tjh-v38i3
Create successful ePaper yourself
Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.
Volume 38 Issue 3
September 2021
E-ISSN: 1308-5263
Research Articles
Association of Immune Thrombocytopenia and Celiac Disease in Children: A Retrospective Case Control Study
Angela Guarina, Maddalena Marinoni, Giuseppe Lassandro, Paola Saracco, Silverio Perrotta, Elena Facchini,
Lucia Dora Notarangelo, Giovanna Russo, Paola Giordano, Francesca Romano, Elisa Bertoni, Chiara Gorio,
Gianluca Boscarol, Milena Motta, Marco Spinelli, Angelica Barone, Marco Zecca, Francesca Compagno,
Saverio Ladogana, Angela Maggio, Maurizio Miano, Gianluca Dell’Orso, Elena Chiocca, Ilaria Fotzi,
Angela Petrone, Assunta Tornesello, Irene D’Alba, Silvia Salvatore, Maddalena Casale, Giuseppe Puccio,
Ugo Ramenghi, Piero Farruggia; Palermo, Varese, Bari, Torin, Naples, Bologna, Brescia, Catania, Bolzano, Monza,
Parma, Pavia, Rotondo, Genoa, Firenze, Trento, Lecce, Ancona, Italy
Comparison of Splenectomy and Eltrombopag Treatment in the Second-Line Treatment of Immune
Thrombocytopenic Purpura
Mehmet Can Uğur, Sinem Namdaroğlu, Esma Evrim Doğan, Esra Turan Erkek, Nihan Nizam, Rafet Eren,
Oktay Bilgir; İzmir, İstanbul, Turkey
Clinical Characteristics and Optimal Therapy of Acute Myeloid Leukemia with Myelodysplasia-Related Changes:
A Retrospective Analysis of a Cohort of Chinese Patients
Lei Wang, Xiaoxia Chu, Jingyao Wang, Licai An, Yinghui Liu, Li Li, Junqing Xu; Yantai, Linyi, China
Hematopoietic Stem Cell Transplantation for Patients with Paroxysmal Nocturnal Hemoglobinuria with or
without Aplastic Anemia: A Multicenter Turkish Experience
Fergün Yılmaz, Nur Soyer, Güldane Cengiz Seval, Sinem Civriz Bozdağ, Pervin Topçuoğlu, Ali Ünal,
Leylagül Kaynar, Gökhan Özgür, Gülsan Sucak, Hakan Göker, Mustafa Velet, Hakan Özdoğu, Mehmet Yılmaz,
Emin Kaya, Ozan Salim, Burak Deveci, İhsan Karadoğan, Güray Saydam, Fahri Şahin, Filiz Vural; İstanbul, İzmir,
Ankara, Adana, Gaziantep, Malatya, Antalya, Turkey
Prediction of Stem Cell Mobilization Failure in Patients with Hodgkin and Non-Hodgkin Lymphoma
Haluk Demiroğlu, Rafiye Çiftçiler, Yahya Büyükaşık, Hakan Göker; Ankara, Turkey
Evaluation of a Generic Bortezomib Molecule in Newly Diagnosed Multiple Myeloma Patients
Sinan Mersin, Ayfer Gedük, Özgür Mehtap, Pınar Tarkun, Serkan Ünal, Merve Gökçen Polat, Kemal Aygün,
Emel Merve Yenihayat, Hayrunnisa Albayrak, Abdullah Hacıhanefioğlu; Kocaeli, Turkey
Cover Picture:
Ceren Uzunoğlu, Tayfur Toptaş,
Yıldız İpek, Fatma Arıkan,
Fergün Yılmaz, Tülin Tuğlular
Shoulder-Pad Sign in a Case of
Amyloidosis Associated with Myeloma
3
Editor-in-Chief
Reyhan Küçükkaya
İstanbul, Turkey
rkucukkaya@hotmail.com
Associate Editors
A. Emre Eşkazan
İstanbul University-Cerrahpaşa, İstanbul, Turkey
emre.eskazan@istanbul.edu.tr
Ali İrfan Emre Tekgündüz
Memorial Bahçelievler Hospital, İstanbul, Turkey
emretekgunduz@yahoo.com
Ayşegül Ünüvar
İstanbul University, İstanbul, Turkey
aysegulu@hotmail.com
Cengiz Beyan
Ankara, Turkey
cengizbeyan@hotmail.com
Hale Ören
Dokuz Eylül University, İzmir, Turkey
hale.oren@deu.edu.tr
İbrahim C. Haznedaroğlu
Hacettepe University, Ankara, Turkey
haznedar@yahoo.com
Selami Koçak Toprak
Ankara University, Ankara, Turkey
sktoprak@yahoo.com
Semra Paydaş
Çukurova University, Adana, Turkey
sepay@cu.edu.tr
Şule Ünal
Hacettepe University, Ankara, Turkey
suleunal2003@hotmail.com
Assistant Editors
Claudio Cerchione
University of Naples Federico II Napoli,
Campania, Italy
Ebru Koca
Başkent University Ankara Hospital,
Clinic of Hematology, Ankara, Turkey
Elif Ünal İnce
Ankara University, Ankara, Turkey
İnci Alacacıoğlu
Dokuz Eylül University, İzmir, Turkey
Mario Tiribelli
University of Udine, Udine, Italy
Müge Sayitoğlu
İstanbul University, İstanbul, Turkey
Nil Güler
Ondokuz Mayıs University, Samsun, Turkey
Olga Meltem Akay
Koç University, İstanbul, Turkey
Veysel Sabri Hançer
İstinye University, İstanbul, Turkey
Zühre Kaya
Gazi University, Ankara, Turkey
International Review Board
Nejat Akar
TOBB University of Economics and Technology Hospital, Ankara, Turkey
Görgün Akpek
Maryland School of Medicine, Baltimore, USA
Serhan Alkan
Cedars-Sinai Medical Center, Los Angeles, USA
Çiğdem Altay
Ankara, Turkey
Meral Beksaç
Ankara University, Ankara, Turkey
Koen van Besien
Weill Cornell Medicine, New York, USA
M. Sıraç Dilber Karolinska University, Stockholm, Sweden
Ahmet Doğan
Memorial Sloan Kettering Cancer Center, New York, USA
Peter Dreger
Heidelberg University, Heidelberg, Germany
Thierry Facon
Lille University, Lille, France
Jawed Fareed
Loyola University, Maywood, USA
Burhan Ferhanoğlu
Koç University, İstanbul, Turkey
Gösta Gahrton
Karolinska University Hospital, Stockholm, Sweden
Dieter Hoelzer
Frankfurt University, Frankfurt, Germany
Andreas Josting
University Hospital Cologne, Cologne, Germany
Emin Kansu
Hacettepe University, Ankara, Turkey
Winfried Kern
Albert Ludwigs University, Freiburg im Breisgau, Germany
Nigel Key
University of North Carolina School of Medicine, NC, USA
Korgün Koral
Southwestern Medical Center, Texas, USA
Abdullah Kutlar
Medical College of Georgia at Augusta University, Augusta, USA
Luca Malcovati
Pavia Medical School University, Pavia, Italy
Marilyn Manco-Johnson University of Colorado Anschutz Medical Campus, Aurora, USA
Robert Marcus
King’s College Hospital, London, UK
Jean Pierre Marie
Pierre et Marie Curie University, Paris, France
Ghulam Mufti
King’s Hospital, London, UK
Gerassimos A. Pangalis Athens University, Athens, Greece
Antonio Piga
Torino University, Torino, Italy
Ananda Prasad
Wayne State University School of Medicine, Detroit, USA
Jacob M. Rowe
Hebrew University of Jerusalem, Jerusalem, Israel
Jens-Ulrich Rüffer
University of Köln, Köln, Germany
Norbert Schmitz
AK St Georg, Hamburg, Germany
Orhan Sezer
Charité Comprehensive Cancer Center, Berlin, Germany
Anna Sureda
Santa Creu i Sant Pau Hospital, Barcelona, Spain
Ayalew Tefferi
Mayo Clinic, Rochester, Minnesota, USA
Nükhet Tüzüner
İstanbul Cerrahpaşa University, İstanbul, Turkey
Catherine Verfaillie
Katholieke Universiteit Leuven, Leuven, Belgium
Srdan Verstovsek
The University of Texas MD Anderson Cancer Center, Houston, USA
Claudio Viscoli
San Martino University, Genoa, Italy
Past Editors
Erich Frank
Orhan Ulutin
Hamdi Akan
Aytemiz Gürgey
Senior Advisory Board
Yücel Tangün
Osman İlhan
Muhit Özcan
Teoman Soysal
Ahmet Muzaffer Demir
Language Editor
Leslie Demir
Statistic Editor
Hülya Ellidokuz
Editorial Office
İpek Durusu
Bengü Timoçin Efe
A-I
Publishing
Services
GALENOS PUBLISHER
Molla Gürani Mah. Kaçamak Sk. No: 21/1, Fındıkzade, İstanbul, Turkey
Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr
Contact Information
Editorial Correspondence should be addressed to Dr. Reyhan Küçükkaya
E-mail : rkucukkaya@hotmail.com
All Inquiries Should be Addressed to
TURKISH JOURNAL OF HEMATOLOGY
Address : Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.) No: 8 06550 Çankaya, Ankara / Turkey
Phone : +90 312 490 98 97
Fax : +90 312 490 98 68
E-mail : tjh@tjh.com.tr
E-ISSN: 1308-5263
Publishing Manager
Muhlis Cem Ar
Management Address
Türk Hematoloji Derneği
Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.)
No: 8 06550 Çankaya, Ankara / Turkey
Online Manuscript Submission
http://mc.manuscriptcentral.com/tjh
Web Page
www.tjh.com.tr
Owner on Behalf of the Turkish Society
of Hematology
Güner Hayri Özsan
Publishing House
Molla Gürani Mah. Kaçamak Sk. No: 21,
34093 Fındıkzade, İstanbul / Turkey
Tel: +90 212 621 99 25
Fax: +90 212 621 99 27
E-mail: info@galenos.com.tr
Publisher Certificate Number: 14521
Publication Date
23.08.2021
Cover Picture
Ceren Uzunoğlu, Tayfur Toptaş, Yıldız İpek, Fatma Arıkan,
Fergün Yılmaz, Tülin Tuğlular
Shoulder-Pad Sign in a Case of Amyloidosis Associated with
Myeloma
Bone marrow biopsy showed plasma cells infiltrating 86% of bone
marrow.
Significant thickening of the subdeltoid bursa was evident upon
shoulder magnetic resonance imaging.
International scientific journal published quarterly.
The Turkish Journal of Hematology is published by the commercial enterprise
of the Turkish Society of Hematology with Decision Number 6 issued by the
Society on 7 October 2008.
A-II
AIMS AND SCOPE
The Turkish Journal of Hematology is published quarterly (March, June,
September, and December) by the Turkish Society of Hematology. It is an
independent, non-profit peer-reviewed international English-language
periodical encompassing subjects relevant to hematology.
The Editorial Board of The Turkish Journal of Hematology adheres to the
principles of the World Association of Medical Editors (WAME), International
Council of Medical Journal Editors (ICMJE), Committee on Publication
Ethics (COPE), Consolidated Standards of Reporting Trials (CONSORT) and
Strengthening the Reporting of Observational Studies in Epidemiology
(STROBE).
The aim of The Turkish Journal of Hematology is to publish original
hematological research of the highest scientific quality and clinical relevance.
Additionally, educational material, reviews on basic developments, editorial
short notes, images in hematology, and letters from hematology specialists
and clinicians covering their experience and comments on hematology
and related medical fields as well as social subjects are published. As of
December 2015, The Turkish Journal of Hematology does not accept case
reports. Important new findings or data about interesting hematological
cases may be submitted as a brief report.
General practitioners interested in hematology and internal medicine
specialists are among our target audience, and The Turkish Journal of
Hematology aims to publish according to their needs. The Turkish Journal of
Hematology is indexed, as follows:
- PubMed Medline
- PubMed Central
- Science Citation Index Expanded
- EMBASE
- Scopus
- CINAHL
- Gale/Cengage Learning
- EBSCO
- DOAJ
- ProQuest
- Index Copernicus
- Tübitak/Ulakbim Turkish Medical Database
- Turk Medline
- Hinari
- GOALI
- ARDI
- OARE
Impact Factor: 1.831
Open Access Policy
Turkish Journal of Hematology is an Open Access journal. This journal
provides immediate open access to its content on the principle that making
research freely available to the public supports a greater global exchange of
knowledge.
Open Access Policy is based on the rules of the Budapest Open Access
Initiative (BOAI) http://www.budapestopenaccessinitiative.org/.
Subscription Information
The Turkish Journal of Hematology is published electronically only as of
2019. Therefore, subscriptions are not necessary. All published volumes are
available in full text free-of-charge online at www.tjh.com.tr.
Address: Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613.
Sok.) No: 8 06550 Çankaya, Ankara / Turkey
Telephone: +90 312 490 98 97
Fax: +90 312 490 98 68
Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh
Web page: www.tjh.com.tr
E-mail: tjh@tjh.com.tr
Permissions
Requests for permission to reproduce published material should be sent to
the editorial office.
Editor: Professor Dr. Reyhan Küçükkaya
Adress: Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613.
Sok.) No: 8 06550 Çankaya, Ankara / Turkey
Telephone: +90 312 490 98 97
Fax: +90 312 490 98 68
Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh
Web page: www.tjh.com.tr
E-mail: tjh@tjh.com.tr
Publisher
Galenos Yayınevi
Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul, Turkey
Telephone : +90 212 621 99 25
Fax : +90 212 621 99 27
info@galenos.com.tr
Instructions for Authors
Instructions for authors are published in the journal and at www.tjh.com.tr
Material Disclaimer
Authors are responsible for the manuscripts they publish in The Turkish
Journal of Hematology. The editor, editorial board, and publisher do not
accept any responsibility for published manuscripts.
If you use a table or figure (or some data in a table or figure) from another
source, cite the source directly in the figure or table legend.
Editorial Policy
Following receipt of each manuscript, a checklist is completed by the Editorial
Assistant. The Editorial Assistant checks that each manuscript contains all
required components and adheres to the author guidelines, after which time
it will be forwarded to the Editor in Chief. Following the Editor in Chief’s
evaluation, each manuscript is forwarded to the Associate Editor, who in
turn assigns reviewers. Generally, all manuscripts will be reviewed by at least
three reviewers selected by the Associate Editor, based on their relevant
expertise. Associate editor could be assigned as a reviewer along with the
reviewers. After the reviewing process, all manuscripts are evaluated in the
Editorial Board Meeting.
Turkish Journal of Hematology’s editor and Editorial Board members are active
researchers. It is possible that they would desire to submit their manuscript
to the Turkish Journal of Hematology. This may be creating a conflict of
interest. These manuscripts will not be evaluated by the submitting editor(s).
The review process will be managed and decisions made by editor-in-chief
who will act independently. In some situation, this process will be overseen
by an outside independent expert in reviewing submissions from editors.
A-III
TURKISH JOURNAL OF HEMATOLOGY
INSTRUCTIONS FOR AUTHORS
The Turkish Journal of Hematology accepts invited review articles,
research articles, brief reports, letters to the editor, and hematological
images that are relevant to the scope of hematology, on the condition
that they have not been previously published elsewhere. Basic science
manuscripts, such as randomized, cohort, cross-sectional, and casecontrol
studies, are given preference. All manuscripts are subject
to editorial revision to ensure they conform to the style adopted by
the journal. There is a double-blind reviewing system. Review articles
are solicited by the Editor-in-Chief. Authors wishing to submit an
unsolicited review article should contact the Editor-in-Chief prior to
submission in order to screen the proposed topic for relevance and
priority.
The Turkish Journal of Hematology does not charge any article
submission or processing charges.
Manuscripts should be prepared according to ICMJE guidelines (http://
www.icmje.org/). Original manuscripts require a structured abstract.
Label each section of the structured abstract with the appropriate
subheading (Objective, Materials and Methods, Results, and Conclusion).
Letters to the editor do not require an abstract. Research or project
support should be acknowledged as a footnote on the title page.
Technical and other assistance should be provided on the title page.
Original Manuscripts
Title Page
Title: The title should provide important information regarding the
manuscript’s content. The title must specify that the study is a cohort
study, cross-sectional study, case-control study, or randomized study (i.e.
Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability
of ferrous succinate tablet formulations without correction for baseline
circadian changes in iron concentration in healthy Chinese male
subjects: A single-dose, randomized, 2-period crossover study. Clin Ther
2011;33:2054-2059).
The title page should include the authors’ names, degrees, and
institutional/professional affiliations and a short title, abbreviations,
keywords, financial disclosure statement, and conflict of interest
statement. If a manuscript includes authors from more than one
institution, each author’s name should be followed by a superscript
number that corresponds to their institution, which is listed separately.
Please provide contact information for the corresponding author,
including name, e-mail address, and telephone and fax numbers.
Important Notice: The title page should be submitted separately.
Running Head: The running head should not be more than 40
characters, including spaces, and should be located at the bottom of
the title page.
Word Count: A word count for the manuscript, excluding abstract,
acknowledgments, figure and table legends, and references, should be
provided and should not exceed 2500 words. The word count for the
abstract should not exceed 300 words.
Conflict of Interest Statement: To prevent potential conflicts of
interest from being overlooked, this statement must be included in each
manuscript. In case there are conflicts of interest, every author should
complete the ICMJE general declaration form, which can be obtained at
http://www.icmje.org/downloads/coi_disclosure.zip
Abstract and Keywords: The second page should include an abstract
that does not exceed 300 words. For manuscripts sent by authors in
Turkey, a title and abstract in Turkish are also required. As most readers
read the abstract first, it is critically important. Moreover, as various
electronic databases integrate only abstracts into their index, important
findings should be presented in the abstract.
Objective: The abstract should state the objective (the purpose of the
study and hypothesis) and summarize the rationale for the study.
Materials and Methods: Important methods should be written
respectively.
Results: Important findings and results should be provided here.
Conclusion: The study’s new and important findings should be
highlighted and interpreted.
Other types of manuscripts, such as reviews, brief reports, and
editorials, will be published according to uniform requirements.
Provide 3-10 keywords below the abstract to assist indexers. Use
terms from the Index Medicus Medical Subject Headings List
(for randomized studies a CONSORT abstract should be provided: http://
www.consort-statement.org).
Introduction: The introduction should include an overview of the
relevant literature presented in summary form (one page), and whatever
remains interesting, unique, problematic, relevant, or unknown about
the topic must be specified. The introduction should conclude with the
rationale for the study, its design, and its objective(s).
Materials and Methods: Clearly describe the selection of observational
or experimental participants, such as patients, laboratory animals, and
controls, including inclusion and exclusion criteria and a description of
the source population. Identify the methods and procedures in sufficient
detail to allow other researchers to reproduce your results. Provide
references to established methods (including statistical methods),
provide references to brief modified methods, and provide the rationale
for using them and an evaluation of their limitations. Identify all drugs
and chemicals used, including generic names, doses, and routes of
administration. The section should include only information that was
available at the time the plan or protocol for the study was devised
A-IV
(https://www.strobe-statement.org/fileadmin/Strobe/uploads/checklists/
STROBE_checklist_v4_combined.pdf).
Statistics: Describe the statistical methods used in enough detail to
enable a knowledgeable reader with access to the original data to verify
the reported results. Statistically important data should be given in the
text, tables, and figures. Provide details about randomization, describe
treatment complications, provide the number of observations, and specify
all computer programs used.
Results: Present your results in logical sequence in the text, tables, and
figures. Do not present all the data provided in the tables and/or figures
in the text; emphasize and/or summarize only important findings, results,
and observations in the text. For clinical studies provide the number of
samples, cases, and controls included in the study. Discrepancies between
the planned number and obtained number of participants should be
explained. Comparisons and statistically important values (i.e. p-value
and confidence interval) should be provided.
Discussion: This section should include a discussion of the data. New and
important findings/results and the conclusions they lead to should be
emphasized. Link the conclusions with the goals of the study, but avoid
unqualified statements and conclusions not completely supported by the
data. Do not repeat the findings/results in detail; important findings/results
should be compared with those of similar studies in the literature, along with
a summarization. In other words, similarities or differences in the obtained
findings/results with those previously reported should be discussed.
Study Limitations: Limitations of the study should be detailed. In
addition, an evaluation of the implications of the obtained findings/
results for future research should be outlined.
Conclusion: The conclusion of the study should be highlighted.
References
Cite references in the text, tables, and figures with numbers in square
brackets. Number references consecutively according to the order in
which they first appear in the text. Journal titles should be abbreviated
according to the style used in Index Medicus (consult List of Journals
Indexed in Index Medicus). Include among the references any paper
accepted, but not yet published, designating the journal followed by “in
press”.
Examples of References:
1. List all authors
Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for marrow
transplantation from unrelated donors for patients with aplastic anemia
after failure of immunosuppressive therapy. Blood 2006;108:1485-1491.
2. Organization as author
Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of
syngeneic bone marrow graft without preconditioning in post-hepatitis
marrow aplasia. Lancet 1977;2:742-744.
3. Book
Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger, 1961.
4. Book Chapter
Perutz MF. Molecular anatomy and physiology of hemoglobin. In:
Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin:
Genetics, Pathophysiology, Clinical Management. New York, Cambridge
University Press, 2000.
5. Abstract
Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin)
stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract).
6. Letter to the Editor
Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further
definition of 20q deletion in myeloid leukemia using fluorescence in situ
hybridization. Blood 1994;84:2821-2823.
7. Supplement
Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr Transplant
2005;9(Suppl 7):81-86.
Brief Reports
Abstract length: Not to exceed 150 words.
Article length: Not to exceed 1200 words.
Introduction: State the purpose and summarize the rationale for the study.
Materials and Methods: Clearly describe the selection of the observational
or experimental participants. Identify the methods and procedures in
sufficient detail. Provide references to established methods (including
statistical methods), provide references to brief modified methods, and
provide the rationale for their use and an evaluation of their limitations.
Identify all drugs and chemicals used, including generic names, doses, and
routes of administration.
Statistics: Describe the statistical methods used in enough detail to
enable a knowledgeable reader with access to the original data to verify
the reported findings/results. Provide details about randomization,
describe treatment complications, provide the number of observations,
and specify all computer programs used.
Results: Present the findings/results in a logical sequence in the text, tables,
and figures. Do not repeat all the findings/results in the tables and figures in
the text; emphasize and/or summarize only those that are most important.
Discussion: Highlight the new and important findings/results of the
study and the conclusions they lead to. Link the conclusions with the
goals of the study, but avoid unqualified statements and conclusions not
completely supported by your data.
Invited Review Articles
Abstract length: Not to exceed 300 words.
Article length: Not to exceed 4000 words.
Review articles should not include more than 100 references. Reviews
should include a conclusion, in which a new hypothesis or study about the
subject may be posited. Do not publish methods for literature search or level
of evidence. Authors who will prepare review articles should already have
published research articles on the relevant subject. The study’s new and
A-V
important findings should be highlighted and interpreted in the Conclusion
section. There should be a maximum of two authors for review articles.
Perspectives in Hematology
“Perspectives” are articles discussing significant topics relevant to
hematology. They are more personal than a Review Article. Authors
wishing to submit a Perspective in Hematology article should contact
the Editor in Chief prior to submission in order to screen the proposed
topic for relevance and priority. Articles submitted for “Perspectives
in Hematology” must advance the hot subjects of experimental and/
or clinical hematology beyond the articles previously published or in
press in TJH. Perspective papers should meet the restrictive criteria of
TJH regarding unique scientific and/or educational value, which will
impact and enhance clinical hematology practice or the diagnostic
understanding of blood diseases. Priority will be assigned to such
manuscripts based upon the prominence, significance, and timeliness of
the content. The submitting author must already be an expert with a
recognized significant published scientific experience in the specific field
related to the “Perspectives” article.
Abstract length: Not to exceed 150 words.
Article length: Not to exceed 1000 words.
References: Should not include more than 50 references
Images in Hematology
Article length: Not to exceed 200 words.
Authors can submit for consideration illustrations or photos that are
interesting, instructive, and visually attractive, along with a few lines
of explanatory text and references. Images in Hematology can include
no more than 200 words of text, 5 references, and 3 figures or tables.
No abstract, discussion, or conclusion is required, but please include a
brief title.
Letters to the Editor
Article length: Not to exceed 500 words.
Letters can include no more than 500 words of text, 5-10 references,
and 1 figure or table. No abstract is required, but please include a brief
title. The total number is usually limited to a maximum of five authors
for a letter to the editor.
Tables
Supply each table in a separate file. Number tables according to the order
in which they appear in the text, and supply a brief caption for each.
Give each column a short or abbreviated heading. Write explanatory
statistical measures of variation, such as standard deviation or standard
error of mean. Be sure that each table is cited in the text.
Figures
Figures should be professionally drawn and/or photographed. Authors
should number figures according to the order in which they appear in
the text. Figures include graphs, charts, photographs, and illustrations.
Each figure should be accompanied by a legend that does not exceed
50 words. Use abbreviations only if they have been introduced in the
text. Authors are also required to provide the level of magnification for
histological slides. Explain the internal scale and identify the staining
method used. Figures should be submitted as separate files, not in
the text file. High-resolution image files are not preferred for initial
submission as the file sizes may be too large. The total file size of the
PDF for peer review should not exceed 5 MB.
Authorship
Each author should have participated sufficiently in the work to assume
public responsibility for the content. Any portion of a manuscript that is
critical to its main conclusions must be the responsibility of at least one
author.
Contributor’s Statement
All submissions should contain a contributor’s statement page. Each
statement should contain substantial contributions to idea and design,
acquisition of data, and analysis and interpretation of findings. All persons
designated as an author should qualify for authorship, and all those that
qualify should be listed. Each author should have participated sufficiently
in the work to take responsibility for appropriate portions of the text.
Acknowledgments
Acknowledge support received from individuals, organizations, grants,
corporations, and any other source. For work involving a biomedical
product or potential product partially or wholly supported by corporate
funding, a note stating, “This study was financially supported (in part)
with funds provided by (company name) to (authors’ initials)”, must
be included. Grant support, if received, needs to be stated and the
specific granting institutions’ names and grant numbers provided when
applicable.
Authors are expected to disclose on the title page any commercial or
other associations that might pose a conflict of interest in connection
with the submitted manuscript. All funding sources that supported the
work and the institutional and/or corporate affiliations of the authors
should be acknowledged on the title page.
Ethics
When reporting experiments conducted with humans indicate that
the procedures were in accordance with ethical standards set forth
by the committee that oversees human subject research. Approval of
research protocols by the relevant ethics committee, in accordance with
international agreements (Helsinki Declaration of 1975, revised 2013
available at https://www.wma.net/policies-post/wma-declaration-ofhelsinki-ethical-principles-for-medical-research-involving-humansubjects/),
is required for all experimental, clinical, and drug studies.
Patient names, initials, and hospital identification numbers should not be
used. Manuscripts reporting the results of experimental investigations
conducted with humans must state that the study protocol received
A-VI
institutional review board approval and that the participants provided
informed consent.
Non-compliance with scientific accuracy is not in accord with scientific
ethics. Plagiarism: To re-publish, in whole or in part, the contents of
another author’s publication as one’s own without providing a reference.
Fabrication: To publish data and findings/results that do not exist.
Duplication: Use of data from another publication, which includes republishing
a manuscript in different languages. Salami slicing: To create
more than one publication by dividing the results of a study unnecessarily.
We disapprove of such unethical practices as plagiarism, fabrication,
duplication, and salami slicing, as well as efforts to influence the
review process with such practices as gifting authorship, inappropriate
acknowledgments, and references. Additionally, authors must respect
participants‘ right to privacy.
On the other hand, short abstracts published in congress books that do
not exceed 400 words and present data of preliminary research, and those
that are presented in an electronic environment, are not considered as
previously published work. Authors in such a situation must declare this
status on the first page of the manuscript and in the cover letter.
(The COPE flowchart is available at http://publicationethics.org.)
We use iThenticate to screen all submissions for plagiarism before
publication.
Conditions of Publication
All authors are required to affirm the following statements before their
manuscript is considered: 1. The manuscript is being submitted only
to The Turkish Journal of Hematology; 2. The manuscript will not be
submitted elsewhere while under consideration by The Turkish Journal
of Hematology; 3. The manuscript has not been published elsewhere,
and should it be published in The Turkish Journal of Hematology it will
not be published elsewhere without the permission of the editors (these
restrictions do not apply to abstracts or to press reports for presentations
at scientific meetings); 4. All authors are responsible for the manuscript’s
content; 5. All authors participated in the study concept and design,
analysis and interpretation of the data, and drafting or revising of the
manuscript and have approved the manuscript as submitted. In addition,
all authors are required to disclose any professional affiliation, financial
agreement, or other involvement with any company whose product
figures prominently in the submitted manuscript.
Authors of accepted manuscripts will receive electronic page proofs and
are responsible for proofreading and checking the entire article within
two days. Failure to return the proof in two days will delay publication.
If the authors cannot be reached by email or telephone within two
weeks, the manuscript will be rejected and will not be published in the
journal.
Copyright
At the time of submission all authors will receive instructions for submitting
an online copyright form. No manuscript will be considered for review until
all authors have completed their copyright form. Please note, it is our practice
not to accept copyright forms via fax, e-mail, or postal service unless there
is a problem with the online author accounts that cannot be resolved. Every
effort should be made to use the online copyright system. Corresponding
authors can log in to the submission system at any time to check the status
of any co-author’s copyright form. All accepted manuscripts become the
permanent property of The Turkish Journal of Hematology and may not be
published elsewhere, in whole or in part, without written permission.
Note: We cannot accept any copyright form that has been altered,
revised, amended, or otherwise changed. Our original copyright form
must be used as is.
Units of Measurement
Measurements should be reported using the metric system, according
to the International System of Units (SI). Consult the SI Unit Conversion
Guide, New England Journal of Medicine Books, 1992.
An extensive list of conversion factors can be found at https://www.
nist.gov/sites/default/files/documents/pml/wmd/metric/SP1038.pdf. For
more details, see http://www.amamanualofstyle.com/oso/public/jama/
si_conversion_table.html.
Abbreviations and Symbols
Use only standard abbreviations. Avoid abbreviations in the title and
abstract. The full term for an abbreviation should precede its first use
in the text, unless it is a standard abbreviation. All acronyms used in the
text should be expanded at first mention, followed by the abbreviation
in parentheses; thereafter the acronym only should appear in the text.
Acronyms may be used in the abstract if they occur 3 or more times
therein, but must be reintroduced in the body of the text. Generally,
abbreviations should be limited to those defined in the AMA Manual of
Style, current edition. A list of each abbreviation (and the corresponding
full term) used in the manuscript must be provided on the title page.
Online Manuscript Submission Process
The Turkish Journal of Hematology uses submission software powered
by ScholarOne Manuscripts. The website for submissions to The Turkish
Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This
system is quick and convenient, both for authors and reviewers.
Setting Up an Account
New users to the submission site will need to register and enter their
account details before they can submit a manuscript. Log in, or click
the “Create Account” button if you are a first-time user. To create a new
account: After clicking the “Create Account” button, enter your name and
e-mail address, and then click the “Next” button. Your e-mail address is very
important. Enter your institution and address information, as appropriate,
and then click the “Next” Button. Enter a user ID and password of your
choice, select your area of expertise, and then click the “Finish” button.
If you have an account, but have forgotten your log-in details, go to
“Password Help” on the journal’s online submission system and enter your
e-mail address. The system will send you an automatic user ID and a new
temporary password.
A-VII
Full instructions and support are available on the site, and a user ID
and password can be obtained during your first visit. Full support for
authors is provided. Each page has a “Get Help Now” icon that connects
directly to the online support system. Contact the journal administrator
with any questions about submitting your manuscript to the journal
(tjh@tjh.com.tr). For ScholarOne Manuscripts customer support, click on
the “Get Help Now” link on the top right-hand corner of every page on
the site.
The Electronic Submission Process
Log in to your author center. Once you have logged in, click the “Submit
a Manuscript” link in the menu bar. Enter the appropriate data and
answer the questions. You may copy and paste directly from your
manuscript. Click the “Next” button on each screen to save your work
and advance to the next screen.
Upload Files
Click on the “Browse” button and locate the file on your computer. Select
the appropriate designation for each file in the drop-down menu next to
the “Browse” button. When you have selected all the files you want to
upload, click the “Upload Files” button. Review your submission before
sending to the journal. Click the “Submit” button when you are finished
reviewing. You can use ScholarOne Manuscripts at any time to check
the status of your submission. The journal’s editorial office will inform
you by e-mail once a decision has been made. After your manuscript
has been submitted, a checklist will then be completed by the Editorial
Assistant. The Editorial Assistant will check that the manuscript contains
all required components and adheres to the author guidelines. Once the
Editorial Assistant is satisfied with the manuscript it will be forwarded to
the Senior Editor, who will assign an editor and reviewers.
The Review Processs
Each manuscript submitted to The Turkish Journal of Hematology is
subject to an initial review by the editorial office in order to determine
if it is aligned with the journal’s aims and scope and complies with
essential requirements. Manuscripts sent for peer review will be assigned
to one of the journal’s associate editors that has expertise relevant to the
manuscript’s content. All accepted manuscripts are sent to a statistical
and English language editor before publishing. Once papers have been
reviewed, the reviewers’ comments are sent to the Editor, who will then
make a preliminary decision on the paper. At this stage, based on the
feedback from reviewers, manuscripts can be accepted or rejected, or
revisions can be recommended. Following initial peer-review, articles
judged worthy of further consideration often require revision. Revised
manuscripts generally must be received within 3 months of the date of
the initial decision. Extensions must be requested from the Associate
Editor at least 2 weeks before the 3-month revision deadline expires;
The Turkish Journal of Hematology will reject manuscripts that are
not received within the 3-month revision deadline. Manuscripts with
extensive revision recommendations will be sent for further review
(usually by the same reviewers) upon their re-submission. When a
manuscript is finally accepted for publication, the Technical Editor
undertakes a final edit and a marked-up copy will be e-mailed to the
corresponding author for review and any final adjustments.
Submission of Revised Papers
When revising a manuscript based on the reviewers’ and Editor’s
feedback, please insert all changed text in red. Please do not use
track changes, as this feature can make reading difficult. To submit
revised manuscripts, please log in to your author center at ScholarOne
Manuscripts. Your manuscript will be stored under “Manuscripts with
Decisions”. Please click on the “Create a Revision” link located to the right
of the manuscript title. A revised manuscript number will be created for
you; you will then need to click on the “Continue Submission” button.
You will then be guided through a submission process very similar to
that for new manuscripts. You will be able to amend any details you
wish. At stage 6 (“File Upload”), please delete the file for your original
manuscript and upload the revised version. Additionally, please upload
an anonymous cover letter, preferably in table format, including a
point-by-point response to the reviews’ revision recommendations. You
will then need to review your paper as a PDF and click the “Submit”
button. Your revised manuscript will have the same ID number as the
original version, but with the addition of an R and a number at the
end, for example, TJH-2011-0001 for an original and TJH-2011-0001.
R1, indicating a first revision; subsequent revisions will end with R2,
R3, and so on. Please do not submit a revised manuscript as a new
paper, as revised manuscripts are processed differently. If you click on
the “Create a Revision” button and receive a message stating that the
revision option has expired, please contact the Editorial Assistant at
tjh@tjh.com.tr to reactivate the option.
English Language and Statistical Editing
All manuscripts are professionally edited by an English language editor
prior to publication. After papers have been accepted for publication,
manuscript files are forwarded to the statistical and English language
editors before publishing. Editors will make changes to the manuscript
to ensure it adheres to TJH requirements. Significant changes or
concerns are referred to corresponding authors for editing.
Online Early
The Turkish Journal of Hematology publishes abstracts of accepted
manuscripts online in advance of their publication. Once an accepted
manuscript has been edited, the authors have submitted any final
corrections, and all changes have been incorporated, the manuscript will
be published online. At that time the manuscript will receive a Digital
Object Identifier (DOI) number. Both forms can be found at www.tjh.
com.tr. Authors of accepted manuscripts will receive electronic page
proofs directly from the printer and are responsible for proofreading
and checking the entire manuscript, including tables, figures, and
references. Page proofs must be returned within 48 hours to avoid delays
in publication.
A-VIII
CONTENTS
Research Articles
175 Association of Immune Thrombocytopenia and Celiac Disease in Children: A Retrospective Case Control
Study
Angela Guarina, Maddalena Marinoni, Giuseppe Lassandro, Paola Saracco, Silverio Perrotta, Elena Facchini, Lucia Dora Notarangelo,
Giovanna Russo, Paola Giordano, Francesca Romano, Elisa Bertoni, Chiara Gorio, Gianluca Boscarol, Milena Motta, Marco Spinelli,
Angelica Barone, Marco Zecca, Francesca Compagno, Saverio Ladogana, Angela Maggio, Maurizio Miano, Gianluca Dell’Orso, Elena Chiocca,
Ilaria Fotzi, Angela Petrone, Assunta Tornesello, Irene D’Alba, Silvia Salvatore, Maddalena Casale, Giuseppe Puccio, Ugo Ramenghi,
Piero Farruggia; Palermo, Varese, Bari, Torin, Naples, Bologna, Brescia, Catania, Bolzano, Monza, Parma, Pavia, Rotondo, Genoa, Firenze,
Trento, Lecce, Ancona, Italy
181 Comparison of Splenectomy and Eltrombopag Treatment in the Second-Line Treatment of Immune
Thrombocytopenic Purpura
Mehmet Can Uğur, Sinem Namdaroğlu, Esma Evrim Doğan, Esra Turan Erkek, Nihan Nizam, Rafet Eren, Oktay Bilgir; İzmir, İstanbul, Turkey
188 Clinical Characteristics and Optimal Therapy of Acute Myeloid Leukemia with Myelodysplasia-Related
Changes: A Retrospective Analysis of a Cohort of Chinese Patients
Lei Wang, Xiaoxia Chu, Jingyao Wang, Licai An, Yinghui Liu, Li Li, Junqing Xu; Yantai, Linyi, China
195 Hematopoietic Stem Cell Transplantation for Patients with Paroxysmal Nocturnal Hemoglobinuria with
or without Aplastic Anemia: A Multicenter Turkish Experience
Fergün Yılmaz, Nur Soyer, Güldane Cengiz Seval, Sinem Civriz Bozdağ, Pervin Topçuoğlu, Ali Ünal, Leylagül Kaynar, Gökhan Özgür,
Gülsan Sucak, Hakan Göker, Mustafa Velet, Hakan Özdoğu, Mehmet Yılmaz, Emin Kaya, Ozan Salim, Burak Deveci, İhsan Karadoğan,
Güray Saydam, Fahri Şahin, Filiz Vural; İstanbul, İzmir, Ankara, Adana, Gaziantep, Malatya, Antalya, Turkey
204 Prediction of Stem Cell Mobilization Failure in Patients with Hodgkin and Non-Hodgkin Lymphoma
Haluk Demiroğlu, Rafiye Çiftçiler, Yahya Büyükaşık, Hakan Göker; Ankara, Turkey
211 Evaluation of a Generic Bortezomib Molecule in Newly Diagnosed Multiple Myeloma Patients
Sinan Mersin, Ayfer Gedük, Özgür Mehtap, Pınar Tarkun, Serkan Ünal, Merve Gökçen Polat, Kemal Aygün, Emel Merve Yenihayat,
Hayrunnisa Albayrak, Abdullah Hacıhanefioğlu; Kocaeli, Turkey
Brief Report
218 Post-Marketing Analysis of Peripheral Neuropathy Burden with New-Generation Proteasome Inhibitors
Using the FDA Adverse Event Reporting System
Syeda A. Mina, Ibrahim N. Muhsen, Ethan A. Burns, Humaira Sarfraz, Sai Ravi Pingali, Jiaqiong Xu, Shahrukh K. Hashmi; Houston, Rochester,
USA; Abu Dhabi, UAE
Images in Hematology
222 Extremity Necrosis Due to Intrauterine Arterial Ischemia
Serdar Beken, Kerim Sarıyılmaz, Eda Albayrak, Arzu Akçay, Ayşe Korkmaz; İstanbul, Turkey
224 Myeloid Sarcoma Involving the Testicular Vein
Nuh Filizoğlu, Salih Özgüven; İstanbul, Turkey
A-IX
226 Giant Cell Arteritis with Concomitant Chronic Myelomonocytic Leukemia
Mert Öztaş, Ilkın Muradov, Abdülkadir Erçalışkan, Ahu Senem Demiröz, Şebnem Batur, Ahmet Emre Eşkazan, Serdal Uğurlu;
İstanbul, Turkey
Letters to the Editor
228 Flower-Like Plasma Cell: A Comment
Smeeta Gajendra; New Delhi, India
229 Myeloma and Cystoisospora belli
Pathum Sookaromdee, Viroj Wiwanitkit; Bangkok, Thailand; Pune, India
230 Lenalidomide Combined with Interferon α-1b and Interleukin-2 in the Treatment of 21 Cases of
Acute Myeloid Leukemia
Cheng Cheng, Ruihua Mi, Dongbei Li, Lin Chen, Xudong Wei; Zhengzhou, China
233 Shoulder-Pad Sign in a Case of Amyloidosis Associated with Myeloma
Ceren Uzunoğlu, Tayfur Toptaş, Yıldız İpek, Fatma Arıkan, Fergün Yılmaz, Tülin Tuğlular; İstanbul, Turkey
234 Sweet Syndrome Associated with Ixazomib
İrfan Yavaşoğlu, Zahit Bolaman; Aydın, Turkey
236 Long Non-Coding RNA MALAT1 Contributed to the Proliferation of PNH Clone in Paroxysmal
Nocturnal Hemoglobinuria Patients
Honglei Wang, Yingying Chen, Hui Liu, Zhaoyun Liu, Rong Fu; Tianjin, China
239 Dicentric (7;12)(p11;p11) in T/Myeloid Mixed-Phenotype Acute Leukemia
Smeeta Gajendra, Akshay Ramesh Gore, Nitin Sood, Manorama Bhargava; New Delhi, Gurgaon, India
241 A Novel Variant in the ACVRL1 Gene in a Patient with Cirrhosis and Hereditary Hemorrhagic
Telangiectasia
Mehmet Baysal, Nihan Alkış, Hakan Gürkan, Ahmet Muzaffer Demir; Bursa, Edirne, Turkey
243 Can Hematological Findings of COVID-19 in Pediatric Patients Guide Physicians Regarding Clinical
Severity?
Kamile Ötiken Arıkan, Şahika Şahinkaya, Elif Böncüoğlu, Elif Kıymet, Ela Cem, Aybüke Akaslan Kara, Nuri Bayram, İlker Devrim;
İzmir, Turkey
A-X
Guarina A. et al: Association of Immune Thrombocytopenia and Celiac Disease
RESEARCH ARTICLE
DOI: 10.4274/tjh.galenos.2021.2021.0128
Turk J Hematol 2021;38:175-180
Association of Immune Thrombocytopenia and Celiac Disease in
Children: A Retrospective Case Control Study
Çocuklarda İmmün Trombositopeni ve Çölyak Hastalık Birlikteliği: Retrospektif Olgu Kontrol
Çalışması
Angela Guarina 1 , Maddalena Marinoni 2 , Giuseppe Lassandro 3 , Paola Saracco 4 , Silverio Perrotta 5 , Elena Facchini 6 ,
Lucia Dora Notarangelo 7 , Giovanna Russo 8 , Paola Giordano 3 , Francesca Romano 4 , Elisa Bertoni 7 , Chiara Gorio 7 ,
Gianluca Boscarol 9 , Milena Motta 8 , Marco Spinelli 10 , Angelica Barone 11 , Marco Zecca 12 , Francesca Compagno 12 ,
Saverio Ladogana 13 , Angela Maggio 13 , Maurizio Miano 14 , Gianluca Dell’Orso 14 , Elena Chiocca 15 , Ilaria Fotzi 15 ,
Angela Petrone 16 , Assunta Tornesello 17 , Irene D’Alba 18 , Silvia Salvatore 19 , Maddalena Casale 5 , Giuseppe Puccio 1 ,
Ugo Ramenghi 4 , Piero Farruggia 1
1U.O.C. Oncoematologia Pediatrica, ARNAS Civico, Di Cristina, Benfratelli, Palermo, Italy
2Pediatria-DH Oncoematologico Pediatrico, SSD Oncoematologia Pediatrica-Ospedale Filippo Del Ponte, Varese ASST Settelaghi, Varese, Italy
3Department of Biomedical Sciences and Human Oncology, University of Bari “Aldo Moro,” Bari, Italy
4SC Pediatria Specialistica Universitaria, AOU Città della Salute e della Scienza, Presidio Ospedale Infantile Regina Margherita, Torin, Italy
5U.O. S.D. Ematologia e Oncologia Pediatrica Dai Materno Infantile - Università degli Studi della Campania Luigi Vanvitelli, Naples, Italy
6Clinica Pediatrica Oncologia Ed Ematologia Pediatrica “Lalla Seràgnoli - Policlinico Sant’Orsola Malpighi,” Bologna, Italy
7U.O. Oncoematologia Pediatrica, Presidio Ospedale dei Bambini, Spedali Civili, Brescia, Italy
8UOC Ematologia ed Oncologia Pediatrica con TMO - AOU Policlinico “Rodolico-San Marco,” Università di Catania, Catania, Italy
9Ospedale Regionale Dipartimento di Pediatria, Bolzano, Italy
10Fondazione MBBM/AO San Gerardo Clinica Pediatrica Universitaria, Monza, Italy
11U.O. Pediatria e Oncoematologia - AOU, Parma, Italy
12SC Oncoematologia Pediatrica - Fondazione IRCCS, Policlinico San Matteo, Pavia, Italy
13UOC Oncoematologia Pediatrica - IRCCS Ospedale Casa Sollievo della Sofferenza, San Giovanni Rotondo, Italy
14Dipartimento di Scienze Pediatriche Generali e Specialistiche, U.O.C. Oncologia IRCCS Istituto Giannina Gaslini, Genoa, Italy
15Oncologia, Ematologia e TCSE - Centro di Eccellenza di Oncologia ed Ematologia - AOU A. Mayer, Firenze, Italy
16U.O.M. Pediatria Ospedale S. Chiara, Trento, Italy
17U.O.C. Di Oncoematologia Pediatrica - PO “Vito Fazzi”, Lecce, Italy
18S.O.S.D., Oncomematologia Pediatrica, A.O.U. Azienda Ospedali Riuniti, Ospedale Pediatrico Salesi, Ancona, Italy
19Dipartimento di Pediatria, Università degli Studi dell’Insubria, Varese, Italy
Abstract
Objective: The association between celiac disease (CD) and immune
thrombocytopenia (ITP) is still uncertain. The aim of this study was to
characterize the coexistence of these two diseases in Italian children.
