Appendix B1.4). The JC-1 probe is used because it is a verysensitive measure of membrane potential and is not sensitive to loss of staining, cell density and dyebleaching (Foster et al., 2007). This probe emits green light when it is in the cytosol and red light whenit is in the mitochondria. The higher the membrane potential, the more probes are attracted to themitochondria and so the higher the ratio of red light emitted as compared to green light.The membrane potential will be measured five times in five separate synchronized cultures of bothcell lines.4 Plot DataThe data obtained from the red/green fluorescence can be plotted against cell cycle progression. Thiswill provide us with a graph that shows how mitochondrial membrane potential is related to cell cycleprogression.SCI 332 Advanced Molecular Cell Biology Research Proposal 17

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Research question 2: How do ROS levels fluctuate throughout the cell cycle?The results of the experiments for question 1 will answer the question whether or not there is a metaboliccycle present in mammalian cells. If there are metabolic fluctuations throughout the cell cycle, it isinteresting to see whether ROS level also fluctuate, since ROS production is an important side effect ofmitochondrial activity. However, metabolic fluctuations do not necessarily mean that ROS levels fluctuateas well:1. Mitochondria are not the sole ROS producers in the cell: peroxisomes and NADPH oxidase arealso producers of ROS (Schrader and Fahimi, 2006; Foster et al., 2006).2. There is an antioxidant system that scavenges ROS, so an increase in ROS production does nothave to mean that there are higher ROS levels in the cell.In question 2, ROS levels and antioxidants will be examined. Takahashi and colleagues (2003) haveshown that ROS levels fluctuate throughout, and apparently synchronous with the cell cycle. However, theROS probes used in the study were neither specific nor localized to compartments in the cell, making itimpossible to assess which ROS producer was the cause of the fluctuation. In the experiments conductedto answer question 2, more specific probes will be selectively targeted to different compartments of thecell where ROS is produced.First, cytosolic ROS levels will be examined, in order to replicate the results obtained byTakahashi et al. (2003). Then, it will have to be determined what the relative ROS production bymitochondria is to that of other ROS producers like peroxisomes (Schrader and Fahimi, 2006) or NADPHoxidase(Foster et al., 2006).Question 2.1: How do cellular O 2-and H 2 O 2 levels fluctuate throughout the cell cycle?In researching fluctuations in ROS levels throughout the cell cycle, two specific ROS will be studied:superoxide (O 2 -) and hydrogen peroxide (H 2 O 2 ). These are the ROS produced directly by mitochondria,peroxisomes and NADPH oxidase. Other ROS are formed by reactions of compounds with O 2-and H 2 O 2 .To assess the role of mitochondria in ROS production, mitochondrial levels of O 2-and H 2 O 2 will beexamined. Technical limitations disable the option of measuring superoxide in the peroxisomes, sincecurrently there are no good specific superoxide probes which are targeted to the peroxisomes. Therefore,only H 2 O 2 levels will be measured in peroxisomes throughout the cell cycle. There are no probes formeasuring NADPH oxidase ROS production. Therefore, cytosolic ROS levels will be measured before andafter inhibition of NADPH oxidase, to get a view of the ROS production by this enzyme.Since the laser used to obtain ROS levels (confocal laser scanning microscopy will be used, seeAppendix A) might influence ROS levels, quiescent cell lines will be used as a control. In theseexperiments multiple synchronized cell cultures will be used, after which single cells from these cultureswill be analyzed for experimental data. Furthermore these experiments will be done twice for everydifferent cell line.-Experiment 2.1.1: Cytosolic O 2 levels throughout the cell cycleThe levels of superoxide present in the cytosol will be studied to determine if these levels fluctuate in a-cyclic pattern. The commercially available probes for measuring cellular O 2 levels are not selectiveenough, nor react fast enough to rapid fluctuations. Thus, a PF-1 probe will be designed, as described inthe protocol of Xu et al. (2007). The PF-1 probe is both very specific for O - 2 and has a short incubationtime, which is relevant for a reactive component such as O - 2 (Xu et al., 2007).1. Construction of Pf-1 probeThe PF-1 probe will be constructed and checked according to protocol as described by Xu et al. (2007)(see Appendix B2.2).2. Cell synchronization & plating the cellsCell cultures will be synchronized using mitotic shake-off with nocodazole, as described in question 1, andwill then be plated in wells with their normal medium (Appendix B0; B1.1).3. Incubation with PF-1 probe and BrdUSCI 332 Advanced Molecular Cell Biology Research Proposal 18

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Taking into account the full length of the cell cycle of the cell line used (Appendix B1A), incubation withPF-1 probes dissolved in DMSO will be performed every two hour of that cycle, beginning with t=0. Adifferent well will be incubated every two hours. As a control, a cell culture will receive DMSO only.4. Fixation & Measuring fluorescence and cell cycle progressionAfter the incubation with BrdU and with PF-1 dissolved in DMSO, the cells will be washed with PBS and-fixated by incubation by formaldehyde in order to measure cell cycle progression and O 2 levels,respectively. To detect the fluorescence of the PF-1 probe, confocal laser scanning microscopy will beused to pinpoint a single cell and measure that cell’s fluorescence. As a control the experiment will beperformed on five different single cells. Subsequently, the cells will be lysed and BrdU incorporation will bemeasured (Appendix B1.2). Intensity will be semi-quantified using the appropriate software.Experiment 2.1.2 Cytosolic H 2 O 2 levels throughout the cell cycleIn this experiment cyclic fluctuations of cellular hydrogen peroxide levels will be measured. A probe,named HyPer, will be designed, using the protocol of Belousov et al. (2006, see Appendix B2.3). Thisprobe can be directed to any organelle or the cytosol, by adding a targeting sequence. Additionally, theprobe is highly selective for H 2 O 2 , more so than other commercially available probes (Belousov et al.,2006).In this experiment, the HyPer probe will be targeted to the cytosol instead of at a specific organelle.Therefore, no targeting sequence will be used while constructing the probe, so that it will be targetedsolely to the cytosol. The probe oxidation is reversible, which allows for real time measurements byfocusing on the same cell.1. Construction of HyPer expression vectorA HyPer expression factor will be constructed and checked according to protocol as described byBelousov et al. (2006) explained in Appendix B2.3.2. Plating and growing cells on a coverslipThe cells will be grown on a coverslip, as indicated in Appendix B2.2.3. Cell cycle controlAs a control, thirteen cell cultures will be taken from the same synchronized batch as the cells which areplated on a coverslip. These cells will then be plated in wells with appropriate medium and every twohours a different well will be checked for its cell cycle progression by BrdU.4. Transfecting the cell with HyPerThe cells will be transfected with a C1 mammalian expression vector containing HyPer, as explained inAppendix B2.3. To control for the effects of transfection on the cells, a different cell culture will be mocktransfected.5. Measuring fluorescenceAt two-hour intervals, starting with t=0, corresponding with the cell cycle length of the cell line, H 2 O 2 levelmeasurements will be done by real-time confocal laser scanning microscopy. The laser is fixed on a singlecell and at each different time interval the laser will be activated and the emitted fluorescence measured.Intensity will then be semi-quantified using the appropriate software. The entire experiment will be done infive different single cells.Experiment 2.1.3: Mitochondrial O - 2 levels throughout the cell cycle-In this experiment, the levels of mitochondrial O 2 will be measured by using a commercially availableprobe, MitoSOX (Invitrogen), which is specifically targeted to the mitochondrial matrix and is highlyspecific for superoxide.1. Cell synchronization & Plating of cellsIn this experiment, as in the previously mentioned experiments, the cells will be synchronized and platedinto the medium. Again, the number of cell cultures is dependent on the total cell cycle length of thedifferent cell lines.SCI 332 Advanced Molecular Cell Biology Research Proposal 19

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 20072. Incubation with MitoSOXThe cell cultures will be incubated with BrdU and MitoSOX dissolved in DMSO at two-hour time intervals,starting at t=0. As a control, one cell culture will only receive DMSO treatment.3. Fixation & Measuring fluorescence and cell cycle progressionAfter the appropriate incubation time for BrdU and MitoSOX, the cells will be washed with PBS and fixatedby incubation with formaldehyde. Afterwards these cells will be examined under a confocal laser scanningmicroscope to determine the level of fluorescence emitted by MitoSOX. Again this will be performed onfive different single cells. The level of BrdU-incorporation of the cells will also be determined to establishtheir cell cycle progression, as in experiment 2.1.2. Intensity will then be semi-quantified using theappropriate software.Experiment 2.1.4: Mitochondrial H 2 O 2 levels throughout the cell cycleThe HyPer probe can be targeted to different organelles using the different targeting sequences.Therefore, in this experiment to measure mitochondrial ROS levels, the probe called HyPer-M, which istargeted to the mitochondria, will be used. This probe is a normal HyPer probe using the mitochondriallocalization sequence. (See protocol of Belousov et al., 2006).1. Construction of HyPer-M expression vectorA HyPer expression factor will be constructed and checked according to protocol as described byBelousov et al. (2006) explained in Appendix B2.3.2. Plating and growing cells on a coverslipThe cells will be grown on a coverslip as indicated in Appendix B2.2.3. Cell cycle controlAs a control, thirteen cell cultures will be taken from the same synchronized batch as the cells which areplated on a coverslip. These cells will then be plated in wells with appropriate medium and every twohours a different well will be checked for its cell cycle progression by BrdU.4. Transfecting the cell with HyPer-MThe cells will be transfected with HyPer-Mito expression vector, as explained Appendix B2.3. To controlfor the effects of transfection on the cells, a different cell culture will be mock-transfected.5. Measuring fluorescenceThe same procedure as in experiment 2.1.2 will be used.Experiment 2.1.5: Peroxisomal H 2 O 2 levels throughout the cell cyclePeroxisomes mainly produce hydrogen peroxide (Schrader and Fahimi, 2006). This experiment thereforemeasures the levels of H 2 O 2 produced by peroxisomes throughout the cell cycle.1. Construction of peroxisomal HyPer expression vectorA HyPer expression factor will be constructed and checked according to protocol as described byBelousov et al. (2006) explained in Appendix B2.3.2. Plating and growing cells on a coverslipThe cells will be grown on a coverslip as indicated in Appendix B2.2.3. Cell cycle controlAs a control thirteen cell cultures will be taken from the same synchronized batch as the cells which areplated on a coverslip. The procedure is the same as that of experiment 2.1.2 and 2.1.3.4. Transfecting the cell with peroxisomal HyPerThe cells will be transfected with HyPer-Peroxi expression vector, as explained in Appendix B2.3. Tocontrol for the effects of transfection on the cells, a different cell culture will be mock-transfected.SCI 332 Advanced Molecular Cell Biology Research Proposal 20

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 20075. Measuring fluorescenceThe same procedure as in experiments 2.1.2 and 2.1.4 will be used.Experiment 2.1.6: NADPH oxidase ROS production throughout the cell cycleApart from the mitochondria and peroxisomes, the NADPH oxidase is also a producer of ROS, namelysuperoxide. (Boveris and Chance, 1973; Dröge, 2002). Therefore, in order to establish the relativecontribution of this enzyme to overall ROS production, NADPH oxidase will be inhibited by means of preactivatedapocynin, a specific NADPH oxidase inhibitor, and the effects on the cellular ROS levels will bedetermined.It is necessary to pre-activate apocynin, since the activation reaction of apocynin, which occurs in cellsafter incubation, can increase intracellular ROS levels (Vejrazka et al., 2005). When this activationreaction has been done before administering apocynin to the cells, this increase in ROS levels is notobserved (Vejrazka et al., 2005).1. NADPH oxdidase inhibition & O 2 - levelsTo measure the effect of NADPH oxidase inhibition on superoxide levels, the experiment 2.1.1 will berepeated. However, in this case, after cells are incubated with PF-1, they are washed with MEM (minimalessential medium) and suspended in pre-activated apocynin (for exact protocol, see Vejrazka et al., 2005).As a control, only medium (without apocynin) will be added to the cells. The fluorescence emitted by theprobe will be measured with a confocal scanning laser microscope. Intensity will then be semi-quantifiedusing the appropriate software.2. NADPH oxidase inhibition & H 2 O 2 levelsSince the NADPH oxidase itself produces superoxide, which is readily converted to hydrogen peroxide inthe cytosol, H 2 O 2 levels will also need to be established. Thus, experiment 2.1.2 will be repeated on cellsthat are transfected with the HyPer gene and are suspended in pre-activated apocynin (for protocol, seeVejrazka et al., 2005).However, it has been shown that endothelial cells can go into cell cycle arrest after inhibition ofNADPH oxidase. If the cell cycle arrest is also observed in this experiment, it will not be able to get animpression of how much NADPH oxidase contributes to ROS fluctuations. On the other hand, it will showthat the NADPH oxidase is important for cell cycle progression, probably due to its function in differentredox-signaling pathways, which have not been clearly identified yet.Experiment 2.1.7 Control for ROS production by laser excitationUsing confocal laser scanning microscopy for the detection of fluorescence allows for the focus andquantification of fluorescence in a single cell. However, the laser used to excite the probes might alsocontribute to the ROS levels observed. This has been observed in ROS-induced ROS release by certainspecific probes (Zorov et al, 2000). As a control, cells of every cell line will be taken and forced intoquiescence by using serum starvation. After that the following control experiments will be conducted:1. Measuring superoxide levels in quiescent cellsThese quiescent cells will be incubated with a PF-1 probe dissolved in DMSO and will then be excited byconfocal laser scanning microscopy and the fluorescence levels of 5 different cells will be quantified usingthe appropriate software.2. Measuring hydrogen-peroxide levels in quiescent cellsAdditionally quiescent cells will be transfected with HyPer and will then be excited by confocal laserscanning microscopy and the fluorescence levels of five different cells will be quantified using theappropriate software.3. Measuring superoxide levels in laser exposed quiescent cellsThe same experimental procedure as in 2.1.6.1 will be used, however before the incubation with PF-1 thecell will first be exposed to a laser excitation dose normally used for the detection of PF-1.4. Measuring hydrogen-peroxide levels in laser exposed quiescent cellsSCI 332 Advanced Molecular Cell Biology Research Proposal 21

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007In this experiment the same experimental setup as described in 2.1.6.2 will be applied, however before thetransfection with HyPer, the cell will first be exposed to a laser excitation dose normally used during thedetection of HyPer.Analyzing the data from these experiments will give a reliable indication of the amount of ROS producedby the laser and this data can then be applied to avoid a possible bias, when interpreting the results of theother experiments.Question 2.2 How does the activity of antioxidants fluctuate throughout the cell cycle?Since antioxidants have the ability to scavenge ROS, they might mediate a possible influence of ROS onthe cell cycle. Therefore, the activity several important antioxidant enzymes, involved in the scavenging ofsuperoxide and hydrogen peroxide specifically, will be measured. Furthermore, GSH/GSSG ratio, a veryimportant antioxidant buffer, will be measured.Experiment 2.2.1 Activity of catalase throughout the cell cycle1. Synchronize cellsIn this experiment, as in the previously mentioned experiments, the cells will be synchronized and platedinto a medium. Again, the number of cell cultures is dependent on the total cell cycle length of the differentcell lines.2. Preparation for assayAt 13 time points (each two hours apart) during the cell cycle, the cells will be collected by centrifugationand subsequently sonicated and lysed. Then, following the protocol of the Catalase Assay Kit (CaymanChemical), the assay will be prepared with the supernatant. The assay is based on the reaction ofcatalase with methanol in the presence of hydrogen peroxide. The result of the reaction is formaldehyde,which reacts with an added chromogen: the product of the reaction fluoresces at 540 nm.3. Spectrophotometric analysisThe emitted fluorescence can be measured by a spectrophotometric plate reader (available at UMCU).Experiment 2.2.2 Activity of superoxide dismutase throughout the cell cycle1. Synchronize cellsIn this experiment, as in the previously mentioned experiments, the cells will be synchronized and platedinto a medium.2. Preparation for assayAt 13 time points during the cell cycle, the cells will be collected by centrifugation and subsequentlyhomogenized and lysed. Then, following the protocol of the Superoxide Dismutase Assay Kit (CaymanChemical), the assay will be prepared with the supernatant. In this assay, superoxide radicals produced byxanthine oxidase and hypoxanthine added to the lysate. Tetrazolium salt (also added to the lysate) iscleaved into a fluorescent Formazan dye (emission at 450 nm.) by the resultant superoxide. One unit ofSOD is defined as the amount of enzyme needed to exhibit 50% of dismutation of the superoxide radical(for further information, see the protocol).3. Spectrophotometric analysisThe emitted fluorescence can be measured by a spectrophotometric plate reader (available at UMCU).Experiment 2.2.3 Activity of glutathione reductase throughout the cell cycle1. Synchronize cellsIn this experiment, as in the previously mentioned experiments, the cells will be synchronized and platedinto a medium.2. Preparation for assayAt 13 time points during the cell cycle, the cells will be collected by centrifugation and subsequentlyhomogenized and lysed. Then, following the protocol of the Glutathione Peroxidase Assay Kit (CaymanChemical), the assay will be prepared with the supernatant. This assay is based on the autofluorescentSCI 332 Advanced Molecular Cell Biology Research Proposal 22

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007properties of NADPH (it emits yellow-blue light at 400-460 nm. when excited at 340-360 nm., Foster et al.,2006). Glutathione peroxidise (Gpx) is an antioxidant that uses 2 GSH molecules to reduce a reactiveoxidant to a less reactive molecule, GSSG and H2O. Oxidized GSSG is converted to GSH by glutathionereductase: this reaction uses GSSG, NADPH and an H+ to form 2 GSH and NADP+. The conversion ofNADPH to NADP+ is accompanied by a decrease of absorbance at 340 nm., which can be measured byspectrophotometry. The kit that is used, thus measures Gpx activity only indirectly.3. Spectrophotometric analysisThe emitted fluorescence can be measured by a spectrophotometric plate reader (available at UMCU).Experiment 2.2.4 Total antioxidant status during the cell cycle1. Synchronize cellsIn this experiment, as in the previously mentioned experiments, the cells will be synchronized and platedinto a medium.2. Preparation for assayAt 13 time points during the cell cycle, the cells will be collected by centrifugation and subsequentlyhomogenized and lysed. Then, following the protocol of the Glutathione Assay Kit (Cayman Chemical), theassay will be prepared with the supernatant. First, GSH will be measured: it reacts with DTNB, producinga yellow-fluorescent TNB molecule (emission at 405/414 nm.) and a GSTNB (a mix of GSH and a TNB).The GSTNB is reduced by glutathione reductase to yield a GSH and another TNB. TNB production isproportional to the reduction reaction, and this in turn is proportional to amount of GSH in the lysate. Tomeasure GSSG only, GSH will be derivatizing GSH with 2-vinylpyridine.3. Spectrophotometric analysisThe emitted fluorescence can be measured by a spectrophotometric plate reader (available at UMCU).Research question 3: Is the G2/M transition controlled by redox-dependentregulation of cyclin-cdk complexes?After having answered question 1 and 2, it will be known whether and how ROS levels fluctuatethroughout the cell cycle, and how this relates to mitochondrial activity. In this question, the effects of thefluctuations in ROS levels on the cell cycle will be investigated.The focus will lie on the G2/M transition for two reasons. Firstly, evidence for ROS-dependency ofthe G1/S transition already exists (Havens et al., 2006). At this transition point in the cell cycle, ROS seemto influence the stability of cyclin A through regulation of APC/C. In the G2/M transition, APC/C plays arole in the degradation of cyclins necessary for entry of and progression through mitosis. In this question,it will be investigated whether APC/C-dependent processes in the G2/M phase are regulated by ROSlevels as well.Second, the focus of this research is not primarily on ROS levels in general, but on the change inROS levels throughout the cell cycle. By studying the G2/M transition, it can be investigated whether theincrease or decrease in ROS levels that is hypothesized in question 2, is essential for cell cycleprogression.In this question, it will first be investigated whether ROS and/or the change in ROS levels isnecessary for entry into mitosis. Then, it will be assessed which APC/C-dependent processes areregulated by ROS, and on what level.Question 3.1: Is the G2/M transition redox-dependent?In the following experiment, two separate hypotheses will be investigated. First, it will be studied whetherROS in general are necessary for the G2/M transition by adding antioxidants to the medium. Second,dependency on the change in ROS levels that is possibly found in question 2 will be studied bycounteracting this change. That is, if ROS levels are higher in G2 compared to G1, they will be lowered tosuch an extent that this change is canceled and G2 ROS levels are the same as in G1; if they are lower inSCI 332 Advanced Molecular Cell Biology Research Proposal 23

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007G2, the opposite will be done. Subsequently, entrance into mitosis will be monitored. This experiment willbe carried out in human fibroblast and human retinal epithelial cells.Experiment 3.1.1: Are ROS in general necessary for the G 2 /M transition?1. Experimental and control groupsTo decrease ROS levels in G2, antioxidants will be used. A complete elimination of ROS will not benecessary; levels significantly lower than the physiological range of ROS levels measured in question2 will be aimed at.• Experimental group: antioxidants• Control group: vehicleMany different antioxidants exist, and they possibly have different preferences for certain kinds ofROS. To cover a range of antioxidants as wide as possible, an ‘antioxidant cocktail’ will be used,containing various antioxidants in PBS that both mimic enzymatic antioxidants and affect redoxbuffers (Appendix B3.1.1). Control cells will only receive PBS.2. Determination of dose of antioxidants neededTo determine the amount of antioxidants required, 1 ml of the antioxidant cocktail in various dilutions(Appendix B3.1.1) will be added to synchronized cells in G2. The concentration necessary to lowerROS levels significantly below the physiological range will be determined using the methods used inquestion 2.3. Cell synchronization and treatmentCells will be synchronized using the methods described in Appendix B1.1 and cultured as described inAppendix B1.4. Addition of antioxidantsFor synchronized cells, the expected start of mitosis can be calculated from the length of the cell cyclephases. Two hours before the expected onset of mitosis, antioxidants or vehicle will be added to themedium.5. Mitotic arrestCells will be arrested in early mitosis to determine whether cells were able to pass the G2/M transitionpoint. Two hours before mitosis, nocodazole (20 µg/ml) will be added to the medium to arrest cells inprometaphase.6. Analysis of entry into mitosisWhen cells enter mitosis, histone H3 becomes phosphorylated (Hendzel et al., 1997). To determinewhether cells entered mitosis, an application of FACS adapted from the description by Manke andcolleagues (2005) will be used (Appendix B3.1.3). Cells will be arrested in prometaphase andincubated with anti-phospho-histone H3 antibodies. FACS will be used to measure the amount of cellsthat contain the phosphorylated form of histone H3.It is possible that cells were already past G2 at the time antioxidants will have been added, due to lossof synchrony or cells proliferating faster than expected. If cells were already past prometaphase,nocodazole will not arrest them anymore. In that case, decreased phosphorylation of histone H3 canmean either that cells could not enter mitosis, or that they were already past mitosis when antioxidantswere added. This can be controlled for by FACS using propdium iodide to stain for DNA content(Appendix B3.1.3). If FACS shows 2n DNA content, cells are properly arrested in mitosis and were inG2 when antioxidants were added. If FACS shows (some) 1n DNA content, some cells were alreadypast prometaphase when nocodazole and antioxidants were added, and have progressed to G1. Inthat case, the experiment should be repeated, but antioxidants and nocodazole should be addedearlier.Experiment 3.1.2: Is a change in ROS levels throughout the cell cycle necessary for the G 2 /M transition?1. Experimental and control groupsSCI 332 Advanced Molecular Cell Biology Research Proposal 24

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Based on previous findings, it is expected that ROS levels are lowest in G1, increase until mitosis, andthen decrease again (Havens et al., 2006). However, since some other studies have differentobservations (Conour et al., 2004), other patterns of ROS levels should not be ruled out.If a change in ROS levels in G2 compared to G1 is found in question 2, they can either be lower orhigher. To counteract this change, ROS levels should be lowered when they are higher in G2 relativeto G1, and increased when they are lower.To decrease ROS levels, the antioxidant cocktail will be used (Appendix B3.1.1). For increasing ROSlevels, two methods will be employed (Appendix B3.1.2). One option is the addition of hydrogenperoxide to the medium. However, since mitochondria initially produce superoxide, which can havedifferent effects than hydrogen peroxide, another method is used to increase superoxide levels.Introduction of superoxides into the cell is hard, so Antimycin A (AMA), an inhibitor of the electrontransport chain (ETC) at complex III that is known to increase superoxide production, will be used.ETC inhibition likely also causes decreased ATP production, which is controlled for by adding ATP tothe medium. Furthermore, ETC inhibition causes dissipation of the mitochondrial membrane potential;to control for this, opening of mitochondrial ATP-sensitive potassium channels will be blocked byDiazoxide, which can slow mitochondrial depolarization (Teshima et al., 2003).Table 1.3 shows the various options of treatment of cultures, depending on the outcome of question 2.Outcome ofquestion 2: ROSlevels in G2compared to G 1Manipulation of ROSlevelsTreatmentexperimental groupHigher Decrease to G1 levels Antioxidants in PBS PBSLower Increase to G1 levels Hydrogen peroxide in PBSPBSLower Increase to G1 levels Antimycin A (AMA) inPBSTable 1.3 Cell treatment of experimental and control groups for different outcomes of question 2Treatment controlgroupPBSAMA + ATPAMA + diazoxide2. Determination of dose of antioxidants neededTo determine the amount of antioxidants, Antimycin A or hydrogen peroxide required, 1 ml of theantioxidant cocktail in various dilutions (Appendix B3.1.1) or hydrogen peroxide and AMA in differentconcentrations (Appendix B3.1.2) will be added to synchronized cells in G2. The concentrationnecessary to lower or raise ROS levels to those found in G1 will be determined using the methodsused in question 2.3. Cell synchronization and treatmentCells will be synchronized using the methods described in Appendix B1.1 and cultured as described inAppendix B1.4. Addition of antioxidants, AMA or hydrogen peroxideFor synchronized cells, the expected start of mitosis can be calculated from the length of the cell cyclephases. Two hours before the expected onset of mitosis, antioxidants, hydrogen peroxide, AMA orcontrols will be added to the medium.5. Mitotic arrest and analysis of entry into mitosisTo analyze whether experimental and control cells could enter mitosis, the same procedure asdescribed in experiment 3.1.1.5 and 3.1.1.6 will be used.Question 3.2: Which pathways necessary for the G2/M transition are affected by ROS?In this experiment, the pathways necessary for G2/M transition that are affected by different ROS levelswill be identified. As stated in the background information, many proteins influence the G2/M transition.Here, the focus will lie on cdk1-cyclin A and cdk1-cyclin B complexes, since they are indispensable for theSCI 332 Advanced Molecular Cell Biology Research Proposal 25

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007G2/M transition (Harborth et al., 2001), and because they are regulated by APC/C, which has been shownto be redox-dependent (Havens et al., 2006).The major function of cdk2-cyclin A is in the G1/S transition, and neither the cdk4&6-cyclin Dcomplex is vital for G2/M transition. However, to get a clear overview of all cdk-cyclin complexes presentat the G2/M transition their activity will also be assessed, even though they might not be needed for entryinto mitosis.After having identified which cdk-cyclin complexes are affected by ROS in the G2/M transition, it isnecessary to establish whether a change in activity is due to ROS-dependency of the cyclins or of thecdks. Cyclins A and B are degraded by APC/C and might therefore by under the control of ROS. However,it also possible that altered levels of activated cdks are responsible for this change.Question 3.2.1: Is activity of cdk-cyclin complexes different in cells with altered ROS levels?The activity of the previously mentioned cdk-cyclin complexes in the G2/M transition will be tested. Activityof these complexes will be examined both in control groups and the experimental groups of experiment3.1.1 and 3.1.2 (lower-than-physiological ROS levels and G1 ROS levels) using an immunoprecipitationkinase assay in order to see if manipulation of ROS levels has an effect on the activity of cdk-cyclincomplexes.Experiment 3.2.1: Immunoprecipitation Kinase AssayCells will be synchronized as explained in Appendix B1 and cultured as described in Appendix B1.1. ROSlevels will be manipulated, together with the addition of nocodazole, 2 hours before the start of mitosis asdescribed for experiments 3.1.1 and 3.1.2. When halted in prometaphase, cells will be fixed as describedin Appendix B3.1.3.1. Immunoprecipitation kinase assayFixed cells from all groups will be lysed and incubated with antibodies against cyclin D, cyclin A, and cyclinB (Appendix B3.2.1). The kinase assay will be performed with the Trulight Universal Kinase/PhosphataseAssay Kit using the immunoprecipitated extracts as explained in the manual. Histone H1 will be used as asubstrate for cell extracts isolated by incubation with cyclin A and B, whereas glutathione transferase(GST) C terminus pRb will be used as a substrate for cell extracts isolated by cyclin D incubation. Afterthe reaction is stopped, kinase activity will be measured very accurately by standard fluorescence intensitymeasurements by a fluorometer.2. Interpretation of resultsA change in activity of the cyclin B kinase assay signifies a change in cdk1-cyclin B complex. However, achange in activity of the cyclin A kinase assay could mean a change in activity of cdk1-cyclin A and/orcdk2-cylin A complex. A change can also be observed in kinase assay for cyclin D signifying an alteredactivity in activity of cdk4&6-cyclin D.Question 3.2.2: Are cyclin levels and/or active cdk levels different in cells treated with ROS?Since this research focuses on the redox-dependency of cyclin-cdk complexes regulated by APC/Cactivity, here the focus will lie on the cdk1-cyclin A&B and cdk2-cyclin A complexes. Here, it will beinvestigated whether a change in activity is due to altered cyclin levels, or altered levels of activated cdks.In case cyclin D-cdk4&6 complexes seem to be affected after Experiment 3.2.1, a similar approach can befollowed.All experiments are carried out on all experimental and control groups.Question 3.2.2.1: Are levels of cyclins in control cells different from cells with manipulated ROS levels?The levels of cyclin A and B in control and experiment cells will be tested with a Western blot (seeAppendix A). A change in cyclin levels would indicate that the change in activity of the complex is (partly)due to the cyclin.Cyclin A is degraded by APC/C in the start of metaphase and cyclin B in the start of anaphase(Reed et al., 2003). Because control cells will be arrested in prometaphase, the amount of cyclins will notdiffer from the amount present at the G2/M transition, so that this is a good control point.Experiment 3.2.2.1: Western BlotSCI 332 Advanced Molecular Cell Biology Research Proposal 26

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Cells will be synchronized as explained in Appendix B1 and cultured as described in Appendix B1.1. ROSlevels will be manipulated, together with the addition of nocodazole, 2 hours before the start of mitosis asdescribed for experiments 3.1.1 and 3.1.2. When halted in prometaphase cells will be fixed as describedin Appendix B3.1.3.Fixed cells will be lysed and incubated with antibodies. Antibodies against cyclin A and cyclin B will beused for the immunoblot analysis. These antibodies are chosen so that all isoforms of cyclin A and cyclinB will be observed in the immunoblot analysis. Actin antibody will be used as a loading control (AppendixB3.2.2a)Question 3.2.2.2: Is phosphorylation/inactivation of cdks in control cells different from cells withmanipulated ROS levels?To see whether the alteration in cdk-cyclin complex activity is caused by different levels of active cdkspresent, a western blot will be applied to see the levels of phosphorylated cdk1 and cdk2 together withtotal amounts of cdk1 and cdk2 present. The difference between the total amount present and the amountof phosphorylated, inactive, cdks will show the extent of cdks inactivation by phosphorylation inexperiment and control cells. A change in levels of active cdks in experiment cells would mean that thechange in activity of the complex is (partly) due to the cdk.Experiment 3.2.2.2: Phospho-specific Western Blot:Cells will be synchronized as explained in Appendix B1 and cultured as described in Appendix B1.1. ROSlevels will be manipulated, together with the addition of nocodazole, 2 hours before the start of mitosis asdescribed for experiments 3.1.1 and 3.1.2. After cells are halted in prometaphase, they will be fixed asdescribed in Appendix B3.1.3.Fixed cells will be lysed and incubated with phospho-specific cdk1 antibodies and phospho-specific cdk2antibodies. Normal (non-phospho-specific) cdk1 and cdk2 antibodies will be used to see whether there isa change in total cdk levels (Appendix B3.2.2b).Question 3.3: At what level are the redox-dependent processes regulated by ROS?After it has been established whether the cdk or the cyclin is affected by ROS in the G2/M transition, thelevel of regulation should be examined. Redox regulation of proteins can occur at the level of transcription,translation, or post-translation (activation or stability). From previous studies (Havens et al., 2006), it isexpected that the stability of cyclins is affected by redox-modulation of APC. Nonetheless, all options areheld open. All experiments are carried out on all experimental and control groups.Question 3.3.1: Are the affected proteins regulated on the level of transcription?To investigate whether transcription of the affected proteins are redox-regulated, Northern blot and realtime RT-PCR experiments will be carried out. (See Appendix A)Experiment 3.3.1.1: Northern blotCells will be synchronized as explained in Appendix B1 and cultured as described in Appendix B1.1. ROSlevels will be manipulated, together with the addition of nocodazole, 2 hours before the start of mitosis asdescribed for experiments 3.1.1 and 3.1.2. When halted in prometaphase, cells will be fixed as describedin Appendix B3.1.3.A Northern blot will be carried out for the proteins affected by changed ROS levels, and for actin as acontrol. Primers for the proteins affected by changed ROS levels can be found using the PrimerBankdatabase. Labeled primers will be synthesized by the Massachusets General Hospital DNA Core Facility.RNA will be purified using a QIAGEN RNEasy kit and the Northern blot will be carried out usingNorthernMax (Ambion) (Appendix B3.3.1).Experiment 3.3.1.2: Real time RT-PCRCells will be synchronized as explained in Appendix B1 and cultured as described in Appendix B1.1. ROSlevels will be manipulated, together with the addition of nocodazole, 2 hours before the start of mitosis asdescribed for experiments 3.1.1 and 3.1.2. When halted in prometaphase, cells will be fixed as describedin Appendix B3.1.3.SCI 332 Advanced Molecular Cell Biology Research Proposal 27

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007A real time RT-PCR experiment will be carried out for the proteins affected by changed ROS levels, andfor actin as a control. RNA will be purified using the RNEasy kit (QIAGEN). The reverse transcription step,the polymerase chain reaction, and detection of the labeled target will be performed using QuantiTect Kits(QIAGEN), as described in Appendix B3.3.2. The amount of cycles necessary for signal detectionrepresents the amount of transcript present.Question 3.3.2: Are the affected proteins regulated at the level of translation?After transcription, second regulatory level is translational control. Even though cyclins A and B have notbeen reported to be regulated in translational level during the normal cell cycle, it should still be examinedto see whether translation of the affected proteins is redox-regulated. 35 S pulse-chase experiments will beconducted which can indirectly quantify how much the mRNA is translated. A comparison will be madebetween normal cells and two groups of experiment cells to see if there is a difference in translation of theprotein.Experiment 3.3.2: 35 S pulse-chase experimentsCells will be synchronized as explained in Appendix B1 and cultured as described in Appendix B1.1. ROSlevels will be manipulated, together with the addition of nocodazole, 2 hours before the start of mitosis asdescribed for experiments 3.1.1 and 3.1.2.To see whether the proteins affected by ROS are regulated at the level of translation, the rate oftranslation will be monitored through a 35 S pulse-chase experiment. This technique uses a radioactiveamino acid that is incorporated into the translated protein. Incorporation of 35 S-cysteine into the protein ofinterest can be observed in SDS-PAGE and can later be quantified using a phosphorimager (AppendixB3.3.3).Question 3.3.3: Are the affected proteins regulated on the level of degradation?In the G1/M checkpoint, the stability of the cyclins was shown to be ROS dependent (Havens et al., 2006).Checking the stability of the cyclins will show whether stability of the proteins changes with altered ROSlevels at G2/M transition. If a change in stability of the protein is observed, activity of APC/C will bechecked to investigate whether altered activity of APC/C is the reason behind altered cyclin levels.Question 3.3.3.1: Are cyclin A and cyclin B less stable in cells with manipulated ROS levels compared tocontrol cells?Experiment 3.3.3.1: Cycloheximide treatmentCells will be synchronized as explained in Appendix B1 and cultured as described in Appendix B1.1. ROSlevels will be manipulated, together with the addition of nocodazole, 2 hours before the start of mitosis asdescribed for experiments 3.1.1 and 3.1.2.Experiment groups and control cells will be treated with cycloheximide after cells are arrested in mitosis.Cycloheximide inhibits translation of all proteins and observation of the cyclin A and cyclin B levels inwestern blot at different intervals will give us information about how quickly proteins get degraded. CyclinA and cyclin B antibodies will be used together with actin antibody as a control (Appendix B3.3.4). Cellextracts will be gathered at three intervals for western blotting. Protein levels at these intervals will give usa clear indication of how stable the protein is. Comparison of protein stability in cells of the experimentcells to control cells will indicate if there is an altered regulation on the level of degradation resulting inaltered cyclin levels.Question 3.3.3.2: Is APC/C activity the reason behind instability of cyclin A and cyclin B?At the G2/M transition, APC/C activity is inhibited by preventing association of Cdh1 to APC/C. Cdc20, theother APC/C co-factor, is not present in this transition and is transcribed only after entry into mitosis andbinds to APC/C starting in metaphase. If APC/C is unexpectedly active in this transition, it is most likelydue to association with Cdh1. In G1/S cell cycle arrest due to altered ROS levels, it is shown that APC/Cdue to changed ROS levels binds to Cdh1 and thus becomes active (Havens et al., 2006) If degradation isshown to be the regulatory step, co-immunoprecipitation analysis (see Appendix A) of APC/C will beperformed in order to confirm that APC/C is the reason behind altered stability of the cyclins.Experiment 3.3.3.2: Co-immunoprecipitationSCI 332 Advanced Molecular Cell Biology Research Proposal 28

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Cells will be synchronized as explained in Appendix B1 and cultured as described in Appendix B1.1. ROSlevels will be manipulated, together with the addition of nocodazole, 2 hours before the start of mitosis asdescribed for experiments 3.1.1 and 3.1.2. When halted in prometaphase, cells will be fixed as describedin Appendix B3.1.3.After cells are arrested at prometaphase, cells will be lysed and co-immunoprecipitation will beperformed as explained in Appendix B3.3.5. Antibody against APC3, a subunit of APC will be used.Cell extracts of co-immunoprecipitation will be displayed in a Western blot to test whether Cdh1 is boundto APC, making it active.SCI 332 Advanced Molecular Cell Biology Research Proposal 29

