tjh-v38i3

Volume 38 Issue 3

September 2021

E-ISSN: 1308-5263

Research Articles

Association of Immune Thrombocytopenia and Celiac Disease in Children: A Retrospective Case Control Study

Angela Guarina, Maddalena Marinoni, Giuseppe Lassandro, Paola Saracco, Silverio Perrotta, Elena Facchini,

Lucia Dora Notarangelo, Giovanna Russo, Paola Giordano, Francesca Romano, Elisa Bertoni, Chiara Gorio,

Gianluca Boscarol, Milena Motta, Marco Spinelli, Angelica Barone, Marco Zecca, Francesca Compagno,

Saverio Ladogana, Angela Maggio, Maurizio Miano, Gianluca Dell’Orso, Elena Chiocca, Ilaria Fotzi,

Angela Petrone, Assunta Tornesello, Irene D’Alba, Silvia Salvatore, Maddalena Casale, Giuseppe Puccio,

Ugo Ramenghi, Piero Farruggia; Palermo, Varese, Bari, Torin, Naples, Bologna, Brescia, Catania, Bolzano, Monza,

Parma, Pavia, Rotondo, Genoa, Firenze, Trento, Lecce, Ancona, Italy

Comparison of Splenectomy and Eltrombopag Treatment in the Second-Line Treatment of Immune

Thrombocytopenic Purpura

Mehmet Can Uğur, Sinem Namdaroğlu, Esma Evrim Doğan, Esra Turan Erkek, Nihan Nizam, Rafet Eren,

Oktay Bilgir; İzmir, İstanbul, Turkey

Clinical Characteristics and Optimal Therapy of Acute Myeloid Leukemia with Myelodysplasia-Related Changes:

A Retrospective Analysis of a Cohort of Chinese Patients

Lei Wang, Xiaoxia Chu, Jingyao Wang, Licai An, Yinghui Liu, Li Li, Junqing Xu; Yantai, Linyi, China

Hematopoietic Stem Cell Transplantation for Patients with Paroxysmal Nocturnal Hemoglobinuria with or

without Aplastic Anemia: A Multicenter Turkish Experience

Fergün Yılmaz, Nur Soyer, Güldane Cengiz Seval, Sinem Civriz Bozdağ, Pervin Topçuoğlu, Ali Ünal,

Leylagül Kaynar, Gökhan Özgür, Gülsan Sucak, Hakan Göker, Mustafa Velet, Hakan Özdoğu, Mehmet Yılmaz,

Emin Kaya, Ozan Salim, Burak Deveci, İhsan Karadoğan, Güray Saydam, Fahri Şahin, Filiz Vural; İstanbul, İzmir,

Ankara, Adana, Gaziantep, Malatya, Antalya, Turkey

Prediction of Stem Cell Mobilization Failure in Patients with Hodgkin and Non-Hodgkin Lymphoma

Haluk Demiroğlu, Rafiye Çiftçiler, Yahya Büyükaşık, Hakan Göker; Ankara, Turkey

Evaluation of a Generic Bortezomib Molecule in Newly Diagnosed Multiple Myeloma Patients

Sinan Mersin, Ayfer Gedük, Özgür Mehtap, Pınar Tarkun, Serkan Ünal, Merve Gökçen Polat, Kemal Aygün,

Emel Merve Yenihayat, Hayrunnisa Albayrak, Abdullah Hacıhanefioğlu; Kocaeli, Turkey

Cover Picture:

Ceren Uzunoğlu, Tayfur Toptaş,

Yıldız İpek, Fatma Arıkan,

Fergün Yılmaz, Tülin Tuğlular

Shoulder-Pad Sign in a Case of

Amyloidosis Associated with Myeloma

3

Editor-in-Chief

Reyhan Küçükkaya

İstanbul, Turkey

rkucukkaya@hotmail.com

Associate Editors

A. Emre Eşkazan

İstanbul University-Cerrahpaşa, İstanbul, Turkey

emre.eskazan@istanbul.edu.tr

Ali İrfan Emre Tekgündüz

Memorial Bahçelievler Hospital, İstanbul, Turkey

emretekgunduz@yahoo.com

Ayşegül Ünüvar

İstanbul University, İstanbul, Turkey

aysegulu@hotmail.com

Cengiz Beyan

Ankara, Turkey

cengizbeyan@hotmail.com

Hale Ören

Dokuz Eylül University, İzmir, Turkey

hale.oren@deu.edu.tr

İbrahim C. Haznedaroğlu

Hacettepe University, Ankara, Turkey

haznedar@yahoo.com

Selami Koçak Toprak

Ankara University, Ankara, Turkey

sktoprak@yahoo.com

Semra Paydaş

Çukurova University, Adana, Turkey

sepay@cu.edu.tr

Şule Ünal


suleunal2003@hotmail.com

Assistant Editors

Claudio Cerchione

University of Naples Federico II Napoli,

Campania, Italy

Ebru Koca

Başkent University Ankara Hospital,

Clinic of Hematology, Ankara, Turkey

Elif Ünal İnce


İnci Alacacıoğlu

Dokuz Eylül University, İzmir, Turkey

Mario Tiribelli

University of Udine, Udine, Italy

Müge Sayitoğlu

İstanbul University, İstanbul, Turkey

Nil Güler

Ondokuz Mayıs University, Samsun, Turkey

Olga Meltem Akay

Koç University, İstanbul, Turkey

Veysel Sabri Hançer

İstinye University, İstanbul, Turkey

Zühre Kaya

Gazi University, Ankara, Turkey

International Review Board

Nejat Akar

TOBB University of Economics and Technology Hospital, Ankara, Turkey

Görgün Akpek

Maryland School of Medicine, Baltimore, USA

Serhan Alkan

Cedars-Sinai Medical Center, Los Angeles, USA

Çiğdem Altay

Ankara, Turkey

Meral Beksaç


Koen van Besien

Weill Cornell Medicine, New York, USA

M. Sıraç Dilber Karolinska University, Stockholm, Sweden

Ahmet Doğan

Memorial Sloan Kettering Cancer Center, New York, USA

Peter Dreger

Heidelberg University, Heidelberg, Germany

Thierry Facon

Lille University, Lille, France

Jawed Fareed

Loyola University, Maywood, USA

Burhan Ferhanoğlu

Koç University, İstanbul, Turkey

Gösta Gahrton

Karolinska University Hospital, Stockholm, Sweden

Dieter Hoelzer

Frankfurt University, Frankfurt, Germany

Andreas Josting

University Hospital Cologne, Cologne, Germany

Emin Kansu


Winfried Kern

Albert Ludwigs University, Freiburg im Breisgau, Germany

Nigel Key

University of North Carolina School of Medicine, NC, USA

Korgün Koral

Southwestern Medical Center, Texas, USA

Abdullah Kutlar

Medical College of Georgia at Augusta University, Augusta, USA

Luca Malcovati

Pavia Medical School University, Pavia, Italy

Marilyn Manco-Johnson University of Colorado Anschutz Medical Campus, Aurora, USA

Robert Marcus

King’s College Hospital, London, UK

Jean Pierre Marie

Pierre et Marie Curie University, Paris, France

Ghulam Mufti

King’s Hospital, London, UK

Gerassimos A. Pangalis Athens University, Athens, Greece

Antonio Piga

Torino University, Torino, Italy

Ananda Prasad

Wayne State University School of Medicine, Detroit, USA

Jacob M. Rowe

Hebrew University of Jerusalem, Jerusalem, Israel

Jens-Ulrich Rüffer

University of Köln, Köln, Germany

Norbert Schmitz

AK St Georg, Hamburg, Germany

Orhan Sezer

Charité Comprehensive Cancer Center, Berlin, Germany

Anna Sureda

Santa Creu i Sant Pau Hospital, Barcelona, Spain

Ayalew Tefferi

Mayo Clinic, Rochester, Minnesota, USA

Nükhet Tüzüner

İstanbul Cerrahpaşa University, İstanbul, Turkey

Catherine Verfaillie

Katholieke Universiteit Leuven, Leuven, Belgium

Srdan Verstovsek

The University of Texas MD Anderson Cancer Center, Houston, USA

Claudio Viscoli

San Martino University, Genoa, Italy

Past Editors

Erich Frank

Orhan Ulutin

Hamdi Akan

Aytemiz Gürgey

Senior Advisory Board

Yücel Tangün

Osman İlhan

Muhit Özcan

Teoman Soysal

Ahmet Muzaffer Demir

Language Editor

Leslie Demir

Statistic Editor

Hülya Ellidokuz

Editorial Office

İpek Durusu

Bengü Timoçin Efe

A-I

Publishing

Services

GALENOS PUBLISHER

Molla Gürani Mah. Kaçamak Sk. No: 21/1, Fındıkzade, İstanbul, Turkey

Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr

Contact Information

Editorial Correspondence should be addressed to Dr. Reyhan Küçükkaya

E-mail : rkucukkaya@hotmail.com

All Inquiries Should be Addressed to

TURKISH JOURNAL OF HEMATOLOGY

Address : Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.) No: 8 06550 Çankaya, Ankara / Turkey

Phone : +90 312 490 98 97

Fax : +90 312 490 98 68

E-mail : tjh@tjh.com.tr

E-ISSN: 1308-5263

Publishing Manager

Muhlis Cem Ar

Management Address

Türk Hematoloji Derneği

Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.)

No: 8 06550 Çankaya, Ankara / Turkey

Online Manuscript Submission

http://mc.manuscriptcentral.com/tjh

Web Page

www.tjh.com.tr

Owner on Behalf of the Turkish Society

of Hematology

Güner Hayri Özsan

Publishing House

Molla Gürani Mah. Kaçamak Sk. No: 21,

34093 Fındıkzade, İstanbul / Turkey

Tel: +90 212 621 99 25

Fax: +90 212 621 99 27

E-mail: info@galenos.com.tr

Publisher Certificate Number: 14521

Publication Date

23.08.2021

Cover Picture

Ceren Uzunoğlu, Tayfur Toptaş, Yıldız İpek, Fatma Arıkan,

Fergün Yılmaz, Tülin Tuğlular

Shoulder-Pad Sign in a Case of Amyloidosis Associated with

Myeloma

Bone marrow biopsy showed plasma cells infiltrating 86% of bone

marrow.

Significant thickening of the subdeltoid bursa was evident upon

shoulder magnetic resonance imaging.

International scientific journal published quarterly.

The Turkish Journal of Hematology is published by the commercial enterprise

of the Turkish Society of Hematology with Decision Number 6 issued by the

Society on 7 October 2008.

A-II

AIMS AND SCOPE

The Turkish Journal of Hematology is published quarterly (March, June,

September, and December) by the Turkish Society of Hematology. It is an

independent, non-profit peer-reviewed international English-language

periodical encompassing subjects relevant to hematology.

The Editorial Board of The Turkish Journal of Hematology adheres to the

principles of the World Association of Medical Editors (WAME), International

Council of Medical Journal Editors (ICMJE), Committee on Publication

Ethics (COPE), Consolidated Standards of Reporting Trials (CONSORT) and

Strengthening the Reporting of Observational Studies in Epidemiology

(STROBE).

The aim of The Turkish Journal of Hematology is to publish original

hematological research of the highest scientific quality and clinical relevance.

Additionally, educational material, reviews on basic developments, editorial

short notes, images in hematology, and letters from hematology specialists

and clinicians covering their experience and comments on hematology

and related medical fields as well as social subjects are published. As of

December 2015, The Turkish Journal of Hematology does not accept case

reports. Important new findings or data about interesting hematological

cases may be submitted as a brief report.

General practitioners interested in hematology and internal medicine

specialists are among our target audience, and The Turkish Journal of

Hematology aims to publish according to their needs. The Turkish Journal of

Hematology is indexed, as follows:

- PubMed Medline

- PubMed Central

- Science Citation Index Expanded

- EMBASE

- Scopus

- CINAHL

- Gale/Cengage Learning

- EBSCO

- DOAJ

- ProQuest

- Index Copernicus

- Tübitak/Ulakbim Turkish Medical Database

- Turk Medline

- Hinari

- GOALI

- ARDI

- OARE

Impact Factor: 1.831

Open Access Policy

Turkish Journal of Hematology is an Open Access journal. This journal

provides immediate open access to its content on the principle that making

research freely available to the public supports a greater global exchange of

knowledge.

Open Access Policy is based on the rules of the Budapest Open Access

Initiative (BOAI) http://www.budapestopenaccessinitiative.org/.

Subscription Information

The Turkish Journal of Hematology is published electronically only as of

2019. Therefore, subscriptions are not necessary. All published volumes are

available in full text free-of-charge online at www.tjh.com.tr.

Address: Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613.

Sok.) No: 8 06550 Çankaya, Ankara / Turkey

Telephone: +90 312 490 98 97

Fax: +90 312 490 98 68

Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh

Web page: www.tjh.com.tr

E-mail: tjh@tjh.com.tr

Permissions

Requests for permission to reproduce published material should be sent to

the editorial office.

Editor: Professor Dr. Reyhan Küçükkaya

Adress: Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613.

Sok.) No: 8 06550 Çankaya, Ankara / Turkey

Telephone: +90 312 490 98 97

Fax: +90 312 490 98 68

Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh

Web page: www.tjh.com.tr

E-mail: tjh@tjh.com.tr

Publisher

Galenos Yayınevi

Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul, Turkey

Telephone : +90 212 621 99 25

Fax : +90 212 621 99 27

info@galenos.com.tr

Instructions for Authors

Instructions for authors are published in the journal and at www.tjh.com.tr

Material Disclaimer

Authors are responsible for the manuscripts they publish in The Turkish

Journal of Hematology. The editor, editorial board, and publisher do not

accept any responsibility for published manuscripts.

If you use a table or figure (or some data in a table or figure) from another

source, cite the source directly in the figure or table legend.

Editorial Policy

Following receipt of each manuscript, a checklist is completed by the Editorial

Assistant. The Editorial Assistant checks that each manuscript contains all

required components and adheres to the author guidelines, after which time

it will be forwarded to the Editor in Chief. Following the Editor in Chief’s

evaluation, each manuscript is forwarded to the Associate Editor, who in

turn assigns reviewers. Generally, all manuscripts will be reviewed by at least

three reviewers selected by the Associate Editor, based on their relevant

expertise. Associate editor could be assigned as a reviewer along with the

reviewers. After the reviewing process, all manuscripts are evaluated in the

Editorial Board Meeting.

Turkish Journal of Hematology’s editor and Editorial Board members are active

researchers. It is possible that they would desire to submit their manuscript

to the Turkish Journal of Hematology. This may be creating a conflict of

interest. These manuscripts will not be evaluated by the submitting editor(s).

The review process will be managed and decisions made by editor-in-chief

who will act independently. In some situation, this process will be overseen

by an outside independent expert in reviewing submissions from editors.

A-III

TURKISH JOURNAL OF HEMATOLOGY

INSTRUCTIONS FOR AUTHORS

The Turkish Journal of Hematology accepts invited review articles,

research articles, brief reports, letters to the editor, and hematological

images that are relevant to the scope of hematology, on the condition

that they have not been previously published elsewhere. Basic science

manuscripts, such as randomized, cohort, cross-sectional, and casecontrol

studies, are given preference. All manuscripts are subject

to editorial revision to ensure they conform to the style adopted by

the journal. There is a double-blind reviewing system. Review articles

are solicited by the Editor-in-Chief. Authors wishing to submit an

unsolicited review article should contact the Editor-in-Chief prior to

submission in order to screen the proposed topic for relevance and

priority.

The Turkish Journal of Hematology does not charge any article

submission or processing charges.

Manuscripts should be prepared according to ICMJE guidelines (http://

www.icmje.org/). Original manuscripts require a structured abstract.

Label each section of the structured abstract with the appropriate

subheading (Objective, Materials and Methods, Results, and Conclusion).

Letters to the editor do not require an abstract. Research or project

support should be acknowledged as a footnote on the title page.

Technical and other assistance should be provided on the title page.

Original Manuscripts

Title Page

Title: The title should provide important information regarding the

manuscript’s content. The title must specify that the study is a cohort

study, cross-sectional study, case-control study, or randomized study (i.e.

Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability

of ferrous succinate tablet formulations without correction for baseline

circadian changes in iron concentration in healthy Chinese male

subjects: A single-dose, randomized, 2-period crossover study. Clin Ther

2011;33:2054-2059).

The title page should include the authors’ names, degrees, and

institutional/professional affiliations and a short title, abbreviations,

keywords, financial disclosure statement, and conflict of interest

statement. If a manuscript includes authors from more than one

institution, each author’s name should be followed by a superscript

number that corresponds to their institution, which is listed separately.

Please provide contact information for the corresponding author,

including name, e-mail address, and telephone and fax numbers.

Important Notice: The title page should be submitted separately.

Running Head: The running head should not be more than 40

characters, including spaces, and should be located at the bottom of

the title page.

Word Count: A word count for the manuscript, excluding abstract,

acknowledgments, figure and table legends, and references, should be

provided and should not exceed 2500 words. The word count for the

abstract should not exceed 300 words.

Conflict of Interest Statement: To prevent potential conflicts of

interest from being overlooked, this statement must be included in each

manuscript. In case there are conflicts of interest, every author should

complete the ICMJE general declaration form, which can be obtained at

http://www.icmje.org/downloads/coi_disclosure.zip

Abstract and Keywords: The second page should include an abstract

that does not exceed 300 words. For manuscripts sent by authors in

Turkey, a title and abstract in Turkish are also required. As most readers

read the abstract first, it is critically important. Moreover, as various

electronic databases integrate only abstracts into their index, important

findings should be presented in the abstract.

Objective: The abstract should state the objective (the purpose of the

study and hypothesis) and summarize the rationale for the study.

Materials and Methods: Important methods should be written

respectively.

Results: Important findings and results should be provided here.

Conclusion: The study’s new and important findings should be

highlighted and interpreted.

Other types of manuscripts, such as reviews, brief reports, and

editorials, will be published according to uniform requirements.

Provide 3-10 keywords below the abstract to assist indexers. Use

terms from the Index Medicus Medical Subject Headings List

(for randomized studies a CONSORT abstract should be provided: http://

www.consort-statement.org).

Introduction: The introduction should include an overview of the

relevant literature presented in summary form (one page), and whatever

remains interesting, unique, problematic, relevant, or unknown about

the topic must be specified. The introduction should conclude with the

rationale for the study, its design, and its objective(s).

Materials and Methods: Clearly describe the selection of observational

or experimental participants, such as patients, laboratory animals, and

controls, including inclusion and exclusion criteria and a description of

the source population. Identify the methods and procedures in sufficient

detail to allow other researchers to reproduce your results. Provide

references to established methods (including statistical methods),

provide references to brief modified methods, and provide the rationale

for using them and an evaluation of their limitations. Identify all drugs

and chemicals used, including generic names, doses, and routes of

administration. The section should include only information that was

available at the time the plan or protocol for the study was devised

A-IV

(https://www.strobe-statement.org/fileadmin/Strobe/uploads/checklists/

STROBE_checklist_v4_combined.pdf).

Statistics: Describe the statistical methods used in enough detail to

enable a knowledgeable reader with access to the original data to verify

the reported results. Statistically important data should be given in the

text, tables, and figures. Provide details about randomization, describe

treatment complications, provide the number of observations, and specify

all computer programs used.

Results: Present your results in logical sequence in the text, tables, and

figures. Do not present all the data provided in the tables and/or figures

in the text; emphasize and/or summarize only important findings, results,

and observations in the text. For clinical studies provide the number of

samples, cases, and controls included in the study. Discrepancies between

the planned number and obtained number of participants should be

explained. Comparisons and statistically important values (i.e. p-value

and confidence interval) should be provided.

Discussion: This section should include a discussion of the data. New and

important findings/results and the conclusions they lead to should be

emphasized. Link the conclusions with the goals of the study, but avoid

unqualified statements and conclusions not completely supported by the

data. Do not repeat the findings/results in detail; important findings/results

should be compared with those of similar studies in the literature, along with

a summarization. In other words, similarities or differences in the obtained

findings/results with those previously reported should be discussed.

Study Limitations: Limitations of the study should be detailed. In

addition, an evaluation of the implications of the obtained findings/

results for future research should be outlined.

Conclusion: The conclusion of the study should be highlighted.

References

Cite references in the text, tables, and figures with numbers in square

brackets. Number references consecutively according to the order in

which they first appear in the text. Journal titles should be abbreviated

according to the style used in Index Medicus (consult List of Journals

Indexed in Index Medicus). Include among the references any paper

accepted, but not yet published, designating the journal followed by “in

press”.

Examples of References:

1. List all authors

Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for marrow

transplantation from unrelated donors for patients with aplastic anemia

after failure of immunosuppressive therapy. Blood 2006;108:1485-1491.

2. Organization as author

Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of

syngeneic bone marrow graft without preconditioning in post-hepatitis

marrow aplasia. Lancet 1977;2:742-744.

3. Book

Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger, 1961.

4. Book Chapter

Perutz MF. Molecular anatomy and physiology of hemoglobin. In:

Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin:

Genetics, Pathophysiology, Clinical Management. New York, Cambridge

University Press, 2000.

5. Abstract

Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin)

stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract).

6. Letter to the Editor

Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further

definition of 20q deletion in myeloid leukemia using fluorescence in situ

hybridization. Blood 1994;84:2821-2823.

7. Supplement

Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr Transplant

2005;9(Suppl 7):81-86.

Brief Reports

Abstract length: Not to exceed 150 words.

Article length: Not to exceed 1200 words.

Introduction: State the purpose and summarize the rationale for the study.

Materials and Methods: Clearly describe the selection of the observational

or experimental participants. Identify the methods and procedures in

sufficient detail. Provide references to established methods (including

statistical methods), provide references to brief modified methods, and

provide the rationale for their use and an evaluation of their limitations.

Identify all drugs and chemicals used, including generic names, doses, and

routes of administration.

Statistics: Describe the statistical methods used in enough detail to

enable a knowledgeable reader with access to the original data to verify

the reported findings/results. Provide details about randomization,

describe treatment complications, provide the number of observations,

and specify all computer programs used.

Results: Present the findings/results in a logical sequence in the text, tables,

and figures. Do not repeat all the findings/results in the tables and figures in

the text; emphasize and/or summarize only those that are most important.

Discussion: Highlight the new and important findings/results of the

study and the conclusions they lead to. Link the conclusions with the

goals of the study, but avoid unqualified statements and conclusions not

completely supported by your data.

Invited Review Articles



Review articles should not include more than 100 references. Reviews

should include a conclusion, in which a new hypothesis or study about the

subject may be posited. Do not publish methods for literature search or level

of evidence. Authors who will prepare review articles should already have

published research articles on the relevant subject. The study’s new and

A-V

important findings should be highlighted and interpreted in the Conclusion

section. There should be a maximum of two authors for review articles.

Perspectives in Hematology

“Perspectives” are articles discussing significant topics relevant to

hematology. They are more personal than a Review Article. Authors

wishing to submit a Perspective in Hematology article should contact

the Editor in Chief prior to submission in order to screen the proposed

topic for relevance and priority. Articles submitted for “Perspectives

in Hematology” must advance the hot subjects of experimental and/

or clinical hematology beyond the articles previously published or in

press in TJH. Perspective papers should meet the restrictive criteria of

TJH regarding unique scientific and/or educational value, which will

impact and enhance clinical hematology practice or the diagnostic

understanding of blood diseases. Priority will be assigned to such

manuscripts based upon the prominence, significance, and timeliness of

the content. The submitting author must already be an expert with a

recognized significant published scientific experience in the specific field

related to the “Perspectives” article.



References: Should not include more than 50 references

Images in Hematology


Authors can submit for consideration illustrations or photos that are

interesting, instructive, and visually attractive, along with a few lines

of explanatory text and references. Images in Hematology can include

no more than 200 words of text, 5 references, and 3 figures or tables.

No abstract, discussion, or conclusion is required, but please include a

brief title.

Letters to the Editor


Letters can include no more than 500 words of text, 5-10 references,

and 1 figure or table. No abstract is required, but please include a brief

title. The total number is usually limited to a maximum of five authors

for a letter to the editor.

Tables

Supply each table in a separate file. Number tables according to the order

in which they appear in the text, and supply a brief caption for each.

Give each column a short or abbreviated heading. Write explanatory

statistical measures of variation, such as standard deviation or standard

error of mean. Be sure that each table is cited in the text.

Figures

Figures should be professionally drawn and/or photographed. Authors

should number figures according to the order in which they appear in

the text. Figures include graphs, charts, photographs, and illustrations.

Each figure should be accompanied by a legend that does not exceed

50 words. Use abbreviations only if they have been introduced in the

text. Authors are also required to provide the level of magnification for

histological slides. Explain the internal scale and identify the staining

method used. Figures should be submitted as separate files, not in

the text file. High-resolution image files are not preferred for initial

submission as the file sizes may be too large. The total file size of the

PDF for peer review should not exceed 5 MB.

Authorship

Each author should have participated sufficiently in the work to assume

public responsibility for the content. Any portion of a manuscript that is

critical to its main conclusions must be the responsibility of at least one

author.

Contributor’s Statement

All submissions should contain a contributor’s statement page. Each

statement should contain substantial contributions to idea and design,

acquisition of data, and analysis and interpretation of findings. All persons

designated as an author should qualify for authorship, and all those that

qualify should be listed. Each author should have participated sufficiently

in the work to take responsibility for appropriate portions of the text.

Acknowledgments

Acknowledge support received from individuals, organizations, grants,

corporations, and any other source. For work involving a biomedical

product or potential product partially or wholly supported by corporate

funding, a note stating, “This study was financially supported (in part)

with funds provided by (company name) to (authors’ initials)”, must

be included. Grant support, if received, needs to be stated and the

specific granting institutions’ names and grant numbers provided when

applicable.

Authors are expected to disclose on the title page any commercial or

other associations that might pose a conflict of interest in connection

with the submitted manuscript. All funding sources that supported the

work and the institutional and/or corporate affiliations of the authors

should be acknowledged on the title page.

Ethics

When reporting experiments conducted with humans indicate that

the procedures were in accordance with ethical standards set forth

by the committee that oversees human subject research. Approval of

research protocols by the relevant ethics committee, in accordance with

international agreements (Helsinki Declaration of 1975, revised 2013

available at https://www.wma.net/policies-post/wma-declaration-ofhelsinki-ethical-principles-for-medical-research-involving-humansubjects/),

is required for all experimental, clinical, and drug studies.

Patient names, initials, and hospital identification numbers should not be

used. Manuscripts reporting the results of experimental investigations

conducted with humans must state that the study protocol received

A-VI

institutional review board approval and that the participants provided

informed consent.

Non-compliance with scientific accuracy is not in accord with scientific

ethics. Plagiarism: To re-publish, in whole or in part, the contents of

another author’s publication as one’s own without providing a reference.

Fabrication: To publish data and findings/results that do not exist.

Duplication: Use of data from another publication, which includes republishing

a manuscript in different languages. Salami slicing: To create

more than one publication by dividing the results of a study unnecessarily.

We disapprove of such unethical practices as plagiarism, fabrication,

duplication, and salami slicing, as well as efforts to influence the

review process with such practices as gifting authorship, inappropriate

acknowledgments, and references. Additionally, authors must respect

participants‘ right to privacy.

On the other hand, short abstracts published in congress books that do

not exceed 400 words and present data of preliminary research, and those

that are presented in an electronic environment, are not considered as

previously published work. Authors in such a situation must declare this

status on the first page of the manuscript and in the cover letter.

(The COPE flowchart is available at http://publicationethics.org.)

We use iThenticate to screen all submissions for plagiarism before

publication.

Conditions of Publication

All authors are required to affirm the following statements before their

manuscript is considered: 1. The manuscript is being submitted only

to The Turkish Journal of Hematology; 2. The manuscript will not be

submitted elsewhere while under consideration by The Turkish Journal

of Hematology; 3. The manuscript has not been published elsewhere,

and should it be published in The Turkish Journal of Hematology it will

not be published elsewhere without the permission of the editors (these

restrictions do not apply to abstracts or to press reports for presentations

at scientific meetings); 4. All authors are responsible for the manuscript’s

content; 5. All authors participated in the study concept and design,

analysis and interpretation of the data, and drafting or revising of the

manuscript and have approved the manuscript as submitted. In addition,

all authors are required to disclose any professional affiliation, financial

agreement, or other involvement with any company whose product

figures prominently in the submitted manuscript.

Authors of accepted manuscripts will receive electronic page proofs and

are responsible for proofreading and checking the entire article within

two days. Failure to return the proof in two days will delay publication.

If the authors cannot be reached by email or telephone within two

weeks, the manuscript will be rejected and will not be published in the

journal.

Copyright

At the time of submission all authors will receive instructions for submitting

an online copyright form. No manuscript will be considered for review until

all authors have completed their copyright form. Please note, it is our practice

not to accept copyright forms via fax, e-mail, or postal service unless there

is a problem with the online author accounts that cannot be resolved. Every

effort should be made to use the online copyright system. Corresponding

authors can log in to the submission system at any time to check the status

of any co-author’s copyright form. All accepted manuscripts become the

permanent property of The Turkish Journal of Hematology and may not be

published elsewhere, in whole or in part, without written permission.

Note: We cannot accept any copyright form that has been altered,

revised, amended, or otherwise changed. Our original copyright form

must be used as is.

Units of Measurement

Measurements should be reported using the metric system, according

to the International System of Units (SI). Consult the SI Unit Conversion

Guide, New England Journal of Medicine Books, 1992.

An extensive list of conversion factors can be found at https://www.

nist.gov/sites/default/files/documents/pml/wmd/metric/SP1038.pdf. For

more details, see http://www.amamanualofstyle.com/oso/public/jama/

si_conversion_table.html.

Abbreviations and Symbols

Use only standard abbreviations. Avoid abbreviations in the title and

abstract. The full term for an abbreviation should precede its first use

in the text, unless it is a standard abbreviation. All acronyms used in the

text should be expanded at first mention, followed by the abbreviation

in parentheses; thereafter the acronym only should appear in the text.

Acronyms may be used in the abstract if they occur 3 or more times

therein, but must be reintroduced in the body of the text. Generally,

abbreviations should be limited to those defined in the AMA Manual of

Style, current edition. A list of each abbreviation (and the corresponding

full term) used in the manuscript must be provided on the title page.

Online Manuscript Submission Process

The Turkish Journal of Hematology uses submission software powered

by ScholarOne Manuscripts. The website for submissions to The Turkish

Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This

system is quick and convenient, both for authors and reviewers.

Setting Up an Account

New users to the submission site will need to register and enter their

account details before they can submit a manuscript. Log in, or click

the “Create Account” button if you are a first-time user. To create a new

account: After clicking the “Create Account” button, enter your name and

e-mail address, and then click the “Next” button. Your e-mail address is very

important. Enter your institution and address information, as appropriate,

and then click the “Next” Button. Enter a user ID and password of your

choice, select your area of expertise, and then click the “Finish” button.

If you have an account, but have forgotten your log-in details, go to

“Password Help” on the journal’s online submission system and enter your

e-mail address. The system will send you an automatic user ID and a new

temporary password.

A-VII

Full instructions and support are available on the site, and a user ID

and password can be obtained during your first visit. Full support for

authors is provided. Each page has a “Get Help Now” icon that connects

directly to the online support system. Contact the journal administrator

with any questions about submitting your manuscript to the journal

(tjh@tjh.com.tr). For ScholarOne Manuscripts customer support, click on

the “Get Help Now” link on the top right-hand corner of every page on

the site.

The Electronic Submission Process

Log in to your author center. Once you have logged in, click the “Submit

a Manuscript” link in the menu bar. Enter the appropriate data and

answer the questions. You may copy and paste directly from your

manuscript. Click the “Next” button on each screen to save your work

and advance to the next screen.

Upload Files

Click on the “Browse” button and locate the file on your computer. Select

the appropriate designation for each file in the drop-down menu next to

the “Browse” button. When you have selected all the files you want to

upload, click the “Upload Files” button. Review your submission before

sending to the journal. Click the “Submit” button when you are finished

reviewing. You can use ScholarOne Manuscripts at any time to check

the status of your submission. The journal’s editorial office will inform

you by e-mail once a decision has been made. After your manuscript

has been submitted, a checklist will then be completed by the Editorial

Assistant. The Editorial Assistant will check that the manuscript contains

all required components and adheres to the author guidelines. Once the

Editorial Assistant is satisfied with the manuscript it will be forwarded to

the Senior Editor, who will assign an editor and reviewers.

The Review Processs

Each manuscript submitted to The Turkish Journal of Hematology is

subject to an initial review by the editorial office in order to determine

if it is aligned with the journal’s aims and scope and complies with

essential requirements. Manuscripts sent for peer review will be assigned

to one of the journal’s associate editors that has expertise relevant to the

manuscript’s content. All accepted manuscripts are sent to a statistical

and English language editor before publishing. Once papers have been

reviewed, the reviewers’ comments are sent to the Editor, who will then

make a preliminary decision on the paper. At this stage, based on the

feedback from reviewers, manuscripts can be accepted or rejected, or

revisions can be recommended. Following initial peer-review, articles

judged worthy of further consideration often require revision. Revised

manuscripts generally must be received within 3 months of the date of

the initial decision. Extensions must be requested from the Associate

Editor at least 2 weeks before the 3-month revision deadline expires;

The Turkish Journal of Hematology will reject manuscripts that are

not received within the 3-month revision deadline. Manuscripts with

extensive revision recommendations will be sent for further review

(usually by the same reviewers) upon their re-submission. When a

manuscript is finally accepted for publication, the Technical Editor

undertakes a final edit and a marked-up copy will be e-mailed to the

corresponding author for review and any final adjustments.

Submission of Revised Papers

When revising a manuscript based on the reviewers’ and Editor’s

feedback, please insert all changed text in red. Please do not use

track changes, as this feature can make reading difficult. To submit

revised manuscripts, please log in to your author center at ScholarOne

Manuscripts. Your manuscript will be stored under “Manuscripts with

Decisions”. Please click on the “Create a Revision” link located to the right

of the manuscript title. A revised manuscript number will be created for

you; you will then need to click on the “Continue Submission” button.

You will then be guided through a submission process very similar to

that for new manuscripts. You will be able to amend any details you

wish. At stage 6 (“File Upload”), please delete the file for your original

manuscript and upload the revised version. Additionally, please upload

an anonymous cover letter, preferably in table format, including a

point-by-point response to the reviews’ revision recommendations. You

will then need to review your paper as a PDF and click the “Submit”

button. Your revised manuscript will have the same ID number as the

original version, but with the addition of an R and a number at the

end, for example, TJH-2011-0001 for an original and TJH-2011-0001.

R1, indicating a first revision; subsequent revisions will end with R2,

R3, and so on. Please do not submit a revised manuscript as a new

paper, as revised manuscripts are processed differently. If you click on

the “Create a Revision” button and receive a message stating that the

revision option has expired, please contact the Editorial Assistant at

tjh@tjh.com.tr to reactivate the option.

English Language and Statistical Editing

All manuscripts are professionally edited by an English language editor

prior to publication. After papers have been accepted for publication,

manuscript files are forwarded to the statistical and English language

editors before publishing. Editors will make changes to the manuscript

to ensure it adheres to TJH requirements. Significant changes or

concerns are referred to corresponding authors for editing.

Online Early

The Turkish Journal of Hematology publishes abstracts of accepted

manuscripts online in advance of their publication. Once an accepted

manuscript has been edited, the authors have submitted any final

corrections, and all changes have been incorporated, the manuscript will

be published online. At that time the manuscript will receive a Digital

Object Identifier (DOI) number. Both forms can be found at www.tjh.

com.tr. Authors of accepted manuscripts will receive electronic page

proofs directly from the printer and are responsible for proofreading

and checking the entire manuscript, including tables, figures, and

references. Page proofs must be returned within 48 hours to avoid delays

in publication.

A-VIII

CONTENTS

Research Articles

175 Association of Immune Thrombocytopenia and Celiac Disease in Children: A Retrospective Case Control

Study

Angela Guarina, Maddalena Marinoni, Giuseppe Lassandro, Paola Saracco, Silverio Perrotta, Elena Facchini, Lucia Dora Notarangelo,

Giovanna Russo, Paola Giordano, Francesca Romano, Elisa Bertoni, Chiara Gorio, Gianluca Boscarol, Milena Motta, Marco Spinelli,

Angelica Barone, Marco Zecca, Francesca Compagno, Saverio Ladogana, Angela Maggio, Maurizio Miano, Gianluca Dell’Orso, Elena Chiocca,

Ilaria Fotzi, Angela Petrone, Assunta Tornesello, Irene D’Alba, Silvia Salvatore, Maddalena Casale, Giuseppe Puccio, Ugo Ramenghi,

Piero Farruggia; Palermo, Varese, Bari, Torin, Naples, Bologna, Brescia, Catania, Bolzano, Monza, Parma, Pavia, Rotondo, Genoa, Firenze,

Trento, Lecce, Ancona, Italy

181 Comparison of Splenectomy and Eltrombopag Treatment in the Second-Line Treatment of Immune

Thrombocytopenic Purpura

Mehmet Can Uğur, Sinem Namdaroğlu, Esma Evrim Doğan, Esra Turan Erkek, Nihan Nizam, Rafet Eren, Oktay Bilgir; İzmir, İstanbul, Turkey

188 Clinical Characteristics and Optimal Therapy of Acute Myeloid Leukemia with Myelodysplasia-Related

Changes: A Retrospective Analysis of a Cohort of Chinese Patients

Lei Wang, Xiaoxia Chu, Jingyao Wang, Licai An, Yinghui Liu, Li Li, Junqing Xu; Yantai, Linyi, China

195 Hematopoietic Stem Cell Transplantation for Patients with Paroxysmal Nocturnal Hemoglobinuria with

or without Aplastic Anemia: A Multicenter Turkish Experience

Fergün Yılmaz, Nur Soyer, Güldane Cengiz Seval, Sinem Civriz Bozdağ, Pervin Topçuoğlu, Ali Ünal, Leylagül Kaynar, Gökhan Özgür,

Gülsan Sucak, Hakan Göker, Mustafa Velet, Hakan Özdoğu, Mehmet Yılmaz, Emin Kaya, Ozan Salim, Burak Deveci, İhsan Karadoğan,

Güray Saydam, Fahri Şahin, Filiz Vural; İstanbul, İzmir, Ankara, Adana, Gaziantep, Malatya, Antalya, Turkey

204 Prediction of Stem Cell Mobilization Failure in Patients with Hodgkin and Non-Hodgkin Lymphoma

Haluk Demiroğlu, Rafiye Çiftçiler, Yahya Büyükaşık, Hakan Göker; Ankara, Turkey

211 Evaluation of a Generic Bortezomib Molecule in Newly Diagnosed Multiple Myeloma Patients

Sinan Mersin, Ayfer Gedük, Özgür Mehtap, Pınar Tarkun, Serkan Ünal, Merve Gökçen Polat, Kemal Aygün, Emel Merve Yenihayat,

Hayrunnisa Albayrak, Abdullah Hacıhanefioğlu; Kocaeli, Turkey

Brief Report

218 Post-Marketing Analysis of Peripheral Neuropathy Burden with New-Generation Proteasome Inhibitors

Using the FDA Adverse Event Reporting System

Syeda A. Mina, Ibrahim N. Muhsen, Ethan A. Burns, Humaira Sarfraz, Sai Ravi Pingali, Jiaqiong Xu, Shahrukh K. Hashmi; Houston, Rochester,

USA; Abu Dhabi, UAE

Images in Hematology

222 Extremity Necrosis Due to Intrauterine Arterial Ischemia

Serdar Beken, Kerim Sarıyılmaz, Eda Albayrak, Arzu Akçay, Ayşe Korkmaz; İstanbul, Turkey

224 Myeloid Sarcoma Involving the Testicular Vein

Nuh Filizoğlu, Salih Özgüven; İstanbul, Turkey

A-IX

226 Giant Cell Arteritis with Concomitant Chronic Myelomonocytic Leukemia

Mert Öztaş, Ilkın Muradov, Abdülkadir Erçalışkan, Ahu Senem Demiröz, Şebnem Batur, Ahmet Emre Eşkazan, Serdal Uğurlu;

İstanbul, Turkey

Letters to the Editor

228 Flower-Like Plasma Cell: A Comment

Smeeta Gajendra; New Delhi, India

229 Myeloma and Cystoisospora belli

Pathum Sookaromdee, Viroj Wiwanitkit; Bangkok, Thailand; Pune, India

230 Lenalidomide Combined with Interferon α-1b and Interleukin-2 in the Treatment of 21 Cases of

Acute Myeloid Leukemia

Cheng Cheng, Ruihua Mi, Dongbei Li, Lin Chen, Xudong Wei; Zhengzhou, China

233 Shoulder-Pad Sign in a Case of Amyloidosis Associated with Myeloma

Ceren Uzunoğlu, Tayfur Toptaş, Yıldız İpek, Fatma Arıkan, Fergün Yılmaz, Tülin Tuğlular; İstanbul, Turkey

234 Sweet Syndrome Associated with Ixazomib

İrfan Yavaşoğlu, Zahit Bolaman; Aydın, Turkey

236 Long Non-Coding RNA MALAT1 Contributed to the Proliferation of PNH Clone in Paroxysmal

Nocturnal Hemoglobinuria Patients

Honglei Wang, Yingying Chen, Hui Liu, Zhaoyun Liu, Rong Fu; Tianjin, China

239 Dicentric (7;12)(p11;p11) in T/Myeloid Mixed-Phenotype Acute Leukemia

Smeeta Gajendra, Akshay Ramesh Gore, Nitin Sood, Manorama Bhargava; New Delhi, Gurgaon, India

241 A Novel Variant in the ACVRL1 Gene in a Patient with Cirrhosis and Hereditary Hemorrhagic

Telangiectasia

Mehmet Baysal, Nihan Alkış, Hakan Gürkan, Ahmet Muzaffer Demir; Bursa, Edirne, Turkey

243 Can Hematological Findings of COVID-19 in Pediatric Patients Guide Physicians Regarding Clinical

Severity?

Kamile Ötiken Arıkan, Şahika Şahinkaya, Elif Böncüoğlu, Elif Kıymet, Ela Cem, Aybüke Akaslan Kara, Nuri Bayram, İlker Devrim;

İzmir, Turkey

A-X

Guarina A. et al: Association of Immune Thrombocytopenia and Celiac Disease

RESEARCH ARTICLE

DOI: 10.4274/tjh.galenos.2021.2021.0128

Turk J Hematol 2021;38:175-180

Association of Immune Thrombocytopenia and Celiac Disease in

Children: A Retrospective Case Control Study

Çocuklarda İmmün Trombositopeni ve Çölyak Hastalık Birlikteliği: Retrospektif Olgu Kontrol

Çalışması

Angela Guarina 1 , Maddalena Marinoni 2 , Giuseppe Lassandro 3 , Paola Saracco 4 , Silverio Perrotta 5 , Elena Facchini 6 ,

Lucia Dora Notarangelo 7 , Giovanna Russo 8 , Paola Giordano 3 , Francesca Romano 4 , Elisa Bertoni 7 , Chiara Gorio 7 ,

Gianluca Boscarol 9 , Milena Motta 8 , Marco Spinelli 10 , Angelica Barone 11 , Marco Zecca 12 , Francesca Compagno 12 ,

Saverio Ladogana 13 , Angela Maggio 13 , Maurizio Miano 14 , Gianluca Dell’Orso 14 , Elena Chiocca 15 , Ilaria Fotzi 15 ,

Angela Petrone 16 , Assunta Tornesello 17 , Irene D’Alba 18 , Silvia Salvatore 19 , Maddalena Casale 5 , Giuseppe Puccio 1 ,

Ugo Ramenghi 4 , Piero Farruggia 1

1U.O.C. Oncoematologia Pediatrica, ARNAS Civico, Di Cristina, Benfratelli, Palermo, Italy

2Pediatria-DH Oncoematologico Pediatrico, SSD Oncoematologia Pediatrica-Ospedale Filippo Del Ponte, Varese ASST Settelaghi, Varese, Italy

3Department of Biomedical Sciences and Human Oncology, University of Bari “Aldo Moro,” Bari, Italy

4SC Pediatria Specialistica Universitaria, AOU Città della Salute e della Scienza, Presidio Ospedale Infantile Regina Margherita, Torin, Italy

5U.O. S.D. Ematologia e Oncologia Pediatrica Dai Materno Infantile - Università degli Studi della Campania Luigi Vanvitelli, Naples, Italy

6Clinica Pediatrica Oncologia Ed Ematologia Pediatrica “Lalla Seràgnoli - Policlinico Sant’Orsola Malpighi,” Bologna, Italy

7U.O. Oncoematologia Pediatrica, Presidio Ospedale dei Bambini, Spedali Civili, Brescia, Italy

8UOC Ematologia ed Oncologia Pediatrica con TMO - AOU Policlinico “Rodolico-San Marco,” Università di Catania, Catania, Italy

9Ospedale Regionale Dipartimento di Pediatria, Bolzano, Italy

10Fondazione MBBM/AO San Gerardo Clinica Pediatrica Universitaria, Monza, Italy

11U.O. Pediatria e Oncoematologia - AOU, Parma, Italy

12SC Oncoematologia Pediatrica - Fondazione IRCCS, Policlinico San Matteo, Pavia, Italy

13UOC Oncoematologia Pediatrica - IRCCS Ospedale Casa Sollievo della Sofferenza, San Giovanni Rotondo, Italy

14Dipartimento di Scienze Pediatriche Generali e Specialistiche, U.O.C. Oncologia IRCCS Istituto Giannina Gaslini, Genoa, Italy

15Oncologia, Ematologia e TCSE - Centro di Eccellenza di Oncologia ed Ematologia - AOU A. Mayer, Firenze, Italy

16U.O.M. Pediatria Ospedale S. Chiara, Trento, Italy

17U.O.C. Di Oncoematologia Pediatrica - PO “Vito Fazzi”, Lecce, Italy

18S.O.S.D., Oncomematologia Pediatrica, A.O.U. Azienda Ospedali Riuniti, Ospedale Pediatrico Salesi, Ancona, Italy

19Dipartimento di Pediatria, Università degli Studi dell’Insubria, Varese, Italy

Abstract

Objective: The association between celiac disease (CD) and immune

thrombocytopenia (ITP) is still uncertain. The aim of this study was to

characterize the coexistence of these two diseases in Italian children.