Materials and Methods: This is a retrospective multicenter study
investigating the occurrence of CD in 28 children with ITP diagnosed
from January 1, 2000, to December 31, 2019.
Öz
Amaç: İmmün trombositopeni (İTP) ve çölyak hastalığı (ÇH) arasındaki
ilişki hala belirsizliğini korumaktadır. Bu çalışmanın amacı İtalyan
çocuklarında bu iki hastalık arasındaki ilişkiyi ortaya koymaktır.
Gereç ve Yöntemler: Bu çalışma, 1 Ocak 2000’den 31 Aralık 2019’a
kadar İTP tanısına ek olarak ÇH tanısı alan 28 çocuğun araştırıldığı
geriye dönük çok merkezli bir çalışmadır.
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
*Institution in which the work was performed: Unità Operativa di Oncoematologia Pediatrica, ARNAS Civico,
Di Cristina e Benfratelli, Piazza Nicola Leotta, 4, 90127 Palermo, Italy.
Address for Correspondence/Yazışma Adresi: Piero Farruggia, M.D., U.O.C. Oncoematologia Pediatrica,
ARNAS Civico, Di Cristina, Benfratelli, Palermo, Italy
Phone : +39-91-6664309
E-mail : piero.farruggia@arnascivico.it ORCID: orcid.org/0000-0002-3412-0399
Received/Geliş tarihi: February 15, 2021
Accepted/Kabul tarihi: May 17, 2021
175
Guarina A. et al: Association of Immune Thrombocytopenia and Celiac Disease
Turk J Hematol 2021;38:175-180
Abstract
Results: The first diagnosis was ITP in 57.1% and CD in 32.1% of
patients. In 3 patients (10.7%), the two diagnoses were simultaneous.
All the potential and silent cases of CD in our cohort were diagnosed
in the groups of “ITP first” and “simultaneous diagnosis”. In all children
ITP was mild, and in 2 out of 8 not recovered from ITP at the time
of CD diagnosis a normalization of platelet counts (>100,000/µL)
occurred 3 and 5 months after starting a gluten-free diet, respectively.
Conclusion: We think that screening for CD should be considered
in children with ITP regardless of the presence of gastrointestinal
symptoms. Furthermore, some patients may recover from ITP after
starting a gluten-free diet.
Keywords: Celiac, Children, Immune, Thrombocytopenia, Pediatric
Öz
Bulgular: Hastaların %57,1’inde ilk tanı İTP ve %32,1’inde ÇH idi.
Üç hastada (%10,7) iki tanı aynı anda konulmuştu. Kohortumuzdaki
tüm potansiyel ve sessiz ÇH olguları “önce İTP” ve “eşzamanlı tanı”
gruplarında teşhis edildi. Tüm çocuklarda İTP hafifti ve ÇH tanısı
sırasında trombositopenisi devam eden 8 çocuktan 2’sinde, glutensiz
diyete başladıktan sonra sırasıyla 3 ve 5 ayda trombosit sayılarında
normalleşme (>100.000/µL) görüldü.
Sonuç: Bu çalışma İTP’li çocuklarda gastrointestinal semptomların
varlığına bakılmaksızın ÇH taramasının yapılması gerektiğini
düşündürmektedir. Bazı hastalarda trombosit sayılarının glutensiz bir
diyete başladıktan sonra düzelebileceği akılda bulundurulmalıdır.
Anahtar Sözcükler: Çölyak, Çocuklar, İmmün, Trombositopeni,
Pediatrik
Introduction
Celiac disease (CD) is an immune disorder of the small intestine,
often associated with other autoimmune disorders [1], whose
prevalence has been estimated in Europe as 0.7% [2]. Immune
thrombocytopenia (ITP) is an acquired disease caused by
autoantibodies against platelet antigens whose estimated yearly
incidence in the pediatric population is 0.0019%-0.0064% [3].
The features of ITP and CD coexistence have been investigated
in some cohorts and case reports with contradictory results,
especially regarding the efficacy of a gluten-free diet on ITP [4,
5,6,7,8,9,10,11,12,13,14,15,16,17,18]. Furthermore, no study has
aimed to describe the specific features of this association in the
pediatric population. The goal of this study was to characterize
the association of these two diseases in Italian children.
Materials and Methods
A case report form (CRF) was sent to all 55 AIEOP (Associazione
Italiana Emato-Oncologia Pediatrica) Centers collecting
information about patients up to 18 years of age with both CD
and ITP diagnosed from January 1, 2000, to December 31, 2019.
Children affected by a known immunodeficiency were excluded.
The clinical phenotypes of ITP and CD autoantibody testing (antitransglutaminase
antibodies ± anti-endomysial antibodies) ±
biopsy results were recorded. CD was considered and classified
according to Tonutti and Bizzaro [19] as classic (presence of
symptoms of malabsorption, positive CD-specific antibodies and
biopsy, and symptom resolution with a gluten-free diet), silent
(positive CD-specific antibodies, HLA DQ2 or DQ8, and biopsy
without symptoms), latent (presence of HLA DQ2 or DQ8 and
histological alterations typical of CD in duodenal biopsy at some
point in life, but neither symptoms nor positive antibodies), or
potential (positive CD-specific antibodies and HLA without
histological abnormalities in duodenal biopsies). ITP was defined
as newly diagnosed (within 3 months from diagnosis), persistent
(between 3 and 12 months from diagnosis), or chronic (cITP,
lasting for more than 12 months) [20]. The ITP bleeding
score was defined as follows [21]: Type A: asymptomaticpaucisymptomatic
ITP, with clinical symptoms ranging from no
bleeding to a few petechiae and some bruises without mucosal
hemorrhages; Type B: intermediate ITP, a clinical picture with
more petechiae, bruising, and mucosal hemorrhages; Type C:
severe ITP, a clinical picture with severe cutaneous and mucosal
bleeding symptoms with at least one of the following: retinal
hemorrhages, intracranial hemorrhage, other severe internal
hemorrhages, hemorrhagic shock, or life-threatening bleeding.
The timing of the diagnosis of the patients was classified as
follows: 1) CD first: CD was diagnosed before ITP; 2) ITP first: ITP
was diagnosed before CD; 3) Simultaneous diagnosis: the second
disease (CD or ITP) was diagnosed during hospitalization or
initial ascertainment for the other disorder. Considering therapy
or efficacy of a gluten-free diet on ITP, complete response was
defined as any platelet count of ≥100,000/µL with the absence
of bleeding, partial response as any platelet count between
30,000 and 100,000/µL with at least doubling of the baseline
count and absence of bleeding, and no response as any platelet
count of <30,000/µL or less than doubling of the baseline count
and/or occurrence of bleeding.
Statistical Analysis
Statistical analysis was performed using open source R statistical
software [22].
Results
We collected CRFs for 28 ITP/CD patients diagnosed in Italy from
2000 to 2019; they were all Caucasian (male/female=1/2.1).
Among CD patients, for 11 the diagnosis was performed
through intestinal biopsy + anti-transglutaminase ± endomysial
antibodies detection, and for the remaining 17 through
antibody dosages only according to ESPGHAN guidelines. The
most relevant clinical features of the cohort are shown in
176
Turk J Hematol 2021;38:175-180
Guarina A. et al: Association of Immune Thrombocytopenia and Celiac Disease
Table 1. The median follow-up (FUP) time from ITP and CD
diagnosis was 4.4 years (range: 0.2-16.5) and 2.3 years (range:
0.02-15.2), respectively. Median age at CD and ITP diagnosis was
6.2 and 5.8 years, respectively. Among 27 evaluable patients,
a positive family history for other autoimmune diseases was
present in 15 (55.6%): thyroid disorders were reported in 66.6%
of these cases and CD in 40%. ITP was present in the family
history of 1 patient only (grandfather). Extraintestinal disorders
affected 4 patients (14.8%); interestingly, 3 out of 4 were
autoimmune hemolytic anemia. The median number of platelets
at ITP diagnosis was 19,500/µL (range: 1,000-96,000) and the
bleeding score was A in 67.9% and B in 32.1% of patients,
respectively. First-line therapy for ITP was IVIG in 18 patients
(64.3%) and oral prednisone in 4 patients (14.3%), while 6
patients (21.4%) were not treated (“wait and see”). ITP turned
out to be persistent in 12 out of 27 evaluable cases (44.4%) and
chronic in 10 out of 25 evaluable cases (40%); the median number
of platelets at 3 and 12 months from ITP onset was 100,000/µL
(range: 1,000-446,000) and 135,000/µL (range: 15,000-343,000),
respectively; only 1 patient at 12 months from ITP diagnosis
had platelets of >20,000/µL. At the last FUP, 25.0% of patients
were still presenting with cITP; none of them had platelets of
>50,000/µL and only 1 patient was still on treatment (with
mycophenolate mofetil). Helicobacter pylori was tested in 57.1%
of patients using a stool antigen test and was found negative in
all cases. Bone marrow aspiration was performed for 57.1% of
patients and was always consistent with ITP. CD was classified
as classical, silent, latent, and potential in 17 (60.7%), 7 (25%),
2 (7.1%), and 2 (7.1%) cases, respectively. The first diagnosis
was ITP for 16 patients (57.1%) and CD for 9 patients (32.1%).
For 3 patients (10.7%), the two diagnoses were simultaneous; 1
potential and 2 classical cases of CD were discovered just after
ITP onset, in 1 patient after having performed an autoimmune
panel for screening and in the other 2 after having evaluated
pre-existing gastrointestinal symptoms. The most relevant
features of the “CD first” and “ITP first” patients are shown
in Table 2. In the “CD first” subgroup (9 patients), the median
time from diagnosis of CD to diagnosis of ITP was 1.6 years
(range: 0.2-10.1). These 9 cases of CD were all of the classic type,
but 2 (latent) patients were on a gluten-free diet at the moment
of ITP diagnosis. None of them suffered from other autoimmune
diseases and 3 out 8 evaluable patients (37.5%) developed
cIPT. In the “ITP first” subgroup (16 patients), the median
time from diagnosis of ITP to diagnosis of CD was 2.8 years
(range: 0.1-12.9) and all cases of silent CD (n=7), diagnosed
thanks to the autoimmune screening performed in the centers,
Table 1. Characteristics of the patients.
Median age at CD diagnosis (years) 6.2 (range: 0.6-27.6)
Median age at ITP diagnosis (years) 5.8 (range: 0.5-15.1)
Median PLTs at ITP diagnosis
Family history of autoimmune diseases 55.6%
Extraintestinal disorders 14.8%
CD type
ITP bleeding score
Timing of diagnosis
Efficacy of gluten-free diet on ITP
cITP at 12 months 40%
First-line therapy for ITP
19,500/µL (range: 1,000-96,000/µL)
Latent: 7.1%
Potential: 7.1%
Silent: 25%
Classic: 60.7%
Score A: 67.9%
Score B: 32.1%
ITP first: 57.1%
CD first: 32.1%
Simultaneous: 10.7%
NR: 77.8%
CR: 22.2%
First rescue therapy for ITP 42.9%
Second rescue therapy for ITP 21.4%
IVIG: 64.3%
Wait and see: 21.4%
Oral prednisone: 14.3%
Median FUP from ITP diagnosis (years) 4.4 (range: 0.2-16.5)
Median FUP from CD diagnosis (years) 2.3 (range: 0.02-15.2)
CD: Celiac disease; ITP: immune thrombocytopenia; FUP: follow-up; PLTs: platelets; NR: no response; CR: complete response; cITP: chronic immune thrombocytopenia; IVIG: intravenous
immunoglobulin.
177
Guarina A. et al: Association of Immune Thrombocytopenia and Celiac Disease
Turk J Hematol 2021;38:175-180
Table 2. Characteristics of the CD first and ITP first patients.
Median PLTs at ITP diagnosis
CD first (n=9)
18,000/µL
(range: 2,000-96,000/µL)
Family history of autoimmune diseases 77.7% 40%
Extraintestinal disorders 0 25%
ITP score bleeding
A: 77.8%
B: 22.2%
ITP first (n=16)
24,000/µL
(range: 1,000-82,000/µL)
A: 68.7%
B: 31.2%
cITP at 12 months 37.5% 46.6%
First-line therapy for ITP
IVIG: 50%
Wait and see: 25.0%
Oral prednisone: 25.0%
IVIG: 62.5%
Wait and see: 25.0%
Oral prednisone: 12.5%
CD: Celiac disease; ITP: immune thrombocytopenia; PLTs: platelets; cITP: chronic immune thrombocytopenia; IVIG: intravenous immunoglobulin.
were seen among these patients. At ITP onset 5 patients
(31.2%) were not treated (“wait and see”), 9 (56.2%) received
intravenous immunoglobulin (IVIG), and 2 (12.5%) received
oral prednisone; after that, at the moment of CD diagnosis,
5 (31.2%) had not yet been treated, 5 (31.2%) had received IVIG,
5 (31.2%) had received both IVIG and oral prednisone, and 1
(6.2%) had received oral prednisone only.
Subsequent rescue therapies for ITP were attempted for 12 out of
28 patients (42.9%): half, relapsed after prednisone, were treated
with IVIG and half, relapsed after IVIG, with oral prednisone.
Only 6 patients (21.4%) needed further treatments: 3 children
received IVIG (one of them was later treated with eltrombopag),
2 intravenous methylprednisolone, and 1 mycophenolate mofetil.
In 2/9 (22.2%) “ITP first” patients not recovered from ITP at the
time of CD diagnosis (after a previous transient response to both
IVIG and oral prednisone), the gluten-free diet seemed to have
played a role in ITP recovery. One child who had ITP lasting for
37 months showed an increase of platelets from 48,000/µL to
118,000/µL after 5 months of diet; in the second patient, whose
ITP had lasted for 33 months, platelets increased from 13,000/µL
to 107,000/µL after 3 months of a gluten-free diet. These patients
had received the last ITP treatment 36 and 23 months before the
start of the gluten-free diet, respectively.
Discussion
ITP is a hematologic disease characterized by thrombocytopenia
caused by antiplatelet autoantibodies that, binding to
platelet membrane glycoproteins, mediate the destruction
of platelets in the reticuloendothelial system, particularly in
the spleen and liver [20,21,23]. The association of ITP with
other autoimmune diseases, above all thyroid autoimmune
diseases and systemic lupus erythematosus, is a wellrecognized
condition [23,24]. CD is an autoimmune disease
that represents the most common life-long food-sensitive
enteropathy in humans: it is characterized by malabsorption
and villous atrophy occurring as a consequence of the
ingestion of wheat gluten or related rye and barley proteins
in genetically predisposed individuals [25]. A wide range
of immune disorders [8,26,27,28,29] have been associated
with CD with a prevalence that can be 7-fold higher than
in healthy people [8], but little is known, particularly in the
pediatric population, about the association between CD and
ITP. Apart from the registry analysis of Olen et al. [4], only 16
pediatric patients have been reported, mostly in single case
reports [6,8,9,10,11,12,13,14,15,16,17]. The ITP prevalence in
children <18 years of age is 6/100,000 [30], and so in Italy
in 2019, among roughly 55,000 CD patients of pediatric age
[31], there were 3 expected children also affected by ITP.
However, in our cohort, we found double that number of
children (n=6). A large Swedish registery-based cohort study
[4] reported an increased risk of ITP in CD patients [hazard
ratio: 1.91, 95% confidence interval (CI): 1.19-3.11] and a
positive association between CD and prior ITP (odds ratio:
2.96, 95% CI: 1.60-5.50). Our results are in accordance with
the Swedish data [4], but not with the findings of Ventura
et al. [8], who analyzed 909 people of all ages. However, it
must be emphasized that the 2 patients only affected by
ITP in that Italian cohort of 909 CD cases [4] were children
and that the present study is the first to focus on patients of
pediatric age, a period of life when a peak of ITP incidence is
seen [32,33]. Based on the available data, it is impossible to
explain the reasons for the probable higher incidence of ITP
among pediatric CD patients. It can be speculated that ITP is
secondary to immunostimulation from luminal antigens, but
it is also possible to postulate a common underlying immune
dysregulation similarly to what is observed in secondary ITP
in the course of other autoimmune disorders such as lupus
erythematosus or common variable immunodeficiency [34].
The median ages at diagnosis of CD (6.2 years) and ITP (5.8 years)
in our cohort are in accordance with what has been previously
reported [35]. The prevalence of female gender confirms what
is observed in the vast majority of studies about CD [4,7,36],
seeming to overcome the opposite slight prevalence of male
178
Turk J Hematol 2021;38:175-180
Guarina A. et al: Association of Immune Thrombocytopenia and Celiac Disease
gender observed in childhood ITP [37]. All the potential (n=2)
and silent (n=7) cases of CD in our cohort were diagnosed in the
groups of “ITP first” and “simultaneous diagnosis”, where CD was
diagnosed during the first tests for ITP, raising the question of CD
screening at ITP onset. In our opinion, despite conflicting results
regarding the frequency of association for these 2 diseases, in
view of the possible complications in untreated CD patients and
the limited costs of anti-transglutaminase antibodies (30 euros
in Italy) [38], screening for CD could be performed.
ITP features, irrespectively of their appearance happening
before or after CD, are very similar in our cohort to what is
typically observed in pediatric ITP, with mild onset and course
[20,21]. No patient suffered from severe hemorrhage and only 1
was on treatment at the last FUP. Based on the limited data on
the association of CD and ITP, the effect of a gluten-free diet is
still uncertain, being beneficial in some cases [6,11,13,16] and
having no impact in others [9,10,15]. In our analysis, the glutenfree
diet seemed to be efficient in no more than 20%-25% of
patients already affected by ITP.
Study Limitations
The limitations of the present study are related to the inherent
biases in a retrospective study. Furthermore, even though the
majority of Italian AIEOP Centers perform autoimmunity
screening including anti-transglutaminase autoantibodies,
that screening is conducted with variable timing and it is
sometimes omitted. Thus, it is possible that some cases of
CD, especially cases that are not of the classic type, have
been missed. At the same time, even with these limitations,
the present work is the first study reporting clinical insights
and detailed information on the ITP/CD association in an
exclusively pediatric cohort.
Conclusion
According to our data, it seems that ITP presents at a higher
prevalence among pediatric CD patients. Therefore, at every ITP
onset in otherwise healthy children, clinicians should be aware
that an association with undiagnosed CD is possible. Finally,
it has to be remarked that ITP in these patients presents the
typical mild clinical features usually observed in childhood, and
that after the diagnosis of CD, the start of a gluten-free diet
could result in a significant increase of platelet levels in a few
cases. However, future studies are needed to further explore the
efficacy of diet in these children.
Acknowledgments: The Parents’ Association ASLTI – Liberi di
crescere (http://www.liberidicrescere.it/) is acknowledged for
supporting the activities of the Pediatric Onco-Hematology
Unit of ARNAS Ospedali Civico, Di Cristina e Benfratelli. No
specific funding was received for this study. Giuseppe Furfari is
acknowledged for electronic CRF design.
Ethics
Ethics Committee Approval: This retrospective study was
designed by the Coagulation Defects Study Group of the
AIEOP (Associazione Italiana Emato-Oncologia Pediatrica)
and approved by the Ethics Committee of the Civico Hospital
(Palermo) and by every local ethics committee. All procedures
followed were in accordance with the ethical standards of the
committee in charge of human experimentation (institutional
and national) and the 1975 Declaration of Helsinki, as revised
in 2000.
Informed Consent: Informed consent for inclusion in the study
was obtained from the parents or the legal guardians of all
patients.
Authorship Contributions
Concept: A.G., F.C., P.F., G.R., P.S., M.M.; Design: A.G., F.C., P.F.,
G.R., P.S., M.M.; Data Collection or Processing: A.G., P.F.; Analysis
or Interpretation: G.P., G.L., S.P., E.F., L.D.N., P.G., F.R., E.B., C.G.,
G.B., M.S., A.B., M.Z., S.L., A.M., M.Mi., G.O., E.C., I.F., A.P., A.T., I.D.,
S.S., M.C., G.P.; Writing: U.R., A.G., F.C., P.F., G.R., P.S., M.M.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Lundin KE, Wijmenga C. Coeliac disease and autoimmune disease–genetic
overlap and screening. Nat Rev Gastroenterol Hepatol 2015;12:507-515.
2. Mustalahti K, Catassi C, Reunanen A, Fabiani E, Heier M, McMillan S,
Murray L, Metzger MH, Gasparin M, Bravi E, Mäki M; Coeliac EU Cluster,
Project Epidemiology. The prevalence of celiac disease in Europe: results of a
centralized, international mass screening project. Ann Med 2010;42:587-595.
3. Terrell DR, Beebe LA, Vesely SK, Neas BR, Segal JB, George JN. The incidence
of immune thrombocytopenic purpura in children and adults: a critical
review of published reports. Am J Hematol 2010;85:174-180.
4. Olen O, Montgomery SM, Elinder G, Ekbom A, Ludvigsson JF. Increased
risk of immune thrombocytopenic purpura among inpatients with coeliac
disease. Scand J Gastroenterol 2008;43:416-422.
5. Rischewski JR, Paulussen M, Thomas K. Celiacs disease is not a major risk
factor for the development of childhood idiopathic thrombocytopenic
purpura. J Pediatr Hematol Oncol 2008;30:185.
6. Sarbay H, Kocamaz H, Akin M, Özhan B. Investigation of celiac disease
followed by immune thrombocytopenic purpura diagnosis in patients and
comparison with literature. Northern Clin Istanbul 2017;26:160-164.
7. Bibbò S, Fozza C, Pes GM, Rojas R, Manetti R, Dore MP. Increased
frequency of immune thrombocytopenic purpura in coeliac disease and
vice versa: a prospective observational study. Gastroenterol Res Pract
2018;2018:4138434.
8. Ventura A, Magazzù G, Greco L. Duration of exposure to gluten and risk for
autoimmune disorders in patients with celiac disease. SIGEP Study Group for
Autoimmune Disorders in Celiac Disease. Gastroenterology 1999;117:297-303.
9. Stenhammar L, Ljunggren CG. Thrombocytopenic purpura and coeliac
disease. Acta Paediatr Scand 1988;77:764-766.
179
Guarina A. et al: Association of Immune Thrombocytopenia and Celiac Disease
Turk J Hematol 2021;38:175-180
10. Stene-Larsen G, Mosvold J, Ly B. Selective vitamin B12 malabsorption in
adult coeliac disease. Report on three cases with associated autoimmune
diseases. Scand J Gastroenterol 1988;23:1105-1108.
11. Hammami S, Hadded S, Lajmi K, Besbès LG, Meriem CB, Chouchane S,
Guediche MN. Immune thrombocytopenic purpure and coeliac disease. J
Paediatr Child Health 2011;47:240.
12. Le Pira A, Lombardo I, Lionetti E. The risk of idiopathic thrombocytopenic
purpura in a patient with coeliac disease: pure coincidence? Acta Pediatrica
Mediterranea 2009;25:37-39.
13. Dogan M, Sal E, Akbayram S, Peker E, Cesur Y, Oner AF. Concurrent celiac
disease, idiopathic thrombocytopenic purpura and autoimmune thyroiditis:
a case report. Clin Appl Thromb Hemost 2011;17:E13-E16.
14. Eliakim R, Heyman S, Kornberg A. Celiac disease and keratoconjunctivitis.
Occurrence with thrombocytopenic purpura. Arch Intern Med
1982;142:1037.
15. Kahn O, Fiel MI, Janowitz HD. Celiac sprue, idiopathic thrombocytopenic
purpura, and hepatic granulomatous disease. An autoimmune linkage? J
Clin Gastroenterol 1996;23:214-216.
16. Fisgin T, Yarali N, Duru F, Usta B, Kara A. Hematologic manifestation of
childhood celiac disease. Acta Haematol 2004;111:211-214.
17. Roganovic J. Celiac disease with Evans syndrome and isolated immune
thrombocytopenia in monozygotic twins: a rare association. Semin Hematol
2016;53(Suppl 1):S61-S63.
18. Karunakaran P, Kochhar R, Lal S, Nampoothiri RV, Varma N, Varma S,
Malhotra P. High prevalence of celiac disease in patients with immune
thrombocytopenia. Indian J Hematol Blood Transfus 2019;35:722-725.
19. Tonutti E, Bizzaro N. Diagnosis and classification of celiac disease and
gluten sensitivity. Autoimmun Rev 2014;13:472-476.
20. Rodeghiero F, Stasi R, Gernsheimer T, Marc M, Provan D, Arnold DM, Bussel
JB, Cines DB, Chong BH, Cooper N, Godeau B, Lechner K, Mazzucconi MG,
McMillan R, Sanz MA, Imbach P, Blanchette V, Kühne T, Ruggeri M, George
JN. Standardization of terminology, definitions and outcome criteria in
immune thrombocytopenic purpura of adults and children: report from an
international working group. Blood 2009;113:2386-2393.
21. De Mattia D, Del Principe D, Del Vecchio GC, Jankovic M, Arrighini A,
Giordano P, Menichelli A, Mori P, Zecca M, Pession A. Acute childhood
idiopathic thrombocytopenic purpura: AIEOP consensus guidelines for
diagnosis and treatment. Associazione Italiana di Ematologia e Oncologia
Pediatrica. Haematologica 2000;85:420-424.
22. R Core Team. R: A Language and Environment for Statistical Computing.
Vienna, R Foundation for Statistical Computing, 2014.
23. Liu Y, Chen S, Sun Y, Lin Q, Liao X, Zhang J, Luo J, Qian H, Duan L, Shi
G. Clinical characteristics of immune thrombocytopenia associated with
autoimmune disease. Medicine (Baltimore) 2016;95:e5565.
24. Giordano P, Urbano F, Lassandro G, Bianchi FP, Tolva A, Saracco P, Russo
G, Notarangelo LD, Gabelli M, Cesaro S, Wasniewska M, Faienza MF. Role
of anti-thyroid and autoimmunity as a predictive biomarker of chronic
immune thrombocytopenia. Pediatr Blood Cancer 2019;66:e27452.
25. Farrel RJ, Kelly CP. Celiac sprue and refractory sprue. In: MH Sleisenger,
JS Fordtran (eds). Gastrointestinal and Liver Disease, 7th ed. Philadelphia,
Saunders, 2003.
26. Collin P, Reunala T, Pukkala E, Laippala P, Keyriläinen O, Pasternack A.
Coeliac disease--associated disorders and survival. Gut 1994;35:1215-1218.
27. Halfdanarson TR, Litzow MR, Murray JA. Hematologic manifestations of
celiac disease. Blood 2007;109:412-421.
28. Stroud C, Almilaji O, Nicholas D, Kirkham S, Surgenor SL, Williams I, Snook
J. Evolving patterns in the presentation of coeliac disease over the last 25
years. Frontline Gastroenterol 2020;11:98-103.
29. Altintas A, Pasa S, Cil T, Bayan K, Gokalp D, Ayyildiz O. Thyroid and
celiac diseases autoantibodies in patients with adult chronic idiopathic
thrombocytopenic purpura. Platelets 2008;19:252-257.
30. Segal JB, Powe NR. Prevalence of immune thrombocytopenia: analyses of
administrative data. J Thromb Haemost 2006;4:2377-2383.
31. Italian Ministry of Health. Direzione Generale per l’Igiene e la Sicurezza degli
Alimenti e la Nutrizione. Rome, Ministry of Health, 2018. Available online at
http://www.salute.gov.it/imgs/C_17_pubblicazioni_2808_allegato.pdf.
32. Moulis G, Palmaro A, Montastruc JL, Godeau B, Lapeyre-Mestre M, Sailler
L. Epidemiology of incident immune thrombocytopenia: a nationwide
population-based study in France. Blood 2014;124:3308-3315.
33. Lebwohl B, HR Green P, Murray JA, Ludvigsson JF. Season of birth in a
nationwide cohort of coeliac disease patients. Arch Dis Child 2013;98:48-
51.
34. Casella J, Bowers D, Pelidis M. Disorders of platelets. In: De Angelis C, Feigin
R, Warshaw J (eds). Oski’s Pediatrics: Principles and Practice. Philadelphia,
Lippincott Williams & Wilkins, 1999.
35. Schifferli A, Holbro A, Chitlur M, Coslovsky M, Imbach P, Donato H, Elalfy
M, Graciela E, Grainger J, Holzhauer S, Riccheri C, Rodeghiero F, Ruggeri M,
Tamary H, Uglova T, Wu R, Kühne T; Intercontinental Cooperative ITP Study
Group (ICIS). A comparative prospective observational study of children and
adults with immune thrombocytopenia: 2-year follow-up. Am J Hematol
2018; 93:751-759.
36. Lima RF, Maria da Silva Kotze L, Kotze LR, Chrisostomo KR, Nisihara R.
Gender-related differences in celiac patients at diagnosis. Arch Med Res
2019;50:437-441.
37. Kühne T, Buchanan GR, Zimmerman S, Michaels LA, Kohan R, Berchtold
W, Imbach P; Intercontinental Childhood ITP Study Group. A prospective
comparative study of 2540 infants and children with newly diagnosed
idiopathic thrombocytopenic purpura (ITP) from the Intercontinental
Childhood ITP Study Group. J Pediatr 2003;143:605-608.
38. De Leo L, Bramuzzo M, Ziberna F, Villanacci V, Martelossi S, Leo GD.
Diagnostic accuracy and applicability of intestinal auto-antibodies in the
wide clinical spectrum of coeliac disease. EBioMedicine 2020;51:102567.
180
Uğur M.C. et al: Immune Thrombocytopenic Purpura
RESEARCH ARTICLE
DOI: 10.4274/tjh.galenos.2021.2021.0216
Turk J Hematol 2021;38:181-187
Comparison of Splenectomy and Eltrombopag Treatment in the
Second-Line Treatment of Immune Thrombocytopenic Purpura
İmmün Trombositopenik Purpuranın İkinci Basamak Tedavisinde Splenektomi ve
Eltrombopag Tedavilerinin Karşılaştırılması
Mehmet Can Uğur 1 , Sinem Namdaroğlu 1 , Esma Evrim Doğan 2 , Esra Turan Erkek 3 , Nihan Nizam 4 , Rafet Eren 1 ,
Oktay Bilgir 1
1University of Health Sciences Turkey, İzmir Bozyaka Training and Research Hospital, Clinic of Hematology, İzmir, Turkey
2University of Health Sciences Turkey, Prof. Dr. Cemil Taşçıoğlu Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey
3University of Health Sciences Turkey, İzmir Dr. Lütfi Kırdar Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey
4İzmir Çiğli Training and Research Hospital, Clinic of Internal Medicine, İzmir, Turkey
Abstract
Objective: Primary immune thrombocytopenia (ITP) is an acquired
autoimmune disease characterized by isolated thrombocytopenia.
While first-line treatments focus on inhibiting autoantibodies and
platelet destruction, second- and third-line treatments include
splenectomy and thrombopoietin receptor agonists. In this study, we
aimed to compare the efficiency and toxicities of splenectomy and
eltrombopag as second-line treatments in ITP.
Materials and Methods: We retrospectively analyzed patients who
were diagnosed with ITP and followed between 2015 and 2020. Patients
who underwent splenectomy or received eltrombopag treatment as
second-line or further therapy were included. For subgroup analyses,
patients were further stratified according to whether they received
eltrombopag in the second or third line of treatment.
Results: There were 38 patients in the splenectomy group and 47 patients
in the eltrombopag group. The mean age of patients in the splenectomy
and eltrombopag groups was 43.2 and 50.5 years, respectively. Time to
response was significantly shorter in the splenectomy arm (p=0.001).
However, response rates at the 3 rd , 6 th , 12 th , and 24 th months did not
exhibit a statistically significant difference between groups; nor did
total duration of response and adverse events. Response rates at the
1 st , 3 rd , 6 th , 12 th , and 24 th months and the total duration of response did
not exhibit a statistically significant difference between eltrombopag
subgroups. Eltrombopag treatment was ceased for 20 patients after a
median of 54.1 months (range: 1-151). Among them, 12 patients (60%)
did not experience a loss of response.
Conclusion: Comparing the splenectomy and eltrombopag arms, even
though time to achieve response was in favor of the splenectomy
group, this advantage disappeared when overall response rates and
response rate at the 2 nd year were considered. Using eltrombopag in
the second or third line of therapy does not yield any difference in
terms of time to achieving response.
Keywords: Thrombocytopenia, Eltrombopag, Splenectomy
Öz
Amaç: Primer immün trombositopeni (İTP), izole trombositopeni ile
karakterize, edinsel bir otoimmün hastalıktır. Birinci basamak tedaviler
otoantikorları ve trombosit yıkımını inhibe etmeye odaklanırken,
ikinci ve üçüncü basamak tedaviler arasında splenektomi ve
trombopoietin reseptör agonistleri bulunur. Bu çalışmada, İTP’de ikinci
basamak tedaviler olarak splenektomi ve eltrombopagın etkinlik ve
toksisitelerinin karşılaştırılması amaçlanmıştır.
Gereç ve Yöntemler: 2015-2020 yılları arasında İTP tanısı alan ve
takip edilen hastaları retrospektif olarak analiz ettik. Splenektomi
yapılan ve 2. veya daha ileri basamaklarda eltrombopag tedavisi alan
hastalar çalışmaya dahil edildi. Alt grup analizleri için, hastalar ikinci
veya üçüncü tedavi hattında eltrombopag alıp almadıklarına göre
gruplandırıldı.
Bulgular: Splenektomi grubunda 38 hasta, eltrombopag grubunda
47 hasta vardı. Splenektomi ve eltrombopag gruplarındaki hastaların
ortalama yaşı sırasıyla 43,2 ve 50,5’di. Splenektomi kolunda yanıt
süresi anlamlı olarak daha kısaydı (p=0,001). Bununla birlikte, 3., 6.,
12. ve 24. aylardaki yanıt oranları, toplam yanıt süresi ve yan etkiler
açısından gruplar arasında istatistiksel olarak anlamlı fark bulunmadı.
Birinci, 3., 6., 12. ve 24. aylardaki yanıt oranları ve toplam yanıt süresi,
eltrombopag alt grupları arasında istatistiksel olarak anlamlı değildi.
Eltrombopag tedavisi medyan 54,1 ay (1-151) sonra 20 hastada kesildi.
Bunlardan 12 hastada (%60) yanıt kaybı yaşanmadı.
Sonuç: Splenektomi ve eltrombopag kolları karşılaştırıldığında yanıt
alma süresi splenektomi lehine olsa da, genel yanıt oranları ve 2. yıldaki
yanıt oranları dikkate alındığında bu avantaj ortadan kalkmaktadır.
İkinci veya 3. basamak tedavide eltrombopag kullanılması, yanıt alma
süresi açısından herhangi bir fark oluşturmamaktadır.
Anahtar Sözcükler: Trombositopeni, Eltrombopag, Splenektomi
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Mehmet Can Uğur, M.D., University of Health Sciences Turkey,
İzmir Bozyaka Training and Research Hospital, Clinic of Hematology, İzmir, Turkey
Phone : +90 505 886 11 26
E-mail : med.can@hotmail.com ORCID: orcid.org/0000-0002-5600-3169
Received/Geliş tarihi: April 4, 2021
Accepted/Kabul tarihi: June 22, 2021
181
Uğur M.C. et al: Immune Thrombocytopenic Purpura
Turk J Hematol 2021;38:181-187
Introduction
Primary immune thrombocytopenia (ITP) is an acquired
autoimmune disease characterized by isolated thrombocytopenia
caused by T-cell-mediated platelet destruction, with
immunoglobulin G autoantibodies binding to platelets and
megakaryocytes, and megakaryocyte dysfunction. Patients may
present with petechiae, purpura, mucosal bleeding, and lifethreatening
organ bleeding [1,2,3]. The aim of treatment is to
prevent serious or life-threatening bleeding. Treatment modalities
employed in ITP target various stages in its pathophysiology,
including the inhibition of autoantibody synthesis, modulation
of T-cell activity, and stimulation of platelet production. While
first-line treatments mainly focus on inhibiting autoantibodies
and platelet destruction, second- and third-line treatments
include immunosuppression, splenectomy, and megakaryocyte
stimulation for increased platelet production [4].
Splenectomy is an effective treatment choice for steroidrefractory
or steroid-dependent ITP because the spleen is the
major site of platelet clearance. Macrophages express the FcγR
function in the phagocytosis of antibody-coated platelets via SYK
signaling pathways [5,6]. They also present antigenic peptides,
including glycoproteins IIa/IIIb and Ib/IX, to CD4+ T cells,
causing activation and expansion of autoreactive B- and T-cells
[7,8]. The spleen also acts as a reservoir for long-lived plasma
cells producing antiplatelet antibodies [9]. However, there is no
reliable predictor for splenectomy response. Considering the
associated risk of infection and cardiovascular complications,
splenectomy is being replaced by immunosuppressive agents
and thrombopoietin receptor agonists (TPO-RAs) as the secondline
treatment of ITP [10].
The TPO-RAs romiplostim and eltrombopag have been widely
used since 2008 [11]. These agents bind to the TPO receptor,
cause conformational changes, and activate the JAK2/STAT5
pathway, increasing megakaryocyte progenitor proliferation
and platelet production [12,13]. Randomized controlled studies
with TPO-RAs have reported response rates of 50% to 90%, as
well as efficiency in preventing bleeding and decreased need to
use additional medication. Data on toxicity indicate reversible
reticulin fibrosis and increased risk of venous thromboembolism
(VTE) [11].
Studies that directly compare the long-term efficacy of secondline
treatments for ITP are limited and treatment decisions
are therefore mostly patient-based. In this study, we aimed
to compare the efficiency and toxicities of splenectomy and
eltrombopag, a TPO-RA, as second-line treatments for ITP.
Materials and Methods
In our study, we retrospectively analyzed patients who were
diagnosed with ITP after the evaluation of complete blood
count, peripheral blood smear, blood biochemistry, viral
serologies including human immunodeficiency virus and
hepatitis C virus, abdominal sonography, and antinuclear
antibody testing and who were followed between 2015 and
2020. Bone marrow aspiration and biopsy were performed for
patients as deemed necessary by the clinician to confirm the
diagnosis of ITP. Among these cases, patients who were steroidresistant,
who were steroid-refractory, or who experienced
relapse after response and who had undergone splenectomy or
received eltrombopag treatment as second-line or third-line
therapy as the next step after only splenectomy were included
in the study. Included subjects were divided into splenectomy
and eltrombopag groups. For subgroup analyses, patients
receiving eltrombopag were further stratified according to
whether they received eltrombopag as the second or third line
of treatment.
Patient data were recorded, including age, sex, ITP bleeding
score, white blood cell (WBC) count, neutrophil and
lymphocyte counts, hemoglobin level, mean corpuscular
volume (MCV), platelet count, mean platelet volume (MPV),
serum creatinine, aspartate aminotransferase, alanine
aminotransferase, and lactate dehydrogenase levels at the
time of splenectomy or initiation of eltrombopag therapy,
as well as the dates of diagnosis and last visit. The ITP
bleeding score was assessed according to the World Health
Organization Bleeding Scale [14]. Cases were classified using
a simple five-point scale in which no bleeding was scored
as 0, petechiae as grade 1, mild blood loss as grade 2, gross
blood loss as grade 3, and debilitating blood loss as grade
4. The following comparisons between the splenectomy and
eltrombopag groups were also performed: time to achieve
response; response at the 1 st , 3 rd , 6 th , 12 th , and 24 th months;
total duration of response; and complications. Response
evaluation was performed according to the American Society
of Hematology’s 2009 International Working Group Report
[15]. Platelet count below 30,000/mm 3 was considered as
no response, above 30,000/mm 3 as response, and above
100,000/mm 3 as complete response.
The compliance of the study with ethical rules was confirmed
by the İzmir Bozyaka Training and Research Hospital Ethics
Committee and approval was granted. Also, the consent was
obtained from the volunteers included in the study.
Statistical Analysis
SPSS 21 was used for statistical tests. Data were
represented as mean ± standard deviation for numeric
variables and as frequency and percentage for categorical
variables. Normality of numeric variables was assessed by
Shapiro-Wilk test. Comparisons of normally distributed variables
were performed using t-tests, while the Mann-Whitney U test
was used for nonnormally distributed nonparametric variables.
182
Turk J Hematol 2021;38:181-187
Uğur M.C. et al: Immune Thrombocytopenic Purpura
The chi-square test was used to determine whether there was a
relationship and dependency between two variables. Values of
p<0.05 were considered statistically significant.
Results
Eighty-five patients were included in the study. Bone marrow
aspiration and biopsy were performed for 67 patients who
required confirmation of the diagnosis of ITP. Among those, 49
were female and 36 were male. The median ages of the patients
in the splenectomy and eltrombopag groups were 43.2 and
50.5 years, respectively. There were 38 patients in the
splenectomy group and 47 patients in the eltrombopag group.
There was no statistically significant difference between the
two groups in terms of age, sex, comorbidities, bleeding score,
WBC count, neutrophil and lymphocyte counts, hemoglobin,
MCV, or platelet count. Characteristics of the treatment groups
are summarized in Table 1.
Table 2 presents data on the time to achieve response (R) or
complete response (CR) in the second line of treatment; R/CR
at the 1 st , 3 rd , 6 th , 12 th , and 24 th months of second-line therapy;
and the total duration of R/CR of the treatment groups. Time
to R/CR was significantly shorter in the splenectomy group
(p=0.001). The R/CR rate at the 1 st month was also significantly
higher in the splenectomy group (p=0.023). However, R/CR rates
at the 3 rd , 6 th , 12 th , and 24 th months and total duration of R/CR
did not exhibit statistically significant differences between the
groups.
One patient in the splenectomy group developed deep vein
thrombosis. In the eltrombopag group, one patient experienced
headache, one patient had elevated liver enzymes, one patient
developed bone marrow fibrosis, one patient developed chronic
myelomonocytic leukemia (CMML), one patient developed basal
cell carcinoma, and one patient developed pancreatic cancer.
There was no statistically significant difference in adverse events
Table 1. Patient characteristics.
Splenectomy Eltrombopag p
Median age, years (range) 43.2 (18-76) 50.5 (23-89) 0.056
Female 28 21
Sex, n
0.329
Male 10 26
Comorbidities, n
Yes 16 27
No 22 20
0.160
0 12 24
Bleeding score, n
1 12 14
2 12 8
0.223
3 2 1
WBCs/µL, mean ± SD 8750.0±2758.8 8970.7±3679.4 0.913
Neutrophils/µL, mean ± SD 5910.5±250.8 5956.5±352.3 0.953
Lymphocytes/µL, mean ± SD 2063.1±685.5 2437.3±1214.0 0.128
Hemoglobin, g/dL, mean ± SD 12.2±2.1 12.8±2.8 0.214
MCV, fL, mean ± SD 84.3±8.0 81.5±6.9 0.125
Platelets/µL, mean ± SD 14,800±8900 14,300±12,300 0.833
SD: Standard deviation; WBCs: white blood cells; MCV: mean corpuscular volume.
Table 2. Comparison of treatment response between splenectomy and eltrombopag groups.
Splenectomy Eltrombopag p
Time to achieve R/CR in second line treatment, days 1.9 (0-9) 19.1 (0-126) 0.001
R/CR at the 1 st month 100% 85.7% 0.023
R/CR at the 3 rd month 86.8% 85.7% 0.403
R/CR at the 6 th month 76.3% 85.7% 0.410
R/CR at the 12 th month 71.0% 61.9% 0.680
R/CR at the 24 th month 57.8% 55.3% 0.677
Total duration of R/CR, months 43.0 (1-123) 34.9 (0-122) 0.341
Complications, n 1 6 0.105
R: Response; CR: complete response.
183
Uğur M.C. et al: Immune Thrombocytopenic Purpura
Turk J Hematol 2021;38:181-187
between treatment groups (p=0.105). Bone marrow fibrosis
was detected in the patient who underwent bone marrow
biopsy 3 years after eltrombopag treatment because platelet
increase could not be achieved despite increasing the dose of
eltrombopag. The diagnosis of CMML was made 14 months after
the patient started eltrombopag. A blast count below 5% was
considered as CMML-0 and the patient was followed without
treatment.
Patients receiving eltrombopag were stratified according to
whether they received the treatment in the second or third line.
Table 3 provides data on age and sex; comorbidities; bleeding
score; WBC, neutrophil, and lymphocyte counts; hemoglobin,
MCV, MPV, and platelet count; time to achieve R/CR; R/CR at the
1 st , 3 rd , 6 th , 12 th , and 24 th months of second-line treatment; and
the total duration of R/CR. Patients who received eltrombopag in
the third line had significantly higher WBC counts (p=0.002). On
the other hand, no significant difference was observed between
the groups in terms of age, sex, comorbidities, bleeding score,
neutrophil and lymphocyte counts, hemoglobin, MCV, or platelet
count. The R/CR rates at the 1 st , 3 rd , 6 th , 12 th , and 24 th months
and the total duration of R/CR also did not exhibit statistically
significant differences between the groups.
Eltrombopag treatment was discontinued with no tapering due
to adverse effects or the patient’s refusal for various reasons
in 20 patients after a median of 54.1 months (range: 1-151).
Among them, 12 patients (60%) did not experience a loss of
response. The median duration of eltrombopag treatment was
25.6 (range: 2-64) months and median follow-up was 67.9
(range: 20-151) months in these patients. The follow-up period
after discontinuation of eltrombopag was 12.4 months, median
platelet count was 159,000/mm 3 , and bleeding score was 0.0.
Discussion
As highlighted in the updated international consensus
report, initial treatments for patients with newly diagnosed
ITP are usually corticosteroid-based regimens, intravenous
immunoglobulin (IVIg), and anti-D. However, the most commonly
preferred treatments are corticosteroids. IVIg can also be added
to the treatment for patients with active bleeding, patients who
are scheduled to undergo emergency interventions, or patients
who experience adverse events with glucocorticoids, even
though this approach is not standardized [16,17,18].
Because there are no randomized controlled studies that directly
compare second-line treatment options in ITP, treatment
Table 3. Eltrombopag as second-line or third-line treatment.
Second-line Third-line p
Median age, years (range) 56.1 (26-79) 46.0 (23-74) 0.067
Female 11 10
Sex, n
0.159
Male 10 16
Comorbidities, n
Yes 14 13
No 7 13
0.914
0 9 15
Bleeding score, n
1 7 7
2 4 4
0.263
3 1 0
WBCs/µL, mean ± SD 7635.7±402.4 9952.6±315.7 0.002
Neutrophils/µL, mean ± SD 5488.8±414.6 6257.1±319.0 0.106
Lymphocytes/µL, mean ± SD 1951.1±862.2 2750.0±132.9 0.146
Hemoglobin, g/dL, mean ± SD 12.1±3.1 13.3±2.6 0.148
MCV, fL, mean ± SD 81.5±6.2 81.5±7.5 0.699
Platelets/µL, mean ± SD 11,900±1040 16,300±1370 0.307
Time to achieve R/CR, days 18.7 (0-90) 19.5 (0-126) 0.784
R/CR at the 1 st month 85.7% 96.1% 0.202
R/CR at the 3 rd month 85.7% 92.3% 0.403
R/CR at the 6 th month 85.7% 88.4% 0.779
R/CR at the 12 th month 61.9% 73.0% 0.414
R/CR at the 24 th month 57.1% 53.8% 0.660
Total duration of R/CR, months 27.6 (0-120) 43.5 (0-122) 0.374
WBCs: White blood cells; MCV: mean corpuscular volume; R: response; CR: complete response.