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007ConclusionStudying regulation of the cell cycle is very valuable. Cancer, a result of abnormal cell cycle proliferation,is a leading cause of death and much research is aimed at identifying new targets for cancer treatment.The suggestion that a metabolic cycle and a redox cycle might influence the cell cycle in yeast is thereforehighly relevant. Much is still unknown about the influence of mitochondrial activity on the cell cycle inmammalian cells. Nonetheless, various lines of evidence suggest that mitochondrial activity might regulatethe cell cycle, possibly through its side-product, reactive oxygen species. This research will fill in the gapson the interplay of the metabolic cycle, redox cycle and cell cycle in mammalian cells.In the first part of this research, mitochondrial activity throughout the cell cycle will be characterized. Iffluctuations in activity are coordinated with the cell cycle, mutual interaction is likely. The first experimentwill show whether a metabolic cycle is present in mammalian cells, similar to the one in yeast. This wouldsuggest that such a cycle is conserved throughout evolution, and might be a universal phenomenon.Furthermore, characterization of the metabolic cycle together with cyclic fluctuations in ROS levels wouldprovide us with an idea on how mitochondrial activity can influence ROS levels throughout the cell cycle.Measurement of two parameters – mitochondrial membrane potential and oxygen consumption – allowsspeculation on how these different parameters might be differentially related to ROS production.If a metabolic cycle in mammalian cells proves not to exist, the subsequent steps in the researchproposal can still be carried out. Since there are still suggestions for a redox cycle, this would likely bemediated by other ROS producers, such as peroxisomes or NADPH oxidase. Their contribution can thenbe assessed.In the second part of the research, not only will it be established whether a redox cycle, or more precisely,a ROS cycle exists, but also whether mitochondria are the main contributors to this cycle. If thathypothesis proves to be correct, it strongly suggests that alterations in mitochondrial activity can modulatethe cell cycle through ROS. If the ROS production by peroxisomes or NADPH oxidases seems to be bettercorrelated with fluctuations in cytosolic ROS levels, this suggests that a mitochondria-independentmechanism might regulate cellular ROS levels.In case no fluctuations in ROS levels are found that are related to the cell cycle (i.e., fluctuationsare random), the evidence of regulation by ROS of certain cell cycle regulators should be more closelyinvestigated. It is possible that the cell cycle is redox-dependent, rather than redox-regulated, meaningthat it just needs a physiological range of ROS levels to function properly, rather than cell cycle phasespecificchanges.The last part of this research will focus on how ROS levels influence cell cycle progression. As this hasalready been shown to occur in G1/S-phase, this research will focus on the G2/M-phase, another pointthat has been expected to be sensitive to ROS levels. It will be investigated whether a change in ROSlevels between G1/S and G2 is required for transition from G2 to M-phase. If a change in progression ofcell cycle is observed, the altered pathway responsible for this change will be identified, and determinedwhich part of the pathway is affected by ROS.It is hypothesized that ROS will influence G2/M transition through regulation of APC. If APC regulation byROS seems to be occur both in G2/M and G1/S, this suggests that redox regulation of the entire cell cyclecould occur through manipulation of just a few proteins Further research should study the exactmechanism by which ROS might alter APC activity. Establishment of the dependency of G2/M to ROSlevels will strengthen the notion that physiological levels of ROS are required throughout the cell cycle fornormal cell cycle progression.As for the entire project it should be taken into account that measurements are only done in two cell types.Further experiments should validate the results of this research in more cell types, and in vivo.Even though this research will add many pieces to the puzzle of the relation between mitochondrialmetabolic activity, ROS levels and cell cycle progression, other pieces will still be left. Based on the resultsof this research, it might be interesting to investigate how other ROS producing organelles influenceSCI 332 Advanced Molecular Cell Biology Research Proposal 30

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007fluctuations in ROS levels throughout the cell cycle. Furthermore, it can be investigated at which otherpoints in the cell cycle ROS levels play an important role. Finally, it will be interesting to investigate howthe cell cycle influences mitochondrial activity. This would show a bidirectional interplay betweenmitochondria and the cell cycle and complete the picture of the relation between a metabolic cycle, redoxcycle and cell cycle.SCI 332 Advanced Molecular Cell Biology Research Proposal 31

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Proposed CostsSalary (PhD student):Bench-fee:40 000 EUR/year (total 160 000 EURO in 4 years)10 000 EUR/year (total 40 000 EURO in 4 years)Experiments andMaterials Year 1 Year 2 Year 3 Year 4General MaterialsCell lines €2.150 - - -Medium €400 €600 €600 €400Nocodazole €100 €100 €100 €100BrdU + antibodies €400 €400 €400 -Histone H3phosphorylation €500 €500 €500 €500Question 1Self-referencing system €23.000 - - -JC-1 mitochondrialdetection kit€200 - - -Question 2ROS probes €1.500 €1.500 - -Antioxidant enzyme kits - €800 - -Question 3Materials ROS level - - €400 -manipulationReal Time RT-PCR - - €500 -IP kinase assay - - - €1.000Antibodies - - - €5.00035 S pulse-chaseexperiment- - - €1.000Total: €5.250 €3.900 €2.500 €8.000€19.650For all machinery used during the proposed experiments, we will use the university as our resource forperforming these measurements. A total of € 242.650 funding is needed for the research proposal.SCI 332 Advanced Molecular Cell Biology Research Proposal 32

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Proposed TimelineFor the entire research, a four-year time span has been allotted. The estimated duration of thesubquestions in all cell lines and conditions is shown in this overview.Question 1: Are there cyclic fluctuations in mitochondrial metabolic activity that are coordinated with thecell cycle?The total time span of question 1, including data analysis, will be around six months. Measurement of oxygen consumption and BrdU-labelling:4 months Measurement of membrane potential and BrdU-labelling:2 monthsQuestion 2: Do ROS levels fluctuate throughout the cell cycle?Approximately 19 months will be allowed for question 2. Making and testing the Hyper and PF-1 probe: Measurement of cytosolic and mitochondrial superoxide and hydrogenperoxide levels: Measurement of peroxisomal hydrogen peroxide levels: Measurement of cytosolic superoxide and hydrogen peroxidewhile NADPH oxidase is inhibited: Control for laser-induced ROS production: Measurement of antioxidant activity: Data analysis:3 months5 months1 month2 months1 month3 months4 monthsQuestion 3: Is the G 2 /M transition controlled by redox-dependent regulation of cyclin-cdk complexes?The total time span of this question will probably cover eighteen months. Determination doses antioxidants, antimycin A and hydrogen peroxide: 4 months Cell cycle progression with FACS:2 months IP Kinase assay and Western blot:2 months Northern blotting and real time RT-PCR:3 months 35-S pulse-chase experiments:1 month Further co-immunoprecipitation:2 months Data analysis:4 monthsThis planning ensures that the last months of the four year time span are available for processing all thedata and combining it into a conclusive research. It also leaves some space for unforeseen events, suchas repetition of experiments.Question 1Question 2Question 3Total Data AnalysisYear 1 Year 2 Year 3 Year 4SCI 332 Advanced Molecular Cell Biology Research Proposal 33

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007ReferencesAdachi T., Fukushima, T., Usami, Y. and Hirano, K. (1993) “Binding of human xanthine oxidase to sulphated glycosamino glycans onthe endothelial cell surface.” Biochemistry Journal 289: 523- 527.Bae YS, Kang SW, Seo MS, Baines IC, Tekle E, Chock PB et al. (1997) ‘’Epidermal growth factor (EGF)-induced generation ofhydrogen peroxide. Role in EGF receptormediated tyrosine phosphorylation’’, J Biol Chem 272: 217–221.Boonstra, J. (2003) ‘’Progression through the G1-phase of the on-going cell cycle.’’ J. Cell. Biochem. 90: 244–252.Boonstra, J., Post, J.A. (2004) “Molecular events associated with reactive oxygen species and cell cycle progression in mammaliancells.” Gene 337: 1-13.Boveris A, Chance B., (1973) “The mitochondrial generation of hydrogen peroxide. General properties and effect of hyperbaricoxygen.” Biochem J. 134:707–16.Boveris, A. et al. (2006) “Mitochondrial metabolic states regulate nitric oxide and hydrogen peroxide diffusion to the cytosol.”Biochimica et Biophysica Acta 1757: 535-542Brar SS, Kennedy TP, Whorton AR, Murphy TM, Chitano P, Hoidal JR. (1999) “Requirement for reactive oxygen species in seruminducedand platelet-derived growth factorinduced growth of airway smooth muscle.” J Biol Chem 274: 20017–20026.Burch, P.M., and N.H. Heintz. (2005) “Redox regulation of cell-cycle re-entry: cyclin D1 as a primary target for the mitogenic effectsof reactive oxygen and nitrogen species.” Antioxid. Redox Signal. 7:741–751.Chance B, Williams GR (1956) “The respiratory chain and oxidative phosphorylation.” Adv.Enzymol. 17: 65-134Chen, Z. et al. (2007) “Restriction of DNA Replication to the Reductive Phase of the Metabolic Cycle protects Genome Integrity.”Science 316: 1916-1919Conour, J.E., Graham, W.V., and H.R. Gaskins. (2004) “A combined invitro/bioinformatic investigation of redox regulatorymechanisms governing cell cycle progression”. Phyiosol Genomics 18: 196-205.Daugherty, A., Dunn, J.L., Rateri, D.L., Heinecke, J.W. (1994) “Myeloperoxidase, a catalyst for lipoprotein oxidation, is expressed inhuman atherosclerotic lesions.” Journal of Clinical Investigation 94(1):437-44.De Duve, C., Baudhuin, P. (1966) “Peroxisomes (microbodies and related particles).” Physiological Review 46: 323–357.Dröge W. (2002) “Free radicals in the physiological control of cell function.” Physiol Rev. 82:47–95.Erich A. Nigg. (2001) “Mitotic Kinases as Regulators of Cell Division and its Checkpoints.” Nature Reviews 2: 21-32.Finkel, T., Holbrook, N.J. (2000) ”Oxidants, oxidative stress and the biology of ageing.” Nature 408: 239–247.Foster et al. (2006) “Optical and pharmacological tools to investigate the role of mitochondria during oxidative stress andneurodegeneration”. Progressive neurobiology 79:136-171Gnaiger, E. (2007) “MitoPathways: respiratory states and flux control ratio’s”. Mitochondrial Physicology Network 12.15: 1-9.Hames, R.S., S.L. Wattam, H. Yamano, R. Bacchieri, A.M. Fry (2001) “APC/C-mediated destruction of the centrosomal kinaseNek2A occurs in early mitosis and depends upon a cyclin A-type D-box.” The Embo Journal 20: 7117-7127.Harborth, J., S.M. Elbashir, L. Berchert, T. Tuschl and K. Weber (2001) ”Identification of essential genes in cultured mammalian cellsusing small interfering RNAs.” J Cell Sci 114: 4557–4565.Havens, C. G., A. Ho, Yoshioka, N., and Dowdy, S. F. (2006) “Regulation of Late G1/S Phase Transition and APC by ReactiveOxygen Species.” Mol. Cell. Biol. 26: 4701–4711.Hendzel, M.J., Y. Wei, M. A. Mancini, et al. (1997) “Mitosis-specific phosphorylation of histone H3 initiates primarily withinpericentromeric heterochromatin during G2 and spreads in an ordered fashion coincident with mitotic chromosome condensation”.Chromosoma. 106:348-360.Jahngen-Hodge J, Obin MS, Gong X, Shang F, Nowell Jr TR, Gong J et al. (1997) “Regulation of ubiquitin-conjugating enzymes byglutathione following oxidative stress.” J Biol Chem 272: 28218–28226.Junn E, Lee KN, Ju HR, Han SH, Im JY, Kang HS et al. (2000) “Requirement of hydrogen peroxide generation in TGF-beta 1 signaltransduction in human lung fibroblast cells: involvement of hydrogen peroxide and Ca2+ in TGFbeta 1-induced IL-6 expression.” JImmunol 165: 2190–2197.Kakkar, P. and B.K. Singh (2007) “Mitochondria: a hub of redox activities and cellular distress control”. Molecular CellularBiochemistry. 305: 235-253Knapp LT, Klann E. (2000) “Superoxide-induced stimulation of protein kinase C via thiol modification and modulation of zinc content.”J Biol Chem 275: 24136–24145.Lee, S. et al. (2007) “Cell cycle-dependent mitochondrial biogenesis and dynamics in mammalian cells”. Biochemical and biophysicalresearch communications 357: 111-117SCI 332 Advanced Molecular Cell Biology Research Proposal 34

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Lida, R. et al. (2003) “M -LP, Mpv17-like protein, has a peroxisomal membrane targeting signal comprising a transmembrane domainand a positively charged loop and up-regulates expression of the manganese superoxide dismutase gene.” Journal BiologicalChemistry 278: 6301–6306.Lloyd, D., Murray, D.B. (2007) “Redox rhythmicity: clocks at the core of temporal coherence”. BioEssays 29: 465-473.Martinez-Diez, M. et al. (2006) “Biogenesis and dynamics of mitochondria during the cell cycle: significance of 3’UTRs” PLoS One1(1):e107Menon, S.G., P.C. Goswami (2007) “A redox cycle within the cell cycle: ring in the old with the new.” Oncogene 26: 1101-1109.Moore, J.D., J.A. Kirk and T. Hunt (2003) “Unmasking the S-phase-promoting potential of cyclin B1.” Science 300: 987–990.Morgan D.O (1999) “Regulation of the APC and the exit from mitosis.”Nature Cell Biology 1: E47-E53.Osbourn, D.M., R.H. Saner and P.J.S. Smith (2005) “Determination of single-cell oxygen consumption with impedance feedback forcontrol of sample-probe separation”. Analytical Chemistry 7: 6999-7004.Porterfield, M. (2006) “Measuring metabolism and biophysical flux in the tissue, cellular and sub-cellular domains: Recentdevelopments in self-referencing amperometry for physiological sensing.” Biosensors and Bioelectronics 22:1186–1196Rane, S.G., P. Dubus, R.V. Mettus, E.J. Galbreath, G. Boden E.P. Reddy (1999) ”Loss of Cdk4 expression causes insulin-deficientdiabetes and Cdk4 activation results in beta-islet cell hyperplasia.” Nat Genet 22: 44–52.Reed, Steven I. (2003) “Ratchets and Clocks: The Cell Cycle, Ubiquitylation and Protein Turnover.” Nature Reviews 4: 855-864.Reinke, H. And D. Gatfield (2006) “Genome-wide oscillation of transcription in yeast” Trends in biochemical sciences 31: 189-191Rhee S.G. (1999) “Redox signaling: hydrogen peroxide as intracellular messenger.” Exp Mol Med 31: 53–59.Sakamaki et al. (2006) “Cyclin D1 determines mitochondrial function in vivo”. Molecular and cellular biology 26: 5449-5469Sánchez I. and B.D. Dynlacht (2005) “New insights into cyclins, CDKs, and the cell cycle control.” Seminars in Cell & Developmentbiology 16: 311-321.Schafer, F.Q., Buettner, G.R. (2001) Redox environment of the cell as viewed through the redox state of the glutathionedisulfide/glutathione couple. Free Radical Biological Medicine 30: 1191–1212.Sudo, T., Y. Ota, S. Kotani, M. Nakao, Y. Takami, S. Takeda, H. Saya (2001) “Activation of Cdh1-dependent APC is required for G1cell cycle arrest and DNA damage-induced G2 checkpoint in vertebrate cells.” The Embo Journal 20: 6499-6508.Takahashi Y., Ogra Y., Suzuki K., (2004) “Synchronized generation of reactive oxygen species with the cell cycle”. Life sciences 75:301-311Teshima, Y., M. Akao, R. A.. Li, et al. (2003) “Mitochondrial ATP-sensitive potassium channel activation protects cerebellar granuleneurons from apoptosis induced by oxidative stress”. Stroke 34: 1796-1802.Tetsu, O., F. McCormick (2003) ”Proliferation of cancer cells despite CDK2 inhibition.” Cancer Cell 3: 233–245.Tsutsui, T., B. Hesabi, D.S. Moons, P.P. Pandolfi, K.S. Hansel and A. Koff et al (1999) “Targeted disruption of CDK4 delays cellcycle entry with enhanced p27 (Kip1) activity.” Mol Cell Biol 19: 7011–7019.Tu, B. P. et al. (2005) “Logic of the Yeast Metabolic Cycle: Temporal Compartmentalization of Cellular Processes.” Science 310:1152-1158Wang, C. et al. (2006) “Cyclin D1 repression of nuclear respiratory factor 1 integrates nuclear DNA synthesis and mitochondrialfunction”. PNAS 103: 11567–11572Zhou, Y., Y-P. Ching, W.M. Raymond, D-Y. Jin (2002) “The APC regulator CDH1 is essential for he progression of embryonic cellcycles in Xenopus.” Elsevier Science 294: 120-126.Zorov D., Filburn C., Klotz O., Zweier J., Sollott S. (2000) “Reactive Oxygen Species (ROS)-induced ROS Release: A NewPhenomenon Accompanying Induction of the Mitochondrial Permeability Transition in Cardiac Myocytes”. The Journal ofExperimental Medicine 192: 1001-1014Zwacka, R.M. et al. (1994) “The glomerulosclerosis gene Mpv17 encodes a peroxisomal protein producing reactive oxygen species”EMBO Journal 13: 5129–5134.SCI 332 Advanced Molecular Cell Biology Research Proposal 35

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Checking the Checkpoint:Understanding the Influence of AMPKAMPK as the mediator of energy-dependent cell cycle progression, and its effects onenergy production mechanisms through the G1 energy checkpoint in mammalian cellsResearch Proposal byA.M. Albers, L.M. Hamerslag, E. Khalil, H.M. Melse, M. Silanikove, M.J.K. Stolte, J. WalkAbstractSuccessful completion of the cell cycle in mammalian cells requires a significant amount of energy. DuringG1 phase a cell’s energy levels are checked, an event in which the protein AMP-activated protein Kinase(AMPK) is thought to play a central role. AMPK becomes phosphorylated as a result of low levels of ATPor hypoxia, making it a reliable sensor of cellular energy. The activation of AMPK has been found toinfluence many cellular processes including cell cycle progression and regulation of energy production incertain cell types. This research will combine several roles of AMPK that have been determined indifferentiated cells and relate their function to the checkpoint in G1 in proliferating cells. Regarding energyproduction mechanisms, AMPK’s influence on glycolysis, oxidative phosphorylation and fatty acidoxidation is studied under several circumstances. Regarding cell cycle progression, the influence ofhigher-than-normal levels of AMPK on cell cycle arrest and apoptosis will be investigated. Furthermore,we will study the influence of AMPK on mitochondrial network morphology as a result of AMPK inducedcell cycle arrest. Finally, we propose a model for the functioning of AMPK as the central mediator of theenergy checkpoint in the G1 phase of differentiating mammalian cells.Figure 2.1: Overview of the central role of AMPK in cell cycle progression/arrest andenergy production. Many more pathways originate from AMPK activity, but onlyconnections relevant to this proposal are shown here.SCI 332 Advanced Molecular Cell Biology Research Proposal 36

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007IntroductionMammalian cells going through the cell cycle are thought to have an energy checkpoint in the G1-phase,which is hypothesized to check whether energy levels are sufficient to proceed to S-phase. AMP-activatedprotein kinase (AMPK) plays a central role in this checkpoint by measuring ATP availability through AMPlevels, since AMP levels increase as ATP levels drop. Activated AMPK is thought to have many effects inthe cell, the major ones of interest in our experiments being influences on cell cycle progression and arrestas well as energy production.Research goalThe goal of this research is to verify a proposed model of AMPK function in proliferating mammalian cells.We theorize that AMPK plays a role in multiple processes within the cell. Firstly, higher-than-normal levelsof activated AMPK induce cell cycle arrest, in some cases followed by apoptosis; secondly, high AMPKlevels upregulate certain mechanisms involved in energy production (Figure 2.1). These two processesare linked in a logical interdependent manner. As soon as AMPK activation exceeds a “threshold value”because of abnormally low levels of ATP (or rather, high levels of AMP), the first consequence observed iscell cycle arrest. The energy supply is insufficient for the cell (probably insufficient to successfullycomplete DNA synthesis, a demanding energy consuming process for which high levels of ATP areneeded). Therefore, instead of proceeding into S-phase, the cell cycle is halted in G1-phase.We theorize that at the same time, activated AMPK causes the upregulation of energy-producing,catabolic pathways, such as glycolysis and fatty acid oxidation. This seems a logical consequence, sincethe apparent cause of the AMPK activity is abnormally low levels of energy; hence, the cell is in need ofincreased energy production. AMPK influence on energy producing mechanisms has been shown indifferentiated cells (Dyck & Lopaschuk, 2006).Furthermore, we know that AMPK activity can cause apoptosis. In our model, this is proposed as thecell's last resort: the energy level of the cell could not be restored sufficiently. Therefore, prolonged AMPKactivity, if unsuccessful in restoring normal energy levels leads to apoptosis. This research aims atconverging already established knowledge on AMPK and evaluating it in the context of the ongoing cellcycle and energy metabolism (see Figure 2.2).Figure 2.2: Proposed Model for AMPK functioning in the cell. Wepropose a model in which the three processes cell cycle arrest,energy-producing processes and apoptosis are linked in a logicalmannerRelated to AMPK’s regulation of cell cycle progression could be a potential effect of AMPK on themorphology of the mitochondrial network of a cell. Changes in the structure of the mitochondrial networkhave been postulated to be important in cell cycle progression, cell differentiation and apoptosis, as wellas energy producuction (McBride et al., 2006; Margineantu et al., 2002; Alirol & Martinou, 2006; Arakaki etSCI 332 Advanced Molecular Cell Biology Research Proposal 37

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007al., 2006). Based on the literature reviewed, we hypothesize that a cell’s entry into a quiescent statecauses changes in the dynamics of mitochondria and a subsequent change in the morphology of themitochondrial network. In the final part of our project we will investigate whether such changes indeed takeplace and whether they are actually related to the energy-regulating function of AMPK.Besides its essential role in energy homeostasis in the cell, AMPK has been suggested to be involved invarious mitochondrial diseases. Additionally, because of the link between AMPK and cell cycle arrest andapoptosis, results of this research could be valuable for cancer research. Moreover, both mitochondrialmorphology and metabolism are usually altered in cancerous cells, so our insights could help identifyingspecific traits in tumor cells. Lastly, AMPK has also been suggested to play a role in diabetes andischemic reperfusion injury (Bokko et al., 2007).HypothesesOur main hypothesis, summarizing the model described above, is:AMPK and its effects on energy production mechanisms mediate energy-dependent cell cycleprogression in G1 in mammalian cells.We will look at three different aspects of AMPK in our research. First, we will study the effects of activeAMPK on glycolysis, oxidative phosphorylation and fatty acid oxidation. Secondly, we will research therelation between AMPK activation and cell cycle arrest and apoptosis. Lastly, we will look into whethermorphological changes in the mitochondrial network can be induced by AMPK when it causes cell cyclearrest.Hypothesis 1AMPK activation mediates energy production to maintain the cell’s energy balance under acutemetabolic stress. It will do this by influencing the following Energy generating processes: glycolysis,Oxidative phosphorylation (Oxphos) and Fatty Acid Oxidation (FAO).Hypothesis 2AMPK induces cell cycle arrest in response to glucose depletion at multiple points in G1. ProlongedAMPK activation induces apoptosis in early G1 but not in late G1.Hypothesis 3AMPK-induced cell cycle arrest can cause morphological changes in the mitochondrial network.BackgroundAMPK, ATP and MetabolismAdenosine-MonoPhosphate-activated protein Kinase (AMPK) is a protein that plays a regulatory role inthe cell cycle and in the cell’s energy metabolism. Its activation depends on the ATP:AMP ratio in the cell.AMPK is inactive when ATP levels are normal, and active when ATP levels are low (Hardie et al., 2005).When ATP is low the cellular enzyme adenylate kinase converts two molecules of ADP to ATP and AMPas illustrated by the following equation: ADP + ADP ATP + AMP. The action of the enzyme adenylatekinase makes cellular AMP levels dependent on ATP levels (Berg et al., 2006).Since the produced ATP is immediately used by the cell, AMP ratios increase rapidly when a cellsuffers from energy shortage, making AMPK a sensitive sensor of cellular energy levels. AMPK, is aheterotrimeric enzyme which consists of an α1 or α2 catalytic subunit and two regulatory subunits: β1 orβ2 in combination with either γ1, γ2 or γ3 (Tzatsos et al., 2007). The γ-subunits allosterically bind AMP aswell as ATP. AMP, however, has a higher affinity for AMPK than ATP and is needed for AMPK activationvia phosphorylation. This is why AMP and not ATP levels determine AMPK activity in the cell. In addition,binding of AMP prevents dephosphorylation by phosphotases (Long et al., 2006). So far, two upstreamkinases have been shown to activate AMPK by phosphorylating a specific threonine residue (Thr-172): thetumor suppressor LKB-1 and calmodulin-dependent protein kinase kinase β, CaMKKβ, which responds toSCI 332 Advanced Molecular Cell Biology Research Proposal 38

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007changes in calcium levels. In addition, AMPK has been shown to be activated by 5-aminoimidazole-4-carboxamideriboside (AICAR) in LKB-1 deficient HeLa cells. Thus, it is possible to activate AMPK in anLKB-1 independent fashion. AICAR is phosphorylated and mimics AMP, thereby inducing its effect onAMPK without changes in the actual AMP:ATP ratio (Sun et al., 2007). Furthermore, AICAR has beenshown to be a direct activator of AMPK (Kaushik et al., 2001). The use of AICAR as an activator of AMPKexclusively is controversial and previous studies postulate that AICAR influences other pathways besidesAMPK (Woods et al., 2000). Therefore, we will use AICAR only in case constitutively active AMPK is notan option and after the specific effect of energy depletion on the systems under study has beendetermined.Activated AMPK has various effects. Firstly, cell cycle arrest is induced, a phenomenon that hasencouraged researches to name this specific activation of AMPK ‘the energy checkpoint’. Secondly,energy consuming processes are inhibited and energy producing mechanisms are up-regulated (seeFigure 2.3).Figure 2.3: The regulatory role of AMPK in cell metabolism (http://www.innovitaresearch.org).Cellular metabolism can be divided into anabolic and catabolic processes. In anabolic processes, such asprotein synthesis, ATP is used to fuel energy-demanding pathways that build essential molecules fromsmall units. Catabolic metabolism on the other hand, is the process of substrate uptake (oxygen, glucose,fatty acids, etc.) and their conversion into energy through a series of controlled oxidation and reductionreactions. These intracellular biochemical processes result in the production of ATP.Three main catabolic pathways are glycolysis, oxidative phosphorylation and fatty acid oxidation.Glycolysis takes place in the cytosol and is the conversion of glucose to pyruvate, which then can enterthe mitochondrial citric acid cycle. Oxidative phosphorylation is the process of cellular respiration,involving the formation of ATP from ADP and a phosphate group that takes place in the electron transportchain in the inner mitochondrial membrane. Lastly, fatty acid oxidation involves transport of fatty acids intothe mitochondria, and the formation of acyl-CoA with CoA. This is converted to acetyl-CoA, which caneventually enter the citric acid cycle.In general, AMPK is known to inhibit anabolic pathways and activate catabolic pathways uponincreased energy demand in certain differentiated cells. For example, AMPK is involved in glycolysis andfatty acid oxidation, but there is insufficient research indicating a direct relation between AMPK and therates of oxidative phosphorylation in the cell. In some cases, it is even suspected that Oxphos could beinhibited by AMPK activation (Hue et al., 2003), but so far this has only been confirmed via indirectpathways in tumor cells (Wu et al., 2007).Glycolysis, Oxidative Phosphorylation (OXPHOS) and AMPKThe conversion of glucose via pyruvate to lactate is the only way by which the cell can produce energywithout using oxygen. Oxidative phosphorylation further breaks down pyruvate and is a far more efficientATP source. However, certain tumor cells inhibit mitochondrial respiration and mainly glycolysis, despitethe presence of oxygen, an observation called the Warburg effect (Brand et al., 1997).AMPK is thought to function as an emergency signal that is activated upon metabolic stress. Its roleis to conserve ATP levels and in this way restore energy homeostasis (Hue et al., 2003). Glucose uptakeand glycolysis are increased when cells re-enter the cell cycle and start proliferating. This indicates theimportance of glucose as essential energy source for proliferating cells (Brand et al., 1997; Frauwirth andThompson, 2004). Why proliferating cells deal with increased energy requirements by upregulatingglycolysis despite the fact that it is a far less efficient ATP production system than the oxidation of glucose,is still unknown. The most common hypothesis is that this form of energy production protects the cell fromSCI 332 Advanced Molecular Cell Biology Research Proposal 39

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007damage in the critical phase of DNA replication induced by Reactive Oxygen Species (ROS) (Brand et al.,1997). Glycolysis is increased during cell cycle progression, reaching a peak in the S phase. This peak ischaracterized by up-regulation of glycolytic enzyme activity and increased lactate production. Inproliferating cells, 86% of ATP is derived from glucose breakdown to pyruvate and lactate (Brand et al.,1997). This rate of glycolysis is much higher than that in differentiated cells.In ischemic myocardium (a condition in which the heart muscle tissue is deprived from oxygen),activated AMPK has been shown to stimulate glycolysis by activating Phosphofructokinase 2 (PFK2),which is an upstream regulator of PFK1. PFK1 is a major glycolytic enzyme that has been found to be upregulateddirectly by AMP. It catalyses the most regulated step of glycolysis: the conversion of fructose 6-phosphate and ATP to fructose 1,6-biphosphate and ADP (Hue et al., 2003). In addition, AMPK is knownto activate glycolysis in skeletal muscle cells in response to hypoxia (depletion of oxygen) or musclecontraction, for which much energy is needed (Hue et al., 2007). Chronic or acute AMPK activation inskeletal muscle increases GLUT4 and GLUT1 expression, which results in increased glucose uptake (Hueet al., 2003). Lastly, changes in AMPK activity are shown to regulate glucose production in differentiatedliver cells as well (Viollet et al., 2006).We suggest that AMPK activation in G1 will induce glycolysis (among other metabolic processes) inorder to re-establish the energetic balance that will enable the cell to progress through the cell cycle. Thisresearch aims to draw a more complete picture of the influence of AMPK on glycolysis in normalproliferating cells and in relation to AMPK-induced cell cycle arrest.Fatty acid oxidation (FAO) and AMPKIn addition to its role in glycolysis, AMPK is known to regulate FAO. In its active form, it increases bothprocesses in response to energy demand induced by ischaemia or hypoxia (Dyck and Lopaschuk, 2006).However, in the absence of those conditions, the effects of AMPK activity on fatty acid oxidation areunknown. In many tissues, such as heart cells, the rate of fatty acid oxidation depends on the plasmaconcentration and transport of fatty acids (Dyck and Lopaschuk, 2006). Also in heart tissue, AMPK playsan important role in regulating Malonyl CoA levels. Malonyl CoA inhibits CPT1, which is a mitochondrialouter membrane enzyme that is involved in transport of fatty acids into the mitochondria for oxidation. It issuggested that both acetyl CoA carboxylase (ACC) and malonyl CoA decarboxylase (MCD), whichinfluence malonyl CoA levels, are under direct phosphorylation control of AMPK (Dyck and Lopaschuk,2006). In addition, some studies demonstrate that activation of AMPK participates in the contractioninducedfatty acid oxidation in muscle cells (Suzuki et al., 2007). We suspect that AMPK activation willresult in increased fatty acid oxidation, possibly via the interaction with the enzymes mentioned above.AMPK as a regulator of the cell cycleBesides multiple effects of active AMPK on the cell's metabolism, it induces cell cycle arrest in G1 andpossibly apoptosis in proliferating cells (Jones et al., 2005; Tzatsos et al., 2007). AMPK inducesphosphorylation of p53 at a specific seronine residue, Ser-15. When p53 is phosphorylated at Ser-15 it isnot targeted for degradation anymore and stabilizes within the cell. P53 subsequently up-regulatestranscription of p21 which is thought to bind and inhibit the cyclinE/Cdk2 complex (Mandal et al., 2005).P21 inhibits the activity of cyclinE/Cdk2 which when active, phosphorylates Rb, inducing E2F genetranscription needed for entry into S-phase. Thus, by stabilizing p53 in the cell, AMPK induces cell cyclearrest.Previous research has demonstrated significant changes in the levels of a number of proteins when cellsenter quiescence. Specifically levels of cyclin D1 as well as cyclin B exhibit a salient decrease upon entryinto the quiescent state (Pajalunga et al., 2007; Huss et al., 2000). Furthermore, the normal build up ofcyclin A towards the end of G1 is suppressed during quiescence. In addition, P130, which is a pocketfamily member protein of Rb, has been shown to be highly expressed in quiescent cells, whereas Rb itselfis mainly present in its unphosphorylated form (Blomen and Boonstra, 2007).The PI3-Kinase / Akt pathway has been postulated to be a central mediator of progression through G1. Ithas been demonstrated that inhibition of the PI3-kinase pathway shortly after or during mitosis leads toirreversible cell cycle arrest in early G1, followed by apoptosis (Hulleman, et al., 2004).SCI 332 Advanced Molecular Cell Biology Research Proposal 40

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Furthermore, AMPK, activated by glucose deprivation, phosphorylates IRS-1 at Ser-794. This leads to thesuppression of the PI 3-kinase/ Akt pathway and subsequent apoptosis. Via co-immunoprecipitation it wasshown that both α catalytic subunits of AMPK bind IRS-1 in response to glucose deprivation (Tzatsos andTsichlis, 2007).Therefore, we hypothesize that under low energy conditions, AMPK induces early G1 cell cyclearrest through the action of IRS-1 on the PI3-kinase pathway, which is illustrated in Figure 2.4.Figure 2.4: Proposed pathways for cell cycle arrest and apoptosis in G1.A novel role for p53 as a regulator of the cell cycle after AMPK activation has been indicated in recentresearch (Jones et al., 2005). It was found that p53 is required to induce AMPK dependent cell cyclearrest at the end of G1. Although p53 has been mainly acknowledged as a pro-apoptotic protein, recentfindings suggest that here p53 mediates AMPK induced, reversible cell cycle arrest. In this way p53promotes cell survival. However, these results implicate a role for p53 only in the checkpoint at the end ofG1, whereas its involvement in the early G1 checkpoint still needs to be elucidated.A well established checkpoint in G1 is the restriction point, R which solely depends on the availability ofgrowth factors. Up to this point a cell will enter quiescence if growth factors are not available. Once a cellpasses R its progression into S-phase is no longer dependent on growth factors (Cooper and Hausman,2007). In general, it is assumed that cells cannot go into cell cycle arrest beyond this point. However, toour knowledge the influence of energy deprivation on cell cycle progression after R, has not beeninvestigated so far.Mitochondrial network dynamicsIn the cell, mitochondria exist as a network of dynamic organelles. Mitochondria are generally connected,forming filaments that reach throughout the cytosol. Individual mitochondria undergo fusion and fission,and the balance between these dynamics determines the overall morphology of the network. The exactreason for this morphology is unknown (Rube and Bliek, 2004). Many theorize that it is a way to distributeenergy throughout the cell, because the mitochondrial membrane potential, critical for ATP production, isthe same throughout the filamentous structure (Westermann, 2002). The morphology of the network isknown to change when cells differentiate. In some cell types, such as myoblasts and spermatocytes theexpression levels of fusion proteins increase drastically during differentiation (McBride et al., 2006).Furthermore, in fully differentiated cells, the majority of mitochondria tends to be located in a specific partof the cell, depending on the cell type (Arakaki et al. 2006). In fibroblasts, the overall mitochondrialmorphology seems to be interconnected and extending throughout the entire cytosol (Westermann, 2002).Mitochondrial morphology and the cell cycleSCI 332 Advanced Molecular Cell Biology Research Proposal 41

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007In proliferating cells, the morphology of the mitochondrial network differs throughout the cell cycle. Themajority of research into the morphology of the mitochondrial network has focused on changes during theG2-M phase transition. These researches foundthat mitochondria displayed a thread-like structure rightbefore the onset of mitosis and that during mitosis themitochondrial tubular network is disorganized and undergoesincreased fission (Martínez-Diez et al., 2006).Margineantu et al. (2002) found that the morphology of themitochondrial network changed in a specific pattern throughoutthe cell cycle of human osteosarcoma (bone cancer) cells.They measured the morphology by the percentage ofobserved cells that had fragmented mitochondrial networks asopposed to reticular morphology. In an asynchronous cellculture about 40% of cells have reticular mitochondria andabout 50% have fragmented morphologies. Significantly lessresearch has been done on the network morphology during G1and S. In cells leaving G0 and entering G1 (after addition ofnutrient serum), the number of fragmented morphologiesdecreased rapidly. In S-phase, however, the majority of thecells have fragmented morphologies. Figure 2.5 summarizesthese data.Figure 2.5: shows the changes in the mitochondrialnetwork as a synchronous cell culture progressesthrough the cell cycle. The nutrient medium used isfetal calf serum (Margineantu et al., 2002).Currently, there are several theories about why the mitochondrial network morphology changes during thecell cycle. Firstly, several studies have reported that increasing fission (i.e. tipping the balance betweenfusion and fission towards fission) decreases cellular respiration, and that increasing fusion increasesrespiration. Thus it is possible that increased fusion takes place in G1 to facilitate greater energyproduction (Alirol and Martinou, 2006). Other research has suggested that mitochondria fuse to first mixgenetic material to ensure proper heredity. The mitochondrial genome has a higher mutation rate than thenuclear genome, and lacks repair mechanisms. By constantly mixing and recombining their geneticmaterial mitochondria prevent expression of mutant phenotypes. It is most likely that the networkundergoes increased fission to separate and distribute mitochondria evenly between daughter cells(Westermann, 2002).The major molecular aspects of fission and fusionMitochondrial fission is controlled by a number of proteins. The most important protein involved is Drp1.Drp1 is a GTPase protein that is normally located throughout the cytosol and becomes localized to themitochondria specifically for fission. Mitochondrial division cannot take place without Drp1, a protein thatself-assembles its units into larger structures and cleaves the mitochondrial membranes through GTPhydrolysis. Several other proteins are important in the division complex, including hFis1, a mitochondrialmembrane protein, and Caf4 (Hoppins et al., 2007). The precise mechanism by which Drp1 is activatedand localized to the mitochondria is not known, although recent research showed that cyclic AMPdependentprotein kinase could phosphorylate Drp1 (Cribbs and Strack, 2007). Drp1 can also bephosphorylated by Cdk1/cyclin B during mitosis (Taguchi et al., 2007).Mitochondrial fusion on the other hand, is regulated by three different proteins. Mfn1 and Mfn2 areproteins located in the outer membrane of the mitochondria, and therefore have cytosolic domains. Opa1,the third protein, is associated with the inner membrane. Fusion is initiated when mitofusins on differentorganelles interact and tether. Fusion proceeds through the GTPase activities of these fusion proteins(Chen and Chan, 2005). Currently, it is not clear exactly how the activity of mitofusins is controlled(Hoppins et al., 2007).SCI 332 Advanced Molecular Cell Biology Research Proposal 42

