Womb as Paradise Lost

Womb as Paradise Lost

Colofon

Lay-out advices Aga-Artonline, Alphen aan den Rijn, Netherlands

Cover design Gideon Benavraham

Printed Pumbo.nl

Illustrations Google Images and private with permission

© Gideon Benavraham, 2016

Womb as Paradise Lost

Regained by the Energy of Life

[Mediated by music of 528 Hz on the Vital-Emotive-Field of Consciousness]

Gideon Benavraham

Original Academic Dissertation

Doctor of Complementary Medicine

Calcutta, 2015

Ad Honorem

Firing brains

hyyb

Omnia in mensura et numero et pondere disposuisti 1

To Tineke, my dear wife and loving mother of

our special daughter Indra

Thank you, my dear children and grand-children,

which have missed my attention so many times,

because of my perseverance, in order to fulfill to my vocation,

and my love for science, research and therapeutic treatment,

in hope to reach (provisional) my final destination:

I am very sorry.

Nonetheless, I hope you will share my gratitude and joy because of the result.

Non Impedas Musicam 2

To all who have professionalized the universal human commitment,

to assist all who has lost the music of life,

re-creating “a paradise regained.

1 "You, (God) have arranged everything according to measure, number and weight.”

2 “Do not disturb the music”

Womb as Paradise Lost – Foetal Programming

Introduction: “A Verdict demands Evidence”

5

Preface

Orchestrated “factor of repair”

a representative result of epigenetic inheritance and

foetal programming

My entire life has been chained by the burden of my descent. My grandfather was

Jewish and spent his life during WWII in a hiding place. He survived this time of

war narrowly with my granny and mother as well.

As a matter of fact, my whole family has been murdered in Sobibor. This topic

was never discussed.

They have buried their haunted sorrows and pushed the horrors away from their

feelings, or coarse jokes were made about this horrible time. They reviewed the

events, but never allowed feelings of loss and fear.

“We should not have existed”. That’s the impressive message I carried all my life

long: the burden of “we actually don’t exist” and the burden of “we don’t talk

about feelings”.

This has been my private burden until yesterday.

Gideon unlocked me with the energetic Mindlink System and taught me I have an

inalienable right to exist.

Now I have integrated my feelings in my renewed life. Essentially I have an inner

rest and a perspective in my life. I am very glad with myself and my existence.

Thank you and success with your further investigations.

Miriam

Tesla-scalar-transformation technology, applied by Mindlink-system as

energetical dialectics between System and Internal Consciousness

6



Philosophical Foundation of MFD-syndrome 3

a scientific research of universal recovering power of 528 Hz music

basically for diagnostic and treatment of physical and mental distortions

treated with musico-phenomenological interventions

(Medical-Philosophical Foundation Part)

*

Research of Scientific Validation of

Tesla-scalar-transformation technology

on behalf of Hermeneutic Mindlink Therapy and Neurological Music Therapy

differential diagnostics an treatment of physical and mental distortions

by evidence- and value based complementary medicine

(Medical-Complementary and Energetic-Practical Part)

3

The original abbreviation MFD-Syndrome standing for Maternal Foetal Distress Syndrome was developed by Frank Lake

(1914-1982). I am grateful for the philosophical aspects of his work, his dominant clinical theology and LSD-program

excluded. I changed the name, content and abbreviation, to be more compatible with the actual research on “Foetal programming”

within European neurological investigations and the development of integrative medicine. I elaborated MFDsyndrome

as a system of differential diagnostics and energetical treatments of the effects of prenatal physical distortions,

with the Mindlink-system as instrument, based on Tesla-scalar-transformation technology.



7

Mission Statement

What gives music its power?

H

ow does music have the ability to transport us to another time and

place?

To lift up a broken spirit?

To bring a tear to a happy soul?

Why does music have the capacity to reach the depths of our heart, bring old

memories alive, awaken our deepest aspirations and causes us to dance to its

beat?

What type of language is the language of song, and where did it originate? We

learn spoken the language at home and school. But who taught us how to sing?

What is the soul of music?

Why do songs have this power?

Because they are the language of the Energy of Life, the Source of All.

A parable

When the Ultimate Concern created the universe, He consulted the angels:

“Should I bestow upon the human race the gift of music?” The elitist angels

unanimously replied with a resounding “no.” “The human race will not appreciate

the sublime power of melody. They will abuse and commercialise it. They won’t

know how to appreciate angelic, the divine nature of song.

“Give ús your gift of music,” the angels said, “and we will sing Your praises, we

will sing Your songs. We will know how to use the power of melody to reach

great spiritual heights.”

8



G’d considered their opinion but overruled them.

He said: “No, I will give the gift of music to humans. Because I want them to

have something to remember me with it.

Sometimes life will be difficult. In such times, the pressures can be overbearing.

They can feel depressed and hopeless. I, therefore, want them to have music to

remind them, that even their stuck in the dire straits of material existence, even

when they are experiencing existential loneliness and quiet desperation, they can

break out in songs, which will lift their spirits. Sometimes life will be comfortable,

too comfortable. Let them sing to remember that there is more to life than

instant gratification.”

“Yes indeed,” G’d concluded, “I will give the human being My unique tongue –

the language of music and song so that he can use it to discover transcendence.”

So music is a dialect from another plane. If the conventional word is the language

of man, music is the language of the Energy of Life, the Source of All.

The spoken and written word is the “quill of the mind: Music is the “quill of the

heart.”

We live in a dichotomous, fragmented world. Matter and spirit compartmentalised,

make it terribly difficult to hear the music of our souls: in truth an ‘inner

hum’ fills all of the existence. Every creature, every molecule, every atom emits

its unique sound. Imagine: “What would it be like to hear the music of the cosmos?

How would it feel the music of your soul? Of other souls? How would life

be different, if you could generate a song at will?”

Every time you experience a moment of truth – an experience that resonates – we

hear the inner music of existence. This attitude taps into the very fabric of the

harmonic chords of existence, which allow us to hear the music from within.

In every life experience, we have two options to choose: To serve your needs, or

to serve a higher cause. When you touch the surface of the experience, it usually



9

will result in narcissistic effects. But when you tap into the inner meaning of the

experience, its music will play.

Let’s start and find the Energy of Life, the Source of 528 Hz music, the heartbeat

music of the Earth (Schumann Resonances) and the silent song of the energetic

transformation of creational frequencies of Tesla Technology and the Mindlinksystem,

to contribute to a new paradigm.

Shalom,

Gideon

10



Summary

A Verdict demands Evidence

T

here isn’t any place in the world with such extraordinarily quantum

of decisions and raised expectations like the Internet. However, the

big missing factor is often strong evidence, the underpinning of the

multiple virtual statements. As long as the evidence is lacking, or

scientifically insufficient, "any statement" belongs to the category of "assertions

with no proof."

Title of the dissertation

The title of this study, "Womb as Paradise Lost" seems to be a "poetic section of

reality". But where life is in sharp action, there is no space for poetic affectivity

and soft feelings. The statement: “I am a very anxious pregnant woman”, demands,

according to the effects of these maternal emotions on the embryo, not

only medical evidence. Biological, epigenetic and technologic-energetic research

is needed, as far as the effects on the embryo are concerned, e.g. caused by the

expression of cortisol-stress-hormone and a possible distortion of the HPA-axis.

Maternal-Foetal-Distortion-syndrome (MFD)

This technological approach of the verdict “I am a very anxious pregnant woman”

is an international academic subject matter: a hot scientific topic under the

heading of “Foetal Programming”. Our scientific research ended in a provisional



11

conclusion: “Maternal-Foetal-Distortion”-syndrome (MFD), is a complex of epigenetic

inheritance and other new prenatal distortions, with many negative energetic

and physical-psychic effects later in life. This complex demands evidence,

according to recover the stored intergenerationally epigenetic inherited experiences:

distortions after the procreation i.e. foetal programming, and the developmental

effects of the ongoing postnatal processes.

Process of Procreation

In our opinion, the term “procreation” is not a single moment between

sperm and ovum, but a complex phenomenon, a sum of intergenerationally

epigenetic inheritance + the gamete as pluripotent stem cell ➔ spermatozoon

+ zygote ➔ blastula formation, a rapid process ➔ morula ➔ blastocyst

+ blastocoel ➔ embryo ➔ foetus.

This complicated process appears as subject matter for many disturbances, because

of the subtle, but a very quick system of development: thus not only an

evolutionary-biological process. The verdicts around these processes depend on

the portrayal of man. “The material of our living body – formatted by a unique

energy field – is very different from that of inert objects. It is secret by living

cells and continuously recycled with very different uses. (...) This material derives

from our context and is to be regarded as dynamically interwoven with it.

(...) The material of our physical body is not physical in nature and behaviour. It

is composed of materials selected by living body cells. The formed substances are

akin to those sought for the design of computers: materials able to process information’.

Intra consciousness as Virtual Energetic Raster

This virtual energetic raster is only meaningful since we can accept the “energetical

cellular portrayal of man’’ as a human being, and an evolutionary result, coming

- via prokaryotes and eukaryotes – into a symbiotic contextually development

12



between genetic and cultural symbionts, finally reaching the Homo Sapiens and

his natural and cultural context. The Darwinist evolution has overruled the older

Lamarckism. Lamarckism has no struggle for life and natural selection on adaptation,

but an evolutionary development of cooperation. Instead of the survival of

the fittest, with the best adaptation ability, Lamarckism has jeopardised the exclusivism

of genetic determinism and formed the beginning of epigenetics.

This proposed portrayal of man exists of about 70 milliard cells with each own

“energy economy” guiding to the Einsteinian conclusion: “All is energy”. That

means memories of experiences too. In this manner, I concluded the axiomatic

statement: “Unconsciousness as the memory of experience” with a molecular left

of right turning quantum spin, as a source of permanently creating negative or

positive energy. Imagine: energetic experiences and chained energetic memories

are stored in a virtual raster connected with DNA-sequences, combined with the

human epigenome.

The hypothalamus and the hippocampus play a very prominent role in the cellprocesses,

the memory and the quantum physical spin 4 in the subatomic cloud of

neutrons and the deeper present information of posibilities within the quantum

void of the nucleus of every cell, in association with the neuronetwork of the brain

and the entire energetic system, with the epigenetic inherited and controlled

“memory of experiences”. 5

4 Spin is a quantum physical phenomenon as a fundamental property of atom nuclei and elementary particles, by which

developed a better understanding of the Periodic System of Elements. The exclusion principal of Pauli (1927) and the

evidence of Paul Dirac are interesting for research of the connection with the stored energy pulses of the hypothesised spin

of the memory of experience e.g. the radio-frequency waves or nucleus spin resonance, a medical, Tesla energetic wave as

an analogy of the MRI in the medical application. “The electron spin within the relativistic quantum physics originates

spontaneously”, was the conclusion of Dirac (1928). This presents the second importance for a further research, outside

the presented hypothesis of this dissertation.

5 Pert, Dr. Candace in her book Molecules of Emotion: “Memories are stored not only in the brain, but psychosomatic

network extending into the body (…) all the way out along pathways to internal organs and the very surface of our skin.”

After her discovery of neuropeptides present in all body tissues, she suggested that through cellular receptors, thoughts or

memories remain unconscious, but can become conscious when energetic-physiological connections between memories,

organs and the mind has been raised.



13

That means - as a consequence of the description above - the experiences coming

from the intergenerational epigenetic inheritance, also has stored in this virtual

energetic raster 6 , permanently active, just like any new, actual experience.

This definition of unconsciousness – and I repeat – is only effective when we

accept the source of creational information on the vital-emotive part of our human

body as an Ayurvedic, Taoist and Jewish image of man. (See Philosophical

Introduction.)

Visual Sensation and Perception by 32 visual centres 7

In the discussion about the visual centres

in the brains raises the question: “Why 32

centres?” Berlucchi wrote about “central

visual information” 8 and also McCallum

studied the 32 visual patterns. 9

After the first question of 32 visual centres,

the next comes in front: “Who or

what is responsible for centralisation of

the diversative information coming out of

the 32 centres, sampled into one “central

visual information”?

6 Following the publications of Pert, this Virtual Energetic Raster can be seen as a sample of all neutron-spinning energetic

activities inside ea. neuropeptides and neurotransmitters, e.g. building blocs of the epigenetic inheritance of experiences.

This defined Virtual Energetic Raster can be at the same time the basis of the Orchestration Factor of Repair.

7 For the blind individuals genuine or became blindness later on in life see the article “The study, Visual Cortex Responds

to Spoken Language in Blind Children”, appeared in the Journal of Neuroscience, 4 th Mai 2016. The work was done in

partnership with researchers from the Massachusetts Institute of Technology.

8 Berlucchi, G. et.al. Handbook of Sensory Physiology/Central visual information: 32 visual Centers in the Brain, Springer

Science, 2012.

9 McCallum, W.C. Slow Potential Changes in the Human Brain, Springer Science 2013

14



The latter question raised during a discussion between the scholars Oliver Sacks,

Rupert Sheldrake, Daniel Dennett, Freeman Dyson, Stephan Jay Gould and

Stephan Toulmin, a discussion on the Dutch TV titled “A Refulgence Accident”,

with Wim Kayser as chairman. “Does exist something like a ‘homunculus’, the

ancient “little man” of the alchemists, responsible for the evolution of a human

being?” Every one denied such an obsolete idea. Oliver Sacks however didn’t

accept a merely deny of a “mastering headquarters” where activity of the individual

centres comes together. He questioned: “How does a composition and consistency

come into being without any point of convergence?”

There must be an intercourse between the different visual centres constructing a

unification as a result of communication between these 32 centres. “Who is the

communicating factor?” “It’s me”, Sacks replied. This mutual communication

between the visual centres weaves the visual sensation, perception and their

threads into a personal story of precious value. In this way the visual sensation

and perception become an existential life-story.

Back to the first question: “What is the very reason why exactly 32 centres?” Because

of my conviction about a Ayurvedic and Jewish layered portrayal of man,

the questions around the 32 centres is an issue that might not be left to chance.

The fundamental answer on the 32 centres brings us to the principle of audible

experiences in protention and retention, stored in the consciousness and unconsciousness,

connected with 528 as the “leading factor”.

The relationship between 32 and 528 is a matter of course. The number 32 is the

triangular number of 528.

The summarizing conclusion in this summary is: the visual sensation and perception

with the 32 visual centres has a relationship with music of 528 Hz as audible

perception and with light as 528 Nm as photosynthetic experience.

The final answer on the question of Oliver Sacks about the communicating factor

we derive from the energetic activities of the epiphysis, the communication gland



15

with internal and external connecting expression and registration on the memories

of experiences.

Conclusion

The number of 32 visual centres can’t be arbitrarily. The connection with 528 and

the [a abs = 1 field] gives obviously sufficient evidence for such a specific and

meaningful matter of fact.

Orchestration Factor of Repair

Our present system seems to be able to de-activate the quantum physical (hypothetical)

spin of the stored negative energy by Tesla-transformed positive energy,

as contra-information, by deeply contrasting frequencies. These frequencies are

present and transformed through the Tesla-technology, developed by Mindlinksystem,

the instrument of diagnosis and treatment. Anyway, the positive experiences

of past and present are stored in the same manner. However, these positive

experiences don’t directly belong to the clinical research, except the hermeneutic

part of the diagnostics and treatments, reaching a better understanding of the existential

way of life.

During this research, music therapy of a particular kind (528 Hz), together with

Tesla’s scalar wave-technology, has proven to be a solution of many distortions,

able to de-activate the stored negative energies, and (re)activate the self-recovering

opportunity. This process creates the Factor of Repair, the instrument of the

self-recovering ability.

The “Orchestration Factor of Repair” for powerful dimensions of healing and

empowerment, seems to be the music of special art, connected with the quantum

physical transformation technology as we have found in the Tesla-technologic

Mindlink-system.

16



What is music?

The scientific debate about music and the evolutionary human genome isn’t still

stalled. The central question remains: “Is there any evolutionary benefit in music

and musicality, or is music a cultural elaboration of only a preliminary signal

function?” In the research of schizophrenia, we find the positive symptom of auditory

hallucinations; that attends to a possible mutation of FOXP2-gene on the

7th chromosome of our human genome; a gene with seemingly an evolutionary

relationship with songbirds, whales and other primates of the Homo Sapiens.

Thus with great caution, it is possible to establish a link between music and

speech, awakened by the FOXP2-gene (Foxp-2 for the primates with distinction

at the human genome FOXP2-mutation). When we step back in time, we conclude

cautiously that both, sound and speech, play a significant role in signal

functions, which should have a contextual, group forming task. Therefore, exists

a genetical importance for strengthening the contextuality, like Lamarckism, as

an evolution model we accept.

Since our human genome changes at a tempo of only ± 0.5% per 100 000 years,

we hypothetically identify the human FOXP2 (as a very broad Fork Gene) nevertheless

linking with songbirds and sounds of whales and dolphins, (perhaps)

equated with us as our disposition in the Paleolithicum. The Mindlink-system

deconstructed these sound and speech and reconstructed the results into a new

act.

Music as structured sound

We hypothesize sound and speech (also present between earlier primates) as energetic

phenomenological components of communication. We define music as

“structured sound”, and speech as a “semantic driven communication”. To treat

people with fundamental communication disorders, we use analysed birdsongs,

whale-sounds, nature-sounds, high structured music - like Bach - and specific



17

affirmations (recorded speech). Thereby we use specific sine-frequencies (extracted

from Hebrew linguistic digit values and Schumann Resonances) pulled

together into the music of 528 Hz and as attractor (“Herz”, the composition of

Mathieu Polak, see Appendices). In addition to this hypothesis, our research expresses

a positive result in a patient with schizophrenia, treating her daily with the

Tesla-energetic transformed music of 528 Hz (by a Tesla-coil with permanent

radiation of these frequencies). Without being aware of the coil and its radiation,

her auditory hallucinations are almost disappearing now.

YouTube-music of 528 Hz also demands evidence

A simple visit tells enough: many assertions, without scientific evidence. The sine

wave of 528 Hz seems to be able to recover damaged DNA-sequences, because

528 Hz is the frequency of love and heart. On YouTube recommended books tell

many success stories, however without any evidence, but the description of the

individual experiences.

“Good gracious, it works!”

“But how does it work?”

We asked an explanation about this problem by e-mail to one of the prominent

representatives and authors. He answered with a lovely letter, but without any

relevant evidence. He addressed to the late Dr. Joseph Puleo, an American naturopathic

physician, a visionary religious person. He has got a vision of Jesus and

some angels. They told him to read the Book of Numbers in the Hebrew Bible,

but explicitly in the King James Version. There, in Numbers 7, 12 - 81 he would

find the frequencies of the lost solfeggio tuning system.

As a Jew I didn’t accept neither such revelations nor a metaphysical order to

work with a translation of the original Hebrew language, to me the linguistic

Source of evidence. Nevertheless, I remained impressed by this matter of fact. So

I decided to start my search with a scrutiny research of the Hebrew Tanakh (Hebrew

Bible), an effort to find the truth about 528 Hz.

18



All Creation is Number (Pythagoras)

All Hebrew Tanakh is Number (Labuschagne)

Number 1 is the Principium Individuationis (Gideon)

Only a Latin Poem?

All the messages around 528 Hz and the suggested miracles entirely based on a

single Latin poem, the poem of the six frequencies of the later in history elaborated

Solfeggio Tuning system. This 528 Hz is the start of the third sentence of the

poem, in Latin: Miraculous Gestorum. So Mi - the latter 3rd tune - was nothing

but the first syllable of the word “miracle”. Herewith, 528 Hz became the frequency

of miracles. This poem was dedicated to the Roman Catholic Church, to

celebrate the feast of St. John the Baptist.

Question: “How is it possible to add such healing powers to a simple sentence of

a human poem, without an explicit connection to the ‘Source of Energy of Life’?”

My answer is clear: this neither gives healing power, nor any scientific evidence.

But what about the 528 Hz in the original Hebrew Bible, with an intermediary

close connection to the Source of Life?

The Hebrew language is an alpha-numeric system. Every letter has a digit with its

value.

I agree Pythagoras’ statement: “All creation is number!” and started working with

his “single digit system” as a reductive “Quantitative Numerological Logotechnique”

(Labuschagne).

By this analytical system of Hebrew linguistics and semantics, I have found an

equilibrium between Science and the Hebrew Tanakh with a connection to the

Source of All, being manifest in the World with some numbers as structural elements.

For instance, 26 is the number value of YHWH, the Name of G’d in the

Jewish tradition. I also have found 528 Hz, the deepest frequency in the Book of

Numbers, and in the entire Tanakh as well. The consequence of these findings is

the absolute disconnection of the Latin poem.



19

My conclusion about the power of 528 Hz is: there is no other evidence for the

recovering power of Mi (528 Hz) as the fundamental connection with the Source

of Life, linguistically elaborated in the Hebrew language and Tanakh, the scriptural

intermediary with the Source of All. Using the linguistics of Tanakh doesn’t

mean a change into the theology. In my research Tanakh functions as a cultural

document with a strong influence on nature and nurture, science included. At the

end of the thetic part, it will be clear; there is evidence of equilibrium between

Science and Tanakh. My refusal to accept the healing power of the Latin poem,

isn’t meant as a devaluation of the Solmization System of Guido of Arezzo, still

present in the music theory.

Quora

Harrison, a biotechnical engineer, confirmed my critics on the internet:

“Is there any proof that 528 Hz repairs DNA? Google gives a number of blog posts, but I

haven't been able to find any hard evidence so far. 528 Hz is just one of the so-called

Solfeggio frequencies.

The ones commonly cited are:

UT – 396 Hz – Liberating Guilt and Fear

RE – 417 Hz – Undoing Situations and Facilitating Change

MI – 528 Hz – Transformation and Miracles (DNA Repair)

FA – 639 Hz – Connecting/Relationships

SO – 741 Hz – Awakening Intuition

LA – 852 Hz – Returning to Spiritual Order.”

This poem has got many therapeutical meanings, as in this short reproduction.

The message of Puleo has reached many practitioners. For many alternative medical

practitioners, Puleo’s vision was trustworthy. They took it for granted, but

without strong evidence it remains an assertion.

20



Division of the dissertation:

Thetic and Practical Part

T

he Thetic Part of this thesis contains two extensive introductions and a

critical consideration on the western psychiatry and the DSM-V. The

modern psychiatric verdicts demand strong evidence too. After the

APA-report of Kupfer (2002), this seems to be impossible yet. Without scientific

evidence, medical and psychiatric diagnostics (DSM-IV-Tr) remain assertions,

only based on the statistic classification of phenomena.

The Practical Part elaborates the music of 528 Hz in a new Tuning System:

“Hexachordum Duplex Therapeuticum”. The outcome of the research of the Hebrew

numbers (each word has its word value) has functioned as building blocks

of the composition by the Dutch Jewish composer Mathieu Polak.

The complex of music has assembled from the researched Hebrew Numbers, the

Schumann resonances, and 528 Hz as a binding attractor. So, the evidence of the

healing and recovering power radiates directly out of the Source of the Energy of

Life: in Hebrew called Ein Sof. (The notes are in the Appendices).

The primary division of the Practical Part of this dissertation is a description of

the Extended Mindlink System with Tesla-scalar-technology, effectuated in the

Mindlink-system, extended with the 528 Hz music complex. The composition is

not yet complete. All frequencies and all diagnostical and treatment recorded information

will be present as a profound matter of treatment shortly.

During the first part of the scientific research, we only used the composition

“Hertz” (Heart) of 528 Hz (see the composition in the Appendices), with statistically

positive results.



21

Casuistry will give insight into the “full colour”- meanings and outcomes of research,

diagnostics, and treatments.

In one of the last chapters I intend to get some recommendations, with an emphasis

on the universal usefulness space for any medical and therapeutical treatment,

by the Tesla-technological Mindlink-system.

Extensive Statistics are also in the Appendices.

Sources and structure of research

Hebrew linguistics and Hebrew numerological logo-technics together with science

forms the Source Code, in this thesis the source of Infinite No-Thing (Hebrew:

Ein Sof).

Traditional Jewish Medicine and the 528 Hz music therapeutic communicationsystem,

expressed in the Hebrew Tanakh, called by me “Hexachordum Duplex”.

In a later stage of research, I discovered the MFD-syndrome and Foetal Programming,

a diagnostic analysis of the pre- and perinatal “stress response syndrome”

and treatment of prenatal disorders treated by the energetic-transformed

music of 528 Hz, and other information like frequencies, affirmations and quantum-field-energy.

The Mindlink-system, based on Tesla-technology, with the energetic transformation

of sound-sourced information into scalar waves, is an essential part of the

process of strategic-dialectical interference with the clients inner-consciousness.

To get differential diagnostics and treatment by an evidenced- and value-based

system, with genotype, phenotype and gnoseotype as key-values, will be a moderate

contribution to Integrate Medicine and Hermeneutical Mindlink Therapy.

Conclusion

This thesis is an attempt to provide sufficient evidence for the scientific validity

22



of Mindlink-system and music therapeutical subject matters, which together open

entrances for new approaches to medical reality in East and West.

The research has produced a new syndrome (MFD syndrome) which provides for

the traumatically damaged people and their offspring sharp features, which opens

scientific criteria like Ayurvedic and Jewish humanity.

My mind and my vital-emotive life in scientific and therapeutic work for 40

years, I have given to my “fellow brothers and sisters in the created reality." Important

for this time to me was the statement of Franz Rosenzweig: “God created

the creation, not the religions”.

This dissertation bears witness to this, with a profound respect for the Hebrew

Tanakh as the Book of Scientific Wisdom, instead of only a book of particular

religions (Jewry, Christianity, Muslim and Hinduism). On this foundation, the

dissertation has remained a medical, philosophical, research regardless of the

Hebrew accent.

Whether I have been able to give a scientific evidence as an answer concerning

the opening statement of this summary "Verdict demands Evidence," it’s in your

hands Dr. Agarwal as promoter and you, Members of the Board of Studies.



23

Acknowledgement

I

always believe that the opposite of love isn’t hatred, but unconcern. And

that means the opposite of knowledge isn’t ignorance, but unconcern. The

opposite of hope isn’t living without hope, but standing in life with an attitude

of unconcern. The opposite of life isn’t death, but unconcern against life and

death. And because of this, I believe that literature or arts or writing a book or

teaching people or working in charity this all possesses one very target: combating

the unconcern (Elie Wiesel).”

We cannot overestimate the importance of negative indifference. One of the

common responses to the gravity of our existence is to live in a society with pressure,

on mere success and profit. This massive responsibility can result in mental

disorders like burnout and depression. However, also, indifference is often an

escape route for responsibility, that challenges us to take up the gauntlet and

fight, combatting the indifferences within ourselves.

A dissertation research is an unmistakable antidote to indifference by widening

the horizons, looking for new solutions at specific moments in fixed places, especially

where the old paradigmata jammed in impotence and, paradoxically, creates

slaves from us through the increasing power of medical conventions. They

have made its vision of truth disqualifying the other; often disproportionally.

The Codex Allimentarii is an example of an emerging threat to the human freedom

of choice. Since the Codex is a UN-institution, the world population is in

danger, concerning the medical freedom of choice, that – I repeat - challenges us

24



to take up the gauntlet and fight, combatting the disproportionality of control out

of the power of conventionalism.

Nonetheless, we all are victims of our own conventions in the medical and therapeutical

world: conventional medicine versus complementary medicine, and alternative

medicine versus renewal processes. We all are deeply convinced that the

actual paradigmata in the entire medical domain are no longer sufficient. The

arguments with the Health Insurance Companies form a speaking example of the

necessity of new politics. Who will guide us between Scylla and Charybdis to a

new scientific and medical period? Did the Sirens disable our ears and our specific

brain parts?

This scientific mondial problem is a phenomenon deserving a place in my

acknowledgement because this research has opened my eyes widely for the medical

power of the 21st century.

Prof. Dr. Agarwal, my promoter, and the Members of the Board of Studies, I

am grateful for the opportunity to present and defend my dissertation, which is a

descriptive result of this actual research as a part of my many years of scientific

and therapeutic experiences. These years have been processes of renewal, transforming

and learning from all lovely and warm people in my surroundings, from

my direct neighbourhood and abroad. They all helped me in becoming who I am

today.

My loving wife Tineke has followed me critically all the time. Her vision of consciousness

and feelings sometimes contrast with my opinion. This kind of exchange

sharpened our minds (see the end of the Acknowledgement). She and our

splendid daughter Indra made it possible to work every day long, just in time

switching the lamps on.



25

With profound respect, I want to give thanks to my Jewish friend and composer

Mathieu D. Polak, for his excellent compositions on our selected Hebrew word

values as results of my investigation. The therapeutical value has already been

proven during this dissertation research. We are waiting for the therapeutic research

with the complete composition called: “Hexachordum Duplex Therapeuticum”,

an elaboration of 1. the 12 key numbers, 2. Heart, 3. Light and 4 Rainbow.

The three last pieces you already can find in the Appendices.

Prof. Dr. Casper Labuschagne has opened the way for my Hebrew foundation

research by his quantitative logotechnical research of the Hebrew Tanakh. Thanks

a lot Casper for your friendship and our ‘Entdeckersfreude’.

In am indebted to Drs. Klaas Eikelenboom. He has developed the software for

the research of the Hebrew Tanakh. Thereby, Klaas, you saved me in many moments

as a physicist, when the technical side of science endangered me as an enemy.

I am also indebted to Prof. Dr. Titia Hompes, Louvain University (Belgium) for

sending me her not-published dissertation “The Effect of Maternal, Prenatal Emotional

Wellbeing and maternal Cortisol on Fetal and Child Development”, a necessary

material for the research of foetal programming.

I give thanks to Prof. Dr. Esther van de Vosse, Leiden University Medical Center,

for her personal advice and warning to be cautious according to the research

of FOXP2-gene on the 7th chromosome, and the possible compatibility with the

evolutionary primates, because of the complexity of the system.

I indebted to Prof. Dr. Eva Jablonka, Tel-Aviv University, for her private publication,

she made available to me, with a profoundly personal effect. I distanced

26



myself from the Neo-Darwinism, full accepting the Neo-Lamarckism as a downward

causation, evolution model.

Thanks to Prof. Dr. Karl Ludvig Reichelt, emeritus of the University of Oslo. In

private correspondence, he confirmed my approach of auditory hallucination of

schizophrenia, concerning FOXP2-mutation.

Much respect and regards to Dr. Med. Dent. Johann Lechner, biological dentist,

naturopathic doctor, with his praxis in Munich. He is the developer of the

Tesla-technological Mindlink-system, a system with extraordinarily, universally

applicable opportunities and applications for the universal medical world.

My supervisor, Mrs. Nini Kalisvaart has given me full support to be able to do

this specific research concerning the Mindlink-system. Without her explosive

knowledge of the system, I probably would never have discovered the energetic

power of 528 Hz music, the MFD-syndrome and preparing a longitudinal research

for offspring from Holocaust survivors, victims of WWII and other survivors

of massive traumatic experiences (PTSD). Thank you, Nini, for your alacrity

and time.

Drs. Erik Welten, pharmaceutic chemist, I thank you for the exchange of our

genuinely love to and connection with the Hebrew numbers. In the Phylak Spagyric

Pharmacology, you have given us a pathway to biotechnologically, naturopathic

medicine, since your implementation of all frequencies belonging to the

Hebrew logotechnical research. Your interest in the Maya culture and the Tzolkin

has enriched me as one of the cultural affirmations of the numbers 26 and 13 as

YHWH and Love.



27

Most especially, I am deeply grateful to all my clients in the Hermeneutic

Mindlink Research Praxis of Amsterdam and Breda, participants and clients in

the recent years of my research.

Ad Commeren, I am indebted to you for your DNA-generator. Without your

research to the number 53, in a quaternary system, focused on the DNA sequences,

I would probably never find out the everlasting repetition of the number 26

and many other derivatives. Without your construction and sample of 2 * 13 as

DNA-structure, I would not have understood the Tzolkin of the Maya’s.

Arie (Aga-Artonline) you have always been willing to assist me with layout advice

and concrete help on the computer. Thank you for your patience, and especially

for your excellent elaboration of the research statistics as material that

gives evidence to the Mindlink-system as a scientific system with evidenced and

value-based value and trustworthiness.

Kees Pieter, my words are too small to illustrate your ever presence when I

needed you in periods of doubt and other disagreeables, full of tension and uncertainty,

during the period of the therapeutical research and description. Your attitude

gave me new inspiration at any moment. I am very grateful to you.

Jacov, thanks for the coordination and watching concerning the normative double-blind

and randomized research, dividing into the three research groups.

Moreover, I thank you for being my assistance as a psychologist in the first period

of the research, until the moment of your serious illness.

Marion, you created much space of time for me by pre-preparing the English

layout. Thank you for all your time.

28



José, thank you for your partially proofreading and corrections of the English

language.

I give thanks to Google Images and Wikipedia for using their images and texts.

It was impossible to ask permission to every artist. Thus my collective thanks for

the illustrative contribution on this dissertation.

At the end of my acknowledgement, I give thanks to my loving family: my wife

Tineke and our daughter Indra, my ex-spouse Truus, our children, children in law

and grandchildren. I have been so unable to be with you, at the moments I actually

should be present. Nonetheless, I was still working: at home or abroad. Thank

you all for your love with all my heart.

The process is still going on. Some days ago, after finishing the text, Tineke

asked me: “What is the meaning of the number 33 in Hebrew?” In less than

one hour, I found the Hebrew verb “to be blessed” with a particular word

value 33. But a big surprise, I found it in the connection between the Hebrew

528 and the Schumann Resonances with the 33 as an axis. I already

knew this, but after Tineke’s question, a new dimension has been born: the

axis 33 tells us: all people on earth should be sure about “to be blessed”-

orchestrated by 528 Hz and the Schumann Resonances, the heartbeat of the

Earth.

In a moment of grateful silence - as a convinced Jew - I want to bless the Name,

saying: Baruch ha Shem, Adonai, ha Kadosh Baruch hoe.



29

Content

MISSION STATEMENT .......................................................................................................... 7

SUMMARY ......................................................................................................................... 10

DIVISION OF THE DISSERTATION: THETIC AND PRACTICAL PARTS .................................. 20

ACKNOWLEDGEMENT ....................................................................................................... 23

CONTENT ........................................................................................................... 23

Thetic Part 32

PART 1 PHILOSOPHICAL INTRODUCTION .......................................................................... 33

Chapter 1 – 18th century enlightment: Resistance against living inside the ‘octave’ ...... 34

Chapter 2 – Hebrew language, a solution of language densification: An Ideal Model for

Medical Philosophical Foundation. Research, Neurological Music Therapy, but fuelled

by Tesla-energetic Mindlink research and treatment - ..................................................... 69

Chapter 3 - Language and music, epigenetics on FOXP2-gene at Chromosome 7 ......... 80

PART 2 PROLEGOMENA INTRODUCTION ........................................................................... 96

Chapter 4 – Introduction: Cause for this research ............................................................ 97

Chapter 5 – Motivation and choice of Jewish Traditional Medicine (JTM) as buiding

block: accountability out of my Jewish mediative approach .......................................... 104

Chapter 6 - Jewish traditional medicine (JTM) in history - Relationship modern Western

medicine and Traditional Oriental Medicine (TOM)...................................................... 126

Chapter 7 – Informatio Potentialis Energetica: Unlocking process of information and

hypothetic-deductive methodology ................................................................................. 138

Chapter 8 – Jewish medicine in the channel of Eastern traditions? TJM and TCM are

strongly connected .......................................................................................................... 156

Chapter 9 - Aleph is the absolute number One, the Apex for evolution as creation: a = 1

produces the standard working formula a = √1 = 1 ...................................................... 163

Chapter 10 – Nature and culture affirm the scientific value of Hebrew numbers .......... 179

30



PART 3 MEDICAL POWER IN A NARCISSISTIC CULTURE .................................................. 202

Chapter 11 - A critical discourse on neuropsychiatry, with consequences for music and

health ............................................................................................................................... 203

Chapter 12 – Medical power and socio-medical ethics .................................................. 203

Chapter 13 - Critical voices about psychiatry ................................................................. 225

PART 4 LOGOTECHNICAL NUMBERS 53 AND 26 AS ENERGY-MARKERS FOR DNA

SEQUENCES IN A SEEMINGLY EMERGENT SYSTEM .......................................................... 245

Chapter 14 - An Equilibrium between Science and Torah ............................................. 246

Chapter 15 - Good Bye, Big Bang!! No fire, but water and light ................................. 246

Chapter 16 - Layered body in dimensions ...................................................................... 293

Chapter 17 - Information, what is it in the energetic health-care? .................................. 301

INTERMEZZO ................................................................................................. 307

Sound and Music, emanated from Source a abs ................................................................ 308

PRACTICAL PART ......................................................................................... 318

Chapter 18 Schumann Resonances: Tesla the first with wave of 12 Hz, after him came

Schumann with his frequencies, starting with 7,83 Hz. .................................................. 319

Chapter 19 - Hexachordum Duplex and Clinical Neuromusicology: Medical-philosophic

research of the energetic Source of Sound, Light and Water ......................................... 319

Chapter 21 - 528 Hz, a systemic “attractor”: Musico-logotechnical investigation ........ 319

Chapter 22 – Womb as Lost Paradise: Mindlink Research: “Back to the Beginning” ... 433

Chapter 23 - Philosophic-Clinical Hermeneutics ........................................................... 444

Chapter 24 - Schizophrenia and Herrneneutics .............................................................. 444

Chapter 25 - Evolution, Scalar waves and Complementarity ......................................... 449

Chapter 26 - Epiphysis, synonymous of the Third Eye .................................................. 454

Chapter 27 - Mindlink-system: technical research and report ....................................... 477

Chapter 28 - Statistical Report ........................................................................................ 494

Chapter 29 - Concluding Remarks .................................................................................. 509

Chapter 30 - Recommandations ...................................................................................... 533



31

Chapter 31 - Epilogue ..................................................................................................... 538

APPENDICES .................................................................................................... 548

APPENDIX 1: CASUISTRY ................................................................................................ 549

APPENDIX 2: LITERATURE .............................................................................................. 561

APPENDIX 3: REGISTER ................................................................................................... 577

APPENDIX 4: THERAPEUTIC TERMS AND FREQUENCES: KEY NUMBERS IN QUALITATIVE

NUMEROLOGICAL LOGOTECHNIQUE: BASIC FOR PARTIMENTO AND STRUCTURAL

COMPOSITION .................................................................................................................. 597

APPENDIX 5: COMPOSITION “HERZ” (HEART) AND ANALYSIS (528 HZ) ....................... 611

APPENDIX 6: SCIENTIFIC RESEARCH OF PART 1 GRAPHICAL STATISTICS ...................... 635

32


Thetic Part 1 – Philosophical Introduction

Thetic Part

33



Part 1

Philosophical Introduction

Cracked Octave – Culture in a basic Crisis

Cultural Tonic: densification of language and music

“Numbers are a universal medium

for the embedding of patterns of any sort,

and that for reason, statements seemingly

about numbers alone, can in fact encode statements

about other universes of discourse”

Douglas Hofstadter

Introduction of Gödel’s Proof 10

10 Hofstadter in his introduction on Gödel’s Proof. “In 1931 Kurt Gödel proved two important theorems about such attempts.

(1) A consistency theorem (consistency here means freedom from contradiction): Not all axiomatic systems can be

proven to be consistent by appealing only to the theorems and axioms of the axiomatic system itself. (2) A completeness

theorem: Within any consistent axiomatic system there are statements that can be neither proved nor disproved although

they are in fact true. Gödel's results are profound, for they not only showed that a complex domain, such as arithmetic,

cannot be fully constructed by an axiomatic approach, but they also stimulated new modes of thinking. For example, the

completeness theorem draws a clear line between truth and provability.

Besides traditional views of Gödel's work, Hofstadter emphasizes that Gödel was the first to demonstrate that any pattern

can be reduced to numbers: his proofs depend on such mappings. Today we not only take such mappings for granted, but

we are hardly aware that we continuously invoke them. We word process, we create and view images, we compose and

play music, we calculate, we simulate, we communicate, we design—and all those many patterns are ultimately mapped

into numbers—ones and zeroes deep in some computer's hardware. So not only are Gödel's proofs important, but his

method of proof was seminal and prophetic”, Macatea Book Review 2005.

34



Chapter 1 - 18th century Enlightment:

Resistance against living inside the ‘octave’

1. Introduction

I

n this dissertation the connection between language related disorders and

neurological music therapy (NMT) has formed one of the core items. Music

and language seem to be an evolutionary unity. The scientific debate about

the question if language and music are genetic phenomena is an ongoing at an

interdisciplinary level. So it’s a part of my investigation. Because the first part of

my dissertation belongs to the fundamental, philosophical research, I only follow

the debate about these genetical problems only by research of literature as relevant

publicated investigations.

1.1 Music and Number

For the cultural meaning and the development of numbers we ought to be in the

community of Pythagoras. We illustrate the music developments by the famous

story of the blacksmith’s workshop. Pythagoras is so illustrated for us, when we

are thinking about the relationship between numbers and music. The proportional

differences between the objects generating musical intervals on which harmony

and melody are often based will first spring in mind. Pythagoras was said to have

been walking past a workshop where the sound of anvils of different weights

were being struck, with each weight producing a different tone. Sounding together

the result was consonant or stable. Upon investigation Pythagoras, it is said,

35



realised that the pleasing aural result, was accompanied by the pleasing integer

proportion between the weights of the hammers: 6, 8, 9 and 12.

After Pythagoras connected with the Hebrew language we have knowledge about

the real power that lies in the hands of numbers, and their ability to describe nature

and her patterns, nurture and culture as well.

It doesn’t surprise us that many musicians and composers are drawn to rigorously

incorporate mathematical patterns into their art. The music of the Greek Iannis

Xenakis is a great illustration of this mode of working. 11

These developments of avant-gardist atonal music has a deeply illustrative meaning,

especially connected with Enlightenment and modern language.

In my humble opinion even a protest against living inside the structures of the

octave, as life rooting in the tonic.

Xenakis’ “Metastasis”

Discussion

Atonal music - atonal life-experiences with linguistic effects on the Unity

of Essence, seems to be a fundamental threat of the Language, the Whole

Universe and the Relative Holism. 12

11 Dr. J. Hart Whalley, Transformation and their musical counterparts, 2014.

36



1.2 Language in the conventionally medical domain

The medical philosophy has to make an irreversible decision on the use of professional

language. Medical language is on the first place diagnostically language.

The definition and description of symptoms have priority over the understanding

of this linguistic reality. Hermeneutics therefore barely fits in the medical field,

because the philosophy of medical language, has to research not a language in

general, but a specific jargon. Jargon is a specific, narrowing down of the human

communication, with an open, understandable language.

Jargon therefore must be seen as a superficial result of a densificated language

without any transparency, the inner circle excluded.

Let’s take schizophrenia as an example. Inside the medical jargon, the existential

life-story – with a lot of words connected with important positive and negative

symptoms, but communicated in a non-medical language, can’t be – jargon-like -

instrumentally in the frame work of the etiology, the leading factor of the diagnosis.

Understanding of the human individual – the patient with his life-story and

symptoms – is essentially different with understanding of schizophrenia as a

brain-guided DSM-complex.

Understanding schizophrenia orders the basic understanding of the human being,

carrying this functional, but disparagingly ear tag: schizophrenia.

Inside the medical profession the word is carrying a broad spectrum of visions,

contrasting to arguments etc. By this unclearness’s the transparency of the languages,

even as professional jargon, has lost its transparency.

1.2.1 Densification of the language

Clinical Hermeneutics has come true, quite necessary because of the densification

of the language, the communication.

12 Relative holism must be understand in connection with Einstein’s special relativity.

37



What happened in the medical domain must be seen as a linguistic aftereffect

of the fragmentation of language into scientific jargons; the language

which creational transparency is lost, communication lost up to God.

Some philosophers have seen this threat: Spinoza, Bohm, Lacan.

Lacan understood the problem of the schizophrenic human individual. The

patient in his weakness wasn’t able to join the symbolic order. This symbolic

order is the order of language and culture, of laws and orders for every

one. The schizophrenic person doesn’t accept the order, and refuses neuropathlogically

the integration of the organizing factors, which are effective

inside the symbolic order. This order must be held for unreachably, because

of his deeply incapacities to a mature responsibility. Instead of the instep

into the symbolic order with the law and order for everybody, he wants to

remain inside the imaginary order. This desire is fundamental in the philosophy

of Lacan and in the existence of the schizophrenic patient, who never

can make a distinction between both orders, because of the symbiotic disposition

as suffering human being. 13

Since we don’t understand the human behind the patient, we tend to reject this

human being existentially. Because of the densification of language we no longer

understand these “strange person”, nevertheless a member of our society, i.c. a

member of my life, asking me for caregiving. In the transparency of the “original

language” he should be able to meet G’d, in his recovering of the Source of Energy,

just we all. We lost the altruistic way from empathy into compassion, because

we lost the connection with the Source of All. In my dissertation I only want you

to give a new look on religion in the meaning of re-ligare, a renewal of binding

13 Lacan concentrated on structural linguistics and the role of the symbolic in the work of Freud. He felt that Freud had

understood that human psychology is linguistically based, but would have needed Saussure's vocabulary and structuralist

concept of language as a system of differences to articulate the relationship. In Les Psychoses: Seminar III, Lacan claims

that the unconscious is "structured like a language," and governed by the order of the signifier. This is contrary to the idea

that the unconscious is governed by autonomous repressed or instinctual desires (Quote of the Philosophy faculty of the

European Graduate School).

38



with the Source of life Energy, similar to the ligands, the protein’s on the cell

membranes and the nuclei.

1.2.2 Densification of the language and the Implicate Order

We read Bohm about the order in his book “Wholeness and the Implicate

Order”. He writes: “In the enfolded order, space and time are no longer the

dominant factors determing the relationships of dependence or independence

of different elements … It is instructive to consider that the word

“health” in English is based on an Anglo-Saxon word “hale” meaning

“Whole”: that is to be healthy is to be whole, which is, I think roughly the

equivalent of the Hebrew “shalom”. Likewise, the English “holy” is based

on the same root as Whole. All of this indicates that man has sensed always

that wholeness of integrity is an absolute necessity to make live worth living.

Yet, over the ages, he has generally lived in fragmentation.” 14

Bohm has expressed the connection with the Hebrew language in order to

set the way free for a step into the causity of the Hebrew language as I have

elaborated in the Prolegomena.

In this introduction about the densification of language I will show the way

to a renewal of the languages in transparency up to the Creating Substance

(Spinoza).

1.3 Analysis of the language

Stephen Hawking has centralized “the analysis of language” as the remaining task

of the philosophy by addressing a quote of Wittgenstein, by which he has con-

14 Bohm, D. The Wholeness …. Page XV – 13.

39



fined physics of the other sciences, like medical science and medical sub sciences.

He wrote:

1.3.1 Wittgenstein

“In the eighteenth century, philosophers considered the whole of human

knowledge, including science, to be their field and discussed questions such

as: “Did the universe have a beginning?” However, in the nineteenth and

twentieth centuries, science became too technical and mathematical for the

philosophers, or anyone else except a few specialists. Philosophers reduced

the scope of their inquiries so much that Wittgenstein, the most famous philosopher

of this century, said, "The sole remaining task for philosophy is

the analysis of language. "What a comedown from the great tradition of

philosophy from Aristotle to Kant! …

We find ourselves in a bewildering world. We want to make sense of what we see

around us and to ask: “What is the nature of the universe? What is our place in it

and where did it and we come from? Why is it the way it is?” 15

After all Hawking left his opinion about the Singularity, the very only point as the

beginning is: time. There is no point, there are no boundaries in the universe,

there is no beginning and no end. In the terminology of this thesis: there can’t be

a cosmological octave, so we have to live in a world without Singularity: the central

point, the cosmological Tonic. I posit the reprehensible nature of the statement

of Hawking without being able to examine these questions in depth. To me

an atonal universe is a contradictio in terminis.

15 Hawking, Stephen, A brief history of Time, 1988

40



1.3.2 Mozart effect

Don Campbell writes in his book “The Mozart Effect” after his life threatening

experience:

"For years I had as my own thoughts about what is eternal and what is transient,

what is essential, and what is superficial. As a musician, I had been

looking for that one fundamental tone that brings us into rapture and carries

our entire universe. I knew since time is immemorial, sound and music

were associated with the power of creation - the primordial vibration - of

the universe itself." 16

I also have been searching my entire conscious life time for the explanation of the

beginning, the Absolute Singularity. I always was looking for the reason of the

“missing link”, to me the first letter of the Hebrew alphabet, missing as the initial

character of the Hebrew Bible. Caused by a hidden, unknowable Power, the creation

has broken open and formed phenomenologically a duality with appropriate

natural laws. Obviously the “Point One”, the Singularity, must be the letter

Aleph, the One, as the absolute and undividable unity of all. By this I have found

the answer: the Aleph, being the primal frequency as Word and Sound, carries as

the Tonic of the Whole reality, which we will bring on a short formula, connected

with science of languages and math’s in addition to come to a fundamental medical

philosophy and the report of our energetically therapeutic research. 17

16 Campbell, Don, The Mozart Effect”, New York 2001, page 14

17 See: Prolegomena

41



1.4 Downward Causation

The evolution as a downward causation will bring us at our human DNA-profile

with a unification of language and music, of Word and Sound, based i.e. in the

FOXP2-gene on the 7th chromosome. This is my point of view as the opposite of

the statement of Hawking about the ultimate discrepancy between physics and the

other sciences.

We leave this item going on to our cultural developments and the importance of

what has happened with our languages in recent history. What has happened with

us, the language and our mondial cultures?

After the Enlightenment a linguistic turn has taken place, conform the American

Richard Rorty. 18 Language became a new philosophical and cultural phenomenon.

The revelation of the philosophy of language came with such a power that it

was similar to a knife, cutting the traditional life and traditional thinking.

Heidegger however wanted to maintain a language with a deep fundamentally

content. He rejected scientific thinking and found the power of language in poetry

full of etymology. He wanted the human individual disappearing from the philosophical

scene: not the human individual but Being is the matter of fact.

But at the same time he declared Being as abyss, a No-thing. 19 In his Sein und

Zeit (Being and Time) he draws attention to the fact that hermeneutics have followed

him from his theological studies. Heidegger’s hermeneutics became the

foundation of the study of the human phenomenon. His “explanation” and “interpretation”

of the structure of man’s existence on the one hand, an understanding

of its being intertwined with historical developments on the existential language

18 Rorty, Richard, The Linguistic Turn (1967). This publication was firmly in the prevailing analytic mode, collecting

classic essays on the linguistic turn in analytic philosophy. With Rorty started the densitification of the language.41

19 Heidegger, M. Unterwegs zur Sprache. Pfullingen 1959.

42



and the Other, is of such fundamental importance that acceptance of his view is a

prerequisite to the study of the openness as a human structural datum.

Woven in the language each person exists in the linguistic reality surrounding

him. He observes and implements this reality wherein he returns to himself. Here

we have found a move of essentialism: returning to the Self via a new vision on

language as existence, coming back into the circle of the totality of impressions,

we experience.

We are connected with the language of experiences in a paradox openness: openness

as a prisoner in the dark virtual raster of the “stored memories of experiences”

synchronously with the openness to the Other. This bifurcate openness –

openness with regard to surrounding linguistic and philological reality, and openness

to one’s own being – is referred to by Heidegger as the protostructure of

understanding. It is not a property, but a dynamic circular process in which the

individual realizes by developing what is possible. We must not confuse “realizing

what is possible” with effecting a certain potential, such as that of becoming a

good doctor. What this process does is creating the conditions necessary for the

realization of potential, by developing a new situation of openness, rising from

above mentioned confrontation reality.

Heidegger shows that openness means “understanding oneself”. An example of

this is someone who knows his trade. He knows how to use his tools in de right

way. In this way the person is able to master himself and arrives at an understanding

both of himself and the community in which he masters himself.

The limitation of the language and the understanding of the existential life-stories

compels him by thinking beyond the exist language. Understanding openness

became a transcendental openness, as Heidegger elaborated in Sein und Zeit (Being

and Time). Openness is the human given circumstance upon which hermeneutical

is based. “Transcendental” is a concept used to express an exceeding of

limitations. We use the compound “transcendental openness” to express that man,

43



in a continual process of openness, exceeds the limitations of his own being (transcendence).

This process of openness consists of his alternately turning to himself

to the environment. 20 It is good to say that in my opinion Heidegger made a distinction

between “transcendental” and “metaphysical”.

1.5 Art of language

The new linguistics have lost the spontaneous openness in understanding oneself.

After the changements of language into “the art of language” with substantial

literature as the new phenomenon in a changing and disturbing culture, we have

to look for a new methodology to explain what is meant, discovering the hidden

existential content and recovering the sometimes desultory language as an effect

of distortion of self-understanding. 21

Methodologically Heidegger invented the Hermeneutical Circle. The movement

of one’s orientation towards the reality is surrounding oneself (Being with Others),

and one’s being by oneself describes a spiralling circular movement within

human existence is realized. Within this hermeneutical circle the Other receives a

place in the realization of the personal Being of the one concerned.

The circular process indicated skirts the permanent interpretation of surrounding

reality, and one’s own Being. Interpretation is not something which takes place in

a virgin state as it were. The Da-sein has a certain pre-understanding of its own

Being, 22 from which the process of interpretation takes place. By participating in

reality – both temporal and historical – man is able to grow and develop.

20 Heidegger, M, Sein und Zeit, page 304

21 Lyotard, Jean-Francois, La condition postmoderne: rapport sur le savoir, Paris, 1988

22 We can hear Plato’s “Vorverständnis”

44



1.5.1 The Whole in Relationship to its Parts

The circle now becomes clear in the light of our explanation: we can explain

each part in terms of the Whole and the Whole in terms of each part.

The circular process will now be explained with reference to Gadamer,

Heidegger's successor at the university of Heidelberg in Germany. 23

1.6 Spiralling Circle of Human Openness:

Hermeneutic circle in the philosophical hermeneutics of Gadamer

Gadamer extends the hermeneutics of Heidegger, endowing it, via a dissertation

on the revelation nature of an object of art and how one relates to a text, with a

new dimension. He criticizes Schleiermacher and Dilthey, and elevates hermeneutics

to “the arts of understanding” which touches every aspect of life.

1.6.1 The hermeneutic rule

The following proposition stems from classical rhetoric “dass man das

Ganze aus dem Einzelne und das Einzelne was dem Ganzen verstehen

müsse …” 24

“So läuft die Bewegung des Verstehens stets vom Ganzen zum Teil und

zurück zum Ganzen. Die Aufgabe ist, in konzentrischen Kreisen die Einheit

des Verstandenen Sinnes zu erweitern”. 25

The criterion for understanding properly also lies in its connection with the

Whole. There must be no contradiction between each part and the sum of all the

23 In France the hermeneutics has go a particular meaning by the works of Paul Ricoeur. The densitation of the language,

resulting into a phenomenon, asking for an adequately interpretation and the new task for hermeneutics as an epistemological

assigment, has been elaborated by Ricoeur in his essay’s collected in a the Dutch language titled Tekst en betekenis

(Tekst and Meaning), Baarn, 1991.

24 Gadamer, H.G. Wahrheit und Methode II, art. Vom Zirkel des Verstehens, 1959. Gesammelte Werke 2, Hermeneutik

II, page 57 ff.

25 Gadamer, H.G, op.cit. II page 58.

45



parts, and the Whole (das Ganze). If agreement between the Whole and each part

fails to materialize, then the process of understanding will be disturbed.

1.7 The task of Hermeneutics

Gadamer expresses the task of hermeneutics as follows: “Es ist die Aufgabe der

Hermeneutik, dies Wunder der Verstehens aufzuklären, das nicht eine geheimnisvolle

Kommunion der Seelen, sondern eine Teilhabe am Gemeinsamen Sinn

ist”. 26 1.7.1 Verständigungsgemeinschaft (Understanding Community) 27

When two opinions in a dialogue agree and both wish to be governed by

this harmonization, then the communion will reach positive results.

1.7.2 Horizontverschmelzung (Fusions of Horizons) 28

Each process of understanding is restricted by the personal ability to understand

of those involved. This ability is determined by historical and cultural

horizons. As soon as we begin understand one another, then horizons are

broadened, merging into communion to produce new understanding, knowing

and insight.

26 Gadamer, H.G, Gesammelte Werke I, Wahrheit und Methode, Grundzüge einer philosophischen Hermeneutik, page

297.

27 Gadamer, H.G. op. cit. Part I and II passim

28 Gadamer, H.G. op.cit. II page 273f, 337f, 358

46



1.8 Conclusion

The developments with regard to truth and methods according to the modern human

individual in our production, achievement and consumption society, are a

direct result of the disaster that has happened after the Enlightenment and the

new-born modern human being with a different, egocentric way of life, disconnected

with the Ultimate Unity, the Whole as the basis of the single phenomena.

The new philosophical developments, with the language, philology and communication

as a core problem, is one of the deep consequences of the loss of transparency

up to the Creator as an evident factor in the culture before the Enlightenment.

The language was an open language with a clear view on G’d. 29 The entire

culture was carried by these convictions. He was the unifying factor, but devaluated

as an eavesdropper and for us, modern entities a foreign, heteronomous

Power, a Corrector on our striving of autonomy.

We have lost as individuals the connection with the Whole, because of the destruction

of this universal unity by the death of G’d.

The ultimate consequence of this developments is: the transparency of the language

has gradually condensed into an impenetrable wall along which we tasting

find our way, even within the neurologic music therapy and the entire medical

domain.

1.8.1 Baruch Spinoza (1632-1677)

There is a philosopher who has been survived until today. His name is Baruch

Spinoza, author of the Ethics 30 , written on the concept of the geometrics

and the vision on G'd as Deus Sive Natura, explaining that there is no

distinction between the natural laws and the laws of G’d. His Jewish life

29 Speaking about God I addresses the Creating Substance, in the Jewish tradition the ineffable Name written as G'd.

30 Spinoza, Baruch, Ethics, Complete Works, 2002.

47



has caused him much stressful pain, but nevertheless he might be seen a

righteous Jew, remained subservient to the unity of thinking in the society

and the injustice contested. Unfortunately, it has given him an eternal banishment

which until today has not been revoked. His philosophy has a connection

with Taoism and Hinduism. That makes him interesting for our holistic

research.

He was ahead of his time that a study has published in our time about the

"quantum fields in Spinoza’s philosophy". 31 His influence on the medical

and therapeutic domains is actually present in our day. 32

The historian Jonathan I. Israel wrote an extraordinarily extended book titled

“Radical Enlightenment: Philosophy and the Making of Modernity”,

with Spinoza as protagonist. 33 Israel suggested the Enlightenment has begun

in the Netherlands with Spinoza et.al by his critical publications on Descartes,

fundamentally rejecting his dualism with his absolutely monism as

his own ultimate philosophy. Spinoza’s monism has made him object of rejection

and hatred, not only in the Jewish community, but in the Christian

society as well. Just the opposite of Spinoza’s enlightened and liberal approach

of reality I found a study of the Spinozist Joachim Wachter (1673-

1757) who became a convinced Kabbalist as result of the influences of Spinoza.

This looses the surprizing effects because of Spinoza’s Kabbalistic

Portuguese pedigree. 34

In this short overview about this very important scientist and philosopher I

tried to illustrate the complexity of a scholar with his influence all over the

globe.

31 Bennett, Jonathan, A Study of Spinoza’s Ethics, Indiana 1984, pages 90 ff.

32 Miriam van Reijen, Spinoza, Kampen, The Netherlands, 2008, an explanation of Ethics instead of a commentary.

33 Israel, Jonathan, I. Radical Enlightenment etc. Oxford University Press, 2001

34 Wachter, J. Der Spinozismus im Jüdentumb, 1699 (edition Stuttgart-Bad Cannstatt 1994)

48



Before I will give some relevant examples of the Ethics, necessary of a scientific

reflection on the meaning of the Universal Whole and the Neurologic

Music Therapy I want to return for a while to the historical loss of the

life-transparency and the cultural crisis, increasing until today’s scientific

and cultural problems. 35 It contains a call for a return to the basis of the

transparent way of life, transparent with a language that will binds us with

the Source of Life. Every medical practitioner and therapist must have a

clear vision on his own private way of life, as an ultimate condition for a

blessing praxis, depending on the influences of the Supramental Intelligent,

with acceptance of its “downward causation” asks for a new vision on the

reality in evolutionary, biological and cultural way, just the opposite of the

Darwinian “upward causation”. 36

1.9 Opaque language is not transparent to the Light

In a short sketch I will confront you will the disaster in humanity guided by dehumanization

of life as a consequence of technology and misinterpretations of

living in the Light of the Creator, living in the Conviction of the Goodness, the

Responsibility for the Other, but at last also with Nietzsche about the murders of

G’d with as the ultimate concern: disappearing of the modern human being.

This all has originated a loss of transparency with lack of insight on the ultimate

questions. The original transparent language has become compact and opaque. 37

A densificated language is not transparent to the Light; the Light of the mystic’s

and the physiological light too. Such kind of language can’t solve the big prob-

35 Goswami, Dr. Amit, The Quantum Doctor, 2004

36 Goswami, Dr. Amit, Creative Evolution, Wheaton, 2008.

37 Derrida, Jacques, La Voix et le phénomène, Paris 1967. An important essay as an intoduction of the relationship between

voice and language in line with the treatment of the evolutionairy forkgene FOXP2.

49



lems of self-understanding, standing outside the connection with the Ultimate

Source, the actual present of the Source of daily life. I will emphasize the philosophical

content of this recovering thesis.

1.10 What do we have lost after the Enlightenment?

In the framework of the research on neurological music therapy (NMT) we shall

think about the care-seeking man and his context, but, because of the philosophical

foundation research, from a philosophical point of view. The described cultural

problems before and after the Enlightenment Friedrich Nietzsche and the

French Michael Foucault will pay our special attention. The first about the death

of G’d and our guilt and the second about the disappearance of the modern human

being and the void that his disappearance left behind. Moreover, our main

attention is the process of solving the densification of language as outcome. Before

reaching insights in the inevitable solution, we need some more historical

information to understand the fundamentality of this cultural and creational disaster

with a spiritual and scientific break down of the holistic view of existence.

1.10.1 Summary of the above and a personal remark

Speaking about people in the European society is speaking about people in

the context of a secular society, from which the “Creating Source as Ultimate

Concern” has been driven away and man meant to be entitled to claim

his freedom by putting a stop on the transcendental thinking of ages.

To be able to estimate the gravity of this development, we must ask ourselves

from which point of view we want to judge the reality, as it presents

itself to us. Therefore, as a personal remark a few words on my presuppositions.

50



Philosophical reflection from my presuppositions on human relations is hardly

thinkable without taking into account my pre-reflective experience of life. To me,

this means that my Jewish experience of life determines my philosophical and

scientific research, concentrated in forty years of clinical hermeneutical praxis.

This is what I stand for. I am aware of the fact that this imposes restrictions on

me. My thinking is a thinking in liberty, yet bound by the Jewish traditions, telling

the caregiving presence of G’d, represented by the responsibility of human

individuals with or without any religion, a praxis wherein we all human beings

have to participate in this creating and recovering Light. The "crown on creation"

is every human being, who cannot be taken “the crown” for himself, but he can

only exist by his relations and his loving care for all the human individuals in the

world. So this connection is the most universal. It is self-evident, that the relation

between the Creating Energetic Substance and all of us is the basis for the total

existence. Denying this ultimate concern will bring us a life cutting of from the

eternal future, falling down into the darkness after the dead of god. 38

1.11 Culture in the aftermath of the ‘dead’ god

About two ages ago the Enlightenment rang the death bells for the ages long of

traditional metaphysics. Characteristic for the traditional metaphysical period is

the thinking of man, who does not regulate his existence, but is guided in his understanding

of the world by drafts of existence, wherein the whole of reality is

understood from a last ground: God, the Good, the One, the All, etc. But the history

of metaphysics has not yet come to an end. It is a phenomenon, that is ineradicably

written in the course of human reality, in spite of all stark efforts to get

rid of it.

38 Here I write the term “god” instead of the Jewish unpronouncably Name, the G’d of Israel, which cannot be murdered.

51



Via Herakleitos and Parmenides, Plato and Aristotle, Plotinus and Thomas Aquinas,

Descartes, Spinoza, Kant and Hegel we see in these days the special place in

the western philosophical community of the French-Jewish philosopher Emmanuel

Levinas, born in Lithuania (1905) and died in Paris (2005). During his scientific

life he was working at the Sorbonne, the University of Paris. His enormous

merit was his effort to reform the western philosophy, that was philosophizing

with the ego on pole position. Levinas developed a philosophy of responsibility

with the care-seeking Other in the centre instead of the ego and his brutal egocentrism.

In the footsteps of Einstein Levinas tried to shed Eternal Light in our

world, new Light over what can be expressed as “the night of the Gotterdammerung”

that was fallen down, c.f. Martin Buber.

Together with the particular sciences, that are grafted on them, the antimetaphysical

developments since the Enlightenment have produced a culture,

where the Creating Substance no longer could be alive. He just had to perish in it

like Nietzsche described for us at the end of the nineteenth century; G’d did not

die an easy death, but was brutally killed by the western Christian culture. He

wrote:

Morder aller Morder? Das Heiligste und Machtigste was die Welt bisher

besass, es ist unter unseren Messern verblutet, - wer wischt diess Blut von

uns ab?

God is dead! God stays dead! And we have killed Him! How can we find

consolation for ourselves, the killers of all killers? The most Holy and most

Mighty the world ever possessed, it has bleed to death under our knives,

who can cleans us from this blood?

Nietzsche brings charges against the Christian culture. It's hypocrisy forces man

to disappear. The Christianity has proved not strong enough to produce a trustworthy

human society. The Jewish G’d doesn’t came in the picture in Nietzsche’s

52



vision. Nietzsche really knew the G’d of Israel could not be murdered. This

Christianity, represented in “the failing man” must make place for a "new man",

an "Uebermensch", a product of unknown, but superior making. Especially in his

"Also sprach Zarathustra" 39 he confronted us with these themes of weakness and

existential guilt. A few quotations make clear how he was thinking.

"Dass der Mensch Etwas sei das überwunden werden müsste dass der

Mensch eine Brücke sei und kein Zweck”.

That man is something that has to be overcome, that man is a bridge and no

goal.

The motive for the murder of God we read from the dialogue between Zarathustra

and "der hassliche Mensch" (the hated man):

"Aber er (Gott) musste sterben: er sah mit Augen, welche sehen alles, er

sah des Menschen Tiefen und Griinde, alle seine verhehlte Schmach und

Hasslich-keit".

But He (God) had to die: He saw with eyes that saw everything, He saw the

deepness’s and grounds of man, and his hidden abuse and maliciousness.

This is the situation of modern, anti-metaphysical man:

Der Gott, der Alles sah, auch den Menschen: dieser Gott musste sterben!

Der Mensch ertragt es nicht, dass solch ein Zeuge lebt".

The God, who saw everything, also humans: this God had to die. Man cannot

bear the thought that such a witness could live.

39 Nietzsche, Fr. “Also sprach Zarathustra”, 1883.

53



In his book "Der fröhliche Wissenschaft" 40 Nietzsche parodies the story of Diogene

in the Athens of Alexander the Great. Humanity is disappearing in the old

country of Greece. In the heart of the city Diogene calls out loud, carrying a lantern

in full daylight: "I am looking for a man!" Nietzsche creates "der tolle

Mensch" and has the fool call: "I am looking for God!" Here follow a few phrases

from this parable:

"Habt ihr nicht von jenem tollen Menschen gehort, der am hellen Vormittag

eine Laterne anzündete, auf den Markt lief und unaufhorlich schrie: 'Ich

suche Gott! Ich suche Gott!' Da dort gerade Vielen von Denen zusammen

standen welche nicht an Gott glaubten, so erregte ein grosses Gelächter…

Der tolle Mensch sprang mitten unter sie und durchbohrte sie mit seinen

Blicken. 'Wohin ist Gott?’ rief er, ich will es euch sagen! Wir haben ihn

getödtet, ihr und ich! Wir Alle sind seine Mörder! Aber wie haben wir diess

gemacht? Wie vermochten wir das Meer auszutrinken? Wer gab uns den

Schwamm, um den ganzen Horizont wegzuwischen? Was thaten wir, als

wir diese Erde von ihrer Sonne losketteten? Wohin bewegt sie sich nun?

Wohin bewegen wir uns? Fort von allen Sonnen?... Irren wir nicht wie

durch ein unendliches Nichts? Haucht uns nicht der leere Raum an? …

Hören wir noch nichts von dem Lärm der Todtengräber welche Gott begraben?

… Gott ist todt! Gott bleibt todt! Und wir haben ihn getödtet! Wie

trösten wir uns, die Mörder aller Mörder? Das Heiligste und Mächtigste

was die Welt bisher besass, es ist unter unseren Messern verblutet, - wer

wischt diess Blut von uns ab? Mit welchem Wasser könnten wir uns reinigen?...

Müssen wir nicht selber zu Göttern werden, um nur ihrer würdig

zu erscheinen? Es gab nie eine grössere That, und wer nur immer nach uns

geboren wird, gehört um dieser That willen in eine höhere Geschichte, als

40 Nietzsche, F. Die Fröhliche Wissenschaft. Berlin, 1973, par. 123.

54



alle Geschichte bisher war!'… Man erzählt noch, dass der tolle Mensch des

selbigen Tages ihn verschiedene Kirchen eingedrungen sei und darin sein

Requiem aeternam Deo angestimmt habe. Hinausgefürht und zur Rede gesetzt,

habe er immer nur diess entgegnet: 'Was sind den diese Kirchen noch,

wenn sie nicht die Grüfte und Grabmähler Gottes sind?" 41

" Didn't you hear of this mad man, who lit a lantern in full daylight, walked on the

market and cried continuously: 'I am looking for God! I am looking for God!' Because

just at that moment there were a lot of people, who didn't believe in God, this

caused a great laughter. The mad man jumped in the middle of them and pierced

them with his eyes. 'Where has God gone?' he called, 'I want to tell it to you! We

have killed him, you and I! All of us are

his killers! But how have we done this? How could we drink all of the sea?

Who gave us the sponge to wipe out the horizon? What did we do, when we unlinked

this earth from it's sun? Where is it heading now? Where are we heading?

Far away from all suns?' Aren't we wandering as through an endless nothing? Aren't

we breathing empty space?' Can't we already hear the noise of the gravediggers

burying God?' God is dead! God will be dead! And we have killed him! What kind

of consolation can we find, the killers of all killers? The most holy and the most

mighty thing the world ever possessed, has bleed away under our knives, who can

cleans us from this blood? What water will be able to cleans us?' Don't we have to

become Gods ourselves, to seem worthy of them? There has been no greater deed,

and those that are to be born after us belong because of this dead to a higher level,

as ever a level has been! People told that the mad man that same day had forced his

way into several churches and sung there his Requiem aeternam Deo. When they

brought him out and tried to bring him to his senses, he could only say the following

phrase: 'What is left of these churches, but to be the graves and memorial stones

of God?’

41 Nietzsche, F. Op. Cit. par. 123.

55



1.12 Commentary

Did you notice:

1. Wer gab uns den Schwamm, um den ganzen Horizont weg zuwischen?

2. Was thaten wir, als wir diese Erde von ihrer Sonne losketteten? Wohin bewegt

sie sich nun? Wohin bewegen wir uns? Fort von allen Sonnen?

3. Haucht uns nicht der leere Raum an?

4. Das Heiligste und Machtigste was die Welt bisher besass, es ist unter unseren

Messern verblutet, wer wischt dieses Blut von uns ab?

5. "Müssen wir nicht selber zu Göttern werden, um nur ihrer wirdig zu erscheinen?"

1. Who gave us the sponge to clean away the entire horizon?

2. What did we do when we unchained this earth from its sun?

3. Where is it moving now? Whither are we moving? Away from all suns?

4. Don’t we feel the breath of empty space?

5. The holiest and most powerful that the world hitherto has possessed, has

bled to death under our knives. Who is able to wipe this blood off from us?

6. "We do not ourselves have to become gods, seeming to be worthy?"

1.13. What Light we lost in the densification of language?

The wide effects of this story only become real clear to us, when we place it in

the light of transcendental reality. When we have a right view of the meaning of

metaphysics, we can value the anti-metaphysical tendencies properly. Therefore,

I suggest before I go on with drawing some conclusions from the stories of Nietzsche,

that is relevant for our view on the cultural context of the man searching

for help to try to find the basically meaning of traditional metaphysics.

56



We do so, following the text of the Flemish writer and mystic Jan van Ruusbroec

from his book "Van den Gheestelijken Tabernakel (From the spiritual Tabernacle)”.

First I shall give the Middle Dutch original text, then some hermeneutical

explanations and finally some conclusions.

1.13.1 Jan van Ruusbroecs text (1293-1381) 42

"Want God ist: ein Licht, daer alle dingen leben Ende overmids dieses

Licht, werden alle dinge gescapen ünd geordent, mit onderscede in haer

naturleke wesen. Ende overmids gehelen toekeer ons geests tote desen lichte,

werden alle dinc volmaect in ons, ende wederbracht in hare begin. Ende

aldus werden wi den Lichte geenecht (d.i.m. of gheneicht), ende herboren,

anderwerf, ute desen Lichte, boven nature: in der genaden. Ende in der

wedergeboerten werden alle dinge: onse eigen; want wi hebben alle dinc

welgeordent ende weder bracht in hare begin. In desen beginne vinden wi

in ons geboren .j. ewech Licht, dat es de Sone Goeds. Ute desen Lichte

ontfaen wij manieren van lichte".

For God is a light, wherein all things live. And because of this light all

things were created and structured, with distinction of their natural being.

And while we dedicated ourselves completely in our spirit to this light, everything

became perfect in us and was brought back to its beginning. And

thus we became inclined to the Light and born again, for the second time,

from this Light, supernaturally: in grace. And in the rebirth all things became

our own; because we have structured all things orderly and brought

them back to their proper, original position. In this origin we find ourselves

born from eternal light, the Son of God. From this light we receive all ways

of light.)

42 Paul Mommaers and Jan van Bragt have emphasised the importance of the scientific discussion between Ruusbroec and

the representatives of the Buddhistic mystics. Averbode, 1995.

57



1.14 Treatment of the text

In the given text there are four strophes, that each cover a main thought of metaphysics.

Strophe 1 "Concerning G’d"

God is a light wherein all things live and exist. AII things radically receive

a position within a principle that is not the empirical, not the material, but

what lies beyond. On the principle of the Light all things have been created.

They become what they are (Aristotle), they come to identity, the world is

being structured from the principle of light ("met onderscede in haer

naturleke wesen" – “with distinction in her natural being”).

Strophe 2 "Concerning the human activity concerning the things"

And when we direct our attention to this Light, then what happens? Then all

things become perfect in us. Man is executor of God’s creation plan. His

task is: to place everything in the light where it came from and then all

things will turn out right ("ende wederbracht in hare begin" – “and brought

back to their origin”).

Strophe 3 "Concerning the human position in God"

He does not only bring back the things to God, but by doing so as the Right

Hand of the Creator, he himself also steps back to his first beginning, in

God ("den Lichte geen echt ende herboren" – “inclined to the light and reborn”).

Strophe 4 "Concerning the Son of God"

The Son of God is in the Christian theology the source of Light. It might be

clear that this mystical vision metaphorically points to the direction of every

human individual and the collective mankind, carrying the Light of crea-

58



tion. That means: every human individual and the entire mankind have to

be a source of creational and re-creational Light. Any “personal claim” to

be the Son of God belongs to a preoccupied theological domain and is philosophically

reject able.

1.15 Conclusion

Here the circular reasoning of the Western, classical metaphysics is expressed in

an unambiguous manner of unequalled simplicity. We draw the lines by six

points and discover the meaning of the traditional metaphysics, as it has developed

from Parmenides, via Plato and Plotinus to Levinas, who brings her under

suspicion and chooses a new way, as we shall see. Now the conclusions at first:

1. God is a Light;

2. From that light man and things are born;

3. Man sees the Light and sees the things;

4. He places the things in the Light of God;

5. Hereby he himself enters the Light of God and

6. Thus he becomes one with the Substance, the Nature and mankind.

The circular reasoning of metaphysics is clear for all who are able to understand

the Universal Unity and the holistic process: “everything comes from the Light

and returns to the Light and man is a creative tool in the Energy power of the

Source of life, bringing all things back in a renewed relation to the Light. So we

all must return into the Light.

59



1.16 Back to our cultural criticism

Modern man has broken with this metaphysics. The Enlightenment has put the

Source on a different track. Nietzsche radicalizes to a frightening nihilism, as was

developed on many stages of science in the past century.

Meaning of "der tolle Mensch"

Especially the anti-metaphysical statements "von ihrer Sonne losketteten", "der

leere Raum" and "die grenzlose Horizont", are underlining the condition of man and

culture and draw our attention. We have been cut loose from "the Light". The

boundaries between the Light and us have been erased. We have killed God. Or

otherwise: we have extinguished the Light. Thus the anti-metaphysical night has

fallen on our culture. In the vision of Nietzsche, the empty room stares at us: "dass

der Mensch etwas selbe das überwunden werden müsse.

1.16.1 Final conclusion on Nietzsche

The ultimate effect of killing God is our self-killing, because we are temporarily

a Place of God, a part of god. God is dead and our language has been

a thick darkness through which we can see nothing more than a one dimensional

reality as our prison. Every caregiving activity has to re-find the way

to the Eternal Light, that has remained behind the darkness of the opaque

language. What kind of language will re-open for us the way of Light?

1.17 One age later.

The vision of Nietzsche is being fulfilled. Now, about two ages later, the French

post-structuralists, also called anti-humanists, herald the new era of the "empty

room that the disappeared man has left behind". God has been killed and man has

disappeared, so the ought to explain with Foucault’s book “Les Mots et les Choses”

(The Words and the Things).

60



1.17.1 Les Mots et les Choses

Mouthpiece of the post-structuralists is the French philosopher Michel Foucault,

participator in the students revolt of the year I968 in Paris. In his

book "Les Mots et les Choses" (The Words and the Things) he describes

the depersonalization of the human communication (les Mots) to become

soulless things (les Choses).

One can only laugh about man. Typically, are the following phrases. I quote:

"Before the end of the 18th Century man did not exist. Man is a very recent creature,

that has been created by the creative power of science with its own hands

more than two ages ago. But this man has been aging so fast, that it could simply

be thought that he already had waited for thousands of years in the dark for the

moment that he would be brought into the light. He summarizes the message

from Nietzsche’s work:

"The death of God is synonymous with the disappearance of man wherein the

promise of the ‘Uebermensch’ first and for all meant the approach of the death of

man. And thereby Nietzsche, who shows us the future not just as something that

comes upon us, but also as a task, marks the threshold from where modern philosophy

can start thinking again the end of man happens to be the return of the first beginning

of philosophy." Then the core of his treatise follows as a radical criticism

on man and culture:

"De nos jours on ne peut plus penser que dans le vide de I'homme disparu"

(In our days one can only think in the emptiness the disappeared man has left behind.)

1.17.2 Man no longer in the center

The anti-metaphysical developments have declassified the position of man.

From the "almost divine" man, in charge of the rule over the earth, the idea

61



moves rather fast to a new position: excentrical, outside the centre. The

Dutch poet Lucebert chooses these words:

“A human being is but a speck of dust on the skirts of universe.”

He can simply disappear and leave an empty space behind. Science has made him

superfluous. Now at last we can start from the beginning with things. The tragedy

of mankind for science is not the "disappeared man" but the existence of “the

traditionally metaphysical man, who sees himself in connection with God. This

man hinders the Darwinist scientific progression with his traditional views and

moral values.

1.18 Crisis in the Western Culture

Western culture, triumphant on her scientifically and technological progress of

the I9t, 20th and 21th century, seems to have no boundaries left: the horizons are

being erased, speeds become supersonic, no record is safe anymore, space is

stripped from its miracles and we place our footsteps on the moon.

1.18.1 Anthropological crisis

Western culture, suffering from the "Gotterdammerung" (Buber), is threatened

by the storms of Rationalism, Idealism, Dialectical-Materialism, Existentialism

and Nihilism, to be crashed on the rocks of anti-metaphysical,

one-dimensional thinking, becoming manifest in the "Ego-culture" of Narcissism

with its awful self-affirmation and neurotically loneliness, deeply

anchored in guilt feelings and uncertainty, as described by the American

62



cultural sociologist Christopher Lasch in his book "The Culture of Narcissism".

43

Perspectives?

The answer to the question what we can expect from a "culture in the aftermath

of the 'dead' God" now seems to be given: a lonely man, alienated from himself,

in search for self-affirmation and power to get fellow-men and environment under

his control.

1.19 Final remarks

Do you understand now why we can only speak in a worried mood about Western

man and his culture when our relationship with the Creating Substance has broken

down? But, the Jewish optimism refuses this pessimism as I will describe

below.

On this uprooted man, crying out, loud for the Other with his unselfish and righteous

goodness and love, I would like to continue sharing my investigations with

all interesting scientists who are positive about the renewal of the biology, neurology,

medicine, cultural anthropology, transformation of Lamarckism 44 as a

new orientation on the evolution (original fifty years older than Darwinism).

The assignment of Neurological Music Therapy – by my research intended to be

connect with the Tesla-energetic transformation system, with a view on genetic

unification of music and speech, bound together in the FOXP2-genes 45 on the 7th

chromosome of the human genome, as I shall elaborate on main lines.

43 Lasch, Christoffer, 1967.

44 Snait B. Gissis and Eva Jablonka, Transformation of Lamarckism: From Subtle Fluids to Molecular Biology, MIT-

Press, London 2000

45 Comparable and related but not similar per definition to the foxp2 of the primates

63



All these developments and renewals can only be fruitful, when we are prepared

to answer the call of this lonely modern man, like we are too, being penetrated

and determined by it, for a fruitful and new integrate medicine, with psychiatry

and neurological music therapy as leading systems.

1.19.1 Foetal programming, vital-emotive incarnation, sickness

behaviour

The portrayal of man in our contemporary Western culture is the image of

the "immature" or "not emotive completely grown up" man, of the "childadult",

of the "child-in-a-grown-up-coat". This portrayal of man shows

troubles in the development of the affective possibilities by which one can

speak of a pseudo-adulthood. That this man will behave immaturely, appears

from manifold situations and developments in our culture. I mention

several examples: violence, youth criminality, drug abuse, frequent breaking

up of relations.

All this has to do with a vital-emotive and psychic immaturity that becomes

manifest in behaviour. Not only the physical maturity may be our aim when

we bring up our children, it is also their vital-emotive and psychic adulthood

and the conditions to achieve that growth, that need the loving attention

of parents, religions and society. They are a source of constant concern

for all of us.

1.19.2 Foetal Programming

International research on the influences on the embryo and the foetus of all

that happens during the pregnancy is full of attention and results. The pregnant,

anxious woman, will create a high stress-level, with an strong activation

of the HPA-axis and the release of cortisol. Via the umbilical cord and

64



the child part of the placenta the cortisol of the mother reaches the embryo

and in a later trimester the foetus (about 13%). This process I have to describe

in the last part of my dissertation: the report of my Maternal-Foetal-

Disorder-Syndrome (MDF-syndrome) research. This prenatal situation can

be the causation of serious illnesses in a later period of life, like cardiovascular

diseases and obesity. It is clear that already in the first trimester of

pregnancy many development disturbances will come true with a very

physiological weakness as a result.

1.19.3 Vital-emotive individuation

In this place I shall confine myself to mentioning a few semantic lines on

the idea of "vital-emotive incarnation". This aspect of the human development

is not a general range of thought and asks therefore a specific treatment.

The presence of the Other in this process of psychic incarnation is necessary,

because the person in question is saved from his structural loneliness

by the "welcome!" of the Other. The neonates are comparable with a candle.

The candle has the potential to spread light and heat, but lacks a self

ignition mechanism. Therefore, the other - under many guises - is necessary

to kindle the light in the neonate. If the Other is absent, the increasing child

will suddenly come to a negative self-affirmation: “I am not welcome”,

with fundamental uncertainty, concentration disorders, feelings of loneliness

and guilt as a part of a series of pathologic disorders and syndrome’s.

Therefore, the consequent sufferings are incalculable.

1.19.4 Sickness Behaviour

The Freudian psychoanalysis and the cognitive behavioural sciences aren’t

effective systems in cases of presuppositional mental disorders. Depression

seems to be a mental disorder, but after the anamnestic research it will be

65



clear that we also have to reckon with physiological disturbances in brain

development or disturbances of the immune system by a cytokine deficiency

e.g. schizophrenia still considers a degenerative mental disorder, with a

genetic component (probably FOXP2). But after research of the period of

pregnancy, physiologic damages can tell us the truth about the origin of this

disease with mental disorders as the visual phenomenology of the personal

dark language of life.

So we have to accept on a lower level, mental disorders should not be mentally,

but physically as well. Behavioural deviations can’t be treated as merely mental

disorder, with the assignment to the patient to change his behaviour. It seems to

be a simplification because of the physiologic inability caused by the damaging

prenatal period. “Sickness behaviour” has become a collective term of cases with

an inadequately diagnosis “insufficiency as mental disorder”. Neither the psychiatrist

nor the clinical psychologist, but the neurological or physiological specialist

on the somatic level is the address for this ask for caregiving. Beside that,

we pay extraordinarily attention to the underlying energetic level, within a renewing

complementary or integrated medicine.

1.20 Recovering of modern science by a linguistic turn

When we make a connection between the problem of the vital-emotive and psychic

incarnation and what we have seen in the book of Foucault we come to the

alarming statement:

A "welcome" among people can’t be present 'dans le vide de I'homme disparu',

(…) in the emptiness of the disappeared human being), the cultural space wherein

compassion disappeared, where loneliness and stress stretched the dark wall of

the intransparent language, full of existential misunderstanding of life.

66



The disappeared man however will be refound, only by the reconstruction of the

densificated language, or by discover an undamaged language, with the structural

opportunity to be open, up to the Light as Singularity, as the Source of life.

As we know counting is older than writing. 46 The Proto-European Language is

much younger (not older than 7000 years BCE), divided in a later stage all over

the differentiated language community. The Hebrew language – a West-Semitic

language – has implemented math and language in such a way that we can count

with the number values of the Hebrew alphabet like mathematicians do with

mathematics as their abstract language.

By way of justifying of my choice of the Hebrew language I will show the Hebrew

linguistic as the open language, just the opposite of “the densificated language

of the philology” with its loss of the gates to the Light of creation.

The Hebrew language is the fundamental language of the Creational Light, with

the specific order to the Jewish people to spread this Light into the world, available

for every one who is looking for a gate in the dark wall of the densificated

language, without any openness, nothing but emptiness. 47

“Here I am”: the fundamental attitude of every caregiving human being

All over the world great philosophical streams have developed, seeking for

“Truth and Methods” in a cultural life with closed (scientific) gates. From the

East to the West I mention Marxism, Phenomenology and Analytical Philosophy.

At the basis of these mainstreams philosophers belong to the Jewish people:

Marx, Husserl and Wittgenstein. The place of Jewish medical tradition and edu-

46 In the later part I will illustrate this statement by the Ishango Bones, 20,000 year old with the counting signs with a

probably economic meaning. They are present in the Museum of Nature Scientific at Brussels.

47 In the later part I will illustrate this statement by the Ishango Bones, 20,000 year old with the counting signs with a

probably economic meaning. They are present in the Museum of Nature Scientific at Brussels.

67



cation is undeniable present in our Western-European culture. 48 A thorough-bred

from the stable of Jewish philosophical tradition and European transcendentalphenomenology

is Emanuel Levinas, I already mentioned. We are grateful to him

because of emphasizing the place of the Other and the Goodness in the Western

philosophy; goodness which he equates with doing righteousness and offering

hospitality. A person is good when he -unselfishly- says to the Other: "Here I

am!"

Righteousness (=hospitality) begins where I am prepared to receive the Other.

This acceptance of the commitment to righteousness is the beginning of a long

and difficult way, that nevertheless gives lots of joy and happiness. 49

The Other is the one who is not a bit, but nothing but fundamentally looking for

help: he needs my recognition in the first place. Without my recognition he cannot

exist happily. He challenges me to listen to him. He is looking for hospitality

from me. Hereby I have stressed the importance of the philosophy of Levinas for

our therapeutic research. His both main works remain very important for a scrutiny

research of his philosophy, indispensable for all who will build a strong foundation

under their scientific research of medical philosophy. 50

1.21 A transparent living language up from 5000 BCE

Up to the Hebrew language as an open, modern language; the very only language

from thousands of years ago, still speaking and reading in todays Jewish life, the

presence of the only ancient people that still exists. All big nations from history

are gone, but the smallest people does still exist, serving the world society with

48 Efron, John M. “A history of Medicine and the German Jews”, Yale University press, 2001

49 Levinas, Emmanuel, Totality and Infinity, an essay on exteriority, Boston, 1991

50 Levinas, Emmanuel, Otherwise than Being or Beyond Essence, The Hague, 1981

68



for instance the most Nobel Prizes, very high technical levels and historical influences

on the medical developments.

When we want to create a holistic medical practice we must come, via a dynamic

gate, to the Light, to the Singularity, by the alpha-numerical language as the Hebrew

structure: the language of counting and story telling, the language of science,

instead of the language of a dogmatic religion. The last Theorem of Fermat

(1601-1665) 51 – the French mathematician - has opened my eyes for the cultural

prove of the gates in the Hebrew language. First I have to describe the systematic

formula of the 231 gates - present in the Tanakh (in Christian religious terms: Old

Testament) - the Creational Energetic and Eternal Light.

This dynamic openness is the reason why I have chosen for the Hebrew language

as the language for a methodological and stable system. Since language is an image

of reality, the open language will give us a concrete entrance and connection

with the energy of the Source of life.

51 Pierre de Fermat posited a mathematical theoreme derived from two-letter units elslanguage permanently openness to

the Light- the lives of the Buddhist mystics. Averbode, 1995 about 1637: “if n = < 2 than there are no solutions for xn +yn

= zn “.

69



Chapter 2 - Hebrew language, a solution of

language densification: An Ideal Model for

Medical Philosophical Foundation.

2. Music and the Hebrew linguistics 52

T

he solution of the densification of language the linguistics of Hebrew

language and holistic neurological music therapy requires real and powerful,

recovering energy.

The philosophical consideration

stops for a while,

giving space to a phenomenological

illustration and

meaning for a neurological

music therapeutic praxis.

F. Gafurio, diagram from De Harmonia Musicorum (1518)

- a implemented by me -

Music and language have a

genetic connection, so we

have to describe the both

functional phenomena in

52 In this Jewish mathematic-linguistic model the factorial of a non-negative integer n, denoted by n! is the product of all

positive integers less than or equal to n. For example, 5! = 5x4x3x2x1 = 120. The value of 0! is 1 inside math, according

to the convention for an empty product. In Hebrew counting the 0 doesn’t exists. See: Ginsburgh, Harav Yitzchak The

Hebrew Language: An Ideal Model for Information Proecssing and Management - Galeinai Publication Society, Jerusalem.

70



the holistic framework of recovery and empowerment. Recovery and empowerment

must lead to health as far as the situation is concerned. An open language is

a source of creating energy, that can only be open, if the gates are opened by widening

the pillars (the linguistic permutations), we experience the bright shining

Light of the universal Creation. Result: reborn and recovered life within the Octave

or the Diapason. Passing the gates of Light is a conditio sine qua non.

Back to the philosophical consideration we declare music and language of cosmological

and universal meaning, close connected with the Creational Substance as

Ultimate Concern. In the image above we see the holistic complexity, with a

hermeneutic and fundamental challenge, in order to open a renewing basis for

medical science and energetic-quantum physical Integrate Medicine in general,

and neurological music therapy (NMT) in particular.

In the centre of the Twelve tones circle, surrounded by the cosmological phenomena

stands the the first letter of the Hebrew alphabet, which is the letter of the

Hebrew Ein Sof, the Infinite No-Thing, the Source of Creating Light. As I will

explain in the Prolegomena this is the Supramental Intelligence, the principle of

Downward Causation. This will be elaborate in the Third Part of my thesis. 53

2.1 Clearly Hebrew, a model for scientific research and

treatment

One of the main focuses in modern science is information processing. Gathering

and retrieving relevant information is probably the most significant point of outset

in almost any project that the modern professional may undertake and it becomes

imperative that the retrieval process quickly and efficiently find the accu-

53 Gafuriom F. De Harmonia musicorum instrumentorum, 1518, Wittkower, Rudolf, 1965, 43a

71



rate sources, precisely serve its purposes. To this end many theories are currently

available.

The prophets in Tanakh, the Hebrew Bible, have already promised – just the opposite

of the above mentioned cultural darkness by the densification of the language

- that in the future will come an era of peace on earth in which all nations

will speak one language. In Hebrew the term the prophet uses is safa berurah, a

clear language. Language is something far broader than merely words. We can

see it in the term "body language," the actions we perform and the way our hands

are moving, all are forms of communication. In the future all the nations of the

earth will speak, think and act out one transparent, rectified language. Clearly,

this language can be the Hebrew language, which we are taught in the Torah and

in Kabbalah. Unlike other languages, Hebrew, the ancient language of the Bible,

is a completely logically structured language that presents us an ideal model for

scientific research, philosophical information and insight in the evolutionary processes

and meaning.

2.1.1 Particularities of Light in linguistic Vessels

There are 22 letters in the Hebrew language. Although this is not the place

to discuss all reasons why the number 22 is significant in itself, we will

demonstrate here one connection between the number twenty-two in relationship

to the universally accepted decimal system of counting.

The twenty-two letters can be observed very simply in relationship between

the area and the perimeter of a 1x10 rectangle, which are 10 and 22 respectively.

We will later explore the general algorithm of this phenomenon [2(n

┴ 1)] in further detail. 54

54 The Hebrew language is built around the verb, usually consists of three consonants, the stem radices (roots). Hebrew

has no vowels. A single letter is meaningless without a connection to at least one other letter. The Aleph, the first letter, is

the fundamental exception as I will describe below.

72



Gates and Roots

None of the twenty-two letters of the Hebrew language bears any specific linguistic

meaning as a stand-alone number. In order to generate meaningful units of

language in Hebrew there must be a dialectic of minimum of two letters. One of

the beauties of the Hebrew language is the roots of all verbs and nouns are derived

from two-letter units, usually assembled as part of a three letter root. In

Kabbalah, the two letter units are called sha'arim, 55 gates. Since one would perceive

each of the letters of the unit as a pillar on each side of the shaped gateway,

one can pass through the gateway from either direction. So the two different permutations

56 of the two-letter units form one gate. These two-letter units are subroots,

each sub-root being a gateway to meaning and understanding. We are

taught that there are 231 gates. This can be calculated mathematically. There are

22 letters and we take 1 of the 22 and match it with one of the 21 remaining letters,

which results in 462 (22 * 21) possible matches. This gives us all the possible

permutations of two-letter units including both permutations of the same

sha'ar, gate. In order to arrive at the exact number of sha'arim, we must divide the

result by the number of permutations, available for the same two letters (2!) by

which we arrive at the number 231.

= = 231

22 x 21 462

2! 2

55 The Hebrew language is built around the verb, usually consists of three consonants, the stem radices (roots). Hebrew

has no vowels. A single letter is meaningless without a connection to at least one other letter. The Aleph, the first letter, is

the fundamental exception as I will describe below.

56 In math the notion of permutation relates to the act of arranging all the members of a set into some sequence or order,

or if the set is already ordered, rearranging (reordering) its elements, a process called permuting.

73



Developing from the two-letter sub-roots, we arrive at the three-letter roots called

shorashim in Hebrew.

20 x 21 x 22 9,240

= =

3! 6

1,540

Just as each sha'ar (two-letter-root) has 2 (2!) permutations, so each shoresh

(three-letter-root) has 6 (3!) permutations. We calculate: each sha'ar (two-letterroot)

has 2 (2!) permutations, so each shoresh (three-letter-root) has 6 (3!) permutations.

Thus we can calculate the total number of possible shorashim (threeletter-roots)

in the Hebrew language is 1540.

Besides their significance in the Hebrew language, mathematically speaking, these

two numbers (231 and 1,540) are also very significant numbers anymore. The

most basic geometric shape is a triangle, even more basic than a square, since a

square can be divided into two triangles. The fact that the triangle is the basic

shape is apparent throughout nature, especially in crystallography and other natural

sciences. The formula for a triangular number is n = n(n ┴ 1)/2. When n = 21

this formula renders an equation that is identical to the one we used to calculate

the number of gates in the Hebrew language. It generates a sum of 231. The number

of gates produced from the 22 letters is therefore equal to the sum of all numbers

from 1 to 21.

Although the number 231 can be expected to be a triangular number, considering

the way that it was generated in this case, it is more surprising that 1,540 is also a

triangular number — a triangular number being a relatively rare phenomenon.

1540 is the triangle of 55 (written: ∆55). However, amazingly, this number is also

the tetrahedron of 20 (written: ∆220) i.e. the sum of all triangular numbers from

74



∆1 to ∆20. Physically spoken, this is a three dimensional construction created by

arranging each triangle one above the other, from the smallest to the largest. It is

an extremely rare phenomenon to find a tetrahedron that is also a triangular number,

but 1,540 is one of these unique numbers.

Within the context of the sha'arim and the three-lettered shorashim, we will note

here another beautiful mathematical phenomenon that illustrates the harmony

between the two. Since 1540 is ∆220, if one adds the next triangular number

(∆21) to the tetrahedron, one has raised the tetrahedron by one level, producing

∆221. Remember that ∆221 = 231 is the number of sha'arim in the Hebrew language,

as mentioned!

2.2 A Simple, Double, Triple, and Quadruple Song

As mentioned previously, there is a mathematical relationship between 10 and 22.

The most important algorithm which appears in Torah is 2(n ┴ 1). Applying this

algorithm for n = 1 generates 2(1 ┴ 1) = 4. When we continue applying this algorithm

to the result: n=4, 2(4┴ 1)=10 and n=10, 2(10┴ 1)= 22. Now we have

generated the following series of numbers: 1, 4, 10, 22. These first four numbers

share the basic development system of n2 = 2(n1┴ 1).

75



As we illustrated before, the

relationship between 10 and 22

is hidden within the lights of the

Kabbalistic Tree of Life and the

22 letters of the Hebrew language.

However, we consider

the numbers preceding these

two – 1 and 4 – we have to realize

the number 4 is the triangular

"root" of 10. This alludes to

the "simple, double, triple, and

quadruple song." Thus the number

4 is an even more basic

model of creation than the number

10. Indeed, G’d's ineffable Name, is composed of four letters. The Tetragrammaton,

God's unique and essential Name, which literally means "the fourlettered

Name of the past, present and future tense," precedes the ten lights.

which literally means "the four-lettered Name of the past, present and future

tense," precedes the ten lights. Even in English this is not an arbitrary name. This

means that there is something essential about the fact that it has four letters.

Although the number 4 indeed precedes the number 10, God is One and 1 precedes

everything. One is the beginning or God's absolute and essential Unity. So

the very fact that this algorithm generates 4 from 1 and 10 from 4 and 22 from 10,

producing three very significant numbers, shows that it is a very essential and

important algorithm. The triangular is the most fundamental mathematic shape.

The rectangle can be divided into two triangles by drawing a diagonal line out of

the two corners.

The triangle is the shape of the “flat land” with the square as the maximal proportion.

76



We saw this in the formular “1540 is the triangle of 55 (written: ∆55)” as a surface

size.

Now we have to look for the opposite: the “measure of capacity” sketched by the

formular “∆221 = 231”. Besides the triangle with the square dimension we have

found the tetrahedron, the shape with the “measure of capacity”.

2.3 What’s the gate to the Light?

In the next part “Prolegomena” I elaborate this query and solve the problem. This

introduction orders me to explain the gate-solution in Hebrew as open result

shortly.

2.3.1 A short resume

The number 4 is an even more basic model of creation than the number 10.

God's ineffable Name, is composed of four letters in Hebrew: hwhy –

YHWH. The value of these 4 numbers are respectively (reading form right

to left) J = 10; H=5; W=6 and H=5. The sum of hwhy – YHWH = 26. This

number is in Hebrew always connected with the Tetragrammaton, God's

unique and essential Name, which literally means "the four-lettered Name,"

precedes the ten lights of the Tree of Life. There is another important Hebrew

word: Ng - gan, the garden, which has actually named Paradise, but it

aims “the place of nature and nurture in line with the intentions of the Creator”:

the cultural place of living.

77



Human measures incorporated inside a tetrahedron illustrates the implementation of triangle and tetrahedron. The Plato

tetrahedron is singular and expresses a good insight in the shape.

As we already expressed in the formation of a gate from two letters belonging

together and which can be put apart by permutation, creating the gate with a path

by which the Light becomes visible and breaks all boundaries to the Ultimate

Source, also behind the Universe - an equally created reality.

We research it and conclude to the two Hebrew letter word Ng - gan. Now we calculate

the numeric value. The g = g = 3 and N = n = 50. The two letters form the

value of 53 which we separate both, based on the permutation, as two columns

which form a port: the gate 5 and 3. But we never forget the 26th, the number of

the Always Present Source, shining bright through the gates, inviting every human

being for recovery of life.

I just highlighted the Last Theorem of Fermat. He introduced the following riddle:

“What number is flanked by a square and a volume. We found the crucial

number 26 positioned as: 25 - 26 - 27. We factorize the two flanking numbers

into the following emerges: 5 2 - 26 - 3 3 . A square is a surface dimension and a

volume is a measure of capacity. Now we directly discover the gate and the

pathway to the new transparent language the gate of 5 and 3, seeing the Source,

expressed in the number 26. In this way the massive language has disappeared. A

new existential meaning for every human being has come to front.

78



A last example - perhaps stronger speaking to our scientific imagination - is DNA

as a four-letter alphabet, that the book of life (president Clinton) has written in

fixed letter combinations, with a strictly genetic grammar. De double Helix has

formed by fixed letter combinations of the four: AGCT. Every sentence, written

by these combinations, has a grammatical beginning with weather the 5, or the 3

and the opposite. So we might accept a new gate to the Light and the Source: the

DNA with 5 an 3, connected with Ng – gan – the Garden as the metaphor of the

entire nature, nurture and culture. So our DNA is also the gate to the Light of 26.

This creates much special as I will reveal. Now we can complete the linguistic

part of the Introduction.

2.4 Conclusion

The connection between the treatment of the Hebrew algorithm, the darkness by

the densification of the language and the boundaries of the Universe of the consciousness

and the thread by the wicked, who refuse to take responsibility to the

vulnerable fellow men and women by themselves, and more seriously the wicked

who obstructs the Good to be good. The motion-picture “The Truman Show” 57 is

a spectacular example of this item.

The structure of the Hebrew language has emergent developments too. These

developments are seemingly coincidental, but in a special way - our intelligence

transcending – they stem from other elements in the evolution as creation, like

57 The Truman Show (1998). Dir. Peter Weir. I deep therapeutic message for all that want to see more than the pictures

and the superficial images. At last, the dictatorial human – the representative of the media and theirs influences able to

keep on scene everyone who is naïve and mentally disordered as well. That, after standing in his transcendental power he

liberated himself, breaking through the last, ultimate obstacle, the stairs unto a new life.

79



Goswami speaks about the "downward causation", a Buddhist vision, I wholeheartedly

share.

This background sketch was absolutely necessary to come "back to the future"

renewing the obstructed language, to stop overlooking the Always-Present Source

and our connection with it. Strictly spoken, no a paradigm shift in the medical

and paramedical professions can comes true without renewal of the existing language,

like new wine in a new bottles.

There is no other language being able to structure our entire reality, the Universe,

Consciousness and Quantum mechanics included, without falling into all kinds of

theological beliefs and assumptions. The Hebrew language with its numerical

values is an appropriate interlocutor for the natural sciences and mathematics.

With this short description I hope sufficiently justified my choice of the Hebrew

philology, logo-analyses of Jewish scriptures and traditions, with special view

and emphasize on the Jewish influences of medical philosophy: neurological music

therapy and biological psychiatry receive full attention in the medical philosophy,

I have researched in theory and praxis.

I have to pay special attention to the psychiatrist diagnostics with schizophrenia

as a main problem, connected with the neurological music therapy.

This choice has many reasons. The main reason is the evolutionary equation of

language and music, and its mutations.

80



Chapter 3 - Language and music, epigenetics

on FOXP2-gene at Chromosome

7 58 he introduction of a fundamental philosophical inquiry into the princi-

T

ples and practices of neurological music therapy (NMT) can not exist

without a brief treatise of the genetic disposition and reaction, as possible

mutations of the gene, that seems to be responsible

for language and music. Therefore here we

provide a brief review of FOXP1 and FOXP2 as

fork genes, located on the 7th chromosome, evolutionary

important for development of speech.

Since it belongs to a fundamental research of the

basic phenomena it’s necessary to look to, and to

examine language and music as a unified, but

functional connectivity. The connection between

psychiatry and neurological music therapy will specify this item.

The pathological application of schizophrenia is not arbitrary, but well selected.

One of the positive symptoms of schizophrenia is auditory hallucination. This

symptom must be categorized as a language disorder, a specialized area of attention

for the NMT.

58 Chromosome 7 is a chromosome in the human body containing about 158 millions of base pairs of DNA: about 5% of

the entire DNA in the nucleus of the cell. There are many vulnerability loci on this chromosome e.g. autism and probably

parts of schizophrenia too.

81



3.1 Music and language innate phenomena?

The question of 3.1 is important for my investigation because of the unification

between music and speech, transformed by the Tesla-technology and Mindlink

energetical treatment. When we split both lines (music and speech) we ought to

be on the way back in the evolution. That’s the reason why I would research the

evolutionary connection between songbirds, whales and other primates. All possess

the Foxp2-gene, responsible for development of language in a primordial

state. It is not correct to extent this gene to the FOXP2 of the homo sapiens and

the modern human being.

It seems to be evidenced the Foxp2 of the songbirds and other primates can be the

collective gene for develop language and speech, the language and speech disorders

in the human system – just like the auditory hallucinations of schizophrenia -

will bring us fundamentally back to the evolutionary disposition: elementary

speech and music. The interdisciplinary debate on this issue is still ongoing.

Many scrutiny publications tell us about the difficulties of this case. Many investigations

are published, but very few will give us an affirmed result.

3.2. Lamarckism

My hermeneutic presuppositions in this research are derived from Lamarckism,

as opposition of the later Darwinism, however indispensable for the sciences followed

by most researchers working within our subject, because of the crucial

aspect of natural selection, just the opposite of the todays re-orientation on biological

and cultural developments, originating in the epigenetics, derivative of

Lamarckism. 59 There are Lamarckian problems, comparing with the younger

59 Minnoo Rassoulzadegan, “An Evolutionary Role for RNA-Mediated Epigenetic Variation”, art. in Gissis and Jablonka’

s Transformation of Lamarckism, from subtle Fluids to Molecular Biology, Cambridge, England, 2011.

82



Darwin. 60 The core differences we will find, comparing both systems, are the

different praxis and meanings about natural selection and adaptation. For instance:

does music have any importance concerning natural selection? For Darwin

it isn’t clear. His vision: the only reason is sexuality.

3.3 What does music share with language?

Currently hot is the fundamental question: “What does music share with language?”

Focusing this question leads to an emphasis on the similarities between

language and music. Sometimes scientists come to a conclusion of similar functions.

We must distinguish between language in general and active speech as

language production, similar to the music production. These differences have

crucial implications for the origins of music in particular. Imagine you were

searching for the genes responsible for musicality. Finding the particular gene or

genes for behaviour is a challenging task, for there are billion of possible loci for

these genes in the human genome. However, if indeed music and speech are similar

functions with common origins, a good principle would be to look for the

genes that already have been identified for speech. One good candidate is the

“The powerful scenario of genetic variations combined with natural selection provides us with a comfortable and satisfying

picture of evolution. According tot his view, mutations, which are the raw material of evolution, are continuously

arising and either accumulate of are eliminate. … Darwin: “This preservation of favourable individual differences and

variations, and the destruction of those injurious, I have called Natural Selection, or Survival of the Fittest”… according

to my view, varieties are species in process of formation, or are, as I have called them, incipient species. How, then, does

the lesser difference between varieties become augmented into the greater difference between species? That natural selection

will always act with extreme slowness, I fully admit” (Darwin, The Origin of the Species, London, 1872). Darwin was

right in thinking that the selection of random mutations is a slow process, although today we know that a new species

could arise with only a single mutation in a master gene… Mutation is not the only source of variations … to create is to

re-combine. From bacteria to higher organism, in addition to de genetic modifications (mutations and recombination)

within individual’s own germ line, recombination with genetic material from other entities may also allow adaptations to

new conditions. Recombination is the foundation of change, which, by itself, provides tremendous possibilities for switching

between types. About the DNA/RNA Minnoo writes: “Small RNA’s are at the center of regulatory networks during

development. Although much remains to be learned about their possible functions, one cannot help wondering whether

they might provide a powerful means for generating diversity and new species”, page 229,230.

60 “A perspective on evolutionary problems that emphasises developmental processes and phenotypic variation. Evolutionary

analysis starts by studying the origins and causes of transmission. Natural selection of heritable variations is seen as

crucial fora an account of evolution, so the Lamarckian approach has considered as complementary in Darwinian, selection-oriented

one”, Giss and Jabloncka, op.cit. page 427.

83



FOXP2 gene. 61 Peretz opens with her text the problem of functionality between

music and speech. She points to the well-known family with genetic disorders of

speech, the scientific pointer “KE-family”, a family as an important object of

research. 62 It is outside the theme of my research to deepen the problems of this

family, so I will limit my remarks with a single conclusion, just like Peretz in her

paper: “Interestingly, the speech disorder experienced by the KE-family is not

language specific. It also affects oral movements. Hence we may wonder if the

mutation of the FOXP2 gene also affects vocal abilities such as singing (…). This

gene seems to play a causal role in the development of normal brain circuitry that

underlies language and speech. (…) Hence, music and speech may have common

origins after all (…) Thus the available data are compatible with the idea that

there are two innate factors, guiding the acquisition of the musical capacity, with

one related to “temporal sequencing” (and possibly related to FOXP2) and the

other, “pitch sequencing” (of which genes remain to be determined). 63

3.4 Music and language innate, but exclusive human

phenomena?

Architecture of the basal ganglia model. Two cortico-basal ganglia loops are

modelled, representing two levels of decision making: a cognitive loop in blue,

and a motor loop in red. Each loop consists of a focused, positive feedback, direct

pathway loop [cortex-striatum-globus pallidus (GPi)-thalamus-cortex] and a divergent,

negative feedback, hyper direct pathway loop [cortex-sub thalamic nucleus

(STN)-GPi-thalamus-cortex].

61 Isabelle Peretz in a keynote paper for “Language and music as cognitive systems”: University of Montreal, Canada,

2008, page 2.

62 See for this subject matter the literature.

63 Peretz, op.cit. page 2

84



Cortico-basal ganglia-thalamic-cortico loop

Action selection within each loop is an emergent property of the interaction of the

direct and hyper direct pathways. Information flows from one loop to another is

via divergence and reconvergence of the direct pathway. Each direct pathway

loop diverges from cortex to associative areas of striatum. The associative striatum

then has outputs to both motor and cognitive GPi. The action selection made

in the cognitive corticostriatal loop is passed to the motor corticostriatal loop via

this divergence and convergence and is used to bias the motor decision.

Within each loop, separate channels represent the decision choices at that level.

Competition for expression occurs between these channels at each level. Association

cortex projects to associative striatum (purple), but is not involved in a

closed feedback loop. Expansions of inputs to each structure are shown in circles.

To avoid confusion, only the inputs are shown; the outputs can be deduced from

the main diagram.

The expansions of cortex and STN show simple 1:1 excitatory inputs. The expansion

of the striatum shows 2 cognitive corticostriatal neurons (in blue), each diverging

to innervate 2 associative striatal neurons, 2 motor corticostriatal neurons

(in red), diverging to innervate a different set of associative striatal neurons, and

an associative corticostriatal neuron (in purple) innervating a single associative

striatal neuron. Inputs from cognitive (motor) cortex to cognitive (motor) striatum

85



are topographic. The expansion of the GPi shows a divergent STN neuron innervating

all 4 GPi neurons and 4 associative striatal neurons converging to innervate

a single GPi neuron. As with the corticostriatal connection, inputs from cognitive

(motor) striatum to cognitive (motor) GPi are topographic. The expansion

of the thalamus shows the topographic inhibitory inputs from the GPi and the

topographic excitatory feedback from the cortex that forms a corticothalamic positive

feedback loop. 64

3.5 In sum

Humans seem to have anterior and posterior vocal pathways which are implicated

in speech production and learning. Parallel to the avian posterior vocal pathway is

the motor cortico-brainstem pathway. Within this pathway, the face motor cortex

projects to the nucleus ambiguous of the medulla, which then projects to the muscles

of the larynx.

