Microbiology Research - Academic Journals

African Journal of 

Microbiology Research 

Volume 6 Number 24 28 June, 2012 

ISSN 1996-0808

About AJMR 

The African Journal of Microbiology Research is published monthly (one volume per year) by Academic 

Journals. 

The African Journal of Microbiology Research (ISSN 1996-0808, IMPACT FACTOR 0.533) is an open access 

journal that provides rapid publication (weekly) of articles in all areas of Microbiology such as: Environmental 

Microbiology, Clinical Microbiology, Immunology, Viriology, Bacteriology, Phycology, Mycology and 

Parasitology, Protozoology, Microbial Ecology, Probiotics and Prebiotics, Molecular Microbiology, 

Biotechnology, Food Microbiology, Industrial Microbiology, Cell Physiology, Environmental Biotechnology, 

Genetics, Enzymology, Molecular and Cellular Biology, Plant Pathology, Entomology, Biomedical Sciences, 

Botany and Plant Sciences, Soil and Environmental Sciences, Zoology, Endocrinology, Toxicology. The Journal 

welcomes the submission of manuscripts that meet the general criteria of significance and scientific 

excellence. Papers will be published shortly after acceptance. All articles are peer-reviewed. 

Submission of Manuscript 

Submit manuscripts as e-mail attachment to the Editorial Office at: ajmr.acadjourn@gmail.com. A manuscript 

number will be mailed to the corresponding author shortly after submission. 

For all other correspondence that cannot be sent by e-mail, please contact the editorial office (at 

ajmr.acadjourn@gmail.com. 

The African Journal of Microbiology Research will only accept manuscripts submitted as e-mail attachments. 

Please read the Instructions for Authors before submitting your manuscript. The manuscript files should be 

given the last name of the first author.

Editors 

Prof. Dr. Stefan Schmidt 

Applied and Environmental Microbiology 

School of Biochemistry, Genetics and Microbiology 

University of KwaZulu-Natal 

Private Bag X01 

Scottsville, Pietermaritzburg 3209 

South Africa. 

E-mail: ajmr.acadjourn@gmail.com 

Prof. Veronica Chima Nwosu (nee Dike) 

Department of Microbiology and Immunology 

Kunming Medical University 

Kunming 650031, 

China. 

Dr. Jianfeng Wu 

Dept. of Environmental Health Sciences, 

School of Public Health, 

University of Michigan 

USA 

Dr. Ahmet Yilmaz Coban 

OMU Medical School, 

Department of Medical Microbiology, 

Samsun, 

Turkey.

Editorial Board 

Dr. Kwang Young Song 

Department of Biological Engineering, 

School of Biological and Chemical Engineering, 

Yanbian Universityof Science and Technology, 

Yanji, 

China. 

Dr. Kamel Belhamel 

Faculty of Technology, 

University of Bejaia 

Algeria. 

Dr. Sladjana Jevremovic 

Institute for Biological Research 

Sinisa Stankovic, 

Belgrade, 

Serbia. 

Dr. Tamer Edirne 

Dept. of Family Medicine, Univ. of Pamukkale 

Turkey. 

Dr. R. Balaji Raja M.Tech (Ph.D) 

Assistant Professor, 

Department of Biotechnology, 

School of Bioengineering, 

SRM University, 

Chennai. 

India 

Dr. Mohd Fuat ABD Razak 

Institute for Medical Research 

Malaysia. 

Dr. Minglei Wang 

University of Illinois at Urbana-Champaign 

USA. 

Dr. Davide Pacifico 

Istituto di Virologia Vegetale – CNR 

Italy. 

Prof. Branislava Kocic 

Specaialist of Microbiology and Parasitology 

University of Nis, School of Medicine Institute 

for Public Health Nis, Bul. Z. Djindjica 50, 18000 Nis 

Serbia. 

Dr. Ntobeko A. B. Ntusi 

Cardiac Clinic, Department of Medicine, 

University of Cape Town and 

Department of Cardiovascular Medicine, 

University of Oxford 

South Africa and 

United Kingdom. 

Prof. N. S. Alzoreky 

Food Science & Nutrition Department, 

College of Agricultural Sciences & Food, 

King Faisal University, 

Saudi Arabia. 

Dr. Sivakumar Swaminathan 

Department of Agronomy, 

College of Agriculture and Life Sciences, 

Iowa State University, 

Ames, Iowa 50011 

USA. 

Dr. Alfredo J. Anceno. 

School of Environment, Resources and Development (SERD), 

Asian Institute of Technology, 

Thailand. 

Dr. Okonko, Iheanyi Omezuruike 

Department of Virology, 

Faculty of Basic Medical Sciences, 

College of Medicine, 

University of Ibadan, 

University College Hospital, 

Ibadan, 

Nigeria. 

Dr. S. Meena Kumari 

Department of Biosciences 

Faculty of Science 

University of Mauritius 

Reduit 

Mauritius. 

Luki Subehi 

Parasitology & Mycology Dept, 

Baghaeei Lab., 

Shams Abadi St. 

Isfahan 

Iran.

Electronic submission of manuscripts is strongly 

encouraged, provided that the text, tables, and figures are 

included in a single Microsoft Word file (preferably in Arial 

font). 

The cover letter should include the corresponding author's 

full address and telephone/fax numbers and should be in 

an e-mail message sent to the Editor, with the file, whose 

name should begin with the first author's surname, as an 

attachment. 

Article Types 

Three types of manuscripts may be submitted: 

Regular articles: These should describe new and carefully 

confirmed findings, and experimental procedures should 

be given in sufficient detail for others to verify the work. 

The length of a full paper should be the minimum required 

to describe and interpret the work clearly. 

Short Communications: A Short Communication is suitable 

for recording the results of complete small investigations 

or giving details of new models or hypotheses, innovative 

methods, techniques or apparatus. The style of main 

sections need not conform to that of full-length papers. 

Short communications are 2 to 4 printed pages (about 6 to 

12 manuscript pages) in length. 

Reviews: Submissions of reviews and perspectives covering 

topics of current interest are welcome and encouraged. 

Reviews should be concise and no longer than 4-6 printed 

pages (about 12 to 18 manuscript pages). Reviews are also 

peer-reviewed. 

Review Process 

Instructions for Author 

All manuscripts are reviewed by an editor and members of 

the Editorial Board or qualified outside reviewers. Authors 

cannot nominate reviewers. Only reviewers randomly 

selected from our database with specialization in the 

subject area will be contacted to evaluate the manuscripts. 

The process will be blind review. 

Decisions will be made as rapidly as possible, and the 

journal strives to return reviewers’ comments to authors as 

fast as possible. The editorial board will re-review 

manuscripts that are accepted pending revision. It is the 

goal of the AJMR to publish manuscripts within weeks 

after submission. 

Regular articles 

All portions of the manuscript must be typed doublespaced 

and all pages numbered starting from the title 

page. 

The Title should be a brief phrase describing the 

contents of the paper. The Title Page should include the 

authors' full names and affiliations, the name of the 

corresponding author along with phone, fax and E-mail 

information. Present addresses of authors should 

appear as a footnote. 

The Abstract should be informative and completely selfexplanatory, 

briefly present the topic, state the scope of 

the experiments, indicate significant data, and point out 

major findings and conclusions. The Abstract should be 

100 to 200 words in length.. Complete sentences, active 

verbs, and the third person should be used, and the 

abstract should be written in the past tense. Standard 

nomenclature should be used and abbreviations should 

be avoided. No literature should be cited. 

Following the abstract, about 3 to 10 key words that will 

provide indexing references should be listed. 

A list of non-standard Abbreviations should be added. 

In general, non-standard abbreviations should be used 

only when the full term is very long and used often. 

Each abbreviation should be spelled out and introduced 

in parentheses the first time it is used in the text. Only 

recommended SI units should be used. Authors should 

use the solidus presentation (mg/ml). Standard 

abbreviations (such as ATP and DNA) need not be 

defined. 

The Introduction should provide a clear statement of 

the problem, the relevant literature on the subject, and 

the proposed approach or solution. It should be 

understandable to colleagues from a broad range of 

scientific disciplines. 

Materials and methods should be complete enough 

to allow experiments to be reproduced. However, only 

truly new procedures should be described in detail; 

previously published procedures should be cited, and 

important modifications of published procedures should 

be mentioned briefly. Capitalize trade names and 

include the manufacturer's name and address. 

Subheadings should be used. Methods in general use 

need not be described in detail.

Results should be presented with clarity and precision. 

The results should be written in the past tense when 

describing findings in the authors' experiments. 

Previously published findings should be written in the 

present tense. Results should be explained, but largely 

without referring to the literature. Discussion, 

speculation and detailed interpretation of data should 

not be included in the Results but should be put into the 

Discussion section. 

The Discussion should interpret the findings in view of 

the results obtained in this and in past studies on this 

topic. State the conclusions in a few sentences at the end 

of the paper. The Results and Discussion sections can 

include subheadings, and when appropriate, both 

sections can be combined. 

The Acknowledgments of people, grants, funds, etc 

should be brief. 

Tables should be kept to a minimum and be designed to 

be as simple as possible. Tables are to be typed doublespaced 

throughout, including headings and footnotes. 

Each table should be on a separate page, numbered 

consecutively in Arabic numerals and supplied with a 

heading and a legend. Tables should be self-explanatory 

without reference to the text. The details of the methods 

used in the experiments should preferably be described 

in the legend instead of in the text. The same data should 

not be presented in both table and graph form or 

repeated in the text. 

Figure legends should be typed in numerical order on a 

separate sheet. Graphics should be prepared using 

applications capable of generating high resolution GIF, 

TIFF, JPEG or Powerpoint before pasting in the Microsoft 

Word manuscript file. Tables should be prepared in 

Microsoft Word. Use Arabic numerals to designate 

figures and upper case letters for their parts (Figure 1). 

Begin each legend with a title and include sufficient 

description so that the figure is understandable without 

reading the text of the manuscript. Information given in 

legends should not be repeated in the text. 

References: In the text, a reference identified by means 

of an author‘s name should be followed by the date of 

the reference in parentheses. When there are more than 

two authors, only the first author‘s name should be 

mentioned, followed by ’et al‘. In the event that an 

author cited has had two or more works published during 

the same year, the reference, both in the text and in the 

reference list, should be identified by a lower case letter 

like ’a‘ and ’b‘ after the date to distinguish the works. 

Examples: 

Abayomi (2000), Agindotan et al. (2003), (Kelebeni, 

1983), (Usman and Smith, 1992), (Chege, 1998; 

1987a,b; Tijani, 1993,1995), (Kumasi et al., 2001) 

References should be listed at the end of the paper in 

alphabetical order. Articles in preparation or articles 

submitted for publication, unpublished observations, 

personal communications, etc. should not be included 

in the reference list but should only be mentioned in 

the article text (e.g., A. Kingori, University of Nairobi, 

Kenya, personal communication). Journal names are 

abbreviated according to Chemical Abstracts. Authors 

are fully responsible for the accuracy of the references. 

Examples: 

Chikere CB, Omoni VT and Chikere BO (2008). 

Distribution of potential nosocomial pathogens in a 

hospital environment. Afr. J. Biotechnol. 7: 3535-3539. 

Moran GJ, Amii RN, Abrahamian FM, Talan DA (2005). 

Methicillinresistant Staphylococcus aureus in 

community-acquired skin infections. Emerg. Infect. Dis. 

11: 928-930. 

Pitout JDD, Church DL, Gregson DB, Chow BL, 

McCracken M, Mulvey M, Laupland KB (2007). 

Molecular epidemiology of CTXM-producing 

Escherichia coli in the Calgary Health Region: 

emergence of CTX-M-15-producing isolates. 

Antimicrob. Agents Chemother. 51: 1281-1286. 

Pelczar JR, Harley JP, Klein DA (1993). Microbiology: 

Concepts and Applications. McGraw-Hill Inc., New York, 

pp. 591-603. 

Short Communications 

Short Communications are limited to a maximum of 

two figures and one table. They should present a 

complete study that is more limited in scope than is 

found in full-length papers. The items of manuscript 

preparation listed above apply to Short 

Communications with the following differences: (1) 

Abstracts are limited to 100 words; (2) instead of a 

separate Materials and Methods section, experimental 

procedures may be incorporated into Figure Legends 

and Table footnotes; (3) Results and Discussion should 

be combined into a single section. 

Proofs and Reprints: Electronic proofs will be sent (email 

attachment) to the corresponding author as a PDF 

file. Page proofs are considered to be the final version 

of the manuscript. With the exception of typographical 

or minor clerical errors, no changes will be made in the 

manuscript at the proof stage.

Fees and Charges: Authors are required to pay a $550 handling fee. Publication of an article in the African Journal of 

Microbiology Research is not contingent upon the author's ability to pay the charges. Neither is acceptance to pay the 

handling fee a guarantee that the paper will be accepted for publication. Authors may still request (in advance) that 

the editorial office waive some of the handling fee under special circumstances. 

Copyright: © 2012, Academic Journals. 

All rights Reserved. In accessing this journal, you agree that you will access the contents for your own personal use 

but not for any commercial use. Any use and or copies of this Journal in whole or in part must include the customary 

bibliographic citation, including author attribution, date and article title. 

Submission of a manuscript implies: that the work described has not been published before (except in the form of an 

abstract or as part of a published lecture, or thesis) that it is not under consideration for publication elsewhere; that if 

and when the manuscript is accepted for publication, the authors agree to automatic transfer of the copyright to the 

publisher. 

Disclaimer of Warranties 

In no event shall Academic Journals be liable for any special, incidental, indirect, or consequential damages of any 

kind arising out of or in connection with the use of the articles or other material derived from the AJMR whether or 

not advised of the possibility of damage, and on any theory of liability. 

This publication is provided "as is" without warranty of any kind, either expressed or implied, including, but not 

limited to, the implied warranties of merchantability, fitness for a particular purpose, or non-infringement. 

Descriptions of, or references to, products or publications does not imply endorsement of that product or publication. 

While every effort is made by Academic Journals to see that no inaccurate or misleading data, opinion or statements 

appear in this publication, they wish to make it clear that the data and opinions appearing in the articles and 

advertisements herein are the responsibility of the contributor or advertiser concerned. Academic Journals makes no 

warranty of any kind, either express or implied, regarding the quality, accuracy, availability, or validity of the data or 

information in this publication or of any other publication to which it may be linked.

International African Journal Journal of Medicine of Microbiology and Medical Research Sciences 

nces 

Review 

Table of Contents: Volume 6 Number 24 28 June, 2012 

ARTICLES 

Soil quality and microbes in organic and conventional farming systems 5077 

Shu Wang, Zheng Li and Guosheng Fan 

Research Articles 

L-cysteine desulfhydrase-an enzyme which can be assayed in soil but 

is unlikely to function in the environment 5086 

Sulaiman Ali Alharbi, Salah Hajomer, Milton Wainwright, Najat A. 

Marraiki and Saleh A. Eifan 

Multi-drug resistant pattern and plasmid profile of Escherichia coli and 

other gram-negative bacteria isolates from clinical specimen in Benin 

City, Nigeria 5091 

E. C. Emerenini and P. I. Okolie 

Fermentation of Cucumeropsis seeds, an uncommon substrate for 

ogiri production 5095 

Odibo F. J. C., Nwabunnia E., Ezekweghi C. C. and Uzoeghe E. 

Combined effect of NPK levels and foliar nutritional compounds on growth 

and yield parameters of potato plants (Solanum tuberosum L.) 5100 

Mona, E. Eleiwa Ibrahim, S. A. and Manal, F. Mohamed

nces 


Table of Content: Volume 6 Number 23 21 June, 2012 

ARTICLES 

ARTICLES 

Antimicrobial properties of skin mucus from four freshwater cultivable 

Fishes (Catla catla, Hypophthalmichthys molitrix, Labeo rohita and 

Influence Ctenopharyngodon of ciprofloxacin idella) on glioma cell line GL26: A new application for 5110 

an Balasubramanian old antibiotic S., Baby Rani P., Arul Prakash A., Prakash M., Senthilraja P. 

Abdolreza and Gunasekaran Esmaeilzadeh, G. Massoumeh Ebtekar, Alireza Biglari and 

Zuhair Mohammad Hassan 4891 

Evaluation of oxidative stress in patients with tularemia 5121 

Identification Sema Koc, Erkan of microbial Sogut, Fazilet diversity Duygu, in caecal Levent content Gurbuzler, of broiler Ahmet chicken Eyibilen 

S. Nathiya, and Ibrahim G. Dhinakar Aladag Raj, A. Rajasekar, D. Vijayalakshmi and T. Devasena 4897 

Microbial Introducing quality a novel of some facultative non-sterile nitrifying pharmaceutical bacterium, products "Nitrobacteria sourced 

from hamadaniensis" some retail pharmacies in Lagos, Nigeria 

5126 

Adeola Mohammad Anifowoshe Zare, R., Mohammad Opara Morrison Hassan I. and Heidari, Adeleye Farkhondeh Isaac A. Pouresmaeili, 4903 

Maryam Niyyati and Mohammad Moradi 

Molecular detection of adhesins genes and biofilm formation in methicillin 

resistant Antibacterial Staphylococcus activities aureus of nicotine and its zinc complex 5134 

Karima Muhammad BEKIR, Omayma Idrees Zaidi, HADDAD, Feroza Mohammed Hamid Wattoo, GRISSA, Muhammad Kamel CHAIEB, Hamid 

Amina Sarwar BAKHROUF Wattoo, and Syed Salem Ahmed IBRAHIM Tirmizi and ELGARSSDI Saad Salman 

4908 

Amylase An in-vitro production model for by moderately studying the halophilic adhesion Bacillus of Lactobacillus cereus in bulgaricus solid 

state in soyghurt fermentation and enteropathogenic Escherichia coli (EPEC) on HEp-2 Cells 5142 

P. Vijayabaskar, Jetty Nurhajati, D. Sayuti, Jayalakshmi Chrysanti and and T. Shankar Syachroni 

4918 

Networking The occurrence clusters of and Bacillus sequence thuringiensis characteristics strains in of chemical clustered intensive regularly rice 

interspaced growing ecosystem short palindromic repeats (CRISPR) direct repeats and their 2299 

evolutionary P. Kannan, comparison R. Xavier, R. with Josephine, cas1 genes K. Marimuthu, in lactic acid S. Kathiresan1 bacteria and 

Kaibo S. Sreeramanan 

Deng, Fei Liu, Chuntao Gu and Guicheng Huo 4927 

Development of a DNA-dosimeter system as biomarker to monitor the 

Antibacterial effects of pulsed screening ultraviolet of the root, radiation stem and leaf extracts of Terminalia albida sc. 5153 

elliot Myriam on selected BEN SAID, pathogenic Masahiro bacteria OTAKI, Shinobu KAZAMA and 

S. M. Abdennaceur Ayodele, G. HASSEN Alpheus and O. M. Iruaga 1457


nces 

ARTICLES 

A survey of Enterobacteriaceae in hospital and community acquired 

infections among adults in a tertiary health institution in Southwestern 

Nigeria 5162 

Hassan A. O., Hassan R. O., Muhibi M. A. and Adebimpe W. O. 

Investigation of genetic variability among different isolates of 

Fusarium solani 5168 

Uzma Bashir, Sidra Javed and Muhammad Shafiq 

Stenotrophomonas koreensis a novel biosurfactant producer for abatement 

of heavy metals from the environment 5173 

Patil S. N., Aglave B. A., Pethkar A. V. and Gaikwad V. B. 

Combining biocontrol agent and high oxygen atmosphere, to reduce 

postharvest decay of strawberries 5179 

Kraiem Menel, Kachouri Faten and Hamdi Moktar 

Expression, purification and antigenic evaluation of toxin-coregulated 

pilus B protein of Vibrio cholera 5188 

Kiaie S., Abtahi H., Alikhani M. and Mosayebi G 

Repellent and fumigant activity of Alpinia officinarum rhizome extract 

against Tribolium castaneum (Herbst) 5193 

Jianhua Lu, Jiejing Wang, Ya Shi and Lailin Zhang 

Detection of QnrB alleles in Enterobacteriaceae and quinolone-resistance 

expression 5198 

Dongguo Wang, Jin Zhang, Haibao Wang, Yongxiao Qi, Yong Liang and 

Lianhua Yu


nces 

ARTICLES 

Analysis of bacteria associated with Acropora solitaryensis by culture- 

dependent and -independent methods 5205 

Liu Z. H, Chen W, Gao L, Zhao JJ, Ren C.H, Hu C. Q. and Chen C 

Simple and rapid detection of Salmonella sp. from cattle feces using 

polymerase chain reaction (PCR) in Iran 5210 

Aida Jadidi, Seyed Davood Hosseni, Alireza Homayounimehr, Adel Hamidi, 

Sepideh Ghani and Behnam Rafiee 

A molecular genetic study on fruiting-body formation of Cordyceps militaris 5215 

TingChi Wen, MinFeng Li, JiChuan Kang and Jing He 

Cloning and prokaryotic expression of ghrelin gene in crucian carp 

(Carassius auratus) 5222 

AChaowei Zhou, Xindong Zhang, Tao Liu, Rongbing Wei, Dengyue Yuan and 

Zhiqiong Li 

Insight into microevolution of Streptomyces rimosus based on analysis 

of zwf and rex genes 5229 

Zhenyu Tang, Paul R. Herron, Iain S. Hunter, Siliang Zhang and Meijin Guo 

Fatigue-alleviating effect of polysaccharides from Cyclocarya paliurus 

(Batal) Iljinskaja in mice 5243 

Wang Jinchao and Wang Kangkang. 

Aggressiveness, diversity and distribution of Alternaria brassicae isolates 

infecting oilseed Brassica in India 5249 

P. D. Meena, A. Rani, R. Meena, Pankaj Sharma, R. Gupta1 and P. Chowdappa.

nces 


ARTICLES 

Heterogeneity of aminoglycoside resistance genes profile in clinical 

Staphylococcus aureus isolates 5259 

Salwa Bdour 

Evaluating the effect of acetic acid, furfural and catechol on the growth 

and lipid accumulation of Trichosporon fermentans by response surface 

methodology 5266 

Chao Huang, Peng Wen, Hong Wu, Wen-yong Lou and Min-hua Zong. 

Purification and characterization of Aspergillus niger α-L-rhamnosidase 

for the biotransformation of naringin to prunin 5276 

Hui Ni, An Feng Xiao, Hui Nong Cai, Feng Chen, Qi You and Yun Zheng Lu. 

Short Communication 

Prevalence of Hepatitis B and C among hemodialysis and thalassemic 

patients in a special medical center in East Tehran in 2011 5285 

Mohammad Aminianfar, Ali-Asghar Saidi, Alireza Fallah and Amin Barghi.

African Journal of Microbiology Research Vol. 6(24), pp.5077-5085, 28 June, 2012 

Available online at http://www.academicjournals.org/AJMR 

DOI: 10.5897/AJMR11.1541 

ISSN 1996-0808 ©2012 Academic Journals 

Review 

Soil quality and microbes in organic and conventional 

farming systems 

Shu Wang 1# , Zheng Li 2# and Guosheng Fan 1 * 

1 College of Landscape Architecture, Southwest Forestry University, Kunming 650224, China. 

2 College of horticulture, Northwest A&F University, Yangling, Shanxi 712100, China. 

Accepted 23 April, 2012 

Compared to conventional farming practices, organic farming practices have an advantage over 

improving soil quality and gain worldwide acceptance. Here we summarize soil properties, microbial 

biomass, abundance and diversity of microbes between organic and conventional soil, as well as 

advantages and disadvantages of various molecular approaches for assessing the diversity of 

microbial communities. The results confirm that higher levels of total and organic C, total N and soluble 

organic C are observed in all of the organic soil. However, other soil properties are inconsistent 

between organic and conventional soil. Consistently, all the studies show that higher levels of microbial 

biomass C and N are found in organic soil with different plants. Nevertheless, different molecular 

approaches for assessing the diversity of microbial communities could lead to different results in the 

same study. In addition, most studies consider that organic management can improve the abundance 

and diversity of total bacteria and fungi. Knowledge and assessment of organic and conventional 

farming systems still need to be evaluated in the future work. 

Key words: Organic and conventional soil, microbial biomass, abundance, diversity, soil properties. 

INTRODUCTION 

Conventional agriculture has played an important role in 

improving food productivity to meet human demands but 

is often associated with problems such as nitrate leaching 

(Foster et al., 1986), soil erosion (Jordahl and Karlen, 

1993), and environmental contamination (Horrigan et al., 

2002). On the other hand, Organic farming has the 

possibility of reducing the negative effects of conventional 

agriculture, because the system avoids or largely 

excludes applications of synthetic fertilizers and 

pesticides, relies on organic inputs and recycling for 

nutrient supply, livestock feed additives, and emphasizes 

cropping system design and biological processes for pest 

management (Rigby and Cáceres, 2001). Organic 

agriculture is gaining worldwide acceptance and has 

*Corresponding author. E-mail: wangtree@msn.com. Tel: +86 

0871 3863023. Fax: +86 0871 3863023. 

# Author contributed equally to this work. 

been expanding at annual rate of 20% in the last three 

years (2004 to 2007) accounting for 32.3 million hectares 

worldwide, and this tendency seems to be increasing 

(Willer and Yussefi, 2004). 

A widely accepted definition of soil quality is the 

capacity of a soil to function within ecosystem and landuse 

boundaries, to sustain biological productivity, 

maintain environmental quality and promote plant and 

animal health (Doran and Parkin, 1994). Varying studies 

with regard to biological, chemical and physical soil 

properties have been investigated in recent years by 

comparing conventional farming systems with organic 

farming systems. Compared to conventional farming 

practices, organic farming practices have an advantage 

over improving soil quality (Reganold et al., 1993; 

Reganold et al., 2001; Mäder et al., 2002), but few 

studies show inconsistent results (Trewavas, 2004). As 

mentioned above, more researches should be conducted 

in the future for a better understanding of the soil 

properties under conventional and organic farming 

practices.

5078 Afr. J. Microbiol. Res. 

Soil microbes play a critical role in ecological processes 

such as recycling of nutrients, nutrients turnover, 

decomposition and transformation of organic materials 

(Marshall, 2000; Nannipieri et al., 2003). Microbial 

processes are important in organic farming system 

because a lot of organic matters are used in organic 

systems. Soil active microbial communities are vital in 

synchronizing nutrient release from organic matter and 

nutrient demands for plant growth in organic farming 

system. Also, it can suppress plant diseases caused by 

soil borne pathogens, mainly by antibiosis and 

competition for nutrients (Whipps, 1997; Mazzola, 2002; 

Garbeva et al., 2004). However, the chemical products 

applied in the conventional systems can not only 

contaminate natural resources but also suppress the soil 

microbial activity, which make the system less 

sustainable and more dependent from agricultural inputs 

(Anaya, 1999; Bengtsson et al., 2005). Changes in 

microbial communities could be used to predict the 

effects of ecosystem perturbations by organic and 

conventional management practices (Bending et al., 

2000; Poudel et al., 2002; van Bruggen and Semenov, 

2000). In addition, knowledge of the changes in soil 

microbial processes is important in order to understand 

how tillage systems can be better managed to improve 

the soil. 

For a better understanding of conventional and organic 

farming systems, therefore, needs comprehensive 

knowledge and monitoring of soil properties and 

microbes in soil under conventional and organic farming 

systems. This review presents the current understanding 

about the difference of soil properties, microbial biomass, 

and microbial abundance and diversity between 

conventional and organic farming systems. It will provide 

first-hand information to the agronomists to formulate 

recommendations for crop rotations and cropping 

systems, to increase crop production with reduced use of 

herbicides. 

SOIL PROPERTIES IN ORGANIC AND 

CONVENTIONAL FARMING SYSTEMS 

Although, there are a number of studies investigating soil 

physicochemical properties in conventional and organic 

farming systems (Clark et al., 1999; Tu et al., 2006; 

Marinari et al., 2006), none of them could give an 

accurate answer to the question whether organic farming 

practices could improve soil quality or not? 

It is undoubted that higher levels of total and organic C, 

total N and soluble organic C are observed in all of the 

organic soil with various plants including rice, kiwifruit, 

strawberry, potato, wheat, tomato, grape (Table 1); N and 

C are key limiting factors for plants growth. Unlike the 

conventional farming system, the plants in organic 

farming system cannot only use a variety of organic 

fertility amendments but all consistently incorporated fall 

cover crops and reasonable rotation. To some extent, 

higher N and C in organic farming system suggest that 

soil quality in organic farms have been improved. 

In comparing conventional and organic soil, there is a 

general trend of pH being higher or equal organically over 

conventional cultivated soils. Only one research found 

that there was no significant difference in the pH of 

organic soils (van Diepeningen et al., 2006). Higher pH 

levels in mildly acidic soil under organic management 

seems to be reasonable, one is because decomposition 

of organic products released Ca and Mg nutrients which 

can slightly increase the soil pH (Ramaswami and Son, 

1996), other organic manures and organic matter inputs 

can increase buffering capacity of soils, preventing 

swings in pH (Arden-Clarke and Hodges, 1988; Stroo and 

Alexander, 1986). In addition, a lower pH in conventional 

systems and the significant loss of soil organic carbon 

might be explained by the use of acidifying mineral 

fertilizers. 

However, the available P and phosphorus, potassium 

and EC in the studied soils above are rather unexpected 

finding. Levels of available P and Phosphorus were 

higher in organic soil than in conventional soils 

(Sugiyama et al., 2010; Lawanprasert et al., 2007; de 

Oliveira Freitas et al., 2011). This disagreed with findings 

from several other studies (Reganold et al., 2010; 

Birkhofer et al., 2008; Carey et al., 2009). The highest 

value in nitrogen, phosphorus, and potassium (NPK) plot 

in conventional farming system indicates that P fertilizer 

application significantly increase soil P concentration. 

Hence, Low level of P in conventional soil may be 

attributed to more P uptake by crop in plant, so less P is 

left for raising its status in soil. Most studies considered 

that potassium were higher in organic soil than 

conventional soil (Lawanprasert et al., 2007; Reganold et 

al., 2010; Sugiyama et al., 2010), however, converse 

results were found recently (Birkhofer et al., 2008). We 

conclude that the variation of K in the convention and 

organic soil is the same as phosphorus. In addition, it is 

difficult to explain the regularity of EC variation between 

the conventional and organic soil. Relatively stable EC 

levels in the organic system indicated that animal 

manures did not increase salinity. But significant 

difference was observed in different duration of organic 

management paddy soil. The short-term (2, 3 year) 

organically managed paddy soil was higher than 

conventional soil, whereas this trends were not found in 

long-term (5, 9 year) organically managed soil (Wang et 

al., 2012). It seems that the value of EC is affected by 

many complex factors. 

Few studies showed that higher levels of cation 

exchange capacity (CEC) were found in organic 

management soil (Burger and Jackson, 2003; de Oliveira 

Freitas et al., 2011). In fact, the farmyard manure can 

increase CEC (Das and Dkhar, 2011). It seems 

reasonable that as a part of organic matter, farmyard 

manure has been added into the organic farming. In the

Table 1. Overview of the Soil properties and microbial biomass C and N in conventional and organic farming systems soil. 

Soil properties 

Organic 

management 

Conventional 

management 

pH +,+,+,+,+,- -,-,-,-,-,+ 

Plant in soil References 

Rice, tomato, strawberry, 

potato 

EC -,-,+,+ +,+,-,- Rice, grape, potato 

CEC +,+ -,- Tomato, grape 

Wang et al. 5079 

Wang et al. (2012), Gajda and Martyniuk (2005), Burger and Jackson (2003), 

Reganold et al. (2010), Sugiyama et al. (2010) and van Diepeningen et al. 

(2006). 

Gajda and Martyniuk (2005), de Oliveira Freitas et al. (2011), Reganold et al. 

(2010) and Sugiyama et al. (2010). 

Burger and Jackson (2003), de Oliveira Freitas et al. (2011), Bending et al. 

(2000) and Kennedy and Smith (1995). 

SOC +,+,+ -,-,- Rice, kiwifruit Araújo et al. (2009), Carey et al. (2009) and Leifeld et al. (2009). 

Total C +,+,+ -,-,- Strawberry, potato 

Organic C +,+,+,+,+ -,-,-,-,- Wheat, tomato, grape 

Total N +,+,+,+,+,+,+,+ -,-,-,-,-,-,-,- 

Wheat, kiwifruit, tomato, 

strawberry, potato, rice 

Leifeld et al. (2009), Sugiyama et al. (2010), Tu et al. (2006) and Wang et al. 

(2012). 

Birkhofer et al. (2008), Liu et al. (2007), Burger and Jackson (2003), Okur 

(2009) and van Diepeningen et al. (2006). 

Birkhofer et al. (2008), Carey et al. (2009), Liu et al. (2007), Burger and 

Jackson (2003), Leifeld et al. (2009), Sugiyama et al. (2010), Tu et al. (2006), 

van Diepeningen et al. (2006) and Wang et al. (2012). 

Total P -,+ +,- Strawberry, potato Reganold et al. (2010) and Sugiyama et al. (2010). 

Available P +,-,-,+ -,+,+,- Rice, wheat, kiwifruit, grape 

K +,-,+,+ -,+,-,- 

Rice, wheat, strawberry, 

potato 

Lawanprasert et al. (2007), Birkhofer et al. (2008), Carey et al. (2009) and de 

Oliveira Freitas et al. (2011). 

Lawanprasert et al. (2007), Birkhofer et al. (2008), Reganold et al. (2010) and 

Sugiyama et al. (2010). 

Ca +,+ -,- Rice Lawanprasert et al. (2007) and Reganold et al. (2010). 

S +, -, Strawberry Reganold et al. (2010). 

Mg 2+ +,- -,+ Rice, strawberry Lawanprasert et al. (2007) and Reganold et al. (2010).


Table 1. Contd. 

Na+ +,+, -,-, Rice, strawberry Lawanprasert et al. (2007) and Reganold et al. (2010). 

Fe + - Rice Lawanprasert et al. (2007). 

Mn +,- -,+ Rice, strawberry Lawanprasert et al. (2007) and Reganold et al. (2010). 

Cu +,+,+, -,-,-, Rice, strawberry, potato Lawanprasert et al. (2007), Sugiyama et al. (2010) and Reganold et al. (2010). 

Zn -,+,+ +,-,- Rice, strawberry, potato Lawanprasert et al. (2007), Sugiyama et al. (2010) and Reganold et al. (2010). 

NO3 +,+,+,-, -,-,-,+, 

+, means the higher content; -, the lower content. 

future, more studies should examine the value of 

CEC in organic soil. 

Comparing the studies about C, N, P and K, few 

studies focused on surveying the levels of 

calcium, sulphur, sodium, copper, magnesium, 

iron, manganese and zinc in organic and 

conventional farms. Depending on limited studies, 

we find that the levels of calcium, sulphur, sodium, 

copper are higher in organic than conventional 

soils (Table 1). However, the levels of magnesium, 

iron, manganese and zinc are uncertain in view of 

present studies. The elevated levels of copper 

Pea, wheat, tomato, 

strawberry 

NH4 +,+,-,-, -,-,+,+, Tomato, strawberry 

Microbial biomass C +,+,+,+,+,+,+ -,-,-,-,-,-,- 

Microbial biomass N +,+,+,+,+ -,-,-,-,- 

Wheat, kiwifruit, tomato 

and pepper, grape, 

strawberry 

Wheat, kiwifruit, tomato 

and Pepper 

and zinc in soils from organic farms may be 

associated with the use of different animal and 

poultry manures on some of the farms. To better 

understand the function of these elements in 

organic soil, more studies should consider these 

elements as an important parameter to 

investigate. 

There were not consistent results about NO3 

and NH4 in organic and conventional soil (Wang et 

al., 2012; Burger and Jackson, 2003; Reganold, et 

al., 2010; van Diepeningen et al., 2006). 

Moreover, the levels of NO3 and NH4 in different 

Girvan et al. (2003), Burger and Jackson (2003), Reganold et al. (2010) and 

van Diepeningen et al. (2006). 

Wang et al. (2012), Burger and Jackson (2003), Reganold et al. (2010) and 

van Diepeningen et al. (2006). 

Gajda and Martyniuk (2005), Carey et al. (2009), Liu et al. (2007), Wander et 

al. (1995), Burger and Jackson (2003), Okur et al. (2009), Leifeld et al. 

(2009) and Tu et al. (2006). 

Gajda and Martyniuk (2005), Carey et al. (2009), Liu et al. (2007), Wander et 

al. (1995) and Tu et al. (2006). 

duration of organic soil are also significantly 

different (Wang, 2011). Regardless of 

conventional and organic soil, different plants 

need different N form resulting in different content 

of NO3 and NH4 in soil. On other hand, plants face 

additional competition for NO3 and NH4 by 

microbes in soil (Poudel et al., 2002). In addition, 

the factors including extracted methods and the 

degree fresh soil and the machine detected the 

NO3 and NH4 are different in many studies. All 

mentioned above cannot answer the regular of 

NO3 and NH4 in organic and conventional soil

exactly. 

MICROBIAL BIOMASS IN ORGANIC AND 

CONVENTIONAL SOIL 

Microbial biomass C and N are often more significantly 

correlated with chemical characteristics of soils and with 

crop yields (Gajda et al., 2000; Martyniuk et al., 2001; 

Myśków et al., 1996). The microbial biomass is a small 

but important reservoir of nutrients (C, N, P and S) and 

many transformations of these nutrients occur in the 

biomass (Dick, 1992). As a consequence, microbial 

processes make a large contribution to the release and 

availability of nutrients required for crop growth. 

Soil management influenced soil microbes and soil 

microbial processes. Interestingly, all the studies showed 

that higher levels of microbial biomass C and N were 

found in organic soil with different plants (Gajda and 

Martyniuk, 2005; Carey et al., 2009; Liu et al., 2007; 

Wander et al.,1995; Burger and jackson, 2003; Okur et 

al., 2009; Leifeld et al. 2009; Tu et al., 2006). In organic 

management systems nitrogen was supplied in organic 

form via cover crops and manures and large amounts of 

C were included in the mass of organic material required 

to achieve adequate amounts of N (Gunapala and Scow, 

1998). An understanding of microbial processes is 

important for the management of farming systems 

(Melero et al., 2006). Otherwise, maintaining soil 

microbial biomass (SMB) and micro flora activity and 

diversity is fundamental for sustainable agricultural 

management (Insam, 2001). 

ABUNDANCE AND DIVERSITY OF MICROBES IN 

ORGANIC AND CONVENTIONAL SOIL 

To better manage soil and minimize negative 

environmental impacts, it is necessary to obtain more 

detailed and predictive understanding of the microbial 

communities responsible for these activities and how they 

may respond to organic agricultural systems. Although 

molecular approaches have been well developed and 

used in analyzing microbes in soil, few studies focused 

on the abundance and diversity of microbial community in 

organic and conventional soil. The Table 2 shows that the 

microbial abundance by culturable or Q-PCR methods 

and diversity by the molecular approaches such as 

DGGE, T-RFLP, clone libraries, microarray and pyro 

sequencing are evaluated successfully in our 

summarized studies. In all the studies, higher abundance 

and diversity of total culturable bacteria and fungi have 

been observed in organic soil by various methods. But 

different methods could inconsistently result. Consistent 

results have been obtained by DGGE and T-RFLP to 

analyze the soil communities in organic soil (Girvan et al., 

2003), however, the contrast result was found that 


the abundance and diversity of total culturable bacteria 

between organic and conventional soils by CLPP and 

DGGE (Liu et al., 2007). This reminds us to choose 

suitable method for different soil in future work. 

Soil microbes have played a critical role in ecological 

processes such as recycling of nutrients, nutrient 

turnover, decomposition and transformation of organic 

materials (Marshall, 2000; Nannipieri et al., 2003). The 

nitrogen-fixing bacteria and ammonia-oxidizing played an 

important role in Nitrogen (N) cycling, however, some 

studies above mainly focused on the total bacteria and 

fungi. Orr et al. (2011) found that management regimen 

affecting both the total bacterial community and the freeliving 

diazotroph community could be secondary to other 

factors such as time of sampling and previous crop. In 

addition, higher abundance of the nitrogen-fixing bacteria 

and ammonia-oxidizing were observed in organic 

management paddy soil except for 2 years organic soil. A 

better understanding of the recycling of nutrients in 

conventional and organic farming systems, therefore, 

needs comprehensive knowledge and monitoring of 

microbes involved in N and C cycle under conventional 

and organic farming systems. 

MOLECULAR APPROACHES TO ASSESS SOIL 

MICROBES 

Various molecular approaches have been developed and 

successfully applied to analyze the microbial community 

in various soil environments, such as denaturing gradient 

gel electrophoresis (DGGE), single strand conformation 

polymorphism (SSCP), amplified ribosomal DNA 

restriction analysis (ARDRA), microarrays methods, 

terminal restriction fragment length polymorphism (T- 

RFLP), length heterogeneity-polymerase chain reaction 

(LH-PCR), ribosomal intergenic spacer analysis (RISA), 

microarray and PCR clone libraries (Girvan et al., 2003; 

Sanz and Köchling, 2007; Ranjard et al., 2000; Mills et 

al., 2007; Reganold et al., 2010; Ottesen, 2008). In 

addition, real-time quantitative PCR (qPCR) has been 

used successfully to determine the abundance of nifh 

gene (Wang et al., 2012). These methods can help to 

better understand the relative abundance and community 

structure and composition of microbes in organic 

agricultural systems. 

The most important advantages and disadvantages of 

individual methods are summarized in Table 3. DGGE 

and TGGE require laborious technical optimization 

including calibration of the linear gradient of DNA 

denaturants (chemical or physical) and improvement of 

the PCR primers with the insertion of a GC clamp to 

obtain better electrophoretic separation of the fragments. 

The main advantage of DGGE and SSCP analysis 

provides full sequences that can be subject to further 

analysis technically and simple gel preparation, however, 

only short sequences can be analyzed. And the


Table 2. Overview of microbial abundance and diversity in conventional and organic farming systems soil. 

Organic management Conventional management Abundance Methods Diversity Methods References 

+, -, Shannon diversity index DGGE, T-RFLP Girvan et al. (2003) 

-, -, Total culturable bacteria Culturable Shannon diversity index DGGE 

+, -, Total culturable fungi Culturable Shannon diversity index CLPP 

Liu et al. (2007) 

+, -, Bacterial diversity DGGE van Diepeningen et al. (2006) 

+, -, Total detected genes signal intensity Microarray Diversity (Simpson’s reciprocal index) Microarray Reganold et al. (2010) 

+, -, Diversity and evenness Pyro sequencing Sugiyama et al. (2010) 

+, -, The bacterial and fungal populations Culturable Das and Dkhar (2011) 

+, -, Nitrogen-fixing bacteria Q-PCR Diversity DGGE Wang et al. (2012) 

+, -, Ammonia-oxidizing bacteria Q-PCR Diversity DGGE Shu et al. (2011) 

+, -, Bacterial and archaeal OTUs, Chao1, Shannon Clone Libraries Ottesen (2008) 

PLFA analysis is the ability to assess the diversity 

of both bacterial and fungal communities 

simultaneously. But this high coverage is 

unfortunately contrasted by a very low level of 

taxonomic discrimination. While an advantage of 

microarrays is that they can overcome the 

potential PCR bias and simultaneously analyze 

about ten thousand samples, only the part of the 

community defined by the test probes can be 

examined and impossible discover a new species. 

Care is needed in interpreting the composition of 

microbial communities by molecular techniques 

because the method of extraction can influence 

patterns obtained by amplified ribosomal DNA 

restriction analysis (ARDRA) or RISA (Martin- 

Laurent et al., 2001). Usually, T-RFLP has the 

highest resolution of the PCR-based methods and 

can reliably analyze a large number of samples, 

but the shortcomings of T-RFLP are loss of some 

variability and low phylogenetic specificity of 

terminal restriction sites. Additionally, FISH 

(fluorescent in situ hybridization) can directly 

analysis without extraction of nucleic acid. 

Nevertheless, Low fluorescent intensity cannot be 

detected. As stated above, we suggest that two 

methods should be used to better investigate the 

microbial community overall in environmental 

samples. 

SUMMARY AND FUTURE PROSPECTS 

To sum up, it is undoubted that higher levels of 

total and organic C, total N and soluble organic C 

are observed in all of the organic soil. However, 

other soil properties are inconsistent between 

organic and conventional soil. Consistently, all the 

studies show that higher levels of microbial 

biomass C and N are found in organic soil with 

different plants. Nevertheless, different molecular 

approaches for assessing the diversity of 

microbial communities can lead to different results 

in the same study. In addition, most studies 

consider that organic management could improve 

the abundance and diversity of total bacteria and 

fungi. 

In future work, we suggest soil microbial 

ecologist to pay a more attention to study the 

inconsistent parameters observed in organic and 

conventional soil. Suitable molecular approaches 

should be examine to study the different type of 

soil under conventional and organic, and at least 

two methods should be used to better investigate 

the microbial community overall in environmental 

samples. At last, a better understanding of the 

recycling of nutrients in conventional and organic 

farming systems, therefore, needs comprehensive 

knowledge and monitoring of microbes involved in 

N and C cycle under conventional and organic 

farming systems. 

ACKNOWLEDGEMENTS 

This research is funded by University Innovation 

Team of Landscape Architecture from Yunnan 

Province, Southwest Forestry University 

(23002802), Ornamental Plant and Horticulture 

key disciplines of Yunnan Province, Southwest

Table 3. Advantages and disadvantages of common fingerprinting methods used in the analysis of soil microbial communities. 

Methods Advantages Disadvantages References 

DGGE∗/TGGE 

SSCP 

T-RFLP 

Provides full sequences that can be subject to further 

analysis technically; obtain an overview of the dominant 

species 

Provides full sequences that can be subject to further 

analysis technically; obtain an overview of the dominant 

species 

Technically simple and reproducible; high discrimination 

power (number of types/analysis); 

ARDRA Technically simple and convenient 

LH-PCR/ARISA 

FISH 

PLFA 

Microarrays 

Technically simple; replicate profiles are highly 

reproducible; it can quickly evaluate community changes 

Direct analysis without extraction of nucleic acid; 

generally quantitative; 

No bias due to PCR; cover whole communities across 

kingdoms; quantitative description of the community 

No bias due to PCR; simultaneously analyze about ten 

thousand samples; high sample throughput expensive 

equipment parallel analysis of different parameters 

16SrDNA library Technically simple, can evaluate the community overall 

∗See text for the explanation of abbreviations. 

Only short sequences < 400 bp can be analyzed; 

DNA fragments of different species might have 

similar electrophoretic mobility 

Only short sequences < 200 bp can be analyzed 

Loss of some variability (sequences not cleaved or 

cleaved near to primer); low phylogenetic 

specificity of terminal restriction sites; 

Affected by PCR biases and the choice of the 

enzyme; 

Low discrimination power; amplicon distributions 

are sometimes difficult to resolve with the current 

software; one amplicon can represent more than 

one taxon 

Low fluorescent intensity cannot be detected; its 

rRNA sequence must be known (if the probe has 

not yet been published); 

Low taxonomic separation limited to community 

composition analysis; not a good choice as a 

standard alone method 

Detects only sequences corresponding to probes; 

detection limit lower than in PCR-based methods; 

impossible discover a new species; 

Only detected the absence or exist between to 

samples; PCR biases; selected clone numbers 


Sanz and Köchling (2007), 

Muyzer et al. (1993) and 

Nannipieri et al. (2003). 

Lee et al. (1996), Dohrmann and 

Tebbe (2004) and Sanz and 

Köchling (2007). 

Liu et al. (1997) and Nannipieri 

et al. (2003). 

Ranjard et al. (2000). 

Fisher and Triplett (1999) and 

Mills et al. (2007). 

Dahllof (2002) and Sanz and 

Köchling (2007). 

Findlay et al. (1989) and Sanz 

and Köchling (2007). 

Shalon et al. (1996) and Ranjard 

et al. (2000). 

Li et al. (2007). 

Forestry University (500017) and Ornamental Plant and Horticulture key lab of Yunnan Province, Southwest Forestry University (000703).


REFERENCES 

Anaya AL (1999). Allelopathy as tool in the management of biotic 

resources in agro-ecosystems. Crit. Rev. Plant. Sci., 18: 697–739. 

Araújo ASF, Leite LFC, Santos VB, Carneiro RFV (2009). Soil Microbial 

Activity in Conventional and Organic Agricultural Systems. 

Sustainability, 1: 268–276. 

Arden-Clarke C, Hodges RD (1988). The environmental effects of 

conventional and organic/biological farming systems. II. Soil ecology, 

soil fertility and nutrient cycles. Biol. Agric. Hortic., 5: 223-287. 

Bending GD, Putland C, Rayns F (2000). Changes in microbial 

community metabolism and labile organic matter fractions as early 

indicators of the impact of management on soil biological quality. Biol. 

Fertil. Soils, 31: 78–84. 

Bengtsson J, Ahnström J, Weibul AN (2005). The effects organic 

agriculture on biodiversity and abundance: a meta-analysis. J. Appl. 

Ecol., 42: 261–269. 

Birkhofer K, Bezemer Martijn T, Bloem Jaap, Bonkowski M, Christensen 

Søren, Dubois D (2008). Long-term organic farming fosters below 

and aboveground biota: Implications for soil quality, biological 

controand productivity. Soil. Biol. Biochem., 40(9): 2297–2308. 

Burger M, Jackson LE (2003). Microbial immobilization of ammonium 

and nitrate in relation to ammonification and nitrification rates in 

organic and conventional cropping systems. Soil. Biol. Biochem., 35: 

29–36. 

Carey PL, Benge JR, Haynes RJ (2009). Comparison of soil quality and 

nutrient budgets between organic and conventional kiwifruit orchards. 

Agr. Ecosyst. Environ., 132(1-2): 7–15. 

Clark MS, Horwath WR, Shennan C, Scow KM, Lantni WT, Ferris H 

(1999). Nitrogen, weeds and water as yield-limiting factors in 

conventional, low-input, and organic tomato systems. Agric. Ecosys. 

Environ., 73: 257-270. 

Dahllof I (2002). Molecular community analysis of microbial diversity. 

Curr. Opin. Biotechnol., 13: 213–217. 

Das BB, Dkhar MS (2011). Rhizosphere Microbial Populations and 

Physico Chemical Properties as Affected by Organic and Inorganic 

Farming Practices. American-Eurasian J. Agric. Environ. Sci., 10(2): 

140–150. 

de Oliveira Freitas N, Yano-Melo AM, da Silva FSB, de Melo NF, Maia 

LC (2011). soil biochemistry and microbial activity in vineyards under 

conventional and organic management at Northeast Brazil. Sci. Agric. 

(Piracicaba, Braz.), 68(2): 223–229. 

Dick RP (1992). A review: long-term effects of agricultural systems on 

soil biochemical and microbial parameters. Agric. Ecosyst. Environ., 

40: 25–36. 

Dohrmann AB, Tebbe CC (2004). Microbial community analysis by 

PCR-single-strand conformation polymorphism (PCR-SSCP). In: 

Kowalchuk GA, de Bruijn FJ, Head IM, Akkermans ADL, van Elsas 

JD (eds): Molecular Microbial Ecology Manual. Kluwer Academic 

Publishers, Dordrecht, pp. 809–838. 

Doran JW, Parkin TB (1994). Defining soil quality, in: Doran, J.W., 

Coleman, D.C., Bezdicek, D.F., Stewart, B.A. (Eds.), Defining Soil 

Quality for a Sustainable Environment, vol. 35. Soil Science Society 

of America Special Publications, Madison, pp. 3–21. 

Findlay RH, King GM, Watling L (1989). Efficacy of phospholipid 

analysis in determining microbial biomass in sediments. Appl. 

Environ. Microbiol., 55: 2888–2893. 

Fisher MM, Triplett EW (1999). Automated approach for ribosomal 

intergenic spacer analysis of microbial diversity and its application to 

freshwater bacterial communities. Appl. Environ. Microbiol., 65: 

4630–4636. 

Foster SSD, Bridge LR, Geake AK, Lowrence AR, Parker JM (1986). 

The groundwater nitrate problem: a summary of research on the 

impact of agricultural land-use practices on groundwater quality 

between 1976 and 1985. Hydrogeol. Rep. Br. Geol. Surv. No. 86/2. 

Br. Geol. Surv., Oxfordshire, England. 

Gajda A, Martyniuk S (2005). Microbial Biomass C and N and Activity of 

Enzymes in Soil under Winter Wheat Grown in Different Crop 

Management Systems. Pol. J. Environ. Stud., 14(2): 159–163. 

Gajda A, Martyniuk S, Stachyra A, Wroblewska B, Zieba S (2000). 

Relations between microbiological and biochemical properties of soil 

under different agrotechnical conditions and its productivity. Pol. J. 

Soil. Sci., 33: 55. 

Garbeva P, van Veen JA, van Elsas JD (2004). Microbial diversity in 

soil: selection of microbial populations by plant and soil type and 

implications for disease suppressiveness. Annu. Rev. Phytopathol., 

42: 243–270. 

Girvan MS, Bullimore J, Pretty JN, Mark Osborn A, Ball, AS (2003). Soil 

Type Is the Primary Determinant of the Composition of the Total and 

Active Bacterial Communities in Arable Soils. Appl. Environ. 

Microbiol., 3: 1800–1809. 

Gunapala N, Scow KM (1998). Dynamics of soil microbial biomass and 

activity in conventional and organic farming systems. Soil Biol. 

Biochem., 30: 805–816. 

Horrigan L, Lawrence RS, Walker P (2002). How sustainable agriculture 

can address the environmental and human health harms of industrial 

agriculture. Environ. Health Perspect., 110: 445–456. 

Insam H (2001). Developments in soil microbiology since the mid 

1960s. Geoderma, 100: 389–402. 

Jordahl JL, Karlen DL (1993). Comparison of alternative farming 

systems. III. Soil aggregate stability. Am. J. Altern. Agric., 8: 27–33. 

Kennedy AC, Smith KL (1995). Soil microbial diversity and the 

sustainability of agricultural soils. In: Collins, H.P., Robertson, G.P., 

Klug, M.J. (Eds.), the Significance and Regulation of Soil Biodiversity. 

Kluwer Academic Publishers, Netherlands, pp. 75–86. 

Lawanprasert A, Kunket K, Arayarangsarit L, Prasertsak A (2007). 

Comparison between Conventional and Organic Paddy Fields in 

Irrigated Rice Ecosystem. 4th INWEPF Steering Meeting and 

Symposium, 2: 1–9. 

Lee DH, Zo YG, Kim SJ (1996). Nonradioactive method to study genetic 

profiles of natural bacterial communities by PCR-single-strandconformation 

polymorphism. Appl. Environ. Microbiol., 62: 3112– 

3120. 

Leifeld J, Reiser R, Oberholzer HR (2009). Consequences of 

Conventional versus Organic farming on Soil Carbon: Results from a 

27-Year Field Exper. Agric. J., 101(5): 1204–1218. 

Li ZY, Hu Y, Liu Y, Huang Y, He LM, Miao XL (2007). 16S rDNA clone 

library-based bacterial phylogenetic diversity associated with three 

South China Sea sponges. World J. Microbiol. B 

iotechnol., 23: 1265–1272. 

Liu B, Tu C, Hu SJ, Gumpertz M, Ristaino JB (2007). Effect of organic, 

sustainable, and conventional management strategies in grower 

fields on soil physical, chemical, and biological factors and the 

incidence of Southern blight. Appl. Soil Ecol., 

doi:10.1016/j.apsoil.2007.06.007 

Liu WT, Marsh TL, Cheng H, Forney LJ (1997). Characterization of 

microbial diversity by determining terminal restriction fragment length 

polymorphisms of genes encoding 16S rRNA. Appl. Environ. 

Microbiol., 63: 4516–4522. 

Mäder P, Fleissbach A, Dubois D, Gunst L, Fried P (2002). Soil fertility 

and biodiversity in organic farming. Sci., 296: 1694–1697. 

Marinari S, Mancinelli R, Campiglia E, Grego S (2006). Chemical and 

biological indicators of soil quality in organic and conventional 

farming systems in Central Italy. Ecol. Indic., 6: 701-711. 

Marshall VG (2000). Impacts of forest harvesting on biological 

processes in northern forest soils. Forest. Ecol. Manag., 133: 43–60. 

Martin-Laurent F, Philippot L, Hallet S, Chaussod R, Germon JC, 

Soulas G, Catroux G (2001). DNA extraction from soils: old bias for 

new microbial diversity analysis methods. Appl. Environ. Microbiol., 

67: 2354–2359. 

Martyniuk S, Gajda A, Kuś J (2001). Microbiological and biochemical 

properties of soil under cereals grown in the ecological, conventional 

and integrated systems. Acta. Agrophysica, 52: 185. 

Mazzola M (2002). Mechanisms of natural soil suppressiveness to 

soilborne diseases. Antonie Van Leeuwenhoek: Intern. J. Gen. Mol. 

Microbiol., 81: 557–564. 

Melero S, Porras JCR, Herencia JF, Madejon E (2006). Chemical and 

biochemical properties in a silty loam soil under conventional and 

organic management. Soil. Till. Res., 90: 162–170. 

Mills DK, Entry JA, Gillevet PM (2007). Assessing microbial community 

diversity using amplicon length heterogeneity polymerase chain 

reaction. Soil Sci. Soc. Am. J., 71: 572–578. 

Muyzer G, de Waal EC, Uitterlinden AG (1993). Profiling of complex 

microbial populations by denaturing gradient gel electrophoresis

analysis of polymerase chain reaction-amplified genes coding for 16S 

ribosomal RNA. Appl. Environ. Microbiol., 59: 695–700. 

Myśków W, Stachyra A, Zięba S, Masiak D (1996). Microbial activity as 

an indicator of soil fertility and productivity (in Polish). Rocz. 

Glebozn., 47: 89. 

Nannipieri P, Ascher J, Ceccherini MT, Landi L, Pietramellara G, 

Renella G (2003). Microbial diversity and soil functions. Eur. J. Soil 

Sci., 54: 655–670. 

Okur N, Altindişli A, Çengel M, Göçmez S, Kayikcioğlu HH (2009). 

Microbial biomass and enzyme activity in vineyard soils under 

organic and conventional farming systems. Turk. J. Agric. For., 33: 

413–423. 

Orr CH, James A, Leifert C, Cooper JM, Cummings SP (2011). Diversity 

and Activity of Free-Living Nitrogen-Fixing Bacteria and Total 

Bacteria in Organic and Conventionally Managed Soils. Appl. 

Environ. Microbiol., 3: 911–919. 

Ottesen AR (2008). Microbial Ecology and Horticultural Sustainability of 

Organically and Conventionally Managed Apples. 

http://hdl.handle.net/1903/9017 

Poudel DD, Horwarth WR, Lanini WT, Temple SR, van Bruggen, AHC 

(2002). Comparison of soil N availability and leaching potential, crop 

yields and weeds in organic, low input and conventional farming 

systems in northern California. Agric. Ecosyst. Environ., 90: 125–137. 

Ramaswami PP, Son TTN (1996). Quality compost from agricultural 

wastes. Paper presented at the national workshop on “Organic 

farming for sustainable agriculture”. Water and land management 

training and Research Institute Hyderabad, India. 

Ranjard L, Poly F, Nazaret S (2000). Monitoring complex bacterial 

communities using culture-independent molecular techniques: 

application to soil environment. Res. Microbiol., 151: 167–177. 

Reganold JP, Andrews PK, Reeve JR, Carpenter-Boggs L, Schadt CW, 

Richard Alldredge J, Ross CF, Davies NM, Zhou JZ (2010). Fruit and 

soil quality of organic and conventional strawberry agroecosystems. 

PLoS One, 5(9): e12346. doi:10.1371/journal.pone.0012346. 

Reganold JP, Glover JD, Andrews PK, Hinman HR (2001). 

Sustainability of three apple production systems. Nature, 410: 926– 

930. 

Reganold JP, Palmer AS, Lockhart JC, Macgregor AN (1993). Soil 

quality and financial performance of biodynamic and conventional 

farms in New Zealand. Sci., 260: 344–349. 

Rigby D, Cáceres D (2001). Organic farming and the sustainability of 

agricultural systems. Agric. Syst., 68: 21–40. 

Sanz JL, Köchling T (2007). Molecular biology techniques used in 

wastewater treatment: an overview. Process Biochem., 42: 119–133. 

Shalon D, Smith SJ, Brown PO (1996). A DNA microarray system for 

analyzing complex DNA samples using two-color fluorescent probe 

hybridization. Genome Res., 6: 639–645. 

Shu W, Ye J, Pablo GP, Dan-Feng H (2011). Abundance and diversity of 

ammonia-oxidizing bacteria in rhizosphere and bulk paddy soil under 

different organic management. Afr. J. Microbiol. Res., 5(31): 5560- 

5568. 


Stroo HF, Alexander M (1986). Role of soil organic matter in the effect of 

acid rain on nitrogen mineralisation. Soil Sci. Soc. Amer. J., 50: 

1219–1223. 

Sugiyama A, Vivanco JM, Jayanty SS, Manter DK (2010). 

Pyrosequencing assessment of soil microbial communities in organic 

and conventional potato farms. Plant. Dis., 94:1329–1335. 

Trewavas A (2004). A critical assessment of organic farming-and-food 

assertions with particular respect to the UK and the potential 

environmental benefits of notill agriculture. Crop Prot., 23: 757–781. 

Tu C, Louws FJ, Creamer Nancy G, Paul Mueller J, Brownie C, Fager K, 

Bell M, Hu SJ (2006). Responses of soil microbial biomass and N 

availability to transition strategies from conventional to organic 

farming systems. Agr. Ecosyst. Environ., 113(1-4): 206–215. 

van Bruggen AHC, Semenov AM (2000). In search of biological 

indicators for plant health and disease suppression. Appl. Soil. Ecol., 

15: 13–24. 

van Diepeningen AD, de Vos OJ, Korthals GW, van Bruggen AHC 

(2006). Effects of organic versus conventional management on 

chemical and biological parameters in agricultural soils. Appl. Soil. 

Ecol., 31:120–135. 

Wander MM, Hedrick DS, Kaufman D, Traina SJ, Stinner BR, 

Kehrmeyer SR, White DC (1995). The functional significance of the 

microbial biomass in organic and conventionally managed soils. 

Plant. Soil., (170): 87–97. 

Wang S, Gonzalez Perez P, Ye J, Huang DF (2012). Abundance and 

Diversity of Nitrogen-fixing Bacteria in Rhizosphere and Bulk Paddy 

Soil under Different Duration Organic Management. World J. 

Microbiol. Biotechnol., 28: 493-503. 

Whipps JM (1997). Developments in the biological control of soil-borne 

plant pathogens. In: Callow, J.A. (Ed.), Adv. Bot. Res., Academic 

Press, San Diego, CA, 26: 1–134. 

Willer H, Yussefi M (2004). The World of Organic Agriculture: Statistics 

and Emerging Trends. International Federation of Organic Agriculture 

Movements: Bonn, Germany, p. 167.

African Journal of Microbiology Research Vol. 6(24), pp. 5086-5090, 28 June, 2012 


DOI: 10.5897/AJMR10.686 


Full Length Research Paper 

L-cysteine desulfhydrase-an enzyme which can be 

assayed in soil but is unlikely to function in the 

environment 

Sulaiman Ali Alharbi 1 *, Salah Hajomer 2 , Milton Wainwright 1,2 , Najat A. Marraiki 1 and Saleh A. 

Eifan 1 

1 Department of Botany and Microbiology, College of Science, King Saud University, P.O. Box 2455 Riyadh, 11451, 

Saudi Arabia. 

2 Department of Molecular Biology and Biotechnology, University of Sheffield, Sheffield, S10 2TN, UK. 

Accepted 14 December, 2011 

An assay was developed to measure the activity of the enzyme L-cysteine desulfhydrase (CDA) in an 

agricultural loam soil. The optimum temperature for CDA in this soil was 60°C and the optimum pH for 

CDA in the soil was 8.5. CDA in the soil required the addition of pyridoxal phosphate to exhibit its 

maximum activity. However since no pyridoxal phosphate was found in this soil it is likely that activity 

of this enzyme in the soil will be limited by the lack of this cofactor. Our studies illustrate the important 

point that not all enzymes which can be assayed in soils under laboratory conditions will function in the 

environment, since some, as in the case of CDA, will be limited by a lack of an essential co-factor. 

Key words: Enzyme activity, enzyme L-cysteine desulfhydrase, agricultural loam soil, pyridoxal phosphate, 

microbial activity. 

INTRODUCTION 

Soils are known to exhibit a wide range of enzyme 

activities which are important in the cycling of nutrients 

through carbon, nitrogen and sulphur cycles (Skujins, 

1976; Burns, 1979). These enzymes are derived from 

animals, plants and microorganisms and are often immobilised 

in soils. Enzyme activity has been used to 

measure overall microbial activity (for example, 

dehydrogenase activity) as well as the role of individual 

enzymes in important soil processes, such as urea 

hydrolysis (urease) and the breakdown of cellulose 

(cellulase) (Burns, 1979, 1982). With the exception of the 

measurement of arylsulfatase activity (Li and Sarah, 

2003) relatively little attention has been paid to the soil 

enzymes involved in the mineralisation of organic sulphur 

compounds. Here, we report on the measurement of 

cysteine desulfhydrase (CDA) activity in an agricultural 

soil. This enzyme is important in the degradation of the 

*Corresponding author. E-mail: sharbi@ksu.edu.sa. Tel: 

00966555232656. 

amino acid cysteine, and therefore of organic sulphur, 

because it catalyses the desulfhydration of cysteine, 

liberating equimolar quantities of pryruvate, hydrogen 

sulphide and ammonia. CDA activity is widely distributed 

in bacteria and fungi (Ohkishi et al., 1981), although it 

has been reported to occur in coastal sand dunes (Skiba 

and Wainwright, 1983), its activity in a fertile agricultural 

soil, like one used here, appears not to have been 

previously reported. Here we report on CDA activity in 

soil by measuring the formation of pyruvate when Lcysteine 

and pyridoxal sulphate were incubated with soil 

in the presence of buffer. The objectives of this work 

were to determine whether CDA can be assayed in soil 

and if so, does this enzyme function in the soil 

environment? 

MATERIALS AND METHODS 

Soil properties 

An agricultural sandy loam [previous crop potatoes, was used 

organic (C, 3.2%; total N, 0.3%; pH, 6.1)].

Enzyme assay 

Triplicate samples of field moist soil (1 g) were treated with toluene 

(0.5 ml) in Universal bottles closed with screw caps and left for 15 

min. The enzyme reaction was initiated by addition of Tris HCl 

buffer (3 ml, 0.2 M, pH 8.3), L-cysteine (5 mm, 1 ml) and pyridoxal 

phosphate, 0.2 mM, 1 ml). The contents of the bottles were 

thoroughly mixed and the bottles were incubated at 37°C. After 2 h, 

the enzyme reaction was stopped by addition of trichloroacetic acid 

(TCA, 10% w/v). Two sets of controls were included a) where no 

cysteine was added and b) where the enzyme reaction was 

stopped immediately. The soils suspensions were filtered through 

Whatman No.1 filter paper and CDA activity was measured by the 

determining the concentration of pyruvate as follows: 

Determination of pyruvate 

To the filtrate (0.5 ml) was added TCA, a 0.3 ml (of 50% w/v 

solution), distilled water (2.2 ml) and 2,4-dintrophenylhydrazine (1 

ml, of a 1% solution in 2 M HCl); mixed and left for 10 min at room 

temperature. Sodium hydroxide (5 ml of a 2.5 N solution) was then 

added, and after 10 min incubation at room temperature, the 

reddish brown colour formed was measured at 445 nm. The 

pyruvate concentration was then determined by reference to a 

standard curve c ranging from 0-0.1 µmoles pyruvate (Case, 1932). 

Development of the CDA assay 

By using the basic assay described above, and varying one 

parameter at a time, the optimum conditions for the assay of CDA in 

this soil was determined. The following were determined: a) the 

optimum amount of soil; the reaction mixture was incubated for 2 h 

at 37°C with one of the following, 0, 0.5, 1.0, 2.0, 3.0, 4.0 g of soil; 

b) period of incubation; the reaction mixture was incubated at 37°C 

for 0, 2, 4, 8, 15, 25 hours; c) substrate concentration, L-Cysteine 

concentration of 0, 0.4, 0.8, 1.0, 1.5, 2.0, 3.0, and 4.0 mM; d) effect 

of temperature on CDA, reaction mixtures were incubated for 2 h at 

10, 20, 25, 40, 50, 60, and 80°C; e) effect of pH- on CDA was 

assayed using Tris-HCL buffer over the following pH range, 7.0 ,7.5 

,8.0 , 8.5, 9.0, 10.0. 

Determination of pyridoxal phosphate in soil 

Soil (10 g) was shaken for a period of 1 h with Tris-HCl buffer (0.2 

M pH 8.3, 100 ml) and then filtered through a Whatman No. 1 filter 

paper. The concentration of pyridoxal phosphate in the filtrate was 

then determined by the following method (Wada and Snell, 1961). 

Phenlyhyrdazine hydrochloride (0.2 ml, 2 % w/v dissolved in 10 N 

H2SO4) was added to 3.8 ml of soil filtrate. The mixture was then 

heated at 60°C for 20 min. and then allowed to stand at room 

temperature for 10 min, and the intensity of the colour formed was 

read at 410 nm. 

RESULTS AND DISCUSSION 

Linearity was observed between CDA and a) the amount 

of soil used (0 - to 0.75 g), b) length of incubation (0 - to 

3.5 h.) and c) the concentration of L-cysteine (0.5- to 1.8 

mM), (Figures 1a, b and c); showing that the assay 

Alharbi et al. 5087 

method employed measures the hydrolysis of L-cysteine 

and that the measured enzyme activity was not limited by 

any of the parameters employed. 

The optimum temperature for CDA in this soil was 60°C 

(Figure 2a) which is higher than that reported by 

Fromageot (1951) for the enzyme in bacteria and 

mammals. Soil enzymes generally show a higher optimum 

temperature than is observed for pure enzymes, or 

when enzyme activity is measured from cells; this is 

because soil enzymes are immobilized onto clays and 

humus particles (Burns, 1979; Sarkar et al., 1989) .The 

optimum pH for CDA in soils was pH 8.5 (Figure 2b). This 

pH optimum is the same as that found for Salmonella 

typhimirium (Guarneros and Ortega, 1970), but 

somewhat higher than that found in other bacteria 

(Fromageot, 1951); again because of soil immobilization 

soils; enzymes often show broader and higher pH 

maximum than enzyme activities measured in other 

systems. Table 1 shows and important property of CDA, 

namely that pyridoxal phosphate is needed in order for it 

to exhibit its maximum activity. Stimulation of CDA by 

pyridoxal phosphate was also reported for this enzyme 

from Proteus morganii (Kallio, 1951) and E.coli 

(Delwiche, 1951). 

Pyridoxal phosphate was not detected in this 

agricultural soil [1:10 w/v soil 0.2 M Tris-HCL buffer (pH 

8.3), extracted by shaking for 1 h], showed that either 

pyridoxal phosphate is not extracted by the method, or 

more probably that it is not present in detectable concentrations 

in this soil. The lack of pyridoxal phosphate in this 

soil means that CDA could not function in this soil (and 

presumably in most other soils also) at its maximum 

activity because of the lack of a necessary cofactor, 

namely pyridoxal phosphate. Burns (1979) emphasised 

that cytoplasmic enzymes from animals, plants and 

microorganism, which rely upon co-factors, electron 

transport chains or multi enzyme complexes will not 

operate in soils unless such cofactors are present. CDA 

provides an excellent example of an enzyme which is 

present is soil, probably bound to humus and clay 

particles which, because of a lack of necessary cofactors 

cannot function in vivo. Activity of the enzyme can 

however, be measured in vitro when the necessary 

cofactors (in this case pyridoxal phosphate) is added. 

The present study therefore illustrates the important point 

that just because an enzyme can be assayed in a soil it 

does not necessarily mean that it functions in the 

environment. Enzymes such as cellulase (Benefield, 

1971), urease (Bremner and Mulvaney, 1978) and ophenol 

oxidase (Wainwright, 1979), which do not require 

cofactors would probably exhibit maximum activity under 

environmental conditions. The important conclusion 

which can be derived from this study is that although 

certain soil enzymes (like CDA) can be assayed in the 

laboratory where all cofactors are provided, this does not 

mean that they will function in the environment and play a 

role in mineral cycling.


Figure 1. Effect of a) soil sample, b) time and c) substrate concentration on L-cysteine desulfhydrase 

activity in the soil (Activity expressed as µmoles pyruvate formed g -1 2 h -1 ).

Figure 2. Effect of a) incubation temperature and b) buffer pH on L-cysteine desulfhydrase activity 

in the soil (Activity expressed as µmoles pyruvate formed g -1 2h -1 ). 

Table 1. Effect of pyridoxal phosphate on CDA in soil. 

CDA µg pyruvate formed g -1 2 h -1 

No pyridoxal phosphate added 0.080 0.004 

Addition of pyridoxal phosphate (1 ml, 0.2 M). 0.295 0.015 

Means of triplicates (+/- standard deviation). 

Alharbi et al. 5089


ACKNOWLEDGEMENT 

The project was supported by King Saud University, 

Deanship of Scientific Research, College of Science, 

Research Centre. Thanks are due to Dr Ute Skiba for her 

contribution to this study. 

REFERENCES 

Benefield CB (1971). A rapid method for measuring cellulase activity in 

soil. Soil Biol. Biochem., 3: 325-329. 

Burns RG (1979). Enzyme activity on soil: some theoretical and 

practical considerations. In: Burns RG (ed), Soil Enzymes, London, 

Academic Press, pp. 295-340.Burns RG (1982). Enzyme activity in 

soil: Location and a possible role in microbial ecology. Soil Biol. 

Biochem., 14: 123-427. 

Bremner JM, Mulvaney RL (1978). Urease activity in soils. In: Burns RG 

(ed.) Soil Enzymes, London, Academic Press, pp. 149-196. 

Case EM (1932). The determination of pyruvic acid. Biochem. J., 26: 

753-758. 

Delwiche EA (1951). Activities of the cysteine desulfhydrase system of 

E.coli. J. Bacteriol., 62: 717-722. 

Fromageot G (1951). Desulfhydrases. In: Sumner JB, Myrback K (eds), 

The Enzymes, New York, Academic Press, pp. 1237-1243. 

Guarneros G, Ortega M (1970). Cysteine desulphydrase activity of 

Salmonella typhimurium and Escherichia coli. Biochem. Biophys. 

Act., 198: 132-142. 

Kallio RE (1951). Function of pyridoxal phosphate in desulfhydrase 

systems of Proteus morganii. J. Biol. Chem., 192: 371-377. 

Li X, Sarah P (2003). Arylsulfatase activity and soil biomass along a 

Mediterranean–arid transect. Soil Biol. Biochem., 35: 925-934. 

Ohkishi H, Nishikawa D, Kumagai H, Yamada H (1981). Distribution of 

cysteine desulfhydrase in microorganisms. Agric. Biol. Chem., 45: 

253-257. 

Sarkar JM, Leonowicz AJ, Bollag JM (1989). Immobilization of 

enzymes on clays and soils. Soil Biol. Biochem., 21: 223-230. 

Skiba U, Wainwright M (1983). Assay and properties of some sulphur 

enzymes in coastal sands. Pl. Soil, 70: 125-132. 

Skujins JJ (1976). Extracellular enzymes in soil. CRC Crit. Rev. 

Microbiol., 4: 383-421. 

Wada H, Snell EE (1961). The enzymatic oxidation of pyridoxene and 

pyridoxamine phosphates. J. Biol. Chem., 236: 2089-2095. 

Wainwright M (1979). Assay of phenol 0-hydroxylase activity in soil. Soil 

Biol. Biochem., 11: 549-541.



DOI: 10.5897/AJMR11.220 



Multi-drug resistant pattern and plasmid profile of 

Escherichia coli and other gram-negative bacteria 

isolates from clinical specimen in Benin City, Nigeria 

E. C. Emerenini 1 * and P. I. Okolie 2 

1 Department of Microbiology, University of Agriculture (UNAAB), Abeokuta, Nigeria. 

2 Biotechnology Centre, University of Agriculture (UNAAB), Abeokuta, Nigeria. 


Escherichia coli (E. coli) belonging to the family Enterobacteriaceae has been implicated as the causal 

agent to many gastro-intestinal disorders in man and animal. Seventy samples of clinical origins were 

collected randomly from patients at Lahour Public Health Research centre, Benin City in Edo state. E. 

coli were found in 4/70 (25%) of the samples; while Klebsiella spp., Proteus spp. and Pseudomonas spp. 

had percentage abundance of 12.5, 31.25 and 31.25% respectively. All E. coli isolates were resistant to 

the following antibiotics Ampicilin, Nalidixic acid, Chloramphenicol, Tetracycline, Cotrimoxazole, 

Norfloxacine, Traflox, Ciproval, Nitrofurantoin and Perflacin, while 75% were resistant to Gentamicine, 

only. E. coli isolates were screened for plasmids. It was observed that 3(75%) were plasmid mediated 

while 1(25%) harbored only the chromosomal DNA. This study indicates the susceptibility pattern of E. 

coli resistance to different antibiotics and the need to contend the continuous spread of the these 

resistant strains. 

Key words: Escherichia coli, antibiotics resistance pattern, plasmid profile. 

INTRODUCTION 

Escherichia coli is a human pathogen worldwide associated 

with meat and meat products, dairy products, 

vegetables, and water (Browning et al., 1990; Obi et al., 

2004; Magwira et al., 2005). It is recognized as a 

bacterium causing hemorrhagic colitis (Olorunshola et al., 

2000). Diarrheal diseases linked to E. coli infections are 

characterized by blood, cramping abdominal pain, fever, 

nausea, and vomiting (Shebib et al., 2003). Resistance of 

pathogenic organisms to antibiotics is an increasing 

problem to the treatment of most microbial infection and 

the rapid dissemination of drug-resistant bacteria is an 

increasing global problem that seriously complicates the 

treatment of human infections (Van den Bogaard and 

Stobberingh, 2000). Different factors could contribute to 

this increase, as the high use of antimicrobial agents in 

*Corresponding author. E-mail: emcslash@gmail.com. Tel: 

+234-803-4950289. 

humans and animals that applies a pressure for selection 

of resistant bacteria, the capacity of bacteria to 

disseminate antimicrobial resistance genes to other 

bacteria mainly by mobile genetic structures, and the 

facility of dissemination of resistant bacteria in different 

ecosystems (Martínez, 2008). 

Antimicrobial resistance associated with specific 

antimicrobials may occur in a number of ways. These 

include: reduced uptake, impermeability or efflux mechanisms 

for a particular antimicrobial, drug degradation 

(enzyme attack) or modification of specific target sites by 

the organism where the drug would normally act. 

Alternatively, organisms modify specific sites where antimicrobials 

normally act by duplication of the target site 

with a site that is non susceptible thus causing a 

‘‘bypass’’ of the antibiotic sensitive step (Chopra and 

Russell and Chopra, 1996; Chopra, 1998; Russell, 1998, 

2002). Recently, integrons have been recognized as a 

mecha-nism for acquiring multiple antimicrobial resistances 

in some organisms. Integrons are a class of novel,


Table 1. Percentage Antibiotics Resistance of Pathogenic Isolates from Clinical samples. 

Antibiotic 

Number of resistant strain Percentage resistance (%) 

A B C D A B C D 

Nalidixic acid 4 1 4 5 100 50 80 100 

Chloramphenicol 4 NIL 4 5 100 NIL 80 100 

Norfloxacin 4 NIL 3 3 100 NIL 60 60 

Gentamycin 3 1 1 4 75 50 80 80 

Ampicilin 4 1 5 5 100 50 100 100 

Tetracycline 4 2 4 5 100 100 80 100 

Cotrimoxazole 4 NIL 3 5 100 NIL 60 100 

Traflox 4 NIL 1 3 100 NIL 20 60 

Ciproval 4 NIL 4 3 100 NIL 80 60 

Nitrofurantoin 4 1 5 5 100 50 100 100 

Perflacin 4 1 5 5 100 NIL 40 60 

Key: A = E. coli; B = Klebsielle spp.; C = Proteus spp. and D = Pseudomonas spp. 

naturally occurring mobile genetic elements that can 

capture antimicrobial resistance and other genes and 

promote their transcription (Stokes and Hall, 1989; 

Hanau-Bercot et al, 2002). Class 1 type integrons are 

con-sidered the most common in clinical isolates 

(Recchia and Hall, 1995; Collis et al., 1998). Resistance 

genes can be integrated in the form of cassettes, this 

reaction is catalysed by the integron encoded integrase 

(int1) gene at the att1 site (Hansson et al., 1997; 

Partridge et al., 2000). 

In many pathogenic bacteria, plasmids frequently carry 

antibiotics resistance encoding genes allowing bacteria to 

survive antibiotic treatment besides encoding virulence 

factors. 

The aims of this study are to determine the antimicrobial 

pattern of some pathogenic bacteria in clinical 

samples and the relationship of plasmid profile. 


Study areas and sample collection 

Seventy clinical samples comprising of stool, urine, sputum and 

exudates from wound were collected from sick patients at Lahor 

Public Health Research Center, Benin City Nigeria. The samples 

were collected in sterile Screw-caped universal container and were 

taken to the laboratory for analysis. 

Identification of bacteria 

One gram of the sample was weighed and suspended into 9 ml of 

peptone water. 10-fold dilution was made. One hundred microlitre 

of each dilution was plated on Blood agar, MacConkay agar and 

Chocolate agar and was incubated aerobically at 37°C for 24 h. 

Isolates were identified biochemically. 

Susceptibility testing 

Antibiotics susceptibility test for the isolated organisms was 

conducted by disc diffusion using Muller Hintin agar plates 

according to modified method of Bauer et al. (1966). The plates 

were incubated at 37°C for 24 h. The antibiotics tes ted includes 

Ampicilline, Nalidixic acid, Chloramphenicol, Tetracycline, 

Cotrimoxazole, Norfloxacine, Traflox, Ciproval, Nitrofurantoin, 

Gentamicin and Perflacin. The zones of inhibition around the disc 

were measured. 

Plasmid profiling 

The modified method of Birmboin and Doly (1979) was used to 

screen for the presence of Plasmid in the resistant isolates. 

Plasmid DNA electrophoresis 

Plasmid DNA was electrophoresed on 1.3% agarose gel, stained 

with ethidium bromide. Hind III digested plasmid was used as a 

control marker. The gel was visualized with UV transilluminator and 

photograph of the bands were taken using the pollaroid. 

RESULTS 

Drug susceptibility testing 

Seventy samples from clinical origins were collected 

randomly from patients at Lahour Public Health Research 

centre, Benin City in Edo state. Percentage abundance of 

E. coli isolated was (25%). While other Gram-negative 

bacteria comprising of Klebsiella spp., Proteus spp. and 

Pseudomonas spp. had percentage abundance of 12.5, 

31.25 and 31.25% respectively. 

All E. coli isolates were resistant to Ampicilin, Nalidixic 

acid, Chloramphenicol, Tetracycline, Cotrimoxazole, 

Norfloxacine, Traflox, Ciproval, Nitrofurantoin and 

Perflacin while 75% were resistant to Gentamicin (Table 

1). 

Two Klebsiella spp. were isolated and tested for 

antibiotic resistance; only one (50%) was resistant to

Table 2. Plasmid profile. 

Emerenini and Okolie 5093 

Isolate number Niurofurantom Traflox Norfloxacin Cotrimoxazeole Gentamicin Tetracyclin Ciproval Nalidixil acid Chloramphenicol Ampicillin Peflacin Plasmid number Plasmid size (kb) 

E1 - - - - - - - - - - - 1 3.3 

E2 - - - - - - - - - - - 1 3.4 

E3 - - - - + - - - - - - 1 3.3 

PR1 - + - - - - + - - - + 2 3.7, 3.4 

PR2 - - - - - - - - - - - 1 3.4 

P1 - + + - + - + - - - + 2 3.5, 3.3 

P2 - - - - - - - - - - - 2 3.5, 3.3 

P3 - + + - - - + - - - + 2 3.5, 3.3 

P4 - - - - - - - - - - - 2 3.5, 3.3 

P5 - - - - - - - - - - - 1 3.2 

+, Positive; _, Negative. 

Nitrofurantoin, Gentamicin, Nalidixic acid and 

Ampicilin. While the two isolates were resistant to 

Tetracyclin. For the rest of other antibiotics 

(Chloramphenicol, Cotrimoxazole, Norfloxacine, 

Traflox, Ciproval and Perflacin), the Klebsiella 

spp. is 100% sensitive (Table 1). 

The five isolates of Pseudomonas spp. tested 

for susceptibility to multi-antibiotics activity were 

100% resistant to Nitrofurantoin, Cotrimoxazole, 

Tetracycline, Nalidixic acid, Chloramphenicol, 

Ampicilin; 80% were resistant to Gentamicin and 

60% were resistant to Norfloxacine, Traflox, 

Ciproval and Perflacin (Table 1). 

Five Proteus spp. isolated and tested for 

antibiotics resistance, 100% were resistant to 

Nitrofurantoin and Ampicilin; 80% were resistant 

to Gentamicin, Tetracycline, Nalidixic acid, Chloramphenicol, 

and Ciproval. 60% were resistant to 

Cotrimoxazole and Norfloxacine; 40% were 

resistant to Perflacin and 20% were resistant to 

Traflox (Table 1). 

Plasmid profilling 

E. coli and other Gram-negative bacteria isolates 

were screened for plasmids. Table 2 shows the 

plasmid number and size from the isolated E. coli, 

Klebsiella spp., Proteus spp. and Pseudomonas 

spp. Gram-negative bacteria from clinical 

samples. It was observed that 3(75%) of E. coli 

isolates were plasmid mediated while 1(25%) 

harbored only the chromosomal DNA. 

DISCUSSION 

The study reveals that multiple antibiotics resistance 

exists among the clinical pathogens 

examined. E. coli isolates were observed to be 

resistant to commonly used antibiotics in clinical 

medicine. 

There has been a growing concern of the 

possible emergences of antimicrobial resistant 

Enterobacteriaceae strains especially E. coli as a 

result of possible neglect of treatment procedures. 

The level of antibiotic resistance of these 

pathogens is quite high and it could be as a result 

of antibiotic drug abuse, in appropriate dosage 

administration and duration, wrong diagnosis 

before treatment has also contributed to the 

spread of antibiotic resistant strains. 

Plasmid profiling analysis of the isolates 

revealed that 3(75%) of E. coli resistant strain 

were Plasmid mediated, thus each harboring one 

plasmid. The other Gram-negative bacteria 

isolates harbored either one or more plasmids 

(Table 2). The implication of this is that these 

isolates may be containing either resistant or 

virulent plasmids. Smith et al. (2003) revealed the 

presence of plasmid (47%) in eight E. coli isolates 

from animal origin. 

The resistance upsurge of these isolates to 

commonly used antibiotics were very high and in 

view of the burden they pose to medical practitioners, 

as well as the limited availability of 

antimicrobial agents for the treatment of infections 

caused by these organisms, there is need to 

contend the spread of the antibiotic resistant 

strains, since multidrug resistant strains can 

transfer resistance through their plasmid to other 

enteric organisms. 