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Proposed ResearchCell lines and CultureIn all of our experiments we will use mouse embryonic fibroblasts (MEFs). The cells will be isolated frommouse embryos and immortalized. Cell lines will be cultured at a temperature of 37 Celsius, at constantatmospheric PH; 95% air and 5% carbon dioxide. These cells are especially useful for our project becausethey are relatively inexpensive, un-differentiated and rapidly proliferating. We chose immortalized cellsbecause we need large quantities of cells, and would like to conserve the cell line throughout ourexperiments. Despite immortalization these cells have a normal cell cycle, maintain contact inhibition andcontain the vital cell cycle pathways (Cell Line Database). Cells will be grown in complete DMEM mediumcontaining 25mM of glucose, as well as 2 mM glutamine, 100 U/ml penicillin100, and 10% new born calfserum (Chen et al., 2006).To verify the information we obtain with the MEF cells, we will use a second cell line to repeat anyexperiments we deem critical at the end. We will use CHO-Chinese hamster ovary epithelial cells. Cellswill be supplied by the American Type Culture Collection (ATCC).Synchronizing cellsFor all our experiments we will need a cell culture of synchronized cells. In order to synchronize the cells,we will use mitotic shake-off (Appendix A). Mitotic Shake-off is a reliable method that starts thesynchronized cell cycle in G1, which is advantageous for us since we are interested in especially this partof the cell cycle. Cells will remain well synchronized for at least 1 cell cycle.Cell cycle length and G0 – determination of standards in our cell line0.1 How long is a normal cell cycle and how long are its phases?Since an important part of this research will focus on the cell cycle progression and cell cycle arrest, it isimportant to know the length of a cell cycle in our cell line. We will also determine the length of theseparate phases, so we can compare the length of G1 in this experiment with the possibly prolonged G1in experiment 2. We expect the cell cycle to be approximately 24 hours (Norbury & Nurse, 1992), thereforewe will measure for 30 hours.Experiment 0.1For this experiment we will take cells that are grown on a complete medium and have not been subjectedto any experiments, measurements, or other intervening conditions. The cell culture will be synchronizedand divided up in 60 small samples. Every 30 minutes a sample will be used to determine the phase thecells are in. The cells will be fixed and permeabilized. The cell phase will be determined by the “Cell phasedetermination Kit” from Cayman Chemicals (Appendix A) according to the protocol. By propidium iodidestaining, the DNA content of the cell can be determined with a flow cytometer, which allows us todetermine the percentage of cells in a sample that are in G0/G1, G2 or S phase. M phase will becalculated.We will start measuring G1 as soon as over 50% of the cells are in this phase. We willsubsequently measure one of the samples every 30 minutes and determine the phase according to thephase >50% of the cells are in. The length of M-phase will be determined when the first cycle is almostcompleted, because with mitotic shake-off, we do not know where in M phase the cells actually start. Thelength of M will be determined by the length of the total cell cycle (determined when over 50% of the cellsare in G1 for the second time) minus the length of the other phases.0.2 What are the physiological concentrations of ATP, Cyclin A, B and D1,phosphorylated/unphosphorylated AMPK and phosphorylated/unphosphorylated Rb throughout the cellcycle?These protein levels are of importance for the following experiments, therefore a reference of thephysiological conditions is required for the specific cell line we use.SCI 332 Advanced Molecular Cell Biology Research Proposal 43

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Experiment 0.2The cells will be synchronized and a western blot (Appendix A) will be performed every 2 hours throughoutthe cell cycle. The antibodies used are obtained from Abcam (www.Abcam.com):Rb: (phospho S249 + T252) antibodyCyclin A: Cyclin A antibody (rabbit polyclonal, ab7956)Cyclin B: Cyclin B antibody (rabbit polyclonal, ab32053)Cyclin D1: cyclin D1 antobody (rabbit polyclonal 31450)AMPK: AMPK beta 1 antibody (Y367, ab 32382)pAMPK: AMPK beta 1 phospho S181 (rabbit polyclonal, ab55311).Protein levels will be determined and fluctuations throughout the cell cycle will become visible.0.3 What are the physiological concentrations of ATP, Cyclin A, B and D1,phosphorylated/unphosphorylated AMPK, phosphorylated/unphosphorylated Rb throughout G1?The cell cycle phase of our interest is G1, therefore a detailed knowledge of the fluctuations of theseproteins in G1 is required as a comparison for our later research.Experiment 0.3The experiments in 0.2 will be repeated, this time throughout G1, every 30 minutes.0.4 Measurement of AMPK activity.Throughout our experiments it will be useful to check the activity of AMPK, for example after inducingconstitutively active AMPK, glucose deprivation or AICAR activation. We will use this method to verifyAMPK activation in the rest of our experiments.Experiment 0.4We will use synchronized cells in which AMPK is activated. AMPK activity will be measured by a syntheticpeptide, SAM, as described by Zhou et al. (2001).1: AMPK and its effect on glycolysis, oxidative phosphorylation and fatty acidoxidation during G1 PhaseHypothesis 1: AMPK activation mediates energy production to maintain the cell’s energy balance underacute metabolic stress. It will do this by influencing the following Energy generating processes: glycolysis,Oxidative Phosphorylation (Oxphos) and Fatty Acid Oxidation (FAO).1.1 What are the fluctuation of glycolysis, Fatty Acid Oxidation and Oxidative Phosphorylation throughoutthe cell cycle?In order to gain an understanding of periodic changes in glycolysis in relation to AMPK, we initially want toestablish the changes that occur during the normal cell cycle of synchronized, proliferating cells. The rateof glycolysis has been observed to increase and reach a peak in S-phase (Brand et al., 1997). We willcheck the fluctuations throughout the cell cycle in our cell lines.We use a cell culture that is grown on complete medium and that has not been exposed to interveningconditions. Cells will be synchronized and divided into four samples. We will perform:1) Extracellular flux (FX) method, to determine the overall changes in glycolysis and oxidativephosphorylation, with the XF24 Extra Cellular Flux Analyzer as described by Hue et al. (2003).This machine will measure the uptake of oxygen and the production of lactate in real time(Appendix A).2) Metabolomics assay. With the metabolomics assay the intermediates of the energy generatingpathways can be screened for and relative quantities measured. Cells will be lysed and frozenimmediately at -45 degrees Celsius, to prevent changes in the metabolome. The analysis will beperformed by the Metabolomics Centre Utrecht at the UMC, or alternatively as described by vander Werf et al. (2007). An assay will be performed every 2 hours throughout the cell cycle andevery 30 minutes during G1.SCI 332 Advanced Molecular Cell Biology Research Proposal 44

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 20073) ATP levels will be measured using CellTiter-Glo Luminescent Cell Viability Assay as explained byWu et al. (2007). A luminescent signal will be generated that is proportional to the amount of ATPpresent in cells. The advantage of this method is that it yields a rapid, simple and sensitivedetermination of the ATP level in cells (Appendix A).4) During all these experiments small samples of cells will be taken to determine the cell phase andensure that the methods do not have an influence on cell cycle progression. This determinationshould correspond to the in experiment 0.1 established phases (Appendix A).1.2 Does AMPK activation regulate levels of glycolysis, FAO or Oxphos in G1phase of proliferating cells?The goal here is to measure the influence of AMPK on catabolic, energy generating processes. In theliterature it can be found that glycolysis as well as FAO is up-regulated through AMPK, but that oxidativephosphorylation is possibly inhibited in differentiated cells (Dyck and Lopaschuk, 2006). In this experimentAMPK will be activated under normal energy conditions, as determined in experiment 0.3, during the G1phase of the cell cycle.Experiment 1.2We use a synchronized cell culture in which ATP levels correspond to the ones determined in experiment0.3. These cells are transfected with constitutively active AMPK (CA-AMPK) with an inducible promoter.(Appendix C). In G1 AMPK will be allowed to be expressed by adding sodium arsenite. Subsequently,after 2 hours, the experiments as described in 1.1 will be performed. The results will be compared to thoseobtained in 1.1, to show the influence of AMPK on these pathways. If the data are clear enough, themetabolomics assay will also give us an indication of the specific enzymatic conversions in the pathwaysthat are up-regulated.1.3 Does AMPK that is activated by AMP also regulate energy production?This experiment is a control to 1.2. Here we activate AMPK in the “natural way” to check that the effectsinduced by AMPK in 1.2 are similar to “natural conditions”. If the effects are different, there might be adirect effect of the energy levels on energy production. We expect the latter, since AMP by itself is aregulator of the glycolytic enzyme phosphofructokinase (Kühn et al., 1974 & Pinilla and Luque, 1977).Experiment 1.3We will use glucose deprivation to lower ATP levels. Cells not treated with any intervening conditions willbe washed and then provided with medium containing 5mM glucose (this will be the standard amount ofglucose used for glucose deprivation throughout all experiments of hypothesis 1). The experiments in 1.1will be repeated and the results will be compared to 1.2.1.4 Is there a change in glycolysis, Oxphos or FAO under lower than normal energy conditions, withoutactive AMPK?To determine the effects of low energy conditions without the influence of AMPK we will inactivate AMPKand determine the effects on the energy producing mechanisms. The effects here should equal thedifference in results of 1.2 and 1.3. We theorize that these cells with inactive AMPK will most likely not beable to restore energy balance.Experiment 1.4In synchronized cells AMPK will be inhibited by compound C, a specific inhibitor of AMPK, obtained fromMerck. We will add compound C (C-(6-[4-(2-Piperidin-1-yl-ethoxy)-phenyl)]-3-pyridin-4-yl-pyyrazolo[1,5-a]pyrimidine) (Zhou et al., 2001) to the medium at a 40µM concentration suspended in Me 2 SO for 3 hourspreceding analysis. Then the experiments described in 1.1 will be repeated and the results compared to1.2 and 1.31.5 When exactly in G1 does AMPK cause up-regulation of glycolysis, Oxphos or FAO?AMPK is thought to be mainly active during the checkpoint in late G1 - however, it also plays a role in anenergy checkpoint in late G2 and possibly at other points in the cell cycle (Hardie et al., 2005). Toelucidate the role AMPK can have throughout G1, AMPK will be up-regulated at several points in thisphase and the effects will be examined.SCI 332 Advanced Molecular Cell Biology Research Proposal 45

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Experiment 1.5Synchronized cells will be treated with Compound C. The cells will be divided over several wells onmedium containing normal glucose and Compound C. The wells are washed at successive points in time(at time intervals of about 1/10 th of the length of G1) and afterwards Compound C-free medium containingAICAR is added. This will quickly activate AMPK. Then the experiments in 1.1 will be performed.1.6 What is the influence of low glucose at successive points in G1?This experiment will be a replication of 1.5, however, this time AMPK will be activated by low glucoselevels, to mimic the “natural situation”.Experiment 1.6Synchronized cells will be treated with Compound C. The cells will be divided over several wells (ten) onmedium containing low glucose and Compound C. The wells are washed at successive points in time (attime intervals of about 1/10 th of the length of G1) and afterwards Compound C-free, low-glucosecontaining medium is added. This will activate AMPK. Then the experiments in 1.1 will be performed andthe results will be compared to 1.5.1.7 What aspects of glycolysis, Oxphos, and FAO are influenced by AMPK activation?When we have determined what the effect of AMPK on the energy generating processes is, we caninvestigate how and where the energy generating processes are influenced more precisely. Severalpathways involving AMPK are known to influence these processes (see Background). The interactionsfound in the literature, as well as possible interactions deduced from our metabolomics assays will beinvestigated.Experiment 1.7Cells transfected with CA-AMPK (see Appendix C) will be synchronized and grown under optimalcircumstances for 48 hours. These cells will then be synchronized and divided into two samples. One willbe used to perform real-time PCR (Appendix A) to measure transcriptional levels of enzymes of interest.Furthermore a western blot will be performed to measure the activity levels of the indicated proteins. Wewill use rabbit antibodies, obtained from Abcam, as primary antibodies. As secondary antibodies we willuse anti-rabbit. β-tubulin will be used as a control. In the second sample AMPK will be activated throughthe inducible promoter by addition of sodium arsenite. Again real-time PCR and a western blot will beperformed. The results will be compared to show transcriptional and regulatory activity of AMPK.1.8 Can the up-regulation of glycolysis, Oxphos or FAO bring the cells back into the cell cycle?Is the up-regulation of a single energy generating process sufficient to make the cell transit from G0 backinto to the G1 phase? To measure the influence of one system, the other two need to be inhibited. If upregulationof one of the processes is enough to bring the cell back into the cell cycle, but up-regulation ofthe others is not, we can establish the importance of the different processes for restoring energy levels inresponse to AMPK.Experiment 1.8Synchronized cells will be divided into three samples. In each sample, one energy generating process willbe inhibited.1) Inhibition of glycolysis will be done by the known inhibitory agents 3-Bromopyruvic Acid andFluoride (Wu et al., 2005) that act on the glycolytic enzymes, respectively, hexokinase andenolase. To allow normal oxidative phosphorylation, the cells will be supplied with additionalpyruvate in the medium (Butler & Williams, 1990) and oxamate to inhibit the conversion of thispyruvate to lactate (Wu et al., 2006).2) Inhibition of oxidative Phosphorylation will be done using CCCP. This is an irreversible inhibitorthat has no effect on the functioning of the rest of the cell.3) For fatty acid oxidation inhibition we will use 3- mercaptopropionic acid and / or arlyoxyalkylsubstituedoxirane carboxylic acid. 3- mercaptopropionic acid inhibits fatty acid oxidation byinhibition of β-oxidation as consequence of the reversible inhibition of acyl-CoA dehydrogenase bylong-chain S-acyl-3-mercaptopropionyl-CoA thioesters. In addition, we will use arlyoxyalkylsubstituedoxirane carboxylic acid, which inhibits the activity of the enzyme Carnitin-Palmitoyl-SCI 332 Advanced Molecular Cell Biology Research Proposal 46

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Transferase-1 (CPT-1). We will measure the levels of fatty acid oxidation to determine which ofthe inhibitors is more efficient in our cell line, or whether we need to use both for completeinhibition.AMPK will be up-regulated by inducing CA-AMPK expression, and the same experiments as in 1.1 will beperformed. Additionally, cycle progression into S-phase will be determined in samples of the population bythe cell phase determination kit at regular intervals of 30 minutes.2: AMPK influence on cell cycle arrest and apoptosisHypothesis 2: AMPK induces cell cycle arrest in response to glucose depletion at multiple points in G1.Prolonged AMPK activation induces apoptosis in early G1 but not in late G1.2.1 Determining the restriction point (R) in G1.It has been established that there is a growth factor restriction point R in mammalian cells (Cooper, 2007).To determine whether the AMPK checkpoint corresponds to R, we will firstly determine where exactly R isin the cells used.Experiment 2.1In order to determine R, synchronized cells are deprived of growth factors at various times after M:Synchronized cells are seeded in a number of wells in complete BrdU/uridine containing medium.Subsequently, individual wells are successively washed (at time intervals of about 1/10 th of the length ofG1) and provided with serum-free medium containing BrdU/uridine. Incubation continues for the previouslydetermined time required for non serum-starved cells to completely reach S-phase (as in Schorl et al.,2003). A 50% rise in BrdU positive cells indicates the time point when cells are no more affected bygrowth factor deprivation, and thus the restriction point, R.2.2 Does AMPK induce quiescence in G1 in response to decreased glucose levels?Here we aim to confirm that AMPK is able to induce quiescence in G1 in response to glucose deprivationin the cell lines under investigation, as has been demonstrated previously for other cell lines (seebackground).Experiment 2.2.1Quiescence will be determined by measuring the differences in levels of Cyclin A, B and D1, p130and phosphorylated Rb (see methods experiment 0.2 and 0.3). If levels of these “quiescent markers” aresignificantly different than control levels, they will serve as a reference to determine quiescence in laterexperiments. Furthermore, we will measure whether G1 is prolonged after AMPK activation. We expect toobserve cell cycle re-entry after increased levels of ATP and decreased AMPK activity.Experiment 2.2.2 Is cell cycle arrest in response to glucose deprivation AMPK dependent?Synchronized cells will be glucose starved while AMPK is inhibited by Compound C. If under theseconditions the cells are arrested, an alternative, AMPK independent pathway must be responsible forhalting the cell cycle in response to low glucose levels.2.3 Where in G1 can AMPK induce cell cycle arrest?The following experiment will be conducted to determine the effect of selective activation of AMPKthroughout G1.Experiment 2.3.1Glucose starved cells treated with Compound C will be used to determine whether AMPK is able to inducecell cycle arrest at different points in G1. The synchronized cells will be divided over several wells with alow-glucose and Compound C containing medium. As in experiment 2.1, individual wells are washed atsuccessive points in time (at time intervals of about 1/10 th of the length of G1) and afterwards CompoundC-free medium containing AICAR with the same low glucose concentration is added. This will lead toSCI 332 Advanced Molecular Cell Biology Research Proposal 47

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007accelerated AMPK activation. Now, by measuring protein levels indicative of quiescence (see: 2.2) it isdetermined whether AMPK can induce quiescence at multiple points in G1.In a subsequent experiment, constitutively active AMPK (CA-AMPK) (Appendix C) with aninducible promoter will be used to activate AMPK at the same points in the cell. This alternative method forAMPK activation is used as a control to assure complete AMPK activation.Experiment 2.3.2 How does activating AMPK under normal energy levels affect cell cycle progression?This experiment will be performed as described in 2.3 but now under normal physiological energy levels(25mM) to see whether AMPK activation alone is sufficient to induce cell cycle arrest. Whether the cellsenter quiescence will again be determined by the measurement of the “quiescent markers”.2.4 Is AMPK-induced quiescence followed by apoptosis or reentry into the cell cycle?The aim of the following experiments is to confirm the results of 2.3, and to investigate whether AMPKinducedquiescence at different points in G1 is followed by apoptosis or reentry into the cell cycle. This isinvestigated at three points in G1: immediately after M, before passage through the previously determinedrestriction point R, and after R.Experiment 2.4.1 AMPK activation and quiescence in early G1In order to activate AMPK, AICAR will be added to synchronized cells in mitosis. Furthermore, the nucleiof cells treated with AICAR will be stained with DAPI and examined via immuno-fluorescence microscopy(Appendix C) to assess whether they display similar nuclear morphology as untreated control cells in earlyG1. Subsequently, the “quiescent markers” will be measured during early G1. This will establish whethercells with active AMPK actually leave mitosis and enter an AMPK induced quiescent state early in G1.The procedure will be repeated using glucose deprivation in mitosis instead of AICAR addition, inorder to mimic physiological conditions of AMPK activation.Experiment 2.4.2 AMPK induced apoptosis after quiescence in early G1As mentioned in the background, an early G1 checkpoint depending on PI3-kinase inhibition within 10min.after M has been proposed previously (Hulleman et al., 2004). Cells arrested at this point cannot reenterthe cell cycle and become apoptotic. Furthermore, IRS-1 has been shown to be phosphorylated by AMPKunder conditions of glucose deprivation, inhibiting the PI3-kinase/Akt pathway and thereby inducingapoptosis. Therefore, we hypothesize that AMPK will induce early G1 cell cycle arrest followed byapoptosis through IRS-1 activation in low glucose conditions.To test this hypothesis we will deprive synchronized cells of glucose during mitosis and assesswhether the cells become apoptotic within 72 hours following completion of mitosis. If cells do not becomeapoptotic but re-enter the cell cycle after AMPK induced quiescence, we have established the possibility ofan AMPK energy checkpoint early in G1. If the cells, however, do not re-enter the cell cycle and becomeapoptotic, it will be investigated if IRS-1 and p53 play a role in this process. Apoptosis will be assessed viaa caspase activity assay (Appendix C).In order to investigate whether the proposed AMPK – IRS-1 pathway leads to IP3-kinase inhibitionand apoptosis, phosphorylation of AMPK at Thr-172, of IRS-1 at Ser-794 and of Akt at Thr-308 will bequantified by Western blot analysis and compared to control levels.Next, it will be determined whether cell cycle arrest in early G1 and/or subsequent apoptosis isp53 and/or IRS-1 dependent. For this purpose, the action of IRS-1 on Akt will be inhibited via a pointmutation of IRS-1 on Ser-794. Furthermore, p53 will be completely inhibited via RNA interference(Appendix C). In 3 consecutive experiments, firstly IRS-1 and secondly p53 will be inhibited. Lastly, bothproteins will be inhibited simultaneously. In all cases apoptosis and quiescence will be assessed aspreviously described.2.5 AMPK induced quiescence before and after RIn the final experiments regarding hypothesis 2 it will be established whether AMPK is able to cause cellcycle arrest and/or apoptosis specifically before and after the restriction point R.As mentioned earlier, it is generally thought that cell cycle arrest can only occur before R.However, it has not been previously investigated whether this is true under conditions of glucosedeprivation. Therefore, we will deprive synchronized cells of glucose before and after R and observewhether these cells still continue into S-phase.SCI 332 Advanced Molecular Cell Biology Research Proposal 48

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Experiment 2.5As in the previous experiment we will assess cell cycle arrest and apoptosis as a consequence of AMPKactivation. In addition we will determine whether these processes depend on p53, using RNAi. This willclarify the role of p53 in AMPK induced cell cycle arrest and apoptosis in the later stages of G1.2.6 Does active AMPK cause apoptosis after prolonged energy depletion?Since AMPK is thought to be able to cause apoptosis (Jones et al., 2005), the question is whether it doesthis in result to energy depletion, and whether it can induce apoptosis in G1 phase.Experiment 2.6Synchronized cells will be put on a BrdU/uridine medium containing low glucose. The energy producingmechanisms will be inhibited as discussed in 1.8, but all three are inhibited simultaneously. Progressioninto S-phase will be measured as described in experiment 2.13: Effects of AMPK-induced cell cycle arrest on mitochondrial networkmorphologyHypothesis 3: Activated AMPK can cause morphological changes in mitochondrial network following cellcycle arrest in G1.3.1 How does mitochondrial network morphology change throughout the cell cycle?Several studies have observed the changes in the mitochondrial network throughout the cell cycle(Arakaki et al., 2006 ; Margineantu et al., 2002). However, these studies have produced varying results,most likely because the network morphology varies greatly between cell types (Arakaki et al., 2006). Forthis reason, we will start by observing the mitochondrial network change throughout the cell cycle of ourmouse fibroblast cells.Experiment 3.1.1We will visualize the mitochondria through fluorescent microscopy. The mitochondria will be made visiblethrough transfection with a vector containing mitochondria-targeted Green Fluorescent Protein. We willuse a transfection solution specialized for DNA transfection into fibroblast cells (Altogen Biosystems,Fibroblast Transfection Reagent). The cells will be transfected with “pTurboGFP-mito vector,” amammalian expression vector containing GFP with a mitochondrial targeting sequence (Evrogen). Thefluorescent mitochondria will be observed and images recorded with a confocal microscope.In this experiment we will observe mitochondrial morphology in cell cultures stuck in three major phases.First we will force a culture into quiescence (G0) by nutrient deprivation. Cells will be removed from thegrowth medium, washed and grown on medium containing 0.1 mM glucose (Jones et al., 2005), for 64hrs.We will fix the culture using paraformaldehyde (Margineantu et al., 2002) and observe mitochondrialmorphology. Secondly, we will synchronize another cell culture through mitotic shake-off (Appendix A),and plate them on normal growth medium. When the cells are about half-way through G1 we will fix theculture using paraformaldehyde (Margineantu et al., 2002). The time the cell culture will be allowed toproceed will be decided bases on the length of G1 in our cell type, determined in experiment 0.1. Finally,we will take a new, synchronized cell culture and treat cells with Aphidicolin, a DNA replication inhibitor,for 16hrs, to stop the cell cycle in S-phase (Margineantu et al., 2002). The cells of this culture will also befixed with paraformaldehyde. Observation of these three cultures should give us an overview of thenetwork morphology in the early phases of the cell cycle as well as in G0. We will use these observationsto decide on categories for the different morphologies of the mitochondrial network.Experiment 3.1.2Secondly, we will observe the changes in mitochondrial morphology in real time. We will visualize themitochondria as in experiment 3.1.1. A synchronous cell culture will be obtained through mitotic shake-off.We will observe the changes in morphology through one cell cycle, by taking images of multiple cells at 30SCI 332 Advanced Molecular Cell Biology Research Proposal 49

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007minute intervals using a confocal microscope. We intend to use this information to construct a graph of thechanges in fission and fusion over time.3.2 How does mitochondrial morphology change when the cell cycle is arrested through AMPK activation?Once we know how the mitochondrial network changes throughout a normal cycle of our cell type, wewould like to see what happens during AMPK induced cell cycle arrest.Experiment 3.2We will prepare a cell culture with constitutively active AMPK, as described earlier. A synchronous cellculture will be obtained through mitotic shake-off, and sodium arsenite will be added to the growth mediumimmediately following synchronization. This should induce CA- AMPK and cause the cell cycle to arrestduring late G1, at the metabolic, AMPK-dependent checkpoint. The changes in the mitochondrial networkmorphology will be observed by GFP fluorescence and confocal microscopy, as described in the previousexperiment.3.3 What happens to mitochondrial network morphology when the cell cycle is arrested independently ofAMPK activation?In order to see whether any changes in the mitochondrial network observed in the previous experimentare related particularly to AMPK activated cell cycle arrest, we want to determine whether these changesoccur when the cell cycle is arrested through any other means.Experiment 3.3We will first inhibit AMPK in a cell culture. This will be done through a direct AMPK inhibition withcompound C as described earlier. The cell culture will be synchronized through mitotic shake-off.Following mitotic shake off, we will arrest the cell cycle just prior to the restriction point in G1 (Hullemanand Boonstra, 2001). About one hour before the restriction point (measured in experiment 2.1) we willremove the growth factor rich medium, wash the cells and replace them on a serum free media (CellularTechnology Ltd.). In the course of this experiment we will observe the changes in mitochondrialmorphology as the cells enter G1 following mitosis and pass through part of G1 until they are forced intoG0 in late G1 due to absence of growth factors.3.4 Does AMPK act on any of the fusion or fission proteins to produce changes in the mitochondrialnetwork?If in the previous experiments we see changes in the mitochondrial network morphology as a result ofAMPK activation and cell cycle arrest, we intend to see whether these are the result of an interactionbetween AMPK and one or multiple fission or fusion proteins. If we see increased fission we will test Drp1,should we see increased fusion we will test the mitofusins (Mfn1 and Mfn2). Opa1 is probably not relevantbecause it does not have a cytosolic domain and therefore cannot interact with AMPK.Experiment 3.4.1We will determine whether or not there is an interaction between AMPK and any of these proteins bymeans of an in vitro kinase assay. This assay combines the kinase and possible substrates in vitro, andallows us to analyze whether the kinase phosphorylated any of the substrates. The proteins will be purifiedfrom our cells through immuno-precipitation. We will grow a culture of cells on normal, nutrient richmedium so that AMPK is inactive. A series of these cells will be lysed and targeted antibodies willprecipitate AMPK. A polyclonal rabbit IgG antibody which targets both AMPKα1 and AMPKα2 will be used.Protein G PLUS-Agarose beads, which have a specificity for the IgG antibodies, will be used to precipitatethe protein (Santa Cruz Biotechnology Inc.). We will use the same procedure to isolate any substrateproteins we want to study. Antibodies for Mfn1, Mfn2 and Drp1 are also commercially available from SantaCruz Biotechnology Inc., and will be ordered depending on the results of experiments 3.2 and 3.3. PurifiedAMPK is mixed with a solution of radioactive [32P]-ATP. This solution is incubated with the possiblesubstrates we wish to study (one substrate per well). Since we need the AMPK in the wells to be activated,we will add AICAR to the solution. After 15 minutes the mixtures will be resolved on SDS-Polyacrylamidegels, which are stained with Coomassie Blue and exposed to x-ray film (Zhang and Prives, 2001). Fromthis it is possible to determine whether AMPK phosphorylated any of the substrates.SCI 332 Advanced Molecular Cell Biology Research Proposal 50

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Experiment 3.4.2Since kinase activity in vitro is not necessarily representative of the interactions within a cell, we wouldalso check protein-protein interactions through co-immunoprecipitation of AMPK. A synchronous cellculture will be forced into cell cycle arrest through nutrient deprivation, and subsequent AMPK activation.Cells from this culture will be lysed and AMPK will be immunoprecipitated through the same procedure asin experiment 3.4.1. In this case AMPK will be precipitated along with any proteins it might be bound to.The precipitates will be analyzed on a western blot. The results will probed with fluorescent antibodiesspecific for the fission or fusion proteins that we chose to investigate.Experiment 3.4.3If the kinase assay and the immunopercipitation show that AMPK can bind one of the fusion or fissionproteins, we want to see whether this occures in vivo as well. We intend to use FRET to see whetherAMPK activates the proteins in the specific case of cell cycle arrest at the metabolic checkpoint. FRETinvolves labeling the kinase and substrate with fluorophores, a donor and acceptor pair. When theacceptor fluorophore is in close proximity to the donor, it emits a certain frequency of light. Twosulfoindocyanine dyes, Cy5 and Cy5.5, will be used to label the molecules. Cy5 emits light at 665nm andCy5.5 at 693nm. Cy5.5 will be targeted to AMPK while Cy5 will be tagged onto the substrate. Thesespecific dyes were chosen because they are a pair that can achieve energy transfer at relatively largedistances, achieving a 50% effective energy transfer at a distance of 69 Ǻ (Schobel et al., 1999), whichmost likely makes them especially suitable for large molecules like AMPK. Additionally, the fluorophore willbe tagged to the N-terminal part of the α-subunit of AMPK. This is the subunit which interacts with thesubstrate, and placing the fluorophore there ensures it is close enough to the substrate for fluorescence tooccur (Hardie, 2007). The fluorescence can be observed through confocal microscopy.SCI 332 Advanced Molecular Cell Biology Research Proposal 51

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Proposed CostsExperiments and Materials Year 1 Year 2 Year 3 Year 4Experiment 1.1Cells 1,500Techniques 100Cell phase determination kit 300Experiment 1.2 - 1.8Cells, proteins, antibodies 2,000 2,000Techniques 900 900Extracellular flux method 750 750Metabolomics assay 2,000 2,000CellTiter glo luminescent viability assay 350Comparative proteomics 3,000Notes1. Travel costs include expendituresfor traveling to universities, researchinstitutes, and conferences to gain(methodological) knowledge anduse specific equipment not availableat own laboratory. Furthermore,travel costs for year 4 are higherbecause of potential publicationcosts, presentations at conferences,etc.2. 'Techniques' covers the costs ofcommonly used techniques(Western blotting, electrophoresis,co-immunoprecipitation, etc.), and ofcommonly used materials in thelaboratory (wells, instruments,washes, stains, etc.).Experiment 2Cells, proteins, antibodies 2,500Construction recombinant adenoviruses 2,000Techniques 1,600Retroviral mediated gene transfer 1,300Site-direct mutagenesis 600Apoptosis assay 400RNAi 600Experiment 3Cells, proteins, antibodies 900Techniques 1,000Confocal fluorescent microscopy 3,000RNAi 600Inducers + inhibitors of AMPK activation 500In vitro kinase assay 500FRET 2,000Experiment total per year 7,550 9,000 9,000 8,500Travel costs 150 300 300 400Salary PhD student 40,000 40,000 40,000 40,000TOTAL per year 47,700 49,300 49,300 48,900TOTAL RESEARCH EXPENDITURE 195,200TimelineExp. Year 1 Year 2 Year 3 Year 40123SCI 332 Advanced Molecular Cell Biology Research Proposal 52

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007ConclusionThis research focuses on the overall role of AMPK as the regulator of energy levels in proliferating cells.Previous research has established the possible roles of AMPK in isolation, but we will provide a coherentpicture of all these roles combined. The model that we propose gives AMPK the central role in deciding oncell cycle progression and modification of energy management in proliferating, non-differentiated cells.The three parameters, (cell cycle progression, energy production and mitochondrial morphology) willbe researched in a single cell line and under similar circumstances. This provides us with data that shouldallow us to make correlations between the occurrence of cell cycle arrest and energy regulation. If we findsimilar correlations in our second cell line, it will allow us to make a broader generalization of the role ofAMPK.If we were to find a link between AMPK-induced cell cycle arrest and an up-regulation of glycolysis,oxphos or FAO, it would support the model we proposed for the energy checkpoint in G1. On the otherhand, a non-correlation might indicate that AMPK does not actively restore the energy balance of the cellfollowing cell cycle arrest in G1, but maybe only allows more time for energy restoration. The data will alsoshow us whether AMPK-induced cell cycle arrest will be accompanied by up-regulation of certain energygenerating processes at every (measured) point in G1. For example, it is a possibility that AMPKactivation will cause only cell cycle arrest at the beginning of G1, but cell cycle arrest and energyproduction at the end of G1. If we find this, further research could then focus on the differences betweenthese situations and make a distinction between the specific pathways.AMPK induced apoptosis, in response to energy insufficiency, is important in maintaining cell viability.Apoptosis of non-viable cells is advantageous for the whole organism. When exactly, and under whatconditions, the checkpoint functions is not fully elucidated yet. Understanding the precise circumstancesunder which AMPK causes apoptosis, as opposed to only cell cycle arrest, will provide important insightinto the regulation and monitoring of cell viability. This knowledge subsequently allows for understandingthe deregulated apoptosis mechanism in cancer cells.Since changes in mitochondrial network morphology are extremely important in cell cycle progression,differentiation and apoptosis, and possibly as well in energy production, we expect to see mitochondrialnetwork changes in response to AMPK-induced cell cycle arrest. Correlating a change in mitochondrialnetwork morphology to energy production might indicate a connection between these two factors.Furthermore, understanding what happens to the network as a cell enters quiescence may give us a morecomplete understanding of the specific importance of mitochondrial network morphology in the cell cycle.Finally, mitochondrial fission has been implicated in the process of apoptosis. If we were to find aconnection between AMPK and fission, this might give insight into part of the mechanism by which AMPKcauses apoptosis.In the course of our experiments we will measure the changes that take place in a cell as it undergoescell cycle arrest in G1 through AMPK activation. These alterations pertain to energy production andmitochondrial network morphology. Finding a difference in these factors between G1 and G0 may give usadditional parameters to distinguish between these two phases. These additional parameters could bevery valuable especially in studying the transition into quiescence at the beginning of G1, because at thispoint in the cell cycle the levels of the proteins measured to determine quiescence are always low. This,then, is also a limitation to this part of our research. An important question regarding cell cycle progressionis whether a cell following G1 cell cycle, arrest actually goes into G0 and later re-enters G1, or whether G1is simply “prolonged”. The results of our experiments might provide clues to answer this question, or atleast provide a method for further research.In many cancerous cells the energy generation, cell cycle progression or mitochondrial morphology ischanged. This project might give us a better insight into some of the important mechanisms involved incell transformation. Knowledge of the energy “household” of the cell will possibly explain the Warburgeffect and provide insights into the growth conditions of cancerous cells.Having elucidated the role of AMPK in proliferating cells, new topics of interest can be found.Subsequent research can bring up new topics of interest from this overview and explore these aspects ingreater depth.SCI 332 Advanced Molecular Cell Biology Research Proposal 53