Humans also have a vocal pathway that is analogous to the avian anterior pathway.

This pathway is a “cortico-basal ganglia-thalamic-cortico loop” which begins

at a strip of the premotor cortex, called the cortical strip, which is responsible

for speech learning and syntax production. 65

The cortical strip includes spans across five brain regions:

anterior insula

Broca’s area

anterior dorsal lateral prefrontal cortex

64 Image and description M. Guthrie a.o. in Journal of Physiology 2015

65 These parts of the brain have to be research on their energetic output, in order to get knowledge about the frequency

input with re-activating of the self-recovering ability as aim of the “energetic differentiated medical treatment”, essential

parts of the Integrate Medicine and Neurological Music Therapy, with Tesla-Mindlink technology as an essentially energetic

treatment. My research on 528 Hz music has proven to be a fundamental frequency, basically binding the cell’s and

the Source of life (see in the Prolegomena the re-definition of religion as re-binding between the Source and the Self). The

mutation of FOXP1 en FOXP2 is relevant for the energetic treatment of schizophrenia as I will illustrate. See below.

86



This cortical strip has projections to the anterior striatum which projects to the

globus pallidus to the anterior dorsal thalamus back to the cortical strip. All of

these regions are also involved in syntax and speech learning. 66

3.5.1 Genetic Applications to Humans

In addition to the similarities in the neurobiological circuits necessary for

vocalizations between animal vocal learners and humans, there are also a

few genetic similarities. The most prominent of these genetic links are the

FOXP1 and FOXP2 genes, which code for forkhead box (FOX) proteins P1

and P2 respectively. FOXP1 and FOXP2 are transcription factors which

play a role in the development and maturation of the lungs, heart and

brain, 67 and are also highly expressed in brain regions of the vocal learning

pathway, including the basal ganglia and the frontal cortex. 68

In these regions (i.e. the basal ganglia and frontal cortex), FOXP1 and

FOXP2 are thought to be essential for brain maturation and development of

speech and language. 69

Researchers have found that patterns of expression of FOXP1 and FOXP2 are

amazingly similar in the human foetal brain and the songbirds. 70

In humans, FOXP2 is highly expressed in the basal ganglia, frontal cortex, and

insular cortex, all thought to be important nodes in the human vocal pathway.

66 Jarvis, ED (2007). "Neural systems for vocal learning in birds and humans: a synopsis". Journal of Ornithology 148

(1): 35–44. An important item according to the research of MDF-syndrome and Fetal Programming.

67 Pariani, MJ; Spenser, A, Graham Jr, JM, Rimoin, DL (2009). "A 785 kb deletion of 3p14.1p13 including the FOXP1

gene, associated with speech delay, contractures, hypertonia and blepharophimosis". European Journal of Medical Genetics

52 (2-3): 123–127.

68 Vargha-Kahadem, F; Gadian, DG; Copp, A; Mortimer, M (2005). "FOXP2 and the neuroanatomy of speech and language".

Nature Reviews Neuroscience 6 (2): 131–138.

69 Vargha-Kahadem, F; Gadian, DG; Copp, A; Mortimer, M (2005). "FOXP2 and the neuroanatomy of speech and language".

Nature Reviews Neuroscience 6 (2): 131–138.

70 Vargha-Kahadem, F; Gadian, DG; Copp, A; Mortimer, M (2005) op.cit.

87



Thus, mutations in the FOXP2 gene are proposed to have detrimental effects on

human speech and language, such as grammar, language processing, and impaired

movement of the mouth, lips, and tongue 71 , as well as potential detrimental

effects on song learning in songbirds.

Additionally, it has been suggested that due to the overlap of FOXP1 and FOXP2

expression in songbirds and humans, mutations in FOXP1 may also result in

speech and language abnormalities seen in individuals with mutations in

FOXP2. 72.

These genetic links have important implications for studying the origin of language

because FOXP2 is similar among vocal learners and humans, as well as

important implications for understanding the etiology of certain speech and language

disorders in humans, like the auditory hallucinations of schizophrenia. Currently,

no other genes have been linked as compellingly to vocal learning in animals

or humans.

3.6 Evolutionary foxp2, Foxp2 and FOXP2

73 74

Songbirds are relevant for basic and applied medical research, is the outcome of

the research of Michael Brainard et.al. Songbirds, long of interest to basic neuroscientists,

have great potential as a model system for translational neuroscience.

Songbirds learn their complex vocal behaviour in a manner that exemplifies gen-

71 Takahashi, K; Liu, F; Hirokawa, K; Takahashi, H (2003). "Expression of FOXP2, a gene involved in speech and language,

in the developing and adult striatum". Journal of Neuroscience Research 73 (1): 61–72.

72 Pariani, MJ; Spenser, A, Graham Jr, JM, Rimoin, DL (2009). "A 785 kb deletion of 3p14.1p13 including the FOXP1

gene, associated with speech delay, contractures, hypertonia and blepharophimosis". European Journal of Medical Genetics

52 (2-3): 123–127.

73 The different formular illustrate the gene as presented in different primates as songbirds, whales, crocodiles etc. Capitalized

it is the premise of human beings.

74 Bolhuis, Noam Chomsky a.o. “Birdsong, Speech, and Language: Exploring the Evolution of Mind and Brain”, MIT

press, 2013.

88



eral processes of perceptual and motor skill learning, and more specifically resembles

human speech learning. Song is sub served by circuitry that is specialized

for vocal learning and production, but that has strong similarities to mammalian

brain pathways (…) there are mechanistic parallels between birdsong and

aspects of speech and social communion. (…) Songbirds therefore represent an

almost unique animal model: song learning has remarkable parallels to human

75 76

speech learning.

The speech disorders like auditory hallucinations of schizophrenia can be a mutation

of FOXP2 as a genetic vulnerability, predisposed for auditory hallucinations.

“Interestingly polymorphisms in FOXP2 have recently been associated with auditory

hallucinations (…) If hallucinations are misidentified perceptions originating

in the speech perception area of the left temporal lobe, then hallucinating patients

should have problems identifying a simultaneously presented external speech

sound, especially when the sound is presented and lateralized to the left hemisphere”.

77

Also the epigenetic research has formed an important part of the FOXP2 research.

The question remains: “Do we have here an irreversible or a reversible distortion

as a selection in the human lineage?” 78

75 Michael S. Brainard a.o. “Translating Songbirds as a model for basic and applied medical research. Conclusion: “No

single animal model is likely to recapitulate all the features of complex neurological and psychiatric diseases, but we argue

here that songbirds, with their easily quantifiable learned behaviur and dedicated circuit, are a iniquely usefull addition to

more traditional model systems. (…) It is our hope that enhanced dialogue between songbird and human researchers, with

attention to both the similarities and differences between systems, can provide new thrapeutic insights”.

76 Ikuku Teramitsu, a.o. “Parallel FOXP1 and FOXP2 Expression in Songbird and Human Brain Predicts Functional

Interaction”, The Journal of Neuroscience, 2004

77 Kenneth Hugdahl a.o. “Auditory hallucinations in schizophrenia: the role of cognitive, brain structural and genetic

disturbances in the left temporal lobe”, Frontiers in Human Neuroscience, 2008.

78 Amporo Tolosa, a.o. “FOXP2 gene and language impairmaent in schizophrenia: association and epigenetic studies”,

BioMed Central, 2010.

89



3.7 Conclusion

Heritage at the moment of procreation and the foetal programming as development

can become a monogenetic disorder. At the development of the epigenetica

we have to discern between the monogenetic disorders (irreversibly) and the epigenetic

disorders (reversibly). For instance: a long time the diagnosis ADHD was

a genetic distortion. Nowadays we know ADHD/ADD must be held for a epigenetic

distortion. The genetic distortion has a damage of the DNA-sequence, the

epigenetic distortion depends on the environmental factors without damaging the

DNA-sequences. That means: when we change the environmental factors, we

have a change to recover.

May be we will come to the conclusion that “schizophrenia in a mild form” will

be a epigenetic disorder with view on recovery, instead of a rigid degenerative

disease. In that case the auditory hallucinations may be can stop by activation of

endorphins, memantine by an energetical treatment.

Because of the universalistic matter “language and music” will form a core element

in the Tesla-technologic Mindlink research and treatment with a systematic

split up between language and music, as positive energy. This energy can be used

for a return to homeostasis by de-blockage of the negative energetic blockages.

The treatment must be as deep as possible, so we have to look for the evolutionary

foundations and energetic functional stimuli. Also for human beings music

and language have an individual signal function and group stimulation power,

that bounds together. Although the investigations around the question “Is music

an evolutionary adaptation, based on natural selection?” is an ongoing process.

My research of “Maternal-Foetal-Distortion”-syndrome (MFD) connected with

the epigenetic and prenatal development disturbances, will prove the positive

effects on these disorders (See the Practical Part of this dissertation).

I will close this part going back to music and the brain, with a statement about the

universal meaning of FOXP2 of Patel:

90



“Quantitative analysis of this variability suggests that this gene has been a target

of selection in human evolution, and was fixed (i.e., became universal) in its current

form within the past 200,000 years”. 79

3.8 Epilogue of the philosophical introduction

With binding conventional and complementary medicine into a new Integrate

Medicine. My deeply desire to contribute to a unification of both medical traditions

(East and West) asks for a scrutiny research, with a re-definition of the

terms: evidence-based, value based, consciously and unconsciously based.

To get a scientific evidentiary theory, the foundation of my ambitious aim for a

small contribution to this necessity ideal, I ought to start this scientific research.

But what’s scientific? The meaning differs fundamentally in the scientific camps

in East and West, medical and philosophical as well.

The western definition is empirical and built up of the factors: double-blind, randomized

and placebo-acknowledged.

Since the meaning of the term placebo has changed in the western medical world

and the Easter medical world already differed from the west, I decided to describe

the empirical definition of “scientific research” c.f. the western medical world,

without the classical meaning of the term “placebo”. So my definition of scientific

research is an empirical investigation as double blind and randomized research.

79 A.D. Patel, Music, Language and the Brain, Oxford University Press 2008, page 366, a quote of Enard a.o. in Nature,

418: 869-872.

91



3.8.1 Placebo and Nocebo

The placebo effect seems to be a result of an activating effect of the “selfrecovering

ability”. This healing ability is a very important element in the

treatment of any physical of mental disorder. Thus the placebo “sugar

grain” is no longer a dummy pill.” It is comparable to the “nocebo effect”

e.g. during a “bad news consult”. “Probably you have only a few months to

live,” the doctor said. The “self-destructive ability” start working after this

notification.

3.9 Discussion

Integrated Medicine as a new paradigm

With the last remarks about the change in the meaning of placebo and nocebo, we

reached the necessity of a paradigm shift for the conventional medicine and the

complementary medicine as well. This shift will give us the opportunity to come

to a new “integrate medicine” as a model, a paradigm must be based on quantum

physics, consciousness and unconsciousness. The enormity of this assignment

asks for a reconstruction and rethinking of the historical “fixed images”, representatives

of our fixed truths. In a critical self-reflection, we ought to release ourselves

from these “fixed images”, to overcome the religious meaning of them:

idols, with their claims to lose our freedom of thoughts and developments in general

and in the paradoxical cohesion of diversities, collected “in varietate concordia”,

united in diversity.

Ayurvedic image of man

The quantum physicist Amit Goswami writes in his book The Quantum Doctor

about the new paradigm for medical sciences and a new Ayurvedic image of man.

92



This image of a five-fold human body is a design

of the complexity of functional human

dimensions. He speaks about five connected

bodies with the vital body in the centre, as a

blueprint activated and realised by the morphogenetic

fields developed by Rupert Sheldrake.

His book after the “New Science of

Life” his "The Rebirth of Nature” shows our

intimate relationship with the universe — that

we are a part of a breathing, living, thinking

cosmos and that intelligence is a pervasive

reality inseparably one with nature. I elaborate

this image of man as a clear connection with

the Jewish image of man, with five dimensions

or “fields”.

For both approaches two concepts are determinative: 1. meaning and 2. anticipation

and retrocipation, based in the evolutionary movement of downward causation,

the system of Goswami, borrowed from D.T. Campbell (1916–1996). This

evolutionary “top-down”-model that has been started at the Source of All (for

Goswami Consciousness) is the ongoing process, with a future scientific completion

as a long desired “Theory of Everything”, the unification of Cause and Effects.

3.9.1 Anticipatie en retrocipatie

This model of the image of man depends on "meaning" and mutualist internal

movements as "anticipation" and "retrocipation".

93



A short explanation of these both concepts suffices on this place. Below I

will compare the Ayurvedic and Jewish image of man as concepts for a new

scientific image of man.

3.9.2 First concept: “Meaning is Substance of all, "modi of existence.”

(Spinoza)

This universal character of referring and expressing, which is proper to our

entire created cosmos, stamps the created reality in meaning, by its dependent

non-self-sufficient nature. Meaning is the Substance of all modi of being,

even the nature of our selfhood. This idea of Spinoza has religious

roots and a divine origin with Substance as Deus sive Natura (G’d or Nature).

Now philosophy furnishes us with a theoretical insight into the inter-modal

coherence of all aspects of the temporal world. Philosophy makes us aware,

that coherence is a coherence of meaning that referring to a Totality. We

have fitted into this coherence of meaning with all our modal functions,

which include both: the so-called ‘natural’ and the so-called ‘cultural’. Philosophy

directs the theoretical view of totality over our cosmos and, within

the limits of its possibilities, answering the question, who we are, living in

an energetic grid as matrix, or within a constantly moving Quantum Field,

collecting all particles, for a while or permanently, with a left or right turning

spin. Philosophical thought in its proper character, never disregarded

with impunity, is theoretical thought, directed to the totality of meaning of

our cosmos. These single remarks contain in themselves the entire complex

of problems, involved in a discussion of possibilities of genuine philosophy.

94



3.9.2 Second concept: influences by anticipation and retrocipation

The layered body of Goswami

The layered five bodies of Goswami must remain a factual unity unless the

effectiveness of the apparently independent functioning bodies. The concepts

of anticipation and retrocipation show us the upwards and downwards

influx on each bodily field. In the vision of Goswami, the bliss is the effect

of consciousness. This consciousness will influence the lower supramental

body, and the supramental body affects the lower mental body. In such

way, the mental body will effect the vital body and at last the vital body

gives the “blue print energy” creating and effectuating the physical body.

Here we see the downward causation applied on the image of man. This influence

is the explanation of the retrocipation-concept. But it isn’t finished.

The downward movement creates a new way in the opposite direction: upward

movement. The physical body affects the vital body etc. This is the

anticipation-concept. After the image of man has been created in a downward

causation, the physical body gives energetic and sometimes pathological

effects on the vital body. So we conclude: all different bodies influence

each other systematically, even our open consciousness. By these two concepts,

we have described the ultimate unity of the image of man in his phenomenological

and functional dimensions or fields.

In the philosophy of the East, we can compare this system of anticipation

and retrocipation with the energetic chakra-system. Just as the crown chakra

must remain open, because of the connection with the environment (universe),

the image of man in the vision of Goswami ought to remain open to

the universal consciousness.

95



3.9.3 Consciousness not the last step

In my opinion, the openness can’t stop with the consciousness, because

consciousness is always “consciousness of something”. In the way of the

quantum mechanics consciousness is always “consciousness of no-thing”.

Therefore, I posit the openness in the universal consciousness, the canal of

the Source of creational Light (Ein Sof – Infinite No-thing - in Hebrew).

As an impetus for further discussion and research, I will come to an end of these

philosophical remarks as preparation of the Prolegomena, with the most specific

focus on the question of downward caution and the reality of the dictum of Pythagorean

school: “All is number”. The Hebrew linguistics follows this dictum by

the alpha-numeric character of the Hebrew language.

The Hebrew language has given us an open view on the representation of the

Light of the Source by structure-numbers, with the number value of the Jewish

name of G’d in the center of the relationship with science and mathematics. This

doesn’t mean theological import into a medical, philosophical research.

The Hebrew biblical language is the only language, standing in a dialectical relationship

with science, without being a language merely of dogmatic religion. The

reason must found in the fact that Jewry isn’t a dogmatic religion, but a religious,

non-dogmatic culture, with nature and nurture, similar to the natural sciences and

mathematics. The influences of the medical science in history and the present

days have been extensive. The very high ranking of the Nobel Prizes for sciences

illustrates the importance of Jewry for the renewing of the world; the medical and

therapeutical domains included.


Thetic Part 2 – Prolegomena

96

Part 2 :

Prolegomena Introduction

Me erpy Nwzx Nya

“Where there is no vision, the people cast off restraint.”

Proverbs 29,18



97

Chapter 4 - Introduction: cause for this

research

4.1 What’s the frequency of love as the music of the

heart?

T

he whispering silence of the space between “you and me” is the place

where love gets its shape. If this is completely correct, what is love

concretely? How can it be the music of the heart? Love must surely

have an energy source, and this emanated energy is a driving factor?

But, love as the energy of the heart? What is it? Emotion … e-motion – energetic

movement – breathing in the rhythm of the soul?

Emotion is an abstraction, an energetic move, we only can perceive by its “fruit,”

an articulation of a fundamental potentiality. This articulation of potentiality must

be a two-fold way because we see “love” and “anger.”

Since emotion is an articulated potentiality, we must fine tune the measurable

energy of a variable frequency. What are the energetic differences between love

and anger? Can we express them in frequencies?

I decided to search on the internet and posed the question: “What is the frequency

of love?”.

What I didn’t expect, happened. I was floored by the big numbers of suggestions

and possibilities, almost referring to YouTube and music of 528 Hz. Not only the

mass of possibilities of 528 Hz sine-frequencies aroused my surprise. Above all,

it seemed to be the frequency of “miraculous healing” by specifically tuned instruments.

When I read about the recovery of damaged DNA-sequences and car-



98

cinogenic disorders by these specific sine-frequencies, my astonishment was

changed into scepticism and distrust.

It sounds aloud on the internet: “It works! It is fantastic!”

But what is working? What are the prove of the reality and scientific model?

Emphasizing and presentation of the success-stories worked counterproductively

to me: I felt a subjective protest but this isn’t allowed in a scientific research.

Does the system work because it has positive effects on the people who are concerned?

I decided to cling to my conviction that I cannot examine the experience

itself, but only the structure of the experience and the theory on which this structure

has built.

So I started my search for the experience-structure of people treated with 528 Hz

music, working at an underlying scientific theory. I hoped to find an answer if the

music of 528 Hz could be the phenomenon, being strong and special enough to

express for a medical paradigm shift.

4.2. YouTube and the 528 Hz “healing music”: a resume

Because my mind awakened through all the success stories, impressive oscilloscopic

waves, video images, and sounds. I remained impressed and tackled by

this wonderful sound of 528 Hz, and its bright effects, appropriate for specific

compositions. This frequency has to recover and to heal for the main purpose of

music as a functional phenomenon just like described above.

In sum, we can say that music of 528 Hz, its connective frequencies and the poetic

language will form a unified phenomenon. That points back to the genetic and

epigenetic expression based on the evolution of 200.000 years ago.

It seems to be important to refer to the fact of very, very slowly enhancement of

our (human) genome and the genome of songbirds, whale sounds, etc. as well.



99

As a communis opinio on YouTube according to the 528 Hz music is connected

to the music system, called Solfeggio, with its specific frequencies on the one

hand. The language, however, consists of a poem, dedicated to the Roman Catholic

St. John, the Baptist on the other hand.

Using the first syllables of sentences of the poem - ut-re-mi-fa-so-la - the Solfeggiosysteem

got its mystical, metaphysical meaning, to which healing powers

granted. Here again language and music are intertwined, but in a way that negates

itself, limited by the restricted inspiration of a poet (personification of language).

He has coupled his poem with Solfeggio, the lost tuning system, which we also

can find in Sanskrit chants.

My main questions became stronger and stronger: “What is the driving force behind

these frequencies and from which creative Source emanates this innovative

strength and healing power, through our natural, sometimes deeply disturbed,

reality?”

The enormous power never can emanate out of a restricted poem, so we must

figure out of what Source this re-creative and recovering power provable comes.

Using the word “miracle” in a poem text doesn’t fit a miracle in stricto sensu.

4.3. Truth without evidence creates a fairy tale

In several publications, I found and re-found the same report of the “relevational

dreaming” of Puleo. The story was copied many times and translated literally into

a lot of meanings and different practices. My statement: “the more people tells

the same story, the bigger the proportions of truth in it. For the purpose of my

findings, I here insert the full text found on YouTube and other publications on

the web.



100

4.4. The story goes

American doctor and leading natural healer dr. Joseph S. Puleo was, in his words,

incited during some mystical experiences to study the biblical book Numbers,

looking for the healing frequencies. Strange as it sounds, ultimately he discovered

six sound frequencies in the book of Numbers in chapter 7, verse 12-81.

The founded frequencies are 396 Hz, 417 Hz, 528 Hz, 639 Hz, 741 Hz, and 852

Hz. These frequencies are those of the old Solfege-scale. This scale was used in

Gregorian chant and Sanskrit chant as well.

4.5. Scientific proof after all?

It is widely spread on the internet the frequencies found by Puleo would have

healing qualities. The frequency of 528 Hz would have a special healing effect on

DNA. The frequency seems to influence water and light molecules positioned

inside and around the DNA-helix.

Glen Rein of the Quantum Biology Research Lab in New York has experimented

with in vitro DNA that was exposed to recordings of different musical styles. He

used a technique to transform music into scalar sound-waves. Using two counterphase,

self-extinguishing sources of the same music, scalar sound-waves were

created.

For these experiments, a cd-player, an amplifier and a spiral-shaped selfextinguishing

coil were used. Four musical styles were played near test-tubes

containing in vitro DNA. The absorption of UV light by test sample DNA was

measured after one hour.

Gregorian chant showed a 5,0% to 9,1% increase in UV light absorption as a consequence

of the unravelling of the DNA-helix.

Sanskrit chant caused an identical effect of 5,8% to 8,2%. Rock (0 - 1%) and

classical music (0 - 1,1%) had little or no effect. Glen Rein concluded that the



101

audible sound waves of the Solfeggio scale could cause resonance in DNA that

can have a healing effect.

4.6. Traduttore, traditore – translating is betraying

Every literary scholar, theologian and philosopher knows that translating is a result

of choices. Words have their origin and meaning. These can hardly translate

into another language in their full glory. Puleo’s revelation referred him to the

English King James Bible translation. There he would retrieve the lost frequencies

of Solfeggio. To me, as a Jew, it was crystal clear: it is impossible to find the

correct answers out of a translation. Hebrew is the original language of the Bible.

If a translation could contain something so special, shouldn’t the original language,

Hebrew, it deepens in the first degree? The verse numbers in the translating

is occasionally an artificial division. In the original language, it’s an unyielding

part of the text, with a special meaning.

So when we apply the fixed numerical structures of Hebrew linguistics, it seems

to be clear to me, the way to Hebrew scriptural language is the only possible way

to bring the centuries-long lost Israelite tuning system back to us so that we

would be able to restore the Israelite ancient Temple-music and other lost musical

phenomena. The healing power of music should have been well-known in the

Jewish history. So I started my research: the par course to a miracle with an attitude

full of expectation.

My working hypothesis

A music-theoretically, authentic and authoritative description about 528 Hz music

can only find a conveniently base on the Hebrew Scriptures, the texts with the

language of number values.



102

4.7. Personal experience

Listening to a 528 Hz sine-frequency using headphones for a long time, I not only

got a propensity for sickness and resistance but my opinion increased:

It can be dangerous to the brain and other functions, despite the plasticity of the

brain. Nevertheless, I opened my mind to that matter, because my interest was

woke up. The most problematic fact I saw, was the binaural beat, with systematically

two different frequencies in both ears with different frequencies in each ear.

Brain activity will subtract both frequencies from each other, so that very low

frequencies can reach - on a subliminal level - the cell structures in the system.

My ultimate interesting concerned the assertion of the effect on schizophrenic

people. They seem to react positively to 14 Hz frequencies, that can be reached

auditory through binaural beat-system. Neither regular nor complementary proof,

however, has to be found. Whether it is working as suggested, also depends on

the scientific approach to the etiologic-causal relationship between schizophrenia

and the gene expression and mutations of DNA.

4.8. Jewish medicine and musical communication

The cause of the research with a Jewish background indicates broadly. Jewish

traditional medicine and the Jewish leading position of medical education and

developments in Europe after the Middle Ages must get again the attention it deserves.

The mediating role of Judaism in Europe has not finished. Famous scholars of

Jewish origin make sure that Jewish scientific developments do not fall into

oblivion, not even after the Shoah.

The tension between conventional and complementary medicine can reconciled

by the actual Judaism combined with the old Jewish wisdom, together with oth-



103

erwise individuals of past and present. This new attention will bring us closer:

enrichment for conventional and complementary (medical) sciences.

4.9. Hebrew Tanakh, a matter of cultural renewal

Tanakh – the Hebrew Bible – in this research strips of the unjustified idea that it

is a religious book. This book should have nothing to contribute scientifically. On

the contrary, the connection between the recovering 528 Hz music, Jewish medicine

and Jewish linguistics, - the language with its fixed numerical structures -

makes Judaism an interlocutor of Sciences. Judaism seeks an equilibrium between

Mathematics, as the language of the natural sciences, and the numerical

“taxonomy” as the expression of the connection to the Source, the Source Code

of evolution as creation.

Acknowledgement of the limitations of human thought brings us together. With

this, the cause of my research is stipulated.



104

Chapter 5 - Motivation and choice of

Jewish Traditional Medicine (JTM) as

building block: accountability out of a Jewish mediative

approach

“The gift of Judaism is an understanding of what it means to be a human being—

what we can do, what we can hope for, how we can live with purpose, what is

expected of us. It is a celebration of human freedom, human possibility and human

responsibility. Judaism is a way to live a heroic life, to construct a life devoted

to values that are eternal, values of ultimate significance. The reward of a

Jewish life is walking the world with a profound faith that you matter, your life

matters, your dreams matter. I call this chutzpah”, rabbi Feinstein said in his

book “The Chutzpah Imperative”, our imperative as Jewish self-empowerment to

reshape our world.” 80

5.1 Introduction

A

lternative, integrative or complementary medicine has spread worldwide

and greatly influences developments in Western and Eastern

medicine and health care. 81 A glimpse at the field of alternative or

complementary medicine shows us its eastern character. Meditations and spiritu-

80 Feinman, rabbi Edward, The Chutzpah Imperative, Jewish Light Publishing, Introduction

81 Unlike the IBAM, I prefer the typology of complementary medicine, substantiated by the fundamental task of Judaism

to bridge the gap between people and systems, between evolution and nature and nurture, ergo: between the medical

sciences of East and West. More specifically: complementary medicine calls for free academic education and nonconventional

scientific research. At the end of my research I will recommend a free university training like that, with

fundamental possibilities for non-conventional scientific research – with bio-energetic Mindlink and Preventest and inauditory

528 Hz music transformed into sub-liminar, scalar waves and information as fundamental instruments. The

Academia Ars Vitae demands a quality of curriculum that is acceptable to the European Union and accredited by the

United Nations and European Accreditation Committee.



105

ality are frequently based on the eastern way of thinking and confer to many a

new sense for an existence that, on a western culturally parched soil came to a

spiritual and sometimes mental standstill.

We could conclude that the controversy in Western culture between complementary

medicine and regular, conventional medicine only consists of the conflict

between Eastern, spiritually oriented and Western, non-spiritually oriented sciences.

Jewish traditional medicine, through which the history of the Old People of Israel

resounds, did not come to an independent development as a systematic medicine

in European culture. However, as we shall see, Jewish scholars were of great service

to Western and Eastern medical sciences.

This research is not only about renewed attention for Jewish traditions, but above

all about the complexity of Jewish unifying influences within worldwide culture,

including medicine, to our time. This complexity can not do without Jewish selfcriticism.

Therefore, as an opening, a critical Jewish sound.

5.2 Jewish traditional medicine (JTM)

Jewish traditional medicine (JTM) is originally anchored in Torah, the teaching

of Israel. 82 Mainstream of this teaching was: “Let the Creative and re-creative

Light shine, whereby all nations can walk!” With this, the fallacy is annulled that

still nourishes anti-Semitism, viz. the alleged Jewish nationalism and particularism,

that in Jewish existence was replaced by universalism at the service of all

nations that shall walk by the Light of i.a. advancing medical-philosophical insights.

The still existing Germanic idea of Jewish world dominance is nullified by

82 Torah consists of the five first books of Tanakh, the Hebrew Bible.



106

the brilliance of the fundamental service that is commissioned to Jewish sciences

83 .

As I will justify below, Hebrew linguistics and the numerological logo-technical

research system of Hebrew language contained in traditional scriptures, demand

our natural-scientific analytical attention. The claim of Hebrew as language of

scientific transparency is made so powerful, that it puts the exclusivity of Latin as

language of medical sciences in the shade, in favour of Hebrew. 84

5.3. History

The “alpha-numeric” character of Hebrew language makes it possible to deepen

the semantics of “the story” by rewriting Torah-events in formula-shaped essentials,

through which the systematics of the numerical values and their formulas

become apparent.

In these systematics we meet Hebrew linguistics with its numerical formulas, and

mathematics as language of the natural sciences and culture. From a mutually

open and scientific attitude, they can compose an equilibrium.

83 The “Germanic Medicine”, developed and organised by dr. Gert Hamer, promotes the Jewish-medical conspiracy

theory, that would have pilfered the ‘mysteries’ of his carcinoma-therapy. His conviction is seemingly supported by a so

called Jewish travelling chief Rabbi who confirms this story. Every researcher deserves the protection of academic freedom,

but where “freedom” threaten human lives, such “freedom” must be combated with arguments and also be averted

within worldwide alternative medicine. Antisemitism can’t go together with trustworthy healthcare: darkness and light

can’t come together. After my cognizance of dr. Hamer’s unanimously rejected dissertation at the university of Tubingen,

I will leave no time unused to factually oppose his activity, which is based on fanatic anti-Semitism and is detrimental to

complementary medical developments. I already received the first fearsome threats, because of being a Jew. I informed the

CIDI (Centre of Information and Documentation Israel with my feelings of unsafety, by de mails I received from one of

Hamers fanatic supporters ). I can’t believe the name Germanic Medicine stands for a serieus medicine. This name is for

Jews emotionally connected with Mengele. Stop it, dr Hamer, because of your own soul and all the people which believe

your nonsens about my People. I am glad to be informed about former supporters of this suggestive movement, taking

distance from the Germanic Medicine. I can’t say something about the therapeutical subject matter of Hamers teaching. In

the near future I will hear some mor about. For the time being I am sure that such kind of practices will harm the alternative

medicine.

84 Of course this is purely hypothetical and meant to underline the importance of Hebrew language for worldwide culture.

Latin is, and may remain, the language of the medical sciences. It is a matter of communication within the field. And

Sanskrit will not have the need to rival Latin as scientific language either. However, the meaning of Latin concepts is not

holy; like the word “religious” in another reading has nothing to do with organised religion, but with the connectedness to

the Source of existence within the crystallized Universe.



107

No linguistic research is possible without a “story”. That also goes for numerological

logo-technics. To the analytical discourse of traditional Jewish medicine,

the Hebrew Tanakh is the “big story” that was robbed of its power by philosophical

postmodernism. We have lost the Word (the fundamental linguistic phenomenon

in semiological respect, not the religious, fundamentalist reference to the

Bible) and the fundamental communication connected with it. Only if we regain

the Word – the linguistic instrument that refers to a deeper meaning – we regain

the underlying proportional values, the essentials, that also render the natural sciences

a philosophical and clinical-hermeneutical widening of their comprehensive

horizon.

The numerological structure-number 528 will systematically constitute the semantic

key to understanding, explaining and hearing; the number in which we

meet the Source Code, “the root of Existence”, the Apex. In other words: number

528 is the hermeneutic key to the secret of Jewish linguistics and the transformation

of music therapy into music-communicative connectedness, based on

quantum physical wave-particle relations. Physicist Nikola Tesla’s transformational

technology plays a key role in this research for the benefit of innovative

energetic medicine, energetic-therapeutic treatments, and a special relationship

between modern bio-energetic-medical developments and historic traditional

Jewish medicine, with Mindlink-system as instrument of my research and practice.

5.4 Hebrew discourse relevant for systematic analysis,

for the benefit of an intermediary, integrative-energetic

medicine

For those who are not at home in Hebrew discourse and therefore do not know

the story views of Jewish traditions and experiences, it is advisable to read the



108

first 3 chapters of Tanakh, the Hebrew Bible – known in Christian culture as the

Old Testament - and keep the text at hand. Why would we involve Latin or Sanskrit

scriptures in our studies and scientific researches and omit a Hebrew text

that radiates with scholarship? The disqualification of the Hebrew bible as a religious

book, that does not seem appropriate for exact scientific ends, is the reason

why. I refer to this later. The Hebrew discourse does not contain a religion, but a

culture of living and surviving with its own ethics; a non-dogmatic practice that

keeps Judaism far from a dogmatic religion, even though ultraorthodox, orthodox

and even more liberalised groups speak another language, whereby Judaism is

wrongfully called the oldest monotheistic religion. 85

Of course there is a structured worship of the Existing, the imageless Name. This

worship is rooted in human (Jewish) self-consciousness, that induces an attitude

of humility towards the Name that exceeds our cognition. Torah is its book. In

my research I will demonstrate how profound and scientifically exact this Hebrew

textual Way is, without falling into a theological or religious discourse.

It is about the investigation and description of Hebrew-scientific core values to

the benefit of a medical philosophy, as an attempt to achieve a shift of paradigm

that provides space for the union of the deep truths that originated within human

history and that can be traced back to the relationship to the Source.

My research is about “tracking the core of life”, a quest for the mystery that is

not based upon an incomprehensible enigma, but on facts that challenge and expose

our human limitations. French philosopher Lyotard says: “G’d disappeared

85 Why IMHO Judaism isn’t called a monotheistic dogmatic religion? Historically the term monotheistic is an original

Greek term, with an image of G’d that can’t correspondent with the Jewish service of YHWH. Relgion is not similar with

“adore, celebrate and serve (ethical) Adonai Echad, the Only One” c.f. observing Torah, with its very special celebration

and ethical practices. It seems to me the Greek terminology conflicts with the Jewish vision on YHWH and the vision of

YHWH on Jewry.

I am not sure, but I can’t imagine that our rabbi’s has chosen for a Greek terminology for Judaism. Moreover the term

“oldest of the three monotheistic religions” can’t also be a Jewish initiative, because of the prohibit of syncretism. Concluding:

Judaism is serving attitude to the G’d of Israel, just the opposite of the dogmatic religions as christianity and

islamic religion. It is not a matter of Jewish nationalistic feelings, but of the special connection with G’d and a private

service (celebrating Shabbat etc.), with an universalist assigment in the world (tikkoen olam). This a short explanation on

my statement: IMO, Judaism can’t be a monotheistic religion.



109

without leaving a trace”. The only traces of G’d as Creator, we find in language

as the source of human encounter: tracking on the linguistic razor’s edge. No

language lends itself to that with so much power as the Hebrew language. No

discourse is so powerful as the Hebrew, to be found narratively and analytically

within the Tanakh, the book of Nature and Nurture, in an unbreakable connection

to the Source. In this way, language becomes reality, but unlike the outdated

views of the Wiener Kreis and their Wissenschaftliche Weltauffassung (1929),

nowadays called “logical positivism” with an exclusive worldview. 86

These bold claims in a Prolegomena demand strong substantiation. That shall be

supplied and justified towards the universal fellowship of man, for which we are

responsible from our Jewish mission to the world.

5.5 Core of the Jewish-intermediary medical discourse

Torah: “G’d spoke to Moshe and the people in the desert: “... for I, the Eternal,

am your physician.”

The doctor was not unknown within the old Israel. The later Talmudic 87 tradition

points the doctor to his fundamental connection with Ha-Shem, the Name, the

86 At this time all kinds of movements developed, and philosophies and world views opposed or complemented each

other. Antisemitism took massive form when Hitler wrote Mein Kampf and his fascist ideology rapidly gained ground.

Logical positivism, the critical movement of 1925-1935 with names like Carnap, seems to have been slain by Popper’s

falsification method. However, logic seems an indestructible principle within Western thinking and within the natural

sciences, which are linked to Western medical sciences. But neither logic, nor positivism have been able to give the conclusive

answers. Their adherents have had to transfer their desire for proof to Max Plank and Einstein and his relativity,

that paved the way for Niels Bohr and the probability principle of Werner Weisenberg, together with quantum physicists

from beginning to present. Newton had apparently lost favour, but medical education still demonstrates his great power of

expression. Music-communication and –therapy can’t come around this quantum physical informatics either, as we shall

demonstrate by means of Mindlink- and Preventest diagnostics and treatment.

87 Two Talmudiem constitute the codex of classical, rabbinical Judaism, the oral tradition and precipitation of the permanent

process of understanding, explaining and hearing of Jewish culture and spirituality, with an inescapable mission to

humanity and creation, in the positive conviction that the world will recover, like the Creating Authority probably will

have intended: justice and acceptance of the Other.



110

G’d of Israel. 88 Jewish traditional medicine knew a pharmacology consisting of

natural medication, that was prescribed after diagnosing.

5.5.1. Doctor, mediator of creative power

The three-way system of “Creator –doctor – creation” is the basis of systematic

Jewish traditional medicine. From this triad, the doctor approaches

the patient. In the healing process the doctor is the first personification of

the Transcendent: the Name – Ha-Shem – that says to be our Physician.

The doctor thereby has an intermediate position between G’d and the diseased.

That means that the doctor, as part of his expertise, fosters the connectedness

between G’d and patient, diagnoses in a skilled way, and thereby

makes use of Nature, the second personification of the Transcendent.

With this, the basic three-way system “Transcendent – doctor – nature” is

mapped out. Doctors that sever these systematics, take credit for healing for

themselves, and release the representative position of the Transcendent Energysource,

receive no good and respectable words in Jewish tradition, because they

have severed the basic pattern of the healing relationship between Apex, the Energetic

Source, and humans.

There are many causes to be designated for the break in systematic Jewish medicine

some centuries before the common era. I mention two of them:

88 The presence of the Name in the evolution as creation will be partly described from the work of Lacan. Klein and Bion

in the early period and the work of prof. dr. Bea van den Bergh in Tilburg, chairman of the European study commission on

“fetal programming”. Their work takes a hermeneutical-relevant place from the considerations with the occurrence of

evolution as creation. I refer to the imaginary and symbolic order (Lacan’s psychoanalysis) and the projective identification

in Klein’s psychoanalysis, worked through by her student Bion, who widens the hermeneutical horizon to the Being of

all being with his container/contained-model. The verb linking and the Third Present constitute the technical terms for a

conditioned symbolic universe. These principles direct our attention to the presence of universal preliminary-psychotic,

pre-pathological elements from the ultimate beginning of Being.



111

1. the growing influence of Aristotle’s autonomy of the body alongside the

soul, that seems to ask for its own therapy

2. the changing view of Judaism as a religion since the Enlightenment: the

metaphysical as God’s secluded domain, alongside the physical as the domain

of autonomous man. The break in these systematics echoes on to our

time. Because this study is not about theology, but about the philosophical

and practical approach to medicine, two Jewish scholars determine the vision

on G’d, Nature and Cosmos: Spinoza and Einstein.

Modern Western medical systematics, based on mathematics and physics,

like Jewish traditional medicine, has a three-way system for the doctor as a

physician.

5.6 Triad of modern medicine:

sick man, medical technology and pharmacy

Because of the universal connectedness with the Source, nobody is able to disrupt

the medical-intermediary system, even though the atheistic scientist believes to

have severed the connection with the Transcendent and raised medicine to an

“independent science”.

Because of anti-Semitic prosecutions and pogroms, the rich Hebrew language and

tradition did not determine the respected foundation and practice of medicine in

Western culture, despite their cultural export possibilities prior to Hellenism, but

Latin as the language of church and culture within the Occident. Analysis of the

Latin semantic concepts doctor and physician places the fundamentally intermediary

position of doctor and medicine in the focal point of our research. We will

shortly consider both concepts.



112

5.6.1 Doctor and physician

Latin has two concepts for healing: mederi and sanare. “Mederi” is a deponent

verb: a passive verb that still has an active meaning. In this we recognise

the doctor as the physician, the mediator, who depends on medical

technology and medication for the practice of his knowledge.

In “sanare” we recognise the referral to Sanskrit, where “san” means

“wholeness”. This san is associated with the Latin “sanctus”, which means

holy, with the basic meaning of: making whole. Here we arrive directly at

the doctor as a healer.

How can we add “being whole and being healed” to a science that proclaims its

own wisdom without connectedness to the Ultimate Source, and puts this into

medical practice autonomously?

The Western physician too, on the basis of universal pre-Christian (read: Hebrew)

and pre-scientific Jewish systematics, has the task of mediating between the

Source and 1. his own medical-academic knowledge, 2. the diseased and 3. the

selected pharmaceutical, surgical and/or psycho-therapeutic c.q. psychiatric

treatment.

However, partly because of the supremacy of religiousness and of pharmacy, today

mediation between doctor and Source is so diluted, that “the physician as a

mediator” is hardly seen any more. Body and soul have become two disciplines

because of Descartes’s philosophy, against which Spinoza much defended himself,

in favour of the absolute Unity of the Creating Substance.

Modern Western medicine not only lost the fundamental mediation with the

Transcendent, the Creating Authority, it also robbed the fundamental mediation

with Nature, as a personification of the Transcendental Power, the Source of our

healing, of its “ultimate concern”-position. Reason? Not knowing the Source

Code, the Apex!



113

5.7 A modern patient system as a result of 1.6

The modern medical system consists of the triad:

1. medical education/specialisation,

2. medical technology and

3. pharmacology, with the object: the diseased as “patient system”.

Some structural equations between Tradition and Modernity:

Jewish traditional medicine (JTM) is a fundamental-systematic medicine:

5.7.1. Transcendent (basis) – 2. doctor – 3. nature

JTM is system related to Traditional Oriental Medicine (TOM):

5.7.2. Transcendent (basis) - 2. doctor – 3. nature

modern medicine is a systematic-conventional medicine:

5.7.3. Education and specialisation (basis) – 2. doctor/specialist – 3. technology

and pharmacology.

If we want to connect the systems 5.7.1 and 5.7.2 with system 5.7.3, we observe a

fundamental gap that can neither be closed nor bridged without a shift of paradigm.

This dissertation is an attempt to develop a medical-clinical philosophy

that can prepare a shift of paradigm and new research by a not-commonplace

method and methodology of Hebrew foundations. 89

89 When do we justly speak of a necessary shift of paradigm, says Kuhn? When the existing situation has no chance to

persist, because revision is not possible and therefore radical and new ways must be taken. This study aims at a mutual

recognition and acceptance of diverged medical care worldwide, in which craftsmanship is developed in a free, universityscientific

way in the permanent exchange of experience, including an end to the subject-object-relationship and room for a

new, clinical-hermeneutical subject-subject-relationship. East and West embrace each other in the acknowledgement of the

responsibility and return to the natural man, freed from the clamping “struggle for life”, in a new scientific, holistic conviction

about the “natural unity of man and mankind”; man as a whole of 50 billion cooperating cells, and the individual

unique human as actualised cell of cooperating humanity, that also takes responsibility for the total creation for the environment

and its influences.



114

5.8 Medicine from tradition to relativity and quantum

physics

Because Jewish scholars have greatly influenced scientific developments in the

European culture of past and present, it is a challenge to put the values of the

medical systems under the Jewish-fundamental and numerical logo-technical microscope,

as an attempt to connect traditional medicine and modern medical technology.

For that, it is necessary to take the most fundamental element out of the

three systems mentioned and to study it, in order to strive for an equilibrium between

modern science, Hebrew linguistic structures and the architecture of

Tanakh. 90

The Ultimate Element of all medical systems mentioned is expressis verbis the

connection with the Transcendent, that remained the Always-present, ‘the Source

or Apex of the Universe for all people’ during the period of the Darwinist Coincidence,

the atheistic denial of the teleological Anthropic Principle, the Creating

Authority, or Substance (Spinoza) within Western sciences, and the often notscientifically

tested spiritual assertions in Eastern medicine. The task of contemporary

Judaism, with its conviction of the multicolour Presence in our world, is to

restore the recognition and acknowledgement of the connection (ligand) to the

Transcendent as Apex (re-ligare), despite the seemingly indestructible anti-

Semitism. If we, as Jews, individually and collectively define our task as an imperative,

averse to permissiveness, the world will soon change into an oasis of

peace, from which iniquity has disappeared and love reigns. But when will that

happen?

90 Tanakh is the Hebrew Bible, that in Christianity was turned into the Old Testament on the basis of the Greek translation

of Hebrew and several supplements.



115

5.8.1 Music as a syntactical, communicative and

therapeutic phenomenon

Music has an important instrumental function for this fundamental change,

as shall be ascertained in my description and research. Music based on

A=444 91 with 528 Hz basic tuning, through Hebrew will be found to possess

a universal connection (ligand) to the Creating Energy Source, through

which healing, curing and cellular connectedness to the Source, fellow man,

nature and cultures can be created. 92 528 Hz Music, as central recreating

basic tuning, relates to 528 nanometer (nm) green light, with the rainbow as

the sevenfold visible light and the heart of the broad magnetic spectrum.

The heart of the rainbow is the 528 nm green light. Obviously, we meet

with a special core in nature here. 93

On YouTube, we find masses of 528 Hz music, the frequency of the heart and of

love, that can even cure DNA-deficiencies, as is claimed there without a basis of

thorough scientific research. Searching for substantiation, I met with a religious

story that apparently appeals to the imagination so much, that it serves as evidence

for many a person. I can only conclude that the usual research error is

made here: quantity guarantees quality, so it becomes a truth principle. Literature

from this line indicates the “fitting for its own purposes” of the supposed truth.

From my point of view and open attitude, partly due to my Jewish way of thinking,

we need the Hebrew syntax, semiotics and semantics to be able to substantiate

it all scientifically. Why is that? Because Hebrew language and tradition is the

91 Good tuning opposite the current A=440 in our time.

92 In anticipation of a critical consideration of the 528 Hz supply on YouTube I admonish to enormous caution regarding

statements like “healing of defect DNA-sequences” without bio-scientific research and substantiation.

93 Correcting factors will have to be calculated, should there be a question of a purely physical relationship between 528

Hz and 528 Nm.



116

oldest living language, that can reveal to us many cultural historic and evolutionary

facts and can renew our thinking. Through numeric logo-technics we reveal

the basic architecture of text, communication, location in creation, and the Source

and root (Apex) of creation, with the objective to find absolute unity. For that, the

deep meaning of number 1 is needed, the number that so escaped our attention.

Number 1 is the Aleph in Hebrew, the number of Absolute Unity. The Good

Book of Judaism begins with the character that has the numerical value 2, whereby

we apparently must search and find the secret of Life behind our noetic reality,

in order to visualise again the Aleph = 1 as the basis and beginning of “all as energy”,

and bring the course of the natural sciences within the channel of the

Aleph (the Aleph Quantum field).

5.9 Infinite No-Thing, or Ein Sof (Hebrew)

The view on God and his capacity is an individual religious answer to the universal

Existence, the Being of all natural beings, and is of interest to the first and last

questions of life and death. These theological questions are outside the scope of

this medical-philosophical research. Our philosophical study focuses on the Infinite

No-Thing as the Evolutionary creative Authority related to cosmos, nature

and culture.

5.9.1 Basic formula a = √1 = 1

The Infinite No-Thing 94 in this study is indicated with the Hebrew letter

Aleph, the first of the Hebrew alphabet, with the numerical value of 1: a =

94 The best understanding is derived from the English nothing, that is an abstraction as “nothing” but becomes concrete as

“no-thing”. Everything is finite and therefore it would be a contradictio in terminis if we talked about an “infinite notsomething”.

With this, our cognition is directly brought into debate.



117

aleph = 1, the expression of Absolute Unity. We connect this to mathematics

by the logo-technical basic formula a = √1 = 1.

To the mathematician Cantor, the a was the possibility to specify cardinal numbers

for his set theory. The harsh criticism on this set theory does not eliminate

the importance of this a. Its pivotal function permeates the whole research, on its

way to the definite recognition of Ein Sof and the Source Code as Apex.

The criticism was that Cantor insufficiently explained the concept of “set”. The

renewed definition of “set” is: “the sum of phenomena with the same basic characteristics”.

These phenomena can be regarded as an actualisation of the potentiality

that cultivates a partnership between nature and nurture; phenomena with

the same basic characteristics that originated from the a. With this, I join the critics

of Cantor’s set theory.

If we want to express the Absolute Unity in line of the set theory, the entire cosmos

consists of phenomena with the same basic characteristics. These characteristics

numerically and creative-energetically pull together in a = 1 and stay that

way, because the formula for the Absolute Unity is a = √1 = 1.

In Hebrew, 0 does not exist. To Hebrew arithmetic, 1 is the basic value and ultimate

reference. That effects the quantum-physical vacuum that is not found to be

‘empty’. Returning to 1 and other numerical values of Tanakh makes it possible

to reunite natural-scientific and Eastern-philosophical systems, as integrative

medicine, with the ultimate Source, as traditional Jewish medicine and traditional

Eastern medicine have shown us, but which in the West were silenced by logic

and empiricist methodology.

5.10 Cellular religion

To end all doubts about the non-religious influences within this medicalphilosophical

research, I take you to the cell membrane of a random cell, with



118

receptor and ligand, i.a. researched by dr. Candace Pert. 95 With a good “match”

the ligand enters the receptor and starts a nucleus connection. The connecting

activity is connected to the ligand. In Latin, ligand is a noun related to the verb

“ligare”, meaning “to connect”. Deviating from the common referral to the Latin

“religio” for religion, I choose “re-ligare”, meaning re-ligion as: re-connecting. 96

Maybe the ligand on the cell membrane is the most adequate expanding external

connecting instrument of the Creating Authority, that on the cell wall, connected

to this Source, provides new creativity and stimulates the self-healing capacity

inside the cell, expanding to our complex life as multicellular creatures to the

healing of our organs and functions, including positive psycho-mental effects. In

this research, music is the main instrument.

Through the cellular “receptor-ligand”-relationship, no man is excluded from the

connectedness with the Source. Partly on these grounds, I come to the theorem:

“evolutionary, every man is a homo religiosus, a creature that is symbiotically

connected to the other, and that is able to connect itself to the Creating Authority

through Nature and Nurture: with reference to the Jewish philosopher Baruch de

Spinoza. 97 The importance of Spinoza’s thinking for our modern time can not be

overestimated. His criticism of the Judaism of his time met him dearly: he was

banished from Judaism for life. The greatness of this thinker did not suffer from

his troublesome existence, and in this study we follow his thinking and interweave

important turns in new forms of contemporary dynamic changes.

95 Pert, dr. Candace Molecules of Emotion

96 Reconnecting (re-ligare) is the activity that propels life to the symbolic order of the third, the Father, or the language

and culture in which the creating phenomena connected to the Source come to fruition. When this connection is seemingly

severed, which in my view is not possible, man can again connect to the Source to become a renewed homo religiosus,

which starts at the cellular level.

97 Homo religiosus iives as a non-mutualistic altruistic creature that serves the other without wanting to benefit itself. He

is shaped by two symbionts: a genetic and a cultural symbiont. That is the evolutionary basis of righteousness that belongs

to the human condition. This contradicts the Darwinist struggle for life, and the one who gives the overtone to these ethics,

seeks out another evolutionistic model, for instance De Lamarck’s and the Hebrew Torah.



119

5.10.1 Spinoza and the Field-theory

Spinoza’s actuality was recently described by Jonathan Bennett in his book

A Study of Spinoza’s Ethics. 98 In Ethica, one of his principal works, he envisions

field metaphysics that could correspond to modern quantum field

theory. That makes his philosophy, based on fundamental unity (that ends

Descartes’s duality), so important. Religion, philosophy and natural sciences

in his thinking are united, making him far ahead of his time, if Bennett’s

research is valid. 99

Precisely field theories can give us a view on the origin of all existence and

provide a basis for a Theory about Everything, which Einstein and many

others have sought and still seek. In this research, by semiotic and logotechnical

analysis of the Hebrew language and of Tanakh, it will become

clear how determinative the Creating Authority – a = √1 = 1 – is in this

search for a specific field theory.

It will also be demonstrated that music therapy is no exception to this within

field theory, partly through fieldwork with Mindlink-technology.

5.11 Music therapy, internal-consciousness dialectics and

the unconscious

Music therapy is defined in different ways: 1. medical-therapeutic support for

healing, recovery and empowerment. 2. intra- and intercellular energetic con-

98 Jonathan Bennett, A Study of Spinoza’s Ethics, Hackett Publishing Company, United States of America, first edition,

second printing, 1988, passim.

99 “One of these interpretations is Jonathan Bennett’s. In his book A Study of Spinoza’s Ethics 1 he states that Spinoza puts

forward a form of field metaphysics that would resemble modern quantum field theory.” (quote of Lotje and Clazina

Wansbeek in the student magazine Physics and philosophy.} Lotje Wansbeek as a PhD student researches the breach of

left-right symmetry on sub-atomic level at the Nuclear Accelerator Institute. Clazina Wansbeek studies philosophy and

mathematics at the RUG.



120

sciousness dialectics. Music therapy as consciousness dialectics requires specific

research and description, because the dialogue with the unconscious, implemented

with the Tesla-technological Mindlink-Preventest System, is a universal system,

that is deployed diagnostically and therapy supportive for all differential

clinical systems, including Eastern and Western music therapy.

5.12. Definition of “unconsciousness”

In literature, there is a plurality of definitions of the concept “unconsciousness”. I

restrict myself to the definition that strengthens the link to the “interconsciousness”

and enlarges the opening to the dialectical approach.

The theory developed here and the research practice

originated from it confirmed that, because of causal

links, the unconsciousness is interpreted most relevantly

as “phenomenological memory of experiences”.

For the aetiology of symptoms, it is important to

research the first experience in prenatal development.

Amongst the research about Foetal programming and

Maternal-Foetal-Distortion-syndrome (MDF) we must

search for the start of the experience and the cellular

and cerebral memory storage in the primary phase of

the embryonic stage, to develop into a dynamic complex from which different

kinds of neuro-networks can develop and distortions in cellular and organic homeostasis

are possible. Different physical and psychological reactions are the



121

subject of broad research. 100 The Tesla-technological Mindlink-system can start

the dialogue with the inter-consciousness at the pre-cerebral embryonic stage in

which the limbic system temporarily provides for the experience. Over the entire

length of the brainstem the formatio recticularis is located, a network of cells that

is partly responsible for consciousness. 101 Could this not be the mechanic beginning

of the “phenomenological memory of experiences”?

HPA-axis deficiency contributes to rudimentary insecurity developments and

postnatal attachment behaviour. Insecurity, fundamental uncertainty and concentration

disorders diagnostically are in line. In many cases that takes us to the rudimentary

experiences in the first trimester of the prenatal period. For the therapy

of the “memory of experience”, the unconsciousness, a dialogical electro-genetic

system is needed that brings to homeostasis the disbalance of the primary experience

by measuring the negative energetic load and the use of the necessary positive

energetic counter-information. This fundamentally supports active and receptive

music therapy. One of the following parts is concerned with this.

Probing sound bowls, bells and other relaxing and stimulating aspects of music

therapy prove to bounce off Freudian and biochemical, cellular defence mechanisms,

antagonists in cells, as unconscious blockades, or – epistemologically – as

pseudo self-defensive programming convictions, whereby the etiologic and development

causality, the real cause of diseases and complaints, is not reached, and

gets bogged in symptom management and behaviour-modification systems.

100 Speirs et.al. “Ontogeny of glutocortico receptor and 11β-hydroxysteroid dehydrogenase type-1 gene expression identifies

potential critical periods of glucocorticoid during development”, Molecular Medicine Centre, Edinburgh: “Multiple

studies associate low birth weight with a substantially increased risk of cardiovascular and metabolical disorders in adult

life...”. Journal of Endocrinology, 2004, 181, 105-116. We will repeat this article when discussing fetal programming and

MDF-syndrome.

101 Myelinisation is the process through which white substance is made. It is often used as an index of the ripening of the

brain. Myelinisation starts after birth and is only fully completed in late adolescence (about 18 years).



122

Therefore general and neurological music therapy greatly benefits from the addition

of energetic-technological dialogue as interference with the unconsciousness,

to be able to count on healing and well-founded change, without being condemned

to unexpected and often final stagnation because of the power of the existing

defence mechanisms. 102 It seems as if modern Western medicine made a

panacea out of its final conclusion: “learning to deal with complaints”. When

music therapy is combined with additional diagnostic and treatment applications

of energetic Mindlink-test, which is aimed at intra- and intercellular homeostasis,

it is enriched from a value-based to an evidence-based therapy, because of the

purely scientific substantiation of these systems, and because of the standardised

scientific research that was conducted in the context of this dissertation and that

meets the criteria of Western scientific requirements: double blind and randomised,

repeatable and methodologically falsifiable. Criticism on systematic repeatability

I have summarised in the footnote. 103

5.13. Definition according to the Dutch Association for

Music therapy

Music therapy is a methodical type of assistance, in which musical means are

used within a therapeutic relationship to effectuate change, development, stabilisation

or acceptance in the emotional, behavioural, cognitive, social or physical

realm.

102 See Anna Freud’s “Defence mechanisms”.

103 Methodological criticism on the necessary “repeatability” of the research can’t be omitted with a changed image of

man: man built from 70 billion cooperating cells, each with its own energy-management and frequency-responses. This

produces a dynamic image of man that answers to quantum physics more than it does to the classical Newtonian image of

man. Meantime we know that the structures of the system permanently change. As the idea of “repeatability” is only

possible with a static image of man, it is not a relevant criterion for the quantum physical image of man and it leads to

outdated methodology.



123

5.13.1 Music therapy in India

Music is an age-old part of Ayurveda; the Holistic Healing and Wellness

Science that promotes optimal health and general well-being. Music has

been an integral part of the Indian Culture. Music has an important place in

the Vedas too! The 'Samveda' is essentially about music.

Ayurveda contends that the three doshas: Vata, Pitta and Kapha can be

regulated and balanced effectively by Music Therapy. Healing through music,

in fact, had been successfully attempted by Great Indian Composers in

the yesteryear. Legend has it that Classical Music Maestro Thyagaraja

brought a dead person back to life through his musical compositions.

Millenias later, Modern Science is now rediscovering the power of music

and its use in healing. The specialized use of music in treating people with

special needs in mental and physical health, rehabilitation and special edu-



124

cation is only gaining ground now. More and more researches are being

conducted on music now and more and more revelations are being made. 104

Music therapy is the clinical and evidence-based use of musical intervention

to accomplish individualized goals within a therapeutic relationship by

an accredited professional, who has completed an approved music therapy

program. Music therapy is an established health profession in which music

is used within a therapeutic relationship to address physical, emotional,

cognitive, and social needs of individuals. After assessing the strengths and

needs of each client, the qualified music therapist provides the indicated

treatment including creating, singing, moving and/or listening to music.

Through musical involvement in the therapeutic context, clients' abilities

are strengthened and transferred to other areas of their lives. Music therapy

also provides avenues for communication that can be helpful to those who

find it difficult to express themselves in words. Research in music therapy

supports its effectiveness in many areas such as: overall physical rehabilitation

and facilitating movement, increasing people's motivation to become

engaged in their treatment, providing emotional support for clients and their

families, and providing an outlet for expression of feelings. 105 Music therapy

is based on the understanding that the ability to respond to music is an

inborn quality of all human beings. This ability usually remains unimpaired

by impairments, injury or illness and is not dependent on musical training.

104 Inage and quote of www.keralaayurveda.biz

105 American Music Therapy Association (musictherapy.org 2011)



125

5.14 Hypothetic-deductive method

Who, as a Jew, says Torah and/or Tanakh (Hebrew Bible), says: “Scientists, research

the wonderful laws of nature to your heart’s content, but begin at the beginning

(deduction), instead of focussing on the end that does not come into view

(reduction)”. 106 In that way, the Hebrew Bible is not a Jewish faith book, but a

Universal Book of Pure Knowledge. How “pure knowledge” enriches scientific

knowledge, is one of the main lines in this research. In short: the beginning of all

knowledge and science is the universally accepted Presence and knowledge of the

Creating Authority (Substance c.f. Spinoza), the a = aleph = 1, the expression of

the Absolute Unity that can be broken just as little as the formula a = √1 = 1.

This study’s methodology is the hypothetic-deductive method, the method that

starts with the absence of the a = √1 = 1 at the beginning of the Hebrew bible; the

opening verse that in my opinion, through an incorrect translation, has caused

much misery and strife and disastrously blurred the Bible as an incitement for

scientists and for scientific research on nature and nurture.

However, who says Bible c.q. Torah respectfully, says Life from beginning to

end and return to beginning, including the wonder of scientists. To every scientist

and man of whatever capacity I would like to say, on the basis of the hypotheticdeductive

method and as a parody to the words of the former presidential candidate

Clinton to Busch sr. “It’s the economy, stupid.”:

“Discover the scientific Torah, because it’s the Aleph (a = √1 = 1), stupid.”

106 Psalm 111



126

Chapter 6 - Jewish traditional medicine

(JTM) in history - Relationship modern

Western medicine and Traditional Oriental

Medicine (TOM) 107

“The basic principle of all principles and the foundation of

all wisdom is to know that there is a Primary Being

who brought into being all existence...

The reality of the Primary Being is arrived at in two ways,

through reason and through tradition”. 108

Mozes Maimonides

famous Jewish Medieval court physician in Egypt

107 TCM stands for traditional Chinese medicine. TCM has had a model function in South-East Asia and India, and can

be extended to traditional Oriental medicine because of its conformity in basic principles and medical practice. In this

study we regard TOM as fully and purely scientific. The conformity between JTM, TOM and modern Western medicine

is: firstly the conventionalism: each system defends itself and clings to acquisitions. Secondly the requirements for scientific

research: it must be implemented double blind and randomised and be “repeatable”. I put repeatable between quotes

because this can systematically be haggled over. All types of medicine and therapeutic practices that do not meet these

requirements and therefore are “pseudo-scientific”, are not relevant to this study.

With this, no qualitative judgment is given of the results of systems that are not defined as scientific. This dissertation

disregards positive or negative effects of medical or therapeutic practice of which results must be attributed to “unknown

possibilities”. That complaints are in remission for some time and return later, can neither be part of a value judgment, nor

of the definition of scientific. The discrepancy between “evidence based medicine” and “value based medicine” after

critical natural-scientific research, proves to be an artificial distinction in Western psychiatrics. I refer to the discussion

about the DSM V (2013) and commission Kupfer’s report in 2002 – by order of the American Psychiatrist Association

(ASA) - that demonstrated that no natural-scientific evidence could be provided for any psychiatric disease mentioned in

DSM IV. Therefore the term “evidence based medicine” is inappropriate for every psychiatric disease and only the term

“value based medicine” is justified. With this, the loud call of genetic determinism should be silenced. No schizophreniagene

was found. And even if it was, no evidence is provided that this genetic preoccupation caused the outbreak of the

disease. As I will demonstrate, connected to i.a. dr. Bruce Lipton’s new cell biology, environmental factors activate the

production of protein within the genetic arsenal. Quick conclusion: the gap between the West, JTM and TOM is smaller

than we presumed. The pertinacity is mostly in conventionalism as a defence mechanism. Where my research tapped the

deeper defence layers, it became clear that Darwinist evolution, with its struggle for life and adaptive survival programs, is

no longer tenable. No “standing up for yourself” at the expense of the “other” as a threat to your genes, but fruitful cooperation,

as the clustering of single-celled from which we too originated, has shown us. With this I have provided sufficient

opening for the view from which I conducted the research, the conclusions we will draw and the deriving recommendations

for university education and research.

108 Mainonides Mishneh Torah Introduction.



127

6.1 introduction

J

udaism is neither only a religion nor only a culture, but a complex way of

Truth through science and tradition. Truth is found when science and tradition

have reached an ultimate unity. Then the creating Substance is fully

actualised as “potentiality in Being”. Jewish scientists too will have to be aware

of this Way and of our service to world society and, with all scientists of whatever

(religious) tradition, go the way that leads to holistic unity, through which Aristotle’s

entelecheia becomes real, the unity of Buddhist ideals is achieved, and

the unity core of the Name YHWH for the world is realised through Judaism,

creatio continua, evolution as creation. Then men have transcended their evolutionary

mammal biology to indestructible true humanity. 109 In humanity,

knowledge and tradition not only found and embraced each other, but will be

assimilated into a unity in the future.

Hebrew language and tradition, apart from the Jewish universal mission to be a

co-creator of nature and culture, lend themselves very well to a dialectical relation

to natural- and other sciences. Hence my fundamental effort to again bring to

the attention of the sciences and of Judaism itself, the power of Judaism as it has

shown itself through the ages, as regards natural-scientific developments on the

way to the Theory about Everything and the universal, healing, energetic power

for sick people within world society from the new connectedness to the Source

(medical and psychological paradigm). This is the first way of knowledge.

109 Evolutionary, humanity consists of non-mutualistic altruism, the basis of the development of morals. Therefore,

morals are not a phenomenon depending on dogmatic, organised religion. Religious statements about morals not seldom

have a doctrinal character, with historical clash of arms to maintain these doctrines. Every man is approachable on moral

conduct, that is: individual action, taking responsibility for society, and the pure availability for the weak and the strangers

in society. By mutualistic altruism we mean the predecessor of the next development in the stages of human civilisation: if

I do something for you when you need me, then you do something for me when I need you. Morals gradually ennobled to:

disinterested solidarity, community spirit and neighbourly love.



128

The second way of tradition can in principle be disclosed by every belief or philosophy,

unless the permanently active Source of renewing, recreating energy is

left. Science then has created an autonomy that has cut itself loose from its roots;

Nietzsche already warned for this in Der Tolle Mensch, in which he says: “Who

holds the sponge that can erase this debt of ours? We have killed God and his

blood still sticks to our knives”. 110

However, Jewish tradition connects unbreakably to what is pursued within the

first way of “knowledge from the Source”. The relativity of human knowledge

has achieved high flight in beta sciences, in conjunction with Jewish ethics: care

for the weak and the strangers, the exploited and afflicted people in the world.

My scientific choice, which is governed by Torah and Emanuel Levinas’s

(1905(6) – 1995) philosophy of Responsibility also has a personal component

because of my being a Jew.

Maimonides (1138-1204)

I conduct my research from the double disposition of scientific knowledge, connected

to the universal Source which is available to all people, and was articulated

in Jewish tradition. There is no question of filling this scientific research with

Jewish or other religiousness, because we are primarily concerned with the first

disposition: scientific knowledge, however built from fundamental knowledge

anchored in Jewish tradition, which is obviously available to the sciences. We

join with the Jewish physician Maimonides, one of the most authoritative physicians

of the 12e century of our era, who initiated this scientifically passable two

way-approach.

Maimonides: “The basic principle of all principles and the foundation of all wisdom

is to know that there is a Primary Being who brought into being all exist-

110 Der Tolle Mensch, Gesammelte Werke 1996.



129

ence. The reality of the Primary Being is arrived at in two ways, through reason

and through tradition “.

We will start with the theorem that Jewish traditional medicine was a part of

medicine in the old Middle-East, with Mesopotamia as the core source of

knowledge. Within this study Judaism comes to its full justice as civilised nation

with its own ethical, liturgical and educational life practice. As will become clear

below, Judaism is not a religion, but an ethical based, unconditional service to the

Creator, with an ultimate responsibility for fellow man and creation as nature and

nurture. Judaism has its own Good Book, Torah, historically written and expanded

to Tanakh 111 , the Hebrew Bible, supplemented by Oral Torah. Tanakh was

modified and renamed Old Testament by Christianity. Qu’ran is also – in the

Jewish view corrupted - based on Jewish Torah. It is not very difficult to indicate

ancient Hebrew legends in other philosophies and religions, through which the

universality of Judaism ideally overcame nationalistic limitations and narrow

inner circles, even though it will still take a lot of time before Jewish community

itself again will be aware of the mission for unity and humanity.

In short: humanity, scattered on earth, largely has a direct or indirect connection

to the Hebrew Tanakh as a source of knowledge and culture. I can only connect

this source to the Creating Instance, the Creator of all men, that in Jewish tradition

is indicated with YHWH. Alongside this Four-letter name, the Tetragrammaton

that we as Jews do not pronounce, but call Always-present, Eternal or Adonai,

we know two more indications of the Creating Instance: 1. Ein Sof, the Infinite

No-Thing and 2. Elohiem, the G’d of all nations, that probably was widely

known in the ancient Semitic world as El.

111 Der Tolle Mensch, Gesammelte Werke 1996.



130

Ein Sof, Elohiem and YHWH, as an Absolute unity, constitute the Ultimate Core

for the evolution of creation and culture. In this research they are indicated nontheologically

as G’d. 112 When in this study I speak of G’d, he/she/it is the philosophical

“You” of the Transcendent and the Immanent, a non-sexist and anthropomorphic

indication as he, she or it, with which we refer to the Source. 113

In this study, they are present as Supporting Instances, Sources of Creative energy,

that have everything to do with medicine, therapy and coaching.

In this respect Spinoza plays an important role because of his relationship to Taoism.

To my research, his view on nature is indispensable and not to be overestimated

in the argumentation for medical philosophy.

We conclude this general introduction with the remark that Hebrew language will

relate us to modern natural sciences and quantum-mechanics. With that, Tanakh

becomes a book that specifically establishes a basis for the ultimate questions of

beginning and end, of man and creation, without getting bogged down in traditional,

dogmatic religiousness.

How is that possible? Well, because Hebrew is an alphanumeric language. Every

letter has a numerical value. As cultural history has demonstrated, calculating is

older than language. Telling stories is an ancient activity, but the numerical proportions

underneath the story constitute a more reliable basis for interpretation

and understanding. Not for nothing, mathematics is the universal language of

science. Logo-technics and analysis of the numerical structures that constitute the

linguistic architecture of Tanakh, will uncover the juxtaposition between natural

sciences and Tanakh, so that there is no more contradiction, but equilibrium.

112 Maimonides has emphasized as quintessence the body- and imageless-ness of G’d in his 13 articles of faith. Therefore,

in our research the source of knowledge we occasionally indicate with G’d, is “dynamic creating Energy”: the Primary

Being or Ein Sof.

113 With this I did not want to create a contradiction to Pascal, who differentiates between the G’d of Abraham and the

God of the philosophers. This dualism tends too much to Descartes, who was justly opposed by Spinoza’s monism.



131

Logo-technical analysis systematically connects with mathematics i.a. Pythagoras’s

and knows the set theory as a signifying phenomenon.

6.2 TJM in European history

Jewish medicine shows ethical and cultural similarities with subsequent medicine

in Europe and the USA. Therefore I join Shyrock’s statement: “The history of

medicine not only has a biological side, but also a social and an economic side; it

is one of the central themes in human experience”. 114

Albert S. Lysons, in the History of Medicine, writes some things about Jewish

medicine that are important to my research, but they do not cover more than two

pages; indicative for the cultural importance of Jewish medicine?

Lysons directly goes wrong interpretatively. It is clear that he connects Jewish

medicine to his view on Judaism as a religion. The link to other cultures with

their religious slant makes this clear: “The medical practices of the Hebrew did

not differ much from those of the peoples around them. Some medications are

mentioned in the Bible, like mandrake, balms, gum, spices, oils and perhaps

drugs, but the list of medications is noteworthy short, compared to the abundant

materia medica of Mesopotamian and Egyptian physicians”. 115 We will see how

great the influence was of Jewish scholars like Maimonides – called Rambam in

the Jewish world – who was a great doctor in the Arabic world and court physician

of the Sultan in Egypt.

Comparing the medical activities within the great cultures of the Middle-East

does not do justice to Jewish medicine. Place and function of the doctor within

Jewish tradition are completely governed by the ultimate principles. A Jewish

114 Shyrock, Richard Harrison, The Development of Modern Medicine, A.A. Knopf, New York 1947 (quote Lyons in An

Illustrated History of Medicine, 1978. Abrams, New York.)

115 Lyons/Petrucelli, History of Medicine, op. cit. p. 70



132

historian would directly have positioned the Jewish doctor in his cultural-ethical

context, the connectedness to the Creating Instance as the source of nature and

well-being, on which the Jewish doctor bases his position and practice.

Spinoza gives us insight in the link between Creating Instance (Nature) and physician

and culture (Nurture). 116

Lysons continues with an important statement: “Even though biblical information

about medicine is relatively limited, a rich collection of medical knowledge is to

be found in the later Talmud, the authoritative collection of Jewish traditions.” 117

In his discussion of the Talmud too, Lysons mentions the relationship to other

traditions. “Even though the medical scriptures of the Talmud witness a remarkable

insight and observation, they are a reflection of both the notions and methods

of the diverse peoples living around the Jews over the centuries, and their own

biblical heritage. In that way, Talmudists based themselves on the body-fluid theory

of the Greek ... mucus, blood, yellow bile and black bile. They joined the

Greek philosophers in the specification of the four elements of the universe:

earth, fire, air and water”. 118

Alexandria played a prominent role in the development of Jewish medicine. Because

Alexandria was the centre of Greek science, it is only logical that Jewish

developments too carried the traces of it. Jewish physicians received lessons in

anatomy, physiology, dietetics, massage and pharmacology. “Though dead bodies

were cultic impure and had to be avoided as such, Jews apparently performed

dissections occasionally ...”. 119

Most anatomical information in the Talmud came from Alexandrian studies. Regarding

surgery, the Talmud discussed the healing of dislocations and the treat-

116 Spinoza speaks about G’d as Deus sive Natura, without bogging down in pantheism. The divine character of nature

makes it much more powerful than we can grasp with our best measuring instruments and thoughts. Therefore nature is the

breeding place of the natural miracle.

117 Lyons/Petrucelli, op. cit. p.71





133

ment of injuries to many organs. Sometimes techniques were described in detail,

like the placing of an artificial anus, when this was missing at birth (atresia ani).

Personal and general hygiene as it existed in ancient Israel, was continued in the

Talmud. Regulations for meals were also strictly maintained. This was partly why

mediaeval Jews suffered less from the deadly plague than non-Jews, who had not

yet discovered the desirability of daily washings.

6.3 TJM as a bridge builder?

Lysons ends with: “ In the Middle Ages, Jews would become the keepers of

Greek and Roman scholarship in the West.” 120

Here we take the next step, that I launch as a working hypothesis:

The Jews have become the keepers of Tanakh-scholarship, that has left its traces

in Greek and Roman scholarship and is developed further to quantum mechanics

and Einstein’s relativity theories in our 21e century.

Tanakh-scholarship can - without being disqualified as “religious-book wisdom”

or “Jewish theology that brings G’d into science through the back door,” – act as

a bridge between the medicine of East and West. 121 Perhaps it is an unstable

bridge, that is strong if we are not afraid!

To build a solid bridge that can guarantee unity in diversity, self-awareness that

leads to a shift of paradigm is an absolute necessity. If we are jointly willing to

renounce the conventionalism behind which we are so eager to hide ourselves to

defend and maintain our values and truths, then we leave the Darwinist “I against

you” and we move forward together as “you and I” to a renewal that can defy


121 For a specific description of TJM and the relationship to TOM, breslev.co.il is illustrative. We will discuss these

relationships with i.a. Yehuda Frischman’s publications.



134

time. Here Martin Buber and the French-Jewish philosopher Emmanuel Levinas

are in place.

Enigma

Before I continue with a deepened description of what the Good Book of

ancient Israel says about medicine, it is necessary to hear a rabbi who,

through an enigma, brought his students to the insight that the Jewish Torah

is not about organised religion, but about life in all its aspects, including

sciences:

One day a Jewish rabbi said to his students:

What do you consider to be the greatest catastrophe that has befallen the

Jewish people in its history?

The four hundred years of slavery in Egypt, said the first student.

No! Replied the master.

The destruction of the Temple, suggested another.


The Exile, offered a third student.


The Shoah (Holocaust), said a fourth.

No! Replied the master; it is neither the Shoah, nor the Exile, not the destruction

of the Temple, nor slavery.

We don’t see it, admitted his students in unison.

The greatest catastrophe that has befallen the Jewish people, instructed the

rabbi, was when the Torah became a religion. 122

122 Ouaknin, Marc-Alain, Les Dix Commendements, édition du Seuil 1999, page 18.



135

This story recalls the phrase of the Jewish philosopher Franz Rosenzweig in his

book The Star of Redemption: “G’d created the world, but He didn’t create religion”.

123

This rabbi definitely opened my eyes for evolution as creation on the basis of

Torah 124 , which provides an ultimate base to the natural sciences, without steering

“God” as “hole filler of our thinking” into the scientific realm through the back

door in an orthodox-Jewish, Christian and other religious way. Hebrew linguistics

make it possible to reform our scientific thinking in such a way, that it revives

again. A living consciousness suddenly sees, what could not be seen before. 125

6.4 Music therapy in ancient times

The preamble about Jewish medicine can’t do without indicating the absence of

Jewish music in a thesis about music in ancient times. We do not answer questions

why; we only note it. In her study “Music in ancient times: an 'enchanting

way' to heal” Tamara Wanker describes the position of music in the medicine of

ancient times. It is remarkable that Greece and Rome are spaciously discussed,

while the Jewish tradition, that must certainly have been of significance in Hellenistic

times, is entirely missing. When we start from the three basic principles

of music therapy – light, sound and meter –then ancient Israel has a lot to tell. 126

The importance of Jewish music can’t be overestimated, especially not after the

123 Rosenzweig, Franz, Stern der Erlösung, Frankfurt am Main, 1921, page 97 ff.

124 View of chief rabbi Cook in Jerusalem.

125 We will see the centrality of the meta-scientific concept of “life” in the scientific discourse in the Hebrew language of

the first three chapters of Genesis, by means of some Hebrew words and concepts, that become totally opposite when

omitting the first letter of the alphabet, the Aleph (the 1). “Life becomes death”. With this, we have a connection to the

natural-scientific discourse about life and death and we see dawning the juxtaposition of the concept “metaphysics” which

is too heavily loaded philosophically and theologically to be of use for a new development, a new paradigm. Metascientific

has a connotation of “possible-but-not-yet”.

126 Word, number and sound are language-specifically sublimated by Hebrew to a “number” as valuation of “spoken

word” and “sound” (melodic and harmonic). The central number in which these basic principles concentrate, is 528, which

we will elaborate broadly.



136

rediscovery of the six-note tone system, that is called “Solfeggio” in the non-

Jewish world of music, a core part of my research. 127 Perhaps the Semitic input is

absent with Wanker because it is outside her discipline. She graduated in ancient

history and with this we usually mean Greek-Roman history. As a Jewish scientist

I can only conclude that Judaism did not get through the filter of ancient history

and thus, apparently, was not interesting enough to the medical music study.

One step beyond lies Pythagoras’s sphere of influence, whose number theory, as

regards the numerical structures of Hebrew scriptures, made its marks within music

theory too. That underlines my astonishment about the absence of Jewish music

developments in her research. Are people so far removed from the ancient

culture bearer of the Middle-East, that they simply can’t or don’t want to understand

what riches lie hidden behind the tradition of the small nation that had no

right to exist for so long? I comfort myself with the thought that my dissertation

will fill the necessary gaps, hoping for acknowledgement of the Jewish servant

stature for man and creation.

NB. When we view the father, mother and child-relationship as a reflection

of the growth of the sexes and fertility based on male and female dispositions

with the child as the phenomenological result, then we move

from the dialectical relationship father and mother, to a triadic relationship

with the child as the third. In general, the male is represented by number 3

and the female by 4. If we take multiplying literally, then the child should

be the outcome of 3 x 4. However, that is 7, which is not a logical succession.

If we decide to sum, we get the same illogical result, because logically

5 is the successive number the child would have. Therefore, Pythag-

127 Solfeggio, based on a religious poem, became the basis of the later solmisation-system by Guido van Arezzo (991-

1033). The full text of the poem is: ut queant laxis resonare fibris mira gestorum famuli tuorum solve polluti labii reatum

Sancte Iohannes! However, for my research only the Hebrew basis, which is referred to by YouTube-publicists, has validity

when it comes to “healing music of the heart and of love” connected to Torah and the Source of Torah.



137

oras brings the solution: a 2 + b 2 = c 2 . When we calculate the above with

this thesis, we get 9 + 16 = 25 = 3 2 + 4 2 = 5 2 . Now logic fits perfectly and

we have substantiated the triadic structure for the expansion of the creation.



138

Chapter 7 - Informatio Potentialis Energetica:

Unlocking process of information

and hypothetic-deductive methodology

7.1 Hebrew linguistics and evolution as unlocking process

of energy and information

E

volution as creation is an ongoing unlocking process of what is actualised

biologically and chemically by all living things as in-formation. 128

It will become clear how Hebrew language unlocks this process and

how close the results of this logo-technic analysis lean against, for instance, Hubble’s

cosmic background radiation , Einstein’s relativity theories, Max Planck’s

quantum mechanics, Laszlo’s Akasha-field, the Higgs-field, after the probable

discovery of the Higgs-particle.

First some further details about Hebrew linguistics. Hebrew is not the oldest language,

but it is the oldest living language that is still spoken within a nation after

3500 years. All major world powers disappeared. Culture-bearers have become

fossilised history, but that small, seemingly unimportant nation in the Levant

lives on indestructibly and will be able to act as a bridge in the reconciliation of

Eastern and Western medicine, when it comes to scientific acknowledgement.

However, this not only means a shift of paradigm in the singular sense. It also

means a farewell to Darwinist evolution with the struggle for life as survival

strategy: eat or be eaten. It possibly means returning to the pre-Darwinist period

128 In-formation is used in this study as derivative of the Greek morfè and the Latin verb in-formare in the meaning of

“form from the inside”. Therefore, information is treated as potentiality that awaits creating or recovering actualisation,

however substantially different from Aristotle.



139

of De Lamarck, who noticed the survival strategy in the cooperation of unicellular

creatures that united in a powerful field of consciousness into multicellular

creatures, into man, into humanity as world population, people who can’t live

without each other: man as a cell within humanity as multicellular system. It is

not for nothing that in Hebrew, man (adam) also means mankind.

7.2 Groping in the dark, creating hope by finding the

beginning: the missing a = √1 = 1

On Friday, November 29th 2013, Mariska van Sprindel wrote an interesting report

about another attempt to find the “missing link”, the beginning of life, in the

Newsletter of Knowledge link. Nobel prizes find their way to savants, but without

the ultimate effect. “How come?” to me is the research question, for which I went

another way than reductionist science and subsequently ran into the missing information.

Because Van Sprindel’s article exactly describes the powerlessness I

encounter everywhere, I here insert the outlines as an illustration.

“We do not know the exact recipe for the primordial soup with which life

began 4 billion years ago. But a team of American and Italian chemists

has now discovered a missing ingredient. The discovery brings the creation

of a primitive artificial cell a step closer”, says Mariska van Sprundel

in Knowledge link. 129

How would the first cell have looked like? Scientists who research the origin of

life, try to create such a primitive cell artificially. A job with several problems,

129 Knowledge link newsletter of November 26th. see http://www.kennislink.nl/publicaties/missend-ingredient-oersoepgevonden



140

that are far from solved. Nobel prize-winner Jack Szostak of Harvard and his colleague

of Roma Tre University (Italy) found a molecule with which they can now

create a credible model of the first cell. They described the functioning of the

molecule, citric acid, in the online edition of Science.

7.2.1 Nobel prize winner

Szostak received the Nobel prize in 2009 for his research on human genetics.

Since ten years he is engaged in the Origins of Life Initiative launched

by him at Harvard to explore how life on earth began. His research targets

i.a. at the spontaneous formation of the cell membrane.

Scientists encountered many obstacles when attempting to create a protocell.

One of those was, that magnesium ions are needed for the spontaneous

doubling of RNA. Normally, enzymes are involved in the doubling of

DNA and RNA, but at the time of the first cell, enzymes didn’t exist yet.

The problem was, that magnesium sticks to the fatty acids of the vesicle.

The result was, that the protocols in the lab collapsed.

7.2.2 Missing molecule

How could RNA survive circumstances on the young earth, if the vesicle

breaks down? In the primordial soup something must have floated that

maintained the RNA-protocell. The scientists first screened an array of

molecules that are able to protect fatty acid vesicles against breakdown by

magnesium. That yielded a few candidates. But one molecule stood out: citric

acid. This went a step further and also let the doubling of RNA run more

efficient.



141

7.2.3 Critical comment

The elaborate quote of this special research is an example of the materialistic-reductionist

science that, by systematic analysis of cells and cosmos as

totality, reduced to the smallest, I believe will jam in an ever-new question

and will end in ever-new failures with the sigh: “we were almost there”.

Maimonides indicates that, without two way-dialectics, science can’t find

the front door of the palace on the single road of empirical knowledge. That

makes a consideration of the access road and the front door itself inevitable:

a = √1 = 1.

At a decisive moment physiological reality, as quantum field, seems to

move away from the researcher. A 180 degrees turn to the road that arrives

at the main entrance, is necessary. Labouring materialistic-reductionist any

longer, led by Neo-Darwinism, only creates illusory scientific expectations,

hoping for “once”: “then we will have described mathematically, as scientists,

independent of whatever external movement, the Theory of Everything

(TOE)”.

However, the beginning of everything is already immovably present and

wants to be known, but only through a double-track road: that of science

and Hebrew traditions. Hebrew language and Jewish traditions are preoccupied

for this.

Our lives consist of bipolar oppositions: day-night; hard-soft; love-hate; etc.

It is not possible to escape these bipolar oppositions within this fourdimensional,

physiological reality. Hebrew language underlines this inevitable

duality, that exists both on physiological and immaterial, spiritual

grounds. The most important tradition, the Torah, therefore begins with the

B as number 2 and not with the A as number 1, as we would expect. Engulfed

by the dualism of “the 2”, we have lost sight of the irrefutable character

and the all determining value of the number 1 in our daily and scientific

existence.



142

This is not a speculative, arithmetic statement, but the declaration of a fundamental

disposition that challenges us to “begin at the beginning” and recognise

the gap in our scientific knowledge as the missing link = the Aleph =

the 1, a recognition that will result in other mathematics, other fundamental

natural sciences and another philosophy of science. Then this missing link

enters our fundamental-scientific thinking order as a presentia realis, a not

empirically measurable knowledge content, that will lead to an applied science

that is shod on a different basis: that of the Aleph, the 1, the numerical

value of the Always-present Creating Instance as a not-yet-measurable “astrophysical

background radiation” through which “everyday duality” must

be reassessed to a “fundamental-energetic trinity”. See the footnote. 130

It is possible not to acknowledge, because our human will has the quasiautonomous

possibility to do so. Why “quasi”-autonomous? Because finally

the return to the Absolute unity, that calls for the acknowledgement of

this trinity in our reality, is the purpose of existence. At that moment, conflict

as the ultimate power consequence of duality will not be learned anymore

and science will see that the “protein that encodes life” is an articula-

130 In Pythagoras’s thesis, the order is 3, 4, 5. We substitute these numbers with father, mother and child. In Hebrew we

read father as aleph-beth (b-a) = 1 + 2 = 3. We saw the father as the progenitor (3), in analogy to the 3 patriarchs and the

mother as the recipient (4), in analogy to the 4 matriarchs. Our expression “mother earth” refers to the female 4 as the

totality of cosmos, the square of 2, that encloses total creation (4 winds, 4 corners of the earth, etc.).

When we typify the Aleph as the “Always-present Energetic Background radiation” and start Evolution as creation with

the Beth, with numerical value 2, we understand the direct meaning we must give to the Father in Evolution as creation

and why the Creating Instance or Substance is metaphorically called Father (b-a), without referring to a sexual meaning at

all. If we, as scientists, reject the recognition of the Creating Instance or Substance (Spinoza), we reject the Alwayspresent,

the bearing Background radiation and we have to blame the “missing link” of our wilful pseudo-autonomy. A

medical science without this Background radiation will always conflict with the last questions of reality and the etiology of

numerous unexplained illnesses, as a result of the disrupted homeostasis between energetic load and energetic capacity,

through which the life system becomes overloaded and defects. To conceptualise both terms, a renewal of the Newtonian

image of man is a strict requirement. Modern medical philosophy challenges the medical world to accept an energetic

image of man, through which quantum physics finally newly connects the natural sciences and biology, with cooperation

between conventional and complementary medicine as a positive result. If science can decide to acknowledge the Begetting

Father (1 and 2), then total existence (the Third) as articulated potentiality, the fruit of the Source of Possibilities, that

is continued by man as co-creator, is loaded with energetic thinking power, that can bring the medical science to even

more fruit. A science that does not achieve acknowledgement of the Energetic Trinity has cut itself off the root soil and

disqualified life to a permanent riddle, and therefore essentially weakened itself, with all its consequences. This can

become clear in the treatment of the “1 – 4” - formula.



143

tion of the potentiality that is given as a scientific mission, command and

challenge, to research and actualisation in creation.

This central, corrective challenge was put into a formula for the hypotheticdeductive

method by me: the number 1 is a = √1 = 1. By this working hypothesis

the central axiom is set: the unity of the a can’t be broken into

fragments, and the absolute unity can’t be undone without falling into illusion.

Hence the statement √1 = 1.

7.3 Hypothetic-deductive method versus empirical reductionism

It is a crazy venture to stab the methodology of the Neo-Darwinist, atheist natural-

scientific model to the crown, without the usual metaphysical arguments or

religious, dogmatic presuppositions, but with the Torah as numerical explanatory

model that is located not opposite, but next to mathematics as the language of

science (knowledge + tradition = 1)?

This research confronts natural-scientific reductionism with the Hebrew Good

Book – the Tanakh - that is built on a logo-technical, numerological numeric

structure with a unique linguistic architecture. That is only possible because Hebrew

is an alpha-numeric language. Every letter has a “numerical value” and a

“locational value” . The latter concerns the location within the Hebrew alphabet.

131 That makes all disputations about science and religiousness, about “God as a

hole filler” ridiculous. If we start from the numerical proportions of the Hebrew

text instead of getting stuck in “stories as stories”, then theological, textual interpretation

of the ‘stories’ around creation is no longer necessary. Through its numerical

structure, the Hebrew of Tanakh becomes an arithmetic source- and cul-

131 Letter m has a numerical value of 40 and a locational value of 13.



144

tural language that supplements mathematics as the language of the natural sciences

and vice-versa.

Mathematical formulas are the same everywhere. When Hebrew provides the

sciences with supplemental numerical formulas, then these formulas have a right

to a place in the scientific discourse, even if we test the limits of our cognitive

faculties and if that is “not yet scientifically” proven to us.

That does not affect the fact that Tanakh expressis verbis can’t be called scientific

literature, because it contains a complex of values and meanings, reports of processes

and events, instruction and consolation. I like to call Tanakh “the Basic

book of Avraham and both other Jewish patriarchs”; Avraham on whom billions

of people have built their lives and their destinies over the centuries, still do that

and will do that.

Autonomous Western man has lost the relationship between natural-scientific

knowledge and the cognition transcending knowledge of the Hebrew Tanakh,

with its referral to and connection to the Energetic Consciousness-field, the

Source of Life. This fundamental “Aleph-knowledge” was sacrificed at the chopping

block of atheistic, pseudo-autonomous sciences. 132 For medical and cultural

change, a renewed introduction to fundamental Hebrew language and culture is

necessary.

In Jewish tradition, the positive expectation of a new world, of the recovery of

everything that threatens to be destroyed by our human conduct and lack of creation-caring

responsibility, lives. That recovery includes the life and health of individual

man. With that, we have opened the door to medical science and the Hebrew

word adam, meaning both human and humanity, gets a special meaning.

Hebrew has no vowels and we read from right to left. We write adam as Mda (M-

D-A) and therewith form an acronym of man “a-d-m” that represents a = adam –

132 I here describe autonomy as the “science of the single road that has put aside the second road of tradition”. It is precisely

the second road that provides the light on the first, scientific road. What happens when this light is extinguished, we

will see by means of a short Torah-study on the 1 : 4 – formula, related to DNA and human genome.



145

d = door – m = mashiach (the personification of the future new world to be realised).

In other words: humanity and individual man, with his or her responsibility, constitute

the door to the new world. That is the universal mission that dynamic renewing

Judaism has for the world. The medical world constitutes an essential part

of this mission. Hebrew-based medical philosophy calls for another scientific

methodology than the Western empirical method, in which “repeatability” is probative.

133 In connection with Spinoza I have chosen for the hypothetic-deductive

method. Besides repeatability, this method dispels the authoritarian objectivity of

the expert opposite the ignorant patient. With quantum physics, the objective determinism

of science has ended. The subjectivity of the researcher as subject can’t

be thought away from the (quantum)field anymore. With that, the natural sciences

have de facto opened the door for a philosophical hermeneutical test: the scientific

method for interpreting, explaining and understanding results etc. It beats a

dent in the hat of scientific conventionalism, corrected by a hermeneutic method

derived from theology, literature science and philosophy. I will describe how persistent

this opposition is, when discussing the state of affairs within Western psychiatry

as psycho-biomedical conflict culture with many victims.

Clinical hermeneutics too, that reads man like a “living human document”, fundamentally

limits the encounter between “objective expert” and “subjective man

opposite him”. Hermeneutical psycho-methodology assumes that observing is not

enough, but that it comes to understanding, interpreting and explaining. Therefore,

hermeneutic means: methodically uncovering and determining the existential

and underlying values or meanings, that have posed as a persisting pattern of

complaints in the patient or client.

133 Through this supposed repeatability, the failing of the medical approach of man as a dynamic unity-creature is shown.

No human reaction equals the previous and will not do that in the future. As “time-creatures” we change every second.

Therefore we can never react the same to a test or to regular medication. Therefore, the term “repeatability” should be

deleted from the criteria as means of proof. Then we have not talked about the subjectivity of the researcher who determines

the test results, as we learned from the quantum physicists. The purest measurement is and stays N=1. More on that

later.



146

The consequence of clinical hermeneutics is, that a unique human being is sitting

opposite me. Together we are situated in a field of consciousness, the hermeneutic

circle, that emphatically widens to an unstoppably sliding horizon. 134 This

fundamental statement makes current empirical-scientific research methods a

statistical randomness of the largest order. Statistics and dynamics do not go together.

In our clinical fieldwork, we measure the effects of the Mindlink-system adapted

to the Western scientific conventional way: double blind and randomised, in

freely formed groups of people, without selection at the gate, distributed over

standard group and control group, that constitutes the shadow of the standard

group. We added a third research group to that: the 528 Hz-group (the heart of

our music-philosophic and music-therapeutic research). In our research we use

the universally accepted statistical size of the research group, N=100. This means

that the research was conducted among 100 people, with their control group.

7.3.1 What do clinical hermeneutics say about N=100? Is it

possible? No man is the same.

We can’t count unique phenomena, unless we first discard them, temporarily

or permanently, of their unicity and classify them as “patient” or as

“group”. The final conclusion of that is, that every scientific research

should be a “N=1” research, because of the individuality of the man, the

participant in the research or the patient to be treated. For that, a specific

method is necessary that collects hypothetical material in a reliable way and

134 In bio-energetic hermeneutics we create an energetic circle on the basis of Tesla-technology, in which therapist or

coach and client are situated. This can be considered as an energetic hermeneutic circle as within philosophical and clinical

hermeneutics. With this, the Mindlink and Preventest,, developed by dr. Johann Lechner in Munich – belong to the tradition

of Heidegger’s, Levinas’s, Gadamer’s and Ricoeur’s a.o. tradition of hermeneutics, although dressed in a bioenergetic

robe. With that, the medical-philosophical relevance of Mindlink and Preventest for the purpose of the clinical

practice is illuminated.



147

interprets, explains and understands it, to subsequently test the hypothesis

by the existential, unique life story of the respective (man as a living human

document). 135 In conventional medical practice, attention for the life story is

limited to the “anamnesis” serving diagnostics. The life story in many cases

ended up outside etiology and has brought us diagnostically and treatmenttechnically

on a road that is ready for demolition. As I will describe hereafter,

it is possible to diagnose someone as schizophrenic on the basis of unproved

psycho-medical conventions on etiological-neurobiological defects

and supposed genetic deviations, without having listened to the life story

for once. With the rise and development of epigenetics, the power of environmental

factors is acknowledged. In many cases they cause the outbreak

of not natural- scientifically proved and, as the life story demonstrates, not

always hereditary “genetic deviations for brain disease”. There can be no

independent power-on of genetic material, as genetic determinism would

have us believe, especially in biological psychiatry. Hopefully, the rise and

development of epigenetics, together with the development of knowledge

and insights around Foetal programming, will be able to cause a massive

turn in this, not with a Darwinist image of man, built from organs as “replaceable

parts”, but with a pre-Darwinist, new biological image of man:

man as an energetic complex of cooperating cells, that remains in balance

(homeostasis) and can survive only through cooperation. 136

135 Because of commercial-economic reasons, such an individual research will never happen. The health insurers can’t

handle this in the current system, based on the mechanistic image of man. Therefore a shift of paradigm is indispensable

and justice precedes economic interests and possibilities. It is only what one finds feasible humanly and politically.

136 For this I gladly refer to the complete works of dr. Bruce Lipton and Nobel prize-candidate Candace Pert.



148

7.3.2 Complementary Preventest and collecting hypothetical

material

Collecting hypothetical material calls for expertise in many areas: medical,

therapeutic and paramedical. In this research, complementary-energetic

Preventest 137 was used to produce differential diagnostic data and put symptomatically

relevant material on the (bio)screen, through a database, on the

basis of Tesla-technology.

As we will see, the data arise from the dialogue with the internal consciousness

of the respective, on the basis of energetic interference of the information

that is provided non-aurally, through the computer, to the energetic

cell structures with their own energy management and system. The expertise

of the person that collects data from the bio-energetic “anamnesis” is

somewhat relieved by what occurs unconsciously dialectically on the interferential

field of consciousness. Because it is about consciousness, meaningfulness

plays a significant role in the process of recovery, change and

empowerment.

7.3.3 Intern-conscious “Memory of Experiences”

The intern-conscious, usually designated as the “un-conscious” has been interpreted

by Freud and psycho-analysis as the neurotic “gathering place” of

experiences, repressed by the ego and by defence mechanisms, that conversation-technically

and through free association are brought into consciousness

by the transfer situation. It can be made clear that psycho-analysis is

waning in current developments in psychotherapy. The Tesla biotechnological

Mindlink-system will have to renounce the Freudian interpre-

137 This method has a reference to the originator of Mindlink, dr. Joh. Lechner in Munich.



149

tation, in favour of the dialogical relation between client and systemic information-supply,

that matches the unconscious or is repelled by it. This

leads to a redefinition of the unconscious. Within Mindlink intervention

strategies, we define the unconscious as “Memory of Experiences”. As this

will be elaborated hereafter, it suffices here to indicate the search for the

very deepest experience ground underneath the syndrome concerned. The

developments of the new biology and biotechnology start from the presence

of “cell-memory”, which provides the possibility to connect to the memory

that, on the basis of epigenetics, is located within the zygote, the fertilised

ovum. Memory of Experiences therefore is a pre-cerebral affair in this perspective.

This has the valuable effect that the Mindlink-test can not only

handle this deep dialogue diagnostically, but can also develop energetic interventions,

through which deep forms of recovery can originate as a solution

to what we consider present within the framework of Foetal programming.

With this, the dialogue with the unconscious is interpreted phenomenologically,

instead of psychoanalytically.

7.3.4 Causality and meaning-adequacy

In clinical-hermeneutical methodology, of which the hypothetic-deductive

method is a part, causality and meaning-adequacy, which sociologist Max

Weber deemed necessary for good sociological research, meet. He brought

both concepts together in the term “causal adequate link”: the statistical

probability between cause and result that is meaning-adequate if it is experienced

as meaningful.

The causality leads to treatment interventions on the basis of contraindications

and contra-information that is focused on breaking the neuronetworks

present. These neuro-networks are maintained by programming

beliefs or blockages, that delay or even prevent the flow of positive life en-



150

ergy. This leads to a “frozen emotional life” with all phenotypical and

genotypical attendant consequences, starting with uteral developments,

Foetal programming. 138

7.4 Hypothetic-deductive method as process strategy

Doctors, therapists and other health professionals face the task to find, together

with the man requesting help, a solution to the current problems. For this, there

are several strategies and interventions, determined by the nature and content of

the discipline.

In our research, by “strategy” we mean: “describing testable and falsifiable assumptions”,

intervening by clinical-hermeneutical analysis of the existential life

story on five dimensions: emotive distortion through internalisation of a surmenagistic

context (led by overstrain) on prenatal, perinatal and neonatogical

level, followed by progressive insecure attachment - started by Foetal programming

- by activation of the HPA-axis, and effects on the autonomous nervous

system, resulting in reactive Foetal behaviour to a permanent production of cortisol

139 that postnatally counteracts the attachment strategy, and usually expands

into a rigid stagnation of emotive life and a frustrated self-image in a later stage if

138 See prof. dr. Bea van de Bergh University Tilburg/Leuven and European study commission around prenatal stress

load.

139 Hereafter we will write about partly eliminating the mother’s cortisol level in the placenta. Research has shown that

this cortisol level is broken down by producing a particular enzyme, in a properly functioning immune system. As we will

see, this immune system remains vulnerable.



151

consciousness (hermeneutical distortion), with a corrupted social contextuality as

an inescapable result (social disintegration). 140

7.4.1 Hypothetic-strategic intervention-analysis

in this methodology starts with:

1 an open energetic Mindlink-test, from which double blind information

is generated for researcher and client.

2. a discussion of test results.

3. a link to the experienced attachment quality c.q. emotive or different

type of deficiency in prenatal, perinatal, neonatological and

early childhood time, that manifests itself as fundamental insecurity

and concentration disorders.

The strategic intervention-analysis of the existential life story follows, starting

with actuality. For this we use 5 tests, the first of which will provide

basic information for the course of the research, treatment or referral.

7.4.2 Tests

1. prenatal, perinatal, neonatogical information 141

140 Anniek Toomen-Vreugdenhil writes in her book “Treatment of the attachment problem”, Houten 2006, p. 55: “In

neglected children (in every possible form, G.), a feeling of despair arises because they have learned that the important

other in their life is helpless and unable to adequately answer their needs, and because their own attempts to receive (loving,

emotive, G) care came to naught, they often exhibit passive and withdrawn behaviour... (called “relational disturbance”

by Toomen, an analogy of hermeneutic distortion and social disintegration discussed by me hereafter. Thus a link

can be found between attachment experiences and thinking about oneself, resulting in negative self-esteem and disqualification

of the contextual, often excessively demanding life-frames. Through the permanent production of cortisol through

continuous activation of the HPA-axis, this basic experience is situated in the unconscious depth level of the cellular

system, that sometimes is extremely loaded with negative energy. Freudian defence mechanisms prevent us from reaching

this depth level. Through the bio-energetic, interference dialectics of the Mindlink-Preventest-system, Freudian defence

mechanisms are circumvented and the registration systems on the cell membrane can be reached at quantum level, through

which unconscious material is systemically visualised by registrating the internal consciousness dialogue. A separate

chapter is devoted to this.



152

2. actuality test distress or surmenage

3. actuality test depression

4. actuality test fears

5. actuality test somatisation. 142

Along this road it must become clear to those involved what the problem is. For

this purpose, the problem is discussed in an open dialogue on the basis of bioenergetic,

Tesla-technological test results, with the aim of interpreting, translating,

explaining and understanding the scorings in the Ideographic Matrix.

The problem is concisely formulated, so that it remains clear for those involved.

After hypothesis inventory, this is all viewed from the clinical-hermeneutical discussion

that, through the Mindlink-database, is tested continually within the reality

of the dialogic process and the recognition and acknowledgement of the person

requesting aid.

7.4.3 Deductive approach

In the hypothetic-deductive approach, right from the start several hypotheses

arise about the problem and the aspects that play a part in it (patterns).

A scientific hypothesis is an explicit assumption based on a more than random

collection of data. Therefore, the inventory of interference possibilities

and solution media for the problem are also part of the hypothesis. On the

141 The Ideographic matrix is used as general personality-information for the double blind and randomised research

during the first phase of the research and is extended in the second phase as a source of information for the basic treatment

route. The ideographic matrix is principally delineated from the nomothetic matrix which is also used in the practice of

scientific research.

142 Tests 2 to 5 belong to the 4DCL, the Four Dimensional Complaints List, publiced by Terluijn et al. in Doctor and

Science, 2008, 5:251-255, used by doctors in primary care, to be downloaded for research and private practice via

www.emgo.nl/researchtools/4dsq.asp.

In our research, tests 2 to 5 are under the lead of test 1, because many complaints and questions in this regard can’t be

separated from the fundamental insecurity problems and the state of tendention life is emotionally in, phenomenologically

expressed in “giving” and “receiving”, as present or absent abilities. Although 4DCL is important as differential measurement,

this research suffices with its own Idiographic Matrix to be introduced in treatment practice later.



153

basis of bio-energetic systematics we are able to create an algorithmic decision

tree, with which we can develop a phased treatment strategy.

We generated the first deductive information from the described hypothetic

system.

Deductive science is science-theoretically synonymous to formal science

and is the opposite of natural-scientific, empiric, or experience-science.

Through a competent and thorough collection of the hypothetic symptomatology,

we found a set of “assumptions” or “postulates”.

These postulates must be defined and subsequently tested through a set of

derivations, patterns, concepts, principles and constants of logics and mathematics:

logical-analytical knowledge (first way), supplemented by the results

of Hebrew linguistic logo-technical analysis and its numerical structures

(second way).

For the deductive treatment plan, we reorder the knowledge found by using

positive counter-indicators. As we read man clinical-hermeneutically as a

“living human document”, we also attempt to let the corrupted parts of the

existential life story be rewritten by the respective on the basis of newly acquired

self-consciousness, supported and treated by positive counterindications

and positive-energetic counter-information (energetic, transformed

music and affirmations, etc.).

In deductive reordering we move from general to specific information and

vice versa: a two way-information system as a treatment structure (including

medical-technical operations or corrections, as is the case in dental

CMD). 143

143 CMD is no general phenomenon in regular medicine and classical dentistry. The abbreviation is: Cranio Mandibularis

Dysfunction, a disease full of surprises and medical astonishment.



154

7.4.4 Conclusion

In the deductive treatment plan, bio-energetic Mindlink-system, plays a

technical key role. For music therapy, that is often a “supportive trailer” of

the regular medical system, a second key place is composed in the recommendations

of this research, namely a place for the key elements of the

treatment: the conversion of phonal (audible) music to a-phonal music, that

is stored as energy in a saccharine-molecular carrier by Tesla-technological

transformation into electric scalar consciousness waves. The globules melt

in the mouth, whereupon positive energy disperses through the human system

and is processed by the cellular recipe and other systems. This also applies

to recorded sounds from nature and distinctly positive affirmations,

that act as dialogic consciousness field in inaudible harmonic frequencies.

However, the experience of the client remains central in the deductive

treatment plan. Therefore, all treatment instruments stand in the light of the

subjective experience of the unique man opposite, or next to us.

We end this consideration with a return to the beginning of the deductive

system, a unity elevated to an axiom as a constant: a = √1 = 1, that has now

left the status of working hypothesis and was elevated to an Absolute Constant

in this study: the Ultimate Concern!

7.4.5 Hebrew Torah

Do we need the Hebrew Torah to get scientific clearness about the circular

course of the infinite? Yes, as I have made clear in outlines before.

It appears that Western and Eastern natural scientists get stuck on all sides

on the questions about the origin of life, or resort to a spiritualism that only

leads to assumptions, based on results. Western religions have created many

images of God that had to answer these last questions satisfactorily, assumptions

that made truth claims on the basis of indoctrinating upbringing.



155

Eastern spirituality has, as a basic belief, its universe filled with divine entities

and energies that seem to be able to clarify our last questions and bring

healing. Here too we find similar assumptions and indoctrination.

In the end, all appear to choke on the Absolute Last questions around the

Ultimate Concern. 144 This is the consequence of a reductionist science that

severed the working connection to the Source, next to a holistic science that

spiritualised the connection to the Source in such a way, that objectifying

scientific research is hardly possible any more. Despite the holistic contrast

to the fragmentary Western medical science, the Eastern medical practices

don’t escape the comparable pitfalls either.

7.5 Theorem

The theorem that will become clear in the course of the study is:

“Scientific acknowledgement of the emanation from the Source, as start of the

beginning, is the end of reductionism and the beginning of the hypotheticdeductive

methodology as a possible new ‘inclusive’ research method.”

7.6 Dialectic community

By using the designation “inclusive method”, we attempt to open the door for a

strictly integrative methodology, in which natural sciences and linguistic logotechnics

– conventional and complementary medicine – include each other, and

the executive beta-, gamma- and alpha-scientists meet each other in a dialectic

community.

144 Term of Tillich, Paul, Correlation theology, in his Systematic Theology, passim



156

Chapter 8 - Jewish medicine in the channel

of Eastern traditions? TJM and TCM are

strongly connected 145

8.1 Traditional Jewish Medicine is complementary c.q.

alternative

T

o understand the history and development of medicine in traditional

Judaism and its importance for contemporary medicine, we must take

note of the source that serves as a guideline, the Torah, and study the

role of medicine described therein. An investigation of what Torah says about this

substantively belongs more properly to the discipline of Jewish theology. Much

of this passes through the filter of my philosophical research, which aims at the

renewed connection of medicine as science to the Source Code, whereby new

orientations on life developments and disturbances become possible.

Maimonides’s proposition will show, that Torah takes us to a key point where

modern science remains stuck, because Torah does not intend religious dogmatism,

but constitutes a dynamic-linguistic potency 146 of creation that substantiates

the concepts of Nature and Nurture and supplies them to the exact sciences to

move forward on the road to understand the origin of “life” as a concept that is

still beyond our systemic capabilities.

145 For facts from Torah and the oral tradition, I refer to the source I quoted: “Medicine in Judaism” by Frischman. He is

authorised by the "California Acupuncture Board" to practice acupuncture and Eastern medicine. He graduated at the

Royal University Dongguk (2004) with a Master of Science degree in Eastern medicine.

146 Jewish tradition speaks about Torah as a blueprint of creation. The term blueprint imports a far too fixed plan, whereby

evolution as creation is stripped of the dynamic process in which anything can go wrong and can be restored. The road

to unity is a road full of pitfalls, but eventually unity will be attained and creation will be completed. That is the appeal

that is made to us humans from the potentiality at the start of the process: actualise the potentiality!



157

“Coincidence” is a semi-dogmatic refuge for scientists who overplay their hand

and are not willing to acknowledge scientific and human limitations. Therefore, I

like to listen for a moment to the old Jewish medicine, following Torah in the

assignments and classes for doctors and sick.

The methods used in traditional Jewish medicine are complementary and related

to other medical traditions, like Chinese medicine, both in theory and in clinical

practice.

The principles of life, both physical, emotional, intellectual and spiritual, originate

from the Torah, the constitution for Jewish life that, according to historiogenic

tradition, about 3,400 years ago was given to ancient Israel in the Sinai desert

at the foot of mountain Horeb, and was elaborated throughout history. The

Torah – translated as "instruction for life and wellbeing in nature and culture" –

consists of two parts: the written Torah, better known as the Pentateuch or

Moshe’s five books, the regulating laws and regulations that determined life from

early Jewish history, and the oral Torah that, also according to tradition “per potentialis

energetica”, in potency 147 was given to Moshe on mount Sinai by Ha-

Shem (G’d).

2000 Years ago, writing down the oral Torah was started. One of the products of

this development was the Babylonian Talmud, which consists of 38 parts or tractates

that go into specific details and forms of practical application of the written

147 As I will elaborate, “in potency” is synonymous to “quantum-physical potentiality, as information that must be actualised”.