Materials and Methods: This is a retrospective multicenter study

investigating the occurrence of CD in 28 children with ITP diagnosed

from January 1, 2000, to December 31, 2019.

Öz

Amaç: İmmün trombositopeni (İTP) ve çölyak hastalığı (ÇH) arasındaki

ilişki hala belirsizliğini korumaktadır. Bu çalışmanın amacı İtalyan

çocuklarında bu iki hastalık arasındaki ilişkiyi ortaya koymaktır.

Gereç ve Yöntemler: Bu çalışma, 1 Ocak 2000’den 31 Aralık 2019’a

kadar İTP tanısına ek olarak ÇH tanısı alan 28 çocuğun araştırıldığı

geriye dönük çok merkezli bir çalışmadır.

©Copyright 2021 by Turkish Society of Hematology

Turkish Journal of Hematology, Published by Galenos Publishing House

*Institution in which the work was performed: Unità Operativa di Oncoematologia Pediatrica, ARNAS Civico,

Di Cristina e Benfratelli, Piazza Nicola Leotta, 4, 90127 Palermo, Italy.

Address for Correspondence/Yazışma Adresi: Piero Farruggia, M.D., U.O.C. Oncoematologia Pediatrica,

ARNAS Civico, Di Cristina, Benfratelli, Palermo, Italy

Phone : +39-91-6664309

E-mail : piero.farruggia@arnascivico.it ORCID: orcid.org/0000-0002-3412-0399

Received/Geliş tarihi: February 15, 2021

Accepted/Kabul tarihi: May 17, 2021

175



Abstract

Results: The first diagnosis was ITP in 57.1% and CD in 32.1% of

patients. In 3 patients (10.7%), the two diagnoses were simultaneous.

All the potential and silent cases of CD in our cohort were diagnosed

in the groups of “ITP first” and “simultaneous diagnosis”. In all children

ITP was mild, and in 2 out of 8 not recovered from ITP at the time

of CD diagnosis a normalization of platelet counts (>100,000/µL)

occurred 3 and 5 months after starting a gluten-free diet, respectively.

Conclusion: We think that screening for CD should be considered

in children with ITP regardless of the presence of gastrointestinal

symptoms. Furthermore, some patients may recover from ITP after

starting a gluten-free diet.

Keywords: Celiac, Children, Immune, Thrombocytopenia, Pediatric

Öz

Bulgular: Hastaların %57,1’inde ilk tanı İTP ve %32,1’inde ÇH idi.

Üç hastada (%10,7) iki tanı aynı anda konulmuştu. Kohortumuzdaki

tüm potansiyel ve sessiz ÇH olguları “önce İTP” ve “eşzamanlı tanı”

gruplarında teşhis edildi. Tüm çocuklarda İTP hafifti ve ÇH tanısı

sırasında trombositopenisi devam eden 8 çocuktan 2’sinde, glutensiz

diyete başladıktan sonra sırasıyla 3 ve 5 ayda trombosit sayılarında

normalleşme (>100.000/µL) görüldü.

Sonuç: Bu çalışma İTP’li çocuklarda gastrointestinal semptomların

varlığına bakılmaksızın ÇH taramasının yapılması gerektiğini

düşündürmektedir. Bazı hastalarda trombosit sayılarının glutensiz bir

diyete başladıktan sonra düzelebileceği akılda bulundurulmalıdır.

Anahtar Sözcükler: Çölyak, Çocuklar, İmmün, Trombositopeni,

Pediatrik

Introduction

Celiac disease (CD) is an immune disorder of the small intestine,

often associated with other autoimmune disorders [1], whose

prevalence has been estimated in Europe as 0.7% [2]. Immune

thrombocytopenia (ITP) is an acquired disease caused by

autoantibodies against platelet antigens whose estimated yearly

incidence in the pediatric population is 0.0019%-0.0064% [3].

The features of ITP and CD coexistence have been investigated

in some cohorts and case reports with contradictory results,

especially regarding the efficacy of a gluten-free diet on ITP [4,

5,6,7,8,9,10,11,12,13,14,15,16,17,18]. Furthermore, no study has

aimed to describe the specific features of this association in the

pediatric population. The goal of this study was to characterize

the association of these two diseases in Italian children.

Materials and Methods

A case report form (CRF) was sent to all 55 AIEOP (Associazione

Italiana Emato-Oncologia Pediatrica) Centers collecting

information about patients up to 18 years of age with both CD

and ITP diagnosed from January 1, 2000, to December 31, 2019.

Children affected by a known immunodeficiency were excluded.

The clinical phenotypes of ITP and CD autoantibody testing (antitransglutaminase

antibodies ± anti-endomysial antibodies) ±

biopsy results were recorded. CD was considered and classified

according to Tonutti and Bizzaro [19] as classic (presence of

symptoms of malabsorption, positive CD-specific antibodies and

biopsy, and symptom resolution with a gluten-free diet), silent

(positive CD-specific antibodies, HLA DQ2 or DQ8, and biopsy

without symptoms), latent (presence of HLA DQ2 or DQ8 and

histological alterations typical of CD in duodenal biopsy at some

point in life, but neither symptoms nor positive antibodies), or

potential (positive CD-specific antibodies and HLA without

histological abnormalities in duodenal biopsies). ITP was defined

as newly diagnosed (within 3 months from diagnosis), persistent

(between 3 and 12 months from diagnosis), or chronic (cITP,

lasting for more than 12 months) [20]. The ITP bleeding

score was defined as follows [21]: Type A: asymptomaticpaucisymptomatic

ITP, with clinical symptoms ranging from no

bleeding to a few petechiae and some bruises without mucosal

hemorrhages; Type B: intermediate ITP, a clinical picture with

more petechiae, bruising, and mucosal hemorrhages; Type C:

severe ITP, a clinical picture with severe cutaneous and mucosal

bleeding symptoms with at least one of the following: retinal

hemorrhages, intracranial hemorrhage, other severe internal

hemorrhages, hemorrhagic shock, or life-threatening bleeding.

The timing of the diagnosis of the patients was classified as

follows: 1) CD first: CD was diagnosed before ITP; 2) ITP first: ITP

was diagnosed before CD; 3) Simultaneous diagnosis: the second

disease (CD or ITP) was diagnosed during hospitalization or

initial ascertainment for the other disorder. Considering therapy

or efficacy of a gluten-free diet on ITP, complete response was

defined as any platelet count of ≥100,000/µL with the absence

of bleeding, partial response as any platelet count between

30,000 and 100,000/µL with at least doubling of the baseline

count and absence of bleeding, and no response as any platelet

count of <30,000/µL or less than doubling of the baseline count

and/or occurrence of bleeding.

Statistical Analysis

Statistical analysis was performed using open source R statistical

software [22].

Results

We collected CRFs for 28 ITP/CD patients diagnosed in Italy from

2000 to 2019; they were all Caucasian (male/female=1/2.1).

Among CD patients, for 11 the diagnosis was performed

through intestinal biopsy + anti-transglutaminase ± endomysial

antibodies detection, and for the remaining 17 through

antibody dosages only according to ESPGHAN guidelines. The

most relevant clinical features of the cohort are shown in

176



Table 1. The median follow-up (FUP) time from ITP and CD

diagnosis was 4.4 years (range: 0.2-16.5) and 2.3 years (range:

0.02-15.2), respectively. Median age at CD and ITP diagnosis was

6.2 and 5.8 years, respectively. Among 27 evaluable patients,

a positive family history for other autoimmune diseases was

present in 15 (55.6%): thyroid disorders were reported in 66.6%

of these cases and CD in 40%. ITP was present in the family

history of 1 patient only (grandfather). Extraintestinal disorders

affected 4 patients (14.8%); interestingly, 3 out of 4 were

autoimmune hemolytic anemia. The median number of platelets

at ITP diagnosis was 19,500/µL (range: 1,000-96,000) and the

bleeding score was A in 67.9% and B in 32.1% of patients,

respectively. First-line therapy for ITP was IVIG in 18 patients

(64.3%) and oral prednisone in 4 patients (14.3%), while 6

patients (21.4%) were not treated (“wait and see”). ITP turned

out to be persistent in 12 out of 27 evaluable cases (44.4%) and

chronic in 10 out of 25 evaluable cases (40%); the median number

of platelets at 3 and 12 months from ITP onset was 100,000/µL

(range: 1,000-446,000) and 135,000/µL (range: 15,000-343,000),

respectively; only 1 patient at 12 months from ITP diagnosis

had platelets of >20,000/µL. At the last FUP, 25.0% of patients

were still presenting with cITP; none of them had platelets of

>50,000/µL and only 1 patient was still on treatment (with

mycophenolate mofetil). Helicobacter pylori was tested in 57.1%

of patients using a stool antigen test and was found negative in

all cases. Bone marrow aspiration was performed for 57.1% of

patients and was always consistent with ITP. CD was classified

as classical, silent, latent, and potential in 17 (60.7%), 7 (25%),

2 (7.1%), and 2 (7.1%) cases, respectively. The first diagnosis

was ITP for 16 patients (57.1%) and CD for 9 patients (32.1%).

For 3 patients (10.7%), the two diagnoses were simultaneous; 1

potential and 2 classical cases of CD were discovered just after

ITP onset, in 1 patient after having performed an autoimmune

panel for screening and in the other 2 after having evaluated

pre-existing gastrointestinal symptoms. The most relevant

features of the “CD first” and “ITP first” patients are shown

in Table 2. In the “CD first” subgroup (9 patients), the median

time from diagnosis of CD to diagnosis of ITP was 1.6 years

(range: 0.2-10.1). These 9 cases of CD were all of the classic type,

but 2 (latent) patients were on a gluten-free diet at the moment

of ITP diagnosis. None of them suffered from other autoimmune

diseases and 3 out 8 evaluable patients (37.5%) developed

cIPT. In the “ITP first” subgroup (16 patients), the median

time from diagnosis of ITP to diagnosis of CD was 2.8 years

(range: 0.1-12.9) and all cases of silent CD (n=7), diagnosed

thanks to the autoimmune screening performed in the centers,

Table 1. Characteristics of the patients.

Median age at CD diagnosis (years) 6.2 (range: 0.6-27.6)

Median age at ITP diagnosis (years) 5.8 (range: 0.5-15.1)

Median PLTs at ITP diagnosis

Family history of autoimmune diseases 55.6%

Extraintestinal disorders 14.8%

CD type

ITP bleeding score

Timing of diagnosis

Efficacy of gluten-free diet on ITP

cITP at 12 months 40%

First-line therapy for ITP

19,500/µL (range: 1,000-96,000/µL)

Latent: 7.1%

Potential: 7.1%

Silent: 25%

Classic: 60.7%

Score A: 67.9%

Score B: 32.1%

ITP first: 57.1%

CD first: 32.1%

Simultaneous: 10.7%

NR: 77.8%

CR: 22.2%

First rescue therapy for ITP 42.9%

Second rescue therapy for ITP 21.4%

IVIG: 64.3%

Wait and see: 21.4%

Oral prednisone: 14.3%

Median FUP from ITP diagnosis (years) 4.4 (range: 0.2-16.5)

Median FUP from CD diagnosis (years) 2.3 (range: 0.02-15.2)

CD: Celiac disease; ITP: immune thrombocytopenia; FUP: follow-up; PLTs: platelets; NR: no response; CR: complete response; cITP: chronic immune thrombocytopenia; IVIG: intravenous

immunoglobulin.

177



Table 2. Characteristics of the CD first and ITP first patients.

Median PLTs at ITP diagnosis

CD first (n=9)

18,000/µL

(range: 2,000-96,000/µL)

Family history of autoimmune diseases 77.7% 40%

Extraintestinal disorders 0 25%

ITP score bleeding

A: 77.8%

B: 22.2%

ITP first (n=16)

24,000/µL

(range: 1,000-82,000/µL)

A: 68.7%

B: 31.2%

cITP at 12 months 37.5% 46.6%

First-line therapy for ITP

IVIG: 50%

Wait and see: 25.0%


IVIG: 62.5%

Wait and see: 25.0%


CD: Celiac disease; ITP: immune thrombocytopenia; PLTs: platelets; cITP: chronic immune thrombocytopenia; IVIG: intravenous immunoglobulin.

were seen among these patients. At ITP onset 5 patients

(31.2%) were not treated (“wait and see”), 9 (56.2%) received

intravenous immunoglobulin (IVIG), and 2 (12.5%) received

oral prednisone; after that, at the moment of CD diagnosis,

5 (31.2%) had not yet been treated, 5 (31.2%) had received IVIG,

5 (31.2%) had received both IVIG and oral prednisone, and 1

(6.2%) had received oral prednisone only.

Subsequent rescue therapies for ITP were attempted for 12 out of

28 patients (42.9%): half, relapsed after prednisone, were treated

with IVIG and half, relapsed after IVIG, with oral prednisone.

Only 6 patients (21.4%) needed further treatments: 3 children

received IVIG (one of them was later treated with eltrombopag),

2 intravenous methylprednisolone, and 1 mycophenolate mofetil.

In 2/9 (22.2%) “ITP first” patients not recovered from ITP at the

time of CD diagnosis (after a previous transient response to both

IVIG and oral prednisone), the gluten-free diet seemed to have

played a role in ITP recovery. One child who had ITP lasting for

37 months showed an increase of platelets from 48,000/µL to

118,000/µL after 5 months of diet; in the second patient, whose

ITP had lasted for 33 months, platelets increased from 13,000/µL

to 107,000/µL after 3 months of a gluten-free diet. These patients

had received the last ITP treatment 36 and 23 months before the

start of the gluten-free diet, respectively.

Discussion

ITP is a hematologic disease characterized by thrombocytopenia

caused by antiplatelet autoantibodies that, binding to

platelet membrane glycoproteins, mediate the destruction

of platelets in the reticuloendothelial system, particularly in

the spleen and liver [20,21,23]. The association of ITP with

other autoimmune diseases, above all thyroid autoimmune

diseases and systemic lupus erythematosus, is a wellrecognized

condition [23,24]. CD is an autoimmune disease

that represents the most common life-long food-sensitive

enteropathy in humans: it is characterized by malabsorption

and villous atrophy occurring as a consequence of the

ingestion of wheat gluten or related rye and barley proteins

in genetically predisposed individuals [25]. A wide range

of immune disorders [8,26,27,28,29] have been associated

with CD with a prevalence that can be 7-fold higher than

in healthy people [8], but little is known, particularly in the

pediatric population, about the association between CD and

ITP. Apart from the registry analysis of Olen et al. [4], only 16

pediatric patients have been reported, mostly in single case

reports [6,8,9,10,11,12,13,14,15,16,17]. The ITP prevalence in

children <18 years of age is 6/100,000 [30], and so in Italy

in 2019, among roughly 55,000 CD patients of pediatric age

[31], there were 3 expected children also affected by ITP.

However, in our cohort, we found double that number of

children (n=6). A large Swedish registery-based cohort study

[4] reported an increased risk of ITP in CD patients [hazard

ratio: 1.91, 95% confidence interval (CI): 1.19-3.11] and a

positive association between CD and prior ITP (odds ratio:

2.96, 95% CI: 1.60-5.50). Our results are in accordance with

the Swedish data [4], but not with the findings of Ventura

et al. [8], who analyzed 909 people of all ages. However, it

must be emphasized that the 2 patients only affected by

ITP in that Italian cohort of 909 CD cases [4] were children

and that the present study is the first to focus on patients of

pediatric age, a period of life when a peak of ITP incidence is

seen [32,33]. Based on the available data, it is impossible to

explain the reasons for the probable higher incidence of ITP

among pediatric CD patients. It can be speculated that ITP is

secondary to immunostimulation from luminal antigens, but

it is also possible to postulate a common underlying immune

dysregulation similarly to what is observed in secondary ITP

in the course of other autoimmune disorders such as lupus

erythematosus or common variable immunodeficiency [34].

The median ages at diagnosis of CD (6.2 years) and ITP (5.8 years)

in our cohort are in accordance with what has been previously

reported [35]. The prevalence of female gender confirms what

is observed in the vast majority of studies about CD [4,7,36],

seeming to overcome the opposite slight prevalence of male

178



gender observed in childhood ITP [37]. All the potential (n=2)

and silent (n=7) cases of CD in our cohort were diagnosed in the

groups of “ITP first” and “simultaneous diagnosis”, where CD was

diagnosed during the first tests for ITP, raising the question of CD

screening at ITP onset. In our opinion, despite conflicting results

regarding the frequency of association for these 2 diseases, in

view of the possible complications in untreated CD patients and

the limited costs of anti-transglutaminase antibodies (30 euros

in Italy) [38], screening for CD could be performed.

ITP features, irrespectively of their appearance happening

before or after CD, are very similar in our cohort to what is

typically observed in pediatric ITP, with mild onset and course

[20,21]. No patient suffered from severe hemorrhage and only 1

was on treatment at the last FUP. Based on the limited data on

the association of CD and ITP, the effect of a gluten-free diet is

still uncertain, being beneficial in some cases [6,11,13,16] and

having no impact in others [9,10,15]. In our analysis, the glutenfree

diet seemed to be efficient in no more than 20%-25% of

patients already affected by ITP.

Study Limitations

The limitations of the present study are related to the inherent

biases in a retrospective study. Furthermore, even though the

majority of Italian AIEOP Centers perform autoimmunity

screening including anti-transglutaminase autoantibodies,

that screening is conducted with variable timing and it is

sometimes omitted. Thus, it is possible that some cases of

CD, especially cases that are not of the classic type, have

been missed. At the same time, even with these limitations,

the present work is the first study reporting clinical insights

and detailed information on the ITP/CD association in an

exclusively pediatric cohort.

Conclusion

According to our data, it seems that ITP presents at a higher

prevalence among pediatric CD patients. Therefore, at every ITP

onset in otherwise healthy children, clinicians should be aware

that an association with undiagnosed CD is possible. Finally,

it has to be remarked that ITP in these patients presents the

typical mild clinical features usually observed in childhood, and

that after the diagnosis of CD, the start of a gluten-free diet

could result in a significant increase of platelet levels in a few

cases. However, future studies are needed to further explore the

efficacy of diet in these children.

Acknowledgments: The Parents’ Association ASLTI – Liberi di

crescere (http://www.liberidicrescere.it/) is acknowledged for

supporting the activities of the Pediatric Onco-Hematology

Unit of ARNAS Ospedali Civico, Di Cristina e Benfratelli. No

specific funding was received for this study. Giuseppe Furfari is

acknowledged for electronic CRF design.

Ethics

Ethics Committee Approval: This retrospective study was

designed by the Coagulation Defects Study Group of the

AIEOP (Associazione Italiana Emato-Oncologia Pediatrica)

and approved by the Ethics Committee of the Civico Hospital

(Palermo) and by every local ethics committee. All procedures

followed were in accordance with the ethical standards of the

committee in charge of human experimentation (institutional

and national) and the 1975 Declaration of Helsinki, as revised

in 2000.

Informed Consent: Informed consent for inclusion in the study

was obtained from the parents or the legal guardians of all

patients.

Authorship Contributions

Concept: A.G., F.C., P.F., G.R., P.S., M.M.; Design: A.G., F.C., P.F.,

G.R., P.S., M.M.; Data Collection or Processing: A.G., P.F.; Analysis

or Interpretation: G.P., G.L., S.P., E.F., L.D.N., P.G., F.R., E.B., C.G.,

G.B., M.S., A.B., M.Z., S.L., A.M., M.Mi., G.O., E.C., I.F., A.P., A.T., I.D.,

S.S., M.C., G.P.; Writing: U.R., A.G., F.C., P.F., G.R., P.S., M.M.

Conflict of Interest: No conflict of interest was declared by the

authors.

Financial Disclosure: The authors declared that this study

received no financial support.

References

1. Lundin KE, Wijmenga C. Coeliac disease and autoimmune disease–genetic

overlap and screening. Nat Rev Gastroenterol Hepatol 2015;12:507-515.

2. Mustalahti K, Catassi C, Reunanen A, Fabiani E, Heier M, McMillan S,

Murray L, Metzger MH, Gasparin M, Bravi E, Mäki M; Coeliac EU Cluster,

Project Epidemiology. The prevalence of celiac disease in Europe: results of a

centralized, international mass screening project. Ann Med 2010;42:587-595.

3. Terrell DR, Beebe LA, Vesely SK, Neas BR, Segal JB, George JN. The incidence

of immune thrombocytopenic purpura in children and adults: a critical

review of published reports. Am J Hematol 2010;85:174-180.

4. Olen O, Montgomery SM, Elinder G, Ekbom A, Ludvigsson JF. Increased

risk of immune thrombocytopenic purpura among inpatients with coeliac

disease. Scand J Gastroenterol 2008;43:416-422.

5. Rischewski JR, Paulussen M, Thomas K. Celiacs disease is not a major risk

factor for the development of childhood idiopathic thrombocytopenic

purpura. J Pediatr Hematol Oncol 2008;30:185.

6. Sarbay H, Kocamaz H, Akin M, Özhan B. Investigation of celiac disease

followed by immune thrombocytopenic purpura diagnosis in patients and

comparison with literature. Northern Clin Istanbul 2017;26:160-164.

7. Bibbò S, Fozza C, Pes GM, Rojas R, Manetti R, Dore MP. Increased

frequency of immune thrombocytopenic purpura in coeliac disease and

vice versa: a prospective observational study. Gastroenterol Res Pract

2018;2018:4138434.

8. Ventura A, Magazzù G, Greco L. Duration of exposure to gluten and risk for

autoimmune disorders in patients with celiac disease. SIGEP Study Group for

Autoimmune Disorders in Celiac Disease. Gastroenterology 1999;117:297-303.

9. Stenhammar L, Ljunggren CG. Thrombocytopenic purpura and coeliac

disease. Acta Paediatr Scand 1988;77:764-766.

179



10. Stene-Larsen G, Mosvold J, Ly B. Selective vitamin B12 malabsorption in

adult coeliac disease. Report on three cases with associated autoimmune

diseases. Scand J Gastroenterol 1988;23:1105-1108.

11. Hammami S, Hadded S, Lajmi K, Besbès LG, Meriem CB, Chouchane S,

Guediche MN. Immune thrombocytopenic purpure and coeliac disease. J

Paediatr Child Health 2011;47:240.

12. Le Pira A, Lombardo I, Lionetti E. The risk of idiopathic thrombocytopenic

purpura in a patient with coeliac disease: pure coincidence? Acta Pediatrica

Mediterranea 2009;25:37-39.

13. Dogan M, Sal E, Akbayram S, Peker E, Cesur Y, Oner AF. Concurrent celiac

disease, idiopathic thrombocytopenic purpura and autoimmune thyroiditis:

a case report. Clin Appl Thromb Hemost 2011;17:E13-E16.

14. Eliakim R, Heyman S, Kornberg A. Celiac disease and keratoconjunctivitis.

Occurrence with thrombocytopenic purpura. Arch Intern Med

1982;142:1037.

15. Kahn O, Fiel MI, Janowitz HD. Celiac sprue, idiopathic thrombocytopenic

purpura, and hepatic granulomatous disease. An autoimmune linkage? J

Clin Gastroenterol 1996;23:214-216.

16. Fisgin T, Yarali N, Duru F, Usta B, Kara A. Hematologic manifestation of

childhood celiac disease. Acta Haematol 2004;111:211-214.

17. Roganovic J. Celiac disease with Evans syndrome and isolated immune

thrombocytopenia in monozygotic twins: a rare association. Semin Hematol

2016;53(Suppl 1):S61-S63.

18. Karunakaran P, Kochhar R, Lal S, Nampoothiri RV, Varma N, Varma S,

Malhotra P. High prevalence of celiac disease in patients with immune

thrombocytopenia. Indian J Hematol Blood Transfus 2019;35:722-725.

19. Tonutti E, Bizzaro N. Diagnosis and classification of celiac disease and

gluten sensitivity. Autoimmun Rev 2014;13:472-476.

20. Rodeghiero F, Stasi R, Gernsheimer T, Marc M, Provan D, Arnold DM, Bussel

JB, Cines DB, Chong BH, Cooper N, Godeau B, Lechner K, Mazzucconi MG,

McMillan R, Sanz MA, Imbach P, Blanchette V, Kühne T, Ruggeri M, George

JN. Standardization of terminology, definitions and outcome criteria in

immune thrombocytopenic purpura of adults and children: report from an

international working group. Blood 2009;113:2386-2393.

21. De Mattia D, Del Principe D, Del Vecchio GC, Jankovic M, Arrighini A,

Giordano P, Menichelli A, Mori P, Zecca M, Pession A. Acute childhood

idiopathic thrombocytopenic purpura: AIEOP consensus guidelines for

diagnosis and treatment. Associazione Italiana di Ematologia e Oncologia

Pediatrica. Haematologica 2000;85:420-424.

22. R Core Team. R: A Language and Environment for Statistical Computing.

Vienna, R Foundation for Statistical Computing, 2014.

23. Liu Y, Chen S, Sun Y, Lin Q, Liao X, Zhang J, Luo J, Qian H, Duan L, Shi

G. Clinical characteristics of immune thrombocytopenia associated with

autoimmune disease. Medicine (Baltimore) 2016;95:e5565.

24. Giordano P, Urbano F, Lassandro G, Bianchi FP, Tolva A, Saracco P, Russo

G, Notarangelo LD, Gabelli M, Cesaro S, Wasniewska M, Faienza MF. Role

of anti-thyroid and autoimmunity as a predictive biomarker of chronic

immune thrombocytopenia. Pediatr Blood Cancer 2019;66:e27452.

25. Farrel RJ, Kelly CP. Celiac sprue and refractory sprue. In: MH Sleisenger,

JS Fordtran (eds). Gastrointestinal and Liver Disease, 7th ed. Philadelphia,

Saunders, 2003.

26. Collin P, Reunala T, Pukkala E, Laippala P, Keyriläinen O, Pasternack A.

Coeliac disease--associated disorders and survival. Gut 1994;35:1215-1218.

27. Halfdanarson TR, Litzow MR, Murray JA. Hematologic manifestations of

celiac disease. Blood 2007;109:412-421.

28. Stroud C, Almilaji O, Nicholas D, Kirkham S, Surgenor SL, Williams I, Snook

J. Evolving patterns in the presentation of coeliac disease over the last 25

years. Frontline Gastroenterol 2020;11:98-103.

29. Altintas A, Pasa S, Cil T, Bayan K, Gokalp D, Ayyildiz O. Thyroid and

celiac diseases autoantibodies in patients with adult chronic idiopathic

thrombocytopenic purpura. Platelets 2008;19:252-257.

30. Segal JB, Powe NR. Prevalence of immune thrombocytopenia: analyses of

administrative data. J Thromb Haemost 2006;4:2377-2383.

31. Italian Ministry of Health. Direzione Generale per l’Igiene e la Sicurezza degli

Alimenti e la Nutrizione. Rome, Ministry of Health, 2018. Available online at

http://www.salute.gov.it/imgs/C_17_pubblicazioni_2808_allegato.pdf.

32. Moulis G, Palmaro A, Montastruc JL, Godeau B, Lapeyre-Mestre M, Sailler

L. Epidemiology of incident immune thrombocytopenia: a nationwide

population-based study in France. Blood 2014;124:3308-3315.

33. Lebwohl B, HR Green P, Murray JA, Ludvigsson JF. Season of birth in a

nationwide cohort of coeliac disease patients. Arch Dis Child 2013;98:48-

51.

34. Casella J, Bowers D, Pelidis M. Disorders of platelets. In: De Angelis C, Feigin

R, Warshaw J (eds). Oski’s Pediatrics: Principles and Practice. Philadelphia,

Lippincott Williams & Wilkins, 1999.

35. Schifferli A, Holbro A, Chitlur M, Coslovsky M, Imbach P, Donato H, Elalfy

M, Graciela E, Grainger J, Holzhauer S, Riccheri C, Rodeghiero F, Ruggeri M,

Tamary H, Uglova T, Wu R, Kühne T; Intercontinental Cooperative ITP Study

Group (ICIS). A comparative prospective observational study of children and

adults with immune thrombocytopenia: 2-year follow-up. Am J Hematol

2018; 93:751-759.

36. Lima RF, Maria da Silva Kotze L, Kotze LR, Chrisostomo KR, Nisihara R.

Gender-related differences in celiac patients at diagnosis. Arch Med Res

2019;50:437-441.

37. Kühne T, Buchanan GR, Zimmerman S, Michaels LA, Kohan R, Berchtold

W, Imbach P; Intercontinental Childhood ITP Study Group. A prospective

comparative study of 2540 infants and children with newly diagnosed

idiopathic thrombocytopenic purpura (ITP) from the Intercontinental

Childhood ITP Study Group. J Pediatr 2003;143:605-608.

38. De Leo L, Bramuzzo M, Ziberna F, Villanacci V, Martelossi S, Leo GD.

Diagnostic accuracy and applicability of intestinal auto-antibodies in the

wide clinical spectrum of coeliac disease. EBioMedicine 2020;51:102567.

180

Uğur M.C. et al: Immune Thrombocytopenic Purpura

RESEARCH ARTICLE

DOI: 10.4274/tjh.galenos.2021.2021.0216


Comparison of Splenectomy and Eltrombopag Treatment in the

Second-Line Treatment of Immune Thrombocytopenic Purpura

İmmün Trombositopenik Purpuranın İkinci Basamak Tedavisinde Splenektomi ve

Eltrombopag Tedavilerinin Karşılaştırılması

Mehmet Can Uğur 1 , Sinem Namdaroğlu 1 , Esma Evrim Doğan 2 , Esra Turan Erkek 3 , Nihan Nizam 4 , Rafet Eren 1 ,

Oktay Bilgir 1

1University of Health Sciences Turkey, İzmir Bozyaka Training and Research Hospital, Clinic of Hematology, İzmir, Turkey

2University of Health Sciences Turkey, Prof. Dr. Cemil Taşçıoğlu Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey

3University of Health Sciences Turkey, İzmir Dr. Lütfi Kırdar Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey

4İzmir Çiğli Training and Research Hospital, Clinic of Internal Medicine, İzmir, Turkey

Abstract

Objective: Primary immune thrombocytopenia (ITP) is an acquired

autoimmune disease characterized by isolated thrombocytopenia.

While first-line treatments focus on inhibiting autoantibodies and

platelet destruction, second- and third-line treatments include

splenectomy and thrombopoietin receptor agonists. In this study, we

aimed to compare the efficiency and toxicities of splenectomy and

eltrombopag as second-line treatments in ITP.

Materials and Methods: We retrospectively analyzed patients who

were diagnosed with ITP and followed between 2015 and 2020. Patients

who underwent splenectomy or received eltrombopag treatment as

second-line or further therapy were included. For subgroup analyses,

patients were further stratified according to whether they received

eltrombopag in the second or third line of treatment.

Results: There were 38 patients in the splenectomy group and 47 patients

in the eltrombopag group. The mean age of patients in the splenectomy

and eltrombopag groups was 43.2 and 50.5 years, respectively. Time to

response was significantly shorter in the splenectomy arm (p=0.001).

However, response rates at the 3 rd , 6 th , 12 th , and 24 th months did not

exhibit a statistically significant difference between groups; nor did

total duration of response and adverse events. Response rates at the

1 st , 3 rd , 6 th , 12 th , and 24 th months and the total duration of response did

not exhibit a statistically significant difference between eltrombopag

subgroups. Eltrombopag treatment was ceased for 20 patients after a

median of 54.1 months (range: 1-151). Among them, 12 patients (60%)

did not experience a loss of response.

Conclusion: Comparing the splenectomy and eltrombopag arms, even

though time to achieve response was in favor of the splenectomy

group, this advantage disappeared when overall response rates and

response rate at the 2 nd year were considered. Using eltrombopag in

the second or third line of therapy does not yield any difference in

terms of time to achieving response.

Keywords: Thrombocytopenia, Eltrombopag, Splenectomy

Öz

Amaç: Primer immün trombositopeni (İTP), izole trombositopeni ile

karakterize, edinsel bir otoimmün hastalıktır. Birinci basamak tedaviler

otoantikorları ve trombosit yıkımını inhibe etmeye odaklanırken,

ikinci ve üçüncü basamak tedaviler arasında splenektomi ve

trombopoietin reseptör agonistleri bulunur. Bu çalışmada, İTP’de ikinci

basamak tedaviler olarak splenektomi ve eltrombopagın etkinlik ve

toksisitelerinin karşılaştırılması amaçlanmıştır.

Gereç ve Yöntemler: 2015-2020 yılları arasında İTP tanısı alan ve

takip edilen hastaları retrospektif olarak analiz ettik. Splenektomi

yapılan ve 2. veya daha ileri basamaklarda eltrombopag tedavisi alan

hastalar çalışmaya dahil edildi. Alt grup analizleri için, hastalar ikinci

veya üçüncü tedavi hattında eltrombopag alıp almadıklarına göre

gruplandırıldı.

Bulgular: Splenektomi grubunda 38 hasta, eltrombopag grubunda

47 hasta vardı. Splenektomi ve eltrombopag gruplarındaki hastaların

ortalama yaşı sırasıyla 43,2 ve 50,5’di. Splenektomi kolunda yanıt

süresi anlamlı olarak daha kısaydı (p=0,001). Bununla birlikte, 3., 6.,

12. ve 24. aylardaki yanıt oranları, toplam yanıt süresi ve yan etkiler

açısından gruplar arasında istatistiksel olarak anlamlı fark bulunmadı.

Birinci, 3., 6., 12. ve 24. aylardaki yanıt oranları ve toplam yanıt süresi,

eltrombopag alt grupları arasında istatistiksel olarak anlamlı değildi.

Eltrombopag tedavisi medyan 54,1 ay (1-151) sonra 20 hastada kesildi.

Bunlardan 12 hastada (%60) yanıt kaybı yaşanmadı.

Sonuç: Splenektomi ve eltrombopag kolları karşılaştırıldığında yanıt

alma süresi splenektomi lehine olsa da, genel yanıt oranları ve 2. yıldaki

yanıt oranları dikkate alındığında bu avantaj ortadan kalkmaktadır.

İkinci veya 3. basamak tedavide eltrombopag kullanılması, yanıt alma

süresi açısından herhangi bir fark oluşturmamaktadır.

Anahtar Sözcükler: Trombositopeni, Eltrombopag, Splenektomi



Address for Correspondence/Yazışma Adresi: Mehmet Can Uğur, M.D., University of Health Sciences Turkey,

İzmir Bozyaka Training and Research Hospital, Clinic of Hematology, İzmir, Turkey

Phone : +90 505 886 11 26

E-mail : med.can@hotmail.com ORCID: orcid.org/0000-0002-5600-3169

Received/Geliş tarihi: April 4, 2021

Accepted/Kabul tarihi: June 22, 2021

181



Introduction

Primary immune thrombocytopenia (ITP) is an acquired

autoimmune disease characterized by isolated thrombocytopenia

caused by T-cell-mediated platelet destruction, with

immunoglobulin G autoantibodies binding to platelets and

megakaryocytes, and megakaryocyte dysfunction. Patients may

present with petechiae, purpura, mucosal bleeding, and lifethreatening

organ bleeding [1,2,3]. The aim of treatment is to

prevent serious or life-threatening bleeding. Treatment modalities

employed in ITP target various stages in its pathophysiology,

including the inhibition of autoantibody synthesis, modulation

of T-cell activity, and stimulation of platelet production. While

first-line treatments mainly focus on inhibiting autoantibodies

and platelet destruction, second- and third-line treatments

include immunosuppression, splenectomy, and megakaryocyte

stimulation for increased platelet production [4].

Splenectomy is an effective treatment choice for steroidrefractory

or steroid-dependent ITP because the spleen is the

major site of platelet clearance. Macrophages express the FcγR

function in the phagocytosis of antibody-coated platelets via SYK

signaling pathways [5,6]. They also present antigenic peptides,

including glycoproteins IIa/IIIb and Ib/IX, to CD4+ T cells,

causing activation and expansion of autoreactive B- and T-cells

[7,8]. The spleen also acts as a reservoir for long-lived plasma

cells producing antiplatelet antibodies [9]. However, there is no

reliable predictor for splenectomy response. Considering the

associated risk of infection and cardiovascular complications,

splenectomy is being replaced by immunosuppressive agents

and thrombopoietin receptor agonists (TPO-RAs) as the secondline

treatment of ITP [10].

The TPO-RAs romiplostim and eltrombopag have been widely

used since 2008 [11]. These agents bind to the TPO receptor,

cause conformational changes, and activate the JAK2/STAT5

pathway, increasing megakaryocyte progenitor proliferation

and platelet production [12,13]. Randomized controlled studies

with TPO-RAs have reported response rates of 50% to 90%, as

well as efficiency in preventing bleeding and decreased need to

use additional medication. Data on toxicity indicate reversible

reticulin fibrosis and increased risk of venous thromboembolism

(VTE) [11].

Studies that directly compare the long-term efficacy of secondline

treatments for ITP are limited and treatment decisions

are therefore mostly patient-based. In this study, we aimed

to compare the efficiency and toxicities of splenectomy and

eltrombopag, a TPO-RA, as second-line treatments for ITP.


In our study, we retrospectively analyzed patients who were

diagnosed with ITP after the evaluation of complete blood

count, peripheral blood smear, blood biochemistry, viral

serologies including human immunodeficiency virus and

hepatitis C virus, abdominal sonography, and antinuclear

antibody testing and who were followed between 2015 and

2020. Bone marrow aspiration and biopsy were performed for

patients as deemed necessary by the clinician to confirm the

diagnosis of ITP. Among these cases, patients who were steroidresistant,

who were steroid-refractory, or who experienced

relapse after response and who had undergone splenectomy or

received eltrombopag treatment as second-line or third-line

therapy as the next step after only splenectomy were included

in the study. Included subjects were divided into splenectomy

and eltrombopag groups. For subgroup analyses, patients

receiving eltrombopag were further stratified according to

whether they received eltrombopag as the second or third line

of treatment.

Patient data were recorded, including age, sex, ITP bleeding

score, white blood cell (WBC) count, neutrophil and

lymphocyte counts, hemoglobin level, mean corpuscular

volume (MCV), platelet count, mean platelet volume (MPV),

serum creatinine, aspartate aminotransferase, alanine

aminotransferase, and lactate dehydrogenase levels at the

time of splenectomy or initiation of eltrombopag therapy,

as well as the dates of diagnosis and last visit. The ITP

bleeding score was assessed according to the World Health

Organization Bleeding Scale [14]. Cases were classified using

a simple five-point scale in which no bleeding was scored

as 0, petechiae as grade 1, mild blood loss as grade 2, gross

blood loss as grade 3, and debilitating blood loss as grade

4. The following comparisons between the splenectomy and

eltrombopag groups were also performed: time to achieve

response; response at the 1 st , 3 rd , 6 th , 12 th , and 24 th months;

total duration of response; and complications. Response

evaluation was performed according to the American Society

of Hematology’s 2009 International Working Group Report

[15]. Platelet count below 30,000/mm 3 was considered as

no response, above 30,000/mm 3 as response, and above

100,000/mm 3 as complete response.

The compliance of the study with ethical rules was confirmed

by the İzmir Bozyaka Training and Research Hospital Ethics

Committee and approval was granted. Also, the consent was

obtained from the volunteers included in the study.


SPSS 21 was used for statistical tests. Data were

represented as mean ± standard deviation for numeric

variables and as frequency and percentage for categorical

variables. Normality of numeric variables was assessed by

Shapiro-Wilk test. Comparisons of normally distributed variables

were performed using t-tests, while the Mann-Whitney U test

was used for nonnormally distributed nonparametric variables.

182



The chi-square test was used to determine whether there was a

relationship and dependency between two variables. Values of

p<0.05 were considered statistically significant.

Results

Eighty-five patients were included in the study. Bone marrow

aspiration and biopsy were performed for 67 patients who

required confirmation of the diagnosis of ITP. Among those, 49

were female and 36 were male. The median ages of the patients

in the splenectomy and eltrombopag groups were 43.2 and

50.5 years, respectively. There were 38 patients in the

splenectomy group and 47 patients in the eltrombopag group.

There was no statistically significant difference between the

two groups in terms of age, sex, comorbidities, bleeding score,

WBC count, neutrophil and lymphocyte counts, hemoglobin,

MCV, or platelet count. Characteristics of the treatment groups

are summarized in Table 1.

Table 2 presents data on the time to achieve response (R) or

complete response (CR) in the second line of treatment; R/CR

at the 1 st , 3 rd , 6 th , 12 th , and 24 th months of second-line therapy;

and the total duration of R/CR of the treatment groups. Time

to R/CR was significantly shorter in the splenectomy group

(p=0.001). The R/CR rate at the 1 st month was also significantly

higher in the splenectomy group (p=0.023). However, R/CR rates

at the 3 rd , 6 th , 12 th , and 24 th months and total duration of R/CR

did not exhibit statistically significant differences between the

groups.

One patient in the splenectomy group developed deep vein

thrombosis. In the eltrombopag group, one patient experienced

headache, one patient had elevated liver enzymes, one patient

developed bone marrow fibrosis, one patient developed chronic

myelomonocytic leukemia (CMML), one patient developed basal

cell carcinoma, and one patient developed pancreatic cancer.

There was no statistically significant difference in adverse events

Table 1. Patient characteristics.

Splenectomy Eltrombopag p

Median age, years (range) 43.2 (18-76) 50.5 (23-89) 0.056

Female 28 21

Sex, n

0.329

Male 10 26

Comorbidities, n

Yes 16 27

No 22 20

0.160

0 12 24

Bleeding score, n

1 12 14

2 12 8

0.223

3 2 1

WBCs/µL, mean ± SD 8750.0±2758.8 8970.7±3679.4 0.913

Neutrophils/µL, mean ± SD 5910.5±250.8 5956.5±352.3 0.953

Lymphocytes/µL, mean ± SD 2063.1±685.5 2437.3±1214.0 0.128

Hemoglobin, g/dL, mean ± SD 12.2±2.1 12.8±2.8 0.214

MCV, fL, mean ± SD 84.3±8.0 81.5±6.9 0.125

Platelets/µL, mean ± SD 14,800±8900 14,300±12,300 0.833

SD: Standard deviation; WBCs: white blood cells; MCV: mean corpuscular volume.

Table 2. Comparison of treatment response between splenectomy and eltrombopag groups.

Splenectomy Eltrombopag p

Time to achieve R/CR in second line treatment, days 1.9 (0-9) 19.1 (0-126) 0.001

R/CR at the 1 st month 100% 85.7% 0.023

R/CR at the 3 rd month 86.8% 85.7% 0.403

R/CR at the 6 th month 76.3% 85.7% 0.410



Total duration of R/CR, months 43.0 (1-123) 34.9 (0-122) 0.341

Complications, n 1 6 0.105

R: Response; CR: complete response.

183



between treatment groups (p=0.105). Bone marrow fibrosis

was detected in the patient who underwent bone marrow

biopsy 3 years after eltrombopag treatment because platelet

increase could not be achieved despite increasing the dose of

eltrombopag. The diagnosis of CMML was made 14 months after

the patient started eltrombopag. A blast count below 5% was

considered as CMML-0 and the patient was followed without

treatment.

Patients receiving eltrombopag were stratified according to

whether they received the treatment in the second or third line.

Table 3 provides data on age and sex; comorbidities; bleeding

score; WBC, neutrophil, and lymphocyte counts; hemoglobin,

MCV, MPV, and platelet count; time to achieve R/CR; R/CR at the

1 st , 3 rd , 6 th , 12 th , and 24 th months of second-line treatment; and

the total duration of R/CR. Patients who received eltrombopag in

the third line had significantly higher WBC counts (p=0.002). On

the other hand, no significant difference was observed between

the groups in terms of age, sex, comorbidities, bleeding score,

neutrophil and lymphocyte counts, hemoglobin, MCV, or platelet

count. The R/CR rates at the 1 st , 3 rd , 6 th , 12 th , and 24 th months

and the total duration of R/CR also did not exhibit statistically

significant differences between the groups.

Eltrombopag treatment was discontinued with no tapering due

to adverse effects or the patient’s refusal for various reasons

in 20 patients after a median of 54.1 months (range: 1-151).

Among them, 12 patients (60%) did not experience a loss of

response. The median duration of eltrombopag treatment was

25.6 (range: 2-64) months and median follow-up was 67.9

(range: 20-151) months in these patients. The follow-up period

after discontinuation of eltrombopag was 12.4 months, median

platelet count was 159,000/mm 3 , and bleeding score was 0.0.