ACKNOWLEDGMENTS 

The authors wish to thank the management of 

Lahor Public Health Research Center, Benin city 

and National Institute of Medical Research (NIMA) 

Lagos Nigeria for laboratory assistance. 

REFERENCES 

Bauer AW, Kirby WM, Sferris JC, Turck M (1966). Antibiotic 

susceptility test by a standard single disc method. Am. J.


Clin. Pathol., 45: 493-496. 

Birmboin HC, Doly J (1979). A rapid alkaline extraction procedure for 

screening recombinant plasmid DNA. Nucleic Acids Res., 7: 1513- 

1523. 

Browning NG, Botha J, Sacho H, Moore PJ (1990). Escherichia coli 

O157:H7 haemorrhagic colitis. Report of the first South African case. 

South Afr. Surg., 28: 28-29. 

Chopra I (1998). Research and development of antibacterial agents. 

Curr. Opin. Microbiol., 1: 495-501. 

Collis CM, Kim MJ, Stokes HW, Hall RM (1998). Binding of the purified 

integron DNA integrase Int1 to integron- and cassetteassociated 

recombination sites. Mol. Microbiol., 29: 477-480. 

Hanau-Bercot B, Podglajen I, Casin I, Collatz E (2002). An intrinsic 

control element for translational initiation in class 1 integrons. Mol. 

Microbiol., 44: 119-130. 

Hansson K, Skold O, Sundstrom L (1997). Nonpalindromic att1 sites of 

integrons are capable of site specific recombination with one another 

and with secondary targets. Mol. Microbiol., 26: 441-453. 

Magwira CA, Gashe BA, Collison EK (2005). Prevalence and antibiotic 

resistance profiles of Escherichia coli O157:H7 in beef products from 

retail outlets in Gaborone, Botswana. J. Food Prot., 68(2): 403-406. 

Martínez JL (2008). Antibiotics and Antibiotic Resistance Genes in 

Natural Environments. Science, 321(5887): 365-367. 

Obi CL, Potgieter N, Bessong PO, Igumbor EO, Green E (2004). Gene 

encoding virulence makers among Escherichia coli isolates from 

diarrheic stools samples and river sources in rural Venda 

communities of South Africa. Water S.A., 30(1): 37-42. 

Olorunshola ID, Smith SI, Cker AO (2000). Prevalence of EHEC 

O157:H7 in patients with diarrhoea in Lagos, Nigeria. APMIS, 108: 

761-763. 

Partridge SR, Recchia GD, Scaramuzzi C, Collis CM, Stokes HW, Hall 

RM (2000). Definition of the att1 site of class 1 integrons. 

Microbiology, 146: 2855-2864. 

Recchia GD, Hall RM (1995). Gene cassettes: a new class of mobile 

element. Microbiology, 141: 3015-3027. 

Russell AD (1998). Mechanisms of bacterial resistance to antibiotics 

and biocides. Prog. Med. Chem., 35: 133-197. 

Russell AD (2002). Antibiotic and biocide resistance in bacteria: 

introduction. J. Appl. Microbiol. Symp. Suppl., 92: 1S-3S. 

Russell AD, Chopra I (1996). Understanding Antibacterial Action and 

Resistance 2nd Edition. Ellis Horwood, Chichester. 

Shebib ZA, Abdul GZG, Mahdi LK (2003). First report of Escherichia coli 

O157 among Iraqi children. Eastern Mediterranean Health J., 9: 1/2. 

Smith S, Aboaba OO, Odeigha P, Shodipo K, Adeyeye NN (2003). 

Plasmid profile of Escherichia coli 0157:H7 from apparently healthy 

animals. Afr. J. Biotechnol., 2(9): 322-324. 

Stokes HW, Hall RM (1989). A novel family of potentially mobile DNA 

elements encoding site-specific gene integration functions: integrons. 

Mol. Microbiol., 3: 1669-1683. 

Van den Bogaard AE, Stobberingh EE (2000). Epidemiology of 

resistance to antibiotics Links between animals and humans. Int. J. 

Antimicrob. Agents, 14: 327-335.



DOI: 10.5897/AJMR11.312 



Fermentation of Cucumeropsis seeds, an uncommon 

substrate for ogiri production 

Odibo F. J. C. 1 , Nwabunnia E. 2 *, Ezekweghi C. C. 1 and Uzoeghe E. 1 

1 Department of Applied Microbiology and Brewing, Nnamdi Azikiwe University, P.M.B. 5025, Awka, Nigeria. 

2 Department of Microbiology, Anambra State University, P. M. B. 02, Uli, Nigeria. 

Accepted 4 June, 2012 

An investigation of the microbes responsible for the traditional fermentation of climbing melon 

(Cucumeropsis mannii Naud) seeds for ogiri production was undertaken over a period of 96 h. Seven 

bacterial genera identified as Bacillus, Klebsiella, Pseudomonas, Pediococcus, Lactobacillus, Serratia, 

and Staphylococcus were recovered from fermenting Cucumeropsis seeds. The pH and temperature of 

the seeds at the end of fermentation were 7.1 and 35°C, respectively. Bacillus and Pseudomonas 

species exhibited proteolytic, amylolytic and lipolytic activities, and were most useful in the 

fermentation process. The ogiri obtained compared favourably in colour, taste, aroma and texture with 

the same condiment from other known and commonly used substrates. 

Key words: Cucumeropsis seeds, fermentation, bacteria, ogiri. 

INTRODUCTION 

Ogiri is a Nigerian fermented condiment produced from 

various substrates, and which when added to soup or 

yam pottage enhances the flavour. This has been 

accentuated by several independent reports on the 

production of ogiri from the fermentation of the seeds of 

castor oil (Ricinus communis) (Odunfa, 1985; Jideani and 

Okeke, 1991), water melon (Citrullus vulgaris Schard) 

(Odunfa, 1981), creeping melon (Colocynthis vulgaris) 

(Odibo, 1985; Jideani and Okeke, 1991; David and 

Aderibigbe, 2010), Citrullus lanatus (David and 

Aderibigbe, 2010) and fluted pumpkin (Telfairia 

occidentalis Hook) (Odibo and Umeh, 1989). 

The choice of substrate for this food condiment, which 

is popular among the Igbos of Southern Nigeria, depends 

on the locality (Odibo et al., 1990). During the last three 

decades, the consumption of ogiri as well as the prices of 

its various substrates has increased in Nigeria. This 

development has given impetus for the trial of other 

relatively cheaper and unpopular seeds, which are 

climbing melon (Cucumeropsis mannii Naud) (David and 

Aderibigbe, 2010). The seeds resemble those of creeping 

*Corresponding author. E-mail: alcamow@yahoo.com. Tel: 

+234 (806) 096-3069. 

nutritively related to those already serving as substrates 

for ogiri production. One of such potential substrates is 

melon (Colocynthis vulgaris) commonly eaten as soup by 

most Nigerians. In variance, Cucumeropsis seeds are 

larger (16-18 mm long, 9 mm wide) with thick outer white 

coat of moulded edges, hard to open or peel (Oyolu, 

1977). 

The cotyledons of climbing melon seeds are scarcely 

used in some parts of Nigeria to prepare soup or as a 

source of oil. Also, the seeds have preservative 

properties in that, the posterior end when slightly and 

carefully opened with the help of the incisors, can be 

placed at appropriate points on a fresh corpse as an 

effective embalmment procedure by some herbalists 

among the Igbos of Southern Nigeria. This study was 

undertaken to determine the microbes responsible for the 

traditional fermentation and suitability of climbing melon 

(C. mannii) seeds as yet another substrate for ogiri 

production. 


Preparation of ogiri 

The traditional method of preparing ogiri (Odibo and Umeh, 1989) 

was adopted and modified. Locally purchased climbing melon (C.


mannii Naud) seeds were washed with water and boiled for about 1 

h to soften. The seed coats were removed and cotyledons washed 

with sterile water. For the fermentation, 200 g of the seeds were 

wrapped in clean plantain (Musa sapientum var. paradisiaca Linn.) 

leaves. The seeds were then left to ferment at room temperature 

(28 to 30°C) for 96 h to obtain ogiri. Prior to use as food condiment, 

the fermented seeds are ground into a smooth paste, wrapped in 

fresh clean plantain leaves and placed over a fire. 

Isolation and identification of microorganisms 

These were as detailed by Odibo and Umeh (1989). Duplicate 

samples (1 g) of the fermenting seeds were removed daily from the 

packet, mashed into a paste with a sterile mortar and pestle for 

determination of the microbial flora and succession by dilutions with 

sterile distilled water. Isolations were made in duplicate on Petri 

dishes of nutrient agar, tomato juice agar (TJA) and Sabouraud’s 

dextrose agar (all Oxoid formulations except for TJA which was 

compounded by us), containing 0.05 mg chloramphenicol/ml using 

the drop method of Miles and Misra as described by Collins et al. 

(2004). The Petri dishes were incubated aerobically at 28°C for 24– 

48 h. Representative colonies of microorganisms were purified on 

fresh media on which they were isolated and stored on agar slopes 

at 4°C prior to characterization. The isolates were ch aracterized 

following the methods outlined by Collins et al. (2004) and identified 

following the description of Bergey’s Manual of Systemic 

Bacteriology (Krieg et al., 1984; Sneath et al., 1986). Fermentation 

of sugars by the isolates was tested using Andrade Peptone water 

(Oxoid CM61) as a basal medium in which acid production within 48 

h indicated positive result. Proteolytic activity of the isolates was 

tested using casein agar and by gelatin liquefaction (Collins et al., 

2004) while Tween 80 hydrolysis was used to assess lipolytic 

activity (Sierra, 1957). 

pH and temperature measurement 

The pH and temperature of the fermenting seeds were determined 

daily. To estimate the pH, 1.0 g of the fermenting seeds was 

mashed with 10 ml of distilled water and the pH of the homogenate 

then determined with a pH meter. 


Only bacterial isolates were recovered from the 

fermenting seeds. This is in keeping with earlier reports 

by Odunfa (1981) and Odibo and Umeh (1989), who 

attributed the absence of mould during the fermentation 

of water melon and fluted pumpkin seeds respectively, for 

ogiri production, to the low oxygen tension within the 

packet of the fermenting seeds. 

A total of seven bacterial genera identified as Bacillus 

sp., Serratia sp., Pseudomonas sp., Klebsiella sp., 

Staphylococcus aureus, Pediococcus sp. and 

Lactobacillus sp., were isolated from the fermenting 

seeds (Table 1). The plantain leaves used to wrap the 

fermenting seeds are presumably a major source of the 

bacteria. Our earlier report (Odibo and Umeh, 1989) 

revealed that a similar microbial flora to that of the 

fermenting Telfairia seeds but including two unidentified 

fungi isolates were recovered from the plantain leaves 

used in wrapping the Telfairia seeds. Apart from Serratia 

sp., the other six bacterial genera implicated in the 

fermentation of climbing melon seeds for ogiri production 

have been previously associated with the fermentation of 

this and other substrates for ogiri (Odunfa, 1981; Odibo, 

1985; Odibo and Umeh, 1989; Jideani and Okeke, 1991; 

Ijabadeniyi, 2007; David and Aderibigbe, 2010), ogiriokpei 

(Odibo et al., 1992) and dawadawa (Odunfa, 1986) 

production. 

The bacterial succession in the fermenting 

Cucumeropsis seeds is shown in Table 2. Although 

Staphylococcus aureus and Bacillus sp. were the only 

organisms isolated at 0 h, S. aureus disappeared after 24 

h while Bacillus sp. persisted till the end of the 

fermentation. Four isolates, Klebsiella sp., Pseudomonas 

sp., Pediococcus sp. and Lactobacillus sp. appeared 

after 24 h and persisted throughout the fermentation. 

Another bacterium, Serratia sp., was encountered as 

from the 72 h until the end of the fermentation. Our 

previous reports attributed the non-occurrence of the 

other isolates except Bacillus spp. at 0 h of the 

fermentation of Telfairia seeds for ogiri production (Odibo 

and Umeh, 1989) and Prosopis seeds for ogiri-okpei 

production (Odibo et al., 1992), to the fact that the 

vegetative bacterial cells were destroyed during boiling, 

but reappeared from the plantain leaves used in wrapping 

the seeds or from the air. In variance with this, the high 

viable cell counts recorded for S. aureus at the 0 h may 

have originated from handling as the seed coats of the 

cooked Cucumeropsis seeds were removed and 

cotyledons washed with sterile water prior to wrapping. 

The disappearance of S. aureus after 24 h of 

fermentation is in contrast with the reports of Odibo and 

Umeh (1989) for ogiri from Telfairia seeds, Odibo et al. 

(1992) for ogiri-okpei from Prosopis seeds and Jideani 

and Okeke (1991) for ogiri from African oil bean, Soya 

bean and Castor oil seeds. According to these reports, S. 

aureus was isolated after 24 h and persisted till the end 

of fermentation except in the case of castor oil seeds in 

which the organism appeared after 24 h and disappeared 

after 48 h. However, the existence of S. aureus in the 

fermenting Cucumeropsis seeds from 0–24 h is in 

keeping with the observation of Popoola and Akueshi 

(1984) that Staphylococcus spp. were present only within 

24 h of fermentation of ‘daddawa’, a nutritionally related 

condiment produced from Soya bean fermentation. 

The isolation of coagulase-positive S. aureus from the 

fermenting seeds is of public health concern as the 

organism is known to cause food poisoning (Frazer and 

Westhoff, 2000). Also, the presence of Klebsiella, a 

coliform could constitute a health risk since some species 

of this genus are associated with diseases of man 

(Collins et al., 2004). However, Odibo and Umeh (1989) 

and Odibo et al. (1992) expressed the expectation that 

the high heat treatment subjected to ogiri and ogiri-okpei, 

respectively during cooking will destroy these 

microorganisms and possibly any toxin elaborated in the 

condiment. Similarly, Odunfa (1981) noted that if ogiri is

Table 1. Properties and identity of bacteria isolated from fermenting Cucumeropsis seeds d . 

Strain 

No. 

1. 

2. 

3. 

4. 

5. 

6. 

7. 

Strain 

No. 

1. 

2. 

Colony morphology and 

characteristics 

White medium sized mucoid 

colonies ca.1mm diameter on 

nutrient agar 

Large white domed colonies 

ca. 1 mm diameter on nutrient 

agar; entire edges and 

smooth surface 

Large convex, cream to 

yellowish on nutrient agar; ca. 

1.5 to 2 mm diameter 

Small colonies 0.8 mm 

diameter; greenish yellow on 

nutrient agar; irregular edges 

Very small, flat, cream to 

yellowish colonies; entire 

edges on tomato juice agar 

Small, dome, white colonies 

ca. 1mm diameter on nutrient 

agar; entire edges 

Red, smooth colonies ca. 2 

mm diameter on nutrient agar; 

lobate edges 

Colony morphology and 

characteristics 

White medium sized mucoid 

colonies ca.1 mm diameter on 

nutrient agar 

Large white domed colonies 


agar; enter edges and smooth 

surface 

Cell shape and 

Gram stain 

Gram positive, long 

rods 

Gram negative 

short and tiny rods 

Gram positive cocci 

in clusters 

Gram negative 

slender rods 

Gram positive rods 

in chains 


in pairs 

Motility Spore 

Starch 

hydrolysis 

Catalase Oxidase Coagulase Urease Citrate 

Odibo et al. 5097 

Casein 

hydrolysis 

Gelatin 

hydrolysis 

+ + + + + ND _ + + + 

_ ND _ + _ _ _ + _ + 

_ ND _ + _ + + _ _ _ 

+ ND + + + ND _ + + + 

_ _ _ _ _ ND _ _ _ _ 

_ ND _ _ ND _ _ ND _ _ 

Gram negative rods + ND _ + _ ND _ + _ _ 

Cell shape and 

gram stain 

Gram positive, long 

rods 

Gram negative 

short and tiny rods 

Tween 80 

hydrolysis 

Sugar utilization 

O/F Lactose Xylose Sucrose Glucose Mannitol Maltose 

Indole 

Probable 

identity 

+ O A _ A A A A _ Bacillus sp. 

+ F A ND ND A ND ND _ 

Klebsiella 

sp.


Table 1. Contd. 

3. 

4. 

5. 

6. 

7. 

Large convex, cream to 

yellowish on nutrient agar; ca. 

1.5 to 2 mm diameter 

Small colonies 0.8 mm 

diameter; greenish yellow on 

nutrient agar; irregular edges 

Very small, flat, cream to 

yellowish colonies; entire 

edges on tomato juice agar 

Small, dome, white colonies 


agar; entire edges 

Red, smooth colonies ca. 2 

mm diameter on nutrient agar; 

lobate edges 


in clusters 

Gram negative 

slender rods 

Gram positive rods 

in chains 


in pairs 

+ F A ND A A A A _ S. aureus 

+ O A A A A A A + 

+ 

F 

A 

_ 

+ F A ND A A A _ ND 

A 

A 

A 

A 

+ 

Pseudomo 

nas sp. 

Lactobacill 

us sp. 

Pediococcu 

s sp. 

Gram negative rods _ O/F A _ A A A A _ Serratia sp. 

d +, Positive reaction; -, no reaction/negative reaction; ND, not determined; A, acid produced; O, oxidative; F, fermentative. 

Table 2. Succession of microorganisms and physical changes in fermenting Cucumeropsis seeds. 

Fermentation 

period (h) 

Temperature 

(°C) 

pH 

Viable cell counts (per g seed) 

A B C D E F G 

0 28 6.0 2.3×10 5 1.8×10 5 0 0 0 0 0 

24 29 6.2 3.0×10 5 1.7×10 6 4.8×10 5 2.4×10 5 1.6×10 5 3.6×10 5 0 

48 31 6.5 0 1.8×10 7 3.2×10 6 2.8×10 6 2.4×10 6 1.2×10 6 0 

72 33 6.8 0 0.8×10 4 1.5×10 3 1.2×10 3 1.7×10 3 0.4×10 4 1.6×10 6 

96 35 7.1 0 1.1×10 2 2.0×10 3 1.4×10 3 0.7×10 4 0.6×10 4 0.2×10 2 

A= Staphylococcus aureus; B= Bacillus sp.; C = Klebsiella sp.; D= Pseudomonas sp.; B = Pediococcus sp.; F= Lactobacillus sp.; G = Serratia sp. 

well boiled in soup, the danger of microbial 

infection is eliminated. 

The pH of fermenting seeds increased gradually 

from 6.0 at 0 h to 7.1 after 96 h. The temperature 

rose continuously from an initial value of 28 to 

35°C at the end of the fermentation (Table 2). The 

trend in pH as observed in this study is in contrast 

with our previous studies on ogiri from Telfairia 

seeds (Odibo and Umeh, 1989) and ogiri-okpei 

from Prospis seeds (Odibo et al., 1992). It is 

however, in line with the trend in pH observed by 

Odunfa (1981) and David and Aderibigbe (2010) 

for ogiri from different melon seeds. Odunfa 

(1981) described the fermentation process as 

essentially putrefactive, noting that the increase in 

pH was probably due to the formation of ammonia 

by the deaminase enzymes of Bacillus and 

Proteus spp. Our present pH trend is made

more understandable by the fact that the lactic acid 

bacterial genera present in the fermenting mash did not 

significantly proliferate. Similarly, poor growth of this 

aciduric Lactobacillus sp. (Aderiye and Ojo, 1987) was 

recently observed by David and Aderibigbe (2010) during 

the fermentation of C. mannii (Naud), Citrullus lanatus (L) 

and Colocynthis vulgaris (Schrad) seeds for ogiri 

production. 

In this study, the ogiri obtained compared favourably in 

colour, taste, aroma and texture with the same condiment 

from other known substrates. It is envisaged that further 

studies on the optimization of ogiri fermentation as well 

as improved packaging will help to ensure industrial 

production and enhanced popularity of this condiment. 

REFERENCES 

Aderiye BI, Ojo O (1987). Monitoring microbiological and biochemical 

changes in fermented yam. Folia Microbiol., 42(2): 141-144. 

Collins CH, Lyne PM, Grange JM, Falkinnam JO (2004). Collins and 

Lyne’s microbiological methods, 8th ed. Hodder Arnold Publication, 

New York, p. 464. 

David OM, Aderibigbe EY (2010). Microbiology and proximate 

composition of ogiri, a pastry produced from different melon seeds. 

N.Y. Sci. J., 3(4): 18-27. 

Frazer WC, Westhoff DC (2000). Food microbiology, 4th ed. Tata 

McGraw-Hill Publication Limited, New Delhi, pp. 17-34. 

Ijabadeniyi AO (2007). Microbiological safety of gari, lafun and ogiri in 

Akure metropolis, Nigeria. Afr. J. Biotechnol., 6(22): 2633-2635. 

Jideani IAO, Okeke CR (1991). Comparative study of microorganisms 

and sensory attributes of condiments from the fermentation of 

different seeds. Plant Fd. Hum. Nutr., 41: 27-34. 

Krieg NR, Holt JG, Murray RGE, Breener DJ, Bryant MP, Holt JG, 

Moulder JW, Pfennig N, Sneath PHA, Staley JT (1984). Bergey’s 

manual of systematic bacteriology, Williams and Wilkins, Baltimore, 

Maryland, 1: 964. 

Odibo et al. 5099 

Odibo FJC, Nwabunnia E, Osuigwe DI (1990). Biochemical changes 

during fermentation of Telfairia seeds for ogiri production. World J. 

Microbiol. Biotechnol., 6: 425-427. 

Odibo FJC, Ugwu DA, Ekeocha DC (1992). Microorganisms associated 

with the fermentation of Prosopis seeds for ogiri-okpei production. 

Food Sci. Technol. (Mysore), 29: 306-307. 

Odibo FJC, Umeh AI (1989). Microbiology of the fermentation of 

Telfairia seeds for ogiri production. MIRCEN J. Appl. Microbiol. 

Biotechnol., 5: 217-222. 

Odibo MC (1985). Microbiology of melon seed fermentation for ogiri 

production. B.Sc. Thesis. Department of Microbiology, University of 

Nigeria, Nsukka, pp. 1-7. 

Odunfa SA (1981). Microbiology and amino acid composition of ogiri—a 

food condiment from fermented melon seeds. Die Nahrung, 25: 811- 

816. 

Odunfa SA (1985). Microbiological and toxicological aspects of 

fermentation of castor oil seeds for ogiri production. J. Food Sci., 50: 

1758-1764. 

Odunfa SA (1986). Dawadawa. In: Reedy NR, Pierson MD, Salunkhe 

DK (eds), Legume-based fermented foods. CRC Press, Boca Raton, 

pp. 173-189. 

Oyolu C (1977). A quantitative and qualitative study of seed types in 

egusi (Colocynthis citrullus L.) Trop. Sci., 19: 55-60. 

Popoola TDS, Akueshi CO (1984). Microorganisms associated with the 

fermentation of soybean for the production of “daddawa” (a 

condiment). Nig. Food J., 2 & 3: 194-198. 

Sierra G (1957). A simple method for the detection of lipolytic activity of 

microorganisms and some observations on the contact between cells 

and fatty substrates. Anton. Leeuwen, 25: 15-22. 

Sneath PHA, Mair NS, Sharpe ME, Holt JG (1986). Bergey’s manual of 

systematic bacteriology, The Williams and Wilkins Inc, Baltimore, 

Maryland. Vol. 2.



DOI: 10.5897/AJMR12.085 



Combined effect of NPK levels and foliar nutritional 

compounds on growth and yield parameters of potato 

plants (Solanum tuberosum L.) 

Mona, E. Eleiwa 1 * Ibrahim, S. A. 2 and Manal, F. Mohamed 3 

1 Botany Department, Faculty of Science, Cairo University, Egypt. 

2 Department of Plant nutrition, NRC, Giza, Egypt. 

3 Department of Agronomy, NRC, Giza, Egypt. 

Accepted 7 February, 2012 

Field experiment was conducted to study the effect of NPK levels and foliar nutritional compounds on 

growth yield, chemical constituents and nutrients content of potato plants grown in newly reclaimed 

soil. The obtained results could be summarized as follows: Increasing the NPK levels significantly 

increased all the growth, and yield parameters (except for number of aerial stem, plant), photosynthetic 

pigments, chemical constituents of potato tuber at harvest, and macro and micronutrients in potato 

shoots and tubers. The highest values of the mentioned parameters were obtained by using the highest 

NPK (120:80:100) as compared with the other two NPK levels (Medium: 102:68:85 and low: 90: 60: 75). 

Foliar application with folifertile, Byfolane and fetrilon combi significantly increased growth and yield 

parameters, photosynthetic pigments, chemical constituents and nutrients content of shoots and 

tubers as compared with the control treatment. The highest effective treatment in this respect was 

folifertile followed by Byfolane and fetrilon combi in decreasing order. The interaction between NPK 

levels and foliar nutritional compounds significantly affected leaves number (LN)/plant, chl. b and chl. a 

+ b, tuber yield, mono sugars, carbohydrate and L-ascorbic acid as well as p, Mn and Cu concentration 

in shoots, and N and Fe in tubers. The interaction did not significantly affect the other studied 

parameters. 

Key words: Foliar compounds, nutrients content, potato NPK chemical constituents, interactions. 

INTRODUCTION 

Potato (Solanum tuberosum) is one of the most important 

and favorite vegetable crop grown in Egypt. Its economic 

importance arises from the fact that large amount of this 

crop is exported yearly. Potato is a staple food in the diet 

of the world's population and also being used as animal 

feed (Dancs et al., 2008). Although potato is considered 

as a starchy food, it is also included in the category of 

vegetables by its micronutrient content, Robert et al. 

(2006) suggested that consumption of cooked potatoes 

(consumed with skin) may enhance antioxidant defense 

and improve the lipid metabolism, these effects could be 

*Corresponding author. E-mail: sala201018@gmail.com. 

interesting for prevention of cardiovascular diseases. 

Potato tubers have been successfully used for high-level 

production of recombinant antibodies accumulated up to 

2% of total soluble tuber protein, also antibodies specific 

activity did not decrease during tuber storage (Artsaenko 

et al., 1998). Potatoes could be used as an important 

dietary source of the carotenoid zeaxanthin which accumulates 

in the human macula lutea and protects retinal cells 

from blue light damage. However, zeaxanthin intake from 

food sources is low. Increasing zeaxanthin in common food 

such as potatoes by traditional plant breeding or by genetic 

engineering could contribute to an increased intake of this 

carotenoid and, consequently, to a decreased risk of agerelated 

macular degeneration (Bub et al., 2008). 

Fertilization either mineral and/or organic and foliar

fertilizers considered the most important agricultural 

practices, which affects the growing period of plant 

foliage and tuber formation as well as the quality of 

produced yield (Gabr et al., 2001; Bekhit et al., 2005). 

The necessity of nitrogen (N), phosphorus (P) and 

potassium (K) for growth has been demonstrated by 

several investigators, since N supply was desirable for 

vegetative growth, dry matter accumulation as well as 

nutrients uptake by potato plants (El-Ghamriny and Saeed, 

2007a). As P is a part of molecular structure of nucleic acid 

(DNA and RNA), the energy transfer compounds, cell 

membranes and phosphoproteins so it has a great 

importance in physiological processes inside the plant, 

moreover, (p) has a role in plant life through energy storage 

and transfer, it acts as a linkage unit and has a vital metabolic 

role as an important structural component of wide varieties of 

biochemical materials including nucleic acids, coenzymes, 

phosphoproteins, phospholipid and sugar phosphates (Daniel 

et al., 1998). Furthermore, (k) is a mobile element in plant 

tissues and it plays an important role in photosynthesis 

through carbohydrate metabolism, osmotic regulation, 

nitrogen uptake and translocation of assimilates, also it has a 

role in physiological processes in plant respiration, 

transpiration, translocation of sugars and carbohydrates 

and enzyme transformation (Kelling et al., 1998). 

In this concern Kolbe et al., 1990) found that different 

NPK-ratios led to maximum yield and tuber quality of potato, 

they added that it is possible to demonstrate characteristic 

differences between the effect of N-fertilization and varied 

N-concentrations on tuber yield and composition. 

Nitrogen, p and k as macronutrients are commonly 

applied to soil. This method of application is usually accompanied 

with some losses through leaching. Excessive 

irrigation as well as the fixation of phosphorus are 

considered to be one of the growers mistakes which 

aggravate N, P and K losses from soil. 

In higher pH soil as that in Egyptian soils, it is known 

that micronutrients as well as some macronutrients may 

be limiting. Foliar products containing multi-nutrients may 

correct these deficiencies giving increases in growth and 

development. Foliar applications are often the most 

effective economical way to correct plant mineral 

deficiency (Kannan, 1986), especially when sink competition 

for carbohydrates between plant organs take place 

and nutrient uptake from the soil is restricted (Marschner, 

1986). 

There are many compounds used in foliar fertilization 

products, chelated compounds made from natural 

organic materials may have advantages since they are 

more ecological safe and have more prolonged and 

efficient action. Agriculturally, a foliar application of 

nutrient solution is particularly useful when the uptake of 

nutrients from the soil is growth limiting (Swietlik and 

Faust, 1994). 

It was advisable in this investigation to study the effect of 

NPK levels and some foliar nutritional compounds on growth, 

yield and chemical composition of potato plants (Solanum 

tuberosum cultivar Diamant) grown under the newly reclaimed 

soil conditions. 


Eleiwa et al. 5101 

Field experiments were carried out in the experimental farm of 

Salah El-Din, El-Bostan, Nobaria, El-Behera Governorate which 

belongs to the National Research Center, Giza (Egypt). Some 

physical and chemical properties of the soil in the experimental 

sites were noted (Table 1). 

The experiment included 12 treatments which were the 

combination between three NPK levels and three foliar nutritional 

compounds, Folifertile, Byfolane and Fetrilon combi. The three NPK 

levels were high (120:80:100), medium (102:68:85) and low 

(90:60:75). 

The treatments were arranged in a split plot design with three 

replications. The NPK levels were randomly arranged in the main 

plots and the foliar nutritional compounds were randomly distributed 

in the sub plots. Chemical composition and concentration of the 

different nutritional compounds used in foliar feeding are presented 

(Table 2). 

Spraying with nutritional compounds were carried out six times by 

15 days intervals during the growth period at rate of 400 L./Fed., 

control plants were sprayed with tap water. Other agricultural 

processes were followed according to normal practice in the region. 

Potato tubers were sown on January 15 th at 20 cm apart. The source 

of fertilizers was ammonium sulfate (20.6% N), triple superphosphate 

(37% P2O5) and potassium sulfate (48% K2O), respectively. One third 

of NPK fertilizers were added at the time of soil preparation along with 

farmyard manure at the rate of 40 m 3 /feddan. The two third of NPK 

were divided into six equal portions and added at 10 days intervals 

beginning one month after planting. 

Data recorded 

Growth parameters 

Random samples of five plants were taken from every plot at 90 days 

after planting, for measuring: stem length, number of areal stems/plant, 

number of leaves/plant, dry weight of roots/plant, dry weight of 

shoots/plant, total dry weight of roots and shoots. 

Photosynthetic pigment 

Disc sample from the fourth upper leaf of potato plants was 

randomly taken from every experimental unit, 90 days after 

planting, to determine chlorophyll a, b and chl. a + b also 

carotenoids and total pigments, according to the method described 

by Wetteslein (1957). 

Yield and its components 

At harvest time, 115 to 120 days after planting, following 

parameters were calculated: No. of tubers/plant, tuber yield/plant, 

average tuber weight and total yield (ton/fed.) 

Chemical composition and nutrients status at harvest 

Crude protein, mono sugars, starch, carbohydrate, total soluble 

solids (T.S.S) and ascorbic acid as well as macro and 

micronutrients in shoots and tubers were determined as described 

by, Cottenie et al. (1982), and A.O.A.C. (2000).


Table 1. Some physical and chemical properties of the experimental soil, according to Ryan et al. (1996). 

a) Te(a) Texture,, pH, EC, O.M%, CaCO3 

Sand % Silt % Clay% Texture pH 1:2.5 EC dsm -1 

O.M% CaCO3 

86.0 8.0 6.0 sandy 7.45 0.89 0.35 1.8 

(b) Soluble cations and anions (meq/L 1:5) and available nutrients (ppm) 

Na + k + Ca ++ Mg ++ CO3 - HCO3 - Cl - 

SO4 -- N P K Fe Mn Zn Cu 

2.77 0.07 4.5 1.00 - 2.35 2.01 3.98 50.0 9.5 64.8 3.12 0.67 0.48 0.39 

Table 2. Nutritional compounds composition and concentration percentage. 

Compound 

Composition 

N P2O5 K2O S Mg Fe Mn Zn Cu Mo B Co Reco. Conc. 

Folifertile 22 21 17 0.167 0.076 0.730 0.0395 0.0068 0.0076 0.0050 0.0033 0.002 0. 30 

Byfolane 11 8.0 6.0 - - 9.018 0.016 0.006 0.0066 0.0095 0.0013 - 0.20 

Fetrilon combi - - - - - 1.5 4.5 3.0 - - - - 0.15 

Statistical analysis 

The proper statistical analysis of all data carried out 

according to Gomez and Gomez (1984). The differences 

between treatments mean were compared using the least 

significant differences at 5% LSD level. 


Vegetative growth and photosynthetic 

pigments 

Effect of NPK levels 

Data concerning the effect of mineral NPK levels 

on vegetative growth parameters at potato plants 

that is stem length, No. of aerial stem/plant, No. of 

leaves/plant, dry weight of roots and shoots/plant 

as well as dry weight of total plant are presented 

in (Table 3). The present result indicated that 

application of NPK levels significantly increased 

all the previous parameters except No. of aerial 

stem/plant which did not significantly affected. The 

highest NPK level (120:80:100) gave the highest 

values for all mentioned parameters as compared 

with other two NPK levels (Medium 102:68:85 and 

low 90:60:75). The necessity of N, P and K for 

growth has been demonstrated by several investigators, 

since nitrogen supply was desirable for 

vegetative growth, dry matter accumulation as 

well as nutrient uptake by potato plants (El- 

Ghamriny and Saeed, 2007a). The increase in 

plant growth may be attributed to the beneficial 

effects of nitrogen on stimulating the merestimatic 

activity for producing more tissues and organs, 

since it plays major roles in the synthesis of 

structural proteins and other several macro 

molecules, in addition to its vital contribution in 

several biochemical processes that related to 

plant growth (Marschner, 1995). Also, nitrogen 

may be contributed with the activation of cell 

division and cell elongation (Medani et al., 2000). 

The promating effect of growth parameters could 

be attributed to phosphorus as structural part of 

high energy compounds (Sarg, 2004). It is also a 

constituent of the cell nucleus and is essential for 

cell division and the merestimatic tissues 

development (Frank, 2002). 

The obtained results of growth parameters in 

this investigation are in good agreement with 

those obtained by El-Arquan et al. (2002), El- 

Ghamriny and Saeed (2007a), Kamel et al. 

(2008), Rafla et al. (2009) on different crops. NPK 

levels significantly affected the phototosynthetic 

pigments of potato plants (chl. a chl. b, chl. a+b, 

carotenoids and total pigments). The obtained 

results took the same trend of those obtain for

Table 3. Effect of NPK levels and some foliar compounds on growth and photosynthetic pigments (mg/g dry weight) in potato shoots 90 days after sawing. 

Treatment e 

Stem length 

(cm) 

No. of aerial 

stem/ plant 

Vegetative growth Vegetative growth Photosynthetic pigments 

No. of leaves/ 

plant 

D. wt. of 

roots /plant 

D. wt of shoots D. wt. of total 

gm/plant plant (gm) 

Chl. a Chl. b Chl. a+b Carotenoids 


NPK levels 

L 25.44 2.91 32.68 4.45 27.41 31.86 2.43 1.69 4.11 1.67 5.78 

M 27.14 3.08 34.66 4.85 29.38 34.23 2.57 1.83 4.39 1.75 6.14 

H 28.68 3.10 36.89 5.28 31.39 36.67 2.68 1.96 4.63 1.89 6.52 

LSD. at 5% 0.42 NS 1.19 0.23 1.36 1.22 0.11 0.07 0.12 6.07 0.11 

Foliar compounds 

Control 24.86 2.41 32.27 4.24 26.99 31.23 2.34 1.65 3.99 1.67 5.67 

FF. 30.49 3.79 37.93 5.69 32.62 38.31 2.79 2.09 4.87 1.92 6.80 

By. 27.18 3.04 35.06 4.94 29.92 34.87 2.61 1.82 4.43 1.75 6.18 

Fet. 25.83 2.88 33.70 5.56 28.04 32.60 2.84 1.74 4.22 1.72 5.94 

LSD at 5% 0.51 0.47 0.55 0.12 1.01 1.06 0.06 0.05 0.08 0.05 0.10 

NPK levels×foliar compounds 

Control 23.03 2.60 29.50 3.83 25.57 29.46 2.27 1.57 3.83 1.60 5.43 

L 

FF. 

By. 

28.70 

25.90 

3.47 

2.83 

36.57 

33.14 

5.30 

4.57 

30.07 

27.63 

35.37 

32.20 

2.60 

2.47 

1.86 

1.66 

4.46 

4.13 

1.80 

1.66 

6.25 

5.79 

Fet. 24.13 2.73 31.50 4.10 26.37 30.47 2.37 1.66 4.03 1.62 5.65 

Control 24.93 2.63 32.73 4.30 27.23 31.53 2.33 1.66 3.99 1.68 5.67 

M 

FF. 

By. 

30.63 

26.90 

3.86 

3.07 

37.47 

34.59 

5.67 

4.80 

32.03 

30.27 

37.70 

37.07 

2.83 

2.63 

2.07 

1.85 

4.90 

4.48 

1.87 

1.75 

6.77 

6.23 

Fet. 26.10 2.83 33.84 4.63 28.00 32.63 2.47 1.73 4.20 1.71 5.90 

Control 26.60 1.99 34.57 4.60 28.17 32.77 2.43 1.72 4.16 1.75 5.96 

H 

FF. 

By. 

32.13 

28.73 

4.10 

3.23 

39.77 

37.47 

6.10 

5.47 

35.77 

31.87 

41.87 

37.33 

2.93 

2.73 

2.33 

1.94 

5.27 

4.68 

2.11 

1.85 

7.38 

6.52 

Fet. 27.27 3.07 35.77 4.93 29.77 34.70 2.60 1.83 4.43 1.84 6.28 

LSD. at 5% NS NS 0.95 NS NS NS NS 0.09 0.13 NS 0.17 

NPK levels: L= Low (90:60:75), M= Medium (102:68:85) , H= High (120:80:100). Foliar compounds: FF. =Folifertile, By.=Byfolane, Fet.= Fertrilon combi. 

the growth parameters. The highest values were 

obtained by using the highest NPK levels 

comparing to the other two levels. It is conspicuous 

that increasing NPK levels significantly 

increased pigments content in potato shoots at 90 

day. The increases in the photosynthetic pigments 

in shoots may be attributed to the important role of 

(P) in the potential activity of photosynthesis. 

Total 

pigments 

Moreover, it has a metabolic activating role to large 

number of enzymatic reactions depending on 

phosphorylation (Nassar et al., 2005). Marschner 

(1995) found that the favourable effect of NPK on


photosynthetic pigments may be also due to N which is a 

constituent of chlorophyll molecule, amino acids and 

proteins acting as structural compounds of the chloroplast, 

correspondingly, an enhancement of protein synthesis and 

chloroplast formation leads to an increase in chlorophyll. It 

seems that NPK treatment significantly increased 

carotenoids in potato shoots, these results are in 

agreement with those obtained by Bijana et al. (2005) and 

Kamel et al. (2008) who found that carotenoids in wheat 

leaves increased significantly by increasing NPK levels. 

Effect of foliar compounds 

Data indicated that foliar application with the investigated 

compounds (folifertile, byfolane and fetrilon combi) 

significantly increased all the growth characters and 

photosynthetic pigments as compared with the control 

treatment (Table 3). The highest effective treatment in this 

respect was that of folifertile followed by byfolane and fetrilon 

combi in decreasing order. The highest effect of folifertile 

might be attributed to its higher content of macro and 

micronutrients than the other two used foliar compounds 

(Table 2). In addition folifertile contains Mg element, which 

plays important physiological and biological role in chlorophyll 

formation, activation of enzymes, synthesis of protein, 

carbohydrate metabolism and energy transfer, as well as it 

acts as a catalyst in many oxidation reduction reactions in 

plant tissues (Saad and El-Kholy, 2000). This means that 

spraying potato plants with the foliar compounds significantly 

encourage the capability of plants to produce vigorous 

vegetative growth characters. Also, these foliar compounds 

play a great role in plant metabolism such as photosynthesis, 

respiration and other metabolic process (Ahmed et al., 2002), 

which in turn produced more carbohydrate, and chlorophyll, 

leading to enhancements of plant height, leaves number and 

branches in bean plant (El-Kabany, 2000). The obtained 

results in this investigation are in good agreement with those 

obtained by Abd-El-Fatah and El-Ghinbihi (2001) and Helal 

Fawzeia et al. (2006) who stated that significant increment in 

faba bean plant height and number of branches/ plant was 

obtained due to the foliar spraying with micronutrients, leads 

to growth increase as compared with control plants. 

Effect of interaction between NPK levels and foliar 

compounds 

The data obtained in Table 3 indicated that the interaction 

between NPK levels and foliar nutritional compounds on 

growth parameters and photosynthetic pigments did not 

significantly affected most of the parameters under study 

except leaves No./plant, chl. b and chl. a+b which were 

significantly affected by the interaction. However the 

highest values of growth and photosynthetic pigments 

were obtained by applying the higher level of NPK and 

sprayed with folifertile compound, on the other hand, the 

lowest values were attained by using the lowest level of 

NPK and sprayed with tap water. 

Yield and its components and some chemical 

constituents of potato tubers 


Data presented in Table (4) indicated that increasing the 

NPK levels significantly increased yield parameters. This 

result is supported by El-Zeiny and Maha (2004) who 

found that increasing N levels application up to 95 kg 

/Fed. Significantly increased stripped stalk and juice, total 

biomass and forage yield of sweet sorghum. The 

increasing yield of potato plant can be explained by the 

important fact of phosphorus as a constituent compound 

in most metabolic processes (El-Arquan et al., 2002). 

Moreover, the effect of NPK on increasing yield is due to 

K which is a co-factor (enzyme activator) for different 

enzymes and it helps to maintain electro-neutrality in 

plant cell. 

In this concern Lindhaver and Fekete (1990) mentioned 

that starch synthesis in potato tubers grown at varied k 

nutrition was investigated with particular regard to the 

activity of selected enzymes (sucrose synthase, UDP-Dglucose 

pyrophosphatase, starch phosphorylase, 

amylases) independence on tuber K content, they added 

that the activity of enzymes related to tuber Kcontent did 

not differ significantly, starch and k content of tubers 

increased with progressing age. Comparing our results in 

Tables 3, 4 and 5, it is obvious that the positive 

correlations between the rates of K uptake, starch 

production and growth indicate that the dynamic phase of 

K supply to the tubers is of greater importance for starch 

synthesizing processes, than the influence of total K 

content. The obtained results agree with those obtained 

by Moustafa et al. (2005) mentioned that increasing NPK 

levels significantly increased the growth parameters, yield 

and its components as well as nutrient uptake of sugar 

beet and sweet sorghum plants. 

The chemical constituents of potato tubers at harvest 

were significantly increased by increasing NPK levels 

(Table 4), El-Ghamriny and Saeed (2007b), and Kamel 

Nadia et al. (2008) proved that NPK application significantly 

increased reducing, nonreducing and total sugar 

as well as carbohydrates, starch, and protein contents in 

wheat grains. Same trend was found by Karcomarczyk et 

al. (1999) who reported that increasing NPK to 450 kg N 

and from 50 to 100% of the recommended rate enhanced 

more carbohydrate and protein accumulation in plants. 


The obtained results in Table (4) indicated that foliar 

compounds under investigation (folifertile, Byfolane and 

fetrilon combi) application significantly increased the yield and

Table 4. Effect of NPK levels and some foliar compounds on yield and chemical composition (%) of potato tubers at harvest time. 

Treatment 

No. of 

tubers/ plant 

Yield VV Yeild its component Chemical composition Chemical c 

Tuber 

yield/plant (gm) 

Average tuber 

wt. (gm) 

Tuber yield 

(ton/fed) 

Crude 

protein 

Mono 

sugars 

Starch Carbohydrate Total soluble 

solids 


L-Ascorbic 

acid 

NPK levels 

L 4.51 510.69 107.58 14.32 11.15 3.58 65.26 76.78 4.45 14.49 

M 4.88 537.17 110.70 15.39 12.05 3.69 67.34 78.40 4.60 14.83 

H 5.36 573.63 113.78 16.60 12.77 3.83 69.17 80.23 4.73 15.36 

LSD. at 5% 0.19 14.49 2.06 0.85 0.06 0.23 0.61 0.92 0.09 0.08 


Control 4.39 505.04 106.88 14.36 1 0.73 3.49 65.41 76.32 4.25 14.41 

FF. 5.49 589.54 115.89 16.69 13.91 4.01 69.97 81.13 4.88 15.61 

By. 5.12 548.96 111.66 15.75 12.31 3.79 67.43 79.44 4.66 14.94 

Fet. 4.67 518.44 108.31 14.96 11.00 3.58 66.22 76.98 4.56 14.61 

LSD at 5% 0.15 13.00 3.34 0.28 0.06 0.20 0.55 0.66 0.10 0.13 

NPK levels× foliar compounds 

Control 4.03 486.07 105.11 13.33 9.90 3.41 63.17 75.23 3.96 13.98 

L 

FF. 

By. 

4.91 

4.80 

537.57 

525.80 

112.05 

106.98 

15.50 

14.73 

12.83 

11.50 

3.86 

3.57 

67.70 

65.53 

78.40 

77.80 

4.79 

4.55 

14.93 

14.66 

Fet. 4.31 493.33 106.19 13.73 10.37 3.50 64.63 75.70 4.48 14.38 

Control 4.40 499.73 106.02 14.07 10.90 3.50 66.03 76.65 4.27 14.32 

M 

FF. 

By. 

5.53 

5.00 

586.10 

535.77 

114.98 

113.62 

16.50 

15.90 

14.00 

12.41 

3.93 

3.72 

70.17 

67.03 

80.90 

78.83 

4.86 

4.67 

15.66 

14.76 

Fet. 4.59 527.07 108.18 15.07 10.87 3.59 66.13 77.20 4.58 14.59 

Control 4.73 529.33 109.52 15.67 11.40 3.57 67.03 77.07 4.53 14.93 

H 

FF. 

By. 

6.03 

5.57 

644.97 

585.30 

120.63 

114.38 

18.06 

16.60 

14.90 

13.03 

4.24 

3.83 

72.03 

69.73 

84.10 

81.70 

5.00 

4.75 

16.23 

15.40 

Fet. 5.09 534.93 110.57 16.07 11.75 3.66 67.90 78.03 4.64 14.87 

LSD. at 5% NS 14.94 NS NS NS 0.34 NS 1.17 NS 0.22 


its components as compared with the control 

treatment. The highest values of all the previous 

studied parameters were obtained by using folifertile 

followed by Byfolane, fetrilon combi and control in 

decreasing order. It is clear from the above results 

that foliar compounds increased signifi-cantly the 

average weight of tuber as well as the weight of 

tubers /plant as compared with control treatment. 

This effect means that foliar nutrition application 

led to an increase in plant yield through dry matter 

accumulation in the economic parts of potato 

tuber. Results agree with El-Zeiny (2002) found


that vegetative growth, data affected by foliar compounds 

which in turn increased carbohydrate, cell division and 

enlargement leading to more yield. 

Generally, data indicated that different nutrient compounds 

favored the increase of vegetative and productive 

growth as well as yield and components of potato plants 

(Tables 3 and 4). The changes in the level of mineral 

nutrition of the above ground organs of plant are not 

attributed to the foliar absorption itself but to the effect of 

nutrients uptake by root system (Shereverga, 1959) 

The results is supported by Abd- El-Hadi et al. (1998), 

on wheat, potato and sugar cane, El-Tohamy et al. 

(2007) on Snap beans and Hussein et al. (2008) on 

Fodder beet plants, they reported that foliar spray of 

micronutrients enhanced growth and increased the dry 

matter accumulation in different crops. The content of 

crude protein, monosugars, starch, carbohydrate, total 

soluble solids (T.S.S) and L. Ascorbic acid in plant tubers 

were significantly increased by using the three different foliar 

nutritional compounds comparing with the control treatment 

(Table 4), the highest values of the chemical composition 

were obtained by applying folifertile, Byfolan, fetrilon combi 

in decreasing order respectively. 

The superiority of folifertile to other nutritional compounds is 

due to its higher content of macro and micronutrients 

especially nitrogen and suphur (Table 2), nitrogen may have 

affect on the uptake and photosynthetic surface, through 

increasing the number of cells / leaf and number of leaves / 

plant (El-Baz, 1967). Also, Dancs et al. (2008) indicated that 

sulphur could increase methionine content of tubers by coexpressing 

a gene involved in methionine synthesis, led to 

rich of storage protein in potato tubers. 

It seems that when foliar nutritionals were used, the 

photosynthetic activity was stimulated, leading to 

enhancement of chemical constituents as crude protein, 

starch, carbohydrate, L-ascorbic acid and T.S.S in shoots 

which were afterwards translocated to the tubers. These 

effects may also due to the presence of micronutrients in 

the foliar compounds as Zn, Cu, Mn and B. Abou-Zied 

(1979) concluded that trace elements of folifertile might 

be mediated via the enzymatic systems responsible for 

biosynthetic apparatus, and thus rising sugars and 

nitrogen in intact plants. Furthermore, El-Bassiony et al. 

(2006) concluded that spraying sweet pepper plants with 

mixture of Fe, Mn and Zn led to increase in ascorbic acid 

(vitamin c), total acidity and as compared with the control 

treatment. 


compounds 

The interaction between the NPK levels and the foliar 

nutritional compounds significantly affected weight of 

tubers/plant and percentage of mono sugars, carbohydrate 

and L-ascorbic acid, but did not affect other parameters of 

yield as well as the chemical constituents of potato plants 

(Table 4). The highest values of yield parameters and 

chemical constituents were obtained when the highest level 

of NPK was applied and sprayed potato plants with folifertile 

compound, while the lowest values were attained by using 

the lowest NPK level and sprayed plants with tap water. 

Nutrients content in potato shoots and tubers at 

harvest 


Data recorded in Table (5) indicated that all the studied 

nutrients in shoots and tubers of potato plants 

significantly increased with different levels of the added 

NPK levels. The highest level of NPK application gave 

the highest values of macro (N, P and K) as well as 

micronutrients (Fe, Mn, Zn and Cu) as compared with the 

medium and lowest levels of NPK. In this connection 

Abdalla (2002) found that N, protein, P and K contents of 

faba bean leaves were increased by increasing P level 

from 100 to 200 kg superphosphate/Fed. 

Results are in agreement with those obtained by 

Moustafa et al. (2005), El-Ghamring and Saeed (2007 a, 

b) and Kamel, et al. (2008) who stated that increasing 

NPK levels significantly increased nutrients content and 

uptake of sugar beet, potato and wheat plants 

respectively. Also, Rohily et al. (2010) found that leaf 

nutrient concentrations were at or above the optimum 

levels for high yield, their study insured that, soil 

application rates of NPK at pre-planting were sufficient to 

produce an economical potato yield. 

Generally macro and micronutrients in potato tubers 

were much lower than those obtained in potato shoots. In 

this case Abdel-Fattah et al. (2001) showed that the concentrations 

of P, K, Mn, Fe, Zn, Cu, Pb, Ni, Cd and Co in 

potato tubers were much lower than that in vegetative 

part especially after 90 days from planting. 


Data presented in Table (5) reveal that macro (N, P and 

K) and micronutrients (Fe, Mn, Zn and Cu) content in 

both vegetative shoots and tubers of potato plants at 

harvest were significantly higher by applying different 

foliar compounds than that of control treatment, except, 

nitrogen content in shoots and tubers as well as Cu 

content in shoots which their increase did not attain the 

level of significance at 5%. Highest values of N, P, K and 

Cu in shoots and tubers of potato plants were obtained 

by using folifertile as compared with other treatments. On 

the other hand the highest content of Fe, Mn and Zn, in 

shoots and tubers were attained by using fetrilon combi 

followed by folifertile, Byfolane and control in decreasing 

order. In this concern, Ahmed et al. (1998) stated that 

spraying macro and/or micro nutrients significantly

Table 5. Effect of NPK levels and foliar compounds on macronutrients (%) and micronutrients (ppm) content in potato shoot and tubers at harvest time. 

Shoot Tuber 


Treatment 

Macronutrients % Micronutrients (ppm) Macronutrients % Micronutrients (ppm) 

N P K Fe Mn Zn Cu N P K Fe Mn Zn Cu 

NPK levels 

L 3.31 0.350 4.68 121.31 68.07 32.22 21.15 1.77 0.340 2.63 40.08 12.17 26.25 7.08 

M 3.50 0.389 4.93 124.87 71.89 34.62 23.38 1.88 0.360 2.72 42.17 13.50 29.34 7.92 

H 3.64 0.415 5.09 128.29 76.89 36.98 26.79 1.99 0.378 2.84 45.33 15.08 30.00 8.75 

LSD. at 5% 0.11 0.018 0.06 0.840 0.880 0.380 0.410 0.06 0.020 0.02 0.380 0.460 0.550 0.73 


Control 3.32 0.361 4.68 119.99 66.98 30.72 21.11 1.76 0.342 2.62 31.33 10.00 19.78 4.89 

FF 3.74 0.417 5.26 126.60 73.90 35.62 28.11 2.17 0.386 2.93 46.56 14.44 31.22 10.00 

By 3.53 0.388 4.91 121.72 69.94 32.75 24.51 1.84 0.364 2.71 43.78 13.00 29.56 9.89 

Fet. 3.37 0.373 4.76 130.98 78.31 39.31 21.35 1.75 0.350 2.68 48.44 16.89 33.56 6.89 

LSD at 5% 0.09 0.002 0.08 0.740 0.640 0.600 0.640 0.05 0.002 0.03 0.58 0.69 0.63 0.55 

NPK levels × foliar compounds 

Control 3.20 0.320 4.50 117.07 62.57 27.97 18.87 1.68 0.330 2.54 27.33 8.67 17.67 4.33 

L 

FF. 

By. 

3.57 

3.37 

0.390 

0.357 

5.00 

4.63 

123.17 

117.83 

69.97 

64.40 

33.67 

30.23 

24.67 

21.17 

1.96 

1.74 

0.363 

0.343 

2.79 

2.62 

44.33 

42.00 

12.67 

12.00 

28.33 

27.33 

8.67 

9.00 

Fet. 3.20 0.330 4.57 127.17 75.33 37.00 19.87 1.69 0.333 2.58 46.67 15.33 31.67 6.33 

Control 3.33 0.370 4.70 120.00 66.43 31.00 20.63 1.78 0.342 2.61 32.00 9.670 20.33 5.000 

M 

FF. 

By. 

3.73 

3.53 

0.413 

0.387 

5.33 

4.93 

126.13 

122.07 

73.17 

70.00 

35.43 

32.90 

27.83 

23.87 

2.20 

1.80 

0.385 

0.365 

2.92 

2.69 

46.00 

43.00 

14.67 

12.67 

32.67 

30.67 

10.33 

9.670 

Fet. 3.40 0.387 4.77 131.27 77.97 39.13 21.17 1.75 0.349 2.65 47.67 17.00 33.67 6.670 

Control 3.43 0.393 4.83 122.90 71.93 33.20 23.83 1.82 0.353 2.70 34.67 11.67 21.33 5.330 

H 

FF. 

By. 

3.93 

3.70 

0.443 

0.420 

5.43 

5.17 

130.50 

125.27 

78.57 

75.43 

37.77 

35.13 

31.83 

28.50 

2.34 

1.97 

0.410 

0.383 

3.07 

2.80 

49.33 

46.33 

16.00 

14.33 

32.67 

30.67 

11.00 

11.00 

Fet. 3.50 0.403 4.93 134.50 81.63 41.80 23.00 1.82 0.367 2.90 51.00 18.33 35.33 7.670 

LSD. at 5% NS 0.004 NS NS 1.110 NS 1.110 0.09 NS NS 1.00 NS NS NS 


increased the leaf content of the sprayed element. 

In most cases the greatest content of N, P, K, Mg, 

Zn, Mn, Fe and Cu was presented in leaves 

picked from trees sprayed with micro and macro- 

nutrients together. They added foliar fertilizer 

namely fetrilon combi proved to be the best effect 

on Fe, Mn and Zn content in their experiment 

condition and they attributed this favourable effect 

to the higher content of fetrilon combi from Fe, Mn 

and Zn nutrients than the other foliar compounds. 

This means that foliar application of fertilizers 

induced increases in mineral status of plants and


is considered a useful way to correct the deficiency of 

nutrients specially under newly cultivated areas (Darwish 

et al., 2002); Thalooth et al., 2005, 2006; Gobarah et al., 

2006). 


compounds 

The interaction between NPK level and foliar nutritional 

compounds significantly affected P, Mn and Cu content in 

potato shoots, while it significantly affected N and Fe 

content of tubers and did not affect other nutrients in 

shoots and tubers of potato plants (Table 5). 

The higher content of N, P, K and Cu in shoots and 

tubers were obtained by applying highest NPK level and 

spraying with folifertile compound, while the highest 

values of Fe, Mn and Zn contents in shoots and tubers 

were attained by using the higher level of NPK and 

sprayed by fetrilon combi. The lowest values of all 

nutrients content in shoots and tubers were obtained by 

spraying potato plants with tap water and using lowest 

level of NPK. 

Conclusion 

It can be concluded that foliar application of nutritional 

compounds under investigation had a beneficial role and 

appears to be of great importance in enhancing growth, 

yield and chemical constituents of potato plants. 

Folifertile showed the highest effect and fetrilon combi 

showed the lowest, while Byfolane showed a moderate 

effect in this respect. Combination between the highest 

NPK levels (120: 80: 100) and folifertile spraying, showed 

the most beneficial effects on potato yield. 

REFERENCES 

Abd El-fatah MA, El-Ghinbihi FH (2001). Effect of foliar spray with zinc 

on growth, chemical composition and yield of broad bean plants 

grown under different levels of phosphorus fertilizer. Minufiya. J. 

Agric. Res., 26:1187-1193. 

Abd El-Hadi AH, Khadr MS, Mohamed YH, Darwish AA (1998). Effect of 

Zn, Mn and Fe-chelates and same different foliar fertilizers on the 

production of wheat, potato and sugar cane under Soil Egyptian 

conditions. Proc. Symp. "Foliar fertilization". Cairo. Bull. Natl. Res., pp. 

119-124. 

Abdalla AM (2002). Effect of bio-and mineral phosphorus fertilizer on the 

growth, productivity and nutritional value of faba bean. Egypt. J. Hort., 

29:187-203 

Abou-Zied EN (1979). Effect of GA, BoH and Folifertile on growth and 

productivity of Ocimum gratissium. Egypt. Bull. Natl. Res. Center, 4:53-59. 

Ahmed FF, Ragab MA, Ahmed AA, Mansour AEM (1998). Beneficial 

effects of supplying active dry yeast to some foliar fertilizers on snna apple 

trees (Malus domestica L.) proc. Symp. "Foliar fertilization" Cairo, Bull. Natl. 

Res. Center, pp. 149-160. 

Ahmed K HA, Madiha MB, Samia HA (20020. response of soybean to 

chemical and fertilization. Egypt. J. Appl. Sci., 17:207-218. 

A. O. A. C. (2000). Association of official Agricultural chemists. Official 

Methods of Analysis 17 th ed, AOAC, Washington DC, USA. pp. 13-15 

Artsaenko O, Babara K, Ulrike F, Udo C, Klaus D (1998). Potato tubers 

as a biofactory for recombinant antibodies. Mol. Breed. J., 4: 313-319. 

Bekhit RS, Hassan HH, Ramadan HM, Al-Anany AMA (2005). Effect of 

different levels and sources of nitrogen on growth, yield and quality of 

potatoes grown under sandy soil conditions. Annals Agric. Sci., 43(38): 1 - 

394. 

Bijana B, Javanka S, Markori A (2005). Effect of fertilization on 

chloroplasts pigments content, leaf surface and dry matter weight in 

some wheat cultivars. Acta Agric. Serbica, 20: 29-37. 

Bub A, Jutta M, Gerhard W, Gerhard R, Karlis B (2008). Zeaxanthin is 

bioavilable from genetically modified Zeaxanthin-rich potatoes. European J. 

Nutr., 47: 99-103. 

Cottenie A, Verloo M, Liekense L, Velghe G, Camerlynck R (1982). 

Chemical analysis of plants and soils. State Univ. of Belgium Gent, Hand 

Book, pp. 1-63. 

Dancs G, Mihaly K, Zsofla B (2008). The effect of enhanced methionine 

synthesis on amino acid and anthocyanin content of potato tubers. BMC 

Plant Biol., 8: 65. 

Daniel TC, Sharpley AN, Lemunyon JLI (998). Agricultural phosphorus 

and eutrophication: A symposium overview. J. Environ. Anal., 27: 

251. 

Darwish DS, Gharieb El, El-Hawary MA, Raffat OA (2002). Effect of 

some macro and micronutrients application on peanut production in a saline 

soil in El-Fayum Governorate Egypt. J. Appl. Sci., 17: 17-32. 

El-Arquan MY, El-Hamdi Kh H, Saleem EM , El-Tantawy IM (2002). 

Nutrient uptake of sugar beet as affected by NPK fertilization and soil salinity 

levels. Egypt. J. Soil Sci., 42:783-797. 

El-Bassiony AM, Fauzy ZF, El-Nemr MA, Shehata, SM (2006). 

Response of sweet pepper plants (Capsicum annuum L.) to some 

micronutrients spray. Egypt. J. Appl. Sci., 21: 208-218. 

El-Baz SA (1967). Effect of some cultural treatments on the quantity 

and quality of seed potatoes. Ph.D. thesis, Fac. of Agric., Ain-Shams 

Univ., Cairo, pp. 111-123 

El-Ghamriny EA, Saeed MNA (2007b). Effect of irrigation intervals, 

mineral fertilizers and biofertilizers on potation plants grown under 

sandy soil conditions. II Yield and its quality. Egypt. J. Appl. Sci., 22: 

512-531. 

El-Ghamriny, EA , Saeed MNA (2007a). Effect of irrigation intervals, 

Mineral fertilizers and biofertilizers on potato plants grown under 

sandy soil conditions. I-Growth, water relations, chemical contents 

and leaf anatomy. Egypt. J. Appl. Sci., 22: 480-511. 

El-Kabany E AY (2000). Effect of foliar spray with zinc and born on yield and 

some chemical constituents of faba bean. Mansoura Univ. J. Agric. Sci., 

25: 1873-1882. 

El-Tohamy W A, El-Greadly N H M (2007). Physiological response, 

growth, Yield and quality of snap beans in response to foliar 

application of yeast, vitamin E and Zinc under sandy soil conditions. 

Australian J. Basic Appl. Sci., 1: 294-299. 

El-Zeiny OAH (2002). Using tissue cultuse as a tool for increasing the 

productivity of seedlings and total yield of some pepper hybrids. Ainshams 

Univ. Cairo Arab Univ. J. Agric. Sci., 10: 273-285. 

El-Zeny Maha M (2004). Response of sweet sorghum to appropriate 

fertilizer regimes. Ph. D. Thesis, Fac. Agric. Moshtohor, Zagazig 

Univ. Egypt, pp. 45-56 

Frank WS (2002). The phosphate uptake mechanism, Plant Soil, 

245:105-114. 

Gabr SM, Ghoneim IM, Mohamed FH (2001). Effects of nitrogen levels 

and nitrate ammonium ratios on growth, yield and chemical composition of 

potato. Adv. Agric. Res., 6: 922-937. 

Gobarah ME, Mohamed MH, Tawfik MM (2006). Effect of phosphorus 

fertilizer and foliar spraying with Zn on growth, yield and quality of ground 

nut under reclaimed sandy soils. J. Appl. Sci. Res., 2: 491-496. 

Gomez KA, Gomez AA (1984). Statistical procedures for agricultural 

research, Second Edition. John Willey and Sons, New York.p. 680. 

Helal Fawzeia A, El-Zeiny OAH, El-sayed SA (2006). Performance of 

broad bean (Vicia faba L.) cultivars and their response to spray with 

some foliar fertilizers and yeast. Egypt. J. Appl. Sci., 21: 135-153. 

Hussein MM, Abd El-Kader, AA, Shafi AM (2008). Effect of foliar 

fertilization with omitting of some irrigations on growth, yield and 

nutritional status of fodder beet in Nobareia region. Egypt. J. Appl. 

Sci., 23:277-285. 

Kamel NH, Mokebel EMM, Saeed MNA, Desoky E M (2008). 

physiological and anatomical effects of Biofertilizers in combination

with mineral NPK on wheat plant. Egypt. J. Appl. Sci., 23: 446-475. 

Kannan S (1986). Foliar absorption and transport inorganic nutrients 

CRC Crit. Rev. Plant Sci. J., pp. 341-375. 

Karcomarczyk S, Rakowski D, Koszonski Z, Podsiado C (1999). Activity 

of some physiological processes and yield of spring wheat and 

trilicale as effect of supplemental irrigation and fertilization. Folia 

universitatis Agricalture Stetinensis, Agriculture, 73: 53-64. 

Kelling KA, Bundy LG, Combs SM, Peters JB (1998). Soil test 

recommendation for field, Vegetable and fruit crops. UWEX Bull. A. 

pp. 2809: 54. 

Kolbe H, Zhang WL, Ballüer L (1990). Simulation of fertilizer influence on 

yield and quality of potato (Solanum tuberosum) tubers by non linear 

optimization method. Plant Soil, 124: 309-313. 

Lindhaver MG, Fekete MAR (1990). Starch synthesis in potato (Solanum 

tuberosum) tubers: Activity of selected enzymes in dependence of 

potassium content in storage tissue. Plant Soil, 124: 291-295. 

Marschner H (1986). Mineral nutrition in higher plants Academic Press New 

York, 564 

Marschner H (1995). Mineral nutrition of higher plants. 2 nd Ed. 

Academic. Press. London New York, p. 889. 

Medani RA, Mohamed SA, El-Yazal MA, Mahfouz SA (2000). Growth, 

Yield and chemical composition of sugar beat as affected by specific 

isolated biofertilizers in relation on nitrogen application. Annals Agric. Sci. 

Moshtohor, 38(4): 20119-2038. 

Moustafa NMS, Safaa E, Comaa AME, Moustafa ZR (2005). Response 

of sugar beet to nitrogen and sulphur foliar application levels. Egypt. J. Appl. 

Sci., 20: 473-478. 

Nassar KE, Abd El-Rasoul, Sh M, El-Shebiny GM (2005). Effect of foliar 

spraying with phosphorus and potassium on faba bean plant under 

calcareous soil conditions. Menufiya J. Agric. Res., 30:1625-1637. 

Rafla H, Linda H, Antoun SW, Zakaria M (2009). Response of cotton 

seed yield and its components to different nitrogen and sulphur 

additions. Egypt. J. Appl. Sci., 24: 365-381. 


Robert L, Agnes N, Edmond R, Chistian D, Anderzej M, Christain R 

(2006). Entire potato consumption improves lipid metabolism and 

antioxidant status in cholesterol – Fed rat. Eur. J. Nutr., 45:267-274. 

Rohily KM, Abdelgadir AH, Sarhan HM, Zekri M (2010). Effect of 

compound fertilizer as a sole source of P and K on potato yield. Plant and soil. 

Intl. Annual meeting, pp. 1-5. 

Ryan J, Garabet S, Harmsen K, Rashid A (1996). Soil and plant 

analysis manual. Adapted for the West Asia and North Africa Region. 

Intl Center Agric. Res. in the Dry Areas ICARDA, Aleppo, Syria, p. 

140. 

Saad AOM, El-Kholy MA (2000). Response of some faba bean to 

phosphorus and magnesium fertilization. Egypt. J. Agron., pp. 19-32. 

Sarg SMA (2004). Influence of seed inoculation with phosphorein and 

levels of phosphorus fertilization on growth, mineral contents, seedless 

green pods yield and yield of seeds of three sugar pea cultivars under 

sandy soil conditions. J. Agric. Sci. Mansoura Univ., 29: 4729-4744. 

Shereverga N E (1959).The interrelationship of foliar and root mineral 

nutrition. Trans. Plant Physiol., 6: 18. 

Swietlik D, Faust M (1994). Foliar nutrition of fruit crops. Hort. Rev., 6:287- 

355. 

Thalooth AT, Badr NM, Mohamed MH (2005). Effect of foliar spraying 

with zinc and different levels of phosphatic fertilizer on growth and yield 

ofsun flower plants grown under saline condition. Egypt. J. Agron., 27:11- 

22. 

Thalooth AT, Tawfik MM, Hogda MH (2006). A comparative study on the 

effect of foliar application of Zinc, potassium and Magnesium on growth, 

yield and some chemical constituents of Mung bean plants grown under 

water stress conditions. World. J. Agric. Sci., 2: 37-46. 

Wetteslein TD (1957). Chlorophyll, letal and der sumikros ovopische 

formme. Ch., Sell der plastiten Expte. Cell. Res., 12:427-433.



DOI: 10.5897/AJMR11.532 



Antimicrobial properties of skin mucus from four 

freshwater cultivable Fishes 

(Catla catla, Hypophthalmichthys molitrix, Labeo rohita 

and Ctenopharyngodon idella) 

Balasubramanian S., Baby Rani P., Arul Prakash A., Prakash M.*, Senthilraja P. 

and Gunasekaran G. 

Department of Zoology, Annamalai University, Annamalai Nagar, Chidambaram-608002, TN, India. 

Accepted 24 August, 2011 

The fishes are living in the medium rich in pathogenic microbes. The mucus secreted by the skin of 

fish showed more antimicrobial properties. The mucus collected from the two exotic fishes and two 

indigenous fishes were tested against the five pathogenic bacteria (Klebsiella pneumonia, Vibrio 

cholerae, Salmonella typhi, Escherichia coli and Pseudomonas aeruginosa) and five pathogenic fungi 

namely (Mucor globosus, Rhizopus arrhizus, Candida albicans, Aspergillus flavus and Aspergillus 

niger). The fishes are living in media rich in pathogenic microbes which secrete substances against 

them. The mucus secreted by the skin of fish showed more antimicrobial properties. More antibacterial 

and antifungal activity were observed in an indigenous fishes (Catla catla and Labeo rohita) than exotic 

fishes (Hypophthalmichthys molitrix and Ctenopharyngodon idella). 

Key words: Antibacterial, antifungal, fish mucus, exotic, indigenous fish. 

INTRODUCTION 

Chemicals from nature have been a part of human 

civilization ever since our early ancestor’s began 

exploiting natural compounds to improve and enrich their 

own lives (Agosta, 1996). A major part of these chemicals 

come from animals. Indeed, animals are therapeutic 

arsenals that have been playing significant roles in the 

healing processes, magic rituals, and religious practices 

of peoples (Costa and Marques, 2000). All living 

organisms including fish coexist with a wide range of 

pathogenic and non- pathogenic microorganisms and 

therefore, posses complex defense mechanisms which 

contribute to their survival. One mechanism is the innate 

immune system that combats pathogens from the 

moment of their first contact (kimbrell and Beutler, 2001). 

The specific immunity including antibody and specific 

cell-mediated responses are significantly less diverse 

*Corresponding author. E-mail: dnaprakash@gmail.com. 

than those of higher (Ellis, 1974; Manning, 1998). 

The development of resistance by a pathogen to many 

of the commonly used antibiotics provides an impetus for 

further attempts to search for new antimicrobial agents, 

which overcome the problems of resistance and side 

effects. Action must be taken to reduce this problem such 

as controlling the use of antibiotics, carrying out research 

to investigate drugs from natural sources. Drugs that can 

either inhibit the growth of pathogen or kill them and have 

no or least toxicity to the host cell are considered for 

developing new antimicrobial drugs. It is well known that 

the global trade in animal based medicinal products 

accounts for billions of dollars per year (Kunin and 

Lawton, 1996). Unlike conventional antibiotics, which are 

synthesized enzymatically by microorganisms, are 

encoded by a distinct gene (AMP) and made from an 

mRNA template. The continuous use of antibiotics has 

resulted in multi resistant bacterial strains all over the 

world (Mainous and Pomeroy, 2001). Consequently, 

there is an urgent need to search for alternatives

to synthetic antibiotics. In spite of modern improvements 

in chemotherapeutic techniques, infectious diseases are 

still an increasingly important public health issue (WHO, 

2002). It has been estimated that in 2000, at least two 

million people died from diarrhoeal disease worldwide 

(WHO, 2002). Still there is a need for new methods of 

reducing or eliminating pathogens, possibly in 

combination with existing methods (Leistner, 1978). In 

the aquatic environment, fish are in constant interaction 

with a wide range of pathogenic and non-pathogenic 

microorganisms (Subramanian et al., 2007). 

Fish live in a challenging environment facing so many 

problems. The microbes play a major role in affecting the 

fish health. They escape from such an environment by 

producing some substances on the dermal layer (Mucus). 

The epidermal mucus produced primarily by epidermal 

goblet or mucus cells are composed mainly of water and 

gel forming macromolecules including mucins and other 

glycoproteins (Shephard, 1993). The composition and 

rate of mucus secretion has been observed to change in 

response to microbial exposure or to environmental 

perturbation such as hyperosmolarity and acidity 

(Agarwal et al., 1979; Zuchelkowski et al., 1981; Ellis, 

2001). The mucus substance secreted from the surface 

of fish performs a number of functions including disease 

resistance, respiration, ionic and osmotic regulation, 

locomotion, reproduction, communication, feeding and 

nest building (Ingram, 1980; Fletcher, 1978). Despite an 

intimate contact with high concentrations of pathogens 

(bacteria and viruses) in their environment, the fish can 

still maintain a healthy system under normal conditions. 

This could be attributed to a complex system of innate 

defense mechanisms within themselves, particularly the 

products of broad spectrum-antimicrobial compound. 

Many researchers have proved that the mucus 

substances are good resistant to invading pathogens 

(Ingram, 1980; Fletcher, 1978; Austin and Mcintosh, 

1988; Fouz et al., 1990). 

Fish mucus (slime layer) is the first physical barrier that 

inhibits entry of microbes from an environment into fish. It 

acts as a chemical barrier containing enzymes and 

antibodies which can kill invading disease causing 

organisms (Rottmann et al., 1992). A fatty acid 

compositional study of the flesh of Haruan (Channa 

striatus) revealed those unusually high arachidonic acids, 

but almost no eicosapentaenoic acids, which were 

hypothesized to be actively involved in initiating tissue 

wound repair (Mat Jais et al., 1994). Antimicrobial activity 

in mucus has been demonstrated in several fish species 

(Austin and Mcintosh, 1988), yet this activity seems to 

vary from one fish species to the other and can be 

specific towards certain bacteria (Noga et al., 1995). 

When we are reviewing the literature among the fresh 

water fishes the studies are available mostly on cold 

water fishes. 

Studies are available on C. striatus, Cyprinus carpio 

(Cole et al., 1997) and Etheostoma crossopterum (Knouft 

Balasubramanian et al. 5111 

et al., 2003). Though studies are available on the 

microbicidal activities of fish mucus they are pertaining 

only against bacteria except a single study against fungi 

(Hellio et al., 2002). Antimicrobial activity was 

demonstrated in Channa punctatus and Cirrhinus mrigala 

(Kuppulakshmi et al., 2008). Antimicrobial activity of skin 

and intestinal mucus of five different freshwater fish 

Channa species was studied by Dhanraj et al. (2009). 

Apart from these no studies are available on the mucus 

of the cultivable fresh water fishes like Catla catla, Labeo 

rohita (Indigenous fishes), Hypophthalmichthys molitrix 

and Ctenopharyngodon idella (Exotic fishes). 

Hence it was decided to evaluate the bactericidal and 

fungicidal properties of surface and column feeders 

namely C. catla, H. molitrix, Labeo rohita and 

Ctenopharyngodon idella. In the present investigation few 

microbial species of bacteria such as, Klebsiella 

pneumonia, Vibrio cholerae, Salmonella typhi, 

Escherichia coli, Pesudomonas aeruginosa and fungi, 

Mucur globosus, Rhizopus arrhizus, Candida albicans, 

Aspergillus flavus and Aspergillus niger were selected. 


Collection of mucus 

The healthy live fishes approximately 6 months old, weigh about 

500 gms of each C. catla, L. rohita, H. molitrix C. idella were 

purchased from near by fish farm in Pinnalur, Cuddalore District, 

Tamil Nadu. Mucus was carefully scraped from the dorsal surface 

of the body using a sterile spatula. Mucus was not collected in the 

ventral side to avoid intestinal and sperm contamination. The 

collected fish mucus was stored at 4ºC for further use. 

Preparation of mucus sample for the antibacterial and 

antifungal studies. 

The mucus samples were collected aseptically from the fish and 

thoroughly mixed with equal quantity of sterilized physiological 

saline (0.85% NaCl) and centrifuged at 5000 rpm for 15 min, the 

supernatant was used for the antimicrobial studies and kept at 4°C 

until use. 

A thin layer of molten agar (Muller Hinton Agar) was dispensed in 

petriplates of 10 × 10 cm and was labled properly. Triplicates were 

maintained for each strain. In the same way for fungal studies PDA 

medium was dispensed in petriplates for different strains of fungi in 

triplicates and the plates were marked. 

Inoculation of bacterial strains 

The microbial strains were collected from the Balaji High-tech 

Laboratory in Manjakuppam, Cuddalore district, Tamil Nadu. 

In vitro antibacterial assay was carried out by disc diffusion 

technique (Bauer et al., 1996). Whatman No.1 filter paper discs 

with 4 mm diameter were impregnated with known amount (10 µl) 

of test sample of fish mucus and a standard antibiotic disc. At room 

temperature (37ºC) the bacterial plates were incubated for 24 h. 

The fungal plates were incubated at 30ºC for 3 to 5 days for 

antifungal activity. The results were recorded by measuring the 

zones of growth inhibition surrounding the disc. Clear inhibition 

zones around the discs were expressed in terms of diameter of


Table 1. Antibacterial activity of skin mucus from Catla and Silver carp. 

S/N Name of the Bacterial Pathogens 

Zone of inhibition (in mm) Control (Ciproflaxin) 

Catla Silver carp 

(in mm) 

1 K. pneumonia 25 22 24 

2 V. cholerae 21 20 22 

3 S. typhi 32 15 28 

4 E. coli 23 16 22 

5 P. aeruginosa 29 22 32 

Table 2. Antibacterial activity of skin mucus from Rohu and Grass carp. 

S/N Name of the Bacterial Pathogens 

Zone of Inhibition (in mm) Control 

(Ciproflaxin) (in mm) 

Rohu Grass carp 

1 K. pneumonia 24 7 24 

2 V. cholerae 21 7 22 

3 S. typhi 14 12 28 

4 E. coli 21 17 22 

5 P. aeruginosa 19 15 32 

zone of inhibition and were measured in mm using cm scale, 

recorded and the average were tabulated. 

Antimicrobial assay 

The spectrum of antimicrobial activity was studied using five 

different strains of human pathogenic bacteria and five species of 

fungal pathogens. One antibiotic agent Ciproflaxin for pathogenic 

bacteria and Ketoconazole for pathogenic fungi were used as 

control. 

RESULTS 

Antimicrobial effect of the mucus of surface feeder and 

column feeder freshwater fishes namely, C. catla, H. 

molitrix (Surface feeder), L. rohita (Column feeder), C. 

idella were tested against, pathogenic bacteria viz, K. 

pneumonia, V. cholerae, S. typhi, E. coli, P. aeruginosa 

and five pathogenic fungi viz, Mucor globosus, Rhizopus 

arrhizus, Candida albicans, Aspergillus flavus, 

Aspergillus niger. The activity was measured in terms of 

zone of inhibition in mm. 

Antibacterial effect of mucus from surface feeders 

and column feeders 

The inhibition effects of mucus of C. catla, H. molitrix 

against five pathogenic bacterial strains are given in 

Table 1 and the zone of inhibition by the mucus of L. 

rohita, C. idella are given in Table 2. The zone of 

inhibition values of mucus were compared with control 

(Ciproflaxin) and the observed values are tabulated in 

Tables 1 and 2, respectively. 

The mucus of C. catla showed more effect in controlling 

the growth of gram-negative bacteria Salmonella typhi 

with an inhibition zone of 32 mm in diameter which is 

more than the control (Figure 3). Next to S. typhi, the 

mucus of C. catla showed a better effect on P. 

aeruginosa having an inhibition zone of 29 mm in 

diameter (Figure 5). That was followed by the K. 

pneumonia with an inhibition zone of 25 mm in diameter 

(Figure 1). Among the five gram-negative bacteria tested 

V. cholerae and E. coli showed very less sensitivity to the 

mucus of C. catla with an inhibition zone of 21 and 23 

mm in diameter (Figures 2 and 4). 

The mucus of H. molitrix showed more effect in 

controlling the growth of K. pneumonia and P. aeruginosa 

with an inhibition zone of 22 and 22 mm in diameter 

(Figures 1 and 5). Moderate effect was observed in 

controlling the growth of V. cholerae with a zone of 

inhibition is 20 mm in diameter (Figure 3). S. typhi (15 

mm) and E. coli (16 mm) showed very less sensitivity to 

the mucus of H. molitrix (Figures 3 and 4). 

Whereas the mucus of L. rohita showed a strong effect 

in controlling the growth of K. pneumonia with an 

inhibition zone of 24 mm diameter (Figure 1). V. cholerae 

and E. coli showed a better effect in the mucus of H. 

molitrix with an inhibition zone of 21 mm in diameter 

(Figures 2 and 4). Among the five bacteria tested S. 

typhi and P. aeruginosa showed less sensitivity to the 

mucus with an inhibition zone is 14 mm and 19 mm in 

diameter (Figures 3 and 5). 

The mucus of C. idella showed more effect in 

controlling the growth of E. coli with an inhibition zone of 

17 mm diameter (Figure 4). The moderate effect was 

observed in controlling the growth of S. typhi (12 mm) 

and P. aeruginosa (15 mm) by the mucus of C. idella.

Among these, the K. pneumonia and V. cholerae showed 

very less sensitivity to the mucus of C. idella with an 

inhibition zone of 7 mm diameter (Figures 1 and 2). 

The antibacterial activity of control Ciproflaxin showed 

maximum activity in three bacteria and some bacteria it 

showed less activity than the mucus sample. 

Antifungal effect of mucus 

Figure 1. K. pneumonia antibacterial activity of fish skin mucus. 

Figure 2. Vibrio cholerae 

The effect of mucus from C. catla, H. molitrix against five 

pathogenic fungal strains are given in Table 3 and the 

zone of inhibition by the mucus of L. rohita, C. idella are 

Figure 2. Vibrio cholera Antibacterial activity of fish skin mucus. 


given in Table 4. The zone of inhibition values of control 

(Ketoconazole) are tabulated in Tables 3 and 4, 

respectively. The mucus of C. catla showed a maximum 

effect in controlling the growth of A. flavus with an 

inhibition zone of 17 mm diameter which is less than the 

control (19 mm) (Figure 9). Next to this, the Mucor 

globosus (16 mm) and R. arrhizus (16 mm) have more 

zone of inhibition (Figure 6 and Figure 7). Whereas as 

the mucus of C. catla has less effect in controlling the 

growth of C. albicans (14 mm) and A. niger (9 mm) 

(Figures 8 and 10). Likewise the mucus collected from H. 

molitrix has highest effect in controlling the growth of A. 

flavus with an inhibition zone is 17 mm (Figure 9). On the


Figure 3. Salmonella typhi 

contrary there is no effect in controlling the growth of 

Rhizopus sp and C. albicans. (Figures 7 and 8). The 

mucus of H. molitrix shows the moderate effect in 

controlling the growth of Mucor globosus (14 mm) and A. 

niger (8 mm) (Figures 6 and 10). 

L. rohita a column feeder showed more effect in 

controlling the growth of A. flavus (17 mm). The mucus 

of L. rohita has very less sensitivity against the growth of 

M. globosus and R. arrhizus (14 mm) (Figures 6 and 7). 

But the mucus of L. rohita has the better effect in 

controlling the growth of C. albicans (15 mm) and A. niger 

Figure 3. Salmonella typhi Antibacterial activity of fish 

skin mucus. 

Figure 4. Escherichia coli 

Figure 4. Escherichia coli Antibacterial activity of fish 

skin mucus. 

(15 mm) (Figures 8 and 10). 

The mucus of C. idella shows the highest activity 

against A. flavus with an inhibition zone of 16 mm in 

diameter (Figure 9). Next to A. flavus the mucus shows 

better effect in controlling the growth of M. globosus (15 

mm), R. arrhizus (15 mm) and C. albicans (13 mm) in 

diameter (Figures 6, 7 and 8). But it failed to control the 

growth of A. niger (Figure 10). 

The antifungal activity of control Ketoconazole showed 

a variety of activity against M. globosus (16 mm), R. 

arrhizus (15 mm), C. albicans (17 mm), A. flavus (19 mm)

Figure 5. Pseudomonas aeruginosa Antibacterial 

activity of fish skin mucus. Co – Control, C – Catla, R 

– Rohu, S - Silver carp, G - Grass carp. 

Table 3. Antifungal activity of skin mucus from Catla and Silver carp. 



SNo Name of the Fungal Pathogens 

Catla Silver carp (Ketoconazole) (in mm) 

1 M. globosus 14 16mm 

16 

2 R. arrhizus 16 ----- 15 

3 C. albicans 14 ----- 17 

4 A. flavus 17 17 19 

5 A. niger 9 8 11 

Table 4. Antifungal activity of skin mucus from Rohu and Grass carp. 

SN Name of the Fungal Pathogens 


(Ketoconazole) (in mm) 

Rohu Grass carp 

1 M. globosus 14 15 16 

2 R. arrhizus 14 15 15 

3 C. albicans 15 13 17 

4 A. flavus 17 16 19 

5 A. niger 15 ---- 11 

and A. niger (11 mm), respectively. 

DISCUSSION 

The epithelial surfaces of fish, such as the skin, gills and 

the alimentary tract provide first contact with potential 

pathogens. The biological interface between fish and 

their aqueous environment consists of a mucus layer 

composing of biochemically-diverse secretions from 

Figure 5. Pseudomonas aeruginosa 

epidermal and epithelial cells (Ellis, 1999). This layer is 

thought to act as a lubricant to have a mechanical 

protective function, to be involved in osmoregulation and 

play a possible role in immune system of fish. Fish tissue 

and body fluids contain naturally occurring proteins or 

glycoproteins of non-immunoglobulin nature that react 

with a diverse array of environmental antigens and may 

confer an undefined degree of natural immunity to fish. 

