TJH-2018-1-baski

Volume 35 Issue 1 March 2018 80 TL

ISSN 1300-7777

Review

Invasive Fungal Infections in Patients with Hematological Malignancies: Emergence of Resistant Pathogens and

New Antifungal Therapies

Maria N. Gamaletsou, et al.; Leeds, United Kingdom; New York, USA; Athens, Greece

Research Articles

A National Registry of Thalassemia in Turkey: Demographic and Disease Characteristics of Patients, Achievements,

and Challenges in Prevention

Yeşim Aydınok, et al.; Hemoglobinopathy Study Group, Turkey

Biological Features of Bone Marrow Mesenchymal Stromal Cells in Childhood Acute Lymphoblastic Leukemia

Stella Genitsari, et al.; Crete, Athens, Greece

Juvenile Myelomonocytic Leukemia in Turkey: A Retrospective Analysis of Sixty-five Patients

Özlem Tüfekçi, et al.; İzmir, Ankara, Samsun, Kayseri, İstanbul, Kocaeli, Antalya, Konya, Bursa, Trabzon, Turkey

Transformation of Mycosis Fungoides/Sezary Syndrome: Clinical Characteristics and Prognosis

Seçil Vural, et al.; Ankara, Turkey

The Effect of Bone Marrow Mesenchymal Stem Cells on the Granulocytic Differentiation of HL-60 Cells

Hossein Nikkhah, et al.; Tabriz, Sari, Iran; Minnesota, USA

NPM1 Mutation Analysis in Acute Myeloid Leukemia: Comparison of Three Techniques – Sanger Sequencing,

Pyrosequencing, and Real-Time Polymerase Chain Reaction

Dushyant Kumar, et al.; Guwahati, New Delhi, India

Incomplete Antibodies May Reduce ABO Cross-Match Incompatibility: A Pilot Study

Mehmet Özen, et al.; Ankara, Turkey

Cover Picture:

Jakub Debski et al.

Ascites in the Course of

Plasma Cell Myeloma

Complicated by AL Amyloidosis

1

Editor-in-Chief

Reyhan Küçükkaya

İstanbul, Turkey

rkucukkaya@hotmail.com

Associate Editors

Ayşegül Ünüvar

İstanbul, Turkey

aysegulu@hotmail.com

Cengiz Beyan

TOBB University of Economics and Technology,

Ankara, Turkey

cengizbeyan@hotmail.com

Hale Ören

Dokuz Eylül University, İzmir, Turkey

hale.oren@deu.edu.tr

İbrahim C. Haznedaroğlu

Hacettepe University, Ankara, Turkey

haznedar@yahoo.com

M. Cem Ar

İstanbul University Cerrahpaşa Faculty of

Medicine, İstanbul, Turkey

mcemar68@yahoo.com

Selami Koçak Toprak

Ankara University, Ankara, Turkey

sktoprak@yahoo.com

Semra Paydaş

Çukurova University, Adana, Turkey

sepay@cu.edu.tr

Assistant Editors

A. Emre Eşkazan

İstanbul University Cerrahpaşa Faculty of

Medicine, İstanbul, Turkey

Ali İrfan Emre Tekgündüz

Dr. A. Yurtaslan Ankara Oncology Training and

Research Hospital, Ankara, Turkey

Claudio Cerchione

University of Naples Federico II Napoli,

Campania, Italy

Elif Ünal İnce

Ankara University, Ankara, Turkey

İnci Alacacıoğlu

Dokuz Eylül University, İzmir, Turkey

Müge Sayitoğlu

İstanbul University, İstanbul, Turkey

Nil Güler

Ondokuz Mayıs University, Samsun, Turkey

Olga Meltem Akay

Koç University, İstanbul, Turkey

Şule Ünal


Veysel Sabri Hançer

İstinye University, İstanbul, Turkey

Zühre Kaya

Gazi University, Ankara, Turkey

International Review Board

Nejat Akar

Görgün Akpek

Serhan Alkan

Çiğdem Altay

Koen van Besien

Ayhan Çavdar

M. Sıraç Dilber

Ahmet Doğan

Peter Dreger

Thierry Facon

Jawed Fareed

Gösta Gahrton

Dieter Hoelzer

Marilyn Manco-Johnson

Andreas Josting

Emin Kansu

Winfried Kern

Nigel Key

Korgün Koral

Abdullah Kutlar

Luca Malcovati

Robert Marcus

Jean Pierre Marie

Ghulam Mufti

Gerassimos A. Pangalis

Antonio Piga

Ananda Prasad

Jacob M. Rowe

Jens-Ulrich Rüffer

Norbert Schmitz

Orhan Sezer

Anna Sureda

Ayalew Tefferi

Nükhet Tüzüner

Catherine Verfaillie

Srdan Verstovsek

Claudio Viscoli

Past Editors

Erich Frank

Orhan Ulutin

Hamdi Akan

Aytemiz Gürgey

Senior Advisory Board

Yücel Tangün

Osman İlhan

Muhit Özcan

Teoman Soysal

Ahmet Muzaffer Demir

TOBB Economy Technical University Hospital, Ankara, Turkey

Maryland School of Medicine, Baltimore, USA

Cedars-Sinai Medical Center, USA

Ankara, Turkey

Chicago Medical Center University, Chicago, USA

Ankara, Turkey

Karolinska University, Stockholm, Sweden

Mayo Clinic Saint Marys Hospital, USA

Heidelberg University, Heidelberg, Germany

Lille University, Lille, France

Loyola University, Maywood, USA

Karolinska University Hospital, Stockholm, Sweden

Frankfurt University, Frankfurt, Germany

Colorado Health Sciences University, USA

University Hospital Cologne, Cologne, Germany


Albert Ludwigs University, Germany

University of North Carolina School of Medicine, NC, USA

Southwestern Medical Center, Texas, USA

Georgia Health Sciences University, Augusta, USA

Pavia Medical School University, Pavia, Italy

Kings College Hospital, London, UK

Pierre et Marie Curie University, Paris, France

King’s Hospital, London, UK

Athens University, Athens, Greece

Torino University, Torino, Italy

Wayne State University School of Medicine, Detroit, USA

Rambam Medical Center, Haifa, Israel

University of Köln, Germany

AK St Georg, Hamburg, Germany

Memorial Şişli Hospital, İstanbul, Turkey

Santa Creu i Sant Pau Hospital, Barcelona, Spain

Mayo Clinic, Rochester, Minnesota, USA

İstanbul Cerrahpaşa University, İstanbul, Turkey

University of Minnesota, Minnesota, USA

The University of Texas MD Anderson Cancer Center, Houston, USA

San Martino University, Genoa, Italy

Language Editor

Leslie Demir

Statistic Editor

Hülya Ellidokuz

Editorial Office

İpek Durusu

Bengü Timoçin

A-I

Publishing

Services

GALENOS PUBLISHER

Molla Gürani Mah. Kaçamak Sk. No: 21/1, Fındıkzade, İstanbul, Turkey

Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr

Contact Information

Editorial Correspondence should be addressed to Dr. Reyhan Küçükkaya

E-mail : rkucukkaya@hotmail.com

All Inquiries Should be Addressed to

TURKISH JOURNAL OF HEMATOLOGY

Address : Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.) No: 8 06550 Çankaya, Ankara / Turkey

Phone : +90 312 490 98 97

Fax : +90 312 490 98 68

E-mail : info@tjh.com.tr

ISSN: 1300-7777

Publishing Manager

Sorumlu Yazı İşleri Müdürü

Muhlis Cem Ar

Management Address

Yayın İdare Adresi

Türk Hematoloji Derneği

Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.)

No: 8 06550 Çankaya, Ankara / Turkey

Online Manuscript Submission

http://mc.manuscriptcentral.com/tjh

Web page

www.tjh.com.tr

Owner on behalf of the Turkish Society of Hematology

Türk Hematoloji Derneği adına yayın sahibi

Güner Hayri Özsan

International scientific journal published quarterly.

Üç ayda bir yayımlanan İngilizce süreli yayındır.

Publishing House / Yayınevi

Molla Gürani Mah. Kaçamak Sk. No: 21, 34093

Fındıkzade, İstanbul, Turkey

Tel: +90 212 621 99 25 Fax: +90 212 621 99 27

E-mail: info@galenos.com.tr

Print: Özgün Ofset Ticaret Ltd. Şti.

Yeşilce Mah. Aytekin Sok. No: 21 34418 4. Levent, İstanbul-Turkey

Phone: +90 212 280 0009

Printing Date / Basım Tarihi

25.02.2018

Cover Picture

Jakub Debski et al.,

Ascites in the Course of Plasma Cell Myeloma Complicated by AL Amyloidosis

Microscopic evaluation of plasmacytes and plasmablasts in an ascitic fluid

smear (modified Wright-Giemsa stain, 400 x ).

Türk Hematoloji Derneği, 07.10.2008 tarihli ve 6 no’lu kararı ile Turkish

Journal of Hematology’nin Türk Hematoloji Derneği İktisadi İşletmesi

tarafından yayınlanmasına karar vermiştir.

A-II

AIMS AND SCOPE

The Turkish Journal of Hematology is published quarterly (March, June,

September, and December) by the Turkish Society of Hematology. It is an

independent, non-profit peer-reviewed international English-language

periodical encompassing subjects relevant to hematology.

The Editorial Board of The Turkish Journal of Hematology adheres to

the principles of the World Association of Medical Editors (WAME),

International Council of Medical Journal Editors (ICMJE), Committee on

Publication Ethics (COPE), Consolidated Standards of Reporting Trials

(CONSORT) and Strengthening the Reporting of Observational Studies in

Epidemiology (STROBE).

The aim of The Turkish Journal of Hematology is to publish original

hematological research of the highest scientific quality and clinical

relevance. Additionally, educational material, reviews on basic

developments, editorial short notes, images in hematology, and letters

from hematology specialists and clinicians covering their experience and

comments on hematology and related medical fields as well as social

subjects are published. As of December 2015, The Turkish Journal of

Hematology does not accept case reports. Important new findings or data

about interesting hematological cases may be submitted as a brief report.

General practitioners interested in hematology and internal medicine

specialists are among our target audience, and The Turkish Journal of

Hematology aims to publish according to their needs. The Turkish Journal

of Hematology is indexed, as follows:

- PubMed Medline

- PubMed Central

- Science Citation Index Expanded

- EMBASE

- Scopus

- CINAHL

- Gale/Cengage Learning

- EBSCO

- DOAJ

- ProQuest

- Index Copernicus

- Tübitak/Ulakbim Turkish Medical Database

- Turk Medline

Impact Factor: 0.686

Open Access Policy

Turkish Journal of Hematology is an Open Access journal. This journal

provides immediate open access to its content on the principle that

making research freely available to the public supports a greater global

exchange of knowledge.

Open Access Policy is based on the rules of the Budapest Open Access

Initiative (BOAI) http://www.budapestopenaccessinitiative.org/.

Subscription Information

The Turkish Journal of Hematology is sent free-of-charge to members

of Turkish Society of Hematology and libraries in Turkey and abroad.

Hematologists, other medical specialists that are interested in hematology,

and academicians could subscribe for only 40 $ per printed issue. All

published volumes are available in full text free-of-charge online at www.

tjh.com.tr.

Address: İlkbahar Mah., Turan Güneş Bulvarı, 613 Sok., No: 8, Çankaya,

Ankara, Turkey

Telephone: +90 312 490 98 97

Fax: +90 312 490 98 68

Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh

Web page: www.tjh.com.tr

E-mail: info@tjh.com.tr

Permissions

Requests for permission to reproduce published material should be sent to

the editorial office.

Editor: Professor Dr. Reyhan Küçükkaya

Adress: İlkbahar Mah, Turan Günes Bulvarı, 613 Sok., No: 8, Çankaya,

Ankara, Turkey

Telephone: +90 312 490 98 97

Fax: +90 312 490 98 68

Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh

Web page: www.tjh.com.tr

E-mail: info@tjh.com.tr

Publisher

Galenos Yayınevi

Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul, Turkey

Telephone : +90 212 621 99 25

Fax : +90 212 621 99 27

info@galenos.com.tr

Instructions for Authors

Instructions for authors are published in the journal and at www.tjh.com.tr

Material Disclaimer

Authors are responsible for the manuscripts they publish in The Turkish

Journal of Hematology. The editor, editorial board, and publisher do not

accept any responsibility for published manuscripts.

If you use a table or figure (or some data in a table or figure) from another

source, cite the source directly in the figure or table legend.

The journal is printed on acid-free paper.

Editorial Policy

Following receipt of each manuscript, a checklist is completed by the

Editorial Assistant. The Editorial Assistant checks that each manuscript

contains all required components and adheres to the author guidelines,

after which time it will be forwarded to the Editor in Chief. Following the

Editor in Chief’s evaluation, each manuscript is forwarded to the Associate

Editor, who in turn assigns reviewers. Generally, all manuscripts will be

reviewed by at least three reviewers selected by the Associate Editor, based

on their relevant expertise. Associate editor could be assigned as a reviewer

along with the reviewers. After the reviewing process, all manuscripts are

evaluated in the Editorial Board Meeting.

Turkish Journal of Hematology’s editor and Editorial Board members are

active researchers. It is possible that they would desire to submit their

manuscript to the Turkish Journal of Hematology. This may be creating

a conflict of interest. These manuscripts will not be evaluated by the

submitting editor(s). The review process will be managed and decisions

made by editor-in-chief who will act independently. In some situation, this

process will be overseen by an outside independent expert in reviewing

submissions from editors.

A-III

TURKISH JOURNAL OF HEMATOLOGY

INSTRUCTIONS FOR AUTHORS

The Turkish Journal of Hematology accepts invited review articles, research

articles, brief reports, letters to the editor, and hematological images that

are relevant to the scope of hematology, on the condition that they have

not been previously published elsewhere. Basic science manuscripts,

such as randomized, cohort, cross-sectional, and case-control studies,

are given preference. All manuscripts are subject to editorial revision

to ensure they conform to the style adopted by the journal. There is a

double-blind reviewing system. Review articles are solicited by the Editorin-Chief.

Authors wishing to submit an unsolicited review article should

contact the Editor-in-Chief prior to submission in order to screen the

proposed topic for relevance and priority.

The Turkish Journal of Hematology does not charge any article submission

or processing charges.

Manuscripts should be prepared according to ICMJE guidelines (http://

www.icmje.org/). Original manuscripts require a structured abstract. Label

each section of the structured abstract with the appropriate subheading

(Objective, Materials and Methods, Results, and Conclusion). Letters to

the editor do not require an abstract. Research or project support should

be acknowledged as a footnote on the title page. Technical and other

assistance should be provided on the title page.

Original Manuscripts

Title Page

Title: The title should provide important information regarding the

manuscript’s content. The title must specify that the study is a cohort

study, cross-sectional study, case-control study, or randomized study (i.e.

Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability

of ferrous succinate tablet formulations without correction for baseline

circadian changes in iron concentration in healthy Chinese male

subjects: A single-dose, randomized, 2-period crossover study. Clin Ther

2011;33:2054-2059).

The title page should include the authors’ names, degrees, and institutional/

professional affiliations and a short title, abbreviations, keywords, financial

disclosure statement, and conflict of interest statement. If a manuscript

includes authors from more than one institution, each author’s name

should be followed by a superscript number that corresponds to their

institution, which is listed separately. Please provide contact information

for the corresponding author, including name, e-mail address, and

telephone and fax numbers.

Running Head: The running head should not be more than 40 characters,

including spaces, and should be located at the bottom of the title page.

Word Count: A word count for the manuscript, excluding abstract,

acknowledgments, figure and table legends, and references, should be

provided and should not exceed 2500 words. The word count for the

abstract should not exceed 300 words.

Conflict of Interest Statement: To prevent potential conflicts of

interest from being overlooked, this statement must be included in each

manuscript. In case there are conflicts of interest, every author should

complete the ICMJE general declaration form, which can be obtained at

http://www.icmje.org/downloads/coi_disclosure.zip

Abstract and Keywords: The second page should include an abstract

that does not exceed 300 words. For manuscripts sent by authors in

Turkey, a title and abstract in Turkish are also required. As most readers

read the abstract first, it is critically important. Moreover, as various

electronic databases integrate only abstracts into their index, important

findings should be presented in the abstract.

Objective: The abstract should state the objective (the purpose of the

study and hypothesis) and summarize the rationale for the study.

Materials and Methods: Important methods should be written

respectively.

Results: Important findings and results should be provided here.

Conclusion: The study’s new and important findings should be

highlighted and interpreted.

Other types of manuscripts, such as reviews, brief reports, and

editorials, will be published according to uniform requirements.

Provide 3-10 keywords below the abstract to assist indexers. Use

terms from the Index Medicus Medical Subject Headings List

(for randomized studies a CONSORT abstract should be provided: http://

www.consort-statement.org).

Introduction: The introduction should include an overview of the

relevant literature presented in summary form (one page), and whatever

remains interesting, unique, problematic, relevant, or unknown about

the topic must be specified. The introduction should conclude with the

rationale for the study, its design, and its objective(s).

Materials and Methods: Clearly describe the selection of observational

or experimental participants, such as patients, laboratory animals, and

controls, including inclusion and exclusion criteria and a description of the

source population. Identify the methods and procedures in sufficient detail

to allow other researchers to reproduce your results. Provide references

to established methods (including statistical methods), provide references

to brief modified methods, and provide the rationale for using them and

an evaluation of their limitations. Identify all drugs and chemicals used,

including generic names, doses, and routes of administration. The section

should include only information that was available at the time the plan

or protocol for the study was devised (https://www.strobe-statement.org/

fileadmin/Strobe/uploads/checklists/STROBE_checklist_v4_combined.

pdf).

Statistics: Describe the statistical methods used in enough detail to

enable a knowledgeable reader with access to the original data to verify

A-IV

the reported results. Statistically important data should be given in the

text, tables, and figures. Provide details about randomization, describe

treatment complications, provide the number of observations, and specify

all computer programs used.

Results: Present your results in logical sequence in the text, tables, and

figures. Do not present all the data provided in the tables and/or figures

in the text; emphasize and/or summarize only important findings, results,

and observations in the text. For clinical studies provide the number of

samples, cases, and controls included in the study. Discrepancies between

the planned number and obtained number of participants should be

explained. Comparisons and statistically important values (i.e. p-value

and confidence interval) should be provided.

Discussion: This section should include a discussion of the data. New and

important findings/results and the conclusions they lead to should be

emphasized. Link the conclusions with the goals of the study, but avoid

unqualified statements and conclusions not completely supported by

the data. Do not repeat the findings/results in detail; important findings/

results should be compared with those of similar studies in the literature,

along with a summarization. In other words, similarities or differences in

the obtained findings/results with those previously reported should be

discussed.

Study Limitations: Limitations of the study should be detailed. In

addition, an evaluation of the implications of the obtained findings/

results for future research should be outlined.

Conclusion: The conclusion of the study should be highlighted.

References

Cite references in the text, tables, and figures with numbers in square

brackets. Number references consecutively according to the order in

which they first appear in the text. Journal titles should be abbreviated

according to the style used in Index Medicus (consult List of Journals

Indexed in Index Medicus). Include among the references any paper

accepted, but not yet published, designating the journal followed by “in

press”.

Examples of References:

1. List all authors

Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for marrow

transplantation from unrelated donors for patients with aplastic anemia

after failure of immunosuppressive therapy. Blood 2006;108:1485-1491.

2. Organization as author

Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of

syngeneic bone marrow graft without preconditioning in post-hepatitis

marrow aplasia. Lancet 1977;2:742-744.

3. Book

Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger,

1961.

4. Book Chapter

Perutz MF. Molecular anatomy and physiology of hemoglobin. In:

Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin:

Genetics, Pathophysiology, Clinical Management. New York, Cambridge

University Press, 2000.

5. Abstract

Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin)

stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract).

6. Letter to the Editor

Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further

definition of 20q deletion in myeloid leukemia using fluorescence in situ

hybridization. Blood 1994;84:2821-2823.

7. Supplement

Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr Transplant

2005;9(Suppl 7):81-86.

Brief Reports

Abstract length: Not to exceed 150 words.

Article length: Not to exceed 1200 words.

Introduction: State the purpose and summarize the rationale for the study.

Materials and Methods: Clearly describe the selection of the observational

or experimental participants. Identify the methods and procedures in

sufficient detail. Provide references to established methods (including

statistical methods), provide references to brief modified methods, and

provide the rationale for their use and an evaluation of their limitations.

Identify all drugs and chemicals used, including generic names, doses, and

routes of administration.

Statistics: Describe the statistical methods used in enough detail to

enable a knowledgeable reader with access to the original data to verify

the reported findings/results. Provide details about randomization,

describe treatment complications, provide the number of observations,

and specify all computer programs used.

Results: Present the findings/results in a logical sequence in the text,

tables, and figures. Do not repeat all the findings/results in the tables and

figures in the text; emphasize and/or summarize only those that are most

important.

Discussion: Highlight the new and important findings/results of the

study and the conclusions they lead to. Link the conclusions with the

goals of the study, but avoid unqualified statements and conclusions not

completely supported by your data.

Invited Review Articles

Abstract length: Not to exceed 300 words.


Review articles should not include more than 100 references. Reviews

should include a conclusion, in which a new hypothesis or study about the

A-V

subject may be posited. Do not publish methods for literature search or

level of evidence. Authors who will prepare review articles should already

have published research articles on the relevant subject. The study’s new

and important findings should be highlighted and interpreted in the

Conclusion section. There should be a maximum of two authors for review

articles.

Images in Hematology


Authors can submit for consideration illustrations or photos that are

interesting, instructive, and visually attractive, along with a few lines of

explanatory text and references. Images in Hematology can include no

more than 200 words of text, 5 references, and 3 figures or tables. No

abstract, discussion, or conclusion is required, but please include a brief

title.

Letters to the Editor


Letters can include no more than 500 words of text, 5-10 references, and

1 figure or table. No abstract is required, but please include a brief title.

Tables

Supply each table in a separate file. Number tables according to the order

in which they appear in the text, and supply a brief caption for each.

Give each column a short or abbreviated heading. Write explanatory

statistical measures of variation, such as standard deviation or standard

error of mean. Be sure that each table is cited in the text.

Figures

Figures should be professionally drawn and/or photographed. Authors

should number figures according to the order in which they appear in the

text. Figures include graphs, charts, photographs, and illustrations. Each

figure should be accompanied by a legend that does not exceed 50 words.

Use abbreviations only if they have been introduced in the text. Authors

are also required to provide the level of magnification for histological

slides. Explain the internal scale and identify the staining method used.

Figures should be submitted as separate files, not in the text file. Highresolution

image files are not preferred for initial submission as the file

sizes may be too large. The total file size of the PDF for peer review should

not exceed 5 MB.

Authorship

Each author should have participated sufficiently in the work to assume

public responsibility for the content. Any portion of a manuscript that

is critical to its main conclusions must be the responsibility of at least

one author.

Contributor’s Statement

All submissions should contain a contributor’s statement page. Each

statement should contain substantial contributions to idea and design,

acquisition of data, and analysis and interpretation of findings. All

persons designated as an author should qualify for authorship, and all

those that qualify should be listed. Each author should have participated

sufficiently in the work to take responsibility for appropriate portions of

the text.

Acknowledgments

Acknowledge support received from individuals, organizations, grants,

corporations, and any other source. For work involving a biomedical

product or potential product partially or wholly supported by corporate

funding, a note stating, “This study was financially supported (in part)

with funds provided by (company name) to (authors’ initials)”, must

be included. Grant support, if received, needs to be stated and the

specific granting institutions’ names and grant numbers provided when

applicable.

Authors are expected to disclose on the title page any commercial or

other associations that might pose a conflict of interest in connection

with the submitted manuscript. All funding sources that supported the

work and the institutional and/or corporate affiliations of the authors

should be acknowledged on the title page.

Ethics

When reporting experiments conducted with humans indicate that

the procedures were in accordance with ethical standards set forth

by the committee that oversees human subject research. Approval of

research protocols by the relevant ethics committee, in accordance

with international agreements (Helsinki Declaration of 1975, revised

2013 available at https://www.wma.net/policies-post/wma-declarationof-helsinki-ethical-principles-for-medical-research-involving-humansubjects/),

is required for all experimental, clinical, and drug studies.

Patient names, initials, and hospital identification numbers should not

be used. Manuscripts reporting the results of experimental investigations

conducted with humans must state that the study protocol received

institutional review board approval and that the participants provided

informed consent.

Non-compliance with scientific accuracy is not in accord with scientific

ethics. Plagiarism: To re-publish, in whole or in part, the contents of

another author’s publication as one’s own without providing a reference.

Fabrication: To publish data and findings/results that do not exist.

Duplication: Use of data from another publication, which includes republishing

a manuscript in different languages. Salami slicing: To create

more than one publication by dividing the results of a study unnecessarily.

We disapprove of such unethical practices as plagiarism, fabrication,

duplication, and salami slicing, as well as efforts to influence the

review process with such practices as gifting authorship, inappropriate

acknowledgments, and references. Additionally, authors must respect

participants‘ right to privacy.

On the other hand, short abstracts published in congress books that do

not exceed 400 words and present data of preliminary research, and

A-VI

those that are presented in an electronic environment, are not considered

as previously published work. Authors in such a situation must declare

this status on the first page of the manuscript and in the cover letter.

(The COPE flowchart is available at http://publicationethics.org.)

We use iThenticate to screen all submissions for plagiarism before

publication.

Conditions of Publication

All authors are required to affirm the following statements before their

manuscript is considered: 1. The manuscript is being submitted only

to The Turkish Journal of Hematology; 2. The manuscript will not be

submitted elsewhere while under consideration by The Turkish Journal

of Hematology; 3. The manuscript has not been published elsewhere,

and should it be published in The Turkish Journal of Hematology it will

not be published elsewhere without the permission of the editors (these

restrictions do not apply to abstracts or to press reports for presentations

at scientific meetings); 4. All authors are responsible for the manuscript’s

content; 5. All authors participated in the study concept and design,

analysis and interpretation of the data, and drafting or revising of the

manuscript and have approved the manuscript as submitted. In addition,

all authors are required to disclose any professional affiliation, financial

agreement, or other involvement with any company whose product

figures prominently in the submitted manuscript.

Authors of accepted manuscripts will receive electronic page proofs and

are responsible for proofreading and checking the entire article within

two days. Failure to return the proof in two days will delay publication. If

the authors cannot be reached by email or telephone within two weeks,

the manuscript will be rejected and will not be published in the journal.

Copyright

At the time of submission all authors will receive instructions for

submitting an online copyright form. No manuscript will be considered

for review until all authors have completed their copyright form. Please

note, it is our practice not to accept copyright forms via fax, e-mail, or

postal service unless there is a problem with the online author accounts

that cannot be resolved. Every effort should be made to use the online

copyright system. Corresponding authors can log in to the submission

system at any time to check the status of any co-author’s copyright form.

All accepted manuscripts become the permanent property of The Turkish

Journal of Hematology and may not be published elsewhere, in whole or

in part, without written permission.

Note: We cannot accept any copyright form that has been altered,

revised, amended, or otherwise changed. Our original copyright form

must be used as is.

Units of Measurement

Measurements should be reported using the metric system, according

to the International System of Units (SI). Consult the SI Unit Conversion

Guide, New England Journal of Medicine Books, 1992.

An extensive list of conversion factors can be found at https://www.

nist.gov/sites/default/files/documents/pml/wmd/metric/SP1038.pdf. For

more details, see http://www.amamanualofstyle.com/oso/public/jama/

si_conversion_table.html.

Abbreviations and Symbols

Use only standard abbreviations. Avoid abbreviations in the title and

abstract. The full term for an abbreviation should precede its first use

in the text, unless it is a standard abbreviation. All acronyms used in the

text should be expanded at first mention, followed by the abbreviation

in parentheses; thereafter the acronym only should appear in the text.

Acronyms may be used in the abstract if they occur 3 or more times

therein, but must be reintroduced in the body of the text. Generally,

abbreviations should be limited to those defined in the AMA Manual of

Style, current edition. A list of each abbreviation (and the corresponding

full term) used in the manuscript must be provided on the title page.

Online Manuscript Submission Process

The Turkish Journal of Hematology uses submission software powered

by ScholarOne Manuscripts. The website for submissions to The Turkish

Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This

system is quick and convenient, both for authors and reviewers.

Setting Up an Account

New users to the submission site will need to register and enter their

account details before they can submit a manuscript. Log in, or click

the “Create Account” button if you are a first-time user. To create a

new account: After clicking the “Create Account” button, enter your

name and e-mail address, and then click the “Next” button. Your e-mail

address is very important. Enter your institution and address information,

as appropriate, and then click the “Next” Button. Enter a user ID and

password of your choice, select your area of expertise, and then click the

“Finish” button.

If you have an account, but have forgotten your log-in details, go to

“Password Help” on the journal’s online submission system and enter your

e-mail address. The system will send you an automatic user ID and a new

temporary password.

Full instructions and support are available on the site, and a user ID

and password can be obtained during your first visit. Full support for

authors is provided. Each page has a “Get Help Now” icon that connects

directly to the online support system. Contact the journal administrator

with any questions about submitting your manuscript to the journal

(info@tjh.com.tr). For ScholarOne Manuscripts customer support, click

on the “Get Help Now” link on the top right-hand corner of every page

on the site.

The Electronic Submission Process

Log in to your author center. Once you have logged in, click the “Submit a

Manuscript” link in the menu bar. Enter the appropriate data and answer

A-VII

the questions. You may copy and paste directly from your manuscript.

Click the “Next” button on each screen to save your work and advance

to the next screen.

Upload Files

Click on the “Browse” button and locate the file on your computer. Select

the appropriate designation for each file in the drop-down menu next to

the “Browse” button. When you have selected all the files you want to

upload, click the “Upload Files” button. Review your submission before

sending to the journal. Click the “Submit” button when you are finished

reviewing. You can use ScholarOne Manuscripts at any time to check

the status of your submission. The journal’s editorial office will inform

you by e-mail once a decision has been made. After your manuscript

has been submitted, a checklist will then be completed by the Editorial

Assistant. The Editorial Assistant will check that the manuscript contains

all required components and adheres to the author guidelines. Once the

Editorial Assistant is satisfied with the manuscript it will be forwarded to

the Senior Editor, who will assign an editor and reviewers.

The Review Processs

Each manuscript submitted to The Turkish Journal of Hematology is

subject to an initial review by the editorial office in order to determine

if it is aligned with the journal’s aims and scope and complies with

essential requirements. Manuscripts sent for peer review will be assigned

to one of the journal’s associate editors that has expertise relevant to the

manuscript’s content. All accepted manuscripts are sent to a statistical

and English language editor before publishing. Once papers have been

reviewed, the reviewers’ comments are sent to the Editor, who will then

make a preliminary decision on the paper. At this stage, based on the

feedback from reviewers, manuscripts can be accepted or rejected, or

revisions can be recommended. Following initial peer-review, articles

judged worthy of further consideration often require revision. Revised

manuscripts generally must be received within 3 months of the date of

the initial decision. Extensions must be requested from the Associate

Editor at least 2 weeks before the 3-month revision deadline expires;

The Turkish Journal of Hematology will reject manuscripts that are not

received within the 3-month revision deadline. Manuscripts with extensive

revision recommendations will be sent for further review (usually by the

same reviewers) upon their re-submission. When a manuscript is finally

accepted for publication, the Technical Editor undertakes a final edit

and a marked-up copy will be e-mailed to the corresponding author for

review and any final adjustments.

Submission of Revised Papers

When revising a manuscript based on the reviewers’ and Editor’s feedback,

please insert all changed text in red. Please do not use track changes, as

this feature can make reading difficult. To submit revised manuscripts,

please log in to your author center at ScholarOne Manuscripts. Your

manuscript will be stored under “Manuscripts with Decisions”. Please click

on the “Create a Revision” link located to the right of the manuscript title.

A revised manuscript number will be created for you; you will then need

to click on the “Continue Submission” button. You will then be guided

through a submission process very similar to that for new manuscripts.

You will be able to amend any details you wish. At stage 6 (“File Upload”),

please delete the file for your original manuscript and upload the revised

version. Additionally, please upload an anonymous cover letter, preferably

in table format, including a point-by-point response to the reviews’

revision recommendations. You will then need to review your paper as

a PDF and click the “Submit” button. Your revised manuscript will have

the same ID number as the original version, but with the addition of an R

and a number at the end, for example, TJH-2011-0001 for an original and

TJH-2011-0001.R1, indicating a first revision; subsequent revisions will

end with R2, R3, and so on. Please do not submit a revised manuscript

as a new paper, as revised manuscripts are processed differently. If you

click on the “Create a Revision” button and receive a message stating that

the revision option has expired, please contact the Editorial Assistant at

info@tjh.com.tr to reactivate the option.

English Language and Statistical Editing

All manuscripts are professionally edited by an English language editor

prior to publication. After papers have been accepted for publication,

manuscript files are forwarded to the statistical and English language

editors before publishing. Editors will make changes to the manuscript to

ensure it adheres to TJH requirements. Significant changes or concerns

are referred to corresponding authors for editing.

Online Early

The Turkish Journal of Hematology publishes abstracts of accepted

manuscripts online in advance of their publication in print. Once an

accepted manuscript has been edited, the authors have submitted any

final corrections, and all changes have been incorporated, the manuscript

will be published online. At that time the manuscript will receive a Digital

Object Identifier (DOI) number. Both forms can be found at www.tjh.

com.tr. Authors of accepted manuscripts will receive electronic page

proofs directly from the printer and are responsible for proofreading

and checking the entire manuscript, including tables, figures, and

references. Page proofs must be returned within 48 hours to avoid delays

in publication.

A-VIII

CONTENTS

Review

1 Invasive Fungal Infections in Patients with Hematological Malignancies: Emergence of Resistant Pathogens and New Antifungal Therapies

Maria N. Gamaletsou, Thomas J. Walsh, Nikolaos V. Sipsas; Leeds, United Kingdom; New York, USA; Athens, Greece

Research Articles

12 A National Registry of Thalassemia in Turkey: Demographic and Disease Characteristics of Patients, Achievements, and Challenges in Prevention

Yeşim Aydınok, Yeşim Oymak, Berna Atabay, Gönül Aydoğan, Akif Yeşilipek, Selma Ünal, Yurdanur Kılınç, Banu Oflaz, Mehmet Akın,

Canan Vergin, Melike Sezgin Evim, Ümran Çalışkan, Şule Ünal, Ali Bay, Elif Kazancı, Talia İleri, Didem Atay, Türkan Patıroğlu, Selda Kahraman,

Murat Söker, Mediha Akcan, Aydan Akdeniz, Mustafa Büyükavcı, Güçhan Alanoğlu, Özcan Bör, Nur Soyer, Nihal Özdemir Karadaş,

Ezgi Uysalol, Meral Türker, Arzu Akçay, Süheyla Ocak, Adalet Meral Güneş, Hüseyin Tokgöz, Elif Ünal, Naci Tiftik, Zeynep Karakaş;

Hemoglobinopathy Study Group, Turkey

19 Biological Features of Bone Marrow Mesenchymal Stromal Cells in Childhood Acute Lymphoblastic Leukemia

Stella Genitsari, Eftichia Stiakaki, Chryssoula Perdikogianni, Georgia Martimianaki, Iordanis Pelagiadis, Margarita Pesmatzoglou,

Maria Kalmanti, Helen Dimitriou; Crete, Athens, Greece

27 Juvenile Myelomonocytic Leukemia in Turkey: A Retrospective Analysis of Sixty-five Patients

Özlem Tüfekçi, Ülker Koçak, Zühre Kaya, İdil Yenicesu, Canan Albayrak, Davut Albayrak, Şebnem Yılmaz Bengoa, Türkan Patıroğlu,

Musa Karakükçü, Ekrem Ünal, Elif Ünal İnce, Talia İleri, Mehmet Ertem, Tiraje Celkan, Gül Nihal Özdemir, Nazan Sarper, Dilek Kaçar,

Neşe Yaralı, Namık Yaşar Özbek, Alphan Küpesiz, Tuba Karapınar, Canan Vergin, Ümran Çalışkan, Hüseyin Tokgöz, Melike Sezgin Evim,

Birol Baytan, Adalet Meral Güneş, Deniz Yılmaz Karapınar, Serap Karaman, Vedat Uygun, Gülsun Karasu, Mehmet Akif Yeşilipek, Ahmet Koç,

Erol Erduran, Berna Atabay, Haldun Öniz, Hale Ören; İzmir, Ankara, Samsun, Kayseri, İstanbul, Kocaeli, Antalya, Konya, Bursa, Trabzon, Turkey

35 Transformation of Mycosis Fungoides/Sezary Syndrome: Clinical Characteristics and Prognosis

Seçil Vural, Bengü Nisa Akay, Ayşenur Botsalı, Erden Atilla, Nehir Parlak, Aylin Okçu Heper, Hatice Şanlı; Ankara, Turkey

42 The Effect of Bone Marrow Mesenchymal Stem Cells on the Granulocytic Differentiation of HL-60 Cells

Hossein Nikkhah, Elham Safarzadeh, Karim Shamsasenjan, Mehdi Yousefi, Parisa Lotfinejad, Mehdi Talebi, Mozhde Mohammadian,

Farhoud Golafshan, Aliakbar Movassaghpour; Tabriz, Sari, Iran; Minnesota, USA

49 NPM1 Mutation Analysis in Acute Myeloid Leukemia: Comparison of Three Techniques - Sanger Sequencing, Pyrosequencing, and

Real-Time Polymerase Chain Reaction

Dushyant Kumar, Anurag Mehta, Manoj Kumar Panigrahi, Sukanta Nath, Kandarpa Kumar Saikia; Guwahati, New Delhi, India

54 Incomplete Antibodies May Reduce ABO Cross-Match Incompatibility: A Pilot Study

Mehmet Özen, Soner Yılmaz, Tülin Özkan, Yeşim Özer, Aliye Aysel Pekel, Asuman Sunguroğlu, Günhan Gürman, Önder Arslan; Ankara, Turkey

Brief Reports

61 Impact of Fluorescent In Situ Hybridization Aberrations and CLLU1 Expression on the Prognosis of Chronic Lymphocytic Leukemia:

Presentation of 156 Patients from Turkey

Ümmet Abur, Gönül Oğur, Ömer Salih Akar, Engin Altundağ, Huri Sema Aymelek, Düzgün Özatlı, Mehmet Turgut; Samsun, Turkey

66 Glomerular and Tubular Functions in Children and Adults with Transfusion-Dependent Thalassemia

Agageldi Annayev, Zeynep Karakaş, Serap Karaman, Altan Yalçıner, Alev Yılmaz, Sevinç Emre; İstanbul, Turkey

A-IX

Images in Hematology

71 Ascites in the Course of Plasma Cell Myeloma Complicated by AL Amyloidosis

Jakub Debski, Lidia Usnarska-Zubkiewicz, Katarzyna Kapelko-Słowik, Aleksander Pawlus, Urszula Zaleska-Dorobisz,

Kazimierz Kuliczkowski; Wroclaw, Poland

73 Pachymeningeal Involvement with Blindness as the Presenting Manifestation of Non-Hodgkin Lymphoma

Charanpreet Singh, Arjun Lakshman, Aditya Jandial, Sudha Sharma, Ram Nampoothiri, Gaurav Prakash, Pankaj Malhotra; Chandigarh, India

Letters to the Editor

75 Leukoagglutination, Mycoplasma pneumoniae Pneumonia, and EDTA Acid Blood

Beuy Joob, Viroj Wiwanitkit; Bangkok, Thailand, Pune, India

77 Cyclic Guanosine Monophosphate-Dependent Protein Kinase I Stimulators and Activators Are Therapeutic Alternatives for Sickle Cell Disease

Mohankrishna Ghanta, Elango Panchanathan, Bhaskar VKS Lakkakula; Tamil Nadu, Chhattisgarh, India

79 Three Factor 11 Mutations Associated with Factor XI Deficiency in a Turkish Family

Veysel Sabri Hançer, Zafer Gökgöz, Murat Büyükdoğan; İstanbul, Ankara, Turkey

81 Participation in Physical and Sportive Activities among Adult Turkish People with Hemophilia: A Single-Center Experience

Arni Lehmeier, Muhlis Cem Ar, Sevil Sadri, Mehmet Yürüyen, Zafer Başlar; İstanbul, Turkey

83 A Lesser Known Side Effect of Tigecycline: Hypofibrinogenemia

Fulya Yılmaz Duran, Halil Yıldırım, Emre Mehmet Şen; İzmir, Turkey

85 Effectiveness of Ankaferd BloodStopper in Prophylaxis and Treatment of Oral Mucositis in Childhood Cancers Evaluated with Plasma Citrulline Levels

Türkan Patıroğlu, Nagihan Erdoğ Şahin, Ekrem Ünal, Mustafa Kendirci, Musa Karakükcü, Mehmet Akif Özdemir; Kayseri, Turkey

87 Late Side Effects of Chemotherapy and Radiotherapy in Early Childhood on the Teeth: Two Case Reports

Sevcihan Günen Yılmaz, İbrahim Şevki Bayrakdar, Seval Bayrak, Yasin Yaşa; Antalya, Eskişehir, Bolu, Ordu, Turkey

89 t(9;19)(q22;p13) in Acute Myelomonocytic Leukemia

Moeinadin Safavi, Akbar Safaei, Marzieh Hosseini; Tehran, Shiraz, Iran

91 Invasive Aspergillosis in Refractory Angioimmunoblastic T-Cell Lymphoma

Prakash NP, Anoop TM, Rakul Nambiar, Jaisankar Puthusseri, Swapna B; Thiruvananthapuram, India

92 Expansion of a Myeloma-associated Lesion from Orbita to the Cerebrum

Sinan Demircioğlu, Demet Aydoğdu, Özcan Çeneli; Konya, Turkey

A-X

REVIEW

DOI: 10.4274/tjh.2018.0007

Turk J Hematol 2018;35:1-11

Invasive Fungal Infections in Patients with Hematological

Malignancies: Emergence of Resistant Pathogens and New

Antifungal Therapies

Hematolojik Kanserleri Olan İnvaziv Mantar Enfeksiyonlu Hastalar: Dirençli Patojenlerin

Ortaya Çıkışı ve Yeni Antifungal Tedaviler

Maria N. Gamaletsou 1 , Thomas J. Walsh 2 , Nikolaos V. Sipsas 3

1

The Leeds Teaching Hospitals NHS Trust, St James University Hospital, Department of Infection and Travel Medicine, Leeds, United Kingdom

2

Weill Cornell Medicine of Cornell University, Department of Medicine, Pediatrics, and Microbiology and Immunology, New York, United States of

America

3

National and Kapodistrian University of Athens Faculty of Medicine, Department of Pathophysiology, Athens, Greece

Abstract

Invasive fungal infections caused by drug-resistant organisms are

an emerging threat to heavily immunosuppressed patients with

hematological malignancies. Modern early antifungal treatment

strategies, such as prophylaxis and empirical and preemptive therapy,

result in long-term exposure to antifungal agents, which is a major

driving force for the development of resistance. The extended

use of central venous catheters, the nonlinear pharmacokinetics

of certain antifungal agents, neutropenia, other forms of intense

immunosuppression, and drug toxicities are other contributing factors.

The widespread use of agricultural and industrial fungicides with

similar chemical structures and mechanisms of action has resulted in

the development of environmental reservoirs for some drug-resistant

fungi, especially azole-resistant Aspergillus species, which have been

reported from four continents. The majority of resistant strains have

the mutation TR34/L98H, a finding suggesting that the source of

resistance is the environment. The global emergence of new fungal

pathogens with inherent resistance, such as Candida auris, is a new

public health threat. The most common mechanism of antifungal drug

resistance is the induction of efflux pumps, which decrease intracellular

drug concentrations. Overexpression, depletion, and alteration of

the drug target are other mechanisms of resistance. Mutations

in the ERG11 gene alter the protein structure of C-demethylase,

reducing the efficacy of antifungal triazoles. Candida species become

echinocandin-resistant by mutations in FKS genes. A shift in the

epidemiology of Candida towards resistant non-albicans Candida spp.

has emerged among patients with hematological malignancies. There

is no definite association between antifungal resistance, as defined by

elevated minimum inhibitory concentrations, and clinical outcomes in

Öz

İlaca dirençli organizmaların neden olduğu invaziv mantar

enfeksiyonları, ağır immün baskılanma altındaki hematolojik kanserli

hastalar için bir tehdittir. Profilaktik, Öz ampirik ve önleyici tedaviler

gibi güncel anti-fungal tedavi yaklaşımları, direnç gelişiminde büyük

bir itici güç olan anti-fungal ajanlara uzun süreli maruz kalma ile

sonuçlanmaktadır. Santral venöz kateterlerin uzun süreli kullanımı,

bazı anti-fungal ajanların doğrusal olmayan farmakokinetiği,

nötropeni, yoğun immün baskılamanın farklı formları ve ilaç

toksisitesi direnç gelişimine katkıda bulunan diğer faktörlerdir. Benzer

kimyasal yapılara ve etki mekanizmalarına sahip, tarımsal ve

endüstriyel fungisitlerin yaygın kullanımı, dört kıtadan bildirilen bazı

ilaca dirençli mantarlar, özellikle azole dayanıklı Aspergillus türleri

için çevresel kaynakların gelişmesine neden olmaktadır. Dirençli

suşların çoğunda bulunan TR34 / L98H mutasyonu, direncin çevresel

kaynaklı olduğunu düşündürmektedir. Candida auris gibi doğal

dirençli yeni fungal patojenlerin ortaya çıkması, yeni bir halk sağlığı

tehdididir. Anti-fungal ilaç direncinin en yaygın mekanizması, hücre

içi ilaç konsantrasyonlarını azaltan hücre dışına atım pompalarının

uyarılmasıdır. Diğer direnç mekanizmaları arasında ilaç hedefinin

aşırı ekspresyonu, tükenmesi ya da değişmesi bulunmaktadır. ERG11

genindeki mutasyonlar, antif-fungal triazollerin etkinliğini azaltarak

C-demetilazın protein yapısını değiştirir. Candida türleri, FKS

genlerindeki mutasyonlarla ekinokandine dirençli hale gelir. Candida

epidemiyolojisinde dirençli albicans-dışı Candida spp. hematolojik

kanseri olan hastalarda ön plana çıkmaktadır. Bu popülasyondaki hasta

grubunda artmış minimum inhibitör konsantrasyonlarla tanımlanan

anti-fungal direnç ile klinik sonuçlar arasında kesin bir ilişki yoktur.

Moleküler yöntemlerin kullanımı ile dirence neden olan genlerin veya

©Copyright 2018 by Turkish Society of Hematology

Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Maria N. GAMALETSOU, M.D.,

Received/Geliş tarihi: January 04, 2018

The Leeds Teaching Hospitals NHS Trust, St James University Hospital, Department of Infection and Travel Medicine, Leeds, United Kingdom Accepted/Kabul tarihi: January 22, 2018

Phone : +44 1132 066 083

E-mail : magama@med.uoa.gr ORCID-ID: orcid.org/0000-0002-0530-3209

1

Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections


this population. Detection of genes or mutations conferring resistance

with the use of molecular methods may offer better predictive values

in certain cases. Treatment options for resistant fungal infections are

limited and new drugs with novel mechanisms of actions are needed.

Prevention of resistance through antifungal stewardship programs is

of paramount importance.

Keywords: Invasive fungal infections, Antifungal resistance,

Hematological malignancies, New antifungal agents

mutasyonların saptanması, bazı olgularda daha iyi klinik ön görü

sağlayabilir. Dirençli fungal enfeksiyonlara yönelik tedavi seçenekleri

sınırlıdır ve yeni mekanizmalara sahip ilaçlara ihtiyaç duyulmaktadır.

Anti-fungal idame programlarıyla direncin önlenmesi büyük önem

taşır.

Anahtar Sözcükler: İnvazif mantar enfeksiyonları, Anti-fungal direnç,

Hematolojik kanserler, Yeni anti-fungal ajanlar

Introduction

Invasive fungal infections (IFIs) are associated with increased

morbidity and unacceptably high mortality among patients

with hematological malignancies (HMs) [1,2]. However,

treatment options are limited, including only four chemical

classes: polyenes, triazoles, echinocandins, and flucytosine. The

expansion of the use of antifungal agents over the last two

decades not unexpectedly contributed to the development

of antifungal resistance [3,4,5]. Another factor driving the

emergence of resistance is the widespread use of agricultural and

industrial fungicides with chemical structures and mechanisms

of action similar to those of human antifungal agents, resulting

in the development of environmental reservoirs for some drugresistant

fungi, especially triazole-resistant Aspergillus species

[6,7]. Recently, researchers showed that even the household

environment may serve as a potential source of triazoleresistant

invasive aspergillosis [8].

Antifungal resistance can be either intrinsic or acquired (Table

1) [9,10,11]. Intrinsic drug resistance can occur naturally

among certain fungi without previous exposure to antifungal

agents, such as fluconazole-resistant Candida krusei [9,12].

The emergence of new fungal species with intrinsic resistance

to some or all antifungal agents is a new threat. The recent

outbreaks of multidrug-resistant Candida auris [13] in many

hematology centers around the world and the increasing

reports of infections caused by panresistant Lomentospora

prolificans [14,15] are characteristic examples.

Acquired or iatrogenic antifungal resistance is favored by

specific risk factors in patients with HMs. Modern early

treatment strategies, such as prophylaxis and empirical and

preemptive therapy, result in long-term exposure to antifungal

agents, which is a major driving force for the development

of resistance [5]. Repeated cycles of chemotherapy and/or

hematopoietic stem cell transplantation (HSCT) prolong even

more the exposure to antifungal agents. Chemotherapyinduced

neutropenia limits the pharmacodynamic response to

antifungal agents and dictates prolonged therapeutic courses.

Indwelling catheters, especially central venous catheters (CVCs),

are a major factor for the development of resistance, as their

surfaces are often infected by pathogenic fungi and the ensuing

biofilm formation does not allow drug penetration, thus

rendering the infection refractory to treatment [16,17,18,19].

Nonlinear pharmacokinetics of certain antifungal agents,

especially certain triazoles, may result in suboptimal antifungal

drug levels, favoring the development of resistance [20,21].

Intraabdominal fungal infections in patients with HMs, such as

intraabdominal abscesses, can promote drug resistance because

antifungal drug delivery in the abdomen is poor and fungi are

exposed to possibly subtherapeutic drug concentrations [22].

The emergence of antifungal drug resistance has tremendous

clinical implications, as it further restricts the already limited

antifungal armamentarium, raising concerns among clinicians

that we are close to the “post-antifungal” era, in parallel to the

“post-antibiotic” era [4,10]. The outlook is similarly grim, as there

is a paucity of new antifungal agents with novel mechanisms of

action in development [23].

The focus of this review will be the emergence of fungal

infections with innate or acquired resistance to antifungal

agents among patients with HMs. We will visit the many

different facets of this complex area, including mechanisms

of resistance, epidemiology, clinical implications, and current

treatment options. Finally, we will review new antifungal agents

in development and the priorities for future research in the field.

Antifungal-Resistant Invasive Aspergillosis

Mechanisms of Resistance

Triazole-Resistant Aspergillus spp.: Triazoles with activity

against Aspergillus spp. (i.e. itraconazole, voriconazole,

posaconazole, and isavuconazole) are recommended for

the treatment of invasive aspergillosis among patients with

HMs. Antifungal triazoles act by inhibiting the cytochrome

P450 enzyme sterol 14α-demethylase, which converts

lanosterol to ergosterol, and is encoded by the gene CYP51 in

filamentous fungi. Inhibition of 14α-demethylase by an azole

results in the interruption of biosynthesis of ergosterol, which

is fungicidal for molds, as it leads to intracellular accumulation

of toxic 14α-methyl sterols and to alterations in cell membrane

structure, impairing its permeability and stability and thus the

2



Table 1. Inherited and acquired resistance reported among pathogenic fungi infecting patients with hematological malignancies.

Fungus Inherent resistance Acquired resistance

Candida spp.

C. albicans

C. parapsilosis

C. tropicalis

C. glabrata

C. krusei

C. lusitaniae

C. guilliermondii

C. auris

Non-Candida yeasts

Trichosporon spp.

Saccharomyces Malassezia spp.

Geotrichum

Rhodotorula

Pichia

Aspergillus spp.

A. fumigatus

A. terreus

A. flavus

A. nidulans

Mucorales

Hyalohyphomycetes

Fusarium solani

Scedosporium spp.

Lomentospora prolificans

Yeasts

None

Echinocandins (?)

None

Triazoles

Triazoles

Amphotericin B

Fluconazole, echinocandins

Azoles, amphotericin B

Echinocandins amphotericin B

None

Echinocandins

Echinocandins

Triazoles

Fluconazole

Molds

Fluconazole

Fluconazole, amphotericin B



Fluconazole, voriconazole

Echinocandins and variably resistant to

amphotericin B and triazoles

Panresistant*


Fluconazole


Echinocandins

Echinocandins


Echinocandins

Fluconazole

Fluconazole

*Panresistant: Consistently resistant to all 4 major classes of systemic antifungal agents: triazoles, polyenes, echinocandins, and fluoropyrimidines.

Voriconazole, isavuconazole




viability of the fungus. Mutations in the CYP51A fungal gene

alter the structure of the 14α-demethylase, leading to reduced

azole binding and thus generating triazole-resistant phenotypes

[24,25]. The two most common alterations in CYP51A offering

resistance to triazoles are tandem repeats in the promoter region

of the gene along with gene mutations and point mutations [5].

There are also other non-CYP51 mechanisms associated with

azole resistance [24].

The most frequently identified mechanism of triazole resistance

in Aspergillus fumigatus involves a 34-bp tandem repeat (TR 34

)

in the promoter region of the CYP51A gene combined with

a substitution of leucine 98 to histidine (TR 34

/L98H). These

alterations cause overexpression of the gene [25,26]. Another

mechanism of resistance involves a 46-bp tandem repeat in

the CYP51A promoter region combined with two substitutions:

tyrosine 121 for phenylalanine and threonine 289 for alanine

(TR 46

/Y121F/T289A) [27]. This modification of the CYP51A gene

makes Aspergillus fumigatus resistant to voriconazole [28].

Finally, a 53-bp tandem repeat in the promoter region of

the CYP51A gene without any other substitution conferring

azole resistance has been detected in environmental [29] and

clinical triazole-resistant Aspergillus fumigatus strains [30].

Another mechanism of triazole resistance for Aspergillus spp. is

nonsynonymous hot-spot mutations in the CYP51A gene.

Numerous amino acid substitutions associated with

reduced susceptibility for triazoles have been reported [2

4,31,32,33,34,35,36,37,38,39,40]. Recently, many azoleresistant

Aspergillus isolates were found not to have point

mutations in CYP51A or promoter duplications, suggesting

that alternative mechanisms for azole resistance exist

[40,41]. Researchers reported that 43% of 64 azoleresistant

Aspergillus isolates did not carry a CYP51A mutation,

indicating that other mechanisms must be responsible [42].

Potential mechanisms conferring resistance include activation

of efflux pumps [43]; overexpression of transporter genes [44];

loss of the algA gene [45]; the point mutation P88L in HapE, an

3



important transcription factor [46]; biofilm formation

[43,47]; and cholesterol import by Aspergillus fumigatus to

overcome ergosterol deprivation [48].

Cryptic Aspergillus spp. may be resistant to voriconazole. For

example, Aspergillus calidoustus typically has elevated minimum

inhibitory concentrations (MICs) for voriconazole that exceed

CLSI and EUCAST interpretive breakpoints. Aspergillus lentulus,

which may phenotypically resemble a slowly growing Aspergillus

fumigatus, may also have elevated MICs for voriconazole [24].

Polyene-Resistant Aspergillus spp.: Polyene antifungal agents

bind to ergosterol on the cell membrane of the fungus and

cause formation of intramembrane channels that kill the cell.

Amphotericin B is a first-line treatment for invasive aspergillosis

in patients with HMs. Although it has been used since 1957,

emergence of resistance is usually not an issue and typically

involves selection of inherently resistant strains. Development

of acquired resistance during therapy is rare [5]. The most

common amphotericin B-resistant species include Aspergillus

terreus, Aspergillus flavus, Aspergillus nidulans, Aspergillus

calidoustus, and Aspergillus lentulus [49,50,51]. The main

mechanism of resistance is believed to be the modification of

the cell membrane, by diminishing its ergosterol content [51].