184
Turk J Hematol 2021;38:181-187
Uğur M.C. et al: Immune Thrombocytopenic Purpura
decisions are mostly based on patient characteristics and
clinical preferences. Second-line medical treatments supported
by robust evidence are rituximab and TPO-RAs. Splenectomy is
still also preferred as a surgical option today [18,19,20].
Splenectomy is among the second-line treatment options with
the greatest likelihood of achieving long-term remission and
changing the course of the disease [21]. Provan et al. [18]
recommended waiting at least 12 months after the diagnosis
to rule out possible spontaneous remission. As new drugs
are available for ITP, splenectomy is often postponed. If the
patient is working in a risky profession or has a thrombotic
history or immunosuppression, splenectomy is considered as
the second line. In developing countries, and especially for
younger patients, it is still recommended for financial reasons
and the difficulties in obtaining novel drugs. Kojouri et al. [22]
conducted a systematic review of 47 case series including 2623
adult patients undergoing splenectomy and found rates of 66%
complete response and 88% overall response. The mean duration
of response was approximately 12 years in this patient group
[22]. Platelet count often tends to rise within 1 to 2 days after
splenectomy, while a delayed response can be observed at up to
8 weeks [23]. The only clinical parameter predicting splenectomy
response is the patient’s age, with younger patients achieving
higher response rates [22]. Even though there is no distinct age
cut-off, splenectomy was recommended for patients younger
than 50 years in two different studies [24,25]. In our study, the
median age of the patients in the splenectomy group was 43.2
years. The higher median age of the patients in the eltrombopag
group was due to elderly patients ineligible for splenectomy
inevitably being in this treatment arm.
The most common complications after splenectomy, which
is an irreversible procedure, are infections and venous
thromboembolism. In the review by Kojouri et al. [22],
complications occurred in 88 of 921 patients (9.6%) undergoing
laparoscopic splenectomy and in 318 of 2465 patients (12.9%)
undergoing open splenectomy. The risk of infection is highest
in the early postoperative period. In another series of 3812
patients undergoing splenectomy for various indications, the
rate of infections was 10.2% in the first 90 days [26]. However,
this rate declines to 1%-3% in the long term [27]. In our study,
no infectious side effects were found. The risk of VTE also
increases after splenectomy. In the aforementioned cohort of
3812 patients undergoing splenectomy, the risk of VTE in the
first year was reported to be 1.9%. Observed thromboses in
that study were deep vein thrombosis in half of the patients,
pulmonary embolism in a quarter, and portal or splenic vein
thrombosis in the remaining quarter [26]. Considering these
potential complications as well as the possibility of spontaneous
remission in ITP, postponing splenectomy for 6 to 12 months
after diagnosis may help avoid needless interventions. However,
this duration may be shortened for symptomatic patients
with severe thrombocytopenia [28]. In our study, response
was observed at a mean of 1.9 days in 38 patients undergoing
splenectomy and this response was durable for a mean of 43
months. One patient (2.6%) experienced deep vein thrombosis.
Studies assessing the efficiency of eltrombopag have reported
overall response rates of about 80%, including temporary
responses. The RAISE study, which randomized 197 adult
patients into eltrombopag and placebo arms, showed that the
mean platelet count of patients receiving eltrombopag was
74,000/mm 3 and their response rate was 79%. This rate showed
no difference among patients who underwent splenectomy and
those who received other therapies prior to eltrombopag. The
long-term response rate was 51% in patients with splenectomy
and 66% in patients without splenectomy [29]. In another study
with 110 adult patients, rates of response to eltrombopag and a
placebo were found to be 59% and 16%, respectively [30]. The
EXTEND study revealed that the 3-year response rates of 299
patients using eltrombopag were 80% for splenectomized and
89.3% for non-splenectomized patients [31]. In a recent study
assessing real-life data, the researchers reported that rates of
response to eltrombopag were not affected by factors including
splenectomy status or initial platelet count. Six of those patients
stopped eltrombopag after a median sustained response of 796
days and remained in remission for a median follow-up of 624
days [32]. Similarly, González-López et al. [33] reported that
51% of patients remained in remission in the 6 th month after
eltrombopag cessation after sustained response.
Eltrombopag is usually well tolerated. The most common side
effects are headache, gastrointestinal complaints, elevated
liver enzymes, thrombosis, and bone marrow fibrosis. In the
EXTEND study, 14% of patients had to cease medication due
to adverse events. Among these, hepatobiliary adverse events
were observed in 7 patients, cataract in 4 patients, deep vein
thrombosis in 3 patients, cerebral infarction in 2 patients,
headache in 2 patients, and myelofibrosis in 2 patients. The rate
of thromboembolic events and hepatobiliary adverse events
did not show any increase with 1 year of therapy [29,34]. In
our study, median duration of response was 34.9 months in
patients receiving eltrombopag and only 55% maintained
response into the 2 nd year. There was no significant difference
in the response rates of patients with and without a history of
splenectomy prior to eltrombopag. Twelve of 20 patients who
stopped eltrombopag treatment remained in remission. The
observed adverse events were consistent with those reported
in the literature; however, malignancy development in 3 (6.3%)
patients was noteworthy. The EXTEND study did not reveal a
significant difference between the treatment and placebo
arms in terms of malignancies [34]. In a multicenter study
from Turkey that reported the 12-month data of 40 patients
on eltrombopag, there were also no eltrombopag-associated
malignancies [35]. We could not identify a direct association
185
Uğur M.C. et al: Immune Thrombocytopenic Purpura
Turk J Hematol 2021;38:181-187
between the observed malignancies and eltrombopag use, but
we think that these malignancies may be incidental due to the
higher median age in the eltrombopag group. Furthermore, a
statistically significant difference was found in our study in
terms of pretreatment leukocyte counts between administration
of eltrombopag as second-line and as third-line treatment. This
difference may be attributable to splenectomy, as the patients
receiving third-line eltrombopag had previously undergone
splenectomy.
Conclusion
Comparing the splenectomy and eltrombopag arms of the
present study, even though time to achieve response and the
response rate at the 1 st month were in favor of splenectomy,
this advantage disappeared when overall response rates and
response rate at the 2 nd year were considered. However, more
adverse events were observed in the eltrombopag group.
Observed malignancies in 3 patients are inconsistent with
the reported data in the literature. Using eltrombopag in the
second or third line of therapy does not yield any difference in
terms of time to achieve response. The overall response rate was
higher when eltrombopag was used as the third-line treatment
after splenectomy compared to second-line treatment, but this
difference did not reach statistical significance. Randomized
prospective studies comparing treatment options such as
splenectomy, immunosuppressive therapies, and eltrombopag
head-to-head are required for the standardization of second-line
and more advanced therapies for immune thrombocytopenia.
Ethics
Ethics Committee Approval: The compliance of the study with
ethical rules was confirmed by the İzmir Bozyaka Training and
Research Hospital Ethics Committee and approval was granted.
Informed Consent: Consent was obtained from the volunteers
included in the study.
Authorship Contributions
Surgical and Medical Practices: M.C.U., E.E.D., E.T.E.; Concept:
S.N., R.E., O.B.; Design: S.N., R.E.; Data Collection or Processing:
M.C.U., E.E.D., E.T.E.; Analysis or Interpretation: M.C.U., R.E., O.B.;
Literature Search: M.C.U., N.N.; Writing: N.N.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Khodadi E, Asnafi AA, Shahrabi S, Shahjahani M, Saki N. Bone marrow niche
in immune thrombocytopenia: a focus on megakaryopoiesis. Ann Hematol
2016;95:1765-1776.
2. Olsson B, Andersson PO, Jernås M, Jacobsson S, Carlsson B, Carlsson LM,
Wadenvik H. T-cell-mediated cytotoxicity toward platelets in chronic
idiopathic thrombocytopenic purpura. Nat Med 2003;9:1123-1124.
3. Moulis G, Palmaro A, Montastruc JL, Godeau B, Lapeyre-Mestre M, Sailler
L. Epidemiology of incident immune thrombocytopenia: a nationwide
population-based study in France. Blood 2014;124:3308-3315.
4. Blickstein D. Treatment of immune thrombocytopenic purpura in adults:
update. Harefuah 2019;15:196-199.
5. Audia S, Santegoets K, Laarhoven AG, Vidarsson G, Facy O, Ortega-Deballon
P, Samson M, Janikashvili N, Saas P, Bonnotte B, Radstake TR. Fcγ receptor
expression on splenic macrophages in adult immune thrombocytopenia.
Clin Exp Immunol 2017;188:275-282.
6. Podolanczuk A, Lazarus AH, Crow AR, Grossbard E, Bussel JB. Of mice and
men: an open-label pilot study for treatment of immune thrombocytopenic
purpura by an inhibitor of Syk. Blood 2009;113:3154-3160.
7. Kuwana M, Okazaki Y, Kaburaki J, Kawakami Y, Ikeda Y. Spleen is a primary
site for activation of platelet-reactive T and B cells in patients with immune
thrombocytopenic purpura. J Immunol 2002;168:3675-3682.
8. Roark JH, Bussel JB, Cines DB, Siegel DL. Genetic analysis of autoantibodies
in idiopathic thrombocytopenic purpura reveals evidence of clonal
expansion and somatic mutation. Blood 2002;100:1388-1398.
9. Mahévas M, Patin P, Huetz F, Descatoire M, Cagnard N, Bole-Feysot C, Le
Gallou S, Khellaf M, Fain O, Boutboul D, Galicier L, Ebbo M, Lambotte O,
Hamidou M, Bierling P, Godeau B, Michel M, Weill JC, Reynaud CA. B cell
depletion in immune thrombocytopenia reveals splenic long-lived plasma
cells. J Clin Invest 2013;123:432-442.
10. Chaturvedi S, Arnold DM, McCrae KR. Splenectomy for immune
thrombocytopenia: down but not out. Blood 2018;131:1172-1182.
11. Ghanima W, Cooper N, Rodeghiero F, Godeau B, Bussel JB. Thrombopoietin
receptor agonists: ten years later. Haematologica 2019;104:1112-1123.
12. Broudy VC, Lin NL. AMG531 stimulates megakaryopoiesis in vitro by binding
to Mpl. Cytokine 2004;25:52-60.
13. 13. Erickson-Miller CL, Delorme E, Tian SS, Hopson CB, Landis AJ, Valoret
EI, Sellers TS, Rosen J, Miller SG, Luengo JI, Duffy KJ, Jenkins JM. Preclinical
activity of eltrombopag (SB-497115), an oral, nonpeptide thrombopoietin
receptor agonist. Stem Cells 2009;27:424-430.
14. Fogarty PF, Tarantino MD, Brainsky A, Signorovitch J, Grotzinger KM.
Selective validation of the WHO Bleeding Scale in patients with chronic
immune thrombocytopenia. Curr Med Res Opin 2012;28:79-87.
15. Rodeghiero F, Stasi R, Gernsheimer T, Michel M, Provan D, Arnold DM, Bussel
JB, Cines DB, Chong BH, Cooper N, Godeau B, Lechner K, Mazzucconi MG,
McMillan R, Sanz MA, Imbach P, Blanchette V, Kühne T, Ruggeri M, George
JN. Standardization of terminology, definitions and outcome criteria in
immune thrombocytopenic purpura of adults and children: report from an
international working group. Blood 2009;12;113:2386-2393.
16. Matschke J, Müller-Beissenhirtz H, Novotny J, Vester I, Hertenstein B, Eisele
L, Lax H, Ose C, Dührsen U. A randomized trial of daily prednisone versus
pulsed dexamethasone in treatment-naïve adult patients with immune
thrombocytopenia: EIS 2002 study. Acta Haematol 2016;136:101-107.
17. Salib M, Clayden R, Clare R, Wang G, Warkentin TE, Crowther MA, Lim W, Nazi
I, Kelton JG, Arnold DM. Difficulties in establishing the diagnosis of immune
thrombocytopenia: an agreement study. Am J Hematol 2016;91:E327-329.
18. Provan D, Arnold DM, Bussel JB, Chong BH, Cooper N, Gernsheimer T,
Ghanima W, Godeau B, González-López TJ, Grainger J, Hou M, Kruse C,
McDonald V, Michel M, Newland AC, Pavord S, Rodeghiero F, Scully M,
Tomiyama Y, Wong RS, Zaja F, Kuter DJ. Updated international consensus
report on the investigation and management of primary immune
thrombocytopenia. Blood Adv 2019;3:3780-3817.
19. Bylsma LC, Fryzek JP, Cetin K, Callaghan F, Bezold C, Mehta B, Wasser
JS. Systematic literature review of treatments used for adult immune
186
Turk J Hematol 2021;38:181-187
Uğur M.C. et al: Immune Thrombocytopenic Purpura
thrombocytopenia in the second-line setting. Am J Hematol 2019;94:118-
132.
20. Cuker A. Transitioning patients with immune thrombocytopenia to secondline
therapy: challenges and best practices. Am J Hematol 2018;93:816-823.
21. George JN. Management of immune thrombocytopenia--something old,
something new. N Engl J Med 2010;363:1959-1961.
22. Kojouri K, Vesely SK, Terrell DR, George JN. Splenectomy for adult patients
with idiopathic thrombocytopenic purpura: a systematic review to assess
long-term platelet count responses, prediction of response, and surgical
complications. Blood 2004;104:2623-2634.
23. Gigot JF, Healy ML, Ferrant A, Michaux JL, Njinou B, Kestens PJ. Laparoscopic
splenectomy for idiopathic thrombocytopenic purpura. Am J Surg
2004;187:720-723.
24. Duperier T, Brody F, Felsher J, Walsh RM, Rosen M, Ponsky J. Predictive
factors for successful laparoscopic splenectomy in patients with immune
thrombocytopenic purpura. Arch Surg 2004;139:61-66.
25. Tastaldi L, Krpata DM, Prabhu AS, Petro CC, Haskins IN, Perez AJ, Alkhatib
H, Colturato I, Tu C, Lichtin A, Rosen MJ, Rosenblatt S. Laparoscopic
splenectomy for immune thrombocytopenia (ITP): long-term outcomes of a
modern cohort. Surg Endosc 2019;33:475-485.
26. Thomsen RW, Schoonen WM, Farkas DK, Riis A, Jacobsen J, Fryzek JP, Sørensen
HT. Risk for hospital contact with infection in patients with splenectomy: a
population-based cohort study. Ann Intern Med 2009;151:546-555.
27. Bisharat N, Omari H, Lavi I, Raz R. Risk of infection and death among postsplenectomy
patients. J Infect 2001;43:182-186.
28. Rodeghiero F. A critical appraisal of the evidence for the role of splenectomy
in adults and children with ITP. Br J Haematol 2018;181:183-195.
29. Cheng G, Saleh MN, Marcher C, Vasey S, Mayer B, Aivado M, Arning M,
Stone NL, Bussel JB. Eltrombopag for management of chronic immune
thrombocytopenia (RAISE): a 6-month, randomised, phase 3 study. Lancet
2011;377:393-402.
30. Bussel JB, Provan D, Shamsi T, Cheng G, Psaila B, Kovaleva L, Salama A,
Jenkins JM, Roychowdhury D, Mayer B, Stone N, Arning M. Effect of
eltrombopag on platelet counts and bleeding during treatment of chronic
idiopathic thrombocytopenic purpura: a randomised, double-blind,
placebo-controlled trial. Lancet 2009;373:641-648.
31. Saleh MN, Bussel JB, Cheng G, Meyer O, Bailey CK, Arning M, Brainsky A;
EXTEND Study Group. Safety and efficacy of eltrombopag for treatment of
chronic immune thrombocytopenia: results of the long-term, open-label
EXTEND study. Blood 2013;121:537-545.
32. Mishra K, Pramanik S, Jandial A, Sahu KK, Sandal R, Ahuja A, Yanamandra
U, Kumar R, Kapoor R, Verma T, Sharma S, Singh J, Das S, Chatterjee T,
Sharma A, Nair V. Real-world experience of eltrombopag in immune
thrombocytopenia. Am J Blood Res 2020;10:240-251.
33. González-López TJ, Alvarez-Román MT, Pascual C, Sánchez-González
B, Fernández-Fuentes F, Jarque I, Pérez-Rus G, Pérez-Crespo S, Bernat S,
Hernández-Rivas JA, Andrade MM, Cortés M, Gómez-Nuñez M, Olivera
P, Martínez-Robles V, Fernández-Rodríguez A, Fuertes-Palacio MA,
Fernández-Miñano C, de Cabo E, Fisac R, Aguilar C, Bárez A, Peñarrubia
MJ, García-Frade LJ, González-Porras JR. Eltrombopag safety and efficacy
for primary chronic immune thrombocytopenia in clinical practice. Eur J
Haematol 2016;97:297-302.
34. Wong RSM, Saleh MN, Khelif A, Salama A, Portella MSO, Burgess P, Bussel
JB. Safety and efficacy of long-term treatment of chronic/persistent ITP
with eltrombopag: final results of the EXTEND study. Blood 2017;130:2527-
2536.
35. Özdemirkıran F, Payzın B, Kiper HD, Kabukçu S, Akgün Çağlıyan G, Kahraman
S, Sevindik ÖG, Ceylan C, Kadıköylü G, Şahin F, Keskin A, Arslan Ö, Özcan
MA, Kabukçu G, Görgün G, Bolaman Z, Büyükkeçeci F, Bilgir O, Alacacıoğlu İ,
Vural F, Tombuloğlu M, Gökgöz Z, Saydam G. Eltrombopag for the treatment
of immune thrombocytopenia: the Aegean Region of Turkey experience.
Turk J Hematol 2015;32:323-328.
187
Wang L. et al: Characteristics and Therapy of AML-MRC
RESEARCH ARTICLE
DOI: 10.4274/tjh.galenos.2021.2021.0009
Turk J Hematol 2021;38:188-194
Clinical Characteristics and Optimal Therapy of Acute Myeloid
Leukemia with Myelodysplasia-Related Changes: A Retrospective
Analysis of a Cohort of Chinese Patients
Myelodisplazi İlişkili Değişiklikler Gösteren Akut Myeloid Löseminin Klinik Özellikleri ve
Optimal Tedavisi: Çinli Hastalar Kohortunun Retrospektif Bir Analizi
Lei Wang 1 , Xiaoxia Chu 1 , Jingyao Wang 1 , Licai An 1 , Yinghui Liu 1 , Li Li 2 , Junqing Xu 1
1Qingdao University Medical College, Affiliated Yantai Yuhuangding Hospital, Department of Hematology, Yantai, China
2Linyi Central Hospital, Department of Hematology, Linyi, China
Abstract
Objective: This study aimed to investigate the clinical characteristics
of acute myeloid leukemia with myelodysplasia-related changes (AML-
MRC) according to the 2016 World Health Organization classification
and the preferred therapy for patients with AML-MRC aged 60-75
years.
Materials and Methods: We retrospectively analyzed differences in
clinical data among 190 patients with AML-MRC and 667 patients
with AML not otherwise specified (AML-NOS). We also compared
different therapeutic regimens among patients with AML-MRC aged
60-75 years.
Results: Compared with AML-NOS, patients with AML-MRC had
significantly different clinical characteristics as well as worse
overall survival (OS) (9.2 vs. 13.6 months; p<0.001) and complete
remission rates (65.3% vs. 76.2%; p=0.005). Multivariate analysis
performed for the whole group (patients with both AML-MRC and
AML-NOS) showed that AML-MRC was the independent prognostic
factor (p=0.002). Additional multivariate analysis performed for 190
patients with AML-MRC indicated that age (p<0.001) and lactate
dehydrogenase (p=0.031) were independent prognostic factors.
Compared with the IA/DA regimen [idarubicin and cytarabine (IA) or
daunorubicin and cytarabine (DA)], the DAC+CAG regimen [decitabine
and half-dose CAG regimen (cytarabine, aclarubicin, and granulocyte
colony-stimulating factor)] was associated with better OS (4.5 vs. 6.2
months; p=0.021) in patients aged 60-75 years and categorized into
the unfavorable risk group.
Conclusion: AML-MRC cases exhibited worse clinical outcomes
compared to AML-NOS. Compared to the IA/DA regimen, the
DAC+CAG regimen was the optimal choice for patients with AML-
MRC in the unfavorable risk group and aged 60-75 years.
Keywords: Acute myeloid leukemia with myelodysplasia-related
changes, Clinical characteristics, Therapy
Öz
Amaç: Bu çalışma, 2016 Dünya Sağlık Örgütü sınıflamasına göre
myelodisplazi ilişkili değişiklikler gösteren akut myeloid löseminin
(AML-MRC) klinik özelliklerini ve 60-75 yaş arası AML-MRC
hastalarında tercih edilen tedaviyi araştırmayı amaçlamıştır.
Gereç ve Yöntemler: AML-MRC’li 190 hasta ve başka şekilde
tanımlanmamış AML’li (AML-NOS) 667 hasta arasındaki klinik
farklılıkları geriye dönük olarak analiz ettik. Ayrıca 60-75 yaş arası
AML-MRC’li hastalar arasında farklı terapötik rejimleri karşılaştırdık.
Bulgular: AML-NOS ile karşılaştırıldığında, AML-MRC’li hastalar, daha
kötü genel sağkalım (GS) (9,22’ye karşı 13,6 ay; p<0,001) ve daha
düşük tam remisyon oranları ile (%65,3’e karşı %76,2; p=0,005) önemli
ölçüde farklı klinik özelliklere sahipti. Tüm grup (hem AML-MRC hem de
AML-NOS’li hastalar) için yapılan çok değişkenli analiz, AML-MRC’nin
bağımsız prognostik faktör olduğunu gösterdi (p=0,002). AML-MRC’li
190 hasta için yapılan ek çok değişkenli analiz, yaşın (p<0,001) ve
laktat dehidrogenaz düzeyinin (p=0,031) bağımsız prognostik faktör
olduğunu gösterdi. IA/DA rejimi [idarubisin ve sitarabin (IA) veya
daunorubisin ve sitarabin (DA)] ile karşılaştırıldığında, DAC+CAG
rejimi [desitabin ve yarım doz CAG rejimi (sitarabin, aklarubisin ve
granülosit koloni uyarıcı faktör)] 60-75 yaş arası ve olumsuz risk
grubuna dahil olan hastalarda daha iyi GS ile ilişkili (4,5’e karşı 6,2 ay;
p=0,021) bulundu.
Sonuç: AML-MRC olguları, AML-NOS’ye kıyasla daha kötü klinik
sonuçlar sergilemiştir. IA/DA rejimi ile karşılaştırıldığında, DAC+CAG
rejimi, olumsuz risk grubundaki 60-75 yaş AML-MRC’li hastalar için
optimal seçim olarak bulunmuştur.
Anahtar Sözcükler: Myelodisplazi ilişkili değişiklikler gösteren akut
myeloid lösemi, Klinik özellikler, Tedavi
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Junqing Xu, M.D., Qingdao University Medical College,
Affiliated Yantai Yuhuangding Hospital, Department of Hematology, Yantai, China
Phone : +86-535-18561001682
E-mail : xjq7619@126.com ORCID: orcid.org/0000-0002-5687-6760
Received/Geliş tarihi: January 6, 2021
Accepted/Kabul tarihi: April 29, 2021
188
Turk J Hematol 2021;38:188-194
Wang L. et al: Characteristics and Therapy of AML-MRC
Introduction
Acute myeloid leukemia with myelodysplasia-related changes
(AML-MRC) is a distinct entity first defined by the World Health
Organization (WHO) in 2008 [1]. The 2016 WHO classification
revised the myelodysplastic syndrome (MDS)-related cytogenetic
abnormalities: del (9q) was removed and patients with mutated
NPM1 or biallelic CEBPA were recategorized as having recurrent
genetic abnormalities [2]. According to recent studies, AML-
MRC has a worse prognosis, including lower complete remission
(CR) rate and shorter overall survival (OS), compared to AML
not otherwise specified (AML-NOS) [3,4,5]. Although the IA/DA
regimen [idarubicin and cytarabine (IA) or daunorubicin and
cytarabine (DA)] and DAC+CAG regimen [decitabine and halfdose
CAG regimen (cytarabine, aclarubicin, and granulocyte
colony-stimulating factor)] have often been chosen for
chemotherapy, no particular therapy has yet been found to
have therapeutic advantages, especially in patients older than
60 years and not eligible for allogeneic hematopoietic stem cell
transplantation (allo-HSCT). We retrospectively investigated 190
patients with AML-MRC admitted to our hospital and compared
those cases with AML-NOS for a better understanding of the
clinical and biological features. We also compared the IA/DA and
DAC+CAG regimens in patients aged 60-75 years to determine
the optimal therapy.
Materials and Methods
Patients
Our study was performed based on a cohort of 857 patients
admitted to our hospital between August 2010 and September
2019 with complete data regarding baseline characteristics and
treatment outcomes. These patients were reevaluated as having
AML-NOS or AML-MRC according to the 2016 WHO classification
of myeloid neoplasms and acute leukemia [2], strictly excluding
cases of therapy-related myeloid neoplasms and AML with
recurrent genetic abnormalities including mutated NPM1
and biallelic CEBPA. Patients who underwent allo-HSCT were
also excluded. Clinical and laboratory data were searched in
electronic medical records. Follow-up information was obtained
from electronic records or by contacting family members and
was initialized from the day of diagnosis to October 1, 2020,
or the day of death. All subjects provided informed consent in
compliance with the Declaration of Helsinki.
Morphology Analysis
Morphology analyses of 857 patients were confirmed by
at least two morphological experts. Peripheral blood and
bone marrow smears were stained using the Wright-Giemsa
method. Cytochemistry was performed using myeloperoxidase,
non-specific esterase, sodium fluoride inhibition tests, and
periodic acid-Schiff staining. Dyserythropoiesis was confirmed
when there were erythroid precursors showing megaloblastic
nuclei, karyorrhexis, nuclear fragments, or multinucleation.
Dysgranulopoiesis was characterized as polymorphonuclear
neutrophils with agranular or hypogranular cytoplasm or
with hyposegmented nuclei (pseudo-Pelger-Hüet anomaly).
Dysmegakaryopoiesis was defined as micromegakaryocytes
and multiple separated nuclei or monolobed nuclei in
megakaryocytes of all sizes. Patients were categorized as having
AML with multilineage dysplasia (AML-MLD) upon the presence
of dysplasia in ≥50% cells in at least two cell lineages. All cases
fulfilled the 2016 WHO criterion of at least 20% blasts in the
peripheral blood or bone marrow.
Molecular Mutation Analysis
Molecular mutation analyses including CEBPA, NPM1, ASXL1,
RUNX1, and Flt3-ITD were obtained for the whole group.
Before May 2016, this process was performed by polymerase
chain reaction, which was then replaced by high-throughput
sequencing.
Cytogenetic Analysis
Cytogenetic information was obtained for all patients.
Chromosome karyotype detection of bone marrow cells was
performed by short-time culture and G-banding methods.
Patients were categorized into an intermediate risk group or
poor risk group based on cytogenetics and molecular mutation
as outlined by the 2017 European Leukemia Net (ELN) criteria [6].
According to the 2016 WHO criteria [2], when ≥20% peripheral
blood or bone marrow blasts are present and prior therapy has
been excluded, cytogenetic abnormalities sufficient to diagnose
AML-MRC are as follows: 1) complex karyotype; 2) unbalanced
abnormalities of -7/del(7q), del(5q)/t(5q), i(17q)/t(17p), -13/
del(13q), del(11q), del(12p)/t(12p), and idic(X)(q13); 3) balanced
abnormalities of t(11;16), t(3;21), t(1;3), t(2;11), t(5;12), and
t(5;7).
Therapy
According to treatment regimens, patients with AML-MRC aged
60-75 years (n=99) were divided into three groups, including an
IA/DA group (n=43), DAC+CAG group (n=49), and supportive
group (n=7). Patients in the IA/DA group were treated with IA
(idarubicin, 10-12 mg/m 2 , days 1-3; Ara-C, 100-200 mg/m 2 , days
1-7) or DA (daunomycin, 45-60 mg/m 2 , days 1-3; Ara-C, 100-
200 mg/m 2 , days 1-7). Patients in the DAC+CAG group received
decitabine (20 mg/m 2 , days 1-5), aclarubicin (10-14 mg/m 2 , days
4-7), Ara-C (10 mg/m 2 q12h, days 4-10), and granulocyte colonystimulating
factor [5 µg/kg, days 4-10 or day 4 until white blood
cell (WBC) count was more than 30x10 9 /L]. In the supportive
group, patients received hydroxyurea to inhibit the proliferation
of leukemia cells or only supportive care such as transfusions
of blood products when necessary and anti-infection therapy
when patients had symptoms of infection.
189
Wang L. et al: Characteristics and Therapy of AML-MRC
Turk J Hematol 2021;38:188-194
Statistical Analysis
OS was defined as the time from diagnosis to death or the last
follow-up. Comparison of quantitative data was performed
using the t-test or Mann-Whitney U test. Comparison of
categorical variables was performed by chi-square or Fisher’s
exact tests. Kaplan-Meier methods and log-rank tests were used
for survival analysis based on OS. Cox multivariate analysis was
used to examine the prognostic factors of AML patients and
confirm which of them was the independent factor. Values of
p<0.05 were considered statistically significant. All statistical
calculations were conducted with SPSS 24.0 (IBM Corp.,
Armonk, NY, USA).
Results
Risk Status of the Whole Group
Information on risk status was based on the revised 2017 ELN
criteria [6]. Since patients with mutated NPM1 or biallelic
mutation of CEBPA were recategorized as having recurrent
genetic abnormalities [2], there were no patients assigned to
the favorable risk group. In the whole cohort (n=857), 689
cases (80.4%) were assigned to the intermediate risk group,
accounting for the largest proportion, and the remaining 168
cases (19.6%) were classified into the unfavorable risk group.
As we expected, compared with the unfavorable risk group,
the intermediate risk group had better OS (13.4 vs. 6.8 months;
p<0.001) and CR rates (76.5% vs. 59.5%; p<0.001).
Subclassification of Patients with AML-MRC
Among 857 patients, 190 patients (22.2%) were diagnosed with
AML-MRC according to the 2016 WHO classification [2]. There
were 7 different subclassifications among AML-MRC patients.
Most cases were diagnosed as AML-MRC for meeting only
one criterion: 38 patients (20%) presented solely with MLD,
108 patients (56.8%) showed MDS-related cytogenetics, and
11 patients (5.8%) had prior history of MDS or myelodysplastic
syndrome/myeloproliferative neoplasm (MDS/MPN). Meanwhile,
32 patients (16.8%) met two criteria: 14 (7.4%) of them
had MDS-related cytogenetics and prior history of MDS or
MDS/MPN, 14 (7.4%) showed MLD and MDS-related cytogenetics,
and 4 (2.1%) had MLD and a history of MDS or MDS/MPN. Only
one case (0.5%) had a combination of all three criteria.
Clinical Characteristics of AML-MRC
After comparing 190 patients with AML-MRC and 667 patients
with AML-NOS, we found many differences between these two
groups (Table 1). Patients with AML-MRC had significantly older
age (p<0.001), lower hemoglobin (Hb) (p<0.001), lower WBC
count (p<0.001), and higher male-to-female ratio (p=0.006)
than the AML-NOS group, while no significant differences
were detected in terms of platelet count (p=0.462) and lactate
dehydrogenase (LDH) (p=0.139). As for clinical outcomes,
compared with AML-NOS, AML-MRC patients had significantly
lower CR rates (65.3% vs. 76.2%; p=0.005) and worse OS (9.2 vs.
13.6 months; p<0.001) (Figure 1). Moreover, in the intermediate
risk group, the OS of AML-MRC was still worse than that of
AML-NOS (9.5 vs. 13.9 months; p=0.011).
Univariate Analysis and Multivariate Analysis
Univariate analysis was performed for the whole cohort
of 857 AML patients in terms of age, WBC count, Hb,
platelet count, history of MDS or MDS/MPN, MDS-related
cytogenetic abnormalities, MLD, LDH, and MRC. It was
found that age (p<0.001), WBC count (p<0.001), history
of MDS or MDS/MPN (p=0.009), MDS-related cytogenetic
abnormalities (p<0.001), MLD (p=0.002), LDH (p<0.001), and
MRC (p<0.001) were prognostic factors for OS. Subsequent
multivariate analysis indicated that among these factors age
Table 1. Information of the whole cohort.
Variable AML-NOS AML-MRC p
No. 667 190
Age, years (range) 50 (16-90) 61 (16-87) <0.001
Male-to-female ratio 354:313 (1.13:1) 122:68 (1.79:1) 0.006
Hemoglobin, g/L (range) 81 (22-158) 71 (30-146) <0.001
White blood cell count, x10 9 /L (range) 13.4 (2-720) 7.5 (0.3-375.9) <0.001
Platelet count, x10 9 /L (range) 46 (3-494) 44 (1-458) 0.462
LDH, IU (range) 336 (2-10168) 387 (86-5986) 0.139
Overall survival, months (range) 13.6 (0-173.9) 9.2 (0-116) <0.001
Complete remission rate (%) 457/600 (76.2%) 109/167 (65.3%) 0.005
Risk status
Intermediate 617/667 (92.5%) 72/190 (37.9%) <0.001
Poor 50/667 (7.5%) 118/190 (62.1%) <0.001
AML-NOS: Acute myeloid leukemia not otherwise specified; AML-MRC: acute myeloid leukemia with myelodysplasia-related changes; LDH: lactate dehydrogenase.
190
Turk J Hematol 2021;38:188-194
Wang L. et al: Characteristics and Therapy of AML-MRC
[hazard ratio (HR)=2.774; p<0.001], LDH (HR=1.788; p<0.001),
and MRC (HR=0.653; p=0.002) were independent prognostic
factors (Table 2).
In 190 patients with AML-MRC, univariate analysis suggested
that LDH (p=0.031) and age (p<0.001) were prognostic factors,
while WBC count, Hb, platelet count, history of MDS or
MDS/MPN, MDS-related cytogenetic abnormalities, and MLD
were not related to prognosis. Multivariate analysis showed that
both age (HR=0.447; p<0.001) and LDH (HR=1.604; p=0.032)
were independent prognostic factors for AML-MRC (Table 3).
Treatment Analysis of Patients with AML-MRC Aged 60-75 Years
There were 99 patients aged 60-75 years with AML-MRC,
who could be categorized as belonging to the intermediate
risk group (n=46) or unfavorable risk group (n=53) based on
the 2017 ELN criteria. We analyzed the efficacy of different
treatment regimens in each group. In the intermediate risk
group, no significant difference was found between the
IA/DA group and DAC+CAG group with respect to CR rate
(60% vs. 63.6%, p=0.808) or OS (6 vs. 6.5 months, p=0.272).
However, in the unfavorable risk group, the OS of the DAC+CAG
group was significantly better than that of the IA/DA group
(6.2 vs. 4.5 months; p=0.021). The CR rate of the DAC+CAG group
was higher than that of the IA/DA group, but the difference was
not statistically significant (59.3% vs. 52.2%; p=0.406).
Discussion
AML-MLD was first proposed in the 2001 WHO classification of
myeloid neoplasms and acute leukemia and was classified as a
separate category [7]. The concept was renamed as “AML-MRC”
in the 2008 WHO classification [1] and myelodysplasia-related
cytogenetic abnormalities as well as prior history of MDS or
MDS/MPN were added as additional criteria for its recognition.
Although the newly revised 2016 WHO classification has
undergone some modifications, AML-MRC still includes these
three categories [2], which were considered associated with
poor prognosis.
We analyzed the clinical features and prognosis of 857 AML
patients including 190 patients with AML-MRC and 667
patients with AML-NOS based on the 2016 WHO classification
of AML [2]. Significant biological differences were found
between AML-NOS and AML-MRC concerning age (p<0.001),
Table 2. Univariate and multivariate analysis for overall survival of 864 AML patients.
Parameter
Univariate
Multivariate
p HR (95% CI) p
Age ≥60 <0.001 2.774 (2.166-3.54) <0.001
White blood cell count <0.001 0.064
Hemoglobin 0.092
Platelet count 0.483
History of MDS or MDS/MPN 0.009 0.481
MDS-related cytogenetic changes <0.001 0.323
Presence of MLD 0.002 0.681
LDH <0.001 1.788 (1.416-2.257) <0.001
AML-MRC <0.001 0.653 (0.51-0.848) 0.002
AML: Acute myeloid leukemia; HR: hazard ratio; CI: confidence interval; MDS: myelodysplastic syndrome; MPN: myeloproliferative neoplasm; MLD: multilineage dysplasia; LDH: lactate
dehydrogenase; AML-MRC: AML with myelodysplasia-related changes.
Table 3. Univariate and multivariate analysis for overall survival of 191 patients with AML-MRC.
Parameter
Univariate
Multivariate
p HR (95% CI) p
Age ≥60 <0.001 0.447 (0.292-0.685) <0.001
White blood cell count 0.21
Hemoglobin 0.426
Platelet count 0.465
History of MDS or MDS/MPN 0.481
MDS-related cytogenetic changes 0.676
Presence of MLD 0.441
LDH 0.031 1.604 (1.041-2.471) 0.032
AML-MRC: Acute myeloid leukemia with myelodysplasia-related changes; HR: hazard ratio; CI: confidence interval; MDS: myelodysplastic syndrome; MPN: myeloproliferative
neoplasm; MLD: multilineage dysplasia; LDH: lactate dehydrogenase.
191
Wang L. et al: Characteristics and Therapy of AML-MRC
Turk J Hematol 2021;38:188-194
Hb (p<0.001), and WBC count (p<0.001). Compared with
AML-NOS, AML-MRC patients had significantly shorter OS
(9.2 vs. 13.6 months; p<0.001) and CR rates (65.3% vs. 76.2%;
p=0.005), similar to recent studies [3,4,5]. However, Devillier
et al. [8] suggested that the worse prognosis of AML-MRC
was probably due to unfavorable cytogenetics, which were
categorized as MDS-related cytogenetics, because they assessed
the prognosis of AML-NOS and AML-MRC in an intermediate risk
group and found no difference between the groups for OS or
relapse-free survival. On the contrary, Weinberg et al. [4] showed
that AML-MRC patients had worse OS and CR rates even after
excluding patients with unfavorable cytogenetics. To address this
discrepancy, we carried out research similar to that of Devillier
et al. [8] and obtained the opposite result: among patients of the
intermediate risk group, the OS of AML-MRC patients was still
significantly worse than that of AML-NOS (9.5 vs. 13.9 months;
p=0.011). Moreover, our multivariate analysis showed that MRC
was an independent prognostic factor after adjustment by age
and MDS-related cytogenetics, coinciding with the study of
Weinberg et al. [4]. The results described here support the WHO
classification separating these two categories.
As described above, many well-known adverse factors were
observed in cases of AML-MRC, such as older age, unfavorable
cytogenetics, and multidrug-resistant phenotype, which lead to
unsatisfying therapeutic response and survival. Young patients
in good physical condition are offered intensive chemotherapy
followed by allo-HSCT. However, the optimal chemotherapy
regimen for patients older than 60 years who are not eligible
for allo-HCST has always been controversial. The standard 3+7
regimen, IA or DA, is the most common induction therapy,
while the CAG regimen is another common choice and is often
combined with decitabine. However, comparisons of the IA/DA
and DAC+CAG regimens for AML-MRC patients aged 60-75 years
have rarely been reported. In our study, no significant difference
was found between the two regimens (OS: 6 vs. 6.5 months,
p=0.272; CR rate: 60% vs. 63.6%, p=0.808) in the intermediate
risk group (Figure 2). In the poor risk group, however, the OS of
patients treated with the DAC+CAG regimen was significantly
longer than patients on the IA/DA regimen (6.2 vs. 4.5 months;
p=0.021) (Figure 3). Therefore, we suggest that the DAC+CAG
regimen should be the preferred choice for AML-MRC patients
categorized into the poor risk group and aged 60-75 years.
Decitabine, a DNA-hypomethylating agent (HMA), can induce
differentiation and apoptosis of leukemic blasts and activate
Figure 2. Kaplan-Meier survival rates. Overall survival for
IA/DA regimen and DAC+CAG regimen in patients aged
60-75 years with acute myeloid leukemia with myelodysplasiarelated
changes (AML-MRC) in the intermediate risk group.
Figure 1. Kaplan-Meier survival rates. Overall survival for patients
with acute myeloid leukemia with myelodysplasia-related changes
(AML-MRC) and AML not otherwise specified (AML-NOS).
Figure 3. Kaplan-Meier survival rates. Overall survival for
IA/DA regimen and DAC+CAG regimen in patients aged
60-75 years with acute myeloid leukemia with myelodysplasiarelated
changes (AML-MRC) in the unfavorable-risk group.
192
Turk J Hematol 2021;38:188-194
Wang L. et al: Characteristics and Therapy of AML-MRC
the silenced tumor suppressor gene (TSG) impaired by the
disorder of DNA methylation [9,10,11]. Recent studies have
proved that decitabine is well tolerated and may improve the
response rate and OS in older AML patients when used as a
single agent [12,13]. When combined with other chemotherapy
regimens such as CAG, IA, or HAA (homoharringtonine,
cytarabine, aclarubicin), decitabine could also significantly
enhance the therapeutic efficacy [14,15,16]. In 2016, Welch
et al. [17] enrolled 84 patients with AML or MDS in a singleinstitution
trial of decitabine. The results showed that the
response to DAC was better among patients in the unfavorable
risk group than patients in the intermediate risk/favorable risk
cytogenetic group (67% vs. 34%, p<0.001), although there
was no statistical difference in OS between these two groups
(11.6 vs. 10 months, p=0.29). Similar findings were also reported
by other researchers [18,19,20]. These studies offer a possible
explanation for our result whereby patients in the unfavorable
risk group benefited most from the DAC+CAG regimen. Further
research will be required to determine the core mechanism of
the better efficacy of DAC among patients in the unfavorable
risk group.
Despite the efficacy of conventional chemotherapy, the
survival of AML patients remains unsatisfactory. Over the
decades, efforts made by researchers led to only minor
improvements in the outcome of AML patients until the
presence of several new therapies offered something fresh
in the landscape of AML therapy. CPX-351, a liposomal
formulation of cytarabine and daunorubicin, was approved
by the US Food and Drug Administration in 2017 for the
treatment of newly diagnosed therapy-related AML (tAML)
or AML-MRC based on a phase III clinical trial named
CLTR0310-301 [21]. In this clinical trial, CPX-351 showed
better OS (9.56 vs. 5.85 months, p=0.003), better event-free
survival (2.53 vs. 1.31 months, p=0.021), and higher CR rate
(37.3% vs. 25.6%, p=0.016) compared to the standard 3+7
regimen in patients 60-75 years of age with newly diagnosed
tAML or AML-MRC and it was found to be safe and welltolerated
[22,23,24]. Venetoclax, a selective inhibitor of
the antiapoptotic protein B-cell lymphoma 2 (BCL-2), can
lead to rapid initiation of apoptosis in leukemia cells [25].
When combined with low-dose cytarabine (LDAC) or HMA,
venetoclax demonstrated significant improvement of CR rate
and OS compared with single-agent LDAC or HMA treatment
in AML patients ineligible for intensive chemotherapy, as
proven by several multicenter clinical trials [26,27,28].
Based on these results, current guidelines recommend this
combination as standard therapy for older and unfit patients
[29]. In addition to more research on new therapies, future
efforts should also be focused on reducing therapeutic
toxicities for wider utilization and improving the OS of AML
patients through different therapeutic combinations.
Study Limitations
There are several limitations of our study. All data were collected
in a retrospective manner and the scale of the cohort was small
while analyzing the optimal choice for patients with AML-MRC
aged 60-75 years in the unfavorable risk group.
Conclusion
AML-MRC is associated with worse prognosis compared to
AML-NOS and shows an independent prognostic effect. The
DAC+CAG regimen may be preferred for patients aged 60-75
years who are classified in the unfavorable risk group.
Ethics
Ethics Committee Approval: The study was approved by the
Ethics Committee of Qingdao University Medical College
Affiliated Yantai Yuhuangding Hospital.
Informed Consent: Informed consent was obtained from all
participants included in the study.
Authorship Contributions
Concept: L.W., J.X., X.C.; Design: L.W., J.X., X.C.; Data Collection
or Processing: L.W., J.W., L.A.; Analysis or interpretation: L.W.,
J.X., L.A.; Literature Search: L.W., J.X., J.W., L.A., Y.L., X.C., L.L.;
Writing: L.W., J.X., J.W., L.A., Y.L., X.C., L.L.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: This research was supported by the Natural
Science Foundation of Shandong Province (Nos. ZR2015HL035,
ZR2015HL074), the Beijing Medical Award Foundation
(YJHYXKYJJ-105), Yantai Technology Development Projects (No.
2014WS024), and the Youth Foundation of Yantai Yuhuangding
Hospital (Nos. 201404, 201405).
References
1. Swerdlow S, Campo E, Lee Harris N. WHO Classification of Tumours of
Haematopoietic and Lymphoid Tissues. Lyon, IARC Press, 2008.
2. Daniel AA, Orazi A, Hasserjian R, Thiele J, Borowitz MJ, Beau ML, Bloomfield
CD, Cazzola M, Vardiman JW. The 2016 revision to the World Health
Organization classification of myeloid neoplasms and acute leukemia.
Blood 2016;127:2391-2405.
3. Haferlach T, Schoch C, Löffler H, Gassmann W, Kern W, Schnittger S, Fonatsch
C, Ludwig WD, Wuchter C, Schlegelberger B, Staib P, Reichle A, Kubica U,
Eimermacher H, Balleisen L, Grüneisen A, Haase D, Aul C, Karow J, Lengfelder E,
Wörmann B, Heinecke A, Sauerland MC, Büchner T, Hiddeman W. Morphologic
dysplasia in de novo acute myeloid leukemia (AML) is related to unfavorable
cytogenetics but has no independent prognostic relevance under the conditions
of intensive induction therapy: results of a multiparameter analysis from the
German AML Cooperative Group studies. J Clin Oncol 2003;21:256-265.
4. Weinberg OK, Seetharam M, Ren L, Seo K, Ma L, Merker JD, Gotlib J, Zehnder
JL, Arber DA. Clinical characterization of acute myeloid leukemia with
myelodysplasia-related changes as defined by the 2008 WHO classification
system. Blood 2009;113:1906-1908.