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007ReferencesArticlesAlirol, E. and Martinou, JC. (2006) “Mitochondria and cancer: is there a morphological connection?”, Oncogene 25, 4706-4716.Arakaki, N et al. (2006) “Dynamics of Mitochondria during the Cell Cycle”, Biology and Pharmacology Bulletins 29, 1962-1965.Ashburner, M. and Bonnert, J.J. (1979) “The induction of gene activity in Drosophila by heat shock”, Cell 17, 241-254.Berg, J.M.; Tymoczko, J.L. and Stryer, L. (2006) Biochemistry, W.H. Freeman & Co Ltd., New YorkBlomen, V.A. and Boonstra, J. (2007) "Cell fate determination during G1 phase progression" Cellular and Molecular Life Sciences,Published Online, 1-21.Bokko, P.B. et al. (2007) "Diverse Cytopathologies in Mitochondrial Disease Are Caused by AMP-activated Protein Kinase Signaling",Molecular Biology of the Cell 18, 1874-1886.Boom, R. et al. (1988) “Induction of gene expression under human cytomegalovirus immediate enhancer-promoter control byinhibition of protein synthesis is cell cycle dependent”, Journal of General Virology 69, 1179-1193.Brand, K. et al. (1997) “Aerobic glycolysis by proliferating cells: protection against oxidative stress at the expense of energy yield”.Journal of Bioenergetics and Biomembranes 29, 355-364.Chen, H. and Chan, D. (2005) "Emerging functions of mammalian mitochondrial fusion and fission", Human Molecular Genetics 14,283-289.Cooper, G.M. and Hausman, R.E. (2007) “The Cell: A Molecular Approach”, Sinauer, 4 th ed.Cribbs, J. and Strack, S. (2007) “Reversible phosphorylation of Drp1 by cyclic AMP-dependent protein kinase and calcineurinregulates mitochondrial fission and cell death”, EMBO Reports 8, 939-944.Desai; Myers; Schreiber, (2002), “FKBP12-Rapamycin-Associated Protein Associates with Mitochondria and Senses Osmotic Stressvia Mitochondrial Dysfunction”, Proceedings of the National Academy of Sciences of the United States of America (PNAS), 99, 4319-4324.Dorward, Sweet, Moorehead and Singh (1997) “Mitochondrial Contributions to Cancer Cell Physiology: Redox Balance, Cell Cycle,and Drug Resistance”, Journal of bioenergetics and biomembrane, 29, pp: 385-392.Fesik, S.W. and Shi, Y. (2001) "Controlling the caspases", Science 294, 5546.Frauwirth, K.A. and Thompson, C.B. (2004) “Regulation of T-lymphocyte metabolism”, The Journal of Immunology 172, 4661-4665.Hardie, D.G. (2005) "New roles for the LKB1->AMPK pathway", Current Opinion in Cell Biology 17, 167-173.Hardie, D. (2007) “AMP-activated/SNF1 protein kinases: conserved guardians of cellular energy”, Nature Reviews 8, 774-785.Hawley, S. et al. (1996) “Characterization of the AMP-activated protein kinase from rat liver and identification of threonine 172 as themajor site at which it phosphoylates AMP-activated protein kinase”, Journal of Biological Chemistry 271, 27879-27887.Hoppins, S. et al. (2007) “The machines that divide and fuse Mitochondria”, Annual Reviews in Biochemistry 76, 751-780.Hue, L. et al. (2003) “AMP-activated protein kinase (AMPK) control of fatty acid and glucose metabolism in the ischemic heart”,Biochem. Soc. Trans. 31, 213-215.Hulleman, E. et al. (2004). “Identification of a restriction point at the G1/M transition in CHO cells”, Molecular Life Science, 61, 600-609.Hulleman, E. and Boonstra, J. (2000) “Regulation of G1 phase progression by growth factors and the extracellular matrix”, Cell. Mol.Life Sci. 58, 80-93.Huss, R. et al. (2000) “Quiescence of CD34-Negative hematopoietic stem cells is mediated by downregulation of Cyclin B and noStat activation”, Cytokine 12, 1195-1204.Hwang et al., (2004) “AMP-Activated Protein Kinase activity is required for vanadate-induced hypoxia-inducible factor 1α expressionin DU145 cells”, Carcinogenesis, 25, 2497-2507.Jones, R.G. et al. (2005) "AMP-Activated Protein Kinase induces a p53-dependent metabolic checkpoint", Molecular Cell 18, 283-293.Kaushik, V.K. et al. (2001) "Regulation of fatty acid oxidation and glucose metabolism in rat soleus muscle: effects of AICAR" Am JPhysiol Endocrinol Metab 281, E335-E340.Kühn, et al. (1974) “Kinetic properties of the phosphofructokinase from erythrocytes of rats and rabbits. 2. The influence of effectorsunder Nearly Cellular Conditions” European Journal of Biochemistry 43, 443-450.Kulawiec, M. et al. (2006) “Proteomics analysis of mitochondria-to-nucleus retrograde response in human cancer”, Cancer Biology &Therapy 5, 967-975.Long, Y.C. et al. (2006). AMP-activated protein kinase signaling in metabolic regulation. Journal of Clinical Investigation 116, 1776.SCI 332 Advanced Molecular Cell Biology Research Proposal 54

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Mandal, S. et al. (2005) "Mitochondrial regulation of cell cycle progression during evelopment as revealed by the tenured mutation indrosophila", Developmental Cell 9, 843-854.Margineantu, D.H. et al. (2002) “Cell cycle dependent morphology changes and associated mitochondrial DNA redistribution inmitochondria of human cell lines”, Mitochondrion 1, 425-435.Martínez-Diez et al. (2006) "Biogenesis and dynamics of mitochondria during the cell cycle: significance of 3' UTRs", Plosone 1, 1-12.McBride, H.M.; Neuspiel, M. and Wasiak, S. (2006) "Mitochondria: More Than Just a Powerhouse" Current Biology Vol. 16, Issue14, R551-R560Min Wu et al. (2007) “Multiparameter metabolic analysis reveals a close link between attenuated mitochondrial bioenergetic functionand enhanced glycolysis dependency in human tumor cells”, American Journal of Physiology and Cell Physiology, 61, C125-137.Norbury, C. and Nurse, P. (1992) “Animal cell cycles and their control”, Annual Review of Biochemistry 61, 441-470.Pajalunga et al. (2007). Critical requirements for cell cycle inhibitors in sustaining non-proliferative states, Cell Biology 176, 807-818.Pinilla and Luque (1977) “Activation of rat erythrocyte phosphofructokinase by AMP and by nonphysiological concentrations of cyclicAMP”, Molecular & Cellular Biochemistry,15.Rube, D. and Van der Bliek, A. (2004) “Mitochondrial morphology is dynamic and varied”, Molecular and Cellular Biochemistry256/257, 331-339.Sabbagh, E. et al. (1985) “3-Mercaptopropionic acid, a potent inhibitor of fatty acid oxidation in rat heart mitochondria” Journal ofBiology and Chemistry 260, 7337-7342.Schobel, U. (1999) “New donor-acceptor pair for fluorescent immunoassays by energy transfer”, Bioconjugate Chemistry 10, 1107-1114.Schomber, T. et al. (2004) "Gene silencing by lentivirus-mediated delivery of siRNA in human CD34+ cells" Blood 103, 4511-4513Schorl, C. et al. (2003) “Loss of protooncogene c-Myc function impedes G1-phase progression both before and after the restrictionpoint”, Molecular Biology of the Cell 14, 823–835.Sekito, T.; Thornton, J.; Butow, R.A.; (2000), “Mitochondria-to-nuclear Signalling is regulated by the Subcellular localization of thetranscription factors Rtg1p and Rtg3p”, Molecular Biology of the Cel, 11 pp: 2103–2115Singh, (2004) “Mitochondria damage checkpoint in apoptosis and genome stability”, FEMS yeast research, 5, pp: 127-132Sun, Y. et al. (2007) “AICAR induces phosphorylation of AMPK in an ATM-dependent, LKB1-independent manner”, Molecular andCellular Biochemistry 306, 239–245.Suzuki, A. et al. (2007) "Leptin Stimulates Fatty Acid Oxidation and Peroxisome Proliferator-Activated Receptor α Gene Expressionin Mouse C2C12 Myoblasts by Changing the Subcellular Localization of the α2 Form of AMP-Activated Protein Kinase" Molecularand Cellular Biology 27, 4317-4327.Taguchi et al. (2007) “Mitotic phosphorylation of dynamin-related GTPase Drp1 participates in mitochondrial fission”, Journal ofBiological Chemistry 282, 11521-11529.Tzatsos, A. and Tsichlis, P.N. (2007). Energy Depletion Inhibits Phosphatidylinositol 3-Kinase/Akt Signaling and Induces Apoptosisvia AMP-activated Protein Kinase-dependent Phosphorylation of IRS-1 at Ser-794. Journal of Biological Chemistry , 282 (25), 1074.Violett, B. et al. (2003a) “Physiological role of AMP-activated protein kinase (AMPK): Insights from knockout mouse models”,Biochem. Soc. Trans. 31, 216-129.Violett, B. et al. (2003b) “The AMP-activated protein kinase a2 catalytic subunit controls whole-body insulin sensitivity”, Journal ofClinical Investigation 111, 91-98.Viollet, B. et al. (2006) “Activation of AMP-activated protein kinase in the liver: a new strategy for the management of metabolichepatic disorders”, Journal of Physiology 574, 41-53.Werf, M.J. van der et al. (2007) “Microbial metabolomics: toward a platform with full metabolome coverage”, Analytical BiochemistryVol. 370, Issue 1, 17-25.Westermann, B. (2002) “Merging mitochondria matters; cellular role and molecular machinery of mitochondrial fusion”, EMBOReports 3, 527-531.Woods, A. et al. (2000) “Characterization of the role of AMP-activated protein kinase in the regulation of glucose-activated geneexpression using constitutively active and dominant negative forms of the kinase”, Molecular and Cellular Biology 20, 6704-6711.Wu, M. et al. (2005) “A novel technology for profiling cell energy metabolism in cancer cells”, The 2nd International Conference onTumor Progression and Therapeutic Resistance, GCTbio, Boston.Xue, B. and Kahn, B.B. (2006) “AMPK integrates nutrient and hormonal signals to regulate food intake and energy balance througheffects in the hypothalamus and peripheral tissues”, Journal of Physiology 574, 73-83.Zhang, T., and Prives, C. (2001) "Cyclin A-CDK phosphorylation regulates MDM2 protein interactions", Journal of Biochemistry 276,29702-29710.SCI 332 Advanced Molecular Cell Biology Research Proposal 55

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Zhou et al., (2001), “Role of AMP-Activated Protein Kinase in mechanism of metformin action”, The Journal of Clinical Investigation,108, 1167-1174.WebsitesAbcam, Cambridge, catalogue for antibodies, www.abcam.com. Consulted on Thursday November 29 th 2007.Amaxa Biosystems, Maryland, catalogue for cell lines, www.amaxa.com. Consulted on Thursday November 29 th 2007.Cellular Technology Ltd., Shaker Heights, 2007, accessed 27 November 2007, http://www.immunospot.com/index.php?id=1Evrogen, Moscow, 2007, accessed 15 November 2007, Istituto Nazionale per la Ricerca sul Cancro: Cell Line Data Base, Genova, 2007, accessed 24 November 2007,Molecular Modeling by Dyck, R.B., and Lopaschuk, G.D. "AMPK Alterations in Cardiac Physiology and Pathology: Enemy or Ally"http://www.bioon.com/book/biology/genomicglossaries/molecular_modeling_gloss.asp.htmSanta Cruz Biotechnology Inc., 2007, accessed 27 November 2007, http://www.scbt.com/index.htmlWebsite for: Aging research; molecular concepts of aging and related diseases and cloning,http://www.innovitaresearch.org/news/04112901.htmlSCI 332 Advanced Molecular Cell Biology Research Proposal 56

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Mitochondrial Biogenesis during the Cell CycleInvestigating interactions of the PPAR family coactivators in the induction ofmitochondrial biogenesis in coordination with the cell cycle through regulation of NRF-1activityResearch Proposal byB.B.F. Eidhof, I. Flament, S.L. Giles, J. Gunkel, W.P. van Klinken, J.A.J.M. PijnenburgAbstractThe cell is a very dynamic and intricate system comprised of a vast array of intracellular components. Amongthese components are the mitochondria, which in broad terms are the master energy providers for cellularfunctions. Mitochondria have long been a topic of fascination in the world of molecular biology. A vastplethora of diseases are attributed to the dysfunction of these crucial organelles that provide cells with energy.Mitochondria are present in multiple copies in the cell and are usually arranged in an elongated tubularnetwork. An important aspect of mitochondria is their biogenesis, which subsumes various processesconcerned with growth of organelles, energy, as well as being an important preparatory measure for cell cycleprogression and mitosis. The Peroxisome Proliferator Activated Gamma Coactivator (PPAR) family proteinsare the master regulatory components that induce mitochondrial biogenesis. They act to induce biogenesis byassociating with Nuclear Respiratory Factor (NRF), which in return is able to activate gene expression ofvarious mitochondrial components. On the other hand, cyclin D appears to inhibit NRF activity. In theproposed research, these two pathways upstream of NRF will be put under scrutiny, to elucidate themechanism that links mitochondrial biogenesis and the cell cycle. Although a lot of research has beendedicated to mitochondrial biogenesis, the details of how this process is activated in quiescent cells enteringthe cell cycle as well as continuously proliferating cells, are still unclear. Therefore, the main aim of thisresearch is to investigate the dynamics of mitochondrial biogenesis during the cell cycle and how thesevarious processes that induce mitochondrial biogenesis may be coordinated.SCI 332 Advanced Molecular Cell Biology Research Proposal 57

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007IntroductionA lot of research has been dedicated to the general function of mitochondria within the cell as well asfocus on mitochondrial related diseases such as the mitochondrial DNA depletion syndrome, which ischaracterized by reduced activity of mitochondrial DNA – encoded respiratory chain complexes (I, III, IVand V) and mitochondrial depletion (Taanman et al., 1997). However, not a lot is known about the actualdynamics of mitochondria during the cell cycle and which signals and stimuli control these processes. Dueto requirements of energy and division of mitochondria during cell division, mitochondria need to preparefor the cell cycle by increasing energy output capacity as well as ensuring enough material to be dividedinto the daughter cells. This is achieved through mitochondrial biogenesis.This research is designed to answer the following question: What are the patterns of mitochondrialbiogenesis observed during the cell cycle and what are the regulatory mechanisms that coordinate thisbiogenesis with progression through the cell cycle?For the purposes of this research we define and measure mitochondrial biogenesis as the increase inmitochondrial mass as well as the replication of mitochondrial DNA. We specifically want to look at theguidance of the mitochondrial biogenesis in response to cell cycle induction signals via the linking proteinsPGC-1 and PRC, the transcriptional regulatory proteins of the Peroxisome Proliferator Activated GammaCoactivator (PPAR) family. Additionally, we wish to establish how these processes are related tomechanisms involved in the regulation of the cell cycle itself (such as the cyclins), coordinatingmitochondrial biogenesis with progression through the cell cycle. Research indicates that PRC might beinvolved in inducing the cell cycle via the metabolic burst (Vercauteren et al., 2006). However, toinvestigate whether the PPAR family is involved in mitochondrial biogenesis during and over subsequentcell cycles irrespective of the metabolic burst, the research will be carried out on a cell line in which thecell cycle is induced and in a cell line that is continuously proliferating to account for possible differences.Our motivation for focusing on the roles of the PPAR family of proteins comes from the simple reason thatknowledge of these proteins in relation to the cell cycle and mitochondrial cycle is rather limited. Researchhas sparked interest in these proteins as recent studies in mice KO indicate that the role of thesecoactivator proteins is crucial for the normal expression of mitochondrial genes (Lin et al., 2005). Otherstudies have associated the involvement of the PPAR family proteins with the SIRT1 proteins, whichregulate metabolism and cell survival through influencing gene silencing as well as regulating cellmetabolism. Increased SIRT1 action induces hepatic gluconeogensis and inhibits glycolysis through PGC-1α during fasting state (Kuningas et al., 2007). Possible further research into this area may reveal furtherfunctions and implications of the PPAR family proteins and this insight may provide a pharmaceuticalbasis for treatment of mitochondrial disease and dysfunction.Our linking factor of the PGC1 family proteins with cell cycle and mitochondrial biogenesis comesfrom its interaction with Nuclear Respiratory Factor 1 (NRF). NRF-1 has been characterized as animportant regulator of transcription of mitochondrial genes encoded in the cell nucleus, as well asregulating the expression of mitochondrial transcription factors that regulate mitochondrial DNA geneexpression and replication (Andersson et al., 1999; Gleyzer et al., 2005; Martinez-Diez et al., 2006). Forexample, the Beta-F1-ATPase subunit of complex IV in the respiratory chain and cytochrome c expression,both of which are essential for normal mitochondrial function, have been shown to be mediated by NRF-1activity (Martinez-Diez et al., 2006; Chau, Evans and Scarpulla, 1992). Additionally, the mTFA and mTFBtranscription factors responsible for regulating mitochondrial DNA transcription and replication have beenshown to be regulated through NRF-1 activity (Gleyzer et al., 2005). These studies have also revealedthat PRC and PGC-1 expression in cells increase NRF-1 transcriptional activity and in doing so, promotemitochondrial biogenesis. We hypothesize that PRC and PGC1 are involved in the cell cycle as importantregulators of mitochondrial biogenesis, in cells transitioning from quiescent to proliferating, directly via themetabolic burst.SCI 332 Advanced Molecular Cell Biology Research Proposal 58

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Background InformationMitochondrial BiogenesisMitochondrial Biogenesis is a vast and very dynamic process within the cell involving a vast plethora ofproteins. Since mitochondrial DNA only encodes 13 subunits of the electron transport chain (Van denBogert et al., 1988) nuclear DNA has to provide the additional essentials for biogenesis. This process thusembodies a complex cross-talk between two genomes (nuclear – mitochondrial).Mitochondrial biogenesis is a crucial process in response to various physiological stimuli such asexposure to cold, it does however also play a pivotal role during the cell cycle. It ensures that throughoutevery cycle, mitochondria supply sufficient ATP as ensuring adequate growth for the mitotic division intorespective daughter cells. The synthesis of mitochondrial proteins occurs in a sequential order for theproper reduplication of mitochondrial mass. Inhibiting pathways involved in biogenesis such as thesynthesis of mitochondrial proteins during the cell cycle results in an increasing shortage of ATP, whichinitially results in a delay of cell cycle progression and ultimately leads to cell cycle arrest in early G1phase (Van den Bogert et al., 1988).The PPAR family proteins and mitochondrial biogenesisThe Peroxisome Proliferator Activated Gamma Coactivator (PPAR) family proteins are a class of proteinsinvolved in an increasing amount of intracellular pathways in relation to many processes such as thestimulation of mitochondrial biogenesis. They also have the capability to interact with a vast array oftranscription factors and are responsible for mediating efficient interaction between these transcriptionfactors and the general transcription apparatus (Puigserver and Spiegelman, 2003). Furthermore, they arethe key regulators and integrators of external stimuli transduction and are the primary targets in regulationof in relation to mitochondrial biogenesis (Lee et al., 2007; Lin et al., 2005) and are involved in the controlof cellular and systemic metabolism such as mitochondrial oxidative metabolism, maintenance of glucoseand energy homeostasis (Lin et al., 2005).There are 3 isoforms currently identified specificto higher eukaryotes namely, PGC-1α, PGC-1βand PRC. There has been no discovery of ahomolog of these proteins in lower eukaryotessuch as worms, flies and yeast (Lin et al., 2005).PGC-1β is the closest homolog to PGC-1α,followed by PRC. These proteins shareextensive sequence identity in their functionaldomains (Figure 3.1). The latter two proteinsshare similarities in their N-terminal activationdomain as well as in their C-terminal RNAbinding domain. Specific to PGC-1α and PGC-1β is the central regulatory domain, which is notshared with PRC. The activational domain is thesite of interaction with transcription factorswhere as the LXXLL motif is accountable for theligand-dependent interaction with certainhormone nuclear receptors (Puigserver andSpiegelman, 2003).Figure 3.1:Sequence homology between PPAR family (PGC-1α,PGC-1β, PRC). Similarities in sequence of (red)acitivation domain, Arg/Ser- rich domain (yellow) andRNA binding domain (green).Source: Puigserver and Spiegelman, 2003PGC-1αAlthough a lot of research has been dedicated to the structure and function of PGC-1 in terms of thestimulation of mitochondrial biogenesis in response to thermogenesis, gluconeogenesis or the indirectinteraction of cytokines and other factors, there seems to be a limited amount of knowledge that describeshow PGC-1α relates to the cell cycle in proliferating cells.SCI 332 Advanced Molecular Cell Biology Research Proposal 59

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Studies have been conducted, revealing an increased level of PGC-1α during muscle regeneration, adynamic and complex event involving phagocytosis of muscle debris, revascularization, activation,proliferation and differentiation (Duguez et al., 2001). More specifically a study done by Duguez et al.,investigated and hypothesized that mitochondrial biogenesis would be stimulated during skeletal muscleregeneration through PGC-1α (Duguez et al., 2001).The study mentioned above focused on skeletal muscle and its capacity to regenerate after injury. Thestudy revealed that during muscle regeneration there was marked increase in mitochondrial respirationafter injection of bupivacaine (a chemical agent frequently used to study muscle regeneration due to itsstimulus for rapid muscle fiber necrosis (Duguez et al., 2001)). The research also visually examined themuscle regeneration process, by means of histochemical analysis of the tissues (Figure 3.2) Along sidethis the levels of mtTFA (mitochondrial transcription factor A) as well as PGC-1α mRNA levels wereassessed (Figure 3.3). At 10 days post bupivacaine injection there is a marked increase in the expressionof PGC-1α, consistent with the regeneration of muscle fibers and mtTFA observed in Figure 3.2c at 10days post bupivacaine injection. (Duguez et al., 2001)This indicates that PGC-1α is involved in the regeneration process of the muscle fibers in relation to anincreased rate of mitochondrial biogenesis.Figure 3.3:Effects of bupivacaine on mtTFA and PGC-1 mRNAlevel. During the time post-bupivacaine injection,increased levels of PGC-1α were as well asincreased levels of mtTFA.Source: Duguez et al., 2001Figure 3.2:Histochemical analysis of necrosis andmuscle regeneration. a) control tissue b) 3days post bupivacaine injection c)10 dayspost bupivacaine injection d) 35 days postbupivacaine injectionSource: Duguez et al., 2001It is relevant to investigate the functions of the PPAR family in terms of cell cycle proliferation as they havepalpable and important roles such as provoking mitochondrial biogenesis. Muscle fibers of adultorganisms are terminally differentiated and have lost the ability to proliferate. Nevertheless, they containan accumulation of satellite cells (myogenic stem cells) which are able to proliferate, inducing hypertrophyas well as muscle regeneration upon stimulations such as injury or increased physical activity (Li et. al.,2006). As is characteristic of cellular proliferation, increased ATP as well as mitochondrial biogenesis isrequired, processes which are under the control of the PPAR family proteins. Connections have beensuggested and PRC has been identified as having the characteristics of an immediate early gene (Duguezet. al. 2001; Melloul & Stoffel, 2004; Vercauteren et. al. 2006) nonetheless, there are no direct studieslinking the activation of all the PPAR family proteins directly to the cell cycle.p38 MAPK and PGC-1αResearches conducted in the field of the PPAR family have identified various upstream factors which areinvolved in the activation of these coactivators. Initially, researchers established that the posttranslationalcontrol of PGC-1α was conducted via a negative regulatory region, located between amino acids 170 andSCI 332 Advanced Molecular Cell Biology Research Proposal 60

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007350 (Fan et al., 2003) that decreased the effectiveness of the transcriptional activation domain at the N-terminus (see Figure 3.1) (Melloul and Stoffel, 2004). It was noted that this inhibitory effect wasdiminished by phosphorylation of the negative regulatory region, specifically at three residues Thr262,Ser265, and Thr298 by a member of the mitogen-activated protein kinase (MAPK) family, greatlystabilizing PGC-1α (Melloul and Stoffel, 2004).A signaling pathway through p38MAPK was established to activate PGC-1α(Fan et al., 2004). This research also identifieda repressor p160 myb of PGC-1α. In responseto cytokine and growth factor signaling (Figure3.4), the p38 MAPK pathway is activatedultimately disrupting the binding of the p160mybrepressor of PGC-1α and lifting theinhibitory effect (Melloul and Stoffel, 2004).Although the p38 MAPK pathway is primarilyinvolved in stress response as well asapoptosis and differentiation, it has also beenimplicated and linked to proliferation in variouscell types. A study done by Petersen et. al.disclosed that proliferation in immature Sertolicells was mediated via p38 MAPK uponstimulation of IL-1a (Interleukin-1 an effectivegrowth factor for immature Sertoli cells).Nevertheless, there is no experimentaldata which links the proliferative role of p38MAPK by means of PGC-1α activation to thecell cycle.Figure 3.4:Activation of PGC-1α by p38 MAPKSource: Melloul and Stoffel, 2004PRCOne of the sister proteins of PGC-1α and β is PRC. PRC shares a lot of structural similarities with theother two isoforms, but differs from them by being ubiquitously expressed in various tissues. Unlike PGC-1α for example, PRC is not induced during adaptive thermogenesis (Vercauteren et al., 2006).On the contrary, PRC is upregulated during G0-G1 transition upon serum induction in fibroblast cellsswitching from quiescent to proliferative, making it particular as there are not a lot of serum-inducibletranscriptional coactivators known (Vercauteren et al., 2006).Additionally, it was observed that PRC is downregulated when cells move back into the G0 stateby either serum withdrawal or contact inhibition implying that PRC is a growth-regulated coactivator(Vercauteren et al., 2006).The study by Vercauteren et al. also established that PRC can be classified as an immediate early gene,capable of complexing in an identical manner on the same binding sites with CREB and NRF-1 and that itoccupies the cytochrome c promoter in vivo. The binding of PRC in a complex with CREB and NRF-1allows for the transcription of cytochrome c, an important element of the mitochondrial electron transportchain (Vercauteren et al., 2006). PRC has been identified as having the characteristics of an immediateearly gene product, as experimental data elucidate that PRC induction is rapid at both the protein andmRNA level, as a result of serum stimulation of quiescent fibroblasts (Vercauteren et al., 2006; Anderssonand Scarpulla , 2001). Furthermore it has been proposed that PRC deficiency may disrupt early postnataldevelopment as PRC directed growth is dependent on cellular conditions in which energy is primarilyobtained by means of oxidative phosphorylation; an enhanced state during postnatal respiratory growth, inwhich tissues depend largely on oxidative energy (Vercauteren et al., 2006). To this day there is noexperimental data that states which part of the cell cycle and which genes would be affected by adominant negative inhibition of PRC.SCI 332 Advanced Molecular Cell Biology Research Proposal 61

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007PGC-1βPGC-1β has a lot of similarity in function and sequencing as its isoform PGC-1α. On a global scale, boththese coactivators also share a similar distribution in specific tissues, with peak expression in brown fatand heart and differently distributed mRNAs in brown adipose tissue, specifically following cold exposureduring brown fat cell differentiation (Lin et al., 2001). PGC-1β has been implied in various physiologicalfunctions such as control over hepatic lipid synthesis and production (Lin et al., 2005). There is alsoevidence from transgenic expression experiments that PGC-1β is involved in mitochondrial biogenesis inskeletal muscle.PGC-1β, PGC-1α & PRCWhat the three isoforms all have in common is their relation to mitochondria. They are also all able to bindto NRF-1 (Vercauteren et al., 2006). There have been studies conducted which demonstrate anintracellular redundancy between PGC-1β and PGC-1α. The overexpression of PGC-1β lead to anincrease of a minor subset of PGC-1α target genes, the majority being involved in mitochondrial oxidativemetabolism as well as other related functions, but not many others (Sonoda et al., 2007). Additionally, theother two PPAR family members are not able to fully compensate for the PGC-1α KO as a study by Wulfet al. demonstrated.MAPK ErkTwo main MAPK pathways, Erk and p38 (Yu et al., 2001; Boppart et al., 2000) were demonstrated to beactivated by various forms of muscle contraction (Widegren et al., 2000). This suggests that the pathwaysare involved in regulation of skeletal muscle genes that change expression rate as a response to exercise.The MAPK-Erk 1/2 signalling pathway was demonstrated in exercise adaptation (Murgia et al., 2000),where an increased fibre percentage occurred during injury repair in vivo when Erk 1/2 was activatedthrough transfectionexperiments.The expression of PGC-1α mRNA levels wasassessed in C2C12skeletal muscle cellsexposed to palmitateeither in the presence orin the absence of severalinhibitors to study thebiochemical pathwaysinvolved (Coll et al.,2006). This studyreported that exposure ofC2C12 skeletal musclecells to 0.75 mmol/lpalmitate reduced PGC-1α mRNA levels. Thisrepression was attributedto MAPK-Erk activationsuggesting that PGC-1αexpression was reducedthrough a mechanisminvolving MAPK-Erk.Figure 5Figure 3.5:Erk pathway indicating the activation of CREBSource: Cell Signaling Technology, Inc., 2007SCI 332 Advanced Molecular Cell Biology Research Proposal 62

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007As seen above, Erk travels into the nucleus and activates CREB (Figure 3.5), which as already discussed,has been indicated in PGC-1α phosphorylation in vitro and modeled in a complex with PRC and CREB.PRC and Cyclin D1 regulation of NRF-1/2 activityThere have been numerous studies highlighting mechanisms that have been identified to regulate NRF-1activity, but the regulation of NRF-2 is less well established. Although a variety of factors have been foundto regulate NRF-1 activity, with respect to the cell cycle, it is mainly PRC and Cyclin D 1 /cdk 4 that havebeen implicated in its regulation.The regulation of NRF-1 and 2 is a crucial component in the control of mitochondrial biogenesis during thecell cycle. The NRF’s act to regulate transcription of various mitochondrial respiratory components as wellas factors involved in regulating transcription of other mitochondrial genes such as mtTFA, TFB1M andTFB2M (Andersson et al., 1999; Gleyzer et al., 2005; Marinez-Diez et al., 2006). These studies provideevidence that NRF activation will mediate and regulate the coordination of mtDNA replication andmitochondrial biogenesis. Taken together with the observations that PRC is expressed in a cell cycledependent manner, and that it trans-activates NRF-1 target genes, these results provide a clue as to howthese two processes may be coordinated and regulated together.It has been observed that PRC interacts directly with NRF-1 (Andersson et al., 1999), to regulate itscontrol on mitochondrial biogenesis through trans-activation of the NRF-1 target genes and in this mannermediating transcription of various down-stream components (Gleyzer et al., 2005). In a study investigatingthe regulation of NRF-1 in the cell cycle, Anderson and Scarpulla (2001) found that PRC expression in thecell cycle up-regulated NRF-1 activity and that this effect required the interaction of these proteins throughNRF-1’s DNA binding domain. From these results, the authors hypothesized that PRC affects NRF-1activity by assisting its docking with DNA in order to induce transcription of down-stream genes. Inaddition to this, it has been found that NRF-1’s DNA binding activity is enhanced with phosphorylation ofserine residues at locations 39, 44, 46, 47 and 52 (Gugneja and Scarpulla, 1997). However, whether thisphosphorylative regulation of NRF-1 activity is observed in the cell cycle is not yet clear. A more recentstudy highlighted the fact that serum induction to the cell cycle sequentially phosphorylated NRF-1, whichincreased its ability to trans-activate target genes expression (Herzig, Scacco and Scarpulla, 2000).With respect to NRF-1 inhibition, cyclin D1 has been shown to down-regulate its activity in a cdk4dependent manner (Wang et al., 2006). This downregulation was mainly attributed to phosphorylation ofNRF-1 at serine 47 which constituted approximately 85% of all phosphorylation activity of the cdk4 onNRF-1. However, although this site was required for the down regulation of NRF-1 by cdk4 it was notsufficient to mediate the full downregulation observed normally (Wang et al., 2006).An interesting point to note here is that both PRC and cdk4 in the regulation of NRF-1 activity(with opposite consequences) phosphorylated the serine at site 47. Whether this site is necessary for theup-regulation of NRF-1 has not been established yet.SCI 332 Advanced Molecular Cell Biology Research Proposal 63

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Proposed ResearchWe will be investigating the involvement of PRC and PGC1 in the cell cycle as important regulators ofmitochondrial biogenesis, in cells transitioning from quiescent to proliferating directly via the metabolicburst.To investigate our hypotheses we chose two cell lines to do this in, the BALB/3T3 cells and U-2 OS cellswhich will be supplied to us by the company LGC Promochem – ATCC. The U-2 OS cells originate fromthe bone tissue of a 15 year old female Caucasian and are osteosarcoma cells. The cells will be culturedin McCoy’s 5A Medium with addition of Fetal Bovine Serum. The BALB/3T3 cells are fibroblast cells whichoriginate from 14- to 17- day old mouse embryos. They are very sensitive to contact inhibition and will becultured in the ATCC formulated Dulbecco’s Modified Eagle’s base Medium. To establish a complete andsuitable growth medium, we will add Calf Bovine Serum to the media, which will also be supplied by LGCPromochem – ATCC. The cells will be shipped to us frozen, therefore we will use the protocol supplied byATCC to culture the cells. The cell lines can be used as non-proliferating (quiescent), continuouslyproliferating and induced from quiescence upon serum stimulation. We chose this cell line because theyhave been successfully used in previous experiments in this topic of research (Vercauteren et al., 2006).In the experiments the induction of the metabolic burst will be carried out by adding specificconcentrations of serum stimulating media such as the bovine calf serum and the fetal bovine serum forthe U-2 OS cells and the BALB/3T3 cells respectively.For a detailed description of the methods and specific materials used in this research please refer toAppendix B. General protocols for the methods are provided in Appendix A.Subtopic 1To establish a solid basis for the proposed research program on mitochondrial biogenesis, experimentsfrom previous research will be replicated in the aforementioned cell lines to suit the experimental context.These experiments provide a value on their own and are needed as a basis for the experiments insubsequent subtopics.Mitochondrial DNA to nuclear DNA ratioFirstly, the ratio of mitochondrial DNA to nuclear DNA will be established during the cell cycle inproliferating cells and for the same amount of time in non-proliferating cells. To distinguish between effectsfrom the metabolic burst and the actual cell cycle, the experiment will be performed on continuouslyproliferating cells and cells in which the cell cycle is induced and thus experience a metabolic burst.Cell cycle synchronization is obtained via a double thymidine block, as the cell lines are not suited forcentral elutriation and will not suffer from disadvantages as inhibition of cell growth and apoptosis whenusing serum deprivation. Nocodazole is used to synchronize cells in M-phase, in order to have cellsynchronized for a full cell cycle. Quantitative real-time PCR will be used to measure the mitochondrialDNA to nuclear DNA ratio.Measuring mitochondrial mass during the cell cycleFluorescent-activated cell sorting (FACS) will be used to measure the relative changes in mitochondrialmass during the cell cycle. This provides information on the rate of mitochondrial biogenesis and indicatesperiods in which the rate of mitochondrial biogenesis changes. Such information is needed to focus onparticular periods or phases in the cell cycle.As the target(s) of a single probe for mitochondria may not be representative of the changes inmitochondrial mass, different probes will be used. The fluorescent probes need to be membrane potentialSCI 332 Advanced Molecular Cell Biology Research Proposal 64

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007independent and mitochondrial uptake of the fluorescent probe should also be membrane potentialindependent.After flow cytometry, the relative changes in intensity will be used to indicate changes in mitochondrialmass during the cell cycle over 30 minute intervals.Subtopic 2The general picture of upstream regulation of mitochondrial biogenesis via the PPAR family is comingtogether piece by piece. Some steps have been determined, while others have merely been indicated.This part of the research will focus on clarifying some of the unknown but suggested steps in regulation ofmitochondrial biogenesis pathways through two main MAPK pathways linked to cell proliferation: Erk andp38.MAPK-p38 has been established to activate PGC-1α. Nevertheless, there is no experimental data whichlinks the proliferative role of p38 MAPK by means of PGC-1α activation. It has also been demonstratedthat p38 MAPK pathway results in the stimulation of CREB (Delghandi et al., 2005). This may be thestarting point of the signaling cascade that leads to the up regulation of PRC because CREB, like NRF-1is able to bind to PRC and induce mitochondrial transcription.MAPK-Erk has been suggested to reduce PGC-1α expression, as well as been shown to increase musclefibre percentage during injury repair in vivo. It has also been suggested that Erk travels into the nucleusand activates CREB. CREB, as already discussed has been indicated in phosphorylation of PGC-1α invitro as well as modelled in a complex with PRC and NRF. Due to some grey areas that remain in currentresearch this research wishes to determine if MAPK-Erk is able to upregulate as well as downregulatePPAR family expression by dephosphorylation and phosphorylation respectively.This section will first try to ascertain the involvement of these regulatory pathways, through identifyingkinase involvement. Once that is established the mechanisms of regulation will be examined more closelyby determining phosphorylative actions.In carrying out this proposal, we hope to establish some differences between p38 and Erk pathways andunderstand their precise role in this vital but complex process. Another goal is to establish moreknowledge about the extent of functional similarity between PPAR family proteins in these pathways. Todo this, we will examine each PPAR member individually and use RNAi to determine the effect of onePPAR member in the absence of another.Presence of PPAR proteins and mRNA levels of PPAR family in cell linesIt is important to establish the timing of PRC and PGC-1α and PGC-1β mRNA transcription so that timingcan be compared to the corresponding stage of the cell cycle. This will allow determination of anytemporal coordination of such pathways with cell cycle progression. To determine when mRNAtranscription occurs, quantitative Real-Time PCR will be used. The amount of product present will bemeasured by densitometry of the intensities of bands after electrophoresis. These results will becompared with results from the subtopic 1.Establishing Regulatory Pathways for PGC family / cell proliferationWe then wish to establish that there is in fact involvement of the considered pathways in our cell lines aswell as the importance of each. We wish to perform RT-PCR on MAPK-ERK and MAPK-p38 to determinepresence and levels thereof throughout the cell cycle.We will investigate kinase involvement by inhibiting the MAPK-ERK and MAPK-p38 pathways. Followingthis, we will measure the level of PPAR family members upon such inhibition through RNAi. In doing so,SCI 332 Advanced Molecular Cell Biology Research Proposal 65

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007we hope to establish the importance of the pathways in PGC regulation. The inhibitions will be tested inresponse to different PPAR members to determine their individual involvements. First, each PPARmember level will be recorded upon pathway stimulation, these results will then be compared to eachPPAR member level upon pathway inhibition.Determining Levels of RegulationOnce the MAPK pathways have been established, the phosphorylative actions MAPK is known for will beexamined as possible regulatory mechanisms of PPAR family members. Namely does MAPK-p38phosphorylate the PPAR family members? Does MAPK-Erk have such a function?We hypothesize that p38 phosphorylates PGC-1α and PGC-1β when PGC-1α is absent. We alsohypothesize that p38 phosphorylates the CREB/PRC/NRF complex. It is unclear what to expect in termsof a phosphorylative action of MAPK-Erk on PGC family members, however it would be interesting touncover whether MAPK-Erk is capable of upregulation as well as downregulation through phosphorylationand dephosphorylation or whether it is only capable of one side of regulation.The first step in determining phosphorylative regulation is to determine whether it occurs at all. This will bedone using PerkinElmer Phos-tools kit.The second step involves identifying phosphorylation sites. Such sites are known for PGC-1α and wepropose to search for similar sequences in PGC-1β and PRC through the BLAST search program.Thirdly, the importance of any occurring phosphorylation should be determined. For example, we wish todetermine whether phosphorylation of PPAR family members is required for NRF-1 binding, or CREBbinding to PRC. To examine this, we will use site directed mutagenesis on the phosphorylation sitespreviously identified and thus determine the effects of disturbed phosphorylation.Determination of phosphorylation sheds light on the mechanisms and pathways through whichmitochondrial biogenesis is regulated. If phosphorylation is identified then this allows control over anothervital step in the mitochondrial biogenesis pathways.Subtopic 3In this section we will be investigating the hypothesis that: ‘The regulation of mitochondrial biogenesis inthe cell cycle will be coordinated through regulation of NRF-1 and 2 activity, mediated by interactions ofthese transcription factors with PRC and CyclinD1/cdk4.’We would wish to establish interactions between NRF-1 and CyclinD1/cdk4 and PRC in order tocharacterize its activity during the cell cycle with respect to its regulation of mitochondrial biogenesis.Additionally, we would like to establish the timing and mechanisms of these interactions and whether theycan be mediated through alternative means. Interestingly, while PRC activates NRF-1 throughphosphorylation of a number of different sites, one of these (S47) is also used to inhibit its activity byCyclinD1/cdk4. Therefore, it is also interesting to investigate the importance of this phosphorylation site forthese two processes in regulating NRF-1 activity. These experiments will be conducted in synchronizedproliferating cells in order to see how these mechanisms relate to the cell cycle and in cells induced intothe cell cycle that experience a metabolic burst in order to establish possible differences in the activity ofthese factors under the different conditions.As a start, the expression patterns of the different compounds throughout the cell cycle have to beestablished, in order to look at activation and interaction. Although it is commonly known when thedifferent cyclins and cdk’s are expressed in the cell cycle, we want to re-investigate these expressionlevels, in combination with NRF-1, NRF-2 and PRC, to get a general overview of the whole transcriptionand translation processes of these compounds throughout the cell cycle. Moreover, we want to look atboth mRNA and protein expressions, to see whether present mRNA levels also mean protein expression.SCI 332 Advanced Molecular Cell Biology Research Proposal 66