158

Torah, with several referrals to medicine and healing that appear in the written

and oral Torah. 148

Despite the possibility of failure, the Torah clearly gives the doctor mandate to

practice medicine. In the case of physical injury inflicted on the other, the Torah

states: "... and he will provide healing." 149 The oral Torah teaches, that it can be

deduced that the doctor not only obtains permission to practice medicine, but

must also use all means he has to cure the patient. It is interesting that the commentators

indicate, that it is the doctor’s essential task to cure with all possible

means he has, but that it is forbidden to give up a patient when the situation is

hopeless! Here Jewish tradition goes one step beyond the ancient Greeks, like

Hippocrates.

In written Torah, another referral to medicine is the instruction to take good care

of bodily and spiritual health. This command is derived from the statement: "And

you will zealously guard your soul." 150 Therefore, oral Torah teaches us to take

care of our physical and mental health to the utmost, to guard and protect them in

all possible ways.

This verse also teaches us three basic principles of traditional Jewish medicine:

firstly, every activity that causes damage to the body (including misuse of harm-

148 In the written Torah, the first referral to medicine is found in Exodus 15:26, where we hear who the ultimate doctor is:

".... I will not impose a single disease on you, that I have imposed on the Egyptians; for I am Ha-Shem, your Healer." This

verse of the oral Torah qualifies the role of the doctor in the actual healing process, because even if the doctor is an eminent

and significant means to accomplish healing, the healing is nevertheless processed by Ha-Shem. Of course there is

always the temptation for the doctor to arrogantly perceive himself as the one who holds the powers of life and death in his

hand. According to the oral Torah, this is a foolish mistake, for as the Mishna (the oldest written precipitation of the oral

tradition) says in Kiddushin 4:14: "[Those who perceive themselves as] the best doctors, go to hell!" Though shocking, the

implication is not to discourage the doctor to practice his profession excellently, but to encourage him to treat his patients

in a spirit of humility and with an eye for detail. Like an imperfect intermediary practicing an art, the doctor must recognise

his own fallibility. It does not matter how competent or experienced the doctor is, the possibility of failure is always

present. Because there are moments, even in the simplest medical cases, in which things don’t go as expected and the

patient deceases. It is just as important, when the doctor is successful, that he accepts his success humbly, with gratitude. It

is interesting that the commentators indicate, that this verse also teaches us that it is the doctor’s essential task to cure with

all possible means he has, but that it is forbidden to give up a patient when the situation is hopeless.

149 Ex. 21, 19

150 Deuteronomy 4, 15



159

ful substances), is strictly forbidden. 151 Secondly, strict prevention of diseases is a

codified command. 152 Thirdly, it is commanded to observe Torah’s life lessons

from a proper focus and intent, for the benefit of physical and mental wellbeing.

153 The Jewish medical tradition is an authoritative tradition with influences to

this day.

Throughout Europe and the Middle-East, where Jewish culture richly flourished,

leading Jewish doctors were present. Oral Torah contains a wealth of practical

medical advice i.a. in the field of general hygiene and healthy lifestyles, like

washing and bathing at a time when this was not yet customary in European culture,

lots of exercise and a good, balanced diet. The Talmud writes that "more

people are killed by the cooking pot than by lack of food." Besides general guidelines,

specific diseases and their cures are mentioned too, varying from toothache

and stomach-ache to fever and heart problems. Organs and systems of the body

are mentioned. But in oral Torah, a systematic medicine is nowhere to be found,

as we find it with the Egyptians, Mesopotamians, Greeks or Romans. 154

Jewish tradition tells us that all healing comes from the One Energy Source. It is

interesting to research several remarkable parallels in traditional Jewish and Eastern

medicine. A common parallel is phlebotomy.

In both traditions, contra-indications are identical and specific locations are used

for phlebotomy, and although, to my knowledge, an energetic network of channels

and meridians is not present in Jewish sources, still the use of specific loca-

151 Allopathic medicines with their harmful side effects are just as forbidden as excessive and unnecessary use of antibiotics

in chicken industry, whereby public health is massively threatened.

152 Systematic population screening has brought profit in terms of prevention. In the Western world, tuberculosis has

disappeared.

153 Globalisation and 24-hour economy, preservation of child labour and absence of effective poverty reduction constitute

an inevitable command within Jewish (social) medicine, according to Torah-instructions. Unfortunately, contact poverty is

an invisible phenomenon, also in current Judaism, that receives attention occasionally when people commit suicide by

burning themselves alive (Tel-Aviv). The Western world is full of this, as will be made clear in the course of this thesis.

154 Interestingly, the Talmud tells us, that about 2500 years ago in Israel a remarkable text existed, called Sefer Harefuos,

the Book of Medicines, that was hidden by the king. It is not known why.



160

tions at the end of the limbs to treat certain diseases in traditional Jewish medicine

(TJM) is an interesting parallel to traditional Chinese medicine (TCM).

Another common element is the sensitivity to the circadian rhythms of the body.

155

In fact, in Jewish traditional sources we find specific seasons and times of the day

for phlebotomy for the benefit of certain organs and diseases. In traditional Eastern

medicine too, every large organ has a specific time of the day and a season,

and can then be treated best. (The Chinese call this system of corresponding seasons

and times of the day "heavenly stems and earthly branches.")

The respect for herbal medicine and the medicinal qualities of food is another

parallel in both traditions. A fascinating common area for diagnosis is the use of

the wrist and its relation to the elements. 156

Lastly, I want to stress that it is of great importance in every system, how emotions

relate to specific organs. I will elaborate on this later.

An example to complete this short consideration is the heart.

In traditional Eastern medicine, the heart is the location where "shen" or spirit

lives and pre-processes our luck. Diseases related to the heart manifest themselves

through brash, erratic behaviour, irritability, insomnia and the inability to

find inner peace.

Sara Childre, president of the Institute of Heart Math, has developed the scientific

knowledge of “heart brains” in her institute. 157

155 A "circadian" rhythm is an overall 24-hour cycle in the biochemical and physiological processes of a living organism.

156 In Torah tradition, the masters of Jewish mystique were able to discern through the wrist not only physical diseases

(as we find in Eastern medicine, where 6 pulse points, 3 on each wrist, 18 diagnostic positions and up to 28 different wrist

patterns are used), but also mental diseases! Mystical Jewish tradition recognises 10 important impulse patterns, each

manifesting a certain kind of vitality that flows in the body through the soul. In the words of the most authoritative kabbalist

Luria: "A given pulse pattern indicates which aspect of the Devine soul enters the vital energy of the pulse, at the

moment when this pattern appears." (It is interesting that in both traditions, the emphasis is on the primate of function

rather than of structure.) In both traditions, general physical health is dependent on the harmony that is expressed in the

pulses, and any defects or blockages in the flow of vital connecting energy (called ‘Chi’ by the Chinese) will lead to

disease.

157 Science of the Heart, an Institute of Heart Math (IHM explains that the heart brain, like the proper brain, has an intricate

network of several types of neurons, neurotransmitters, proteins and support cells. It can act independently to learn, remember,

feel and sense. One of the key discoveries IHM researchers made about the heart brain, which it also called the



161

From a Jewish perspective, the absence of joy and happiness is the reason that

"neshama" or the core part of the soul falls ill, and as a consequence, the body

does too. Joy, as Jewish sages tell, animates the wrist and brings wellbeing. 158

It is my hope, that our research will demonstrate that a contemporary Jewish systematic

medicine is possible while maintaining the authority of Hebrew language

and Jewish traditions; a Jewish medicine that is associated with complementary

medicine, but also commits itself to conventional Western medicine. The universalism

of Judaism makes it possible to build science philosophical bridges between

various medical modalities and therapies, on their way to unity in diversity

of vision and practice.

In any case, we have already described in this short preview that Jewish tradition

and Eastern medicine can be studied together and, where possible, harmonised:

after all, our motto is “Unity in diversity”.

Finally, this. The referrals to Torah for Jewish medicine have another implication

for the members of the Jewish nation than for all that belong to other nations. Our

research focuses on the universal character of Judaism and its mission to serve

mankind and creation worldwide with everything we received from the Creator,

the Creating Instance or Deus sive Natura (Spinoza), and in that way contribute to

the renewal of world society, to the honour of the One, the Eternal, the Source of

our existence: Ein Sof, the Infinite No-Thing, in this study the Ultimate Concern,

designated as a = 1. 159

intelligent heart, is that intentionally experienced emotions can change the information the heart sends to the brain. Institute

of Heart Math’s studies have shown that emotions such as compassion, care and love, or generally positive feelings,

can actually benefit you in many ways. For example, in one IHM study, hundreds of participants were asked to intentionally

feel positive emotions. The result was, that their heart rhythms became smoother and more stable, particularly after

having felt a negative emotion.

158 Here too, Torah is clear. A positive work ethic is a mission for employers and employees. We work to live, and we do

not live to work. Is everything allowed that is possible? There are many social-ethical questions to be answered.

159 Here too, Torah is clear. A positive work ethic is a mission for employers and employees. We work to live, and we do

not live to work. Is everything allowed that is possible? There are many social-ethical questions to be answered.



162

For a fundamental prop under the Linguistic-Hebrew probative value of the

Source of beginning and end, it is necessary to have logo-technical specialities,

like letter meanings and numerical values, somewhat in the picture. The power of

Hebrew is, that it does not lose its meaning in the weakness of a translation.

The main part of this fundamental study about music communication is about

music of 528 Hz as basic tuning. The wealth of the Hebrew origin is completely

lost in the English Bible translation to which publicists of all religious hue refer

to on YouTube.

Several times, I have confronted you with the basic formula a = 1 and the unbreakability

of 1 as the number of absolute unity, that transcends beyond our concept

of “unity” and is more than the sum of the individual parts, as we say in

hermeneutics. Our “unity” can be broken in plurality; this can never happen to a

= 1. To clarify this, we move to a new paragraph to take a next step on the way to

the equilibrium between Tanakh and natural sciences.



163

Chapter 9 - Aleph is the absolute number

One, the Apex for evolution as creation:

a = 1 produces the standard working formula a = √1 = 1

9.1 The semantic function of the a

T

o determine the equilibrium between both ways of Maimonides: natural

sciences and Torah, it is necessary to use “the number” as a common

standard. Research reports and Torah stories that have settled on the

numbers, are put on hold. Mathematics and quantitative and qualitative numerological

logo-technology will investigate the foundations, even more: we will

have to investigate the ground on which the foundations rest to search out truth

and reality.

Because the reader of this study may be more familiar with mathematics, it is

necessary to start with logo-technics and to describe the semiotic meanings and

semantic effects of the a to prepare the site for a juxtaposition with the natural

sciences.

9.2 How do we return to the fundamental evolutionary

cooperation that unifies us (holism) and do we find the

way to end the Darwinist “eat or be eaten” (fragmentism)?

“A better world for all” is the motto for a future-oriented, renewing Judaism. Service

to man and creation is service to G’d, without turning scientific developments

into religious affairs.



164

To Jews, nature and G’d have a very special connection, expressed by Jewish

philosopher Baruch Spinoza’s G’ds-name Deus sive Natura, translated as “G’d or

Nature”.

It needs further argument how much the connection between nature and the Ultimate

Origin is at issue in this dissertation, because it defies all organised religiousness

without dethroning the Creator, like Western atheist natural sciences

have tried and failed, considering the renewals in evolution-developments, a new

cell biology, dynamic quantum physics and quantum philosophy.

The controversy between regular and complementary medicine is fundamentally

based on a different interpretation of Darwinist evolution, which focuses on

struggle for life to survive individually. 160 The new vision on evolution, like dr.

Bruce Lipton offers us, is in step with the vision of pre-Darwinist scientist Jean

Baptiste Lamarck (1744–1829). He stressed the evolutionary cooperation in order

to be able to survive, instead of the struggle for life or eat or be eaten.

The evolutionary phenomenon “humanity” was born out of cooperation, which

nowadays is in danger of dying because of fragmentation and materialistic view

on society. The reign of genetic determinism battles against the energetic, cell

biological primacy in the system of genetic management and production of natural-chemical

compounds.

The only possibility to free ourselves from imminent downfall is: to give up the

old systems and meet each other in an open dialogue that leads to “unity in diversity”.

The hatchet is buried then and cooperative building can start, also in medicine.

Where there’s a will, there’s a recreating, fundamentally renewing way.

We all know the metalingual meaning of the concept way. There is no spirituality

or philosophy that does not assign a meta-lingual meaning to the concept “way of

160 We will have to take Spinoza’s Conatus essendi, the involuntary urge to survive, under the critical microscope because

he apparently describes homonymous insights, that are confirmed by Darwin. When we have a good look at Spinoza,

we discover the actuality of this Jewish philosopher in quantum physics.



165

life”. Maybe we could even speak of a meta-historical meaning, because it is the

way of all humanity and creation: the way to unity as ultimate concern of the a -

field. 161 But what do we discover when we enter the Western neuro-scientific or

histologic laboratory with Eastern medicine? And when we enter the research

field of Eastern medicine with Western medics? 162

9.3 Unity is a fact we can’t create, but which can only

be executed on us

Striving openly and honestly for “unity in diversity” 163 is the only way to resolve

the controversy between Western and Eastern medicine. On closer inspection,

this controversy turns out to be nothing other than a paradox, consisting of mutual

cognitive dissonance. Cognitive dissonance aims to break down the scientific

value and human dignity of the other, whereby conflict is kept open. If we stop

this, the gap between both scientific, medical worlds is closed by cognitive consonance,

which is reached through the acknowledgement of the scientific value

and dignity of the other stream and its view on man and science.

Here we find ourselves in the heart of Darwinist evolution, where the “struggle

for life” was the leading motive to survive, and not “cooperating to reinforce each

161 “The a-field” is the typology chosen by me for the fundamental ground underneath the discourse that will possibly

lead to the long searched Theory of everything (TOE).

162 As we will see, Western technological medicine will have to formulate an answer to the new biology, that announces

the end of genetic determinism. Natural-scientific research into psychiatry as evidence based medicine has already made it

clear in 2002 that there is no question at all of natural-scientific proof for the correctness of the medical disease model in

diagnostics and statistics (DSM V – 2013). The conclusion is: Western psychiatry rests on experience and agreement

between authorities (APA). When will conventionalism be renounced because psychiatry has no natural-scientific substantiation,

and will genetic determinism be renounced because no gene was found for any psychiatric disease? In addition,

when a gene is demonstrably connected to a mental disease, like schizophrenia, this does not yet establish that schizophrenia

is caused by this gene. Environmental factors direct the experiences and activate the genes in the cell nuclei. Ergo: no

Western evidence based medicine, but an experience science – just like Eastern science. The report of an orthopedic

surgeon on several “sham operations” on the knee stresses the healing power of the “whole man in actu” (placebo does not

only work on psychological complaints). When this is correct, the distance between West and East is less significant and a

scientific complementarity is not only possible, but also necessary. This is only a cross for the elaborate treatment.

163 I come back to this later in connection to the origin of this term and its use in the European Union.



166

other” and thus not just survive, but grow together to an increased awareness and

evolutionary abilities. People in the West, with their scientific knowledge, are de

facto “animals that can think”, like the ancient Greeks have handed down to us.

They think from a logic whose premises are incorrect and generate an erroneous

result at all times. When A is true, then –A is not true. In the West, we have

grown up with this classical truth logic and have developed systems that saved

millions of lives, but maybe in modern history took even more. Living with the

logic of “dynamic truth” still encounters incomprehension in many people. The

resistance against the idea of probability in quantum mechanics determines that

conclusively.

Our modern human thinking still neglects to look back retentionistically 164 to our

biological evolutionary history, that brings us to the unicellular creatures we all

once were. In this research, we have an open vision of the future and we are situated

in the tension field of what is yet to come; this is our protentionistical life

pattern. The concepts of retention and protention take us to the music hall: we

enjoy the sounds we have registered in our emotion (retention) and we wait tensely

for the sounds that are yet to come (protention).

American cell-biologist dr. Bruce Lipton describes, how cooperation among cells

has led to “multicellular creatures”, up to and including man. It is not limited to

the cooperation among cells only, but it also appears that the function distribution

among cells and groups of cells has composed our biology. The development of

cooperation offers sociological and economical perspectives to man and his connections

165 and ends the Darwinist fallacy that we can only survive if we fragment

the existence into ‘mine and thine’, in ‘my right and your wrong’, in ‘high

pitched Western medical science against alleged Eastern quackery’. Or, to speak

164 I introduce the terms retention and protention in anticipation of the music-philosophical concept.

165 I come back abundantly to the ‘nature and nurture’ consideration about natura naturans and natura naturata as we

find them with Spinoza and in other terms in Taoism. For now, beating the pickets as direction givers is sufficient.



167

with Spinoza’s fundamental thesis: the “conatus essendi”, the natural fight to survive

by standing up for yourself.

Summary

Cognitive dissonance 166 between Western and Eastern medicine can only change

into fundamental cognitive consonance if we bury the hatchet of mutual arrogance

167 and meet each other in open dialogue.

But isn’t it paradoxical for a Western exact scientist to make the physical or cosmological

reality a subject they can analyse and interpret methodically in rounds

of talks through a discourse? Surely it comes to the facts, isolated in the laboratory,

and not to a discourse?

And isn’t it equally paradoxical for an Eastern scientist to let go the spiritual discourse

that in many cases constitutes the background radiation for Eastern alternative

medicine, and give the facts from laboratory research an additional, interpretative

voice?

9.4 An entry in history

Since the sixties of the last century, the exact sciences are as governed by the

researcher and his subjective interpretation, as the non-exact sciences are by their

strive for objectivity. This silences us in the West and unites us with the East.

166 With cognitive dissonance we mean the gap between truth and reality. Our ‘holy’ convictions suddenly appear to be

less valid than we thought and instead of striking sail, we seek arguments to cover the gap between our conviction and

revealed reality with the label: although it is different, most still believe that it’s true and that we should keep it that way.

Scientific research loses its power and becomes merchandise of its own interpretation-being right. When the gap is closed,

peace has returned and we speak of cognitive consonance: we agree again. Our being right is saved on the basis of new

supply of arguments.

167 Arrogance has the everyday meaning of haughtily thinking yourself better than the other. However, the villainous

basic meaning cuts much deeper: arrogance is humiliating and refuting the other and his other vision. This also illustrates

the seriousness of the conflict, which has brought us on the way to scientific and societal ruin, unless ...!



168

Cognitive dissonance evaporates when reality in West and East can’t persist but

jointly and at the grace of research experience and its interpretation.

The history of philosophy indicates, that what we typify as pre-scientific today,

because it would not be able to meet the methodological and sciencephilosophical

demands of modern Western science practices, is a time bound interpretation

of a development that started in ancient times. Modern medicine connects

with Hippocrates and Galenus and links the other “lesser” kinds of medicine

to the “quacks” and the “faith healers, the priests of Asklepios”. 168

These three kinds of “healers” existed for centuries before our common era and

therefore have nothing to do with modern differences between scientific and nonscientific.

We will need science-philosophical definitions to clarify these differences. The

preliminary question that precedes the science-philosophical turn or shift of paradigm,

is the willingness to review the Darwinist “survival of the fittest” and to

positively revalue the “environmental factors” Darwin covered too little, as he

himself handed down to us 169 and include their influence in our paradigmatic reality

definitions. Then the environmental factors will pull us away from Darwin

and genetic determinism and bring us to our own biological cell structures in the

differentiated neuro-network, the energetic and chemical driving force of our biological

and cultural-sociological systems.

Socio-political and business-organisational phenomena can mirror themselves in

our constructive cell developments. This not only applies to social-societal

movement in Western society, but certainly also to social inequality in Eastern

social-economic relations which has individual-pathological implications, just

168 The Aesculapius sign as doctor’s character is the sign found on Asclepios’s temple i.a. in Ephesus (Turkey).

169 Darwin, F (red) Charles Darwin. Life and Letters. Murray London 1888



169

like the emotively alienating culture of the West, as will become clear in my research.

170

As a result of cognitive consonance, the terms regular and alternative medicine

will disappear and make way for “complementary medicine” on the basis of integration

of the medical reality-values of East and West. 171

9.5 Prejudices, hard as steel

Jewish scientist Albert Einstein, besides his physics, made striking philosophical

statements that put us clamp and force a solution:

“It is harder to crack a prejudice than an atom!”

Prejudices are like immemorial oaks. A lot of skill and strength is needed for

felling them. “Who are today’s woodcutters that can fell the prejudices?”

My poetic question images my Jewish research methodology and problem solving.

The short preliminary sketch of cognitive dissonance between Western and

Eastern medicine, through the outlined dichotomy, has created an interspace for

Judaism as intermediary, that can be unsuspected to regular and alternative medicine.

Judaism is willing and able to fulfil this intermediary function, because

there is no modern, specifically Jewish medicine. Of course individual Jewish

medics work in Western medicine and in Eastern medicine, like acupuncture and

homeopathy.

170 Philosopher Arnold Cornelis published research about this I will treat elaborately in connection with pathogenesis in

nature and nurture.

171 I use the term “complementary medicine” in relation to Bohr’s and Heisenberg’s use of the concept complementarity.

The rigid mechanics of the 19th century, based on Darwinist evolution and genetic supremacy in the etiology of, among

others, psycho-pathology, still play a severe role in Western medical education. Quantum mechanics puts the predictability

and purposefulness of actions in kinematics aside as a shift of paradigm. The concepts “complementarity” (Bohr) and

“central ordering” (Heisenberg) will play a key role in solving the conflict model between Western and Eastern medicine.



170

Judaism is a worldwide way of living and neither a particular culture nor an organised

religion, although de facto culture and ethical religion are determining

view. It might seem that I want to isolate Eastern medicine from its spiritual

background-radiation and strip Western science of its seemingly necessary atheistic

autonomy, to bring in Judaism as religion through the back door. The previously

cited anecdote about the greatest catastrophe that has befallen Israel, makes

it clear how religious shifts in Judaism and the loss of the explicitly constitutional,

socio-political meaning of the Jewish Constitution – the Torah – is mourned

by many.

One of Judaism’s riches is the possibility of renewal and return to the moment it

went wrong. Jewish renewal movements in the modern world gradually – and

certainly under the influence of events during WW II – became aware of the necessity

to reconsider the constitutional dispositions 172 that developed in history:

partly from within, partly because of external pressure like pogroms and other

alarming events in our history.

From the ancient Israel, Judaism is a culture with universality in the making. Of

course, regulated spiritual experience is associated with the Jewish movement to

the present day. However, it is and remains a cultural renewal movement connected

to the Name (YHWH) and each other, at the service of humanity and creation.

We will investigate, how much the Name has connected itself with this process

and is part of the Informatio that evolves immediately in natural objects and cultural

phenomena, or lets itself be evolved by investigating man and be described

in organic natural- or cultural laws.

172 By “constitutional disposition” this research means the link between Torah as basis and the poly-form cultural practice

evolving from there.



171

The prevailing statement is: nothing can exist without the Informatio Potentialis

Energetica as the Source, Ein Sof, the Infinite No-Thing, that possesses this Informatio

per essentiam and opened it by itself and in itself as creatio ex nihilo. 173

Individual man lives together and cooperates, rooted in connection to the Source

of existence (Apex) and his fellow man. From an altruistic-energetic basis he

forms a human culture, in which diseases and medicine are phenomenological

basic structures that are governed by a broken homeostasis between load capacity

and ability. Philosophically speaking, it is about the ontology of pathology on the

basis of fundamental medical scientific research, including subjective interpretations

of, and personal answers to, the results found.

Because I believe that evolution is not based on chance, the bridging function of

my research at the service of dialectics for both blocks of worldwide medicine in

our modern world (East and West – north-south axis included), will lead us back

to evolutionary questions of human life, when cultural distinctions were not yet

fixed. Naturally, we will discuss the questions about the Creating Instance and the

Informatio Potentialis Energetica. A process of osmosis will liberate us from the

Big Bang-hypothesis which was elevated to truth, and create the power space that

generates the natural and cultural fields in an ongoing process of development, a

dynamic Universe; a process constantly driven by Information, that finds its way

through space and time through energetic carrier waves.

Because it is all about the articulation of the potentiality 174 in Information, we

regard information not as a substantive, but as a verb in this research. Information

173 Creatio ex nihilo is interpreted by the religions as “creation from nothing”, in the meaning of “nothing as withoutsomething”.

In English, “infinite no-thing” is more clear. G’d does not exist in the shapes that we humans have devised.

He is without Image, without beginning and without end. He is Substance causa sui, c.f. Spinoza. On those grounds it is

perfectly right that the Creating Instance created “from the infinite no-thing”. We can understand more of this today than

we did before. After all, we know that the quantum vacuum is not empty and that there is an existence within the quantum

vacuum that is not a Thing. Creatio ex nihilo brings us to wave-particles –super-positions that determine our research for

an important part, because they influence the music frequencies we discuss and prepare for music therapeutic, healing

applications.

174 Articulation is synonymous here to “in actu” through which potentiality becomes actuality c.f. Aristotle.



172

is derived from the Latin verb “informare”, that can also be written with a hyphen:

“in-formare” meaning “shaping from the inside”.

Through osmosis, two types of information emerge, two instances seeking to balance:

1. Informatio Potentialis Energetica per Essentiam, which shapes creation

in a process-oriented and independent way and 2. Informatio Energetica per Participationem,

the realisation of Informatio Energetica by universe and by man, as

the carrier of the information that makes him a co-creator through the creativity

that enables him to describe and develop new forms and new natural laws.

From evolution as creation, the research follows the way to various fields, i.a.

visualised by the numerical values of the Hebrew Tanakh, through the Hebrew

language, translated into the music of ancient Israel, that appears to have spread

over the Middle-East, the Arabic peninsula, North-Africa and North-Asia and

was later included in Christian Gregorian and Hindu and Buddhist Sanskrit. The

research ends with music-therapeutic applications that culminate in the broad

complementary medicine in the Mindlink-system, and that manifest themselves

loud and clear on the internet, titled 528 Hz.

9.6 Static sinus-waves on YouTube versus Hebrew

The relation between the syntax of Hebrew linguistics and the syntax of tonal

music, on which this research focuses, is the justification of my choice for a research

of the Hebrew Tanakh as a base for a fundamental medical-philosophical

dissertation with a major emphasis on the change of mind in conventionalism,

including music communication as energetic treatment-element c.q. instrumentation.

It is therapeutically necessary to work with structured music with a clear syntax,

because of the therapeutic restructuring of the intern-conscious through quantum-energetic

consciousness-fields. This syntactical music is preferable to emo-



173

tional, new age-like music which is aimed at spiritual experience and emotion,

and not fundamentally at musical and linguistic structure.

During transformation to scalar fields, compositional information continues to

distinguish itself from supporting energy, so that structures remain intact like

bearing walls. In this way, carefully counted out and composed music is transferred,

both in form and in content, through these consciousness-fields to the client

or patient, as will be elaborately researched and described from field research

in the last part. The music of J.S. Bach deserves our therapeutic preference because

of its metric-mathematical character and unmistakable harmony.

The need for a critical consideration of the YouTube-supply lies in the lack of

substantiation of music applications and presentations. Some explanations point

to the Hebrew Tanakh, alongside many “statements about healing abilities

through certain frequencies”, however, without scientific proof. On YouTube,

432 Hz and 528 Hz are the two essential frequencies. For my research 528 Hz is

relevant, because theoretical evidence that is scientifically falsifiable and the

healing effect of which can be demonstrated on the basis of empirical research,

can be provided for this. I leave the 432 Hz frequency out of the research, though

interesting things can be said about this.

Demonstrations on YouTube show static sinus waves of i.a. 528 Hz that are,

sometimes for a very long time, released on the brain of the listener, with the aim

of, for instance, recovery of damaged DNA-codons. Harmful effects on the brain

of a continuous 528 Hz sinus tone are not described. Everyone praises his own

goods, the one with an even better result than the other, however, without solid

evidence.

Descriptions of this “528-heart-love–frequency” always come from a general

story that is taken over from one another and functions as truth. The story, that is

connected to the deceased American natural healer dr. Puleo, must guarantee the

truth of the healing effects of these frequencies. It is about music therapeutic pro-



174

ductions, mostly of Eastern-spiritual weft, in their own words connected to Eastern

medicine. Dr. Puleo’s story refers to the Hebrew Tanakh, unfortunately in the

English King James translation, where the supposedly lost Solfeggio-tone system

would be found. Because my being a Jew inhibits me to be dependent on a translation

of the original Hebrew text in such crucial matters, I checked Puleo’s stories

with Hebrew, on which I will report extensively below.

Scientific research on the healing effects and the dangers of irresponsible applications

of the music frequencies that are mostly based on the fragmentary and Eastern

image of man, is not only desirable but even necessary, where it comes to the

intended bridge function and reconciliation effort between Western and Eastern

medicine, including a shift of paradigm to broader applications in diagnostics and

treatment of measurable cell frequencies and music communication and -therapy

as a powerful connecting factor, including Mindlink-system as excellent instrumentation

in the field of quantum-related consciousness–fields to serve as a starter

to this necessary shift of paradigm. A carcinogenic tumour in the breast, found

through a fMRI-scan, is a cell proliferation of which the energetic frequency can

be measured. The energetic counter-information on the basis of the values measured,

can be set in such a way that a homeostasis is generated between healthy

and carcinogenic cells. This calls for a change in thinking and testing. Perhaps

surgery can be omitted through this. Dr. Bruce Lipton demonstrated the possibility

of this type of diagnostics and treatment, through laboratory testing. The penetrating

power of music, transformed into frequencies indicated by the patient as

needed and measured, is a very efficient method, if applied interdisciplinary. This

calls for further research by medical specialists. However, it will not work without

a change of concept and image of man. We must return to the beginning,

where we are heading irreversibly.

It is not done to discuss G’d in a medical dissertation. For the sake of the research,

I put this convention in the freezer for a while, because these (Christian

and Eastern) God views have no active connection to the origin of my research



175

and support no place in natural-scientific discourse. It appears paradoxical for a

research that has Hebrew linguistics as a starting point and aims at an equilibrium

between natural sciences and original Hebrew numerical values of the Tanakh.

9.7 The Source of structural numbers in Hebrew

In Judaism, G’d is an unspeakable greatness and an undepictable reality. Therefore,

Jews call the sexless G’d “the Name” (ha-Shem), the manifestation of Ein

Sof, the Infinite No-Thing. 175

The structural numbers not only refer to the relations, but also to the essence (nature)

of the concept they constitute. For example: number 26 is the number of

YHWH, the four letters representing the unspeakable Name, expressed in numerical

values: J = 10; H=5; W=6; H=5 giving the sum of 26. Every time we encounter

this number in a certain context, there is an attention signal, a referral to the

deeper meaning of numbers.

In a grammatically shortened form, the Name also has number 17. The shortened

name Jah - the ending of the known word hallelu-Jah - has numerical value 15.

So, the number of man (adam) is 45. The numbers are reduced in a Pythagorean -

single digit system - to a single number. So, 45 is 4 + 5 = 9. The referring character

is the characteristic of Hebrew numerical values.

Thus, 9 is the number that in many cases refers to “connection” (nine months for

a viable human being connected to the mother). So, all Hebrew numbers and texts

have a referring significance.

175 The branching of the G’d’s name to Christianity and Islam does not influence this. Traits in Hinduism also suggest a

primal relationship to ancient Israel, to be made comprehensible by Israel’s cultural mandate to replace the Levant’s

thousands of years old Natuf-culture by the culture of social democracy on the basis of Torah as constitution, even though

the Tanakh was only completed and made into the national law of Moses in Ezra’s time, commissioned by the Persian

king. The cultural expansion in the time of the ancient Israeli monarchy possibly influenced the ancient Veda’s that preceded

the Sanskrit scriptures and exert their influence in systems like Ayurveda until today. Therefore, modern sociologists

of religion regard Hinduism as a monotheistic religion.



176

The one who dwells on the number or the story and handles it like a phenomenon

that is suitable for many, often ambiguous explanations, forgets that it is not

about a story as we know it, but about recounting a story, in which we find the

core value “counting”. The Hebrew word for writing equals counting. Through

this, text and number are of the same order, in the connecting service to the underlying

Source. Ergo: Hebrew linguistics directly or indirectly refer to the

Source of all that exists and connects to the energy that maintains our reality in a

constant emanation. In that, Hebrew differs from religious and spiritual life ways

that attribute the source-function to the universe. However, they forget that the

universe is a created/evolved reality, a being and not the Being.

The difference between the Hebrew Tanakh and the wisdom books of other spiritual

streams like Buddhism, Hinduism, Taoism and Confucianism, and the Christian

and Islamic scriptures that may or may not have arrogated the Hebrew

Tanakh and distilled their own theological design from it, beside the universe

almost all refer to Wise men (Buddha, Jesus etc.) and not by definition to the

Source of existence itself, to which a creating connection is intended and established.

The Solfeggio music-system derives its wonder-energy from two poems.

Can “mi” arouse healing power, because the poet writes the Latin sentence “miraculous

gestorum” on this place? YouTube-musicians and technicians keep silent

about these critical side notes, even where reference is made to the Hebrew

Bible. In the last case, it is about finding the truth in the sentences of the Solfeggio-poem,

because it is no more than this. Is it possible that this power source

cures cancer or broken DNA-sequences?

The languages in which wisdoms are recorded are mostly not alpha-numeric like

Hebrew, and therefore unsuited for this numeric analysis for non-theological and

non-religion philosophic research.

The Hebrew Tanakh and Judaism refer to the Name as the Source and Creating

Instance itself, that connects us to the Informatio Potentialis Energetica. With the



177

Hebrew Tanakh, we have to do with the actively creating and recreating energy

that, after realising parts of the information contained in “naturata” (created phenomena

or creations, after Spinoza) offers its research objects to the natural sciences

and other types of science (East and West together). So, without Informatio

Potentialis Energetica there is no evolution as creation.

9.8 Concluding summary

There is an inexplicable connection between Hebrew numerical values and the

Creating Instance, the Infinite No-Thing, in Hebrew Ein Sof, represented by the

first letter of the alphabet: a = 1. Its name is Aleph. Like other Semitic languages,

Hebrew has no vowels and we read from right to left. If we fully write the name

Aleph and count the letter values, we get the letters P-l-a = 1 + 30 + 80 = 111.

In the part about music analysis of this thesis, the particularity of 111 will become

clear. Here, we lift a corner of the veil and point to the numerical value of “wonderful”

in Hebrew: 111. Because in the supposedly lost Solfeggio-system “ut-remi-fa-sa-la”

mi stands for “miraculous”, Latin for wonder 176 , with a 528 Hz frequency,

we will concern ourselves with the importance of “the wonderful” in

Hebrew: the wonder of G’d is a-l-p - pèlèh .

The tone steps of the Solfeggio-system have their own frequencies. Every frequency

is separated from the other by 111 Hz intervals (vector). The conclusion

from this piece of text is: a-l-p - pèlèh = Aleph as Apex and wonder, which

connects the music of the Solfeggio-system, having 528 Hz as the central tone, to

the wonder: the Apex to which every interval of 111 Hz leads and is connected

with.

176 For a Hebrew research, the Latin poem can’t be a terminal station. This is explained in detail in the part concerned.



178

We will distance ourselves from the concept Solfeggio because of the objections

mentioned earlier concerning a poem as origin, and provisionally speak about

Hexachordum (6-note tuning system). The elaboration into a 12-note tone system

will be named Hexachordum Duplex (2 x 6).



179

Chapter 10 - Nature and culture affirm

the scientific value of Hebrew numbers

W

e started with nature and nurture from the whole numbers of the

Hebrew linguistic-numerological logotechnique. We completed the

Prolegomena now with the “reverse movement”: from science with

its math unto the whole numbers of the Hebrew language. Fibonacci will reveal

us the truth of this “reverse pathway”.

The end of these Prolegomena shows us the emergent forces with phenomena that

were apparently born by "unintentional spontaneity" in the ongoing process of

evolution and acculturation.

The work of Ad Commeren will illustrate these emergent processes as we shall

see below.

10.1 Fibonacci sequence: proof of a spirally emergent

process from the Apex, a = √1 = 1

The Fibonacci sequence has captivated mathematicians, artists, designers and

scientists for centuries. The famous Fibonacci sequence consists of the first two

numbers 1 and 1, or 0 and 1, depending on the chosen starting point of the sequence,

and each subsequent number, which is the sum of the previous two. This

looks like: 0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144, 233, 377, 610, 987 etc. 177 If

177 The numbers 144 and 233 are important numbers by the connection with the Hebrew story of the Paradise (Gan

Eden).



180

you draw a line starting in the right bottom corner of a golden rectangle within

the first square, and then touch each succeeding multiple square’s outside corners,

you create a Fibonacci spiral.

In nature there are many examples of Fibonacci sequences; here are some examples

of it.

First the Fibonacci spiral as basic image.

In the basic shape of the Fibonacci sequence, we see the Apex as start point or

end point of the spiral, dependent on the direction of the movement. It is scientifically

sound to omit 0 and to suffice with double 1, so that, in this research, the

Fibonacci sequence is an emergent process having 1 as Apex. Meanwhile we

know that we can’t see 1 without the formula a = √1 = 1.

This means that we see the a as Apex grounding every number of the sequence of

Hebrew numerical structures, which can be worked through and calculated in the

decimal system by dividing the numbers by each other. When we divide 5 by 3

the outcome is 1,618 (rounded), and thus approximately equal to the Greek number

Φ (Phi). Thus, the process from Torah supplies the building blocks for a decimal

mathematical structure that is effectively seen and analysed in nature and

culture. In this way, for science the Hebrew a = √1 = 1 becomes a source of

emergent systems, that would remain floating in the air without this Apex,

whereby natural sciences too would have no solid, empirical ground underneath



181

their feet, even though Fibonacci and Kieth strive for the aesthetic ideal 0, 1, 1, 2,

3, 5, 8, 13, 21, 34, ... etc.

We find Fibonacci’s spiral and the golden rectangle based on the ratio 1,618 in

almost everything. The A4 we write on is part of it. In this paragraph I restrict

myself to the spiral in nature.

Before I display the pictures, a final remark. In nature, there is no straight line to

be found. Everything is curved, up to and including space (Einstein). When we

throw a bucket of water down the drain, we will see the water go circling in a

spiral shape. At the end of the spiral is its Apex: 1. In this way, we can calculate

back.

A good listener rejoices nature and culture. Human proportions are also Fibonacci-proportions,with

which an artist can carve a human out of marble in perfect

dimensions. This perfection appeared unbearable for the Greek, and they asked

for a less perfect image. The most profound shape is our DNA, that can be

sketched in a Fibonacci-way.

In the next part, we will elaborate the meanings and particularities of DNA as

Human Genome System in a double helix. Here, it suffices to evoke amazement,

on the way to the insight in the sequence that leads to the aesthetic ideal.

The nautilus is more or less Fibonacci’s symbol. In this picture, we see the spiral

as a natural turn, with the Apex (a = √1 = 1) as the smallest area: 1 + 1 + 2 + 3 +

5 etc. The aesthetically ideal dimension is the golden rectangle with Φ (Phi) dimensions

in proportions of 1,618 (approximately 1/3 : 2/3 to get a quick picture

without using the golden ratio compass).

In the Fibonacci sequence, we find the Source code of Tanakh, a = √1 = 1, as a

self-emergent process, in the spiral shape that doesn’t sink into nothing, but is

borne by the Fundamental Unity that controls the tonality of the process in Hebrew

linguistics and by this process it always emanates new energies. This teach-



182

es us two inseparable concepts; firstly, we can’t do anything without the Apex as

the start of the spiral movement and secondly, we can’t do anything without the

energy that keeps the movement going.

A millisecond without this proportion “a = √1 = 1” and e.g. Fibonacci sequence

would make life collapse and turn into chaos, until death follows. Naturally, the

supply of the Source code a = √1 = 1 is procedurally accessible and emergently

operating in all other branches of science.

The moment we as scientists become amazed again, ask ourselves the pressing

question what the Hebrew numbers 144 and 233 in the Fibonacci-sequence mean,

starting from the fundamental proposition that everything is energy, with which

144 and 233 supply their own frequencies as emergent sources. We have endorsed

the energetic value of the Hebrew numbers in their root function, the

“general apex”. The Hebrew “whole number” phenomenologically must be clear

as a centripetal, emergent movement – in an ongoing process – with holistic existence

of All, still going back to 1 as Apex.

Naturally, 528 Hz music fits within this emergent structure and disperses energy

that can work healingly. This conclusion will become clear in the conducted research.

The spiral in nature

We see this sequence elucidate

brilliant shapes, not just

in our nearby nature and culture;

in cosmology too, we

encounter the shapes in

space.



183

10.2 John Chandler’s 3-6-9- matrix of Fibonacci sequences

178

Nikola Tesla had said quite enigmatically, “If you only knew the magnificence of

the 3, 6 and 9, then you would have a key to the universe.”

A quote of Chandler

I think I found the key. It is like a cipher. It is very similar to the Vedic

Square (…) Fibonacci sequence is an approximation of the Golden Ratio.

The Golden Ratio is within all of nature (…) Long story short, I started

playing around with Fibonacci. I thought, what if I start Fibonacci sequence

with other numbers besides 1?”

Fibonacci sequence is simple. The string of

sums ends up looking like this: 1, 2, 3, 5, 8,

13, 21, 34, 55, and on and on. It ends up

creating a spiral, called the Golden Spiral.

It is seen in most examples with the

Nautilus Shell.

Chandler decided to see what would happen

if he started Fibonacci on the 9 single

digit numbers (1-9). When he putted the

results in graph form, the lines were essentially

all the same. He decided to take all

the solutions and reduces them to single digit numbers, comparable with the Pythagorean

reduction. He founded that the solutions repeated themselves. The dec-

178 John Chandler Adams on his blogspot http://vortex369.blogspot.nl



184

imal string just goes on forever without any kind of discernible pattern. When the

solutions are reduced to single digit, all the numbers 1-9 and their solutions had

repeating properties.

Chandler started Fibonacci sequence on the number 1, and reduce the sums to

single digit numbers, it creates a repeating pattern of single digits. This repeats

every 24 steps of doing Fibonacci on the number 1.

He repeated the process starting with all the digits 1 – 9 as starting point.

He founded a two-ways outcome. Starting with 1,2,4,5,7 and 8 the solution have

a string of numbers that repeat exactly every 24th step up to infinitely.

Starting with 3 and 6 a shorter sequence came true. Not a repetitive sequence of

24 digits but a 8-fold sequence is repeating up to infinity. Number 9 is the central

number and repeats the solution of 9 infinitely. 179

This 9-folded digit-sequence result, placed in another table of numbers (1-9) is

absolutely incredible in the way it creates relationships and patterns. This “Magic

Square” is a similar table of numbers that has unique properties.

179 The only variation I found in this is that the second string of solutions, which is steps 25-48 of Fibonacci, was that

there was a sum of 2 where it should have been 1. Other than that, no matter how far you go doing Fibonacci and reducing

the solution to single digit, it always repeats the exact same string of numbers each 24th steps of Fibonacci.



185

The outcome of this relational pattern gives 15. 180 For the Hebrew letter-values 15

is the value of hy – Jah, well

known in the word “hallelu-

Jah”. The total sum of all

numbers is 45. In Hebrew

45 is the letter value of Mda

– adam – human being, or

mankind. The outcome of

the first table is 24 x 9 =

216. 181 This number is the

value of the Most Holiest in

the Jewish tradition. Theologically an important item, but here, in a philosophical

study it emphases the deep connection between nature and nurture in mondial

cultures connected with the Ultimate Source of Life; mondial because of the holistic

approach of any (medical) system. Also in the Vedic’s (Vedic square) the

number 9 has a final and infinite meaning, combined with 3 and 6. 182

Inside the lattices of 3 6 9, all numbers (being either 1 2 4 5 7 and/or 8) when

added together result in 3 6 or 9. 183

After all, the Fibonacci-sequences have led us into the Sublime, from nature and

nurture to the perfect human body - as the “squaring of the circle” (Vitruvius 85-

20 BCE, and Leonardo da Vinci) and the visual arts, music and architecture.

180 See 1. Prolegomena, later as 2. Connection with the Periodic System of Elements and 3. DNA-molucules, for a thoroughly

explanation

181 The movie “Pi” gives a confirmation of importancy of the number 216, which should form patterns inside the number

π, the rearch of the actor. After a meeting with kabbalists he discovered the special connection of 216 with the Ultimate

Source of life. This fuelled his entire intellectuality and life-paterns.

182 John Chandler Adams, op.cit.

183 For further explanation of Vedic and other ancient applies see Chandler op.cit.



186

10.3 Conclusion

Despite the fact that whole numbers have no residual numbers in Hebrew language,

it may be clear that Source-numbers are loaded with potentiality, which

provides the basis for emergent processes that activate this potentiality into form

and content, into evolution as creation, without ever losing the bond to a = √1 =

1. Physics, mathematics, medical sciences and pharmacy are all dependent on the

Source that supplies the creative energy, and remain connected to 1, even though

they have averted their eyes from holistic unity and lost themselves in detail.

The moment the scientist discovers that there’s something going on with Fibonacci-numbers

144 and 233 and investigates Hebrew philology, there is a eurekalike

joy about “paradise regained”, and the tree of Life is reconnected to the Tree

of Knowledge.

Phi and the entire nature and culture, medicine included

233 * 144 = 1,618.

Pythagorean single digit reduction

144 + 233 = 377 = 3 + 7 + 7 = 17.

This is the first peculiarity: phi and the small value of hwhy - YHWH

The second peculiarity: I summed the figures after the decimal point as though it

were whole numbers. In math it seems to be unacceptable, but because we interpret

these numers as a recurring decimal residue up going into the infinite.

233 * 144 = 1.618055555555 which 0.0000555555 \ 5 going through until infinity

as the repetitive part. As this continues into the infinite – called ‘the limit to

infinity’ – so in mathematics is 0.0000555555 \ 5 = 0.0001.

Therefore 1.618055555555 = 1.6181 (by ‘the limit to infinity’)



187

The third peculiarity of Fibonacci structure is: 1,6181 is the outcome of the 10th

ratio = 89/55. This has been proved by Robert Simson: 1/1, 2/1, 3/2, 5/3, 8/5,

13/8, 21/13, 34/21, 55/34, 89/55, 144/89 >>> This ongoing sequence points (55 +

89) * (34+55) = 144/89. Next step: (89+144) * (55+89) = 233/144 the twelfth in

the sequence. So the value of Ets Chaim (Tree of Life) and Khedem (in the East)

are present in Fibonacci and Phi.

The fourth peculiarity concerns the 10th ratio, with 89 in the first series and 55

in the second series. By Pythagorean reduction: 89 = 8 + 9 = 17 and in the second

55 = 5 + 5 = 10 = 1

Ergo: 144 + 233 = 377 = 3 + 7 + 7 = 17, the small value of hwhy – YHWH with

the 1 (a) as the absolute basic number.

When Fibonacci, and Lucas as well, are connected to Phi, then the total culture is

connected with 1, 17 and 26, with 26 as the Dominant Number: hwhy – YHWH =

26.

Due to the dynamic development of human culture we are able to work with irrational

numbers, even since the Hebrew language lacks the decimal structure. The

Hebrew language offers all sciences the possibilities to come, from the intrinsic

meaning of whole numbers, to mathematical calculations and formulas in detail.

That also mean there is evolutionary space for emergent processes. So there is no

functional and hermeneutic discrepancy between the Hebrew alpha-numeric system

and mathematics as the language of science.



188

10.4 On the way to a Philosophia Perennis?

The one who wants to process his amazement about nature and nurture in a medical-philosophical

discourse, faces the description of the nature, extent and universal

meaning of the discourse, and the core values as Ultimate Concern.

From the preceding 5 sections of the Prolegomena it has become clear that Hebrew

linguistics supply the core values for nature and nurture as connectedness to

the energetic Source of life and sciences, expressed in the formula a = √1 = 1,

with which the unbreakable, universal unity in diversity is anchored. The first

processing of the formula is the relative distinction between a abs and a rel or 1abs

and 1rel made through a process of osmosis to be described in more detail, without

severing the universal unity in diversity. This means that the formula a = √1

= 1 stays intact and functions as the root for the empirical reality that is suitable

for both discourse and empirical scientific research. However, relativity doesn’t

rest in the formula a = √1 = 1 but in epistemological, natural-scientific, cosmologic

and other scientific research at the service of medical and therapeutic developments,

on the way to unity in diversity.

As said in the caption of this part of the Prolegomena, the presence of the energetic

reality connected to the formula a = √1 = 1 is predominating and so authentic

that no science can mute the Source and cutoff the Apex, the root of empiric

reality. Denying this is the paradox of pseudo-autonomous science.

The a = √1 = 1 leaves us at Hebrew linguistics to demonstrate the universality

and indispensability of the a. The moment the a or 1 is absent, there will have to

be an essential change of the reality that exists in the force field of a = 1.

We need this proof to demonstrate the reality of numerical values in empirical

reality. Just as number 220 refers to Volt and his voltage, which no one doubts, so

we too will have to refer number 26 and its derived values to the Apex and measurable

energetic universality.



189

Qua talis mathematics is the language to describe the voltage, but not the electric

power itself. But one mistake in the abstract mathematical formula can have major

consequences.

Sometimes it isn’t possible to describe the beginning of Existence on the basis of

mathematical calculations and empirical research, like the ultimate consequences

of the protein that encodes for life in DNA.

Because Hebrew, as language of the Tanakh, connects us to the reality of the

Source, we will have to investigate the function of the a = 1 in Hebrew semantics,

to transpose the conclusions to other scientific disciplines, including the natural

sciences at the service of i.a. medical developments.

We conduct this philological research with reference to two examples that could

be further expanded.

We conclude these introductory words by mentioning the presence of the so

called and mathematically processed Fibonacci-numbers in Tanakh. Hebrew

logo-technics puts no other than whole numbers at our disposal. Mathematics

later develop on the basis of the evolutionary, natural and creaturely selfemergent

process, directed by the fundamental “whole numbers” that connect

nature and nurture to the Source through Tanakh. Because of this, mathematics

and other numerical structures maintain their connection to Hebrew numerical

values and overall mathematics, just like the other sciences, borne by the a = 1 as

their energetic Apex.

10.4.1 Two Hebrew examples as linguistic proof

The first example is a singular word. The second example is a derivation

from the relation between the numerical values of two objects.



190

10.4.1.1 tma – emeth = truth

The value of the letters is 1 + 40 + 400 = 441. Number 4 is dominantly present here

because it is a dominant number, like Pythagoras too thought and taught his pupils:

“If you can count to 4, you understood total reality.” Apart from these mystical assertions,

we know from everyday life that number 4 comprises the cosmos, like the

four winds etc.

We score out the a now. What happens? We are left with tm – meth = death. It

appeals to our imagination very much to see truth and life coincide in the word

emeth.

Conclusion

Removing a produces an essential change of meaning. Concretely: when a human

cuts himself off the Source (a = 1), this causes a change in core value. Life

changes into its opposite: death. In other words: when 1 disappears, 4 remains,

and 4 without 1 is without perspective.

10.4.1.2 Two trees in the garden of Eden in the East

To arrive at a good understanding, we must add the numerical values

of both trees and compare them to each other. In the third chapter of

Tanakh we read about both these trees in the garden that was situated

in the East. It is good to say immediately that Hebrew for “East” has

the numerical value 144 and the first tree, called the tree of Life 184,

184 Tree of Life

ajin – tsade = 70 – 90 = tree

hee – cheth – jod – jod – mem = 5 – 8 – 10- 10 – 40 = of life

Totalising: 70 + 90 + 5 + 8 + 10 + 10 + 40 = 233

The total value of the tree of Life = 233



191

has the value 233. Here we see two numbers belonging to the Fibonacci-sequence.

The numerical value of the second tree, the tree of Knowledge of

good and evil 185 , is 932.

We now place both trees in a ratio 233 : 932.

This makes a smallest proportion of 1 : 4.

The moment people choose to abolish the “tree of life”, we again see an essential

change through the disappearance of the a = 1.

In the story, both trees relate as life and death. As soon as life is out, a “dead

knowledge” remains. In other words: where a = 1 is cut away, a science remains

that has to miss the vital juices of the Apex.

10.4.2 Conclusion for medical science

In both examples, we see an essential change through removal of the a = 1.

Hebrew philology tells us that our scientific search for the origin of life, the

safeguarding of life from death, and the effective treatment of fundamental

disbalance as the cause of diseases and their symptoms remain without fundamental

perspective as long as the connection to the Apex is not restored

and the priming bodily and spiritual power can’t take in the recovering,

lifegiving energies.

185 Tree of Knowledge of good and evil

ajin – tsade = 70 – 90 = tree

hee – daleth – ajin – tav = 5 – 4 – 70 – 400 = of knowledge

teth – waw – beth = 9 – 6 – 2 = good

waw – resh – ajin = 6 – 200 – 70 = and evil

Totalising: 70 + 90 + 5 + 4 + 70 + 400 + 9 + 6 + 2 + 6 + 200 + 70 = 932.

The total value of the tree of Knowledge of good and evil = 932.



192

In other words: as long as medical science must make do with a knowledge that is

restricted by 4, medicine is the art of combatting symptoms and learning to deal

with complaints. Without consciously restoring the 1 – 4 relation (a = 1) through

acknowledgement of the permanently emergent Source of healing energies, nothing

“professionally beats”. The developments to quantum-physics disclose a renewed

connection to a = 1. Unfortunately, the Western medical world is not fully

focused on these possibilities yet, and there is still the Newtonian view on the

image of man and the autonomy of the individual, instead of acknowledging holistic

unity, in which man is an organic cooperating cell in the organ called mankind

in nature and nurture.

On the basis of the starting points of this research, I sufficiently substantiated that

absence of a = 1 puts life and sciences on loss.

Because this core value a = 1 is universal and thus of interest to every branch of

life and science, the development of the philosophy based on a = 1 is generally

valid, with a meta-temporal character. This philosophy can therefore claim the

title “Philosophia Perennis”, philosophy from the Source up to crossing the borders

of space time.

Philosophicus Rex

Hebrew philology is based on Torah and Tanakh, and Moses - as a statesman – is

permanently connected to Israel. We however should not see him as the founder

of a new religion, but as a man who, in great wisdom, kept the people to the

Source, through laws and regulations and prophetic reflection on these scriptures,

still bearing his name, li Auctor Honoris. Therefore, as for me, he deserves the

title Philosophicus Rex, King of the “a = 1- philosophy”. The thought that a great

philosopher like Plato probably oriented himself to him, makes sense. The truth

of this statement is not up for discussion here. It is an homage to a name that ra-



193

diates authority to this day, inside and outside of Judaism and will continue to do

so.

The philosophical discourse as hermeneutic part of the research moves around

hwhy - YHWH with value 26 and the derived numerical values, including 17 as

abbreviated value and 15 as the value of hy - Jah, the last word of the commonly

known hallelu-Jah. These numbers will appear to be of great importance in the

description of and relation to DNA and the special connection to the periodic system

of elements.

The conclusion requires from us to analyse the situation of the western medical

domain critically, particularly focusing on the biological psychiatry, the alleged

evidence based medicine and the braking forces on meaning and functions of

music communication and music therapy as well.

The reason why I have chosen for a short exposure according to the state of affairs

in western psychiatry, is the high frequently presence of music therapy as an

important applied phenomenon inside the psychiatric domain.

The link with the content of the Prolegomena has made clear that psychiatry has a

fundamental place in the recovery processes of disorders of the human existence

and mind in the broadest sense (1-4 – disposition, see: Prolegomena).

Narrowing down of psychiatry into a biomedical science requires a new approach

and investigation of the global society we can bring under the title “Culture of

Narcissism”, like Christopher Lasch wrote in his eponymous book published in

1991, that gained global notoriety.

The medical establishment within this culture has become a medical (economic)

power which structural disposition has made clear by philosophical hermeneutics.

The idea of the positional inequality in a culture which aims for equality and cultural

homeostasis must be considered obsolete. But isn’t it a feature of narcissistic-cultural

conventions just to maintain the ego-led structure for their own bene-



194

fit? Is it a fictitious example is it, or an illustration of the global reality existing

inside the medical domain with superiority of knowledge, represented by the individual

physician or therapist? Adjusts the balance of power as "acting subject"

(physician) versus "treating object" (patient) still in our modern, autonomic western

society? Adjusts this balance of power also in the politics of healthcare within

the cultures of the East with their disparities in capabilities? In my humble opinion

the answer on the two questions has to be negative, and a purpose of fundamental

changements.

The philosophical hermeneutics, implemented in the medical domain via university

faculties e.g. under the guise of hermeneutical psychotherapy and pedagogy

as far as I know first originated and developed at the University of Utrecht in the

Netherlands 186 , the medical subject-object relationship is replaced by a new therapeutical

subject-subject relationship. In the footsteps of these developments, the

care questioning man - medical, therapeutic or paramedics – has got a new position

within the value area, where the expert radiates servitude, a renewed attitude

evolutionarily belonging to human individuals as single entities, living by the

power of a curative altruism 187 with compassion as a core value. 188

Anchored in the immutable conventions the suffering human being in his full

dignity is slipping into a dehumanizing qualification "patient", similar to the

praxis in the therapeutic speaking as "client" or "customer".

186 Prof. Dr. Rob Lubbers is the founder of this educational method of treatment. The Langeveld Institute for the RUU is

continuing this development. Reference to the main work of Hans-Georg Gadamer's philosophical hermeneutics can not be

neglected.

187 The term curative altruism is shaped by me as a counterpart of mutualist altruism where "I do something for you, then

I can later aks you to do something to me”. The characteristic of human involvement is an attitude without self-profit,

giving care for others! This brings us close to the philosophy of the French-Jewish philosopher Emmanuel Levinas with

his philosophy of responsibility, with the Other as the Face of G’d that looks upon us and requires to altruistic curative

care.

188 Ricard, Matthieu, Plaidoyer pour l’altruisme, Paris, 2013



195

There is a sociological problem: unique individuals we can’t count. To solve this

problem, we have to create a “format” as sociological group designations, which

depersonalisation as an inevitably result.

It is not only the terminology inside the specific discipline that forms the rigid

part of the ruling conventions, it is also an inevitable part of the economic system:

the first part carries gainfully caregiving services and the other part has to furnish

the necessary financial counter achievement. In this way, the term "customer"

applies reasonably well in this medical and paramedical liberally market idea.

Any society that ignores the Face of the Other, is entangled in a narcissistic desire

and builds a culture with a real downfall trace.

Production, achievement and consumption are core values of our modern, neoliberal

western society – also increasing in the new economy’s like India – a socio-political

community which is responsible for many cultural indicated diseases.

These diseases ask in particular psychiatric related care, but concerned as an

economic burden, which surpasses, together with other factors inside the medical

domain, the ability to pay our narcissistic culture.

Our conclusion is: a revision of the scientific image of man, and the cultural image

too, is inevitable. At the moment we accept our scientific attitude and thereby

we recognize our human limitations, we perceive our Apex, the Source of Creative

Energy, as described in the Prolegomena. So we are able to widen new fundamental

scientific horizons.

The music of 528 Hz, the centre of the Hexachordum Duplex, the corner position

of this thesis, that forms the energetic image (sound and colour) as the channel

between our existence and the essence, situated behind the Universal Consciousness.

Consciousness can’t be the source of existence, because it is creational. I

will elaborate this problem below. For now we conclude this “natural” music sys-



196

tem of 528 Hz is very impressive and challenging forming a new take on the old

concept of man.

In the last part of this dissertation the double-blind, randomized and placebo research

- conducted within the Tesla technology driving the Mindlink system, the

evidence for a positive treatment based on the new humanity, seems to be very

successful. Main change of the vision on the image of man is the quantum vision

with a human body of 70 billion interacting cells, each with its own energy management.

Maternal-Foetal-Distortion-syndrome (MFD) 189

research field of Foetal Programming and the epigenetic factors.

will be connected with the broad

Transformed music - a process through the Tesla technology – reactivating the

“self-recovering power”, the possible return to homeostasis, by way of entrainment,

the process of aligning two or more phenomena. The connection between

the Schumann resonance and the brain will play a fundamental role, according to

the potential for music therapy resulting in our findings of a new twelve-tone system

with - instead of the traditional circle of fifths and the Twelve Tunes composition

method of Schonberg - the duodeciem-circle in dynamic Tuning sequences

based on the numbers 3 – 6 - 9, whose importance has been recognized by Tesla,

according to his statement. My new circle is built like a circle of “natural tunes”,

or frequencies (see below).

189 The syndrome designation comes from Dr. Frank Lake and prenatal psychology. In the Prolegomena I devoted a

footnote to his syndrome. Here I reposition the name and its own elaboration on the basis of my research which is discussed

in Part 4, which I take away from his positions are strictly Christian theological in character. The fetal programming

as it is widely studied is focused on the defects with physical and psychological characteristics at a later age, which

is etiologically as possible to the prenatal stage can be traced back. This road we walk on the energetic cellular level with

entrainment as systemic tool for resTorahtion of homeostasis in various layers of consciousness, the brain functions and

the energetic-physiological structure of the human system as a quantum field of possibilities with collapse of waves to

particles , whose properties can be examined.



197

This combination of integers will also found in the Golden Ratio of Fibonacci and

the Omega 3 – 6 – 9 very important additional nutrition supplements.

From Nikola Tesla

He Writes About His Experiments In Electrical Healing 190

After publishing an interesting article concerning electrical oscillations as observed

by the eminent scientist, Nikola Tesla, so much interest was shown in the

subject that Mr. Tesla was appealed to directly and in response to that appeal he

sends to The Detroit Free Press this open letter:

New York, February 10, 1896

190 Publication of Tesla Coils



198

During the past few weeks I have received so many letters concerning the

same subject that it was entirely beyond my power to answer all of them individually.

In view of this I hope that I shall be excused for the delay,

which I must regret, in acknowledging the receipt, and also for addressing

this general communication in answer to all inquiries.

The many pressing demands which have been made upon me in consequence

of exaggerated statements of the journals have painfully impressed

me with the fact that there are a great many sufferers, and furthermore that

nothing finds a more powerful echo than a promise held out to improve the

condition of the unfortunate ones.

The members of the medical fraternity are naturally more deeply interested

in the task of relieving the suffering from their pain, and, as might be expected,

a great many communications have been addressed to me by physicians.

To these chiefly this brief statement of the actual facts is addressed.

Some journals have confounded the physiological effects of electrical oscillations

with those of mechanical vibrations, this being probably due to the

circumstance that a few years ago I brought to the attention of the scientific

men some novel methods and apparatus for the production of electrical oscillations

which, I learn, are now largely used in some modification or other

in electrotherapeutic treatment and otherwise. To dispel this erroneous idea

I wish to state that the effects of purely mechanical vibrations, which I have

more recently observed, have nothing to do with the former.

Mechanical vibrations have often been employed locally with pronounced

results in the treatment of diseases, but it seems that the effects I refer to

have either not been noted at all, or if so, only to a small degree, evidently

because of the insufficiency of the means which have eventually been employed

in the investigations.

While experimenting with a novel contrivance, constituting in its simplest

form a vibrating mechanical system, in which from the nature of the con-



199

struction the applied force is always in resonance with the natural period, I

frequently exposed my body to continued mechanical vibrations. As the

elastic force can be made as large as desired, and the applied force used be

very small, great weights, half a dozen persons, for instance, may be vibrated

with great rapidity by a comparatively small apparatus.

I observed that such intense mechanical vibrations produce remarkable

physiological effects. They affect powerfully the condition of the stomach,

undoubtedly promoting the process of digestion and relieving the feeling of

distress, often experienced in consequence of the imperfect function of the

organs concerned in the process. They have a strong influence upon the liver,

causing it to discharge freely, similarly to an application of a cathartic.

They also seem to affect the glandular system, notably in the limbs; also the

kidneys and bladder, and more or less influence the whole body. When applied

for a longer period they produce a feeling of immense fatigue, so that

a profound sleep is induced.

The excessive tiring of the body is generally accompanied by nervous relaxation,

but there seems to be besides a specific action on the nerves.

These observations, though incomplete, are, in my own limited judgment,

nevertheless positive and unmistakable, and in view of this and of the importance

of further investigation of the subject by competent men I prepared

about a year ago a machine with suitable adjustments for varying the

frequency and amplitude of the vibrations, intending to give it to some

medical faculty for investigation. This machine, together with other apparatus,

was unfortunately destroyed by fire a year ago, but will be reconstructed

as soon as possible. In making the above statements I wish to disconnect

myself with the extraordinary opinions expressed in some journals

which I have never authorized and which, though they may have been made



200

with good intent, cannot fail to be hurtful by giving rise to visionary expectations.

Yours very truly, N. Tesla

Comment

Our senses enable us to perceive only a minute portion of the outside

world. Our hearing extends to a small distance. Our sight is impeded by

intervening bodies and shadows. To know each other we must reach beyond

the sphere of our sense perceptions. We must transmit our intelligence,

travel, transport the materials and transfer the energies necessary for

our existence. Following this thought we now realize, forcibly enough to

dispense with argument, that of all other conquests of man, without exception,

that which is most desirable, which would be most helpful in the establishment

of universal peaceful relations is the complete annihilation of

distance.

To achieve this wonder, electricity is the one and only means. Inestimable

good has already been done by the use of this all powerful agent, the nature

of which is still a mystery. Our astonishment at what has been accomplished

would be uncontrollable were it not held in check by the expectation

of greater miracles to come. That one, the greatest of all, can be

viewed in three aspects: Dissemination of intelligence, transportation, and

transmission of power. 191

But the fact that stationary waves are producible in the earth is of special

and, in many ways, still greater significance in the intellectual development

191 Tesla, N. “The transmission of electrical energy without wires as a means for furthering peace”, Electrical World and

Engineer, January 7, 1905, pp. 21-24



201

of humanity. Popularly explained, such a wave is a phenomenon generically

akin to an echo result of reflection. It affords a positive and incontrovertible

experimental evidence that the electric current, after passing into the

earth travels to the diametrically opposite region of the same and rebounding

from there, returns to its point of departure with virtually undiminished

force. The outgoing and returning currents clash and form nodes and loops

similar to those observable on a vibrating cord. To traverse the entire distance

of about twenty-five thousand miles, equal to the circumference of the

globe, the current requires a certain time interval, which I have approximately

ascertained. In yielding this knowledge, nature has revealed one of

its most precious secrets, of inestimable consequence to man. So astounding

are the facts in this connection, that it would seem as though the Creator,

himself, had electrically designed this planet just for the purpose of enabling

us to achieve wonders which, before my discovery, could not have

been conceived by the wildest imagination. 192

192 Tesla, N. op.cit. “The transmission ….”


Thetic Part – Medical power in a narcissistic culture

202

Part 3 :

Medical power in a narcissistic

culture

“Let us not seek the Republican answer or the Democratic answer,

but the right answer.

Let us not seek to fix the blame for the past.

Let us accept our own responsibility for the future.”

John F. Kennedy



203

Chapter 11- A critical discourse on neuropsychiatry,

with consequences for

music and health

11.1 Introduction

S

urprised he left me behind. In my hands I held a thick book and a bigtuning

fork; one I had never seen before.

The German builder, copyist of ancient instruments, told his project of

tuning instruments at a pitch of 432 Hz. For the ancient instruments a tuning of

415 Hz is quite normally.

He elaborated the impact of the pitches on the human mind. Experiments have

proven that music tuned at 415 Hz causes dullness and drowsiness.

The tension in 432 Hz however refreshes the mind and makes the audience happy.

I have experienced it myself. In that time I was still unaware of the healing,

universal-transforming power of the tuning of 528 Hz. This sinusoidal vibration,

which is the compositional principle of music, the ultimate pitch could be powerful

for neurological and general music therapy, which - as our practical research

has shown – is the basis for the energetic, integrative medicine that would proven

to be.

To investigate this integrative action, there is not only needed a theoretical, fundamental

approach, but also an empirical test.

This fundamental basis I have partially described in the Prolegomena, based on

the Hebrew numerical structures, which are inseparable from the source of the

creative and re-creative Sound and Light - 528 Hz (sound) and 528 Nm (green



204

light). Practice will illustrate that numbers do not stand alone, but are allusive.

The numbers connect us with the ultimate reality, to which they refer.

The confrontation with 528 Hz on YouTube was profound. I intuitively knew

how to tap of the source which, after sufficient research and evidence, could provide

a grounded element for a renewed medical-philosophical science theory,

with positive effects on the diagnostics and treatments, especially as an energetical-transformative

medicine. That would also create an increasing appreciation

for musical communication and therapy within the medical and therapeutic spectrum.

Since "language" and "sound" are evolutionarily connected via the FOXP2

gene 193 ,"word" and "music" must also serve an evolutionary importance. As I

pointed out previously, my research is related to the Neo-Lamarckism with the

environmental interests, emphasized in the evolutionary choices, such as the

group interests of songbirds. For example, we see the singing of birds, interpret

out of their signal functions and the transfer of messages, is a sufficient argument

for sound and word, as a necessary evolutionary step in communication development.

Therefore, sound, speech and language as well, have an equivalent relationship

with each other. I am not using birdsongs and the sound of whales as epiphenomena

in primate behaviour, but as functional evolutionary binding strength,

with not only external goals, but also with internal effects on the (epi) genetic

expression.

The cultural development of language and music, which among other things lead

to the definition of music as "organized sound", I'll still be excluded from this

treatment and the technological features of word and sound, as two components

193 An exposure of this and is responsible for speech and music will be discussed in further. It should be immediately

noted that the differences in the gene FOXP2 are not necessarily the primates and humans as homo sapiens can be applied.



205

of one evolutionary unit. Since word (language) and sound (music) form an energetic-dual

unit which - taking into account all the detail differences - have a bond

with the FOXP2 gene, the effects will be different from words and music on the

biological-genetic system and must be examined separately. Here is a lot of evolutionary

biology and medical research to which I refer.

It is bringing together sound as a unit, based on a Tesla technology, patented

Mindlink-system, which is a diagnostic and treatment computer data systemic

phenomenon, that splits in words (digital spoken affirmations with a diversity of

energy frequencies) and music (sound of birds, whales and composed music

clips). With this "sound-differentiation", and its administration to the human system,

Mindlink-diagnostics and treatments try to reach the deepest layers of the

human system. This will be approached by means of an interference between the

technologically achieved in audit eve transformation of "Word and Sound" and

The "Cellular energy economy", within the differentiated human system.

This study distances itself from the Freudian definition of "unconsciousness as a

repository of repressed passions" and is represented by me as "the memory of the

experience". Because of this it is possible to transfer epigenetic, multigenerational,

defective experienced effects or ancestry, which are, in order to restore, transmitted

by the gametes to the fertilization, through this energetic system of interference

and non-auditory transfer of energy. Due to the frequency of 528 Hz

granting a basic universal place, we will lay a foundation for the pursuit of homeostasis

within the facets of the system, the consciousness and the non-empirical

link between consciousness and Source. In this way we are able to live within the

a-field of absolute Unity. Here will just fit "shut up in ignorance", with an end to

ever-advancing processes of science.



206

11.2 In sum

The transfer of epigenetic -possibly- reversible experiences and effects, cannot be

separated from their active presence in the internal consciousness within the

"memory of actual experiences". This memory of actual experiences consists in

the presence of the cell memory, such as cell biologists like Bruce Lipton 194 have

been demonstrated. 195 Our research addresses to the importance of the prenatal

period and the foetal programming, as a large-scale object of study within the

university domain. The observed corrupted homeostasis at the cellular level - e.g.

due to epigenetic inheritance – seems to be recoverable, including through the

Tesla-energy Mindlink-system, which has found an emanative, instrumental

source in the Tesla-technology which transforms word and sound. The music of

528 Hz during this dissertation research is developed and composed, and creates a

foundation for the recovery of the homeostasis by the energetic connection with

the Source of existence (see Prolegomena tap).

We, as human beings, are composed out of cells that renew themselves every day

in large numbers. In other words, we are created in the energetic Picture G’d 196 .

194 Bruce Lipton, The Biology of Belief. Unleashing the Power of Consciousness, Matter and Miracles, Santa Rosa 2007

195 "Gamete is a cell type in a diploid organism that carries only one set of chromosomes and is specialized for sexual

reproduction. A sperm or an egg; also called germ cell. Our understanding of how chromosomes shuttle genetic

information from one generation to the next did more than demystify the basis of inheritance: it united the science of

genetics with other life sciences, from cell biology and biochemistry to physiology and medicine. Genetics Provides a

powerful way to discover what specific genes do and how variations in those genes are underlying the differences between

one species and another or between individuals within a species. Such knowledge also has practical benefits, and

understanding the genetic and biological basis of diseases can help us to better diagnose, treat, and prevent them.

Important is the connection with the epigenetic inheritance. The transmission of a heritable pattern of gene expression

from our cell to its progeny That doesn’t involve alter ting the nucleotide sequence of the DNA ", Essential Cell Biology,

Bruce Alberts, Garland Science, 2014.

196 There is a general consensus regarding the source and origin of existing. Except for the denial within a particular

circle of scientists who rather slave of their scientism, their dogmatic views on science and their scientific methods, than

being free researchers. In my research, I am making a distinction between non-conventional research with enforcement of

accepted scientific methodology, but as a counterpart of scientism, that truth on world and human demands, without the

willingness to test their "ism" to the "rigorous science", which should be free of unspeakable assumptions and conventions.

The source is provided among us people of all contents and names. Since my research 'Linguistics and Jewish scriptures,

used written sources', the source in the Hebrew language and tradition provides a name which will accentuate the Public, a

Source that (measured with our limited instruments) is beyond our epistemological capacities. That doesn't only apply the

source, but also for astrophysical beliefs concerning black holes where the laws of physics cease and mathematics as the

language of science must fail It is important that for a scientist the source is unacceptable because there is no empirical

evidence to provide it. The stagnation of the laws of nature on the black holes -under the recognition that these issues

transcend the epistemological capacity and cannot meet the criteria of pure scientific method- is clearly of a different

order. The Source is muted with the debris of Darwinian evolution. I am not against evolution as a process, but I'm more a



207

This means that we are built out of creative energy, like all matter. Since the theory

of relativity of Einstein and quantum physics we know this more precisely.

The Newtonian concept that human beings only consist out of multiple organic

parts, is still dominating the common medical education is thereby replaceable.

This mechanic, Newtonian concept of the human being must disappear and been

replaced by more energetic dimensional human images based on the new biology,

quantum mechanics and information technology. We described this also above,

with reference to the work of Goswami.

As long as this idea is not a common paradigm along biologists, nothing is going

to chance. There are two fundamental points of conflict: 1. conventionalism and

2. Darwinism, as a movement that still dictates the Western science. To overcome

the first point an open attitude from a critical self-reflection is necessary within

conventional medicine and to overcome the second point we will be given an eye

for a revival of Lamarckism, which again came in the spotlight by the development

of epigenetics. "Natural selection" should be replaced by ”survival by joint

interest", in which the struggle for life is defeated by the power of the" curative

altruism 197 . We are not ready yet. Within the scientific biology it also clashes

between biologists themselves: biologists with the vision that human beings are

an entertainment "machine" (matter), and biologists who are seeing human beings

as energetic cell communities.

Most scientists of the new biology are on the side of Eastern thought, which has

always been seeing humans as energetical beings.

fan of the French biologist Jean-Baptiste Lamarck and Lamarckism, with his cooperation as a survival mechanism, rather

than the Darwinian coincidence when it’s to eat or be eaten. Wrongly Lamarckism disgraced science, although older than

Darwinism. As a Jew the Source includes a specific, unmistakable interpretation: Ein Sof, the Infinite Non-Something (nothing),

with a deep silence as the Infinite Non something "beyond our cognitive faculties epistemological" lies. This

flashes a relationship between astrophysics, quantum physics and the Hebrew tradition, which later expanded will also be

discussed. Where can I use the term god, I will refer to that as a Jew and will write - because a Jew unpronounceable name

- hwhy – G’d or Ha-Shem, the name.

197 Curative altruism is the ultimate consequence of which care for the other leads to compassion. This term is represented

by me, because altruism often has the connotation of the mutualism: I will do something for you, if you do need something

to back me. Curative altruism is the human care for each other in a joint process of becoming humanity .



208

Western scientists who are eminently materialistic, have always evoked resistance.

Since the Enlightenment is not only left out the Source, G´d as Creative

Authority, but also the causal link between body and mind has been removed

through biomedical sciences. Dualistic thinking is introduced by Descartes to

especially save the Christian ecclesiastic authority from the influence of the natural

sciences. This man has the image of a man who made a split between body

and mind, and giving the church the authority held on the spiritual side of life

(soul) and thereby giving the opportunity to develop only materialistic ideas to

science. The Jewish Baruch Spinoza was the most important philosopher Descartes

competed against. This is reviled by many Jews who cursed it for life, but

nowadays this is a very hot topic.

11. 3 Music that repairs DNA?

(See: Intermezzo, below)

Those recovering DNA codons (pieces of DNA) flew through the YouTube videos

on my screen. I was upset, because it was lacking any reference to any scientific

studies or other substantiation. That is what they do with the decisions of

such great people and to establish a program of hope, which has not conclusive

evidence.

I read this thesis and unless there were some limited descriptions, I joined a

Christian story that referred to the English translation of the Book of Numbers in

the Hebrew Bible, the Tanakh, as I already described above and which I am referring

to here. The revelation was Jesus and He and some angels refer to the book

of Numbers, where to find the key to the mystery of the lost Solfeggio music system

would be. The authority he has received from sympathizers, according to the

amount of quotations from his experience, proved its purported revelation to

make furore among his followers and others like you. They in turn used his story



209

again to underline and their, Puleo support derivative, visions and expand their

own experiences, but without publishing the results of empirical research, the

truth of their own findings. Through the "stack effect" real "truth" is something

without saying a 'certainty', because it is on a wide support and sovereignty in

'their own circle "that count.

At the start of my Hebrew literature search, the deeper meaning of the number

528 was revealed. To that extent, YouTube put me on the right track. Through my

study of Hebrew, original text to the story of Puleo and others that refer after him,

it became clear that the great healing power of 528 Hz - so praised by the supporters

of Puleo tradition - was not taken from the Ultimate Creative Source, but

was in a poem written in Latin, which was dedicated to the religious feast of John

the Baptist. I'll elaborate on it back in part "Hexachordum Duplex" (Twelve-tone

sequence based on the frequency found in Hebrew).

The significance of 528 in the Hebrew tradition was much more important than I

could have imagined.

So I began my search for the frequencies of love and the heart, but from the Hebrew

texts (Tanakh and traditions) as a linguistic logo technical study on the rele-



210

vance of the number 528 within the Hebrew texts, especially the book of Bemidbar

/ Numbers. 198

When I started I thought - beyond all scepticism - "Interestingly, for sure, because

it is a very old sound system. Maybe we'll get this thing on the track of the music

of ancient Israel, the lost music system? "

If it is really as effective as they claim, there is a music development for music

therapy with the 528 Hz development a new era, with a strictly relevant place for

music therapy within the medical spectrum, as I have already pointed out.

I am going to stop the introduction of this section that makes a consideration

about the appreciation of music therapy in relation to neuroscience and neuropsychiatry

a critical analysis of Western psychiatry necessary. 199

198 Horowitz, Dr. Leonard G. writes extensively in his book The Book of 528. Prosperity Key of Love, in which he dealt

with the codes from the English alphabet. With respect for his opinions anyway I think we must critically must respond to

this treatment because he was a Jew and needed to be aware of the major differences in numerological logo technique

between the original Hebrew Torah (Numbers) and the English language and translation. Although he states clearly religious

enough, it is perfectly clear that he stands for the Christian interpretation of the Hebrew Tanakh and the original text

where it is suitable for him, explaining from the New Testament: a hermeneutical method that even in modern Christian

theology is to be referred to as outdated. Of course, he says interesting things in his study that I have in my study of the

Ultimate Concern of 528 Hz will take and it will reflect critically. Where and disband my research paths definitively

caused by the place that the Latin Church poem takes with him and with all other 528 sympathizers. It's not about the

objectivity of 528 Hz, but the word "miraculous" whose name Mi tone in later Solmization system is the abbreviation.

Without this line of poetry "Mi" would not have been the miracle tone. As an example of the nonsensical fooling with

numbers that have previously been on, I met with Horowitz in his conspiracy theory. The figure 6 is an integral number.

With this I agree, albeit differently than on its grounds. However, at the when he will connect the Mi as the divine number

to six, making "Mi6" created which is regarded by him as the MI-6 as the British Secret Service, I radically am saying

goodbye to this treatment because the health-giving power of the 528 Hz music is abused by the diabolical conspiracy of

the Illuminati and the music invaded to therewith earn much money. I quote: "This MI6 also designates the Illuminati

Gestapo - the intelligence agency of the British Secret Service. MI6 is really the western world's center of espionage and

war operations. MI6 is another example of hashing to serve evil. The designation covers the greatest secreted truth, in this

case "528" - the miraculous healing power of LOVE ", op. cit. page 22. This is how the fantasies when you do not really

analyse, but stories braid around one basic fact: the poem and not the Hebrew Bible reference number, regardless that it

refers to Torah. One thing is clear: the music of Ancient Israel does not know the poem on which it is based on a solmisation

system?. The zestonige music system as we are going to see is a hexachordum duplex (double six tune sound system,

a 12-tone circular distributed based on the classic Pi = 22/7, as I will elaborate below).

199 In anticipation of a treat in part four I mentioned here the discrepancy between biological psychiatry and neurobiology

or by Maes proposed molecular psychiatry because it is a form of medicine that goes to the very core of the cells. The

neuropsychiatrist takes into account what is in, going around and between all body cells. Maes also tackles all problems

and the causes of the disorders with molecular and personalized therapy ... a combination of conventional medication,

omega-3 fatty acids (EPA and DHA) and antioxidants ... successfully applied to CVS and ADHD. The attention to the

immune system and the production of cytokines cannot be underestimated. Deviations from the autoimmunity in particular

the cytokine production appears as experimental research to lay a foundation for psychiatric disorders such as depression,

obesity, ADHD, dyslexia and others

Psychiatric disorders may therefore not be separated from the molecular imbalance in the overall system. That makes the

psychiatric disorders disorder with physiological etiology. I will share the conclusion of Maes when he speaks of psychiatric

disorders such as sickness behaviour. Prof. Dr. Michael Maes "From Freud to Omega-3", Antwerp, 2005.



211

To bring the music therapy for further growth, it is necessary in my view to first

examine the power of today's psychiatry and peeling off down to the core. That is

another way to create greater authority for other forms of care within the psychiatric

and general medical domain. If the medical psychiatry no longer explicitly

pretentious the position of "evidence based medicine" that can take on the base of

fundamental research 200 than there will be room for "value-based medicine,"

which we will find in the Integrative Medicine, and also in the presented here,

specialized form of energy-neurologic music therapy, specialized and authoritative

part of the physiological, biological and psychiatric fields of application.

Now will Follow an overview of the historical and contemporary developments in

Western psychiatry, focusing on the 2013 published DSM V. Without this place

to make plenty of room for a fundamental critique of the DSM classification and

diagnostic method for mental disorders, I cannot single a critical comment by

people from the research to, otherwise my research will stagnate.

After a historical overview that took place in the Netherlands and qualifying for

the qualification of "universal validity in the western area", we will end up with

"attempted hypothetical relocation of music therapy within the medical spectrum,"

which Active solidarity with the Tesla-technology transformation of

Mindlink a prerequisite showed. The reason for this lies in the unique possibilities

of the inferential accessibility of the "awareness low among the symptomatic patterns

and disorders", making "behaviour change is no longer in the mind, but requires

revision to universal sickness behaviour (retrocipation) and the reliquary

(renewal of connectivity), which is developing the dialectic between the internalconscious

and the "transcendental consciousness of the unknowable," that at the

In the sickness behaviour we will find a possible connection with the Foetal Programming as in Section 4 will be demonstrated.

200 APA study of scientific evidence for mental disorders or DSM-IV as evidence-based medicine by the commission

Kupfer in 2002 has demonstrated the unsustainability of it (see below).



212

level of mental life (Goswami) on a hermeneutic change of self-awareness (Gideon)

anticipates (anticipation).



213

Chapter 12 - Medical power and sociomedical

ethics

12.1 Some representative historical lines

I

n the sixties of the last century the Dutch prof. Dr. Jan Hendrik van den

Berg, neurologist/psychiatrist in Leiden made a furore with his metabletica,

the cultural doctrine of synchronous events within the European culture. His

homonymous book, and many other’s published by him, found their way around

all around the globe in many translations. Van den Berg was also called one of

the most translated Dutch writers. His political right-wing idea’s - almost reactionary

views on the equality of the human race and society - made him controversial

for scientists and non-scientists as well.

After his period as a neurologist-psychiatrist, he held a chair at the University of

Utrecht (Pastoral Psychology, 1951) and lateron in Leiden (Phenomenological

methods and Conflict Psychology, 1954). His work will be discussed here in general

terms because of the interesting of his cultural methodology and his spectacular

vision on medical ethics in his old days.

12.2 Medical power and medical ethics

In 1969 he published his book "Medical power and medical ethics." The rapid

and technological advances in the medical community opened for the medical

specialists many new treatment options. But his developments also gave the necessary

ethical problems. Should be the medical power, relied upon medical expectations,

put an end to a new, a maimed life which is hardly being a dignified



214

life, compatible with standards and expectations of medical science? A tremendous

resistance was the primary reaction. Actual memories with the eugenic programs

of the Nazi’s were still fresh in mind of the society.

I will summarize the idea in two questions Van den Berg stated: 1. the medical

power to cure and prolong life .... only where it makes sense and 2. a summary

populist question: "Why to make high costs for human life hardly can bear the

name "human life", referring to the striking images of severely physically and

mentally maimed people, children and elderly? "The discussion about active euthanasia

became trendy.

The medical power, modelled on Van den Berg’s vision, had become a technical

power which has to interpreted the Hippocratic oath in a contemporary way.

Medical ethics has been connected with the Hippocratic Oath being responsible to

the human life, acting as personal medical doctor related to his medical object.

The book "Medical Power and Medical Ethics” doesn’t content empathic engagements

and capital, gains on humanity directly involved, but describes the

life-taking power of the physician, which his medical decisions, taken on the

scale of medical options. 201 The power of the medical profession was brought into

a powerful and clear limelight.

The development of the medical power has lead to a profound depersonalization

and loss of value areas. 202 The individual carrying its own name and taking its

own decisions has lost its identity exchanged by the abstractly “patient”. Henceforth

listening in the waiting room to the voice of the speakerphone: "Next patient".

201 For a brief statement after 40 years of medical power and medical ethics:

http://deeinder.nl/archief/medische-macht-en-medische-ethiek

202 The term "nocebo" is stated her. If the doctor says, "You have to live for a few months," it breaks the vital forces. This

counterpart of the placebo can of course also be deliberately used to activate or reactivate the vital forces. That can have

good effects without medicinal support the self-healing capacity of the patient. More about this topic will follow later.



215

Medical power and medical ethics meet each other in a common understanding of

"professional distance". The technological approach to the patient prevents the

proximal identification, the maximal closeness. 203 The asymmetrical relationship

"doctor - patient" is formalized into the ratio of “the expert” who has the

knowledge knowing what to do, just the opposite of the patient accepting the expertise

and authority of the doctor. The doctor is always right, and the patient

depends on his diagnostics. This authoritive subject-object relation also has a

nozebo-effect as a result of a bad news interview.

An inevitable consequence of these asymmetries is: dehumanization of technological

and medical treatment. The patient’s role is effectuated and when his prolonged

hospitalization, the hospital will be a substitutional “at home”.

A terminal patient said to me at the end of his weekends leaving his family: "I go

home." The alienation of his wife and children had finally struck me. It is amazing

that a clinical hospitalization declassified emotionally the family life, exchanged

his emotions actually settled in a technological, chilly, medical-technical

environment. Chill was carrying emotion rather than the warm compassion within

an empathic, loving and homely system.

12.3 The Sixties: progress and protest

The progress just described was not limited to the clinical medical specialities.

Also the pharmaceutical industry achieved successes, not only on the economic

and commercial fields.

Medical specialization of mental disorders - neurologist-psychiatrist - raised

speedily in the ‘50s-'60s. The increasing medical attention to the human mind

was started at the end of the 19th century, but incorporated in the exclusive medi-

203 Proximal identification is the highest degree of closeness within the hermeneutic clinical treatment strategies is a core

value.



216

cal world as already has been discussed. Medical doctors as Kraepelin, which

dementia praecox as the cause of what in qualifying by Bleuler, was also highlighted

as a physician, schizophrenia that, gave the "psychiatrist" - the seemingly

irreversible position as a medical specialist - a permanent place in the spectrum of

medical specialties. 204 Through this mental development, the human mind and its

'disorders' were dominated by medical models and technological innovations.

Resisting technological medicalization of the treatment of "mental illness" by the

alternative anti-psychiatry that was dismissed as "goat woolly socks-hassle".

The dehumanization of care for the mental suffering man fell gradually into a

technocracy led by neuro-psychiatrists and related neurosciences and led - almost

irreversible - to devaluation of the etiologic and axiological meanings of the existential,

personal story behind the syndrome. Hermeneutics and existential story

shifted from the subjective hermeneutic science proper understanding and translating

the individual life to "evidence-based facts" that were consistent with the

alleged scientific evidence. This development was an inevitable consequence of

developments in society, with its emphasis on production, consumption and performance.

The psychiatrist is a physician and a physician has patients. A physician writing

medication. Ergo: the life which must be listened to and which etiological factors

reside which make a fundamental contribution to the history and the diagnosis or

treatment, that disappeared behind the specialist medical scenes and was replaced

by the reification and the mental distortion which medication should be developed.

A new vision of the "social not trailing fellow man" took place, but the old

vision of Kraepelin remained of spite, albeit in other forms. The non-trailing fel-

204 Psychiatry is as a term that was first mentioned by Reil in 1808 became the first professor of psychiatry, appointed in

1810 at the University of Berlin.



217

low man was reappointed to carry a specific label. The humanitarian careproviding

cordiality which people in a deep hidden grief to cry 205 changed it in a

clinical care, whether or not with harsh measures such as isolation and “chemical

castration”.

The future of psychiatry is in reverse to humanity and to listen to that technical

advice, including implementation of supportive medication. First a talk, then pills

is the motto for this change. The current practice shows the opposite: no pills

(therapy refuses) is therefore no talk.

Within this reversal of policy - paradigm shift – there are systems like music

communication and therapy - as logical ruling power - into the limelight and the

physician in general and psychiatrists in particular a component of a functional,

humanitarian interdisciplinary system with respect, acceptance and encouragement

of human beings in his "socially non-trailing life opportunities."

The anti-psychiatry cannot be denied any right when they lift a finger to our hard

industrialized society without falling into the "flowers and bees' atmosphere of

205 How deep hidden grief in people can be we are only aware in recent decades by examination of the foetal programming,

which, as in the Practical Section of this thesis, ensures that beyond the mental distortions physiological deficiencies

and defects can be hidden, which previously said the term sickness behaviour alone. This applies not only to mental disorders

but also somatic problems such as cardio-vascular diseases and brain damages.



218

the flower power of the sixties of the last century. Medical Psychiatry 206 and psychiatric

practice - as he drafted a harsh treatment history (Betlam as an example) -

fled from the Sixties in the tentacles of the pharmaceutical industry, which put an

end to the era of lacking differentiated psychotropic drugs. One developed treatment

intervenes with compositions of opium to bromides, barbiturates, hyoscines,

amphetamines, as a replacement of the chlorpromazine (Largactil) – that

was dominant. The pharmaceutical industry became a powerful social phenomenon

with a choice of including antipsychotics and antidepressants. This industry

has created itself a market and is conquering the global culture. The trend was

put. No longer "the sick" but "disease" was the object of medical psychiatry. The

psychiatrist was positioned ally of a full health care, because of his medical training

and his future specialization. His medical status became equivalent to the surgeon

and others!

12.4 Diagnostic and Statistical Manual of Mental Disorders

The American influence from the American Psychiatric Association (APA) via

the DSM development was enormously in the world. A McDonald's-like con-

206 The term "medical psychiatry is used by me here as a clarification of the medical character of psychiatry. It is actually

a pleonasm, because psychiatry etymologically is always medical. The word comes from the Greek psyche (soul) and

"Iatros (doctor). A psychiatrist is a "doctor for the human soul." Here we have two sub-problems: 1. the importance of the

human soul is culture bound and, for example, in the secularized West they are undergoing a change due to an altered

scientific humanity. This also applies to the "humanities", the science of the human mind. Are his "soul" and "spirit"

synonyms? For the science human beings are an anthropological dichotomy: body and soul (Platonic). The spiritual meaning

of life sciences employ a concept of man as anthropological trinity of body, soul and spirit (Jewish, Christian, humanist

and oriental heritage). 2. If as a result of scientific advances touch the "doctor of the soul" out of the picture, because

the neurophysiology research into and treatment of disorders of the brain as a substrate for the human mind takes over and

the brain diseases to the discipline of the neurologist must be counted, it means that on closer analysis, the end of the

psychiatry will occur as a medical specialty. Psychiatry will have to focus on the treatment of "psychological reaction

fields caused by the - evidence from neurological examination - brain disorders, which are also handled by neurology.

Since the psychological problems - whether or not caused by brain disease or - damaging - express themselves in human

behaviour affecting the environment, creates a psychosocial health care, where the medical dimension can be simplified

considerably. But more about that topic will later follow. We will see that the term "medical psychiatry" as pleonasm

becomes necessary in the future, as this is soon under the 'enhancement' in psychiatry, it no longer relates only to 'cure'

disorders, but to "improve the human being." The 'cosmetic psychiatry "is a competitor of medical psychiatry. The ethical

issues against cosmetic psychiatry are still enormous. We must accept that, or should this be the part of a paradigm

change?



219

quest of Europe and other parts of the world followed. The manufacturing of ever

new psychotropic drugs became big business. Research of which is contradicted

by the medical associations worldwide revealed 72% of doctors have in some

way a relationship with the pharmaceutical industry.

The link made by the anti-psychiatry according to the situation in western society

was not devoid of truth. With the new DSM-V 207 it addresses a number of new

diseases induced by participating in the modern society, delivering new medications,

important for the psycho-pharmaceutical industry. "Looking too much TV"

is an extremely example.

The new disorders are listed in the DSM-V which was published in 2013. At the

same time opened a new and an attractive source for the pharmaceutic industrial

power. “It’s no longer possible to renew the same pills with a new coloured sugar.

Nowadays we have to accept three "powers" on the cultural map: the medical

power, the pharmaceutical power and the increasing power of the industrially

nutricial supplements. The last power seems to be innocent, because of being the

most importance instrument of the alternative medicine, but I wonder the increasing

industrial production of these nutricial supplements don’t have the same profit

as aim?

The term "healing" appears in the current state of affairs to be lost within the contemporary

psychiatry, lost on the misty plains of all biochemical and neuropsychiatric

developments, occasionally glowing like marsh gas flames without effect.

207 Diagnostic and Statistical Manual of Mental Disorders (ASA).



220

12.5 Jan Foudraine and “Who is made of wood?”

(Dutch translated title contently meaning ‘Who is an object?’)

We turn our critique still going back to the Sixties and the social protests. We

have taken for granted on a large scale the international celebrities from the scope

of anti-psychiatry with their criticism of Western society as the presupposed

cause of many mental disorders, because of the western culture of production,

achievement and consumption. I am in an open, but critical distance of this antipsychiatry,

with hope for a possible solution leading to an integrative medicine

with interdisciplinary psychiatric models and music therapy as well.

Because we draw historical lines, I researched shortly the criticism of psychiatry

as a medical speciality, which is continuously published, the name of the now

passed away dr. Jan Foudraine included. The Seventies did not unmentioned him.

He deserved international fame by his publications, though his private choice for

a band with the Bhagwan movement, scored scientifically bad effects. 208

Foudraine was not counted into the anti-psychiatry, but railed strongly against the

medicalization of mental health, especially according to psychosis and schizophrenia.

"He made his contrarian views on schizophrenia clearly revealed in his

book "Who's made of wood?" (1971) 209

208 He was also known as Swami Deva Amrito, the name he got from Osho, who was called at the time “Bhagwan Shree

Rajneesh”.

209 In "Who is wood," a quest through psychiatry Foudraine argues that psychiatry, which he considers to teach in his

training to know the schizophrenic man wrongly as a patient, someone with a disease of the psyche to be treated in a

hospital or nursing home, cared for by nurses and exchangeable object of research for the treating physician. Treatments

are physical interventions in the body, such as medications, electroshock and even lobotomies.

He rejects the qualitative separation therewith is made between these "sick" and "healthy" people: according to him schizophrenics

are only quantitatively different, namely people with problems like everyone else, although the burden of suffering

itself shows empathy . He makes use of a quote from the American psychiatrist Harry Stack Sullivan, who says: "[...]

we are all much more simply human than other wise, but we are happy and successful, contented and detached, miserable

and mentally disordered or whatever . "



221

The long quote in a footnote emphasises the relevant matters still within the nowadays

psychiatry. It is primarily the change in our culture of "doctor-objectrelationship"

(subjectivity is not allowed) concerning the human relationship

(subjectivity is allowed) who has my interest and certainly in the context of the

development of "rehabilitation and recovery support" of the social trailing, a requirement

in its publication "Bunker Builders" out of I have given a single crucial

quote. Foudraine pointed the lack of real identity as a major problem in psychiatry.

I will summarize his vision together as "a pendulum between neuroscience

and psychotherapy, which however does not stop in the scientific identity of psychiatry."

If you do not possess basic identity you take a resource to a "made to measure"

identity. Releasing these "made to measure" identity is only possible to come to

an actual recognition of the essences. Foudraine constantly adjusts actual conventionalism

on the agenda for an upcoming Integrative Medicine.

Because the "scientific identity" for psychiatry and the psychiatrist has still not

been established and there is a going pendulum movement between illness, disease

and mental disorders, a recourse into the conventionalism - the defence of

the medical establishment - with an advance on the future, in which the evidence

will be provided, for example, schizophrenia and diabetes mellitus within “the

theory of medicine” that fit within a clear value-free naturalistic-nosology. During

a Study Generale University Brno in 1992, I drew attention to this philosophical

thinking, which I quote:

Foudraine argues that this view and treatment approach is counterproductive. Personnel and the patient will not be considered

in order to build up normal human relationships: that is considered as unprofessional. The person in question is

treated as minors and incapacitated thing ("Wood") and goes to behave themselves there. Foudraine argues that the problems

of many schizophrenics just stem from the fact that they never were able to build such relationships in their youth,

and they need to be better to learn.

He describes an experiment in a psychiatric institution in which he gives himself addressed responsibilities and let them

help each other, themselves, and the staff of the hospital clothing Pulling himself as man to man handle the addressed and

his staff require to do the same. After a culture shock getting staff and patients more responsibility and more devoted to the

company, and report dramatic improvements. He calls his department demonstrative no longer an institution for the sick,

but a school to learn to live. (Summary Wikipedia).



222

"The objectivist-naturalistic model of the American philosopher Chr. Boorse is

not only of significance for physiology and somatic medicine. The objectivist

map of the mental functions and disorders must be compiled. He noted in psychiatry

far behind compared to the physiology and somatic medicine. In his article

"What a theory of mental health shouldering be?" He points to the essential description

of the mental functions, leading to an objective view, showing how a

person works.

"Foudraine strove for a value-free psychophysiology, a description of the man as

he is and not as he would like to be. Here we hear the Ethics of Spinoza." 210 - I

quote Foudraine in “Bunker Builders" again in which he gives a quotation out of

a speech of R.H. van den Hoofdakker, emeritus professor of biological psychiatry

at the opening of the Year of the Schizophrenia "... the ideal psychiatrist would be

both: a brain specialist as a psychoanalytic-psycho-therapist." This universal psychiatry

would have to give her true identity and also as a focal point for politicians,

may be the key figure in the mental health, commented Foudraine. 211

Sometimes it is necessary to declare a person "as building from wood", to objectify

the individual as he underlines. Medici require people to be object of science,

academic affairs and research. "Hermeneutical understanding, explaining and

understanding in the service of restoring internal and external communication are

not addressed and understand. 212

210 Quote from my speech delivered in 1992 at a Study Generale at the Mazaryk University in Brno (Czech Republic).

The wishes of Boorse still lingers in the air and despite all neurobiological advances are not gone beyond assumptions and

expectations, without letting go of these supposed necessities. The question of the extent and nature of "suffering" it not

the case as he determines the difference between illness, disease and mental disorders, but the objectivity of the nosology

in the theory of medicine. Based on the degree of suffering it is pragmatic and should be avoided as the basis for a distinction

between the different diseases. He also assumes a value-free psychophysiology.

211 Foudraine, J. Bunker Builders, Ambo, Amsterdam, 1998, p. 18. It is remarkable that this book was first published in

October 1997 and lived the 5th edition in January 1998. Talked about importance of vision.

212 Foudraine, a citation page 16.



223

12.6 Conclusion

The (psycho) medical power in its pursuit of scientific identity and evidencebased

medicine strides unintentionally within a perhaps unstoppable process of

alienation of humanity.

Is not this a hard conclusion? Yes.

Like every 'yes' also follows the relativation: "but".

The call for a paradigm shift is not heard when the system is functioning as intended,

and has room for structural changes. Thomas Kuhn says that a change of

paradigm is necessary as the current situation cannot be solved with the old way

of thinking and acting. That creates a new paradigm which is necessary, because

revision of the existing inadequate.

Kuhn did not leave this undiscussed. Stephen Toulmin stressed that the renewal

of science should be an ongoing process of self-reflection, with openness to ever

new adjustments, focusing on future opportunities.

Personally I think Toulmin is relevant, but if we have passed a point of no return,

we must learn from Albert Einstein, that we are not able to solve problems with

the same thinking, and so the problems have arisen."

Does this mean that we are at a paradigm shift the achievements of the "old way

of thinking" must jettison and must declare invalid? Absolutely not. It only requires

a new but integrative system of thought. That is easy to say but hard to

accomplish.

Science and human beings are forcing forces that the back-and-forth oscillating

balance to be within the psychiatric care in the middle that gives an identity to

psychiatry, requires a willingness to revise the fundamental questions. That willingness,

faithful to the fundamental conventions, leaves no space for the hegemony

of Darwinism in our time, in which - unjustly fell into oblivion - Jean-Baptiste



224

Lamarck is in revival. 213 By this revival the development of the epigenetics has

provided a boost. 214

Humanity and ethics

Another brief word about the 'ethics of humanity is a generalization, but to get a

few things clear it cannot be otherwise. This ethics of attention and closeness

transforms the medical psychiatry into empathic-judgmental service and frees the

physician from he spells of his or her "divine status" as a representative of Asklepios,

the Greek god of medicine, renamed "Auctoris Medicalis in Scientia" .

The ethics of humanity stops deemed necessary objectification, and re-humanizes

the medical specialist of expert speaker listening to fellow man, to whom the human

suffering (normativity) and no longer the theory of medicine (objectivity)

forms the base. That certainly applies to the psychiatrist out of mouth the objectification

of the patient (diagnosed as degenerative un treatability) persistent stigmata

and disappointments are begetting. He (the patient), after all, had to experience

so much understanding and confidence in his suffering.

Talking about a paradigm shift will only be successful if about the findings of the

"old thinking" and the "old handling competences" when a preliminary consensus

is reached and the contours of a new thinking are coming up.

213 Snait R. Gissis and Eva Jablonka Transformations of Lamarckism, From Subtle Fluids to Molecular Biology, MIT

Press, 2011

214 Eva Jablonsky "transgenerational epigenetic inheritance: prevalence mechanisms, and Implications for the study of

heredity and evolution", The Quarterly Review of Biology, 84-2, 131-176 - June 2009



225

Chapter 13 - Critical voices about psychiatry

P

sychiatry and more particularly the pathology will not continue until

they dare to go beyond the dichotomy of facts and values, objectivity

and normativity, science and humanities. We can think of the so-called

dynamical systems theory and other system approaches. In such an approach there

are disruptions (impaired preceded functions, Gideon) localized at all levels. (...)

The different types of disturbances may be related to the context in which they

occur and the 'what' or 'who ', in which the dislocation is attributed: neural circuits

(example: memory problems during depression which are attributed to atrophy

of the hippocampus), certain interactions between the central nervous system

and the periphery (for example, sensitivity to stress which is attributed to disruption

of the hypothalamus-pituitary-adrenocortical axis), or the person (e.g. social

inhibitions attributed to one's personality). Increasingly it comes to three things:

the level, the context and the support to which the disorder is attributed. Such

consideration makes the pathology complex, dynamic and open. Besides the biological

dysfunctions this disease model also includes psychological disturbances

and disruptions in social equilibria. The model shows the fact that a structural

disruption at a certain level is located at different levels. Indeed, admit that even

in the presence of structural disruptions it is not always the disruption that makes

someone sick. So does a genetic predisposition to mood disorders (structural dis-



226

ruption) in someone with good coping skills only lead to depression if there is an

accumulation of stressors. These are the stressors that make you sick. 215

Glass joins the criticism of the latest developments surrounding the new DSM-V.

This is in the next report, in which scientists give their critical light on the developments,

currently in psychiatry, we execute globally. They have joined forces in

an authoritative collection ‘Handbook of Psychiatry and Philosophy’. To illustrate

the current states of affairs we read the report of Trudy Dehue with the title

"On the (un) scientific nature of the DSM, an epistemological perspective. 216

After discussing the situation and seeing the effects, we describe the key concepts

for our purposes being the most important data of the Handbook.

13.1 Schizophrenia and auditory hallucinations: an illustration

The first reason why I have chosen schizophrenia as illustrative model is the presupposed

connection with the mentioned mutation of the FOXP2 gene on the 7th

chromosome with the possibility of silencing the gene expression by treatment

with memantine. 217 Central to this stands the question of possibilities for a complementary

treatment by Tesla-energy, for activation of self-healing through the

Mindlink-system, including the epigenetic causation however without damaging

the DNA sequences.

215 Prof. Dr. Glass, Gerrit, Handbook of Psychiatry and Philosophy, The Time stream Utrecht in 2012, pg. 48. Glas prior

to the long quotation given a critical light on the disease as "harmful dysfunction" by Jerome C. Wakefield. He tries in its

design to keep the objective base of the disease in this image, and also makes a link to the DSM. Although Glass DSM-IV

critic increases, he is silent on the developments and research reports around the DSM-V. That is unfortunate, because

many of the suggestions are put in a contemporary light.

216 Trudy Dehue, on citation page 53-69

217 Memantine (1-amino adamantane derivative) is an un competitive NMDAR antagonist with moderate affinity (...)

NMDA receptor is a subtype of glutamate receptors. Memantine is effective in Reducing the negative and general psychopathological

symptoms of schizophrenia.



227

Second, my choice for reporting schizophrenia is linked to my n = 1 examination

of a schizophrenic patient with auditory hallucinations, a diagnosis merely on

DSM-classification. Her situation and improvement I will describe in the practical

part. 218 Third, my choice is determined by the "binaural beat" as the energetic

frequency therapy which is used for the creation of sub-audible frequencies of 14

Hz, which - reading the claims, unfortunately without scientific evidence - people

with schizophrenia would react positively.

My scepticism to these claims is enormously, but the intricate neurological research

via FOXP2 genetic effects, functional neuroimaging research of the relevant

brain regions, and the "dichotic listening" experiments with the advantage of

the right ear in reactions (REA), did appear my scepticism and I became willing

to accept the "binaural beat" as a experimentally factual matter. 219

In the practical part I have described the meeting with the above mentioned patient.

The final reason of my choice for schizophrenia as illustration concerns the

critical reflection on the neurobiological psychiatry.

The new DSM-V has been replaced published facts, results of neuroimaging and

neurophysiological studies in the United States, commissioned by the American

Psychiatric Association (APA) with international participation of high qualified

. 218 This personal research is a starting point for the reversibility of epigenetic inheritance which does not damage the

DNA sequences, so the idea of schizophrenia as "irreversible degenerative disease" is to be released until such time as

neurological research has shown that there is a causative relationship that exists between the detected DNA defects and the

phenomena which can typically be considered symptoms of schizophrenia. To date, this is not the case, all the suggestions

of specific genetic findings derived from different research groups, twin studies etc. No one has been able to say that these

genetic mutations have caused schizophrenia. However, the outbreak of schizophrenia may well have edited the selected

genetic phenomena. That no one prevents searching the value and reality of human suffering and non-trailing behaviour in

epigenetics to restore capabilities. The micro-contextual conditions may have led to genetic mutations. In contrast to the

prevailing model of the genetic determinism we must conclude that the genes themselves contain no on / off button, but be

triggered by environmental factors, of which I've made in a single sentence mention. Schizophrenia: incurable, degenerative

follows it to death? Evidence at first but once neurologically that the term "schizophrenia" consists, as we think two

centuries it exists. The development of DSM-V has previously placed himself on a downfall route. But that requires a lot

more research that is outside these specifications.

219 In the study of Hugdahl we read about differences or "hearing voices" at patient's healthy and Individuals. He reports

about the attention to and report from the stimulus presented in the right ear (forced-right, FR) or left (forced-left, FL) or

with no specific instruction (non-forced, NF). His study also reports about the differences or bottom-up and top-down

conditions. "Thus the three instruction procedures can be said to contain three different cognitive processes: a perceptual

process (NF), an attention process (FR) and an inhibitory control process (FL) ...". This study can be used as an entrance

for Further research on the effects binaural beat in the here Mentioned music therapy.



228

scholars. Since the results of these studies are quite shocking, I draw the necessary

attention to this list concerning my research on these developments. These

results are for the definitions of mental illnesses and treatments, but also for the

socio-cultural influences in healthcare of paramount importance.

To this I opt for psychopathology, with the neuropsychiatric vision of "schizophrenia"

as a starting point. This choice must be fruitful because music therapy is

an effectful therapy for people with a fundamental communication disorder, of

which the schizophrenic patient is a serious representative.

Music therapy based on music 528 Hz in combination with the technology Tesla

treatment Mindlink can be of great significance for these people. This interference

system descends within the lower regions of the epigenetic transmission of

multigenerational factors, which may have effects on neuropathology, without

being able to prove that the cerebral distortions are absolutely causative for the

etiologic and epigenetic expressions. The latter would result in an "evidence

based medicine of neuropsychiatry".

The pharmaceutical industry has become a force that determines the fate of many

patients: positive, but in many cases negative. This applies in particular the plight

of schizophrenia and the social-contextual causality (environmental factors),

which as possible casualties are denied, based on the fear of laying the "alleged

debt to the parents and relatives." Also fits the idea of the possible causal link

between the internal and external conceptuality, the search for the complex causes

of this incense suffering from schizophrenic people in which all scientific attention

is focused: biotechnology to the chemical-physiological function and variable

obstructions in the brain with a procedurally reducing plasticity.

Biological psychiatrists deliver attempts to a conversation about the etiological

importance of these causal relationships, according to some publications. Conventionalism

reigns supremely. Fortunately, inside the sectors protest movements



229

have started. The psychiatrist Jim van Os opened for this purpose a new website

where people can ask their questions, being helped in different but positive

way’s. 220

He also joins the ranks of experts who believe that a paradigm shift must come up

with new interest in the "whole man" without the DSM. He called his book "Beyond

the DSM-5" and “Schizophrenia doesn’t exist”. 221

13.2 Critical reflection on schizophrenia and DSM V

"Schizophrenia and to schizophrenia related psychotic disorders are very debilitating

mental distortions. These disorders are probably caused by a combination

of hereditary of environmental factors. The validity and operationalization of the

concept of schizophrenia are controversial” 222

What is the value and the meaning of "The validity and operationalization are

controversial ..."? The compilers of the answers on this question – the research

committee Kupfer – published in 2002 a critical report about the "contentious"

validation because no conclusive neuro-scientific evidence was stated for an evidence-based

medicine of mental disorders in the DSM-IVtr classification symp-

220 In the past 20 years there has been much research into schizophrenia and psychosis. The research group of professor

of psychiatry Jim van Os, together with many colleagues in the country showed that psychosis is a normal human variation.

One where you with the right help and support often well can cope.

Some of the mental health (mental health) does not agree with this matter. There you will still get an old-fashioned 'schizophrenia'

diagnostics and high doses of antipsychotics. (https://www.schizofreniebestaatniet.nl/schizofrenie/wel-of-niet/)

221 Os, Dr. Jim van, Beyond the DSM-5: Personal diagnostics into a new Mental Health Care, University Medical Center

Maastricht, 2014 and Schizophrena doesn’t exist.