193
Wang L. et al: Characteristics and Therapy of AML-MRC
Turk J Hematol 2021;38:188-194
5. Yanada M, Suzuki M, Kawashima K, Kiyoi H, Kinoshita T, Emi N, Saito H,
Naoe T. Long-term outcomes for unselected patients with acute myeloid
leukemia categorized according to the World Health Organization
classification: a single center experience. Eur J Haematol 2005;74:418-423.
6. Döhner H, Estey E, Grimwade D, Amadori S, Appelbaum FR, Büchner T,
Dombret H, Ebert BL, Fenaux P, Larson RA, Levine RL, Lo-Coco F, Naoe T,
Niederwieser D, Ossenkoppele GJ, Sanz M, Sierra J, Tallman MS, Tien HF,
Wei AH, Löwenberg B, Bloomfield CD. Diagnosis and management of AML
in adults: 2017 ELN recommendations from an international expert panel.
Blood 2017;129:424-447.
7. Jaffe ES, Harris NL, Stein H. Pathology and Genetics of Tumours of
Haematopoietic and Lymphoid Tissues. World Health Organization
Classification of Tumours. Lyon, IARC Press, 2001.
8. Devillier R, Gelsi-Boyer V, Murati A, Prebet T, Rey J, Etienne A, D’Incan E,
Charbonnier A, Blaise D, Mozziconacci MJ, Vey N. Prognostic significance of
myelodysplasia-related changes according to the WHO classification among
ELN-intermediate-risk AML patients. Am J Hematol 2015;90:E22-24.
9. Döhner H, Weisdorf DJ, Bloomfield CD. Acute myeloid leukemia. N Engl J
Med 2015;373:1136-1152.
10. Christman JK. 5-Azacytidine and 5-aza-2’-deoxycytidine as inhibitors of
DNA methylation: mechanistic studies and their implications for cancer
therapy. Oncogene 2002;21:5483-5495.
11. Oki Y, Aoki E, Issa JP. Decitabine-bedside to bench. Crit Rev Oncol Hematol
2007;61:140-152.
12. Lübbert M, Rüter BH, Claus R, Schmoor C, Schmid M, Germing U, Kuendgen
A, Rethwisch V, Ganser A, Platzbecker U, Galm O, Brugger W, Heil G,
Hackanson B, Deschler B, Döhner K, Hagemeijer A, Wijermans PW, Döhner
H. A multicenter phase II trial of decitabine as first-line treatment for
older patients with acute myeloid leukemia judged unfit for induction
chemotherapy. Haematologica 2012;97:393-401.
13. Kantarjian HM, Thomas XG, Dmoszynska A, Wierzbowska A, Mazur G, Mayer
J, Gau JP, Chou WC, Buckstein R, Cermak J, Kuo CY, Oriol A, Ravandi F, Faderl
S, Delaunay J, Lysák D, Minden M, Arthur C. Multicenter, randomized, openlabel,
phase III trial of decitabine versus patients choice, with physician
advice, of either supportive care or low-dose cytarabine for the treatment
of older patients with newly diagnosed acute myeloid leukemia. J Clin
Oncol 2012;30:2670-2677.
14. Liu F, Wang H, Liu J, Zhou Z, Zheng D, Huang B, Su C, Zou W, Xu D, Tong
X, Li J. A favorable inductive remission rate for decitabine combined with
chemotherapy as a first course in <60-year-old acute myeloid leukemia
patients with myelodysplasia syndrome features. Cancer Med 2019;8:5108-
5115.
15. Scandura JM, Roboz GJ, Moh M, Morawa E, Brenet F, Bose JR, Villegas L,
Gergis US, Mayer SA, Ippoliti CM, Curcio TJ, Ritchie EK, Feldman EJ. Phase
I study of epigenetic priming with decitabine prior to standard induction
chemotherapy for patients with AML. Blood 2011;118:1472-1480.
16. Jiang X, Wang Z, Ding B, Yin C, Zhong Q, Carter BZ, Yu G, Jiang L, Ye J,
Dai M, Zhang Y, Liang S, Zhao Q, Liu Q, Meng F. The hypomethylating
agent decitabine prior to chemotherapy improves the therapy efficacy
in refractory/relapsed acute myeloid leukemia patients. Oncotarget
2015;6:33612-33622.
17. Welch JS, Petti AA, Miller CA, Fronick CC, O’Laughlin M, Fulton RS, Wilson
RK, Baty JD, Duncavage EJ, Tandon B, Lee YS, Wartman LD, Uy GL, Ghobadi
A, Tomasson MH, Pusic I, Romee R, Fehniger TA, Stockerl-Goldstein KE, Vij R,
Oh ST, Abboud CN, Cashen AF, Schroeder MA, Jacoby MA, Heath SE, Luber K,
Janke MR, Hantel A, Khan N, Sukhanova MJ, Knoebel RW, Stock W, Graubert
TA, Walter MJ, Westervelt P, Link DC, DiPersio JF, Ley TJ. TP53 and decitabine
in acute myeloid leukemia and myelodysplastic syndromes. N Engl J Med
2016;375:2023-2036.
18. Ritchie EK, Feldman EJ, Christos PJ, Rohan SD, Lagassa CB, Ippoliti C, Scandura
JM, Carlson K, Roboz GJ. Decitabine in patients with newly diagnosed and
relapsed acute myeloid leukemia. Leuk Lymphoma 2013;54:2003-2007.
19. Blum W, Garzon R, Klisovic RB, Schwind S, Walker A, Geyer S, Liu S,
Havelange V, Becker H, Schaaf L, Mickle J, Devine H, Kefauver C, Devine
SM, Chan KK, Heerema NA, Bloomfield CD, Grever MR, Byrd JC, Villalona-
Calero M, Croce CM, Marcucci G. Clinical response and miR-29b predictive
significance in older AML patients treated with a 10-day schedule of
decitabine. Proc Natl Acad Sci U S A 2010;107:7473-7478.
20. Lübbert M, Suciu S, Hagemeijer A, Rüter B, Platzbecker U, Giagounidis A,
Selleslag D, Labar B, Germing U, Salih HR, Muus P, Pflüger KH, Schaefer
HE, Bogatyreva L, Aul C, de Witte T, Ganser A, Becker H, Huls G, van der
Helm L, Vellenga E, Baron F, Marie JP, Wijermans PW. Decitabine improves
progression-free survival in older high-risk MDS patients with multiple
autosomal monosomies: results of a subgroup analysis of the randomized
phase III study 06011 of the EORTC Leukemia Cooperative Group and
German MDS Study Group. Ann Hematol 2016;95:191-199.
21. Krauss AC, Gao X, Li L, Manning ML, Patel P, Fu W, Janoria KG, Gieser G,
Bateman DA, Przepiorka D, Shen YL, Shord SS, Sheth CM, Banerjee A,
Liu J, Goldberg KB, Farrell AT, Blumenthal GM, Pazdur R. FDA Approval
Summary: (Daunorubicin and cytarabine) liposome for injection for the
treatment of adults with high-risk acute myeloid leukemia. Clin Cancer Res
2019;25:2685-2690.
22. Lancet JE, Cortes JE, Hogge DE, Tallman MS, Kovacsovics TJ, Damon
LE, Komrokji R, Solomon SR, Kolitz JE, Cooper M, Yeager AM, Louie AC,
Feldman EJ. Phase 2 trial of CPX-351, a fixed 5:1 molar ratio of cytarabine/
daunorubicin, vs cytarabine/daunorubicin in older adults with untreated
AML. Blood 2014; 123:3239-3246.
23. Cortes JE, Goldberg SL, Feldman EJ, Rizzeri DA, Hogge DE, Larson M, Pigneux
A, Recher C, Schiller G, Warzocha K, Kantarjian H, Louie AC, Kolitz JE. Phase
II, multicenter, randomized trial of CPX-351 (cytarabine:daunorubicin)
liposome injection versus intensive salvage therapy in adults with first
relapse AML. Cancer 2015;121:234-242.
24. Lancet JE, Uy GL, Cortes JE, Newell LF, Lin TL, Ritchie EK, Stuart RK,
Strickland SA, Hogge D, Solomon SR, Stone RM, Bixby DL, Kolitz JE,
Schiller GJ, Wieduwilt MJ, Ryan DH, Hoering A, Banerjee K, Chiarella M,
Louie AC, Medeiros BC. CPX-351 (cytarabine and daunorubicin) liposome
for injection versus conventional cytarabine plus daunorubicin in older
patients with newly diagnosed secondary acute myeloid leukemia. J Clin
Oncol 2018;36:2684-2692.
25. Lagadinou ED, Sach A, Callahan K, Rossi RM, Neering SJ, Minhajuddin M,
Ashton JM, Pei S, Grose V, O’Dwyer KM, Liesveld JL, Brookes PS, Becker
MW, Jordan CT. BCL-2 inhibition targets oxidative phosphorylation and
selectively eradicates quiescent human leukemia stem cells. Cell Stem Cell
2013;12:329-341.
26. DiNardo CD, Pratz K, Pullarkat V, Jonas BA, Arellano M, Becker PS, Frankfurt
O, Konopleva M, Wei AH, Kantarjian HM, Xu T, Hong WJ, Chyla B, Potluri J,
Pollyea DA, Letai A. Venetoclax combined with decitabine or azacitidine
in treatment-naive, elderly patients with acute myeloid leukemia. Blood
2019;133:7-17.
27. Wei AH, Strickland SA Jr, Hou JZ, Fiedler W, Lin TL, Walter RB, Enjeti A,
Tiong IS, Savona M, Lee S, Chyla B, Popovic R, Salem AH, Agarwal S, Xu T,
Fakouhi KM, Humerickhouse R, Hong WJ, Hayslip J, Roboz GJ. Venetoclax
combined with low-dose cytarabine for previously untreated patients
with acute myeloid leukemia: results from a phase Ib/II study. J Clin Oncol
2019;37:1277-1284.
28. DiNardo CD, Jonas BA, Pullarkat V, Thirman MJ, Garcia JS, Wei AH, Konopleva
M, Döhner H, Letai A, Fenaux P, Koller E, Havelange V, Leber B, Esteve J,
Wang J, Pejsa V, Hájek R, Porkka K, Illés Á, Lavie D, Lemoli RM, Yamamoto K,
Yoon SS, Jang JH, Yeh SP, Turgut M, Hong WJ, Zhou Y, Potluri J, Pratz KW.
Azacitidine and venetoclax in previously untreated acute myeloid leukemia.
N Engl J Med 2020;383:617-629.
29. National Comprehensive Cancer Network. Clinical Practice Guidelines
in Oncology: Acute Myeloid Leukemia. Plymouth Meeting, NCCN, 2020.
Available online at https://www.nccn.org/professionals/ physician_gls/pdf/
aml.pdf.
194
Yılmaz F. et al: Stem Cell Transplantation in PNH Patients
RESEARCH ARTICLE
DOI: 10.4274/tjh.galenos.2021.2021.0105
Turk J Hematol 2021;38:195-203
Hematopoietic Stem Cell Transplantation for Patients with
Paroxysmal Nocturnal Hemoglobinuria with or without Aplastic
Anemia: A Multicenter Turkish Experience
Aplastik Aneminin Eşlik Ettiği ve Etmediği Paroksismal Noktürnal Hemoglobinüri
Hastalarında Hematopoetik Kök Hücre Nakli Deneyimi: Çok Merkezli Türkiye Deneyimi
Fergün Yılmaz 1, *, Nur Soyer 2, *, Güldane Cengiz Seval 3 , Sinem Civriz Bozdağ 3, *, Pervin Topçuoğlu 3 , Ali Ünal 4, *,
Leylagül Kaynar 4 , Gökhan Özgür 5, *, Gülsan Sucak 5 , Hakan Göker 6 , Mustafa Velet 6 , Hakan Özdoğu 7 ,
Mehmet Yılmaz 8, *, Emin Kaya 9, *, Ozan Salim 10, *, Burak Deveci 11 , İhsan Karadoğan 11 , Güray Saydam 2, *,
Fahri Şahin 2, *, Filiz Vural 2, *
1Marmara University Faculty of Medicine, Department of Hematology, İstanbul, Turkey
2Ege University Faculty of Medicine, Department of Hematology, İzmir, Turkey
3Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey
4Erciyes University Faculty of Medicine, Department of Hematology, Ankara, Turkey
5Medical Park Bahçeşehir Hospital, Clinic of Hematology and Transplantation, İstanbul, Turkey
6Hacettepe University Faculty of Medicine, Department of Hematology, Ankara, Turkey
7Başkent University Faculty of Medicine, Adana Bone Marrow Transplantation Center, Department of Hematology, Adana, Turkey
8SANKO University Faculty of Medicine, Department of Hematology, Gaziantep, Turkey
9İnönü University Faculty of Medicine, Department of Hematology, Malatya, Turkey
10Akdeniz University Faculty of Medicine, Department of Hematology, Antalya, Turkey
11İstanbul Gelişim University, Medstar Antalya Hospital Bone Marrow Transplantation Center, Department of Hematology, Antalya, Turkey
*PESG, PNH, and Education Study Group
Abstract
Objective: Although inhibition of the complement system at different
steps is a promising therapy modality in patients with paroxysmal
nocturnal hemoglobinuria (PNH), allogeneic hematopoietic stem cell
transplantation (HCT) is still the only curative therapy, especially for
patients with intractable hemolysis or bone marrow failure. The aim
of this study is to evaluate the outcomes of allogeneic HCT in PNH
patients with aplastic anemia (PNH-AA) or without.
Materials and Methods: Thirty-five PNH/PNH-AA patients who were
treated with allogeneic HCT in 10 transplantation centers in Turkey
were retrospectively analyzed.
Results: Sixteen (45.7%) and 19 (54.3%) patients were diagnosed
with classical PNH and PNH-AA, respectively. The median age of the
patients was 32 (18-51) years. The 2-year overall survival (OS) rate and
rate of graft-versus-host disease-free, failure-free survival (GFFS) was
81.2% and 78.1%, respectively. The 2-year OS in cases of classical PNH
and PNH-AA was 81.3% and 79.9%, respectively (p=0.87), and 2-year
GFFS in cases of PNH and PNH-AA was 79% and 76% (p=0.977),
Öz
Amaç: Paroksismal noktürnal hemoglobunüri (PNH) hastalarının
tedavisinde kompleman sisteminin değişik basamaklardaki inhibisyonu
umut vadedici bir tedavi yöntemidir. Ancak hastalığın belirti ve
bulgularını kontrol etmekte etkin bir tedavi yöntemi olsa da küratif bir
tedavi seçeneği değildir. Özellikle kompleman inhibisyonuna rağmen
devam eden hemolizi, replasman ihtiyacı ve kemik iliği yetmezliği
ile birlikteliği olan hasta grubunda halen tek küratif tedavi seçeneği
allojeneik kök hücre naklidir (KHN). Bu çalışmamızda aplastik anemi
ile birlikteliği olan (PNH-AA) ve olmayan PNH hastalarında yapılmış
allojeneik KHN’nin sonuçlarını değerlendirmeyi amaçladık.
Gereç ve Yöntemler: On ayrı merkezde PNH/PNH-AA tanısı olup
allojeneik KHN yapılan toplam 35 hasta retrospektif olarak tarandı.
Bulgular: On altı (%45,7) PNH ve 19 (%54,3) PNH-AA hastası
çalışmaya dahil edildi. Hastaların ortanca yaşı 32 (18-51) idi.
Hastalardaki sağkalım analizlerine baktığımızda; 2 yıllık genel sağkalım
(GS) ve graft versus host hastalıksız ve graft yetmezliksiz sağkalım
(GFFS) oranları sırasıyla %81,2 ve %78,1 idi. İki yıllık sağkalım PNH
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Fergün Yılmaz, M.D., Marmara University Faculty of Medicine,
Department of Hematology, İstanbul, Turkey
Phone : +90 532 783 90 18
E-mail : fergunaydin@hotmail.com ORCID: orcid.org/0000-0001-5118-6894
Received/Geliş tarihi: February 5, 2021
Accepted/Kabul tarihi: May 31, 2021
195
Yılmaz F. et al: Stem Cell Transplantation in PNH Patients
Turk J Hematol 2021;38:195-203
Abstract
without statistical significance. The OS and GFFS rates also did not
differ between transplantations with matched sibling donors (MSDs)
and matched unrelated donors (MUDs).
Conclusion: Allogeneic HCT with MSDs or MUDs is a good option
for selected patients with classical PNH and PNH-AA. In particular,
patients with debilitating and refractory hemolysis and patients with
bone marrow failure might form an excellent group of candidates for
allogeneic HCT.
Keywords: Paroxysmal nocturnal hemoglobinuria, Transplantation,
Allogeneic stem cell transplantation, Aplastic anemia
Öz
ve PNH-AA hastalarında sırasıyla %81,3 ve %79,9 olarak hesaplandı
ve gruplar arasında istatistiksel bir fark tespit edilmedi (p=0,87). Tam
uyumlu akraba donör ve tam uyumlu akraba dışı donör alt grupları
karşılaştırıldığında 2 yıllık OS ve GFFS oranlarında istatistiksel fark
gözlenmedi.
Sonuç: Seçilmiş PNH ve PNH-AA hasta grubunda akraba veya akraba
dışı tam uyumlu donör ile yapılan allojeneik KHN uygun bir seçenektir.
Özellikle refrakter hemolizi ve replasman ihtiyacı devam eden ve
kemik iliği yetmezliği bulguları olan hasta grubunda allojeneik KHN
bir tedavi seçeneği olarak değerlendirilmelidir.
Anahtar Sözcükler: Paroksismal noktürnal hemoglobinuri,
Transplantasyon, Allojeneik kök hücre nakli, Aplastik anemi
Introduction
Paroxysmal nocturnal hemoglobinuria (PNH) is an
acquired clonal disorder characterized by a defect in the
glycosylphosphatidyl-inositol (GPI) anchor protein, which
results in partial or complete absence of GPI-linked proteins.
In particular, the absence of GPI-linked CD55 and CD59
proteins leads to the increased sensitivity of erythrocytes to
complement activation and complement-mediated hemolysis.
The hallmarks of the disease are hemolysis, bone marrow
failure, and increased risk of thromboembolism [1,2].
Eculizumab, a humanized monoclonal antibody that inhibits
the formation of C5a and membrane attack complex, can
control hemolysis effectively [3] and improve quality of life
and survival rates while decreasing the incidence of thrombosis
[3,4]. Although it has changed the fate of the disease, it does
not cure it. Under these circumstances, it is an effective therapy
for classical PNH (cPNH) patients with prominent intravascular
hemolysis; however, its role in PNH with bone marrow failure
is very limited. Furthermore, there is still a group of patients
refractory to anticomplement therapy [5,6]. Considering all the
available therapies, the only curative therapy is still allogeneic
hematopoietic stem cell transplantation (allo-HCT), which is the
effective and preferred therapy, especially in patients with bone
marrow failure.
According to the literature, allo-HCT is generally limited to
patients with incurable hemolysis under anticomplement
therapy and patients with bone marrow failure due to a high
risk of graft-versus-host disease (GVHD), transplant-related
mortality and morbidity, and lack of suitable donors [7,8,9].
In this study, we retrospectively evaluate the efficiency and
safety of allo-HCT in patients with cPNH and PNH with aplastic
anemia (PNH-AA).
Materials and Methods
Patients
Thirty-five cPNH/PNH-AA patients who were treated with allo-
HCT between October 2005 and April 2019 in 10 transplantation
centers in Turkey were included. PNH was diagnosed by a
flow cytometric method based on the analysis of CD55 and
CD59 expression or by determining GPI-negative clones
(granulocytes/monocytes) using fluorescent aerolysin (FLAER).
cPNH was defined based on obvious hemolysis with abnormal
lactate dehydrogenase (LDH) and other laboratory tests related
to intravascular hemolysis. PNH-AA was defined in patients
with evidence of AA with pancytopenia and related clinical
presentation with a PNH clone with or without prominent
hemolysis [5]. Patients with AA without PNH clones, patients
with primary AA, patients with Fanconi anemia, and secondary
AA cases other than PNH-AA were excluded. The indications for
allo-HCT were incurable hemolysis with ongoing transfusion
requirement and severe/very severe AA.
The study was approved by Ege University’s Ethics Committee
and conducted in accordance with the Declaration of Helsinki.
Transplantation
Human leukocyte antigen (HLA) matching for donor selection
was based on serologic typing for HLA-A, -B, and -C antigens
and on DNA typing for the HLA-DRB1 antigen. HLA-matched
sibling donors (MSDs) were the first choice. When MSDs were
unavailable, HLA-matched unrelated donors (MUDs) were
preferred. Peripheral blood stem cells (PBSCs) were infused for
25 patients and bone marrow grafts were used for 10 patients.
Conditioning Regimen
For 28 patients, a fludarabine-based reduced intensity
chemotherapy (RIC) regimen was given, mainly
cyclophosphamide, fludarabine, and antithymocyte globulin
196
Turk J Hematol 2021;38:195-203
Yılmaz F. et al: Stem Cell Transplantation in PNH Patients
(ATG) or busulfan, fludarabine, and ATG. The patients were
mostly treated with cyclosporine and methotrexate for GVHD
prophylaxis according to the guidelines of the institution. For
7 patients, cyclophosphamide, busulfan and cyclophosphamide,
and fludarabine regimens with or without ATG were used as
myeloablative therapy. Cyclosporine and methotrexate were
mainly used as GVHD prophylaxis. Data on the conditioning
regimens and GVHD prophylaxis are provided in the
Supplementary Table. Regarding the types of ATG, the rabbit
type was used for all patients except 6 of them. The dose for
rabbit ATG was 10-40 mg/kg/day for 2-4 days and the dose for
the horse type was 2.5-5 mg/kg/day for 2-4 days according to
the institutional protocol.
Supportive Therapy
All patients were treated with antibacterial, antiviral, antifungal,
and anti-Pneumocystis jirovecii infection prophylaxis with
fluoroquinolones, acyclovir/valacyclovir, fluconazole, and
trimethoprim/sulfamethoxazole, respectively.
Granulocyte colony-stimulating factor was started as indicated
in the conditioning regimen protocol until myeloid recovery.
Irradiated and leuko-depleted blood products were administered
to maintain hemoglobin and platelet levels according to
the threshold determined by the transplantation center.
Ursodeoxycholic acid and defibrotide were administered for 8
and 3 patients, respectively, for prevention of veno-occlusive
disease.
Definitions
AA severity was defined according to the guidelines published
by Marsh et al. [10]. Neutrophil and platelet engraftment were
defined as an absolute neutrophil count (ANC) of >500/µL on
3 consecutive days and a platelet count of >20000/µL without
transfusion support on 3 consecutive days, respectively. Primary
graft failure was defined as failure to achieve engraftment
28 days after HCT. Secondary graft failure was defined as
the development of ANC of <500/µL after achieving initial
engraftment [11,12]. Acute and chronic GVHD were defined
and graded according to the established guidelines [13,14].
GVHD-free, failure-free survival (GFFS) was reported as survival
without grades 3-4 acute GVHD, moderate to severe chronic
GVHD, or treatment failures, which were determined as death,
primary or secondary graft failure, and relapse. Overall survival
(OS) was defined as the time from transplantation until the time
of death or the last follow-up.
Statistical Analysis
Statistical analyses were performed using SPSS 16 (SPSS
Inc., Chicago, IL, USA). The variables were first assessed by
Kolmogorov-Smirnov/Shapiro-Wilk tests in terms of normal
distribution. The results were provided as mean ± standard
deviation for normally distributed variables and as median
(minumum-maximum) for abnormally distributed parameters.
All p-values were two-tailed and statistical significance was
set at the level of p<0.05. Survival analysis was performed by
log rank test and Kaplan-Meier curves. Values of p<0.05 were
accepted as statistically significant.
Results
Patients
Thirty-five patients (19 male and 16 female) who were treated
with allo-HCT in 10 transplantation centers were enrolled in this
study. The median age at the time of transplantation was 32
years (minumum-maximum: 18-51). The characteristics of the
patients are shown in Table 1.
Sixteen (45.7%) and 19 (54.3%) patients were diagnosed with
cPNH and PNH-AA, respectively. The most common symptom
displayed was fatigue, which was present in 25 (71.4%) patients,
while dark urine was the least common symptom, present in
only 2 (5.7%) patients. Dyspnea, abdominal pain, and jaundice
were not reported in any cases. Six patients (17.1%, 5 patients
with cPNH [31.2%] and 1 patient with PNH-AA [5.2%]) had
a history of thromboembolism before transplantation, and
1 patient had multiple attacks. The sites for embolisms were
the pulmonary vein, hepatic vein, and deep vein of the leg and
upper extremities. No arterial embolisms were documented.
The therapies used before transplantation were steroids (12
patients), cyclosporine (13 patients), ATG (3 patients), growth
factors and erythropoietin (2 patients), androgens (3 patients),
and eculizumab (21 [60%] patients for a median of 24 months;
minumum-maximum: 1-44). The patients were treated with a
median of 2 different classes of therapies (minumum-maximum:
1-5) and the number of patients treated with more than 3
classes of therapies was 7 (20%). Fourteen (40%) patients were
not treated with eculizumab because 9 patients were diagnosed
before the availability of eculizumab in Turkey and 5 patients
mainly presented with signs and symptoms of pancytopenia
rather than hemolysis. Twenty-two patients were transfusiondependent
for both red blood cells and platelets. All patients were
transfused with a median of 24 (minumum-maximum: 4-120)
units of packed red blood cells and the median ferritin level
before transplantation was 561 ng/mL (minumum-maximum:
18-5236). Ferritin values of ≥1500 mg/mL were only reported
for 9 patients. Additionally, 14 patients were transfused with a
median of 24 units (minumum-maximum: 4-74) of apheresis or
pooled platelets. The PRBC dependence did not differ between
patients with cPNH and PNH-AA (p>0.05).
Transplantation
The median time to transplantation was 36 months
(minumum-maximum: 3-240). The median hemoglobin (Hb),
197
Yılmaz F. et al: Stem Cell Transplantation in PNH Patients
Turk J Hematol 2021;38:195-203
leukocyte, neutrophil, platelet, and LDH levels were 6.8 g/dL
(minumum-maximum: 5-9.8), 3360/µL (minumum-maximum:
100-13500), 680/µL (minumum-maximum: 90-13200),
56000/µL (minumum-maximum: 6000-340000), and 882 IU/L
(minumum-maximum: 230-4440), respectively. The median
neutrophil count (1800/µL versus 450/µL, p=0.001), leukocyte
count (4000/µL versus 1700/µL, p=0.004), platelet count
(125000/µL versus 18000/µL, p=0.001), LDH (1144 IU/L versus
310 IU/L, p=0.016), and bone marrow cellularity (60% versus
15%, p<0.0001) were statistically different between patients
with cPNH and PNH-AA. The laboratory parameters and
characteristics of the patients are shown in Table 1.
The median percentages of PNH clone in granulocytes and
monocytes before transplantation were 62.7% (2.6%-97%) and
60% (3.1%-95%), respectively. PNH clone size for granulocytes
was statistically different between cPNH and PNH-AA patients
(90% versus 30%, p=0.04). Allo-HCT was performed with MUDs
and MSDs for 12 and 23 patients, respectively. In the subgroup
analysis of patients with cPNH and PNH-AA, transplantation
from a MSD was much more frequent in patients with cPNH
(p=0.039).
Myeloablative regimens and RIC protocols were used for 7 (20%)
and 28 (80%) patients, respectively. A bone marrow source
was used for 10 patients, and PBSCs were transfused for 25
patients. The median number of stem cells infused was 2.54x10 6
(2.17-3.91x10 6 ) and 7x10 6 (3.39-11.3x10 6 ) CD34+ cells/kg recipient
weight for bone marrow harvesting and PBSCs, respectively.
Platelet and neutrophil engraftments were achieved in 28 (80%)
and 29 (82.8%) cases, and primary graft failure was documented
in 6 (17.1%) cases. Graft failure rates did not differ between
patients with cPNH and PNH-AA. The patients with primary
graft failure died due to refractory disease, pancytopenia, and
sepsis. Secondary graft failure was reported in only 1 patient
who died due to aplastic bone marrow, sepsis, and peripheral
lymphoproliferative disease. The median days to neutrophil
and platelet engraftment were 16 (10-27) and 16 (11-27) days,
respectively. The median days to both neutrophil and platelet
engraftments did not differ between the patients with cPNH
and PNH-AA or patients receiving transplants from MUDs and
MSDs.
Six (17.1%) patients had acute GVHD, including cutaneous in
5 patients, gastrointestinal system in 1 patient, and liver in 1
patient. All cases of acute GVHD were grade 1 or 2. RIC and
cyclosporine/methotrexate regimens were given to all patients
with acute GVHD for conditioning and GVHD prophylaxis,
respectively. There was no reported acute GVHD-related death.
Four patients (11.4%) had mild chronic GVHD, affecting the
eyes (3 patients), liver (2 patients), and skin (1 patient). All
patients with chronic GVHD were treated with RIC protocols as
the conditioning regimen, and 3 of 4 patients received PBSCs.
All patients documented with chronic GVHD were alive at the
last follow-up visit and the GVHD was under control with
immunosuppressive therapy given according to the guidelines
of the center. Presence of chronic or acute GVHD did not differ
between the patients with cPNH and PNH-AA or the patients
with MUDs and MSDs.
Possible and probable fungal pneumonia and CMV reactivation
were both documented in 4 patients. Two of these patients
experienced both CMV activation and possible fungal
pneumonia.
Table 1. Characteristics of the patients.
All patients PNH-AA cPNH
Number of patients 35 (100%) 19 (45.7%) 16 (54.3%)
Gender, male/female 19/16 12/7 7/9
Median age at the time of transplantation, years (range) 32 (18-51) 32 (24-51) 31 (18-48)
Number of patients treated with eculizumab 21 11 10
History of thromboembolism, yes 6 3 3
Laboratory parameters, median (range)
LDH, IU/L
WBC, µL
Hb, g/dL
Neutrophils, µL
PLT, µL
PNH clone before transplantation, %, median (range)
Granulocytes
Monocytes
882 (230-4440)
3360 (100-13500)
6.8 (5-9.8)
680 (90-13200)
56000 (6000-340000)
62.7 (2.6-97)
60 (3.1-95)
310 (230-550)
1700 (100-3400)
6.5 (5.7-9.8)
450 (90-900)
18000 (6000-67000)
30 (2.6-76)
32 (3.1-76)
1144 (400-4440)
4000 (980-13500)
6.8 (5-9.6)
1800 (500-13200)
125000 (19000-340000)
90 (55-97)
86 (50-95)
Bone marrow cellularity (%) 45 (3-100) 15 (3-30) 60 (30-100)
PNH-AA: Paroxysmal nocturnal hemoglobinuria with anaplastic anemia; cPNH: classical paroxysmal nocturnal hemoglobinuria; LDH: lactate dehydrogenase; WBC: white blood cells;
Hb: hemoglobin; PLT: platelets.
198
Turk J Hematol 2021;38:195-203
Yılmaz F. et al: Stem Cell Transplantation in PNH Patients
Survival
The median follow-up duration was 36 months (minumummaximum:
2-156). The PNH clone was detectable in only
4 patients at the last visit. The percentages of the clone in
monocytes were 0.3%, 1%, 1.2%, and 2% and in granulocytes
were 0.2%, 2%, 2%, and 3%. The chimerism levels were 98%,
93%, 96%, and 98%, respectively, at the last visit. All patients
with detectable PNH clones were alive at the last visit and were
transfusion-independent.
Six patients died during the follow-up period. For 5 patients,
graft failure and related pancytopenia and sepsis were the
causes of death; 1 patient with secondary graft failure died
due to peripheral T-cell and lymphoproliferative disease and
sepsis. All patients were treated with RIC protocols, except
1 patient who had a myeloablative conditioning regimen.
Transplantations from MUDs and MSDs were performed for 2
and 3 patients, respectively.
Two-year OS and GFFS were 81.2% and 78.1%, respectively, and
mean OS and GFFS were 126.9±10.4 months and 121.4±12.1
months, respectively. The 2-year OS for cPNH and PNH-AA
was 81.3% and 79.9%, respectively (p=0.87). The 2-year
GFFS for cPNH and PNH-AA was 79% and 76%. There was
no statistical difference between the two groups (p=0.977)
(Figures 1 and 2). In patients receiving transplantations from
MSDs and MUDs, although 2-year OS and GFFS rates were
higher in patients with MSDs, this difference did not reach
statistical significance (2-year OS: 83.3% versus 69% [p=0.44]
for MSDs and MUDs, respectively; GFFS: 83% versus 70.7%
[p=0.62] for MSDs and MUDs, respectively). Although there
was a difference between the groups, this difference did not
reach statistical significance, probably due to the small size of
the cohort.
1-44 months). In the literature, the median follow-up period
before transplantation was 6-28 months [11,12,19,20]. The
median time to transplantation was reported to be as short as
6 months by Liu et al. [11], probably due to the unavailability of
eculizumab in China. In the present study, time to transplantation
was relatively long because patients were treated with different
modalities, including eculizumab. Additionally, searching for a
suitable related or unrelated donor might also increase the time
to transplantation.
Laboratory parameters are summarized in Table 1. The median
neutrophil count, leukocyte count, platelet count, LDH level,
and bone marrow cellularity were statistically different in
patients with cPNH and PNH-AA. Although we did not find a
correlation between survival and laboratory parameters, Bemba
et al. [20] reported better survival rates in patients with ANC of
Figure 1. Overall survival in paroxysmal nocturnal hemoglobinuria
(PNH) patients with or without anaplastic anemia.
cPNH: Classical PNH; PNH-AA: PNH with aplastic anemia.
Discussion
Although anticomplement therapy with eculizumab is very
effective in cPNH patients, refractoriness is a problem.
Furthermore, eculizumab is not an option for patients with
bone marrow failure without obvious hemolysis. Under these
circumstances, allo-HCT is an option for patients with ongoing
hemolysis and PNH-AA.
In this multicenter study, we retrospectively evaluated the allo-
HCT results of 35 patients with cPNH and PNH-AA. The median
age at the time of transplantation was 32 and the oldest patient
was 51 years of age. In the literature, the median ages of patients
were generally in the range of 24.5-37 years, but a patient
as old as 60 years was transplanted [11,12,15,16,17,18]. The
median time to transplantation was 36 months in our cohort,
and patients received different therapies, including eculizumab
(21 patients with a median of 24 months; minumum-maximum:
Figure 2. Graft-versus-host disease-free, failure-free survival in
paroxysmal nocturnal hemoglobinuria (PNH) patients with or
without anaplastic anemia.
cPNH: Classical PNH; PNH-AA: PNH with aplastic anemia.
199
Yılmaz F. et al: Stem Cell Transplantation in PNH Patients
Turk J Hematol 2021;38:195-203
>1000/µL and hemoglobin of >9 g/dL at transplantation;
however, this finding was not confirmed by other studies.
The median PNH clone size for granulocytes in cPNH cases
was higher than in PNH-AA (90% in cPNH versus 30% in
PNH-AA [p=0.04]), which was compatible with the literature
[12]. Neither our study nor other studies have documented a
survival benefit related to PNH clone size.
Primary engraftment failure was reported in 6 (17.1%) patients
and secondary failure was observed in only 1 patient. The
Supplementary Table. Transplant data of the patients.
Patient
no.
Sex
Diagnosis: cPNH,
PNH-AA
HLA
disparity
median time to neutrophil and platelet engraftment was 16
(10-27) and 16 (11-27) days, respectively. The primary graft
failure rate was higher in our study, mainly due to differences in
definitions. In the study conducted by Liu et al. [11], there was
no reported primary graft failure; however, the range of time
to platelet engraftment was up to 75 days, and there were 3
patients (6.82%) with delayed platelet engraftment. The median
time to neutrophil and platelet engraftment in our cohort was
within the range reported in the literature (13-20.5 days for
neutrophils and 12-27 for platelets) [15,16,18,21].
MSD or MUD Stem cell source Conditioning regimen
(RIC or myeloablative regimen)
1 Male PNH-AA 10/10 MSD Bone marrow RIC
2 Female cPNH 10/10 MSD Peripheral blood RIC
3 Female PNH-AA 10/10 MSD Peripheral blood RIC
4 Female PNH-AA 10/10 MSD Peripheral blood RIC
5 Female PNH-AA 10/10 MSD Peripheral blood RIC
6 Male cPNH 10/10 MSD Peripheral blood RIC
7 Female cPNH 10/10 MSD Peripheral blood RIC
8 Male cPNH 10/10 MUD Peripheral blood Myeloablative
9 Male PNH-AA 10/10 MUD Peripheral blood RIC
10 Male PNH-AA 10/10 MUD Peripheral blood RIC
11 Male PNH-AA 10/10 MUD Peripheral blood RIC
12 Male PNH-AA 10/10 MUD Peripheral blood RIC
13 Male cPNH 10/10 MSD Peripheral blood RIC
14 Female PNH-AA 10/10 MSD Peripheral blood RIC
15 Male cPNH 10/10 MSD Bone marrow RIC
16 Female cPNH 10/10 MUD Peripheral blood Myeloablative
17 Female cPNH 10/10 MSD Peripheral blood RIC
18 Female cPNH 10/10 MSD Peripheral blood RIC
19 Male cPNH 10/10 MSD Bone marrow RIC
20 Female cPNH 10/10 MSD Bone marrow RIC
21 Female cPNH 10/10 MSD Peripheral blood RIC
22 Female cPNH 10/10 MSD Bone marrow RIC
23 Male PNH-AA 9/10 MUD Peripheral blood Myeloablative
24 Male cPNH 10/10 MSD Bone marrow RIC
25 Male PNH-AA 10/10 MSD Bone marrow RIC
26 Male PNH-AA 10/10 MUD Peripheral blood RIC
27 Female PNH-AA 9/10 MUD Peripheral blood Myeloablative
28 Female PNH-AA 9/10 MUD Peripheral blood Myeloablative
29 Female cPNH 10/10 MUD Peripheral blood Myeloablative
30 Male PNH-AA 10/10 MSD Bone marrow RIC
31 Male PNH-AA 10/10 MSD Bone marrow Myeloablative
32 Male PNH-AA 10/10 MSD Peripheral blood RIC
33 Male cPNH 10/10 MSD Peripheral blood RIC
34 Female PNH-AA 10/10 MSD Bone marrow RIC
35 Male PNH-AA 10/10 MUD Peripheral blood RIC
Busulfan2: Reduced dose busulfan in Ric regimen according to protocol of the institution.
aGVHD: Acute graft-versus-host disease; cGVHD: chronic graft-versus-host disease; cPNH: classical paroxysmal nocturnal hemoglobinuria;
CSA: cyclosporin; MMF: mycophenolate mofetil; MSD: matched sibling donor; Mtx: methotrexate; MUD: matched unrelated donor; PNH-AA:
paroxysmal nocturnal hemoglobinuria with aplastic anemia; RIC: reduced intensity chemotherapy.
200
Turk J Hematol 2021;38:195-203
Yılmaz F. et al: Stem Cell Transplantation in PNH Patients
In our study, the rates of 2-year OS and GFFS were 81.2%
and 78.1%, respectively, and the mean OS and GFFS were
126.9±10.4 months and 121.4±12.1 months, respectively.
Recently, a study by Pantin et al. [16] analyzed the long-term
outcome of fludarabine-based RIC allo-HCT in 17 patients with
cPNH and PNH-AA. The conditioning and GVHD prophylaxis
regimens were similar to those of our study. With a followup
of a median of nearly 6 years, 87.8% patients survived.
The survivors were transfusion-independent and there was no
evidence of PNH [16]. Another retrospective study evaluating
RIC regimens in 33 PNH patients with or without AA also
demonstrated excellent survival rates. At a median followup
of 57.0 months (minumum-maximum: 6.0-151.3), the
estimated OS was 87.9±5.7% [12]. The low transfusion rates
and transplantation with the RIC regimen were probably
related to the higher survival rates.
Beside these studies, data from previous studies also revealed
poor survival rates with allo-HCT [19,20]. Saso et al. [19]
revealed the results of allo-HCT performed between 1978 and
Conditioning regimen GVHD prophylaxis aGVHD
(yes/no)
cGVHD
(yes/no)
Secondary
graft failure
Survival status
at the last visit
Cyclophosphamide + fludarabine + ATG CSA-MMF No No No Alive
Cyclophosphamide + fludarabine + ATG CSA-MMF No No No Alive
Cyclophosphamide + fludarabine + ATG Mtx No No No Alive
Cyclophosphamide + fludarabine + ATG Mtx No No No Alive
Cyclophosphamide + fludarabine + ATG Mtx No No No Alive
Busulfan2 + fludarabine + ATG Mtx No No No Dead
Busulfan2 + cyclophosphamide + ATG CSA + Mtx No No No Alive
Cyclophosphamide + fludarabine + ATG CSA + Mtx No No No Alive
Cyclophosphamide + fludarabine + ATG CSA + Mtx No Yes No Alive
Cyclophosphamide + fludarabine + ATG CSA + Mtx Yes No No Dead
Cyclophosphamide + fludarabine + ATG CSA + Mtx No No No Alive
Melphalan + fludarabine + ATG CSA + Mtx No No No Alive
Cyclophosphamide + fludarabine + ATG CSA + Mtx Yes Yes No Alive
Cyclophosphamide + fludarabine + ATG CSA No No No Alive
Cyclophosphamide + fludarabine + ATG CSA Yes No No Alive
Busulfan + cyclophosphamide + ATG CSA + Mtx No No No Alive
Cyclophosphamide + fludarabine + ATG CSA + Mtx No No No Alive
Cyclophosphamide + fludarabine + ATG CSA + Mtx No Yes No Alive
Cyclophosphamide + fludarabine + ATG CSA + Mtx No Yes No Alive
Cyclophosphamide + fludarabine + ATG CSA + Mtx No No No Alive
Busulfan2 + cyclophosphamide + ATG CSA + Mtx No No Yes Dead
Cyclophosphamide + fludarabine + ATG CSA + Mtx No No No Alive
Busulfan + cyclophosphamide CSA + Mtx Yes No No Dead
Cyclophosphamide + fludarabine + ATG CSA + Mtx No No No Dead
Cyclophosphamide + fludarabine + ATG CSA + Mtx Yes No No Alive
Cyclophosphamide + fludarabine + ATG CSA + Mtx No No No Alive
Busulfan + cyclophosphamide CSA + Mtx Yes No No Alive
Cyclophosphamide + fludarabine + ATG CSA + Mtx No No No Dead
Cyclophosphamide + fludarabine + ATG CSA + Mtx No No No Alive
Cyclophosphamide + fludarabine + ATG CSA + Mtx No No No Alive
Cyclophosphamide + fludarabine + ATG CSA + Mtx No No No Alive
Fludarabine + ATG CSA + Mtx No No No Alive
Fludarabine + ATG CSA + Mtx No No No Alive
Fludarabine + ATG CSA + Mtx No No No Alive
Fludarabine + ATG CSA + Mtx No No No Alive
201
Yılmaz F. et al: Stem Cell Transplantation in PNH Patients
Turk J Hematol 2021;38:195-203
1995. In this study, the 2-year probability of survival was as
low as 56%, and transplantation could restore normal marrow
function in only about 50% of patients. However, in this study,
there were several factors that might have been related to
the lower survival rates. First of all, the patients were heavily
transfused, and platelet refractoriness was documented in more
than 20% of cases. Secondly, myeloablative regimens were
mostly used, and the rates of acute and chronic GVHD (34%
and 33%, respectively) were high. These characteristics of the
patients might be related to lower survival rates compared to
the results in our study.
Considering the rarity of this disease and other treatment
options, although prospective randomized studies are lacking in
the literature, the safety and efficiency of RIC regimens were
demonstrated in small series [17,22]. By integrating RIC regimens
with allo-HCT for PNH patients, the mortality and morbidity
rates have been reduced, obviating the need for more potentially
toxic myeloablative therapies [16,23].
In our cohort, only 4 of the patients had a detectable PNH
clone in a range of 0.2%-3%. All patients with detectable
clones were transfusion-independent. In 88.5% of the
patients, the PNH clone was undetectable at the last followup.
PNH clone negativity was also high after allo-HCT in other
studies [16,18].
When we performed a subgroup analysis including cPNH and
PNH-AA, the rates of 2-year OS (81.3% in cPNH and 79.9% in
PNH-AA, p=0.87) and GFFS (79% in cPNH and 76% in PNH-AA,
p=0.977) were not statistically different. Similar to our results,
Liu et al. [11] reported that 3-year OS and GFFS were 90.4% and
85.6%, respectively, without showing a statistical difference.
Although GFFS tended to be better for cPNH patients in both
our study and the study by Liu et al. [11], this difference did not
reach statistical significance.
In addition, we did not discover a statistically significant
difference between transplantation from MUDs or MSDs.
Although data from previous studies reported that MUD
allografts might result in high mortality rates [19], other
studies documented successful transplantation results with
MUD allografts [24,25,26]. In patients without suitable
sibling donors, unrelated donors can be a particularly good
option.
In terms of GVHD, we documented acute GVHD and chronic
GVHD in 17.1% and 11.4% of the patients, respectively. Thus,
we have reported relatively low GVHD rates. This might be
due to several reasons. First of all, this was a retrospective
study and loss of data is one of the major limitations in
retrospective studies. Secondly, a regimen including ATG
was used for all patients except 2 of them. It is well known
that regimens with ATG are associated with low GVHD rates.
Another reason for low GVHD might be the wide range of
follow-up time. Although the median follow-up duration
was 36 months, the range was between 2 and 156 months.
Patients with short follow-up periods might decrease
the overall GVHD rate. A very recent study including PNH
patients with allogeneic transplantation reported the rate of
acute GVHD at 100 days as 21%. The cumulative incidence
of extensive chronic GVHD at 2 years was 17% [27]. The
Polish Adult Leukemia Group also reported acute GVHD and
cumulative 1-year incidence of extensive chronic GVHD as
23% and 10.8%, respectively [28].
Study Limitations
Our study had some limitations. First of all, it was a
retrospective study; therefore, missing data and loss of followup
visits constituted a problem. Although it was a multicenter
study including a relatively large cohort, it only included
matched related and unrelated donors. There were no data
for haploidentical transplantation in PNH patients. In spite of
these limitations, this is the first multicenter study to report
allo-HCT results from Turkey; considering the rarity of this
disease, our study included a relatively large cohort with 35
patients.