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007To establish mRNA levels, reverse-transcriptase real-time PCR (RT-PCR) will be used. To see whetherthis mRNA is also converted to proteins, Western Blotting will be used. All experiments in this subtopic willbe conducted at half an hour intervals commencing after cell synchronization.Characterizing Cyclin D 1 /cdk 4 interaction with NRF-1 and whether this extends to NRF-2Although previous research has shown that Cyclin D 1 /cdk 4 inhibits NRF-1 activity through phosphorylationof S47 (serine at location 47 on the protein) (Wang et al., 2006) it is useful to check whether thesemechanisms are active during the cell cycle and whether it may also be involved in regulating the activityof NRF-2 in a similar way. The phosphorylation of NRF-1 at S47 was found in the same study to berequired but not sufficient on its own for the full repression of NRF-1 activity. It would therefore beinteresting to establish which other sites may be phosphorylated in this process. In order to examine thiswe propose to conduct the following experiments.Identification of the nature and extent of phosphorylation of NRF-1 and NRF-2 by Cyclin D1/cdk4 and PRCTo establish whether (or rather at which points) NRF-1 and NRF-2 are phosphorylated at specific points inthe cell cycle we will conduct phosphoprotein analysis using mass spectrometry to identify specific sites ofphosphorylation. These analyses will be conducted at the time points in the cell cycle mentioned above.Due to the fact that we need to distinguish between NRF-1 that is phosphorylated by PRC and Cyclin D1 itis important for us not only to check if NRF-1 is phosphorylated, but the precise nature and extent of thisphosphorylation. In order to do this we propose to use the PerkinElmer Phos-tools kit along withPerkinElmer Phos-tag stains to highlight phosphorylated proteins due to their high binding affinities withphosphorylated serine, threonine, and tyrosine residues. Additionally, for this method it is required toenrich the phosphopeptides for adequate detection using PerkinElmer Phos-trap. We will then establishdifferences in phosphorylation of activated and inhibited NRF. This method allows us to do this, is highlysensitive to phosphoprotiens, and does not take too much time. For these reasons this method isappropriate for our experiment and provides relevant data that we could not as easily get from othersources.The role of localization of Cyclin D 1 /cdk 4 in NRF regulationWe will look at differences in phosphorylation of NRF-1 and NRF-2 in the cell cycle with respect to whenCyclin D 1 /cdk 4 is located in the nucleus and when it is moved out. We will also look at changes in thephosphorylation of NRF-1 and 2 following the phosphorylation and activation of PRC characterized insubtopic 2.Using evidence of the timing of PRC activation and NRF activation found in this subtopic we will be able tohypothesize whether PRC activation can override cyclin D 1 /cdk 4 inhibition or whether this must beremoved before PRC can exert its activity. If removal of the inhibitory signal is required it is likely thatcyclin D 1 /cdk 4 translocation to the cytoplasm will coincide with NRF activation.To check whether cyclin D1 inhibition of NRF is related to its nuclear localization we will construct amutant that has been shown to remain located in the nucleus by mutating cyclin D1 at this site: T286A.Differences in cyclin D1 binding between cdk4 & 6All cyclin D isoforms have been shown to bind with cdk4 to mediate cell cycle progression. Cyclin Disoforms are expressed in different levels in various tissue types, suggesting a partial or completeredundancy (Carthon et al., 2005). However, there has been no study conducted into the possibilities ofNRF-1 regulation by the other two cyclin D isforms through either cdk4 or cdk6. Only cyclins D1 and D3bind to cdk6, which means that cdk4, is the sole cdk for cyclin D2, whereas D1 and D3 can bind both.Cdk4 and cdk6 both exert the same functions in terms of cell cycle progression when bound to cyclin D.We want to examine when cyclin D/cdk complexes are formed, but more importantly, if there is a bindingspecificity for either cdk4 or cdk6 during certain points in the cell cycle.SCI 332 Advanced Molecular Cell Biology Research Proposal 67

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Although the majority of the studies on cyclin D effects on NRF-1 have been focused on cdk4, thisdoes not exclude cdk6 as another possible mediator. By using co-immunoprecipitation we can see whenwhich cyclin D isoform binds to which cdk.Possible role of other cdk’s in mediating regulation of NRF-1 and NRF-2 activityDue to the fact that it is cdk4 that is responsible for the phosphorylation of NRF-1 it would be interesting tosee if other cdk’s are also involved in this regulation during the cell cycle.We would therefore first like to check if these cdks can interact with NRF-1 and 2. In order to do this wewould like to do kinase assay using the AlphaScreen® PhosphoSensor Kits (PerkinElmer).SCI 332 Advanced Molecular Cell Biology Research Proposal 68

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Proposed CostsItem Year 1 Year 2 Year 3 Year 4 Total itemexpenditurePhD student 40,000 40,000 40,000 40,000 160,000Bench fee 10,000 10,000 10,000 10,000 40,000Antibodies 3,000 3,000Custom antibodies 1,500 1,500FACS probes 350 350Cell lines 600 600 600 600 2,400Phos-tools 650 650PCR primers 300 800 1,100PCR probes 150 150 300PCR First Strand Kit 150 150Taqman assay 1100 1,100Light Cycler 2.0 ® RT-PCR system10,000 10,000 15,000 35,000Nocodazole 250 250AlphaScreen®PhosphoSensor KitsMAPK p38 & ErkinhibitorssiRNA (custom siRNA& materials)260 260700 700800 800Unforeseen costs 2440Total per year 62,600 62,250 71,850 50,860Total expenditure 250,000TimelineActivity Year 1 Year 2 Year 3 Year 4PreparationSubtopic 1Subtopic 2Subtopic 3SCI 332 Advanced Molecular Cell Biology Research Proposal 69

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007DiscussionThis research is aimed at establishing the regulatory role of the PPAR-family in mitochondrial biogenesisduring cell cycle progression and in the metabolic burst. Therefore, the main hypothesis this researchfocuses on is: PRC and PGC-1 are involved in the cell cycle as important regulators of mitochondrialbiogenesis, in cells transitioning from quiescent to proliferating, directly via the metabolic burst.During the first year of the research a solid basis for the rest of the research is set. Previously conductedstudies and experiments are repeated in the cell lines used in this project, to suit the experimental context.The ratio of mitochondrial DNA and nuclear DNA is examined in continuously proliferating cells and ininducible cells, i.e. the metabolic burst. Also, the mitochondrial mass throughout the cell cycle isestablished, as this gives an indication as to mitochondrial biogenesis throughout the cell cycle.Knowledge of these aspects is important in the rest of the research.In the second year the focus shifts to the upstream regulation of the PPAR family. Important aspectsconcerning two upstream regulatory pathways of the PPAR family are determined: the MAPK-Erk pathwayand MAPK-p38 pathway. By checking presence of these compounds and performing kinase assays theregulation of these pathways on the PPAR family is determined. Knowledge of this upstream regulationmight prove invaluable to further research in mitochondrial biogenesis. With the activation patterns of thePPAR family determined, it could become possible to closer regulate mitochondrial biogenesis.In the final part of this research, focus is shifted downstream of the PPAR family to their main target, NRF-1, and a regulation of cell cycle involved complexes on mitochondrial biogenesis is established. As anaddition, the extent of similar functionality of NRF-2 is compared to NRF-1. The regulation of thesecompounds through phosphorylation, both activation and inhibition, is examined. The inhibitory influenceof different cyclin/cdk complexes present mainly in the G1 phase of the cell cycle, is established, andcompared to activation effects of PRC. Knowledge of downstream activities of PRC provides insight to itsdirect positive effects on mitochondrial biogenesis. More so, the inhibitory influence of important cell cyclecomplexes shows how the cell cycle regulates mitochondrial biogenesis, and therefore provides its ownenergy. A functional comparison between PRC and cyclin/cdk complexes reveals how mitochondrialbiogenesis is coordinated with the cell cycle.This research provides a very useful basis for future research into mitochondrial behavior throughout thecell cycle. The PPAR family has been established to be the main regulatory family of mitochondrialbiogenesis and a better understanding of the up- and downstream regulation of this family providesinvaluable insight into cellular-mitochondrial communications. Unfortunately, there are many moreregulatory proteins and pathways involved in mitochondrial biogenesis that remain to be determined. Thisresearch tries to stimulate more investment in this research area, as it could prove invaluable to have acomplete understanding of mitochondrial biogenesis in the cell cycle.SCI 332 Advanced Molecular Cell Biology Research Proposal 70

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007ReferencesAkimoto, T. et. al. (2005) “Exercise Stimulates PGC-1a Transcription in Skeletal Muscle through Activation of the p38 MAPKPathway” The Journal of Biological Chemistry 280, 19587-19593Andersson, Ulf, et al., (1999), Mechanisms controlling mitochondrial biogenesis and respiration through thremogenic coactivatorPGC-1, Cell, Vol. 98, pp115-124Andersson, U. and Scarpulla R. C., 2001, PGC-l-related coactivator, a novel, serum-inducible coactivator of nuclear respiratoryfactor 1-dependent transcription in mammalian cells, Molecular Cell Biology, 21, 3738-3749.Ashley, Harris and Poulton (2005) “Detection of mitochondrial DNA depletion in living human cells using PicoGreen staining”.Experimental Cell Research 303, 432–446Bergeron, R. et. al. (2001) “Chronic activation of AMP kinase results in NRF-1 activation and mitochondrial biogenesis” Am J PhysiolEndrinol Metab 281, El340-El346Carthon, Bradley C. et al. (2005) “Genetic Replacement of Cyclin D1 Function in Mouse Development by Cyclin D2” Molecular andCellular Biology 25, 1081-1088Chau C.A., Evans M.J., and Scarpulla R.C., 1992, “Nuclear Respiratory Factor 1 Activation Sites in Genes Encoding the Gama-Subunit of ATP Synthase, Eukaryotic Initiation Facto 2-alpha, and Tyrosine Aminotrahsferase”, Journ. Biol. Chem., 267(10), 6999-7006.Coll, T., et. al, (2006) “Palmitate-Mediated Downregulation of Peroxisome Proliferator-Activated Receptor-γ Coactivator 1α inSkeletal Muscle Cells Involves MEK1/2 and Nuclear Factor-κB Activation” Diabetes 55, 2779-2787Delghandi, M. P. et al., (2005) “The cAMP signalling pathway activates CREB through PKA, p38 and MSK1 in NIH 3T3 cells” CellularSignaling 17 (11), 1343-1351Duguez, S. et. al. (2001) “Mitochondrial Biogenesis during skeletal muscle regeneration” AJP – Endocrinology and Metabolism 282,E802-E809Fan, M. et. al. (2004) “Suppression of mitochondrial respiration through recruitment of p160 myb binding protein to PGC-1α:modulation by p38 MAPK” Genes & Development 18, 278-289Gleyzer, N., Scarpulla, R.C., and Vercauteren, K., (2005), Control of Mitochondrial Transcription Specificity Factors (TFB1M andTFB2M) by Nuclear Respiratory Factors (NRF-1 and NRF-2) and PGC-1 Family Coactivators, Molecular and Cellular Biology 25(4),1354-1366Gugneja, S., and Scarpulla R. C., 1997, Serine phosphorylation within a concise amino-terminal domain in nuclear respiratory factor1 enhances DNA binding, Journal of Biological Chemistry, 272, 18732-18739Herzig R.P., Scacco S., and Scarpulla, R.C. 2000, Sequential serum-dependent activation of CREB and NRF-1 leads to enhancedmitochondrial respiration through the induction of cytochrome c, Journal of Biological Chemistry, 275, 13134-13141.Kuningas, M. et. al. (2007) “SIRT1 Gene, Age-Related Diseases, and Mortality: The Leiden 85-Plus Study” The Journals ofGerontology Series A: Biological Sciences and Medical Sciences 62, 960-965Lee, S. et al. (2007) “Cell cycle-dependent mitochondrial biogenesis and dynamics in mammalian cells” Science Direct 357, 111-117Lin, J. et. al. (2001) “PGC1b: A Novel PGC1 Related Transcription Coactivator Associated with Host Cell Factor” J. Biol. Chem. 10,1074Lin, J. et al. (2005) “Metabolic control through the PGC-1 family of transcription coactivators” Cell Metabolism 1, 361-367Li, P. et. al., (2006) “Resident stem cells are not required for exercise-induced fiber-type switching and angiogenesis but arenecessary for activity-dependent muscle growth” American Journal of Physiology – Cell Physiology 290, C1467-C1468Mandal, S. et. al. (2005) “Mitochondrial Regulation of Cell Cycle Progression during Development as Revealed by the tenuredMutation in Drosophila” Developmental Cell 9, 843-854Martinez-Diez, M., Santamaria, G., Ortega, A.D., and Cuezva, J.M., (2006), Biogenesis and Dynamics of Mitochondrial during theCell Cycle: Significance of 3’UTRs, PLoS ONE 1(1), e107Melloul, D. and Stoffel, M. (2004) “Regulation of Transcriptional Coactivator PGC-1α” Sci. Aging Knowl. Environ. 2004, pe9Ongwijitwat, S. & Wong-Riley, M.T. (2005) “Is nuclear respiratory factor 2 a master transcriptional coordinator for all ten nuclearencodedcytochrome c oxidase subunits in neurons?” Gene 360, 65-77Petersen, C. et. al. (2005) “The p38 MAPK pathway mediates interleukin-1-induced Sertoli cell proliferation” Cytokine 32, 51-59Petit, Maftah, Ratinaud and Julien (1992), “10N-Nonyl acridine orange interacts with cardiolipin and allows the quantification of thisphospholipid in isolated mitochondria” European Journal of Biochemistry 209, 267-273Presley, Fuller and Arriaga (2003) “MitoTracker Green labeling of mitochondrial proteins and their subsequent analysis by capillaryelectrophoresis with laser-induced fluorescence detection” Journal of Chromotography B issue 1, 141-150SCI 332 Advanced Molecular Cell Biology Research Proposal 71

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Puigserver, P. and Spiegelman, B.M. (2003) “Peroxisome Proliferator-Activated Receptor – γ Coactivator 1α (PGC-1α): TranscriptionalCoactivator and Metabolic Regulator” Endocrine Reviews 24, 78-90Reznick, R. and Shulman, G.I. (2006) “The role of AMP-activated protein kinase in mitochondrial biogenesis” The Journal of Physiology,574, 33-39Sonoda, J. et. al., (2007) “PGC-1β controls mitochondrial metabolism to modulate circadian activity, adaptive thermogenesis, andhepatic steatosis” Proc Natl Acad Sci U.S.A. 104, 5223–5228.Taanman, J.W. et. al. (1997) “Molecular mechanisms in mitochondrial DNA depletion syndrome” Human Molecular Genetics 6, 935-942Van den Bogert, C. et. al. (1988) “Mitochondrial Biogenesis and Mitochondrial Activity during the Progression of the Cell Cycle ofHuman Leukemic Cells” Experimental Cell Research 178, 143-153Vercauteren, K. et. al. (2006) “PGC-1-related coactivator (PRC): immediate early expression and characterization of a CREB/NRF-1binding domain associated with cytochrome c promoter occupancy and respiratory growth” Mol Cell Biology 20, 7409-7419Virbasius and Scarpulla (1994) “Activation of the human mitochondrial transcription factor A gene by nuclear respiratory factors: apotential regulatory link between nuclear and mitochondrial gene expression in organelle biogenesis” Proc. Natl. Acad. Sci. 91(4),1309-1313Wackerhage, H. et. al, (2002) “Exercise-induced Signal Transduction and Gene Regulation in Skeletal Muscle” Journal of SportsScience and Medicine 1, 103-114Wang C., et al., (2006), Cyclin D1 repression of nuclear respiratory factor 1 integrates nuclear DNA synthesis and mitochondrialfunction, PNAS, 103, 11567-11572.Wulf, A. et. al. (2007) “T3-mediated gene expression is independent of PGC-1α” Molecular and Cellular Endocrinology 270, 57-63Zoltan, A., et. al. (2007) “The Transcriptional Coactivator PGC-1β Drives the Formation of Oxidative Type IIX Fibers in SkeletalMuscle” Cell Metabolism 5, 35-46SCI 332 Advanced Molecular Cell Biology Research Proposal 72

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Mitofusin 2 and the Cell CycleA role for Mitofusin 2 in the regulative interaction between mitochondria and cell cycleprogressionResearch proposal byJ. Claus, S.J.H. Diederen, L. Hussaarts, S. Kamps, A. Moussa, A. SchierenbergAbstractMitofusins play a crucial role in the fusion machinery of mitochondria. Mitofusin-2 (Mfn2) contributes tofusion, but has additional roles as well. Overexpression of the protein causes an upregulation of OXPHOS,which results in a higher mitochondrial membrane potential. Mfn2 is also able to bind to Ras, which leadsto inhibition of the Raf-MEK-ERK pathway, resulting in cell cycle arrest or apoptosis. It is striking that oneprotein can have such contradictory functions in the cell. Little is known about these functions of Mfn2,especially when it comes to the protein’s role in cell cycle progression and normal cellular functioning.Recent discoveries of two isoforms of Mfn2 – a lighter and a heavier one – provided new insights on howMfn2 can play a role in both pathways. To investigate these isoforms with their different roles andespecially in relation to the cell cycle, this research proposes firstly measuring the Mfn2 levels throughoutthe different phases of the cell cycle. Subsequently, it will be investigated how Mfn2 influences OXPHOSin addition to examining the role of Stomatin-like Protein 2 (Stoml2) in this process. Moreover, it will beexplored whether the lighter isoform of Mfn2 is restricted to the cytosol, and whether this isoform iscreated through cleavage of a specific part of the heavier isoform, which suggested to be localized in themitochondria. Furthermore, it will be studied whether cytosolic Mfn2 fluctuates throughout the cell cycleand whether oxidative stress leads to higher expression of this cytosolic form. It will be researchedwhether Ras mediated cell cycle arrest is induced when Mfn2 reaches a certain threshold. Finally anexploration of the correlation between cyclins and Mfn2 is proposed, to explore whether cyclins play a rolein influencing Mfn2 production or activity.SCI 332 Advanced Molecular Cell Biology Research Proposal 73

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007IntroductionMitofusin 2 is a member of the mitochondrial outer membrane GTPases family of mammalian mitofusins.The structure of Mfn2, shown in Figure 4.1, is characterized by a GTPase domain, which is present on theN terminal of the protein. Both cytosolic parts of Mfn2 contain coiled coil domains. As for the midsection ofthe protein, a transmembrane domain affixes Mfn2 to the outer mitochondrial membrane (Ansgar, 2006).Figure 4.1:Schematic representation of Mfn2. In the outer mitochondrial membrane.Note that both the N- and C-terminals face the cytosol. HR1 and HR2indicate two heptad repeat regions, motifs that generally form coiled-coilstructures.To date, much research has elaborately explored the role of Mfn2 accounting for the morphologicalchanges of mitochondria. The protein enables mitochondria to tether, which eventually mediates fusion(Yan Zhanga, 2007). Furthermore, the role of dysfunctional Mfn2 has been investigated extensively. Amutated form of the protein compromises many of the vital functions of the mitochondria, leading tovarious neurodegenerative disorders such as that of Charcot-Marie-Tooth 2 (Ansgar, 2006).However, perhaps the focus on the role of Mfn2 in mitochondrial morphogenesis has overshadowedmultiple other functions this protein exhibits. Mfn2 plays an important role in maintaining membranepotential and thus OXPHOS activity. It is known that overexpression of Mfn2 can upregulate OXPHOScomplexes resulting in a higher membrane potential (Pich et al., 2005). Nonetheless, as Mfn2 has beenshown to be involved in apoptosis (Shen et al., 2007) and cell cycle arrest pathways (Chen et al., 2004) itcan be safely assumed that the functions of Mfn2 are not merely restricted to the mitochondria but alsoare also effective in the cytosol.Thereby, this research will focus on exploring the various functions of Mfn2, apart from those exhibited inthe morphology of the mitochondria (Figure 4.2). Rather will this research focus on Mfn2 as a regulatingfactor between the functionality of the mitochondria and the progression of the cell cycle.Since Mfn2 is capable of upregulating OXPHOS, it could be targeted when energy demands change. It isthought that during the cell cycle OXPHOS activity should be regulated, as different demands of energycorrespond to the different phases of the cell cycle (Cuezva et al., 2006). Therefore, it is hypothesized thatMfn2 expression and/or activity fluctuates throughout the cell cycle. By regulation of Mfn2 levels during theSCI 332 Advanced Molecular Cell Biology Research Proposal 74

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007cycle, OXPHOS activity could be matched to the phase-specific demands. In hypothesis 1 the fluctuationsof Mfn2 levels will be investigated, to determine its proposed relation to the progression of the cell cycle.Secondly, Mfn2 has been shown to form a complex with an inner mitochondrial membrane protein,Stomatin-like Protein 2 (Stoml2). The presence of Stoml2 on the inner mitochondrial membrane isinvolved in regulating the mitochondrial membrane potential (Hájek et al., 2007). Based on these findings,the second part of this proposal will explore the molecular mechanisms that fuel the upregulation ofOXPHOS through Mfn2. The hypothesis will examine the influence of the formation of an Mfn2-Stoml2complex as a proposed necessity for the maintenance of a mitochondrial membrane potential.Collectively, the first two hypotheses will support the notion that oxidative phosphorylation isregulated throughout the cell cycle via the first isoform of Mfn2, situated in the mitochondria.The proposal will proceed with the exploration of the exerted functions of Mfn2 in the cytosol. CytosolicMfn-2 has been shown to be capable of inducing both cell cycle arrest and apoptosis as previouslydescribed. The contradictory influence of Mfn2 in upregulating OXPHOS and prohibiting cell cycleprogression through cytosolic pathways could be explained through the third hypothesis of this research.In this section it is hypothesized that through the cleavage of a specific site of mitochondrial Mfn2,cytosolic Mfn2 can be generated. It could very well be that this cleavage and thus the generation ofcytosolic Mfn2 is a consequence to a need of cell cycle arrest under various cellular stress factors. Thecleavage of the mitochondrial protein will be of a dual benefit in this case, for on the one handmitochondrial Mfn2 will seize to aid in the production of energy, whilst the newly formed cytosolic Mfn-2will induce cell cycle inhibition. This notion of that the cytosolic isoform of Mfn2 stems from themitochondrial Mfn2 due to cleavage is more elaborately explored in hypothesis 3.In hypothesis 4 the functions of cytosolic Mfn2 will be further scrutinized. Previous research hasestablished the capability of Mfn2 to inhibit Ras, after which inhibition of the Raf-MEK-ERK pathway willlead to cell cycle arrest. However, since a small amount of cytosolic Mfn2 is always present in the cytosol(Chen et al., 2004), it is reasoned that cell cycle arrest can be achieved when cytosolic Mfn2 levels reacha certain threshold of Ras inhibition.The final hypothesis will verify the regulative role of cyclins exerted on Mfn2. This will illustrate yet anotherinteraction of Mfn2 with the cell cycle. With a focus on both the indirect and direct effects of cyclins onMfn2, i.e. expression and/or activity, this part of the research will use statistical data analysis to measurethe possible correlation between cyclin D1 / E levels and those of Mfn2.Figure 4.2 Project 4 and its hypothesesWhere other projects look at more general processes and are trying to elucidate the mechanisms behindthem, this research rather proceeds by using a divergent manner of investigation. This research proposalis not aimed at investigating a group of proteins, responsible in one mechanism, but rather investigation ofSCI 332 Advanced Molecular Cell Biology Research Proposal 75

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007one protein and its different functions is focused on. In broadening understanding about its functionality, apotent drug target for diseases like Charcot-Marie-Tooth 2 and several hyper-proliferative diseases mayappear. Moreover, the existence of a new cell cycle regulating protein may be established and ourunderstanding of OXPHOS regulation will broadened. Apart form the cell cycle, it is proposed that Mfn2 isinvolved in a specific type of fusion, where Mfn2 is responsible for both OXPHOS upregulation, whichgenerally leads to an increase in ROS, and at the same time initiating fusion, resulting in mtDNArecombination compensating for ROS’s harmful effects. This research could provide further evidence insupport of this hypothesis.It is hypothesized that Mfn2 is a protein which can aid in cell cycle progression by Stoml2 mediated energygeneration, and can prohibit cell cycle progression through cytosolic pathways. Conclusively, we proposethat Mfn2 is a key player in multiple regulative interactions between mitochondria and the cell cycle.SCI 332 Advanced Molecular Cell Biology Research Proposal 76

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Proposed ResearchHypothesis 1: Mfn2 levels fluctuate throughout the cell cycle and this istranscriptionally regulatedAs indicated by previous research fusion is promoted in certain phases of the cell cycle (Margineantu et al.,2002). Since Mfn1 and Mfn2 play an important role in fusion accordingly, either their levels or their activitymust be regulated in coordination to the necessity of performing fusion. In addition, as hypothesized bygroup 1, it seems likely that during the cell cycle OXPHOS activity is constantly being regulated (Tu et al.,2005). In the G1 phase the biosynthetic activities of the cell cycle increase, consequently causing a rise inthe energy demand (Martínez-Diez et al., 2006), whereas a downregulation of OXPHOS would bedesirable from pre-S-phase through S-phase. Since Mfn2 is able to upregulate OXPHOS, it might be thatthis protein is targeted according to the energy demands expressed in each various cell cycle phase.Derived from these findings, it is viable to propose that levels of Mfn2 are regulated throughout the cellcycle, presumably in a coordinated manner. Therefore, this hypothesis will research the fluctuation of theprotein throughout the different phases of the cell cycle. It will aim to establish the regulation of the levelsof Mfn2. For that purpose, expressed mRNA levels, next to those of the protein itself, will be measured.Question 1.1: Are there fluctuations in the levels of Mfn2 corresponding to the various phases of the cellcycle?As prior background knowledge was mainly obtained from research using human aortic smooth musclecells (Chen et al., 2004), unless indicated otherwise, experiments throughout this research will also makeuse of the same cell line; HAoSMC-c (Promocell) (for cell culture medium, see Appendix E1).Firstly, in order to determine the protein levels of Mfn2 throughout the cell cycle, measurementswill be taken at various intervals; in the middle and end of each phase of the cell cycle (i.e. M/G1, mid G1,G1/S, mid S, S/G2, G2/M, mid M). This will be done over the length of two cycles in order to exclude anypossible side effects attributed to re-entry into the cell cycle. Additional intervals may be added to furtherinvestigate the fluctuation of Mfn2 protein levels after these initial results have been obtained. The cellswill be synchronized by the use of mitotic shake off (Appendix A). Not only is this a non-disruptive methodfor synchronizing cells but also, as opposed to other methods, it doesn’t influence OXPHOS neither doesit disturb the energy balance (Davis et al., 2001). This is of crucial importance, since those factors mightinfluence the expression of Mfn2. Followed by this, the protein levels will be quantified using western blotanalysis (Appendix A).Experiment 1.1In order to determine the length of each cell phase, cells will be labeled with bromo-deoxyuridine (BrdU)(Appendix A), using the standardized protocol, provided by the manufacturing company (Invitrogen).Mitotic shake-off will be carried out as discussed in (Muray, 2006).To label the cells, DAPI (Appendix A)will be used, thus enabling the detection of the desired cell phase (Exalpha Biologicals).A Western Blot Kit (Invitrogen) will be used to perform western analysis. This kit contains twosecondary anti-bodies, namely anti-rabbit IgG-HRP (starting dilution 1:5000) and anti-mouse IgG-HRP(starting dilution 1:2000). The procedure will be performed according to the manufacturer’s manual. As aprimary antibody Mfn2 H-68: rabbit polyclonal IgG (starting dilution 1:50) will be used (Santa CruzBiotechnology). As an internal control β-tubilin, a household protein, will be blotted using 3F3-G2, amouse monoclonal IgM (Santa Cruz Biotechnology).Research Question 1.2: Are there fluctuations in the Mfn2 mRNA levels corresponding to the variousphases of the cell cycle?The same procedure discussed in the previous experiment 1.1, will be executed, with the change ofmeasuring mRNA levels rather than those of the protein itself. mRNA levels will be examined using realtime PCR (Appendix A). As this is a highly sensitive method, it will exclude closely related mRNA levelsand yield accurate results of Mfn2 mRNA levels. Since mitotic shake-off will be used to synchronize thecells, the amount of available cells will be limited. Real time PCR is therefore particularly useful, since itSCI 332 Advanced Molecular Cell Biology Research Proposal 77

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007involves an amplification step. Real time PCR can give the quantitative results, needed for this experiment,with relative simplicity compared to other methods.Experiment 1.2The RNA extraction and treatment with DNase will be performed using Rneasy mini kit (Qiagen). RNAconcentration will be determined by spectrophotometry. Using Superscript TM III reverse transcriptase(Invitrogen), Oligo-dT first-strand cDNA must be synthesized. SYBR®Green technology will be used toperform Real-time PCR with a QuantiFast SYBR Green RT-PCR Kit (Qiagen).The following, will be usedas a forward and reverse primer for Mfn2:and5’-CCCCCTTGTCTTTATGCTGATGTT-3’3’-CTTTATTCGTTGTGGAGAGGGTTTT-5’ (Pich et al., 2005)As a standard, GCB must be used with its corresponding primers:and5’-GCACAACTTCAGCCTCCCAGA-3’3’-TTACCTCGCCACTTACCCTTC-5’ (Pich et al., 2005)PCR amplification will be performed in duplicate in a total reaction volume of 15 µL. The reaction mixturewill consists of 1 µL diluted template, 1.5 µL the FastStart DNA Master SYBR Green I kit, 3 mM MgCl 2 ,and 0.5 µM forward and reverse primers (as described by Pich et al., 2005) A melting curve will be used toexamine amplification specificity. The results will be normalized to GCB transcription, compensatingvariation in input of RNA and reverse transcription.Hypothesis 2: Mitochondrial Mfn2 forms a complex with Stoml2 regulatingmitochondrial membrane potential and OXPHOS complex I, II, III and V subunitexpression.The mammalian homologues for yeast protein Fzo1p, mitofusins 1 and 2 are best known for their activityin mitochondrial membrane fusion (Griffin et al., 2006). Mfn2, however, has been implicated in differentprocesses as well. Amounts of Mfn2 present in the mitochondria have been shown to regulate oxidativephosphorilation (OXPHOS) complex formation (Pich et al., 2005). Inhibition of functional Mfn2 led to adecrease in expression of subunits of OXPHOS complexes I, II, III and V, independent of mitochondrialmorphology (i.e. fusion) (Pich et al., 2005).Secondly, Mfn2 has been shown to form a complex with Stomatin-like Protein 2 (Stoml2), an innermitochondrial membrane protein (Hájek et al., 2007). The presence of Stoml2 on the inner mitochondrialmembrane is involved in regulating the mitochondrial membrane potential, as Stoml2 knockdown wasassociated with loss of membrane potential.Mfn2 is a membrane protein with two transmembrane domains and two cytoplasmic coiled-coildomains on both the C-terminus and the N-terminus. The intermembrane space loop of Mfn2 consists ofone amino acid, W626. Furthermore, Mfn2 contains three small GTP domains, ranging from four to eightamino acids each (Bach et al., 2003; Rojo et al., 2002).This section of the research will focus on the role of the Mfn2-Stoml2 complex in the regulation ofmitochondrial membrane potential and expression of the subunits of OXPHOS complexes I, II, III and V. Itis hypothesized that the formation of an Mfn2-Stoml2 complex is necessary for the maintenance of amitochondrial membrane potential. It is also hypothesized that a lack of Mfn2-Stoml2 complex will lead toa decrease in expression of subunits of OXPHOS complexes I, II, III and V.Question 2.1: What is the role of the intermembrane space loop of Mfn2 in Mfn2-Stoml2 complexformation?SCI 332 Advanced Molecular Cell Biology Research Proposal 78

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007To research the influence of the Mfn2-Stoml2 complex on mitochondrial functioning, a mutant ensuring nodisplay of complex formation will have to be synthesized. The likely mutation site to achieve this would bethe Mfn2 intermembrane space loop. The tryptophan on location 626 is the only amino acid in theintermembrane space loop of Mfn2, causing it to be a relevant mutation target. Proline is commonly foundin turns and does not readily form hydrogen bonds, which makes it suitable for this type of mutation.Experiment 2.1Using custom synthesized oligonucleotides replacing amino acid VGGVVWKAVGW withVGGVVPKAVGW (Integrated DNA Technologies) in site-directed mutagenesis (QuickChange, Stratagene)an Mfn2 W626P mutant will be generated (Appendix A).As indicated earlier, human aortic smooth muscle cell line: HAoSMC-c (Promocell). The cells willbe transfected with a plasmid containing the Mfn2 W626P mutant. To silence wild type (wt) expression ofMfn2, siRNA against Mfn2 (siGenome SMARTpool, Dharmacon) will be used.As control groups, firstly wt Mfn2 cells will be used, thus enabling the complex formation.Secondly, as a negative control, untransfected cells with siRNA against Mfn2, in which no complexformation would be anticipated, will be utilized.Results will be measured using co-immunoprecipitation (Appendix A) using Dynabeads-Protein A(Dynal). The primary antibody for Mfn2 H-68: rabbit polyclonal IgG, starting dilution 1:50 (Santa CruzBiotechnology). Subsequent western blotting will be performed using a Western Blot Kit (Invitrogen). Thiskit containsa secondary antibody,namely mouse anti-rabbit IgG.Question 2.2: How does mitochondrial membrane potential change when Mfn2-Stoml complex formationis inhibited?Inhibition of Stoml2 has been shown to decrease the mitochondrial membrane potential (Hájek et al.,2007). A decrease in Stoml2 will also cause a decrease in Mfn2-Stoml2 complex formation. Thisexperiment will help ascertain whether it is the lack of Mfn2-Stoml2 complex presence rather than theexpression of Stoml2 that causes the decrease in membrane potential.Experiment 2.2In order to research the influence of the Mfn2-Stoml2 complex on mitochondrial membrane potential, wewill use cells transfected with the Mfn2 W626P mutant and stained using JC-1 (Molecular Probes), whichexhibits a fluorescence emission shift when the mitochondrial membrane potential changes. We willexamine whether a downregulation of Mfn2-Stoml2 complexes will lead to a downregulation in membranepotential. We will measure the membrane potentials of cells containing different amounts of Mfn2-Stoml2complexes. These different amounts of complex formation are generated by using different levels ofsiRNA Mfn2 wt and siRNA Mfn2 W626P in the cells.To visualize the change in membrane potential in Mfn2-Stoml2 complex-deficient cells versus themembrane potential in wt Mfn2 cells, we will use different levels of wt Mfn2 and Mfn2 mutant inhibitionthrough siRNA (Table 4.1).The Mfn2 W626P mutant siRNA will be acquired in custom made form(Dharmacon).As a control group, wild type cells will be stained with JC-1 and measured without transfection orsiRNA inhibition. The fluorescence emission will be measured using confocal fluorescence microscopy(Appendix A).SCI 332 Advanced Molecular Cell Biology Research Proposal 79

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Mfn2 wtMfn2 mutant0 nM siRNA Mfn2 wt Mfn2 W626P100 nM siRNA60 nM siRNA Mfn2 wt Mfn2 W626P40 nM siRNA80 nM siRNA Mfn2 wt Mfn2 W626P20 nM siRNA100 nM siRNA Mfn2 wt Mfn2 W626P0 nM siRNATable 4.1: Amounts of siRNA Mfn2 wt and siRNA Mfn2 W626P to be simultaneously administered to cells.Question 2.3: How does OXPHOS complex I, II, III and V subunit expression change when Mfn2-Stoml2complex formation is inhibited?Mfn2 knockdown results in a decrease in OXPOS complex I, II, III and V subunit expression (Pich et al.2005). In this experiment, we will look at the influence of the Mfn2-Stoml2 complex on OXPHOS complex I,II, III and V subunit expression.Experiment 2.3To assess the influence of the Mfn2-Stoml2 complex on OXPHOS complex subunit expression, we willuse western blots (Appendix A) to measure subunit abundance in the Mfn2 W626P mutant cells comparedto wild type cells, using actin as a control measure. The subunits looked at in particular are the ones thathave shown to be decreased when Mfn2 expression is downregulated (Pich et al., 2005), being subunitp39 from complex I, p70 from complex II, p49 from complex III and the α-subunit of complex V, allencoded by nuclear DNA.The antibodies that will be used are anti-NDUFA9 (Santa Cruz Biotechnology) against complex I,anti-Fp (Molecular Probes, A11142) against complex II, anti-core 2 (Molecular Probes, A11143) againstcomplex III and anti-subunit α from H + -F 1 ATP synthase (Molecular Probes, ) against complex V. As antiactin,CGA7, a smooth muscle actin antibody (Santa Cruz Biotechnology) will be used.Question 2.4: Are Mfn2-Stoml2 complexes still formed in the absence of Mfn2 GTP binding domains?Mfn2 contains three GTP binding domains. Since GTP binding might be necessary for the formation of theMfn2-Stoml2 complex, it is useful to create GTP binding domain-deficient Mfn2 mutant to see if Mfn2-Stoml2 complexes are still being formed.Experimental ProceduresWe will use a custom made mutant of Mfn2 which lacks the three GTP domains 103-110, 199-203 and258-261, Mfn2 GTP- (GenScript). We will transfect cells with this plasmid along with siRNA Mfn2 wt to silencewild type expression. As controls we will use wild type cells, which will form complexes, and untransfectedcells with siRNA Mfn2 wt as a negative control.The results will be measured using co-immunoprecipitation and western blotting as describedabove.Hypothesis 3: Cytosolic Mfn2 weighs 68 kilo Dalton and is formed after cleavageof the heavier type Mfn2Apart from the role of Mfn2 in the mitochondria, multiple studies conclude a role for Mfn2 in the cytoplasm.A recent study illustrated an emerging role of Mfn2 in inducing apoptosis. There are multiple pathwaysinvolving Mfn2 through which apoptosis could be induced (Shen et al., 2007). Firstly, apoptosis can beachieved through a mitochondrial pathway, also known as the intrinsic pathway, through whichmitochondrial Mfn2 can act upon the activation of both Caspases 9 and 3 (Shen et al., 2007). Secondly,binding of cytosolic Mfn2 to inhibit Ras can provoke apoptosis through a mitochondria independentmanner involving Akt (Shen et al., 2007). Moreover, In a study conducted on vascular smooth muscle cells,researchers noted reduced presence of Mfn2 in hyper-proliferative vascular smooth muscle cells (Chen etSCI 332 Advanced Molecular Cell Biology Research Proposal 80