Antimicrobial peptides are among the earliest developed 

molecular effectors of innate immunity and are significant


in the first line of host defense response of diverse 

species. 

Most antimicrobial peptides found through out the 

animal and plant kingdom are small, functionally 

specialized peptides (Boman, 1995). Several 

endogenous peptides with antimicrobial activity from fish, 

Figure 6. Mucor globosus 

Figure 6. Mucor globosus Co – Control, C – Catla, R – Rohu, 

S - Silver carp, G - Grass carp. 

Figure 7. Rhizopus arrhizus 

Figure 7. Rhizopus arrhizus Co – Control, C – Catla, R – 

Rohu, S - Silver carp, G - Grass carp. 

especially from the skin and skin mucus are reported 

(Park et al., 1997). Endogenous peptides play an 

important role in fish defense, possess broad spectrum of 

antimicrobial activity against bacteria, yeast and fungi. 

The epidermic and the epithelial mucus secretions act as 

biological barriers between fish and the potential

pathogens of their environment (Shephard, 1993). Group 

of researchers suggest that the epidermal mucus acts as 

a first line of defense against pathogens and therefore 

may offer a potential source of novel antimicrobial 

compounds (Ellis, 2001; Fouz et al., 1990; Grinde et al., 

1988; Nagashima et al., 2001; Sarmasik, 2002). 

The mucus producing cells in epidermal and epithelial 

layers had been reported to differ between fish species 

Figure 8. Candida albicans 

Figure 8. Candida albicans Co – Control, C – Catla, R – 


Figure 9. Aspergillus flavus 

Figure 9. Aspergillus flavus Co – Control, C – Catla, R – Rohu, 

S - Silver carp, G - Grass carp. 


and therefore could influence the mucus composition. 

Furthermore, the biochemical substances of mucus have 

been showed to differ depending on the ecological and 

physiological condition (Subramanian et al., 2008). In the 

present study also the mucus secreted by fishes are 

having strong resistance to the microbes. The mucus 

collected from all the four fishes show vary activity 

against the tested bacteria.


Figure 10. Aspergillus niger Co – Control, C – Catla, R – 


Amphipathic α-helical peptides, such as dermaseptin, 

ceratotoxin and magainin bind with anionic 

phospholipids-rich membranes and dissolve them like 

detergents (Pouny et al., 1992; Shai, 1995). These 

peptides are known to exert action by binding to the 

surface of the microbial membranes and causing a lysis 

of the intracellular contents. Our present study was also 

supported by the above studies in showing the 

antibacterial activity. 

Fish contain serum and cellular interferon which 

possess anti-viral proteins, enzymes- inhibitors (e.g. αmacroglobulin 

and other β-globulins) that inhibit the extra 

cellular proteases secreted by pathogens (Alexander and 

Ingram, 1992). They added that number of relatively 

specific lytic molecules, like hydrolase enzymes 

(Lysozyme, Chinase and Chitobiase) act on fungi and 

bacteria. Fish also contain lectins possess antifungal and 

antibacterial activities. Mucus contain several proteases 

(serine proteases, cysteine proteases, metalloproteases 

and trypsin (like proteases) having strong antibacterial 

activity (Fast et al., 2002). The mechanism by which 

antimicrobial substance kill microbes are still unclear, but 

it is currently thought that different peptides employ 

different strategies. These include the fatal depolarization 

of the cell membrane (Westerhoff et al., 1989), the 

formation of pores and subsequent leakage of the cell 

contents (Yang et al., 2000) or the damaging of critical 

intracellular targets after internalization of the peptide 

(Kargol et al., 2001). 

The antimicrobial substance present in the mucus may 

function either in the cytoplasm against intracellular 

pathogens or extracellularly through release to mucosal 

Figure 10. Aspergillus niger 

surfaces after infection-induced cell lysis or apoptosis. 

Few antimicrobial agents structurally identified in the 

mucus of bony fishes are proteins. It has been proposed 

that these compounds bind to and essentially dissolve 

cellular membrane (Ebran et al., 1999; Zasloff, 2002). 

The data of present study indicate that the antimicrobial 

activity of the fish mucus may be due to the presence of 

the above said substances. The mode of action of 

mucus is yet to be determined but studies have proposed 

various killing mechanisms for fish derived AMPs such as 

cytoplasmic membrane disruption, pore or channel 

formation (Syvitski et al., 2005) and inhibition of cell wall 

and nucleic acid synthesis (Partzykat et al., 2002; 

Brogden, 2005). 

In the present study, variation in their antimicrobial 

activity was observed among the fish mucus. This may 

be due to the variation in the relative levels of lysozyme, 

alkaline phosphatase, cathepsin B and proteases of the 

epidermal mucus of all fish species (Subramanian et al., 

2007). 

Both the indigenous and exotic fish species have the 

activity against the bacterial pathogens, whereas some 

fungal pathogens were not controlled by the mucus of 

exotic fishes. But the mucus of indigenous fishes controls 

the tested fungal pathogens. Native fish species 

(indigenous) thrives better in prevalent conditions in 

controlling the mosquitoes than exotic fishes (Chandra et 

al., 2008). Falling in line with the above observation, the 

indigenous fish species such as C. catla and L. rohita 

show higher antimicrobial activity than that of the exotic 

fish species such as H. molitrix and C. idella. This is the 

first report on the antimicrobial activity of skin mucus of

cultivable indigenous fishes of India. Moreover the mucus 

of fish possesses antimicrobial agents which could be 

used to formulate new drugs for the therapy of infectious 

diseases caused by pathogenic and opportunistic 

microorganisms. These properties of mucus suggest that 

it may be beneficial in aquaculture and human healthrelated 

applications. Further studies are needed to isolate 

the bioactive compounds (antimicrobial substances) from 

the mucus of these cultivable fish species and the 

mechanism of antimicrobial action. 

AKNOWLEDGEMENTS 

Authors thank the authorities of Annamalai University, 

and the Head of the Department of Zoology for providing 

the facilities to carry out this study. 

REFERENCES 

Agarwal SK, Banerjee TK, Mittal AK (1979). Physiological adaptation in 

relation to hyperosmotic stress in the epidermis of a freshwater 

teleost Barbus sophor (Cypriniformes: Cyprinidae) a histochemical 

study. Z. Mikrosk. Anat. Forsch., 93: 51-64. 

Agosta W (1996). Bombardier beetles and fever trees: a close-up look 

at chemical warfare and signals in animals and plants. Addison- 

Wesley Publishing Company, New York. P. 224. 

Alexander JB, Ingram GA (1992). Non cellular nonspecific defense 

mechanisms of fish. Ann. Rev. Fish Dis., 2: 249-279. 

Austin B, McIntosh D (1988). Natural antibacterial compounds on the 

surface of rainbow trout. J. Fish Dis., 11: 275-277. 

Bauer AW, Kirby WMM, Sherris JC, Turck M (1996). Antibiotic 

susceptibility testing by a standardized single disc method. Am. J. 

Clin. Pathol., 45: 493-496. 

Boman HG (1995). Peptide antibiotics and their role in innate immunity. 

Ann. Rev. Immunol., 13: 61-92. 

Brogden KA (2005). Antimicrobial peptides: pore formers or metabolic 

inhibitors in bacteria. Nat. Rev. Microbiol., 3(3): 238-250. 

Chandra G, Bhattacharjee I, Chatterjee SN, Ghosh A (2008). Mosquito 

control by larvivorous fish. Indian J. Med. Res., 127: 13-27. 

Cole AM, Weis P, Diamond G (1997). Isolation and characterization of 

pleurocidin, an antimicrobial peptide in the skin secretions of winter 

flounder. J. Biol. Chem., 272: 12008-12013. 

Costa EM, Marques JGW (2000). Faunistic resources used as 

medicines by artisanal fishermen from Siribinha Beach, State of 

Bahia, Brazil. J. Ethnobiol., 20: 93-109. 

Dhanaraj M, Haniffa M, Arun A, Singh SV, Muthu RC, Manikandaraja 

D, Milton JM (2009). Antibacterial activity of skin and intestinal mucus 

of five different freshwater fish species viz., Channa striatus, C. 

micropeltes, C. marulius, C. punctatus and C. gachua. Malay. J. Sci., 

28(3): 257-262. 

Ebran N, Julien S, Orange N, Saglio P, Lemaitre C, Molle G (1999). 

Pore forming properties and antibacterial activity of proteins extracted 

from epidermal mucus of fish. Comp. Biochem. Physiol., 2: 181-189. 

Ellis A (1999). Immunity to bacteria in fish. Fish Shellfish Immunol., 9: 

291-308. 

Ellis AE (1974). Non-specific defense mechanisms in fish and their role 

in disease processes. Dev. Biol. Stand., 49: 337-352. 

Ellis AE (2001). The immunology of teleosts, In: Roberts RJ (Ed), Fish 

Pathology, 3 rd edition. Elsevier, New York. pp. 133-150. 

Fast MD, Sims DE, Burka JF, Mustafa A, Ross NW (2002). Skin 

morphology and humoral non-specific defense parameters of mucus 

and plasma in rainbow trout, coho and Atlantic salmon. Comp. 

Biochem. Physiol. Mol. Integr. Physiol., 132: 645-657. 

Fletcher T (1978). Defense mechanisms in fish. In: Malins D, Sargent J 

(Eds.). Biochemical and biophysical perspectives in marine biology. 


Academic Press, London. pp. 189-222. 

Fouz B, Devesa S, Gravningen K, Barja JL, Tranzo AE (1990). 

Antibacterial action of the mucus of the turbot. Bull. Eur. Assoc. Fish 

Pathol., 10: 56-59. 

Grinde B, Jolles J, Jolles P (1988). Purification and characterization of 

two lysozymes from rainbow trout (Salmo gairdneri). Eur. J. 

Biochem., 173: 269-273. 

Hellio C, Pons AM, Beaupoil C, Bourgougnon N, Gal YIE (2002). 

Antibacterial, antifungal and cytotoxic activities of extracts from fish 

epidermis and epidermal mucus. Int. J. Antimicrob. Agents, 20(3): 

214-219. 

Ingram GA (1980). Substances involved in the natural resistance of fish 

to infection-a review. J. Fish Biol., 16: 23-60. 

Kimbrell DA, Beutler B (2001). The evolution and genetics of innate 

immunity. Nat. Rev. Genet., 2: 256-267. 

Knouft JH, Page LM, Plewa MJ (2003). Antimicrobial egg cleaning by 

the fringed darter (Perciformes: Percidae: Etheostoma 

crossopterum): Implications of a novel component of parental care in 

fishes. Lond. Biol. Sci., 270: 2405-2411. 

Kragol G, Lovas S, Varadi G, Condie BA, Hoffmann R, Otvos L Jr 

(2001). The antibacterial peptide pyrrhocorin inhibits the ATPase 

actions of Dnak and prevents chaperone-assisted folding. 

Biochemistry, 40(10): 3016-3026. 

Kunin WK, Lawton JH (1996). Does biodiversity matter? Evaluating the 

case for conserving species. In Gaston KJ (Ed) Biodiversity: A 

Biology of numbers and differences, Oxford: Blackwell Sci., 283-308. 

Kuppulakshmi C, Prakash M, Gunasekaran G, Manimegala G, Sarojini 

S (2008). Antibacterial properties of fish mucus from Channa 

punctatus and Cirrhinus mrigala. Eur. Rev. Med. Pharmacol. Sci., 

12: 149-153. 

Leistner L (1978). Hurdle effect and energy saving. In Downey WK (Ed.) 

Food Quality and Nutrition. London: Appl. Sci. Pub., p. 553. 

Mainous A, Pomeroy C (2001). Management of Antimicrobials in 

Infectious Disease. Humana Press, New York. p. 349. 

Manning MJ (1998). Immune defense systems. In: Blank KD, Pickering 

AD (Eds), Biology of Farmed Fish. Academic Press, Sheffield. 180- 

221. 

Mat JAM, Mc Cullock R, Croft K (1994). Fatty acid and amino acid 

composition in haruan as a potential role in wound healing. Gen. 

Pharmacol., 25: 947-950. 

Nagashima Y, Sendo A, Shimakura K, Kobayashi T, Kimura T, Fujii T 

(2001). Antibacterial factors in skin mucus of rabbit fishes. J. Fish. 

Biol., 58: 1761-1765. 

Noga M, Magarinos B, Toranzo AE, Lamas J (1995). Sequential 

pathology of experimental pasteurellosis in gilthead seabream sparus 

aurata a light microscopic and electron microscopic study. Dis. 

Aquat. Org., 21: 177-186. 

Park CB, Lee JH, Park IY, Kim MS, Kim SC (1997). A novel 

antimicrobial peptide from the loach Misgumus anguillicaudatus. 

FEBS Lett., 411: 173-178. 

Patrzykat A, Friedrich CL, Zhang L, Mendoza V, Hancock REW (2002). 

Sublethal concentrations of pleurocidin-derived antimicrobial peptides 

inhibit macromolecular synthesis in Escherichia coli. Antimicrob. 

Agents Chemother., 46: 605-614. 

Pouny Y, Rapaport D, Mor A, Nicolas P, Shai Y (1992). Interaction of 

antimicrobial dermaseptin and its fluorescently labeled analogs with 

phospholipid-membranes. Biochemistry, 31: 12416-12423. 

Rottmann RW, Francis-Floyed R, Durborow R (1992). The role of stress 

in fish disease. South. Reg. Aquac. Centre Publication, 3: 474. 

Sarmasik A (2002). Antimicrobial peptides: a potential therapeutic 

alternative for the treatment of fish diseases. Turk. J. Biol., 26: 201- 

207. 

Shai Y (1995). Molecular recognition between membrane-spanning 

polypeptides. Trends Biochem. Sci., 20: 460-464. 

Shephard KL (1993). Mucus on the epidermis of fish and its influence 

on drug delivery. Adv. Drug. Deliv. Rev., 11: 403-417. 

Subramanian S, Mackinnon SL, Ross NW (2007). A comparative study 

on innate immune parameters in the epidermal mucus of various fish 

species. Comp. Biochem. Physiol., 148B: 256-263. 

Subramanian S, Ross NW, Mackinnon SL (2008). Comparison of 

antimicrobial activity in the epidermal mucus extracts of fish. Comp. 

Biochem. Physiol., 150 (B): 85-92.


Syvitski R, Burton I, Mattatall NR, Douglas SE, Jakeman DL (2005). 

Structural characterization of the antimicrobial peptide pleurocidin 

from Winter flounder. Biochem., 44: 7282-7293. 

Westerhoff HV, Juretic D, Hendler RW, Zasloff M (1989). Magainins 

and the disruption of membrane- linked free-energy transduction. 

Proc. Natl. Acad. Sci., USA. 86: 6597. 

WHO (2002). Food safety and food borne illness. World Health 

Organization Fact Sheet, Geneva. 237. 

Yang JY, Shin SY, Lim SS, Hahm KS, Kim Y (2000). Structure and 

bacterial cell selectivity of a fish derived antimicrobial peptide, 

pleurocidin. J. Microbiol. Biotech., 16: 880-888. 

Zasloff M (2002). Antimicrobial peptides of multicultural organisms. 

Nature, 415: 389-395. 

Zuchelkowski EM, Lantz RC, Hinton DE (1981). Effects of acid-stress 

on epidermal mucus cells of the brown bullhead-Ictalurus nebulosus 

(Leseur): A morphometric study. Anat. Rec., 200: 33-39.



DOI: 10.5897/AJMR11.1007 



Evaluation of oxidative stress in patients with tularemia 

Sema Koc 1 , Erkan Sogut 2 , Fazilet Duygu 3 , Levent Gurbuzler 1 , Ahmet Eyibilen 1 and 

Ibrahim Aladag 1 

1 Department of Otorhinolaryngology, Gaziosmanpasa University School of Medicine, Tokat/Turkey. 

2 Department of Biochemistry and Clinical Biochemistry, Gaziosmanpasa University School of Medicine, Tokat/Turkey. 

3 Department of Infectious Disease and Clinic Microbiology, Tokat State Hospital, Tokat/Turkey. 

Accepted 25 October, 2011 

Tularemia, a zoonotic acute febrile invasive disease with rapid intracellular replication resulting in high 

bacterial densities, accumulation of phagocytes, and extensive tissue necrosis; may be related to 

increased free radical production and antioxidant depletion and; oxidative stress. The aim of this study 

was to investigate serum malondialdehyde (MDA) level and superoxide dismutase (SOD), glutathione 

peroxidase (GSHPx) activities in patients with tularemia during pre- and post-treatment period and to 

compare results obtained with data from healthy subjects. A total of 90 subjects (40 patients with 

tularemia and 50 healthy controls) were enrolled in this study. Peripheral venous blood samples were 

taken from patients before and 3 months after the treatment. In the control group, blood samples from 

healthy volunteers were collected only once. Serum MDA level and SOD, GSHPx activities were 

measured. In the ‘before treatment’ group, MDA concentration was significantly higher than the control 

group (p


is the consequence of an increase in ROS and/or 

impairment in antioxidant mechanisms (Serafini and Del 

Rio, 2004; Dogruer et al., 2004). 

Lipid peroxidation is an autocatalytic mechanism; fatty 

acids from the cell membrane become oxidized by a 

chain reaction. Malondialdehyde (MDA) is an important 

product of the peroxidation process; its levels correlate 

with the degree of lipid peroxidation. Therefore, MDA 

levels are generally used as an indicator of lipid 

peroxidation (Ogunro and Ologunagba, 2011; Valko et 

al., 2006). 

Antioxidant enzymes like superoxide dismutase (SOD), 

glutathione peroxidase (GSHPx), and catalase (CAT) try 

to prevent the damaging effects oxidation products have 

on an organism (Koc et al., 2011; Akanbi et al., 2010). 

Numerous studies have demonstrated that in various 

types of infectious diseases, reactive oxygen species are 

produced by activated inflammatory cells during the 

inflammatory response in order to kill various intracellular 

pathogens (Serefhanoglu et al., 2009; Selek et al., 2008). 

Therefore, it is possible that tularemia may be related to 

increased free radical production and antioxidant 

depletion, and oxidative stress may be implicated in the 

pathogenesis of tularemia. 

The aim of this study was to investigate serum MDA 

level, SOD and GSHPx activities in patients with 

tularemia during pre- and post-treatment period and to 

compare results with data from healthy subjects. 


Patients and methods 

This is a prospective, controlled study of patients with tularemia. 

The study was approved by the local ethics committee. Patient’s 

consents were obtained prior to the start of any procedures. 

A total of 90 subjects (40 patients with tularemia and 50 healthy 

controls) were enrolled in this study. All patients underwent a 

baseline evaluation including a detailed medical history, typical 

otorhinolaryngologic examination, and blood tests. Tularemia was 

suspected in individuals living in the epidemic zone who presented 

with the findings of fever, pharyngitis or tonsillitis and/or cervical 

lymphadenopathy and who did not respond to penicillin treatment. 

Exclusion criteria included autoimmune disorders, pregnancy, 

malignancy, drug or alcohol abuse, human immune deficiency virus 

infection, other acute infections other than tularemia, chronic 

respiratory insufficiency and any liver, hematological, 

cardiovascular, cerebrovascular, metabolic, neurologic, or 

psychiatric diseases. The patients with tularemia were treated with 

intramuscular streptomycin (1 g every 12 h) for 14 days. 

Diagnosis of tularemia 

Blood specimens were obtained from all patients with suspected 

tularemia. Patient’s diagnoses were confirmed by serological tests 

and polymerase chain reaction (PCR). The microagglutination 

method was used for the serological diagnosis. Antibody titers of 

1:160 and above or positive polymerase chain reaction (PCR) were 

accepted to be significant for diagnosis (Leblebicioglu et al., 2008). 

In our patients, a granulomatous inflammation was observed in the 

histopathological examination of the specimen taken from the 

cervical lymphadenopathy. 

Blood sample collections 

Fasting peripheral venous blood samples were taken before and 3 

months after the treatment. In the control group, blood samples 

from healthy volunteers were collected only once. Samples were 

allowed to clot for 20 min at room temperature before the serum 

was separated by centrifugation (1500 xg for 10 min at 4°C). The 

serum samples were separated from the clot within one hour of 

blood collection and transferred to a clean test tube. Serum 

samples were stored at –70°C until the investigation . 

Biochemical analysis 

The following determinations were made on the samples using 

commercial chemicals supplied by Sigma (St. Louis, USA). Total 

(Cu/Zn and Mn) SOD activity was determined according to the 

method of Sun et al. (1988). The principle of the method is based 

on the inhibition of nitroblue tetrazolium (NBT) reduction by the 

xanthine-xanthine oxidase system as a superoxide generator. One 

unit of SOD was defined as the enzyme amount causing 50% 

inhibition in the NBT reduction rate. Serum SOD activity was 

expressed as units per milliliter serum (U ml -1 ). Glutathione 

peroxidase activity was measured by the method of Paglia and 

Valentine (1967). The enzymatic reaction in the tube, which 

contains NADPH, reduced glutathione, sodium azide, and 

glutathione reductase, was initiated by addition of H2O2, and the 

change in absorbance at 340 nm was monitored by a 

spectrophotometer. Activity is expressed as U L -1 . The MDA level 

was determined by a method based on the reaction with 

thiobarbituric acid (TBA) at 90-100°C (Esterbauer and Chee seman, 

1990). In the TBA test reaction, malondialdehyde (MDA) or MDAlike 

substances and TBA react together to produce a pink pigment 

having an absorption maximum at 532 nm. The results were 

expressed as micromole per liter serum sample (umol L -1 ). 


Pearson’s chi-square test was used to compare the gender 

between groups. Gender was presented as count and percentage. 

The Kolmogorov-Smirnov test was used to evaluate whether the 

variables were normally distributed. The two independent sample t 

test or Mann Whitney U test were used to compare continuous 

variables between control and patient groups. Continuous variables 

were presented as mean (standard deviation (SD) or median 

(interquartile range[Q1-Q3]). A paired t test or Wilcoxon test were 

used to detect differences between the before- and after-treatment 

periods. SPSS software 15.0 for Windows (Chicago, IL, USA) was 

used for all statistical analysis. P-values were considered 

statistically significant when they were

Table 1. Oxidative stress parameters in the study groups. 

GSHPx * MDA † SOD * 

Before treatment (n = 40) 581±179 b 

3.40 (2.79-4.02) a 

After treatment (n = 40) 633±150 

4.33±1.23 

c 

2.00 (1.74-2.70) a,d 

3.83±1.43 

Control (n = 50) 709±251 1.36 (1.30-1.52) 4.08±0.86 

* , Values are presented as means ± SD; † , Values are presented as median and interquartile range (Q1-Q3); a , p 


two groups. Prasad et al. (2008) evaluated 100 patients 

with leprosy and 50 healthy controls for oxidative stress. 

They determined that blood glutathione content and 

erythrocyte antioxidant enzyme activities of GSH-Px and 

glutathione reductase were lower in leprosy patients with 

chronic granulomatous infection than those in the control 

group. Moreover, they reported that oxidative stress was 

associated with insufficient antioxidant defense potential 

in subjects with leprosy. Melek et al. (2006) inoculated 

Brucella melitensis, an intracellular pathogen leading to 

chronic infection, into rats in their experimental study. 

They reported the formation of oxidative stress, as well 

as decreased activities of antioxidant enzymes like 

glutathione peroxidase (GSH-Px) and superoxide 

dismutase (SOD) which indicated that oxidative stress 

may be important in the pathogenesis of brucellosis. 

Naderi et al. (2011) found that antioxidant activities were 

decreased in patients with pulmonary tuberculosis as 

compared to control group. They reported that 

oxidant/antioxidant imbalance induced by inflammation 

may have an impact on antioxidant activities. 

Conclusion 

In our study, in the ‘before treatment’ group, MDA 

concentration was significantly higher than the control 

group, but GSH-Px activity was lower than the control 

group. The SOD activity was similar in the ‘before 

treatment’ group and the control group. MDA 

concentration decreased in the ‘after treatment’ group. In 

the ‘after treatment’ group, MDA concentration was 

significantly higher than the control group. GSH-Px 

activity increased in the ‘after treatment’ group, but the 

difference was statistically insignificant. GSH-Px activity 

was slightly higher in the control group compared to the 

‘after treatment’ group, but the difference was statistically 

insignificant. SOD activity has not changed in the ‘after 

treatment’ group. Also, SOD activity was similar in the 

control and the ‘after treatment’ group. In conclusion, the 

data obtained from the present study showed that 

patients with tularemia are exposed to potent oxidative 

stress. However, further studies with larger sample sizes 

are needed to define the exact role of oxidative stress in 

the pathogenesis and treatment of the disease. 

REFERENCES 

Akanbi OM, Odaibo AB, Ademowo OG (2010). Effect of antimalarial 

drugs and malaria infection on oxidative stress in pregnant women. 

Afr. J. Reprod. Health, 14(3): 209-212. 

Capaccio P, Pignataro L, Gaini LM, Sigismund PE, Novembrino C, De 

Giuseppe R, Uva V, Tripodi A, Bamonti F (2011). Unbalanced 

oxidative status in idiopathic sudden sensorineural hearing loss. Eur. 

Arch. Otorhinolaryngol. Jun 26. [Epub ahead of print] 

Desai PB, Manjunath S, Kadi S, Chetana K, Vanishree J (2010). 

Oxidative stress and enzymatic antioxidant status in rheumatoid 

arthritis: a case control study. Eur. Rev. Med. Pharmacol. Sci., 

14(11): 959-967. 

Ellis J, Oyston PC, Green M, Titball RW (2002). Tularemia. Clin. 

Microbiol., 15(4): 631-646. 

Dogruer ZN, Unal M, Eskandari G, Pata YS, Akbaş Y, Cevik T, Cimen 

MY (2004). Malondialdehyde and antioxidant enzymes in children 

with obstructive adenotonsillar hypertrophy. Clin. Biochem., 37(8): 

718-21. 

Erdem FH, Karatay S, Yildirim K, Kiziltunc A (2010). Evaluation of 

serum paraoxonase and arylesterase activities in ankylosing 

spondylitis patients. Clinics, 65(2): 175-179. 

Esterbauer H, Cheeseman KH (1990). Determination of aldehydic lipid 

peroxidation products: malonaldehyde and 4-hydroxynonenal. 

Methods Enzymol., 186: 407-421. 

Guina T, Radulovic D, Bahrami AJ, Bolton DL, Rohmer L, Jones-Isaac 

KA, Chen J, Gallagher LA, Gallis B, Ryu S, Taylor GK, Brittnacher 

MJ, Manoil C, Goodlett DR (2007). MglA regulates Francisella 

tularensis subsp. novicida (Francisella novicida) response to 

starvation and oxidative stress. J. Bacteriol.,189(18): 6580-6486. 

Hepburn MJ, Simpson AJ (2008). Tularemia: current diagnosis and 

treatment options. Expert Rev. Anti. Infect. Ther., 6(2): 231-240. 

Kaygusuz I, Ilhan N, Karlıdag T, Keles E, Yalcin S, Cetiner H (2003). 

Free radicals and scavenging enzymes in chronic tonsillitis. 

Otolaryngol. Head Neck Surg., 129(3): 265-268. 

Kiroglu AF, Noyan T, Oger M, Kara T (2006). Oxidants and antioxidants 

in tonsillar and adenoidal tissue in chronic adenotonsillitis and 

adenotonsillar hypertrophy in children. Int. J. Pediatr. 

Otorhinolaryngol., 70(1): 35-38. 

Koc F, Kalay N, Ardic I, Ozbek K, Celik A, Ceyhan K, Kadi H, Karayakali 

M, Sahin S, Altunkas F, Onalan O, Kaya MG (2011). Antioxidant 

status and levels of antioxidant vitamins in coronary artery ectasia. 

Coron. Artery Dis., 22(5): 306-310. 

Leblebicioglu H, Esen S, Turan D, Tanyeri Y, Karadenizli A, Ziyagil F, 

Goral G (2008). Outbreak of tularemia: a case-control study and 

environmental investigation in Turkey. Int. J. Infect. Dis., 12(3): 265- 

269. 

Melek IM, Erdogan S, Celik S, Aslantas O, Duman T (2006). Evaluation 

of oxidative stress and inflammation in long term Brucella melitensis 

infection. Mol. Cell Biochem., 293(1-2): 203-209. 

Naderi M, Hashemi M, Komijani-Bozchaloei F, Moazeni-Roodi A, 

Momenimoghaddam M (2011). Serum paraoxonase and arylesterase 

activities in patients with pulmonary tuberculosis. Pathophysiology, 

18(2): 117-20. 

Ogunro PS, Ogungbamigbe TO, Muhibi MA (2010). The influence of 

storage period on the antioxidants level of red blood cells and the 

plasma before transfusion. Afr. J. Med. Med. Sci., 39(2): 99-104. 

Ogunro PS, Ologunagba PO (2011). The Effect of Palm Wine on Lipid 

Peroxidation and Antioxidant status of Rural dwellers in South West 

Nigeria. Niger Postgrad. Med. J., 18(3): 186-90. 

Ozcan C, Tamer L, Ates NA, Görür K (2010). The glutathione-Stransferase 

gene polymorphisms (Gstt1, Gstm1, and Gstp1) in 

patients with non-allergic nasal polyposis. Eur. Arch. 


Paglia DE, Valentine WN (1967). Studies on the quantitative and 

qualitative characterization of erythrocyte glutathione peroxidase. J. 

Lab. Clin. Med., 70: 158-169. 

Parks RR, Huang CC, Haddad J Jr (1996). Middle ear catalase 

distribution in an animal model of otitis media. Eur. Arch. 


Prasad CV, Kodliwadmath MV, Kodliwadmath GB (2008). Erythrocyte 

glutathione peroxidase, glutathione reductase activities and blood 

glutathione content in leprosy. J. Infect., 56(6): 469-473. 

Selek S, Cosar N, Kocyigit A, Erel O, Aksoy N, Gencer M, Gunak F, 

Aslan M (2008). PON1 activity and total oxidant status in patients 

with active pulmonary tuberculosis. Clin. Biochem., 41(3): 140-144. 

Serafini M, Del Rio D (2004). Understanding the association between 

dietary antioxidants, redox status and disease: is the total 

antioxidant capacity the right tool? Redox Rep., 9(3): 145-152. 

Serefhanoglu K, Taskin A, Turan H, Timurkaynak FE, Arslan H, Erel O 

(2009). Evaluation of oxidative status in patients with brucellosis. 

Braz. J. Infect. Dis., 13(4): 249-251. 

Sun Y, Oberley LW, Li Y (1988). A simple method for clinical assay of 

superoxide dismutase. Clin. Chem., 34(3): 497-500. 

Tärnvik A, Chu MC (2007). New approaches to diagnosis and therapy

of tularemia. Ann N Y Acad. Sci., 1105: 378-404. 

Valko M, Rhodes CJ, Moncol J, Izakovic M, Mazur M (2006). Free 

radicals, metals and antioxydants in oxidative stress-induced cancer. 

Chem. Biol. Interact., 160(1): 1-40. 

Koc et al. 5125 

Westerveld GJ, Dekker I, Voss HP, Bast A, Scheeren RA (1997). 

Antioxidant levels in the nasal mucosa of patients with chronic 

sinusitis and healthy controls. Arch. Otolaryngol. Head Neck Surg., 

123(2): 201-204.



DOI: 10.5897/AJMR11.1008 



Introducing a novel facultative nitrifying bacterium, 

"Nitrobacteria hamadaniensis" 

Mohammad Zare 1 , Mohammad Hassan Heidari 2 *, Farkhondeh Pouresmaeili 3 , Maryam Niyyati 4 

and Mohammad Moradi 5 

1 Department of Plant Pathology, Faculty of Agriculture, University of Bu-Ali-Sina, Hamadan, Iran. 

2 Cellular and Molecular Biology Research Center, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, 

Tehran, Iran. 

3 Department of Genetics, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. 

4 Department of Medical Parasitology and Mycology, School of Medicine, Shahid Beheshti University of Medical 

Sciences, Tehran, Iran. 

5 Department of Microbiology, Faculty of Medicine, Kerman University of Medical Sciences, Kerman, Iran. 


A new nitrifying bacterium has been identified as "Nitrobacteria hamadaniensis", from a potato farm in 

Hamadan, Iran. Its morphological and molecular characteristics were examined by electron microscopy, 

protein purification, SDS-PAGE and 16S rRNA analysis. It was cultured at the different conditions to 

determine the optimum pH and the generation time. The cells are rod shaped, 0.3-0.4×0.8-1.2 μm in 

size, and contains polar caps of intracytoplasmic membrane. The strain is lithotrophic and grow slower 

than heterotrophic strains. The best growth was observed at mixotrophic conditions. It grew at pH 

range between 6.7 to 8.3 with an optimum pH at 7.6. Based on the growth conditions, the generation 

time ranged from 7-16 h. The G+C content of this strain was 59 mol%. Also, 16S rRNA gene sequence 

analysis indicated that the bacterium represents a hitherto unknown line peripherally associated to the 

Caulobacteriaceae with low G+C relatives. The sequence of nearly complete 16S rRNA gene of the 

strain is recorded in the GenBank under number AY569007. According to the phylogenetic analysis and 

phenotypic criteria, it is proposed that the bacterium should be assigned to a new genus Nitrobacteria. 

Key words: Nitrobacter, nitrobacteria, nitrification, genotype, morphovar, biovar. 

INTRODUCTION 

Nitrifying organisms of the genus Nitrobacter are 

polymorphic; which are mostly rods to pear shaped and 

possess polar caps of cytomembranes. The major source 

of energy and reducing power is from the oxidation of 

nitrite to nitrate. Some Nitrobacter strains are able to 

growth in heterotrophic conditions with acetate (Smith 

and Hoare, 1968), or pyruvate (Bock, 1976) as carbon 

source. These organisms are also facultative (Bock et al., 

1988; Freitag et al., 1987). Nitrite-oxidizing bacteria are 

ubiquitous in terrestrial and aquatic natural environments 

under moderate conditions (Bock and Koops, 1992; 

*Corresponding author. E-mail: heidari34@gmail.com. Tel: 

+982123872584. Fax: +9821 22171928. 

Laanbroek and Woldendorp, 1995; Both et al., 1992). 

There are some indications that nitrifying bacteria may 

also be present in extreme environments such as acid 

soils (De Boer and Laanbroek, 1989; De Boer et al., 

1991; Hakinson and Schmidt, 1988), and acid sulfinic ore 

(Bock et al., 1992). These bacteria have been found in 

alkaline environments such as saline soda lakes and 

soda soil samples in Wadi Natrun, Egypt (Imhoff et al., 

1979). The nitrite oxidoreductase consisted of three 

major proteins with apparent molecular weights of 

116.000, 65.000 and 32.000 kDa (Sundermeyer-Klinger 

et al., 1984). These species of Nitrobacter, that is, 

Nitrobacter winogradskyi (Watson et al., 1981; 

Winogradsky, 1892; Engel et al., 1954), Nitrobacter 

hamburgensis (Bock et al., 1983), Nitrobacter vulgaris 

(Bock et al., 1990), and Nitrobacter alkalicus (Sorokin et

al., 1998; Heubuelt 1929) have already been described. 

This article describes the cultural and the biochemical 

characteristics of a new strain of bacteria and the result 

of a phenotypic and phylogenetic analysis based on 16S 

rRNA gene sequences. 


Isolation procedures 

Isolation 

The strain was isolated from soil in a potato field in Hamadan (Lat. 

34˚47′46″ N, Long. 48˚30′57″ E), Iran (March 2004, GenBank 

accession No. AY569007). Five hundred mg soil was shrilled in a 

300 ml flask according to Drews (1968). The cells were grown at 

28°C for 2 weeks. Then the cell suspension was inoculated into 

agar media (basic mineral medium and 18 g agar-agar added to 1 

liter of water) (Merck, Germany). Various types of colonies were 

isolated and grown separately on agar plates with nitrite and 

mineral salt (Merck, Germany) by multiple subcultures. 

Culture conditions 

The culture media was prepared as described by Drews (1968) 

and Bock et al. (1990). The basic mineral was supplemented with 

400 mg sodium acetate, 1500 mg yeast extract (Difco, USA) and 

1500 mg peptone (Merck, Germany) in 1 L of water at pH 7.6 (for 

aerobic-growth), and nitrate instead of peptone, as an electron 

acceptor for anaerobic conditions. Master plates (Stock cultures) 

were prepared under mixotrophic conditions. 

Batch cultivation 

Batch cultures were grown in 50 ml liquid media. Based mineral 

medium (Merck, Germany) supplemented with sodium acetate, 

yeast extract, and peptone for routine and mixotrophic cultivation 

under aerobic conditions was used (Bock et al., 1990; Drews, 

1968). For heterotrophic growth (Bock et al., 1990), the medium 

was modified as follows: 1000 mg nitrate (Merck, Germany) as an 

electron acceptor was added to 1 L of medium under anaerobic 

conditions. All experiments were done at pH 6.7, 7.6, and 8.3 and 

repeated at least 3 times. 

Analytical procedures 

Protein purification 

The protein was purified from enzyme extracts and measured 

exactly as previously described by Bradford (1976), Spector (1978), 

Davie (1982) and Laemmli (1970). Membranes and nitrite 

oxidoreductase were isolated and purified according to 

Sundermeyer-Klinger et al. (1984). 

Gel electrophoresis 

SDS-PAGE (Merck, Germany) was performed as described by 

Milde and Bock (1984) and Sundermeyer-Klinger et al. (1984). The 

cytochrome spectra of cell-free extract of the new strain (104) was 

determined as previously explained by Sorokin et al. (1998). A 

Zare et al. 5127 

diode-array spectrophotometer (Hewlett Packard, USA) was used 

for the investigation. Proteins were identified from polyacrylamide 

gels by the method of Francis and Becker (1984). 

DNA and 16S rRNA analysis 

For isolation of DNA, 2 g of wet weight cells were suspended in 5 

ml TE buffer (50 mmol Tris, 20 mmol EDTA, pH 8.0) (Merck, 

Germany). Cell lysates were prepared as described by Kraft and 

Bock (1984). Total DNA was isolated and purified according to 

Marmur (1961). The G+C content was calculated from the 

denaturizing rate according to De Ley (1970). 

PCR amplification for the nearly complete 16S rRNA gene and 

sequencing were done as described by Brinkhoff and Muyzer 

(1997) and Muyzer et al. (1995). Sequences were compared using 

ARB software (Ludwig et al., 2004). The 16S rRNA gene 

sequences of the isolates were automatically aligned to sequences 

stored in the ARB database. 

Electron microscopy 

Cells cultured under mixotrophic conditions were concentrated 100fold, 

and methods for fixation, embedding, and ultra-thin sections 

were those described by Bock and Heinrich (1969). Sections were 

stained with uranyl acetate and lead citrate (Electron Microscopy 

Sciences, USA). Electron micrographs were taken with a 

transmission electron microscope (Carl Zeiss EM-900; Zeiss, 

Germany) at 80 kV accelerating voltage. Negatives were scanned 

at 1200 dpi resolution, by CanoScan 8800F (Canon, Japan), and 

pictures were processed using Adobe ® Photoshop ® software (CS4 

Extended, Middle East Version 11.0). 

Phylogenic analysis 

In order to establish the precise taxonomic position of unknown 

bacterium, the entire 16S rRNA sequences of the strain (104) was 

determined. 

RESULTS 

G+C analysis 

The G+C content of the new strain 104 DNA was 59%. 

This value is different from Nitrobacter winogradskyi (61.7 

mol%), Nitrobacter hamburgensis (61.2-61.6 mol%), 

Nitrobacter vulgaris (58.9-59.9 mol%) and Nitrobacter 

alkalicus (61.5-62.4 mol%) (Bock et al., 1990; Sorokin et 

al., 1998). 

The derived 16S rRNA consisted of 1421 nucleotides. 

The determined sequences were compared with those of 

other 16S rRNA sequences available in the GenBank. 

Nitrobacteria hamadaniensis (strain 104) with 95.9% 

genetic homology with Caulobacter, and 96.3% with 

Brevundimonas (Table 1). It has 86-87.4% genetic 

homology to the genus Nitrobacter, which are classified 

as one of the main classes of Caulobacteriaceae. A 

phylogenic tree, depicting the relationship of unknown 

bacterium with Caulobacteriaceae and close relatives,are 

shown in Figure 1, and the sequence similarities are


Table 1. Similarity matrix of 16S rRNA sequences. 

1 2 3 4 5 6 7 8 9 10 11 12 13 

Afipia clevenlandensis 

Afipia felis 98.6 

Blastobacter denifricans 96.5 96.5 

Bradyrhizobium japonicum 97.9 97.3 98.2 

Rhodopseudomonas palustris 96.9 96 97.3 98.3 

Nitrobacter winogradskyi ATTCC 25381 97.4 96.9 97.1 98.2 97.1 

Nitrobacter winogradskyi ATTCC 14123 97 96.7 96.5 97.9 96.9 98.7 

Nitrobacter sp. strain R6 96.8 96.4 96.7 97.7 96.7 98.8 99.3 

Nitrobacter hamburgensis strain x 14 96.6 96.3 96.8 97.7 97.5 98 98 98 

Nitrobacter hamburgensis strain nb 14 96.9 96.5 96.9 97.9 97.2 98.4 98.3 98.4 99.5 

Nitrobacter alkalicus strain AN1 97.3 96.9 97.2 98.3 97.2 99.1 99.2 99.2 98.4 98.6 

Nitrobacter alkalicus strain AN2 97.4 97.5 97.1 98.3 97.2 99 99.1 99.1 98.3 98.6 99.9 

Nitrobacteria hamadaniensis strain 104 86.3 85.3 86 86.3 86.6 86.2 87.1 86.7 86.1 86.7 87.4 87.5 

Brevundimonas diminuta 87.7 87.1 87.8 87.8 87.8 87.7 87.1 87.6 88 87.6 87.8 87.7 96.3 

Figure 1. A phylogenetic tree derived from 16S rRNA gene sequences, the tree was created by using the neighbor-joining method and Knuc 

values, showing the phylogenetic interrelationships between Nitrobacteria hamadaniensis and other close relatives. The bootstrap values are 

indicated.

Table 2. Influence of organic compounds on growth of the nitrite-oxidizing strain 104 under 

anaerobic conditions at different pH values in batch culture a . 

Growth condition Strain 104 growth Amounts of NO2 concentration (mmol) 

pH 8.3 Weak 0.15 

pH 7.6 Weak 0.16 

pH 6.7 Weak 0.1 

a Specific activity of the strain 104 was weak in heterotrophic condition at different pH values. 

indicated in Table 1. The comparisons help distinguish 

the new bacterium located at the periphery of the 

Caulobacteriaceae. 

Protein analysis 

The protein analysis of cell free extracts of the strain 

(104) grown at pH 7.6, indicated α-bands (437 and 589 

nm in size), presenting nitrite cytochrome spectra 

comparable to those of other Nitrobacter species. This 

strongly suggests that the new strain belongs to the 

Nitrobacteria genus. In addition to α-bands, cytochrome c 

550 and cytochrome c oxidase type α3 (maximum 550 

nm up to 607 nm) were other prominent features of the 

strain, respectively. 

Physiological characteristics 

Nitrobacteria hamadaniensis grew optimally at 26-28°C 

and pH 7.6. Colonies on agar plates formed within 3, 4 

and 12 d under mixotrophic, heterotrophic, and 

lithotrophic conditions. Colonies on mineral salt agar 

plates sized 0.1 mm in diameter, were orange, circular, 

and swelled. Optimum growth rates were obtained in 

mixotrophic medium containing nitrite, sodium acetate, 

yeast extract and peptone. 

Strain 104 was able to grow under nitrite-oxidizing 

lithoautotrophic, mixotrophic and heterotrophic conditions 

at pH 6.7 to 8.3. The stoichiometry analysis, conversion 

of nitrite to nitrate in batch culture was 96.3-99.1% and 

nitrate to nitrite, under anaerobic condition was 1-1.6% 

(Table 2). The organisms grew on mineral medium 

supplemented with organic compounds such as sodium 

acetate, yeast extract and peptone as sources of energy 

and carbon. Batch cultivation at different pH values 

clearly demonstrated that the nitrite-oxidizing strain (104) 

isolated from soil belonged to facultative neutrophilic 

species. It could grow within a pH range of 6.7 to 8.3 

(Figure 4). The growth rate at pH below and above 7.6, 

was extremely slow. During growth at pH above 7, cells 

started to branch. Their optimum growth was close to 

their upper pH limit (around 7.6). The main difference of 

the strain 104 from all four known species of the genus 


Nitrobacter (Nitrobacter winogradskyi, Nitrobacter 

hamburgensis, Nitrobacter vulgaris and Nitrobacter 

alkalicus) was the rapid growth on culture medium used 

for cultivation of strain (104) with a starting pH 7.6 and a 

nitrite concentration of about 1 g. Strain 104 was able to 

grow in nitrite limited culture media within a broad pH 

range from 6.7 to 8.3 with an optimum pH 7.6 (Figure 4). 

The doubling times of autotrophically and mixotrophically 

grown Nitrobacteria strain 104 was 16 and 7 h at pH 7.6, 

respectively. This was higher than the rate described for 

neutrophilic species grown lithoautotrophicaly with nitrite 

(Bock and Koops, 1992; Keen and Prosser, 1987). Our 

study shows that organic compounds had an influence on 

the growth of nitrite-oxidizing strain 104 from soil, at pH 

6.7 to 8.3, during 5 d incubation. There were no 

significant differences between the bacteria activity in 

heterotrophic with 1000 mgP/L nitrate under anaerobic 

conditions at different pH values in batch culture (Table 

2). 

The pH profile in the kinetics of oxidation in batch 

culture was significantly different for the cells grown at 

different pH values. The profile for the rate of nitrite 

oxidation (Figure 4) measured with cells grown at pH 6.7 

was similar to that measured for Nitrobacter species 

(Hunik et al., 1993). The curve had its maximum at pH 

7.6 and decreased at a pH higher than 8. The nitriteoxidizing 

activity measured with cells grown at pH 7.6, 

6.7, and 8.3 that was maximal at pH 7.6, respectively, 

and incubation time was 192 h. 

SDS-PAGE analysis 

The results of SDS-PAGE of cell-free extracts, based on 

phenotypic criteria, showed that Nitrobacteria 

hamadaniensis is composed of 4 bands, 2 strong and 

prominent bands of ~116 kDa, one 67 kDa, and a 14 kDa 

band, respectively (Figure 3). 

DISCUSSION 

A new species of bacteria was identified, that was 

different from Nitrobacter winogradskyi (Bock 1976), 

Nitrobacter hamburgensis (Bock et al., 1983), and Nitro-


a b 

Figure 2. Electron photograph of Nitrobacteria hamadaniensis ultrasturcture. Thin section from 

grown cell mixotrophically and harvested during exponential phase of growth, showing lamellar 

membrane system, poly-β-hydroxybutyrate (PHB), and polyphosphate granules (X: 50,000). 

PHB = Poly-β-hydroxybutyrate. PP = Polyphosphate granules. CM = Cytoplasmic membrane. 

Figure 3. SDS-PAGE (12.5% acryl amide) of 

cell free extract from Nitrobacteria 

hamadaniensis protein stained with 

comassie blue R- 250. 

bacter vulgaris (Bock et al., 1990). The new bacteria 

grew at all the different culture conditions, as reported by 

Steinmueller and Bock (1977), and the growth rates in 

mixotrophic media could be used for taxonomic 

purposes. Our observations showed that this new 

organism, like Nitrobacter vulgaris (Bock et al., 1990) 

grows by dissimilation and reduces nitrate where nitrate 

is present as an alternative electron acceptor. The cells 

of Nitrobacteria hamadaniensis had a similar shape, size, 

and ultrastructure. This is further evidence to prove the 

existence of the new Nitrobacteria species. The new 

isolate is different from most of the other Gram negative 

bacteria. They are short rod cells, pear shaped, 0.3- 

0.4×0.8-1.2 μm in size, and motile. They tend to form 

flocks (Figure 2) and/or biofilms on the glass surface of 

culture flasks. Cell division normally occurres by budding. 

The cytoplasmic membrane protrudes into the 

cytoplasm, forming a polar cap of interacytoplasmic 

membranes. Carboxysomes were found in the strains 

grown under chemolithotrophic conditions, but this was 

not observed under mixotrophic conditions. The other 

typical inclusion bodies were poly-β-hydroxybutyrate and 

polyphosphate granules. These results correspond to the 

other four strains, Nitrobacter winogradskyi, 

(Winogradsky, 1892), Nitrobacter hamburgensis (Bock et 

al., 1983), Nitrobacter vulgaris (Bock et al., 1990), and 

Nitrobacter alkalicus (Sorokin et al., 1998). However, in 

the new strain the upper band was clearly separated. 

The phenotypic criteria are similar to the recent findings 

obtained by Samelis et al. (1995). This suggests that 

each species yields a specific protein profile identical to 

the respective type strain. Bock et al. (1990) reported that 

there are significant differences between protein profiles 

of Nitrobacter winogradskyi, Nitrobacter hamburgensis, 

Nitrobacter vulgaris and Nitrobacter alkalicus. 

In conclusion, the new nitrite-oxidizing bacteria strain 

104 isolated from soil differs from previously described 

species by their potential to grow and oxidize nitrite at pH 

7.6. The batch continuous cultivation showed their 

remarkable ability to adapt to abroad range of pH values. 

Our data shows that the analysis of the whole cell 

protein was a quick and effective method to distinguish 

any bacteria among Nitrobacteria hamadaniensis. 

Species description 

Description of Nitrobacteria hamadaniensis sp. nov. 

nitro bacteria. npl (NL. fr. Nitr- + bacteria): the soil 

bacteria concerned in nitrification. Nitrobacteria

NO2 

NO2 


Figure 4. A-B. Influence of pH and culture condition on dynamic of nitrite oxidation of Nitrobacteria hamadaniensis strain 104 in 

Batch culture and influence of pH on oxidation activity of washed cells grown in Batch culture at pH 6.7-8.3. The culture started to 

wash out at D = 0.008 h -1 . A. Lithoautotrophic condition. B. Mixotrophic condition. C-D. Influence of pH on the growth of 

Nitrobacteria hamadaniensis strain 104 in Batch culture with 14.5 mmol nitrite at pH 6.7, 7.6 and 8.3 (Culture wash out at D = 0.008 

h -1 ). C. Nitrite oxidizing activity of cell cultivated at lithoautotrophic with nitrite. D. Nitrite oxidizing activity of cell cultivated at 

mixotrophic condition. 

hamadaniensis = hamadani, ensis. Hamadan Iranian 

place name; M.L. adj. hamadaniensis of Hamadan. The 

cells are Gram negative, short rods to pear shaped with a 

size of 0.3-0.4×0.8-1.2 μm. Each cell contains several 

carboxysomes and posses a polar cap of 

cytomembranes to form flattened vesicles. Cells produce 

extracellular polymers at all growth conditions causing 

the formation of a biofilm. Facultative lithoautotrophs 

oxidize nitrite to nitrate under aerobic conditions and 

reduce nitrate to nitrite under anaerobic conditions. Cells 

grow chemolithotrophically, heterotrophically, or 

mixotrophically. The growth rate in chemo-organic 

medium is more rapid than in chemolithotrophic medium. 

The surfaces of colonies on mineral salt agar plates are 

0.1 mm in diameter after 12 d at 28°C and pH values 

between 7.6-7.8. They have two prominent proteins of 

116 and 67 kDa, and a 14 kDa protein which appears as 

a faint band. The G+C content of DNA is 59 mol% and 

the sequence of nearly complete 16S rRNA gene of 

strain 104 is stored in the GenBank database and Japan 

collection of microorganisms under accession numbers, 

AY569007(http://www.ncbi.nlm.nih.gov/Genbank/index.ht


ml), and JCM 14789 (http://jcm.riken.go.jp/JCM/ 

catalogue.shtml), respectively. Nitrobacteria 

hamadaniensis is deposited in Persian type culture 

collection under the number, PTCC 1681 

(http://www.irost.org/en/ptcc/index.asp?code=1#). 


We thank M. Piriai and F. Niazi (Department of Anatomy, 

Faculty of Medicine, Shahid Beheshti University of 

Medical Sciences) for their excellent technical assistance. 

REFERENCES 

Bock E (1976). Growth of nitrobacter in the presence of organic matter 

II Chemoorganotropic organic Growth of Nitrobacter agilis. Arch. 

Microbiol., 108(3): 305-312. doi: 10.1007/BF00454857. PMID: 

942282. 

Bock E, Heinrich G (1969). Morphologische und physiologische 

untersuchungen an zellen Von Nitrobacter winogradskyi Buch. Arch. 

Microbiol., 69(2): 149-159. doi: 10.1007/BF00409759. 

Bock E, Koops HP (1992). The genus Nitrobacter and related genera. 

In The prokaryotes, 2nd ed., vol 1. Edited by Balows A, Truper HG, 

Dworkin M, Harder W, Shleifer KH. Springer-Verlag, New York, NY., 

pp. 2302-2309. 

Bock E, Sundermeyer–Klinger H, Stackebrandt E (1983). New 

facultative lithoautotrophic nitrite-oxidizing bacteria. Arch. Microbiol., 

136(4): 281-284. doi: 10.1007/BF00425217. 

Bock E, Wilderer PA, Freitag A (1988). Growth of Nitrobacter in the 

absence of dissolved oxygen. Water Res., 22(2): 245-250. doi: 

10.1016/0043-1354(88)90085-1. 

Bock E, Koops HP, Moller UC, Rudert M (1990). A new facultatively 

nitrite oxidizing bacterium, Nitrobacter vulgaris sp. nov. Arch. 

Microbiol., 153(2): 105-110. doi: 10.1007/BF00247805. 

Bock E, Koops HP, Ahlers B, Harms H (1992). Oxidation of inorganic 

nitrogen compounds as energy source. In The prokaryotes, 2nd, vol 

1. Edited by Balows A, Truper HG, Dworkin M, Harder W, Schleifer 

KH. Springer-Verlag, New York, pp. 414-430. 

Both GJ, Gerards S, Laanbroek J (1992). Kinetics of nitirite oxidation in 

two Nitrobacter species grown in nitrite-limited chemostats. Arch. 

Microbiol., 157(5):436-441. doi: 10.1007/BF00249101. 

Bradford MM (1976). Rapid and sensitive method for the quantitation of 

microgram quantities of protein utilizing the principle of protein-dye 

binding. Anal. Biochem., 72(1-2): 248-254. doi: 10.1016/0003- 

2697(76)90527-3. PMID: 942051. 

Brinkhoff T, Muyzer G (1997). Increased species diversity and extended 

habitat range of sulfur-oxidizing Thiomicrospira spp. Appl. Environ. 

Microbiol., 63(10): 3789-3796. PMID: 9327542. 

Davie JR (1982). Two-dimensional gel systems for rapid histone 

analysis for use in minislab polyacrylamide gel electrophoresis. Anal. 

Biochem., 120(2): 276-281. doi: 10.1016/0003-2697(82)90348-7. 

PMID: 7046507. 

De Boer W, Laanbroek HJ (1989). Ureolytic nitrification at low pH by 

Nitrosospira species. Arch. Microbiol., 152(2): 178-181. doi: 

10.1007/BF00456098. 

De Boer W, Gunnewiek K, Veenhuis PJA, Bock E, Laanbroek HJ 

(1991). Nitrification at low pH by aggregated chemolithotrophic 

bacteria. Appl. Environ. Microbiol., 57(12): 3600-3604. PMID: 

16348608. 

De Ley J (1970). Reexamination of the association between melting 

point, buoyant density, and chemical base composition of 

deoxyribonucleic acid. J. Bacteiol., 101(3): 738-754. PMID: 5438045. 

Drews G (1968). Mikrobiologisches praktikum fur naturwissenschaftler. 

Springer Verlag, Berlin-Heidelberg-New York. 

Engel H, Krech E, Friederichsen I (1954). Beitrage zur kenntnis der 

Nitritoxidation durch Nitrobacter winogradskyi. Arch. Microbiol., 21(1): 

96-111. doi: 10.1007/BF00412608. 

Francis RT, Becker RR (1984). Specific indications of hemoproteins in 

polyacrylamide gels using a double-staining process. Anal. Biochem., 

136(2): 506-514. doi: 10.1016/0003-2697(84)90253-7. PMID: 

6202169. 

Freitag A, Rudert M, Bock E (1987). Growth of Nitrobacter by 

dissimilatory nitrate reduction. FEMS Microbiol. Lett., 48(1-2):105- 

109. doi: 10.1111/j.1574-6968.1987.tb02524.x. 

Hakinson TR, Schmidt EL (1988). An acidophilic and a neutrophilic 

Nitrobacter strain isolated from the numerically predominant nitrite 

oxidizing population of an acid forest soil. Appl. Environ. Microbiol., 

54(6):1536-1540. PMID: 16347664. 

Heubuelt J (1929). Untersuchungen uber Nitritbacterien. Planta, 8:398- 

422. 

Hunik JH, Meijer HJG, Tramper J (1993). Kinetics of Nitrobacter agilis at 

exterem substrate product and salt concentration. Appl. Microbiol. 

Biotechnol., 40(2-3):442-448. doi: 10.1007/BF00170408. 

Imhoff JF, Sahl HG, Soliman GSH, Truper HG (1979). The Wadi 

Natrun: chemical composition and microbial mass developments in 

alkaline brines of Eutrophic Desert Lakes. Geomicrobiol. J., 1(3):219- 

234. doi: 10.1080/01490457909377733. 

Keen GA, Prosser JI (1987). Steady state and transient growth of 

autotrophic nitrifying bacteria. Arch. Microbiol., 147(1): 73-79. doi: 

10.1007/BF00492908. 

Kraft I, Bock E (1984). Plasmids in Nitrobacter. Arch. Microbiol., 

140(1):79-82. doi: 10.1007/BF00409775. 

Laanbroek HJ, Woldendorp JW (1995). Activity of chemolithotrophic 

nitrifying bacteria under stress in natural soils. Adv. Microb. Ecol., 

14:275-305. 

Laemmli UK (1970). Cleavage of structural proteins during the 

assembly of the head of bacteriophage T4. Nature, 227:680-685. doi: 

10.1038/227680a0. PMID: 5432063. 

Ludwig W, Strunk O, Westram R, Richter L, Meier H, Yadhukumar BA, 

Lai T, Steppi S, Jobb G, Forster W, Brettske I, Gerber S, Ginhart A 

W, Gross O, Grumann S, Hermann S, Jost R, Konig A, Liss T, 

Lussmann R, May M, Nonhoff B, Reichel B, Strehlow R, Stamatakis 

A, Stuckmann N, Vilbig A, Lenke M, Ludwig T, Bode A, Schleifer K H 

(2004). ARB: a software environment for sequence data. Nucleic 

Acids Res., 32(4):1363-1371. PMID: 14985472. 

Marmur J (1961). A procedure for the isolation of deoxyribonucleic acids 

from microorganism. J. Mol. Biol., 3:208-218. 

Milde K, Bock E (1984). Isolation and partial characterization of inner 

and outer membrane fraction of Nitrobacter hamburgensis. FEMS 

Microbiol. Lett., 21(2):137-141. doi: 10.1111/j.1574- 

6968.1984.tb00199.x. 

Muyzer G, Teske A, Wirsen CO, Jannasch HW (1995). Phylogenetic 

relationships of Thiomicrospira species and their identification in 

deep-sea hydrothermal vent samples by denaturing gradient gel 

electrophoresis of 16S rDNA fragments. Arch. Microbiol., 164(3):165- 

172. doi: 10.1007/BF02529967. PMID: 7545384. 

Samelis J, Tsakalidou E, Metaxopoulos J, Kalantzopoulos G (1995). 

Differentiation of Lactobacillus sake and Lact. Curvatus isolated from 

naturally fermented Greek dry salami by SDS-PAGE of whole-cell 

protein. J. Appl. Bacteriol., 78(2):157-163. doi: 10.1111/j.1365- 

2672.1995.tb02836.x. 

Smith AJ, Hoare DS (1968). Acetate assimilation by Nitrobacter agilis in 

relation to its “obligate autotrophy”. J. Bacteriol., 95(3):844-855. 

PMID: 5643062. 

Sorokin DY, Muyzer G, Brinkhoff T, Kuenen JG, Jetten MSM (1998). 

Isolation and characterization of a novel facultatively alkaliphilic 

Nitrobacter species, N. alkalicus sp. nov. Arch. Microbiol., 

170(5):345-352. doi: 10.1007/s002030050652. PMID: 9818354. 

Spector T (1978). Refinement of the Coomassie blue method of protein 

quantitation: A simple and linear spectrophotometric assay for ≤0.5 to 

50 μg of protein. Anal. Biochem., 86(1):142-146. doi: 10.1016/0003- 

2697(78)90327-5. 

Steinmueller W, Bock E (1977). Enzymatic studies on autotrophically, 

mixotrophically and heterotrophically grown Nitrobacter agilis with 

special reference to nitrite oxidase. Arch. Microbiol., 115(1):51-54. 

doi: 10.1007/BF00427844. PMID: 931509.

Sundermeyer-Klinger H, Meyer W, Warninghoff B, Bock E (1984). 

Membrane-bound nitrite oxidoreductase of Nitrobacter: evidence for a 

nitrate reductase system. Arch. Microbial., 140(2-3):153-158. doi: 

10.1007/BF00454918. 

Watson SW, Valois FW, Waterbury JB (1981). The family 

Nitrobacteraceae. In The prokaryotes. Edited by Starr MP, Stop H, 

Truper HG, Balows A, Schlegel HG. Springer-Verlag, New York, 1: 

1005-1022. 


Winogradsky S (1892). Contributions a la morphologie des organismes 

de la nitrification. Arch. Sci. Biol., (St. Petersb.) 1:88-137.



DOI: 10.5897/AJMR11.1209 



Antibacterial activities of nicotine and its zinc complex 

Muhammad Idrees Zaidi 1 , Feroza Hamid Wattoo 2 *, Muhammad Hamid Sarwar Wattoo 3 , 

Syed Ahmed Tirmizi 3 and Saad Salman 4 

1 Department of Chemistry, Islamia College University, Peshawar, Pakistan. 

2 Department of Biochemistry, PMAS-Arid Agriculture University, Rawalpindi, Pakistan. 

3 Department of Chemistry, Quaid-i-Azam University, Islamabad, Pakistan. 

4 Department of Pharmacy, University of Peshawar, Peshawar, Pakistan. 

Accepted 9 January, 2012 

Nicotine, isolated from leaves of Nicotiana tabacum was complexed with zinc and studied for their 

antibacterial activities against ten different strains of Gram positive and Gram negative bacteria. Results 

showed that zinc (II) complex of nicotine is more active against different types of bacterial strains as 

compared to zinc metal salt used for complexation and nicotine alone. 

Key words: Antibacterial activities, Nicotiana tabacum, nicotine, zinc (II) complex. 

INTRODUCTION 

Isolation and extraction of medicinal compounds from plant 

sources and their characterization have been a common 

practice since the recent past (Munir et al., 1994; Chohan 

et al., 2002). Many of these natural products have been 

reported without their biological properties. In some cases, 

their effective biological properties have been remained 

unknown for the long years. Natural products like 

Vinblastine and Vincristine were isolated in 1954 but their 

antitumor activities were discovered in 1980 (Johnson, 

1994). The discovery of new natural products without 

accompanying biological data is not just more than pure 

phytochemistry. There is, no doubt, a real need of reliable, 

bioassays in general which can detect a broad spectrum of 

pharmacological activities in plants and metal complexes of 

their isolated components in particular (Munir et al., 1995). 

Nicotine, 3-(1-methyl-2-pyrrolidinyl) pyridine is a colourless, 

light pale yellow, hygroscopic oily liquid present in 

the leaves of Nicotiana tabacum (Figure 1). It is one of 

the highly toxic chemicals belonging to the tobacco 

alkaloids (Al-Tamrah, 1999). Since nicotine is the 

predominant component of cigarette smoking, this natural 

agent is thought to be responsible for the cigarettes’ 

*Corresponding author. E-mail: drfhwattoo@gmail.com. 

benefits to Alzheimer’s disease (Shen et al., 2007). 

Nicotine and zinc are closely related to a variety of 

brain pathologies, including schizophrenia, anxiety, major 

depression, Parkinson’s and Alzheimer’s diseases 

(Mocchegiani et al., 2005; Gotti et al., 2006; Levin et al., 

2006; Takeda et al., 2007). It is widely accepted that 

metal chelators and antioxidants hold great potential to 

ameliorate these diseases (Shen et al., 2007). Nicotine, 

extracted from N. tabacum, is an important bioligand and 

has good chelating sites for coordination with numerous 

metals. From the literature concerning the complexes of 

Zn (II) with various nicotine derivatives, compounds with 

different compositions were synthesized and investigated 

(Ide et al., 2002; Bayari et al., 2003; Pasaoglu et al., 

2006). They were mostly obtained as anhydrous 

compounds and for their preparation the Zn (II) chloride 

or iodide, as substrates, were used. The zinc (II) ion in 

these complexes is coordinated by two chloride or iodide 

ions and two pyridine ring N atoms (Ide et al., 2002; 

Bayari et al., 2003; Pasaoglu et al., 2006; Dziewulska- 

Kuaczkowska et al., 2009). But pure Zn (II) - nicotine 

complex without chloride ion bridging has not been 

reported so far. 

Antimicrobial activities of plant ingredients and their metal 

complexes can be detected by observing the growth 

response of various micro-organisms placed in contact with

Table 1. Composition of Mueller-Hinton medium. 

Materials Ingredients (g/L) 

Beef, Infusion 300.0 

Casamino acids 17.5 

Starch 1.5 

Bacto Agar 17.0 

Final pH at 25°C 7.3±0.1 

H 3C 

N N 

3-(1-methylpyrrolidin-2-yl)pyridine 

Figure 1. Nicotine, 3-(1-methyl-2-pyrrolidinyl) pyridine, 

extracted from leaves of N. tabacum. 

them. Most of the methods for detecting such activities are 

based on the same principle and are not equally sensitive. 

The obtained results are profoundly influenced by the 

selected method and by the microorganisms being used for 

the required tests. It is clear that biological evaluation in 

general can be carried out much more efficiently on water 

soluble, nice crystalline compounds/complexes then on 

mixtures like plant extracts (Zaidi and Gul, 2005). However, 

to the best of authors knowledge, the antimicrobial 

activities of zinc (II) nicotine complexes have not been 

reported so far. 

In our previous study, nicotine was isolated from the 

seeds of N. tabacum and its Zinc (II) complex was 

synthesized (Munir et al., 1994) and now in the present 

study, tested these materials for their anti-bacterial 

sensitivity against ten different micro-organisms. 


Anti-bacterial activity 

The anti-microbial sensitivity tests of the title compounds were tested 

against ten different species of gram positive and gram negative 

bacteria including Aeromonas sabriae, Salmonella typhii, Shigella 

boydii, Escherichia coli, Vibrio chlolerae, Pseudomonas pseudomallis, 

Pseudomonas aeroginosa, Bacillus subtilis, Staphylococcus aureus, 

and Streptococcus faecalis. The compounds were used in two 

concentrations that is, 100 µg/100 µl (first dose level) and 200 µg/100 

µl, the second dose level. 

The anti-bacterial activities of nicotine and its zinc complex were 

Zaidi. 5135 

determined by ‘Agar Well diffusion Method’ proposed by Akhtar et al. 

(1987). According to this method, the weighed components of the 

dehydrated medium were dissolved in distilled water and made the 

volume to one litre. Solution was heated till boiling for complete 

dissolution of the components. The medium was autoclaved at the 

pressure of 15 Ibs/in 2 for 15 min while keeping the temperature of 

121°C. The autoclaved medium was then poured in the sterile Petri 

plates and was allowed to solidify in the clean environment. Then 

these plates were incubated at 37°C for 24 h to check their sterility. 

Preparation of stock solutions 

Stock solutions of all the test samples in the concentration of 1 mg/ml 

were prepared in dimethylsulphoxide and then diluted to 100 µg and 

200 µg/ml with the same solvent. 

Measurement of antibacterial activity 

One loop, full of 24 h old bacterial culture containing approximately 

104 to 106 CFU, was spread on the surface of Mueller-Hinton agar 

plates. The composition of Mueller-Hinton agar medium is given in 

Table 1. Wells were dug in the medium with the help of sterile metallic 

borer. The marked area was filled with diluted solutions of the test 

samples, metal salts and solvent dimethylsulphoxide. These plates 

were incubated at 37°C for 24 h. At the end of the incubation period, 

the inhibition zones were measured to the nearest millimeters. Antibacterial 

activity was indicated by a clear zone encircling the marked 

area. Beyond the marked area, there was a homogenous confluent 

lawn of bacterial growth. 

Comparison with standard antibiotics 

The anti-bacterial activity of nicotine and its complex was compared 

with three standard antibiotics, namely, Gentamicin, Tetracycline and 

Tobramycin. This was done by agar disc diffusion method (Zaidi and 

Gul, 2005). In this method, the oxoid multidisc was used in the study. 

The trypticase soy agar was seeded with over-night culture of the test 

organisms. An excess of inoculums was removed. The multodisc was 

aseptically placed over the agar and incubated at 37°C for 24 h. The 

zone of inhibition was measured to the nearest millimeter. 

RESULTS AND DISCUSSIONS 

Nicotine anion is useful moieties in forming an extended 

structure because of its unsymmetrical divergent ligand 

properties with a nitrogen atom. Structure of synthesized 

zinc (II) – nicotine complex is given in Figure 2. Here only 

antimicrobial properties are discussed with reference to 

the standard antibiotics used. 

The anti-microbial sensitivity tests of the presently studied 

compounds were carried out against the Gram negative 

and Gram positive organisms. The compounds were used 

in two concentrations that is, 100 µg/100 µl and 200 µg/100 

µl, (first dose level and the second dose level). Results of 

antibacterial activities of zinc (II) chloride, nicotine and 

the zinc (II) - nicotine complex for the concentrations of 

first and second dose level are given in Table 2. 

These results indicate that nicotine is inactive at first


Figure 2. Structure of Zinc(II)–Nicotine complex. 

Table 2. Antibacterial activities of standard antibiotics, zinc(II) chloride, nicotine and the zinc(II)-nicotine complex at concentration of first and second dose levels 

Compound used 

Gentamicin 

Tetracycline 

Tobramycin 

Zinc (II) chloride 

Nicotine 

Zinc(II)– Nicotine 

complex 

Conc. 

(µg/100 

µg) 

Gram Negative Organism Gram Positive Organism 

A. sabriae S. typhii S. boydii E. coli V. chlolerae P. pseudomallis P. aeroginosa B. subtilis S. aureus S. faecalis 

Zone of Inhibition (mm) 

100 20 25 25 40 35 35 36 _ 31 _ 

200 40 42 39 85 80 85 71 _ 40 _ 

100 _ _ 15 10 51 _ _ 45 _ _ 

200 _ _ 35 27 90 _ _ 67 _ _ 

100 25 27 31 35 31 34 31 30 30 32 

200 51 60 61 55 50 85 90 65 69 71 

100 8 – – 8 6 6 8 – 8 6 

200 10 6 6 10 8 8 10 6 9 8 

100 – – – – – – – – – – 

200 – – – 14 – – 14 – – 14 

100 14 – 14 17 – 16 – – 15 – 

200 17 – 18 18 17 18 14 17 16 –

dose level, and is effective antibiotic at the second dose 

level against E. coli and P. aeroginosa (Gram negative 

organism) and S. faecalis (Gram positive organism) with an 

inhibition zone of 14 mm. Photos of all inhibition zone are 

not shown here. 

Zinc-nicotine complex inhibited only five bacterial species 

at first concentration, however at second dose level; it 

inhibited the growth of eight test bacterial species. In the 

case of zinc (II) chloride, the zone of inhibition ranged 6 to 

18 mm at first dose level and 7 to 20 mm at second dose 

level. 

Compared to nicotine alone; the zinc (II) complex of 

nicotine is able to inhibit almost all the studied gram positive 

and gram negative organisms at the higher dose level. 

These results are also well comparable with the three 

reference antibiotics that is, Gentamicin, Tetracycline and 

Tobramycin. Therefore, we comment that this complex is 

broad spectrum anti-microbial agent active against the 

variety of gram positive and gram negative bacterial 

species. 

Further research is underway on the antibacterial 

mechanism of this zinc-nicotine complex that either this is 

cell wall inhibitors or bactericidal or bacteriostatic. 

However, some researchers (Munir et al., 1994, 1995; 

Chohan et al., 2002) studied considerable changes in the 

bacterial cell membranes upon metal ion treatment, 

which might be one of the cause or consequence of cell 

death. 

Conclusion 

Zinc is relatively abundant element in biological 

organisms, plays an essential role in the large number of 

enzymatic reactions. Having the broad spectrum antimicrobial 

activities, zinc and its nicotine compounds may 

be used as a therapeutic agent and anti-sickness agent 

playing a role in the prevention of pain crisis in sickle-cell 

disease and in the treatment of various sicknesses. 


Authors are thankful to the higher education commission, 

HEC, formerly named as university grant commission, 

UGC, for providing some financial support to this project. 

H.E.J. Research Institute of Chemistry, Karachi, 

Pakistan, is acknowledged for providing necessary 

instrumental facilities. 

REFERENCES 

Zaidi. 5137 

Akhtar N, Malik A, Ali SN, Kazmi SU (1987). Proceragenin, an 

antibacterial cardenolide from Calotropic Procera. Phyto. Chem., 31: 

2821-2824. 

Al-Tamrah SA (1999). Spectrophotometric determination of nicotine. 

Analytica Chimica Acta, 379: 75–80. 

Bayari S, Atac A, Yurdakul S (2003). Coordination behaviour of 

nicotinamide: an infrared spectroscopic study. J. Mol. Struct., 655: 

163–170. 

Chohan ZH, Rauf A, Noreen S, Scozzafava A, Supuran CT (2002). 

Antibacterial cobalt(II), nickel(II) and zinc(II) complexes of nicotinic 

acid-derived Schiff-bases. J. Enzyme Inhib. Med. Chem., 17: 101– 

106. 

Dziewulska-Kuaczkowska A, Mazur L, Ferenc W (2009).Thermal, 

spectroscopic and structural studies of zinc(II) complex with 

nicotinamide. J. Therm. Anal. Calorim., 96: 255–260. 

Gotti C, Zoli M, Clementi F (2006). Brain nicotinic acetylcholine 

receptors: native subtypes and their relevance. Trends Pharmacol. 

Sci., 27: 482–491. 

Ide S, Atac A, Yurdakul S (2002). Spectroscopic and structural studies 

on dichlorobis(nicotinamide)zinc(II). J. Mol. Struct., 605: 103–107. 

Johnson I (1994).The vinca alkaloids: A new class of oncolytic agents. 

Cancer Res., 12: 43–45. 

Levin ED, McClernon FJ, Rezvani AH (2006). Nicotinic effects on 

cognitive function: behavioral characterization, pharmacological 

specification, and anatomic localization. Psychopharmacology (Berl.), 

184: 523–539. 

Mocchegiani E, Bertoni-Freddari C, Marcellini F, Malavolta M (2005). 

Brain, aging and neurodegeneration: role of zinc ion availability. Prog. 

Neurobiol., 75: 367–390. 

Munir C, Zaidi MI, Ahmad N, Rehman AR (1995). An easy rapid metal 

mediated method of isolation of harmine and harmaline from 

Peganum harmala. Fitoterapia, 66: 73–76. 

Munir C, Zaidi MI, Yousaf SM (1994). Zinc, cadmium and mercury as 

extractants of nicotine from tobacco leaves. Main Group Metal 

Chem., 17: 673–677. 

Pasaoglu H, Guven S, Heren Z, Buyukgungor O (2006). Synthesis, 

spectroscopic and structural investigation of ZnI2(nicotinamide)2, 

ZnI2(isonicotinamide)2 and [Zn(H2O)2(picolinamide)2]I2. J. Mol. Struct., 

794: 270–276. 

Shen L, Zhang H, Ji HF (2007). Computational note on the SOD-like 

antioxidant potential of nicotine–copper(II) complexes. J. Mole. 

Struct., Theochem., 817: 161–162. 

Takeda A, Tamano H, Kan F, Itoh H, Oku N (2007). Anxiety-like 

behavior of young rats after 2-week zinc deprivation. Behav. Brain 

Res., 177: 1–6. 

Zaidi MI, Gul A (2005). Antibacterial activity of nicotine and its copper 

complex. J. Sc. Tech. Univ. Peshawar, 29: 45–49.



DOI: 10.5897/AJMR11.1222 



Comparison of the Cepheid Xpert FluA/H1N1 screening 

test with real time polymerase chain reaction (PCR) in 

detection of 2009 H1N1 Influenza A Pandemic 

S. M. Al Johani* and J. Akhter 

Division of Microbiology, Department of Pathology and Laboratory Medicine, King Abdulaziz Medical City, Riyadh 

11426, Saudi Arabia. 


Although infections with the novel pandemic 2009 influenza A (H1N1) virus (A/H1N1/2009) appear to be 

relatively mild during the summer months of circulation ('off season'), there has been significant 

morbidity and hospitalization and several fatal cases. Thus, rapid detection of A/H1N1/2009 is crucial. In 

contrast to seasonal influenza, where point-of-care (POC) rapid antigen tests and direct fluorescent 

antibody (DFA) staining ensure rapid detection, diagnosis of A/H1N1/2009 has so far been based mainly 

on RT-PCR due to lack of sensitivity of the other non-molecular methods. This study is aimed to 

evaluate the Xpert FluA/H1N1 test (Cepheid®), rapid molecular test for influenza A virus including 

A/H1N1/2009 for the detection of the recently emerged swine influenza A (H1N1) and compare it with 

RT-PCR. A total of 386 respiratory samples were tested in parallel using Cepheid Xpert FluA and 

compared with RT-PCR. We determined the analytical performance characteristics (sensitivity, 

specificity) of the xpert test using RT-PCR as the gold standard. RESULTS: Xpert Flu A Panel detected 

A(H1N1) seasonal and 2009 pandemic, A(H3N2), A(H5N2), A(H5N1) and A(H7N7) viruses and correctly 

subtyped A(H1N1) 2009 virus. Of 386 samples, 53 samples were positive by the two methods, RT-PCR 

detected 2 samples that were negative by Xpert Flu. Analytical sensitivity was comparable to RT-PCR. 

The Xpert Flu A Panel is the first commercially available rapid molecular test for detection of influenza 

A and B viruses and at the same time, it can determine H1 2009 subtype. The test has comparable 

sensitivity compared with RT-PCR and high specificity. Therefore, it represents a useful rapid test for 

molecular detection of Flu A and B viruses and can also rule out H1N1. 

Key words: Xpert fluA, 2009 H1N1, rapid Influenza diagnostics. 

INTRODUCTION 

In April 2009, a novel influenza A (H1N1) virus was 

detected in the US, which developed in to pandemic 

proportions. Pandemic H1N1 2009 (pdmH1) has a broad 

clinical spectrum. Although, many cases are mild, its 

pathogenesis is not necessarily low as it often causes 

serious respiratory disorder in children, and thus early 

treatment is necessary. 

The Pandemic once declared there were major moves 

*Corresponding author. E-mail: johanis@ngha.med.sa. Tel: 

+9661 2520088 ext. 12817. Fax: +966-1-2520130 or 11264 

to find a rapid, easy, highly sensitive and specific 

diagnostic method. A novel real-time RT-PCR for 

(A/H1N1/2009) was set up in a very short time and 

validated following industry-standard criteria (Panning et 

al., 2009; Novel Swine-Origin Influenza A (H1N1) Virus 

Investigation Team, 2009). 

As for the infectiousness, based on higher household 

transmission from parents to children in comparison to 

seasonal influenza A (FluA), as well as a high prevalence 

among primary school children, pandemic H1N1 appears 

more likely to affect children, especially school children. 

In addition, since pandemic H1N1 has a long incubation 

period, which can facilitate latent viral transmission,

wearing a mask is useful during the epidemic period. A 

judgment of recovery should be carefully made especially 

in children, because the virus remains for a long time 

even after resolution of fever. 

Direct antigen detection (DFA), typing, and/or subtyping 

of influenza can be rapidly carried out by several 

methods, such as nucleic acid techniques, 

immunofluorescence assay, or enzyme-linked 

immunosorbent assay. Benefits of DFA include 

identification of good quality specimens based on the 

presence of epithelial cells, and the ability to test 

individual specimens without batching, thus improving the 

turn-around time compared with most PCR-based assays 

for low numbers of samples. In contrast to RT-PCRbased 

methodologies, DFA suffers from a lack of 

sensitivity and issues of false-positives have been 

identified especially during times of low prevalence or 

due to misreading of slides because of the subjective 

nature of the test. Culture-based methods have been 

traditionally used for the detection and characterization of 

influenza; however, they have a lower sensitivity 

compared with most molecular tests for the detection of 

influenza. Tissue culture methods utilize shell vial (for 

example, mixed monolayers of human adenocarcinoma 

cells and mink lung cells on a glass slide) or traditional 

tube or flask culture techniques (for example, rhesus 

monkey kidney cells or Madine Darby canine kidney 

cells) to support the growth of influenza. Key limitations 

are based on the fact that, tissue culture requires special 

skills for identification of cytopathic effect, which is labor 

intensive, and uses paired immunofluorescent 

methodologies to identify the virus. Emerging strains of 

influenza that are more pathogenic may require highly 

controlled environments. By contrast, PCR-based 

methods often involve the use of lysis buffer for viral 

inactivation and release of nucleic acid, thus making it 

feasible for laboratories with Biosafety Level 2 

capabilities to handle these viruses (Pabbaraju et al., 

2011). 

Rapid diagnosis of influenza can facilitate timely clinical 

management decisions and applications of infection 

control precautions. Antigen detection tests for Flu A 

were less sensitive in comparison to culture and RT-PCR 

in detecting (A/H1N1/2009) with sensitivity ranging 

between 50-80% in several studies (Panning et al., 2009; 

Loeffelholz, 2008; Al Johani, 2009; Cheng et al., 2009). 

In this study, we evaluated the performance of a new 

Molecular Point-Of-Care (POC) GeneXpert flu A /H1N1 

test from Cepheid® for rapid detection of different 

Influanza A virus including (A/H1N1/2009) virus and 

compared it to RT-PCR results at King Abdulaziz Medical 

City, Riyadh, Saudi Arabia. 


A total of 186 respiratory patient samples were collected from 

patient’s with influenza like illness (ILI) attending the King Abdulaziz 

Al Johani 5139 

Medical City, Riyadh. This is a 1,000 bed tertiary care facility. 

Patient specimens were tested in parallel using a real-time reversetranscriptase 

PCR (RT-PCR) (Roche Diagnostics GmbH, 

Mannheim, Germany®) kits and GeneXpert FluA/ H1N1 kit from 

Cepheid®. All specimens were collected from patients with 

influenza-like illness who met the World Health Organization and 

Centre of Disease Control (CDC's) guidelines for screening (CDC, 

2009). 

Polymerase chain reaction (PCR) method 

A/H1N1/2009 was detected by Reverse-Transcription Polymerase 

Chain Reaction (RT-PCR) based assay that begins with isolating of 

viral RNA from patient’s nasopharyngeal aspiration specimen. 

Briefly, viral RNA was extracted on the QIA symphony®SP 

system from 400-µL nasopharyngeal aspirates using the 

QIAsymphony Virus/Bacteria Kits (Qiagen, Hamburg, Germany®). 

The RNA was reverse-transcribed to cDNA using Transcriptor First 

Strand cDNA Synthesis kit (Roche Diagnostics GmbH, Mannheim, 

Germany®), following the manufacturer recommendations. The 

resultant cDNA is then amplified and detected by specific primers 

and probes for H1N1 using LightMix InfA swine H1 kit (TIB 

MOLBIOL GmbH, Berlin, Germany) and following the manufacture 

recommendation. 

The amplification and the presence of H1N1 genotype is 

confirmed by the melting curve analysis using the Roche lightCycler 

2.0 instruments. 

GeneXpert FluA test 

The Cepheid GeneXpert instrument is a cartridge-based PCR 

system for performing nucleic acid extraction, PCR amplification, 

and real-time detection automatically without intermediate samplehandling 

steps. GeneXpert FluA test were used according to the 

manufacturer’s instructions on 100 µL of original sample from 

patients with ILI. 

The GeneXpert Dx Systems automate and integrate sample 

purification, nucleic acid amplification, and detection of the target 

sequence in simple or complex samples using real-time RT-PCR 

and PCR assays. The system consists of an instrument, personal 

computer, and preloaded software for running tests and viewing the 

results. The systems require the use of single-use disposable 

GeneXpert cartridges that hold the RT-PCR and PCR reagents and 

host the RT-PCR and PCR processes. Because the cartridges are 

self-contained, cross-contamination between samples is minimized. 

For a full description of the systems, refer to the appropriate 

GeneXpert Dx System Operator Manual. 

The Xpert Flu Assay includes reagents for the detection and 

differentiation of Influenza A, Influenza B and Influenza A subtype 

2009 H1N1 directly from nasal aspirates/washes (NA/W) and 

nasopharyngeal (NP) swab specimens of patients suspected of 

having influenza. A Sample Processing Control (SPC) and a Probe 

Check Control (PCC) are also included in the cartridge. The SPC is 

present to control for adequate processing of the target viruses and 

to monitor the presence of inhibitors in the PCR reaction. The 

Probe Check Control (PCC) verifies reagent rehydration, PCR tube 

filling in the cartridge, probe integrity, and dye stability. 

RESULTS 

A total of 186 patients with symptoms of influenza were 

tested in parallel by using two different methods 

GeneXpert FluA and RT-PCR. Of 186 samples, 53


Table 1. Comparing of Xpert Flu A with Gold standard test. 

Xpert Flu A 

patient samples were positive by the two methods, RT- 

PCR detected 2 patient samples that were negative by 

Xpert Flu. Results were classified as true positive, true 

negative, false positive, or false negative Xpert Flu A 

detected A(H1N1) seasonal and 2009 pandemic, 

A(H3N2), A(H5N2), A(H5N1) and A(H7N7) viruses and 

correctly subtyped A(H1N1) 2009 virus. Analytical 

sensitivity was comparable to RT-PCR. Xpert Flu A 

sensitivity and specificity were 96.36 and 100% 

respectively when compared to RT-PCR (Table 1). 

Sensitivity = 53/55 x 100 = 96.36% 

Specificity = 131/131 x 100 = 100% 

Positive Predictive Value = 53/ (53 + 2) = 96.36% 

Negative Predictive Value = 131 (0 + 131) = 100% 

DISCUSSION 

In January 2010, Cepheid granted Emergency Use 

Authorization (EUA) from the U.S. Food and Drug 

Administration (FDA) for its Xpert® Flu A Panel test. The 

test, which runs on Cepheid's GeneXpert® System, 

identifies Influenza A, Influenza B, and identified the 2009 

H1N1 influenza virus in less than one hour. The FDA has 

authorized Cepheid's Xpert Flu A Panel to be used in 

laboratories certified under the Clinical Laboratory 

Improvement Amendments (CLIA) to perform "moderate 

complexity" (not waived) testing, enabling the test to be 

performed in hospital near-patient settings. 