222 Dutch statement (GGZ).



230

tomatology . 223 Now the conventional psychiatry need to do thoroughly selfreflection

and have to reinvent themselves on a new paradigm.

"For the psychiatric examination, one interprets the information obtained from

history and collateral history and from observation of the patient. One example,

concludes without empirical research into the diagnosis of schizophrenia with

paranoid delusions, auditory hallucinations, speech poverty, and / or disturbances

in motor function, matters that refer to possible mutation of the FOXP2 gene and

other loci on the 7th chromosome.

Use of the passage: "one interprets the information obtained from ...". Interpretation

in diagnosis leads to conclusions from the interpretation of subjective perceptions.

This also applies to the somatic differential diagnosis of exclusion as a

goal. "On indication ... an fMRI scan of the brains. These diagnostic capabilities

of hermeneutics are the leading factor. Lastly, an fMRI scan is the perceived image

that the "possibility" bends toward a "reification, a fact objectively," a brain

abnormality and is the verdict: schizophrenia is an irreversible degenerative disease.

224 The cable attachment with neurological evidence for the diagnosis of

schizophrenia would have been delivered. As I've mentioned before, this "evi-

223 The DSM-IV has been achieved by consensus. It is a product of meetings. But science is not the same as "meetings"?

Prof. Dr. Trudy Dehue sketches during a debate in Amsterdam in brief the history of the 2013 projected DSM-V. Plans for

a DSM-V originated in 1999 when three influential policymakers in the US mental

health, the conclusion was drawn that the DSM was revised. Although the DSM is based in many countries, has the diagnostic

handbook and decides what is unacceptable suffering or unacceptable behaviour, the DSM is also often exposed to

criticism. Too often it leads to the conclusion of 'comorbidity', to patients who may be grouped often suffer from various

disorders and places the other people in different categories that we wonder if they could not be better considered as

belonging to one group. But the most important argument to be had to revise the (hopeful) expectation that genetics and

neuroscience research now could solve the various problems of the current DSM-IV. A first step towards a new DSM was

therefore set up by a committee to investigate which of the existing DSM categories is actually linked to neurobiological

indicators. By linking the categories of "objective" criteria physiological diagnosis in psychiatry it would not only be

based on patients reported feelings and observed behaviours. This would make the psychiatric diagnosis considerably

more reliable. This would thereby be more psychiatry as a medical discipline on the map as coexist areas such as neurology

and internal medicine. The committee met in 2002 and their results are on the outside. Apparently, none of the DSM

categories was to connect with certainty to a neurobiological indicator!

224 In personal correspondence Prof. Dr. med. Holger Hoffmann informed me as if from the University of Bern that cures

40% of schizophrenia patients in the Soteria clinics in Switzerland and Germany by a total human-centred, personal counselling

with barely supporting medication. It does not understand the tenacity of the neurobiological psychiatry. Environmental

factors seem here to prove that we should think etiologic in schizophrenia at the epigenetic genome and not the

mutations by an alleged "schizophrenia gene". Personal attention and a positive energy negate the neurobiological conclusion

"irreversible degenerative." Even in this notification is the need for a paradigm shifts to the front. Again it offers such

a result opportunities for transforming "sound and speech" therapy as the hermeneutic Mindlink empowering therapy.



231

dence" is only an indication of the existence, and not the onset of symptoms associated

statistically, c.f. the DSM diagnostics.

"Schizophrenia and other DSM diagnoses for psychotic disorder are not separate

diseases with a specific phenotype, or a specific etiology. At the level of phenomenology,

there are smooth transitions between schizophrenia and bipolar disorder

and schizophrenia between normality. At the level of the etiology it has been determined

that genes that increase the risk of schizophrenia, as well as the risk of

other psychotic disorders and bipolar disorders. Moreover, the term 'schizophrenia'

reveals confusion because many people still thinking of an outdate notion of

the split personality. 225

Strikingly, the cautious wording has to be used here. The risk model may refer to

the exceeding of thresholds by external factors that the 'present vulnerability' operationalization

which breaks the disorder. This too is a theoretical consideration

without hard evidence. Whether this vulnerability is genetic, epigenetic or otherwise

provided and it gives no evidence the brain is – arising from genetic determinism

- still responsible for the outbreak of schizophrenia as a reificated disease.

It is the moment for a justification of my critical reflections acknowledging with

authoritative experts / scientists to speak their critical and adequate statements

bundled in the former mentioned handbook. 226

13.3 Critical voices of specialists concerning schizophrenia

A note from Van den Bosch is a part of my own experience and the propositions

involved in clinical hermeneutics as well. I quote Van den Bosch: "... Central to

225 Dutch statement (GGZ)

226 Denys a.o. Handbook of Psychiatry and Philosophy (Dutch), 2012.



232

the current therapeutic approach is the view that schizophrenia is a disease prone

to chronicity, often accompanied by significant limitations in cognitive, emotional

and social. These restrictions justify a rehabilitation approach. The futility of

treating the disease, such a statement within the biological approach will be only

really justified as the embodiment of a mental disorder to a "disease" within the

definition of nosology - the theory of medicine - is included and, as such, has

been established by neurophysiological studies. Until then, the idea of

schizophrenia may be a genetic disease, which is incurable and has degenerative

character, but is not proved. Treating the disease is “futile", is a pragmatic conclusion,

which rests in the normativity of the institutions and not on medical objectivity”.

That is the debate surrounding the new DSM-V. From this pragmatic

basis, we can draw the following conclusion, contently following Van den Bosch

saying:

"It is not about the disappearance of the 'disease', but to limit the effects of the

disorder, learning to deal with the constraints and the processing of this reality by

patient and family (...) it's about the resilience of increase patient and his social

network with (...) shall not forget that patients develop all kinds of methods to

maintain itself, to suppress symptoms and possibly prevent by coping methods

(...) cerebral and genetic vulnerability is permanent and difficult to change”. 227

We need to understand the vulnerabilities mentioned here as the necessary genetic

factor which is presupposed for the construction of the disorder. Without this

vulnerability a predisposition to schizophrenia will not necessarily lead to this

effect.

Here is a note from Dr. Jos de Kroon concerning de-institutionalization of psychiatry

in the ‘60s of last century USA, which was the malleability of society,

central and still in the technological optimism of that era schizophrenia always

227 ibid. 156



233

called a brain disease founded with historical certainty (Kraepelin and Bleuler),

which soon will be overcome by technological progress. De Kroon says:

"Madness, psychosis or schizophrenia is a brain disease has to be called a “medical

magic trick” that will reveal themselves in the future." 228

13.4 DSM-V, a deep disappointment

We will follow the international press regarding the published research on the

scientific reliability of the DSM-V.

Under the headline "The diagnose madness or DSM-V" denounced the Internet

magazine Time Magazine the "bragging" of the APA that the DSM-V "rigorous

and evidence-based “ whereas it just discusses the inclusion of disorders such as

bitterness, apathy, excessive shopping, and overuse of the internet.

Time Magazine poses the question whether "a thousand Ph.D's gathered at a dozen

conferences” ever really can fathom the meaning of vague symptoms such as

fatigue, low self-esteem and feelings of hopelessness. The "sit around the Table

‘'-method should still be called “science”, suggested Time Magazine. The qualification

"scientific" would only connect to the DSM-V if the book should be constructed

on strong neurobiological evidence. And that is lacking right now.

Commentary

We can reasonably assume that the term 'evidence-based' is absolute realism in

psychiatry and has lost the conventional medical care models, now they are finally

opening of proceedings and must face that the firm, authorized claims which

228 Kroon, Dr.Jos de, on citation page 174



234

does take away the hope of recovery. One should be honest and finally get to

Lamarck saying that "environmental factors" since our human evolution have

always done, and there must be fundamental differences between the nosology of

somatic diseases and mental disorders. Evidence-based will have to be proven

and than be flanked by equally powerful value-based-medicine, causing dualism

in the medical worlds, which have lost their strength and a reciprocal service to

the medical developments and practice, bundled into Integrative Medicine, to

well-being of humanity.

In the previously described term "sickness behaviour" we create space for the

possible physiological basis among the mental disorders that epigenetic prenatal

and may be indicated because of potential foetal programming.

Resume

Ratification of mental disorders such as schizophrenia and psychosis is motivated

by the desire of the medical speciality to secure the medical nature of the action

competence, such as the treatment of diabetes mellitus. This reification does not

change a penny between neurosis and psychosis as happened in the history of the

early 20th century. Anyway there should be found a physical basis for the aetiology

of mental disorders indeed, because "we are our brains", in the opinion of

Dick Swaab, is it?

Of course our brains play a prominent role, but no fMRI-scan, no other perfect

matter can prove the exclusive causation of the distortion observed as a brain disorder

or a defective genetic marker. It is perfectly conceivable that behaviours are

caused by inherited environmental factors, prenatal uterine disorders and insecure

attachment, with possibly disruptive effects on brains and genes.

Now it seems impossible at this stage of neuroscience research to be "evidencebased"

and what statements do belong here, it seems more sophisticated to speak

about scientific opportunities instead of facts. Why do people cling to the static



235

notion of 'fact' is embedded in our culture, in which facts coincide with truth.

Facts are established indeed!

As we will see below, we cannot do anything else but approximate our culture out

of the dynamic developments in a cultural community of opportunities, in order

to fit new developments of information and communication.

13.5 Mental disorders and psychosocial pharmacy

Because we believe that we are dealing with brain diseases as reified objective

facts, it seems inevitable that ongoing research focuses on pharmaceutical researchers.

The brain diseases must be fighting with proper medication indeed. But

when we talk about a brain disease, is it allowed to remain on the field of the psychiatrist

and isn’t it the exclusive specialism of the neuroscientist to treat brain

diseases?

Psychotropic drugs the only way?

It seems to be proven that the brain disorders only can recover by medication? [I

think in particular the negative symptoms of schizophrenia, or sometimes opposing

effects of both conventional and atypical antipsychotics on this.]

Or have the visual brain and energetic - scalar transformed information to offer -

a symbiotic relationship that reaches the brain in "administration" of the energetic-powerful

and positive information to this emotive molecular information just

as how 'medication' works?

Deep empathy and expert concerns would thereby give direction led to the recovery

of the manifest behaviour as sickness behaviour. The lowering of thresholds

of stress (prenatal programmed HPA insufficiency, social psychological and / or

neurochemical stressors) that may have played a role in the onset of the disorder,

for which there are multi-generational, existential stories of relevant excuses.



236

Finally, I try to draw a conclusion from the quotes that can serve as a start for a

cultural-evolutionary treatise on 'fact' and 'opportunity'.

13.6 Evolution Theory, features and the disease concept

[Andreas de Block 229 en Pieter Adriaens 230 ]

More and allow more researchers from the humanities inspired by the theory of

evolution. Of course, in some academic circles there are some reservations about

the application of the theory of evolution to human behaviour and thinking. But

while the controversy about evolutionary psychology, human behavioural ecology

and evolutionary anthropology certainly are not facing such a nature, that the

growing popularity of the Darwinian disciplines and sub-disciplines have to deal

with.

Parallel to the "evolutionary revolution" in the humanities also occur in many

medical disciplines a Darwinian revolution. (...) But psychiatric illnesses are all

but increasingly studied from an evolutionary perspective. Since the nineties of

the last century such a study called "evolutionary psychiatry." Central to the evolutionary

psychiatrics research is the question of the relationship between natural

selection and psychological disorders. Philosophers can provide answers to crucial

questions such as: does mental illness really exist? And secondly, what

makes a certain mental condition that can be classified as sick or insane? The

chapter is also devoted to the relationship function and dysfunction with the investigation

of Wakefield as core to its harmful dysfunction analysis of the disease

concept.

229 Block, prof. Dr. Andrew, the, philosophy professor, Institute of Philosophy, Catholic University Leuven.

230 Adriaens, dr. Peter, postdoctoral researcher Institute of Philosophy, Catholic University Leuven.



237

The function of an organ is what it should do as a specific organ. For such belong,

there should have seemed no place within the mechanistic science. An objective

opinion could never be prescriptive, and normative judgment could not

claim objectivity. But with the mechanization of biological functions it would be

with the evolutionary approach, and have managed to distinguish objectively

standards in nature.

A satisfactory scientific explanation for the origin of a biological norm or a biological

ideal seems to have a very great importance for the philosophy of medicine.

In the debate, depression writers refer to one of the architects of the DSM. Rejection

citing the authors of this article to him, "Robert, more pointed, the architect

of the leading classification of mental illness, the DSM-IV, praises the harmful

dysfunction analysis even explicitly as an excellent tool for the reliability and the

scientific character of diagnostic raising criteria. "However, there is no conclusive

evidence to distinguish between normal grief and depressive mood changes (Horowitz

and Wakefield).

So far this citation as a precursor for the short description of the evolutionary

development. In the following quote this evolutionary line of Glas continues.

13.7 What is a psychiatric illness?

[Gerrit Glas 231 ]

The question "What is a mental illness" is important for two reasons: he defines

the terrain of psychiatry, and he forces a vision of what exactly abnormal, dis-

231 Glass, Prof. Dr. Gerrit, including Professor of philosophical aspects of psychiatry.



238

turbed, or is wrong anything else with the patient. Glass concludes with a plea for

an open and dynamic concept disease.

Through the description of the differences between diagnosis and classification

Glass steps into the discussion about the biological taxonomy (relations between

different classes), and the basis for discussion of the taxonomy and the medical

questions to which a medical taxonomy should be based. To clarify that he sets

numerical (statistical) taxonomy next to cladistics and evolutionary organizing

principles.

The taxonomy defines one example (...) a number of properties going after the

combinations of properties which are mostly common in a given population. The

cladistics organizes evolutionary information. Each step in the evolution implies,

according to the cladistics a new functional adaptation and thus a new organizational

principle or plan. This building project is embedded in the genetic information.

(...) Classification of the species takes place, containing the evolutionary

information. (...) Popular today is a somewhat weakened form of cladistics known

as "evolutionary system”. It combines planning based on similarities (numeric)

with planning based on organizational principles or genetic information (cladistics).

The problems he runs for the question to the disease as categorical or dimensional

phenomenon. Categorical: you have an illness and you do not like him. Dimensional,

there is a continuum as a manifestation of variant possibilities with the

degree of disruption of the process. Psychiatry tends to present a categorical conception

of disease, despite the growing louder out of the negative attitude. The

categorical approach is consistent with how clinicians prefer to think. When one

realizes, the current dissatisfaction with the classification of personality disorders

is explicable. Personality is pre-eminently a dimensional construct. Despite the

fact that it seems to go beyond that, the DSM-IV.



239

The discussion on diagnosis and classification in psychiatry goes up till today on

the feasibility and desirability of nosology in the style of Kraepelin. (...) But

maybe another objection is more fundamental, namely that this project is [of a

psychiatric nosology] incorrectly conceptualized, i.e. as if it would be possible to

find direct links between phenomena on the 'surface' (clinical phenomena, the

phenotype) and causal mechanisms in the "depth" (e.g., impaired brain function).

Perhaps the mechanisms correlate in the 'depth' or at very different way with the

clinical reality we imagine. (...) And perhaps it is therefore not impossible that the

psychiatric disorders correlate one to one with impaired brain function.

Glass also discuss disease as harmful dysfunction in response to Wakefield. He

gives a meaningful illustration of the broad concept of disease as a dysfunction.

Each child who is losing more than an average composure, arguing with adults,

refuses to do his homework and scolds, he will be touched by one of the new criteria

of disorders. Variations of normal rebellion soon meet the criteria of the

disorder, without acceptance the context of high demands on the behaviour of

children.

Wakefield shove 'harm' and 'dysfunction' in which each scrambling occurs. By

maintaining that dysfunction a 'purely factual scientific concept is Wakefield

leans heavily on the dichotomy of facts and values. (...) Putting this evolutionary

approach features means for Glass unpicking the only scientific approach to functions

and thus the objectivity of the conceptualisation of the special disease. We

mean functions and dysfunctions do the same in the various disciplines, Glass

asks. He contends that:

We can analyse the mental processes on the same as biotic processes (...)? And if

you cannot, what does that mean for our understanding of function and dysfunc-



240

tion in psychiatry? (...). I will make a second remark. Psychiatry and in particular

the pathology will not continue until they are dare to go beyond the dichotomy of

facts and values, objectivity and normativity, science and humanities. It is difficult,

but not impossible. We can think of the so-called dynamical systems theory.

He concludes on the basis of a short impact of the target system to the next approach:

increasingly it comes to three phenomena: level, context and support to

which the disruptions are attributed. Such consideration makes the pathology

complex, dynamic and open. ... The model allows a structural disruption at a certain

level that is located at different levels. Indeed, in the presence of structural

disruptions it is not always the disruption itself that makes sick. So does a genetic

predisposition ... with good coping skills only lead to depression, if there is an

accumulation of stressors. The stressors cause the specific illness (the latter is a

repeat of a previous reference).

13.8 What are DSM-categories? ADHD as casus

[Edo Nieweg 232 ]

ADHD cannot be missed in such a theory and practice-changing philosophy

about brain disorders. Therefore Nieweg’s comments fits within the reflection on

schizophrenia. Furthermore, the analysis from Nieweg is so illustrative that it

forms a focal point for everything that could apply to the clinical discourse surrounding

schizophrenia. Therefore, some salient points of his argumentation are

mentioned. Through the philosophical discussion of "artificial" (based on human

decisions without a natural substrate) and 'natural' (based on naturally stricto sensu),

he comes to a clear decision, which puts the sequel that set the tone for me.

He continues:

232 Nieweg, Edo, child and adolescent psychiatrist, Lonx/Lentis, Groningen.



241

(...) My thesis is that most psychiatric disorders are artificial disorders. I discuss

three reasons for this. (...) The DSM criteria are gradually changed in character:

from descriptive syndromes to categories of natural kinds disorders.

Through the reference to the new DSM-V development and research of Kupfer

and others he writes:

"Where the neo-Kraepelinianen still believed in clear boundaries between normality

and psychopathology are now many experts are convinced of the multifaceted

nature of the psychiatric problems. This is also true for ADHD. Of carving

nature at the joints is not the case, the borders are only where we have placed

them. (...) "Nature has not chosen psychiatric disorders making neat packages

with clear boundaries," wrote the authors of DSM-IV.

The philosophical core of psychiatry deals with the question of the presence and

the power of the values to objectivity in somatic medicine. A wonderful quotation

from the British psychiatrist-philosopher follows:

"Values play in psychiatry a greater role than in the somatic, because psychiatry

diversity of values is greater: psychiatry is not only evidence-based but also value-based.

The somatic relates to psychiatry as a good strawberry into a good film,

good (...) Good strawberry and film are both value terms, but there is an important

difference. Because we all think the same about what is a good strawberry,

we can describe this concept in real terms as redness and sweetness; we can

ignore the value aspect. Because we have different views on what is a good film,

so we can not describe this in purely factual terms (like: lots of action, lots of

humour). The term “good film” remains value-laden."

[The good comparison is the heart attack (somatic) and the panic attack (psychiatric).]



242

Although most types of psychiatric phenomena are artificial species, they nevertheless

are often perceived as natural species. Nieweg gives two reasons at the

core of the problem area, hence the problems surrounding schizophrenia.

The first reason is that psychiatric disorders are often presented by experts as

brain disorders. ADHD, for example, put in the literature and education as a (dopamine)

deficiency disease, similar to diabetes mellitus. (...) For example, a hardness

of neurobiological findings in ADHD suggested that cannot be fulfilled. (...)

The 'brain disorders' according to some, because too many people are not identifiable

with ADHD and those without ADHD did. (...) Many possessors of ADHD

brains do not have ADHD. (...) The same applies to the genes. (...) Most children

with ADHD do not have a DNA-variants, while the majority of children with

ADHD do not have any of the DNA variants. (...) Then, even if there were to be

found consistent specific brain abnormalities in ADHD, it does not mean that

such derogations are causative. We know that the brains are plasticistic (...) the

brains to conduct and behaviour to the brains.

For my research this is the last comment of particular interest because of the positive-energy

action through the act systematically.

Another reason (...) is the tendency towards reification or of abstract, humandevised

concepts for concrete, natural keep things going. (...). There is always the

tendency to keep the true diagnostic categories applicable at that time, for real

entities. This, reinforced by the DSM operates is as a self-fulfilling prophecy: the

categories are creating our expectation of what we get to see, and because we

have our own spectacles, we see that - which categories affirm their own existence.

He gives an excellent example of circular reasoning. As a result of reification and

the confusion of labelling and certification often act like circular reasoning on.



243

"How come Johnny is so busy?"

"Because of his ADHD."

"How do you know he has ADHD?"

"Because he is so busy."

When we are aware that most psychiatric disorders are artificial species, we will

have less tendency to overestimate the predictive ability of DSM categories. That

power is limited (Kupfer, 2002) (...) The classification would therefore not have

to be so important as we often do. In our clinical work, we should less focus on

scoring of DSM criteria for diagnosis in a broad sense, drawing more attention to

the lifestory, the current context and the meaning of the complaints. Therefore, I

plead for the restoration of the distinction between 'ideographic' (the unique case

descriptive) diagnosis and 'generalising' classification. ... It seems unlikely that

the diagnostic categories in DSM-style in the foreseeable future will disappear.

As long as we continue to work with the current understanding of mental illness,

we should be aware that most of the problems are not discovered in nature, but

artificially categories created by human beings.

The end of the quotes

13.9 Shift of discourse

When we philosophically look at "the language of the lifestory", the discourse

becomes an object of confusion at the moment "the language of the story" itself

changes. The language of the original anamnestic discourse, which substantially

speaks of existential patterns of complaints of the patient, is the actual language

of the demand for care, captured in words that can be a disguised request for

proximity (proximal nature of the encounter).



244

If however it does not produce the – by the patient - desired closeness of the encounter,

every treatment advances into a "primordial disappointment". Thus: the

illusion of "closeness" on the contrary will harden the disillusionment of the 'distance'.

The causation?

The discourse has changed by obstruction of the content of patient’s personal

language. The "language of life" has been changed into a psychiatric discourse,

signified by the "language of diagnostics and symptomatology." This blows out

the existential narrative of the patient beyond the scenes and has become the language

of the subsequent discourses: "the language of the diagnostic-symptomatologic

story".

The patient is now anchored in the discourse of diagnosis and symptoms, which

medication is regularly checked and the "existential language of his personal story"

is devalued to the question: "How do you do?", start of a 15 minutes session.

By such kind of altering the discourse, it alienates the patient from his own

lifestory, feeling not understood. The medical doctor or therapist has lost the "story

of the patient" - thus de facto - the unique personality of the patient, expressly

'his story' – has been hit off screen.

The psychiatrist seems to turned into a “prisoner of a formally occupational disability”,

since he or she cannot do anything else than working in accordance with

the classified assessment and action competencies; for whom the language of the

patient has become unintelligible because his lifestory in the status of psychiatric

diagnosis no longer plays an etiologic, causative role.

This idea is based on his more than 30 years of observation and experience. This

problem has been discussed several times under the heading "Proximal identification",

and remains a pitfall for philosophical reflection.



245

Part 4 :

Logotechnical numbers 53 and

26 as energy-markers for DNA

sequences in a seemingly

emergent system



246

Chapter 14 - An Equilibrium between

Science and Torah

14.1 Introduction

H

ebrew markers 53 and 26 clearly influence energetic systems and processes

in the empirical fields that can be measured and researched by

science. In the Prolegomena, I gave a consideration to the Source and

Apex, that transcends our cognitive faculty, but is nevertheless present.

Undoubtedly, my principles will be criticised through a fundamental misconception

about religion and the Hebrew Bible as a religious book. The common conclusion

from this criticism will be: this study is not scientific in its principle, because

it does not start with the common standards and definitions, dominating the

terms ‘science’ and ‘scientific character’. This conclusion is correct, upon acceptance

of these definitions. But when we keep the subjectivity of every definition

in sight, we can’t do otherwise then maintain the agreements that were made

and take these agreements as a benchmark for the degree of a scientific character.

Science is nothing more but research in accordance with the used system based

on the general agreements for instance the repeatability of research, predictable

results, double blindness and randomised investigation.

In the medical education of the Western culture, the accompanying image of man

and a ‘closed worldview’ becomes dealt with as a standard fact. Cell biological

renewal of the image of man is still mostly disregarded within the conventional

research practice. This is of fundamental meaning, concerning the content and

outcome of the medical research and developments. The gap between conventional

and complementary medicine has been anchored in the vision on the image

of man. So we can’t express the differences between both medical streams out of



247

the different diagnostic and treatment, naturopathic or allopathic medication. It

depends on the fundamental theory in general, and the vision on the image of man

in particular. In both camps the renewing of medical education must be seen as an

absolutely necessity.

This fundamental disagreement sustains the conflict between conventional and

complementary medicine. It is not easy to bridge both streams. It asks for a paradigm

shift in both traditions, West and East.

By these facts we have to pay a renewed scientific attention on the lost Source of

Energy of Life. It’s clearly one of the most important intentions of this dissertation.

We propose in this study the Apex [a = √1 = 1] as the present Source of the Energy

of Life, about we can do nothing better than to emphasise its Absolute character,

lying beyond our ability of cognition. By acceptance of this Apex the differences

between “evidence based” and “value based” as a fundamental contradiction,

would be resolved. Upon acceptance of this Source quantum-vacuum and

many field theories do come closer. Since every word and every number is born

by the continuous process of energy emanated from the Source, the linguistics

and numerology are legally and valuable. There can not be another knowledge,

no other science and no other life than a “value based one.” That means: Every

conclusion is a conclusion related to the Source, starting with 1 as basic factor of

the entire numerological system. For example: we factorise a random whole

number, but the 1 remains the fundament: e.g. 26 * 1 = 26 and subsequently 13 *

2 = 26.

Because the multiplication with 1 is the last factor of any factorised number, we

conclude that 1 is the categorical Apex, which bestows energy and other values to

any application.



248

For great mathematical formulas it’s the same: [outcome * 1 = outcome]. The

Prolegomena show that the 1 controls the phenomenological essence that, in its

absence, causes existential confusion and even knowledge infatuation.

When we join the Human Genome process dealing with DNA, we are on the

track of number 4, the number of natural and cultural existence. In the Prolegomena

we saw that 4 without 1 does not reveal the beginning of life by a

knowledge wherein the start of life in stricto sensu became inaccessible for a science

that banished 1 as Apex and Source. The following phrase seems to make

sense. Speedily appears clarity a half-truth is veiling the real problems.

Human Genome Project

We listen to former president Bill Clinton in the Oval Office celebrating the first

results of the complete Human Genome Project. 233

14.1.1 Bill Clinton’s speech in the Oval Office

“Today we learn the language in which God wrote life. The complexity,

beauty and mystery of this so heavenly and yet sacred gift of God are becoming

more awesome… Now is revealed by science, that something we

had long been aware of from ‘old religious tradition’, is also true. The

most important aspect of our life on earth is, that we are all human together.”

234

233 In the period of 1953 – 2003 scientists all over the world endeavoured to unravel the code of the human genome. The

statement “The Human Genome Project will determine the science of the 21st century”, reflects the optimism about the

improvement of man, without the slow biologic evolution by genetic manipulation. Stephen Hawkins says “ … that man

will perfectly well be improved somewhere by someone, even though there are such strict laws regarding genetic manipulation

in man”, quote from Kevin Davies, The code of life, Amsterdam, Prometheus, 2001, p. 334.

234 Davies, K. quote on p. 317-18



249

14.2 Book of Life, written in a four letter-alphabet (Clinton

et.al.)

How can I connect the Hebrew language of Torah with other signs in our universe,

like DNA strands, mathematical formulas and physical calculations? Clinton’s

speech mentioned DNA as G’d’s language. Many scientific publications

confirm the origin of life with this idea. According to biochemists and other scientists

DNA is the book of life. For example, Paul Davies, a biochemist, is occupied

with the unravelling of life, and searching for the last link. With a sigh, he

writes about DNA: “… DNA contains the total amount of information needed to

assemble and function the organism it belongs to. Consequently, life is only an

arrangement of four letter-words”. 235 The term “God’s language,” used by Clinton,

is more or less equal to the numerical structures with which we describe clarification

and wonder, leading to assumptions or value based evidence.

DNA is the stockroom of information that determines the genetic development of

an organism. But does DNA reveal the secret of this information up to the

Apex? 236

14.2.1 A basically quaternary system

A computer can not calculate with four letter-words. Therefore, I automatically

diverted to the question whether under the DNA-alphabet’s four letters,

a quaternary system was concealed, analogous to the Hebrew language.

235 Davies, P., The 5 e wonder, Kampen Ten Have, 1999, p. 100

236 DNA as we know it, has phosphor as a very important component, just like the elements connected to it, that are

responsible for DNA. Though DNA still takes this position, we must not forget that research is ongoing about the origin of

life from micro-organisms that are not based on phosphor and therefore are not dependent on oxygen either. This interesting

development is in its infancy. Life forms become conceivable that biologically do not exist on the basis of phosphor,

and maybe the DNA-story must be revised.



250

According to Paul Davies following Pythagoras, we can express the essence

of life with number 4, four individual chemicals that can constitute life,

however, only in connection to information still unknown to science about

the production of “protein X” that is stored in the genetic code; this ensures

the constitution of life, the first protein, containing 20 amino acids.

To be able to calculate I will write a short formula: “X is the unknown”.

When we accept the 4 letters as ‘given source of information’ for the origin

of life, alongside the unknown protein X, as the factor coding for life, than

the formula [X - 4] 237 originates. It will be directly recognisable that, with

the equation with “1 unknown”, we are in line with what we treated in Prolegomena

6 about the relation 1 : 4 as [life : death], translated into the science-theoretical

conclusion: “knowledge without 1 = knowledge without

insight in and understanding of the origin of life” (downward causation).

14.2.2 How prominent is number 4, from ancient times, among

us?

Number 4 is prominent among us, that’s out of the question. We talk about

4 winds, 4 corners of the earth, 4 seasons, 4 quadrants of an area, 4 quarters

of the moon, 4 quarters of our clocks etc.

I mentioned earlier the special value of number 4 for Pythagoras and his

mystical community, who regarded 4 as a holy, a divine number. That’s the

fundamental difference with the number in Hebrew: it is effectively refer-

237 The choice for DNA-research is not arbitrary but deliberate, as will appear later. I only want to occupy myself with

the origin of life here, the biogenesis and Torah. The emergence of matter in cosmos from compacted Apex-energy is also

relevant. However, I will suffice with the comparison between a form of kabbalah (tsimtsum) and the cosmological explanation

of the emergence of matter.



251

ring and essentially binding to the Originating Energy, the Source and

Apex.

14.3 Biogenesis, the way to the Genome

(DNA: A-T-C-G)

DNA consists of 4 chemicals indicated by the letters ATCG, that always occur in

fixed pairs (A-T) and (C-G). 238

Among all scientists, the pressing question remains: “How could Life originate?

Will Life ever disclose its formula?

Will the information through which life originated, stored in DNA, ever be revealed

by the current science?”

“Will anyone ever know the answer, other than through thought-experiments?”

“Will there be a shift of paradigm in science, so that “knowing” on the basis of

“empirical evidence” universally makes space for “intuitive knowing”; a shift that

will give a new power to the entire scientific enterprise, because the connection

between the unknown “X-factor” (1) and the well-known “4” is restored through

real connecting energy (ligand), at the moment science reconnects with the Substance,

the One, the Creating Instance, the a = 1, represented by 26, the energetic

numerical value of the G’d’s name hwhy - YHWH.

I assume that there is perspective and may be it will happen in the near future.

That’s my positive vision of the future. Meanwhile we face the question: “What

does the quaternary DNA-system teach us as the language of the book of life?”

238 The 4 letters represent chemical bases named adenine, thymine, guanine and cytosine. The genetic code, which is

composed of these four chemicals, contains billions of combinations for a human being, however always in the parings A-

T and C-G.



252

To get a clear view on this, and as a summary of the Prolegomena, we compare

the position of the DNA-formula with the proportional numerical structures of

storytelling in the Hebrew discourse. These numerical structures open up the way

to a parallel structure between Torah as “Nature & Nurture Genome Project”

(henceforth N&NGP) and the Human Genome Project (HGP), as a result of natural-scientific

research of the processes, as self-emergent activity from the Apex,

the Source of Potentiality: [a = √1 = 1].

How much Hebrew expresses with the 22 letters of the alphabet sets the trend for

the basis of the N&NGP is evident from the next example.

14.4 N&NGP and 22 as genome number

Language or speech is a human prerogative and represents communication and

living conditions. In Hebrew linguistics, the language that is transferred in 22

letters from parents to child at conception, functions as heredity factor. A brief

look at this structural building:

ba – av = father

Ma – em = mother

dly – yeled = child

dly – yalad = beget or bear

The numerical values show the following development:

ba = 1 + 2 = 3

Ma = 1 + 40 = 41

dly = 10 + 30 + 4 = 44

Father (3) and mother (41) beget the child (44). The unity between father and

mother ensures the arrival of the child: dly (44), a verb meaning “begetting” for

the man and “bearing” for the woman.



253

14.4.1 Autosomal chromosomes

Number 44 has a central position in reproduction. Because the child is the

effect of begetting and bearing, and has an equal numerical value (44), we

must divide 44 in two series of 22, as 2 * 22 = 44. When we see 22, the

genes of Hebrew alphabet representing language and life, flowing together

by both father and mother in the child, this brings us to the human genetic

code as we encounter it in the natural sciences. Human heredity consists of

2 * 22 = 44 autosomal chromosomes that determine the inherited uniqueness

of man, excluding both X and Y chromosomes that determine gender.

When we follow number 22 in linguistics, we continue to encounter its

powerful, productive, sometimes very specific character.

14.4.2 Structural numbers

We just saw the cross-border nature of Hebrew numbers with features such

as genes, that deliver the genetic material for scientific genetics and derivative

processes beyond the Hebrew language structure, the Torah: Clinton’s

DNA, as “four- letter book of life”, that could emerge from these genome

numbers, through the potentiality of Source and Apex [a = √1 = 1].

We see the genome-character of the specific numbers applies to many more

structural numbers like 17, 26, 53, 144, 197, 233, 987 and many other “genome

numbers” sprouting from the hearts, heads and hands of scientists like

mathematicians, natural scientists and other scientific geniuses like Einstein,

Bohr, Fibonacci, Fermat, besides phenomena like the double helix of

DNA, the ‘snake’ as the source of knowledge, worldwide known (without

a) as we will discuss later, and the Hexachordum Duplex, the music with

528 Hz as central tonality.



254

In my view, this can eventually lead to the conclusion that Torah, the “Nature

& Nurture Genome Project” (NNGP) indeed, not only may be called

Philosophia Perennis, but it is real on the basis of the Apex-formula [a=√1

= 1] whence the previously proposed philosophy of the a-field deserves this

all encompassing title because of its ultimate validity in all fields of nature

and nurture, matter, spirit and life. On the same grounds I argued previously

for a tribute to Moshe as Philosophicus Rex, because he is the founder of

these oral genotypic numerical structures - described and elaborated by others

- as a competent statesman and sociologist, with a philosophy grafted on

personal observation, still valid, despite the improper devaluation to a religious

row of rules.

14.5 New look at old conventions

What happens to the Hebrew concepts-treasure if we would lose 1, as the sciences

still haven’t the 1 within their range?

What could be the reason for the loss of 1? Do essential changes really appear?

And conversely: which essential changes are necessary to see the link between 1

and 4 through which for example a shift of paradigm occurs and a new energetic

image of man relieves the old Newtonian-mechanic image of man, through which

a new medical philosophy can contribute to a new look at old conventions, so that

there will be an opening to complementary medicine, which has based on the

energetic image of man, but nonetheless affected by the disconnected 1 – 4, as we

will see.

Integrative medicine can only arise if there is a new biology as energetic development,

including the question of Darwinism which is responsible for the evolutionary

fragmentation. Eliminating fragmentise and accepting the holistic-



255

energetic image of man and an open worldview brings us back on the way to unity,

the ‘ligand’ with the lost a =1.

Current holism, rooted in the East, can’t either start a new awareness of the lost a

=1, including a new look at the technological, positive medical developments of

West and East and acknowledgement of the new biology based on cooperation,

including individual man as a “unique cell” (nature) for humanity (nurture).

Therefore, the Genome Project gains new interpretative insights through the development

of epigenetics and the changing of the guard between Newtonian medical

education and quantum-physics oriented training, including non-locality and

probability principles. This brings a shift of paradigm and unity in diversity between

Eastern and Western medicine closer.

14.6 Load capacity and ability, a homeostasis

When we prepare to suspend our conventions from both medical directions and to

investigate and acknowledge the loss of the bearing a=1 as the Energetic Background

Radiation, the solution to an approaching integrative medical science

dawns, in which it is no longer about fighting a disease by technological or pharmacological

means, but about the whole man and his context, who is bogged

through a disbalance between load capacity and load ability, on the way to energetic

homeostasis. 239

The openness for discussion concerning natural and synthetic medicines will undoubtedly

lead to elimination of the Codex Allimentarii inside the European Union,

just like DSM V for psychiatry will have to acknowledge publicly its own

239 Jongerius, J.C.J. Decompensation, load capacity and ability in relation to decompensation with the neurasthenia syndrome,

dissertation Rotterdam, edition Utrecht 1984.



256

natural scientific incapacities. 240 Only in this way true transparency will benefit

the global man in a global structure.

In short: the acknowledgement of the limitations of autonomous thinking in East

and West, through the loss of connectedness to the fundamental, unbreakable

Unity of the Source, will lead to worldwide renewal and righteousness, in which

hearts will open again for suffering individuals, without the connectedness to

political-economic values which limit developments, and through which the poor

remain deprived of adequate help. On the way to recognition which can lead to

acknowledgement, we investigate the DNA-formula from Hebrew numerological

logo-technics. The formula we investigate will appear to reach from “the maximum

large” (astro physiology) to “the maximum small” (quantum physics).

14.6.1 An unexpected encounter with crucial implications

I went looking for the answer to the question: Is there really a relationship

between DNA with its four fabrics and a quaternary number system? I

surfed the Internet for the Science Forum and asked my question.

"Dear Forum members, what is the significance of a quaternary system

in relation to DNA, with its four bases in strands with fixed links?"

How great my surprise was, I will tell you now.

14.6.2 Excel DNA-generator and the quaternary system

Working with a quaternary system, with 0, 1, 2 and 3 as values for everyday

use is a little awkward. I was redirected to the appropriate department

at the Science Forum, fortunately with a current discussion about my sub-

240 In a next part, Kupfer’s research report, which is responsible for this, will be extensively discussed. Here I confine

myself to the reference to prof. dr. Jim van Os, professor MU and his book against the new DSM V “Beyond the new

DSM-5”, personal diagnostics in a new GGZ (Dutch Health Department). Such honest reactions at the top of regular

psychiatry give hope for a shift of paradigm and a return to energetic medical evidence.



257

ject. Ad Commeren, ICT professional, developed an Excel DNA generator

which he presented for a review on this forum. 241

He started because of his interest in the four fabrics of the DNA a study of

the four bases in a quaternary system, which could provide new significance

for the development of DNA-sequences.

He took the prime number 53 as a starting point rather than taking a random

number and found remarkable things that I display here in a summary.

14.7 53 as prime 242 in the quaternary system

The prime number 53 delivered via this DNA-generator a consistent set of 26

digits which as a group of solid 26, the same numerals, and always in the same

order, infinite was found to repeat.

Ad Commeren, split the infinitely repeating sequence of 26 in two sets of 13. He

replaced the numbers of the system 0-1-2-3 in T-C-G-A by the initial letters of

the DNA. He put one row with 13 below the other. The result of this coupling of

the two series of 13 permanent numbers was the correspondence with the double

helix and the fixed links: A and T and C and G, which by hydrogen bonds always

are connected with each other. 243

Here I first saw the number 26, as the Hebrew G'd’s name and manifestation of

the creative Substance in an infinite repetition, present in a scientific environ-

241 His research can be found at http://fiboart.jouwweb.nl.

242 A prime number is a number that is only divisible by one and itself. The prime number in the Hebrew numerical

structures refers to a direct link with a.

243 That changes when RNA.



258

ment. Mathematicians, participants in the science forum, examined Commeren's

findings and confirmed the accuracy of mathematical calculations. 244

The debate on the science forum and illustration

Commeren wrote:

"Because a DNA helix is made up of four nucleotide bases ATCG, I used 4 as

number base. The ratio 1:53 in the quaternary system gives the following value:

0.0010311020130332302231320300103110201303323022313203\ etc.

As you can see the cluster repeats as sequence of 26 equal numbers, continuing

until the (scientific, G) infinite.

We take the first 26 digits, and we substitute the figure 0 = T,

0 = T, 1 = C, 2 = G and 3 = A. Result: a series of TTCTACCTGTCATAA-

GATGGACAGTA.

At first glance, this series are random, but after studying there appears a wonderful

symmetry. If you take the first half of this series over the second half you will

see a property that you also found in the composition of the DNA helix.

Each A is associated with T and each G is coupled with C.

The final result is comparable with 26 = 2 * 13.

TTCTACCTGTCAT

AAGATGGACAGTA

The number value of hwhy – YHWH = 26 expresses a connection with DNA.

The number 13 is the value of the Hebrew of "love".

244 This link takes you directly to the discussion which I refer

http://www.wetenschapsforum.nl/index.php?showtopic=28971 Unfortunately, the debate is closed and you will have

to satisfy yourself with this view.



259

The ratio of 1:53 has been chosen by me, because it is sufficiently large in order

to demonstrate the effect, and not too large to be unworkable, but is otherwise

selected arbitrary."

We follow the steps around the special significance of the number 26 in other

sciences and cultural patterns.

By the work of Commeren 53 remains a part of my focus. Now we continue with

more on the findings of Commeren.

The Golden Mean and 26

The series consists of the sum of the two preceding numbers. This series led to

the ratio of the two adjacent numbers:

1 : 2 = 0,500

2 : 3 = 0,667

(…)

21 : 34 = 0,618

34 : 55 = 0,618.



260

The last two conditions are called the Golden Section or Proportio Divina, the

Divine Ratio. This ratio is found in geometry, physics, botany, zoology, music,

painting, architecture, paper sizes etc. The human body carries unmistakably the

Golden Mean proportions. Two examples: the body is divided by means of the

Golden Mean ratio 3: 5: 8 as the head with forehead, nose and chin is divided in

the ratio of 3: 5: 8 (Fibonacci sequence). The Greek sculptor Polykleitos (ca. 420

BCE) has made a perfect image of a man on all the Golden Section proportions of

the human body. It was as perfect as possible in beauty that even the Greeks, with

their ability experiencing beauty, could not endure this perfectness and asked him

to scratch some imperfections. For the connection between the Hebrew numbers

and the Fibonacci numbers (0,618) see the Register.

14.8 The physical standing wave and 26

For information and results of Commeren's research of standing waves I will give

first some general information about the wave as physiologic phenomenon.

14.8.1 Emergence of a standing wave 245

A wave can occur when a wave is reflecting between two fixed points. One

example is a sound wave in a closed organ pipe. In the case of a closed

pipe, a standing wave occurs when the wave length is equal to 2 * the

length of the pipe, either as the half-wavelength is equal to the length of the

pipe. Also waves with a smaller half-wavelength (3 times the length of the

pipe, 4 times the length of the pipe, etc.) may cause a standing wave. A

standing wave can therefore only occur if there is any resonance.

245 Documents taken from Wikipedia "Standing Wave".



261

organ pipes

An organ works just like this principle. The pipes of the organ are blown with air.

This produces sound of all frequencies, with all wavelengths. However, only the

sound of a wavelength which suits the length of the organ pipe can continue to

exist.

The examples above are for one dimensional systems. Standing waves can also

occur in two dimensions (a vibrating plate) or in three dimensions (within the

sound box of a string instrument, or in a bathroom with a singer in the shower).

Standing waves can occur in larger spaces especially at low frequencies (longer

wavelengths). You may experience strange audible effects. In one corner of the

room there could be heard something, but than again in the middle there could not

be heard anything (because there is a node).



262

14.8.2 Schumann resonance

The space around the cross-section of the earth and upwardly up to the 55

miles above the earth's crust located ionosphere is filled with energy of 7.83

Hz and variables. This space acts as the organ pipe described here.

In the last part we will return to the Schumann resonance and its connection

to our human brain.

14.8.3 Physical standing wave and 26

The result of Commeren's research showed that the number 53 generates a

physical "standing wave" with four harmonic overtones, "two waves of 26"

and "two waves of 13".

What we saw with the number 26 mathematically, now appears also in the

physics field. In my view, this physical standing wave also points back to

the harmony of Pythagoras, who, like the Golden Section, has a relationship

with other elements.

The standing wave and the number 53



263

Description of the picture (Ad Commeren)

The prime number 53 generates a standing wave with 52 (2x26) as the root and a

first harmonic overtone of 26 waves, a second harmonic of 13 waves, a third and

a fourth of 13 waves of 26 waves.

When we put the results of Commeren's investigations in a row, we successively

have the following particularities concerning the presence of the Creative Source,

reflected in the number 26.

Perhaps it is the ratio between the Source of Energy of Life and the number 26,

illustrated by the ratio between the sun and the moon. The moon reflects the light

of the sun, without being the sun. The number 26 reflects the creative Ligh 246 of

Ein Sof, the infinite no-thing, without being the Creative Substance itself. The

presented moon does provide an effective light in the darkness of night. The abstract

number 26 radiates actual energy due by the active connection with the

origin of the creative Light.

It allows two cases to be clear with this

1. The number is not divine as in the case of Pythagoras, and

2. the number has an effective energetic significance through the connection

within the nucleus of the created reality.

In the language of religions, we might say that the number 26 accentuates the

Presence of God. Noteworthy is that the discussion about G’d as creator is of an

lesser importance than the always present meanings suggests, which is not compatible

with the Jewish tradition. Labuschagne has emphasized this in his thesis

long time ago. His thesis has maintained its actuality.

246 Labuschagne, Prof, Dr. Casper, The Incomparability of YHWH”, 1966, passim



264

Some examples of Fibonacci Super Lissajous figures.

These forms are the result of operations of the Fibonacci series

(Ad Commeren)

My research is involved with the actual reality of the creative energy, which is

made current by the present substance, which receives numerical values, meanings

which are important for the entire humanity and science.

Here we are back at the downward causation, in which are emergent processes

which produce not apparently planned phenomena.

Commeren: the "emergent process" from its precise vision of reality show unleashes

awesome form.

For the process in which these forms in an emergent manner have arisen, as a

result of the fact that everything is in motion, within the creative space of evercontinuing

creation. See the website on which the process is placed:

http://fiboart.jouwweb.nl.

The phenomenon of "emergent process" is not at odds with the downward causation,

unless the driving source of permanent emanation of creative energy is not

replaced by Darwinian upward causation, as "dogmatic evolutionist, materialistic

phenomenon".



265

We already have seen that the number 26 inside the nature and culture is explicitly

more than striking and necessitates further research.

Since mathematics is the language of exact science, I looked for a possible continuation

of the special nature of the number 26 in mathematics as a abstract science.

I met the work of the French mathematician Pierre Fermat (1601-1665). The

number 53 mentioned above plays a central role which is described in the second

Philosophical Introduction as the numerical value of "Garden in the east, in

Eden," popularized as paradise, but which in Hebrew means Ng - gan (garden). We

already saw that permutation could create a space between the two letters.

Again we apply permutation, and we consider the numerical value of Ng as two

separate numbers 5 and 3.

14.9 Last Theorem of Fermat and 26

I returned to the DNA test, reread the book of Kevin Davies and discovered that

the stop and start codons of a human chromosome end with 5 and 3, or vice versa

3 and 5. 247 Back at the permuted Garden (5-3), we not only obtain a view of the

figure 26, but also to the DNA, which has a relation with the number 26 and its

derivations.

First a brief interlude, as a repetition of the earlier description in the introduction

of Simon Singh's book "Last Theorem of Fermat”. 248

247 Davies, Kevin, The code of life, Prometeus Amsterdam 2001: “The special 'end of the human chromosome is as

follows”:GCGATTGGGATTGGGATTGGGATTGGGATT – (5’)

CCCTAACCCTAACCCTAACCCTAA – (3’).

The double stranded RNA does not end in a neat manner, but stuttering tips ... for the fact hunters, from the above sequence

shows that the first letter in the book of life is a G ", p. 64.

248 The subtitle of the book indicates the importance, "the story of a proposition that the greatest minds of the earth 358

years until desperation drove" ... with the statement: "If n> 2 there are no solutions x n + y n = z n .” A variant of the Pythagorean

theorem: x 2 + y 2 = z 2 in whole numbers: (3 x 3) + (4 x 4) = (5 x 5) or 9 + 16 = 25.



266

14.9.1 Pierre Fermat and his mathematical discovery

"With the discovery of a new pair of so-called "friendly numbers" Fermat

something of a celebrity, his reputation became firmly established through a

series of mathematical challenges.

It was Fermat who noticed that 26 sandwiched between the numbers 25 and

27, one of which is a square (25 = 5 2 = 5 x 5), and the other is a volume, a

third power (27 = 3 3 = 3 x 3 x 3) . He went looking for other numbers that

would be wedged between a square and a cube, but found none. He suspected

that 26 had to be unique. After days of hard work, he managed to

construct an elaborate argument, which was conclusively shown that 26 is

indeed the only number in the mathematical universe that is between a

square and a cube is clamped. His gradual logical evidence had established

that no other numbers could be met this criterion. Fermat made this Unique

property of 26 known to the mathematical community and defied mathematicians

to prove that it was indeed the matter. He openly admits that he had

to proof himself; The question was, however, the colleagues were resourceful

enough to emulate him? Despite the simplicity of the statement is proof

canine difficult …”. 249

14.9.2 Yet an additional particularity

Fermat proved the uniqueness of the position of 26, but continued with

squares and cubes. He showed that 5 2 = 3 3 – 2 is the only comparison is

with a difference of 2. Here again, the particular position of 26 is proven.

249 Singh, Simon, The last puzzle Fermat, Arbeiders Pers Amsterdam, 1998, pag. 84.



267

14.10 Tzolkin and 26

After some exact-scientific examples according to the importance of number 26

as word value of YHWH follows a short information about the life and wisdom

of the Maya’s. The Maya civilization was a Mesoamerican civilization developed

by the Maya People, and noted for its hieroglyphic script, the only known fully

developed writing system of the pre-Columbian Americas—as well as for its art,

architecture, mathematics, calendar and astronomical system. The Maya civilization

developed in an area that encompasses south-eastern Mexico.

Erik Welten, a Maya expert, told me in private about the presence of Hebrew

words in the Maya language. I didn’t research this and have taken it for good and

interesting. The most important thing for my research is the matrix of the Universe,

called Tzolkin.

The Tzolkin is the Sacred Calendar that the Maya utilized for their own sacred

personal journey. It is both a master calendar providing a unifying pattern for all



268

creation and the hub of the Mayan calendar system. The meaning of the Tzolkin

is mostly given as “the count of days” [but] it may also be translated into “pieces

of the sun” and by inference to “pieces of divine creation”, which may come

closest to its true meaning given that among the Maya, the sun has often been

identified with God.

The Tzolkin calendar is based on a system of twenty named day signs (Kin’s),

combined with thirteen numbers to produce 260 unique days (13x20=260). Despite

popular convention declaring that the start of the Tzolkin is 1Imix, the left

side of the universe. There is in fact no "beginning" and no "end" to the Tzolkin.

It is an eternal, cyclical calendar, which is not related to or dependent upon

astronomical cycles, end dates, or any other linear phenomena or concepts. But

nevertheless there is a galactic disposition between the Earth, the Sun and Mars.

After the position 780 (3 * 260) a new cycle starts.



269

The Tzolkin has 260 kin’s, one for every day. That means a center cannot be

there: so it is 130 and 131. To be easy here, the middle point is 131 as a mirror

position with 130.

The structure of the Tzolkin is 20 * 13. Around the middle point of 131 lay 2 * 13

= 26 kin’s. Total amount of kin’s is 260 = 10 * 26.

When we go back to the search of Commeren and his DNA we see number 13 as

the mount of love in Hebrew, similar to the core theme of the Maya’s: love.

The infinite structure of DNA and 26 is also present in the Galactic System of the

Maya’s.

Because of the Galactic character and the time as a spiral with no beginning and

no end, it seems to me the Maya-system is part of a closed worldview.

Conclusion

Two remarks are relevant for my research: 1. the 26 exist in a closed system

(Maya, Scientific, et al.) as well as in the open system (Jewish) and 2. 260 of the

Tzolkin emphasizes the kingdom of G’d with word value of 10. The final conclusion

is an affirmation of the importance of 26 as gate to the Source of Energy of

Life on behalf of the entire creation.

14.11 Cosmology and Physics

Before I will come to a conclusion of the discussion about the prime number 53

one more peculiarity about 53 is in cosmology. This time as an exponent of the

cosmological constant 10 -53 . Since Copernicus knew the instructions (parameters)

in nature, such as the ratio between the force of gravity and the nuclear forces in

an atom, have to be very precisely tracked, to be able to create the universe, with

the earth as the planet were life would be possible. For defenders of the Big Bang



270

hypothesis the first nanosecond after the Big Bang determines the progress. The

speed at which the universe expended after the Big Bang must therefore be exact.

This precision is expressed in the aforementioned cosmological constant: 10 53 ,

this is a 1, with 53 zero’s. The weight of visible matter in our universe should be

exactly according to these models 10 53 kg. The ratio between the present matter,

the gravitational constant, and the rate of expansion of the universe, was determined

if there is an earth where life could be possible. This accuracy defines what

is needed to form atoms, and the forces needed to act at the atomic nucleus in

order to produce a carbon atom, for example. Carbon is the building block for all

living organisms. The slightest deviation from the strong binding force (interaction),

the electromagnetic force, the weak binding force and gravity within the

atom, would made it impossible to arise life. It succeeded. But it is not managed

by the parameters of the Big Bang hypothesis. My clear rejection, substituted by

the Osmosis model, led me to the thesis “Good bye, Big Bang”, because of the

categorical and indissoluble a = 1 formula of downward causation.

Whatever would be the case when one deviation would be a larger or smaller

nanosecond than the “cosmological constant”, it would have no life according to

the model calculations of upward causation can occur.

All of us talk about DNA and human development that is a result of the primary

precision:10 -53 .

Before my osmosis model replaces the Big Bang hypothesis, we return to the four

bases of DNA in relation to the Periodic Table of the Elements (PTE), and in relation

with the Hebrew numerical values, of the PTE, which - as we previously

wielded as the lunar effect - reflect the creative Light.

There is another metaphor which is thought forming, indicating the empirical

reality an extra dimension that transcends our intelligence again. It is a song rule:



271

“and the waters cover the sea”. This sentence is a part of the text: “the entire

Universe shall be full of the knowledge of G’d, as the waters cover the sea”. 250

In a short explanation we are wondering what is the meaning of this unclear sentence.

A sea exists by being a space full of water. What about the waters that cover

the waters? The latter must be metaphorically seen as giving an extra, specific

and effective dimension at the physical water, in addition of the real Knowledge,

more than the flat knowledge of science: The Knowledge of the a=1. So the

number 26 and its derivatives as 15, the value of hy - Jah as we already saw in the

Prolegomena, give an effective meaning to all that exists, analysed as chemical

elements in the Periodic System, as we shall see in the sense giving analyse of the

molecules of the DNA inside the Periodical System. This will guide us to the

conclusion that nothing exists outside the Creating Substance, reflected by the

number 26 and derivatives and relatives of 26, like 32 the number of heart and 32

as the triangle number of 528, the central number for our music of 528 Hz.

250 Jesaja 11,9



272

14.12 DNA in Periodic Table of the Elements

The Periodic Table of Elements has a long history. In the prehistory all metals

looked like gold. It was not until the 20th century that the system could be standardized.

It now looks like this. That does not apply to the basic elements.

For our purposes, the system is an equilibrium with the numerical values of the

Name of G’d. Evolutionary spoken, also the periodic system is the result of

"downward causation", the systematic potentiality, an energetic flow with late

emergent processes, but without losing the connection with cause and purpose.

As we have dealt with it several times, the process of downward causation is

complex, because it binds causality and permanently to the results of updating

and individuation.

Thus, there is no formula number without the "basic factor a = 1". The numerical

value of hwhy = 26, so via the factor 26 * 1 = 26. The number is not complete in

its referral and reflection of the Creative Light.

Another example of downward causation is the energy emanation, which binds

the reality of the chemical periodic table from PSE to DNA. Not the DNA gives



273

life, but the connection with the downward causation, the Source, which we have

described with the formula a = √1 = 1.

The Periodic Table of the Elements is an overview of the chemistry of the nature

on the basis of a variety of details. For an understanding of the deep structure of

the DNA the Periodic Table of the Elements is indispensable. What I said above

about the downward causation binds energetically through the updated systems

within creation, also applies to the Periodic Table.

The fundamental and most profound expression of the downward causation is

found in the numerical values of the Hebrew G'ds name like hy = Jah with a numerical

value of 10 and 5. This bond between the original Source of potential

energy and the physiologically-chemical energy is not measurable by our currently

empirical research instruments. But actually the immeasurability presupposes

Darwinian and neo-Darwinian upward causation or processes of reduction, eventually

lost in the quantum physiological decay of the wave-particle ratio which

after all, the measurement of dynamic processes is the precipitation of a solid

particle structure, the paradox of immeasurability.

By accepting the fundamental evolutionary relationship with the Hebrew numerical

structures as a manifestation of the "downward causation", we have moved

away from Darwinism, which is based on the "upward causation" on natural selection,

adaptation and reduction.

Since in our research to "voice and sound" like a structure number, in a causal

connectivity, including emergence as a possibility, from the downward √1 = 1,

we have to rule out coincidence, by the fundamental connection to Torah and the

Hebrew numerical structures, the formula a = √1 = 1, the synthesis between the

downward and upward causation giving priority to the first one. The cause of the

presence of a = √1 = 1 it’s the Spinozist “causa sui”, the cause in itself. 251 No

coincidence, not even within the PSE. Hydrogen (hydrogenium) on the first place

251 Spinoza, Ethica



274

in the PSE and the atomic number 1, could never be in a different place because

of the steering force of the downward causal process. Without the H = 1 no H 2 O,

water as a substance. Hydrogen, which we can call the first effect of the downward

causation, has effected the atomic state in an intimate connection with a =

√1 = 1, which carries the start-up and development of life. They also belong to

chemical water and live together symbiotically.

When we choose this position, we will have to face the light of the chemical formulas,

that life is not aroused by the DNA, or updated. The materialist view of

the origin of life (upward causation) crashes in genetic determinism is not interested

in objective causation and systematic control (a = √1 = 1), including emergence

as apparently coincidentally arisen, free trial developments. Suppose life,

as the “a = √1 = 1- potentiality" is the downward causation, and in everything

present, even in the supposed 'lifeless' matter.

14.12.1 Downward Causation

Thereby any attempt to evidence, regarding causation and genesis of life

through investigations of any kind, loses its scientific character; at the moment

we want to measure with the size of the current scientific standards.

Only when we find the synthesis between the downward and upward causation

we can change the academic standards and qualification and loses

quantification its normative position. When we find the syntheses and we

have redeemed our scientific autonomy for the acceptance of a = √1 = 1 as

the beginning and end of everything, we will be able to describe the Theory

of Everything, and we are even inside the quantum vacuum and matter,

negligence of the morphogenetic fields beyond, and is Squaring of the Circle

just valid within the Aristotelian entelecheia: the end as potentiality in

the beginning. Then turn out the laws of nature, by Darwinian science described

in the upward causation, exactly equal to the laws of nature, by non-

Darwinian scientists, such as the followers of De Lamarck, are revealed by



275

the acceptance of the downward causation, and neither intervention, alleged

a Supramental Intelligence, can changed the direction. In other words, in

both cases we have to accept the Source and its code, which is beyond our

mind and there is no Supramental Intelligence (G’d), which is resetting in

cases of being wrong, such as the Intelligent Design. In short, in philosophicis:

"Being is and remains present in the “a = √1 = 1-potentiality" in actualisation

of Being. Actualised beings evolve seemingly selective in apparently

emergent processes. The emergent processes will maintain their spontaneity,

without being in contravention of the principles of the primordial

downward causation, the a = √1 = 1-potentiality.

Life, heredity and DNA are inseparable Titans of the downward causation that

"chance" (another term of emergence) is excluded. The fact that the DNA itself is

structured in 4 bases, and not 5 or 6 calls for an explanation. Why exactly 4? In

the Prolegomena we have already given some explanation. We will go down into

some detail by quotations from geneticists. We're going to first looking at the

chemical structure of the DNA and the above link from the downward causation

and the value of the Name of G’d highlights that structurally, but immeasurable

binds to the PSE. When we approach the coupling of the numerical value of Jah

and PSE from a quantum physical perspective, we would say that the numerical

value of the target the Name of G’d, Jah maintains its wave dynamics without

falling into particle, an observable, measurable stature. With this latest addition,

we can escape from philosophical speculation and maintaining the downward

causation in terms of number, both within the scientific approach remain as the

Tanakh-numerical structures which an equilibrium can adhere possible.

The double helix of deoxyribonucleic acid, commonly known as DNA, is the

major carrier of our heredity. The DNA is composed of four molecules: adenine,

thymine, cytosine and guanine each with their own structure as in the state that

can be seen below.



276

DNA: science book of life

14.12.2 Thymine C 5 H 6 N 2 O 2

The first letters of these four molecules form the four-letter alphabet to the

Book of Life with the letters A - T and C - G. In other words, our life book

is written in a quaternary system in which five and three key will turn out to

accomplish, but more of that subject will be later explained. The two wavy

shapes, which begin and end with the values 5 and 3 (stops), something that

later is treated extensively, are held together by "hydrogen bonds" created

by mating between the molecules. These couples are immutable. A always

pairs with T and C always pairs with G (see illustration). Before we look at

the connection between DNA and Torah, I will first give the structure of

these molecules that make up deoxyribonucleic acid.

Brief commentary, with thymine as an example.

Adenine

C 5 H 5 N 5

Thymine

C 5 H 6 N 2 O 2

Cytosine

C 4 H 5 N 3 O

Guanine

C 5 H 5 N 5 O



277

In the molecules A, T, C, and G which build up the DNA, we are getting

the same atoms attached to the base against: hydrogenium (H), nitrogenium

(N), Oxigenium (O) and Carbon (C), respectively, hydrogen, nitrogen, oxygen

and carbon.

Look at the formula above Thymine C 5 H 6 N 2 O 2 . This means that Thymine

is made up of five carbon atoms (C), 6 hydrogen atoms (H), two nitrogen

atoms (N) and two oxygen atoms (O).

What characterizes an atom as the element - for example carbon - is not its mass

(mass is the sum of the number of protons and neutrons in the nucleus), but only

the number of protons in the nucleus. If we look at carbon (C) then there are carbon

atoms with different masses. Thus, in addition to carbon atoms having an

atomic mass of 12 there are also carbon atoms also with atomic masses 13 and

14. Whether the carbon atom has an atomic mass of 12, 13 or 14, for the chemical

reactions of the carbon atom it doesn’t have an effect because that is determined

by the number of protons. The characteristic number of protons, that remains in

any given mass variants is 6. That number is found in the Periodic Table as the

atomic number. The order of the elements in the Periodic Table is the base of

their atomic numbers. The number of electrons surrounding the nucleus is determined

by the number of protons in the nucleus and is equal to the number of protons

which are located in the nucleus. These electrons are decisive for the optional

compounds, bindings of the atom with other atoms. The result of the connections

of the atoms is a molecule.

We now move from atoms to molecules. What the molecule thymine as a speck

of dust, a molecule, does work in chemical sense, is in first instance the electric

field which is based on the atomic structure of the molecule thymine. This electric

field is a result of the collaboration of molecules. Again, as many protons,

there are in all of the nucleus that make up the molecule, there are as many elec-



278

trons that surround the molecule in a joint cloud. The electric fields of the atoms

are as mentioned previously in the first instance, a result of the number of protons

within the atom and not of the neutrons. The atomic number in the Periodic Table

which reflect the numbers of protons in the atoms, so are far more important than

their atomic masses with respect to the molecules that are made up of atoms.

Because we a link between the DNA and the Torah that works with numbers and

treat this as the reduction system of Pythagoras (sum to a single number), it's useful

adding up a few numbers together and see what happens.

You have seen that the DNA is fixed couples. We look at atomic numbers of the

two pairs of A - T and C - G.

DNA structure on the basis of atoms T – A and their

build-up on the basis of atomic numbers

We count the atomic numbers of atoms in T and A.

This gives 66 + 70 = 136 = 1+3+6 = 10 = 1 + 0 = 1

C – G and their build-up on the basis of atomic numbers

We count the atomic numbers of atoms in C en G.

Thit gives 58 + 78 = 136 = 1+3+6 = 10 = 1 + 0 = 1

T – A and their build-up on the basis of atomic masses

We count the masses of atoms in A and T.

This gives 126.11 + 135.13 = 261.24 = complete 261 = 2 + 6 + 1 = 9

C – G and their build-up on the basis of atomic masses

We count the masses of atoms in C and G.

This gives 111.10 + 151.13 = 262.23 =

Rounded 262 = 2 + 6 + 2 = 10 = 1 + 0 = 1



279

T – A and their number of atoms

We count the number of T and A.

That gives and their number atoms

We count the number of T and A on.

That gives 15 + 15 = 30 = 3 + 0 = 3

C – G and their number of atoms

We count the number of C and G.

That gives 13 + 16 = 29 = 2 + 9 = 11 = 1 + 1 = 2

The core numbers 1, 2, 3 and 9 are indictors, in the relationship between Nature

hy – Jah

rbx – ch-v-r

Adenine

Thymine

atoms

atoms

Cytosine atoms Guanine atoms

Connection C 5 H 5 N 5 C 5 H 6 N 2 O 2 C 4 H 5 N 3 O C 5 H 5 N 5 O

y 10 = 1 Hydrogen 1 5 Hydrogen 6 Hydrogen 5 Hydrogen 5

h 1 + 4 = 5 Nitrogen 14 5 Nitrogen 2 Nitrogen 3 Nitrogen 5

7 (1 + 6) Oxygen 16 0 Oxygen 2 Oxygen 1 Oxygen 1

3 (1 + 2) Carbon 12 5 Carbon 5 Carbon 4 Carbon 5

and Torah. The logotechnical meanings come from the intrinsic, in-forming

(forming from within) potential of the downward causation, either the a = √1 = 1.

Forms created on one basis and expression, sometimes bound, sometimes emergent.

The duality in the actualization of the potentiality of controlled, planned

forms and spontaneous emergent forms and self-emergent processes, within the

space of creation of elements and developments that we - in the tropics of our

minds - would consider mistake who may well be and should be.



280

14.13 DNA associated with the Hebrew Name

Disclosures trip to Torah

hy

G’d's name shortened to hy = J and H in terms of numerical values correspond to

the atoms of the DNA molecules.

The y jod has a numerical value of 10, reduced by the Pythagorean single digit

reduction from 10 = 1 + 0 = 1. We see the link with the atom Hydrogenium.

The h has a value of 5. This is the second letter of the name matches with Nitrogen

with an atomic mass of 14, reduced to a single digit number:1 + 4 = 5.

God is a verb (Cooper)

The name why is connected to the verb hwh (hawah) with the meanings,

are, existence and happen. Besides the time meanings past, present and future,

with also a working activity as the Tetragrammaton, the Greek term

of the four-letter name (ha-Shem), the for Jews unspeakable name of G'd.

As we saw in the connection with the the Periodic Table is is yh (Jah) a

derivative that we encounter in hallelu-Jah. The first two atoms, H, and N

are connected to hy (Jah). It is not only a passive connection, but an

exciting Source of information. That is clear from the second derivation of

hwhy: hy = (Jah).

The second derivative of which brings us to the first word of creation yhyw

rwa yhy (jehie Or, wa jehie Or):"There must be light and there was light

immediately." I transform this creation assignment as a mission with an

immediate consequence. I chose this, because the creation of this Light is

of a different order than the sunlight, that comes later and forms a component

of evolution and creation. This light is the light of the "harmonious

order" that transforms chaos into the Light-order. The verb is entered in



281

the text spoken as aloud as "the creative Word should sound”: yhy (jehie).

252 The verb is grammatically the 3rd person. male. sing of the qal of

the verb HWH, but in the jussives form, a subjunctive, polite form, sometimes

also used as imperative (imperative). The conclusion is clear. The

name hy (Jah) is the underlining of the idea by Rabbi Cooper described

that G’d is a verb. We see that confirmed the verb yhy with y as grammatical

praefix. We describe the name hy (Jah) as a source of power as Information

activator of potentiality. This means that the connection with the

Name also has a connection with the creative information, which is supported

by our energy and activation.

The Name as a verb, linked to the DNA

We are bringing these active particularity back to the first two elements of our

DNA, fixed in the Periodic Table and established as the connection with hw, the

Word creating "harmonious order" - the Light. The connection between our DNA

and the Source of creative power, making every human creature moderately capable

of creating this "harmonious order," the Light, that transforms chaos into an

eternal order.

In our DNA, our “co-created self” is discounted. Any individual who does not

developed into 'co-creator' which brings a fracture in his own human identity as

creative and regenerative, restorative and transformative agency.

This compound is present in every human being. This connection comes from

legate, the basic form of religion. It is this connection between our DNA and hy

(Jah), which makes each man a religious being, a human, religious from primal

connection with which hy (Jah), also bond with man and creation and is taking

active responsibility.

252 The verb is grammatically the 3rd person. man. enk. qal of the verb HWH, but in the jussivus form, a subjunctive, the

polite form, sometimes also as imperative (imperative) is used. That is clearly the case here.



282

The sixth as perfect number for space and periodization

We know that physical hydrogenium (hydrogen = 1) hardly can be found in a free

form in creation, but that has a high degree of reactivity to bind many elements.

Thus, the first is again provided with a special feature: high binding capacity. The

physical launch of the creation process which begins with the release of hydrogen.

253 Hydrogenium has the ultimate connection with hy, like all the connections

in the billions of years that follow, in which the rest of evolution and creation will

develop on the basis of the information, provided through hy (Jah) from Ein Sof,

the Infinite No-thing planned resulting in a permanent process of osmosis.

When we revisit it, by numerically and totalising we get 15 as a numerical value.

We totalise and simplify via the single digit reduction into a single number:

10 + 5 = 1 + 0 + 5 = 6.

Since Pythagoras, we know that six is a perfect number. A perfect number is the

number of which is the sum of the divisors is equal to the number itself,

so: 1 + 2 + 3 = 6.

We read the first word of Tora tySarb (with the Beginning) splitting it into two

parts arb (create) and ySS (six as a cardinal) - as the Babylonian Talmud does

substitutes ySS into tyS (six as space and periodization) - than we have deepened

meaning: "And G’d created the sixth”. 254

253 In the further it is clear that I take with my proposed Osmose model farewell to the Big Bang and thus of the Big

Crunch.

254 We read about this in BT Sukkot 29a: "The school of R. Ishmael taught: Bereshith; read but not Bereshith bara shith ".

The linguistic relationship between YSS (six) and Tys (in the sense of "created reality") is difficult to find and requires

further research. The Zohar uses this dichotomy and the meaning of the sixth which was created as proportions of the

space of creation, including the periodicity is discounted in the sixth



283

14.12 Word is sound

Since the overall shape of the first word of the Torah consists of six letters, we

could accept without any difficulty the special creative meaning of the sixth as

informative number, space and time expressing in Torah. The perfection of the

number six in the Pythagorean sense is overruled by the connection with the Creative

Word of six letters for communication and information, leading to the complete

creation. The Word is the real spoken word that brings us to the scientific

knowledge of our current time concretely in the statement: Word = Sound. The

Hebrew "laienen" (reciting a Torah text) is an example of how a text switches

into sound 255 , as in Greek literature, where the metrical feet ensures the musical

character and harmony of sounds, as architecture of the texts, besides the rhetoric’

as melodic declamation.

Creation, result of sound?

The physical developments have brought the super string theory closer. As I will

describe later is also the numerical composition between string theory and Tora

strikingly related. The ten dimensions of the super string theory are significant.

(Jah) and Ha-Wa-JaH (existents)

As the sixth as perfect number has entered in the creation and evolution, we find

the sixth as the space dimension in which is created, then we accept the sixth also

as periodization of the evolution (days as periodicity). This physical elements

space and time are functionally present in nature and culture, also connected to

the Name.

255 The Bible should be read in public, and must be made understandable for the audience by pleasant melodies. Whoever

reads from the Torah without melody demonstrates disrespect for both the Torah and to the said laws and regulations

therein.' (Talmoed B. Megilla 32a.).



284

Thus the Periodic Table of the Elements, the 6 as the sum of the letters hy = 1 + 5

= 6 and the elements H + N = 6 starting with the fundamental relationship between

the Periodic Table as equilibrium with Nature and Torah (1+5 – h + N).

The bond between nature and hy is ultimate concern for the total reality in progress,

Existence (in Hebrew HaWaJaH = 26), in which human beings are being

set as co-creators. Since he is the Creative Substance he is giving the substantial

attributes emanated on behalf of creation of derivative phenomena, modes, bywhich

the evolution is created with the Periodic Table as Nature of the Book of

creation, hence the equilibrium with Tora.

The presence of all these details in the first two elements of the DNA of all living

organisms, from plants to my wife, establishes the unity of all creation and stresses

the indissoluble bond with hwhy or (Jah).

Fragmentation we've made in the west, with the human being as specific appearance

as co-Creator, far above all living things, has broken the unit into differentiated

cultural formation chained in the centuries.

Fortunately, we respect the DNA as possibility of the openness for spreading the

Information of the present hy (Jah), the creative force, possessing the ability to

heal what is broken: the single human cell to crush injuries at the cosmological

level. That is our human mission to make the world better. In Hebrew it is called

tiqqun olam (new world). Before that time is currently we need to love each other

as a unit, as a community of responsible people.

We thus close the discussion of the first two elements of the DNA molecules and

move on to the 3rd and 4th element of our DNA (see Table).

14.12 DNA makes humans a human community

r-b-x (ch-b-r) the Hebrew equivalent for the Latin "ligare" connect



285

We have found - in the first two atoms of the underlying source codes - that atoms,

after analysis of elementary particles, quantum waves and particles connecting

their probabilities and possibilities in the downward causation. All that rest

for us is forcing the same task for the other two atoms Oxigenium (16 = 7), and

Carbon (12 = 3). These both create an interesting dynamic as the both values of

the atoms are taken together to 3 * 7 = 21.

The first atoms reflect the shortened G’d's name as the first action potential. The

next two atoms of the DNA also have a relationship with the G'd’s name as a verb

hyha – ejeh, with a value of 21. The significance of the presence of these active

force is within the DNA: connecting, merging, make up to unity. Here we have a

reflection on the second action potential in Thymine (C 5 H 6 N 2 O 2 ) one of the 4

molecules of DNA.

The first result of the updating of the existing potential is the Hebrew verb rbx

(ch-br), a word that is known as "chaber". The numerical value of rbx(ch-br) is

from right to left: 200 + 8 + 2 + 0 = 210 = 21 = 21 = 7 x 3. These are the two digits

of reduced Oxygen and Carbon.

The verb rbx (ch-br) can be translated as "Connection" and is an equivalent of

the Latin "ligare", of which the biochemical term "ligand" - agonist on the cell

membrane and/or nucleus - stems.

(Example: Ligand binds to the receptor on the membrane of the cell and penetrates,

after the bond has arisen, through the wall into the interior of the cell - the

cytoplasm - and is doing its intended work with the purposes of the cell.)

Be attending: we have create a new calculation, by which we can open the black

box dynamics of DNA. The atoms Oxigenium (16 = 7) and Carbon (12 = 3) illustrate

the relationship with the Hebrew verb rbx (ch-br) 'from an single connection

into the mankind community", based on the numerical values. Now follows

an ultimate explanation of the numerical value 210.



286

Factorization and new conceptualisation

210 = 2 * 3 * 5 * 7

Regroup = 210 (2 * 7) * (3 * 5) = 14 * 15

210 = 14 * 15

14 the numerical value of dy - yad (hand) * 15 as the numerical value of hy - Jah.

Both terms are symbols of activity (the hand with which we act in relationship

with Jah). The appropriate verb, to deduce from the two terms, would connect as

stated [rbx - ch-br] can be. The number 14 is the numerical value of the human

hand. There is, as we saw a Source hyha - ejeh, with 21 as value.

The DNA is the base of this connection structurally open for the creating and

recreating by transformed information, through which energy frequencies as vehicle

in connection with the name (hy) in the cells longing for the healing frequences

of on behalf of the "psycho-neuro-immune" - system, by cell function up

to return into its original healthy state. As a result, it also heals the immune system

and is the likelihood of a complete cure of the disease individual. No merely

a treatment of symptoms, but an attack on the cause of the disease itself. 256 Finally,

we see hope to experience again the stability has recovered by the Orchestration

Factor of Repair.

256 We have omitted in this statement the difference between genome and epigenome. This is further up the order.



287

Chapter 15 - Good Bye, Big Bang!!

No fire, but water and light 257

B

oth Eastern and Western scholars agree the proposition: all is energy!

The energy within this overall study is based on the a as the 1 abs . Besides

the a, the letter and number symbol of Ein Sof, we presuppose

the creative Authority, the Infinite No-Thing. This authority over whom we can

not say anything, withdraws inside himself through which is created in the heart

of the unknowable infinity an "empty space". This void is different from the

“empty space” of quantum physicists. This void is the space in which the process

of evolution as creation will take place. The "void" is enclosed all around by the

non-infinite self, by me expressed in the formula a = 1 abs . We can this supposed

process best characterises with the term "wall" (ergo: Ein Sof itself), the boundary

between Infinite and finite not only reflect in necessary vocabulary, but also in

our minds, focussing on the reality of this "delimitation", making the "effective,

energetic space of creation", was born. Behind this wall is the unknowable information

with the apparent parameters for the process of evolution and creation.

Carried by the energy of “a = 1 abs ” emanates the "creative potential" of the a and

imbues the entire "creative empty space". This process creates something new,

something that will become known to humans as the crown on the created reality

in the present "potential" waiting on disclosure. The emanation has transformed

the a-energy as 1 abs into the same energy but now as a = 1 rel .

257 As used tunnel-image is metaphorically derived from the Lorenz wormhole and used for my evolutionary model

function as a basis for Osmosis, by the categorical enforcement of 1- absoluut, replaces the Big Bang hypothesis, all the

troubles it generates notwithstanding. When we watch the Hubble resonances physics can remain in full force until quantum

physics. But the improbable 0 disappears from the system and makes way for security of immovable 1. As we will

see, the first and the heart of cosmology can be based on the Hubble background radiation. The one here is the locus in the

space where the greatest density of galaxies is present at redshift 1.



288

The first conclusion is: the multi-dimensionality is an enlightening information

within this system is becoming. The discrepancy between 1 abs and 1 rel extracts the

multi-dimensionality of our perception in awareness and knowledge. These dimensions

are located but because we do not nothing about this Absolute Energy

we never ought to speculate about the a = 1 abs . The Consciousness by oriental

philosophers and quantum physicists like Goswami as a fundamental starting

a

a absoluut = √1=1

a

Aa relatief = √1=1

point for "Being of beings", it is the

model that I advocate here broken down

to the a = 1 rel which does have an active

connection to the a = 1 abs so that the

unity of Being is guaranteed from the

process of downward causation,

through the osmose model that we'll

describe shortly.

Creative Substance is incomplete,

but remains absolutely

downward causation

An unscientific, simplistic explanation

for what happens in the osmosis. what

we will find in what happens when we

put it through a coffee filter. The coffee

is supplied with water in the filter, and

drips through the filter in the basin that

collects the filtrate, and for us as a drink

has made available. The filtrum, the

actual coffee is left in the filter. Here

the example is misplaced, because the

actual coffee is of no interest to us, and



289

we throw it away. We have enough of the substance with which we can do something.

When we look back to the "delimitation of the space of creation" and the creative

substance that will fill this empty space, then the simple example of the brewing

enough to tap into some imagination as stage for a higher level of abstraction of

the osmosis process.

The filter is the division between absolute (coffee) and relative (coffee). Only the

last coffee is within our reach.

The Creative Authority a = 1 abs gives us the bulkhead as filter “The Creative Authority

a = 1 rel .” The last body is within our reached life and science. The downward

causation is launched: the process will come to an end after all. The question

that continuously occupies us and also we will not cover here is: “Is there a

way back from relative to absolute in a final station of evolutionary developments?

In the Prolegomena we have given some guidance on that.

Now, the physical side of the osmosis-model.

During the emanation, the flow out through the "separation wall", a structural

change took place, namely the process of 1 abs to 1 rel. In other words, the process is



290

a substantial and dynamic change of "energy beyond our ability of recognition

(Ein Sof - a = 1 abs )” to “energy recognisable (as Substance Deus sive Naturam -

a = 1 rel )”.

The first result of this process is formation of water and light, occurrence of probability

information waves and particles. There is no "fire" involved. Hydrogen is

the first atom - atomic number one in the Periodic Table - within the space itself

and everything inside this space happens relatively late in Ein Sof, as

“a = 1 absoluut “.

The osmosis model has an explanation for this change without first being lost into

0, as in the Big Bang hypothesis came true. We consider - through the Darwinian

upward causation the zero-point energy as a form of "an endpoint". Matter phenomenologically

ends in the quantum vacuum and probabilities (Heisenberg and

Bohr).

The osmosis model, the "probable" of the Unknowable absorbs and makes the

Unknowable, the Infinite No Thing potential expressed in the osmotic effects.

Not the "fire" of the big bang bestows existence, but the hydrogen with atomic

number 1 continues the trend of downward causation, all evolutionary processes

included. That does not mean there would not be a release from heat and cosmic

background radiation unlocking the potentiality of the a = 1 rel .

In sum

The first result of the osmosis process, basic energy through a semi-permeable

boundary present between ‘infinite’ and ‘finite’, is the emerge of the "relative a -

field", a vacuum field, full of potentiality which contains the entire creation in

potency. Through the downward causation, with an inner guidance to articulate

outbursts and gradual processes, we recognize this actualisation as nature and

nurture. Thus, the evolution started in order to complete itself, without a break

between the "relative-energy a - field" (whole of Being and beings) and the Un-



291

knowable Absolute, which makes “everything as relative”. All the laws of nature

are outcrops of this articulating potentiality, with evolution as creation as an ongoing

process, enabling actualizations in space and time, matter and matter negligence.

15.1 Man, cosmologic genetic field and unlocking process

epigenetic structure of anticipations and retrocipations

During the evolutionary development, human being stands in the spotlight of the

a = 1 rel in order to crown the actualization of the downward causation: the

planned, but also the emergent processes, leading to the above described developments.

In order to get a good overview of the place of man, we need making a radical

break with the veiled, but still active dualism of Descartes, who divided man in

body and soul. In my humble opinion there is no essential distinction inside a

human being as a fundamental unit. There is only one being as the unification

existence of functionally distinct layers. These paradoxally substantial layers create

a functional unit by anticipation and retrocipation, with differentiation influencing

the different layers, which form parts of the disclosure process in macro

economic (organs) and micro economic (cell’s) sense. Note that the term "economic"

here and elsewhere is used in its original Greek meaning: household, in

particular: energetic economy as effective and affective communion with Being

and beings, in a transcendental phenomenology, the cosmological grid a = 1 rel

included.

Are we a creature without a soul?

To ask the question is to answer it. Of course not, but what do we say when we

ask ourselves this question? Would we think about one or more loci in our physi-



292

cality (body, soul and spirit)? Or should we retent in our unity a reminiscent of

creative unity, by which the soul is the life-giving Body, which binds us in our

cell economy through ligands at the cosmogenetic substance, which we have

shown in the all-pervading energy-cosmogenetic grid (a = 1 rel ) that all levels of

our existence governed as human system?

In short, the man has no soul, but he is a complete unity, a living soul. In other

words, he has no divine sparks, but it is a divine flame, burning in the darkness of

existence, available as homeostasis inside our often disrupted structure of the

unlocking process.



293

Chapter 16 - Layered body in dimensions

Human being

Dialectic-ligand body image

Consciousness body image

Hermeneutical body image

Vital-emotive body image

Physiological body image

Downward Causation

multidimensional phenomenon on evolutionary grid a = 1 rel



294

16.1 Body diagram and body image

S

urrounded by the creational-energetic matrix, an evolutionary a = 1 rel -

grid, the human being is a concrete reality, a matter of fact. It’s a body

that develops “a carnal life in contact with the physical world, represented

in the illustrated energetic matrix, the evolutionary a = 1 rel -grid. This open

body constitutes the “body diagram”, for every human being. In all circumstances

the “body diagram” remains unchanged: a girl remains a girl, and normally we all

have legs to go. But inside the body diagram a personal interior grammar rules

life. Our verbal and non-verbal communication reveals the interior grammar. This

grammar, with syntax and vocabulary, will change by emotional experiences.

Grammar and experiences produce the “open body image”.

This open image is unique to each person. It is a part of the subjective and personal

history. The body image is not the body diagram, although the body diagram

contributes to its creation by living inside the creational-energetic matrix,

the evolutionary a = 1 rel -grid.

The unconscious body image is a living synthesis, constantly updated by life experiences

we repeatedly store through elective, erogenous sensations we previously

felt by our current bodies. The body image is a carrier of the temporal dynamics,

the dynamics of desire and its records in time; it records the passing of

the time of desire, its peregrinations, halts, and the possibility of pursuing a harmonious,

balanced, and inspiring temporality.

The main difference between body diagram and body image is this: the latter

can’t draw freely, but can only be experienced by the dialogue: sometimes as a

“dialogue interior” (e.g. pathological element of schizophrenia), but mostly as an

interpersonal dialogue with revelation of inner elements of life.

Although both elements of the human being seem to be substantial, the body diagram

and the body image remain a united phenomenon with a dialectical essence.



295

Actually the idea of the differences between body and soul must give up. Spinoza

has given us very strong evidence to solve the mind-body dualism of Descartes.

The universal Substance (a = 1 abs ) emanates both body and mind; while they are

different attributes, there are no fundamental differences between them. This

formulation in his Ethics is a historically significant solution to the mind-body

problem, known as neutral monism. There is a correlation between Spinoza and

Taoism. In the image of man, belonging to the Hebrew traditions, is more or less

an equation with the Ayurvedic image of man, close to the explanation of Goswami.

16.1.1 Body image and the Identification Factor

The five-fold body image has a specific meaning for every “energy field”

inside the image of man as a unity. This specific meaning, concentrated in

one central point, dominates the entire field as an Identification Factor.

16.1.2 Identification factor of images downwards

dialectic-ligand body image:

consciousness body image:

hermeneutical body image:

vital-emotive body image:

physiological body image:

source bounding

cosmic consciousness

self-consciousness

unlocking process of attachment

bodily and mentally homeostasis

The Identification factors have a double meaning. The first function of the mentioned

factors is the "foundation function." With this foundation function, we

build specific meaning and praxis. Besides this foundation operates the Identification

Factor in order to get a so-called "destination function". The existential

question of the destination function is: “How can we reach our destination, prepared

by the foundation function of the specific part of the body image, in connection

with the external body diagram, fed by the creational-energetic matrix,

the evolution a = 1 rel –grid?” The available energy in different frequencies inside



296

the matrix, empowers the body diagram and the body image as well. In a mutual

process of anticipation and retrospection between the Identification Factors, the

human individual is growing on all levels of the body image and has been woven

in an adequate learning process of life. Obstructions of this process creates a catastrophic

unavoidable learning process, with pathogenesis as the effect. Disruption

of source bonding, cosmic consciousness, self-consciousness, unlocking affirmation

and mentally and bodily homeostasis, effects into diseases, illnesses, and

mental disorders. Schizophrenia is a strong example of an overall obstruction,

with a flat affect and auditory hallucinations as positive symptoms. Hopeless?

No! The self-recovery mechanisms will be activate by e.g. the Tesla-energetic

Mindlink-system.

The multidimensional human being - distinguished into body diagram and body

image - can be considered as a creative energetic "container-contained" -

development model. This model will give us perfect insight into the pathogenesis

of the foetal programming as I will elaborate in the last part of this dissertation.

16.2 “Container-contained” development model

This open development model is a hermeneutic model of the downward causation.

In this top-down model, the physical body – vitally and mentally included – is an

open container, open to receive the specific energy from the radiation background,

the a = 1 rel -grid. This openness belongs to the first conscious-dimension:

“transcendental-ligand”. The ligand is a derivative of the Latin verb “ligare” and

is an antenna protein on the cell membrane in micro-sense. The same verb in

macro-sense illustrates the permanent connection with the a = 1 rel -grid and, as an

ultimate consequence, the eternal connection, via the a = 1 rel –grid, with the

Source of All: a = 1 abs . As extensive elaborated in the Prolegomena, the loss of

the personal contact with this final consciousness of the Source of All, asks for



297

recovery: re-ligare, the verb of religion, without being a religion as an organized

dogmatic phenomenon.

Because of the final connection with the Source of All by the human layer of

“transcendental ligand”, the human being is typologically a homo religious, in a

mutualistic meaning by anticipation and retrocipation, terms as representatives of

the downward and upward mutual influences.

In this model we are a container in which continuously is putting potentially creative

and informative energy. After actualization of this potential and informative

energy, the effects will emanate upward and downward to the adjacent levels in

an ongoing process of development of the partial dimension and finally of the

whole system.

In a short description of every dimension, drawn in the image, the importance of

this “container-contained” development model will be clear.

16.2.1 Three-dimensional image of human beings

The departure point is the downward causation, that means a top-down

model for humanity. When the human being of the "evolution and creation"

is being developed, and as homo sapiens is unlocked, he lives in his natural

state, but with an awakening consciousness of his dialogical disposition, his

relationship with the Source. He exists on the second level, cosmological

and sociological aware of its existence, in an open manner in a dialecticalligand

and transcendental dimension, in solidarity with himself and his surroundings.

We speak of an ecstatic person 258 – a person in fundamental relationships, being

able to step outside himself – living in communion with the Other, with them-

258 The Latin verb “exstare” means literally ex-stare as “being outside himself” or extend above



298

selves, with a transcendent and immanent position, with the human community

and the earth. So his transcendental consciousness is an anticipation, the increasing,

steady growing unity on the a = 1 rel -grid, in a process of constant absorption

of new information as permanent education.

This learning process in the first degree gives adequate information to the partially

opened underlying four dimensions, with selective reply as additional information,

an enrichment of the next upper level.

16.3 More dimensional portrayal of man

When someone has a strong conviction of the cosmic consciousness as the fountain

of life and reality, this ‘programming conviction’ has a limiting effect on the

dialogical relationship and growth processes, belonging to the transcendentalligand

dimension, i.e. dimension 1, fundamentally open to the Source of Energy

of Life. In other words, the dialectical-ligand dimension of life receives full influx

of energy directly from the Source of Life: a = 1 rel . The human life of the

first level is in a permanent state of tendency, waiting for energetic information

coming from the Highest Level: The Source (anticipation). This tendency only

can be satisfied by fulfilling of the desire, the leading power within the development

process.

This received and elaborated energy radiates enriched upward back to the Source.

The Source also will be enriched by the dialectical-ligand transcendent relationship

coming from the human being in his first Level. This is the process of reverse

influence by retrocipation. All levels deals with the same process of anticipation

and retrocipation, downward and upward connections as the Vital Program,

elaborated on level four. Obstruction of this mutual Vital Program in antic-



299

ipation and retrocipation creates a catastrophic learning process, with – in medical

terms - pathogenesis as negative-energy effect.

Because of downward causation we are connected with the Source, which gives

us life energy, and instruct us to open up and activate the interwoven information,

holistic unification, as ultimate concern. Updating the energy information carried

within each dimension on various appropriate manner.

This effect visualises, that every dimension of the human system has its own container

function, by which the information is elaborated in a way appropriate within

the bounds of dimensional possibilities, contained upwards and downwards by

indicating the adjacent dimensions. The resulting effects of anticipation and

retrocipation ensure the systemic-organic unity: the human condition in an adequate

or catastrophic learning process.

[Since we compare the human system with a bio-computer - modelled by Lechner

in his publications on the technique of Mindlink-system - the computer is determined

by the programmed information. The concept of information and functions

are the most relevant source to get a closer look to the facts, with a view on the

collection of the sampled material which will lead us to a diagnosis. Storage of

this information effectuates the "container-contained" model for a more dimensional

portrayal of man.]

16.3.1 Information in our "container"

We receive continuous information in our lives, roughly putting in our

container, which we must do something with this "contained" energetic

material - the result of processing of information - to treat the system parts

of our individual lives and the collectiveness of the community to which

we belong. This raw information is prepared, personified as "my information"

which I - with positive assessment - to myself and others may



300

pass, or negative assessment - to destroy because of the threatening content.

Also within the downward causation guiding evolution is space for corruption

because of the emergence of independent power giving virtual

shape to the present energetic information. This creates good and evil actions,

which might not have been included within the causation, but must

be attributed to the evolutionary and phenomenological independency of

the processes.



301

Chapter 17 - Information, what is it in the

energetic health-care?

17.1 What is actual information and how does it work in

us?

W

e find the basic meaning of information looking at the Latin verb

`informare`, which is a composition of 'in' and 'formare`. Forming

is to give shape. But what happens when we connect to form with

the prefix 'in'? We get a new meaning: in-formare is "shaping from inside."

We take some data in, and what we have taken in will constitute us. Information

thus has an active internal effect.

Our brain activity is mega fast. We receive information and compare it immediately

with the knowledge we already have received and which we have stored as

useful in our memory. New information confronts us. Our meteoric thinking pose

as a thunderbolt to the question: is this an enrichment of what I already know, or

is it a threat to me? Our choice is easily made: useful, it is an enrichment, unusable,

it is a possible threat.

The actual information operation of our inner self is a general process, the same

for every human individual. It belongs to the structure of the human perception

and experience.

Central point in this process is a stored residue: the "background radiation", radiating

effects of what we already received and stored in our subconscious that we

define as "the memory of the experience," our permanent "background, stored on



302

a vital-emotive virtual raster. 259 Decisions are made. always influenced through

this background information. That is our standard. We give meaning to all aspects

of our life and thereby we create ethics, by which arises right and wrong behaviour.

17.2 Pathogenic-energy background radiation

As part of our investigation now we will consider the Foetal Programming as a

process, being the "pathogenic-energy background radiation" of the prenatal

stage, with genetic, epigenetic and maternal developmental effects as sources of

radiation, which develops the embryo and the later foetus as a "container" to contain

"harsh" information in order to soften this rigid material: actually to live.

This information is, after a shaping process and potential disempowerment, an

example of defensive action of two main enzymes on the rigid energies, as HPA

insufficiencies, appropriate energy "contained" in the foetus as container, passing

the five dimensions of our physicality, processed by anticipation and retrocipation

in our human system as we considered in the previous chapter.

The background - result of foetal programming - e.g. inhibiting growth (pre-, peri-

and post-natal) until approximately 4 year’s age – is responsible for the hermeneutical

horizon of understanding of life, with related links, disrupting the human

system with diseases and distortions of all matters of fact.

Distorted understanding of ourselves as well as the Other as horizon of understanding

within we live, takes us on the way of negative self-understanding, creates

pathogenic force fields with diseases, illnesses and mental disorders, with

heterostasis, allostasis, homeostasis as possibly results. The hermeneutical distortion,

with effects for a negative self-understanding, full of misconceptions, affects

259 The field of epigenetics presents itself here.



303

the overall physicality, being the central part of our human physical unity. Goswami

speaks about the "mental body" in which the intellect plays a main role.

This “mental body” is in my vision the 'container-contained’ system that has become

a universal pathological and pedagogical “anchorage-detach” model, in

other words: an attachment-disattachment model

The intra-systemic or the micro-cosmologic background radiation - the effects of

prenatal intra- and intercellular information - exists - like everything - of energy

in different frequencies like music of 528 Hz of which we researched and registered

the healing effects, together with the energetic harmonization program of

the Mindlink-system.

"Everything is energy" dominates the scientific domain! Unfortunately, within the

conventional medical education domain it isn’t. In the complementary-alternative

medical work field we hear too many statements like: "my energetic system it's

true!" These items have to be questioned because of the questions around the real

relevant, scientific evidence. Therefore, strong research is needy to be sure about

real "evidence and value based medicine", bound together as unity in diversity, a

new unbroken paradigm for East and West.

In sum

Summarizing, we concluded information is an overall concept playing an active

role in the development and intra change of any system. In this study, it concerns

the biological and cosmological systems in addition to the human way of

thoughts and presented images, playing a dynamic role of information.



304

17.3 The a-field: quantum energy, number 26 and

its derivatives

The universe is a result of the osmotic process and has received its own quality of

creative energy emerging from the Creative Authority, Ein Sof, with an osmotic

value, physically unknowable, but as an impenetrable mystery remained inside

the inaccessible Absolute Energy. The osmotic process works like a filter and

makes a distinction between absolute and relative energy, distinction between

active and measurable physical energy within the universe and the unmeasurably

non-physical energy of Ein Sof. This emerging process never stops. We cannot

say nothing more about this fundamental distinction. Ein Sof, as the Creative Authority,

has given the most important part for scientific research of the Universe,

energetic filtrate of the continuous osmotic process, research until the boundaries

of our cognitive faculties.

17.3 The composite structure number of the a = 1

The shape meaning of Aleph, the a, the quantum energy field in which the number

26 and the dominant source of energy have emanated and are present within

nature and nurture.

We now come to a conclusion of the theoretical part of this dissertation. We

talked about a permanent emanating source of energy with the number 26 in a

representative place inside nature and its shapes, as well as in the culture and its

developments.

In a medical thesis we not only deal with medical-philosophic views with which

we agree or not agree. We desire an evidence-based medicine with a concrete

space for the value based medicine as complementary enrichment of what can be

in the medical science field. The extensive philosophical considerations which I



305

really consider indispensable for a solid foundation of the energy diagnosis and

treatment within the medical and therapeutic domain.

The number 528 is in this thetic part the dominant number of 528 Hz music, basically

connected with the Hebrew text and its numerical values. That is what we

will describe in the following part about medical and therapeutical praxis. However,

we will also have to consider the 528 Hz as a representative of a physicist

particularity, based on empirical research, established by energetic reality. The

latter we deal with as basically for a brief treatment of the Schumann resonances.

The a - quantum field proposed by me, with the first and irremovable presence,

will be the contrast and open to the debate with the opposition of the field of zero-point

energy.

The downward causation, which has determined the structure of our research, the

state 0 as principle and final point of evolution is not increasing.

We will point back to 26, the number of the Hebrew fourletter Name of G’d, unmistakable

in the full light put down as a source of power. The 26 refers to the

Aleph and in it to itself, as the shape will clarify.

a = composition of the mirror = 10 =

and w = 6 and the y = 10.

Value 10 + 6 + 10 = 26

With this we can conclude that hwhy – YHWH also consists of the numbers

10 + 5 + 6 + 5 = 26.

For a final application I point return to the infinite repetition of the number linked

to the DNA structure (Commeren).

As the formula of the Source of creative Substance formula has represented as a

= 1 abs and through osmosis into scientific research valuable energy is enabled,

thereby the moderate formula is drawn as a = 1 rel , the Hebrew numerical values



306

will form a equitation with mathematics, which represents the abstract language

of physics. The steadfastness of the Absolute One we have stressed by the formula

[a = 1 abs = √ 1 = 1] we originate the Hebrew Tanakh that appears to be an equilibrium

with mathematics and the natural sciences.

As much as it implements the natural sciences, we will see it based on the Schumann

Resonances.


307

Practical Part – 528 Hz-music- Schumann Resonances - Mindlink-system

Intermezzo


308


Sound and Music, emanated from Source

a abs

M

usic is the representative of u-topia: in the original sense: a non

place.

Why? Is Music indeed organized noise with strict limitations?

True, but these restrictions are not caused by phenomenology of music, but by

our human and cosmological limitations. Every frequency has its own power and

restriction. As a human being we have to accept the audibility registration of the

tonal range of 20 Hz - 20 kHz (20,000 Hz). Beyond these limits, we are definitely

not in the structureless middle of nowhere, where music ends and the eternal silence

begins.

Passing the borders of the acoustic realm of 20 Hz – 2 kHz – the borders of the

upper and lower limitations, phonomen of Infrasound and Ultrasound exist, quantum

waves with a multitude of left and right spin. This cosmogenetic pool of original

a-energy stretches to the boundary of the Infinite, when unmeasurable sound

frequencies try to stabling the boundary of a, the creative, energetic Source of all

life, and of all motion and spin, ergo the Source of phonomen full of energy and

specific frequencies.

This argument only makes sense within the darwinist “upward causation” and the

reduction policy.

A new argument with a strong outcome arises out of the opposite movement: the

“downward causation”, with an unavoidable change of thinking. No reduction of

matter, but “origin of matter” through the process of activation and coagulation

of potentiality, that contains all aspects of life and all cell developments in a process

of sane activation.


309


The conclusion of the downward causation is: sound has a founding function of

all matter and life. I agree with Dr. Bruce Lipton and his research community:

DNA and the Genetic Code can’t be the origin of life, neither the Genetic Determinism

in relation with the epigenome of the influences of the environment.

My postulate therefore is: sound is the creative power, interfering at the boundaries

of the cosmological and astrophysical existence. We approximate the superstring

theory, in connection with 528 Hz as attractor. With this postulate we place

(Tesla) transformed audible music (acoustical realm) and the Ultra- and Infrasound-waves

(sine-waves) in the center of the process of life. That means the

“Orchestration Factor of Repair” is the founding Sound- and Music-power under

all medical and therapeutical processes which guide us to the origin of the disturbances

(diagnostics) of the completely homeostasis (Ultra-high and Ultra-low

frequencies), implemented - via the Schumann Resonances and the Tesla-

Mindlink-technology – in the attractor i.e. music of 528 Hz, which in this dissertation

has elaborated.

Music and mRNA-codons

The developments in the field of Infra-sound and Ultra-sound as nature – outside

the acoustic realm – remain us inside our ranges of perception. For instance, the

dark sound of an organ pipe of – virtual – 256 ft (excessively built beyond the 20

Hz) produces a sound of ± 2,05 Hz (λ=v/f). This sound – widely beneath the

Schumann Frequencies - can be registrated by vibration of our skull, skeleton,

organs and our skin, as the trembling process, going along the nervous system,

the registration parts of the brain, and the receptors, ligands and Guanine Coupling

Protein Receptors (GCPR) as well. That means: all Infra- and Ultrasound

influence our body, just like all objects in common.


310


Music divided in Triads (codons)

The acoustic range 20 Hz – 20.000 Hz is divided over 8 octaves = 8 x 8 tones =

64 tones.

Immediately the question raises: Does a connection exist between the 64 tones of

the 8 octaves and the 64 codons of the mRNA?

The next fundamental question is: “Are the music and sound frequencies the ingredients

or instruments for the Genetic Code, the DNA and the Proteins?”

If the answer is affirmative, then music (acoustic realm), the Infrasonic and the

Ultrasonic are the source factors of generation of DNA, Polypeptides, Proteins,

Nucleus Receptors (NR) and GCPR.

The Codons of music have a basic structure in Triads, just like the Triplets or

Codons of the Amino Acids.

What is the main step of implementation of this music/sounds into the medical

praxis? When 528 Hz music is indeed the Absolute Attractor by its relationship

with the a-Source – also subliminal – then we have found the “Orchestration Factor

of Repair”. Consequently, can sound and music, mastered as 528 Hz music,

repair broken DNA-sequences? But also this verdict demands evidence by scrutinous

scientific research.

In the scientific domain of the Upward Causation many scholars are researching

the repair of faulty DNA-sequences. One of them is Jennifer Doudna, researcher

at the University of California, Berkeley. She has developed the CRISPR-Cas9-

system for replacing faulty pieces of the DNA sequences, by sane sequences. It

has become possible, in theory, to treat these diseases by removing a patient's

bone marrow, repairing the damaged gene, and then returning the repaired cells

into the patient. In practice succeeding with that approach has been nearly impossible.

"But now, the cost for that has come down to where it's really feasible to

tailor therapies using the patient's own cells, essentially correcting their genetic

disease." Though a lot of testing still needs to be done before doctors can say the


311


CRISPR-technique is safe and effective enough for use in treating patients, even

many scientists, not directly involved in the research, are enthusiastic about its

possibilities. So CRISPR is one of those interesting inventions that comes, not

from scientists explicitly trying to cure a disease, but from researchers trying to

understand something fundamental about nature.

The CRISPR-Cas9 enzyme (green and red) binds to a stretch of double-stranded NA (purple and red),

preparing to snip out the faulty part.

Conclusion

In this thought experiment – as a starting point for longitudinal research – we see

the Source of power – the Source of creating and re-creation Sound/Music that

must be the inspirational power to the researchers and the recovering power, implementing

and guiding the process of healing; a treatment with basic energy,

transformed by the technology of Tesla.

Music, energy of nuclear-receptors NR, GCPR and

pharmacology

A mission for alternative biotechnological-pharmacological research


312


How deep reaches the music and sound by Tesla-technological mindlinksystematic

transformed energy? Is it possible to research evidence for biotechnological

pharmacology comparable with the synthetical pharmacology within

the conventional research?

I am convinced that the opportunities we have are positive, that we are able to

reach each other, instead of rejecting each other.

Starting point is Einstein’s statement “All is energy”. This complex of energy we

all have in common. The most important concerns are the receptors (membrane

and nucleus) and their energy in protein or molecular movation.

In this study I focussed my attention mostly on the receptors of the cell membranes,

until this point of research as a setup for a new research. Beside the membrane-receptors

(MR) exist the Nuclear Receptors (NR), very important phenomena.

In a Brief Overview, Vanden Heuvel wrote interesting details. I quote: “Unlike

receptors found on the cell surface, members of the nuclear hormone receptor

(NR) superfamily are restricted to metazoan organisms such as nematodes, insects,

and vertebrates. These proteins are intracellular transcription factors that

directly regulate gene expression in response to lipophilic molecules. They affect

a wide variety of functions, including fatty acid metabolism, reproductive development,

and detoxification of foreign substances. Many of the NR’s act as ligandinducible

transcription factors, responding to endogenous and exogenous chemicals.

However the vast majority of known receptors do not have an identifiable

physiologically relevant ligand, and are deemed orphan receptors.

To date, over 300 NR’s have been cloned, although there are only 48 members of

the family in humans”. 260 Nutrition must be seen as an important carrying instrument

for development of a sane working human system.

260 Vanden Heuvel, J.P. Nuclear Receptors: a Brief Overview, 2009.


313


Prof. Dr. Luc Brunsveld recently published a research about the NR in relation to

the pharmaceutical industry. About 13% of all medications has a connection with

the receptors in the nucleus. Strong problems are the side effects of these medications.

According to the “alternative” or “complementary” pharmacology the fundamental

question arises as to whether we can we give evidence by strong scientific

research for naturopathic medications as a complement of the allopathic

medication. It might be possible, I think.

There are 48 known NR’s with openness also to exogenous chemicals. These

chemicals can be replaced by direct energetical impulses, a result of Teslaenergetic

Mindlink transformation into the needed frequencies.

The music of 528 Hz is an attractor which assimilates e.g. the ELF Schumann

Frequencies, but also the energy coming from outside our domain of measurable

science - the a-field - as I described in this dissertation.

Let’s try to find out the opportunities of the healing power of energy without side

effects and resistance. This must be seen as a conditio sine qua non for leaving

behind the mutual distrust within the medical domain. Bio-chemical research –


314


Mindlink-harmonisation program and 528 Hz music as attractor included – must

produce new research, in order to reach a new vision on the Integrative Medicine

and all side frames.

The Mindlink-system can function as an instrument and help to reach this progressive

result.

DNA binding domain (DBD)

Crystallographic structure of the human progesterone receptor

DNA-binding domain dimer (cyan and green) complexes with double stranded DNA (magenta).

Zinc atoms are depicted as grey spheres.

Composition Model for 528 Hz music as

Mindlink NR- and GCPR-binding research

In the Practical Part of this dissertation I will prove the probability factors for the

accuracy of my raised postulate.


315



316


Explanation image above

In the center of the Power are Sound and Light, which flow from the a-axis and

a-source-field of all existence. The connecting lines put 528 Hz at the intersection

of the Acoustic realm, the Infrasound and the Ultrasound, culminating in the

virtual shape in which they are formed. The Just Intonation, concerning the 8 octaves

(8 x 8 = 64 tones), has the C’ as exactly 528 Hz. In the image we see 10

octaves. The C1 is hardly audible and the C10 is only for flageolet tones. So the

central 8 octaves form the composition realm with 64 tones.

Explanation image below

The 528 Hz music gives creational power to the DNA-molecules and influences

the production of proteins and polypeptides

(see the grey block).

The mRNA, is responsible for the

translation of the 20 amino acids

into 64 codons or triplets. Uracil has

taken the place of the Thymine in

DNA. (see: the blue table).

Defect DNA-sequence

Left: a damaged DNA-sequence,

that has to be repaired by physical

instruments as described above:

CRISPR-Cas9-system of Jennifer

Doudna.

As far as my postulate is concerned,

we consider the “Orchestration Factor of Recovery” prior to the physical instruments,

because of the preliminary position of sound and music in the evolution.

Finally, this means every DNA-molecule, polypeptide, protein, NR and GCPR


317


probably has sound and music as an intrinsic factor. So the final “Orchestration

Factor of Repair” exists as “sound and music” (see below in the dissertation).

The “Orchestration Factor of Repair” is rooted in the fundamental a-Field, the

Source of Life and Existence. Herewith, we are back at the beginning, the source

of the downward causation evolutionary process – Ein Sof.

Summary

The Orchestration Factor of Repair (OFR) has a twofold elaboration according to

the connection between the agonists and the antagonists of the Membrane Receptor

(MR) and the Ligands (neurotransmitters, steroids and the peptides) with their

binding activities, and the Nucleus Receptor (NR) and the binding Ligands of

GCPR.

The net gain of the Tesla-transformation, as activator of the Orchestration Factor

of Repair, we find after deduction of the energy frequencies of the agonists and

the antagonists. The OFR creates a power center between the agonist and the antagonist

with homeostasis as result. Anyway, this is the conventional way of creating

allopathic synthetically medication, as well as the natural biochemical research

for naturopathic medication.

As a third option I suggest the 528 Hz music and the Mindlink-technology as a

medium-less treatment, based on the exact frequencies, connected with the origin

of the distortion, disease or illness.

This three methods of medication should be considered as complementary.

We ought to establish strong evidence for this distinct verdict.


318


Practical Part

18. Schumann Resonances

19. Hexachordum Duplex and Clinical Neuromusicology

20. Hebrew 528 Hz, a systemic “attractor”

21. Womb as Paradise Lost

22. Philosophical Clinical Hermeneutics

23. Schizophrenia and Hermeneutics

24. Evolution, Scalar waves and Complementarity

25. Epiphysis, synonymous of the Third Eye

26. Mindlink-system, technical research and report

27. Statistical Report

28. Concluding Remarks

29. Recommendation

30. Epilogue


319


Chapter 18 - Schumann Resonances -

Tesla, the first person with a wave of 12 Hz,

after him Schumann with his frequencies,

starting with 7.83 Hz.

7,83 Hz - Schumann Resonance - 528 Hz


320


18.1 On the rhythm of the earth

T

he Schumann Resonance (henceforth the SR) is academic as well as

popular science. The latter mostly belongs to the esoteric domain, with

statements still asking for evidence. The sincere outcome of the content

of my research implicates also research of verdicts as esoteric speculations, without

evidence, even statements of academic geophysics from Greg Braden. “He

claims to have found data, collected by Norwegian and Russian researchers not

widely reported in the US (...) about the change of the Schumann Resonances

because of climate factors. Braden pointed to the only reference to SR, to be

found in the Seattle Library. This referenced section is tied to the weather. Science

acknowledges the SR as a sensitive indicator of temperature variations and

worldwide weather conditions. Braden believes the fluctuating SR may be a factor

in the severe storms, floods and weather of recent years.” 261 The remarks of

Braden are supported by a recently scientific publication “The Schumann Resonance

for Tyros”. 262 As far as the geophysical matters are concerned Braden

could be right but there is something more.