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007al., 2004). In this study, Mfn2 has been shown to be able to induce cell cycle arrest via inhibition of Ras,after which the Raf-MEK-ERK pathway is blocked.From this information, it seems viable to assume that Mfn2 plays a major role in the induction ofcell cycle arrest and apoptosis. In most findings it seems that it is specifically Mfn2 located in the cytosol,as opposed to mitochondrial Mfn2, that plays a role in these cell-progression pathways. Therefore, anexploration of the presence and formation of this cytosolic Mfn2 type is a logical step in our research, as itwill allow a more in depth exploration of the regulative role of Mfn2 on the cell cycle.It should be noted that at first sight, Mfn2 seems to have contradicting roles within the cell. On onehand Mfn2 maintains OXPHOS, whereas on the other hand, Mfn2 can induce cell cycle arrest andapoptosis. This might be explained through a mechanism that cleaves mitochondrial Mfn-2 in case cellcycle arrest or apoptosis is needed. Through cleavage, mitochondrial Mfn2 levels will decrease, afterwhich OXPHOS maintenance will drop and energy levels will be lowered. As has been discussed inproject 1, this might lead to cell cycle arrest. On the other hand, cytosolic Mfn2 will increase, which caninduce cell cycle arrest or apoptosis.Question 3.1: Does cytosolic Mfn2 weigh 68 kD?In the research on hyper-proliferating vascular smooth muscle cells (Chen et al., 2004) it was discoveredthrough western blot analysis that two forms of Mfn2 were present in the cell. The two strands representedMfn2 types of a varying molecular weight. The first strand with a molecular weight of 86 kD was equallypresent in normal and highly proliferating cells. Contrary to the former, the second type of Mfn2, weighing68 kD, showed to be less present in hyper-proliferative cells. (Chen et al., 2004) This suggests a specificfunction for the lighter type Mfn2 in Ras inhibition. As Ras is inhibited by cytosolic Mfn2 it is viable tohypothesize that light-type Mfn2 represents in fact cytosolic Mfn2.In order to answer the question whether the 68 kD Mfn2 is restricted to the cytosol and the 86 kDMfn2 is restricted to the mitochondria, cell fractionation (Appendix A) and subsequently western analysis(Appendix A) will be used. The vascular smooth muscle cell culture HAoSMC-c (Promocell) will again beused.Experiment 3.1Fractionation will be executeded by usage of a cytosol/mitochondria cell fractionation kit (BioVision). Thiskit separates the mitochondria from the cytosol, the latter will contain everything that is usually present inthe cytosol, except for the mitochondria. The procedure will be carried out as described in themanufacturer’s protocol. Subsequently, western analysis will be exerted with help of a Western BreezeChemiluminescence Kit anti-goat (Invitrogen). The kit contains a secondary anti-goat IgG antibody(starting dilution 1:5000) conjugated with AP and an AP substrate. The procedure will be carried outaccording to the manufacturer’s manual.After fractionation, the cytosolic sample will be tested through western analysis for a protein thatis exclusively found in mitochondria, namely the protein Tom40. A primary antibody (starting dilution 1:200)from goat (Santa Cruz Biotechnology) will be obtained. The mitochondrial sample will be tested for aprotein that is only found in the cytosol as well. In this case the ribosomal protein L28 will be used. Again,a primary antibody (starting dilution 1:200) from goat (Santa Cruz Biotechnology) will be obtained. If bothtests are found to be negative, the fractionation has been successful. As an internal control for all westernblots (except for the mitochondrial samples) β-tubulin will be checked with help of a primary antibody β-tubulin L15 (Santa Cruz Biotechnology).Thereafter, the mitochondrial and cytosolic samples will be tested separately for Mfn2 throughwestern analysis. In order to detect Mfn2 we will use the primary antibody Y-19 (Santa CruzBiotechnology), a goat polyclonal IgG antibody specific for the N-terminal (starting dilution 1:200) After thistest it can be concluded which weight-types of Mfn2 are present in both the mitochondria and the cytosol.Question 3.2: Is cytosolic Mfn2 formed after cleavage of the heavier type Mfn2?The structure of mitochondrial Mfn2 is known and is schematically represented in Figure 4.1 (inintroduction). Mfn2 consists out of 757 amino acids. The first 604 amino acids account for the N-terminalcytosolic part of Mfn2, containing both a GTPase and a heptad repeat region, which forms a coiled coil.Amino acids 605-625 and 627-647 account for the trans-membrane regions (TMD). Furthermore, aminoacids 648-757 account for the C-terminal cytosolic region, containing heptad repeat region and a coiledcoil (Swissprot).SCI 332 Advanced Molecular Cell Biology Research Proposal 81

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007The difference between the two types of Mfn2 is hypothesized to be constituted by the cleavage ofregions that are responsible for mitochondrial targeting. Firstly, a TMD is normally sufficient to target aprotein to the mitochondria (Santel and Fuller, 2001). As cytosolic Mfn2 is not targeted to the organelle,the TMD might partially account for the difference in weight between cytosolic and mitochondrial Mfn2.Secondly, Mfn2 contains coiled-coil domains that are upstream and downstream of the TMD, whichinteraction is also important for mitochondrial targeting. When any of these domains is deleted, part of theMfn2 population remains cytosolic (Rojo et al., 2002). Furthermore, it has been noticed that the C-terminalis also essential for mitochondrial targeting of Mfn2 (Rojo et al., 2002).The region of Mfn2 reaching from the first TMD to the cytoplasmic C-terminal regions contains alldomains that have been identified as mitochondrial-targeting regions. The difference between the light andheavy type Mfn2 accounts for 18 kD. Through a simple calculation one can conclude that the regionsresponsible for mitochondrial targeting must altogether weigh approximately 18 kD. This can be concludedas the region contains 152 amino acids and an average amino acid weighs 0,115 kD. Thus, 0,115 times152 equals 17,48 kD.From the information presented above it is hypothesized that the N-terminal cytosolic region ofmitochondrial Mfn2 is also present in cytosolic Mfn2. After cleavage of both TMD’s, the intermembraneloop and the C-terminal cytosolic region, Mfn2 becomes cytosolic.Experiment 3.2Firstly, the western blots obtained in experiment 1 will be used. Antibodies specific for the N-terminal havealready been added to the western blots, as was described above. Additionally, mouse antibodies 6A8(Starting dilution 1:200) specific for the C-terminal (Abnova) will be added as well. Thereafter, secondarydonkey anti-mouse IgG (starting dilution 1:2000) conjugated with HRP (Santa Cruz Biotechnology) will beadded. A luminal reagent obtained from the same company will be used as HRP substrate. It will bevisualized which Mfn2 populations still contain the C-terminal region.In a new cell culture, from the same cell line as used in previous experiments, immuno-fluorescencemicroscopy (Appendix A) will be used to asses the localization of the N-terminal and C-terminal antibodiesin formalin fixated paraffin-embedded cells. The primary C-terminal and N-terminal specific antibodies thatwill be used are the same as in previous experiments, although as indicated, different dilutions must beused in western analysis and immuno-fluorescence microscopy. It is hypothesized that the N-terminalantibody (starting dilution 1:50) will bind to all present Mfn2, whereas the C-terminal antibody (startingdilution 1:50) will only be seen in the mitochondria. A secondary rabbit anti-goat antibody (starting dilution1:100), labeled with FITC (green) (Santa Cruz Biotechnology), will be used to visualize the N-terminalprimary antibody. A secondary donkey anti-mouse antibody (starting dilution 1:100) (Santa CruzBiotechnology) labeled with biotin (red) will be used to identify the C-terminal specific primary antibody.After having shown the distribution of the two variants of Mfn2 over the previously mentioned fractions,and after having determined whether there is a difference in C-terminal region between the two, it will befurther explored how this difference has come to being. It is hypothesized that the light 68 kD variant isformed after cleavage of the heavier 86 kD Mfn2. However, to proof that the difference is not explainedthrough the occurrence of alternative splicing, a northern analysis (Appendix A) will be performed toexamine mRNA populations, in a cell culture obtained from the cell line stated above. A probe specific forthe N-terminal will be used to see whether one or two bands of Mfn2 mRNA will appear, as it ishypothesized that the two variants share identical N-terminals. Northern analysis will be performed usingthe Northern Max-Gly kit (Ambion). As a probe, a N-terminal specific custom made oligonucleotide will beused (Integrated DNA Technologies). The probe will be labelled using StarFire (Integrated DNATechnologies).Lastly, to show that cleavage is really the mechanism behind the two different forms of Mfn2, the expectedcleavage site will be deleted. At the same time it will be tested whether the hypothesized cleavage site isin fact the cleavage site. It is expected that the region reaching from the first TMD to the C-terminal regionis cleaved off to form cytosolic Mfn2. Therefore, cleavage is expected to take place somewhere betweenamino acids 595 and 604 (Appendix E4.2). Through the deletion of the 30 base pairs that form this region,we will try to disable cleavage. To form this mutant, a custom made oligonucleotide will be used(Integrated DNA Technologies) along with site-directed mutagenesis (Appendix A) (QuickChange,SCI 332 Advanced Molecular Cell Biology Research Proposal 82

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Stratagene). siRNA to silence the wild type expression of Mfn2 will be used (Dharmacon). Afterintroduction of both into a cell culture (cell line as described above), western blots (as described above)will again be used to evaluated the occurrence of both Mfn2 variants. If only the 86 kD Mfn2 appears to bepresent after mutation it has been shown that the 68 kD variant is formed after cleavage of the 86 kD, andthe approximate cleavage site will have been identified.Hypothesis 4: Levels of cytosolic Mfn2 fluctuate throughout the cell cycle andthere is a threshold at which Mfn2 inhibition of Ras will lead to cell cycle arrestMfn2 can be present at a minimal of two locations within the cell, being in the outer mitochondrialmembrane and in the cytosol (Pich et al., 2005). Mfn2 located in the mitochondrial membrane has positivefunctions on mitochondrial activity, as has been discussed above (Pich et al., 2005). However, cytosolicMfn2 has the capability of binding to Ras, and subsequently inhibiting its function. This interaction withRas inhibits the MEK dependant signaling pathway. In vascular smooth muscles cells, this will ultimatelylead to cell cycle arrest throughout ERK-2 arrest (Shen et al., 2007). In conclusion, it is conceived thatcytosolic and mitochondrial Mfn2 have distinct functions. Mitochondrial Mfn2 function has been discussedabove. Here, cytosolic Mfn2 will be elaborated upon.Cell hyper-proliferation has long been thought to be one of the main etiologies in the causation of cancerand cardiovascular diseases. Especially vascular proliferative disorders, such as atherosclerosis, are themain common cause of cardiovascular diseases. These diseases are all characterized by uncontrolledproliferation of vascular smooth muscle cells. Proliferation of cells is influenced by a variety of externalfactors. All these factors have one common goal, namely influencing the cell cycle. One central regulatorin this targeting process is in the protein Ras. Ras is required to allow transition from G1 into S phase. Themain downstream pathway of Ras involves factors such as Raf, Mek1/2, ERK1/2 and MAPK. Thispathway ultimately leads to activation of cdk’s that in turn interact with cyclins, and thus allow cell cycleprogression. Mfn2 has been found to interfere with this pathway, and thus with hyper-proliferation. Mfn2has also been found to be capable of leading to cell cycle arrest throughout different pathways, andmoreover, the protein is capable of inducing apoptosis. Cytosolic Mfn2 appears to be a target ofupregulation when interference with cell cycle is needed. Because of this role for Mfn2, the protein hasalso been called hyperplasia suppressor gene. Various death-inducing stimuli, such as oxidative stress,can induce higher (cytosolic) Mfn2 expression (Shen et al., 2007). It is hypothesized that these effects ofMfn2 are due to cytosolic Mfn2 rather than to mitochondrial Mfn2. Therefore, by exploration of cytosolicMfn2, and its regulation, knowledge on diseases related to hyper-proliferation might be obtained, and newdrug targets could be discovered.Question 4.1: How do the levels of cytosolic Mfn2 fluctuate through out the cell cycle?Research has gone to indicate the presence of Mfn2 in the cytosol throughout the cell cycle (Pich et al.,2005). In the cytosol Mfn2 is capable of inducing cell cycle arrest in the course of binding to RAS.However, Mfn2 does not seem to be capable to elucidate a specific function at the cytosolic location at alltimes. Based on the previous working frame presented in the third hypothesis, the following experimentwill be aimed towards testing the levels of cytosolic Mfn2 throughout the various phases of the cell cycle.Experiment 4.1For the conductance of all the experiments to follow under this hypothesis, the human aortic smoothmuscle cell line, HAoSMC-c (Promocell), will be used yet again. Furthermore, the same measuresprovided in hypothesis 1 will be taken for cell synchronization. In order to achieve the goal of thisexperiment, the mitochondria first need to be fractioned from the cytoplasm. For that purpose, cellfractionation (Appendix A) will be carried out, with the aid of mitochondria/cytosol fractionation kit(Biovision). The procedure will be conducted according to the instructions provided by the manufactures'protocol. The same procedure used in hypothesis 3, will be repeated in order to determine the purity of theobtained fractions.The step to follow will entail conducting western blot (Appendix A), for which a BreezeChemiluminescence Kit anti-goat (Invitrogen) will be used. A C-terminal mouse monoclonal anti-humanSCI 332 Advanced Molecular Cell Biology Research Proposal 83

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007primary antibody 6A8 (Abnova) and secondary donkey anti-mouse (Santa Cruz Biotechnology) will beused to identify the cytosolic Mfn2. In addition, Y19, an N-terminal goat primary antibody (Santa CruzBiotechnology) and as a secondary antibody donkey anti-goat IgG-HRP will be used (Santa CruzBiotechnology). After performing a western blot of the preceding, only the levels of Mfn2 with the Cterminal antibody will be taken into account. The procedure will be carried out at the various stages of thecell cycle, as indicated in hypothesis 1. As a control, all western blots will also measure ß-tubulin withprimary antibody ß-tubulin 3F3-G2: mouse monoclonal IgM (Santa Cruz Biotechnology). The secondaryantibody will be goat anti-mouse IgM-HRP (Santa Cruz Biotechnology. The starting dilutions will be 1:200and 1:2000, respectively.Question 4.2: How do increased levels of oxidative stress influence the levels of cytosolic Mfn2 expression?A previous study by Shen et al. in 2007 demonstrated that in cardiomyocytes an increased abundance inthe levels of Mfn2 mRNA expression correlate to the increase of cellular oxidative stress. Based onhypothesis 3, this experiment will provide data supporting the proposed notion of the cleavage ofmitochondrial Mfn2 into cytosolic Mfn2. We hypothesize that there will be a shift in the levels ofmitochondrial Mfn2 versus that of the cytosolic Mfn2. This means that in this experiment we will test thenotion that levels of cytosolic Mfn2 will change due to the cleavage of mitochondrial Mfn2 under conditionsof cellular stress, more specifically oxidative stress.Experiment 4.2To test this notion, western analysis will be performed (Appendix A). The Breeze Chemiluminescence Kitanti-goat (Invitrogen) will be used again. Similarly to the procedure in the previous hypothesis, the sameantibodies will be applied, under normal cellular conditions. Secondly, to test the influence of oxidativestress on the expressed levels of cytosolic Mfn2, the introduction of H 2 O 2 to the cells will serve as asource of reactive oxygen species (Chesley et al., 2000). 200 µM of H 2 O 2 will be injected into the cells,followed by which the same process of western analysis will be carried out. As earlier described inhypothesis 3, cytosolic Mfn2 is expected to be of a lighter weight strand appearing on the SDS page. Afterthe addition of the oxidative stress H 2 O 2 compound, the results expected will be the occurrence of areduction of in the expressed levels of the heavier type of Mfn2, while that of the cytosolic Mfn2 isexpected to increase, in comparison to the results obtained under normal cellular conditions.Question 4.3: Is there a threshold level at which Mfn2 can bind to and inactivate Ras, thus inducing cellcycle arrest?As discussed earlier, cytosolic Mfn2 is capable of inducing cell cycle arrest upon binding to the Raspathway (Chen et al., 2004). Nonetheless, this does not occur merely by the presence of the two factors inthe cytosol (Shen et al 2007). In order for cell cycle arrest to be induced in such a manner, there might bea required sufficient level of expressed cytosolic Mfn2 to elucidate this effect. The following hypothesis willtest for the assumed necessary threshold level of cytosolic Mfn2 upon which it binds to Ras, thusexhibiting cell cycle arrest.Experiment 4.3To determine the needed amounts of Mfn2 to inhibit the Ras pathway, siRNA (siGenome SMARTpool,Dharmacon) against Mfn2 will be used. The used amounts of siRNA against Mfn2 will correspond to thosementioned in hypothesis 2, in Table 4.1, titled under Mfn2 wt. Followed by each of the administered dosesof siRNA, co-immunoprecipitation (Appendix A) with the use of mammalian CO-IP kit (Pierce), togetherwith the rabbit polyclonal Mfn2 antibody H68 (Santa Cruz Biotechnology) will help assess the formedcomplex of Mfn2 and Ras. As a blank control we will conduct the same procedure, without the use of Mfn2antibody, to assess the aspecifc binding of Ras to the beads. Furthermore, the highest dose of siRNAused in the experiment (i.e. siRNA 100nM) will serve as a negative control. Since it is hypothesized thatcytosolic Mfn2 is capable of binding to Ras and thus inducing cell cycle arrest at a certain level of complexformation, the experiment will proceed by incorporating BrdU, in a similar way to that previouslydescribed in hypothesis 1. Once BrdU can no longer be incorporated into the cells, we can conclude thatthere was no cell cycle phase transition, and thus cell cycle arrest has been induced by the complex ofinterest.SCI 332 Advanced Molecular Cell Biology Research Proposal 84

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Hypothesis 5: Cyclin D1 or cyclin E can mediate Mfn2 production or activityCyclins in combination with their cdk’s play an important role in cell cycle progression and in the regulationof mitochondrial activity. It has been demonstrated, for example, that cyclin B regulates mitochondrialfusion. The protein binds to Drp1 on Ser 585 (Taguchi, 2007), where it directly induces fission. Mfn2 alsohas a Ser 442 PKA phosphorylation site (Kuang-Hueih Chen1 2004). This site might have the samefunction as the SER 585 in Drp1, i.e. a target for cyclin mediated activation.In 2000, Alt et al. proved that cyclin D1 is capable of influencing mitochondrial activity. Decreasedcyclin D1 levels correspond to increased mitochondrial activity, whereas normal cyclin D1 levels repressmitochondrial activity (Sakamaki, 2006). Studies show that cyclin E can take over the functions of cyclinD1. In addition, analysis suggests that cyclin E is the major downstream target of cyclin D (Geng, 1999).Cyclin E is demonstrated to be an important downstream target of AMPK, when insufficient levels of ATPare available in the cell, which will lead to increased levels of AMP, AMP can activate the energy sensorAMPK. In turn, AMPK can activate many upstream targets, including p53. P53 is a cell cycle regulator thathas the capability of inducing cell cycle arrest via reduction of cyclin E levels. Therefore, it is hypothesizedthat after cyclin E is downregulated by p53, this will lead to increased ATP production and mitochondrialactivity. One of the downstream targets in this proposed pathway might very well be Mfn2 since Mfn2overexpression results in an upregulation of OXPHOS (Pich et al., 2005) (Figure 4.3).ATPCyclin E can restore Cyclin D1 deficiency Weexpect Cyclin E to be responsible for mtMfn2downregulatIonAMPKp53p21InhibitsCyclin EATPOXPHOMfn2When cyclin E is able* toinhibit Mfn2 production ↓Cyclin E ↑Mfn2* Supported by the fact thatcyclin D1 deficiency causesincrease in oxidative glycolsis[Sakamaki,.T. 2006] leading todisease.Figure 4.3: Scheme of proposed pathway LEGENDIn addition, as hypothesized by group 1, one could imagine that a reduction of OXPHOS would bedesirable from pre-S-phase through S-phase. We know such a “metabolic cycle” exists in yeast (Tu et al.,2005) but is not yet discovered in mammalian cells. Since Mfn2 loss of function decreases oxidation, wepropose a role for Mfn2 in this downregulation of OXPHOS. Both cyclin D1 and cyclin E are candidates forthe direct or indirect inhibition of Mfn2, because both cyclins are major players in the G1/S phasetransition (Resnitzky et al., 1994). In addition to that, they are the only cyclins present at high levels duringpre-S-phase. We hypothesize that, starting in pre-S-phase and mediated by cyclin D1 or E, either Mfn2levels decrease, or the activity by Mfn2 goes down.SCI 332 Advanced Molecular Cell Biology Research Proposal 85

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Since we have very little insight in the cellular distribution and difference of the functionality of the Mfn2isoforms, we want to investigate Mfn2 regulation by cyclin D1 and E and their partner cdk’s on two levels:we will research Mfn2 protein levels in addition to the (de)activation of the protein.Another reason to look at both protein levels and (de)activation, is that cyclins have the tendencyto be translocated during the cell cycle; cyclin D1 accumulates in the nucleus during G1 phase and istranslocated to the cytosol during S phase (Alt 2000). This makes it very complex to research the (in)directinteraction between cyclins and Mfn2. Investigating two levels of regulation is therefore imperative.Question 5.1: Is there a correlation between Mfn2 protein levels and cyclin D1 / cyclin E levels?In order to investigate the influence of the active forms of cyclin D1 and E (i.e. together with their partnercdk’s) on Mfn2 protein levels, we propose a quantitative research to start off with. The main reason forperforming a quantitative research rather than a qualitative research is that our knowledge of Mfn2 in theirinteraction with cyclins is extremely limited. The proposed research will indicate whether it is viable toassume that the active forms of cyclin D1 and E are somehow able to regulate Mfn2 protein levels. Fornow, it is then sufficient to measure only cyclin D1 and cyclin E levels, and leave the cdk’s out ofconsideration. A quantitative research in this case thus means that we will look at the correlation betweencyclin D1 / E levels and Mfn2 protein levels in a large set of mammalian cell lines that differ in theironcogenic state and tissue type. We will conduct our research in 14 cell lines that are known (or expectedto) differ in their cyclin D1 or E expression (for a detailed description including motivation and cell culturingmedia, see Appendix E4.1). We chose this many cell lines not merely because it will contribute to thesignificance of our research, but also because it allows us to generalize conclusions to multiple cell lines.We decided to use this method, as apposed to using one cell line in which microinjection or transfectionwith cyclins is executed, in order to prevent unforeseen side effects that may occur with the latter methods.As said before, both cyclins are important in G1/S phase transition (Resnitzky et al., 1994), andtherefore we will conduct our experiments at the beginning, the middle and the end of G1 and S phase.We will thus perform cell synchronization (Appendix A) after which we will execute western analysis(Appendix A) to measure all protein levels. Since very little is known about the two types of Mfn2, we willtake into account the protein levels of both cytosolic and mitochondrial Mfn2. In order to do this, we willperform cell fractionation (Appendix A). Once the results are obtained, we will use SPSS (StatisticalPackage for the Social Sciences) to perform the statistical analysis.Experiment 5.1As in hypothesis 1, cells will be synchronized using mitotic shake-off. Cell phase determination will bedone using BrdU and DAPI.Western analysis will be executed with help of a Western Blot Kit (Invitrogen). The kit contains twosecondary antibodies: anti-mouse IgG-HRP (starting dilution 1:2000) and anti-rabbit IgG-HRP (startingdilution 1:5000). The procedure will be carried out according to the manufacturer’s manual. For cyclin D1detection we will use DCS-6: mouse monoclonal IgG 2a (Santa Cruz Biotechnology). For cyclin E, ourprimary antibody will be E-4: mouse monoclonal IgG 1 (Santa Cruz Biotechnology).In order to measure the levels of mitochondrial and cytosolic Mfn2 separately, two samples haveto be generated. Cell fractionation will be executed in the same way as in hypothesis 3, namely with acytosol / mitochondria cell fractionation kit (BioVision). We will perform a control to see whetherfractionation was successful. The cytosolic sample will be tested through western analysis for Tom40, aprotein that is only present in mitochondria. The western blot kit used in this experiment contains differentsecondary antibodies than the one in hypothesis 3. Therefore, the primary antibody for Tom40 will be H-300: rabbit polyclonal IgG (starting dilution 1:200) (Santa Cruz Biotechnology). The mitochondrial samplewill be tested through western analysis for the presence ribosomal protein L28. The primary antibody forthis protein will be F-137: polyclonal rabbit IgG (starting dilution 1:200) (Santa Cruz Biotechnology).After cell fractionation Mfn2 levels can be detected. We will use H-68 (Santa Cruz Biotechnology)as a primary antibody. This is a rabbit polyclonal IgG (starting dilution 1:200).As an internal control to demonstrate similar protein loading among the samples (all except for themitochondrial samples), ß-tubulin will also be blotted. The primary antibody for ß-tubulin will be 3F3-G2:mouse monoclonal IgM (starting dilution 1:200).Question 5.2: Can cyclins mediate the (de)activation of Mfn2?SCI 332 Advanced Molecular Cell Biology Research Proposal 86

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007In the previous study we tried to find a correlation between cyclin D1 / E presence and Mfn2protein levels. We hypothesized that the active form of cyclin D1 / E, i.e. together with its partner cdk,either was able to decrease Mfn2 transcription or translation. When this hypothesis would be refuted, itcould be the case that cyclins are able to directly interact with Mfn2. In the counterpart of fusion, thefission machinery this type of interacting between Cdk1/cyclin B and Ser 585 on Drp1 has already beendemonstrated (Taguchi 2007). In 2004 Chen et al. demonstrated that Mfn2 has a similar PKA/PKGphospholylation site at Ser 442 as Drp1. We hypothesize that Mfn2 can be phosphorylated by cyclin D1 /E, in turn inhibiting its activity. In regard of the cell cycle and Ras this will mean that increased levels ofcyclin/Cdk holoenzymes can phosphorylate cytosolic Mfn2, leading to increased Ras activity and at thesame time decrease OXPHOS by mitochondrial Mfn2 deactivation.Experiment 5.2To investigate this we will look at the protein-protein interaction of Mfn2 with cyclin D1 / E by performingan in vitro kinase assay. Verification of the phosphorylation site of Mfn2 will be done by site directedmutagenesis on Ser 442 of the PKA domain in Mfn2. Regarding the Cdk/cyclin complexes, twoconstitutions come to mind:1. Cdk4/Cyclin D12. Cdk2/Cyclin EA third constitution, i.e. Cdk6/Cyclin D1, could be possible, cdk4, however, appears to be their mostprominent partner (Matsushime, 1994). The reason to limit our research to only cyclin D1 and notincluding cyclin D2 and D3 is due to the fact that cyclin D1 appears to be the major player in G1/S phasetransition, which is our main interest. In a later stage we could include additional cyclin/Cdk complexes.The majority of the proteins we will use in this experiment are commercially available. This incombination with the fact that only small quantities of these proteins will be used, makes the purchaseinstead of the manufacture of these items (Table 4.2) evident.Code Size Price RetailerCdk4 + Cyclin D1 protein ab55695 2 x 10 µg €660.00 AbcamCdk2 with GTS tag H00001017-P02 10 µg1 unknown AbnovaCyclin E with GTS tag H00000898-P01 10 µg1 unknown AbnovaMfn2: GST Expression and 554803/ 554763/ Kit/cells/culture2 unknown BD BiosciencesPurification Kit + Sf9 insectcells + TNM-FH Insect CellMedium554760mediumpRb, control cyclin D1/Cdk4 H00005925-Q01 10 µg1 unknown AbnovaNPM1 control Cyclin E/Cdk2 H00004869-P01 10 µg1 unknown AbnovaTable 4.2: Overview of proteins and their retailers.Since Mfn2 protein is not available commercially it will be purified using a GTS-tag expression vector andSf9 insect cells. These cells will be transfected with recombinant plasmid DNA containing our gene(according to BD biosciences handbook). These plasmids will be custom made by GeneScript. To assistin the proper folding of Mfn2 and keep them from precipitating we will make use the solubilization agentGST. This GST Expression and Purification Kit, containing all necessary products for Mfn2 expression andpurification, will be purchased from BD Bioscience’s. We will use HUAoSMC-c cells, purchased for earlierexperiments, to obtain the Mfn2 gene, this way we will use solely mouse proteins, which will preventincompatibility of protein originating from different animals.As a positive control to cyclin D1 / E phophorylation activity we will use pRb, which is known to bephosphorylated by Cdk4/cyclin D1 (Zhang, 2001). NPM1, which is phosphorylated by cyclin E/Cdk21 Estimated price €300,-2 Estimated price €800,-SCI 332 Advanced Molecular Cell Biology Research Proposal 87

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007(Yukari Tokuyama, 2001), will be applied as a positive control to cyclin E phophorylation activity. Thesepositive controls will illustrate the phosphorylative functionality of the Cdk/cyclin complexes.To asses the above listed constitutions on their kinase activity we will perform an in vitro kinaseassay (Appendix A). Since kinases are enzymes that catalyze the transfer of a phosphate group from ATPto a substrate, radioactive ATP can be measured and quantified in a western blot (Appendix E4.2).We will start by checking for phosphorylation of Mfn2 by either Cdk4/Cyclin D1 or Cdk2/Cyclin Eholoenzymes, this will indicate which of the holoenzymes exhibits kinase activity on Mfn2. The kinaseassay mixtures (30 µl) contained kinase buffer (50 mM Hepes (pH 7.5), 10 mM MgCl2, 1 mM dithiothreitol,100 µM ATP, and 4 µCi of γ-[32P]ATP and 100 ng of purified WT Mfn2, S442T Mfn2, S442A Mfn2 andpRb or NPM1 proteins as substrates. Cyclin-CDK complexes will be added into reaction mixtures, whichwere incubated at 30 °C for 15 min, and then resolved on 10% SDS-polyacrylamide gels. The gels will besilver-stained before exposure to Kodak X-OMAT MR film. In regard to the western blots with mutatedMfn2 (Table 4.3, WB# 2 and 3), we will only use the cdk/cyclin complex that exhibits phosphorylationactivity over Mfn2, not wasting any purified proteins.For this assay, the two cyclin holoenzymes and Mfn2 are needed in a purified form (see Proteinsource). Moreover, the two purified point mutated Mfn2 proteins (see Mutagenesis PKA site Mfn2) will beneeded in western blot 2 and 3.WB# Cdk4/cyclinD1 amount in µl Cdk2/cyclinE amount in µl1. WT 100 ng - 0,125 0,25 0,5 1 1,5 3 - 0,125 0,25 0,5 1 1,5 32. S442T100 ng - 0,125 0,25 0,5 1 1,5 3 - 0,125 0,25 0,5 1 1,5 33. S442A100 ng - 0,125 0,25 0,5 1 1,5 3 - 0,125 0,25 0,5 1 1,5 3All Control pRb100 ng NPM-1100 ng1. WT 0 ng 1 12. S442T 0 ng 1 13. S442A 0 ng 1 1Table 4.3: Western blot configuration.Due to the increasing concentrations of cyclin/Cdk complexes we can investigate if phosphorylationoccurs in a dose-dependant matter. In all western blots a negative control group will be used. This meansthat we will present the Cdk/cyclin complexes without any form of substrate to insure no other form ofsubstrate is present.To further investigate cyclin D1/E holoenzyme kinase activity on Mfn2, we will investigate the siteof phosphorylation by using site directed mutagenesis (Appendix A). These mutations are simple pointmutations, which can easily be implemented using a PCR-based mutagenesis kit (QuikChange) using themanufacturer’s protocol. We will transfect Sf9 insect cells with a plasmid containing the Mfn2 mutants.Two mutations (Table 4.4) will be performed to investigate the importance of Ser 442 in the PKA site. Toharvest these mutant proteins we will use the GST Expression and Purification Kit earlier described.Mutation Motivation ExpectationS442T Cyclin D1/E could be specific for Similar phosphorylation activity as inphosphorylation at S442S442S442A Phosphate group will be unable to bind No phosphoriylation by Cyclin D1/ETable 4.4: Overview mutations Mfn2SCI 332 Advanced Molecular Cell Biology Research Proposal 88

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007DiscussionBy performing the proposed research, the understanding of several basic cell biological issues, such ascell cycle arrest, cell cycle progression and oxidative phosphorylation will be enriched. Through Mfn2 alink might be found between cell cycle progression and mitochondrial activity. However, this link to the cellcycle is not the only reason the proposed research is relevant. Mfn2 is mutated in variousneurodegenerative diseases, of which Charcot-Marie-Tooth disease is the most prevalently studied.Moreover, since decreased levels of cytosolic Mfn2 have been noticed in hyper-proliferative diseases,insight into this protein might help to develop new medical therapies.However, research is a dynamic process, and thus the proposed research does not provide a completepicture. Even if all our hypotheses are indicated to be true, further research has to be done. The secondhypothesis will gain insight into the function of the Mfn2-Stoml2 complex. It could, however, still beexplored what the binding site of Stoml2 to Mfn2 is. In addition, this research doesn’t go into the exactpathway through which Mfn2 is able to regulate OXPHOS. Further research could investigate throughwhat mechanism this occurs.Hypothesis 3 will provide insight into the formation of cytosolic Mfn2. It is suggested to conductadditional experiments that explore the conditions under which mitochondrial Mfn2 is cleaved to formcytosolic Mfn2. As proposed in the introduction, when cell cycle arrest is needed, there might be amechanism that cleaves the mitochondrial isoform of Mfn2. This will result in a decrease of mitochondrialMfn2, as well as an increase in cytosolic Mfn2 levels. Therefore, a bi-functional mechanism will work toachieve cell cycle arrest or apoptosis. Although this research will point out whether cleavage occurs, moreresearch will have to be done to determine whether this proposed mechanism is true. It could beinvestigated where cleavage occurs, as this might occur either in the cytosol or after insertion into themitochondrial membrane. Furthermore, it can be investigated which protein(s) are involved in this processof cleavage. Additionally, it can be explored under which cellular conditions cleavage is upregulated.The fourth hypothesis focuses on the relation between Ras, cytosolic Mfn2 and cell cycle arrest.This research will show under what conditions the binding of Mfn2 to Ras causes cell cycle arrest,however it doesn’t go into the binding mechanisms. Further research could investigate this.If hypothesis 5 proves to be true, thus, if there is a correlation between mitochondrial or cytosolicMfn2 levels and cyclin D1 and cyclin E, further research is needed to see whether this correlationindicates causality. As a follow up experiment, the first step would be to look at the activity of the cyclins,since this depends on their interaction with cdk’s. At the indicated time intervals co-immunoprecipitation ofthe cyclins and their cdk’s (cdk4 and cdk2, respectively) is suggested in order to extract the activecomplexes. An in vitro kinase assay would thereafter be necessary to quantify the complexes and tocheck whether the cyclins are indeed more active. We would have liked to include these experiments inour research, however due to time limitations this is beyond the scope of our project.However, this hypothesis might show that cyclin D1 / E directly influence Mfn2 by phosphorylation.Whether this phosphorylation results in activation or deactivation has to be explored. In case ofdeactivation, this could mean that Mfn-2 is no longer able to bind to Ras and subsequently induce cellcycle arrest. In addition, the protein would no longer be able to mediate OXPHOS. Both would bedesirable in progression from G1 to S phase. Since experiment 5.2 will be conducted in vitro, the resultscannot be generalized to in vivo circumstances. Further research could explore the relation in vivo.SCI 332 Advanced Molecular Cell Biology Research Proposal 89

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Financial Overview and Time LineProductPriceBlotting & Co-IP Kits € 4,822.00Cell Lines € 8,000.00Fractionation Kits € 545.00Mutations & Mutation Kits € 3,615.00Primary Antibodies € 5,838.00Proteins € 2,660.00Real Time PCR € 1,347.00Secondary Antibodies € 382.33siRNA € 1,831.12Staining € 1,322.0010% unexpected costs € 3,000.00Total € 33,362.45Annual Stipend Researcher € 40,000.00Total € 160,000.00Total Cost Research € 193,362.45Year 1 Year 2 Year 3 Year 4Hypothesis 1Hypothesis 2Hypothesis 3Hypothesis 4Hypothesis 5SCI 332 Advanced Molecular Cell Biology Research Proposal 90