Discussion

As highlighted in the updated international consensus

report, initial treatments for patients with newly diagnosed

ITP are usually corticosteroid-based regimens, intravenous

immunoglobulin (IVIg), and anti-D. However, the most commonly

preferred treatments are corticosteroids. IVIg can also be added

to the treatment for patients with active bleeding, patients who

are scheduled to undergo emergency interventions, or patients

who experience adverse events with glucocorticoids, even

though this approach is not standardized [16,17,18].

Because there are no randomized controlled studies that directly

compare second-line treatment options in ITP, treatment

Table 3. Eltrombopag as second-line or third-line treatment.

Second-line Third-line p

Median age, years (range) 56.1 (26-79) 46.0 (23-74) 0.067

Female 11 10

Sex, n

0.159

Male 10 16

Comorbidities, n

Yes 14 13

No 7 13

0.914

0 9 15

Bleeding score, n

1 7 7

2 4 4

0.263

3 1 0

WBCs/µL, mean ± SD 7635.7±402.4 9952.6±315.7 0.002

Neutrophils/µL, mean ± SD 5488.8±414.6 6257.1±319.0 0.106

Lymphocytes/µL, mean ± SD 1951.1±862.2 2750.0±132.9 0.146

Hemoglobin, g/dL, mean ± SD 12.1±3.1 13.3±2.6 0.148

MCV, fL, mean ± SD 81.5±6.2 81.5±7.5 0.699

Platelets/µL, mean ± SD 11,900±1040 16,300±1370 0.307

Time to achieve R/CR, days 18.7 (0-90) 19.5 (0-126) 0.784

R/CR at the 1 st month 85.7% 96.1% 0.202

R/CR at the 3 rd month 85.7% 92.3% 0.403




Total duration of R/CR, months 27.6 (0-120) 43.5 (0-122) 0.374

WBCs: White blood cells; MCV: mean corpuscular volume; R: response; CR: complete response.

184



decisions are mostly based on patient characteristics and

clinical preferences. Second-line medical treatments supported

by robust evidence are rituximab and TPO-RAs. Splenectomy is

still also preferred as a surgical option today [18,19,20].

Splenectomy is among the second-line treatment options with

the greatest likelihood of achieving long-term remission and

changing the course of the disease [21]. Provan et al. [18]

recommended waiting at least 12 months after the diagnosis

to rule out possible spontaneous remission. As new drugs

are available for ITP, splenectomy is often postponed. If the

patient is working in a risky profession or has a thrombotic

history or immunosuppression, splenectomy is considered as

the second line. In developing countries, and especially for

younger patients, it is still recommended for financial reasons

and the difficulties in obtaining novel drugs. Kojouri et al. [22]

conducted a systematic review of 47 case series including 2623

adult patients undergoing splenectomy and found rates of 66%

complete response and 88% overall response. The mean duration

of response was approximately 12 years in this patient group

[22]. Platelet count often tends to rise within 1 to 2 days after

splenectomy, while a delayed response can be observed at up to

8 weeks [23]. The only clinical parameter predicting splenectomy

response is the patient’s age, with younger patients achieving

higher response rates [22]. Even though there is no distinct age

cut-off, splenectomy was recommended for patients younger

than 50 years in two different studies [24,25]. In our study, the

median age of the patients in the splenectomy group was 43.2

years. The higher median age of the patients in the eltrombopag

group was due to elderly patients ineligible for splenectomy

inevitably being in this treatment arm.

The most common complications after splenectomy, which

is an irreversible procedure, are infections and venous

thromboembolism. In the review by Kojouri et al. [22],

complications occurred in 88 of 921 patients (9.6%) undergoing

laparoscopic splenectomy and in 318 of 2465 patients (12.9%)

undergoing open splenectomy. The risk of infection is highest

in the early postoperative period. In another series of 3812

patients undergoing splenectomy for various indications, the

rate of infections was 10.2% in the first 90 days [26]. However,

this rate declines to 1%-3% in the long term [27]. In our study,

no infectious side effects were found. The risk of VTE also

increases after splenectomy. In the aforementioned cohort of

3812 patients undergoing splenectomy, the risk of VTE in the

first year was reported to be 1.9%. Observed thromboses in

that study were deep vein thrombosis in half of the patients,

pulmonary embolism in a quarter, and portal or splenic vein

thrombosis in the remaining quarter [26]. Considering these

potential complications as well as the possibility of spontaneous

remission in ITP, postponing splenectomy for 6 to 12 months

after diagnosis may help avoid needless interventions. However,

this duration may be shortened for symptomatic patients

with severe thrombocytopenia [28]. In our study, response

was observed at a mean of 1.9 days in 38 patients undergoing

splenectomy and this response was durable for a mean of 43

months. One patient (2.6%) experienced deep vein thrombosis.

Studies assessing the efficiency of eltrombopag have reported

overall response rates of about 80%, including temporary

responses. The RAISE study, which randomized 197 adult

patients into eltrombopag and placebo arms, showed that the

mean platelet count of patients receiving eltrombopag was

74,000/mm 3 and their response rate was 79%. This rate showed

no difference among patients who underwent splenectomy and

those who received other therapies prior to eltrombopag. The

long-term response rate was 51% in patients with splenectomy

and 66% in patients without splenectomy [29]. In another study

with 110 adult patients, rates of response to eltrombopag and a

placebo were found to be 59% and 16%, respectively [30]. The

EXTEND study revealed that the 3-year response rates of 299

patients using eltrombopag were 80% for splenectomized and

89.3% for non-splenectomized patients [31]. In a recent study

assessing real-life data, the researchers reported that rates of

response to eltrombopag were not affected by factors including

splenectomy status or initial platelet count. Six of those patients

stopped eltrombopag after a median sustained response of 796

days and remained in remission for a median follow-up of 624

days [32]. Similarly, González-López et al. [33] reported that

51% of patients remained in remission in the 6 th month after

eltrombopag cessation after sustained response.

Eltrombopag is usually well tolerated. The most common side

effects are headache, gastrointestinal complaints, elevated

liver enzymes, thrombosis, and bone marrow fibrosis. In the

EXTEND study, 14% of patients had to cease medication due

to adverse events. Among these, hepatobiliary adverse events

were observed in 7 patients, cataract in 4 patients, deep vein

thrombosis in 3 patients, cerebral infarction in 2 patients,

headache in 2 patients, and myelofibrosis in 2 patients. The rate

of thromboembolic events and hepatobiliary adverse events

did not show any increase with 1 year of therapy [29,34]. In

our study, median duration of response was 34.9 months in

patients receiving eltrombopag and only 55% maintained

response into the 2 nd year. There was no significant difference

in the response rates of patients with and without a history of

splenectomy prior to eltrombopag. Twelve of 20 patients who

stopped eltrombopag treatment remained in remission. The

observed adverse events were consistent with those reported

in the literature; however, malignancy development in 3 (6.3%)

patients was noteworthy. The EXTEND study did not reveal a

significant difference between the treatment and placebo

arms in terms of malignancies [34]. In a multicenter study

from Turkey that reported the 12-month data of 40 patients

on eltrombopag, there were also no eltrombopag-associated

malignancies [35]. We could not identify a direct association

185



between the observed malignancies and eltrombopag use, but

we think that these malignancies may be incidental due to the

higher median age in the eltrombopag group. Furthermore, a

statistically significant difference was found in our study in

terms of pretreatment leukocyte counts between administration

of eltrombopag as second-line and as third-line treatment. This

difference may be attributable to splenectomy, as the patients

receiving third-line eltrombopag had previously undergone

splenectomy.

Conclusion

Comparing the splenectomy and eltrombopag arms of the

present study, even though time to achieve response and the

response rate at the 1 st month were in favor of splenectomy,

this advantage disappeared when overall response rates and

response rate at the 2 nd year were considered. However, more

adverse events were observed in the eltrombopag group.

Observed malignancies in 3 patients are inconsistent with

the reported data in the literature. Using eltrombopag in the

second or third line of therapy does not yield any difference in

terms of time to achieve response. The overall response rate was

higher when eltrombopag was used as the third-line treatment

after splenectomy compared to second-line treatment, but this

difference did not reach statistical significance. Randomized

prospective studies comparing treatment options such as

splenectomy, immunosuppressive therapies, and eltrombopag

head-to-head are required for the standardization of second-line

and more advanced therapies for immune thrombocytopenia.

Ethics

Ethics Committee Approval: The compliance of the study with

ethical rules was confirmed by the İzmir Bozyaka Training and

Research Hospital Ethics Committee and approval was granted.

Informed Consent: Consent was obtained from the volunteers

included in the study.


Surgical and Medical Practices: M.C.U., E.E.D., E.T.E.; Concept:

S.N., R.E., O.B.; Design: S.N., R.E.; Data Collection or Processing:

M.C.U., E.E.D., E.T.E.; Analysis or Interpretation: M.C.U., R.E., O.B.;

Literature Search: M.C.U., N.N.; Writing: N.N.


authors.



References

1. Khodadi E, Asnafi AA, Shahrabi S, Shahjahani M, Saki N. Bone marrow niche

in immune thrombocytopenia: a focus on megakaryopoiesis. Ann Hematol

2016;95:1765-1776.

2. Olsson B, Andersson PO, Jernås M, Jacobsson S, Carlsson B, Carlsson LM,

Wadenvik H. T-cell-mediated cytotoxicity toward platelets in chronic

idiopathic thrombocytopenic purpura. Nat Med 2003;9:1123-1124.

3. Moulis G, Palmaro A, Montastruc JL, Godeau B, Lapeyre-Mestre M, Sailler

L. Epidemiology of incident immune thrombocytopenia: a nationwide

population-based study in France. Blood 2014;124:3308-3315.

4. Blickstein D. Treatment of immune thrombocytopenic purpura in adults:

update. Harefuah 2019;15:196-199.

5. Audia S, Santegoets K, Laarhoven AG, Vidarsson G, Facy O, Ortega-Deballon

P, Samson M, Janikashvili N, Saas P, Bonnotte B, Radstake TR. Fcγ receptor

expression on splenic macrophages in adult immune thrombocytopenia.

Clin Exp Immunol 2017;188:275-282.

6. Podolanczuk A, Lazarus AH, Crow AR, Grossbard E, Bussel JB. Of mice and

men: an open-label pilot study for treatment of immune thrombocytopenic

purpura by an inhibitor of Syk. Blood 2009;113:3154-3160.

7. Kuwana M, Okazaki Y, Kaburaki J, Kawakami Y, Ikeda Y. Spleen is a primary

site for activation of platelet-reactive T and B cells in patients with immune

thrombocytopenic purpura. J Immunol 2002;168:3675-3682.

8. Roark JH, Bussel JB, Cines DB, Siegel DL. Genetic analysis of autoantibodies

in idiopathic thrombocytopenic purpura reveals evidence of clonal

expansion and somatic mutation. Blood 2002;100:1388-1398.

9. Mahévas M, Patin P, Huetz F, Descatoire M, Cagnard N, Bole-Feysot C, Le

Gallou S, Khellaf M, Fain O, Boutboul D, Galicier L, Ebbo M, Lambotte O,

Hamidou M, Bierling P, Godeau B, Michel M, Weill JC, Reynaud CA. B cell

depletion in immune thrombocytopenia reveals splenic long-lived plasma

cells. J Clin Invest 2013;123:432-442.

10. Chaturvedi S, Arnold DM, McCrae KR. Splenectomy for immune

thrombocytopenia: down but not out. Blood 2018;131:1172-1182.

11. Ghanima W, Cooper N, Rodeghiero F, Godeau B, Bussel JB. Thrombopoietin

receptor agonists: ten years later. Haematologica 2019;104:1112-1123.

12. Broudy VC, Lin NL. AMG531 stimulates megakaryopoiesis in vitro by binding

to Mpl. Cytokine 2004;25:52-60.

13. 13. Erickson-Miller CL, Delorme E, Tian SS, Hopson CB, Landis AJ, Valoret

EI, Sellers TS, Rosen J, Miller SG, Luengo JI, Duffy KJ, Jenkins JM. Preclinical

activity of eltrombopag (SB-497115), an oral, nonpeptide thrombopoietin

receptor agonist. Stem Cells 2009;27:424-430.

14. Fogarty PF, Tarantino MD, Brainsky A, Signorovitch J, Grotzinger KM.

Selective validation of the WHO Bleeding Scale in patients with chronic

immune thrombocytopenia. Curr Med Res Opin 2012;28:79-87.

15. Rodeghiero F, Stasi R, Gernsheimer T, Michel M, Provan D, Arnold DM, Bussel

JB, Cines DB, Chong BH, Cooper N, Godeau B, Lechner K, Mazzucconi MG,

McMillan R, Sanz MA, Imbach P, Blanchette V, Kühne T, Ruggeri M, George

JN. Standardization of terminology, definitions and outcome criteria in

immune thrombocytopenic purpura of adults and children: report from an

international working group. Blood 2009;12;113:2386-2393.

16. Matschke J, Müller-Beissenhirtz H, Novotny J, Vester I, Hertenstein B, Eisele

L, Lax H, Ose C, Dührsen U. A randomized trial of daily prednisone versus

pulsed dexamethasone in treatment-naïve adult patients with immune

thrombocytopenia: EIS 2002 study. Acta Haematol 2016;136:101-107.

17. Salib M, Clayden R, Clare R, Wang G, Warkentin TE, Crowther MA, Lim W, Nazi

I, Kelton JG, Arnold DM. Difficulties in establishing the diagnosis of immune

thrombocytopenia: an agreement study. Am J Hematol 2016;91:E327-329.

18. Provan D, Arnold DM, Bussel JB, Chong BH, Cooper N, Gernsheimer T,

Ghanima W, Godeau B, González-López TJ, Grainger J, Hou M, Kruse C,

McDonald V, Michel M, Newland AC, Pavord S, Rodeghiero F, Scully M,

Tomiyama Y, Wong RS, Zaja F, Kuter DJ. Updated international consensus

report on the investigation and management of primary immune

thrombocytopenia. Blood Adv 2019;3:3780-3817.

19. Bylsma LC, Fryzek JP, Cetin K, Callaghan F, Bezold C, Mehta B, Wasser

JS. Systematic literature review of treatments used for adult immune

186



thrombocytopenia in the second-line setting. Am J Hematol 2019;94:118-

132.

20. Cuker A. Transitioning patients with immune thrombocytopenia to secondline

therapy: challenges and best practices. Am J Hematol 2018;93:816-823.

21. George JN. Management of immune thrombocytopenia--something old,

something new. N Engl J Med 2010;363:1959-1961.

22. Kojouri K, Vesely SK, Terrell DR, George JN. Splenectomy for adult patients

with idiopathic thrombocytopenic purpura: a systematic review to assess

long-term platelet count responses, prediction of response, and surgical

complications. Blood 2004;104:2623-2634.

23. Gigot JF, Healy ML, Ferrant A, Michaux JL, Njinou B, Kestens PJ. Laparoscopic

splenectomy for idiopathic thrombocytopenic purpura. Am J Surg

2004;187:720-723.

24. Duperier T, Brody F, Felsher J, Walsh RM, Rosen M, Ponsky J. Predictive

factors for successful laparoscopic splenectomy in patients with immune

thrombocytopenic purpura. Arch Surg 2004;139:61-66.

25. Tastaldi L, Krpata DM, Prabhu AS, Petro CC, Haskins IN, Perez AJ, Alkhatib

H, Colturato I, Tu C, Lichtin A, Rosen MJ, Rosenblatt S. Laparoscopic

splenectomy for immune thrombocytopenia (ITP): long-term outcomes of a

modern cohort. Surg Endosc 2019;33:475-485.

26. Thomsen RW, Schoonen WM, Farkas DK, Riis A, Jacobsen J, Fryzek JP, Sørensen

HT. Risk for hospital contact with infection in patients with splenectomy: a

population-based cohort study. Ann Intern Med 2009;151:546-555.

27. Bisharat N, Omari H, Lavi I, Raz R. Risk of infection and death among postsplenectomy

patients. J Infect 2001;43:182-186.

28. Rodeghiero F. A critical appraisal of the evidence for the role of splenectomy

in adults and children with ITP. Br J Haematol 2018;181:183-195.

29. Cheng G, Saleh MN, Marcher C, Vasey S, Mayer B, Aivado M, Arning M,

Stone NL, Bussel JB. Eltrombopag for management of chronic immune

thrombocytopenia (RAISE): a 6-month, randomised, phase 3 study. Lancet

2011;377:393-402.

30. Bussel JB, Provan D, Shamsi T, Cheng G, Psaila B, Kovaleva L, Salama A,

Jenkins JM, Roychowdhury D, Mayer B, Stone N, Arning M. Effect of

eltrombopag on platelet counts and bleeding during treatment of chronic

idiopathic thrombocytopenic purpura: a randomised, double-blind,

placebo-controlled trial. Lancet 2009;373:641-648.

31. Saleh MN, Bussel JB, Cheng G, Meyer O, Bailey CK, Arning M, Brainsky A;

EXTEND Study Group. Safety and efficacy of eltrombopag for treatment of

chronic immune thrombocytopenia: results of the long-term, open-label

EXTEND study. Blood 2013;121:537-545.

32. Mishra K, Pramanik S, Jandial A, Sahu KK, Sandal R, Ahuja A, Yanamandra

U, Kumar R, Kapoor R, Verma T, Sharma S, Singh J, Das S, Chatterjee T,

Sharma A, Nair V. Real-world experience of eltrombopag in immune

thrombocytopenia. Am J Blood Res 2020;10:240-251.

33. González-López TJ, Alvarez-Román MT, Pascual C, Sánchez-González

B, Fernández-Fuentes F, Jarque I, Pérez-Rus G, Pérez-Crespo S, Bernat S,

Hernández-Rivas JA, Andrade MM, Cortés M, Gómez-Nuñez M, Olivera

P, Martínez-Robles V, Fernández-Rodríguez A, Fuertes-Palacio MA,

Fernández-Miñano C, de Cabo E, Fisac R, Aguilar C, Bárez A, Peñarrubia

MJ, García-Frade LJ, González-Porras JR. Eltrombopag safety and efficacy

for primary chronic immune thrombocytopenia in clinical practice. Eur J

Haematol 2016;97:297-302.

34. Wong RSM, Saleh MN, Khelif A, Salama A, Portella MSO, Burgess P, Bussel

JB. Safety and efficacy of long-term treatment of chronic/persistent ITP

with eltrombopag: final results of the EXTEND study. Blood 2017;130:2527-

2536.

35. Özdemirkıran F, Payzın B, Kiper HD, Kabukçu S, Akgün Çağlıyan G, Kahraman

S, Sevindik ÖG, Ceylan C, Kadıköylü G, Şahin F, Keskin A, Arslan Ö, Özcan

MA, Kabukçu G, Görgün G, Bolaman Z, Büyükkeçeci F, Bilgir O, Alacacıoğlu İ,

Vural F, Tombuloğlu M, Gökgöz Z, Saydam G. Eltrombopag for the treatment

of immune thrombocytopenia: the Aegean Region of Turkey experience.

Turk J Hematol 2015;32:323-328.

187

Wang L. et al: Characteristics and Therapy of AML-MRC

RESEARCH ARTICLE

DOI: 10.4274/tjh.galenos.2021.2021.0009


Clinical Characteristics and Optimal Therapy of Acute Myeloid

Leukemia with Myelodysplasia-Related Changes: A Retrospective

Analysis of a Cohort of Chinese Patients

Myelodisplazi İlişkili Değişiklikler Gösteren Akut Myeloid Löseminin Klinik Özellikleri ve

Optimal Tedavisi: Çinli Hastalar Kohortunun Retrospektif Bir Analizi

Lei Wang 1 , Xiaoxia Chu 1 , Jingyao Wang 1 , Licai An 1 , Yinghui Liu 1 , Li Li 2 , Junqing Xu 1

1Qingdao University Medical College, Affiliated Yantai Yuhuangding Hospital, Department of Hematology, Yantai, China

2Linyi Central Hospital, Department of Hematology, Linyi, China

Abstract

Objective: This study aimed to investigate the clinical characteristics

of acute myeloid leukemia with myelodysplasia-related changes (AML-

MRC) according to the 2016 World Health Organization classification

and the preferred therapy for patients with AML-MRC aged 60-75

years.

Materials and Methods: We retrospectively analyzed differences in

clinical data among 190 patients with AML-MRC and 667 patients

with AML not otherwise specified (AML-NOS). We also compared

different therapeutic regimens among patients with AML-MRC aged

60-75 years.

Results: Compared with AML-NOS, patients with AML-MRC had

significantly different clinical characteristics as well as worse

overall survival (OS) (9.2 vs. 13.6 months; p<0.001) and complete

remission rates (65.3% vs. 76.2%; p=0.005). Multivariate analysis

performed for the whole group (patients with both AML-MRC and

AML-NOS) showed that AML-MRC was the independent prognostic

factor (p=0.002). Additional multivariate analysis performed for 190

patients with AML-MRC indicated that age (p<0.001) and lactate

dehydrogenase (p=0.031) were independent prognostic factors.

Compared with the IA/DA regimen [idarubicin and cytarabine (IA) or

daunorubicin and cytarabine (DA)], the DAC+CAG regimen [decitabine

and half-dose CAG regimen (cytarabine, aclarubicin, and granulocyte

colony-stimulating factor)] was associated with better OS (4.5 vs. 6.2

months; p=0.021) in patients aged 60-75 years and categorized into

the unfavorable risk group.

Conclusion: AML-MRC cases exhibited worse clinical outcomes

compared to AML-NOS. Compared to the IA/DA regimen, the

DAC+CAG regimen was the optimal choice for patients with AML-

MRC in the unfavorable risk group and aged 60-75 years.

Keywords: Acute myeloid leukemia with myelodysplasia-related

changes, Clinical characteristics, Therapy

Öz

Amaç: Bu çalışma, 2016 Dünya Sağlık Örgütü sınıflamasına göre

myelodisplazi ilişkili değişiklikler gösteren akut myeloid löseminin

(AML-MRC) klinik özelliklerini ve 60-75 yaş arası AML-MRC

hastalarında tercih edilen tedaviyi araştırmayı amaçlamıştır.

Gereç ve Yöntemler: AML-MRC’li 190 hasta ve başka şekilde

tanımlanmamış AML’li (AML-NOS) 667 hasta arasındaki klinik

farklılıkları geriye dönük olarak analiz ettik. Ayrıca 60-75 yaş arası

AML-MRC’li hastalar arasında farklı terapötik rejimleri karşılaştırdık.

Bulgular: AML-NOS ile karşılaştırıldığında, AML-MRC’li hastalar, daha

kötü genel sağkalım (GS) (9,22’ye karşı 13,6 ay; p<0,001) ve daha

düşük tam remisyon oranları ile (%65,3’e karşı %76,2; p=0,005) önemli

ölçüde farklı klinik özelliklere sahipti. Tüm grup (hem AML-MRC hem de

AML-NOS’li hastalar) için yapılan çok değişkenli analiz, AML-MRC’nin

bağımsız prognostik faktör olduğunu gösterdi (p=0,002). AML-MRC’li

190 hasta için yapılan ek çok değişkenli analiz, yaşın (p<0,001) ve

laktat dehidrogenaz düzeyinin (p=0,031) bağımsız prognostik faktör

olduğunu gösterdi. IA/DA rejimi [idarubisin ve sitarabin (IA) veya

daunorubisin ve sitarabin (DA)] ile karşılaştırıldığında, DAC+CAG

rejimi [desitabin ve yarım doz CAG rejimi (sitarabin, aklarubisin ve

granülosit koloni uyarıcı faktör)] 60-75 yaş arası ve olumsuz risk

grubuna dahil olan hastalarda daha iyi GS ile ilişkili (4,5’e karşı 6,2 ay;

p=0,021) bulundu.

Sonuç: AML-MRC olguları, AML-NOS’ye kıyasla daha kötü klinik

sonuçlar sergilemiştir. IA/DA rejimi ile karşılaştırıldığında, DAC+CAG

rejimi, olumsuz risk grubundaki 60-75 yaş AML-MRC’li hastalar için

optimal seçim olarak bulunmuştur.

Anahtar Sözcükler: Myelodisplazi ilişkili değişiklikler gösteren akut

myeloid lösemi, Klinik özellikler, Tedavi



Address for Correspondence/Yazışma Adresi: Junqing Xu, M.D., Qingdao University Medical College,

Affiliated Yantai Yuhuangding Hospital, Department of Hematology, Yantai, China

Phone : +86-535-18561001682

E-mail : xjq7619@126.com ORCID: orcid.org/0000-0002-5687-6760

Received/Geliş tarihi: January 6, 2021

Accepted/Kabul tarihi: April 29, 2021

188



Introduction

Acute myeloid leukemia with myelodysplasia-related changes

(AML-MRC) is a distinct entity first defined by the World Health

Organization (WHO) in 2008 [1]. The 2016 WHO classification

revised the myelodysplastic syndrome (MDS)-related cytogenetic

abnormalities: del (9q) was removed and patients with mutated

NPM1 or biallelic CEBPA were recategorized as having recurrent

genetic abnormalities [2]. According to recent studies, AML-

MRC has a worse prognosis, including lower complete remission

(CR) rate and shorter overall survival (OS), compared to AML

not otherwise specified (AML-NOS) [3,4,5]. Although the IA/DA

regimen [idarubicin and cytarabine (IA) or daunorubicin and

cytarabine (DA)] and DAC+CAG regimen [decitabine and halfdose

CAG regimen (cytarabine, aclarubicin, and granulocyte

colony-stimulating factor)] have often been chosen for

chemotherapy, no particular therapy has yet been found to

have therapeutic advantages, especially in patients older than

60 years and not eligible for allogeneic hematopoietic stem cell

transplantation (allo-HSCT). We retrospectively investigated 190

patients with AML-MRC admitted to our hospital and compared

those cases with AML-NOS for a better understanding of the

clinical and biological features. We also compared the IA/DA and

DAC+CAG regimens in patients aged 60-75 years to determine

the optimal therapy.


Patients

Our study was performed based on a cohort of 857 patients

admitted to our hospital between August 2010 and September

2019 with complete data regarding baseline characteristics and

treatment outcomes. These patients were reevaluated as having

AML-NOS or AML-MRC according to the 2016 WHO classification

of myeloid neoplasms and acute leukemia [2], strictly excluding

cases of therapy-related myeloid neoplasms and AML with

recurrent genetic abnormalities including mutated NPM1

and biallelic CEBPA. Patients who underwent allo-HSCT were

also excluded. Clinical and laboratory data were searched in

electronic medical records. Follow-up information was obtained

from electronic records or by contacting family members and

was initialized from the day of diagnosis to October 1, 2020,

or the day of death. All subjects provided informed consent in

compliance with the Declaration of Helsinki.

Morphology Analysis

Morphology analyses of 857 patients were confirmed by

at least two morphological experts. Peripheral blood and

bone marrow smears were stained using the Wright-Giemsa

method. Cytochemistry was performed using myeloperoxidase,

non-specific esterase, sodium fluoride inhibition tests, and

periodic acid-Schiff staining. Dyserythropoiesis was confirmed

when there were erythroid precursors showing megaloblastic

nuclei, karyorrhexis, nuclear fragments, or multinucleation.

Dysgranulopoiesis was characterized as polymorphonuclear

neutrophils with agranular or hypogranular cytoplasm or

with hyposegmented nuclei (pseudo-Pelger-Hüet anomaly).

Dysmegakaryopoiesis was defined as micromegakaryocytes

and multiple separated nuclei or monolobed nuclei in

megakaryocytes of all sizes. Patients were categorized as having

AML with multilineage dysplasia (AML-MLD) upon the presence

of dysplasia in ≥50% cells in at least two cell lineages. All cases

fulfilled the 2016 WHO criterion of at least 20% blasts in the

peripheral blood or bone marrow.

Molecular Mutation Analysis

Molecular mutation analyses including CEBPA, NPM1, ASXL1,

RUNX1, and Flt3-ITD were obtained for the whole group.

Before May 2016, this process was performed by polymerase

chain reaction, which was then replaced by high-throughput

sequencing.

Cytogenetic Analysis

Cytogenetic information was obtained for all patients.

Chromosome karyotype detection of bone marrow cells was

performed by short-time culture and G-banding methods.

Patients were categorized into an intermediate risk group or

poor risk group based on cytogenetics and molecular mutation

as outlined by the 2017 European Leukemia Net (ELN) criteria [6].

According to the 2016 WHO criteria [2], when ≥20% peripheral

blood or bone marrow blasts are present and prior therapy has

been excluded, cytogenetic abnormalities sufficient to diagnose

AML-MRC are as follows: 1) complex karyotype; 2) unbalanced

abnormalities of -7/del(7q), del(5q)/t(5q), i(17q)/t(17p), -13/

del(13q), del(11q), del(12p)/t(12p), and idic(X)(q13); 3) balanced

abnormalities of t(11;16), t(3;21), t(1;3), t(2;11), t(5;12), and

t(5;7).

Therapy

According to treatment regimens, patients with AML-MRC aged

60-75 years (n=99) were divided into three groups, including an

IA/DA group (n=43), DAC+CAG group (n=49), and supportive

group (n=7). Patients in the IA/DA group were treated with IA

(idarubicin, 10-12 mg/m 2 , days 1-3; Ara-C, 100-200 mg/m 2 , days

1-7) or DA (daunomycin, 45-60 mg/m 2 , days 1-3; Ara-C, 100-

200 mg/m 2 , days 1-7). Patients in the DAC+CAG group received

decitabine (20 mg/m 2 , days 1-5), aclarubicin (10-14 mg/m 2 , days

4-7), Ara-C (10 mg/m 2 q12h, days 4-10), and granulocyte colonystimulating

factor [5 µg/kg, days 4-10 or day 4 until white blood

cell (WBC) count was more than 30x10 9 /L]. In the supportive

group, patients received hydroxyurea to inhibit the proliferation

of leukemia cells or only supportive care such as transfusions

of blood products when necessary and anti-infection therapy

when patients had symptoms of infection.

189




OS was defined as the time from diagnosis to death or the last

follow-up. Comparison of quantitative data was performed

using the t-test or Mann-Whitney U test. Comparison of

categorical variables was performed by chi-square or Fisher’s

exact tests. Kaplan-Meier methods and log-rank tests were used

for survival analysis based on OS. Cox multivariate analysis was

used to examine the prognostic factors of AML patients and

confirm which of them was the independent factor. Values of

p<0.05 were considered statistically significant. All statistical

calculations were conducted with SPSS 24.0 (IBM Corp.,

Armonk, NY, USA).

Results

Risk Status of the Whole Group

Information on risk status was based on the revised 2017 ELN

criteria [6]. Since patients with mutated NPM1 or biallelic

mutation of CEBPA were recategorized as having recurrent

genetic abnormalities [2], there were no patients assigned to

the favorable risk group. In the whole cohort (n=857), 689

cases (80.4%) were assigned to the intermediate risk group,

accounting for the largest proportion, and the remaining 168

cases (19.6%) were classified into the unfavorable risk group.

As we expected, compared with the unfavorable risk group,

the intermediate risk group had better OS (13.4 vs. 6.8 months;

p<0.001) and CR rates (76.5% vs. 59.5%; p<0.001).

Subclassification of Patients with AML-MRC

Among 857 patients, 190 patients (22.2%) were diagnosed with

AML-MRC according to the 2016 WHO classification [2]. There

were 7 different subclassifications among AML-MRC patients.

Most cases were diagnosed as AML-MRC for meeting only

one criterion: 38 patients (20%) presented solely with MLD,

108 patients (56.8%) showed MDS-related cytogenetics, and

11 patients (5.8%) had prior history of MDS or myelodysplastic

syndrome/myeloproliferative neoplasm (MDS/MPN). Meanwhile,

32 patients (16.8%) met two criteria: 14 (7.4%) of them

had MDS-related cytogenetics and prior history of MDS or

MDS/MPN, 14 (7.4%) showed MLD and MDS-related cytogenetics,

and 4 (2.1%) had MLD and a history of MDS or MDS/MPN. Only

one case (0.5%) had a combination of all three criteria.

Clinical Characteristics of AML-MRC

After comparing 190 patients with AML-MRC and 667 patients

with AML-NOS, we found many differences between these two

groups (Table 1). Patients with AML-MRC had significantly older

age (p<0.001), lower hemoglobin (Hb) (p<0.001), lower WBC

count (p<0.001), and higher male-to-female ratio (p=0.006)

than the AML-NOS group, while no significant differences

were detected in terms of platelet count (p=0.462) and lactate

dehydrogenase (LDH) (p=0.139). As for clinical outcomes,

compared with AML-NOS, AML-MRC patients had significantly

lower CR rates (65.3% vs. 76.2%; p=0.005) and worse OS (9.2 vs.

13.6 months; p<0.001) (Figure 1). Moreover, in the intermediate

risk group, the OS of AML-MRC was still worse than that of

AML-NOS (9.5 vs. 13.9 months; p=0.011).

Univariate Analysis and Multivariate Analysis

Univariate analysis was performed for the whole cohort

of 857 AML patients in terms of age, WBC count, Hb,

platelet count, history of MDS or MDS/MPN, MDS-related

cytogenetic abnormalities, MLD, LDH, and MRC. It was

found that age (p<0.001), WBC count (p<0.001), history

of MDS or MDS/MPN (p=0.009), MDS-related cytogenetic

abnormalities (p<0.001), MLD (p=0.002), LDH (p<0.001), and

MRC (p<0.001) were prognostic factors for OS. Subsequent

multivariate analysis indicated that among these factors age

Table 1. Information of the whole cohort.

Variable AML-NOS AML-MRC p

No. 667 190

Age, years (range) 50 (16-90) 61 (16-87) <0.001

Male-to-female ratio 354:313 (1.13:1) 122:68 (1.79:1) 0.006

Hemoglobin, g/L (range) 81 (22-158) 71 (30-146) <0.001

White blood cell count, x10 9 /L (range) 13.4 (2-720) 7.5 (0.3-375.9) <0.001

Platelet count, x10 9 /L (range) 46 (3-494) 44 (1-458) 0.462

LDH, IU (range) 336 (2-10168) 387 (86-5986) 0.139

Overall survival, months (range) 13.6 (0-173.9) 9.2 (0-116) <0.001

Complete remission rate (%) 457/600 (76.2%) 109/167 (65.3%) 0.005

Risk status

Intermediate 617/667 (92.5%) 72/190 (37.9%) <0.001

Poor 50/667 (7.5%) 118/190 (62.1%) <0.001

AML-NOS: Acute myeloid leukemia not otherwise specified; AML-MRC: acute myeloid leukemia with myelodysplasia-related changes; LDH: lactate dehydrogenase.

190



[hazard ratio (HR)=2.774; p<0.001], LDH (HR=1.788; p<0.001),

and MRC (HR=0.653; p=0.002) were independent prognostic

factors (Table 2).

In 190 patients with AML-MRC, univariate analysis suggested

that LDH (p=0.031) and age (p<0.001) were prognostic factors,

while WBC count, Hb, platelet count, history of MDS or

MDS/MPN, MDS-related cytogenetic abnormalities, and MLD

were not related to prognosis. Multivariate analysis showed that

both age (HR=0.447; p<0.001) and LDH (HR=1.604; p=0.032)

were independent prognostic factors for AML-MRC (Table 3).

Treatment Analysis of Patients with AML-MRC Aged 60-75 Years

There were 99 patients aged 60-75 years with AML-MRC,

who could be categorized as belonging to the intermediate

risk group (n=46) or unfavorable risk group (n=53) based on

the 2017 ELN criteria. We analyzed the efficacy of different

treatment regimens in each group. In the intermediate risk

group, no significant difference was found between the

IA/DA group and DAC+CAG group with respect to CR rate

(60% vs. 63.6%, p=0.808) or OS (6 vs. 6.5 months, p=0.272).

However, in the unfavorable risk group, the OS of the DAC+CAG

group was significantly better than that of the IA/DA group

(6.2 vs. 4.5 months; p=0.021). The CR rate of the DAC+CAG group

was higher than that of the IA/DA group, but the difference was

not statistically significant (59.3% vs. 52.2%; p=0.406).

Discussion

AML-MLD was first proposed in the 2001 WHO classification of

myeloid neoplasms and acute leukemia and was classified as a

separate category [7]. The concept was renamed as “AML-MRC”

in the 2008 WHO classification [1] and myelodysplasia-related

cytogenetic abnormalities as well as prior history of MDS or

MDS/MPN were added as additional criteria for its recognition.

Although the newly revised 2016 WHO classification has

undergone some modifications, AML-MRC still includes these

three categories [2], which were considered associated with

poor prognosis.

We analyzed the clinical features and prognosis of 857 AML

patients including 190 patients with AML-MRC and 667

patients with AML-NOS based on the 2016 WHO classification

of AML [2]. Significant biological differences were found

between AML-NOS and AML-MRC concerning age (p<0.001),

Table 2. Univariate and multivariate analysis for overall survival of 864 AML patients.

Parameter

Univariate

Multivariate

p HR (95% CI) p

Age ≥60 <0.001 2.774 (2.166-3.54) <0.001

White blood cell count <0.001 0.064

Hemoglobin 0.092

Platelet count 0.483

History of MDS or MDS/MPN 0.009 0.481

MDS-related cytogenetic changes <0.001 0.323

Presence of MLD 0.002 0.681

LDH <0.001 1.788 (1.416-2.257) <0.001

AML-MRC <0.001 0.653 (0.51-0.848) 0.002

AML: Acute myeloid leukemia; HR: hazard ratio; CI: confidence interval; MDS: myelodysplastic syndrome; MPN: myeloproliferative neoplasm; MLD: multilineage dysplasia; LDH: lactate

dehydrogenase; AML-MRC: AML with myelodysplasia-related changes.

Table 3. Univariate and multivariate analysis for overall survival of 191 patients with AML-MRC.

Parameter

Univariate

Multivariate

p HR (95% CI) p

Age ≥60 <0.001 0.447 (0.292-0.685) <0.001

White blood cell count 0.21

Hemoglobin 0.426

Platelet count 0.465

History of MDS or MDS/MPN 0.481

MDS-related cytogenetic changes 0.676

Presence of MLD 0.441

LDH 0.031 1.604 (1.041-2.471) 0.032

AML-MRC: Acute myeloid leukemia with myelodysplasia-related changes; HR: hazard ratio; CI: confidence interval; MDS: myelodysplastic syndrome; MPN: myeloproliferative

neoplasm; MLD: multilineage dysplasia; LDH: lactate dehydrogenase.

191



Hb (p<0.001), and WBC count (p<0.001). Compared with

AML-NOS, AML-MRC patients had significantly shorter OS

(9.2 vs. 13.6 months; p<0.001) and CR rates (65.3% vs. 76.2%;

p=0.005), similar to recent studies [3,4,5]. However, Devillier

et al. [8] suggested that the worse prognosis of AML-MRC

was probably due to unfavorable cytogenetics, which were

categorized as MDS-related cytogenetics, because they assessed

the prognosis of AML-NOS and AML-MRC in an intermediate risk

group and found no difference between the groups for OS or

relapse-free survival. On the contrary, Weinberg et al. [4] showed

that AML-MRC patients had worse OS and CR rates even after

excluding patients with unfavorable cytogenetics. To address this

discrepancy, we carried out research similar to that of Devillier

et al. [8] and obtained the opposite result: among patients of the

intermediate risk group, the OS of AML-MRC patients was still

significantly worse than that of AML-NOS (9.5 vs. 13.9 months;

p=0.011). Moreover, our multivariate analysis showed that MRC

was an independent prognostic factor after adjustment by age

and MDS-related cytogenetics, coinciding with the study of

Weinberg et al. [4]. The results described here support the WHO

classification separating these two categories.

As described above, many well-known adverse factors were

observed in cases of AML-MRC, such as older age, unfavorable

cytogenetics, and multidrug-resistant phenotype, which lead to

unsatisfying therapeutic response and survival. Young patients

in good physical condition are offered intensive chemotherapy

followed by allo-HSCT. However, the optimal chemotherapy

regimen for patients older than 60 years who are not eligible

for allo-HCST has always been controversial. The standard 3+7

regimen, IA or DA, is the most common induction therapy,

while the CAG regimen is another common choice and is often

combined with decitabine. However, comparisons of the IA/DA

and DAC+CAG regimens for AML-MRC patients aged 60-75 years

have rarely been reported. In our study, no significant difference

was found between the two regimens (OS: 6 vs. 6.5 months,

p=0.272; CR rate: 60% vs. 63.6%, p=0.808) in the intermediate

risk group (Figure 2). In the poor risk group, however, the OS of

patients treated with the DAC+CAG regimen was significantly

longer than patients on the IA/DA regimen (6.2 vs. 4.5 months;

p=0.021) (Figure 3). Therefore, we suggest that the DAC+CAG

regimen should be the preferred choice for AML-MRC patients

categorized into the poor risk group and aged 60-75 years.

Decitabine, a DNA-hypomethylating agent (HMA), can induce

differentiation and apoptosis of leukemic blasts and activate

Figure 2. Kaplan-Meier survival rates. Overall survival for

IA/DA regimen and DAC+CAG regimen in patients aged

60-75 years with acute myeloid leukemia with myelodysplasiarelated

changes (AML-MRC) in the intermediate risk group.

Figure 1. Kaplan-Meier survival rates. Overall survival for patients

with acute myeloid leukemia with myelodysplasia-related changes

(AML-MRC) and AML not otherwise specified (AML-NOS).

Figure 3. Kaplan-Meier survival rates. Overall survival for

IA/DA regimen and DAC+CAG regimen in patients aged

60-75 years with acute myeloid leukemia with myelodysplasiarelated

changes (AML-MRC) in the unfavorable-risk group.

192



the silenced tumor suppressor gene (TSG) impaired by the

disorder of DNA methylation [9,10,11]. Recent studies have

proved that decitabine is well tolerated and may improve the

response rate and OS in older AML patients when used as a

single agent [12,13]. When combined with other chemotherapy

regimens such as CAG, IA, or HAA (homoharringtonine,

cytarabine, aclarubicin), decitabine could also significantly

enhance the therapeutic efficacy [14,15,16]. In 2016, Welch

et al. [17] enrolled 84 patients with AML or MDS in a singleinstitution

trial of decitabine. The results showed that the

response to DAC was better among patients in the unfavorable

risk group than patients in the intermediate risk/favorable risk

cytogenetic group (67% vs. 34%, p<0.001), although there

was no statistical difference in OS between these two groups

(11.6 vs. 10 months, p=0.29). Similar findings were also reported

by other researchers [18,19,20]. These studies offer a possible

explanation for our result whereby patients in the unfavorable

risk group benefited most from the DAC+CAG regimen. Further

research will be required to determine the core mechanism of

the better efficacy of DAC among patients in the unfavorable

risk group.

Despite the efficacy of conventional chemotherapy, the

survival of AML patients remains unsatisfactory. Over the

decades, efforts made by researchers led to only minor

improvements in the outcome of AML patients until the

presence of several new therapies offered something fresh

in the landscape of AML therapy. CPX-351, a liposomal

formulation of cytarabine and daunorubicin, was approved

by the US Food and Drug Administration in 2017 for the

treatment of newly diagnosed therapy-related AML (tAML)

or AML-MRC based on a phase III clinical trial named

CLTR0310-301 [21]. In this clinical trial, CPX-351 showed

better OS (9.56 vs. 5.85 months, p=0.003), better event-free

survival (2.53 vs. 1.31 months, p=0.021), and higher CR rate

(37.3% vs. 25.6%, p=0.016) compared to the standard 3+7

regimen in patients 60-75 years of age with newly diagnosed

tAML or AML-MRC and it was found to be safe and welltolerated

[22,23,24]. Venetoclax, a selective inhibitor of

the antiapoptotic protein B-cell lymphoma 2 (BCL-2), can

lead to rapid initiation of apoptosis in leukemia cells [25].

When combined with low-dose cytarabine (LDAC) or HMA,

venetoclax demonstrated significant improvement of CR rate

and OS compared with single-agent LDAC or HMA treatment

in AML patients ineligible for intensive chemotherapy, as

proven by several multicenter clinical trials [26,27,28].

Based on these results, current guidelines recommend this

combination as standard therapy for older and unfit patients

[29]. In addition to more research on new therapies, future

efforts should also be focused on reducing therapeutic

toxicities for wider utilization and improving the OS of AML

patients through different therapeutic combinations.

Study Limitations

There are several limitations of our study. All data were collected

in a retrospective manner and the scale of the cohort was small

while analyzing the optimal choice for patients with AML-MRC

aged 60-75 years in the unfavorable risk group.

Conclusion

AML-MRC is associated with worse prognosis compared to

AML-NOS and shows an independent prognostic effect. The

DAC+CAG regimen may be preferred for patients aged 60-75

years who are classified in the unfavorable risk group.

Ethics

Ethics Committee Approval: The study was approved by the

Ethics Committee of Qingdao University Medical College

Affiliated Yantai Yuhuangding Hospital.

Informed Consent: Informed consent was obtained from all

participants included in the study.


Concept: L.W., J.X., X.C.; Design: L.W., J.X., X.C.; Data Collection

or Processing: L.W., J.W., L.A.; Analysis or interpretation: L.W.,

J.X., L.A.; Literature Search: L.W., J.X., J.W., L.A., Y.L., X.C., L.L.;

Writing: L.W., J.X., J.W., L.A., Y.L., X.C., L.L.


authors.