Researchers have found that previous treatment with

triazoles also may reduce the amount of membrane ergosterol

in Candida spp. resistant to amphotericin B [52]. Reduction of

membrane ergosterol renders Cryptococcus neoformans less

susceptible to amphotericin B [53]. Whether this mechanism

also confers polyene resistance to Aspergillus spp. is uncertain.

Epidemiology

Triazole-resistant Aspergillus fumigatus has been

described in the Netherlands since 1999, with an estimated

prevalence of 6.0%-12.8% of patients with invasive

aspergillosis [6]. In 2007, infections caused by triazoleresistant

Aspergillus fumigatus were reported in hematology

patients from six different hospitals in the Netherlands [25]. One

year later, another Dutch hospital noted that 28.1% of 32

patients with invasive aspergillosis had an azole-resistant isolate

of Aspergillus fumigatus [54]. The predominant mechanism

of resistance of clinical isolates from patients in different

hospitals was TR34/L98H, a finding suggesting that the source

of resistance was the environment [54,55]. Subsequent studies

from the Netherlands [55] and the United Kingdom [56] showed

that, from 1994 to 2009, the incidence of triazole-resistant

aspergillosis rapidly increased to 20%. Recently, a prospective

study on the prevalence and the mechanisms of azole-resistance

was conducted among 22 centers in 19 European countries

[25]. Triazole-resistant Aspergillus fumigatus isolates have

been reported in 11 countries, although the prevalence ranged

widely, from 0% to 26%, among the participating centers and

even among centers from the same country. The overall triazole

resistance prevalence was 3.2% [25]. To date, triazole-resistant

clinical isolates of Aspergillus fumigatus have been reported in

the majority of European counties [24], as well as Turkey [56].

Most reports of triazole-resistant Aspergillus spp. have

originated from Europe, but recently researchers from four

continents reported increasing numbers of infections caused by

resistant Aspergillus strains [34,57,58,59,60,61], suggesting that

azole resistance is a global threat.

Clinical Significance

Data on the clinical significance of triazole resistance are

limited and contradictory. In vitro studies have shown that the

presence of triazole resistance mechanisms is associated with

reduced susceptibility of Aspergillus fumigatus to all azoles

[62], including the recently licensed isavuconazole [63,64,65].

Several studies have shown that triazole resistance is associated

with treatment failure, especially among patients with HMs

[24,28,29,36,39]. In a study from India, invasive aspergillosis

caused by a resistant isolate was associated with a significantly

higher mortality rate (88%) compared with that of aspergillosis

caused by wild-type isolates (30%-50%) [66]. On the contrary,

in a retrospective study from the United States, higher azole

MICs were not correlated with outcome of aspergillosis in

patients with HMs or HSCT recipients [67]. Clearly, more data

are needed to delineate the clinical significance of triazole

resistance in Aspergillus spp.

Treatment

Due to the low worldwide prevalence of azole-resistant

aspergillosis, there are no clinical studies on its treatment. In

2015, an expert panel published an opinion paper on how to

treat azole-resistant aspergillosis [68]. They suggested that in

areas with high (>10%) environmental resistance, first-line

therapy should be liposomal amphotericin B or a combination

of voriconazole and an echinocandin. These suggestions

require meticulous surveillance studies to define areas of high

resistance; such studies are not always feasible.

Antifungal-Resistant Invasive Candidiasis

Mechanisms of Resistance

Triazole-Resistant Candida spp.: Antifungal azoles act by

inhibiting the enzyme sterol 14α-demethylase, resulting in

the interruption of biosynthesis of ergosterol, which is an

essential Candida cell membrane component. The inhibition

of ergosterol synthesis may be fungicidal for molds, but

4



only fungistatic for yeasts. Several mechanisms confer azole

resistance to Candida spp. [18]. The most common mechanism is

the induction of efflux pumps, which decrease the intracellular

drug concentration. Efflux pumps are encoded by various

genes belonging to the ATP-binding cassette superfamily or

to the major facilitator superfamily [69]. The transcription

of these genes is regulated by transcription factors, such as

Tac1 and Mrr1 for Candida albicans and CgPdr1 for Candida

glabrata [69]. Overexpression or alteration of the drug

target, 14α-demethylase, is another mechanism of resistance.

Numerous point mutations in the ERG11 gene, usually after

exposure to fluconazole, can generate structural changes in the

active site of the demethylase, causing reduced target affinity

and thus triazole resistance [70]. Overexpression of ERG11 [71]

and loss of function of the sterol Δ5,6-desaturase gene (ERG3)

[72] also confer azole resistance. Loss of function of the sterol

Δ5,6-desaturase gene in Candida glabrata may also result in

resistance to amphotericin B. These mechanisms can occur

either alone or concurrently in a single isolate and may lead to

cross-resistance to many azoles.

Echinocandin-Resistant Candida spp.: The mechanism of

action of the echinocandins is inhibition of (1,3)-β-D-glucan

synthesis [73]. Beta-D-glucans are cross-linked to chitin and

mannoproteins, providing structural integrity to cell walls

of various fungi. Echinocandins are fungicidal for Candida

spp., as β-D-glucan accounts for approximately 30%-60% of

the cell wall mass in Candida species [73]. Conversely, among

filamentous fungi, echinocandins have only fungistatic effects,

as the cell wall contains less glucan, concentrated at the apical

tips and branching points of hyphae.

Echinocandins exert their antifungal activity by binding to the

enzyme FKS, which catalyzes the synthesis of (1,3)-β-D-glucans.

Glucan synthase has two catalytic subunits, FKS1 and FKS2,

encoded by their respective FKS genes. Candida species become

echinocandin-resistant by genetic acquisition of mutations

in FKS genes, which encode amino acid substitutions in two

narrow hot-spot regions of FKS1 for all Candida species and FKS2

for C. glabrata [74]. The most common (>90%) FKS1 substitutions

among echinocandin-resistant Candida albicans isolates occur

at Ser-641 or Ser-645 [74]. In Candida glabrata, the most

common amino acid substitutions occur in FKS2 [75].

Resistance to two or more classes of antifungal agents further

augments the threat of Candida glabrata in patients with

HMs. Candida glabrata bloodstream isolates from patients

with HMs developed cross-resistance to both triazoles and

echinocandins [76]. While the molecular events leading to

triazole and echinocandin resistance may occur independently,

one potential unifying mechanism is the development of DNA

mismatch-repair gene mutations, which lead to “hypermutable”

clinical strains [12].

Polyene-Resistant Candida spp.: Candida species with acquired

resistance to polyenes are uncommon, although researchers

have reported cases of Candida albicans, Candida krusei,

Candida glabrata, Candida tropicalis, Candida rugosa, Candida

lusitaniae, and Candida guilliermondii with high MICs to

amphotericin B [5,18]. The main mechanism of resistance

involves a reduction in cell membrane ergosterol, which is the

biological target of amphotericin B. Reduction of ergosterol can

be caused by previous treatment with triazoles, which lowers

membrane sterol concentrations, or mutations affecting sterol

biosynthesis, such as defects in ERG1, ERG2, ERG3, ERG4, ERG6,

and ERG11 [18,77].

Biofilm Formation and Candida Resistance: Biofilm formation

on artificial devices, especially CVCs, is an essential factor driving

the development of drug-resistant Candida spp. in patients with

HMs. Antifungal drugs do not achieve therapeutic levels within

the biofilm because they are trapped in a glucan-rich matrix

polymer. The hypoxic environment within biofilms results in

a metabolic stress response that leads to increased MICs to

triazoles. Moreover, once the Candida strain is embedded in the

biofilm, it may not need to be resistant in order to grow despite

adequate antifungal treatment and may cause breakthrough

candidemia [19].

Epidemiology

Antifungal drug resistance has emerged through the

development of acquired resistance and an epidemiological shift

in the distribution of Candida species towards inherently less

susceptible non-albicans species [16]. In large-scale surveillance

studies of bloodstream isolates, the overall prevalence of Candida

albicans resistance is less than 1% [78]. Resistance rates are

higher among non-albicans Candida species, notably Candida

glabrata, reaching 2%-4% in most epidemiological prevalence

studies [79]. A trend towards increasing rates of Candida

glabrata resistance has been noted, as the proportion of

nonsusceptible isolates increased from 4.2% in 2008 to 7.8%

in 2014 [80], while some institutions reported resistance rates

close to 10% [75]. In hematology patients, a rise in Candida

glabrata with echinocandin and azole resistance and crossresistance

to two or more antifungal classes (multidrug

resistance) has been reported, mainly in the United States,

but not in Europe [81]. In a European study of candidemia

among hematology patients, in vitro resistance to at least one

antifungal agent was observed for 27% of Candida isolates [17].

The problem of antifungal-resistant yeast infections has been

aggravated by recent epidemiological changes. A shift in

5



the distribution of candidemia-associated Candida species

towards more resistant non-albicans species, such as Candida

parapsilosis, Candida tropicalis, Candida glabrata, and Candida

krusei, has been reported among patients with HMs in both

the United States and Europe [16,17]. In addition, the recent

emergence of Candida auris, an uncommon species that exhibits

both multidrug resistance and strong potential for nosocomial

transmission, raises concerns worldwide [82]. Cases and hospital

outbreaks of Candida auris invasive infections have been

reported from four continents, mainly among patients with

HMs, with high mortality [82,83].

Clinical Significance

There are no clinical studies showing a definite association

between in vitro susceptibility testing and outcomes of invasive

candidiasis in neutropenic patients [4,18,19], with the exception

of Candida glabrata, where clinical studies demonstrated that

infection with an echinocandin-resistant strain was associated

with worse outcomes [9,75]. Clinical failure was associated

with the presence of the FKS mutation and not MIC values

[9]. Finally, the recent epidemiological shift of Candida species

distribution towards non-albicans species in patients with HMs

[16] has an impact on outcomes as many non-albicans species,

especially Candida glabrata and Candida krusei, exhibit higher

resistance rates and higher mortality [16,17].

Treatment

There are no clinical studies on the optimal initial treatment

of patients with or at risk for antifungal-resistant

invasive Candida infections. Current guidelines for treatment

of candidiasis recommend lipid formulation of amphotericin

B (3-5 mg/kg daily) for patients with suspected azoleand

echinocandin-resistant Candida infections [84]. This

recommendation is characterized as “strong” but is based on

“low-quality evidence”. Regarding the emerging problem of

multidrug-resistant Candida glabrata infection, there are

no good clinical data on the optimal treatment. The best

strategy for the initial treatment of suspected or documented

resistant Candida infection is to be tailored according to

individual risk factors and the local epidemiology [18].

Antifungal Resistance in Fungal Infections Caused by Rare

Molds and Non-Candida, Non-Cryptococcus Yeasts

The frequency of invasive fungal disease caused by resistant

filamentous fungi other than Aspergillus is increasing. The

majority of these rare molds are Mucorales, hyalohyphomycetes

(Fusarium spp., Scedosporium spp.), and dematiaceous fungi

and they occur mainly in heavily immunosuppressed patients

with HMs [85]. The TRANSNET study reported that among 983

IFIs identified in 875 HSCT recipients, 8% were mucormycosis

and 14% of infections were caused by other filamentous fungi

[86]. The intrinsic resistance of many of these rare fungi to

antifungal agents is of concern. Mucorales species are resistant

to some triazoles, while multidrug resistance has been reported

for Fusarium spp., Scedosporium spp., and dematiaceous fungi.

Although Candida infections comprise the vast majority

of yeasts growing in blood cultures, clinicians should be

aware that a substantial proportion of fungemia cases are

caused by non-Candida, non-Cryptococcus yeasts [87], such

as Trichosporon asahii, Magnusiomyces (Blastoschizomyces)

capitatus, Saccharomyces cerevisiae, Malassezia spp.,

Saprochaete (Geotrichum) spp., and Rhodotorula spp. The

majority of these rare yeasts are intrinsically resistant to one

or more classes of antifungal agents, and infections occur

frequently as breakthrough infections in hematology patients

receiving antifungals and with a CVC in place [87,88]. For

instance, Trichosporon spp. are resistant to echinocandins and

to the fungicidal activity of polyenes, while Rhodotorula spp.

are resistant to the triazoles [18]. In vitro susceptibility testing

is not always useful in patients with infections caused by

less frequent opportunistic yeast or mold infections. In these

patients, breakpoints are not based on data derived from clinical

responses or outcomes but only from epidemiological cut-off

values and pharmacokinetic and pharmacodynamic data from

animal models [89].

Diagnostic Tests for the Detection of Fungal Resistance

Isolation of the infecting fungus through conventional culture

of biological fluids and tissues, identification to the species

level, and in vitro testing to determine the susceptibility to

antifungal agents is the current standard for the diagnosis of IFIs

caused by resistant fungi and for decision making [90]. Species

identification is time-consuming, prompting physicians to

initiate empirical treatment until the results become available.

Newer methods, including MALDI-TOF mass spectroscopy and

T2 magnetic resonance assay, allow rapid species identification

with excellent sensitivity and specificity [90,91]. Antifungal

susceptibility testing is recommended for the triazoles against

all bloodstream Candida isolates and for the echinocandins

against resistant species, such as Candida glabrata and Candida

parapsilosis isolates [84]. As mentioned previously, clinical

breakpoints are only available for certain species of fungi and

are not useful for the diagnosis of resistance, as they do not

always correlate with clinical outcomes, especially in patients

with HMs [18,19,90]. Thus, a low MIC value does not necessarily

predict successful treatment and an elevated MIC does not

automatically predict treatment failure.

Currently, only polymerase chain reaction (PCR) has the potential

for early detection of resistance [92]. Even PCR, though, has its

drawbacks, such as low sensitivity for detection of resistance

markers and difficulty in differentiating colonization from

6



invasive infection or a living from a dead organism [93].

Therefore, clinicians should be cautious as to how to interpret

these non-culture-based diagnostic tests in everyday clinical

practice and for decision making. New molecular detection

methods, including HRMA/PCR, microarrays, and metagenomic

shotgun sequencing, are under development and hold promise

for the future [92].

New Antifungal Agents for Resistant Fungi

IFIs caused by drug-resistant organisms are an emerging threat

to heavily immunosuppressed patients with HMs. Therefore,

there is an urgent need for new antifungals with activity

against resistant fungi. It should be underlined, though, that

fungi are eukaryotes, just like human cells; thus, discovering

new antifungal agents not interfering with human cells is

challenging.

Recent developments in fungal functional genomics, proteomics,

and gene mapping allowed the discovery of potential new drug

targets that could offer additional options to treat resistant

fungal infections [94]. Cellular and biochemical targets of

investigational agents against drug-resistant fungal pathogens

include metabolic pathways (such as the glyoxylate cycle,

iron metabolism, and heme biosynthesis), cell wall and cell

membrane components, signal transduction pathways (such

as MAP kinase), and gene expression. However, there is a

paucity of novel antifungal compounds in preclinical or clinical

development, as the majority of these new antifungal agents

are in the very early stages of development.

SCY-078 is the first orally bioavailable inhibitor of (1,3)-β-Dglucan

synthesis of the fungal cell wall. A triterpene derivative,

SCY-078 has demonstrated in vitro and in vivo activity against

all tested Candida spp., including Candida auris, as well as

triazole-resistant and echinocandin-resistant Candida spp.

[94]. Its spectrum includes Aspergillus spp., where it may

be particularly effective in combination with anti-mold

triazoles. E1210 is a novel isoxazolyl-bis-pyridine wall-active

antifungal compound that inhibits inositol acylation of

mannosylated cell wall proteins, resulting in arrest of fungal

growth [94]. The antifungal spectrum includes most yeast

with the exception of Candida krusei and molds, including

isolates resistant to triazoles and polyenes. Biafungin (CD101)

is a novel, long-acting, semisynthetic echinocandin derivative

of anidulafungin that is currently in phase III clinical

studies. In vitro susceptibility testing showed that biafungin

has activity against caspofungin-resistant Candida strains

containing FKS mutations [95]. Other antifungal agents under

development include F901318 (dihydroorotate dehydrogenase

inhibitor), VT-1598 (metalloenzyme inhibitors of CYP51), and

ASP2397 (hydroxamate siderophores-like agent) [94].

Future Research Directions in Fungal Resistance

Invasive infections caused by resistant fungi are emerging global

problems of public health, associated with increased morbidity

and mortality, particularly among patients with HMs. There are

unanswered questions and unmet needs in all areas of knowledge

of fungal resistance, including epidemiology, diagnostics,

therapeutics, prevention, and education, that require expertise

from many different disciplines to be addressed [96].

The emerging epidemiological data raise intriguing questions:

why is the prevalence of azole resistance in Aspergillus so

variable? The frequency of resistance may vary considerably,

not only between continents and countries but also between

hospitals within the same country, between departments, or

between risk groups within the same hospital [97,98,99]. Is this

under- or overreporting, suboptimal sampling, and/or technical

issues in Aspergillus fumigatus isolation and resistance

detection? Alternatively, are there any geoclimatic factors that

create ecological niches favoring the spread of resistance?

Obviously, general surveillance studies are not sufficient to

capture the problem. In the future, meticulous well-funded

epidemiological studies targeted to specific high-risk groups,

especially patients with HMs, are necessary.

Development and implementation of laboratory diagnostic

tools should be a priority for future research in the field of

resistant fungal infections, as current technology does not

allow rapid species identification and assessment of resistance.

Development of interpretive breakpoints for fungal infections

in neutropenic patients with HMs is an unmet need. New

molecular technologies for the prompt and accurate detection

of genes and mutations associated with fungal resistance are

urgently needed.

The existing antifungal agents are not sufficient to confront

the growing trend of resistance. The limited antifungal

armamentarium should be enriched with agents with novel

mechanisms of action to overcome resistance. A fascinating

direction for future research is the development of new

antifungal agents that do not kill or inhibit the growth of

fungi but impair key virulence properties, such as invasion or

adherence.

Prevention of fungal resistance should be at the core of future

research. Antifungal stewardship programs should ensure

that there is an indication for antifungal therapy, that the

appropriate antifungal agent is selected, and that the dosage,

route of administration, and duration are optimal and that deescalation

is implemented when feasible. A robust antifungal

stewardship program might have beneficial effects on the

prevention of resistance. Understanding the pathophysiology

7



of biofilm formation and reducing the use of CVCs might also

prevent the development of catheter-related resistant fungal

infections.

Authorship Contributions

Concept: M.N.G.; Design: M.N.G., T.J.W., N.V.S.; Data Collection

or Processing: M.N.G.; Analysis or Interpretation: M.N.G., T.J.W.,

N.V.S.; Literature Search: M.N.G.; Writing: M.N.G., T.J.W., N.V.S.

Conflict of Interest: MNG reports no conflict of interest for

this specific work; TJW reports receiving research grants for

experimental and clinical antifungal pharmacotherapeutics

from Astellas, Novartis, Merck, and Pfizer; he has served as a

consultant to Astellas, Drais, iCo, Novartis, Pfizer, Methylgene,

and Sigma-Tau. NVS reports receiving consulting fees, grant

support, lecture fees, and honoraria from Astellas Greece, Gilead

Greece, MSD Greece, and Pfizer Greece.

Financial Disclosure: This work was supported by the Special

Account for Research Grants (ELKE) of the National and

Kapodistrian University of Athens (grant number 70/3/11724)

and by a grant from the Save Our Sick Kids Foundation (http://

soskidsfoundation.org).

References

1. Sipsas NV, Bodey GP, Kontoyiannis DP. Perspectives for the management

of febrile neutropenic patients with cancer in the 21st century. Cancer

2005;103:1103-1113.

2. Neofytos D, Horn D, Anaissie E, Steinbach W, Olyaei A, Fishman J, Pfaller M,

Chang C, Webster K, Marr K. Epidemiology and outcome of invasive fungal

infection in adult hematopoietic stem cell transplant recipients: analysis of

Multicenter Prospective Antifungal Therapy (PATH) Alliance registry. Clin

Infect Dis 2009;48:265-273.

3. Kontoyiannis DP, Lewis RE. Antifungal drug resistance of pathogenic fungi.

Lancet 2002;359:1135-1144.

4. Kontoyiannis DP. Antifungal resistance: an emerging reality and a global

challenge. J Infect Dis 2017;216(Suppl 3):431-435.

5. Perlin DS, Rautemaa-Richardson R, Alastruey-Izquierdo A. The global

problem of antifungal resistance: prevalence, mechanisms, and

management. Lancet Infect Dis 2017;17:383-392.

6. Verweij PE, Snelders E, Kema GH, Mellado E, Melchers WJ. Azole resistance

in Aspergillus fumigatus: a side-effect of environmental fungicide use?

Lancet Infect Dis 2009;9:789-795.

7. Snelders E, Melchers WJ, Verweij PE. Azole resistance in Aspergillus

fumigatus: a new challenge in the management of invasive aspergillosis?

Future Microbiol 2011;6:335-347.

8. Lavergne RA, Chouaki T, Hagen F, Toublanc B, Dupont H, Jounieaux V, Meis

JF, Morio F, Le Pape P. Home environment as a source of life-threatening

azole-resistant Aspergillus fumigatus in immunocompromised patients.

Clin Infect Dis 2017;64:76-78.

9. Shields RK, Nguyen MH, Press EG, Kwa AL, Cheng S, Du C, Clancy CJ. The

presence of an FKS mutation rather than MIC is an independent risk factor

for failure of echinocandin therapy among patients with invasive candidiasis

due to Candida glabrata. Antimicrob Agents Chemother 2012;56:4862-

4869.

10. Verweij PE, Chowdhary A, Melchers WJ, Meis JF. Azole resistance in

Aspergillus fumigatus: can we retain the clinical use of mold-active

antifungal azoles? Clin Infect Dis 2016;62:362-368.

11. Chowdhary A, Sharma C, Meis JF. Azole-resistant aspergillosis: epidemiology,

molecular mechanisms and treatment. J Infect Dis 2017;216(Suppl 3):436-

444.

12. Healey KR, Zhao Y, Perez WB, Lockhart SR, Sobel JD, Farmakiotis D,

Kontoyiannis DP, Sanglard D, Taj-Aldeen SJ, Alexander BD, Jimenez-

Ortigosa C, Shor E, Perlin DS. Prevalent mutator genotype identified in

fungal pathogen Candida glabrata promotes multi-drug resistance. Nat

Commun 2016;7:11128.

13. Lockhart SR, Etienne KA, Vallabhaneni S, Farooqi J, Chowdhary A, Govender

NP, Colombo AL, Calvo B, Cuomo CA, Desjardins CA, Berkow EL, Castanheira

M, Magobo RE, Jabeen K, Asghar RJ, Meis JF, Jackson B, Chiller T, Litvintseva

AP. Simultaneous emergence of multidrug-resistant Candida auris on 3

continents confirmed by whole-genome sequencing and epidemiological

analyses. Clin Infect Dis 2017;64:134-140.

14. Lamaris GA, Chamilos G, Lewis RE, Safdar A, Raad II, Kontoyiannis DP.

Scedosporium infection in a tertiary care cancer center: a review of 25

cases from 1989-2006. Clin Infect Dis 2006;43:1580-1584.

15. Park BJ, Pappas PG, Wannemuehler KA, Alexander BD, Anaissie EJ, Andes DR,

Baddley JW, Brown JM, Brumble LM, Freifeld AG, Hadley S, Herwaldt L, Ito JI,

Kauffman CA, Lyon GM, Marr KA, Morrison VA, Papanicolaou G, Patterson

TF, Perl TM, Schuster MG, Walker R, Wingard JR, Walsh TJ, Kontoyiannis DP.

Invasive non-Aspergillus mold infections in transplant recipients, United

States, 2001-2006. Emerg Infect Dis 2011;17:1855-1864.

16. Sipsas NV, Lewis RE, Tarrand J, Hachem R, Rolston KV, Raad II, Kontoyiannis

DP. Candidemia in patients with hematologic malignancies in the era

of new antifungal agents (2001-2007): stable incidence but changing

epidemiology of a still frequently lethal infection. Cancer 2009;115:4745-

4752.

17. Gamaletsou MN, Walsh T, Zaoutis T, Pagoni M, Kotsopoulou M, Voulgarelis

M, Panayiotidis P, Vassilakopoulos T, Angelopoulou MK, Marangos

M, Spyridonidis A, Kofteridis D, Pouli A, Sotiropoulos D, Matsouka P,

Argyropoulou A, Perloretzou S, Leckerman K, Manaka A, Oikonomopoulos P,

Daikos G, Petrikkos G, Sipsas NV. A prospective, cohort, multicenter study of

candidemia in hospitalized adult patients with hematological malignancies.

Clin Microbiol Infect 2014;20:50-57.

18. Farmakiotis D, Kontoyiannis DP. Epidemiology of antifungal resistance in

human pathogenic yeasts: current viewpoint and practical recommendations

for management. Int J Antimicrob Agents 2017;50:318-324.

19. Gamaletsou MN, Daikos GL, Walsh TJ, Perlin DS, Ortigosa CJ, Psaroulaki

A, Pagoni M, Argyropoulou A, Nepka M, Perivolioti E, Kotsopoulou M,

Perloretzou S, Marangos M, Kofteridis D, Grammatikou M, Goukos D,

Petrikkos G, Sipsas NV. Breakthrough candidemia caused by phenotypically

susceptible Candida spp. in patients with hematological malignancies does

not correlate with established interpretive breakpoints. Int J Antimicrob

Agents 2014;44:248-255.

20. Siopi M, Neroutsos E, Zisaki K, Gamaletsou M, Piroynaki M, Tsirigotis P,

Sipsas N, Dokoumetzidis A, Goussetis E, Zerva L, Valsami G, Meletiadis J.

Bioassay for determining voriconazole serum levels in patients receiving

combination therapy with echinocandins. Antimicrob Agents Chemother

2015;60:632-636.

21. Walsh TJ, Driscoll T, Milligan PA, Wood ND, Schlamm H, Groll AH, Jafri H,

Arrieta AC, Klein NJ, Lutsar I. Pharmacokinetics, safety, and tolerability of

voriconazole in hospitalized immunocompromised children. Antimicrob

Agents Chemother 2010;54:4116-4123.

22. Shields RK, Nguyen MH, Press EG, Clancy CJ. Abdominal candidiasis is a

hidden reservoir of echinocandin resistance. Antimicrob Agents Chemother

2014;58:7601-7615.

23. Osherov N, Kontoyiannis DP. The anti-Aspergillus drug pipeline: is the glass

half full or empty? Med Mycol 2017;55:118-124.

24. Chowdhary A, Sharma C, Meis JF. Azole-resistant aspergillosis: epidemiology,

molecular mechanisms, and treatment. J Infect Dis 2017;216(Suppl 3):436-

444.

25. van der Linden JW, Arendrup MC, Warris A, Lagrou K, Pelloux H, Hauser PM,

Chryssanthou E, Mellado E, Kidd SE, Tortorano AM, Dannaoui E, Gaustad

8



P, Baddley JW, Uekötter A, Lass-Flörl C, Klimko N, Moore CB, Denning DW,

Pasqualotto AC, Kibbler C, Arikan-Akdagli S, Andes D, Meletiadis J, Naumiuk

L, Nucci M, Melchers WJ, Verweij PE. Prospective multicenter international

surveillance of azole resistance in Aspergillus fumigatus. Emerg Infect Dis

2015;21:1041-1044.

26. Verweij PE, Mellado E, Melchers WJ. Multiple-triazole-resistant aspergillosis.

N Engl J Med 2007;356:1481-1483.

27. Mellado E, Garcia-Effron G, Alcázar-Fuoli L, Melchers WJ, Verweij PE,

Cuenca-Estrella M, Rodríguez-Tudela JL. A new Aspergillus fumigatus

resistance mechanism conferring in vitro cross-resistance to azole

antifungals involves a combination of cyp51A alterations. Antimicrob


28. van der Linden JW, Camps SM, Kampinga GA, Arends JP, Debets-Ossenkopp

YJ, Haas PJ, Rijnders BJ, Kuijper EJ, van Tiel FH, Varga J, Karawajczyk A, Zoll

J, Melchers WJ, Verweij PE. Aspergillosis due to voriconazole highly resistant

Aspergillus fumigatus and recovery of genetically related resistant isolates

from domiciles. Clin Infect Dis 2013;57:513-520.

29. Le Pape P, Lavergne RA, Morio F, Alvarez-Moreno C. Multiple fungicidedriven

alterations in azole-resistant Aspergillus fumigatus, Colombia, 2015.

Emerg Infect Dis 2016;22:156-157.

30. Hodiamont CJ, Dolman KM, Ten Berge IJ, Melchers WJ, Verweij PE, Pajkrt D.

Multiple-azole-resistant Aspergillus fumigatus osteomyelitis in a patient

with chronic granulomatous disease successfully treated with long-term

oral posaconazole and surgery. Med Mycol 2009;47:217-220.

31. Howard SJ, Arendrup MC. Acquired antifungal drug resistance in Aspergillus

fumigatus: epidemiology and detection. Med Mycol 2011;49 (Suppl 1):90-

95.

32. Mann PA, Parmegiani RM, Wei SQ, Mendrick CA, Li X, Loebenberg D,

DiDomenico B, Hare RS, Walker SS, McNicholas PM. Mutations in Aspergillus

fumigatus resulting in reduced susceptibility to posaconazole appear to be

restricted to a single amino acid in the cytochrome P450 14α-demethylase.

Antimicrob Agents Chemother 2003;47:577-581.

33. Mellado E, Garcia-Effron G, Alcazar-Fuoli L, Cuenca-Estrella M, Rodriguez-

Tudela JL. Substitutions at methionine 220 in the 14α-sterol demethylase

(Cyp51A) of Aspergillus fumigatus are responsible for resistance in vitro to

azole antifungal drugs. Antimicrob Agents Chemother 2004;48:2747-2750.

34. Chen J, Li H, Li R, Bu D, Wan Z. Mutations in the cyp51A gene and

susceptibility to itraconazole in Aspergillus fumigatus serially isolated from

a patient with lung aspergilloma. J Antimicrob Chemother 2005;55:31-37.

35. Bellete B, Raberin H, Morel J, Flori P, Hafid J, Manhsung RT. Acquired

resistance to voriconazole and itraconazole in a patient with pulmonary

aspergilloma. Med Mycol 2010;48:197-200.

36. Krishnan Natesan S, Wu W, Cutright JL, Chandrasekar PH. In vitro-in vivo

correlation of voriconazole resistance due to G448S mutation (cyp51A

gene) in Aspergillus fumigatus. Diagn Microbiol Infect Dis 2012;74:272-

277.

37. Paul RA, Rudramurthy SM, Meis JF, Mouton JW, Chakrabarti A. A novel

Y319H substitution in CYP51C associated with azole resistance in Aspergillus

flavus. Antimicrob Agents Chemother 2015;59:6615-6619.

38. Arendrup MC, Jensen RH, Grif K, Skov M, Pressler T, Johansen HK, Lass-Flörl

C. In vivo emergence of Aspergillus terreus with reduced azole susceptibility

and a Cyp51a M217I alteration. J Infect Dis 2012;206:981-985.

39. Howard SJ, Cerar D, Anderson MJ, Albarrag A, Fisher MC, Pasqualotto

AC, Laverdiere M, Arendrup MC, Perlin DS, Denning DW. Frequency and

evolution of azole resistance in Aspergillus fumigatus associated with

treatment failure. Emerg Infect Dis 2009;15:1068-1076.

40. Albarrag AM, Anderson MJ, Howard SJ, Robson GD, Warn PA, Sanglard

D, Denning DW. Interrogation of related clinical pan-azole-resistant

Aspergillus fumigatus strains: G138C, Y431C, and G434C single nucleotide

polymorphisms in cyp51A, upregulation of cyp51A, and integration and

activation of transposon Atf1 in the cyp51A promoter. Antimicrob Agents

Chemother 2011;55:5113-5121.

41. Moye-Rowley WS. Multiple mechanisms contribute to the development

of clinically significant azole resistance in Aspergillus fumigatus. Front

Microbiol 2015;6:70.

42. Bueid A, Howard SJ, Moore CB, Richardson MD, Harrison E, Bowyer P,

Denning DW. Azole antifungal resistance in Aspergillus fumigatus: 2008

and 2009. J Antimicrob Chemother 2010;65:2116-2118.

43. Rajendran R, Mowat E, McCulloch E, Lappin DF, Jones B, Lang S, Majithiya

JB, Warn P, Williams C, Ramage G. Azole resistance of Aspergillus fumigatus

biofilms is partly associated with efflux pump activity. Antimicrob Agents

Chemother 2011;55:2092-2097.

44. Paul S, Diekema D, Moye-Rowley WS. Contributions of both ATP-binding

cassette transporter and Cyp51A proteins are essential for azole resistance

in Aspergillus fumigatus. Antimicrob Agents Chemother 2017;61:e02748-

16.

45. Wei X, Chen P, Gao R, Li Y, Zhang A, Liu F, Lu L. Screening and characterization

of the non-cyp51A mutation Afcox10 conferring azole resistance in

Aspergillus fumigatus. Antimicrob Agents Chemother 2017;61:e02101-16.

46. Camps SM, Dutilh BE, Arendrup MC, Rijs AJ, Snelders E, Huynen MA, Verweij

PE, Melchers WJ. Discovery of a hapE mutation that causes azole resistance

in Aspergillus fumigatus through whole genome sequencing and sexual

crossing. PLoS One 2012;7:e50034.

47. Ramage G, Mowat E, Jones B, Williams C, Lopez-Ribot J. Our current

understanding of fungal biofilms. Crit Rev Microbiol 2009;35:340-355.

48. Xiong Q, Hassan SA, Wilson WK, Han XY, May GS, Tarrand JJ, Matsuda SP.

Cholesterol import by Aspergillus fumigatus and its influence on antifungal

potency of sterol biosynthesis inhibitors. Antimicrob Agents Chemother

2005;49:518-524.

49. Balajee SA, Gribskov JL, Hanley E, Nickle D, Marr KA. Aspergillus lentulus sp.

nov., a new sibling species of A. fumigatus. Eukaryot Cell 2005;4:625-632.

50. Alastruey-Izquierdo A, Cuesta I, Houbraken J, Cuenca-Estrella M, Monzon

A, Rodriguez-Tudela JL. In vitro activity of nine antifungal agents against

clinical isolates of Aspergillus calidoustus. Med Mycol 2010;48:97-102.

51. Walsh TJ, Petraitis V, Petraitiene R, Field-Ridley A, Sutton D, Ghannoum

M, Sein T, Schaufele R, Peter J, Bacher J, Casler H, Armstrong D, Espinel-

Ingroff A, Rinaldi MG, Lyman CA. Experimental pulmonary aspergillosis due

to Aspergillus terreus: pathogenesis and treatment of an emerging fungal

pathogen resistant to amphotericin B. J Infect Dis 2003;188:305-319.

52. Vazquez JA, Arganoza MT, Boikov D, Yoon S, Sobel JD, Akins RA. Stable

phenotypic resistance of Candida species to amphotericin B conferred by

preexposure to subinhibitory levels of azoles. J Clin Microbiol 1998;36:2690-

2695.

53. Perfect JR, Cox GM. Drug resistance in Cryptococcus neoformans. Drug

Resist Updat 1999;2:259-269.

54. Snelders E, van der Lee HA, Kuijpers J, Rijs AJ, Varga J, Samson RA, Mellado

E, Donders AR, Melchers WJ, Verweij PE. Emergence of azole resistance in

Aspergillus fumigatus and spread of a single resistance mechanism. PLoS

Med 2008;5:e219.

55. Snelders E, Huis In ‘t Veld RA, Rijs AJ, Kema GH, Melchers WJ, Verweij PE.

Possible environmental origin of resistance of Aspergillus fumigatus to

medical triazoles. Appl Environ Microbiol 2009;75:4053-4057.

56. Özmerdiven GE, Ak S, Ener B, Ağca H, Cilo BD, Tunca B, Akalın H. First

determination of azole resistance in Aspergillus fumigatus strains carrying

the TR34/L98H mutations in Turkey. J Infect Chemother 2015;21:581-586.

57. Hsueh PR, Lau YJ, Chuang YC, Wan JH, Huang WK, Shyr JM, Yan JJ, Yu

KW, Wu JJ, Ko WC, Yang YC, Liu YC, Teng LJ, Liu CY, Luh KT. Antifungal

susceptibilities of clinical isolates of Candida species, Cryptococcus

neoformans, and Aspergillus species from Taiwan: surveillance of

multicenter antimicrobial resistance in Taiwan program data from 2003.

Antimicrob Agents Chemother 2005;49:512-517.

58. Lockhart SR, Frade JP, Etienne KA, Pfaller MA, Diekema DJ, Balajee SA.

Azole resistance in Aspergillus fumigatus isolates from the ARTEMIS global

surveillance study is primarily due to the TR/L98H mutation in the cyp51A

gene. Antimicrob Agents Chemother 2011;55:4465-4468.

9



59. Wiederhold NP, Gil VG, Gutierrez F, Lindner JR, Albataineh MT, McCarthy DI,

Sanders C, Fan H, Fothergill AW, Sutton DA. First detection of TR34 L98H

and TR46 Y121F T289A Cyp51 mutations in Aspergillus fumigatus isolates

in the United States. J Clin Microbiol 2016;54:168-171.

60. Gonçalves SS. Global aspects of triazole resistance in Aspergillus fumigatus

with focus on Latin American countries. J Fungi 2017;3:5.

61. Kidd SE, Goeman E, Meis JF, Slavin MA, Verweij PE. Multi-triazole-resistant

Aspergillus fumigatus infections in Australia. Mycoses 2015;58:350-355.

62. van Ingen J, van der Lee HA, Rijs TA, Zoll J, Leenstra T, Melchers WJ, Verweij

PE. Azole, polyene and echinocandin MIC distributions for wild-type,

TR34/L98H and TR46/Y121F/T289A Aspergillus fumigatus isolates in the

Netherlands. J Antimicrob Chemother 2015;70:178-181.

63. Howard SJ, Lass-Flörl C, Cuenca-Estrella M, Gomez-Lopez A, Arendrup

MC. Determination of isavuconazole susceptibility of Aspergillus and

Candida species by the EUCAST method. Antimicrob Agents Chemother

2013;57:5426-5431.

64. Gregson L, Goodwin J, Johnson A, McEntee L, Moore CB, Richardson M,

Hope WW, Howard SJ. In vitro susceptibility of Aspergillus fumigatus

to isavuconazole: correlation with itraconazole, voriconazole, and

posaconazole. Antimicrob Agents Chemother 2013;57:5778-5780.

65. Steinmann J, Hamprecht A, Vehreschild MJ, Cornely OA, Buchheidt D,

Spiess B, Koldehoff M, Buer J, Meis JF, Rath PM. Emergence of azoleresistant

invasive aspergillosis in HSCT recipients in Germany. J Antimicrob

Chemother 2015;70:1522-1526.

66. Chowdhary A, Kathuria S, Xu J, Sharma C, Sundar G, Singh PK, Gaur

SN, Hagen F, Klaassen CH, Meis JF. Clonal expansion and emergence of

environmental multiple-triazole-resistant Aspergillus fumigatus strains

carrying the TR 34

/L98H mutations in the cyp51A gene in India. PLoS One

2012;7:e52871.

67. Heo ST, Tatara AM, Jiménez-Ortigosa C, Jiang Y, Lewis RE, Tarrand J, Tverdek

F, Albert ND, Verweij PE, Meis JF, Mikos AG, Perlin DS, Kontoyiannis DP.

Changes in in vitro susceptibility patterns of Aspergillus to triazoles and

correlation with aspergillosis outcome in a tertiary care cancer center,

1999-2015. Clin Infect Dis 2017;65:216-225.

68. Verweij PE, Ananda-Rajah M, Andes D, Arendrup MC, Brüggemann RJ,

Chowdhary A, Cornely OA, Denning DW, Groll AH, Izumikawa K, Kullberg BJ,

Lagrou K, Maertens J, Meis JF, Newton P, Page I, Seyedmousavi S, Sheppard

DC, Viscoli C, Warris A, Donnelly JP. International expert opinion on the

management of infection caused by azole-resistant Aspergillus fumigatus.

Drug Resist Updat 2015;21-22:30-40.

69. Cowen LE, Sanglard D, Howard SJ, Rogers PD, Perlin DS. Mechanisms of

antifungal drug resistance. Cold Spring Harb Perspect Med 2015;5:a019752.

70. Sagatova AA, Keniya MV, Wilson RK, Monk BC, Tyndall JD. Structural

insights into binding of the antifungal drug fluconazole to Saccharomyces

cerevisiae lanosterol 14α-demethylase. Antimicrob Agents Chemother

2015;59:4982-4989.

71. Flowers SA, Barker KS, Berkow EL, Toner G, Chadwick SG, Gygax SE,

Morschhäuser J, Rogers PD. Gain-of-function mutations in UPC2 are a

frequent cause of ERG11 upregulation in azole-resistant clinical Isolates of

Candida albicans. Eukaryotic Cell 2012;11:1289-1299.

72. Vale-Silva LA, Coste AT, Ischer F, Parker JE, Kelly SL, Pinto E, Sanglard D.

Azole resistance by loss of function of the sterol Δ 5,6 -desaturase gene (ERG3)

in Candida albicans does not necessarily decrease virulence. Antimicrob


73. Douglas CM. Fungal beta(1,3)-D-glucan synthesis. Med Mycol 2001;39(Suppl

1):55-66.

74. Arendrup MC, Perlin DS. Echinocandin resistance: an emerging clinical

problem? Curr Opin Infect Dis 2014;27:484-492.

75. Alexander BD, Johnson MD, Pfeiffer CD, Jiménez-Ortigosa C, Catania

J, Booker R, Castanheira M, Messer SA, Perlin DS, Pfaller MA. Increasing

echinocandin resistance in Candida glabrata: clinical failure correlates with

presence of FKS mutations and elevated minimum inhibitory concentrations.

Clin Infect Dis 2013;56:1724-1732.

76. Bailly S, Maubon D, Fournier P, Pelloux H, Schwebel C, Chapuis C, Foroni

L, Cornet M, Timsit JF. Impact of antifungal prescription on relative

distribution and susceptibility of Candida spp.- trends over 10 years. J

Infect 2016;72:103-111.

77. Hull CM, Bader O, Parker JE, Weig M, Gross U, Warrilow AG, Kelly DE, Kelly

SL. Two clinical isolates of Candida glabrata exhibiting reduced sensitivity

to amphotericin B both harbor mutations in ERG2. Antimicrob Agents

Chemother 2012;56:6417-6421.

78. Pfaller MA, Messer SA, Woosley LN, Jones RN, Castanheira M. Echinocandin

and triazole antifungal susceptibility profiles for clinical opportunistic yeast

and mold isolates collected from 2010 to 2011: application of new CLSI

clinical breakpoints and epidemiological cutoff values for characterization

of geographic and temporal trends of antifungal resistance. J Clin Microbiol

2013;51:2571-2581.

79. Pham CD, Iqbal N, Bolden CB, Kuykendall RJ, Harrison LH, Farley MM,

Schaffner W, Beldavs ZG, Chiller TM, Park BJ, Cleveland AA, Lockhart SR.

Role of FKS mutations in Candida glabrata: MIC values, echinocandin

resistance, and multidrug resistance. Antimicrob Agents Chemother

2014;58:4690-4696.

80. Vallabhaneni S, Cleveland AA, Farley MM, Harrison LH, Schaffner W, Beldavs

ZG, Derado G, Pham CD, Lockhart SR, Smith RM. Epidemiology and risk

factors for echinocandin non-susceptible Candida glabrata bloodstream

infections: data from a large multisite population-based candidemia

surveillance program, 2008-2014. Open Forum Infect Dis 2015;2:ofv163.

81. Klotz U, Schmidt D, Willinger B, Steinmann E, Buer J, Rath PM, Steinmann

J. Echinocandin resistance and population structure of invasive Candida

glabrata isolates from two university hospitals in Germany and Austria.

Mycoses 2016;59:312-318.

82. McCarthy MW, Walsh TJ. Containment strategies to address the expanding

threat of multidrug-resistant Candida auris. Expert Rev Anti Infect Ther

2017;15:1095-1099.

83. Calvo B, Melo AS, Perozo-Mena A, Hernandez M, Francisco EC, Hagen F,

Meis JF, Colombo AL. First report of Candida auris in America: clinical and

microbiological aspects of 18 episodes of candidemia. J Infect 2016;73:369-

374.

84. Pappas PG, Kauffman CA, Andes DR, Clancy CJ, Marr KA, Ostrosky-Zeichner

L, Reboli AC, Schuster MG, Vazquez JA, Walsh TJ, Zaoutis TE, Sobel JD.

Executive summary: Clinical practice guideline for the management of

candidiasis: 2016 update by the Infectious Diseases Society of America. Clin

Infect Dis 2016;62:409-417.

85. Slavin M, van Hal S, Sorrell TC, Lee A, Marriott DJ, Daveson K, Kennedy K,

Hajkowicz K, Halliday C, Athan E, Bak N, Cheong E, Heath CH, Orla Morrissey

C, Kidd S, Beresford R, Blyth C, Korman TM, Owen Robinson J, Meyer W,

Chen SC; Australia and New Zealand Mycoses Interest Group. Invasive

infections due to filamentous fungi other than Aspergillus: epidemiology

and determinants of mortality. Clin Microbiol Infect 2015;21:490.

86. Kontoyiannis DP, Marr KA, Park BJ, Alexander BD, Anaissie EJ, Walsh TJ, Ito

J, Andes DR, Baddley JW, Brown JM, Brumble LM, Freifeld AG, Hadley S,

Herwaldt LA, Kauffman CA, Knapp K, Lyon GM, Morrison VA, Papanicolaou

G, Patterson TF, Perl TM, Schuster MG, Walker R, Wannemuehler KA,

Wingard JR, Chiller TM, Pappas PG. Prospective surveillance for invasive

fungal infections in hematopoietic stem cell transplant recipients, 2001-

2006: overview of the Transplant-Associated Infection Surveillance

Network (TRANSNET) Database. Clin Infect Dis 2010;50:1091-1100.

87. Fernández-Ruiz M, Guinea J, Puig-Asensio M, Zaragoza Ó, Almirante B,

Cuenca-Estrella M, Aguado JM; CANDIPOP Project; GEIH-GEMICOMED

(SEIMC) and REIPI. Fungemia due to rare opportunistic yeasts: data from a

population-based surveillance in Spain. Med Mycol 2017;55:125-136.

88. Bretagne S, Renaudat C, Desnos-Ollivier M, Sitbon K, Lortholary O, Dromer

F; French Mycosis Study Group. Predisposing factors and outcome of

uncommon yeast species-related fungaemia based on an exhaustive

surveillance programme (2002-14). J Antimicrob Chemother 2017;72:1784-

1793.

10



89. Espinel-Ingroff A, Turnidge J. The role of epidemiological cutoff values

(ECVs/ECOFFs) in antifungal susceptibility testing and interpretation for

uncommon yeasts and moulds. Rev Iberoam Micol 2016;33:63-75.

90. Ostrosky-Zeichner L, Andes D. The role of in vitro susceptibility

testing in management of fungal infections. J Infect Dis 2017;216(Suppl

3):452-457.

91. Mylonakis E, Clancy CJ, Ostrosky-Zeichner L, Garey KW, Alangaden GJ,

Vazquez JA, Groeger JS, Judson MA, Vinagre YM, Heard SO, Zervou FN,

Zacharioudakis IM, Kontoyiannis DP, Pappas PG. T2 magnetic resonance

assay for the rapid diagnosis of candidemia in whole blood: a clinical trial.

Clin Infect Dis 2015;60:892-899.

92. Perlin DS, Wiederhold NP. Culture-independent molecular methods for

detection of antifungal resistance mechanisms and fungal identification. J

Infect Dis 2017;216(Suppl 3):458-465.

93. Alanio A, Bretagne S. Performance evaluation of multiplex PCR including

Aspergillus-not so simple! Med Mycol 2017;55:56-62.

94. McCarthy MW, Kontoyiannis DP, Perfect J, Cornely OS, Walsh TJ. Novel

agents and drug targets to meet the challenges of resistant fungi. J Infect

Dis 2017;216(Suppl 3):474-483.

95. Pfaller MA, Messer SA, Rhomberg PR, Jones RN, Castanheira M. Activity

of a long-acting echinocandin, CD101, determined using CLSI and EUCAST

reference methods, against Candida and Aspergillus spp., including

echinocandin- and azole-resistant isolates. J Antimicrob Chemother

2016;71:2868-2873.

96. McCarthy MW, Denning DW, Walsh TJ. Future research priorities in fungal

resistance. J Infect Dis 2017;216(Suppl 3):484-492.

97. Verweij PE, Lestrade PP, Melchers WJ, Meis JF. Azole resistance surveillance

in Aspergillus fumigatus: beneficial or biased? J Antimicrob Chemother

2016;71:2079-2082.

98. Alanio A, Denis B, Hamane S, Raffoux E, Peffault de la Tour R, Touratier S,

Bergeron A, Bretagne S. New therapeutic strategies for invasive aspergillosis

in the era of azole resistance: how should the prevalence of azole resistance

be defined? J Antimicrob Chemother 2016;71:2075-2078.

99. Lestrade PP, Meis JF, Arends JP, van der Beek MT, de Brauwer E, van Dijk K,

de Greeff SC, Haas PJ, Hodiamont CJ, Kuijper EJ, Leenstra T, Muller AE, Oude

Lashof AM, Rijnders BJ, Roelofsen E, Rozemeijer W, Tersmette M, Terveer

EM, Verduin CM, Wolfhagen MJ, Melchers WJ, Verweij PE. Diagnosis and

management of aspergillosis in the Netherlands: a national survey. Mycoses

2016;59:101-107.

11

RESEARCH ARTICLE

DOI: 10.4274/tjh.2017.0039


A National Registry of Thalassemia in Turkey: Demographic

and Disease Characteristics of Patients, Achievements, and

Challenges in Prevention

Türkiye Ulusal Talasemi Kaydı: Hastaların Demografik ve Hastalık Özellikleri, Kontrol

Programının Başarısı ve Sorunları

Yeşim Aydınok, Yeşim Oymak, Berna Atabay, Gönül Aydoğan, Akif Yeşilipek, Selma Ünal, Yurdanur Kılınç, Banu Oflaz,

Mehmet Akın, Canan Vergin, Melike Sezgin Evim, Ümran Çalışkan, Şule Ünal, Ali Bay, Elif Kazancı, Talia İleri, Didem

Atay, Türkan Patıroğlu, Selda Kahraman, Murat Söker, Mediha Akcan, Aydan Akdeniz, Mustafa Büyükavcı, Güçhan Alanoğlu,

Özcan Bör, Nur Soyer, Nihal Özdemir Karadaş, Ezgi Uysalol, Meral Türker, Arzu Akçay, Süheyla Ocak, Adalet Meral

Güneş, Hüseyin Tokgöz, Elif Ünal, Naci Tiftik, Zeynep Karakaş

Hemoglobinopathy Study Group, Turkey

Abstract

Objective: The Turkish Society of Pediatric Hematology set up a

National Hemoglobinopathy Registry to demonstrate the demographic

and disease characteristics of patients and assess the efficacy of a

hemoglobinopathy control program (HCP) over 10 years in Turkey.

Materials and Methods: A total of 2046 patients from 27 thalassemia

centers were registered, of which 1988 were eligible for analysis. This

cohort mainly comprised patients with β-thalassemia major (n=1658,

83.4%) and intermedia (n=215, 10.8%).

Results: The majority of patients were from the coastal areas of

Turkey. The high number of patients in Southeastern Anatolia was

due to that area having the highest rates of consanguineous marriage

and fertility. The most common 11 mutations represented 90% of

all β-thalassemia alleles and 47% of those were IVS1-110(G->A)

mutations. The probability of undergoing splenectomy within the

first 10 years of life was 20%, a rate unchanged since the 1980s.

Iron chelators were administered as monotherapy regimens in 95%

of patients and deferasirox was prescribed in 81.3% of those cases.

Deferasirox administration was the highest (93.6%) in patients aged

<10 years. Of the thalassemia major patients, 5.8% had match-related

hemopoietic stem cell transplantation with a success rate of 77%.

Cardiac disease was detected as a major cause of death and did not

show a decreasing trend in 5-year cohorts since 1999.

Conclusion: While the HCP has been implemented since 2003, the

affected births have shown a consistent decrease only after 2009,

being at lowest 34 cases per year. This program failure resulted from

a lack of premarital screening in the majority of cases. Additional

problems were unawareness of the risk and misinformation of the

Öz

Amaç: Türk Pediatrik Hematoloji Derneği, Türkiye’de 10 yıldır devam

eden Hemoglobinopati Kontrol Programı’nın (HCP) etkinliğini

değerlendirmek ve hemoglobinopati hastalarının demografik ve

hastalık özelliklerini ortaya koymak üzere bir Ulusal Hemoglobinopati

Kayıt Programı oluşturdu.

Gereç ve Yöntemler: Toplam 27 talasemi merkezinden 2046 hasta

kaydedildi ve bunların 1988’i analize uygun bulundu. Kayıtların

çoğunluğunu β-talasemi majör (n=1658, %83,4) ve intermedia

(n=215, %10,8) olguları oluşturdu.

Bulgular: Hastaların büyük çoğunluğu kıyı bölgelerde bulunuyordu.

Güneydoğu Anadolu’da yüksek hasta sayısına, bu bölgede en yüksek

görülen akraba evliliği ve yüksek doğum oranının etkisi olabilirdi.

En sık 11 talasemi mutasyonu, tüm β-talasemi allellerinin %90’ını

oluşturuyordu ve bunların %47’si IVS1-110(G->A) mutasyonu

idi. Yaşamın ilk 10 yılında splenektomi olasılığı %20 idi ve bu oran

1980’lerden beri değişmemişti. Demir şelasyonu hastaların %95’inde

monoterapi olarak uygulanmaktaydı ve %81,3’ünü deferasiroks

oluşturuyordu. Deferasiroks uygulaması en yüksek (%93,6) 10

yaştan küçük hastalarda bulundu. Talasemi majör olgularının %5,8’i

hemopoetik kök hücre nakli olmuştu ve başarı oranı %77 idi. Kardiyak

hastalık ölümlerin majör nedeni idi ve beşer yıllık kohortlarda,

1999’dan beri azalma eğilimi göstermiyordu.

Sonuç: HCP 2003 yılından beri uygulanmakla beraber, yeni hastaların

doğumu ancak 2009’dan itibaren azalma eğilimi gösteriyordu ve en

düşük yılda 34 yeni hasta saptandı. Program başarısızlığı, çiftlerin

çoğunda, evlilik öncesi tarama yapılmamasından kaynaklanmaktaydı.

Bir kısmında ise riskin farkında olunmaması ve çiftlerin hatalı



Address for Correspondence/Yazışma Adresi: Yeşim AYDINOK, M.D.,

Ege University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey

Phone : +90 532 396 27 46

E-mail : yesim.aydinok@ege.edu.tr ORCID-ID: orcid.org/0000-0001-8463-2723


Accepted/Kabul tarihi: April 11, 2017

12


Aydınok Y, et al: A National Registry of Thalassemia in Turkey

at-risk couples. In addition, prenatal diagnosis was either not offered

to or was not accepted by the at-risk families. This study indicated

that a continuous effort is needed for optimizing the management of

thalassemia and the development of strategies is essential for further

achievements in the HCP in Turkey.

Keywords: Thalassemia, Hemoglobinopathies, Splenectomy, Registries,

Iron chelators, β-thalassemia mutations, Turkey

bilgilendirilmesi nedenliydi. Sonuç olarak, risk ailelerine prenatal

tanı önerilmemesi veya prenatal tanının reddi diğer nedenleri

oluşturuyordu. Bu çalışma, Türkiye’de talasemi tedavisinin

optimizasyonu için çabanın sürdürülmesine ve HCP’nin daha yüksek

başarısı için gelişen stratejilere gereksinim olduğunu gösterdi.

Anahtar Sözcükler: Talasemi, Hemoglobinopatiler, Splenektomi,

Kayıt, Demir şelatörleri, β-talasemi mutasyonları, Türkiye

Introduction

Better management of thalassemia by regular and adequate

red cell transfusions, close monitoring of iron loading, and

appropriate iron chelation therapy (ICT) with deferoxamine

(DFO) has changed the prognosis of the disease worldwide [1].