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007AcknowledgementsFirst of all, we would like to thank dhr. dr. F.A.C. Wiegant and dhr. prof. dr. J. Boonstra for their devotionto this project. They have been of great help to us.Secondly, we greatly appreciated the help of dhr.dr. L.H.K. Defize. He has provided us with great idea’sand advice on the methodology used in this program.Ms. Martha Lewis, of Santa Cruz Biotechnologies, advised us with choosing the antibodies that wereproposed in this project. We want to thank her for that.Dr. Cristian Scheler, of ProteomeFactory has given great advice on the possibilities of protein sequencing,and thus we thank him for that.Ms. Silvia Otternberg, of Thermo Scientific Pierce Protein Research Products, has provided detailedinformation on the use of cell fractionation to which we are thankful.Mr. Rizwan Farooqui, Thermo Scientific Pierce Protein Research Products, for providing information onCo immunoprecipitation ,which was of great help.Dr. Jamil Talhouk , Of Biovision. He provided our research with additional insight on cell fractionation.Lastly, Ms. Belin Chen, from Abnova, has been a great source of information on the usage of a Mfn2 C-terminal antibody. We are very thankful.SCI 332 Advanced Molecular Cell Biology Research Proposal 91

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007ReferencesAlt, J. R., Cleveland, J. L., Hannink, M., et al, (2000). "Phosphorylation-dependent regulation of cyclin D1 nuclear export and cyclinD1-dependent cellular transformation." Genes & Dev. 14: 3102-3114.Bach, D., Pich, S., Soriano, F.X., et al. (2003), “Mitofusin-2 Determines Mitochondrial Network Architecture and MitochondrialMetabolism”, The Journal of Biological Chemistry, 278, 17190-17197Castello, A., et al., (1994), “Perinatal hypothyroidism impairs the normal transition of GLUT4 and GLUT1 glucose transporters fromfetal to neonatal levels in heart and brown adipose tissue. Evidence for tissue-specific regulation of GLUT4 expression by thyroidhormone” J. Biol. Chem. 269, 5905-5912Chan. D., (2006) ‘Dissecting Mitochondrial Fusion’. Developmental Cell, 11, 592-594Chien, K. R., Hoshijima, M. (2004). "Unravelling Ras signals in cardiovascular disease." NatureCell Biology 6: 807 - 808.Chung, D.C. et al., (2000) “Overexpression of Cyclin D1 Occurs Frequently in Human Pancreatic Endocrine Tumors”, Journal ofClinical Endocrinology & Metabolism, Vol. 85, 4373-4378Davis, P.K., (2001), “Biological Methods for Cell-Cycle Synchronization of Mammalian Cells”, BioTechniques 30, 1322-1331Griffin E.E., Detmer S.A. and Chan D.C., (2006) “Molecular Mechanism of Mitochondrial Membrane Fusion”, Biochimica etBiophysica Acta, 1763, 482-489Hájek P., Chomyn A., Attardi G., (2007) “Identification fo a Novel Mitochondrial Complex Containing Mitofusin 2 and Stomatin-likeProtein 2”, The Journal of Biological Chemistry, 282, 5670-5681Lin BT et al., (1998) “Cyclin D1 expression in renal carcinomas and oncocytomas: an immunohistochemical study”, Mod Pathol,11(11): 1075Margineantu, D.H. et al., (2002), “Cell cycle dependent morphology changes and associated mitochondrial DNA redistribution inmitochondria of human cell lines”, Mitochondrion 1, 425-435Marshall, C. J., (1995) ‘Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulatedkinase activation.’ Cell 80, 179–185Martínez-Diez, M. et al., (2006), “Biogenesis and Dynamics of Mitochondria during the Cell Cycle: Significance of 3′UTRs”, PloSONE 1, 107Matsushime, H., Quelle, D.E., Shurtleff, E.A., et al (1994). "D-Type Cyclin-Dependent Kinase Activity in Mammalian Cells." Mol. andCel. Bio. 14(3): 2066-2076.Motokura T., Arnold A., (1993) “Cyclin D and oncogenesis”, Curr Opin Genet Dev, 3(1): 5-10Muray, A., (2006), “Mitotic shake-off, bioprotocol”, http://www.bio.com/protocolstools/protocol.jhtml?id=p9006, HarvardPeeper, D. S. et al. (1997) ‘Ras signaling linked to the cell-cycle machinery by the retinoblastomaprotein.” Nature 386, 177–181Pich S., Bach D., Briones P., et al. (2005) “The Charcot-Marie-Tooth type 2a gene product, Mfn2, up-regulates fuel oxidation throughexpression of OXPHOS system”, Human Molecular Genetics, 14, 1405-1415Resnitzky D et al., (1994), “Acceleration of the G1/S phase transition by expression of cyclins D1 and E with an inducible system”,Mol Cell Biol, , 14: 1669-1679Rojo M., Legros F., Chateau D. and Lombès, (2002) “Membrane topology and mitochondrial targeting of mitofusins, ubiquitousmammalian homologs of the transmembrane GTPase Fzo”, Journal of Cell Science, 115, 1663-1674Sakamaki, T., Casimiro, M. C., Ju, X., et al, (2006). "Cyclin D1 Determines Mitochondrial Function In Vivo." Mol and Cell Bio 26(14):5449-5469.Santel, A., Fuller, M.T., (2002) ‘Control of mitochondrial morphology by a human mitofusin’. Journal of Cell Science 114, 867-874Scharml, P. et al., (2003) “Cyclin E overexpression and amplification in human tumour cells”, J Pathol, 200: 375-382Shen, T., Zheng, M., Cao, C., et al. (2007) ‘Mitofusin-2 Is a Major Determinant of Oxidative Stress-mediated Heart Muscle CellApoptosis’ Biol. Chem., 282, 23354-23361Taguchi, N., et al, (2007). "Mitotic Phosphorylation of Dynamin-related GTPase Drp1 Participates in Mitochondrial Fission." J. of Bio.Chem. 282(15).Tetsu O., McCormick F., (1999) “Beta-catenin Regulates Expession of Cyclin D1 in Colon Carcinoma Cells”, Nature, 398.SCI 332 Advanced Molecular Cell Biology Research Proposal 92

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Tu, B.P. et al. (2005) “Logic of the Yeast Metabolic Cycle: Temporal Compartmentalization ofCellular Processes.” Science 310 (1152): 1152-1158Yan Zhanga et al., (2007), “New insights into mitochondrial fusion”, FEBS letters 581, 2168-2173Yukari Tokuyama, H. F. H., Kenji Kawamura, Pheruza Tarapore, and Kenji Fukasawa (2001). "Specific phosphorylation ofnucleophosmin on Thr199 by CDK2/cyclin E, and its role in centrosome duplication " J. Biol. Chem. 276(24): 21529-37SCI 332 Advanced Molecular Cell Biology Research Proposal 93

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007General ConclusionThis research proposal focuses on the various regulative influences the mitochondria have on thecell cycle and cell cycle progression, and vice versa. The goal of this research program, consisting of fourprojects, is to establish a more complete picture of the mechanisms through which the cell cycle and themitochondria correspond with one another. The links between the cell cycle and the mitochondria areimportant to be established as the mechanisms regulate to some extend the two very important cellularprocesses of cell cycle progression and mitochondrial activity. Next to the gaining of knowledge that willbe achieved throughout the conductance of the proposed research, better understanding of severaldiseases, such as cancer and Charcot Marie tooth may be developed.In the first project, the existence of a metabolic cycle was discussed. ROS fluctuation throughout the cellcycle is proposed to be studied. In addition, the relative contribution of mitochondria to ROS productionshould be investigated in comparison to other known ROS producers. Lastly, the influence of ROS on theG2/M phase transition should be explored in order to establish a clear link on how ROS levels regulate cellcycle progression. Through performing this research, a strong interaction between the cell cycle andmitochondria through ROS might be indicated.In the second part of this proposal, focus was placed on the energy checkpoint in G1 phase. Thepathways through which high levels of activated AMPK can induce cell cycle arrest should be explored. Alink between energy-producing mechanism and cell cycle arrest is aimed to be better understood, and adirect link between AMPK and energy-producing mechanisms is proposed. Lastly, it will be investigatedwhether, and how, mitochondrial morphology changes after the cell goes into cell cycle arrest. Throughthe accomplishment of this research proposal, the role and functionality of AMPK in the regulativeinteraction between energy status in the cell and cell cycle arrest will be better determined.Consecutively, a research that is mainly focused on the role of the cell cycle for mitochondrialbiogenesis was proposed. This research is necessary to improve the perception of the dependence ofmitochondrial biogenesis on cell cycle progression. The role of nuclear respiration factor (NRF) is ofparticular interest as it is a factor which is capable of activating the transcription of various mitochondrialcomponents. The main aim of this research is to investigate the dynamics of mitochondrial biogenesisduring the cell cycle and to understand how induction of mitochondrial biogenesis by different factors maybe coordinated.Lastly, the regulative interaction between mitochondria and cell cycle progression is aimed to beexplained through the activities of mitofusin2. The fluctuations of Mfn2 levels throughout the cell cycle areinvestigated and a possible mechanism of oxidative phosphorylation maintenance with the aid Mfn2 ishypothesized. A mechanism of Mfn2 cleavage is proposed. Through the latter, the generation of both themitochondrial and the cytosolic isoforms with their opposing roles may be explained. Furthermore, itinvestigates the ability of cytosolic Mfn2 to inhibit Ras. Lastly, the influence of cyclins on Mfn2 levels andactivity are assessed to round up the circle of regulative interaction between the cell cycle andmitochondria through Mfn2.To conclude, the four projects share in common much more than merely the general theme ofresearch. Both project one and two shed a focus on metabolic activities, which is also a common aspectwith project four. Even though throughout the different projects several pathways to cell cycle arrest areexplored independently, in practice of reality they might all be linked to a general pathway of cell cyclearrest. Project three focuses on the nuclear encoding of mitochondrial proteins. Mfn2, discussed in projectfour might be influenced by NRF. Since the four topics are linked by various means, a complete picturewill not be provided throughout one individual project. Rather, throughout the performance of all fourproposals, a more lucid picture will be created, and a broader platform of background information forfuture research, will be provided.SCI 332 Advanced Molecular Cell Biology Research Proposal 94

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Appendix A[35] S Incorporation[35S]-cysteine and [35S]-methionine can be used to label cells in pulse chase analyses. Metaboliclabeling of this kind is made possible by the low-energy beta-emitting radioisotopes ([35S]-cysteine and[35S]-methionine) and are often used to track in vivo biosynthesis, maturation or degradation of proteins.AICAR5-Aminoimidazole-4-carboxamide-ribonucleoside (AICAR) is an AMP-activated protein kinase (AMPK)activator. Rat hepatocyte incubation with AICAR results in an accumulation of a monophosphorylatedderivative called 5-aminoimidaz-ole-4-carboxamide ribonucleoside (ZMP) inside the cell. ZMP has amimicking action of both activating effects of AMP on AMPK and promotes phosphorylation by AMPKkinase.This technique is particularly advantageous because unlike other methods for activating AMPK inintact cells, AICAR does not disturb the cellular contents of ATP, ADP or AMP. AICIAR is a usefultechnique for identifying new target pathways and regulative processes controlled by the protein kinasecascade.Amplex Red Hydrogen Peroxide/Peroxidase Assay Kit (Microplate Fluorometer)The Amplex Red Hydrogen Peroxide/Peroxidase Assay Kit is a single step, fluorometric assay with highsensitivity. The assay is able to detect quantities as small as 10 picomoles of hydrogen peroxide (H 2 O 2 )or 10 µU/mL of horseradish peroxidase activated in a 100 µL volume of assay.The Amplex Red reagent is one of the most stable and sensitive fluorogenic substrates availablefor horseradish peroxidase and allows for a variety of fluorogenic and chromogenic assays for enzymesproducing hydrogen peroxide. Assays using this reagent are capable of the extremely sensitivequantification of various analytes such as glucose, galactose, cholesterol and many more as well ashydrogen peroxide.This kit provides an easy, sensitive way to detect H 2 O 2 or the horseradish peroxidase bymeasuring fluorescence with a microplate fluorometer. The substrate in this kit enables detection of activeperoxidases and H 2 O 2 release from cells as well as detection of H 2 O 2 production from enzyme-coupledreactions.BrdU & DAPI Cell CycleThe synthetic nucleoside, Bromodeozyuridine (5-bromo-2-deoxyuridine, BrdU) is commonly applied fordetection of proliferating cells in living tissues. Incorporation of BrdU into new synthesized DNA ofreplicating cells during the S phase substitutes the role of thymidine during DNA replication. The techniqueapplies specific BrdU antibodies, which allow the detection of the chemical by immunohistochemistry, thisthen confirms whether cells are actively replicating their DNA.4’,6-diamidino-2-phenylindole (DAPI) is a fluorescent stain capable of strong binding to DNA. TheDAPI stained is used particularly in fluorescence microscopy, where DAPI is excited with ultraviolet light.DAPI is able to pass through an intact cell membrane and is therefore a useful stain in detection of DNA inboth live and fixed cells.cDNAStrands of cDNA or copy DNA can be either single stranded or double stranded. In vitro synthesis ofcDNA from an mRNA template can be achieved by using reverse transcriptase, which produces singlestranded cDNA. This process is referred to as reverse transcription or first strand cDNA synthesis.Microarray experiments require double stranded cDNA, which can be produced through anotherround of DNA synthesis after the first strand cDNA synthesis. Conversion of mRNA to cDNA is usedprimarily in template mRNA analysis because DNA is more stable than RNA. cDNA conversion alsoallows use in RT-PCR, as a probe for analysis of expression of mRNA sequences.SCI 332 Advanced Molecular Cell Biology Research Proposal 95

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Cell FractionationCell fractionation refers to a broad set of techniques aiming to separate and isolate specific organellesfrom cell. In other words, it is the separation of homogenous sets (organelles) from a heterogenouspopulation of cells. There are a number of steps involved in cell fractionation; namely disruption (alsoknown as homogenization) of cells, macro-filtration and purification of the cell components.Central-ElutriationCentrifugal elutriation is a technique used to synchronize cells at specific phases of the cell cycle. It is adrug-independent method capable of synchronizing cells from asynchronous cell populations in any phaseof the cell cycle. This method entails that cells in a particular phase in the cell cycle can be isolatedaccording to their size. In other words, early G1 cells are around half the size of cells in late G2 or Mphase. However, it is important to consider that not all cell types show significantly enough size variabilitythroughout the cell cycle.Cerium Ions with ReflectanceConfocal laser scanning microscopy adaptations have been made to allow detection and assessment ofsemiquantitatively cerium based primary reaction products of oxidases, phosphatases as well as the 3,3-diaminobenzidine (DAB) based primary reaction product of cytochrome-c-oxidase. This technique offers aunique method to make histochemical reaction products, which are weakly absorbent, but sufficientlyreflective, visible.ChemiluminescenceChemiluminescence is the generation of light by a chemical reaction. When used as a method, a specificprobe can be used, which reacts with a specific compound. The luminescence can then be measured by aluminometer, to show and quantify the presence of the compoundCo-immunoprecipationCo-immunoprecipation can be used to check if proteins physically interact with each other and form animmune complex. First, the cell gets lysed, after which antibodies get added, which specifically bind to theprotein complex. Then the antibodies and the bound immune complex get immobilized on a solid complex,after which the remaining cell lysate is washed off. The complexes are then eluded and analyzed by SDS-PAGE usually followed by a western blot.Figure A.1: Principles of co-immunoprecipitationSCI 332 Advanced Molecular Cell Biology Research Proposal 96

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Compound C Specific InhibitorA specific inhibitor called compound C inhibits AMPK and is produced by Merck UK. This can be usedaccording to the manufacturer’s protocol.Confocal Laser Scanning MicroscopyConfocal laser scanning microscopy is a technique for obtaining high-resolution optical images and can beused to semi-quantify the fluorescence. A laser beam passes through a light source aperture and then isfocused by an objective lens into a small focal volume within a fluorescent specimen. The specimen thenemits reflected laser light and emitted fluorescence, then the laser light gets filtered out so that thefluorescence can be absorbed by a detection apparatus.Double Thymidine BlockIs used for cell synchronization, by adding excessive amount of thymidine, so that DNA replication isblocked. That way all cells will be halted in G1/S phase, and this arrest is lifted by adding additionalguanine, adenine and cytosine.Extracellular Flux (FX)FX is a method to measure the changes in oxidative phosphorilation and glycolysis. The measurementsare done by observing alterations in the rates of consumption or production of extracellular solutes relatedto aerobic and anaerobic cellular metabolism, such as oxygen, protons, nutrients, carbon dioxide, lactate,or lactic acid. The measurements can be done by means of a XF24 Extra Cellular Flux Analyzer.Fluorescence Activated Cell Sorting (FACS) AnalysisCells in a solution are led through a small nozzle one by one in droplets, passing a fluorescencemeasuring apparatus. This measures the fluorescence of proteins contained in the cell. A computeranalyzes the data and separates droplets with different fluorescent properties by applying a small currentto the droplets, which are then deflected into tubes by passing electrodes. The data measured can beused by computer analysis to give quantities of cells with the different fluorescent properties.Glucose DeprivationDenying the cell glucose in order to prevent glycolysis. To do this, a glucose-free Dulbecco's modifiedEagle's medium can be bought and applied according to the manufacturer’s protocol from invitrogen.Growth Factor DeprivationDenying the cell growth factors in order to prevent cell cycle progression and cause quiescence. Toachieve this a growth-factor-free medium can be used.GST Expression and PurificationIn this technique, vectors are introduced into the cell so that they can stimulate high expression ofglutathione S-transferase (GST). The protein that needs to be purified is linked to GST with certaincleavage site so that they can be separated. Glutathione-affinity chromatography can be used to purifyfusion proteins from cell lysates.Immunofluorescence MicroscopyA certain protein of interest is targeted by an antibody, which contains a fluorescent chemical group.Following the labeling of proteins with fluorescent dyes, immunofluoresence microscopy is used tovisualize, localize and sometimes quantify protein of interest within the cell. Cells can be incubated withmore than one tag with different colors. Because cells are not killed as in electron microscopy, thistechnique can also be used in real-time measurements.Inhibition of ATP synthesis; Olygomycin & CCCPOxidative phosphorylation is one of the main processes to take place in mitochondria. Inhibition of thisfunction is used to understand the energy metabolism of the cell or to further study the oxidativephosphorylation event. Olygomycin decreases oxygen consumption to background values by inhibiting theenzymatic activity of ATP syntheses. CCCP inhibits oxidative phosphorylation by uncoupling the electronSCI 332 Advanced Molecular Cell Biology Research Proposal 97

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007transport chain. Although they both inhibit mitochondrial activity, these inhibitors have different effects onmitochondria and the cell.Ion Trap Tandem Mass Spectrometry analysisTandem mass spectrometry is a more advanced version of the single mass spectrometry. In ion traptandem mass spectrometry, ions are trapped at the same place and several separation steps occur overtime. Several spectrometry measurements can be performed on the mixture, whereas in original versiononly one type of measurement would be possible.JC-1 Dual-Emission Potential-Sensitive ProbeThis is a potential sensitive probe with a dual-emission that can be used to measure mitochondrialmembrane potential. The probe is green when the mitochondrial membrane potential is low and it turnsred at higher membrane potentials. The ratio of the two colors is a measure of mitochondrial membranepotential. This probe specifically measures membrane potential and is not affected by other mitochondrialfactors.Kinase AssayProtein kinases phosphorylate other proteins by catalyzing the addition of a phosphate group to a certainlocation of the proteins. As regulation by phosphorylation is very significant in different functions of the cell,measuring activity of these kinases can prove to be important. In this technique, a certain kinase protein isintroduced to the medium together with ATP and the substrate that the kinase is known to act upon.Phosphate groups are tagged with radioactive or fluorescent tags and become active once incorporatedinto the substrate. Measurements of the activity of these tags indicate protein kinase activity.Knockout/Inhibition of Cyclins/CDKsA knockout of a protein is used to inhibit its activity. The cell is transfected by a plasmid or a DNAconstruct. This transfected construct recombines with the gene of interest. A sequence from the gene istransferred into the construct and thus a part of the original gene is deleted. The deletion of the sequenceprevents proteins from being translated. Even if the proteins are translated, they are non-functional. Thistechnique is used widely to study proteins whose functions are unidentified.Mass SpectrometryMass spectrometry can be used to identify compounds in a given mixture to determine the structure of thecompound as well as to measure the amount of compound in that mixture. The basis of this technique ismeasuring the mass to charge ratio of ions.MitoSOX Red ProbeROS is inevitable as a side product of cellular respiration in aerobic organisms. O 2-superoxide ispredominant in mitochondria and its presence initiates a cascades producing more ROS, includinghydroxyl peroxide and hydroxyl radical.To monitor O 2-in living cells, hydroethidine (HE), which is a reduced form of the nucleic acidintercalator ethidium, is used as a indicator of ROS. Once HE is oxidized, it exhibits weak cytosolic bluefluorescence. However, the probe also binds to nucleic acids, which results in staining the nuclei andparticularly the nucleoli by red fluorescence. The MitoSOX Red mitochondrial superoxide indicatorconsists of HE covalently bound to a triphosphonium cation via a hexyl carbon chain. The phoshoniumgroup is positively charged and targets HE analog to mitochondria. Here it accumulates as a function ofmitochondrial membrane potential after which it exhibits red fluorescence due to oxidation and binding tonucleic acids in the mitochondria.So far, ethidium has been postulated as the oxidation product of HE. Recent findings, however,indicate that 2-hydroxyethidium is the oxidation product of HE. The conventional wavelength that is usedto indicate ethidium was 510 nm. By using this wavelength is was hard to distinguish between ethidiumand 2-hydroxyethidium and therefore it is more significant to use a wavelength of 396 nm to excite theMitoSOX red probe. The MitoSOX Red probe with 396 nm excitation can be used to selectivelymonitor O 2 - in the mitochondria.SCI 332 Advanced Molecular Cell Biology Research Proposal 98

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Mitotic Shake-offMitotic shake-off is a procedure in cell biology used to synchronize cells. Cells have the natural tendencyto round up during mitosis and become less attached to the rest of the cell culture. By gently shaking theculture, the mitotic cells can be removed from the cell culture. Since cells that are not in mitosis are morefirmly attached to the cell culture, the suspension will contain cells in mitosis. To increase this number,cells can be first treated with a drug, for example colcemid, that blocks mitosis during metaphase.Mitotracker Green FMMitotracker Green FM is a dye directed towards mitochondria regardless of their mitochondrial membranepotential. It will appear as a green-fluorescent dye and can be used to stain living cells as well as fixedcells. However, it is not well retained after aldehyde fixation and the conditions of cell fixation should beconsidered carefully when this method will be applied.Nocodazole TreatmentNocodazole is an inhibitor of the cell cycle. It halts the cell cycle at the G2/M phase transition by disruptionof the mitotic spindles. When Nodocazole is added to a mammalian cell culture it results in the destructionof most cytoplasmic microtubules. The attachment of the spindle microtubules to the kinetochores ofchromosomes is essential in the development of the mitotic spindle, allowing for cell division. Since noneof these events can happen in the absence of microtubules the cell cycle will be halted at the end of G2.Nonyl Acridine Orange (NAO)NOA is a mitochondrial dye that can be used to investigate mitochondrial function. Its localization is notdependent upon the mitochondrial membrane potential. NOA has been used in the past to investigatedrug resistance and to measure the change in mitochondrial mass before/during apoptosis.Northern BlotA northern blot, from which the western blot technique is derived, has as main difference with the latterthat it detects RNA instead of proteins. mRNA is isolated and hybridized in northern blots. Before mRNA isloaded onto a gel to undergo electrophoresis it is first extracted and purified from the cell. mRNA is madeof different sizes and upon activation of an electric current through the gel, the mRNA will start to moveaway from the negatively charged electrode. This will separate the mRNA based on size after which alabeled probe for the mRNA sequence in interest will be introduced. After this the blot is washed and onlythe specific probe, usually labeled for detection, will remain bound.PerkinElmer Phos-tagThis method can be used to detect the phosphorylation of proteins. Phos-tag is a chelate that can mimicnatural phosphate binding proteins. It has great affinity for the phosphomonoesters of serine, tyrosine andthreonine. This tag can be used in a wide variety of detection methods.PerkinElmer Phos-tag StainsThis stain can be used to detect phosphoproteins in 2D polyacrylamide and SDS gels. It exhibits a highsensitivity with any imaging technique used. Staining can proceed at the natural PH of the protein withavoids the denaturing of proteins during the process.PerkinElmer Phos-tools KitKit combining PerkinElmer Phos-tag and Phos-trap methods.PerkinElmer Phos-trapIs used to measure phosphorylation of proteins. Phosphoproteins are cleaved in different peptides inpresence of titania-coated magnetic beads. The phosphorylated peptides bind to the beads, but theunphosphorylated ones do not. After this, further analysis with mass spectrometry can be used to identifywhich peptides were phosphorylated.Randox-Total Antioxidant Capacity KitUsed to standardize the total capacity of antioxidants within a solution. It is based upon the incubation ofABTS with metmyoglobin, which gives ABTS + . This ABTS + emits light at 600 nm. This emission, however,SCI 332 Advanced Molecular Cell Biology Research Proposal 99

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007is inhibited by antioxidants. Since this inhibition is proportional to the amount of antioxidants present, thedecrease in ABTS + emission can be used to measure the amount of antioxidants in the solution.Real time cPCRComparable to normal PCR, but the amount of replicated DNA is instantly quantified. This happensthrough using a sequence specific fluorescent probe with a fluorescence quencher on one end. After theprobe anneals to the DNA it is cleaved off by the polymerase and degraded. This degradation splits thequencher from the fluorophore, allowing it to become fluorescent. The increase of fluorescence can beanalyzed by FACS to quantify DNA amplification.Retrovirus IntroductionThe retrovirus has a RNA genome and possesses an enzyme called reverse transcriptase, which allowsthe virus to transcribe its own RNA into DNA that is later introduced into the genome of the host organism.In some studies, a certain gene is introduced in the genome of the retrovirus, then the host is infected withthe virus so that it can integrate the gene of interest into the host cell's genome.RNAiA method used to silence specific mRNA using double stranded RNA (dsRNA) of the same gene. ThisdsRNA is cleaved into short pieces, called small interfering RNA (siRNA), which binds to thecomplementary sites of the mRNA target. Subsequently, it is bound by the Argonaut subunit of the RNAinducedsilencing complex (RISC), which degrades the mRNA.Self-Referencing Clark-type MicroelectrodeUsed to measure oxygen flux into a cell. An electrode is placed in close proximity to the cell (around 5 µm),measuring the oxygen levels. The electrode then makes a second measurement at a specified distance(around 10 µm) from the cell membrane. These steps are repeated several times. From this data theoxygen flux into a cell can be accurately measured.siRNASee RNAiSite Directed MutagenesisUsed to create a plasmid expressing a desirable mutated protein with which cells can be transfected. Thistechnique requires a plasmid with a wild type gene, which can then be (partially) excised by restrictionenzymes and replaced by a specific oligonucleotide containing the desired mutation, which is sealed inplace by a ligase.SpectrofluorimeterUsed for fluorescence spectroscopy, where a fluorescent compound is excited by light of a certainwavelength. The various wavelengths the compound subsequently emits are measured and displayed inan emission spectrum, which can be analyzed to determine properties of the compound.Two-hybrid Screening / The CheckMate System (Promega)Used to study protein-protein interactions. The first protein of interest (A) is expressed through a plasmidin such a way that it contains a DNA binding domain for a reporter gene. The second protein of interest (B)is expressed in such a way that it contains a transcriptional activation domain for the same reporter gene.The reporter gene will only be expressed if proteins A and B form a complex and thus bring their DNAbinding domain and transcriptional activation domain in close proximity. Reporter gene expression is thenmeasured to assess protein A-protein B complex formation.Western BlottingUsed for protein characterization. A sample containing various proteins is treated with SDS, whichdenaturates the proteins, giving long chains of polypeptides. A gel is loaded with this sample and a currentis applied to it. The proteins will migrate across the gel to their iso-electric point. Subsequently, a primaryantibody is added which binds specifically to the protein of interest. A secondary antibody is added whichSCI 332 Advanced Molecular Cell Biology Research Proposal 100

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007binds to the primary antibody and is used to visualizing the protein of interest, whereas the other proteinswill not be visualized.SCI 332 Advanced Molecular Cell Biology Research Proposal 101

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Appendix BAppendix 0: Cell culture and treatmentTwo different cell types will be used throughout the project. CCD-1072 Sk human fibroblasts (CRL-2088,ATCC) have a relatively short doubling time and are capable of at least 28 more doublings. The hTERT-RPE 1 retinal epithelial cells (CRL-4000, ATCC) are immortalized using human telomerase reversetranscriptase (hTERT). They have a doubling time of about 19 hours.The fibroblasts will be cultured in 90% Iscove’s modified Dulbecco’s medium (I-6529, Sigma), 10% FBS(Sigma), streptomycin and penicillin (Sigma). For quiescent cells, FBS is omitted.The retinal epithelial cells will be cultured in a 1:1 mixture of modified Dulbecco’s medium (I-6529, Sigma)and Ham’s F12 medium (N-8641, Sigma) supplemented with 0.01 mg/ml of hygromycin B (H3274, Sigma)and 10% FBS. For quiescent cells, FBS is omitted.All cells are grown at 37 °C with 5% CO 2 at a PH of 7.4. Subculturing will be carried out according to theprotocol provided by ATCC.Appendix 0.A: Measurement of human fibroblast doubling timeThe doubling time of the human fibroblasts will be measured with a normal light microscope, simply bymonitoring the time span between two consecutive cell divisions. This will be measured for 10 differentcells and the average will be taken to represent the doubling time of these human fibroblastsAppendix 1.1: Cell synchronizationNocodazole is used to halt cells in the prometaphase after which all cells arrested in mitosis will beseparated from the other cells with mitotic shake-off.1.1a: Nocodazole treatmentThis experiment will be done with cultures of both cell types.400ng/ml nocodazole diluted in DMSO will be added to the cells and incubated at 37°C for 12-16 hours.The cells will be washed and treated according to the protocol described by Jackman and O’Connor(2001). After the treatment the cells will be transferred to a plate that can be used for mitotic shake-off.Materials:• 400ng/ml Nocodazole in DMSO (SIGMA)1.1b: Mitotic shake-offThe plate with the nocodazole treated cells will gently be tapped against a hard object (i.e. a desk) for 1minute and the detached cells will be collected in a culture flask according to the protocol of Jackman andO’Connor (2001). The shaken-off mammary epithelial cells will be divided over wells. For the hTERT-RPE1cells, with a cell cycle length of 19 hours, 11 wells are needed, since measurement time intervals of twohours are used. For CCD-1072 Sk cells, this depends on the outcome of the measurements described inAppendix 1A. Half the amount of the doubling time in hours + 1 is needed as to be able to takemeasurements every two hours, starting at t=0, throughout one entire cell cycle.Appendix 1.2: Cell-phase determinationSynchronized cells (as described in appendix 1.1) of both cell lines will be grown in wells in media asdescribed above. With BrdU pulse-labeling and Histone H3 phosphorylation the timing of the different cellphases will be determined.Length of G1 = End of mitotic shake-off until the start of BrdU-incorporationLength of S = Start of BrdU-incorporation until the end of BrdU-incorporationLength of G2 = End of BrdU-incorporation until the start of Histone H3 phosphorylationLength of M = Start of Histone H3 phosphorylation until the end of Histone H3-phosphorylation.1.2a: BrdU pulse-labelingSCI 332 Advanced Molecular Cell Biology Research Proposal 102

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007At time points of two hours 1µg/ml BrdU will be added to one of the wells for 30 minutes. Then the cellswill be fixated with 4% paraformaldehyde and nucleases will be added to cut open the DNA. Then anti-BrdU antibodies [BrdU (MBDU-65A): sc-65723 (Santa Cruz biotechnology, Inc.)] will be added and thefluorescence will be measured. For this experiment a BrdU-kit from Roche Applied Sciences (ELISA) willbe used and the supplied protocol will be followed.The cell phase can be determined with BrdU until the end of S-phase. When no BrdU-incorporation ismeasured anymore, Histone H3 phosphorylation method will be used.Materials:• 5-Bromo-2'-deoxy-uridine Labeling and Detection Kit III (Roche Applied Sciences)• 1µg/ml BrdU in PBS (Roche Applied Sciences)• 4% paraformaldehyde• Anit-BrdU antibodies [BrdU (MBDU-65A): sc-65723 (Santa Cruz biotechnology, Inc.)]• Nucleases (Roche Applied Sciences)• ELISA reader1.2b: Histone H3 phosphorylationThe onset of mitosis and length of G2 will be determined with Histone H3 phosphorylation. When cellsenter mitosis, histone H3 is phosphorylated at the Ser10 residue while at other times in the cell cycle itremains unphosphorylated.Cells will be fixed in 70% ethanol overnight at –20°C. Subsequently, they will be permeabilized with PBScontaining 0.1% Triton X-100 for 20 minutes at 4 °C, blocked with 2% FBS in PBS, and incubated with 1µg of anti-pSer10-histone H3 anti-rabbit antibody per 10 6 cells for 60 minutes on ice. After washing, cellswill be incubated with 1 µg of Alexa Fluor 488-conjugated goat anti-rabbit antibody per 10 6 cells for 30minutes on ice, washed and re-suspended in PBS.Cells will be prepared for flow cytometry following the protocol accompanying the anti-pSer10-histone H3antibodies. FACS will be carried out according to the protocol to count cells containing phosphorylatedhistone H3.Materials:• Ethanol (Sigma)• PBS containing 0.1% Triton X-100 (Invitrogen)• anti-pSer10-histone H3 anti-rabbit antibody (Cell Signaling Technology)• Alexa Fluor® 488 F(ab') 2 fragment of goat anti-rabbit IgG (Invitrogen)FACS for cell cycle phase checkPreparation of cells for FACS will be performed as described by Ezhevsky and colleagues (1997): Cellsarrested in prometaphase will be washed with PBS, fixed in 70% ethanol overnight at -20 °C, andrehydrated with PBS containing 0.1% BSA, RNAase A (1 µg/ml) and propidium iodide (10 µg/ml), 20minutes before analysis with FACS. For FACS procedure, the protocol accompanying the machine atUtrecht University will be followed.Appendix 1.3: Oxygen measurementThis method follows the protocol designed by BioCurrents Research Center (BRC) and described in Smithet al (2007) and Osbourn et al. (2005).A self-referencing microelectrode with a 2µm platinum diameter reactive surface at the tip will be usedalong with the return path reference electrode (3M KCl in 3% Agar). The amperometric electrode will bemade following the protocol of BioCurrents Research Center (MBL, Woods Hole MA: “Electrodeconstruction” 2007; Smith, Sanger and Messerli 2007; Messerli, Robinson and Smith 2006: &www.biocurrents.org). The self-referencing microelectrode will be constructed on an inverted microscope,fitted with DIC and/or phase contrast capability. The microscope is mounted on a vibration isolation tableand housed in a Faraday box. Images are acquired remotely via a video port. The appropriatemeasurement site will be determined visually and although cell specific is normally taken away from thenucleus where more mitochondria are located. An example of this, with the application of self-referencingis given by Osbourn et al (2005) The electrode will be attached to a 3 dimensional stepper motorSCI 332 Advanced Molecular Cell Biology Research Proposal 103

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007assembly controlled remotely by a computer through Ionview software. The electrode tip is placedapproximately 5um from the visible edge of the cell or over the cell after briefly and gently touching thesurface before a measured withdrawal. This position is termed the near pole. The software will thencontrol the regular translation in a step function from the near pole to the far pole routinely set at 10umaway. In each position the current generated from the reduction of oxygen at –0.6V is sampled at 1000times per second, binned, averaged and compared to the values at the previous pole (Ionview). One thirdof all data is discarded to avoid artifacts during and after the movement to a new pole. Most commonly thespace and positioning of the electrode is maintained by visual observation or occasional checks by gentlytouching the cell. These are tedious but adequate approaches. Osbourn et al (2005) have published apreliminary report on a method for automating this process.The reference electrode is placed in the bulk medium.By moving the electrode between two points that are 10µm apart, at a frequency of 0.3 Hz, the sensor canmeasure the flux of oxygen into the membrane. The movement is controlled by the computer driven motorcontrol system as described in Figure B.1. The oxygen flux is calculated with the Fick equation: J= –D(∆C/ ∆X) where J = flux, D is the diffusion coefficient, ∆C is the differential concentration and ∆X is thedistance between the two electrode measuring positions (Smith et al 2007; Porterfield, 2007).From the well, one single cell will be selected that is as isolated as possible (it should have no contact withother cells). The oxygen consumption will be measured for 5 minutes every hour for one single cell,throughout the duration of one entire cell cycle.First of all, the measurements will be done 5 times in both cell lines. Secondly, the measurements will bedone in non-synchronized cells of both cell lines, as a nocodazole control. Thirdly, the measurements willbe done in non-proliferating cells, as a cell proliferation control.Materials:• BRC can provide a complete self-referencing system – stepper motors, motion controller,headstage preamplifier, main amplifier, A to D board, software and computer• Amperometric electrodes (BRC)• Return-path reference electrodeFigure B.1 Left: the electrode is place 5µm from the cell membrane and moves to and back from a point at 15 µmfrom the membrane. A reference electrode is placed in the bulk medium. In this figure the analyte can move throughchannel openings. Right: the electrode is attached to a motor and connected to a computer that monitors the data andcontrols the motor. In this figure analyte is injected into the medium. Adapted from BioCurrents Research Center©Appendix 1.4: JC-1 Dual-emission potential-sensitive probe to measure mitochondrialmembrane potential in single cellsSCI 332 Advanced Molecular Cell Biology Research Proposal 104