Financial Disclosure: This research was supported by the Natural

Science Foundation of Shandong Province (Nos. ZR2015HL035,

ZR2015HL074), the Beijing Medical Award Foundation

(YJHYXKYJJ-105), Yantai Technology Development Projects (No.

2014WS024), and the Youth Foundation of Yantai Yuhuangding

Hospital (Nos. 201404, 201405).

References

1. Swerdlow S, Campo E, Lee Harris N. WHO Classification of Tumours of

Haematopoietic and Lymphoid Tissues. Lyon, IARC Press, 2008.

2. Daniel AA, Orazi A, Hasserjian R, Thiele J, Borowitz MJ, Beau ML, Bloomfield

CD, Cazzola M, Vardiman JW. The 2016 revision to the World Health

Organization classification of myeloid neoplasms and acute leukemia.

Blood 2016;127:2391-2405.

3. Haferlach T, Schoch C, Löffler H, Gassmann W, Kern W, Schnittger S, Fonatsch

C, Ludwig WD, Wuchter C, Schlegelberger B, Staib P, Reichle A, Kubica U,

Eimermacher H, Balleisen L, Grüneisen A, Haase D, Aul C, Karow J, Lengfelder E,

Wörmann B, Heinecke A, Sauerland MC, Büchner T, Hiddeman W. Morphologic

dysplasia in de novo acute myeloid leukemia (AML) is related to unfavorable

cytogenetics but has no independent prognostic relevance under the conditions

of intensive induction therapy: results of a multiparameter analysis from the

German AML Cooperative Group studies. J Clin Oncol 2003;21:256-265.

4. Weinberg OK, Seetharam M, Ren L, Seo K, Ma L, Merker JD, Gotlib J, Zehnder

JL, Arber DA. Clinical characterization of acute myeloid leukemia with

myelodysplasia-related changes as defined by the 2008 WHO classification

system. Blood 2009;113:1906-1908.

193



5. Yanada M, Suzuki M, Kawashima K, Kiyoi H, Kinoshita T, Emi N, Saito H,

Naoe T. Long-term outcomes for unselected patients with acute myeloid

leukemia categorized according to the World Health Organization

classification: a single center experience. Eur J Haematol 2005;74:418-423.

6. Döhner H, Estey E, Grimwade D, Amadori S, Appelbaum FR, Büchner T,

Dombret H, Ebert BL, Fenaux P, Larson RA, Levine RL, Lo-Coco F, Naoe T,

Niederwieser D, Ossenkoppele GJ, Sanz M, Sierra J, Tallman MS, Tien HF,

Wei AH, Löwenberg B, Bloomfield CD. Diagnosis and management of AML

in adults: 2017 ELN recommendations from an international expert panel.

Blood 2017;129:424-447.

7. Jaffe ES, Harris NL, Stein H. Pathology and Genetics of Tumours of

Haematopoietic and Lymphoid Tissues. World Health Organization

Classification of Tumours. Lyon, IARC Press, 2001.

8. Devillier R, Gelsi-Boyer V, Murati A, Prebet T, Rey J, Etienne A, D’Incan E,

Charbonnier A, Blaise D, Mozziconacci MJ, Vey N. Prognostic significance of

myelodysplasia-related changes according to the WHO classification among

ELN-intermediate-risk AML patients. Am J Hematol 2015;90:E22-24.

9. Döhner H, Weisdorf DJ, Bloomfield CD. Acute myeloid leukemia. N Engl J

Med 2015;373:1136-1152.

10. Christman JK. 5-Azacytidine and 5-aza-2’-deoxycytidine as inhibitors of

DNA methylation: mechanistic studies and their implications for cancer

therapy. Oncogene 2002;21:5483-5495.

11. Oki Y, Aoki E, Issa JP. Decitabine-bedside to bench. Crit Rev Oncol Hematol

2007;61:140-152.

12. Lübbert M, Rüter BH, Claus R, Schmoor C, Schmid M, Germing U, Kuendgen

A, Rethwisch V, Ganser A, Platzbecker U, Galm O, Brugger W, Heil G,

Hackanson B, Deschler B, Döhner K, Hagemeijer A, Wijermans PW, Döhner

H. A multicenter phase II trial of decitabine as first-line treatment for

older patients with acute myeloid leukemia judged unfit for induction

chemotherapy. Haematologica 2012;97:393-401.

13. Kantarjian HM, Thomas XG, Dmoszynska A, Wierzbowska A, Mazur G, Mayer

J, Gau JP, Chou WC, Buckstein R, Cermak J, Kuo CY, Oriol A, Ravandi F, Faderl

S, Delaunay J, Lysák D, Minden M, Arthur C. Multicenter, randomized, openlabel,

phase III trial of decitabine versus patients choice, with physician

advice, of either supportive care or low-dose cytarabine for the treatment

of older patients with newly diagnosed acute myeloid leukemia. J Clin

Oncol 2012;30:2670-2677.

14. Liu F, Wang H, Liu J, Zhou Z, Zheng D, Huang B, Su C, Zou W, Xu D, Tong

X, Li J. A favorable inductive remission rate for decitabine combined with

chemotherapy as a first course in <60-year-old acute myeloid leukemia

patients with myelodysplasia syndrome features. Cancer Med 2019;8:5108-

5115.

15. Scandura JM, Roboz GJ, Moh M, Morawa E, Brenet F, Bose JR, Villegas L,

Gergis US, Mayer SA, Ippoliti CM, Curcio TJ, Ritchie EK, Feldman EJ. Phase

I study of epigenetic priming with decitabine prior to standard induction

chemotherapy for patients with AML. Blood 2011;118:1472-1480.

16. Jiang X, Wang Z, Ding B, Yin C, Zhong Q, Carter BZ, Yu G, Jiang L, Ye J,

Dai M, Zhang Y, Liang S, Zhao Q, Liu Q, Meng F. The hypomethylating

agent decitabine prior to chemotherapy improves the therapy efficacy

in refractory/relapsed acute myeloid leukemia patients. Oncotarget

2015;6:33612-33622.

17. Welch JS, Petti AA, Miller CA, Fronick CC, O’Laughlin M, Fulton RS, Wilson

RK, Baty JD, Duncavage EJ, Tandon B, Lee YS, Wartman LD, Uy GL, Ghobadi

A, Tomasson MH, Pusic I, Romee R, Fehniger TA, Stockerl-Goldstein KE, Vij R,

Oh ST, Abboud CN, Cashen AF, Schroeder MA, Jacoby MA, Heath SE, Luber K,

Janke MR, Hantel A, Khan N, Sukhanova MJ, Knoebel RW, Stock W, Graubert

TA, Walter MJ, Westervelt P, Link DC, DiPersio JF, Ley TJ. TP53 and decitabine

in acute myeloid leukemia and myelodysplastic syndromes. N Engl J Med

2016;375:2023-2036.

18. Ritchie EK, Feldman EJ, Christos PJ, Rohan SD, Lagassa CB, Ippoliti C, Scandura

JM, Carlson K, Roboz GJ. Decitabine in patients with newly diagnosed and

relapsed acute myeloid leukemia. Leuk Lymphoma 2013;54:2003-2007.

19. Blum W, Garzon R, Klisovic RB, Schwind S, Walker A, Geyer S, Liu S,

Havelange V, Becker H, Schaaf L, Mickle J, Devine H, Kefauver C, Devine

SM, Chan KK, Heerema NA, Bloomfield CD, Grever MR, Byrd JC, Villalona-

Calero M, Croce CM, Marcucci G. Clinical response and miR-29b predictive

significance in older AML patients treated with a 10-day schedule of

decitabine. Proc Natl Acad Sci U S A 2010;107:7473-7478.

20. Lübbert M, Suciu S, Hagemeijer A, Rüter B, Platzbecker U, Giagounidis A,

Selleslag D, Labar B, Germing U, Salih HR, Muus P, Pflüger KH, Schaefer

HE, Bogatyreva L, Aul C, de Witte T, Ganser A, Becker H, Huls G, van der

Helm L, Vellenga E, Baron F, Marie JP, Wijermans PW. Decitabine improves

progression-free survival in older high-risk MDS patients with multiple

autosomal monosomies: results of a subgroup analysis of the randomized

phase III study 06011 of the EORTC Leukemia Cooperative Group and

German MDS Study Group. Ann Hematol 2016;95:191-199.

21. Krauss AC, Gao X, Li L, Manning ML, Patel P, Fu W, Janoria KG, Gieser G,

Bateman DA, Przepiorka D, Shen YL, Shord SS, Sheth CM, Banerjee A,

Liu J, Goldberg KB, Farrell AT, Blumenthal GM, Pazdur R. FDA Approval

Summary: (Daunorubicin and cytarabine) liposome for injection for the

treatment of adults with high-risk acute myeloid leukemia. Clin Cancer Res

2019;25:2685-2690.

22. Lancet JE, Cortes JE, Hogge DE, Tallman MS, Kovacsovics TJ, Damon

LE, Komrokji R, Solomon SR, Kolitz JE, Cooper M, Yeager AM, Louie AC,

Feldman EJ. Phase 2 trial of CPX-351, a fixed 5:1 molar ratio of cytarabine/

daunorubicin, vs cytarabine/daunorubicin in older adults with untreated

AML. Blood 2014; 123:3239-3246.

23. Cortes JE, Goldberg SL, Feldman EJ, Rizzeri DA, Hogge DE, Larson M, Pigneux

A, Recher C, Schiller G, Warzocha K, Kantarjian H, Louie AC, Kolitz JE. Phase

II, multicenter, randomized trial of CPX-351 (cytarabine:daunorubicin)

liposome injection versus intensive salvage therapy in adults with first

relapse AML. Cancer 2015;121:234-242.

24. Lancet JE, Uy GL, Cortes JE, Newell LF, Lin TL, Ritchie EK, Stuart RK,

Strickland SA, Hogge D, Solomon SR, Stone RM, Bixby DL, Kolitz JE,

Schiller GJ, Wieduwilt MJ, Ryan DH, Hoering A, Banerjee K, Chiarella M,

Louie AC, Medeiros BC. CPX-351 (cytarabine and daunorubicin) liposome

for injection versus conventional cytarabine plus daunorubicin in older

patients with newly diagnosed secondary acute myeloid leukemia. J Clin

Oncol 2018;36:2684-2692.

25. Lagadinou ED, Sach A, Callahan K, Rossi RM, Neering SJ, Minhajuddin M,

Ashton JM, Pei S, Grose V, O’Dwyer KM, Liesveld JL, Brookes PS, Becker

MW, Jordan CT. BCL-2 inhibition targets oxidative phosphorylation and

selectively eradicates quiescent human leukemia stem cells. Cell Stem Cell

2013;12:329-341.

26. DiNardo CD, Pratz K, Pullarkat V, Jonas BA, Arellano M, Becker PS, Frankfurt

O, Konopleva M, Wei AH, Kantarjian HM, Xu T, Hong WJ, Chyla B, Potluri J,

Pollyea DA, Letai A. Venetoclax combined with decitabine or azacitidine

in treatment-naive, elderly patients with acute myeloid leukemia. Blood

2019;133:7-17.

27. Wei AH, Strickland SA Jr, Hou JZ, Fiedler W, Lin TL, Walter RB, Enjeti A,

Tiong IS, Savona M, Lee S, Chyla B, Popovic R, Salem AH, Agarwal S, Xu T,

Fakouhi KM, Humerickhouse R, Hong WJ, Hayslip J, Roboz GJ. Venetoclax

combined with low-dose cytarabine for previously untreated patients

with acute myeloid leukemia: results from a phase Ib/II study. J Clin Oncol

2019;37:1277-1284.

28. DiNardo CD, Jonas BA, Pullarkat V, Thirman MJ, Garcia JS, Wei AH, Konopleva

M, Döhner H, Letai A, Fenaux P, Koller E, Havelange V, Leber B, Esteve J,

Wang J, Pejsa V, Hájek R, Porkka K, Illés Á, Lavie D, Lemoli RM, Yamamoto K,

Yoon SS, Jang JH, Yeh SP, Turgut M, Hong WJ, Zhou Y, Potluri J, Pratz KW.

Azacitidine and venetoclax in previously untreated acute myeloid leukemia.

N Engl J Med 2020;383:617-629.

29. National Comprehensive Cancer Network. Clinical Practice Guidelines

in Oncology: Acute Myeloid Leukemia. Plymouth Meeting, NCCN, 2020.

Available online at https://www.nccn.org/professionals/ physician_gls/pdf/

aml.pdf.

194

Yılmaz F. et al: Stem Cell Transplantation in PNH Patients

RESEARCH ARTICLE

DOI: 10.4274/tjh.galenos.2021.2021.0105


Hematopoietic Stem Cell Transplantation for Patients with

Paroxysmal Nocturnal Hemoglobinuria with or without Aplastic

Anemia: A Multicenter Turkish Experience

Aplastik Aneminin Eşlik Ettiği ve Etmediği Paroksismal Noktürnal Hemoglobinüri

Hastalarında Hematopoetik Kök Hücre Nakli Deneyimi: Çok Merkezli Türkiye Deneyimi

Fergün Yılmaz 1, *, Nur Soyer 2, *, Güldane Cengiz Seval 3 , Sinem Civriz Bozdağ 3, *, Pervin Topçuoğlu 3 , Ali Ünal 4, *,

Leylagül Kaynar 4 , Gökhan Özgür 5, *, Gülsan Sucak 5 , Hakan Göker 6 , Mustafa Velet 6 , Hakan Özdoğu 7 ,

Mehmet Yılmaz 8, *, Emin Kaya 9, *, Ozan Salim 10, *, Burak Deveci 11 , İhsan Karadoğan 11 , Güray Saydam 2, *,

Fahri Şahin 2, *, Filiz Vural 2, *

1Marmara University Faculty of Medicine, Department of Hematology, İstanbul, Turkey

2Ege University Faculty of Medicine, Department of Hematology, İzmir, Turkey

3Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey

4Erciyes University Faculty of Medicine, Department of Hematology, Ankara, Turkey

5Medical Park Bahçeşehir Hospital, Clinic of Hematology and Transplantation, İstanbul, Turkey

6Hacettepe University Faculty of Medicine, Department of Hematology, Ankara, Turkey

7Başkent University Faculty of Medicine, Adana Bone Marrow Transplantation Center, Department of Hematology, Adana, Turkey

8SANKO University Faculty of Medicine, Department of Hematology, Gaziantep, Turkey

9İnönü University Faculty of Medicine, Department of Hematology, Malatya, Turkey

10Akdeniz University Faculty of Medicine, Department of Hematology, Antalya, Turkey

11İstanbul Gelişim University, Medstar Antalya Hospital Bone Marrow Transplantation Center, Department of Hematology, Antalya, Turkey

*PESG, PNH, and Education Study Group

Abstract

Objective: Although inhibition of the complement system at different

steps is a promising therapy modality in patients with paroxysmal

nocturnal hemoglobinuria (PNH), allogeneic hematopoietic stem cell

transplantation (HCT) is still the only curative therapy, especially for

patients with intractable hemolysis or bone marrow failure. The aim

of this study is to evaluate the outcomes of allogeneic HCT in PNH

patients with aplastic anemia (PNH-AA) or without.

Materials and Methods: Thirty-five PNH/PNH-AA patients who were

treated with allogeneic HCT in 10 transplantation centers in Turkey

were retrospectively analyzed.

Results: Sixteen (45.7%) and 19 (54.3%) patients were diagnosed

with classical PNH and PNH-AA, respectively. The median age of the

patients was 32 (18-51) years. The 2-year overall survival (OS) rate and

rate of graft-versus-host disease-free, failure-free survival (GFFS) was

81.2% and 78.1%, respectively. The 2-year OS in cases of classical PNH

and PNH-AA was 81.3% and 79.9%, respectively (p=0.87), and 2-year

GFFS in cases of PNH and PNH-AA was 79% and 76% (p=0.977),

Öz

Amaç: Paroksismal noktürnal hemoglobunüri (PNH) hastalarının

tedavisinde kompleman sisteminin değişik basamaklardaki inhibisyonu

umut vadedici bir tedavi yöntemidir. Ancak hastalığın belirti ve

bulgularını kontrol etmekte etkin bir tedavi yöntemi olsa da küratif bir

tedavi seçeneği değildir. Özellikle kompleman inhibisyonuna rağmen

devam eden hemolizi, replasman ihtiyacı ve kemik iliği yetmezliği

ile birlikteliği olan hasta grubunda halen tek küratif tedavi seçeneği

allojeneik kök hücre naklidir (KHN). Bu çalışmamızda aplastik anemi

ile birlikteliği olan (PNH-AA) ve olmayan PNH hastalarında yapılmış

allojeneik KHN’nin sonuçlarını değerlendirmeyi amaçladık.

Gereç ve Yöntemler: On ayrı merkezde PNH/PNH-AA tanısı olup

allojeneik KHN yapılan toplam 35 hasta retrospektif olarak tarandı.

Bulgular: On altı (%45,7) PNH ve 19 (%54,3) PNH-AA hastası

çalışmaya dahil edildi. Hastaların ortanca yaşı 32 (18-51) idi.

Hastalardaki sağkalım analizlerine baktığımızda; 2 yıllık genel sağkalım

(GS) ve graft versus host hastalıksız ve graft yetmezliksiz sağkalım

(GFFS) oranları sırasıyla %81,2 ve %78,1 idi. İki yıllık sağkalım PNH



Address for Correspondence/Yazışma Adresi: Fergün Yılmaz, M.D., Marmara University Faculty of Medicine,

Department of Hematology, İstanbul, Turkey

Phone : +90 532 783 90 18

E-mail : fergunaydin@hotmail.com ORCID: orcid.org/0000-0001-5118-6894

Received/Geliş tarihi: February 5, 2021


195



Abstract

without statistical significance. The OS and GFFS rates also did not

differ between transplantations with matched sibling donors (MSDs)

and matched unrelated donors (MUDs).

Conclusion: Allogeneic HCT with MSDs or MUDs is a good option

for selected patients with classical PNH and PNH-AA. In particular,

patients with debilitating and refractory hemolysis and patients with

bone marrow failure might form an excellent group of candidates for

allogeneic HCT.

Keywords: Paroxysmal nocturnal hemoglobinuria, Transplantation,

Allogeneic stem cell transplantation, Aplastic anemia

Öz

ve PNH-AA hastalarında sırasıyla %81,3 ve %79,9 olarak hesaplandı

ve gruplar arasında istatistiksel bir fark tespit edilmedi (p=0,87). Tam

uyumlu akraba donör ve tam uyumlu akraba dışı donör alt grupları

karşılaştırıldığında 2 yıllık OS ve GFFS oranlarında istatistiksel fark

gözlenmedi.

Sonuç: Seçilmiş PNH ve PNH-AA hasta grubunda akraba veya akraba

dışı tam uyumlu donör ile yapılan allojeneik KHN uygun bir seçenektir.

Özellikle refrakter hemolizi ve replasman ihtiyacı devam eden ve

kemik iliği yetmezliği bulguları olan hasta grubunda allojeneik KHN

bir tedavi seçeneği olarak değerlendirilmelidir.

Anahtar Sözcükler: Paroksismal noktürnal hemoglobinuri,

Transplantasyon, Allojeneik kök hücre nakli, Aplastik anemi

Introduction

Paroxysmal nocturnal hemoglobinuria (PNH) is an

acquired clonal disorder characterized by a defect in the

glycosylphosphatidyl-inositol (GPI) anchor protein, which

results in partial or complete absence of GPI-linked proteins.

In particular, the absence of GPI-linked CD55 and CD59

proteins leads to the increased sensitivity of erythrocytes to

complement activation and complement-mediated hemolysis.

The hallmarks of the disease are hemolysis, bone marrow

failure, and increased risk of thromboembolism [1,2].

Eculizumab, a humanized monoclonal antibody that inhibits

the formation of C5a and membrane attack complex, can

control hemolysis effectively [3] and improve quality of life

and survival rates while decreasing the incidence of thrombosis

[3,4]. Although it has changed the fate of the disease, it does

not cure it. Under these circumstances, it is an effective therapy

for classical PNH (cPNH) patients with prominent intravascular

hemolysis; however, its role in PNH with bone marrow failure

is very limited. Furthermore, there is still a group of patients

refractory to anticomplement therapy [5,6]. Considering all the

available therapies, the only curative therapy is still allogeneic

hematopoietic stem cell transplantation (allo-HCT), which is the

effective and preferred therapy, especially in patients with bone

marrow failure.

According to the literature, allo-HCT is generally limited to

patients with incurable hemolysis under anticomplement

therapy and patients with bone marrow failure due to a high

risk of graft-versus-host disease (GVHD), transplant-related

mortality and morbidity, and lack of suitable donors [7,8,9].

In this study, we retrospectively evaluate the efficiency and

safety of allo-HCT in patients with cPNH and PNH with aplastic

anemia (PNH-AA).


Patients

Thirty-five cPNH/PNH-AA patients who were treated with allo-

HCT between October 2005 and April 2019 in 10 transplantation

centers in Turkey were included. PNH was diagnosed by a

flow cytometric method based on the analysis of CD55 and

CD59 expression or by determining GPI-negative clones

(granulocytes/monocytes) using fluorescent aerolysin (FLAER).

cPNH was defined based on obvious hemolysis with abnormal

lactate dehydrogenase (LDH) and other laboratory tests related

to intravascular hemolysis. PNH-AA was defined in patients

with evidence of AA with pancytopenia and related clinical

presentation with a PNH clone with or without prominent

hemolysis [5]. Patients with AA without PNH clones, patients

with primary AA, patients with Fanconi anemia, and secondary

AA cases other than PNH-AA were excluded. The indications for

allo-HCT were incurable hemolysis with ongoing transfusion

requirement and severe/very severe AA.

The study was approved by Ege University’s Ethics Committee

and conducted in accordance with the Declaration of Helsinki.

Transplantation

Human leukocyte antigen (HLA) matching for donor selection

was based on serologic typing for HLA-A, -B, and -C antigens

and on DNA typing for the HLA-DRB1 antigen. HLA-matched

sibling donors (MSDs) were the first choice. When MSDs were

unavailable, HLA-matched unrelated donors (MUDs) were

preferred. Peripheral blood stem cells (PBSCs) were infused for

25 patients and bone marrow grafts were used for 10 patients.

Conditioning Regimen

For 28 patients, a fludarabine-based reduced intensity

chemotherapy (RIC) regimen was given, mainly

cyclophosphamide, fludarabine, and antithymocyte globulin

196



(ATG) or busulfan, fludarabine, and ATG. The patients were

mostly treated with cyclosporine and methotrexate for GVHD

prophylaxis according to the guidelines of the institution. For

7 patients, cyclophosphamide, busulfan and cyclophosphamide,

and fludarabine regimens with or without ATG were used as

myeloablative therapy. Cyclosporine and methotrexate were

mainly used as GVHD prophylaxis. Data on the conditioning

regimens and GVHD prophylaxis are provided in the

Supplementary Table. Regarding the types of ATG, the rabbit

type was used for all patients except 6 of them. The dose for

rabbit ATG was 10-40 mg/kg/day for 2-4 days and the dose for

the horse type was 2.5-5 mg/kg/day for 2-4 days according to

the institutional protocol.

Supportive Therapy

All patients were treated with antibacterial, antiviral, antifungal,

and anti-Pneumocystis jirovecii infection prophylaxis with

fluoroquinolones, acyclovir/valacyclovir, fluconazole, and

trimethoprim/sulfamethoxazole, respectively.

Granulocyte colony-stimulating factor was started as indicated

in the conditioning regimen protocol until myeloid recovery.

Irradiated and leuko-depleted blood products were administered

to maintain hemoglobin and platelet levels according to

the threshold determined by the transplantation center.

Ursodeoxycholic acid and defibrotide were administered for 8

and 3 patients, respectively, for prevention of veno-occlusive

disease.

Definitions

AA severity was defined according to the guidelines published

by Marsh et al. [10]. Neutrophil and platelet engraftment were

defined as an absolute neutrophil count (ANC) of >500/µL on

3 consecutive days and a platelet count of >20000/µL without

transfusion support on 3 consecutive days, respectively. Primary

graft failure was defined as failure to achieve engraftment

28 days after HCT. Secondary graft failure was defined as

the development of ANC of <500/µL after achieving initial

engraftment [11,12]. Acute and chronic GVHD were defined

and graded according to the established guidelines [13,14].

GVHD-free, failure-free survival (GFFS) was reported as survival

without grades 3-4 acute GVHD, moderate to severe chronic

GVHD, or treatment failures, which were determined as death,

primary or secondary graft failure, and relapse. Overall survival

(OS) was defined as the time from transplantation until the time

of death or the last follow-up.


Statistical analyses were performed using SPSS 16 (SPSS

Inc., Chicago, IL, USA). The variables were first assessed by

Kolmogorov-Smirnov/Shapiro-Wilk tests in terms of normal

distribution. The results were provided as mean ± standard

deviation for normally distributed variables and as median

(minumum-maximum) for abnormally distributed parameters.

All p-values were two-tailed and statistical significance was

set at the level of p<0.05. Survival analysis was performed by

log rank test and Kaplan-Meier curves. Values of p<0.05 were

accepted as statistically significant.

Results

Patients

Thirty-five patients (19 male and 16 female) who were treated

with allo-HCT in 10 transplantation centers were enrolled in this

study. The median age at the time of transplantation was 32

years (minumum-maximum: 18-51). The characteristics of the

patients are shown in Table 1.

Sixteen (45.7%) and 19 (54.3%) patients were diagnosed with

cPNH and PNH-AA, respectively. The most common symptom

displayed was fatigue, which was present in 25 (71.4%) patients,

while dark urine was the least common symptom, present in

only 2 (5.7%) patients. Dyspnea, abdominal pain, and jaundice

were not reported in any cases. Six patients (17.1%, 5 patients

with cPNH [31.2%] and 1 patient with PNH-AA [5.2%]) had

a history of thromboembolism before transplantation, and

1 patient had multiple attacks. The sites for embolisms were

the pulmonary vein, hepatic vein, and deep vein of the leg and

upper extremities. No arterial embolisms were documented.

The therapies used before transplantation were steroids (12

patients), cyclosporine (13 patients), ATG (3 patients), growth

factors and erythropoietin (2 patients), androgens (3 patients),

and eculizumab (21 [60%] patients for a median of 24 months;

minumum-maximum: 1-44). The patients were treated with a

median of 2 different classes of therapies (minumum-maximum:

1-5) and the number of patients treated with more than 3

classes of therapies was 7 (20%). Fourteen (40%) patients were

not treated with eculizumab because 9 patients were diagnosed

before the availability of eculizumab in Turkey and 5 patients

mainly presented with signs and symptoms of pancytopenia

rather than hemolysis. Twenty-two patients were transfusiondependent

for both red blood cells and platelets. All patients were

transfused with a median of 24 (minumum-maximum: 4-120)

units of packed red blood cells and the median ferritin level

before transplantation was 561 ng/mL (minumum-maximum:

18-5236). Ferritin values of ≥1500 mg/mL were only reported

for 9 patients. Additionally, 14 patients were transfused with a

median of 24 units (minumum-maximum: 4-74) of apheresis or

pooled platelets. The PRBC dependence did not differ between

patients with cPNH and PNH-AA (p>0.05).

Transplantation

The median time to transplantation was 36 months

(minumum-maximum: 3-240). The median hemoglobin (Hb),

197



leukocyte, neutrophil, platelet, and LDH levels were 6.8 g/dL

(minumum-maximum: 5-9.8), 3360/µL (minumum-maximum:

100-13500), 680/µL (minumum-maximum: 90-13200),

56000/µL (minumum-maximum: 6000-340000), and 882 IU/L

(minumum-maximum: 230-4440), respectively. The median

neutrophil count (1800/µL versus 450/µL, p=0.001), leukocyte

count (4000/µL versus 1700/µL, p=0.004), platelet count

(125000/µL versus 18000/µL, p=0.001), LDH (1144 IU/L versus

310 IU/L, p=0.016), and bone marrow cellularity (60% versus

15%, p<0.0001) were statistically different between patients

with cPNH and PNH-AA. The laboratory parameters and

characteristics of the patients are shown in Table 1.

The median percentages of PNH clone in granulocytes and

monocytes before transplantation were 62.7% (2.6%-97%) and

60% (3.1%-95%), respectively. PNH clone size for granulocytes

was statistically different between cPNH and PNH-AA patients

(90% versus 30%, p=0.04). Allo-HCT was performed with MUDs

and MSDs for 12 and 23 patients, respectively. In the subgroup

analysis of patients with cPNH and PNH-AA, transplantation

from a MSD was much more frequent in patients with cPNH

(p=0.039).

Myeloablative regimens and RIC protocols were used for 7 (20%)

and 28 (80%) patients, respectively. A bone marrow source

was used for 10 patients, and PBSCs were transfused for 25

patients. The median number of stem cells infused was 2.54x10 6

(2.17-3.91x10 6 ) and 7x10 6 (3.39-11.3x10 6 ) CD34+ cells/kg recipient

weight for bone marrow harvesting and PBSCs, respectively.

Platelet and neutrophil engraftments were achieved in 28 (80%)

and 29 (82.8%) cases, and primary graft failure was documented

in 6 (17.1%) cases. Graft failure rates did not differ between

patients with cPNH and PNH-AA. The patients with primary

graft failure died due to refractory disease, pancytopenia, and

sepsis. Secondary graft failure was reported in only 1 patient

who died due to aplastic bone marrow, sepsis, and peripheral

lymphoproliferative disease. The median days to neutrophil

and platelet engraftment were 16 (10-27) and 16 (11-27) days,

respectively. The median days to both neutrophil and platelet

engraftments did not differ between the patients with cPNH

and PNH-AA or patients receiving transplants from MUDs and

MSDs.

Six (17.1%) patients had acute GVHD, including cutaneous in

5 patients, gastrointestinal system in 1 patient, and liver in 1

patient. All cases of acute GVHD were grade 1 or 2. RIC and

cyclosporine/methotrexate regimens were given to all patients

with acute GVHD for conditioning and GVHD prophylaxis,

respectively. There was no reported acute GVHD-related death.

Four patients (11.4%) had mild chronic GVHD, affecting the

eyes (3 patients), liver (2 patients), and skin (1 patient). All

patients with chronic GVHD were treated with RIC protocols as

the conditioning regimen, and 3 of 4 patients received PBSCs.

All patients documented with chronic GVHD were alive at the

last follow-up visit and the GVHD was under control with

immunosuppressive therapy given according to the guidelines

of the center. Presence of chronic or acute GVHD did not differ

between the patients with cPNH and PNH-AA or the patients

with MUDs and MSDs.

Possible and probable fungal pneumonia and CMV reactivation

were both documented in 4 patients. Two of these patients

experienced both CMV activation and possible fungal

pneumonia.

Table 1. Characteristics of the patients.

All patients PNH-AA cPNH

Number of patients 35 (100%) 19 (45.7%) 16 (54.3%)

Gender, male/female 19/16 12/7 7/9

Median age at the time of transplantation, years (range) 32 (18-51) 32 (24-51) 31 (18-48)

Number of patients treated with eculizumab 21 11 10

History of thromboembolism, yes 6 3 3

Laboratory parameters, median (range)

LDH, IU/L

WBC, µL

Hb, g/dL

Neutrophils, µL

PLT, µL

PNH clone before transplantation, %, median (range)

Granulocytes

Monocytes

882 (230-4440)

3360 (100-13500)

6.8 (5-9.8)

680 (90-13200)

56000 (6000-340000)

62.7 (2.6-97)

60 (3.1-95)

310 (230-550)

1700 (100-3400)

6.5 (5.7-9.8)

450 (90-900)

18000 (6000-67000)

30 (2.6-76)

32 (3.1-76)

1144 (400-4440)

4000 (980-13500)

6.8 (5-9.6)

1800 (500-13200)

125000 (19000-340000)

90 (55-97)

86 (50-95)

Bone marrow cellularity (%) 45 (3-100) 15 (3-30) 60 (30-100)

PNH-AA: Paroxysmal nocturnal hemoglobinuria with anaplastic anemia; cPNH: classical paroxysmal nocturnal hemoglobinuria; LDH: lactate dehydrogenase; WBC: white blood cells;

Hb: hemoglobin; PLT: platelets.

198



Survival

The median follow-up duration was 36 months (minumummaximum:

2-156). The PNH clone was detectable in only

4 patients at the last visit. The percentages of the clone in

monocytes were 0.3%, 1%, 1.2%, and 2% and in granulocytes

were 0.2%, 2%, 2%, and 3%. The chimerism levels were 98%,

93%, 96%, and 98%, respectively, at the last visit. All patients

with detectable PNH clones were alive at the last visit and were

transfusion-independent.

Six patients died during the follow-up period. For 5 patients,

graft failure and related pancytopenia and sepsis were the

causes of death; 1 patient with secondary graft failure died

due to peripheral T-cell and lymphoproliferative disease and

sepsis. All patients were treated with RIC protocols, except

1 patient who had a myeloablative conditioning regimen.

Transplantations from MUDs and MSDs were performed for 2

and 3 patients, respectively.

Two-year OS and GFFS were 81.2% and 78.1%, respectively, and

mean OS and GFFS were 126.9±10.4 months and 121.4±12.1

months, respectively. The 2-year OS for cPNH and PNH-AA

was 81.3% and 79.9%, respectively (p=0.87). The 2-year

GFFS for cPNH and PNH-AA was 79% and 76%. There was

no statistical difference between the two groups (p=0.977)

(Figures 1 and 2). In patients receiving transplantations from

MSDs and MUDs, although 2-year OS and GFFS rates were

higher in patients with MSDs, this difference did not reach

statistical significance (2-year OS: 83.3% versus 69% [p=0.44]

for MSDs and MUDs, respectively; GFFS: 83% versus 70.7%

[p=0.62] for MSDs and MUDs, respectively). Although there

was a difference between the groups, this difference did not

reach statistical significance, probably due to the small size of

the cohort.

1-44 months). In the literature, the median follow-up period

before transplantation was 6-28 months [11,12,19,20]. The

median time to transplantation was reported to be as short as

6 months by Liu et al. [11], probably due to the unavailability of

eculizumab in China. In the present study, time to transplantation

was relatively long because patients were treated with different

modalities, including eculizumab. Additionally, searching for a

suitable related or unrelated donor might also increase the time

to transplantation.

Laboratory parameters are summarized in Table 1. The median

neutrophil count, leukocyte count, platelet count, LDH level,

and bone marrow cellularity were statistically different in

patients with cPNH and PNH-AA. Although we did not find a

correlation between survival and laboratory parameters, Bemba

et al. [20] reported better survival rates in patients with ANC of

Figure 1. Overall survival in paroxysmal nocturnal hemoglobinuria

(PNH) patients with or without anaplastic anemia.

cPNH: Classical PNH; PNH-AA: PNH with aplastic anemia.

Discussion

Although anticomplement therapy with eculizumab is very

effective in cPNH patients, refractoriness is a problem.

Furthermore, eculizumab is not an option for patients with

bone marrow failure without obvious hemolysis. Under these

circumstances, allo-HCT is an option for patients with ongoing

hemolysis and PNH-AA.

In this multicenter study, we retrospectively evaluated the allo-

HCT results of 35 patients with cPNH and PNH-AA. The median

age at the time of transplantation was 32 and the oldest patient

was 51 years of age. In the literature, the median ages of patients

were generally in the range of 24.5-37 years, but a patient

as old as 60 years was transplanted [11,12,15,16,17,18]. The

median time to transplantation was 36 months in our cohort,

and patients received different therapies, including eculizumab

(21 patients with a median of 24 months; minumum-maximum:

Figure 2. Graft-versus-host disease-free, failure-free survival in

paroxysmal nocturnal hemoglobinuria (PNH) patients with or

without anaplastic anemia.

cPNH: Classical PNH; PNH-AA: PNH with aplastic anemia.

199



>1000/µL and hemoglobin of >9 g/dL at transplantation;

however, this finding was not confirmed by other studies.

The median PNH clone size for granulocytes in cPNH cases

was higher than in PNH-AA (90% in cPNH versus 30% in

PNH-AA [p=0.04]), which was compatible with the literature

[12]. Neither our study nor other studies have documented a

survival benefit related to PNH clone size.

Primary engraftment failure was reported in 6 (17.1%) patients

and secondary failure was observed in only 1 patient. The

Supplementary Table. Transplant data of the patients.

Patient

no.

Sex

Diagnosis: cPNH,

PNH-AA

HLA

disparity

median time to neutrophil and platelet engraftment was 16

(10-27) and 16 (11-27) days, respectively. The primary graft

failure rate was higher in our study, mainly due to differences in

definitions. In the study conducted by Liu et al. [11], there was

no reported primary graft failure; however, the range of time

to platelet engraftment was up to 75 days, and there were 3

patients (6.82%) with delayed platelet engraftment. The median

time to neutrophil and platelet engraftment in our cohort was

within the range reported in the literature (13-20.5 days for

neutrophils and 12-27 for platelets) [15,16,18,21].

MSD or MUD Stem cell source Conditioning regimen

(RIC or myeloablative regimen)

1 Male PNH-AA 10/10 MSD Bone marrow RIC

2 Female cPNH 10/10 MSD Peripheral blood RIC

3 Female PNH-AA 10/10 MSD Peripheral blood RIC



6 Male cPNH 10/10 MSD Peripheral blood RIC


8 Male cPNH 10/10 MUD Peripheral blood Myeloablative

9 Male PNH-AA 10/10 MUD Peripheral blood RIC






15 Male cPNH 10/10 MSD Bone marrow RIC

16 Female cPNH 10/10 MUD Peripheral blood Myeloablative




20 Female cPNH 10/10 MSD Bone marrow RIC


22 Female cPNH 10/10 MSD Bone marrow RIC

23 Male PNH-AA 9/10 MUD Peripheral blood Myeloablative




27 Female PNH-AA 9/10 MUD Peripheral blood Myeloablative

28 Female PNH-AA 9/10 MUD Peripheral blood Myeloablative

29 Female cPNH 10/10 MUD Peripheral blood Myeloablative


31 Male PNH-AA 10/10 MSD Bone marrow Myeloablative

32 Male PNH-AA 10/10 MSD Peripheral blood RIC


34 Female PNH-AA 10/10 MSD Bone marrow RIC


Busulfan2: Reduced dose busulfan in Ric regimen according to protocol of the institution.

aGVHD: Acute graft-versus-host disease; cGVHD: chronic graft-versus-host disease; cPNH: classical paroxysmal nocturnal hemoglobinuria;

CSA: cyclosporin; MMF: mycophenolate mofetil; MSD: matched sibling donor; Mtx: methotrexate; MUD: matched unrelated donor; PNH-AA:

paroxysmal nocturnal hemoglobinuria with aplastic anemia; RIC: reduced intensity chemotherapy.

200



In our study, the rates of 2-year OS and GFFS were 81.2%

and 78.1%, respectively, and the mean OS and GFFS were

126.9±10.4 months and 121.4±12.1 months, respectively.

Recently, a study by Pantin et al. [16] analyzed the long-term

outcome of fludarabine-based RIC allo-HCT in 17 patients with

cPNH and PNH-AA. The conditioning and GVHD prophylaxis

regimens were similar to those of our study. With a followup

of a median of nearly 6 years, 87.8% patients survived.

The survivors were transfusion-independent and there was no

evidence of PNH [16]. Another retrospective study evaluating

RIC regimens in 33 PNH patients with or without AA also

demonstrated excellent survival rates. At a median followup

of 57.0 months (minumum-maximum: 6.0-151.3), the

estimated OS was 87.9±5.7% [12]. The low transfusion rates

and transplantation with the RIC regimen were probably

related to the higher survival rates.

Beside these studies, data from previous studies also revealed

poor survival rates with allo-HCT [19,20]. Saso et al. [19]

revealed the results of allo-HCT performed between 1978 and

Conditioning regimen GVHD prophylaxis aGVHD

(yes/no)

cGVHD

(yes/no)

Secondary

graft failure

Survival status

at the last visit

Cyclophosphamide + fludarabine + ATG CSA-MMF No No No Alive

Cyclophosphamide + fludarabine + ATG CSA-MMF No No No Alive

Cyclophosphamide + fludarabine + ATG Mtx No No No Alive



Busulfan2 + fludarabine + ATG Mtx No No No Dead

Busulfan2 + cyclophosphamide + ATG CSA + Mtx No No No Alive

Cyclophosphamide + fludarabine + ATG CSA + Mtx No No No Alive

Cyclophosphamide + fludarabine + ATG CSA + Mtx No Yes No Alive

Cyclophosphamide + fludarabine + ATG CSA + Mtx Yes No No Dead


Melphalan + fludarabine + ATG CSA + Mtx No No No Alive

Cyclophosphamide + fludarabine + ATG CSA + Mtx Yes Yes No Alive

Cyclophosphamide + fludarabine + ATG CSA No No No Alive

Cyclophosphamide + fludarabine + ATG CSA Yes No No Alive

Busulfan + cyclophosphamide + ATG CSA + Mtx No No No Alive





Busulfan2 + cyclophosphamide + ATG CSA + Mtx No No Yes Dead


Busulfan + cyclophosphamide CSA + Mtx Yes No No Dead

Cyclophosphamide + fludarabine + ATG CSA + Mtx No No No Dead

Cyclophosphamide + fludarabine + ATG CSA + Mtx Yes No No Alive


Busulfan + cyclophosphamide CSA + Mtx Yes No No Alive

Cyclophosphamide + fludarabine + ATG CSA + Mtx No No No Dead




Fludarabine + ATG CSA + Mtx No No No Alive




201



1995. In this study, the 2-year probability of survival was as

low as 56%, and transplantation could restore normal marrow

function in only about 50% of patients. However, in this study,

there were several factors that might have been related to

the lower survival rates. First of all, the patients were heavily

transfused, and platelet refractoriness was documented in more

than 20% of cases. Secondly, myeloablative regimens were

mostly used, and the rates of acute and chronic GVHD (34%

and 33%, respectively) were high. These characteristics of the

patients might be related to lower survival rates compared to

the results in our study.

Considering the rarity of this disease and other treatment

options, although prospective randomized studies are lacking in

the literature, the safety and efficiency of RIC regimens were

demonstrated in small series [17,22]. By integrating RIC regimens

with allo-HCT for PNH patients, the mortality and morbidity

rates have been reduced, obviating the need for more potentially

toxic myeloablative therapies [16,23].

In our cohort, only 4 of the patients had a detectable PNH

clone in a range of 0.2%-3%. All patients with detectable

clones were transfusion-independent. In 88.5% of the

patients, the PNH clone was undetectable at the last followup.

PNH clone negativity was also high after allo-HCT in other

studies [16,18].

When we performed a subgroup analysis including cPNH and

PNH-AA, the rates of 2-year OS (81.3% in cPNH and 79.9% in

PNH-AA, p=0.87) and GFFS (79% in cPNH and 76% in PNH-AA,

p=0.977) were not statistically different. Similar to our results,

Liu et al. [11] reported that 3-year OS and GFFS were 90.4% and

85.6%, respectively, without showing a statistical difference.

Although GFFS tended to be better for cPNH patients in both

our study and the study by Liu et al. [11], this difference did not

reach statistical significance.

In addition, we did not discover a statistically significant

difference between transplantation from MUDs or MSDs.

Although data from previous studies reported that MUD

allografts might result in high mortality rates [19], other

studies documented successful transplantation results with

MUD allografts [24,25,26]. In patients without suitable

sibling donors, unrelated donors can be a particularly good

option.

In terms of GVHD, we documented acute GVHD and chronic

GVHD in 17.1% and 11.4% of the patients, respectively. Thus,

we have reported relatively low GVHD rates. This might be

due to several reasons. First of all, this was a retrospective

study and loss of data is one of the major limitations in

retrospective studies. Secondly, a regimen including ATG

was used for all patients except 2 of them. It is well known

that regimens with ATG are associated with low GVHD rates.

Another reason for low GVHD might be the wide range of

follow-up time. Although the median follow-up duration

was 36 months, the range was between 2 and 156 months.

Patients with short follow-up periods might decrease

the overall GVHD rate. A very recent study including PNH

patients with allogeneic transplantation reported the rate of

acute GVHD at 100 days as 21%. The cumulative incidence

of extensive chronic GVHD at 2 years was 17% [27]. The

Polish Adult Leukemia Group also reported acute GVHD and

cumulative 1-year incidence of extensive chronic GVHD as

23% and 10.8%, respectively [28].

Study Limitations

Our study had some limitations. First of all, it was a

retrospective study; therefore, missing data and loss of followup

visits constituted a problem. Although it was a multicenter

study including a relatively large cohort, it only included

matched related and unrelated donors. There were no data

for haploidentical transplantation in PNH patients. In spite of

these limitations, this is the first multicenter study to report

allo-HCT results from Turkey; considering the rarity of this

disease, our study included a relatively large cohort with 35

patients.

Conclusion

Allo-HCT with MSDs and MUDs is a good option for selected

patients with cPNH and PNH-AA. Patients with debilitating and

refractory hemolysis and patients with bone marrow failure

might form a particularly excellent group of candidates for

allo-HCT. In the era of complement inhibitors, identifying the

patients who will benefit from allo-HCT is a very important

issue. Even though allo-HCT is the only curative therapy, its

mortality and morbidity rates remain an issue. Although there

are still unanswered questions, allo-HCT is an option for selected

patients with PNH.

Ethics

Ethics Committee Approval: The study was approved by Ege

University’s Ethics Committee and conducted in accordance

with the Declaration of Helsinki.