Furthermore, there was a revolutionary development in the

management of the disease at the beginning of the twentyfirst

century with the introduction of magnetic resonance

imaging (MRI) as a measure of tissue-specific iron loading and

the availability of oral iron chelators deferiprone (DFP) and

deferasirox (DFX) [2,3].

In parallel, DFP and DFX were registered in Turkey in 2004

and 2006, respectively, and gradually replaced DFO. However,

the dissemination of cardiac T2* MRI as a useful tool for the

monitoring and management of iron overload has remained

limited.

The cornerstone of relevant public health policies in Turkey was

the recognition of thalassemia as a common health problem in

1993. Eventually, a comprehensive national hemoglobinopathy

control program (HCP) was implemented by law and came into

force on 24 October 2002 in 33 provinces of Turkey.

In 2012, the Turkish Society of Pediatric Hematology set up

the National Registry for Hemoglobinopathies to collate the

demographic and disease characteristics of patients, and also

quantified and assessed the efficacy of the HCP over 10 years

in Turkey.

Materials and Methods

A website was prepared to conduct this observational

prospective cohort study. The website was launched after

receiving the approval of the ethics committee in October

2012 (B.30.2.EGE.0.20.05.00/OY/1747-723 decision number: 12-

5.2/11) and remained active until June 2015. The investigators

received a secure entrance to the website. The electronic case

report form for each patient with a thalassemia disease and

variant hemoglobins and the signed informed consent form

were completed by the investigators. The system was able to

detect repeated registries for any patient receiving health care

in more than one center. The demographic features and disease

characteristics of the patients were reported. Affected births

from marriages after 2003 were also investigated and relevant

information was collected.

Results

The overall population with a major hemoglobinopathy comprised

2046 patients from 27 thalassemia centers (TCs) participating in

the study. A total of 56 double and one triple registration were

excluded. A total of 1988 patients were analysed.

Distribution of Patients Throughout Turkey

The majority of patients came from TCs in the Aegean (n=622),

Marmara (n=518), Mediterranean (n=348), and Southeastern

Anatolia (n=338) regions. A total of 139 patients were

registered from TCs in Central Anatolia and 23 patients were

from a single TC serving the whole of Eastern Anatolia. There

was no TC in the Black Sea region where a few patients may be

living and receiving health care from the nearest TCs outside

the region (Table 1). The highest number of registered patients

lived in İstanbul (n=265), İzmir (n=207), and Şanlıurfa (n=201)

provinces.

Table 1. Regional distribution of the registered patients.

Regions Provinces Centers (n) Patients (n)

Marmara

Central Anatolia

Southeastern Anatolia

Aegean

Mediterranean

İstanbul 3 416

Bursa 2 102

Ankara 1 36

Kayseri 1 31

Eskişehir 1 19

Konya 1 54

Şanlıurfa 2 187

Diyarbakır 2 105

Gaziantep 1 46

İzmir 4 495

Denizli 1 73

Aydın 2 54

Antalya 1 96

Mersin 1 92

Adana 1 90

Hatay 1 49

Isparta 1 21

Eastern Anatolia Erzurum 1 23

13



Demographic Characteristics of Patients

This was a relatively young cohort (51% male), of which 72%

of individuals were below 20 years old (Figure 1). A total of

378 subjects (19%) in the cohort were of preschool age (<6

years). The majority of subjects aged ≥6 years were students

(n=981, 67%). A total of 480 subjects (33%) were not attending

school. Just over half of these (n=256, 53%) were >18 years

old and employed, whereas 224 (47%) were unemployed and

214 of those were >18 years old. Of the unemployed patients

57% had only completed the 8-year primary education, whereas

33% had graduated from high school and 10% from university.

The schooling or employment status was not obtained from 149

subjects. All patients, except for 1%, were covered by social

security regardless of their social status.

Consanguineous marriage was reported for 48% of parents

and 51% of those were first-cousin marriages. Consanguineous

marriages accounted for 75% of parents from Şanlıurfa, which

was the city with the third highest number of thalassemic

patients on the registry. In comparison, consanguineous

marriages were reported in 38.5% and 29% of parents from

İstanbul and İzmir, respectively. Furthermore, the average

number of children born to parents with an affected child was

4 in Şanlıurfa but 2 in İstanbul and İzmir. A total of 214 families

in the registry had more than one thalassemic child.

Disease Characteristics

The majority of subjects (95%) had homozygous β-thalassemia

(Table 2). A total of 1385 β-thalassemia alleles reported from

724 patients contained 22 different β-thalassemia mutations.

The most common 11 mutations represented 90% of all

β-thalassemia alleles. IVS1-110(G->A) was the most prevalent

mutation (Table 3).

Although β-thalassemia intermedia (TI) was reported in 215

(11.5%) of 1873 patients with β-thalassemia, only one-third

of subjects (33.3%) were entirely transfusion-free. Regular

(>8 times/year), frequent (5-8 times/year), and occasional

(0-4 times/year) transfusions were reported in 79 (37.6%), 30

(14.3%), and 31 (14.8%) patients, respectively.

Splenectomy had been performed in 79 (38%) of 207 patients

with TI and 590 (37%) of 1594 patients with β-thalassemia

major (TM). The patients were divided into four age cohorts by

decades and splenectomy indication during the first decade was

compared between age cohorts II, III, and IV. The splenectomy

frequency in age cohort III displayed a slight decrease compared

to cohort IV and simply shifted to the second decade. However,

the frequency of splenectomy did not change in age cohort II

compared to III (Table 4).

A total of 115 patients with TM were aged <2 years at the time

of registration and had not met the criteria for starting ICT.

A total of 150 patients with TI, hemoglobin H (HbH) disease,

Table 2. The diagnosis of registered patients.

Diagnosis n %

β-thalassemia major 1658 83.4

β-thalassemia intermedia 215 10.8

β/S-thalassemia 16 0.8

S/S disease 77 3.9

HbH disease 22 1.1

HbH: hemoglobin H

Table 3. The most common β-thalassemia mutations in the

cohort.

β T mutation

Homozygous

Compound

heterozygous

Total

β T allele

IVSI-110(G->A) 234 184 652 47.1

IVSI-1(G->A) 26 53 105 7.6

IVSI-6(T->C) 24 56 104 7.5

Codon 39(C->T) 22 35 79 5.7

IVSII-745(C->G) 19 40 78 5.6

IVSII-1(G->A) 20 36 76 5.5

Codon 8(-AA) 23 26 72 5.2

Codon 44(-C) 17 11 45 3.3

Codon 5(-CT) 12 17 41 3.0

-30 (T->A) 10 13 33 2.4

IVSI-5(G->C) 10 9 29 2.1

%

Table 4. Changes in frequency and age of splenectomy in age cohorts by decades.

Age cohorts of patients

Age of

I (0-10 years), II (10-20 years), III (20-30 years), IV (30-40 years),

splenectomy (years)

n=685 (%)

n=716 (%)

n=366 (%)

n=129 (%)

0-10 37 (5.5) 135 (19) 73 (20) 33 (26)

10-20 - 105 (15) 137 (37) 36 (29)

20-30 - - 22 (6) 18 (15)

30-40 - - - 2 (1.5)

14



sickle-cell disease (SCD), and β/S thalassemia were not receiving

ICT. The history of ICT was not obtained for 78 patients. Overall,

1561 of 1645 patients (95%) with TM (n=1473), TI (n=128),

SCD (n=31), β/S thalassemia (n=9), and HbH disease (n=4) were

receiving a monotherapy regimen. DFX was the most prevalent

chelator, prescribed to 1337 (81.3%) patients, followed by DFO

to 131 (8%) and DFP to 93 (5.7%) patients. Combined therapy of

DFO+DFP was reported in 58 (3.5%), DFX+DFO in 20 (1.2%), and

DFX+DFP in 6 (0.3%) patients. The highest DFX administration of

93.6% was reported in patients aged <10 years and it remained

the most prevalent chelator in all age cohorts. The use of DFO

and DFP was lowest in patients aged <10 years and increased

gradually in older age cohorts (Table 5).

Hemopoietic stem cell transplantation (HSCT) was reported in 96

patients, of which all but one with SCD had TM. The average age

at HSCT was 8.1 years (median: 7 years) and the oldest patient

was 18 years old. The source of HSCT was matched sibling

donor (MSD) in 87 of 92 patients, whereas three family and

two unrelated-donor transplantations were reported. Overall,

70 of 91 patients (77%) had thalassemia-free survival after

HSCT, whereas 20 patients had graft rejection with autologous

recovery (22%) and 1 died (1.1%). There were 115 patients with

an MSD who had not yet had HSCT, of whom 84 were <17 years

old. Furthermore, there were 417 patients with a healthy sibling

whose human leukocyte antigen (HLA) compatibility had not

Figure 1. The age distribution of the registered patients.

Figure 2. The number of affected births prior to and after the

implementation of the hemoglobinopathy control program.

been evaluated.

There were 34 deaths (5%) out of 680 patients from 3 TCs. The

causes of death were heart disease (n=17), infections (n=8),

hepatic failure (n=2), anemia (n=1), HSCT (n=1), and unknown

causes (n=5). The earliest cardiac death was at 11 years old. The

rates of cardiac deaths in the population at risk (age of >10

years) improved gradually in 5-year cohorts since 1999 (Table 6).

The Impact of the Hemoglobinopathy Control Program on

Thalassemic Births

There were 619 thalassemic births after 2004. The number of

new cases has shown a consistent decrease only since 2009

(Figure 2). The year of marriage was recorded for 482 of 619

parents, of whom 242 had been married since 2003 or later.

According to the statements of couples, overall 142 of those

242 (58.7%) had married in provinces covered by the HCP but

did not receive premarital screening. The remaining 100 couples

had premarital screening but 40% of those either received

no feedback information (n=25) or were misinformed (n=15)

regarding screening results and 60% had been informed of

being couples at risk of having thalassemic offspring but those

parents either had not had a prenatal diagnosis (n=49) or had

knowingly given birth to a thalassemic child (n=11).

Sixty-two of these 242 (25.6%) couples were married in Şanlıurfa.

Premarital screening was performed for only 17 (27%) of these

62 couples. Although 12 out of those 17 were informed that

they were at-risk couples, only one had a prenatal diagnosis but

knowingly gave birth to an affected child. Nineteen (7.8%) of

the 242 couples were married in İzmir, of whom 15 (79%) had

premarital screening and 10 of those 15 were informed that they

were at-risk couples, but only 5 of those had a prenatal diagnosis.

Table 5. Changes over time in percentage of chelator use in

patients with hemoglobinopathies.

Age (years) n DFO (%)

DFP

(%)

DFX

(%)

0-10 486 3.3 2 93.6 1.1

11-20 637 7 4 85 4

21-30 317 12 11.3 69.4 7.3

31-40 112 21.4 14.2 60 4.5

DFX: Deferasirox, DFO: deferoxamine, DFP: deferiprone.

Table 6. Changes over time in the number and age of

cardiac deaths.

Cardiac deaths

n

Average age

(years)

1994-1998 6 17.2±5.9 3.26

1999-2003 3 13.7±2.3 1.98

2004-2008 4 19.8±4.0 1.53

2009-2013 3 23.3±3.5 0.85

% of deaths,

DFP + DFO

(%)

at-risk population

15



Discussion

Previous epidemiological studies from Turkey reported that

the Çukurova region was the most prevalent for hemoglobin S

(HbS) carriers (up to 10%) and the majority of patients with SCD

were from that region [4,5,6]. Because the TCs that participated

from Çukurova had not registered patients with SCD, the

current registry mainly included patients with homozygous

β-thalassemia. TI accounted for 11.5% of the cohort and the

majority of those individuals were receiving transfusions. It

remains to be determined whether the milder forms have been

missed.

Although the prevalence of β-thalassemia carriers was

stated as 2.1% overall in Turkey [7], the epidemiological data

demonstrated regional differences, with a higher prevalence

in coastal areas [5,8,9,10]. In concordance with this, the

majority of patients came from the Marmara, Aegean, and

Mediterranean regions. Although epidemiological data from

Southeastern Anatolia did not indicate a high prevalence of

thalassemia carriers [11,12], homozygous forms in the region

were found to be as high as those in the coastal areas, most

probably because of the higher number of consanguineous

marriages and the higher fertility rate. The considerable number

of families with more than one affected child indicated that

preventive measures have not been implemented even for the

families with a proven risk. After implementation of the HCP,

the highest number of affected children were born in Şanlıurfa.

It was revealed that the majority of these couples had not had

premarital screening and, furthermore, prenatal diagnosis was

either not offered or not accepted by the at-risk families. The

number of newborns with thalassemia and hemoglobinopathies

was reported as being reduced from 272 in 2002 to 25 in 2010,

which accounted for a 90% reduction over these years [13]. We

consider that report with caution since in the current registry

79 affected births were reported from 27 TCs in Turkey in 2010.

This inconsistency can be explained by insufficient reporting of

new cases to the official registry system used by the Ministry of

Health in Turkey. Nevertheless, the number of affected newborns

per year demonstrated a trend towards a consistent decrease

since 2009. This achievement can be improved by auditing all

components of the program carefully and applying appropriate

corrective measures.

This was a relatively young cohort as 72% of the registry

was <20 years old and they were mostly either of preschool

age (19%) or students (67%). Approximately one-half of the

remaining thalassemic subjects were employed while just under

half were neither employed nor in education or training (NEET).

The Organisation for Economic Co-operation and Development

(OECD) reported that nearly 30% of young people in Turkey

aged 15-29 were NEET, which is well above the OECD average

of 15%, and low skills were a key barrier to achieve better

labor market outcomes for youth in Turkey [14]. In fact, 57%

of NEET individuals in the registry were early school-leavers.

Although the patients were covered by social security regardless

of their social status, effective policies are needed to improve

the education, job, and career prospects of the patients up to at

least the average of their peers. Taking into account that most

children and adolescents in this cohort will be moving from

childhood to adulthood in the near future, the transition from

pediatric to adult care should also be adjusted appropriately.

The wide molecular heterogeneity of Turkish thalassemic

subjects has been confirmed by this registry. The most

common seven mutations accounted for less than 80% of

all thalassemia alleles, consistent with previous reports from

Turkey [15,16,17,18,19,20]. The IVS-I-110(G->A) substitution

was the most common defect with a frequency of 47% within

all β-thalassemia alleles in the cohort. Five of the seven most

common β-thalassemia alleles were either β 0 (codon 39[C->T],

IVSI-1[G->A], FSC8[-AA]) or severe β + thalassemia (IVSI-110[G-

>A], IVSII-745[C->G]), whereas only two prevalent alleles (IVSI-

6[T->C], IVSII-1[G->T]) were related to mild β ++ -thalassemia

mutations.

It is suggested that improved tissue oxygenation by adequate

transfusion regimens has considerably reduced the incidence

of splenectomy within the first 10 years of life in thalassemic

patients [21,22]. The unchanged needs for splenectomy in our

patients from the mid-1970s to mid-2000s may be related to

the low transfusion rates in Turkey.

All guidelines provide age-specific recommendations for

the initiation of ICT. In children <6 years old, all guidelines

recommend DFO as the first-line choice and DFX as the

second-line option for patients where DFO is ineffective or not

tolerated. DFP is recommended for children >6 years old and/or

as a second-line option if patients are resistant or intolerant to

DFX [21,23]. Under the regulations of Turkey, all chelators have

been approved as first-line treatment at the age of ≥2 years

and DFX has been the first-line choice for more than 90% of

patients.

HSCT has remained the only curative treatment for TM.

The Turkish Pediatric Bone Marrow Transplantation Group

specifically collected the data of 245 thalassemic children who

underwent HSCT and of whom 68% achieved thalassemia-free

survival [24]. In this registry, only 96 patients were reported as

having HSCT. The missing registration data may result from the

loss of follow-up of these patients because their health care

is usually moved from the TC to the transplantation center

after HSCT. Nevertheless, there were 115 TM patients with an

16



MSD but not yet transplanted and a further 417 patients with

healthy sibling(s) with unknown HLA compatibility. These data

indicate that the awareness of physicians and parents about this

curative option should be increased.

The widespread implementation of cardiac T2* MRI and

appropriate intensification of chelation in those with cardiac

iron overload reduced cardiac mortality significantly [2,3].

Survival data from three major TCs indicated that despite a

gradual improvement in cardiac deaths in the at-risk population

in 5-year cohorts since 1994, cardiac disease is still a major

cause of early deaths and a sustained effort in dissemination of

cardiac T2* MRI and optimum use of ICT should be maintained.

The compliance with ICT remained the most important factor

in ensuring the desired outcome for thalassemic patients and

that may be strengthened by individualized treatment, careful

monitoring, and continuous psychosocial support [2,25].

Conclusion

In conclusion, many efforts have been directed toward optimizing

patients’ management and implementing a prevention program

in Turkey in the new millennium. The current data indicate

that these efforts should be maintained to achieve further

improvement in the survival and quality of life associated with

better integration into social life for thalassemic patients. The

developing strategies are also essential for further achievements

in the prevention program.

Acknowledgments

The authors thank Çağlar Serdar, Aylin Gökduman, and Tolga

Turgay of Plexus Information Technologies for their website

support. The current study and the work presented here are from

an Investigator Initiated Trial, which was sponsored by the Ege

Children’s Foundation and funded by Novartis Pharmaceuticals

Corporation.

Ethics

Ethics Committee Approval: The website was launched after

receiving the approval of the Ege University Faculty of Medicine

Ethics Committee in October 2012 (B.30.2.EGE.0.20.05.00/

OY/1747-723 decision number: 12-5.2/11) and remained active

until June 2015.

Informed Consent: The electronic case report form for each

patient with a thalassemia disease and variant hemoglobins

and the signed informed consent form were completed by the

investigators.


Study Design: Y.A.; Data Collection or Processing: Y.A., Y.O., B.A.,

G.A., A.Y., S.Ü., Y.K., B.O., M.A., C.V., M.E., Ü.Ç., Ş.Ü., A.B., E.K.,

T.İ., D.A., T.P., S.K., M.S., M.A., A.A., M.B., G.A., Ö.B., N.S., N.K.,

E.U., M.T., A.A., S.O., A.M., H.T., Z.U., M.A.Ö., N.T., Z.K.; Analysis or

Interpretation: Y.A.; Literature Search: Y.A.; Writing: Y.A.

Conflict of Interest: The authors of this paper have no conflicts

of interest, including specific financial interests, relationships,

and/or affiliations relevant to the subject matter or materials

included.

References

1. Ehlers KH, Giardina PJ, Lesser ML, Engle MA, Hilgartner MW. Prolonged

survival in patients with beta-thalassemia major treated with deferoxamine.

J Pediatr 1991;118:540-545.

2. Modell B, Khan M, Darlison M, Westwood MA, Ingram D, Pennell DJ.

Improved survival of thalassaemia major in the UK and relation to T2*

cardiovascular magnetic resonance. J Cardiovasc Magn Reson 2008;10:42.

3. Borgna-Pignatti C, Cappellini MD, De Stefano P, Del Vecchio GC, Forni GL,

Gamberini MR, Ghilardi R, Piga A, Romeo MA, Zhao H, Cnaan A. Cardiac

morbidity and mortality in deferoxamine or deferiprone-treated patients

with thalassemia major. Blood 2006;107:3733-3737.

4. Altay C, Yetgin S, Ozsoylu S, Kutsal A. Hemoglobin S and some other

hemoglobinopathies in Eti-Turks. Hum Hered 1978;28:56-61.

5. Koçak R, Alparslan ZN, Ağridağ G, Başlamisli F, Aksungur PD, Koltaş S. The

frequency of anaemia, iron deficiency, hemoglobin S and beta thalassemia

in the south of Turkey. Eur J Epidemiol 1995;11:181-184.

6. Canatan D, Kose MR, Ustundag M, Haznedaroglu D, Ozbas S.

Hemoglobinopathy control program in Turkey. Community Genet

2006;9:124-126.

7. Cavdar AO, Arcasoy A. The incidence of-thalassemia and abnormal

hemoglobins in Turkey. Acta Haematol 1971;45:312-318.

8. Dinçol G, Aksoy M, Erdem S. Beta-thalassaemia with increased haemoglobin

A2 in Turkey. A study of 164 thalassaemic heterozygotes. Hum Hered

1979;29:272-278.

9. Bircan I, Sişli S, Güven A, Cali S, Yeğin O, Ertuğ H, Güven AG, Akar N.

Hemoglobinopathies in the district of Antalya, Turkey. Pediatr Hematol

Oncol 1993;10:289-291.

10. Aydinok Y, Oztop S, Nişli G, Kavakli K. Prevalence of beta-thalassaemia trait in

1124 students from Aegean region of Turkey. J Trop Pediatr 1997;43:184-185.

11. Koç A, Kösecik M, Vural H, Erel O, Ataş A, Tatli MM. The frequency and

etiology of anemia among children 6-16 years of age in the southeast

region of Turkey. Turk J Pediatr 2000;42:91-95.

12. Kilinç M, Yüregir GT, Ekerbiçer H. Anaemia and iron-deficiency anaemia in

south-east Anatolia. Eur J Haematol 2002;69:280-283.

13. Canatan D. Thalassemias and hemoglobinopathies in Turkey. Hemoglobin

2014;38:305-307.

14. OECD. Employment Outlook 2016. Paris, OECD Publishing, 2016.

15. Nişli G, Kavakli K, Aydinok Y, Oztop S, Cetingül N. Beta-thalassemia alleles

in Aegean region of Turkey: effect on clinical severity of disease. Pediatr

Hematol Oncol 1997;14:59-65.

16. Tadmouri GO, Tüzmen S, Ozçelik H, Ozer A, Baig SM, Senga EB, Başak AN.

Molecular and population genetic analyses of beta-thalassemia in Turkey.

Am J Hematol 1998;57:215-220.

17. Cürük MA, Arpaci A, Attila G, Tuli A, Kilinç Y, Aksoy K, Yüreğir GT. Genetic

heterogeneity of beta-thalassemia at Cukurova in southern Turkey.

Hemoglobin 2001;25:241-245.

18. Ayçiçek A, Koç A, Özdemir ZC, Bilinç H, Koçyiğit A, Dilmeç F. Beta-globin

gene mutations in children with beta-thalassemia major from Şanlıurfa

province, Turkey. Turk J Haematol 2011;28:264-268.

19. Aldemir O, Izmirli M, Kaya H. The spectrum of β-thalassemia

mutations in Hatay, Turkey: reporting three new mutations. Hemoglobin

2014;38:325-328.

17



20. Ozkinay F, Onay H, Karaca E, Arslan E, Erturk B, Ece Solmaz A, Tekin IM,

Cogulu O, Aydinok Y, Vergin C. Molecular basis of β-thalassemia in the

population of the Aegean region of Turkey: identification of a novel

deletion mutation. Hemoglobin 2015;39:230-234.

21. Cappellini MD, Cohen A, Porter J, Viprakasit V. Guidelines for the

Management of Transfusion Dependent Thalassaemia (TDT), 3rd ed. Nicosia,

Thalassaemia International Federation, 2014.

22. Piga A, Serra M, Longo F, Forni G, Quarta G, Cappellini MD, Galanello R.

Changing patterns of splenectomy in transfusion-dependent thalassemia

patients. Am J Hematol 2011;86:808-810.

23. Musallam KM, Angastiniotis M, Eleftheriou A, Porter JB. Cross-talk between

available guidelines for the management of patients with beta-thalassemia

major. Acta Haematol 2013;130:64-73.

24. Yesilipek MA, Ertem M, Cetin M, Öniz H, Kansoy S, Tanyeli A, Anak S, Kurekci

E, Hazar V. HLA-matched family hematopoetic stem cell transplantation

in children with beta thalassemia major: the experience of the Turkish

Pediatric Bone Marrow Transplantation Group. Pediatr Transplant

2012;16:846-851.

25. Musallam K, Cappellini MD, Taher A. Challenges associated with prolonged

survival of patients with thalassemia: transitioning from childhood to

adulthood. Pediatrics 2008;121:1426-1429.

18

RESEARCH ARTICLE

DOI: 10.4274/tjh.2017.0209


Biological Features of Bone Marrow Mesenchymal Stromal Cells

in Childhood Acute Lymphoblastic Leukemia

Çocukluk Çağı Akut Lenfoblastik Lösemisinde Kemik İliği Mezenkimal Stroma Hücrelerinin

Biyolojik Özellikleri

Stella Genitsari 1 , Eftichia Stiakaki 1 , Chryssoula Perdikogianni 2 , Georgia Martimianaki 3 , Iordanis Pelagiadis 4 , Margarita

Pesmatzoglou 1 , Maria Kalmanti 5 , Helen Dimitriou 1

1

Crete University Faculty of Medicine, University Hospital of Heraklion, Department of Pediatric Hematology and Oncology, Crete, Greece

2

Crete University Faculty of Medicine, Department of Pediatrics, Crete, Greece

3

Crete University Faculty of Medicine, Division of Mother and Child Health, Crete, Greece

4

Metropolitan Hospital, N. Faliro, Athens, Greece

5

Private Sector

Abstract

Objective: Mesenchymal stromal cells (MSCs) have a supportive

role in hematopoiesis and as components of the bone marrow (BM)

microenvironment may present alterations during acute lymphoblastic

leukemia (ALL) and be affected by chemotherapeutic agents. We

examined the biological and functional characteristics of MSCs in

ALL diagnosis and treatment and their effect on MSC qualitative

properties.

Materials and Methods: Immunophenotypic characterization,

evaluation of clonogenicity, and proliferative capacity were measured.

Apoptotic features, cell-cycle analysis, and stromal cell-derived factor

1α and angiopoietin-1 levels in MSC supernatant at diagnosis and

in different phases of treatment were assessed. Chemotherapy was

administered according to the Berlin-Frankfurt-Munster-2000

protocol. BM samples from children with solid tumors without BM

involvement were used as the control group.

Results: The morphology, the immunophenotypic profile, and the

apoptotic characteristics of the MSCs were not affected by leukemia.

The secretion of factors involved in the trafficking of hematopoietic

cells in the BM seems to be upregulated at diagnosis in comparison

to the treatment phases. MSCs are influenced by the disease in

terms of their functional characteristics such as clonogenicity and

proliferation rate. These effects cease as soon as treatment is initiated.

Chemotherapy does not seem to exert any effect on any of the MSC

features examined.

Conclusion: MSCs from children with ALL are affected by their

interaction with the leukemic environment, but this phenomenon

ceases upon treatment initiation, while no effect is observed by

chemotherapy itself.

Keywords: Bone marrow microenvironment, Childhood leukemia,

Mesenchymal stromal cells, Stromal cell-derived factor 1α

Öz

Amaç: Mezenkimal stroma hücreleri (MSH) hematopoezde destek

rolü oynar, kemik iliği (Kİ) mikroçevresinin parçası olduklarından akut

lenfoblastik lösemide (ALL) değişikliğe uğrayabilir ve kemoterapötik

ajanlardan etkilenebilirler. Bu çalışmada, ALL’de tanı anında ve

tedavide MSH’lerin biyolojik ve fonksiyonel özellikleri ile bunların

MSH’lerin niteliksel özellikleri üzerine olan etkilerini araştırdık.

Gereç ve Yöntemler: İmmünofenotipik özellikler, klonalite

değerlendirilmesi ve çoğalma kapasitesi ölçümleri yapıldı. Tanıda

ve tedavinin değişik evrelerinde MSH süpernatanında apoptotik

özellikler, hücre döngüsü analizi ve stromal hücre türevi factor-1α ile

anjiyopoietin-1 düzeyleri değerlendirildi. Kemoterapi olarak Berlin-

Frankfurt-Munster-2000 protokolü uygulandı. Solid tümörü olan ve

Kİ tutulumu bulunmayan hastaların Kİ örnekleri kontrol grubu olarak

kullanıldı.

Bulgular: MSH’lerin morfoloji, immünofenotipik profil ve apoptotik

özellikleri açısından lösemiden etkilenmediği görüldü. Hematopoetik

hücrelerinin Kİ’de yer değiştirmesi üzerine etkisi olabilen faktörlerinin

salınımının tanıda, tedavi evrelerine göre upregüle olduğu tespit

edildi. MSH’ler hastalıktan klonalite ve çoğalma hızı gibi fonksiyonel

özellikler kapsamında etkilenmekteydi. Bu etkiler tedavi başlanması

ile duraklamaktaydı. Kemoterapinin incelenen MSH özelliklerinden

hiçbiri üzerine bir etkisi olmadığı görüldü.

Sonuç: ALL’si olan çocuklardaki MSH’ler lösemik çevre ile ilişkilerden

etkilenir, ancak bu fenomen tedavi başlanması ile duraklar ve bu

çalışmada kemoterapinin bunun üzerine bir etkisi gözlenmemiştir.

Anahtar Sözcükler: Kemik iliği mikroçevresi, Çocukluk çağı lösemisi,

Mezenkimal stroma hücreleri, Stromal hücre türevi factor-1α



Address for Correspondence/Yazışma Adresi: Helen DIMITRIOU, PhD, Crete University Faculty of Medicine,

University Hospital of Heraklion, Department of Pediatric Hematology and Oncology, Crete, Greece

Phone : +30 2810 394 674

E-mail : lena.dimitriou@uoc.gr ORCID-ID: orcid.org/0000-0001-9142-907X

Received/Geliş tarihi: May 24, 2017

Accepted/Kabul tarihi: September 08, 2017

19

Genitsari S, et al: MSCs in Childhood ALL


Introduction

Mesenchymal stromal cells (MSCs) constitute part of the

bone marrow (BM) microenvironment where the survival,

proliferation, and differentiation of hematopoietic stem cells

(HSCs) take place [1]. Despite the large amount of information

on the nature of MSCs, they have not been fully characterized

so far. The in vivo counterparts or possibly precursors of culturedeveloped

MSCs are currently considered to be perivascular

cells, namely pericytes. These two-cell populations share similar

properties in terms of marker expression, ability to self-renew,

and potential to differentiate into multiple cell types such as

adipocytes, chondrocytes, osteocytes, and myocytes under

specified culture conditions [2,3]. The BM microenvironment

is believed to play a pivotal role in the development and

progression of leukemia [4]; thus, it is reasonable to speculate

that MSCs may also be involved in the perturbation of

normal hematopoiesis. Their putative role in oncogenesis and

leukemogenesis has not been fully clarified and the results from

the studies already published are contradictory. In vitro studies

have shown that MSCs from newly diagnosed adult patients

with leukemia (acute myeloid leukemia and acute lymphoblastic

leukemia) are less efficient for supporting normal hematopoietic

progenitor cell survival and this functional capacity is partially

restored after chemotherapy [5]. Their implication in childhood

ALL has only recently being addressed, revealing that ALL-

MSCs display reduced proliferative capacity and ability to

support long-term hematopoiesis in vitro while those isolated

at diagnosis did not differ from those obtained during

treatment [6]. The detection of leukemia-associated genetic

aberrations in MSCs implied a clonal relationship between

MSCs and leukemia cells in childhood ALL and suggested the

involvement of MSCs in the pathogenesis of the disease [7].

Involvement of MSCs in various malignancies via deregulation

of the secretion of chemokines [8,9,10] implies that

they mediate cell migration and homing [11]. Stromal cellderived

factor 1α (SDF-1α or CXCL12) was found to retain

and support the HSCs in the BM via the SDF-1α/CXCR4 axis

[12,13]. CXCL12 is constitutively secreted by marrow stromal

cells, being the major source for CXCL12 in adults [14]. Less is

known about its role in hematological malignancies and how

it could be affected during chemotherapy. The existing studies

have come to conflicting results [8,15]. Angiopoietin-1 (Ang-

1), initially known for its role in both embryonic and postnatal

angiogenesis, has recently been reported to interact with HSCexpressed

Tie-2 [3,16], enhancing the maintenance of HSCs in a

quiescent state within the BM, and Ang-1 is thereby part of the

network regulating the “stemness” of HSCs [17].

MSCs have been considered promising candidates for cell

therapies and, in view of their potential, there are many ongoing

studies to understand their properties, mechanisms of action,

and putative role in hematological malignancies [7,18,19,20]. So

far MSCs from different sources have been shown to exhibit

different properties [21]. Moreover, BM MSCs from children

seem to be different from their adult counterparts [22].

The aim of this study is to characterize MSCs derived from the

BM of children with ALL at the onset of the disease in order

to evaluate the leukemic effect, if any, on their biological/

functional properties. In addition, an attempt was made to

compare this population with the MSCs derived from the BM

during different treatment phases for the assessment of the

effect of chemotherapy on these features.


Patients

BM samples from children with B-lineage ALL and >90% BM

infiltration at diagnosis, hospitalized from 2006 to 2010 at the

Department of Pediatric Hematology and Oncology, University

Hospital of Heraklion, were studied. They included samples

at diagnosis (d, n=28), day 15 (d15, n=12), day 33 of

induction therapy (d33, n=20) when remission was achieved,

at intensification-consolidation (consol, n=33), during

maintenance (maint, n=19) therapy, and at the end of treatment

(end, n=20), all in remission. MSCs examined at different phases

of ALL treatment are not necessarily in all cases from the same

patients. Patients were treated according to the ALL Berlin-

Frankfurt-Munster-2000 protocol and their risk stratification

[medium risk (MR) and high risk (HR)] according to the same

protocol was considered in some of the employed assays. The

control group (n=15) consisted of BM samples from children

with solid tumors without BM involvement. Patients’ ages

ranged from 1.2 to 18 years (median: 6 years). The study was

approved by the Ethical Committee of the University Hospital

of Heraklion.

Methods are described in more detail in the Appendix

(Supplementary Materials and Methods).

BM Mononuclear Cells (MNCs) Isolation and MSC Culture and

Expansion

BM MNCs, following Ficoll-Hypaque separation (1077 g/mL;

Lymphoprep, Nycomed, Oslo, Norway), were cultured in a-MEM

as described previously for MSC development [22]. MSCs were

maintained for up to five passages. Assays were performed at

any of P1 to P4 depending on the cell availability.

Immunophenotyping Evaluation

Phenotypic characterization of MSCs was performed by flow

cytometry at various passages using hematopoietic cell and

MSC-specific monoclonal antibodies (BD Biosciences, San Jose,

CA, USA). One hundred thousand cells were stained with the

markers as described previously [23]. At least 10,000 events

were acquired for each analysis.

20



Cell Doubling Time (DT)

DT was calculated according to the formula DT=t/n=t×log(2)/log

(cells harvested/cells inoculated), where t is the time between

initial plating and harvest for the respective passage.

Colony Forming Units-Fibroblast (CFU-F) Formation

At day 0, 1x10 5 MNCs were seeded in each well of a 24-well plate

(in triplicate) in the absence of fibroblast growth factor-2 (FGF-

2). At subsequent passages, MSCs were plated in 20-cm 2 petri

plates at a concentration of 10 cells/cm 2 (in duplicate). The

colonies that developed were categorized according to their

size as small (S), medium (M), and large (L, highly proliferating)

CFU-F. The sum of all sizes is denoted as CFU-F.

Cell-Cycle Analysis - Apoptosis

MSCs at either P2 or P3 were stained with propidium iodide in

order to estimate the percentage of cells in each phase of the

cell cycle. Cell-cycle analysis was performed using WinMDI

software version 2.8 [24].

Apoptotic MSCs at passages P2 and P4 were detected by flow

cytometry and 7-amino-actinomycin D (7-AAD; Sigma, St.

Louis, MO, USA) staining [25].

than 0.05 were considered as statistically significant. Analysis

was performed using SPSS 18.0 (SPSS Inc., Chicago, IL, USA).

Results

Morphology and Immunophenotypic Profile

BM MSCs from all groups were expanded until the fifth passage

and all displayed the characteristic spindle-shape morphology.

Immunophenotypic assays at P2 and P4 did not identify any

differences among groups. MSCs at diagnosis expressed CD90

(99.67±0.09%), CD105 (97.39±0.72%), CD146 (59.55±2.84%),

CD29 (99.1±0.12%), CD44 (98.07±1.39%), CD95 (90.25±2.85%),

and CD73 (99.4±0.4%), while there was no expression of

hematopoietic markers such as CD34, CD45, and CD14. The same

immunophenotypic profile was also observed at all treatment

phases and in the control group.

Growth Rate of MSCs (DT)

MSCs within the MNC fraction (d0) at diagnosis reached

confluency in approximately 20.71±1.24 days, whereas at the

end of chemotherapy they required 15.10±0.63 days. The DT at

Detection of SDF-1α and Ang-1 (ELISA)

A quantitative sandwich enzyme-linked immunosorbent assay

technique (ELISA) was employed for the determination of both

SDF-1α and Ang-1 (R&D Systems, Minneapolis, MN, USA) in the

supernatant of MSCs at any of P1 to P3 cultures (and of MNCs

at d0) within the leukemia group only, at diagnosis, and during

treatment phases following the instructions of the manufacturer.

Statistical Analysis

Results are expressed as mean ± standard error of the mean

mean (SEM). Differences between groups were assessed using

the nonparametric Mann-Whitney U-test and p-values lower

Figure 1. Days required for mesenchymal stromal cells in the

mononuclear cells fraction (d0) to reach confluency. The doubling

time at diagnosis differs from that of the phases of chemotherapy

(p: d15=0.042, d33=0.007, consol=0.001, maint=0.022, end=0.002)

and of the control (p=0.011). This defect subsides with the

progression of culture (*: ss in comparison to the d group).

Table 1. Doubling time of mesenchymal stromal cells of all groups in the different passages (P1-P5).

P1 P2 P3 P4 P5

d 3.30±0.41 3.07±0.58 4.20±0.80 5.37±1.06 4.75±0.95

d15 2.39±0.31 5.49±1.18 4.80±1.22 3.83±0.97 3.82±0.69

d33 2.57±0.24 2.86±0.35 3.47±0.42 3.85±0.61 3.82±0.41

Consol 2.59±0.19 2.72±0.23 3.24±0.30 4.12±0.61 4.50±0.93

Maint 3.44±0.53 5.98±1.17 3.57±0.49 3.18±0.52 4.21±0.50

End 2.49±0.20 2.59±0.25 2.57±0.32 3.41±0.38 3.73±0.40

CTL 2.34±0.11 3.03±0.31 2.42±0.25 4.41±1.07 4.47±2.13

Data are expressed as mean ± standard error of mean. CTL: Cytotoxic lymphocyte

21

Genitsari S, et al: MSCs in Childhood ALL Turk J Hematol 2018;35:19-26

diagnosis was statistically different compared to all the phases

of treatment (Figure 1). At subsequent passages, DT was similar

among all groups (Table 1). This finding indicates that MSCs

present in the MNC fraction at diagnosis, which was mainly

constituted of lymphoblasts, expanded more slowly compared

to treatment phases and the control group, but this defect

subsided with the progression of culture (more advanced P). No

difference was observed among all passages in all other studied

groups. As the culture progressed, DT increased in all groups and

the control.

CFU-F Development

At day 0, the CFU-F formation at diagnosis appeared to be impaired

compared to the other groups (Figure 2), a result attributed to the

lower number of the medium and the large-sized colonies. The

impaired clonogenicity of MSCs at the time of diagnosis was a

constant finding, observed at subsequent passages as well (Table

2). Culture progression resulted in lower colony development,

the control included, and this became statistically significant at

the later passages (P1 vs. P4 or P5, p<0.001). MSCs at diagnosis

formed fewer small, medium, and large colonies compared to all

other groups. Larger colonies prevailed at early passages, while

at the later ones, the CFU-F population consisted of mainly small

colonies (Supplementary Figure 1).


Most of the MSCs were in quiescence, presenting a higher

percentage of cells in the G0G1 phase compared to the control

group (Figure 3). The study of apoptosis in all phases of disease

and treatment at P2 and P4 confirmed the stability of BM-MSCs

under long-term culture expansion through serial passages.

Spontaneous apoptosis was detected at P2 and it did not change

at P4 in all groups (Table 3).

Figure 2. Colony forming units-fibroblast development of

mesenchymal stromal cells in the mononuclear cells fraction (d0)

from all studied groups. The number of colonies at diagnosis is

lower than that of the other groups (d vs. end, control: p<0.0001).

Culture progression resulted in lower colony development,

becoming significant at the later passages.

Data are expressed as mean ± SEM (*: p<0.05 compared to

diagnosis).

CFU-F: Colony forming units.

Figure 3. Analysis of the cell-cycle phases. Most of the

mesenchymal stromal cells are in quiescence as the highest

percentage of cells are in the G0G1 phase.

Data are expressed as mean ± SEM.

SDF-1α and Ang-1

SDF-1α in the MSC supernatants at diagnosis was variably

expressed (median: 5334.63 pg/mL, range: 1066.70-22,480.86 pg/mL)

Table 2. Colony forming units-fibroblast development of mesenchymal stromal cells from all studied groups (P1-P5).

P1 P2 P3 P4 P5

d 26.80±2.79 21.39±3.63 19.61±4.69 23.59±3.45 19.46±3.55

d15 45.08±5.72* 34.96±5.44* 37.73±6.01* 17.59±3.48 7.82±2.21

d33 38.52±3.52* 41.40±2.87* 32.06±3.51* 21.11±2.90 17.11±2.41

Consol 47.10±3.10* 34.47±2.68* 26.78±2.30* 24.83±3.33 27.94±3.25

Maint 46.15±3.28* 33.63±3.99* 31.93±2.63* 26.50±3.32 15.12±2.02

End 48.34±4.43* 41.23±4.48* 34.20±4.28* 24.50±3.52 29.00±3.30

CTL 57.27±4.47* 43.53±3.71* 37.38±5.40* 35.67±3.2* 38.83±6.05*

Data are expressed as mean ± standard error of mean.

*Statistical significance in comparison to the d group, CTL: Cytotoxic lymphocyte

22



Supplementary Figure 1. Colony forming units-fibroblast (CFU-F) colonies of large (L), medium (M), and small (S) size at the initial (P1)

and last (P5) passages of the study. Larger colonies prevail at early passages while at the later ones the CFU-F population consists of

mainly small colonies.

Table 3. Spontaneous apoptosis, evaluated by flow cytometry after 7-amino-actinomycin D staining of mesenchymal stromal

cells at diagnosis and during treatment at passages 2 and 4 (P2, P4).

Study group P2 (%) P4 (%)

A D A D

d 4.92±2.38 2.5±0.94 3.47±0.97 2.37±1.15

d15 2.48±0.86 1.97±1.21 2.82±0.65 1.97±1.21

d33 2.65±0.59 1.07±0.56 1.42±0.27 0.52±0.25

Consol 2.01±0.45 1.4±0.38 2.2±0.32 1.05±0.21

Maint 1.97±0.38 0.97±0.57 1.2±0.65 1.67±1.2

End 2.94±0.93 3.78±1.33 1.62±0.77 1.45±1.02

CTL 1.75±0.29 0.58±0.16 0.92±0.37 0.27±0.14

Values are expressed as mean ± standard error of mean.

A: Apoptotic cells, D: dead cells, CTL: Cytotoxic lymphocyte

and did not differ in comparison with the treatment phases. Its

levels were higher in the HR group compared to the MR group

(HR=9205.77±2721.82, MR=6686.11±4006.34, p=0.021).

As far as Ang-1 expression is concerned, in the two cell

subpopulations of MNCs and MSCs, our results showed that,

similar to SDF-1α, stromal cells secreted statistically significant

higher amounts of this growth factor (Figure 4). No difference

was found in the comparison of diagnosis with treatment

groups.

Discussion

MSCs are described as fibroblast-like cells, displaying a

characteristic spindle shape, and all of our cells exhibited this

feature. As in vitro culture progresses, cells enter senescence

and MSCs become larger with irregular and flat shapes [26], not

observed in our samples. Our source though was the BM of

children, albeit leukemic BM, and our culture was followed up

to P5 [27].

23


that leukemic cells do not confer to MSCs any preferential ability

to proliferate, but they rather promote a deficient capacity,

opposing the hypothesis that MSC populations might be crucial

for the efficient promotion of the survival and proliferation of

blasts [30]. Treatment does not affect the clonogenicity as the

number of colonies produced at any time-point is similar to that

of the controls. Another factor involved in colony development

is the duration of the culture. Interestingly, the decrease of

colony number throughout passages is more profound in largeand

medium-sized colonies. Considering that large colonies

derive from more primitive cells, it becomes obvious that older

cultures contain more mature MSCs. Altogether, the above

indicate that the presence of leukemia cells at diagnosis, but

not chemotherapeutic agents, modifies BM-MSC properties.

Figure 4. The stromal cell-derived factor-1α (SDF-1α) and

angiopoietin-1 (Ang-1) expressions by both mesenchymal

stromal cells (MSCs) and mononuclear cells (MNCs) at diagnosis

and treatment. Stromal cells secrete higher amounts of both

these factors. A) Variability in their expression was noticed at

diagnosis, which became more uniform in treatment phases. B)

No difference in angiopoietin-1 levels between diagnosis and

treatment groups.

MSC: Mesenchymal stromal cell, MNC: mononuclear cell, Ang-1:

angiopoietin-1, SDF-1α: stromal cell-derived factor-1α.

MSCs from all groups at different passages were highly

expressing MSC-related markers and lacking the hematopoietic

markers, as proposed by the International Society for Cell

Therapy [28,29]. This indicates that the MSC cultures were

homogeneous, in agreement with Conforti et al. [6], and neither

disease nor treatment had any influence on them. Clonogenicity

and proliferation potential were lower at diagnosis and decreased

as the culture progressed, in partial agreement with the only study,

so far, examining the characteristics of pediatric ALL-MSCs [6].

The lowest number of colonies was developed at

diagnosis. Although this result does not stand alone to support

that it is an intrinsic defect (because of the effect of the disease on

MSCs) rather than a quantitative one, due to the lower frequency

of MSCs in BM infiltrated by leukemic cells combined, with the

fact that it continues to be seen in subsequent passages, where

the same number of MSCs are used to initiate the culture, it is

more suggestive of the hypothesis that the microenvironment

(as expressed by BM MSCs) is also affected by the leukemic

process. This result favors the observation of Conforti et al. [6]

Cell-cycle analysis revealed that most of the MSCs are in quiescence

while about 20% of the cells of the control group are at the

S phase, compared to less than 10% of the rest of the groups.

Further analysis is required in order to fully clarify this difference

found under identical culture conditions. Apoptosis remained

unaltered throughout passages, a finding reported for BM-MSCs

from children with benign hematological disorders [26]. Conforti

et al. [6] reported different results, but they evaluated apoptosis

for many passages and reported data for the latest one (P18).

Finally, we evaluated the levels of SDF-1α and Ang-1,

recently revealed as major regulators in the crosstalk between

hematopoietic progenitors and their microenvironment [31,32].

Data reporting the expression of SDF-1α by BM MSCs in patients

with hematological malignancies are limited. SDF-1α in the

supernatant of MSCs at diagnosis of ALL was slightly increased

compared to that from treatment phases, although this difference

was not statistically verified. Interestingly, HR patients exhibited

higher levels compared to the MR ones, a difference no longer

occurring upon treatment initiation. Reduced extracellular

levels of SDF-1α were assessed in hematological malignancies of

adults [33,34]. Others found increased SDF-1α secretion from

MSCs at diagnosis in adolescents and young adults with ALL,

reversed by chemotherapy [6]. In pediatric patients with acute

leukemia, SDF-1α serum levels differed depending on whether

they were evaluated in PB or BM serum (decreased expression) or

MSC supernatants at diagnosis (decrease not evident) compared

to the remission and control groups [15]. The above, combined

with our findings, further support the notion that leukemic cells

do not affect CXCL12 production and the decrease reported in

serum cannot be attributed to the productive capacity of MSCs.

We found that the lowest amount of Ang-1 was expressed

in MSC culture supernatant from diagnosis, albeit not

statistically differently from treatment phases. There is one

more study to date, on the effect of Ang-1 in childhood ALL

[35], in which the authors claimed similar findings in the MSC

supernatant and low levels of Ang-1 and Ang-2 in BM serum

at diagnosis. Nevertheless, other factors such as age-related

24



post-transcriptional effect on the expression of proteins or the

exposure of BM MSCs to fetal bovine serum and FGF-b [36]

have to be taken into consideration in order to fully exploit the

role of these molecules in leukemia.

Study Limitation

A limitation of our study is that the samples examined at

different phases of ALL are not necessarily from the same patients

longitudinally. This approach ensures a reasonable number of

samples within a reasonable timeframe for each group for a

rather rare pediatric entity and hence a stronger statistical result.

Conclusion

In conclusion, biological characteristics and functional properties

of MSCs are affected at the onset of leukemia. Most defects persist

throughout passages. MSCs recover after treatment initiation and

remission achievement and are not affected by chemotherapy.

Their secretory profile remains unaltered by the disease. The

summing of these data clearly indicates that any effect on MSCs

from the leukemic clones in childhood ALL is transient and ceases

upon treatment initiation. A standard hurdle in the comparison of

our data to other studies continues to be the diversity of working

protocols used for MSC cultures and further evaluation.

Acknowledgments

The authors would like to thank Kaparou Maria and Fillipides

Anthi for their contributions in the performance of a number

of experiments, Choumerianou Despina for her contribution

in experiments and helpful suggestions, and Koutala Helen for

technical advice and support in flow cytometry.

Ethics

Ethics Committee Approval: The study was approved by the

Ethical Committee of the University Hospital of Heraklion.


Medical Practices: E.S., M.K., C.P.; Concept: H.D., I.P., C.P., E.S.;

Design: H.D., I.P., C.P., E.S.; Data Collection or Processing: S.G.,

H.D., G.M., I.P., M.P.; Analysis or Interpretation: S.G., M.P., H.D.,

I.P., C.P., E.S., M.K.; Literature Search: S.G., I.P., H.D., G.M., Writing:

H.D.; S.G., C.P.




included.

Financial Disclosure: This work was partially supported by

the European 6 th Framework Program GENOSTEM (contract

no: 503161) and the University of Crete Secretariat Research

Committee (KA 3769).

References

1. El Marsafy S, Larghero J, Bennaceur-Griscelli A, Turhan A. Mesenchymal stem cells:

pivotal players in hematopoietic stem cell microenvironment. J Stem Cell Res Ther

2014;4:225.

2. Wong SP, Rowley JE, Redpath AN, Tilman JD, Fellous TG, Johnson JR. Pericytes,

mesenchymal stem cells and their contributions to tissue repair. Pharmacol Ther

2015;151:107-120.

3. Sacchetti B, Funari A, Michienzi S, Di Cesare S, Piersanti S, Saggio I, Tagliafico E,

Ferrari S, Robey PG, Riminucci M, Bianco P. Self-renewing osteoprogenitors in

bone marrow sinusoids can organize a hematopoietic microenvironment. Cell

2007;131:324-336.

4. Sanchez-Aguilera A, Mendez-Ferrer S. The hematopoietic stem-cell niche in health

and leukemia. Cell Mol Life Sci 2017;74:579-590.

5. Sorokina T, Shipounova I, Bigildeev A, Petinati N, Drize N, Turkina A, Chelysheva E,

Shukhov O, Kuzmina L, Parovichnikova E, Savchenko V. The ability of multipotent

mesenchymal stromal cells from the bone marrow of patients with leukemia to

maintain normal hematopoietic progenitor cells. Eur J Haematol 2016;97:245-252.

6. Conforti A, Biagini S, Del Bufalo F, Sirleto P, Angioni A, Starc N, Li Pira G, Moretta F,

Proia A, Contoli B, Genovese S, Ciardi C, Avanzini MA, Rosti V, Lo-Coco F, Locatelli F,

Bernardo ME. Biological, functional and genetic characterization of bone marrowderived

mesenchymal stromal cells from pediatric patients affected by acute

lymphoblastic leukemia. PLoS One 2013;8:e76989.

7. Shalapour S, Eckert C, Seeger K, Pfau M, Prada J, Henze G, Blankenstein T,

Kammertoens T. Leukemia-associated genetic aberration in mesenchymal stem cells

of children with acute lymphoblastic leukemia. J Mol Med (Berl) 2010;88:249-265.

8. Ge J, Hu Y, Gui Y, Hou R, Yang M, Zeng Q, Xia R. Chemotherapy-induced alteration

of SDF-1/CXCR4 expression in bone marrow-derived mesenchymal stem cells from

adolescents and young adults with acute lymphoblastic leukemia. J Pediatr Hematol

Oncol 2014;36:617-623.

9. Azab AK, Runnels JM, Pitsillides C, Moreau AS, Azab F, Leleu X, Jia X, Wright R,

Ospina B, Carlson AL, Alt C, Burwick N, Roccaro AM, Ngo HT, Farag M, Melhem MR,

Sacco A, Munshi NC, Hideshima T, Rollins BJ, Anderson KC, Kung AL, Lin CP, Ghobrial

IM. CXCR4 inhibitor AMD3100 disrupts the interaction of multiple myeloma cells

with the bone marrow microenvironment and enhances their sensitivity to therapy.

Blood 2009;113:4341-4351.

10. Noh YH, Yim YS, Kim DH, Lee MW, Kim DS, Kim HR, Lee SH, Chueh HW, Choi SJ, Oh

WI, Yang YS, Jung HL, Yoo KH, Sung KW, Koo HH. Correlation between chemokines

released from umbilical cord blood-derived mesenchymal stem cells and

engraftment of hematopoietic stem cells in nonobese diabetic/severe combined

immunodeficient (NOD/SCID) mice. Pediatr Hematol Oncol 2011;28:682-690.

11. Fouillard L, Francois S, Bouchet S, Bensidhoum M, Elm’selmi A, Chapel A. Innovative

cell therapy in the treatment of serious adverse events related to both chemoradiotherapy

protocol and acute myeloid leukemia syndrome: the infusion of

mesenchymal stem cells post-treatment reduces hematopoietic toxicity and

promotes hematopoietic reconstitution. Curr Pharm Biotechnol 2013;14:842-848.

12. Van Overstraeten-Schloge N, Beguin Y, Gothot A. Role of stromal derived factor-1

in the hematopoietic-supporting activity of human mesenchymal stem cells. Eur J

Haematol 2006:76:488-493.

13. Sharma MB, Limaye LS, Kale VP. Mimicking the functional hematopoietic stem

cell niche in vitro: recapitulation of marrow physiology by hydrogel-based threedimensional

cultures of mesenchymal stromal cells. Haematologica 2012;97:651-

660.

14. Burger JA, Kipps TJ. CXCR4: a key receptor in the crosstalk between tumor cells and

their microenvironment. Blood 2006;107:1761-1767.

15. Van den Berk LC, van der Veer A, Willemse ME, Theeuwes MJ, Luijendijk MW,

Tong WH, van der Sluis IM, Pieters R, den Boer ML. Disturbed CXCR4/CXCL12

axis in paediatric precursor B-cell acute lymphoblastic leukaemia. Br J Haematol

2014;166:240-249.

16. Fukuhara S, Sako K, Noda K, Nagao K, Miura K, Mochizuki N. Tie2 is tied at the

cell-cell contacts and to extracellular matrix by angiopoietin-1. Exp Mol Med

2009;41:133-139.

17. Arai F, Hirao A, Ohmura M, Sato H, Matsuoka S, Takubo K, Ito K, Koh GY, Suda T. Tie2/

angiopoietin-1 signaling regulates hematopoietic stem cell quiescence in the bone

marrow niche. Cell 2004;118:149-161.

25


18. Blau O, Hofmann WK, Baldus CD, Thiel G, Serbent V, Schümann E, Thiel E, Blau IW.

Chromosomal aberrations in bone marrow mesenchymal stroma cells from patients

with myelodysplastic syndrome and acute myeloblastic leukemia. Exp Hematol

2007;35:221-229.

19. Menendez P, Catalina P, Rodriguez R, Melen GJ, Bueno C, Arriero M, García-Sánchez

F, Lassaletta A, García-Sanz R, García-Castro J. Bone marrow mesenchymal stem

cells from infants with MLL-AF4+ acute leukemia harbor and express the MLL-AF4

fusion gene. J Exp Med 2009;206:3131-3141.

20. Zhao Z, Tang X, You Y, Li W, Liu F, Zou P. Assessment of bone marrow mesenchymal

stem cell biological characteristics and support hematopoiesis function in patients

with chronic myeloid leukemia. Leuk Res 2006;30:993-1003.

21. Karaöz E, Çetinalp Demircan P, Erman G, Güngörürler E, Eker Sarıboyacı A.

Comparative analyses of immune-suppressive characteristics of bone-marrow,

Wharton’s jelly, and adipose tissue-derived human MSCs. Turk J Hematol

2017;34:213-225.