Molecular testing is now recognized as the new gold 

standard for detection of influenza virus infection, test 

availability for 2009, H1N1 has so far been limited to 

high-complexity laboratories and results are not typically 

available around the clock. Xpert Flu A Panel combines 

the convenience and ease-of-use of rapid testing with the 

performance of PCR, in a test format that maximizes 

medical value by providing results when they are most 

needed. 

All other rapid Influenza tests currently on the market 

are designed to detect influenza type A, type B, or both. 

They can distinguish influenza A from influenza B, but 

cannot distinguish (A/H1N1/2009) it from seasonal strains 

of flu (Wilde, 2009). 

CDC RT-PCR 

+ - Total 

+ 53 0 53 

- 2 131 133 

Total 55 131 186 

Routine testing for (A/H1N1/2009) using rapid Enzyme 

Immunoassay (EIA) tests is not recommended by the 

CDC because the sensitivities of the currently available 

rapid tests for the detection of (A/H1N1/2009) are quite 

poor. Various studies have shown detection rates 

between 11 and 70% (CDC 2009a; Faix et al., 2009; 

CDC, 2009b; Jenny et al., 2010; Sambol et al., 2010). 

This means that the rapid test may fail to detect 

(A/H1N1/2009) in 30-90% of cases (Wilde, 2009). Xpert 

Flu A, on the other hand, combines the rapid detection 

time, on demand use and high sensitivity and specificity, 

which are comparable to RT-PCR (Jenny et al., 2010; 

Sambol et al., 2010). 

The Xpert Flu A Panel is the first commercially 

available POC molecular test for detection of influenza A 

virus and determination of the H1 2009 subtype and is 

comparably sensitive compared with RT-PCR and highly 

specific and therefore it represent an excellent alternative 

to antigenic POC tests, but it is by far more expensive 

than routine Point Of Care testing. 

REFERENCES 

Al Johani S (2009). Swine infuenza H1N1; Is your laboratory prepared? 

Saudi Med. J., 30: 7. 

CDC (2009a). Updated interim recommendations for the use of antiviral 

medications in the treatment and prevention of influenza for the 2010 

season. October 16. Available at: 

http://www.cdc.gov/h1n1flu/recommendations.htm (Accessed 

November 10). 

CDC (2009b). Evaluation of rapid influenza diagnostic tests for 

detection of novel influenza A (H1N1) virus --- United States, 2009. 

MMWR Morb. Mortal Wkly Rep.; 58: 826-829. 

CDC (2009). Protocol of real time RT-PCR for influenza A H1N1 

Geneva: World Health Organization, April. (Accessed September 29, 

at 

http://www.who.int/csr/resources/publications/swineflu/realtimeptpcr/e 

n/index.html.). 

Cheng CK, Cowling BJ, Chan KH, Fang VJ, Seto WH, Yung R, Uyeki 

TM, Houck PM, Peiris JS, Leung GM (2009). Factors affecting 

QuickVue Influenza A + B rapid test performance in the community 

setting. Diagn. Microbiol. Infect. Dis., 65(1): 35-41. 

Faix DJ, Sherman SS, Waterman SH (2009). Rapid-test sensitivity for 

novel swine-origin influenza A (H1N1) virus in humans. N. Engl. J. 

Med., 361: 728-729. 

Jenny SL, Hu Y, Overduin P, Meijer A (2010). Evaluation of the Xpert 

Flu A Panel nucleic acid amplification-based point-of-care test for 

influenza A virus detection and pandemic H1 subtyping. J. Clin. Virol., 

49(2): 85-89. 

Loeffelholz MJ (2008). American Society For Microbiology. Sentinel 

Laboratory Guidelines For Suspected Agents Of Bioterrorism And 

Emerging Infectious Diseases; Avian Influenza A H5N1.

Novel Swine-Origin Influenza A H1N1 Virus Investigation Team (2009). 

Emergence of a novel swine-origin influenza A (H1N1) virus in 

humans. N. Engl. J. Med., 360: 2605-2615. 

Pabbaraju K, Wong S, Drews SJ (2011). Rethinking Approaches to 

Improve the Utilization of Nucleic Acid Amplification Tests for 

Detection and Characterization of Influenza A in Diagnostic and 

Reference Laboratories. Future Microbiol., 6(12): 1443-1460. 

Panning M, Eickmann M, Landt O, Monazahian M, Olschläger S, 

Baumgarte S, Reischl U, Wenzel JJ, Niller HH, Günther S, Hollmann 

B, Huzly D, Drexler JF, Helmer A, Becker S, Matz B, Eis-Hübinger A, 

Drosten C (2009). Detection of influenza A (H1N1)v virus by realtime 

RT-PCR. Eur. Surveill., 14(36): 19329. 

Al Johani 5141 

Sambol AR, Iwen PC, Pieretti M, Basu S, Levi MH, Gilonske KD, Moses 

KD, Marola JL, Ramamoorthy P (2010). Validation of the Cepheid 

Xpert Flu A real time RT-PCR detection panel for emergency use 

authorization. J. Clin. Virol., 48(4): 234-238. 

Wilde J (2009). Testing for H1N1 Influenza in the Emergency 

Department; Medscape Emergency Medicine (Accessed November 

10).



DOI: 10.5897/AJMR11.1235 



An in-vitro model for studying the adhesion of 

Lactobacillus bulgaricus in soyghurt and 

enteropathogenic Escherichia coli (EPEC) on HEp-2 

Cells 

Jetty Nurhajati, Sayuti 1 *, Chrysanti 2 and Syachroni 1 

1 Department of Biology, Faculty of Mathematics and Natural Sciences, Padjadjaran University, Indonesia. 

2 Microbiology Department, Faculty of Medicine, Padjadjaran University, Indonesia. 


Attachment or adhesion of Lactobacillus bulgaricus in soyghurt and enteropathogenic Escherichia coli 

(EPEC) with HEp-2 cells has been done. This research was aimed at finding out the adhesion ability of 

L. bulgaricus and EPEC on HEp-2 cells experimentally in vitro. The results showed that L. bulgaricus in 

soyghurt could carry out adherence in HEp-2 cells and the best adhesion activity of L. bulgaricus was 

after 3 h of contact with HEp-2 cells. The longer the incubation time of contact, the greater the adhesion 

of L. bulgaricus. The next results of research showed that EPEC could carry out adherence by 

expressing localized adherence (LA) pattern and attaching and effacing lesion (A/E) forming a pedestal 

on HEp-2 cells. L. bulgaricus in soyghurt has adhesive characteristics so it can be expected to carry out 

adherence in gastrointestinal tract and could inhibit EPEC adhesion activity. 

Key words: Enteropathogenic Escherichia coli (EPEC), Lactobacillus bulgaricus, culture cell, bacterial 

adhesion, soyghurt. 

INTRODUCTION 

Microorganisms for the production of yoghurt is generally 

chosen according to their growth characteristics and taste 

in the fermentation of milk; besides, the other aspect to 

be considered is bacteria are needed to settle in the 

digestive tract and give beneficial effect in vitro. One of 

the aspects in question is the capability to carry out 

adhesion in the intestinal cell and ephithelial membrane, 

with adhesion of the gastrointestinal, is a prerequisite of 

colonization by many species of bacteria (Coconnier et 

al., 1992). 

Adhesion is a factor of bacteria virulence carried out by 

the adhesin protein present in pilli and outer membrane 

protein (OMP) bacteria. Bacterial adhesion on the tissue 

can determine the microorganism colonization capability 

(Surono, 2004). 

Bacterial adhesion which is followed by the occurrence 

of colonization in the sensitive host is an important factor 

*Corresponding author. E-mail: jettynurhajati@yahoo.com. 

and is needed to start the pathogenesis of diseases 

(Todar, 2008). Escherichia coli is one of the bacteria 

included in normal microflora of the digestive tract; after 

1940, however, the E. coli strain was found in the USA, 

the cause of several diseases, one which was E. coli 

enteropathogenic (EPEC) (Nataro and Kaper, 1998). 

EPEC is the most frequent cause of diarrhoea in babies 

and infants, in particular in developing countries like 

Indonesia, and to cause infection by way of adhesion with 

the receptor present on the host cell surface, like in the 

ileum part of the intestine epithelial cell. 

Probiotic is a living microbe which, consumed, will 

create a therapeutic effect in the body by way of 

improving microflora equilibrium in the digestive tract 

(Fuller, 1989). Lactobacillus bulgaricus is a probiotic 

bacteria used in the production of yoghurt as well 

soyghurt. Soyghurt is soybean milk fermented by 

probiotic bacteria and which can be converted into 

yoghurt, because soybean is known to possess natural 

prebiotic source (Winarno, 1993). The addition of L. 

bulgaricus in soyghurt can be beneficial for the health, in

that it produces lactic acid, bacteriocins, and H2O2 

(Nurhajati et al., 2008). 

Cell culture is a very useful way to study bacteria 

virulence rate. This is due to the uniformity of cell 

population capable of being infected with certain 

conditions. Bacterial adhesion has been studied in 

various in vitro models, comprising polymer surface, 

intestinal epithelial cell, or intestinal cell lines to be 

related to clinical relation and placing the adhesion or 

adhesion key (Jankowska et al., 2008). The use of 

human epidermoid laryngeal (HEp-2) cell lines is an 

appropriate method because of good cell population 

uniformity to be used in the testing of adhesion potential 

of pathogenic as well as non-pathogenic bacteria. And 

HEp-2 also resists temperature, nutritional, and 

enviromental changes without a loss of viability. Beside 

that, it has been used for experimental studies of tumor 

production in rats, hamster, mice, embryonated eggs, 

and volunteer terminal cancer patients (Viromed, 2012). 

This simple test provides an illustration of bacterial 

adhesin as well as bacteria receptor in eukaryotic cells, 

so as to be able to be used for the characterization of 

lactobacilli mechanism capable of interacting with other 

cell surfaces, like the intestinal epithelial cell. In addition, 

the bacterial adhesion test in HEp-2 cells have been used 

to detect virulence among E. coli, which belongs to 

serotype E. coli (EPEC) and strain which does not belong 

to serotype EPEC (Mathewson and Cravioto, 1989). 

A research will therefore be conducted on the L. 

bulgaricus bacteria adhesion in soyghurt and E. coli 

enteropathogenic (EPEC) in HEp-2 cells. 


Bacteria strain and culture condition 

The cultures used were L. bulgaricus FNCC 0041 from collection of 

the Microbiology Laboratorium, Department of Biology, Padjadjaran 

University, and the EPEC bacteria culture, from the collection of 

Microbiology Laboratorium, Faculty of Medicine, Padjadjaran 

University. Each bacteria was grown in the Man Rogosa Sharpe 

(MRS) agar (OXOID CM0361 B) media which was supplemented 

with 0.5% CaCO3 and McConkey Agar (MCA) (OXOID CM0007) 

media at a temperature of 37°C for 24 h. 

HEp-2 cell culture 

The human epidermoid laryngeal (HEp-2) cell culture from the 

collection of the PT. BIOFARMA Product Evaluation and 

Surveillance was grown in a 25 cm 2 tissue culture flask, with MEM 

media growth supplemented with 10% (v/v) heated inactivated FBS 

(30 min 56°C), HEPES, antibiotic-antimicotic solution (1% Penicillin 

G-Streptomycin Solution Stabilised and 1% Fungizone 

Amphotericyn, and 7.5% NaHCO3 solution. The cell was incubated 

at a temperature of 37 at 5% (v/v) CO2 atmospheric condition. The 

culture medium was changed every 2 to 3 days. The cell was then 

passaged every seven days or after it reached 90% confluent. 

For adhesion test, a number of 1, 4 × 10 4 cells per cm 2 were 

moved to coverslips in microplate 6 well (22 × 22 mm) with a similar 

new culture without antibiotic-antimicotic solution and grown until 

80% confluent. 

Making soybean milk 

Sayuti et al. 5143 

The soybeans are sorted until a weight of 300 g and washed clean, 

then immersed in 5 L water containing NaHCO3 of 0.25 to 0.5% 

concentration for 12 to 24 h. The soybeans are washed and peeled. 

The soybeans are crushed using a blender while 2.5 L (80 to 

100°C) is added until pulp is obtained. The soybean pulp is sifted to 

obtain raw soybean milk. Then 125 g granuled sugar is added and 

the mixture is sterilized in an autoclave at 121°C temperature and 

pressure of 1 atm (15 lbs) for 10 min (Basuki, 2008). 

The making of soyghurt 

Soyghut is made using soybean milk as medium and uses as pure 

culture L. bulgaricus previously prepared in MRS (Man Rogose 

Sharpe) slant Agar. An amount of two ose of L. bulgaricus culture 

was inoculated in 100 ml soybean milk medium. The culture 

medium was incubated using a shaker bath incubator for 24 h at 37 

to 40°C and at a speed of 125 rpm (Misgiyarta, 2003). 

Bacterial adhesion activity in HEp-2 cells 

L. bulgaricus adhesion activity in Hep-2 cells was conducted by first 

preparing a HEp-2 cell monolayer. At the time of use each well was 

then rinsed twice with D-PBS. The soyghurt was then turned in a 

centrifuge at a speed of 5,000 × g for 10 min, disposing of the 

supernatant. The bacteria pellets were twice washed with PBS, 

then turned in a centrifuge again at a speed of 5,000 × g for 10 min, 

and then equalized to an McFarland 1 turbidity, namely 3×10 8 CFU 

mL -1 . The same procedure was applied to the EPEC bacteria. Then 

1 ml of each bacteria suspension was added to the 1 ml cell culture 

medium. The suspension (2 ml) was then distributed respectively to 

microplate 6 shafts, then incubated at 37°C and atmospheric 

condition of 5% CO2 (v/v) for 0, 1, and 3 h. Each Hep-2 cell 

monolayer was then rinsed with PBS five times. Then the cell HEp- 

2 monolayer was fixated with methanol and left to dry at room 

temperature, then coloured with Gram stain, and examined under a 

microscope. (Coconnier et al., 1992; Zhong et al., 2004). 

Data analysis 

The data of the number of L. bulgaricus bacteria adhesion counted 

were 20 random microscopic areas replicated twice to reduce bias, 

then statistically analyzed using ANOVA, follwed by DMRT 

(Duncan's Multiple Range Test) in the case of significant difference 

(P


Figure 1. L. bulgaricus adhesion in HEp-2 cells (arrow) with Gram stain 

magnified 2,000x. 

the fact that each probiotic bacteria, like L. bulgaricus and 

pathogen bacteria like EPEC can carry out adhesion at 

HEp-2. In Figure 1, the L. bulgaricus can carry out 

adhesion at HEp-2 with the adherence type in the form of 

diffuse or spreading. This is similar to the research that 

used L. acidophilus BG2FO4 the type of adhesion of 

which can diffuse at the Caco-2 (Coconnier et al., 1992) 

cell. To see the extent of adhesive nature, L. bulgaricus 

adhesion activity potential test was carried out in 

soyghurt at HEp-2, the results of which are shown in 

Figure 2. 

On the basis of DMRT results, Figure 2 shows that all 

treatment contact incubation time (0, 1, and 3 h) could 

affect the number of L. bulgaricus cells in soyghurt which 

adhered to the HEp-2 cells. There was no difference 

between the incubation contact time of 0 and 1 h. The 3 h 

contact incubation time showed a very significant 

difference with the 0 h, that is, the average number of L. 

bulgaricus cells in soyghurt which adhered to the HEp-2 

cells increased to become 3 to 4 bacteria cells in 

microscopic area, or 71 bacteria cells in 20 microscopic 

areas (data not shown) adhere more to the HEp-2 cells 

compared to the control average, namely, 0 bacteria 

cells. The best L. bulgaricus adhesion potential activity is 

at the 3 rd incubation hour, after being incubated with the 

HEp-2 cells. This was due to the fact that the longer the 

contact incubation time given, the more the adhering L. 

bulgaricus. The capability of bacteria to carry out 

adhesion at the host cell depends on the structure or 

molecule capable of adhering or carrying out adhesion, 

which is called adhesin, which enables the organism in 

question to adhere to the receptor present in the host 

cell. Some probiotic bacteria yield extracellular protein in 

the form of adhesin which is specific with respect to 

mannosa receptor like MSA. The MSA adhesin protein 

made Lactobacillus and in general played a role in the 

colony forming in the digestive tract and competition with 

other pathogen bacteria (Nurhajati et al., 2009). L. 

bulgaricus included Gram-positive has rod forming and 

usually keep size 0.5 - 1.2 x 1.0 – 10 µm, nonspora, 

motile by peritrik flagel. Characteristic of bacteria surface 

related to adhesion ability on some substrat. Tecoat acid 

and spesific O-polisacarida can used as adhesin by 

Gram positive bacteria. In Gram positive bacteria, 

adhesin protein measures spesific to receptor such as 

mannosa (Nurhajati et al., 2008). 

EPEC adhesion activity at HEp-2 cells 

Results of adhesion activity in HEp-2 cells after being 

incubated at 37 to 5% CO2 are shown in Figure 3.

Figure 2. DMRT Graph, effect of various contact incubation period on the number of L. bulgaricus cells in 

soyghurt which adhere to the HEp-2 cell. ** The best adhesion number activity (P < 0.01). 

Figure 3. EPEC adhesion in HEp-2 cells (arrow) with Gram stain. (A) show Localized 

Adherence or LA at 1,700x magnification; (B) The forming of Attaching and Effacing (Pedestal) 

Lesion magnified 4,000x; and (C) EPEC Bacteria which have already formed a Pedestal Attract 

other EPEC Bacteria, at 4,000x magnification. 

Sayuti et al. 5145


Localized adherence (LA) is a term used for bacteria 

cells which adhere to the epithelial cell in vitro and which 

form a microcolony in a clear area. The LA phenotype 

has a link in induction at the attaching and effacing lesion 

(A/E) produced by EPEC. 

Lesion (A/E) is characterized by the destruction of 

microvilli, strong adhesion by the bacteria at the intestinal 

epithelium, forming a pedestal and centralized actin 

aggregation (Rüttler et al., 2006) The pedestal is an 

increase in cell membrane up to 10 µM above the cell 

with invagination central and cystoskeleton protein 

accumulation beneath the microcolony adhesion which 

causes the surface to lose its absorption function, 

causing the suspicion that it is responsible for the coming 

about of diarrhea. The production of lesion (A/E) is 

determined by the genetic factor present in locus 

enterocyte effacement (LEE) EPEC, like intimin and tir 

(translocator intimin receptor) (Rüttler et al., 2006). The 

intimin-Tir interaction makes a cystoskeletal accumulation 

beneath the strong adhesion of the bacteria which form 

lesion formation (A/E) (Goosney et al., 2000). 

This happens because at EPEC bacteria there is gene 

group which encodes bundle forming pili (Bfp) with the 

function to connect bacteria with the microcolony so as to 

create stability. Bfp plays an important role in the host cell 

adhesion which will increase lesion formation (A/E), 

partially as well as fully, by the mobilization of bacteria in 

the host cell environment (Trabulsi et al., 2002). EPEC 

included Gram-negative bacteria cell with thin cell wall 

(10 nm) and comprises single peptidoglycan layer 

surrounded by membrane structure which is outer 

membrane protein (OMP). To Gram-negative bacteria, 

adhesion was minor subunit protein in posterior of pilli 

which can be adhesion media (Todar, 2008). 

Conclusion 

In the overall microscopic research observation, it was 

clearly seen that there was adhesion between bacteria, 

probiotic as well pathogen bacteria with HEp-2 cell 

surface. In addition, the bacteria cell cluster visible on the 

cell surface showed the presence of some cell to cell 

interactions occurring between bacteria cells. It is 

therefore expected that L. bulgaricus probiotic bacteria 

adhesion can prevent gastroenteritis diseases due to 

pathogen bacteria adhesion, one of which is EPEC. Their 

bacterial detective work as a powerful proof of concept 

for understanding the health implications of the close 

relationship between microbes and their hosts, and for 

advancing the development of micro-organism-mediated 

‘probiotic’ therapeutic strategies in the future. 


We would like to express our thanks to I-MHERE for the 

donation provided. We would also like to thank the 

Healthcare Research Unit of the Faculty of Medicine, 

Padjadjaran University and PR. BIOFARMA for the aid in 

providing research materials. 

REFERENCES 

Basuki TJ (2008). Making Healthy Soybean Milk.http://basuki.asia/ 

archives/46. (Culinary: making healthy soybean milk). pp. 1-3. 

Coconnier MH, Klaenhammer TR, Kernéis S, Bernet MF, Servin AL 

(1992). Protein-mediated adhesion of Lactobacillus acidophilus 

BG2FO4 on human enterocyte and mucus- secreting cell lines in 

culture. Appl. Environ. Microbiol., 58(6): 2034-2039. 

Fuller R (1989). Probiotics in man and animals. J. Appl. Bacteriol., 66: 

365-378. 

Goosney DL, DeVinney R, Pfuetzner RA, Frey EA, Strynadka NC, 

Finlay BB (2000). Enteropathogenic E. coli translocated intimin 

receptor, Tir, interacts directly with alpha-actinin. Curr. Biol., 10:735– 

738. 

Jankowska A, Laubitz D, Antushevich H, Zabielski R, Grzesiuk E 

(2008). Competition of Lactobacillus paracasei with Salmonella 

enterica for adhesin to Caco-2 cells. J. biomed. biochem., Article 

ID357964: pp. 1-6. 

Mathewson JJ, Cravioto A (1989). HEp-2 cell adherence as an assay 

for virulence among diarrheagenic Escherichia coli. J. Infect Dis., 

159: 1057-1060. 

Misgiyarta dan Widowati S (2003). Selection and characterization of 

indigenus lactic acid bacteria. Proceedings of seminar pilot research 

and plant biotechnology results. pp. 374-387. 

Nataro JP, Kaper JB (1998). Diarrheagenic Escherichia Coli. Clin. 

Microbiol. Rev., 11(1): 142-201. 

Nurhajati JS, Indrawati I, Syaftika N (2008). Soyghurt Antibacterial 

Activity Both Single Culture and Mixed Culture of Lactobacillus 

bulgaricus and Streptococcus thermophillus According Incubation 

Time on Several Species of Bacteria Bacteria Causing Diarrhea. 

(Thesis) (Microbiology Laboratory, Department of Biology, 

Padjadjaran University Documentation). pp: 20. 

Nurhajati JS, Nurhidayat N, Annis D, Rachmawati R (2009). Selection of 

Lactobacillus genus probiotic bacteria characterization from kuweni 

manggo (Mangifera odorata G.) based on Mannose Specific Adhesin 

(MSA) gene expression and acitivity. (Thesis) (Microbiology 

Laboratory, Department of Biology, Padjadjaran University 

Documentation), pp: 58-60. 

Rüttler ME, Yanzón CS, Cuitiño MJ, Renna NF, Pizarro MA, Ortiz AM 

(2006). Evaluation of multiplex PCR method to detect 

enteroaggregative Escherichia coli. Biocell. 30(2): 301-308. 

Surono IS (2004). Fermented Milk Probiotic and Healthcare. YAPMMI. 

Jakarta: pp. 1-252 

Todar K (2008). Bacterial structure in relationship to pathogenicity: The 

importance of the bacterial surface. http://www.textbookof 

bacteriology.net University of Wisconsin-Madison Department of 

Bacteriology. Pp. 1-4. 

Trabulsi LR, Keller R, Gomes TAT (2002). Typical and atypical 

enteropathogenic Escherichia coli. Emerg. Infect. Dis., 8(5): 508-513. 

Viromed (2012). HEp-2 Cell Lines. http://www.viromed.com/ 

service/product/hep2.com. 

Winarno FG (1993). Food nutrition,technology and consumer. PT. 

Gramedia Pustaka Utama. Jakarta: p. 238. 

Zhong SS, Zhang ZS, Wang JD, Pan LJ (2004). Competitive inhibition 

of adherence of enterotoxigenic Escherichia coli, entero-pathogenic 

Escherichia coli and Clostridium difficile to intestinal epithelial cell line 

lovo by purified adhesin of Bifidobacterium adolescentis 1027. World 

J. Gastroenterol., 10(11): 1630-1633.

African Journal of Microbiology Research Vol. 6(24) pp. 5147-5152, 28 June, 2012 


DOI: 10.5897/AJMR11.1242 



The occurrence of Bacillus thuringiensis strains in 

chemical intensive rice growing ecosystem 

P. Kannan 1 , R. Xavier 1 , R. Josephine 1 , K. Marimuthu 1 , S. Kathiresan 1 and S. Sreeramanan 2 * 

1 Department of Biotechnology, Faculty of Applied Sciences, AIMST University, Malaysia. 

2 School of Biological Sciences, Universiti Sains Malaysia (USM), Penang, Malaysia. 

Accepted 13 January, 2012 

Sustainable crop production is largely depended on the efficient crop protection measures. Use of 

synthetic chemicals though seemed to be effective; in long run it proved to be detrimental to the 

biosphere. Rice being the major stable food of Asians received much attention on improving the 

productivity. In the present investigation, native Bacillus thuringiensis (Bt) isolates were isolated in the 

chemical intensive rice growing ecosystem. The isolation of Bt from the soils of rice fields indicated the 

ability of Bt to survive under chemical stress. Since all the isolates are motile, it is presumed that these 

isolates may be virulent against different rice pests and indicated their possible role in nitrogen cycle. 

The results obtained also reveal the presence of multiple strains of Bt with varying protein profile and 

hence possibility of a broad spectrum of insecticidal activity. 

Key words: Bacillus thuringiensis, isolation, rice ecosystem. 

INTRODUCTION 

Sustainable food production is the global concern to feed 

the tremendously increasing population from a declining 

acreage of farm lands. Plant health is one of the major 

contributing factors which decide the quantum of crop 

production. Pests and diseases are the prime limiting 

factors for sustainable rice production, particularly the 

yellow stem borer (Scirpophaga incertulas), the striped 

stem borer (Chilo suppressalis) and the leaf folder 

(Cnaphalocrosis medinalis) (Ye et al., 2009). Synthetic 

chemicals though seemed to be effective, have become 

the cause of insect resistance, resurgence and 

environmental contamination. Logically the introduction of 

naturally occurring native Bacillus thuringiensis (Bt) 

strains as one of the armour in the rice integrated pest 

management (IPM) will help in the sustainable rice 

production. 

B. thuringiensis (Bt) is a Gram-positive, spore-forming 

soil bacterium, produces crystalline inclusions 

concomitantly during sporulation. These crystal proteins 

are highly toxic to a number of insects belonging to 

*Corresponding author. E-mail: sreeramanan@gmail.com. 

different orders including Lepidoptera (Cohen et al., 

2000). The crystal proteins are highly target specific and 

are harmless to the non-target organisms including 

humans and other vertebrates. Bt had been isolated from 

different environments including phylloplane (Smith and 

Couch, 1991), herbivorous farm animal faeces 

(Maheswaran et al., 2010) grain storage facilities, 

sericulture and from crop growing farm lands (Xavier et 

al., 2007) and the entomocidal potency of these new Bt 

isolates had been demonstrated. However, there have 

been no much investigations to isolate B. thuringiensis 

strains from chemical intensive rice ecosystem. The 

results of our study indicated the presence of more than 

one strain of Bt in the high chemical stress condition. This 

novel result suggests possible pesticide degrading 

potential of the Bt isolates, which can be considered one 

of the viable solution to overcome the problem of 

chemical persistence in soil. Globally there has been a 

renewed surge in the isolation and characterization of 

native strains of Bt for the following reasons: 

1. It is presumed that the native Bt strains may exhibit a 

better entomocidal activity toward the target species, 

because of prolonged habitation and adaptation in the


particular environment. 

2. To understand the diversity and predominance of 

different strains of Bt with varying cry gene content. 

3. To study the biological role of non-insecticidal crystal 

proteins produced by certain naturally occurring Bt 

strains. 

4. Periodical introduction of native strains of Bt with novel 

activities will serve as a tool to manage insect resistance. 

5. The new strains of Bt develop through evolutionary 

process, may harbor novel cry genes, that may be 

gainfully used in the development of insect resistant 

plants. 

Hence the present study is aimed at investigating the 

occurrence and distribution of native B. thuringiensis in 

the chemical intensive rice growing fields. 


Sample collection 

Soil samples were collected from different rice fields in the State of 

Kedah Darul Aman, Malaysia. To our knowledge, these fields had 

not been previously treated with Bt based bio-pesticides, thus it is 

likely that commercial strains of Bt were an artefact in this study. 

Samples were collected by scrapping off the surface material with a 

sterile spatula and collecting approximately 30 g sample 2 to 5 cm 

below the surface in sterile plastic bags. Samples were transferred 

to the laboratory and stored at 4°C until further processing. 

Isolation of B. thuringiensis from soil 

Approximately 10 g of soil was ground to powder using a sterile 

paper. A modified version of temperature selection method was 

used to isolate B. thuringiensis from the soil samples (Xavier et al., 

2007). Briefly, the powered sample was added to 100 ml of sterile 

distilled water and homogenized in an orbital shaker (200 rpm) for 4 

h at room temperature. After complete homogenization, 1 ml aliquot 

was taken and heated at 80°C for 15 min in a pre-warmed 6 ml 

glass test tube to kill or inactivate all the vegetative forms. The heat 

shocked aliquots were serially diluted to 10 -7 and plated on nutrient 

agar and incubated overnight. Bacillus-like colonies were randomly 

picked, subcultured on nutrient agar and maintained for further 

investigation. 

Coomassie brilliant blue (CBB) staining 

A straight inoculating wire was used to transfer an aliquot of the 

sporulated colony on to a microscopic slide. The slide was then 

heat fixed and stained (0.133% Coomassie Brilliant Blue stain in 

50% acetic acid), rinsed with distilled water, dried and observed 

under light microscope using 100 × oil immersion objective 

(Rampersad and Ammons, 2002). The presence of parasporal 

bodies were clearly observed as dark –blue staining objects. 

Motility test 

Motility of B. thuringiensis isolates were tested by the growth 

pattern on nutrient agar plates. The isolates were streak-inoculated 

onto the middle of the agar plate from top to bottom and incubated 

overnight at 30°C. If a colony was to spread out from the inoculation 

site, the strain was scored as motile; otherwise it was scored as 

non-motile (Frederiksen et al., 2006). 

Nitrate reduction assay 

This assay was conducted to determine the ability of B. 

thuringiensis isolates to reduce nitrate to nitrite. The procedures 

followed were as indicated by the manufacturer (Becton, Dickinson 

and Company, USA). B. thuringiensis isolates were grown in nitrite 

broth for 24 h at 37°C. To this broth, the Nitrate A and B reagents 

were added in equal proportions. The medium will turn pink or red if 

the organism is nitrate positive. The reaction indicates the ability of 

the organism to reduce nitrate (NO3) to nitrite (NO2). The absence 

of colour development either to pink or red indicates that the 

isolates are negative to nitrate test. The addition of Nitrate C 

reagent (zinc dust) to the broth is used to detect the unreduced 

nitrate. In the presence of unreduced nitrate, zinc dust will turn the 

medium pink or red. 

Protein profiling by SDS-PAGE 

The protein profiles of the B. thuringiensis isolates were determined 

through sodium dodecyl sulfate-polyacrylamide gel electrophoresis 

(SDS-PAGE) (Laemmli, 1970). The bacterial isolates were grown 

on nutrient broth. When 90% of the cells are lysed the culture was 

harvested. This spore-crystal mixture was thoroughly washed with 1 

M NaCl for three times by centrifugation at 12,000 g for 10 min. The 

pellet was resuspended in distilled water in an eppendorf tube. The 

total protein concentration was estimated by Bradford method 

(Bradford, 1976). The samples were boiled for 10 min in 5 × sample 

solubilising buffer and loaded onto 10% SDS-polyacrylamide gel. 

Upon completion of electrophoresis the gels were stained with 

Coomassie Brilliant Blue R250 [50% (v/v) ethanol, 10% (v/v) acetic 

acid and 0.1% Coomassie Brilliant Blue dye] for 1 h for complete 

staining. The excess stain was removed by destaining with a 

solution containing 6.75% (v/v) glacial acetic acid and 9.45% (v/v) 

ethanol for 2 to 3 h on a rocker. The molecular mass of proteins 

was determined by comparison with protein standards. 

Transmission electron microscopy 

The B. thuringiensis isolate S1 was grown in nutrient broth until 

sporulation. The sample was subjected to negative staining to 

observe the morphological features of the isolate. A drop of the 

culture to be examined was placed on a carbon film coated with 

400 mesh copper grid. After 1 to 3 min, the droplet was wicked to 

dryness using pieces of filter paper. After a minute, a drop of the 

negative stain solution (2% methylamine tungstate) was added to 

the surface of the grid. After complete drying the grid was examined 

with transmission electron microscope (Philips CM12 equipped with 

an analysis Document Version 3.2 image analyse system). 

RESULTS 

Colony morphology 

The colony morphology of B. thuringiensis and Bacillus 

cereus cannot be distinguished. Therefore colonies 

showing the typical morphology of B. cereus were 

selected. The fully developed colonies are round, white, 

with regular margins exhibiting identical colony

Bacillus colony 

Fig 1. Colony morphology of Bacillus thuringiensis isolate S3 

Figure 1. Colony morphology of B. thuringiensis 

isolate S3. 

Fig 1. Colony morphology of Bacillus thuringiensis isolate S3 

Crystal 

Vegetative cell 

Spore 

Figure 2. Phase contrast microscopy of CBB stained vegetative 

and sporulated cells with crystal protein of B. thuringiensis isolate 

S1 (100 x). 

morphology as that of the wild type B. thuringiensis 

strains The organism in the Figure 1 was identified to be 

B. thuringiensis isolate S3. The next level of screening is 

to check the isolates for sporulation, an important feature 

of B. thuringiensis. The isolates are grown in nutrient 

broth, after 72 h; the culture was checked under light 

microscope. The presumptive B. thuringiensis isolates 

appear as thin slender rods in short chains, and the 

spores are seen as bright objects. 

Fig 2: Phase contrast microscopy of CBB stained vegetativ 

crystal protein of B. thuringiensis Kannan isolate et al. S1 (100 5149 x) 

Figure 3. A motile strain of B. thuringiensis isolate. 

Coomassie brilliant blue (CBB) staining of crystal 

protein 

The sporulated cultures of the isolates were subjected to 

CBB staining. The parasporal crystalline inclusions were 

stained which appear as dark blue objects (Figure 2). 

This method combines the advantage of phase contrast 

microscopy and staining the parasporal bodies. Generally 

phase contrast microscopy is commonly used to detect 

the presence of parasporal inclusion bodies in the 

environmental isolates of B. thuringiensis. CBB staining 

method offers two significant advantages over phasecontrast 

microscopy. The first, unlike phase-contrast 

microscopy, very small parasporal bodies were readily 

visible. Second, the presence of stained parasporal 

bodies were striking and instantaneously visible, much 

more so than with phase-contrast microscopy 

(Rampersad and Ammons, 2002). This method is best 

suited for preliminary screening of B. thuringiensis 

isolates. 

Motility test 

Fig 2: Phase contrast microscopy of CBB stained vegetative and sporulated cells with 

crystal protein of B. thuringiensis isolate S1 (100 x) 

Most of the Bt strains are motile by peritrichous flagellum. 

However, non-motile Bt had also been reported 

(Damgaard et al., 1997). Motility of Bt is an indirect 

indicator of virulence and biological activity of Bt strains 

(Bouillaut et al., 2005). The results of motility study 

indicated that all the Bt isolates are motile (Figure 3), 

indicating that these Bt isolates are virulent and may 

exhibit desired biological activity from the crop protection 

perspectives. 

Nitrate reduction test 

All the isolates tested for nitrate reduction test exhibited

5150 Afr. J. Microbiol. Fig 3. Res. A motile strain of B. thuringiensis isolate 

kDa 

250 

150 

100 

75 

50 

37 

Protein 

marker 

Figure 4. SDS-PAGE analysis of B. thuringiensis isolates S1 to S4. 

nitrate reduction activity. Nitrogen is one of the 

macronutrient, the deficiency of which significantly affects 

the crop production, particularly the nitrogen deficiency is 

pronounced in rice. Denitrification, the respiratory 

reduction of nitrate to gaseous products is an important 

component of nitrogen cycle, which influences the soil 

fertility. From the results it is assumed that these Bt 

isolates may play a role in biological nitrogen cycle and in 

improving the soil fertility. 

SDS-PAGE analysis of crystal proteins 

Fig 4. SDS-PAGE analysis of B. thuringiensis isolates S1 to S4 

Protein 

marker 

S5 S6 S7 

The SDS-PAGE analysis of the total protein showed a 

S1 S2 S3 S4 


kDa 

250 

150 

100 

75 

50 

37 

Figure 5. SDS-PAGE analysis of B. thuringiensis isolates S5 to S6. 


distinctly varying pattern. Despite, the similarities in the 

protein profile between isolate S6 and S7, there is a 

conspicuous absence of 27 kDa protein in S6, which is 

apparent in the isolate S7. The major protein bands in all 

the isolates ranges from approximately 120 to 145 kDa. 

Similarly, a protein in the range of 45 to 47 kDa and a 

27 kDa is noticed in all the isolates (Figures 4 and 5). 

Transmission electron microscopy 

The negative staining studies with transmission electron 

microscopy showed the rod shaped morphology and 

commencement of autolysis upon sporulation of B.

thuringiensis isolate S1 (Figure 6). 

DISCUSSION 

Figure 6. Transmission electron microscopy of B. thuringiensis isolate S1. 

There has been a worldwide search for isolation of native 

strains of B. thuringiensis that exhibit higher and broad 

spectrum entomocidal activity and Bt strains with novel 

biological activity for potential application in various fields. 

B. thuringiensis is ubiquitous in natural environment and 

most abundant in soil (Ohba et al., 2000). The present 

study investigated the occurrence of B. thuringiensis 

isolates in soils of chemical intensive rice ecosystem. 

Despite the global awareness on the environmental and 

health impact of synthetic pesticides, farmer’s world over 

continues to rely heavily on the chemical pesticides to 

protect the crops against the agricultural pests. Rice is no 

exception to this problem. To our knowledge, no previous 

studies have been undertaken to isolate Bt from a 

chemical stress rice ecosystem. The presumptive isolates 

upon Coomassie staining revealed the presence of 

protein inclusions, the insecticidal component. The SDS- 

PAGE analysis showed unique protein profile for each of 

the isolates, indicating the distribution of more than one 

B. thuringiensis strains in the rice ecosystem. Generally 

the presence of 130 to 140 kDa protein is the indication 

of anti lepidopteran activity (de Silva et al., 2004). The 

presence of approximately 140 kDa protein in S1 isolate 

is indicative of entomocidal activity against lepidopteran 

pests, which are considered to be the major pests of rice 

world over. The cry gene content of the natural Bt 

isolates exhibit wide diversity (Wang et al., 2003). Since 

Kannan et al. 5151 

the entomocidal potential of the Bt is largely depend on 

the toxins (Berry et al., 2002), the varying pattern of 

protein profile of the Bt isolated in this study, suggest the 

possible diverse spectrum of biological activity. 

Generally, Bt is a motile bacterium through peritrichous 

flagella (Ghelardi et al., 2002). However, non-motile Bt 

had also been reported (Damgaard et al., 1997). Motility 

of Bt is an indirect indicator of virulence and biological 

activity (Ghelardi et al., 2002). All the B. thuringiensis 

isolates were found to be motile which indicates the 

virulence and possible entomocidal nature of these 

isolates. Further the motility study also forms the basis for 

sera typing with flagellar antigens. The Bt isolates which 

exhibited nitrate reduction activity may play a critical role 

in nitrogen cycle and plant nutrition. Most importantly, this 

study has revealed the tolerance and sustainability of the 

B. thuringiensis isolates for chemical stress. Zeinat et al. 

(2010) reported that a Bt strain isolated from agricultural 

waste water contaminated with organophosphorus 

pesticides decomposed 91% of malathion incorporated in 

the liquid culture with in 15 days. Thus, the Bt isolates 

which can survive in the chemical rich environment may 

play the scavenging role by degrading the toxic 

xenobiotics in the rice ecosystem. Further molecular 

analysis on the cry gene content and insect bioassays 

will reveal the full entomocidal potential of these Bt 

isolates, which can be harnessed to be a potent microbial 

pesticides and can also be a good candidate for 

developing transgenic plants. Moreover, periodical 

isolation and introduction of such native Bt isolates as a 

bio-pesticide will help in the insect resistance 

management and soil health management.


REFERENCES 

Berry C, O’Neil S, Ben-Dov E, Jones A, Murphy L, Quail M, Holden M, 

Harris D, Zaritsky A, Parkhill J (2002). Complete sequence and 

organization of pBtoxis, the toxin-coding plasmid of Bacillus 

thuringiensis subsp. israelensis. Appl. Environ. Microbiol., 68: 5082- 

5095. 

Bouillaut L, Ramarao N, Buisson C, Gilois N, Gohar M, Lereclus D, 

LeRoux CN (2005). FlhA Influences Bacillus thuringiensis PlcR- 

Regulated gene transcription, Protein Production and Virulence. Appl. 

Environ. Microbiol., 71(12): 8903-8910. 

Bradford MM (1976). A rapid and sensitive method for the quantitation 

of microgram quantities of protein utilizing the principle of protein–dye 

binding. Annal. Biochem., 72: 248-254. 

Cohen BM, Gould F, Bentur JC (2000). Bt rice: Practical steps to 

sustainable use. Int. Rice Res., 25(2): 4-10. 

Damgaard PH, Granum PE, Bresciani J, Torregrossa MV, Eilengerg J, 

Valentino L (1997). Characterization of Bacillus thuringiensis isolated 

from infections in burn wounds. FEMS Immunol. Med. Microbiol., 18: 

47-57. 

De Silva SMB, Silva Werneck JO, Falcao R, Gomes AC, Fragoso RR, 

Quezado MT, Neto OBO, Aguiar JB, de Sa MFG, Bravo A Monnerat 

RG (2004). Characterization of novel Brazilian Bacillus thuringiensis 

strains active against Spodoptera frugiperda and other insect pests. 

J. Appl. Ent., 128: 102-107. 

Frederiksen K, Rosequist H, Jorgensen K, Wilcksi A (2006). Occurance 

of Natural Bacillus thuringiensis based insecticide on fresh fruit. Appl. 

Environ. Microbiol., 72: 3435-3340. 

Ghelardi E, Celandroni F, Salvetti S, Beecher DJ, Gominet M, Lereclus 

D, Wong AC, Senesi S (2002). Requirement of flh A for swarming 

differentiation, flagellin export, and secretion of virulence-associated 

proteins in Bacillus thuringiensis. J. Bacteriol., 184: 6424-6433. 

Laemmli UK (1970). Cleavage of structural proteins during the 

assembly of head of bacteriophage T4. Nature, 227: 680-685. 

Maheswaran S, Sreeramanan S, Reena Josephine CM, Marimuthu K, 

Xavier R (2010). Occurrence of Bacillus thuringiensis in faeces of 

herbivorous farm animals. Afr. J. Biotechnol., 9(47): 8013-8019. 

Ohba M, Wasano N, Mizuki E (2000). Bacillus thuringiensis soil 

populations naturally occurring in the Ryukyus, a subtropic region of 

Japan. Microbiol. Res., 155:17-22. 

Rampersad J, Ammons D (2002). Usefulness of staining parasporal 

bodies when screening for Bacillus thuringiensis. J. Inverteb. Pathol., 

79: 203-204. 

Smith RA, Couche GA (1991). The phylloplane as a source of Bacillus 

thuringiensis variants. Appl. Environ. Microbiol., 57: 311-313. 

Wang J, Boets A, Rie JV, Ren G (2003). Characterization of cry1, cry 2 

and cry 9 genes in Bacillus thuringiensis isolates from China. J. 

Inverteb. Pathol., 82: 63-71. 

Xavier R, Nagarathinam P, Gopalakrisnan, Murugan V, Jayaraman, K 

(2007). Isolation of Lepidopteran Active Native Bacillus thuringiensis 

Strains Through PCR Panning. Asia Pacific J. Mol. Biol. Biotechnol., 

15 (7): 61-67. 

Ye R, Huang H, Yang Z, Chen T, Liu L, Li X, Chen H, Lin Y (2009). 

Development of insect-resistant transgenic rice with Cry1C-free 

endosperm. Pest Manag. Sci., 65(9): 1015-1020. 

Zeinat KM, Mohamed AA, Nashwa AF, Sherif ME (2010). Isolation and 

molecular characterization of malathion degrading bacterial strains 

from waste water in Egypt. J. Adv. Res., 1: 145-149.



DOI: 10.5897/AJMR12.022 



Development of a DNA-dosimeter system as biomarker 

to monitor the effects of pulsed ultraviolet radiation 

Myriam BEN SAID 1 *, Masahiro OTAKI 2 , Shinobu KAZAMA 2 and Abdennaceur HASSEN 1 

1 Water Treatment and Recycling Laboratory (LTRE); Water Research and Technologies Centre (CERTE), 

BP 273, 8020 Borj-Cedria, Tunis, Tunisia. 

2 Departments of Human and Environment Sciences, Ochanomizu University, 2-1-1 Otsuka, Bunkyo-Ku, 

Tokyo 112–8610, Japan. 

Accepted 22 March, 2012 

To report the effects of pulsed ultraviolet (PUV) radiation, we have developed a reliable biological 

monitoring system based on two approaches. Firstly, a conventional method was used to measure the 

number of colonies by the estimation of viable and cultivable bacteria before, and after each exposure 

to PUV radiation. The second method was a DNA-dosimeter system based on polymerase chain 

reaction (PCR) 16S ribosomal DNA (rDNA) and on terminal restriction fragment length polymorphism (T- 

RFLP) analysis. PCR was performed using 27F and 905R primers to replicate a fragment of the 

rDNA gene. The comparison of inactivation kinetic results obtained by a classic account of viable and 

cultivable bacteria (UV dose/ response) and the analysis of DNA-dosimeter determined by PCR 

amplification and peak-profiles T-RFLP; shows a correlation between the reduction of the colonyforming 

ability of Pseudomonas aeruginosa and the progressive decrease of 16S rDNA PCR products 

and of relative peak area of a specific terminal restriction fragment (T-RF). 

Key words: Pulsed UV light, Pseudomonas aeruginosa, viable but non-culturable (VBNC) bacteria, 16S rDNA, 

terminal restriction fragment length polymorphism (T-RFLP). 

INTRODUCTION 

The light generated by pulsed ultraviolet (PUV) lamps 

consists of a continuous broadband spectrum from deep 

UV to the infrared (IR), especially rich in UV range below 

400 nm, which is germicidal. In PUV light system, UVlight 

is pulsed several times per second and each pulse 

lasts between 100 ns and 2 ms (Sharifi-Yazdi and 

Darghahi, 2006). 

PUV light is a non-thermal, high-peak power 

technology that consists of intense flashes of broadspectrum 

white light with wavelengths from 200 nm in the 

UV to 1000 nm in the near-IR region (Rowan et al., 

1999). 

Each pulse may have up to 90000 times the intensity of 

sunlight at sea level, and may last only a few hundred 

*Corresponding author. E-mail: myriam_rebia@yahoo.fr. 

millionths of a second, and thus a PUV light system can 

produce very high peak power pulsed light in a very short 

time. Because of its high peak power, PUV light has been 

successfully used as a sterilization tool to kill bacteria and 

fungi in foods (Bialka et al., 2008) and water (Sharifi- 

Yazdi and Darghahi, 2006). The killing effect is 4 to 6 

times higher than that of the conventional continuous UV 

light at the same energy level (MacGregor et al., 1998). 

The wavelength for UV processing ranges from 200 to 

280 nm, called the germicidal range, since it effectively 

inactivates the microorganisms. The effectiveness of 

germicidal UV light in biological inactivation arises 

primarily from the fact that DNA molecules absorb UV 

photons between 200 and 300 nm, with peak absorption 

at 254 nm (Ben Said et al., 2011). This absorption 

creates damage in the DNA by altering nucleotide base 

pairing; thereby creating atypical linkages between 

adjacent nucleotides on the same DNA strand. This


damage occurs particularly between pyrimidine bases 

that result in an inhibition of replication and, in case of 

lethal doses, in a loss of reproducibility. However, 

microbes possess several mechanisms to enable cell 

survival following UV exposure. 

Two well known types of mutagenic lesions in UV 

irradiated DNA were determined; Cyclobutane Pyrimidine 

Dimers (CPDs) formed between the C-4 and C-5 

positions of adjacent thymidine or cytosine residues, and 

pyrimidine (6–4). Pyrimidine (6–4) photoproducts formed 

between the C6 and C4 position of adjacent pyrimidine 

residues, most often between T-C and C-C residues 

(Douki et al., 2003). 

However, UV disinfection is noted to have some 

problems, one of them is reactivation. In fact, to a certain 

extent, DNA damage can be tolerated by the cell until 

repair occurs (Zimmer and Slawson, 2002). The 

mechanism by which, microorganism recovers replication 

activity; through a direct reversion of thymine dimers is 

called photoreactivation (Douki et al., 2003). This process 

is catalysed by the DNA repair enzyme photolyase and 

requires visible light. Apart from photoreactivation, 

numerous light-independent repair mechanisms exist that 

are regulated by the expression of the single-strand DNA 

binding protein RecA (Makarova et al., 2000). 

The aim of this study was to monitor the effectiveness 

of PUV light to inactivate tested bacteria using two biodosimetry 

approaches: (i) study of bacterial response to 

an increasing number of PUV irradiation (dose/response); 

(ii) use of PCR assay amplified a 16S rDNA fragment and 

T-RFLP analysis of PCR products and (iii) compare 

between results obtained by classic and molecular biodosimetry 

techniques. 


Bacterial strains 

Pseudomonas aeruginosa used in this study was obtained from 

American Type Culture Collection (ATCC 15442). Cultures were 

grown in Luria-Bertani broth (LB) [10 g tryptone; 5 g yeast extract; 

10 g NaCl] or LB agar (LBA) (10 g tryptone; 5 g yeast extract; 10 g 

NaCl 15 g/L agar). Saline [0.85% (wt/vol) NaCl] was used for cells 

suspensions during UV irradiation. 

PUV radiation 

The PUV system is developed by the combination with power and 

flash UV lamp technology. PUV light was differed from the 

traditional continuous UV light by the much higher irradiance of UV 

illumination and reduction of exposure time. Indeed flash lamps 

commonly operate with pulse lengths ranging from a few tens of 

milliseconds to over milliseconds. 

UV irradiation for polychromatic UV source (UV pulse lamp) was 

measured using a potasium iodide/iodate actinometry (KI/KIO3) 

according to Rahn et al. (2003).For this study, UV dose determined 

by chemical actinometry was equal to 5.72 mJ/cm 2 per UV-pulse. 

In order to reduce the photo-thermal effect of PUV light due to 

visible light and IR, the PUV system was equipped with a 

ventilator. 

UV-irradiated bacteria 

For dose/response relationship and reactivation experiments, the 

strain of P. aeruginosa was cultured in Luria-Bertani broth (LB). 

Bacterial suspension was diluted in saline Phosphate Buffer (PBS) 

in order to obtain a concentration ranged from 1 x 10 5 to 1 x 10 6 cfu/ 

ml. Then, the bacterial suspensions were used for irradiation 

experiments. A volume of 20 ml of the prepared suspensions was 

transferred into a standard Petri dish for the eventual exposure to 

an increasing number of PUV-light. 

Viable cell counts 

Viable cell counts were taken before and immediately after UV 

exposure. A 100 µl portion of each irradiated samples was removed 

in order to prepare serial dilutions in PBS buffer. A volume equal to 

100 µl of the appropriate serial dilutions was spread in duplicate 

onto LB agar. The number of colony-forming unit (CFU/ml) or a 

number of viable and cultivable bacteria was determined after 24 h 

of incubation at 37°C. The fraction of viable and cultivable bacteria 

was calculated by dividing the number of CFU in the UV-treated 

sample (N) by the number of CFU determined at time zero before 

UV irradiation (N0). 

DNA extraction from P. aeruginosa 

The genomic DNA of P. aeruginosa was extracted immediately 

before and after irradiation by different doses of UV-C light and 

after rest times conditions the DNA extraction using DNA extraction 

kit UltraClean_Soil DNA TM Isolation Kit (Mo Bio Laboratories, Int., 

Carlsbad, CA) following the manufacturer’s instructions. The 

quantity and quality of the DNA were checked by agarose gel 

electrophoresis (1%, w/v) in TAE buffer. The image of the stained 

gel was photographed (Gel Doc 1000; Bio Rad) and analysed 

(Molecular Analyst software; BioRad). 

PCR conditions 

For 16S rDNA amplification, the universal bacterial primer set with 

27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 905R (5'- 

CCGTCAATTCATTTGAG-3’) primers was used (Kasuga et al., 

2007). The 5’ end of forward primer (27F) was labeled with a 6carboxylfluorescein-derived 

phosphoramidite fluorochrome (6- 

FAM). PCR amplification was conducted in triplicate by using an 

AmpliTaq Gold DNA polymerase kit (Applied Biosystems, Foster 

City,CA). The termal cycling conditions consisted of initial heat 

denaturation at 95°C for 10 min, followed by 30 cycles of 

denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and 

extension at 72°C for 2 min. A final extension was then performed 

at 72°C for 10 min. The amplified rDNA were quantified using a 

NanoDop� ND-1000 spectrophotometer (NanoDop Technologies, 

Wilmington, DE). 

T-RFLP analysis 

The triplicate PCR products for each irradiated samples were mixed 

and purified using a MinElute PCR Purification kit (QIAGE, Hilden, 

Germany). The DNA concentration was quantified using a 

NanoDop� ND-1000 spectrophotometer (NanoDop Technologies, 

Wilmington, DE).

Figure 1. The Kinetic of P. aeruginosa ATCC 15442 inactivation following exposure to UV-C 

radiation according to the model of Chick-Watson where; y: Reduction = N/N0 with N0: Number of 

viable cell before exposure to UV light, N: Number of viable cell after exposure to UV-C radiation; x 

= I n Ʈ with I: UV intensity (mW/cm 2 ), Ʈ: Number of PUV light; n = 1. Where error bar are not shown, 

differences between duplicates were not detected. 

Restriction enzyme digestion was conducted in triplicate. The 

PCR products were digested with 10 U of the tetrameric restriction 

enzyme HhaI (TaKaRa BIO Inc., Otsu, Japan) in a 20 µl volume 

according to the manufacturer’s instruction. The digested products 

were purified using a QIAquick Nucleotide Removal Kit (QIAGEN). 

The 6-FAM-labeled fragments were analysed with an ABI Prism� 

310 Genetic Analyser (Applied Biosystems). Fragment analysis was 

carried out by using GeneMapper TM v3.0 software (Applied 

Biosystems). The detection threshold for terminal-restriction 

fragments (T-RFs) was set to 100 relative fluorescent units (RFU) 

for the software. Relative abundance of T-RFs was calculated 

based on their peak area. 

RESULTS 

The inactivation kinetic of P. aeruginosa 

The inactivation rate of P. aeruginosa was function of UV- 

C dose. The germicidal dose was expressed as the 

product of UV radiation intensity (I) and number of PUV 

light (Ʈ) (Figure 1). 

The lethal effects of pulsed light can be attributed to its 

rich broad-spectrum UV content, its short duration, and 

high peak power, which play a major role in bacterial 

inactivation (Sharifi-Yazdi and Darghahi, 2006). Indeed 

the UV region is crucial to the efficiency of PUV light 

treatment. It has been confirmed that no killing effect is 

achieved if a filter is included to remove the UV 

wavelength region below 320 nm (Takeshita et al., 2003). 

UV dose-response 

N/NO= 1.204e -0.76 Ʈ 

R2= 0.988 

Said et al. 5155 

In order to study the behavior or the response of tested 

bacteria to an increasing UV dose (dose/response), the 

mathematical model of Chick-Watson was used 

according to Hassen et al. (2000): 

N/N0 = A exp (- kI n Ʈ) (1) 

Where, N0: Number of viable cultivable bacteria before 

exposure to UV light; N: Number of viable cultivable 

bacteria after exposure to PUV light; A: constant 

corresponding to bacteria retaining viability following UV 

irradiation; K: Coefficient of lethality; I: The UV-C intensity 

expressed in mW/cm 2 ; Ʈ: number of UV pulse and n: 

Threshold level of series-event mode; n = 1 for the first 

order Chick-Watson model. The constants K and A were 

determined by linear regression. 

The inactivation kinetic (dose/response) according to 

the model of Chick-Watson (Equation 1) shows that the 

irradiation of P. aeruginosa by 8 UV pulses is sufficient 

for 99.99% inactivation of colony-forming ability, which 

corresponds to a UV dose equal to 45.76 mJ.cm -2 . This 

UV dose is nearest of the UV fluency generally used in 

Europe and the USA for the disinfection of drinking water. 

Indeed, according to the literature, 40 mJ.cm -2 is enough 

to inactivate 4 Unit-log10 of pathogenic bacteria as 

Legionella, enteric viruses, Cryptosporidium oocysts and


Figure 2. Agarose gel electrophoresis of PCR products generated from irradiated P. aeruginosa 

with the primer set 27F and 905R. Image of a 1% agarose gel stained with ethidium bromide. 

With, L: 100bp ladder; +C: positive control, Ʈn: Number of PUV light. 

Giardia cysts (US-EPA, 2003). 

By the analysis of irradiated P. aeruginosa kinetic 

curve, we can conclude that 8 UV pulses were sufficient 

to inactivate 99.99% of viable and cultivable bacteria 

according to a conventional applied dose. 

At this stage of research, the question is the equivalent 

UV dose equal to 8 UV pulses effective or not for 

inactivating bacteria at molecular level? 

To answer this question, and to predict biologically 

effective of applied UV doses, DNA dosimeter system 

based on 16S rDNA PCR amplification and T-RFLP 

analysis were used to monitor effects of PUV radiation. 

PUV light DNA dosimeter 

Based on UV-inactivation’s kinetic curve of P. 

aeruginosa, the tested bacteria were exposed to 8, 12, 

and 18 UV pulses. Applying these doses resulted in the 

inactivation of 99.99% inactivation of bacteria, where the 

loss of cultivability of tested bacteria was with or without 

subsequent reactivation. Moreover, the bacteria to a 

higher number of UV pulses (25, 30, and 35 UV pulses) 

were exposed in order to explore the effects of PUV 

irradiation on bacterial DNA at a sub-lethal doses. 

DNA dosimeter analyzed by polymerase chain 

reactions (PCR) 

The study of DNA-dosimeter was obtained by the 

analysis of 16S rDNA PCR products for the same tested 

bacteria and for different irradiation conditions using 27F 

and 905R primers. The amplified fragments were to be 

approximately 1500 base pairs long (Figure 2). 

PCR inhibition was detected already by agarose gel 

electrophoresis prior to T-RFLP analysis to check the 

size of the PCR products (Figure 2). An intense band was 

visible for the unirradiated sample and irradiated samples 

with a low PUV. The signal strength of the band was 

reduced directly after irradiation (8 UV-pulses). 

During PCR amplification, primers and Taq polymerase 

across different obstacles (photoproducts) conducts 

continual disruption of PCR amplification in function of an 

increase number of PUV light. 

The comparison between UV dose /response and 

DNA dosimeter 

The comparison of inactivation kinetic obtained by a 

classic account of viable and cultivable bacteria (Figure 

1) and the analysis of DNA-dosimeter determined by 

PCR amplification (Figure 2) shows in part, the relationship 

between the progressive decrease of PCR products 

and the reduction of the colony-forming ability of P. 

aeruginosa. 

The exploitation of DNA-dosimeter determined by 16S 

rDNA PCR of P. aeruginosa was obtained by the analysis 

of PCR products using Molecular Analyst software 

(BioRad), by which a fluorescence intensity area (FIA) of 

stained DNA bands was determined, with ethidium 

bromide (Figure 3). 

According to the first used bio-dosimetry system 

(dose/response), 8 UV pulses were sufficient to inactivate 

99.99% of viable and cultivable bacteria. This number of 

UV pulses can allow the inhibition of nearly 35% of 16S 

rDNA amplification in vitro by PCR using 27F and 905R 

primers and Taq polymerase for DNA extension (Figure 

3). Despite the partially inhibition of PCR amplification, 

nearly 65% of amplified 16S rDNA can be ensured in 

vitro. This percentage revel that, the equivalent dose of 8 

UV pulses allows the inhibition of 99.99% of bacterial 

cultivability in usual media, but not the DNA replication, 

and thereby, bacterial viability and toxicity. 

We can conclude that, the information obtained 

restrictively from the simple count of viable and cultivable 

bacteria is incomplete. Indeed, some bacteria lose the 

cultivability on appropriate growth media but can exhibit 

signs of metabolic activity and thus viability (Armisen and

Figure 3. DNA-dosimeter determined by fluorescence intensity area (%) of PCR products of P. aeruginosa using 

27F and 905R primers. 

Servais, 2004). The presence of these viable but nonculturable 

(VBNC) bacteria in natural environment could 

be important from a sanitary point of view as some 

authors (Ben Said et al., 2010; Servais et al., 2009; 

Pommepuy et al., 1996) suggested that pathogenic 

VBNC bacteria could maintain their virulence being a 

potential reservoir of disease. 

In addition, after irradiation by 12 UV pulses (� 68 

mJ.cm -2 ), nearly 48% of 16S rDNA could be amplified 

(Figure 3). This percentage shows the ability of viable but 

non cultivable bacteria not yet reactivated to ensure DNA 

replication and bacteria resuscitation. However, when the 

number of UV pulses were increased over 12 pulses, a 

significant inhibition of PCR amplification was shown for 

consequent accumulation of photoproducts generated by 

germicidal wavelengths of PUV light. In fact, UV-induced 

DNA lesions such as CPDs show differential effects on 

DNA conformation, impairing their regulatory functions 

and other dynamic processes. Their UV-DNA effects 

have a repercussion on DNA replication in vitro using 

PCR. Thus, an increasing number of PUV light can cause 

mutations in the primer binding sites on the template 

strand or a blockage of extension step assumed by Taq 

polymerase. Noted that, the inhibition of rDNA 

amplification for post-irradiated strain in vitro is similar to 

what is going in vivo at bacterial DNA level during 

replication and transcription. 

y= 114.7e -0.06Ʈ 

R 2 = 0.923 


PUV light DNA dosimeter analyzed by “peak-profiles 

T-RFLP” 

A semi-quantitative molecular technique was developed 

for rapid analysis of PUV light effects on rDNA 

amplification. The technique employed PCR in which one 

of the two primers used was fluorescently labeled at the 

5' end, and was used for genes encoding 16S rDNA from 

total community DNA of unirradiated and irradiated P. 

aeruginosa. The PCR product was digested with 

restriction enzymes, and the fluorescently labeled 

terminal restriction fragment was precisely measured by 

using an automated DNA sequencer (Kasuga et al., 

2007). 

Figure 4 shows the electropherograms of 16 rDNA T- 

RFLP profiles before and after each irradiation by PUV 

light. 

The analysis of terminal restriction fragment length 

polymorphisms 

Computer-simulated analysis of terminal restriction 

fragment length polymorphisms (T-RFLP) for UV-post 

irradiated P. aeruginosa sequences showed that with 

proper selection of PCR primers (27F and 905R) and 

restriction enzyme (HhaI) (Figure 4), there is no


Relative Fluorescence Unit 

Terminal Restriction Fragment 

12 UV pulses 

18 UV pulses 

Figure 4. Electropherograms of T-RFLPs of HhaI digested 16S rDNA amplified from unirradiated and irradiated P. aeruginosa ATT15422 by an increasing number of PUV light.

Relative Fluorescence Unit 

Figure 4. Contd. 

Terminal Restriction Fragment 


25 UV pulses 

30 UV pulses


1.4 

1.2 

1 

0.8 

0.6 

0.4 

0.2 

0 

Figure 5. Relative peak area of T-RFs of irradiated P. aeruginosa ATT15422 by an increasing 

number of PUV light. 

difference in terminal restriction fragment (T-RF) sizes; 

Indeed, all profiles consisted of identical and single T-RF 

nearly 148 pb (� 1pb); however, some of T-RF had 

different peak area. Relative peak area (RPA) was 

calculated in percentage by dividing peak signal 

determined for the irradiated bacteria by the total signal 

determined for the control test before UV irradiation 

(Urakawa et al., 2000). The measure of relative peak 

area or relative peak height was presented in Figure 4. 

The difference in “peak-profiles T-RFLP” was probably 

due to the interruption of PCR steps. This partial or 

complete interruption of PCR amplification was 

directlyrelated to the applied number of PUV light (Figure 

5). 

We can model the results of DNA-dosimeter 

determined by T-RFLP analysis according to Chick- 

Watson model with modification: 

RPAƮ/ RPAƮ0 = ACPD exp (- ki Ʈ) (2) 

With, RPAƮ0: RPA calculated at time zero before UV 

irradiation; RPAƮ: RPA calculated after irradiation by a 

number (Ʈ) of PUV light; ki: inhibition coefficient of a 

specific terminal restriction fragment (T-RF); and ACPD: 

photoproduct accumulation rate. 

T-RFLP technique was based on the determination of 

relative peak area of terminal restriction fragments (T- 

RFs) generated by a restriction enzyme after PCR step. 

For consequence, by T-RFLP analysis we can “zoom” the 

effects of PUV light on bacterial DNA. 

In addition, after irradiation by PUV light, there was a 

Y= 2.073e -0.58Ʈ 

R 2 = 0.969 

decrease of a relative peak area (RPAƮ) of the specific T- 

RF for irradiated DNA (Figures 4 and 5). For instance, 

after irradiation by 8 pulses UV light and inactivation of 

99.99% of viable and cultivable bacteria; the relative peak 

area of T-RF is equal to 64% compared to the relative 

peak area determined for P. aeruginosa at time zero 

before UV irradiation. 

Moreover, after 12 UV pulses; the RPAƮ (%) is equal to 

43% of the single T-RF comparing to RPAƮ0 at time zero 

before UV irradiation. According to the inactivation kinetic 

of tested bacteria (Figure 1), this applied dose allowed 

the loss of bacteria cultivability in usual media with 

subsequent reactivation. 

Also, the persistence of a specific T-RF despite the 

increasing irradiation by a PUV light shows a higher 

intrinsic resistance of studied P. aeruginosa against UV 

irradiation. The disappearance of T-RF was shown after 

30 UV pulses (Figure 4). 

The relatively abundance of bacteria in irradiated 

samples given by DNA-dosimetry results, strengthens the 

existence of different “bacterial viability form” among the 

same irradiated bacteria. Indeed, the single T-RF can 

include viable but non cultivable (VBNC) bacteria not yet 

reactivated, active but non cultivable (ABNC) bacteria 

and, VBNC-UV inactivated bacteria. This fact was not 

taken into consideration in the classical evaluation 

method. 

Accordingly, the application of DNA-dosimetry to 

estimate the effectiveness of UV disinfection and the 

relative abundance of bacteria before and after treatment 

of water was shown to be useful.

Conclusion 

The public health risk is thus not only a function of the 

abundance of the microorganism’s contaminants in 

water, but also of their capacity to survive in the receiving 

environments to maintain their virulence (Ben et al., 

2010). It would be pertinent to take into consideration at 

the same time the effectiveness of the disinfection 

system process and to develop sensible techniques such 

as molecular methods in order to compare survival of the 

bacteria upstream and downstream the disinfection 

system and to study the infectivity and the virulence of 

the microorganisms treated by UV light (continuous UV 

radiation or PUV light). 

In addition, the DNA- dosimeter based approach 

presented is a promising tool for biological risk assessment 

during UV-based technical processes. It directly 

records the response of bacteria to UV radiation 

independently of cultivability in usual media. 

The DNA-dosimetry methods should be standardized to 

provide accurate estimation of water quality instead of 

bio-dosimetry which is based only on the determination of 

viable and cultivable bacteria after UV treatment. 


This study was done with the collaboration of the 

Department of Urban Engineering in the University of 

Tokyo, and the Department of Water Supply Engineering 

in National Institute of Public Health (NIPH), Japan. 

REFERENCES 

Armisen TG, Servais P (2004). Enumeration of viable E. coli in rivers 

and wastewaters by fluorescent in situ hybridization. J. Microbiol. 

Meth., 58:269–279. 

Ben Said M, Masahiro O, Hassen A (2011). Use of lytic phage to control 

Salmonella typhi’s viability after irradiation by pulsed UV light. Ann. 

Microbiol., 62:107-11. 

Ben Said M, Masahiro O, Kasama S, Hassen A (2010). Detection of 

active Escherichia coli after irradiation by pulsed UV light using a Qβ 

phage. AJMR, 4 (11): 1128-1134. 

Bialka KL, Demirci A, Puri VM (2008). Modeling the inactivation of 

Escherichia coli O157:H7 and Salmonella enterica on raspberries 

and strawberries resulting from exposure to ozone or pulsed UV-light. 

J. Food Eng., 85(3):444–449. 

Douki T, Laporte G, Cadet J (2003). Inter-strand photoproducts are 

produced in high yield within A-DNA exposed to UVC radiation. 

Nucleic Acids Res., 31(12): 3134-3142. 

Hassen A, Mahrouk M, Ouzari H, Damelincourt J (2000). UV 

disinfection of treated waste water in a large-scale pilot plant and 

inactivation of selected bacteria in a laboratory UV devise. Elsevier 

science., J. Bite, 1464: 1-10. 


Kasuga I, Shimazaki D, Kunikune S (2007). Influence of backwashing 

on the microbial community in a biofilm developed on biological. 

Water Sci. Technol., 55 (8-9):173-80. 

MacGregor SJ, Rowan NJ, Macllvaney L, Anderson JG, Fouracre RA, 

Farish O (1998). Light inactivation of food-related pathogenic bacteria 

using a pulsed power source. Lett. Appl. Microbiol., 27:67–70. 

Pommepuy M, Butin M, Derrien A, Gourmelon M, Colwell RR, Cormier 

M (1996). Retention of enteropathogenicity by viable but 

nonculturable Escherichia coli exposed to seawater and sunlight. 

Appl. Environ. Microbiol., 62: 4621-4626. 

Rahn RO, Bolton JR, Goren E, Shaw PS, Lykke KR (2003). Quantum 

yield of the iodide-iodade chemical actinometer: dependence on 

wavelength and concentration. Photochem. Photobiol., 78:146–152. 

Rowan NJ, MacGregor SJ, Anderson JG, Fouracre RA, Macllvaney L, 

Farish O (1999). Pulsed-light inactivation of food-related 

microorganism. Appl. Environ. Microbiol., 65(3):1312–1315. 

Servais P, Prats J, Passerat J, Garcia-Armisen T (2009). Abundance of 

culturable versus viable Escherichia coli in freshwater. Canadian J. 

Microbiol., 55(7):905-909 

Sharifi-Yazdi MK, Darghahi H (2006). Inactivation of pathogenic 

bacteria using pulsed UV-light and its application in water 

disinfection. Acta. Med. Iran, 44:305–308. 

Takeshita K, Yamanaka H, Itoh M (2003). Damage of yeast cells 

induced by pulsed light irradiation. Int. J. Food Microbiol., 85:151– 

158. 

Urakawa H, Yoshida T, Nishimura M, Ohwada K (2000). 

Characterization of Depth-Related Population Variation in Microbial 

Communities of a Coastal Marine Sediment Using 16S rDNA-based 

Approaches and Quinone Profiling. Environ. Microbiol., 2(5):542-554. 

US-EPA (2003). UV disinfection guidance manual. EPA., 815-D-03-007. 

Zimmer JL, Slawson RM (2002). Potential repair of Escherichia coli 

DNA following exposure to UV radiation from both medium- and lowpressure 

UV sources used in drinking water treatment. Appl. Environ. 

Microbiol., 68: 3293-3299.



DOI: 10.5897/AJMR12.131 



A survey of Enterobacteriaceae in hospital and 

community acquired infections among adults in a 

tertiary health institution in Southwestern Nigeria 

Hassan A. O. 1 , Hassan R. O. 2 , Muhibi M. A. 2 and Adebimpe W. O. 3 * 

1 Medical Microbiology Department LAUTECH Teaching Hospital Osogbo, Nigeria. 

2 Haematology Department LAUTECH Teaching Hospital Osogbo, Nigeria. 

3 Community Medicine Department Osun State University Osogbo, Nigeria. 

Accepted 17 May, 2012 

Hospital and community acquired infections, continue to be a threat to public health, causing 

morbidities and mortalities. This survey was carried out to determine the prevalence of 

Enterobacteriaceae in nosocomial and community acquired infections among adults in LAUTECH 

Teaching Hospital in Osogbo southwestern Nigeria. Two hundred and forty isolates from General Out 

Patient Department (GOPD) and two hundred and forty isolates from different wards (Surgical, Medical, 

Gyneacological, Pediatric, Burn Unit and Ear, Nose and Throat wards) of the hospital were collected. 

The bacterial strains were isolated from Cerebrospinal fluid (CSF), Urine, Pus, Ear swab, Blood, Sputum 

and Pleural fluid. The isolates were identified on the basis of standard microbiological and biochemical 

techniques as describe by Cowan and Steel. The incidence of Escherichia coli, Klebsiella pneumoniae, 

Proteus mirabilis, Proteus vulgaris, Enterobacter cloacae and Citrobacter freundii was studied 

according to their distribution among different wards and nosocomial patients, specimens and age 

groups of patients. Five genera belonging to the family of bacteria Enterobacteriaceae were isolated 

from 240 community acquired infections and hospital acquired infections in different wards according 

to different age groups in this study. E. coli were most frequent in all the specimens with 49.2 and 

47.5% for urine samples in community acquired and nosocomial infection respectively. Nosocomial 

infections are common with E. coli and K. pneumoniae causing a significant proportion of these 

community acquired infections. 

Key words: Enterobacteriacae, hospital acquired, community, tertiary health institution. 

INTRODUCTION 

Hospital and community acquired infections constitutes 

serious public health problem throughout the world 

causing morbidity and mortality. Hospital acquired 

infections are generally described as infection acquired 

during hospital care or stay which was not present or 

incubating at the time of admission. This is in contrast to 

community-acquired infections which are acquired 

anywhere other than in a healthcare facility, in settings 

*Corresponding author. E-mail: lekanadebimpe@yahoo.com, 

lekanadebimpe@gmail.com. 

such as schools, exercise facilities, or any place you 

come in contact with other people or with surfaces that 

have been contaminated (Somwant et al., 2007; Coffin 

and Zaoutis, 2008). 

Several studies have however, reported a prevalence 

of hospital acquired infections between 5 and 10% 

(Somwant et al., 2007; Olawale et al., 2011; Pittet et al., 

2008). Escherichia, Klebsiella, Enterobacter, Serratia, 

Proteus and Citrobacter, genera are obligatory and 

opportunistic pathogens responsible for infections 

ranging from urinary tract, surgical wounds and lower 

respiratory tract infections (Mouton et al., 2001) among 

hospital acquired infections. Many species of these

general are members of the normal intestinal flora. 

Escherichia coli are the most common isolates reported 

from many hospital laboratories (Bello et al., 2005). 

Bacteremia is caused by Klebsiella, Enterobacter, and 

Serratia species and they are also frequently involved in 

infections with respiratory tract procedures, such as 

tracheostomy and manipulations using contaminated 

inhalation therapy equipments (Bello et al., 2005). Other 

organisms that are occasionally encountered in Urinary 

tract infections are Klebsiella, Enterobacter and Serratia 

species (Shah et al., 2002). E. coli causes approximately 

86% of urothrocystitis, about 8% of chronic bacterial 

prostatitis and up to 90% acute pyelonephritis (Guentzel, 

1995). Proteus species frequently cause infections of the 

urinary tract, surgical wounds and lower respiratory tract 

(Alli et al., 1998). Proteus mirabilis is believed to be the 

most common cause of infection – related kidney stones, 

which is one of the most serious complications of 

recurrent bacteriuria (Alli et al., 1998). Citrobacter freundii 

and C. diversus have been isolated predominantly as 

super infecting agents from urinary and respiratory tract 

infections. Citrobacter septicaemia may occur in patients 

with multiple predisposing factors; Citrobacter species 

also cause meningitis, septicemia and pulmonary 

infection in neonates and young children (Shah et al., 

2002). 

In hospital acquired pneumonias, bacteria such as 

Pseudomonas aeruginosa, Enterobacter, Klebsiella 

pneumoniae, Escherichia coli, Serratia marcescens and 

Proteus species are the most frequently isolated 

pathogens causing nosocomial infections. Pathogenesis 

can be caused by aspiration or inhalation of aerosolized 

particles containing the bacteria. Colonization of the gram 

negative bacteria in the pharynx, increased gastric pH 

and contaminated equipment are the primary source of 

pathogenesis. 

In community acquired infections, the major cause of 

urinary tract infections is E. coli (Guentzel, 1995). It also 

account for majority of cases of prostatitis and 

pyelonephritis. Klebsiella, Proteus and Enterobacter 

species are also other common urinary tract pathogens 

(Alli et al., 1998). K. pneumoniae accounts for a small 

percentage of pneumonia cases, however, extensive 

damage produced by the organism results in high case 

fatality rates over 80% of untreated cases. 

Disturbance or eradication of the normal intestinal and 

body flora generally by antibiotic therapy may allow 

resistant nosocomial strains to overgrow (Alli et al., 

1998). Nosocomial strains progressively colonize the 

intestine, pharynx or other organs with increase length of 

mobility and hospital stay. This may result into an 

increase risk of infections (Shah et al., 2002). The 

bacteria responsible for many common out patient 

infections too have developed resistant strains, which are 

posing new obstacles to effective therapy (Butler et al., 

2001). The major sites of nosocomial infections, in order 

of decreasing frequency are the urinary tract, surgical 

sites, pneumonias (lung infection), and blood stream. The 

Hassan et al. 5163 

most incriminated premier nosocomial pathogen is E. coli 

(Guentzel, 1995). 

Nosocomial infections are a serious threat to all 

hospitalized patients and in particular to those who 

require endotracheal intubation and mechanical 

ventilation. Accurate diagnosis of pneumonia and correct 

identification of pathogens of great importance and 

should be achieved as quickly as possible to avoid 

prolonged hospitalization and increased risk of mortality 

(Shah et al., 2002). With better understanding and treatment 

of nosocomial infections, the risks of contracting 

nosocomial infections associated with these pathogens 

can be reduced to the nearest minimum if not eradicated. 

It is against this background that this study was designed 

to determine and analyze the prevalence of 

Enterobacteriaceae in relation to community and hospital 

acquired infections in wards, specimens and age of 

patients in LAUTECH Teaching Hospital Osogbo in 

Southwestern Nigeria. 


Study location 

This survey was carried out between July 2009 and June 2010 at 

the Medical Microbiology and Parasitology Department of 

LAUTECH Teaching Hospital Osogbo, Osun State, Nigeria, to find 

out the incidence of Enterobacteriaceae in community acquired and 

nosocomial infections. 

Selection of cases 

Some of the known risk factors for these hospital and acquired 

community infections include older age, long period of hospital stay, 

having invasive or manipulative procedures carried out, subjects 

staying in wards with traditionally high prevalence of nosocomial 

infections, long period on immunosuppressive drugs, 

immunosuppressive conditions, irrational use of antibiotics, 

improper hospital waste disposal and the absence of hospital 

implementation policy on infection control. This could form the basis 

for comparism of case selections. Two hundred and forty samples 

were collected from patients attending general outpatient 

department and another set of two hundred and forty bacterial 

samples were obtained from patients hospitalized in different wards 

of LAUTECH Teaching Hospital Osogbo. The nosocomial isolates 

were isolated from patients who had a minimum of 7 days in the 

hospital as described by Shah et al. (2002) prior to sample 

collection and the subjects must be free of infection at the time of 

hospital admission. Various samples collected from the patients like 

Blood, Cerebrospinal fluid (CSF), pus, sputum, urine, pleural fluid 

and peritoneal fluid were cultured for the presence of bacteria 

belonging to the family Enterobacteriaeae according to Shah et al. 

(2002). 

Reagents and cultural media 

Blood agar base, Cystein Lactose Electrolytes Deficiency (CLED) 

agar and Mac Conkey’s agar obtained from Oxoid Ltd. Basing 

stoke, Hamphire, England. Triple sugar iron agar, peptone water, 

motility, indole and gas (H2S) test medium, citrate test medium and 

urease test medium were obtained from Difco Laboratories, Detroit, 

Michigan, USA.


Table 1. Distribution of Nosocomial isolates in various specimens. 

Specimen 

Isolates 

Escherichia 

coli 

Klebsiella 

pneumoniae 

Enterobacter 

cloacae 

Proteus 

mirabilis 

Proteus 

vulgaris 

Citrobacter 

freundii 

CSF 03 04 00 00 00 00 07 

Blood 07 06 02 02 00 00 17 

Urine 76 30 8 12 10 08 144 

Pus and other fluids 32 20 10 04 04 02 72 

Total 118 60 20 18 14 10 240 

Culture of specimen 

All the samples were inoculated on blood agar and Mac Conkey’s 

agar except urine samples which were inoculated on CLED agar. 

Inoculated plates were in incubated at 37°C in ambie nt air for 16 – 

24 h as described by Cowan and Steel (1970). 

Identification of Isolates 

After overnight incubation, the culture plates were examined for 

growth. Identification was performed macroscopically and 

microscopically by using the standard microbiological and 

biochemical techniques (Cowan and Steel, 1970; Shal et al., 2002). 

These criteria were used in pathogens identification. 

Sensitivity testing of isolates 

All bacterial isolated were characterized by using the standard 

methods described by Pekarski (1989). Stokes disc diffusion agar 

method was employed for Antibiogram of isolates obtained. The 

antibiotics used include augumentin (30 µg), peflacine (30 µg), 

ceftriaxone (10 µg), cephalexin (10 µg), cotrimoxazole (25 µg), 

amoxicillin (25 µg), tetracycline (30 µg), nalidlic acid (30 µg) 

gentamycin (10 µg), erythromycin (5 µg) and nitrofurantoin (300 

µg). 

Data analysis 

Data was analyzed using the EPI Info software to generate 

frequency tables. The χ 2 (Chi-Square) test was used to determine 

significant relationship between relevant categorical variables at 

P≤0.05. 

RESULTS 

Distribution of 240 nosocomial isolates in various 

specimens was presented in Table 1. Urine samples 

accounted for 144 (60%) isolates, 72 (30%) isolates were 

obtained from pus and other aspirates, 17 (7.1%) from 

blood and the remaining 07 (2.9%) were obtained from 

Cerebrospinal fluid. E. coli was the most prevalent isolate 

118 (49.2%) which was statistically significant (p 0.05) and any observed difference 

was due to mere chance. The least recorded isolate is C. 

freundii with 9 isolates out of 240. Age group 60 and 

above had highest prevalence of 4 out of 9 (44.4%) while 

age group 18 – 40 years and 40 – 50 years had 1 out of 9 

(11.11%) each as the least prevalence rate in this study. 

From Table 3, a total of two hundred and forty isolates 

of Enterobacteriaceae were equally collected from out 

patient department during the study period. The highest 

number of isolates were obtained from urine which is 194 

out of 240 (47.5%), pus 42 of 240 (17.5%). 38 (15.8%) 

from ear swab, 19 (7.9%) from high vaginal swab, 13 

(5.4%) from blood and only 6 (2.5%) isolates from 

cerebrospinal fluid been the least. 

Among these isolates E. coli was the most abundant 

130 (54.2%), followed by K. pneumoniae 56 (23.3%). 18 

(7.5%) isolates of E. cloacae (7.5%), 16 P. mirabilis, 

(6.7%), 11 P. vulgaris (4.6%) and 9 isolates of C. fruendii 

(3.8%) were obtained from out door isolates. Among 

these 130 isolates, E. coli was most prevalent in urine 62 

out of 130 (47.7%), followed by 25 from pus (19.2%), 16 

from ear swab (12.3%), 9 (6.9%) from high vaginal swab 

(HVS) (6.9%), 10 from blood (7.7%), 5 from cerebrospinal 

fluid (CSF) (3.8%), and 3 from sputum (2.3%). 

Among these 240 isolates, 41 isolates were K. 

pneumoniae. This was most prevalent in urine 28, 7 are 

from pus, 8 from ear swab, 5 from HVS, 4 from sputum, 3 

from blood and only one from CSF. Urine samples have

Table 2. Distribution of Nosocomial Isolates in various species according to age group. 

Isolates 

Age group 


18 – 40 40 – 50 50 – 60 60 and above Total 

E. coli 28 25 30 35 118 

K. pneumonia 13 10 20 17 60 

E. cloacae 04 05 06 05 20 

P. mirabilis 05 03 06 04 18 

P. vulgaris 03 02 05 04 14 

Cit. freundii 02 01 04 03 10 

Total 55 46 71 68 240 

E: Escherichia; K: Klebsiella; Ent: Enterobacter P: Proteus; Cit: Citrobacter. P


Table 5. Antibiotic susceptibility pattern of baterial isolates. 

Antibiotic 

E. coli K. pneumonia 

Percentage sensitivity 

Ent. cloacae P. mirabilis P. vulgaris Cit. freundii 

Ofloxacine 100 85 86 100 100 100 

Peflacine 100 72 85 100 100 100 

Ceftriaxone 100 100 100 100 100 100 

Gentamycin 80 81 76 60 80 80 

Amoxycillin 18 40 98 75 18 18 

Cephalexin 98 97 100 100 98 98 

Cotrimoxazone 0 20 62 0 0 0 

Tetracycline 0 0 18 7 0 0 

Nalidixic acid 0 0 10 0 0 0 

Nitrofurantoin 25 0 50 80 

Erythromycin 0 0 42 0 

bacteriaceae were isolated from 240 each of hospital 

acquired infections and community acquired infections in 

different wards according to different age groups in a 

tertiary health hospital in south western Nigeria. 

The bacteria were isolated from urine, pus, blood, high 

vaginal swab, CSF, sputum and ear swabs. It was shown 

that E. coli were most frequent in all the specimens with 

49.2 and 47.5% for urine samples in community acquired 

and nosocomial infection respectively. The age group 60 

years and above in both cases of nosocomial and 

community acquired infections recorded E. coli as most 

abundant organism. This result varied with work of Shah 

et al. (2002) that recorded E. coli as highest in the age 

group 50-60 years. In accordance with another work 

(Mouton et al., 2001), who recorded E. coli in 65 years 

and above as cause of both nosocomial and community 

acquired infections. 

In the period 1988-1993, after E. coli, Klebsiella was 

the leading cause of Gram-negative bacteraemia, from 6- 

7% in the late 1980s to 12-13% in more recent years. 

Urinary tract infection was the underlying source of 58% 

of community-acquired Klebsiella bacteraemia as against 

28% of hospital-acquired Klebsiella bacteraemia (Butler 

et al., 2001). There are many of these infections in the 

community that are different from those reported in 

studies on K. pnemoniae bacteremia from referral centers 

(Haddy et al., 1989). Urinary tract infections (25.6%) were 

the main types of infection in the cancer patients in 

oncology intensive care unit according to Velasco et al. 