Concept: F.Y., N.S., G.C.S., S.C.B., P.T., A.Ü., L.K., G.Ö., G.S., H.G.,

M.V., H.Ö., M.Y., E.K., O.S.,B.D., İ.K., G.Sa., F.Ş., F.V.; Design: F.Y., N.S.,

G.C.S., S.C.B., P.T., A.Ü., L.K., G.Ö., G.S., H.G., M.V., H.Ö., M.Y., E.K.,

O.S., B.D., İ.K., G.Sa., F.Ş., F.V.; Analysis or Interpretation: F.Y., N.S.,

G.C.S., S.C.B., P.T., A.Ü., L.K., G.Ö., G.S., H.G., M.V., H.Ö., M.Y., E.K.,

O.S.,B.D., İ.K., G.Sa., F.Ş., F.V.; Literature Search: F.Y., N.S., G.C.S.,

S.C.B., P.T., A.Ü., L.K., G.Ö., G.S., H.G., M.V., H.Ö., M.Y., E.K., O.S.,B.D.,

İ.K., G.Sa., F.Ş., F.V.; Writing: F.Y., N.S., G.C.S., S.C.B., P.T., A.Ü., L.K.,

G.Ö., G.S., H.G., M.V., H.Ö., M.Y., E.K., O.S.,B.D., İ.K., G.Sa., F.Ş., F.V.

202




authors.



References

1. Takeda J, Miyata T, Kawagoe K, Iida Y, Endo Y, Fujita T, Takahashi M, Kitani T,

Kinoshita T. Deficiency of the GPI anchor caused by a somatic mutation of

the PIG-A gene in paroxysmal nocturnal hemoglobinuria. Cell 1993;73:703-

711.

2. Rosse WF. Paroxysmal nocturnal hemoglobinuria as a molecular disease.

Medicine (Baltimore) 1997;76:63-93.

3. Fontbrune FS, Latour RP. Ten years of clinical experience with eculizumab

in patients with paroxysmal nocturnal hemoglobinuria. Semin Hematol

2018;55:124-129.

4. Hill A, DeZern AE, Kinoshita T, Brodsky RA. Paroxysmal nocturnal

haemoglobinuria. Nat Rev Dis Primers 2017;18:17028.

5. Parker CJ. Update on the diagnosis and management of paroxysmal

nocturnal hemoglobinuria. Hematology Am Soc Hematol Educ Program

2016;2016:208-216.

6. Parker C. Eculizumab for paroxysmal nocturnal haemoglobinuria. Lancet

2009;373:759-767.

7. Brodsky RA. Paroxysmal nocturnal hemoglobinuria. Blood 2014;124:2804-2811.

8. Peffault de Latour R, Schrezenmeier H, Bacigalupo A, Blaise D, de Souza CA,

Vigouroux S, Willemze R. Allogeneic stem cell transplantation in paroxysmal

nocturnal hemoglobinuria. Haematologica 2012;97:1666-1673.

9. Brodsky RA. Stem cell transplantation for paroxysmal nocturnal

hemoglobinuria. Haematologica 2010;95:855-856.

10. Marsh JC, Ball SE, Cavenagh J, Darbyshire P, Dokal I, Gordon-Smith EC,

Keidan J, Laurie A, Martin A, Mercieca J, Killick SB, Stewart R, Yin JA; British

Committee for Standards in Haematology. Guidelines for the diagnosis and

management of aplastic anaemia. Br J Haematol 2009;147:43-70.

11. Liu L, Liu S, Zhang Y, Zhou H, Wang Q, Tian H, Chen F, Qiu H, Tang X, Han Y,

Fu C, Jin Z, Chen S, Sun A, Miao M, Wu D. Excellent outcomes of allogeneic

haematopoietic stem cell transplantation in 44 patients with paroxysmal

nocturnal haemoglobinuria: a single-centre study. Biol Blood Marrow

Transplant 2019;25:1544-1549.

12. Lee SE, Park SS, Jeon YW, Yoon JH, Cho BS, Eom KS, Kim YJ, Lee S, Min CK,

Kim HJ, Cho SG, Kim DW, Min WS, Lee JW. Outcomes of allogeneic stem

cell transplantation in patients with paroxysmal nocturnal hemoglobinuria

with or without aplastic anemia. Eur J Haematol 2017;99:336-343.

13. Przepiorka D, Weisdorf D, Martin P, Klingemann HG, Beatty P, Hows J,

Thomas ED. Consensus conference on acute GVHD grading. Bone Marrow

Transplant 1995;15:825-828.

14. Filipovich AH, Weisdorf D, Pavletic S, Socie G, Wingard JR, Lee SJ, Martin P,

Chien J, Przepiorka D, Couriel D, Cowen EW, Dinndorf P, Farrell A, Hartzman

R, Henslee-Downey J, Jacobsohn D, McDonald G, Mittleman B, Rizzo JD,

Robinson M, Schubert M, Schultz K, Shulman H, Turner M, Vogelsang

G, Flowers ME. National Institutes of Health Consensus Development

Project on criteria for clinical trials in chronic graft-versus-host disease: I.

Diagnosis and staging working group report. Biol Blood Marrow Transplant

2005;11:945-956.

15. Santarone S, Bacigalupo A, Risitano AM, Tagliaferri E, Di Bartolomeo E,

Iori AP, Rambaldi A, Angelucci E, Spagnoli A, Papineschi F, Tamiazzo S, Di

Nicola M, Di Bartolomeo P. Hematopoietic stem cell transplantation for

paroxysmal nocturnal hemoglobinuria: long-term results of a retrospective

study on behalf of the Gruppo Italiano Trapianto Midollo Osseo (GITMO).

Haematologica 2010;95:983-988.

16. Pantin J, Tian X, Geller N, Ramos C, Cook L, Cho E, Scheinberg P, Vasu S,

Khuu H, Stroncek D, Barrett J, Young NS, Donohue T, Childs RW. Long-term

outcome of fludarabine-based reduced-intensity allogeneic hematopoietic

cell transplantation for debilitating paroxysmal nocturnal hemoglobinuria.

Biol Blood Marrow Transplant 2014;20:1435-1439.

17. Schcolnik-Cabrera A, Labastida-Mercado N, Galindo-Becerra LS, Gomez-

Almaguer D, Herrera-Rojas MA, Ruiz-Delgado GJ, Ruiz-Arguelles GJ.

Reduced-intensity stem cell allografting for PNH patients in the eculizumab

era: the Mexican experience. Hematology 2015;20:263-266.

18. DeZern AE, Jones RJ, Brodsky RA. Eculizumab bridging before bone

marrow transplant for marrow failure disorders is safe and does not limit

engraftment. Biol Blood Marrow Transplant 2018;24:e26-e30.

19. Saso R, Marsh J, Cevreska L, Szer J, Gale RP, Rowlings PA, Passweg JR, Nugent

ML, Luzzatto L, Horowitz MM, Gordon-Smith EC. Bone marrow transplants for

paroxysmal nocturnal haemoglobinuria. Br J Haematol 1999;104:392-396.

20. Bemba M, Guardiola P, Garderet L, Devergie A, Ribaud P, Esperou H, Noguera

MH, Gluckman E, Socié G. Bone marrow transplantation for paroxysmal

nocturnal haemoglobinuria. Br J Haematol 1999;105:366-368.

21. Vallet N, de Fontbrune FS, Loschi M, Desmier D, Villate A, Barraco F,

Chevallier P, Terriou L, Yakoub-Agha I, Ruggeri A, Mohty M, Maillard N,

Rohrlich PS, Ceballos P, Nguyen S, Poiré X, Guillerm G, Tabrizi R, Farhi J,

Devillier R, Rubio MT, Socié G, de Latour RP; Société Francophone de Greffe

de Moelle et Thérapie Cellulaire. Hematopoietic stem cell transplantation

for patients with paroxysmal nocturnal hemoglobinuria previously treated

with eculizumab: a retrospective study of 21 patients from SFGM-TC

centers. Haematologica 2018;103:e103-e105.

22. Hegenbart U, Niederwieser D, Forman S, Holler E, Leiblein S, Johnston

L, Pönisch W, Epner E, Witherspoon R, Blume K, Storb R. Hematopoietic

cell transplantation from related and unrelated donors after minimal

conditioning as a curative treatment modality for severe paroxysmal

nocturnal hemoglobinuria. Biol Blood Marrow Transplant 2003;9:689-697

23. Srinivasan R, Takahashi Y, McCoy JP, Espinoza-Delgado I, Dorrance C, Igarashi

T, Lundqvist A, Barrett AJ, Young NS, Geller N, Childs RW. Overcoming graft

rejection in heavily transfused and allo-immunised patients with bone

marrow failure syndromes using fludarabine-based haematopoietic cell

transplantation. Br J Haematol 2006;133:305-314. .

24. Flotho C, Strahm B, Kontny U, Duffner U, Peters AM, Dupuis W, Niemeyer

CM. Stem cell transplantation for paroxysmal nocturnal haemoglobinuria in

childhood. Br J Haematol 2002;118:124-127.

25. Woodard P, Wang W, Pitts N, Benaim E, Horwitz E, Cunningham J, Bowman

L. Successful unrelated donor bone marrow transplantation for paroxysmal

nocturnal hemoglobinuria. Bone Marrow Transplant 2001;27:589-592

26. Matos-Fernandez NA, Abou Mourad YR, Caceres W, Kharfan-Dabaja MA. Current

status of allogeneic hematopoietic stem cell transplantation for paroxysmal

nocturnal hemoglobinuria. Biol Blood Marrow Transplant 2009;15:656-661.

27. Nakamura Y, Takenaka K, Yamazaki H, Onishi Y, Ozawa Y, Ikegame K,

Matsuoka KI, Toubai T, Ueda Y, Kanda Y, Ichinohe T, Atsuta Y, Mori T. Outcome

of allogeneic hematopoietic stem cell transplantation in adult patients with

paroxysmal nocturnal hemoglobinuria. Int J Hematol 2021;113:122-127.

28. Markiewicz M, Drozd-Sokolowska J, Biecek P, Dzierzak-Mietla M,

Boguradzki P, Staniak M, Piatkowska-Jakubas B, Piekarska A, Tormanowska

M, Halaburda K, Ussowicz M, Waszczuk-Gajda A, Basak G, Bołkun L, Rybka

J, Sadus-Wojciechowska M, Giebel S, Szmigielska-Kaplon A, Mendek-

Czajkowska E, Warzybok K, Burdacki A, Dwilewicz-Trojaczek J. Allogeneic

hematopoietic stem cell transplantation for paroxysmal nocturnal

hemoglobinuria: multicenter analysis by the Polish Adult Leukemia Group.

Biol Blood Marrow Transplant 2020;26:1833-1839.

203

Demiroğlu H. et al: Prediction of Stem Cell Mobilization Failure in Patients with Hodgkin and Non-Hodgkin Lymphoma

RESEARCH ARTICLE

DOI: 10.4274/tjh.galenos.2020.2020.0409


Prediction of Stem Cell Mobilization Failure in Patients with

Hodgkin and Non-Hodgkin Lymphoma

Hodgkin ve Non-Hodgkin Lenfomalı Hastalarda Kök Hücre Mobilizasyon Başarısızlığının

Öngörüsü

Haluk Demiroğlu, Rafiye Çiftçiler, Yahya Büyükaşık, Hakan Göker

Hacettepe University Faculty of Medicine, Departments of Hematology, Ankara, Turkey

Abstract

Objective: Autologous stem cell transplantation (ASCT) is a significant

and potentially curative treatment modality for patients with

relapsed/refractory lymphoma. Insufficient mobilization and harvest

of peripheral stem cells can be a major obstacle for performing ASCT.

The aim of this study was to evaluate the factors that might influence

mobilization failure in patients with lymphoma.

Materials and Methods: Eighty-seven patients diagnosed with

non-Hodgkin and Hodgkin lymphoma who underwent stem cell

mobilization afterwards at the Hacettepe University Medical School

Bone Marrow Transplantation Center, Turkey, between the years of

2000 and 2018 were evaluated.

Results: A total of 87 patients were included in this study. In 66 of 87

patients (75.9%), the first mobilization trial was successful. Adequate

(≥2x106/kg) CD34+ cells were collected in the first apheresis for 66

patients (9.5±8.1). For 21 of 87 (24.1%), the first mobilization trial was

unsuccessful. Therefore, a second mobilization trial was performed for

these patients with plerixafor (5.5±3.3). The number of CD34+ cells

was significantly higher in patients who were successful in the first

mobilization (p=0.002).

Conclusion: The success rate of the first mobilization trial was found

to be higher in patients with high platelet counts before mobilization

and patients who received chemotherapy-based mobilization

protocols. In the patients who had mobilization failure in the first

trial, plerixafor was used in a later mobilization, and those patients

had an adequate amount of stem cells for ASCT. Parameters predicting

mobilization failure would allow for preemptive, more cost-effective

use of such agents during the first mobilization attempt; however, risk

factors for mobilization failure are still not clear.

Keywords: Hodgkin lymphoma, Non-Hodgkin lymphoma, Stem cell

mobilization, Mobilization failure

Öz

Amaç: Otolog kök hücre transplantasyonu (OKHT), relaps/refrakter

lenfoma hastaları için önemli ve potansiyel olarak küratif bir

tedavi yöntemidir. Yetersiz mobilizasyon ve periferik kök hücrelerin

toplanması OKHT’nin gerçekleştirilmesi için büyük bir engel olabilir.

Bu çalışmanın amacı lenfoma hastalarında mobilizasyon başarısızlığını

etkileyebilecek faktörleri değerlendirmektir.

Gereç ve Yöntemler: Hacettepe Üniversitesi Tıp Fakültesi Kemik İliği

Nakil Merkezi’nde 2000-2018 yılları arasında Hodgkin ve non-Hodgkin

lenfoma tanısı alan ve sonrasında kök hücre mobilizasyonu yapılan 87

hasta değerlendirildi.

Bulgular: Bu çalışmaya toplam 87 hasta dahil edildi. Seksen yedi

hastanın 66’sında (%75,9) ilk mobilizasyon denemesi başarılı oldu.

66 hastada (9,5±8,1) ilk aferezde yeterli (≥2x106/kg) CD34+ hücre

toplandı. Seksen yedi kişiden 21’i (%24,1) için ilk mobilizasyon

denemesi başarısız oldu. Bu nedenle bu hastalara pleriksafor ile

(5,5±3,3) ikinci bir mobilizasyon denemesi yapıldı. İlk mobilizasyonda

başarılı olan hastalarda CD34+ hücre sayısı anlamlı olarak yüksekti

(p=0,002).

Sonuç: Mobilizasyon öncesi trombosit sayısı yüksek olan hastalarda

ve kemoterapi bazlı mobilizasyon protokolleri alan hastalarda ilk

mobilizasyon denemesinin başarı oranı daha yüksek bulundu. İlk

denemede mobilizasyon başarısızlığı olan hastalarda daha sonraki

mobilizasyonda pleriksafor kullanılmış ve bu hastalarda OKHT için

yeterli miktarda kök hücre mevcuttu. Mobilizasyon başarısızlığını

öngören parametreler, ilk mobilizasyon girişimi sırasında bu tür

ajanların önleyici, daha uygun maliyetli kullanımına izin verecektir;

ancak, mobilizasyon başarısızlığı için risk faktörleri hala net değildir.

Anahtar Sözcükler: Hodgkin lymphoma, Non-Hodgkin lymphoma,

Kök hücre mobilizasyonu, Mobilizasyon başarısızlığı



Address for Correspondence/Yazışma Adresi: Hakan Göker, M.D., Hacettepe University Faculty of Medicine,

Departments of Hematology, Ankara, Turkey

Phone : +90 312 305 30 50

E-mail : hgoker1@gmail.com ORCID: orcid.org/0000-0002-1039-7756

Received/Geliş tarihi: July 16, 2020

Accepted/Kabul tarihi: November 4, 2020

204



Introduction

Autologous stem cell transplantation (ASCT) is a significant

and potentially curative treatment modality for patients with

relapsed/refractory lymphoma. However, 5%-40% of lymphoma

patients fail to mobilize sufficient peripheral blood stem cells

and thus cannot undergo ASCT, which is known to improve

survival [1]. Hematopoietic stem cells generally circulate in very

small numbers in the peripheral blood and have to be mobilized

into the circulation prior to being collected by apheresis.

Peripheral blood stem cell (PBSC) mobilization is accomplished

by administration of granulocyte colony-stimulating factor

(G-CSF) alone or in combination with chemotherapy [2].

Peripheral blood has been shown to be superior to bone marrow

as a source of hematopoietic stem cells for ASCT [3]. Insufficient

mobilization and harvest of peripheral stem cells can be a

major obstacle for performing ASCT. Currently, a minimum of

2x10 6 CD34+ cells/kg hematopoietic stem cells is considered

appropriate in most centers to proceed to ASCT. This threshold

is necessary for a rapid and sustained blood count recovery and

for reduced hospitalization, blood product usage, and infections

[4]. However, the optimal hematopoietic stem cell dose is about

5x10 6 /kg [5]. Bone marrow infiltration, advanced age, number

of prior cytotoxic therapies, and myelodysplastic changes

are the best defined factors associated with increased risk of

mobilization failure [6,7].

We have collected and analyzed data from a series of non-

Hodgkin and Hodgkin lymphoma patients who received ASCT

in order to determine the frequency of harvest failure and

to identify factors influencing PBSC mobilization outcomes.

The aim of this study was to evaluate the factors that might

influence mobilization failure in patients with lymphoma.


Study Design and Data Collection

This study was performed in a retrospective manner.

Demographic data of the patients, treatment regimens, and

stem cell mobilization data updates were obtained from the

hospital database. As a result of the application standards of

the hospitals of the Hacettepe University Medical School Bone

Marrow Transplantation Center, Turkey, it has been recognized

from the patient records that all of the studied patients had given

informed consent at the time of hospitalization and before the

administration of chemotherapy and other relevant diagnostic/

therapeutic standards of care. Patients gave informed consent

for procedures in accordance with the Declaration of Helsinki.

Patients and Disease Characteristics

Eighty-seven patients diagnosed with non-Hodgkin and Hodgkin

lymphoma who underwent stem cell mobilization afterwards

at the Hacettepe University Medical School Bone Marrow

Transplantation Center between the years of 2000 and 2018

were evaluated. The key inclusion criteria were patients ≥18

years of age diagnosed with non-Hodgkin or Hodgkin lymphoma

who required systemic chemotherapy and underwent ASCT

with Eastern Cooperative Oncology Group (ECOG) performance

status (PS) of <2 [8] with an indication for ASCT.

Median age, gender, ECOG PS, lymphoma subtypes, stage at

diagnosis, bone marrow infiltration at diagnosis, induction

chemotherapy, salvage chemotherapy, chemotherapy cycles

received before mobilization, radiotherapy before mobilization,

platelet count before mobilization, mobilization protocols, and

disease status before ASCT were compared for patients who

had successful stem cell mobilization and those with stem cell

mobilization failure. Additionally, disease status after ASCT, relapse

rate, and mortality results were evaluated between these groups.

The target CD34+ cell dose for collection was >2x10 6 /kg for each

planned autograft. All patients received G-CSF at a dose of 10 µg/

kg from day +5 until the peripheral stem cell harvest. CD34+ cells

were measured in peripheral blood and apheresis products by flow

cytometry. We had a CD34+ cut-off level of 20 µL for starting

apheresis. We harvested the cells on the 5 th and/or 6 th day after

beginning G-CSF administration. Peripheral blood CD34% and

CD34/µL values at the first day on which leukocytes reached the

value of 1x10 9 /L and were maintained above that threshold over

at least 2 days were correlated with overall CD34+ collection. A

harvest of less than 2x10 6 CD34+/kg was considered as mobilization

failure. Twenty-one patients received plerixafor as an additional

mobilizing agent for the second apheresis. Subcutaneous plerixafor

(0.24 mg/kg) was administered to the patients on the evenings of

the 4 th and 5 th days of the mobilization protocol.


Statistical analyses were performed using SPSS 25 (IBM

Corp., Armonk, NY, USA). Variables were investigated

using visual (histograms, probability plots) and analytical

(Kolmogorov-Smirnov/Shapiro-Wilk test) methods to determine

whether they were normally distributed or not. Statistical

comparisons were made using chi-square tests for categorical

data. Student’s t-test for two independent samples was used

for comparison of continuous numerical data. Variables found

to be significant (p<0.05) in univariate analysis were tested in

multivariate analysis, which was performed using a stepwise

logistic regression model. Survival analyses were performed

using the Kaplan-Meier test with log rank. Values of p<0.05

were considered statistically significant.

Results

Patient Characteristics

A total of 87 patients were included in this study. The median

age was 48 (range: 18-70) years at the time of diagnosis.

205



The baseline clinical and demographic characteristics of

the patients are listed in Table 1. For 66 of 87 patients

(75.9%), the first mobilization trial was successful. Adequate

(≥2x10 6 /kg) CD34+ cells were collected in the first apheresis for

66 patients (9.5±8.1). For 21 of 87 (24.1%), the first mobilization

trial was unsuccessful. Therefore, a second mobilization trial

was conducted for these patients with plerixafor (5.5±3.3). The

number of CD34+ cells was significantly higher in patients who

Table 1. Baseline clinical and demographic characteristics of patients.

Parameters

206

Patients who had successful stem

cell mobilization

N (%) 66 (75.9%) 21 (24.1%)

Patients who had stem cell

mobilization failure*

Male/female (%) 38/28 (57.6%/42.4%) 15/6 (71.4%/28.6%) 0.25

Median age at diagnosis (range), years 48 (18-70) 53 (18-66) 0.07

ECOG PS 0/1/2 2/49/15 (3%/74.2%/22.7%) 0/16/5 (0%/76.2%/23.8%) 0.72

Type of lymphoma 0.45

Hodgkin lymphoma (HL) 18 (27.3%) 4 (19.0%)

Nodular sclerosis classical HL 13 (19.7%) 3 (14.3%)

Mixed cellularity classical HL 4 (6.1%) 1 (4.8%)

Lymphocyte depleted classical HL 1 (1.5%) 0

Non-Hodgkin lymphoma 48 (72.7%) 17 (81.0%)

Diffuse large B-cell lymphoma 28 (42.4%) 9 (42.9%)

Mantle cell lymphoma 9 (13.6%) 3 (14.3%)

Follicular lymphoma 4 (6.1%) 1 (4.8%)

Burkitt lymphoma 2 (3%) 0

Peripheral T-cell lymphoma 4 (6.1%) 1 (4.8%)

Angioimmunoblastic T-cell lymphoma 0 1 (4.8%)

Hepatosplenic T-cell lymphoma 1 (1.5%) 0

Stage at diagnosis

I/II/III/IV

0/11/21/34

0%/16.7%/31.8%/51.5%

0/3/5/13

0%/14.3%/23.8%/61.9%

Bone marrow infiltration at diagnosis 25 (37.9%) 11 (52.4%) 0.24

Induction chemotherapy 0.51

ABVD 18 (27.3%) 5 (23.8%)

CHOEP 3 (4.5%) 3 (14.3%)

CHOP 35 (53.0%) 12 (57.1%)

MPV 4 (6.1%) 0

EPOCH 0 0

CHOP/DHAP 2 (3%) 0

H-MTX-ARA-C 4 (6.1%) 1 (4.8%)

Rescue chemotherapy 0.49

ICE 42 (70.0%) 12 (66.7%)

DHAP 5 (8.3%) 4 (22.2%)

MPV 3 (5%) 0

GDP 1 (1.7%) 1 (5.6%)

H-MTX-ARA-C 3 (5.0%) 1 (5.6%)

BEACOPP 3 (5.0%) 0

Mobilization in first-line therapy 6 (9.1%) 3 (14.3%) 0.49

Mobilization after rescue therapy 60 (90.6%) 18 (85.7%) 0.49

Radiotherapy 21 (31.8%) 4 (19%) 0.26

Chemotherapy cycles before stem cell mobilization 10 (5-17) 10 (6-18) 0.78

Disease status before ASCT [9] 0.95

CR 27 (40.9%) 8 (38.1%)

p

0.69



Table 1. Continued

Parameters


cell mobilization

PR 28 (42.4%) 10 (47.6%)

Stable disease 5 (7.6%) 1 (4.8%)

Progressive disease 6 (9.1%) 2 (9.5%)

Patients who had stem cell


Platelet count before mobilization (x10 9 /L) 258 (78-650) 120 (48-470) 0.041

CD 34+ cells, 106/kg (mean ± SD) 9.5±8.1 5.5±3.3 0.002

Mobilization protocol 0.20

Filgrastim 43 (65.2%) 18 (85.7%)

Lenograstim 2 (3%) 1 (4.8%)

Filgrastim + ICE 13 (19.7%) 2 (9.5%)

Filgrastim + cyclophosphamide 8 (12.1%) 0

ASCT: Autologous stem cell transplantation; CR: complete response; G-CSF: granulocyte colony-stimulating factor; PR: partial response. *: Twenty-one patients received plerixafor as

an additional mobilizing agent for second apheresis.

p

were successful in the first mobilization (p=0.002). There were

no differences in hematocrit at the time point of apheresis.

Between the two groups, there was no statistically significant

gender (p=0.25) or age (p=0.07) difference. There was no

significant difference between the ECOG PS of the patients

(p=0.72). No significant difference was found between the

groups in terms of lymphoma types (p=0.45). Number of

chemotherapy cycles before stem cell mobilization was not

statistically significantly different between patients who had

mobilization failure and patients who had successful stem cell

mobilization (p=0.78). The stages of both groups were similar

at the time of diagnosis (p=0.69). There was no significant

difference between bone marrow infiltration at diagnosis

(p=0.24). There was no significant difference between the groups

in terms of induction chemotherapy protocols (p=0.51). Platelet

count before mobilization was higher in patients who had

successful stem cell mobilization than in patients who had stem

cell mobilization failure (p=0.041). After relapse, no significant

difference was found between rescue chemotherapies given

before mobilization (p=0.49). Disease status before ASCT was

complete response (CR) in 27 (40.9%) patients, partial response

(PR) in 28 (42.4%) patients, stable disease in 5 (7.6%) patients,

and progressive disease in 6 (9.1%) patients in the successful

mobilization group. Disease status before ASCT was CR in

8 (38.1%) patients, PR in 10 (47.6%) patients, stable disease in

1 (4.8%) patient, and progressive disease in 2 (9.5%) patients

in the stem cell mobilization failure group for the first trial

(p=0.95). The use of filgrastim or lenograstim as G-CSF did not

affect mobilization success. There was no significant difference

between the two groups in terms of filgrastim or lenograstim

mobilization (p=0.20). However, when the patients who received

only G-CSF or a chemotherapy-based mobilization protocol

were evaluated, 19 (29.7%) of the patients who were mobilized

with only G-CSF had mobilization failure, while only 2 (8.7%)

patients who received a chemotherapy-based mobilization

protocol had mobilization failure (p=0.04). This shows the

superiority of chemotherapy-based mobilization.

Post-transplant Outcomes

All of the patients finally underwent ASCT. Remarkably,

disease status after ASCT (on day +100) was CR in 38 (61.3%)

patients, PR in 1 (1.6%) patients, stable disease in 20 (32.3%)

patients, and progressive disease in 3 (4.8%) patients in the

successful mobilization group. Disease status after ASCT (on

day +100) was CR in 13 (65%) patients, PR in 5 (5%) patients,

stable disease in 4 (20%) patients, and progressive disease in

2 (10%) patients in the stem cell mobilization failure group

for the first trial, as shown in Table 2. The relapse rate was

significantly higher in patients who had stem cell mobilization

failure than in those with successful stem cell mobilization

(47.6% vs. 21.2%, p=0.01). Moreover, the mortality rate

was significantly higher among patients who had stem cell

mobilization failure than those with successful stem cell

mobilization (38.1% vs. 16.7%, p=0.01).

Overall Survival

The overall survival (OS) rate for patients who had successful

stem cell mobilization was 151.6±9.3 months versus 71.4±7.8

months for patients with stem cell mobilization failure for

the first trial; this was a statistically significant difference, as

shown in Figure 1 (p=0.02). The 3-year OS rates for patients

with successful stem cell mobilization and those with stem

cell mobilization failure for the first trial were 85% and 79%,

respectively. The 5-year OS rates for patients with successful

stem cell mobilization and stem cell mobilization failure for

the first trial were 81% and 63%, respectively. OS was better in

patients with lymphoma for whom the first mobilization trial

was successful.

The disease-free survival (DFS) rate for patients who had

successful stem cell mobilization was 111.9±10.6 months versus

207



57.6±6.4 months for patients who had stem cell mobilization

failure for the first trial; this was a statistically significant

difference, as shown in Figure 2 (p=0.004). The 3-year DFS rates

for patients with successful stem cell mobilization and those

with stem cell mobilization failure for the first trial were 82%

and 74%, respectively. The 5-year DFS rates for patients with

successful stem cell mobilization and stem cell mobilization

failure for the first trial were 68% and 44%, respectively.

Discussion

Stem cell mobilization is still difficult in a significant proportion

of patients with lymphoma and the factors predicting poor

mobilization are still not fully explained. An obvious reason for

these difficulties might be the fact that previous studies have

been heterogeneous concerning diagnosis, prior therapy, and

mobilization regimen used [7]. The frequency of mobilization

failure was 24.1% in the first mobilization in this study,

Table 2. Post-transplantation outcomes.

Parameters


cell mobilization

Patients with stem cell


Disease status after ASCT [9] 0.53

CR 38 (61.3%) 13 (65.0%)

PR 1 (1.6%) 5 (5.0%)

Stable disease 20 (32.3%) 4 (20.0%)

Progressive disease 3 (4.8%) 2 (10.0%)

Relapse (%) 14 (21.2%) 10 (47.6%) 0.01

Mortality (%) 11 (16.7%) 9 (42.9%) 0.01

ASCT: Autologous stem cell transplantation; CR: complete response; PR: partial response. *: Twenty-one patients received plerixafor as an additional mobilizing agent for second

apheresis.

p

Figure 1. Overall survival (OS) of patients who had successful stem

cell mobilization and patients who had stem cell mobilization

failure (p=0.02).

Figure 2. Disease-free survival (DFS) of patients who had

successful stem cell mobilization and patients who had stem cell

mobilization failure (p=0.004).

208



but no factor was detected in analysis that would cause

mobilization failure in these lymphoma patients. No statistically

significant difference was found between age, sex, stage of

diagnosis, ECOG PS, bone marrow infiltration at diagnosis,

induction chemotherapy, chemotherapy cycles before stem cell

mobilization, disease status before ASCT, receiving radiotherapy

before mobilization, lymphoma types, or mobilization regimen

in the two groups. On the other hand, OS and DFS were

significantly longer in the group with successful mobilization in

the first trial. It was observed that survival outcomes were worse

in patients who needed plerixafor for mobilization. However, it

was thought that the worse survival outcomes might have been

due to the poor bone marrow reserve and disease status before

ASCT in patients who needed plerixafor for mobilization.

For successful ASCT, one of the most important factors is to

mobilize sufficient numbers of CD34+ cells. In this study, the

cut-off value of 2x10 6 CD34+ cells/kg body weight was

determined as the target for a successful mobilization procedure.

It can be thought that the necessity of using plerixafor can be

predicted according to the number of peripheral CD34 cells.

CD34 cell count on apheresis day was reported to be the best

predictor of mobilization failure [10]. Additionally, CD34 cell

count was suggestive of preemptive plerixafor use and the

authors suggested a low level of CD34+ in peripheral blood

on day +13 as a possible criterion for initiating plerixafor

administration [11]. In this study, the number of CD34+ cells of

the apheresis product was observed to be significantly higher in

patients who were successful in the first mobilization.

Recent studies reported that the incidence of mobilization failure

in lymphoma was as high as 46% [12,13,14]. Variables already

reported to be associated with mobilization failure include

age, body weight, diagnosis, type of lymphoma and dose of

chemotherapy, extent of cell recovery from chemotherapy, bone

marrow involvement of lymphoma cells, prior radiation therapy,

and interval from diagnosis to mobilization [12,13,14,15]. On the

other hand, some hematological parameters such as cytopenia

at any stage of mobilization, high mean corpuscular volume,

long myelosuppression between salvage chemotherapies, and

poor bone marrow microenvironment can predict mobilization

failure. Özkurt et al. [16] reported that the CD34+ cell count of

the first apheresis product was positively correlated with the

white blood cell count, platelet count, peripheral CD34+ cell

count, and grade of bone marrow reticulin fibrosis. In this study,

chemotherapy-based mobilization was seen to be superior to

G-CSF mobilization. Additionally, the platelet count before

mobilization was higher in patients who had successful stem

cell mobilization than in patients with stem cell mobilization

failure. Apart from these two prognostic factors, none of

the patient or disease characteristics that we analyzed were

associated with mobilization failure. Prognostic factors such

as patient characteristics (age, gender, diagnosis, bone marrow

involvement, previous number of chemotherapy lines, previous

radiotherapy) were also not found to be associated with

mobilization failure in previous clinical studies [12,14].

It is not clear whether patients with treatment efficiency may

be best mobilized by higher doses of chemotherapy and/or

G-CSF. Previously, some studies demonstrated the superiority of

chemotherapy plus growth factors over growth factors alone

for mobilization [6,17,18]. On the other hand, Pusic et al. [17]

found similar rates of mobilization failure with chemotherapy

plus growth factors and only growth factor. Additionally, André

et al. [19] found no significant difference in CD341 cell harvest

yields among 131 patients randomized to receive 5 or 10 µg/

kg/day of G-CSF following mobilization chemotherapy. In our

study, it was observed that mobilization regime did not affect

mobilization failure. However, when the patients who received

only G-CSF and those who received a chemotherapy-based

mobilization protocol were evaluated, chemotherapy-based

mobilization was superior.

Conclusion

In this study, the success rate of the first mobilization trial was

found to be higher in patients with high platelet counts before

mobilization and in patients who received chemotherapy-based

mobilization protocols. This study had a few limitations. First,

it was retrospective. Second, all patients did not receive the

same induction chemotherapy before mobilization. Third, the

diagnoses of the patients were very heterogeneous. For the

patients who had mobilization failure in the first trial, plerixafor

was used in a later mobilization, and those patients then had an

adequate amount of stem cells for ASCT. Parameters predicting

mobilization failure would allow for a preemptive, more

cost-effective use of such agents during the first mobilization

attempt. However, the risk factors for mobilization failure are

still not clear.

Ethics

Ethics Committee Approval: All ethical considerations were

strictly followed in accordance with the 1964 Declaration of

Helsinki. As standard care/action of the hospitals of the Hacettepe

University Medical School Bone Marrow Transplantation Center,

Turkey, it has been recognized from the patient records that all

of the studied patients had given informed consent at the time

of hospitalization and before the administration of relevant

diagnostic/therapeutic standards of care.

Informed Consent: Obtained.


Surgical and Medical Practices: H.G.; Concept: H.D.; Design: H.D.;

Data Collection or Processing: R.Ç.; Analysis or Interpretation:

R.Ç.; Literature Search: Y.B.; Writing: R.Ç.

209




authors.



References

1. Sheppard D, Bredeson C, Allan D, Tay J. Systematic review of randomized

controlled trials of hematopoietic stem cell mobilization strategies for

autologous transplantation for hematologic malignancies. Biol Blood

Marrow Transplant 2012;18:1191-1203.

2. Van Gorkom G, Finel H, Giebel S, Pohlreich D, Shimoni A, Ringhoffer

M, Sucak G, Schaap N, Dreger P, Sureda A, Schouten HC. Prospective

noninterventional study on peripheral blood stem cell mobilization in

patients with relapsed lymphomas. J Clin Apher 2017;32:295-301.

3. Siena S, Schiavo R, Pedrazzoli P, Carlo-Stella C. Therapeutic relevance of

CD34 cell dose in blood cell transplantation for cancer therapy. J Clin Oncol

2000;18:1360-1377.

4. To LB, Levesque JP, Herbert KE. How I treat patients who mobilize

hematopoietic stem cells poorly. Blood 2011;118:4530-4540.

5. Allan DS, Keeney M, Howson-Jan K, Popma J, Weir K, Bhatia M, Sutherland

DR, Chin-Yee IH. Number of viable CD34+ cells reinfused predicts

engraftment in autologous hematopoietic stem cell transplantation. Bone


6. Mendrone A Jr, Arrais CA, Saboya R, de Alencar Fischer Chamone D, Dulley

FL. Factors affecting hematopoietic progenitor cell mobilization: an analysis

of 307 patients. Transfus Apher Sci 2008;39:187-192.

7. Kuittinen T, Nousiainen T, Halonen P, Mahlamäki E, Jantunen E. Prediction

of mobilisation failure in patients with non-Hodgkin’s lymphoma. Bone


8. Oken MM, Creech RH, Tormey DC, Horton J, Davis TE, McFadden ET, Carbone

PP. Toxicity and response criteria of the Eastern Cooperative Oncology

Group. Am J Clin Oncol1982;5:649-656.

9. Cheson BD, Fisher RI, Barrington SF, Cavalli F, Schwartz LH, Zucca E, Lister TA;

Alliance, Australasian Leukaemia and Lymphoma Group; Eastern Cooperative

Oncology Group; European Mantle Cell Lymphoma Consortium; Italian

Lymphoma Foundation; European Organisation for Research; Treatment of

Cancer/Dutch Hemato-Oncology Group; Grupo Español de Médula Ósea;

German High-Grade Lymphoma Study Group; German Hodgkin’s Study

Group; Japanese Lymphorra Study Group; Lymphoma Study Association;

NCIC Clinical Trials Group; Nordic Lymphoma Study Group; Southwest

Oncology Group; United Kingdom National Cancer Research Institute.

Recommendations for initial evaluation, staging, and response assessment

of Hodgkin and non-Hodgkin lymphoma: the Lugano classification. J Clin

Oncol 2014;32:3059-3068.

10. Ford C, Chan K, Reilly W, Petersen F. An evaluation of predictive factors for

CD34+ cell harvest yields from patients mobilized with chemotherapy and

growth factors. Transfusion 2003;43:622-625.

11. Milone G, Tripepi G, Martino M, Ancora F, Bartolozzi B, Spadaro A, Nozzoli C,

La Fauci A, Amico I, Leotta S, Poidomani M, Irrera G, Iacopino P, Saccardi R,

Guidi S, Bosi A. Early measurement of CD34+ cells in peripheral blood after

cyclophosphamide and granulocyte colony-stimulating factor treatment

predicts later CD34+ mobilisation failure and is a possible criterion for

guiding “on demand” use of plerixafor. Blood Transfus 2013;11:94-101.

12. Hosing C, Saliba RM, Ahlawat S, Körbling M, Kebriaei P, Alousi A, De Lima

M, Okoroji JG, McMannis J, Qazilbash M, Anderlini P, Giralt S, Champlin

RE, Khouri I, Popat U. Poor hematopoietic stem cell mobilizers: a single

institution study of incidence and risk factors in patients with recurrent or

relapsed lymphoma. Am J Hematol 2009;84:335-337.

13. Rossi G, Skert C, Morello E, Almici C, Arcaini L, Basilico C, Cavalli L, Botto B,

Castelli A, Pica G, Ripamonti F, Salvi F, Carella AM, Gaidano G, Levis A, Nosari

A, Russo D, Vitolo U. PBSC mobilization in lymphoma patients: analysis of risk

factors for collection failure and development of a predictive score based

on the kinetics of circulating CD34+ cells and WBC after chemotherapy and

G-CSF mobilization. Hematol Oncol 2015;33:125-132.

14. 14. Wuchter P, Ran D, Bruckner T, Schmitt T, Witzens-Harig M, Neben K,

Goldschmidt H, Ho AD. Poor mobilization of hematopoietic stem cells—

definitions, incidence, risk factors, and impact on outcome of autologous

transplantation. Biol Blood Marrow Transplant 2010;16:490-499.

15. Tarella C, Di Nicola M, Caracciolo D, Zallio F, Cuttica A, Omede P, Bondesan

P, Magni M, Matteucci P, Gallamini A, Pileri A, Gianni AM. High-dose ara-C

with autologous peripheral blood progenitor cell support induces a marked

progenitor cell mobilization: an indication for patients at risk for low

mobilization. Bone Marrow Transplant 2002;30:725-732.

16. Özkurt ZN, Yeğin ZA, Suyanı E, Akı ŞZ, Acar K, Yağcı M, Türköz Sucak G.

Factors affecting stem cell mobilization for autologous hematopoietic stem

cell transplantation. J Clin Apher 2010;25:280-286.

17. Pusic I, Jiang SY, Landua S, Uy GL, Rettig MP, Cashen AF, Westervelt P, Vij R,

Abboud CN, Stockerl-Goldstein KE, Sempek DS, Smith AL, DiPersio JF. Impact

of mobilization and remobilization strategies on achieving sufficient stem

cell yields for autologous transplantation. Biol Blood Marrow Transplant

2008;14:1045-1056.

18. Fruehauf S, Seggewiss R. It’s moving day: factors affecting peripheral

blood stem mobilization and strategies for improvement. Br J Haematol

2003;122:360-375.

19. André M, Baudoux E, Bron D, Canon JL, D’Hondt V, Fassotte MF, D’Hondt L,

Fillet G, Humblet Y, Jerusalem G, Vermeulen P, Symann M, Beguin Y. Phase

III randomized study comparing 5 or 10 µg per kg per day of filgrastim

for mobilization of peripheral blood progenitor cells with chemotherapy,

followed by intensification and autologous transplantation in patients with

nonmyeloid malignancies. Transfusion 2003;43:50-57.

210

Mersin S. et al: Evaluation of a Generic Bortezomib Molecule in Newly Diagnosed Multiple Myeloma Patients

RESEARCH ARTICLE

DOI: 10.4274/tjh.galenos.2021.2020.0555


Evaluation of a Generic Bortezomib Molecule in Newly Diagnosed

Multiple Myeloma Patients

Yeni Tanı Multipl Myelom Hastalarında Eşdeğer Bortezomib Molekülünün Değerlendirilmesi

Sinan Mersin, Ayfer Gedük, Özgür Mehtap, Pınar Tarkun, Serkan Ünal, Merve Gökçen Polat, Kemal Aygün,

Emel Merve Yenihayat, Hayrunnisa Albayrak, Abdullah Hacıhanefioğlu

Kocaeli University Faculty of Medicine, Department of Hematology, Kocaeli, Turkey

Abstract

Objective: Constantly increasing health expenditures lead to the use

of generic molecules and generic versions of bortezomib have been

used for a long time. The aim of this study is to retrospectively examine

the effectiveness, side effects, and reliability of generic bortezomib in

newly diagnosed multiple myeloma (MM) patients.

Materials and Methods: The data of 95 patients who received four

cycles of bortezomib as first- or second-line therapy in a single center

were retrospectively recorded. Treatment responses, side effects, and

progression-free survival (PFS) rates were calculated and compared.

Results: Of the 95 patients, 42 used the original and 53 used the

generic molecule. Epidemiological data, MM types, genetic risk

groups, laboratory values at diagnosis, and bortezomib treatment lines

(as a first line or second) were evaluated and there was no statistical

difference between the two groups. When the response rates were

evaluated according to International Myeloma Working Group criteria,

there was no significant difference (p=0.42). Rates of partial response

and higher responses were similar (81% vs. 79.2%, p=0.84). PFS rates

were 42.8 months with the original and 37.8 months with the generic

molecule (p=0.68). Side effects were seen in 44.2% of all patients,

and the most common side effects were neuropathy, cytopenia, and

infection. These rates were similar in the two groups (p=0.55).

Conclusion: Although this retrospective study is limited in scope, it is

the first study comparing the original molecule of bortezomib with a

generic version. There were no statistical differences between the two

groups in terms of treatment responses, PFS, or side effects. However,

large-scale evaluations will help obtain more data on this subject.

Keywords: Bortezomib, Multiple myeloma, Equivalent

Öz

Amaç: Sürekli artan sağlık harcamaları jenerik moleküllerin

kullanımına yol açmaktadır ve bortezomibin jenerik molekülleri uzun

süredir kullanılmaktadır. Bu çalışmanın amacı, yeni tanı konmuş

multipl myelom (MM) hastalarında jenerik bortezomibin etkinliğini,

yan etkilerini ve güvenilirliğini retrospektif olarak incelemektir.

Gereç ve Yöntemler: Tek merkezli çalışmamızda birinci veya ikinci

basamak tedavide dört kür bortezomib alan 95 hastanın verileri geriye

dönük olarak incelendi. Tedavi yanıtları, yan etkiler ve progresyonsuz

sağkalım (PFS) oranları hesaplandı ve karşılaştırıldı.

Bulgular: Doksan beş hastanın 42’si orijinal molekülü, 53’ü eşdeğer

molekülü kullanmıştır. Epidemiyolojik veriler, MM tipleri, genetik risk

grupları, tanı anındaki laboratuvar değerleri ve bortezomib tedavi

sıraları (birinci sıra veya ikinci sıra olarak) değerlendirildiğinde iki grup

arasında istatistiksel fark olmadığı izlendi. Uluslararası Myelom Çalışma

Grubu kriterlerine göre yanıt oranları değerlendirildiğinde anlamlı bir

fark bulunmadı (p=0,42). Kısmi yanıt ve daha yüksek yanıt oranları

benzerdi (%81’e karşı %79,2, p=0,84). PFS süreleri orijinal molekül için

42,8 ay ve eşdeğer molekül için 37,8 ay olarak hesaplandı (p=0,68).