In the study of the Dutch biologist Bosman “The stimulance of self-recovery by

Schumann-resonances” she collects some options about the SR inside the esoteric

domain. 263 In much spiritual literature and on the internet we find many speculative

opinions about the basic-frequency of the SR (7,8 Hz). This basic-frequency

261 Miller, Richard Allen and Iona Miller, “Schumann’s Resonances and Human Psychobiology (extended version), 2003.

This paper is a mixture of scientific particularities and esoteric material, useful, but with a very critically attitude, shifting

the corn.

262 Nickolaenko, A. and Hayakawa, M, Schumann Resonance for Tyros, Essentials of Global Electromagnetic Resonance

in the Earth-Ionosphere Cavity, Springer Verlag, Tokyo, 2014. “Thus, observational data indicate that the Schumann

resonance frequency band is a natural (and free of charge) instrument for the remote sensing and monitoring of many

interesting phenomena from a single or a few ground-based observatories. The advantage of such a method is in its “passivity”:

only the receiving equipment is applied while the radio signals are supplied by natural sources of radiation. (...)

owing to its natural origin, the solutions of inverse electromagnetic problems becomes rather complicated since we do not

know much about the source of particular events of radiation”. The introduction of the book will underlines the actuality of

the matter of facts. The authors: “We tried to include all the new results and present them from the point of view of possible

geophysical applications”.

263 Publicated in the Dutch scientific Magazine of Integrate Medicine (TIG), 2003


321


should increase from 7,8 unto 14 of 15 Hz, cause of the increase of our consciousness

and our brainwave-frequency from the Alpha-level to the Beta-level.

Because of reaching the wake-level-frequency, esoterists like Greg Braden translate

this suggested increase as a spiritual awakening. This interpretation is neither

reachable - because of the impossibility to sleep (alpha-level) – nor geophysiological

correct, because of the relationship between the fixed circumference

of the earth (40.000 km). If the SR should increase in the way they suggest,

the earth has to downsize. This didn’t happen. Bosman also quotes Braden, who

has got his information from Russian scientists, however without any references.

264

As Braden, according to worldwide spiritual circles, should not speak with an

great authority, even beyond his work as a geophysicist, I would have keep my

“pen” shut, because of my fundamentally disinterest in his opinion. However I

want to take my scientific responsibility actually playing the critical chord, as

belonging to my research.

In his book “The God Code”, Braden uses the Hebrew language seemingly to

give support for his idea’s. For instance he wanted to connect the Periodic System

and DNA. 265 In an absolutely unacceptable way he has changed the atom values

in such a way so that they will be useful to him and his idea’s. I wrote him personally

but he answered me after my follow up through his secretary that he was

too busy to pay attention to my critical remarks.

Why do I mention this fact? Because it damages the weak, but positive developments

of bridge building between conventional, complementary and alternative

medicine.

264 Braden, Greg, Awakening to zero point: the collective initiation, LL.Productions, Bellevue WA, 1994, pages 65-82.

265 Braden, Greg, The God Code. The secret of Our Past, the Promise of our Future, London, 2004, pages 155 following.

Braden is using the Kabbalah and his gematria is – as far as the Hebrew meaning of Torah and TNK is concerned – very

doubtful and a mixture of many cultural traditions. This and his former publications have no scientific sense for the linguistic

research of the Hebrew language in connection with the sciences.


322


18.2 Tesla the first person with wave of 12 Hz, after him

came Schumann with his frequencies, starting with 7.83

Hz.

Is there a relationship between the Earth’s Fundamental Resonant Frequency

(SR) of approximately seven and half beats per second, the natural phenomenon

of lightning and a simple and inexpensive device, that creates enough electricity

to power an average home? Nikola Tesla’s experiments in Colorado Springs during

the 1890’s assisted him in making important findings and conclusions about

the waves of electromagnetic energies, flowing through the earth. (…) Tesla proclaimed

that he could provide free electrical energy for the entire world. Was

Tesla the first to manipulate or control the Earth’s Resonant Frequency? 266

The frequency of an electromagnetic wave is not precise and slightly fluctuates

whether generated influenced by a black or a white hole, or a computer program.

Therefore, the SR can slightly shift above and below the 7,5 Hz average, the

Earth’s Resonant Frequency (7,5 Hz).

The electromagnetic wave differs in meaning with the amplitude. This difference

is very important for the expressions of the SR, with 7.83 Hz as the general accepted

frequency, with a correction of 0.5 Hz above and below 7.83 Hz.

Anyway, there are many cosmic and weather events and earthquakes which influence

the SR and its harmonics. Geomagnetic storms leads to magnetic changes,

produced by ionospheric storms and are thus associated with conditions capable

of changing the Schumann Resonances SR. However, although such storms can

produce these changes, measurement of these parameters cannot give any indication

of whether the resonant signals have changed into a value outside their nor-

266 Andersen, Bryon David writes in his paper “Manipulation and Harnessing the Schumann Resonance” about the historical

knowledge of the Egyptians and the Pyramids. So Tesla wasn’t the first one.


323


mal range or not. Since the undisturbed state of the ionosphere correspondents to

the normal SR-patterns, then ionosphere disturbances are likely to produce abnormal

patterns, but will not necessarily do so in all cases. When biological response

is linked to the Schumann signals, this will reduce any apparent link with

geomagnetic or ionospheric data. 267

18.3 Electromagnetic ELF frequencies and brainwaves

Several studies have made clear the SR and the brainwaves are close connected,

but not directly as I explain here.

Brainwaves have been studied in 1920 with the outcome of the alpha-rhythm,

nowadays the most well-known frequency between 8 and 12 Hz, with an average

of 10.5 Hz. Theta- and Beta-rhythm signals also occurs, and are identifiable by

EEG, below the 8 Hz and above the 12 Hz frequencies.

In the Fifties of the last century Schumann suggested that electromagnetic signals

might circulate at extremely low frequencies (ELF) in the electrically resonant

cavity between the earth and the ionosphere. This signal became the Schumann

Resonance (the SR). One major component was originally predicated at a frequency

of about 10 Hz, likely the same EEG-frequency of the mid- or the alphawaves

(8-12 Hz).

In fact, the first mode of these circulating signals has an average value of 7.83 Hz

with a typical diurnal range of from 7.2 to 8.8. Hz, and the second mode has an

average value of 14,1 Hz. This last value is for the moment the first harmonic

upper value of the – in musical terms – tonic of 7.8 Hz with the fixed correction

of 0.5 Hz. The SR seems to remain in the neighbourhood of the alphabrainwaves.

267 Miller and Miller, op. cit. page 6


324


The brain is a massive source of ELF signals that get transmitted throughout the

body through the nervous system, which is sensitive to magnetic fields. Brainwaves

and biorhythms can be entrained by strong external ELF signals such as

stationary waves as SR. Entrainment, synchronisation, and amplification leads

toward coherent large-scale activity (…) Thus resonant standing waves emerge

from the brain, which under the right conditions facilitates internal and external

bio-information transfer via ELF electromagnetic waves. These SR waves exhibit

non-local character and nearly-instant communication. 268

The conclusion of Schumann and his successor König about the 7.83 Hz was: we

have to do with the heart-beat and the brainwaves of the earth.

18.4 Entrainment, synchronisation and amplification 269

Before we describe the three terms it is necessary to put in line the meanings of

the diverse brainwaves for our daily life and the pathogenesis as well.

We find this outline in the Brainwave Frequency Listing.

18.5 Full Brainwave Frequencies Table

Between 0.5 and 90 Hz are the states and frequencies that comprise the vast majority

of our day to day experiences. The table below breaks these core frequencies

down further and shows some frequencies outside of this range that correspond

to some more rare and unusual states of consciousness.

268 I am very grateful for the summation of the mainline of this matter, by M & M.

269 This overview is part of the “infinite mind”. (www.infiniteminds.info)


325


Name Frequency Characteristics

Lambda

Hyper Gamma

~200Hz

~100Hz

Self-awareness, higher levels of

insight and information. Tibetan

monks that walk barely clothed for

days through the snow have exhibited

high levels of these. They are

difficult to measure and little is

known about them. They are carried

on the very slow moving Epsilon

Waves (<0.5Hz).

Gamma 38 - 90Hz

Important in harmonizing and unifying

thoughts processed in different

parts of the brain. Combines

different perceptions. Essential for

complex motor processes. Suppressed

totally by anesthetic. Found

in all parts of the brain.

Beta (High) 18 - 38Hz

Wide awake, alert, focused, analyses

and assimilates new information

rapidly, complex mental

processing, peak physical and mental

performance, cannot be sustained

indefinitely otherwise exhaustion,

anxiety, and tension result.

Beta (Mid orange)

15Hz-18Hz Wide awake and alert behaviour.

Beta (Low) 12 - 15Hz

Also known as Sensory Motor

Rhythm (SMR) - vigilance, reduced


326


Beta-Alpha

Alpha

Alpha-Theta

Theta

12Hz

7.5 - 12Hz

7.48Hz

4 - 7.5Hz

6.2 - 6.7Hz

4.5Hz

mobility, shallow breathing, less

blinking, fixed attention and eye

focus, enhancing through neurofeedback

has a calming effect.

Hyper-efficient in processing single

tasks as the brain can focus on the

details as well as the overall task at

the same time

Mental coordination and resourcefulness,

relaxation, alert but not

mentally processing anything, inward

focus, calmness, at ease, deep

breathing and closed eyes can amplify

alpha wave production, peaks

around 10Hz.

Schumann frequency. Stimulates

retrieval of memories from the subconscious.

This is the natural vibrational

frequency of the ionosphere

in the earth’s atmosphere.

Associated with memory access,

learning, deep meditation, sensations,

emotions, the threshold of the

subconscious, dreaming.

Cognitive activity, sustained attention,

low anxiety

Associated with many altered consciousness

states. Shamanic trances,

Tibetan mantras and Buddhist


327


chants use this frequency to access

trance states

Theta-Delta ~3.5Hz Long term memory access

Delta

0.5 - 4Hz

Deep sleep, human growth hormone

release, low blood pressure,

low respiration, low body temperature.

No muscle movement - Reticular

Activating System (RAS) shuts

this down.

Epsilon <0.5Hz

As with Lambda and Hyper Gamma

waves, less is known about these

states due to the rarity of observing

them. They have reportedly

been associated with the state Yogi's

go into when they achieve

"suspended animation" where no

heartbeat, respiration or pulse are

noticeable.

Brainwaves, recovery and the Schuman Resonance

In the contact between the brains and the SR - a remarkable phenomenon - has

been revealed. The brains has a tendency to change its dominant EEG frequency

towards the frequency of the dominant external stimulus. This is known as the

“frequency following response”. The stimulus that creates this response can be

visual, tactile or aural.


328


In Sum

The research of Bosman concludes that our brains undergo the influence of the

stronger SR. The systematic effects on the brainwaves is “entrainment” – the frequencies

of the brains will be tied up by the SR so that the lowest frequency harmonizes

with the highest.

Bosman uses the example of two clock’s hanging on the same wall. One of the

clock’s is ticking stronger compared with the other one. After some times the

clock with the softer tick has been slowed down and is harmonized with the

stronger. The wall has an intermediary function.

This intermediary function is always necessary for entrainment. What is the intermediary

for entrainment between the stronger heartbeat and the softer brainwave

frequencies? The image of human beings with several dimensions can function

as intermediary in a specific way.

Bosman mentions several instruments for entrainment: cell membranes, proteins,

DNA-sequences as fluid crystals and the cytoplasm as a fluid crystal by which the

ELF becomes stronger. Very interesting is the idea that electromagnetic waves

radiating biological systems and frequencies higher than the SR tends to form

interference patterns.

One of the practical conclusions is: the SR creates biological effects. These effects

are important for medical approach. 270

Before I come to a last and most effective treatment of the SR and the 528 Hz we

will prepare for the entrainment concerning music and speech elements of the

Mindlink-system.

We found a summary on Infinite Minds with very useful material for the practical

research and the brainwave entrainment.

270 Bosman, Dr. S. op. cit. page 350.


329


18.6. These are three main methods currently used for

brainwave entrainment.

In 1973, Dr. Gerald Oster of the Mount Sinai Medical Center published a report

in Scientific American called “Auditory Beats in the Brain”. In this report he explained

that when tones of different frequencies were presented separately to each

ear, pulsations called binaural beats occurred in the brain, which resulted in the

whole brain becoming entrained to the internal beat and resonating to that frequency.

The application of the binaural brainwave entrainment process is quite simple.

You hear two pure tones in each ear. Let's say 400 Hertz and 410 Hertz. Each ear

hears a singular tone. Your brain detects the difference between these two frequencies

- and 'produces' a 3rd tone of 10 Hertz inside the brain.

18.7 How binaural beats generates a single frequency in

the brain

Even though you perceive this 10 Hz sound, the third tone, it is not an actual

sound at all. It is an electrical signal that is created as your brain processes each

tone from the left and right ear separately. As the brain continually processes this

3rd ‘ghost’ signal, it begins to emulate frequencies (or “entrain”) unto that 10 Hz

stimulus.

This phantom 10 Hz signal is created by both sides of the brain working in

unison. This dual processing can lead to a state called hemispheric synchronization

or whole brain sync. This high functional brain state occurs when both sides

of the brain are functioning in tandem.


330


This is especially useful for entraining the brain to frequencies that are below the

threshold of human hearing as entrainment at these levels cannot be produced by

Isochronic or Monaural beats.

18.8 Isochronic Tones

Isochronic tones played out of each speaker are identically spaced Isochronic

tones also referred to as rhythmic entrainment uses audio entrainment pulses to

entrain the brain; a single tone that is cycled on and off to produce the beat. The

main advantage of using Isochronic tones over binaural beats is, they do not require

stereo headphones for effective entrainment. It has also been claimed that

the brain adapts to it and as a result filters out binaural beats with prolonged use

and although there is some research that supports this hypothesis there is still conflicting

evidence over this claim.

18.9 Monaural beats waveform

Monaural beats play both tones in each channel so the interference pattern that

produces the entrainment beat is present outside your head and we repeat it, it

does not need headphones to be heard. The last is of less meaning for the

Mindlink-system.


331


18.10 The SR and Yin and Yang: research of Ludwig 271

The aim of the dissertation research on the Schumann Resonance by Dr. Wolfgang

Ludwig was to measure what kind of natural signals actually exist in the

healthy environment. He became aware of the fact that due to manmade electromagnetic

signals within the atmosphere it was almost impossible in the city. He

went to the sea and registered stronger SR conductivity.

The electromagnetic field inside the earth registered close to the surface of the

earth is considered to be in close connection with the electromagnetic field in the

space between the earth and the border of the ionosphere. Ludwig postulated that

two directions of ELF influenced the environment and the human body as well.

Out of the earth: the signal from below and the signal from the ionosphere as the

signal from above in a mutual interaction. This mutual interaction brought him at

the old Chinese vision of Yin and Yang. In the image of man for a complementary

medical development the Yin and Yang can also be replaced by anticipation

and retrocipation, the interaction between the body fields of the image of man,

compatible with the bodies, or fields, in the Ayurvedic image of man of Goswami

and his connection with the morphogenetic fields of Rupert Sheldrake. 272

Ludwig’s description fits the relatively strong signal of the Schumann wave surrounding

our planet being Yang and the weaker geomagnetic waves coming from

below, from within the planet, being the Yin signal. The Chinese teachings state

that to achieve perfect health, both signals must be in balance. (...). “Resonance:

Beings of Frequency”, is a fascinating documentary which speaks of the Schumann

Resonance of planet Earth and the effect it has on human health. 273

271 Ludwig, Dr. Wolfgang: www.schumannresonator.com and Aetherforce, open course living science/Schumann Resonance.

Informative Medizin, Essen, Germany, 1999.

272 Sheldrake, Dr. Rupert A New Science of Life: The Hypothesis of Morphic Resonance (1981)

273 Ludwig, Dr. W. op. cit.


332


Coming to an end of the considerations

on the SR and the complementary

medicine, before description of

the startling conclusions on the SR

and the relationship with music of

528 Hz, I will give a quote from

Ingrid P. Dickenson from her website

article.

“Although Schumann Resonance could easily be confirmed by measurements at

the time of its discovery, it is no longer so obvious due to our atmosphere being

filled with manmade radiation noise at different frequencies. This is almost

drowning out the natural signals – signals that have been there through aeons of

evolution. It is possible that these signals act like a natural tuning fork, not just

for the biological oscillators of the brain, but for all the processes of life. (...) We

may be creating an environment that is literally ’out of tune’ with Nature itself.

And it is at this point that there is an urgent need for us to understand how everything

alive responds to the most subtle changes in magnetic and electromagnetic

fields surrounding us. For instance, we need to examine the possible interaction

between magnetite crystals within cells and manmade magnetic fields in the environment”.

274 The meaning of the functionality of magnetite crystals comes true in

the next part, where we have to speak about the possibly antenna character of the

pineal gland.

274 Dickenson, Ingrid. P: www.earthbreathing.co.uk/sr.htm


333


18.11 The SR and the fundamental frequencies in short:

7.83 Hz, harmonisations and octavation device

What is the connection between the SR and the a – field with 26 as a crucial

number value?

What is the connection between the SR and all we have descripted as the foundation

of the complementary medicine, the neurological music therapy and the

Mindlink-system of energetically-dialectic diagnostics and treatment?

What is the connection between the SR and the Twelve Tunes Circle as an elaboration

of the so-called solfeggio-frequencies, corrected by me into Hexachordum

Duplex (see the next part)?

The answer is as well complex and simple considering of what has been argued

earlier.

First we look backwards to what has been revealed as the “standing wave” that

Commeren has discovered on the prime number 53 in the quadruple number system.

I repeat the explanation:

The prime number 53 creates a standing wave with 52 as root (2x26) as fundamental

and a first harmonic overtone of 26 wave, a second harmonic of 13 waves,

13 waves of a third and a fourth from 26 waves.

18.12 Standing wave

Since the space between the earth crust and the underside of the ionosphere it

gave space to lightings and storms and a radio wavelength of 40.000 km,

the dynamic amplitudes between the earth crust and the underside of the ionosphere

have the character of a standing wave with a maximum amplitude of 50

km.

Here I refer to the image of the a and the different meaning of 26 in nature and

nurture. The SR is a scientific affirmation of the creational meaning of the num-


334


ber 26 as the reflection of the Source and the effective presence in the empirical

reality.

Since the Schumann resonance and its ± 8 Hz (7.8 +/- 0.5 correction) correlates

with the prime number 53, we use the single digit method of Pythagoras and conclude:

the “standing wave”-model on 53 in a quadruple number system is related

with the Schumann Resonances.

Because of the meaning of 26 as the value of the Name YHWH, we consider the

SR as an effective part of the quantum a-field, concretes in the name Ein Sof, the

Infinite, No-thing. The final conclusion is: the SR has a connection with the Hebrew

text of Torah.

The SR, the ground tune and the harmonics

The ground tune of the SR is a dynamically but steady frequency of 7.83 Hz with

variation of 0.5+ of 0.5-.

Schumann measured several harmonics: 14.1-20-26-33-39-45-51. 275

We see 7 harmonics ending in the “triple 17” and 17 is the short value of JHWH.

The second conclusion is: the SR has a connection with the Hebrew text of

Tanakh, because of 51 times 528 in Tanakh.

The SR and the music of 528 Hz

The octave device will give us a solution: the variation on the SR 7.83 with +

0.42. 276

“Octavation” in music means an ongoing process of doubling the frequencies by

twice the former frequency, starting with the Tonic, the ground tune.

275 These numbers belong to the structure numbers of the Hebrew language. The numbers 26 and 17 (3*17=51) are the

value of the Name of G’d (full and small).

Number 45 is the value of Adam, the human being.

276 My research about the outcome of the octavation of the SR has been confirmed by the research of Nickolaenko and

Hayakawa: “Frequency (SR) is the parameter (...) of the Pointing vector for f = 7.5, 7.75, 8.0 and 8.25 Hz. This dynamic

results of the SR upgrades the 7.83 into 8.25 Hz as the ground tune in the African and American point sources, op. cit.

page 281


335


That means for SR 7.83+0.42= 8.25 Hz as ground tune.

Octave 1 = (7.83) 8.25 * 2 = 16.5 Hz

Octave 2 = 16,5 * 2 = 33 Hz

Octave 3 = 33 * 2 = 66 Hz

Octave 4 = 66 * 2 = 132 Hz

Octave 5 = 132 * 2 = 264 Hz

Octave 6 = 264 * 2 = 528 Hz

The third conclusion is: SR has a connection with the Hebrew text of Torah.

SR and the cross-connection harmonics and octave device

(7) harmonics 277

14.1

20

(7.83+0.42) 26

(6) octavation 8.25 16.50 33 66 132 264 528

39

45

51

277 All SR-harmonics are structure-numbers in the Hebrew Tanakh. The last is 51 = 3 x 17. We know 17 as the short

name of G’d in the Hebrew language. It is remarkable that these frequencies are connected with the Tanakh. Exactly 51

unique words with value 528 in the entire Tanakh. So here we found an evidence of value in Tanakh and science (SR).


336


About the cross-position of 33 Hz we ought to do more research

For the time being it is enough to conclude that the SR fulfils a key-position for a

renewal of the energetic complementary medicine in general and the Mindlinksystem

in particular.

From the start of the SR until 528 Hz are 6 octaves.

From the start of the SR there are 7 harmonics. The seventh is 3 * 17 with 17 as

the short value of the Name JHWH.

Actually there are 6 creational harmonics and the 7th is the resting harmony as

equivalent to the a – field. The 6 activations culminates in the a-field too.

Around the a-field moves the new twelve tunes circle as we shall see in the next

part.

Anyway, science and the Hebrew numerological logo technics form an equilibrium.

The numerical values of the Hebrew language and the numerical values of

the mathematics are no longer concurrent but in partnership. The evolutionary

creating energy of the SR and the 528 Hz is as realistic as the tree in front of my

window.


337


Chapter 19 - Hexachordum Duplex and

Clinical

Neuromusicology -

medical-philosophic research of the energetic Source of Sound,

Light and Water

19.1 Instrument for recovery, empowerment and renewing

of man and creation

FOXP2 - gene

O

ver the past 20 years, research in the neurosciences of music has

brought a fundamental shift in concepts about role and function of

music in therapy and medicine. Now we consider music as a complexity

of sensory language that engages cognitive, affective, and sensory-motor skills

as processes in the brain, which can be structured to facilitate re-educating of the


338


injured brain. The past years have led to understanding of music as a skill of language

rehabilitation in perception, cognition, and movement. Critical consideration

opens the way to research items, linking auditory rhythm and music as skill,

to the motor system, elucidating the brain, basis of music recognition in regard to

attention, memory, executive function and brain plasticity.” 278

19.2 The reason for the 528-analytical research

It can’t have happened by chance, my confrontation with music that explicitly

hadn’t any effect on me as an aesthetic experience. After research it became clear

not the audible, but the transformed-energetical effects touched the brain. Thereby

it influenced directly the activity of the cells of our body and mind, besides the

intrinsic seat of our consciousness and unconsciousness. Since we are created as

human beings composed of cells, renewing themselves every day in large numbers,

connected with the Quantum Field of Potential Energy like all life and mat-

278 Dr. Michael H. Thaut, “Rhythm, Music, and the Brain: An Evidence Based Scientific Framework for Neurologic Music

Therapy”


339


ter. Body cells - vibrant energy particles with separate functions – are susceptible

to environmental influences, and since everything is energy, vibrations, it is logic

that music affects cells, cell-contents and cell-functions with many different reactions.

Now let me say this immediately: there is an ongoing research concerning

the effects of this music influence, depending on the layered portrayal of men.

Within the scientific biology there are clashes between biologists who are traditionally

fixed in mind, accepting a human being as a machine (matter), versus

biologists who renewed the portrayal of man as an energetic cell-community, a

partnership of about 50 billion interacting cells.

Most scientists of the New Biology stand along the side of the Eastern philosophy.

They always have been assumed consciously of the substantial energy and

human being as an energetic being.

Western traditional and materialistic scientists mostly evoked a resistance to outsiders.

Natural sciences not only has rejected G’d as Creator and Re-creator, but

they even have broken the causal link between body and mind on the contrary of

Descartes. Descartes splitted the human individual into a new dualism: the soul

for the church and the body for sciences. In this way he saved the church authority

from the atheistic influences of science. He actually made a spiritual and biological

split between mind and body. The “little gland” (epiphysis as the seat of

the soul) had he handed over to the church, which remains authority over the spiritual

side of human life. The fabric body became object of science. Against this

artificial dualism fulminated Spinoza, Decartes’ strongest opponent. Spinoza defended

his monism as fundamental contrast with this still actual dualism.


340


19.3 Music that repairs DNA: a resume

The suggested recovering DNA codons (pieces of DNA) fled over my screen.

YouTube was full in action. I was upset because of lacking any reference to scientific

research or other substantiation. Here I give a short resume of the within

YouTube movies suggested healing factors of 528 Hz music.

Reading the limited descriptions as a foundation I found a story telling that referred

to the English translation of the Hebrew Bible, the Tanakh, "a revelation

story of Jesus and some angels." It was a self-proclaimed religious experience of

the American natural doctor Joseph Puleo who passed away in 2008. Judging by

the extraordinarily amount of quotations of his experience, it seemed to make

furore inside the inner circle of like-minded followers; time and again using this

story for emphasizing the truth of their own findings.

Instead of using the translation in English I started my research with looking for

the frequencies of love and heart within the original Hebrew texts (Tanakh and

traditions) as well as the linguistic-logo technical study of the number 528.

Semantic research on the music of Torah (528 Hz)

Once starting my Hebrew language research, I noticed an immense astonishment

and "Entdeckersfreude" about the linguistic miracle in the composition of

Tanakh, the Hebrew Bible with its alpha numerical structure, the literary architecture

by the Hebrew language.

Averse to scientism, my methodological choice nonetheless intends to give an

expression of scientific reverences concerning the greatness of the creative relationship

between Infinity and the process of finite, the ultimate silence at the

crossroads between Emptiness and Fullness of Being.

My research, dealing with the number 528, touched the source question: "For the

writers of Tanakh does the number 528 also was of equivalent value. Was this the

impact I encountered in the YouTube presentations?” And if not, out of what


341


source emerges these suggested supramental frequencies, and with what supramental

Source the YouTube-number 528 is meta-linguistic 279 connected?”

19.4 Method of revealing linguistic architecture

In 1908 the Jewish Bible scholar Oskar Goldberg (1889-1953) discovered that the

Torah was a building built of compositional numbers.

In the Sixties of the 20th century the Austrian Bible scholar Claus Schedl discovered

that the findings of Goldberg even applied to the entire Tanakh.

In the Netherlands, prof. Dr. Casper Labuschagne developed this system thoroughly

and I am indebted to him for his knowledge, dealing our interest and love

of Torah, Tanakh and Jewish thoughts. On my turn a culturally additional part of

this logotechnical system I opened and this is also available for re-examination by

strictly scientific researchers.

The entrance for my basic research was the question: "Is there any evidence in the

Torah for a six tone music system, which was similar to the extra-biblical term

“Solfeggio tuning system”? Does this also mean that the music of 528 Hz belonging

to this Solfeggio-tuning system, contending the power for profound healing

on cellular levels, as it proposed many times on YouTube and in the publications

of writers like Horowitz and his like-minded followers?

279 By "metalinguistic" I understand the linguistic added value that stands behind our epistemological brainpower. With

this I illustrate my attempts to avoid the hollowed and theologically loaded term "metaphysical". Obviously it is as a

philosopher not inappropriate to use that term but in the comparative study the tendency to cross-border theological consciousness

is very large. I will refer to it repeatedly. It is not necessary to create images of God that can fill gaps in our

thinking as we find with creationists, proponents of Intelligent Design and theistic evolutionists. The task for a scientist is

indeed create and interpret the verifiable reality. That is precisely the order in the opening up of the numerical proportions

of Torah, towards homeostasis of the scientific reality which, like the just mentioned theological-dogmatic convinced, is to

refrain from dogmatic scientism, that same compulsion the "scientific world", as the only scientific truth claims for himself.

My research involves a homeostasis between the numerical values of the Torah (mathematical proportions as formula

language) and the numerical values of the natural sciences (mathematics as formula language).


342


"Recovery and Healing" are concepts that invite us wholeheartedly to work out

the mission to provide a better world and to help the injured individual. In Hebrew

this recovery process is called tikkun olam, repair of the world. The personal

character of music does not only has an advanced sense of the new world we look

for. The entire mankind – without any religion - is subservient to this new world.

But as far as a deep self-reflection is concerned, we come to our private and

communal search of tikkun middot, the renewal of our personal lives, transformation

of our souls and transforming our socio-political convictions.

It would be great if the music of ancient Israel and its specific frequencies of restorative,

regenerative energy transferring at the cellular level will improve the

suffering individuals. Here I have broken down the link with the Roman Catholic

poem - base of the later Solmisation system. Let us focus the presence of the Solfeggio-frequencies

in Torah, in line with the YouTube information.

As a part of the scientific study of the question concerning the provability of correctness

it must be without falling into pragmatism like: "It works, so it's true”.

An investigation to prove truth and reality of subjective experiences is doomed to

fail. Therefore, this study has to research the structures of the theory of the experience.

These structures are plural and empirically researchable. By this standing

in the evolutionary history of nature and nurture - we cannot go along the ancient

mysticism and the experiences of the mystics.

19.5 Without mysticism no scientific knowledge

There is no argument concerning the proposal that mysticism precedes scientific

developments subsequently providing a base for scientific developments. This

doesn’t mean that mysticism is blended with, or pushed away by the exact sciences.

Any approach retains its own specific nature and is not separated. The distinction

between exact science and mystical experience seems insurmountable.

But on closer inspection, expressis verbis dealing with a paradigmatic paradox


343


which finally results in the "matter-mind" paradox of the apparent separation of

the pathways of science in e.g. the two medical-therapeutic mainstream programs

and their derivatives.

Facing these paradoxes creating space for an open dialogue will give possibilities

to resolve the hardly irreconcilable nature of the relationship between conventional

and complementary medicine: a dialogue within the common field of research,

more specifically in this study: "the non-conventional scientific research".

Because the developments of Jewish mysticism since the Middle Ages and the

early modern period exhibited in our time in astrophysics and cosmology. These

mystical developments are nowadays associated with natural sciences in general

and biochemistry and nanotechnology in particular. Here I find a defiant justification

for the choice for my research as a fundamental departure point with the influential

Jewish mystical writings included. To be clear: I am not a mystic, but I

am really open to the deepened layers of life (meta-positions and -dispositions) as

we find in Tanakh.

Invisible presence off the Source of Creative Energy

At this moment I do not hear any music. However, the radio signals with classical

music are around in my room but I do not hear them. They are present because I

know about it. If we don’t perceive, they are not exactly present quantum physicists

taught which have changed the security of Einstein into "probabilities" and

uncertainty (Niels Bohr, Werner Heisenberg, Copenhagen interpretation).

Let’s go back to the musical frequencies in my room. When do I hear the

"waves"? At the moment I turn on the receiver. But if I don’t turn on the tuner/amplifier

the sound waves are converted into particles because of my lack of

knowledge, converted into "inaudible, subliminal musical particles of experience"

stored in my unconscious memory. These particles are unconsciously, stored on


344


the virtual raster of memories of experience, but we nonetheless can research

them because of their being particles.

The Source of indispensability

Does the above remarks mean that the audible beautiful music is stored in my

tuner-amplifier or stored in the good quality antenna?

No, not at all.

We always need an active, emerging source producing the music. We also must

have knowledge about the source, if we want understand the waves and the particles,

the unobservable and observable sounds, not only to enjoy but also to develop

knowledge about the physics of sound and sound transmission.

Even the quantum void of subliminal, unconscious experiences is never barred

from contact with the Source. The scientific "white heat" of quantum physics is

ever dependent on the source; the source of knowledge, which is "the key to the

secret of the energy of life".

19.6 To the music as a focus

The quantum physics - translated into the clinical energy in our time – have

changed the old physics of the Newtonian matter, as the previous source of the

origin of life. Quantum physics have whisked us into new developments of an

invisible reality: the world of processes and developments driven by quantum

energy within a quantum vacuum of a filled void. The world of emptiness is no

longer unfilled, but a filled incipit, a radical initial. 280 In philosophical terms: the

sciences have lost the incipit, the pride of the voiced Word from the beginning.

We are stuck in the space between non-being and being.

280 The Latin incipit still pointing in the old English for "the beginning." As a cultural tour de force the monks decorated

the first letter of a text - the initium - with rich images and colors. The beginning after all represented as "the start of the

important”.


345


The contact between the cells of the body with their "antennas" (the proteins as

receptors and ligands), and the music and frequencies which bind to the cells,

belong to creative synthesis of (recovery) processes. 281 If we consider the creative

power of the energy of life, then music is a vehicle for the transfer of power and

re-creating many things.

It’s an assignment for us to examine the blueprint (Torah, Evolution and Creation)

282 with new proportional meanings for healing music communication, implicitly

for the purpose of integrative medicine, recognizing the human, epistemological

and methodological limitations. 283

From my principles a thorough study of the numerical and linguistic peculiarities

is surrounded by precise, transparent and numerical structures of the Hebrew

Tanakh, the confrontation with wisdom and insight of the writers and their

knowledge as "background radiation" to get fundamental insight in the power of

music. The Shekinah, the Ever-Present Power, as source of inspiration will give

the scientific knowledge an extra dimension. All together, these particularities

form the epistemological-hermeneutical background radiation, which is more

than the cosmological background radiation of Hubble. This preliminary background

radiation is composed of empirical reality, energy emanating from the

Source, recognizable by the numerological logotechnical compositions of

Tanakh, connecting to our inner consciousness that manifests itself in personal

experience as natural and cultural significant "background radiation" the dialectical

encounter with the Source, which - without precise empirical knowledge and

insight - is creative, reshaping knowledge in our mind.

281 Bruce Lipton therefore speaks of "cell membrane", partly because of his claim that the cell has memory, even if the

cell itself short-lived. Refer to its destination.

282 The Vital-Emotive field of Ayurvedic and Jewish portrayal of men.

283 With some reluctance, I use the term "blueprint" because this fits into the origin of the creation of Jewish tradition. A

blueprint, however, indicates that the realization is made along a solid design. I here prefer potentiality as a set of opportunities.

These opportunities will continue to dominate this study.


346


With the famous formula E = mc 2 Albert Einstein proved that energy, mass and

speed are related. Energy is divided into a variety of forms. For us, energy in the

form of sound is the most important, because we are talking about sound as

speech and music.

The central tone for the music of our time is A in the first octave, that makes 440

vibrations per second. Abbreviated: A = 440 Hz.

But that wasn’t always the case. The music has a variety of artificial moves that

preceded the equally artificial equal temperament. We must return to our research

further the tuning trends of Pythagoras.

The development of tuning forks demonstrates the diversity of pitches which

were often practised in different countries and cultural circles, difficulties within

the international and even interregional orchestra. In the middle of the 20th century

the A of the first octave became the standard tuning: A = 440 Hz. The revival

of early music has led to the baroque tuning of A = 415 Hz. The "just intonation"

with A = 444 Hz remains a special tuning, which is closer to the natural tones.

With the focus on the music of 528 Hz all seems to be a simple procedure. You

only have to tune your instrument from 440 Hz, into 444 Hz. Then we find within

a frequency range of 528 Hz, the C in the 2nd octave in the opinion of Horowitz.

But that's an oversimplification which undermines the exclusivity of 528 Hz in

the intonation. The misapprehension of Horowitz concerns the harmonics which

are present in the moment of tuning the instrument from 440 into 444 Hz. These

overtones make a tight, sinus-compliant tone of 528 Hz impossible. The most

pure possibility is the electronic generation of a sinus tone of 528 Hz. We are sure

of the absence of overtones.

Tuning a just intonation of an instrument that stands at 444 Hz, instead of the

tuning of the C' in the 2nd octave of A= 440 Hz has a frequency of 523.3 Hz, it

has changed into 528 Hz, with a value of 1200 cents. This correction should


347


cause an "oscilloscopic straight line", but the shared harmonic overtones prevents

it. These overtones would be in the case of a desired oscilloscopic straight line

may be mentioned a “fouling”. But "harmonic pollution" is a contradictio in terminis,

because the harmonious wholes or parts enrich the tones or timbres.

Since nature has no straight lines, but standing waves with harmonic overtones,

sine wave represents a bald or straight sound that detracts when used solo; affect

the inner aesthetic experience, evoking possibly even inverse reactions in the human

system, as we shall see in the medical and therapeutic Mindlink-system,

which, based on Tesla technology transforms audible sound waves into nonauditory

frequencies. The overtones have an additional, vital transformative function.

Inside the Mindlink praxis exist differences of opinion.

My conclusion is: we want to reach the inestimable effects of 528 Hz music. We

pursue the deepest purity, without sinking into a single sine tone that defies aesthetics.

Sine tones only have a stimulating function in the brain, in particular in

the (pre) frontal cortex, more particular in the epiphysis or pineal gland, with its

responses on light and dark effects (serotonin and melatonin synthesis). There is a

functional distinction between information-carrying energetic frequencies 284 and

the aesthetic, auditory tones 285 without essential distinction. That makes an intonation

with the firm "cents relationships" in minimal but adequate overtones, to

284 The "information-carrying energetic frequencies" associated with the Hebrew language and the numerical proportions,

the numbers that are derivatives of the Absolute one, the Aleph (a = 1), which leads to my research controlling basic

formula a = √1 abs = 1 rel Absolute as the source in which the information emanates to 1 rel via which the Hebrew linguistics

is included in the semantics of the numerical proportions, to then be transferred as a healing or re-creating information

to the cell structures for processing. Again, this is just a preliminary remark.

285 The "in-auditory tone" is a composition of pure 528 Hz by the appropriate overtones processed pleasant impulses of

the unconscious mechanism experience. Confidential feelings at the inter conscious level have the strength to the stalled

emotive development - a result of insecure attachment that sometimes is even of prenatal origin - again to form a powerful

reactivated unlocking process, with resumption of the emotional growth. Philosophically we are on the premises mentioned

by the Jewish philosopher Hannah Arendt's "natalism": the possibility of the experience and development of ever

new birth moments and opportunities arising from it. The significance of this, I will discuss in the appropriate chapter.

Like the auditory experience of aesthetic beauty of sound, is for the in-aural experience the aesthetic quality of decisive

significance. After all, we already know from Plato that beauty is one of the cores of nature and its processes, which led to

culture friendly applications and then into the culture again corrupted, so much that one can speak of a "devolution to the

bestialism" (Shoah and Nazism), as George Steiner describes in his Grammar of Creation. In short, listen to music and so

auditory experience is not essentially different from music experience at a subliminal level.


348


healing, connected to Source, music of 528 Hz as leading frequency. This can be

a double hexachord extended to a 12-pitched tone system, with own tonal values,

material to be composed. 286 A 12-tone system is represented here as the final consequence

of the 528 Hz as dominant frequency. 287 All other frequencies of the 12-

tone circle are principally sub-dominant to 528 Hz.

Atonal music evidences the illusion of the avant-garde for which we have to go

back in time, because the term avant-garde actually has disappeared, sometimes

coming back in a neo style. In general, also the modern music returned into the

tonality of harmony and counterpoint. For the differences between the refraction

of the octave and the acceptance of the unbreakable octave expanded, as theoretical

finality of the duodecimal with its own circular frequencies, as the paradox of

an atonal tonic.

Intonation on this place is a technical term that has to be considered as leading

factor to a scientific equation between the Twelve Tones Interval System with the

dominant frequency of 528 Hz and the Hebrew transparent language, in a direct

connection with the Creative Source.

Customer registration and value judgement

We have become accustomed to the "equal temperament," the tune of the piano

that is equally false, by which we usually like a round, warm tone experience. 288

This appears as a rather alienating effect on our musical ear and our aesthetic

286 Here I firmly refer to the composition "Herz" from Mathieu Polak based on my figure studies (528 Hz with a duration

of exactly 528 seconds) as "broad spectrum activation and medication" positive appears to work on many symptoms and

causal relationships, such as the reduction of side effects of regular psychoactive medication. If we convert to translate to

terms of physics, the wavelength of the center of the rainbow is 528 nanometers, the refraction of the light in water, with

the colour green, the colour of chlorophyll, the product of photosynthesis in plants essential for converting CO 2 in oxygen

O 2 and more, and therefore makes life possible for us. This gives 528 both in the context of Tora and in the context of

physics a fundamental importance for life and revival.

287 The tonic is not always the keynote of the key, but can be the most important show in the composition. That is in my

view the 528 at the base of the Hexachordum Duplex system. Herz Mathieu Polak is therefore a tonal composition, despite

the contemporary timbre and the use of digital instrumentation, such as the Chinese Ocarina, a wind instruments with little

but appropriate overtones.

288 For the technical aspects of the equal temperament, I refer to the information about the Pythagorean comma and the

relevant literature.


349


music experience. Music performed by musicians playing instruments in a tuning

scale other than equal temperament, gives unexpected reactions in our brains. 289

The various tonations of ancient medieval and renaissance music with distinct

frequencies have a deep effect on the human mind and the objectifying experience.

The beauty of music transcends the subjective aesthetics.

Here we enter the grounds of the essential therapeutic music with its possibilities

and its failure, because of its effects on the human mind as aesthetics and musicpsycho-physiological

praxis. In order to bring this broad spectrum of tuning in

word and sound into the domain of the energetical music-psychophysiological

praxis, the music-therapy and conversation-therapeutic elements must be reduced

into scalar waves and quantum possibilities as consciousness fields. The "ligand"

on the cell wall - the intelligent membrane - is a recreational and restorative instrument.

The Tesla technology connected with the Mindlink research and treatment

practice, transforms the therapeutic music into a universal energetic phenomenon,

that has an application to the aural and aesthetic transcends, includes

the field of quantum-energetic medicine. But first a brief impression of the quality

of the auditory perception of ancient music in the 21st century!

19.7 Touched by sound and music

We are aesthetically affected by music. The energy frequencies generated by the

instrument(s) come to us. Not only via our ears, nerves and brain are we touched

by the music. All the body and organs are feeling the frequency information (nature

and content of the music we received) stored in our system. Very loud music

produces high trembling frequencies and gives a pleasing, physical resonance

inside our system. The quality of music doesn’t matter: it must be loud with

289 Again I must make a mere reference to arouse interest in the issue. We have medieval mean tone, later Werkmeister I,

II and III moods and many other.


350


strong basses like heavy metal. This kind of music is absolutely unfit for our

medical and therapeutical intended purposes. What we need is harmony and

structure, Apollonian instead of Dionysian, Bach instead of New Age sounds.

Besides these randomized bodily but pleasurable moments, the aesthetical side of

music experiences is preferable as far as the medical applications are concerned.

This aesthetical experiences are influenced by historical developments e.g. the

history of tuning the instruments. The apollonian-like music of the Middle Ages

must have sounded for the people of the Middle Ages much different as our experience

with the same tuned instruments. This can’t be only a matter of instrumental

music, but also a matter of personal experience. The musical “ears” of the

people in the Middle Ages and Renaissance registrate the music in different

sound patterns as we do nowadays. We live after a crucial cultural event, whereby

we are completely overwhelmed. This event is the origin of the Well-Tempered

Clavier.

Bach’s Well-Tempered Clavier, a turning point in history

The Well-Tempered Clavier may well have had the greatest impact of any

piece of music in history, across many generations of composers.

For a long time, Bach's Well-Tempered Clavier was considered a purely

educational piece. Indeed, the two volumes are an inexhaustible source of

technical exercises requiring quick, independent finger movements. At the

same time, they are textbooks on contrapuntal techniques. In forty-eight

preludes and fugues, Bach demonstrates all the possible knowledge of

complicated counterpoint, which he mastered like no other. The Well-

Tempered Clavier assumed a central role in the debate on tuning methods

that had already been going on for a century. It was the first systematic

and exemplary use of the equal temperament, which had been introduced

in Bach's time after a long experimental phase and which made it possible

to use all the keys on a keyboard instrument.

As I wrote, our musical ears differ from the time-period of tuning systems before

the well-tempered system. Popularly spoken: well-tempered is nothing more then

regularly false. The reason is the division of the so-called Pythagorean comma,

the remnant as last piece of his monochordial tuning system. The conclusion is:


351


the piano is tuned and sounds round and soft but the cause of this intonation is

systematic falsehood.

The differences between our musical ears today and the people of the 16 th century

in Europe are undoubtedly caused by continuously undergoing the categorical

“well-tempered-falsehood” with deeply effects on the concept of beauty. This

ancient music playing in the original tuning brings our modern experience of music

into great problems of understanding and perception.

A personal experience

My experience during a concert on an old, recently restored organ, tuned

in the meantone tuning system became an affirmation of the change of our

musical ears. The organ was recently just retuned in the meantone appropriate

for this instrument. The tone of this instrument sounds rough to me.

Insiders know that we can’t play the complete organ literature on an organ

tuned in this meantone system. Only the compositions composed for this

tune, as in the Renaissance, the works of Sweelinck, should be heared as

jewels of beauty for the lovers of this early music. Just the opposite is the

fact nowadays.

I played on this organ a work of Sweelinck. The organ was pure, but the

auditory perception of the sound made me almost hurt my ears, because of

experiencing a false sound. With some "experts" we debated after an extensive

discussion on this curious, paradoxical experience.

"Why do we hear today what is clean tuned nonetheless as false?"

The results of our debate we found in the change of our "contemporary

and culturally induced (read: corrupted) musical ears experience", related

to our contemporary feelings of beauty and timbre. Our musical ear apparently

does not tolerate the old, truly pure tone systems any longer as

pure beauty. The technique was right, but it had an unexpected result.


352


19.8 Of interest for music therapeutic applications

We can draw conclusions out-of this presented experience in an open reflection

on music and its therapeutic power and influence. From our conclusion above it

became clear that it appears to be tied to a certain period and cultural aesthetics

and ditto perception. An example that calls for some thought is the use of singing

bowls - a product of oriental music practice - now frequently entering the West.

This form of music therapy cannot be of a universal meaning because there is no

clear, general or universal effect on human beings of all times and geographic

positions. The originally Christian Western European culture has obviously given

us another “hearing mechanism” in our brain. So differs western music experience

as part of music therapy in terms of applicability and effectiveness of the

clients of Oriental origin.

19.9 Energy, words and sounds, and the effects on

our cells, organs and observation structures

Returning to the triad: energy, sound and music, with their effects on cells, organ

and tissues and their structures, functions and perceptions.

All tone heights, frequencies, or energies as quantum waves penetrate through the

smallest cells of our existence, where they are picked up by receptors (proteins)

subsequently in order to be bound by another protein (a ligand) to the receptor.

After this binding, the associated frequency penetrates through the cell wall, the

diaphragm and enters the cytoplasm of the cell to a new and innovative action

potential. For example, the operation will have an affect within the cell, including

the start of building proteins that code for amino acids and proteins for the relevant

genes that are stored within the cell nucleus. The success of this process

would be the healing of the affected cells and organs over time. It can have the


353


effect of partly determined by the wave that information as "information-particle"

enters the cell.

For this procedure, music is an extremely important but complex phenomenon -

due to scalar character of the sound waves (carriers) spreading the information

(particles) without fixed direction (scalar waves) fit to the total human system in

individual organisms and cells. Sadly there also can be a backlash by antagonists

inside and outside the cell. The access road for the new energy (by agonists) is

trying to be closed by the antagonists. 290 This intracellular defence mechanism is

perhaps the main opposition force thwarts healing of cells and organs.

The strings of the violin transform energy,

convert it into sound waves that

reach our ears via the acoustics in the

concert hall.

Modern quantum physicists claim,

the waves we experience and store in

our memory can be seen as particles.

Is our brain the exclusive seat of our

emotions? Or there is more?

290 Here I mentioned the strength of the exorfines which the body opiates, endorphins, and break down the substances

block dopamine and serotonin production.


354


19.10 Human beings as cell community, the result of

"downward causation”

When we analyse creation as a methodical energetic evolutionary process we

don’t only investigate the "creation and evolution” but also the Absolute Blueprint

emerging from Ein Sof, the Unknowable Source of the knowable. Thus my

research has taken a fundamental distance from the Darwinian chance, with the

struggle for life, adaptation and survival mechanisms.

We evolved from a single-celled life into multicellular beings, not by engaging in

the fight for survival, but by way of cellular cooperation. At the moment we made

our "nature" artificial, it has been overridden by a rule-governed cultural life (nurture),

with a change of alienation inside this cultural life-pattern, longing to return

to the origin principles of nature. This cultural alienation forces an attempt of a

paradigm shift.

Incipit or Principle of beginning

There is no beginning without a principle. Therefore, in contrast with modern

scientific thinking: there is a beginning, or should we, on the basis of a timephilosophical

concept, dispense any "beginning" of everything with the axiom:

essence has always existed. All attempts to reach in human thought for some support

here, that cannot think otherwise than in time structures and lastly but then

chooses the accident, which has become a dogmatic principle. I realize that it is

too short to deal with this in a few lines, but discussing this interesting switch

would take me beyond the scope of this activity.

Ein Sof, the Unknowable Source for nature scientifically knowledge is just such

an assumption as coincidence. Here, too, the start is carried by the principle. The

difference between chance and Ein Sof is: coincidence is an artificial choice from

the human autonomy, free access to the actual language to make statements and

to generate truths from alleged sightings (exclusive thinking). Ein Sof is a natural


355


Presence based on the human disposition, in which human beings discovers

themselves the universe updating an emanated, original potentiality that comes

from an independent Source which transcends our intelligence. For now, we have

highlighted both choices. In choosing the chance human beings are a scientist

source for an artificial axiom: absent beginning with chance as principle. In the

choice of Ein Sof, the Source that transcends our intelligence subdue the man as a

scientist to these sources, and acknowledges himself - like the entire universe - as

relational part of the Source (inclusive thinking). In anticipation of the continuation

of it I have the two choices in one number: exclusive thinking has the 4 as a

totality of the empirical-scientific cosmos, while inclusive thinking has 1 as absolute

unity, which the 4 is enclosed. The ratio of 1: 4 will evidence to be the most

fundamental ratio.

19.11 Cells bind their strengths and allocate tasks

We exist as stated in a cell community of 70 billion cells, all work together for

functional reasons and have divided the tasks. It is an interesting biological process

and worth to be included in biomedical evidence-based scientific research.

Blood cells, muscle cells, nerve cells and brain cells differ from each other but

the essence, the architecture of each cell is the same, such as the storage of the

DNA in the cell nuclei, and the energy supplied by the mitochondria, the organelles

outside the cell nucleus.

As a counter-movement of the conventional genetic determinism develops in our

time a new, energetic biology, based on the energetic recording, emissions and

capabilities of each individual cell. It appears that the cell by a variety of energy

can be influenced (cell-experience), which is also the experience and events in the

cell-storing memory that is within the enclosure of the cell, the membrane (the


356


brain of the cell). 291 In the laboratory it has been made visible by the cell biologist

Dr. Bruce Lipton 292 and the now deceased former candidate for the Nobel Prize

dr. Candace Pert for her discoveries in the field of endorphins and the emotions

like molecules. 293

19.12 Pathogenesis and physiological stress

Energy penetrating the cell wall (membrane) is stored in order to do its job, making

new peptides. This also applies for the negative, hormonally-fed energy, such

as stress as the result of the switched-HPA-axis. 294 Thus, for example, this process

is creating constantly cortisol and other types of adrenergic hormones, which

can result in an overload of the adrenal glands. If the human system is long

enough in state of stress (negative energy) individual cells, tissues and organs are

affected in such a way that all kinds of functions are touched in the cooperation

between the cells, as the functioning of the brain, the immune system, hormonal

system, central nervous system, sympathetic and parasympathetic system etc.

This creates all sorts of psycho-energetic and physical failures, psychological and

mental disturbances too. This "physical stress" has negative energy as source,

influencing the human behaviour. Psychological and psychiatric treatment being

focussed on clinical behavioural modifications and changements must be held for

insufficient.

291 Despite the short life span of individual cells by the division the "cell memory" fully transferred, making all kinds of

important processes keep going.

292 Lipton, Dr. Bruce "Biology of Belief. Unleashing the Power of Consciousness, Matter and Miracles, in edition in

private, 2005

293 Pert, Dr. Candace, Molecules of Emotion, Berne Convention 2007

294 HPA-axis is controlled by an insecure attachment and engaged systematically linking "hypothalamic-pituitary-adrenal

glands" that ensure a constant production and release of cortisol, among others. This "switch" is to be transposed and that

can only happen if the insecure attachment is replaced with the necessary security, allowing the development to a basic

trust can be restarted and there is an opening process of the emotive life. See below in the appropriate chapter.


357


Physical stress differs principally stress as effect of a heavy burden on us as employers,

determined by a specific reason. That will passes in time after a period of

rest.

A treatment with energetic counter-information does exist in the shape of positive

energy - transformed music, nature sounds and affirmations - which enters the

cell by interfering with the unconscious, breaking through the cell wall, and turn

the negative antagonists in a collapse of its power and neutralizes the effects of

stress making the inner landscape ready for reconstruction of all kinds of on human

activity based developments. Eventually they will transform the potential of

the cell to positive energy and in such cases humans will provide new opportunities

for an enjoyable life.

Conclusion

Purposely I am staying longer in this introduction to support the necessary common

understanding and knowledge of the applications and opportunities for understanding

and the scientific substantiation of the restorative functions of the 528

Hz music, based on the Twelve-tone music system, through the Hebrew linguistics

and numerological logo technique.

I am sure it was necessary for the research to show the importance of the Hebrew

language and the writings of the philosophical and scientific knowledge of nature

and nurture, underling and perhaps deepening the meanings of the Hebrew language

and its numerical structures, a suggested alternative of the hegemony of

Latin within the medical world as a joke. The Hebrew language exposes by its

numerical values our science and culture in a way hidden from other languages,

even for mathematics and quantum physics. The attention request for a place of

the Hebrew language in the scientific discourse, combined with mathematics, I

am leaving again the paved road, to build a bridge from the Hebrew linguistics

and numerological logo technique between conventional and non-conventional

medical-philosophic research .


358


With this hopeful conclusion, I return to a brief examination of the YouTube

range of 528 Hz music as "music that refers to G´d."

During some weeks I tested "music on YouTube that refers to G’d” and I made

many important discoveries. The question is: is there an indication that the music

of 528 Hz on YouTube is dedicated to G’d or is it derived from the poem interspersed

with a religious sauce, sampled of information from the Bible? I will

mention the most relevant findings.

I found a report of a christian scientist using the Jewish menorah as a model 295

operating as an explanation for his music of 528 Hz. He got stuck in his Christian

dogmatic presuppositions, partly because of the King James translation of the

Hebrew texts. Translation is indeed betrayed and never leads to the real insights

intended by the original writers, with their profound knowledge and sources of

inspiration. This man belongs to the spectrum of supporters of the religious experiences

of Dr. Pule, referencing to the Book of Numbers in King James Translation

(KJV). Since I am Jewish, it might be understandable that I have a very suspicious

look for statements referring directly to information "beyond the human

horizon." The stories touched me and I decided to make this information a part of

my dissertation research because of my search for a versatile music therapy and

medical-philosophical base for an integrative medicine.

It was clear to me from the beginning of my numerologic logotechnical analysis

of the Hebrew text: "The music of 528 Hz on YouTube and the Solfeggio-poem

have no connection with the original Hebrew text, and do not guide to the ancient

sources, i.e. the music of Ancient Israel."

A poem can be beautiful and sometimes do have far reaching implications like:

1. For the church to which the poem is dedicated, and

295 The seven-armed candelabra in the ancient Temple or the Menorah, the nine-branched used during Hanukkah Festival

of Lights.


359


2. for the musicological developments from the "ut-re-mi-fa-so-la", the first syllables

of the Latin poem as I will show completely afterwards. It cannot rely on a

revelation and a seemingly connective force, with the claim to be able to restore

DNA defects and to cure cancer, without any kind of scientific research and evidence,

like the infamous statement: "the experience says it works." For serious

scientific research it works since the underlying theory will be tested positive

based on a double blind randomised research and tests.

Personal change

Besides the medical and philosophical basis, I started my research for a scientific

research of validation together with a field research, exactly in line with the current

standards in the scientific domain. The initial choice didn’t belong to the

conventional medical circuit, but to complementary, because of the confrontation

with the complementary Tesla's technology and transformation of information

into scalar fields, exchanging information with the internal consciousness of the

patient. This energy-technology works in order to get a diagnostic and treatment

method concerning the Mindlink-system. This system is my fundamental and

carrying field of research, of which I report in the next part by casuistry and statistics.

One of the greatest factors is the application of Foetal Programming and

Maternal Foetal Distortion Syndrome (MFD-s).

This underlines my opening remarks as justification for the relationship between

medical and philosophical research, involving the scientific value of the numerical

structures and architecture of the Hebrew Tanakh.

19.13 Philosophical core question

"Can the pitched six-tones music system contribute to a better world and a healthier

humanity? The Prolegomena have given enough basic information to be able

to proceed directly to the analysis and study of the linguistic-numerological semi-


360


otics and hermeneutics of the Hebrew Tanakh and other Hebrew sources, which,

as extensively reported in the Prolegomena. The Traditional Jewish Medicine

(TJM) is connected with the Traditional Chinese Medicine (TCM) or Traditional

Orient Medicine (TOM) and Ayurvedic Indian variants of the TOM, as we have

described detailed in the Prolegomena.

19.14 A language with no sign is in this universe 296

Linguistic-numerological semiotics 297 and hermeneutics of the Hebrew Tanakh

flanked by a few articles of Jewish scholars expressing a lot, supported by the

software on my computer for experimental research of Hebrew, I started searching

through the thousands of possibilities of Hebrew, which would lead us to new

philosophical convictions. 298

Here we leave for a while our concentration on the music of 528 Hz. We do

switch unto the semiological study of Hebrew words and concepts. The rational

character of the numbers in the Hebrew context reveals the differences with the

number theory of Pythagoras, to whom the number was divine. The Hebrew

Tanakh excludes this conclusion.

From the hermeneutics of the Hebrew language we do lead a connection with

other numbers and dimensions, particularly in relation to the four-letter Name of

G’d, the Tetragrammaton - YHWH - expressed by the numbers 26 and 17. The

296 Chapter title taken from a poem by the Dutch poet Gerrit Achterberg

297 Semiotics or semiotics here we consider a number stabbing which represents a reference value, as does each sign

language. We distinguish between intentional semiotics and semantics. The latter focuses on the senses. We have the

semantic nature de facto included in the technique of numerological logo technique. Therefore, here semiology the break

set of numerals and the proportional values per letter. The semi logical analysis resulting from this formula finds a universal

value, affording the windows of nature and nurture factors.

298 The private software is made by drs. Klaas Eikelenboom, Utrecht the Netherlands


361


presence of these numbers is very significant within the architecture of Tanakh as

we have seen in the Prolegomena.

The music in this medical concept has an energetic function to restore the disturbed

homeostasis, the fundamental effect to all diseases.

The map is not equal to the city. The map is only a reference, a mark limited only

for achieving the reality. Without a map we get lost quickly. Similarly, the Hebrew

numerals aren’t reality itself. It is the map as a skill bringing us to the reality

or to bring us back after losing our way (see the definition of re-ligare in the Prolegomena).

Now you know every navigator, map reading is an accurate activity.

One wrong character and you're off course, so you will never reach its destination

unless a hard manoeuvre makes the corrections.

To analyse the number of characters it is necessary to release the linguistic narratives

and storytelling history or vice versa history telling story and a "narrative"

to treat as a "complex of characters we need to count". In Hebrew counting and

writing are of the same radix. Telling stories and history asks beforehand an accurate

count of verses, words and letters, making the deep structures visible, along

with their deep connections.

That's why this logo technical analysis is required for the study of 528 Hz music.

Anyway, if the reader is without insight in the world of the Hebrew numbers it is

hardly possibly to understand the Presence and Power of the Source concerning

our medical and therapeutic systems using for healing. Therefore we will explain

the effectiveness of the frequencies, discussed on its merits to assess, seeing the

unifying factor for fraternisation between the medical and therapeutic worlds of

East (complementary) and West (conventional).

We used the name of the Source several times: Hebrew Ein Sof with the word sof

in the meaning of "secret", but not in the mystical sense, but in the structural

sense of "cognition that transcends us". The logotechnical analysis has an occa-


362


sionally overlap with the Kabbalah, but as scientific research system it is not

linked hitherto. This has been addressed sufficient in the previous section.

By way of repetition

"The Source of Life is on the other side of our intelligence and not inside our

DNA!" The "evolutionary downward causation" has only one fundamental character,

that is the a (aleph), the character for the number 1 (See the Prolegomena).

The peculiarity of this sign, the a, does clarify why the Hebrew Bible is beginning

with 2 (b = beith) 299. We understand from this fact that our nature and culture

are dualistic in nature. Everything is made up from the beginning in binary

oppositions: light and dark, day-night, white and black, far-close, man-woman,

infinite and finite, timelessness and time.

Hebrew, a language we read from right to left

b

When we want go back from the end of the

text to the beginning, we finally arrive at the

first character in the Bible b in Hebrew letter

with this form b = beith.

When we increase the Hebrew letter we see

something special.

299 Summary of the Prolegomena. B'reshiet, as always badly translated as "in the beginning". "The beginning of everything"

takes place "before the start of everything," the "beginning of time takes place before the time." Being the beginning

of Being of all creaturely, is set before the Being. It follows that the second the updates transforms the potentiality of 1.

This has the significant effect that we cannot reduce the second from the 1, and the Absolute Unity cannot arise from

bipolar dispositions as well. As we further develop we will see already here a "reflective metaphorical reality," the ratio of

1: 2. Trias Creationis - Word - water - Light beings as forming the first effects of the Potestativus Absolutis, the emanating

energy from Ein Sof, the Source, as [a abs - 1 abs è a rel - 1 rel. ] the formula that will later be extended with a differential that

will develop the potential for a quantum physical manner.


363


The blue arrow indicates back to the beginning. The arrow illustrates the direction

of the movement we made from the start. This "direction to the beginning" is the

equivalent of the "upward causation", with the materialistic Darwinism as a driving

factor for reductionism leading to a microscopic quantum physics and a macroscopic

cosmological and astrophysical sciences.

Returning to the letters and regarding their design, the shapes in Hebrew semiotics

have their own meaning. The arrow strikes the "wall". We can’t go forward on

our way. Obviously we are caught in the dichotomy of life. Yet we understand

the problems in our language about the term "unity". The semantics of our concept

of "unity" is defined by the sum of the individual parts. In other words, our

concept of "unity" is the sublimation of all diversity, plurality. That means we

never complete the unity concept but a "unity in diversity", submitted to the unity

as absolute principle.

This illustrated “return” is an analogy of “scientific reduction” with the same final

stop on “the border of Infinity”, linguistically compatible with the b (Beith)

as the last step, without being really the last step. A science refusing to accept its

self-restraint explore the boundaries as a blind looking for an opening in the wall

of the empirical, methodological capabilities. This doesn’t make sense until we

come to recognize our general human, scientific and epistemological limitations.

Positively: “Behind the wall lays the √1 = 1 as the Infinite shelter.”

This is the inevitable axiom touching our complete universal existence, which is

in matter and life chained at the Absolute Source, a (Aleph), which - I cannot

emphasize enough - is beyond our analytical skills and conceptual thinking, expressing

our human limitations in the understanding of the "Absolute-Relative

Downward Causality”, with anthropic and emergent potentiality as emanating

energy in divergent evolutionary processes.

Our reality as manifestation of Being of all creaturely beings can be recognised as

“Actualitas Energetica” divided in Sound, Water and Light: Trias Creationis.


364


I repeated the Prolegomena and the other places in this study because of

the profound importance of this knowledge and awareness.

It seems justified to translate the Torah into the Triassic derived Creations

to the scientific concepts:

Sound = Creational Acoustical Superstring Actuation

(CASA, contraction of me)

Hydrogen = Hydrogenium (H) and

Light = Photon (P)

The ultimate Relativity (Sound, Water and Light) or (CASA, H and P) we have

introduced the from Ein Sof derived formula: a rel or 1 rel . We can now recognize

absolute and relative unity as a, the language and character for the number 1 in

absolute and relative terms.

We will write in the future, as part of one absolute and one relative as formula

[a abs - 1 abs → a rel - 1 rel .] 300 The square root of 1 remains unbreakable, regardless

of the absolute or relative essence.

Conclusion

Because of the One Source, Ein Sof, we only know one matter of energy:

Energetica Potentialis per essentiam 301 . The physiological (matter) or biological

energy (life) of the macro Universe - including the Micro Universe of the waveparticle

duality of the quantum field, the quantum vacuum as filled emptiness,

and the collapsed wave-particles, is relative energy by participation in the Energetica

Potentialis per essentiam. This researchable energy of science is called:

300 The arrow in the formula is to work out for the other osmosis, causing the relativity of 1 is formed. Here already I set

my belief: Good Bye, Big Bang!

301 “Per Essentiam” is translated, independently of any other source present in itself. In the language of Spinoza we can

essentiam replaced by Causa Sui, from an independent source that exists in Himself.


365


Energetica Potentialis per Participationem, 302 arose from the Energetical Essence

of the Absolute. The music of 528 Hz is an activated (or articulated) part of the

Energetica Potentialis per Participationem.

19.15 Physics and 528

Light and water are following the sound core concepts of physics. Sound is especially

an issue in the superstring theory in which acoustic waves are connected

and the number 10 is striking. The sound as a phenomenon should rest for a moment.

Light and water are important. Light itself is invisible. Photons are only visible in

reflection and the refraction in a prism or in water.

The simplest application for us is the rainbow. This refraction of the light in water

forms an electromagnetic spectrum of light of which a huge part we cannot see

(gamma rays with ultra-short waves, and on the other side of the spectrum, the

ultra-long radio waves). In between - in the centre of the electromagnetic spectrum

- there is visible light: the seven colours of the rainbow.

The following special feature is the colour in the centre of the rainbow: green.

Light and colour both consist of vibrations and waves. Waves have a length that

is measured by the distance between two wave crests. The wavelength of the light

colour is expressed in nanometers (nm). The wavelength of green is 530 nm. To

understand the smallness: 1 mm = 1 000 000 nm. We accept the compatibility of

528 Hz (music) and 528 nm (colour) under the conditions thus that actually a

mathematical correction is mandatory.

302 “Per Participationem” is translated, through participation in something; in our case inseparable attachment to the

absolute power of Ein Sof.


366


Colour: Red Orange Yellow Green Bleu Indigo Violet

R O G G B I V

Wavelength

(nm):

690 610 580 530 470 430 400

Green is the nucleus of energy in the universe. Life consists of water and light.

Light can be described as a photon, an elementary particle. In Chapter 14 we

treated the Periodic Table of the Elements with hydrogen H as the first atom.

We saw nitrogen N as 2nd element. Of only hydrogen and nitrogen live can’t

occur, because it would suffocate immediately. We questioned the next element

oxygen O. When all should exist of oxygen, everything burned. Life therefore

can’t be possible. Ergo the first element Hydrogen H is searching for a connection

to another for life essential element, and that is Oxygen. However, this is not

readily available.

This brings us to an evolutionary core development: chlorophyll, the green colour

of the plants, result of photosynthesis. This process of photosynthesis also produces

oxygen; all the oxygen we breathe and on which all animal life relies

comes from the photosynthesis activity of plants and trees.

The mixture of hydrogen with oxygen results in the production of energy with the

only by-product being water. This “by-product” H 2 O is the third main element of

creation.

After the creating Sound, number 1 in the evolution, Light and Water are the next

presuppositions of life with green as the colour of the ultimate creative process.

So chlorophyll is a very important substance in our nutrition and healing pattern.

We conclude number 528 can be called Wave-length of Life and has become visible

and audible. So number 528 (Hz + Nm) is the center of the existence. We

have to draw attention to the fact of the basic tuning of 528 Hz. The conclusion

about Hz and Nm is only sustainable in a tuning system of A = 444 instead of the

general tune A = 440. Being the Wave-length of Life requires a fundamental


367


correction in the musical domain. See the Table of comparition:

Note Hertz

Equivalent

Wavelength

Angstroms/10

Nanometer’s

Approximate Color

A 440 619.69 Orange-Yellow

A# 457.75 595.66 Yellow-Orange

Bb 472.27 577.34 Yellow

B 491.32 554.95 Yellow-Green

Cb 506.91 537.89 Green-Yellow

B# 511.13 533.44 Green

C 527.35 517.03 Green

C# 548.62 496.99 Green-Blue

Db 566.03 481.70 Blue-Green

D 588.86 463.03 Blue

D# 612.61 445.08 Blue-Violet

Eb 632.05 431.39 Violet-Blue

E 657.54 414.67 Violet

Fb 678.41 401.91 Ultra Violet

E# 684.06 398.59 Invisible Violet

F 705.77 772.66 Invisible Red

F# 734.23 742.71 Infra-Red

Gb 757.53 719.86 Red

G 788.08 691.96 Red-Orange

The abstract concepts of harmony, love, communication, etc. are converted by the

528 Hz waves in concrete and positive energy. By this positive energy deep heal-


368


ing can occur, even after years of physiological stress which affected the cells and

the personality structure e.g. because of insecure attachment in the prenatal stage

by foetal programming. In such cases the embryo starts with a variety of pathological

conditions and mental distortions as fundamental uncertainty and disturbance

of concentration. In my clinical practice, I see the positive effects of

this music with people who have spent their lives for years struggling with the

question of what was going on with them anyway.

19.16 Mathematics and 528

One of the standard numbers in mathematics is π (Pi). This number is necessary

in order to calculate the circumference of the circle. Meanwhile, in modern mathematics

π has a different meaning, so we get a difference between the ancient and

modern π. First something about the circle. In my research, the circle has the

meaning of "infinite limits". The general meaning of the circle was the symbol of

infinity. I will now explain why the word "limiting" has been added. But first I

need to explain the details surrounding the ancient π.

The circumference of the circle is 22/7 = 3,142857 (the modern calculation comes

with π = 3,14159… with an infinitely variable range of numbers). The ancient

result of this division is also an infinite series with 6 repetitive decimals:

22/7 = 3, 142857 142857 142857 142857 142857 to infinity.

The first number opens a fourth segment of the circle. Do we want calculate a

semicircle we must double the initial number from three to six?

Now something happens quite remarkable. The six decimal comma maintain itself

in a fixed system, only the first number 14 now moves up to the last place,

the combination 6, 285714 arises.

We see the following rows:

3, 142857 142857 142857 142857 142857 till infinity


369


6, 285714 285714 285714 285714 285714 till infinity.

We want to cover the double circle then we have to double again from 6 to 12.

Although it represents a similar range, but there is another shift. Now the 28

slides to the last place whereby the range 12 571 428 arises. We put the previous

two above and it emerges the following table.

π = 22/7 = 3, 14 ... and further

3, 142857 142857 142857 142857 142857 till infinity

6, 285714 285714 285714 285714 285714 till infinity

12, 571428 571428 571428 571428 571428 till infinity

The circle is a phenomenon that everything confines within the Infinite.

The first conclusion is: we cannot double the 12, because we should cross the

border of the circle. This makes 12 the number of the infinite limit.

Before a guiding conclusion we will go to the Hebrew language and research the

Name of G’d El Shaddai (yds) as a very important indicator unifying the forces

of order and chaos, setting boundaries. The root is shad with the original meaning

of mother's breast. In El Shaddai does not only exist a question of restriction, but

also of nutrition.

When we determine the numerical value of yds we get the following outcome:

300 - 4 - 10 = 300 + 4 + 10 = 314 the number that is related to π in Greek mathematics.

In the single digit system, we get the outcome 3 + 1 + 4 = 8. This is in

Hebrew the number of “closing”.


370


With introducing Shaddai (yds) we are able to explain the meaning of the circle

as a symbol of "infinite limits" with the 12 as the final limitation of the circle.

After finding the digit 12 as representative of the full circle and belonging to the

content of Shaddai yds we indicate 528 as a new dimension.

We divide 528 by 2 and get as a result: 528/2 = 264. Then we calculate 264 by

the Pythagorean single digit system and we see 2 + 6 + 4 = 12. This provides for

the significance of 2 x 264 of the full circumference of one circle, in other words:

528 indicates two circles. Without being able to elaborate on this place, I conclude,

in anticipation of what we have found concerning the Source of Light and

Life, the first circle (12) as the Source-circle and the second circle (12) as Realisation

Circle (nature + nurture). Within the latter circle does existential life and

culture actually exist inside the boundary of the circle, making clear infinity (circle

1) essential differs from the fundamental finite (circle 2).

Conclusion from mathematics

The position of 528 in the reality of essence and existence finds its expression in

the squaring of the circle 303 , teaches us that the frequency of 528 is a universal

phenomenon within the Realization Circle. The music based on 528 Hz in conjunction

with the 528 nm as light (green), has a loving, communicative and harmonizing

effect on all life within the created reality, the Realization Circle. The

energy of yds (the Source-circle) bonds (ligands) the entire created reality as

well as all human individuals, living within the Realisation Circle, with the

Source of Energy from which emanates the effective energy of all frequencies,

manifest in the existence of the Realization Circle.

303 See Chapter 14 Vetruvius and Fibonacci.


371


To start using this energy is extremely fertile for medical and therapeutic purposes

and transcending all that seems to be contrary to science.

19.17 528 and the Source of Light and Life

“With you is the Source of Life, by your light we see light.” 304

rwa-hark Krwab Myyx rwqm Kme-yk

When we start at the beginning of the Hebrew Bible we meet a gap, missing the

concept of the Source. We ought to look for the Aleph, the first number with the

value 1, the Source existing before everything, the symbol of Ein Sof, the Infinite

No-thing.

After all, the Torah begins with 2 and puts us immediately in the proximity of

yds all restrictions included.

b

a Pwo Nya

We virtually break through the last wall on the way back, the final "wall" of the b

discovering Pwo Nya = Ein Sof with number value 207, similar at the number of

Light. Now we are able to see that the structure of the two circles and their affiliation

enlighten itself as compatible with the origin of the Source of Life and the

Source of Light: Pwo Nya - Ein Sof (207)

304 Ps. 36, 10


372


Ein Sof is manifested in line of a poem sentence like Myyx rwqm – Fountain of

(Source) Life. 305 We calculate the numerical value of Fountain of Life with 414 as

outcome. In this poetic sentence we read the word Light twice: your Light and

our Light. We translate Circle 1 into the “Circle of Your Light”, equated with the

Light emerging out-of the Source-circle and “our light” as the Light inside the

Realization Circle and found a fundamental solution: 2 * 207.

We write rwa - or - light with the numerical value 207. That means light exists

twice in the same sentence: 2 x 207 = 414. This underlines light as life-energy.

It is evident that Ein Sof with the numerical value of 207 must be an equation of

Light itself and the Source of Light = Life.

When we reduce 207 to a single digit the outcome is 2 + 0 + 7 = 9. Nine is in

Greek, as in Hebrew, the number of connection. In the language of my research it

means the representative of "the process of connection." The 9 connects the 10 in

the order of the numbers after 9 stands 10, in single digit 10 = 1 + 0 = 1. This

adjoins the 9 to the 1 of Absolute Infinity (see Prolegomena Fibonacci).

When we finally get back to the two circles and we factorize nine in 3 2 than we

have three for each circle. When we began this review we are left with sound,

light and water as the base for creation. We end this preview also with the conclusion

that these three are present in the Source-perfect circle, but only as a potentiality.

The Realization circle in these three as well, but as energy that activates

the potentiality for creative energy (nature and nurture) in which 528 Hz is a leading

disposition in tone and colour.

305 Ps. 36,10


373


528 as an energetic prefix

We're going to do some linguistic-numerological research with the number 528 -

as an essential key number in the Torah and Tanakh.

Structure of the description by questioning the text

1. Is the number 528 present in Tanakh?

2. What are the various meanings?

3. Does the number relate to the Source of Torah, Israel and the world community?

4. Does it have a number association with the recovery of brokenness of a human

individual and creation by the relationship with the Source of Energy?

5. Do we find the Solfeggio tone system in the Torah so that all doubts about the

ancient music during the political and cultural expansion under the kings David

and Solomon can probably be solved?

6. Can we develop concrete activities with Jewish musicologists and musicians

that are medically and therapeutically relevant? Compositions witness to us and

take us further on the path of the reconstruction of music communication in relation

to the history of the ancient Israel?

With linguistic engineering logo-numerical values of individual characters, the

characters also have a place value, a value calculated concerning the place in the

hebrew alphabet. Example: the letter Khaf - k has a numerical value of 20, but the

letter is on the 11th place in the alphabet. So this letter has the major value of 20

and the place value of 11.

We combine as a second example, the letters of the Hebrew Name of G’d

YHWH. The survey number tells us the major-values, which we count now:

Y – H – W – H = 10 + 5 + 6 + 5 = 26. This will be in the culture of the mathematical

universe a very important number.


374


There is also a smaller and older version: A - H - W - H = 1 + 5 + 6 + 5 = 17.

This is the small Hebrew Name of G’d. 306

In the Tanakh there are exactly 51 unique different words with major value 528.

Here we find the first comprehensive linkage between 528 and the Hebrew

Tanakh. We can factorise 51 in 3 x 17. This means that 51 times 528 expresses an

intrinsic link with the shortened Name of G’d 17 (3 x 17 = 51). How special these

51 terms are, we can perceive from the following table reading the words in context.

I restricted for three relevant concepts sufficient for the purpose of my research.

Summate all the individual letters of each word in the table and you will

get 528 as a result for the major value. The number 51 we also find as the last

step of the Schumann Resonances ergo with a connection to 528.

19.18 Meaning of the Jewish community for the

world society

The words in Deuteronomy 4 (see list below) are very important to illustrate the

stature of being servant as Jews for the entire world society. It is our map to the

universal world, providing our mission as shown twice in Deuteronomy 4.6. The

nations recognize and acknowledge us as bearers of exceptional knowledge and

understanding, even if today it seems not political ideal in the Middle East. But

let's be honest: how about science without Einstein? What does it say about the

highest rate of Jewish Nobel Prize laureates in the scientific world (169)? What

about "brain-power" as the main sophisticated, technologically export product of

Israel, the Silicon Valley of the Middle East? Should the influences of Jewish

knowledge exclude from the medical community? Clinical communication and

306 The abbreviated form "as it were (hwha) is also an old grammatical form of YHWH. Also, the number 17 will be

fundamental to understanding the origin and destiny of creation and culture.


375


music therapy don’t they present effectually their vision in this medical field all

over the globe, however based on a Hebrew linguistics-based medical philosophy?

Can it be a bridge between conventional and complementary medical praxis?

From my Jewish presuppositions these are rhetorical questions, as any connoisseur

of Jewish interest in history will attest. We continue the philosophicanalytical

way, without falling into the trap of a theological discourse, regardless

using the Hebrew linguistics and documents.

20.19 528, a logotechnical pillar in Tanakh architecture?

The core text in the search for the importance and presents of the number 528 as

3 x 17 = 51 is Isaiah 22, 22 with the term "key" as the core, forward pointing to

the future. A key has given to the house of David.


376


Three bold row’s and verses from 51 texts are sufficient for my purpose.

These three verses I will translate and give the concerning medical philosophical

purposes appropriate statement. It concerns Deuteronomy 4, 6 (2x), and Isa 22,

22.

528 = sum of all the single characters of 51 unique

words in entire Tanakh

1 xtpm 528 Gen 18:2

2 Ktxq 528 Gen 30:15

3 wrsbk 528 Exo 4:7

4 Mtxnl 528 Exo 13:21

5 wrksb 528 Exo 22:15

6 Uxlt 528 Exo 23:9

7 Mkytnbw 528 Exo 32:2

8 wtymeb 528 Lev 6:2

9 tnweb 528 Lev 26:39

10 twbul 528 Num 5:22

11 tqxk 528 Num 9:14

12 xlut 528 Num 14:41

13 tegnh 528 Num 19:22

14 syrxy 528 Num 30:14

15 Mtobkw 528 Num 31:24

16 Mtlxn 528 Num 34:14

17 tlxnm 528 Num 35:2

18

528 Israel Chokma

Mktmkx

Deu 4:6

(wisdom)

19 Mktnybw 528 Israel Bina (insight) Deu 4:6


377


20 tpjjl 528 Deu 6:8

21 rksbw 528 Deu 14:26

22 wnytnyb 528 Jos 22:34

23 xtpyl 528 Jdg 11:6

24 hnlet 528 1Sa 8:13

25 Mkytwnb 528 2Sa 5:1

26 Krsbw 528 2Sa 23:8

27 ynmkxt 528 Isa 20:2

28 Mxtp 528 Key position Isa 22:22

29 Mytebw 528 Isa 50:1

30 ytmxlm 528 Isa 58:8

31 swkrb 528 Isa 66:10

32 twlub 528 Eze 3:25

33 xonty 528 Eze 23:3

34 txnml 528 Hos 14:8

35 Pylxt 528 Joel 1:7

36 wmytbe 528 Micha 3:3

37 srxk 528 Psa 2:3

38 whwrsay 528 Psa 22:15

39 tulx 528 Psa 72:17

40 ynxynt 528 Psa 116:8

41 Kxqt 528 Psa 119:121

42 hwrsayw 528 Pro 6:25

43 Ulxt 528 Pro 31:28

44 Mkyespbw 528 Iob 29:20

45 rxsk 528 Rut 1:13

46 Mylbatmh 528 Ezra 1:6

47 Mytwbe 528 Ezra 2:52


378


48 hnynztw 528 Ezra 6:11

49 swrbk 528 Ezra 9:4

50 hygyrs 528 2Ch 15:5

51 rsbkw 528 2Ch 35:21

51 times 528, logo-technically related

with 51 Hz of Schumann

528 a logotechnical word value.

528 characters’ in the Divine Speech

about creation of man (Gen.1, 28).

528 the sum of all single figures from 1 – 32.

I will first give the translations of the words and than we take a look at the Hebrew

form by counting the major letter values of the Hebrew alphabet and see the

presence and significance of 528.

The first number is the place in the table.

Deuteronomy 4,6:

"Watching you over there and finish you like them, because it will lead you as

wise and prudent to be considered in the eyes of the nation’s when they hear all

these laws will say, truly this great nation is a wise and understanding people".

18 Mktmkx Chokma (wisdom) Deut. 4:6

19 Mktnybw Bina (insight) Deut. 4:6


379


18 Mktmkx

chet + kaf + mem + tav + kaf + mem = 8 + 20 + 40 + 400 + 20 + 40 = 528

19 Mktnybw

wav + beth + jod + nun + tav + kaf + mem = 6 + 2 + 10 + 50 + 400 + 20 + 40 =

528 307

Description 1

Wisdom and insight are clearly perceptible characteristics of the people of Israel

(Am Yisrael) in the eyes of the nations. Observance of Torah places the Jews of

respect for the members of the world community. How different is today and how

does this text appeal to our Jewish conscience and sense of responsibility as a

Jewish community?

According to the Hebrew texts, the Creator created everything from chokma (in

wisdom) and Bina (and understanding) inextricably linked to this creative activity.

Love and harmony are thus a direct result if Jewish life takes place c.f. Torah: A

Life of Wisdom and Insight (2 x 528)?

528 Hz as "music that refers to G’d" and in the service of the heart and love, so it

appears at first consideration associated with Torah. In addition, the Hebrew and

Jewish tradition that are attached to it by unleashing an energetic process that

springs directly from the source and leads back to the Source.

For further details on the latter, we look at the relevance of the concept "key",

which we can unlock the secret and shut it down.

The dialectic between Israel in its observance of Torah and the number 528 is

clear.

307 by copulum "wav = and" the two concepts are connected to a unit so that the result value is: 2 x 528.


380


Conclusion

There are two substantive connections between the number 528 and Tanakh: 1.

with the Source (3 x 17), and 2. with Israel as a nation (2 x 528).

28 Mxtp 528 Key position Isa 22:22

The Key and the Process: Jesaja 22, 22

“I will give him the key of the house of David; when he opens, no one can shut,

when he shuts no one can open.”

28 Mxtp

mem + pe + tav + chet = 40 + 80 + 400 + 8 = 528

Description 2

"The house of David" has a tradition like the Jewish multiple meaning. One minute

we have to do with history and the other moment the future is at stake.

Summed up, we could say: the expression is a promise and a force for the purpose

of reckoning with the past and the development of the new global society.

This statement we can interpret as "processes at the macro level" "close" to the

phenomenology of change and "open".

What is in "the house of David as historical and futurological collectively" play

that cannot be detached from David as the founder of his "home", as is intended.

As mentioned earlier we saw him as a boy playing on the harp. He closes by playing

the neurotic-narcissistic rage of King Saul with opening of a new situation of

peace. Only David was apparently able to do so.

These individual explanation, we might describe as "process at the micro level."

Instrumentally, the process at the micro level is a direct connection to the Source.

The power does not come from the process itself, but from the information ema-


381


nating from the music of the regenerative sources. David and his instrument are

the vehicles of the soothing activity of that moment.

Here we see how the key already is present early in David's life, even before the

kingdom van Saul is handed over to David and how his music is the vehicle of

the 528, the number of the connection with the Source.

We give the semantic element Key with the numeric value 528 a universal expansion,

because the process is fed at the micro level through 528 Hz in the Source

from which the creative energy emanates, which commits itself to the cell structures

of the respective system, supported by the energy of 528 nm with the colour

green. In other words, the music based on 528 Hz concludes the process of negative

influence and unlocks the process that has stagnated in momentum, causing

mental or physical defects that have occurred.

In non-therapeutic, but in aesthetic terms, we can complete it as follow:

Description 3

It is no coincidence that in the text - Isaiah 22, 22 - the number 528 and 2 x the

number 22 in a single text are brought together by the biblewriters and by the

Masoretes united in one text link. 308

A single brief summary of relevant numbers that have a direct or indirect link

with 528 and Tanakh as orientation. Dissolution of 528 gives 22 x 24. The number

22 refers to the 22 letters of the Hebrew alphabet, about which more below.

308 The chapter division of the Hebrew Bible is not free from arbitrariness but the fresh delineation is given accurately in

Hebrew, so that the Masoretes notes are very reliable and in the text itself indicated manner, the entire Hebrew Bible lyrics

are provided.


382


The number 24 we dissolve in 2 x 12 = 2 (2 x 6). These numbers are important

for the investigation of Hexachordum in the book of Numbers (see the discussion

of the circle).

The number 2 is the value of the beith, the letter opening of Tora. The text opens

with the incipit in the deep meaning of the Hebrew b'reshit refers to "bara shit,"

G’d created the sixth (shit). 309

The number 12 dissolved in (2 x 6) which represents the twelve tribes of Israel as

socio-political and religious people.

The number 32 is the number of the heart (bl) with the numerical value 30 + 2 =

32. The number 32 has 528 as a triangular number that is to say that a triangle

number is the sum of all numbers of 1 to n. In our case this is the sum of all the

numbers from 1-32 = 528. “From our hearts, is the origin of life”, says the proverb

poet.

Heart and life - in other words - 32, 414, 207 and 528 have a fundamental relationship

in and with the Torah. In other words, where 528 Hz is transformed as

scalar waves, subliminal sounds, it carries the overall creative and re-creative

content Tanakh as information (particles) with it. Information emanating from the

Evolution of Source and Creation at micro and macro levels. This energy transcends

all knowable processes and sets to me the psycho-energetic name "broadspectrum"

– quantum field.

The final analysis shows the connection between 528 and our hearts. That means

my YouTube investigation have in any case made clear that the music on the basis

of 528 Hz is not only "music that refers to a general spiritual energy", but that

it is music that refers and is effective for those with connect to the source of it, as

the religious experience of Puleo edited and provided imitation, albeit with reservations.

309 Conform the Zohar.


383


Clinical hermeneutics, music communication and healing processes

Because music and communication come together, especially if we pay attention

to the warning function which we know from the biological evolution debate

about the genetic nature of sound and language, like in ancient cultural and religious

Israel (shophar, trumpets), we need to look at the origin of communication.

We therefore create an intermediate step that is needed to perform communications

as in understanding and to let out as being entwined in the therapeutic values

that has a recovery procedure.

In order to communicate we need language which consists of words. The natural

sciences have in mathematics a language of simplification and an absolute and

universal communication via formulas. Words were as semantic symbols with a

generally applicable nature and with axiomatic, axiological value representation.

The complexity of the new language has become so enormously that the universal

mathematical system language cannot be translated, being interchangeably.

Mathematics consists of the alphabet that requires explanation.

Aleph Beit and 528

Central to Jewish live covenant and commitment are positioned. With all Jewry is

a human society as a language community. We need words to communicate and

to maintain cultural life. Words we learn as a child. We speak first and later in

school we discover what we are actually speaking and how we can read and

write. Every child learns in his own language to lay the foundation with its own

alphabet. Thus we learn as children Jewish the aleph-beith. That has a connection

with 528 as we will see.

We write now ha-aleph-beith in Hebrew letters: tybplah

We calculate the numerical value. he + aleph + lamed + pe + beth + jod + tav = 5

+ 1 + 30 + 80 + 2 + 10 + 400 = 528.


384


In the so-called “nota accusativi” ta we find a word simply indicating grammatically

that the next word is an accusative, a direct object. But in the context of the

creative words, the Zohar puts us on the trail of the "aleph beith". The word ta is

no longer only a reference to the heavens and the earth as accusative’s, direct

objects, but also expresses ta as the combination of the first and last letter of the

Hebrew alphabet, which consists of 22 letters. This makes the number 22 in Isaiah

22,22 - with 528 as the key – of an unfolding meaning?

The alphabet represents the communication in speech and writing. Even pronounced

words creates energy with a particular frequency. No one will find it

difficult to accept the different expression in frequency between a rage and a

love. Apparently the Zohar lets us know that the human language community is

not a human cultural invention but with the potentiality of creation has come

along in the downward causation.

The 22 letters of this alphabet are therefore directly in the first creation utterances

included: the creation of communication has also miscommunication as an unavoidable

opposite.

Language is a basic tool for people, society and music binds with it because of

the connection of 528 = 22 x 24. If the number 22 refers to the aleph beith, we

have to find out the sense of 24 = 2 * 12.

That leads us to the question:

“Does Torah also communicate the energy that may lead to recovery of man and

world by music frequencies, just as we found in the Hexachordum tone system?”


385


19.20 Hexachordum-tone system and Tora

Before we continue with Torah study it is necessary to inform you about the Solfeggio-tone

system, otherwise you are going to see the details that we do not understand

and value.

An important hymn we need?

When we look at the other music systems in antiquity, as ancient Egypt

and Sanskrit, we come from a link between the Gregorian and Sanskrit

(ancient India) further. I have already pointed out the cultural expansion

of Israel in the time of David and Solomon. We therefore assume the

hymn from the Gregorian chant as a working hypothesis, which remains

to be seen present in Torah.

Text of the anthem written in bold letters have shaped the tone names of the tone

pair is written by Quintus Horatius Flaccus (December 8, 65 BCE - November

27, 8 CE), a leading poet in the time of Augustus. In the 8th century the hymn

was rewritten by the Lombard historian Paul Diaconus based on the old Solfeggio-tone

system: ut-re-mi-fa-so-la.

Ut queant laxis

Resonare fibris

Mira gestorum

Famuli tuorum

Solve polluti

Labii reatum

For this example, I refer to Webster Encyclopaedia. The old hymn was dedicated

to “St. John the Baptist”, which caused Si (Ti) expanding the system into seven.

The old Ut was replaced by the Do (Guido van Arezzo, 991-1033 CE). Musicologists

have noted that the Vatican hided this six pitched scheme for reasons on

their own.


386


(It Solmization system 'which refers to this is in music theory still relevant, especially

in the discipline of solfege.)

Translation of the hymn

So that your servants may, with loosened voices, resound the wonders of your

deeds, clean the guilt from our unclean lips ...

(The devotion to John the Baptist, the seventh tone "si" of locust, I rejected as

not authentic because of the intercultural values of the Solfeggio system)

We discovered wonderful relationships in our research around the number 528.

Our study has negated the poem with the suggested energetic and powerful 3rd

tone Mi only as the first syllable of "Mira Gestorum", which can be translated as

"that who works marvels", superfluous, because it serves a different purpose.

Musicologically we need not disable the history and the "Solmization system" to

retain the place it has acquired worldwide since Guido d'Arezzo.

These marvels worked in Tora

It's about how alp hse = G’d performed miracles. The wonder of G’d is all in

One. We now examine the details of a-l-p = aleph = a.

The miracle has the root a-l-p - peh-lamed-aleph. The numerical value of the

letters (from right to left) is 80 + 30 + 1 = 111. That is exactly the distance (interval)

between the music frequencies of Numbers 7, 12-89, as we will see below.

Aleph, the transcript does not only have a 111 as a numerical value, but also three

times the 1. In music theory, the 1 is equal to the indivisible prime. That gives a

new clarity to the importance of a=1. But as for the research we do here it is not

useful to specify the value of the aleph = 111. This is about 3 x 1, otherwise written

as 1.1.1!

Of course 111 is of importance. That shows the dissolution of the number of factors

111 can be de-composed into 3 x 37. And 37 is a prime number.


387


According to the current research system - single digit - we simplify the complex

numbers into a single number (Pythagoras). That results in 37 = 3 + 7 = 10 = 1 +

0 = 1. For the music awl (37) is the mirror of the Creative Authority a = a = 1.

It is the same 1 eliminating the Big Bang as I have hypothesised in my Osmosismodel

in this study. The 3 has a single meaning in this case.

Before we go on it is imperative that the frequencies set by the solfeggio system

are presented in a column.

Ut = 396

Re = 417

Mi = 528 (dominant frequency)

Fa = 639

So = 741

La = 852

When we factorize these frequencies the appearing factors all are factors of prime

numbers. The extensive meanings of the prime numbers, I am not mentioning

here, other then expressing the link with the 1.1.1: the three primes, connecting to

the Source of Living Energy.

Therefore, it is - as already described - in our music system, the "prime", as the

fundamental tonic, breaking through all frequencies directly unto the Source of

energy. This powerful prime is the basis from which all the other frequencies are

derivatives within the octave. A clear example can be found in the I - IV - V - I

(pure prime, perfect fourth, perfect fifth, pure octave), with the pure energy from

a = 1 as the permanently emanating source.

Systemic all this frequency are active energy, each one in unison or polyphonic

composite possess specific energy and regenerative power via the direct emanation

from the Source of Life, in the space of quantum relativity: a rel = 1 rel.


388


We factorize the common frequencies in factors:

528 Hz 2 x 2 x 2 x 2 x 3 x 11

639 Hz 3 x 3 x 71

741 Hz 2 x 3 x 29

852 Hz 2 x 2 x 3 x 71

963 Hz 3 x 3 x 107

174 Hz 2 x 3 x 29

396 Hz 2 x 2 x 3 x 3 x 11

417 Hz 3 x 139

285 Hz 3 x 5 x 19

1074 Hz 2 x 3 x 179

1185 Hz 3 x 5 x 79

1296 Hz 2 x 2 x 2 x 2 x 3 x 3 x 3 x 3

We know that the central pitch and frequency is 528 Hz. Semantically this frequency

is dominant. How do we arrive at the pitches that occur in the solmisation

system and after the Mi?

The following steps show the Fa as Hexachordum 639 vibrations per second, or

639 Hz. The system we use to find the following frequencies is an addition or

reduction of the vector 1.1.1 added to or subtracted from 528 Hz.

Vector consensus

When we count the frequencies as vectors, we consider each frequency as

a combination of single digits. This also applies to the 1.1.1. This interval

frequency we would put in every three-digit frequency, and thus the new

frequencies occur at a fixed interval of 1.1.1. We know that the Hebrew

language does not know 0. By this the 1 is the smallest number. In addition,

the 10 via the single digit method as well: 1 + 0 = 1.


389


Example

Addition of frequencies goes like this: 639 + 111 added as vectors is as

6.3.9 + 1.1.1 = (6+1).(3+1).(9+1) = 7.4.0 = 741. In this (9+1) = 1 though

10 might be expected but 10 = 1 + 0 = 1 for the 0 has no effect.

In this manner all the frequencies or pitches established. Always adding from 528

with equal intervals of 111 to get higher tones or subtract the lower tones. The

last time we can do this is by 174 Hz - 111 = 63 Hz. That is, the "auditory root"

of the system. When we reduce 63 in the single digit system we get 6 + 3 = 9, the

number of connection and the process of being filled, the attribute of the root.

Does the connection to the numerical value of the "miracle of G´d" i.e. 111 - not

make the musical frequencies the everlasting creative and re-creative Source of

information?

The latter feature the Aleph remains as 1 expressing the absolute and unbreakable

unity. So 1 * 1 * 1 = 1 and the same goes for √1 always 1. The music frequencies

shape therefore information absorbed as wave-particle energy of the Creative

Authority, focused on the restoration of the unified creation by the human voice,

verbal communication and the instrumental music. This unification can be generated

and realized with all types of available sound techniques and instruments, in

medical praxis effective for diagnosis and treatment across the entire medical

field of the physical bodily layer of the portrayal of men. The radiating, actually

presence of 528 Hz and its derivatives are significant as universal-energy, influencing

the vital-emotive body, which is in direct communication with the physiological

body, as has been described superior.

Extending six frequencies into 12

We reduce the pitches down to a single number by adding the individual vectors

together, as Pythagoras developed his theory of music, which in the antiquity was

known. In our logotechnics numerological Tanakh study we also apply this kind


390


of analysis. The limit of 12 is clear when we look back to the two circles (source

and realization) and the number π.

Twelve-tone system with aleph as center

00 = 63 (tonic)

01 = 174

02 = 285

03 Ut = 396

04 Re = 417

05 Mi = 528 (dominant frequency)

06 Fa = 639

07 So = 741

08 La = 852

09 = 963

10 = 1074

11 = 1185

12 = 1296

Single Digit Results

00 = 63= 6 + 3 = 9

01 = 174 = 1 + 7 + 4 = 12 = 1 + 2 = 3

02 = 285 = 2 + 8 + 5 = 15 = 1 + 5 = 6

Ut = 396 = 18 = 9

Re = 417 = 12 = 3


391


Mi = 528 = 15 = 6

Fa = 639 = 18 = 9

So = 741 = 12 = 3

La = 852 = 15 = 6

09 = 963 = 18 = 9

10 = 1074 = 12 = 3

11 = 1185 = 15 = 6

12 = 1296 = 18 = 9

Description 5

1. Despite the fact that the old pitched six basic scale must have been present inside

ancient Israel, so for David to his existing system of tuning his 10-strings

harp. The divine harmony of the + and - vector 1.1.1 has provided a comprehensive

12-tone system.

2. We place 63 as a substantial keynote without discussion here. The 63 takes us

to a different meaning in Torah. When we see the repetitive 3 6 9, we find a circle,

comparable with the modern circle of fifths.

3. The circle begins with 174 Hz = 1 and 7 and 4. This first step of 174 Hz is running

from 3 through 6 unto 9 in the 12th stage connecting to the 3 from the beginning.

So the circle of Hexachordum Duplex is completed.

19.21 Numbers and the old sound system

The fact that nature doctor Puleo and the like-minded followers of his "revelations"

start searching in Numbers and seemingly found what they wanted, should

have made our investigation nothing more then an renewed observation. But,


392


standing behind my research, I am sure to have found evidence for the medical

value of this kind of music.

19.22 ‘Solfeggio’ in Numbers 7, 12 - 81?

The time has come to delete the name Solfeggio, stepping forward to the Hexachordum

system with six frequencies: 369, 417 , 528, 639, 741 and 852.

The secret is laid in the verse formatting by the Masoretes, Jewish scholars of the

10th century CE. In the text itself they have found numeral text-ends as meaningful

markers to create a reliable layout of the text. The meaning of this verse formatting

is unlocked for us. Again we use the "single digit" method and reduce the

verse numbers to one single number. That does not mean we also limit ourselves

to 7:12-81. We deal with the total data in Numbers after a closer look, to study

the placement of numbers in their broad context, even some particularities are

marginal in this research. In addition to one single number from the 12th verse

number as we did above, we found the frequencies we looked for.

The following diagrams of the analysis are clearly showing how the frequencies

are present. Striking is the dominant presence of the 6th and the 12th.

In our case, the sixth for the Hexachordum and 12 completing the full circle as

extension to Hexachordum Duplex, the already mentioned 12-tone system.


393


Numbers 7, 12 - 81

no verse calculation frequency no verse calculation frequency

1 12 1 + 2 = 3 1 13 4

2 18 9 2 19 10 = 1

3 24 6 3 25 7

4 30 3 4 31 4

5 36 9 5 37 10 = 1

6 42 6 6 43 7

7 48 12 = 3 7 49 13 = 4

8 54 9 8 55 10 = 1

9 60 6 9 61 7

10 66 12 = 3 10 67 13 = 4

11 72 9 11 73 10 = 1

12 78 15 = 6 12 79 16 = 7

Sum 396 Hz Sum 471 Hz


394


no verse calculation frequency no verse calculation frequency

1 14 5 1 15 6

2 20 2 2 21 3

3 26 8 3 27 9

4 32 5 4 33 6

5 38 11 = 2 5 39 12 = 3

6 44 8 6 45 9

7 50 5 7 51 6

8 56 11 = 2 8 57 12 = 3

9 62 8 9 63 9

10 68 14 = 5 10 69 15 = 6

11 74 11 = 2 11 75 12 = 3

12 80 8 12 81 9


Then we suffice that the tables above and the comparison show us that it is compatible

with the frequencies of the Solfeggio tuning system, like Puleo after receiving

his "spiritual revelations". As we have clearly seen 528 tells much more

than what is only presented in the tables, we are now already at a great distance

from the poem and solfeggio. We also look at chapter 3 of Numbers. To be complete,

I give some more specific information.


395


no verse calculation keyword no verse calculation keyword

1 16 7 1 17 8

2 22 4 2 23 5

3 28 10 = 1 3 29 11 = 2

4 34 7 4 35 8

5 40 4 5 41 5

6 46 10 = 1 6 47 11 = 2

7 52 7 7 53 8

8 58 13 = 4 8 59 14 = 5

9 64 10 = 1 9 65 11 = 2

10 70 7 10 71 8

11 76 13 = 4 11 77 14 = 5

12 82 10 = 1 12 83 11 = 2


Moshe has been commissioned to count the Levites. He counted the number of

22,000 (ch. 3, 39). The Levites were chosen by YHWH as representatives of all

the firstborn and became the peculiar possession of YHWH.

Afterwards Moshe commanded to count all firstborn males from one month old.

The result was: 22 273 firstborn (3, 43).

Not all of the members of the people could be replaced by the number of Levites.

Now we look at the numbers 22,273-22,000 = 273. The outcome we reduce as

usually: 2 + 7 + 3 = 12.

The substantive conclusion is that all 12 tribes of Israel stand next to the Levites.

The number of Levites was 22,000. In the single digit system, we delete the zero’s

and keep the number 22. The analysis of 528 = 22 x 24 is of interest on this

place.


396


We arrived at the number 24 in the central chapter 7 that we have analysed. The

total number of the silver items had a value of 2400 shekels. We again emphasize

the analytical pathway and found 24 with two zeros on screen.

We looked at the end of the chapter and found also two duodecimals and their

multiples, aligning the key number 12.

From verse 84 we found 32 * 12. Previously these two numbers received the following

meanings: 32 as triangular number of 528 and 12 as the fullness of the

circle.

Conclusion

The additional analysis is a confirmation of what is stated above, relating to 528:

22 (Levites) x 24 (silver) = 528 also 528, with 12 as the number of the covenant

between G´d and Israel, as a nation with the exclusive position of servant (Ebed

Yahweh).

Now we conclude with 528 as a cultural totality with the 12 tribes of Israel as

representatives of tikkun olam (the renewal of the World), the healing factor of


397


mankind and creation. Music, based on 528 Hz and derivative frequencies, presents

the healing and regenerative energetic power of creation.

With the number 528 we arrived in the nucleus of Torah and Tanakh.

Through synchronisation 528 Hz is the nucleus of any tonal system. But, as we

have seen in the previous section, there is also attraction of the Schumann frequencies,

effected by the entrainment principle.

HEXACHORDUM DUPLEX THERAPEUTICUM

KEYNOTE - 63 Hz

BEMIDBAR-NUMBERS 7, 12 - 88

SOURCE VECTOR 1.1.1

TORAH-MASTERTUNE

UPPERTRIAD

For this review, I have placed the frequencies in a new system and the conventional

music terminology is shunned. Because the Aleph-miracle is a process and

the value of the marvellous equality of the intervals (1.1.1). It is also the determining

factor. In the twelve-tone circle it becomes clear how the system works

and offers new possibilities to composers.


398


Twelve-frequency "Aleph-tone system” in contact with the conventional

system

Our findings open new pathways for unknown distances. They however has to

find a technical relationship with the contemporary music theory. It was less difficult

than expected. I present here the table. The link can be found in 528 Hz, the

dominant frequency of the new system in a just tuning system.

Striking is the accuracy of the C'' of 528 Hz in the just intonation. The 1200 cents

show that there are no residues, but it fits exactly in the octave at a diatonic system.

For our system give the 1200 cents accuracy of the duodecimal circle and

the tone of 528 Hz "just intonate”.

Frequencies of the different tones. By multiplication of the frequency in Hertz or division by 2 can be determined by the frequencies of two other

octaves. That does not apply to our new system.

c'

cis'

des'

d'

dis'

es'

e'

f'

fis'

ges'

g'

gis'

as'

a'

ais'

bes'

b'

c''

Equal

hertz

(rounded)

261,6 277,2 293,7 311,1 329,6 349,2 370,0 392,0 415,3 440,0 466,2 493,9

523,

3

Temperament

cents (exact)

0 100 200 300 400 500 600 700 800 900 1000 1100

120

0

Just intonation

hertz (exact)

cents

(rounded)

264 297 330 352 396 440 495 528

0 204 386 498 702 994 1088 1200

19.23 a- quantum fields 528 Hz

The pressing question that concerns me is this: we have determined the frequencies

from the Aleph, the 1.1.1. But what about the frequency of 1.1.1 itself? Here

we thank the quantum physicists for their knowledge. The frequencies set with

our system are no longer "ripples" in a quantum field, but can be dealt with as

"particles" that are transmitted through carriers, determined by vectors, or scalar


399


waves. The quantum reason is we have experienced the frequencies, so the quantum

field has changed from uncertain waves into particles of energy. As long as

there is no experience, the quantum field exists as a vacuum embracing the entire

Universe. The entire reality is chained in a "wave-particle-dualism”, situated beyond

our perception in uncertainty (Heisenberg) virtually rooted in morphogenetic

fields (Sheldrake) or the a-quantum field in my research.

About the a as the energetic nucleus of the circle of our “Hexachordum Duplex”-

tuning-system, our consciousness informs us concerning existing virtual waves

full of creative energy, permanently emerging by music as an energy of 528 Hz,

medicalised by transforming activities and shaping by the Mindlink-Teslatechnology.

But what about the immeasurability of the morpho-genetic fields, the

a-quantum field and the layered portrayal of men? 310 This remains here an open

question.

Clinical, therapeutical and other purposed applications of our tuning-system contain

energetic particles of different art, surrounded by the tonal power of "energy

waves" we do not perceive but we intend they are present. We cannot include this

in a composition, but the frequencies which appear belong to the score and resonate.

They can differentiate substantially without our imple-mentation or shape as

a articulated part of the Original Energetic Potentiality.

Cell biologists with their studies teach us about frequencies - the music frequencies

of the Hexachordum-tuning-system as well – that positive energetic influences

influx all art of cells: brain cells, blood cells, hormones, cells of the central

nervous system, cells of the sympathetic and parasympathetic nervous system,

lymph cells etc. By this our 528 Hz-music connects the human individual in its

310 Perhaps the via Sheldrake highly functional turn to the "vital body," Goswami, or my "vital-emotive body" where the

energy loci for effective ring of ripples in particles down anticipatory and retrocipatory to act on top of the adjacent bodies.

For healing and recovery, we must start at this energetic loci for the benefit of the whole person and his holistic physicality.


400


dimensional layered body, as not broken physicality in mental and spiritual

awareness. But anyway, this process however can be disturbed.

Example

Start of life among nine-month maternal stress. The highly damaging

MFD-syndrome 311 with e.g. its negative energy - disturbs brain development,

immune system, HPA-axis system and the complexity of the nervous

system of the embryo and the later foetus, all kinds of physical and

mental illnesses can be. When we approach the increasing human being

out of layered image of man with the energetic field of “vital-emotive

body” as entry for diagnosis and treatment, it orders us to take care of this

growing individual with all approaches: regularly and complementary

medicine. After all, the positive energies that can cope and restore the disturbed

homeostasis resetting all the negative energy by transformed positive

contra-energy? Here the Mindlink-system, issue of my research, has a

high ability to initiate and support the integrate medical field, providing

adequate services.

For the energetic approach of foetal programming and MDF-syndrome longitudinal

research has required. The free-activity, inside the layered bodily fields, of the

528 Hz and the entrainment connection with the Schumann Resonance are fundamental

and also requires longitudinal research. The statistical reports give evidence

of the positive results. The energetic effects of a schizophrenia patient

(n=1) and many MDS patients (n=50) indicates a hopeful future.

The second challenge assign us to recreate a global interdisciplinary society as a

holistic organism dealing with 528 Hz energy of music, working out and using it

for therapeutical and recovery support for people with a hopeless life. Moreover

the pollution of the earth, which includes the disruption of the Schumann Resonance

and its harmonics as a result are our big responsibilities.

311 Maternal-Foetal Syndrome Disorder with cortisol has a big influence on the development of the fertilized ovum in the

embryonic and Foetal stage from which the so-called Foetal programming occurs. The pathological effects of this program

relate mainly to the symbiotic relationship in the prenatal stage which does not lead to the healthy "bonding between

mother and child", but a "pathologic binding" with the maintenance of a symbiosis. The transformed 528 Hz frequency

seems to be able to restore the disturbed process and recover the "binding" into an "affective bonding." (See the last part of

this dissertation.)


401


The physical effects of a treatment with 528 Hz energy we see in an experiment

with the heavily polluted water out-of the Gulf of Mexico. The connection to the

528 Hz frequencies obtains purified water. A proof that the orchestration and

connection between the composite energy frequencies of 528 Hz on a cellular

level (prokaryotes and eukaryotes) takes place, and not solely through the brains.

Water and consciousness? The studies by dr. Emotu would be worthy of detailed

study in relation to 528 Hz.

The observed frequencies of the Hexachordum Duplex are sine-tones. The orchestration

in the composition of the 12-tone circle and their frequency subbands,

along with the ELF SR frequencies 312 - which are stored in the laboratory

as visible, subliminal and auditory sinus rates - attached the supraliminal sine

wave frequencies of the 12-tone circle and their frequency sub-bands as selfadditives.

They can be worked out in a composition with the different sine-linear

frequencies as cantus firmi, as tight melodic lines without overtones. The result of

this composition art is a complex of tonal overtones and sound expressions which

can intensivate body and mind of the audience. The pure sine wave frequencies

without the distraction of overtones, directly act on the vital emotive body, the

seat of memory of experiences, being the central position of the human, holistic

organism, creating the possibility of change and restoration of the disturbed organisms

by anticipation and retrocipation.

The dominant presence of the straight sinus frequencies and the implementation

into the composition opens the "emergent freedom of composing", based on the

main system (528 Hz) derived from numerical values.

312 ELF SR-frequencies are the extremely low frequencies functional and connectable by the system of "entrainment",

with the "Orchestrating Factor 528 Hz" as "attractor" and "emergent".


402


The subjective choice of composer for the numerical structure of the composition

- in permanent connection with the 12-tone frequencies and derivatives, as well as

the personal consciousness factors of the composer and the performing musician,

are mitigated by pure sine wave frequencies, or neutralized. That’s also a subject

for further research.

The investigation which is described in the latter part only took place on the base

of the Mindlink-Tesla-transformed composition "Hertz" with explicit targets on

the main frequency and the numerical derivatives of the Hebrew linguistics. The

final composition will yield a score of "Hertz (Heart) Light and Water" applied

by the above mentioned ELF SR and all the sinus rates.

19.24 The phenomenology of the “Orchestrating Factor

of Repair”

The phenomenology of Orchestrating Factor of Repair (OFR), the 528 Hz frequency

and the elaboration as above mentioned must be considered as a pluriphorm-conductor,

on behalf of the activities on the a=1-quantumfield. The OFR

has only one purpose: to stop “spin” (permanently creating negative energy) of

the on the virtual raster stored memory of experiences and bringing into health of

the human organism, that has fallen down into several shifts of human organic

functions: a complex of pathological, psychopathological and bio-mentally diversity.