(1997). The most common organisms isolated were from 

Entrobacteriaceae (29.7%). This increased incidence of 

Enterobacteriaceae in urine could be due to the 

indwelling urinary catherter, and central vainous 

catheters used for patients. Klebsiella spp 9.1% and P. 

mirabilis 4.9% were responsible for the risk of nosocomial 

bacteria transmission during ultrasound scanning in 

LAUTECH Teaching Hospital Osogbo in a survey in 2005 

(Bello et al., 2005). 

In medical, surgical and intensive care wards of Swiss 

University hospital, surgical site infections were most 

prevalent (30% of all nosocomial), followed by urinary 

tract infections according to a survey in May 1996 

(Harbarth et al., 1999). The most frequently isolated 

organism were Enterobacteriaceae (Harbarth et al., 

1999). Nosocomial infections are considered as a heavy 

burden on health services. A total of 240 isolates were 

obtained from subjects belonging to different age groups. 

Most of the nosocomial isolates were obtained from age 

group 50-60 years with (29.6%) while most of the 

community acquired isolates were from age group 60 

years and above with (31.7%). 

E. coli was most prevalent organism (24.6%) in the age 

groups 50-60 for nosocomial infection and 60 and above 

community acquired infection respectively (15.8%). In the 

current study, 130 out of 240 isolates were E. coli 62 of 

130 (54.2%). E. coli were obtained from urine in cases of 

community acquired infections accounting for (47.6%) in 

all age groups. It was observed by Alli et al. (1998) that 

30% of all blood stream infections were found in patients 

over 50 years and that 65% of these were cause by 

gram-negative organisms, these results are similar to the 

findings of the present study. Prevention of infections, 

particularly those that are hospital acquired, is difficult 

and may be impossible. Sewage treatment, water 

purification, proper hygiene, and other control methods 

for enteric pathogens will reduce the incidence of E. coli 

and other entero-pathogens of Enterobacteriaceae. 

However, these control measures are rarely available in 

less developed regions of the world like Nigeria. All 

hospital staff both Clinical and non Clinical can do much 

to reduce nosocomial infections through identification and 

control of predisposing factors, education and training of 

hospital personnel, and adequate microbial surveillance. 

Observance of standard procedures and use of aseptic 

conditions for all medical interventions will go a long way 

in control of hospital acquired infection. 

This study of infection rates provides specific 

surveillance data for further inter hospital comparisons

and also to assess the influence of invasive medical 

interventions, thus allowing for the implementation of 

preventable measures to control infections. Education of 

staff regarding pathogenesis, diagnosis, and appropriate 

intervention needed for nosocomial infections is essential 

to its control and prevention (Shah et al., 2002). Also 

essential is the evaluation and alteration if needed, of 

policies and procedures to better provide control and 

prevention of nosocomial infections. 


Authors wish to thank the management of LAUTECH 

Teaching Hospital Osogbo in southwestern Nigeria and 

the Head of Department of microbiology and 

parasitological for their cooperation and express 

permission to carry out this review. 

REFERENCES 

Alli M, Elbashier MD, Malik AG, Khot AP (1998). Blood Stream 

Infections Micro organisms, Risk Factors and Mortality Rate in Qatif 

Central Hospital. Saudi Med., 18(2): 172-176. 

Bello TO, Taiwo SS, Oparinde DP, Hassan WO, Amure JO (2005). Risk 

of Nosocomial Bacterial Transmission: Evaluation of cleaning 

methods of probes used for routine Ultrasonography. West Afr. J. 

Med., 24(2): 167-170. 

Butler KH, Reed C, Bosker G (2001). New Diagnostic Modalities, 

Alteration of Drug Resistance Patterns and Current Antimicrobial 

Treatment Guild lines for the Hospital and out Patient Settings in: 

Clinical Consensus Report: Urinary Tract Infection. 

Coffin SE, Zaoutis TE (2008). Healthcare-Associated Infections. In: 

Long SS, Pickering LK, Prober CG. Principles and Practice of 

Pediatric Infectious Diseases. 3 rd ed. Churchill Livingstone; p. 101. 

Mouton CP, Baza Idua OU, Pierce B, Espino DV (2001). Common 

Infections in older adults. Am. J. Fam. Phys., 2: 257-276. 

Cowan SF, Steel KJ (1970). Manual for the Identification of the Medical 

Microorganism. Cambridge: Cambridge University Press: pp. 7-122 

Guentzel MN (1995). Escherichia, Klebsiella, Enterobacter, Serratia, 

Citrobacter and Proteus. General Concepts Clinical Manifestations, 

20(3): 275-282. 

Haddy RI, Kee M, Sangal GM, Walbroehl GS, Hambrick CS, Sarti GM 

(1989). Klebsiella Pneumoniae bacteremia in the Community 

Hospital. J. Fam. Pract., 28(6): 686-690. 


Harbarth S, Ruef C, Francioli P, Widmer A, Pittet D (1999). Nosocomial 

Infections in Swiss Hospitals: a Multi-Centre Survey and Review of 

the Published Experience Swiss- Noso Network Schweiz Med. 

Wochenschr, 23; 129(42): 152. 

Olawale KO, Fadiora SO, Taiwo SS (2011). Prevalence of hospitalacquired 

Enterococci infections in two Primary-care hospitals in 

Osogbo, Southwestern Nigeria. Afr. J. Infectious Dis., 5(2): 16-22. 

Pekarski E (1989). In “Medical Parasitology” Springer – Verlag Berlin, 

Berlin Heidelberg. pp. 168-169. 

Pittet D, Hugonnet S, Harbarth S, Mourouga P, Sauvan V, Touveneau S 

Perneger TV (2000). Effectiveness of a hospital wide programme to 

improve compliance with hand hygiene. Lancet, 356: 1307–1311. 

Shah AA, Hasan F, Hameed A (2002). Study on the Prevalence of 

Enterobacteriacae in Hospital Acquired and Community Acquired 

Infections. Pak J. Med. Res., 41(1):1-7. 

Somwang D, Tepnimit J, Siriporn S, Kakanang N, Tanarak P (2007). 

Prevalence of Nosocomial Infection in Thailand 2006. J. Med. Assoc. 

Thai., 90(8): 1524-1529. 

Velasco E, Thuler LC, Martins CA, Dias LM, Goncalves VM (1997). 

Nosocomial Infections in an Oncology Intensive care unit. Am. J. 

Infection Control, 25(6): 458-62. 

Yinnon AM, Butnaru A, Raveh D, Jerassy Z, Rudensky B (1996). 

Klebsiella Bacteraemia: Community Versus Nosocomial Infection. Q 

J. Med., 89(12): 933-941.



DOI: 10.5897/AJMR12.205 



Investigation of genetic variability among different 

isolates of Fusarium solani 

Uzma Bashir*, Sidra Javed and Muhammad Shafiq 

Institute of Agricultural Sciences, University of the Punjab, Quaid-e-Azam Campus Lahore, Pakistan. 


Fusarium solani (Mart). Sacc. is an important wilt causing pathogenic fungi. Plant diseases have caused 

severe losses to human beings. In the present investigation five different isolates of F. solani were 

subjected to genetic variability analysis in terms of DNA-polymorphism using RAPD-PCR. F. solani 

isolate V3 (Lycopersicum esculentum Mill.) and V5 (Solanum melongena L.) showed 78.2% similarity. 

Sequences of isolates V1 (Lense esculentum L.) and V 2 (Acacia sp.) were 74.2% similar. Isolates (V1 and 

V2) and (V3 and V5) also show 65.5% similarities among their sequences. Whereas isolate V4 (Gladiolus 

sp.) gives 70.3% similar results. Genetic variability pattern among isolates of F. solani were also 

supported by UPGMA dendrogram and percentage similarity table. 

Key words: Acacia sp. Fusarium solani, Gladiolus sp. Lens esculenta, Lycopersicum esculentum, RAPD-PCR 

Solanum melongena. 

INTRODUCTION 

Vegetables play a significant role in human nutrition, 

especially as sources of vitamins, minerals, and dietary 

fiber (Wargovich, 2000). Egg plant is economically 

important vegetable crop in Asia and Africa, and although 

it is also grown in Europe and the United States. The 

global area under brinjal cultivation has been estimated 

at 1.85 million ha with total production of brinjal fruit of 

about 32 million. Brinjal is grown over 8670 hectare area 

throughout Pakistan with the annual production of 91260 

tones, out of which the Punjab, Province has the highest 

share in terms of area of sowing (4890 ha) and 

production, 60890 tons (Anonymous, 2007). Among the 

many diseases that attack the brinjal crop, wilt is major 

damaging disease that causes the severe yield losses. 

The pathogen can survive in the soil for many years 

(Babu et al., 2008). Fusarium Wilt is due to the species 

Fusarium solani. Disease symptoms are often helpful in 

making decisions, but a definitive diagnosis requires clear 

identification of pathogen so in order to apply appropriate 

*Corresponding author. E-mail: uzmamppl@yahoo.com. 

controls, it is extremely important to make an accurate 

and timely diagnosis of plant diseases (Frederick et al., 

2000). Molecular techniques are important tools in 

solving the problems of species restriction and also 

provide alternative methods for taxonomic studies 

(MacLean et al., 1993). In the last years characterizations 

of plant genetic resources based on molecular markers 

have been increased. Studies using a broad range of 

markers applied on hundreds of plant species are the 

theoretical basis for understanding genetic diversity to 

propose both breeding and conservation strategies 

(Laurentin, 2009). Polymerase chain reaction can be 

applied to measure responses of experimental stimuli 

and to gain knowledge of potential changes in protein 

level and function (Mark et al., 2005). The development 

and application of molecular diagnostic methods have 

made it possible to study plant diseases with the help of 

new technologies (McCartney et al., 2003). RAPD has 

been used widely for the detection of genetic variability in 

plants because of its simplicity and lack of need for any 

prior information about the genetic material of plant. 

RAPD patterns remains constant in plant whether it is 

young or old (Welsh and McClelland, 1990; Micheli et al.,

Table 1. List of decamers used in RAPD. 

Serial No. Primer designation Primer sequence 

1 RAPD 1 3΄ AGGGGTCTTG 5΄ 

2 RAPD2 3΄ AATCGGGCTG 5΄ 

3 RAPD 3 3΄ CAGGCCCTTC 5΄ 

1994). This technique has also been reported very useful 

for identification and genotyping of ornamental as well as 

of many other varieties (Temiesak et al., 1993). 

According to McClelland and Welsh, (1994) high quality 

templates should be used to assure reproducible RAPDs. 

RAPD markers were also used by Katherine et al. (2003) 

to examine the degree of genetic variation within the 

putatively asexual basidiomycetes fungus (lepiotaceae). 

Due to simplicity of this process RAPD is used as 

molecular markers for taxonomic and systematic analysis 

of plants and is used widely in plant breeding and genetic 

relationships (Bartish et al., 2000). RAPD fingerprinting 

method can be used for studying phenotypically similar 

Candida strains according to molecular era (Steffan et al., 

1997) and this technique is more accurate and rapid for 

the identification of Candiada species (Rocha et al., 

2008). Recently RAPD has been used widely for 

estimation of genetic material of many endangered plants 

(Zheng et al., 2008). 


Molecular characterization of Fusarium species 

Genetic similarity among five different isolates of F. solani was 

examined. Four samples were obtained from FCBP (First Fungal 

Culture Bank of Pakistan IAGS University of The Punjab Lahore) 

and one sample was isolated from Solanum melongena plant. 

Fungal cultures were further purified as a single spore culture on 

Malt Extract Agar (MEA) plates by single spore isolation technique 

(Choi et al., 1999) and incubated at 27˚C ± 2°C. After 2 weeks 

fungal colony was removed from the Petri plate by scratching the 

surface with a sterilized needle and then placed in the (Pre-chilled 

at -80°C) sterilized mortar. Fungal tissues were ground with liquid 

nitrogen to form a fine powder with the help of a pestle. Fungal 

DNA was extracted by using the CTAB method described by Doyle 

and Doyle (1990) with some modifications. 

DNA quality analysis 

The target fungal genomic DNA was isolated by doing 1% agarose 

gel electrophoresis. To 70 ml of 0.5 × TAE buffer(10ml 50 × TAE, 

990ml distilled water) 0.7 g of agarose was added and subjected to 

heat in a microwave oven until a clear, transparent solution was 

obtained. After cooling for about 5 min, 2 μL of ethidium 

bromide(EtBr) was added from 10 mg/ml stock solution (0.2 g EtBr 

in 20ml ddH2O) in the melted gel. The melted agarose was poured 

into a flat bed gel tray and comb was inserted. The gel was allowed 

to solidify completely at room temperature. Then comb was 

carefully removed and gel tray was placed in the electrophoresis 

tank containing 0.5 × TAE buffer.DNA samples and the DNA 

standard marker were loaded into the wells of the solidified gel 

Bashir et al. 5169 

submerged in 0.5 × TAE buffer. Gel electrophoresis was carried out 

at 100 volts for about 40 min. The DNA bands in the gel were 

visualized using UV transilluminatior and photographed by using gel 

documentation system (Wise Doc MUV-M2O). 

RAPD analysis (random amplification of polymorphic DNA) 

Each of the five fungal DNA extract was amplified with three 

different decamer primers. In order to determine genetic variability 

among different isolates of Fusarium solani RAPD technique was 

applied. PCR amplification involved the following steps. 

Primer screening 

In RAPD analysis 3 primers (decamers) were used. Table 1 show 

the decamers used in RAPD. 

Reactions for RAPD-PCR 

PCR tube contains 25 μL RAPD reaction mixture; which is 

composed of 0.5 μL Taq Polymerase, 2.5 μL PCR Buffer, 2.0 μL 

MgCl2, 5.0 μL dNTPs, 5.0 μL Primer, 5.0 μL Template DNA, 8.0 μL, 

Double distilled deionized water. All the chemicals were placed in 

ice under sterile conditions. 

Conditions of RAPD-PCR 

Polymerase chain reaction (PCR) tubes containing the reaction 

mixture were placed in the PCR machine. Machine was 

programmed under the following conditions of temperature. The 

initial process of denaturation was done at 94°C for 5 min followed 

by 40 cycles of denaturation at 94°C for 1 min, annealing was done 

at 40°C for 1 min and final extension for 10 min at 72°C. 

Termination of reaction was done at 22°C. Until further analysis on 

agarose gel the amplified products were stored at 4°C. 

Amplified DNA fragment analysis 

RAPD sample (25 μL) was mixed with 3 μL of loading dye and the 

mixture was then loaded in the wells of 1% agarose gel. 

Electrophoresis was carried out same as described earlier for 

genomic DNA. Bands were visualized through the documentation 

system [Wise Doc MUV-M20] and were recorded. The number of 

amplified DNA bands for each Fusarium isolate was recorded along 

with their sizes. According to genetic similarities and differences F. 

solani isolates were grouped in different clusters. 

RESULTS 

RAPD markers were used to examine the degree of 

genetic variation within the isolates of Fusarium solani. 

The accession numbers of fungal isolates are given in 

Table 2. Initially three random decamer primers were 

chosen in order to generate RAPD profile of the five 

fungal isolates, RAPD primers were selected for the 

further studies as it produced consistent and reproducible 

bands for all of the fungal isolates. The results of primer 

(RAPD 3 primer) are shown in Figure 1. Number of 

shared RAPD bands was compared between each pair of 

isolates to quantify the similarity between fungal isolate.


Table 2. Serial and accession numbers of Isolates obtained from FCBP. 

Serial No. Accession No Isolation source 

1 136 Lense esculenta 

2 438 Acacia 

3 443 Lycopersicum esculentum 

4 277 Gladiolus 

5 1127 Solanum melongena 

UPGMA 

64 70 76 

82 88 94 100 

Percent similarity 

Figure 1. Dendrogram showing different isolates of Fusarium solani. 

Table 3. Percentage similarity among different isolates of Fusarium solani. 

Node Group 1 Group 2 Percentage similarity (%) Objects in group 

1 L. esculentum S. melongena 78.261 2 

2 L. esculenta Acacia 74.286 2 

3 Node 2 Gladiolus 70.370 3 

4 Node 3 Node 1 65.536 5 

Data was recorded and used to generate a Phylogenetic 

tree using Multivariate Statistical Package, ver 3. (MVSP 

3.0). The percentage similarity of F. solani isolates are 

shown in Table 3. 

It is evident from the dendrogram that F. solani isolate 

V3 (Lycopersicum esculentum) is closer to V5 (Solenum 

melongena) isolate of F. solani and they have the highest 

percentage similarity that is 78.2% and occupy the node 

position 1. Similarly V1 (Lense esculenta) and V2 

(Acacia) occupied second position on the node and 

showed the 74.2% similarity in their sequences (Table 3). 

Node 2 is occupied by V4 (Gladiolus) and shared 70.3% 

of its rapid bands. Some similarities were also observed 

in the isolates present on node 3 (V1 and V2) and node 1 

(V3 and V5). Both of them share 65.5% similarity. 

DISCUSSION 

In this study, the suitability of RAPD techniques for 

molecular characterization of F. solani isolates, isolated 

from different sources, was observed. It was observed 

that RAPD 3 marker provide clear polymorphism and 

provide profiles which differed markedly between isolates 

of F. solani from different plant host and this further 

revealed polymorphism with reference to different 

isolates of Fusarium solani (Figure 2), and established 

DNA fingerprints which is useful for genetic

Figure 2. RAPD profile of Fusarium solani by using decamer 

RAPD 3. The size of DNA was compared with 1.0 kb DNA ladder 

(L). 

characterization and specific identification of F. solani 

isolates from other different host plants. According to 

Goodwin et al. (2001) and Sunnucks (2000) the genetic 

diversity of some Penicillium species was reported by 

random amplified polymorphic DNA. The use of RAPD 

markers was also reported by Pitt (1973) for molecular 

characterization of 10 Penicillium species. It is evident 

from the present study that F. solani isolated from L. 

esculentum is closer to F. solani which was isolated from 

S. melongena as they share 78.2% similarity which is the 

highest percentage among all the other isolates. Similarly 

Lense esculenta and Acacia showed 74.2% similarity in 

their sequences. 65.5% similarity was also observed 

among the isolates present on node 3 (L. esculenta and 

Acacia) and node 1 (L. esculentum and S. melongena). 

So it was concluded from the study that isolate of F. 

solani isolated from Gladiolus differs from all the four 

isolates of F. solani as it does not show similarity with any 

of the isolate. Fusarium species usually require time 

consuming and lengthy pathogenicity and vegetative 

compatibility analysis (Williams et al., 1990). Therefore 

RAPD analysis has been used widely among 

phytopathogenic fungi including Fusarium species for 

their detection and genetic characterization (Kim et al., 

1993; Miller, 1996; Gulino et al., 2003). Thirty isolates of 

Pestalotiopsis and two isolates of Bartalinia robillardoides 

were genotypically compared by RAPD techniques and 

241 reproducible polymorphic bands were obtained using 

23 random primers (Tejesvi et al., 2007). By using RAPD 

analysis, population of Fusarium spp. from different plant 

hosts have been grouped and recommended by various 

workers that RAPD markers could be a quick and reliable 

alternative for different isolates of Fusarium sp. (Hyun 

and Clark, 1998; Ibrahim and Nirenberg, 2000; Jana et 

al., 2003). 

REFERENCES 

Bashir et al. 5171 

Anonymous (2007). Agriculture Statistics of Pakistan 2006-2007 

Government of Pakistan, Ministry of Food, Agriculture and Livestock, 

Islamabad. 

Babu HBN, Mahesh PA, Venkatesh YP (2008). A cross-sectional study 

on the prevalence of food allergy to eggplant (Solanum melongena 

L.) reveals female predominance. Clin. Exp. Allergy, 38: 1795–1802. 

Bartish V, Garkawo LP, Rumpunen K, Nybom H (2000). Phylogenetic 

relationship and differenciation among and within population of 

Chaenomeles Lindl. (Rosaceae) estimated with RAPD and isozyme. 

Theor. Appl. Genet., 101: 554-563. 

Choi YW, Hyde KD, Ho WH (1999). Single spore isolation of fungi. 

Fungal Diversity, 3: 29-38. 

Doyle JJ, Doyle JL (1990). Isolation of plant DNA from fresh tissue. 

Focus, 12: 13-15. 

Frederick RD, Synder KE, Tooley PE, Berthier-Schaad Y, Peterson GB, 

Bonde MR, Schaad NW, Knorr DA (2000). Identification and 

differenciation of Tilletia indica and T. walker using the polymerase 

chain reaction. Phytopathology, 90: 951-960. 

Goodwin SB, Dunkle LD, Zismann VL (2001). Phylogenetic Analysis of 

Cercospora and Mycosphaerella Based on the Internal Transcribed 

Spacer Region of Ribosomal DNA. Phytopathology, 91: 648-658. 

Gulino LM, Bentley S, Kochman JK, Allen SJ, Moore NY, Irwin JAG 

(2003). A DNA diagnostic test for detecting and identifying Australian 

strains of Fusarium wilt of cotton-8 th International Congress of Plant 

Pathology, Christchurch, New Zealand, pp. 7-8. 

Hyun JW, Clark CA (1998). Analysis of Fusarium lateritium using RAPD 

and rDNA RFLP techniques. Mycol. Res., 102: 1259-1264. 

Ibrahim G, Nirenberg HI (2000). Recent studies on Fusarium vascular 

wilt of cotton at the Fedral Biological Center for Agricultural and 

Forestery (BBA), Berlin- Mitt. Biology. BundAnst. Ld.-u. Forstwirtsch. 

H, 377: 87-88. 

Jana TK, Sharma TR, Prasad D, Arora DK (2003). Molecular 

characterization of Macrophomina phaseolina and Fusarium species 

by single primer RAPD technique. Microbiol., Res., 158: 264-274. 

Katherine RD, Doherty EW, Erica WZ, Nels CE, Mark JM, Stephan GZ 

(2003). Random amplified polymorphic DNA markers reveal genetic 

variation in the symbiotic fungus of leaf cutting ants. Mycologia, 95: 

19-23. 

Kim DH, Martyn RD, Magill CW (1993). Mitochondrial DNA-relatedness 

among formae specials of Fusarium oxysporum in the cucurbitaceae. 

Phytopathol., 83: 91-97. 

Laurentin H (2009). Data analysis for molecular characterization of plant 

genetic resources. Genet. Resour.Crop Ev., 56: 277-292. 

MaClean DJ, Braithwaite KS, Manners JM, Irwing JAG (1993). How do 

we identify and classify fungal pathogens in the era of DNA analysis? 

Adv. Plt. Pathol., 10: 207-244. 

Mark A, Valasek, Repa JJ (2005). The power of real-time PCR. Adv. 

physiol. ed., 29: 151-159. 

McCartney HA, Foster SJ, Fraaije BA, Ward E (2003). Molecular 

diagnostics for fungal plant pathogens. Pest Manag. Sci., 59: 129– 

142. 

McClelland M, Welsh J (1994). DNA fingerprinting by arbitrarily primed 

PCR. PCR Meth. Appl., 4: 59-65. 

Micheli MR, Bova R, Pascale E, Ambrosio E (1994). Reproducible DNA 

fingerprinting with the random amplified Polymorphic DNA (RAPD) 

method. Nucleic Acid Res., 22: 1921-1922. 

Miller SA (1996). Detecting propagules of plant pathogenic fungi. Adv. 

Bot. Res., 23: 73-102. 

Pitt JI (1973). Appraisal of Identification Methods for Penicillium 

species: Novel Taxonomic Criteria Based on Temperature and Water 

Relations. Mycologia, 65: 1135-1157. 

Rocha BA, Negro GM, Yamamoto L, Souza MV, Precioso AR, Okay TS 

(2008). Identification and differentiation of Candida species from 

pediatric patients by random amplified polymorphic DNA. Rev. Soc. 

Bras. Med. Trop., 41: 1-5. 

Steffan P, Vazquez JA, Boikov D, Xu C, Sobel JD, Akins RA (1997). 

Identification of Candida species by randomly amplified polymorphic 

DNA printing of colony lysates. J. Clin. Microbiol., 35: 2031-9 

Sunnucks P (2000). Efficient Genetic Markers for Population Biology. 

Trends Ecol. Evol., 15: 199-203.


Tejesvi MV, Kini KR, Parkash HS, Ven S, Shetty HS (2007). Genetic 

diversity and antifungal activity of species of Pestalotiopsis isolated 

as endophytes from medicinal plants. Fungal Div., 24: 37-54. 

Temiesak P, Ponpim Y, Harada T (1993). RAPD analysis for varietal 

identification in Brassica. Kasetsart J. Nat. Sci., 27: 37-42. 

Wargovich MJ (2000). Anticancer properties of fruits and vegetables. J. 

Hortic. Sci., 35: 573-575. 

Welsh J, McClelland M (1990). Finger printing Genomes using PCR 

with arbitrary primers. Nucleic acid Res., 18: 7213-7218. 

Williams JK, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV (1990). DNA 

polymorphism amplified by arbitrary primers are useful as genetic 

markers. Nucleic Acid Res., 18: 6531-6535. 

Zheng W, Wang LM, Liu L (2008). Genetic variation in the endangered 

Anisodus tanguticus (Solanaceae), an alpine perennial endemic to 

the Qinghai-Tibetan Plateau. Genetica, 132: 123-129.


Available online http://www.academicjournals.org/AJMR 

DOI: 10.5897/AJMR12.647 



Stenotrophomonas koreensis a novel biosurfactant 

producer for abatement of heavy metals from the 

environment 

Patil S. N. 1 *, Aglave B. A. 2 , Pethkar A. V. 1 and Gaikwad V. B. 1 

1 Department of Biotechnology, KTHM College, Nashik-422002 M.S., India. 

2 Post Doctoral Scientist, Florida Ag Research - Pacific Ag Group, 13138, Lewis Gallagher Road, Dover, 

Florida-33527, USA. 


The removal of heavy metal contaminants from the environment is one of the potential areas in which 

the usefulness of biosurfactants has not been thoroughly explored. The molecular nature of 

biosurfactants offers the possibility of interaction with the metals in solution, aiding in their subsequent 

removal and/or recovery. In the present research work, a systematic isolation and screening program 

was undertaken for obtaining biosurfactant-producing bacteria. A total of 129 isolates were screened 

and three bacterial isolates were selected for high surface tension reducing ability. Pseudomonas 

aeruginosa, Stenotrophomonas koreensis (Strain DX1 16S ribosomal RNA gene, partial sequence NCBI 

Acc. No. GQ 493998 BankIt 1255714) and Rhodococcus spp isolates were identified by routine 

microbiological tests, API-32 and 16s rRNA profiling. The surface tension reduction of MS medium for 

the three isolates was: P. aeruginosa, 62.3 to 31.6 dynes/cm; S. koreensis, 62.4 to 27.8 dynes/cm; in 24 

to 30 h for both organisms and Rhodococcus spp, 64.4 to 43.7 dynes/cm in a period of 48 h. The 

emulsification index for all three isolates was 100% in diesel, petrol, toluene and sunflower oil. The 

ability of S. koreensis to remove heavy metal ions from solutions was explored. More than 30% of lead 

and cadmium ions were removed from 200 ppm metal solutions. 

Key words: Biosurfactant, Stenotrophomonas koreensis, surface tension, heavy metals, lead, cadmium. 

INTRODUCTION 

Surfactants are amphipathic molecules consisting of both 

hydrophilic and hydrophobic moieties that partition 

preferentially at the interface between fluid phases having 

different degrees of polarities and hydrogen bonding eg. 

oil and water or air and water interfaces (Benincasa et al., 

2001; Bodour et al., 2003). Synthetic surfactants used to 

increase contaminant solubility are often toxic, 

representing an additional source of contamination 

(Bodour and Miller-Maier, 1998). Microbially produced 

surface active compounds that is, biosurfactants have 

similar properties as that of chemical surfactants, but are 

less toxic, biodegradable and can be produced in situ at 

*Corresponding author. E-mail: suchetapatil27@gmail.com. 

the contaminated site (Bonglo, 1998; Bordoloi and 

Konwar, 2007). These molecules reduce surface tension, 

critical micelle concentration and interfacial tension in 

both aqueous solutions and hydrocarbon mixtures (Bosch 

et al., 1988). Biosurfactants have gained increased 

attention because of their ability to be produced from 

cheap raw materials and effectiveness in extreme 

conditions of temperature, pH and salinity (Cha, 2000; 

Das and Mukherjee, 2007). The properties of the various 

biosurfactants have been extensively reviewed (Desai 

and Banat, 1997; Muthusamy et al., 2008). 

Most microbial surfactants are complex molecules 

comprising a wide variety of chemical structures such as 

glycolipids, lipopeptides, fatty acids, polysaccharideprotein 

complexes, phospholipids and neutral lipids. 

Rhamnolipidsproduced by Pseudomonas aeruginosa is a


major class of biosurfactants and extensively studied by 

investigators (Desai et al., 1994; Harman and 

Artiola,1995; Kosaric, 2000). Due to the diverse synthetic 

capabilities of microorganisms, it is not surprising that a 

large variety of biosurfactants and novel compounds are 

produced by them, providing new possibilities for 

industrial applications (Lang and Wullbbrandt, 1999; 

Banat et al., 2010). Thus, there is an increasing interest 

in the possible use of biosurfactant in mobilizing heavy 

crude oil, transporting petroleum in pipe lines, managing 

oil spills, biodegradation of hydrocarbons in the soil, 

removal of heavy metals, production of detergents, agroindustries 

and in the manufacture of pharmaceutical 

products (Banat et al., 2010; Franzetti et al., 2010; 

Plociniczac et al., 2011). A lot of research efforts are 

directed towards the isolation of organisms that produce 

biosurfactants, since the biosurfactants offer the 

possibility of large scale manufacture at low operating 

costs. Hence, in the present investigations, efforts were 

undertaken in order to employ a systematic isolation and 

screening program for biosurfactant producers and 

attempts were made for the isolation of novel organisms 

that could offer better solutions to the current industrial 

problems. In earlier investigations, although biologically 

produced surfactants have been projected as useful 

chemicals for many applications, there are few reports 

about the uses in heavy metal removal. Therefore, 

attempts were made to explore if biosurfactant producing 

organisms could be used for heavy metal 

removal/recovery. 

The present work was aimed at the isolation and 

screening for biosurfactant producing microorganisms 

from hydrocarbon contaminated soil and crude oil 

samples. The development of a systematic screening 

program and screening methodology was also one of the 

primary aims of the work, since some screening tests are 

prone to errors in the selection. Another objective was to 

indentify and characterize organisms, especially if novel 

strains were isolated in the screening work. Finally, the 

possibility of using biosurfactant producers for 

remediation of heavy metal contamination was explored. 


Isolation of bacteria 

Soil samples contaminated with petroleum and its products were 

collected from eastern Maharashtra region at Jawaharlal Nehru Port 

Trust, Navi Mumbai and oil contaminated sites in north Maharashtra 

region. Samples were inoculated in 100 ml of mineral salts medium 

(MSM). [ glucose: 10 g; (NH4)2SO4:1 g; Na2HPO4: 4 g; yeast extract: 

5 g; KH2PO4: 3 g; NaCl: 2.7 g; MgSO4: 0.6 g and 5 ml/L trace 

element solution containing FeSO4.7H2O: 5 mg; ZnSO4.7H2O:3.34 

mg; MnSO4.7H2O: 1.56 mg; CoCl2.2H2O: 2 mg (1 L distilled water)]. 

For enrichment of biosurfactant producers instead of glucose, 5% of 

diesel, petrol and dodecane were added in three flasks 

respectively. Then the flasks were incubated on a rotary shaker at 

37°C for up to 4 weeks at 120 rpm. Samples were withdrawn from 

the flasks at weekly intervals to test for growth of bacteria. 

Screening for biosurfactant production 

The isolated cultures were grown in 150 ml of MSM in 500 ml 

Erlenmeyer flasks and samples were withdrawn from the medium at 

definite time intervals (one week) for screening. Medium without 

inoculation of bacteria served as the negative control. Two 

approaches were used for screening the biosurfactant producers: 

(i) Qualitative screening: Blood agar lysis method-cultures were 

spread onto blood agar plates to observe for any hemolysis which 

was indicative of biosurfactant production (Bodour and Miller-Maier, 

1998; Bordoloi and Konwar, 2007). Colonies showing hemolysis 

were tested further by oil spread technique, drop collapse method 

and blue agar plate method. For oil spread technique-50 ml of 

distilled water was added to large Petri dish (25 cm diameter) 

followed by addition of 100 µl of crude oil to the surface of water. 10 

µl of culture were then added to the surface of oil. A clear zone on 

oil surface indicated biosurfactant activity of the culture and 

diameter of the clear zone was proportional to the production of 

biosurfactant by the bacteria. The diameter of the clear zone on the 

surface of oil was determined. The experiment was carried out in 

triplicates. The drop collapse technique and blue agar plate method 

was carried out as described by Bodour and Miller-Maier (1998). 

ii) Quantitative screening: All isolates that tested positive in the 

qualitative tests were subjected to quantitative assays viz. 

determination of emulsification index by the method of Bosch et al. 

(1988) and determination of surface tension by the du Nouy ring 

method (Benincasa et al., 2001; Bodour et al., 2003; Mukherjee et 

al., 2009). All samples for quantitative assays were analyzed in 

triplicates. 

Optimization of the growth parameters for production of 

biosurfactant 

Different carbon (mannitol, sucrose, starch, glycerol, olive oil, 

dodecane) and nitrogen sources (ammonium sulphate, potassium 

nitrate, ammonium nitrate, ammonium dihydrogen orthophosphate) 

were tested in order to find out the best combination of nutrients for 

biosurfactant production using MSM as basal medium (Das and 

Mukherjee, 2007). The effect of medium pH (4-10) and growth 

temperature (25, 37, 45 and 50°C) were also tested in order to 

determine the optimal conditions for maximum biosurfactant 

production. Each factor was varied by keeping all other factors 

constant and all samples were taken in triplicates. Subsequently, 

the Placket-Burman design was used to find out the critical media 

components. 

Determination of lead and cadmium tolerance for S. koreensis 

by Kirby-Bauer method and metal removal studies 

S. koreensis was grown in Nutrient broth (pH 6.8) in the presence of 

varying concentrations (25-800 ppm) of the metals viz. lead and 

cadmium. Once the tolerance level was determined, the organisms 

were grown in presence of 200 ppm of each metal and incubated 

for up to 6 days (37°C, 120 rpm) in order to allow the interaction of 

organisms with the metal ions. Samples were withdrawn at 12 h 

intervals and the concentration of metal ions remaining in solution 

was determined by AAS (Shimadzu AA-6300, Japan). Uninoculated 

flasks containing the metals were used as controls. 


Isolation of bacteria 

Most studies on biosurfactant producing organisms have

Table 1. Biosurfactant production profile of selected isolates with qualitative and quantitative tests. 

Patil et al. 5175 

Name of isolate *Blood hemolysis *Blue agar *Oil spread *Drop collapse EI (%) Surface tension dyne/cm 

S. koreensis ++++ ++ ++++ ++++ 100% (24 h) 62.4 to 27.8 

P.aeruginosa +++ ++ +++ +++ 100% (24 h) 62.3 to 31.6 

Rhodococcus ++ - ++ ++ 100% (48 h) 64.4 to 43.7 

R72 +++ - - - - - 

*Number of ‘+’ signs indicates the degree of biosurfactant activity in qualitative tests, ‘-’ sign indicates the absence of the desired activity. 

‘-’ sign indicates the absence of the desired activity 

Figure 1. Biosurfactant activity of S. koreensis in (a) blood agar, (b) EI-24 in (i) petrol 

and (ii) diesel, (c) foam formation in production medium. 

Figure 1: Biosurfactant activity of S. koreensis in (a) blood agar, (b) EI-24 in (i) petrol 

been carried out on previously isolated strains of bacteria 

and fungi. According to many published reports, 

investigators successfully isolated biosurfactantproducing 

organisms from soils contaminated with 

hydrocarbons or mineral oils (Mukherjee et al., 2009; 

Moran et al., 2001; Mulligan, 2005). Taking this as a 

guideline, in the present investigation, samples of soil 

contaminated with petroleum and its products were 

collected for isolation of unique and acclimatized bacteria 

that might possess superior biosurfactant activity. From 

the enriched samples, a total of 129 bacterial strains 

were isolated and preserved on nutrient agar slants until 

use. 

Screening for biosurfactant production 

The screening program yielded three bacterial isolates 

that could reduce the surface tension with high 

efficiencies (Table 1 and Figure 1). The isolates were 

identified by routine microbiological tests, API32 and 16s 

rRNA profiling as Stenotrophomonas koreensis (NCBI 

Acc. No. GQ 493998), Pseudomonas aeruginosa and 

Rhodococcus sp. Among the three isolates, S. koreensis 

showed highest levels of biosurfactant activity with the 

qualitative and quantitative assays, hence it was chosen 

for further experimentation. It was found that the 

quantitative du Nouy ring method was the most reliable 

a b c 

(i) (ii) 

and (ii) diesel, (c) foam formation in production medium 

and sensitive method for determination of surface tension 

reducing ability followed by the emulsification index 

method. Moreover, it was also observed that isolates that 

showed blood haemolysis (in this case the isolate 

designated R72) were not necessarily efficient producers 

of biosurfactants as evidenced from their inability to 

reduce the surface tension of the medium. Similar 

observations were also made by Plaza et al. (2005) 

where blood agar haemolysis method yielded many false 

positive isolates. It could be seen that among the 

qualitative tests, the oil spread and drop collapse 

methods were the most reliable methods for screening, 

since organisms testing positive with these tests were 

also strongly positive with the quantitative tests. In 

general, it could be concluded that the qualitative oil 

spread method may be used as a standard screening 

method on account of its simplicity, rapidity and reliability. 

For further work on optimization of biosurfactant yield and 

its quantification, the highly sensitive quantitative de 

Nouy ring method may be used. 

Optimization of growth parameters 

It was observed that glucose as carbon source and 

potassium nitrate as nitrogen source yielded maximum 

biosurfactant production as evidenced from the reduction 

in surface tension by du Nouy ring method (Table 2). A


Table 2. Optimization of carbon and nitrogen sources of MSM for biosurfactant production by S. koreensis. 

Nitrogen source 

Surface tension reduction (dynes/cm) 

Glucose Mannitol 

(NH4)2SO4 31.2 29.4 

KNO3 34.6 29.2 

NH4NO3 21.4 24.7 

NH4H2PO4 19.4 20. 2 

Time (h) 

Figure 2. The efficiency of removal of lead Time and (h) cadmium by S. koreensis. 

temperature of 37°C and pH 6 were found to yield 

maximal levels of biosurfactant. The time required for 

complete emulsification of the added oils and to lower the 

surface tension of the production medium (MSM) was 24 

to 30 h. The surface tension remained more or less the 

same for several days once the critical micelle 

concentration is attained. Using the Placket and Burman 

design for media optimization, it could be concluded that 

MgSO4 and KH2PO4 were the very critical factors that 

affected biosurfactant production. Thus, the enrichment 

and screening program on the first place and 

subsequently the media optimization step have been 

useful for obtaining more efficient organisms that could 

be valuable for large-scale industrial applications. 

Moreover, it was possible to obtain a novel strain of S. 

koreensis that had a high efficiency of reducing the 

surface tension of liquids (Table 2). 

Determination of lead and cadmium tolerance for S. 

koreensis by Kirby-Bauer method and metal removal 

studies 

In the present experiments, lead and cadmium were 

chosen for heavy metal removal studies due to the 

following reasons: (i) ease of availability of the metal 

salts, (ii) availability of sensitive atomic absorption 

spectrophotometric method for estimations (iii) huge data 

available on removal and recovery of these metals from 

solutions, (iv) large scale use of these metals in 

industries (viz. batteries, cable coverings, plumbing, fuel, 

paints, PVC plastic, pencils, pesticides, alloys for lead 

and Ni-Cd batteries, coating, pigments, fertilizers for 

cadmium) that raises environmental concerns about 

heavy metal pollution, (v) major toxic effects of these 

metals on living cells, (vi) reports on rhamnolipid (a type 

of biosurfactant) interactions specifically with lead and 

cadmium and use of the interactions to eliminate 

cadmium toxicity (Desai et al., 1994; Franzetti et al., 

2010; Mulligan, 2005). It was found that the isolates 

obtained in the present studies were tolerant to high 

metal concentrations of 200 ppm. This resistance could 

be attributed to the presence of biosurfactant that could 

effectively complex with the metal ions in solution. The 

biosurfactant might confer resistance by a complexation 

mechanism that removes ions from solution and thus 

keeping the toxic metal away from the bacterial cells 

(Banat et al., 2010; Mulligan, 2005; Sandrin et al., 2000; 

Zosim et al., 1983). It was observed that more than 30% 

of the metal ions were removed from the media (Figure 

2). It is evident from Figure 3, that there was a huge 

reduction in the surface tension of the medium in 24 to 30

Figure 3. The correlation of reduction in surface tension and metal removal as a result of 

biosurfactant productionbyS. Koreensis. 

h after inoculation of the culture. This reduction is seen 

as a spurt of increase in the difference in surface tension 

of sample and control that is, Δ dyne/cm. The reduction in 

the surface tension was due to production of 

biosurfactant that also reduced metal concentration of the 

medium. Although the metal removal efficiency appears 

to be low, it must be mentioned that percentage figures 

are often misleading, since at lower metal concentrations 

the observed percent removal values could be greater 

(Paknikar et al., 1999). Moreover, at low metal 

concentrations, better growth of bacteria would result in 

higher biomass and biosurfactant yields, and hence 

better metal removal efficiencies. The concentrations of 

heavy metals in industrial effluents are often in the range 

of 10 to 50 ppm. At these lower concentrations, 

conventional physical and chemical methods of treatment 

do not work efficiently; whereas, biosurfactant-based 

method would work efficiently. 

Conclusion 

Time (days) 

A novel metal resistant bacterial culture capable of high 

biosurfactant activity was isolated from petroleum 

contaminated soil through a systematic screening 

program. The bacterial culture produced a biosurfactant 

rhamnolipid that proffers resistance to metals and was 

also responsible for removing metals from solutions. Due 

to the biodegradability and low toxicity, biosurfactants 

may have a promising future for use in remediation of 

metalliferous wastes. Considering these aspects, further 

research on purification and detailed characterization of 

the material using chromatographic techniques and 

instrumental analysis is being pursued in the laboratory. 


Patil et al. 5177 

The authors express deep sense of gratitude to late Dr. 

Vasantrao Pawar (Sarchitnis, Maratha Vidyaprasarak 

Samaj, Nashik) and Dr. V. B. Gaikwad (Principal, KTHM 

College, Nashik) for providing infrastructure, laboratory 

facilities and constant motivation. 

REFERENCES 

Banat IM, Franzetti A, Gandolfi I, Bestetti G, Martinotti MG, Fracchia L, 

Smyth TJ, Marchant R (2010). Microbial biosurfactant production, 

applications and future potential. Appl. Microbiol. Biotechnol., 87 : 

427-444. 

Benincasa M, Contiero J, Manresa MA, Moraes IO (2001). Rhamnolipid 

production by Pseudomonas aeruginosa LBI growing on soapstock 

as the sole carbon source. J. Food Eng., 54 : 283-288. 

Bodour AA, Dress KP, Mair RM (2003). Distribution of Biosurfactant- 

Producing in Undisturbed and Contaminated Arid Southwestern soils. 

Appl. Environ. Microbiol., 30 : 3280-3287. 

Bodour AA, Miller-Maier RM (1998). Application of a modified dropcollapse 

technique for surfactant quantitation and screening of 

biosurfactant producing microorganism. Microbiol. Methods, 32 : 

273–280. 

Bonglo G (1998). Biosurfactants as emulsifying agents for 

hydrocarbons. Colloidal Surf A: Physiochem Eng. Aspects, 152 : 41- 

52. 

Bordoloi NK, Konwar BK (2007). Microbial Surfactant-enhanced mineral 

oil recovery under laboratory conditions. Colloids and surfaces B : 

Biointerfaces, 63 : 73-82. 

Bosch MP, Robert M, Mercade ME, Espuni MJ, Parra JL, Guinea J 

(1988). Surface active compounds on microbial cultures.Tenside 

surfactants Deterg., 25 : 208-211. 

Cha DK (2000). The effect of biosurfactant on the fate and transport of 

non-polar organic contaminants in porous media. Environ. Eng., 20: 

1-17. 

Das K, Mukherjee AK (2007). Comparison of lipopeptide biosurfactant 

production by Bacillus subtilis strain in submerged and solid state 

fermentation system using a cheap carbon source: Some industrial


application of biosurfactant. Proc. Biochem., 42: 1191-1199. 

Desai J, Banat IM (1997). Microbial production of Surfactants and their 

commercial potential. Am. Soc. of Microbio., 61 (1): 47-67. 

Desai J, Patel RM, Desai JD (1994). Advances in production of 

biosurfactant and their commercial applications. Sci. Ind. Res., 53: 

619–629. 

Franzetti A, Gandolfi l, Bestetti G, Smyth TJ, Banat IM (2010). 

Production and applications of trehalose lipid biosurfactants. Eur. J. 

Lipid. Sci. Tech., 112 : 617-627. 

Harman DC, Artiola JF (1995). Removal of cadmium, lead, and zink 

from soil by a rhamnolipid biosurfactant.Environ. Sci. Technol., 29: 

2280-2285. 

Kosaric N (2000). Biosurfactant in Industry. Pure and Appl. Ind., 64 (11): 

1731-1737. 

Lang S, Wullbbrandt D (1999). Rhamnos lipid biosynthesis, microbial 

production and application potential. Appl. Microbiol. Biotechnol., 55: 

713-721. 

Moran C, Martinez MA, Sineriz F (2001). Quantification of surfactin in 

Culture Supernatants by Haemolytic Activity. Biotechnol. Lett., 241: 

176-180. 

Mukherjee S, Das P, Sen R (2009). Rapid quantification of a microbial 

surfactant by a simple turbidometric method. J. Microbiol. Meth., 76: 

38-42. 

Mulligan CN (2005). Environmental Application for Biosurfactants. 

Environ. Poll., 133: 183-198. 

Muthusamy K, Gopalkrishna S, Ravi TK, Sivachidambaram P (2008). 

Biosurfactants: properties, commercial production and application. 

Curr. Sci., 94: 736-747. 

Paknikar KM, Puranik PR, Pethkar AV (1999). Development of microbial 

biosorbents- a need for the standardization of experimental protocols. 

In: Ballaster A, Amils R. Biohydrometallurgy and the environment 

toward the mining of the 21 st century, Elsevier, Amsterdam., 2 : 363- 

372. 

Plaza GA, Zjawiony I, Banat IM (2005). Use of Different methods for 

detection of thermophilic biosurfactant producing bacteria in 

undisturbed and contaminated acid southwestrern soil. J. Petroleum 

Sci. Eng., 50 : 71-77. 

Plociniczac PM, Plaza GA, Seget ZP, Cameotra SS (2011). 

Environmental Applications of Biosurfactants: Recent Advances. Int. 

J. Mol. Sci., 12(1): 633-654. 

Sandrin R, Chech AM, Maier RM (2000). A rhamnolipid biosurfactant 

reduces cadmium toxicity during naphthalene biodegradation. Appl. 

Environ. Microbiol., 66 : 4585-4588. 

Zosim Z, Gutnick DL, Rosenberg E (1983). Uranium binding by emulsan 

and emulsansols. Biotech. Bioengg., 25: 1725-1735.



DOI: 10.5897/AJMR11.1388 



Combining biocontrol agent and high oxygen 

atmosphere, to reduce postharvest decay of 

strawberries 

Kraiem Menel 1 , Kachouri Faten 2 and Hamdi Moktar 1 * 

1 Laboratoire Microbial Ecology and Technology, National Instituteof Applied Science and Technology (INSAT), 

B. P. 676, 1080Tunis, Tunisia. 

2 Laboratory Microbial Ecology and Technology, School of Food Industries (ESIAT), 53, Alain Savary Street, 1002, 

Tunisia. 

Accepted 27 December, 2011 

The use of Lactobacillus pentosus, in combination with high oxygen packaging modified atmosphere 

(O2MAP) for the preservation of the good quality of strawberries to control fruit decay, was investigated 

for 4 storage days at 4°C. Fruits without bacterial treatment and high O2 modified atmosphere 

packaging (MAP) decreases water loss (82.15%) and fruit decay (66.7%). However, bacterial-treated 

fruits and high O2 MAP effects are enhanced giving water loss reduction and a fruit decay preservation 

at about 33.81 and 14.28%, respectively. The color index, (L x (a/b)), was effectively preserved under the 

combined bacterial-high MAP with 21.9 for 80% O2 compared to the control. L. pentosus fruit adding 

was significantly beneficial for quality preservation by enhancing the high O2 MAP (80% O2) moulds and 

yeasts spoilage to 31.47% (p


resistant strain of pathogens (Conway et al., 2004). The 

resistance increase of fungal pathogens against 

fungicides had resulted in a significant interest in the 

development of alternative methods of fruit control 

(Ragasdale and Sister, 1994). 

Biological control was developed as an alternative to 

synthetic fungicide treatment. A considerable success 

was achieved after utilizing antagonistic microorganisms 

to control both preharvest and postharvest diseases 

(Janisiewicz and Korsten, 2002). Various microbial 

antagonists have been reported to control several 

different pathogens on various fruits and vegetables 

(Fravel, 2005). 

A major advantage of using lactic acid bacteria (LAB) 

as biocontrol agent is that it is generally recognized as 

safe (GRAS) and usually matches all recommendations 

for food products (Stiles and Holzapfel, 1997). Moreover, 

LAB is natural colonizers of fresh fruit and has been 

previously described as good antagonists of several 

bacteria and fungi in different food products (Batish et al., 

1997; Sathe et al., 2007). 

Lactic acid bacteria strains can be used to prevent the 

development of blue mold. This finding is supported not 

only by the observed inhibition capacity, but also by other 

characteristics. In fact, they have a wide growth range, 

which allows their application under different conditions, 

including refrigerator temperatures. Moreover, some acid 

lactic bacteria strains such as Lactobacillus plantarum 

and Lactococcus lactis are able to inhibit more than one 

phytopathogen, which is beneficial for a wide range of 

plant protection (Trias et al., 2008). 

Protection of food from spoilage and pathogenic 

microorganisms by LAB is done through producing 

organic acids, hydrogen peroxide, diacethyl (Menssens 

and De Vugst), antifungal compounds such as fatty acids 

(Corsetti et al., 1998) or phenullactic acid (Lavermicocca 

et al., 2000), and/or bacteriocins (De Vugst and 

Vandamme, 1994). 

The antimicrobial activity was shown in the lactic acid 

bacteria isolated from a traditional fermented milk “Raib” 

acting as a barrier to inhibit food spoilage and/or growth 

of pathogenic microorganisms in foods (Mechai and 

Kirane, 2008). 

It is important to note that there are effective methods 

which could increase the biological efficacy and inhibit 

fungal spoilage. Enhancement of biological control could 

be obtained by combining organic and inorganic additives 

(Jackson et al., 1991). Droby et al. (2009) affirmed that 

the biological control is only effective when concentration 

of the antagonist is reached and the efficacy is not as 

useful as fungicides. There are many papers about the 

modest efficiency of the biological biocontrol when 

applied alone, and researches studies about the efficacy 

of combining antagonists with other postharvest treatments 

(Spotts et al., 2002) are appearing in increased 

number. 

The combination of different preservations methods 

such as modified atmosphere packaging, low temperature 

storage or the additional preservation methods may be 

an excellent way to preserve the original quality attributes 

of these products (Alzamora, 1998). 

Enhancement of the biocontrol activity of antagonist 

can be obtained when combined with another strawberry 

treatment, such as, modified atmosphere treatment. 

Recently, elevated oxygen atmospheres was suggested 

as an alternative to the traditional low oxygen and high 

CO2 modified atmosphere packaging to maintain quality 

and safety (Day, 1996). Also, high O2 atmosphere was 

suggested as an effective method to inhibit the growth of 

microorganisms and prevent undesirable anoxic 

fermentation (Kader and Ben Yehoshua, 2000). 

The objective of this study is to evaluate the combined 

effect of the lactic acid bacteria and high oxygen 

atmosphere treatment on the undesirable microbial 

strawberries strain and the overall postharvest fruit 

quality for 4 storage days at 4°C. 


Fruits treatment and storage condition 

Strawberries (cv. Camarosa) were harvested at the red ripe stage 

from a local market and transported to laboratory. After their 

selection according to size and color uniformity, strawberries were 

ready to be used for the test. 

All samples were stored, after being weighted, under the 

considered modified atmospheres at 4°C for 4 days. The 

strawberries were packaged using tree packaging models of 

modified atmosphere: 20, 50 and 80%O2 balanced with the N2. All 

these packaging atmosphere were achieved by using a 

polyethylene bag, and a gas packaging unit composed of a gas 

mixer (Witt-Gasetechnik), and a vacuum compensation chamber 

(mini pack-Torre/Food Division). 

Biological material 

The bacterial strain used in this study is L. pentosus isolated from 

rayeb spontaneous fermented milk grown in Man–Rogosa-Sharpe 

(MRS) (De Man et al., 1960) at 32°C. L. pentosus was prepared in 

MRS incubated at 32°C for 24 h, and then washed twice by 

centrifugation (3500 g, 30 min) with 9‰ NaCl solution. The final cell 

was suspended in 10 ml of 9‰ NaCl solution, resulting in a final 

bacterial concentration ranging from 1.3 to 3.1 × 10 6 CFU/ml. The 

bacterial cocktail was then immediately sprayed on the strawberries 

under a slight agitation to maximize the bacteria adherence to the 

fruit surface. After that, the fruit were placed on a sterile sealed 

polyethylene bag (100 g) and kept at 4°C under different modified 

atmospheres. 

Visual decay assessment, weight loss and water content 

The visual decay of the strawberries was measured by weighing 

fruit with visible mycelium growth and with damaged surface due to 

softening and bruising. Fruit decay was expressed as a percentage 

of fruit showing decay symptoms (Zheng et al., 2007). 

The weight loss due to transpiration and respiration of the fruit was 

measured by weighing the fruit each day of the experiment, and 

expressed as a percentage of the original weight of the packaged 

fruit (Zhang et al., 2008).

To estimate the water content, strawberry were heated at 100°C 

for 2 h in a Universal Oven (Memmert UNB500). Water content was 

expressed using the weight after heating as a percentage of the 

initial weight. 

Color surface measurement, total titrable acidity (TAA) and pH 

The fruit surface color intensity was measured with a hand-held 

Tristimulus reflectance colorimeter (Spectrocolorimetre mobile 

color-test/ Erichsen SARL). Color was recorded using the CIE - L * 

a * b * uniform color space (CIE-Lab), where L * indicates lightness, a * 

indicates chromaticity on a green to red axis, and b * chromaticity on 

a blue to yellow axis (Francis, 1980). These recorded color values 

(a * and b * ) or some of their combinations should be considered as 

the physical parameters to describe the visual color degradation. 

Ahmed et al. (2002) founded out that a representation of visual 

quality in terms of total color may be more relevant. This is why they 

founded that L * (a * /b * ) or (L * a * b * ) are the best combination (Ahmed et 

al., 2004). The intensity or the saturation color was expressed by 

* * 2 * 2 1/ 

2 

Chroma (C*) ( C � [ a � b ] ). 

The titrable acidity was determined by titration with NaOH (0.1 N) 

to an end point of pH = 8.1. The results were calculated as percent 

of citric acid (Nunes et al., 1995). 

The pH of the puree was determined using a pH-meter (WTW, 

pH/oxi 340i) standardized to pH 4 and 7. 

Microbiological analysis 

After opening the packages, 30 g of each package was aseptically 

added into a stomacher bag and diluted with a peptone saline 

solution (8.5 g NaCl/L + 1 g peptone/L). A dilution series was made 

(1:10) and the microbial levels of the packaged vegetables were 

determined after plating each one onto the appropriate media. 

Lactic acid bacteria were counted on MRS agar plate (MRS-agar, 

Oxoid) after 3 days of incubation at 30°C. Sorbic acid (Sigma) was 

added to MRS-agar at 1.4 g/L to prevent growth of yeast and 

moulds. The aerobic psychrotrophic count was determined on plate 

count agar (PCA, oxoid), then incubated at 22°C for 5 days. The 

yeasts and mould count was enumerated on yeast glucose 

chloramphenicol agar (YGC-agar) after 3 days of incubation at 

30°C (Van der Steen et al., 2002). 


The storage experiment was conducted in triplicate. The statistical 

analyses were performed by ANOVA and the Student’s t-test. The 

results were expressed as means ± SE to show variations in the 

different experiments. Difference was considered significant at p < 

0.05. 


Overall quality 

At 20% O2 storage condition, we observed a low water 

content which can be reported to be due to fruits 

packaging (Table 1). In fact, packaging enhanced loss of 

firmness during cold storage by affecting loss of cell wall 

integrity (Amarante et al., 2002). At 20% O2 there was no 

interesting effect observed for the refrigeration. 

Cordenunsi et al. (2005) demonstrated that reducing the 

Kraiem et al. 5181 

storage temperature is an effective way to extend the 

strawberry shelf-life maintaining the fruits edible for 

additional days. However, temperature can also affect 

some ripening-related processes, which in turn can 

improve both sensorial and nutritional value. 

The 20% O2 strawberries atmosphere showed the 

greatest loss of weight at about 91.17 and 32.35%, 

respectively for the control and the bacterial treated 

samples, at the end of the storage period (Figure 2). Van 

der Steen et al. (2002) reported in similar works that the 

resulting loss after 3 days of storage was due to fungal 

respiration translated into H2O production. Wszelaki and 

Mitcham (2000) reported in comparable published works 

that low O2 modified atmosphere prevents the 

strawberries Botrytis growth. These are major factors 

which affect the fruit quality causing up to 50% of loss. 

The bacterial fruit spray reduced the weight loss 

through coating the fruit surface and avoiding the higher 

water loss. This fact is explained by the construction of a 

hydrophobic film forming a continuous matrix around the 

product reported to be bacterial exopolysaccharides 

(Sánchez-González et al., 2010). 

The LAB adding prevented water loss for high oxygen 

storage atmosphere condition especially for the 80% O2 

which improves the water preservation at about 43.33% 

compared to 20% O2 (Figure 2). The high oxygen 

atmosphere enhanced the water fruit preservation 

compared to the control about 59.67 and 33.81%, 

respectively for 50 and 80% O2. The LAB fruit adding 

provided the preservation of the fruit quality due to the 

bacterial inhibitory metabolites that avoid growth which 

cause damage in the fruit surface. 

The non bacterial treated fruit decay was also affected 

by the applied O2 treatments and reached 14.28% for 

80% O2 compared to 20% O2 (Figure 1). A similar 

example of decay suppression under high O2 level during 

cold storage at 5°C was also observed in blueberries by 

Zheng et al. (2003). The enriched atmospheres with O2 ≥ 

60 kPa were effective in inhibiting strawberry fruit decay 

during storage tanks to the oxygen atmosphere 

concentration toxicity (Zheng et al., 2007). 

Fruit quality was preserved after the bacteria adding for 

the entire storage oxygen atmosphere 33.3, 57.14 and 

66.7% for 20, 50 and 80% O2, respectively (Figure 1). 

The fruit quality preservation is a result of the water 

loss reduction. Also, the oxidative stress may affect 

synthesis and accumulation of some volatile compounds 

associated with respiratory metabolism, including 

fermentative metabolites such as acetaldehyde, ethanol 

and ethyl acetate (Wszelaki and Mitcham, 2003). 

The adding of bacterial to the fruit prevented decay for 

all oxygen atmospheres especially for the 80% O2 which 

experienced a decrease of about 58.3% compared to the 

control (Figure 1). Bacterial coatings associated to the 

modified packaging atmosphere could delay fruit 

senescence, by decreasing both respiration rate and 

water losses, which could be explained by the changes in 

the mechanical response and color development during


Table 1. Effect of the oxygen atmosphere concentration on strawberries color parameters (a and b) and indice ((L*(a/b) and Chroma value), during 3 days of storage at 4°C * . 

Day % O2 

a b L*(a/b) Chroma value 

Control Inoculated Control Inoculated Control Inoculated Control Inoculated 

Day 0 39.37±0.23 42.54±0.16 20.25±0.16 22.30±0.83 72.64±1.38 76.27±2.54 44.27±0.77 48.03±1.65 

Day 1 

Day 2 

Day 3 

20 35.15±0.36 38.72±0.23 21.51±0.17 22.33±0.16 60.15±1.63 66.12±1.94 41.21±0.75 44.70±0.67 

50 39.43±0.11 43.33±0.09 21.95±0.38 25.98±0.39 72.11±1.86 73.10±1.39 45.13±0.91 50.52±0.80 

80 34.42±0.09 37.99±0.27 20.75±0.22 22.66±0.83 53.28±1.04 61.88±0.93 40.19±0.06 44.23±0.53 

20 37.64±0.34 31.10±0.11 23.87±0.11 25.08±0.27 52.19±0.89 43.79±2.54 44.57±1.46 39.95±0.46 

50 39.84±0.08 31.07±0.32 25.02±0.27 25.21±0.75 65.22±0.64 44.49±2.65 47.04±1.84 40.01±1.99 

80 35.63±0.13 34.73±0.15 21.58±0.16 22.34±0.82 56.19±0.82 56.37±3.85 41.66±1.36 41.29±1.28 

20 35.02±0.24 21.24±0.15 21.05±0.18 13.91±0.55 53.79±0.91 33.82±2.48 40.86±1.25 25.39±0.66 

50 32.28±0.43 17.45±0.03 22.85±0.08 12.25±0.36 53.70±0.75 35.88±1.84 39.55±0.98 21.32±1.75 

80 36.14±0.61 24.41±0.05 22.55±0.12 22.55±0.26 19.50±0.15 23.13±2.89 42.60±1.32 33.23±1.35 

* Data expressed as means ±SE of triplicate essays. 

storage (Garcia et al., 1998). 

pH and acidity 

The lactic bacteria added to the fruit promoted the 

pH decrease compared to the control at the end of 

the test for all the studied storage atmospheres. 

The main observed values for the 80% O2 

atmosphere are in accordance with an increase at 

about 10.9% for the bacterial adding while they 

reached only 9.2% for the control (Table 1). 

According to El-Ziney (1998), media acidification 

was explained by the bacterial metabolites. Lactic 

and acetic acids are the main products of the 

fermentation of carbohydrates by lactic acid 

bacteria, generally recognized as safe agents for 

the preservation of foods. In their steps, Kalt et al. 

(1999) attribute this media acidity to the higher 

strawberry acid ascorbic preserved tanks to the 

intracellular compartmentalization of ascorbic acid 

and phenols. At the end of the test, after the lactic 

acid bacteria adding, we observed a fruit acidity 

increase of about 18.2% 80% O2 (Table 1). Acidity 

increase and pH decrease were reported for lactic 

acid bacteria oxygen toleration under a high 

oxygen concentration atmosphere. In fact, Gram 

negative bacteria are better protected from the 

toxic effect of oxygen metabolites because of the 

synthesis of an outer Iipo-polysaccharide layer 

that traps active molecular oxygen (Dahl et al., 

1989). 

We also observed a noticeable rise of acidity of 

56% for the 80% O2 atmosphere compared to the 

control 20% O2. Pérez and Sanz (2001) founded 

similar results in strawberry exposed to a high 

oxygen atmosphere (90 kPa O2) before day 4 

compared to fruit held in air. 

Color surface measurement 

During the storage time, the chroma decreased 

slightly for the bacterial treated strawberries compared 

with the control (Table 2). It was reduced 

slightly (P < 0.05) for the bacterial high oxygen 

treated sample compared to the control. At the 

end of storage, the chroma value decreased significantly 

for the bacterial treated samples and was 

about 31% while it was only 4% for the control at 

80% O2 atmosphere. The color fruit pre-servation 

was explained by the LAB pH decrease. In fact, 

according to Brouillard (1988), at the pH of 5 to 7, 

the anthocyanins are unstable and are quickly 

decolorized due to hydration at the 2-position of 

the anthocyanidin skeleton. Result confirmed by 

Keller (1984) who associated the fruit color to the 

media pH reporting that the acid induced gelatin 

of pectin at pH levels is lower than 3.5.


Table 2. Effect of the oxygen atmosphere concentration on the strawberries physiochemical parameters: pH, acidity and dry matter, during 3 

days of storage at 4°C*. 

Day Treatment 

pH Acidity (% citric acid) Dry matter (%) 

Control Inoculated Control Inoculated Control Inoculated 

Day 0 3,58±0.33 3.58±0.33 0.82±0.08 0.82±0.08 0.34±0.85 0.34±0.85 

Day 1 20%O2 3.48±0.46 3.65±0.01 0.80±0.05 0.84±0.08 0.42±1.45 0.35±0.79 

50%O2 3.57±0.91 3.42±0.06 0.77±0.02 0.79±0.09 0.45±1.20 0.40±0.07 

80%O2 3.54±0.94 3.39±0.05 0.81±0.88 0.78±0.02 0.54±0.18 0.3±0.02 

Day 2 20%O2 3.36±1.34 3.43±0.05 0.77±0.54 0.79±0.25 0.47±0.74 0.45±0.16 

50%O2 3.34±1.39 3.38±0.02 0.72±0.67 0.78±0.16 0.61±0.38 0.55±0.24 

80%O2 3.33±1.34 a 3.35±0.03 0.77±0.30 0.77±0.33 0.87±0.03 0.59±0.91 

Day 3 20%O2 3.33±1.88 3.34±0.01 0.77±0.44 0.77±0.04 0.65±0.36 0.45±0.08 

50%O2 3.29±1.32 3.23±0.02 0.71±0.58 0.74±0.26 0.84±0.75 0.62±0.74 

80%O2 3.25±1.44 3.19±0.15 0.75±0.19 0.73±0.12 1.23±0.88 0.68±0.09 

* Data expressed as means ±SE of triplicate essays. 

We observed an interesting effect of the bacterial fruit 

adding on the color preservation (color index), especially 

at the last storage day with an improvement of 37, 33 and 

20 and 50% O2, respectively (Table 2). The fruit browning 

surface protection was reported for the ascorbic acid. 

This matches the finding of Dias and Weimer (1998) who 

explained that lactobacilli produce free thiols which 

reduce glutathione as an alternative to ascorbic acid. 

In this study, the controls’ samples showed noticeable 

fruit browning surface during 4 storage days. The 

mechanism involved in browning inhibition by antioxidant 

is explained by LAB treatments. Similar results was 

reported by Lin and Yen (1999) who demonstrated the 

antioxidative activity of the intracellular lactic acid 

bacteria-free extract with an inhibition rate of ascorbate 

oxidation in the range of 7 to 12%. 

Oxidative browning is usually caused by the enzyme 

polyphenol oxidase (PPO) which in the presence of O2 

converts fruits and vegetables phenol compound into 

dark colored pigments. Ascorbic acid can prevent PPOmediated 

cut surface discoloration by reducing pH 

surface, and further slowing browning reaction (Beaulieu 

and Gorny, 2004). This finding reinforced the hypothesis 

of the protective effect of the LAB on the natural ascorbic 

acid fruit content, and on the syntheses of new 

antioxidant compounds. 

Microbiological counting 

The L. pentosus spray on fruit reduced significantly the 

natural spoilage of strawberries at the end of test (Figure 

3) for all the atmospheric studied conditions (p


Figure 1. Effect of the oxygen atmosphere concentration on the strawberries decay 

indices, during 3 days of storage at 4°C. Without lactic acid bacteria (�) and with lactic 

acid bacteria adding ( ).Bars represent standard deviations of the means. 

reduction. The results suggested the use of 80 kPa O2 to 

reduce significantly mycelium growth and the amount of 

moulds spores (Van der Steen et al., 2002) and the use 

of 100 kPa to reduce effectively mycelium growth than 15 

kPa CO2 or air after 14 days at 5°C (Wszelaki and 

Mitcham, 2000). 

The number of aerobic psychrotrophic bacteria 

increased after the bacterial fruit treatment, under the 

different studied MAP reaching 11.35% at the end of the 

test for the 20% O2 atmosphere. However, it attained 

16.89 and18.49% for the 50 and the 80% O2 atmosphere, 

respectively compared to the control (Figure 3). This 

increase was a logic result to the lactic acid bacteria 

proliferation in this adequate environment under high 

oxygen atmosphere. The aerobic psychrotroph also 

observed an increase after the rise of oxygen 

atmosphere. It was about 49 and 63% for the 50 and the 

80% O2, respectively compared to the 20% O2. The 

number of psychrotrophic bacteria increase was reported 

to the lactic acid bacteria oxygen tolerance. Supporting 

this idea, Condon (1987) demonstrated that the hydrogen 

peroxide sensitive lactic bacteria exposed to a sub-lethal 

of oxygen concentration became capable of growth in the 

presence of a lethal concentration of hydrogen peroxide. 

The bacterial fruits adding enhanced the natural lactic 

microbiota of the strawberries under the 20% O2 

atmosphere reaching a rate of 16.22% (Figure 3). 

Without the bacterial treatment oxygen atmosphere

log CFU/g 

log CFU/g 

log CFU/g 

8.5 

7.5 

6.5 

5.5 

4.5 

3.5 

7.5 

6.5 

5.5 

4.5 

3.5 

7.5 

6.5 

5.5 

4.5 

3.5 

Figure 2. Effect of the oxygen atmosphere concentration on 

the strawberries water loss (%), during 3 days of storage at 

4°C. Without lactic acid bacteria (A) and with lactic acid 

bacteria adding (B). Error bars indicate one standard error. 


Figure 3. Effect of the oxygen atmosphere concentration on the microbial strawberries fruits evolution, during 3 days of 

storage at 4°C. Without lactic acid bacteria (�) and with lactic acid bacteria adding (�). The modified atmosphere 

condition: 20% oxygen atmosphere (A), 50% oxygen atmosphere (B) and 80% oxygen atmosphere (C). Error bars 

indicate one standard error.


induced a slight increase in the lactic bacterial fruit 

content, especially for the 80% O2 atmosphere with a rate 

of 16.49% compared to 20% O2 (control). Beside, the 

LAB count increased under high MAP at about 21.21 and 

23.17% for the following atmosphere, 50 and 80% O2, 

respectively (Figure 3). L. pentosus tolerates the oxidant 

stress and enhances the effect of high oxygen storage 

atmosphere. Similar results have been reported by 

Higuchi et al., (2000) showing that NADH oxidase LAB 

induced by O2 in an oxygen-tolerant strain contain two 

types of enzyme activity, one forming H2O2 and the other 

H2O. 

Conclusion 

The strawberry high oxygen modified atmosphere 

treatment has affected the water loss, the fruit decay and 

the microbial profile. But, it did not affect color and pH 

after four storage days at 4°C. The L. pentosus bacterial 

combination with the oxygen MAP treatment preserved 

the fruit quality and microbiology especially for 80% O2 

atmosphere, where the decrease of the moulds and yeast 

and the increase of the lactic acid bacteria enhance the 

color and the water fruit preservation, resulting in fruit 

quality preservation at the end of the test. This bacterialhigh 

MAP postharvest storage technique must be 

thoroughly studied in order to replace the un-safety 

chemical techniques widely applied. 

REFERENCES 

Ahmed J, Shivhare US, Kaur M (2002). Thermal colour degradation 

kinetics of mango puree. Int. J. Food Prop., 5: 359–366. 

Ahmed J, Shivhare, US, Raghavan, GSV (2004). Thermal degradation 

kinetics of anthocyanin and visual colour of plum puree. Eur. Food 

Res. Technol., 218: 525–528. 

Higushi SM, Tapia MS, Welti J (2000). New strategies for minimally 

processed foods. The role of multi-target preservation. Food Sci. 

Technol. Int., 4:353–361. 

Amarante C, Banks NH, Max S (2002). Effect of preharvest bagging on 

fruit quality and postharvest physiology of pears (Pyrus communis). 

New Zeal. J. Crop Hort., 30: 99-107. 

Batish VK, Roy U, Lal R, Grover S (1997). Antifungal attributes of lactic 

acid bacteria. Crit. Rev. Biotechnol., 17: 209-225. 

Beaulieu JC, Gorny JR (2004). Fresh-cut fruits. In: Gross KC, Wang 

CY, Saltveit ME (3 rd eds) USAD Handbook N.66 The commercial of 

fruits, vegetables and florist and nursery stocks, Washington DC 

Agriculture Research Service, USA. 

Brouillard R (1988). Flavonoids and flower colour. In: Harborne JB (eds) 

The flavonoids. Advances in research since 1980. Chapman and 

Hall, London, pp. 525-538. 

Condon S (1987). Responses of lactic acid bacteria to oxygen. FEMS. 

Microbiol. Rev., 46: 269-280 

Conway WS, Levrentez B, Janisiewicz WJ, Blodgett AB, Saftner RA, 

Camp MJ (2004). Integrating heat treatment, biocontrol and sodium 

bicarbonate to reduce potharvest decay of appel caused by 

Colletotrichum acutatum and Penicillum expansum. Postharvest Biol. 

Technol., 34: 11-20. 

Cordenunsi BR, Genovese MI, do Nascimento JRO, Hassimotto NMA, 

dos Santos RJ, Lajolo FM (2005). Effects of temperature on the 

chemical composition and antioxidant activity of three strawberry 

cultivars. Food Chem., 91: 113-121. 

Corsetti A, Gobetti M, Rossi J, Damiani P (1998). Antimould activity of 

sourdough lactic acid bacteria: identification of a mixture of organic 

acids produced by Lactobacillus sanfrancisco CB1. Appl. Microbiol. 

Biotechnol., 50: 253–256. 

Dahl TA, Midden WR, Hartman PE (1989). Comparison of killing of 

Gram-negative and Gram-positive bacteria by pure singlet oxygen. J. 

Bacteriol., 171: 2188-2194 

Day BPF (1996). High oxygen modified atmosphere packaging for fresh 

prepared produce. Postharvest News and Information, 7: 1N–34N. 

Day BPF (1998). Novel MAP a brand new approach. Food Manuf., 73: 

22–24. 

De Man JC, Rogosa M, Shape ME (1960). A medium of cultivation for 

Lactobacillus. J. Appl. Bacteriol., 23, 130-135. 

De Vugst L, Vandamme E J (1994). Bacteriocins of lactic acid bacteria, 

microbiology genetics and applications, Blackie Academic and 

professional, London. 

Dias B, Weimer B (1998). Conversion of Methionine to Thiols by 

Lactococci, Lactobacilli, and Brevibacteria. Appl. Env. Microbiol., 64: 

3320-3326. 

Droby S, Wisniewski M, Wilson C (2009). Twenty years of postharvest 

biocontrol research: Is it time for a new paradigm. Postharvest Biol. 

Technol., 52: 137-145. 

Eckert JW, Ogawa JM (1988). The chemical control of postharvest 

diseases: deciduous fruits, berries, vegetables and root/ tuber crops. 

Ann. Rev. Phytopathol., 26: 433– 469. 

El-Tarabily KA, Sivasithamparam K (2006). Potential of yeasts as 

biocontrol agents of soil-borne fungal plant pathogens and as plant 

growth promoters. Mycoscience, 47: 25–35. 

El-Ziney M (1998). Antimicrobial activity of lactic acid bacteria 

metabolites: The role of lactic acid enterocin 5701 and reuterin. PhD 

dissertation, University of Gent, Belgium. 

Francis FJ. (1980). Colour quality evaluation of horticultural crops. 

HortScience, 15: 58–59. 

Fravel DR (2005). Commercialization an implementation of biocontrol. 

Ann. Rev. Phytopathol., 43: 337–359. 

Garcia JM, Medina RJ, Olias JM (1998). Quality of strawberries 

automatically packaged in different plastic films. J. Food Sci., 6: 

1037–1041. 

Gonzalez-Flecha B, Demple B (1995). Metabolic sources of Hydrogen 

Peroxide in Aerobically Growing Escherichia coli. J. Biol. Chem., 270: 

13681-13687. 

Jackson AM, Whipps JM, Lynch JM, Bazin MJ (1991). Effects of some 

carbon and nitrogen sources on spore germination, production of 

biomass and antifungal metabolites by species of Trichoderma and 

Gliocladium virens antagonistic to Sclerotium cepivorum. Biocontrol 

Sci. Techn., 1: 43-51. 

Janisiewicz WJ, Korsten L (2002). Biological control of postharvest 

diseases of fruits. Ann. Rev. Phytopathol., 40: 411–441. 

Higuchi M, Yamamoto Y, Kamio Y (2000). Molecular biology of oxygen 

tolerance in lactic acid bacteria: Functions of NADH oxidases and 

Dpr in oxidative stress. J. Biosci. Bioeng., 90: 484-493. 

Kader AA, Ben-Yehoshua S (2000). Effects of superatmospheric 

oxygen levels on postharvest physiology and quality of fresh fruits 

and vegetables. Postharvest Biol. Technol., 20: 1–13. 

Kalt W, Forney CF, Martin A, Prior RL (1999). Antioxidant capacity, 

vitamin C, phenolics, and anthocyanins after fresh storage of small 

fruits. J. Agric. Food Chem., 47: 4638–4644. 

Keller J (1984). Pectin. In: D.L. Downing (eds) Gum and Starch 

Technology 18 th Annual Symposium. New York State Agri. Exp. Sta. 

Special Report 53, USA. 

Lavermicocca P, Valeria F, Evidente A, lazzaroni S, Corsetti A, Gobbetti 

M (2000). Purification and characterization of novel antifungal 

compounds by sourdough Lactobacillus plantarum 21 B. App. 

Environ. Microb., 66: 4084-4090. 

Lin MY, Yen CL (1999). Antioxidative Ability of Lactic Acid Bacteria. J. 

Agric. Food Chem., 47: 1460–1466. 

Mechai A, Kirane D (2008). Antimicrobial activity of autochthonous lactic 

acid bacteria isolated from Algerian traditional fermented milk “Raïb”. 

Afr. J. Biotechnol., 7: 2908-2914. 

Menssens W, De Vugst L (2002). Inhibitory substances produced by 

Lactoacilli isolated from sourdougts. In. J. Food Microbiol., 72: 31-43. 

Nunes MCN, Brecht JK, Sargent SA, Morais AM (1995). Effects of

delays to cooling and wrapping on strawberry quality (cv. Sweet 

Charlie).Food Control, 6: 323-328. 

Pérez AG, Sanz C (2001). Effect of high oxygen and high carbon 

dioxide atmospheres on strawberry flavor and other quality traits. J. 

Agric. Food Chem., 49: 2370–2375. 

Ragaert P, Devlieghere F, Loos S, Dewulf J, Van Langenhove H, 

Debevere J (2006). Metabolite production of yeasts on a strawberryagar 

during storage at 7°C in air and low oxygen atmosphere. Food 

Microbiol., 23: 154– 161. 

Ragasdale NN, Sister HD (1994). Social and political implications of 

managing plant disease with decreased availability of fungicides in 

the United States. Ann. Rev. Pythoplatol., 32: 51-58. 

Sallato BV, Torres R, Zoffoli JP, Latorre BA (2007). Effect of boscalid on 

postharvest decay of strawberry caused by Botrytis cinerea and 

Rhizopus stolonifer. Span. J. Agric. Res., 5: 67-68. 

Sams CE, Conway WS (1987). Additive effects of controlled 

atmospheres storage and calcium chloride on decay, firmness 

retention, and ethylene production in apples. Plant Dis., 71: 1003– 

1005. 

Sánchez-González L, Gonzalez-Martinez C, Chiralt A, Chafer M 

(2010). Physical and antimicrobial properties of chitosan–tea tree 

essential oil composite films. J. Food Eng., 98: 443-452. 

Sathe SJ, Nawani NN, Dhakephalkar PK, Kapadnis BP (2007). 

Antifungal lactic acid bacteria with potential to prolong shelf-life of 

fresh vegetables. J. Appl. Microbiol., 103: 2622-2628. 

Spadaro D, Vola R, Piano S, Gullino ML (2002). Mechanisms of action 

and efficacy of four isolates of the yeast Metschnikowia pulcherrima 

active against postharvest pathogens on apples. Postharvest Biol. 

Technol., 24: 123–134. 

Spotts RA, Cervantes LA, Facteau TJ (2002). Integrated control of 

brown rot of sweet cherry fruit with a preharvest fungicide, a 

postharvest yeast, modified atmosphere packing, and cold storage 

temperature. Postharvest Biol. Technol., 24: 251–257. 


Stiles M, Holzapfel W (1997). Lactic acid bacteria of foods and their 

current taxonomy. Int. J. Food Microbiol., 36: 1-29. 

Trias R, Baneras L, Montesinos E, Bados E (2008). Lactic acid bacteria 

from fresh fruit and vegetables as biocontrol agents of 

phytopathogenic bacteria and fungi. Int. Microbiol., 11: 231-236. 

Van der Steen C, Jacxsens L, Devlieghere F, Debevere J (2002). 

Combining high oxygen atmospheres with low oxygen modified 

atmosphere packaging to improve the keeping quality of strawberries 

and raspberries. Postharvest Biol. Technol., 26: 49–58. 

Wszelaki AL, Mitcham EJ (2000). Effects of superatmospheric oxygen 

on strawberry fruit quality and decay. Postharvest Biol. Technol., 20: 

125–133. 

Wszelaki AL, Mitcham EJ (2003). Effect of combinations of hot water 

dips, biological control and controlled atmospheres for control of gray 

mold on harvested strawberries. Postharvest Biol. Technol., 27: 255- 

264. 

Zhang H, Ma L, Wang L, Jiang S, Dong Y, Zheng X (2008). Biocontrol 

of gray mold decay in peach fruit by integration of antagonistic yeast 

with salicylic acid and their effects on postharvest quality parameters. 

Biol. Control., 47: 60–65. 

Zheng Y, Wang SY, Wang SY, Zheng W (2007). Changes in strawberry 

phenolics, anthocyanins, an antioxidant capacity in response to high 

oxygen treatments. Food Sci. Technol. Leb. Wiss. Technol., 40: 49– 

57. 

Zheng Y, Wang CY, Wang SY, Zheng W (2003). Effect of high-oxygen 

atmospheres on blueberry phenolics, anthocyanins, and antioxidant 

capacity. J. Agric. Food Chem., 51: 7162–7169



DOI: 10.5897/AJMR11.1558 



Expression, purification and antigenic evaluation of 

toxin-coregulated pilus B protein of Vibrio cholera 

Kiaie S. 1 , Abtahi H.²*, Alikhani M. 3 and Mosayebi G. 2 

1 Department of Microbiology and Immunology, School of Medicine, Arak University of Medical Sciences, Arak, Iran. 

2 Molecular and Medicine Research Center, Arak University of Medical Sciences, Arak, Iran. 

3 Department of Microbiology, School of Medicine, Hamedan University of Medical Sciences, Hamedan, Iran. 


The toxin co-regulated pilus B (TcpB) as well as tcpA has been verified as a critical colonization factor 

for Vibrio cholera O1. TcpB is a candidate for making subunit vaccine against cholera; this study aims 

to produce an oral vaccine by expressing recombinant toxin co-regulated pilus B in Escherichia coli (E. 

coli). The toxin co-regulated pilus B (tcpB) gene was amplified by polymerase chain reaction (PCR) 

method. PCR product was sub-cloned to prokaryotic expression vector PET32a, was transformed in E. 

coli BL21 (DE3) and was induced by Isopropyl_β-D-1-thiogalactopyranoside (IPTG). Recombinant 

protein was detected by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and 

purified by Ni-NTA resin. The immune response to TcpB in animal model was studied. PCR product of 

tcpB gene has 1297 bp and it was confirmed by sequencing. In SDS-PAGE analysis a band with 65 kDa 

was seen. In patient recovering from cholera and animal model such as Mice, rabbit with oral 

inoculation, high titer of antibody in serum was detected. These results demonstrated that the 

recombinant TcpA is antigenic and can be used in a carrier host as an oral vaccine against cholera. 

Key words: Antigenicity, Escherichia coli, recombinant protein, toxin co-regulated pilus B. 

INTRODUCTION 

Vibrio cholera is a causative agent of the intestinal 

disease (Herrington et al., 1988). V. cholera is important 

in gram-negative motile enteric pathogen, which is 

spread via the fecal-oral route (Manning, 1997) that is, 

upon passage through the stomach, bacterium wields the 

single polar flagellum to reach the epithelial surface in the 

intestinal crypts where it colonies and expression of 

specific virulence genes occurs (Taylor et al., 1987). 

Among these virulence factors are the genes encoding 

the toxin co-regulated pilus (tcp) and tcp biogenesis 

apparatus, the cholera toxin (CT) genes, as well as 

activates of these two main virulence factors. Toxin coregulated 

pilus (tcp) introduces elementary step to 

colonization of the bacteria in small intestine (Rhine and 

*Corresponding author. E-mail: abtahi@arakmu.ac.ir. Tel: 

+988614173502. Fax: +988614173526. 

Taylor, 1994). Tcp is classified as a type 4 pilus, that are, 

long, filamentous appendages expressed by a number of 

Gram-negative bacteria, for example, 

Enteropathogenic Escherichia coli (EPEC), 

Enterotoxigenic Escherichia coli (ETEC) and Neisseria 

gonorrhoeae (Nataro and Kaper, 1998). 

Upon colonization the bacterium produces cholera toxin 

that is composed of two subunits, A and B. The B subunit 

binds GM1 (monosialotetrahexosylganglioside) on the 

epithelial cells providing the insertion and cleavage of the 

A subunit at the membrane (Sandkvist, 2001). 

Contemporaneous expression of CT and tcp is controlled 

via the ToxR regulatory protein, that is, ToxR controls 

expression of another regulator, ToxT, and ToxT directly 

controls expression of virulence gene (Miller and 

Mekalanos, 1988). The cholera toxin operons are verified 

as a section of the genome of the cholera toxin 

bacteriophage (CTXQ), which utilizes tcp as its receptor 

(Walder and Mekalanos, 1996). The toxin co-regulated

pilus (tcp) that is a subtle of polymerized TcpA. The tcp 

operon is composed of nine tcp-specific proteins but is 

nearly characterized (Kirn et al., 2003). The 20.5KD tcpA 

is produced as precursor for the tcp which is processed 

at the cytoplasmic side of the IM via tcpJ which is a 

protease (Taylor et al., 2004). The subunits precursors’ 

protein, tcpA is accumulated into tcp via the tcp 

biogenesis apparatus (Taylor et al., 2004). The 

biogenesis apparatus Including tcpB, tcpE and tcpJ are 

thought to form an assembly scaffold; these intermediate 

proteins are required for tcp assembly. In this report we 

identify one of the components from tcp biogenesis 

apparatus, consisted of tcpB. tcpB was originally 

deduced to amino acid sequence analogously to C of B 

of ETEC (Taniguchi et al., 1995). The tcpA is the major 

pilin subunit and 47.5-kD. Tcpb pilin subunit is required 

for colonization that is also an intermediate subunit as a 

minor pilin along the shaft, which is perhaps a machinery 

of the basal structure (Manning, 1997). As mentioned 

above tcpJ is required for the processing of tcpA, and is 

also responsible for processing of tcpB (Manning, 1997). 