22. Choumerianou DM, Martimianaki G, Stiakaki E, Kalmanti L, Kalmanti M, Dimitriou

H. Comparative study of stemness characteristics of mesenchymal cells from bone

marrow of children and adults. Cytotherapy 2010;12:881-887.

23. Dimitriou H, Linardakis E, Martimianaki G, Stiakaki E, Perdikogianni CH, Charbord P,

Kalmanti M. Properties and potential of bone marrow mesenchymal stromal cells

from children with hematologic diseases. Cytotherapy 2008;10:125-133.

24. Nicoletti I, Migliorati G, Pagliacci MC, Grignani F, Riccardi C. A rapid and simple

method for measuring thymocyte apoptosis by propidium iodide staining and flow

cytometry. J Immunol Methods 1991;139:271-279.

25. Lecoeur H, Ledru E, Prevost MC, Gougeon ML. Strategies for phenotyping

apoptotic peripheral human lymphocytes comparing ISNT, annexin V and 7-AAD

cytofluorometric staining methods. J Immunol Methods 1997;209:111-123.

26. Wagner W, Horn P, Castoldi M, Diehlmann A, Bork S, Saffrich R, Benes V, Blake J,

Pfister S, Eckstein V, Ho AD. Replicative senescence of mesenchymal stem cells: a

continuous and organized process. PLoS One 2008;3:e2213.

27. Stolzing A, Jones E, McGonagle D, Scutt A. Age-related changes in human bone

marrow-derived mesenchymal stem cells: consequences for cell therapies. Mech

Ageing Dev 2008;129:163-173.

28. Horwitz EM, Le Blanc K, Dominici M, Mueller I, Slaper-Cortenbach I, Marini FC, Deans

RJ, Krause DS, Keating A; International Society for Cellular Therapy. Clarification of

the nomenclature for MSC: the International Society for Cellular Therapy position

statement. Cytotherapy 2005;7:393-395.

29. Lv FJ, Tuan RS, Cheung KM, Leung VY. Concise review: the surface markers and

identity of human mesenchymal stem cells. Stem Cells 2014;32:1408-1419.

30. Nagasawa T. Microenvironmental niches in the bone marrow required for B-cell

development. Nat Rev Immunol 2006;6:107-116.

31. Gomes AC, Gomes MS. Hematopoietic niches, erythropoiesis and anemia of chronic

infection. Exp Hematol 2016;44:85-91.

32. Nie Y, Han YC, Zou YR. CXCR4 is required for the quiescence of primitive

hematopoietic cells. J Exp Med 2008;205:777-783.

33. Ge J, Hou R, Liu Q, Zhu R, Liu K. Stromal-derived factor-1 deficiency in the bone

marrow of acute myeloid leukemia. Int J Hematol 2011;93:750-759.

34. Khandany BK, Hassanshahi G, Khorramdelazad H, Balali Z, Shamsizadeh A, Arababadi

MK, Ostadebrahimi H, Fatehi A, Rezazadeh M, Ahmadi Z, Karimabad MN. Evaluation

of circulating concentrations of CXCL1 (Gro-α), CXCL10 (IP-10) and CXCL12 (SDF-

1) in ALL patients prior and post bone marrow transplantation. Pathol Res Pract

2012;208:615-619.

35. Karakurt N, Aksu T, Koksal Y, Yarali N, Tunc B, Uckan-Cetinkaya D, Ozguner M.

Angiopoietins in the bone marrow microenvironment of acute lymphoblastic

leukemia. Hematology 2016;21:325-331.

36. Pelagiadis I, Stiakaki E, Choulaki C, Kalmanti M, Dimitriou H. The role of children’s

bone marrow mesenchymal stromal cells in the ex vivo expansion of autologous

and allogeneic hematopoietic stem cells. Cell Biol Int 2015;39:1099-1110.

Appendix: Supplementary Materials and Methods

BM MNC Isolation and MSC Culture and Expansion

BM MNCs, following separation with Ficoll-Hypaque (1077 g/mL; Lymphoprep,

Nycomed, Oslo, Norway), were cultured in a-MEM without nucleotides in the presence

of 10% lot-selected fetal calf serum (Invitrogen Ltd., Paisley, UK) as described previously

[21]. They were seeded at a concentration of 5x10 4 cells/cm 2 in the presence of 1 ng/

mL FGF-2 (FGF-2; Abcys SA, Paris, France). A complete medium change was performed

twice a week. When layers became confluent at ~90%, cells were detached using 0.25%

trypsin/1 mM EDTA (Invitrogen Ltd.) and then replated at a concentration of 1x10 3 cells/

cm 2 (passage 1, P1). MSCs were maintained in culture for up to five passages. Assays

were performed at any of P1 to P4 depending on the cell availability.

Immunophenotyping Evaluation

Phenotypic characterization of MSCs was performed by flow cytometry at various

passages using the following monoclonal antibodies: CD105-phycoerythrin (PE)

CD146-PE, CD73-PE CD29-fluorescein isothiocyanate (FITC), CD44-FITC, CD90-FITC,

CD14-FITC, CD45-FITC, CD34-PE, and CD95-FITC (BD Biosciences, San Jose, CA, USA).

One hundred thousand cells were stained with the markers as described previously [21].

At least 10,000 events were acquired for each analysis.


MSCs, at either P2 or P3, after detachment by trypsinization (trypsin/EDTA 0.25%) were

centrifuged at 150 x g for 10 min at 4 °C and washed with PBS. In order to estimate the

percentage of cells in each phase of the cell cycle, 1x10 6 MSCs were stained with 1 mL

of propidium iodide staining solution (50 µg/mL propidium iodide, 1 mg/mL RNAse in

PBS without Ca ++ /Mg ++ , pH 7.4) for 30 min at room temperature. After the acquisition

of at least 10,000 events for each sample, cells were gated according to forward vs.

side scatter (FSC/SSC) characteristics. Cell-cycle analysis was performed using WinMDI

software, version 2.8 [22].

Apoptotic MSCs at passages P2 and P4 were detected by flow cytometry and 7-aminoactinomycin

D (7-AAD; Sigma, St. Louis, MO, USA) staining [23]. They were initially

gated according to their morphology (FSC/SSC). Then a scattergram was generated by

combining FSC with 7-AAD fluorescence to quantitate 7-AAD negative (alive), 7-AAD low

(early apoptotic), and 7-AAD high (late apoptotic/dead) cells.

Cell DT

DT was calculated according to the formula DT=t/n=t×log(2)/log (cells harvested/cells

inoculated), where t is the time between initial plating and harvest for the respective

passage.

CFU-F Formation

At day 0.1x10 5 MNCs were seeded in each well of a 24-well plate (in triplicate) in the

absence of FGF-2. At subsequent passages, MSCs were plated in 20-cm 2 petri plates

at a concentration of 10 cells/cm 2 (in duplicate). Following 14 days of culture at 37 °C

and 5% CO 2

, CFU-F was quantified after staining with Giemsa stain and categorized

according to size as small CFU-F (S: <50 cells), medium CFU-F (M: 50-500 cells), and

large CFU-F (highly proliferating; L: >500 cells). The sum of CFU-F of all sizes is denoted

as CFU-F.

Detection of SDF-1α and Ang-1 (ELISA)

A quantitative sandwich ELISA was employed for the determination of both SDF-1α

and Ang-1 in the supernatant of MSCs at any of P1 to P3 cultures (and of MNCs at

d0) within the leukemia group only. All subgroups were examined for the evaluation

of these factors through the whole course of the disease, diagnosis, and treatment. The

ELISA kits were purchased from R&D Systems, and the instructions of the manufacturer

were followed. More specifically, 100 µL for SDF-1α (50 µL for Ang-1) of standard or

sample per well was added and incubated for 2 h at room temperature on a shaker.

After well aspiration and washing, 200 µL of the corresponding conjugate was added.

Incubation was continued for 2 h further under the same conditions. After washing,

200 µL of substrate solution was added to each well for 30 min at room temperature

and then 50 µL of stop solution terminated the reaction. The optical density of each

well was determined at 450 nm with wavelength correction at 570 nm.

26

RESEARCH ARTICLE

DOI: 10.4274/tjh.2017.0021


Juvenile Myelomonocytic Leukemia in Turkey: A Retrospective

Analysis of Sixty-five Patients

Türkiye’de Juvenil Miyelomonositik Lösemi: Altmış Beş Hastanın Retrospektif Analizi

Özlem Tüfekçi 1 , Ülker Koçak 2 , Zühre Kaya 2 , İdil Yenicesu 2 , Canan Albayrak 3 , Davut Albayrak 3 , Şebnem Yılmaz Bengoa 1 ,

Türkan Patıroğlu 4 , Musa Karakükçü 4 , Ekrem Ünal 4 , Elif Ünal İnce 5 , Talia İleri 5 , Mehmet Ertem 5 , Tiraje Celkan 6 , Gül Nihal Özdemir 6 ,

Nazan Sarper 7 , Dilek Kaçar 8 , Neşe Yaralı 8 , Namık Yaşar Özbek 8 , Alphan Küpesiz 9 , Tuba Karapınar 10 , Canan Vergin 10 , Ümran Çalışkan 11 ,

Hüseyin Tokgöz 11 , Melike Sezgin Evim 12 , Birol Baytan 12 , Adalet Meral Güneş 12 , Deniz Yılmaz Karapınar 13 , Serap Karaman 14 , Vedat

Uygun 15 , Gülsun Karasu 15 , Mehmet Akif Yeşilipek 15 , Ahmet Koç 16 , Erol Erduran 17 , Berna Atabay 18 , Haldun Öniz 18 , Hale Ören 1

1

Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey

2

Gazi University Faculty of Medicine, Department of Pediatric Hematology, Ankara, Turkey

3

Ondokuz Mayıs University Faculty of Medicine, Department of Pediatric Hematology, Samsun, Turkey

4

Erciyes University Faculty of Medicine, Department of Pediatric Hematology and Oncology, Kayseri, Turkey

5

Ankara University Faculty of Medicine, Department of Pediatric Hematology and Oncology, Ankara, Turkey

6

İstanbul University Cerrahpaşa Faculty of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey

7

Kocaeli University Faculty of Medicine, Department of Pediatric Hematology, Kocaeli, Turkey

8

Ankara Children’s Hematology and Oncology Training and Research Hospital, Ankara, Turkey

9

Akdeniz University Faculty of Medicine, Department of Pediatric Hematology and Oncology, Antalya, Turkey

10

Dr. Behçet Uz Children Training and Research Hospital, Clinic of Pediatric Hematology and Oncology, İzmir, Turkey

11

Necmettin Erbakan University Meram Faculty of Medicine, Department of Pediatric Hematology, Konya, Turkey

12

Uludağ University Faculty of Medicine, Department of Pediatric Hematology, Bursa, Turkey

13

Ege University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey

14

Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Pediatric Hematology and Oncology, İstanbul, Turkey

15

Bahçeşehir University Faculty of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey

16

Marmara University Faculty of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey

17

Karadeniz Technical University Faculty of Medicine, Department of Pediatric Hematology and Oncology, Trabzon, Turkey

18

Tepecik Training and Research Hospital, Clinic of Pediatric Hematology and Oncology, İzmir, Turkey

Abstract

Objective: This study aimed to define the status of juvenile

myelomonocytic leukemia (JMML) patients in Turkey in terms of

time of diagnosis, clinical characteristics, mutational studies, clinical

course, and treatment strategies.

Materials and Methods: Data including clinical and laboratory

characteristics and treatment strategies of JMML patients were

collected retrospectively from pediatric hematology-oncology centers

in Turkey.

Results: Sixty-five children with JMML diagnosed between 2002

and 2016 in 18 institutions throughout Turkey were enrolled in the

study. The median age at diagnosis was 17 months (min-max: 2-117

months). Splenomegaly was present in 92% of patients at the time of

diagnosis. The median white blood cell, monocyte, and platelet counts

were 32.9x10 9 /L, 5.4x10 9 /L, and 58.3x10 9 /L, respectively. Monosomy

Öz

Amaç: Türkiye’deki juvenil miyelomonositik lösemi (JMML) hastalarının

durumunu, tanı zamanı, klinik özellikler, mutasyon çalışmaları, klinik

gidiş ve tedavi stratejileri açısından ortaya koymaktır.

Gereç ve Yöntemler: Ülkemizdeki pediatrik hematoloji ve onkoloji

kliniklerinden veri istenerek, JMML tanısı ile takip ve tedavisi yapılan

hastaların klinik ve laboratuvar bulguları geriye dönük olarak

değerlendirildi.

Bulgular: On sekiz merkezden, 2002-2016 tarihleri arasında JMML

tanısı alan toplam 65 hasta çalışmaya dahil edildi. Ortanca tanı

yaşı 17 ay idi (2-117 ay). Splenomegali tanıda %92 hastada vardı.

Ortanca lökosit, monosit ve trombosit sayıları sırasıyla 32,9x10 9 /L,

5,4x10 9 /L ve 58,3x10 9 /L idi. Monozomi 7, %18 hastada saptanmıştı.

JMML mutasyonları 32 hastada (%49) çalışılmış olup, en sık rastlanan

mutasyon PTPN11 idi. Hematopoetik kök hücre nakli (HKHN)



Address for Correspondence/Yazışma Adresi: Özlem TÜFEKÇİ, M.D.,

Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey

Phone : +90 232 412 61 50

E-mail : ozlemtufekci@hotmail.com ORCID-ID: orcid.org/0000-0002-0721-1025


Accepted/Kabul tarihi: February 07, 2017

27

Tüfekçi Ö, et al: Juvenile Myelomonocytic Leukemia in Turkey


7 was present in 18% of patients. JMML mutational analysis was

performed in 32 of 65 patients (49%) and PTPN11 was the most

common mutation. Hematopoietic stem cell transplantation (HSCT)

could only be performed in 28 patients (44%), the majority being

after the year 2012. The most frequent reason for not performing

HSCT was the inability to find a suitable donor. The median time from

diagnosis to HSCT was 9 months (min-max: 2-63 months). The 5-year

cumulative survival rate was 33% and median estimated survival

time was 30±17.4 months (95% CI: 0-64.1) for all patients. Survival

time was significantly better in the HSCT group (log-rank p=0.019).

Older age at diagnosis (>2 years), platelet count of less than 40x10 9 /L,

and PTPN11 mutation were the factors significantly associated with

shorter survival time.

Conclusion: Although there has recently been improvement in terms

of definitive diagnosis and HSCT in JMML patients, the overall results

are not satisfactory and it is necessary to put more effort into this

issue in Turkey.

Keywords: Hematopoietic stem cell transplantation, Juvenile

myelomonocytic leukemia, Turkey

hastaların ancak %44’üne uygulanabilmiş olup, nakillerin büyük bir

oranı 2012 yılından sonra yapılmıştı. Nakil yapılamamasının en sık

nedeni uygun donör bulunamamasıydı. Tanı aldıktan nakile kadar

geçen ortalama süre 9 ay (2-63 ay) olarak saptandı. Tüm hastalarda 5

yıllık kümülatif sağkalım oranı %33, ortanca tahmini yaşam süresi ise

30±17,4 ay (%95 CI: 0-64,1) olarak bulundu. Sağkalım süresi HKHN

yapılan hastalarda anlamlı olarak daha uzundu (log-rank p=0,019).

Tanıda 2 yaşın üstünde olmak, trombosit sayısının 40x10 9 /L’nin altında

saptanması ve PTPN11 mutasyon varlığı yaşam süresini anlamlı olarak

kısaltan faktörler olarak bulundu.

Sonuç: Ülkemizde her ne kadar son dönemlerde JMML hastalarında

kesin tanı ve HKHN açısından iyileşme kaydedilmiş olsa da genel sonuç

tatminkar değildir ve bu konu ile ilgili daha fazla çaba göstermeye

gerek vardır.

Anahtar Sözcükler: Hematopoetik kök hücre nakli, Juvenil

miyelomonositik lösemi, Türkiye

Introduction

Juvenile myelomonocytic leukemia (JMML) is a chronic

malignant myeloproliferative disease of early childhood [1].

The World Health Organization classifies JMML in the group

of myelodysplastic/myeloproliferative disorders owing to both

myelodysplastic and proliferative features of the disease [2]. It is

a rare disease comprising 2%-3% of all pediatric leukemias with

a yearly incidence of 1.2 per million children [3,4]. Symptoms

and signs of the disease result from infiltration of different

organs including the spleen, liver, lungs, and gastrointestinal

tract by leukemic cells [5,6]. Affected children generally present

at a median age of 1.8 years with pallor, fever, infection, skin

bleeding, cough, skin rash, marked splenomegaly, and sometimes

diarrhea [5,7]. Leukocytosis with marked monocytosis,

circulating myeloid/erythroid precursors, varying degrees of

myelodysplasia and thrombocytopenia in peripheral blood, and

an elevated hemoglobin F (HbF) corrected for age are common

findings that are important for diagnosis. Bone marrow aspirate

findings are not diagnostic per se but rather supportive with the

presence of hypercellularity, predominance of granulocytic cells,

and fewer than 20% blasts [5,6,7,8,9,10,11]. Monosomy 7 is the

major cytogenetic anomaly found in 20%-25% of patients [5,7].

The majority of genetic mutations identified in JMML cause

pathologic activation of the RAS-RAF-MAPK signaling pathway.

These genes include NF1, KRAS, NRAS, and PTPN1. NF1 and CBL

are found in approximately 90% of patients [1,6,8]. The advances

that have been achieved in the molecular characterization

of JMML are important not only in diagnosis, but also in

the management and prognosis of the disease, addressing

a crucial phenotype-genotype relationship [1,2,8,12,13].

Some mutation types have been associated with mild clinical

phenotypes and spontaneous remission rates, but the disease

follows an aggressive course in the majority of cases if not

treated [8,13,14,15,16,17]. Chemotherapy approaches have not

been successful; the only curative treatment known so far is

hematopoietic stem cell transplantation (HSCT) [7,8,9,11].

The characteristics of the disease together with problems in

finding a suitable donor for HSCT make the disease management

difficult, especially in a developing country. In this context,

we aimed to define the status of JMML patients in Turkey in

terms of time of diagnosis, clinical characteristics, mutational

analysis, clinical course, and treatment strategies. We think that

identifying the problems in the management of this specific

group of patients will help us achieve better care for them by

taking the necessary precautions.


Sixty-five children with JMML diagnosed between 2002 and

2016 in 18 institutions throughout Turkey were enrolled in the

study. The diagnosis of JMML was based on previously published

criteria [2,18,19,20]. Data including patient and disease

characteristics and transplantation outcome were collected by

standardized questionnaires for each patient.

Due to the retrospective nature of the study, several patients

had some missing data for some of the parameters.

Clinical Assessment

Data including age, sex, presenting symptoms at first diagnosis,

presence of recurrent fever, respiratory and gastrointestinal

problems, rash, hepatosplenomegaly, and additional findings in

physical examination were all noted.

The details of the management of the disease for each patient

including chemotherapy and HSCT were all noted.

28



Laboratory Measurements, Bone Marrow, and Genetic Studies

Hematologic data including initial complete blood count,

hemoglobin electrophoresis, analysis of peripheral blood smears,

and bone marrow aspiration slides as well as cytogenetic and

molecular genetic studies from the bone marrow aspirates were

all noted.

JMML mutations including PTPN11, NRAS, KRAS, and CBL

were all studied at the University of Freiburg in the European

Working Group on Myelodysplastic Syndromes in Childhood

(EWOG-MDS) center. Analyses for CBL mutations were started

after the year 2011.


All statistical analyses were performed using SPSS 22 (IBM Corp.,

Armonk, NY, USA). Overall survival for all patients was defined

as the time from diagnosis to death or last follow-up. Survival

probabilities were estimated by Kaplan-Meier method and

comparisons between different patient groups were performed

using two-sided log-rank tests. Prognostic factors for the length

of survival were analyzed by using the log-rank chi-square test.

The choice of variables tested was based on our own results

and other studies, and p<0.05 was considered statistically

significant.

Results

A total of 65 children were enrolled in the study. Only six had

received the diagnosis of JMML between 2002 and 2006. The

majority of the study patients (92%) had received the diagnosis

of JMML in the last 10 years (2007-2016); 52 of them (80%)

received the diagnosis after the year 2010 (Figure 1).

Clinical Features

The clinical characteristics of the patients are detailed in

Table 1.

The median age at diagnosis was 17 months (min-max: 2-117

months). Only three patients (4%) were older than 5 years old,

the eldest being 9.7 years old. There was a male predominance

with a male/female ratio of 2.25:1. The most common symptom

at presentation was fever, followed by frequent infection,

recurrent pulmonary symptoms, abdominal distension, and

skin rash. Pallor was a presenting symptom in only 12% of

patients.

Splenomegaly was present in 92% at the time of diagnosis,

whereas lymphadenopathy was noted in 18%. Four children

(6%) had the clinical diagnosis of neurofibromatosis type 1.

Laboratory Features

The hematologic data are given in Table 2. The median white

blood cell (WBC), monocyte, and platelet counts were 32.9x10 9 /L,

5.4x10 9 /L, and 58.3x10 9 /L, respectively. The hemoglobin level

was below 10 g/dL in 55 (84%) patients.

Table 1. Clinical characteristics of the patients.

Median age at diagnosis, months (minimummaximum)

n=65

17 (2-117)

Male/female 45/20

Symptoms at diagnosis n (%)

Fever 36 (55)

Recurrent fever 30 (46)

Frequent infection 28 (43)

Recurrent pulmonary symptoms 23 (35)

Abdominal distension 21(32)

Skin rash 15 (23)

Gastrointestinal system symptoms 14 (21)

Pallor 8 (12)

Signs at diagnosis n (%)

Figure 1. The distribution of newly diagnosed juvenile

myelomonocytic leukemia patients and the number of juvenile

myelomonocytic leukemia patients for whom hematopoietic

stem cell transplantation was performed according to years.

JMML: Juvenile myelomonocytic leukemia, HSCT: hematopoietic stem

cell transplantation.

Splenomegaly 60 (92)

Hepatosplenomegaly 49 (75)

Lymphadenopathy 12 (18)

Clinical diagnosis of neurofibromatosis type 1 4 (6)

29



The percentage of blasts in the bone marrow was less than 5%

in the majority (69%) of patients.

Cytogenetics and JMML Mutation Analysis

Cytogenetic study of the bone marrow was available in 49

patients; of those, 9 patients (18%) were found to have

monosomy 7 positivity (Table 2). Complex karyotypes were seen

in three patients. The remaining 37 patients (75%) had normal

karyotypes.

JMML mutation analysis was performed in 32 of 65 patients

(49%). The most common mutation was PTPN11, followed by

NRAS, KRAS, and CBL, respectively (Table 3). Seven patients were

found to have none of the screened mutations. The mutations

were all somatic, except for one germline CBL mutation.

Treatment Strategies

Treatment, either in the form of mild cytoreductive or acute

myeloid leukemia (AML)-like intensive chemotherapy, was given

to 46 of 61 patients (75%) with or without subsequent HSCT.

The combination of low-dose cytarabine (40 mg/m 2 /day) and

6-mercaptopurine was the most frequent treatment given to 11

patients (23%), followed by high dose cytarabine+etoposide in

7 patients (16%) and 6-mercaptopurine in 6 patients (15%). The

Table 2. Hematologic data of the patients at diagnosis.

Peripheral blood

n=65 Median

(minimummaximum)

other less commonly used agents in treatment were azacitidine,

cis-retinoic acid, hydroxyurea, and cytarabine, alone or in

various combinations.

HSCT was planned for 63 of 65 patients but could only be

performed in 28 (44%) patients. Five other patients (8%) were

also found to have suitable donors, but they were still waiting for

HSCT at the time of data collection. The most frequent reason for

not performing HSCT was the inability to find a suitable donor

(21 patients: 33%). Patient/family incompatibility in 5 patients

(8%) and death due to disease in 4 patients while planning HSCT

(6%) were other reasons for not performing HSCT.

“Watch and wait” was the main treatment strategy for those

two patients for whom HSCT was not planned. One of them was

a female patient with CBL mutation and the other was a male

patient with NRAS mutation.

The median time from diagnosis to HSCT was 9 months (minmax:

2-63 months).

HSCT was performed in 28 patients (44%). Three patients were

transplanted twice and two patients were transplanted three

times due to relapse. The distribution of the transplanted

patients according to years is shown in Figure 1. HSCT was

performed for 50% of the newly diagnosed JMML patients after

the year 2012. Donor type was matched sibling donor in 18

patients (64%), matched unrelated donor in 8 patients (28%),

haploidentical donor in one patient, and unrelated cord blood

in one patient.

Median hemoglobin at diagnosis, g/dL 8.8 (3.3-12.3)

Median leukocytes at diagnosis, x10 9 /L 32.9 (0.3-325)

Median monocytes at diagnosis, x10 9 /L 5.4 (1-49.1)

Median thrombocytes at diagnosis, x10 9 /L 58.3 (5-925)

Median percentage of myeloid precursors 10 (0-59)

Median percentage of HbF 8 (0-63)

Bone marrow n=58 (%)

Bone marrow blasts: <5% 40 (69)

Bone marrow blasts: 5%-20% 18 (31)

Bone marrow cytogenetics n=49 (%)

Normal karyotype 37 (75)

Monosomy 7 9 (18)

Karyotype abnormality other than monosomy 7 3 (6)

HbF: Fetal hemoglobin.

Figure 2. Survival of patients with or without hematopoietic

stem cell transplantation (patients with hematopoietic stem cell

transplantation: n=25, patients without hematopoietic stem cell

transplantation: n=40).

HSCT: Hematopoietic stem cell transplantation.

30



Survival

The 5-year cumulative survival rate of the whole group was

33%. The mean estimated survival time was 72.4±12.9 months

(95% CI: 46.9-97.9) and median estimated survival time was

30±17.4 months (95% CI: 0-64.1) for all patients. Survival time

was significantly better in the HSCT group (log-rank p=0.019)

(Figure 2). Relapse after HSCT occurred in 10 of 28 (35%)

patients. Death occurred in 31 of 62 patients (50%); of those,

12 were in the HSCT (44%) group and 19 (54%) were in the

non-HSCT group. The causes of death were HSCT toxicity (50%)

and sepsis/organ failure due to relapse (50%) in the HSCT group.

In all patients in the non-HSCT group, the cause of death was

sepsis/organ failure due to progressive disease.

Factors Influencing Survival

Older age at diagnosis (>2 years old), platelet count at diagnosis

of less than 40x10 9 /L, and PTPN11 mutation were the factors

associated with shorter survival time (Figures 3, 4, and 5; Table

4). Sex, fetal hemoglobin (HbF) percentage (<10% or ≥10%),

presence of monosomy 7, and bone marrow blast percentage at

diagnosis did not influence survival significantly (Table 4).

Figure 4. Survival of patients according to platelet count at

diagnosis (platelets <40x10 9 /L: n=21, platelets ≥40x10 9 /L: n=44).

Figure 3. Survival of patients according to age at diagnosis (age

<2 years: n=38 , age ≥2 years: n=27).

Table 3. The distribution of juvenile myelomonocytic

leukemia mutations in 32 patients.

n=32 (%)

PTPN11 9 (28)

NRAS 8 (25)

KRAS 7 (22)

CBL 1 (3)

Mutation not detected 7 (22)

Figure 5. Survival of patients according to PTPN11 mutation

status in patients for whom JMML mutation analysis was

conducted (n=32) (PTPN11 mutation: n=9, NRAS/KRAS/CBL/no

mutation: n=23).

Discussion

This retrospective clinical study reflects the diagnosis, treatment

strategies, and prognosis of 65 JMML patients from Turkey. The

clinical features of the patients were highly similar to those

reported in the literature [3,5,10,12]. In our study, the median

time of diagnosis was found as 17 months and almost all of

the patients (95%) were younger than 5 years old. The median

age of diagnosis in the previous studies was reported within a

range of 17-24 months old and more than 90% of patients were

reported to be younger than 5 years old. The male predominance

that was reported in other studies has also been observed in our

study with a male:female ratio of 2.2 [4,5,7,12,21].

31



Table 4. Factors influencing survival in patients with juvenile myelomonocytic leukemia.

Variable Number of patients Mean estimated survival time

(months), ± SE

95% CI Log-rank p

Age

Younger than 2 years

2 years and older

38

27

94±19

29±6

56-132

16-41

0.014

Sex

Male

Female

40

18

36±4

96±21

27-45

55-137

0.449

Platelet count at diagnosis

Below 40x10 9 /L

40x10 9 /L or above

21

44

22±4

87±15

12-31

56-118

0.024

Mutational status

PTPN11 mutation

NRAS/KRAS/CBL/no mutation

9

23

14±3

83±11

7-22

61-105

0.004

HbF level

Less than 10%

10% or more

26

15

97±21

38±9

55-140

20-56

0.162

Monosomy 7

Positive

Negative

9

40

32±6

59±9

19-45

39-78

0.903

Bone marrow blasts

Less than 5%

5%-20%

38

16

94±16

29±6

62-125

17-41

0.165

Patients with JMML have been commonly reported to present

with symptoms of pallor, fever, infection, skin bleeding, cough,

skin rash, and sometimes diarrhea [5,7]. The major presenting

symptoms were fever and recurrent infection in the present study.

Recurrent pulmonary infections and gastrointestinal symptoms

were also seen in a substantial number of patients in this study.

However, pallor was not a common symptom, which was reported

as the major frequent symptom in the EWOG-MDS study [5]. In

fact, the median hemoglobin level was 8.1 g/dL in our study and

84% of patients had an initial hemoglobin value of less than 10

g/dL. This was a retrospective study collecting data from patients’

records and so pallor might have been overlooked.

The presence of splenomegaly is a hallmark in the diagnosis of

JMML; nevertheless, it has been reported that 7% of patients do

not have splenomegaly at the time of diagnosis [6]. Similarly,

splenomegaly was present in 92% of our patients at the time

of diagnosis. Lymphadenopathy, on the other hand, was not as

frequent in our patients as reported by the EWOG-MDS study

[5]. Neurofibromatosis type 1 has been well recognized to have

a 200- to 500-fold increased risk for development of JMML and

has been reported in 8%-14% of JMML patients [5,10,22,23,24].

It was present in 4 patients (6%) in our study.

Patients with JMML generally present with leukocytosis,

monocytosis, and thrombocytopenia [5,6,7,8]. The hematologic

data in our study were highly similar to those reported in the

literature [5,7,12]. In our study, the median WBC, monocyte,

and platelet counts were 32.9x10 9 /L, 5.4x10 9 /L, and 58.3x10 9 /L,

respectively. The median HbF value was 8%. Locatelli et al. [7]

reported the median WBC, monocyte, and platelet counts as

34x10 9 /L, 5.5x10 9 /L, and 65x10 9 /L, respectively, and the HbF

value as 9%. These data show that although there might be

some differences in the clinical presentation, hematologic data

do not differ significantly among JMML patients.

Major advances have been achieved in defining the genomic

landscape of JMML in recent years [1,6,11,12,13,14,15,16,17].

Progress in the discovery of the underlying mutations helped in

the definitive diagnosis of the patients and also led physicians

to establish a phenotype-genotype relationship, predict the

clinical outcome, and determine a treatment strategy. In JMML,

for patients with NF1 and somatic mutations of PTPN11 and

K-RAS, and for the majority of patients with somatic NRAS

mutations, HSCT is recommended as the first treatment option

[8]. As patients with germline CBL and a few patients with

somatic NRAS mutations were reported to have had spontaneous

remission, careful follow-up rather than HSCT is recommended

in the first place for those patients [8,14,15,16,17]. In our study,

mutational analysis was done for only 32 patients (49%) at the

EWOG-MDS center. PTPN11 mutation was the most frequently

seen mutation (28%) and was also associated with significantly

32



lower survival rates compared to other mutations. Somatic

PTPN11 mutations constitute ~35% of all JMML mutations and

in some series have been reported to be associated with lower

survival rates compared to other mutations [12,25,26]. Given

the fact that the majority of the patients in this study had the

diagnosis of JMML after 2010, mutational analysis was possible

for most of them. In this respect, we hope that this study

increases the awareness of JMML among physicians in terms

of diagnosis as well as mutational analysis in order to outline

a treatment strategy and to start a donor screening program

immediately for HSCT if indicated.

The only curative treatment approach in JMML to date has been

HSCT [7,8,27,28,29]. HSCT was planned for all but two patients

but could only be performed in 44% of the patients and it

was associated with better survival time compared to those

who were not transplanted. Mild cytoreductive or AML-like

intensive chemotherapy was given to the majority of patients.

Approximately one-third of the patients lacked a suitable donor

for transplantation. The median time from the time of diagnosis

to HSCT has been reported as between 6 and 10 months in various

studies [7,27,28]. It was 9 months in our study, comparable to

other studies, but 6% of the patients died while waiting for

HSCT. It seems that besides finding a suitable donor we also had

problems in performing HSCT. However, Turkey has made great

progress in stem cell transplantation in the recent years. Besides

the tremendous increase in the number of well-equipped stem

cell transplantation centers in the last 5 years, difficulties in

finding suitable donors have been mainly overcome. A national

bone marrow bank, called Turkey Stem Cell Coordination Center,

was established by the Turkish Ministry of Health in 2014 and

has reached a substantial number of volunteer donors over

time [30]. Along with these developments, most of our patients

had stem cell transplantation in the recent years. Indeed, much

effort has been needed, as HSCT remains the only curative

treatment for this disease.

Factors associated with poor prognosis other than mutational

status have been reported as older age at diagnosis (>2 years),

platelet count of <33-40x10 9 /L, and increased HbF level at

diagnosis [4,5]. Consistent with the literature, besides PTPN11

mutation, age older than 2 years and platelet count of less

than 40x10 9 /L were associated with lower survival rates in our

study. Patients with HbF level greater than 10%, as well as male

sex and higher bone marrow blast percentage (5%-20%) at

diagnosis, seemed to have worse outcomes, but the statistical

differences were not significant.

The natural course of JMML is aggressive and the great majority

of patients die if the disease is left untreated [4,5,10]. The

5-year overall survival rate in JMML patients has been reported

as 30%-40% in older studies [4,10]. However, with HSCT, the

EWOG-MDS study reported the 5-year probability of overall

survival as 64%, with the median observation time of patients

alive being 40 months (min-max: 6-44) [7]. In our study, the

5-year cumulative survival rate of all patients was 33%, the

median estimated time of survival was 30±17.4 months, and

the most common cause of death was sepsis/organ failure due

to progressive disease. This low survival rate in our patients

obviously results from the low transplantation rate. Relapse

after allogeneic stem cell transplantation has been a great

problem in patients with JMML, occurring in one-third of

transplanted patients [7,27,29]. The relapse rate was 35% in our

study, and half of the relapsed patients had received more than

one transplant.

Conclusion

In summary, the genotype-phenotype relationship becomes

increasingly important in JMML. As a result, mutational analysis

is important not only for definitive diagnosis of the disease but

also to determine the indication and urgency for HSCT, and to

promptly initiate donor screening if necessary. Although there

is a possibility of spontaneous remission with certain types of

mutations, HSCT still remains the only curative treatment for

this disease. As the main reason for not performing HSCT was

the inability to find a suitable donor in this study, we think that

it is necessary to put more effort into this issue in Turkey.

Ethics

Ethics Committee Approval: Retrospective study.

Informed Consent: Not applicable.


Surgical and Medical Practices: Ö.T., Ü.K., Z.K., İ.Y., C.A., D.A.,

Ş.Y.B., T.P., M.K., E.Ü., E.Ü.İ., T.İ., M.E., T.C., G.N.Ö., N.S., D.K., N.Y.,

N.Y.Ö., A.K., T.K., C.V., Ü.Ç., H.T., M.S.E., B.B., A.M.G., D.Y.K., S.K.,

V.U., G.K., M.A.Y., A.K., E.E., B.A., H.Ö., H.Ö.; Concept: Ö.T., H.Ö.;

Design: Ö.T., H.Ö.; Data Collection or Processing: Ö.T., Ü.K., Z.K.,

İ.Y., C.A., D.A., Ş.Y.B., T.P., M.K., E.Ü., E.Ü.İ., T.İ., M.E., T.C., G.N.Ö.,

N.S., D.K., N.Y., N.Y.Ö., A.K., T.K., C.V., Ü.Ç., H.T., M.S.E., B.B.,

A.M.G., D.Y.K., S.K., V.U., G.K., M.A.Y., A.K., E.E., B.A., H.Ö., H.Ö.;

Analysis or Interpretation: Ö.T., Ş.Y., H.Ö.; Literature Search: Ö.T.;

Writing: Ö.T., Ş.Y., H.Ö.

Conflict of Interest: The authors of this paper have no conflicts of

interest, including specific financial interests, relationships, and/or

affiliations relevant to the subject matter or materials included.

References

1. Chang TY, Dvorak CC, Loh ML. Bedside to bench in juvenile myelomonocytic

leukemia: insights into leukemogenesis from a rare pediatric leukemia.

Blood 2014;124:2487-2497.

2. Arber DA, Orazi A, Hasserjian R, Thiele J, Borowitz MJ, Le Beau MM,

Bloomfield CD, Cazzola M, Vardiman JW. The 2016 revision to the World

Health Organization classification of myeloid neoplasms and acute

leukemia. Blood 2016;127:2391-2405.

33



3. Hasle H, Wadsworth LD, Massing BG, McBride M, Schultz KR. A populationbased

study of childhood myelodysplastic syndrome in British Columbia,

Canada. Br J Haematol 1999;106:1027-1032.

4. Passmore SJ, Chessells JM, Kempski H, Hann IM, Brownbill PA, Stiller CA.

Paediatric myelodysplastic syndromes and juvenile myelomonocytic

leukemia in the UK: a population based study of incidence and survival. Br

J Haematol 2003;121:758-767.

5. Niemeyer CM, Arico M, Basso G, Biondi A, Cantu Rajnoldi A, Creutzig U,

Haas O, Harbott J, Hasle H, Kerndrup G, Locatelli F, Mann G, Stollmann-

Gibbels B, van’t Veer-Korthof ET, van Wering E, Zimmermann M. Chronic

myelomonocytic leukemia in childhood: a retrospective analysis of 110

cases. European Working Group on Myelodysplastic Syndromes in Childhood

(EWOG-MDS). Blood 1997;89:3534-3543.

6. Loh ML. Recent advances in the pathogenesis and treatment of juvenile

myelomonocytic leukaemia. Br J Haematol 2011;152:677-687.

7. Locatelli F, Nöllke P, Zecca M, Korthof E, Lanino E, Peters C, Pession A,

Kabisch H, Uderzo C, Bonfim CS, Bader P, Dilloo D, Stary J, Fischer A, Révész

T, Führer M, Hasle H, Trebo M, van den Heuvel-Eibrink MM, Fenu S, Strahm

B, Giorgiani G, Bonora MR, Duffner U, Niemeyer CM; European Working

Group on Childhood MDS; European Blood and Marrow Transplantation

Group. Hematopoietic stem cell transplantation (HSCT) in children with

juvenile myelomonocytic leukemia (JMML): results of the EWOG-MDS/

EBMT trial. Blood 2005;105:410-419.

8. Locatelli F, Niemeyer CM. How I treat juvenile myelomonocytic leukemia.

Blood 2015;125:1083-1090.

9. Niemeyer CM, Kratz CP. Paediatric myelodysplastic syndromes and juvenile

myelomonocytic leukaemia: molecular classification and treatment options.

Br J Haematol 2008;140:610-624.

10. Passmore SJ, Hann IM, Stiller CA, Ramani P, Swansbury GJ, Gibbons B,

Reeves BR, Chessells JM. Pediatric myelodysplasia: a study of 68 children

and a new prognostic scoring system. Blood 1995;85:1742-1750.

11. Sakashita K, Matsuda K, Koike K. Diagnosis and treatment of juvenile

myelomonocytic leukemia. Pediatr Int 2016;58:681-690.

12. Yoshida N, Yagasaki H, Xu Y, Matsuda K, Yoshimi A, Takahashi Y, Hama A,

Nishio N, Muramatsu H, Watanabe N, Matsumoto K, Kato K, Ueyama J,

Inada H, Goto H, Yabe M, Kudo K, Mimaya J, Kikuchi A, Manabe A, Koike K,

Kojima S. Correlation of clinical features with the mutational status of GM-

CSF signaling pathway-related genes in juvenile myelomonocytic leukemia.

Pediatr Res 2009;65:334-340.

13. Matsuda K, Shimada A, Yoshida N, Ogawa A, Watanabe A, Yajima S, Iizuka S,

Koike K, Yanai F, Kawasaki K, Yanagimachi M, Kikuchi A, Ohtsuka Y, Hidaka E,

Yamauchi K, Tanaka M, Yanagisawa R, Nakazawa Y, Shiohara M, Manabe A,

Kojima S, Koike K. Spontaneous improvement of hematologic abnormalities

in patients having juvenile myelomonocytic leukemia with specific RAS

mutations. Blood 2007;109:5477-5480.

14. Flotho C, Kratz CP, Bergsträsser E, Hasle H, Starý J, Trebo M, van den Heuvel-

Eibrink MM, Wójcik D, Zecca M, Locatelli F, Niemeyer CM; European Working

Group of Myelodysplastic Syndromes in Childhood. Genotype-phenotype

correlation in cases of juvenile myelomonocytic leukemia with clonal RAS

mutations. Blood 2008;111:966-967.

15. Loh ML, Sakai DS, Flotho C, Kang M, Fliegauf M, Archambeault S, Mullighan

CG, Chen L, Bergstraesser E, Bueso-Ramos CE, Emanuel PD, Hasle H, Issa

JP, van den Heuvel-Eibrink MM, Locatelli F, Stary J, Trebo M, Wlodarski M,

Zecca M, Shannon KM, Niemeyer CM. Mutations in CBL occur frequently in

juvenile myelomonocytic leukemia. Blood 2009;114:1859-1863.

16. Niemeyer CM, Kang MW, Shin DH, Furlan I, Erlacher M, Bunin NJ, Bunda

S, Finklestein JZ, Gorr TA, Mehta P, Schmid I, Kropshofer G, Corbacioglu S,

Lang PJ, Klein C, Schlegel PG, Heinzmann A, Schneider M, Starý J, van den

Heuvel-Eibrink MM, Hasle H, Locatelli F, Sakai D, Archambeault S, Chen L,

Russell RC, Sybingco SS, Ohh M, Braun BS, Flotho C, Loh ML. Germline CBL

mutations cause developmental abnormalities and predispose to juvenile

myelomonocytic leukemia. Nat Genet 2010;42:794-800.

17. Matsuda K, Taira C, Sakashita K, Saito S, Tanaka-Yanagisawa M, Yanagisawa

R, Nakazawa Y, Shiohara M, Fukushima K, Oda M, Honda T, Nakahata T, Koike

K. Long-term survival after nonintensive chemotherapy in some juvenile

myelomonocytic leukemia patients with CBL mutations, and the possible

presence of healthy persons with the mutations. Blood 2010;115:5429-

5431.

18. Pinkel D. Differentiating juvenile myelomonocytic leukemia from infectious

disease. Blood 1998;91:365-367.

19. Hasle H, Niemeyer CM, Chessells JM, Baumann I, Bennett JM, Kerndrup G,

Head DR. A pediatric approach to the WHO classification of myelodysplastic

and myeloproliferative diseases. Leukemia 2003;17:277-282.

20. Chan RJ, Cooper T, Kratz CP, Weiss B, Loh ML. Juvenile myelomonocytic

leukemia: a report from the 2nd International JMML Symposium. Leuk Res

2009;33:355-362.

21. Yoshida N, Hirabayashi S, Watanabe S, Zaike Y, Tsuchida M, Yoshimi A,

Masunaga A, Otsuka Y, Ito M, Kojima S, Nakahata T, Manabe A. Prognosis

of 75 patients with juvenile myelomonocytic leukemia: prospective study

by MDS committee in the Japanese Society of Pediatric Hematology. Rinsho

Ketsueki 2011;52:1853-1858.

22. Bader JL, Miller RW. Neurofibromatosis and childhood leukemia. J Pediatr

1978;92:925-929.

23. Stiller CA, Chessells JM, Fitchett M. Neurofibromatosis and childhood

leukaemia/lymphoma: a population-based UKCCSG study. Br J Cancer

1994;70:969-972.

24. Side L, Taylor B, Cayouette M, Conner E, Thompson P, Luce M, Shannon

K. Homozygous inactivation of the NF1 gene in bone marrow cells from

children with neurofibromatosis type 1 and malignant myeloid disorders. N

Engl J Med 1997;336:1713-1720.

25. Tartaglia M, Niemeyer CM, Fragale A, Song X, Buechner J, Jung A, Hählen

K, Hasle H, Licht JD, Gelb BD. Somatic mutations in PTPN11 in juvenile

myelomonocytic leukemia, myelodysplastic syndromes and acute myeloid

leukemia. Nat Genet 2003;34:148-150.

26. Park HD, Lee SH, Sung KW, Koo HH, Jung NG, Cho B, Kim HK, Park IA, Lee KO,

Ki CS, Kim SH, Yoo KH, Kim HJ. Gene mutations in the Ras pathway and the

prognostic implication in Korean patients with juvenile myelomonocytic

leukemia. Ann Hematol 2012;91:511-517.

27. Manabe A, Okamura J, Yumura-Yagi K, Akiyama Y, Sako M, Uchiyama H,

Kojima S, Koike K, Saito T, Nakahata T; MDS Committee of the Japanese

Society of Pediatric Hematology. Allogeneic hematopoietic stem cell

transplantation for 27 children with juvenile myelomonocytic leukemia

diagnosed based on the criteria of the International JMML Working Group.

Leukemia 2002;16:645-649.

28. Smith FO, King R, Nelson G, Wagner JE, Robertson KA, Sanders JE, Bunin N,

Emaunel PD, Davies SM; National Marrow Donor Program. Unrelated donor

bone marrow transplantation for children with juvenile myelomonocytic

leukaemia. Br J Haematol 2002;116:716-724.

29. Locatelli F, Niemeyer C, Angelucci E, Bender-Götze C, Burdach S, Ebell W,

Friedrich W, Hasle H, Hermann J, Jacobsen N, Klingebiel T, Kremens B, Mann

G, Pession A, Peters C, Schmid HJ, Stary J, Suttorp M, Uderzo C, van’t Veer-

Korthof ET, Vossen J, Zecca M, Zimmermann M. Allogeneic bone marrow

transplantation for chronic myelomonocytic leukemia in childhood: a

report from the European Working Group on Myelodysplastic Syndrome in

Childhood. J Clin Oncol 1997;15:566-573.

30. Türk Kızılay. Kök Hücre Bağış. Available online at http://www.kanver.org/

sayfa/kan-hizmetleri/kok-hucre-bagisi/53.

34

RESEARCH ARTICLE

DOI: 10.4274/tjh.2016.0502


Transformation of Mycosis Fungoides/Sezary Syndrome: Clinical

Characteristics and Prognosis

Mikozis Fungoides/Sezary Sendromunda Transformasyon: Klinik Özellikler ve Prognoz

Seçil Vural 1 , Bengü Nisa Akay 1 , Ayşenur Botsalı 1 , Erden Atilla 2 , Nehir Parlak 1,3 , Aylin Okçu Heper 4 , Hatice Şanlı 1

1Ankara University Faculty of Medicine, Department of Dermatology, Ankara, Turkey

2Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey

3Etimesgut Şehit Sait Ertürk State Hospital, Clinic of Dermatology, Ankara, Turkey

4Ankara University Faculty of Medicine, Department of Pathology, Ankara, Turkey

Abstract

Objective: Transformed mycosis fungoides (T-MF) is a rare variant

of MF with an aggressive course. In this study, we aimed to

describe characteristics of MF/Sezary syndrome (SS) patients with

transformation.

Materials and Methods: Patients diagnosed with T-MF among MF/

SS patients between 2000 and 2014 in a tertiary single center were

evaluated retrospectively. Demographic data, clinical data, laboratory

data, immunophenotype features, response to treatment, survival, and

histopathologic features were analyzed.

Results: Among 254 MF patients, 25 patients with T-MF were

identified (10.2%) and included in the study. The male-to-female ratio

was 2.6/1. The median time between MF diagnosis and transformation

was 32 months (range: 0-192). Nine (36%) patients were diagnosed

initially with T-MF. Advanced disease stage and high serum lactate

dehydrogenase (LDH) levels were indicators of poor prognosis and

treatment response. Five of the 18 patients with progressive disease

had undergone allogeneic hematopoietic stem cell transplantation

(allo-HSCT). Allo-HSCT resulted in complete remission in three (60%)

patients. Ten (40%) patients died as a result of disease progression.

Mean survival time was 25.2±14.9 (2-56) months after transformation.

Conclusion: Advanced stage, high serum LDH levels, and loss of

CD26 and CD7 expression in the peripheral blood are poor rognostic

factors in T-MF. Treatment-resistant tumors and nodules should be

cautionary for T-MF. Patients with T-MF have a shortened survival.

Some patients may respond to first-line treatments. However, the

majority of patients who do not respond to first-line therapies also

are unresponsive to second or third-line therapies. Allo-HSCT may be

an alternative option in patients with T-MF.

Keywords: Anaplastic, Transformation, Mycosis fungoides,

Transformed, Allogeneic hematopoietic stem cell transplantation,

Sezary syndrome

Öz

Amaç: Transforme mikozis fungoides (T-MF) MF nadir görülen

agresif seyirli bir alt tipidir. Bu çalışmada transformasyon gelişen MF/

Sezary sendromu (SS) hastalarının klinik ve laboratuvar özelliklerinin

değerlendirilmesi amaçlanmıştır.

Gereç ve Yöntemler: Bu çalışmada tek bir referans merkezde 2000-

2014 yılları arasında takip edilen MF/SS hastaları arasından T-MF

geliştirenler retrospektif olarak değerlendirilmiştir. Demografik,

klinik ve laboratuvar veriler, immünfenotiplendirme, tedavi yanıtları,

histopatolojik özellikler ve sağkalım analiz edilmiştir.

Bulgular: Takip edilen 254 MF hastası içerisinde 25 T-MF saptanarak

(%10,2) çalışmaya dahil edilmiştir. Erkek kadın oranı 2,6/1’dir.

MF tanısı ile T-MF tanısı arasında geçen sürenin medianı 32 ay

olarak tespit edilmiştir (0-192). Dokuz hastada (%36) tanı anında

transformasyon bulunmaktadır. İleri hastalık evresi ve yüksek serum

laktat dehidrogenaz (LDH) düzeyleri kötü prognoz ve tedavi yanıtı

göstergesi olarak saptanmıştır. Tedaviye dirençli 18 ileri evre hastadan

beşine allojenik hematopoetik kök hücre transplantasyonu (allo-HKHT)

yapılmıştır. Bunlardan üçünde tam remisyon sağlanmıştır. İzlemde

toplam 10 hasta hastalık progresyonu nedeniyle kaybedilmiştir. T-MF

sonrası ortalama sağkalım 25,2±14,9 (2-56) aydır.

Sonuç: İleri hastalık evresi, yüksek LDH düzeyi, perifer kan T hücrelerde

CD26 ve CD7 kaybı kötü prognoz belirteçlerindendir. Tedaviye dirençli

nodül ve tümörler T-MF açısından şüphe uyandırmalıdır. T-MF’de

sağkalım kısalmıştır. Bazı hastalarda birinci basamak tedavilere iyi

yanıt alınabilmektedir. Ancak birinci basamak tedavilere yanıtsız

hastalar genellikle ikinci ve üçüncü basamak tedavilere de direnç

gösterebilmektedir. Allo-HKHT, T-MF hastalarında alternatif bir tedavi

yöntemi olarak kullanılabilir.

Anahtar Sözcükler: Anaplastik, Transformasyon, Mikozis fungoides,

Transforme, Allojenik hematopoetik kök hücre transplantasyonu,

Sezary sendromu



Address for Correspondence/Yazışma Adresi: Seçil VURAL, M.D.,

Ankara University Faculty of Medicine, Department of Dermatology, Ankara, Turkey

Phone : +90 505 432 46 82

E-mail : secilsaral@gmail.com ORCID-ID: orcid.org/0000-0001-6561-196X

Received/Geliş tarihi: December 30, 2016

Accepted/Kabul tarihi: May 22, 2017

35

Vural S, et al: Transformation of Mycosis Fungoides


Introduction

Mycosis fungoides (MF) is the most common subtype of

cutaneous T-cell lymphoma (CTCL). Generally, MF has an

indolent course with slow progression from patch/plaque-stage

disease to cutaneous tumors [1]. However, in the case of largecell

transformation (LCT), it is associated with an aggressive

clinical course and poor survival [2].

Diagnosis of transformed MF (T-MF) is based on the presence

of large cells (CD30 +/-) exceeding 25% of the infiltrate

throughout the lesion or forming microscopic nodules of large

cells [3]. Molecular studies have demonstrated that the largecell

infiltrate in T-MF/Sezary syndrome (SS) represents evolution

from the original clone [4].

Advanced stage of MF at the time of transformation and

folliculotropism are suggested as the most important factors

affecting survival [2]. Additionally, early transformation in MF

lesions was described as a poor prognostic factor in previous

studies [5]. Even though the CD30 expression is more common

in advanced MF, in T-MF, it is reported as a favorable prognostic

factor [6,7,8].

Risk factors associated with an aggressive course of T-MF are

not well described in the literature due to the low incidence of

MF/SS and thus T-MF. In different series, the incidence of T-MF

has been reported to range between 8% and 55% among MF

patients [3,5,9,10,11]. This study was designed to investigate the

clinical, laboratory, and histopathological parameters associated

with T-MF.


We retrospectively evaluated all MF/SS patient records in a

single reference center in Ankara, Turkey, from 2000 to 2014.

Among all MF/SS patients, T-MF patients with at least one

histopathologically confirmed biopsy were included in the study.

For each case, clinical features were evaluated by three

dermatologists and histopathological findings were reviewed by

one pathologist who was an expert in this area.

All patients were classified according to the International

Society for Cutaneous Lymphomas and European Organisation

of Research and Treatment of Cancer revised criteria of 2007

[12]. Staging included physical examination, blood cell count

and chemistry, peripheral blood smear and flow cytometry,

lymph node ultrasonography, and, in most cases, computed

tomography scans of the abdomen, chest, and pelvis.

Histopathology included one or multiple skin biopsies for all

patients. In the case of clinically and sonographically significant

adenopathy, a lymph node biopsy was performed.

The accompanying prognostic factors were also analyzed: age,

sex, age at diagnosis of T-MF, presence of folliculotropism in

skin lesions, CD30 expression in more than 75% of cutaneous

neoplastic T cells, serum lactate dehydrogenase (LDH) levels,

serum β2-microglobulin levels, and eosinophilia. The time

interval between MF and T-MF, clinical stage at the time of

T-MF, and survival were analyzed.

Therapies were classified as first-, second-, and third-line

treatments according to the 2014 National Comprehensive

Cancer Network Clinical Practice Guidelines in Oncology [13,14].

Allogeneic hematopoietic stem cell transplantation (allo-HSCT)

and autologous stem cell transplantation were evaluated

separately.

Response to treatment was evaluated as follows: complete

response (CR), complete resolution of the disease; partial

response (PR), at least 50% improvement compared with

baseline; stable disease (SD), some improvement (25% to 50%

improvement in lesions) plus reduction in the size of axillary

and inguinal lymph nodes in the absence of significant evidence

of disease; or progressive disease (PD), more than 25% increase

in the number or size of clinically abnormal lymph nodes, or

development of novel tumors or pathologically positive nodes

or visceral disease [12].


The data obtained from patients were analyzed with SPSS 16.0.

The Mann-Whitney U test, chi-square test, Spearman’s test,

and Mantel-Cox analysis were used to compare variables. The

Kaplan-Meier method was used to determine overall survival.

Results

Clinical Data

The disease stage and exact TNMB stages of patients, initial

treatments, and follow-up data of each patient are summarized

in Table 1. Durations between the diagnosis of MF and

transformation and the follow-up duration are given in Table

2. The rate of T-MF was 10.2% (n=25) among all MF/SS patients

(n=254). The median age at the time of MF diagnosis was 49

years (range: 26-76), whereas the median age at the time

of transformation was 54 years (range: 30-78). The male-tofemale

ratio was 2.6 (M/F: 18/7). Sex was not significantly related

to survival (p=0.218). Patients’ age at the time of transformation

was also not related to survival (p=0.697). Transformation was

detected in 36% (n=9) of the patients at the onset of MF. The

median time between the diagnosis of MF and transformation

was 32 months (range: 0-192). Patients were followed for a

mean of 39.4±17.1 months after transformation.

