Turkish Journal of Hematology Volume: 35 - Issue: 1

More documents

Recommendations

Info

Nikkhah H, et al: BM-MSCs’ Effects on HL-60 Cell DifferentiationTurk J Hematol 2018;35:42-48Table 1. Primers for real-time polymerase chain reaction.Gene name Forward primer Reverse primerPU.1 GACACGGATCTATACCAACGCC CCGTGAAGTTGTTCTCGGCGAACD11b GGAACGCCATTGTCTGCTTTCG ATGCTGAGGTCATCCTGGCAGALysozyme ACTACAATGCTGGAGACAGAAGC GCACAAGCTACAGCATCAGCGAC/EBP-α AGGAGGATGAAGCCAAGCAGCT AGTGCGCGATCTGGAACTGCAGC/EBP-β AGAAGACCGTGGACAAGCACAG CTCCAGGACCTTGTGCTGCGTC/EBP E CCAGCCTCTGCGCGTTCTCAA CAAGGCTATCTTTGTTCACTGCCMPO GAGCAGGACAAATACCGCACCA AGAGAAGCCGTCCTCATACTCCCD16 GGTGACTTGTCCACTCCAGTGT ACCATTGAGGCTCCAGGAACACGCSFR CCACTACACCATCTTCTGGACC GGTGGATGTGATACAGACTGGCCathepsin G CGACAGTACCATTGAGTTGTGCG TTCGTCCATAGGAGACAATGCCCMPO: Myeloperoxidase.Figure 1. Flow cytometry analysis confirmed the mesenchymal nature of the bone marrow mesenchymal stem cells. The markers assessedby flow cytometry included CD14, CD19, CD34, CD45 CD90, CD105, and CD73. The experiments were done in triplicate.Morphological Changes of the Treated CellsTo assess the morphological changes in the treated HL-60 cells,Wright-Giemsa staining was performed (Figures 2A-2D). Thecomparative study of the morphological changes in the HL-60cells stained by Wright-Giemsa indicated that, in comparison tothe control, the cells treated with ATRA and BM-MSCs individuallyhad induced granulocytic differentiation of the HL-60 cells(Figures 2B and 2C) and showed an additive effect when usedwith BM-MSCs in combination with ATRA (Figure 2D). While thecontrol cells (Figure 2A) demonstrated typical morphology in thepromyelocytic cells (a circular nucleus), the treated HL-60 cellsexhibited a kidney-shaped nucleus and segmented nucleus andalso had a reduced nuclear/cytoplasmic ratio.44
Turk J Hematol 2018;35:42-48Nikkhah H, et al: BM-MSCs’ Effects on HL-60 Cell DifferentiationCD11b Expression Increased in Treated HL-60 CellsIn the treated HL-60 cells, an increase was observed in thepercentage of CD11b marker expression, one of the maingranulocytic differentiation markers measured by flowcytometry, after 48 h. Flow cytometry results displayed thatthe expression of the CD11b marker was 17.12%, 76.69%,23.96%, and 96.4% in the untreated HL-60 cells, in the HL-60cells treated with ATRA, in the HL-60 cells treated with BM-MSCs, and in the HL-60 cells treated with a combination ofBM-MSCs and ATRA, respectively (Figure 3). The expression ofCD11b significantly increased in the HL-60 cells treated withthe combination of BM-MSCs and ATRA compared to the HL-60cells treated with ATRA alone or with BM-MSCs alone.Effects of BM-MSCs and ATRA on Gene Expression in HLA-60CellsIn the ATRA-treated HL-60 cells, there was a marked increase(p<0.05) in the gene expressions of CD11b, lysozyme, GCSFR,CD64, PU.1, and C/EBP-ALPHA from 1.00 to 8.33 (±0.07), 5.53(±0.16), 3.36 (±0.12), 1.94 (±0.02), 1.26 (±0.04), and 1.11 (±0.02),respectively. There was no gene expression for C/EBP-BETA,C/EBP E, or CD16 (Figure 4). On the other hand, as revealed inFigure 4, in the HL-60 cells co-cultured with the BM-MSCs,there was significant increase (p<0.05) in CD11b, lysozyme, PU.1,CD64, and GCSFR expression levels from 1.00 to 2.2 (±0.07), 3.3(±0.16), 1.23 (±0.02), 1.11 (±0.02), and 1.51 (±0.12), respectively,and there was no expression of C/EBP-BETA, C/EBP E, or CD16levels. In the HL-60 cells co-cultured with the combination