However, experimental evidence provides a prediction for 

tcpB to interact with tcpA in the pili (Manning, 1997). The 

results of the present study indicate tcpB as a tcp 

biogenesis apparatus that is required for tcpA assembly 

and stability. 

Isolation, characterization and expression of Vibrio 

cholera tcpB gene in E. coli as a host are presented in 

this paper. We also showed that recombinant V. cholera 

tcpB protein is recognized by infected sera using Western 

blot analysis. 


Bacterial strains, media and vector 

V. cholerae EL-Tor (Inaba) was used throughout this study. 

Bacterial strain was maintained at -70°C in Lysogeny broth (LB) 

medium containing 25% (vol/vol) glycerol (Miller, 1972). LB and 

TCBS (Thiosulfate Citrate Bile Salts Sucrose) media were prepared 

as described previously (Miller, 1972; Mekalanos et al., 1978). 

Prokaryotic expression vector pET-32a was used. This vector 

enables the expresses a fusion protein with a histidines tag, a 

thrombin recognition site and a T7 tag in N-terminus. These 

additional amino acids increase the size of expressed protein near 

20 kDa. The recombinant pET32a (pET-32a-tcpB) is transformed is 

in E. coli, BL21 (DE3) plysS as host strain. 

Isolation of chromosomal DNA 

After overnight incubation of V. cholera subsp. EL-Tor in LB at 

37°C, bacterial cells were centrifuged at 5000 rpm for 2 min and the 

pellet was re-suspended in 567 µl of TE buffer. Chromosomal DNA 

prepared according to standard CTAB/NACL method. Briefly, resuspended 

the pellet of 1.5 ml overnight bacterial culture in TE 

buffer( Tris 10 mM, EDTA 1 mM, PH 8), the bacterial cell was 

lysed by SDS and proteinase K, the chromosomal DNA was 

extracted by CTAB/NACL solution (10% CTAB and 0.7 M NACL). 

Remove the cell debris and proteins by two times 

phenol/chloroform/isoamylalcohole (25:24:1) mixture. DNA 

kiaie et al. 5189 

precipitated by isopropanol and washed in ethanol (70%), air dried 

and then re-suspend in TE buffer. Quality and quantity of purified 

genomic DNA was assayed by 0.8% Agarose gel electrophoresis' in 

1×TBE buffer and spectrophotometrically (260/280 nm), 

respectively (Sambrook et al., 2001). 

Primers design 

The protein product encoded by the tcpB gene was identified by 

expression It as 6xHis tag and T7 tag fusion proteins. The tcpB 

open reading frame was amplified with two synthetic primers 

containing engineered Xho1 and BamHI sites. Primers were 

designed according to published sequence for tcpb of Cholera 

(accession number: FJ209011); Forward: (5’ TCG AGC TCA TGA 

GAA AAT ACC AA 3’) and Reverse: (5’ ACT CGA GAT TTT CAC 

ACC ATT GA 3’). The PCR product was digested with BamHI and 

XhoI are cloned into the fusion protein expression vector pET-32a. 

The nucleotide sequence of the tcpB gene has been deposited in 

the GenBank data library under accession number FJ209011. 

Gen amplification of tcpB 

PCR was performed in a 50µL total volume containing 500 ng of 

template DNA, 1 µM of each primers, 2.5 mM Mg 2+ , 200 µM (each) 

deoxynucleoside triphosphates, 10× PCR buffer and 2.5 unit of 

Pwo DNA polymerase (Roche). The following conditions were used 

for amplification: hot start at 94°C for 5 min, followed by twenty five 

cycles of denaturation at 94°C for 1 min, annealing at 63°C for 1 

min and extention at 72°C for 1 min. The program followed by a 

final extension at 72°C for 5 min. The PCR product was analyzed 

by electrophoresis in 1% agarose gel in 1× TBE buffer and 

visualized by ethidium bromide staining on UV transilluminator. The 

PCR product was purified from the agarose gel by high pure PCR 

product purification kit (Roche) according to manufacturer 

recommendation. PCR product was checked by electrophoresis in 

1% agarose gel in 1× TBE buffer. 

Cloning of tcpB gene in bacterial expression vector 

The PCR product was digested with BamHI and XhoI and cloned 

into the fusion protein expression vector pET-32a, which digested 

by the same restriction enzymes, that is, by T4 DNA ligase 

(cinagene). At 16°C over night E. coli DH5α and E. coli BL21 (DE3) 

plysS competent cells were prepared by calcium chloride method 

and used for transformation of pET32a -tcpB plasmid. The 

transformed bacteria were selected by screening the colonies on 

antibiotic containing media and plasmid purification. The suspected 

colony further analyzed by restriction enzymes digestion and PCR. 

Expression and purification of recombinant tcpB 

E. coli BL21 (DE3) plysS was transformed with pET32a-tcpB and 

grown in 2 ml LB broth supplemented with Ampicillin (100 µg/ ml) 

and chloramphenicol (34 µg/ml) at 37°C with agitation. A colony 

contained with recombinant plasmid was cultured on shaking 

incubator for overnight at 37°C in 2 ml LB medium containing 100 

µg/ml Ampicillin and 34 µg/ml chloramphenicol. The next day, 500 

µl of culture was removed and inoculated in 50 ml LB broth (per 

litre: 10 g yeast extract (Difco), 20 g bactotryptone broth (Difco), 

0.2% (mass/vol.) glucose, 10 g NaCl, 1 g KCl, 0.5 g MgCl2, 0.5 g 

CaCl2) and incubated at 37°C, shaking at 200 rpm with vigorous 

agitation to an absorbance of 0.5 at 600 rpm. Expression of the 

tcpB protein was then induced by the addition of Isopropyl-β-D-1thiogalactopyranoside 

(IPTG) to a final concentration of 1mM and


70 kda 

60 kda 

50 kda 

1 2 3 4 5 6 7 

Figure 1. Expression and purification of recombinant tcpB Ni-NTA purification of recombinant 

toxin co-regulated pilus produced in E. coli and stained with coomassie brilliant blue. Lane1: 

marker, lane 2: uninduced cells of pET32a-tcpB without using IPTG, lane 3, 4: induced cells of 

pET32a-tcpB with using IPTG at a long time 2 and 4 hours, lane 5, 6 and 7: Extract proteins 

after Ni-NTA affinity chromatography. 

incubation was continued for a further 4 h. The expressed protein 

was purified using Ni-NTA column according to manufacturer’s 

instruction (Qia gene). The purified protein was dialyzed twice 

against PBS (pH 7.5) at 4°C overnight. The quality and quantity of 

purified recombinant tcpB protein was dialyzed by SDS-PAGE 

(15%) and Bradford methods, respectively. 

Antigenicity and Immunoblot analysis of recombinant tcpB 

For preparation of primary antibody 100 µg of emulsion containing 

bacteria and complete freund´s Adjuvant (50 µg vibrio cholerae + 

50 µg complete freund´s Adjuvant sigma, St. Louis Ma) at three 

weeks were injected into five mice, rabbit and acute phase patients 

and sera received as a gift from Dr. Amozande (Immunology 

Department, Iran, Arak). After 21 days Injections were repeated by 

replacing incomplete freund´s Adjuvant (50 µg vibrio cholerae + 50 

µg incomplete freund´s Adjuvant). 10 days after the second 

injection, sera separated were used as primary antibodies. 

RESULTS 

DNA extraction 

The Chromosomal DNA of Vibrio cholera was extracted 

and concentration was adjusted to 250 µg/ml. This DNA 

was used as a template for amplification of tcpB 

gene. PCR product had expected size of 1297 bp 

compare to 100 bp DNA ladder (Fermentas). The 

sequencing result was confirmed by comparing with 

databases and using basic local alignment search tool 

(BLAST) soft ware (data not shown). 

Expression and purification of recombinant tcpB 

pET32a -tcpB in E. coli BL21 (DE3) plysS was induced 

and the expression protein was purified by Ni-NTA 

column (Figure 1). SDS.PAGE analyses, showed the 

expected molecular mass of near 65 kDa recombinant 

protein. The concentration of recombinant protein was 

Assayed and calculated to 400 mg purified protein per 

liter of the initial culture. 

Western immunoblot analysis 

To determine the antigenicity of recombinant tcpB in 

mice, human and rabbit immunized with Vibrio cholera, 

the recombinant tcpB was assayed by Western-blotting. 

Figure 2 shows the specific interaction between 

standardized antibody and purified recombinant tcpB

protein. 

DISCUSSION 

70 kda 

60 kda 

50 kda 

Figure 2. Western blotting analysis of tcpB extracts using anti- tcpB rabbit, human and rabbit antiserums. 

lane 1 : Protein marker, lane 2 : interaction between serum of Immunized mice with purified recombinant 

tcpB protein , lane 3 : interaction between serum of Infected human with purified recombinant tcpB 

protein, lane 4: interaction between serum of Immunized rabbit with purified recombinant tcpB protein, 

lane 5 : control negative. 

Cholera is an acute diarrheal disease leading to death by 

severe dehydration without appropriate treatment, 

especially in developing countries. Vibrio cholerae is 

mainly a fecal-orally transmitted and humans are the only 

known natural host. Cholera has been endemic in 

southern Asia. Cholera has spread in seven pandemic 

since 1817. In 2008, the WHO reported 190,130 cholera 

cases worldwide, associated with 5143 deaths (98% in 

Africa), but cholera is globally under-reported and the 

true disease burden is estimated to be in the millions. In 

addition to endemic outbreaks, sporadic outbreaks can 

occur whenever sanitation and clean water provisions are 

lacking, such as occurred in Zimbabwe between 2008 to 

2009. The ability of V. cholerae to persist in water will 

continue to confound our ability to eradicate cholera and 

thus cholera vaccines are needed. V. cholerae utilizes 

adhesion factors some of which may remain to be 

elucidated, but may include O1 LPS; GlcNAc-binding 

protein (GbpA); a protein (tcpF) secreted by the toxin 

coregulated pilus (tcp) biogenesis apparatus; outer 

kiaie et al. 5191 

membrane protein OmpU and cholera toxin (CT), 

although this has only been implicated in an adult rabbit 

model. Tcp facilitates inter-bacterial interactions that are 

important for colonization. An effective cholera vaccine 

could prevent colonization by inducing the production of 

antibodies that directly neutralize the function of key 

colonization factors and/or facilitate phagocytosis and 

killing through bacterial opsinization (Bishop and Camilli, 

2011). 

Tcp of V. cholera belongs to a subgroup of type-4 

fimbriae and is expressed by both classical and ELT or 

strains of the O1 serotype, as well as O139 Bengal 

(Manning, 1997). In the present study, we sought 

Antigenic activity the tcpB, within the virulence factors 

from V. cholerae serotype inaba. Toxin-Coregulated Pilus 

B (tcpB) would be expected to be important element in 

pathogenesis in V. cholera. Tcpb is a predicated major 

pilin subunit protein with a molecular mass of 49.5 kDa 

and some similarity to tcpA in this pilus (Manning, 1997). 

In this study, recombinant protein TcpB was expressed in 

E. coli BL-21 (DE3) plysS bacteria through expression 

vector pET32a mediated transformation. The presence of 

6xHis tag and T7 tag to the N or C terminal of 

recombinant peptide causes increase near 20 kDa. 

Therefore, molecular weight of tcpB-pET32a fusion


proteins was found to be 65 kDa. Recent studies 

(karaolis et al., 1998, 1999; Walder and Mekalanos, 

1996) of V. cholera have demonstrated that tcp gene 

cluster occupied a V. cholera pathogenicity island which 

genes of lysogenic filamentous phage were included and 

tcp, specific tcpA acts as a receptor foe cholera toxin 

phage (CTXQ). On the other hand, this would show a 

marker for tcpB to indicate more importance of its 

function in pathogenicity pilus. As simple as this sound 

tcpB can be evaluated as a vaccine antigen. These 

results have demonstrated the value of tcpB in the 

genetic analysis of bacterial virulence and its potential 

application in the field of vaccine development. We 

suggest that tcpB in combination with other molecular 

subunits of V.cholera would provide superior protection to 

infection because solid protective immunity requires 

immunization with several parasite proteins rather than a 

single moiety. 

ACKNOWLEDGMENT 

This work was supported by Research council of Arak 

University of Medical sciences. 

REFERENCES 

Bishop AL, Camilli A (2011). Vibrio cholerae lessons for mucosal 

vaccine design. Exp. Rev. Vaccin., 10(1): 79–94. doi: 

10.1586/erv.10.150. 

Herrington DA, Hall RH, Loson sky G, Mekalanos JJ, Taylor RK, Levine 

MM (1988). Toxin, toxin-coregulayed Pili, and the toxR regulon are 

essential for Vibrio cholera pathogenesis in humans. J. Exp. Med., 

168: 1487-1492, PMCID: PMC218907. 

Karaolis DK, Johnson JA, Bailey CC, Boedeker EC, Kaper JB, Reeves 

PR (1998). A Vibrio cholera pathogenicity island associated with 

epidemic and pandemic strains. Proc. NatI. Sci., USA., 95: 3134- 

3139. PMID: 9501228. 

Karaolis DK, Somara S, Maneval DR, Johnson JA, Kaper JB (1999). A 

bacteriophage encoding a pathogenicity island, a type-IV pilus and a 

phage receptor in cholera bacteria. Nature, 399: 375-379. PMID: 

10360577. 

Kirn TJ, Bose N, Taylor RK (2003). Secretion of a soluble colonization 

factor by the TCP type 4 pilus biogenesis pathway in Vibrio cholera. 

Mol. Microbiol., 49: 81-92. PMID: 12823812. 

Manning PA (1997). The Tcp gene cluster of Vibrio cholerae.GENE., 

192: 63-70. PMID: 9224875. 

Mekalanos JJ, Collier RJ, Romig WR (1978). Affinity filters, a new 

approach to the isolation of tox mutants of Vibrio cholerae. Proc. Natl. 

Acad. Sci. USA., 75: 941-945. PMID: 345281. 

Miller JH (1972). Experiments in molecular genetics. ColdSpring Harbor 

Laboratory, Cold Spring Harbor, N.Y. 

Miller VL, Mekalanos JJ (1988). A novel suicide vector and its use in 

construction of insertion mutations: osmoregulation of outer 

membrane proteins and virulence determinants in Vibrio cholera 

requires taxR. J. Bacteriol., 170: 2575-2583. PMCID: PMC211174. 

Nataro JP, Kaper JB (1998). Diarrheagenic Escherichia coli. Clin. 

Microbiol. Rev., 11: 142-201. PMCID: PMC121379. 

Rhine JA, Taylor RK (1994). TcpA pilin sequences and colonization 

requirements for O1 and O139 Vibrio cholera. Mol. Microbiol., 13: 

1013-1020. PMID: 7854116. 

Sambrook SJ, Fritsch EF, Maniatis T (2001). Molecular cloning: A 

Laboratory Manual. 3rd Edn. Cole spring Harbor Laboratory Press, 

New York. 

Sandkvist M (2001). Biology of type II secretion. Mol. Microbiol., 40: 

271-283. PMID: 11309111. 

Taniguchi T, Fujino YK, Yamamoto T, Honda T (1995). Sequencing of 

the gene encoding the major pilin of pilus colonization factor antigen 

III (CFA/III ) of human enterotoxigenic Escherichia coli and evidence 

that CFA/III is related to type IV pili. Infect. Immun., 63: 724-728. 

PMID: 7822050. 

Taylor RK, Kirn TJ, Bose N, Stonehouse E, Tripathi SA, Kovác P, Wade 

WF (2004). Progress towards development of a cholera subunit 

vaccine. Chem. Biodivers., 1(7): 1036-57. PMID: 17191897. 

Taylor RK, Miller VL, Furlong DB, Mekalanos JJ (1987). Use of phoA 

gene fusions to identify a pilus colonization factor coordinately 

regulated with cholera Toxin . Proc. Natl. Acad. Sci. USA., 84: 2833- 

2837. PMCID: PMC304754. 

Walder MK, Mekalanos JJ (1996). Lysogenic conversion by a 

filamentous phage encoding cholera toxin. Science, 272:1910-1914. 

PMID: 8658163.



DOI: 10.5897/AJMR11.1562 



Repellent and fumigant activity of Alpinia officinarum 

rhizome extract against Tribolium castaneum (Herbst) 

Jianhua Lu*, Jiejing Wang, Ya Shi and Lailin Zhang 

School of Food Science and Technology, Henan University of Technology, Zhengzhou 450052, China. 


The plant extract was prepared by Soxhlet method with anhydrous diethyl ether from Alpinia 

officinarum rhizome, a traditional Chinese herbal plant, and its repellent and fumigant activity was 

investigated against Tribolium castaneum (Herbst) adults. The A. officinarum rhizome extract had 

potent repellent activity against T. castaneum adults with over 80% repellency values at the tested 

concentration (A. officinarum extract: acetone = 1:10, v/v) during 48 h of exposure time. A. officinarum 

rhizome extract exhibited strong fumigant activity in a dosage-dependent manner against T. castaneum 

adults with 75% mortality at a dosage of 80 µl/l air after 48 h exposure. These naturally occurring plant 

extracts could be useful for managing populations of T. castaneum. 

Key words: Alpinia officinarum rhizome extract, Tribolium castaneum (Herbst), fumigant activity, repellent 

activity, plant extract. 

INTRODUCTION 

The red flour beetle, Tribolium castaneum (Herbst) 

(Coleoptera: Tenebrionidae) is one of the most serious 

pest of stored grains and processed foods throughout the 

world (Lee et al., 2002a). Currently, control of T. 

castaneu population is primarily dependent upon 

intensive use of phosphine (White and Leesch, 1995). 

However, its repeated use for decades has disrupted 

biological control by natural enemies and led to serious 

problems including insecticide resistance, environmental 

and human health concerns, rising cost of production and 

lethal effects on non-target organisms (Rajendran and 

Narasimhan, 1994; Jembere et al., 1995; Okonkwo and 

Okoye, 1996; Jovanović et al., 2007). Development and 

implementation of alternative control strategies and 

integrated pest management systems have recently been 

considered to be the only solution to combat these 

increasing insecticide-resistant insect pests (Kim et al., 

2003; Tapondjoua et al., 2005). 

Plant-derived insecticides may provide potential 

alternatives to currently used insect-control agents 

because they are natural source of bioactive chemicals 

*Corresponding author. E-mail: jianhlv@yahoo.com.cn. 

with complicated action mechanism, to which the insect 

pests are difficult to produce resistance, readily 

biodegradable, often less toxic to mammalian and with 

less or negligible danger to the environment if used in 

suitable amounts. Particularly, because of the 

unacceptable high cost and difficulty of researching and 

developing new synthetic insecticides, recent research 

has focused on natural product alternatives for pest 

control in developing countries and for organic food 

production in industrialized countries (Boekea et al., 

2004; Isman, 2006, 2008; Liu et al., 2007; Rajendran and 

Sriranjini, 2008; Nerio et al., 2009; Paul et al., 2009). 

Many Chinese herbal plants are potential sources of 

pesticides and have exhibited potent toxic bioactivity to 

stored-grain insects (Yang and Tang, 1988; Wang et al., 

2006; Liu et al., 2007). In fact, as a traditional Chinese 

herbal plant (Lee et al., 2003; Fan et al., 2007), the 

rhizome of A. officinarum Hance (Zingiberales: 

Zingiberaceae) has also for many generations been used 

as a traditional method by farmers to protect stored 

products from insect infestation in China. However, 

bioactivity of plant extract from A. officinarum against T. 

castaneum has not been investigated so far. 

Thus, we evaluated the potential repellent and fumigant 

activity of plant extract obtained from A. officinarum


rhizome against adults of T. castaneum in the laboratory. 


Insects 

Cultures of the red flour beetle, T. castaneum, were maintained in 

the laboratory without exposure to any insecticide at the Institute of 

Stored Product Insects of Henan University of Technology. They 

were reared on wheat flour and rolled oats (6:1, w/w) at 25 to 29°C, 

70 to 80% relative humidity and a 12:12 light:dark photoperiod. 

Healthy, consistent and two-week-old adults were randomly chosen 

for bioassays. 

Preparation of the plant extract 

The A. officinarum rhizome was purchased from a traditional 

Chinese medicine store. It was identified by the Biology Department 

of Zhengzhou University, then dried at room temperature and finely 

ground to powder. Each 50 g of the powder was extracted by 

Soxhlet method with 250 ml anhydrous diethyl ether until the 

distilled liquid was colorless. The solvent was evaporated under 

vacuum in a rotary evaporator. The plant extract was stored in 

airtight fuscous glassware in a refrigerator at 4°C. 

Repellency bioassay 

The repellent effect of the A. officinarum rhizome extract against T. 

castaneum adults was evaluated using the area preference method. 

Test areas consisted of Whatman No.1 filter paper cut in half 

(Ф12.5 cm). The A. officinarum rhizome extract was dissolved in 

acetone (1:10, v/v). Then, 1 ml of the solution was uniformly applied 

to a half-filter paper disc using a micropipette. The other half of the 

remaining filter paper was treated with 1 ml acetone alone and used 

as control. Chemically treated and control half discs were air-dried 

for about 10 min to evaporate the solvent completely. Full discs 

were subsequently remade by attaching treated halves to untreated 

halves with clear adhesive tape. Each remade filter paper disc was 

tightly fixed on the bottom of a 12.5 cm diameter Petri dish daubed 

with polytetrafluoroethylene (PTFE) on the inside wall to avoid the 

insects escaping. Then 30 unsexed adults of T. castaneum were 

released at the center of the filter paper disc and the Petri dishes 

were subsequently covered and kept in incubators at 25 to 29°C 

and 70 to 80% relative humidity. Each treatment was replicated 4 

times and the number of insects present on the control (Nc) and 

treated (Nt) areas of the discs was recorded after 12, 24, 36, 48 and 

72 h, respectively. 

Percentage repellency (PR) values were calculated as follows: 

PR = [(Nc - Nt) / Nc]100% 

The mean percentage repellency value was calculated and 

assigned to repellency classes (Juliana and Su, 1983) from 0 to V: 

class 0 (PR< 0.1%), class I (PR = 0.1 to 20%), class II (PR = 20.1 

to 40%), class III (40.1 to 60%), class IV (60.1 to 80%) and class V 

(80.1 to 100%). 

Fumigant activity 

Fumigant activity on T. castaneum adults was carried out with 25 

unsexed adults exposed in a 250 ml flask tightly sealed with a 

rubber stopper. The flask contained 10 g wheat at about 13.5% 

equilibrium moisture content. An aliquot of 0, 2.5, 5, 10 and 20 µl of 

the plant extract dissolved in 1 ml acetone was evenly applied to a 

Whatman No.1 filter paper strip (7 × 9 cm) corresponding to 

dosages of 0, 10, 20, 40 and 80 µl/l air, which was then dried in air 

for 10 min prior to being fixed on the rubber stopper by a staple at 

one end. The rubber stopper was tightly stuffed to keep the filter 

paper suspending in the top of the flask. Care was taken to avoid 

the filter paper contacting the flask wall. The flask was placed in the 

incubators at 25 to 29°C and 70 to 80% relative humidity. Four 

replicates were conducted. After 48 h exposure, insects were 

moved into clean vials and mortality determined immediately. 

Insects showing any movement were considered to be alive. 


The percentage mortality was corrected by the Abbott (1925) 

formula. The percentage mortality was determined and transformed 

to arcsine square root values for analysis of variance (ANOVA). 

Treatment means were compared and separated by Scheffe’s test 

at P = 0.05. The LD50 value was calculated using probit analysis 

(Finney, 1971). 

RESULTS 

Repellent activity 

The A. officinarum rhizome extract showed potent 

repellent activity against T. castaneum adults during the 

whole exposure time. Percentage repellency values 

always kept over 80% at class V at the tested 

concentration (A. officinarum extract: acetone = 1:10, v/v) 

within 48 h of exposure (Figure 1). 

Fumigant activity 

A. officinarum rhizome extract had strong fumigant 

activity in a dosage-dependent manner against T. 

castaneum adults (df = 4,P < 0.05). At a dosage of 80 

µl/l air, the A. officinarum rhizome extract induced 75% 

mortality of T. castaneum adults after 48 h exposure 

(Figure 2). 

From the probit analyses for mortality of T. castaneum 

adults after 48 h of exposure to A. officinarum rhizome 

extract, the calculated regression line equations was Y = 

2.01X + 1.72 (� 2 = 1.67, p = 0.43) for T. castaneum 

adults, the LD50 value and its confidence limit were 42.42 

µl/l and 35.74-52.67 µl/l, respectively. 

DISCUSSION 

In our study, A. officinarum rhizome extract showed 

promise as a repellent and fumigant for the control of T. 

castaneum adults. Similarly, the crude seed extracts of 

Aphanamixis pofystachya were strong repellents and 

moderate feeding deterrents to T. custuneum. The 

ground leaves, bark and seeds of A. pofystachya in a 

2.5% mixture provided some protection for wheat flour by

Percentage repellency (%) 

Percentage repellency(%) 

100 

80 

60 

40 

20 

0 

a 

a 

a 

12 24 36 48 72 

Exposure time (h) 

Exposure time (h) 

Figure 1. Repellent activity of the A. officinarum rhizome extract against T. castaneum adults. 

Mortality (%) 

Mortality (%) 

100 

80 

60 

40 

20 

0 

e 

d 

c 

0 10 20 40 80 

Dosage (µl/l) 

Figure 2. Fumigant activity of the A. officinarum rhizome extract against T. castaneum adults. 

reducing F1 progeny (Talukder and Howse, 1995). Ho et 

al. (1996) found that the essential oil of garlic killed 100% 

of eggs at 4.4 mg/cm 2 , using the filter paper impregnation 

bioassay. Evodia rutaecarpa essential oil exhibited strong 

contact toxicity against T. castaneum adults (LD50 = 0.118 

mg/mg body wt) and larvae (LD50 = 0.093 mg/mg body 

wt), fumigant activity (LC50 = 11.7 mg/l air), repellent 

activity to T. castaneum adults (Liu and Ho, 1999). Liu et 

al. (2007) screened extracts of 40 species of Chinese 

medicinal herb from 32 different botanical families for 

bioactivity against Sitophilus zeamais and T. castaneum. 

Thirty species of Chinese medicinal herb extracts had 

insecticidal or feeding-deterrent activities against S. 

zeamais and T. castaneum. Specially, extracts of 

Artemisia argyi, Evodia rutaecarpa, Sophora flavescens, 

Litsea cubeba, Narcissus tazetta var. chinensis, 

Polygonum aviculare, Dictamnus dasycarpus, 

Rhododendron molle, Stemona sessilifolia, Tripterygium 

b 

a 

a 

b 

Lu et al. 5195 

wilfordii, and Torreya grandis showed the strongest 

bioactivity. Elletaria cardamomum oil signifficantly (P < 

0.05) reduced the hatching of T. castaneum eggs and the 

subsequent survival rate of the larvae in the 

concentration range 1.04 to 2.34 mg cm -2 . E. 

cardamomum oil was also drastically reduced of T. 

castaneum adult emergence and totally suppressed its 

F1 progeny production at a concentration of 5.3 × 10 3 

ppm (Huang et al., 2000). Lee et al. (2002b) reported that 

the essential oil from Rosmarius officinalis had the most 

potent fumigant toxicity against the red flour beetle, T. 

castaneum (Herbst) (LD50 = 7.8 µl/l air) followed by the 

oils of Citrus limonum (LD50 = 16.2µl/l air), Pimenta 

racemosa (LD50 = 17.8µl/l air), Citrus auratifolia (LD50 = 

17.9µl/l air), and Mentha piperata (LD50 = 25.8 µl/l air). 

The essential oil of mugwort, Artemisia vulgaris had a 

very strong repellent activity at a 0.6 µl/ml (v/v) and high 

fumigant activity with 100% mortality at 8.0 µl/ml to T.


castaneum adults (Wang et al., 2006). Artemisia sieberi 

essential oil induced 100% mortality of T. castaneum 

adults at the concentration of 37 ml/l and an exposure 

time of 24 h (Negahban et al., 2007). The percentage 

repellence value for the Ocimum gratissimum oil against 

T. castaneum after 24 h exposure was 38 to 79%. 

However, the T. castaneum was more tolerant to the O. 

gratissimum oil, with only 23% mortality after 168 h 

treatment with 10 ml/l air (Ogendo et al., 2008). The LC50 

with fiducial limits for T. castaneum exposed to Alpinia 

conchigera essential oils at 12, 24 and 48 h the values 

were; 140, 105 to 178; 97, 81 to 116 and 73, 64 to 82 µl/l 

in air (Suthisut et al., 2011). Moreover, many essential 

oils and their constituents have been studied to possess 

potential as alternative compounds to currently used 

insect-control agents for the management of populations 

of T. castaneum (Shaaya et al., 1991, 1997; Lee et al., 

2004; Sahaf et al., 2008; Nerio et al., 2009). 

The observed repellent and fumigant activity against T. 

castaneum adults demonstrates that A. officinarum 

rhizome extract is a source of biologically active 

components which may potentially prove to be effective 

for integrated pest management of stored grain insects. 

Furthermore, as a traditional pharmaceutical agent, the 

A. officinarum rhizome extract is also considered to be 

safe for human being and the environment. Therefore, 

how to appropriately use the A. officinarum rhizome 

extract as a control agent for the management of T. 

castaneum may warrant further investigation. 


This research was supported by Henan Provincial Key 

Scientific and Technological Project (No. 092102110022), 

Key Scientific Program in the Education Department of 

Henan Province (No. 12A210003). 

REFERENCES 

Abbott WS (1925). A method of computing the effectiveness of an 

insecticide. J. Econ. Entomol., 18: 265–267. 

Boekea SJ, Baumgarta IR, Van Loon JJA, Van Huis A, Dicke M, Kossou 

DK (2004). Toxicity and repellence of African plants traditionally used 

for the protection of stored cowpea against Callosobruchus 

maculates. J. Stored Prod. Res., 40: 423– 438. 

Fan GJ, Kang YH, Han YN, Han BH (2007). Platelet-activating factor 

(PAF) receptor binding antagonists from Alpinia officinarum. 

Bioorganic. Med. Chem. Lett., 17: 6720–6722. 

Finney DJ (1971). Statistical Method in Biological Assay, 2nd edn. 

Griffin, London. 

Ho SH, Koh L, Ma Y, Huang Y, Sim KY (1996). The oil of garlic, Allium 

sativum L. (Amaryllidaceae), as a potential grain protectant against 

Tribolium castaneum (Herbst) and Sitophilus zeamais Motsch. 

Postharvest Biol. Technol., 9: 41-48. 

Huang Y, Lam SL, Ho SH (2000). Bioactivity of essential oil from 

Elletaria ardamomum (L.) Maton. to Sitophilus zeamais Motschulsky 

and Tribolium castaneum (Herbst). J. Stored Prod. Res., 36: 107– 

117. 

Isman MB (2006). Botanical insecticides, deterrents, and repellents in 

modern agriculture and an increasingly regulated world. Annu. Rev. 

Entomol., 51: 45–66. 

Isman MB (2008). Botanical insecticides: for richer, for poorer. Pest 

Manag. Sci., 64: 8–11. 

Jembere B, Obeng-Ofori D, Hassanali A, Nyamasyo GNN (1995). 

Products derived from the leaves of Ocimum kilimanndscharicum 

(Labiatae) as post-harvest grain protectants against the infestation of 

three major stored product insect pests. B. Entomol. Res., 85: 361– 

367. 

Jovanović Z, Kostić M, Popović Z (2007). Grain-protective properties of 

herbal extracts against the bean weevil Acanthoscelides obtectus 

Say. Ind. Crop. Prod., 26(1): 100–104. 

Kim S, Park C, Ohh MH, Cho HC, Ahn YJ (2003). Contact and fumigant 

activity of aromatic plant extracts and essential oils against 

Lasioderma serricorne (Coleoptera: Anobiidae). J. Stored Prod. Res., 

39: 11–19. 

Lee BH, Annis PC, Tumaalii F, Choi WS (2004). Fumigant toxicity of 

essential oil from the Mytaceae family and 1,8-cineole against 3 

major stored-grain insects. J. Stored Prod. Res., 40: 553–564. 

Lee BH, Lee SE, Annis PC, Pratt SJ, Park BS, Tumaalii F (2002a). 

Fumigant Toxicity of Essential Oils and Monoterpenes Against the 

Red Flour Beetle, Tribolium castaneum Herbst. J. Asia-Pacific 

Entomol., 5(2): 237 -240. 

Lee BH, Lee SE, Annis PC, Pratt SJ, Park BS, Tumaalii F (2002b). 

Fumigant toxicity of essential oils and monoterpenes against the red 

flour beetle, Tribolium castaneum Herbst. J. Asia-Pacific Entomol., 

5(2): 237 -240. 

Lee SE, Hwang HJ, Ha JS, Jeong HS, Kim JH (2003). Screening of 

medicinal plant extracts for antioxidant activity. Life Sci., 73: 167– 

179. 

Liu ZL, Goh SH, Ho SH (2007). Screening of Chinese medicinal herbs 

for bioactivity against Sitophilus zeamais Motschulsky and Tribolium 

castaneum (Herbst). J. Stored Prod. Res., 43: 290–296. 

Liu ZL, Ho SH (1999). Bioactivity of the essential oil extracted from 

Evodia rutaecarpa Hook f. et Thomas against the grain storage 

insects, Sitophilus zeamais Motsch. and Tribolium castaneum 

(Herbst). J. Stored Prod. Res., 35: 317–328. 

Negahban M, Moharramipour S, Sefidkon F (2007). Fumigant toxicity of 

essential oil from Artemisia sieberi Besser against three storedproduct 

insects. J. Stored Prod. Res., 43: 123–128. 

Nerio LS, Olivero-Verbel J, Stashenko EE (2009). Repellent activity of 

essential oils from seven aromatic plants grown in Colombia against 

Sitophilus zeamais Motschulsky (Coleoptera). J. Stored Prod. Res., 

45: 212–214. 

Ogendo JO, Kostyukovsky M, Ravid U, Matasyoh JC, Deng AL, Omolo 

EO, Kariuki ST, Shaaya E (2008). Bioactivity of Ocimum gratissimum 

L. oil and two of its constituents against five insect pests attacking 

stored food products. J. Stored Prod. Res., 44: 328–334. 

Okonkwo EU, Okoye WI (1996). The efficacy of four seed powders and 

the essential oils as protectants of cowpea and maize grain against 

infestation by Callosobruchus maculatus (Fabricius) (Coleoptera: 

Bruchidae) and Sitophilus zeamais (Motschulsky) (Coleoptera: 

Curculionidae) in Nigeria. Int. J. Pest Manag., 42: 143–146. 

Paul UV, Lossini JS, Edwards PJ, Hilbeck A (2009). Effectiveness of 

products from four locally grown plants for the management of 

Acanthoscelides obtectus (Say) and Zabrotes subfasciatus 

(Boheman) (both Coleoptera: Bruchidae) in stored beans under 

laboratory and farm conditions in Northern Tanzania. J. Stored Prod. 

Res., 45: 97–107. 

Rajendran S, Narasimhan KS (1994). Phosphine resistance in the 

cigarette beetle Lasioderma serricorne (Coleoptera: Anobiidae) and 

overcoming control failures during fumigation of stored tobacco. Int. 

J. Pest Manag., 40: 207–210. 

Rajendran S, Sriranjini V (2008). Plant products as fumigants for storedproduct 

insect control. J. Stored Prod. Res., 43: 126–135. 

Sahaf BZ, Moharramipour S, Meshkatalsadat MH (2008). Fumigant 

toxicity of essential oil from Vitex pseudo-negundo against Tribolium 

castaneum (Herbst) and Sitophilus oryzae (L.). J. Asia-Pacific 

Entomol., 11: 175–179. 

Shaaya E, Kostjukovski M, Eilberg J, Sukprakarn C (1997). Plant oils as 

fumigants and contact insecticides for the control of stored-product 

insects. J. Stored Prod. Res., 33: 7–15. 

Shaaya E, Ravid U, Paster N, Juven B, Zisman U, Pisarrev V (1991).

Fumigant toxicity of essential oils against four major stored-product 

insects. J. Chem. Ecol., 17: 499–504. 

Suthisut D, Fields PG, Chandrapatya A (2011). Fumigant toxicity of 

essential oils from three Thai plants (Zingiberaceae) and their major 

compounds against Sitophilus zeamais, Tribolium castaneum and 

two parasitoids. J. Stored Prod. Res., 47: 222-230. 

Talukder FA, Howse PE (1995). Evaluation of Aphanamixis polystachya 

as a source of repellents, antifeedants, toxicants and protectants in 

storage against Tribolium castaneum (Herbst). J. Stored Prod. Res., 

31: 55-61. 

Tapondjoua AL, Adlerb C, Fontemc DA, Boudaa H, Reichmuth C 

(2005). Bioactivity of cymol and essential oils of Cupressus 

sempervirens and Eucalyptus saligna against Sitophilus zeamais 

Motschulsky and Tribolium confusum du Val. J. Stored Prod. Res., 41: 

91–102. 

Lu et al. 5197 

Wang J, Zhu F, Zhou XM, Niu CY, Lei CL (2006). Repellent and 

fumigant activity of essential oil from Artemisia vulgaris to Tribolium 

castaneum (Herbst) (Coleoptera: Tenebrionidae). J. Stored Prod. 

Res., 42: 339–347. 

White NDG, Leesch JG (1995). Chemical control. In: Subramanyam, B., 

Hagstrum, D.W. (Eds.), Integrated Management of Insects in Stored 

Products. Marcel Dekker, New York, pp. 287–330. 

Yang RZ, Tang CS (1988). Plants used for pest control in China: a 

literature review. Econ. Bot., 42: 376–406.



DOI: 10.5897/AJMR11.1619 



Detection of QnrB alleles in Enterobacteriaceae and 

quinolone-resistance expression 

Dongguo Wang 1 * + , Jin Zhang 1*+ , Haibao Wang 1 , Yongxiao Qi 2 , Yong Liang 2 and Lianhua Yu 1 

1 Department of Clinical Laboratory Medicine, Medical College of Taizhou University affiliated Taizhou Municipal Hospital, 

Taizhou, 381 Zhongshan Dong Rd. Jiaojiang District of Taizhou, 318000, P.R. China. 

2 Department of Lab Medicine, Medical College of Taizhou University, Taizhou, P.R. China. 


Plasmid-mediated resistance to quinolones in clinical isolates has been found. We have recently 

identified the types of the plasmid-mediated qnrB genes in Klebsiella pneumoniae, Escherichia coli and 

Citrobacter freundii. Through BLASTn analysis of qnrB alleles’ characteristics, we had obtained qnrB5 

gene and qnrB31 gene (GenBank accession number HQ418999) in plasmids of isolates of K. 

pneumoniae, qnrB9 and qnrB16 genes in plasmids of isolates of E. coli, and qnrB2, qnrB15 and qnrB18 

genes from C. freundii. And the susceptibility testing showed that the main causes of resistance to 

quinolone were mediated by plasmid. The analysis of the structure of qnrB alignment showed that 

LexA-protein-binding site was the determining gene of fluoroquinolone resistance, and if the gene exist, 

then strains were sensitive to fluoroquinolone and vice versa. 

Key words: Quinolone-resistance, QnrB, Klebsiella pneumonia, Escherichia coli, Citrobacter freundii. 

INTRODUCTION 

Plasmids carrying qnr gene have been found to transmit 

quinolone resistance (Martínez et al., 1998). These genes 

encode pentapeptide repeat protein that block the action 

of ciprofloxacin on bacterial DNA gyrase and 

topoisomerase IV (Tran and Jacoby, 2002; Tran et al., 

2005), resulting in low-level quinolone resistance with an 

increase in Minimum inhibitory concentration (MIC) of 

ciprofloxacin for wild-type Escherichia coli J53 from 0.016 

to 0.25 μg/ml. This reduced susceptibility is most likely 

important in that it facilitates the selection of mutants with 

higher-level resistance (Martínez et al., 1998). 

The first plasmid-mediated quinolone resistance gene 

(qnr) was discovered in a Klebsiella pneumoniaee 

isolating from Birmingham, Alabama, 1994 (Martínez et 

al., 1998). It occurred in a multi resistance plasmid, 

pMG252, an integron-like structure near Orf513 (Tran 

and Jacoby, 2002). Qnr plasmids have been found in 

*Corresponding author. E-mail: zhangjin_jhb@163.com, 

wdgtzs@163.com. Tel: +86-576-88858569. Fax: +86-576- 

88858284. 

+Authors contributed equally to this work. 

clinical isolates of Citrobacter freundii, Enterobacter spp, 

E. coli, K. pneumoniaee, Providencia stuartii, and 

Salmonella spp, from the United States, Europe, and the 

Near and Far East (Cheung et al., 2005; Nordmann and 

Poirel, 2005). Another qnr gene, qnrS, has also recently 

been found in a plasmid from a strain of Shigella flexneri 

which was isolated in Japan (Kim et al., 2010). qnrD has 

also been found in four Salmonella enterica isolates 

which were isolated from China (Cavaco et al., 2008). 

Since then, qnr alleles have been discovered in clinical 

strains of gram-negative bacilli around the world. Qnr 

proteins confer quinolone resistance, and belong to the 

pentapeptide repeat protein (PRP) family (Guo et al., 

2010). 

QnrB gene was found to be of most alleles in qnr 

families, up to now, there were 51 qnrB alleles that have 

been discovered in the world (see Lahey Clinic 

http://www.lahey.org/qnrstudies/). Recently, Thomas 

Guillard discovered qnrB25 (GenBank accession number 

HQ172108); Xia R, Guo X and Xu H discovered qnrB26; 

Shin JH discovered qnrB27, qnrB28, qnrB29, qnrB30, the 

GenBank accession number are HM439641, HM439643, 

HM439649, HM439650, respectively; and Wang D 

discovered qnrB31 (HQ418999) in K. pneumonae 

(http://www.lahey.org/qnrstudies/).

Table 1. Primers used for PCR and sequencing. 

Gene Primer Primer sequence (5’→3’) 

Reference 

Primer 

Annealing 

temperature (°C) 


Size of 

product (bp) 

qnrB Forward CCTGAGCGGCACTGAATTTAT DQ777878 57 681 

qnrB Reverse GTTTGCTGCTCGCCAGTCGA 

qnrB (sequencing) Forward ATGACGCCATTACTGTATAAAAAA DQ777878 

qnrB (sequencing) Reverse CTAGCCAATAATCGCGATGCCA 

qnrA Forward GCCGTATGGATATTATTGA AY070235 57 657 

qnrA Reverse CTAATCCGGCAGCACTAT 

qnrS Forward ATGGAAACCTACAATCATAC AB178643 50 657 

qnrS Reverse AAAAACACCTCGACTTAAGT 

qnrC Forward ACTGAGTTGGCTCATGTAGC EU917444 50 666 

qnrC Reverse CCATTAAGTGACCCGTTG 

qnrD Forward ACTAACTCGCCGTTTAACAT EU917444 51 645 

qnrD Reverse TACCACATTGGGGCATTAGG 

We have recently identified the types of the plasmid- 

mediated qnrB genes in K. pneumoniae, E. coli and C. 

freundii. This study was conducted in order to compare 

the characteristics and prevalence of the plasmidmediated 

qnrB alleles gene among K. pneumoniae, E. 

coli and C. freundii, which were isolated from different 

specimens from 2008 to 2010 in Taizhou Municipal 

Hospital of China. 


Strains 

We have tested 90 cases of the qnr genes that were resistant to 

quinolone for Enterobacteriaceae, in which 36 isolates were K. 

pneumoniae, 34 isolates were E. coli and 20 isolates were C. 

freundii. The qnr gene were identified by amino acid sequence 

(Strahilevitz et al., 2009). All K. pneumoniae, E. coli and C. freundii 

were isolated from different specimens from 2008 to 2010 in 

Taizhou Municipal Hospital of China, which sufficient amount of 

bacteria could be obtained from blood for culturing. The samples 

were cultured directly on MacConkey agar (Difco) and were 

identified as K. pneumoniae, E. coli and C. freundii using 

biochemical procedures (Chen et al., 2004). 

Conjugation and susceptibility testing 

According to Wang et al. (2003), conjugation experiments were 

carried out in LB broth with E. coli J53 Az R (resistance to sodium 

azide) as the recipients, polymerase chain reaction (PCR) positive 

strains as donor strains. Cultures of donor and recipient cells in 

logarithmic phase (0.5 ml of each) were added to 4 ml of fresh LB 

broth and incubated overnight without shaking. Transconjugants 

were selected on Trypticase soy agar (TSA) plates containing 

sodium azide (300 mg/L) and ciprofloxacin (0.03 mg/L), and then 

incubated to 18-24 h at 35°C. To determine if quinolone resistance 

was co-transferred, MICs for the donor, recipient, and 

transconjugant strains were compared (Kim et al., 2010). The MICs 

were determined by broth dilution and interpreted according to 

Clinical and Laboratory Standards Institute guidelines (CLSI, 2011). 

PCR-amplified and sequencing 

To investigate the genetic characteristics of the qnrB allele gene in 

K. pneumoniaee, E. coli../../../../Program Files/Youdao/Dict4/resultui/queryresult.html, 

C. freundii and their E. coli transconjugants, 

PCR amplification was performed to analyze qnr genes used 

primers listed in Table 1. Corresponding sense and antisense 

strands were obtained through positive results of DNA sequencing, 

then sequencing results were assembled. The analysis of all genes 

was performed through BLASTn program (http://blast.ncbi.nlm.nih.gov/). 

Plasmid analysis 

To study the plasmids carrying qnrB2, qnrB5, qnrB9, qnrB15, 

qnrB16, qnrB18 and qnrB31 genes mapping, the plasmids DNA 

was extracted (Axygen kit, USA) and separated by 0.6% agarose 

gel electrophoresis (60 V, 90 min), and then the different sizes of 

plasmid DNA fragments were cut and recycled (Promega, USA). 

Used each of recycled plasmid DNA as template, PCR was 

conducted to amplify qnrB2, qnrB5, qnrB9, qnrB15, qnrB16, qnrB18 

and qnrB31genes, where the initial position of all genes plasmids 

was determined. The primers used for qnrB were all listed in Table 

1. The estimated size of plasmid DNA was referenced (Wang et al., 

2003). 


Susceptibility testing 

The MICs results were shown in Table 2. And we could 

see that the isolates of K. pneumoniaee, E. coli../../../../


Table 2. Characteristics of isolates for K. pneumoniaee, E. coli, C. freundii and their E. coli transconjugants. 

Donor bacteria Amino acid point mutations a 

K. pneumoniaee (36) 

3 (3/36=8.3%) 

1 (1/36=2.8%) 

E. coli (34) 

2 (2/34=5.9%) 

1 (1/34=2.9%) 

C. freundii (20) 

1 (1/20=5.0%) 

1 (1/20=5.0%) 

1 (1/20=5.0%) 

Ala(N)2→Thr(T), Iie(I)20→Val(V), 

Ser(S)79→Val(V), Iie(I)142→Met(M), 

Iie(I)144→Thr(T), Asn(N)198→Ser(S) 

Arn(N)27→Leu(L), Ser(S)79→Ala(A), 

Arg(R)87→Ser(S), Gly(G)188→Arg(R), 

Val(V)212→Iie(I) 

Ser(S)79→Ala(A), Iie(I)142→Met(M), 


Ser(S)79→Ala(A), Iie(I)142→Met(M), 

Ala(A)144→Thr(T), Val(V)212→Iie(I) 

Asp(D)11→Ala(N), Ser(S)79→Ala(A), 

Iie(I)142→Met(M),Gly(G)188→Arg(R),V 

al(V)212→Iie(I) 

Glu(E)20→Asp(D), Ser(S)79→Ala(A), 

Iie(I)142→Met(M) 

Asp(D)11→Ala(N), Ser(S)79→Ala(A), 

Iie(I)142→Met(M),Gly(G)188→Arg(R), 


qnr 

gene 

MICs(μg/ml) b 

NAL OFL LVN CIP 

qnrB5 >256 8-16 4-8 2 

qnrB31 >256 16 8 4 

qnrB9 >256 16-32 8-16 2-4 

qnrB16 >256 8-16 4-8 2-4 

qnrB2 >256 8-16 4-8 2-4 

qnrB15 >256 8-16 4-8 2-4 

qnrB18 >256 8-32 4-8 2-4 

E.coliJ53AZ R 2 0.0039 0.0019 0.0019 

Transconjugants 

KP1-E.coliJ53 qnrB5 8-16 0.25- 0.50 0.064-0.128 0.064-0.128 

KP2-E.coliJ53 qnrB31 8 0.25 0.064 0.064 

EC1-E.coliJ53 qnrB9 8-16 0.25-0.50 0.064-0.128 0.064-0.128 

EC2-E.coliJ53 qnrB16 16 0.50 0.128 0.128 

FC1-E.coliJ53 qnrB2 16 0.25 0.064 0.064 

FC2-E.coliJ53 qnrB15 16 0.50 0.128 0.128 

FC3-E.coliJ53 qnrB18 8 0.25 0.064 0.064 

a Amino acid point mutations were compared with qnrB1 gene (http://www.lahey.org/qnrstudies/). b NAL, nalidixic acid, OFX, ofloxacin, LVX, 

levofloxacin, CIP, ciprofloxacin. 

Program Files/Youdao/Dict4/resultui/query-result.html 

and C. freundii showed resistance to ofloxacin, 

levofloxacin, ciprofloxacin, and nalidixic acid. 

Furthermore, the MICs of plasmid transconjugantswere 

significantly higher than E. coli J53 Az R , the tests of 

transconjugants were successful, it illustrated that the 

main causes of resistance to quinolone were mediated by 

plasmid. 

The comparison and analysis of variable sites in 

qnrB alleles 

QnrB2, qnrB5, qnrB9, qnrB15, qnrB16, qnrB18 and 

QnrB31 that we had achieved were compared with other 

qnrB alleles, and the amino acid sequence diagram was 

made as Table 3. From Table 3, we could clearly identify 

the qnrB variable sites and variable

Table 3. Amino acid substitutions in qnrB1 to qnrB31 a . 

Allele 

Amino acid change at position 

2 7 11 18 20 21 22 27 35 36 55 60 69 74 79 80 87 94 11 

8 

12 

9 

14 

2 

14 

4 

14 

7 

15 

1 

16 

2 

16 

3 

16 

8 

17 

1 

18 

6 

18 

8 

19 

8 


qnrB1 A G D E I E N N L S N M C A S S R A N V I A L F S T A F I G N S L M V I 

qnrB2 N A M R I 

qnrB3 K M 

qnrB4 T V N I N S M T S V S L M 

qnrB5 T V V M T S I 

qnrB6 A M 

qnrB7 A M T I 

qnrB8 T V I V A M T L S T A 

qnrB9 A M I 

qnrB10 T V V M T 

qnrB11 T A V I V S M T S V S I L M 

qnrB12 T A V I V S M T S V S I L 

qnrB13 A M R I 

qnrB14 D A M T I 

qnrB15 S A N M I 

qnrB16 A M T I 

qnrB17 M 

qnrB18 D A M 

qnrB19 T V V M T S 

qnrB20 N A M R 

qnrB21 T V I V A M T L S T S A 

qnrB22 T V C N I N S M T S V V S L M 

qnrB23 Y A M I 

qnrB24 M V A M 

qnrB25 V I V S A M T L S T S A I 

qnrB27 T S V A S M T A A S A 

qnrB28 T S V V S M T A A S A 

qnrB29 V A M 

qnrB30 S A M 

qnrB31 L A S M R I 

a Variations from the qnrB1 sequence numbered from the second potential ATG initiation codon are shown (http://www.lahey.org/qnrstudies/). 

20 

2 

20 

4 

20 

5 

21 

2 

21 

3


Figure 1. (a) Sequence alignment of the qnrB promoter and qnrB alleles. The –10 promoter elements are indicated; the +1 start site 

is represented by an arrow; the start of the qnrB coding sequence is indicated by a dashed-open frame and the consensus sequence 

of the LexA-protein-binding site is boxed. Sequence accession numbers DQ351241, DQ351242, DQ303920, DQ303921, DQ303919, 

EF520349, EU043311, EU043312, EF526508, DQ631414, EF653270, AM774474, EU273755, EU273757, EU302865, EU136183, 

AM919398, AM919399, EU432277, AB379831, FJ611948, FJ981621, FJ981622, HM192542, HQ172108, HM439641, HM439643, 

HM439649, HM439650 and HQ418999 for sequences with promoter regions for qnrB1, qnrB2, qnrB3, qnrB4, qnrB5, qnrB6, qnrB7, 

qnrB8, qnrB9, qnrB10, qnrB11, qnrB12, qnrB13, qnrB14, qnrB15, qnrB16, qnrB17, qnrB18, qnrB19, qnrB20, qnrB21, qnrB22, 

qnrB23, qnrB24, qnrB25, qnrB27, qnrB28,, qnrB29, qnrB30 and qnrB31 (to date Dec. 2010) and (b) Diagrammatic drawing of qnrB 

allele sequences.

composition in qnrB alleles. Although variable sites were 

fixed relatively in qnrB alleles and the base composition 

was different in variable sites, the expression of the 

amino acid composition was largely identical only with 

minor differences. It illustrated the bases of qnr alleles 

existed certain numbers of "silent" mutations, which 

should arouse people's attentions. Based on plasmid 

analysis (Figure 1), there were two or three different 

length plasmids in isolates. The qnrB2, qnrB5, qnrB9, 

qnrB15, qnrB16, qnrB18 and qnrB31genes located in 

about 23.1 kb length plasmids, respectively. 

Prevalent distribution of qnr alleles 

After BLASTn through detection of qnrB alleles for 36 

isolates of K. pneumoniae which were resistant to 

quinolones, we had achieved qnrB5 gene and qnrB31 

gene (GenBank accession number HQ418999) in 

plasmids of 3 isolates of K. pneumoniae and plasmid of 1 

isolate of K. pneumoniae. The positive rates of qnrB5 and 

qnrB31 genes in 36 isolates of K. pneumonia were 

accounted for 8.3 and 2.8%. 


isolates of E. coli which were resistant to quinolones, we 

had achieved qnrB9 and qnrB16 genes in plasmids of 2 

isolates of E. coli and plasmid of 1 isolate of E. coli. The 

positive rates of qnrB9 and qnrB16 genes were 

accounted for 5.9 and 2.9%. 


isolates of C. freundii which were resistant to quinolones, 

we had achieved qnrB2, qnrB15 and qnrB18 genes in 

plasmids of 3 isolates of C. freundii. The positive rate of 

qnrB2, qnrB15 and qnrB18 genes were accounted for 

5.0, 5.0 and 5.0%, respectively. 

We did not detect qnrA, qnrS, qnrC and qnrD genes, 

but obtained the corresponding qnrB alleles by 

transconjugant with E. coli J53 Az R (Table 2). It showed 

that the plasmid-mediated qnrB genes were prevalent in 

our region, and we should pay more attention. 

The structure of qnrB alignment and quinoloneresistance 

expression 

Until now, a total of 51 qnrB alleles have been found. 

According to previous report (Da Re et al., 2009), we 

have analysed the qnrB gene as described in Table 3. A 

complete qnrB gene sequences consists of three parts 

sequence of different meanings: promoter sequence from 

-35 to -10 regions, the consensus sequence of the LexAprotein-binding 

site and the qnrB coding sequence. The 

consensus sequence of the LexA-protein-binding site is 

the most key sequence for quinolone-resistance (Da Re 

et al., 2009; Wang et al., 2009). If any kind of quinolone 

antibiotic could make the consensus sequence of the 

LexA-protein-binding site open and truncated, and only 

leave the promoter sequence and the qnrB coding 


sequence in qnrB alignment, the isolates would express 

quinolone-resistance (Figure 1). The isolates of K. 

pneumoniaee, E. coli../../../../Program Files/Youdao/Dict4- 

/resultui/queryresult.html and C. freundii showed 

resistance to ofloxacin, levofloxacin, ciprofloxacin, and 

nalidixic acid in our experiments (Table 2), suggesting 

that the LexA-protein-binding site had been made open 

and truncated. On induction of the SOS response, taking 

ciprofloxacin for example, single stranded DNA (ssDNA) 

is produced and the co-protease activity of the RecA 

protein is activated by binding to ssDNA. As described to 

Da Re et al. (2009), the interaction between LexA and the 

nucleoprotein filament RecA/ssDNA results in 

autoproteolytic cleavage of LexA, and subsequently 

leading to qnrB derepression. Induced expression of qnrB 

leads to an increase in the ciprofloxacin minimal inhibitory 

concentration. 


The study was supported by the grant from the affiliated 

Taizhou Municipal Hospital of Medical College of Taizhou 

University and the grant from Taizhou Science and 

Techology Bureau in Zhejiang, P.R. China (No.081KY30). 

REFERENCES 

Cavaco LM, Hasman H, Xia S, Aarestrup M (2008). qnrD, a noval gene 

conferring transferable quinolone resistance in salmonella enterica 

serovars Kentucky and Bovismorbificans of human origin. Antimicrob. 


Chen X, Gao S, Jiao X, Liu X (2004). Prevalence of serogroups and 

virulence factors of E. coil strains isolated from pigs with postweaning 

diarrhea in eastern China. Vet. Microbiol., 103: 13-20. 

Cheung TK, Chu YW, Chu MY, Ma CH, Yung RW, Kam KM (2005). 

Plasmid-mediated resistance to ciprofloxacin and cefotaxime in 

clinical isolates of Salmonella enterica serotype Enteritidis in 

HongKong. J. Anti. Microb. Chemother., 56(3): 586–589. 

CLSI (2011). Performance standards for antimicrobial susceptibility 

testing; twenty-first informational supplement. Clin. Lab. Stand. Inst., 

M100-S21 (1): 31. 

Da Re S, Garnier F, Guérin E, Campoy S, Denis F, Ploy M (2009). The 

SOS response promotes qnrB quinolone-resistance determinant 

expression. EMBO reports, 10(8): 929–933. 

Guo Q, Weng J, Xu X, Wang M, Wang X, Ye X, Wang W, Wang M 

(2010). A mutational analysis and molecular dynamics simulation of 

quinolone resistance proteins QnrA1 and QnrC from Proteus 

mirabilis. BMC Struct. Biol., 10(1): 33. 

Kim HB, Wang M, Ahmed S, Park CH, LaRocque RC, Faruque AS, 

Salam MA, Khan WA, Qadri F, Calderwood SB, Jacoby GA, Hooper 

DC (2010). Transferable Quinolone Resistance in Vibrio cholerae. 

Antimicrob. Agents Ch., 54(2): 799–803. 

Martínez L, Pascual A, Jacoby GA (1998). Quinolone resistance from a 

transferable plasmid. Lancet, 351(14): 797–799. 

Nordmann P, Poirel L (2005). Emergence of plasmid-mediated 

resistance to quinolones in Enterobacteriaceae. J. Antimicrob. 

Chemother., 56(3): 463–469. 

Strahilevitz J, Jacoby GA, Hooper DC, Robicsek A (2009). Plasmidmediated 

quinolone resistance: a multifaceted threat. Clin. Microbiol. 

Rev., 22: 664-689. 

Tran JH, Jacoby GA (2002). Mechanism of plasmid-mediated quinolone 

resistance. Proc. Nat. Acad. Sci. USA, 99(8): 5638–5642.


Tran JH, Jacoby GA, Hooper DC (2005). Interaction of the plasmidencoded 

quinolone resistance protein Qnr with E. coli DNA gyrase. 

Antimicrob. Agents Ch., 49(1): 118–125. 

Tran JH, Jacoby GA, Hooper DC (2005). Interaction of the plasmidencoded 

quinolone resistance protein QnrA with E. coli 

topoisomerase VI. Antimicrob. Agents Ch., 49(7): 3050–3052. 

Wang M, Jacoby GA, Mills DM, Hooper DC (2009). SOS Regulation of 

qnrB Expression. Antimicrob. Agents Ch., 53(2): 821–823. 

Wang M, Tran JH, Jacoby GA, Zhang Y, Wang F, Hooper DC (2003). 

Plasmid-mediated quinolone resistance in clinical isolates of E. coli 

from Shanghai, China. Antimicrob. Agents Ch., 47(7): 2242–2248.



DOI: 10.5897/AJMR12.059 



Analysis of bacteria associated with Acropora 

solitaryensis by culture-dependent and -independent 

methods 

Liu Z. H. 1,2 , Chen W. 1,2 , Gao L. 1,2 , Zhao JJ 1,2 , Ren C.H. 1 , Hu C. Q. 1 and Chen C. 1,2 * 

1 The Key Laboratory of Marine Bio-resources Sustainable Utilization(LMB), South China Sea Institution of Oceanology, 

Chinese Academy of Sciences,Guangzhou, 501301, China. 

2 The Ocean Observation and Research Station at XiSha Island, South China Sea Institution of Oceanology, Chinese 

Academy of Sciences, China. 

3 The graduate school of Chinese Academy of Sciences, Beijing, 10049, China. 


Diversity of bacteria associated with Acropora solitaryensis, the main species in Hermatypic corals of 

XiSha Island, was investigated using culture-dependent and culture-independent methods (denature 

gradient gel electrophoresis, DGGE). It shows rich diversity of coral-associated bacteria with abundant 

novel species or genus. However, the diversity gained by the two methods was different. Among the 

bacteria identified by DGGE, XSLJ4 (Psychrobacter sp. KOPRI 25503), XSLJ6 (Rhizobium sp.), XSLJ11, 

(Uncultured Pseudomonadales), XSLJ12 (Ochrobactrum sp. Yw28) and XSLJ 13 (Ochrobactrum sp. 

B10B)are the predominant species, while the vibrios were the predominant ones identified by bacterial 

culture method. 

Key words: Acropora solitaryensis, diversity of bacterium denature gradient gel electrophoresis (DGGE). 

INTRODUCTION 

Coral reefs, known as the oasis in desert and tropical 

rainforest in sea for its biodiversity and high productivity 

(Bjornsen et al., 1991; Rohwer et al., 2002; Rosenberg et 

al., 2007). However, due to the global warming and 

human activity, survival of coral reefs are faced with 

serious threat (Rosenberg et al., 2002, Luna et al., 2007). 

Wilkinson (2008) reported that, by 2008, the area of 

global coral reefs has been reduced by 19%, and nearly 

35% of coral reefs were in emergency or dangerous 

state. It is controversial how this global destruction of 

coral reefs occurred, but more and more evidence has 

pointed to the micro-organisms associated with coral 

reefs (Kushmaro et al., 1998; Ben-Haim et al., 1999, 

2003; Barash et al., 2005). As the largest creature of the 

world, coral reef is a giant symbiont called “holobiont” 

*Corresponding author. E-mail: chen.chang@scsio.ac.cn. Tel: 

(+86)18620006618. 

which contained large, diverse and specific population of 

microorganisms (Siboni et al., 2008; Thurber et al., 2009). 

In addition to the algae of zooxanthellae, bacteria, 

archaea and eukaryote as well as viruses are all involved 

in construction of the holobiont. Among them, diverse 

bacteria are extensively distributed in the coral reefs in a 

species specific, tissue specific and location unspecific 

manner (Gast et al., 1998). Moreover, over 99% of 

bacteria in the coral reef are unculturable and many novel 

species were identified, but the roles of these bacteria in 

coral health and disease are largely unknown (Rohwer et 

al., 2001). It has become an intriguing topic for the 

microbiologists and substantial progress has been made 

in recent years. 

This paper attempts to use culture-dependant and 

culture-independent (DGGE) techniques to explore and 

analyse bacteria diversity of Acropora solitaryensis, that 

is, the main species in Hermatypic corals of XiSha, laying 

the foundation for the future research of coral bacterial 

diseases.



Sampling 

Staghorn coral (Acropora solitaryensis) were collected from 8 

colonies in Yongxing isle, Hainan province, China (Figure 1). Ca 0.5 

cm fragment was grinded with sterilized mortar and pestle and 

suspended in 2 ml PBS buffer followed by centrifugation at 3000 

rpm for 4 min to remove the big debris. 100 µl of the supernatant 

was spread on the 2216E plates and incubated at 30°C overnight. 

Identification of the culturable bacterium 

The bacteria growing on the 2216E plates were purified and 

identified by 16S rDNA sequencing. Briefly, the bacteria grow in the 

2216E medium and genomic DNA was prepared using a Bacteria 

DNA Extraction kit (Takara, Dalian, China). The fragment of 16S 

rDNA for sequencing was amplified with the pair of primers 

63F(CAGGCCTAACACATGCAAGTC) and 

1389R(ACGGGCGGTGTGTACAAG) in a 25 ul PCR mixture 

containing 10x PCR Buffer 2.5 ul, dNTP (each, 2.5mM) 2.0 ul, each 

primer (20 uM) 0.25 ul, rTaq (5 U/ul) 0.25 ul and 1 ul of purified 

DNA. PCR was performed with an initial denaturation of 95°C for 5 

min; followed by 30 cycles of 94°C for 1 min, 55°C for 30 s, and 

72°C for 2 min;. The PCR products were separated in 1.5% 

agarose gel and documented with image viewer. (Bio-rad, USA). 

16S rDNAs were sequenced by Invitrogen (Guangzhou, China), 

and the sequences were aligned with Blastn in NCBI website. 

DNA preparation for denature gradient gel electrophoresis 

(DGGE) 

Total DNA was extracted using a modified method referred to by 

Zhou et al. (1996) following the standard phenol/chloroform 

extractions. (i) 5 g coral sample was grinded with mortar and pestle 

in liquid N2. (ii) 13.5 ml DNA lysis buffer (100 mM Tris-HCl, pH 8.0, 

100 mM Na2EDTA, 100 mM Na3PO4, 1.5 M NaCl, 1% Cetyltrimethyl 

ammonium Bromide[CTAB],) and lysozyme(final concentration: 

1mg/ml) was added and shaked at 240 rpm for 30 min at 37°C, 

followed by addition of proteinase K (final concentration: 0.2 mg/ml) 

and shaked for 20 min. (iii) 100 ul of SDS (20%) was added in the 

tubes which were incubated in the water bath tank at 65°C for 2 h, 

mixing the tubes every 15 to 20 min gently. Then centrifuged at 

6,000 rpm for 10 min to remove the debris. (iv) The supernatant 

was extracted with equal volume of phenol-chloroform (24:1) twice 

and 0.1 volume of NaAC (pH=5.2) and 0.6 volume of isopropanol 

was used to precipitate the DNA at -20°C for at least 1 hr, followed 

by centrifugation at 14,000 g for 10 min. The DNA was washed 

twice with 70% cold ethanol and dissolved in 80 ul sterile water. 

Amplification of 16S rDNA for denature gradient gel 

electrophoresis (DGGE) analysis 

Two rounds of PCR amplification for the variable region of 16S 

rDNA were performed. The first round was carried out as described 

above except with 15 cycles, then continued the second round of 

PCR with the same volume and the primers are GC- 

341f(CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGG 

GGGGCCTACGGGAGGCAGCAG) and 534r 

(ATTACCGCGGCTGCTGG) (Muyzer et al., 1993). Touch-down 

PCR (Davies et al., 2004) was performed with an initial denaturation 

step of 95°C for 5 min; followed by 20 cycles at 94°C for 1 min, 

65°C (-0.5°C per cycle) for 45 s, and 72°C for 1 min; followed by 10 

cycles of 94°C for 1 min, 55°C for 45 s, and 72°C for 1 min. The 

PCR products were separated in 1.5% agarose gel stained with 

goldview and visualized using the gel Chem. Doc (Bio-Rad, USA). 

Denature gradient gel electrophoresis (DGGE) 

DGGE was done by using the Bio-Rad D-CODE system. 6% 

acrylamide gel was prepared with the range of gradient from 30 to 

50% (100% denaturants gels defined as 7 M urea and 40% 

deionized formamide) and stayed at room temperature for at least 7 

h before use. Twenty micro liter PCR products which have been 

mixed with 2×loading buffer (Takara, Dalian, China) were loaded in 

each well. And the tank was filled with 7L 0.5× TAE as running 

buffer. The electrophoresis was performed at the constant voltage 

of 80V at 60°C for 18 h. Gels were stained with EB (Sigma) diluted 

in 0.5× TAE buffer (1:10,000) for 30 min and visualized by using the 

Gel Doc system (Bio-Rad, USA). The prominent bands on the 

DGGE gel were excised by using sterile scalpel blades, washed 

with 200 ul ultra-pure water twice and soaked in 50 ul ultra-pure 

water at 4°C overnight. The supernatant was harvested with 

centrifugation for 10 min at 12,000 rpm at 4°C. 0.5 µl of the 

supernatant was re-amplified with the set of primers 534r and 341fnc 

which has the same sequence as 341f but containing no GC 

clamp as described above. The PCR products was purfied and 

sequenced. The sequences were aligned with Blastn. Two bands 

which share the identity by more than 97% were considered to be 

the same phylotype (Stackebrandt et al., 1994), Mega 4.1 was 

employed to construct the phylogenetic trees based on neighborjoining 

algorithm (Saitou et al., 1987). Bootstrap analysis with 1,000 

replicated was applied to assign confidence levels to the nodes in 

the trees. 

RESULTS 

Bactrial communities based on culturale technique 

Less than 20 bacterial colonies from each sample grow 

on the 2216E plates which are incubated for more than 2 

days. 9 isolates were selected according to their colony 

morphology. Based on their sequences of 16S rDNA, one 

strain was identified as Halobacillus sp. (100% identity 

with H. sp) and one strain was Alteromonas sp. (with 99% 

identity). 7 strains were identifed as vibrio sp. It is 

suprising that only few colonies were isolated from all the 

samples, indicating that the most of the bacteria 

associated with coral are uncultureble under high 

concentration of nuitritions, and the predominant 

heterotrophic bacteria are vibrios. 

Bactrial communities based on denature gradient gel 

electrophoresis (DGGE) 

Before DGGE analysis, PCR products were checked on 

1.5% agarose gel. The fragments about 250 bp are 

expected (data not shown). DGGE analysis with a 

denaturing gradient from 35 to 50% showed good 

resolution and separation. More than 30 bands are 

obtained and the predominant bands are concomitant in 

all three samples (Figure 2). Fifteen bands that were 

clear and intensive were excised from acrylamide gel, reamplified 

and subjected to sequencing. The sequences 

from 14 bands were successfully determined. As shown

Figure 1. Overview the Yongxing isle. The mark represents the 

sampling site. 

Figure 2. The DGGE pattern of 16SrDNA-V3 of three 

Acropora solitaryensis. I,II,III separately represent of three 

differernt Acropora solitaryensis, 1-14 represent the bands 

that were excised. 

in Table 1, all bands are belonged to proteobacteria. 

Among them, 9 are Gamma-proteobacteria. 2 (XSLJ12 

and XSLJ13) are alpha-proteobacteria and 3 (XSLJ6, 

Liu et al. 5207 

XSLJ9 and XSLJ14) are unclassified_"Proteobacteria". 

Most of the sequences show identities with 16S rDNA of 

uncultured bacterium clone from marine environmental 

samples. Interestingly, none of the sequences is 

attributed to a defined species. The most intensive band 

XSLJ4 is identified as a bacterium that belongs to 

Psychrobacter. Bands XSLJ 2 and XSLJ 3 are also 

related to this genus. Bands XSLJ 12 and XSLJ 13 which 

are the second intensive bands are similar to the genus 

Ochrobactrum. Band XSLJ 6 is close to Rhizobium sp. 

3C6-41. The phylogenetic relationships of all the 14 

sequenced bands are shown in Figure 3. It clearly shows 

that these sequences are generally aligned into 3 clades. 

XSLJ2-4 is attributed to one group which is represented 

by culturable bacteria Psychrobacter. XSLJ1, 5, 7-11 and 

14 gather into a group which has close relationship with 

uncultured bacterium clones. XSLJ6, 12, 13 form a clade 

which is represented by Rhizobium sp. and 

Ochrobactrum sp. 

DISCUSSION 

As the result shows, the diversity of bacteria associated 

with Acropora solitaryensis determined by the method of 

culture-dependant or culture-independent exhibited great 

discrepancy. A very few bacteria colony and species were 

identified by culture on 2216E marine agar, suggesting 

that a large portion of bacteria associated with healthy 

Acropora solitaryensis are unable to be cultured under 

the experimental conditions. Interestingly, each method 

identified a distinctive group of species, and the most 

abundant one identified by both approaches are different, 

in agreement on that in many marine habitats, the most 

abundant microbial phylotypes have no close relationship 

with that have been cultured. 

With the culture-dependant method, three different 

bacterium genuses were identified. Among them, vibrios 

accounted for nearly 75% (7 out of 9 strains). It implied 

that vibrios are the dominant heterotrophic bacteria 

species in the niche of coral reef, which is supported by 

the similar results found in other coral species (Bourne et 

al., 2005; Ritchie, 2006). However, compared with the 

coastal area, the concentration of vibrios isolated from 

the deep sea coral is at a low level (Penn et al., 2006). 

Interestingly, two of the vibrio species, Vibrio shiloi and 

Vibrio corallyticus, have been demonstrated to infect the 

corals and cause pandemic coral bleaching (Reshef et 

al., 2006). It might be possible that the vibrios are able to 

be evolved in a pathogen under the stress conditions. 

On the contrary, the diversity of bacteria identified by 

DGGE is much more complex, and most of the bacteria 

are close to uncultured species, moreover, the identified 

species are novel genus or species. As suggested by 

Rohwer et al. (2002), 97% of the identity of 16S rDNA is 

used as the objective boundary for species 

circumscription and the identity between 97 and 93% is 

considered as the boundary of genus. According to this


59 

49 

39 

85 

49 

96 

0.02 

93 

27 

90 

19 

XSLJ10 

XSLJ8 

Uncultured bacterium clone TT118ant12a03 

Uncultured bacterium clone B4 

Uncultured Pseudomonadales bacterium ... 

Uncultured bacterium clone 080528-8 

XSLJ7 

XSLJ14 

Uncultured bacterium clone ncd317c01c1 

XSLJ1 

XSLJ2 

Psychrobacter sp. KOPRI 25503 

XSLJ3 

XSLJ4 

Uncultured bacterium clone nbw138d06c1 

XSLJ5 

18 

40 

Uncultured bacterium clone SN124 

XSLJ6 

Figure 3. Phylogenetic tree constructed based on bacterial 16S rDNA V3 region fragments from 

bacterium associtated with Acropora solitaryensis. The trees were drawn from ClustalW generated 

multiple sequence alignment of nucleotide sequences using the neighbor-joining method within the 

MEGA (4.1) package. 

Table 1. Blast of the V3 region sequence of 16S rDNA of bands excised. 

95 

98 

90 

99 

XSLJ11 

S/N Name Taxon The closest relatives Similarity (%) 

1 XSLJ1 Gammaproteobacteria Uncultured bacterium clone 080528-8 91 

2 XSLJ2 Gammaproteobacteria Psychrobacter sp. KOPRI 25503 92 



5 XSLJ5 Gammaproteobacteria Uncultured bacterium clone SN124 92 

6 XSLJ6 unclassified_"Proteobacteria Rhizobium sp. 3C6-41 98 

7 XSLJ7 Gammaproteobacteria Uncultured bacterium clone ncd317c01c1 98 

8 XSLJ8 Gammaproteobacteria Uncultured bacterium clone B4 100 

9 XSLJ9 unclassified_"Proteobacteria Uncultured bacterium clone 16slp96-1a04.p1k 93 

10 XSLJ10 Gammaproteobacteria Uncultured bacterium clone nbw138d06c1 100 

11 XSLJ11 Gammaproteobacteria Uncultured Pseudomonadales bacterium clone E203G05 89 

12 XSLJ12 Alphaproteobacteria Ochrobactrum sp. Yw28 100 

13 XSLJ13 Alphaproteobacteria Ochrobactrum sp. B10B 100 

14 XSLJ14 unclassified_"Proteobacteria Uncultured bacterium clone TT118ant12a03 91 

XSLJ9 

Rhizobium sp. 3C6-41 

65 

XSLJ12 

Ochrobactrum sp. B10B 

Ochrobactrum sp. Yw28 

XSLJ13 

Uncultured bacterium clone 16slp96-1a...

standard, XSLJ1, XSLJ2, XSLJ5, XSLJ11 and XSLJ14 

are attributed to new genus and XSLJ9 belongs to new 

species. As identified by DGGE, XSLJ4 which is identical 

to Psychrobacter sp. KOPRI 25503 is the dominant 

species. It was reported that Psychrobacter sp. can 

synthesis an enzyme that can adsorb heavy metal ions 

such as Hg 2+ that may assist Acropora solitaryensis to 

resist the effect of external environment toxic 

substances(Xuejiang et al., 2010). XSLJ6 is identical to 

Rhizobia sp. These genuses of bacteria are 

chemoautotrophic. It may provide nutrients such as the 

carbon and nitrogen sources for the coral (Child, 1975). 

Further more, it was reported to secrete polysaccharides 

which could enhance the immune system of Acropora 

solitaryensis (Djordjevic et al., 1987; Xiao-bo et al., 2006; 

Yan-Li et al., 2010). XSLJ12 and XSLJ13 are attributed to 

Ochrobactrum sp. which belongs to pale coli genera. It 

often lives in the niche where there are rich phosphorus, 

for an instance, Ca3PO4 and phosphate minerals 

(Palaniappan et al., 2010). It can fix nitrogen and degrade 

toxic organic chemicals such as phenol as well as absorb 

heavy metal ions (Ozdemir et al., 2003; Ngom et al., 

2004; Wei et al., 2008), this function may assist A. 

solitaryensis to adapt to harmful stress environment. 


The study is funded by the National key technology 

support program (2009BAB44B02) and NSFC 

(30972273). 

REFERENCES 

Barash Y, Sulam R, Loya Y, Rosenberg E (2005). Bacterial strain ba-3 

and a filterable factor cause a white plague-like disease in corals 

from the eilat coral reef. Aquat. Microb. Ecol., 40:183-189 

Ben-Haim Y, Banim E, Kushmaro A, Loya Y, Rosenberg E (1999). 

Inhibition of photosynthesis and bleaching of zooxanthellae by the 

coral pathogen Vibrio shiloi. Environ. Microbiol., 1: 223-229. 

Ben-Haim Y, Thompson F, Thompson C, Cnockaert M, Hoste B, Swings 

J, Rosenberg E (2003) Vibrio coralliilyticus sp. Nov., a temperaturedependent 

pathogen of the coral pocillopora damicornis. Int. J. Syst. 

Evol. Microbiol., 53: 309-315. 

Bjornsen P, Kuparinen J (1991). Determination of bacterioplankton 

biomass, net production and growth efficiency in the southern ocean. 

MEPS, 71:185-194. 

Bourne DG, Munn CB (2005). Diversity of bacteria associated with the 

coral Pocillopora damicornis from the great barrier reef. Environ. 

Microbiol., 7:1162-1174. 

Child J (1975). Nitrogen fixation by a rhizobium sp. In association with 

non-leguminous plant cell cultures. Nature, 253: 350-351. 

Davies CE, Hill KE, Wilson MJ, Stephens P, Hill CM, Harding KG, 

Thomas DW (2004). Use of 16s ribosomal DNA pcr and denaturing 

gradient gel electrophoresis for analysis of the microfloras of healing 

and nonhealing chronic venous leg ulcers. J. Clin. Microbiol., 42: 

3549. 

Djordjevic S, Chen H, Batley M, Redmond J, Rolfe B (1987). Nitrogen 

fixation ability of exopolysaccharide synthesis mutants of Rhizobium 

sp. Strain ngr234 and Rhizobium trifolii is restored by the addition of 

homologous exopolysaccharides. J. Bacteriol., 169: 53-60. 

Gast GJ, Wiegman S, Wieringa E, van Duyl FC, Bak RPM (1998). 

Bacteria in coral reef water types: Removal of cells, stimulation of 

Liu et al. 5209 

growth and mineralization. MEPS, 167:37-45. 

Kushmaro A, Rosenberg E, Fine M, Haim YB, Loya Y (1998) Effect of 

temperature on bleaching of the coral Oculina patagonica by vibrio 

ak-1. MEPS, 171: 131-137. 

Luna G, Biavasco F, Danovaro R (2007). Bacteria associated with the 

rapid tissue necrosis of stony corals. Environ. Microbiol., 9:1851- 

1857. 

Muyzer G, de Waal EC, Uitterlinden AG (1993). Profiling of complex 

microbial populations by denaturing gradient gel electrophoresis 

analysis of polymerase chain reaction-amplified genes coding for 16s 

rrna. Appl. Environ. Microbiol., 59: 695-700. 

Ngom A, Nakagawa Y, Sawada H, Tsukahara J, Wakabayashi S, 

Uchiumi T, Nuntagij A, Kotepong S, Suzuki A, Higashi S, Abe M 

(2004). A novel symbiotic nitrogen-fixing member of the 

ochrobactrum clade isolated from root nodules of Acacia mangium. 

J. Gen. Appl. Microbiol., 50: 17-27. 

Ozdemir G, Ozturk T, Ceyhan N, Isler R, Cosar T (2003). Heavy metal 

biosorption by biomass of Ochrobactrum anthropi producing 

exopolysaccharide in activated sludge. Biores. Technol., 90: 71-74. 

Palaniappan P, Chauhan PS, Saravanan VS, Anandham R, Sa T 

(2010). Isolation and characterization of plant growth promoting 

endophytic bacterial isolates from root nodule of Lespedeza sp. Biol. 

Fert. Soils, 46: 807-816. 

Penn K, Wu D, Eisen JA, Ward N (2006). Characterization of bacterial 

communities associated with deep-sea corals on Gulf of Alaska 

seamounts. Appl. Environ. Microbiol., 72:1680-1683. 

Ritchie KB (2006) Regulation of microbial populations by coral surface 

mucus and mucus-associated bacteria. MEPS, 322: 1-14. 

Rohwer F, Breitbart M, Jara J, Azam F, Knowlton N (2001) Diversity of 

bacteria associated with the caribbean coral Montastraea franksi. 

Coral Reefs, 20: 85-91. 

Rohwer F, Seguritan V, Azam F, Knowlton N (2002). Diversity and 

distribution of coral-associated bacteria. MEPS, 243: 1-10. 

Rosenberg E, Ben-Haim Y (2002). Microbial diseases of corals and 

global warming. Environ. Microbiol., 4: 318-326. 

Rosenberg E, Koren O, Reshef L, Efrony R, Zilber-Rosenberg I (2007). 

The role of microorganisms in coral health, disease and evolution. 

Nat. Rev. Microbiol., 5: 355-362. 

Saitou N, Nei M (1987). The neighbor-joining method: A new method for 

reconstructing phylogenetic trees. Mol. Biol. Evol., 4: 406-425. 

Siboni N, Ben-Dov E, Sivan A, Kushmaro A (2008). Global distribution 

and diversity of coral-associated archaea and their possible role in 

the coral holobiont nitrogen cycle. Environ. Microbiol., 10: 2979-2990. 

Stackebrandt E, Goebel B (1994) Taxonomic note: A place for DNA- 

DNA reassociation and 16s rrna sequence analysis in the present 

species definition in bacteriology. Int. J. Syst. Evol. Microbiol., 44: 

846-849. 

Thurber RV, Willner-Hall D, Rodriguez-Mueller B, Desnues Cand 

(2009). Metagenomic analysis of stressed coral holobionts. Environ. 

Microbiol., 11: 2148-2163. 

Wei X, Xiao-yu C, Jian T, Jun G, Ning-feng W (2008). Cloning of a 

methyl parathion hydrolase gene from ochrobactrum sp. J. Agric. Sci. 

Technol., 10: 99-102. 

Wilkinson C (2008). Status of coral reefs of the world: 2008. Australian 

Inst. Mar. Sci., 1-304. 

Xiao-bo H, Jian-guo Z, Yong H, Liang-qi Z (2006). Effects of an 

exopolysaccharide from rhizobium sp on immunologic function in 

mice. Immun. J., 22:149-151. 

Xuejiang W, Ying H, Yuli D, Jianhua L, Daqiang Y (2010) Toxicity 

analysis based on a psychrobacter rsp. Microbial Biosensor. Acta Sci. 

Circum., 30: 965-971. 

Yan-Li C, Sheng R, Guo-Qin W, Li-Hua L, Liang-Qi Z (2010). Antioxidant 

activity of exopolysaccharide from Rhizobium sp. N613. Microbiology, 

37:234-238. 

Zhou J, Bruns MA, Tiedje JM (1996). DNA recovery from soils of diverse 

composition. Appl. Environ. Microbiol., 62:316-322.



DOI: 10.5897/AJMR12.199 



Simple and rapid detection of Salmonella sp. from 

cattle feces using polymerase chain reaction (PCR) in 

Iran 

Aida Jadidi 1 , Seyed Davood Hosseni 2 *, Alireza Homayounimehr 3 , Adel Hamidi 2 , Sepideh 

Ghani 4 and Behnam Rafiee 4 

1 Department of Microbiology, Qom Branch, Islamic Azad University, Qom, Iran. 

2 Department of Cellular and Molecular Biology, Razi Vaccination and Serum Research Institute, Arak, Iran. 

3 Department of Medical Science, Arak Branch ,Islamic Azad University, Arak, Iran. 

4 Young Researchers Club, Arak Branch, Islamic Azad University, Arak, Iran. 


The aim of this study was to employ biochemical and molecular assays to detect and diagnose 

Salmonella in cattle. For this reason, 1124 fecal samples were collected from cattle in Markazi provinces 

of Iran. Selective specific culture media for Salmonella were used to grow a number of isolates from the 

cattle samples. Salmonella bacteria were identified with biochemical test. The antimicrobial 

susceptibility test with disc diffusion method was performed on samples of Salmonella by using a 

molecular based approach, and it was possible to identify Salmonella sp by amplifying specific genes 

’’16s rRNA’’ as a step for identification. Our studies showed that the molecular-based approach are 

more rapid for initial detection of Salmonella SP. 

Key words: Salmonella, cattle, detection, polymerase chain reaction (PCR), 16s rRNA. 

INTRODUCTION 

The genus Salmonella consists of over 2668 different 

serotypes (Alena and Mark, 2009). Salmonellosis is 

responsible for large numbers of infections in both 

humans and animals (Keusch, 2002). Salmonella strains 

are not detectable in certain clinical samples that contain 

small numbers of organisms (Fricker, 1987). However, 

the number of salmonella present in the faeces of an 

infected individual is large, that is, approx. This level of 

excretion is maintained for several weeks, before falling 

gradually until the individual no longer excretes (Taylor 

and McCoy, 1969). Furthermore, after the disappearance 

of the organism from the intestinal tract, up to 5% of 

patients, upon recovery from this disease, may become 

carriers who shed the organism in their faeces (Jay, 

2000). Therefore, detection of Salmonella strains in 

faecal samples is not only important for the diagnosis of 

*Corresponding author. E-mail: hosseinida@yahoo.com. 

salmonellosis, but also essential to identify carriers of this 

organism, especially among food handlers, who have 

higher risks of spreading the pathogen. 