Conclusion
Allo-HCT with MSDs and MUDs is a good option for selected
patients with cPNH and PNH-AA. Patients with debilitating and
refractory hemolysis and patients with bone marrow failure
might form a particularly excellent group of candidates for
allo-HCT. In the era of complement inhibitors, identifying the
patients who will benefit from allo-HCT is a very important
issue. Even though allo-HCT is the only curative therapy, its
mortality and morbidity rates remain an issue. Although there
are still unanswered questions, allo-HCT is an option for selected
patients with PNH.
Ethics
Ethics Committee Approval: The study was approved by Ege
University’s Ethics Committee and conducted in accordance
with the Declaration of Helsinki.
Authorship Contributions
Concept: F.Y., N.S., G.C.S., S.C.B., P.T., A.Ü., L.K., G.Ö., G.S., H.G.,
M.V., H.Ö., M.Y., E.K., O.S.,B.D., İ.K., G.Sa., F.Ş., F.V.; Design: F.Y., N.S.,
G.C.S., S.C.B., P.T., A.Ü., L.K., G.Ö., G.S., H.G., M.V., H.Ö., M.Y., E.K.,
O.S., B.D., İ.K., G.Sa., F.Ş., F.V.; Analysis or Interpretation: F.Y., N.S.,
G.C.S., S.C.B., P.T., A.Ü., L.K., G.Ö., G.S., H.G., M.V., H.Ö., M.Y., E.K.,
O.S.,B.D., İ.K., G.Sa., F.Ş., F.V.; Literature Search: F.Y., N.S., G.C.S.,
S.C.B., P.T., A.Ü., L.K., G.Ö., G.S., H.G., M.V., H.Ö., M.Y., E.K., O.S.,B.D.,
İ.K., G.Sa., F.Ş., F.V.; Writing: F.Y., N.S., G.C.S., S.C.B., P.T., A.Ü., L.K.,
G.Ö., G.S., H.G., M.V., H.Ö., M.Y., E.K., O.S.,B.D., İ.K., G.Sa., F.Ş., F.V.
202
Turk J Hematol 2021;38:195-203
Yılmaz F. et al: Stem Cell Transplantation in PNH Patients
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Takeda J, Miyata T, Kawagoe K, Iida Y, Endo Y, Fujita T, Takahashi M, Kitani T,
Kinoshita T. Deficiency of the GPI anchor caused by a somatic mutation of
the PIG-A gene in paroxysmal nocturnal hemoglobinuria. Cell 1993;73:703-
711.
2. Rosse WF. Paroxysmal nocturnal hemoglobinuria as a molecular disease.
Medicine (Baltimore) 1997;76:63-93.
3. Fontbrune FS, Latour RP. Ten years of clinical experience with eculizumab
in patients with paroxysmal nocturnal hemoglobinuria. Semin Hematol
2018;55:124-129.
4. Hill A, DeZern AE, Kinoshita T, Brodsky RA. Paroxysmal nocturnal
haemoglobinuria. Nat Rev Dis Primers 2017;18:17028.
5. Parker CJ. Update on the diagnosis and management of paroxysmal
nocturnal hemoglobinuria. Hematology Am Soc Hematol Educ Program
2016;2016:208-216.
6. Parker C. Eculizumab for paroxysmal nocturnal haemoglobinuria. Lancet
2009;373:759-767.
7. Brodsky RA. Paroxysmal nocturnal hemoglobinuria. Blood 2014;124:2804-2811.
8. Peffault de Latour R, Schrezenmeier H, Bacigalupo A, Blaise D, de Souza CA,
Vigouroux S, Willemze R. Allogeneic stem cell transplantation in paroxysmal
nocturnal hemoglobinuria. Haematologica 2012;97:1666-1673.
9. Brodsky RA. Stem cell transplantation for paroxysmal nocturnal
hemoglobinuria. Haematologica 2010;95:855-856.
10. Marsh JC, Ball SE, Cavenagh J, Darbyshire P, Dokal I, Gordon-Smith EC,
Keidan J, Laurie A, Martin A, Mercieca J, Killick SB, Stewart R, Yin JA; British
Committee for Standards in Haematology. Guidelines for the diagnosis and
management of aplastic anaemia. Br J Haematol 2009;147:43-70.
11. Liu L, Liu S, Zhang Y, Zhou H, Wang Q, Tian H, Chen F, Qiu H, Tang X, Han Y,
Fu C, Jin Z, Chen S, Sun A, Miao M, Wu D. Excellent outcomes of allogeneic
haematopoietic stem cell transplantation in 44 patients with paroxysmal
nocturnal haemoglobinuria: a single-centre study. Biol Blood Marrow
Transplant 2019;25:1544-1549.
12. Lee SE, Park SS, Jeon YW, Yoon JH, Cho BS, Eom KS, Kim YJ, Lee S, Min CK,
Kim HJ, Cho SG, Kim DW, Min WS, Lee JW. Outcomes of allogeneic stem
cell transplantation in patients with paroxysmal nocturnal hemoglobinuria
with or without aplastic anemia. Eur J Haematol 2017;99:336-343.
13. Przepiorka D, Weisdorf D, Martin P, Klingemann HG, Beatty P, Hows J,
Thomas ED. Consensus conference on acute GVHD grading. Bone Marrow
Transplant 1995;15:825-828.
14. Filipovich AH, Weisdorf D, Pavletic S, Socie G, Wingard JR, Lee SJ, Martin P,
Chien J, Przepiorka D, Couriel D, Cowen EW, Dinndorf P, Farrell A, Hartzman
R, Henslee-Downey J, Jacobsohn D, McDonald G, Mittleman B, Rizzo JD,
Robinson M, Schubert M, Schultz K, Shulman H, Turner M, Vogelsang
G, Flowers ME. National Institutes of Health Consensus Development
Project on criteria for clinical trials in chronic graft-versus-host disease: I.
Diagnosis and staging working group report. Biol Blood Marrow Transplant
2005;11:945-956.
15. Santarone S, Bacigalupo A, Risitano AM, Tagliaferri E, Di Bartolomeo E,
Iori AP, Rambaldi A, Angelucci E, Spagnoli A, Papineschi F, Tamiazzo S, Di
Nicola M, Di Bartolomeo P. Hematopoietic stem cell transplantation for
paroxysmal nocturnal hemoglobinuria: long-term results of a retrospective
study on behalf of the Gruppo Italiano Trapianto Midollo Osseo (GITMO).
Haematologica 2010;95:983-988.
16. Pantin J, Tian X, Geller N, Ramos C, Cook L, Cho E, Scheinberg P, Vasu S,
Khuu H, Stroncek D, Barrett J, Young NS, Donohue T, Childs RW. Long-term
outcome of fludarabine-based reduced-intensity allogeneic hematopoietic
cell transplantation for debilitating paroxysmal nocturnal hemoglobinuria.
Biol Blood Marrow Transplant 2014;20:1435-1439.
17. Schcolnik-Cabrera A, Labastida-Mercado N, Galindo-Becerra LS, Gomez-
Almaguer D, Herrera-Rojas MA, Ruiz-Delgado GJ, Ruiz-Arguelles GJ.
Reduced-intensity stem cell allografting for PNH patients in the eculizumab
era: the Mexican experience. Hematology 2015;20:263-266.
18. DeZern AE, Jones RJ, Brodsky RA. Eculizumab bridging before bone
marrow transplant for marrow failure disorders is safe and does not limit
engraftment. Biol Blood Marrow Transplant 2018;24:e26-e30.
19. Saso R, Marsh J, Cevreska L, Szer J, Gale RP, Rowlings PA, Passweg JR, Nugent
ML, Luzzatto L, Horowitz MM, Gordon-Smith EC. Bone marrow transplants for
paroxysmal nocturnal haemoglobinuria. Br J Haematol 1999;104:392-396.
20. Bemba M, Guardiola P, Garderet L, Devergie A, Ribaud P, Esperou H, Noguera
MH, Gluckman E, Socié G. Bone marrow transplantation for paroxysmal
nocturnal haemoglobinuria. Br J Haematol 1999;105:366-368.
21. Vallet N, de Fontbrune FS, Loschi M, Desmier D, Villate A, Barraco F,
Chevallier P, Terriou L, Yakoub-Agha I, Ruggeri A, Mohty M, Maillard N,
Rohrlich PS, Ceballos P, Nguyen S, Poiré X, Guillerm G, Tabrizi R, Farhi J,
Devillier R, Rubio MT, Socié G, de Latour RP; Société Francophone de Greffe
de Moelle et Thérapie Cellulaire. Hematopoietic stem cell transplantation
for patients with paroxysmal nocturnal hemoglobinuria previously treated
with eculizumab: a retrospective study of 21 patients from SFGM-TC
centers. Haematologica 2018;103:e103-e105.
22. Hegenbart U, Niederwieser D, Forman S, Holler E, Leiblein S, Johnston
L, Pönisch W, Epner E, Witherspoon R, Blume K, Storb R. Hematopoietic
cell transplantation from related and unrelated donors after minimal
conditioning as a curative treatment modality for severe paroxysmal
nocturnal hemoglobinuria. Biol Blood Marrow Transplant 2003;9:689-697
23. Srinivasan R, Takahashi Y, McCoy JP, Espinoza-Delgado I, Dorrance C, Igarashi
T, Lundqvist A, Barrett AJ, Young NS, Geller N, Childs RW. Overcoming graft
rejection in heavily transfused and allo-immunised patients with bone
marrow failure syndromes using fludarabine-based haematopoietic cell
transplantation. Br J Haematol 2006;133:305-314. .
24. Flotho C, Strahm B, Kontny U, Duffner U, Peters AM, Dupuis W, Niemeyer
CM. Stem cell transplantation for paroxysmal nocturnal haemoglobinuria in
childhood. Br J Haematol 2002;118:124-127.
25. Woodard P, Wang W, Pitts N, Benaim E, Horwitz E, Cunningham J, Bowman
L. Successful unrelated donor bone marrow transplantation for paroxysmal
nocturnal hemoglobinuria. Bone Marrow Transplant 2001;27:589-592
26. Matos-Fernandez NA, Abou Mourad YR, Caceres W, Kharfan-Dabaja MA. Current
status of allogeneic hematopoietic stem cell transplantation for paroxysmal
nocturnal hemoglobinuria. Biol Blood Marrow Transplant 2009;15:656-661.
27. Nakamura Y, Takenaka K, Yamazaki H, Onishi Y, Ozawa Y, Ikegame K,
Matsuoka KI, Toubai T, Ueda Y, Kanda Y, Ichinohe T, Atsuta Y, Mori T. Outcome
of allogeneic hematopoietic stem cell transplantation in adult patients with
paroxysmal nocturnal hemoglobinuria. Int J Hematol 2021;113:122-127.
28. Markiewicz M, Drozd-Sokolowska J, Biecek P, Dzierzak-Mietla M,
Boguradzki P, Staniak M, Piatkowska-Jakubas B, Piekarska A, Tormanowska
M, Halaburda K, Ussowicz M, Waszczuk-Gajda A, Basak G, Bołkun L, Rybka
J, Sadus-Wojciechowska M, Giebel S, Szmigielska-Kaplon A, Mendek-
Czajkowska E, Warzybok K, Burdacki A, Dwilewicz-Trojaczek J. Allogeneic
hematopoietic stem cell transplantation for paroxysmal nocturnal
hemoglobinuria: multicenter analysis by the Polish Adult Leukemia Group.
Biol Blood Marrow Transplant 2020;26:1833-1839.
203
Demiroğlu H. et al: Prediction of Stem Cell Mobilization Failure in Patients with Hodgkin and Non-Hodgkin Lymphoma
RESEARCH ARTICLE
DOI: 10.4274/tjh.galenos.2020.2020.0409
Turk J Hematol 2021;38:204-210
Prediction of Stem Cell Mobilization Failure in Patients with
Hodgkin and Non-Hodgkin Lymphoma
Hodgkin ve Non-Hodgkin Lenfomalı Hastalarda Kök Hücre Mobilizasyon Başarısızlığının
Öngörüsü
Haluk Demiroğlu, Rafiye Çiftçiler, Yahya Büyükaşık, Hakan Göker
Hacettepe University Faculty of Medicine, Departments of Hematology, Ankara, Turkey
Abstract
Objective: Autologous stem cell transplantation (ASCT) is a significant
and potentially curative treatment modality for patients with
relapsed/refractory lymphoma. Insufficient mobilization and harvest
of peripheral stem cells can be a major obstacle for performing ASCT.
The aim of this study was to evaluate the factors that might influence
mobilization failure in patients with lymphoma.
Materials and Methods: Eighty-seven patients diagnosed with
non-Hodgkin and Hodgkin lymphoma who underwent stem cell
mobilization afterwards at the Hacettepe University Medical School
Bone Marrow Transplantation Center, Turkey, between the years of
2000 and 2018 were evaluated.
Results: A total of 87 patients were included in this study. In 66 of 87
patients (75.9%), the first mobilization trial was successful. Adequate
(≥2x106/kg) CD34+ cells were collected in the first apheresis for 66
patients (9.5±8.1). For 21 of 87 (24.1%), the first mobilization trial was
unsuccessful. Therefore, a second mobilization trial was performed for
these patients with plerixafor (5.5±3.3). The number of CD34+ cells
was significantly higher in patients who were successful in the first
mobilization (p=0.002).
Conclusion: The success rate of the first mobilization trial was found
to be higher in patients with high platelet counts before mobilization
and patients who received chemotherapy-based mobilization
protocols. In the patients who had mobilization failure in the first
trial, plerixafor was used in a later mobilization, and those patients
had an adequate amount of stem cells for ASCT. Parameters predicting
mobilization failure would allow for preemptive, more cost-effective
use of such agents during the first mobilization attempt; however, risk
factors for mobilization failure are still not clear.
Keywords: Hodgkin lymphoma, Non-Hodgkin lymphoma, Stem cell
mobilization, Mobilization failure
Öz
Amaç: Otolog kök hücre transplantasyonu (OKHT), relaps/refrakter
lenfoma hastaları için önemli ve potansiyel olarak küratif bir
tedavi yöntemidir. Yetersiz mobilizasyon ve periferik kök hücrelerin
toplanması OKHT’nin gerçekleştirilmesi için büyük bir engel olabilir.
Bu çalışmanın amacı lenfoma hastalarında mobilizasyon başarısızlığını
etkileyebilecek faktörleri değerlendirmektir.
Gereç ve Yöntemler: Hacettepe Üniversitesi Tıp Fakültesi Kemik İliği
Nakil Merkezi’nde 2000-2018 yılları arasında Hodgkin ve non-Hodgkin
lenfoma tanısı alan ve sonrasında kök hücre mobilizasyonu yapılan 87
hasta değerlendirildi.
Bulgular: Bu çalışmaya toplam 87 hasta dahil edildi. Seksen yedi
hastanın 66’sında (%75,9) ilk mobilizasyon denemesi başarılı oldu.
66 hastada (9,5±8,1) ilk aferezde yeterli (≥2x106/kg) CD34+ hücre
toplandı. Seksen yedi kişiden 21’i (%24,1) için ilk mobilizasyon
denemesi başarısız oldu. Bu nedenle bu hastalara pleriksafor ile
(5,5±3,3) ikinci bir mobilizasyon denemesi yapıldı. İlk mobilizasyonda
başarılı olan hastalarda CD34+ hücre sayısı anlamlı olarak yüksekti
(p=0,002).
Sonuç: Mobilizasyon öncesi trombosit sayısı yüksek olan hastalarda
ve kemoterapi bazlı mobilizasyon protokolleri alan hastalarda ilk
mobilizasyon denemesinin başarı oranı daha yüksek bulundu. İlk
denemede mobilizasyon başarısızlığı olan hastalarda daha sonraki
mobilizasyonda pleriksafor kullanılmış ve bu hastalarda OKHT için
yeterli miktarda kök hücre mevcuttu. Mobilizasyon başarısızlığını
öngören parametreler, ilk mobilizasyon girişimi sırasında bu tür
ajanların önleyici, daha uygun maliyetli kullanımına izin verecektir;
ancak, mobilizasyon başarısızlığı için risk faktörleri hala net değildir.
Anahtar Sözcükler: Hodgkin lymphoma, Non-Hodgkin lymphoma,
Kök hücre mobilizasyonu, Mobilizasyon başarısızlığı
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Hakan Göker, M.D., Hacettepe University Faculty of Medicine,
Departments of Hematology, Ankara, Turkey
Phone : +90 312 305 30 50
E-mail : hgoker1@gmail.com ORCID: orcid.org/0000-0002-1039-7756
Received/Geliş tarihi: July 16, 2020
Accepted/Kabul tarihi: November 4, 2020
204
Turk J Hematol 2021;38:204-210
Demiroğlu H. et al: Prediction of Stem Cell Mobilization Failure in Patients with Hodgkin and Non-Hodgkin Lymphoma
Introduction
Autologous stem cell transplantation (ASCT) is a significant
and potentially curative treatment modality for patients with
relapsed/refractory lymphoma. However, 5%-40% of lymphoma
patients fail to mobilize sufficient peripheral blood stem cells
and thus cannot undergo ASCT, which is known to improve
survival [1]. Hematopoietic stem cells generally circulate in very
small numbers in the peripheral blood and have to be mobilized
into the circulation prior to being collected by apheresis.
Peripheral blood stem cell (PBSC) mobilization is accomplished
by administration of granulocyte colony-stimulating factor
(G-CSF) alone or in combination with chemotherapy [2].
Peripheral blood has been shown to be superior to bone marrow
as a source of hematopoietic stem cells for ASCT [3]. Insufficient
mobilization and harvest of peripheral stem cells can be a
major obstacle for performing ASCT. Currently, a minimum of
2x10 6 CD34+ cells/kg hematopoietic stem cells is considered
appropriate in most centers to proceed to ASCT. This threshold
is necessary for a rapid and sustained blood count recovery and
for reduced hospitalization, blood product usage, and infections
[4]. However, the optimal hematopoietic stem cell dose is about
5x10 6 /kg [5]. Bone marrow infiltration, advanced age, number
of prior cytotoxic therapies, and myelodysplastic changes
are the best defined factors associated with increased risk of
mobilization failure [6,7].
We have collected and analyzed data from a series of non-
Hodgkin and Hodgkin lymphoma patients who received ASCT
in order to determine the frequency of harvest failure and
to identify factors influencing PBSC mobilization outcomes.
The aim of this study was to evaluate the factors that might
influence mobilization failure in patients with lymphoma.
Materials and Methods
Study Design and Data Collection
This study was performed in a retrospective manner.
Demographic data of the patients, treatment regimens, and
stem cell mobilization data updates were obtained from the
hospital database. As a result of the application standards of
the hospitals of the Hacettepe University Medical School Bone
Marrow Transplantation Center, Turkey, it has been recognized
from the patient records that all of the studied patients had given
informed consent at the time of hospitalization and before the
administration of chemotherapy and other relevant diagnostic/
therapeutic standards of care. Patients gave informed consent
for procedures in accordance with the Declaration of Helsinki.
Patients and Disease Characteristics
Eighty-seven patients diagnosed with non-Hodgkin and Hodgkin
lymphoma who underwent stem cell mobilization afterwards
at the Hacettepe University Medical School Bone Marrow
Transplantation Center between the years of 2000 and 2018
were evaluated. The key inclusion criteria were patients ≥18
years of age diagnosed with non-Hodgkin or Hodgkin lymphoma
who required systemic chemotherapy and underwent ASCT
with Eastern Cooperative Oncology Group (ECOG) performance
status (PS) of <2 [8] with an indication for ASCT.
Median age, gender, ECOG PS, lymphoma subtypes, stage at
diagnosis, bone marrow infiltration at diagnosis, induction
chemotherapy, salvage chemotherapy, chemotherapy cycles
received before mobilization, radiotherapy before mobilization,
platelet count before mobilization, mobilization protocols, and
disease status before ASCT were compared for patients who
had successful stem cell mobilization and those with stem cell
mobilization failure. Additionally, disease status after ASCT, relapse
rate, and mortality results were evaluated between these groups.
The target CD34+ cell dose for collection was >2x10 6 /kg for each
planned autograft. All patients received G-CSF at a dose of 10 µg/
kg from day +5 until the peripheral stem cell harvest. CD34+ cells
were measured in peripheral blood and apheresis products by flow
cytometry. We had a CD34+ cut-off level of 20 µL for starting
apheresis. We harvested the cells on the 5 th and/or 6 th day after
beginning G-CSF administration. Peripheral blood CD34% and
CD34/µL values at the first day on which leukocytes reached the
value of 1x10 9 /L and were maintained above that threshold over
at least 2 days were correlated with overall CD34+ collection. A
harvest of less than 2x10 6 CD34+/kg was considered as mobilization
failure. Twenty-one patients received plerixafor as an additional
mobilizing agent for the second apheresis. Subcutaneous plerixafor
(0.24 mg/kg) was administered to the patients on the evenings of
the 4 th and 5 th days of the mobilization protocol.
Statistical Analysis
Statistical analyses were performed using SPSS 25 (IBM
Corp., Armonk, NY, USA). Variables were investigated
using visual (histograms, probability plots) and analytical
(Kolmogorov-Smirnov/Shapiro-Wilk test) methods to determine
whether they were normally distributed or not. Statistical
comparisons were made using chi-square tests for categorical
data. Student’s t-test for two independent samples was used
for comparison of continuous numerical data. Variables found
to be significant (p<0.05) in univariate analysis were tested in
multivariate analysis, which was performed using a stepwise
logistic regression model. Survival analyses were performed
using the Kaplan-Meier test with log rank. Values of p<0.05
were considered statistically significant.
Results
Patient Characteristics
A total of 87 patients were included in this study. The median
age was 48 (range: 18-70) years at the time of diagnosis.
205
Demiroğlu H. et al: Prediction of Stem Cell Mobilization Failure in Patients with Hodgkin and Non-Hodgkin Lymphoma
Turk J Hematol 2021;38:204-210
The baseline clinical and demographic characteristics of
the patients are listed in Table 1. For 66 of 87 patients
(75.9%), the first mobilization trial was successful. Adequate
(≥2x10 6 /kg) CD34+ cells were collected in the first apheresis for
66 patients (9.5±8.1). For 21 of 87 (24.1%), the first mobilization
trial was unsuccessful. Therefore, a second mobilization trial
was conducted for these patients with plerixafor (5.5±3.3). The
number of CD34+ cells was significantly higher in patients who
Table 1. Baseline clinical and demographic characteristics of patients.
Parameters
206
Patients who had successful stem
cell mobilization
N (%) 66 (75.9%) 21 (24.1%)
Patients who had stem cell
mobilization failure*
Male/female (%) 38/28 (57.6%/42.4%) 15/6 (71.4%/28.6%) 0.25
Median age at diagnosis (range), years 48 (18-70) 53 (18-66) 0.07
ECOG PS 0/1/2 2/49/15 (3%/74.2%/22.7%) 0/16/5 (0%/76.2%/23.8%) 0.72
Type of lymphoma 0.45
Hodgkin lymphoma (HL) 18 (27.3%) 4 (19.0%)
Nodular sclerosis classical HL 13 (19.7%) 3 (14.3%)
Mixed cellularity classical HL 4 (6.1%) 1 (4.8%)
Lymphocyte depleted classical HL 1 (1.5%) 0
Non-Hodgkin lymphoma 48 (72.7%) 17 (81.0%)
Diffuse large B-cell lymphoma 28 (42.4%) 9 (42.9%)
Mantle cell lymphoma 9 (13.6%) 3 (14.3%)
Follicular lymphoma 4 (6.1%) 1 (4.8%)
Burkitt lymphoma 2 (3%) 0
Peripheral T-cell lymphoma 4 (6.1%) 1 (4.8%)
Angioimmunoblastic T-cell lymphoma 0 1 (4.8%)
Hepatosplenic T-cell lymphoma 1 (1.5%) 0
Stage at diagnosis
I/II/III/IV
0/11/21/34
0%/16.7%/31.8%/51.5%
0/3/5/13
0%/14.3%/23.8%/61.9%
Bone marrow infiltration at diagnosis 25 (37.9%) 11 (52.4%) 0.24
Induction chemotherapy 0.51
ABVD 18 (27.3%) 5 (23.8%)
CHOEP 3 (4.5%) 3 (14.3%)
CHOP 35 (53.0%) 12 (57.1%)
MPV 4 (6.1%) 0
EPOCH 0 0
CHOP/DHAP 2 (3%) 0
H-MTX-ARA-C 4 (6.1%) 1 (4.8%)
Rescue chemotherapy 0.49
ICE 42 (70.0%) 12 (66.7%)
DHAP 5 (8.3%) 4 (22.2%)
MPV 3 (5%) 0
GDP 1 (1.7%) 1 (5.6%)
H-MTX-ARA-C 3 (5.0%) 1 (5.6%)
BEACOPP 3 (5.0%) 0
Mobilization in first-line therapy 6 (9.1%) 3 (14.3%) 0.49
Mobilization after rescue therapy 60 (90.6%) 18 (85.7%) 0.49
Radiotherapy 21 (31.8%) 4 (19%) 0.26
Chemotherapy cycles before stem cell mobilization 10 (5-17) 10 (6-18) 0.78
Disease status before ASCT [9] 0.95
CR 27 (40.9%) 8 (38.1%)
p
0.69
Turk J Hematol 2021;38:204-210
Demiroğlu H. et al: Prediction of Stem Cell Mobilization Failure in Patients with Hodgkin and Non-Hodgkin Lymphoma
Table 1. Continued
Parameters
Patients who had successful stem
cell mobilization
PR 28 (42.4%) 10 (47.6%)
Stable disease 5 (7.6%) 1 (4.8%)
Progressive disease 6 (9.1%) 2 (9.5%)
Patients who had stem cell
mobilization failure*
Platelet count before mobilization (x10 9 /L) 258 (78-650) 120 (48-470) 0.041
CD 34+ cells, 106/kg (mean ± SD) 9.5±8.1 5.5±3.3 0.002
Mobilization protocol 0.20
Filgrastim 43 (65.2%) 18 (85.7%)
Lenograstim 2 (3%) 1 (4.8%)
Filgrastim + ICE 13 (19.7%) 2 (9.5%)
Filgrastim + cyclophosphamide 8 (12.1%) 0
ASCT: Autologous stem cell transplantation; CR: complete response; G-CSF: granulocyte colony-stimulating factor; PR: partial response. *: Twenty-one patients received plerixafor as
an additional mobilizing agent for second apheresis.
p
were successful in the first mobilization (p=0.002). There were
no differences in hematocrit at the time point of apheresis.
Between the two groups, there was no statistically significant
gender (p=0.25) or age (p=0.07) difference. There was no
significant difference between the ECOG PS of the patients
(p=0.72). No significant difference was found between the
groups in terms of lymphoma types (p=0.45). Number of
chemotherapy cycles before stem cell mobilization was not
statistically significantly different between patients who had
mobilization failure and patients who had successful stem cell
mobilization (p=0.78). The stages of both groups were similar
at the time of diagnosis (p=0.69). There was no significant
difference between bone marrow infiltration at diagnosis
(p=0.24). There was no significant difference between the groups
in terms of induction chemotherapy protocols (p=0.51). Platelet
count before mobilization was higher in patients who had
successful stem cell mobilization than in patients who had stem
cell mobilization failure (p=0.041). After relapse, no significant
difference was found between rescue chemotherapies given
before mobilization (p=0.49). Disease status before ASCT was
complete response (CR) in 27 (40.9%) patients, partial response
(PR) in 28 (42.4%) patients, stable disease in 5 (7.6%) patients,
and progressive disease in 6 (9.1%) patients in the successful
mobilization group. Disease status before ASCT was CR in
8 (38.1%) patients, PR in 10 (47.6%) patients, stable disease in
1 (4.8%) patient, and progressive disease in 2 (9.5%) patients
in the stem cell mobilization failure group for the first trial
(p=0.95). The use of filgrastim or lenograstim as G-CSF did not
affect mobilization success. There was no significant difference
between the two groups in terms of filgrastim or lenograstim
mobilization (p=0.20). However, when the patients who received
only G-CSF or a chemotherapy-based mobilization protocol
were evaluated, 19 (29.7%) of the patients who were mobilized
with only G-CSF had mobilization failure, while only 2 (8.7%)
patients who received a chemotherapy-based mobilization
protocol had mobilization failure (p=0.04). This shows the
superiority of chemotherapy-based mobilization.
Post-transplant Outcomes
All of the patients finally underwent ASCT. Remarkably,
disease status after ASCT (on day +100) was CR in 38 (61.3%)
patients, PR in 1 (1.6%) patients, stable disease in 20 (32.3%)
patients, and progressive disease in 3 (4.8%) patients in the
successful mobilization group. Disease status after ASCT (on
day +100) was CR in 13 (65%) patients, PR in 5 (5%) patients,
stable disease in 4 (20%) patients, and progressive disease in
2 (10%) patients in the stem cell mobilization failure group
for the first trial, as shown in Table 2. The relapse rate was
significantly higher in patients who had stem cell mobilization
failure than in those with successful stem cell mobilization
(47.6% vs. 21.2%, p=0.01). Moreover, the mortality rate
was significantly higher among patients who had stem cell
mobilization failure than those with successful stem cell
mobilization (38.1% vs. 16.7%, p=0.01).
Overall Survival
The overall survival (OS) rate for patients who had successful
stem cell mobilization was 151.6±9.3 months versus 71.4±7.8
months for patients with stem cell mobilization failure for
the first trial; this was a statistically significant difference, as
shown in Figure 1 (p=0.02). The 3-year OS rates for patients
with successful stem cell mobilization and those with stem
cell mobilization failure for the first trial were 85% and 79%,
respectively. The 5-year OS rates for patients with successful
stem cell mobilization and stem cell mobilization failure for
the first trial were 81% and 63%, respectively. OS was better in
patients with lymphoma for whom the first mobilization trial
was successful.
The disease-free survival (DFS) rate for patients who had
successful stem cell mobilization was 111.9±10.6 months versus
207
Demiroğlu H. et al: Prediction of Stem Cell Mobilization Failure in Patients with Hodgkin and Non-Hodgkin Lymphoma
Turk J Hematol 2021;38:204-210
57.6±6.4 months for patients who had stem cell mobilization
failure for the first trial; this was a statistically significant
difference, as shown in Figure 2 (p=0.004). The 3-year DFS rates
for patients with successful stem cell mobilization and those
with stem cell mobilization failure for the first trial were 82%
and 74%, respectively. The 5-year DFS rates for patients with
successful stem cell mobilization and stem cell mobilization
failure for the first trial were 68% and 44%, respectively.
Discussion
Stem cell mobilization is still difficult in a significant proportion
of patients with lymphoma and the factors predicting poor
mobilization are still not fully explained. An obvious reason for
these difficulties might be the fact that previous studies have
been heterogeneous concerning diagnosis, prior therapy, and
mobilization regimen used [7]. The frequency of mobilization
failure was 24.1% in the first mobilization in this study,
Table 2. Post-transplantation outcomes.
Parameters
Patients who had successful stem
cell mobilization
Patients with stem cell
mobilization failure*
Disease status after ASCT [9] 0.53
CR 38 (61.3%) 13 (65.0%)
PR 1 (1.6%) 5 (5.0%)
Stable disease 20 (32.3%) 4 (20.0%)
Progressive disease 3 (4.8%) 2 (10.0%)
Relapse (%) 14 (21.2%) 10 (47.6%) 0.01
Mortality (%) 11 (16.7%) 9 (42.9%) 0.01
ASCT: Autologous stem cell transplantation; CR: complete response; PR: partial response. *: Twenty-one patients received plerixafor as an additional mobilizing agent for second
apheresis.
p
Figure 1. Overall survival (OS) of patients who had successful stem
cell mobilization and patients who had stem cell mobilization
failure (p=0.02).
Figure 2. Disease-free survival (DFS) of patients who had
successful stem cell mobilization and patients who had stem cell
mobilization failure (p=0.004).
208
Turk J Hematol 2021;38:204-210
Demiroğlu H. et al: Prediction of Stem Cell Mobilization Failure in Patients with Hodgkin and Non-Hodgkin Lymphoma
but no factor was detected in analysis that would cause
mobilization failure in these lymphoma patients. No statistically
significant difference was found between age, sex, stage of
diagnosis, ECOG PS, bone marrow infiltration at diagnosis,
induction chemotherapy, chemotherapy cycles before stem cell
mobilization, disease status before ASCT, receiving radiotherapy
before mobilization, lymphoma types, or mobilization regimen
in the two groups. On the other hand, OS and DFS were
significantly longer in the group with successful mobilization in
the first trial. It was observed that survival outcomes were worse
in patients who needed plerixafor for mobilization. However, it
was thought that the worse survival outcomes might have been
due to the poor bone marrow reserve and disease status before
ASCT in patients who needed plerixafor for mobilization.
For successful ASCT, one of the most important factors is to
mobilize sufficient numbers of CD34+ cells. In this study, the
cut-off value of 2x10 6 CD34+ cells/kg body weight was
determined as the target for a successful mobilization procedure.
It can be thought that the necessity of using plerixafor can be
predicted according to the number of peripheral CD34 cells.
CD34 cell count on apheresis day was reported to be the best
predictor of mobilization failure [10]. Additionally, CD34 cell
count was suggestive of preemptive plerixafor use and the
authors suggested a low level of CD34+ in peripheral blood
on day +13 as a possible criterion for initiating plerixafor
administration [11]. In this study, the number of CD34+ cells of
the apheresis product was observed to be significantly higher in
patients who were successful in the first mobilization.
Recent studies reported that the incidence of mobilization failure
in lymphoma was as high as 46% [12,13,14]. Variables already
reported to be associated with mobilization failure include
age, body weight, diagnosis, type of lymphoma and dose of
chemotherapy, extent of cell recovery from chemotherapy, bone
marrow involvement of lymphoma cells, prior radiation therapy,
and interval from diagnosis to mobilization [12,13,14,15]. On the
other hand, some hematological parameters such as cytopenia
at any stage of mobilization, high mean corpuscular volume,
long myelosuppression between salvage chemotherapies, and
poor bone marrow microenvironment can predict mobilization
failure. Özkurt et al. [16] reported that the CD34+ cell count of
the first apheresis product was positively correlated with the
white blood cell count, platelet count, peripheral CD34+ cell
count, and grade of bone marrow reticulin fibrosis. In this study,
chemotherapy-based mobilization was seen to be superior to
G-CSF mobilization. Additionally, the platelet count before
mobilization was higher in patients who had successful stem
cell mobilization than in patients with stem cell mobilization
failure. Apart from these two prognostic factors, none of
the patient or disease characteristics that we analyzed were
associated with mobilization failure. Prognostic factors such
as patient characteristics (age, gender, diagnosis, bone marrow
involvement, previous number of chemotherapy lines, previous
radiotherapy) were also not found to be associated with
mobilization failure in previous clinical studies [12,14].
It is not clear whether patients with treatment efficiency may
be best mobilized by higher doses of chemotherapy and/or
G-CSF. Previously, some studies demonstrated the superiority of
chemotherapy plus growth factors over growth factors alone
for mobilization [6,17,18]. On the other hand, Pusic et al. [17]
found similar rates of mobilization failure with chemotherapy
plus growth factors and only growth factor. Additionally, André
et al. [19] found no significant difference in CD341 cell harvest
yields among 131 patients randomized to receive 5 or 10 µg/
kg/day of G-CSF following mobilization chemotherapy. In our
study, it was observed that mobilization regime did not affect
mobilization failure. However, when the patients who received
only G-CSF and those who received a chemotherapy-based
mobilization protocol were evaluated, chemotherapy-based
mobilization was superior.
Conclusion
In this study, the success rate of the first mobilization trial was
found to be higher in patients with high platelet counts before
mobilization and in patients who received chemotherapy-based
mobilization protocols. This study had a few limitations. First,
it was retrospective. Second, all patients did not receive the
same induction chemotherapy before mobilization. Third, the
diagnoses of the patients were very heterogeneous. For the
patients who had mobilization failure in the first trial, plerixafor
was used in a later mobilization, and those patients then had an
adequate amount of stem cells for ASCT. Parameters predicting
mobilization failure would allow for a preemptive, more
cost-effective use of such agents during the first mobilization
attempt. However, the risk factors for mobilization failure are
still not clear.
Ethics
Ethics Committee Approval: All ethical considerations were
strictly followed in accordance with the 1964 Declaration of
Helsinki. As standard care/action of the hospitals of the Hacettepe
University Medical School Bone Marrow Transplantation Center,
Turkey, it has been recognized from the patient records that all
of the studied patients had given informed consent at the time
of hospitalization and before the administration of relevant
diagnostic/therapeutic standards of care.
Informed Consent: Obtained.
Authorship Contributions
Surgical and Medical Practices: H.G.; Concept: H.D.; Design: H.D.;
Data Collection or Processing: R.Ç.; Analysis or Interpretation:
R.Ç.; Literature Search: Y.B.; Writing: R.Ç.
209
Demiroğlu H. et al: Prediction of Stem Cell Mobilization Failure in Patients with Hodgkin and Non-Hodgkin Lymphoma
Turk J Hematol 2021;38:204-210
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Sheppard D, Bredeson C, Allan D, Tay J. Systematic review of randomized
controlled trials of hematopoietic stem cell mobilization strategies for
autologous transplantation for hematologic malignancies. Biol Blood
Marrow Transplant 2012;18:1191-1203.
2. Van Gorkom G, Finel H, Giebel S, Pohlreich D, Shimoni A, Ringhoffer
M, Sucak G, Schaap N, Dreger P, Sureda A, Schouten HC. Prospective
noninterventional study on peripheral blood stem cell mobilization in
patients with relapsed lymphomas. J Clin Apher 2017;32:295-301.
3. Siena S, Schiavo R, Pedrazzoli P, Carlo-Stella C. Therapeutic relevance of
CD34 cell dose in blood cell transplantation for cancer therapy. J Clin Oncol
2000;18:1360-1377.
4. To LB, Levesque JP, Herbert KE. How I treat patients who mobilize
hematopoietic stem cells poorly. Blood 2011;118:4530-4540.
5. Allan DS, Keeney M, Howson-Jan K, Popma J, Weir K, Bhatia M, Sutherland
DR, Chin-Yee IH. Number of viable CD34+ cells reinfused predicts
engraftment in autologous hematopoietic stem cell transplantation. Bone
Marrow Transplant 2002;29:967-972.
6. Mendrone A Jr, Arrais CA, Saboya R, de Alencar Fischer Chamone D, Dulley
FL. Factors affecting hematopoietic progenitor cell mobilization: an analysis
of 307 patients. Transfus Apher Sci 2008;39:187-192.
7. Kuittinen T, Nousiainen T, Halonen P, Mahlamäki E, Jantunen E. Prediction
of mobilisation failure in patients with non-Hodgkin’s lymphoma. Bone
Marrow Transplant 2004;33:907-912.
8. Oken MM, Creech RH, Tormey DC, Horton J, Davis TE, McFadden ET, Carbone
PP. Toxicity and response criteria of the Eastern Cooperative Oncology
Group. Am J Clin Oncol1982;5:649-656.
9. Cheson BD, Fisher RI, Barrington SF, Cavalli F, Schwartz LH, Zucca E, Lister TA;
Alliance, Australasian Leukaemia and Lymphoma Group; Eastern Cooperative
Oncology Group; European Mantle Cell Lymphoma Consortium; Italian
Lymphoma Foundation; European Organisation for Research; Treatment of
Cancer/Dutch Hemato-Oncology Group; Grupo Español de Médula Ósea;
German High-Grade Lymphoma Study Group; German Hodgkin’s Study
Group; Japanese Lymphorra Study Group; Lymphoma Study Association;
NCIC Clinical Trials Group; Nordic Lymphoma Study Group; Southwest
Oncology Group; United Kingdom National Cancer Research Institute.
Recommendations for initial evaluation, staging, and response assessment
of Hodgkin and non-Hodgkin lymphoma: the Lugano classification. J Clin
Oncol 2014;32:3059-3068.
10. Ford C, Chan K, Reilly W, Petersen F. An evaluation of predictive factors for
CD34+ cell harvest yields from patients mobilized with chemotherapy and
growth factors. Transfusion 2003;43:622-625.
11. Milone G, Tripepi G, Martino M, Ancora F, Bartolozzi B, Spadaro A, Nozzoli C,
La Fauci A, Amico I, Leotta S, Poidomani M, Irrera G, Iacopino P, Saccardi R,
Guidi S, Bosi A. Early measurement of CD34+ cells in peripheral blood after
cyclophosphamide and granulocyte colony-stimulating factor treatment
predicts later CD34+ mobilisation failure and is a possible criterion for
guiding “on demand” use of plerixafor. Blood Transfus 2013;11:94-101.
12. Hosing C, Saliba RM, Ahlawat S, Körbling M, Kebriaei P, Alousi A, De Lima
M, Okoroji JG, McMannis J, Qazilbash M, Anderlini P, Giralt S, Champlin
RE, Khouri I, Popat U. Poor hematopoietic stem cell mobilizers: a single
institution study of incidence and risk factors in patients with recurrent or
relapsed lymphoma. Am J Hematol 2009;84:335-337.
13. Rossi G, Skert C, Morello E, Almici C, Arcaini L, Basilico C, Cavalli L, Botto B,
Castelli A, Pica G, Ripamonti F, Salvi F, Carella AM, Gaidano G, Levis A, Nosari
A, Russo D, Vitolo U. PBSC mobilization in lymphoma patients: analysis of risk
factors for collection failure and development of a predictive score based
on the kinetics of circulating CD34+ cells and WBC after chemotherapy and
G-CSF mobilization. Hematol Oncol 2015;33:125-132.
14. 14. Wuchter P, Ran D, Bruckner T, Schmitt T, Witzens-Harig M, Neben K,
Goldschmidt H, Ho AD. Poor mobilization of hematopoietic stem cells—
definitions, incidence, risk factors, and impact on outcome of autologous
transplantation. Biol Blood Marrow Transplant 2010;16:490-499.
15. Tarella C, Di Nicola M, Caracciolo D, Zallio F, Cuttica A, Omede P, Bondesan
P, Magni M, Matteucci P, Gallamini A, Pileri A, Gianni AM. High-dose ara-C
with autologous peripheral blood progenitor cell support induces a marked
progenitor cell mobilization: an indication for patients at risk for low
mobilization. Bone Marrow Transplant 2002;30:725-732.
16. Özkurt ZN, Yeğin ZA, Suyanı E, Akı ŞZ, Acar K, Yağcı M, Türköz Sucak G.
Factors affecting stem cell mobilization for autologous hematopoietic stem
cell transplantation. J Clin Apher 2010;25:280-286.
17. Pusic I, Jiang SY, Landua S, Uy GL, Rettig MP, Cashen AF, Westervelt P, Vij R,
Abboud CN, Stockerl-Goldstein KE, Sempek DS, Smith AL, DiPersio JF. Impact
of mobilization and remobilization strategies on achieving sufficient stem
cell yields for autologous transplantation. Biol Blood Marrow Transplant
2008;14:1045-1056.
18. Fruehauf S, Seggewiss R. It’s moving day: factors affecting peripheral
blood stem mobilization and strategies for improvement. Br J Haematol
2003;122:360-375.
19. André M, Baudoux E, Bron D, Canon JL, D’Hondt V, Fassotte MF, D’Hondt L,
Fillet G, Humblet Y, Jerusalem G, Vermeulen P, Symann M, Beguin Y. Phase
III randomized study comparing 5 or 10 µg per kg per day of filgrastim
for mobilization of peripheral blood progenitor cells with chemotherapy,
followed by intensification and autologous transplantation in patients with
nonmyeloid malignancies. Transfusion 2003;43:50-57.
210
Mersin S. et al: Evaluation of a Generic Bortezomib Molecule in Newly Diagnosed Multiple Myeloma Patients
RESEARCH ARTICLE
DOI: 10.4274/tjh.galenos.2021.2020.0555
Turk J Hematol 2021;38:211-217
Evaluation of a Generic Bortezomib Molecule in Newly Diagnosed
Multiple Myeloma Patients
Yeni Tanı Multipl Myelom Hastalarında Eşdeğer Bortezomib Molekülünün Değerlendirilmesi
Sinan Mersin, Ayfer Gedük, Özgür Mehtap, Pınar Tarkun, Serkan Ünal, Merve Gökçen Polat, Kemal Aygün,
Emel Merve Yenihayat, Hayrunnisa Albayrak, Abdullah Hacıhanefioğlu
Kocaeli University Faculty of Medicine, Department of Hematology, Kocaeli, Turkey
Abstract
Objective: Constantly increasing health expenditures lead to the use
of generic molecules and generic versions of bortezomib have been
used for a long time. The aim of this study is to retrospectively examine
the effectiveness, side effects, and reliability of generic bortezomib in
newly diagnosed multiple myeloma (MM) patients.
Materials and Methods: The data of 95 patients who received four
cycles of bortezomib as first- or second-line therapy in a single center
were retrospectively recorded. Treatment responses, side effects, and
progression-free survival (PFS) rates were calculated and compared.
Results: Of the 95 patients, 42 used the original and 53 used the
generic molecule. Epidemiological data, MM types, genetic risk
groups, laboratory values at diagnosis, and bortezomib treatment lines
(as a first line or second) were evaluated and there was no statistical
difference between the two groups. When the response rates were
evaluated according to International Myeloma Working Group criteria,
there was no significant difference (p=0.42). Rates of partial response
and higher responses were similar (81% vs. 79.2%, p=0.84). PFS rates
were 42.8 months with the original and 37.8 months with the generic
molecule (p=0.68). Side effects were seen in 44.2% of all patients,
and the most common side effects were neuropathy, cytopenia, and
infection. These rates were similar in the two groups (p=0.55).
Conclusion: Although this retrospective study is limited in scope, it is
the first study comparing the original molecule of bortezomib with a
generic version. There were no statistical differences between the two
groups in terms of treatment responses, PFS, or side effects. However,
large-scale evaluations will help obtain more data on this subject.
Keywords: Bortezomib, Multiple myeloma, Equivalent
Öz
Amaç: Sürekli artan sağlık harcamaları jenerik moleküllerin
kullanımına yol açmaktadır ve bortezomibin jenerik molekülleri uzun
süredir kullanılmaktadır. Bu çalışmanın amacı, yeni tanı konmuş
multipl myelom (MM) hastalarında jenerik bortezomibin etkinliğini,
yan etkilerini ve güvenilirliğini retrospektif olarak incelemektir.
Gereç ve Yöntemler: Tek merkezli çalışmamızda birinci veya ikinci
basamak tedavide dört kür bortezomib alan 95 hastanın verileri geriye
dönük olarak incelendi. Tedavi yanıtları, yan etkiler ve progresyonsuz
sağkalım (PFS) oranları hesaplandı ve karşılaştırıldı.