Yan etkiler tüm hastaların %44,2’sinde görüldü ve en sık görülen yan

etkiler nöropati, sitopeni ve enfeksiyondu. Bu yan etkilerin görülme

oranları iki grupta benzerdi (p=0,55).

Sonuç: Bu retrospektif çalışma, kapsamı sınırlı olmakla birlikte, orijinal

bortezomib molekülünü eşdeğeri ile karşılaştıran ilk çalışmadır. Tedavi

yanıtları, PFS veya yan etkiler açısından iki grup arasında istatistiksel

fark izlenmemiştir. Ancak geniş çaplı değerlendirmeler bu konuda

daha fazla veri elde edilmesine yardımcı olacaktır.

Anahtar Sözcükler: Bortezomib, Multipl myelom, Eşdeğer

Introduction

Multiple myeloma (MM) is a plasma cell dyscrasia that

constitutes 14% of all hematological malignancies and 20%

of mortality due to hematological malignancies. It has no cure

with current treatment options. In a study examining the global

data of 2016, it was shown that the total incidence of MM was

2.1 per 100000 (95% UI: 1.8-2.3) and that 1.5 per 100000 (95%

UI: 1.3-1.7) total deaths were associated with myeloma [1]. The

incidence has increased over the past 30 years [2,3].



Address for Correspondence/Yazışma Adresi: Sinan Mersin, M.D., Kocaeli University Faculty of Medicine,

Department of Hematology, Kocaeli, Turkey

Phone : +90 505 828 64 38

E-mail : sinanmersin86@msn.com ORCID: orcid.org/0000-0001-7588-6000

Received/Geliş tarihi: September 9, 2020


211



Proteasome is the main extra lysosomal system of cells and

inhibition of this system causes cell cycle arrest and apoptosis

mainly in neoplastic cells. Proteasome inhibitors are mainly

used for myeloma and lymphoma, and bortezomib was the first

one to be used. Although patients became refractory to this

treatment after a while, it is still used in the first line of myeloma

treatment [4,5,6]. In recent years, new proteasome inhibitors

such as carfilzomib and ixazomib have been developed and they

are used for these relapsed/refractory MM patients with better

treatment response rates [7].

In optimal treatment approaches for newly diagnosed patients,

besides good efficiency and reliability, the cost balance should

also be taken into account. Overall health expenditures for

MM continue to increase with the increase in incidence as well

as the costs of new treatments [3]. Because of this increase,

the development of generic drugs has become necessary and

patients have had to use these generic molecules because of the

price differences. However, the use of generic molecules initially

creates concerns among physicians in terms of effectiveness

and side effects. We planned this study in order to eliminate this

uncertainty. Bortezomib has more than 70 generic versions in

use and 4 of them have been used here in Turkey. In our center,

Borcade is used as a generic, and in this study, we compared this

molecule with the original one (Velcade) [4,8].


The files of 340 patients diagnosed with MM between 2011

and 2019 in a single center were retrospectively scanned.

Ninety-five patients had received only original (Velcade) or only

generic (Borcade) bortezomib treatment for at least 4 cycles

in the first or second line of therapy with cyclophosphamide

and dexamethasone. VCD therapy was selected rather than

VTD (bortezomib, thalidomide, and dexamethasone therapy)

mainly because of the reimbursement rules of the country.

Original molecule users used bortezomib between March 2011

and March 2017 while generic molecule users used it between

May 2015 and February 2019. Of the 95 patients included in the

study, 42 used the original molecule and 53 used the generic

molecule. Patients who received both original and generic

molecules, who received more than one generic molecule,

who received bortezomib as a third line of treatment, or who

received bortezomib after autologous stem cell transplantation

or relapse were excluded from the study.

International Myeloma Working Group (IMWG) diagnostic

criteria were applied in the diagnosis of patients while

International Staging System criteria were used for staging and

genetic risk factors were also considered according to IMWG

criteria [9]. Routine laboratory analysis, radiological imaging,

and positron emission tomography/computed tomography

examinations of the patients were performed in our hospital’s

central laboratory, radiology department, and nuclear medicine

units, respectively. IMWG response criteria were also used in

post-treatment response evaluations. Consent was obtained

from the ethics committee of our hospital for the analysis of

patient files.

After recording the demographic characteristics of our patients,

M protein levels at diagnosis, MM types, disease stages, genetic

risk groups, extramedullary involvement and lytic lesions in the

bones, laboratory values at the time of diagnosis, and the first

treatments received before bortezomib-cyclophosphamidedexamethasone

(VCD) therapy, if any, were recorded. After

receiving VCD treatment for 4 cycles, response evaluations were

performed for all patients. Some of the patients who responded

to treatment underwent transplantation immediately, while

some underwent autologous stem cell transplant (ASCT) after

continuing the same treatment. This was due to ASCT availability

at the time of treatment and treatment being continued to

maintain the response rates. Patients who could not undergo

ASCT were followed. A small number of patients with or

without ASCT received maintenance lenalidomide therapy

(10 mg/day for 21 days in a 28-day period as the standard in both

groups). The recurrence dates of these patients were recorded

for both groups and progression-free survival (PFS) times were

calculated. Hematological and non-hematological side effects

occurring during treatment were rated and recorded according

to the latest National Cancer Institute Common Terminology

Criteria for Adverse Events (CTCAE) [10].


SPSS was used for analysis. The Student t-test was used in

the analysis of numerical data with normal distribution, the

Mann-Whitney U test was used in the analysis of data that did

not fit normal distribution and for more than two categorical

variables, the chi-square test was used in the analysis of binary

categorical variables, and the Kaplan-Meier test was used for

estimating survival times. Values of p<0.05 were considered

statistically significant.

Results

Epidemiological data are given in Table 1. There was no statistical

difference in the distribution of patients. Associated p-values

are also given.

As can be seen in Table 1, the majority of patients in both groups

were male and the average age at diagnosis was over 60. The

percentage of stage 2 patients in the original molecule group

was 50%, and a more homogeneous distribution was observed

in the generic molecule group. When the disease stages were

categorized according to treatment lines, even though it was

statistically insignificant and there were only 11 patients in the

generic group for the second treatment line, the high-risk patient

212



group had a slightly higher percentage in the second treatment

line in the generic molecule group (p=0.43 and p=0.49).

Otherwise, these distributions were similar to those seen in the

main groups to which these patients belonged. When evaluated

in terms of MM types, the most common myeloma type was

immunoglobulin G kappa in both groups. The rate of high-risk

patients was 21.4% in the original molecule group and 37.7%

in the generic molecule group. When risk group distributions

between treatment lines and high-risk patients were evaluated,

there were some differences between subgroups. The subgroups

of original molecule users in the first line of treatment and

generic molecule users in the second line had higher percentages

of high risk than the main groups to which they belonged.

The numbers of patients in these subgroups were low and the

Table 1. Characteristics of patients.

Original molecule

Number (%)

Total number of patients 42 53

Equivalent molecule

Number (%)

Average age (range), years 64 (36-87) 62 (32-85) 0.36

Gender (female/male) 13/29 (31/69) 14/39 (26.4/73.6) 0.63

Stage (ISS)

I 8 (19) 16 (30.2)

II 21 (50) 18 (34)

III 13 (31) 19 (35.8)

Stage in treatment lines First - second First - second First - second

I 5 (19.2) - 3 (18.8) 13 (31) - 3 (27.3)

II 13 (50) - 8 (50) 15 (35.7) - 3 (27.3)

III 8 (30.8) - 5 (31.5) 14 (33.3) - 5 (45.5)

Myeloma type

IgG kappa 16 (38.1) 12 (22.6)

IgG lambda 3 (7.1) 12 (22.6)

IgA kappa 7 (16.7) 10 (18.9)

IgA lambda 2 (4.8) 2 (3.8)

Lambda light chain 6 (14.3) 11 (20.8)

Kappa light chain 6 (14.3) 1 (1.9)

Non-secretory 2 (4.8) 4 (7.5)

Genetic risk group

Standard risk 9 (21.4) 20 (37.7)

High risk 3 (7.1) 6 (11.3)

Unknown 30 (71.4) 27 (50.9)

p

0.25

0.43-0.49

Genetic risk groups in treatment lines First - second First - second First - second

Standard risk 5 (19.2) - 4 (25) 15 (35.7) - 5 (45.5)

High risk 3 (11.5) - 0 4 (9.5) - 2 (18.2)

Unknown 18 (69.2) - 12 (75) 23 (54.8) - 4 (36.4)

At diagnosis:

Extramedullary involvement 8 (19) 8 (15.1) 0.60

Lytic lesions 28 (66.7) 41 (77.4) 0.28

Laboratory results Mean (±SD) Mean (±SD)

Hemoglobulin (g/dL) 10.53 (1.87) 10.38 (1.92) 0.78

Leukocytes (U/mm 3 ) 6254 (2517) 6546 (2568) 0.45

Platelets (U/mm 3 ) 238045 (124255) 204602 (83510) 0.29

Creatinine (mg/dL) 1.2 (1.12) 1.31 (1.11) 0.62

Calcium (mg/dL) 9.44 (0.9) 9.58 (1.21) 0.71

ISS: International Staging System; SD: standard deviation, IgA: immunoglobulin.

0.1

0.13

0.34 - 0.07

213



findings were statistically insignificant, but still worth noting

when evaluating the results (p=0.34 and p=0.49). It should also

be noted that genetic risk assessment could not be performed

for the vast majority of patients. In summary, there was no

significant statistical difference between groups and subgroups

according to treatment lines. Extramedullary involvement, lytic

lesion rates, and mean laboratory values at the time of diagnosis

were also similar in the groups.

Bortezomib was used in combination with cyclophosphamide

and dexamethasone. The bortezomib dosage was 1.3 mg/m 2

and it was reduced to 1.1 mg/m 2 for patients experiencing

side effects such as neuropathy. Bortezomib was given

subcutaneously to all patients. The cyclophosphamide dosage

was 500 mg. The dexamethasone dosage was 40 mg for patients

below 60 years of age and 20 mg for older patients. The response

rates of the patients to the treatments containing bortezomib

that they received in the first or second line are given in

Table 2.

The patients’ responses were evaluated after 4 cycles of

treatment and another evaluation was performed for patients

who underwent more than 4 cycles in the pre-transplantation

period. Those rates were determined in the same groups according

to IMWG criteria for each patient. When the patients’ responses

were evaluated, there were some minor differences between the

two molecule groups, but these were not statistically significant

(p=0.42). When response rates were divided into two groups

as above minimal response or below partial response (PR), the

results were similar in the two groups (81% vs. 79.2%, p=0.83).

In Turkey, reimbursement rules did not allow the use of

bortezomib as a first line of treatment for a period of time.

Patients were able to use bortezomib after at least 2 cycles of

a combination treatment that did not contain bortezomib, such

as vincristine, doxorubicin, and dexamethasone (VAD). After

the reimbursement rules were changed, patients were able to

use bortezomib treatment in the first line of treatment. For

this reason, 27 of the patients received bortezomib-containing

regimens as a second line of therapy after 2 cycles of VAD

combination therapy. Eleven of 27 patients were in the generic

molecule group and 16 of them were in the original molecule

group (p=0.63). Treatment results were also analyzed according

to these subgroups. The rate of PR and better responses was

higher among those using the generic molecule in the group

that received bortezomib treatment as the first line of treatment

(81% vs. 76.9%) and among those receiving the original

molecule in the group that received bortezomib treatment as

the second line (87.5% vs. 72.7%). This may be due to the higher

percentage of high-risk patients in those subgroups, but again,

this finding was not statistically significant (p=0.69 and p=0.33,

respectively).

Before the PFS times of the patients were calculated, whether

the patients had extra VCD treatment cycles, whether they

underwent ASCT, and whether they received maintenance

lenalidomide treatment were compared between the groups.

Some of the patients in both groups received extra cycles

of VCD treatments due to ASCT availability at their time of

treatment. The maximum number of treatment cycles was 8 in

both groups and means of treatment cycle numbers were 5.2

in the original and 5.7 in the generic molecule group (p=0.89).

Twenty-three (54.8%) of the patients using the original molecule

and 25 (47.2%) of the patients using the generic molecule

underwent transplantation. In both molecule groups, high-dose

cyclophosphamide therapies were used for mobilization. All

Table 2. Response to treatments.

Total response rates

Original

molecule

Number (%)

Progression 3 (7.1) 3 (5.7)

SD 0 3 (5.7)

MR 5 (11.9) 5 (9.4)

Equivalent

molecule

Number (%)

PR 11 (26.2) 21 (39.6)

VGPR 13 (31.0) 11 (20.8)

CR 10 (23.8) 10 (18.9)

Total response rates

PR and above 34 (81) 42 (79.2)

MR and below 8 (19) 11 (20.8)

Response rates in first line

Progression 2 (7.6) 2 (4.7)

SD 0 1 (2.3)

MR 4 (15.3) 5 (11.9)

PR 4 (15.3) 18 (42.8)

VGPR 9 (34.6) 7 (16.6)

CR 7 (26.9) 9 (21.4)

Response rates in first line

PR and above 20 (76.9) 34 (81)

MR and below 6 (23.1) 8 (19)

Response rates in second line

Progression 1 (6.2) 1 (9)

SD 0 2 (18.2)

MR 1 (6.2) 0

PR 7 (43.8) 3 (27.3)

VGPR 4 (25) 4 (36.4)

CR 3 (18.8) 1 (9)

Response rates in second line

PR and above 14 (87.5) 8 (72.7)

MR and below 2 (12.5) 3 (27.3)

p

0.41

0.84

0.21

0.69

0.44

0.33

PR: Partial response; VGPR: very good partial response; CR: complete response; SD:

stable disease; MR: minimal response.

214



mobilizations succeeded with enough stem cell collection and

there was no difference between molecule groups regarding

mobilization or transplantation toxicities. After transplantation,

all patients in both molecule groups had successful engraftment

and no serious complications were seen in either group after

transplantation. Twelve (30.8%) of the patients using the

original molecule and 13 (24.5%) of the patients using the

generic molecule received maintenance lenalidomide treatment.

The lenalidomide dosage was 10 mg/day for 21 days in a 28-day

period as the standard for all patients. There was no significant

difference between the groups in this respect (p=0.537 and

p=0.637, respectively). The median follow-up time was longer in

the original molecule group, mainly because of treatment dates

(30 months vs. 20 months). Considering all these differences, it

should be kept in mind that the statistical relations among PFS

values are very weak. However, the PFS values were calculated

for the two groups to provide a general idea (Figure 1). PFS

values were 42.8±4.8 months in the group receiving the original

molecule and 38.3±5.89 months in the generic group with no

statistically significant difference (p=0.68).

When the side effects related to these molecules were evaluated,

side effects were seen in 44.7% of patients using bortezomib.

The most common side effects were neuropathy, anemia,

thrombocytopenia, neutropenia, and infections. Side effects

were observed in 20 patients (47.6%) receiving the original

molecule and 22 patients (41.5%) receiving the generic molecule

(p=0.55). When side effect grades were evaluated according to

the CTCAE, grade 3-4 side effects were observed as neuropathy

in 4 patients (2 patients in the original molecule group and 2

patients in the generic molecule group). All remaining observed

side effects were grade 1-2. Vincristine therapy (included in the

VAD regimen) can also cause permanent neuropathy, so to better

separate this from the side effects of bortezomib, neuropathy

was evaluated in both first-line and second-line subgroups. In

the first-line treatment subgroup, the neuropathy risk was higher

in the original molecule group, while the opposite finding was

seen for the second-line group. However, these differences were

statistically insignificant (23.1% vs. 7.1%, p=0.06 and 18.8% vs.

27.3%, p=0.6, respectively). The side effects seen in both groups

and the associated p-values in comparing the groups are given

in Table 3.

Discussion

It is known that the treatment results of patients are improved

with new drugs. However, the increase in health expenditures

related to these drugs leads health authorities to seek some

alternatives. One of the prime examples of this is generic

imatinib therapy. It was reported that the responses of chronic

myeloid leukemia patients treated with original imatinib were

maintained with generic products and annual cost was reduced

by 96% [11]. In two real-life studies, generic imatinib was

reported to be effective and safe in first-line treatment [11,12].

There are also studies about the economics of generic drugs

on a nationwide scale and studies addressing the reasons for

choosing generic products [13,14]. Other than imatinib, there

are only a few studies comparing generic molecules with their

original counterparts. Those studies include comparisons of

low-molecular-weight heparin and psychoactive drugs with

their generic counterparts [15,16]. As far as we know, our study

is the first one comparing original bortezomib with its generic

molecule.

Bortezomib was licensed by the Food and Drug Administration in

2003 for patients with MM and it has been used in combination

therapy with cyclophosphamide and dexamethasone since 2007

[17,18,19]. In Turkey, the original molecule has been used in

Figure 1. Evaluation of progression-free survival (PFS).

Table 3. Side effects.

Original

molecule

Number (%)

Equivalent

molecule

Number (%)

Any side effects 20 (47.6) 22 (41.5) 0.55

Neuropathy 9 (21.4) 6 (11.3) 0.18

Anemia 4 (9.5) 8 (15.1) 0.41

Neutropenia 2 (4.8) 4 (7.5) 0.58

Thrombocytopenia 3 (7.1) 2 (3.8) 0.46

Respiratory tract

infections

4 (9.5) 4 (7.5) 0.73

Diarrhea 4 (9.5) 3 (5.7) 0.47

p

215



combination therapy since 2010. Generic bortezomib was

launched with the obtaining of a license in 2012. In accordance

with the reimbursement policy of the relevant health authority,

it started to be used for patients due to the price difference.

However, generic bortezomib caused some concerns among

physicians at first regarding its effectiveness and side effect

profile.

Study Limitations

In our study, when the data of these patients were examined, the

distributions of epidemiological features, stages, disease types,

and other risk factors between groups were not statistically

different. When the response rates to treatment were evaluated,

there was no statistically significant difference between the

two groups in either first-line or second-line treatments. There

were some statistically insignificant differences observed

between subgroups that may be due to the percentage of

high-risk patients. Treatment response rates in both groups

were similar to those reported in studies in which the original

bortezomib molecule was combined with cyclophosphamide

and dexamethasone. In those studies, the rate of any response

(PR and above) was 80%, and similar data were obtained in both

groups in our study [17,19,20,21]. The results showed us that the

responses of patients using the generic bortezomib molecule

were similar to those of patients using the original molecule

(81% with the original molecule, 79.2% with the generic). Even

though these findings were statistically weak, there was also no

significant difference between PFS times, and these values were

similar to those of other studies on the VCD protocol [22,23].

When side effects were evaluated, no significant difference was

found between the two groups. The most common side effects

were neuropathy, cytopenia, and infections, similar to other

studies, and in our study the side effect of diarrhea was observed

less often than in other bortezomib studies [17,19,20,22,23,24].

Conclusion

MM is a disease in which response rates are increased with new

treatments and total survival is prolonged, but there is still no

cure. It is a fact that such diseases add additional costs to the

health expenditures of countries. Generic medicines can be

an alternative both to provide access to new medicines and

to reduce the burden on health expenditures. Although this

retrospective study includes a limited number of patients, it is

the first study of generic bortezomib since it became available

for use in Turkey. Our data show that the responses to this

drug are similar to those of the original molecule, while the

side effects are also similar to those of the original molecule

and manageable. Randomized, prospective studies with greater

numbers of patients and longer follow-up times are needed

to understand whether the use of generic bortezomib in MM

treatment affects long-term survival.

Ethics

Ethics Committee Approval: Consent was obtained from the

ethics committee of our hospital for the analysis of patient files.



Concept: S.M., A.G., Ö.M.; Design: S.M., A.G.; Data Collection or

Processing: S.M., A.G., Ö.M., P.T., S.Ü., M.G.P., K.A., E.M.Y., H.A.,

A.H.; Analysis or Interpretation: S.M., A.G.; Literature Search:

S.M.; Writing: S.M.


authors.



References

1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin

2016;66:7-30.

2. Teras LR, DeSantis CE, Cerhan JR, Morton LM, Jemal A, Flowers CR. 2016 US

lymphoid malignancy statistics by World Health Organization subtypes. CA

Cancer J Clin 2016;66:443-459.

3. Cowan AJ, Allen C, Barac A, Basaleem H, Bensenor I, Curado MP, Foreman

K, Gupta R, Harvey J, Hosgood HD, Jakovljevic M, Khader Y, Linn S, Lad D,

Mantovani L, Nong VM, Mokdad A, Naghavi M, Postma M, Roshandel G,

Shackelford K, Sisay M, Nguyen CT, Tran TT, Xuan BT, Ukwaja KN, Vollset SE,

Weiderpass E, Libby EN, Fitzmaurice C. Global burden of multiple myeloma:

a systematic analysis for the Global Burden of Disease Study 2016. JAMA

Oncol 2018;4:1221-1227.

4. Field-Smith A, Morgan GJ, Davies FE. Bortezomib (Velcadetrade mark) in the

treatment of multiple myeloma. Ther Clin Risk Manag 2006;2:271-279.

5. Jackson G, Einsele H, Moreau P, Miguel JS. Bortezomib, a novel proteasome

inhibitor, in the treatment of hematologic malignancies. Cancer Treat Rev

2005;31:591-602.

6. Richardson PG, Mitsiades C, Hideshima T, Anderson KC. Proteasome

inhibition in the treatment of cancer. Cell Cycle 2005;4:290-296.

7. Mateos MV, Ludwig H, Bazarbachi A, Beksac M, Bladé J, Boccadoro M,

Cavo M, Delforge M, Dimopoulos MA, Facon T, Geraldes C, Goldschmidt H,

Hájek R, Hansson M, Jamroziak K, Leiba M, Masszi T, Mendeleeva L, O’Dwyer

M, Plesner T, San-Miguel JF, Straka C, van de Donk NWCJ, Yong K, Zver S,

Moreau P, Sonneveld P. Insights on multiple myeloma treatment strategies.

Hemasphere 2018;3:e163.

8. Borcade Drug Information. Available online at https://www.ndrugs.

com/?s=borcade.

9. Rajkumar SV, Dimopoulos MA, Palumbo A, Blade J, Merlini G, Mateos

MV, Kumar S, Hillengass J, Kastritis E, Richardson P, Landgren O, Paiva B,

Dispenzieri A, Weiss B, LeLeu X, Zweegman S, Lonial S, Rosinol L, Zamagni

E, Jagannath S, Sezer O, Kristinsson SY, Caers J, Usmani SZ, Lahuerta JJ,

Johnsen HE, Beksac M, Cavo M, Goldschmidt H, Terpos E, Kyle RA, Anderson

KC, Durie BG, Miguel JF. International Myeloma Working Group updated

criteria for the diagnosis of multiple myeloma. Lancet Oncol 2014;15:e538-

548.

10. US Department of Health and Human Services. Common Terminology

Criteria for Adverse Events (CTCAE) Version 5.0. Washington, HHS,

2017. Available online at https://ctep.cancer.gov/protocoldevelopment/

electronic_applications/docs/CTCAE_v5_Quick_Reference_5x7.pdf.

216



11. Eskazan AE, Soysal T. The tolerability issue of generic imatinib in patients

with chronic myeloid leukemia (Comment on Adi J. Klil-Drori et al.,

Haematologica 2019;104(7):e293). Haematologica 2019;104:e330.

12. Lejniece S, Udre I, Rivkina A. Generic imatinib in the treatment of chronic

myeloid leukemia: two years’ experience in Latvia. Exp Oncol 2017;39:151-

154.

13. Kanavos P. Do generics offer significant savings to the UK National Health

Service? Curr Med Res Opin 2007;23:105-116.

14. Gallelli L, Palleria C, De Vuono A, Mumoli L, Vasapollo P, Piro B, Russo E.

Safety and efficacy of generic drugs with respect to brand formulation. J

Pharmacol Pharmacother 2013;4(Suppl 1):S110-114.

15. Borgheini G. The bioequivalence and therapeutic efficacy of generic versus

brand-name psychoactive drugs. Clin Ther 2003;25:1578-1592.

16. Fareed J, Leong WL, Hoppensteadt DA, Jeske WP, Walenga J, Wahi R, Bick

RL. Generic low-molecular-weight heparins: some practical considerations.

Semin Thromb Hemost 2004;30:703-713.

17. Kropff M, Bisping G, Schuck E, Liebisch P, Lang N, Hentrich M, Dechow T,

Kröger N, Salwender H, Metzner B, Sezer O, Engelhardt M, Wolf HH, Einsele

H, Volpert S, Heinecke A, Berdel WE, Kienast J; Deutsche Studiengruppe

Multiples Myelom. Bortezomib in combination with intermediate-dose

dexamethasone and continuous low-dose oral cyclophosphamide for

relapsed multiple myeloma. Br J Haematol 2007;138:330-337.

18. Kim SJ, Kim J, Cho Y, Seo BK, Kim BS. Combination chemotherapy with

bortezomib, cyclophosphamide and dexamethasone may be effective for

plasma cell leukemia. Jpn J Clin Oncol 2007;37:382-384.

19. Davies FE, Wu P, Jenner M, Srikanth M, Saso R, Morgan GJ. The combination

of cyclophosphamide, velcade and dexamethasone induces high response

rates with comparable toxicity to velcade alone and velcade plus

dexamethasone. Haematologica 2007;92:1149-1150.

20. Tsukada N, Ikeda M, Shingaki S, Miyazaki K, Meshitsuka S, Yoshiki Y, Abe

Y, Suzuki K. Induction treatment with bortezomib-cyclophosphamidedexamethasone

(CyBorD) for newly diagnosed transplant-eligible patients

with multiple myeloma. Rinsho Ketsueki 2015;56:1069-1075.

21. Tanaka K, Toyota S, Akiyama M, Wakimoto N, Nakamura Y, Najima Y, Doki

N, Kakihana K, Igarashi A, Kobayashi T, Ohashi K, Kudo D, Shinagawa A,

Takano H, Fujio T, Okoshi Y, Hori M, Kumagai T, Saito T, Mukae J, Yamamoto

K, Tsutsumi I, Komeno T, Yoshida C, Yamamoto M, Kojima H; on behalf of

the Ochanomizu Hematology Study Group. Efficacy and safety of a weekly

cyclophosphamide-bortezomib-dexamethasone regimen as induction

therapy prior to autologous stem cell transplantation in Japanese patients

with newly diagnosed multiple myeloma: a phase 2 multicenter trial. Acta

Haematol 2019;141:111-118.

22. Khan ML, Reeder CB, Kumar SK, Lacy MQ, Reece DE, Dispenzieri A, Gertz MA,

Greipp P, Hayman S, Zeldenhurst S, Dingli D, Lust J, Russell S, Laumann KM,

Mikhael JR, Bergsagel PL, Fonseca R, Rajkumar SV, Stewart AK. A comparison

of lenalidomide/dexamethasone versus cyclophosphamide/lenalidomide/

dexamethasone versus cyclophosphamide/bortezomib/dexamethasone in

newly diagnosed multiple myeloma. Br J Haematol 2012;156:326-333.

23. Figueiredo A, Atkins H, Mallick R, Kekre N, Kew A, McCurdy A.

Cyclophosphamide-bortezomib-dexamethasone compared with

bortezomib-dexamethasone in transplantation-eligible patients with newly

diagnosed multiple myeloma. Curr Oncol 2020;27:e81-e85.

24. Ashrafi F, Moghaddas A, Darakhshandeh A. Reduced weekly subcutaneous

doses of bortezomib in combination with cyclophosphamide and

dexamethasone for newly diagnosed multiple myeloma. J Res Pharm Pract

2020;9:56-59.

217

Mina S.A. et al: Peripheral Neuropathy and Proteasome Inhibitors

BRIEF REPORT

DOI: 10.4274/tjh.galenos.2021.2021.0052


Post-Marketing Analysis of Peripheral Neuropathy Burden with

New-Generation Proteasome Inhibitors Using the FDA Adverse

Event Reporting System

Yeni Jenerasyon Proteozom İnhibitörleriyle Olan Çevresel Nöropati Yükünün FDA Yan Etki

Raporlama Sistemi Kullanılarak Pazarlama Sonrası Analizi

Syeda A. Mina 1 , Ibrahim N. Muhsen 2 , Ethan A. Burns 3 , Humaira Sarfraz 2 , Sai Ravi Pingali 3 , Jiaqiong Xu 4 ,

Shahrukh K. Hashmi 5,6

1Mayo Clinic, Department of Medicine, Rochester, USA

2Houston Methodist Hospital, Department of Medicine, Houston, USA

3Houston Methodist Cancer Center, Houston Methodist Hospital, Houston, USA

4Center for Outcomes Research, Houston Methodist Research Institute, Houston, USA

5Mayo Clinic, Department of Medicine, Rochester, USA

6Sheikh Shakbout Medical City, Department of Medicine, Abu Dhabi, UAE

Abstract

Proteasome inhibitors (PIs) are an integral component of multiple

myeloma therapies. Peripheral neuropathy (PN) is a well-known

consequence of PIs, most frequently reported with earlier generations

such as bortezomib (BTZ). There is a paucity of data highlighting the

risk of developing PN with the new-generation PIs carfilzomib (CFZ)

and ixazomib (IZB). This study evaluated reports of PN encountered

with all three PIs using the Food and Drug Administration Adverse

Event (AE) Reporting System (FAERS). Signal disproportionality

analysis was reported using the reporting odds ratio (ROR) with 95%

confidence interval (CI). PN was reported in a total of 2.1%, 5.0%, and

10.9% of AEs with CFZ, IZB, and BTZ, respectively. The ROR (95% CI)

for PN secondary to BTZ, CFZ, and IZB was 34.10 (32.76-35.49), 6.37

(5.50-7.37), and 14.97 (13.63-16.44), respectively. Compared to BTZ,

CFZ and IZB have lower rates of reported PN, with RORs of 0.19 (0.16-

0.22) and 0.48 (0.43-0.54), respectively.

Keywords: Multiple myeloma, Proteasome inhibitors, Peripheral

neuropathy

Öz

Proteozom inhibitörleri (Pİ) multipl myelom tedavilerinin integral

parçalarındandır. Çevresel nöropatiler (ÇN) Pİ’nin iyi bilinen bir

sonucudur, bortezomib (BTZ) gibi önceki jenerasyonlarla daha sık

bildirilmiştir. Yeni jenerasyon PI olan karfilzomib (KFZ) ve iksazomib

(IZB) ile gelişen ÇN riskini vurgulayan çalışmalar yetersizdir. Bu

çalışmada, Gıda ve İlaç İdaresi Olumsuz Olay (OO) Raporlama Sistemini

(FAERS) kullanarak her üç PI ile karşılaşılan ÇN raporları değerlendirildi.

Sinyal orantısızlık analizi, raporlama olasılık oranı (ROO) %95 güven

aralığı (GA) kullanılarak yapıldı. ÇN; KFZ, IZB, BTZ ile sırasıyla OO’nun

toplamında %2,1, %5,0, ve %10,9’unda rapor edilmişti. BTZ, KFZ, ve

IZB’ye ikincil ÇN için ROO (%95 GA) sırasıyla 34,10 (32,76-35,49),

6,37 (5,50-7,37), ve 14,97 (13,63-16,44) idi. KFZ ve IZB ile, BTZ ile

karşılaştırıldığında daha az ÇN rapor edilmişti, ROO sırasıyla 0,19

(0,16-0,22) ve 0,48 (0,43-0,54) idi.

Anahtar Sözcükler: Multipl myelom, Proteozom inhibitörleri,

Periferik nöropati

Introduction

Multiple myeloma (MM) is an incurable clonal plasma cell disease

expected to be diagnosed in 34,920 individuals in the year 2021

in the United States alone [1]. While the incidence has remained

stable over the past decade, the prevalence and 5-year overall

survival (OS) rate have substantially improved with therapeutic

breakthroughs in monoclonal antibodies, immunomodulatory

therapy, and, recently, proteasome inhibitors (PIs) [2,3]. Currently,

PIs are approved in combination with other agents in induction

therapies for newly diagnosed MM, for autologous stem cell

transplant candidates as maintenance therapies, and in cases of



Address for Correspondence/Yazışma Adresi: Shahrukh K. Hashmi, M.D., Mayo Clinic, Department of Medicine,

Rochester, USA

Phone : +91 507 538 32 70

E-mail : hashmi.shahrukh@mayo.edu ORCID: orcid.org/0000-0002-4738-8714



218



relapsed/refractory disease [2,4]. There are three PIs approved by

the US Food and Drug Administration (FDA): bortezomib [(BTZ),

approved in 2003], carfilzomib [(CFZ), approved in 2012], and

ixazomib [(IZB), approved in 2015].

Despite profound therapeutic benefits, there are significant

adverse events (AEs) that may impact the quality of life and

impede medication use, one such toxicity being peripheral

neuropathy (PN) [5]. This is most commonly reported with

BTZ, and it has been reported as a dose-limiting toxicity in

as many as 30%-60% of patients [6]. Recent clinical trials

have suggested that the newer PIs have a lower association

with these off-target effects [7,8]. However, there remains a

relative paucity of post-marketing data on PN. This analysis

aims to compare the rate of reported PN incidences with BTZ,

CFZ, and IZB using the FDA Adverse Event Reporting System

(FAERS).


This study is a retrospective analysis using cases of AEs reported

to the FAERS pharmacovigilance database. This public database

is used by the FDA for post-marketing safety surveillance

of pharmaceutical products. AEs and medication errors are

coded to terms in the Medical Dictionary for Regulatory

Activities. The cases are reported by healthcare professionals,

manufacturers, and consumers. With input from 1968 to June

2020, the database contains approximately 19 million AE

reports from around the world. Each reported event includes

information about the constituents of the suspected product,

indication for use, adverse reactions, characterization of the

outcome (serious vs. non-serious, and whether hospitalization

was required), patient demographics (gender, age, weight),

and details of the reporting event (latest manufacturer report

received to date, initial FDA report received, reporting country,

and reporter type). All events have a unique case identification

number.

This study retrospectively reviews AEs reported from the date

of FDA approval of the respective medications, BTZ (2003), CFZ

(2012), and IZB (2015), through June 20, 2020. The FAERS was

queried for “bortezomib,” “ixazomib,” and “carfilzomib.” The

following terms were subsequently selected as reasons for use:

“plasma cell leukemia,” “plasma cell myeloma,” “plasma cell

myeloma in remission,” and “plasma cell myeloma recurrent.”

The specific AEs included were “peripheral neuropathy,” “sensory

peripheral neuropathy,” “motor peripheral neuropathy,” and

“sensorimotor peripheral neuropathy.”

Analysis

Reported AEs attributed to new-generation PIs, namely CFZ and

IZB, were compared individually to the total number of events

reported to FAERS and to those for BTZ. Signal disproportionality

analysis was performed by calculating the reporting odds ratio

(ROR) and 95% confidence interval (CI). The ROR was reported

to be significant if the 95% CI did not surpass 1, with an ROR of

>1 suggestive of a higher likelihood of AEs being reported with

the drug and <1 suggesting AEs to be less likely to occur with

the drug. The chi-square test was used to calculate p-values,

with p<0.05 being taken as significant. Continuous data were

reported as means with standard deviations.

Results

The number of adverse events of PN reported per year

following the approval of the respective PIs are presented in

Table 1. The mean patient age was 65.5±9.9, 67.7±10.1, and

68.5±9.5 years in the BTZ, CFZ, and IZB groups, respectively, with

male-to-female ratios of 1.26:1, 1.3:1, and 1.01:1, respectively.

The total numbers of PN events reported in the FAERS from the

first FDA approval through June 2020 were 2802 (10.9%) for

BTZ, 191 (2.06%) for CFZ, and 475 (4.98%) for IZB in comparison

to the total reported AE rate in MM patients (Table 2). In most

cases, PN was reported in the absence of reported concomitant

medications, at rates of 71.8% for BTZ, 70.3% for IZB, and 51.8%

for CFZ.

Compared to the entirety of the FAERS database for the

corresponding years, the ROR (95% CI) for PN reported with

Table 1. Summary of characteristics of patients with plasma

cell disorders on proteasome inhibitors with side effects of

peripheral neuropathy.

Cases of PN reported to the FAERS

Bortezomib Carfilzomib Ixazomib

Before 2010 480 - -

2010-2015 1203 69 6

2016-June 2020 1119 122 469

Total PN cases reported 2802 191 475

Mean age of patients

with reported PN, years

(± SD)

Sex (%)

65.5 (±9.9) 67.7 (±10.1) 68.5 (±9.5)

Male 1217 (43.4) 88 (46.0) 229 (48.2)

Female 972 (34.7) 66 (34.6) 225 (47.3)

Not specified 613 (21.9) 37 (19.4) 21(4.4)

Reporter (%)

Healthcare professional 2341 (83.5) 135 (70.6) 320 (67.3)

Non-healthcare 461 (16.4) 56 (29.3) 155 (32.6)

Suspected drug (%)

Proteasome inhibitor +

other medications

Proteasome inhibitor

only

790 (28.1) 92 (48.1) 141 (29.6)

2012 (71.8) 99 (51.8) 334 (70.3)

PN: Peripheral neuropathy; FAERS: Food and Drug Administration Adverse Event

Reporting System; SD: standard deviation.

219



BTZ, CFZ, and IZB was 34.10 (32.76-35.49), 6.37 (5.50-7.37), and

14.97 (13.63-16.44), respectively (Figure 1). When comparing

CFZ and IZB to BTZ, there was a lower reported rate of PN, with

RORs of 0.19 (0.16-0.22) and 0.48 (0.43-0.54), respectively, as

shown in Figure 2.

Table 2. Comparative peripheral neuropathy reports in FAERS

between different PIs.*

Number of PN cases

reported

Total number of

adverse events

Total number of

adverse events in

FAERS since PI’s FDA

approval

Number of PN

cases reported in

FAERS since PI’s FDA

approval

ROR (vs. FAERS)

(95% CI)**

ROR (vs. BTZ)

(95% CI)**

Carfilzomib Ixazomib Bortezomib

191 475 2802

9261 9528 25,687

13,899,084 10,687,588 17,260,353

44,987 35,591 55,215

6.37

(5.50-7.37)

0.19

(0.16-0.22)

14.97

(13.63-16.44)

0.46

(0.41-0.51) -

34.10

(32.76-35.49)

*Calculations are based on total numbers of PN cases reported and total number of

reported adverse events in the FAERS from date of drug approval by FDA to June 2020.

**All reported results had p-values of <0.0001.

PI: Proteasome inhibitor; PN: peripheral neuropathy; FAERS: Food and Drug

Administration Adverse Event Reporting System; FDA: Food and Drug Administration;

ROR: reporting odds ratio; CI: confidence interval; BTZ: bortezomib.

Figure 1. Forest plot of reporting odds ratios (RORs) with

95% confidence intervals (CIs) of adverse events reported

for proteasome inhibitors compared to the Food and Drug

Administration Adverse Event Reporting System (FAERS).

Figure 2. Forest plot of reporting odds ratios (RORs) with 95%

confidence intervals (CIs) of adverse events reported for ixazomib

and carfilzomib compared to bortezomib.

Discussion

The results of this study suggest a higher risk of reported PN

with PIs, but when compared individually, there is lower risk

with the new-generation PIs. PIs have become the standard

of care in the treatment of MM. Recent data indicate higher

levels of treatment-related toxicities with BTZ. For instance,

the multicenter ENDEAVOR trial, which entailed a head-tohead

comparison of BTZ versus CFZ in patients with relapsed or

refractory MM, reported ≥ grade 2 PN in 32% of patients in the

BTZ group compared to 6% in the CFZ group [9]. This analysis

further substantiates these results and suggests that BTZ is

more likely to be linked to reported PN than CFZ. Moreover,

the ENDEAVOR and CLARION trials have consistently shown

improved progression-free survival rates with CFZ that suggest

it to be a more tolerable and potentially more efficacious option

[9,10]. The present study also suggests a significantly lower

likelihood of PN reported with IZB compared to BTZ.

Moreover, among the new-generation PIs, the post-marketing

data showed a higher number of PN events reported to the

FAERS with IZB versus CFZ despite later approval. During

the safety analysis of single-agent CFZ in phase II clinical

trials, the overall rate of PN was 13.9%. Furthermore, the

majority of patients (87.3%) with baseline PN did not report

worsening of PN while receiving CFZ [11]. On the contrary, the

TOURMALINE-MM1 clinical trial showed a higher incidence

of PN with the addition of IZB to a regimen of lenalidomidedexamethasone

(27% in the IZB group and 22% in the

placebo group) [12]. This may suggest a higher propensity

of developing PN with IZB. Although no head-to-head

studies have compared AE profiles between the two newergeneration

PIs, the potential for this treatment limiting AEs

should be further substantiated in clinical analyses in the

standard of care setting.

Although the FAERS database gives insight into important

long-term trends associated with medications, some limitations

should be recognized. It is a heterogeneous database that

only allows for retrospective review. As such, treatment

recommendations should not be derived from these findings,

but this work does identify potential trends in toxicities that

should be monitored and validated in additional studies.

Additionally, the true incidence of an event occurring cannot

be determined since the ratio of events occurring is based on

total AEs rather than the true number of patients receiving

medication. Moreover, the FAERS provides limited data about

patients’ baseline comorbidities, thus introducing possible

confounding factors that could serve as a predisposition to PN,

including diabetes. Finally, PIs are typically given in combination

with other myeloma agents that may predispose to PN. It is

important to recognize that these patients were likely exposed

to BTZ prior to trials of CFZ or IZB, as the new-generation PIs are

220



rarely used as frontline therapy. It is possible that these agents

further impacted the risk of PN development in these patients.

Ethics

Regarding the ethics approval and informed consent; in this

analysis, we used public data published by the FDA so both are

not applicable.


Concept: S.A.M., I.N.M., SK.H., Design: S.A.M., I.N.M., E.A.B., H.S.,

S.R.P., J.X., S.K.H., Data Collection or Processing: S.A.M., I.N.M.,

E.A.B., J.X., H.S., Analysis or Interpretation: S.A.M., I.N.M., E.A.B.,

S.R.P., J.X., SK.H., Literature Search: I.N.M., S.A.M., Writing:

S.A.M., I.N.M., S.K.H.


authors.



References

1. Siegel R, Miller K, Fuchs H, Jemal A. Cancer statistics, 2021. CA Cancer J Clin

2021;71:7-33.

2. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin

2016;66:7-30.

3. Kazandjian D. Multiple myeloma epidemiology and survival: a unique

malignancy. Semi Oncol 2016;43:676-681.

4. Kumar SK, Rajkumar SV, Dispenzieri A, Lacy MQ, Hayman SR, Buadi FK,

Zeldenrust SR, Dingli D, Russell SJ, Lust JA, Greipp PR. Improved survival in

multiple myeloma and the impact of novel therapies. Blood 2008;111:2516-

2520.

5. Beijers AJ, Vreugdenhil G, Oerlemans S, Eurelings M, Minnema MC, Eeltink

CM, van de Poll-Franse LV, Mols F. Chemotherapy-induced neuropathy

in multiple myeloma: influence on quality of life and development of a

questionnaire to compose common toxicity criteria grading for use in daily

clinical practice. Support Care Cancer 2016;24:2411-2420.

6. Velasco R, Alberti P, Bruna J, Psimaras D, Argyriou AA. Bortezomib and

other proteosome inhibitors—induced peripheral neurotoxicity: from

pathogenesis to treatment. J Peripher Nerv Syst 2019;24:S52-62.

7. Arastu-Kapur S, Anderl JL, Kraus M, Parlati F, Shenk KD, Lee SJ, Muchamuel

T, Bennett MK, Driessen C, Ball AJ, Kirk CJ. Nonproteasomal targets of the

proteasome inhibitors bortezomib and carfilzomib: a link to clinical adverse

events. Clin Cancer Res 2011;17:2734-2743.

8. Kirk CJ, Jiang J, Muchamuel T, Dajee M, Swinarski D, Aujay M, Bennett MK,

Yang J, Lewis E, Laidig G, Molineaux CJ. The selective proteasome inhibitor

carfilzomib is well tolerated in experimental animals with dose intensive

administration. Blood 2008;11211:2765 (abstract).

9. Dimopoulos MA, Goldschmidt H, Niesvizky R, Joshua D, Chng WJ, Oriol A,

Orlowski RZ, Ludwig H, Facon T, Hajek R, Weisel K. Carfilzomib or bortezomib

in relapsed or refractory multiple myeloma (ENDEAVOR): an interim overall

survival analysis of an open-label, randomised, phase 3 trial. Lancet Oncol

2017;18:1327-1337.

10. ClinicalTrials.gov. Phase 3 Study of Carfilzomib, Melphalan, Prednisone vs

Bortezomib, Melphalan, Prednisone in Newly Diagnosed Multiple Myeloma

(CLARION). Last Update: 2019. Available online at https://clinicaltrials.gov/

ct2/show/NCT01818752.

11. Martin TG. Peripheral neuropathy experience in patients with relapsed

and/or refractory multiple myeloma treated with carfilzomib. Oncology

(Williston Park) 2013;27(Suppl 3):4-10.

12. Moreau P, Masszi T, Grzasko N, Bahlis NJ, Hansson M, Pour L, Sandhu I,

Ganly P, Baker BW, Jackson SR, Stoppa AM. Oral ixazomib, lenalidomide,

and dexamethasone for multiple myeloma. N Engl J Med 2016;374:1621-

1634.