So the aim of the conducting activities is the energetic orchestration of inhibited,

impaired and damaged elements, expressing the natural self-healing abilities

to recover the damaged homeostasis, in connection with the new generated recovering

energies.

This “pluriform-conductor” is neither an enigma, nor a metaphor, as long as we

accept the downward causation, emerging energy out of the a rel =1 rel -quantum

field, a bio-energetic method as presented by the “Tesla-Energetic-Transforming


403


Mindlink-system” with the systematically splitting up of music and speech, reunifying

by activating the Mindlink-system via the Tesla-transformation coil.

Acknowledgement

I am indebted to Bie, Scheffers and Tellingen for their publication of “The

Healing Process”, in the series Bolk’s Companions, and Van Geffen in the

Dutch Magazine of Integrate Medicine because of their neologist term

“Organ of Repair”. 313 They have given me the opportunity to translate this

hermeneutic term, being useful for my research on 528 Hz music as the

“Orchestrating Factor of Repair”. 314

This does not mean that administration of these complex energy as therapy is

sufficient. Human communication requires a personal touch, the warmth of the

attention and learning to discover the self-esteem through hermeneutical counterinformation

and joint corrections to the existential life. In terms of the researcher

c.q. tester: diagnosis is not sufficient, there ought to be an appropriate treatment

based on the common root. Causes must be set. The expert tester, however, will

also have to be an expert listener, in an attitude of maximum proximity, chained

with the maximum distance.

19.25 From bio-neurologic entrainment to system

theoretical attractor

313 Geffen, Marko from, “System Biology in Psychiatry”, art. in Dutch Magazine of Integrate Medicine, 2015/3

314 Bie, Guus van der, a.o. “The Healing Process, Organ of Repair”, part of the Bolk’s Companion on the Fundamentals

of Medicine, 2008


404


We finish this part and go on to the final consideration of the power and abilities

of 528 Hz connected with the a-field.

After a short philosophical consideration about the system theoretical meaning

and usefulness of the semantic phenomena “attractor” and “emergent” follows a

description of the sub-frequencies and Hebrew terms in addition to the medical

and therapeutic work field, ending in a first matrix as a preparation for the above

mentioned complex composition and partite.

19.26 Partimento Napolitana: rules or regole

The ‘rules’ or regole of a partimento treatise are typically presented in the form

of short definitions or exhortations. (…) Each such rule, or set of related rules, is

a small partimento. 315

Every beginner of playing basso continuo has to start with these rules. “Perhaps

because these simplest exercises presume an audience of beginners, the figures

are given predominantly in a ‘literal’ form with the vertical stack of numbers arranged

like the stack of tones in the chords. That is, the top number represents the

top or soprano tone, and the lower number represents lower tones”. 316

315 Gjerdingen, Robert, Partimento counterpoint and composition, art. In Partimento and Contiuno Playing, Orpheus

Institute, Louvain University Press, 2010 page.56 (with notes)

316 Gjerdingen, Robert, op.cit. page 56.


405


In the Appendices the single frequencies, belonging to the Hebrew words with

their sampled word value, will form the foundation for the several meanings of

the figured bass in a counterpoint and composition framework.

In the next chapter we elaborate the prepositions to that structural, musical architecture

with therapeutical implications. The dominant factor 528 Hz remains attractor,

collecting the twelve frequencies of Hexachordum Duplex and the ELF

frequencies of the Schumann Resonances.


406


Chapter 20 - 528 Hz, a systemic “attractor”

Musico-logotechnical investigation

T

he meaning of the term "attractor" is diverse and within various scientific

disciplines different meanings are provided. Sometimes it is called

the "strange attractor" a fractal structure that incorporates subsystems

within it by appeal. In our study, the appeal consists of the a = 1 with the Schumann-resonance

of 7.83 Hz - 51 Hz as one of the primary energy realizations.

Subsystems include in our music research the structures forming an energetic

sequence, sharing a sound image based on the fundamental tonality of 528 Hz.

About the fractal structures in music the

musician Bouwe Streets writes in the

Dutch Magazine “Kennislink” about a

publication of Daniel Levitin 317 in

PNAS, (Proceedings of the National

Academy of Sciences of the United

States of America) quoting:

"Snowflakes, traffic flows and floods:

they all have a fractal structure. Composers

use the same structure for their

compositions through the ages. Our brain is apparently open to those patterns.

The Dutch composer Peter Schat called it "The speech of the dream is the mathematical

regularity in music, intuitively reveals in a moment of inspiration. Prob-

317 Author of This is Your Brain on Music, Understanding human obsession,2006


407


ably not deliberately added by the composer, but nonetheless: distinctive patterns.”

The American musicologist Daniel Levitin has discovered exactly such patterns,

characteristics for many shapes of music. He wrote in PNAS:

“A pattern which can be found in the annual flooding of the Nile, in the traffic on

busy highways, the signals between brain cells and the form of broccoli. In 1788

more than forty songs from composers including Bach, Mozart, Chopin, Scott

Joplin and Dave Brubeck, which span four centuries of music together. This pattern

is best described as a fractal, the famous visualizations of mathematical equations,

in which the global moulded in the tiny keeps coming back. Each part is

therefore a repetition of the whole. Levitin saw the same in music: all pieces are

made up of small fragments which are a reflection of the big picture. They discovered

by using computers that every note and every silence to take compositions

into a musical map, which specifically addressed by its length, at the moment

all the tracks are the same fractal relationships forward. Previous research

had already shown that you can find those relationships even when you look at

the differences in musical pitch.”

In another article of Levitin “Musical rhythm spectra from Bach to Joplin obey a

1/f power law” 318 (Publication of PNAS) Levitin i.a wrote:

“Much of our enjoyment of music comes from its balance of predictability and

surprise. Musical pitch fluctuations follow a 1/f power law that precisely achieves

this balance. Musical rhythms, especially those of Western classical music, are

considered highly regular and predictable, and this predictability has been hypothesized

to underlie rhythm’s contribution to our enjoyment of music. Are musical

rhythms indeed entirely predictable and how do they vary with genre and

318 1 / frequency.


408


composer? (...) We found that an overwhelming majority of rhythms obeyed 1/f

power law (...) Although music compositions are intended to be performed, the

fact that the notated rhythms follow a 1/f spectrum indicates that such structure is

no mere artefact of performance or perception, but rather exists within the written

composition before the music is performed”. 319

In the same line, Dr. Johann Lechner – the founder of Mindlink-system - considers

the partite more effect full, comparing the performed, according to the therapeutical

value of transformed music. His vision is connected with the preference

of the consciousness-field of the composer, instead of the consciousness-field of

the performer. In his German article “Scalar-music for stress-impairment” he

wrote: “Durch dieses Feld intensiviert Transformierte Musikeinspielung die Kopplung

zwischen dem “Bewusstseinsfield” des Komponisten und dem Anwender,

der gar nicht mehr Zuhörer ist. Dadurch, dass transformierte Musikeinspielung

die akustische Ebene verlässt und sie durch ein neuartiges informations-skalares

Feld ersetzt, kommt es zu einer rezitatorischen Kopplung zwischen dem Bewusstseinsfeld

des Anwenders und dem Komponisten ‘hinter der Musik’. (...) Die Wirkung

ist also unabhängig von der Konzentration des Anwenders und trotzdem

sicherer und zielgerichteter, denn Resonanz kommt zustande, ohne dass der Anwender

eine mentale Eigenleistung erbringen muss”. 320

(Translation German text)

Through this field intensified transformed music recording the linkage between

the "consciousness field" of the composer and the performer as

well, who is no longer a passive listener.

The fact that transformed recorded music leaves the acoustic level and replaces

it with a new information into a scalar field, there is a resonation

319 Levetin, Daniel J. a.o. “Musical rhythm spectra from Bach to Joplin obey a 1/f power law” (Publication of PNAS,

vol.109, March 6, 2012)

320 Lechner, Dr. Johannn, Skalar-Musik für das gestresste”, Raum&Zeit 183/2013


409


connection between the field of consciousness of the performer and of the

composer 'Behind the Music'. (...) The effect is independent of the concentration

of the performer, yet safer and more full of intention, because resonance

comes about, without the performer providence to have a mental

self-power."

The equation is balanced when it sounds good. Stravinsky: “Musical form

is close to mathematics; not perhaps to mathematics itself but certainly to

something like mathematical thinking and relationship”. Above all music

is inherently, deeply and strangely hierarchical. Notated music of the

western art tradition is basically a graph of frequency information quantised

to the pitches of the chromatic scale over time. 321 Besides the chromatic

scale and other well-tempered scales there are many other scales

with a non-natural character, as Aline Honigh defended in her dissertation.

This has no connection to my research, but it is important enough to address

this scientific publication. See the remarks in the footnotes. 322

“Prime/f” or (1/f): Law of Entrainment.

Music and the brains are connected fractalized, with the fixed power law of 1/f as

Levitin emphasized. He wrote: “The well-known Richardson Effect which began

the modern study of fractals, states that measurements of natural phenomena are

characterized by 1/f fluctuations is also a prominent feature of human cognition.

Neurons in primary visual cortex were found to exhibit higher gain, and the spike

responses exhibit higher coding efficiency and information transmission rates for

1/f signals ...”. 323

321 Whally, Dr. J. Harry, “Transformations and their musical counterparts”, Thinking about Music, 2014.

322 Honigh, Dr. Aline, “The Origin and Well-Formedness of Tonal Pitch Structures”, University of Amsterdam, 2006.

The central question is: “When we call a set of tunes a scale or an accord?”

Untill today there is no definitive answer on this question. She searches an answer inside the so

called tuning space. The scales in this tuning space create convex forms, that are forms without

any deformation like a donut or a star. All scales inside this space have a convex form. Honigh

postulates in her dissertation that convexity of scales has to do with consonance. The more tones in connection,

the easier the steps and the smaller the intervals.

323 Levitin a.o. PNAS op.cit.


410


20.1 Schumann Resonance in combination with 528 Hz

When we focus on the Schumann Resonances in combination with 528 Hz, we

discover the fractalized Schumann frequencies and the attractional octave equivalences.

The dominant frequency of 582 Hz entrains the SR and the octaves of the

SR-frequencies. This 1/f power law is a foundation of brainwave entrainment 324

with 528 Hz as the “locomotive”, full of suction power, and transformation power.

So this 528 Hz and the compositions tuned in the “just intonation” frequency

creates a dissipative system, connected with the Absolutely Harmonious Source,

the a-field. In sum: We intend to accept “prime/f” (1/f) as the Law of Entrainment

that activates by internal and external pulses, translated into the several

brainwaves regarding the EEG registrations.

This is not only the fact of 528 Hz, but the entire rationalized music-system,

started with Pythagoras is an open system, connected with the a–field, the Source

of all Music and Speech frequencies. The original Greek meaning of this open

system could have explained the open worldview of Plato.

The next image

The next image is a compilation and an overview of all previous remarks. This

illustration will express the concrete connection and influences of 528 Hz as attractor

pulling by entrainment the Schumann Resonances as an essential part of

the Hexachordum Duplex Therapeuticum.

A new number is part of the guiding membership: blessing frequency: number 33.

324 The human brain has a tendency to change its dominant EEG frequency of the dominant external stimulus, this is

known as the ‘frequency following response’. This frequency following response on an external stimulus can be seen as

synonymous of entrainment. See above. The question arises: What is the structure in the brain that reacts on these external

stimuli? Is it the pineal gland as Descartes and after him many esoteric movements accepted? In the next part we have to

research this problem, regarding the influences of the Tesla-technology and the scalar-waves, 528 Hz music included.


411



412


20.2 A dissipative system 325

The attraction activities of the attractor (528 Hz) effect in a 'dissipative system

"as an open structure” in which everything is seeking a balance. A reference to

the quote of Levitin about the balance between predictability and enjoyment remains

relevant. The balance in this musical experience can be disrupted by "a

disorder of rhythm." This disorder can be seen as an allusion of the homeostasis,

of the disturbance of rhythm- or sound-production and speech.

A dissipative system is dynamic, because it is of bootable influence by environmental

factors. This system can be fuelled by such complex shapes that we can

say with impunity: life itself is a fine-grained shape of a dissipative system.

The question we have to answer is: "What are the attractive and cohesive forces

within the system?" Notice that all has been said in the foregoing assumptions

may be a suffice designation of dynamic energetic attractions and emergent ostracism

in places of new processes with formula a = a absolute : a relative = √1 abs - 1 rel .

The a as the nucleus of the attractor 528 Hz as described above, is the supramental

a = 1 rel which attracts the mutualistic and energetic process and keeps going a

new emergent process, able to realize life in consciousness. This self-emergent

systems we find not only in biology, but also in art, and thus in music also.

A self-emergent or dissipative process contains two values: autopoiesis and selforganisation.

Both concepts are embedded in one energy stream. If the biological

conditions are exact, then possibly a new biological system comes through. If the

sound is compliant, it’s developing music, a phenomenon distinct from indifferent

sound. This is the actual meaning of the Greek term autos, self, and poieisis

containing creation. This means: autopoiesis apparently creates spontaneously a

325 Term from the Russian-Belgium professor Ilya Prigogine who received the Nobel Prize for this open system, structural

exchanging matter and energy in a process of autopoiesis and self-organisation. See specific literature.


413


new system. The organization development is managed by a creative force within

the system that also cares for an effective conservation of the activated system.

Here I return to the previously mentioned matter.

20.3 Music, a result of autopoiesis and self-organization

Music is created in this definition only if the conditions for emerging of music are

effective. We have seen that the conditions for the emergence of life as potentiality

is present and flowing through the process of osmosis towards the seemingly

emergent creation of the Universe. The concreteness, coming from the creative

potentiality fills the system, are the forces of self-organization, realising many

different processes, maintaining, refining, renewing or extending a complexity

that is extensively discussed in quantum mechanics. These matters of fact form

here a hypothesis to return unto the unity of a simplicity, creative, unknowable

singularity: a = 1 relatief in permanent bond with the a = 1 absoluut.

When we apply the two concepts autopoiesis and self-organization of music as a

reflection on the processes of life, as the act of composing, or the act of interpretation

(hermeneutics in the implementation and performance process), we notice

the music-analytical interpretation of the performance as "the process of bringing

into life on the scene”. In a good hermeneutical system of performance there a

new composition comes true - maintaining the intention of the genotypic composition.

The internal hermeneutics, which explicitly focuses on the written work

and the executive interpretation becomes a source of external hermeneutics. The

context of the concert interpretations, inextricably embedded in the context - the

current environment - impacts the dynamics of the playing, creating a fictional

new work. The interpreter leaves the genetic character of the present composition

and the active hermeneutics of the nomination comes to the creation of a new


414


opus: the "gnoseogene composition". This occurs during the concert performance,

which at best can be canned by making a recording.

The self-organization of the emergent process is governed by known and unknown,

expanding and limiting factors. It is primarily the power of expression,

the potency of the work that determines the ongoing values.

We must conclude that these processes in biology, the social sciences and culture

- with music as a specific process - search its own pathways, which belong to the

natural dissipative order. In music-theory dissipative considerations are restoring

Order (tonal music) out-of Chaos (atonal music like e.g. the aleatoric improvisations).

Concertante music is playing with the energy, stored as potentiality within

the composition itself, the energy actualized in sound touches us in our twofold

manner: attraction or repelling, making a mystical-like dimension to a process.

With these insights, we can now look at the processes taking place within the

music that springs from a or Ein Sof, the Source of downward causation, with

528 Hz as the dominant tonality, absorbing the underlying and transcending frequencies

as attractor and emergent, which as a system of self-organization and

autopoiesis could explicitly lead unto new collections of other frequencies. We

can hear music theory cadenza or enter a new "thematic improvisation", which

gives its expansion in the described piece. The Neapolitan Partimenti were educational

and concert examples for which we have opened a place in the structure of

our Twelve Frequency range in notation, hermeneutics and implementation, in

which the numbers 3, 6 and 9 pre-dominate, with the 528 Hz as dominant. We

return through the Chaos again and again into the Order of tonality.

The sets of frequencies are part of the logo technical analysis of the Hebrew philology

(Torah and Tanakh). What makes 528 Hz of an autopoietic process? Because

it is both an attractor and an emergent process which are systemically equal

to each other concentrated in a or 1.1.1, the vector that provides attraction and


415


appeal of energy, leading the composer and the interpretive performer to new

frequencies and extending of the processes. This process follows the natural path

embedded inside the constraints of the Hebrew text of the Torah and Tanakh.

This enclosure is the typology for the t32 (tN is triangular number N where t

stands for triangle). This means that the sum of all the individual integers from 1

to 32 is equal to 528.

The overall procedure therefore takes place within the semantic text of the Torah

and Tanakh, which indicates the number 528 as an energetic collection of nature

such as the a-numbers of the mathematician Cantor and his set theory.

In sum

With the inclusion of the remaining 11 frequencies of 528 Hz, the music is expanded

to a complex musical system with a dissipative structure. Because of the

self-emergent system it gives the composer new composition and the performer

freedom, managed by value opportunities arising by the choice of Hebrew therapeutically

relevant words and concepts, which have a close connection with the

Source a including healing components relevant elements in the composite structure.

The nature of the composition itself adjust "automatically" (autopoiesis) in

bearing frequencies and their factors, which we bind to associated frequencies as

a figured bass, with therapeutically relevant words, the composer gives musical

shape to this material, chosen of a frame as the Partimento, in our case consisting

of 12 separate frequencies, sine waves, their views and their semantic concepts

that are tailored to healing.

We end these remarks with a quote of Nikola

Tesla on the numbers 3-6-9.

With this statement of Tesla and the use of its

technology in our researching discoveries around

528 Hz all has become more meaningful and


416


powerful. In this verdict physics and Tanakh are finding each other .

We treat the individual frequencies as contained in the circle: 63 | 174-285-396-

417-639-741-852-963-1074-1185-1296 with 528 as dominant at the end, written

as 260-8-260 = 528 Hz.

We have studied the Tanakh for words with a particular value of relevant frequency.

From the number of words and formulations we have made a choice of

words or concepts to be close to the therapeutic-energy application. The choice is

not entirely arbitrary, though a subjective choice I cannot denied. The choice is

determined by the objectivity we want to achieve: music and healing out-of the

Source with 528 Hz as prefix - expressed in a formula, based on the numerical

value of Hebrew Name of G’d i.e. 26: 260 + 8 + 260 = 528.

After these remarks as preparation for the last part of the composition as Coda we

make analyses and comments of all frequencies of the Twelve-frequency Table.

We will finish this analysis processing the structure of a Partimento, in which

frequencies, words and their number values are the ingredients for the figuring

bass, which is alternately carried by electronic sine-waves of all of the individual

frequencies of the twelve-tone sequence, identified by the composer and improviser

on speed to a healing and caressing composition looking for the connection

with the Source.

Important to promote the formation of our opinion is the statement of Tesla:

"Who has found the numbers 3, 6 and 9 discovered the entrance to the universe!"

(We read in our research, “Universe as a-field”.)

We are very happy with the twelve-tone series, based on the series of numbers 3,

6 and 9 referring to Tesla. Besides this we also find the combination 3-6-9 in relation

with nutrition (Omega 3-6-9).

Legend for reading and counting the Hebrew values

A = position value (location inside the alphabet 1 - 22)


417


B = major value (fixed numeral value of every letter from 1 – 400, without the

grammatically final letters)

C = minor value (fixed numeral value after removing 0’s, because 0 doesn’t exist

in Hebrew language, so e.g. 10 is reduced to 1)

Therapeutical values, words and terminology with short applications

63 Hz

aybn – nabi = prophet = 63

63 = 1+10+2+50 – partial tuning system: 1.1.2.5

Prophetical means visionary wisdom. It gives a new future. The prophetical character

gives the 528 Hz-system a sample of Source Power, the basic value for the

entire system.

Subvalues come clear by factorization. The outcome addresses to the presence of

a therapeutically relevant word or notion.


418


Factorization: 7 * 3 * 3 = 63

Subvalue

7 is general prime referring to the totality of the cosmos, to male and female aspects

inside creation.

Divison: 7 = 3 + 4

is the number of the three layered, old Ptolemaic worldview, 1. the cosmic number

of earth, 2. world above the earth and 3. world under the earth (Open Vertical

Cosmic Line) as well as comparable with the layered portrayal of man;

as well as the old worldview and time the four quarters of the earth and the quarters

of time (Open Horizontally Cosmic Line) and the contextuality of mankind

also.

9 is the number of collecting power, of victory and of fraternization in personal

and collective sense.

Relevant words:

lag – ga’al: joyfulness (about victory over enmity)

xa - ach: brotherhood (regained personal relationship)

Remark

The universally cosmic meaning or 7 * 9: the entire cosmos (7) breaks forth into

singing about the victory (9) (influenced by a strongly positive energy)

Number 9 has a final meaning, a fundamental change into a new life after the

victory over the evil. The song never stops giving the golden flow.

Number 9 in this meaning we encounter at the Ninth Symphony of Beethoven's

"Alle Menschen werden Brüder", also the song of European Union.


419


By this meaning 63 Hz is the basic tune of a harmony model and also the nexus

of external frequencies with our internal gamma brainwave (30-90 Hz).

174 Hz

wnuew – we’itzboe = we are aggrieved (to aggrieve)

174 = 6+50+90+70+6 – partially tuning system: 6.5.9.7.6

Factorization: 2 * 3 * 29 = 6 * 29 (6 is ‘double perfect’ and 29 is prime)

Subvalues

6 is the number of creation and recreation (recovery) with “double perfection”.

(For the explanation of perfection and double perfection see Prolegomena.)

Perfect: the sum of the divisors (1-2-3) is equal to the number (6).

Double perfect: 1 * 2 * 3 = 6 (the product of the divisors is equal to the number)

29 is prime, connected with life.

hyxah – ha’chajah – life

Remark

The first step on the basic frequency refers to the rupture of life, visualized in the

verb to grieve, with a negative energetic effect on the systemic entire life.

The double action of the double perfect 6 as number of creation and recovery,

changes grieve into joyfulness because of the victory.

The 29 rules this frequency by the holistic connection between the entire recreation

and living re-ligand at the Source of life.

So I postulate on this remarks 174 Hz is the first step of a therapeutic model of

forgiveness and reconciliation.

285 Hz

wnrkzb – be-zacharno – in remembrance of


420


285 = 6+50+200+7+2 - partially tuning system: 6.5.2.7.2

Factorization: 3 * 5 * 19 = 285 = 15 * 19 = 285

Subvalues

15 is the first part of the Tetragrammaton, YHWH, with 26 as major value.

hy – Jah has the major value of 15. 326

19 is prime, metaphorically to hwx – Chawa in general known as Eva the “mother

of all living human beings”. 327

Remark

The subject ‘be-zacharno’ takes us to the “hidden remembrances”, ordered to

open and to clean up. This order and obligation forms a therapeutically entrance

to the raster of “(unconscious) remembrances of experiences”.

This raster is metaphorically like an impermeable blanket, a programming blockage

making the human existence closed, instead of living with an open

future. Mindlink-system, involved with the transformed 528 Hz-music system, is

a powerful instrument to open and de-activate the powers of remembrances. 328

In the frequencies of 19 as prime we have a universal perspective model of life.

326 We let the number 15 as ay integer stand and not fit for Pythagorean reduction to a single number to (1 + 5 = 6) as

elsewhere in this study hy we let the number 15 as ay integer stand and not fit for Pythagorean reduction to a single number

to (1 + 5 = 6) as elsewhere in this study.

327 The name Eve occurs in the anthropological and cultural and archaeological sciences as the African Eve, the earth

mother of the evolutionary homo sapiens. About 50,000 years later, the African Adam appears on the scene within the socalled

Noah's Ark model. They are models borrowed from the Tanakh, but only minor scientific models and no acknowledgment

of the historicity of the biblical namesakes, who formed the first human couple. The Chawa used here should be

read as a model for the origin of us all and can be implemented in doing so in the M-FDS syndrome (problems of development

after conception) in which we have to connect for recovery on a bio-energetic way to human beginning: the Foetal

programming in utero. See elsewhere in this study.


421


396 Hz

eyswy – joshia – he will liberate us out of our passions and break down the oppressive,

originating factors of life.

396=70+10+300+6+10 - partially tuning system: 7.1.3.6.1

Factorization: 4 * 3 * 3 * 11 = 396

36 * 11 = 396

Subvalues

36 is the number of ldb – badal – resistance of all that happens in life e.g. divorce,

whereby the wholeness breaks down. But there is hope. ld – dal – also

means a flexible wall with the opportunity to be open like a door. This hope will

get an energetic form by meaning of 11. (Psalm 141:3 ld is is door.)

11 belongs to abx – chaba – concealments, secrets. These facts will disappear

because of the liberation powers of “joshia”.

Remark

The third step on the basic frequency of 63 Hz refers to core reason “liberation

from the originating factors”. Only knowledge with the fundamental causes will

activate the self-recovery abilities, with health as a expecting result.

The first subvalue 36 contains energy, activating the inner choice between remaining

an closed structure, refusing to open the door as way to freedom (dal), or

remaining chained at the unconscious concealments (chavah).

328 For those readers who have been inducted of the MFD-syndrome and who tend to think of regression therapy I must

disappoint in this study, perhaps despite the good results. I'm going to give this place a positive comment to this form of

therapy. The Tesla-energy potential of the Mindlink-system accepts the distortions during prenatal development as a defect

that does not inhabit in the past, but in the here and now in the same undeveloped and unsafe way of life is present, which

not only has an effect on human behaviour after birth until old age, but also has effects on the entire human system, to

heart disease, diabetes, obesity, etc. increased in the last stages of life. The Mindlink-system goes through a Teslaenergetic

process in dialogue with the unconscious of the basement of the living house, running where possible off the tap

and pump the basement out, causing in the present, creates a new basis and get existential power of new opportunities as

the feelings that just unconscious insecurity emanating dims and dies, a new life house can be built.


422


With the frequencies of 396 we create a model of consciousness with the subvalues

as compositorical frequencies 36 Hz and 11 Hz. 329

417 Hz

tyz – zajit – Olive tree giving olive oil, feedstock of healing ointment.

417=400+10+7 - partially tuning system 4.1.7

Factorization: 3 * 139 = 417

Subvalues

3 = prime

139 = prime

Prime’s are nearest to the Source of Energy.

Remark

The healing substance of the olive tree has a high energetic connection with a,

the basic frequency 63 Hz and the gamma brainwaves. 417 has a compositorical

meaning: the Good - tbjw - vetovot, because the number is a composition of two

prime’s: 3 and 139, frequencies of the highest order of re-creational and recovering

energy of the Source of downward causation.

639 Hz

Kytxra – archtich - recover the ways of life –

639=1+200+8+400+10+20 - partially tuning system 1.2.8.4.1.2

Factorization: 3 * 3 * 71

9 * 71 = 639

329 The frequency of 11 Hz can only be reached by music by the "binaural beat" through a headset. The left and right ear

receives unequal frequencies. The brain pulls off the differences between the two frequencies. then you heart the listener

subliminal the low frequency. This suggestion is controversial and requires research.


423


Subvalues

3 * 3 = twice a prime = 9. We already found 9 as the number of interconnection

(see: 63 Hz).

71 = prime. All people are involved of fullness of knowledge and understanding

in the 71. These frequencies are important for recovery of the earth and the world

community (e.g. pollution and E-smog).

Remark

The notion of “fullness of mind” illustrates an open channel with the Source for

all people. Therapeutically this energy is important to create a new or renewed

mind-set and positive self-reflection. Mindlink prepares and transforms the frequencies

into the positive energy of healing, wholeness in the meaning of the

English “holy”, medicine as ‘art of wholeness’.

741 Hz

tasm – mash’t – burden, the heavy circumstances of life, factor of releasing

741=400+1+300+40 - partially tuning system: 4.1.3.4

Factorization: 3 * 13 * 19

Subvalues

3 * 13 = numerical value of the Ultimate Creating Instance: dxa hwhy - Adonai

Echad

13 = prime and the numerical value of hbha – ahavah - love

19 = prime and the numerical value of xjb – batach - reliance

Remark

Prime values accentuate the creating power of the Source, represented in the

terms release, love and reliance, the therapeutically terms with recovering energy.

The central number in this frequency is 19 with the highest value of prime.

Reliance is the core value in the medical treatment of releasing, concerning the


424


heavy burden of life. This energy of love constantly emits from the Source by

speaking this word. (Words and thoughts are power fields of quantum opportunities).

Recorded words and sentences will be transformed by the Mindlink-system

and Tesla technology.

852 Hz

yneyswtw – wetoshieeni – the one who rescues me

852=10+50+70+10+300+6+400+6 - partially tuning system: 1.5.7.1.3.6.4.6

Factorization: 2 * 2 * 3 * 71

4 * 3 * 71 = 12 * 71 = 852

Subvalues

2 * 2 * 3 = 12 - hwa – awah = desiring

12 = 3 * 4 is the product of male (3) and female (4). Twelve is a time measure (12

months) 2 * 12 hours in a natural day.

71 is prime as fullness (alm – melo) and a pointer to a higher consciousness

Remark

Deliverance from desperation is the window to a new perspective of life.

This frequency contributes to this renewal.

963 Hz

hnsrxt – tacharashanah – stillness and introspection

963=5+50+300+200+8+400 - partially tuning system: 5.5.3.2.8.4


3 * 3 * 107 = 9 * 107 = 963

Subvalues

3 * 3 * 107 = 9 * 107


425


9 = fraternization, connection, linkage

107 = prime – feelings of contempt and expulsion, woam – maso.

Remark

maso (expulsion and contempt) has a therapeutically content. Feelings of expulsion

and contempt are high frequent present in the medial culture. This frequency

has a special content, because of the meditative aspects with introspection, as a

beginning of new self-understanding in a new, or renewed connection with the

personal self and the Source.

1074 Hz

Ktrwt ybhal – le’ohave Torahtecha – respecting the Law of Creation gives

peace and renewal of the world

1074=20+400+200+6+400+10+2+5+1+30 –

partially tuning system: 2.4.2.6.4.1.2.5.1.3

Factorization: 2 * 3 * 179 = 1074

Subvalues

6 * 179 = 1074

6 = perfect number of creation

179 = prime = Ndeb-Ng – gan-be’eden – Garden of Eden

Remark

The frequency 1074 Hz is for therapeutic purposes a composition of two words,

which connect the basic culture and the cultural mandate command to the entire

mankind. Implementation is an obligation of respecting the Law of Creation.

Mankind is wanted by the Creating Instance, who has taken us - on an evolutionary,

creative way - out of the earth, with a "heart-to-heart" relationship with himself

and all creations. At the moment the assignments are to heavy (burn out) due


426


to debilitated energy, application of new energy from positive frequencies, gives

new strength and courage to continue.

The Garden of Eden is a Hebrew metaphor of nature and nurture.

Debilitated energy becomes revitalized by the extraordinary energy of the heart

and love frequency of the music of 528 Hz.

1185 Hz

teysth – hateshyit – the Ninth

1185=400+70+10+300+400+5 - partially tuning system: 4.7.1.3.4.5


Subvalues

15 * 79 = 1185

15 = hy – Jah * 79 = 1185

hed –da’ah = knowledge

Remark

The number 9 - besides the former remarks - stands for an end and a new beginning.

We need intuitive knowledge and insight coming from the Source of Creation.

As we already remarked we need knowledge and insight out of the relationship

with the Creational Instance. In the Periodic Table of the Elements, the hydrogen

forms (atom 1) - and nitrogen atom (5), the first two elements of the DNA molecule,

draws the line between the Name hy - Jah with the collective value of 15,

divided on the first two atoms of the DNA molecule. The life-giving presence is

not the DNA but the relationship with hy – Jah, the actualization of the Source,

Ein Sof. Where the source actually connects the atoms, their effects are also energetically

concrete.


427


1296 Hz

twbytn Kwtb – betowach netiboth – the heart of the good way

1296=400+6+2+10+400+50+20+6+400+2

partially tuning system: 4.6.2.1.4.5.2.6.4.2

Factorization:2 * 2 * 2 * 2 * 3 * 3 * 3 * 3= 1296 i.e. 6 * 6 * 6 * 6 i.e. 36 * 36

Subvalues

16 * 81 = 1296

16 = 4 * 4 = (d – daleth = door) d * d

81 = 9 * 9 = perfect square

Remark

We are at the end of the cycle. The last rate places us in the center of the flow of

life, the golden flow of justice and light working in our entire system. With the

perfect square 9 * 9 = 81 we conclude, the series we started with 63 Hz = 7 * 9.

Since 9 is the number of effective compounds, here we pay as the final aim special

attention of 4 * 4. As we already mentioned 4 is d = daleth = door. But here

we have twice 4 = two doors: the door as entrance and the door as exit.

The first door opens the inner self-reflection and self-healing consciousness, the

next door enlightens the way to ethics and justice. When both doors are open effectiveness

and light emits in and out. So we are walking our life in the middle!

That must be actually the state of wholeness.

Herz (Heart) and the composition

528 Hz – the heart of the composition

528 = 260+8+260 - partially tuning system: 2.6.8.2.6 (dominant)

We dissolve the core of the research: 528 Hz, factorized into 260 - 8 - 260.


428


We see in 260 the name YHWH twice, with the number 8 as the number -

representing the future - in the middle.

With the development of these frequencies in the general bass on a = 1,

we can fixed a tonic, transposed to 63 Hz, providing the chords on the 12

steps we described, and entrainmentely and attractively connected with

the Schumann Resonances. In the last phase of this elaboration and explanation

of therapeutically usefulness we will make sine-recordings of all

frequencies, creating an admixture of electronic sine-waves, which are

compositorally harmonized on accords, counterpoints and (allegorical)

improvisation based on a frame of the Neapolitan Partimento, with the

free shape of choice, coupled with all the Hebrew words we elaborated

here; words and their energy based on the statement: Words are energetic

forces.

The strength and the power of the spoken words we read in Misjlee 18, 21: tyrp

lkay hyhaw Nwsl-dyb Myyxw twm. (Translation: “Death and life are in the hands

of every one who is speaking words; who loves the chosen words, eats the fruits

of them”.

Number analysis of the verse of Proverbs 18,21

Words: 7

Letters: 29

Value: 1307

It is remarkable that this proverb has composed of 3 primes’. When we

accept the special meaning of prime (to close to call with a=1.1.1 as

pri me’ s), we only have to conclude: the author obviously wanted us to

show something fundamentally: 1.1.1 the ultimate interval between all

frequencies of the Twelve Frequencies Circle.


429


Remark

The spoken words are forces as well for good or evil, dominated by the intentions

of those who express them and effects (negative of positive).

When we finally look to the Twelve-frequency-series, with 528 Hz as dominant,

and we subtract 12 intervals from 528 as the attracting dominant the remnant is

516. 516 is the numerical value of hwqth – ha-tikvah, hopefulness, the guiding

factor for the entire mankind.

Conclusion

We have descripted the Twelve-frequency-series as a composition of opportunities:

collapsed quantum waves transformed into particles as sound and speech,

with only one effective aim: creating music with a healing power and functions: a

musico-energetic guide to be useful to regular and complementary or alternative

medicine.

How can we describe issues we neither can measure nor knowing? 330

If we are limiting ourselves unto an abstract, philosophical reflection on the domain

of the Infinite No-thing, the Creative Substance of which we know nothing,

330 See the consideration about the relationship between complementarity of Bohr and the discussion about qualia and

quantumfysics in the Epilogue.


430


simply because our minor epistemological, scientific and mathematical abilities

fail, we will come to renewed insights on science and Torah Now it comes down

to the philosophical foundation of research, aimed for a possible reconciliation of

conventional and complementary medicine in East and West. We aren’t able to

abstract freely, but we intend with all the opportunities we have, working towards

the realisation of potentialities within our domain.

Everyone agrees the presence of the ongoing evolutionary process of development

in all areas of the global cultures. Therefore, there can’t be any misunderstanding

about that. It remains difficult to understand start and finish of the evolutionary

processes of creation.

At this stage we dedicate some words as sound waves being an implication of

creatio continua, the continuing process of development, creation and recovery.

The domain of the Source of energy and the consequent emerging of energy is

scientifically just an assumption and eludes our human capacity of knowing and

measuring. We assume power, but we cannot identify scientifically verifiable

frequencies because the "meta-frequency area" is behind the human powers of

thinking and thus it is neither verifiable nor falsifiable. That leads to the conclusion:

the general scientific method of upward causation will sink into the morass

of the human inabilities, calling for change.

This research, musically shaped in a compositional complex by Mathieu Polak,

will gave a modest contribution to the reconciliation and renewal of the domains

of all medicine into an Integrative Medicine, by the energetic frequencies of 528

Hz as attractor and dominant tonality of the heartbeat of earth and humanity,

transformed by the Tesla technology, according to his statement on the number

combination 3-6-9.

[√1rel ← -∞ ∫ +∞ freq. ← √1abs ]


431


The formula we worked with makes the energy of the Aleph accessible for our

abstract thinking, just inside the downward causation. From “a = 1” we expect

concrete energy, collapsing like quantum waves into observable matter. The frequency

of 63 Hz is such a collapsed wave which has taken the shape of a sine

wave, a sound reproduction of 63 Hz; a shape formed through a word with numerical

values compatible with the corresponding frequency (see above). This

applies to all frequencies. They explicitly retain the link with the fundamental a

= 1, specified in a hypothesised new the formula, indicating our reality conform

infinite quantum possibilities, basically for new creations in new terms and concepts,

for music and speech.

Future Working hypothesis

The a-energy has a wave range of 1 meta-frequency 331 with an infinite

wavelength: [√1rel ← -∞ ∫ +∞ freq. ← √1abs ]

We cannot speak other than in terms of "opportunities" which materialise in the

way of collapsing waves. We call this process of opportunities inside and outside

our space-time reality as an integral, with -∞ ∫ +∞ as formula. Due to this formula, it

is possible, after the acceptance of the human limitations within the process of

download causation, we are able to work with the results of these processes of

downward causation. Our Twelve Frequency Circle is compiled of "collapsed

opportunities”, quantum waves changed into sound waves as particles arranged

by equal intervals with a = 1.1.1 as the ultimate foundation.

The frequencies and the applications are concrete in their operations and deliver

practical purposes in reporting and evidences, the energetic effects via the Teslatechnology

of the Mindlink-system.

331 My intended “meta-frequency” must be read as “the integral of all frequencies”


432


We now proceed processing the individual frequencies. The frequencies are processed

into melodious composition elements, converted of digital numerical values

by the corresponding word or concept, shaping into intervals. The relationship

between the individual sine-waves is preserved as an effective undercurrent

of the composition in which all differentiations are in an emergent manner processed,

with 528 Hz as the dominant attractor and SR-entrainment.

All transforming energy emanates from the Source: “a =1”


433

Practical Part – Mindlink sysrtem: “Concluding Remarks”

Chapter 21 - Womb as Lost Paradise:

Mindlink Research: “Back to the Beginning”

21.1 Introduction

R

esearch of the universal applicability and scientific validation of the

Mindlink-system: a foundational system in favour of “convergence

in the globally medical domain”, with music therapy included. The

following statistical report is not an analysis of Mindlink-system

only. It also draws attention to every medical and therapeutical system.

The Mindlink-system combined with the music of 528 Hz appears as to be a

high quality for all medical and therapeutical systems being open to an energetic

layered image of man. Reading the statistical report and positive results by the

casuistry, anyone can feel the challenge of this Mindlink-system to connect with

his/her own using system, in order to create a deeper fundamental approach of

the causes of distortions.

This Mindlink-system research is a private initiative without any commercial implication

or support. The recommendation of this system merely laid on the scientific

value and the unique opportunity to reach hidden and fundamental causes of

distortions e.g. by epigenetic inheritance and foetal programming, the mentioned

MFD-syndrome, treated by the Mindlink-treatment in general and the music of

528 Hz in particular.

21.2 Personal remark

This year I started exactly 40 years ago with my therapeutical praxis and research.

My specialization became clinical hermeneutics with as subject matter

fundamental uncertainty and concentration disorders and the philosophical foundation

research for these subjects. Both symptoms have formed the phenomenology

of missing existential and contextual affirmation in the primary stages of life.


434


We observed the basis and researched as long as we could find a defendable scientific

conceptualization. Why could we not reach the real causes? Only after this

clearness of investigation we could make a model for recovery and structural

change of negative self-awareness and self-esteem both “pressing gaps” in these

suffering lives?

Hence a central research theme is: negative self-image associated with selfdenial,

caused by disturbances of the undeveloped emotive life in the early stages

of the pregnancy process. Is it only a matter of less attention or shortage of

warmth in the primary stage of life, a non-attachment, is it?

Contextual conditions seemed to be the cause of the later developed self-image,

with a chain to self-rejection, feelings of uncertainty and guilt?

The existential life-story is a reflection of what was in the mind and stored a diversity

of experiences. The life-story became the representative of the personal

reality. The hermeneutical conclusion was: “You don’t have a life-story; you are

your life-story!”

Looking back to my professional life: I see forty years of lucky moments in help,

but also of years with deep disappointments, because we only take some narrow

steps with our clients, without a completely healing and recovery, but notwithstanding

this always looking forward, searching the real wisdom and insights.

21.3 Mindlink, an eye-opening confrontation

He was very sad.

After a period of many years of speaking about uncertainty and concentration

disturbances, I was convinced about the inner presence of sadness and tears that

couldn’t discharge because of all the fear and traumatic experiences in the early

childhood. Because I wasn’t interested in alternative medicine, coming from a

scientific background, I was a bit in refusal at the moment he wanted me to go to

an alternative neurological therapist.


435


He won. So I went with him.

“I will do a mindlink-test with you,” the therapist said to him.

To me: “Are you familiar with Mindlink?”

My answer was: “no!”

I didn’t understand the test-techniques. After one hour, the consult was finished.

The next day he phoned me about the consult of the day before. He told me he

couldn’t stop crying. This was a miracle to me. The simple grains - as was told to

me - loaded with the test stored energy, did in one day, what I couldn’t get done

in many years.

I was upset about the powerful system.

In less of a month, I decided to involve this mindlink-system as a part of my dissertation

research on the scientific and therapeutical value of 528 Hz music. The

representative of Mindlink Benelux, Mrs. Nini Kalisvaart, came to me and taught

me to be able to perform the test.

So my new hermeneutic mindlink-research praxis has become true, involving my

40-years experiences in clinical hermeneutics.

Now, after about 650 tests, I am glad to be able to publish the statistical results,

with the conclusion: “The Mindlink-system deserves to be accepted as an evidence-

and value-based complementary medicine, with a recommendation as a

supplying system for every type of treatment and therapy, any types of music

therapy included.

The recovery results of about approximately 50 clients with prenatal disorders

have convinced me. The solution I was looking for for many years – and I never

expected as central - was the “womb as lost paradise” for many adult individuals,

suffering from fundamental uncertainty and concentration disorders. The combination

with 528 Hz music reveals the ideal powerful and energetic way of solving


436


the unconsciousness of stored experiences, even coming from the multigenerational

germ line(s) transmitted by the epigenome.

In the casuistry of some of the 50 clients I will quote about their experiences with

Mindlink and their improvement of life, suffering at the MFD-syndrome, the third

stage of my scientific research.

(End of my personal remark.)

21.4 Extended Mindlink-system

I intend to compose the main elements described in this dissertation into the Extended

Mindlink-system: Mindlinktest (basic) + 528 Hz-music + Schumann

Resonances + Tesla-scalar wave-radiation with Transformational ability of

Information-transfer.

This idea of Extended Mindlink-system here has no other basis then a proposal on

behalf of the results of my research praxis (see Casuistry) and a humble consideration

offered to Dr. Lechner, the designer and founder of Mindlink-system. I am

convinced the Extended Mindlink-system will be an enrichment of the complete

Mindlink-system, a suitable additional system for the general medical and therapeutic

praxis, dentistry included. 332 Extended Mindlink-system revealed a final

result in the treatment for off-spring of WW II-survivors and off-spring of other

deep traumatic experiences in the germ-line.

332 The Preventest, the diagnostical and specialist treatment system of the Mindlink-system, will be enriched by this

extension as well, I guess.


437


21.5 Mindlink Research: “Back to the Beginning”

The metaphor as the title of this section requires an explanation. The statement:

”Back to the beginning" is in one way the conviction of Mindlink-system. It is a

statement that has been interpreted from many disciplines. Philosophically it fits

us in the circle of existence and re-existence. The philosophy of the East is very

familiar with the Wheel of the Rebirths, the reincarnation as a process of purification

by the circular hallway, stops in Nirvana, back to the beginning.

Western philosophy less profiled under the influence of mainstream Christianity,

theologically rejects reincarnation.

In our actual time of philosophical "migrations," hybrid forms originated creating

various types of images of man. Concerning the several images of man we divide

the concepts into two main groups: 1. the Darwinist-materialistic (Upward Causation)

and 2. the energetic vital-emotive portrayal of man (Downward Causation).

Herewith, we give an impetus to understand the scientific differences between

conventional and alternative medicine. Conventional medicine, with the materialistic

image of man, has formally removed from the holistic, the time-space disposition

wherein everything is connected with everything. Fortunately, there are the

first signs of change. The alternative or complementary medicine is fixed in the

holistic-energetic worldview. With a bit rigid statement we can call the differences

as follows: conventional medicine treats the "diseases," the alternative

medicine treats the "entire diseased individual."

The implication of the statement “back to the beginning" therefore, is a characterisation

of the differences within the medical domain. For reasons I already have

mentioned the conventional medicine limits itself, concerning the symptomatic

treatment, combating diseases, on the contrary of the complementary energetically-holistic

treatment, which starts looking for the causes, inspired by the statement:

“first we ought to find the causes, and after that we start the treatment”,

Spinoza taught us.


438


21.6 Back to the beginning of life

At the provisional end of my research I concluded the Mindlink-system opens an

energetic, dialogical possibility, back to the beginning of life, the prenatal stage.

Patients discovered step by step the unconscious way, inviting to go back to the

beginning of existence: the womb and the complexity of embryological development,

foetal programming and epigenetic inheritance in the germ-line.

Epigenetic inheritance and foetal programming cause of distortions of different

art, with longitudinal influences to the entire existence, even into the old age.

Researching the causes of diseases (physically and mentally) the Mindlink-test

opens through interference the place of the ultimate beginning: “womb as paradise

lost”. Nevertheless, with a way out – a recovering solution.

21.7 Adaptogenic capacity

Concerning the umbrella factor of distortions in the prenatal stage (Period of

Time, element of the system) I postulate: “decreased adaptogenic capacity, with

fundamental uncertainty and concentration distortions as the phenomenology of

self-sabotage, hermeneutical distortion and social disintegration, are results of

decreased adaptogenic capacity. Epigenetic inheritance and foetal programming

should be differentiated into symptomatology of distinct nature, starting with the

moment of procreation inside the “Period of Time”, the timeline of the preembryonic

development unto later in life. But “procreation” needs differentiation

in multigenerational, genetic and epigenetic inheritance.

The praxis of the Mindlink research, therefore, will not focus on individual symptoms,

presentations to many alternative practices, with a range of marketingrelated

advertisement’s and strong skills affecting their systems. The power of

Mindlink-system in my opinion is and I repeat: "going back to the beginning."


439


Therein Mindlink has a universal character, especially after the implementation of

the 528 Hz music sufficiently described.

Mindlink-system is an "application"-system giving other specialists specific

treatments and therapies new additional opportunities, by highlighting the aetiology

of diseases in cases of the intergenerational history and scientific hermeneutics.

So the Mindlink-system can develop a global intermediary function for Eastern

and Western medical philosophies.

21.8 The scientific validity of the Mindlink-system

Our research concerning the scientific validity of the Mindlink-system seems to

remain somewhat behind all I described so far. The thetic part and the music research

and composition, became a fundamental preparation for what follows next,

examining a system that deserves to be practiced worldwide as a universal applicability.

These very positive conclusions beforehand are nonetheless conclusive

after a research period of many years; years of intensive literature study,

clinical hermeneutic praxis and about two years of practical Mindlinktestresearch.

The scientific properties of Mindlink-system has a principal link with the quantum

physics of complementarity of Niels Bohr. This focus is needy to avoid the –

for regular scientists rejectable – classical metaphysics.

My medical, philosophical research stands in the monist, non-dualistic education

of Spinoza together with Taoism. The ultimate consequence of the monist disposition

is: we have to start with the ratio and not with the subjective experiences.

Nota Bene: priority of the ratio doesn’t mean “rationalism”. This dogmatism belongs

to the Darwinist, materialistic atheism, with contingency as the only term of

beginning: the self-declared source of the materialist upward causation.


440


After the conclusion based on statistical analyses about the scientific validity

(published at the end of this Practical Part), researched with the conventional scientific

skills, the estimated universal scientific value illuminated after discovering

the impact of prenatal distortions, the foetal programming as interference field.

The unlocking process of the epigenetic and prenatal phenomena (procreation, as

the momentum of hereditary, innate and acquired processes) can disrupt, with

strong negative effects on the new increasing life (blastula, embryo, etc.). These

distortions can be caused by epigenetic inheritance and the excessive presence of

the stress hormone cortisol. This cortisol with a high expression in the womb of

the pregnant mother can reach the embryo e.g. by weakness of the placenta barrier

or an excessive level of cortisol, the effects of the HPA-axis, seemingly as an

irreversible process without the opportunity to switch off. (HPA-axis is a feedback

system of switch on and switch off making cortisol and other hormones.).

A fundamental correction on the work of Frank Lake, we postulate the “Maternal-

Foetal-Distortion”-syndrome (MFD). We changed this psychological filled term

“distress” into the semantic broader “distortion” because of implying multitude

disorders, physically and mentally as a semantic part of it. This change makes our

renewed MFD-syndrome valuable and supportable by the Mindlink-system, with

growing up to the ability to serve other medical and therapeutical systems in the

alternative, complementary and conventional medical domain.

Moreover, the change of what into “distortion” brings diagnostics and treatment

of the Tesla-technology in the Mindlink-system more online with the broad research

on “Foetal Programming”, a subject matter at many representative International

Universities and the Council for European Studies as well.


441


21.9 Embryogenesis and disturbances

This prenatal domain actually is a locus of security, many times it is not. Instead

of creating the energy of happiness the uterine atmosphere has become unsafe

because the stress of the mother has broken through the placenta barrier and

reaches the “human in growth (embryogenesis)” with the dramatic effects in all

senses.

But there are more causes of negative energy inside the uterus. A profound effect

on the growing human has the “lost twin” – a real drama within the womb - a

situation as a source of physiological and mental distortions, basically for a lot of

diseases later on life. After birth, behaviour disturbances don’t but belong to the

psychopathology. It seems to have a physiologically-pathologic basis. Therefore,

behaviour disturbance is no longer only a matter of psychological behaviour modification,

but of “sickness behaviour”, a conducting disorder, with a physiologically

starting point. This disorder begins in many cases at the start of the timeline

of life, at the moment of procreation (with an epigenetic inheritance coming from

the multigenerational domain, the germ-line).

The very specific character of the MFD-syndrome listed within the Mindlinksystem

isn’t primarily focused on medical biotechnology and psychotechnic as in

conventional medicine.

Characterologically, the specific approach of the Mindlink-system comes from

the emphasize on the “energetic layered bodily system”, the energetic-cellcollection

as the image of man. This image is conceptualized by the accent on

influences from epigenetics, morphogenetic fields, as defined by Rupert Sheldrake,

an Ayurvedic concept of Goswami, and my personal vision of the permanently

unlocking process of potentiality, transmitted through the gamete, as a

stem cell: spermatozoa and ovum.


442


Conclusion

The conclusion remains: longitudinal, specific research is needed to continue,

following these fundamental distortions of the human system, supporting the patient

and to develop new Tesla-technological and Mindlink-research. Special attention

ought to be draw to music and speech-related physiological and psychological

distortions as “auditory hallucinations in schizophrenia”, ADHD, ADD

and other symptoms within the autism spectrum.

21.10 No symptoms but causes

A categorical norm of the Mindlink-system is: “We don’t treat the symptoms, we

principally look for the (rational) causes”, like Spinoza taught in his Ethics: “Every

disease has a cause, find the cause and the recovery is proximal”.

We end this summary with the seal of Spinoza and the emblematic significance of

the Latin word “caute”.

What did he mean by this cryptic term that normally

means: be prudent? It isn’t likely this “man of courage”,

deeply touched by enmity, that will warn us to

be prudent to come into the public domain with our

specific convictions, neither scientific nor in private.

We find a possibility of better understanding by the

translation of “Caute” into Greek: fronhsij –

phronèsis in the meaning of “practical wisdom”. Caute was the instrument for

him to illustrate, the primate of his life wasn’t “vita contemplative”, the way of

contemplation, but on the contrary “vita active”, the way of practical acting. This

practical acting in the sense of Spinoza – in contrast with the vision of Aristotle –

means: striving to get more definitive insight in the cohesion of natural phenomena.


443


The conclusion must be: every one who has got fundamental insight into the nature

of reality (holistic), ought to be prudent with the revelation of his convictions,

because of the enmity we will meet anytime. Nevertheless, if we stand for

our meaning, we have to.


444


Chapter 22 - Philosophic-Clinical Hermeneutics

22.1 Widening the Horizons

W

ith the verbs to comprehend, to understand and to explain we

thread the pathway of philosophical hermeneutics. The Greek god

Hermes transported the messages of Zeus. The “hermen” – messages

written in the language of the gods – ought to be understandable for human

individuals. So it was the task of Hermes to translate the message and afterwards

to explain the content. Hermeneutics became the science of revelation of secrets

or mysteries. On the philosophical university level, we research “the scientific key

to unlock the secrets”.

Only in this way can we exchange the content of texts. After theology and literature

sciences, the philosophical hermeneutics generated new opportunities. In the

framework of the human care, the scientific hermeneutics start reading human

individuals as “living human documents”, according to the existential life-story.

Mistakes in the life-story were synonymous for wrong self-understanding, with

all (psycho)pathological effects. Since these developments the verbs to comprehend,

understand and explain became therapeutical interventions. So hermeneutics

increased into a medical and therapeutic intervention-system, with "clinical

hermeneutics" as the final step into the medical domain. To the clinical hermeneutics

belong two main terms, valued as a diagnosis of wrong self-understanding

and self-rejection:

1. hermeneutical distortion;

2. social disintegration.


445


The two terms "hermeneutic distortion" and "social disintegration" were for

years fixed patterns that have been taught on several scientific institutes and faculties

as the specific object of research; time and again the object of movement

and change of approach.

Dr. Rob Lubbers, Professor at State University of Utrecht (The Netherlands), has

reconstructed the old days textual hermeneutics as it was philosophically developed

by Hans-Georg Gadamer at the University of Heidelberg. He remade the

term for being a strong therapeutic intervention against "disturbances in the process

of Self-Understanding", leading factor of the diagnosis: hermeneutical distortion.

In a former publication I wrote something about the research of Lubbers. Here I

will give a short excerpt. 333

Gadamer’s hermeneutic circle begins with the “Einverständnis in der Sache”

(Consent in the matter). This unity results from an open consultation, in which

each part is explained in terms of the whole and the whole in terms of each part.

See Gadamer’s “Vom Zirkel des Verstehens” ( According of the Circle of understanding).

334

If a circular hermeneutic contact results in agreement, then those concerned are

sharing into a “Verständigungsgemeinschaft” a community with mutual understanding.

According to Gadamer’s view, loss of communion must have pathological

effects.

Hermeneutical distortion

333 Benavraham, Gideon, “In the Twilight of the Eastern European Dialectical Materialism”, 1992

334 Gadamer, H.G. “Truth and Method”, London 1975. For an English introduction

http://www.metajournal.org/articles_pdf/286-303-regan-meta8-tehno.pdf


446


If we hold the view that a person “is” rather than “has” a life-story, then our attempts

to interpret the latter is what really happened to people when they end up

in a kind of existential “cul de sac”. 335

It is twice as difficult to get back on the right road because:

the person in question is not understood by those around him; they have the

wrong view of him or her.

The sad person doesn’t understand himself of herself anymore.

The whole problem depends on a deficient interpretation. In other words, people

either get themselves all wrong or they fail to understand others. Lubbers remarks:

“I have called deficient interpretation, together with its consequences,

“hermeneutic distortion”, because the term expresses dislocation and deformation.

The consequences of deficient interpretation are not of minor importance

as it so happens”. 336

Knowledge and insight are pre-conditional to understanding

“Hermeneutic aid involves co-operation between a therapist and one or more clients

with the aim of understanding and interpreting of unacceptable experiences”.

337

The nature of behaviour will remain obscure as long as the knowledge and understanding

- relevant to its observation – is lacking. Lubbers mentioned an example

to illustrate this.

335 Typical French statement. Literal translation is impossible. The term comes from the French speaking part of the nobility

in the UK and means: the bottom of the bag.

336 Lubbers, Dr. R. op. cit. page 12



447


22.2 Example of misunderstanding

A dog falls into the rough seas of a basin shaped harbour. It can not get unto the

quayside. The people on the quay are unable to do anything to help. The animal is

terrified. A boat is the solution. A few people row out to the dog. The animal becomes

more terrified and attacks the people. It does not understand what they are

doing and snaps at them, trying to get away. It has to be caught in a net before it

gives up and can be brought to safety. The dog tried to protect himself but his

aggression endangered those who were trying to save it.

The people can see by the manner the dog is behaving that it wants to get out of

the water, but it is unable to do so. Its weak efforts betray its tiredness and he

looks dreadful. The people in the boat understand why it is frightened and change

their tactics. As result it is saved.

Their acceptance of its aggression is not something to be taken for granted. A dog

which bites is vicious. People try protect themselves against vicious dogs and get

frightened. Usually their attitude is defensive, they do not try to understand.

If we wish to understand the behaviour of a certain animal we must know something

about biology and animal psychology. He who has no sympathy for animals

will never become a good vet. A deeper understanding is gained by furthering

one’s knowledge. 338

22.3 Conclusion of the example

Sympathy for another person requires knowledge of material and biological conditions

supplemented by a knowledge of cultural conditions. “Sympathy implies

338 Lubbers, Dr. R. op. cit. page 25-26


448


knowledge and insight. Sometimes it is possible to understand with a little previous

knowledge, in cases of the dog in the harbour.

But in cases of women who have been victim of incest request more than

knowledge of water, quaysides and tiredness”. 339 This means that a therapist or a

doctor has to explicit patients the way out of a distressing situation. This requires

specific hermeneutical knowledge and expertise which every therapist or doctor

must possess.



449


Chapter 23 - Schizophrenia and Hermeneutics

A short – trendsetting – casuistry

My recent hermeneutical experience with a schizophrenic person and her contextual

and cultural repudiation

23.1 Lotte, an unforgettable encounter

I

t came to pass.

The reason does not matter.

She was sitting silently. Basking in the sun she treated herself to an extraordinary

amount of chips, meatballs, croquettes with mayo, ketchup, and salt.

Her radiation was like a Parisian tramp and attracted attention.

Bystanders were spending time and gaped at the figure before them.

It was not clear whether it was a young woman or a boy.

I saw their faces and read their thoughts:

"Homeless, junk or regular crazy?"

A wave of anger hit me. "Monkeys, social looking bitches," I thought.

In front of the spectators, I stepped toward her, my bicycle at hand.

Surprised she looked up, her eyes shielded by dark sunglasses.

I held out my hand.


450


"My name is Gideon," I said, loud enough to touch the bystanders and told them

indirectly that I was not afraid to do anything personal, as giving my name to the

"outcast."

"I'm Lotte," she replied.

Her outstretched hand felt like the gesture of a lonely individual, who never experiences

such a spontaneous contact.

The sun was suddenly brighter.

The atmosphere became more transparent.

It was like the singing of the nightingales.

The sound of her voice faded the mental distance from her tramp figure and her

tray, full of unpalatable fast food.

"I'm Lotte!"

Neither a homeless junkie nor an ordinary fool but Lotte who revealed in less

then a second the testimony of her self-awareness.

My philosophical perception immediately told me that this was not a mistake.

“I am” instead of “my name is” Lotte!

The glow on her face betrayed loveliness behind her covered eyes.

All about friendliness.

When I left her, she leaned over and attended her meal, unperturbed, as if there

had been no meeting.

I looked around me. The bystanders were disappeared. Whether it was because of

my earlier glare, or not?

The sun shone on her figure.

Lotte was born in my heart!

I cycled home, wrapped in boundless joy.


451


It should take a long time before the contact with her renewed as a therapeutic

acquaintance.

23.2 Lotte, a Living Human Document

Lotte, a living human document, written in a language for which there seemed to

be no sign available in the universe.

"How can we explain your words?

How can I understand your wordless language?"

Such questions are only to be answered if I am willing to accept the uniqueness of

her private language. Her language: “being Lotte in person”.

I lost the effect-fullness of my standard logic, confronted with her specific cryptic

language. Using ordinary meanings of words and concepts didn’t make sense.

I only accepted Lotte in "respect." I would say nothing more or less than:

"Lotte, I will respect you and your damaged life!"

Since I know a bit more about the content of her life, I encountered undeniably

deep layers, in which "my respect" must be interpreted and experienced by Lotte

herself. Unfortunately, she was labelled by the regular psychiatric diagnostic:

schizophrenia! I really refuse accepting ear tags.

This image shows brain activation and severity of symptoms in schizophrenia patients. Red areas represent regions

related to the severity of speech fluency in schizophrenia. Blue regions represent areas involved in a significantly

blunted ability to experience joy.

Belger Image (image) - University of North Carolina Health Care


452


23.3 Lotte, a schizophrenic young woman and the

Mindlink-system

In spite of the positive confrontation with Lotte, all my questions and resistance

to the diagnosis and the psychiatric concept of schizophrenia lost their negativity

in the light of the possibilities that became true.

Is it possible to recover these damaged parts of the brain by 528 Hz music, connected

with the brainwave-entrainment of Schumann Resonances and the

Mindlink treatment?

Could the Tesla-transformed energetic information (Mindlink Solutions plus 528

Hz music) receive the receptors of the disturbed cell’s, creating a better speech

and more joy in life? Does the vital-emotive body, or the morphogenetic field,

give quantum mechanical energetic opportunities to radiate the damaged parts of

the physical brains?

With these questions Lotte remained an element of surprise to me in my research

of the Tesla-energetic Mindlink-system. A new opening in her closed system became

a matter of fact.

Every little step however is a great matter of joyfulness but calls for longitudinal

research of the Mindlink-system, combined with the music of 528 Hz frequencies,

with the brainwave-entrainment of the Schumann Resonances.

After many encounters and an increasing confidentiality, Lotte gradually lost her

“flat affect”, a main factor in the DSM-diagnosis. She experienced more joy. Her

communication became more personal.

Now we have a big Tesla coil in the vicinity of the test-practice, with the

Mindlink harmonization program, together with the 528 Hz composition. We

placed the coil without her knowledge. It appeared to be a real instrument and an

effective operation. The transformed energy appeared to be a strengthening of her


453


relatively light anti-psychotic medication. Her improvement is proverbial and

visual for everyone who is familiar with her.

What obviously happened? Constantly playing the positive harmonization program

of the Mindlink-system, strictly combined with "Herz", the in scalar waves

transformed compositional complex of 528 Hz, connected with the Schumann

Resonance reached her cell economy and created the noticeable improvements,

without any conscious choice for treatment with the Mindlink-system by herself.

The working of the Mindlink-coil and the music appeared to be fabulous.

It's a miracle that a system energetically creates a dialogical contact with a patient

on an unconscious level by transformative information. Lotte made her disorder

to me as “a specific file”, a challenge of hope, to serve schizophrenic, valuable

human beings. This is a open window for people, labelled as suffering of a degenerative

disease without any constructive treatment, directed to recovery. But

at the moment Mindlink and the composition “Herz” reactivate the selfrecovering

abilities, the transformed information starts, looking for receptors and

ligands, to win the match.

Lotte came in at the moment when the primary part of the research was already

completed, statistics included. But she is however the personification of the hope

that the Mindlink-system - with a moderate change - gives for suffering people.

Lotte’s case relativizes for us the theoretical necessity of acknowledging the scientific

validity of the Mindlink-system. But after the first double blind phase we

didn’t lost the ambition of the fundamental outcome of our research: “scientific

validity!”


454


Chapter 24 - Evolution, Scalar waves and

Complementarity

Evolution, Scalar waves and Complementarity Preparation of

analysis of the Mindlink-system

B

ecause the Mindlink system consists of two streams: music as a signal

factor and spoken language, it is necessary to research the effects and

affects of the genome and the epigenome. We described in the Philosophical

Introduction 3 about a relationship that exists between sound and language,

between energy production (making music) and energy-reception (listening

to music). Listening to music is a receptive process and should not be seen as

passivity, undergoing of music as subject of sound. The human system is very

active in listening, such as fMRI studies have shown. Because the basis for the

natural system involves a permanent active emanation of energy. The human system

is a unit within the nature of the procedural influences, without evolutionary

exclusivity present.

The debate among biologists and musicologists whether or not musicality has an

evolutionary component in the Darwinist model is still going on. What is the evolutionary

importance of music? Does it share in the genetic survival or should we

look for the evolutionary value in the way of Lamarckianism: sound as a binder

on behalf of forming a functional group, in which the survival of genes of the

individual participants of the group are saved?

When music and speech are no longer separated from each other, bounded by

functionality and nothing else, we almost automatically come to the question of

the genome and the genes within these ‘blackbox’ as deterministic responsible for

the development of music and speech? I consciously use speech instead of lan-


455


guage because speech is a "registrable language production", just like music is a

"registrable signal production."

We already pointed to the FOXP2 gene, which occurs early in the evolution of

primates in several different configurations: the various compositions as pathway

to the various proteins which are formed in various systems. Therefore, the

FOXP2 gene of the homo sapiens evolution is not equal to the FoxP2 gene, for

example, of song birds and whale signals in their evolution. The FoxP2-gene

seemingly points to a collective and functional factor: communication.

24.1 FOXP2 and Human Cognition

Our restless species strives ceaselessly to invent ever more useful devices, improve

out of a social system, creating new works of art. Our creative ability derives

from motor, a cognitive flexibility that allows us to form a potentially unbounded

number of new words and sentences as well as skills, art, dance shapes,

and music. It is a fundamental defining attribute of Homo Sapiens that presumably

derives from a suit of neural capabilities, absent or greatly reduced in other

species. The archaeological record, however, reveals few signs of creativity earlier

than 200.000 years ago. 340

We must take into account the changes taking place within the FOXP2 gene, as a

discussion about the auditory hallucinations of schizophrenia, by a possible mutation

on the 7th chromosome. The damages of the DNA-sequences are irreversible

effecting - if indeed a mutation is present on one of the loci of the 7th chromosome

- unless the operation of the Mindlink-system is done. (Distance and referral.)

We are not convinced about the aetiologically genetic source of schizophrenia

and contesting the "irreversibility". The existence of a schizophrenia-gene

340 Lieberman, Philip, Cognitive and Linguistic Sciences Brown University, 2009


456


isn’t obviously confirmed. Therefore, the correlation between language disturbance,

speech disturbance or communication disturbance in patients with schizophrenia

and other communication distortions e.g. the ASS-syndrome, probably

paving the way to the epigenetic chromatin structure and change of FOXP2-gene

and its broad features. 341

Since communication is not free from environmental influences, we must sample

the evolutionary processes and environmental influences, whereon the epigenome

dynamically increased. New biology is exploring the effect of environment on

cellular behaviour.

24.2 Relevance for the Mindlink-system

The attention to the FOXP2-gen and the sound and speech phenomena in the late

evolution (± 200.000 years ago) is relevant for the analysis of the Mindlinksystem.

In short: the Mindlink-system has originated an effective split between speech,

nature sounds and composed music: elementary elements of communication in

nature and nurture.

Because of the very slow change of the genome, the split creates the opportunity

to go back on the stage of the evolution, with strong creative energy inside the

functional cells, with storage of any experience into the epigenome. Because time

is relative and the change of the genome is very slow, the life-experiences, stored

341 Lalmansingh, Alvin S. Science Direct BBA, art. “Multiple modes of chromatin remodeling by Forkhead box proteins”,

part of “Chromatin in time and space”, 2012, quote:

“FOXP proteins, in contrast, function as classic transcription factors to recruit a variety of chromatin modifying enzymes

to regulate gene expression. FOXO proteins represent a hybrid subclass having dual roles as pioneering factors and transcription

factors. (...) The overall diversity in chromatin remodelling function by FOX proteins is related to unique structural

motifs present within the DBD (DNA Binding Domain) flanking regions that govern selective interactions with core

histones and/or chromatin coregulatory proteins.


457


within the cells and the DNA remain active in the unconsciousness as interference

field. New transformed scalar-energy and radiation, emitted from the three

basic elements, tries to de-activate the stored experiences, inherited as damaged

epigenetic structures, at the moment of forming gametes, the precursors of spermatozoa

and ova, carrying the effects of environmental influences, stored in the

epigenetic chromatin structure, as inheritance of the stored life-experiences in the

germ-line. The Mindlink-system generates energetic contra-information concerning

the negative, stored experiences, to recover the disturbed homeostasis, by deactivation

of stored memories.

In Nature we read:

“Cells of a multicellular organism are genetically homogeneous but structurally

and functionally heterogeneous owing to the differential expression of genes.

Many of these differences in gene expression arise during development and are

subsequently retained through mitosis. Stable alterations of the kind are said to be

‘epigenetic’, because they are heritable in the short term but do not involve mutations

of the DNA itself. Research over the past few years has focused on two molecular

mechanisms that mediate epigenetic phenomena: DNA methylation and

histone modifications. (...) External influences on epigenetic processes are seen in

the effects of diet on long-term diseases (...). Thus, epigenetic mechanisms seem

to allow organism to respond to the environment through changes in gene expression.

The extent to which environmental effects can provoke epigenetic responses

represents an exciting area of future research.” 342

For my research, landing on MFD-syndrome with clients of different ages, DNAmethylation

seems to play a major role to stably demarcate by its absence of a set

342 Nature Genetics 33, 2014


458


of embryonically active promoters, namely CpG islands 343 , so that they remain

potentially active throughout development and adulthood. (...) Thus, CpG islands

that are silenced by other mechanisms during embryogenesis would acquire dense

methylation leading to irreversible silencing. When, however, the density of

methylated CpG’s is low, as it is in most of the genome, repression is likely to be

weak and may be overcome by the presence of strong activators. 344

In the cadre of MFD-syndrome we have to research the correlation between prenatal

emotional state and maternal cortisol with methylation state of NR3C1. 345

Here the genome and the epigenome, together with the vital-emotive and/or physical

disorders of the pregnant woman, has received in-formation that gives form

to the potentiality of the “unknown” content. This form is phenomenologically

343 CpG islands (or CG islands) are regions with a high frequency of CpG sites, though objective definitions for CpG

islands are limited. The usual formal definition of a CpG island is a region with at least 200 bp, and a GC percentage that

is greater than 50 % ..., Wikipedia.

344 Shobha Vasude, Emre Seli, and Joan A. Steitz Metazoan oocyte and early embryo development program: a progression

through translation regulatory cascades Genes Development. January 15, 2006 20: 138-146

345 The name glucocorticoid (glucose + cortex + steroid) derives from its role in the regulation of the metabolism of glucose,

its synthesis in the adrenal cortex, and its steroidal structure. A less common synonym is glucocorticosteroid.


459


the complementary of the unknown, like the Copenhagen Interpretation of the

quantum physics as follows below.

The effects between the maternal-distortion and the embryo can be extensive. The

negative energy of the intra-uterine, prenatal stress, manufacturing cortisol, passes

the placenta barrier, activating the generation of cortisol in the embryo/foetus.

The 11β-hydroxysteroid dehydrogenase type 1 and type 2 are converting enzymes

from cortisol into cortisone. When these enzymes are sufficiently available, a

cortisone reductase deficiency is caused with implications on foetal programming

of hypothalamic-pituitary-adrenal (HPA-axis) deficiency, endocrine insults, brain

development disturbances etc. 346 . Anyway, all complementarity of the unknown

starts with the multigenerational genetic and epigenetic history, with the gamete

as stem cell. The hereditary experiences from the passed generations will get the

complementary form, by the energetic information as the potentiality of life. Life

isn’t explainable. We only can research the results of the forming potency of the

vital-emotive or morphogenetic fields as Sheldrake elaborated.

24.3 The gene-expression, the epigenome and the polymorph

foetal programming

I discovered in the third stage of my research the main origin of the foundation of

fundamental uncertainty and concentration disorders.

The womb should be a space of safety, but many times it became a space of unsafety

and of non-attachment. The womb is not guilty!!

346 Cortisone reductase deficiency is caused by dysregulation of the 11β-hydroxysteroid dehydrogenase type 1 enzyme,

otherwise known as cortisone reductase. The 11β-HSD1 enzyme is responsible for catalysing the interconversion of circulating

cortisone to cortisol, using NADH as a co-factor.


460


This will be clear after a short consideration of the quantum physics of Niels

Bohr and Heisenberg as the Copenhagen Interpretation.

First of all, I quote some scholars about scalar waves and quantum physics.

24.4 Scalar waves

Because of the importance of scalar waves and scalar-field inside the Mindlinksystem,

the diagnostics and treatments, I want to deal with these phenomena more

extensively.

I deal with these on three levels:

1 the vision of historical and contemporary scholars, with fundamental

contribution to Mindlink-system,

2 the Tesla-technology and Mobius winded Tesla-coil.

3 scalar waves and scepticism.

24.5 The vision of historical and contemporary scholars

What is a “scalar wave” exactly? 347 A scalar wave (hereafter SW) is just another

name for a “longitudinal” wave. The term “scalar” is sometimes used instead because

the hypothetical source of these waves is thought to be a “scalar field” of

some kind similar to the Higgs Field for example. 348

There is nothing particularly controversial about longitudinal waves (hereafter

LW) in general. They are a ubiquitous and well-acknowledged phenomenon in

nature. Sound waves traveling through the atmosphere (or under water) are longi-

347 Meijl, Prof. Dr. Ir. Konstantin, Scalar Waves, theory and experiment (Congress of German Association for Space

Energy) and quotes of his website (English).

348 Meijel, Prof. Dr. Ir. Konstantin, Scalar Waves, Paper based on the presentation at the Amsterdam Conference of the

Scientific for Science Exploration, 2000


461


tudinal; as are plasma waves propagating through space. Longitudinal waves

moving through the Earth’s interior are known as “telluric currents”. They

can all be thought of as pressure waves of sorts.

SW/LW are quite different from “transverse” waves. You can observe transverse

waves (TW) by plucking a guitar string or watching ripples on the surface of a

pond. They oscillate perpendicular to their arrow of propagation (directional

movement). Comparatively SW/LW oscillate in the same direction as their arrow

of propagation. In modern day electrodynamics, electromagnetic waves (EMW)

traveling in “free space” (such as photons in the “vacuum”) are generally considered

to be TW. But this was not always the case. Maxwell first modelled and

formalized his unified theory of electromagnetism in the late 19th-century.

He only had postulated and calculated the existence of both. Heinrich

Hertz demonstrated experimentally the existence of transverse radio waves in

1887. In the 1889 Nikola Tesla discovered experimental proof for the elusive

electric scalar wave. This seemed to suggest that SW/LW as opposed to

TW, could propagate as pure electric waves or as pure magnetic waves. Tesla


462


also believed these waves carried a hitherto-unknown form of excess energy, he

referred to as “radiant”. SW/LW in free space are quite real.

Beside Tesla, empirical work was carried out by electrical engineers such as prof

dr. ir. Konstantin Meyl. They have clearly demonstrated the existence of these

waves experimentally. These waves seem able to exceed the speed of light, pass

through EM shielding (Faraday cage), and produce more energy out than in. They

seem to propagate in a yet unacknowledged counter-spatial dimension (a.k.a implicit

order, etc.).

Because the concept of an all pervasive, material ether was discarded by most

scientists, the thought of vortex-like electric and/or magnetic waves existing in

free space, without the support of a viscous medium, was thought to be impossible.

Recently Daniele Funaro, Paul LaViolette, and Harold Aspden all have conceived

or/and mathematically formulated models for a free space ether, that is dynamic,

fluctuating, self-organizing, and allows for the formation and propagation of

SW/LW.

Meyl develops a self-consistent field theory which is used to derive at all known

interactions of the potential vortex. Instead of the normally used Maxwell equation,

Meyl chooses Faradays law of induction, as a hypothetical factor and proves

that the electric vortex is a part thereof. This potential vortex propagates scalarlike

through space and is a longitudinal electric wave, whose properties have already

been established a century ago by Nicola Tesla. This phenomenon can now

be studied and examined thanks to a fully functional replica designed by Meyl.

Meyl’s field theory is non speculative and enables new interpretations of several

principles of electrical engineering and quantum physics.

In consideration of environmental sustainability, significant advances result by

means of this revised theory regarding today’s electromagnetic pollution.


463


The presented theory is based on an extension of the Maxwell theory and as such

is a special case scenario that does not affect classic physical laws which remain

in force. 349

Glen Rein, a biophysicist at the Institute of Heart Math, has been working on

detecting subtle energies he calls non-Herzian or scalar energy. Scalar

waves (non-Herzian or Tesla's "Radiant Energy" waves) are hyper spatial vortex

rings in structure, arising from abruptly bucking magnetic fields, winded into a

caduceus (bifilar) coil.

Scalar energy or healing energy has been shown to be not part of the electromagnetic

spectrum as we understand it. (...) Thus explaining the phenomena of both

romantic love and shaktipat, 350 and why we feel elevated and sparked in the presence

of individuals of genius. (...) In Rein’s opinion kundalini energy may have

scalar wave origins, for there is no doubt that kundalini and healing energy are

one and the same. 351

Scalar waves might be the point of fundamental intersection where matter and

consciousness can influence each other. Their effect is independent of distance

and time and is 3-5 times stronger than that of electromagnetic fields. They are

more fundamental than magnetic fields and they transmit information, not energy.

The transmission of scalar information creates consciousness fields which are

probably equal at Rupert Sheldrake's Morphogenic Fields. They cannot be detected

by the usual instruments for measuring electric and magnetic fields, that work

by interacting with electron flow and energy transmission. For this reason they

are still considered theoretical. 352

349 http://www.meyl.eu/go/index.php?dir=10_Home&page=1&sublevel=0

350 Sanskrit of shakti as transferable energy from person to person.

351 http://biologyofkundalini.com/article.php?story=BiologicalRelationtoZero-Point

352 http://www.tfmetalsreport.com/forum/6309/dots?page=296


464


Comment

Rein’s vision about the equation of scalar energy and kundalini belongs to a Hindu

theological vision on spiritual energy. I mentioned his vision because of his

idea of applied scalar waves, instead of the idea that scalar waves are only theoretical

phenomena.

25.6 Scalar waves and scepticism

Why are scientists and scepticists so deeply critical concerning all that can’t be

measured like materialistic empirically research?

Herewith we touch the core problem between the conventional science and the

complementary and alternative medicine? In the Rational Wiki Thomas Bearden

has portrayed as a quack.

The contrast with the scepticists

“The work of three leaders in the search for a new energy source, spanning a full

century, is examined. Nikola Tesla, T. Henry Moray and Thomas E. Bearden,

among others, have claimed the existence of another source of energy besides

those presently in use. This source is the energy contained in apparently empty

space.” 353

Also in Rational Wiki: Scalar waves appear to have broken out into the mainstream

around 2005 or 2006, with this text (now widely quoted as the standard

explanation) from The Heart of Health; the Principles of Physical Health and Vitality

by Stephen Linsteadt. Anonymous quotes:

“Scalar waves are produced when two electromagnetic waves of the same frequency

are exactly out of phase (opposite to each other) and the amplitudes sub-

353 Power Engineering Review, IEEE, Volume:12, Issue 1


465


tract and cancel or destroy each other. The result is not exactly an annihilation of

magnetic fields but a transformation of energy, back into a scalar wave. This scalar

field has reverted back to a vacuum state of potentiality. Scalar waves can be

created by wrapping electrical wires around a figure eight in the shape of a Mobius

coil. When an electric current flows through the wires in opposite directions,

the opposing electromagnetic fields from the two wires cancel each other and

create a scalar wave.”

He ends with: “At this point it was all-in. Scalar waves explain neo-homeopathy,

achieve lymph detoxification, cure diabetes, short sight, kidney stones, Parkinson's,

strokes, arthritis, cancer and reverse the aging process”. Scalar waves are

also part of the biological powers of ORMUS. “Harmonized H 2 O" is a drinkable

sunscreen, made only of pure water, that works by scalar waves. 354

24.7 Defensive voice in Rational Wiki (Talk)

There are two ways to characterize an EM field: by its electric and magnetic field

components (both vector fields) or by its scalar and vector potentials. The potentials

are actually more fundamental than the fields (the Aharonov-Bohm effect is

an example of this), as it is the electromagnetic potential that must be gauge invariant

(both for Lorentz transformations in relativity and for quantum mechanics).

In general, there are problems in physics for which the scalar wave equation

needs to be solved, and there are problems for which the vector wave equation

needs to be solved. At the end of the day though, these two subsets of problems

are mostly disjoint. To say that a "scalar version" exists that is "accurate enough"

is mostly not kosher.

354 Rational Wiki


466


24.8 Safe the communication

Regardless of the unfair criticism due to another way of thinking and perceiving,

I can not halt making some observations to contribute in my humble opinion as

improving the relation between the conventional and complementary medicine.

The qualification and quantification of the available energy in the total (nonlocal)

space is such a complicated matter that we take our responsibility and help

to ensure that there are no extraneous and questionable experiences, where opinions

arise without a single basis, also in a non-scientific framework.

Such untested, at random placed success-stories to promote the truth and reality

of the "personal, healing system", harming the serious improvements of communication

in the medical field. No one has any profit of the increase of distance

between our systems, conscientiously committed to the suffering man.

The Mindlink-system is a system, proven to be as valuable as never to be engaged

with inferior practices. Note: with “inferior practices” I don’t intend any qualification

of dissenting views. Nevertheless, respect is a good thing, but it's much

better to remain respectful-critical, sometimes with a strong “never”, when the

Good Case we serve becomes in danger. This Good Case is the purpose of this

thesis: contribute to an “evidence- and value-based medicine", a way to find “unity

in diversity".

Before I stop with the prepositions starting the statistical part of my research, I

will be a moment with Niels Bohr, the quantum physicist of the Copenhagen Interpretation

of quantum mechanics and his ultimate vision on the completeness of

the quantum mechanics, just the opposite of Einstein, Schrödinger a.o.

24.9 Complementarity of Niels Bohr


467


Probably complementarity is the ultimate answer

on the criticism of scientists as Schrödinger and

Einstein. The latter was convinced that the quantum

mechanics could not be finished, because this

system didn’t found the origin of life. The Copenhagen

Interpretation with Heisenberg’s “Uncertainty

Principle” and the Complementarity of Bohr

couldn’t convince many scientists. It remains unclear

to me why Einstein, who was Jewish too,

didn’t understood the ultimate meaning of Complementarity.

Thereby, he and other scientists are

religiously adepts of Spinoza and his monistic vision of the Divine Laws of Nature.

They should be involved with Bohr because of the forgotten attribute of

Spinoza’s philosophy: his knowledge of the Kabbalàh. In the Kabbalàh we find

strong evidence of the complementarity in the way of Bohr. Every cell, every

organ, every plant, every human being is a representative formation of the information,

present in the unknowable, exceeding our human epistemological abilities.

Bohr discovered in the Holy Texts of Buddha and the Jewish prophets his

inspiration.

Bohr reflected on the relationship between the concepts of quantum theory and

the world of physical phenomena. He accepted the idea that the concept of complementarity

also plays a key role outside the scientific discourse. It contributes to

the rejection of any form of dualism. Therefore, to him the "wave-particle"-

dualism is unsatisfactory. His complementarity teaches us to understand the quantum

physics from a holistic, coherent, non-dualistic description of the physical

phenomena.


468


Herewith Bohr stands on the Platonic heritage with the physical phenomena as

the "representative impulses of the Idea". 355 My research of the "a = 1 field” theory

fits perfectly with the complementarity of Bohr, concerning the unknowable

nature of the invisible world, completely present in the a = 1-potentiality, waiting

for the right conditions to unlock. It is an open question whether after unlocking

the potentiality remains an active idea, or simply a model. It gives to me the same

problems as the morphogenetic fields of Sheldrake. If we give up our individuality,

with only “collectivistic thinking” we could accept the physical reality as a

representation of the non-physical reality. In the language of quantum mechanics,

it is comparable with locality and non-locality.

The content of complementary in mankind is the impossibility to exist without

one another. This phenomenological connection protects the entire mankind in

order not to fall into duality. Here I am on the familiar ground, running as a red

thread through my research: the unity of a = 1 can not be broken. Complementarity

as proposed by Bohr fits my formula that governs the relationship between

a abs and a rel . Here we unlock a new equation between Hebrew numerical values

and physics.

24.10 End of the presuppositions

Mindlink has developed a system of energetic differential diagnosis and energetic

treatment. The dialogue with the inner consciousness is the most fundamental

process we ought to wish. The aim of the Mindlink-system is being reasonably

355 Plato, Timaeus


469


and systematically directed at the restoration of the heterostasis 356 , allostasis 357,

homeostasis 358 and epigenetic balance 359 .

These four system elements are all active inside Mindlink, but in an energetic

way, solving blockages and de-activating unconscious stored experiences, even

epigenetical experiences, coming from the multigenerations of the past. The four

mentioned core elements have made Mindlink a universalistic system, in order to

serve other types of medical treatment, to lay a new, stabilized foundation under a

destabilized life of the patient, the hermeneutic encounter included.

24.11 After the first parts of my research, I postulate:

Mindlink-system is in many aspects an energetic broad spectrum-system,

strengthened with 528 Hz music as my research praxis has evidenced.

The Herz-composition of Polak is expressively strong, because of the foundation

function of the attracted and entrained frequencies, transformed by the Teslatransformational-technology,

which transports the positive, energetical information

as electric scalar-field, in-formation carried by magnetic waves. Tesla’s

radiation creates an “in-formation-consciousness field”. The scale of affirmative

solutions of the Mindlink-system transfers the information by “brainwave en-

356 Heterostasis is functional salutogenic ability and resilience by self-confidentiality. Being balanced in situations with a

claim on remote control is a ‘tour de force’ to someone who is suffering at fundamental uncertainty caused by the disturbance

of the “adaptogenic capacity”, a polymorph pathogenic effect of Foetal programming (MFD-syndrome, legally for

the other note’s).

357 Allostasis: our physical organisation reacts pathologically on unavoidable situations, without any possibility to escape

alive. Fundamental unsafety instead of the womb as place of certain attachment. This can also be an effect of Foetal programming

as coming from “outside” during the Foetal growth with “allostatic loaded stress”, and other pathological and

psychopathological remaining effects, as high blood pressure, cardiovascular diseases, schizophrenia and ADHD.

358 Homeostasis: physiological and mental disturbances of the inner balance ask for treatment (energetical and/or with

medication) to recreate the balance with a change on recovery of disease or mental disorder.

359 Epigenetic balance: the disturbance of life by multigenerational inheritance mostly starts with the procreation, by

which the male gamete functions a stem cell to carry over the genome and epigenetical genome and their effects (DNAmutation

or epigenetical information).


470


trainment”, with the epiphysis, the “glandula pinealis” as antenna. 360 This gland

seems to receive and coordinates internal and external frequencies: internal pulses,

coming from the CNS and hormone system, external pulses, coming from

outside, like the transformed information as electric pulses of 528 Hz music, the

Mindlink harmonisation program and spoken affirmations – rhythmic, pulsing

frequencies of the Mindlink solutions also. These pulses permeate the brains and

the entire cell-system by this special gland, the “small gland” of Descartes as the

settle of the soul, the start of his dualism.

360 http/www.stamcel.org/html/epifyse.htm


471


Chapter 25 - Epiphysis, synonymous of

the Third Eye

25.1 Glandula pinealis or Epiphysis

I

n order to create insight in the working of the epiphysis, concerning the “antenna

of external pulses” we must analyse the name and function of the

glandula pinealis. 361

Image Dreamtime

The pineal gland, also known as the pineal body, conarium or epiphysis cerebri,

is a small endocrine gland in the vertebrate. It produces melatonin, a serotonin

derived hormone, which affects the modulation of sleep patterns in both seasonal

and circadian rhythms. Its shape resembles a tiny pine cone (hence its name), and

it is located in the epithalamus, near the center of the brain, between the two hem-

361 Small text WikiPedia


472


ispheres, tucked in a groove where the two halves of the thalamus join. The results

of various scientific research in evolutionary biology, comparative neuroanatomy

and neurophysiology, have explained the phylogeny of the pineal gland in

different vertebrate species. From the point of view of biological evolution, the

pineal gland represents a kind of atrophied photoreceptor. In the epithalamus of

some species of amphibians and reptiles, it is linked to a vestigial organ, known

as the parietal eye which is also called the third eye.

René Descartes believed the pineal gland to be the "principal seat of the soul" (a

mystical concept). Academic philosophy among his contemporaries considered

the pineal gland as a neuroanatomical structure, without special metaphysical

qualities; science studied it as one endocrine gland among many. However, the

pineal gland continued to have an exalted status in the realm of pseudoscience

25.2 Pseudo or altered science?

Altered visions on the image of man, the change of the Cartesian and Newtonian

“man as a machine”, object of science, have also opened new appearance on the

function and composition of the human being and his bodily composite.

All is energy! All is radiation! In the language of Bohr: the human body is part of

the holistic complementarity. The entire human individual is built up by billions

of cells, with specific functions, collected in the organs and moving-apparatus.

We already wrote about the capability to receive external pulses, frequencies. The

ultimate question is: “What kind of antenna is responsible of receiving external

frequencies and brainwave-entrainment?”

We try to imagine what happens concerning of external pulses. In the ancient

world the “seer” was an authority. He or she could see in the invisible world. This

special “eye” has got an esoteric meaning, placed between the two eyes. May be

in the past we could have been a human being with only one eye, who in the evolution

has splitted into two eyes and afterwards the first eye, in the middle of the


473


forehead, has closed. The small gland in the middle of the brains, centered between

the two hemispheres, was then unknown. The only explanation in ancient

times was the spiritual explanation. Nowadays, specialists still don’t know for

sure the meaning of this small gland. I quote:

“The pineal gland is a structure that lies behind the third brain chamber. The

function of this "small organ" is not clear, but it is thought, by analogy with other

species, it plays a role in the "biological clock".

With this, we take a big jump to modern times, the time of Bohr and the complementarity.

If complementarity is true – and I accept this – all glands have a complement

in the unknown reality: so the epiphysis too. The complementarity and

the functionality applied to the epiphysis ask for evidence of being the antenna of

the brainwave-entrainment. The double function (generating melatonin and receiving

external frequencies) must be proved, but how?

25.3 Epiphysis and crystals

Exploratory experiments also show that the pineal gland is sensitive to noise.

Sound is quicker registered by the pineal gland than by the nerves which form the

hearing sense! Further research should follow.

Another interesting discovery was the presence in the pineal gland of crystalline

spheres (brain sand) in the size of 100-300 nm. These crystals are found to consist

of calcite, apatite, and magnetite. The first two substances are also found in bone

tissue. Magnetite is an iron-containing crystal with magnetic properties. The crystals

are piezoelectric. This means that under mechanical pressure an electric field

can be created. This probably explains the reaction of the pineal gland on sound

as pressure waves, pressure fluctuations on the crystals.


474


26.4 What about the Greek meaning of epiphysis?

The only way we can follow is the linguistics. We analyse the Greek word “epiphysis”.

The prefix “epi” we meet also in the term epigenetica, with the meaning:

epi – as surplus thus: “added to genetica”. We see “epi” and “physis = phusis” =

physical nature. So epi-phusis means “added to nature”. The epiphysis complements

our physical “pineal gland” (local function) with the “phenomenon of contact”

(antenna) on behalf of the unknowable Source, radiating into our system,

received by ligands on the cell membranes.

At the end of this explanation we have meet three terms:

Source (Nye - ayin)

Eye (Nye - ayin)

Connection (ladder - Mlo – sulam – symbol of DNA)

With these terms I comes to the Hebrew language and the numerical values of the

three terms.

In the first place all terms have a major value of 130.

The Hebrew word Source is value-synonymous of Eye.

The third term Ladder (Mlo – sulam) is value-synonymous of Source and Eye.

The Ladder needs a little explanation. In the dream of Jacob, he sees a Ladder

from the earth into heaven. Angels climb up from the earth and down to earth

again.

So the ladder (Mlo – sulam) is the instrument of the connection between Heaven

and earth. In many cultures the ladder and the snake are symbols of DNA .362

Mlo – sulam also has a numerical value of 130. So it is a beautiful composition.

362 Narby, Jeremy, The Cosmic Serpent, DNA and the Origin of Knowledge, Geneva, 1995, passim


475


The three terms we found has a communal meaning of energetic transcendency.

Thus the ‘epi’ of ‘physis’ is more than a physical little organ. It seems to be the

antenna of the external incoming energy, pulses and frequencies. The regulation

task of the epiphysis is steering the frequencies and entraining the different pulses,

connecting the extreme low frequencies (ELF) of the brains, Schumann Resonance

and the cell receptors in our energetical bodily system.

(Image with permission of Librero Netherlands)

25.5 Energy is radiation.

The radiation energy seems to go forwards to the prefrontal cortex, more specific

to the orbitofrontal cortex in the middle of the eye sockets. These low-frequent


476


energy, emerging through the center of the forehead, can temporarily be disturbed,

e.g. by touching with a finger or thumb.

This is the entrance activity, starting up the Mindlinktest. The test-structure and

the proceedings of the test has been based on the radiation I explained here, without

using the ancient idea of the Third Eye, in a spiritual sense.

The image of eastern Yin and Yang, combined with the Jewish fig-tree as symbol

of the Tree of Life, stand for consciousness (Yang) and unconsciousness (Yin).

The radiation, coming by the epiphysis, stops flowing for a while at the moment

we touch the forehead between the eyes. A fundamental change happens, registrated

by the specific Mindlink-system (see below).


477


Chapter 26 - The Mindlink-system: technical

research and report

I

t is clear: a scientific validation research must agree to the normative scientific

standards, concluding to scientific validity.

What is the value of the outcome: “Mindlink is a scientific evidence- and

value-based system?”

My personal view is: in the “struggle for recognition” between conventional and

complementary medicine, we can’t win the struggle on our own, but we want to

be trendsetters on the way of reconciliation, with trustworthiness for our patients

and clients as an imperative.

Are biophysical and rational science important for a complementary/alternative

medical system? In my humble opinion I think: Yes.

Feeling (vital-emotive activity) follows Ratio (logical-mind activity). When feelings

should dominate the ratio we enter the field of psychopathology. Herewith

we have found a natural law and order: Feeling follows Ratio. In cosmological

sense we agree with David Bohm and his Implicit Order and also Heisenberg

with his Central Order. The same order is active in the human system. The inescapable

conclusion out-of this natural law is: the judgment of the trustworthiness

of a medical and therapeutical system can never be pragmatic like: “It works,

because of the patient’s positive experience!” Here we touch the necessity of a

theoretical upgrade, explicitly what’s the best understanding of the patients complains?

We stepped on the terrain of the hermeneutics.

I already wrote about the hermeneutical problems of understanding; the key on

the lock of the existential life-story. In the implicit order of research the experi-


478


ence is clear. The experience can’t be examined only because the experience as

phenomenon is personally and consequently not repeatable even if the differences

are to close to call. The cause of this matter is categorical and change is a constant

factor because of the dynamic character of the human existence. Therefore

the object of research isn’t the experience only but the theory of the experience

and the structure of the experience. The basic-structure of the Mindlink-system

wants to comply both of these requirements. Nevertheless, the Mindlinktestpraxis

emphasises an individual and strictly personal approach. That however still

results in a changing outcome, causing a systemic equation. Comparable individual

solutions are excluded from a scientific description because of differences and

the emphasise on the repeatability, one of the stronger requirements for acknowledgment

of scientific validity.

26.1 Mindlink-system, a sociological model

In a sociological sense it is impossible to count unique people, without stripping

their loner munity. In medical and therapeutic terms does it mean a group treatment

is possible, but not before founding a equitation denominator based on the

confluence of the complaints. So we have to collect a group of patients with the

same symptoms. After this sociological and fundamental decision, we can start a

group dynamical treatment and treating the disorders or complaints.

To be treated individuality the patient has to leave the group, stopping participation

within the collectivistic experiments. The consequently sociological conclusion

must be: actually any research and treatment is an n=1 research. In a small

investigation of a n=1-structure – like the case of Lotte – the outcome touches

only the single participant, excluding any generalisation.

Is this sociological approach the moment of breaking down any possibility of

repeatability? This depends on the definition of repeatability, as we shall see.


479


26.2 Repeatability

Repeatability or “test–retest reliability” 363 is the variation in measurement, taken

by the same instrument, the same item, the same conditions, and a fixed period of

time.

A “less-than-perfect” test–retest reliability causes “test–retest variability”. Such

variability can be caused by, for example, “intra-individual variability” and “intra-observer

variability”.

A measurement may be said to be repeatable when this variation is smaller than

the pre-determined criteria, with in other words: differences to close to call.

Test–retest variability is practically used, for example, in medical monitoring of

conditions. In these situations, there is often a pre-determined "critical difference",

and for differences in monitored values smaller than these critical differences,

the possibility of pre-test variability as a specific cause of the differences,

may be considered in addition to e.g. explicities of diagnostics and treatments. 364

26.3 Repeatability within my research

Repeatability can be mentioned “manifest” if we find similar test-patterns, with

comparable outcome, obtained under the same test conditions, acts and equal variability’s.

Forasmuch the statistical elaboration needs some fixed pillars.

Only by sufficient statistical notions we can conclude the repeatability of the system.

The starting point of the Mindlinktest is the dominating “specific file”,

which shares the general information of the computer database and the individual

disposition. The general opening-file is the oppositional statement “I am com-

363 The Research Methods Knowledge Base. Last Revised: 20 October 2006

364 Fraser, C. G. and Fogarty, Y. Interpreting laboratory results”, BMJ (Clinical research ed.), 1989 (re-edited by me).


480


pletely healthy”. In order to create a specific group, we have to add – concerning

the group identity – a second specific file. In our research the second specific file

is the oppositional statement: “I am certain of myself and I can concentrate myself

very well”. The test system is now locked on the personal connection with the

general information of the database and opened creating the scalar-field of unconsciousness

by the Tesla-transformational technology.

To receive a positive conclusion about the repeatability of the Mindlink-system it

is necessary using similar skill’s concerning the diagnostical part (negative

blockages) as well as the treatment part (positive solutions).

While maintaining the individuality of the client (testee) and his or her personal

reactions, it is inevitable to use the acquired expertise as researcher (tester). The

choice of using the specific skills (structure of the test and content of the

Mindlink-database) depends on the decision of the researcher, only in order to get

comparable test material. The comparability of the generated material opens up to

the possible conclusion: effective repeatability of the system on a n=>1 system.

Outside the research group patterns, the Mindlinktest remains the character of

n=1-system, the principle approach of the Mindlink-system.

26.4 Structure of research

Investigation of the scientific nature

A short consideration on: “What are the testing criteria of the scientific nature

and validity of a system?”

Primary normative criteria of scientific research:

double-blind

randomized

placebo-effects

focus group

control group


481


528 Hz-group (specific added element in this Mindlink research) repeatability

Secondary criteria:

academic freedom of research

being free of existing practices and conventions

independency

Two assistants organized three groups, without any familiarity to the researcher:

1. a focus group (mindlink test solutions)

2. a control group (placebo)

3. a 528 Hz group (grains with transformed 528 Hz-music only)

Gideon’s Theorem:

The Orchestration Factor of Repair

About the Technology of Mindlinktest

We divide the structure and result of the test over three compilations which are

put into action in the Mindlinktest-system:

1. the combination of 30 different affirmations, as a resonance on the complex

tender to the subconscious of the patient – by the use of per text-to-speech, computer

output of recorded sentences, with a positive or uncluttering energy (content),

2. the combination of various fragments of music and

3. the combination of – evolutionary relevant sounds like sounds of birds, whales,

the ocean, frogs and other sounds.

After the effectuation of the above three combinations and the storage of the positive

resonances the test has ended and the gathered information has to be intervened

with the subconscious of the patient of client. Hence the storage of the test


482


is a storage of auditive information, it is in its whole played simultaneous and

auditory. The result is cacophony of sounds that has lost every structure and harmony

at the conscious, auditory, level. The next action done is to make a connection

with the Mindlink Tesla coil with its Mobius winding for the purpose to create

a scalar field of the conscious as carrier of the information, previously notable

as a test result that could be measured. After the transformation of the previous

auditive information a scalar field is formed on which no proper measurement

can be adjusted. Even so the non auditive information after the transformation to

a scalar field remains intact. For quantum physics not only teaches us the entanglement

of particles, but also the occurrence of annulation of particles. When we

see the result of the test (information) as a combination of colliding particles like

phonons e.g. 528 Hz and photons e.g. 528 Nm, the result is an annulation of the

particles, non detectable anymore. Note that waves are represented as particles.

This is a choice of one of the two most often used descriptive forms of physics,

that is waves or particles. In analogy with the quantum vacuum the particles are

still existent. The storage of this ‘formless information’ takes place in the molecular

structure of the saccharide which hosts the information for some time. When

the saccharide dissolves the formless information gets liberated and effects, connects

to the ligands and receptors on the cell membranes and nuclei, located within

the subconscious as a memory of experiences. Through the interaction of the

positive information by the test, the transformation, storage and intake of the saccharide,

the stored experience has lost its spin by this intervention. The deactivation

of the negative experience is a fact. Through the deactivation under the influence

of the “Orchestration Factor of Repair” the ability of self healing increases

linearly and the homeostasis can be repaired with possibly healing as result. The

structure of the test remains of important meaning concerning the music, recorded

spoken text and evolutionary active sounds. These structural requirements should

be stressed, put forward. For the music does it mean good structured music: counterpoint,

harmonic and melodic. The impact of the structure of the composition


483


exceeds the esthetic and emotional aspects of the music because restoration of the

homeostasis requires obviously a firm structure. My recommendation is to look

for mathematical music, like the tradition of the Partimenti Napolitano, the

school of figured bass: basso fugato, basso vocalis and basso continuo, with,

among other things, the Inventions of J.S. Bach form a good example. No accent

on the emotional, esthetical and ecstasy like new age music and comparable

forms, but emphasizing the structures of the music are effectful elements for music

in the way of the Tesla-technological “Factor of Repair” disorders on any level.

The fragments of composition in the appendices from Mathieu Polak, based on

the Hebrew therapeutical words and terms, with specific frequencies, analyzed by

me are preparations to mathematical and physiological forms of music as a cradle

for recovery and healing.

26.5 Mindlink Technical information

Before starting, all participants received the same, but minimal technical information

about the content of presentation, working of the Tesla-coil, the content of

the database, and the armlength-reflextest (kinesiology as part of the Mindlinksystem,

also a part of research).

The very most important information is: “How does the system create a dialogue

(interference) between the

scalar-field, created by the

Tesla-system and the energy

of the cells in the human

system?” These energetical

results we test with, making

a sample of the outcome.

The outcome of this energetical test at the end we are playing these ener-


484


gies by the Tesla-coil stored into tubes with grains of sugar (Globuli). These

grains of sugar give temporarily molecular space, so the tested energy outcome

will be stored between these molecules of sugar (saccharide).

Technical Remark 1

Analysis of storage of test-information

A grain of saccharide in the glass-tube placed on the Tesla-coil, with on the computer

screen the notion: “test solutions is playing” is subjected information recording.

saccharide

Within the chemical structure of a lump of saccharides a change takes place, induced

by using a Tesla-coil. The Tesla-coil is driven by information from elsewhere.

The foreign element is the information coming from the compute, the

stored test-solutions. The change in the grains of sugar that takes place, is an increase

in the molecular order, that is the arrangement of all or at least many of the

individual saccharide molecules - globuli in the glass-tube - as a whole lump of

saccharides.

After a time period, the increase of molecular harmony will be lost, that is, the

information - stored in the globuli in the glass-tube - disappears. Why? Due to

very small kinetic movements on the molecular scale of the individual saccharide

molecules.


485


After taking the grains with the stored information (energy) the sugar melts and

the information is released, going its specific way through the human system taken

in by cell-proteins, receptors and ligands. 365

26.6 Description of the method

The method of research is connected with the method of the Mindlink-system:

gathering anamnestic information via the test-action.

After finishing the test, we have generated a lot of anamnestic data coming from

interfered unconsciousness of the client.

26.7 Hypothetic-deductive method

Instead of the medical and therapeutical practice, which on beforehand needs the

story of the patient as anamnesis, to come to a diagnosis, starting a treatment, the

Mindlink-system has the opportunity to collect the particularities, organizing the

complaints on an unconscious level, by testing as described shortly above.

The sparse data at the beginning of the testing research will be extended, leading

to the affirmation of the origin of the fundamental uncertainty and concentration

disorders, which were hypothetically present. In a deductive way we will assemble

the data by testing the internal consciousness.

This hypothetic-deductive method depends no longer on the professional choices

we make in the classic differential diagnostics.

365 Albers, Bruce a.o. Essential Cell Biology, Garland Science, 2014. Image: Google Images


486


In sum

The content of the hypothetical deductive method is: to collect data by deduction

of the whole case. The Mindlink-system affirms in a technical sense the usefulness

of this methodology. Interference is effected by the scalar waves, moving

between the data of the system (Mindlink-Tesla-transformation coil) and the energy

waves of the cell economy of the human system as such.

"With the Mindlink coils, according to Tesla, we are involved to enable rapidly

dismantling internal blockages. Both stress symptoms, as well as mental and

physical discomfort are reduced or completely dismantled by this method. This

works by the so-called scalar wave technics with various embodiments of the

coils which are used. The scalar waves are no longer perceptible to the external

auditory sense and adjust according to the definition of modern "vacuum physics"

as a potential energy, "so the possibility makes the difference". With by the

Mindlink Tesla coils an informed scalar field is built up and transmits the positive

energy resultant directly into the subconscious, but doesn’t involve conscious

perception. That's why we do not hear anything when the coil is processing, but

however we quickly feel an invigorating, ordering effect." (German original text

in the footnote.) 366

Technical Remark 2

Armlength-reflextest and interference

366 www.mindlink.info: “Mit den Mindlink Spulen nach Tesla wurde eine Selbsthilfemethode entwickelt, die rasches

Abbauen innerer Blockaden ermöglicht. Sowohl Stresssymptome, als auch seelische und körperliche Beschwerden werden

durch diese einfache Methode vermindert oder ganz abgebaut. Dies funktioniert durch die sogenannte Skalarwellentechnik,

die mit den verschiedenen Ausführungen der Spulen zur Anwendung kommt.

Die Skalarwellen sind für den äußeren Gehörsinn nicht mehr wahrnehmbar und stellen laut Definition der modernen

„Vakuum-Physik“ eine potentielle Energie dar, „mit der Möglichkeit, etwas zu bewirken“. Mit den MindLINK-Spulen

wird ein informiertes skalares Feld aufgebaut, das die entstehende positive Energie direkt in das Unterbewusstsein

überträgt, ohne die bewusste Wahrnehmung miteinzubeziehen. Deshalb hören Sie nichts, wenn Sie die Spulen benutzen,

verspüren aber rasch eine belebende, ordnende Wirkung.” (Quote website Mindlink).


487


We test the reaction on interference by the armlength-reflextest. 367 This phenomenon

is the central element of the Applied Kinesiology, in use with the Mindlinksystem,

coming from e.g. Klinghardt’s Psycho-Kinesiology ,368 and the Clinical

Kinesiology of A.G. Beardall and his biocomputer-modell. 369

The positive resonance – tested by the armlength-reflextest - will give us a “Yes”

on the system and the answer is stored on the specific screen. We descent into a

deeper level, waiting for new positive information. If there is a dissonance the

answer is “No” and we leave the item continuing to the next subject matter.

By this process at last we find the material giving us knowledge and insight in the

internal consciousness of the patient, without any specific questioning of the therapist/tester.

367 Lechner, Dr. Joh. “Störfelddiagnostik, Medikamenten- und Materialtest” I und II, Münich, 2000 and “Armlängenreflex-Test

und Systemische Kinesiologie”, Freiburg, 2003

368 Klinghardt, Dr. D. Lehrbuch der Psycho-Kinesiologie, INK, 2013

369 Lechner, Dr. Joh. Störfelddiagnostik II, page 16,17


488


26.8 Central aim of Mindlinktest-system

The central aim of the Mindlinktest-system is: to come to a dialogue with the

internal consciousness! This also means an energetic connection with stored experiences,

even from the pre-conception level, because of the stem cell developments

of the gamete, before it became sperm and ovum. The start of this process

of development includes the multi-generational experiences belonging the epigenetic

inheritance. The research on the off-spring of parents with PSTDexperiences

(children of holocaust survivors and other victims of WWII et.al.

disasters, individual and collective) has opened the effects of prenatal HPA-axis

deficiency and other distortions.

The Mindlinktest-system can be positively involved in researching and treating

these pathology by the specific energetic system, because of the de-activation of

blockages of vital-emotive life-expression (see below).

After an increasing

conviction in a

later stage of my

research, I hypothesised

the unconsciousness

as an

“open vitalenergetic

system”

in-formed 370 as an

“energetic raster of remembrance of experiences, stored by DNA-methylation and

epigenetic-chromatin”.

370 In-formed has the original meaning of “to give form from within”.


489


Technical Remark 3

Lock-in of setup and specific file

This is a short summary of the extended explanation above. The Mindlink-system

starts with the Setup, touching the fore-head. What happens at the moment I

touch the forehead with my forefinger and thumb, moving the thumb between the

eyes towards the hairline?

I did extended suggestions for a rational explanation, open to other visions as the

chakra-vision and the Third Eye. As I made clear, I rather look for a more rational

explanation, depending on the axiom: all is energy, sharing the meaning of Tesla:

all is radiation!

This opens a way of two energetical-radiation directions: irradiance (inside) and

eradiation (outside) in a constant, mutual process.

Touching the center of the forehead between the eyes, and moving the thumb vertically

from the center unto the hair line, this should be the moment we break

through the eradiation of the extreme-low-frequent (ELF)-energy emerging from

the orbitofrontal cortex: a while, but long enough to registrate the effects by the

armlength-reflextest. Adjacent we test the percentage of unconscious tension,

pressing on the entire system in general.

By the setup-test, the general information of the database has been personalized,

because of the private information revealed by the internal consciousness of the

patient, stored into the computer system as storage medium. 371

26.9 Setup, percentages and comparability

371 Much technical information is available in the technical and informative publications of Dr. Joh. Lechner. It doesn’t

make sense to repeat information of all he has written down in his scrutiny scholarship.


490


The start of the test begins with a switch-test with a check of the absence of

“switching”. Yin has to be Yin and the opposite Yang has to be Yang. In other

words the arm length reflex-test functions as a computer screen with a “Yes” for

the “equal length of both arms” and a “No” for the unequal length of both arms”.

Concrete: the test on switching tells us by the equal arm length reflects a “resonance”

and by the unequal arm length a “dissonance” as reaction on the started

“Tesla-scalar-transformation-information”-process, working as an interference

between the energetic disposition of the entire cell-economy. In cases of switching

the Mindlink-harmonization program helps to correct this phenomenon. After

the correction with the Setup the test starts.

The standard setup for our research is I am completely healthy. The internal consciousness

creates a unconscious tension because nobody is completely healthy.

But nobody is completely unhealthy as well. By this setup the system creates an

internal opposition between I am and I am not. The negative energetical tension

between “I am and I am not” is measurable by the armlength-reflextest, the fixed

measurement instrument of the Mindlink-system. 372 In the image below we see a

test result of 70% negative energetic pressure on the entire bodily-system. 373

372 During the research period I tried to research may be there is a less subjective, a digital alternative of the reflex-test. I

tried to realize a kind of EEG-test, with monitoring by advanced software. But neither the hardware, nor the software did

what the patient did by his concrete reaction of the reflex-test. I thought it was the weakest link in the chain, but just the

opposite was the definitely fact.