ofBM-MSCs and ATRA, the gene expression of CD11b, lysozyme,CD64, GCSFR, C/EBP-ALPHA, and PU.1 was markedly increased(p<0.05) from 1.00 to 12.26 (±0.07), 7.19 (±0.16), 1.92 (±0.02),4.77 (±0.12), 1.31(±0.02), and 1.18 (±0.04), respectively. There wasno expression for C/EBP-BETA, C/EBP E, or CD16 (Figure 4). Themyeloid differentiation was characterized by downregulation ofmyeloperoxidase (MPO), a major protein expressed in myeloidcells. We assessed the mRNA level of MPO by RT-PCR after 48 hof treatment. The BM-MSCs, like ATRA, tended to decrease theMPO transcription (Figure 4).DiscussionMSCs can support hematopoiesis by producing soluble factor(s)and also by the expression of cell adhesion molecules that areimportant for cell-to-cell interaction [15]. MSCs have been thesubject of particular interest in recent years due their greatpotential for treating various diseases, especially those relatedto immune system disorders. However, there are controversialopinions on the role of MSCs in malignancies [16,17,18,19].In recent years, several groups investigated the possible role of MSCsin influencing the behavior of tumor cells [20,21]. These studiesFigure 2. BM-MSCs induced the granulocytic differentiationof HL-60 cells after 48 h of incubation and showed an additiveeffect with all-trans-retinoic acid (ATRA). The differentiationof the HL-60 cells was assessed by Wright-Giemsa staining:a) untreated HL-60 cells, b) HL-60 cells treated with ATRA, c) HL-60 cells treated with bone marrow mesenchymal stem cells, d)HL-60 cells treated with ATRA and BM-MSCs. Magnitude: 100 x .Figure 3. The flow cytometric analysis of CD11b, a granulocyticdifferentiation marker, after 48 h: a) untreated HL-60 cells, b) HL-60 cells treated with BM-MSCs, c) HL-60 cells co-cultured withall-trans-retinoic acid (ATRA), d) HL-60 cells treated with BM-MSCs and ATRA. BM-MSCs and ATRA synergistically upregulatedCD11b expression in cells treated with the combination of thetwo. The experiments were done in triplicate.45
Page 1:
Volume 35 Issue 1 March 2018 80 TLI
Page 4 and 5:
Contact InformationEditorial Corres
Page 6 and 7: TURKISH JOURNAL OF HEMATOLOGYINSTRU
Page 8 and 9: subject may be posited. Do not publ
Page 10 and 11: the questions. You may copy and pas
Page 12 and 13: Images in Hematology71 Ascites in t
Page 14 and 15: Gamaletsou MN, et al: Antifungal-Re
Page 24 and 25: RESEARCH ARTICLEDOI: 10.4274/tjh.20
Page 26 and 27: Aydınok Y, et al: A National Regis
Page 32 and 33: Genitsari S, et al: MSCs in Childho
Page 40 and 41: Tüfekçi Ö, et al: Juvenile Myelo
Page 48 and 49: Vural S, et al: Transformation of M
Page 58 and 59: Nikkhah H, et al: BM-MSCs’ Effect
Page 60 and 61: Nikkhah H, et al: BM-MSCs’ Effect
Page 62 and 63: Kumar D, et al: NPM1 Mutation Analy
Page 64 and 65: Kumar D, et al: NPM1 Mutation Analy
Page 68 and 69: Özen M, et al: ABO Blood Group and
Page 74 and 75: Abur Ü, et al: CLLU1 Expression an
Page 76 and 77: Abur Ü, et al: CLLU1 Expression an
Page 78 and 79: BRIEF REPORTDOI: 10.4274/tjh.2017.0
Page 80 and 81: Annayev A, et al: Kidney Functions
Page 82 and 83: Annayev A, et al: Kidney Functions
Page 84 and 85: Debski J, et al: Plasma Cell Myelom
Page 86 and 87: Singh C, et al: Pachymeningeal Invo
Page 88 and 89: LETTERS TO THE EDITORTurk J Hematol
Page 106:
Advisory Board of This Issue (March
show all

Turkish Journal of Hematology Volume: 35 - Issue: 1

Create successful ePaper yourself

Delete template?

Save as template?