Bulgular: Doksan beş hastanın 42’si orijinal molekülü, 53’ü eşdeğer
molekülü kullanmıştır. Epidemiyolojik veriler, MM tipleri, genetik risk
grupları, tanı anındaki laboratuvar değerleri ve bortezomib tedavi
sıraları (birinci sıra veya ikinci sıra olarak) değerlendirildiğinde iki grup
arasında istatistiksel fark olmadığı izlendi. Uluslararası Myelom Çalışma
Grubu kriterlerine göre yanıt oranları değerlendirildiğinde anlamlı bir
fark bulunmadı (p=0,42). Kısmi yanıt ve daha yüksek yanıt oranları
benzerdi (%81’e karşı %79,2, p=0,84). PFS süreleri orijinal molekül için
42,8 ay ve eşdeğer molekül için 37,8 ay olarak hesaplandı (p=0,68).
Yan etkiler tüm hastaların %44,2’sinde görüldü ve en sık görülen yan
etkiler nöropati, sitopeni ve enfeksiyondu. Bu yan etkilerin görülme
oranları iki grupta benzerdi (p=0,55).
Sonuç: Bu retrospektif çalışma, kapsamı sınırlı olmakla birlikte, orijinal
bortezomib molekülünü eşdeğeri ile karşılaştıran ilk çalışmadır. Tedavi
yanıtları, PFS veya yan etkiler açısından iki grup arasında istatistiksel
fark izlenmemiştir. Ancak geniş çaplı değerlendirmeler bu konuda
daha fazla veri elde edilmesine yardımcı olacaktır.
Anahtar Sözcükler: Bortezomib, Multipl myelom, Eşdeğer
Introduction
Multiple myeloma (MM) is a plasma cell dyscrasia that
constitutes 14% of all hematological malignancies and 20%
of mortality due to hematological malignancies. It has no cure
with current treatment options. In a study examining the global
data of 2016, it was shown that the total incidence of MM was
2.1 per 100000 (95% UI: 1.8-2.3) and that 1.5 per 100000 (95%
UI: 1.3-1.7) total deaths were associated with myeloma [1]. The
incidence has increased over the past 30 years [2,3].
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Sinan Mersin, M.D., Kocaeli University Faculty of Medicine,
Department of Hematology, Kocaeli, Turkey
Phone : +90 505 828 64 38
E-mail : sinanmersin86@msn.com ORCID: orcid.org/0000-0001-7588-6000
Received/Geliş tarihi: September 9, 2020
Accepted/Kabul tarihi: May 3, 2021
211
Mersin S. et al: Evaluation of a Generic Bortezomib Molecule in Newly Diagnosed Multiple Myeloma Patients
Turk J Hematol 2021;38:211-217
Proteasome is the main extra lysosomal system of cells and
inhibition of this system causes cell cycle arrest and apoptosis
mainly in neoplastic cells. Proteasome inhibitors are mainly
used for myeloma and lymphoma, and bortezomib was the first
one to be used. Although patients became refractory to this
treatment after a while, it is still used in the first line of myeloma
treatment [4,5,6]. In recent years, new proteasome inhibitors
such as carfilzomib and ixazomib have been developed and they
are used for these relapsed/refractory MM patients with better
treatment response rates [7].
In optimal treatment approaches for newly diagnosed patients,
besides good efficiency and reliability, the cost balance should
also be taken into account. Overall health expenditures for
MM continue to increase with the increase in incidence as well
as the costs of new treatments [3]. Because of this increase,
the development of generic drugs has become necessary and
patients have had to use these generic molecules because of the
price differences. However, the use of generic molecules initially
creates concerns among physicians in terms of effectiveness
and side effects. We planned this study in order to eliminate this
uncertainty. Bortezomib has more than 70 generic versions in
use and 4 of them have been used here in Turkey. In our center,
Borcade is used as a generic, and in this study, we compared this
molecule with the original one (Velcade) [4,8].
Materials and Methods
The files of 340 patients diagnosed with MM between 2011
and 2019 in a single center were retrospectively scanned.
Ninety-five patients had received only original (Velcade) or only
generic (Borcade) bortezomib treatment for at least 4 cycles
in the first or second line of therapy with cyclophosphamide
and dexamethasone. VCD therapy was selected rather than
VTD (bortezomib, thalidomide, and dexamethasone therapy)
mainly because of the reimbursement rules of the country.
Original molecule users used bortezomib between March 2011
and March 2017 while generic molecule users used it between
May 2015 and February 2019. Of the 95 patients included in the
study, 42 used the original molecule and 53 used the generic
molecule. Patients who received both original and generic
molecules, who received more than one generic molecule,
who received bortezomib as a third line of treatment, or who
received bortezomib after autologous stem cell transplantation
or relapse were excluded from the study.
International Myeloma Working Group (IMWG) diagnostic
criteria were applied in the diagnosis of patients while
International Staging System criteria were used for staging and
genetic risk factors were also considered according to IMWG
criteria [9]. Routine laboratory analysis, radiological imaging,
and positron emission tomography/computed tomography
examinations of the patients were performed in our hospital’s
central laboratory, radiology department, and nuclear medicine
units, respectively. IMWG response criteria were also used in
post-treatment response evaluations. Consent was obtained
from the ethics committee of our hospital for the analysis of
patient files.
After recording the demographic characteristics of our patients,
M protein levels at diagnosis, MM types, disease stages, genetic
risk groups, extramedullary involvement and lytic lesions in the
bones, laboratory values at the time of diagnosis, and the first
treatments received before bortezomib-cyclophosphamidedexamethasone
(VCD) therapy, if any, were recorded. After
receiving VCD treatment for 4 cycles, response evaluations were
performed for all patients. Some of the patients who responded
to treatment underwent transplantation immediately, while
some underwent autologous stem cell transplant (ASCT) after
continuing the same treatment. This was due to ASCT availability
at the time of treatment and treatment being continued to
maintain the response rates. Patients who could not undergo
ASCT were followed. A small number of patients with or
without ASCT received maintenance lenalidomide therapy
(10 mg/day for 21 days in a 28-day period as the standard in both
groups). The recurrence dates of these patients were recorded
for both groups and progression-free survival (PFS) times were
calculated. Hematological and non-hematological side effects
occurring during treatment were rated and recorded according
to the latest National Cancer Institute Common Terminology
Criteria for Adverse Events (CTCAE) [10].
Statistical Analysis
SPSS was used for analysis. The Student t-test was used in
the analysis of numerical data with normal distribution, the
Mann-Whitney U test was used in the analysis of data that did
not fit normal distribution and for more than two categorical
variables, the chi-square test was used in the analysis of binary
categorical variables, and the Kaplan-Meier test was used for
estimating survival times. Values of p<0.05 were considered
statistically significant.
Results
Epidemiological data are given in Table 1. There was no statistical
difference in the distribution of patients. Associated p-values
are also given.
As can be seen in Table 1, the majority of patients in both groups
were male and the average age at diagnosis was over 60. The
percentage of stage 2 patients in the original molecule group
was 50%, and a more homogeneous distribution was observed
in the generic molecule group. When the disease stages were
categorized according to treatment lines, even though it was
statistically insignificant and there were only 11 patients in the
generic group for the second treatment line, the high-risk patient
212
Turk J Hematol 2021;38:211-217
Mersin S. et al: Evaluation of a Generic Bortezomib Molecule in Newly Diagnosed Multiple Myeloma Patients
group had a slightly higher percentage in the second treatment
line in the generic molecule group (p=0.43 and p=0.49).
Otherwise, these distributions were similar to those seen in the
main groups to which these patients belonged. When evaluated
in terms of MM types, the most common myeloma type was
immunoglobulin G kappa in both groups. The rate of high-risk
patients was 21.4% in the original molecule group and 37.7%
in the generic molecule group. When risk group distributions
between treatment lines and high-risk patients were evaluated,
there were some differences between subgroups. The subgroups
of original molecule users in the first line of treatment and
generic molecule users in the second line had higher percentages
of high risk than the main groups to which they belonged.
The numbers of patients in these subgroups were low and the
Table 1. Characteristics of patients.
Original molecule
Number (%)
Total number of patients 42 53
Equivalent molecule
Number (%)
Average age (range), years 64 (36-87) 62 (32-85) 0.36
Gender (female/male) 13/29 (31/69) 14/39 (26.4/73.6) 0.63
Stage (ISS)
I 8 (19) 16 (30.2)
II 21 (50) 18 (34)
III 13 (31) 19 (35.8)
Stage in treatment lines First - second First - second First - second
I 5 (19.2) - 3 (18.8) 13 (31) - 3 (27.3)
II 13 (50) - 8 (50) 15 (35.7) - 3 (27.3)
III 8 (30.8) - 5 (31.5) 14 (33.3) - 5 (45.5)
Myeloma type
IgG kappa 16 (38.1) 12 (22.6)
IgG lambda 3 (7.1) 12 (22.6)
IgA kappa 7 (16.7) 10 (18.9)
IgA lambda 2 (4.8) 2 (3.8)
Lambda light chain 6 (14.3) 11 (20.8)
Kappa light chain 6 (14.3) 1 (1.9)
Non-secretory 2 (4.8) 4 (7.5)
Genetic risk group
Standard risk 9 (21.4) 20 (37.7)
High risk 3 (7.1) 6 (11.3)
Unknown 30 (71.4) 27 (50.9)
p
0.25
0.43-0.49
Genetic risk groups in treatment lines First - second First - second First - second
Standard risk 5 (19.2) - 4 (25) 15 (35.7) - 5 (45.5)
High risk 3 (11.5) - 0 4 (9.5) - 2 (18.2)
Unknown 18 (69.2) - 12 (75) 23 (54.8) - 4 (36.4)
At diagnosis:
Extramedullary involvement 8 (19) 8 (15.1) 0.60
Lytic lesions 28 (66.7) 41 (77.4) 0.28
Laboratory results Mean (±SD) Mean (±SD)
Hemoglobulin (g/dL) 10.53 (1.87) 10.38 (1.92) 0.78
Leukocytes (U/mm 3 ) 6254 (2517) 6546 (2568) 0.45
Platelets (U/mm 3 ) 238045 (124255) 204602 (83510) 0.29
Creatinine (mg/dL) 1.2 (1.12) 1.31 (1.11) 0.62
Calcium (mg/dL) 9.44 (0.9) 9.58 (1.21) 0.71
ISS: International Staging System; SD: standard deviation, IgA: immunoglobulin.
0.1
0.13
0.34 - 0.07
213
Mersin S. et al: Evaluation of a Generic Bortezomib Molecule in Newly Diagnosed Multiple Myeloma Patients
Turk J Hematol 2021;38:211-217
findings were statistically insignificant, but still worth noting
when evaluating the results (p=0.34 and p=0.49). It should also
be noted that genetic risk assessment could not be performed
for the vast majority of patients. In summary, there was no
significant statistical difference between groups and subgroups
according to treatment lines. Extramedullary involvement, lytic
lesion rates, and mean laboratory values at the time of diagnosis
were also similar in the groups.
Bortezomib was used in combination with cyclophosphamide
and dexamethasone. The bortezomib dosage was 1.3 mg/m 2
and it was reduced to 1.1 mg/m 2 for patients experiencing
side effects such as neuropathy. Bortezomib was given
subcutaneously to all patients. The cyclophosphamide dosage
was 500 mg. The dexamethasone dosage was 40 mg for patients
below 60 years of age and 20 mg for older patients. The response
rates of the patients to the treatments containing bortezomib
that they received in the first or second line are given in
Table 2.
The patients’ responses were evaluated after 4 cycles of
treatment and another evaluation was performed for patients
who underwent more than 4 cycles in the pre-transplantation
period. Those rates were determined in the same groups according
to IMWG criteria for each patient. When the patients’ responses
were evaluated, there were some minor differences between the
two molecule groups, but these were not statistically significant
(p=0.42). When response rates were divided into two groups
as above minimal response or below partial response (PR), the
results were similar in the two groups (81% vs. 79.2%, p=0.83).
In Turkey, reimbursement rules did not allow the use of
bortezomib as a first line of treatment for a period of time.
Patients were able to use bortezomib after at least 2 cycles of
a combination treatment that did not contain bortezomib, such
as vincristine, doxorubicin, and dexamethasone (VAD). After
the reimbursement rules were changed, patients were able to
use bortezomib treatment in the first line of treatment. For
this reason, 27 of the patients received bortezomib-containing
regimens as a second line of therapy after 2 cycles of VAD
combination therapy. Eleven of 27 patients were in the generic
molecule group and 16 of them were in the original molecule
group (p=0.63). Treatment results were also analyzed according
to these subgroups. The rate of PR and better responses was
higher among those using the generic molecule in the group
that received bortezomib treatment as the first line of treatment
(81% vs. 76.9%) and among those receiving the original
molecule in the group that received bortezomib treatment as
the second line (87.5% vs. 72.7%). This may be due to the higher
percentage of high-risk patients in those subgroups, but again,
this finding was not statistically significant (p=0.69 and p=0.33,
respectively).
Before the PFS times of the patients were calculated, whether
the patients had extra VCD treatment cycles, whether they
underwent ASCT, and whether they received maintenance
lenalidomide treatment were compared between the groups.
Some of the patients in both groups received extra cycles
of VCD treatments due to ASCT availability at their time of
treatment. The maximum number of treatment cycles was 8 in
both groups and means of treatment cycle numbers were 5.2
in the original and 5.7 in the generic molecule group (p=0.89).
Twenty-three (54.8%) of the patients using the original molecule
and 25 (47.2%) of the patients using the generic molecule
underwent transplantation. In both molecule groups, high-dose
cyclophosphamide therapies were used for mobilization. All
Table 2. Response to treatments.
Total response rates
Original
molecule
Number (%)
Progression 3 (7.1) 3 (5.7)
SD 0 3 (5.7)
MR 5 (11.9) 5 (9.4)
Equivalent
molecule
Number (%)
PR 11 (26.2) 21 (39.6)
VGPR 13 (31.0) 11 (20.8)
CR 10 (23.8) 10 (18.9)
Total response rates
PR and above 34 (81) 42 (79.2)
MR and below 8 (19) 11 (20.8)
Response rates in first line
Progression 2 (7.6) 2 (4.7)
SD 0 1 (2.3)
MR 4 (15.3) 5 (11.9)
PR 4 (15.3) 18 (42.8)
VGPR 9 (34.6) 7 (16.6)
CR 7 (26.9) 9 (21.4)
Response rates in first line
PR and above 20 (76.9) 34 (81)
MR and below 6 (23.1) 8 (19)
Response rates in second line
Progression 1 (6.2) 1 (9)
SD 0 2 (18.2)
MR 1 (6.2) 0
PR 7 (43.8) 3 (27.3)
VGPR 4 (25) 4 (36.4)
CR 3 (18.8) 1 (9)
Response rates in second line
PR and above 14 (87.5) 8 (72.7)
MR and below 2 (12.5) 3 (27.3)
p
0.41
0.84
0.21
0.69
0.44
0.33
PR: Partial response; VGPR: very good partial response; CR: complete response; SD:
stable disease; MR: minimal response.
214
Turk J Hematol 2021;38:211-217
Mersin S. et al: Evaluation of a Generic Bortezomib Molecule in Newly Diagnosed Multiple Myeloma Patients
mobilizations succeeded with enough stem cell collection and
there was no difference between molecule groups regarding
mobilization or transplantation toxicities. After transplantation,
all patients in both molecule groups had successful engraftment
and no serious complications were seen in either group after
transplantation. Twelve (30.8%) of the patients using the
original molecule and 13 (24.5%) of the patients using the
generic molecule received maintenance lenalidomide treatment.
The lenalidomide dosage was 10 mg/day for 21 days in a 28-day
period as the standard for all patients. There was no significant
difference between the groups in this respect (p=0.537 and
p=0.637, respectively). The median follow-up time was longer in
the original molecule group, mainly because of treatment dates
(30 months vs. 20 months). Considering all these differences, it
should be kept in mind that the statistical relations among PFS
values are very weak. However, the PFS values were calculated
for the two groups to provide a general idea (Figure 1). PFS
values were 42.8±4.8 months in the group receiving the original
molecule and 38.3±5.89 months in the generic group with no
statistically significant difference (p=0.68).
When the side effects related to these molecules were evaluated,
side effects were seen in 44.7% of patients using bortezomib.
The most common side effects were neuropathy, anemia,
thrombocytopenia, neutropenia, and infections. Side effects
were observed in 20 patients (47.6%) receiving the original
molecule and 22 patients (41.5%) receiving the generic molecule
(p=0.55). When side effect grades were evaluated according to
the CTCAE, grade 3-4 side effects were observed as neuropathy
in 4 patients (2 patients in the original molecule group and 2
patients in the generic molecule group). All remaining observed
side effects were grade 1-2. Vincristine therapy (included in the
VAD regimen) can also cause permanent neuropathy, so to better
separate this from the side effects of bortezomib, neuropathy
was evaluated in both first-line and second-line subgroups. In
the first-line treatment subgroup, the neuropathy risk was higher
in the original molecule group, while the opposite finding was
seen for the second-line group. However, these differences were
statistically insignificant (23.1% vs. 7.1%, p=0.06 and 18.8% vs.
27.3%, p=0.6, respectively). The side effects seen in both groups
and the associated p-values in comparing the groups are given
in Table 3.
Discussion
It is known that the treatment results of patients are improved
with new drugs. However, the increase in health expenditures
related to these drugs leads health authorities to seek some
alternatives. One of the prime examples of this is generic
imatinib therapy. It was reported that the responses of chronic
myeloid leukemia patients treated with original imatinib were
maintained with generic products and annual cost was reduced
by 96% [11]. In two real-life studies, generic imatinib was
reported to be effective and safe in first-line treatment [11,12].
There are also studies about the economics of generic drugs
on a nationwide scale and studies addressing the reasons for
choosing generic products [13,14]. Other than imatinib, there
are only a few studies comparing generic molecules with their
original counterparts. Those studies include comparisons of
low-molecular-weight heparin and psychoactive drugs with
their generic counterparts [15,16]. As far as we know, our study
is the first one comparing original bortezomib with its generic
molecule.
Bortezomib was licensed by the Food and Drug Administration in
2003 for patients with MM and it has been used in combination
therapy with cyclophosphamide and dexamethasone since 2007
[17,18,19]. In Turkey, the original molecule has been used in
Figure 1. Evaluation of progression-free survival (PFS).
Table 3. Side effects.
Original
molecule
Number (%)
Equivalent
molecule
Number (%)
Any side effects 20 (47.6) 22 (41.5) 0.55
Neuropathy 9 (21.4) 6 (11.3) 0.18
Anemia 4 (9.5) 8 (15.1) 0.41
Neutropenia 2 (4.8) 4 (7.5) 0.58
Thrombocytopenia 3 (7.1) 2 (3.8) 0.46
Respiratory tract
infections
4 (9.5) 4 (7.5) 0.73
Diarrhea 4 (9.5) 3 (5.7) 0.47
p
215
Mersin S. et al: Evaluation of a Generic Bortezomib Molecule in Newly Diagnosed Multiple Myeloma Patients
Turk J Hematol 2021;38:211-217
combination therapy since 2010. Generic bortezomib was
launched with the obtaining of a license in 2012. In accordance
with the reimbursement policy of the relevant health authority,
it started to be used for patients due to the price difference.
However, generic bortezomib caused some concerns among
physicians at first regarding its effectiveness and side effect
profile.
Study Limitations
In our study, when the data of these patients were examined, the
distributions of epidemiological features, stages, disease types,
and other risk factors between groups were not statistically
different. When the response rates to treatment were evaluated,
there was no statistically significant difference between the
two groups in either first-line or second-line treatments. There
were some statistically insignificant differences observed
between subgroups that may be due to the percentage of
high-risk patients. Treatment response rates in both groups
were similar to those reported in studies in which the original
bortezomib molecule was combined with cyclophosphamide
and dexamethasone. In those studies, the rate of any response
(PR and above) was 80%, and similar data were obtained in both
groups in our study [17,19,20,21]. The results showed us that the
responses of patients using the generic bortezomib molecule
were similar to those of patients using the original molecule
(81% with the original molecule, 79.2% with the generic). Even
though these findings were statistically weak, there was also no
significant difference between PFS times, and these values were
similar to those of other studies on the VCD protocol [22,23].
When side effects were evaluated, no significant difference was
found between the two groups. The most common side effects
were neuropathy, cytopenia, and infections, similar to other
studies, and in our study the side effect of diarrhea was observed
less often than in other bortezomib studies [17,19,20,22,23,24].
Conclusion
MM is a disease in which response rates are increased with new
treatments and total survival is prolonged, but there is still no
cure. It is a fact that such diseases add additional costs to the
health expenditures of countries. Generic medicines can be
an alternative both to provide access to new medicines and
to reduce the burden on health expenditures. Although this
retrospective study includes a limited number of patients, it is
the first study of generic bortezomib since it became available
for use in Turkey. Our data show that the responses to this
drug are similar to those of the original molecule, while the
side effects are also similar to those of the original molecule
and manageable. Randomized, prospective studies with greater
numbers of patients and longer follow-up times are needed
to understand whether the use of generic bortezomib in MM
treatment affects long-term survival.
Ethics
Ethics Committee Approval: Consent was obtained from the
ethics committee of our hospital for the analysis of patient files.
Informed Consent: Obtained.
Authorship Contributions
Concept: S.M., A.G., Ö.M.; Design: S.M., A.G.; Data Collection or
Processing: S.M., A.G., Ö.M., P.T., S.Ü., M.G.P., K.A., E.M.Y., H.A.,
A.H.; Analysis or Interpretation: S.M., A.G.; Literature Search:
S.M.; Writing: S.M.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin
2016;66:7-30.
2. Teras LR, DeSantis CE, Cerhan JR, Morton LM, Jemal A, Flowers CR. 2016 US
lymphoid malignancy statistics by World Health Organization subtypes. CA
Cancer J Clin 2016;66:443-459.
3. Cowan AJ, Allen C, Barac A, Basaleem H, Bensenor I, Curado MP, Foreman
K, Gupta R, Harvey J, Hosgood HD, Jakovljevic M, Khader Y, Linn S, Lad D,
Mantovani L, Nong VM, Mokdad A, Naghavi M, Postma M, Roshandel G,
Shackelford K, Sisay M, Nguyen CT, Tran TT, Xuan BT, Ukwaja KN, Vollset SE,
Weiderpass E, Libby EN, Fitzmaurice C. Global burden of multiple myeloma:
a systematic analysis for the Global Burden of Disease Study 2016. JAMA
Oncol 2018;4:1221-1227.
4. Field-Smith A, Morgan GJ, Davies FE. Bortezomib (Velcadetrade mark) in the
treatment of multiple myeloma. Ther Clin Risk Manag 2006;2:271-279.
5. Jackson G, Einsele H, Moreau P, Miguel JS. Bortezomib, a novel proteasome
inhibitor, in the treatment of hematologic malignancies. Cancer Treat Rev
2005;31:591-602.
6. Richardson PG, Mitsiades C, Hideshima T, Anderson KC. Proteasome
inhibition in the treatment of cancer. Cell Cycle 2005;4:290-296.
7. Mateos MV, Ludwig H, Bazarbachi A, Beksac M, Bladé J, Boccadoro M,
Cavo M, Delforge M, Dimopoulos MA, Facon T, Geraldes C, Goldschmidt H,
Hájek R, Hansson M, Jamroziak K, Leiba M, Masszi T, Mendeleeva L, O’Dwyer
M, Plesner T, San-Miguel JF, Straka C, van de Donk NWCJ, Yong K, Zver S,
Moreau P, Sonneveld P. Insights on multiple myeloma treatment strategies.
Hemasphere 2018;3:e163.
8. Borcade Drug Information. Available online at https://www.ndrugs.
com/?s=borcade.
9. Rajkumar SV, Dimopoulos MA, Palumbo A, Blade J, Merlini G, Mateos
MV, Kumar S, Hillengass J, Kastritis E, Richardson P, Landgren O, Paiva B,
Dispenzieri A, Weiss B, LeLeu X, Zweegman S, Lonial S, Rosinol L, Zamagni
E, Jagannath S, Sezer O, Kristinsson SY, Caers J, Usmani SZ, Lahuerta JJ,
Johnsen HE, Beksac M, Cavo M, Goldschmidt H, Terpos E, Kyle RA, Anderson
KC, Durie BG, Miguel JF. International Myeloma Working Group updated
criteria for the diagnosis of multiple myeloma. Lancet Oncol 2014;15:e538-
548.
10. US Department of Health and Human Services. Common Terminology
Criteria for Adverse Events (CTCAE) Version 5.0. Washington, HHS,
2017. Available online at https://ctep.cancer.gov/protocoldevelopment/
electronic_applications/docs/CTCAE_v5_Quick_Reference_5x7.pdf.
216
Turk J Hematol 2021;38:211-217
Mersin S. et al: Evaluation of a Generic Bortezomib Molecule in Newly Diagnosed Multiple Myeloma Patients
11. Eskazan AE, Soysal T. The tolerability issue of generic imatinib in patients
with chronic myeloid leukemia (Comment on Adi J. Klil-Drori et al.,
Haematologica 2019;104(7):e293). Haematologica 2019;104:e330.
12. Lejniece S, Udre I, Rivkina A. Generic imatinib in the treatment of chronic
myeloid leukemia: two years’ experience in Latvia. Exp Oncol 2017;39:151-
154.
13. Kanavos P. Do generics offer significant savings to the UK National Health
Service? Curr Med Res Opin 2007;23:105-116.
14. Gallelli L, Palleria C, De Vuono A, Mumoli L, Vasapollo P, Piro B, Russo E.
Safety and efficacy of generic drugs with respect to brand formulation. J
Pharmacol Pharmacother 2013;4(Suppl 1):S110-114.
15. Borgheini G. The bioequivalence and therapeutic efficacy of generic versus
brand-name psychoactive drugs. Clin Ther 2003;25:1578-1592.
16. Fareed J, Leong WL, Hoppensteadt DA, Jeske WP, Walenga J, Wahi R, Bick
RL. Generic low-molecular-weight heparins: some practical considerations.
Semin Thromb Hemost 2004;30:703-713.
17. Kropff M, Bisping G, Schuck E, Liebisch P, Lang N, Hentrich M, Dechow T,
Kröger N, Salwender H, Metzner B, Sezer O, Engelhardt M, Wolf HH, Einsele
H, Volpert S, Heinecke A, Berdel WE, Kienast J; Deutsche Studiengruppe
Multiples Myelom. Bortezomib in combination with intermediate-dose
dexamethasone and continuous low-dose oral cyclophosphamide for
relapsed multiple myeloma. Br J Haematol 2007;138:330-337.
18. Kim SJ, Kim J, Cho Y, Seo BK, Kim BS. Combination chemotherapy with
bortezomib, cyclophosphamide and dexamethasone may be effective for
plasma cell leukemia. Jpn J Clin Oncol 2007;37:382-384.
19. Davies FE, Wu P, Jenner M, Srikanth M, Saso R, Morgan GJ. The combination
of cyclophosphamide, velcade and dexamethasone induces high response
rates with comparable toxicity to velcade alone and velcade plus
dexamethasone. Haematologica 2007;92:1149-1150.
20. Tsukada N, Ikeda M, Shingaki S, Miyazaki K, Meshitsuka S, Yoshiki Y, Abe
Y, Suzuki K. Induction treatment with bortezomib-cyclophosphamidedexamethasone
(CyBorD) for newly diagnosed transplant-eligible patients
with multiple myeloma. Rinsho Ketsueki 2015;56:1069-1075.
21. Tanaka K, Toyota S, Akiyama M, Wakimoto N, Nakamura Y, Najima Y, Doki
N, Kakihana K, Igarashi A, Kobayashi T, Ohashi K, Kudo D, Shinagawa A,
Takano H, Fujio T, Okoshi Y, Hori M, Kumagai T, Saito T, Mukae J, Yamamoto
K, Tsutsumi I, Komeno T, Yoshida C, Yamamoto M, Kojima H; on behalf of
the Ochanomizu Hematology Study Group. Efficacy and safety of a weekly
cyclophosphamide-bortezomib-dexamethasone regimen as induction
therapy prior to autologous stem cell transplantation in Japanese patients
with newly diagnosed multiple myeloma: a phase 2 multicenter trial. Acta
Haematol 2019;141:111-118.
22. Khan ML, Reeder CB, Kumar SK, Lacy MQ, Reece DE, Dispenzieri A, Gertz MA,
Greipp P, Hayman S, Zeldenhurst S, Dingli D, Lust J, Russell S, Laumann KM,
Mikhael JR, Bergsagel PL, Fonseca R, Rajkumar SV, Stewart AK. A comparison
of lenalidomide/dexamethasone versus cyclophosphamide/lenalidomide/
dexamethasone versus cyclophosphamide/bortezomib/dexamethasone in
newly diagnosed multiple myeloma. Br J Haematol 2012;156:326-333.
23. Figueiredo A, Atkins H, Mallick R, Kekre N, Kew A, McCurdy A.
Cyclophosphamide-bortezomib-dexamethasone compared with
bortezomib-dexamethasone in transplantation-eligible patients with newly
diagnosed multiple myeloma. Curr Oncol 2020;27:e81-e85.
24. Ashrafi F, Moghaddas A, Darakhshandeh A. Reduced weekly subcutaneous
doses of bortezomib in combination with cyclophosphamide and
dexamethasone for newly diagnosed multiple myeloma. J Res Pharm Pract
2020;9:56-59.
217
Mina S.A. et al: Peripheral Neuropathy and Proteasome Inhibitors
BRIEF REPORT
DOI: 10.4274/tjh.galenos.2021.2021.0052
Turk J Hematol 2021;38:218-221
Post-Marketing Analysis of Peripheral Neuropathy Burden with
New-Generation Proteasome Inhibitors Using the FDA Adverse
Event Reporting System
Yeni Jenerasyon Proteozom İnhibitörleriyle Olan Çevresel Nöropati Yükünün FDA Yan Etki
Raporlama Sistemi Kullanılarak Pazarlama Sonrası Analizi
Syeda A. Mina 1 , Ibrahim N. Muhsen 2 , Ethan A. Burns 3 , Humaira Sarfraz 2 , Sai Ravi Pingali 3 , Jiaqiong Xu 4 ,
Shahrukh K. Hashmi 5,6
1Mayo Clinic, Department of Medicine, Rochester, USA
2Houston Methodist Hospital, Department of Medicine, Houston, USA
3Houston Methodist Cancer Center, Houston Methodist Hospital, Houston, USA
4Center for Outcomes Research, Houston Methodist Research Institute, Houston, USA
5Mayo Clinic, Department of Medicine, Rochester, USA
6Sheikh Shakbout Medical City, Department of Medicine, Abu Dhabi, UAE
Abstract
Proteasome inhibitors (PIs) are an integral component of multiple
myeloma therapies. Peripheral neuropathy (PN) is a well-known
consequence of PIs, most frequently reported with earlier generations
such as bortezomib (BTZ). There is a paucity of data highlighting the
risk of developing PN with the new-generation PIs carfilzomib (CFZ)
and ixazomib (IZB). This study evaluated reports of PN encountered
with all three PIs using the Food and Drug Administration Adverse
Event (AE) Reporting System (FAERS). Signal disproportionality
analysis was reported using the reporting odds ratio (ROR) with 95%
confidence interval (CI). PN was reported in a total of 2.1%, 5.0%, and
10.9% of AEs with CFZ, IZB, and BTZ, respectively. The ROR (95% CI)
for PN secondary to BTZ, CFZ, and IZB was 34.10 (32.76-35.49), 6.37
(5.50-7.37), and 14.97 (13.63-16.44), respectively. Compared to BTZ,
CFZ and IZB have lower rates of reported PN, with RORs of 0.19 (0.16-
0.22) and 0.48 (0.43-0.54), respectively.
Keywords: Multiple myeloma, Proteasome inhibitors, Peripheral
neuropathy
Öz
Proteozom inhibitörleri (Pİ) multipl myelom tedavilerinin integral
parçalarındandır. Çevresel nöropatiler (ÇN) Pİ’nin iyi bilinen bir
sonucudur, bortezomib (BTZ) gibi önceki jenerasyonlarla daha sık
bildirilmiştir. Yeni jenerasyon PI olan karfilzomib (KFZ) ve iksazomib
(IZB) ile gelişen ÇN riskini vurgulayan çalışmalar yetersizdir. Bu
çalışmada, Gıda ve İlaç İdaresi Olumsuz Olay (OO) Raporlama Sistemini
(FAERS) kullanarak her üç PI ile karşılaşılan ÇN raporları değerlendirildi.
Sinyal orantısızlık analizi, raporlama olasılık oranı (ROO) %95 güven
aralığı (GA) kullanılarak yapıldı. ÇN; KFZ, IZB, BTZ ile sırasıyla OO’nun
toplamında %2,1, %5,0, ve %10,9’unda rapor edilmişti. BTZ, KFZ, ve
IZB’ye ikincil ÇN için ROO (%95 GA) sırasıyla 34,10 (32,76-35,49),
6,37 (5,50-7,37), ve 14,97 (13,63-16,44) idi. KFZ ve IZB ile, BTZ ile
karşılaştırıldığında daha az ÇN rapor edilmişti, ROO sırasıyla 0,19
(0,16-0,22) ve 0,48 (0,43-0,54) idi.
Anahtar Sözcükler: Multipl myelom, Proteozom inhibitörleri,
Periferik nöropati
Introduction
Multiple myeloma (MM) is an incurable clonal plasma cell disease
expected to be diagnosed in 34,920 individuals in the year 2021
in the United States alone [1]. While the incidence has remained
stable over the past decade, the prevalence and 5-year overall
survival (OS) rate have substantially improved with therapeutic
breakthroughs in monoclonal antibodies, immunomodulatory
therapy, and, recently, proteasome inhibitors (PIs) [2,3]. Currently,
PIs are approved in combination with other agents in induction
therapies for newly diagnosed MM, for autologous stem cell
transplant candidates as maintenance therapies, and in cases of
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Shahrukh K. Hashmi, M.D., Mayo Clinic, Department of Medicine,
Rochester, USA
Phone : +91 507 538 32 70
E-mail : hashmi.shahrukh@mayo.edu ORCID: orcid.org/0000-0002-4738-8714
Received/Geliş tarihi: January 20, 2021
Accepted/Kabul tarihi: June 29, 2021
218
Turk J Hematol 2021;38:218-221
Mina S.A. et al: Peripheral Neuropathy and Proteasome Inhibitors
relapsed/refractory disease [2,4]. There are three PIs approved by
the US Food and Drug Administration (FDA): bortezomib [(BTZ),
approved in 2003], carfilzomib [(CFZ), approved in 2012], and
ixazomib [(IZB), approved in 2015].
Despite profound therapeutic benefits, there are significant
adverse events (AEs) that may impact the quality of life and
impede medication use, one such toxicity being peripheral
neuropathy (PN) [5]. This is most commonly reported with
BTZ, and it has been reported as a dose-limiting toxicity in
as many as 30%-60% of patients [6]. Recent clinical trials
have suggested that the newer PIs have a lower association
with these off-target effects [7,8]. However, there remains a
relative paucity of post-marketing data on PN. This analysis
aims to compare the rate of reported PN incidences with BTZ,
CFZ, and IZB using the FDA Adverse Event Reporting System
(FAERS).
Materials and Methods
This study is a retrospective analysis using cases of AEs reported
to the FAERS pharmacovigilance database. This public database
is used by the FDA for post-marketing safety surveillance
of pharmaceutical products. AEs and medication errors are
coded to terms in the Medical Dictionary for Regulatory
Activities. The cases are reported by healthcare professionals,
manufacturers, and consumers. With input from 1968 to June
2020, the database contains approximately 19 million AE
reports from around the world. Each reported event includes
information about the constituents of the suspected product,
indication for use, adverse reactions, characterization of the
outcome (serious vs. non-serious, and whether hospitalization
was required), patient demographics (gender, age, weight),
and details of the reporting event (latest manufacturer report
received to date, initial FDA report received, reporting country,
and reporter type). All events have a unique case identification
number.
This study retrospectively reviews AEs reported from the date
of FDA approval of the respective medications, BTZ (2003), CFZ
(2012), and IZB (2015), through June 20, 2020. The FAERS was
queried for “bortezomib,” “ixazomib,” and “carfilzomib.” The
following terms were subsequently selected as reasons for use:
“plasma cell leukemia,” “plasma cell myeloma,” “plasma cell
myeloma in remission,” and “plasma cell myeloma recurrent.”
The specific AEs included were “peripheral neuropathy,” “sensory
peripheral neuropathy,” “motor peripheral neuropathy,” and
“sensorimotor peripheral neuropathy.”
Analysis
Reported AEs attributed to new-generation PIs, namely CFZ and
IZB, were compared individually to the total number of events
reported to FAERS and to those for BTZ. Signal disproportionality
analysis was performed by calculating the reporting odds ratio
(ROR) and 95% confidence interval (CI). The ROR was reported
to be significant if the 95% CI did not surpass 1, with an ROR of
>1 suggestive of a higher likelihood of AEs being reported with
the drug and <1 suggesting AEs to be less likely to occur with
the drug. The chi-square test was used to calculate p-values,
with p<0.05 being taken as significant. Continuous data were
reported as means with standard deviations.
Results
The number of adverse events of PN reported per year
following the approval of the respective PIs are presented in
Table 1. The mean patient age was 65.5±9.9, 67.7±10.1, and
68.5±9.5 years in the BTZ, CFZ, and IZB groups, respectively, with
male-to-female ratios of 1.26:1, 1.3:1, and 1.01:1, respectively.
The total numbers of PN events reported in the FAERS from the
first FDA approval through June 2020 were 2802 (10.9%) for
BTZ, 191 (2.06%) for CFZ, and 475 (4.98%) for IZB in comparison
to the total reported AE rate in MM patients (Table 2). In most
cases, PN was reported in the absence of reported concomitant
medications, at rates of 71.8% for BTZ, 70.3% for IZB, and 51.8%
for CFZ.
Compared to the entirety of the FAERS database for the
corresponding years, the ROR (95% CI) for PN reported with
Table 1. Summary of characteristics of patients with plasma
cell disorders on proteasome inhibitors with side effects of
peripheral neuropathy.
Cases of PN reported to the FAERS
Bortezomib Carfilzomib Ixazomib
Before 2010 480 - -
2010-2015 1203 69 6
2016-June 2020 1119 122 469
Total PN cases reported 2802 191 475
Mean age of patients
with reported PN, years
(± SD)
Sex (%)
65.5 (±9.9) 67.7 (±10.1) 68.5 (±9.5)
Male 1217 (43.4) 88 (46.0) 229 (48.2)
Female 972 (34.7) 66 (34.6) 225 (47.3)
Not specified 613 (21.9) 37 (19.4) 21(4.4)
Reporter (%)
Healthcare professional 2341 (83.5) 135 (70.6) 320 (67.3)
Non-healthcare 461 (16.4) 56 (29.3) 155 (32.6)
Suspected drug (%)
Proteasome inhibitor +
other medications
Proteasome inhibitor
only
790 (28.1) 92 (48.1) 141 (29.6)
2012 (71.8) 99 (51.8) 334 (70.3)
PN: Peripheral neuropathy; FAERS: Food and Drug Administration Adverse Event
Reporting System; SD: standard deviation.
219
Mina S.A. et al: Peripheral Neuropathy and Proteasome Inhibitors
Turk J Hematol 2021;38:218-221
BTZ, CFZ, and IZB was 34.10 (32.76-35.49), 6.37 (5.50-7.37), and
14.97 (13.63-16.44), respectively (Figure 1). When comparing
CFZ and IZB to BTZ, there was a lower reported rate of PN, with
RORs of 0.19 (0.16-0.22) and 0.48 (0.43-0.54), respectively, as
shown in Figure 2.
Table 2. Comparative peripheral neuropathy reports in FAERS
between different PIs.*
Number of PN cases
reported
Total number of
adverse events
Total number of
adverse events in
FAERS since PI’s FDA
approval
Number of PN
cases reported in
FAERS since PI’s FDA
approval
ROR (vs. FAERS)
(95% CI)**
ROR (vs. BTZ)
(95% CI)**
Carfilzomib Ixazomib Bortezomib
191 475 2802
9261 9528 25,687
13,899,084 10,687,588 17,260,353
44,987 35,591 55,215
6.37
(5.50-7.37)
0.19
(0.16-0.22)
14.97
(13.63-16.44)
0.46
(0.41-0.51) -
34.10
(32.76-35.49)
*Calculations are based on total numbers of PN cases reported and total number of
reported adverse events in the FAERS from date of drug approval by FDA to June 2020.
**All reported results had p-values of <0.0001.
PI: Proteasome inhibitor; PN: peripheral neuropathy; FAERS: Food and Drug
Administration Adverse Event Reporting System; FDA: Food and Drug Administration;
ROR: reporting odds ratio; CI: confidence interval; BTZ: bortezomib.
Figure 1. Forest plot of reporting odds ratios (RORs) with
95% confidence intervals (CIs) of adverse events reported
for proteasome inhibitors compared to the Food and Drug
Administration Adverse Event Reporting System (FAERS).
Figure 2. Forest plot of reporting odds ratios (RORs) with 95%
confidence intervals (CIs) of adverse events reported for ixazomib
and carfilzomib compared to bortezomib.
Discussion
The results of this study suggest a higher risk of reported PN
with PIs, but when compared individually, there is lower risk
with the new-generation PIs. PIs have become the standard
of care in the treatment of MM. Recent data indicate higher
levels of treatment-related toxicities with BTZ. For instance,
the multicenter ENDEAVOR trial, which entailed a head-tohead
comparison of BTZ versus CFZ in patients with relapsed or
refractory MM, reported ≥ grade 2 PN in 32% of patients in the
BTZ group compared to 6% in the CFZ group [9]. This analysis
further substantiates these results and suggests that BTZ is
more likely to be linked to reported PN than CFZ. Moreover,
the ENDEAVOR and CLARION trials have consistently shown
improved progression-free survival rates with CFZ that suggest
it to be a more tolerable and potentially more efficacious option
[9,10]. The present study also suggests a significantly lower
likelihood of PN reported with IZB compared to BTZ.
Moreover, among the new-generation PIs, the post-marketing
data showed a higher number of PN events reported to the
FAERS with IZB versus CFZ despite later approval. During
the safety analysis of single-agent CFZ in phase II clinical
trials, the overall rate of PN was 13.9%. Furthermore, the
majority of patients (87.3%) with baseline PN did not report
worsening of PN while receiving CFZ [11]. On the contrary, the
TOURMALINE-MM1 clinical trial showed a higher incidence
of PN with the addition of IZB to a regimen of lenalidomidedexamethasone
(27% in the IZB group and 22% in the
placebo group) [12]. This may suggest a higher propensity
of developing PN with IZB. Although no head-to-head
studies have compared AE profiles between the two newergeneration
PIs, the potential for this treatment limiting AEs
should be further substantiated in clinical analyses in the
standard of care setting.
Although the FAERS database gives insight into important
long-term trends associated with medications, some limitations
should be recognized. It is a heterogeneous database that
only allows for retrospective review. As such, treatment
recommendations should not be derived from these findings,
but this work does identify potential trends in toxicities that
should be monitored and validated in additional studies.
Additionally, the true incidence of an event occurring cannot
be determined since the ratio of events occurring is based on
total AEs rather than the true number of patients receiving
medication. Moreover, the FAERS provides limited data about
patients’ baseline comorbidities, thus introducing possible
confounding factors that could serve as a predisposition to PN,
including diabetes. Finally, PIs are typically given in combination
with other myeloma agents that may predispose to PN. It is
important to recognize that these patients were likely exposed
to BTZ prior to trials of CFZ or IZB, as the new-generation PIs are
220
Turk J Hematol 2021;38:218-221
Mina S.A. et al: Peripheral Neuropathy and Proteasome Inhibitors
rarely used as frontline therapy. It is possible that these agents
further impacted the risk of PN development in these patients.
Ethics
Regarding the ethics approval and informed consent; in this
analysis, we used public data published by the FDA so both are
not applicable.
Authorship Contributions
Concept: S.A.M., I.N.M., SK.H., Design: S.A.M., I.N.M., E.A.B., H.S.,
S.R.P., J.X., S.K.H., Data Collection or Processing: S.A.M., I.N.M.,
E.A.B., J.X., H.S., Analysis or Interpretation: S.A.M., I.N.M., E.A.B.,
S.R.P., J.X., SK.H., Literature Search: I.N.M., S.A.M., Writing:
S.A.M., I.N.M., S.K.H.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Siegel R, Miller K, Fuchs H, Jemal A. Cancer statistics, 2021. CA Cancer J Clin
2021;71:7-33.
2. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin
2016;66:7-30.
3. Kazandjian D. Multiple myeloma epidemiology and survival: a unique
malignancy. Semi Oncol 2016;43:676-681.
4. Kumar SK, Rajkumar SV, Dispenzieri A, Lacy MQ, Hayman SR, Buadi FK,
Zeldenrust SR, Dingli D, Russell SJ, Lust JA, Greipp PR. Improved survival in
multiple myeloma and the impact of novel therapies. Blood 2008;111:2516-
2520.
5. Beijers AJ, Vreugdenhil G, Oerlemans S, Eurelings M, Minnema MC, Eeltink
CM, van de Poll-Franse LV, Mols F. Chemotherapy-induced neuropathy
in multiple myeloma: influence on quality of life and development of a
questionnaire to compose common toxicity criteria grading for use in daily
clinical practice. Support Care Cancer 2016;24:2411-2420.
6. Velasco R, Alberti P, Bruna J, Psimaras D, Argyriou AA. Bortezomib and
other proteosome inhibitors—induced peripheral neurotoxicity: from
pathogenesis to treatment. J Peripher Nerv Syst 2019;24:S52-62.
7. Arastu-Kapur S, Anderl JL, Kraus M, Parlati F, Shenk KD, Lee SJ, Muchamuel
T, Bennett MK, Driessen C, Ball AJ, Kirk CJ. Nonproteasomal targets of the
proteasome inhibitors bortezomib and carfilzomib: a link to clinical adverse
events. Clin Cancer Res 2011;17:2734-2743.
8. Kirk CJ, Jiang J, Muchamuel T, Dajee M, Swinarski D, Aujay M, Bennett MK,
Yang J, Lewis E, Laidig G, Molineaux CJ. The selective proteasome inhibitor
carfilzomib is well tolerated in experimental animals with dose intensive
administration. Blood 2008;11211:2765 (abstract).
9. Dimopoulos MA, Goldschmidt H, Niesvizky R, Joshua D, Chng WJ, Oriol A,
Orlowski RZ, Ludwig H, Facon T, Hajek R, Weisel K. Carfilzomib or bortezomib
in relapsed or refractory multiple myeloma (ENDEAVOR): an interim overall
survival analysis of an open-label, randomised, phase 3 trial. Lancet Oncol
2017;18:1327-1337.