Majority of the human salmonellosis cases are caused 

by consumption of contaminated egg, poultry, pork, beef 

and milk products (Geimba et al., 2004). Salmonella 

infections in calves continue to be a major problem 

worldwide. Substantial economical losses were 

manifested through mortality and poor growth of infected 

animals as well as the hazard of transmitting food 

poisoning to humans. S. typhimurium, S. enteritidis, S. 

anatum S. newport, S. cerro, S. montevideo, S. agona 

and S. dublin was considered the major host-adapted 

Salmonella from cattle (Mitz et al., 1981; Konrad et al., 

1994; Ritchie et al., 2001; Veling et al., 2002). 

Typhimurium is the most common serovar isolated from 

diarrheal patients, and Choleraesuis, Dublin, and 

Enteritidis are often isolated from patients with 

bacteremia (Guiney, 1995). 

Salmonella has been widely reported in cattle (Field,

Table 1. primer information: sequence (Seq), optical density (OD), molecular weight (MW), 

and temperature melting (TM). 

Primer name 

Forward 

Reverse 

Sequence (seq) 

5´→ 3´ 

OD MW 100PM/ µL TM 

AGAGTTTGATCATGGCTCAG 3.1 6172 138 55.3 

5 →´3´ 

GGTTACCTTGTTACGACTT 3/1 5784 158 52.4 

Table 2. Rate of isolated Salmonella sp from fecal cattle in Arak province in Iran. 

Samples Positive samples Positive samples (%) Negative samples Negative samples (%) 

1124 36 3.2 1088 96.79 

1948; Hughes et al., 1971; Wray et al., 1977; Hollinger et 

al., 1998; McDonough et al., 1999). The infected animals 

may shed the organism in their feces without showing 

any clinical signs of disease (Gibson, 1965). Thus a 

rapid, specific and sensitive detection method for 

Salmonella is important for animal and human health and 

for the diagnostic industry (Gouws, 1998). In this pilot 

study, we analyzed the 16S rRNA sequences of 36 

isolates of 1124 cattle samples that have been isolated in 

Arak province of Iran. Our goal was to establish a simple 

and rapid sequence-based method for molecular 

identification. 


Samples 

1124 fecal samples were randomly collected from 15 different farms 

since one month age and above, and collected during several 

months. 

Isolation salmonella 

Fecal samples were placed in enrichment medium and then 

transported to Razi Vaccination and Serum Research Institute. The 

samples were cultivated on to selective medium such as SS agar 

for 18-24 h at 37°C. For identification of salmonella colonies, 

samples were subjected to biochemical tests such as Triple sugar 

iron (TSI), Sulfide-Indole-Motility medium (SIM), (Methyl Red, 

Voges-Proskauer (MRVP), Urea, and Catalase and finally 

reconfirmed as negative-bacilli or coco bacilli by optic microscope. 

Antibiogram test 

The antimicrobial susceptibility testing with disc diffusion method 

was performed on samples of salmonella. The test was evaluated in 

Salmonella susceptibility to 16 antibiotics Including Lincospectin, 

Enrofloxacin, Tobramycin, Nitrofurantoin, Imipenem, Gentamycin, 

Doxycycline,Co-trimoxazole, Ciprofloxacin, Chloramphenicol, 

Cephalothin, Ceftriaxone, Cefotaxime, Cefazolin, Ampicillin, 

Amikacin 

Chromosomal DNA extraction 

Jadidi et al. 5211 

Salmonella isolates were cultivated on Luria Bertani (LB) for 18-24 

h at 37°C; the extraction of DNA was performed according to the 

method of Sambrook (2000). 

Primers 

Two universal oligonucleotides primers mentioned in Table 1 were 

obtained from fermentas (USA). The primers were used to amplify 

the sequences of 16s rRNA. 

Polymerase chain reaction (PCR) 

Amplification program was carried out as described previously, 

PCR was done in 25 µL reaction volumes, 2 µL of 10X PCR buffer, 

1 µL of MgCl2, 1 µL of 10 mM dNTP, 0/5 µL of Taq DNA 

Polymerase (Fermentase), 1 μl from each primer (Cinnagen), 3 µL 

of sample. The reaction was completed up to 25 µL with distilled 

water. The PCR was programed to 2 min for denaturation at 95°C, 

34 cycles to denaturation at 94°C for 1 min, annealing at 52°C for 1 

min and extraction at 72°C for 1 min following by 72°C for 10 min. 

Then stored at -20°C (Hosseini et al., 2003). 

Electrophoresis of PCR products 

The amplified DNA products from Salmonella spp specific-PCR 

were analyzed with electrophoresis on 1% agarose gels stained 

with ethidium bromide and visualized by UV illumination. 


36 samples out of 1124 samples from cattle feces were 

isolated as positive. In biochemical test, isolated 

salmonella sp were lactose (-), indol (-), urea (-), catalase 

(+), and TSI test was K/A. The entire positives were 

confirmed by using coloring gram and optical microscope 

as Gram negative bacilli and coco bacilli (Table 2). 18.2%


Table 3. Antibiotic resistance patterns of Salmonella isolated from samples of cattle. 

Antibiotic name Ampicillin Chloramphenicol Lincospectin Nitrofurantoin Doxyciclin 

Resistant percent 36.1% 36.1% 33.3% 8.3% 5.5% 

Figure 1. Representative samples determined by PCR and detected by 1 % agarose gel electrophoresis Lane M: 

1kb molecular size marker ladder; lane P: positive control, lanes 1 – 12: positive samples. 

of Salmonella typhimurium was isolated by bacte- 

riological examination of 66 fecal samples collected from 

calves suffering from watery diarrhea (Riad et al., 1998). 

The antibiotic disk diffusion showed that some isolates 

were resistant to Ampicillin (36.1%), Chloramphenicol 

(36.1%), Lincospectin (33.3%), Nitrofurantoin (8.3%), and 

Doxyciclin (5.5%). 33.3% of samples were resistant to 

three antibiotics. All samples showed the highest 

sensitivity to Ceftriaxone and Enrofloxacin (Table 3). 

From sampling in slaughter houses in Uganda in 2010, S. 

Majalija took only 1.23% of the samples; Salmonella was 

more resistant to the antibiotics ampicillin, kanamycin, 

and chloramphenicol that the public health concerns in 

order to control the use of antibiotics with the present 

results (Majalija et al., 2010). 

The amplified PCR products which were carried out 

using the universal bacterial 16srRNA primers and 

visualized by UV illumination showed the expected bands 

of about 1500 bp (Figure 1). The results demonstrated a 

correct genus identification of examined Salmonella 

isolates. 

The data shows the results of 36 samples, which were 

positive by the PCR assay and the results of the same 

samples was tested using the cultural method for the 

detection of Salmonella sp. More studies on comparative 

routine microbial cultures and PCR method. The need for 

the development of rapid and accurate detection methods 

for salmonella sp. has increased in recent years due to 

the higher incidence of salmonellosis in industrialized 

countries over the past decades (Tauxe, 1991; Lewis, 

1997). Gallegos-Robles et al., (2008) isolated and 

detected with microbiological and PCR methods, 

Salmonella sp. from fresh beef and cantaloupes. 

Salmonella was detected by the microbiological method 

in 9 of 20 samples (45%), whereas the pathogen was 

detected by the PCR in 11 samples (55%). That study 

demonstrates the utility of the PCR targeting the invA 

gene to determine the presence of Salmonella sp. in beef 

and cantaloupe samples (Gallegos-Robles et al., 2008). 

Salmonella strains were detected by direct PCR 

amplification of the hilA gene. The hilA primers are 

specific for Salmonella species and the PCR method 

presented may be suitable for the detection of Salmonella 

in feces (Pathmanathan et al., 2003). 

Assay had been used to detect Salmonella in food and 

beverage samples using suitable primers which were 

based on specific invA gene of Salmonella. The method 

of PCR demonstrated the specificity of invA primers for 

detection of Salmonella as confirmed by biochemical and 

serological assay. The results of this study revealed that 

PCR was a rapid and useful tool for detection of 

Salmonella in food and beverage samples (Radji et al., 

2010). One searched about detection of Salmonella sp. in 

animal feed samples by PCR after Culture Enrichment. 

The result of this search showed that 8% of the samples 

were positive by PCR, compared with 3% with the

conventional method. The reasons for the differences in 

sensitivity are discussed. Use of this method in the 

routine analysis of animal feed samples would improve 

safety in the food chain (Charlotta et al., 2004). 

Salmonella was rapidly detected in dairy cows. All 

Salmonella strains were examined using PCR method. 

Two oligonucleotide primers were used to detect 

Salmonella invA gene (Eid, 2010). Salmonella dublin was 

detected by PCR amplification of the SopE Gene in Iran 

(Mirmomeni, 2008). They cause substantial economical 

loss both directly and and indirectly; directly though 

mortality and poor growth after clinical disease, and 

indirectly from animal carriage leading to cases of human 

Salmonella infection which is a serious food-borne 

infection in man (Ritchie et al., 2001; Donkersgoed et al., 

1999; Galland et al., 2000; Rake et al., 2002). The 

diagnostic method currently in use for Salmonella 

enteritis is a time-consuming and laborious process, that 

is, culture of the bacteria from the stool samples. 

Therefore, development of a rapid and sensitive method 

for the diagnosis of Salmonella enteritis is desirable. 

Several techniques for improving the detection of 

Salmonella serovars in feces, such as the use of a 

selective culture medium and enzyme-linked 

immunosorbent assay have been developed. However, 

problems remain with sensitivity and specificity that have 

limited routine use of these procedures. PCR technology 

that allows amplification of a specific fragment of nucleic 

acid has been used to identify the presence of specific 

pathogens directly from clinical specimens, such as urine, 

blood, and cerebrospinal fluid specimens (Cheng-hsun 

and Jonathan, 1996). 

Conventional methods of isolation of Salmonella strains 

take 4–7 days to complete and are therefore laborious 

and require substantial manpower (Van der Zee et al., 

2000). Besides, very small numbers of viable organisms 

present in the faeces may fail to grow in artificial 

laboratory media. Molecular testing has been most 

successful in areas for which conventional micro- 

biological techniques do not exist, are too slow or are too 

expensive (Jungkind, 2001). PCR is the best known and 

most successfully implemented nucleic acid detection 

technology to date (Nissen et al., 2002). 

Conclusion 

Salmonella are usually dispersed in the environment and 

animals are carriers without symptoms of disease. 

Prevention is not easy and depends on spending on 

animal husbandry and veterinary. If this patient do not 

diagnose early and does not treatment of affected 

animals could be wasting up to 75% of patients. So rapid 

and exact diagnosis of animal disease can prevented 

damages inflicted on livestock industry. Thus, there is a 

need for more reliable and faster methods. The PCR 

method has proved to be an invaluable tool for this 

detection. 

REFERENCES 

Jadidi et al. 5213 

Alena K, Mark RW (2009). Salmonellosis, E medicine Florida State 

University. 

Charlotta L, Rickard K, Charlotta EA, Peter R (2004). Rapid and 

Specific Detection of Salmonella spp. in Animal Feed Samples by 

PCR after Culture Enrichment; Applied Environ. Microbiol., 70(1): 69– 

75. 

Cheng-hsun C, Jonathan TO (1996). Rapid Identification of Salmonella 

Serovars in Feces by Specific Detection of Virulence Genes, invA 

and spvC, by an Enrichment Broth Culture-Multiplex PCR 

Combination Assay, J. Clin. Microbiol., 34(10). 

Donkersgoed JV, Graham T, Ganon V (1999). “The prevalence of 

verotoxins, Escherichia coli O157: H7 and Salmonella in the feces 

and rumen of cattle at processing.” Can. Vet. J., 40: 332-338. 

Field HI (1948). A survey of bovine salmonellosis in mid and west 

Wales. Veter. J., 104: 251–339. 

Fricker CR (1987). The isolation of salmonellas and campylobacters. J. 

Appl. Bacteriol., 63, 99–116. 

Galland JC, House JK, Hyatt DR, Hawkins LL, Smith BP (2000). 

Prevalence of Salmonella in beef feeder steers as determination by 

bacterial culture and ELISA serology. Vet. Microbiol., 76:143-151. 

Geimba M, Tondo E, Oliveira F, Canal C (2004). Serological 

characterization and prevalence of spvR genes in Salmonella 

isolated from foods involved in outbreaks in Brazil. 

Gibson EA (1965). Reviews of the progress of dairy science. J. Dairy 

Res., 32, 17–134. 

Gouws PA, Visser M, Brözel V (1998). A polymerase chain reaction 

procedure for the detection of Salmonella spp. within 24 hours. J. 

Food Prot., 61: 1039-1042. 

Guiney DG, Fang FC, Krause M, Libby S, Buchmeier NA, Fierer J 

(1995). Biology and clinical significance of virulence plasmids in 

Salmonella serovars. Clin. Infect. Dis., 21(Suppl. 2): S146–S151. 

Hamza Eid MI (2010). Rapid Detection of Salmonella in Dairy Cows 

Using Polymerase Chain Reaction. J. Am. Sci., 6(10): 31-37. 

Hollinger K, Wray C, Evans S, Pascoe S, Chapell S, Jones Y (1998). 

Salmonella Typhimurium DT104 in cattle in Great Britain. J. Am. Vet. 

Med. Assoc., 213: 1732–1733. 

Hosseini SD, Omar AR, Aini I (2003). Molecular characterization of an 

infectious Bursal disease virus isolate from Iran, Acta virol., 48: 79 – 

83. 

Hughes LE, Gibson EA, Roberts HE, Davies ET, Davies G, Sojka WJ 

(1971) Bovin salmonellosis in England and Wales. British Veter. J., 

127: 225–238. 

Jay JM (2000). Foodborne gastroenteritis caused by Salmonella and 

Shigella. In Modern Food Microbiol., 6: 511–528. 

Sambrook J (2000). Molecular Cloning: A Laboratory Manual, Cold 

spring Harbor Laboratory Press, 3rd edition. 

Jungkind D (2001). Automation of laboratory testing for infectious 

diseases using the polymerase chain reaction: our past, our present, 

our future. J. Clin. Virol., 20: 1–6. 

Keusch GT (2002). Systemic gastro-intestinal infections: a clinical 

overview. In Mol. Med. Microbiol., 2: 1357–1363. 

Konrad H, Smith BP, Dilling GW, John KH (1994). Production of 

Salmonella serogroup D (O9)-specific enzyme-linked immunosorbant 

assay antigen. Am. J. Vet. Res., 55(12): 1647-1651. 

Lewis MJ (1997). Salmonella In: Medical Microbiology, 15th eds 

Greenwood D, Slack RCB and Peutherer JF, Churchill Livingstone, 

London, pp. 252-261. 

Gallegos-Robles MA, Morales-Loredo A, Alvvarez-Ojeda G, Osuna- 

Garc’ia JA, Martinez IO, Morales-ramos LH, Fratamico P (2008). 

PCR Detection and Microbiological Isolation of Salmonella spp. from 

Fresh Beef and Cantaloupes; Food Microbiol. Saf., 74(1). 

Majalija S, Ezama A, Vudriko V (2010). Fecal shedding off multidrug 

resistant Sallmonella in slaughter Ankle cattle in Kampala city, 

Uganda, Afr. J. Animal Biomed. Sci., 5(3): 1819-4214. 

McDonough PL, Fogelman D, Shin SJ, Brunner MA, Lein DH (1999). 

Salmonella enterica serotype Dublin infection: an emerging infectious 

disease for the northeastern United States. J. Clin. Microbiol., 37: 

2418–2427. 

Mitz H, Hellman E, Staak C (1981). Immune response and resistance to 

infection of calves following oral immunization against S. typhimurium


with an inactivated vaccine. Zentralbl. Veterinarmed. (B), 28:759-766. 

Mirmomeni MH, kiani S, Sisakhtnezhad S (2008). Rapid Detection of 

Salmonella Dublin by PCR Amplification of the SopE Gene and its 

cloning. Pak. J. Biol. Sci., 11 (11): 1497-1501. 

Pathmanathan SG, Cardona-Castro N, Sánchez-Jiménez MM, 

Correa-Ocho MMA, Puthucheary SD, Thong KL (2003). Simple and 

rapid detection of Salmonella strains by direct PCR amplification of 

the hilA gene ; J. Med. Microbiol., vol. 52 no. 9 773-776. 

Radji M, Malik A, Widyasmara A (2010). Rapid detection of Salmonella 

in food and beverage samples by polymerase chain reaction 

Malaysian. Malaysian J. Microbiol., 6(2): 166-170. 

Rake BR, McCall M, Radostits SM (2002). Salmonella Muenster 

infection in a dairy herd. Can. Veter. Microbiol., 43(6):443-53. 

Riad EM, Tanios AI, El-Moghny AFA (1998). Antigen capture ELISA 

technique for rapid detection of Salmonella typhimurium in fecal 

samples of diarrheic cow calves. Assiut Vet. Med. J., 39(78): 324 – 

333. 

Ritchie C, Foster G, Gunn G, Pearce M, Mather H (2001). Salmonella 

typhimurium DT170 in cattle. Veter. Record, 149: 631. 

Tauxe RV (1991). Salmonella: A postmodern pathogen J. Food Prot., 

54: 563-568. 

Taylor J, McCoy JH (1969). Salmonella and Arizona infections. In Foodborne 

Infections and Intoxications. pp. 3–72. 

Van der Zee H, Huis in't Veld JHJ (2000). Methods for the rapid 

detection of Salmonella. In Salmonella in Domestic Animals, pp. 373– 

391. 

Veling J, Barkema HW, van der Schans J, van Zijderveld F, Verhoeff J 

(2002). Herdlevel diagnosis for Salmonella enterica subsp. enterica 

serovar Dublin infection in bovine dairy herds. Prev. Veter. Med., 14: 

53(1-2): 31-42. 

Wray C, Sojka WJ (1977). Reviews of the progress of dairy science: 

bovine salmonellosis. J. Dairy Res., 44: 383–425.

African Journal of Microbiology Research Vol.6 (24), pp. 5215-5221, 28 June, 2012 


DOI:10.5897/AJMR12.522 



A molecular genetic study on fruiting-body formation of 

Cordyceps militaris 

TingChi Wen 1# , MinFeng Li 2# , JiChuan Kang 1 * and Jing He 2 

1 Engineering Research Center of Southwest Bio-Pharmaceutical Resources, Ministry of Education, Guizhou University, 

Guiyang 550025, Guizhou Province, China. 

2 School of Life Science, Guizhou University, Guiyang 550025, Guizhou Province, China. 

Accepted 9 June, 2102 

In the fungal genus Cordyceps, the type species C. militaris produces bioactive ingredients and 

exhibits medicinal effects as a Traditional Chinese Medicine (TCM). Currently, the fruiting-body of C. 

militaris has been artificially mass-produced as functional food and medicine in China. The unstable 

variation in forming fruiting-body is however a restriction in the production. The genetic study on 

perithecial stromata (fruiting-body) formation in vitro of C. militaris has not yet been reported. In this 

study, we report the effect of genetic variation including possession of the mating system on perithecial 

stromata formation of C. militaris. The results showed that the mono-conidial isolates with both MAT1- 

1-1 and MAT1-2-1 (genotype MAT1-1/2) produced stromata. While the isolates having only either MAT1- 

1-1 or MAT1-2-1 failed to produce stromata. Despite obvious heterothallism, homothallism was 

occasionally observed in a few isolates of C. militaris. Genetic variation was observed amongst the 

different mono-conidial isolates of C. militaris. The unstable variation or loss of fruiting-body formation 

was caused by the inner-specific genetic variation. 

Key words: Cordyceps militaris, molecular genetics, genetic variation, homothallism, heterothallism, fruitingbody. 

INTRODUCTION 

The old genus Cordyceps (Fr.) Link (now belonging to the 

family of Cordycipitaceae, Ophiocordycipitaceae and 

Clavicipitaceae) is a large, cosmopolitan family, 

comprising of 460 to 500 species and varieties (Liu, 

1999; Sung et al., 2007). Most of its members are 

pathogenic to different insects, spiders, and few grow on 

hypogeal fungi of Elaphomyces spp. They are mainly 

distributed in sub-tropical to temperate regions of the 

world. In China and East Asia, many species of 

Cordyceps have been utilized as medicinal mushrooms 

for thousands of years. C. militaris, the type species of 

the genus, has been recently used as functional food and 

medicine in China. The pharmaceutical component 

*Corresponding author. E-mail: bcec.jckang@gzu.edu.cn. Tel: 

+86 851 8298675. Fax: +86 851 8297499. 

# Authors contributed equally to the work. 

namely cordycepin produced by C. militaris has been 

found to be effective in antitumor (Overgaard-Hansen, 

1964), antivirus (De Julian-Ortiz et al., 1999), antileukemic 

(Kodama et al., 2000), preventing and treating of obesity 

(Kim et al., 2008) and hypolipidemic (Zhu et al., 2003). 

C. militaris has been studied for the commercial 

production of bioactive compounds through their in vitro 

culture (Basith and Madelin, 1968; Pen, 1995; Wen et al., 

2008; 2009). Artificial culturing of C. militaris is a good 

way to solve the insufficient resource from the nature. 

However, in the process of artificial culturing, the isolates 

of C. militaris showed unstable variation in forming 

fruiting-body. Most of the isolates failed to produce 

fruiting-body or produced only few deformed ones. 

Meanwhile other isolates, which initially produced good 

fruiting-body, could not produce fruiting-body with the 

same quality in subsequent subcultures. The degenerating 

of the isolates in forming fruiting-body has 

become a key restrictive factor in industrial production. 

Up-to-date there were few reports on molecular genetic


study of variation in fruiting-body formation and mating 

system of C. militaris (Shrestha et al., 2004; Yokoyama et 

al., 2005). Sato and Shimazu (2002) considered that C. 

militaris had homothallism based on the research on 

lepidopteran pupae. On the other hand, Shrestha et al. 

(2004) reported that C. militaris behaved as a bipolar 

heterothallic fungus and required two compatible mating 

strains in order to produce regular clubshaped perithecial 

stromata. 

In this study, molecular genetics of in vitro stromata 

formation of C. militaris has been carried out based on 

mono-conidial isolates and their offspring. Mating system 

was studied via observation of perithecial stromata 

formation and PCR assay. Herewith, we report the effects 

of genetic variation including the mating system on 

perithecial stromata formation and both heterothallic and 

homothallic sexual behavior of C. militaris. 


Fungal culture 

C. militaris isolate CGMCC2459 (namely Ori-S) were originally 

isolated from Sichuan province of China. The isolate was isolated 

from wild perithecial stromata and maintained on PDA medium at 

25°C for 4 days. 

22 mono-conidial isolates (named SSP1 to SSP22) were 

established from the original isolates (Liang and Fox, 1997). Ori-S 

was cultured until sporulation was evident (approximately 15 days). 

Conidia and the hyphae attached were removed with a loop and 

transferred to fresh medium. This was repeated for twelve 

successive in vitro sub-cultures (namely Deg-S). All cultures were 

stored at 2°C until use. 

Inoculum preparation and fruiting 

C. militaris was initially cultured on PDA in a Petri dish, and then 

transferred to the seed culture by punching out 5 mm of the agar 

disc with a sterilized self-designed cutter. The seed culture was in a 

250 ml flask containing 50 ml of basal medium (20 g/L sucrose, 20 

g/L peptone, 0.5 g/L MgSO4·7H2O and 1 g/L K2HPO4 with 1000 ml 

distilled water), on a rotary shaking incubator, 26°C, 130 rev/min for 

4 days. Fruiting medium of C. militaris was prepared by mixing 20 g 

of rice and 32 ml of liquid medium (20 g/L sucrose, 20 g/L peptone, 

0.5 g/L MgSO4·7H2O and 1 g/L K2HPO4 with 1000 ml distilled water) 

in cylindrical glass bottle and were autoclaved for 20 min at 121°C. 

Each glass bottle containing fruiting medium was inoculated with 5 

ml of liquid inoculum of C. militaris for in vitro fruiting. After 

inoculation, the bottle were incubated at 20°C under dark for 10 

days, then under 14:10 L:D (500 lux light) at 25°C and high 

humidity conditions (80 to 90%) for 50 days. All experiments were 

performed at least in duplicate (10 bottles as one treatment). 

DNA extraction and reagents 

Taq enzyme and dNTPs was purchased from Shanghai Sangon. 

An Agarose Gel DNA Purification kit ver 2.0 was purchased from 

TRKARA Company. Fresh, sporulating cultures on Czapek agar 

were used for DNA extraction following Tigano-Milani et al. (1995); 

the extracted DNA is stored at -20°C. 

PCR amplification and determination of DNA sequences 

In the first preliminary experiments, when different DNA extraction 

methods were compared, RAPD-PCR amplifications were 

performed with an Gene Amp PCR system 9700 (Bio-RAD) with a 

modified RAPD program (one cycle of 60 s at 95°C followed by 40 

cycles of 20 s at 94°C, 60 s at 36°C and 60 s at 72°C) . 50 μl 

reaction system: 10× reaction buffer 5 μl, 10 mM dNTPs 0.66 μl, 

random primer 2 μl, 25 mM MgC12 5 μl, 3 μl of template DNA (50 

ng/μl), Taq DNA polymerase 0.66 μl, ddH2O 33.68μl and 165 

random 10-base oligonucleotide primers (Shanghai Sangon, 

Shanghai, China) were used in these experiments. 


Morphological polymorphism and fruiting 

Amongst the 24 isolates, isolates SSP1 and SSP3 

(mono-conidial) and ORI-S (original) and Deg-S (subculture) 

produced perithecial club-shaped stromata. The 

other twenty mono-conidial isolates SSP2 and SSP4 to 

SSP22 produced either no stromata or only abnormal 

nonperithecial stromata. 

All the 24 isolates from the same original isolate 

differed significantly in their ability to form fruiting-body, 

morphological characteristics and mycelium growth rate. 

In particular, the difference in the 20 no fruiting monoconidial 

isolates SSP2 and SSP4 to SSP22 were also 

significantly different. These results confirmed the polymorphism 

in the anamorph of C. militaris (Liang and Fox, 

1990, 1998). 

RAPD 

Initial screening of 165 RAPD primers resulted in the 

identification of 25 primers that yielded unambiguously 

scorable bands with high reproducibility. These primers 

amplified between 5 and 15 bands each. The molecular 

weight of the PCR products ranged between 200 to 2500 

bp (Figure 1). 

The 25 oligonucleotide primers produced a total of 247 

bands from the 6 isolates including ORI-S, DEG-S, 

SSP2, SSP7, SSP19 and SSP21. Amongst them, 235 

RAPD markers showed polymorphism (95.14%) (Table 

1). The primers of S23, S30, S37, S46, S51, S61, S67, 

S80, S92, S103, S151, S153, S219 and S354 presented 

the highest polymorphism (100% of the bands). 

Genetic distances 

The genetic distances were calculated amongst the 6 

isolates based on null allele frequencies within each 

isolate (Table 2). There was great variation in the genetic 

distances matrix. The longest genetic distance, 0.4890, 

was encountered between SSP2 and DEG-S, followed by 

SSP2 and SSP7 (0.4889), SSP19 and SSP7 (0.4777).

Figure 1. Comparison of amplification patterns obtained by random amplified polymorphic DNA 

(RAPD) with the 8 primers selected (A. S151 and S153; B. S140 and S301; C. S37 and S61; D. 

S23 and S20) from genomic DNA of the 6 isolates (from left to right): 1. ORI-S; 2. DEG-S; 3. 

SSP19; 4. SSP2; 5. SSP7; 6. SSP21; M: molecular weight marker (SM0331 mix DNA ladder, 

Fermentas, Burlington, Canada). 

Table 1. Polymorphism provided by the RAPD primers. 

Primers codes Nucleotide sequence 

Number of scorable 

PCR products 

Number of polymorphic 

PCR products 

S3 CATCCCCCTG 15 14 

S6 TGCTCTGCCC 12 10 

S20 GGACCCTTAC 5 4 

S23 AGTCAGCCAC 8 8 

S26 GGTCCCTGAC 7 6 

S30 GTGATCGCAG 9 9 

S37 GACCGCTTGT 10 10 

S46 ACCTGAACGG 12 12 

S51 AGCGCCATTG 11 11 

S61 TTCGAGCCAG 8 8 

S67 GTCCCGACGA 9 9 

S79 GTTGCCAGCC 9 8 

S80 ACTTCGCCAC 12 12 

S90 AGGGCCGTCT 10 9 

S92 CAGCTCACGA 10 10 

S103 AGACGTCCAC 11 11 

S136 GGAGTACTGG 11 10 

S140 GGTCTAGAGG 12 10 

S151 GAGTCTCAGG 11 11 

S153 CCCGATTCGG 12 12 

S216 GGTGAACGCT 8 7 

S219 GTCCGTATGG 13 13 

S301 CTGGGCACGA 14 13 

S354 CACCCGGATG 8 8 

S360 AAGCGGCCTC 10 9 

Total 247 235 

Wen et al. 5217


Table 2. Estimation of matrix genetic distances between the 6 isolates with enset clones studied 

using RAPD. 

ORI-S DEG-S SSP19 SSP2 SSP7 SSP21 

ORI-S 0.0000 

DEG-S 0.3026 0.0000 

SSP19 0.3765 0.2834 0.0000 

SSP2 0.4656 0.4890 0.4534 0.0000 

SSP7 0.3865 0.4374 0.4777 0.4889 0.0000 

SSP21 0.3906 0.4009 0.4656 0.3684 0.4089 0.0000 

Figure 2. UPGMA dendrogram calculated from RAPD profiles in enset, based on matrix 

genetic distances among the 6 isolates. 

The shortest distance, 0.2834, was between SSP19 and 

Deg-S, followed by ORI-S and DEG-S (0.3026). These 

genetic distances and phenotypes were positively 

correlated. For example, ORI-S and DEG-S (0.3026) 

have the same colony and both of them can produce 

perithecial stromata. SSP19 and ORI-S (0.3765), SSP19 

and DEG-S (0.2834) also have shorter distance along 

with their same colony characteristics. 

Based on the analysis of all primers, the average 

genetic distances between ORI-S and no fruiting isolates, 

DEG-S and no fruiting isolates, ORI-S and DEG-S, and 

the all no fruiting isolates were 0.4048, 0.4027, 0.3026, 

and 0.4438, respectively. The average distance of 0.4438 

between no fruiting isolates showed higher diversity than 

those of others. These results also indicated that innerspecies 

genetic diversity of C. militaris was indeed high. 

Cluster analysis 

A dendrogram (Figure 2) was constructed using UPGMA 

program based on the matrix of genetic distance among 

the 6 isolates in which ORI-S, DEG-S, SSP7 and SSP19 

formed one cluster, while SSP2 and SSP21 formed 

another. Within these two clusters, SSP19 and DEG-S 

are more closely related isolates. This result correlated 

well with phenotype similarity coefficients. 

PCR-based assay of the genotype MAT1-2 and 

fruiting 

The primer sets of MAT1-1-1 and MAT1-2-1 used in this 

study (Yokoyama et al., 2004) could amplify the MAT1-1- 

1 gene of the 11 isolates and the MAT1-2-1 gene of the 

13 isolates of C. militaris with a molecular weight of 220 

to 250 bp respectively (Table 3, Figure 3). These results 

indicated that ORI-S, DEG-S, SSP1 and SSP3 which 

produced perithecial stromata possessed both MAT1-1-1 

and MAT1-2-1 genes namely the genotype MAT1-1/2. 

While the other isolates which could not produce 

stromata possessed only either MAT1-1-1 or MAT1-2-1 

namely the genotype MAT1-1 or MAT1-2. 

Isolates ORI-S and DEG-S, which were not derived

Table 3. Fruiting-body formation and mating type test of C. militaris. 

Strain Mating type Fruit body formation* Fruit body dry weight (g/bottle) † 

ORI-S MAT1-1/2 10/10 2.37 

DEG-S MAT1-1/2 10/10 1.92 

SSP1 MAT1-1/2 8/10 2.13 

SSP3 MAT1-1/2 6/10 1.42 

SSP5 MAT1-1 No fruiting 0 
















* Fruiting-body formation was examined in 10 trials. † Values are mean of all fruiting-body formation determinations. 

Figure 3. Results of PCR assay for the MAT1-2-1(A) and MAT1-1-1 (B) genes. The PCR 

products were electrophoresed on a 1.5% agarose gel. Lane M is a 100bp DNA ladder 

(Fermentas, Burlington, Canada). Lanes 1 to 20 show the PCR products of MAT1-2-1(A) and 

MAT1-1-1 (B) genes from C. militaris isolates ORI-S, DEG-S, SSP9, SSP2, SSP6, SSP4, SSP5, 

SSP7, SSP10, SSP16, SSP1, SSP11, SSP13, SSP12, SSP15, SSP8, SSP19, SP14, SSP21 and 

SSP3, respectively. 

Wen et al. 5219


from single conidium but a mass of conidium with a 

heterothallic mixture of MAT1-1 and MAT1-2 cells, 

possessed both MAT1-1-1 and MAT1-2-1 genes. 

However, isolates SSP1 and SSP3 which were derived 

from mono-conidium also possessed both MAT1-1-1 and 

MAT1-2-1 genes. One fungus that contained both 

homothallic and heterothallic mating system was reported 

in Candida albicans (Kevin, 2009), Botrytinia fuckeliana 

and Chromocrea spinulosa (Coppin et al., 1997). Our 

study demonstrated that C. militaris was both homothallic 

and heterothallic as isolates SSP1 and SSP3 were 

homothallic with the genotype MAT1-1/2, while the other 

isolates which possessed only either MAT1-1-1 or MAT1- 

2-1 with the genotype MAT1-1 or MAT1-2 were 

heterothallic. 

Mating-type genes control sexual reproduction, which is 

the hub of the whole sexual reproduction process. 

Recently, heterothallism in Cordyceps takaomontana 

have been reported and the mating type loci of C. 

takaomontana have been sequenced (Yokoyama et al., 

2005; Eiji et al., 2005). Besides Clavicipitaceae family, 

mating systems of other filamentous Ascomycetes have 

been described and mating type loci have been 

sequenced. Until now, it has not been fully understood 

why certain single ascospore or conidial strain of 

heterothallic filamentous Ascomycetous species behave 

as homothallic mating system. In Neurospora crassa, 

bisexuality has been reported, but most of the cases 

might be due to simple mixtures of ascospores during 

isolation and further growth (Shrestha et al., 2004). 

Mating type heterokaryosis and self-fertility have been 

recently reported in Cryphonectria parasitica (McGuire et 

al., 2004). Similarly, it has been reported that a mating 

system with multiple mating type alleles exist in the 

filamentous ascomycete Glomerella cingulata (Cisar and 

TeBeest, 1999). 

Wang et al. (2008) reported that the genetic diversity of 

inter-species in Cordyceps was extremely small and did 

not correlate with geographical origins and types. In 

contrast, genetic variation from different monoconidial 

isolates and their serial sub-culture of inner-species in C. 

militaris was found in this study. It was therefore 

concluded that the reason for C. militaris showing 

unstable variation in fruiting-body formation was genetic 

variation of inner-species. Furthermore, the instability 

could reflect their loss of genotype of MAT1-1/2 in the 

same culture after serial sub-cultures of the same isolate 

(most common sub-culture method is streak plate 

method, there were only a few conidials random 

transferred to the next sub-culture as seed once a time). 


This work was supported by the National Natural Science 

Foundation of China (NSFC No. 30870009), the Natural 

Science Foundation of Educational Council of Guizhou 

Province (No.[2009]0129) and the Agricultural Science 

and Technology Foundation of Guizhou Provincial 

Government of China (No. [2011]3054). 

REFERENCES 

Basith M, Madelin ME (1968). Studies on the production of perithecial 

stromata by Cordyceps militaris in artificial culture. Can. J. Bot., 46: 

475-480. 

Cisar CR, TeBeest DO (1999). Mating system of the filamentous 

ascomycete, Glomerella cingulata. Curr. Genet., 35: 127-133. 

Coppin E, Debuchy R, Arnaise S, Picard M (1997). Mating types and 

sexual development in filamentous ascomycetes. Microbiol. Mol. Biol. 

Rev., 61: 411-428. 

De Julian-Ortiz JV, Galvez J, Munoz-Collado C, Garcia-Domenech R, 

Gimeno-Cardona C (1999). Virtual combinatorial syntheses and 

computational screening of new potential anti-herpes compounds. J. 

Med. Chem., 42: 3308-3314. 

Eiji Y, Kenzo Y, Akira H (2005). Heterothallism in Cordyceps 

takaomontana. FEMS Microbial. Lett., 250: 145-150. 

Kevin A (2009). Homothallic and heterothallic mating in the 

opportunistic pathogen Candida albicans. Nature, 460: 890-893. 

Kim SK, Sung WL, Su C (2008). A pharmaceutical composition 

comprising cordycepin for the treatment and prevention of obesity: 

[P]. WO/2008/038973. 

Kodama EN, McCaffrey RP, Yusa K, Mitsuya H (2000). Antileukemic 

activity and mechanism of action of cordycepin against terminal 

deoxynucleotidyl transferase-positive (TdT+) leukemic cells. 

Biochem. Pharmacol., 59: 273-281. 

Liang ZQ, Fox RTV (1990). Anamoph of cordyceps militaris and artificial 

culture of its fruitbody. Southwest. China. J. Agric. Sci., pp. 31-36. 

Liang ZQ, Fox RTV (1997). Vegetative compatibility of inter-and intramonoconidium 

strains of anamorph of cordyceps pruinosa. 

Mycosystema, 16: 216-223. 

Liang ZQ, Fox RTV (1998). The polymorphism in the anamorph of 

cordyceps militaris. Mycosystema, 17: 57-62. 

Liu ZY (1999). Studies on relationship between Cordyceps spp. and 

their anamorphs. PhD dissertation. Huazhong agricultural university. 

China. 

McGuire ICP, Marra E, Milgroom MG (2004). Mating-type 

heterokaryosis and selfing in Cryphonectria parasitica. Fung. Gen. 

Biol., 41: 521-555. 

Overgaard-Hansen K (1964). The inhibition of 5-phosphoribosyl-1pyrophosphate 

formation by cordycepin triphosphate in extracts of 

Ehrlich ascites tumor cells. Biochim. Biophys. Acta, 80: 504-507. 

Pen X (1995), The cultivation of Cordyceps militaris fruitbody on artificial 

media and the determination of SOD. Acta. Edulis. Fungi, pp. 225- 

228. 

Sato H, Shimazu M (2002). Homothallism in Cordyceps militaris. Book 

of'Abstracts of the 7th International Mycological Congress, August 

11-17. Oslo, Norway, p. 311. 

Shrestha B, Kim HK, Sung GH, Spatafora JW, Sung JM (2004). Bipolar 

heterothallism, a principal mating system of Cordyceps militaris in 

vitro. Biotechnol. Bioprocess. Eng., 9: 440-446. 

Sung GH, Hywel-Jones NL, Sung JM, Luangsa-Ard JJ, Shrestha B, 

Spatafora JW (2007). Phylogenetic classification of Cordyceps and 

the clavicipitaceous fungi. Stud. Mycol., 57: 50-59. 

Tigano-Milani MS, Samson RA, Martins I, Sobral BWS (1995). DNA 

markers for differentiating isolates of Paecilomyces lilacinus. 

Microbiology (Reading, U.K.), 141: 239-245. 

Wang L, Zhang WM, Hu B, Chen YQ, Qu LH (2008). Genetic variation 

of Cordyceps militaris and its allies based on phylogenetic analysis of 

rDNA ITS sequence data. Fungal Divers., 31: 147-155. 

Wen TC, Kang JC, Li GR, Lei BX (2008). Effect of culture condition on 

the fruit body and cordycepin production in Cordyceps militaris in 

solid-state fermentation. Guizhou. Agric. Sci., 36: 92-94. 

Wen TC, Lei BX, Kang JC, Li GR He J (2009). Enhanced production of 

mycelial and cordycepin by submerged culture using additives in 

Cordyceps militaris. Food. Ferment. Ind., 35: 162-166.

Yokoyama E, Yamagishi K, Hara A (2004). Development of a PCRbased 

mating-type assay for Clavicipitaceae. FEMS Microbiol. Lett., 

237: 205-212. 

Yokoyama E, Yamagishi K, Hara A (2005). Structures of the matingtype 

loci of Cordyceps takaomontana. Appl. Environ. Microbiol., 69: 

5019-5022. 

Wen et al. 5221 

Zhu P, Zhu HB, Zhu HX (2003). Application in preparing hypolipidemic 

drug from cordycepin: China. 200310101650.



DOI: 10.5897/AJMR12.528 



Cloning and prokaryotic expression of ghrelin gene in 

crucian carp (Carassius auratus) 

Chaowei Zhou, Xindong Zhang, Tao Liu, Rongbing Wei, Dengyue Yuan and Zhiqiong Li* 

Department of Aquaculture, College of Animal Science and Technology, Sichuan Agricultural University, Ya’an, 625014, 

China. 


To make up the flaw that there is no available information about ghrelin gene in crucian carp. The 

ghrelin gene was amplified by reverse transcription-PCR (RT-PCR) using total RNA extracted from 

intestine of crucian carp. PCR product was cloned into the pMD®19-T vector to construct pMD®19-Tghrlein 

for sequencing. Then the cDNA was subcloned into the prokaryotic expressing plasmid vector 

pET32a and was transformed into host Escherichia coli strain Rosetta for expression. In this study, 490 

bp fragment of ghrelin was obtained by RT-PCR. In comparison with other fishes, the amino acid 

sequences of ghrelin in crucian carp showed a high similarity to that of goldfish (99%). The high 

expression of ghrelin gene was detected in the intestine and liver by real-time PCR. IPTG at 

concentrations of 0, 0.1, 0.2, 0.3, 0.5, 0.7 and 1.0 mmol/L could efficiently induce the expression of pGh- 

32. The result showed that the optimal concentration of IPTG was 0.3 mmol/L by SDS-polyacrylamide 

gel electrophoresis (SDS-PAGE). The ghrelin gene expressed as early as 1 h after IPTG induction, and 

reached peak levels after 3 h. Successful expression of ghrelin fusion protein in prokaryotic cell could 

lay a basis for further study of industrial production. 

Key words: Crucian carp, ghrelin, cloning, prokaryotic expression. 

INTRODUCTION 

The discovery of ghrelin was reported by Kojima et al. 

(1999) who were searching for a ligand for an orphan G 

protein coupled receptor (GHS-R1a) that stimulates the 

secretion of growth hormone in the pituitary gland. The 

ghrelin possesses two forms in gastrointestinal tissue, 

designed n-octanoyl ghrelin and des- n-octanoyl ghrelin. 

The n- octanoyl ghrelin plays important roles in regulation 

of GH release in rat (Szczepankiewicz et al., 2010), While 

ghrelin activates growth-hormone secretagogue (GHS) 

receptor-expressing cells, the nonmodified des-n-octanyl 

form of ghrelin, designated as des-acyl ghrelin, does not 

(Hosoda et al., 2000). 

In mammalian, ghrelin is involved in various 

physiological functions other than GH release in 

mammals (Kojima and Kangawa, 2005; Korbonits et al., 

2004; Van Der Lely et al., 2004). Ghrelin plays critical role 

*Corresponding author. E-mail: lizhiqiong454@163.com. Tel: 

86-835-2885654. 

in the body, such as appetite, adjusting of energy 

metabolism and immune system (Hattori, 2009). In 

human, octanoylation of the gastric peptide ghrelin could 

produce active forms that regulate appetite and other 

metabolic functions (Goodyear et al., 2010). 

In recent years, in teleosts, the spot of research was 

focus on the ghrelin. To our knowledge, the cDNA cloning 

and sequence analysis and appraisal of all amino acid of 

the ghrelin have been reported in non-mammalian 

vertebrates, such as goldfish (Unniappan et al., 2002), 

Nile tilapia (Parhar et al., 2003), Channel catfish (Kaiya et 

al., 2005), Sea bream (Yeung et al., 2006), Atlantic cod 

(Xu and Volkoff, 2009), and it demonstrated that there 

were invariably homology of molecular weight, amino 

acids and sequence in fish species, but there were no 

report about ghrelin in the crucian carp neither at home 

nor abroad. 

The purpose of this paper was to identify the structure 

of ghrelin cDNA in crucian carp, to detect ghrelin 

expression in the tissues and Escherichia coli (E. coli). 

The current study would provide useful experimental

Table 1. Primer oligonucleotide sequences and their applications. 

Primer name Sequence (5`→3') Size of the product (bp) Applications 

Ghrelin-F1 

Ghrelin-R1 

CTGTGCATTCTGCATACATATTTGAG 

GTTTTGGAAGATTATTACATC 

490 

Cloning of ORF 

Cloning of ORF 

Zhou et al. 5223 

Ghrelin-F2 CGGATCCGGCACCAGCTTCCTCAGT 

Prokaryotic expression 

248 

Ghrelin-R2 GCTCGAGTGAATTCAAGTGGCGA Prokaryotic expression 

Ghrelin-F3 GAAGAGATGTTGCAGAGCCAGAG 

Real time PCR 

152 

Ghrelin-R3 GCCAAGAAGATTGACCAGAACC Real time PCR 

β-Actin-F4 TTTGAGCAGGAGATGGGAACC 

Real time PCR 

134 

β-Actin-R4 AGGAAGGATGGCTGGAAAAGAG Real time PCR 

materials for further functional analysis of ghrelin in 

crucian carp. 


Fish for cloning crucian carp ghrelin 

Healthy crucian carp were purchased from a local fish nursery in 

Ya’an City, China and kept for survival when transported to the 

laboratory. After the fish were sacrificed, the tissues were frozen at 

liquid nitrogen and then removed and stored at -80°C. 

Cloning of ORF sequences of crucian carp ghrelin 

Total RNA was extracted from tissues of intestine of crucian carp by 

the TRIzol reagent (TaKaRa, Dalian, China) following the 

manufacturer′s protocol. The purified RNA concentration was 

quantified using a photometer (Bio-Rad) and the ratio of optical 

densities was between 1.8 and 2.0 (at 260 and 280 nm). 

Subsequently, RT-PCR was performed using a commercially 

available RT-PCR kit (TaKaRa, Dalian, China). For PCR, 100 ng of 

sense primer and antisense primer (Table 1) was used. The 

parameters for PCR were 94°C for 5 min, ×1; 94°C for 30 s; 47°C 

for 30 s, 72°C for 45 s, ×38; and then 72°C for 8 min. After 

visualizing by 1%(w/v) agarose gels electrophoresis, the PCR 

product was purified and cloned into plasmid vector pMD®19-T by 

T-A Cloing Kit (TaKaRa, Dalian, China). The recombinant plasmid 

of pMD®19-T-ghrlein was transformed into DH5a, cultured in LB 

medium at 37°C and then extracted by Sambrook′s method 

(Sambrook et al., 1989). The recombinant plasmid was subjected to 

DNA sequencing by automated sequence analysis (TaKaRa). 

Deducing amino acid sequence of ORF and comparison with 

other teleosts 

To compare the sequence of the ghrelin with that from other 

teleosts, we downloaded the ghrelin sequence of other teleosts in 

the NCBI database (http://www.ncbi.nlm.nih.gov/). Multiple 

alignments of the proteins of ghrelin ORF were constructed using 

ClustalX. 

Real time PCR 

Tissues (that is, intestine, liver, mesonephron, head, kidney, spleen, 

skin, heart, muscle, gill and pituitary gland) were pooled separately 

according to different tissue types from ten crucian carp and total 

RNA was extracted by TRIzol reagent (TaKaRa, Dalian, China). The 

housekeeping gene β-actin was used as the endogenous control. 

Primers F3/R3 and F4/R4 were employed to obtain partial fragment 

of ghrelin and β-actin cDNA respectively. All the primers used in the 

real-time PCR were listed in Table 1. 

Subcloning and Construction of pGh-32 recombinant plasmid 

pMD®19-T-ghrlein was used as a template to amplify a truncated 

gene encoding a signal peptide-deleted ghrelin. The gene 

amplification using primer F2/R2 (Table 1) resulted in the deletion of 

the first 78 nucleotides in the N-terminal of the ghrelin gene, and 

then the PCR product was purified with a commercially available kit 

(Keygen Biotech, Nanjing, Jiangsu, China); meanwhile, pET-32a 

was transformed into E. coil DH5a, and cultured in LB medium at 

37°C and then extracted by Sambrook′s method (Sambrook et al., 

1989). The plasmid pET-32a was digested with BamHIand 

XhoIenzymes, and then purified with a commercially available kit. 

The truncated gene was cloned into the multiple cloning sites 

BamHIand XhoI of prokaryotic expression vector pET-32a and the 

authenticity of insert was confirmed by automated sequence 

analysis (TaKaRa). 

Expression of ghrelin gene 

The recombinant plasmid of pGh-32 was relatively cultured in LB 

medium at 37°C and induced by IPTG at different concentrations of 

0, 0.1, 0.2, 0.3, 0.5, 0.7 and 1.0 mmol/L and different times of 0, 1, 

2, 3, 4, 5 and 6 h. The supernatant and precipitate were separated 

through centrifugation after the bacterial pellet was ultrasonically 

broken (300V, 3×5s). The molecular mass and output of the target 

recombinant protein were measured by SDS-PAGE. 

RESULTS 

Cloning of crucian carp ghrelin and nucleotide 

sequence 

As shown in Figure 1, the fragment of ghrelin gene was 

490 bp in length and confirmed the target size. The 

nucleotide sequence and its deduced amino acid 

sequence were shown in Figure 2. The cDNA sequence 

included a whole Open Reading Frame (ORF), which


2000 

1000 

750 

500 

200 

100 

Figure 1. Amplification of ghrelin gene by RT-PCR. 

M, DL2, 000 DNA marker; Lane 1, PCR product of 

ghrelin amplification. 

encoded 103 amino acids. The signal peptide region 

included 26 amino acids in length. (GeneBank accession 

number: HM567312). 

Homology of the ghrelin gene 

Figure 3 revealed the amino acid sequences of ghrelin of 

crucian carp and other fishes. The ORF region of ghrelin 

gene in crucian carp presented a high similarity with 

those of goldfish (99%), common carp (89.4%) and zebra 

fish (78.8%), as all four species derived from the 

Cyprinidae family. However, it only showed 53.8% 

similarity with channel fish. Therefore, it can be 

concluded that this ghrelin gene was rather conserved 

among different fish species. 

mRNA expression 

M 

The expression levels of the ghrelin gene were shown in 

Figure 4. High expression levels were detected in the 

intestine and liver, followed by mesonephron, head 

kidney and the spleen, and the skin, heart, muscle, gill 

and pituitary gland showed relatively weak expression 

levels. 

1 

Construction and identification of the recombinant 

plasmid 

The mature peptide gene fragment was amplified from 

the recombinant plasmid of pMD-ghrelin by PCR with the 

size of 248 bp and inserted into bacterial expression 

vector of pET-32a. As a result, the prokaryotic expression 

plasmid pGh-32 was obtained. pGh-32 was amplified and 

purified to recycle, digested with BamHIand 

XhoIenzymes, and tested by 1% (w/v) agarose gels 

electrophoresis. The flow chart of the vector construction 

was shown in Figure 5. 

Expression of the target recombinant protein 

The expressed products detected with 15% SDS-PAGE 

and a 27.0 KDa protein band could be seen after staining 

with Coomassie brilliant blue R250 (Figures 6 and 7). 

IPTG at concentrations of 0, 0.1, 0.2, 0.3, 0.5, 0.7 and 1.0 

mmol/L could efficiently induce the expression of pGh-32. 

SDS-PAGE indicated that the optimal concentration of 

IPTG was 0.3 mmol/L. The ghrelin gene expressed as 

early as 1 h after IPTG induction, attaining peak levels 

around 3 h (Figure 7), the ghrelin fusion protein was 

mainly soluble protein and appeared in the precipitate 

only in a small amount (Figure 8). 

DISCUSSION 

Ghrelin plays an important role in appetite, adjusting of 

energy metabolism and immune system. More recently, it 

has been reported to be related to human diseases (Vila 

et al., 2007). The cDNA cloning and sequence analysis 

as well as appraisal of all amino acid of the ghrelin have 

been reported in non-mammalian vertebrates. However, 

no information is available on the role of ghrelin in teleost 

diseases. In this study, we obtained 490 bp of ghrelin 

which encoded 103 amino acids of ORF from the 

intestine of crucian carp, and the ghrelin involved 26 

amino acids of the signal peptide region. The mature 

peptide started immediately after the signal peptide and 

this indicated that protein will be secreted out of the cell 

after its synthesis (Von Heijne, 1992) which demonstrated 

it was the secreted protein. The the high similarity 

between crucian carp and other fishes was consistent 

with previous studies (Kaiya et al., 2003c). Many species 

like rainbow trout (Kaiya et al., 2003a), Janpanese eel 

(Kaiya et al., 2003b), and channel catfish (Kaiya et al., 

2005) showed highest expression levels in the stomach. 

Because the crucian carp lacks a stomach, our result 

showed the highest expression of ghrelin mRNA was 

found in intestine which had been proved in Cyprinidae 

family (Unniappan et al., 2002). This finding indicated that 

ghrelin could play important roles in gastrointestinal 

hormone in the crucian carp.

Figure 2. Nucleotide and putative amino acids sequences of crucian carp ghrelin. Beneath the 

nucleotide sequence is the puttied amino acids sequence. The signal peptide region is the black box. 

Figure 3. Multiple alignment of the deduced amino acid sequences of ghrelin in crucian carp and other 

vertebrates. The multiple alignments were produced using ClustalX. ‘*’ indicates positions that have a single, 

fully conserved residue. ‘:’ and ‘.’ indicate positions that have strong and weak similarity, respectively. Amino 

acid identities (%) between crucian carp and other vertebrates are show at end of each aligned sequence. 

Previous study (Itakura et al., 1977) reported that it was 

a milestone in genetic engineering to make a foreign 

gene successfully expressed in E. coil with the advantage 

of rapid growth rate, capacity for continuous fermentation, 

and relatively low cost. The purpose of the current study 

was to obtain the high expression levels of target gene to 

facilitate further functional analysis. The 26-amino acid 

signal peptide was identified by SingalP v3.0 software, 

which was often useless but influenced the protein 

expression in prokaryotic system; therefore, we cloned a 

truncated gene encoding the target protein without signal 

peptide into prokaryotic vector pET-32a. SDS-PAGE 

performed in this study confirmed that a 27 KDa protein 

band could be seen after staining which indicated that the 

recombinant prokaryotic expression system of pGh-32 

was constructed successfully. 

The product of crucian carp ghrelin gene was mainly 


soluble protein, which was consistent with the pig ghrelin 

protein (Yang et al., 2005). Intriguingly, the ghrelin gene 

in Black-feather chicken was expressed in E. coli 2566 by 

pTYB11 prokaryotic expression plasmids and the ghrelin 

protein was cytorrhyctes (Dai et al., 2008). These could 

be explained that the vector, form or condition might 

impact the existing form of the ghrelin protein in the host 

cell, and further study needed to be continued. The 

output of ghrelin was relatively high (approximately 33% 

of the total bacterial proteins) and this was beneficial to 

industrial production. 

Conclusions 

In conclusion, the ghrelin gene was obtained by 

molecular cloning techniques and was successfully


Relative expression abundances of ghrelin 

Figure 4. Expression level of ghrelin gene in ten tissues of the crucian carp. 

Ghrelin 

Figure 5. Flow chart of the vector construction.

Figure 6. Ghrelin expression induced with different dosages of IPTG. M: Protein marker; Lane 1: Blank 

control; Lane 2: PET32a after induced; Lane 3: None-induced with IPTG; Lane 4-9: Induced with 0.1, 0.2, 

0.3, 0.5, 0.7 and 1.0 mmol/L IPTG, respectively. 

Figure 7. Ghrelin expression induced with IPTG at different times. M: Protein marker; Lane 1: Blank 

control; Lane 2: PET32a after induced; Lane 3: None-induced with IPTG; Lane 4-9: Induced with IPTG 

at 1, 2, 3, 4, 5 and 6 h, respectively. 

Figure 8. Identification of soluble protein of recombinant PET32a/ghrelin. M: Protein marker; Lane 

1: Blank control; Lane 2: PET32a after induced; Lane 3: None-induced with IPTG; Lane 4: 

PET32a/ghrelin after induced; Lane 5 and 6: Bacterial supernatant and precipitate with IPTG, 

respectively. 


Ghrelin 

Ghrelin 

Ghrelin


expressed in E. coli in this study, and this will lay the 

foundation for the further study on the function of this 

protein and its mechanism. 


The researchers would like to thank the staff of the 

Department of aquaculture, Sichuan Agricultural 

University, Ya , an, Sichuan, China. 

REFERENCES 

Dai X, Ran X, Wang J (2008). cDNA and Genomie DNA Cloning and 

Expression of Ghrelin Gene in Blaek-feather Chicken of Guizhou. 

China Poult., 30(7): 25-28. 

Goodyear S, Arasaradnam RP, Quraishi N, Mottershead M, Nwokolo 

CU (2010). Acylated and des acyl ghrelin in human portal and 

systemic circulations. Mol. Biol. Rep., 37(8): 3697-3701. 

Hattori N (2009). Expression, regulation and biological actions of growth 

hormone (GH) and ghrelin in the immune system. Growth Horm. IGF 

Res., 19(3): 187-197. 

Hosoda H, Kojima M, Matsuo H, Kangawa K (2000). Ghrelin and desacyl 

ghrelin: two major forms of rat ghrelin peptide in gastrointestinal 

tissue. Biochem. Biophys. Res. Commun., 279(3): 909-913. 

Itakura K, Hirose T, Crea R, Riggs AD, Heyneker HL, Bolivar F (1977). 

Expression in Escherichia coli of a chemically synthesized gene for 

the hormone somatostatin. Science, 198(4321): 1056-1063. 

Kaiya H, Kojima M, Hosoda H, Moriyama S, Takahashi A, Kawauchi H 

(2003a). Peptide purification, complementary deoxyribonucleic acid 

(DNA) and genomic DNA cloning, and functional characterization of 

ghrelin in rainbow trout. Endocrinology, 144(12): 5215-5226. 

Kaiya H, Kojima M, Hosoda H, Riley LG, Hirano T, Grau EG (2003b). 

Amidated fish ghrelin: purification, cDNA cloning in the Japanese eel 

and its biological activity. J. Endocrinol., 176(3): 415-423. 

Kaiya H, Kojima M, Hosoda H, Riley LG, Hirano T, Grau EG (2003c). 

Identification of tilapia ghrelin and its effects on growth hormone and 

prolactin release in the tilapia, Oreochromis mossambicus. Comp. 

Biochem. Physiol. B., 135(3): 421-429. 

Kaiya H, Small BC, Bilodeau AL, Shepherd BS, Kojima M, Hosoda H 

(2005). Purification, cDNA cloning, and characterization of ghrelin in 

channel catfish, Ictalurus punctatus. Gen. Comp. Endocrinol., 143(3): 

201-210. 

Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K 

(1999). Ghrelin is a growth-hormone-releasing acylated peptide from 

stomach. Nature, 402(6762): 656-660. 

Kojima M, Kangawa K (2005). Ghrelin: structure and function. Physiol. 

Rev., 85(2): 495-522. 

Korbonits M, Goldstone AP, Gueorguiev M, Grossman AB (2004). 

Ghrelin--a hormone with multiple functions. Front. Neuroendocrin., 

25(1): 27-68. 

Parhar IS, Sato H, Sakuma Y (2003). Ghrelin gene in cichlid fish is 

modulated by sex and development. Biochem. Bioph. Res. Co., 

305(1): 169-175. 

Sambrook J, Fritsch E, Maniatis T (1989). Molecular cloning: a 

laboratory manual. 2nd. New York: Cold Spring Harbor Laboratory, 

18: 58. 

Szczepankiewicz D, Skrzypski M, Pruszynska-Oszmalek E, 

Zimmermann D, Andralojc K, Kaczmarek P (2010). Importance of 

ghrelin in hypothalamus - pituitary axis on growth hormone release 

during normal pregnancy in the rat. J. Physiol. Pharmacol., 61(4): 

443-449. 

Unniappan S, Lin X, Cervini L, Rivier J, Kaiya H, Kangawa K (2002). 

Goldfish ghrelin: molecular characterization of the complementary 

deoxyribonucleic acid, partial gene structure and evidence for its 

stimulatory role in food intake. Endocrinology, 143(10): 4143-4146. 

Van Der Lely AJ, Tschop M, Heiman ML, Ghigo E (2004). Biological, 

physiological, pathophysiological, and pharmacological aspects of 

ghrelin. Endocr. Rev., 25(3): 426. 

Vila G, Maier C, Riedl M, Nowotny P, Ludvik B, Luger A (2007). Bacterial 

endotoxin induces biphasic changes in plasma ghrelin in healthy 

humans. J. Clin. Endocr. Metab., 92(10): 3930. 

Von Heijne G (1992). Membrane protein structure prediction: 

Hydrophobicity analysis and the positive-inside rule. J. Mol. Biol., 

225(2): 487-494. 

Xu M, Volkoff H (2009). Molecular characterization of ghrelin and 

gastrin-releasing peptide in Atlantic cod (Gadus morhua): cloning, 

localization, developmental profile and role in food intake regulation. 

Gen. Comp. Endocr., 160(3): 250-258. 

Yang L, Yang W, ZHAO Y, QIAN J, Wang Z (2005). Chemical Synthesis 

and Prokaryotic Expression of Ghrelin of Pig. Chin. J. Vet. Sci., 25(6): 

614-616. 

Yeung CM, Chan CB, Woo NY, Cheng CH (2006). Seabream ghrelin: 

cDNA cloning, genomic organization and promoter studies. J. 

Endocrinol., 189(2): 365-379.



DOI: 10.5897/AJMR12.545 



Insight into microevolution of Streptomyces rimosus 

based on analysis of zwf and rex genes 

Zhenyu Tang 1 , Paul R. Herron 2 , Iain S. Hunter 2 , Siliang Zhang 1 and Meijin Guo 1 * 

1 State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237, 

P. R. China. 

2 Strathclyde Institute of Pharmacy and Biomedical Sciences, University of Strathclyde, Glasgow, G4 0RE, Scotland, 

United Kingdom. 


Streptomyces rimosus has greatly influenced human history as a producer of many important 

secondary polyketide metabolites, such as oxytetracycline (OTC). The traditional screen and mutation 

program has resulted in a dramatic increase in OTC production. The availability of multiple semicomplete 

genome sequences of S. rimosus facilitates attempts to systematically address basic 

questions in genome evolution. We refer to such efforts as micro-evolutionary analysis. We report the 

results of comparative analysis of semi-complete genome sequences of three S. rimosus strains from 

the genealogy map (G7, M4018 and 23383) with different OTC production levels using genome 

comparison (single nucleotide polymorphisms, SNPs) method. These data were used to assess the 

influence of microevolution on the physiology, genetics and evolution of S. rimosus. Some SNPs were 

found in primary metabolism related genes which might affect the final OTC production. We further 

discussed the microevolution of primary metabolite genes (Glucose-6-phosphate dehydrogenase, zwf) 

and regulatory genes (redox regulator, rex) in S. rimosus. Using SOLEXA sequencing data, the 

phylogenetic trees of zwf and rex were constructed. The results indicate that S. rimosus is closely 

related with Streptomyces albus and represents a distinct evolutionary lineage compared with other 

Streptomyces. Our research cannot only provide important information for genotyping and evolutionary 

research of S. rimosus, but can also make possible the development of an informed view of genotype 

and phenotype. 

Key words: Microevolution, Streptomyces rimosus, single nucleotide polymorphisms (SNPs), glucose-6phosphate 

dehydrogenase, redox sensor. 

INTRODUCTION 

Evolution can be divided into two categories: 

macroevolution and microevolution. Macroevolution 

focuses on changes that occur within and among 

populations, while microevolution refers to smaller 

evolutionary changes within a species or population, 

including the genetic composition of a population (Hendry 

and Kinnison, 2001). Based on this theory, 

microevolution normally occurs over shorter intervals. In 

*Corresponding author. E-mail: guo_mj@ecust.edu.cn. Tel: +86 

21 64251131. Fax: +86 21 64253702. 

the past few years, studies of microevolution have made 

a transition from the evolutionary synthesis to new levels 

of melioration, and now are the symbol of the evolution 

outcome. 

Microevolution studies tend to focus on polymorphism, 

which refers to variation within a population. This may 

evolve a lot of mechanisms, such as mutations, genome 

rearrangement, gene duplication, transposition, and 

homologous and non-homologous recombination 

(Lawrence and Hendrickson, 2003). For mutation, it is 

defined as an alteration in DNA sequence, including both 

point mutations where one base pair of DNA is 

substituted for another, and insertions and deletions


Table 1. The SNPs related to the primary metabolism in S. rimosus 23383. 

Tang et al. 5231 

Primary metabolism related genes SNPs position Nucleotide sequence changes Amino acid changes 

Phosphoglycerate mutase 576 G to A Ser to Asn 

Phosphoglycerate kinase 119 G to A Gly to Asp 

Acyl-CoA synthetase 310 G to A Asp to Asn 

Aldehyde dehydrogenase 721 G to A Gly to Arg 

Alcohol dehydrogenase 1055 G to A Gly to Asp 

Glucose-6-phosphate 1-dehydrogenase 139 C to T Pro to Ser 

sequencing machines. Maq first aligns reads to reference 

sequences (M4018) and then calls the consensus. At the mapping 

stage, maq performs ungapped alignment. At the assembling stage, 

maq calls the consensus based on a statistical model. It calls the 

base which maximizes the posterior probability and calculates a 

phred quality at each position along the consensus. All the SNPs 

and Indels generated from G7, M4018 and 23383 were predicated 

by Maq during the mapping as well. 

Phylogenetic analysis 

The phylogenetic trees of zwf1, zwf2 and rex encoded proteins from 

S. rimosus M4018 were carried out using the Neighbor-Joining 

algorithm from NCBI website. The neighbor-joining method is a 

special case of the star decomposition method (Saitou and Nei, 

1987). The raw data are provided as a distance matrix and the star 

tree is the initial tree. Then, a modified distance matrix is 

constructed in which the separation between each pair of nodes is 

adjusted on the basis of their average divergence from all other 

nodes. The tree is constructed by linking the least-distant pair of 

nodes in this modified matrix. When two nodes are linked, their 

common ancestral node is added to the tree and the terminal nodes 

with their respective branches are removed from the tree. This 

pruning process converts the newly added common ancestor into a 

terminal node on a tree of reduced size. At each stage in the 

process, two terminal nodes are replaced by one new node. The 

process is complete when two nodes remain, separated by a single 

branch. 

Rex protein structure prediction 

SWISS-MODEL (http://swissmodel.expasy.org) which is a server for 

automated comparative modeling of three-dimensional (3D) protein 

structures was used to predict the Rex protein structure. In the 

‘alignment mode’, the modeling procedure is initiated by submitting 

the Rex sequence (S. rimosus M4018) alignment file. We specified 

which sequence in the given alignment was the target sequence 

and which one corresponded to a structurally known protein chain 

from the ExPDB template library. At last, the server would build the 

model based on the given alignment. 

RESULTS 

Microevolution analysis of S. rimosus with different 

OTC production levels 

Using S. rimosus M4018 genome sequence as the 

reference, 78 and 615 SNPs were found in S. rimosus G7 

and S. rimosus 23383 genomes respectively by Maq 

software. However, there were no SNPs and Indels 

identified in OTC gene clusters, while some SNPs were 

found in primary metabolism related genes in S. rimosus 

23383 as shown in Table 1. The SNPs positions and 

amino-acid changes are all listed in the table. These 

SNPs are all belonged to nSNPs. 

Microevolution analysis of glucose-6-phosphate 

dehydrogenase gene 

In Streptomyces, housekeeping genes are normally 

stable and conserved, so it can well demonstrate the 

microevolution relationship between different species 

using phylogeny tree analysis. 

As shown in Figure 2, the phylogenetic trees of zwf1 

and zwf2 form two different groups; while Streptomyces 

albus is located at the adjacent branch of both trees. The 

GC contents of zwf1 and zwf2 in S. rimosus are 68 and 

73%, respectively. Besides, the ZWF protein sequences 

share high homology with other Streptomyces species by 

blast analysis, 85 to 90% for zwf1 and 76 to 86% for zwf2. 

Microevolutionary analysis of rex gene 

Rex (Redox regulator, Rex) characterized in S. rimosus is 

a transcriptional regulator that responds directly to the 

poise of the NADH/NAD + redox (Shen et al., 2012). The S. 

rimosus Rex protein sequence shares high homology 

with those of four Streptomyces species by blast analysis: 

S. coelicolor A3(2) (84%), Streptomyces avermitilis MA- 

4680 (84%), Streptomyces griseus (80%) and 

Streptomyces lividans TK24 (71%). Meanwhile, database 

searches revealed that Rex-related proteins were 

encoded by the genomes of most Gram-positive bacteria, 

including B. subtilis (38% identity), Bacillus anthracis 

(38% identity), Listeria monocytogenes (39% identity). 

The phylogenetic tree showed that Sr-Rex was located at 

the edge of the tree (Figure 3), which concludes that it is 

different from other Rex proteins. The protein sequence 

data also confirms that Sr-Rex is much longer that other 

Rex proteins from homologues species (Shen et al., 

2012). Kirby (2008) analyzed SSU ribosomal RNA


a

Figure 2. The phylogenetic trees of glucose-6-phosphate dehydrogenase from S. rimosus M4018 (a) 

ZWF1 (b) ZWF2. They were constructed using the Neighbor-Joining algorithm from NCBI website. 

The ZWF proteins from S. rimosus M4018 are highlighted in yellow. 

Tang et al. 5233


Figure 3. The phylogenetic tree of rex gene from S. rimosus M4018. It was constructed using the Neighbor-Joining algorithm from 

NCBI website. The Rex protein from S. rimosus M4018 is highlighted in yellow. 

phylogeny of S. rimosus, the results showed that the 

species is positioned at the edge of the Streptomyces 

clade as well. 

DISCUSSION 

With the development of sequencing technology, whole 

genome sequencing of bacteria becomes more and more 

popular and advances the microevolution analysis. In this 

study, we report the results of comparative analysis of 

semi-complete genome sequences of three S. rimosus 

strains (G7, M4018 and 23383) with different OTC 

production levels using genome comparison (SNPs) 

method. Some SNPs were found in primary metabolism 

related genes. As primary metabolism can provide 

precursors (e.g. CoenzyhmeA), energy (e.g. ATP), 

reducing power (e.g. NADPH) for the secondary 

metabolites (e.g. OTC), we assumed that these changes 

might affect the final OTC production. The microevolution 

of primary metabolite genes (glucose-6-phosphate 

dehydrogenase, zwf) and regulatory genes (redox 

regulator, rex) in S. rimosus indicate that S. rimosus is 

closely related with S. albus. The zwf genes of S. rimosus 

and S. albus may come from the same ancestor and 

undergo a long evolution time. The difference GC 

contents of zwf1 and zwf2 suggest that they may 

incorporate into the genome in different time. Thus, we 

can conclude that S. rimosus represents a distinct 

evolutionary lineage compared with other Streptomyces. 

All the nSNPs found in S. rimosus 23383 are involved 

in the conserved domains of the proteins. For the point 

mutation in phosphoglycerate mutase (Ser to Asn), it 

might influence the glycolysis pathway and the reversible 

interconversion of 3-phosphoglycerate to 2phosphoglycerate, 

while the mutation in 

phosphoglycerate kinase (Gly to Asp) might affect the 

formation of ATP to ADP. For the nSNP in acyl-CoA 

synthetase (Asp to Asn), it could change the lipid 

synthesis, fatty acid catabolism, and remodeling of 

membranes. The point mutation in alcohol 

dehydrogenase (Gly to Asp) and aldehyde 

dehydrogenase (Gly to Arg) might have an impact on the 

conversion of ethanol to harmless acetic acid. Glucose-6phosphate 

1-dehydrogenase is the first enzyme in PPP 

and is involved in the production of reducing power 

NADPH, so the mutation (Pro to Ser) could cause the 

significant change and affect the OTC production (the last 

three steps in the biosynthesis of OTC need a lot of 

NADPHs). 

In S. rimosus, zwf1 and zwf2 are two isoforms of 

G6PDH. Their amino acids and nucleotide sequences are 

different, so it may be concluded that they cannot be 

replaced by each other. By disruption of zwf1 or zwf2, the

a 

c 

Rex 

DNA 

Tang et al. 5235 

Figure 4. The 3D structure of Rex. (a) A ribbon representation of the 3D structure of Sr-Rex was constructed by Swiss- 

Model, alignment mode. The binding of Sr-Rex protein with DNA is presented in this figure as well. (b) Model for T- 

Rex/DNA Recognition (Nakamura et al., 2007). (c) Overall crystal structure of the B-Rex (Wang et al., 2008). 

specific OTC productivity was increased by 66 or 33% 

compared with the wild type control. Meanwhile, the 

biomasses of zwf gene intensified mutants (zwf1 

b 

+ and 

zwf2 + ) were 20 or 10% more than their zwf gene 

disrupted counterparts (Tang et al., 2011). All these data 

indicate that zwf1 contributes more to biomass formation 

and OTC production than zwf2 does. 

As the production of antibiotics is the outcome of 

multiple genes interactions and network regulations, 

regulatory genes are involved as well. Sr-Rex, a novel 

redox-sensitive repressor in S. rimosus M4018, which 

appears to modulate transcription in response to changes 

in cellular NADH levels, was discovered recently (Shen et 

al., 2012). The highly conserved phylogenetic sequence 

suggests common structural mechanisms for redoxdependent 

gene regulation among Rex family members. 

Previously, Brekasis and Paget (2003) demonstrated that 

NADH dissociated a Sc-Rex/ROP complex, as well as B- 

Rex homologs in B. subtilis (Gyan et al., 2006). 

Furthermore, there is a common motif GlyXGlyXXGly 

which is important for the NADH binding in all rex genes. 

We find the same sequence in Sr-rex which is Gly100- 

Ile101-Gly102-Asn103-Leu104-Gly105. By further investigation, 

it suggests that NADH can inhibit the Rex and ROP 

binding. However, NAD + has no effect on the REX-ROP 

complex formation. This was consistent with the 

researches in S. coelicolor (Brekasis and Paget, 2003) 

and B. subtilis (Ellen et al., 2008). As shown in Figure 4, 

by Swiss-Model, the final structure of the predicted Sr- 

Rex model is similar to T-Rex (Nakamura et al., 2007) 

and B-rex (Wang et al., 2008). 

Moreover, we found that some SNPs of regulatory 

genes existed in S. rimosus G7 and S. rimosus 23383 

genomes. For example, a Streptomyces antibiotic 

regulatory protein (SARP) was found downstream the 

otrB gene in the OTC biosynthesis cluster. Compared 

with S. rimosus 4018, there is a point mutation in this 

gene which mutates the amino acid from leucine into 

phenylalanine. Since this leucine is conserved in all the 

SAPRs, it might affect the regulation function of this gene. 

This work is under study in Paul R. Herron’s group in 

University of Strathclyde. 

To understand the role of microevolution in biological 

control, more data need to be exploited. Thus, it may be 

possible to guide the evolution into efficient ways. From 

the DNA sequence alterations (SNPs and Indels), after 

we get the information of microevolution, all the data 

related to genotype, phenotype, transcriptional levels will 

be correlated in an informed view. A selected mutation 

identified in the production strain (23383) will be


introduced by recombinant techniques to the low 

producer (G7 or M4018). To date, there is little literature 

about this. Only with a good understanding of the role of 

microevolution in S. rimosus genealogy, can we minimize 

the negative factors and maximize the benefits such as 

OTC production. 


This work was supported by grants from the Scotland- 

China Higher Education Research Partnership for PhD 

Studies, the Fundamental Research Funds for the 

Central Universities (ECUST), and the Open Project 

Program of the State Key Laboratory of Bioreactor 

Engineering, ECUST (No. 2060204). 

REFERENCES 

Brekasis D, Paget MS (2003). A novel sensor of NADH/NAD + redox 

poise in Streptomyces coelicolor A3(2). EMBO J., 22: 4856–4865. 

Chopra I, Hawkey PM, Hinton M (1992). Tetracyclines, molecular and 

clinical aspects. J. Antibiot. Chemother., 29: 245–277. 

Ellen W, Mikael CB, Annika R (2008). Structure and functional 

properties of the Bacillus subtilis transcriptional repressor Rex. Mol. 

Microbiol., 69(2): 466-478. 

Gyan S, Shiohira Y, Sato I, Takeuchi M, Sato T (2006). Regulatory loop 

between redox sensing of the NADH/NAD + ratio by Rex (YdiH) and 

oxidation of NADH by NADH dehydrogenase Ndh in Bacillus subtilis. 

J. Bacteriol., 88: 7062–7071. 

Hendry AP, Kinnison MT (2001). An introduction to microevolution: rate, 

pattern, process. Genetica, 112-113: 1–8. 

Hughes AL (1999). Adaptive Evolution of Genes and Genomes. Oxford 

Univ. Press, Oxford, UK. 

Kerry J, Hiney M, Coyne R, Nicgabhainn S, Gilroy D, Cazabon D, Smith 

P (1995). Fish feed as a source of oxytetracycline-resistant bacteria 

in the sediments under fish farms. Aquaculture, 131: 101–113. 

Kirby R, Gan TK, Hunter IS (2008). The genome of Streptomyces 

rimosus subsp. rimosus shows a novel structure compared to other 

Streptomyces using DNA/DNA microarray analysis. Antonie van 

Leeuwenhoek, 94: 173–186. 

Lawrence J, Hendrickson H (2003). Lateral gene transfer: When will 

adolescence end? Mol. Microbiol., 50: 739–749. 

Nakamura A, Sosa A, Komori H, Kita A, Miki K (2007). Crystal structure 

of TTHA1657 (AT-rich DNA-binding protein; p. 25) from Thermus 

thermophilus HB8 at 2.16 A resolution. Proteins, 66: 755–759. 

Saitou N, Nei M (1987). The neighbor-joining method: a new method for 

reconstructing phylogenetic trees. Mol. Biol. Evol., 4(4): 406-425. 

Shen J, Tang ZY, Xiao CY, Guo MJ (2012). Cloning and expression of 

the redox-sensing transcriptional repressor Rex and in vitro DNAbinding 

assay of the Rex and rex operator in Streptomyces rimosus 

M4018. Acta Microbiol. Sin., 52(1): 30-35. 

Tang ZY, Xiao CY, Guo MJ, Zhuang YP, Chu J, Zhang SL, Herron P, 

Hunter IS (2011). Improved Oxytetracycline Production in 

Streptomyces rimosus M4018 by Metabolic Engineering of Housekeeping 

Enzyme G6PDH Gene in Pentose Phosphate Pathway 

Enzym. Microb. Tech., 49: 17–24. 

Wang E, Bauer MC, Rogstam A, Linse S, Logan DT (2008). Structure 

and functional properties of the Bacillus subtilis transcriptional 

repressor Rex. Mol. Microbiol., 69: 466–478.



DOI: 10.5897/AJMR12.574 



Molecular characterization of hepatitis B virus (HBV) 

genotypes in HBsAg positive individuals of Khyber 

Pakhtunkhwa, Pakistan 

Zia Ur Rahman Awan 1 *, Abdul Haleem Shah 1 and Sanaullah Khan 2 

1 Department of Biological Sciences, Gomal University Dera Ismail Khan, Pakistan. 

2 Department of Zoology, Kohat University of Sciences and Technology Kohat, Pakistan. 


Hepatitis B virus (HBV) is a crucial health problem with up to 350 million people infected globally. The 

epidemiological significance of HBV genotypes has been well established however, no such large scale 

data available for HBV genotypes and much little is known about the mixed infection with more than 

one HBV genotypes. The main aim of the present study was to determine the molecular characterization 

of HBV genotypes in HBsAg positive patients in Khyber Pakhtunkhwa, Pakistan. A total of 713 HBsAg 

positive individuals were included in the present study. All the samples were confirmed for HBV DNA 

with nested polymerase chain reaction (PCR) and HBV DNA positive samples were further processed 

for HBV genotypes with type specific primers. This study demonstrated that genotype A (33.66%) is the 

predominant genotype followed by genotype D (29.5%), genotype C (2.10%), genotype F (1.40%) and 

mixed genotypes A+D (10.52%) while 5.9% of the samples were untypable. Genotype B and E was not 

found in this study. The current study shows the high frequency of genotype A and a heterogeneous 

distribution of HBV genotypes. Further study needs to investigate genetic and geographical divergence 

and characteristics of the virus in this area especially. 

Key words: Hepatitis B virus, HBsAg, HBV DNA, genotype, characterization. 

INTRODUCTION 

Hepatitis B virus (HBV) is the most common infection with 

approximately one third of the world population has been 

infected with this infection (Kevin and Leonard, 2011). 

Chronic HBV infection is common by an estimate in 350 

million persons globally, and carriers of HBV are at 

increasing risk of developing cirrhosis, hepatic decomposition 

and hepatocellular carcinoma (Jose et al., 2012). 

HBV is the smallest human DNA virus, with 3200 

nucleotides genome (Kao et al., 2011). HBV is transmitted 

through blood and blood products, although sexual 

transmission and intrafamilial transmission have also 

been reported (Rauf et al., 2010). 

*Corresponding author. E-mail: ziabiotech78@yahoo.com. Tel: 

+92 333 9731178, +92 966 750273. 

The evolution of HBV has led to the present existence of 

various genotypes, sub genotypes, mutants, recombinants, 

and even quasispecies of HBV (Kao, 2002). At 

present HBV can be classified into 9 genotypes from A to 

I (Santos et al., 2010; Yu et al., 2010) based on a 

nucleotide divergence in the entire genome of at least 

8%, with specific and characteristic geographical distributions, 

but most have a worldwide prevalence because 

of human migration (Jose et al., 2012). Genotype A can 

be regarded as pandemic but is most commonly found in 

Northern Europe, North America and Central Africa, while 

genotype B predominates in Asia (China, Indonesia and 

Vietnam). Genotype C is found in the Far East in Korea, 

China, Japan and Vietnam as well as the Pacific rim and 

Island Countries, while genotype D, which is also more or 

less pandemic, is found in the Mediterranean countries, 

the Middle East extending to India, North America and


parts of the Asia-Pacific region. Genotype E is related to 

Africa while genotype F is found predominately in South 

America, including among Amerindian populations, and 

also Polynesia. Genotype G has been found in North 

America and Europe while genotype H has been reported 

from America (Alam et al., 2007a), but recently two 

genotypes, “I” in China, Vietnam and Laos (Santos et al., 

2010; Kao et al., 2011) and “J” in Japan, were identified 

(Kao et al., 2011). 

According to WHO, Pakistan, falls in the low endemic 

area of HBV infection with prevalence of 3% infected 

population. Studies regarding HBV infection from 

Pakistan focused more towards the HBV prevalence rate, 

epidemiological issues, genotyping of most prevalent 

strains and its genetic variability regarding core region 

(Baig et al., 2007). HBV infection rate in Pakistan is 

increasing day by day. Awan et al. (2010) reported 

approximately 38% prevalence with a 4% carrier rate and 

32% with anti-HBV surface antibodies by natural 

conversion (Khan et al., 2011). The reason may be the 

lack of proper health facilities or poor economical status 

and less public awareness about the transmission of 

major communicable disease like HBV, HCV and HIV 

(Alam et al., 2007a, b). Because HBV genotypic determination 

is of particular importance for the study of the 

detection of the virus’s origin, course of evaluating HBV, 

the severity and activity of liver disease, prognosis and 

response to antiviral treatment, patterns of serological 

reactivity and replication of the virus, the present study 

was designed to determined the prevalence of HBV 

genotypes in the Khyber Pakhtunkhwa Province of 

Pakistan. 


Study samples 

This study was carried out on HBsAg positive patients from 

September 2011 to January 2012 in seven divisions: Dera Ismail 

Khan (D.I. Khan), Bannu, Kohat, Peshawar, Mardan, Hazara and 

Malakand of Khyber Pakhtunkhwa, Pakistan. 

A total of 713 blood samples were collected from HBsAg positive 

male and female patients, with age 01 to 70 years. Informed 

consent forms were signed and collected from all volunteers 

following Institutional Review Board policies of the respective 

institutes. A 3 ml blood sample was collected in a vacutainer from 

each patient involved in the study. Sera were separated and stored 

at -20°C in the Molecular Parasitology and Virology Laboratory, 

Department of Zoology, Kohat University of Science and 

Technology Kohat, Pakistan for further processing. For reducing 

contamination, standard procedures were strictly followed. For the 

detection of HBV DNA and HBV genotyping all the samples were 

analyzed. 


The liver function tests (LFTs) especially Alanine aminotransferase 

(ALT) and Asparate aminotransferase (AST), were performed (two 

readings for each patient) for six months using Microlab 300 (Merck 

USA) using ALT and AST kit (Diasys Diagnostic System Germany) 

as described in manufacturer’s manual. 

HBV DNA detection 

DNA extraction 

DNA was extracted from 100 μl of HBsAg positive serum, using GF- 

1 nucleic acid extraction kit (Vivantas USA) according to 

manufacturer’s instructions. 

DNA amplification and detection 

PCR reactions were carried out in a thermal cycler (Nyxtechnik 

USA) with 5U Taq DNA polymerase (Fermentas USA). The first 

round of amplification was performed with 5 μl of extracted DNA by 

using an outer sense primer and an outer antisense primer specific 

to the surface gene of HBV. Another round of PCR was carried out 

with inner sense primer and inner antisense primer. Amplified 

products were subjected to electrophoresis in 2% agarose gel and 

evaluated under UV transillumination. The 185 bp specific amplified 

HBV DNA product was determined by comparing with the 50 bp 

DNA ladder (Fermentas USA), used as DNA size marker. 

HBV genotyping 

For HBV genotypes determination, the same procedure was 

followed as described by Naito et al. (2001). 

RESULTS 

713 HBsAg positive individuals with age of 1-70 years 

including 489 (68.6%) males and 224 (31.42%) females 

(Male to Female ratio 2.18:1) were analyzed in this study. 

Of the total, 419 male and 173 female were confirmed for 

HBV DNA while in 70 male and 51 female patients HBV 

DNA was not detected. The confirmed 592 HBV DNA 

samples were further processed for genotyping. The 

gender wise distribution of genotypes in all the HBV DNA 

positive patients of Khyber Pakhtunkhwa is shown in 

Table 1. 

Out of the 592 HBV DNA positive samples analyzed, 

550 (92.91%) showed genotype specific bands for 

genotype A, C, D, F and A+D, while the remaining 42 

(7.09%) were untypable. The HBV infection in this study 

in HBsAg positive patients were attributed predominantly 

to viral genotype A constituted 240 (33.66%) of the total 

individuals. Genotype D was the second prevalent with 

210 (29.5%), followed by genotype C 15 (2.10%) and 

genotype F 10 (1.40%). Mixed genotypes A+D were 

detected in 75 (10.52%) samples (Figure 1), while 

genotypes B and E were not found in this study. The 

highest prevalence of genotype A (70%) was found in 

Mardan Division and that of genotype D (60%) in D.I. 