491


26.10 A glimpse over the test structure

After the setup and check of the general pressure on the entire bodily system, the

test continues without any choice of the researcher. The starting point is “blockage

of physical dynamics”. After resonance by the arm length reflex-test the

header (+) opens into sub-blockages. If we get a dissonance the next header must

be opened.

After each resonance on the sub-blockages, these blockages ought to be transported

into the right screen, the Selection: Blockages.

After opening all the headers and testing the sub-blockages, transported into the

right screen, the test of negative blockages has finished, confirmed by the resonance

on the last element: “End of blockages”, the final momentum for this test.

For more technical and practical information see the online Mindlink publications.

373 The term “bodily” means here the complete human-system (physically, mentally etc.).


492


Technical Remark 4

Repeatability and statistics

As I earlier described concerning the conclusions of the research and the factor of

repeatability, it is insurmountable to organize - on behalf of the groups - with the

same specific file (in this dissertation: fundamental uncertainty and concentration

distortions) in a similar structure, using the same tools, over an equal time period

with a same dosage of globuli. Thereupon I will sketch the following systematic

structure:

First test

Time and again the same order of the test-structure:


493


negative blockages: open test with a maximum store of 7 blockages as negative

energetical symptoms;

solutions with three tools: 1. sounds of nature, 2. music and 3. basic affirmations

ending with test check of “end of blockages” c.q. “end of solutions”

always a resonance at the end for every participant

hermeneutical analysis in response to the test outcome

fixed time-period between the tests (4 weeks)

same dosage of the individual test-loaded grains, after the first test

(3 grains, 3 times per day for every participant)

Second test

Evaluation of first period:

evaluation about the period after the test (personal experiences of effects)

re-test in the same open way of the first one (free reactions)

solutions with the same three tools

After the second test the dosage of the new grains changes into a personal need,

checked by a dosage-test, the same as usually.

Final contact

Evaluation and treatment advice after two tests with two choices:

to stop or a follow up in a basic treatment of 6 months.

(After finishing the basic treatment a new choice has to be made, connected with

the symptomology, many times the start of MFD-syndrome.)


494


Chapter 27 - Statistical Report

27.1 Statistical report of fundamental research and practical

observations

P

rotocol 1. Validity Test (system centered)

Not the client, but the system is the primary starting point over here. To

this starting, we opt for a far-free access of research, based on the recognition

of the research setup: "Fundamental Uncertainty and Concentration Distortion".

We worked with three groups: a focus group, a control group and a 528

Hz group in a double blind and randomized, academic required researchsystem.

The standard Mindlink setup we have added a paradoxical setup "I am sure of

myself and I can concentrate very well."

Overview most of scored blockages tests 1 and 2

(period: October 2013 – December 2014)

Regeneration

I am

Superego

Loneliness

Guilt

Emotional block

Remote control

Psychological dependency

Original family (intergenerational epigenetic inheritance marker for MFDsyndrome)


495


Total Participants 91: divided into three groups

Focus Group: 30

Control Group: 31

528 Hz-music Group: 30

participants per group

100

90

80

70

60

50

40

30

20

10

0

91

77

30 28

31 30 28

21

10

2

2

group 1 group 2 group 3 total

14

total balance drop out

group 1 group 2 group 3 total

total n=30 n=31 n=30 n=91

balance 28 21 28 77

drop out 2 10 2 14

Explanation

1. 91 individuals are participants of investigation

2. 14 early drop-outs based on personal reasons

3. 77 individuals finished the first stage research

4. The statistic standard is n=91 individuals unless otherwise noted

5. Participants selected into three groups, without any pre-selection


496


Group 1: focus group

Complete test, globuli loaded with test-information,

transformed by Tesla-technology

Group 2: control group

Complete test but placebo (empty) globuli

Group 3: 528 Hz music group

Complete test, but globuli loaded with 528 Hz music only.

6. Dosage

The first stage dosage is equal to everyone because of the statistics

The second stage dosage is personal tested and differs par participant.

Report of results Protocol 1

General Overview of Tables (see Tables in Appendices)

Explanation

This General Overview of Tables is important in order to create an overall insight

in the detailed Tables in the Appendices.

The Explanation scores Music and sound of nature formed the general part of the

solutions in the first degree. Secondly we placed in this frame the most of scored

blockages.

In the Specificity Tables we elaborated the details of the tests and the scores on

the diversative blockages and solutions per group, per male/female division and

people as drop outs before ending the test period. The reasons are personal.


497


80

70

60

50

40

30

20

10

0

66,67

20

20

6

13,33

4

2

result group 1

6,67

0 0 0 0

absolute number % (30 = 100%) absolute number % (30 = 100%)

all

drop outs

improvement stagnation deterioration

all

drop outs

% (30 = absolute number

100%)

% (30 =

absolute number 100%)

improvement 20 66,67 2 6,67

stagnation 6 20 0 0

deterioration 4 13,33 0 0

Explication Group 1

The improvement of 66,67% in the Focus Group can be seen as a high result.

This improvement has been affirmed by the personal experiences of the participants

(see Casuistry).

The stagnation points to the status quo, with no change in measure and personal

experience. The percentage of 20% must be seen as meaningful.

Deterioration is a minority in Group 1. Deterioration is too vague to describe.


498


result group 2

90

80

70

60

50

40

30

20

10

0

80,65

32,26

25

16,13

10

5

1 3,23

0 0 0 0


all

drop outs


all

absolute

number % (31 = 100%)

drop outs

absolute

number % (31 = 100%)

improvement

25 80,65 10 32,26

stagnation 5 16,13 0 0

deterioration 1 3,23 0 0

31 100,01

Explication Group 2

Participants group two placebo group

The result - in terms of proportions – is not significantly different from the other

two groups. It became actually interesting concerning the number of drop-outs. It

is striking that 32,26% drop-outs of the research are within this placebo group, in

contrast with the remarkable clear improvements. Looking to the improvements

(25) we see 40% drop-outs (10).


499


result group 3

80

70

60

50

40

30

20

10

0

73,33

26,67

22

8

6,67

0 0 2 0 0 0 0


all

drop outs


all

drop outs

absolute

number (30 = 100%)

absolute

number (30 = 100%)

improvement 22 73,33 2 6,67

stagnation 8 26,67 0 0

deterioration 0 0 0 0

30 100

Explication Group 3

Participants group three: 528 Hz music

Most prominently in this group is the high score of improvement with none deterioriation,

and only two drop-outs. The effect of 528 Hz on the disorders is very

positive, derived from the sense improvements, indicated by the participants. The

dissertation has elaborated the causes of the qualification on improvement: stability

in an uncertain existence.


500


Overall Results of Protocol 1

overall results

80

70

60

50

40

30

20

10

0

73,63

67

19 20,88

10 10,99

5 5,49 4 4,4

0 0


all

drop outs


All participants

Drop outs

absolute

absolute

number % (91 = 100%) number % (91 = 100%)

improvement

67 73,63 4 4,4

stagnation 19 20,88 10 10,99

deterioriation

5 5,49 0 0

91 100

Explanation

As a provisional evaluation of the scientific research it’s remarkable that in

Group 2 – the placebo group – after the basic treatment of 6 months or earlier –

has the most drop-outs, unless the improvement they noted in the beginning. That

means: the placebo effect activates the self-recovering ability, but obviously for a

short time. The members of Group 1 and 3 wanted to go on, because of the physi-


501


cal and mental improvement, the re-socialization included. So we reached Protocol

3: the MFD-syndrome.

27.2 Statistics: evaluation Protocol 2

Explanation Protocol 2

These statistic data are not implemented. The effects of the basic treatment plan

of 6 months was a logic consequence of the tests of Protocol 1.

During this basis treatment plan of Protocol 2, the contours of Protocol 3 came

up. In the cadre of the research around the scientific validity came in front. The

question of Mindlinktest-system would we able as group-treatment, an extending

opportunity of a group with similar “specific files” (e.g. the group with fundamental

uncertainty and concentration disorders as specific file).

The general scoring blockage (epigenetical marker) “original family” has opened

the window to Protocol 3 with the epigenetic inheritance, prenatal cortisol expression

and foetal programming sampled as the MFD-syndrome.

27.3 Statistics: evaluation Protocol 3

Evaluation Protocol 3

After the From scientific research of validation, to longitudinal investigation

basic treatment period of 6 months, or during this period guided by revealed

symptomatology, (with Original Family as epigenetic marker) we started the new

research group of people with the “Maternal-Foetal-Distortion (MFD)-syndrome,

the result of the both previously research stages.

All elements of this syndrome were already present in the Mindlink-system, however

without the ordering according to the model I will present in the next chapter.


502


Self-evidently “Herz”, the composition of Mathieu D. Polak was absent in the

Mindlink-system. The consequences of working with “Herz” appeared strongly

therapeutical effects on the 528 Hz frequencies, in combination with the specific

solving elements of Mindlink.

So it would be terrific to implement this kind of music - including the Schumannfrequencies

- in the Mindlink-system.

After the positive results of Protocol 1, group 3 (528 Hz) sometimes – in specific

circumstances - I treated clients with 528 Hz only, after testing the correctness by

armlength-reflextest (See Casuistry).

27.4 In the structure of Mindlink-system research two

streams emerge:

1. The (single) traditional n=1 stream with a strictly individual treatment especially

concerning the solutions, with no choice on beforehand of the therapist (no

research, or group-treatment program)

2. the (group) specialist n= >1 stream with a strictly prepared treatment-plan, effectuated

by test of the individual partner of the group. For instance: in the research

of MFD I developed three structural research-pillars:

In negative energetic blockages:

First research-pillar: Indices of the Physical Dynamic (with obviously physiological

stress-index in the dominant role)

Second research-pillar: Period of Time.

In the positive energetic solutions:

Third research-pillar: expressing the reduction of physiological stress, strongly

chained with the prenatal foetal programming. (As help: I consulted the database

on “stress”, that contains all affirmations with a relation to any kind of stress and


503


stress reduction. The quite normal test reveals what’s needy, the percentages included.).

The Harmonization (sounds and music) plus 528 Hz music, also belong standardly

to the structural group treatment.

After different consults the percentages of the three structural research-pillars

decrease unto 0% with strong evidence of positive effects, affirmed by the oral

report of the clients. (See Casuistry).

After reaching 0% of negative energetic blockages of (epigenetic) preprocreation,

procreation, prenatal, perinatal, neonatal and infant, the positive energy

of the Mindlinktest-solutions has de-activated memories and (re)activated

self-recovering ability by the Orchestrating Factor of Repair. The evidence has

been tested as usually. Every element of the test ends in a dissonance (unequal

armlength-reflex test) = 0%, as remnant of the negative energetic blockages, a

correlate of the setup with the (group) specific file.

27.5 Orchestrating Factor of Repair (OFR) or selfrecovering

ability

We have to be cautious because of the difficult interpretation and explanation of

the test results (hermeneutics). We have nothing but measuring results and subjective

reactions of the patients, however supported by authoritive publications on

epigenetics, DNA-methylation and quantum physical subject matters, in order to

give evidence of the self-recovering ability. So the factor of epigenetic inheritance

and the heritage of DNA-methylation pays our highest attention, concerning

any conclusive evidence.


504


The last part of the group-research structure is: re-start of Mindlinktest on a individual

level, as mentioned ad 1. with the start setup and the usually way of testing.

At this moment I treats - with very good results - about 50 clients with MFDsyndrome,

by the structural approach as described above. The casuistry speaks its

own language, with hope for new group-treatments with different setup.

The group-treatment concerning the intergenerational epigenetic inheritance, and

the prenatal caused distortions, ask for a fundamental structure (individual deviations

included). See the last part about the off-spring of parental epigenetic

transmission (Holocaust-survivors and other victims of WW II (Jewish, German,

Japanese etc.) and off-spring of PTSD-patients.

from

start-research

to MFD

participants 91

drop-out 14

balance 77

100

50

0

91

14

77

52 25 15

stop after program 52

continue to MFD 25

new MFD participants

after 1/12/14 15

27.6 Syndromatic Structure MFD-Syndrome

“Period of time for this dynamic” (part of the Mindlinktest) 374

374 Perhaps it would be good to reconsider the definitions of the used structural terms since the widening of the context of

the Mindlink-system to other scientific and therapeutic discipline’s.


505


Starting research and treatment

The epigenetic marker - result of the first diagnostical research - is: original family

375 After concluding “original family” at the end of the second test research as a

epigenetic marker, we go to the indices of the physiological dynamics:

anxiety index ...%

Endurance index...%

Stress index...%

Energy index...%

Relaxation index...%

Nutrition index...%

Stimulant index...%

Weight index...%

Psycho-emotional index...%

Congestion index...%

Pain index...%

Wound healing disorder index...%

The testing of the indices gives insight in the mutual connection between the core

elements of the physiological system.

The negative blockages of these indices betrays the combination of the indices

couple with the distortions connecting with the foetal programming and the specific

epigenetic-physiological and stress-related elements.

375 Original family is the complex of the intergenerational transmission of genetic and environmental properties (epigenetics).

In the search on the cause of the problems this element is a crossing element around many ways. Therefore, it

opens the next step to the question of there are physiological defeats inside the Mindlink physical blockage? Because of

this contextuallity we have found an epigenitic marker of MFD-syndrome, as core-correlation between the five levels of

the image of man.


506


Because these indices are agreements with results of research on Foetal Programming,

we forward the test of the epigenetic inheritance and the prenatal programming.

27.7 Maternal Foetal Distortion (MFD) – Syndrome Epigenetic

and prenatal period 376

1a Pre-procreation (before procreation)

preparing intergenerational epigenetic inheritance

1b Pre-procreation (before conception)

preparing gametes as stem cells before sperm and ovum 377

1c Procreation (conception)

preparation ovum

conception

meiosis 378

2. In utero

Maternal HPA-axe activation (feedback disturbance):

First trimester (11bHDS1 and 11bHDS2 enzyme insufficient?

Foetal HPA-axe activation (feedback disturbance)

Second trimester

Third trimester (emotional development)

3. Development of Adaptogenic Capacity

Transmarginal stress 379

376 This structure of the epigenetic and prenatal period, ending on the average around the age of 4 has nothing more status

like a proposal.

377 Marks, Hendrik, a.o. The Transcriptional and Epigenome Foundations of Ground State Pluripotency, Cell 149, 2012

378 a type of cell division in which a nucleus divides into four daughter nuclei, each containing half the chromosome number

of the parent nucleus: occurs in all sexually reproducing organisms in which haploid gametes or spores are produced


507


Supra paradoxical response pattern

Acceptance of life

Death wish 380

Attempted abortion*

Vehemently unwanted child (also feelings of the foetus)

4. Birth

Physical

Physically traumatic birth

Emotional

Emotionally traumatic birth

5. Postnatal

Social matrix (prepared during the prenatal period)

Commitment avoidance

Avoidance of bonding

Avoidance of social integration

6. The ongoing process of the pre-, peri- and neonatal period

7. Infant

Provisional stop of the test

379 Insufficient vital-emotive impulses to develop sufficient adaptogenic capacity, with complications on the development

of maturity and adaptation later in life. (Connection with Pavlov.)

380 Death wish as ultimate reaction on the feelings of unsafety in womb. The exact reason of this unsafety is different, but

so strong that the embryo/fetus doesn’t accept life and prefers death. This doesn’t mean an increasing person with a suicidal

personality. Some of my clients recognizes these latently feelings translated into: What is my place here in life? Why do

I exist?

Later in life feelings of being guilt become at the surface. In many cases this guilt isn’t only a feeling of guilt, but an

existential guilt because he or she exists, against the parental will.


508


The test stops at the moment of dissonance at the infant age.

My research points to an average of 4 years. That’s the moment of internal

changements in de vital-emotive life, with an increasing negative self-image,

fixed in the hermeneutic distortion of the Self, as negative programming blockage,

a dominant, overruling conviction.

* Attempted abortion can be connected with the transmarginal stress and the

death wish. This is a new research item, because of questions around the miscarriages

and the death wish of the foetus, instead of the physically problems of the

pregnant woman. The same problem can be the SIDS (sudden infant death syndrome)

and a possible consequence of the Supra paradoxical response.

Structural solutions **

music and sound of nature...% 381

Fit for learning (stress reduction and sub-affirmations) ...%

Sexuality and Relationships (and sub-affirmations) ...%

Motivation (and sub-affirmation) ...%

check End of solutions ...%

** This chosen structural solution is only on behalf of the purpose of this grouptreatment

with the same setup and aim as I already elaborated above.

Outside this structural formation the normally n=1-praxis is and remain normative

for all Mindlinktests, as taught at the start of the test-praxis.

Why 528 Hz music and Mindlink-system ought to be world-wide present in the

medical- and cultural domain?

381 The percentages are necessary to reckon the progression and thus the extent of recovery of the homeostasis.


509


Chapter 28 - Concluding Remarks

28.1 Provisional conclusion

A

llmost at the end of my considerations around the Mindlink-system -

extended with 528 Hz music - and the place in the medical domain, I

will give a short overview and explanation, why it has to be.

My entire research has emphasized the connection between the human mankind

and the culture (nature and nurture) with sound (music) and speech as corecomponents.

Grateful to the Hebrew language and scriptural particularities we found a sublime

openness to the Source of all Energy, and after all a new definition of nondogmatic

religion as re-ligare: re-connect with the Source of All.

Because of the 528 Hz-attractor for the entrainment of Schumann Resonances

implemented in 528 Hz, we also found brainwave-entrainment chained with 528

Hz. 382

In order to get a powerful and universal system, the sketched music frequencies

and the entire Mindlinktest-program has to be involved. This extended system

forms a powerful energetic program, being an instrument of healing for people

whose hardships in life disaster (PTSD), epigenetic pass on their children.

This Mindlink-system seems to be able to de-activate the heritage of the influences

coming from the intergenerational and germ line.

382 A combination of 528 Hz (Hexachordum Duplex or Solfeggio-revised), Schumann Resonances and the brainwave

frequencies.


510


Mindlink and the extensive fields of unconsciousness (inherited) experiences for

instance the group of Holocaust-survivors, Vietnam veterans, Germans in WW II

and individual and other collective suffers of PTSD.

Challenge of Widening the Horizons

Extended Mindlink-system, 383 treatment for off-spring of WW II-survivors

(Example of deeply traumatic experiences and intergenerationally epigenetic inheritance).

29.1.1 Womb as Lost Paradise

Intergenerational Epigenetic Inheritance, Foetal Programming, disruption of

Adaptogenic Capacity

The final effect of our hypothetical-deductive methodology is a wonderful

opportunity to recover experiences from

the past, by intergenerational, and epigenetical

inheritance at the moment even

before the procreation, with the preprocreationally

gamete as embryonic stem

cell with temporarily non active genes -

Schumann and Tesla 2004, Vol. 74,4 related

to ADHD Symptoms, Externalizing

Problems, And Anxiety in 8- an 9-Year

Olds, inside the wo 384 , and the fertilized ovum in a latter stage.

383 Meaning: Mindlinktest-528 Hzmusic-Schumann and Tesla combination. This idea has no other status then a proposal

on behalf of the research results.

384 Marks, Hendrik, The Transcriptional and Epigenomic Foundations of Ground State Plurypotency, op. cit. 2012


511


As the ultimate consequence of this methodological system we find the

prenatal influences from the stress-reductive hormone cortisol and the foetal

programming with physical and psychological disorders like the HPA-

Axis-insufficiency, basis for an adrenal gland overload of insufficiency. 385

This foetal programming and the inheritance of the epigenetic genome stamps the

development of the embryo and the fetus with early-birth, low-birth weight and

brain-damage in several disorders. 386

Decreasing flexibility is a sample of distortions by the foetal programming. This

decrease affects metabolic and immunologic flexibility. This disorder of flexibility

belongs to the epigenetic programming of the genes belonging to the stress,

metabolic and immune system. Some effects of gen-programming - as a deeply

psycho-trauma – can overcome by re-programming the epigenetic expression,

e.g. by activation of the self-recovering ability, just like the Tesla-transformational-Mindlink-system.

Besides the effects on the HPA-axis, HPT-axis and

HPG-axis are close connected and influenced in the same manner. 387

As an umbrella term we introduced adaptogenic capacity, the disordered capability

to live adapted as full responsible member of society, living within a social

matrix. Adaptation gives us the opportunity to be flexible and dynamic. The contrast

is a rigid or mental disabled personality.

After treating the effects of the prenatal period, the clinical hermeneutic part of

the system is a strong tool to recover the attenuated adaptogenic capacity.

385 Hompes, Dr. Titia, op. cit. part 1

386 The Foetal Programming and the origins of diseases later in life belongs to the so-called Barker-hypothesis and his

publications e.g. the foetal origins of coronary heart disease (art. BMJ, 1995).

“He described in detail the potential influence of an adverse inuterine environment on the potential development of disease”,

quote of Hompes op. cit. introduction.

387 Bergh, Dr. Bea van den, a.o. “High Antenal Maternal Anxiety is Related to ADHD Symptoms, Externalizing Problems,

And Anxiety in 8- an 9-Year-Olds, Child Development, 2004, Vol. 74,4


512


As an emergent development of this research, we came to the definition of “Maternal-Foetal-Distortion-syndrome”

(MFD) and the international academic research

of foetal programming. The regular treatment of the physical disorders

differs from our proposal of a new energetic diagnosis and treatment 388 , with the

Extended Mindlink-system as instrument of de-activation unconscious pulses

caused by remembrance of experiences and re-activate by self-recovering ability.

Caution is required

Many open gaps in knowledge of epigenetic inheritance, the connectivity with the

evolutionary speech and music (the actuality of the Extended Mindlink-system),

DNA-methylation and Epigenetic-chromatin expression and other scientific matters

of research, have to pay attention to be cautious with a new vision of this

subject matter. Self-critical consideration creates very important questions, however

carried by positive effects on these basically distortions inside the womb as

lost paradise.

I repeat:

“Some effects of gen-programming - as a deeply psycho-trauma – can overcome

by re-programming the epigenetic expression, e.g. by activation of the selfrecovering

ability, just like the Extended Tesla-Transformational-Mindlinksystem

(ETTM).”

29.1.2 Questions of qualification

The first question to the Extended Mindlink-system is: “Is the Tesla-scalartransformation-system,

implemented into the Mindlink-system, connected

with 528 Hz and the Schumann Resonances (ETTM) energetic strong

388 Bergh, Prof. Dr. Bea van den, op.cit. DOHaD (Developmental Origins of Health and Disease-paradigm), formulated 20

years ago by David Barker.


513


enough to (re)activate the human “self-recovering ability”, cleaning up the

unconsciousness, and recovering mutations of DNA sequences as well?”

“Is it sufficient, we have successfully treated about 50 MFD-syndrome patients,

suffering at a diversity of distortions, but all directly related to the prenatal stages,

so we can treat in the same way larger and different specific groups (Holocaustsurvivors)?”

I can’t affirm this question evidently, although a strong probability exists, derived

from the treatment results. The collective system creates a unifying relationship

with anyone who is suffering at the same distortions. They all – as a cohort - enter

the Mindlink-system with the same “specific file” following the same structural

trail, exceptions included.

Experiences – beginning with the intergenerationally epigenetic inheritance – are

hypothetically stored in “the presumed raster of methylated DNA”, in space and

time always expressive, but as epigenetic chromatin also amenable to correction

at the moment the energetic-transformational counter-information reaches the

chained experiences on the raster. I hypothesize the “raster” as “energetic unconsciousness

as storage facility”, carrying “the memory of experiences”.

Crucial remains the question: “Is it possible to reach the unconsciousness (phenomenal)

by brain stored consciousness (physically)? This question originates at

the reductionist “bottom up” or “Upward Causation”-model, state of affair concerning

image of man and the evolution. Perhaps the content of unconsciousness

can categorized by the hypothetically existence of physical qualia. 389

389 About qualia and quantum physics we will be short, but without devaluate the importance concerning the evolution on

the system of downward causation (vital-emotive-dimension) with space for data, existing but inexplicability. The formula

of Andrew Lee in his paper “Reductive Explanation and Qualia” will give us two openings: 1. an explanation model of the

definition of the seemingly inexplicability and 2. an affirmation of our described hermeneutic model.


514


The purpose of the Extended Mindlink-system, with its transmitting Teslatransformed

contra-information (speech, music and nature sounds as affirmative

energy sources), is: to de-activate the scale of unconscious memories of different

arts. 390 In a manner of law we hypothesize: the earlier disturbed experiences, the

worse (to be treated), with strongest possibilities of influence on getting diseases

later on life, especially early brain ageing.

Erasing of (epigenetic inherited) or actually foetal programmed experiences is

hardly possible. A scar remains, with pain now and then.

Qualia explain what’s inexplicable?

28.2 Qualia explain what’s inexplicable

These final question depends on both different directions of evolutionary causation.

This study is founded on downward causation, with the homo sapiens as

(provisionally??) final, but very complex result. The complexity depends on the

interpretation of the image of man. The second main foundation is the homo sapiens

as holistic phenomenon. The third main foundation follows from the latter:

“re-ligare par essentiam” with the Source of All, “existere per participationem”,

transcending space and time “ad Infinitum”.

The development from “existere per participationem” until “ad Infinitum” contains

many explicable phenomena, but may be an exceeding number inexplicable

phenomena. The inexplicability has less sense for a scientist of downward causation,

because it is a property of nature in process, that many things are hidden to

the human mind, on the way to the revelation in the unlocking process, wherein

we - human co-creators - are responsible for the conditional requirements. I intend

to overcome the useful idea of metaphysics as explanation model of the in-

390 “The unconscious memories of different arts” can probably researched inside the field of qualia as we will see.


515


explicable phenomena, like some physicists and philosophers try to solve these

ultimate inexplicabilities. This escape to the likewise metaphysical explanation of

inexplicabilities belongs to the domain of science, ruled by the straight line of

upward causation. These scientists are entangled in the conviction of the materialistic

beginning of life, with contingency as driving factor. The bottom-up-model

has to solve the empirical problems evidently, before the next phase can go on. If

the model fails – as a ground tone of science – a new paradigm-shift makes its

appearance, but for the time being. The quantum mechanics and Einstein’s both

relativity-theories has a proximity of the Source: the time-space-dimension and

the not-empty quantum vacuum. In this short explanation of the bumps in the

road, and an enclosed passway it will be clear that the upward causation will

stuck in its limitations, maintained by the scientific complacency and selfsufficiency.

The repetition of the image of man and the explaining terms shows us the way of

the top-down, emitted from the Ultimate Source, the a (see the Prolegomena). All

that exists today is an actualization of the potentiality, within the entire reality in

the macro and micro pathway’s, the intra-cellular and extra-cellular worlds of

life. This top-down unlocking process expresses partial articulations. The consequence

of these partial articulations is the existence of inexplicable states of affair.

In short: the last part of the five internal human levels – the physical body –

has the most inexplicable phenomenon, divided into physical and mental phenomena.

In the materialist image of man, experiences remain a point of argue and

rejection of many suggestions, aimed as an explanation of the inexplicability of

phenomena. A general example is the colour-scientist Mary who never had experienced

the colour red, she however knew all the physical properties of color’s.

The first experience with the colour red couldn’t describe or orally explained. The

human language obviously fails. So the question raises inside this level: “Is an

experience physical or phenomenal?”


516


Here we arrived the term Qualia with the troubles of explanation. In my hypothesis

qualia – or in the experience of the colour red – remained ultimately on the 4th

level: vital-emotive level, with pathway’s to give new content as increasing factor

to the 5th level and to receive results of new articulated phenomena from the 5th

level. Thereby the 4th level gives actualized phenomena to the 3rd level, the hermeneutical

level of mind and mind-set. The result of the unlocking consciousness

on the 3rd level as retrocipation back to the 4th level, and upwards to the 4th level

as anticipation of the development of interaction with the 5th level: the reconnection

with the Source of Life. This last step is the retrocipation back to the

4th level, still going and increasing downward to the 5th level.

The non-stop interaction between these internal levels of life in an unlocking process,

I earlier mentioned technically: participation and retrocipation (see Philosophical

Introduction).

Conclusion: after the interaction between the 4th and the 5th level the consciousness

of the 4th level has inexplicable knowledge about the presence of the Source

and the partial consciousness of the unlocked potentiality.

In the downward causation we have shalom – rest of heart, head and hands – also

we all don’t know at this moment, searching to more insight and real knowledge:

da’at in Hebrew. Da’at differs from knowledge or science in the upward causation

with the focus on intelligence. We will be surprised, after hearing some voices

about qualia, the efforts of explanation inexplicable experiences, only one step

away from understanding the phylo-energetic of the 4th level: the energetic vitalemotive

level, covered up by the energetic raster as unconsciousness, in interaction

with the DNA-methylation, epigenome and hidden distortions of the foetal

programming in a mutual dissonance between the physical 5th and the morphogenetic

quantum field of the 4th level, the stage of the negative energetic disturbances

of the homeostasis between all five levels, especially between the informational

processes of the 4th and the 5th level.


517


Provisional conclusion: the negative energetic or epigenetic effects are stored on

the 4th level with effective radiation downwards to the 5th, the psycho-physical

level and upwards to the 3rd level as correction of the hermeneutic distortions and

the development and enrichment of the mind-set.

The states of affair of the inexplicabilities seem to be cleared dealing with the

qualia.

29.2.1 Qualia, feelings and experiences as inexplicabilities 391

Feelings and experiences vary broadly. For example, I run my fingers over

sandpaper, feel a sharp pain in my finger and become extremely angry. In

each of these cases, I am subject of a mental state with a very distinctive

subjective character. There is something it is like for me to undergo each

state, some phenomenology it has. Philosophers often use the term “qualia”

to refer to introspectively accessible, phenomenal aspects of our mental

lives. In this broad sense of the term, it is difficult to deny that there are

qualia. (...) Qualia are intrinsic qualities of their bearers, and how qualia

relate to the physical world, both inside and outside the head. 392 Qualia are

at the very heart of the mind-body problem. 393

Heil definited qualia as characteristics of conscious sensory experiences. But

What are these characteristics? They differ much from the properties of the brain.

(...). You can give someone an exhaustive description of what physical processes

391 In philosophy qualia with the singular form “quale” are individual instances of subject, conscious experience. The

term “qualia” derives from the Latin neuter plural form (qualia) of the Latin “qualis”, meaning “of what sort” of “of what

kind”. Examples of qualia include the pain of headache, the taste of wine, or the perceived redness of an evening sky. As

qualitative character of sensation, qualia stand in contrast to “propositional attitudes”. The scholars Dennett and Schrödinger

differs in meaning as many other scholars do. This quote is the start of an extent article about Qualia in Wikipedia,

free encyclopedia.

392 Tye, Michael, “Qualia”, art. Stanford Encyclopedia of Philosophy, 2015

393 Mind-Body-problem is one of the energetic interventions of the Mindlink-system. Qualia as interventional phenomena

will form an object of advanced research of the Extended Mindlink-system.


518


are playing in a particular person like he's in pain, but from such a description

may still not be inferred someone experience if he is in pain. (...) Looking for a

declaration may not lead to dualism that the holistic phenomenology breaks.

Downward causation

Relation to the physical world, both inside and outside the head. 394

Qualia form the very heart of the mind-body problem. 395

a rel – Unification Field

Dialectic-ligand body image

Consciousness body image

Hermeneutical body

Vital-emotive body image

Physiological body image

Energetic unconsciousness

as storage facility carrying

memory of experiences

Downward Causation

394 Tye, Michael, “Qualia”, art. Stanford Encyclopedia of Philosophy, 2015

395 Mind-Body-problem is one of the energetic interventions of the Mindlink-system. Qualia as interventional phenomena

will form an object of advanced research of the Extended Mindlink-system.


519


Jackson’s wrote in his article “Epiphenomenal qualia” a number of arguments for

the proposition that qualia can’t displayed by a physical description. 396

The “what is it like to be a bat” argument of Thomas Nagel is often cited in debates

over qualia. Nagel argues that consciousness has an essentially subject

character, a “what-is-it-like” aspect. (...) Nagel also suggests that the subjective

aspect of the mind may not ever be sufficiently accounted for by the objective

methods of reductionist science. 397

If the idea’s of Johnson and Nagel are true, then only rests the single conclusion:

“there are signs that the epistemological materialism can’t offer any conclusive

explanation. 398

As a follow up of the statements of Nagel we will elaborate the study of Andrew

Lee, titled “Reductive Explanation and Qualia”. 399

Lee says: What counts as reductive explanation is sometimes unclear. I will only

consider the functional analysis method of reductive explanation, and reductive

explanation will refer to functional reductions. Other explanatory methods that

might count as reductive explanations include bridge law connections and identity

statements. However, I will count only functional reductions as reductive explanations,

for three reasons: 1. Bridge law connections and identity statements

are better regarded as reductions rather than reductive explanations, because they

establish two properties that are at different levels but are coextensive; 2. Functional

analysis allow for the multiple-realization of properties at the higher level,

a chief reason that many have preferred reductive explanation to reduction in the

first place; 3. Arguably, functional reductions have greater explanatory power

396 Jackson, Frank, Epiphenomenal Qualia in “Philosophical Quarterly, 32, reprinted in Philosophical of Mind – a guide

and anthology”, quoted from Matthijs Melissen, 2004. Later he rejected his vision on Epiphenomenal Qualia.

397 Tye, Michael, op. cit. 2000, page 450

398 The hermeneutical treatment of the introspection on the 5th and 4th level of the image of man I won’t describe here.

399 Lee, Andrew, “Reductive Explanation and Qualia”, Aporia vol. 21, 2-2011


520


than the other two methods, in that functional analysis can be applied to more

phenomena in the natural world.” 400

Lee’s roughly explanation will give us a tool to understand the levels of the image

of man, but also the anticipation and retrocipation as working model of the

entire reality. Lee gives us a basic formular and we extend this to a general formular:

an interaction between higher-level and lower-level properties. The application

of this formula to the energetic treatment of the epigenetic inheritance and

Foetal programming on the 4th level.

“What is important”, says Lee, “is that reductive explanations shows how the

instantiation 401 of one property can result from the instantiation of other properties.

A reductive explanation requires two steps. First, the higher-level property to

be reductively explained must be given a functional analysis, or a definition in

terms of its causal roles.”

I agree with Lee as a criticises Block and Stalnaker about water as phenomenon.

He makes the next statement about water compared with pain:

“Even if XYZ satisfies the functional rule of water, we would not say it water,

because it is an a-posteriori truth that water = H 2 O are required for reductive explanations

of water, and that it may be a similar case for reductive explanations of

pain. I will not consider this line of reply.”

So do I!

Such a definition in terms of causal roles has the following form:

400 Lee, A. op. cit., page 2

401 Instantiation is a principle close related to Plato’s ideas. Plato used in this context, the Greek term παρουσια, which

could be literally translated as presence. Thus instantiation can be translated as achievement or realization. That means the

existence of properties or universals is not tied to their actual existence now, but to their existence in space-time considered

as a whole. Thus, any property which is instantiated, has been instantiated, or will be instantiated exists. The property

of being red would exist even if all red things were to be destroyed, because it has been instantiated. This broadens the

range of properties which exist if the principle is true.


521


29.2.2 G = def – (F ~ C)

Property G = def having a lower-level property F, such that F fulfils causal

role C. (In any kind of reductive explanation, the explanans must only

use terms that are at level lower than the terms of explandum. Otherwise it

would not be a reductive explanation.)

C can be taken to be a specification of causal relations, such as “transmitting

and encoding information”. Then if we can have shown how property

F can transmit and encode genetic information, we have shown how F fulfils

causal role C.

Second, after establishing this functional definition, we can do the scientific, empirical

work of constructing an account of how some lower-level property L fulfils

C. It should then be clear how it is that L realizes G. In other words, once L

fulfils C, G comes for free-L fulfilling C necessitates the instantiation of G. Once

we have this account, the reductive explanation is complete. 402

Nevertheless my comment in the footnote we illustrate the example of Lee, before

we will apply to our five layered, but holistic image of man.

“As an example, consider a reductive explanation of a gene. First, we must find a

functional definition for the gene. We might come up with something like this:

Gene = def a mechanism that transmits and encodes genetic information. Then

we must construct an account using lower-level property terms that satisfies this

functional role. As it turns out, DNA molecules transmit and encode genetic information,

and so can fulfill this functional role, giving a detailed molecular bio-

402 What does he mean with the completeness of the reductive explanation? Many arguments offend his idea. Many philosophers

reject the existence of qualia. So there is a lot of work to do when it comes to the usability of qualia and the 4 th

level of in-formation of vital-emotive energy.


522


logical account of the details of the process. Once we have this, the reductive

explanation of the gene in terms of DNA molecules is complete.” 403

The term “other than” must be a state of affaire in the consideration of Lee.

This “other than” therefore will form a tool of explanation of the correlation and

explicitation of the five layers of the image of man as a part of the whole.

We follow Lee again in summery of his observations about reductive explanations.

Reductive explanations are largely empirical and scientific in nature. (...)

Reductive explanations remove the mystery of why certain phenomena occur.

When we reductively explain the gene we see that genetic mechanisms are not

just brute facts that have no explanation. Rather, the function of DNA molecules

necessitates the mechanisms of genes. This paints an attractive ontological picture.

Through reductive explanation, we see that once the base-level properties

are fixed, the higher-level properties automatically are instantiated.

“Reductive explanations remove the mystery of why certain phenomena occur.”

(Lee).

This statement must be held for jumping to conclusions. What remove what mystery?

What phenomena occurs when and due by what reason?

Dennett offers an argument against qualia. (...) In a series of thought experiments,

he brings qualia into the world of neurosurgery, clinical psychology and psychological

experimentation. His argument attempts to show that, once the concept of

qualia is so imported, it turns out that we can either make no use of it in the situa-

403 Lee, A. op. cit. page 2. We have to be grateful for this formular, very useful for broader applications. “Note however,

that this sort of explanation is not a reduction of the gene to DNA molecules. Reductions are biconditional, such that a

reduction of property G to property F shows that property G <-> property F. (...) Thus, the reductive explanation of the

gene in terms of DNA molecules is consistent with genes being instantiated by something other than DNA molecules, aa

well as reductive explanations of genes in terms of things other than DNA molecules.


523


tion in question, or that the questions posed by the introduction of qualia are unanswerable

precisely because of the special properties defined for qualia. 404

Dennett’s most interesting conclusion from one of his thought experiments about

“Mary the colour scientist”. 405 I quote Dennett leading to the final conclusion,

very important to our own vision.

“Mary would therefore already know exactly what to expect of seeing red, before

she leaves the room (with only black and white, G.). Dennett argues that the misleading

aspect of the story is that Mary is supposed to not merely be knowledgeable

about colour but to actually know all the physical facts about it, which would

be a knowledge so deep that it exceeds what can be imagined, and twists our intuitions.”

(...) Dennett uses this example to show us that Mary’s all-encompassing

physical knowledge makes her own internal states as transparent as those of a

robot of computer, and it is almost straightforward for her to figure out exactly

how it feels to see red.

29.2.3 Finger down of the deficit

Dennett: “Perhaps Mary’s failure to learn exactly what seeing red feels

like is simply a failure of language, or a failure of our ability to describe

experiences. An alien race with a different method of communication or

description might be perfectly able to teach their version of Mary exactly

how seeing the colour red would feel. Perhaps it is simply a uniquely human

failing to communicate first-person experiences from a third-person

perspective.

404 Dennett, Daniel, Consciousness Explained, London 1988, and Quining Qualia,

http://ase.tufts.edu/cogstud/papers/quinqual.html

405 see for the entire thought experiments the extended article in Wikipedia (Qualia, Bennett).


524


Dennett approves of an account of qualia defined as the deep, rich collection of

individual neural responses that are too fine-grained for language to capture.

Conclusion

We infer the existence of qualia out of the storage of experiences. The qualia

comes into the consciousness and will be reactivated at the moment it has touched

by a similar accident. The therapeutical intervention of systematic desensitization

underpins this conclusion.

Qualia form the last residue of the memory of experiences. The “last residue”

means in the framework of all that has said above: the inexplicability part as residue

of the stored experience.

With this conclusion we have underpinned the statement: “unconsciousness is the

energetic raster as storage of the memory of experiences”.

The effort of Lee and his Reductive Explanation of Qualia gives a good opportunity

to show the final way of the reductionism, but also the poverty of the conclusions.

The central idea of his formular of reductive explanation is the definition

of the properties, in a permanently downwarding process, with always new

lower-level definitions to come to a bottom cause. After reaching this last step

down, the definition roundabouts from lower-level into higher-level. But I think

we have to do with a circular logic, because this process is a part of the evolutionary

upward causation, that will be finished in a “non liquet” that means: “We

don’t know, it isn’t clear!”

The explanation and conclusion of Dennett is more realistic. Our human language

posibilities fail to define the depth of the experience itself. I really agree with this

conclusion. But at the moment he illustrates the relativity of these failures and

speaks about “an alien race” I disagree, because of the cleavage of the holistic

cosmological and human nature. But, is an explanation of the qualia of experi-


525


ences really impossible? If we are anchored in our thoughts within the Darwinist

upward causation and reductionism, we only can conclude – with Lee and Dennett

as opponents – the data we have created are insufficient, so we fail at the end

of the road, i.e. the “physical body”, the 5th level in the image of man.

The crux is “the data we have created” with the factual meaning: the world we

have build up by science, from matter, states of affair until the quantum vacuum.

29.2.4 Data we received

The fundamental correction that guides us unto a new paradigm is the original

meaning of “data”. Because of the popularity of the computer terminology

we have lost the contact with the original Latin meaning. Data, plural

from Latin datum "given phenomenon” - neuter past participle - of dare

"to give". Meaning: the given phenomena are transmittable and storable information.

With acceptance of this original meaning of data we touched the core of the evolutionary

reality: the downward causation with “to give” and “to receive” as phenomenology

of the energetical unlocking process of the evolutionary potentiality.

The locus of this phenomenology in giving and receiving (development, ethics

and medical care) is the 4th level of the image of man. On this level the strongest

disturbances and distortions are situated. This energetic 4th level – containing the

morphogenetic fields (Sheldrake) and the raster as storage of memory of experiences

(qualia) gives the energetic and (epi)genetic data to the physical, the 5th

level, and receives the data of this level as an increasing and revealing factor upwards,

vice versa to the levels 3, 2 and 1.

In the Mindlink-system the negative blockages are the phenomena which have

erect a barrier between the 4th and the 5th level, between the flowing energy of

the vital-emotive body and the physico-psychic body.


526


We marking here the broader meaning of homeostasis: the balance between all

the levels of the image of man, and larger: the balance within the entire existence

by the dialectic-ligand relationship with the Source of All, with all relevant numbers,

active pointers to the Beginning, but also the recovering of the cosmological

and climatological disbalance.

Recovering of the qualia – the residue of the experiences – is possible by giving

adequate energy, transformed into the quantum fields of unconsciousness, like the

Extended Mindlink-system, with music of 528 Hz as interaction between dynamic

information-carrying quanta.

28.3 Casuistry MFD-client (fem) – (Research praxis Amsterdam)

After one and a half year of mindlink therapy, I am just able to see the

vast differences between before and after me. I can see my relationship

with my surrounding. It is about being able to be present in my body, and

conscious of my existence. Before I felt prisoned behind a sturdy, nonresilient

wall. I was pushing against it, and it didn't move at all, maybe a

bit. It was hard working at all. The wall made sure I was under permanent

stress because I wasn't in the position to be present. I was only able to

impress myself a tiny bit by pushing myself against that wall. Or by describing

the contours of my feelings and thoughts. The describing part

was very complicated, which I constantly did in my head also as it went

about organising things. My head was always full of ideas but without

plans. So I never got into action. Well, that is fundamentally changed.

Since we cleaned up the cellars of my system (MFD-syndrome), I started

to notice distinct changes in myself. This changing became viral and were

hard to repeat because so many new experiences happened since then.

What can I say? The most of the partition wall has gone. Sometimes, when

I'm tired, or when there are happening drastic things in my surrounding,

some echoes out of the past will come and visit me. My energy and smile

will disappear then. Even though I am recovering quicker than ever, partly

because I have now experienced that the dip is not forever. Also that the


527


dip is not as deep as my highest light was in earlier times. My spontaneity

is huge, and I can communicate in that spontaneity. I seem to get more

self-possession and even a form of discipline! I'm making human connections

very easily, but I will also, if necessary, go out of the way. I am telling

people what my needs are and what I can't use. It seems I managed to

break out of the egg.

Widening of the Mindlink-horizons creates a new potentiality giving a setup for a

mondial development, treating the deeply suffering fellow man. The casuistry

provides evidence of the potential of the Extended Mindlink-system. The casuistry

underpins the treatment of intergenerational epigenetic inheritance, addressing

to DNA-methylation and other epigenetic expressions.

This verdict demands new evidences, however based on the results of this research.

A setup for a new challenge

The Guardian of Friday, 21 August published an article with the headline:

“Study of Holocaust survivors finds trauma passed on to children’s genes”.

As lower head: “New finding is clear example in humans of the theory of epigenetic

inheritance: the idea that environmental factors can affect the genes of your

children”.

The Daily Mail of 22 August also wrote: “Holocaust survivors pass the genetic

damage of their trauma onto their children, researchers find.”

Children of survivors found to have increased chance of stress disorders.

In Epilogue publications of Rachel Yehuda, Bastiaan Heijmans and the book of

George Steiner “Grammars of Creation” have been the building blocks as challenge

and recommendation to practice the Extended Mindlink-system, in addition

to cultural contextuality and medical and (music) therapeutical praxis as a fundamental

application, because of the major value of this system.


528


Besides the medical and therapeutical value, the Mindlink-system also has a

strong power on the cultural level. Dealing with MFD as core-syndrome, we create

new opportunities, using the Mindlink-structure of the MFD-syndrome as

described above, as a fundamental building block for many cultural problems.

Since the MFD-syndrome is effective for intergenerational epigenetic inherited

and prenatal exposure in general, it also should be relevant for people who were

prenatally exposed to famine during the Dutch Hunger Winter in 1944-1945. The

final step: if the Extended Mindlink-system is persistent for the Dutch group, offspring

of the famine period, the Mindlink-System can also be effective for other

groups with intergenerational epigenetic inheritance and prenatal exposure to

famine in the world. “Extensive epidemiologic studies have suggested that risks

of adult diseases are associated with adverse environmental conditions early in

development. Although the mechanisms behind these relationships are unclear, an

involvement of epigenetic dysregulation has been hypothesized.” 406

Perhaps the Extended Mindlink-system, directed to and connected with the Vital-

Emotive Body, part of the image of man, can eventually be hypothesized as an

operating system to recover the dysregulation and distortions caused by the historical

contextuality of original family (marker), epigenetic inheritance and foetal

programming, with a spectrum of diseases and distortions later on life.

Final conclusions at the end of this dissertation suffice with an analysis of the

composition, which step by step leading to the Epilogue and the Recommendations.

Thetic parts of this dissertation are excluded from the final conclusions. I decided

because of the intervening conclusion of all single parts.

406 Heijmans, B.T. a.o. “Persistent epigenetic differences associated with prenatal exposure to famine in humans”, a

publication of Proceedings of the National Academy of Sciences of the USA, 2008. Research of the University of Amsterdam.


529


Medical and therapeutic aspects of this dissertation have been highlighted implicitly,

aimed to Integrate Medicine and Therapy, thereby music therapy has explicitly

included.

Some genes, epigenetics and DNA-methylation are important for an approach out

of the 4th level of the image of man. It concerns especially epigenetic expression

or mutations of the next genes:

FOXP2, FKPB5 and IFG2, important for respectively schizophrenia, violence,

PTSD and growth-functions.

Mindlink-system with MFD-model strengthening, thickening of the prefrontal

cortex, which is thinner at a later age.

One of the consequences of the distortions found in the prenatal examination is

early aging. Therefore we must alert about this symptom using for dialogue with

the conventional study of "Mild Cognitive Impairment (MCI), with symptomatology:

remember names, find the right words, where is my stuff and concentration

disorder.

As prevention against Alzheimer we can strengthen the hippocampus, the brain

structure connected with learning, combined with the prefrontal cortex, both relevant

for the short-time and long-time memory. The hippocampus is responsible

for new brain-cells (neurogenesis). Thereby strengthening, thickening of the prefrontal

cortex, which is thinner on later age.

One of the consequences of the distortions found in the prenatal examination is

early aging. Therefore, we must be alert about these symptoms.

For this MCI the Mindlink-system and the MFD-model can be relevant for the

interdisciplinary research on the 4th (energetic) and 5th (physiological) level.

(This is placed between the conclusions as preparation of the Recommendations.

Structural analysis of the Extended Mindlink System; conclusive composition:


530


Extended

Mindlinksystem

Tesla

transformation

technology

528 Hz music

Mindlinktest

Hexachordum

Duplex

Schumann

Resonances

Individual

n = 1

Group

n = > 1

MFD-syndrome

a =

Source of All

The casuistry of MFD-syndrome expresses the positive results belonging to the

high scientific qualification of the Extended Mindlink-system.

Anyway this research concludes: MFD-syndrome is suitable as medical and therapeutic

model for nature and culture. 407

407 The cultural and cosmic pollution by e-smog and other forms of pollution are an integrated part of the Mindlinksystem.

They however couldn’t deal with inside this research, because of the medical and therapeutical subject matter of

the dissertation.


531


Read upwards starting at the Source of All energy. Green elements are the

Mindlink-steps Tesla transformational technology is the scalar energetic source

Osmose

a a absoluut = √1=1

a

Aa relatief = √1=1

creative

emptiness

Downward causation

interstellar space

Tesla-Schumann

energy

cosmologic

consciousness

matter

earth-life

Brainwaveentrainment

spacetime

Pineal Gland

(epiphysis)

Intracellular

activity

Genome

Epigenome

Inheritance

Fetal

Programming


532


Hexachordum Duplex points to music frequencies in the Hebrew linguistics

The 528 Hz functions as attractor and absorbs beside the HD the SR.

Last step: integration one.


Practical Part – Recommandations as result of dissertation research

533

Chapter 29 - Recommendations

28.1 Recommendations

R

ecommendation 1

Truth between conventional and complementary medicine

Logic of Principium Contradictionis and Tertium non Datur

Recommendation 2

Tesla-Schumann resonances geopathic heart beat of nature

Brainwave-entrainment, Tesla-Schumann and 528 Hz music as attractor

Recommendation 3

Extended Mindlink-system in area’s of violence and hunger

MFD-syndrome as model for off-spring of survivors of war and famine

Recommendation 4

Extended Mindlink-system and Academically Education University Academia

“Ars Vitae” and a place in the curriculum of University of Complementary Medicine

- IBAM?



534

Recommendation 1

Truth between conventional and complementary medicine

Logic of Principium Contradictionis and Tertium non Datur

The conflicting trends between the various movements within medicine maintaining

in the world on basis of multi-coloured power.

Argumentative logic have the field of classical Aristotelian logic abandoned,

leaving the principle of contradiction to a theorem has become, since the development

of the Principium Mathematic.

In modern axiomatically built logical systems, such as the Principium Mathematic,

the principle of contradiction is no longer part of the axioms. "The law of contradictions

is merely one among logical propositions, it has no special preeminence."

It is surprising that there is a distinction between the modern axiomatic,

and the mathematical theorem. A theorem ever loses all validity if it is not

built on the basis of the absence of contradiction.

The proposition which I posit here as part of the recommendations is:

If the principle of contradiction as Aristotle gave forms no longer the preliminary

truth and the exclusive third, sacrificed to a multi-conventional understanding but

claiming the "truth", is not essentially different from a pluralistic tolerance,

wherein each his "truth" can exist.

The formula of Aristotle is: it is not correct ("¬") ... and ("∧") ... is not correct

("¬"). These elements create the formular or his Principium Contradiction Is: ¬ (P

∧¬P). That Means P and ¬P: can not be true. Statement P and the contradiction P

(¬P) is true as well. As a completion we added the "tertium non datur". Between

P ∧¬P is no space (option) for a Third phenomenon or statement.

Transpositions

¬ (evidence based medicine ∧¬ evidence based medicine)

¬ (value based medicine ∧ ¬ value based medicine)

¬ (value based medicine ∧ ¬ evidence based medicine)



535

Tertium Datur

(evidence based medicine ∧ value based medicine)

It is recommended, concerning the controversy between conventional and complementary

medicine, to screen on the actually presence of principle of contradiction

and tertium non datur. That will order in both camps the same assignment to

stop creation of "authoritive opinions" out of which infinite distractions can be

done, however within its own ranks. "Opinions" are nothing but a way for "truth".

It's simple to distil two opinions, finding a "tertium datur", worn by the Principium

Mathematic.

Arrange a Committee of Wise Men researching a new foundation for joining scientific

developments, acceptance of pluralism and mutual fertilization, instead of

the traditional PC and TND. This can be able to open the way of an applicable

unification between Eastern and Western medicine in education and practice.

Recommendation 2

Tesla-Schumann resonances geopathic heart beat of nature, Brainwaveentrainment,

Tesla-Schumann-entrainment and 528 Hz music as attractor

The research for this thesis has delivered a wealth of new insights and opportunities

that require an in-depth and interdisciplinary research. The complexity of 528

Hz, which now consists of three parts, (water, light and heart) which are also

coupled to the individual sine waves of the Hexachordum Duplex and Schumann

Resonances, must longitudinal be tested for patients with the MFD-syndrome as

model variant groups epigenetic inheritance and foetal programming.

This continued research requires a multidisciplinary approach in collaboration

with geneticists and biochemists.



536

Recommendation 3

Extended Mindlink-system in area’s of violence and hunger

MFD-syndrome as model for off-spring of survivors of war and famine

The positive results presented in this research has opened an opportunity for

treatment of people in traumatic area’s. Since the Extended Mindlink System is

so much important that it should be widely presented in the medical world, but

also addressed to the broadly, international politics, like the UN.

The Indian “International University of Alternative Medicine” at Calcutta in

which this dissertation has presented, the university in a strong relationship with

the UN. It is a reasonable possibility of the strengthen these contacts by this new

system of aid. Mindlink-system also has the ability to serve people on a large

scale with this unique system, that has shown unprecedented opportunities in the

years of its existence and also during the period of the research and study, of

which this dissertation has become a philosophical foundation and a practical and

statistical report.

Perhaps it will be possible in the near future to arrange international representatives

for the purposes of large-scale treatments of war- and crime victims in the

Third World.

Recommendation 4

Extended Mindlink-system and the Scientific Academically Education

University Academia “Ars Vitae” and a connection with the the curriculum of

University of Complementary Medicine - IBAM?

In The Netherlands we already started the preparation of Higher Education of

Hermeneutical Mindlink Therapy on University-Academic level and an Institution

of Research. The accreditation by the Dutch Government shall be very diffi-



537

cult, but nothing ventured, nothing gained. Self-evidently this steps need permission

of the German direction of Mindlink-system.


538

Practical Part – Appendices

Chapter 30 - Epilogue

30.1 Womb as Paradise Lost caused inside historical contextuality

A

thirst for explanation, for causality, inhabits our nature. We do want

to know: why? What conceivable hypothesis can elucidate a phenomenology,

a structure of felt experience, as diffuse, as manifold in its

expression, as that of ‘terminality’? Are such questions worth asking seriously, or

do they merely invite vacuous high gossip? I am not certain. 408

Filmmaker and artist Yann Arthus-Bertrand spent 3 years collecting real-life

emotional stories from more than 2,000 women and men in 60 countries. Those

emotions, those tears and smiles, those struggles and those laughs are the ones

uniting us all. Here, the Jewish survivor, tells her story; her interview in the movie.

Because of the exceptionality of the event, without subtract anything of the immense

suffering of Jews, Homo-sexuals and Sinties by the perfect organized nazimachinery

and war’s and disasters after WWII, I have given space to an illustrative

event with a Jewish baby at the entrance of Auschwitz.

408 Steiner, George, “Grammer of Creation”, London, 2000, e-Book version chapter I, page 3


539


31.2 A Holocaust survivor tells her story

Here’s what happened:

A German officer in an SS uniform entered the ghetto, one rainy night. My mother

told him: Take my daughter. She lifted the wire fence and handed him her baby,

me, a Jewish girl two and a half years old. And with a heavy heart, she put me

in the hands of a wonderful man in an SS uniform.

I now know that this man, Alois Pleva, served in the German army and lived near

the German border. This man put me in his coat. He hid me inside his coat and

took me to the border between Germany and Poland, to his parents. They passed

me off as his daughter.

They raised me in the purest Catholic tradition, until the end of the war.

What a gesture!

What magic this outstretched hand.

Like sparks of light in what we call “human folly”.

The third stage of my research: MFD-syndrome, with intergenerational epigenetic

inheritance as fundamental source of prenatal distortions (nature, seems to be a

cultural correlate with disasters in collective and individual human lives. One of


540


the darkest periods in the world history of the 20th century is WW II with about

11 million victims, 6 million Jews included. But the light is never extinguished in

the hearts of friend and foe, like within the story of the SS officer and the Jewish

girl.

On the contrary George Steiner wrote strong words about this period – concentrated

in the Shoah – echoing until the present days:

“I do not want to enter into vexed, is some manner demeaning, debates over the

uniqueness of the Shoah (‘holocaust is a noble, technical Greek designation for

religious sacrifice, not a name proper for controlled insanity and the ‘wind out of

blackness’). But it does loo if the Nazi extermination of European Jewry is a ‘singularity’,

not so much in respect of scale – Stalinism killed far more – but motivation.

Here a category of human persons, down to infancy, were proclaimed

guilty of being. Their crime was existence, was the mere claim to life.” 409

Here Steiner confronts us with the silence of death and bite to be damaged as impact

on mankind and humanity. We all are responsible. But “never more Auschwitz”

has devaluated into an impersonal, abstract term. But our research re-opens

the responsibility of the “living past”, pass over the consequences on the offspring

in a non-stop ongoing process; non-stop until the moment we found the

mechanism behind the damaging process. But where are we looking for? Steiner

illustrates our wrong choices and lack of responsibility:

We have not begun to gauge the damage to man – as a species, as one entitling

himself sapiens – inflicted by events since 1914. We do not begin to grasp the

coexistence in time and space, a coexistence sharpened by the immediacy of

409 Steiner, George, op. cit. I/5


541


graphic and verbal presentation on the global mass media, of western superfluity

and the starving, the destitution, the infant mortality which now batten on some

three fifths of mankind. There is a dynamic of clear-sighted lunacy in our waste

of what is left of natural resources, of fauna and flora. The South Col of Everest

is a garbage dump. Forty years after Auschwitz, the Khmer Rouge buries alive an

estimated hundred thousand innocent human beings. The rest of the world, fully

apprised of the fact, does nothing. New weapons soon start flowing from our factories

to the killing fields.

To repeat: violence, oppression, economic enslavement and social irrationality

have been endemic in history, whether tribal or metropolitan. But the twentieth

century has, owing to the magnitude of massacre, to the insane contrast between

available wealth and actual misère, to the probability that thermonuclear and bacterial

weapons could, in fact, terminate man or his environment, given to despair

a new warranty.

It has raised the distinct possibility of a reversal of evolution, of a systematic

turnabout towards bestialization. 410

Our research hinders us the loss of the past, the human history as source of intergenerational

effects, revealing that traumatic events can alter a person’s genetic

make-up, meaning the effects can be carried through generations.

Scientific American published an interview with Rachel Yehuda, about her research

on the profound impact of the Holocaust on the off-spring.

Yehuda, a researcher in the growing field of epigenetics and the intergenerational

effects of trauma on survivors and their off-spring.

410 Steiner, George, op. cit. I/7


542


Former research already revealed that descendants of people who survived the

Holocaust have different stress hormone profiles than their peers, perhaps predisposing

them to anxiety disorders. (...) Survivors have lower levels of cortisol, just

like those who suffer PTSD .411

It is not completely clear why survivors produce less cortisol, 412 but Yehuda’s

team recently found that survivors also have low levels of the enzyme 413 that

breaks down cortisol. Reducing enzyme activity keeps more free cortisol in the

body, which allows the liver and kidneys to maximize stores of glucose and metabolic

fuels (...) The younger the survivors were during WW II, the less of the

enzyme they have as adult. 414

The enzyme - 11bHDS1 and 11bHDS2 – is usually present in high levels in the

placenta to protect the fetus from the mother’ circulating cortisol. 415

Epigenetic changes often serve to biologically prepare offspring for an environment

similar to that of the parents, Yehuda explains. (...) These descendants may

also be at risk for age-related metabolic syndromes, including obesity, hypertension

and insulin resistance. 416

411 Yehuda, Rachel “Parental Posttraumatic Stress Disorder as a Vulnerability Factor for Low Cortisol Trait in offspring

of Holocaust survivors”, reprint Arch. Gen. Psychiatry, 2007.

412 This seems to be a core-problem, just like Heijmans intended.

413 11bHDS1 and 11bHDS2 (hydroxysteroid dehydrogenase, type 1 and 2)

414 Rodriguez, Tori, “Descendants of Holocaust Survivors Have Altered Stress Hormones”, Scientific American, March

2015.

415 Yehuda’s research and the Foetal programming described in the dissertation of Hompes on the hypothesis of Barker

et.al. concerning materno-Foetal undernutrition and overexposure of the fetus to glucocorticoids/stress.

The question seems likely reliable whether in both cases anxiety and undernutrition phenomenologically are intertwined.

The stronger the trauma the deeper the anxiety, the less the cortisol production and 11bHDS1 and 11bHDS2 expression.

Therefore, it is suggested that environmental stressors such as violence and hunger may operate as epigenetic modifications

and inheritance in the research of trauma survivors.

416 Rodriguez, Tori, op. cit.


543


In her paper “Holocaust Exposure Induced Intergenerational Effects on FKBP5 417

Methylation”, Yehuda reports at the end of her research:

“This is the first demonstration of an association of pre-conception parental trauma

with epigenetic alterations that is evident in both exposed parent and offspring,

providing potential insight into how severe psychophysiological trauma

can have intergenerational effects”. 418

Yehuda, who led the study at New York’s Mount Sinai hospital, said: ‘The gene

changes in the children could only be attributed to Holocaust exposure in the parents.’

The research suggests that ‘epigenetic inheritance’, where a person’s life experiences

can affect the genes of their offspring, may play a huge part in a child’s

development.

While it is widely acknowledged among scientist’s DNA does not change, chemical

tags that originate from a person’s lifestyle and habits can become attached to

DNA leading to small differences.

If these tags were to also appear in an individual’s children, it could mean factors

such as smoking, diet and stress can affect future generations.

But the idea is still controversial as most scientists believe the only way to acquire

genetic attributes is through genes contained in DNA.

A previous study showed that daughters of Dutch women who suffered from a

famine in the 1940s were more likely to develop schizophrenia.

Violence and hunger obviously to be considered as operators in the process of

genetic damage. Gene-environmental interaction – with a negative energetic ex-

417 FKPB5 regulates the glucocorticoid system by suppressing activity. Glucocorticoids are released in response to stress.

Methylation modifies DNA and can result in increased expression of a particular gene or gene-silencing. De-methylation

in individuals with the risk variant of FKPB5, who were also exposed to early life trauma, resulted in increased expression

of FKBP5, that resulted in an abnormal response to stress.

418 Yehuda, Rachel et.al. “Holocaust Exposure Induced Intergenerational Effects on FKBP5 Methylation”, Biological

Psychiatry, 2015


544


pression - results in altered epigenetics, with the next step as pre-procreation, to

the Foetal programming on the way to “gene-trauma interaction”: in other words:

“intergenerational altered epigenetic inheritance”, expressive after the gamete

preparation into the conception.

Gene-environmental interaction has a cultural contextuality: here the Holocaust

and Concentration Camp violence and hunger. In this matter of fact violence has

been the dominant factor, guided the process of trauma transmission. 419

30.3 Dutch Hunger Winter (1944-1945)

Dutch television 420 made a documentary about the hunger winter during the period

1944-1945, a period in which over 15,000 people died of starvation. In that

period were also new people born. What happened to them? Under the headline

"Hunger Winter haunts offspring" Elmar Veerman reports an interview with

Bastaan T. Heijmans, epigenetic researcher at the Leiden University Medical

Center.

Bastiaans in the publication of PNAS: “Here we show that individuals who were

prenatally exposed to famine during the Dutch Hunger Winter in 1944–45 had, 6

decades later, less DNA methylation of the imprinted IGF2 gene compared with

their unexposed, same-sex siblings. 421 (...) These data are the first to contribute

419 Kellermann, Natan P.F. “Transmission of Holocaust Trauma”. In his model he includes four levels: 1. psychodynamic,

2. socio-cultural, 3. family system and 4. biological points of view.

420 NPO-science, 29th of October 2008.

421 Heijmans, Bastiaan T., op. cit. “One of the best-characterized epigenetically regulated loci is insuline-like growth

factor II (IGF2). IGF2 is a key factor in human growth and development and is maternally imprinted. Imprinting is maintained

through the IGF2 differentially methylated region (DMR), the hypomethylation of which leads to bi-allelic expression

of IGF2. (...) IGF2 DMR methylation is a normally distributed quantitative trait that is largely determined by genetic

factors in both adolescence and middle age, indicating that the methylation mark is stable up to middle age. Thus, if affected

by environmental conditions early in human development, altered IGF2 DMR methylation may be detected many

years later.


545


empirical support for the hypothesis that early-life environmental conditions can

cause epigenetic changes in humans that persist throughout life.” 422

In a press release (2014) LUMC affirmed the research of 2008. We quote:

“During the famine of 1944-1945 the availability of food fell to a quarter of what

a man needs. Yet when children were conceived that were born with a normal

birth weight. Advanced DNA testing of famine children has now revealed that the

genes that promote growth are tuned differently by them. This probably explains

why those in middle age have a higher risk of health problems.

The modifications to the DNA that have occurred in famine children do seem to

follow a special pattern: groups of genes work together to promote growth in the

womb, are tuned differently to them than to their siblings, who were conceived

before or after the famine and born ”.423

30.4 Conditions in the uterus

The investigated Hunger Winter Children were all around 60 years old at the time

they ceded DNA to the investigation. The growth genes are adjusted life, different

for people who are conceived during the Hunger Winter.

"Adjusting genes occurs largely in the first weeks after conception. The operating

system determines which genes are on and off is then tuned. This operating system,

also known as epigenetics, consists of molecular dimmers on the DNA.

Conditions in the uterus, such as lack of food or stress of the mother, can cause

422 Heijmans, Bastiaan T., op. cit. “... we used the ongoing Hunger Winter Families Study to investigate whether prenatal

exposure to famine is associated with persistent differences in methylation of the IGF2 DMR (...) whether periconceptional

exposure to famine was associated with differences in IGF2 DMR methylation in adulthood (...) who were conceived

during the famine 6 decades ago. The exposure period thus included the very early stages of development”.

423 Press Release, LUMC 2014.


546


permanently changes in the operating system of the unborn child, Heijmans declared”.

30.5 Critical phases during pregnancy

The course of early pregnancy can thus affect health later in life. "Due to research

of famine children we can identify the critical stages of early development, important

for each pregnancy. We are now studying in a European joint venture or

adverse conditions of unborn children today, lead to similar changes to the operating

system when exposure to famine”, first author of the paper Dr. Elmar Tobi

declared. 424

Back to the publications of Yehuda and her conclusive reaction, which corresponds

to the researchers from Leiden:

“It is still too early in our investigation into the epigenetics of this complex stressresponse

system to know for sure whether these molecular changes indicate any

real-world risks or benefits ... We are just beginning of understanding this”. 425

30.6 Violence, Hunger, Trauma’s and the Extended

Mindlink-system

The Epilogue has come to an end. The extended information about the geneenvironmental

interaction, the epigenetics as operating system before and after

the conception, has a deep connection with the MFD-system of the Extended

Mindlinktest-system.

424

Tobi, Dr. Elmer et.al. “DNA methylation signatures link prenatal famine exposure to growth and metabolism”, Nature

Communications, July 2015.

425 Yehuda, Rachel, op. cit. “Parental Posttraumatic Stress Disorder as a Vulnerability Factor ...”.


547


Looking back to the layered unity of the image of man we intend to accept an

interaction between the 5th level (psychophysiological, genetic and epigenetic

level) and the 4th level (vital-emotive and unconscious like “transformed energetic

raster of memory of experiences”, memory on intra-cellular level, starting with

the primary stage of epigenetic inheritance). 426

Since these both levels form fields of work, with new opportunities and cooperation

between the conventional and the complementary medicine.

30.7 Conclusion

Womb as Lost Paradise because of disruption of homeostasis

Disruption of homeostasis in broader sense (nature and nurture) can be caused by

refusal of the physical level to accept the energetic transmitting information, offered

by the 4th level, as vital-emotive quantum field.

Disruption of homeostasis in individual sense (nature and nurture) can be caused

by intergenerational epigenetic inheritance, stem cell effects (gamete’s, ovum),

foetal programming, distortion of adaptogenic capacity and effects of intergenerational

inheritance of disasters such as being offspring of Holocaust survivors.

The results of my research on the several details of the disruption of homeostasis

has opened a new way of recovering the disbalance of people with fundamental

uncertainty and concentration distortions. Moreover these results have opened a

group treatment, with hope for people, which are physically and mentally suffering

as survivors of the Holocaust and other disasters (PTSD).

426 Lipton, Dr. Bruce, op. cit. cell memory and the storage of experiences in the cell membrane’s. Not only the cell

memory of the developmental specific and differentiated aims, but also a storage of epigenetical inherited experiences. In

our research this is similar to violence- and hunger experiences inside the “original family”, the marker of the MFDsyndrome.


548


Appendices

Appendix 1: Casuistry

Appendix 2: Literature

Appendix 3: Register

Appendix 4: Key Numbers In Qualitative Numerological Logotechnique:

basic for Partimento and structural composition

Appendix 5:

Composition “Herz” (Heart) and Analysis (528 Hz)

Composition “Vayhi Or” (Let’s there be Light) and Analysis (Nuqun

528 Hz + 528 Nm)

Composition “Keshet” (Rainbow 528 Nm + 528 Hz) and Analysis

Appendix 6: Graphical Statistics


Appendices: Casuistry

549

Appendix 1:

Casuistry

T

he casuistry of this dissertation research is a compound treatment report.

I have strived to give the variegation of therapeutic research and

treatment options in the casuistry. I am averse to success stories, because

reality usually disappears behind an unrealistic sum of results. That's why I

prefer reporting disappointments as well.

This study does not report a therapeutic system, which is intended to be perfect. It

doesn't make sense to indicate a formula of success. The music therapeutic aspects

are more implicit like explicit present in these cases. Although it might be

clear 528 Hz music, composed as a complex full score, directed as music therapeutical

core moment, addressed to the caregiving program, functions as an attractor

for the Schumann Resonances, absorbed and embedded into the Mindlinksystem,

as a therapeutic key, created due to the Hebrew language.

One of the clients only came in rest after a placebo tube with grains. After one

month she was able to take 2 grains of only 528 Hz music. Nonetheless, the process

of the MFD-syndrome, with prenatal distortions and heavy traumatic experiences

of sexual abuse, positively increased. The provisional treatment with transformed

528 Hz music only, has confirmed 528 Hz as a core-element of the Orchestrating

Factor of Repair, also underpinned through the next test results.

Thus, the combination of the standard Mindlink-test + 528 Hz music, complemented

by diversity of the frequencies, creating the 12-tone series + the Schumann

Resonances - transformed by the technology of Tesla-scalarwaves – form

the Orchestrating Factor of Repair (OFR). This OFR elements we bundle as Extended

Mindlink System (EMS), for the awareness invaluable.



550

How can I treat a client who is opposed by a strong, unconscious conviction of

self-sabotage and against any treatment as well? De-activation of these stored –

permanently active – epigenetic inherited and daily experiences of life, has been

the greatest wish of my 40-years of therapeutical praxis. My desire has been silenced

after embracing the Mindlink-system and the powerful 528 Hz music, embedded

in the Hebrew linguistics.

The potential complexity of Extended Mindlink System as Orchestrating Factor

of Repair, with such collective opportunities, is why I dare to the integrated medical

and therapeutical community: add Extended Mindlink System to your own

practice, and the positive effects of your efforts will increase enormously. In this

fragmented casuistry I will give evidence demanded to these verdicts. *

* The Cases are divided in Research connected as the first stage of the research.

The Cases MFD presuppose the six-month basic treatment with a stop or a follow-up

to the MFD-syndrome. The ranking is random.

Casus Research (Female, 52)

My experience with Mindlink Research Practice

One and a half year ago I came because of my insecurity and difficulty with concentrating

myself, in touch with the Mindlink-system and scientific dissertation

research of Gideon Benavraham.

I've been through a lot, of harsh times especially in my youth. I did my very best,

but time and again I ran against a wall in myself. I felt usually sad, and full of

bodily pain. The conclusion of the family doctor after a consult was: there’s nothing

wrong with your health!

From the beginning, I was impressed about the Mindlinktest, which exactly

opened the hidden place, where my life was obstructed. It was clear to me, and so

it could be confirmed as exactly



551

the truth. The sugar grains, which carry the energy of the positive affirmations

and music, were working!

The breakthrough came in spring of 2015. In a test around the period of maternal

pregnancy, we discovered I didn’t want to be born. A fundamental attended prenatal

testing period followed for many months then. I was suffering at the MFDsyndrome,

as Gideon called this disruption. I understood and agreed on the outcome

of the test anytime.

The followed operation of the granules was very intensively. After a few days the

intensity took off and during the following weeks, I felt released from a heavy

pressure, disappeared from my shoulders.

Now, I can breathe again, and I am feeling more and more space inside and

around me, with less uncertainty and a better concentration, however it remains

trial and error.

Mindlink and the 528 Hz music made me feel virtually about 20 years younger,

more vital, more free. I am beginning to regain confidence in myself. I came

home within myself.

I am very impressed about the knowledge and support according to the Mindlinksystem

within Gideon’s

“Hermeneutic Mindlink Research Practice”, a difficult name, but I could still understand.

Anyone who is experiencing turmoil in him- of herself and wants to

become free of it. I recommend Mindlink. You will be amazed what a profound

affect this system, combined with 528 Hz. music, can have on your life.

Casus Research (Male, 63)

Rebuked by the cardiologist

A few weeks after the initial screening test the client, being a heart patient, was

for inspection at the cardiologist in the hospital. After a test, the cardiologist said:

"I do not know what you have done, but there is quite a real improvement. The



552

client told him about Mindlink-therapy and grains with 528 Hz music. The doctor

acknowledged “What ever happens, continue with this”. Many months later, the

patient wasn't consequently taking the grains anymore. He received a bit angry

warning of the cardiologist to be more accurate with using the grains. The

Mindlinktest showed a gradual progress in his cardiovascular disorder.


Unwanted

The reference to "original family" was quite right. I do not need to look far back

from where my uncertainty is coming from: It was obvious I couldn’t do any

good in the eyes of my parents, and I was nothing compared to my sister, my father's

eyeball. My mother did not want me, attempted abortion, but eventually

took pleasure that I came, but I cannot remember ever being pampered by her.

She could not help it. I wear in me the uncertainty whether I may exist. I am feeling

this my whole life. You, Gideon, have opened my eyes to the core of my uncertainty

and guilt. Guilt isn’t an expression of unethical deeds done by me, but

only the fact I am still alive. I decided to enter the basic treatment program, and

now I am very far in the process of the MFD, as Gideon calls the prenatal developmental

disorders. Without Mindlink I would never have become free!


It does not make sense to me

After the second test it became clear the uncertainty of this woman had everything

to do with the social context during her mother’s pregnancy and afterwards.

Her father had an aggressive drink problem. This context shaped her life in the

parental home. After the first month of research, she noticed a growing peace

coming over her and she felt more stable. This improvement continued after the



553

second test, but nevertheless she decided not to go on. The reason why she kept

for herself. (She belonged to the control, placebo group, as it revealed afterwards.)

Casus Research (Boy, 9)

Autistic behaviour

The only answer to every question directed at him, would set this boy into tears.

Speaking about himself was unthinkable, his parents and teachers at school were

desperate. I tested him in a proposed playful way and merely limited the solutions

to the Mindlink harmonization plan plus 528 Hz music. Nonetheless, during the

test I could ask him something about himself. A month later I took the second

test. His mother reported a slight improvement. Now I could more talk with him

and the test was a play for him. After several weeks, I received a note of his

mother, the next appointment could be cancelled. He was very improved with a

big break through caused by tests and grains, to the amazement of his family and

school teachers. A year later, the mother confirmed his steady improvement and

his obviously high talented, we attended his mother during the last test.


German woman, offspring of a WWII-survivor

After the first test, it was clear that epigenetic inheritance governed the lineage of

ancestors, who survived the Shoah. By using the marker "original family," we set

up the inquiry into the MFD-syndrome, which after the first full test became confirmed.

After four treatments with positive energetic Mindlink solutions and 528

Hz music, they reported substantial progress in feelings of security and concentration.

Her life is stabilizing slowly. The globuli treatment caused occasionally



554

pain and intense emotion. The effects of prenatal programming disappear gradually.

Memories took off, and vitality increased.

Casus Research (Male, 58)

German mother on the run, during WWII

"My uncertainty should have everything to do with the war and my mother was

carrying the harmful effects of the flight during the war period." He said that she

was a German refugee, chased by the Nazi’s for unknown reasons. After two research

tests, he decided to continue with the basic treatment. The marker "original

family" steady present in the tests, revealed the MFD-syndrome. The symptoms,

associated with MFD, disappeared entirely after a testing treatment of several

months, without using pharmacological support. Now we are working on the effects

of his Foetal programmed life development, partly based on the epigenetic

inheritance. Significant barriers that prevent the flow of life energy presented

themselves during the test. His unconscious obviously cleaned up by the systematically

treatment with transformed music and affirmations as positive contrainformation.

Casus MFD-syndrome: (Kid, 3)

Restless little daughter

I would like to give thanks for the music grains of 528 Hz. My daughter (3 yrs.) is

much more tranquil comparable with two months ago.


A coach expresses her experiences with Mindlink-system



555

Should it be merely a coincidence that I read a message on Facebook about an

investigation of uncertainty as a focus? I do not think so.

Every day I am grateful to Gideon. In the past year, he has made me familiar with

the Mindlink Therapy. Because of the positive effects, I have experienced in my

life, shortly, I will practice the

Mindlinktest in my work as a coach.

I was looking for the roots of my fears and uncertainties, which have regularly

made my life full of ADHD turmoil.

Thanks to the awareness of the Mindlink-system, that took place in a very subtle,

but powerful way.

Discovery the root of my insecurity and my self-esteem - the prenatal period, in

which my self-denial and other disorders have developed – it has given my life a

positive turn, I want to pass this on to others, through my coaching practice. I

don’t mean to be single in this strive. I want work in collaboration with other

coaches and therapists, who also have embraced Mindlink and the 528 Hz music

operator, and are convinced of the unique opportunities we can offer with

Mindlink-system, as support for other treatment and counselling forms (regular

and complementary) as well.

Let us join hands in communicating this universal method for many people, suffering

at the profound epigenetic inheritance and Foetal programming, as I did.

Casus MFD-syndrome (Male, 50)

The Programming Blockage remain too strong: a therapeutical defeat

Many months I work with him. His agoraphobia was very strong. After starting

with the first stage of the research I was clear to me: he was suffering at a prenatal

distortion. The test affirmed my conclusion. After starting the basic treatment,

my conviction became stronger and his resistance against the therapy increased,

but he remained in an attitude of pleasing behaviour. We started the MFD-



556

research and I felt, I was close to the center of his fear. His resistance was directly

disproportional to my increasing conviction. His programming blockade however

was 0%, but nevertheless I couldn’t reach him with the tests and the applicable

hermeneutical therapy.

After a friendly good-bye some days after the consult, I got a furious mail: he

distrusted me, and I was terribly wrong with my vision, at that moment I told

him, he refused to be healthy, because of the order to take responsibility for himself

and others. My conclusion was: “bull’s eye”. I only wanted earn money and I

was a liar and a fantasist, he said.

It was a painful experience, but such kind of situations are unavoidable in the

medical and therapeutical praxis.


A new insight after finishing the MFD-test

The month after the first MFD-syndrome test my client reported me enthusiastically:

“My entire life I wondered about my place in life; why do I exist? Now you confronted

me with a death wish,

developed during the prenatal period. Now, some days after the test, I released

and became free of these clamping feelings”.

He affirmed the trustworthiness of the Extended Mindlink System concerning the

de-activating

of the unconscious, negative energetic memories and the activating of the selfrecovering

abilities.


The rope of self-hatred around my neck



557

"Confirmation that I was welcome in life, I never got it. It was always about what

I did wrong.

Visualization illuminated the image of the rope around my neck, with explosive

fear and blocking every time I had to perform, for example at school.” Intestinal

problems expressed their story of tension and self-hatred. The marker "original

family" led along the path of the basic treatment program, directly to the MFD,

with a positive result after about six months. An “irritable bowel syndrome” was

the medical remnant of the tension of all years of life. The treatment is still going

on.

Casus MFD-syndrome (Female, 38)

Not linking both hemisphere’s

She was convinced her left and right hemispheres of the brain didn’t work together.

Her daily experience affirmed this to her, but she never went to a doctor. As a

part of the MFD-research, we found the affirmation.

After some month’s the feelings disappeared by the combination of Mindlink and

528 Hz.

Casus MFD-syndrome (Female, 23)

Hermeneutics and grief counselling

Not only a treatment by tests and grains forms the complete content of the Extended

Mindlink System. Understanding and translation of the life story, listening

in an empathic attitude, belongs to the core of the system, as a part of the next

case illustrates.

"I found myself getting stuck in my past and, therefore, difficult new challenges

contracted. I was suffering from an unexplained uncertainty. Through talk sessions

with Gideon - along with the tests - I got new insights and experienced con-



558

siderable personal growth. I'm more sure of myself, dare to rely more on my feelings

at school (Masters). Therefore it improved and I am easy to get along with

others.

Gideon has been a support to me in my times of grief counselling. Also, to the

tests and the associated grains has the Mindlink system also helped me in expressing

my feelings. These upgrades also affect my social life in a positive way.

Casus “my private experience”

Effects of daily presence within the scalar energy field and music of 528 Hz

Seven years ago I lost my ability of speech. In a blink of an eye, I could not make

any sound. Something my wrong in my brain, but medical an atypical disorder.

After two years of therapy, I could speak a bit through a text-to-speech-computer

program and a small amplifier for one-to-one meetings. After starting my research

on the Mindlink-system, my daily study and treatment of clients, made me

sitting on the energetic cloud of quantum consciousness, created by the Teslatechnological

system of Mindlink. Now, two years later, my speech ability has

improved so much that I can speak without amplifier in a one-to-one meeting. I

can give lectures again only with my amplifier, and I stopped working with the

computer program.

I am quite sure, the daily sphere of influence caused by the continue treatments of

others with Mindlink and 528 Hz music (transformed by the Tesla-technology)

has saved me from a medical insolvable distortion. The remnant of the braindamage

has been weaker, so I can manage by professional life again.

I am indebted to Dr. Hans Lechner, developer of this system. But time and again

the energetical contact with the Source of All has given me blessings.

MFD-syndrome: Improvement and Continuation of Research



559

Value improvement of daily life

Many of the 42 clients with the MFD-syndrome are questioned about the improvement

of their daily life.

All clients reported improvement of the entire life or significant parts of the lifeproblems.

What is the value of improvement expressed in a digit on the scale 1 – 10?

On the average the score was between 7 and 9 with the general description: better

balanced, more inspired, more stable and less restlessness like ADHD-turmoil.

Main reason for the improvement: disappearing of unnameable, vague complaints.

Research Conclusion Improvement

The ongoing process from the first stage of the research onto the MFD-syndrome

as the third phase of the research, has shown a very impressive development as a

combination of 528 Hz music (earth beat frequencies of Schumann Resonances

included) implemented into the Mindlink-system, resulted in the new version:

Extended Mindlink System (EMS).

Offspring of War- and PTSD-survivors

Based on the results of MFD we will continue a longitudinal research as a deeper

specialization of epigenetic inheritance, foetal programming and vital-emotive

distortions, with the EMS, connected with interested epigenetics and cell biologists.

The casuistry of this dissertation research is a compound treatment report. I have

strived to give the variegation of therapeutic research and treatment options in the

casuistry. I am averse to success stories, because reality usually disappears behind



560

an unrealistic sum of results. That's why I prefer reporting disappointments as

well.

This study does not report a therapeutic system, which is intended to be perfect. It

doesn't make sense to indicate a formula of success. The music therapeutic aspects

are more implicit like explicit present in these cases. Although it might be

clear 528 Hz music, composed as a complex full score, directed as music therapeutical

core moment, addressed to the caregiving program, functions as an attractor

for the Schumann Resonances, absorbed and embedded into the Mindlinksystem,

as a therapeutic key, created due to the Hebrew language.

One of the clients only came in rest after a placebo tube with grains. After one

month she was able to take 2 grains of only 528 Hz music. Nonetheless, the process

of the MFD-syndrome, with prenatal distortions and heavy traumatic experiences

of sexual abuse, positively increased. The provisional treatment with transformed

528 Hz music only, has confirmed 528 Hz as a core-element of the Orchestrating

Factor of Repair, also underpinned through the next test results.

Thus, the combination of the standard Mindlink-test + 528 Hz music, complemented

by diversity of the frequencies, creating the 12-tone series + the Schumann

Resonances - transformed by the technology of Tesla-scalarwaves – form

the Orchestrating Factor of Repair (OFR). This OFR elements we bundle as Extended

Mindlink System (EMS), for the awareness invaluable.

How can I treat a client who is opposed by a strong, unconscious conviction of

self-sabotage and against any treatment as well? De-activation of these stored –

permanently active – epigenetic inherited and daily experiences of life, has been

the greatest wish of my 40-years of therapeutical praxis. My desire has been silenced

after embracing the Mindlink-system and the powerful 528 Hz music, embedded

in the Hebrew linguistics.


Appendices: Literature and Register

561

Appendix 2:

Literature



562

1. Abbott, Adwin A., Flatland: A Romance of Many Dimensions, unabridged, New

York, 1952

2. Ader, Robert, Founder of Psychoneuroimmunology, Dies, 2011

3. Alberts, Bruce, et.al. Essential Cell Biology, Garland Science, New York, 2014

4. Andersen, Brian David, Manipulating and Harnessing the Schumann Resonance,

2005, Tri-Vortex Technology, www.trivortex.com

5. Andersson, Terése, Estrogen and Glucocorticoid Metabolism, diss. Umea, no.

1345, 2010

6. Anodea, Judith, Eastern Body, Western Mind, Berkeley, 1996

7. Appelo, Martin, The Layered Brain, Amsterdam, 2010

8. Arvind, Quantum entanglement and quantum computational algorithms, Indian

Academy of Science, Pramana Journal of physics, 2001

9. Austermann, Alfred R. et.al. Ich habe meinen Zwilling verloren. Alleingeborenen

erzählen (I lost my twin *), Berlin, 2013

10. Austermann, Alfred, R. et.al. Das Drama im Muterleib-die verlorene Zwieling

(The drama in the womb-the lost twin), Berlin, 2006

11. Austin, James H. Zen and the Brain, MIT, Massachusetts, 2000

12. Balkom, Ingrid D.C., Phenotypes and epidemiology of rare neurodevelopmental

disorders, diss. Amsterdam, 2012

13. Barker, D.J.P. Foetal origins of coronary heart disease, BMJ-publishing 311, July

1995

14. Barker, D.J.P. The Foetal and infant origins of adult disease– The Womb may be

more important than the home. BMJ-publishing 301, 1990

15. Bates, Don, Knowledge and the Scholarly Medical Traditions, Cambridge, 1995

16. Bearden, Tom, Extraordinary Biology, Chapter 5: Kervran Transmutations Biologique,

Paris 1962

17. Behe, Michael, J. Dawin’s Black Box: The Biochemical Challenge to Evolution,

New York, 1996

18. Benavraham, Gideon “Medical Power and Social Cultural Ethics”- about dissociative

identity, resocialiation and experience-competence” (unpublished), 2012.

19. Benavraham, Gideon, Adam, where are you? About spirituality and ethics of responsibility,

2004

20. Benavraham, Gideon, In the Twilight of the Eastern European Dialectic Materialism,

1990

21. Benavraham, Gideon, Obstetrics and Pathogenesis of Insecure Attachment, Study

2014.

22. Benavraham, Gideon, Structure Analysis and Language Symbolism, 1988

23. Benavraham, Gideon, Systematic Hermeneutics, a philosophical study of hermeneutic

therapeutic modelling, 1999

24. Benavraham, Gideon, Talent and Character, basic for spiritual maturity, 2003

25. Benitez-Burraco, A., FOXP2: from the specific disorder to the molecular biology



563

of language. Implications for the ontogenesis and phylogenesis of language. Pub

Med. 2011

26. Bennett, Jonathan, A Study of Spinoza’s Ethics, Indianapolis, 1984

27. Bergh, B.R.H.M. van den et.al. Antenal maternal anxiety is related to HPA-axis

dysregulation and self-reported depressive symptoms in adolescence: A prospective

study on the Foetal origins of depressed moods, Neuropsychopharmacology,

33(3), pp. 536-545

28. Bergh, B.R.H.M. van den, Alfons Marcoen, High Antenatal Maternal Anxiety is

Related to ADHD Symptoms, Externalizing Problems, and Anxiety in 8- and 9-

Year-Olds, Society for Research in Child Development, 2004

29. Bergh, B.R.H.M. van den, To Become or to Be, The Duality of Neurodevelopment

has a Perinatal and therefore also Social Dimension (Inaugural UvT 2010)

30. Bergh, Bea, et.al. Developmental Psychology (Dutch), Nijmegen, 2004

31. Biblia Hebraica Stuttgartensia, Deutsche Bibelgeselschaft Stuttgart, 1967-1977

32. Bishop, D.V.M. Genes, Cognition, and Communication, Insights from Neurodevelopmental

Disorders, Ann. of N.Y. Academy of Sciences 2009

33. Bodifée, Gerard, Attention and Presention: Creativity in an unfinished world,

World Library,

34. Boer, A. den, et.al. Core Problems of Psychiatry (Dutch), Amsterdam, 2008

35. Boer, Theo, de, Grondslagen van een kritische psychologie (Foundations of a

critical psychology), Baarn, 1980

36. Boerman, Robert, Water, Sound and Images, Deventer, 2008

37. Bohm, David, Causality and Change in Modern Physics, Penn. Press. 1971

38. Bohm, David, Lee Nichol On Dialogue, London 1996

39. Bohm, David, Wholeness and the Implicate Order, London 1983

40. Bolhuis, Johan J. et.al. Birdsong, Speech, and Language: Exploring the Evolution

of Mind and Brain, MIT-press, 2013

41. Bolk’s Companions, The Healing Process, Organ of Repair, Netherlands, 2008

42. Bongers, Karlienn et.al. Integrative Medicine, Amsterdam 2015

43. Bonnet, Jerome et.al. Rewritable digital data storage in live cells via engineered

control of recombination directionality, PNAS 2012, Vol. 109/23

44. Borges, Jorge Luis, The Aleph, Aleph.web.archive.

45. Bosman, S. Stimulation of self-healing ability by Schumann resonance (Dutch

art. TIG 19, 2003

46. Bosman, Saskia, Role of Pineal Gland in mystical experiences (Dutch publication)

Endocriene pagina, follow@stamcel.org, 2014.

47. Braden, Greg, The God Code, the Secret of Our Past, the Promise of Our Future,

London, 2004

48. Brainard, M.S. et.al. Translating Birdsong: Songbirds as a model for basic and

applied medical research, Annu Rev Neuroscience, Author manuscript in PMC,

August 2014

49. Brainwave Entrainment, www.infiniteMinds.info.

50. Briley, Paul M. et.al. Evidence for Pitch Chroma Mapping in Human Auditory



564

Cortex, Cerebral Cortex, 2013

51. Bruni, Kees, Brain from Pharaoh to fMRI (Dutch), We are People, not Brains,

Delft, 2015

52. Buber, Martin, Geschichte des Individuationsproblems (History of the Modern

Individu), 1904

53. Buber, Martin, Urdistanz und Beziehung, Werke zu Philosophie, München, s.a.

54. Buss, Claudia, Maternal cortisol over the course of pregnancy and subsequent

child amygdala and hippocampus volumes and affective problems, Proceedings

N.A.S., vol. 109, 20

55. Cajochen, Christian, et.al. Circadian and Light Effects on Human Sleepiness-

Alertness, Center for Chronobiology, Bazel, s.a.

56. Callahan, Roger, Tapping Out Trauma, Stress, Fear and Anxiety Removes Our

Blocks to Achieving Success and Well-Being, 2012 www.RogerCallahan.com.

57. Campbell, Don, The Mozart Effect, New York, 2001

58. Campbell, Polli et.al. Conservation and Diversity of Foxp2 Expression in Muroid

Rodents: Functional Implications, The Journal of Comparative Neurology, 2009

59. Capra, Fritjov, The Tao of Physics, Shambhala Boulder, 1975

60. Chamberlain, David B. When Does Parenting Begin? An Introduction, APPPAH,

2014

61. Chandler, John, The 216 Golden Rectangle, Blogspot, 2014

62. Chen, Yu-Chien, et.al. Roles of Melatonin in Foetal Programming in Compromised

Pregnancies, Int. Journal of Molecular Science, 2013

63. Cocilovo, Anna, Coloured Light Therapy: Overview of its History, Theory, Recent

Developments and Clinical Applications Combined with Acupuncture,

American Journal of Acupuncture, vol. 27, 1&2, 1999

64. Codex Medicus, Reeds Business, Amsterdam, 2009

65. Commeren, Ad, DNA-generator – 3

66. Contradiction, Stanford Encyclopedia of Philosophy, Center for the study of

Language and Information, ISSN 1095-5054

67. Cooper, Rabbi David A. God is a Verb. Kabbalah and the Practice of Mystical

Judaism, New York 1997

68. Cornelis, Arnold, Logic of Feelings (Belgium), Brussels, 1988

69. Corum, Kenneth L., et.al. Nikola Tesla and the Planetary Radio Signals, Belgrade,

1996

70. Counet, Patrick Chatelion et.al. God, I presume: the elusiveness of theology and

physics (Dutch), Zoetermeer, 2000

71. Dankers, Beau, Attachment and Autonomy in Mood and Anxiety Disorders and

Personal Disorders, Tilburg, s.a.

72. Davies, Kevin, Cracking the Genome, Inside the Race to Unlock Human DNA,



565

2001

73. Davies, Paul, The Fifth Miracle, London, 1998

74. Dawkins, Richard, The Blind Watchmaker, Harlow:Longman, 1986

75. Dawkins, Richard, The God Delusion, Batantam Press, 2006

76. Dawkins, Richard, The Selfish Gene, Oxford, 1976

77. Denys, Damiaan, et.al. Manual of Psychiatry and Philosophy (Dutch), Utrecht,

2012

78. Derrida, Jacques, La voix et le phénomène (The Voice and the Phenomenon, Introduction

the Sign in the philosophy of Husserl), Paris, 1967

79. Description Scalar Wave Technology, 2015

80. Diamond, Jared, The Third Chimpansee. The Evolution and Future of the Human

Animal,

81. Dickinson, Hayley, et.al. Sex-Specific Effects of Prenatal Glucocorticoids on

Placenta Development, s.a.

82. Dijkema, Jan, The physics of Music (Dutch article), 1998/1999

83. Dijksterhuis, A.P. The Smart Unconsciousness: Thinking with Feeling (Dutch),

Amsterdam, 2007

84. Dingemans, P.M.A.J. Schizophrenia: research and implications of treatment

(Dutch), Houten, 1995

85. Distin, Kate, The Selfish Meme. A Critical Reassesment, Cambridge University

Press, s.a.

86. Dowling, Terence Transmarginaler Stress und paradoxe Reaktionen. Das

Konzept der psychosomatischen Implosion, Adelphos, s.a.

87. DSM-V (2013), Diagnostic and Statistical Manual of Mental Disorders, APA,

2013

88. Eckhard, Clint, Understanding Pitch and Chroma, Prolobe, 2015

89. Efron, John, M. Medicine and the German Jews: A History, Yale University,

2001

90. Erhuma, Aml Mohammed, Glucocorticoids: Biochemical Group That Play Key

Role in Foetal Programming of Adult Disease, www.dx.doi.org/10.5772/50798

91. Evers, Dayan, Dead mother, live incubator, (Dutch article), NIW, 19/2014

92. Extendo, The DPP-IV enzyme (Dutch article) s.a.

93. Feinstein, Rabbi Edward, The Chutzpah Imperative, Woodstock, 2014

94. Ferguson, Susan, The Matrix and the Sanskrit Texts, collection of articles,

methaphysical Musing.com

95. Fibonacci, Rodin, Wheel Symmetries, January 2011

96. Fisher, Simon E. et.al. FOXP2 as a molecular window into speech and language,

Cell, 2000

97. Fisher, Simon E. et.al. FOXP2 as a molecular window into speech and language,

Cell 2008

98. Fitch, W.T. et.al. The biology and evolution of music: A comparative perspective,

Science Direct, Cognition 100, 2006, pp 173-215



566

99. Foster, Harold, D. What Really Causes Schizophrenia, Ortho Communications,

2006

100. Foudraine, Jan, Bunker Builders, Amsterdam 1997

101. Fridman, Ruth, The Maternal Womb: The First Musical School for the Baby,

APPPAH, 2014

102. Frijda, Nico H. The Emotions, Cambridge, 1986

103. Frischman, Yehuda, Medicine in Judaism 1, Breslev.co.il.

104. Frischman, Yehuda, Medicine in Judaism 2, Breslev.co.il.

105. Frischman, Yehuda, Medicine in Judaism 3, Similarities between traditional Jewish

and Chinese Medicine, Breslev.co.il.

106. Frischman, Yehuda, Sun, Torah and Vitamin D and other important Jewish medical

articles Breslev.co.il.

107. Frischman, Yehuda, Traditional Jewish Medicine, Breslev.co.il.

108. Gadamer, Hans-George, Hermeneutik I, Band 1 Gesammelte Werke, Tübingen,

1986 (Truth and Method, London 1975)

109. Gage, Fred et.al. Your Brain Under the Microscope: The Promise of Stem Cells,

The Dana Foundation/Cerebrum

110. Gariaev, P.P., et.al. DNA as Basis for Quantum Biocomputer, DNA Decipher

Journal, 2011

111. Gaser, Chr. et.al. Neuroanatomy of ‘Hearing Voices’: A Frontotemporal Brain

Structural Abnormality Associated with Auditory Hallucinations in Schizophrenia,

pub. University of Jena, Cerebral Cortex, 2004.

112. Geday, Jacob, Functions of the Medial Frontal Cortex, a Model of Monoaminerge

Modulation, diss. Aahus University Denmark, 2009

113. Geijskens, Tomas, et.al. Questions to Freud, From death drive to attachment theory,

Amsterdam, 2003

114. Gerkin, Charles, V. Widening the Horizons, Philadelphia, 1986

115. Gerven, Marko van, System Biology in Psychiatry (Dutch article), Magazine of

Integrate Medicine (TIG, 30/3), 2015

116. Gesenius, W. Hebraisches und Aramaisches Handwörterbuch, Heidelberg, 1962

117. Ginsburgh, Harav Yitzchak, The Hebrew Language: An Ideal Model for Information

Processing and Management, Galeinai Publication Society, edited 2005.

118. Gissis, Snait, B. and Eva Jablonka, Transformations of Lamarkism: From Subtle

Fluids to Molecular Biology, London, 2000

119. Goswami, A. Creative Evolution – A Physicist’s Resolution Darwinism and Intellgent

Design, Wheaton, 2008

120. Goswami, A. The Quantum Doctor, Charlottesville, 2004

121. Green, Arthur, EHYEH, A Kabbalah for tomorrow, Woodstock, 2003

122. Guthrie, M. et.al. Interaction between cognitive and motor cortico-basal ganglia

loops during decision making: a computational study, Journal of Neurophysiology,

June 2013

123. Halici, Ugur, Neural Networks as Associative Memory, Ankara

124. Hameroff, S. Quantum computation in brain microtubules? The Penrose-



567

Hameroff “Orch OR” model of consciousness, 2013,

www.quantumconsciousness.org

125. Hameroff, Stuart et.al. Consciousness in the Universe, A review of the Orch OR

theory, Oxford, 2013

126. Harpers Collins, 1992

127. Heidegger, Martin, Being and Time, translation Oxford 1962 (Sein und Zeit, Tübingen)

128. Heij, Monique, de, Emptiness of Existence (Dutch), Delft, 2013

129. Heijmans, Bastiaan T. et.al. Persistent epigenetic differences associated with prenatal

exposure to famine in humans, PNAS, 2008

130. Hepper, Peter, Unraveling Our Beginnings: on the Embryonic Science of Foetal

Psychology, APPPAH, 2014

131. Hero, Barbara, On the Effects of Music Art as Therapy, Collected Works, lambdoma.com

132. Hoedemaker, Ph.J. Pathology (Dutch scientific publication) Maarssen, 1999

133. Hoenders, Rogier, Integrative Psychiatry Conceptual foundation, implementation

and effectiveness, diss. State University Groningen (nl).

134. Höhne, Nina, et.al. FKBP5 Genotype-Dependent DNA Methylation and mRNA

Regulation After Psychosocial Stress in Remitted Depression and Healthy Controls,

Int. J. of Neuropsychopharmacol, 2015, 18/4.

135. Hompes, Titia, et.al. Investigating the influence of maternal cortisol and emotional

state during pregnancy on the DNA methylation status of the glucocorticoid

receptor gene (NR3C1) promotor region in cord blood, Journal of Psychiatric

Research, September 2014

136. Hompes, Titia, The Effect of Maternal Prenatal Emotional Wellbeing and Maternal

Cortisol on Foetal and Child Development, an Epigenetic Study, (unpublished

diss.), Cath. University of Louvain, 2014

137. Honing, Henkjan, et.al. Without it no music: cognition, biology and evolution of

musicality, Philosophical Transactions B 370: 20140088

138. Honingh, Aline, et.al. In search of universal properties of musical scales, Journal

of New Music Research 2011

139. Hoogsteder, Mariëtte, et.al. Attachment and Loyalty (Dutch) Amsterdam, 2012

140. Horowitz, L.G. The Book of 528. Prosperity Key of Love, Tetrahedron Publishing

Group, 2011

141. Hugdahl, Kenneth et.al. Auditory hallucinations in schizophrenia: the role of

cognitive, brain structural and genetic disturbances in the left temporal lobe,

Frontiers, 2008/1

142. Hugdahl, Kenneth, et.al. “Hearing Voices”: Auditory hallucinations as failure of

top-down control of bottom-up perceptual processes, Scandinavian Journal of

Psychology, 2009, 50, pp 553-560

143. Hulse, D.D. Forgotten in Time: The Ancient Solfeggio Frequencies,

www.somaenergetics.com

144. Icke, Vincent, Gravity doesn’t exist, University Press Amsterdam, 2014



568

145. IJzendoorn, M.H. et.al. Are Children of Holocaust Survivors Less Well-Adapted?

A Meta-Analytic Investigation of Secondary Traumatization, Journal of Traumatic

Stress, 2003, pp 459-469

146. Indian Council of Medical Health Research, Mental Health Research in India,

Technical Monograph on ICMR Mental Health Studies, New Delhi, 2005

147. Irwin, Michael, Psychoneuroimmunology of Depression, Brain Behavior Immunology,

2000 (PubMed).

148. Jewish Link, The Course in Jewish Healing, 2011

149. Jourdain, Robert, Music, the Brain and Ecstasy: How music captures our imagination,

New York, 1997

150. Kaplan, Fara, Holocaust Survivors and Their Children: A Search for Positive

Effects, AAETS.org/article 96.htm

151. Kares, Horst, et.al. Der etwas andere Kopf- und Gesichtsschmerz: Craniomandibuläre

Dysfunktionen CMD (The slightly different head and facial pain: Craniomandibular

dysfunctions CMD), Erlangen, 2011

152. Kellermann, Natan, P.F. Transmission of Holocaust Trauma, AMCHA, s.a.

153. Kent, David, J. Tesla – The Wizard of Electricity, New York, 2013

154. Klengel, Torsten, et.al. Allele-specific FKBP5 DNA demethylation mediates

gene-childhood trauma interactions, Nature Neuroscience 16, 2013 (PubMed)

155. Klinghardt, Dietrich, Lehrbuch der Psycho-Kinesiologie, Instititut für Neurobiologie,

2006

156. Klotter, Jule, Light, Cancer and Fritz-Albert Popp, Townsend Letter, 2010

157. Klotz, Neil Douglas, Methodical Madness: The “psychotic” and the “Spiritual” in

the development of Western Religious Hermeneutics, Edinburgh Institute for

Advanced Learning, 2000

158. Knight-Jadczyk, Laura, Transmarginal Inhibition, Cassiopedia.com

159. Köhler-Baumgartner, Lexicon in Veteris Testamenti Libros, Leiden, 1908

160. Kok, Albert, The hierarchical brain: Introduction of Cognitive Neuroscience

(Dutch), Assen (Memory as Multiple System), 2004

161. Kotermanski, Shawn Edward, Mechanism of block and behavioral effects of the

N-methyl-D-aspartate receptor antagonists Memantine and Ketamine, Neuroscience

Pittsburgh, 2001

162. Kour, Kamalpreet, et.al. Mematine for Schizophrenia, the Cochrane Library,

2013

163. Kuks, J.B.M. et.al. Clinical Neurology (Dutch) Springer Media, Houten, 2012

164. Labuschagne, C.J. The Incomparability of YHWH in the Old Testament (diss.

Pretoria), Leiden, 1966

165. Laszlo, Ervin, The Akashic Field, Dutton/Penguin USA, 2007

166. Lechner, J. Skalar-Musik für das gestresste, Raum & Zeit, 183, 2013.



569

167. Lechner, Johann, Das Handbuch: Armlängenreflex-Test und Systemische Kinesiologie

(The Handbook: Armlength-reflextest and Systemic Kinesiology),

Kirchzarten bei Freiburg, 2002

168. Lechner, Johann, Dialog mit dem inneren Bewusstsein: Mit moderne Skalarwellen-Technik

zu emotionaler Selbstbalance und autonomen Bewustseinsstrategien

(Dialogue with the inner consciousness: With modern scalar wave technics to

emotional balance and self-autonomous Consciousness Strategy), private edition,

2008

169. Lechner, Johann, Störfelddiagnostik, Medikamenten- und Materialtest II,

Kötzling, 2000

170. Lechner, Johann, Störfelder im Trigeminusbereich und Systemerkrankungen,

Kötzing, 1999

171. Lee, Andrew, Reductive Explanation and Qualia, Aporia vol. 24 no 2-2011

172. Leone, Dino P. et.al. The determination of projection neuron identity in the developing

cerebral cortex, Science Direct, Neurobiology 2008

173. Levinas and Buber, Transcendence and society, Sophia 38, 1999

174. Levinas, Emmanuel, Entre Nous (Between us), Paris, 1991

175. Levinas, Emmanuel, Otherwise than Being or Beyond Essence, The Hague, 1988

176. Levinas, Emmanuel, Totality and Infinity, London 1961

177. Levitin, D.L. et.al. Musical rhythm spectra from Bach to Joplin obey a 1/f power

law., PNAS, vol 109 March 2012

178. Levitin, Daniel, This Is Your Brain On Music; Understanding a Human Obsession,

Dutton, 2006

179. Lieberman, Ph. FOXP2 and Human Cognition, Cell 137, May 2009

180. Lietaer, G. et.al. Client-centered and experiential psychotherapy in the Nineties,

Louvain, 1990

181. Lipton, Bruce, The Biology of Believe. Unleashing the Power of Consciousness,

Matter and Miracles, Santa Rosa, 2005

182. Lommel, Pim, van, Infinity Consciousness (NDE) (Dutch), Kampen, 2007

183. Lorentz, Madeline, M. Stress and Psychoneuroimmunology Revisited: Using

mind-body interventions to reduce stress, Alternative Journal of Nursing, 2006,

Issue 11

184. Lubber, R. et.al. Hermeneutical Diagnostic and Problem Solving: human being as

text

185. Lubbers, R. Psychotherapy (Dutch University Utrecht), 1988

186. Lundi, Miranda, et.al. Quadrivium, Wooden Books, New York, 2010

187. Lyotard, Jead-Francois, La condition postmoderne: rapport sur la savoir, Paris,

1979

188. Lyotard, Jean-Francois, Phenomenology, New York, 1991

189. Maes, Michael, From Freud unto Omega-3, a revolutionary approach of depression,

ADHD, chronic fatigue syndrome and chronical pain (Belgium), Antwerp,

2005

190. Mahesh, T.S., et.al. Implemental Logic Gates and the Deutsch-Jozsa Quantum

Algorithm by Two-Dimensional NMR Using Spin- and Transition-Selective



570

Pulses, Journal of Magnetic Resonance, 2001

191. Maier, Steven F. et.al. Psychoneuroimmunology, The Interface Between Behavior,

and Immunity, American Psychologist, 1994.

192. Maret, Stephen, M. The Prenatal Person: Frank Lake’s Maternal-Foetal Distress

Syndrome, Maryland, 2007

193. Marks, Hendrik et.al. The Transcriptional and Epigenomic Foundations of

Ground State Pluripotency, Cell 149, April 2012

194. Masataka, Nobuo, Music, evolution and language, Development Science, 2007

195. McClain, Ernest G., The Myth of Invariance. The Origin of the Gods, Mathematics

and Music From the RiG Veda to Plato, York Beach, 1976

196. McCraty, Rollin, et.al. Modulation of DNA Conformation by Heart-Focused Intention,

Publication HeartMath, 2003

197. McCraty, Rollin, The Energetic Heart: Bioelectromagnetic Interactions Within

and Between People, Institute of HeartMath, 2003

198. McTaggart, Lynne, The Bond – Connection Through the Space between Us, New

York, 2011

199. McTaggart, Lynne, The Field – The Quest for the Secret of the Universe, New

York, 2004

200. Meijl, Konstantin, Scalar Waves, Theory and Experiments, Report of a Congress

Geman Association for Space Energy, s.a.

201. Meijl, Konstantin, Scalar Waves: Theory and Experiments, Paper Amsterdam

Conference of the Society for Scientific Exploration, October 2000.

202. Miller, Richard Allen, et.al. Schumann’s Resonances and Human Psychobiology,

O.A.K. New Physics-Schumann’s Resonances*, 2003

203. Mollon, Phil, Psychoanalytic Energy Psychotherapy, London, 2008

204. Molnar, I et.al. Music and mirror neurons: from motion to e-motion, Social Cognitive

and Affective Neuroscience, 2006.

205. Moss, Roger, C.S. Integration Workshop-Part II about Frank Lake, 1986

206. Mossop Philosophy, Use the Vibrational Energy of plants, Phytobiophysics, s.a.

207. Mulisch, Harry, The Composition of the World (Dutch), Principium Contradictionis,

Amsterdam 1980

208. Muskiet, F.A.J. Evolutionary Medicine (Dutch) “U bent wat u eet, maar u moet

weer worden wat u at”, (You are what you eat, but you should go back to what

you ate) Ned. Tijdschrift voor Klinisch-Chemische Labgeneeskunde, 2005

209. Nachman of Breslov, Anatomy of the Soul, Jerusalem, 1998

210. Narby, Jeremy, the Cosmic Serpent, DNA and the origins of Knowedge, Geneva,

1995

211. Newham, James J, et.al. Effects of Antenal Yoga on Maternal Anxiety and De-



571

pression: A Randomized Controlled Trial, Depression and Anxiety, 2014

212. Nickolaenko, Alexander, et.al. Schumann Resonance for Tyros, Essentials of

Global Electromagnetic Resonance in the Earth-Ionosphere Cavity, Springer Geophysics,

2014

213. Nieuwenhuijze, Otto van, Independent Research Scientist, Consciousness and/of

Freedom of Choice in ou Living Body; The dynamic Logic of Dimensional Phase

Change, Amsterdam, s.a.

214. Nugent, B.M. et.al. The omniscient placenta: Metabolic and epigenetic regulation

of Foetal programming, Front Neuroendrocrinology, 2015

215. Nummenmaa, Lauri, et.al. Bodily maps of emotions. PNAS10.1073/PNAS

1321664111

216. O’Neill, John J., Prodigal Genius, Biography of Nikola Tesla, Dartmouth, 1994

217. Os, Jim, van Dutch Critical Comment on DSM-V – Towards Personal Diagnostics,

2014

218. Ouaknin, Marc-Alain, Mysteries of the Kabbalah, London/Paris, 2000

219. Palmer, Richard, E. Hermeneutics, Evanston, 1969

220. Patel, Aniruddh, D. Music, Language and the Brain, Oxford University Press,

2007

221. Peretz, Isabelle, et.al. Music, Language and modularity in action, keynote paper,

August 6, 2008.