Two of 25 patients with T-MF (8%) had early patch and plaque

MF (stage IA: 1, stage 1B: 1). Twenty-three patients had

advanced-stage disease [stage IIB (n=9, 36%), stage III (n=3,

12%), stage IVA 1

(n=8, 32%), stage IVA 2

(n=2, 8%), and stage

36



Table 1. Characteristics of patients with transformed mycosis fungoides.

Diagnosis and

stage

Sex and age Initial treatment Response to treatment

Follow-up

(months)

MF IA M 36 1 st line (PUVA, IFN) Complete remission 51 CR

MF IB F 52 1 st line (PUVA, INF, ECP, bexarotene) Stable disease 37 PD

MF IIB M 58 1 st line (PUVA, IFN, ECP, bexarotene) Progression 13 PD

MF IIB M 78 1 st line (PUVA, IFN, bexarotene, ECP) Progression 47 PD

MF IIB M 48 1 st line (PUVA, IFN) Progression 20 PD

MF IIB M 61 1 st line (PUVA, ECP, Roferon) SD 49 SD

MF IIB M 56

1 st line (PUVA, ECP, Roferon,

bexarotene, local RT)

Progression 30 PD

MF IIB M 43 1 st line (PUVA, Roferon, bexarotene) SD 51 SD

MF IIB M 40 1 st line (PUVA, IFN, local RT) SD 34 SD

MF IIB M 48 1 st line (PUVA, IFN) Complete remission 70 CR

MF IIB F 30 1 st line (PUVA, IFN, ECP, bexarotene) Progression 59 PD

MF III F 50 1 st line (PUVA, IFN) PR 16 PR

MF III M 59

1 st line (PUVA, IFN, ECP), 3 rd line

(CHOPx6)

Progression 29 E

MF III M 75 1 st line (PUVA, IFN) SD 59 SD

MF IVA2 M 33 3 rd line* (CHOPx6), 1 st line (local RT)

Progression**

25 CR

MF IVA2 F 69 1 st line (PUVA, ECP, IFN) Progression 19 E

MF IVA2 M 49

1 st line (PUVA, IFN, ECP, HDAC

inhibitor)

Progression** 56 E

MF IVA2 M 60 1 st line (PUVA, IFN, bexarotene, ECP) Progression** 19 E

MF IVA2 M 48

1 st line (PUVA, IFN, ECP, HDAC

inhibitor), 2 nd line (gemcitabine)

Progression 29 E

SS IVA2 F 54 1 st line (PUVA, IFN) Progression** 40 E

SS IVA2 M 55 1 st line (methotrexate, PUVA, IFN, ECP) Progression 13 E

SS IVA1 F 51

1 st line (PUVA, ECP, IFN, HDAC

inhibitor, local electron beam

radiotherapy)

Progression 19 E

SS IVA2 M 48 1 st line (PUVA, IFN, ECP) Progression** 54

SS IVA2 M 53 1 st line (ECP, IFN) Progression 18 Exitus

SS IVA1 F 48 3 rd line (CHOPx6)* Progression 2 Exitus

Last follow-up

Complete

remission

*Before admission, **Patients referred for allogeneic hematopoietic stem cell transplantation due to progressive disease.

ECP: Extracorporeal photopheresis, PUVA: psoralen ultraviolet A, IFN: interferon-alpha 2a, CHOP: cyclophosphamide, doxorubicin, vincristine, and prednisolone regimen chemotherapy,

HDAC: histone deacetylase, CR: complete remission, PR: partial remission, SD: stable disease, PD: progressive disease; E: exitus.

IVB (n=1, 4%)]. Most patients had transformation only at a skin

site (96%); in one patient skin and lymph, node transformations

were detected simultaneously (4%). Furthermore, 32% of T-MF

patients presented with a new or enlarging tumor accompanied

by long-standing plaque lesions. Dermatological examination

at the time of T-MF diagnosis for the rest of the patients

revealed the following: two (8%) patients had long-standing

enlarging tumors, four (16%) patients had a new tumor

accompanied with erythroderma (one bullous), one (4%)

patient demonstrated ichthyosiform erythroderma, three (12%)

patients had an enlarging plaque with erythroderma, three

(12%) patients had long-standing plaques, two (8%) patients

had newly scattered papules distinct from MF plaques, one

(4%) patient showed an abrupt onset of multiple pink scattered

nodules, and another patient (4%) had follicular papules

associated with hair loss within the involved area (Figure 1).

Histopathological examinations of the transformation site

showed tumoral lesions in 18 (72%) cases and plaque lesions

in seven (28%) cases. Lesion subtype (plaque or tumor) was not

significantly correlated with survival (p=0.678). Less prominent

37

Vural S, et al: Transformation of Mycosis Fungoides Turk J Hematol 2018;35:35-41

or focal epidermotropism was present in 15 (60%) of the 25

patients in our study, and only 2 (8%) patients had Pautrier

microabscesses. Folliculotropism was observed in ten cases

(40%) with LCT. In eight (80%) of them, there was progression

under treatment, while in one (10%) patient PR to treatment

and in 1 (10%) patient CR was observed. Folliculotropism was

not correlated statistically with survival (p=0.568).

correlated with poor survival (p=0.017). Loss of CD7 expression

(more than 40%) was significantly related to poor survival

(p=0.001).

Laboratory findings are summarized in Table 3. High serum

LDH levels were correlated significantly with poor survival

(p=0.000). There was a statistically significant relationship

Immunophenotype analysis of the skin biopsies showed that

24 (96%) patients had a CD3 + CD4 + CD8 − T-cell phenotype

and one (4%) patient had a double CD4 + CD8 + T-cell aberrant

phenotype. In most cases (88%), there was partial loss of one

or more pan-T-cell antigens. Loss of CD7 expression was seen in

22 (88%) patients.

CD30 positivity in more than 75% of all the large T cells was

present in skin biopsies of five patients (20%). In the remaining

20 (80%) cases, CD30 staining was either completely negative

or expressed by only a very few (<5%) large T cells. There was

no statistically significant difference either in disease stage or

treatment response among CD30-positive and CD30-negative

patients (p=0.290, p=0.630). Twelve patients with early (<2

years, n=3, 12%) and concurrent (n=9, 36%) transformation

were also evaluated separately for survival (p=0.582).

Advanced disease stage at the time of transformation correlated

with poor survival (p=0.003). In our study, among the deceased

patients, 80% had stage IV disease, whereas only 20% of

patients had stage IV disease among the surviving patients

(p=0.002). During follow-up, 10 patients died of disease-related

events (32%). Three (30%) of 10 patients who died in our

study had SS, and the other patients’ stages were as follows:

stage IIB (n=1, 10%), stage III (n=1, 10%), and stage IVA (n=5,

50%). The survival curve of the patients is presented in Figure

2. Mean survival time was 25.2±14.9 (2-56) months after

transformation.

Laboratory Findings

Flow cytometry of peripheral blood showed an increased ratio

of CD4/CD8 (>2) in 13 (52%) patients. The ratio was between

2 and 10 in ten (40%) patients and higher than 10 in three

(12%) patients. The patients’ disease stages and CD4/CD8

levels showed a statistically significant positive correlation

(p=0.038). Increased CD4+/CD26 cell ratio was significantly

Figure 1. Histopathologically confirmed transformed mycosis

fungoides (T-MF) lesions in different patients: extensive tumoral

lesions with anaplastic transformation on the trunk (a); resistant

tumoral lesion with loss of hair on eyebrow (b); refractory plaque

on forearm (c); erythrodermic patient with ichthyotic lesions on

legs, consistent with T-MF (d); postinflammatory hypopigmentary

areas from previous treated tumors and tumoral lesions with

anaplastic transformation (e); plaques and tumoral lesions on

gluteal region and legs of a patient receiving extracorporeal

photopheresis, interferon psoralen ultraviolet A, and bexarotene

(f).

Table 2. Clinical features of transformed mycosis fungoides patients.

Mean ± SD Median Minimum Maximum

Age at MF diagnosis, years 49±11.95 48 26 76

Age at T-MF diagnosis, years 53.68±12.06 50 30 78

MF to T-MF duration, months 67.9±62.6 32 0 192

Survival, months 25.2±14.9 23 2 56

MF: Mycosis fungoides, T-MF: transformed mycosis fungoides, SD: standard deviation.

38



between elevated serum LDH levels and advanced disease stage

(p=0.028). The disease stage and β2-microglobulin levels were

found to be positively correlated with Spearman’s test (p=0.026,

r=0.463). There was no statistically significant relationship

between β2-microglobulin levels and survival (p=0.125).

Figure 2. Kaplan-Meier survival curve: survival in months after

anaplastic transformation.

Table 3. Laboratory findings of transformed mycosis

fungoides patients.

Laboratory findings

n (%)

Normal

n (%)

High

Eosinophil count 21 (84) 4 (16)

LDH 14 (56) 11 (44)

β2-microglobulin 7 (28) 18 (72)

Peripheral blood

flow cytometry

CD4/CD8

<2 >10

11 (44) 3 (12)

CD26 loss 10 (40)* 13 (52)

CD7 loss 16 (64)** 9 (36)

*CD4+/CD7-, 40% or more, **CD4+/CD26-, 30% or more.

LDH: Lactate dehydrogenase.

Treatment

All patients received first-line therapy as a combination

treatment of two or more of the following: psoralen plus

ultraviolet, interferon-alpha, extracorporeal photopheresis,

vorinostat, bexarotene, retinoid, low-dose methotrexate, local

radiotherapy, or total skin electron beam radiotherapy. Of

the 18 (72%) patients showing PD with first-line treatment

modalities, 12 (48%) patients received either second- or thirdline

treatments. Of these 12 patients, six (48%) received secondline

treatments either for the induction of remission or in an

attempt to decrease tumor burden before allo-HSCT. Secondline

therapy included single-agent chemotherapy of either

gemcitabine or pralatrexate in 5 (20%) patients to decrease the

tumor burden before allo-HSCT. One patient had a lymph node

biopsy consistent with concomitant natural killer cell lymphoma

and received an Aurora A kinase inhibitor as second-line therapy

following five cycles of multiagent chemotherapy. All of the

patients’ treatment responses with second-line treatment were

evaluated as PD.

Seven (28%) patients received third-line therapy due to PD.

Additionally, three (12%) patients had received multiagent

chemotherapy before first- and second-line treatments before

admission to our center. In all patients, the treatment responses

of the third-line treatments were evaluated as PD.

Five (20%) patients with PD underwent allo-HSCT and CR was

achieved in 3 (60%) of them after the procedure. Two patients’

disease recurred 2 and three months after allo-HSCT, and these

two patients died 9 and 11 months following transplantation,

respectively. One patient in follow-up with complete remission

died 24 months after allo-HSCT due to sepsis. Autologous

stem cell transplantation was performed in one patient in 2000,

and the patient died four months after the procedure due to

disease progression. The outcome of patients with HSCT is given

in Table 4.

Table 4. Clinical features and treatment results of the patients who had undergone allogeneic hematopoietic stem cell

transplantation.

Type Age Sex Stage

HSCT/HLA

mismatch

Conditioning

regimen

Follow-up after allo-

HSCT

Treatment response at last

follow-up

1 Allo-HSCT 33 M IVA 10/10 RIC (Flu+Cy+TBI) 21 months CR

2 Allo-HSCT 49 M IVA 10/10 RIC (Flu+Cy+TBI) 41 months CR

3 Allo-HSCT 48 M IIB** 10/10 RIC (Flu+Cy+TBI) 24 months CR*

4 Allo-HSCT 59 F IVA 9/10 MA (Cy+TBI) 7 months Exitus (refractory)

5 Allo-HSCT 60 M IVA 9/10 RIC (Flu+Cy+TBI) 11 months Exitus (refractory)

6 Autologous 63 M III NA - 4 months Exitus (refractory)

*Patient died due to sepsis without recurrence, **The patient’s stage was IIB at the time of transformation and progressed to stage IVA during follow-up.

Allo-HSCT: Allogeneic hematopoietic stem cell transplantation, HSCT: hematopoietic stem cell transplantation, HLA: human leukocyte antigen, CR: complete response.

39

Vural S, et al: Transformation of Mycosis Fungoides Turk J Hematol 2018;35:35-41

Discussion

LCT of MF can occur at any stage of MF, and it has been

associated with disease progression and poor outcome.

Unfavorable prognostic factors for T-MF have been reported

previously as advanced stage, presentation of MF with

transformation, generalized skin tumors, increased LDH level,

and use of combination chemotherapy [5,15]. CD30 expression

in less than 10% of skin lesions is one of the poor prognostic

factors [5,6,8,15]. On the other hand, in this study, high serum

LDH levels, loss of CD26 expression of more than 30% in

peripheral blood, and loss of CD7 expression were associated

with poor survival among T-MF patients.

LCT at initial diagnosis of MF or within two years

has been associated with worse prognosis in several

studies [3,5,16,17,18]. However, in some studies, including ours,

the prognostic significance of early transformation was not

validated [19]. Mean time between MF and T-MF diagnosis varies

from 44 months to 6.5 years in reported studies [2,7,17,19]. In

our study, this period was determined as 32 months.

In previous studies, LCT of MF has been reported mainly in

advanced disease. In a series with 22 T-MF patients, Arulogun

et al. [17] reported that only 1.4% of early-stage MF patients

developed T-MF, whereas this rate was more than 25% in stage

2B patients and more than 50% in stage 4 patients. Consistent

with this study, LCT of MF was detected in 8% of cases in the

early stage in our series. MF is a slowly progressive CTCL with

an excellent prognosis, especially in early-stage disease. In

the case of transformation, the prognosis of early-stage MF

deteriorates significantly [20]. Still, previous studies have shown

that patients with early (stage I-IIA) LCT have longer survival

compared with patients with LCT in advanced disease (stage

IIB-IV) [5]. Likewise, in our study, advanced disease stage at the

time of transformation was significantly correlated with shorter

survival. In different studies, extracutaneous disease (stage IV)

was shown to be associated with poor prognosis [2,19]. In our

study, a significant majority of the patients who died had stage

IV MF. The mean survival time after LCT has been reported to

be in the range of 2 to 36 months [2,3,4,5,7,9,10,17,19]. In our

study, the mean survival time of the ten patients who died was

determined as 25.2±14.9 (2-56) months.

Transformed folliculotropic MF patients were previously found

to have shorter survival time [2,21,22]. In one previous study,

epidermotropism was detected in patients with LCT, although it

was less prominent or focal [3]. In our series epidermotropism

was present only in 60% of patients and it was less noticeable

in histopathological examinations.

According to a recent study, several clinical characteristics such

as a new solitary nodule on MF plaques or rapidly presenting

scattered papules may be indicators of the development of

LCT for dermatologists [15]. We would like to emphasize that

transformation was also observed in treatment-refractory

long-standing tumoral and plaque lesions, and in a patient

with ichthyosiform erythroderma. For this reason, in addition

to the cautionary skin findings mentioned before, reevaluation

of treatment-resistant and unexpected lesions, especially in

advanced-stage patients, is recommended.

The treatment strategy is challenging in T-MF. It is important to

note that, among our patients with advanced stages of T-MF,

none had a CR to treatment under first-line therapies. Among

patients receiving first-line therapy, 20% had either SD or PR

with these therapies. Notably, all the patients who received

second- and third-line therapies had PD. This finding highlights

the refractory nature of T-MF. In fact, aggressive treatment

strategies and multiple chemotherapies for MF result in a short

period of CR, followed by an aggressive relapse [13]. Allo-HSCT

is an emerging effective therapy in MF/SS, demonstrating a

decrease in the relapse rate and an overall increase in diseasefree

survival. It was reported that one year after allo-HSCT,

42% of patients remained in remission [23]. In our series, 60%

of patients were in remission one year after transplantation.

Transplant-related mortality and infections are significant

factors decreasing the success rate of allo-HSCT. However, in

selected patients with T-MF, allo-HSCT increases disease-free

survival and thus the quality of life.

Study Limitations

A limitation of the present study was the small number of

patients with T-MF, highlighting the rarity of MF/SS. A second

limitation was the retrospective design of the study, which may

have restricted retrieval of the data from patient archives.

Conclusion

Unfavorable prognostic factors in T-MF include advanced stage,

high serum LDH levels, and loss of CD7 and CD26 expression in

T helper cells. In patients with treatment-refractory tumors and

unusual lesions, a biopsy is warranted to exclude T-MF. Patients

with T-MF have a short life expectancy. Patients may have CR,

PR, or SD with first-line treatments, which underlines the value

of less aggressive therapies. However, nonresponders usually do

not respond to second- or third-line therapies. Allo-HSCT may

be an alternative option for patients with T-MF.

Ethics

Ethics Committee Approval: Ankara University Faculty of

Medicine Ethical Comittee (09/01/2017 number: 01-05-17).

Informed Consent: Retrospective study

40




Medical Practices: E.A., S.V., B.N.A., H.Ş., N.P., A.O.H.;

Concept: B.N.A., H.Ş.; Design: S.V., A.B.; Data Collection or

Processing: A.B., N.P., E.A., S.V.; Analysis or Interpretation: A.B.,

S.V., B.N.A., H.Ş.; Literature Search: A.B., S.V.; Writing: S.V., A.B.




included.

References

1. Willemze R, Jaffe ES, Burg G, Cerroni L, Berti E, Swerdlow SH, Ralfkiaer

E, Chimenti S, Diaz-Perez JL, Duncan LM, Grange F, Harris NL, Kempf W,

Kerl H, Kurrer M, Knobler R, Pimpinelli N, Sander C, Santucci M, Sterry W,

Vermeer MH, Wechsler J, Whittaker S, Meijer CJ. WHO-EORTC classification

for cutaneous lymphomas. Blood 2005;105:3768-3785.

2. Benner MF, Jansen PM, Vermeer MH, Willemze R. Prognostic factors in

transformed mycosis fungoides: a retrospective analysis of 100 cases. Blood

2012;119:1643-1649.

3. Salhany KE, Cousar JB, Greer JP, Casey TT, Fields JP, Collins RD. Transformation

of cutaneous T cell lymphoma to large cell lymphoma. A clinicopathologic

and immunologic study. Am J Pathol 1988;132:265-277.

4. Wolfe JT, Chooback L, Finn DT, Jaworsky C, Rook AH, Lessin SR. Large-cell

transformation following detection of minimal residual disease in cutaneous

T-cell lymphoma: molecular and in situ analysis of a single neoplastic T-cell

clone expressing the identical T-cell receptor. J Clin Oncol 1995;13:1751-

1757.

5. Diamandidou E, Colome-Grimmer M, Fayad L, Duvic M, Kurzrock

R. Transformation of mycosis fungoides/Sezary syndrome: clinical

characteristics and prognosis. Blood 1998;92:1150-1159.

6. Talpur R, Jones DM, Alencar AJ, Apisarnthanarax N, Herne KL, Yang Y, Duvic

M. CD25 expression is correlated with histological grade and response

to denileukin diftitox in cutaneous T-cell lymphoma. J Invest Dermatol

2006;126:575-583.

7. Barberio E, Thomas L, Skowron F, Balme B, Dalle S. Transformed mycosis

fungoides: clinicopathological features and outcome. Br J Dermatol

2007;157:284-289.

8. Greisser J, Doebbeling U, Roos M, Mueller B, Schmid M, Burg G, Kadin ME,

Kempf W. Apoptosis in CD30-positive lymphoproliferative disorders of the

skin. Exp Dermatol 2005;14:380-385.

9. Dmitrovsky E, Matthews MJ, Bunn PA, Schechter GP, Makuch RW, Winkler

CF, Eddy J, Sausville EA, Ihde DC. Cytologic transformation in cutaneous T

cell lymphoma: a clinicopathologic entity associated with poor prognosis. J

Clin Oncol 1987;5:208-215.

10. Greer JP, Salhany KE, Cousar JB, Fields JP, King LE, Graber SE, Flexner JM,

Stein RS, Collins RD. Clinical features associated with transformation

of cerebriform T-cell lymphoma to a large cell process. Hematol Oncol

1990;8:215-227.

11. Cerroni L, Rieger E, Hodl S, Kerl H. Clinicopathologic and immunologic

features associated with transformation of mycosis fungoides to large-cell

lymphoma. Am J Surg Pathol 1992;16:543-552.

12. Olsen E, Vonderheid E, Pimpinelli N, Willemze R, Kim Y, Knobler R, Zackheim

H, Duvic M, Estrach T, Lamberg S, Wood G, Dummer R, Ranki A, Burg G,

Heald P, Pittelkow M, Bernengo MG, Sterry W, Laroche L, Trautinger F,

Whittaker S, ISCL/EORTC. Revisions to the staging and classification of

mycosis fungoides and Sezary syndrome: a proposal of the International

Society for Cutaneous Lymphomas (ISCL) and the cutaneous lymphoma

task force of the European Organization of Research and Treatment of

Cancer (EORTC). Blood 2007;110:1713-1722.

13. Alberti-Violetti S, Talpur R, Schlichte M, Sui D, Duvic M. Advancedstage

mycosis fungoides and Sezary syndrome: survival and response to

treatment. Clin Lymphoma Myeloma Leuk 2015;15:105-112.

14. National Comprehensive Cancer Network. NCCN Clinical Practice Guidelines

in Oncology. Fort Washington, NCCN, 2017. Available online at https://

www.nccn.org/professionals/physician_gls/f_guidelines.asp.

15. Talpur R, Sui D, Gangar P, Dabaja BS, Duvic M. Retrospective analysis of

prognostic factors in 187 cases of transformed mycosis fungoides. Clin

Lymphoma Myeloma Leuk 2016;16:49-56.

16. Diamandidou E, Colome M, Fayad L, Duvic M, Kurzrock R. Prognostic factor

analysis in mycosis fungoides/Sezary syndrome. J Am Acad Dermatol

1999;40:914-924.

17. Arulogun SO, Prince HM, Ng J, Lade S, Ryan GF, Blewitt O, McCormack C.

Long-term outcomes of patients with advanced-stage cutaneous T-cell

lymphoma and large cell transformation. Blood 2008;112:3082-3087.

18. Scarisbrick JJ, Prince HM, Vermeer MH, Quaglino P, Horwitz S, Porcu P,

Stadler R, Wood GS, Beylot-Barry M, Pham-Ledard A, Foss F, Girardi M,

Bagot M, Michel L, Battistella M, Guitart J, Kuzel TM, Martinez-Escala ME,

Estrach T, Papadavid E, Antoniou C, Rigopoulos D, Nikolaou V, Sugaya M,

Miyagaki T, Gniadecki R, Sanches JA, Cury-Martins J, Miyashiro D, Servitje

O, Muniesa C, Berti E, Onida F, Corti L, Hodak E, Amitay-Laish I, Ortiz-

Romero PL, Rodríguez-Peralto JL, Knobler R, Porkert S, Bauer W, Pimpinelli

N, Grandi V, Cowan R, Rook A, Kim E, Pileri A, Patrizi A, Pujol RM, Wong H,

Tyler K, Stranzenbach R, Querfeld C, Fava P, Maule M, Willemze R, Evison F,

Morris S, Twigger R, Talpur R, Kim J, Ognibene G, Li S, Tavallaee M, Hoppe

RT, Duvic M, Whittaker SJ, Kim YH. Cutaneous Lymphoma International

Consortium study of outcome in advanced stages of mycosis fungoides

and Sezary syndrome: effect of specific prognostic markers on survival and

development of a prognostic model. J Clin Oncol 2015;33:3766-3773.

19. Vergier B, de Muret A, Beylot-Barry M, Vaillant L, Ekouevi D, Chene G,

Carlotti A, Franck N, Dechelotte P, Souteyrand P, Courville P, Joly P,

Delaunay M, Bagot M, Grange F, Fraitag S, Bosq J, Petrella T, Durlach A, De

Mascarel A, Merlio JP, Wechsler J. Transformation of mycosis fungoides:

clinicopathological and prognostic features of 45 cases. French Study

Group of Cutaneous Lymphomas. Blood 2000;95:2212-2218.

20. Herrmann JL, Hughey LC. Recognizing large-cell transformation of mycosis

fungoides. J Am Acad Dermatol 2012;67:665-672.

21. Agar NS, Wedgeworth E, Crichton S, Mitchell TJ, Cox M, Ferreira S, Robson

A, Calonje E, Stefanato CM, Wain EM, Wilkins B, Fields PA, Dean A, Webb

K, Scarisbrick J, Morris S, Whittaker SJ. Survival outcomes and prognostic

factors in mycosis fungoides/Sezary syndrome: validation of the revised

International Society for Cutaneous Lymphomas/European Organisation

for Research and Treatment of Cancer staging proposal. J Clin Oncol

2010;28:4730-4739.

22. van Doorn R, Van Haselen CW, van Voorst Vader PC, Geerts ML, Heule F,

de Rie M, Steijlen PM, Dekker SK, van Vloten WA, Willemze R. Mycosis

fungoides: disease evolution and prognosis of 309 Dutch patients. Arch

Dermatol 2000;136:504-510.

23. Duarte RF, Canals C, Onida F, Gabriel IH, Arranz R, Arcese W, Ferrant A,

Kobbe G, Narni F, Deliliers GL, Olavarria E, Schmitz N, Sureda A. Allogeneic

hematopoietic cell transplantation for patients with mycosis fungoides and

Sezary syndrome: a retrospective analysis of the Lymphoma Working Party

of the European Group for Blood and Marrow Transplantation. J Clin Oncol

2010;28:4492-4499.

41

RESEARCH ARTICLE

DOI: 10.4274/tjh.2016.0498


The Effect of Bone Marrow Mesenchymal Stem Cells on the

Granulocytic Differentiation of HL-60 Cells

Kemik İliği Mezankimal Hücrelerinin HL-60 Hücrelerindeki Granülositik Farklılaşması

Üzerine Etkisi

Hossein Nikkhah 1 , Elham Safarzadeh 2,3 , Karim Shamsasenjan 1 , Mehdi Yousefi 2,3 , Parisa Lotfinejad 1,3 , Mehdi Talebi 1 ,

Mozhde Mohammadian 4 , Farhoud Golafshan 5 , Aliakbar Movassaghpour 1

1

Tabriz University Faculty of Medicine, Hematology and Oncology Research Center, Tabriz, Iran

2

Tabriz University Faculty of Medicine, Drug Applied Research Center, Tabriz, Iran

3

Tabriz University Faculty of Medicine, Department of Immunology, Tabriz, Iran

4

Mazandaran University Faculty of Medicine, Amol Faculty of Paramedical Sciences, Sari, Iran

5

Hamline University Faculty of Medicine, Department of Biology, Minnesota, USA

Abstract

Objective: Mesenchymal stem cells (MSCs) are multipotent stromal

cells that can differentiate into a variety of cell types. They control the

process of hematopoiesis by secreting regulatory cytokines and growth

factors and by the expression of important cell adhesion molecules for

cell-to-cell interactions. This investigation was intended to examine

the effect of bone marrow (BM)-derived MSCs on the differentiation

of HL-60 cells according to morphological evaluation, flow cytometry

analysis, and gene expression profile.

Materials and Methods: The BM-MSCs were cultured in Dulbecco’s

modified Eagle’s medium supplemented with 10% fetal bovine serum

(FBS). After the third passage, the BM-MSCs were irradiated at 30

Gy. To compare how the HL-60 cells differentiated in groups treated

differently, HL-60 cells were cultured in RPMI-1640 and supplemented

with 10% FBS. The HL-60 cells were seeded into six-well culture

plates and treated with all-trans-retinoic acid (ATRA), BM-MSCs, or

BM-MSCs in combination with ATRA, while one well remained as

untreated HL-60 cells. The expression levels of the granulocyte subsetspecific

genes in the HL-60 cells were assayed by real-time polymerase

chain reaction.

Results: Our results revealed that BM-MSCs support the granulocytic

differentiation of the human promyelocytic leukemia cell line HL-60.

Conclusion: Based on the results of this study, we concluded that

BM-MSCs may be an effective resource in reducing or even preventing

ATRA’s side effects and may promote differentiation for short

medication periods. Though BM-MSCs are effective resources, more

complementary studies are necessary to improve this differentiation

mechanism in clinical cases.

Keywords: Mesenchymal stem cells, HL-60 cells, Differentiation, Alltrans-retinoic

acid

Öz

Amaç: Mezankimal kök hücreler (MKH) birçok hücre tipine göre

farklılaşabilen multipotent stromal hücrelerdir. Hematopoez sürecini

düzenleyici sitokinler ve büyüme faktörleri salınımı ile ve hücreler arası

etkileşim için önemli hücresel adezyon moleküllerinin ifadesi yoluyla

kontrol ederler. Bu çalışma da kemik iliği (Kİ) kaynaklı MKH HL-60

hücrelerinin farklılaşması üzerine etkisini morfolojik değerlendirme,

akım sitometri ve gen ifade analizi yöntemleriyle araştırılması

amaçlanmıştır.

Gereç ve Yöntemler: Kİ-MKH %10 fetal sığır serumu (FSS) içeren

Dulbecco’nun modifiye Eagle ortamında kültür edildi. Üçüncü

pasaj sonrası, Kİ-MKH 30 Gy ile ışınlandı. HL-60 hücrelerinin farklı

şartlarda nasıl farklılaştığını karşılaştırmak için HL-60 hücreler %10

FSS eklenmiş RPMI-1640 ortamında kültür edildi. HL-60 hücreleri altı

kuyucuklu plaklarda all-trans retinoik asit (ATRA), Kİ-MKH ve ATRA

ile birlikte Kİ-MKH ile muamele edilirken, bir kuyucuğa sadece HL-

60 hücreleri kondu. HL-60 hücrelerinde granülosit alt gruplarına özgü

genlerin ifade düzeyleri gerçek zamanlı polimeraz zincir reaksiyonu ile

değerlendirildi.

Bulgular: Sonuçlarımız Kİ-MKH’nin insan promiyelositik lösemi hücre

dizisi HL-60’ın granülositik farklılaşmasını desteklediğini gösterdi.

Sonuç: Bu çalışmanın bulgularına göre, Kİ-MKH’nin ATRA yan etkilerini

azaltıcı ve hatta önleyici etkili bir kaynak olduğu ve kısa ilaç kullanımı

süreçlerinde farklılaşmayı uyarabileceği sonucunu çıkarttık. Kİ-MKH

etkili bir kaynak olsa da, klinik olgularda bu farklılaşma mekanizmasını

iyileştirmek için destekleyici ek çalışmalara ihtiyaç vardır.

Anahtar Sözcükler: Mezankimal kök hücreler, HL-60 hücreleri,

Farklılaşma, All-trans retinoik asit



Address for Correspondence/Yazışma Adresi: Ali Akbar MOVASSAGHPOUR, M.D.,

Tabriz University Faculty of Medicine, Hematology and Oncology Research Center, Tabriz, Iran

Phone : +984 133 343 888

E-mail : movassaghpour@tbzmed.ac.ir ORCID-ID: orcid.org/0000-0002-6990-9260


Accepted/Kabul tarihi: June 12, 2017

42


Nikkhah H, et al: BM-MSCs’ Effects on HL-60 Cell Differentiation

Introduction

There are different cell types of the osteoblast lineage in bone

and the bone marrow, the most primitive of them being the

mesenchymal stem cells (MSCs) [1,2]. MSCs can differentiate into

several types of cells and produce important growth factors and

cytokines [3,4]. MSCs are defined by the International Society

of Cellular Therapy based on three properties: the adherence to

plastic in standard culture; the expression of CD105, CD73, and

CD90 and lack of expression of CD45, CD34, CD14 or CD11b,

CD79α or CD19, and HLA class II; and differentiation potential

into osteocytes, adipocytes, and chondrocytes [5,6]. These cells

are involved in the regulation of hematopoietic precursor cell

proliferation and differentiation [7,8].

All-trans-retinoic acid (ATRA) has a potential role in treating

acute myeloid leukemia (AML) and some hematological

disorders [9]. It has been recognized that ATRA induces the

differentiation of myeloid leukemic cells through growth

inhibition [10]. Many studies have reported severe adverse

effects of ATRA. Therefore, novel therapeutic strategies need

to be developed to decrease ATRA’s potential side effects and

enhance the efficacy of this drug. One possible approach is the

use of ATRA-based combinations that are more efficient than

the single components [11,12,13]. The roles of the various cells

in the bone marrow niche are unclear in the differentiation of

hematopoietic stem cells, and MSCs, as the precursors of the

cellular components, are important cells of the bone marrow

niche [14]. To understand the precise interaction between MSCs

and leukemic cells, in the current study we investigated whether

MSCs affect the differentiation of HL-60 cells.


Cell Culture

Human promyelocytic leukemia cell line HL-60 (a kind gift

from Dr. Abroun, Tarbiat Modares University, Tehran, Iran)

was cultured in RPMI-1640 medium (Sigma-Aldrich, St.

Louis, MO, USA) supplemented with 10% fetal bovine serum

(HyClone, Logan, UT, USA), 100 U/mL penicillin, and 100 µg/mL

streptomycin (Sigma, St. Louis, MO, USA). The BM-MSCs (Stem

Cell Technology, Tehran, Iran) were cultured in low-glucose

Dulbecco’s modified Eagle medium (GIBCO BRL, Gaithersburg

MD, USA) containing 10% fetal bovine serum.

Co-culture Experiments

HL-60 cells (10 5 cells/mL) were seeded onto plates and treated

with ATRA at a concentration of 5x10 -7 M (Sigma-Aldrich) for

48 h. The co-culture experiments were performed in six-well

plates including the HL-60 cells treated with BM-MSCs or those

treated with BM-MSCs and 5x10 -7 M ATRA together. Before coculturing

with cancer cells, the BM-MSCs were irradiated at 30

Gy when they reached 60% confluence. The HL-60 cells came

into direct contact with the BM-MSCs.

Morphological Study of Differentiated Granulocyte Cells

To study the morphological changes, the HL-60 cells were

treated with ATRA, BM-MSCs, or a combination of ATRA and

BM-MSCs. After 48 h of incubation, the cells were stained with

Wright-Giemsa stain and studied by light microscope.

Flow Cytometric Assessment of Granulocytic Markers for

Differentiation

The HL-60 cells (1x10 6 ) of the different groups, the co-culture

of the HL-60 cells with BM-MSCs, the HL-60 cells with BM-

MSCs and ATRA in combination, the HL-60 cells with ATRA as

a positive control, and the HL-60 cells without additions as a

negative control were harvested and incubated with FITClabeled

anti-CD11b (Becton Dickinson, San Jose, CA, USA) for 30

min at 4 °C. The cells were then analyzed for the evaluation of

CD11b expression (a myeloid differentiation marker) with a flow

cytometer (Becton Dickinson).


The expression of the granulocyte subset-specific genes in the

treated HL-60 cells was investigated by real-time polymerase

chain reaction (RT-PCR) after an incubation period of 48 h.

Total RNA was extracted using the QIAzol lysis reagent (QIAGEN,

Germantown, MD, USA) according to the manufacturer’s

instructions. The cDNA was prepared according to the

instructions of the Revert Aid Single Strand Kit (Fermentas,

Burlington, ON, Canada). The mRNA levels of PU.1, CD11b,

lysozyme, C/EBP-ALPHA, C/EBP-BETA, C/EBP E, MPO, CD64,

CD16, GCSFR, and cathepsin G were analyzed using qRT-PCR.

The GAPDH gene was used as an internal control (Table 1).


Data were reported as mean ± standard deviation and were

analyzed using Graph Pad Prism v 5.00 (Graph Pad Software, Inc.,

La Jolla, CA, USA). Student’s t-test for single comparisons and twoway

ANOVA for multigroup comparisons were used for analysis

and p<0.01 was regarded as denoting statistical significance.

Results

Flow Cytometry Confirmation of the Nature of the BM-MSCs

To verify the mesenchymal nature of the BM-MSCs, the surface

antigens were assessed by flow cytometry, including CD14,

CD19, CD34, CD45 CD90, CD105, and CD73. The characterization

experiments performed in our study demonstrated that the

BM-MSCs were negative in the expression of the hematopoietic

markers for CD14, CD19, CD34, and CD45, and they had positive

expression for CD90, CD105, and CD73 markers (Figure 1).

43



Table 1. Primers for real-time polymerase chain reaction.

Gene name Forward primer Reverse primer

PU.1 GACACGGATCTATACCAACGCC CCGTGAAGTTGTTCTCGGCGAA

CD11b GGAACGCCATTGTCTGCTTTCG ATGCTGAGGTCATCCTGGCAGA

Lysozyme ACTACAATGCTGGAGACAGAAGC GCACAAGCTACAGCATCAGCGA

C/EBP-α AGGAGGATGAAGCCAAGCAGCT AGTGCGCGATCTGGAACTGCAG

C/EBP-β AGAAGACCGTGGACAAGCACAG CTCCAGGACCTTGTGCTGCGT

C/EBP E CCAGCCTCTGCGCGTTCTCAA CAAGGCTATCTTTGTTCACTGCC

MPO GAGCAGGACAAATACCGCACCA AGAGAAGCCGTCCTCATACTCC

CD16 GGTGACTTGTCCACTCCAGTGT ACCATTGAGGCTCCAGGAACAC

GCSFR CCACTACACCATCTTCTGGACC GGTGGATGTGATACAGACTGGC

Cathepsin G CGACAGTACCATTGAGTTGTGCG TTCGTCCATAGGAGACAATGCCC

MPO: Myeloperoxidase.

Figure 1. Flow cytometry analysis confirmed the mesenchymal nature of the bone marrow mesenchymal stem cells. The markers assessed

by flow cytometry included CD14, CD19, CD34, CD45 CD90, CD105, and CD73. The experiments were done in triplicate.

Morphological Changes of the Treated Cells

To assess the morphological changes in the treated HL-60 cells,

Wright-Giemsa staining was performed (Figures 2A-2D). The

comparative study of the morphological changes in the HL-60

cells stained by Wright-Giemsa indicated that, in comparison to

the control, the cells treated with ATRA and BM-MSCs individually

had induced granulocytic differentiation of the HL-60 cells

(Figures 2B and 2C) and showed an additive effect when used

with BM-MSCs in combination with ATRA (Figure 2D). While the

control cells (Figure 2A) demonstrated typical morphology in the

promyelocytic cells (a circular nucleus), the treated HL-60 cells

exhibited a kidney-shaped nucleus and segmented nucleus and

also had a reduced nuclear/cytoplasmic ratio.

44



CD11b Expression Increased in Treated HL-60 Cells

In the treated HL-60 cells, an increase was observed in the

percentage of CD11b marker expression, one of the main

granulocytic differentiation markers measured by flow

cytometry, after 48 h. Flow cytometry results displayed that

the expression of the CD11b marker was 17.12%, 76.69%,

23.96%, and 96.4% in the untreated HL-60 cells, in the HL-60

cells treated with ATRA, in the HL-60 cells treated with BM-

MSCs, and in the HL-60 cells treated with a combination of

BM-MSCs and ATRA, respectively (Figure 3). The expression of

CD11b significantly increased in the HL-60 cells treated with

the combination of BM-MSCs and ATRA compared to the HL-60

cells treated with ATRA alone or with BM-MSCs alone.

Effects of BM-MSCs and ATRA on Gene Expression in HLA-60

Cells

In the ATRA-treated HL-60 cells, there was a marked increase

(p<0.05) in the gene expressions of CD11b, lysozyme, GCSFR,

CD64, PU.1, and C/EBP-ALPHA from 1.00 to 8.33 (±0.07), 5.53

(±0.16), 3.36 (±0.12), 1.94 (±0.02), 1.26 (±0.04), and 1.11 (±0.02),

respectively. There was no gene expression for C/EBP-BETA,

C/EBP E, or CD16 (Figure 4). On the other hand, as revealed in

Figure 4, in the HL-60 cells co-cultured with the BM-MSCs,

there was significant increase (p<0.05) in CD11b, lysozyme, PU.1,

CD64, and GCSFR expression levels from 1.00 to 2.2 (±0.07), 3.3

(±0.16), 1.23 (±0.02), 1.11 (±0.02), and 1.51 (±0.12), respectively,

and there was no expression of C/EBP-BETA, C/EBP E, or CD16

levels. In the HL-60 cells co-cultured with the combination of

BM-MSCs and ATRA, the gene expression of CD11b, lysozyme,

CD64, GCSFR, C/EBP-ALPHA, and PU.1 was markedly increased

(p<0.05) from 1.00 to 12.26 (±0.07), 7.19 (±0.16), 1.92 (±0.02),

4.77 (±0.12), 1.31(±0.02), and 1.18 (±0.04), respectively. There was

no expression for C/EBP-BETA, C/EBP E, or CD16 (Figure 4). The

myeloid differentiation was characterized by downregulation of

myeloperoxidase (MPO), a major protein expressed in myeloid

cells. We assessed the mRNA level of MPO by RT-PCR after 48 h

of treatment. The BM-MSCs, like ATRA, tended to decrease the

MPO transcription (Figure 4).

Discussion

MSCs can support hematopoiesis by producing soluble factor(s)

and also by the expression of cell adhesion molecules that are

important for cell-to-cell interaction [15]. MSCs have been the

subject of particular interest in recent years due their great

potential for treating various diseases, especially those related

to immune system disorders. However, there are controversial

opinions on the role of MSCs in malignancies [16,17,18,19].

In recent years, several groups investigated the possible role of MSCs

in influencing the behavior of tumor cells [20,21]. These studies

Figure 2. BM-MSCs induced the granulocytic differentiation

of HL-60 cells after 48 h of incubation and showed an additive

effect with all-trans-retinoic acid (ATRA). The differentiation

of the HL-60 cells was assessed by Wright-Giemsa staining:

a) untreated HL-60 cells, b) HL-60 cells treated with ATRA, c) HL-

60 cells treated with bone marrow mesenchymal stem cells, d)

HL-60 cells treated with ATRA and BM-MSCs. Magnitude: 100 x .

Figure 3. The flow cytometric analysis of CD11b, a granulocytic

differentiation marker, after 48 h: a) untreated HL-60 cells, b) HL-

60 cells treated with BM-MSCs, c) HL-60 cells co-cultured with

all-trans-retinoic acid (ATRA), d) HL-60 cells treated with BM-

MSCs and ATRA. BM-MSCs and ATRA synergistically upregulated

CD11b expression in cells treated with the combination of the

two. The experiments were done in triplicate.

45



Figure 4. Gene expression during differentiation of the HL-60 cells after 48 h: a) PU.1 gene expression, b) CD11b gene expression, c)

lysozyme gene expression, d) C/EBP-alpha gene expression, e) myeloperoxidase gene expression, f) CD64 gene expression, g) GCSFR gene

expression, h) cathepsin G gene expression. The experiments were performed in triplicate. *p<0.05.

MPO: Myeloperoxidase, ATRA: all-trans-retinoic acid.

mostly focused on the proliferation and apoptosis of cancer cells,

but little is known about the effect of MSCs in the differentiation

of leukemic cells [22]. It has been shown that substances such

as ursolic acid, 12-O-tetradecanoylphorbol 13-acetate, and

1,25-dihydroxyvitamin D3 [1,25(OH)2D3] inhibit the proliferation

of and promote the monocyte/macrophage differentiation of

AML HL-60 cells. A secosteroid, 1,25(OH)2D3 has a potential role

in the differentiation of the cells of the myeloid lineage in vitro

and ex vivo. This ability results in the use of 1,25(OH)2D3 to treat

myelodysplastic syndromes or AML. However, 1,25(OH)2D3 leads

to the partial differentiation of the hematopoietic blast cells and

hypercalcemia, which is a limiting factor in its clinical application

[23,24]. Differentiation therapy in APL patients with ATRA alone or

in combination with chemotherapy has made great breakthroughs

and results in high rates of complete clinical remission. However,

it has potentially fatal side effects, such as retinoic acid syndrome

and the development of resistance to this drug [13,25]. Repeated

treatment with ATRA results in progressive resistance that it is

attributed to the decrease of the ATRA serum level, which may

46

be caused by accelerated clearance [26]. The use of ATRA in

combination is one possible method to increase the therapeutic

efficacy of this drug. Therefore, increasing efforts have been

focused on developing alternative differentiation-promoting

therapeutic methods with fewer side effects [22]. MSCs possess

great advantages in research and clinical applications because of

their better expandability, sufficient supply, and painless collection

process [27].

Previous studies have shown that ATRA induces morphological

differentiation of HL-60 cells. The results from this study

indicated that ATRA, BM-MSCs, and ATRA in combination with

BM-MSCs promote the differentiation of HL-60 cells compared

to untreated cells. It should be added that the HL-60 cells

treated with both ATRA and BM-MSCs appeared more mature,

presenting band-form nuclei and segmented nuclei, compared

to cells treated with either ATRA or the BM-MSCs alone (Figure

2). Matching of the morphological and immunophenotypic data

is critical, so immunophenotypic evaluations were performed.

The proliferating HL-60 cells, in contrast to monocytes and



neutrophils, do not express the CD11b marker, the b-subunit

of integrin-aMb2 (also known as CD11b/CD18, MAC-1, or

CR3). It was demonstrated that most HL-60 cells, following

treatment with D3 (90% at 3-4 days) or ATRA (80% at 4-5

days), become CD11b-positive [28]. As shown in Figure 3, the

morphological data were further confirmed by the results of

the immunophenotyping of CD11b. After 48 h of treatment, the

expression of the CD11b marker in the HL-60 cells co-cultured

with BM-MSCs in combination with ATRA was higher than

that in the HL-60 cells co-cultured with BM-MSCs or ATRA

individually. Therefore, we concluded that BM-MSCs induce the

granulocytic differentiation of HL-60 cells.

Our data described the changes in the gene expression pattern

during the transformation of the proliferating HL-60 cells into

mature cells. One of the important factors that regulate the

differentiation of HSCs along the myeloid lineage towards

granulocytes rather than monocytes is CCAAT-enhancer

binding protein-alpha (C/EBP-ALPHA). Indeed, C/EBP alpha

knock-out mice demonstrate an early block in granulocytic

differentiation [29]. The results of this study indicate that the

BM-MSCs enhance ATRA’s effect on the amplification of C/EBP-

ALPHA transcription, but the BM-MSCs alone were upregulated

without statistical significance. Our data also showed that the

BM-MSCs and ATRA synergistically increased the expression of

the CD11b and lysozyme genes.

In this study, we found an increased level of gene expression

of PU.1 in the three groups of experiments compared to the

untreated cells. Interestingly, we observed no significant

synergistic effect in the HL-60 cells treated with ATRA in

combination with the BM-MSCs. PU.1 has a critical role in the

growth and development of hematopoietic cells. Several studies

reported that PU.1-deficient mice lack mature myeloid lineages

[30,31]. Uchino et al. [32] reported that the expression of the

G-CSF receptor, contrary to their hypotheses, was downregulated

after treatment with ATRA. The G-CSF receptor is present in the

progenitor cells in the bone marrow, which is involved in the

differentiation of the granulocytes through induction of G-CSF

[33]. In our study, ATRA upregulated the expression of the G-CSF

receptor gene and the use of the BM-MSCs in combination with

ATRA synergistically enhanced ATRA’s effect on the expression of

this gene, which may demonstrate the critical role of the G-CSF

receptor in the promotion of differentiation in promyelocytic

leukemia cells. Furthermore, in line with our hypothesis, the

treatment with ATRA downregulated the expression of the MPO

gene, but the BM-MSCs in combination with ATRA did not have

a synergistic effect on the expression of this gene.

Conclusion

Our results demonstrated that BM-MSCs could promote the

granulocytic differentiation of HL-60 cells and could elicit

an additive effect when used in combination with ATRA.

Consequently, our data highlight the critical role of BM-MSCs

in the granulocytic differentiation of HL-60 cells and the use of

BM-MSCs and ATRA in combination could be a novel therapeutic

strategy for AML patients.

Acknowledgments

We would like to acknowledge the support of the Shahid Ghazi

Hematology and Oncology Research Center and Hematology

and Oncology Laboratory, Tabriz University Faculty of Medicine.

We would also like to thank the Blood Transfusion Research

Center of Tabriz.

Ethics

Ethics Committee Approval: Tabriz University Faculty of

Medicine, approval number (IR.TBZMED.REC.8204).

Informed Consent: N/A.


Concept: A.M.; Design: A.M., M.Y.; Cellular Analysis: H.N.;

Molecular Analysis: E.S.; Data Collection or Processing: M.M.,

Analysis or Interpretation: K.S.; Literature Search: M.T.;

Writing: P.L., F.G.




included.

References

1. Kim YH, Yoon DS, Kim HO, Lee JW. Characterization of different

subpopulations from bone marrow-derived mesenchymal stromal cells by

alkaline phosphatase expression. Stem Cells Dev 2012;21:2958-2968.

2. Short B, Brouard N, Occhiodoro-Scott T, Ramakrishnan A, Simmons PJ.

Mesenchymal stem cells. Arch Med Res 2003;34:565-571.

3. Delorme B, Chateauvieux S, Charbord P. The concept of mesenchymal stem

cells. Regen Med 2006;1:497-509.

4. Beyer Nardi N, da Silva Meirelles L. Mesenchymal stem cells: isolation, in

vitro expansion and characterization. Handb Exp Pharmacol 2006:249-282.

5. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D,

Deans R, Keating A, Prockop DJ, Horwitz E. Minimal criteria for defining

multipotent mesenchymal stromal cells. The International Society for

Cellular Therapy position statement. Cytotherapy 2006;8:315-317.

6. Horwitz EM, Le Blanc K, Dominici M, Mueller I, Slaper-Cortenbach I, Marini

FC, Deans RJ, Krause DS, Keating A; International Society for Cellular

Therapy. Clarification of the nomenclature for MSC: The International

Society for Cellular Therapy position statement. Cytotherapy 2005;7:393-

395.

7. Majumdar MK, Thiede MA, Haynesworth SE, Bruder SP, Gerson SL. Human

marrow-derived mesenchymal stem cells (MSCs) express hematopoietic

cytokines and support long-term hematopoiesis when differentiated toward

stromal and osteogenic lineages. J Hematother Stem Cell Res 2000;9:841-

848.

8. Dazzi F, Ramasamy R, Glennie S, Jones SP, Roberts I. The role of mesenchymal

stem cells in haemopoiesis. Blood Rev 2006;20:161-171.

47



9. Andreeff M, Jiang S, Zhang X, Konopleva M, Estrov Z, Snell VE, Xie Z, Okcu

MF, Sanchez-Williams G, Dong J, Estey EH, Champlin RC, Kornblau SM,

Reed JC, Zhao S. Expression of Bcl-2-related genes in normal and AML

progenitors: changes induced by chemotherapy and retinoic acid. Leukemia

1999;13:1881-1892.

10. Tarantilis PA, Morjani H, Polissiou M, Manfait M. Inhibition of growth

and induction of differentiation of promyelocytic leukemia (HL-60) by

carotenoids from Crocus sativus L. Anticancer Res 1994;14:1913-1918.

11. Fenaux P, Le Deley MC, Castaigne S, Archimbaud E, Chomienne C, Link H,

Guerci A, Duarte M, Daniel MT, Bowen D. Effect of all transretinoic acid in

newly diagnosed acute promyelocytic leukemia. Results of a multicenter

randomized trial. European APL 91 Group. Blood 1993;82:3241-3249.

12. Esser AC, Nossa R, Shoji T, Sapadin AN. All-trans-retinoic acid-induced

scrotal ulcerations in a patient with acute promyelocytic leukemia. J Am

Acad Dermatol 2000;43:316-317.

13. Frankel SR, Eardley A, Lauwers G, Weiss M, Warrell RP Jr. The retinoic acid

syndrome in acute promyelocytic leukemia. Ann Intern Med 1992;117:292-

296.

14. Molaeipour Z, Shamsasanjan K, Movassaghpour AA, Akbarzadehlaleh P,

Sabaghi F, Saleh M. The effect of bone marrow mesenchymal stem cells on

vitamin D 3

induced monocytic differentiation of U937 cells. Adv Pharm Bull

2016;6:23-29.

15. Smirnov SV, Harbacheuski R, Lewis-Antes A, Zhu H, Rameshwar P,

Kotenko SV. Bone-marrow-derived mesenchymal stem cells as a target for

cytomegalovirus infection: implications for hematopoiesis, self-renewal

and differentiation potential. Virology 2007;360:6-16.

16. Rhee KJ, Lee JI, Eom YW. Mesenchymal stem cell-mediated effects of tumor

support or suppression. Int J Mol Sci 2015;16:30015-30033.

17. Tocci A, Forte L. Mesenchymal stem cell: use and perspectives. Hematol J

2003;4:92-96.

18. Porada CD, Almeida-Porada G. Mesenchymal stem cells as therapeutics and

vehicles for gene and drug delivery. Adv Drug Deliv Rev 2010;62:1156-1166.

19. Uccelli A, Moretta L, Pistoia V. Mesenchymal stem cells in health and

disease. Nat Rev Immunol 2008;8:726-736.

20. Ramasamy R, Lam EW, Soeiro I, Tisato V, Bonnet D, Dazzi F. Mesenchymal

stem cells inhibit proliferation and apoptosis of tumor cells: impact on in

vivo tumor growth. Leukemia 2007;21:304-310.

21. Dasari VR, Velpula KK, Kaur K, Fassett D, Klopfenstein JD, Dinh DH, Gujrati

M, Rao JS. Cord blood stem cell-mediated induction of apoptosis in glioma

downregulates X-linked inhibitor of apoptosis protein (XIAP). PLoS One

2010;5:e11813.

22. Chen F, Zhou K, Zhang L, Ma F, Chen D, Cui J, Feng X, Yang S, Chi Y, Han Z, Xue

F, Rong L, Ge M, Wan L, Xu S, Du W, Lu S, Ren H, Han Z. Mesenchymal stem

cells induce granulocytic differentiation of acute promyelocytic leukemic

cells via IL-6 and MEK/ERK pathways. Stem Cells Dev 2013;22:1955-1967.

23. White SL, Belov L, Barber N, Hodgkin PD, Christopherson RI.

Immunophenotypic changes induced on human HL60 leukaemia cells by

1α,25-dihydroxyvitamin D 3

and 12-O-tetradecanoyl phorbol-13-acetate.

Leuk Res 2005;29:1141-1151.

24. Zhang T, He YM, Wang JS, Shen J, Xing YY, Xi T. Ursolic acid induces HL60

monocytic differentiation and upregulates C/EBPβ expression by ERK

pathway activation. Anticancer Drugs 2011;22:158-165.

25. Gallagher RE. Retinoic acid resistance in acute promyelocytic leukemia.

Leukemia 2002;16:1940-1958.

26. Adamson PC, Boylan JF, Balis FM, Murphy RF, Godwin KA, Gudas LJ, Poplack

DG. Time course of induction of metabolism of all-trans-retinoic acid and

the up-regulation of cellular retinoic acid-binding protein. Cancer Res

1993;53:472-476.

27. Baksh D, Yao R, Tuan RS. Comparison of proliferative and multilineage

differentiation potential of human mesenchymal stem cells derived from

umbilical cord and bone marrow. Stem Cells 2007;25:1384-1392.

28. Drayson MT, Michell RH, Durham J, Brown G. Cell proliferation and CD11b

expression are controlled independently during HL60 cell differentiation

initiated by 1,25α-dihydroxyvitamin D 3

or all-trans-retinoic acid. Exp Cell

Res 2001;266:126-134.

29. Dahl R, Walsh JC, Lancki D, Laslo P, Iyer SR, Singh H, Simon MC. Regulation

of macrophage and neutrophil cell fates by the PU.1:C/EBP α

ratio and

granulocyte colony-stimulating factor. Nat Immunol 2003;4:1029-1036.

30. Scott EW, Simon MC, Anastasi J, Singh H. Requirement of transcription

factor PU.1 in the development of multiple hematopoietic lineages. Science

1994;265:1573-1577.

31. Moreau-Gachelin F, Wendling F, Molina T, Denis N, Titeux M, Grimber G,

Briand P, Vainchenker W, Tavitian A. Spi-1/PU.1 transgenic mice develop

multistep erythroleukemias. Mol Cell Bio 1996;16:2453-2463.

