Evaluation of MassCleave™ Technology For Diagnostic Mutation ...

More documents

Recommendations

Info

3819 del GTAAA C-froward C froward
Frameshifts not flagged �� 4184 del TCAA base 231-234 231 234 fragment L – 2/9 missed �� Close proximity <strong>of</strong> 2 nd mutation �� Only T-forward T forward gives unambiguous signals �� Both amplicons failed/poor quality in T-forward T forward �� T rich fragment in C-reverse C reverse Rxn TF TF CF CF CF CR CR mass 5520 5247 2990 5210 6913* 3761 2479 Relative frequency in normal 1 0 1 1 0 1 0 Relative frequency in mutant 0.5 0.5 0.5 0.5 0.5 0.5 0.5 CAAGAAGAACAAAGCAT AAGAAGAACAAAGCAT AAGAAGAAC TTGGAAGAAAATAATC TTGGAAGAAAATAAGAAGAAC TTGATTATTTTC TTATTTTC Sequence
Page 1 and 2: Evaluation of MassCleave MassCleave
Page 3 and 4: MassCleave MassCleave Evaluation
Page 5 and 6: Mutation type Insertion Deletion He
Page 7: Frameshifts not flagged �� 3819
Page 11 and 12: 2731 ins T T-reverse T reverse
Page 13 and 14: 3450 del CAAG T-forward T forward
Page 15 and 16: Summary �� Design non-optimal n
Page 17 and 18: �� Larger study Further work
Page 19: Preliminary report available at htt

Evaluation of MassCleave™ Technology For Diagnostic Mutation ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?