10. ClinicalTrials.gov. Phase 3 Study of Carfilzomib, Melphalan, Prednisone vs
Bortezomib, Melphalan, Prednisone in Newly Diagnosed Multiple Myeloma
(CLARION). Last Update: 2019. Available online at https://clinicaltrials.gov/
ct2/show/NCT01818752.
11. Martin TG. Peripheral neuropathy experience in patients with relapsed
and/or refractory multiple myeloma treated with carfilzomib. Oncology
(Williston Park) 2013;27(Suppl 3):4-10.
12. Moreau P, Masszi T, Grzasko N, Bahlis NJ, Hansson M, Pour L, Sandhu I,
Ganly P, Baker BW, Jackson SR, Stoppa AM. Oral ixazomib, lenalidomide,
and dexamethasone for multiple myeloma. N Engl J Med 2016;374:1621-
1634.
221
Beken S. et al: Intrauterine Arterial Ischemia
IMAGES IN HEMATOLOGY
DOI: 10.4274/tjh.galenos.2020.2020.0530
Turk J Hematol 2021;38:222-223
Extremity Necrosis Due to Intrauterine Arterial Ischemia
İntrauterin Arteriyel İskemiye Bağlı Gelişen Ekstremite Nekrozu
Serdar Beken 1 , Kerim Sarıyılmaz 2 , Eda Albayrak 3 , Arzu Akçay 4 , Ayşe Korkmaz 1
1Acıbadem University Faculty of Medicine, Department of Pediatrics, Neonatology Subdivision, İstanbul, Turkey
2Acıbadem University Faculty of Medicine, Department of Orthopedics, İstanbul, Turkey
3Acıbadem University Faculty of Medicine, Department of Pediatrics, İstanbul, Turkey
4Acıbadem University Faculty of Medicine, Department of Pediatrics, Pediatric Hematology Subdivision, İstanbul, Turkey
Figure 1. (a-d) Left lower extremity was rudimentary, pale, shorter than
the right, and had a club-foot deformity. The demarcation line became
clear on the 5 th day and amputation was performed under the left hip
joint.
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Serdar Beken, M.D., Acıbadem University Faculty of Medicine,
Department of Pediatrics, Neonatology Subdivision, İstanbul, Turkey
Phone : +90 532 671 31 96
E-mail : serbeken@gmail.com ORCID: orcid.org/0000-0002-8609-2684
Received/Geliş tarihi: September 1, 2020
Accepted/Kabul tarihi: October 13, 2020
222
Turk J Hematol 2021;38:222-223
Beken S. et al: Intrauterine Arterial Ischemia
A preterm male infant weighing 1230 g was delivered by cesarean
section at 32 1/7 gestational weeks. His twin weighed 1300 g and
neither required resuscitation. On physical examination, the left
lower extremity was rudimentary, pale, shorter than the right,
and had a club-foot deformity. Computerized tomographic
angiography demonstrated a bluntly filled femoral artery with
no distal passage. During follow-up, the demarcation line
became clear on the 5 th day and amputation was performed
under the left hip joint (Figure 1).
Laboratory tests including homocysteine, folate, prothrombin
time, activated partial thromboplastin time, protein C and S
activity, fibrinogen, and antithrombin III activity were within
normal limits according to gestational age, except for high
D-dimer (4.13 mg/dL). Antiphospholipid and anticardiolipin
antibodies were also negative. The patient was found to be
homozygous for methylenetetrahydrofolate reductase C677T;
thrombosis was not observed in histopathological examination.
The patient was successfully discharged from the hospital on
the 40 th day of life.
Arterial ischemia of the limb can be seen after thromboembolic
events or vascular interventions [1,2]. Ischemic changes present
at birth suggested intrauterine onset causes that might be
attributable to occlusive vascular disruption [3]. Diminished
blood flow altered normal soft tissue and osseous growth and
resulted in ischemia in fetal life, ending with limb loss.
Keywords: Newborn, Ischemia, Arterial
Anahtar Sözcükler: Yenidoğan, İskemi, Arteriyel
Informed Consent: It was received.
Authorship Contributions
Surgical and Medical Practices: S.B., K.S., E.A, A.A., A.K.; Literature
Search: S.B., K.S., E.A, A.A., A.K.; Writing: S.B., K.S., A.K.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Wang SK, Lemmon GW, Drucker NA, Motaganahalli RL, Dalsing MC, Gutwein
AR, Gray BW, Murphy MP. Results of nonoperative management of acute
limb ischemia in infants. J Vasc Surg 2018;67:1480-1483.
2. Bekmez S, Beken S, Dinç T, Dursun A, Zenciroğlu A, Dilli D, Okumuş N. Lower
extremity amputation in a preterm infant due to MTHFR homozygosity.
Genet Couns 2014;25:245-249.
3. Turnpenny PD, Stahl S, Bowers D, Bingham P. Peripheral ischemia and
gangrene presenting at birth. Eur J Pediatr 1992;151:550-554.
223
Filizoğlu and Özgüven: Myeloid Sarcoma Involving the Testicular Vein
IMAGES IN HEMATOLOGY
DOI: 10.4274/tjh.galenos.2020.2020.0436
Turk J Hematol 2021;38:224-225
Myeloid Sarcoma Involving the Testicular Vein
Testiküler Veni Tutan Myeloid Sarkom
Nuh Filizoğlu,
Salih Özgüven
Marmara University Pendik Training and Research Hospital, Clinic of Nuclear Medicine, İstanbul, Turkey
Figure 1. (A-C) F18-FDG PET/CT after left orchiectomy depicted moderate hypermetabolic metastatic retrocrural and paraaortic lymph
nodes and multiple intense hypermetabolic foci along the course of the left testicular vein extending up to the left renal vein suggesting
testicular vein infiltration of myeloid sarcoma (arrows).
F18-FDG PET/CT: F18-fluorodeoxyglucose positron emission tomography/computed tomography.
A 66-year-old man with a diagnosis of acute myeloid leukemia
(AML) type M4 in 2017 who had undergone allogeneic
hematopoietic stem cell transplantation in January 2018
presented with painless, nontender left hemiscrotal swelling.
The patient underwent unilateral radical orchiectomy and
histopathology revealed myeloperoxidase-, CD33-, and CD117-
positive and CD34-negative infiltration of AML in the testis
and local spread into the spermatic cord, rete testis, epididymis,
tunica albuginea, and the surrounding soft tissue suggesting
myeloid sarcoma (MS). F18-fluorodeoxyglucose positron
emission tomography/computed tomography (FDG PET/CT) after
left orchiectomy depicted moderate hypermetabolic metastatic
retrocrural and paraaortic lymph nodes and multiple intense
hypermetabolic foci along the course of the left testicular
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Nuh Filizoğlu, M.D., Marmara University Pendik Training and Research
Hospital, Clinic of Nuclear Medicine, İstanbul, Turkey
Phone : +90 536 495 38 49
E-mail : nuhfilizoglu@gmail.com ORCID: orcid.org/0000-0002-9139-9752
Received/Geliş tarihi: July 29, 2020
Accepted/Kabul tarihi: October 15, 2020
224
Turk J Hematol 2021;38:224-225
Filizoğlu and Özgüven: Myeloid Sarcoma Involving the Testicular Vein
vein extending up to the left renal vein, suggesting testicular
vein infiltration of MS (arrows in Figures 1A-1C). MS is a rare
neoplasm of leukemic cells that infiltrates extramedullary soft
tissue. Testicular involvement of MS is an uncommon entity,
especially following hematopoietic stem cell transplantation,
and invasion of MS into the spermatic cord and testicular vein
is even rarer [1,2]. Although FDG PET/CT is well established for
detecting, staging, and monitoring response to treatment in
MS, this is an extremely rare condition of testicular involvement
with invasion of the testicular vein not described before [3,4].
Keywords: Myeloid sarcoma, Testicular vein, Leukemia
Anahtar Sözcükler: Myeloid sarkom, Testiküler ven, Lösemi
Informed Consent: Obtained.
Authorship Contributions
Concept: S.Ö.; Design: S.Ö.; Data Collection or Processing: N.F.;
Analysis or Interpretation: N.F.; Literature Search: N.F.; Writing:
N.F.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Almond LM, Charalampakis M, Ford SJ, Gourevitch D, Desai A. Myeloid
sarcoma: presentation, diagnosis, and treatment. Clin Lymphoma Myeloma
Leuk 2017;17:263-267.
2. Valbuena JR, Admirand JH, Lin P, Medeiros LJ. Myeloid sarcoma involving
the testis. Am J Clin Pathol 2005;124:445-452.
3. Stölzel F, Röllig C, Radke J, Mohr B, Platzbecker U, Bornhäuser M, Paulus
T, Ehninger G, Zöphel K, Schaich M. 18 F-FDG-PET/CT for detection of
extramedullary acute myeloid leukemia. Haematologica 2011;96:1552-
1556.
4. Niu N, Cui R, Li F. FDG PET/CT findings of intracardiac myeloid sarcoma. Clin
Nucl Med 2016;41:235-236.
225
Öztaş M. et al: Giant Cell Arteritis with Concomitant Chronic Myelomonocytic Leukemia
IMAGES IN HEMATOLOGY
DOI: 10.4274/tjh.galenos.2020.2020.0357
Turk J Hematol 2021;38:226-227
Giant Cell Arteritis with Concomitant Chronic Myelomonocytic
Leukemia
Eşzamanlı Kronik Myelomonositik Lösemi ile Dev Hücreli Arterit
Mert Öztaş 1 , Ilkın Muradov 2 , Abdülkadir Erçalışkan 3 , Ahu Senem Demiröz 4 , Şebnem Batur 4 , Ahmet Emre Eşkazan 3 ,
Serdal Uğurlu 1
1İstanbul University-Cerrahpaşa, Cerrahpaşa Faculty of Medicine, Department of Rheumatology, İstanbul, Turkey
2İstanbul University-Cerrahpaşa, Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, İstanbul, Turkey
3İstanbul University-Cerrahpaşa, Cerrahpaşa Faculty of Medicine, Department of Hematology, İstanbul, Turkey
4İstanbul University-Cerrahpaşa, Cerrahpaşa Faculty of Medicine, Department of Pathology, İstanbul, Turkey
Figure 1. PET-CT showed aortic arch involvement and diffuse
bone marrow FDG uptake.
PET-CT: Positron emission tomography-computed tomography, FDG:
fluorodeoxyglucose
Figure 2. a) Bone marrow aspiration showed monocytic cells of
over 20% and monoblasts of 7%, with dysplasia in all cell lineages
(Giemsa 1000 x ). b) Bone marrow biopsy showed hyperplasia
and dysplasia in all cell lineages (hematoxylin & eosin, 400 x ). c)
Immunohistochemically, MPO is positive in very few cells (400 x ).
d) CD33 showed that monocytic cells are increased (400 x ).
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Serdal Uğurlu, M.D., İstanbul University-Cerrahpaşa, Cerrahpaşa
Faculty of Medicine, Department of Rheumatology, İstanbul, Turkey
E-mail : serdalugurlu@gmail.com ORCID: orcid.org/0000-0002-9561-2282
Received/Geliş tarihi: June 29, 2020
Accepted/Kabul tarihi: July 23, 2020
226
Turk J Hematol 2021;38:226-227
Öztaş M. et al: Giant Cell Arteritis with Concomitant Chronic Myelomonocytic Leukemia
A 62-year-old man with no previous medical conditions was
hospitalized with constitutional symptoms, which had started
within the past 2 months. He described recurrent fever
(>39 °C), weight loss, and headache. Initial physical examination
was unremarkable except for pallor of conjunctiva and
fever (39.3 °C). His hemoglobin was 7.5 g/dL (normal range:
13-17.2 g/dL), while white blood cell (WBC) and platelet
counts were 22.8x10 9 /L (normal: 4.3-10.3x10 9 /L) and 58.3x10 9 /L
(normal: 150-400x10 9 /L), respectively. He also had remarkable
monocytosis of 6.2x10 9 /L (normal: 0.3-0.9x10 9 /L). He had
elevated C-reactive protein of 150 mg/L (normal: <5 mg/L) and
an erythrocyte sedimentation rate of 140 mm/h. His blood and
urine cultures were sterile. On the suspicion of vasculitis and
in order to exclude concomitant malignancy, positron emission
tomography-computed tomography (PET-CT) was ordered,
which showed both aortic arch and ascending aorta involvement
without any signs of solid tumors (Figure 1). Diffuse bone
marrow fluorodeoxyglucose uptake was also observed on PET-CT.
Fragmentation of the lamina elastica interna was detected upon
temporal artery biopsy without any sign of active vasculitis. He
was diagnosed with giant cell arteritis (GCA) based on his age,
initial erythrocyte sedimentation level, headache, fever, and
large vessel involvement in PET-CT. He was further diagnosed
with chronic myelomonocytic leukemia (CMML) with peripheral
blood monocytosis (≥1x10 9 /L and monocytes accounting for
≥10% of the WBC differential count) [1]. Peripheral blood smear
revealed 8% blasts and bone marrow aspiration and biopsy were
consistent with CMML-1 (Figure 2). Prednisolone was initiated
at 40 mg/daily and his constitutional complaints were resolved.
Azacytidine was planned to be initiated for CMML, but the
patient decided to receive this treatment in his hometown.
While the pathogenic link between GCA and CMML has not been
clearly established so far, an association is commonly observed
between GCA and myelodysplastic syndromes [2].
Keywords: Giant cell arteritis, Vasculitis, Chronic myelomonocytic
leukemia, Leukemia
Anahtar Sözcükler: Dev hücreli arterit, Vaskülit, Kronik
myelomonositik lösemi, Lösemi
Informed Consent: Informed consent was obtained from the
individual participant included in this study.
Author Contributions
Concept: M.Ö., A.E.E., S.U; Design: M.Ö.; Data Collection or
Processing: I.M., M.Ö., A.E., A.S.D, S.B.; Interpretation: M.Ö.,
A.E.E., S.U.; Literature Search: M.Ö.; Writing: M.Ö., A.E.E., S.U.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Arber DA, Orazi A, Hasserjian R, Thiele J, Borowitz MJ, Le Beau MM,
Bloomfield CD, Cazzola M, Vardiman JW. The 2016 revision to the World
Health Organization classification of myeloid neoplasms and acute
leukemia. Blood 2016;127:2391-2405.
2. Roupie AL, de Boysson H, Thietart S, Carrat F, Seguier J, Terriou L, Versini M,
Queyrel V, Groh M, Benhamou Y, Maurier F, Decaux O, d’Aveni M, Rossignol
J, Galland J, Solary E, Willems L, Schleinitz N, Ades L, Dellal A, Samson M,
Aouba A, Fenaux P, Fain O, Mekinian A; on behalf of MINHEMON (French
Network of Dysimmune Disorders Associated with Hemopathies). Giant-cell
arteritis associated with myelodysplastic syndrome: French multicenter case
control study and literature review. Autoimmun Rev 2020;19:102446.
227
LETTERS TO THE EDITOR
Turk J Hematol 2021;38:228-245
Flower-Like Plasma Cell: A Comment
Çiçek Benzeri Plazma Hücresi: Bir Yorum
Smeeta Gajendra
Laboratory Oncology Unit, Dr. B.R.A. IRCH, AIIMS, New Delhi, India
To the Editor,
I read “Flower-Like Plasma Cell Nuclei in Multiple Myeloma”
by Sall et al. [1], recently published in this journal. This image
report is very descriptive and informative regarding a case of
multiple myeloma showing abnormal plasma cells with flowershaped
nuclear features. These morphological features can pose
a diagnostic dilemma and can mimic lymphoma as “flower
cells” or clover-leaf lymphocytes are described typically in
HTLV-1-induced adult T-cell leukemia and very rarely in B-cell
lymphoma [2]. Plasma cell myeloma or leukemia rarely presents
with flower‐shaped nuclei and occasional cases of plasma cell
leukemia mimicking adult T-cell leukemia/lymphoma were
previously reported in the literature [3,4]. Upon flowcytometric
immunophenotyping, the absence of B-cell or T-cell markers
and the presence of plasma cell markers with strong CD38
and CD138 help in differentiating it from lymphoma. The
morphological variation of abnormal plasma cells in plasma cell
neoplasms is vast, ranging from small lymphocyte-like cells to
cleaved, convoluted, monocytoid or multilobated plasma cells
to anaplastic pleomorphic large plasma cells, which have been
reported previously. A few cases of morphological variants of
plasma cell neoplasms, like megakaryocytic, plasmoblastic, or
megakaryoblastic mimicking acute leukemia, have also been
reported in the literature [5]. The presence of cytoplasmic
granulations, vacuolations, crystals (mimicking histiocytes),
Auer rod-like inclusions, or cytoplasmic projections has also
been noted in the literature. Morphological transformation
of plasma cells into multilobated nuclei during the clinical
course followed by anaplastic myeloma transformation is
also occasionally reported [6]. Circulating cells with cleaved,
multilobated, or monocytoid nuclei can be present in a variety
of non-hematologic and hematologic disorders, such as reactive
plasmacytosis associated with breast carcinoma, metastatic
carcinoma, plasma cell leukemia, myelomonocytic leukemia,
malignant lymphoma, and multiple myeloma [7]. Autoimmune
disorders, hepatitis C, human immunodeficiency virus
infections, angioimmunoblastic T-cell lymphoma, and Hodgkin
lymphoma are a few examples in which reactive plasmacytosis
of bone marrow may reach levels of up to 30%-50%. Abnormal
plasma cells can be differentiated from normal or reactive
plasma cells on flowcytometric immunophenotyping as
abnormal plasma cells are mostly CD19-, CD20+, CD27-, CD28+,
CD117+, CD56+, CD33+, CD200++, CD307++, CD81-weak to
-negative, and clonal for kappa or lambda immunoglobulin
[8]. The presence of flower cells in this case demonstrates
the use of immunophenotyping and FISH/cytogenetic studies
in the classification of atypical, multilobated flower-shaped
mononuclear cells and also that flower cell morphology is not
restricted only to lymphomas. Sometimes neoplastic plasma
cells exhibit cytoplasmic heterogeneity, which poses difficulty
in morphological diagnosis and requires ancillary technology
like biopsy with immunohistochemistry or immunophenotyping
for a definitive diagnosis.
Keywords: Flower cells, Plasma cell myeloma, Flowcytometric
immunophenotyping, Immunohistochemistry
Anahtar Sözcükler: Çiçek hücreler, Plazma hücre myelom, Akım
sitometrik immün fenotipleme, İmmünohistokimya
Financial Disclosure: The author declared that this study
received no financial support.
References
1. Sall A, Seck M, Samb D, Faye B, Gadji M, Diop S, Touré AO. Flower-like
plasma cell nuclei in multiple myeloma. Turk J Hematol 2021;38:153-154.
2. Singh N, Gandhi J, Agrawal N, Panaych A, Tejwani N, Mehta A. Diagnostic
dilemma in the morphological detection of flower cells in lymphomas.
Indian J Hematol Blood Transfus 2017;33:614-616.
3. De Miguel Sánchez C, Robles de Castro D, Pisón Herrero C, Pérez Persona
E, Salcedo Cuesta L, Guinea de Castro JM. Primary plasma cell leukaemia
presenting with flower-shaped nuclei. Br J Haematol 2021;193:689.
4. Shibusawa M. Plasma cell leukaemia presenting as flower-shaped plasma
cells mimicking adult T-cell leukaemia or lymphoma. Lancet Haematol
2020;7:e270.
5. Liu K, Song H, Shi J, Zhang W, Mu R, Li L. Rare case of plasma cell myeloma
with megakaryoblastic morphology mimicking acute leukemia. Indian J
Pathol Microbiol 2020;63:485-487.
6. Fujimi A, Nagamachi Y, Yamauchi N, Kanisawa Y. Morphological
transformation of myeloma cells into multilobated plasma cell
nuclei within 7 days in a case of secondary plasma cell leukemia
that finally transformed as anaplastic myeloma. Case Rep Hematol
2017;2017:5758368.
7. Yeh YA, Pappas AA, Flick JT, Butch AW. A case of aggressive multiple
myeloma with cleaved, multilobated, and monocytoid nuclei, and no serum
monoclonal gammopathy. Ann Clin Lab Sci 2000;30:283-288.
228
Turk J Hematol 2021;38:228-245
LETTERS TO THE EDITOR
8. Flores-Montero J, de Tute R, Paiva B, Perez JJ, Böttcher S, Wind H,
Sanoja L, Puig N, Lecrevisse Q, Vidriales MB, van Dongen JJ, Orfao A.
Immunophenotype of normal vs. myeloma plasma cells: toward antibody
panel specifications for MRD detection in multiple myeloma. Cytometry B
Clin Cytom 2016;90:61-72.
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Smeeta Gajendra, M.D., Laboratory Oncology Unit, Dr. B.R.A.
IRCH, AIIMS, New Delhi, India
Phone : 9013590875
E-mail : drsmeeta@gmail.com ORCID: orcid.org/0000-0002-1759-7857
Received/Geliş tarihi: April 12, 2021
Accepted/Kabul tarihi: April 26, 2021
DOI: 10.4274/tjh.galenos.2021.2021.0230
REPLY FROM THE AUTHORS
We thank Dr. Gajendra for the interest shown in our article.
She described in detail the morphological abnormalities, both
nuclear and cytoplasmic, of tumoral plasma cells as well as
reactive plasma cells.
We fully agree with her that, when in doubt, immunophenotyping
is an indispensable tool for distinguishing plasma cells.
Unfortunately, we do not have the cytogenetics to deepen this
characterization.
Regards,
Abibatou Sall, Moussa Seck, Diama Samb, Blaise Félix Faye,
Macoura Gadji, Saliou Diop, Awa Oumar Touré
Myeloma and Cystoisospora belli
Myelom ve Cystoisospora belli
Pathum Sookaromdee 1 , Viroj Wiwanitkit 2
1Private Academic Consultant, Bangkok, Thailand
2Honorary Professor, Dr. D.Y. Patil University, Pune, India
To the Editor,
We would like to share our ideas on “Prolonged Severe Watery
Diarrhea in a Long-Term Myeloma Survivor: An Unforeseen
Infection with Cystoisospora belli” regarding multiple
myeloma (MM) patients [1]. Tiryaki et al. [1] concluded that
“Parasitic infections are very uncommon… In MM diarrhea
points mainly to infection in acute or chronic form,” further
noting that, to their best knowledge, “this [was] the first
case of a patient with MM with C. belli infection” [1]. The
incidence of parasitic infection is usually associated with
local geography. In developing countries without good
hygienic foundations, parasitic infections are common
but there is usually no routine screening of MM patients.
In a recent report from Brazil, de Castro et al. [2] studied
infectious diarrhea in autologous stem cell transplantation
cases, including myeloma patients, and found that there
were many parasitic infections including C. belli infections. In
conclusion, we suggest a new recommendation for screening
for parasitic infection in any patients with MM and other
hematological malignancies.
Anahtar Sözcükler: Kan, Kanser, Myelom, Cystoisospora
Authorship Contributions
Concept: P.S., V.W.; Design: P.S., V.W.; Data Collection or
Processing: P.S., V.W.; Analysis or Interpretation: P.S., V.W.;
Literature Search: P.S., V.W.; Writing: P.S., V.W.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Tiryaki TO, Anıl KU, Büyük M, Yıldırım AY, Atasoy A, Örmeci AC, Beşışık SK.
Prolonged severe watery diarrhea in a long-term myeloma survivor: an
unforeseen infection with Cystoisospora belli. Turk J Hematol 2021;38:171-
173.
2. de Castro MD, Chebli JM, Costa LJ, Alves KRL, Atalla A, Neto AEH. Infectious
diarrhea in autologous stem cell transplantation: high prevalence of coccidia
in a South American center. Hematol Transfus Cell Ther 2018;40:132-135.
Keywords: Blood, Cancer, Myeloma, Cystoisospora
229
LETTERS TO THE EDITOR
Turk J Hematol 2021;38:228-245
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Pathum Sookaromdee, M.D., Private Academic Consultant,
Bangkok, Thailand
E-mail : pathumsook@gmail.com ORCID: orcid.org/0000-0002-8859-5322
Received/Geliş tarihi: June 8, 2021
Accepted/Kabul tarihi: July 25, 2021
DOI: 10.4274/tjh.galenos.2021.2021.0356
REPLY FROM THE AUTHORS
We have reviewed the commentary by Sookaromdee and
Wiwanitkit and our reply is as follows.
We observed a patient with long-term multiple myeloma
(MM) and an infrequent infection with Cystoisospora belli
[1]. An intestinal-type chronic diarrhea was the only symptom
contributing to the diagnosis. We wished to emphasize
awareness of C. belli infection in MM patients. Sookaromdee
and Wiwanitkit are of the same opinion as they mentioned the
importance of C. belli infection in MM patients and emphasized
that recommendations should be developed based on
regional characteristics, especially in relation to poor hygiene
conditions. They also cited an original study reported from
Brazil to demonstrate that the infection could be observed in
this patient population [2]. The mentioned study included 47
hematological malignancy patients and evaluated the infectious
complications in patients who underwent autologous stem cell
transplantation. The number of MM patients was 29. The study
did not specify infectious agents according to primary diagnosis.
The only result given in that study that might be pertinent for
C. belli infection was that the authors observed 7 coccidia cases.
Coccidia subgroups were not defined. For that reason, we did
not cite that study in our original manuscript. Indeed, our aim
was similar to that of Sookaromdee and Wiwanitkit; when
treating MM patients from variable hygienic backgrounds with
the complication of diarrhea, C. belli should be considered. Thus,
the letter above supports our original argument.
Tarık Onur Tiryaki, Kadir Uluç Anıl, Melek Büyük,
Ahmet Yasir Yıldırım, Alp Atasoy, Aslı Çiftçibaşı Örmeci,
Sevgi Kalayoğlu Beşışık
References
1. Tiryaki TO, Anıl KU, Büyük M, Yıldırım AY, Atasoy A, Örmeci AC, Beşışık SK.
Prolonged severe watery diarrhea in a long-term myeloma survivor: an
unforeseen infection with Cystoisospora belli. Turk J Hematol 2021;38:171-
173.
2. de Castro MD, Chebli JM, Costa LJ, Alves KRL, Atalla A, Neto AEH. Infectious
diarrhea in autologous stem cell transplantation: high prevalence of coccidia
in a South American center. Hematol Transfus Cell Ther 2018;40:132-135.
Lenalidomide Combined with Interferon α-1b and Interleukin-2 in
the Treatment of 21 Cases of Acute Myeloid Leukemia
Yirmi Bir Akut Myeloid Lösemi Olgusunda İnterferon α-1b ve Interlökin-2 ile Birlikte
Lenalidomid Tedavisi
Cheng Cheng*, Ruihua Mi*, Dongbei Li, Lin Chen, Xudong Wei
Affiliated Tumor Hospital of Zhengzhou University, Henan Cancer Hospital, Department of Hematology, Zhengzhou, China
*These authors contributed equally to this work.
To the Editor,
The prognosis of patients with refractory/relapsed acute
myeloid leukemia (R/R AML) is extremely poor and the longterm
survival rate is less than 10%. Minimal residual disease
(MRD) is an important independent prognostic indicator of
AML, indicating a higher risk of recurrence; thus, it is vital
for the prognosis of patients to eliminate MRD [1,2]. Our
center previously used thalidomide combined with interferon
α-1b (IFN α-1b) and interleukin-2 (IL-2) in the treatment
of R/R AML and the total effective rate was 50% [3,4]. We
further optimized the treatment plan, adjusted thalidomide
to lenalidomide, and applied it for 21 patients with R/R AML
or MRD.
All patients were treated with lenalidomide combined with
the IFN α-1b and IL-2 regimen. The specific treatment plan
was as follows: oral administration of lenalidomide capsule,
230
Turk J Hematol 2021;38:228-245
LETTERS TO THE EDITOR
10-25 mg, every night; IFN-α1b, 60 µg; and IL-2, 1,000,000 U
subcutaneous injection, once every other day. Each treatment
cycle lasted 4 weeks. This retrospective analysis was approved by
the Institutional Review Board of Henan Cancer Hospital.
Among 17 patients with R/R AML, 7 patients had complete
remission (CR), 2 had CR with incomplete recovery of blood
cells (CRi), and 8 had no remission. One patient in the
low-risk group achieved CR, while the remission rate in the
intermediate-risk group and high-risk group was 57.1%
(4/8) and 50% (4/8), respectively. Of 3 patients with TET2
mutations, 2 patients achieved remission; 6 patients with
FLT3-ITD/TKD mutations were given sorafenib at the same
time and 3 patients achieved remission. Particularly, among
the 4 MRD-positive patients with remission of AML, the MRD
of 3 patients was lower than before and the MRD of 1 patient
was higher than before. These patients’ clinical data are
presented in Table 1. The total effective rate (CR+CRi+MRD
decreased) of 21 patients was 57.1%. No treatment-related
deaths occurred. The median overall survival time of the
21 patients was 26 months (9-89 months), and the 3-year
survival rate reached 42.9%. Among patients with effective
application of this regimen, the duration of relief ranged
from 2 to 28+ months.
IFN can directly kill AML by inhibiting growth-promoting
cytokines, inducing apoptosis, and inhibiting cell proliferation.
Meanwhile, it is possible to indirectly target AML cells
through the immunostimulatory effects of interferon on
dendritic cells, T-cells, and natural killer (NK) cells [5,6]. IL-2
increases the proliferation and activity of cytotoxic T-cells,
NK-cells, and killer cells activated by lymphokines. It can also
promote the secretion of antibodies and interferon to play an
anti-tumor role [7]. Lenalidomide promotes tumor cell
apoptosis by inhibiting the secretion of tumor necrosis factor
α, IL-1, and IL-12. It also produces an anti-tumor effect by
inhibiting the secretion of overexpressed vascular endothelial
growth factor [8,9,10].
The combination of lenalidomide, IFN α-1b, and IL-2 showed
improvements in efficacy and safety profiles as compared to
monotherapy among patients with R/R AML, and especially
in the elimination of MRD, and it may become a promising
treatment regimen.
Keywords: Acute myeloid leukemia, Refractory/relapsed,
Minimal residual disease, Lenalidomide, Interferon α-1b,
Interleukin-2
Anahtar Sözcükler: Akut myeloid lösemi, Dirençli/nüks, Minimal
kalıntı hastalık, Lenalidomid, İnterferon α-1b, İnterlökin-2
Table 1. Clinical data of 21 patients with refractory/relapsed or minimal residual disease-positive acute myeloid leukemia treated with lenalidomide combined with
interferon α-1b and interleukin-2.
OS
(months)
Duration of
remission
(months)
Remission
status
Bone marrow
cellularity
Marrow blasts
(%) before the
application of
the regimen
Status
NCCN risk
category
FAB
typing
Gene mutation
Karyotype at first
diagnosis
Age
(years)
No. Sex
1 F 53 Normal TET2 M2a Intermediate Refractory 14% Hypocellular CR 5 16
2 M 63 Complex karyotype TET2 M2a High Refractory 39% Normocellular NR - 9
3 M 59 Normal (-) M5b Intermediate Refractory 68% Hypercellular NR - 11
4 F 36 Normal U2AF1 M0 Intermediate First relapse 53% Normocellular NR - 20
5 F 57 Normal FLT3-ITD M1 High Second relapse 10% Normocellular NR - 15
6 M 60 Normal FLT3-ITD, IDH1, NPM1 M1 Intermediate First relapse 1.6% Normocellular CR 4 26
7 F 60 Normal (-) M2a Intermediate Second relapse 12.5% Hypocellular CRi 20 71
8 F 65 Normal DNMT3A M2a High First relapse 5% Normocellular CR 8 17
9 M 61 Normal ASXL1, PHF6 M2a High Second relapse 12.5 Hypocellular CR 7 44
10 F 66 Normal (-) M2a Low Second relapse 14.8%, Normocellular NR - 89
C-KIT M2b Intermediate Second relapse 7.9% Normocellular CRi 11 54
46,XX,t(8,21)
(q22,q22)
11 F 59
231
LETTERS TO THE EDITOR
Turk J Hematol 2021;38:228-245
Table 1. Continued.
OS
(months)
Duration
of
remission
(months)
Remission
status
Bone marrow
cellularity
Marrow blasts
(%) before the
application of
the regimen
Status
NCCN risk
category
FAB
typing
Gene mutation
Karyotype
at first
diagnosis
Age
(years)
No. Sex
FLT3-ITD M2b High Second relapse 9.8% Normocellular CR 14 53
46,XY,t(8;21)
(q22;q22)
12 M 68
13 M 59 Normal FLT3-ITD M4 High First relapse 4.8% Hypocellular NR - 22
14 M 67 47,XY,+8[10] (-) M4 Intermediate First relapse 12.4% Normocellular NR - 28
M5 High First relapse 27.2% Normocellular NR - 20
FLT3-TKD, DNMT3A,
NPM1
15 M 55 Normal
16 F 58 Normal TET2 M5b Intermediate First relapse 48% Hyperactive CR 2 18
17 F 43 Normal FLT3-ITD, NPM1 M7 High First relapse 12.2% Normocellular CR 9 20
Hypocellular CR 22 37
0%, AML-ETO/
ABL 0.010%
(-) M2a Low CR with MRD+
46,XY,t(8;21)
(q22;q22)[10]
18 M 28
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Normocellular CR 23 51
0.2%, AML-ETO/
ABL 0.082%
(-) M2b Low CR with MRD+
46,XX,t(8,21)
(q22,q22)[20]
19 M 38
Normocellular CR - 41
0%, CBFB-
MYH11A/ABL
0.016%
M4 Low CR with MRD+
IKZF1, ERG, MLL-
PTD
46,XY,inv(16)
(p13q22)[17]
20 M 47
Hypocellular CR 28 52
0.8%, WT1/ABL
0.40%
IDH2, TET2 M5b High CR with MRD+
46,XY,add
(12)(q24)
(8)/47,idm,
+8(2)
21 M 58
FAB: French-American-British; NCCN: National Comprehensive Cancer Network; OS: overall survival; CR: complete remission; MRD: minimal residual disease; CRi: CR with incomplete recovery of blood cells; NR: no
remission.
Authorship Contributions
Concept: C.C., R.M. D.L., L.C., X.W.; Writing: C.C., R.M.
Conflict of Interest: No conflict of interest was
declared by the authors.
Financial Disclosure: This study was supported
by the Henan Science and Technology Research
Project (No. 192102310056; No. 202102310053).
References
1. Dohner H, Weisdorf DJ, Bloomfield CD. Acute myeloid
leukemia. N Engl J Med 2015;373:1136-1152.
2. Schuurhuis GJ, Heuser M, Freeman S, Béné M-C, Buccisano
F, Cloos J, Grimwade D, Haferlach T, Hills RK, Hourigan CS,
Jorgensen JL, Kern W, Lacombe F, Maurillo L, Preudhomme
C, van der Reijden BA, Thiede C, Venditti A, Vyas P, Wood BL,
Walter RB, Döhner K, Roboz GJ, Ossenkoppele GJ. Minimal/
measurable residual disease in AML: a consensus document
from the European LeukemiaNet MRD Working Party. Blood
2018;131:1275-1291.
3. Wei XD, Ai H, Mi RH, Chen L, Yuan FF, Hao QM, Yin QS,
Wang P, Song YP. Thalidomide combined with interferon
and interleukin-2 in treatment of relapsed or refractory
acute myelogenous leukemia. Zhonghua Nei Ke Za Zhi
2016;5511:875-877.
4. Mi RH, Chen L, Wei XD, Yin QS, Wang MF, Liang LJ, Yuan
FF, Li MJ, Ji XJ, Song YP. Therapeutic effect of combined
use of interferon alpha-1b, interleukin-2 and thalidomide
on reversing minimal residual disease in acute myeloid
leukemia. Zhonghua Xue Ye Xue Za Zhi 2019;40:111-116.
5. Anguille S, Lion E, Willemen Y, Van Tendeloo VF, Berneman
ZN, Smits EL. Interferon-α in acute myeloid leukemia: an
old drug revisited. Leukemia 2011;25:739-748.
6. Ferrantini M, Capone I, Belardelli F. Interferon-α and cancer:
mechanisms of action and new perspectives of clinical use.
Biochimie 2007;89:884-893.
7. Inamoto Y, Fefer A, Sandmaier BM, Gooley TA, Warren
EH, Petersdorf SH, Sanders JE, Storb RF, Appelbaum FR,
Martin PJ, Flowers ME. A phase I/II study of chemotherapy
followed by donor lymphocyte infusion plus interleukin-2
for relapsed acute leukemia after allogeneic hematopoietic
cell transplantation. Biol Blood Marrow Transplant
2011;17:1308-1315.
8. Skarbnik AP, Goy AH. Lenalidomide for mantle cell
lymphoma. Expert Rev Hematol 2015;8:257-264.
9. Ruan J, Martin P, Shah B, Schuster SJ, Smith SM, Furman
RR, Christos P, Rodriguez A, Svoboda J, Lewis J, Katz O,
Coleman M, Leonard JP. Lenalidomide plus rituximab as
initial treatment for mantle-cell lymphoma. N Engl J Med
2015;373:1835-1844.
10. Luo J, Gagne JJ, Landon J, Avorn J, Kesselheim AS.
Comparative effectiveness and safety of thalidomide and
lenalidomide in patients with multiple myeloma in the
United States of America: a population-based cohort study.
Eur J Cancer 2017;70:22-33.
232
Address for Correspondence/Yazışma Adresi: Xudong Wei, Prof., Affiliated Tumor Hospital of Zhengzhou
University, Henan Cancer Hospital, Department of Hematology, Zhengzhou, China
Phone : 0371-65587358
E-mail : xudongwei@zzu.edu.cn ORCID: orcid.org/0000-0002-6289-2011
Received/Geliş tarihi: January 19, 2021
Accepted/Kabul tarihi: May 17, 2021
DOI: 10.4274/tjh.galenos.2021.2020.0050
Turk J Hematol 2021;38:228-245
LETTERS TO THE EDITOR
Shoulder-Pad Sign in a Case of Amyloidosis Associated with
Myeloma
Myelom ile İlişkili Sistemik Amiloidoz Olgusunda Omuz-Yastığı Işareti
Ceren Uzunoğlu 1 , Tayfur Toptaş 2 , Yıldız İpek 2 , Fatma Arıkan 2 , Fergün Yılmaz 2 , Tülin Tuğlular 2
1Marmara University Training and Research Hospital, Clinic of Internal Disease, İstanbul, Turkey
2Marmara University Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey
To the Editor,
A 78-year-old female was admitted with the complaints of
multiple joint swellings that had progressed over 8 months,
involving the shoulders, elbows, wrists, knees, and ankles.
On physical examination, she had generalized edema. The
tongue was enlarged. Joint examination revealed swelling and
tenderness of the bilateral anterior parts of the shoulders,
elbows, wrists, knees, and ankles (Figure 1).
“Shoulder-pad sign” is the prominent appearance of the bilateral
anterior deltoid area. It is rare but suggestive for amyloid
light-chain amyloidosis. It is mostly associated with the kappa
light chain, which has a predilection for amyloid deposition in
periarticular tissues [1].
Her complete blood count and calcium levels were as follows:
leukocytes, 5100/µL; hemoglobin, 5.2 g/dL; hematocrit,
16%; platelets, 313,000/µL; serum calcium, 11.9 mg/dL.
Serum total protein and albumin levels were 4.6 g/dL and
3.0 g/dL, respectively. Serum free light chain kappa, lambda, and
kappa/lambda ratio were 6792 mg/L, 7.31 mg/L, and 929,
respectively. Serum immunofixation electrophoresis was
consistent with the kappa monoclonal band. Proteinuria (5 g)
was identified upon 24-h urine analysis.
Bone marrow biopsy showed plasma cells infiltrating 86% of
bone marrow (Figure 2). No lytic bone lesions were detected on
positron emission tomography-computed tomography, but there
were joint involvements compatible with inflammatory processes.
Significant thickening of the subdeltoid bursa was evident upon
shoulder magnetic resonance imaging (Figure 3). Bone marrow
biopsy with Congo red staining revealed a green birefringent
color representing amyloid deposition. A diagnosis of systemic
amyloidosis associated with multiple myeloma was made.
Figure 2. Bone marrow biopsy showed plasma cells infiltrating
86% of bone marrow.
Figure 1. Joint examination revealed swelling and tenderness of
the bilateral anterior parts of the shoulders, elbows, wrists, knees,
and ankles.
Figure 3. Significant thickening of the subdeltoid bursa was
evident upon shoulder magnetic resonance imaging.
233
LETTERS TO THE EDITOR
Turk J Hematol 2021;38:228-245
In amyloidosis, joint or soft tissue involvement rarely occurs [2]. It
was reported that 3.7% of 191 patients with systemic amyloidosis
had amyloid arthropathy and the shoulders were the most
commonly affected joints [3]. Due to symmetrical joint involvement
with pain, swelling, and limitation of movement, rheumatologic
diseases might be considered in the differential diagnosis.
Keywords: Shoulder pad, Multiple myeloma, Kappa light chain,
AL amyloidosis
Anahtar Sözcükler: Omuz yastığı, Multipl myelom, Kappa hafif
zincir, AL amiloidoz
Informed Consent: Obtained.
Authorship Contributions
Concept: C.U., T.T., Y.İ., F.A., F.Y., T.T.; Design: C.U., T.T., Y.İ., F.A.,
F.Y., T.T.; Data Collection or Processing: C.U., T.T., Y.İ., F.A., F.Y.,
T.T.; Analysis or Interpretation: C.U., T.T., Y.İ., F.A., F.Y., T.T.;
Literature Search: C.U., T.T., Y.İ., F.A., F.Y., T.T.; Writing: C.U., T.T.,
Y.İ., F.A., F.Y., T.T.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Liepnieks JJ, Burt C, Benson MD. Shoulder-pad sign of amyloidosis: structure
of an Ig kappa III protein. Scand J Immunol 2001;54:404-408.
2. Gertz MA, Lacy MQ, Dispenzieri A, Buadi FK. Immunoglobulin light
chain (AL) amyloidosis. In: Greer JP, Arber DA, Glader BE, List AF, Means
RT Jr, Rodgers GM (eds). Wintrobe’s Clinical Hematology, 14th Edition.
Philadelphia, Wolters Kluwer, 2019.
3. Prokaeva T, Spencer B, Kaut M, Ozonoff A, Doros G, Connors LH, Skinner M,
Seldin DC. Soft tissue, joint, and bone manifestations of AL amyloidosis:
clinical presentation, molecular features, and survival. Arthritis Rheum
2007;56:3858-3868.
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Tayfur Toptaş, M.D., Marmara University Training and
Research Hospital, Clinic of Hematology, İstanbul, Turkey
Phone : +90 505 457 55 57
E-mail : tayfur.toptas@marmara.edu.tr ORCID: orcid.org/0000-0002-2690-8581
Received/Geliş tarihi: October 21, 2020
Accepted/Kabul tarihi: May 20, 2021
DOI: 10.4274/tjh.galenos.2021.2021.0630
Sweet Syndrome Associated with Ixazomib
İksazomib ile İlişkili Sweet Sendromu
İrfan Yavaşoğlu,
Zahit Bolaman
Aydın Adnan Menderes University Faculty of Medicine, Department of Hematology, Aydın, Turkey
To the Editor,
A 69-year-old male patient was diagnosed with immunglobulin
G-kappa chain type symptomatic multiple myeloma according
to International Myeloma Working Group criteria (hemoglobin
9.8 g/dL, creatinine 1.5 mg/dL). The case was categorized
as Revised International Staging System (R-ISS) stage 2
[β2-microglobulin 4 mg/L; high risk not detected by fluorescence
in situ hybridization (FISH)], and because of the patient’s renal
failure, he was started on bortezomib-cyclophosphamidedexamethasone.
After eight cycles (stem cell mobilization
was performed after four cycles), peripheral blood stem cell
transplantation with high-dose melphalan was performed with
the patient in full remission. Lenalidomide and dexamethasone
(lenalidomide 25 mg/day, days 1-21; dexamethasone 40 mg/day,
days 1, 8, 15, and 22) were started after a clinical recurrence at
the 26th month of follow-up. The patient was in R-ISS stage 3 at
the time of relapse (FISH with 17p was 12% positive). Ixazomib
(4 mg/day, days 1, 8, and 15) was added to the treatment due
to stable disease findings at the 3 rd month of evaluation. On
the 13 th day of treatment, he presented with a high fever
(38.7 °C) and sudden, painful, 1- to 2-cm-diameter indurated,
erythematous, papular lesions on the front and back of the neck
(Figure 1). Laboratory tests showed a white blood cell count
of 2.1x10 9 /L, neutrophil cell count of 1.4x10 9 /L, hemoglobin
concentration of 8.9 g/dL, and platelet count of 37x10 9 /L. Skin
biopsy revealed marked perivascular neutrophilic inflammatory
infiltration in the dermis, consistent with Sweet syndrome.
While arthralgia and myalgia were present, as seen in cases of
Sweet syndrome, no ocular inflammation, headaches, or oral
or genital lesions appeared. There was no granulocyte colonystimulating
factor usage, the antinuclear antibody (ANA) test
was negative, and no signs of infection were detected. Ixazomib
was stopped. Triamcinolone acetonide (0.1%) was applied
locally. The lesions disappeared significantly by the 10 th day.
One of the common side effects of ixazomib has been reported
234
Turk J Hematol 2021;38:228-245
LETTERS TO THE EDITOR
Keywords: Sweet syndrome, Ixazomib
Anahtar Sözcükler: Sweet sendromu, İksazomib
Informed Consent: Informed consent was obtained from the
patient.
Authorship Contributions
Surgical and Medical Practices: İ.Y.; Concept: İ.Y., Z.B.; Design:
İ.Y., Z.B.; Data Collection or Processing: İ.Y.; Analysis or
Interpretation: İ.Y.; Literature Search: İ.Y.; Writing: İ.Y.
Conflict of Interest: No conflict of interest was declared by the
authors.
Figure 1. Painful, 1- to 2-cm-diameter indurated, erythematous,
papular lesions.
to be rash (36% in all degrees) [1]. To our knowledge, there is
rarely a relationship between ixazomib and Sweet syndrome
[2,3,4]. Lenalidomide is known to frequently cause rashes and
rarely Sweet syndrome. This usually occurs shortly after its
use [5]. No skin lesions were observed in our patient during 3
months of lenalidomide usage. Other causes of Sweet syndrome
were not considered since ANA was negative, there were no
signs of infection, and the lesions disappeared after ixazomib
discontinuation. It is emphasized that diagnosis was finalized
with the revised Sweet syndrome criteria: typical rash (abrupt
onset of painful or tender erythematous papules, plaques, or
nodules) and histopathological (dense dermal neutrophilic
infiltrate) findings. It has been stated that no separate criteria
are required for drugs [6]. In conclusion, it should be kept in
mind that rashes associated with Sweet syndrome may appear
during treatment with ixazomib.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Moreau P, Masszi T, Grzasko N, Bahlis NJ, Hansson M, Pour L, Sandhu I, Ganly
P, Baker BW, Jackson SR, Stoppa AM, Simpson DR, Gimsing P, Palumbo A,
Garderet L, Cavo M, Kumar S, Touzeau C, Buadi FK, Laubach JP, Berg DT, Lin
J, Di Bacco A, Hui AM, van de Velde H, Richardson PG; TOURMALINE-MM1
Study Group. Oral ixazomib, lenalidomide, and dexamethasone for multiple
myeloma. N Engl J Med 2016;374:1621-1634.