32. Uchino Y, Iriyama N, Hatta Y, Takei M. Granulocyte colony-stimulating factor

potentiates all-trans retinoic acid-induced granulocytic differentiation in

acute promyelocytic leukemia cell line HT93A. Cancer Cell Int 2015;15:30.

33. Zeidler C, Welte K. Kostmann syndrome and severe congenital neutropenia.

Semin Hematol 2002;39:82-88.

48

RESEARCH ARTICLE

DOI: 10.4274/tjh.2017.0095


NPM1 Mutation Analysis in Acute Myeloid Leukemia: Comparison

of Three Techniques - Sanger Sequencing, Pyrosequencing, and


Akut Miyeloid Lösemide NPM1 Mutasyon Analizi: Üç Tekniğin Karşılaştırılması/Sanger

Dizileme, Pirodizileme ve Gerçek Zamanlı Polimeraz Zincir Reaksiyonu

Dushyant Kumar 1 , Anurag Mehta 2 , Manoj Kumar Panigrahi 1 , Sukanta Nath 1 , Kandarpa Kumar Saikia 1

1

Gauhati University Faculty of Medicine, Department of Bioengineering and Technology, Guwahati, India

2

Rajiv Gandhi Cancer Institute and Research Centre, New Delhi, India

Abstract

Objective: Nucleophosmin-1 (NPM1) mutations have prognostic

importance in acute myeloid leukemia (AML) patients with

intermediate-risk karyotype at diagnosis. Approximately 30% of newly

diagnosed cytogenetically normal AML (CN-AML) patients harbor the

NPM1 mutation in India. In this study we compared the efficiency of

three molecular techniques in detecting NPM1 mutation in peripheral

blood and bone marrow samples.

Materials and Methods: In a single-center cohort we analyzed

165 CN-AML bone marrow/peripheral blood samples for NPM1

mutation analysis. About 30% of the CN-AML samples revealed NPM1

mutations. For the detection, three methods were compared: Sanger

sequencing, pyrosequencing, and real-time polymerase chain reaction

(PCR).

Results: NPM1 exon 12 mutations were observed in 52 (31.51%) of all

CN-AML cases. The sensitivity of Sanger sequencing, pyrosequencing,

and real-time PCR was 80%, 90%, and 95%, whereas specificity

was 95%, 100%, and 100%, respectively. The minimum limit of

mutation detection was 20%-30% for Sanger sequencing, 1%-5% for

pyrosequencing, and 0.1%-1% for real-time PCR.

Conclusion: The sequencing method, which is the reference method,

has the lowest sensitivity and is sometimes difficult to interpret. Realtime

PCR is a highly sensitive method for mutation detection but

is limited for specific mutation types. In our study, pyrosequencing

emerged as the most suitable technique for the detection of NPM1

mutations on the basis of its easy interpretation and less timeconsuming

processes than Sanger sequencing.

Keywords: NPM1, Pyrosequencing, Acute myeloid leukemia, Mutation

analysis

Öz

Amaç: Nükleofosmin-1 (NPM1) mutasyonları tanı anında orta risk

akut miyeloid lösemi (AML) hastalarında prognostik öneme sahiptir.

Hindistan’da, yeni teşhis normal sitogenetiğe sahip AML (CN-AML)

hastalarının yaklaşık %30’u NPM1 pozitiftir. Bu çalışmada periferik kan

ve kemik iliği örneklerinde NPM1 mutasyonu saptamada kullanılan üç

moleküler tekniğin etkinliğini karşılaştırdık.

Gereç ve Yöntemler: Tek merkezli bu kohortta, 165 CN-AML kemik

iliği/periferik kan örneklerinde NPM1 mutasyon analizi yapıldı. CN-

AML örneklerinin yaklaşık %30’unda NPM1 mutasyonu saptandı.

Mutasyonun taranmasında üç yöntem karşılaştırıldı: Sanger dizileme,

pirodizileme, gerçek-zamanlı polimeraz zincir reaksiyonu (PCR).

Bulgular: Tüm CN-AML olgularının 52’sinde (%31,51) NPM1 exon12

mutasyonları gözlendi. Sanger dizileme, pirodizileme ve gerçek zamanlı

PCR’nin duyarlılıkları sırasıyla %80, %90 ve %95 iken, özgünlükleri

%95, %100 ve %100’dü. Mutasyonun saptanmasında minimum limit

Sanger dizileme yöntemi için %20-%30, pirodizilemede %1-5, ve

gerçek-zamanlı PCR için %0,1-%1 idi.

Sonuç: Referans yöntemi olan dizileme yöntemi, en düşük duyarlılığa

sahiptir ve bazen yorumlaması güçtür. Gerçek-zamanlı PCR mutasyon

saptamada yüksek duyarlılığa sahip bir yöntemdir fakat özel

mutasyon tipleri için sınırlıdır. Çalışmamızda, pirodizileme yönteminin

kolay yorumlanması ve Sanger dizileme yönteminden daha az

zaman harcanan işlem olması esasına dayanarak NPM1 mutasyonun

saptanmasında en uygun teknik olduğu sonucuna varılmıştır.

Anahtar Sözcükler: NPM1, Pirodizileme, Akut miyeloid lösemi,

Mutasyon analizi



Address for Correspondence/Yazışma Adresi: Dushyant KUMAR, M.D.,

Gauhati University Faculty of Medicine, Department of Bioengineering and Technology, Guwahati, India

Phone : +91 858 886 60 49

E-mail : anumehta11@gmail.com ORCID-ID: orcid.org/0000-0003-4255-8283

Received/Geliş tarihi: March 07, 2017

Accepted/Kabul tarihi: November 09, 2017

49

Kumar D, et al: NPM1 Mutation Analysis


Introduction

An increasing number of genetic abnormalities are revealed

in acute myeloid leukemia (AML). Among these genetic

alterations, potential prognostic genetic markers are the

nucleophosmin 1 (NPM1) gene, FLT3 gene, and CEBPA gene

[1]. Mutations in the NPM1 and FLT3 genes represent the

most important diagnostic and prognostic indicators in

patients with cytogenetically normal AML (CN-AML). NPM1

is a phosphoprotein that continuously shuttles between the

cytoplasm and nucleus. Several functions for this protein have

been described, including the binding of p53, the initiation

of centrosome duplication, and ribosomal protein assembly

and transport [2]. NPM1 mutations found in exon 12 code

for the COOH terminal region. Frameshift mutations in the

NPM1 gene result in an elongated protein that contains an

additional nuclear export signal and leads to an abnormal

cytoplasmic localization of the protein [3,4]. These mutations are

involved in leukemogenesis and are detected in about 35%-60%

of AML cases [5]. Six types of NPM1 mutation variants have been

identified: NPM1 mutation A (c.860_863dupTCTG), mutation B

(c.862_863insCATG), mutation D (c.863_864insCCTG), mutation

I (c.863_864insTAAG), mutation J (c.863_864insCTTG), and

mutation K (c.863_864insTATG). Mutation A (TCTG insertion)

is the most commonly occurring variant, found in about 80%

of all NPM1-mutated AML cases (Table 1) [3,5]. The effect

of mutant NPM1 has been studied using gene expression

profiling and studies revealed a distinctive signature of

these mutations [6]. Many studies reported the prognostic

significance of NPM1 mutation status in AML [7,8,9,10,11].

There are highly specific and sensitive molecular assays available

for detecting NPM1 mutations, like Sanger sequencing, highresolution

melting curve analysis, real-time polymerase chain

reaction (PCR), and pyrosequencing (Pyr). In this study, we

evaluated the utility of Pyr in the detection of NPM1 mutation

detection and also compared it with Sanger sequencing and realtime

PCR in terms of assay sensitivity, specificity, limit of

mutation detection, turnaround time, and assay cost [12,13].


A total of 165 CN-AML bone marrow aspiration or peripheral

blood samples taken at the time of first diagnosis were included

in this study from February 2014 to September 2016. Out of

these 165 patients, 79 (47.87%) were male and 86 (52.12%)

were female. Twenty cases (12.12%) were pediatric cases.

DNA Extraction

Genomic DNA was extracted from the received samples using

the QIAGEN DNeasy Kit (QIAGEN, Hilden, Germany) as per the

manufacturer’s instructions.

NPM1 Mutation Detection by Pyr Analysis

In the Pyr method for DNA sequence analysis, inorganic

phosphate released in the course of nucleotide incorporation

serves as the initial substrate in a sequence of four successive

enzymatic reactions. This results in the emission of light, which

functions as a signal that is proportional to the number of

nucleotides incorporated.

For NPM1 mutation analysis TTAACTCTCTGGTGGTAGAATG was

used as a forward primer, biotin-ACATTTATCAAACACGGTAGG

as a reverse primer, and TTTTCCAGGCTATTCAAGAT as the

sequencing primer (Sigma-Aldrich, New Delhi, India). DNA

(50 ng) was amplified using 400 nmol of forward and reverse

primers in 25 µL of reaction mix with PyroMark master mix

(QIAGEN). PCR conditions were as follows: initial denaturing

at 95 °C for 15 min; 42 cycles of 95 °C for 20 s, 53 °C for 30

s, and 60 °C for 20 s; and final extension at 72 °C for 5 min.

PCR products were electrophoresed on agarose gel to confirm

successful amplification. The PCR products (10 µL) were then

sequenced with the Pyr PyroMark Q24 system (QIAGEN).

NPM1 Mutation Detection by Pyr Analysis

Using Ipsogen NPM1 MutaScreen Kit

The Ipsogen NPM1 MutaScreen Kit (QIAGEN) combines two

techniques to screen for the presence of mutations in the

target gene. The real-time quantitative PCR (qPCR) double-dye

oligonucleotide hydrolysis principle uses specific primers and

an internal double-dye probe with a reporter and a quencher

(FAM-TAMRA) for the amplification reactions. In addition,

a 3’-end modified phosphate oligonucleotide is used that

perfectly matches the wild-type NPM1 gene and does not allow

polymerization. The Ipsogen NPM1 MutaScreen Kit detects

total NPM1 (wild-type + mutated) and mutated NPM1 and

separately identifies NPM1 Mut A, Mut B, and Mut D in genomic

DNA. A sample of DNA of 25 ng was used in a final reaction

volume of 25 µL. The PCR profile for Rotor-Gene Q (QIAGEN)

was 50 °C for 2 min, 95 °C for 10 min, and then 40 cycles of 95

°C for 15 s and 60 °C for 90 s with acquisition performed at 60

°C. Analysis was performed as per the kit’s instructions.

NPM1 Mutation Analysis by Sanger Sequencing

Analysis of NPM1 exon 12 mutations was done as described by

Falini et al. [4]. A sample of DNA of 50 ng was amplified using

an Applied Biosystems Veriti thermal cycler (Foster City, CA,

USA) and purified PCR product was used for BigDye termination

bidirectional sequencing. Results were analyzed using BioEdit

sequence analysis software.

Results

NPM1 exon 12 mutation was observed in 52 (31.51%) of all CN-

AML cases. As expected, the percentage of the DNA samples in

50



which mutations were detected varied and depended upon the

method of detection used. NPM1 mutation analysis by Pyr had the

highest likelihood of identifying a mutation in the NPM1 gene,

followed by the NPM1 MutaScreen kit and direct sequencing

(Table 2). However, on the basis of our evaluation criteria (Table

1), the most sensitive tool was the Ipsogen MutaScreen kit

(95%), followed by Pyr (90%) and Sanger sequencing (80%). In

terms of specificity, all three methods matched equally.

Discussion

It has been found that 99% of all NPM1 mutations detected

by Pyr have 4-base insertions at position 860 while the rest of

the NPM1 mutations detected by Pyr were found as insertion at

862 and deletion at 863 and 861 [14]. We have examined

the ability of three different methods to detect mutations in

NPM1 gene exon 12 in 165 CN-AML samples. Bone marrow

or peripheral blood samples with a minimum of 15% blasts

were examined in this study. NPM1 mutations were found in

52 samples (31.51%), while 113 (68.48%) samples were found

to be wild-type. Twenty-eight (53.84%) of the NPM1-positive

patients were male while 24 (46.15%) were female. Seven

(13.46%) of the NPM1-positive samples were from pediatric

patients while 45 (86.53%) were from adults. Mutation type A

was the most frequent mutation (~80%), followed by types B

(12%) and D (6%). We also found one case of mutation type K

(c.863_864insTATG) by Pyr (Figure 1). The sequencing method is

considered the gold-standard technique for detection of somatic

as well as generic mutations. Jancik et al. [15] compared the

specificity, sensitivity, cost, and working time of five techniques

Table 1. NPM1 mutation frequencies in de novo acute

myeloid leukemia.

NPM1

mutation

type

Nucleotide

Insertion

Mutation A c.860_863dupTCTG ~72%

Mutation B c.862_863insCATG ~12%

Mutation D c.863_864insCCTG ~4%

Mutation G c.863_864insTTTG <1%

Mutation I c.863_864insTAAG <1%

Mutation J c.863_864insCTTG <1%

Mutation K c.863_864insTATG <1%

Others - <1%

AML: Acute myeloid leukemia.

Frequency in

de novo AML

References

[3,5]

Table 2. Number and percentage of mutations detected by

three different methods.

Method Mutations/Samples Percentage

Pyrosequencing 52/165 31.51%

Ipsogen MutaScreen Kit 51/165 30.90%

Sanger sequencing 46/165 27.87%

including Pyr, Sanger sequencing, and real-time PCR for KRAS

mutations. Ogino et al. [16] stated that the Pyr assay to detect

somatic mutations from formalin-fixed paraffin embedded

tissue is more sensitive than Sanger sequencing. Tsiatis et al.

[17] compared Pyr, Sanger sequencing, and melting curve

methods for the detection of somatic mutations like KRAS,

NRAS, and BRAF and demonstrated that Sanger sequencing

specificity is generally high compared with other methods, but

sensitivity has been reported to differ. Real-time PCR is the most

sensitive method for detecting minimal residual disease [18],

but it is limited to specific detection of mutations A, B, and D.

In the case of limited mutation, we can synthesize primers and

probes for other mutations as well, but it will add extra cost per

reaction (Table 3).

Figure 1. NPM1 mutation detection by pyrosequencing detection

by pyrosequencing.

Figure 2. A) NPM1 mutation detection by real-time polymerase

chain reaction using Ipsogen MutaScreen Kit. B) Sanger

sequencing.

51

Kumar D, et al: NPM1 Mutation Analysis Turk J Hematol 2018;35:49-53

Table 3. Sensitivity, specificity, time, and monetary cost of pyrosequencing, real-time polymerase chain reaction, and Sanger

sequencing.

Technique Sensitivity* Specificity* Limit of detection* Detection of rare mutations Time

Pyrosequencing 90% 100% 1%-5%

Real-Time PCR Ipsogen

MutaScreen Kit

Yes (can detect any mutation

located between the primers)

Monetary cost

(per reaction)

2 days 2500 INR ($38)

95% 100% 0.1%-1% No 1 day 4000 INR ($61)

Sanger sequencing 80% 95% 20%-30%

*From Jancik et al. [15].

INR: Indian rupee, PCR: polymerase chain reaction.

Yes (can detect any mutation

located between the primers)

4 days 1500 INR ($23)

Pyr is easily capable of detecting PCR fragments that are 25-

50 bp in length while longer fragments may pose a problem

[15,16]. In the case of NPM1, in which 99% of mutations occur at

position 956 in exon 12 [14], with Pyr we were able to detect all

types of mutations (Figure 1) with lower cost than real-time PCR

and less time than Sanger sequencing (Figure 2). Recently nextgeneration

sequencing (NGS) has become popular for detection

of mutations in 50 genes to 100 genes simultaneously. NGS is the

method to detect mutations down to the mutational burden of

1.25%. However, even though NGS is an accurate method, it is

still costly and time-consuming compared with Pyr.

Conclusion

In our study Pyr emerged as the most suitable technique for

the detection of NPM1 mutations on the basis of its easy

interpretation and less time-consuming processes than Sanger

sequencing. However, the limit of mutation detection by realtime

PCR is 0.1%-1%, the lowest of all three techniques, so realtime

PCR is the best technique to determine minimal residual

disease compared to Pyr, which has a limit of detection of

1%-5%. The Pyr assay can be considered as a better technique

for NPM1 mutation detection.

Ethics

Ethics Committee Approval: This study was approved by the

Gauhati University Ethical Committee with code number GUEC-

12/2015.



Concept: K.K.S., D.K.; Design: K.K.S., D.K.; Data Collection or

Processing: D.K., M.K.P., S.N.; Analysis or Interpretation: D.K.,

K.K.S., A.M.; Literature Search: D.K., M.K.P., S.N.; Writing: D.K.,

M.K.P.




References

1. Naoe T, Suzuki T, Kiyoi H, Urano T. Nucleophosmin: a versatile molecule

associated with hematological malignancies. Cancer Sci 2006;97:963-969.

2. Zhao T, Zhu HH, Wang J, Jia JS, Yang SM, Jiang H, Lu J, Chen H, Xu LP, Zhang

XH, Jiang B, Ruan GR, Wang DB, Huang XJ, Jiang Q. Prognostic significance

of early assessment of minimal residual disease in acute myeloid leukemia

with mutated NPM1 patients. Zhonghua Xue Ye Xue Za Zhi 2013;38:10-16.

3. Verhaak RG, Goudswaard CS, van Putten W, Bijl MA, Sanders MA, Hugens

W, Uitterlinden AG, Erpelinck CA, Delwel R, Löwenberg B, Valk PJ.

Mutations in nucleophosmin (NPM1) in acute myeloid leukemia (AML):

association with other gene abnormalities and previously established gene

expression signatures and their favorable prognostic significance. Blood

2005;106:3747-3754.

4. Falini B, Mecucci C, Tiacci E, Alcalay M, Rosati R, Pasqualucci L, La Starza

R, Diverio D, Colombo E, Santucci A, Bigerna B, Pacini R, Pucciarini A,

Liso A, Vignetti M, Fazi P, Meani N, Pettirossi V, Saglio G, Mandelli F, Lo-

Coco F, Pelicci PG, Martelli MF; GIMEMA Acute Leukemia Working Party.

Cytoplasmic nucleophosmin in acute myelogenous leukemia with a normal

karyotype. N Engl J Med 2005;352:254-266.

5. Thiede C, Creutzig E, Reinhardt D, Ehninger G, Creutzig U. Different types of

NPM1 mutations in children and adults: evidence for an effect of patient

age on the prevalence of the TCTG-tandem duplication in NPM1-exon 12.

Leukemia 2007;21:366-367.

6. Alcalay M, Tiacci E, Bergomas R, Bigerna B, Venturini E, Minardi SP, Meani

N, Diverio D, Bernard L, Tizzoni L, Volorio S, Luzi L, Colombo E, Lo Coco F,

Mecucci C, Falini B, Pelicci PG. Acute myeloid leukemia bearing cytoplasmic

nucleophosmin (NPMc +

AML) shows a distinct gene expression profile

characterized by up-regulation of genes involved in stem cell maintenance.

Blood 2005;106:899-902.

7. Liu Y, He P, Liu F, Shi L, Zhu H, Zhao J, Wang Y, Cheng X, Zhang M. Prognostic

significance of NPM1 mutations in acute myeloid leukemia: a metaanalysis.

Mol Clin Oncol 2014;2:275-281.

8. Suzuki T, Kiyoi H, Ozeki K, Tomita A, Yamaji S, Suzuki R, Kodera Y, Miyawaki

S, Asou N, Kuriyama K, Yagasaki F, Shimazaki C, Akiyama H, Nishimura M,

Motoji T, Shinagawa K, Takeshita A, Ueda R, Kinoshita T, Emi N, Naoe T.

Clinical characteristics and prognostic implications of NPM1 mutations in

acute myeloid leukemia. Blood 2005;106:2854-2861.

9. Gale RE, Green C, Allen C, Mead AJ, Burnett AK, Hills RK, Linch DC; Medical

Research Council Adult Leukaemia Working Party. The impact of FLT3

internal tandem duplication mutant level, number, size, and interaction

with NPM1 mutations in a large cohort of young adult patients with acute

myeloid leukemia. Blood 2008;111:2776-2784.

10. Becker H, Marcucci G, Maharry K, Radmacher MD, Margeson KM,

Whitman SP, Wu YZ, Schwind S, Paschka P, Powell BL, Carter TH, Kolitz ZE,

Wetzler M, Carrol AJ, Baer MR, Caligiuri MA, Larson RA, Bloomfield CD.

Favorable prognostic impact of NPM1 mutations in older patients with

cytogenetically normal de novo acute myeloid leukemia and associated

gene and microRNA-expression signatures: a Cancer and Leukemia Group B

study. J Clin Oncol 2010;28:596-604.

52



11. Boonthimat C, Thongnoppakhun W, Auewarakul CU. Nucleophosmin

mutation in Southeast Asian acute myeloid leukemia: eight novel variants,

FLT3 coexistence and prognostic impact of NPM1/FLT3 mutations.

Haematologica 2008;93:1565-1569.

12. Falini B, Martelli MP, Pileri SA, Mecucci C. Molecular and alternative

methods for diagnosis of acute myeloid leukemia with mutated NPM1:

flexibility may help. Haematologica 2010;95:529-534.

13. Gorello P, Cazzaniga G, Alberti F, Dell’Oro MG, Gottardi E, Specchia G, Roti

G, Rosati R, Martelli MF, Diverio D, Lo Coco F, Biondi A, Saglio G, Mecucci

C, Falini B. Quantitative assessment of minimal residual disease in acute

myeloid leukemia carrying nucleophosmin (NPM1) gene mutations.

Leukemia 2006;20:1103-1108.

14. Schnittger S, Kern W, Tschulik C, Weiss T, Dicker F, Falini B, Haferlach C,

Haferlach T. Minimal residual disease levels assessed by NPM1 mutationspecific

RQ-PCR provide important prognostic information in AML. Blood

2009;114:2220-2231.

15. Jancik S, Drabek J, Berkovcova J, Xu YZ, Stankova M, Klein J, Kolek V, Skarda

J, Tichy T, Grygarkova I, Radzioch D, Hajduch M. A comparison of direct

sequencing, pyrosequencing, high resolution melting analysis, TheraScreen

DxS, and the K-ras StripAssay for detecting KRAS mutations in non small

cell lung carcinomas. J Exp Clin Cancer Res 2012;31:79.

16. Ogino S, Kawasaki T, Brahmandam M, Yan L, Cantor M, Namgyal C, Mino-

Kenudson M, Lauwers GY, Loda M, Fuchs CS. Sensitive sequencing method

for KRAS mutation detection by pyrosequencing. J Mol Diagn 2005;7:413-

421.

17. Tsiatis AC, Norris-Kirby A, Rich RG, Hafez MJ, Gocke CD, Eshleman JR,

Murphy KM. Comparison of Sanger sequencing, pyrosequencing, and

melting curve analysis for the detection of KRAS mutations: diagnostic and

clinical implications. J Mol Diagn 2010;12:425-432.

18. Falini B, Martelli MP, Bolli N, Sportoletti P, Liso A, Tiacci E, Haferlach T. Acute

myeloid leukemia with mutated nucleophosmin (NPM1): is it a distinct

entity? Blood 2011;117:1109-1120.

53

RESEARCH ARTICLE

DOI: 10.4274/tjh.2016.0504


Incomplete Antibodies May Reduce ABO Cross-Match

Incompatibility: A Pilot Study

İnkomplet Antikorlar ABO Çapraz Karşılaştırma Uyumsuzluğunu Azaltabilirler:

Bir Başlangıç Çalışması

Mehmet Özen 1 , Soner Yılmaz 2 , Tülin Özkan 3 , Yeşim Özer 4 , Aliye Aysel Pekel 5 , Asuman Sunguroğlu 3 , Günhan Gürman 6 ,

Önder Arslan 6

1

Ufuk University Faculty of Medicine, Department of Hematology, Ankara, Turkey

2

University of Health Sciences, Gülhane Training and Research Hospital, Blood Bank Unit, Ankara, Turkey

3

Ankara University Faculty of Medicine, Department of Medical Biology, Ankara, Turkey

4

Ankara University Faculty of Medicine, Unit of Blood Bank, Ankara, Turkey

5

University of Health Sciences, Gülhane Training and Research Hospital, Clinic of Immunology and Allergy Diseases, Ankara, Turkey

6

Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey

Abstract

Objective: Any erythrocyte transfusion among humans having type A or

B blood groups is impossible due to antibodies causing fatal transfusion

complications. A cross-match test is performed to prevent immune

transfusion complications before transfusion. Our hypothesis is that the

fragment antibody (Fab) part of the antibody (incomplete antibody) may

be used to prevent an immune stimulus related to the complete antibody.

Therefore, we designed a pilot study to evaluate the effectiveness of these

incomplete antibodies using cross-match tests.

Materials and Methods: Pepsin enzyme and staphylococcal protein A

columns were used to cut anti-A and anti-B monoclonal antibodies and

purify their Fab (2) fragments, respectively. An Rh-positive erythrocyte

suspension with purified anti-A Fab (2) solution and B Rh-positive

erythrocyte suspension with purified anti-B Fab (2) solution were

combined correspondingly. Cross-match tests were performed by tube and

gel centrifugation methods. The agglutination levels due to the anti-A and

anti-B Fab (2) antibodies and their effects on the agglutination normally

observed with complete antibodies were then measured.

Results: No agglutination for the purified incomplete anti-A Fab (2) with

A Rh+ erythrocyte and anti-B Fab (2) with B Rh+ erythrocyte combinations

was observed in the tube cross-match tests. These agglutination levels were

1+ in two wells in the gel centrifugation cross-match tests. Fab (2)-treated

erythrocytes were also resistant to the agglutination that normally occurs

with complete antibodies.

Conclusion: We determined that the Fab (2) fragments of antibodies may

not only be used to obtain a mild or negative reaction when compared

to complete antibodies, but they might also be used for decreasing ABO

incompatibility. Incomplete antibodies might be a therapeutic option in

autoimmune hemolytic anemia and they may also be used in solid organ

or hematopoietic stem cell transplantation. Therefore, we have planned an

in vivo study to prove these in vitro findings.

Keywords: Transfusion medicine, Red blood cells, Complications, Humoral

immune response

Öz

Amaç: Tip A ve B kan grubuna sahip insanlar arasında herhangi bir eritrosit

nakli öldürücü transfüzyon komplikasyonlarına neden olan antikorlar

nedeniyle imkansızdır. İmmün transfüzyon komplikasyonlarını önlemek için

transfüzyondan önce çapraz karşılaştırma testi yapılır. Hipotezimiz komplet

antikorla ilişkili bağışıklık yanıtını önlemekte antikorun fragman antikor

(Fab) parçasının (inkomplet antikor) kullanılabileceğidir. Bu inkomplet

antikorların etkinliğini değerlendirmek için de çapraz karşılaştırma

testlerini kullanarak bir başlangıç çalışması tasarladık.

Gereç ve Yöntemler: Anti-A ve anti-B monoklonal antikorlarını kesmek ve

saflaştırmak için sırasıyla pepsin enzimi ve stafilokokal protein A kolonları

kullanıldı. A Rh pozitif eritrosit süspansiyonu ile saflaştırılmış anti-A Fab

(2) solüsyonu ve B Rh pozitif eritrosit süspansiyonu ile saflaştırılmış anti-B

Fab (2) solüsyonu sırasıyla birleştirildi. Çapraz karşılaştırma testleri tüp ve

jel santrifügasyon yöntemleri kullanılarak çalışıldı. Sonrasında anti-A ve

anti-B Fab (2) antikorlara bağlı aglütinasyon düzeyi ve bunların komplet

antikorlarla normalde gözlenen aglütinasyon üzerine etkileri ölçüldü.

Bulgular: Tüp yöntemi ile yapılan çapraz karşılaştırma testinde saflaştırılmış

inkomplet anti-A Fab (2) ile A Rh pozitif eritrosit ve anti-B Fab (2) ile B Rh pozitif

eritrosit kombinasyonlarında aglütinasyon gözlenmedi. Jel santrifügasyon

yöntemi ile yapılan çarpraz karşılaştırma testinde bu aglütinasyon düzeyleri

her iki kuyucukta da 1 pozitifti. Fab (2) ile muamele edilen eritrositler komplet

antikorla normalde oluşan aglütinasyona da dirençliydiler.

Sonuç: Antikorların Fab (2) fragmanlarının sadece komplet antikorlara

kıyasla daha hafif veya negatif reaksiyonu elde etmekte değil, aynı zamanda

ABO uyumsuzluğunu azaltmakta da kullanılabileceğini değerlendirdik.

İnkomplet antikorlar otoimmün hemolitik anemide bir tedavi seçeneği

olabileceği gibi aynı zamanda solid organ veya hematopoeitik kök hücre

naklinde kullanılabilir. Bu nedenle in vitro bulguları doğrulamak için in vivo

bir çalışma planladık.

Anahtar Sözcükler: Transfüzyon tıbbı, Alyuvarlar, Komplikasyonlar,

Hümöral bağışıklık yanıtı



Address for Correspondence/Yazışma Adresi: Mehmet ÖZEN, M.D.,

Ufuk University Faculty of Medicine, Department of Hematology, Ankara, Turkey

Phone : +90 536 275 00 74

E-mail : kanbilimci@gmail.com ORCID-ID: orcid.org/0000-0002-0910-9307


Accepted/Kabul tarihi: May 22, 2017

54


Özen M, et al: ABO Blood Group and Fab Antibodies

Introduction

There are many blood groups used for the human population,

including ABO, Rh, Kidd, Kell, Duffy, MNS, and Lewis. The ABO

system is the most important of all blood groups in transfusion

practice due to the reciprocal antibodies [1]. These antibodies

consistently and predictably present in the sera of normal people

whose erythrocytes lack the corresponding antigen(s) [2]. These

antibodies may cause immediate lysis of donor red blood cells

(RBCs) during ABO-incompatible transfusion and initiate fatal

hemolytic transfusion reactions [1].

Typing and screening are the first steps of pretransfusion

compatibility tests. These tests are used to define the patient’s

ABO group and Rh type and to detect expected and unexpected

antibodies in the patient’s serum. The cross-match is the final

step of pretransfusion testing [3]. In this test, donor cells

are combined with the patient’s serum and checked for

agglutination, which would signify incompatible blood [4]. This

process, also known as major cross-matching, serves as the last

safeguard to ensure a safe transfusion [4,5,6].

Antibodies are also essential for humoral immunity [7].

Many antibodies have been shown to be primarily related

to autoimmune diseases and such diseases are referred to as

antibody-related autoimmune diseases [7,8,9]. Many of these

diseases may disappear in the absence of certain antibodies [9].

All antibodies have two fragments. The antigen-binding fragment

(Fab) binds to an antigen, and the crystallizable fragment (Fc)

stimulates the immune system by activating the complement

[10]. Additionally, macrophages or lymphocytes detect the Fc

fragment of antibodies [11,12]. Therefore, the Fab fragment

detects antigens and the Fc fragment stimulates the immune

system. An antibody with the Fc part removed, in which only

the Fab fragment exists, may be called an incomplete antibody.

Papain or pepsin enzymes can be used in the fragmentation of

antibodies and can produce Fab or Fab (2) fragments of the

antibodies, respectively [13]. The effectiveness levels of Fab

and Fab (2) fragments of an antibody are similar and they

are interchangeable [14]. Our hypothesis is that incomplete

antibodies may be used to prevent an immune stimulus. We

designed a pilot study to examine the effectiveness of these

incomplete antibodies in incompatible cross-matches due

to ABO antibodies and we are presenting it here. Local ethics

committee approval was obtained for this study.


Anti-A and anti-B monoclonal antibodies (Eryclone, Verna

Industrial Estate, Verna, India) were used for this study. First the

pepsin enzyme was used to cut these monoclonal antibodies

and staphylococcal protein A columns were used to purify their

Fab (2) fragments. The Pierce F(ab’)2 Preparation Kit (Thermo

Fisher Scientific, Rockford, IL, USA) was used to produce the

Fab (2) fragments from complete antibodies. This process was

conducted according to the manufacturer’s instructions.

After obtaining purified Fab (2)s, we began the second part of

the study. During purification of Fab (2)s, the volume of the

products changed. The ratios of the complete monoclonal

antibodies to the standard erythrocyte solution for an

optimal cross-match test were calculated according to the

manufacturer’s instructions. We used these ratios for the anti-A

or -B Fab (2) to the A or B Rh-positive erythrocyte solutions for

the cross-match tests, respectively.

After calculation, an anti-IgG cross-match card (Ortho-Clinical

Diagnostics, High Wycombe, UK) was used for the compatibility

tests. We combined 10 µL of A Rh-positive 5% erythrocyte

suspension with 150 µL of purified anti-A Fab (2) solution in the

same well to conduct a cross-match test in order to prove that

the erythrocytes were covered with anti-A Fab (2). We also used

150 µL of complete anti-A antibodies for the positive control

and 150 µL of phosphate-buffered saline (PBS) for the negative

control. We incubated all cards at 37 °C for 10 min and then

centrifuged them for 5 min. The negative controls lacked the

complete and incomplete antibodies. We repeated the same

process with complete and incomplete anti-B antibodies and the

B Rh-positive erythrocyte suspension. In addition, we repeated

these tests using Across Gel ® Anti-Human Globulin IgG+C3d

cross-match cards (Dia Pro, İstanbul, Turkey). We also evaluated

agglutination levels when complete and incomplete antibodies

were put in the same well at the same time, noting the amounts

for A and B erythrocyte suspensions. We conducted an antibody

titration test and repeated this last test with several ratios

(32/1, 8/1, 4/1, 1/1, 1/4, and 1/16) for complete to incomplete

antibodies when used simultaneously. Finally, we evaluated the

reactions in all wells.

We also performed a tube test to confirm the results of the

card tests and to show whether incomplete antibodies inhibited

normal agglutination with complete antibodies or not. First,

we treated A Rh+ erythrocytes with anti-A Fab (2) and B Rh+

erythrocytes with anti-B Fab (2) in two separate tubes. We then

added complete anti-A and anti-B antibodies to the respective

tubes and mixed them. As a positive control, A Rh+ erythrocytes

were treated only with complete anti-A antibodies and B Rh+

erythrocytes were treated only with complete anti-B antibodies

in a tube without adding incomplete fragments. Consequently,

there were no incomplete antibodies in positive control tubes.

We then evaluated the agglutination levels in the tubes.

In addition, we performed a flow cytometric analysis to prove

the results of all these tests. The B Rh+ erythrocyte sample

was transferred to a tube containing K 3

EDTA and that tube’s

contents were divided into four tubes. We mixed each tube with

55



one of the following: PBS, anti-B complete antibodies alone,

anti-B incomplete antibodies alone, or a mix of anti-B antibodies

(1:1 ratio for incomplete to complete). To label the erythrocytes,

CD235a FITC (glycophorin A, BD Pharmingen, San Diego, CA, USA)

and cytoplasm-staining nucleic acid dye 7-amino-actinomycin

(7-ADD) (BD Pharmingen) were added to the tubes. The samples

were analyzed using the FACSDiva software of the FACSCanto

II model flow cytometer (BD Biosciences, San Jose, CA, USA).

Viable erythrocytes were identified as cells stained positive with

CD235a FITC and negative with 7-ADD. We evaluated 100,000

events per sample to show the erythrocyte agglutination levels

in the tubes. Agglutination levels were calculated with the

single-cell analysis and forward-scatter gating strategy [15].

The antibody titration test results are given in Table 1. Higher

concentrations of complete antibodies (from 8 to 32 times

more than incomplete antibodies) were associated with 4+

agglutination levels in simultaneous use on the cross-match card

Results

For the card test, we observed a 1+ reaction for the purified

incomplete anti-A Fab (2) and A Rh+ erythrocyte combination.

However, we observed 4+ reactions for the complete anti-A

antibody with the A Rh+ erythrocyte combination. No positive

reactions were observed in the negative control wells. The test

results were similar for the B Rh+ erythrocyte and complete

anti-B or incomplete anti-B Fab (2) antibody combinations and

negative controls (Figures 1 and 2).

Figure 2. Group B erythrocytes: T, with complete (total) antibody

(4+ reaction); PBS, with phosphate-buffered saline (- reaction);

Fab, with anti-B Fab (2) (- reaction); Fab+T: with anti-B complete

(total) and anti-B Fab (2) simultaneously, 1:1 dilution (double

reaction with 4+ and -).

PBS: Phosphate-buffered saline, Fab: fragment antibody.

Figure 1. A) Group A erythrocytes: Ai, with incomplete anti-A

antibody (1+ reaction); A+, with complete anti-A antibody (4+

reaction); A-, with negative control (no reaction). B) Group B

erythrocytes: Bi, with incomplete anti-B antibody (1+ reaction);

B+, with complete anti-B antibody (4+ reaction); B-, with

negative control (no reaction).

Table 1. Antibody titration tests on the immunoglobulin G

cross-match cards according to the ratios for complete to

incomplete antibodies added simultaneously.

Complete/

Incomplete ratio

Group

A erythrocytes

From 8/1 to 32/1 4+ 4+

4/1 -/4+* -/4+*

1/1 -/4+* -/4+*

1/4 -/4+* -/4+*

1/16 -/4+* -/4+*

*Double population.

Group

B erythrocytes

56



tests (Table 1). Lower ratios than 8/1 showed double population

results when both complete and incomplete antibodies were

simultaneously added to the wells before erythrocytes (Table 1,

Figure 2). Increasing the amounts of incomplete antibodies did

not cause any 4+ results if complete antibodies were not added

to the wells.

For the tube tests, we observed no agglutination for the A

Rh+ erythrocytes and incomplete anti-A Fab (2) antibodies

combination and the B Rh+ erythrocytes and incomplete

anti-B Fab (2) antibodies combination in two separate tubes.

There was also no agglutination when complete anti-A and

anti-B antibodies were added to the respective tubes. No

agglutination continued when the two tubes were mixed (Figure

3). Agglutination was present in the positive control tube that

contained complete antibodies (Figure 4).

minimal or no agglutination in the card and tube cross-match

tests. Minimal agglutination with Fab (2) parts was similar to

the negative controls. These results come from the characteristic

features of an antibody. The Fab part of an antibody binds to the

antigen, and the Fc part of the antibody both starts agglutination

and stimulates the immune system via activating the complement

system and/or binding to Fc receptors of macrophages or

lymphocytes [10,11,12]. Fc and its interactions with the Fc

receptors of macrophages have a critical role and are required

for antibody response [16,17]. Hemolytic disease of newborns is a

good example of this pathologic mechanism of antibody response.

Flow cytometric analysis also showed similar results (Figure 5).

Agglutinated erythrocytes expressed brighter CD235a positivity

than non-agglutinated erythrocytes. Almost all erythrocytes

were viable in the tubes. Erythrocyte agglutination levels were

calculated as 0.9% for the PBS tube, 0.1% for the Fab (2) tube,

7.1% for the complete anti-B antibody tube, and 2.9% for the

mixed tube (1:1, complete to incomplete antibody).

Discussion

Although complete anti-A and -B antibodies cause strong

agglutination, the Fab (2) parts of these antibodies caused

Figure 3. Group A and group B erythrocytes in the same tube

incubated with incomplete anti-A and -B fragment antibody

fragments and after addition of complete anti-A and -B to the

medium. No agglutination.

Figure 4. Group A and group B erythrocytes in the same tube

incubated with complete anti-A and -B antibodies. Positive

agglutination.

57



purified Fab fragments of the anti-D antibody were studied for

hemolytic disease of newborns because of their binding to Rh+

erythrocytes [19,20]. However, anti-D Fab treatment was not

sufficient for being used for hemolytic disease of newborns due

to its ineffectiveness [16]. This situation comes from the Fc part

of the antibody. Removal of the Fc part of an antibody may result

in ineffectiveness of the antibody when stimulating the immune

system even if it binds to an antigen. Similarly, the digoxinspecific

incomplete Fab antibody effectively binds to its antigen

(Digifab). However, no significant immune reaction was reported

in patients treated with this agent, probably due to the absence

of the Fc part of the antibody [21].

Figure 5. Flow cytometric analysis with group B erythrocytes:

a) with phosphate-buffered saline, 0.9% agglutination; b) with

anti-B fragment antibody (Fab) (2), 0.1% agglutination; c) with

complete anti-B, 7.1% agglutination; d) with anti-B complete

and Fab (2) simultaneously, 2.9% agglutination.

In this antibody-related disease, anti-D antibody treatment

is used to prevent hemolytic disease of newborns [18]. Anti-D

antibody drugs should be composed of complete antibodies to

prevent competitive binding of Fab fragments [16]. In the past,

ABO incompatibility is an unavoidable clinical issue, and

complications associated with ABO incompatibility should

be managed and treated appropriately [22]. Hemovigilance

procedures are recommended and used because of the potential

for fatal complications following blood transfusion [23].

Although some procedures for treating ABO-incompatible

blood transfusions are used, to the best of our knowledge,

none of them are specific [24]. In our study, we showed that

if erythrocytes are exposed to Fab (2) and complete antibodies

simultaneously, complete antibody-associated agglutination

ratios may decrease due to the coating of some erythrocytes

with Fab (2) and others with complete antibodies. Therefore, we

hypothesized that anti-A and anti-B Fab (2) antibodies might

be a useful treatment for these patients and may reduce fatal

complications. Competitive binding between complete and

incomplete antibodies may reduce or eliminate the effects of

complete antibodies [25]. No strong agglutination with high

amounts of Fab (2) and insufficiency of low amounts of Fab

(2) in preventing agglutination related to complete antibodies

also supports our hypothesis. Similarly, anti-Rh antibodies

are considered for use in preventing transfusion reactions in

hemolytic disease of newborns and their effect is superior when

they are used early after birth [26]. Our results could also be

explained with the epitope-masking hypothesis [27]. When

an epitope on an antigen is coated with an antibody, other

antibodies cannot bind the same epitope. Therefore, if the

first antibody did not start an immune response and occupy

the epitope, the following antibodies will also not be able to

cause an immune response. Our hypothesis may be stated as

follows: the Fab (2) parts of the same antibodies may be used

for masking the epitopes instead of other antibodies. Moreover,

our findings may also help in universal group O RBC studies [28].

Instead of polyethylene glycol, Fab (2)s may be used in order to

cover erythrocytes via coating surface antigens. However, our

in vitro study needs to be supported with future in vivo animal

studies for this use. Therefore, we are planning to conduct an in

vivo study to prove the results of our pilot study.

ABO incompatibility between the donor and the recipient can

cause hemolysis in the recipient, especially when performing

58



hematopoietic and solid organ transplantations [22,29].

It also presents several challenges for hematopoietic stem

cell transplantation [29]. During hematopoietic stem cell

transplantation, transfused erythrocytes and other blood

products change based on the donor’s and recipient’s blood

groups, and such changes are not stable [30]. Irradiated, filtered,

and leukocyte-depleted blood products are commonly used

for blood transfusions [31]. Some hemolytic anemia patients

also have auto-anti-A or auto-anti-B antibodies [32,33,34].

We hypothesize that the anti-A and anti-B Fab (2) antibody

fragments presented here may be used to prepare suitable

or alternative blood products for such patients in the future.

Using Fab (2) fragments of antibodies, including those of other

blood groups, may simplify current antibody screening and

identification tests. In spite of the importance of these tests,

due to problems originating from technical procedures and

evaluation methods, these tests take time, postpone the use of

blood products for patients, and sometimes result in inconclusive

outcomes [35]. As we showed, seeing a double population in a

well may help in the identification process of antibodies.

ABO-incompatible solid organ transplantation presents

other challenges, and some such transplants are currently

impossible due to ABO incompatibility [22,36]. Solid organs

contain ABO antigens that can cause incompatibility [22,36].

Immunoadsorption techniques are used to prevent the

antibody-related immune response and to extend the survival

of grafts and transplant recipients having ABO incompatibility

[37]. Hyperacute rejection in solid organ transplants may also be

reversed by using Fab fragments [38]. We hypothesized that the

intravenous administration of anti-A and anti-B Fab (2) antibody

fragments may also be applied in solid organ transplantation.

Study Limitations

Our study has some limitations. Our sole aim was to test our

hypothesis that Fab (2) antibody fragments can be used to

prevent an immune stimulus. All of the funds for this project were

provided by the authors and our funds were not sufficient to fully

complete the project. Although the results of cross-match tests

and flow cytometric analysis were consistent, we were not able

to evaluate all possible immune stimulus mechanisms associated

with incomplete antibodies. In addition, we would have preferred

to measure the levels of the Fab (2) antibody fragments and

pepsin after completing the reaction, and also to measure the

reaction in various environmental conditions, but we did not have

sufficient funds to perform all these tests. It should also be noted

that the weak positive reactions in group A or B erythrocytes

with incomplete anti-A or anti-B antibodies in IgG cross-match

card tests, respectively, may have originated from inadequate Fab

(2) antibody fragment yields with pepsin and protein A columns

in our study [39]. However, we cannot state a definite reason

explaining these mild agglutinations in card tests as we could not

measure the levels of complete and incomplete antibodies in the

products used for card tests. Higher agglutination results related

to Fab (2) fragments by the gel centrifugation technique than

tube tests may also have originated from its higher sensitivity in

detecting agglutination [40].

Conclusion

In this in vitro study, we showed that ABO incompatibility can

be minimized by using Fab (2) antibody fragments of anti-A

and anti-B antibodies. In vivo studies are needed to explore the

potential therapeutic effects of these agents. Therefore, we have

planned to start an in vivo study to prove these in vitro findings.

Acknowledgments

The authors declare no financial, consulting, or personal

relationships with other people or organizations that could

influence the work. There was also no scientific writing

assistance or grant support or employment in this study.

Ethics

Ethics Committee Approval: Dumlupınar University Faculty of

Medicine, Ethics Committee 04.05.2015 and approval number:

2015-KAEK-86/2015.04.



Surgical and Medical Practices: Y.Ö., A.A.P.; Concept: M.Ö., G.G.;

Design: M.Ö., T.Ö., G.G., A.S.; Data Collection or Processing: T.Ö.,

M.Ö., S.Y.; Analysis or Interpretation: M.Ö., S.Y., Ö.A.; Literature

Search: M.Ö., S.Y.; Writing: M.Ö., S.Y., Ö.A.

Conflict of Interest: We report that Dr. Mehmet Özen has a

patent pending (PCT/TR2016/050352). The other authors declare

that they have no conflict of interest.

References

1. Harmening DM, Forneris G, Tubby BJ. The ABO blood group system. In:

Harmening DM, (ed). Modern Blood Banking & Transfusion Practices.

Philadelphia, F. A. Davis Company, 2012.

2. Blancher A, Klein J, Socha WW. Molecular Biology and Evolution of Blood

Group and MHC Antigens in Primates, 1st ed. New York, Springer, 1997.

3. Makarovska-Bojadzieva T, Blagoevska M, Kolevski P, Kostovska S. Optimal

blood grouping and antibody screening for safe transfusion. Prilozi

2009;30:119-128.

4. Petrides M. Pretransfusion compatibility testing. In: Petrides M, Stack G,

(eds). Practical Guide to Transfusion Medicine, 2nd ed. Bethesda, American

Association of Blood Banks, 2007.

5. Shulman IA, Nelson JM, Saxena S, Thompson JC, Okamoto M, Kent

DR, Nakayama RK. Experience with the routine use of an abbreviated

crossmatch. Am J Clin Pathol 1984;82:178-181.

6. Judd WJ, Fullen DR, Steiner EA, Davenport RD, Knafl PC. Revisiting the issue:

can the reading for serologic reactivity following 37 degrees C incubation

be omitted? Transfusion 1999;39:295-259.

59



7. Janeway CA Jr. How the immune system works to protect the host from

infection: a personal view. Proc Natl Acad Sci U S A 2001;98:7461-7468.

8. Kamisawa T, Funata N, Hayashi Y, Eishi Y, Koike M, Tsuruta K, Okamoto A,

Egawa N, Nakajima H. A new clinicopathological entity of IgG4-related

autoimmune disease. J Gastroenterol 2003;38:982-984.

9. Ferraccioli GF, De Vita S, Casatta L, Damato R, Pegoraro I, Bartoli E.

Autoimmune connective tissue disease, chronic polyarthritides and B cell

expansion: risks and perspectives with immunosuppressive drugs. Clin Exp

Rheumatol 1996;14(Suppl 14):71-80.

10. Stigbrand T, Ahlström KR, Sundström B, Makiya R, Stendahl U. Alternative

technologies to generate monoclonal antibodies. Acta Oncol 1993;32:841-

844.

11. Bussel JB. Modulation of Fc receptor clearance and antiplatelet antibodies

as a consequence of intravenous immune globulin infusion in patients with

immune thrombocytopenic purpura. J Allergy Clin Immunol 1989;84:566-

578.

12. Nardin A, Lindorfer MA, Taylor RP. How are immune complexes bound

to the primate erythrocyte complement receptor transferred to acceptor

phagocytic cells? Mol Immunol 1999;36:827-835.

13. Andrew SM, Titus JA. Fragmentation of immunoglobulin G. Curr Protoc

Immunol 2001;2:2-8.

14. Kulberg AJ, Bartova LM, Evnin DN. Further studies of the adjuvant properties

of homologous IgG split products: mode of action of F(ab’)2 and related

fragments. Immunology 1978;34:199-206.

15. Won DI, Jung OJ, Lee YS, Kim SG, Suh JS. Flow cytometry antibody screening

using pooled red cells. Cytometry B Clin Cytom 2010;78:96-104.

16. Rewald E. Are there options for donor-derived i.m. anti-D IgG preparations

other than to prevent Rh(D) sensitization? The intravenous route. Transfus

Sci 1995;16:383-389.

17. Yu X, Menard M, Seabright G, Crispin M, Lazarus AH. A monoclonal antibody

with anti-D-like activity in murine immune thrombocytopenia requires

Fc domain function for immune thrombocytopenia ameliorative effects.

Transfusion 2015;55:1501-1511.

18. Altuntas N, Yenicesu I, Himmetoglu O, Kulali F, Kazanci E, Unal S, Aktas

S, Hirfanoglu I, Onal E, Turkyilmaz C, Ergenekon E, Koc E, Atalay Y. The

risk assessment study for hemolytic disease of the fetus and newborn in a

University Hospital in Turkey. Transfus Apher Sci 2013;48:377-380.

19. Margni RA, Leoni J, Bazzurro M. The incomplete anti-Rh antibody

agglutination mechanism of trypsinized ORh+ red cells. Immunology

1977;33:153-160.

20. Williamson RA, Persson MA, Burton DR. Expression of a human monoclonal

anti-(rhesus D) Fab fragment in Escherichia coli with the use of

bacteriophage λ vectors. Biochem J 1991;277:561-563.

21. Chan BS, Buckley NA. Digoxin-specific antibody fragments in the treatment

of digoxin toxicity. Clin Toxicol (Phila) 2014;52:824-836.

22. Simmons DP, Savage WJ. Hemolysis from ABO incompatibility. Hematol

Oncol Clin North Am 2015;29:429-443.

23. Vasudev R, Sawhney V, Dogra M, Raina TR. Transfusion-related

adverse reactions: from institutional hemovigilance effort to National

Hemovigilance program. Asian J Transfus Sci 2016;10:31-36.

24. Aliç Y, Akpek EA, Dönmez A, Ozkan S, Perfusionist GY, Aslamaci S. ABOincompatible

blood transfusion and invasive therapeutic approaches during

pediatric cardiopulmonary bypass. Anesth Analg 2008;107:1185-1187.

25. Mijares A, Lebesgue D, Wallukat G, Hoebeke J. From agonist to antagonist:

Fab fragments of an agonist-like monoclonal anti-β2-adrenoceptor

antibody behave as antagonists. Mol Pharmacol 2000;58:373-379.

26. Chang TY, Siegel DL. Genetic and immunological properties of phagedisplayed

human anti-Rh(D) antibodies: implications for Rh(D) epitope

topology. Blood 1998;91:3066-3078.

27. Karlsson MC, Getahun A, Heyman B. FcgammaRIIB in IgG-mediated

suppression of antibody responses: different impact in vivo and in vitro. J

Immunol 2001;167:5558-5564.

28. Kruskall MS, AuBuchon JP. Making Landsteiner’s discovery superfluous:

safety and economic implications of a universal group O red blood cell

supply. Transfus Sci 1997;18:613-620.

29. Staley EM, Schwartz J, Pham HP. An update on ABO incompatible

hematopoietic progenitor cell transplantation. Transfus Apher Sci

2016;54:337-344.

30. Worel N. ABO-mismatched allogeneic hematopoietic stem cell

transplantation. Transfus Med Hemother 2016;43:3-12.

31. Özen M, Üstün C, Öztürk B, Topçuoğlu P, Arat M, Gündüz M, Atilla E, Bolat

G, Arslan Ö, Demirer T, Akan H, İlhan O, Beksaç M, Gürman G, Özcan M.

Allogeneic transplantation in chronic myeloid leukemia and the effect of

tyrosine kinase inhibitors on survival: a quasi-experimental study. Turk J

Hematol 2017;34:16-26.

32. Govoni M, Turbiani C, Menini C, Tomasi P. Anti-A autoantibody associated

with immune hemolytic anemia. Vox Sang 1991;61:75.

33. Atichartakarn V, Chiewsilp P, Ratanasirivanich P, Stabunswadgan S.

Autoimmune hemolytic anemia due to anti B autoantibody. Vox Sang

1985;49:301-303.

34. Aygun B, Padmanabhan S, Paley C, Chandrasekaran V. Clinical significance

of RBC alloantibodies and autoantibodies in sickle cell patients who

received transfusions. Transfusion 2002;42:37-43.

35. Özen M, Erkul S, Alptekin Erkul GS, Genç Ö, Akgül E, Vural AH. Therapeutic

plasma exchange ameliorates incompatible crossmatches. Turk J Hematol

2016;33:356-358.

36. Rydberg L. ABO-incompatibility in solid organ transplantation. Transfus

Med 2001;11:325-342.

37. Genberg H, Kumlien G, Wennberg L, Berg U, Tydén G. ABO-incompatible

kidney transplantation using antigen-specific immunoadsorption and

rituximab: a 3-year follow-up. Transplantation 2008;85:1745-1754.

38. Urbani L, Cardoso J, Soubrane O, Houssin D, Gautreau C. Fab fragments from

intravenous immunoglobulin prevent hyperacute rejection in the guinea

pig-to-rat combination without reducing hemolytic complement activity

in rat serum. Transplant Proc 2000;32:2707-2709.

39. Jones RG, Landon J. A protocol for ‘enhanced pepsin digestion’: a step by

step method for obtaining pure antibody fragments in high yield from

serum. J Immunol Methods 2003;275:239-250.

40. Judd WJ, Steiner EA, Knafl PC. The gel test: sensitivity and specificity for

unexpected antibodies to blood group antigens. Immunohematology

1997;13:132-135.

60

BRIEF REPORT

DOI: 10.4274/tjh.2017.0112


Impact of Fluorescent In Situ Hybridization Aberrations and CLLU1

Expression on the Prognosis of Chronic Lymphocytic Leukemia:

Presentation of 156 Patients from Turkey

Kronik Lenfositik Lösemi Hastalarının Prognozunda Floresan İn Situ Hibridizasyon

Aberasyonları ve CLLU1 Ekspresyonunun Etkisi: Türkiye’den 156 Hastanın Sunumu

Ümmet Abur 1 , Gönül Oğur 1 , Ömer Salih Akar 1 , Engin Altundağ 1 , Huri Sema Aymelek 1 , Düzgün Özatlı 2 , Mehmet Turgut 2

1

Ondokuz Mayıs University Faculty of Medicine, Department of Medical Genetics, Samsun, Turkey

2

Ondokuz Mayıs University Faculty of Medicine, Department of Hematology, Samsun, Turkey

Abstract

Objective: This study evaluates the impact of CLLU1 expression and

fluorescent in situ hybridization (FISH) analysis of a group of Turkish

chronic lymphocytic leukemia (CLL) patients.

Materials and Methods: A total of 156 CLL patients were analyzed

by FISH method; 47 of them were also evaluated for CLLU1 expression.

Results were correlated with clinical parameters.

Results: FISH aberrations were found in 62% of patients. These

aberrations were del13q14 (67%), trisomy 12 (27%), del11q22 (19%),

del17p (8%), and 14q32 rearrangements (20%). Overall del11q22 and

del17p were associated with the highest mortality rates, shortest

overall survival (OS), and highest need for medication. Homozygous

del13q14, 14q32 rearrangements, and higher CLLU1 expression

correlated with shorter OS.