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007The JC-1 probe is a monomer in the cytosol emits green light. The membrane potential attracts the probesto the inside of the mitochondria, where the probes form aggregates, called J-aggregates, and emit redlight. The higher the membrane potential, the higher the ratio of aggregates in the mitochondria, so thehigher the amount of red light emitted as compared to green light. This way, the ratio of red-to-green JC-1fluorescence can be calculated and so a change of membrane potential can be observed. This ratio isonly dependent on changes in membrane potential and not dependent of size, density etc. (Foster et al.2006).As such, a high ratio means that there are a lot of aggregates (red) inside the mitochondria relative tomonomers (green) in the cytoplasm and this means that there is a high membrane potential.Appendix 1.4A: Measuring mitochondrial membrane potential with a JC-1 probe.The JC-1 Mitochondrial membrane potential detection kit 30001 from Biotium () will beused and the supplied protocol will be followed.This measurement will be done 11 times in the hTERT-RPE 1 (retinal epithelium) cells. For the fibroblastthe amount of measurements depends on the doubling time; half the amount of the doubling time in hours+ 1 is needed as to be able to take measurements every two hours, starting at t=0, throughout one entirecell cycle.The entire protocol will be done 5 times in five separate synchronized cultures.Materials:0.3 µg/ml JC-1 diluted in assay buffer (Biotium)Fixator (4% formaldehyde)(Invitrogen)Flow cytometer with a 15 mW, 488 nm argon excitation laser (Utrecht University)11 wells with medium as described in Appendix 0 for the hTERT-RPE 1 cells, a number(dependent on outcome of experiment described in Appendix 0.A) of wells with medium asdescribed in Appendix 0 for the CCD-1072 Sk cells.Appendix 2.1: ROS probesProbes:Probe Lex Lem Incubation time Expression plasmidPF-1 490 530 5-10 Not expressedHyPer, HyPer-M 488 500-520 Gets expressed pQE30MitoSOX 510 580 10 Not expressedTable B.1 Overview of probe characteristics. Both PF-1 and MitoSOX will be dissolved in DMSO.Appendix 2.2: PF-1Besides being a ROS, superoxide also shows super-nucleophilicity. This characteristic allows forsuperoxide detection by 3’,6’-bis(diphenylphosphinyl)-fluorescein (PF-1), a phosphinate, since superoxidecauses increased hydrolysis of phosphinate. Probes will be synthesized as described in Xu et al. (2007).Growing cells on a coverslip (WEHI):• First the coverslip will be soaked in 70% EtOH• Then the coverslip will be placed into a 10 cm petridish containing the appropriate medium for thecell line (as described in Appendix 1)• The coverslip will remain in the dish for 30 minutes to allow the EtOH to evaporate• Then the cell can be added to the coverslip and transfected if neededTo obtain fluorescence data from single cell, a Zeiss 510 confocal laser scanning microscope will be used,with a 1.4 numerical aperture objective, and 125 mW argon and 1 mW helium-neon lasers. Scanning willbe performed using 400 Hz line frequency, 512 x 512 format. Excitation of the probe at 490 nm., emissionat 530 nm. Image intensities will be quantified with Zeiss confocal software.SCI 332 Advanced Molecular Cell Biology Research Proposal 105

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Appendix 2.3: Design of HyPerThe Escherichia coli Oxy-R protein is specifically sensitive to hydrogen peroxide. Circularly permutedyellow fluorescent protein (cpYFP) will be cloned into pQE30 plasmid (Qiagen), and inserted into theflexible region (between residues 205-225) of the Oxy-R sequence, producing a hydrogen-peroxidefluorescent protein sequence (HyPer, as described by Belousov et al., 2006). The HyPer sequence issubcloned into pEGFP-C1 (Clontech), which can be transfected into cells.For localization to mitochondria, the HyPer sequence will be cloned into pECFP-Mito vector (Clontech).For specific localization to mitochondria, the mitochondrial targeting sequence for the subunit VIII ofhuman cytochrome C oxidase is be inserted into the vector (Filippin et al., 2005). For peroxisomes, theHyPer sequence will be cloned into pECFP-Peroxi vector (Clontech). Peroxisomal targeting sequence 1will be used for specific localization.The cell lines will be transfected with the resultant vector using the Lipofectamine 2000 (Invitrogen).To obtain fluorescence data from single cell, a Zeiss 510 confocal laser scanning microscope will be used(available in Utrecht), with a 1.4 numerical aperture (NA) oil objective, and 125 mW argon and 1 mWhelium-neon lasers. Scanning will be performed using 400 Hz line frequency, 512 x 512 format. The greenfluorescent signal of HyPer will be acquired using a 420/500-nm excitation laser line (4% intensity) anddetected at 500–520 nm wavelength range. Image intensities will be quantified with Zeiss confocalsoftware.Data analysisWhen comparing the fluctuations in H 2 O 2 levels in mitochondria, peroxisomes and the cytosol, it will betaken into account that the HyPer probe is pH sensitive. The pH within the organelles differs, but does notfluctuate significantly due to homeostatic control regulation (Damareux, 2002). This difference in pHbetween the organelles will be included into the calculations needed for comparison.‘Materials:• pQE30 (Qiagen)• pEGFP-C1 (Clontech)• pECFP-Mito (Clontech)• Lipofectamine (Invitrogen)• Zeiss 510 confocal laser scanning microscopeAppendix 2.4: MitoSOXMitoSOX is a fluorescent mitochondria-specific superoxide-probe. Upon oxidation by O 2 - , the probe willemit red fluorescent light at 580 nm. when excited at 510 nm. The probe is highly specific for superoxide(Mukhopadhyay et al., 2007). The probe will be used according to the protocol that comes with it. Imageintensities will be quantified with Zeiss confocal software.Materials:• MitoSOX probe (Invitrogen)Appendix 2.5: Measuring of antioxidantsFor the measurement of antioxidant enzymes, kits will be purchased from Cayman Chemical. Theprotocols that come with the kits will be used.Materials:• Catalase Assay Kit (Cayman Chemical)• Superoxide Dismutase Assay Kit (Cayman Chemical)• Glutathione Peroxidase Assay Kit (Cayman Chemical)• Glutathione Assay Kit (Cayman Chemical)• Microplate readerAppendix 3.1: Antioxidant cocktailSCI 332 Advanced Molecular Cell Biology Research Proposal 106

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Appendix 3.1.1: Constitution ‘antioxidant cocktail’The antioxidant cocktail that will be used will consist of the following antioxidants, in the relativeconcentrations indicated (Table B.2). These concentrations are based on concentrations usually effectivein lowering ROS. Equal volumes of the various antioxidants in the concentrations indicated will form thecocktail, so that it will contain all antioxidants in the relative concentrations indicated. To determine therequired dose for lowering ROS levels, the cocktail will be further diluted in PBS to various extents (1x to10.000x).Antioxidant Effect Concentration Relative concentrationTempol SOD mimetic 2,5 mM 200Diethyldithiocarbamic SOD mimetic 50 µM 4acid (DDC)N-acetyl-L-cysteine Increases glutathione 5 mM 400(NAC)poolsEUK-8 (salenmanganeseSOD/catalase mimetic 12,5 µM 1complex)Table B.2 Overview Antioxidant cocktailMaterials:4. 4-hydroxy-TEMPO (tempol) (Sigma)5. Diethyldithiocarbamic acid, lead salt, moist (DDC) (Sigma)6. N-acetyl-L-cysteine (NAC) (Sigma)7. EUK-8 (Eukarion, Inc.)Appendix 3.1.2: Increasing ROS levelsH 2 O 2 in PBS will be added to the medium in concentrations varying from 10 µM to 20 mM.Antimycin A, ATP and Diazoxide will be added to the medium in the concentrations indicated in the text.Materials:6. H 2 O 2 in PBS (Sigma)7. Antimycin A (Sigma)8. Adenosine 5’-triphosphate, Disodium salt (Sigma)9. Diazoxide (Sigma)Appendix 3.1.3: Northern blotMaterials:• PrimerBank database ()• Massachusetts General Hospital DNA Core Facility• RNEasy kit (QIAGEN)• NorthernMax (AM1940) (Ambion)Appendix 3.1.4: Real time RT-PCRThe following kits will be used for RNA isolation and two-step real time RT-PCR. SYBR Green is a dyethat selectively binds to double-stranded DNA.• For RNA purification: RNEasy kit (QIAGEN)• For reverse transcription: QuantiTect Reverse Transcriptase Kit (QIAGEN)• For PCR of the target transcript: QuantiTect Primer Assay (QIAGEN)• For quantification: QuantiTect SYBR Green PCR Kit (QIAGEN)Appendix 3.1.5: Analysis of entry into G2Cells will be grown in nocodazole-containing medium (20 µg/ml) to arrest them in prometaphase. Fivehours after adding hydrogen peroxide, antioxidant or control, cells will be fixed in 70% ethanol overnight at–20°C. Subsequently, they will be permeabilized with PBS containing 0.1% Triton X-100 for 20 minutes at4 °C, blocked with 2% FBS in PBS, and incubated with 1 µg of anti-pSer10-histone H3 anti-rabbit antibodySCI 332 Advanced Molecular Cell Biology Research Proposal 107

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007per 10 6 cells for 60 minutes on ice. After washing, cells will be incubated with 1 µg of Alexa Fluor 488-conjugated goat anti-rabbit antibody per 10 6 cells for 30 minutes on ice, washed and re-suspended in PBS.Cells will be prepared for flow cytometry following the protocol accompanying the anti-pSer10-histone H3antibodies. FACS will be carried out according to the protocol to count cells containing phosphorylatedhistone H3.Materials:• Nocodazole (Sigma)• Hydrogen peroxide (Sigma)• Ethanol (Sigma)• PBS containing 0.1% Triton X-100 (Invitrogen)• anti-pSer10-histone H3 anti-rabbit antibody (Cell Signaling Technology)• Alexa Fluor® 488 F(ab') 2 fragment of goat anti-rabbit IgG (Invitrogen)FACS for cell cycle phase checkPreparation of cells for FACS will be performed as described by Ezhevsky and colleagues (1997): Cellsarrested in prometaphase will be washed with PBS, fixed in 70% ethanol overnight at -20 °C, andrehydrated with PBS containing 0.1% BSA, RNAase A (1 µg/ml) and propidium iodide (10 µg/ml), 20minutes before analysis with FACS. For FACS procedure, the protocol accompanying the machine atUtrecht University will be followed.Appendix 3.2: Immunoprecipitation Kinase AssayImmunoPrecipitation Kinase Assay:Immunoprecipitation will be applied as explained by Ezhevsky et al. (2001) using 2 µg of antibodiesmentioned below.Antibodies:− Cyclin D1 antibody (ab7953) (Abcam) binds to D1 and D2− Cyclin A antibody (ab53054) (Abcam) binds to A1 and A2− Cyclin D1 antibody (ab7953) (Abcam) binds to D1, weakly binds to D2− 50 µg of protein A beads will be usedKinase assay will be applied to cell extracts obtained from immunoprecipitation as described in the manualof Trulight Universal Kinase/Phosphatase Assay Kit (Calbiochem).Substrates:Histone H1 (Calbiochem) for cell extracts incubated with antibodies against cyclin A and cyclin Bglutathione transferase (GST) C terminus pRb (Calbiochem) for cell extracts incubated with antibodyagainst cyclin D assay.2 µg of substrate will be used together with 50 µg cold ATP (Amersham). Reactions will be performed for30 minutes at 30°C.Measurement of Kinase activity:Kinase activity will be measured as explained in the kit manual. Statistical analysis will show the activity ofthe kinase as a percentage which makes it possible to compare kinase activities.Appendix 3.3: Western BlotWestern blot will be done as explained by Ezhevsky et al. (2001) using antibodies mentioned below as aprobe. Beta Actin antibody (Abcam) will be used as a loading control.a) Antibodies:− Cyclin A antibody (ab53054) (Abcam) binds to A1 and A2− Cyclin B2 antibody(X29.2) (Abcam) binds to B1 and B2b) Phospho-specific antibodies:SCI 332 Advanced Molecular Cell Biology Research Proposal 108

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007−−−−Phospho-specific anti-cdk1 antibody (pThr14, pTyr15) (Calbiochem) binds to cdk1, phosphorylated atThr14 and/or Tyr15Cdk2 (phospho T160) antibody (Abcam) binds to cdk2 phosphorylated at T160Anti-Cdk2 (Abcam)Anti-Cdc2 (Abcam)Appendix 3.4: 35 S pulse-chase experiments35 S pulse-chase experiments:35 S pulse-chase experiments and Western Blot will be performed as described by Toby et al. (2005).Antibodies used:Cyclin A antibody (ab53054) (Abcam) binds to A1 and A2Cyclin B2 antibody(X29.2) (Abcam) binds to B1 and B2Measurement of Incorporation:Incorporation will be observed in SDS-Page and quantified by phosphorimager. Phosphorimagermeasures intensity of photon emission which is an indication of how much the protein is translated.Appendix 3.5: Co-immunoprecipitationCo-immunoprecipitation:Co-immunoprecipitation experiment and Western Blot will be performed as described by Havens et al.(2006).Antibodies used:Anti-Cdc27 AF3.1 antibody (Santa Cruz) conjugated with Protein A-Sepharose beads.Beta Actin antibody (Abcam) will be used as a loading controlAppendix 3.6: Cycloheximide treatmentThis experiment will be performed as explained by Havens et al. (2006)Cells will be harvested at three intervals for western blotting:1. Before treatment with cycloheximide2. 1.5 hours after treatment with cycloheximide3. 3 hours after treatment with cycloheximideAntibodies:− Cyclin A antibody (ab53054) (Abcam) binds to A1 and A2− Cyclin B2 antibody(X29.2) (Abcam) binds to B1 and B2− Beta Actin antibody (Abcam) will be used as a loading control.References:“Bio Currents Research Center Protocol - Electrode Construction” Retrieved on 20 November 2007“Bio Currents Research Center.” MBL, Woods Hole, MA. Retrieved on 20 November 2007Demaurex, N. (2002) “pH homeostasis of cellular organelles”. News in physiological sciences 17:1-5Ezhevsky, S. A., A. Ho, M. Becker-Hapak, P. K. Davis, and S. F. Dowdy (2001) “Differential regulation of retinoblastoma tumorsuppressor protein by G1 cyclin-dependent kinase complexes in vivo.” Mol. Cell. Biol. 21: 4773–4784.Filippin, L. et al. (2005) “Improved strategies for the delivery of GFP-based Ca2+ sensors into the mitochondrial matrix” Cell Calcium37:129-36.Foster et al. (2006) “Optical and pharmacological tools to investigate the role of mitochondria during oxidative stress andneurodegeneration”. Progressive neurobiology 79:136-171Havens, C. G., A. Ho, Yoshioka, N., and Dowdy, S. F. (2006) “Regulation of Late G1/S Phase Transition and APC by ReactiveOxygen Species.” Mol. Cell. Biol. 26: 4701–4711.SCI 332 Advanced Molecular Cell Biology Research Proposal 109

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007in Mouse Peritoneal Macrophages” Chemistry European Journal 13:1411-1416.Jackman, J. and P.M. O’Connor (2003) “Methods for synchronizing cells at specific stages of the cell cycle”. Invitrogen. [adaptedfrom: Bonifacino et al. (1998) “Current protocols in cell biology” John Wiley & sons, Inc.Messerli, M.A., Robinson, K.R. and Smith, P.J.S. (2006) “Electrochemical sensor applications to the study of molecular physiologyand analyte flux in plants”. Plant Electrophysiology - Theory and Methods. Edited by Alexander G. Volkov. Springer-Verlag: 73-107.Mukhopadhyay P. et al. (2007) “Simple quantitative detection of mitochondrial superoxide production in live cells” Biochemistry &Biophysiology Research Community 358(1):203-8.Osbourn, D.M., R.H. Saner and P.J.S. Smith “Determination of single-cell oxygen consumption with impedance feedback for controlof sample-probe separation” 2005. Analytical Chemistry 77: 6999-7004.Porterfield, M. (2006) “Measuring metabolism and biophysical flux in the tissue, cellular and sub-cellular domains: Rencentdevelopments in self-referencing amperometry for physiological sensing.” Biosensors and Bioelectronics 22:1186–1196Schorl, C. and J.M. Sedivy (2007) “Analysis of cell cycle phases and progression in cultured mammalian cells.” Methods in cell cycleresearch 41: 143-150.Smith, P.J.S., Sanger, R.S. and Messerli, M.A. (2007) “Principles, Development and Applications of Self-ReferencingElectrochemical Microelectrodes to the Determination of Fluxes at Cell Membranes”. Methods and New Frontiers in Neuroscience.Ed. Adrian C. Michael. CRC Press. Ch. 18: 373-405.Toby L., M. Bebien, G.Y. Liu, V. Nizet et al. (2005) “IKKa limits macrophage NF-kB activation and contributes to the resolution ofinflammation.” Nature 434:1138-1143.Xu, K. et al. (2007) “Design of a Phosphinate-Based Fluorescent Probe for Superoxide DetectionSCI 332 Advanced Molecular Cell Biology Research Proposal 110

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Appendix CAppendix 1: Retroviral mediated gene transfer and CA-AMPKCA-AMPK and DN-AMPK are constructed from recombinant adenoviruses as demonstrated in Woods etal. (2000), in which a cDNA containing the activity-essential residues of the AMPK α1 subunit is insertedinto a plasmid vector under the control of a cytomegalovirus (CMV) IE promoter. This promoter is essentialfor accomplishing time specific expression of the modified AMPKs, since the repression of the genesfollowing this promoter is relieved by several stimuli including heat-shock treatment, which can beachieved either through physically creating hyperthermic conditions, or by treating the cells with sodiumarsenite, an inducer of cellular heat-shock genes (Boom et al., 1988). Besides sodium arsenite, a numberof other compounds can be used to induce activation of the CMV IE promoter, but sodium arsenite has nodiscernable effect on the ATP concentration or ATP/ADP ratio, whereas most other compounds do(Ashburner and Bonnert, 1979).Appendix 2: Determination of apoptosis:In order to judge whether a cell goes into apoptosis after induced experimental conditions, caspaseactivity can be assessed by means of an apoptosis assay, as performed in Hulleman et al. (2004).Caspases are proteins released in the mitochondria at the onset of apoptosis, thus characterizingcontrolled cell death (Fesik, 2001). The cell permeable, fluorescent marker FITC-VAD-FMK bindsirreversibly to those activated caspases and inhibits them. Through subsequent measurement of emittedfluorescence intensity, apoptosis can be detected.Appendix 3: IRS-1 inhibitionWe will mutate IRS-1 via targeted gene mutation. A null mutation will be introduced into the target gene,which will be done by a designed alteration in a cloned DNA sequence. This DNA sequence is thenintroduced into the genome via homologues recombination. This will result in the replacement of thenormal allele by the introduced mutated allele.Overlap extension PCR will be carried out to site-direct mutagenesis of IRS-1. Ser-794 will be mutatedinto aspartic acid or alanine which one do you choose? by primers 5’-CGTCTCTCTTCAGACTCTGGACGC-3’ and5’-CGTCTCTTCAGCATCTGGACGC-3’ (the underlined nucleotides indicate the location of the mutation). In orderto span two unique BlpI sites, the following two primers were designed: an outer IRS-1 primer IRS-1 1338-1359Forward 5'-CACACCCCACCAGCCAGGGT-3', as well as IRS-1 3189-3159Reverse 5'-TCCCAGCAAGGAAGAGTGAGC-3'. These plasmids will be digested with Xhol and Sall restriction enzymes togenerate the pCMV-Myc-IRS-1-S794D and pCMV-Myc-IRS-1-S794A constructs. The fragments producedin the Xhol and HindIII sites of the previously described pCMV-Myc-IRS-1 will be subcloned.Appendix 4: P53 inhibition via RNAiiRNA Gene silencing of p53 in hematopoietic stem cells has been shown to reduce the expression of thisprotein by 95%. (Schomber et al., 2004).The human p53 iRNA will be created using the annealed primers5’-GATCCCCGACTCCAGTGGTGGTCTACTTCAAGAGAGAGTAGATTACCACTGGAGTCTTTTTGGAAC-3’ and5’-TCGAGTTCCAAAAAGACTCCAGTGGTAATCTACTCTCTTGAAGTAGATTACCACTGGAGTCGGG-3’. Both primers will beintroduced into the HindIII and BglII site of the pSUPER vector, which was described by Brummelkamp etal (2002). The same primers as used by Schomber et al. (2004) will be used as control:5’-GATCCCCCTGGCATCGGTGTGGATGATTCAAGAGATCATCCACACCGATGCCAGTTTTTGGAAA- 3’ and 5’-AGCTTTTCCAAAAACTGGCATCGGTGTGGATGATCTCTTGAATCATCCACACCGATGCCAGGGG-3’. Further steps willproceed as described by Schomber et al. (2004).SCI 332 Advanced Molecular Cell Biology Research Proposal 111

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Appendix DCell cycle synchronizationCell cycle synchronization is obtained via a double thymidine block, as the cell lines are not suited forcentral elutriation and will not suffer from disadvantages as inhibition of cell growth and apoptosis whenusing serum deprivation. Nocodazole is used to synchronize cells in M-phase, in order to have cellsynchronized for a full cell cycle.Reverse-transcription real-time PCRRT-PCR has the unique quality that is able to detect and quantify even minimal amounts of RNA. As weare looking at fluctuating levels of different compounds throughout the cell cycle (and the mRNA levels ofthese compounds could become very low in certain phases) it would be wisest for us to use this techniqueas it will provide the most accurate quantification.It is recommendable to use a two-step RT-PCR instead of a one-step RT-PCR. Normally a RT-PCR isdone in two steps: the reverse transcription and the actual PCR. However, it is also possible to do thesetwo steps simultaneously. A two-step RT-PCR provides more sensitivity and a longer conservation ofreagents. For all PCR experiments BrdU pulse labelling is used to indicate in which phase in the cell cycleit is. Facilities from the University Utrecht laboratories will be used for visualization.Mitochondrial DNA to nuclear DNA ratioQuantitative real-time PCR will be used to measure the mitochondrial DNA to nuclear DNA ratio. Thefollowing primer sequences will be used for the mitochondrial fragment: forward primer MitHu3130F,AGGACAAGAGAAATAAGGCC, reverse primer MitHu3301RAAGAAGAGGAATTGAACCTCTGACTGTAA. For the nuclear fragment, forward primer APP137FTTTTTGTGTGCTCTCCCAGGTCT and reverse primer APP210R TGGTCACTGGTTGGTTGGC will beused. These probes will be labelled with TAMRA at the 3’ end and FAM at the 5’ end. Probe oligosequences will be mit3153T, TTCACAAAGCGCCTTCCCCCGTAAATG for the mitochondrial fragmentand APP161T, CCCTGAACTGCAGATCACCAATGTGGTAG for the nuclear fragment. TaqManfluorogenic probes will be used to enable detection of the aforementioned PCR products that accumulateduring the PCR cycles (Ashley et al., 2005).PPAR family (PRC, PGC-1α and PGC-1β) mRNA levels1 µg of total RNA will be then treated with DNase I (Applied Biosystems) before being treated with M-MLVReverse Transcriptase (Applied Biosystems). The synthesized cDNAs will be amplified using specificprimers: PRC sense primer, 5′-GCAACAGCC GTTCTGT-3′; PRC antisense primer, 5′-CTGCAAATGCCTCCTC-3′, PGC-1α (sense, 5’-TCAGTCCTCACTGGTGGACA-3’; antisense, 5’-TGCTTCGTCGTCAAAAACAG-3’). TaqMan (5'-FAM;3'-TAMRA) probes will be used.Cyclin D1, D2, D3, E1, E2 cdk2, cdk3, cdk4, cdk6, NRF-1, mRNA levelsWe will be using SYBR Green, a commonly used probe for detecting the desired PCR product. It is themost convenient method to use when examining a large number of mRNA targets, as no specific probedesign (as with Taqman or Molecular Beacons) for every single mRNA target has to be done.We propose to buy a RT 2 First Strand Kit (Superarray Bioscience). This kit contains almost all theessential components to do a RT-PCR, both for the reverse transcription and the actual PCR. It also hascomponents that ensure the removal of genomic DNA from the PCR. As discussed before, we decided touse SYBR Green for fluorescent detection; this component has to be bought separately (SuperarrayBioscience). The primers for the specific compounds we want to investigate are all, except for NRF-2,available at the same company.Specific Primers required: (Cyclin D1, D2, D3, E1, E2 cdk2, cdk3, cdk4, cdk6 NRF-1, PRC)Unfortunately, no commercial primer is available for NRF-2, as its sequence has not been fully establishedyet. However, the sequence of the α subunit has been determined. Therefore, we will order a customprimer against the α subunit (Invitrogen). Although this might not give entirely accurate results about NRF-2 mRNA levels, it will provide a close identification. As RT-PCR is a rather lengthy method, especiallySCI 332 Advanced Molecular Cell Biology Research Proposal 112

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007considering that we are looking at many compounds. It requires careful planning and design to perform asuccessful RT-PCR, and as we are using this method to quantify quite a number of different compounds, itwill probably take multiple weeks or months.Fluorescent-activated Cell Sorting (FACS)FACS will be used to measure the relative changes in mitochondrial mass throughout the cell cycle. Wewill be utilizing the laboratory facilities at the University of Utrecht.As the target(s) of a single probe for mitochondria may not be representatives of the changes inmitochondrial mass, different probes will be used. The fluorescent probes need to be membrane potentialindependent and mitochondrial uptake of the fluorescent probe should also be membrane potentialindependent. Both MitoTracker Green FM and NAO (10N-nonyl acridine orange) have these propertiesand will be used as the fluorescent probes in FACS. The targets of the former probe are a subset ofmitochondrial proteins that have free thiol groups of cyteine residues in mitochondrial proteins (Presley etal., 2003), while the target of the latter probe is cardiolipin, an inner membrane component of mitochondria(Petit et al., 1992)Western BlottingFor the Western Blot analysis to detect protein expression of the different compounds, specific primaryand secondary antibodies have to be ordered (Invitrogen).In general, it is better to use monoclonal antibodies in Western Blotting. Apart from the obvious reasonthat monoclonal antibodies have a higher specificity than polyclonal antibodies, they also ensure a lowerbackground and less non-specific detection.Antibodies against PRC and NRF-2 however are commercially unavailable. However, a possible way totarget NRF-2 is by targeting the α subunit, which is homologous with GABPA (GA-binding protein chain α)and does have antibodies against it. This means these antibodies will also target NRF-2α, which has beenshown in a research studying the function of NRF-2 (Ongwijitwat & Wong-Riley 2005). As the genetic codeof NRF-2 remains unknown or incomplete, at this point we are unable to synthesize antibodies againstNRF-2 directly. An antibody against PRC will be synthesized (Invitrogen).The negative control for both RT-PCR and Western Blot will be β-tubulin, because its expression levelsare hardly affected by changes in the cell, and β-tubulin has been successfully used as a control inprevious research in the same field (Wang et al. 2006). The antibody for β-tubulin will be bought fromInvitrogen Corporation and the primer will be obtained from Superarray Bioscience Corporation.Co-ImmunoprecipitationRegarding binding between Cyclin D1 and cdk4 and 6, the antibodies against these compounds used forthe Western Blot can also be used for co-immunoprecipitation.Phosphoprotein and phosphopeptide analysis: Identification of the nature and extent of phosphorylation ofNRF-1 and 2 by Cyclin D1/cdk4 and PRC: Phosphorylation detection of NRF-1 and PRCPerkinElmer Phos-tools kit will be used along with PerkinElmer Phos-tag stains to highlightphosphorylated proteins due to their high binding affinities with phosphorylated serine, threonine, andtyrosine residues. Additionally, for this method it is required to enrich the phosphopeptides for adequatedetection using PerkinElmer Phos-trap.Using these kits, as described by the manufactures, we will be able to identify if and at which sites NRF-1is phosphorylated by Cyclin D 1 /cdk 4 . Using this method requires one to first identify the protein of interestusing 1D PAGE analysis. Following this, staining with PerkinElmer Phos-tag will reveal if the protein ofinterest (in this case NRF-1) is phosphorylated. This stain does not target specific phosphorylation sitesbut binds with the phosphomonoesters of tyrosine, serine and threonine. Following this PerkinElmer Phostrapis necessary to enrich the phosphopeptides and the protein is then analyzed using massspectrometry to identify the sites of phosphorylation. We will then do the same process to establish thenature of phosphorylation of NRF by PRC.SCI 332 Advanced Molecular Cell Biology Research Proposal 113

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Kinase assay AlphaScreen® PhosphoSensor KitsUsing these kits one is able to test the activity of various kinases in phosphorylation a particular substrate.This method does not require us to identify particular phosphorylation sites using antibodies however,antibodies will be required in order to purify and isolate the various substrates we are interested in. TheAlphaScreen® PhosphoSensor Kits requires the substrate (in this case NRF-1 or 2) to be biotinylated. Asthe substrate is phosphorylated (by the specific kinase in the assay) a streptavidin donor andPhosphoSensor acceptor bead capture the substrate, causing the PhosphoSensor acceptor bead to emitlight. This emission can be observed using most imaging systems providing a quantification of thephosphorylation activity of the specific kinase with respect to the substrate being examined.Mutations: The role of localization of Cyclin D 1 /cdk 4 in NRF regulationWe will mutate the following site: T286A (Wang et al., 2006). In this study it was found that the continuedlocalization of Cyclin D1 in the nucleus resulted in continued inhibition of NRF-1. However, whether thisdown-regulation is still observed when PRC is activated during the cell cycle has not been established.RNA isolationCells will be treated with TRIZOL Reagent (Invitrogen) to isolate RNA according to manufacturer’sinstructions.RNAiCustom siRNAs designed for PGC-1α, PGC-1β, PRC, and MAP2k6 knockdown will be ordered throughApplied Biosystems with the target mRNA sequences obtained from RefSeq (PGC-1α: NM_013261 ;PGC-1β: NM_133263; PRC: NM_015062). Positive and negative controls for siRNA are: Silencer®GAPDH siRNA and Silencer® Negative Control #1 siRNA (Applied Biosystems). Vectors containing thesiRNA of choice according to the experiment will be inserted into the cell using the pSUPER vector(Oligoengine 2.0) designed by Thijn R. Brummelkamp et al. A Western blot will then be performed tocheck whether the vectors have been successfully expressed. Applied Biosystems TaqMan® GeneExpression Assays specific to PGC-1α, PGC-1β and PRC will be used to detect the RNAi effect.MAPK-p38 inhibitionTo inhibit the MAPK-p38 pathway, we will be using SB220025 MAPK INHIBITOR Multiple (BioSource)(Invitrogen). SB 220025 is a potent inhibitor of p38 MAPK for elucidating p38 MAPK's role in signalingpathways.MAPK Erk inhibitionInhibition of the MAPK Erk ½ pathway will be achieved using the MEK Inhibitor U0126 (Promega). U0126Inhibits both active and inactive MEK1,2 unlike PD098059 (the other possible inhibitor for this pathway)which only inhibits activation of inactive MEK (1,2). MEK Inhibitor U0126 results in downstream inhibitionof Erk 1 and Erk 2 mediated responses.RT-PCR SystemFor our research we would like to apply for an extra grant to purchase the Light Cycler 2.0 from RocheDiagnostics. There are two Light Cycler systems; the 2.0 and 480; the difference being in the samplenumber one is able to process at one time. The Light Cycler 480 is a larger system for 96- and 384- wellthermal cycler units. Since our sample size is not that big we opt for the Light Cycler 2.0 which has 32 wellthermal cycler units, which is enough for our experiments.What sets the Light Cycler apart from other systems is that it allows for very rapid running of samples in atime span of 30 minutes. Furthermore, this technology has improved sensitivity through rapid cyclingwhich increases the signal to noise ratio and protects against the accumulation of unwanted PCR products.In comparison to the BioRad iCycler iQ Real Time PCR System supplied by Bio Rad, the Light Cycler hassix fluorescence detection channels that measure fluorescence at 530, 560, 610, 640, 670 and 750 nm.The BioRad iCycler iQ Real Time PCR System only has a three color analysis systems. Moreover, theLight Cycler 2.0 comes with optimized hardware components, which allow for rapid, precise, temperatureregulation for maximum reproducibility as well as providing us with an unlimited choice of detection format.SCI 332 Advanced Molecular Cell Biology Research Proposal 114

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007It is also very sensitive in being able to detect single copies of genes in one genome equivalent of DNA,as well as measuring 10 to 10 10 copies in a single run. The Light Cycler 2.0 also comes with probe designsoftware, so we are also able to create our own specific probes.SCI 332 Advanced Molecular Cell Biology Research Proposal 115

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Appendix EE1 Cell Lines and cell culturesCell linesAll cell lines will be purchased through LGC Promochem in cooperation with ATCC unless statedotherwise.Mouse cell linesName ATCC # Cell type and tissue MotivationJ1 SCRC- Embryonic Stem Cell, Inner cell Control for proliferating cells1010 massMEF SCRC- Embryonic FibroblastDifferentiated stem cell(CF-1) 1040NIT-1 CRL- Insulinoma of the Islets of Might overexpress Cyclin D1 12055 LangerhansMOVAS CRL-2797Smooth Muscle of the Aorta Used in H1 and H3Human cell linesName ATCC # Cell type and tissue MotivationMaDo CCL-135 Lung fibroblast Non-proliferating cell(LL-47)HeLa CCL-2 Adenocarcinoma of the cervix Frequently used cell in researchA-704 HTB-45 Adenocarcinoma of the kidney Might overexpress cyclin D1 2WiDr CCL-218 Adenocarcinoma of the colon Might overexpresses cyclin D1 3Farage CRL- Non-Hodgkin B cell lymphoma Known to overexpress cyclin E 42630ZR-75-1 CRL- Ductal carcinoma (mammary Probably overexpress cyclin E 41500 gland)BC-3 CRL-2277B-cell lymphoma Known to overexpress cyclin D1 5The following cell line will be purchased through Promocell:HAoSMC-cC-12533 Human Aortic Smooth Muscle This is the cell line used in allhypothesisRat cell LinesName & ATCC # Cell type and tissue MotivationATCC #IA- CRL- Adenocarcinoma of the small To compare to HeLaXsSBR 1677 intestineRn1T Cancer of the mammary gland To compare to ZR-72-11 Chung et al., 20002 Schraml et al., 20033 Lin et al., 19984Tetsu & McCormick, 19995Motokura & Arnold, 1993SCI 332 Advanced Molecular Cell Biology Research Proposal 116

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007Cell CulturesAll cell lines will be cultured at a temperature of 37º Celsius, the atmosphere will be 95% air and 5%carbon dioxide to maintain the pH. The medium and serum differs per cell line, the optimal growth mediaare listed below. The different components of the serum will be bought through ATCC unless indicatedotherwise. For subculturing protocols of all cell lines (except for HAoSMC-c) we would like to refer to theLGC website: www.lgcprochem-atcc.com. For HAoSMC-c cultering and thawing protocols we would like torefer to Promocell’s instructions ‘Recovery of crypopreserved cells’.J1 - This cell line will be propagated in Dulbecco’s modified Eagle’s Medium (DMEM) supplemented with2.0 mM L-Alanyl-L-Glutamine, 0.1 mM non-essential Amino Acids, 0.1 mM 2-mecrapoethanol (InvitrogenLife Technologies No. 21985), 1000 U/ml mouse leukemia inhibitory factor (LIF) (Chemicon No. ESG1107)and 15% fetal bovine serum.MEF - This cell line will be propagated in DMEM supplemented with with 4 mM L-glutamine adjusted tocontain 1.5 g/L sodium bicarbonate and 4.5 g/L glucose (85%) and 15% fetal bovine serum.NIT-1 - This cell line will be propagated in Ham's F12K medium supplemented with 2 mM L-glutamineadjusted to contain 1.5 g/L sodium bicarbonate (90%) and 10% heat-inactivated dialyzed fetal bovineserum.MOVAS -This cell line will be propagated in DMEM with 4 mM L-glutamine adjusted to contain 1.5 g/Lsodium bicarbonate and 4.5 g/L glucose supplemented with 0.2 mg/ml G418, (90%) and 10% fetal bovineserum.MaDo - This cell line will be propagated in Ham’s F12K medium (85%) and 15% fetal bovine serum.HeLa, WiDr - These cell lines will be propagated in ATCC-formulated Eagle’s Minimum Essential Medium(EMEM) supplemented with fetal bovine serum to a final concentration of 10%.A-704 - This cell line will be propagated in EMEM in Earle’s BSS supplemented with nonessential aminoacids and sodium pyruvate (85%) and 15% fetal bovine serum.Farage, ZR-75-1 - These cell lines will be propagated in ATCC-formulated RPMI-1640 mediumsupplemented with fetal bovine serum to a final concentration of 10%.BC-3 - This cell line will be propagated in RPMI-1640 medium supplemented with 20% fetal bovine serum.HAoSMC-c – This cell line will be propagated in a vascular smooth muscle growth medium purchasedthrough Promocell will be used.IA-XsSBR - This cell line will be propagated in Ham’s F10 medium (90%) supplemented with 10% fetalbovine serum.Rn1T - This cell line will be propagated in DMEM supplemented with fetal bovine serum to a finalconcentration of 10%.SCI 332 Advanced Molecular Cell Biology Research Proposal 117

Tour-de-Force: Interplay between Mitochondria and Cell Cycle Progression Fall 2007E2 Amino acid sequence of human Mfn2Amino acid sequence of human Mfn2. In experiment 3.2, a mutant generated through site-directedmutagenesis that lacks amino acids 595-604 (red) will be used , as this is the expected cleavage site.(From NCBI)001 msllfsrcns ivtvkkdkrh maevnasplk hfvtakkkin gifeqlgayi qesagfledt061 hrnteldpvt teeqvldvkg ylskvrgise vlarrhmkva ffgrtsngks tvinamlwdk121 vlpsgightt ncflrvggtd gheafllteg seekksvktv nqlahalhqd eqlhagslvs181 vmwpnskcpl lkddlvlmds pgidvtteld swidkfclda dvfvlvanse stlmqtekqf241 fhkvserlsr pnifilnnrw dasasepeym eevrrqhmer ctsflvdelg vvdraqagdr301 iffvsakevl sarvqkaqgm pegggalaeg fqvrmfefqn ferrfeecis qsavktkfeq361 htvrakqiae avrlimdslh iaaqeqrvyc lemreerqdr lrfidkqlel laqdyklrik421 qmteeverqv stamaeeirr lsvlvdeyqm dfhpspvvlk vyknelhrhi eeglgrnmsd481 rcstaiassl qtmqqdmidg lkpllpvsvr nqidmlvprq cfslsydlnc dklcadfqed541 iefhfslgwt mlvnrflgpk nsrrallgyn dqvqrplplt panpsmpplp qgsltqeelm601 vsmvtglasl tsrtsmgilv vggvvwkavg wrlialsfgl ygllyvyerl twttrakera661 fkrqfveyas eklqliisyt gsncshqvqq elsgtfahlc qqvditrdnl eqeiaamnkk721 vealdslqsk akllrnkagw ldselnmfih qylqpsrSCI 332 Advanced Molecular Cell Biology Research Proposal 118