221

Beken S. et al: Intrauterine Arterial Ischemia

IMAGES IN HEMATOLOGY

DOI: 10.4274/tjh.galenos.2020.2020.0530


Extremity Necrosis Due to Intrauterine Arterial Ischemia

İntrauterin Arteriyel İskemiye Bağlı Gelişen Ekstremite Nekrozu

Serdar Beken 1 , Kerim Sarıyılmaz 2 , Eda Albayrak 3 , Arzu Akçay 4 , Ayşe Korkmaz 1

1Acıbadem University Faculty of Medicine, Department of Pediatrics, Neonatology Subdivision, İstanbul, Turkey

2Acıbadem University Faculty of Medicine, Department of Orthopedics, İstanbul, Turkey

3Acıbadem University Faculty of Medicine, Department of Pediatrics, İstanbul, Turkey

4Acıbadem University Faculty of Medicine, Department of Pediatrics, Pediatric Hematology Subdivision, İstanbul, Turkey

Figure 1. (a-d) Left lower extremity was rudimentary, pale, shorter than

the right, and had a club-foot deformity. The demarcation line became

clear on the 5 th day and amputation was performed under the left hip

joint.



Address for Correspondence/Yazışma Adresi: Serdar Beken, M.D., Acıbadem University Faculty of Medicine,

Department of Pediatrics, Neonatology Subdivision, İstanbul, Turkey

Phone : +90 532 671 31 96

E-mail : serbeken@gmail.com ORCID: orcid.org/0000-0002-8609-2684

Received/Geliş tarihi: September 1, 2020

Accepted/Kabul tarihi: October 13, 2020

222


Beken S. et al: Intrauterine Arterial Ischemia

A preterm male infant weighing 1230 g was delivered by cesarean

section at 32 1/7 gestational weeks. His twin weighed 1300 g and

neither required resuscitation. On physical examination, the left

lower extremity was rudimentary, pale, shorter than the right,

and had a club-foot deformity. Computerized tomographic

angiography demonstrated a bluntly filled femoral artery with

no distal passage. During follow-up, the demarcation line

became clear on the 5 th day and amputation was performed

under the left hip joint (Figure 1).

Laboratory tests including homocysteine, folate, prothrombin

time, activated partial thromboplastin time, protein C and S

activity, fibrinogen, and antithrombin III activity were within

normal limits according to gestational age, except for high

D-dimer (4.13 mg/dL). Antiphospholipid and anticardiolipin

antibodies were also negative. The patient was found to be

homozygous for methylenetetrahydrofolate reductase C677T;

thrombosis was not observed in histopathological examination.

The patient was successfully discharged from the hospital on

the 40 th day of life.

Arterial ischemia of the limb can be seen after thromboembolic

events or vascular interventions [1,2]. Ischemic changes present

at birth suggested intrauterine onset causes that might be

attributable to occlusive vascular disruption [3]. Diminished

blood flow altered normal soft tissue and osseous growth and

resulted in ischemia in fetal life, ending with limb loss.

Keywords: Newborn, Ischemia, Arterial

Anahtar Sözcükler: Yenidoğan, İskemi, Arteriyel

Informed Consent: It was received.


Surgical and Medical Practices: S.B., K.S., E.A, A.A., A.K.; Literature

Search: S.B., K.S., E.A, A.A., A.K.; Writing: S.B., K.S., A.K.


authors.



References

1. Wang SK, Lemmon GW, Drucker NA, Motaganahalli RL, Dalsing MC, Gutwein

AR, Gray BW, Murphy MP. Results of nonoperative management of acute

limb ischemia in infants. J Vasc Surg 2018;67:1480-1483.

2. Bekmez S, Beken S, Dinç T, Dursun A, Zenciroğlu A, Dilli D, Okumuş N. Lower

extremity amputation in a preterm infant due to MTHFR homozygosity.

Genet Couns 2014;25:245-249.

3. Turnpenny PD, Stahl S, Bowers D, Bingham P. Peripheral ischemia and

gangrene presenting at birth. Eur J Pediatr 1992;151:550-554.

223

Filizoğlu and Özgüven: Myeloid Sarcoma Involving the Testicular Vein


DOI: 10.4274/tjh.galenos.2020.2020.0436


Myeloid Sarcoma Involving the Testicular Vein

Testiküler Veni Tutan Myeloid Sarkom

Nuh Filizoğlu,

Salih Özgüven

Marmara University Pendik Training and Research Hospital, Clinic of Nuclear Medicine, İstanbul, Turkey

Figure 1. (A-C) F18-FDG PET/CT after left orchiectomy depicted moderate hypermetabolic metastatic retrocrural and paraaortic lymph

nodes and multiple intense hypermetabolic foci along the course of the left testicular vein extending up to the left renal vein suggesting

testicular vein infiltration of myeloid sarcoma (arrows).

F18-FDG PET/CT: F18-fluorodeoxyglucose positron emission tomography/computed tomography.

A 66-year-old man with a diagnosis of acute myeloid leukemia

(AML) type M4 in 2017 who had undergone allogeneic

hematopoietic stem cell transplantation in January 2018

presented with painless, nontender left hemiscrotal swelling.

The patient underwent unilateral radical orchiectomy and

histopathology revealed myeloperoxidase-, CD33-, and CD117-

positive and CD34-negative infiltration of AML in the testis

and local spread into the spermatic cord, rete testis, epididymis,

tunica albuginea, and the surrounding soft tissue suggesting

myeloid sarcoma (MS). F18-fluorodeoxyglucose positron

emission tomography/computed tomography (FDG PET/CT) after

left orchiectomy depicted moderate hypermetabolic metastatic

retrocrural and paraaortic lymph nodes and multiple intense

hypermetabolic foci along the course of the left testicular



Address for Correspondence/Yazışma Adresi: Nuh Filizoğlu, M.D., Marmara University Pendik Training and Research

Hospital, Clinic of Nuclear Medicine, İstanbul, Turkey

Phone : +90 536 495 38 49

E-mail : nuhfilizoglu@gmail.com ORCID: orcid.org/0000-0002-9139-9752

Received/Geliş tarihi: July 29, 2020

Accepted/Kabul tarihi: October 15, 2020

224


Filizoğlu and Özgüven: Myeloid Sarcoma Involving the Testicular Vein

vein extending up to the left renal vein, suggesting testicular

vein infiltration of MS (arrows in Figures 1A-1C). MS is a rare

neoplasm of leukemic cells that infiltrates extramedullary soft

tissue. Testicular involvement of MS is an uncommon entity,

especially following hematopoietic stem cell transplantation,

and invasion of MS into the spermatic cord and testicular vein

is even rarer [1,2]. Although FDG PET/CT is well established for

detecting, staging, and monitoring response to treatment in

MS, this is an extremely rare condition of testicular involvement

with invasion of the testicular vein not described before [3,4].

Keywords: Myeloid sarcoma, Testicular vein, Leukemia

Anahtar Sözcükler: Myeloid sarkom, Testiküler ven, Lösemi



Concept: S.Ö.; Design: S.Ö.; Data Collection or Processing: N.F.;

Analysis or Interpretation: N.F.; Literature Search: N.F.; Writing:

N.F.


authors.



References

1. Almond LM, Charalampakis M, Ford SJ, Gourevitch D, Desai A. Myeloid

sarcoma: presentation, diagnosis, and treatment. Clin Lymphoma Myeloma

Leuk 2017;17:263-267.

2. Valbuena JR, Admirand JH, Lin P, Medeiros LJ. Myeloid sarcoma involving

the testis. Am J Clin Pathol 2005;124:445-452.

3. Stölzel F, Röllig C, Radke J, Mohr B, Platzbecker U, Bornhäuser M, Paulus

T, Ehninger G, Zöphel K, Schaich M. 18 F-FDG-PET/CT for detection of

extramedullary acute myeloid leukemia. Haematologica 2011;96:1552-

1556.

4. Niu N, Cui R, Li F. FDG PET/CT findings of intracardiac myeloid sarcoma. Clin

Nucl Med 2016;41:235-236.

225

Öztaş M. et al: Giant Cell Arteritis with Concomitant Chronic Myelomonocytic Leukemia


DOI: 10.4274/tjh.galenos.2020.2020.0357


Giant Cell Arteritis with Concomitant Chronic Myelomonocytic

Leukemia

Eşzamanlı Kronik Myelomonositik Lösemi ile Dev Hücreli Arterit

Mert Öztaş 1 , Ilkın Muradov 2 , Abdülkadir Erçalışkan 3 , Ahu Senem Demiröz 4 , Şebnem Batur 4 , Ahmet Emre Eşkazan 3 ,

Serdal Uğurlu 1

1İstanbul University-Cerrahpaşa, Cerrahpaşa Faculty of Medicine, Department of Rheumatology, İstanbul, Turkey

2İstanbul University-Cerrahpaşa, Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, İstanbul, Turkey

3İstanbul University-Cerrahpaşa, Cerrahpaşa Faculty of Medicine, Department of Hematology, İstanbul, Turkey

4İstanbul University-Cerrahpaşa, Cerrahpaşa Faculty of Medicine, Department of Pathology, İstanbul, Turkey

Figure 1. PET-CT showed aortic arch involvement and diffuse

bone marrow FDG uptake.

PET-CT: Positron emission tomography-computed tomography, FDG:

fluorodeoxyglucose

Figure 2. a) Bone marrow aspiration showed monocytic cells of

over 20% and monoblasts of 7%, with dysplasia in all cell lineages

(Giemsa 1000 x ). b) Bone marrow biopsy showed hyperplasia

and dysplasia in all cell lineages (hematoxylin & eosin, 400 x ). c)

Immunohistochemically, MPO is positive in very few cells (400 x ).

d) CD33 showed that monocytic cells are increased (400 x ).



Address for Correspondence/Yazışma Adresi: Serdal Uğurlu, M.D., İstanbul University-Cerrahpaşa, Cerrahpaşa

Faculty of Medicine, Department of Rheumatology, İstanbul, Turkey

E-mail : serdalugurlu@gmail.com ORCID: orcid.org/0000-0002-9561-2282

Received/Geliş tarihi: June 29, 2020

Accepted/Kabul tarihi: July 23, 2020

226


Öztaş M. et al: Giant Cell Arteritis with Concomitant Chronic Myelomonocytic Leukemia

A 62-year-old man with no previous medical conditions was

hospitalized with constitutional symptoms, which had started

within the past 2 months. He described recurrent fever

(>39 °C), weight loss, and headache. Initial physical examination

was unremarkable except for pallor of conjunctiva and

fever (39.3 °C). His hemoglobin was 7.5 g/dL (normal range:

13-17.2 g/dL), while white blood cell (WBC) and platelet

counts were 22.8x10 9 /L (normal: 4.3-10.3x10 9 /L) and 58.3x10 9 /L

(normal: 150-400x10 9 /L), respectively. He also had remarkable

monocytosis of 6.2x10 9 /L (normal: 0.3-0.9x10 9 /L). He had

elevated C-reactive protein of 150 mg/L (normal: <5 mg/L) and

an erythrocyte sedimentation rate of 140 mm/h. His blood and

urine cultures were sterile. On the suspicion of vasculitis and

in order to exclude concomitant malignancy, positron emission

tomography-computed tomography (PET-CT) was ordered,

which showed both aortic arch and ascending aorta involvement

without any signs of solid tumors (Figure 1). Diffuse bone

marrow fluorodeoxyglucose uptake was also observed on PET-CT.

Fragmentation of the lamina elastica interna was detected upon

temporal artery biopsy without any sign of active vasculitis. He

was diagnosed with giant cell arteritis (GCA) based on his age,

initial erythrocyte sedimentation level, headache, fever, and

large vessel involvement in PET-CT. He was further diagnosed

with chronic myelomonocytic leukemia (CMML) with peripheral

blood monocytosis (≥1x10 9 /L and monocytes accounting for

≥10% of the WBC differential count) [1]. Peripheral blood smear

revealed 8% blasts and bone marrow aspiration and biopsy were

consistent with CMML-1 (Figure 2). Prednisolone was initiated

at 40 mg/daily and his constitutional complaints were resolved.

Azacytidine was planned to be initiated for CMML, but the

patient decided to receive this treatment in his hometown.

While the pathogenic link between GCA and CMML has not been

clearly established so far, an association is commonly observed

between GCA and myelodysplastic syndromes [2].

Keywords: Giant cell arteritis, Vasculitis, Chronic myelomonocytic

leukemia, Leukemia

Anahtar Sözcükler: Dev hücreli arterit, Vaskülit, Kronik

myelomonositik lösemi, Lösemi

Informed Consent: Informed consent was obtained from the

individual participant included in this study.

Author Contributions

Concept: M.Ö., A.E.E., S.U; Design: M.Ö.; Data Collection or

Processing: I.M., M.Ö., A.E., A.S.D, S.B.; Interpretation: M.Ö.,

A.E.E., S.U.; Literature Search: M.Ö.; Writing: M.Ö., A.E.E., S.U.


authors.



References

1. Arber DA, Orazi A, Hasserjian R, Thiele J, Borowitz MJ, Le Beau MM,

Bloomfield CD, Cazzola M, Vardiman JW. The 2016 revision to the World

Health Organization classification of myeloid neoplasms and acute

leukemia. Blood 2016;127:2391-2405.

2. Roupie AL, de Boysson H, Thietart S, Carrat F, Seguier J, Terriou L, Versini M,

Queyrel V, Groh M, Benhamou Y, Maurier F, Decaux O, d’Aveni M, Rossignol

J, Galland J, Solary E, Willems L, Schleinitz N, Ades L, Dellal A, Samson M,

Aouba A, Fenaux P, Fain O, Mekinian A; on behalf of MINHEMON (French

Network of Dysimmune Disorders Associated with Hemopathies). Giant-cell

arteritis associated with myelodysplastic syndrome: French multicenter case

control study and literature review. Autoimmun Rev 2020;19:102446.

227

LETTERS TO THE EDITOR


Flower-Like Plasma Cell: A Comment

Çiçek Benzeri Plazma Hücresi: Bir Yorum

Smeeta Gajendra

Laboratory Oncology Unit, Dr. B.R.A. IRCH, AIIMS, New Delhi, India

To the Editor,

I read “Flower-Like Plasma Cell Nuclei in Multiple Myeloma”

by Sall et al. [1], recently published in this journal. This image

report is very descriptive and informative regarding a case of

multiple myeloma showing abnormal plasma cells with flowershaped

nuclear features. These morphological features can pose

a diagnostic dilemma and can mimic lymphoma as “flower

cells” or clover-leaf lymphocytes are described typically in

HTLV-1-induced adult T-cell leukemia and very rarely in B-cell

lymphoma [2]. Plasma cell myeloma or leukemia rarely presents

with flower‐shaped nuclei and occasional cases of plasma cell

leukemia mimicking adult T-cell leukemia/lymphoma were

previously reported in the literature [3,4]. Upon flowcytometric

immunophenotyping, the absence of B-cell or T-cell markers

and the presence of plasma cell markers with strong CD38

and CD138 help in differentiating it from lymphoma. The

morphological variation of abnormal plasma cells in plasma cell

neoplasms is vast, ranging from small lymphocyte-like cells to

cleaved, convoluted, monocytoid or multilobated plasma cells

to anaplastic pleomorphic large plasma cells, which have been

reported previously. A few cases of morphological variants of

plasma cell neoplasms, like megakaryocytic, plasmoblastic, or

megakaryoblastic mimicking acute leukemia, have also been

reported in the literature [5]. The presence of cytoplasmic

granulations, vacuolations, crystals (mimicking histiocytes),

Auer rod-like inclusions, or cytoplasmic projections has also

been noted in the literature. Morphological transformation

of plasma cells into multilobated nuclei during the clinical

course followed by anaplastic myeloma transformation is

also occasionally reported [6]. Circulating cells with cleaved,

multilobated, or monocytoid nuclei can be present in a variety

of non-hematologic and hematologic disorders, such as reactive

plasmacytosis associated with breast carcinoma, metastatic

carcinoma, plasma cell leukemia, myelomonocytic leukemia,

malignant lymphoma, and multiple myeloma [7]. Autoimmune

disorders, hepatitis C, human immunodeficiency virus

infections, angioimmunoblastic T-cell lymphoma, and Hodgkin

lymphoma are a few examples in which reactive plasmacytosis

of bone marrow may reach levels of up to 30%-50%. Abnormal

plasma cells can be differentiated from normal or reactive

plasma cells on flowcytometric immunophenotyping as

abnormal plasma cells are mostly CD19-, CD20+, CD27-, CD28+,

CD117+, CD56+, CD33+, CD200++, CD307++, CD81-weak to

-negative, and clonal for kappa or lambda immunoglobulin

[8]. The presence of flower cells in this case demonstrates

the use of immunophenotyping and FISH/cytogenetic studies

in the classification of atypical, multilobated flower-shaped

mononuclear cells and also that flower cell morphology is not

restricted only to lymphomas. Sometimes neoplastic plasma

cells exhibit cytoplasmic heterogeneity, which poses difficulty

in morphological diagnosis and requires ancillary technology

like biopsy with immunohistochemistry or immunophenotyping

for a definitive diagnosis.

Keywords: Flower cells, Plasma cell myeloma, Flowcytometric

immunophenotyping, Immunohistochemistry

Anahtar Sözcükler: Çiçek hücreler, Plazma hücre myelom, Akım

sitometrik immün fenotipleme, İmmünohistokimya

Financial Disclosure: The author declared that this study


References

1. Sall A, Seck M, Samb D, Faye B, Gadji M, Diop S, Touré AO. Flower-like

plasma cell nuclei in multiple myeloma. Turk J Hematol 2021;38:153-154.

2. Singh N, Gandhi J, Agrawal N, Panaych A, Tejwani N, Mehta A. Diagnostic

dilemma in the morphological detection of flower cells in lymphomas.

Indian J Hematol Blood Transfus 2017;33:614-616.

3. De Miguel Sánchez C, Robles de Castro D, Pisón Herrero C, Pérez Persona

E, Salcedo Cuesta L, Guinea de Castro JM. Primary plasma cell leukaemia

presenting with flower-shaped nuclei. Br J Haematol 2021;193:689.

4. Shibusawa M. Plasma cell leukaemia presenting as flower-shaped plasma

cells mimicking adult T-cell leukaemia or lymphoma. Lancet Haematol

2020;7:e270.

5. Liu K, Song H, Shi J, Zhang W, Mu R, Li L. Rare case of plasma cell myeloma

with megakaryoblastic morphology mimicking acute leukemia. Indian J

Pathol Microbiol 2020;63:485-487.

6. Fujimi A, Nagamachi Y, Yamauchi N, Kanisawa Y. Morphological

transformation of myeloma cells into multilobated plasma cell

nuclei within 7 days in a case of secondary plasma cell leukemia

that finally transformed as anaplastic myeloma. Case Rep Hematol

2017;2017:5758368.

7. Yeh YA, Pappas AA, Flick JT, Butch AW. A case of aggressive multiple

myeloma with cleaved, multilobated, and monocytoid nuclei, and no serum

monoclonal gammopathy. Ann Clin Lab Sci 2000;30:283-288.

228



8. Flores-Montero J, de Tute R, Paiva B, Perez JJ, Böttcher S, Wind H,

Sanoja L, Puig N, Lecrevisse Q, Vidriales MB, van Dongen JJ, Orfao A.

Immunophenotype of normal vs. myeloma plasma cells: toward antibody

panel specifications for MRD detection in multiple myeloma. Cytometry B

Clin Cytom 2016;90:61-72.



Address for Correspondence/Yazışma Adresi: Smeeta Gajendra, M.D., Laboratory Oncology Unit, Dr. B.R.A.

IRCH, AIIMS, New Delhi, India

Phone : 9013590875

E-mail : drsmeeta@gmail.com ORCID: orcid.org/0000-0002-1759-7857

Received/Geliş tarihi: April 12, 2021


DOI: 10.4274/tjh.galenos.2021.2021.0230

REPLY FROM THE AUTHORS

We thank Dr. Gajendra for the interest shown in our article.

She described in detail the morphological abnormalities, both

nuclear and cytoplasmic, of tumoral plasma cells as well as

reactive plasma cells.

We fully agree with her that, when in doubt, immunophenotyping

is an indispensable tool for distinguishing plasma cells.

Unfortunately, we do not have the cytogenetics to deepen this

characterization.

Regards,

Abibatou Sall, Moussa Seck, Diama Samb, Blaise Félix Faye,

Macoura Gadji, Saliou Diop, Awa Oumar Touré

Myeloma and Cystoisospora belli

Myelom ve Cystoisospora belli

Pathum Sookaromdee 1 , Viroj Wiwanitkit 2

1Private Academic Consultant, Bangkok, Thailand

2Honorary Professor, Dr. D.Y. Patil University, Pune, India

To the Editor,

We would like to share our ideas on “Prolonged Severe Watery

Diarrhea in a Long-Term Myeloma Survivor: An Unforeseen

Infection with Cystoisospora belli” regarding multiple

myeloma (MM) patients [1]. Tiryaki et al. [1] concluded that

“Parasitic infections are very uncommon… In MM diarrhea

points mainly to infection in acute or chronic form,” further

noting that, to their best knowledge, “this [was] the first

case of a patient with MM with C. belli infection” [1]. The

incidence of parasitic infection is usually associated with

local geography. In developing countries without good

hygienic foundations, parasitic infections are common

but there is usually no routine screening of MM patients.

In a recent report from Brazil, de Castro et al. [2] studied

infectious diarrhea in autologous stem cell transplantation

cases, including myeloma patients, and found that there

were many parasitic infections including C. belli infections. In

conclusion, we suggest a new recommendation for screening

for parasitic infection in any patients with MM and other

hematological malignancies.

Anahtar Sözcükler: Kan, Kanser, Myelom, Cystoisospora


Concept: P.S., V.W.; Design: P.S., V.W.; Data Collection or

Processing: P.S., V.W.; Analysis or Interpretation: P.S., V.W.;

Literature Search: P.S., V.W.; Writing: P.S., V.W.


authors.



References

1. Tiryaki TO, Anıl KU, Büyük M, Yıldırım AY, Atasoy A, Örmeci AC, Beşışık SK.

Prolonged severe watery diarrhea in a long-term myeloma survivor: an

unforeseen infection with Cystoisospora belli. Turk J Hematol 2021;38:171-

173.

2. de Castro MD, Chebli JM, Costa LJ, Alves KRL, Atalla A, Neto AEH. Infectious

diarrhea in autologous stem cell transplantation: high prevalence of coccidia

in a South American center. Hematol Transfus Cell Ther 2018;40:132-135.

Keywords: Blood, Cancer, Myeloma, Cystoisospora

229





Address for Correspondence/Yazışma Adresi: Pathum Sookaromdee, M.D., Private Academic Consultant,

Bangkok, Thailand

E-mail : pathumsook@gmail.com ORCID: orcid.org/0000-0002-8859-5322

Received/Geliş tarihi: June 8, 2021

Accepted/Kabul tarihi: July 25, 2021

DOI: 10.4274/tjh.galenos.2021.2021.0356

REPLY FROM THE AUTHORS

We have reviewed the commentary by Sookaromdee and

Wiwanitkit and our reply is as follows.

We observed a patient with long-term multiple myeloma

(MM) and an infrequent infection with Cystoisospora belli

[1]. An intestinal-type chronic diarrhea was the only symptom

contributing to the diagnosis. We wished to emphasize

awareness of C. belli infection in MM patients. Sookaromdee

and Wiwanitkit are of the same opinion as they mentioned the

importance of C. belli infection in MM patients and emphasized

that recommendations should be developed based on

regional characteristics, especially in relation to poor hygiene

conditions. They also cited an original study reported from

Brazil to demonstrate that the infection could be observed in

this patient population [2]. The mentioned study included 47

hematological malignancy patients and evaluated the infectious

complications in patients who underwent autologous stem cell

transplantation. The number of MM patients was 29. The study

did not specify infectious agents according to primary diagnosis.

The only result given in that study that might be pertinent for

C. belli infection was that the authors observed 7 coccidia cases.

Coccidia subgroups were not defined. For that reason, we did

not cite that study in our original manuscript. Indeed, our aim

was similar to that of Sookaromdee and Wiwanitkit; when

treating MM patients from variable hygienic backgrounds with

the complication of diarrhea, C. belli should be considered. Thus,

the letter above supports our original argument.

Tarık Onur Tiryaki, Kadir Uluç Anıl, Melek Büyük,

Ahmet Yasir Yıldırım, Alp Atasoy, Aslı Çiftçibaşı Örmeci,

Sevgi Kalayoğlu Beşışık

References

1. Tiryaki TO, Anıl KU, Büyük M, Yıldırım AY, Atasoy A, Örmeci AC, Beşışık SK.

Prolonged severe watery diarrhea in a long-term myeloma survivor: an

unforeseen infection with Cystoisospora belli. Turk J Hematol 2021;38:171-

173.

2. de Castro MD, Chebli JM, Costa LJ, Alves KRL, Atalla A, Neto AEH. Infectious

diarrhea in autologous stem cell transplantation: high prevalence of coccidia

in a South American center. Hematol Transfus Cell Ther 2018;40:132-135.

Lenalidomide Combined with Interferon α-1b and Interleukin-2 in

the Treatment of 21 Cases of Acute Myeloid Leukemia

Yirmi Bir Akut Myeloid Lösemi Olgusunda İnterferon α-1b ve Interlökin-2 ile Birlikte

Lenalidomid Tedavisi

Cheng Cheng*, Ruihua Mi*, Dongbei Li, Lin Chen, Xudong Wei

Affiliated Tumor Hospital of Zhengzhou University, Henan Cancer Hospital, Department of Hematology, Zhengzhou, China

*These authors contributed equally to this work.

To the Editor,

The prognosis of patients with refractory/relapsed acute

myeloid leukemia (R/R AML) is extremely poor and the longterm

survival rate is less than 10%. Minimal residual disease

(MRD) is an important independent prognostic indicator of

AML, indicating a higher risk of recurrence; thus, it is vital

for the prognosis of patients to eliminate MRD [1,2]. Our

center previously used thalidomide combined with interferon

α-1b (IFN α-1b) and interleukin-2 (IL-2) in the treatment

of R/R AML and the total effective rate was 50% [3,4]. We

further optimized the treatment plan, adjusted thalidomide

to lenalidomide, and applied it for 21 patients with R/R AML

or MRD.

All patients were treated with lenalidomide combined with

the IFN α-1b and IL-2 regimen. The specific treatment plan

was as follows: oral administration of lenalidomide capsule,

230



10-25 mg, every night; IFN-α1b, 60 µg; and IL-2, 1,000,000 U

subcutaneous injection, once every other day. Each treatment

cycle lasted 4 weeks. This retrospective analysis was approved by

the Institutional Review Board of Henan Cancer Hospital.

Among 17 patients with R/R AML, 7 patients had complete

remission (CR), 2 had CR with incomplete recovery of blood

cells (CRi), and 8 had no remission. One patient in the

low-risk group achieved CR, while the remission rate in the

intermediate-risk group and high-risk group was 57.1%

(4/8) and 50% (4/8), respectively. Of 3 patients with TET2

mutations, 2 patients achieved remission; 6 patients with

FLT3-ITD/TKD mutations were given sorafenib at the same

time and 3 patients achieved remission. Particularly, among

the 4 MRD-positive patients with remission of AML, the MRD

of 3 patients was lower than before and the MRD of 1 patient

was higher than before. These patients’ clinical data are

presented in Table 1. The total effective rate (CR+CRi+MRD

decreased) of 21 patients was 57.1%. No treatment-related

deaths occurred. The median overall survival time of the

21 patients was 26 months (9-89 months), and the 3-year

survival rate reached 42.9%. Among patients with effective

application of this regimen, the duration of relief ranged

from 2 to 28+ months.

IFN can directly kill AML by inhibiting growth-promoting

cytokines, inducing apoptosis, and inhibiting cell proliferation.

Meanwhile, it is possible to indirectly target AML cells

through the immunostimulatory effects of interferon on

dendritic cells, T-cells, and natural killer (NK) cells [5,6]. IL-2

increases the proliferation and activity of cytotoxic T-cells,

NK-cells, and killer cells activated by lymphokines. It can also

promote the secretion of antibodies and interferon to play an

anti-tumor role [7]. Lenalidomide promotes tumor cell

apoptosis by inhibiting the secretion of tumor necrosis factor

α, IL-1, and IL-12. It also produces an anti-tumor effect by

inhibiting the secretion of overexpressed vascular endothelial

growth factor [8,9,10].

The combination of lenalidomide, IFN α-1b, and IL-2 showed

improvements in efficacy and safety profiles as compared to

monotherapy among patients with R/R AML, and especially

in the elimination of MRD, and it may become a promising

treatment regimen.

Keywords: Acute myeloid leukemia, Refractory/relapsed,

Minimal residual disease, Lenalidomide, Interferon α-1b,

Interleukin-2

Anahtar Sözcükler: Akut myeloid lösemi, Dirençli/nüks, Minimal

kalıntı hastalık, Lenalidomid, İnterferon α-1b, İnterlökin-2

Table 1. Clinical data of 21 patients with refractory/relapsed or minimal residual disease-positive acute myeloid leukemia treated with lenalidomide combined with

interferon α-1b and interleukin-2.

OS

(months)

Duration of

remission

(months)

Remission

status

Bone marrow

cellularity

Marrow blasts

(%) before the

application of

the regimen

Status

NCCN risk

category

FAB

typing

Gene mutation

Karyotype at first

diagnosis

Age

(years)

No. Sex

1 F 53 Normal TET2 M2a Intermediate Refractory 14% Hypocellular CR 5 16

2 M 63 Complex karyotype TET2 M2a High Refractory 39% Normocellular NR - 9

3 M 59 Normal (-) M5b Intermediate Refractory 68% Hypercellular NR - 11

4 F 36 Normal U2AF1 M0 Intermediate First relapse 53% Normocellular NR - 20

5 F 57 Normal FLT3-ITD M1 High Second relapse 10% Normocellular NR - 15

6 M 60 Normal FLT3-ITD, IDH1, NPM1 M1 Intermediate First relapse 1.6% Normocellular CR 4 26

7 F 60 Normal (-) M2a Intermediate Second relapse 12.5% Hypocellular CRi 20 71

8 F 65 Normal DNMT3A M2a High First relapse 5% Normocellular CR 8 17

9 M 61 Normal ASXL1, PHF6 M2a High Second relapse 12.5 Hypocellular CR 7 44

10 F 66 Normal (-) M2a Low Second relapse 14.8%, Normocellular NR - 89

C-KIT M2b Intermediate Second relapse 7.9% Normocellular CRi 11 54

46,XX,t(8,21)

(q22,q22)

11 F 59

231



Table 1. Continued.

OS

(months)

Duration

of

remission

(months)

Remission

status

Bone marrow

cellularity

Marrow blasts

(%) before the

application of

the regimen

Status

NCCN risk

category

FAB

typing

Gene mutation

Karyotype

at first

diagnosis

Age

(years)

No. Sex

FLT3-ITD M2b High Second relapse 9.8% Normocellular CR 14 53

46,XY,t(8;21)

(q22;q22)

12 M 68

13 M 59 Normal FLT3-ITD M4 High First relapse 4.8% Hypocellular NR - 22

14 M 67 47,XY,+8[10] (-) M4 Intermediate First relapse 12.4% Normocellular NR - 28

M5 High First relapse 27.2% Normocellular NR - 20

FLT3-TKD, DNMT3A,

NPM1

15 M 55 Normal

16 F 58 Normal TET2 M5b Intermediate First relapse 48% Hyperactive CR 2 18

17 F 43 Normal FLT3-ITD, NPM1 M7 High First relapse 12.2% Normocellular CR 9 20

Hypocellular CR 22 37

0%, AML-ETO/

ABL 0.010%

(-) M2a Low CR with MRD+

46,XY,t(8;21)

(q22;q22)[10]

18 M 28



Normocellular CR 23 51

0.2%, AML-ETO/

ABL 0.082%

(-) M2b Low CR with MRD+

46,XX,t(8,21)

(q22,q22)[20]

19 M 38

Normocellular CR - 41

0%, CBFB-

MYH11A/ABL

0.016%

M4 Low CR with MRD+

IKZF1, ERG, MLL-

PTD

46,XY,inv(16)

(p13q22)[17]

20 M 47

Hypocellular CR 28 52

0.8%, WT1/ABL

0.40%

IDH2, TET2 M5b High CR with MRD+

46,XY,add

(12)(q24)

(8)/47,idm,

+8(2)

21 M 58

FAB: French-American-British; NCCN: National Comprehensive Cancer Network; OS: overall survival; CR: complete remission; MRD: minimal residual disease; CRi: CR with incomplete recovery of blood cells; NR: no

remission.


Concept: C.C., R.M. D.L., L.C., X.W.; Writing: C.C., R.M.

Conflict of Interest: No conflict of interest was

declared by the authors.

Financial Disclosure: This study was supported

by the Henan Science and Technology Research

Project (No. 192102310056; No. 202102310053).

References

1. Dohner H, Weisdorf DJ, Bloomfield CD. Acute myeloid

leukemia. N Engl J Med 2015;373:1136-1152.

2. Schuurhuis GJ, Heuser M, Freeman S, Béné M-C, Buccisano

F, Cloos J, Grimwade D, Haferlach T, Hills RK, Hourigan CS,

Jorgensen JL, Kern W, Lacombe F, Maurillo L, Preudhomme

C, van der Reijden BA, Thiede C, Venditti A, Vyas P, Wood BL,

Walter RB, Döhner K, Roboz GJ, Ossenkoppele GJ. Minimal/

measurable residual disease in AML: a consensus document

from the European LeukemiaNet MRD Working Party. Blood

2018;131:1275-1291.

3. Wei XD, Ai H, Mi RH, Chen L, Yuan FF, Hao QM, Yin QS,

Wang P, Song YP. Thalidomide combined with interferon

and interleukin-2 in treatment of relapsed or refractory

acute myelogenous leukemia. Zhonghua Nei Ke Za Zhi

2016;5511:875-877.

4. Mi RH, Chen L, Wei XD, Yin QS, Wang MF, Liang LJ, Yuan

FF, Li MJ, Ji XJ, Song YP. Therapeutic effect of combined

use of interferon alpha-1b, interleukin-2 and thalidomide

on reversing minimal residual disease in acute myeloid

leukemia. Zhonghua Xue Ye Xue Za Zhi 2019;40:111-116.

5. Anguille S, Lion E, Willemen Y, Van Tendeloo VF, Berneman

ZN, Smits EL. Interferon-α in acute myeloid leukemia: an

old drug revisited. Leukemia 2011;25:739-748.

6. Ferrantini M, Capone I, Belardelli F. Interferon-α and cancer:

mechanisms of action and new perspectives of clinical use.

Biochimie 2007;89:884-893.

7. Inamoto Y, Fefer A, Sandmaier BM, Gooley TA, Warren

EH, Petersdorf SH, Sanders JE, Storb RF, Appelbaum FR,

Martin PJ, Flowers ME. A phase I/II study of chemotherapy

followed by donor lymphocyte infusion plus interleukin-2

for relapsed acute leukemia after allogeneic hematopoietic

cell transplantation. Biol Blood Marrow Transplant

2011;17:1308-1315.

8. Skarbnik AP, Goy AH. Lenalidomide for mantle cell

lymphoma. Expert Rev Hematol 2015;8:257-264.

9. Ruan J, Martin P, Shah B, Schuster SJ, Smith SM, Furman

RR, Christos P, Rodriguez A, Svoboda J, Lewis J, Katz O,

Coleman M, Leonard JP. Lenalidomide plus rituximab as

initial treatment for mantle-cell lymphoma. N Engl J Med

2015;373:1835-1844.

10. Luo J, Gagne JJ, Landon J, Avorn J, Kesselheim AS.

Comparative effectiveness and safety of thalidomide and

lenalidomide in patients with multiple myeloma in the

United States of America: a population-based cohort study.

Eur J Cancer 2017;70:22-33.

232

Address for Correspondence/Yazışma Adresi: Xudong Wei, Prof., Affiliated Tumor Hospital of Zhengzhou

University, Henan Cancer Hospital, Department of Hematology, Zhengzhou, China

Phone : 0371-65587358

E-mail : xudongwei@zzu.edu.cn ORCID: orcid.org/0000-0002-6289-2011



DOI: 10.4274/tjh.galenos.2021.2020.0050



Shoulder-Pad Sign in a Case of Amyloidosis Associated with

Myeloma

Myelom ile İlişkili Sistemik Amiloidoz Olgusunda Omuz-Yastığı Işareti

Ceren Uzunoğlu 1 , Tayfur Toptaş 2 , Yıldız İpek 2 , Fatma Arıkan 2 , Fergün Yılmaz 2 , Tülin Tuğlular 2

1Marmara University Training and Research Hospital, Clinic of Internal Disease, İstanbul, Turkey

2Marmara University Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey

To the Editor,

A 78-year-old female was admitted with the complaints of

multiple joint swellings that had progressed over 8 months,

involving the shoulders, elbows, wrists, knees, and ankles.

On physical examination, she had generalized edema. The

tongue was enlarged. Joint examination revealed swelling and

tenderness of the bilateral anterior parts of the shoulders,

elbows, wrists, knees, and ankles (Figure 1).

“Shoulder-pad sign” is the prominent appearance of the bilateral

anterior deltoid area. It is rare but suggestive for amyloid

light-chain amyloidosis. It is mostly associated with the kappa

light chain, which has a predilection for amyloid deposition in

periarticular tissues [1].

Her complete blood count and calcium levels were as follows:

leukocytes, 5100/µL; hemoglobin, 5.2 g/dL; hematocrit,

16%; platelets, 313,000/µL; serum calcium, 11.9 mg/dL.

Serum total protein and albumin levels were 4.6 g/dL and

3.0 g/dL, respectively. Serum free light chain kappa, lambda, and

kappa/lambda ratio were 6792 mg/L, 7.31 mg/L, and 929,

respectively. Serum immunofixation electrophoresis was

consistent with the kappa monoclonal band. Proteinuria (5 g)

was identified upon 24-h urine analysis.

Bone marrow biopsy showed plasma cells infiltrating 86% of

bone marrow (Figure 2). No lytic bone lesions were detected on

positron emission tomography-computed tomography, but there

were joint involvements compatible with inflammatory processes.

Significant thickening of the subdeltoid bursa was evident upon

shoulder magnetic resonance imaging (Figure 3). Bone marrow

biopsy with Congo red staining revealed a green birefringent

color representing amyloid deposition. A diagnosis of systemic

amyloidosis associated with multiple myeloma was made.

Figure 2. Bone marrow biopsy showed plasma cells infiltrating

86% of bone marrow.

Figure 1. Joint examination revealed swelling and tenderness of

the bilateral anterior parts of the shoulders, elbows, wrists, knees,

and ankles.

Figure 3. Significant thickening of the subdeltoid bursa was

evident upon shoulder magnetic resonance imaging.

233



In amyloidosis, joint or soft tissue involvement rarely occurs [2]. It

was reported that 3.7% of 191 patients with systemic amyloidosis

had amyloid arthropathy and the shoulders were the most

commonly affected joints [3]. Due to symmetrical joint involvement

with pain, swelling, and limitation of movement, rheumatologic

diseases might be considered in the differential diagnosis.

Keywords: Shoulder pad, Multiple myeloma, Kappa light chain,

AL amyloidosis

Anahtar Sözcükler: Omuz yastığı, Multipl myelom, Kappa hafif

zincir, AL amiloidoz



Concept: C.U., T.T., Y.İ., F.A., F.Y., T.T.; Design: C.U., T.T., Y.İ., F.A.,

F.Y., T.T.; Data Collection or Processing: C.U., T.T., Y.İ., F.A., F.Y.,

T.T.; Analysis or Interpretation: C.U., T.T., Y.İ., F.A., F.Y., T.T.;

Literature Search: C.U., T.T., Y.İ., F.A., F.Y., T.T.; Writing: C.U., T.T.,

Y.İ., F.A., F.Y., T.T.


authors.



References

1. Liepnieks JJ, Burt C, Benson MD. Shoulder-pad sign of amyloidosis: structure

of an Ig kappa III protein. Scand J Immunol 2001;54:404-408.

2. Gertz MA, Lacy MQ, Dispenzieri A, Buadi FK. Immunoglobulin light

chain (AL) amyloidosis. In: Greer JP, Arber DA, Glader BE, List AF, Means

RT Jr, Rodgers GM (eds). Wintrobe’s Clinical Hematology, 14th Edition.

Philadelphia, Wolters Kluwer, 2019.

3. Prokaeva T, Spencer B, Kaut M, Ozonoff A, Doros G, Connors LH, Skinner M,

Seldin DC. Soft tissue, joint, and bone manifestations of AL amyloidosis:

clinical presentation, molecular features, and survival. Arthritis Rheum

2007;56:3858-3868.



Address for Correspondence/Yazışma Adresi: Tayfur Toptaş, M.D., Marmara University Training and

Research Hospital, Clinic of Hematology, İstanbul, Turkey

Phone : +90 505 457 55 57

E-mail : tayfur.toptas@marmara.edu.tr ORCID: orcid.org/0000-0002-2690-8581

Received/Geliş tarihi: October 21, 2020


DOI: 10.4274/tjh.galenos.2021.2021.0630

Sweet Syndrome Associated with Ixazomib

İksazomib ile İlişkili Sweet Sendromu

İrfan Yavaşoğlu,

Zahit Bolaman

Aydın Adnan Menderes University Faculty of Medicine, Department of Hematology, Aydın, Turkey

To the Editor,

A 69-year-old male patient was diagnosed with immunglobulin

G-kappa chain type symptomatic multiple myeloma according

to International Myeloma Working Group criteria (hemoglobin

9.8 g/dL, creatinine 1.5 mg/dL). The case was categorized

as Revised International Staging System (R-ISS) stage 2

[β2-microglobulin 4 mg/L; high risk not detected by fluorescence

in situ hybridization (FISH)], and because of the patient’s renal

failure, he was started on bortezomib-cyclophosphamidedexamethasone.

After eight cycles (stem cell mobilization

was performed after four cycles), peripheral blood stem cell

transplantation with high-dose melphalan was performed with

the patient in full remission. Lenalidomide and dexamethasone

(lenalidomide 25 mg/day, days 1-21; dexamethasone 40 mg/day,

days 1, 8, 15, and 22) were started after a clinical recurrence at

the 26th month of follow-up. The patient was in R-ISS stage 3 at

the time of relapse (FISH with 17p was 12% positive). Ixazomib

(4 mg/day, days 1, 8, and 15) was added to the treatment due

to stable disease findings at the 3 rd month of evaluation. On

the 13 th day of treatment, he presented with a high fever

(38.7 °C) and sudden, painful, 1- to 2-cm-diameter indurated,

erythematous, papular lesions on the front and back of the neck

(Figure 1). Laboratory tests showed a white blood cell count

of 2.1x10 9 /L, neutrophil cell count of 1.4x10 9 /L, hemoglobin

concentration of 8.9 g/dL, and platelet count of 37x10 9 /L. Skin

biopsy revealed marked perivascular neutrophilic inflammatory

infiltration in the dermis, consistent with Sweet syndrome.

While arthralgia and myalgia were present, as seen in cases of

Sweet syndrome, no ocular inflammation, headaches, or oral

or genital lesions appeared. There was no granulocyte colonystimulating

factor usage, the antinuclear antibody (ANA) test

was negative, and no signs of infection were detected. Ixazomib

was stopped. Triamcinolone acetonide (0.1%) was applied

locally. The lesions disappeared significantly by the 10 th day.

One of the common side effects of ixazomib has been reported

234



Keywords: Sweet syndrome, Ixazomib

Anahtar Sözcükler: Sweet sendromu, İksazomib


patient.


Surgical and Medical Practices: İ.Y.; Concept: İ.Y., Z.B.; Design:

İ.Y., Z.B.; Data Collection or Processing: İ.Y.; Analysis or

Interpretation: İ.Y.; Literature Search: İ.Y.; Writing: İ.Y.


authors.

Figure 1. Painful, 1- to 2-cm-diameter indurated, erythematous,

papular lesions.

to be rash (36% in all degrees) [1]. To our knowledge, there is

rarely a relationship between ixazomib and Sweet syndrome

[2,3,4]. Lenalidomide is known to frequently cause rashes and

rarely Sweet syndrome. This usually occurs shortly after its

use [5]. No skin lesions were observed in our patient during 3

months of lenalidomide usage. Other causes of Sweet syndrome

were not considered since ANA was negative, there were no

signs of infection, and the lesions disappeared after ixazomib

discontinuation. It is emphasized that diagnosis was finalized

with the revised Sweet syndrome criteria: typical rash (abrupt

onset of painful or tender erythematous papules, plaques, or

nodules) and histopathological (dense dermal neutrophilic

infiltrate) findings. It has been stated that no separate criteria

are required for drugs [6]. In conclusion, it should be kept in

mind that rashes associated with Sweet syndrome may appear

during treatment with ixazomib.



References

1. Moreau P, Masszi T, Grzasko N, Bahlis NJ, Hansson M, Pour L, Sandhu I, Ganly

P, Baker BW, Jackson SR, Stoppa AM, Simpson DR, Gimsing P, Palumbo A,

Garderet L, Cavo M, Kumar S, Touzeau C, Buadi FK, Laubach JP, Berg DT, Lin

J, Di Bacco A, Hui AM, van de Velde H, Richardson PG; TOURMALINE-MM1

Study Group. Oral ixazomib, lenalidomide, and dexamethasone for multiple

myeloma. N Engl J Med 2016;374:1621-1634.