2. Suyama T, Ito S, Shinagawa A. Ixazomib-induced Sweet’s syndrome. Int J
Hematol 2020;111:161-162.
3. Oka S, Ono K, Nohgawa M. Ixazomib-induced Sweet’s syndrome. Leuk
Lymphoma 2019;60:3590-3591.
4. Katz H, Shenouda M, Dahshan D, Sonnier G, Lebowicz Y. A rare case of
ixazomib-induced cutaneous necrotizing vasculitis in a patient with
relapsed myeloma. Case Rep Hematol 2019;2019:6061484.
5. Hoverson AR, Davis MD, Weenig RH, Wolanskyj A. Neutrophilic dermatosis
(Sweet syndrome) of the hands associated with lenalidomide Arch Dermatol
2006;142:1070-1071.
6. Nofal A, Abdelmaksoud A, Amer H, Nofal E, Yosef A, Gharib K, Albalat
W, Eldesouky F, Ebrahim H, Abdelshafy AS, Fayed H. Sweet’s syndrome:
diagnostic criteria revisited. J Dtsch Dermatol Ges 2017;15:1081-1088.
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: İrfan Yavaşoğlu, M.D., Aydın Adnan Menderes University
Faculty of Medicine, Department of Hematology, Aydın, Turkey
Phone : +90 256 212 00 20
E-mail : dryavas@hotmail.com.com ORCID: orcid.org/0000-00003-1703-2175
Received/Geliş tarihi: March 31, 2021
Accepted/Kabul tarihi: June 11, 2021
DOI: 10.4274/tjh.galenos.2021.2021.0210
235
LETTERS TO THE EDITOR
Turk J Hematol 2021;38:228-245
Long Non-Coding RNA MALAT1 Contributed to the Proliferation of
PNH Clone in Paroxysmal Nocturnal Hemoglobinuria Patients
Uzun Kodlama Yapmayan RNA, MALAT1, Paroksismal Noktürnal Hemoglobinüri Hastalarında
PNH Klonal Proliferasyonuna Katkı Sağlar
Honglei Wang*, Yingying Chen*, Hui Liu, Zhaoyun Liu, Rong Fu
*These authors contributed equally to this work.
Tianjin Medical University General Hospital, Department of Hematology, Tianjin, China
To the Editor,
Paroxysmal nocturnal hemoglobinuria (PNH) is an acquired
clonal disorder of hematopoietic stem cells caused by
somatic mutation of the phosphatidylinositol glycan A gene
(PIG-A) on chromosome Xp22.1 [1]. The PIG-A mutation is
necessary but insufficient to explain PNH clone proliferation.
The mechanism of the proliferative advantage of the PNH
clone has not yet been clarified. At present, studies on the
mechanism of PNH clone proliferation are mainly focused
on protein-coding genes, while the function and clinical
significance of non-coding RNAs (ncRNAs), and in particular
long ncRNAs (LncRNAs), in PNH remain unknown. MALAT1 is
one of the most extensively studied LncRNAs. It was found
localized in the nucleus and expressed in a variety of tissues
[2]. MALAT1 can regulate cell proliferation, differentiation,
apoptosis, migration, and autophagy, among others [3].
MALAT1 has been demonstrated to be involved in many
cancers, cardio-cerebrovascular disease, and hematological
malignancies. However, knowledge of the action of MALAT1
in PNH is still lacking. The purpose of our study was to
investigate the role of MALAT1 in PNH clone proliferation
and to find a new therapeutic direction for PNH.
A total of 30 PNH patients, including 22 PNH patients and 8
aplastic anemia (AA)-PNH patients, were enrolled in our study
according to international PNH Study Group Criteria [4]. CD59 –
and CD59 + granulocytes and monocytes were obtained by
flow cytometry (Figures 1A and 1B). MALAT1 expressions were
verified for these 30 PNH patients by quantitative real-time
polymerase chain reaction (qRT-PCR). The clinical features of the
PNH patients, primers of MALAT1, and methods of cell sorting
and qRT-PCR are available from the authors as supplementary
data. Correlations were analyzed with clinical indexes, including
hemoglobin (Hb), white blood cell count (WBC), platelet count
(PLT), reticulocytes (Ret), lactate dehydrogenase (LDH), total
bilirubin (TBIL), and PNH clones.
As the results of qRT-PCR showed, MALAT1 (3.070±2.503)
expressions in CD59 – cells were consistently higher than those
in CD59+ cells (1.281±1.246, p=0.0004) among these 30 PNH
patients (Figure 1C).
High expression of MALAT1 was negatively correlated with Hb
level (r=-0.3894, p=0.0334) and positively correlated with the
percentage of Ret (r=0.4481, p=0.0168), LDH levels (r=0.6244,
p=0.0307), and CD59 – granulated and monocyte cell ratio
(r=0.5188, p=0.0049) (Figure 1D).
The level of MALAT1 in PNH clone cells was found to be
significantly increased and was correlated with clinical indicators
of PNH. The molecular functions of MALAT1 include alternative
splicing, transcriptional regulation, and competing endogenous
RNA functions. MALAT1 was shown to bind alternative splicing
factor SRSF1 in hepatocellular carcinoma development [5].
In another study, MALAT1 promoted the proliferation and
imatinib resistance of chronic myeloid leukemia cells via the
MALAT1/miR-328 axis [6]. MALAT1 downregulated miR-181a-5p
through the Hippo-YAP signaling pathway, resulting in regulation
of myeloma cell proliferation [7]. MALAT1 could also induce
tolerogenic dendritic cells and immune tolerance in autoimmune
diseases by regulating the miRNA-155/DC-SIGH/IL10 axis [8].
These results illustrate that MALAT1 plays an important role not
only in malignant tumors but also in benign diseases.
The characteristics of clonal dynamics and selection forces of
PNH clones are similar to those of tumors. Thus, we predict
that MALAT1 may have an important function in contributing
to proliferation advantages and restraining apoptosis in PNH
progression. The mechanism remains to be further studied.
Keywords: Paroxysmal nocturnal hemoglobinuria, LncRNA,
Clone proliferation, MALAT1
Anahtar Sözcükler: Paroksismal noktürnal hemoglobinüri,
LncRNA, Klonal proliferasyon, MALAT1
Informed Consent: Our study complied with the International
Ethical Guidelines for Biomedical Research Involving Human
Subjects (2002) developed by the Council for International
Organizations of Medical Sciences (CIOMS) in collaboration
236
Turk J Hematol 2021;38:228-245
LETTERS TO THE EDITOR
Figure 1. A) The cells of 30 PNH patients were sorted by flow cytometry to obtain CD59 – and CD59 + granulocytes and monocytes.
Granulocytes and monocytes were selected as sorting objects in the first flow diagram, and CD59 – (P2) and CD59 + (P3) granulocytes
and monocytes were selected in the second flow diagram by CD59 sorting. B) Sorting purity of the CD59 – and CD59 + granulocytes and
monocytes. The sorting purity is about 90%. C) MALAT1 expression of the CD59 – and CD59 + cells in 30 PNH patients. D) Correlation
analysis between MALAT1 expression and clinical data. The expression of MALAT1 was negatively correlated with the proportion of the
level of Hb and positively correlated with the percentage of Ret, LDH levels, and the proportion of PNH clones.
with the World Health Organization (WHO) and was approved
by the Ethics Committee of Tianjin Medical University.
Authorship Contributions
Design: R.F.; Data Collection or Processing: H.W., Y.C., H.L., Z.L.;
Writing: H.W., Y.C.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: This work was supported by the National
Natural Science Foundation of China (Grant nos. 81770110,
81900131, 82000128), the Tianjin Municipal Natural Science
Foundation (Grant nos. 18JCYBJC27200, 18JCQNJC80400), and
the Tianjin Education Commission Research Project (2018KJ043,
2018KJ045).
References
1. Hill A, DeZern AE, Kinoshita T, Brodsky RA. Paroxysmal nocturnal
haemoglobinuria. Nat Rev Dis Primers 2017;3:17028.
2. Lei L, Chen J, Huang J, Lu J, P ei S, Ding S, Kang L, Xiao R, Zeng Q. Functions
and regulatory mechanisms of metastasis-associated lung adenocarcinoma
transcript 1. J Cell Physiol 2018;234:134-151.
3. Zhang X, Hamblin MH, Yin KJ. The long noncoding RNA Malat1: its
physiological and pathophysiological functions. RNA Biol 2017;14:1705-
1714.
4. Parker C, Omine M, Richards S, Nishimura J, Bessler M, Ware R, Hillmen
P, Luzzatto L, Young N, Kinoshita T, Rosse W, Socié G; International PNH
Interest Group. Diagnosis and management of paroxysmal nocturnal
hemoglobinuria. Blood 2005;106:3699-3709.
5. Malakar P, Shilo A, Mogilevsky A, Stein I, Pikarsky E, Nevo Y, Benyamini
H, Elgavish S, Zong X, Prasanth KV, Karni R. Long noncoding RNA MALAT1
promotes hepatocellular carcinoma development by SRSF1 upregulation
and mTOR activation. Cancer Res 2017;77:1155-1167.
237
LETTERS TO THE EDITOR
Turk J Hematol 2021;38:228-245
6. Wen F, Cao YX, Luo ZY, Liao P, Lu ZW. LncRNA MALAT1 promotes cell
proliferation and imatinib resistance by sponging miR-328 in chronic
myelogenous leukemia. Biochem Biophys Res Commun 2018;507:1-8.
7. Sun Y, Jiang T, Jia Y, Zou J, Wang X, Gu W. LncRNA MALAT1/miR-181a-5p
affects the proliferation and adhesion of myeloma cells via regulation of
Hippo-YAP signaling pathway. Cell Cycle 2019;18:2509-2523.
8. Wu J, Zhang H, Zheng Y, Jin X, Liu M, Li S, Zhao Q, Liu X, Wang Y, Shi M, Zhang
S, Tian J, Sun Y, Zhang M, Yu B. The long noncoding RNA MALAT1 induces
tolerogenic dendritic cells and regulatory T cells via miR155/dendritic cellspecific
intercellular adhesion molecule-3 grabbing nonintegrin/IL10 axis.
Front Immunol 2018;9:1847.
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Rong Fu, M.D., Tianjin Medical University General Hospital,
Department of Hematology, Tianjin, China
Phone : (086) 02260817181
E-mail : florai@sina.com ORCID: orcid.org/0000-0002-9928-9224
Received/Geliş tarihi: January 22, 2021
Accepted/Kabul tarihi: March 16, 2021
DOI: 10.4274/tjh.galenos.2021.2021.0065
Supplemental Table 1. Clinical characteristics of 30 paroxysmal nocturnal hemoglobinuria patients.
Characteristics
Total no. of patients 30
Values
Gender, M/F 19/11
Age, years, median (range) 41 (16-68)
Clinical classification, n (%)
Classical PNH 22 (73.33)
AA-PNH 8 (26.67)
History of thrombosis, n (%) 11 (36.67)
Hb (g/L) 79.71±23.97
Ret (%) 8.285±5.589
WBC (x10 9 /L) 5.47±3.29
PLT (x10 9 /L) 116.00±95.03
TBIL (µmol/L) 34.53±18.59
LDH (U/L) 1543.00±1181.0
Granulocyte CD59– (%) 74.90±24.39
Erythrocyte CD59– (%) 47.50±31.77
PNH: Paroxysmal nocturnal hemoglobinuria; AA-PNH: aplastic anemia-paroxysmal nocturnal hemoglobinuria; Hb: hemoglobin; Ret: reticulocytes; WBC: white blood cell count; PLT:
platelet count; TBIL: total bilirubin; LDH: lactate dehydrogenase.
Supplemental Table 2. Gene primer sequences.
Gene Forward Reverse Annealing temperature, °C
MALAT1 GCAGCAGTTCGTGGTGAAGATAGG TCGCCTCCTCCGTGTGGTTG 58.0
GAPDH CAGGAGGCATTGCTGATGAT GAAGGCTGGGGCTCATTT
238
Turk J Hematol 2021;38:228-245
LETTERS TO THE EDITOR
Dicentric (7;12)(p11;p11) in T/Myeloid Mixed-Phenotype Acute
Leukemia
T/Myeloid Karışık-Fenotip Akut Lösemide Disentrik (7;12)(p11;p11)
Smeeta Gajendra 1 , Akshay Ramesh Gore 2 , Nitin Sood 3 , Manorama Bhargava 2
1Department of Laboratory Oncology, All India Institute of Medical Sciences, Dr. B.R.A. Institute Rotary Cancer Hospital, New Delhi, India
2Department of Hematopathology, Medanta - The Medicity, Gurgaon, India
3Department of Medical Oncology & Hematology, Medanta - The Medicity, Gurgaon, India
To the Editor,
Mixed-phenotype acute leukemia (MPAL) is a rare heterogeneous
group of acute leukemias with immunophenotypic
co-expression of more than one cell lineage, which could be
bilineal or biphenotypic. MPAL could be further classified
as B/myeloid, T/myeloid, B/T-lymphoid, and, more rarely,
trilineage B/T/myeloid. “MPAL, T/myeloid, not otherwise
specified” is a rare variant of this disease accounting for <1%
of all leukemias [1]. It is associated with male predominance,
frequent lymphadenopathy, and poor prognosis [2]. Most of
the cases have clonal chromosomal abnormalities, but none
are specific for this group. Here, we report a case of T/myeloid
bilineage acute leukemia with unusual cytogenetic features
upon karyotyping and fluorescence in situ hybridization (FISH),
with karyotyping showing a dicentric chromosome between
the derivative chromosome 7 and chromosome 12, dic(7;12)
(p11;p11).
A 51-year-old male presented with generalized weakness and
loss of appetite. On examination, he had pallor and abdominal
mass with hepatomegaly (2 cm below the right costal margin).
Abdominal computed tomography showed multiple large
lymph nodes in the paraaortic, aortocaval, paracaval, celiac
axis, periportal, and mesenteric regions, the largest measuring
3.0x2.5 cm in the left paraaortic region. Fine-needle aspiration
of the paraaortic lymph node showed clusters of pleomorphic
cells, suggesting a lymphoproliferative lesion. Complete blood
count showed hemoglobin of 7.7 g/dL, total leukocyte counts of
9.0x10 9 /L, and platelets of 156x10 9 /L. Peripheral blood smear and
bone marrow aspirate showed 70% and 85% blasts, respectively.
Morphologically, there were two distinct populations of blasts,
one that was larger with 2-3 prominent nucleoli and moderate
to abundant amounts of granular cytoplasm (Figure 1A), while
the other was of medium size with inconspicuous nucleoli and
scanty agranular cytoplasm (Figure 1B). Upon flowcytometric
immunophenotyping (Figure 1E), there were two different
blast populations seen in the CD45-moderate blast region,
extending into the monocytic region: a blast population in the
CD45-moderate region with high side scatter (~60% of blasts),
extending to the monocytic region, was positive for cMPO, CD13,
CD33, CD64, CD14, HLA-DR, CD38, CD11b, CD71, CD123, CD56,
CD4, CD117, CD7, and CD11c and negative for cCD79a, CD19,
CD10, cCD3, CD8, CD3, CD5, CD2, CD1a, and CD16, while the
blast population present in the CD45-moderate region with low
side scatter (~40% of blasts) was positive for cCD3, CD3, CD7,
CD5, CD34, HLA-DR, CD38, CD99, TdT, and CD33 and negative
for cCD79a, cMPO, CD19, CD10, CD1a, CD2, CD4, CD8, CD13,
CD14, and CD64. Immunohistochemistry based on bone marrow
biopsy also showed sheets of blasts comprising two populations
of blasts with myeloid (CD33, CD117) and T lymphoid markers
(CD3, CD5, CD7). The overall features were consistent with MPAL
of myeloid and T lymphoblastic lineage (MPAL: T/myeloid).
Karyotyping (Figure 1C) showed a dicentric chromosome formed
between chromosome 7 and 12: 45,XY, dic(7;12)(p11;p11).
Dicentric chromosomes involving 12p are associated with loss
of 12p material, often including the ETV6 (TEL) gene localized in
12p 13.2. The karyotyping findings were supported by FISH using
the ETV6/RUNX1 probe (Figure 1D), which showed deletion of
the ETV6 (TEL) gene localized on 12p13.2. Real-time quantitative
polymerase chain reaction results for PML-RARA, AML1-ETO,
RUNX1:RUNX1T1, CBFB - MYH11, FLT3 ITD and TKD, D835,
NPM1, BCR-ABL1, and KIT were negative. The patient began
hyper-CVAD induction chemotherapy comprising
cyclophosphamide, vincristine, doxorubicin, and dexamethasone.
On day 19, he developed febrile neutropenia. Blood culture
showed growth of Pseudomonas, for which he was treated, and
he recovered. The patient was assessed after completion of four
cycles and he achieved a complete morphological remission
with this regimen.
T/myeloid MPAL is rare and characterized by the presence of
both T and myeloid lineage markers in immunophenotyping.
Although the specific type and frequency of genetic
abnormalities associated with T/myeloid MPAL are largely
unknown, some chromosomal abnormalities described in
the literature commonly include recurrent monosomies 7p
and/or 12p [2,3,4,5]. Structural abnormalities in the short
arm of chromosome 12 are observed in a broad spectrum of
hematological malignancies including myeloid malignancies
239
LETTERS TO THE EDITOR
Turk J Hematol 2021;38:228-245
Figure 1. A) Bone marrow aspirate showing two distinct populations of blasts (insets showing two types of blasts). Bone marrow biopsy
(hematoxylin and eosin stain; 400 x ) with immunohistochemistry showing two populations of blasts with mixed myeloid (CD33) and
T lymphoid markers (CD7 and CD5). B) Flowcytometry showing two blast populations positive for myeloid CD33, CD64, CD14, and T
lymphoid markers (cCD3, CD5, CD7). C) Karyogram showing dicentric chromosome formed between 7 and 12, dic(7;12)(p11;p11), with
GTG staining and banding method, 100 x oil immersion, Carl Zeiss Axioscope Z2, processed using IKAROS software. D) Fluorescence in situ
hybridization analysis with interphase nuclei and metaphase showing deletion of the ETV6 (TEL) gene localized on 12p 13.2 using the
ETV6/RUNX1 DC, DF probe (ETV6 - orange, RUNX1 - green; ZytoVision, Germany).
and acute lymphoblastic leukemia. Various aberrations result in
abnormal 12p, including balanced translocations, deletions, and
formation of dicentric chromosomes. Dicentric chromosomal
abnormalities have been reported in many hematological
malignancies including myelodysplastic syndrome, acute myeloid
leukemia [6], and acute lymphoblastic leukemia [7,8,9,10], and
dic(7;12) is a rare but recurrent chromosomal abnormality
described mainly in childhood acute lymphoblastic leukemia
[7]. A case of dic(7;12)(p11;p11) in T/myeloid biphenotypic acute
leukemia has also been reported; that patient was successfully
treated with myeloablative stem cell transplantation [2]. A rare
case of new dic(7;12)(p12.21;p12.2) chromosome aberration
was also reported in a patient with acute myeloid leukemia with
FAB-M1 morphology. It is known that dic(7;12) results in partial
monosomies of 7p and 12p, leading to concomitant deletions
of tumor suppressor genes from both chromosomes, which
plays a role in the pathogenesis of hematological malignancies.
As MPAL with dic(7;12) is rarely reported in the literature, the
prognostic significance and definite therapeutic regimens for
these patients have not yet been established.
Keywords: Dicentric (7;12), Mixed-phenotype acute leukemia,
Fluorescence in situ hybridization, ETV6/RUNX1
240
Turk J Hematol 2021;38:228-245
LETTERS TO THE EDITOR
Anahtar Sözcükler: Disentrik (7;12), Karışık-fenotip akut lösemi,
Floresan in situ hibridizasyon, ETV6/RUNX1
Informed Consent: Informed consent was obtained from the
patient.
Authorship Contributions
Concept: S.G.; Data Collection or Processing: S.G., N.S.; Analysis
or Interpretation: A.R.G, M.B.; Writing: S.G.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Borowitz MJ, Bene MC, Harris NL, Porwit A, Matutes E, Arber DA. Acute
leukemias of ambiguous lineage. In: Swerdlow SH, Campo E, Harris NL,
Jaffe ES, Pileri SA, Stein H, Thiele J (eds). WHO Classification of Tumours of
Haematopoietic and Lymphoid Tissues, Revised 4th Edition, Volume 2. Lyon,
IARC Press, 2017.
2. Matsumoto Y, Taki T, Fujimoto Y, Taniguchi K, Shimizu D, Shimura K,
Uchiyama H, Kuroda J, Nomura K, Inaba T, Shimazaki C, Horiike S, Taniwaki
M. Monosomies 7p and 12p and FLT3 internal tandem duplication: possible
markers for diagnosis of T/myeloid biphenotypic acute leukemia and its
clonal evolution. Int J Hematol 2009;89:352-358.
3. Rubio MT, Dhedin N, Boucheix C, Bourhis JH, Reman O, Boiron JM, Gallo
JH, Lhéritier V, Thomas X, Fière D, Vernant JP. Adult T-biphenotypic acute
leukaemia: clinical and biological features and outcome. Br J Haematol
2003;123:842-849.
4. Tiribelli M, Damiani D, Masolini P, Candoni A, Calistri E, Fanin R. Biological
and clinical features of T-biphenotypic acute leukaemia: report from a
single centre. Br J Haematol 2004;125:814-815.
5. Owaidah TM, Al Beihany A, Iqbal MA, Elkum N, Roberts GT. Cytogenetics,
molecular and ultrastructural characteristics of biphenotypic acute
leukemia identified by the EGIL scoring system. Leukemia 2006;20:620-626.
6. MacKinnon RN, Campbell LJ. The role of dicentric chromosome formation
and secondary centromere deletion in the evolution of myeloid malignancy.
Genet Res Int 2011;2011:643628.
7. Raimondi SC, Privitera E, Williams DL, Look AT, Behm F, Rivera GK, Crist
WM, Pui CH. New recurring chromosomal translocations in childhood acute
lymphoblastic leukemia. Blood 1991;77:2016-2022.
8. Pan J, Xue Y, Wu Y, Wang Y, Shen J. Dicentric (7;9)(p11;p11) is a rare but
recurrent abnormality in acute lymphoblastic leukemia: a study of 7 cases.
Cancer Genet Cytogenet 2006;169:159-163.
9. Wafa A, Jarjour RA, Aljapawe A, ALmedania S, Liehr T, Melo JB, Carreira
IM, Othman MAK, Al-Achkar W. An acquired stable variant of a
dicentric dic(9;20) and complex karyotype in a Syrian childhood B-acute
lymphoblastic leukemia case. Mol Cytogenet 2020;13:29.
10. Illade L, Fioravantti V, Andion M, Hernandez-Marques C, Madero L,
Lassaletta A. Dicentric translocation (9;12) in acute lymphoblastic
leukemia: a chromosomal abnormality with an excellent prognosis? Tumori
2017;103(Suppl 1):e44-e46.
11. Tapinassi C, Gerbino E, Malazzi O, Micucci C, Gasparini P, Najera MJ,
Calasanz MJ, Odero MD, Pelicci PG, Belloni E. A new dic(7;12)(p12.21;p12.2)
chromosome aberration in a case of acute myeloid leukemia. Cancer Genet
Cytogenet 2008;185:102-105.
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Smeeta Gajendra, Asst. Prof., Department of Laboratory
Oncology, All India Institute of Medical Sciences, Dr. B.R.A. Institute Rotary Cancer Hospital, New Delhi, India
Phone : 9013590875
E-mail : drsmeeta@gmail.com ORCID: orcid.org/0000-0002-1759-7857
Received/Geliş tarihi: May 2, 2021
Accepted/Kabul tarihi: June 29, 2021
DOI: 10.4274/tjh.galenos.2021.2021.0280
A Novel Variant in the ACVRL1 Gene in a Patient with Cirrhosis
and Hereditary Hemorrhagic Telangiectasia
Herediter Hemorajik Telenjiektazi ve Sirozu Olan bir Hastada ACVRL1 Geninde Saptanan Yeni
Bir Varyant
Mehmet Baysal 1 , Nihan Alkış 1 , Hakan Gürkan 2 , Ahmet Muzaffer Demir 3
1Bursa City Hospital, Clinic of Hematology, Bursa, Turkey
2Trakya University Faculty of Medicine, Department of Medical Genetics, Edirne, Turkey
3Trakya University Faculty of Medicine, Department of Hematology, Edirne, Turkey
To the Editor,
Hereditary hemorrhagic telangiectasia (HHT) is a rare bleeding
disorder characterized by arteriovenous malformations (AVMs),
telangiectasia, and bleeding episodes [1]. Pulmonary, hepatic,
and cerebral AVMs may be seen in the course of the disease
[2]. Mutations in the ENG, ACVRL1, and SMAD4 genes were
associated with HHT [3]. A 65-year-old man was admitted
to our hospital with anemia and intermittent nose bleeding.
241
LETTERS TO THE EDITOR
Turk J Hematol 2021;38:228-245
Upon physical examination, telangiectasias were noticed on his
face and nose. Further investigations in his work-up revealed
hypochromic microcytic anemia with a hemoglobin level of
8 g/dL. Detailed laboratory analysis revealed iron deficiency
anemia. In the upper gastrointestinal endoscopy performed
for iron deficiency anemia, grade 1 esophageal varices were
detected and intravenous iron carboxymaltose treatment was
planned. His epistaxis severity score was 3.22, which can be
categorized as mild bleeding [4].
Family history revealed positive findings for nose bleeds and
telangiectasia in his first-degree relatives and molecular
genetic analysis was performed on a next-generation sequence
analysis platform (NextSeq550-Illumina) using the QIAseq
Targeted DNA Panel Kit (CDHS-14647Z-252-QIAGEN), which
includes the ACVRL1, ADAM17, ENG, GDF2, PTPN14, RASA1, and
SMAD4 genes. Variant analysis was performed using QIAGEN
Clinical Insight software. As a result of the bioinformatics
analysis performed considering the ACMG-2015 criteria, the
NM_000020.3(ACVRL1):c.1415G>A (p.Trp472Ter) variant was
evaluated as pathogenic according to the PVS1, PM2, and PP3
rules (in silico analysis results - DANN score: 0.9944, GERP score:
4.4, MutationTaster: Disease causing). The ACVRL1:c.1415G>A
variant was reported in the dbSNP database with reference
number rs1555154144, but its clinical significance was not
reported in the ClinVar or HGMD Professional 2020.3 databases.
The minor allele frequency was not reported in the dbSNP, ExAC,
or GnomAD_exome databases [5,6]. Computed tomography of
the abdomen showed nodularity of the surface of the liver, a
heterogeneous appearance of the liver parenchyma, and atrophy
of the left liver lobe (Figure 1). No arteriovenous malformations
were found in the liver and evaluation of the portal venous
system was normal. Hepatitis virus markers, immunoglobulin
levels, and autoimmune markers were normal. As the patient’s
anamnesis was detailed, a history of regular alcohol consumption
was noted and the patient was diagnosed with Child A liver
parenchymal disease. A colonoscopic evaluation of the patient
was also performed, and multiple small telangiectases were seen
in the rectal mucosa. Local preventive measures and tranexamic
acid were given for epistaxis and low-dose propranolol was
started for grade 1 esophageal varices.
Gastric and hepatic manifestations of HHT are broad, and on
rare occasions HHT can be associated with liver cirrhosis [7,8].
However, as in our case, HHT and alcohol intake have both
caused and triggered liver cirrhosis. Our patient has stopped
consuming alcohol and is being followed as an outpatient for
both HHT and cirrhosis. Mutations in the ACVRL1 gene occur
more frequently in HHT type 2 patients, and according to the
University of Utah mutation database there are 571 confirmed
variants in the ACVRL1 gene associated with HHT; our novel
variation was not reported before [9]. Regardless of the age
of the patient, HHT should be on the physician’s mind when
Figure 1. Computed tomography of the abdomen showed
nodularity of the surface of the liver, a heterogeneous appearance
of the liver parenchyma, and atrophy of the left liver lobe.
evaluating a patient with telangiectasias and unexplained iron
deficiency.
Keywords: Hereditary hemorrhagic telangiectasia, ACVRL1
mutation, Cirrhosis, Epistaxis, Anemia
Anahtar Sözcükler: Herediter hemorajik telenjiektazi, ACVRL1
mutasyonu, Siroz, Epistaksis, Anemi
Informed Consent: Informed consent has been obtained from
the patient.
Authorship Contributions
Concept: M.B., N.A., H.G., A.M.D.; Design: M.B., N.A., H.G., A.M.D.;
Data Collection or Processing: M.B., N.A., H.G., A.M.D.; Analysis
or Interpretation: M.B., N.A., H.G., A.M.D.; Literature Search:
M.B., N.A., H.G., A.M.D.; Writing: M.B., N.A., H.G., A.M.D.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Shovlin CL, Guttmacher AE, Buscarini E, Faughnan ME, Hyland RH,
Westermann CJ, Kjeldsen AD, Plauchu H. Diagnostic criteria for hereditary
hemorrhagic telangiectasia (Rendu-Osler-Weber syndrome). Am J Med
Genet 2000;91:66-67.
2. Faughnan ME, Mager JJ, Hetts SW, Palda VA, Lang-Robertson K, Buscarini
E, Deslandres E, Kasthuri RS, Lausman A, Poetker D, Ratjen F, Chesnutt
MS, Clancy M, Whitehead KJ, Al-Samkari H, Chakinala M, Conrad M,
242
Turk J Hematol 2021;38:228-245
LETTERS TO THE EDITOR
Cortes D, Crocione C, Darling J, de Gussem E, Derksen C, Dupuis-Girod S,
Foy P, Geisthoff U, Gossage JR, Hammill A, Heimdal K, Henderson K, Iyer
VN, Kjeldsen AD, Komiyama M, Korenblatt K, McDonald J, McMahon J,
McWilliams J, Meek ME, Mei-Zahav M, Olitsky S, Palmer S, Pantalone R,
Piccirillo JF, Plahn B, Porteous MEM, Post MC, Radovanovic I, Rochon PJ,
Rodriguez-Lopez J, Sabba C, Serra M, Shovlin C, Sprecher D, White AJ,
Winship I, Zarrabeitia R. Second international guidelines for the diagnosis
and management of hereditary hemorrhagic telangiectasia. Ann Intern
Med 2020;173:989-1001.
3. Baysal M, Demir S, Ümit EG, Gurkan H, Bas V, Karaman Gülsaran S, Demirci
U, Kirkizlar HO, Demir AM. Genetic diagnosis of hereditary hemorrhagic
telangiectasia: four novel pathogenic variations in Turkish patients. Balkan
Med J 2020;37:43-46.
4. Hoag JB, Terry P, Mitchell S, Reh D, Merlo CA. An epistaxis severity score for
hereditary hemorrhagic telangiectasia. Laryngoscope 2010;120:838-843.
5. Bossler AD, Richards J, George C, Godmilow L, Ganguly A. Novel mutations
in ENG and ACVRL1 identified in a series of 200 individuals undergoing
clinical genetic testing for hereditary hemorrhagic telangiectasia (HHT):
correlation of genotype with phenotype. Human Mutation 2006;27:667-
675.
6. Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde
M, Lyon E, Spector E, Voelkerding K, Rehm HL; ACMG Laboratory Quality
Assurance Committee. Standards and guidelines for the interpretation of
sequence variants: a joint consensus recommendation of the American
College of Medical Genetics and Genomics and the Association for
Molecular Pathology. Genet Med 2015;17:405-424.
7. Xu BG, Liang J, Jia KF, Han T. Liver cirrhosis in a patient with hepatic
hereditary hemorrhagic telangiectasia and Budd-Chiari syndrome: a case
report. BMC Gastroenterol 2020;20:169.
8. Tortora A, Riccioni ME, Gaetani E, Ojetti V, Holleran G, Gasbarrini A. Rendu-
Osler-Weber disease: a gastroenterologist’s perspective. Orphanet J Rare Dis
2019;14:130.
9. University of Utah. Hereditary Hemorrhagic Telangiectasia Mutation
Database. Salt Lake City, University of Utah Department of Pathology, 2020.
Available at http://www.arup.utah.edu/database/HHT.
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Mehmet Baysal, M.D., Bursa City Hospital, Clinic of
Hematology, Bursa, Turkey
Phone : +90 535 966 41 88
E-mail : drmehmetbaysal@gmail.com ORCID: orcid.org/0000-0001-7681-4623
Received/Geliş tarihi: December 15, 2020
Accepted/Kabul tarihi: March 22, 2021
DOI: 10.4274/tjh.galenos.2021.2020.0749
Can Hematological Findings of COVID-19 in Pediatric Patients
Guide Physicians Regarding Clinical Severity?
Pediatrik Hastalarda COVID-19 Hematolojik Bulguları Klinisyenlere Klinik Ciddiyet Açısından
Yol Gösterebilir mi?
Kamile Ötiken Arıkan, Şahika Şahinkaya, Elif Böncüoğlu, Elif Kıymet, Ela Cem, Aybüke Akaslan Kara, Nuri Bayram,
İlker Devrim
University of Health Sciences Turkey, İzmir Dr. Behçet Uz Children Hospital, Clinic of Pediatric Infectious Disease, İzmir, Turkey
To the Editor,
The coronavirus disease-19 (COVID-19) pandemic originated
in December 2019 in the city of Wuhan, the capital of Hubei
Province, China. The virus then spread to numerous other
countries in Asia and by January 2020 infected patients were
identified in Europe [1]. Children of all ages are susceptible to
infection by severe acute respiratory syndrome-coronavirus-2,
the causative agent. Most children have relatively mild clinical
symptoms without fever or pneumonia [2,3,4,5,6,7,8].
We conducted a retrospective study at the University of Health
Sciences Turkey, İzmir Dr. Behçet Uz Children’s Hospital between
March 30 and October 31, 2020.
A total of 3878 pediatric patients were tested and 353
(9.1%) of them were diagnosed with COVID-19. Of these 353
children, 184 (52.1%) were male (52.1%) (female/male: 0.91).
The median age of the patients was 9 years (range: 4 days to
17 years). Thirty-five (9.9%) patients had underlying diseases,
most commonly a neurological disease (n=9). Regarding
severity, 9 (2.5%), 293 (83%), 38 (10.8%), and 13 (3.7%)
cases were diagnosed as asymptomatic, mild, moderate, and
severe/critical, respectively. Neutropenia (47.9%) was the
most common abnormal parameter in complete blood counts,
followed by lymphocytosis (22.4%), lymphopenia (20.7%),
leukopenia (9.1%), neutrophilia (6.5%), and thrombocytopenia
(3.4%) (Table 1).
Neutropenia was statistically significantly more common
in neonates (84.6%). Lymphocytosis and neutrophilia
were statistically significantly more common in infants
(75.9%, p<0.001 and 23.3%, p<0.001, respectively). Lymphopenia
and leukopenia were statistically significantly more common in
patients >11 years old (38.4%, p<0.001 and 15.2%, p=0.025,
243
LETTERS TO THE EDITOR
Turk J Hematol 2021;38:228-245
Table 1. Comparisons of hematologic and biochemical parameters of patients according to disease severity.
Asymptomatic Mild Moderate Severe/Critical p
Hemoglobin (g/dL)* 13.5 (8.9-14.3) 12.5 (8.9-11.5) 12.3 (6.6-16) 8.9 (2.5-13.1) 0.001
Leukocytes (x10 3 /µL)* 6.4 (2.8-12.5) 6.0 (3.0-25.2) 6.0 (2.2-19.2) 9.9 (4.0-13.1) 0.39
Leukocytosis* 1 (11.1) 14 (5.6) 6 (15) 2 (28.6) 0.011
Leucopenia** 2 (22.2) 24 (9.5) 6 (15) 0 (0) 0.79
ANC (x10 3 /µL)* 2.4 (0.86-3.7) 2.6 (0.11-17.7) 2.7 (0.16-10.9) 6.8 (0.7-10.3) 0.12
Neutropenia** 7 (77.8) 138 (54.8) 22 (55) 2 (28.6) 0.174
ALC (x10 3 /µL)* 2.2 (1.2-9.1) 2.2 (0.23-14.6) 2.7 (0.7-8.2) 1.7 (0.68-6) 0.93
Lymphocytosis** 4 (44.4) 61 (24.3) 12 (30) 2 (28.6) 0.90
Lymphopenia** 2 (22.2) 56 (22.3) 12 (30) 3 (42.9) 0.13
Platelets (x10 3 /µL)* 321 (128-547) 263 (52-595) 258 (146-665) 196 (55-358) 0.15
Thrombocytopenia** 1 (11.1) 6 (2.4) 2 (5) 3 (42.9) 0.001
Neutrophil-to-lymphocyte ratio* 0.84 (0.2-3) 1.12 (0.04-28) 1.32 (0.11-4.6) 3.39 (0.23-10) 0.25
Platelet-to-lymphocyte ratio* 114 (59-301) 110 (24-830) 126 (38-268) 101 (0-287) 0.82
Lymphocyte-to-white blood cell ratio* 0.48 (0.22-0.73) 0.39 (0.03-0.92) 0.37 (0.16-0.70) 0.22 (0.09-0.61) 0.27
RDW (%)* 12.3 (12-13.1) 12.9 (11.2-13.2) 12.9 (11.6-19.5) 14.9 (13-19.6) 0.005
MPV (fL)* 9.5 (8.5-11.5) 9.8 (8-13.6) 9.7 (8.2-11.7) 10.7 (8.7-12.8) 0.15
PDW (%)* 9.3 (8.5-14.9) 10.6 (7.3-22) 10.5 (8.1-14.8) 13.6 (7.6-16.8) 0.26
Prothrombin time (seconds)* 13.2 (9.5-14.1) 12.8 (9.4-17.7) 13 (11-16.4) 14.7 (12.9-20.9) 0.037
Increased PT** 0 (0) 10 (6.7) 1 (3.4) 4 (33.3)
aPTT (seconds)
Fibrinogen (mg/dL)*
29.6 (24.3-35.8)
224 (189-409)
31.9 (17.9-61.10)
260 (136-967)
31.2 (21.5-39.1)
273 (100-510)
31.3 (23.7-46)
374 (98-510)
Serum D-dimer (ng/mL)* 180 (150-231) 150 (70-3145) 150 (150-1887) 1235 (394-3037) <0.001
Increased D-dimer** 0 (0) 25 (17.1) 7 (22.6) 6 (100) <0.001
Serum ferritin (µg/L)* 16.9 (9.5-48.8) 40.2 (3-343) 39.8 (16.6-137) 134 (44-2051) 0.003
Increased ferritin** 0 (0) 9 (11.8) 2 (10) 3 (42.9)
ANC: Absolute neutrophil count; ALC: absolute lymphocyte count; RDW: red cell distribution width; MPV: mean platelet volume; PDW: platelet distribution width; PT: prothrombin
time; aPTT: activated partial thromboplastin time.
*: Median (min-max).
**: n (%).
0.91
0.26
respectively). Patients older than 11 years of age were more
often thrombocytopenic, but this finding was not statistically
significant (p=0.17).
The neutrophil-to-lymphocyte ratio (NLR) was higher in
severe/critical cases compared to cases of asymptomatic, mild,
and moderate severity [median NLR values in asymptomatic,
mild, moderate, and severe cases were as follows: 0.84 (range:
0.2-3), 1.12 (0.04-28), 1.32 (0.11-4.6), and 3.39 (0.23-10),
respectively; p=0.25].
The platelet-to-lymphocyte ratio statistically significantly
increased as age increased.
Lymphocyte-to-white blood cell ratio statistically significantly
decreased as age increased and it was lower in severe/critical
cases compared to cases of asymptomatic, mild, and moderate
severity. Red cell distribution width (RDW) statistically
significantly increased in severe cases (median values in
asymptomatic, mild, moderate, and severe cases were as follows:
12.3 [range: 12-13.1], 12.9 [11.2-13.2], 12.9 [11.6-19.5], and
14.9 [13-19.6], respectively; p=0.005). Median serum ferritin
and D-dimer were statistically significantly increased in severe
cases. Increased serum D-dimer was found to increase the risk
of disease severity 2.9-fold (95% confidence interval: 0.13-0.85,
p=0.022).
In our findings, the NLR ratio was higher in severe/critical
cases compared to cases of asymptomatic, mild, and moderate
severity. Qin et al. [6] reported an increase in NLR in patients
with severe disease compared to those without [8]. In our
findings, RDW levels were also significantly higher in severe
cases. In adult studies, it was concluded that elevated RDW at
the time of hospital admission and an increase in RDW during
hospitalization were associated with increased mortality
244
Turk J Hematol 2021;38:228-245
LETTERS TO THE EDITOR
risk for patients with COVID-19, compatible with our results
[6,9,10].
We recommend that clinicians closely monitor leukocyte
count, lymphocyte count, platelet count, serum D-dimer,
serum ferritin, and RDW as markers for potential progression
to critical illness.
Keywords: COVID-19, Hematological parameters, Clinical
severity, Red cell distribution width, Lymphopenia
Anahtar Sözcükler: COVID-19, Hematolojik parametreler, Klinik
şiddeti, Kırmızı küre dağılım aralığı
Informed Consent: Retrospective study.
Authorship Contributions
Concept: K.Ö.A., İ.D.; Design: K.Ö.A., İ.D., A.A.K., Ş.Ş., E.C., E.B., E.K.;
Data Collection or Processing: K.Ö.A.; Analysis or Interpretation:
K.Ö.A., N.B., İ.D.; Literature Search: K.Ö.A.; Writing: K.Ö.A.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: The authors declared that this study
received no financial support.
References
1. Lu H, Stratton CW, Tang YW. Outbreak of pneumonia of unknown etiology
in Wuhan, China: the mystery and the miracle. J Med Virol 2020;92:401-
402.
2. Zhou MY, Xie XL, Peng YG, Wu MJ, Deng XZ, Wu Y, Xiong LJ, Shang LH. From
SARS to COVID-19: what we have learned about children infected with
COVID-19. Int J Infect Dis 2020;96:710-714.
3. Jiang L, Tang K, Levin M, Irfan O, Morris SK, Wilson K, Klein JD, Bhutta
ZA. COVID-19 and multisystem inflammatory syndrome in children and
adolescents. Lancet Infect Dis 2020;20:276-288.
4. Lippi G, Plebani M. The critical role of laboratory medicine during
coronavirus disease 2019 (COVID-19) and other viral outbreaks. Clin Chem
Lab Med 2020;58:1063-1069.
5. Henry BM, Lippi G, Plebani M. Laboratory abnormalities in children with
novel coronavirus disease 2019. Clin Chem Lab Med 2020;58:1135-1138.
6. Sharma D, Dayama A, Banerjee S, Bhandhari S, Chatterjee A, Chatterjee
D. To study the role of absolute lymphocyte count and RDW in COVID 19
patients and their association with appearance of symptoms and severity. J
Assoc Physicians India 2020;68:39-42.
7. Qin C, Zhou L, Hu Z, Zhang S, Yang S, Tao Y, Xie C, Ma K, Shang K, Wang W,
Tian DS. Dysregulation of immune response in patients with coronavirus
2019 (COVID-19) in Wuhan, China. Clin Infect Dis 2020;71:762-768.
8. Tang N, Li D, Wang X, Sun Z. Abnormal coagulation parameters are associated
with poor prognosis in patients with novel coronavirus pneumonia. J
Thromb Haemost 2020;18:844-847.
9. Wang C, Zhang H, Cao X, Deng R, Ye Y, Fu Z, Gou L, Shao F, Li J, Fu W,
Zhang X, Ding X, Xiao J, Wu C, Li T, Qi H, Li C, Lu Z. Red cell distribution
width (RDW): a prognostic indicator of severe COVID-19. Ann Transl Med
2020;8:1230.
10. Henry BM, Benoit JL, Benoit S, Pulvino C, Berger BA, Olivera MHS, Crutchfield
CA, Lippi G. Red blood cell distribution width (RDW) predicts COVID-19
Severity: a prospective, observational study from the Cincinnati SARS-
CoV-2 Emergency Department Cohort. Diagnostics (Basel) 2020;10:618.
©Copyright 2021 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Kamile Ötiken Arıkan, M.D., University of Health Sciences
Turkey, İzmir Dr. Behçet Uz Children Hospital, Clinic of Pediatric Infectious Disease, İzmir, Turkey
Phone : +90 545 281 19 35
E-mail : kamilearikan15@gmail.com ORCID: orcid.org/0000-0002-1610-4395
Received/Geliş tarihi: March 2, 2021
Accepted/Kabul tarihi: April 26, 2021
DOI: 10.4274/tjh.galenos.2021.2021.0157
245
Advisory Board of This Issue (September 2021)
Abhishek Maiti, USA
Ayşe Çırakoğlu, Turkey
Ayşegül Gündüz, Turkey
Bela Balint, Serbia
Birsen Karaman, Turkey
Brenda W. Cooper, USA
Cem Mirili, Turkey
Claudio Cerchione, Italy
Daniel Vasile Balaban, Romania
Deniz Tuğcu, Turkey
Elif Ünal, Turkey
Emine Zengin, Turkey
Engin Kelkitli, Turkey
Eric Solary, France
Fahri Şahin, Turkey
Felicetto Ferrara, Italy
Giuseppe Visani, Italy
Güçhan Alanoğlu, Turkey
İnci Alacacıoğlu, Turkey
Jan Palmblad, Sweden
Jose Perdomo, Australia
L E Damon, USA
Manu Goyal, India
Marie Detrait, France
Marius J. Coetzee, South Africa
Massimo Martino, Italy
Mehmet Çandır, Turkey
Meral Beksaç, Turkey
Özden Hatirnaz Ng, Turkey
Parvind Singh, India
Piero Farruggia, Italy
Pınar Bayrak Toydemir, USA
Rauf Haznedar, Turkey
Rejin Kebudi, Turkey
Selin Aytaç, Turkey
Şule Mine Bakanay Öztürk, Turkey
Sushant Kumar Meinia, India
Tuğrul Elverdi, Turkey
Vahid Afshar-Kharghan, USA
Vanessa Innao, Italy
Vassiliki Pappa, Greece
Wei Cui, USA
Yeşim Oymak, Turkey