Conclusion: Cytogenetics/FISH analysis is still indicated for routine

evaluation of CLL. Special consideration is needed for the poor

prognostic implications of del11q22, del17p, 14q32 rearrangements,

and homozygous del13q14. The impact of CLLU1 expression is not yet

clear and it requires more data before becoming routine in genetic

testing in CLL patients.

Keywords: Chronic leukemia, Chronic lymphocytic leukemia,

Cytogenetics/FISH, CLLU1

Öz

Amaç: Bu çalışma, bir grup Türk kronik lenfositik lösemi (KLL)

hastasında CLLU1 ekspresyonu ve floresan in situ hibridizasyon (FISH)

analizinin prognostik etkisini değerlendirmektedir.

Gereç ve Yöntemler: Yüz elli altı KLL hastası FISH yöntemiyle

analiz edildi. Bu 156 hastanın 47’sinde ek olarak CLLU1 ekspresyonu

incelendi. Sonuçlar klinik parametrelerle ilişkilendirildi.

Bulgular: FISH aberasyonu, hastaların %62’sinde bulundu.

Aberasyonların dağılımı del13q14 (%67), trizomi 12 (%27), del11q22

(%19), del17p (%8) ve 14q32’nin yeniden düzenlenmesi (%20) olarak

bulundu. En yüksek mortalite, en kısa sağkalım süresi ve en fazla

ilaç kullanımı del11q22 ve del17p grubunda idi. Homozigot 13q14

delesyonu, 14q32 yeniden düzenlenmesi ve yüksek CLLU1 ekspresyonu

olan hastalar kısa sağkalıma sahipti.

Sonuç: Sitogenetik/FISH analizi, KLL’nin prognostik değerlendirmesinde

ve yeni genetik moleküler belirteçlerin belirlenmesinde halen etkili

yöntemlerdir. del11q22, del17p, 14q32 yeniden düzenlenmesi ve

homozigot del13q14’ün kötü prognostik etkisi gözden kaçırılmamalıdır.

CLLU1’in KLL’de prognostik yeri tartışmalıdır. Çalışmamızda orta-kötü

prognostik bir kriter olarak belirmesine rağmen, KLL’de rutin genetik

testler arasına girebilmesi için daha fazla veri gereklidir.

Anahtar Sözcükler: Kronik lösemi, Kronik lenfositik lösemi,

Sitogenetik/FISH, CLLU1



Address for Correspondence/Yazışma Adresi: Ümmet ABUR, M.D.,

Ondokuz Mayıs University Faculty of Medicine, Department of Medical Genetics, Samsun, Turkey

Phone : +90 362 312 19 19

E-mail : ummetabur@hotmail.com ORCID-ID: orcid.org/0000-0002-4811-9321

Received/Geliş tarihi: March 16, 2017


61

Abur Ü, et al: CLLU1 Expression and FISH Aberrations in CLL


Introduction

The clinical manifestation of chronic lymphocytic leukemia

(CLL) is variable. While some patients are asymptomatic for

years, others show a rapid progression of the disease [1].

Recent identifiers of high-risk patients include chromosomal

abnormalities, immunoglobulin heavy chain variable gene,

ZAP70, CD38, β2 microglobulin and lactate dehydrogenase

(LDH), and CLL upregulated gene 1 (CLLU1) expression [2].

The chromosomal abnormality rate in CLL is 30%-50%; this

rate reaches up to 70%-80% with the fluorescent in situ

hybridization (FISH) method [3,4]. FISH results have shown that

del13q14 is correlated with good prognosis whereas del11q22

and del17p indicate poor prognosis [5,6].

Unfortunately, CLL is genetically heterogeneous. Recently

relevant new genomic abnormalities such as NOTCH1 and

SF3B1 mutations as well as BIRC3 disruptions have been

described [7,8], but none of these genetic markers are unique

to CLL. CLLU1 is defined as the first gene specific to CLL. The

high expression level of CLLU1 seems to be unique in CLL [9].

However, its relevance to prognosis is still unclear.

In this study, the distribution and prognostic impact of

chromosomal aberrations via FISH as well as CLLU1 expression

levels were analyzed in a group of North Anatolian CLL patients.


Patients

Interphase FISH analysis was applied to blood or bone marrow

samples of 156 CLL patients. Of these, 47 were also evaluated

for CLLU1 expression and compared with 35 healthy controls.

Staging was done according to the modified Rai staging (MRS)

system. The results of the β2 microglobulin, LDH, white blood

cell (WBC) count, and absolute lymphocyte count were grouped

as high or low risk (Table 1).

FISH data were categorized as group 1: del13q14, group 2:

trisomy 12, group 3: del11q and del17p, and group 4: normal

FISH results. Additionally, two groups were formed with

14q32(IGH) rearrangements being positive or normal.

Interphase FISH

FISH analysis was performed by directly labeled probes (Vysis/

Abbott Co., Abbott Park, IL, USA). A FISH panel of 5 probes

(D13S319, LSI 13q34, LSI ATM, CEP12, LSI p53) was applied [10].

Seventy-one out of 156 patients were also tested by 14q32

break-apart probe.

FISH analyses were conducted using an Olympus BX51

microscope equipped with a Progressive Scan Video Camera

(Tokyo, Japan). Image analysis was carried out with CytoVision

software (version 3.93; Applied Imaging, Grand Rapids, MI, USA).

For each probe for optimization, a cut-off level was obtained

by counting 300 cells. Results were considered clonal when the

percentage of cells with any given chromosome abnormality

exceeded the normal cut-off value.

CLLU1 Expression

For the analysis of CLLU1 expression, RNA was isolated (QIAGEN,

Hilden, Germany); cDNA was synthesized using a cDNA Reverse

Transcription Kit (Ipsogen, QIAGEN). CLLU1 expression was tested

by real time-polymerase chain reaction (Rotor-Gene Q, QIAGEN)

using primers/probes previously defined (Ipsogen, CLLU1 Profile

Quant Kit). Analysis was performed using the comparative Ct

method of relative quantification with β2 microglobulin as an

endogenous control. The CLLU1 expression levels were measured

as fold upregulation in relation to normal patients’ cells and a

Table 1. Distribution of patients according to risk groups and chromosomal abnormalities (fluorescent in situ hybridization).

White blood cell

count

Absolute lymphocyte count b2 Microglobulin Lactate dehydrogenase

FISH

anomalies

Low

risk

(<50x10 3 /µL)

High

risk

(≥50x10 3 /µL)

Low

risk

(<30x10 3 /uL)

High

risk

(≥30x10 3 /µL)

Low

risk

(<2300 g/

mL)

High

risk

(≥2300

ng/mL)

Low

risk

(<500

U/L)

High

risk

(≥500 U/L)

del 11q22/del17p

(TP53)

12 (50%) 12 (50%) 7 17 (71%) 6 17 (71%) 7 (78%) 2 (22%)

del13q14 24 (65%) 13 (35%) 20 17 (45%) 19 15 (44%) 36 (95%) 2 (5%)

Trisomy 12 14 (65%) 5 (35%) 15 4 (21%) 8 10 (55%) 14 (74%) 5 (26%)

Normal 47 (79%) 13 (21%) 42 18 (30%) 22 32 (60%) 51 (88%) 7 (12%)

p-value <0.05 <0.05 >0.05 >0.05

FISH: Fluorescent in situ hybridization.

62



cut-off value was defined to separate high from low expression

levels [11].


The chi-square test was applied to determine the relationship

among clinical and laboratory parameters (LDH and β2

microglobulin, WBC, MRS, CLLU1 expression, and subsets of FISH

abnormalities). Overall survival (OS) was tested by the Kaplan-

Meier method. The survival curves were statistically compared

using a log-rank test (p≤0.05).

Results

Patient Population

Of 156 patients, 103 patients were male. Ages ranged from 36

to 90 years (median: 68 years). In total, 37 patients died during

the study. The median OS time was 101±12 months.

Results of FISH

FISH analysis detected aberrations in 96 patients (62%). The

most frequent abnormality was del13q14 (67%), followed by

trisomy 12 (27%), del11q22 (19%), and del17p13 (8%). The

occurrence of del13q14 and del11q22 was the most frequent

complex abnormality (Table 2). 14q32 rearrangements were

detected in 14 of 71 patients (20%).

The shortest survival was observed with del11q and del17p

and trisomy 12; the longest survival was with del13q14

and in normal patients (p>0.05). The need for medication

was significantly higher for del11q22 and del17p (p<0.05).

Homozygous del13q14 showed twofold shorter OS (p>0.05) and

was categorized in the high-risk group (p<0.05) (Table 3). Positive

14q32 rearrangements showed a twofold increase in mortality

and need for medication (p>0.05). They were categorized in the

intermediate- to high-risk group (p<0.05).

FISH results were correlated with MRS. The 11q22 and 17p13

deletions had an advanced stage (p<0.05), as well as higher

WBC and absolute lymphocyte counts (p<0.05). No difference

was observed within groups with respect to β2 microglobulin

and LDH and initiation of therapy (p>0.05) (Table 1).

Results of CLLU1 Expression

CLLU1 expression represented a continuum ranging from 0.1 to

3900 and a median of 17.6-fold upregulation (Figure 1). In the

group with high CLLU1 expression, survival time was twofold

lower and the need for medication was twofold higher (p>0.05).

High CLLU1 expression was associated with higher WBC count.

Table 2. Frequencies of fluorescent in situ hybridization

anomalies in chronic lymphocytic leukemia patients.

Main FISH anomalies Patient (n) Percent (%)

Heterozygote del13q14 64 67

Trisomy 12 26 27

del11q22 18 19

del17p13 8 8

Complex FISH anomalies

del13q14 + del11q22 (most common) 9 33

Homozygote del13q14 6 22

del11q22 + trisomy 12 2 7

del13q14 + del17p13 3 11

del13q14 + trisomy 12 4 15

del13q14 + del13q34 1 4

del13q14 + del13q34 + del17p13 1 4

Homozygote del13q14 + del17p13 1 4

Total 27 100

FISH: Fluorescent in situ hybridization.

Table 3. Correlation of the genetic markers with overall survival and medication.

Genetic markers Overall survival (months) No medication Medication Total

Normal 123±22 months 35 (59%) 24 (41%) 59

del11q22/del17p13 77±12 months 1 (11%) 8 (89%)* 9

Trisomy 12 74±7 months 12 (60%) 8 (40%) 20

Heterozygote del13q14 98±22 months 22 (58%) 16 (42%) 38

Homozygote del13q14 47±4 months 3 (50%) 3 (50%) 6

High expression CLLU1 levels 48±3 months 13 (46%) 15 (54%) 28

Low expression CLLU1 levels 82±8 months 4 (21%) 15 (79%) 19

*p<0.05.

63

Abur Ü, et al: CLLU1 Expression and FISH Aberrations in CLL Turk J Hematol 2018;35:61-65

Table 4. Comparison of prognostic markers in the group with high CLLU1 expression with the findings of previous studies.

Overall survival Need for

medication

Advanced stage High β2

microglobulin level

FISH

anomalies

Age

Our study

Shorter

(p>0.05)

High

(p>0.05)

-

(p>0.05)

-

(p>0.05)

-

(p>0.05)

-

(p>0.05)

Buhl et al. [18]

Shorter

(p<0.05)

High

(p<0.05)

+

(p<0.05)

NA +*

(p<0.05)

NA

Chen et al. [20] NA NA +

(p<0.05)

Josefsson et al.

[11]

Gonzalez et al.

[19]

Shorter

(p<0.05)

Shorter

(p<0.05)

High

(p<0.05)

-

(p>0.05)

(p>0.05) NA +

(p<0.05)

NA -

(p>0.05)

NA +*

(p<0.05)

-

(p>0.05)

NA

-

(p>0.05)

+

(p<0.05)

*del11q22 and del17p group correlation.

NA: Not available, FISH: fluorescent in situ hybridization.

There was no correlation between CLLU1 expression and FISH

anomalies, β2 microglobulin and LDH levels, or MRS (p>0.05).

Discussion

Genetic markers have been major factors in the prognostic

evaluation of CLL. The chromosomal anomaly detection rate with

FISH is 70%-80% [3]. In our study, the FISH abnormality rate

was 62%. Detected abnormalities include del13q14 (40%-60%),

trisomy 12 (15%-20%), del11q22 (10%-20%), and del17p13

(5%-10%). Our study yielded a similar pattern. Survival was

significantly shorter among patients with del11q12 and del17p13.

Similar to the literature data, significant correlation was observed

between these two deletions and poor prognosis [5,6,12]. In this

study, patients with positive 14q32 rearrangements also had poor

outcomes, as shown in some previous reports [13,14].

Few studies refer to homozygote del13q14, and its contribution

to prognosis is unclear. Some have reported that homozygote

del13q14 is associated with an advanced stage [15,16], while

Puiggros et al. [17] noted the opposite. In our study, homozygote

del13q14 was correlated with advanced stage and shorter

survival.

Previous studies reported that TP53, NOTCH, SF3B1, and BIRC3

mutations are accountable for poor prognosis [7,8]. The impact

of CLLU1 expression as a new prognostic factor in CLL is unclear.

In the present report, high CLLU1 expression indicated shorter

survival and higher need for treatment. Similar results were

observed in the literature [11,18,19].

In our study, there was no correlation between CLLU1 expression

and FISH aberrations. Some have reported that patients with

del17p13 and del11q22 have significantly higher levels of CLLU1

[11,18]. Chen et al. [20] noted the opposite. Buhl et al. [21] reported

no increase in the level of CLLU1 in patients with trisomy 12;

Gonzalez et al. [19] noted the opposite. There was no correlation

between trisomy 12 and CLLU1 expression in our study (Table 4).

Figure 1. Levels of CLLU1 expression: a, b, d, g- patients; c-

standard; e, f- healthy controls.

Conclusion

A chromosomal evaluation is still needed for the genetic

evaluation of CLL because it can identify unique translocations

or aberrations in which breakpoints could lead to identification

of new molecular markers. Application of a FISH panel including

probes aiming to detect homozygous del13q14, del11q22,

del17p, 14q32 rearrangements, and trisomy 12 should still be

the routine. The impact of testing CLLU1 expression is not yet

clear and there is a need for more relevant data.

Ethics

Ethics Committee Approval: This study had the permission

of the Ondokuz Mayıs University Ethical Committee (approval

number: 201/855).

Informed Consent: It was received.


Surgical and Medical Practices: G.O., M.T., D.Ö.; Concept: G.O.,

D.Ö., M.T.; Design: Ü.A., Ö.S.A., H.S.A.; Data Collection or

Processing: Ü.A., E.A., Ö.S.A.; Analysis or Interpretation: Ü.A., E.A.;

Literature Search: Ü.A., H.S.A., E.A., Ö.S.A.; Writing: G.O., Ü.A.

64






References

1. Gentile M, Mauro FR, Guarini A, Foà R. New developments in the diagnosis,

prognosis and treatment of chronic lymphocytic leukemia. Curr Opin Oncol

2005;17:597-604.

2. Byrd JC, Stilgenbauer S, Flinn IW. Chronic lymphocytic leukemia.

Hematology Am Soc Hematol Educ Program 2004;163-183.

3. Dicker F, Schnittger S, Haferlach T, Kern W, Schoch C. Immunostimulatory

oligonucleotide-induced metaphase cytogenetics detect

chromosomal aberrations in 80% of CLL patients: a study of 132 CLL

cases with correlation to FISH, IgVH status, and CD38 expression. Blood

2006;108:3152-3160.

4. Shanafelt TD, Geyer SM, Kay NE. Prognosis at diagnosis: integrating

molecular biologic insights into clinical practice for patients with CLL.

Blood 2004;103:1202-1210.

5. Lai YY, Huang XJ. Cytogenetic characteristics of B cell chronic lymphocytic

leukemia in 275 Chinese patients by fluorescence in situ hybridization: a

multicenter study. Chin Med J (Engl) 2011;124:2417-2422.

6. Döhner H, Stilgenbauer S, Benner A, Leupolt E, Kröber A, Bullinger L,

Döhner K, Bentz M, Lichter P. Genomic aberrations and survival in chronic

lymphocytic leukemia. N Engl J Med 2000;343:1910-1916.

7. Puiggros A, Blanco G, Espinet B. Genetic abnormalities in chronic

lymphocytic leukemia: where we are and where we go. Biomed Res Int

2014;2014:435983.

8. Stilgenbauer S, Schnaiter A, Paschka P, Zenz T, Rossi M, Döhner K, Bühler A,

Böttcher S, Ritgen M, Kneba M, Winkler D, Tausch E, Hoth P, Edelmann J,

Mertens D, Bullinger L, Bergmann M, Kless S, Mack S, Jäger U, Patten N, Wu

L, Wenger MK, Fingerle-Rowson G, Lichter P, Cazzola M, Wendtner CM, Fink

AM, Fischer K, Busch R, Hallek M, Döhner H. Gene mutations and treatment

outcome in chronic lymphocytic leukemia: results from the CLL8 trial. Blood

2014:123:3247-3254.

9. Buhl AM, James DF, Neuberg D, Jain S, Rassenti LZ, Kipps TJ. Analysis of

CLLU1 expression levels before and after therapy in patients with chronic

lymphocytic leukemia. Eur J Haematol 2011;86:405-411.

10. Schoch C, Schnittger S, Bursch S, Gerstner D, Hochhaus A, Berger U,

Hehlmann R, Hiddemann W, Haferlach T. Comparison of chromosome

banding analysis, interphase and hypermetaphase-FISH, qualitative and

quantitative PCR for diagnosis and for follow-up in chronic myeloid

leukemia: a study on 350 cases. Leukemia 2002;16:53-59.

11. Josefsson P, Geisler CH, Leffers H, Petersen JH, Andersen MK, Jurlander J,

Buhl AM. CLLU1 expression analysis adds prognostic information to risk

prediction in chronic lymphocytic leukemia. Blood 2007;109:4973-4979.

12. Ripollés L, Ortega M, Ortuño F, González A, Losada J, Ojanguren J, Soler JA,

Bergua J, Coll MD, Caballín MR. Genetic abnormalities and clinical outcome

in chronic lymphocytic leukemia. Cancer Genet Cytogenet 2006;171:57-64.

13. Pittman S, Catovsky D. Prognostic significance of chromosome abnormalities

in chronic lymphocytic leukaemia. Br J Haematol 1984;58:649-660.

14. Cavazzini F, Hernandez JA, Gozzetti A, Russo Rossi A, De Angeli C, Tiseo R,

Bardi A, Tammiso E, Crupi R, Lenoci MP, Forconi F, Lauria F, Marasca R, Maffei

R, Torelli G, Gonzalez M, Martin-Jimenez P, Maria Hernandez J, Rigolin GM,

Cuneo A. Chromosome 14q32 translocations involving the immunoglobulin

heavy chain locus in chronic lymphocytic leukaemia identify a disease

subset with poor prognosis. Br J Haematol 2008;142:529-537.

15. Stilgenbauer S, Sander S, Bullinger L, Benner A, Leupolt E, Winkler D, Kröber

A, Kienle D, Lichter P, Döhner H. Clonal evolution in chronic lymphocytic

leukemia: acquisition of high-risk genomic aberrations associated with

unmutated VH, resistance to therapy, and short survival. Haematologica

2007;92:1242-1245.

16. Shanafelt TD, Witzig TE, Fink SR, Jenkins RB, Paternoster SF, Smoley SA,

Stockero KJ, Nast DM, Flynn HC, Tschumper RC, Geyer S, Zent CS, Call TG,

Jelinek DF, Kay NE, Dewald GW. Prospective evaluation of clonal evolution

during long-term follow-up of patients with untreated early-stage chronic

lymphocytic leukemia. J Clin Oncol 2006;24:4634-4641.

17. Puiggros A, Delgado J, Rodriguez-Vicente A, Collado R, Aventín A, Luño

E, Grau J, Hernandez JÁ, Marugán I, Ardanaz M, González T, Valiente A,

Osma M, Calasanz MJ, Sanzo C, Carrió A, Ortega M, Santacruz R, Abrisqueta

P, Abella E, Bosch F, Carbonell F, Solé F, Hernández JM, Espinet B; Grupo

Cooperativo Español de Citogenética Hematológica (GCECGH) and Grupo

Español de Leucemia Linfática Crónica (GELLC). Biallelic losses of 13q do not

confer a poorer outcome in chronic lymphocytic leukaemia: analysis of 627

patients with isolated 13q deletion. Br J Haematol 2013;163:47-54.

18. Buhl AM, Jurlander J, Geisler CH, Pedersen LB, Andersen MK, Josefsson P,

Petersen JH, Leffers H. CLLU1 expression levels predict time to initiation

of therapy and overall survival in chronic lymphocytic leukemia. Eur J

Haematol 2006;76:455-464.

19. Gonzalez D, Else M, Wren D, Usai M, Buhl AM, Parker A, Oscier D, Morgan G,

Catovsky D. CLLU1 expression has prognostic value in chronic lymphocytic

leukemia after first-line therapy in younger patients and in those with

mutated IGHV genes. Haematologica 2013;98:274-278.

20. Chen L, Li J, Zheng W, Zhang Y, Wu Y, Li L, Qian S, Xu W. The prognostic

evaluation of CLLU1 expression levels in 50 Chinese patients with chronic

lymphocytic leukemia. Leuk Lymphoma 2007;48:1785-1792.

21. Buhl AM, Jurlander J, Jørgensen FS, Ottesen AM, Cowland JB, Gjerdrum

LM, Hansen BV, Leffers H. Identification of a gene on chromosome

12q22 uniquely overexpressed in chronic lymphocytic leukemia. Blood

2006;107:2904-2911.

65

BRIEF REPORT

DOI: 10.4274/tjh.2017.0266


Glomerular and Tubular Functions in Children and Adults with

Transfusion-Dependent Thalassemia

Transfüzyona Bağımlı Çocuk ve Erişkin Talasemi Hastalarında Glomerüler ve Tubuler Böbrek

Fonksiyonları

Agageldi Annayev 1 , Zeynep Karakaş 1 , Serap Karaman 1 , Altan Yalçıner 2 , Alev Yılmaz 3 , Sevinç Emre 3

1

İstanbul University İstanbul Faculty of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey

2

Düzen Laboratories, İstanbul, Turkey

3

İstanbul University İstanbul Faculty of Medicine, Department of Pediatric Nephrology, İstanbul, Turkey

Abstract

This study aimed at assessing renal functions in patients with

transfusion-dependent thalassemia (TDT). Fifty patients and 30

controls were enrolled in this prospective study. Serum levels of

electrolytes and albumin were measured by a spectrophotometer.

Serum levels of cystatin-C and urinary levels of β2-microglobulin

were measured by nephelometric method. Thirty-eight patients were

receiving deferasirox and 8 were on deferiprone. Serum electrolytes

and albumin levels of the patients were found to be within normal

ranges. Urinary β2-microglobulin and serum cystatin-C levels were

significantly higher in patients than controls. They did not significantly

differ between the subgroup of patients on deferiprone and the

control group, whereas they were found to be higher in patients using

deferasirox compared to controls. Urinary β2-microglobulin levels

significantly increased in patients who were receiving high-dose

deferasirox compared to those who were receiving a daily dose of

15-20 mg/kg or controls. Subclinical renal injury may be present in

TDT patients.

Keywords: Thalassemia, Tubulopathy, Glomerulopathy, β2-

Microglobulin, Cystatin

Öz

Bu çalışmada transfüzyona bağımlı talasemi (TBT) hastalarında

böbrek fonksiyonlarının değerlendirilmesi amaçlanmıştır. Prospektif

çalışmaya, 50 TBT ve 30 kontrol grubu dahil edildi. Serum elektrolitleri

ve albumin düzeyleri spektrofotometre ile ölçüldü. Serum sistatin-C ve

idrar β2-mikroglobülin düzeyleri nefelometrik yöntemle ölçüldü. Otuz

sekiz hasta deferasiroks, 8 hasta deferipron alıyordu. Hastaların serum

elektrolitleri ve albumin düzeyleri normal sınırlardaydı. İdrar β2-

mikroglobulin ve serum sistatin-C düzeyleri hasta grubunda kontrol

grubundakilere göre anlamlı derecede yüksekti. Serum Cys-C ve idrar

β2-mikroglobulin düzeyleri, deferipron kullananlar ve kontrol grubu

arasında anlamlı farklılık göstermezken, deferasiroks kullananlarda

kontrol grubuna göre daha yüksek bulundu. İdrar β2 mikroglobulin

düzeyleri, yüksek doz deferasiroks alan hastalarda, 15-20 mg/kg/

gün deferasiroks alanlara veya kontrol grubuna göre anlamlı şekilde

artmıştı. Transfüzyona bağımlı talasemi hastalarında subklinik olarak

renal hasar mevcut olabilir.

Anahtar Sözcükler: Talasemi, Tubulopati, Glomerulopati, β2-

Mikroglobulin, Sistatin C

Introduction

Iron accumulation may lead to renal damage in transfusiondependent

thalassemia (TDT) [1,2]. Cystatin C (Cys-C), a small

molecular weight protein, is filtered from the glomeruli,

reabsorbed from the tubular cells, and metabolized from the

kidneys. It is a good marker for glomerular filtration rate (GFR).

β2-Microglobulin (β2MG), a single-chain, low-molecular-weight

polypeptide, is filtered by the glomeruli, then reabsorbed and

catabolized in the proximal tubular cells. Increased urinary

excretion of β2MG may demonstrate tubular dysfunction. Our

study assessed kidney function in patients with TDT using serum

Cys-C (SCys-C) and urinary β2MG (Uβ2MG) measurements in

addition to routine tests, as well as the utility of these markers as

indicators for early glomerulopathy and tubulopathy.


Fifty patients with TDT, 25 under and 25 above the age of 18,

have been followed since their childhood by the Thalassemia



Address for Correspondence/Yazışma Adresi: Serap KARAMAN, M.D., İstanbul University İstanbul

Faculty of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey

Phone : +90 533 437 81 30

E-mail : drkaramans@yahoo.com ORCID-ID: orcid.org/0000-0002-7428-3897

Received/Geliş tarihi: July 17, 2017

Accepted/Kabul tarihi: July 28, 2017

66


Annayev A, et al: Kidney Functions in Transfusion-Dependent Thalassemia Patients

Center at the İstanbul Faculty of Medicine of İstanbul University.

Twenty-two patients were male and 28 were female. The mean

age was 18.4±11.8 years (range: 2-45). Thirty age- and sexmatched

subjects were included in the control group. Ethical

approval was granted by the institutional review board and

patient consent was obtained.

Serum electrolytes, urine calcium/creatinine (uCa/Cr) and

fractional excretion of sodium (FENa), GFR, proteinuria, serum

Cr, and albumin levels were measured and were compared to

their reference ranges in the patient group. SCys-C and Uβ2MG

levels in the patient group were compared to those of the

controls and potential correlations between SCys-C or Uβ2MG

levels and the severity of anemia, ferritin levels, and chelation

therapy were also evaluated. Blood samples collected to

measure SCys-C were cold-centrifuged at 4000 rpm for 10 min.

A photometric analysis of serum albumin, urea, Cr, uric acid, and

electrolyte levels was conducted. Ferritin levels were measured

by the electrochemiluminescent immunoassay method. SCys-C

and Uβ2MG levels were measured by nephelometry.

Statistical analysis was done using SPSS 17.0.

Results

No significant differences were found between the patients

and controls in terms of age or sex (p>0.05). Demographic and

clinical characteristics of the patients are summarized in Table

1. In the patients, serum Na, K, Ca, P, Mg, urea, Cr, and albumin

were within normal limits. None of the patients had proteinuria.

The mean uCa/Cr ratio was found to be higher than the normal

level. Estimated GFR was elevated in the patient group (Table

2). SCys-C and Uβ2MG levels were higher in patients than

controls (p=0.001, p=0.010) (Table 3). SCys-C was increased with

age (r=0.376; p=0.007). No correlations were found between

Uβ2MG levels and age (r=-0.186, p=0.217).

Renal dysfunction was detected in 30 out of 50 patients. FENa

levels were increased in 8 patients, while Uβ2MG and SCys-C

levels were increased in 9 and 25 patients, respectively. In our

study, renal involvement was observed in 54% of the patients

under the age of 18 and 64% of the patients above the age of

18. No correlations were observed between the mean SCys-C

and Uβ2MG levels and pretransfusion hemoglobin and iron load

(p>0.05) (Figures 1 and 2). No correlations were found between

SCys-C and ferritin levels. The assessment of the correlations

between the Uβ2MG and ferritin levels in patients revealed that

Uβ2MG levels were greater than in the controls, particularly

in those who had a ferritin level of <500 ng/mL or >1000 ng/

mL (p=0.001). Although Uβ2MG levels were slightly elevated in

the patients who had ferritin levels between 500 and 1000 ng/

mL, the difference between the patients and controls was not

statistically significant (p>0.05).

The distribution of patients by their chelation therapy was

as follows: 38 patients (75.5%) were on deferasirox (DFX); 8

(16.3%) were on deferiprone (DFP). Among the patients who

were on DFX, 11 (31%) were receiving a dose of 15-20 mg/kg/

day, 13 (33%) were receiving a dose of 20-30 mg/kg/day, and 14

(36%) were receiving a dose of 30-40 mg/kg/day. When SCys-C

concentrations were categorized by iron chelation therapy, there

were no differences between the patients who were on DFP and

the controls, while significant differences were found between

Table 1. Demographics and clinical characteristics of the

patient group.

Mean

Age 18.4±11.8

years

Pretransfusion hemoglobin (g/dL) 8.7±0.78

Serum ferritin (ng/mL) 1770.8±1883

TSH (mIU/L) 2.7±1.14

fT4 (pmol/L) 11.3±2.15

n %

Age <18 years 25 50

>18 years 25 50

Sex Male 22 44

Female 28 56

Ferritin (ng/mL) <500 8 -

500-1000 10 -

1000-2500 23 -

>2500 9 -

Chelator Deferasirox 38 75.5

Deferiprone 8 16.3

None 4 8.2

Splenectomy No 33 66

Yes 17 34

Osteoporosis Yes 24 48

Liver iron concentration

(mg/g dry weight)

No 26 52

<7 21 50

7-15 11 26

>15 10 24

Non-MRI - 8 -

Heart T2* (ms) <10 2 4

10-20 3 6

>20 37 74

Non-MRI - 8 -

MRI: Magnetic resonance imaging.

67



Table 2. Renal function test results in the patient group and reference ranges.

Renal function tests Mean ± SD Min - Max Reference ranges*

FENa 0.65±0.32 0.15-1.54 <1%

Na, mmol/L 137.8±2.04 135-142 136-145

K, mmol/L 4.65±0.5 3.8-5.3 3.5-5.1

Ca, mg/dL 9.39±0.56 8.1-10.9 9.2-11

P, mg/dL 4.7±0.79 3.2-6 3.4-4.2

Mg, mg/dL 1.1±2.3 1.1-2.3 1.5-2.5

uCa/Cr 0.22±0.11 0.1-0.4 <0.2

Urea, mg/dL 30.24±9.44 9-45 5-50

Cr, mg/dL 0.42±0.16 0.2-0.79 0.4-0.7

Albumin, g/dL 4.64±0.36 4.1-5.3 2.9-4.6

GFR, mL/min/1.73 m 2 , 2-12 years 216±57.2 90-302 113±27

GFR, mL/min/1.73 m 2 , 13-21 years (female) 213±65 99-213 126±22

GFR, mL/min/1.73 m 2 , 13-21 years (male) 206±20.8 110-300 140±30

GFR, mL/min/1.73 m 2 , >21 years 180±55 81-248 70-145

*Reference ranges of the Clinical Biochemistry Laboratory of the Faculty Medicine of İstanbul University.

FENa: Fractional excretion of sodium, Ca: calcium, uCa: urine calcium Cr: creatinine, GFR: glomerular filtration rate, SD: standard deviation, min: minute.

Table 3. Serum cystatin-C and urinary β2-microglobulin

levels in the patient and control groups.

Patient group

(mean ± SD)

Control group

(mean ± SD)

p-value

SCys-C, mg/L 0.75±0.12 0.66±0.09 0.001

Uβ2MG, mg/L 0.35±0.43 0.20±0.01 0.010

SCys-C: Serum cystatin-C, Uβ2MG: urinary β2-microglobulin, SD: standard deviation.

the patients who were on DFX and the controls (p=0.002) (Table

4). No correlations were found between DFX dosages and SCys-C

concentrations. When urinary β2MG levels were categorized by

iron chelation therapy, there were no differences between the

patients who were on DFP and the controls, while significant

differences were found between the patients who were on DFX

and the controls (p=0.004) (Table 4). In the subgroup of patients

on DFX, the assessment of Uβ2MG and SCys-C levels by DFX doses

revealed that there were no significant differences between the

controls and patients who were taking DFX at a dose of 15-

20 mg/kg, while statistically significant differences were found

between controls and patients who were taking DFX at a dose

of 20-40 mg/kg (p=0.011). Uβ2MG levels were increased with

increasing DFX doses. SCys-C levels were higher in all patient

groups in comparison to the control group (p=0.013), but the

difference was not dose-related.

Discussion

In our study, serum electrolytes were within reference ranges,

but FENa levels were elevated in 8 patients. In another study,

FENa was elevated in 29% of 103 TBT patients [3]. Several

studies have reported normal FENa levels [4,5]. In our study

the Ca/Cr ratio was found to be higher than the upper limit of

the normal range in 28% of the patients. Higher Ca/Cr ratios

may be associated with tubular dysfunction as well as with

impaired calcium homeostasis or bone disorders. In our study,

osteoporosis was diagnosed in almost half of the patients. Some

studies have reported high levels of Uβ2MG in patients with

TBT [6,7,8], while other studies reported the opposite [5]. In our

study, Uβ2MG concentrations in patients were significantly

higher than in the controls. No significant differences were

found between the controls and the subgroup of patients who

were on DFP, whereas statistically significant differences were

found between the controls and the DFX subgroup. Positive

68



Table 4. The comparisons of urinary β2-microglobulin and serum cystatin-C levels between the control group and the subgroups

of patients who were on chelation therapy with deferiprone or deferasirox.

Deferiprone (n=8) Deferasirox (n=38) Controls (mean ± SD) p-value* p-value**

SCys-C, mg/L 0.73±0.09 0.75±0.13 0.66±0.09 NS 0.002

Uβ2MG, mg/L 0.20±0.01 0.39±0.49 0.20±0.01 NS 0.004

*p: DFP vs. controls; **p: DFX vs. controls.

NS: Nonsignificant, Uβ2MG: urinary β2-microglobulin, SCys-C: serum cystatin-C, SD: standard deviation.

Figure 1. Correlations between pretransfusion hemoglobin and

urinary β2-microglobulin and serum cystatin-C.

Uβ2MG: Urinary β2-microglobulin, SCys-C: serum cystatin-C, Hb:

hemoglobin.

correlations between the Uβ2MG levels and DFX doses suggested

that DFX might cause dose-dependent tubulopathy. Uβ2MG

levels were significantly higher in patients than the controls,

particularly in patients who had ferritin levels of <500 ng/mL or

Figure 2. Correlations between heart T2* and Uβ2MG and SCys-C.

Uβ2MG: Urinary β2-microglobulin, SCys-C: serum cystatin-C, MRI:

magnetic resonance imaging.

>1000 ng/mL, whereas even though Uβ2MG levels were slightly

elevated in the subgroup of patients with ferritin between 500

and 1000 ng/mL, the difference between this subgroup and the

control group was not statistically significant. No associations

were found between Uβ2MG levels and iron load.

69



GFR has been a commonly used method to measure kidney

functions. In two studies, no significant differences were found

in GFR between patients and controls [3,9]. In our study, GFR

in the patient group was higher than the upper limit of the

age-adjusted reference range. The routine markers of kidney

function, including serum urea and Cr levels, were within

normal limits in all patients, in line with similar studies in the

literature [10,11,12].

Some studies reported higher SCys-C levels in patients with

TBT [13,14,15]. In our study, SCys-C levels were found to

be significantly higher in the patients in comparison to the

controls. No differences were found between the patients who

were taking DFP and the controls, while SCys-C levels were

significantly higher in patients on DFX in comparison to the

controls. No correlations were found between SCys-C or ferritin

levels and pretransfusion Hb, liver, and heart T2* values, while

SCys-C levels increased with age. Koliakos et al. [16] revealed

that the urinary markers of tubular dysfunctions correlated

positively with serum ferritin and liver iron deposition in

patients with TBT. Papassotiriou et al. [17] detected elevated

SCys-C in patients who received DFX at doses of 20-40 mg/kg/

day. Acute kidney injury has been reported in 40% of patients

on deferoxamine [18]. None of our patients were taking

deferoxamine during this study.

Conclusion

In conclusion, patients with TDT may develop renal dysfunction.

In follow-up, regular testing for early markers in addition to

routine kidney function tests may be beneficial to prevent

future severe kidney dysfunction.

Ethics

Ethics Committee Approval: İstanbul University İstanbul

Faculty of Medicine (approval number: 07.03.2014/05).

Informed Consent: Patients consent was obtained.


Surgical and Medical Practices: Z.K., A.A.; Concept: Z.K., S.E.;

Design: S.K., A.Y.; Data Collection or Processing: A.A.; Analysis

or Interpretation: A.Y.; Literature Search: A.A., A.Y., S.K.; Writing:

S.K., A.A., Z.K.




included.

References

1. Steinberg MH, Forget, BG, Higgs DR, Weatherall DJ. Disorders of Hemoglobin:

Genetics, Pathophysiology, Clinical Management. 2 nd ed. Cambridge,

Cambridge University Press, 2009.

2. Musallam KM, Capellini MD, Taher AT. Iron overload in β-thalassemia

intermedia: an emerging concern. Curr Opin Hematol 2013;20:187-192.

3. Mohkam M, Shamsian BS, Gharib A, Nariman S, Arzanian MT. Early markers

of renal dysfunction in patients with beta-thalassemia major. Pediatr

Nephrol 2008;23:971-976.

4. Aldudak B, Karabay Bayazit A, Noyan A, Ozel A, Anarat A, Sasmaz I, Kilinç Y,

Gali E, Anarat R, Dikmen N. Renal function in pediatric patients with betathalassemia

major. Pediatr Nephrol 2000;15:109-112.

5. Jafari HM, Vahidshahi K, Kosaryan M, Karami H, Mandavi MR. Ehteshami S.

Major beta-thalassemia, use of desferiexamine and renal proximal tubular

damage. Bratisl Lek Listy 2011;112:278-281.

6. Sadeghi-Bojd S, Hashemi M, Karimi M. Renal tubular function in patients

with beta-thalassaemia major in Zahedan, southeast Iran. Singapore Med J

2008;49:410-412.

7. Mula-Abed WA, Al-Hashmi HS, Al-Muslahi MN. Indicators of renal

glomerular and tubular functions in patients with beta-thalassaemia major:

A cross sectional study at the Royal Hospital, Oman. Sultan Qaboos Univ

Med J 2011;11:69-76.

8. Deveci B, Kurtoglu A, Kurtoglu E, Salim O, Toptas T. Documentation of

renal glomerular and tubular impairment and glomerular hyperfiltration in

multitransfused patients with beta thalassemia. Ann Hematol 2016;95:375-

381.

9. Kalman S, Atay AA, Sakallioglu O, Ozgürtaş T, Gök F, Kurt I, Kürekçi AE, Ozcan

O, Gökçay E. Renal tubular function in children with beta-thalassemia

minor. Nephrology (Carlton) 2005;10:427-429.

10. Smolkin V, Halevy R, Levin C, Mines M, Sakran W, Ilia K, Koren A. Renal

function in children with beta-thalassemia major and thalassemia

intermedia. Pediatr Nephrol 2008;23:1847-1851.

11. Lai ME, Spiga A, Vacquer S, Carta MP, Corrias C, Ponticelli C. Renal function

in patients with β-thalassaemia major: a long-term follow-up study.

Nephrol Dial Transplant 2012;27:3547-3551.

12. Almadzadeh A, Jalali A, Assar S, Khalilian H, Zandian K, Pedram M. Renal

tubular dysfunction in pediatric patients with beta-thalassemia major.

Saudi J Kid Dis Transpl 2011;22:497-450.

13. Economou M, Printza N, Teli A, Tzimouli V, Tsatra I, Papachristou F,

Athanassiou-Metaxa M. Renal dysfunction in patients with beta-thalassemia

major receiving iron chelation therapy either with deferoxamine and

deferiprone or with deferasirox. Acta Haematol 2010;123:148-152.

14. Ali BA, Mahmoud AM. Frequency of glomerular dysfunction in children

with beta thalassaemia major. Sultan Qaboos Univ Med J 2014;14:88-94.

15. Hamed AE, Elmelegy NT. Renal functions in pediatric patients with betathalassemia

major: relation to chelation therapy: original prospective study.

Ital J Pediatr 2010;30:36-39.

16. Koliakos G, Papachristou F, Koussi A, Perifanis V, Tsatra I, Souliou E,

Athanasiou M. Urine biochemical markers of early renal dysfunction are

associated with iron overload in beta-thalassaemia. Clin Lab Haematol

2003;25:105-109.

17. Papassotiriou I, Margeli A, Hantzi E, Delaporta P, Sergounioti A, Goussetis

E, Ladis V, Kattamis A. Cystatin C levels in patients with beta-thalassemia

during deferasirox treatment. Blood Cells Mol Dis 2010;44;152-155.

18. Prasannan L, Flynn JT, Levine JE. Acute renal failure following deferoxamine

overdose. Pedi¬atr Nephrol 2003;18:283-285.

70

IMAGES IN HEMATOLOGY

DOI: 10.4274/tjh.2016.0262


Ascites in the Course of Plasma Cell Myeloma Complicated by AL

Amyloidosis

AL Amiloidoz ile Komplike Plazma Hücre Miyeloması Seyrindeki Asitler

Jakub Debski 1 , Lidia Usnarska-Zubkiewicz 1 , Katarzyna Kapelko-Słowik 1 , Aleksander Pawluś 2 , Urszula Zaleska-Dorobisz 1 ,

Kazimierz Kuliczkowski 1

1

Uniwersytet Medyczny im Piastow Slaskich we Wroclawiu, Department of Hematology, Blood Neoplasms and Bone Marrow Transplantation,

Wroclaw, Poland

2

Uniwersytet Medyczny im Piastow Slaskich we Wroclawiu, Department of Radiology, Wroclaw, Poland

A 60-year-old Caucasian male with plasma cell myeloma

(PCM) immunoglobulin G (IgG) kappa, International Staging

System stage 3, diagnosed 5 months ago, was admitted to the

department of hematology due to progression of the disease.

He had completed three cycles of chemotherapy comprising

bortezomib, thalidomide, and dexamethasone; one cycle

comprising vincristine, doxorubicin, and dexamethasone;

and two cycles comprising lenalidomide and dexamethasone,

without any clinically significant response. Three weeks before

visiting the hospital, the patient also started complaining

of progressive weakness, impaired respiratory function,

and abdominal distension; an abdominal ultrasound at the

time revealed hepatosplenomegaly with ascites, most likely

associated with portal hypertension and protein disturbance,

which initially he tolerated very well. Physical examination

revealed crackles over the basal areas of the lungs, an enlarged

spleen and liver, ascites (stage 2), and peripheral pitting edema.

Bone marrow aspiration revealed that plasmacytes accounted

for 58% of all nucleated cells. Laboratory tests revealed the

following: serum monoclonal IgG, 88.4 g/L (normal: 8-17) and

β2-microglobulin, 26.8 mg/L (normal: 1.09-2.53). An abdominal

wall fat pad biopsy was positive for amyloid by Congo red

staining; this correlated with elevated B-type natriuretic peptide

levels (818.7 pg/mL; normal: 0-125). Peritoneal paracentesis was

performed and 650 mL of red fluid was aspirated. Laboratory

tests revealed a serum-ascites albumin gradient of 1.1 g/dL,

with elevated lactate dehydrogenase. Microscopic examination

of slide preparations revealed extensive monotonous infiltration

by plasmacytes and plasmablasts with highly atypical nuclei

Figure 1. A) Microscopic evaluation of plasmacytes and

plasmablasts in an ascitic fluid smear (modified Wright-Giemsa

stain, 400 x ). B) Multiple myelomatous infiltrations of the

peritoneal cavity (computed tomography scan, axial plane).

C) Multiple myelomatous infiltrations of the peritoneal cavity

(computed tomography scan, sagittal plane).

and wide polymorphism; monoclonality (CD38+ CD56+ CD45+

CD138+ cyκ+) was confirmed by immunophenotyping (Figure

1A). Computed tomography of the abdomen and thorax

revealed interstitial changes in the lower lobes of the lungs;

pathological contrast enhancement of enlarged (up to 16-20

mm in diameter) paraaortic, paratracheal, and mediastinal



Address for Correspondence/Yazışma Adresi: Jakub DEBSKI, M.D.,

Uniwersytet Medyczny im Piastow Slaskich we Wroclawiu, Department of Hematology, Blood Neoplasms and

Bone Marrow Transplantation, Wroclaw, Poland

Phone : +48 71 784 2610

E-mail : jmdebski@gmail.com ORCID-ID: orcid.org/0000-0002-2944-0929


Accepted/Kabul tarihi: August 15, 2016

71

Debski J, et al: Plasma Cell Myeloma


lymph nodes; hepatosplenomegaly with ascites and dilatation

of the portal venous system; multiple infiltrations of the

abdominal wall (described as peritoneal carcinomatosis);

focal osteolysis of the thoracic and lumbar vertebrae; and

enlargement of the right ventricle (Figures 1B and 1C). This

clinical presentation reflected aggressive features of advanced,

chemoresistant PCM with coexisting AL amyloidosis. Due to the

high level of monoclonal proteins in the serum, we performed

plasmapheresis and implemented a salvage chemotherapy

regimen based on bendamustine. However, despite intensive

treatment, the patient died of disease progression.

Ascites is an extremely rare extramedullary manifestation of a

heterogeneous clinical entity such as PCM, although it is worth

noting that it has a greater predilection for the IgA subtype than

for IgG [1,2]. Similarly, as in the current case, the condition may

have multifactorial etiology associated with PCM progression,

i.e. infiltration of the liver, heart failure, renal failure, portal

hypertension, amyloidosis, and, finally, peritoneal myelomatous

deposits [3]. Despite multimodal treatment, including radiation

therapy, plasmapheresis, systemic chemotherapy based on

novel drugs, and hematopoietic stem cell transplantation, the

appearance of ascites heralds a dismal prognosis; median overall

survival is usually no longer than 2 months [2,4].

Keywords: Myeloma, Amyloidosis, Ascites

Anahtar Sözcükler: Miyelom, Amiloidoz, Asit





included.

References

1. Morgan D, Cieplinski W. Myelomatous ascites. Am J Med Sci 1985;290:159-

164.

2. Mitra S, Mukherjee S, Chakraborty H, Bhattacharyya M. IgG lambda

myeloma presenting as plasmacytic ascites: case report and review of

literature. Indian J Hematol Blood Transfus 2015;31:472-479.

3. Karp SJ, Shareef D. Ascites as a presenting feature multiple myeloma. J R

Soc Med 1987;80:182-184.

4. Kyle RA, Gertz MA, Witzig TE, Lust JA, Lacy MQ, Dispenzieri A, Fonseca R,

Rajkumar SV, Offord JR, Larson DR, Plevak ME, Therneau TM, Greipp PR.

Review of 1027 patients with newly diagnosed multiple myeloma. Mayo

Clin Proc 2003;78:21-33.

72

IMAGES IN HEMATOLOGY

DOI: 10.4274/tjh.2016.0404


Pachymeningeal Involvement with Blindness as the Presenting

Manifestation of Non-Hodgkin Lymphoma

Hodgkin Dışı Lenfomada Başlangıç Bulgusu Olarak Körlük ile Birlikte Pakimeningeal Tutulum

Charanpreet Singh 1 , Arjun Lakshman 1 , Aditya Jandial 2 , Sudha Sharma 3 , Ram Nampoothiri 2 , Gaurav Prakash 2 ,

Pankaj Malhotra 2

1

Postgraduate Institute of Medical Training and Research, Department of Internal Medicine, Chandigarh, India

2

Postgraduate Institute of Medical Training and Research, Department of Internal Medicine, Clinical Hematology and Bone Marrow Division,

Chandigarh, India

3

Postgraduate Institute of Medical Training and Research, Department of Pathology, Chandigarh, India

A 44-year-old female presented with fever for 6 months and

gradual-onset progressive diminution of vision in both eyes for 1

month. On examination, she had enlarged cervical, axillary, and

inguinal lymph nodes; hepatomegaly (7 cm under the right costal

margin); splenomegaly (5 cm under the left costal margin); and

bilateral renomegaly. Examination of the optic fundi (Figures

1A and 1B) showed bilateral disc edema (black arrowhead) with

hemorrhages in the right eye (white arrowhead). Contrastenhanced

magnetic resonance imaging of the brain (Figure 2A)

was done, which showed pachymeningeal enhancement (white

arrow). Histopathological examination of the excised cervical

lymph node showed infiltration by atypical lymphoid cells, with

immunohistochemistry suggesting diffuse large B-cell lymphoma

(DLBCL)-activated B-cell-like. Microscopic examination of

cerebrospinal fluid showed infiltration by malignant lymphoid

cells (Figure 2B). A diagnosis of non-Hodgkin lymphoma-DLBCL

with secondary central nervous system (CNS) involvement and

bilateral grade 4 papilledema, likely due to pachymeningeal

involvement, was made. The patient was started on systemic

and intrathecal chemotherapy.

CNS involvement with aggressive lymphomas is uncommon

at initial presentation and usually occurs during relapse after

primary therapy [1]. Ophthalmological abnormalities are usually

Figure 1. A) Right fundus photograph showing optic disc edema

with multiple hemorrhages. B) Left fundus photograph showing

large optic disc with blurred margins suggestive of papilledema.

Figure 2. A) Contrast-enhanced magnetic resonance imaging

of the brain showing patchy meningeal enhancement and

thickening, suggestive of pachymeningitis. B) Cerebrospinal fluid

cytology showing atypical lymphoid cells 2-3 times the size of

normal lymphoid cells with prominent nucleoli.



Address for Correspondence/Yazışma Adresi: Pankaj MALHOTRA, M.D.,

Postgraduate Institute of Medical Training and Research, Department of Internal Medicine,

Clinical Hematology and Bone Marrow Division, Chandigarh, India

Phone : +91 386 280 38 08

E-mail : pgimerhemat@gmail.com ORCID-ID: orcid.org/0000-0003-1198-8491

Received/Geliş tarihi: October 12, 2016


73

Singh C, et al: Pachymeningeal Involvement with Blindness


attributed to the direct invasion of the optic nerve and ocular

structures by the lymphoma [2], which was not seen in our case.

Keywords: Non-Hodgkin lymphoma, Central nervous system

involvement, Blindness, Papilledema

Anahtar Sözcükler: Hodgkin dışı lenfoma, Merkezi sinir sistemi

tutulumu, Körlük, Papilödem





included.

References

1. Gleissner B, Chamberlain M. Treatment of CNS dissemination in systemic

lymphoma. J Neurooncol 2007;84:107-117.

2. Güler E, Kutluk T, Akalan N, Akyüz C, Atahan L, Büyükpamukçu M. Acute

blindness as a presenting sign in childhood non-Hodgkin lymphoma. J

Pediatr Hematol Oncol 2003;25:69-72.

74

LETTERS TO THE EDITOR


Leukoagglutination, Mycoplasma pneumoniae Pneumonia, and

EDTA Acid Blood

Lökosit Agregasyonu, Mycoplasma pneumoniae Pnömonisi ve EDTA’lı Kan

Beuy Joob 1 , Viroj Wiwanitkit 2

1

Sanitation 1 Medical Academic Center, Bangkok, Thailand

2

Hainan Medical University, Hainan Sheng, China; DY Patil University Faculty of Medicine, Pune, India

To the Editor,

We read the report “Peculiar Cold-Induced Leukoagglutination

in Mycoplasma pneumoniae Pneumonia” with great interest [1].

Kubota et al. [1] reported an interesting patient with Mycoplasma

pneumoniae pneumonia who had leukoagglutination. They

noted that this is a rare condition. We agree that the patient

had leukoagglutination and Mycoplasma pneumoniae

pneumonia. Nevertheless, the leukoagglutination in this case

may or may not have been due to Mycoplasma pneumoniae

pneumonia. A common problem that might be forgotten is

EDTA-induced leukoagglutination [2]. This basic laboratory

interference phenomenon cannot be ruled out in the present

case. As noted by Grob and Angelillo-Scherrer, EDTA-dependent

leukoagglutination can be seen in healthy individuals and this is

not related to Mycoplasma pneumoniae pneumonia [3].

Keywords: EDTA, Leukoagglutination, Mycoplasma

Anahtar Sözcükler: EDTA, Lökosit agregasyonu, Mikoplazma




included.

References

1. Kubota Y, Hirakawa Y, Wakayama K, Kimura S. Peculiar cold-induced

leukoagglutination in Mycoplasma pneumoniae pneumonia. Turk J Hematol

2017;34:354-355.

2. Anand M, Gulati HK, Joshi AR. Pseudoleukopenia due to

ethylenediaminetetraacetate induced leukoagglutination in a case of

hypovolemic shock. Indian J Crit Care Med 2012;16:113-114.

3. Grob AV, Angelillo-Scherrer A. Leukoagglutination reported as platelet

clumps. Blood 2011;118:2940.

Address for Correspondence/Yazışma Adresi: Beuy JOOB, M.D.,

Sanitation 1 Medical Academic Center, Bangkok, Thailand

Phone : +90 386 280 38 08

E-mail : beuyjoob@hotmail.com ORCID-ID: orcid.org/0000-0002-5281-0369

Received/Geliş tarihi: November 28, 2017

Accepted/Kabul tarihi: December 01, 2017

DOI: 10.4274/tjh.2017.0425

75



Reply to the Authors:

To the Editor,

We thank Joob and Wiwanitkit [1] for their helpful comments regarding the cause of leukoagglutination in our case [2]. Although

the underlying mechanism of in vitro leukoagglutination has not been fully clarified, leukoagglutination can be classified into two

groups: (1) EDTA-dependent leukoagglutination, and (2) EDTA-independent cold-induced leukoagglutination [3,4]. As pointed out

by Joob and Wiwanitkit [1], both EDTA and cold agglutinin (CA) may have been implicated in our case, although high-titer CA was

detected, and numerous erythrocyte agglutinations were observed in the peripheral blood smear.

Screening for CA has shown that low-titer CAs may be found in the serum of healthy adults [5]; this may suggest the possibility

that naturally occurring CA is somewhat involved in EDTA-dependent leukoagglutination in healthy subjects. Nonetheless, when

leukoagglutination occurs in an EDTA-anticoagulated blood sample, additional examination of the sample using other anticoagulants

could be recommended to confirm the relationship between leukoagglutination and EDTA.

References

1. Joob B, Wiwanitkit V. Leukoagglutination, Mycoplasma pneumoniae pneumonia and EDTA blood. Turk J Hematol 2018;35:75.

Best Regards

Yasushi Kubota, Shinya Kimura

2. Kubota Y, Hirakawa Y, Wakayama K, Kimura S. Peculiar cold-induced leukoagglutination in Mycoplasma pneumoniae pneumonia. Turk J Hematol 2017;34:354-

355.

3. Goyal P, Agrawal D, Kailash J, Singh S. Cold-induced pseudoneutropenia in human immunodeficiency virus infection: first case report and review of related

articles. Indian J Hematol Blood Transfus 2014;30(Suppl 1):148-150.

4. Lee JH. Neutrophil aggregation on the peripheral blood smear in a patient with cold agglutinin disease. Ann Hematol 2017:96:885-886.

5. Dacie J. Auto-immune haemolytic anaemia (AIHA): cold-antibody syndromes II: immunochemistry and specificity of the antibodies; serum complement in autoimmune

haemolytic anaemia. In: Dacie J (ed). The Haemolytic Anaemias. Vol. 3. London, Churchill Livingstone, 1992.