2. Suyama T, Ito S, Shinagawa A. Ixazomib-induced Sweet’s syndrome. Int J

Hematol 2020;111:161-162.

3. Oka S, Ono K, Nohgawa M. Ixazomib-induced Sweet’s syndrome. Leuk

Lymphoma 2019;60:3590-3591.

4. Katz H, Shenouda M, Dahshan D, Sonnier G, Lebowicz Y. A rare case of

ixazomib-induced cutaneous necrotizing vasculitis in a patient with

relapsed myeloma. Case Rep Hematol 2019;2019:6061484.

5. Hoverson AR, Davis MD, Weenig RH, Wolanskyj A. Neutrophilic dermatosis

(Sweet syndrome) of the hands associated with lenalidomide Arch Dermatol

2006;142:1070-1071.

6. Nofal A, Abdelmaksoud A, Amer H, Nofal E, Yosef A, Gharib K, Albalat

W, Eldesouky F, Ebrahim H, Abdelshafy AS, Fayed H. Sweet’s syndrome:

diagnostic criteria revisited. J Dtsch Dermatol Ges 2017;15:1081-1088.



Address for Correspondence/Yazışma Adresi: İrfan Yavaşoğlu, M.D., Aydın Adnan Menderes University

Faculty of Medicine, Department of Hematology, Aydın, Turkey

Phone : +90 256 212 00 20

E-mail : dryavas@hotmail.com.com ORCID: orcid.org/0000-00003-1703-2175

Received/Geliş tarihi: March 31, 2021


DOI: 10.4274/tjh.galenos.2021.2021.0210

235



Long Non-Coding RNA MALAT1 Contributed to the Proliferation of

PNH Clone in Paroxysmal Nocturnal Hemoglobinuria Patients

Uzun Kodlama Yapmayan RNA, MALAT1, Paroksismal Noktürnal Hemoglobinüri Hastalarında

PNH Klonal Proliferasyonuna Katkı Sağlar

Honglei Wang*, Yingying Chen*, Hui Liu, Zhaoyun Liu, Rong Fu

*These authors contributed equally to this work.

Tianjin Medical University General Hospital, Department of Hematology, Tianjin, China

To the Editor,

Paroxysmal nocturnal hemoglobinuria (PNH) is an acquired

clonal disorder of hematopoietic stem cells caused by

somatic mutation of the phosphatidylinositol glycan A gene

(PIG-A) on chromosome Xp22.1 [1]. The PIG-A mutation is

necessary but insufficient to explain PNH clone proliferation.

The mechanism of the proliferative advantage of the PNH

clone has not yet been clarified. At present, studies on the

mechanism of PNH clone proliferation are mainly focused

on protein-coding genes, while the function and clinical

significance of non-coding RNAs (ncRNAs), and in particular

long ncRNAs (LncRNAs), in PNH remain unknown. MALAT1 is

one of the most extensively studied LncRNAs. It was found

localized in the nucleus and expressed in a variety of tissues

[2]. MALAT1 can regulate cell proliferation, differentiation,

apoptosis, migration, and autophagy, among others [3].

MALAT1 has been demonstrated to be involved in many

cancers, cardio-cerebrovascular disease, and hematological

malignancies. However, knowledge of the action of MALAT1

in PNH is still lacking. The purpose of our study was to

investigate the role of MALAT1 in PNH clone proliferation

and to find a new therapeutic direction for PNH.

A total of 30 PNH patients, including 22 PNH patients and 8

aplastic anemia (AA)-PNH patients, were enrolled in our study

according to international PNH Study Group Criteria [4]. CD59 –

and CD59 + granulocytes and monocytes were obtained by

flow cytometry (Figures 1A and 1B). MALAT1 expressions were

verified for these 30 PNH patients by quantitative real-time

polymerase chain reaction (qRT-PCR). The clinical features of the

PNH patients, primers of MALAT1, and methods of cell sorting

and qRT-PCR are available from the authors as supplementary

data. Correlations were analyzed with clinical indexes, including

hemoglobin (Hb), white blood cell count (WBC), platelet count

(PLT), reticulocytes (Ret), lactate dehydrogenase (LDH), total

bilirubin (TBIL), and PNH clones.

As the results of qRT-PCR showed, MALAT1 (3.070±2.503)

expressions in CD59 – cells were consistently higher than those

in CD59+ cells (1.281±1.246, p=0.0004) among these 30 PNH

patients (Figure 1C).

High expression of MALAT1 was negatively correlated with Hb

level (r=-0.3894, p=0.0334) and positively correlated with the

percentage of Ret (r=0.4481, p=0.0168), LDH levels (r=0.6244,

p=0.0307), and CD59 – granulated and monocyte cell ratio

(r=0.5188, p=0.0049) (Figure 1D).

The level of MALAT1 in PNH clone cells was found to be

significantly increased and was correlated with clinical indicators

of PNH. The molecular functions of MALAT1 include alternative

splicing, transcriptional regulation, and competing endogenous

RNA functions. MALAT1 was shown to bind alternative splicing

factor SRSF1 in hepatocellular carcinoma development [5].

In another study, MALAT1 promoted the proliferation and

imatinib resistance of chronic myeloid leukemia cells via the

MALAT1/miR-328 axis [6]. MALAT1 downregulated miR-181a-5p

through the Hippo-YAP signaling pathway, resulting in regulation

of myeloma cell proliferation [7]. MALAT1 could also induce

tolerogenic dendritic cells and immune tolerance in autoimmune

diseases by regulating the miRNA-155/DC-SIGH/IL10 axis [8].

These results illustrate that MALAT1 plays an important role not

only in malignant tumors but also in benign diseases.

The characteristics of clonal dynamics and selection forces of

PNH clones are similar to those of tumors. Thus, we predict

that MALAT1 may have an important function in contributing

to proliferation advantages and restraining apoptosis in PNH

progression. The mechanism remains to be further studied.

Keywords: Paroxysmal nocturnal hemoglobinuria, LncRNA,

Clone proliferation, MALAT1

Anahtar Sözcükler: Paroksismal noktürnal hemoglobinüri,

LncRNA, Klonal proliferasyon, MALAT1

Informed Consent: Our study complied with the International

Ethical Guidelines for Biomedical Research Involving Human

Subjects (2002) developed by the Council for International

Organizations of Medical Sciences (CIOMS) in collaboration

236



Figure 1. A) The cells of 30 PNH patients were sorted by flow cytometry to obtain CD59 – and CD59 + granulocytes and monocytes.

Granulocytes and monocytes were selected as sorting objects in the first flow diagram, and CD59 – (P2) and CD59 + (P3) granulocytes

and monocytes were selected in the second flow diagram by CD59 sorting. B) Sorting purity of the CD59 – and CD59 + granulocytes and

monocytes. The sorting purity is about 90%. C) MALAT1 expression of the CD59 – and CD59 + cells in 30 PNH patients. D) Correlation

analysis between MALAT1 expression and clinical data. The expression of MALAT1 was negatively correlated with the proportion of the

level of Hb and positively correlated with the percentage of Ret, LDH levels, and the proportion of PNH clones.

with the World Health Organization (WHO) and was approved

by the Ethics Committee of Tianjin Medical University.


Design: R.F.; Data Collection or Processing: H.W., Y.C., H.L., Z.L.;

Writing: H.W., Y.C.


authors.

Financial Disclosure: This work was supported by the National

Natural Science Foundation of China (Grant nos. 81770110,

81900131, 82000128), the Tianjin Municipal Natural Science

Foundation (Grant nos. 18JCYBJC27200, 18JCQNJC80400), and

the Tianjin Education Commission Research Project (2018KJ043,

2018KJ045).

References

1. Hill A, DeZern AE, Kinoshita T, Brodsky RA. Paroxysmal nocturnal

haemoglobinuria. Nat Rev Dis Primers 2017;3:17028.

2. Lei L, Chen J, Huang J, Lu J, P ei S, Ding S, Kang L, Xiao R, Zeng Q. Functions

and regulatory mechanisms of metastasis-associated lung adenocarcinoma

transcript 1. J Cell Physiol 2018;234:134-151.

3. Zhang X, Hamblin MH, Yin KJ. The long noncoding RNA Malat1: its

physiological and pathophysiological functions. RNA Biol 2017;14:1705-

1714.

4. Parker C, Omine M, Richards S, Nishimura J, Bessler M, Ware R, Hillmen

P, Luzzatto L, Young N, Kinoshita T, Rosse W, Socié G; International PNH

Interest Group. Diagnosis and management of paroxysmal nocturnal

hemoglobinuria. Blood 2005;106:3699-3709.

5. Malakar P, Shilo A, Mogilevsky A, Stein I, Pikarsky E, Nevo Y, Benyamini

H, Elgavish S, Zong X, Prasanth KV, Karni R. Long noncoding RNA MALAT1

promotes hepatocellular carcinoma development by SRSF1 upregulation

and mTOR activation. Cancer Res 2017;77:1155-1167.

237



6. Wen F, Cao YX, Luo ZY, Liao P, Lu ZW. LncRNA MALAT1 promotes cell

proliferation and imatinib resistance by sponging miR-328 in chronic

myelogenous leukemia. Biochem Biophys Res Commun 2018;507:1-8.

7. Sun Y, Jiang T, Jia Y, Zou J, Wang X, Gu W. LncRNA MALAT1/miR-181a-5p

affects the proliferation and adhesion of myeloma cells via regulation of

Hippo-YAP signaling pathway. Cell Cycle 2019;18:2509-2523.

8. Wu J, Zhang H, Zheng Y, Jin X, Liu M, Li S, Zhao Q, Liu X, Wang Y, Shi M, Zhang

S, Tian J, Sun Y, Zhang M, Yu B. The long noncoding RNA MALAT1 induces

tolerogenic dendritic cells and regulatory T cells via miR155/dendritic cellspecific

intercellular adhesion molecule-3 grabbing nonintegrin/IL10 axis.

Front Immunol 2018;9:1847.



Address for Correspondence/Yazışma Adresi: Rong Fu, M.D., Tianjin Medical University General Hospital,

Department of Hematology, Tianjin, China

Phone : (086) 02260817181

E-mail : florai@sina.com ORCID: orcid.org/0000-0002-9928-9224


Accepted/Kabul tarihi: March 16, 2021

DOI: 10.4274/tjh.galenos.2021.2021.0065

Supplemental Table 1. Clinical characteristics of 30 paroxysmal nocturnal hemoglobinuria patients.

Characteristics

Total no. of patients 30

Values

Gender, M/F 19/11

Age, years, median (range) 41 (16-68)

Clinical classification, n (%)

Classical PNH 22 (73.33)

AA-PNH 8 (26.67)

History of thrombosis, n (%) 11 (36.67)

Hb (g/L) 79.71±23.97

Ret (%) 8.285±5.589

WBC (x10 9 /L) 5.47±3.29

PLT (x10 9 /L) 116.00±95.03

TBIL (µmol/L) 34.53±18.59

LDH (U/L) 1543.00±1181.0

Granulocyte CD59– (%) 74.90±24.39

Erythrocyte CD59– (%) 47.50±31.77

PNH: Paroxysmal nocturnal hemoglobinuria; AA-PNH: aplastic anemia-paroxysmal nocturnal hemoglobinuria; Hb: hemoglobin; Ret: reticulocytes; WBC: white blood cell count; PLT:

platelet count; TBIL: total bilirubin; LDH: lactate dehydrogenase.

Supplemental Table 2. Gene primer sequences.

Gene Forward Reverse Annealing temperature, °C

MALAT1 GCAGCAGTTCGTGGTGAAGATAGG TCGCCTCCTCCGTGTGGTTG 58.0

GAPDH CAGGAGGCATTGCTGATGAT GAAGGCTGGGGCTCATTT

238



Dicentric (7;12)(p11;p11) in T/Myeloid Mixed-Phenotype Acute

Leukemia

T/Myeloid Karışık-Fenotip Akut Lösemide Disentrik (7;12)(p11;p11)

Smeeta Gajendra 1 , Akshay Ramesh Gore 2 , Nitin Sood 3 , Manorama Bhargava 2

1Department of Laboratory Oncology, All India Institute of Medical Sciences, Dr. B.R.A. Institute Rotary Cancer Hospital, New Delhi, India

2Department of Hematopathology, Medanta - The Medicity, Gurgaon, India

3Department of Medical Oncology & Hematology, Medanta - The Medicity, Gurgaon, India

To the Editor,

Mixed-phenotype acute leukemia (MPAL) is a rare heterogeneous

group of acute leukemias with immunophenotypic

co-expression of more than one cell lineage, which could be

bilineal or biphenotypic. MPAL could be further classified

as B/myeloid, T/myeloid, B/T-lymphoid, and, more rarely,

trilineage B/T/myeloid. “MPAL, T/myeloid, not otherwise

specified” is a rare variant of this disease accounting for <1%

of all leukemias [1]. It is associated with male predominance,

frequent lymphadenopathy, and poor prognosis [2]. Most of

the cases have clonal chromosomal abnormalities, but none

are specific for this group. Here, we report a case of T/myeloid

bilineage acute leukemia with unusual cytogenetic features

upon karyotyping and fluorescence in situ hybridization (FISH),

with karyotyping showing a dicentric chromosome between

the derivative chromosome 7 and chromosome 12, dic(7;12)

(p11;p11).

A 51-year-old male presented with generalized weakness and

loss of appetite. On examination, he had pallor and abdominal

mass with hepatomegaly (2 cm below the right costal margin).

Abdominal computed tomography showed multiple large

lymph nodes in the paraaortic, aortocaval, paracaval, celiac

axis, periportal, and mesenteric regions, the largest measuring

3.0x2.5 cm in the left paraaortic region. Fine-needle aspiration

of the paraaortic lymph node showed clusters of pleomorphic

cells, suggesting a lymphoproliferative lesion. Complete blood

count showed hemoglobin of 7.7 g/dL, total leukocyte counts of

9.0x10 9 /L, and platelets of 156x10 9 /L. Peripheral blood smear and

bone marrow aspirate showed 70% and 85% blasts, respectively.

Morphologically, there were two distinct populations of blasts,

one that was larger with 2-3 prominent nucleoli and moderate

to abundant amounts of granular cytoplasm (Figure 1A), while

the other was of medium size with inconspicuous nucleoli and

scanty agranular cytoplasm (Figure 1B). Upon flowcytometric

immunophenotyping (Figure 1E), there were two different

blast populations seen in the CD45-moderate blast region,

extending into the monocytic region: a blast population in the

CD45-moderate region with high side scatter (~60% of blasts),

extending to the monocytic region, was positive for cMPO, CD13,

CD33, CD64, CD14, HLA-DR, CD38, CD11b, CD71, CD123, CD56,

CD4, CD117, CD7, and CD11c and negative for cCD79a, CD19,

CD10, cCD3, CD8, CD3, CD5, CD2, CD1a, and CD16, while the

blast population present in the CD45-moderate region with low

side scatter (~40% of blasts) was positive for cCD3, CD3, CD7,

CD5, CD34, HLA-DR, CD38, CD99, TdT, and CD33 and negative

for cCD79a, cMPO, CD19, CD10, CD1a, CD2, CD4, CD8, CD13,

CD14, and CD64. Immunohistochemistry based on bone marrow

biopsy also showed sheets of blasts comprising two populations

of blasts with myeloid (CD33, CD117) and T lymphoid markers

(CD3, CD5, CD7). The overall features were consistent with MPAL

of myeloid and T lymphoblastic lineage (MPAL: T/myeloid).

Karyotyping (Figure 1C) showed a dicentric chromosome formed

between chromosome 7 and 12: 45,XY, dic(7;12)(p11;p11).

Dicentric chromosomes involving 12p are associated with loss

of 12p material, often including the ETV6 (TEL) gene localized in

12p 13.2. The karyotyping findings were supported by FISH using

the ETV6/RUNX1 probe (Figure 1D), which showed deletion of

the ETV6 (TEL) gene localized on 12p13.2. Real-time quantitative

polymerase chain reaction results for PML-RARA, AML1-ETO,

RUNX1:RUNX1T1, CBFB - MYH11, FLT3 ITD and TKD, D835,

NPM1, BCR-ABL1, and KIT were negative. The patient began

hyper-CVAD induction chemotherapy comprising

cyclophosphamide, vincristine, doxorubicin, and dexamethasone.

On day 19, he developed febrile neutropenia. Blood culture

showed growth of Pseudomonas, for which he was treated, and

he recovered. The patient was assessed after completion of four

cycles and he achieved a complete morphological remission

with this regimen.

T/myeloid MPAL is rare and characterized by the presence of

both T and myeloid lineage markers in immunophenotyping.

Although the specific type and frequency of genetic

abnormalities associated with T/myeloid MPAL are largely

unknown, some chromosomal abnormalities described in

the literature commonly include recurrent monosomies 7p

and/or 12p [2,3,4,5]. Structural abnormalities in the short

arm of chromosome 12 are observed in a broad spectrum of

hematological malignancies including myeloid malignancies

239



Figure 1. A) Bone marrow aspirate showing two distinct populations of blasts (insets showing two types of blasts). Bone marrow biopsy

(hematoxylin and eosin stain; 400 x ) with immunohistochemistry showing two populations of blasts with mixed myeloid (CD33) and

T lymphoid markers (CD7 and CD5). B) Flowcytometry showing two blast populations positive for myeloid CD33, CD64, CD14, and T

lymphoid markers (cCD3, CD5, CD7). C) Karyogram showing dicentric chromosome formed between 7 and 12, dic(7;12)(p11;p11), with

GTG staining and banding method, 100 x oil immersion, Carl Zeiss Axioscope Z2, processed using IKAROS software. D) Fluorescence in situ

hybridization analysis with interphase nuclei and metaphase showing deletion of the ETV6 (TEL) gene localized on 12p 13.2 using the

ETV6/RUNX1 DC, DF probe (ETV6 - orange, RUNX1 - green; ZytoVision, Germany).

and acute lymphoblastic leukemia. Various aberrations result in

abnormal 12p, including balanced translocations, deletions, and

formation of dicentric chromosomes. Dicentric chromosomal

abnormalities have been reported in many hematological

malignancies including myelodysplastic syndrome, acute myeloid

leukemia [6], and acute lymphoblastic leukemia [7,8,9,10], and

dic(7;12) is a rare but recurrent chromosomal abnormality

described mainly in childhood acute lymphoblastic leukemia

[7]. A case of dic(7;12)(p11;p11) in T/myeloid biphenotypic acute

leukemia has also been reported; that patient was successfully

treated with myeloablative stem cell transplantation [2]. A rare

case of new dic(7;12)(p12.21;p12.2) chromosome aberration

was also reported in a patient with acute myeloid leukemia with

FAB-M1 morphology. It is known that dic(7;12) results in partial

monosomies of 7p and 12p, leading to concomitant deletions

of tumor suppressor genes from both chromosomes, which

plays a role in the pathogenesis of hematological malignancies.

As MPAL with dic(7;12) is rarely reported in the literature, the

prognostic significance and definite therapeutic regimens for

these patients have not yet been established.

Keywords: Dicentric (7;12), Mixed-phenotype acute leukemia,

Fluorescence in situ hybridization, ETV6/RUNX1

240



Anahtar Sözcükler: Disentrik (7;12), Karışık-fenotip akut lösemi,

Floresan in situ hibridizasyon, ETV6/RUNX1


patient.


Concept: S.G.; Data Collection or Processing: S.G., N.S.; Analysis

or Interpretation: A.R.G, M.B.; Writing: S.G.


authors.



References

1. Borowitz MJ, Bene MC, Harris NL, Porwit A, Matutes E, Arber DA. Acute

leukemias of ambiguous lineage. In: Swerdlow SH, Campo E, Harris NL,

Jaffe ES, Pileri SA, Stein H, Thiele J (eds). WHO Classification of Tumours of

Haematopoietic and Lymphoid Tissues, Revised 4th Edition, Volume 2. Lyon,

IARC Press, 2017.

2. Matsumoto Y, Taki T, Fujimoto Y, Taniguchi K, Shimizu D, Shimura K,

Uchiyama H, Kuroda J, Nomura K, Inaba T, Shimazaki C, Horiike S, Taniwaki

M. Monosomies 7p and 12p and FLT3 internal tandem duplication: possible

markers for diagnosis of T/myeloid biphenotypic acute leukemia and its

clonal evolution. Int J Hematol 2009;89:352-358.

3. Rubio MT, Dhedin N, Boucheix C, Bourhis JH, Reman O, Boiron JM, Gallo

JH, Lhéritier V, Thomas X, Fière D, Vernant JP. Adult T-biphenotypic acute

leukaemia: clinical and biological features and outcome. Br J Haematol

2003;123:842-849.

4. Tiribelli M, Damiani D, Masolini P, Candoni A, Calistri E, Fanin R. Biological

and clinical features of T-biphenotypic acute leukaemia: report from a

single centre. Br J Haematol 2004;125:814-815.

5. Owaidah TM, Al Beihany A, Iqbal MA, Elkum N, Roberts GT. Cytogenetics,

molecular and ultrastructural characteristics of biphenotypic acute

leukemia identified by the EGIL scoring system. Leukemia 2006;20:620-626.

6. MacKinnon RN, Campbell LJ. The role of dicentric chromosome formation

and secondary centromere deletion in the evolution of myeloid malignancy.

Genet Res Int 2011;2011:643628.

7. Raimondi SC, Privitera E, Williams DL, Look AT, Behm F, Rivera GK, Crist

WM, Pui CH. New recurring chromosomal translocations in childhood acute

lymphoblastic leukemia. Blood 1991;77:2016-2022.

8. Pan J, Xue Y, Wu Y, Wang Y, Shen J. Dicentric (7;9)(p11;p11) is a rare but

recurrent abnormality in acute lymphoblastic leukemia: a study of 7 cases.

Cancer Genet Cytogenet 2006;169:159-163.

9. Wafa A, Jarjour RA, Aljapawe A, ALmedania S, Liehr T, Melo JB, Carreira

IM, Othman MAK, Al-Achkar W. An acquired stable variant of a

dicentric dic(9;20) and complex karyotype in a Syrian childhood B-acute

lymphoblastic leukemia case. Mol Cytogenet 2020;13:29.

10. Illade L, Fioravantti V, Andion M, Hernandez-Marques C, Madero L,

Lassaletta A. Dicentric translocation (9;12) in acute lymphoblastic

leukemia: a chromosomal abnormality with an excellent prognosis? Tumori

2017;103(Suppl 1):e44-e46.

11. Tapinassi C, Gerbino E, Malazzi O, Micucci C, Gasparini P, Najera MJ,

Calasanz MJ, Odero MD, Pelicci PG, Belloni E. A new dic(7;12)(p12.21;p12.2)

chromosome aberration in a case of acute myeloid leukemia. Cancer Genet

Cytogenet 2008;185:102-105.



Address for Correspondence/Yazışma Adresi: Smeeta Gajendra, Asst. Prof., Department of Laboratory

Oncology, All India Institute of Medical Sciences, Dr. B.R.A. Institute Rotary Cancer Hospital, New Delhi, India

Phone : 9013590875

E-mail : drsmeeta@gmail.com ORCID: orcid.org/0000-0002-1759-7857

Received/Geliş tarihi: May 2, 2021


DOI: 10.4274/tjh.galenos.2021.2021.0280

A Novel Variant in the ACVRL1 Gene in a Patient with Cirrhosis

and Hereditary Hemorrhagic Telangiectasia

Herediter Hemorajik Telenjiektazi ve Sirozu Olan bir Hastada ACVRL1 Geninde Saptanan Yeni

Bir Varyant

Mehmet Baysal 1 , Nihan Alkış 1 , Hakan Gürkan 2 , Ahmet Muzaffer Demir 3

1Bursa City Hospital, Clinic of Hematology, Bursa, Turkey

2Trakya University Faculty of Medicine, Department of Medical Genetics, Edirne, Turkey

3Trakya University Faculty of Medicine, Department of Hematology, Edirne, Turkey

To the Editor,

Hereditary hemorrhagic telangiectasia (HHT) is a rare bleeding

disorder characterized by arteriovenous malformations (AVMs),

telangiectasia, and bleeding episodes [1]. Pulmonary, hepatic,

and cerebral AVMs may be seen in the course of the disease

[2]. Mutations in the ENG, ACVRL1, and SMAD4 genes were

associated with HHT [3]. A 65-year-old man was admitted

to our hospital with anemia and intermittent nose bleeding.

241



Upon physical examination, telangiectasias were noticed on his

face and nose. Further investigations in his work-up revealed

hypochromic microcytic anemia with a hemoglobin level of

8 g/dL. Detailed laboratory analysis revealed iron deficiency

anemia. In the upper gastrointestinal endoscopy performed

for iron deficiency anemia, grade 1 esophageal varices were

detected and intravenous iron carboxymaltose treatment was

planned. His epistaxis severity score was 3.22, which can be

categorized as mild bleeding [4].

Family history revealed positive findings for nose bleeds and

telangiectasia in his first-degree relatives and molecular

genetic analysis was performed on a next-generation sequence

analysis platform (NextSeq550-Illumina) using the QIAseq

Targeted DNA Panel Kit (CDHS-14647Z-252-QIAGEN), which

includes the ACVRL1, ADAM17, ENG, GDF2, PTPN14, RASA1, and

SMAD4 genes. Variant analysis was performed using QIAGEN

Clinical Insight software. As a result of the bioinformatics

analysis performed considering the ACMG-2015 criteria, the

NM_000020.3(ACVRL1):c.1415G>A (p.Trp472Ter) variant was

evaluated as pathogenic according to the PVS1, PM2, and PP3

rules (in silico analysis results - DANN score: 0.9944, GERP score:

4.4, MutationTaster: Disease causing). The ACVRL1:c.1415G>A

variant was reported in the dbSNP database with reference

number rs1555154144, but its clinical significance was not

reported in the ClinVar or HGMD Professional 2020.3 databases.

The minor allele frequency was not reported in the dbSNP, ExAC,

or GnomAD_exome databases [5,6]. Computed tomography of

the abdomen showed nodularity of the surface of the liver, a

heterogeneous appearance of the liver parenchyma, and atrophy

of the left liver lobe (Figure 1). No arteriovenous malformations

were found in the liver and evaluation of the portal venous

system was normal. Hepatitis virus markers, immunoglobulin

levels, and autoimmune markers were normal. As the patient’s

anamnesis was detailed, a history of regular alcohol consumption

was noted and the patient was diagnosed with Child A liver

parenchymal disease. A colonoscopic evaluation of the patient

was also performed, and multiple small telangiectases were seen

in the rectal mucosa. Local preventive measures and tranexamic

acid were given for epistaxis and low-dose propranolol was

started for grade 1 esophageal varices.

Gastric and hepatic manifestations of HHT are broad, and on

rare occasions HHT can be associated with liver cirrhosis [7,8].

However, as in our case, HHT and alcohol intake have both

caused and triggered liver cirrhosis. Our patient has stopped

consuming alcohol and is being followed as an outpatient for

both HHT and cirrhosis. Mutations in the ACVRL1 gene occur

more frequently in HHT type 2 patients, and according to the

University of Utah mutation database there are 571 confirmed

variants in the ACVRL1 gene associated with HHT; our novel

variation was not reported before [9]. Regardless of the age

of the patient, HHT should be on the physician’s mind when

Figure 1. Computed tomography of the abdomen showed

nodularity of the surface of the liver, a heterogeneous appearance

of the liver parenchyma, and atrophy of the left liver lobe.

evaluating a patient with telangiectasias and unexplained iron

deficiency.

Keywords: Hereditary hemorrhagic telangiectasia, ACVRL1

mutation, Cirrhosis, Epistaxis, Anemia

Anahtar Sözcükler: Herediter hemorajik telenjiektazi, ACVRL1

mutasyonu, Siroz, Epistaksis, Anemi

Informed Consent: Informed consent has been obtained from

the patient.


Concept: M.B., N.A., H.G., A.M.D.; Design: M.B., N.A., H.G., A.M.D.;

Data Collection or Processing: M.B., N.A., H.G., A.M.D.; Analysis

or Interpretation: M.B., N.A., H.G., A.M.D.; Literature Search:

M.B., N.A., H.G., A.M.D.; Writing: M.B., N.A., H.G., A.M.D.


authors.



References

1. Shovlin CL, Guttmacher AE, Buscarini E, Faughnan ME, Hyland RH,

Westermann CJ, Kjeldsen AD, Plauchu H. Diagnostic criteria for hereditary

hemorrhagic telangiectasia (Rendu-Osler-Weber syndrome). Am J Med

Genet 2000;91:66-67.

2. Faughnan ME, Mager JJ, Hetts SW, Palda VA, Lang-Robertson K, Buscarini

E, Deslandres E, Kasthuri RS, Lausman A, Poetker D, Ratjen F, Chesnutt

MS, Clancy M, Whitehead KJ, Al-Samkari H, Chakinala M, Conrad M,

242



Cortes D, Crocione C, Darling J, de Gussem E, Derksen C, Dupuis-Girod S,

Foy P, Geisthoff U, Gossage JR, Hammill A, Heimdal K, Henderson K, Iyer

VN, Kjeldsen AD, Komiyama M, Korenblatt K, McDonald J, McMahon J,

McWilliams J, Meek ME, Mei-Zahav M, Olitsky S, Palmer S, Pantalone R,

Piccirillo JF, Plahn B, Porteous MEM, Post MC, Radovanovic I, Rochon PJ,

Rodriguez-Lopez J, Sabba C, Serra M, Shovlin C, Sprecher D, White AJ,

Winship I, Zarrabeitia R. Second international guidelines for the diagnosis

and management of hereditary hemorrhagic telangiectasia. Ann Intern

Med 2020;173:989-1001.

3. Baysal M, Demir S, Ümit EG, Gurkan H, Bas V, Karaman Gülsaran S, Demirci

U, Kirkizlar HO, Demir AM. Genetic diagnosis of hereditary hemorrhagic

telangiectasia: four novel pathogenic variations in Turkish patients. Balkan

Med J 2020;37:43-46.

4. Hoag JB, Terry P, Mitchell S, Reh D, Merlo CA. An epistaxis severity score for

hereditary hemorrhagic telangiectasia. Laryngoscope 2010;120:838-843.

5. Bossler AD, Richards J, George C, Godmilow L, Ganguly A. Novel mutations

in ENG and ACVRL1 identified in a series of 200 individuals undergoing

clinical genetic testing for hereditary hemorrhagic telangiectasia (HHT):

correlation of genotype with phenotype. Human Mutation 2006;27:667-

675.

6. Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde

M, Lyon E, Spector E, Voelkerding K, Rehm HL; ACMG Laboratory Quality

Assurance Committee. Standards and guidelines for the interpretation of

sequence variants: a joint consensus recommendation of the American

College of Medical Genetics and Genomics and the Association for

Molecular Pathology. Genet Med 2015;17:405-424.

7. Xu BG, Liang J, Jia KF, Han T. Liver cirrhosis in a patient with hepatic

hereditary hemorrhagic telangiectasia and Budd-Chiari syndrome: a case

report. BMC Gastroenterol 2020;20:169.

8. Tortora A, Riccioni ME, Gaetani E, Ojetti V, Holleran G, Gasbarrini A. Rendu-

Osler-Weber disease: a gastroenterologist’s perspective. Orphanet J Rare Dis

2019;14:130.

9. University of Utah. Hereditary Hemorrhagic Telangiectasia Mutation

Database. Salt Lake City, University of Utah Department of Pathology, 2020.

Available at http://www.arup.utah.edu/database/HHT.



Address for Correspondence/Yazışma Adresi: Mehmet Baysal, M.D., Bursa City Hospital, Clinic of

Hematology, Bursa, Turkey

Phone : +90 535 966 41 88

E-mail : drmehmetbaysal@gmail.com ORCID: orcid.org/0000-0001-7681-4623

Received/Geliş tarihi: December 15, 2020

Accepted/Kabul tarihi: March 22, 2021

DOI: 10.4274/tjh.galenos.2021.2020.0749

Can Hematological Findings of COVID-19 in Pediatric Patients

Guide Physicians Regarding Clinical Severity?

Pediatrik Hastalarda COVID-19 Hematolojik Bulguları Klinisyenlere Klinik Ciddiyet Açısından

Yol Gösterebilir mi?

Kamile Ötiken Arıkan, Şahika Şahinkaya, Elif Böncüoğlu, Elif Kıymet, Ela Cem, Aybüke Akaslan Kara, Nuri Bayram,

İlker Devrim

University of Health Sciences Turkey, İzmir Dr. Behçet Uz Children Hospital, Clinic of Pediatric Infectious Disease, İzmir, Turkey

To the Editor,

The coronavirus disease-19 (COVID-19) pandemic originated

in December 2019 in the city of Wuhan, the capital of Hubei

Province, China. The virus then spread to numerous other

countries in Asia and by January 2020 infected patients were

identified in Europe [1]. Children of all ages are susceptible to

infection by severe acute respiratory syndrome-coronavirus-2,

the causative agent. Most children have relatively mild clinical

symptoms without fever or pneumonia [2,3,4,5,6,7,8].

We conducted a retrospective study at the University of Health

Sciences Turkey, İzmir Dr. Behçet Uz Children’s Hospital between

March 30 and October 31, 2020.

A total of 3878 pediatric patients were tested and 353

(9.1%) of them were diagnosed with COVID-19. Of these 353

children, 184 (52.1%) were male (52.1%) (female/male: 0.91).

The median age of the patients was 9 years (range: 4 days to

17 years). Thirty-five (9.9%) patients had underlying diseases,

most commonly a neurological disease (n=9). Regarding

severity, 9 (2.5%), 293 (83%), 38 (10.8%), and 13 (3.7%)

cases were diagnosed as asymptomatic, mild, moderate, and

severe/critical, respectively. Neutropenia (47.9%) was the

most common abnormal parameter in complete blood counts,

followed by lymphocytosis (22.4%), lymphopenia (20.7%),

leukopenia (9.1%), neutrophilia (6.5%), and thrombocytopenia

(3.4%) (Table 1).

Neutropenia was statistically significantly more common

in neonates (84.6%). Lymphocytosis and neutrophilia

were statistically significantly more common in infants

(75.9%, p<0.001 and 23.3%, p<0.001, respectively). Lymphopenia

and leukopenia were statistically significantly more common in

patients >11 years old (38.4%, p<0.001 and 15.2%, p=0.025,

243



Table 1. Comparisons of hematologic and biochemical parameters of patients according to disease severity.

Asymptomatic Mild Moderate Severe/Critical p

Hemoglobin (g/dL)* 13.5 (8.9-14.3) 12.5 (8.9-11.5) 12.3 (6.6-16) 8.9 (2.5-13.1) 0.001

Leukocytes (x10 3 /µL)* 6.4 (2.8-12.5) 6.0 (3.0-25.2) 6.0 (2.2-19.2) 9.9 (4.0-13.1) 0.39

Leukocytosis* 1 (11.1) 14 (5.6) 6 (15) 2 (28.6) 0.011

Leucopenia** 2 (22.2) 24 (9.5) 6 (15) 0 (0) 0.79

ANC (x10 3 /µL)* 2.4 (0.86-3.7) 2.6 (0.11-17.7) 2.7 (0.16-10.9) 6.8 (0.7-10.3) 0.12

Neutropenia** 7 (77.8) 138 (54.8) 22 (55) 2 (28.6) 0.174

ALC (x10 3 /µL)* 2.2 (1.2-9.1) 2.2 (0.23-14.6) 2.7 (0.7-8.2) 1.7 (0.68-6) 0.93

Lymphocytosis** 4 (44.4) 61 (24.3) 12 (30) 2 (28.6) 0.90

Lymphopenia** 2 (22.2) 56 (22.3) 12 (30) 3 (42.9) 0.13

Platelets (x10 3 /µL)* 321 (128-547) 263 (52-595) 258 (146-665) 196 (55-358) 0.15

Thrombocytopenia** 1 (11.1) 6 (2.4) 2 (5) 3 (42.9) 0.001

Neutrophil-to-lymphocyte ratio* 0.84 (0.2-3) 1.12 (0.04-28) 1.32 (0.11-4.6) 3.39 (0.23-10) 0.25

Platelet-to-lymphocyte ratio* 114 (59-301) 110 (24-830) 126 (38-268) 101 (0-287) 0.82

Lymphocyte-to-white blood cell ratio* 0.48 (0.22-0.73) 0.39 (0.03-0.92) 0.37 (0.16-0.70) 0.22 (0.09-0.61) 0.27

RDW (%)* 12.3 (12-13.1) 12.9 (11.2-13.2) 12.9 (11.6-19.5) 14.9 (13-19.6) 0.005

MPV (fL)* 9.5 (8.5-11.5) 9.8 (8-13.6) 9.7 (8.2-11.7) 10.7 (8.7-12.8) 0.15

PDW (%)* 9.3 (8.5-14.9) 10.6 (7.3-22) 10.5 (8.1-14.8) 13.6 (7.6-16.8) 0.26

Prothrombin time (seconds)* 13.2 (9.5-14.1) 12.8 (9.4-17.7) 13 (11-16.4) 14.7 (12.9-20.9) 0.037

Increased PT** 0 (0) 10 (6.7) 1 (3.4) 4 (33.3)

aPTT (seconds)

Fibrinogen (mg/dL)*

29.6 (24.3-35.8)

224 (189-409)

31.9 (17.9-61.10)

260 (136-967)

31.2 (21.5-39.1)

273 (100-510)

31.3 (23.7-46)

374 (98-510)

Serum D-dimer (ng/mL)* 180 (150-231) 150 (70-3145) 150 (150-1887) 1235 (394-3037) <0.001

Increased D-dimer** 0 (0) 25 (17.1) 7 (22.6) 6 (100) <0.001

Serum ferritin (µg/L)* 16.9 (9.5-48.8) 40.2 (3-343) 39.8 (16.6-137) 134 (44-2051) 0.003

Increased ferritin** 0 (0) 9 (11.8) 2 (10) 3 (42.9)

ANC: Absolute neutrophil count; ALC: absolute lymphocyte count; RDW: red cell distribution width; MPV: mean platelet volume; PDW: platelet distribution width; PT: prothrombin

time; aPTT: activated partial thromboplastin time.

*: Median (min-max).

**: n (%).

0.91

0.26

respectively). Patients older than 11 years of age were more

often thrombocytopenic, but this finding was not statistically

significant (p=0.17).

The neutrophil-to-lymphocyte ratio (NLR) was higher in

severe/critical cases compared to cases of asymptomatic, mild,

and moderate severity [median NLR values in asymptomatic,

mild, moderate, and severe cases were as follows: 0.84 (range:

0.2-3), 1.12 (0.04-28), 1.32 (0.11-4.6), and 3.39 (0.23-10),

respectively; p=0.25].

The platelet-to-lymphocyte ratio statistically significantly

increased as age increased.

Lymphocyte-to-white blood cell ratio statistically significantly

decreased as age increased and it was lower in severe/critical

cases compared to cases of asymptomatic, mild, and moderate

severity. Red cell distribution width (RDW) statistically

significantly increased in severe cases (median values in

asymptomatic, mild, moderate, and severe cases were as follows:

12.3 [range: 12-13.1], 12.9 [11.2-13.2], 12.9 [11.6-19.5], and

14.9 [13-19.6], respectively; p=0.005). Median serum ferritin

and D-dimer were statistically significantly increased in severe

cases. Increased serum D-dimer was found to increase the risk

of disease severity 2.9-fold (95% confidence interval: 0.13-0.85,

p=0.022).

In our findings, the NLR ratio was higher in severe/critical

cases compared to cases of asymptomatic, mild, and moderate

severity. Qin et al. [6] reported an increase in NLR in patients

with severe disease compared to those without [8]. In our

findings, RDW levels were also significantly higher in severe

cases. In adult studies, it was concluded that elevated RDW at

the time of hospital admission and an increase in RDW during

hospitalization were associated with increased mortality

244



risk for patients with COVID-19, compatible with our results

[6,9,10].

We recommend that clinicians closely monitor leukocyte

count, lymphocyte count, platelet count, serum D-dimer,

serum ferritin, and RDW as markers for potential progression

to critical illness.

Keywords: COVID-19, Hematological parameters, Clinical

severity, Red cell distribution width, Lymphopenia

Anahtar Sözcükler: COVID-19, Hematolojik parametreler, Klinik

şiddeti, Kırmızı küre dağılım aralığı

Informed Consent: Retrospective study.


Concept: K.Ö.A., İ.D.; Design: K.Ö.A., İ.D., A.A.K., Ş.Ş., E.C., E.B., E.K.;

Data Collection or Processing: K.Ö.A.; Analysis or Interpretation:

K.Ö.A., N.B., İ.D.; Literature Search: K.Ö.A.; Writing: K.Ö.A.


authors.



References

1. Lu H, Stratton CW, Tang YW. Outbreak of pneumonia of unknown etiology

in Wuhan, China: the mystery and the miracle. J Med Virol 2020;92:401-

402.

2. Zhou MY, Xie XL, Peng YG, Wu MJ, Deng XZ, Wu Y, Xiong LJ, Shang LH. From

SARS to COVID-19: what we have learned about children infected with

COVID-19. Int J Infect Dis 2020;96:710-714.

3. Jiang L, Tang K, Levin M, Irfan O, Morris SK, Wilson K, Klein JD, Bhutta

ZA. COVID-19 and multisystem inflammatory syndrome in children and

adolescents. Lancet Infect Dis 2020;20:276-288.

4. Lippi G, Plebani M. The critical role of laboratory medicine during

coronavirus disease 2019 (COVID-19) and other viral outbreaks. Clin Chem

Lab Med 2020;58:1063-1069.

5. Henry BM, Lippi G, Plebani M. Laboratory abnormalities in children with

novel coronavirus disease 2019. Clin Chem Lab Med 2020;58:1135-1138.

6. Sharma D, Dayama A, Banerjee S, Bhandhari S, Chatterjee A, Chatterjee

D. To study the role of absolute lymphocyte count and RDW in COVID 19

patients and their association with appearance of symptoms and severity. J

Assoc Physicians India 2020;68:39-42.

7. Qin C, Zhou L, Hu Z, Zhang S, Yang S, Tao Y, Xie C, Ma K, Shang K, Wang W,

Tian DS. Dysregulation of immune response in patients with coronavirus

2019 (COVID-19) in Wuhan, China. Clin Infect Dis 2020;71:762-768.

8. Tang N, Li D, Wang X, Sun Z. Abnormal coagulation parameters are associated

with poor prognosis in patients with novel coronavirus pneumonia. J

Thromb Haemost 2020;18:844-847.

9. Wang C, Zhang H, Cao X, Deng R, Ye Y, Fu Z, Gou L, Shao F, Li J, Fu W,

Zhang X, Ding X, Xiao J, Wu C, Li T, Qi H, Li C, Lu Z. Red cell distribution

width (RDW): a prognostic indicator of severe COVID-19. Ann Transl Med

2020;8:1230.

10. Henry BM, Benoit JL, Benoit S, Pulvino C, Berger BA, Olivera MHS, Crutchfield

CA, Lippi G. Red blood cell distribution width (RDW) predicts COVID-19

Severity: a prospective, observational study from the Cincinnati SARS-

CoV-2 Emergency Department Cohort. Diagnostics (Basel) 2020;10:618.



Address for Correspondence/Yazışma Adresi: Kamile Ötiken Arıkan, M.D., University of Health Sciences

Turkey, İzmir Dr. Behçet Uz Children Hospital, Clinic of Pediatric Infectious Disease, İzmir, Turkey

Phone : +90 545 281 19 35

E-mail : kamilearikan15@gmail.com ORCID: orcid.org/0000-0002-1610-4395

Received/Geliş tarihi: March 2, 2021


DOI: 10.4274/tjh.galenos.2021.2021.0157

245

Advisory Board of This Issue (September 2021)

Abhishek Maiti, USA

Ayşe Çırakoğlu, Turkey

Ayşegül Gündüz, Turkey

Bela Balint, Serbia

Birsen Karaman, Turkey

Brenda W. Cooper, USA

Cem Mirili, Turkey

Claudio Cerchione, Italy

Daniel Vasile Balaban, Romania

Deniz Tuğcu, Turkey

Elif Ünal, Turkey

Emine Zengin, Turkey

Engin Kelkitli, Turkey

Eric Solary, France

Fahri Şahin, Turkey

Felicetto Ferrara, Italy

Giuseppe Visani, Italy

Güçhan Alanoğlu, Turkey

İnci Alacacıoğlu, Turkey

Jan Palmblad, Sweden

Jose Perdomo, Australia

L E Damon, USA

Manu Goyal, India

Marie Detrait, France

Marius J. Coetzee, South Africa

Massimo Martino, Italy

Mehmet Çandır, Turkey

Meral Beksaç, Turkey

Özden Hatirnaz Ng, Turkey

Parvind Singh, India

Piero Farruggia, Italy

Pınar Bayrak Toydemir, USA

Rauf Haznedar, Turkey

Rejin Kebudi, Turkey

Selin Aytaç, Turkey

Şule Mine Bakanay Öztürk, Turkey

Sushant Kumar Meinia, India

Tuğrul Elverdi, Turkey

Vahid Afshar-Kharghan, USA

Vanessa Innao, Italy

Vassiliki Pappa, Greece

Wei Cui, USA

Yeşim Oymak, Turkey

tjh-v38i3

Create successful ePaper yourself

Delete template?

Save as template?