222. Peretz, Isabelle, Music, Language and modularity framed in action, Psychologica

Belgica, 2009, 49-2&3, pp 157-175

223. Peretz, Isabelle, The nature of music from a biological perspective, Science Direct,

2006

224. Pert, Candace, B. Molecules of Emotion: Why You Feel the Way You Feel, London,

1997

225. Philips, Stephen M. Derivation of Bone & Classical Acupoint Compositions of

the Human Body and Their Relationship to the Seven Musical Scales, Article 32,

http://smphilips.8m.com

226. Picard, Michael, Philosophy adventures in thought and reasoning, Quid Publishing,

Canada 2012

227. Pierce, John, R. The Science of Musical Sound, Oxford, 1983

228. Pitt, David, Unconscious Intentionality, California Phenomenology Circle, California

State University, June 2007

229. Pok-Hon, Wally Yu, Schoenberg’s Transition to Atonality (1904-1908): The Use

of Intervallic Symmetry and the Tonal-Atonal Relationship in Schoenberg’s Pre-

Atonal Compositions, diss. University of Texas at Austin, 2005.

230. Popp, F.A. et.al. Biophotons emission. New evidence for coherence and DNA as

source, Cell Biophysical Journal 1984

231. Popp, Fritz-Albert, Mistletoe vs Cancer, 2009,

http://www.examiner.com/holistic*



572

232. Pourhasan, Razieh, et.al. A Holographic Origin for the Big Bang, Waterloo University,

Canada, 2013

233. Pruimboom, L. et.al. Foetal Programming, distortions of HPA-axis and diseases

of adults (Dutch article), PNI-Katern, s.a.

234. Qualia, Stanford Encyclopedia of Philosophy, substantive revision August 2015.

235. Qualia, Wikipedia, the free encyclopedia.org/wiki/Qualia

236. Rauch, Judith, Das Gen, das Sprache schafft, Focus online, 2008

237. Rebyidel, A Brief History of Medicine and Healing in Jewish Tradition 1, 2 and

3, www.soundsourcery.com

238. Reijden, Miriam van, Spinoza and the Therapeutical approach on Ethica,

Kampen, 2008

239. Rein, Glen, Effect of Conscious Intention on Human DNA, Proceeds of the International

Forum on New Science, October 1996

240. Ricard, Matthieu, Plaidoyer pour l’altruisme; La force de la bienveillance (Altruism:

The Power of Compassion), Paris, 2013

241. Ricoeur, Paul, Hermeneutics & the Human Sciences, Cambridge, 1981

242. Ricoeur, Paul, Text and Meaning; about interpretation of literature, Edition du

Seuil, 1986

243. Ridgway, Roy, The Unborn Child: Beginning a Whole Life an Overcoming Problems

of early Origin, London, 2006

244. Rivas, T, Why a psychic memory exist? (Dutch art. Waarom er een psychisch

geheugen moet bestaan), www.txttxs.nl/print_artikel.asp?artid=195

245. Rodin, Marko, Vortex Based Mathematics, 2013

246. Rodriguez, Tori, Descendants of Holocaust Survivors Have Altered Stress Hormones,

Parents’ traumatic experience may hamper their offspring’s ability to

bounce back from trauma, art. Scientific American, March 2015

247. Roederer, Juan, G. Introduction to the Physics and Psychophysics of Music, University

of Alaska, 1969

248. Romme, M.A.J. et.al. Acceptance of Auditory Hallucinations (Dutch), Baarn,

1999

249. Roodenburg, Rob, A Matter of Time: Einstein’s Uncompleted Relativity, Schiedam,

2007

250. Roodenburg, Rob, Repairing Special Relativity: Quantum relativity (for Speed),

Schiedam, 2013

251. Rouse, Alisha, Holocaust survivors pass the genetic damage of their trauma onto

their children, *, Art. Dailu Mail, 22 august 2015

252. Ruppert, Franz, Frühes Trauma – Schwangerschaft, Geburt und erste Lebensjahre

(Early trauma - pregnancy, birth and the first years of life), Stuttgart, 2014

253. Ruppert, Franz, Symbiose und Autonomie – Symbiose Trauma und Liebe (Symbiosis

and autonomy - symbiosis Trauma and Love), Stuttgart, 2014

254. Ruppert, Franz, Trauma, Angst und Liebe. Unterwegs zu gesundener Eigenständigkeit.

Wie Aufstellungen dabei helfen (Trauma, fear and love. Heading to

healthy autonomy. How Lineups help), München, 2012



573

255. Russell, James, The Discovery of Schumann Resonance,

www.earthbreathing.co.uk

256. Ruusbroec, Jan van, Opera Omnia III (Latin version), Tielt (Belgium), 1988

257. Saab, Bechara, J. et.al. Neurobiological disease etiology and inheritance: an epigenetic

perspective, The Journal of Experimental Biology, 2014.

258. Sacks, Oliver, Musicofilia. Tales of Music and the Brain, Hampshire, 2007

259. Sagan, Sam, Awakening the Third Eye, 2007 (part of Pineal Physiology)

260. Sai Krishna Tikka, Psychiatry and Music, Indian Journal of Psychiatry, 2014, pp.

128-140

261. Samana, Leo, The Sense of Music, (Dutch) University Amsterdam, 2013

262. Sample, Ian, Genome editing: how to modify genetic faults – and the human

germline, art. The Guardian, 2 September 2015-12-29

263. Sanjuan, J. et.al. Association between FOXP2 polymorphismus and schizophrenia

with auditory hallucinations, Psychiatric Genet. 2006 (PubMed)

264. Sayer Ji, Our Cells and DNA use Biophotons to Store and Communicate Information,

2005

265. Schmidt Galaaen, Oistein, The Disturbing Matter of Downward Causation. A

Study of the Exclusion Argument and its Causal-Explanatory Presuppositions,

diss. Oslo, 2006

266. Schroeder, Gerald, L., Genesis and the Big Bang: The Discovery of Harmony

between Modern Science and the Bible, Bantam, 1990

267. Schroeder, Gerald, L., The Science of God, New York, 1997

268. Schumann Resonance, Schumann Resonance: Earth’s Frequency Increasing, Aetherforce

open source living science, www.aetherforce.com

269. Schwab, Matthias (project coordinator) Impact of Prenatal Stress on brain ageing,

Foetal programming, undernutrition and stress + Effects and mechanisms of prenatal

programming + Maternal stress during pregnancy + Mechanisms of effects

of prenatal stress + Potential targets of intervention. Committed to healthy brain

ageing from the very beginning. Project supported by the FP7 of the European

Community, Jena University Hospital.

270. Schwiebert, Valerie L. Twin Loss: Implications for counselors working with surviving

twins, Twinless Twins Support Group International, Journal of Counseling

and Development, 2005

271. Siegelbaum, Chana.B. The Mitzvah guarding our health, part 1, Breslev.co.il.

love, soul, joy, 2013

272. Sills, Franklyn, Being and Becoming: Psychodynamics, Buddhism, and the Origins

of Selfhood, Berkeley, 2009

273. Singh, Simon, Fermat’s Last Theorem, London, 1997

274. Smuts, Jan Christiaan, Holism and Evolution, (1926) reprint 1986, Gestalt Journal

Press USA (Gouldsboro)

275. Spaniel, Filip, et.al. Genetic variation in FOXP2 alters grey matter concentration

in schizophrenia patients, Neuroscience Letters, 2011

276. Speirs, H.J.L. et.al. Ontogeny of glucocorticoid receptor and 11b-hydroxysteroid

dehydrogenase type-1 expression identifies potential critical periods of glucocor-



574

ticoid susceptibility during development, Journal of Endocrinology, 2004.

277. Spiegel, Dana, The Physics and Psychophysics of Music, 1997

278. Spinoza, Baruch, Ethica, Latin/Dutch, Krop (translation), Amsterdam, 2009

279. Spinoza, Baruch, Tractatus Theologico-Politicus (version Klever), Delft, 1999

280. Srednicki, Mark, Quantum Field Theory, diss. University of California, 2006

281. Steiner, George, Grammars of Creation, Yale University Press London, 2002

282. Stickler, Gunnar B., “Alternative” Medicine: A Review of Studies Supported by

Grants Awarded by the National Center for Complementary and Alternative

Medicine, The Scientific Review of Alternative Medicine

283. Stroecken, Gaby, et.al. The Myth of a Happy Childhood (Belgium), Antwerp,

2006

284. Swaab, Dick, Wij zijn ons brein (Dutch, We exist as our brain only!), Amsterdam,

2011

285. Sykes, Bryan, The Seven Daughters of Eve, New York, 2007

286. Taylor, Charles, Sources of the Self: The Making of the Modern Identity, University

of Cambridge, 1989

287. Tecumseh Fitch, W. The Evolution of Music in Comparative Perspective, Ann.

of N.Y. Academy of Sciences, 2005

288. Teramitsu, I. et.al. Parallel FoxP1 and FoxP2 Expression in Songbird and Human

Brain Predicts Functional Interaction, Journal of Neuroscience, March 2004

289. Tesla, Nikola, The Transmission of Electrical Energy without Wires as a Means

for Furthering Peace, Electric World and Engineer, 1905.

290. Tesla, Nikola, Weird science: Schumann Resonance, Wireless Electricity,

291. Thaut, Michael H. et.al. Handbook of Neurologic Music Therapy, Oxford (UK)

2014

292. Third Eye – Pineal Gland, the Human Brain, www.crystalinks.com

293. Thomas, Helen, A 21 st Century Guide to the 3000 Years Old Science of Health

and Longevity From Ancient India: www.EffortlessAyurvedicLiving.com/ezine.

294. Thomson, Helen, Study of Holocaust survivors finds trauma passed on to children’s

genes, art. The Guardian, 21 August 2015

295. Thoomes-Vreugdenhil, Anniek Treatment of Attachment Disorders (Dutch),

Houten, 2006

296. Tobi, Elmar.W. et.al. Prenatal Famine and Genetic Variation Are Independently

and Additively Associated with DNA Methylation at Regulatory Loci within

IGF2/H19, PLoS 2012, 7(5)

297. Toloso, Amparo, et.al. FOXP2 gene and language impairment in schizophrenia:

association and epigenetic studies, BMC Medical Genetics, 2010

298. Tress, W. et.al. Psychosomatic medicine between natural science and psychological

science-tertium non datur?, Psychother. Psychosom Med. Psychol. 1992, 42

(PubMed)

299. Tris (Rosicrucian), The Earth’s magnetic field with human health. Solar and geomagnetic

activity, extremely low frequency magnetic and electric fields and

human health at the Earth’s surface, blog, posted December 30, 2012.



575

300. Trollinger, Valerie L., 5000 Languages, 5000 Ways to Sing? University of Pennsylvania,

s.a.

301. Tweel, Jan, G. van den, Immunology: the Human Immune System, Nature and

Technics, Brussels, 1988

302. Twersky, Isodora, Introduction to de Code of Maimonides (Mishneh Torah) New

Haven, Yale University Press, 1980

303. Tzadok, Rabbi Ariel Bar, The Science Underlying Kabbalistic Prophetic Meditation,

21th Century Physics & Timeless Kabbalah, Panu Derekh Journal – Prepare

the Way, 1998.

304. Verhagen, P.J. et.al. Manual of Psychiatry, Religion and Spirituality (Dutch),

Utrecht, 2012

305. Verismo, Christi, Twelve Things you should know about Scalar Weapons, Token

Rock,

306. Verny, Thomas, R. What Cells Remember: Toward A Unified Field Theory of

Memory, APPPAH, 2014

307. Vries, Marja, de, De hele olifant in beeld (Dutch, about Universal Laws and

Golden Ratio), 2011

308. Wallin, David. J. Attachment in Psychotherapy, New York, 2010

309. Wanker, Tamara, Ancient music, an enchanting way to cure (Dutch master thesis,

cum laude, University of Leiden), 2000

310. Weaver, Ian C.G., Epigenetic effects of glucocorticoids, Ontario, Canada, s.a.

311. Welten, Erik, Physical aspects of amino acids according to the Hebrew letters,

DNA-codon like approach of shamanist herbal extracts (Phylak Saksen)

312. Whalley, J.Harry, Transformations and their Musical Counterparts,

www.thinkingaboutmusic.com.

313. Whitehead, A.N. Religion in the Making, MacMillan Company, 1926 (renewed

1954)

314. Whitehead, A.N., Adventures of Ideas, London, 1967

315. Wijk, Roel and Eduard P.A. van, Work on the basis of Biology and Medicine.

Fundamentally new insights into the dynamics of life, Magazine of Integrate

Medicine (TIG), 2015.

316. Wilber, Ken, Integral Psychology. Consciousness, spirit, psychology, therapy,

Boston, 2000

317. Wilson, James L. Adrenal Fatigue; The 21st Century Stress Syndrome, Smart

Publications, 2001

318. Witfield, Geoffrey Victor, The Prenatal Psychology of Frank Lake and the Origins

of Sin and Human Dysfunction, Lexington, 2007

319. Wu H, et.al. Environmental Susceptibility of the Sperm Epigenome During Windows

of Male Germ Cell Development, Curriculum Environmental Health Report,

2015, www.world-mysteries.com

320. Yehuda, Rachel et.al. Influences of maternal and paternal PTSD on epigenetic

regulation of the glucocorticoid receptor gene in Holocaust survivor offspring.

Am. J. Psychiatry, 2014

321. Yehuda, Rachel et.al. Maternal, not paternal PTSD, is related to increased risk



576

for PTSD in offspring of Holocaust Survivors, NIH Public Access, author manuscript,

2008

322. Yehuda, Rachel, et.al. Holocaust Exposure Induced Intergenerational Effects on

FKBP5 Methylation, Journal of Biological Psychiatry, 2015, 8

323. Yehuda, Rachel, et.al. Parental Posttraumatic Stress Disorder as a Vulnerability

Factor for Low Cortisol Trait in Offspring of Holocaust Survivors, Arch. Gen.

Psychiatry, Vol. 64, 2007

324. Ypma, Sytze, Between God and Madness (Dutch diss.), Schizophrenia and Psychosis,

Zoetermeer, 2005

325. Zachariae, Robert, Psychoneuroimmunology: A bio-psycho-social approach to

health and disease, Scandinavian Journal of Psychology, 2009, 50 pp 645-651



577

Appendix 3:

Register

11β-hydroxysteroid dehydrogenase .............. 459

[

144 .......................... 179, 182, 186, 187, 190, 253

[√1rel ← -∞∫+∞ freq. ← √1abs ] ........... 430, 431

2

√

√1 = 1 ...... 125, 143, 154, 182, 188, 254, 273, 274,

275, 363

∞

∞∫+∞ ..................................................... 430, 431

1

1,540 ................................................................ 73

1,618 .............................................. 180, 181, 186

1.618055555555 ............................................ 186

10 49, 71, 74, 75, 76, 117, 119, 160, 175, 179,

183, 186, 187, 188, 189, 190, 191, 197, 252,

269, 270, 272, 273, 274, 276, 278, 280, 282,

305, 323, 329, 331, 354, 365, 367, 369, 371,

372, 373, 376, 377, 379, 383, 387, 388, 390,

391, 393, 394, 395, 417, 421, 422, 424, 425,

426, 427, 463, 468, 495, 498, 500, 559, 565

111 .................................. 177, 278, 386, 389, 391

2 36, 38, 40, 45, 55, 57, 58, 60, 63, 69, 70, 71,

72, 73, 74, 76, 78, 81, 84, 92, 93, 94, 96, 98,

100, 105, 111, 112, 113, 116, 119, 129, 131,

139, 140, 141, 142, 148, 151, 152, 163, 172,

178, 179, 181, 183, 184, 185, 187, 190, 191,

206, 213, 214, 229, 247,249, 250, 252, 253,

256, 257, 258, 259, 262, 263, 266, 276, 278,

279, 282, 285, 286, 295, 296, 297, 302, 304,

322, 323, 326, 335, 336, 338, 366, 370, 372,

373, 376, 377, 379, 380, 381, 382, 383, 388,

390, 391, 393, 394, 395, 412, 417, 418, 419,

420, 424, 425, 427, 433, 436, 437, 444, 447,

451, 456, 459, 472, 479, 481, 486, 493, 494,

495, 496, 497, 498, 499, 500, 501, 506, 512,

513, 514, 517, 519, 520, 521, 522, 523, 525,

533, 535, 538, 539, 542, 544, 548, 549, 560,

561, 564, 566, 569, 571, 572, 573

20 amino acids ............................................... 250

21 67, 72, 73, 74, 179, 181, 183, 187, 259, 285,

286, 376, 377, 378, 391, 394, 406, 410, 412,

413, 428, 495, 519, 527, 574

22 71, 72, 73, 74, 75, 210, 252, 253, 368, 375,

376, 377, 380, 381, 384, 392, 395, 396, 416,



578

433, 434, 436, 437, 438, 439, 441, 442, 499,

527, 572

231 ............................................ 68, 72, 73, 74, 76

233 .................. 179, 182, 186, 187, 190, 191, 253

24 184, 185, 278, 376, 377, 381, 382, 384, 393,

395, 396, 402, 449, 451, 452, 569

26 76, 77, 78, 158, 175, 187, 188, 193, 245, 246,

247, 251, 253, 257, 258, 259, 260, 262, 263,

265, 266, 271, 272, 284, 304, 305, 333, 334,

335, 360, 373, 376, 377, 394, 404, 416, 420,

447, 471, 472, 473, 474, 475, 498, 499

264 ................................................................. 335

27 77, 266, 367, 377, 385, 394, 448, 477, 478,

479, 480, 483, 485, 488, 489, 491, 564

3

3 38, 39, 40, 55, 57, 58, 64, 73, 76, 77, 78, 80,

81, 82, 83, 85, 86, 87, 89, 90, 91, 92, 93, 94,

95, 99, 106, 108, 112, 113, 133, 136, 141,

142, 143, 146, 148, 149, 151, 152, 157, 165,

179, 180, 181, 183, 184, 185, 186, 187, 196,

197, 202, 208, 215, 231, 251, 252, 256, 257,

258, 259, 260, 262, 265, 266, 276, 278, 279,

282, 285, 286, 298, 299, 304, 323, 327, 334,

335, 340, 366, 368, 372, 373, 374, 375, 376,

377, 380, 381, 386, 387, 388, 389, 390, 391,

393, 394, 395, 403, 413, 414, 415, 416, 418,

419, 420, 421, 422, 423, 424, 425, 426, 428,

430, 434, 437, 447, 452, 454, 459, 463, 473,

479, 481, 489, 493, 495, 496, 498, 499, 500,

501, 502, 506, 519, 523, 525, 526, 533, 536,

538, 544, 548, 554, 563, 564, 566, 569, 571,

572, 577

33 77, 266, 334, 335, 336, 377, 394, 457, 497,

499, 563

4

4 41, 55, 57, 58, 64, 74, 75, 76, 78, 83, 85, 97,

98, 99, 100, 101, 102, 103, 107, 135, 136,

139, 142, 144, 149, 150, 151, 152, 154, 167,

175, 184, 185, 188, 189, 190, 191, 192, 193,

218, 220, 233, 248, 250, 251, 252, 253, 254,

260, 275, 280, 302, 324, 326,335, 341, 355,

369, 370, 373, 374, 376, 378, 390, 391, 393,

394, 395, 421, 422, 423, 424, 425, 426, 427,

438, 460, 474, 480, 492, 493, 495, 497, 500,

502, 506, 507, 508, 511, 525, 533, 536, 544,

545, 548, 567, 597

432 ................................................................. 173

44 252, 253, 367, 377, 394

440 ......................................................... 346, 367

45 175, 185, 334, 335, 377, 394, 544

5

5 43, 44, 55, 58, 76, 77, 78, 85, 86, 100, 104,

105, 106, 107, 109, 110, 111, 112, 113, 114,

115, 116, 117, 119, 120, 122, 123, 125, 136,

142, 151, 152, 154, 155, 169, 175, 179, 180,

181, 183, 184, 185, 186, 187, 188, 190, 191,

223, 229, 235, 245, 254, 260,265, 266, 273,

275, 276, 280, 282, 284, 286, 305, 322, 323,

324, 326, 327, 334, 335, 342, 373, 374, 376,

377, 378, 383, 388, 390, 391, 393, 394, 395,

417, 419, 420, 424, 425, 426, 427, 438, 460,

463, 475, 483, 495, 498, 500, 503, 507, 540,

546, 548, 562, 574, 611

528 . 3, 6, 85, 97, 98, 99, 100, 101, 102, 103, 104,

107, 115, 135, 146, 162, 172, 173, 177, 182,

195, 209, 210, 228, 253, 271, 303, 305, 318,

328, 332, 334, 335, 336, 338, 340, 341, 346,



579

347, 348, 357, 358, 360, 365, 366, 368, 370,

371, 372, 373, 374, 375, 376, 377, 378, 379,

380, 381, 382, 383, 384, 386, 387, 388, 389,

390, 391, 392, 394, 395, 396, 397, 398, 399,

400, 401, 402, 403, 404, 405, 406, 410, 412,

414, 415, 416, 417, 420, 426, 427, 429, 430,

432, 433, 435, 436, 439, 452, 453, 469, 470,

481, 494, 495, 496, 499, 502, 503, 509, 512,

526, 532, 533, 535, 548, 549, 550, 551, 552,

553, 555, 557, 558, 559, 560, 567, 620, 628

528 Hz ..... 3, 6, 85, 97, 98, 99, 100, 101, 102, 103,

104, 115, 146, 162, 172, 173, 177, 182, 195,

209, 210, 228, 253, 271, 303, 305, 318, 328,

332, 334, 335, 336, 340, 341, 346, 347, 348,

357, 358, 360, 372, 379, 381, 382, 388, 389,

394, 397, 398, 399, 400, 401, 402, 403, 404,

405, 406, 410, 412, 414, 415, 416, 417, 420,

426, 427, 429, 430, 432, 433, 435, 436, 439,

452, 453, 469, 470, 481, 494, 495, 496, 499,

502, 503, 508, 509, 512, 526, 532, 533, 535,

548, 549, 550, 551, 552, 553, 554, 555, 557,

558, 559, 560, 611, 620, 628

53 77, 245, 246, 253, 257, 258, 259, 262, 263,

265, 269, 270, 333, 334, 367, 395

55 73, 76, 179, 183, 187, 259, 262, 393

6

6 35, 44, 55, 58, 73, 76, 87, 101, 111, 112, 113,

126, 127, 128, 131, 133, 135, 155, 172, 175,

178, 183, 184, 185, 191, 196, 197, 236, 250,

255, 256, 275, 277, 278, 282, 284, 305, 323,

326, 329, 335, 336, 344, 346, 368, 369, 370,

373, 374, 376, 377, 378, 379, 382, 389, 390,

391, 393, 394, 395, 408, 414, 415, 416, 419,

420, 421, 424, 425, 427, 430, 439, 464, 485,

7

493, 496, 497, 499, 500, 501, 504, 507, 540,

544, 545, 546, 548, 571, 635

7th chromosome ........... 41, 62, 80, 226, 230, 455

8

8 35, 46, 90, 91, 100, 102, 114, 115, 156, 177,

179, 181, 183, 184, 185, 187, 190, 240, 260,

262, 285, 320, 323, 330, 334, 335, 352, 376,

377, 379, 380, 385, 390, 393, 394, 395, 416,

424, 427, 428, 442, 466, 488, 489, 499, 511,

563, 576

9

9 35, 48, 91, 92, 93, 94, 95, 100, 103, 116, 137,

163, 165, 167, 169, 172, 175, 177, 183, 184,

185, 187, 191, 196, 197, 243, 265, 266, 278,

279, 330, 352, 372, 376, 378, 389, 390, 391,

393, 394, 395, 414, 415, 416, 418, 419, 421,

422, 423, 424, 425, 426, 427, 430, 466, 491,

510, 511, 553, 559, 563

A

a – field .................................... 333, 336, 410, 416

a = √1 = 1 116, 117, 119, 125, 139, 141, 143, 163,

179, 180, 181, 182, 186, 188, 247, 252, 253,

273, 274, 279

a = 1 117, 161, 162, 163, 177, 188, 189, 190, 191,

192, 251, 270, 272, 287, 290, 304, 347, 387,

406, 428, 431, 468

a = 1 abs ............. 288, 289, 290, 295, 296, 305, 306



580

a = 1rel ............................................................ 412

a -field. ........................................................... 165

a abs - 1 abs ................................................. 362, 364

a-axis .............................................................. 316

absolute unity .. 116, 117, 125, 143, 162, 355, 362

Acknowledgement ......................................... 403

acting subject ................................................. 194

acupuncture ........................................... 156, 169

Ad Commeren ................................ 179, 257, 263

adam ....................................... 139, 144, 175, 185

adaptation .............................................. 354, 507

ADD .......................................................... 89, 442

ADHD 89, 210, 240, 241, 242, 243, 442, 469, 510,

511, 555, 559, 563, 569

Adriaens ......................................................... 236

a-energy ................................................. 287, 431

a-field .............................. 254, 304, 317, 334, 404

Akasha-field .................................................... 138

Aleph .... 40, 71, 72, 116, 125, 135, 142, 144, 163,

177, 304, 305, 347, 363, 371, 383, 386, 389,

397, 398, 431, 563

Aleph Quantum field ...................................... 116

alpha-numeric ................... 95, 106, 143, 176, 187

alternative ...... 106, 321, 429, 434, 437, 438, 440,

464, 490

alternative medicine ...... 106, 167, 169, 321, 429,

434, 437, 464

American Psychiatric Association ........... 218, 227

amplification .................................................. 324

Analytical Philosophy ....................................... 66

anamnesis ...................................... 147, 148, 485

ancient times .................................................. 473

anger .............................................................. 449

antagonists .............................. 121, 353, 357, 568

anterior ...................................................... 85, 86

anticipation 92, 94, 212, 291, 296, 297, 299, 302,

331, 355, 370, 516, 520

anticipation-concept ........................................ 94

anti-psychiatry ......................... 216, 217, 219, 220

anti-Semitism ......................................... 106, 114

APA .......................................... 218, 227, 233, 565

Apex 107, 110, 112, 114, 116, 117, 163, 171, 177,

179, 180, 181, 182, 188, 189, 191, 195, 246,

247, 248, 249, 250, 251, 252, 253, 254

architecture ............................. 340, 355, 359, 361

a rel - 1 rel ................................................... 362, 364

Aristotle . 39, 51, 57, 111, 127, 138, 171, 442, 534

armlength-reflextest ....... 483, 487, 489, 490, 502

art of language ................................................. 43

arts of understanding ....................................... 44

Asklepios ................................................ 168, 224

Asomal chromosomes .................................... 253

a-source-field ................................................. 316

associative striatum ......................................... 84

A-T .................................................................. 251

A-T-C-G ........................................................... 251

Atonal music ..................................................... 35

auditory hallucinations ..... 80, 81, 87, 88, 89, 226,

227, 230, 296, 442, 455, 573

autonomous man ........................................... 111

avant-gardistic atonal music ............................ 35

avian ................................................................. 85

axiological ............................................... 216, 383

Ayurvedic ..................... 91, 93, 295, 331, 360, 441

B

basal ganglia ............................ 83, 84, 85, 86, 566

behaviour ..... 63, 65, 87, 121, 150, 160, 211, 234,

235, 236, 239, 242, 441, 446, 447, 456, 553,

555

Being ..... 41, 42, 43, 116, 127, 128, 176, 275, 288,

290, 291, 340, 362, 363, 469, 564, 567, 569,

573



581

Big Bang .. 171, 269, 270, 287, 290, 364, 387, 572,

573

binaural beat .................................. 102, 227, 422

biological clock ............................................... 473

biological psychiatry .................. 79, 147, 193, 222

biology .... 126, 142, 165, 339, 355, 412, 414, 447,

456, 472

Bleuler .................................................... 216, 233

body cells ........................................................ 210

body language .................................................. 71

Bohm ................................... 37, 38, 465, 477, 563

Bohr 253, 290, 343, 429, 439, 460, 466, 467, 468,

472, 473

book of Numbers ..................... 100, 208, 358, 382

Boorse ............................................................ 222

Braden ............................................ 320, 321, 563

Brain activity ................................................... 102

brain development ................................. 400, 459

brainwave entrainment ........... 328, 329, 410, 470

Brainwave Frequencies Table ....................... 324

Brainwave Frequency Listing .......................... 324

brainwave-entrainment .......... 452, 472, 473, 509

Bruce Lipton .................... 126, 164, 166, 174, 345

Buber ................................... 51, 61, 134, 564, 569

Buddhism ............................................... 176, 573

building block ................................................. 528

C

Campbell ............................................ 40, 92, 564

Cantor ..................................................... 117, 415

Cantor’s set theory ......................................... 117

carcinogenic ............................................. 98, 174

cardiovascular diseases ............................ 64, 469

CASA ............................................................... 364

Casuistry .................................. 503, 526, 548, 549

catastrophic learning process ........................ 299

causal adequate link ....................................... 149

causality .......................... 121, 149, 228, 272, 538

Cell ... 457, 485, 506, 562, 565, 569, 570, 571, 575

cell membrane ........................ 151, 328, 345, 547

cell membranes .............................................. 474

cell receptors .................................................. 475

cell-memory ................................................... 149

cell-system ..................................................... 470

C-G .................................................................. 251

child-adult ........................................................ 63

Christianity ..................................... 114, 175, 437

chromatin ........................ 456, 457, 488, 512, 513

Chromosome 7 ................................................. 80

cladistics ......................................................... 238

Clinical Hermeneutics ....... 36, 146, 231, 318, 433,

435, 444

clinical-hermeneutical .................................... 113

closeness ........................................................ 215

codons ............................................................ 340

cognitive consonance ..................... 165, 167, 169

Cognitive dissonance ...................... 165, 167, 168

coil ... 403, 452, 453, 460, 463, 465, 483, 484, 486

communication ...... 106, 109, 324, 345, 367, 373,

374, 383, 384, 389, 403, 452, 455, 456, 466,

523

complementarity .... 165, 169, 439, 459, 467, 468,

472, 473

complementary 3, 6, 82, 104, 106, 142, 169, 321,

331, 332, 333, 336, 343, 359, 361, 375, 429,

430, 435, 437, 440, 459, 464, 466, 468, 477,

533, 534, 535, 547

complementary (medical) sciences ................ 103

complementary medicine ... 3, 6, 90, 91, 102, 104,

105, 142, 155, 161, 164, 169, 172, 247, 254,

332, 333, 336, 343, 430, 435, 437, 466, 477,

533, 534, 535, 547



582

complex ...... 33, 88, 325, 333, 337, 353, 361, 387,

401, 402, 403, 404, 412, 415, 430, 453, 505,

514, 546

composition .... 340, 347, 348, 399, 401, 402, 404,

408, 413, 414, 416, 422, 425, 427, 429, 432,

439, 452, 469, 472, 474, 502, 528, 529

compositions ........... 345, 351, 373, 408, 410, 455

Concentration Camp ...................................... 544

concentration disorders ... 64, 121, 151, 433, 435,

459, 485, 501

Consciousness .. 3, 79, 92, 95, 144, 151, 195, 196,

288, 321, 324, 326, 341, 345, 349, 356, 359,

401, 402, 408, 409, 412, 422, 424, 427, 463,

468, 469, 476, 480, 485, 488, 489, 490, 513,

516, 519, 523, 524, 567, 569, 571, 575

container-contained ................ 296, 297, 299, 303

contextuality ........................... 527, 528, 538, 544

conventional medicine ........................... 437, 441

conventionalism ...... 126, 133, 145, 165, 172, 221

convergence ............................................. 84, 433

convictions ..................................... 167, 442, 443

Copenhagen Interpretation ..... 459, 460, 466, 467

Cornelis .................................................. 169, 564

cortex ...................... 347, 409, 458, 475, 489, 529

cortex-striatum-globus pallidus (GPi)-thalamuscortex

.......................................................... 83

cortico-basal ganglia loops ............................... 83

cortisol .... 150, 151, 356, 400, 440, 458, 459, 501,

511, 542

cortisone ........................................................ 459

cosmological constant ............................ 269, 270

cosmological octave ......................................... 39

cosmological Tonic ........................................... 39

cosmos .................................... 142, 250, 355, 418

CpG ................................................................. 458

Creating Authority ... 109, 112, 114, 118, 119, 125

Creating Energetic Substance ........................... 50

Creating Energy Source .................................. 115

Creating Substance .......... 38, 46, 51, 62, 112, 271

Creational Substance ........................................ 70

creational-energetic matrix .................... 294, 295

Creative Authority .......................................... 389

Creator ... 46, 48, 57, 76, 109, 110, 129, 161, 164,

201, 339, 379

CRISPR-Cas9-system ....................................... 316

cross-position of 33 Hz ................................... 336

cultural indicated diseases ............................. 195

cultural-sociological systems .......................... 168

Culture of Narcissism ............................... 62, 193

curative altruism ............................................ 194

cytoplasm ....................................... 285, 328, 352

D

Darwin ...................................................... 82, 168

Darwinism ...................................................... 363

Darwinist ......... 118, 126, 169, 437, 439, 454, 525

Darwinist evolution ........................ 138, 164, 165

Dasein ............................................................... 43

de Block .......................................................... 236

de-activate ...................... 420, 457, 469, 509, 514

defence mechanisms ...................................... 151

degenerative mental disease ........................... 89

densification ..................................................... 33

densification of language .......... 37, 38, 49, 55, 69

Densification of the language ........................... 36

deoxyribonucleic acid ............................. 275, 276

depersonalization ..................................... 60, 214

Depression ................................ 64, 567, 568, 571

Derrida, Jacques ............................................... 48

Descartes .... 47, 51, 112, 119, 130, 291, 295, 339,

410, 470, 472

Deterioration .................................................. 497

Deus Sive Natura ...................................... 46, 132



583

development of speech .............................. 80, 86

diagnostics .. 6, 109, 165, 229, 256, 333, 440, 460,

479

Dialectical-materialism ..................................... 61

dialectics ..................................................... 5, 151

Dick Swaab ..................................................... 234

Dilthey .............................................................. 44

disorder ... 210, 369, 412, 441, 453, 505, 511, 529

Dissemination of intelligence ......................... 200

dissertation .... 106, 126, 255, 331, 358, 400, 409,

435, 436, 499, 528, 529, 530, 536, 542

dissonance ...... 165, 169, 487, 490, 491, 503, 508,

516

distortions .. 6, 217, 368, 421, 433, 438, 440, 442,

456, 488, 492, 504, 505, 511, 512, 513, 516,

517, 525, 528, 529, 539, 547

divergence ........................................................ 84

Divine Ratio .................................................... 260

DNA .... 41, 78, 80, 82, 89, 97, 100, 101, 102, 115,

140, 144, 173, 176, 181, 185, 189, 193, 208,

226, 227, 242, 245, 249, 250, 251, 252, 253,

256, 257, 258, 265, 270, 271, 272, 273, 274,

275, 276, 277, 278, 280, 281, 284, 285, 286,

305, 321, 328, 340, 355, 359, 362, 426, 455,

456, 457, 469, 474, 488, 503, 512, 513, 516,

521, 522, 527, 529, 543, 544, 545, 546, 564,

566, 567, 568, 570, 571, 572, 573, 574, 575

DNA is the book of life .................................... 249

DNA-helix ....................................................... 100

DNA-methylation ........................................... 503

DNA-sequence .................................................. 89

DNA-sequences ... 89, 97, 115, 176, 257, 328, 455

Doctor .................................................. 3, 48, 152

dogmatic ................. 108, 127, 341, 354, 358, 439

double blind ..... 90, 122, 126, 146, 151, 246, 359,

453, 494

double-blind ..................................... 90, 196, 480

Downward Causation ...... 41, 70, 79, 92, 94, 250,

264, 270, 272, 273, 274, 275, 279, 285, 288,

289, 290, 291, 296, 297, 299, 300, 305, 354,

362, 384, 402, 414, 422, 431, 513, 514, 516,

525, 573

downwards causation .................................... 437

Dr. Bruce Lipton ............................................. 356

Dr. Jos de Kroon ............................................. 232

DSM .. 36, 126, 165, 211, 218, 219, 226, 227, 229,

230, 231, 232, 233, 237, 238, 240, 241, 242,

243, 255, 256, 452, 565, 571

DSM V ............................................. 126, 165, 256

dualism ...... 47, 141, 234, 291, 295, 467, 470, 518

Dutch biologist Bosman ................................. 320

Dutch Hunger Winter ............................. 528, 544

E

Earth’s Resonant Frequency (7,5 Hz). ............ 322

Efron, John M ................................................... 67

Ein Sof . 70, 95, 116, 117, 129, 130, 161, 171, 175,

177, 263, 282, 287, 290, 304, 334, 354, 361,

362, 364, 365, 371, 372, 414, 426

Einstein36, 51, 109, 111, 119, 133, 138, 169, 181,

223, 253, 346, 374, 466, 467, 515, 572

El Shaddai ............................................... 369, 370

electric scalar-field ......................................... 469

electromagnetic wave .................................... 322

electromagnetic waves ........... 324, 328, 461, 464

ELF ........... 323, 324, 328, 331, 401, 402, 475, 489

Elohiem .................................................. 129, 130

embryo .................... 400, 440, 458, 459, 507, 511

Embryogenesis ............................................... 441

emeth ............................................................. 190

Emmanuel Levinas .......................................... 194

Emotion ............................................ 97, 356, 571

empowerment ............................................... 337



584

emptiness ............................................... 344, 364

endorphines ..................................................... 89

energetic .. 85, 104, 142, 146, 151, 196, 256, 336,

337, 339, 347, 349, 354, 355, 356, 357, 361,

364, 379, 382, 399, 400, 402, 406, 412, 415,

419, 420, 421, 422, 428, 429, 430, 431, 433,

435, 437, 438, 441, 452, 457, 459, 468, 469,

475, 488, 490, 502, 503, 509, 512, 513, 516,

517, 518, 520, 524, 525, 529, 531, 543, 547

Energetic Source ............................................ 110

energetic treatment ....................................... 172

Enlightenment . 35, 41, 46, 47, 49, 50, 51, 59, 111

Entrainment ................................... 324, 330, 410

environment ... 113, 218, 331, 332, 413, 456, 457,

511, 541, 542

environmental factors ...... 89, 126, 147, 168, 228,

229, 234, 412, 527

enzymes .................................. 140, 302, 456, 459

epigenetic . 88, 224, 227, 230, 433, 438, 440, 441,

456, 457, 459, 469, 488, 494, 501, 503, 504,

505, 506, 509, 510, 511, 512, 513, 514, 517,

520, 527, 528, 539, 542, 543, 544, 545, 547

epigenetic disorder .......................................... 89

epigenetic inheritance .... 224, 227, 433, 438, 440,

441, 488, 501, 503, 506, 510, 512, 513, 520,

527, 528, 543, 544, 547, 553, 554, 555, 559

epigenetic transmission ......................... 228, 504

epigenetics . 80, 81, 147, 149, 224, 227, 255, 302,

441, 503, 505, 541, 544, 545, 546, 559

Epilogue ............ 90, 318, 429, 527, 528, 538, 546

Epiphenomenal qualia .................................... 519

Epiphysis ......................................... 318, 471, 473

epiphysis cerebri ............................................ 471

epithalamus .................................................... 471

equations ........................................................ 407

equilibrium ..... 103, 106, 114, 130, 162, 163, 175,

272, 275, 284, 306, 336

essentialism .............................................. 42, 347

Eternal ............................................................ 395

ethics of humanity .......................................... 224

etiologic-causal ............................................... 102

Ets Chaim ........................................................ 187

eukaryotes ...................................................... 401

evidence ..... 6, 126, 165, 211, 218, 227, 234, 256,

320, 330, 335, 338, 341, 355, 359, 431, 435,

466, 467, 473, 503, 527, 534, 535, 563

evidence based medicine 126, 193, 211, 228, 534

evidence-based . 90, 122, 124, 216, 223, 229, 233,

234, 241, 304

evolution .. 82, 104, 110, 126, 156, 169, 179, 224,

248, 332, 354, 383, 455, 456, 472, 513, 541

evolutionary anthropology ............................. 236

evolutionary fragmentation theory ................ 254

existence 106, 126, 142, 171, 352, 354, 363, 366,

420, 437, 438, 455, 461, 462, 464, 478, 499,

513, 515, 520, 521, 524, 526, 536, 540

existential life-story ........................ 434, 444, 477

Existentialism ................................................... 61

Extended Mindlink System ............................. 529

Extended Mindlink-system ............ 436, 517, 518

F

Factorization .. 419, 420, 421, 422, 423, 424, 425,

426, 427

Fermat ..................................... 253, 265, 266, 573

Fetal .................................................................. 86

fetus ............................................... 507, 511, 542

Fibonacci 179, 180, 181, 182, 183, 184, 185, 186,

187, 189, 191, 197, 253, 260, 264, 372, 565

figured bass ............................................ 405, 415

FKBP5 ...................................... 543, 567, 568, 576

FKPB5 ..................................................... 529, 543

fMRI ......................................... 174, 230, 454, 564



585

fMRI-scan ....................................................... 174

Foetal . 6, 63, 64, 86, 89, 120, 147, 149, 150, 196,

234, 302, 359, 400, 420, 433, 438, 440, 459,

469, 501, 502, 505, 506, 510, 511, 512, 516,

520, 528, 535, 542, 544, 547, 554, 555, 559,

562, 563, 564, 565, 567, 570, 571, 572, 573

Foetal programming ....... 6, 63, 89, 120, 147, 149,

150, 196, 234, 296, 302, 368, 400, 420, 433,

438, 440, 459, 469, 501, 502, 505, 511, 512,

516, 520, 528, 535, 542, 544, 547, 555, 559,

564, 565, 571, 572, 573

foetus ..................................................... 459, 507

forkgene FOXP2 ................................................ 48

Formare .......................................................... 301

Foucault ........................................... 49, 59, 60, 65

foundation function ....................................... 469

FOXP1 ........................................ 80, 85, 86, 87, 88

FOXP2 ... 41, 62, 65, 80, 81, 83, 85, 86, 87, 88, 89,

226, 227, 230, 455, 456, 529, 562, 565, 569,

573, 574

FOXP2 gene .................................................... 455

FOXP2-gen ............................................. 337, 456

FOXP2-gene ................................... 41, 80, 81, 456

FOXP2-genes .................................................... 62

frequencies ..... 171, 323, 324, 328, 329, 330, 332,

333, 334, 335, 340, 343, 345, 347, 348, 349,

352, 361, 370, 384, 386, 387, 388, 389, 392,

394, 397, 399, 401, 402, 404, 410, 414, 415,

416, 420, 422, 423, 426, 428, 430, 431, 432,

452, 469, 472, 473, 475, 502, 509, 531, 532

frequencies of Solfeggio ................................. 101

frequency . 85, 122, 320, 322, 323, 326, 327, 328,

329, 334, 346, 348, 352, 370, 384, 387, 388,

390, 393, 394, 398, 400, 401, 402, 409, 410,

414, 416, 419, 421, 422, 423, 424, 425, 426,

429, 430, 431, 458, 464

Fusions of Horizons .......................................... 45

G

G’d 37, 46, 48, 49, 50, 51, 52, 57, 58, 93, 95, 108,

109, 110, 111, 129, 130, 132, 133, 135, 157,

163, 164, 171, 174, 175, 177, 194, 251, 263,

271, 275, 280, 282, 285, 334, 335, 338, 382,

386

Gadamer ...................................... 44, 45, 445, 566

Galenus ........................................................... 168

gamete ............ 441, 459, 469, 488, 510, 544, 547

gametes .................................................. 457, 506

gate ............................. 66, 68, 72, 76, 77, 78, 146

Gates ........................................................ 72, 569

gene 82, 86, 87, 88, 121, 126, 165, 230, 454, 455,

456, 457, 459, 521, 522, 543, 544, 546

genetic determinism ....... 126, 147, 164, 165, 168,

227, 274, 355

Genome Project ...................... 248, 252, 254, 255

Gerrit Glas ...................................................... 237

glandula pinealis .................................... 470, 471

Glass ............................................... 226, 238, 239

Glen Rein ........................................................ 463

Globuli ............................................................ 484

God ........................ 4, 46, 130, 321, 341, 358, 386

Gödel’s Proof .................................................... 33

Goldberg ......................................................... 341

Golden Mean .......................................... 259, 260

Golden Ratio ................................... 183, 197, 575

Golden Section ....................................... 260, 262

Golden Spiral .................................................. 183

Good ... 50, 78, 116, 129, 134, 143, 241, 270, 287,

364, 422, 466

Goswami ... 48, 79, 91, 92, 94, 212, 288, 295, 303,

331, 441, 566

gravitational constant .................................... 270

Greek ...... 108, 114, 138, 218, 410, 412, 442, 444,

474, 520, 540



586

Gregorian chant ............................................. 385

guilt ................. 49, 52, 61, 64, 386, 434, 507, 552

H

hallucinations ........................................... 88, 567

Hans-Georg Gadamer ............................. 194, 445

harmful dysfunction ....................... 236, 237, 239

harmonic frequencies .................................... 154

Hawking ................................................ 38, 39, 41

health ..... 147, 159, 160, 210, 218, 229, 230, 331,

402, 421, 545, 546

health care ..................................................... 218

Heart ....... 160, 382, 402, 463, 464, 548, 570, 611

Hebrew ... 69, 71, 72, 73, 105, 106, 114, 118, 135,

136, 142, 177, 179, 210, 257, 265, 318, 321,

334, 335, 336, 340, 342, 345, 347, 348, 357,

358, 359, 360, 361, 362, 363, 369, 371, 372,

373, 374, 375, 378, 379, 381, 382, 383, 388,

402, 404, 414, 415, 416, 417, 426,468, 474,

509, 516, 532

Hebrew Bible ...... 40, 71, 103, 108, 125, 129, 176,

208, 246, 340, 381

Hebrew linguistic ....................... 66, 114, 153, 179

Hebrew linguistics ...... 69, 95, 101, 106, 135, 138,

172, 175, 176, 181, 188, 252, 550, 560

Hebrew Tanakh ...... 103, 107, 129, 144, 172, 173,

174, 176, 306

Heidegger ................................ 41, 42, 43, 44, 567

Helix .................................................................. 78

hemispheric synchronization ......................... 329

Herakleitos ....................................................... 51

Here I am ........................................................ 468

hermeneutic . 44, 70, 81, 107, 145, 146, 151, 187,

193, 212, 215, 216, 230, 296, 360, 435, 445,

446, 469, 508, 511, 513, 517, 562

Hermeneutical Circle ........................................ 43

hermeneutical distortion . 151, 302, 438, 444, 445

Hermeneutical Mindlink Therapy .................. 536

Hermeneutical understanding ....................... 222

hermeneutics 41, 44, 45, 145, 162, 193, 194, 230,

360, 383, 413, 414, 439, 444, 445, 503

Herz ................................. 348, 427, 453, 469, 502

hexachord ....................................................... 348

Hexachordum Duplex ..... 178, 195, 209, 253, 318,

333, 337, 348, 405, 509, 532, 535

Higgs-field ....................................................... 138

Higgs-particle ................................................. 138

Hinduism .................................................. 47, 176

hippocampus .................................. 225, 529, 564

Hippocrates ............................................ 158, 168

Hofstadter ........................................................ 33

holistic research ............................................... 47

Holocaust 134, 488, 504, 510, 513, 527, 539, 540,

541, 542, 543, 544, 547, 568, 572, 574, 575,

576

Holocaust survivors ........................ 527, 542, 547

homeopathy ........................................... 169, 465

homeostasis ..... 89, 120, 121, 122, 142, 147, 171,

174, 193, 196, 255, 292, 295, 296, 302, 361,

400, 402, 412, 457, 469, 508, 516, 526, 547

homo religiosus .............................................. 118

Homo Sapiens ................................................ 455

horizon ........................ 54, 55, 107, 146, 302, 358

horizons ....................................... 45, 61, 195, 527

HPA-axis ... 63, 121, 150, 151, 356, 440, 459, 488,

511, 563, 572

Hubble .................................................... 138, 345

human being ........... 106, 218, 251, 334, 467, 472

Human Cognition ........................................... 455

human genome ........................... 62, 82, 144, 248

Humanity .. 53, 109, 113, 127, 218, 224, 359, 430,

540

Husserl ...................................................... 66, 565



587

hypertension .................................................. 542

hypothalamic-pituitary-adrenal ............. 356, 459

hypothetic-deductive approach ..................... 152

Hypothetic-deductive method ..... 125, 143, 145,

149, 150, 485

Hypothetic-strategic intervention-analysis .... 151

I

Idealism ............................................................ 61

Ideographic Matrix ......................................... 152

IFG2 ................................................................ 529

image of man . 122, 142, 147, 331, 433, 437, 441,

472, 505, 513, 514, 515, 519, 520, 521, 522,

525, 526, 528, 529, 547

imaginairy order ............................................... 37

immune system ....................... 150, 210, 356, 511

Implicate Order ........................................ 38, 563

improvements ......................... 453, 466, 498, 499

in varietate concordia ...................................... 91

Infinite No-Thing ...... 70, 116, 129, 161, 171, 175,

177, 287

in-formare ...................................................... 138

Informatio Energetica per Participationem .... 172

Informatio per essentiam ............................... 171

Informatio Potentialis Energetica .. 138, 171, 172,

176

Informatio Potentialis Energetica per Essentiam

.................................................................. 172

information .... 104, 138, 152, 157, 161, 321, 324,

325, 347, 348, 349, 353, 357, 358, 359, 380,

382, 389, 394, 403, 408, 409, 452, 453, 457,

459, 463, 469, 479, 480, 481, 483, 484, 485,

487, 489, 490, 491, 496, 513, 514, 521, 525,

526, 546, 547

Infrasound ...................................... 308, 309, 316

innate ............................................................. 440

insulin resistance ............................................ 542

integrate medicine ........ 63, 85, 91, 320, 403, 529

Integrative Medicine211, 220, 221, 234, 430, 563

interference .... 122, 148, 152, 228, 328, 330, 440,

457, 483, 486, 487, 490

interference field .................................... 440, 457

intergenerational ... 494, 504, 505, 506, 509, 510,

527, 528, 539, 541, 543, 544, 547

intergenerational epigenetic inheritance .... 494,

504, 527, 528, 539, 547

intergenerationally ................................. 510, 513

Intermezzo ............................................. 208, 307

Internal Consciousness ....................................... 5

internal-consciousness dialectics .................. 119

intern-conscious ..................................... 148, 172

intervention-analysis ...................................... 151

Ishango Bones .................................................. 66

Isochoric Tones .............................................. 330

J

Jablonka ............................................. 62, 81, 224

Jan Foudraine ................................................. 220

Jean Baptiste Lamarck (1744–1829) .............. 164

Jennifer Doudna ..................................... 310, 316

Jewish ... 46, 50, 69, 104, 106, 108, 109, 126, 156,

159, 160, 164, 194, 218, 341, 343, 345, 347,

358, 360, 373, 374, 375, 379, 380, 383, 392,

467, 476, 504, 538, 539, 540

Jewish image of man ........................................ 93

Jewish linguistics .................................... 103, 107

Jewish self-empowerment .............................. 104

Jewish traditional medicine .... 102, 105, 110, 111,

113, 126, 129

Jewry ...................................................... 108, 540

JHWH 76, 108, 127, 129, 130, 170, 175, 186, 187,

193, 251, 263, 305, 334, 336, 420, 568



588

JTM .......................................... 104, 105, 113, 126

Judaism ... 102, 103, 104, 108, 109, 111, 114, 116,

118, 127, 129, 131, 136, 145, 156, 159, 161,

163, 169, 170, 175, 176, 193, 564, 566

Judaism in Europe .......................................... 102

K

Kabbalah ...... 71, 72, 321, 362, 564, 566, 571, 575

Kabbalàh ......................................................... 467

Kalisvaart ............................................... 435, 508

Kant ............................................................ 39, 51

KE-family .......................................................... 83

Kevin Davies ................................................... 265

Khedem .......................................................... 187

Kraepelin ........................................ 216, 233, 239

kundalini ................................................. 463, 464

Kupfer ...................................... 126, 211, 241, 243

L

Labuschagne ........................................... 341, 568

Lacan ........................................................ 37, 110

Lamarckian ................................................. 81, 82

Lamarckism ........................................ 62, 81, 224

language 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43,

44, 46, 48, 59, 65, 66, 67, 68, 69, 70, 71, 72,

73, 74, 75, 77, 78, 79, 80, 81, 82, 83, 86, 87,

88, 89, 95, 98, 99, 101, 103, 106, 108, 109,

111, 115, 118, 119, 127, 130, 135, 138, 141,

143, 144, 161, 172, 179, 186, 187, 189, 210,

243, 244, 248, 249, 251, 252, 253, 263, 265,

306, 321, 334, 335, 336, 337, 338, 340, 341,

347, 348, 354, 357, 360, 362, 363, 364, 372,

383, 384, 444, 451, 454, 455, 456, 468, 472,

474, 504, 509, 515, 523, 524, 549, 560, 563,

565, 570, 574

language of the Bible ................................ 71, 101

languages ....................................................... 357

larynx ................................................................ 85

Last Theorem of Fermat ................................ 265

Laszlo ...................................................... 138, 568

Leonardo da Vinci ........................................... 185

Levant ............................................................. 138

Levinas ................... 51, 58, 67, 128, 134, 146, 569

ligand ...... 114, 115, 118, 251, 285, 295, 296, 297,

298, 349, 352, 526

ligands ..................................... 345, 453, 474, 485

Light 48, 50, 51, 55, 56, 57, 58, 59, 66, 68, 70, 71,

76, 77, 78, 95, 104, 105, 263, 270, 272, 280,

281, 337, 362, 363, 364, 365, 366, 370, 371,

372, 402, 548, 564, 568, 620

linguistic turn .................................................... 41

linguistics ........... 37, 347, 357, 375, 402, 474, 532

living human document .................................. 451

loneliness ............................................. 61, 64, 65

longitudinal ............. 442, 452, 460, 462, 501, 559

Lotte ........................ 449, 450, 451, 452, 453, 478

love . 127, 136, 161, 340, 341, 367, 379, 384, 423,

426, 463

Lubbers ............................ 445, 446, 447, 448, 569

Lyotard ............................................. 43, 108, 569

Lysons ............................................. 131, 132, 133

M

Maimonides ... 126, 128, 130, 131, 141, 156, 163,

575

mammalian brain pathways ............................. 88

mankind .................. 113, 425, 468, 509, 540, 541

Marx ................................................................. 66

Marxism ........................................................... 66



589

materialistic scientists .................................... 339

Maternal-Foetal-Disorder-Syndrome ............... 64

Maternal-Foetal-Distortion”-syndrome ... 89, 440

Maternal-Foetal-Distortion-syndrome .. 120, 196,

512

mathematics ... 119, 336, 341, 357, 368, 370, 383,

409

Mathieu D. Polak ............................................ 502

Mathieu Polak ................................................ 348

Max Weber ..................................................... 149

maximum distantion ...................................... 403

maximum proximity ....................................... 403

MDF .................................................. 64, 120, 400

MDF-syndrome ................................. 86, 121, 400

meaning-adequacy ......................................... 149

mederi ............................................................ 112

medical ethics ................................ 213, 214, 215

medical philosophy 36, 40, 67, 79, 108, 130, 142,

145, 254, 375

Medical power ........................ 202, 213, 214, 215

Medical Psychiatry ......................................... 218

medical technology ................. 111, 112, 113, 114

medical-intermediary system ......................... 111

medicine ..... 6, 104, 126, 153, 156, 158, 159, 160,

165, 169, 210, 211, 222, 230, 337, 345, 349,

358, 423, 430, 437, 466, 534, 535

medulla ............................................................ 85

memantine ............................................... 89, 226

memory of experience ................................... 121

mental disorder .............................................. 469

mental disorders 64, 65, 211, 217, 220, 221, 222,

229, 234, 235, 296, 302, 441

mental illness .......................... 216, 236, 237, 243

metaphysical .... 43, 50, 51, 52, 55, 59, 60, 61, 99,

111, 143, 341, 472, 515

metaphysics ............................. 119, 135, 439, 514

methodologically falsifiable ........................... 122

methylation .... 457, 458, 488, 503, 512, 516, 527,

529, 543, 544, 545, 546, 567, 574, 576

Meyl ............................................................... 462

MFD ... 6, 400, 433, 436, 440, 441, 457, 458, 469,

494, 501, 502, 504, 505, 506, 512, 513, 528,

529, 530, 533, 535, 536, 539, 546, 547

MFD-syndrome ... 6, 528, 549, 550, 551, 553, 554,

555, 556, 557, 558, 559, 560

mind ... 34, 98, 102, 172, 193, 211, 215, 218, 275,

295, 324, 339, 349, 414, 423, 434, 514, 516,

517, 518, 519, 569

Mindlink intervention strategies .................... 149

Mindlink-system ..... 5, 6, 107, 121, 146, 148, 172,

226, 296, 299, 303, 318, 328, 330, 333, 336,

347, 400, 403, 408, 420, 421, 424, 431, 433,

435, 436, 438, 439, 440, 441, 452, 453, 454,

455, 456, 457, 460, 466, 469, 476, 477, 478,

480, 483, 485, 486, 487, 489, 490, 501,

502,504, 508, 509, 510, 511, 512, 513, 514,

517, 518, 525, 526, 527, 528, 529, 530, 533,

536, 537, 546, 549, 550, 551, 554, 555, 558,

559, 560

Mindlinktest-system ....................... 488, 501, 546

miracle ..... 132, 210, 340, 386, 389, 397, 435, 453

Miracles .......................................................... 356

miraculous gestorum ..................................... 176

missing link ....................................... 40, 139, 142

Mobius ................................................... 460, 465

Molecular Biology .............................. 62, 81, 224

Monaural beats .............................................. 330

monism ..................................................... 47, 295

monotheistic religions .................................... 108

morphogenetic fields ...... 331, 441, 459, 468, 525

motor corticostriatal loop ................................ 84

Mozart .............................................. 40, 407, 564

mRNA ...................................... 309, 310, 316, 567

multicellular organism .................................... 457



590

music .. 3, 4, 6, 33, 83, 85, 90, 104, 109, 124, 136,

166, 171, 210, 227, 328, 332, 333, 334, 337,

338, 339, 340, 341, 342, 343, 344, 345, 346,

347, 348, 349, 351, 352, 353, 357, 358, 359,

360, 361, 370, 373, 375, 379, 381, 382, 383,

384, 385, 386, 387, 389, 398, 399, 400, 403,

406, 407, 408, 409, 410, 412, 413, 414, 415,

416, 420, 422, 426, 429, 431, 433, 435, 436,

439, 442, 452, 453, 454, 455, 456, 469, 470,

493, 495, 496, 499, 502, 503, 508, 509, 512,

514, 526, 527, 529, 532, 533, 535

music therapy ... 46, 107, 119, 120, 121, 122, 124,

135, 154, 193, 196, 210, 211, 220, 227, 228,

333, 352, 358, 375, 433, 435, 529

musicality ......................................... 82, 454, 567

mutation ...................................... 82, 85, 455, 469

mutations 79, 80, 82, 87, 102, 227, 230, 457, 513,

529

mysticism ............................................... 342, 343

N

Name .... 50, 75, 76, 108, 109, 110, 127, 170, 175,

176, 272, 280, 325, 334, 336, 426

natural selection ............................................... 82

naturata .......................................................... 166

Nature 58, 66, 86, 90, 92, 93, 104, 109, 110, 111,

112, 118, 132, 156, 164, 166, 169, 179, 222,

241, 252, 254, 279, 284, 332, 333, 342, 347,

349, 354, 357, 360, 362, 370, 372, 383, 391,

415, 426, 438, 443, 446, 454, 456, 457, 460,

467, 468, 474, 480, 493, 496, 508, 509, 514,

522, 524, 530, 533, 535, 538, 539, 546, 547,

568, 575

Neo-Darwinism ............................................... 141

neonates ........................................................... 64

Neurologic Music Therapy ............... 48, 338, 574

neurological ....................... 88, 218, 227, 333, 434

Neurological Music Therapy . 6, 34, 49, 62, 63, 69,

70, 79, 80, 85, 122

neurology ............................................... 218, 230

neuro-networks ...................................... 120, 149

neuropsychiatry ..................................... 203, 210

Nietzsche ... 48, 49, 51, 52, 53, 54, 55, 59, 60, 128

Nieweg ................................................... 240, 242

nihilism ....................................................... 59, 61

Nini ................................................................. 435

Nocebo ............................................................. 91

Non Impedas Musicam ....................................... 4

No-thing ........................................................... 41

nucleus ...................................... 80, 352, 355, 506

number 26 ...................................................... 334

numerical structures ....... 257, 340, 345, 357, 359

numerological logo-technical research .......... 106

nurture ... 104, 109, 118, 132, 156, 166, 169, 252,

254, 333, 342, 354, 357, 360, 370, 372, 426,

456, 509, 547

O

obesities ........................................................... 64

obesity .................................................... 421, 542

occupational disability .................................... 244

octavation ...................................... 333, 334, 335

offspring .................................. 542, 543, 544, 547

Old Testament ................................................ 114

onsciousness .................................................. 338

Openness .................................................... 42, 44

opium ............................................................. 218

optimism ........................................................ 248

oral Torah ....................................................... 158

Orchestrating Factor of Repair” ..................... 403

Orchestration Factor of Recovery . 309, 310, 316,

317



591

osmosis-model ............................................... 289

P

parable ............................................................. 53

paradigm ...... 79, 91, 98, 108, 113, 127, 133, 135,

138, 147, 168, 169, 174, 217, 218, 223, 224,

229, 230, 247, 251, 254, 255, 256, 303, 354,

512, 515, 525

particles .. 171, 196, 339, 344, 353, 382, 399, 429,

431

Patel ................................................... 89, 90, 571

pathway .......................................... 444, 515, 516

pathways ........................................................ 343

Paul Davies ............................................. 249, 250

Peretz ....................................................... 83, 571

Periodic Table . 270, 272, 273, 277, 278, 281, 284,

290, 366, 426

Periodic Table of Elements ............................. 272

Periodic Table of the Elements ..... 270, 273, 284,

366, 426

permutations ........................................ 70, 72, 73

pharmacology ................................. 110, 113, 132

phenomenological memory of experiences ... 120

Phenomenology ............................... 66, 569, 571

phenomenon .... 44, 127, 153, 159, 322, 323, 327,

349, 353, 365, 412, 441, 460, 462, 474, 478,

487, 490, 514, 515, 520, 525, 534

phenotype .............................................. 231, 239

philology ......................................................... 414

Philosophia Perennis ..................... 188, 192, 254

Philosophical Foundation of MFD ............. 6

philosophical introduction .............. 90, 454, 516

philosophical research ........ 34, 95, 116, 117, 156

Philosophicus Rex ................................... 192, 254

photon ............................................................ 366

physical ....... 6, 109, 115, 122, 157, 160, 196, 220,

325, 356, 362, 381, 400, 401, 452, 458, 463,

467, 468, 469, 474, 475, 486, 491, 501, 503,

505, 511, 512, 513, 515, 516, 517, 518, 519,

523, 525, 547

Physical standing wave ................................... 262

physician ................................................ 126, 220

physiology ...................................... 132, 222, 256

Pierre de Fermat .............................................. 68

Pierre Fermat (1601-1665)............................. 265

pineal gland of crystalline spheres (brain sand)

.................................................................. 473

pitch sequencing .............................................. 83

pitches ..................................... 346, 388, 389, 409

placebo90, 91, 165, 196, 214, 480, 481, 496, 498,

500, 549, 553, 560

placebo-acknowledged .................................... 90

placenta ........................... 150, 440, 441, 459, 542

Planck ............................................................. 138

Plato ...... 43, 51, 58, 192, 347, 410, 468, 520, 570

Plotinus ....................................................... 51, 58

PNAS 406, 407, 408, 409, 544, 563, 567, 569, 571

poet ................................................ 360, 382, 385

Point One ......................................................... 40

polypeptide .................................................... 316

polypeptides ................................................... 316

portrayal of man ............................................... 63

positive resonance ......................................... 487

posterior ........................................................... 85

postulates ............................................... 153, 409

potentiality ..... 138, 142, 156, 157, 171, 345, 355,

362, 372, 384, 413, 441, 458, 459, 465, 468,

515, 516, 525, 527

prefrontal ......................................... 85, 475, 529

prefrontal cortex ...................................... 85, 529

pregnancy ... 63, 65, 434, 546, 551, 552, 564, 567,

572, 573



592

Prejudices ....................................................... 169

prenatal ...... 6, 150, 196, 347, 368, 400, 421, 435,

438, 440, 441, 458, 459, 488, 501, 502, 503,

504, 506, 507, 511, 513, 528, 529, 539, 545,

546

prenatal programmed HPA insufficiency ....... 235

preparation egg .............................................. 506

Primary Being ................................. 126, 129, 130

primates ............................................. 62, 87, 455

primordial vibration ......................................... 40

probabilities ................................................... 343

process of understanding ............................... 109

procreation ....... 89, 438, 440, 441, 469, 503, 506,

510, 544

prof. Dr. Jan Hendrik van den Berg ................ 213

Programming ... 86, 211, 359, 400, 440, 506, 510,

511

prokaryotes .................................................... 401

Prolegomena .... 38, 70, 76, 95, 96, 109, 179, 188,

193, 195, 246, 248, 250, 252, 271, 275, 289,

296, 359, 361, 362, 364, 372, 419, 515

Proportio Divina ............................................. 260

protein ....... 38, 126, 142, 189, 250, 296, 317, 352

protention ...................................................... 166

Proto-European Language ................................ 66

protostructure of understanding ..................... 42

Proximal identification ........................... 215, 244

proximity ................................................ 243, 515

pseudo-adulthood ............................................ 63

pseudoscience ................................................ 472

PSTD-experiences ........................................... 488

psychiatric nosology ....................................... 239

psychiatry165, 210, 216, 218, 220, 229, 230, 237,

256

psychic immaturity ........................................... 63

psychopathology ..................... 228, 241, 441, 477

psychosocial pharmacy .................................. 235

Psychotropic drugs ......................................... 235

PTSD ........ 504, 509, 510, 529, 542, 547, 559, 575

PTSD-patients ................................................. 504

Puleo ....... 100, 101, 173, 209, 340, 382, 391, 394

Puleo, ..................................................... 340, 394

Pythagoras .. 34, 35, 131, 136, 137, 142, 190, 250,

262, 263, 278, 282, 334, 346, 360, 387, 389,

410

Pythagorean ..... 95, 175, 183, 186, 187, 280, 283,

348, 370, 420

Pythagorean reduction ................................... 420

Q

Qu’ran ............................................................ 129

Qualia ..... 513, 514, 516, 517, 518, 519, 523, 524,

569, 572

quantum . 109, 119, 122, 142, 145, 151, 157, 164,

171, 196, 287, 334, 343, 344, 349, 352, 357,

362, 363, 364, 382, 387, 413, 424, 429, 431,

452, 459, 460, 462, 465, 466, 467, 468, 503,

513, 515, 516, 525, 526, 547

Quantum mechanics ................................ 79, 169

quantum physics .... 122, 142, 164, 287, 344, 357,

363, 460, 462, 467, 513

quaternary system .......... 249, 256, 257, 258, 276

R

radiation . 138, 142, 167, 170, 287, 290, 301, 302,

320, 332, 345, 436, 457, 469, 472, 475, 476,

489, 517

rainbow ................................... 348, 365, 548, 628

randomised ............................. 122, 126, 146, 246

Rationalism ....................................................... 61



593

receptor .. 118, 121, 226, 285, 352, 567, 568, 573,

575

Recommandations ......................................... 533

Recommendation ................... 533, 534, 535, 536

reductionism .................................. 363, 524, 525

Reductive Explanation ............. 513, 519, 524, 569

Rein ......................................... 100, 463, 464, 572

relativity . 114, 128, 133, 138, 188, 364, 387, 465,

515, 524, 572

re-ligare ................................... 118, 361, 509, 514

religion ...................... 85, 106, 108, 127, 175, 509

repeatability ... 122, 145, 246, 478, 479, 480, 481,

492

repeatable ............................... 122, 126, 478, 479

research .... 6, 85, 86, 88, 104, 115, 122, 126, 130,

136, 147, 152, 165, 167, 169, 170, 171, 177,

196, 210, 218, 220, 226, 227, 229, 230, 249,

250, 256, 257, 282, 320, 321, 328, 330, 331,

334, 336, 337, 338, 339, 340, 341, 343, 346,

347, 349, 354, 355, 357, 358, 359, 360, 362,

368, 372, 373, 386, 387, 392, 400, 402, 403,

406, 407, 409, 410, 415, 416, 422, 427, 430,

433, 435, 436, 438, 439, 440, 442, 444, 445,

452, 453, 454, 457, 458, 459, 464, 466, 468,

469, 472, 473, 477, 478, 479, 480, 481, 483,

485, 488, 490, 492, 494, 495, 498, 500, 501,

502, 503, 504, 505, 506, 508, 509, 510, 512,

517, 518, 527, 529, 530, 535, 536, 539, 540,

541, 542, 543, 545, 546, 547

retrocipation ...... 92, 94, 291, 297, 298, 299, 302,

331, 516, 520

retrocipation-concept ...................................... 94

RNA................................................................. 140

RNA-protocell ................................................. 140

Rob Lubbers ........................................... 194, 445

Roots ................................................................ 72

Rorty ................................................................. 41

Rosenzweig ..................................................... 135

Rupert Sheldrake .................................... 441, 463

Ruusbroec ................................................ 56, 573

S

saccharide ...................................................... 484

san .................................................................. 112

sanare ............................................................. 112

sanctus ........................................................... 112

Sanskrit ..... 99, 100, 106, 108, 112, 172, 175, 385,

463, 565

Saussure ........................................................... 37

scalar fields ..................................................... 173

scalar sound-waves ........................................ 100

Scalar waves ............ 318, 454, 460, 463, 464, 465

schizophrenia ... 36, 65, 79, 80, 81, 85, 87, 88, 89,

102, 126, 165, 216, 220, 221, 222, 226, 227,

228, 229, 230, 231, 232, 233, 234, 235, 240,

242, 294, 296, 318, 400, 442, 449, 451, 452,

455, 469, 529, 543, 565, 566, 567, 568, 573,

574, 576

schizophrenic .... 37, 102, 147, 228, 449, 452, 453

Schleiermacher ................................................. 44

Schumann resonance ..... 196, 262, 305, 306, 320,

322, 323, 331, 332, 334, 400, 410, 453, 475,

562, 563, 571, 573, 574

Schumann Resonances ... 318, 319, 374, 405, 428,

436, 452, 509, 512, 549, 559, 560

science .... 142, 144, 165, 218, 230, 248, 320, 331,

335, 336, 339, 342, 357, 374, 444, 464, 472,

477, 515, 516, 519, 525, 544

scientific evidence ... 126, 211, 216, 227, 303, 477

scientific image of man ............................ 93, 195

Seldrake .......................................................... 331

self-affirmation ..................................... 61, 62, 64

self-consciousness ................... 108, 153, 295, 296



594

self-destructive ability ...................................... 91

self-emergent process .................................... 412

self-reflection ............ 91, 223, 230, 342, 423, 427

semantics ....................................... 347, 360, 363

shaktipat ......................................................... 463

shape .............................................. 415, 465, 471

Sheldrake ........................... 92, 331, 459, 468, 525

Shoah ...................................................... 347, 540

Sickness behaviour ............ 65, 210, 211, 217, 441

sine-frequencies ............................................... 97

Singularity ........................................ 39, 40, 66, 68

sinus-waves .................................................... 172

small organ ..................................................... 473

social disintegration ................ 151, 438, 444, 445

social system .................................................. 455

sociological .............. 149, 166, 168, 195, 297, 478

Solfeggio ... 99, 101, 136, 174, 176, 177, 178, 208,

333, 341, 342, 358, 373, 385, 386, 387, 392,

394, 509, 567

Song ........................................................... 74, 88

songbirds ........................... 81, 86, 87, 88, 98, 563

sound and speech .......................... 230, 429, 456

Source .. 37, 48, 49, 59, 66, 68, 70, 77, 78, 79, 85,

92, 95, 99, 103, 106, 107, 108, 109, 111, 112,

114, 115, 116, 117, 118, 127, 128, 130, 136,

142, 144, 155, 156, 159, 161, 162, 171, 175,

176, 181, 182, 185, 186, 188, 189, 190, 192,

195, 209, 246, 247, 248, 251,252, 253, 256,

263, 273, 275, 286, 296, 297, 298, 299, 305,

334, 337, 344, 345, 348, 354, 361, 362, 363,

364, 370, 371, 372, 373, 379, 380, 381, 382,

387, 389, 410, 415, 416, 417, 419, 422, 423,

425, 426, 430, 432, 474, 509, 514, 515, 516,

526, 531, 558

Source Code .................... 103, 107, 112, 117, 156

Source of All ... 3, 37, 92, 296, 297, 509, 514, 526,

531, 558

Source of daily life ............................................ 49

Source of Energy .............................................. 37

Source of existence ................................ 171, 176

Source of life ................................. 38, 66, 68, 188

speech 86, 87, 222, 328, 346, 384, 403, 406, 412,

431, 442, 452, 454, 456, 509, 512, 514

Spinoza 37, 38, 46, 47, 51, 93, 111, 112, 114, 118,

119, 125, 130, 132, 142, 145, 161, 164, 166,

167, 171, 177, 222, 273, 295, 364, 437, 439,

442, 467, 563, 572, 574

Spinoza’s philosophy ...................................... 467

spirituality ...................................................... 109

SR 320, 322, 323, 324, 327, 328, 331, 332, 333,

334, 335, 336, 401, 402, 410, 432, 532

standing wave ................. 260, 262, 263, 333, 334

Statistical report of fundamental research and

practical observations .............................. 494

stem cell .................. 441, 459, 469, 488, 510, 547

stress .. 63, 65, 160, 225, 235, 356, 357, 368, 400,

408, 440, 441, 459, 469, 486, 502, 505, 506,

508, 511, 527, 542, 543, 545, 546, 569, 573

striatum ............................................................ 87

Structural numbers ........................................ 253

subliminal ........................ 102, 347, 382, 401, 422

Substance ... 58, 93, 114, 125, 127, 142, 171, 251,

257, 263, 284, 288, 290, 295, 305, 429

substances .............................................. 353, 473

sufficient .......... 126, 166, 362, 376, 403, 507, 513

Super Lissajous figures ................................... 264

superstring theory .......................................... 365

supramental body ............................................ 94

Supramental Intelligence ......................... 70, 275

symbionts ....................................................... 118

symbolic order .................................. 37, 110, 118

symptoms 226, 227, 348, 433, 438, 442, 478, 486

synchronisation .............................................. 324

syntactical .............................................. 115, 172



595

synthesis ......................................... 345, 347, 458

T

Talmud ............................ 132, 133, 157, 159, 282

Tanakh 68, 71, 103, 105, 108, 109, 114, 117, 119,

125, 129, 130, 133, 143, 144, 162, 175, 176,

177, 181, 189, 190, 192, 208, 209, 210, 275,

335, 340, 341, 343, 345, 359, 360, 361, 373,

374, 375, 376, 380, 381, 382, 389, 397, 414,

415, 416, 420

Taoism ....................... 47, 130, 166, 176, 295, 439

taxonomy ............................................... 103, 238

TCM ........................................................ 126, 360

Temple-music ................................................. 101

temporal lobe ................................................... 88

Tertium Datur ................................................. 535

Tesla 5, 6, 62, 81, 85, 89, 107, 120, 121, 146, 148,

152, 154, 183, 196, 197, 200, 201, 211, 226,

228, 319, 322, 347, 349, 359, 402, 410, 415,

416, 421, 424, 430, 431, 436, 440, 442, 452,

460, 461, 462, 463, 464, 469, 483, 484, 486,

489, 490, 496, 510, 511, 512, 514, 531, 533,

535, 549, 558, 560, 564, 568, 571, 574

Tesla-scalar-transformation technology ........ 5, 6

Tesla-technology ..... 146, 410, 431, 440, 460, 496

Tetragrammaton ......... 75, 76, 129, 280, 360, 420

tetrahedron .......................................... 73, 74, 76

thalamus ......................................................... 472

the Other ................................................ 109, 194

The Schumann Resonance for Tyros .............. 320

The Truman Show ............................................ 78

theorem ..................... 33, 118, 129, 155, 265, 534

Theorem of Fermat ............................ 68, 77, 265

Theory about Everything ........................ 119, 127

Theory of Everything .............................. 141, 274

Third Eye .................. 318, 471, 476, 489, 573, 574

Thomas Aquinas ............................................... 51

Thymine .......................................... 276, 277, 285

Time Magazine ............................................... 233

TJM ......................................................... 133, 360

Tonic ......................................................... 40, 334

Torah .. 71, 74, 105, 106, 108, 109, 118, 125, 126,

128, 129, 134, 135, 136, 141, 143, 144, 154,

156, 157, 158, 159, 160, 161, 163, 170, 175,

180, 192, 210, 246, 249, 250, 252, 253, 254,

273, 278, 279, 280, 283, 284, 321, 334, 335,

340, 341, 342, 345, 364, 371, 373, 379, 382,

384, 385, 391, 397, 414, 415, 566, 575

Toulmin .......................................................... 223

Transcendent ........... 110, 111, 112, 113, 114, 130

transcendental 42, 49, 55, 67, 112, 211, 291, 296,

297, 298

transcendental openness ................................. 42

transformation ..... 5, 6, 35, 62, 81, 347, 359, 403,

410, 465, 486, 490, 512

transformational technology .......................... 531

translational neuroscience ............................... 87

transverse waves (TW)................................... 461

treatment 6, 48, 85, 109, 142, 152, 165, 194, 210,

215, 218, 221, 328, 333, 349, 356, 357, 359,

389, 400, 401, 403, 423, 435, 436, 437, 440,

452, 453, 468, 469, 478, 480, 485, 488, 493,

500, 501, 502, 503, 504, 505, 508, 510, 512,

513, 519, 520, 527, 536, 547

treatments ................... 6, 439, 460, 479, 504, 536

Tree of Life ............................................. 190, 476

triangle ................................................... 382, 415

triangular number .......................... 382, 396, 415

Trias Creations ................................................ 363

Trudy Dehue ................................................... 226

Twelve Frequency range in notation .............. 414

Twelve tones circle ........................................... 70

twelve-tone system ........................................ 196



596

U

Ultimate Concern 49, 70, 154, 155, 161, 188, 210

Ultrasound ...................................... 308, 309, 316

uncertainty . 61, 64, 121, 368, 433, 434, 435, 438,

459, 469, 485, 492, 501, 547, 551, 552, 554,

555, 557

Uncertainty Principle ...................................... 467

unconscious ...... 37, 151, 347, 357, 420, 421, 438,

453, 469, 485, 489, 490, 512, 514, 547

unconsciousness .... 120, 121, 122, 436, 457, 476,

485, 487, 488, 510, 513, 516, 524, 526

Understanding Community) ............................. 45

unintentional spontaneity .............................. 179

unity in diversity ..... 133, 161, 164, 165, 188, 255,

303, 363, 466

Unity of Essence ............................................... 35

universal human commitment ........................... 4

universalism ........................................... 105, 161

Universe . 35, 77, 78, 79, 106, 114, 171, 271, 304,

364, 413, 567, 570

unlocking process .. 138, 291, 292, 347, 440, 441,

514, 515, 516, 525

Uracil .............................................................. 316

uterus ..................................................... 441, 545

ut-re-mi-fa-so-la ............................... 99, 359, 385

V

validity .... 136, 439, 440, 453, 477, 478, 480, 501,

534

value based .................................... 126, 534, 535

value based evidence ..................................... 249

value-based ..... 122, 211, 234, 241, 435, 466, 477

Van den Berg .................................................. 214

Van den Bosch ........................................ 231, 232

vertebrate ...................................................... 471

vital-emotive incarnation ........................... 63, 64

vital-emotive life .................................... 488, 508

Vital-Emotive-Field of Consciousness ............... 3

Vitruvius ......................................................... 185

vocal pathways ................................................. 85

vortex ..................................................... 462, 463

W

Wachter ............................................................ 47

Wanker ................................................... 135, 575

whales ........................................................ 81, 87

Whole .......................... 35, 38, 40, 44, 46, 48, 572

whole brain sync ............................................ 329

Wittgenstein ......................................... 38, 39, 66

Womb as Paradise Lost ................................. 538

word and sound ............................................. 349

Y

Yin and Yang .......................................... 331, 476

YouTube 97, 98, 99, 115, 136, 162, 172, 173, 176,

208, 209, 340, 341, 358, 382

Φ

Φ (Phi) .................................................... 180, 181


Appendices: Frequencies in Therapeutical Terms and Key Numbers

597

Appendix 4:

Therapeutic Terms and Frequencies:

Key Numbers In Qualitative Numerological Logotechnique:

basic for Partimento and structural composition



598

Key Numbers in Qualitative Numerological Logotechnique

- 63 -

63, nabi (prophet): 1+10+2+50=1.1.2.5

1

5

63=7*9

1

2

9

7

7=3+4

4

3

Melody on the 63

Harmony on 63

Rhythm on 63 (1.1.2.5)

Rhythm on 63 (6.3)



599

Qualitative Numerological Logotechnique

- 174 -

174 Ve'itzbu (we are aggrieved)

: 6.5.9.7.6

6

5

9

7

6 5 9 seen as 2

7

6

174: 2*3*29

2

2

3

9

Melody on 174 (6.5.9.7.6)

Melody on 174 (6.5.9.7.6 - 2*3*29)

Harmony on 174 (6.5.9.7.6)

Harmony on 174 (2*3*29)

Rhythm on 174 (6.5.9.7.6)



600

285 Be-zacharno (in remembrance)

: 6.5.2.7.2

6

Qualitative Numerological Logotechnique

- 285 -

2

2

5

7

6 5 2

7

2

285 (3*5*19)

3

5

1

9

Melody on 285 (6.5.2.7.2): is the same as on 174

Melody on 285 (6.5.2.7.2 + 3.5.19)

Harmony on 285 (6.5.2.7.2):

same as on 174 Fmaj7/C

Harmony on 285 (3.5.19)

Cmaj7

Rhythm on 285 (6.5.2.7.2)

6

5 2

7 2



601



602



603



604



605



606



607



608



609



610


Appendices: Compositions and Analyses

611

Appendix 5:

Composition “Herz” (Heart) and Analysis

(528 Hz)



612

Ocarina

Adagio (q = 60)

ppp

Herz

- 528 -

Mathieu Daniël Polak

Cheshvan 5774

Harp

Adagio (q = 60)

mp

p

p sub.

p

4

6

8

p

Poco piu mosso (q = 90)

Poco piu mosso (q = 90)

pp mp

p

pp

pp mp p pp

rit. Tempo primo (q = 60)

rit. Tempo primo (q = 60)

p

pp

p



613

2

Herz (528)

12

A

16

18

p. sub

Leggiero (q = 120)

mp

mp mp pp

A Leggiero (q = 120) rit.

p

pp

p

p

mp

p

p

mp

20

p

a tempo

pp

rit.

p

pp

pp

p

rit.

rit.



614

Herz (528) 3

23

a tempo

mp

mp

p

pp

p

rit.

rit.

25

f

a tempo

mf

mp p pp

27

f mf p f

mf

29

mp

pp

p

rit.

rit.

pp



615

4

Herz (528)

31 B Adagio (q = 60)

B

p

Adagio (q = 60)

36

40

rit.

rit.

a tempo

mp

p

44

mp

p

pp



616

Herz

Analysis of the 528 1 composition 'Herz' by Mathieu Daniël Polak

Herz is a musical composition by Mathieu Daniël Polak. The composition is based on the

Qualitative Numerological Logotechnique 2 of the Hebrew Tanach. The composition is

commissioned by Gideon Benavraham, as part of his dissertation research for the purpose of the

quantum technological Mindlink test 3 as 'wide frequency spectrum of Heart and Love.'

Moreover, the composition Herz is composed for the purpose of universal therapeutic

applications, including music therapy.

Introduction: Herz, the numbers 528 & 32

A couple of years ago, I put an advertisement in the Jewish magazine NIW (Nieuw Israëlitisch

Weekblad) to obtain commissions for new compositions. Gideon Benavraham called me and told me

about his research of numerological structures of the Tanach. His enthusiasm for the number 528 in

the Tanach and the significance of 528 4 in music therapy became mutual. We decided to cooperate.

For this reason, I composed Herz for harp with ocarina. In this composition the number 528 plays a

significant role. After completion of the composition, Gideon asked me to analyze Herz. Significant

Tanach numbers such as 8,15,17,26,528 could be found in the composition Herz. The title Herz

(German: Heart) refers to both the Hertz-frequency 528 (C2 in pure intonation) as well as to the fact

that the heart (read: love) is the main motivation to my work as a composer 5 . The Hebrew word for

heart is Lev. This word is built from two consonants namely Lamed (L) and Beith/Veith (V). The

sum of Lamed (number: 30 – see appendix) and Veith (2 – see appendix) is 32. The first letter of the

Torah is Beith and the last letter of the Torah is Veith as well. The relationship between the heart and

the Torah becomes evident by their numbers equivalence. If we add 32/31/30/29 and so on all the

way to 1, the end result will be 528. This points out that there is a relationship between the heart (32)

and the DNA repairing number of 528. It points out that here is a relationship between the heart of

men and the task of men namely to contribute to Tikkun Olam 6 .

I. Time signatures: the numbers 15 & 528

I. The time signature of this composition, 15/8 is rather unusual. The number 15 is a reference to the

name of HaShem 7 . The additive value of the first two letters of the Hebrew name of God 8 namely

Yud – Heh 9 , is 15. The composition consists of 3 x 15 bars. In the first part (m1-15) are eleven bars

in 15/8 time and four bars in 7/8 written. Although the number 15 plays an important role in this

composition, this work is in essence about the number 528. I have four 7/8 bars inserted (m9-12) so

the number 28 (four x seven) would be manifest. The number 28 refers to 528.

1 The number 528 plays an important role in the Tanach (Hebr. the Jewish Bible). In music 528 Hertz is the frequency of

the tone C2 in pure (just) intonation.

2 Logotechnique is a term invented by Claus Schedl and developed by Prof. Dr. Casper Labuschagne, emeritus University

of Groningen (RUG). The term originates from the Modern Greek and refers to numeric structures that lie under

literature. The Tanach is full of numeric structures. Hence, the Tanach could be considered a composition of numbers.

Reference: C. Schedl, Baupläne des Wortes: Einführung in die biblische Logotechnik, Wien 1974.

3 Mindlink test: in mental therapy: test for detecting and treating mental blockades.

4 In some branches of musical therapy the frequency of 528 Hertz is considered healing and DNA repairing.

5 My master thesis at the Lemmens Institute ends with the words: What is the essence of the Torah? The essence of the

Torah is love. The thesis is published at: http://www.joodsstudieplatform.eu/OJS/welkom.html

6 Tikkun Olam (Hebrew): the responsibility of humanity to repair or heal the world.

7 HaShem = The Name (Hebrew). In Judaism, God has many names such as Elohim, Eli, Adonai, Adoshem, Shechina.

8 The Name of God in Hebrew consist of four symbols/consonants (Tetragrammaton) namely YHVH.

9 The Hebrew alphabet is built from 22 symbols/consonants, starting with Aleph and ending with Tav. Every consonant

represents a number as well.



617

Analysis of the 528 composition Herz by M.D. Polak 2

Let us note that 5 + 2 + 8 = 15. Moreover, note that the 7/8 time signature points to 528. After all: 5

+ 2 = 7...... 5 + 2/8 = 7/8. By maneuvering a 15/8 to 14/8, 13/8 and eventually a 12/8 (bars 21/22)

an incorporated accelerando appears. In the third part of the composition (m31-45) the dominant

time signature is 7/8, but the piece ends as it began, with a 15/8 time.

II. Metronome, the number 15

The first four bars of the composition build the first section. 15 x 4 = 60.

For the metronome, the number 60 is chosen. Note that the average heart rate (Hz) of man at rest is

around 60. The number 4 in Judaism stands for the four corners of the world. If 60 is the average

heart rate of humanity, the division by 4 is understandable. It implies people of all the corners of

the world have the same heart rate.

The second section (m5-8) has as metronome rating 90. If we add 60 and 90 this will lead to 15(0).

The second part of the composition (m16-30) has the tempo indication 120.

The second part is significantly more agitato, ' the moving human body.'

Of course there never will be a live performance, by a harpist, at a perfectly executed metronome

number. Because exactness in tempi in this composition is crucial, an electronic performance above

a live performance is preferable. The third movement returns to the pulse 60, ' the moved man. '

III. Rhythm, the number 528

The first note of the composition lasts five beats. The second note lasts 2 beats and the last note of

the first measure lasts 8 beats. 5 + 2 + 8.

Although in the piece permutations take place (bar 2: 2 + 5 + 8), the ‘528 principle’

remains permanently present in the constellation of time values.

In bars 5/6 and 16/30, the number 5 has a central position. This zooms in on the first note value

(bar 1, first note). The number 5 is in this composition, divided into 2 + 3 or 3 + 2.

IV. Intervals, the number 528

The first bar begins with a G sharp, followed by an F and then an E. This downward pattern is

made up of seconds. The augmented second (G sharp – F) is the essential coloring interval of the

Ahavah Rabbah shtayger 10 , a Jewish scale that means 'much love.'

From bar 1 to bar 2, a fifth - leap occurs. The pure fifth is the distance of five.

In the F clef, we see both a fifth namely B backward to E and an octave namely B – B.

An octave in music is the distance of eight. The intervals 5/2/8 are permanently used in this

composition. Another example: bar 16: F sharp – B = descending fifth. Then B – E = descending fifth.

E – D sharp = second. D sharp – G sharp = descending fifth.

V. Movement, the number 528

Bars 16/17 (2 bars) are based on the gestures of bar 5.

Bars 18/22 (5 bars) follow the gestures of bar 6.

Bars 23/30 (8 bars) are the gestures of bar 5. So there is a 2/5/8

rollover of the gestures.

The lowest note of part 2 (m16-30) is the C sharp great octave (bar 2); the highest note is the G

sharp five-striped (bar 24). C sharp – G sharp has a five relationship. Actually, the range of the

composition as a whole is 5.5 octave.

VI. The C2 – striped & Ocarina

Note that each part ends at the C2 striped. This C2 has a frequency of 528 Hz. The ocarina adds an

ever-sounding C2. The ocarina is a relatively harmonic free instrument and is therefore chosen. The

ocarina is a type of flute, generally made from ceramic or clay.

10 The Ahavah Rabbah Shtayger is also known as Freygish (Phrygian) Scale, in which the augmented second is the most

significant interval. In Jewish music, one could find the ahavah rabbah mainly in East-European melodies.



618


VII. Transpositions, the number 528

The opening notes in the melody of part 2 (m16-30) have a relationship. The numbers 5/2/8 could

be observed. Bar 18 begins with a C sharp, bar 19 with an E flat (D sharp), bar 20 with an F.

This second –relationships turns into an octave relationship. In bar 23, bar 18 is re-presented. The

bars 24/25/26 are octave transformations of 23 (18). In bar 27 to 30, we find fifth relations in the

opening notes.

VIII. The numbers 26, 17 & 8

According to the Kabbalah 11 , the number 26 is the God number.

The Jewish name for God is YHVH.

In Hebrew, letters are at the same time numbers. Y=10, H=5, V=6, H= 5. Jews, who believe God to

be the Creator, believe the number of his name to be 26.

In Herz, the number 26 as well as another holy Jewish number, 17, appear.

The number 17 is the result of a different way of counting the name of God: 10565 (YHVH):

1+0+5+6+5=17. Bar 1 through 4 are made from 26 notes. Bar 5 through 8 are built from 68 notes.

68 is 4 times 17. Bar 9 through 12 consist of 17 notes.

Bar 9 through 15 if we consider just the right hand contains 26 notes.

In this field (bar 9 through 15) the left hand contains 9 notes. 26 – 9 = 17 12 .

Mind that bars 5/6 are built from 18 and 16 notes. The number 17 seems to be avoided.

The same avoiding of the number 17 applies to bars 7/8.

Perhaps it would also be possible to count the God name in another way: YHV = 21 + H = 5= 8

(2+1+5)? Moreover: YH=15, VH=11. 1+5+1+1= 8.

The third section of Herz (m31-45) is built from 88 notes. However, this kind of playing around

with the name of God would certainly be disapproved in Judaism.

Oskar Goldberg wrote a book called Die fünf Bücher Mosis ein Zahlengebäude (Berlin, 1908).

In his book, he claimed that the Pentateuch 13 is a through Gods names commanded Number -

Composition. For Oskar Goldberg, the number 8 plays a key role: 17:1+7=8. 26:2+6=8 14 .

IX. Duration of the composition, the numbers 15 and 528

The score covers 45 bars. However, the composition needs to be repeated and followed by a

repetition of the first 15 bars. That long version covers then 105 bars.

This refers to 15. The duration of the composition Herz is 528 seconds in the long version.

X. The number 6

Elohim created the world in 6 days 15 . This is one of the most essential principles of Judaism. In the

number six we find: 1+2+3 = 6. In mathematics, 6 is considered a perfect number 16 .

The 6 in mathematics, is considered double perfect because 1x2x3 = 6 as well.

What is the number 6 in Herz? The melody from bar 1/2 is made from 6 notes. The left hand in the

same bars show 6 notes as well.

In bars 4/5, the melody in the soprano is made from 6 notes. The total amount of notes in bars 1

through 4 is 26. Let us focus on the intervals of bars 1 and 2. From G-sharp to F is 2. From F to E is

11 Kabbalah (Hebrew: receiving) is a Jewish religious philosophical system that states every word and number has a

hidden, deeper meaning to it.

12 In Judaism, this way of counting (26-17=9) is not allowed because it is considered disrespectful.

13 Pentateuch: Torah, the first five books of the Tanach (Jewish Bible).

14 Source: C.J. Labuschagne, Het geheim van de verborgen getallen 17 en 26, Haren, 25-02-2011

15 Elohim (Hebrew) is one of the names of God. The first sentence of Genesis is: Bereishit bara Elohim et hashamayim

ve'et ha'aretz. (In a beginning, Elohim created heavens and the earth.

16 Perfect number, a number that is equal to the sum of its proper divisors. The smallest perfect number is 6, which is the

sum of 1, 2, and 3. Source: http://www.britannica.com/EBchecked/topic/451491/perfect-number



619


2. All intervals could be measured in the same way both for the right hand as well as for the left

hand. In bar one this leads to 13. In bar 2 this leads to 13 as well. In this way, the intervals of bars 1

and 2 are 26.

XI. Notes on the composition process of Herz and conclusion

I have composed Herz at the piano. Composing with not more than the numbers 5, 2 and 8 has not

been an obstacle at any moment. Not all numbers, which have been described in the analysis, were

consciously used in the composing process. The appearance of 26 and 17 for instance, surprised me

when I analysed the composition. I became fascinated by numerological structures in compositions

and have intention to analyse own compositions as well as pieces by other composers. I assume

underlying numbers could be found in every piece of music. In Hebrew, words with the same

number could be compared with each other. By these comparisons, remarkable connections

between words appear. Often, words could be explained by other words with the same underlying

number. In music, this could mean that motives, melodies or even chords could be compared with

their numerological equivalents. These numerological principles would bring a whole new

perspective to music. Which numbers should be focussed on? As a Jewish composer, the numbers

from the Torah (such as 15, 17, 26 and 528) are important to me. It is appropriate for me to find the

meaning of these numbers in music 17 . Currently, Gideon Benavraham is applying my composition

Herz in music therapy sessions with his patients as part of his PhD research. Because of our mutual

enthusiasm for numerological logotechnique of the Torah, the essence of music and the deeper

meaning of 528 in the Torah and in music for the healing of people, cooperation will continue in

future.

17 For instance, in a song, the meaning of the text and the number(s) of the composition with its/their meaning(s) could

be compared.



620

Composition “Vayhi Or” (Let’s there be Light) and Analisis (Nuqun 528 Hz +

528

Flute

Harp

mp

mp

mp

Vayhi Or

Y'hi-Or Vayhi-Or

- Nigun (528 composition) -

B'reishit 1:3

Tranquillo (q = 77)

Mathieu Daniël Polak

15 Adar I, 5774

Chazan

Chimes

mp

Y' Hi Or Va

Fl.

4

Hp.

M-S.

molto vibrato

Chim.

Y' Hi Or Va

mp

Y' hi Or



621

2

Vayhi Or

Fl.

7

Hp.

rit.

M-S.

Chim.

Va Y' hi Or

rit.

Fl.

Hp.

A

9

M-S.

Chim.

mp a tempo, poco vibrato

3 3

Y'

Hi Or



622

Vayhi Or 3

Fl.

11

Hp.

rit. Meno mosso (q = 52)

M-S.

Chim.

mf

Va

mp

Y' Hi Or Y'

rit.

Hi

Or

Fl.

14

p

Hp.

p

p

M-S.

p

3

Chim.

Va

Y' Hi Or

p



623

4

Vayhi Or

Fl.

Tempo primo (q = 77)

B

18

Hp.

M-S.

Chim.

Fl.

21

Hp.

mp

Va

Y' Hi Or

Meno mosso (q = 52)

p

M-S.

p timido

Chim.

Or

Y' Hi

Or



624

Vayhi Or 5

Fl.

Hp.

accel.

Tranquillo (q = 77)

C

mp

24

M-S.

Chim.

accel.

Or

Fl.

27

3

Hp.

M-S.

Chim.

mp



625

6

Vayhi Or

Fl.

Meno mosso (q = 52)

D

30

Hp.

mp

M-S.

mp

3

Va

Y' Hi Or

Chim.

Fl.

31

Hp.

p

rit.

p

M-S.

Chim.

3

Y' Hi Or Va

p

Y' Hi Or

rit.

p



626

Analysis of the 528 composition Vayhi Or by M.D. Polak

Vayhi Or

Analysis of the 528 composition 'Vayhi Or' by Mathieu Daniël Polak

Vayhi Or is a musical composition by Mathieu Daniël Polak. The composition is based on the

Qualitative Numerological Logotechnique of the Hebrew Tanach. The composition is

commissioned by Gideon Benavraham, as part of his dissertation research for the purpose of

the quantum technological Mindlink test as 'wide frequency spectrum of Heart and Love.'

Moreover, the composition Vayhi Or is composed for the purpose of universal therapeutic


Introduction

And God said: ‘’Let there be light, and there was light 1 .’’

This sentence of Genesis 1:3 2 was the starting point of the composition Vayhi Or.

In the words Y’hi Or, Vayhi Or (let there be light and there was light) the vowels in particular

drew my attention. Therefore, immediately I had the feeling the composition ought to be a

song for voice and accompaniment. In the song, the sounds uh-i-o-ay-i-or, taken from the

words Y’ (’ = uh) hi Or, Vayhi Or would be dominant.

The subtitle, Nigun (Hebrew: melody with non-existing words or fantasy syllables), explains

the function of the words. As in a Nigun, in my composition one doesn’t necessarily listen to

the meaning of the words but to the sounds of the words and/or syllables 3 .

At first, I composed a melody for voice. The melody is constructed by chaining motives.

This technique refers to the practice of leyning.

Leyning (also known as cantillation) is the chanting of texts from the Hebrew Bible in the

Synagogue. In most of my composition this technique is used.

After that, the words were added to the notes. To emphasize the sounds rather than the

meaning of the text, the words were spread out by which the melody became melismatic.

All notes of the accompaniment are derived from the melody. For me the technique of basing

the harmony completely on the melody was quite a discovery.

By this technique, Vayhi Or started to sound like the music of Arvo Pärt 4 . In Judaism,

resemblance with (the idiom of) other artists/composers is considered a sign of craftsmanship.

Perhaps due to this Pärt-like idiom, chazzan Anna de Voogt 5 thought Vayhi Or sounded

esoterically. Listening to the music of Pärt brought to me the idea of using chimes.

The number 528

In Vayhi Or, the number 528 is manifested in all 6 intervals. The voice starts with an ascending

second (2) followed by a fifth (5). From bar two towards bar three an octave (8) is used.

1 This sentence in Hebrew: ‘Vayomer Elohim, Y’hi Or, Vayhi Or.’

2 Genesis in the Hebrew Bible is called B’reishit (literally: in a beginning).

3 In music, a song in which the sound is more important than the content of the text is called Vocalise.

4 Arvo Pärt (born 1935) is an Estonian composer of minimal music.

5 Anna de Voogt is the principle chazzan of the Jewish congregation Beit ha Chidush in Amsterdam.

6 There are two exceptions: bar 15 ends in the voice with B1, in bar 18 the voice continues with D flat 1, Bar 25

ends with B1, in bar 30 the voice continues with A0. This sixth (B1-D flat1) plus nine (B1 – A0) adds up to 15.

The number 15 refers to the God Name Yud – Heh. The source of these two situations is the taking over of the

melody from the voice by the flute. Without this taking over, by all intervals really all intervals would be fifths,

seconds and octaves.



627

Analysis of the 528 composition Vayhi Or by M.D. Polak 2

The first word of the title, Y’hi, is built from three Hebrew letters namely Yud, Heh, Yud. In

Hebrew every letter is a number as well. In this case 10 plus 5 plus 10 makes 25. If we look at

the number 25 we see a 2 (interval second in music) and a 5 (interval fifth in music) in the

first bar of the score. The intervals of the voice are indeed d-e (second) followed by e-b

(fifth).

The theme is built from eight bars. The next eight bars show a variation of the theme.

Therefore, Vayhi Or is built from four sections of eight bars each which sums up to 32 bars.

The triangle number of 528 is 32 7 . Interestingly, the electronic reproduction of Vayhi Or has

duration of 258 seconds. The accompanying instruments show the same intervals as the voice,

namely seconds, fifths and octaves.

Meters and beats, 22

The theme (bar 1 through 8) is built from three times 5/4 meter and one time 7/4 meter 8

followed by three times 5/4 and one time 7/4 meter. So the theme before the comma contains

22 beats (5+5+5+7) and after the comma once more 22 beats. The number 22 is referring to

the Hebrew alphabet which is built from 22 letters. The division of the bars is either 2+3 or

3+2. The total amount of beats in Vayhi Or is 180. The number 18(0) points to the Hebrew

word chai which means ‘life’ and has a value of 18. The number 180 is the value of the name

Yitzchak, the son of Abraham. The flute has an interval number of 18 in the first four bars.

The harp shows an interval amount of 32 namely 17 in the right hand and 15 in the left hand.

32, 17 and 15 are all relevant numbers in the numerological logotechnique.

Interval calculations, 36, 68, 90, 54

The intervals of the theme (bars 1-8) could be measured in several ways:

I. Range per bar: the range between the lowest note in bar 1 (D) and the highest (B) = 6.

Bar 2: 5, bar 3: 5, bar 4: 5, bar 5/6: 7, bar 7/8: 8.

The sum of 6/5/5/5/7/8 is: 36. The number 36 (range-interval-sum of the theme) is interesting.

36=6². The number 6 is a perfect number 9 and the time aspect of the creation of the world.

The square of six, could be pointing to the aspect of space of the creation of the world.

II. If we would count all intervals per bar the following numbers appear: bar 1: 7 (namely

2+5), bar 2: 7, bar 3: 12, bar 4: 12, bar 5/6: 12, bar 7/8: 18. The sum of these intervals is: 68.

The number 68 is important in Judaism because 4x17=68. Seventeen is a God number (see

analysis of Herz) and four points to the four corners of the world.

III. We could also count all intervals without the consideration of separate bars. This

calculation would be: 2 (DE), 5 (EB), 2 (BA), 5 (DA), 2 (DE), 8 (EE) and so on. The sum of

all intervals of the theme (bars 1-8) would be: 90. Interestingly, two Jewish numbers appear in

calculating with the interval numbers of the theme namely 32 (68-36) and 22 (90-68).

Moreover, the number 54 (32+22 or 90-36) is interesting.

7 Triangle number: 32+31+30+29+28+27 and so on sums up to 528.

8 B’reishit 1:3 is symbolized by the division 1 (a bar of 7/4 meter) to 3 (three bars of 5/4 meter).

9 Perfect number, a number that is equal to the sum of its proper divisors. The smallest perfect number is 6,

which is the sum of 1, 2, and 3. Source: http://www.britannica.com/EBchecked/topic/451491/perfect-number



628

Composition “Keshet” (Rainbow 528 Nm + 528 Hz) and Analysis



629



630



631



632



633

Analysis of the 528 composition Keshet

Keshet

Analysis of the 528 composition 'Keshet' by Mathieu Daniël Polak

Keshet is a musical composition by Mathieu Daniël Polak. The composition is based on the

Qualitative Numerological Logotechnique of the Hebrew Tanach. The composition is

commissioned by Gideon Benavraham, as part of his dissertation research for the purpose of

the quantum technological Mindlink test as 'wide frequency spectrum of Heart and Love.'

Moreover, the composition Keshet is composed for the purpose of universal therapeutic


Theme

The theme is made up of seconds, fifths and octaves. With these three intervals, the number

528 is symbolized. The theme starts with a G – striped 1 and ends in bar ten also with G –

striped 1. This would easily lead to the conclusion that the key is G. That is not the intent.

Earlier, the G could be considered as a dominant of C.

The C2, with which the composition in bar 107 is terminated, is the carrier frequency of the

number 528 in the pure intonation.

In the first ten bars, the melody is divided on the two violins. The technique of dividing

melody notes among several instruments is called Klangfarbenmelodie by the composer

Arnold Schönberg. ‘Tone colors’ in a composition that is about the Rainbow seems like a

good match to me.

Tone doublings are interesting to mention. One finds in bar one already a doubling of the D –

striped 1. This is especially intended to make it easier for violinists to carry out the piece.

There are in the first ten bars, 17 of these tone doublings. The number 17 refers to the name of

God. A side note should be placed. In bar ten, instead of doubling (unison note), I have

chosen for an octave interval. As a composer, this sound seemed better.

The rhythm of the theme consists of a dotted eighth note followed by a straight eighth note.

The first note therefore has a value of three sixteenths. The second note is worth two

sixteenths. The resulting number, 32, is the triangle number of 528.

The theme is performed pizzicato. By this (pizzicato), raindrops are portrayed.

The composition voiced not only the Rainbow but also takes Flood elements. Thus bears the

composition cause (flood) and effect (rainbow).

The theme unfolds in the first ten bars. In bar one, we see in five sixteenths plus five

sixteenths: ten sixteenth in totals. In the length of the theme, ten bars, this number could be

observed as well. The first violin is playing 29 notes in the theme. The second violin has also

29 notes to play in total. It would numerically perhaps be preferable to compose twice 28

notes. 28 Indeed, we find in the main number 528. Alternatively, one could say that 29 plus

29 leads to 58. The number 58 is equally present at the number 528.

Structure

The theme is presented in bar one to ten. In bar eleven to twenty, we see the theme in the first

violin while there is disclosed a counterpoint in the second violin. Bar one to ten is

substantially fully pizzicato imagined. Bar eleven through twenty is played arco.



634

Analysis of the 528 composition Keshet

Bars 21 to 28 show the main theme in the second violin. The first violin takes the

counterpoint to her account. Bars 21 to 28 modulate to and ends on D – double flat.

Bars 1 to 10 and 11 to 20 culminated in G. Bar 29 leaves from A.

D in bar 28 is therefore part of a fifth sequence.

The first thematic field consists of bars 1 to 28. The second field consists of 27 bars namely,

bars 29 to 55.

Also, the second thematic field is built up of two sentences of ten bars each, followed by a

shorter sentence.

The second thematic field has more octave leaps and 32nd notes deployed. By this, more

tension is generated.

Bars 49 to 55 are carried out pizzicato. If this area of seven bars will be combined with the

first pizzicato area (bars 1 to 10), then arises a sum of 17, a reference to the Name of God.

After bar 55, the description of the flood ended and the rainbow appears.

In the Rainbow (bars 56 to 63) once is referred to the flood namely in the first violin in bar 60.

This acts as a kind of a moment of doubt: the flood actually ended?

Can we already go out of the Ark?

It should be noted that bars 56 to 63 (eight bars) associated with the first Rainbow, could be

combined with bars 88 to 107 (twenty bars), the second Rainbow.

Two Rainbows are together the number 28.

In bars 97/98 and bars 101/102 the Flood is remembered. This ‘referring to’ I would like to

call ‘Zochreinu principle’.

This recalling is a typical Jewish phenomenon. We remember the Exodus from Egypt

(Passover) and we remember the Dedication of the Temple (Chanukah).

How the Rainbow does build the composition? In bars 56 to 63, both violins have descending

lines in seconds. The interval between the two voices is a fifth in bars 56/57 and 58/59 a tenth

(10). From the 528 number are thus manifested both the 2 and the 5.

The first violin jumps in bars 60/61 using intervals 5 and 8.

The second Rainbow (bars 88 to 107) begins with a fifth harmony and tenth-harmony (bars 88

to 96). Bars 99/100 narrows the harmony from quarter to third. Bars 105 to 107 does both

instruments merge from second to prime.


Appendices: Graphical Statistics of Research Mindlink on the first stage

635

Appendix 6:

First part of the scientific research -

Graphical Statistics



636



637

System information, male participants

Explanation of Selection

Scores(Blockages(T1(minus(T2.(

Scores(Pos.(energy(T1(minus(T2(

50!

150!

40!

100!

30!

20!

50!

Scores(

10!

0!

scores(

0!

150!

Male participants, (early drop outs excluded)

important if we will search the different

efffects between male and female

participants

110!

1100!

120!

130!

1150!

140!

1! 2! 3! 4! 5! 6! 7! 8! 9! 10! 11! 12! 13!

1200!

1! 2! 3! 4! 5! 6! 7! 8! 9! 10! 11! 12! 13! 14!

Series1! 3! 24! 11! 12! 7! 130! 10! 45! 19! 0! 0! 0! 17,1!

Series1! 10! 1177! 1170! 20! 110! 0! 10! 0! 0! 20! 10! 120! 0! 18,9!

Information about selection(s) made

Process results selected group (=100%)

Different process used

Results selected group test 1 minus test 2

Gender Selected Group

Selection Neg % all % Sel Gr. Pos % all % Sel Gr.

selected group

Group Average for selected persons Blockages 0,2 abs percentage M F abs Percentage

"improvement" 8 8,8% 66,7% 4 4,4% 33,3%

Group Average all selected persons Pos. Energ. -0,1

12 13,2% 12 0 0 0,0%

"stagnation" 0 0,0% 0,0% 0 0,0% 0,0%

"deterioration" 4 4,4% 33,3% 8 8,8% 66,7%

Information about all registered persons

Process results all registered

All different used

Results total group test 1 minus test 2

Gender all Registered

Selection Neg Pos

processes

Average for all registered persons Blackages 1,8

abs procenten M F abs Percentage

"improvement" 66 72,5% 54 59,3%

Average for all registered persons Pos. Energ. 2,3

91 100,0% 34 57 0 0,0%

"stagnation" 5 5,5% 5 5,5%

"deterioration" 20 22,0% 32 35,2%

Explanation scores Music and sound of Nature

1.1 brain power

1.2 fit for learning

1.3 mind-body-harmony

1.4 with motivation and enthusasim to success

1.5 sexuality and relationship

Explanation about specified selection

Explanation about all registered persons !!!!!!!!!!

Total of registerd people

Total of selected people 12 91

0

Selected number of persons with different scores in T1 and T2. 0 Number of ALL registered persons with different scores in T1 and T2

Different scores selection per subgroup in T1 and T2 6 7 6 8 4 37 45 47 41 48 Different scores per subgr. In T1 and T2 all registered persons.

Total number of diff. scores in selection. 31

is 0,0% of(selection 0 is 0,0% of(all(persons Total number of diff. scores.

0 218

1.5 sexuality and relationship

1.4 with motivation and enthusasim to success

1.3 mind-body-harmony

1.2 fit for learning

1.1 brain power



638



639



640



641



642



643



644



645



646

Womb as Paradise Lost

Create successful ePaper yourself

Delete template?

Save as template?