76



Cyclic Guanosine Monophosphate-Dependent Protein Kinase I

Stimulators and Activators Are Therapeutic Alternatives for Sickle

Cell Disease

Siklik Guanozin Monofosfat Bağımlı Protein Kinaz I Uyarıcıları ve Aktivatörleri Orak Hücreli

Anemide Tedavi Alternatifleridir

Mohankrishna Ghanta 1 , Elango Panchanathan 1 , Bhaskar VKS Lakkakula 2

1

Sri Ramachandra Medical College and Research Institute-DU, Faculty of Medicine, Department of Pharmacology, Chennai, Tamil Nadu, India

2

Sickle Cell Institute Chhattisgarh, Department of Molecular Genetics, Division of Research, Raipur, Chhattisgarh, India

To the Editor,

Sickle cell anemia (SCA) can lead to a host of complications,

including hemolysis, vaso-occlusive episodes (painful crises),

pulmonary hypertension, acute chest syndrome, and multiorgan

damage. SCA has no widely available cure. Furthermore, the

available treatments have unfavorable side effects, such

as myelosuppression of blood cells from continuous use of

hydroxyurea, iron overload from repeated blood transfusions,

or immunosuppressive treatments required to sustain a bone

marrow transplant. In patients with SCA, hemoglobin-induced

damage of endothelial cells can lead to endothelial dysfunction

due to the deficiency of nitric oxide (NO) [1]. NO is continuously

synthesized by the endothelium to maintain vascular tone.

The NO-soluble guanylate cyclase (sGC)-cyclic guanosine

monophosphate (cGMP) signaling (NO-sGC-cGMaP) pathway is

one of the three important signaling pathways that are regulated

by NO in maintaining the vascular tone. NO stimulates sGC in

the vascular smooth muscle cells to induce formation of cGMP.

This produced cGMP causes stimulation of cGMP-dependent

protein kinases (cGKs), which in turn stimulate voltagedependent

ion channels. The cGKs are serene and threonine

kinases, substrates for cGMP to elicit physiological functions.

cGKs inhibit calcium release from the endoplasmic reticulum

through the inositol 1,4,5-trisphosphate receptor-associated

cGMP kinase substrate (IRAG) and alternatively activate myosinlight-chain

phosphatase by inhibiting the MLC kinases, with

both mechanisms resulting in smooth muscle relaxation [2].

Two types of cGKs have been revealed to date. Mammalian cGKs

exist as two isoforms, cGKI and cGKII, which are coded by the

prkg1 and prkg2 genes, respectively. In humans two isoforms of

cGKI have been described, cGKI-α and cGKI-β, differing only in

their N-terminal parts and generated by alternative splicing of a

single gene. Northern blot analysis revealed that human cGKI-α

mRNA was present in the aorta, heart, kidneys, and adrenal

glands. In contrast, human cGKI-β mRNA was present only in

the uterus.

In SCA, vascular tone control is compromised due to

vasculopathy associated with hemolysis. As NO is considered

beneficial, hydroxyurea and inhalational NO were administered

to increase the bioavailability of NO, which raises cGMP levels

[3]. Phosphodiesterases (PDEs) are enzymes that catalyze

cGMP to GMP. Inhibitors of PDEs also increase cGMP levels

by decreasing the degradation of cGMP. Inhibition of PDE9A

enzyme with the specific inhibitor BAY73-6691 reversed the

increased adhesive properties of neutrophils in sickle cell disease

and increased production of the γ-globin gene (HBG) in K562

cells. Furthermore, sGC activators were suggested for treatment

of sickle cell disease (Figure 1) [4].

Figure 1. Schema of the nitric oxide-soluble guanylate cyclasecyclic

guanosine monophosphate-protein kinases I signaling

pathway in the treatment of sickle cell anemia vasculopathies.

NO: Nitric oxide, sGC: soluble guanylate cyclase, cGMP: cyclic guanosine

monophosphate, cGKI: protein kinases.

77



NO can lead to excess production of reactive oxygen species (ROS)

and peroxynitrites. NO was also shown to induce cyclooxygenase

and its isoforms, resulting in formation of prostaglandins,

which leads to neuroinflammation [5]. NO also increases cGMP

levels and leads to glutamate-induced toxicity resulting in

neurodegeneration in the central nervous system (CNS) [6].

Furthermore, NO-dependent and NO-independent activators of

sGC and inhibitors of PDEs tend to increase cGMP levels and

similarly lead to glutamate toxicity and neurodegeneration

in the CNS upon prolonged usage. The above-mentioned

limitations show that there is a need for developing a potent

drug similar to it with a safer pharmacological profile using

the candidates of the pathway. Hence, another member of the

same pathway, cGKI, can help as a therapeutic target, because

cGK activity was reported to be spared on cGMP-dependent

ion channels, which were shown to cause neurotoxicity [7].

cGKI activators that regulate IP3/IRAG calcium channels of

the endoplasmic reticulum are therapeutically valuable and

may change the phase of treatment. cGKI-β was reported to

be abundant in platelets and inhibited platelet aggregation

by decreasing intracellular calcium by blocking IRAG/IP3

calcium channels [8]. A study reported cGK’s regulatory role

in stimulation of γ-gene expression of fetal hemoglobin [9].

Activators of cGKI may provide drugs with safer pharmacological

profiles in the treatment of SCA vasculopathies and pulmonary

hypertension. To date, S-tides have been reported as activator

drugs produced as synthetic peptides stimulating cGKI-α [10].

New drug discoveries targeting cGKI-α and cGKI-β may ensure

safer pharmacological drug profiles of the NO-sGC-cGMP-cGK

pathway in the treatment of SCA.

Keywords: Sickle cell anemia, cGK activation, Nitric oxide

Anahtar Sözcükler: Orak hücreli anemi, cGK aktivasyonu, Nitrik

oksit

Conflicts of Interest: The authors of this paper have no conflicts



included.

References

1. Verma H, Mishra H, Khodiar PK, Patra PK, Bhaskar LV. NOS3 27-bp and IL4

70-bp VNTR polymorphisms do not contribute to the risk of sickle cell crisis.

Turk J Hematol 2016;33:365-366.

2. Schlossmann J, Ammendola A, Ashman K, Zong X, Huber A, Neubauer G,

Wang GX, Allescher HD, Korth M, Wilm M, Hofmann F, Ruth P. Regulation

of intracellular calcium by a signalling complex of IRAG, IP 3

receptor and

cGMP kinase Iβ. Nature 2000;404:197-201.

3. Weiner DL, Hibberd PL, Betit P, Cooper AB, Botelho CA, Brugnara C.

Preliminary assessment of inhaled nitric oxide for acute vaso-occlusive

crisis in pediatric patients with sickle cell disease. JAMA 2003;289:1136-

1142.

4. Sharma D, Potoka K, Kato GJ. Nitric oxide, phosphodiesterase inhibitors

and soluble guanylate cyclase stimulators as candidate treatments for

sickle cell disease. Journal of Sickle Cell Disease and Hemoglobinopathies

2016:JSCDH-D-16-00097.

5. Mancuso C, Scapagini G, Curro D, Giuffrida Stella AM, De Marco C,

Butterfield DA, Calabrese V. Mitochondrial dysfunction, free radical

generation and cellular stress response in neurodegenerative disorders.

Front Biosci 2007;12:1107-1123.

6. Ghanta M, Panchanathan E, Lakkakula BVKS, Narayanaswamy A.

Retrospection on the role of soluble guanylate cyclase in Parkinson’s

disease. J Pharmacol Pharmacother 2017;8:87-91.

7. Li Y, Maher P, Schubert D. Requirement for cGMP in nerve cell death caused

by glutathione depletion. J Cell Biol 1997;139:1317-1324.

8. Antl M, von Brühl ML, Eiglsperger C, Werner M, Konrad I, Kocher T, Wilm

M, Hofmann F, Massberg S, Schlossmann J. IRAG mediates NO/cGMPdependent

inhibition of platelet aggregation and thrombus formation.

Blood 2007;109:552-559.

9. Ikuta T, Ausenda S, Cappellini MD. Mechanism for fetal globin gene

expression: role of the soluble guanylate cyclase-cGMP-dependent protein

kinase pathway. Proc Natl Acad Sci USA 2001;98:1847-1852.

10. Moon TM, Tykocki NR, Sheehe JL, Osborne BW, Tegge W, Brayden JE,

Dostmann WR. Synthetic peptides as cGMP-independent activators of

cGMP-dependent protein kinase Iα. Chem Biol 2015;22:1653-1661.

Address for Correspondence/Yazışma Adresi: Bhaskar VKS LAKKAKULA, Ph.D., Sickle Cell Institute

Chhattisgarh, Department of Molecular Genetics, Division of Research, Raipur, Chhattisgarh, India

Phone : +91 8224979600

E-mail : lvksbhaskar@gmail.com ORCID-ID: orcid.org/0000-0003-2977-6454

Received/Geliş tarihi: November 17, 2017


DOI: 10.4274/tjh.2017.0407

78



Three Factor 11 Mutations Associated with Factor XI Deficiency in

a Turkish Family

Türk Bir Ailede Faktör XI Yetersizliği ile İlişkili Üç Faktör 11 Mutasyonu

Veysel Sabri Hançer 1 , Zafer Gökgöz 2 , Murat Büyükdoğan 1

1İstinye University Faculty of Medicine, Department of Medical Genetics, İstanbul, Turkey

2Medicana International Ankara Hospital, Clinic of Hematology, Ankara, Turkey

To the Editor,

Factor XI (FXI) is a homodimeric serine protease, which is

produced in the liver and circulates in the plasma complexed

with high-molecular-weight kininogen. FXI plays an important

role in the amplification of the initial coagulation response via

a positive feedback mechanism for the generation of additional

thrombin [1,2,3,4]. Congenital FXI deficiency is characterized by

decreased levels or activity of FXI in the plasma and may cause

an inherited bleeding disorder. The FXI gene is located on 4q34-

35 and consists of 15 exons.

The index case was a 10 year-old-boy with bleeding diathesis

(excessive bleeding after tooth extraction). His activated partial

thromboplastin time (aPTT) was 84.3 s (normal range: 32-39 s),

FXI activity was 0%, and he was diagnosed with FXI deficiency.

His parents were related. The father had a mild bleeding tendency

with prolonged aPTT (48.2 s). FXI activity was found to be 4%.

The mother and the second child had no bleeding history with

mildly decreased FXI activities (40% and 60%, respectively). We

performed a mutational analysis for the whole family, including

the patient’s grandparents. Genomic DNA was extracted from

whole blood. All exons and approximately 25-bp exon-intron

boundaries of the factor 11 (F11) gene were amplified using

sets of designed primers. After polymerase chain reaction, the

amplified fragments were sequenced.

The patient and his father had a p.Ala109Thr (ENST00000492972.6,

p.A109T, c.325 G>A, rs768474112) homozygous mutation for

F11; the patient also had novel heterozygous p.I454T and p.Y472*

mutations (Figure 1). The presence of a homozygous p.A109T

mutation in the father and the index patient caused severe FXI

deficiency. The mother and the second child had heterozygous

p.I454T and p.Y472* mutations. As shown in Figure 2, p.I454T

and p.Y472* heterozygosity moderately decreases the activity

of FXI. In this family, we found two novel mutations, p.I454T

and p.Y472*, associated with a homozygous p.A109T mutation.

p.I454T is probably damaging with a PolyPhen score of 0.9. This

is the first case reported in the literature with homozygous

p.A109T. Previously, Guella et al. [5] reported a heterozygous

p.A109T mutation in an Italian family with FXI deficiency. They

showed that exon-skipping had occurred due to a heterozygous

p.A109T mutation and they explained that the unchanged

enzyme activity was due to a non-sense mediated RNA decay

mechanism. With this mechanism, due to p.A109T mutation,

incorrectly spliced transcripts are not allowed to exit the nucleus

to the cytoplasm. Our cases confirmed their results, such that a

heterozygous p.A109T mutation did not affect enzyme activity;

the enzyme activity of a person who has two heterozygous

mutations (p.Y472* and p.I454T) is the same as that of someone

Figure 1. Electropherogram results.

Figure 2. Pedigree of the family.

AE: Activity of the enzyme, +: heterozygous, ++: homozygous.

79



who has three heterozygous mutations (p.A109T, p.Y472*, and

p.I454T). However, when p.A109T was homozygous, like in our

index patient and his father, the enzyme activity decreased by

approximately 96% as shown in the pedigree. Another interesting

point was the presence of a homozygous p.A109T mutation in

the patient while his mother had no p.A109T mutation. This may

be explained by a second-hit de novo mutation in the index

case. Further expression studies evaluating the effects of these

mutations will improve our understanding of the functional and

structural features of the FXI enzyme.

Keywords: Factor XI, Mutation, Family

Anahtar Sözcükler: Faktör XI, Mutasyon, Aile




included.

References

1. Thompson RE, Mandle R Jr, Kaplan AP. Studies of binding of prekallikrein

and factor XI to high molecular weight kininogen and its light chain. Proc

Natl Acad Sci USA 1979;76:4862-4866.

2. Geng Y, Verhamme IM, Smith SM, Sun MF, Matafonov A, Cheng Q, Smith

SA, Morrisey JH, Gailani D. The dimeric structure of factor XI and zymogen

activation. Blood 2013;121:3962-3969.

3. Kravtsov DV, Wu W, Meijers JC, Sun MF, Blinder MA, Dang TP, Wang H,

Gailani D. Dominant factor XI deficiency caused by mutations in the factor

XI catalytic domain. Blood 2004;104:128-134.

4. Whelihan MF, Orfeo T, Gissel MT, Mann KG. Coagulation procofactor

activation by factor XIa. J Thromb Haemost 2010;8:1532-1539.

5. Guella I, Solda G, Spena S, Asselta R, Ghiotto R, Tenchini ML, Castaman G,

Duga S. Molecular characterization of two novel mutations causing factor

XI deficiency: a splicing defect and a missense mutation responsible for a

CRM+ defect. Thromb Haemost 2008;99:523-530.

Address for Correspondence/Yazışma Adresi: Veysel Sabri HANÇER, M.D.,

İstinye University Faculty of Medicine, Department of Medical Genetics, İstanbul, Turkey

Phone : +90 533 634 30 14

E-mail : vshancer@yahoo.com ORCID-ID: orcid.org/0000-0003-2994-1077

Received/Geliş tarihi: April 01, 2017


DOI: 10.4274/tjh.2017.0140

80



Participation in Physical and Sportive Activities among Adult

Turkish People with Hemophilia: A Single-Center Experience

Türk Hemofili Hastalarında Fiziksel Etkinlik ve Sportif Faaliyetlere Katılım: Tek Merkez Deneyimi

Arni Lehmeier 1 , Muhlis Cem Ar 1 , Sevil Sadri 1 , Mehmet Yürüyen 2 , Zafer Başlar 1

1

İstanbul University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey

2

İstanbul University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of Geriatrics, İstanbul, Turkey

To the Editor,

Because of the increased bleeding risk, people with hemophilia

(PwH) were advised to avoid physical activity (PA) until the 1970s

[1]. However, with the advent of modern treatment modalities

and regarding the numerous benefits that PA offers, currently

PwH are encouraged to participate in PA and sports as much as

possible [2]. Nevertheless, how physically active are adult PwH?

This question has readily been studied in high-income countries

with unrestricted access to coagulation factors [3], but facts

are lacking about the awareness level on PA and its prevalence

among adult hemophiliacs in developing countries, such as

Turkey, where the market entrance of coagulation factors and

the practice of prophylaxis have been relatively recent.

In order to assess this question, 70 Turkish PwH with hemophilia

A (84.3%) and B (15.7%) aged 19-61 years (mean: 38.0±11.8)

were asked to complete a questionnaire that included questions

on the sociodemographic characteristics and bleeding patterns

of the patients, their attitudes towards exercise and sports, and

their levels of involvement in PA.

The study strikingly showed that Turkish PwH had a low level of

awareness about PA. Less than one-fifth of the patients reported

being sufficiently involved in PA. The level of involvement was

highest (35%) in young adults (18-29 years) and lowest (0%)

in patients aged 50-69 years (p<0.05). Conversely, in a German

study [4], more than half of the adult hemophiliacs were very

interested in exercise and sports. Although sportive activity is

not equal to PA, German PwH seem to be more involved in an

active lifestyle than Turkish patients.

However, the present results might be associated with the

severity of hemophiliac arthropathy, which is significantly more

prevalent in older age groups (p<0.05).

Despite the low awareness of PA, more than 40% of the patients

met the current World Health Organization recommendations

for PA [5], with young adults (65%) again being significantly

more involved in physical activities than older PwH (23%)

(p<0.05).

Our results indicate that most of the patients avoid sportive

activities (60%). Those who are physically active reported

preferring moderate-intensity PA like walking or climbing stairs,

instead of vigorous-intensity activities. As expected, the level

of sportive activity significantly declined with increasing age

(p<0.05).

What are the reasons underlying the low level of PA in adult PwH

in Turkey? Pain, fear of being injured, and lack of motivation

were the most frequently reported reasons for avoiding PA. This

is not surprising, given the late implementation of prophylaxis

in Turkey (in 2005) and the resultant high prevalence of

hemophilic arthropathy among elderly Turkish PwH causing

pain and immobility.

A multidisciplinary approach for implementation of suitable/

safe physical exercises associated with less or no pain would help

patients overcome the fear of being injured and thus increase

their involvement in PA. The risk of injury can be minimized by

following the recommendations for safe PA for hemophiliacs

[6], which are often ignored, as shown by the patients (Table 1).

In conclusion, a reasonable treatment program for hemophilia

should include much more than just factor replacement. PwH

should be educated on the positive impact of PA on their

physical, social, and psychological well-being. Furthermore, they

should be well instructed about the recommendations for safe

PA and what happens if they ignore the safety issues. PA should

be considered as an integrated part of modern hemophilia

treatment, which requires the collaboration of experts from

various scientific fields.

Keywords: Hemophilia, Physical activity, Sports, Turkey

Anahtar Sözcükler: Hemofili, Fiziksel aktivite, Spor, Türkiye




included.

81



Table 1. Results of the questionnaire according to age groups.

Variable Category Total 18-29 30-39 40-49 50-69

Treatment

Inhibitors

Severity

Joint replacement

Arthropathy

On-demand

Prophylaxis

Never

Currently

Healed

Severe

Moderate

Mild

No

Yes

No

Yes, 1 joint

Yes, 2 joints

Yes, 3+ joints

27.5

72.5

88.1

10.4

1.5

84.1

10.1

1.5

90.0

10.0

12.9

32.9

20.0

34.2

Awareness for adequate PA Little 54.3 35.3 53.6 41.7 92.3

17.6

82.4

100.0

-

-

94.1

5.9

-

100.0

-

23.5

58.8

11.8

5.9

18.5

81.5

92.3

7.7

-

81.5

14.8

3.7

85.7

14.3

7.1

25.0

32.1

35.7

41.7

58.3

75.0

16.7

8.3

66.7

16.7

16.7

83.3

16.7

16.7

33.3

16.7

33.3

Partial 27.1 29.4 28.6 41.7 7.7

Much 18.6 35.3 17.9 16.7 -

WHO guidelines Fulfilled 45.6 64.7 38.5 58.3 23.1

46.2

53.8

76.9

23.1

-

92.3

-

7.7

92.3

7.7

7.7

15.4

7.7

69.3

Unfulfilled 54.4 35.3 61.5 41.7 76.9

Swimming Swimmer 57.1 64.7 35.7 75.0 76.9

Non-swimmer 42.9 35.3 64.3 25.0 23.1

Sporting activity None 60.0 29.4 60.7 66.7 92.3

Paying attention to

adequate blood

clotting activity

Up to 2 h/week 24.3 41.1 32.2 8.3 -

At least 2 h/week 15.7 29.4 7.2 25.0 7.7

Never or rarely 58.5 53.3 50.0 66.7 75.0

Sometimes 16.9 26.7 23.1 8.3 -

Always or usually 24.6 20.0 26.9 25.0 25.0

Paying attention to safety Never or rarely 63.1 53.3 69.2 50.0 75.0

Sometimes 13.8 20.0 15.4 8.3 8.3


Participation in school sports Never or rarely 60.0 29.4 71.4 58.3 76.9

Data in percentages.

WHO: World Health Organization, PA: physical activity.

Sometimes 22.9 35.3 21.4 25.0 7.7


References

1. von Mackensen S. Quality of life and sports activities in patients with

haemophilia. Haemophilia 2007;13(Suppl 2):38-43.

2. Srivastava A, Brewer AK, Mauser-Bunschoten EP, Key NS, Kitchen S, Llinas

A, Ludlam CA, Mahlangu JN, Mulder K, Poon MC, Street A; Treatment

Guidelines Working Group on Behalf of The World Federation Of Hemophilia.

Guidelines for the management of hemophilia. Haemophilia 2013;19:1-47.

3. Goto M, Takedani H, Yokota K, Haga N. Strategies to encourage physical

activity in patients with hemophilia to improve quality of life. J Blood Med

2016;7:85-98.

4. Fromme A, Dreeskamp K, Pollmann H, Thorwesten L, Mooren FC, Völker

K. Participation in sports and physical activity of haemophilia patients.

Haemophilia 2007;13:323-327.

5. World Health Organization. Global Recommendations on Physical Activity

for Health. Geneva, WHO, 2010.

6. Kurme A, Seuser A. Fit durch Bewegung: Ein Ratgeber für Hämophile zu

Spiel, Sport und Tanz. 1st ed. Hamburg, OmniMed-Verl.-Ges, 2002.

Address for Correspondence/Yazışma Adresi: Arni LEHMEIER, M.D.,

İstanbul University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of

Hematology, İstanbul, Turkey

Phone : +90 541 977 2696

E-mail : arni.lehmeier@gmx.net ORCID-ID: orcid.org/0000-0002-2468-4879

Received/Geliş tarihi: August 06, 2017


DOI: 10.4274/tjh.2017.0292

82



A Lesser Known Side Effect of Tigecycline: Hypofibrinogenemia

Tigesiklinin Daha Az Bilinen Bir Yan Etkisi: Hipofibrinojenemi

Fulya Yılmaz Duran, Halil Yıldırım, Emre Mehmet Şen

Bozyaka Training and Research Hospital, Clinic of Anesthesiology and Reanimation, İzmir, Turkey

To the Editor,

Fibrinogen is a soluble protein that is produced in hepatocytes. It

participates in blood coagulation and is considered as an acute

phase protein with a half-life of 3 to 4 days [1,2]. Fibrinogen values

range from 200 to 400 mg/dL [1,3]. While hyperfibrinogenemia

is correlated with systemic inflammation and malignancy,

hypofibrinogenemia can be observed in chronic inherited diseases,

acquired hepatic dysfunction, severe malnutrition, disseminated

intravascular coagulation, abnormal fibrinolysis, large volumes of

blood transfusions, and drug administration [1,3,4].

Tigecycline is the first member of the glycylcyclines. This is a new

class of drugs structurally similar to tetracyclines [1,5,6]. It can be

used to treat complicated intraabdominal infections, complicated

skin infections, and community-acquired bacterial pneumonia

[6,7]. Tigecycline inhibits protein synthesis by binding to the

30S ribosomal subunit and blocking entry of aminoacyl-transfer

RNA molecules into the A side of the ribosome [1,2]. It has poor

bioavailability and so requires intravenous administration with

a loading dose of 100 mg, followed by 50 mg twice daily [1,6].

In patients with child C cirrhosis, the manufacturer suggests a

reduced dose (25 mg twice daily) [5]. Multiple adverse events

have been reported [1]. A decrease in fibrinogen levels has been

observed and severe coagulopathy has also been reported during

tigecycline treatment [2,6].

A 90-year-old female patient was admitted to the emergency

department with the complaint of nausea and vomiting for 3 days.

Her medical history included asthma and chronic renal failure.

Physical examination revealed respiratory failure, unconsciousness,

and bilateral rhonchi on chest auscultation. Computer tomography of

the thorax revealed bilateral effusion, consolidation, and diaphragm

hernia. She was intubated and transferred to the intensive care

unit (ICU). The initial antiinfective regime consisted of piperacillin/

tazobactam at 3x4.5 g and ciprofloxacin at 2x400 mg intravenously.

On the 15 th day of admission, the antibiotherapy was switched to

tigecycline because of unresponsiveness to the first antibiotherapy.

On the 10 th day of tigecycline therapy, a progressive worsening of

hyperbilirubinemia was noted. Simultaneously, the hemoglobin

level was markedly decreased (Table 1). To exclude hepatic or biliary

pathology and abdominal pathology, abdominal ultrasonography

was performed, followed by computed tomography, but they

revealed no pathological entities. Moreover, fibrinogen was

lower. As we suspected an association with the use of tigecycline,

we discontinued the drug on the 10 th day of therapy. After

discontinuation of tigecycline, fibrinogen levels improved markedly

within 8 days and bilirubin levels tended to be lower. On the 40 th day

of ICU admission, she died.

We hypothesized that the decrease in fibrinogen level was a

side effect of tigecycline because hypofibrinogenemia became

Table 1. Laboratory findings of the patient.

Tigecycline

started

On 10 th day

of tigecycline

therapy (first)

On 10 th day of

tigecycline therapy

(second)

On 5 th day after

tigecycline therapy

cessation

OOn 8 th day after

tigecycline therapy

cessation

On 13 th day after

tigecycline therapy

cessation

Hemoglobin 11.3 6.3 4.9 10 9.5 8.6

Total bilirubin 0.56 1.27 1.44 19.05 18.4 14.7

Direct bilirubin 0.22 - 0.89 7.9 17.6 9

Fibrinogen levels 400 115 115 185 673 203

Platelets 282 310 259 116 121 183

INR 1.28 1.92 1.45 1.34 1.24 1.18

aPTT 31.1 62 45.7 38.2 34.2 34.5

PT 14.2 21.7 16.2 14.9 13.8 13.1

INR: International normalized ratio, aPTT: activated partial thromboplastin time, PT: prothrombin time.

83



apparent only after 10 days of antimicrobial therapy and the

fibrinogen level increased after the withdrawal of tigecycline.

Life-threatening coagulopathy and hypofibrinogenemia

cases induced by tigecycline were reported by Rossitto et al.

[5], Pieringer et al. [7], and Sabanis et al. [1]; clinical studies

were reported by Routsi et al. [6] and Zhang et al. [2] in the

literature. However, the main mechanism by which tigecycline

provokes hypofibrinogenemia is ambiguous [1,5]. It could be

by intestinal microflora or by hepatic dysfunction [1,5,7]. The

posttranscriptional regulation of the fibrinogen gene by miRNAs

could be the cornerstone in this field [1].

We suggest routine strict monitoring of coagulation parameters in

patients receiving tigecycline. If patients develop hypofibrinogenemia,

one should consider discontinuation of the drug.

Keywords: Hypofibrinogenemia, Tigecycline, Hemoglobine level

Anahtar Sözcükler: Hipofibrinojenemi, Tigesiklin, Hemoglobin

seviyesi




included.

References

1. Sabanis N, Paschou E, Gavriilaki E, Kalaitzoglou A, Vasileiou S.

Hypofibrinogenemia induced by tigecycline: a potentially life-threatening

coagulation disorder. Infect Dis (Lond) 2015;47:743-746.

2. Zhang Q, Zhou S, Zhou J. Tigecycline treatment causes a decrease in

fibrinogen levels. Antimicrob Agents Chemother 2015;59:1650-1655.

3. Martis N, Chirio D, Queyrel-Moranne V, Zenut MC, Rocher F, Fuzibet JG.

Tocilizumab-induced hypofibrinogenemia: a report of 7 cases. Joint Bone

Spine 2017;84:369-370.

4. Zhou HB. Hypofibrinogenemia caused by hemocoagulase after colon polyps

excision. Am J Case Rep 2017;18:291-293.

5. Rossitto G, Piano S, Rosi S, Simioni P, Angeli P. Life-threatening coagulopathy

and hypofibrinogenaemia induced by tigecycline in a patient with advanced

liver cirrhosis. Eur J Gastroenterol Hepatol 2014;26:681-684.

6. Routsi C, Kokkoris S, Douka E, Ekonomidou F, Karaiskos I, Giamarellou H.

High-dose tigecycline-associated alterations in coagulation parameters

in critically ill patients with severe infections. Int J Antimicrob Agents

2015;45:90-93.

7. Pieringer H, Schmekal B, Biesenbach G, Pohanka E. Severe coagulation

disorder with hypofibrinogenemia associated with the use of tigecycline.

Ann Hematol 2010;89:1063-1064.

Address for Correspondence/Yazışma Adresi: Fulya YILMAZ DURAN, M.D.,

Bozyaka Training and Research Hospital, Clinic of Anesthesiology and Reanimation, İzmir, Turkey

Phone : +90 232 250 50 50

E-mail : drfulya@mynet.com ORCID-ID: orcid.org/0000-0002-6901-7404



DOI: 10.4274/tjh.2017.0310

84



Effectiveness of Ankaferd BloodStopper in Prophylaxis and

Treatment of Oral Mucositis in Childhood Cancers Evaluated with

Plasma Citrulline Levels

Çocukluk Çağı Kanserlerinde Oral Mukozit Tedavi ve Profilaksisinde Ankaferd BloodStopper

Etkinliği ve Plazma Sitrülin Seviyeleri ile Değerlendirilmesi

Türkan Patıroğlu 1 , Nagihan Erdoğ Şahin 2 , Ekrem Ünal 1 , Mustafa Kendirci 3 , Musa Karakükcü 1 , Mehmet Akif Özdemir 1

1

Erciyes University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology and Oncology, Kayseri, Turkey

2

Erciyes University Faculty of Medicine, Department of Pediatrics, Kayseri, Turkey

3

Erciyes University Faculty of Medicine, Department of Pediatrics, Division of Metabolism, Kayseri, Turkey

To the Editor,

Oral mucositis is one of the toxic effects of chemotherapy [1].

Ankaferd BloodStopper (ABS) is an herbal product that is used as a

hemostatic agent in traditional Turkish medicine. ABS affects the

endothelium, blood cells, angiogenesis, cellular reproduction, and

vascular dynamics and stimulates the mediators that lead to rapidly

progressive wound healing [2]. Additionally, antiinflammatory,

antimicrobial, antifungal, and antioxidative effects have been

attributed to ABS in previous studies [3,4,5].

In this study, we aimed to investigate the effectiveness of ABS

in the prophylaxis and treatment of oral mucositis in patients

receiving chemotherapy in childhood. In addition, plasma levels

of citrulline, which are a biochemical marker for mucosal barrier

injury, were measured and the effectiveness of ABS therapy

in mucositis was correlated by quantitative data in addition to

clinical assessment.

This is a case-control study. The study included 31 patients aged

4-17 years receiving chemotherapy regimens with strong mucotoxic

effects. The standard oral care (SOC) protocol consisted of tooth

brushing and use of 5% sodium bicarbonate, 0.2% chlorhexidine

mouthwash, and nystatin. The patients were asked to perform SOC

starting on the first day of a course of chemotherapy, lasting for

14 days, and oral mucosa was assessed daily upon completion of

chemotherapy based on the World Health Organization scale for

oral mucositis. In addition, blood samples were drawn to measure

citrulline levels immediately before initiation of chemotherapy

and in the period in which mucositis became most severe. The

same patients receiving the same chemotherapeutic agents in the

second course of chemotherapy were asked to gargle with ABS

(3-4 mL, liquid form) four times daily in addition to SOC. Mucosa

ratings were performed before the second chemotherapy course

and in the period in which mucositis became most severe. Of the

patients included, 17 (55%) were male and 14 (45%) were female.

The mean age was 9.3±4.5 years (range: 4-17 years). When the

stages of oral mucositis before and after chemotherapy were

assessed, it was found that there was no significant difference

between chemotherapy sessions given with SOC and with ABS plus

SOC before chemotherapy, while there was a significant difference

between these sessions after chemotherapy regarding stages

of oral mucositis (p=0.004) (Figure 1). When the extent of the

decrease in plasma citrulline levels was compared, it was higher in

chemotherapy sessions with SOC than in those with SOC plus ABS,

indicating a significant difference (p<0.008).

In conclusion, our study is a prospective, clinical trial demonstrating

that ABS is effective in the prophylaxis and treatment of oral

mucositis secondary to chemotherapy in childhood cancers.

Moreover, adding ABS to SOC limits the decrease in plasma

citrulline levels. Further randomized studies with larger samples

will allow the introduction of ABS in the prophylaxis and treatment

protocols of oral mucositis.

Figure 1. Change in oral mucositis grade before and after

chemotherapy treatment between groups. A value of p<0.05 was

considered statistically significant.

SOC: Standard oral care, CT: chemotherapy.

85



Acknowledgment

The authors would like to thank Ankaferd Pharmaceuticals for

providing the study drugs and Dr. İbrahim Haznedaroğlu for his

critical review of the manuscript.

Keywords: Childhood cancers, Oral mucositis, Ankaferd

BloodStopper, Citrulline

Anahtar Sözcükler: Çocukluk çağı kanserleri, Oral mukozit,

Ankaferd BloodStopper, Sitrülin




included.

References

1. Bonnaure-Mallet M, Bunetel L, Tricot-Doleux S, Guérin J, Bergeron C, LeGall

E. Oral complications during treatment of malignant diseases in childhood:

effects of tooth brushing. Eur J Cancer 1998;34:1588-1591.

2. Bilgili H, Kosar A, Kurt M, Onal IK, Goker H, Captug O, Shorbagi A, Turgut M,

Kekilli M, Kurt OK, Kirazli S, Aksu S, Haznedaroglu IC. Hemostatic efficacy

of Ankaferd Blood Stopper in a swine bleeding model. Med Princ Pract

2009;18:165-169.

3. Koçak E, Akbal E, Taş A, Köklü S, Karaca G, Can M, Kösem B, Üstün H. Antiinflammatory

efficiency of Ankaferd blood stopper in experimental distal

colitis model. Saudi J Gastroenterol 2013;19:126-130.

4. Saribas Z, Sener B, Haznedaroglu IC, Hascelik G, Kirazli S, Goker H.

Antimi¬crobial activity of Ankaferd BloodStopper® against nosocomial

bacterial pathogens. Cen¬tral Eur J Med 2010;5:198-202.

5. Ciftci S, Keskin F, Keceli Ozcan S, Erdem MA, Cankaya B, Bingol R, Kasapoglu

C. In vitro antifungal activity of Ankaferd BloodStopper against Candida

albicans. Curr Ther Res Clin Exp 2011;72:120-126.

Address for Correspondence/Yazışma Adresi: Nagihan ERDOĞ ŞAHİN, M.D.,

Erciyes University Faculty of Medicine, Department of Pediatrics, Kayseri, Turkey

Phone : +90 232 250 50 50

E-mail : dr.nagihansahin@yahoo.com ORCID-ID: orcid.org/0000-0002-7144-064X



DOI: 10.4274/tjh.2017.0320

86



Late Side Effects of Chemotherapy and Radiotherapy in Early

Childhood on the Teeth: Two Case Reports

Erken Çocukluk Döneminde Alınan Radyoterapi ve Kemoterapinin Dişler Üzerine Geç Dönem

Etkileri: İki Olgu Sunumu

Sevcihan Günen Yılmaz 1 , İbrahim Şevki Bayrakdar 2 , Seval Bayrak 3 , Yasin Yaşa 4

1

Akdeniz University Faculty of Dentistry, Department of Oral and Maxillofacial Radiology, Antalya, Turkey

2

Eskişehir Osmangazi University Faculty of Dentistry, Department of Oral and Maxillofacial Radiology, Eskişehir, Turkey

3

Abant İzzet Baysal University Faculty of Dentistry, Department of Oral and Maxillofacial Radiology, Bolu, Turkey

4

Ordu University Faculty of Dentistry, Department of Oral and Maxillofacial Radiology, Ordu, Turkey

To the Editor,

Radiotherapy and chemotherapy can generate adverse results

during or after the completion of therapy and these treatments

can also cause some oral anomalies [1,2,3]. Early and late oraldental

abnormalities have been reported in head and neck cancer

patients treated with radiotherapy and chemotherapy. The late

side effects of chemotherapy and radiotherapy on the permanent

teeth of two patients who had cancer treatment in their early

childhood periods are presented here.

Radiotherapy and chemotherapy, which are the main treatments

of cancer for young children, can have long-term adverse effects

pertaining to the growth and development of orofacial and dental

structures.

Case 1: According to the medical history of a 17-year-old female

patient who applied to our clinic for routine dental treatment,

she had received radiotherapy and chemotherapy due to having

Hodgkin lymphoma between the ages of 4 and 5. At the age of 4

years, the patient was admitted to the hospital with an early stage

of Hodgkin lymphoma and 4 cycles of the adriamycin, bleomycin,

vinblastine, dacarbazine (ABVD) chemotherapy protocol and 20 Gy

of neck-region radiotherapy were applied. Complete remission was

obtained.

In the oral and radiographic examinations, microdontia was found

in teeth 11, 15, 17, 21, 25, 36, and 46. The root formations of these

teeth were less developed. Due to the lack of germ of teeth 26, 27,

37, and 47, hypodontia was found (Figure 1A). The unstimulated

salivary rate was low (0.3 mL/min). The mouth opening was normal.

Case 2: According to the medical history of a 24-year-old male

patient who applied to our clinic for routine dental treatment, six

cycles of ABVD chemotherapy protocol and 30 Gy of radiotherapy

to the neck region had been given due to diagnosis of stage III

Hodgkin lymphoma between the ages of 7 and 9 years old.

Complete remission was achieved.

In oral and radiographic examinations, microdontia was found in

teeth 34, 35, 37, 44, 45, 47, and 48 (Figure 1B). The root formations

of these teeth were less developed. The unstimulated salivary rate

was low (0.3 mL/min). The mouth opening was normal.

Figure 1. A) Panoramic radiography of case 1; B) panoramic

radiography of case 2. A) Panoramic radiography of case 1; B)

panoramic radiography of case 2.

87



When pediatric patients are exposed to radiation during the period

of tooth development, the formation of dental anomalies such

as hypodontia, the cessation of root development, microdontia,

taurodontism, temporomandibular joint disorders, malocclusion,

and enamel hypoplasia can occur [4,5,6,7,8]. Such problems do

not occur in adults.

These treatments may have different effects depending on the

dose, the duration of treatment, and the age of the patient [8].

In both of our patients, microdontia due to hypodontia and

underdevelopment was observed because dental germs could not

be formed [1,2,3,5]. Both patients had low salivary flow rates. This

has been observed in previous studies [6]. Both of the patients’

mouth openings were normal. In some studies, limitation of the

mouth opening or trismus has been reported.

It has been discovered that chemotherapy and radiotherapy in

early childhood have different effects in relation to the doses

received in the development stages of the teeth. It is important

to inform children who were treated for cancer at early ages and

their parents accordingly.

Keywords: Pediatric hematologic malignancies, Late side effects,

Radiotheraphy and chemotherapy, Teeth, Salivary flow rate

Anahtar Sözcükler: Pediatrik hematolojik maligniteler, Geç yan

etkiler, Radyoterapi ve kemoterapi, Dişler, Tükürük akış hızı




included.

References

1. Tummawanit S, Shrestha B, Thaworanunta S, Srithavaj T. Late effects of

orbital enucleation and radiation on maxillofacial prosthetic rehabilitation:

a clinical report. J Prosthet Dent 2013;109:291-295.

2. Owosho AA, Brady P, Wolden SL, Wexler LH, Antonescu CR, Huryn JM, Estilo

CL. Long-term effect of chemotherapy-intensity-modulated radiation

therapy (chemo-IMRT) on dentofacial development in head and neck

rhabdomyosarcoma patients. Pediatr Hematol Oncol 2016;33:383-392.

3. Jaffe N, Toth BB, Hoar RE, Ried HL, Sullivan MP, McNeese MD. Dental and

maxillofacial abnormalities in long-term survivors of childhood cancer:

effects of treatment with chemotherapy and radiation to the head and neck.

Pediatrics 1984;73:816-823.

4. Lalla RV, Long-Simpson L, Hodges JS, Treister N, Sollecito T, Schmidt B, Patton

LL, Brennan MT; OraRad Study Group. Clinical registry of dental outcomes in

head and neck cancer patients (OraRad): rationale, methods, and recruitment

considerations. BMC Oral Health 2017;17:59.

5. Harorlı A. Ağız, Diş ve Çene Radyolojisi. İstanbul, Nobel Tıp Kitabevleri, 2014.

6. Thouvenin-Doulet S, Fayoux P, Broucqsault H, Bernier-Chastagner V.

Neurosensory, aesthetic and dental late effects of childhood cancer therapy.

Bull Cancer 2015;102:642-647.

7. Cooper JS, Fu K, James Marks J, Silverman S. Late effects of radiation therapy

in the head and neck region. Int J Radiat Oncol Biol Phys 1995;31:1141-1164.

8. Rouers M, Dubourg S, Bornert F, Truntzer P, Antoni D, Couchot J, Ganansia

V, Bourrier C, Guihard S, Noel G. Orodental status before radiation therapy

of the head and neck area: a prospective analysis on 48 patients. Cancer

Radiother 2016;20:199-204.

Address for Correspondence/Yazışma Adresi: Sevcihan GÜNEN YILMAZ, M.D.,

Akdeniz University Faculty of Dentistry, Department of Oral and Maxillofacial Radiology, Antalya, Turkey

Phone : +90 242 310 69 69

E-mail : dentistsevcihan@hotmail.com ORCID-ID: orcid.org/0000-0002-4566-2927

Received/Geliş tarihi: May 27, 2017


DOI: 10.4274/tjh.2017.0216

88



t(9;19)(q22;p13) in Acute Myelomonocytic Leukemia

Akut Miyelomonositik Lösemide t(9;19)(q22;p13)

Moeinadin Safavi 1,2 , Akbar Safaei 2 , Marzieh Hosseini 2

1

Tehran University Faculty of Medicine, Department of Pathology, Molecular Pathology and Cytogenetic Ward, Tehran, Iran

2

Shiraz University of Faculty of Medicine, Department of Pathology, Molecular Pathology and Cytogenetic Ward, Shiraz, Iran

To the Editor,

Chromosomal aberrations play a role in the leukemogenesis of

acute myeloid leukemia. Some chromosomal abnormalities such as

t(8;21), t(15;17), and inv(16) are frequently observed, but hundreds

of uncommon chromosomal translocations also exist and their

significance remains to be clarified [1]. Here we introduce a case of

acute myeloid leukemia with a very rare translocation and explain

its morphologic and immunophenotyping findings.

The patient was a 50-year-old man with malaise and weakness.

Paraclinical evaluation revealed leukocytosis along with anemia

and thrombocytopenia (white blood cells: 24,000/µL, hemoglobin:

7.4 g/dL, platelets: 30,000/µL). Peripheral blood smear exhibited

atypical blastoid cells. Subsequently the patient underwent

bone marrow aspiration, which showed 80% blasts of myeloid

and monocytic type with prominent cytoplasmic vacuolization.

Immunophenotyping by flow cytometry revealed positive

reactions for CD117, HLA-DR, MPO, and CD64. Morphologic

findings and immunophenotyping were compatible with acute

myelomonocytic leukemia. Bone marrow cytogenetic study

showed t(9;19)(q22;p13) (Figure 1). Reverse transcriptase PCR was

performed for t(8;21) (AML1-ETO fusion gene) and inv(16) (CBFB-

MYH11 fusion gene), which was negative for both of them. FLT3

duplication and D835 mutation were also negative. Subsequently,

the patient underwent a 7+3 chemotherapy regimen with

cytarabine continuous infusion (300 mg, IV) over 24 h on days 1

to 7 and daunorubicin (115 mg, IV bolus) on days 1 to 3. Although

remission was achieved after induction therapy (3% blasts in bone

marrow 4 weeks after chemotherapy), unfortunately the patient

contracted sepsis due to neutropenia and died 1.5 months after

treatment initiation.

Acute myeloid leukemia with prominent monocytic lineage

involvement (M4-M5) is usually associated with determined

recurrent cytogenetic aberrations like inv(16), t(v;11) (MLL gene

rearrangement), and t(8;16). According to a literature review,

t(9;19)(q22;p13) has been reported previously only twice. The

Figure 1. Bone marrow karyotype study revealed t(9;19)(q22;p13).

89



first case was a 57-year-old man with acute myelomonocytic

leukemia and concomitant inv(16). Exact morphologic and

immunophenotyping characteristics of this case were not

determined [2]. The second case was a 13-year-old boy with

acute myeloid leukemia (M0) who developed multiple clonal

abnormalities during his treatment course [3]. The present case is

the first patient with acute myelomonocytic leukemia with t(9;19)

(q22;p13) as the sole chromosomal abnormality. This cytogenetic

finding and its associated morphologic and immunophenotyping

characteristics are noteworthy and merit attention.

Keywords: Acute myeloid leukemia, Cytogenetic, Monocytic

differentiation

Anahtar Sözcükler: Akut miyeloid lösemi, Sitogenetik, Monositik

farklılaşma

References

1. Yang JJ, Park TS, Wan TSK. Recurrent cytogenetic abnormalities in acute

myeloid leukemia. In: Wan TSK (ed). Cancer Cytogenetics. New York,

Springer Nature, 2017.

2. Buonamici S, Ottaviani E, Testoni N, Montefusco V, Visani G, Bonifazi F,

Amabile M, Terragna C, Ruggeri D, Piccaluga PP, Isidori A, Malagola M,

Baccarani M, Tura S, Martinelli G. Real-time quantitation of minimal

residual disease in inv(16)-positive acute myeloid leukemia may indicate

risk for clinical relapse and may identify patients in a curable state. Blood

2002;99:443-449.

3. Ostronoff F, Bueso-Ramos C, Cortes J, Giralt S. Normal hematopoietic

function and multiple bone marrow clonal abnormalities in a patient with

acute myeloid leukemia after two mismatched stem-cell transplants with

graft failure and autologous reconstitution. Am J Hematol 2007;82:744-

747.

Address for Correspondence/Yazışma Adresi: Moeinadin SAFAVI, M.D.,

Tehran University Faculty of Medicine, Department of Pathology, Molecular Pathology and Cytogenetic

Ward, Tehran, Iran

E-mail : safavi_moeinadin@yahoo.com ORCID-ID: orcid.org/0000-0002-4042-7506

Received/Geliş tarihi: October 07, 2017


DOI: 10.4274/tjh.2017.0368

90



Invasive Aspergillosis in Refractory Angioimmunoblastic

T-Cell Lymphoma

Refrakter Anjiyoimmünoblastik T-Hücreli Lenfomada İnvaziv Aspergilloz

Prakash NP 1 , Anoop TM 1 , Rakul Nambiar 1 , Jaisankar Puthusseri 1 , Swapna B 2

1

Regional Cancer Centre, Department of Medical Oncology, Thiruvananthapuram, India

2

Regional Cancer Centre, Department of Microbiology, Thiruvananthapuram, India

To the Editor,

A 40-year-old man with angioimmunoblastic T-cell lymphoma, on

palliative chemotherapy with lenalidomide at 20 mg, developed

pancytopenia and progressive loss of vision and conjunctival swelling

over the right eye after the second cycle (Figure 1). Brain magnetic

resonance imaging with orbit demonstrated endophthalmitis. A

pus sample was inoculated onto routine bacteriological media

and Sabouraud’s dextrose agar (SDA) for detection of fungal

pathogens. On the 4 th day, fungal growth was observed on SDA. The

surface of the fungal colony was initially white; it turned to a bluegreen

color and had a powdery texture. Lactose phenol cotton blue

mount showed hyaline septate hyphae with short conidiophores

and vesicle-bearing chains of round conidia covering the upper

half of the vesicle, suggestive of Aspergillus fumigatus. He was

started on parenteral voriconazole, but his condition worsened and

he died following severe fungal sepsis.

Orbital invasive aspergillosis is a fatal condition, often

misdiagnosed, and the mortality rate remains high even after

proper treatment. Patients at risk for invasive aspergillosis include

patients with prolonged neutropenia, allogeneic hematopoietic

stem cell recipients, solid organ transplant recipients, patients on

chronic steroid therapy, and patients with HIV infection or chronic

granulomatous disease [1,2]. Among patients with hematologic

conditions (both benign and malignant), the duration and grade of

neutropenia predict the risk of invasive aspergillosis. The incidence

of invasive aspergillosis in patients with hematologic malignancies

has been reported to be as high as 3.1%, with Aspergillus fumigatus

representing the most commonly isolated species [3]. Compared to

amphotericin B, voriconazole demonstrates a survival benefit, less

systemic toxicity, and better tolerance by patients [4].

Figure 1. Photograph showing red conjunctival swelling over the

right eye.

Keywords: Lymphoma, Endophthalmitis, Aspergillus

Anahtar Sözcükler: Lenfoma, Endoftalmi, Aspergilloz




References

1. Weinberger M, Elattar I, Marshall D, Steinberg SM, Redner RL, Young NS,

Pizzo PA. Patterns of infection in patients with aplastic anemia and the

emergence of Aspergillus as a major cause of death. Medicine (Baltimore)

1992;71:24-43.

2. Gerson SL, Talbot GH, Hurwitz S, Strom BL, Lusk EJ, Cassileth PA. Prolonged

granulocytopenia: the major risk factor for invasive pulmonary aspergillosis

in patients with acute leukemia. Ann Intern Med 1984;100:345-351.

3. Nicolle MC, Bénet T, Thiebaut A, Bienvenu AL, Voirin N, Duclos A, Sobh

M, Cannas G, Thomas X, Nicolini FE, De Monbrison F, Piens MA, Picot S,

Michallet M, Vanhems P. Invasive aspergillosis in patients with hematologic

malignancies: incidence and description of 127 cases enrolled in a

single institution prospective survey from 2004 to 2009. Haematologica

2011;96:1685-1691.

4. Ohlstein DH, Hooten C, Perez J, Clark CL 3rd, Samy H. Orbital aspergillosis:

voriconazole – the new standard treatment? Case Rep Ophthalmol

2012;3:46-53.

Address for Correspondence/Yazışma Adresi: Rakul NAMBIAR, M.D.,

Regional Cancer Centre, Department of Medical Oncology, Thiruvananthapuram, India

E-mail : rakulnambiar@yahoo.com ORCID-ID: orcid.org/0000-0001-9670-3453

Received/Geliş tarihi: June 13, 2017


DOI: 10.4274/tjh.2017.0236

91



Expansion of a Myeloma-associated Lesion from Orbita to the

Cerebrum

Orbitadan Serebruma Kadar Uzanan Miyelom ile İlişkili Lezyon

Sinan Demircioğlu 1 , Demet Aydoğdu 2 , Özcan Çeneli 1

1

Necmettin Erbakan University Meram Faculty of Medicine, Department of Hematology, Konya, Turkey

2

Necmettin Erbakan University Meram Faculty of Medicine, Department of Radiology, Konya, Turkey

To the Editor,

Involvement of the central nervous system due to multiple myeloma

(MM) is a very exceptional presentation with an estimated rate of

1% of all cases [1], showing a poor survival duration of 1-2 months

[2,3,4]. This involvement may present in three different patterns:

1) solitary plasmacytoma, 2) multiple plasmacytomas, and 3)

cerebrospinal fluid involvement with plasma cells [5].

A 64-year-old female diagnosed with MM IgG kappa for 1 year

was admitted with swelling and pain in the right eye. Physical

examination was remarkable for proptosis. Laboratory evaluation

revealed normocytic anemia, hypercalcemia, and M-protein peak in

serum protein electrophoresis. Brain magnetic resonance imaging

showed a retro-orbital mass of 5x6 cm in diameter extending

to the right temporal region and cerebral parenchyma (Figure

1), leading to widespread edema (Figure 2). We did not evaluate

the cerebrospinal fluid because it was an intracranial mass. The

patient was diagnosed with recurrent MM and treated with VCD

(bortezomib, cyclophosphamide, and dexamethasone). After four

cycles of chemotherapy, significant clinical improvement including

the regression of proptosis along with a decrease of radiological

involvement was observed (Figure 3).

Keywords: Multiple myeloma, Orbita, Cerebrum

Anahtar Sözcükler: Multipl miyelom, Orbita, Serebrum


of interest, including specific financial interests, relationships, and/

or affiliations relevant to the subject matter or materials included.

Figure 1. Cranial axial contrast magnetic resonance image before

treatment: in the lateral aspect of the right orbit there is a

mass lesion that expands and destroys the zygomatic bone and

temporal lobe (red arrow). The mass lengthened in the cerebral

parenchyma by invading the dura in the temporal region.

Figure 2. There is widespread edema (T2 axial images) around the

joint due to cerebral parenchymal involvement.

92



Figure 3. Significant regression is seen in the lesion after

treatment (red arrow).

References

1. Fassas AB, Muwalla F, Berryman T, Benramdane R, Joseph L, Anaissie

E, Sethi R, Desikan R, Siegel D, Badros A, Toor A, Zangari M, Morris C,

Angtuaco E, Mathew S, Wilson C, Hough A, Harik S, Barlogie B, Tricot

G. Myeloma of the central nervous system: association with high-risk

chromosomal abnormalities, plasmablastic morphology and extramedullary

manifestations. Br J Haematol 2002;117:103-108.

2. Nieuwenhuizen L, Biesma DH. Central nervous system myelomatosis: review

of the literature. Eur J Haematol 2008;80:1-9.

3. Gangatharan SA, Carney DA, Prince HM, Wolf MM, Januszewicz EH, Ritchie

DS, Harrison SJ. Emergence of central nervous system myeloma in the era

of novel agents. Hematol Oncol 2012;30:170-174.

4. Gozzetti A, Cerase A, Lotti F, Rossi D, Palumbo A, Petrucci MT, Patriarca F,

Nozzoli C, Cavo M, Offidani M, Floridia M, Berretta S, Vallone R, Musto

P, Lauria F; GIMEMA (Gruppo Italiano Malattie Ematologiche dell’Adulto)

Myeloma Working Party, Marchini E, Fabbri A, Oliva S, Zamagni E, Sapienza

FG, Ballanti S, Mele G, Galli M, Pirrotta MT, Di Raimondo F. Extramedullary

intracranial localization of multiple myeloma and treatment with novel

agents: a retrospective survey of 50 patients. Cancer 2012;118:1574-1584.

5. Petersen SL, Wagner A, Gimsing P. Cerebral and meningeal multiple myeloma

after autologous stem cell transplantation. A case report and review of the

literature. Am J Hematol 1999;62:228-233.

Address for Correspondence/Yazışma Adresi: Sinan DEMİRCİOĞLU, M.D.,

Necmettin Erbakan University Meram Faculty of Medicine, Department of Hematology, Konya, Turkey

Phone : +90 332 223 78 69

E-mail : sinandemircioglumd@gmail.com ORCID-ID: orcid.org/0000-0003-1277-5105



DOI: 10.4274/tjh.2017.0283

93

Advisory Board of This Issue (March 2018)

Ana Boban, Croatia

Anıl Tombak, Turkey

Antonis Kattamis, Greece

Aysun Adan, Turkey

Berna Ateşağaoğlu, Turkey

Beyza Ener, Turkey

Burhan Ferhanoğlu, Turkey

Caroline Houillier, France

Çiğdem Kader, Turkey

Deniz Aksu Arıca, Turkey

Elif Birtaş Ateşoğlu, Turkey

Ergül Berber, Turkey

Erol Erduran, Turkey

Evgenios Goussetis, Greece

Fahri Şahin, Turkey

Fatih Demirkan, Turkey

Fatma Çağlayan, Turkey

Feride İffet Şahin, Turkey

Ferit Avcu, Turkey

Gabriela Tanasie, Romania

Gülderen Yanıkkaya Demirel, Turkey

Hakan Özdoğu, Turkey

Hamdi Akan, Turkey

Hüseyin Gülen, Turkey

Klara Dalva, Turkey

Mahmut Bayık, Turkey

Mahmut Töbü, Turkey

Mehmet Ertem, Turkey

Mehmet Özen, Turkey

Meral Beksaç, Turkey

Meryem Albayrak, Turkey

Michael Mitchell, United Kingdom

Mutlu Arat, Turkey

Müge Sayitoğlu, Turkey

Nil Güler, Turkey

Nurdan Taçyıldız, Turkey

Olga Meltem Akay, Turkey

Priya Vadhana, India

Rajive Kumar, India

Rein Willemze, The Netherlands

Reyhan Küçükkaya, Turkey

Sema Anak, Turkey

Serena Valsami, Greece

Şebnem Yılmaz Bengoa, Turkey

Şule Ünal, Turkey

Vasilios Berdoukas, China

Yaghoub Yazdani, Iran

Zehra Çoban, Turkey

Zühre Kaya, Turkey

TJH-2018-1-baski

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?