Khan Division while the untypable (15%) patients were 

mostly found in Peshawar Division and the mixed 

genotype was not found in Mardan Division. The 

genotype C was found in Hazara Division (5%) and 

Malakand Division (10%) while genotype F (10%) was 

fond in Hazara Division only (Table 1). 

The prevalence of genotypes was assessed further 

with respect to patient’s age. The high frequency of all 

genotypes, A (39.58%), D (40.48%), F (50%) and A+D

Table 1. Gender and division wise distribution of HBV genotypes in HBV DNA positive patients of Khyber Pakhtunkhwa, Pakistan. 

Awan et al. 5239 

Genotype gender D.I. Khan n (%) Bannu n (%) Kohat n (%) Peshawar n (%) Mardan n (%) Hazara n (%) Malakand n (%) Total n (%) 

Genotype A 

Male - 30(12.5) 45(18.75) 25(10.42) 45(18.75) 5(2.08) 12(5.0) 162(27.4) 

Female 10(4.17) - 10(4.17) 20(8.33) 25(10.42) 5(2.08) 8(3.33) 78 (13.2) 

Genotype C 

Male - - - - - 5(33.33) 7(46.67) 12(2.03) 

Female - - - - - - 3(20.0) 3(0.51) 

Genotype D 

Male 45(21.43) 25(11.9) 10(4.76) 10(4.76) - 25(11.9) 35(16.67) 150(25.34) 

Female 15(7.14) 15(7.14) 5(2.38) - - 15(7.14) 10(4.76) 60(10.14) 

Genotype F 

Male - - - - - 5(50.0) - 5(0.84) 

Female - - - - - 5(50.0) - 5(0.84) 

Mix genotype A+D 

Male 10(13.33) 10(13.33) 10(13.33) 10(13.33) - 10(13.33) 10(13.33) 60(10.14) 

Female 5(6.67) - - 5(6.67) - - 5(6.67) 15(2.53) 

Untypable 

Male 2(4.76) 1(2.38) 3(7.14) 10(23.81) 9(21.43) 3(7.14) 2(4.76) 30(5.1) 

Female - 2(4.76) - 5(11.9) 3(7.14) 2(4.76) - 12(2.03) 

n = 592 [Male 419 (70.8%) and Female 173 (29.22%)]. 

(40%) was found in the age group of 16-30 years. 

However, in individuals aged more than 60 years, 

genotype A 10 (4.17%) and D 15 (7.14%) was 

found and no other genotype, mixed genotype or 

untypable was found in this age group. Genotype 

C 15 (100%) was found only in the age group of 

46-60 (Table 2). 

DISCUSSION 

HBV infection is a global health problem with its 

continuously increasing burden on the developing 

countries like Pakistan (Khan et al., 2011). Very 

limited data on HBV epidemiology and pattern of 

transmission representing all the geographical 

regions of Khyber Pakhtunkhwa is available. To 

investigate the epidemiological distribution of HBV 

genotypes in the Khyber Pakhtunkhwa, we 

applied nested PCR with type specific primers. 

HBV genotypes have different biologicaland 

epidemiological behavior (Attaullah et al., 2011). 

Since they influence the activity and outcome of 

HBV-associated chronic liver disease, as well as 

the response to antiviral therapies (Zhu and Dong, 

2009; Eftikhari et al., 2010; Khaled et al., 2010), 

their detection and monitoring is more than just 

academic but also medically significant. Therefore 

HBV genotyping become a routineexercise in 

clinical medicine and molecular epidemiology 

(Khaled et al., 2010). Since several genotypes 

HBV are very closely associated with the severity, 

development of severe liver diseases (cirrhosis 

and hepatocellular carcinoma) and antiviral


Figure 1. HBV genotypes distribution in HBsAg positive patients. 

Table 2. Age wise distribution of genotypes in HBV DNA positive patients (n = 592). 

Age 

(in years) 

A 

n(%) 

C 

n(%) 

D 

n(%) 

Genotype 

F 

n(%) 

A+D 

n(%) 

Untypable 

n(%) 

Total 

n(%) 

1-15 25 (10.42) - 35 (16.67) - 10 (13.33) 3 (7.14) 73 (12.33) 

16-30 95 (39.58) - 85 (40.48) 5 (50.00) 30 (40.00) 23 (54.8) 238 (40.20) 

31-45 85 (35.42) - 45 (21.43) 5 (50.00) 10 ((13.33) 12(28.6) 157 (26.52) 

46-60 25 (10.42) 15 (100) 30 (14.29) - 25 (33.33) 4 (9.52) 99 (16.72) 

˃60 10 (4.17) - 15 (7.14) - - - 25 (4.00) 

therapy. Detection of HBV genotypes is also very 

important to clarify the pathogenesis, route of infection 

and virulence of the virus (Dokanehiifard and 

Bidmeshkipour, 2009). 

Initially HBV genotypes were analyzed in Japan and 

China, where genotype B and C were considered as the 

most prevalent genotypes and predominant of genotypes 

D in South Asia and the Middle East including India, 

Afghanistan and Iran (Baig et al., 2009). HBV genotypes 

show a characteristic geographic distribution with a 

proposed association with human migration. It is interested 

to note that Arians firstly colonized to the North of 

the Caspian Sea, then migrated to Iran, India and 

Europe. It might be those people who acquired the virus 

with the genotype D before their migration and then 

transmitted the virus generation by generation after their 

migration. That is why the dominant genotype in India, 

Iran and most part of the Europe is D (Jazayeri and 

Carman, 2009). In countries with high levels of immigration, 

a variety of genotypes are being reported as all 

of the known genotypes can be found in the Europe and 

North America (Kurbanov et al., 2010). The presence of 

genotypes A and D also reflected the immigrant origins of 

the population of Buenos Aires, Argentina which is 

cosmopolitan city and has received immigration from the 

Mediterranean area (Afghanistan, Iran, Pakistan, Egypt 

etc), where genotype D predominates. 

In fact genotyping can help to trace the migration of 

ancestors as well as the routes of transmission in 

accidental exposure to HBV (Poustchi et al., 2007). A 

study of 39 asymptomatic HBV carriers and 103 liver 

diseases patients from southern China showed circulation 

of A, B, C, and D genotypes with 78.9% being 

genotype C (Kaya et al., 2007). However, in Pakistanis

62% were genotype D, A (14%), C (6%), other genotypes 

(4%) and recombination (10%). Interestingly, no genotype 

other than D has been found in Iran. The epidemiological 

data about HBV genotypes in various Asian countries 

demonstrated the presence of all seven genotypes, 

particularly the pre-dominance of genotype D (Jazayeri 

and Carman, 2009). However, genotype A is distributed 

globally and is the main genotype found in Europe, North 

America, Africa and India (Santos et al., 2010). Hepatitis 

B virus genotype A has been increasing in chronic HBV 

patients in Japan (Matsuura et al., 2009); some HBV/A 

isolates have been imported from foreign countries. But 

unlike previous research, our study shows the dominance 

of genotype A which is the second most prevalent 

genotype in Pakistan (Ali et al., 2011). Idrees et al. (2004) 

reported the high prevalence of genotype A in Sindh 

province of Pakistan. This is good news because 

previous studies shows that genotype A is less severe 

disease and highly responsive to interferon therapy as 

compared to genotype D and have lower HBV DNA 

levels (Ali et al., 2011). 

It is of much important finding that we have reported 

such patients infected with multiple (more than one) HBV 

genotypes in the current study. This is in accordance with 

a number of very recent studies from different regions of 

the world. Hannoun found 8% of HBV patients with 

genotype mixture (Alam et al., 2007b). Leblebcioglu and 

Erglu (2004) reported that chronic patients are more 

prone to be infected with more than one HBV genotype 

than acutely infected patients. Genotypes mixture in HBV 

patients is also common in Thailand (Jutavijittum et al., 

2006). 16% HBV cases were positive for HBV genotype 

mixture in France (Halfon et al., 2006). 

In our study, 42 HBV DNA positive samples remained 

untypable for HBV genotypes. It may be assumed that 

such samples represent recombinant or new genotypic 

variants present in our population that can be resolved 

after sequencing and further analysis. Because, some 

minor HBV genotypes as well as novel or distinct 

genotypic groups may be present in any population 

besides major genotypes (Bowyer and Sim, 2000). 

Regarding the sex distribution of HBV infection there 

were more male (68.6%) patients than female (31.42%). 

This was compatible with work of Naz et al. (2002), who 

reported a high prevalence in males 68.3% than females 

31.7%, which is quite comparable with our results. 

Nwokediuko (2010), Zubair et al. (2010), Moosa et al. 

(2009) and Awan et al. (2010) also reported a significantly 

higher infection rate in male as compared to the 

female. The higher HBV infection in males as compared 

to female may be due to their being employed outsides 

their homes, visiting barber shops and also their 

involvement in blood transfusion practices. While women 

are mostly involved in house hold activates based on the 

social, cultural and religious preferences and influence. 

Prevalence data from individual studies were further 

segregated into age groups. There was an age effect on 

Awan et al. 5241 

the prevalence of hepatitis B infection. Prevalence rose 

from 18.33% in children’s 1-15 to a peak of 46.67 and 

25% in people aged 61-30 and 31-45 years respectively. 

After this it declined to 6.67 and 3.33% in people aged 

46- 60 and >60 years. Alam et al. (2007b) also reported a 

significantly higher infection in persons with age between 

21-40 years followed by 41-60 years age. Very young 

and old individuals were very less frequently infected by 

HBV. Castolo et al. (2001) report also supported our 

finding that prevalence of HBV infection is higher in 

patients up to the age of 40 years. HBV infection being 

higher in young’s respondents may be due to their 

greater exposures and interaction in society as compared 

to children and aged persons. 

REFERENCES 

Alam MM, Zaidi SZ, Shaukat S, Sharif S, Angez M, Naeem A, Salha S, 

Butt JA , Malik SA (2007a). Common genotypes of hepatitis B virus 

prevalent in injecting drug abusers (addicts) of North West Frontier 

Province of Pakistan. Virol. J., 4: 63. 

Alam MM, Zaidi SZ, Malik SA, Shaukat S, Naeem A, Sharif S, Angez M, 

Butt JA (2007b). Molecular epidemiology of Hepatitis B virus 

genotypes in Pakistan. BMC Infect. Dis., 7: 115. 

Ali M, Idrees M, Ali L, Hussain A, Rehman A, Saleem S, Afzal S, Butt S 

(2011). Hepatitis prevalence in Pakistan: A systematic review of 

prevalence, risk factors, Awareness status and genotypes. Virol. J., 

8: 102. 

Attaullah S, Khan S, Naseemullah, Ayaz S, Khan SN, Ali I, Hoti N, Siraj 

S (2011). Prevalence of HBV and HBV vaccination coverage in 

health care workers of tertiary hospitals of Peshawar, Pakistan. Virol. 

J., 8: 275. 

Awan Z, Idrees M, Amin I, Butt S, Afzal S, Akbar H, Rehman I, Younas 

S, Shahid M, Lal A, Saleem S, Rauff B (2010). Pattern and 

molecular epidemiology of Hepatitis B virus genotypes circulating in 

Pakistan. Infect. Gen. Evol., 10: 1242-1246. 

Baig S, Siddique AA, Ahmed W, Qureshi H, Arif A (2007). The 

association of complex liver disorders with HBV genotypes prevalent 

in Pakistan. Virol. J., 4: 128. 

Baig S, Siddiqui A, Chakravarty R, Moatter T (2009). Hepatitis B virus 

sub genotypes D1 and D3 are prevalent in Pakistan. BMC Res. Not., 

2: 1. 

Bowyer SM, Sim GM (2000). Relationship within and between the 

genotypes of Hepatitis B virus at point across the genome: footprints 

of recombination in certain isolates. J. Gen. Virol., 81: 379-392. 

Castolo MC, ndez-ruiz LH, Ibarra-robles IE, Rate IHFN, Pena JEL 

(2001). Prevalence of Hepatitis B Virus Infection and Related Risk 

Factors in a rural community of Mexico. Am. J. Trop. Med. Hyg., 65: 

759-763. 

Dokanehiifard S, Bidmeshkipour A (2009). Study of Hepatitis B Virus 

(HBV) Genotypes in Kermanshah Province, West of Iran. J. Biol. Sci., 

1: 113-120. 

Eftikhari Y, Arababadi MK, Hakimi H, Zarandi ER (2010). Common HBV 

Genotype in Southeastern Iranian Patients. Arch. Iran. Med., 13: 147- 

149. 

Halfon P, Bourliere M, Pol S, Benhamou Y, Ouzan D (2006). Multicenter 

study of Hepatitis B virus genotypes in France: Correlation with liver 

fibrosis and hepatitis B e antigen status. J. Viral Hepatol., 13: 329- 

325. 

Idrees M, Khan S, Riazuddin S (2004). Common genotypes of hepatitis 

B virus. J. Coll. Physicians Surg. Pak., 14: 344-347. 

Jazayeri SM, Carman WF (2009). Evolution of HBV Genotype D in the 

Middle East and South Asia. Hepatit. Mon., 9: 9-11. 

Jose AMM, Carla LAA, Gloria MC, Sergio CR, Jose LFA, Rafael AF, 

Jesus GM (2012). Prevalence and resistance pattern of genotype G 

and H in chronic hepatitis B and HIV co-infected patients in Mexico. 

Ann. Hepatol., 11: 47-51.


Jutavijittum P, Jiviriyawat Y, Yousukh A, Kunachiwa W, ToriYama K 

(2006) Genotypes of Hepatitis B virus among voluntary blood donors 

in northern Thailand. Hepatol. Res. 26. 

Kao JH (2011). Molecular epidemiology of hepatitis B virus. Korean J. 

Int. Med. 26: 255-261. 

Kao JH (2002). Hepatitis B viral genotypes: clinical relevance and 

molecular characteristics. J Gastroenterol. Hepatol., 17: 643-650. 

Kaya S, Cetin ES, Aridogan BC, Onal SN, Demirci M (2007). 

Distribution of Hepatitis B Virus (HBV) Genotypes among HBV 

Carriers in Isparta. Iranian Biomed. J., 1: 59-63. 

Kevin LW, Leonard HC (2011). Let the fog be lifted: Screening for 

hepatitis B virus before biological therapy. Ann. Rheum. Dis. 70: 

1701-1703. 

Khaled IAA, Mahmoud OM, Saleh AF, Baioumi EA (2010). Prevalence 

of HBV Genotypes in Egypt among Hepatitis Patients. J. Am. Sci., 6: 

185-190. 

Khan F, Akbar H, Idrees M, Khan H, Shahzad K, Kayani MA (2011). 

The prevalence of HBV infection in the cohort of IDPs of war against 

terrorism in Malakand Division of Northern Pakistan. BMC Infect. 

Dis., 11: 176. 

Kurbanov F, Tanaka Y, Mizokami M (2010). Geographical and genetic 

diversity of the human hepatitis B virus. Hepatol. Res., 40: 14-30. 

Matsuura K, Tanaka Y, Hige S, Yamada G, Murawaki Y, Komatsu M, 

Kuramitsu T, Kawata S, Tanaka E, Izumi N, Okuse C, Kakumu S, 

Okanoue T, Hino K, Hiasa Y, Sata M, Maeshiro T, Sugauchi F, Nojiri 

S, Joh T, Miyakawa Y, Mizokami M (2009). Distribution of Hepatitis B 

Virus Genotypes among Patients with Chronic Infection in Japan 

Shifting toward an Increase of Genotype A. J. Clin. Microbiol. 

doi:10.1128/JCM.02081-08. 

Moosa FA, Sheikh BA, Choudhry MS, Khan FW, Sultan N (2009). 

Frequency of Hepatitis B and C in Pre-operative Elective Surgery. 

JLUMHS, 8(02). 

Naito H, Hayashi S, Abe K (2001). Rapid and specific genotyping 

system for hepatitis B virus corresponding to six major genotypes by 

PCR using type specific primers. J. Clin. Microbiol., 39: 362-364. 

Naz S, Ahmad M, Asghar H (2002. Prevalence of Hepatitis ‘B’ Among 

Combined Military Hospital (CMH) Muzaffarabad. Int. J. Agric. Biol., 

4: 227-230. 

Nwokediuko CS (2010). Risk Factors for Hepatitis B Virus Transmission 

in Nigerians. Int. J. Gastroenterol., 10(1). 

Poustchi H, Mohamadnejad M, Malekzadeh R (2007). Hepatitis B virus 

infection in Iran. Iran. J. Clin. Infect. Dis., 2: 37-51. 

Rauf A, Nadeem MS, Ali A, Iqbal M, Mustafa M, Latif MM, Latif MZ, 

Ahmed A, Shakoori AR (2010). Prevalence of hepatitis B and C in 

internally disposed persons of war against terrorism in Swat, 

Pakistan. Eur. J. Pub. Health, pp. 1-5. 

Santos AO, Mora MVA, Botelho L, Vieira DS, Pinho JRR, Carrilho FJ, 

Honda ER, Salcedo JM (2010). Characterization of Hepatitis B virus 

(HBV) genotypes in patients from Rondonia, Brazil. Virol. J., 7: 315. 

Yu H, Yuan Q, Ge SX, Wang HY, Zhang YL, Chen QR, Zhang J, Chen 

PJ, Xia NS (2010). Molecular and phylogenetic analyses suggest an 

additional hepatitis B virus genotype “I”. PLoS One, 5: e9297. 

Zhu CT, Dong CL (2009). Characteristics of general distribution of 

hepatitis B virus genotypes in China. Hepatobiliary Pancreat. Dis. 

Infect., 8: 397-401. 

Zubair M, Anjum ZM, Zafar S, Shamaoon M, Balouch GR (2010). 

Frequency of Hepatitis B virus infection among children with chronic 

liver disease. APMC, 4(1).



DOI: 10.5897/AJMR12.655 



Fatigue-alleviating effect of polysaccharides from 

Cyclocarya paliurus (Batal) Iljinskaja in mice 

Wang Jinchao* and Wang Kangkang 

Physical Education School, Zhengzhou University, Zhengzhou, China. 


In this study, the fatigue-alleviating effect of polysaccharides from Cyclocarya paliurus (Batal) Iljinskaja 

(PCP) in mice were evaluated using a weight-loaded swimming test and some biochemical parameters 

related to fatigue, including serum urea nitrogen (SUN), blood lactic acid (BLA), hemoglobin (Hb) and 

hepatic glycogen were measured. Male Kunming mice were administered PCP at doses of 0, 25, 50 and 

100 mg/kg for 4 weeks. The results showed that PCP can increase swimming time to exhaustion, Hb 

and hepatic glycogen contents whilst reducing SUN and BLA contents, indicating an alleviating effect 

on exercise-induced fatigue in mice. 

Key words: Polysaccharides, Cyclocarya paliurus (Batal) Iljinskaja, fatigue, swimming test, mice. 

INTRODUCTION 

Cyclocarya paliurus (Batal.) Iljinskaja, a Chinese native 

plant, belongs to the genus Cyclocarya Iljinskaja 

(Juglangdaceae) (Yi et al., 2002; Xie et al., 2010a). This 

plant is grown on cloudy and foggy highlands in southern 

China including Anhui, Fujian, Hubei, Hunan, Jiangsu, 

Jiangxi, Sichuan, Guizhou, and Zhejiang Provinces. And 

it is commonly called the ‘sweet tea tree’ because of the 

flavour of its leaves (Xie et al., 2010b). The leaves of C. 

paliurus have been a food resource for maritime people 

for a long time, and have also been used for drug 

formulations in traditional Chinese medicine (TCM), as 

well as for an ingredient in functional foods in China (Li et 

al., 2002; Birari and Bhutani, 2007; Fang et al., 2011). 

Significant attention has recently been drawn to the use 

of C. paliurus for developing functional food, as C. 

paliurus produces a great variety of nutrients that are 

essential for human health. C. paliurus health tea, the 

aqueous extract of C. paliurus leaves, is already known 

as a functional health food for ailments, the enhancement 

of mental efficiency, and recovery from mental fatigue, 

has been become the first Food and Drug Administration 

(FDA)-approved health tea of China in 1999 (Xu and 

Song, 2004; Xie et al., 2010a). Recently, the wide array 

*Corresponding author. E-mail: wangjinchaozz@sina.com. Tel: 

+86 371 63632763. Fax: +86 371 63632763. 

of therapeutic effects of C. paliurus have been reported, 

such as enhancement of mental efficiency and 

hypolipidaemic, antihypertensive and immunomodulatory 

effects (Kurihara et al., 2003; Li et al., 2008, 2011). 

Recently, the bio-activities of polysaccharides from 

plants and fungi have attracted more and more attention 

in biochemistry and medicine. In the last few decades, 

polysaccharides from plants and fungi exhibit varied bioactivities 

such as antioxidant, antidiabetic, antitumor, 

anticancer, antifatigue, antiviral, antibacterial, antifungal, 

anticoagulant and immunological activities (Hwang et al., 

2005; Yu et al., 2006; Kardosová and Machová, 2006; 

Lee et al., 2007; Thierbach and Steinberg, 2009). To 

date, most studies on C. paliurus were concerned about 

the extract bio-activities, and low molecular weight 

substances, such as triterpenoids, flavonoids, steroids, 

saponins and other compounds present in this plant (Shu 

et al., 1995; Jiang et al., 2006; Wang and Cao, 2007; 

Fang et al., 2011). Whereas, there have been only a few 

reports on polysaccharides from C. paliurus (PCP) and 

few on its bio-activities. For example, Liu et al. (2007) 

found that PCP has anti-tumor activity and can 

significantly inhibit the proliferation of cervical cancer 

HeLa cells. Xie et al. (2010) reported that PCP exerted 

significant scavenging effects on 2,2-diphenyl-1- 

picrylhydrazyl (DPPH) radicals. Shangguan et al. (2010) 

found that PCP possesses a hypoglycemic effect in 

alloxan-induced hyperglycemic mice. To the best of our


knowledge, there are no previous reports on the effect of 

the anti-fatigue. In this study, we investigated whether 

PCP can improve exercise-induced fatigue. In order to 

assess potential mechanisms of PCP bio-activities, we 

measured some biochemical parameters related to 

fatigue, including serum urea nitrogen (SUN), blood lactic 

acid (BLA), hemoglobin (Hb) and hepatic glycogen. 


Plant material 

The dried leaves of C. paliurus were provided by Zhangjiajie 

Hongmao ecological Co. (Hunan, China). A voucher specimen 

(registration number: 2010069) has been deposited in the Natural 

Products Laboratory, Zhengzhou University. All samples were 

sliced and ground into fine powder in a mill before extraction. 

Extraction of PCP 

The method of Xie et al. (2007) was used in the extraction of PCP. 

The procedures are described as follows: the dried leaves of C. 

paliurus powder (100 g) were first weighed and extracted with 1000 

ml of 80% ethanol for 24 h to remove the interfering components in 

the samples at 80°C. The extraction procedure was carried out in 

the water bath. After filtration, the residue were dried at room 

temperature and placed in an extraction tube, then extracted twice 

with ultra-pure water (20:1 weight/volume ratio) at 80°C for 2 h. The 

extracts were filtered, while warm, through glass wool and 

centrifuged for 15 min to separate the supernatant and the residue. 

The Sevag method was used to remove protein components 

(Staub, 1965). After removing the Sevag reagent, the water phase 

were concentrated under reduced pressure at 55°C and 

precipitated with four volumes of ethanol, then kept at 4°C overnight 

in refrigerator to precipitate polysaccharides. The precipitates 

formed in the solution were collected and then redissolved in ultrapure 

water, centrifuged for 15 min. The supernatant was further 

dialysed for 36 h in natural water and 12 h in ultra-pure water 

before concentration under vacuum evaporator at 55°C. Lastly, the 

precipitate was frozen at -40°C overnight and lyophilized in vacuum 

freeze dryer. The crude PCP was obtained. The polysaccharide 

content was measured by the sulfuric acid/phenol method. Briefly, 

polysaccharides were hydrolyzed to sugar aldehyde in the 

presence of sulfuric acid and condensed with phenol to give a 

colored complex, which can be quantified by spectrometry at 480 

nm. Then the extraction yield of PCP was 6.27 wt % (dry basis) 

Animals 

The study protocol was approved by the Institutional Animal Care 

and Use Committee of Zhengzhou University (Zhengzhou, China.). 

Healthy male Kunming mice were obtained from Laboratory Animal 

Center, Medical College of Zhengzhou University. Mice were 

housed in environmentally controlled conditions (temperature 

20±2°C; relative humidity 50 to 60%) with a 12 h light/dark cycle. All 

animals had free access to standard rodent pellet food and water 

ad-libitum. Animals weighing 18 to 22 g were used in the study. 

Experimental design 

After an adaptation period for a week, the 64 mice were randomly 

divided into four groups, with 16 mice in each group. PCP was 

given to the mice at doses of 0, 25, 50 and 100 mg/kg and the four 

groups were accordingly named as the control (C) group, PCP lowdose 

treatment (PL) group, PCP middle-dose treatment (PM) group 

and PCP high-dose treatment (PH) group. PCP was dissolved in 1 

ml of distilled water and the same volume of distilled water was 

given to mice in C group. Samples were orally administered (8: 00 

am) into mice using a feeding atraumatic needle once per day for 4 

weeks. The doses of PCP used in this study were confirmed to be 

suitable and effective in tested rabbits according to our preliminary 

experiment. The mice were made to swim for 15 min three times a 

week to accustom them to swimming. After 4 weeks, 8 mice were 

taken out from each group for weight-loaded swimming test. The 

other 8 mice were taken out from each group for analyses of some 

biochemical parameters related to fatigue. 

Weight-loaded swimming test 

The weight-loaded swimming test was employed in this study to 

evaluate the effects of PCP on exercise-induced fatigue. The test 

was induced by forcing animals to swim until exhaustion as 

described in the literature (Tang et al., 2008). Briefly, 30 min after 

the last administration, the mice were dropped individually into an 

acrylic plastic pool (90�45�45 cm) filled with fresh water maintained 

at 30±1°C, approximately 35 cm deep so that mice could not 

support themselves by touching the bottom with their tails. A lead 

block (5% of body weight) was loaded on the tail root of the mice. 

Mice were regarded as exhaustion when they were underwater for 

8 s (Chi et al., 2008), and their swimming time was immediately 

recorded. 


In order to explore the mechanism, some biochemical parameters 

related to fatigue, including SUN, BLA, Hb and hepatic glycogen 

were measured. Briefly, 30 min after the last administration, the 

mice were forced to swim for 90 min without a load. Rested for 60 

min, the mice were anesthetized with ether and blood samples 

were collected in tubes by heart puncture to determine the contents 

of SUN, BLA and Hb. In addition, immediately after the blood had 

been collected, the liver was dissected out quickly from the mice, 

washed with physiological saline and dried with absorbent paper. 

Then the contents of hepatic glycogen were determined. 

Data analysis 

Data were expressed as the mean ± SD and analyzed by one-way 

analysis of variance (ANOVA), followed by Post hoc test (SPSS 

15.0). The difference was considered significant when P

Swimming time (s) 

1000 

800 

600 

400 

200 

0 

* 

C PL PM PH 

Group 

Figure 1. Effects of PCP on weight-loaded swimming test of mice. C group, control 

group (the mice were administered distilled water); PL group, PCP low-dose treatment 

group (the mice were administered 25 mg/kg of PCP); PM group, PCP middle-dose 

treatment group (the mice were administered 50 mg/kg of PCP); PH group, PCP highdose 

treatment group (the mice were administered 100 mg/kg of PCP). Values are the 

means ± S.D.*, P < 0.05, compared with control group. 

safely (Wang et al., 2008). In the present study, the mice 

had a weight attached 5% body weigh in the duration of 

the swim-to-exhaustion. As shown in Figure 1, the 

swimming time to exhaustion of the PL, PM and PH 

groups were significantly prolonged compared with that in 

the C group (P


Blood lactic acid (mmol/L) 

Serum urea nitrogen (mmol/L) 

12 

10 

8 

6 

4 

2 

0 

* 

C PL PM PH 

Group 

Figure 2. Effects of PCP on serum urea nitrogen of mice. C group, control group (the mice were 

administered distilled water); PL group, PCP low-dose treatment group (the mice were 

administered 25 mg/kg of PCP); PM group, PCP middle-dose treatment group (the mice were 

administered 50 mg/kg of PCP). PH group, PCP high-dose treatment group (the mice were 

administered 100 mg/kg of PCP). Values are the means ± S.D. *, P < 0.05, compared with control 

group. 

14 

12 

10 

8 

6 

4 

2 

0 

* 

C PL PM PH 

Group 

Figure 3. Effects of PCP on BLA of mice. C group, Control group (the mice were administered 

distilled water); PL group, PCP low-dose treatment group (the mice were administered 25 mg/kg 

of PCP); PM group, PCP middle-dose treatment group (the mice were administered 50 mg/kg of 

PCP); PH group, PCP high-dose treatment group (the mice were administered 100 mg/kg of 

PCP). Values are the means ± S.D. *P < 0.05, compared with control group. 

in the present study. As shown in Figure 4, the Hb 

contents of the PM and PH groups were much higher 

than that in C group (P0.05). These results 

indicated that increase in the contents of Hb may be 

another pathway of PCP alleviating exercise-induced 

fatigue. 

* 

* 

Effects of PCP on hepatic glycogen of mice 

* 

* 

It is generally accepted that endurance capacity 

decreases if the available energy is exhausted. Glycogen 

is the major energy source during exercise; the increase 

in glycogen stored in liver is an advantage to enhance the 

physical endurance (Wagenmakers et al., 1991). 

Depletion of hepatic glycogen is an important factor in the

Hepatic glycogen (mg/g) 

Hemoglobin (g/L) 

200 

150 

100 

50 

0 

C PL PM PH 

Group 

Figure 4. Effects of PCP on Hb of mice. C group, Control group (the mice were 

administered distilled water); PL group, PCP low-dose treatment group (the mice were 

administered 25 mg/kg of PCP); PM group, PCP middle-dose treatment group (the mice 

were administered 50 mg/kg of PCP); PH group, PCP high-dose treatment group (the 

mice were administered 100 mg/kg of PCP). Values are the means ± S.D. *P < 0.05, 

compared with control group. 

25 

20 

15 

10 

5 

0 

* 

C PL PM PH 

Group 

Figure 5. Effects of PCP on hepatic glycogen of mice. C group, Control group (the mice 

were administered distilled water); PL group, PCP low-dose treatment group (the mice 

were administered 25 mg/kg of PCP); PM group, PCP middle-dose treatment group (the 

mice were administered 50 mg/kg of PCP); PH group, PCP high-dose treatment group 

(the mice were administered 100 mg/kg of PCP). Values are the means ± S.D. *P < 

0.05, compared with control group. 

exercised fatigue, which may lead to hypoglycemia 

impairing nervous function (Dohm et al., 1983). The 

previous studies have indicated that glycogen 

accumulates in the body and delays fatigue after 

exercise. As shown in Figure 5, the hepatic glycogen 

contents of the PL, PM and PH groups were significantly 

increased compared with that in the C group (P


evaluate its anti-fatigue effect at cellular and molecular 

levels. 


The authors are thankful to Dr. J. Zhang for typing this 

manuscript. 

REFERENCES 

Birari RB, Bhutani KK (2007). Pancreatic lipase inhibitors from natural 

sources: Unexplored potential. Drug Discov. Today, 12: 879-889. 

Chi AP, Chen JP, Wang ZZ, Xiong ZY, Li QX (2008). Morphological and 

structural characterization of a polysaccharide from Gynostemma 

pentaphyllum Makino and its anti-exercise fatigue activity. Carbohydr. 

Polym., 74: 868-874. 

Ding JF, Li YY, Xu JJ, Su XR, Gao X, Yue FP (2011). Study on effect of 

jellyfish collagen hydrolysate on anti-fatigue and anti-oxidation. Food 

Hydrocoll., 25: 1350-1353. 

Dohm GL, Tapscott EB, Barakat HA, Kasperek GJ (1983). Influence of 

fasting on glycogen depletion in rats during exercise. J. Appl. Physiol., 

55(3): 830-833. 

Fang SZ, Yang WX, Chu XL, Shang XL, She CQ, Fu XX (2011). 

Provenance and temporal variations in selected flavonoids in leaves 

of Cyclocarya paliurus. Food Chem., 124: 1382-1386. 

Gao SJ, Wu D (2008). Research of various dosage carnosine affecting 

on anti-fatigue of motility for rats. J. Guangzhou Sport Univ., 28: 90- 

92. 

Hwang HJ, Kim SW, Lim JM, Joo JH, Kim HO, Kim HM, Yun JW (2005). 

Hypoglycemic effect of crude exopolysaccharides produced by a 

medicinal mushroom Phellinus baumii in streptozotocin-induced 

diabetic rats. Life Sci., 76(26): 3069-3080. 

Jiang ZY, Zhang XM, Zhou J, Qiu SX, Chen JJ (2006). Two new 

triterpenoid glycosides from Cyclocarya paliurus. J. Asian. Nat. Prod. 

Res., 8(1-2): 93-98. 

Kardosová A, Machová E (2006). Antioxidant activity of medicinal plant 

polysaccharides. Fitoterapia, 77(5): 367-373. 

Khanna GL, Manna I (2005). Supplementary effect of carbohydrateelectrolyte 

drink on sports performance, lactate removal & 

cardiovascular response of athletes. Indian J. Med. Res., 121(5): 

665-669. 

Kurihara H, Fukami H, Kusumoto A, Toyoda Y, Shibata H, Matsui Y, 

Asami S, Tanaka T (2003). Hypoglycemic action of Cyclocarya 

paliurus (Batal.) Iljinskaja in normal and diabetic mice. Biosci. 

Biotechnol. Biochem., 67(4): 877-880. 

Lambert CP, Flynn MG (2002). Fatigue during high-intensity intermittent 

exercise: application to bodybuilding. Sports Med., 32(8): 511-522. 

Lee HH, Lee JS, Cho JY, Kim YE, Hong EK (2007). Study on 

immunostimulating activity of macrophage treated with purified 

polysaccharides from liquid culture and fruiting body of Lentinus 

edodes. J. Microbiol. Biotechnol., 19(6): 566-572. 

Lee S, You Y, Yoon HG, Kim K, Park J, Kim S, Ho JN, Lee J, Shim S, 

Jun W (2011). Fatigue-alleviating effect on mice of an ethanolic 

extract from Rubus coreanus. Biosci. Biotechnol. Biochem., 

75(2):349-351. 

Li J, Lu Y, Su X, Li F, She Z, He X, Lin Y (2008). A norsesquiterpene 

lactone and a benzoic acid derivative from the leaves of Cyclocarya 

paliurus and their glucosidase and glycogen phosphorylase inhibiting 

activities. Planta Med., 74(3): 287-289. 

Li L, Xie M, Yi X (2002). Study on reducing blood sugar of 

polysaccharide from Cyclocarya paliurus (Batal.) Iljinsk. Zhong Yao 

Cai. 25(1): 39-41. 

Li S, Li J, Guan XL, Li J, Deng SP, Li LQ, Tang MT, Huang JG, Chen 

ZZ, Yang RY (2011). Hypoglycemic effects and constituents of the 

barks of Cyclocarya paliurus and their inhibiting activities to 

glucosidase and glycogen phosphorylase. Fitoterapia, 82(7): 1081- 

1085. 

Liu X, Wang SQ, Xie MY, Xie JH, Huang DF, Tang YF (2007). Effects of 

Polysaccharide from Cyclocarya paliurus (Batal.) Iljinskjk on Growth 

of HeLa Cells and Human Umbilical Vein Endothelial Cells. Food Sci., 

28(10): 520-522. 

Nikinmaa M (1997). Oxygen and carbon dioxide transport in vertebrate 

erythrocytes: An evolutionary change in the role of membrane 

transpor. J. Exp. Biol., 200: 369-380. 

Shangguan XC, Chen MS, Jiang Y, Wu SF (2010). Hypoglycemic effect 

of Cyclocarya paliurus(batal) ijinskaja polysaccharide on diabetic and 

normal mice. Food Sci. Tech., (3): 142-146. 

Shu RG, Xu CR, Li LN, Yu ZL (1995). Cyclocariosides II and III: two 

secodammarane triterpenoid saponins from Cyclocarya paliurus. 

Planta. Med., 61(6): 551-553. 

Staub AM (1965). Removal of proteins: Sevag method. Methods 

Carbohydr. Chem., 5: 5-6. 

Tang W, Zhang Y, Gao J, Ding X, Gao S (2008). The anti-fatigue effect 

of 20(R)-ginsenoside Rg3 in mice by intranasally administration. Biol. 

Pharm. Bull., 31(11): 2024-2027. 

Thierbach R, Steinberg P (2009). Automated soft agar assay for the 

high-throughput screening of anticancer compounds. Anal. Biochem., 

387(2): 318-320. 

Wagenmakers AJ, Beckers EJ, Brouns F, Kuipers H, Soeters PB, van 

der Vusse GJ, Saris WH (1991). Carbohydrate supplementation, 

glycogen depletion, and amino acid metabolism during exercise. Am. 

J. Physiol., 260(6 Pt 1): E883-890. 

Wang JJ, Shieh MJ, Kuo SL, Lee CL, Pan TM (2006). Effect of red mold 

rice on antifatigue and exercise-related changes in lipid peroxidation 

in endurance exercise. Appl. Microbiol. Biotechnol., 70(2): 247-253. 

Wang KQ, Cao Y (2007). Research Progress in the Chemical 

Constituents and Pharmacologic Activities of Cyclocarya 

Paliurus(Batal.) Iljinshaj. Heilongjiang Med. J., (8): 89-92. 

Wang L, Zhang HL, Lu R, Zhou YJ, Ma R, Lv JQ, Li XL, Chen LJ, Yao Z 

(2008). The decapeptide CMS001 enhances swimming endurance in 

mice. Peptides, 29(7): 1176-1182. 

Watts P, Newbury V, Sulentic J (1996). Acute changes in handgrip 

strength, endurance, and blood lactate with sustained sport rock 

climbing. J. Sports Med. Phys. Fitness., 36(4): 255-260. 

Xie JH, Xie MY, Nie SP, Dong CJ, Huang P, Liu X (2007). Study on 

Extraction Technology of Polysaccharides from Cyclocarya paliurus 

(Batal.) Iljinskaja. Food Sci., 28(10): 188-189. 

Xie JH, Xie MY, Nie SP, Shen MY, Wang YX, Li C (2010a). Isolation, 

chemical composition and antioxidant activities of a water-soluble 

polysaccharide from Cyclocarya paliurus (Batal.) Iljinskaja. Food 

Chem., 119: 1626-1632. 

Xie JH, Xie MY, Shen MY, Nie SP, Li C, Wang YX (2010b). 

Optimisation of microwave-assisted extraction of polysaccharides 

from Cyclocarya paliurus (Batal.) Iljinskaja using response surface 

methodology. J. Sci. Food Agric., 90(8): 1353-1360. 

Xu Q, Song YJ (2004). Research status on Cyclocarya paliurus. Acta. 

Med. Sinica., 17(3): 451-453. 

Yi X, Shi JG, Zhou GX, Xie MY (2002). Studies on the chemical 

constituents in the leaves of Cyclocarya paliurus. Zhongguo Zhong 

Yao Za Zhi. 27(1): 43-45. 

Yu F, Lu S, Yu F, Feng S, McGuire PM, Li R, Wang R (2006). 

Protective effects of polysaccharide from Euphorbia kansui 

(Euphorbiaceae) on the swimming exercise-induced oxidative stress 

in mice. Can. J. Physiol. Pharmacol., 84(10): 1071-1079. 

Zheng SQ, Jiang F, Gao HY, Zheng JG (2010). Preliminary 

observations on the antifatigue effects of longan (Dimocarpus longan 

Lour.) seed polysaccharides. Phytother. Res., 24(4): 622-624.



DOI: 10.5897/AJMR12.705 



Aggressiveness, diversity and distribution of Alternaria 

brassicae isolates infecting oilseed Brassica in India 

P. D. Meena 1 , A. Rani 1 , R. Meena 1 , Pankaj Sharma 1 *, R. Gupta 1 and P. Chowdappa 2 

1 Directorate of Rapeseed-Mustard Research, Sewar, Bharatpur 321 303 (Raj), India. 

2 Indian Institute of Horticultural Research, Bangalore (Karnataka) 560 089, India. 


Alternaria brassicae (Berk.) Sacc., a necrotrophic fungus devastating oilseed Brassica crops in India, 

causes up to 47% reduction in seed yield. Morphological characteristics of different isolates revealed 

variation in growth, shape and pigmentation of colony, conidial measurements and number of septa. 

Conidial length varied from 106.7 to 285.9 µm, width 33.5 to 57.0 µm and beak length 41.4 to 180.0 µm. 

Number of horizontal septa varied from 3.2 to 8.0 and vertical 0.3 to 1.4. Different synthetic media 

showed profound variation in mycelial growth of A. brassicae isolates and the poor sporulation 

indicated that the fungus requires some organic sources of nutrition for better growth and sporulation. 

The degree of sporulation of A. brassicae isolates is a function of nutrition proved for the first time. Per 

cent inhibition of mycelial growth showed diverge among A. brassicae isolates, which may be due to 

the variation towards fungicidal sensitivity among isolates. Pathogen aggressiveness study 

demonstrated the existence of considerable variation in tolerance of Brassica species to A. brassicae, 

which is proved with the location specific disease severity. 

Key words: Variability, Alternaria brassicae, fungicides sensitivity, aggressiveness, Brassica. 

INTRODUCTION 

Indian mustard [Brassica juncea (L.) Czern and Coss.] 

alone contributes about 80% of the total rapeseedmustard 

which is one of the major oilseed crops 

cultivated in India (AICRP-RM, 2011). Alternaria blight 

disease caused by Alternaria brassicae (Berk.) Sacc. has 

been reported from all the continents of the world and is 

one among the important diseases of Indian mustard 

causing up to 47% yield losses (Meena et al., 2010a) with 

no proven source of resistance against the disease 

reported till date in any of the hosts (Meena et al., 

2010b). Little work on variability has been reported on 

genetic structure of A. brassicicola population suggests 

the occurrence of sexual recombination (Bock et al., 

2005). Information on trends in variability of A. brassicae 

population in India is lacking. In view of the economic 

importance of rapeseed-mustard crops to India, it 

seemed desirable to learn more of the biology of the A. 

*Corresponding author. E-mail: pksvirus@gmail.com. Tel: +91 

5644 260379/260575 or +91 9414239831. Tel/Fax: +91 5644 

260565. 

brassicae that attack these crops. 

A comparative knowledge of the nutritional patterns 

and factors influencing its growth are prerequisite to any 

study leading to the understanding of host-pathogen 

relationship and specificity. Alternaria blight severity on 

rapeseed-mustard differs among seasons and regions as 

also between individual crops within a region. This may 

be due to existence of variability among isolates of 

Alternaria species. Some reports on the existence of 

morphological variability within the isolates of other 

Alternaria species have been reported by earlier workers 

(Meena et al., 2005; Varma et al., 2006). Special 

attention was focused on variability in pathogen diversity 

and aggressiveness of 30 A. brassicae isolates collected 

from different geographical locations from different 

Brassica hosts. 


Pathosystem 

The current study is part of a project on the population of the 

Brassica–Alternaria system. The study area includes three


Table 1. Alternaria brassicae isolates infecting Brassica species at different geographical locations. 

A. brassicae isolate Host Date of collection Location Latitude and longitude Plant part 

BAB-02 B. napus 15-Feb-05 Jammu, J & K 32° 44' N, 74° 54'E leaf 

BAB-19 B. juncea 22-Jun-09 Bharatpur, Raj 27° 15' N, 77° 30'E seed 

BAB-20 B. juncea 28-Feb-05 Alwar, Raj 27° 34' N, 76° 36'E pod 

BAB-23 B. carinata 23-Feb-05 Behrampore, WB 24° 6' N, 88° 15'E leaf 

BAB-30 B. rapa spp ys 24-Jan-06 Berhampore, WB 24 o 6' N, 88 o 19' E leaf 

BAB-08 B. juncea 8-Mar-06 Dhamsya, Jaipur, Raj 26°88' N,76°15'E leaf 

BAB-39 B. carinata 1-Feb-10 Kangra, HP 32° 05' N, 76° 18'E leaf 

BAB-40 B. juncea 1-Feb-10 Kangra, HP 32° 05' N, 76° 18' leaf 

BAB-41 B. napus 3-Mar-10 Kangra, HP 32° 05' N, 76° 18'E leaf 

BAB-42 B. juncea 10-Feb-10 Parwai, Jhansi, UP 25° 27' N, 78° 37'E leaf 

BAB-43 B. juncea 21-Jan-10 Hazaribag, Jharkhand 23º 59' N, 85º 25'E leaf 

BAB-44 B. juncea 30-Jan-10 Nagina, Bijnor, UP 29° 27´N, 78° 29´E leaf 

BAB-45 B. juncea 26-Jan-10 Mandore, Jodhpur, Raj 26° 18' N, 73° 04'E leaf 

BAB-47 B. juncea Feb-10 Tonk, Raj 26° 11' N, 75° 50'E leaf 

BAB-48 B. juncea 4-Feb-10 Shivrajpur, Kanpur, UP 26° 28'N 80° 21'E leaf 

BAB-49 B. juncea 25-Jan-10 Jobner, Jaipur, Raj 26° 95' N,75° 34'E leaf 

BAB-50 B. juncea 10-Feb-10 Jhansi, UP 25° 27' N, 78° 37'E leaf 

BAB-04 B. rapa spp toria 2-Mar-05 Kamrup, Assam 25°74‟ N,93° 85‟E pod 

BAB-06 B. juncea 3-Mar-05 Golaghat, Assam 22° 7' N, 92° 6'E leaf 

BAB-18 B. juncea 18-Jun-08 Pantnagar, Uttarakhand 29°03' N, 79°31'E leaf 

BAB-28 B. juncea 2-Mar-05 Ri-Bhoi, Meghalaya 25° 50‟ N, 90°55‟E leaf 

BAB-29 B. juncea 5-Mar-05 Dimapur, Nagaland 25° 55' N, 93° 44'E leaf 

BAB: Brassica Alternaria brassicae. 

sub-regions from the north western to north eastern between 

Rajasthan (27° 00' N, 74° 00' E) and north east states (Latitude 21° 

58' and 24° 35' N, Longitude 92° 15' and 93° 29' E), and comprises 

a total of 30 populations of A. brassicae, which is a common 

necrotrophic pathogen of Brassica species in this region, producing 

black lesions on leaves, stems and developing pods (Meena et al., 

2010). The common occurrence of infected seeds and stubbles in 

soil indicates the potential for vertical transmission (parent to 

offspring) to play a role in the epidemiology of the interaction. A 

survey was conducted to observe the disease pressure under 

AICRP-RM throughout monitoring for these regions. 

Collection of A. brassicae isolates 

Plant material infected with A. brassicae was sampled randomly 

from different geographical locations on Brassica species cultivated 

in India was collected and designated as BAB stands for Brassica 

Alternaria brassicae (Table 1). These selected infected spots were 

washed 3-4 times in sterilized distilled water and then surface 

sterilized by dipping in 4% NaOCl solution for 1 min, followed by 

washing with sterilized water 3-4 times. Surface sterilized leaf spot 

pieces were then aseptically transferred into 9 cm Petri dishes 

containing Potato Dextrose Agar (PDA) and incubated at 25±2°C 

for seven days. Thereafter, growing mycelia from margin of 

apparently distinct colonies of the leaf spot pieces on the medium 

were aseptically transferred into another Petri plate containing PDA 

medium, where it was grown for 15 days at 23±2°C in the BOD 

incubator. On the basis of their conidiophore and conidial 

morphology as described by Simmons (2007), the pathogen was 

identified as Alternaria brassicae (Berk.) Sacc. and purified by 

single spore isolation method. The isolated fungal pathogen 

cultures were maintained on PDA slants at 4°C. The 22 isolates 

(NAIMCC F 02599-02620) have been submitted to the National 

Bureau for Agriculturally Important Microorganisms (ICAR), Mau 

Nath Bhanjan (Uttar Pradesh, India) to develop the National 

Repository on Alternaria spp. 

Single-spore colonies were prepared with the help of stereo 

microscope by grown on potato dextrose agar (PDA). Sub-culturing 

was done after three months on PDA. Brassica leaf broth (BLB) 

medium was used at fourth subculturing to maintain the 

aggressiveness of the isolates every year. BLB medium was 

prepared using 250 g fresh leaf of Brassica juncea cultivar Varuna 

in 1 L distilled water supplemented with 15 g sucrose. Culture 

slants of isolates were stored on PDA in the refrigerator. A total of 

22 A. brassicae isolates were collected and maintained (Table 1). 

Morphological variability 

Ocular micrometer was calibrated and by use of micrometry (Meena 

et al., 2005), morphological variability among the 22 isolates of A. 

brassicae was studied in 2010-11. Total fifty conidia from each slide 

were examined at 40X magnification of light microscope and 

measured using ocular and stage micrometer. The average was 

used to calculate the conidial length, width, beak length and 

number of horizontal and vertical septa. 

Effect of different temperature and relative humidity on A. 

brassicae isolates 

Effect of temperature on radial growth of only limited isolates of A. 

brassicae (from Bharatpur, Pantnagar, Alwar, Kanpur, Hazaribag,

Table 2. Sporulation index. 

Sign Index No of spores per microscopic fields 

- Absent Nil 

+ Trace 1-10 

++ Mild 11-30 

+++ Moderate 31-50 

++++ Abundant More than 50 

Berhampur) was studied. Petri plates containing PDA medium were 

inoculated with agar blocks taken from fresh actively growing 

culture plates. Plates were incubated for 10 days at 15, 20, 25, 30, 

35 and 40°C temperature in B.O.D. incubator at a constant 100% 

relative humidity (RH) maintained in separate lower lid of the plate 

which was fixed with sticky tape on the other lower lid of fungal 

culture plates by mixing different quantities of KOH and distilled 

water (Chatopadhyay and Appaji, 2000). Similarly, A. brassicae 

isolates were incubated at 25°C in B.O.D. incubator for 10 days at 

100, 95, 90, 85, 80, 75, 70, 60 and 50% RH. Radial growth was 

measured after 10 days of inoculation for all isolates. 

Cultural characteristics 

To observe the variation among the isolates in cultural 

characteristics, that is, colony colour, shape, margin and texture a 

separate experiment was conducted on PDA and incubated in 

B.O.B. incubator at 25°C temperature and 100% relative humidity. 

Effect of culture media on mycelia growth and sporulation 

To study the effect of culture media on mycelia growth and 

sporulation, five different culture media, viz Asthana and Hawker‟s, 

Brown‟s, Czapek‟s, Elliot‟s and Richard‟s media were prepared in 

250 ml conical flask. Each treatment was replicated four times. A 

2.0 mm diameter mycelium disc from 10 day old culture grown on 

PDA was transferred into each 250 ml conical flask containing 25 

ml test media were incubated in B.O.D. incubator at 25°C for 20 

days. To observe the sporulation on 21 day old culture the filtrate 

was diluted thousand times and spores per microscopic field were 

counted with the help of Heamocytometer for sporulation index and 

results obtained are presented in the table. The fungal growth of 

each flask was separated on oven dried whatman filter paper No. 

42 and subsequently oven dried for 48 h at 50°C to obtain the true 

weight of the mycelial mat. The dry weight of the fungal growth was 

obtained by subtracting the weight of filter paper with four 

replications. The fungal growth of each isolate by weight of oven 

dried mycelial mat was obtained. 

Sporulation index 

This is shown is Table 2. 

Fungicide sensitivity among isolates 

Effect of four fungicides viz, Sure (carbendazim 12% + mancozeb 

63% WP), Mancozeb, Ridomil-MZ 72 WP (metalaxyl 8% + 

mancozeb 64% WP) and Kvistin (carbendazim 50% WP) on 

mycelial growth of A. brassicae isolates was studied in vitro at 200 

and 500 ppm concentrations. Stock solutions (10, 000 mg/l) were 

prepared for each active ingredient in distilled water. The solvent 

Meena et al. 5251 

concentration in both controls and assays never exceeded 1% (v/v). 

Aliquots of stock solutions were incorporated to autoclaved PDA 

medium at 45-50°C to get desired concentrations of 200 and 500 

ppm by mixed thoroughly before plating using poisoned food 

technique (Nene and Thapaliyal, 1993). Amended medium with the 

fungicides was then poured into each Petri plate and inoculated 

with 2 mm mycelial disc of each isolate separately and incubated at 

25±2°C. Medium without fungicide served as control. Thus, isolates 

were classified into three major groups‟ viz., highly resistant (HR), 

moderately resistant (MR) and sensitive (S). The radial growth of A. 

brassicae colonies in diameter of tested isolates on PDA medium 

was measured after 10 days and per cent inhibition was calculated 

by the following formula. 

Percentage inhibition = Growth of the pathogen in control – the 

presence of antagonist × 100/ Growth of pathogen in control plate. 

Pathogen aggressiveness 

In this experiment, two leaves (3rd/4th true leaves) were collected 

from 45 day-old plants having approximately six leaves to 

determined aggressiveness of A. brassicae isolates of 8 different 

Brassica species. Five cultivar/ genotypes of B. juncea including 

PHR-2, PAB-9511 and EC-399299 as tolerant and Varuna and 

Rohini as susceptible, Sinapis alba, Eruca sativa, B. oleracea, B. 

carinata (Kiran), B. rapa spp toria (PT-303), B. rapa spp. brown 

sarson (BSH-1) and B. napus (GSL-1) were screened for reaction 

against 30 isolates of A. brassicae. 

A replicate for the detached leaf test consisted of three randomly 

selected leaves from a set of the 3 rd /4 th true leaves collected from 

several plants that were pooled. The turgidity of detached leaves 

was maintained by plugging the petioles with moist cotton in 200 

mm size Petri plates having fourfold moist sterilized filter paper in 

bottom. Conidia of a 10 day-old culture were washed off with 

distilled water and filtered through cheesecloth of 0.1 mm diameter 

mesh size. The conidial suspension was then shaken and 

supplemented with 10 μl Tween-20 l -1 of suspension. The 

concentration of the conidial suspension was determined at least 

three times using a haematocytometer and adjusted to 5x10 4 

conidia ml -1 then incubated at 25±2°C for 3 days in the dark 

controlled-temperature room. Isolate aggressiveness was also 

evaluated with regard to the growth rate of individual lesions. 

Lesion size was measured after 10 days of inoculation. 


The pathosystem 

Severity of Alternaria blight on oilseed Brassicas differ 

from seasons to season and among regions as also 

between individual crops within a region. This may be 

due to existence of variability among isolates of Alternaria 

species. Mean maximum Alternaria blight disease 

severity both on leaves and pods was observed during 

2009 at Pantnagar followed by Faizabad, Dholi, Kangra, 

Kanpur, Morena and Hisar where the weather conditions 

were conducive for development of the pathogen. 

Disease pressure was observed mild at Bharatpur, 

Sriganganagar and Jaipur districts of Rajasthan (Table 

3). This reflected the adaptation of the respective isolates 

to the ambient conditions in the different cropping areas, 

where the disease occurs in varied proportions in 

different years. Disease dynamics in the Brassica-


Table 3. Percent Alternaria blight disease severity on Brassica spp. during 2009. 

Genotypes JAG DOL HSR PNT MOR KNG NAV BHP 

PHR 2 (Bj) 29.9 (25.0) 43.6 (47.5) 31.6 (27.5) 39.0 (39.6) 46.5 (52.7) 41.7 (44.3) 20.1 (11.7) 15.2 (27.1) 

PBC 9221 (Bc) 15.7 (7.5) 43.6 (47.5) 18.4 (10.0) 39.0 (39.6) 42.9 (46.3) 36.3 (35.0) 7.9 (1.9) 7.7 (16.1) 

GSL 1 (Bn) 24.7 (17.5) 50.8 (60.0) 15.9 (7.5) 48.6 (56.3) 49.4 (57.7) 39.7 (40.9) 15.2 (6.9) 8.4 (16.8) 

VARUNA (Bj) 42.1 (45.0) 49.3 (57.5) 38.2 (38.3) 51.0 (60.4) 50.2 (59.0) 53.3 (64.3) 17.4 (8.9) 25.3 (33.0) 

C.D. (P < 0.05) 6.5 2.8 3.1 3.7 10.9 4.8 1.5 1.1 

Figures in parenthesis are arc sin transformation and others are original values. 

Figure 1. Conidia of different A. brassicae isolates. 

Alternaria system are highly epidemic, and follow a clear 

„boom-and-bust‟ pattern, with prevalence in local 

populations often reaching 100% by the end of February 

during the growing season (Kolte, 1985; Chattopadhyay 

et al., 2005). 

Morphological variability among isolates 

The 22 single-spore isolates of A. brassicae showed 

significant (P

Table 4. Conidial size of different geographical isolates of A. brassicae*. 

A. brassicae isolates Length (µm) Width (µm) Beak length (µm) 


No. of Septa 

Horizontal Vertical 

BAB-02 152.3 47.5 47.3 3.8 1.3 

BAB-04 185.1 47.3 95.2 3.5 0.9 

BAB-06 252.1 33.9 178.0 6.8 0.1 

BAB-08 106.7 33.5 48.3 3.8 0.3 

BAB-18 285.9 47.5 180.0 6.3 0.5 

BAB-19 140.6 44.2 61.4 3.2 0.9 

BAB-20 189.7 35.6 111.5 4.2 0.3 

BAB-23 211.7 41.8 125.9 3.7 0.7 

BAB-28 122.2 34.7 44.7 3.4 0.4 

BAB-29 198.4 43.4 104.7 3.8 0.9 

BAB-30 193.6 57.0 87.3 3.2 0.9 

BAB-39 144.5 37.2 70.9 3.2 0.5 

BAB-40 198.2 41.6 100.4 5.6 1.1 

BAB-41 206.5 44.2 116.8 4.0 0.8 

BAB-42 196.6 33.7 113.9 5.5 0.1 

BAB-43 147.5 36.6 66.7 3.3 0.5 

BAB-44 140.6 35.4 67.9 3.5 0.4 

BAB-45 144.1 48.3 41.4 3.4 1.4 

BAB-47 168.1 40.4 76.2 4.1 0.9 

BAB-48 151.1 33.9 73.9 4.6 0.4 

BAB-49 201.2 44.6 105.9 6.1 1.1 

BAB-50 284.3 40.0 172.7 8.0 0.6 

Mean 182.8 41.0 95.0 4.4 0.7 

CV% 26.07 15.25 43.82 30.82 53.41 

*Average of 50 conidia in each isolates. 

Table 5. Mycelial growth of A. brassicae under different temperatures and relative humidity conditions. 

A. brassicae 

isolate 

Radial growth (mm)* 

Temperatures (°C) 1 Relative Humidity (%) 2 

15 20 25 30 35 40 50 60 70 75 80 85 90 95 100 

BAB-18 16.7 16.0 24.7 24.7 16.3 12.3 10.0 13.3 20.0 22.3 24.3 26.3 24.7 29.3 31.3 

BAB-19 11.0 16.3 27.0 25.3 16.0 12.7 10.5 13.5 20.5 21.7 23.5 25.7 27.0 29.0 30.0 

BAB-20 15.3 19.0 30.0 27.3 18.0 12.7 10.3 13.0 20.3 21.3 24.0 26.7 30.0 28.7 29.5 

BAB-23 11.0 15.3 24.0 21.0 15.0 13.0 11.7 14.0 21.0 23.0 25.0 27.7 24.0 30.7 31.0 

BAB-30 16.7 16.7 28.0 23.3 16.3 12.3 9.7 12.7 19.5 21.5 23.7 26.7 28.0 29.3 30.0 

BAB-43 14.3 15.0 29.3 29.0 16.0 10.0 10.7 13.0 20.3 22.0 24.7 27.0 29.3 29.0 30.0 

BAB-48 15.7 16.3 24.3 27.0 16.0 14.0 11.0 13.7 19.7 22.7 24.5 27.3 24.3 29.3 30.5 

L.S.D. 

(P < 0.05) 

Temperature: 2.2; Isolate: 1.8 

Temperature x isolate: 2.1 

*mean of three replications, 1 Relative Humidity 100%, 2 Temperature 25°C. 

been reported earlier by many workers (Sharma and 

Tewari, 1998, Meena et al., 2005; Singh et al., 2007). 

Most favourable optimal temperature 23-25°C for 

sporulation has been reported (Kadian and Saharan, 

Relative Humidity: 3.2; isolate: 2.1 

Relative humidity x isolate: 2.2 

1984; Ansari et al., 1989). In the present study, different 

temperatures were found optimum for mycelial growth 

and sporulation of different isolates of A. brassicae, which 

showed cultural variability among them. This temperature


Figure 2. Variability in wet and dry mycelial weight of A. brassicae isolates on different 

media. 

ranged from 25 to 30°C and 15 to 35°C for mycelia 

growth and sporulation, respectively. The enormous 

disparity available among only twenty two isolates of A. 

brassicae also indicates their ability to adapt to varied 

climatic situations. These findings are supported by Singh 

et al. (2007), who also found variability among different A. 

brassicae isolates of different geographical origin for 

temperature requirement. Further, the higher temperature 

and RH being favourable for Berhampore isolate could be 

related with climatic condition of the West Bengal state, 

where temperature and RH during rapeseed-mustard 

crop season is generally higher than other geographical 

regions in India (Table 1). 

Cultural characteristic of A. brassicae isolates 

Isolates of A. brassicae showed variable cultural 

characteristics varied from regular to irregular, cottony 

white, dark green to light brown mycelial growth and 

based on characteristics, all A. brassicae isolates could 

be grouped into four colony types. Group 1 isolates 

produced white to pale gray or apricot orange colonies 

with a cottony texture. Tufts of sterile white hyphae were 

present at the center of the colony. Group 2 isolates 

produced dark olive gray to iron gray colonies with wavy 

or torn margin and fluffy to woolly colony texture. Group 3 

isolates produced pale olive gray to olive gray colonies, 

often with a very thin (1 to 2 mm) white margin with 

woolly to cottony colony texture. Diffusible pigments 

absent, although all isolates produced whitish crystals in 

agar medium underneath the mycelial mat and some 

produced crystals in great abundance. Group 4 consisted 

of colonies showed lettuce green to olive green and 

usually had a prominent (2 to 5 mm) white margin. 

Colony texture was fulfy to woolly. This group did not 

produce diffusible pigments, but about half of the isolates 

produced whitish crystals in the agar medium underneath 

the mycelial mat. 

Effect of culture media 

Different test synthetic broth media showed profound 

variation in wet biomass of mycelium of A. brassicae 

isolates infecting rapeseed-mustard. Maximum wet 

mycelial biomass of A. brassicae isolates (BAB 48, BAB 

42, BAB, 40 and BAB 44) was recorded in Elliot‟s 

medium, followed by Brown‟s medium, Czapeck‟s 

medium. However, least mycelial wet biomass was 

observed for all isolates in Asthana and Howker‟s 

medium. Maximum dry mycelial biomass of A. brassicae 

isolates (BAB 50, BAB 19, BAB, 49 and BAB 42) was 

recorded in Czapeck‟s medium followed by Elliot‟s 

medium. However, least mycelial dry weight was 

observed for all isolates in Brown‟s medium and Asthana 

and Hawker‟s medium (Figure 2). 

Maximum sporulation was observed in BAB 28 followed 

by BAB-18 isolate in Eilliot‟s, Richard‟s and Asthana and 

Howker‟s medium. Brown‟s medium showed no 

sporulation in all isolates. However, Asthana and 

Howker‟s medium showed good sporulation in almost all 

the isolates (Table 6). Poor sporulation of A. brassicae in 

different synthetic media indicated that the fungus require 

some organic sources of nutrition for better growth and 

sporulation. 

Fungicide sensitivity among isolates 

Maximum per cent mycelial growth inhibition over control 

at 200 ppm concentration was observed in metalaxyl +

Table 6. Sporulation of Alternaria brassicae isolates on different culture media. 


Isolates Brown's Eilliot's Asthana and Howker's Czapek’s Richard’s 

BAB-02 - + ++ + - 

BAB-04 - ++ + ++ +++ 

BAB-06 - + + + - 

BAB-08 - + ++ + - 

BAB-18 - ++++ ++ ++ ++ 

BAB-19 - - + - + 

BAB-20 - - ++++ + ++ 

BAB-23 - - ++ + + 

BAB-28 - ++++ ++++ ++++ +++ 

BAB-29 - + + + - 

BAB-30 - - ++ + ++ 

BAB-39 - - ++ - - 

BAB-40 - - ++ + + 

BAB-41 - ++ + + - 

BAB-42 - - + + +++ 

BAB-43 - + - - + 

BAB-44 - + ++ + + 

BAB-45 - + - - + 

BAB-47 - + + + + 

BAB-48 - + + + - 

BAB-49 - - +++ + - 

BAB-50 - ++ + ++ +++ 

Mycelial growth inhibition (%) 

Figure 3. Fungicide sensitivity of A. brassicae isolates at 200 ppm concentration. 

mancozeb fungicide with a wide variation ranged from 8.9 

percent (BAB- 41) to 92.5% (BAB-48). While at 500 ppm, 

growth inhibition was in carbendazim fungicide with a 

wide variation ranged from 8.9% (BAB- 41) to 92.5% 

(BAB-48). However, fungicide carbendazim provided 

least mycelial growth inhibition over control ranged from 

2.6 (BAB-44) to 86.1% (BAB-08). Isolates, BAB-44, BAB- 

Mancozeb kvistin 

45, BAB-19, BAB-41, BAB-40, BAB-50 and BAB-23 were 

found sensitive to fungicides which showed similar 

response against all four test fungicides in inhibiting 

mycelial growth. Isolates viz., BAB-08, BAB-18, BAB-47, 

BAB-20, BAB-39 and BAB-48 were found highly resistant 

to test fungicides, seems to be highly virulent (Figure 3), 

Based on the mycelial growth in fungicide assay at 500


Mycelial growth inhibition (%) 

Figure 4. Fungicide sensitivity of A. brassicae isolates at 500 ppm concentration. 

ppm concentration (Figure 4), A. brassicae isolates were 

categorized into three major group‟s viz., highly resistant 

(BAB-02, BAB-18, BAB-24, BAB-26, BAB-29, BAB-40, 

BAB-44, BAB-47, BAB-50, BAB-51, BAB-52, BAB-53), 

moderately resistant (BAB-06, BAB-08, BAB-12, BAB- 

19BAB-23, BAB-39, BAB-41, BAB-43, BAB-54) and 

sensitive (BAB-03, BAB-04, BAB-20, BAB-28, BAB-42, 

BAB-45, BAB-49, BAB-55, BAB-56). Similar observations 

recorded when studying the effect of difenoconazole on 

A. alternata (Reuveni and Sheglov, 2002). 

Results indicated that all test fungicides showed 

inhibition over control (Figure 2) but differ in percent 

inhibition of mycelial growth which may be due to the 

variation towards sensitivity among A. brassicae isolates. 

The present findings are in line with Meena et al. (2004) 

in controlling A. brassicae with mancozeb, but differ in 

percent inhibition of mycelial growth. Our results 

indicated that mancozeb and sure caused significant 

reductions of mycelial growth of A. Brassicae. However, 

iprodione was efficient in reducing germ tube length with 

EC50 below 10 mg/l observed for A. brassicicola isolates 

(Huang and Levy, 1995) but these authors also found 

that this fungicide was able to inhibit germination at 

concentrations as low as 5 mg/l. During the course of this 

study, four A. brassiciae isolates highly resistant to 

mancozeb were identified. Resistance of A. brassicicola 

to iprodione has already been documented by Huang and 

Levy (1995). Our results proved with the earlier study of 

thirteen isolates of A. brassicae tested on oilseed rape 

differed in their virulence (Mirdha, 1983). Based on radial 

Alternaria brassicae isolates 

mycelial growth, A. brassicae isolates could be 

categorized into three major groups viz., highly resistant, 

moderately resistant and sensitive (Table 7). 

Pathogen aggressiveness 

Different isolates of A. brassicae showed variable 

response on host differentials of Brassica species. 

Significant tolerance with minimum lesion size was 

observed in Brassica alba, EC-399299, B. juncea (PAB 

9511), Eruca sativa and B. carinata, B. napus. Variation 

in tolerance and susceptibility on same host depending 

on aggressiveness of isolates revealed that the variability 

exist among A. brassicae isolates (Table 7). Different 

Brassica species showed variable reaction against same 

isolate, which reflect the variation among the geographical 

isolates that may be used as host differentials 

against A. brassicae. Highest mean susceptibility for A. 

brassicae isolates was observed on B. juncea cultivars 

Varuna and Rohini while tolerance was recorded on B. 

alba and B. napus. Penetration by pathogen through 

wounds of host plants has been a significant component 

of infection process for Alternaria spp. (Rotem, 1994). 


Funding was received under the Outreach Programme 

(ICAR) and facilities were provided by DG, and ICAR.

Table 7. Reaction of different genotypes/ species of Brassica against Alternaria brassicae isolates. 

Isolates S. alba PHR-2(B.j) 

(B.j) 

Varuna 

(B.j) 

PAB-9511 

(B.j) 

Rohini 

(B.j) 

EC399299 

B. rapa 

(BSH-1) 

E. sativa 

B. rapa 

ssp toria 

B. carinata B. napus 

(GSL-1) 


B. oleracea 

BAB-01 0.0 6.5 2.0 5.5 5.0 3.5 3.9 8.7 6.0 6.8 4.3 6.3 

BAB-02 10.3 4.6 9.0 6.6 6.6 4.8 7.5 7.3 5.1 6.0 1.5 7.3 

BAB-03 8.5 0.0 4.1 6.8 6.7 11.0 6.0 8.1 5.8 9.3 5.1 8.3 

BAB-04 7.4 10.8 8.5 7.4 10.0 9.8 6.6 9.0 8.4 2.8 5.8 9.4 

BAB-05 7.5 8.2 15.5 4.6 5.7 6.6 4.6 9.7 8.6 8.3 3.1 8.5 

BAB-06 0.0 7.5 17.8 4.4 5.8 6.8 6.0 8.4 10.3 10.3 9.5 8.1 

BAB-07 0.0 9.0 4.8 5.8 6.3 10.7 5.8 7.9 5.8 1.5 5.2 9.7 

BAB-08 7.0 7.8 17.3 7.1 18.9 7.4 6.2 8.5 8.0 11.1 6.5 10.2 

BAB-09 9.8 3.6 6.6 7.0 7.1 8.4 9.6 7.9 12.2 7.1 6.8 7.1 

BAB-10 7.9 7.8 17.8 0.0 20.0 8.0 5.1 9.2 7.0 5.0 7.1 9.6 

BAB-11 9.3 6.3 6.0 5.4 8.3 9.1 3.8 2.4 8.0 3.3 8.8 8.0 

BAB-12 7.1 5.9 8.0 3.8 6.6 9.6 6.3 6.2 7.7 5.0 6.1 9.3 

BAB-13 8.2 12.2 18.7 8.5 18.0 8.2 8.9 5.8 8.4 3.4 3.5 8.0 

BAB-14 4.0 8.7 9.4 6.8 7.0 6.3 7.8 10.5 9.8 6.3 3.3 9.2 

BAB-15 3.5 7.9 7.5 7.8 8.1 6.9 3.6 7.9 6.2 11.6 5.3 5.9 

BAB-16 0.0 6.8 4.0 5.3 8.0 6.0 8.0 7.1 6.3 10.5 7.4 8.8 

BAB-17 5.9 11.0 7.1 9.0 16.8 7.9 6.6 7.1 10.8 11.0 7.4 8.0 

BAB-18 8.3 9.9 17.2 7.6 15.2 5.3 7.3 8.3 6.1 9.0 10.7 6.4 

BAB-19 9.6 3.3 5.0 10.5 7.5 1.9 8.0 11.2 7.1 9.3 12.3 8.7 

BAB-20 6.3 7.8 11.9 7.5 6.6 0.0 8.1 8.2 8.0 8.3 11.0 11.0 

BAB-21 5.8 5.8 9.8 9.2 6.8 6.9 8.6 8.1 7.0 0.0 4.9 9.1 

BAB-22 8.8 9.8 5.9 7.1 6.4 8.0 6.0 6.3 7.0 6.7 9.3 10.5 

BAB-23 0.0 10.5 7.3 10.1 10.0 7.1 7.7 7.5 5.7 4.9 11.7 9.0 

BAB-24 6.3 4.9 17.6 13.0 14.0 4.7 8.6 7.4 7.6 9.3 9.5 10.0 

BAB-25 10.1 9.1 7.5 3.9 16.0 7.3 7.7 11.9 6.4 0.0 4.8 10.1 

BAB-26 10.1 9.6 7.6 5.0 8.8 5.8 5.8 6.9 3.5 7.3 2.5 10.3 

BAB-27 10.8 4.6 17.6 0.0 15.0 5.0 5.1 12.1 9.0 10.5 7.3 13.2 

BAB-28 9.3 8.7 8.2 2.9 10.3 9.7 6.0 9.0 5.0 6.8 10.2 8.3 

BAB-29 0.0 9.0 6.8 7.0 13.0 8.8 4.5 9.8 8.0 6.0 10.0 9.4 

BAB-30 7.8 9.4 8.8 8.3 11.2 9.3 6.9 7.9 7.6 9.6 11.1 10.8 

CD at 1% 3.2 3.9 3.0 4.2 3.2 3.4 4.0 2.4 2.2 2.5 2.6 3.8


Director, Directorate of Rapeseed-Mustard Research, 

Bharatpur is gratefully acknowledged for carrying out the 

investigation. 

REFERENCES 

Ansari NA, Wajid Khan M, Muheet A (1989). Effect of some factors on 

growth and sporulation of Alternaria brassicae causing Alternaria 

blight of rapeseed and mustard. Acta Bot. Indica, 17: 49-53. 

Awasthi RP, Kolte SJ (1989). Variability in Alternaria brassicae affecting 

rapeseed and mustard. Indian Phytopath., 42: 275. 

Bock CH, Thrall Peter H, Burdon Jeremy J (2005). Genetic structure of 

populations of Alternaria brassicicola suggests the occurrence of 

sexual recombination. Mycol. Res., 109(2): 227-236. 

Chattopadhyay C, Agrawal R, Kumar A, Bhar LM, Meena PD, Meena 

RL, Khan SA, Chattopadhyay AK, Awasthi RP, Singh SN, 

Chakravarthy NVK, Kumar A, Singh RB, Bhunia CK (2005). 

Epidemiology and forecasting of Alternaria blight of oilseed Brassica 

in India – a case study. J. Pl. Dis. Prot., 112(4): 351-365. 

Chatopadhyay C, Appaji S (2000). Factors affecting Plasmopara 

halstedii (Farl.) Berl. and de Toni. Annals Pl. Prot. Sci., 8: 36-39. 

Huang R, Levy Y (1995). Characterization of iprodione-resistant isolates 

of Alternaria brassicicola. Plant Dis., 79: 828-833. 

Kadian AK, Saharan GS (1984). Studies on spore germination and 

infection of Alternaria brassicae of rapeseed-mustard. J. Oilseed 

Res., 1: 183-188. 

Kaur S, Singh G, Banga SS (2007). Documenting variation in Alternaria 

brassicae isolates based on conidial morphology, fungicidal 

sensitivity and molecular profile. (in) Proceeding of the 12th 

International Rapeseed Congress, 26–30 March, Wuhan, China, 4: 

87-89. 

Kolte SJ (1985). Diseases of Annual Edible Oilseed Crops, Vol. II, 

Rapeseed-Mustard and Sesame Diseases. CRC Press Inc. Boca 

Raton, Florida, USA, p. 135 

Meena PD, Awasthi RP, Chattopadhyay C, Kolte SJ, Kumar A (2010a). 

Alternaria blight: a chronic disease in rapeseed-mustard. J. Oilseed 

Brassica, 1: 1-11. 

Meena PD, Chattopadhyay C, Kumar VR, Meena RL, Rana US (2005). 

Spore behaviour in atmosphere and trends in variability of Alternaria 

brassicae population in India. J. Mycol. Plant Pathol., 35: 511. 

Meena PD, Gupta R, Rani A, Sharma P, Rai PK, Chowdappa P 

(2010b). Morphological and cultural variability among Alternaria 

brassicae isolates from India. In: Souvenir cum Abstracts of National 

Symposium on “Molecular Approaches for Management of Fungal 

Diseases of Crop Plants” during 27-30, Dec 2010 held at IIHR, 

Bangalore, pp. 184-185. 

Meena PD, Meena RL, Chattopadhyay C, Kumar A (2004). 

Identification of critical stage for disease development and biocontrol 

of Alternaria blight of Indian mustard (Brassica juncea). J. Phytopath., 

152: 204-209. 

Mirdha MAU (1983). Virulence of different isolates of Alternaria 

brassicae on winter oilseed rape cultivars. 6th Intl. Rapeseed 

Congress, Paris, France, 17-19 May 1983, pp. 1025-1029. 

Nene YL, Thapliyal PN (1993). Fungicides in Plant Disease Control. 

Oxford and IBH Publ. Co., New Delhi, p. 507 

Reuveni M, Sheglov D (2002). Effects of azoxystrobin, difenoconazole, 

polyoxin B (polar) and trifloxystrobin on germination and growth of 

Alternaria alternata and decay in red delicious apple fruit. Crop. Prot., 

21: 951-955. 

Rotem J (1994). The Genus Alternaria: Biology, Epidemiology and 

Pathogenicity. St Paul, MN, USA: APS press, p. 326. 

Sharma TR, Tewari JP (1998). RAPD analysis of three Alternaria 

species pathogenic to crucifers. Mycol. Res., 102: 807-814. 

Simmons EG (2007). Alternaria: An Identification Manual. CBS 

Biodiversity Series No. 6, Utrecht, The Netherlands, p. 775. 

Singh D, Singh R, Singh H, Yadav R C, Yadav N, Barbetti M, Salisbury 

P, Nimbal S, Chattopadhyay C, Kumar A (2007). Cultural and 

morphological variability in Alternaria brassicae isolates of Indian 

mustard (Brassica juncea L. Czern & Coss.). (in) Proceeding of the 

12th International Rapeseed Congress, 26-30 March, Wuhan, China, 

4: 158-160. 

Varma PK, Singh S, Gandhi SK, Chaudhary K. (2006). Variability 

among Alternaria solani isolates associated with early blight of 

tomato. Comm. Agril. Appl. Biol. Sci., 71: 37-46.



DOI: 10.5897/AJMR12.791 



Heterogeneity of aminoglycoside resistance genes 

profile in clinical Staphylococcus aureus isolates 

Salwa Bdour 

Department of Biological Sciences, Faculty of Science, University of Jordan, Amman, Jordan. 

E-mail: bsalwa@ju.edu.jo. Tel: 962-6-5355000 Ext. 22333. Fax: 962-6-5348939. 


One hundred clinical Staphylococcus aureus including 57 methicillin-resistant (MRSA) and 43 

methicllin-sensitive (MSSA) isolates were analyzed for susceptibility to three aminoglycosides and for 

the presence of genes encoding aminoglycoside modifying enzymes (AMEs). 52% of these isolates 

were resistant to 1-3 aminoglycosides, which included 65% MRSA and 35% MSSA isolates. The 

aminoglycoside resistance genes were more frequently identified in MRSA than in MSSA isolates. The 

most frequent gene was aac(6')/aph(2") and it was detected in 45% S. aureus isolates which included 

52.6% MRSA and 34.8% MSSA isolates. The second prevalent gene was ant(4',4") and it was detected in 

31% S. aureus which included 40.3% MRSA and 18.6% MSSA isolates. 21% of S. aureus isolates 

including 29.8% MRSA and 9.3% MSSA isolates, carried the aph(3')III gene. The most frequent 

combination of genes was aac(6′)/aph(2′′) with ant(4',4") in 22.8% MRSA and in 16.2% MSSA isolates. 

The second dominant gene combination was aac(6')/aph(2") with aph(3')III in 17.5% MRSA and in 6.9% 

MSSA isolates. The ant(4',4") and aph(3′)III combination existed only in 7% MRSA isolates. The 3 genes 

coexisted in 5.3% MRSA and in 2.3% MSSA isolates. The concordance between the presence of genes 

and aminoglycoside resistance phenotype was observed in most MRSA and MSSA isolates. Emerging 

of isolates harboring these genes must not be ignored because it limits the choices in the number of 

antibiotics available to clinicians to treat staphylococcal infections in risk patients. 

Key words: Staphylococcus aureus, aminoglycoside resistance genes, methicillin-resistant, methicillinsensitive, 

polymerase chain reaction, Jordan. 

INTRODUCTION 

Methicillin–resistant Staphylococcus aureus (MRSA) is a 

major cause of hospital and community-acquired infections 

(Konno et al, 1995; Kluytmans-VandenBergh and 

Kluytmans, 2006). MRSA isolates may also be resistant 

to a wide range of antibiotics including aminoglycosides 

which are often used in combination with either a βlactam 

or a glycopeptide, for treatment of serious staphylococcal 

infections such as bacteremia and endocarditis 

(Baddour et al., 2005; Cosgrove et al., 2009; Kim et al., 

2010). The main mechanism of aminoglycoside 

resistance is drug inactivation by aminoglycoside 

modifying enzymes (AMEs) (Nakaminami et al., 2008; 

Fatholahzadeh et al., 2009) which can be plasmid-borne 

or chromosomally encoded on transposable elements 

(Byrne et al., 1990; Chambers, 1997; Ito et al., 1999; 

Vakulenko and Mobashery, 2003). The bifunctional 

enzyme, aminoglycoside-6'-N-acetyltransferase/2"-Ophosphoryltransferase 

[AAC(6')/APH(2")], encoded by the 

aac(6′)/aph(2′′) gene, is the most frequently encountered 

AME in staphylococcal isolates and mediates resistance 

to gentamicin, tobramycin, kanamycin, dibekacin, 

netilmicin, amikacin and isepamicin (Byrne et al., 1990; 

Vakulenko and Mobashery, 2003). Additional enzyme 

such as aminoglycoside-4'-O–nucleotidyltransferase I 

[ANT(4')-I] encoded by ant(4′)-Ia is known to mediate 

resistance to neomycin, amikacin, kanamycin and 

tobramycin in staphylococci (Chambers, 1997; Ito et al., 

1999; Vakulenko and Mobashery, 2003). Resistance to


Table 1. Primers and the anticipated sizes of the target region s for the tested genes. 

Target gene Primer sequence Size of the target region (bp) 

rrs (16S rRNA) 

aac(6')/aph(2") 

aph(3') III 

ant(4', 4") 

5'-GGATTAGATACCCTGGTAGTCC-3' 

5'-TCG TTGCGGGACTTAACCCAAC -3' 

5'-CCAAGAGCAATAAGGGCATA-3' 

5'-CACTATCATAACCACTACCG -3' 

5'-GCCGATGTGGATTGCGAAAA-3' 

5'-GCTTGATCCCCAGTAAGTCA -3' 

5'-GCAAGGACCGACAACATTTC -3' 

5'-TGGCACAGATGGTCATAACC -3' 

neomycin, and kanamycin is also conferred by an 

aminoglycoside-3'-O-phosphoryltransferase III [APH(3')- 

III] encoded by aph(3′)-III (Vakulenko and Mobashery, 

2003; Woodford, 2005). The acetylated, phosphorylated 

or adenylated aminoglycosides do not bind to ribosomes, 

and thus do not inhibit protein synthesis (Woodford, 

2005). AME produced by MRSA isolates can be 

determined by identifying the corresponding genes (Van 

De Klundert and Vliegenthart 1993; Schmitz et al., 1999; 

Hauschild et al., 2008). 

Development of multiple aminoglycosides resistant 

MRSA isolates was reported in different countries around 

the world (Schmitz et al., 1999; Ida et al., 2001; Choi et 

al., 2003; Nakaminami et al., 2008; Ardic et al., 2006; 

Fatholahzadeh et al., 2009; Liakopoulos et al., 2011). 

Differences in prevalence of these isolates is linked to the 

antibiotic policies applied in different countries (Schmitz 

et al., 1999; Mangeney et al., 2002). Infections caused by 

these isolates are particularly difficult to treat, often 

associated with high mortality and increased healthcare 

costs (Klein et al., 2007; Nickerson et al., 2009). There is 

currently little information on the prevalence and 

predominant types of AME genes in MRSA isolated in the 

Middle-East countries where the prevalence of MRSA is 

high (Ardic et al., 2006; Fatholahzadeh et al., 2009). In 

Jordan, the prevalence of clinical MRSA is 57% (Al-Zu’bi, 

et al. 2004) and the aminoglycosides are widely used in 

the hospitals and community in the absence of national 

antimicrobial use guidelines (Al-Bakri et al., 2005). Also, 

reports on the aminoglycoside susceptibility phenotype of 

MRSA isolates, and the prevalence and distribution of the 

aminoglycoside resistance genes in these isolates are 

lacking. Therefore, the aim of the present study was to 

provide information regarding the prevalence and 

distribution of aac(6′)/aph(2′′), ant(4', 4") and aph(3′)-III 

genes encoding the most clinically relevant AMEs in 

clinical methicillin-resistant and sensitive S. aureus 

isolates. This information is necessary to define a 

baseline for monitoring possible future increase in the 

320 

220 

292 

165 

prevalence of resistant strains and for the implementation 

of an antibiotic use policy in Jordan. 


Bacterial strains 

This study included 100 clinical S. aureus isolates which were 

obtained from various clinical specimens submitted to the 

microbiology laboratory of Jordan University Hospital, Amman, 

Jordan. These isolates were identified by biochemical tests. Their 

sensitivity to oxacillin was studied and the mecA gene was detected 

by polymerase chain reaction (PCR) in 57 MRSA isolates (Al-Zu’bi 

et al., 2004). 

Antimicrobial susceptibility test 

In vitro susceptibility of 57 MRSA and 43 methicillin-sensitive 

(MSSA) isolates to the aminoglycosides: gentamicin (Gen), 

tobramycin (Tob) and kanamycin (K) (Sigma, USA) was tested 

using the agar dilution method (Woods and Washington., 1995). 

Isolates with minimum inhibitory concentrations (MICs) of ≤4 µg/ml 

to gentamicin and tobramycin and MICs of ≤16 µg/ml to kanamycin 

were considered to be susceptible. Isolates with MICs of ≥16 µg/ml 

to gentamicin and tobramycin and MICs of ≥64 µg/ml to kanamycin 

were considered to be resistant. 

PCR detection of aminoglycoside resistance genes 

The aminoglycoside resistance genes in the cell lysate of the 

antibiotic resistant S. aureus isolates were detected by multiplex 

PCR (Van De Klundert and Vliegenthart, 1993) using 15 p.mole of 

each primer shown in Table 1. DNA amplification was carried out in 

GeneAmp PCR system 9600 (Perkin Elmer, USA) with the following 

thermal cycling profile: an initial denaturation at 94°C for 3 min 

followed by 32 cycles of 30 s at 94°C, 45 s at 60°C , 2 min at 72°C 

and final extension at 72°C for 7 min (Van De Klunde rt and 

Vliegenthart, 1993). The PCR products were detected in 3% 

agarose gel and band size was assessed by direct comparison with 

50 bp DNA ladder (Invitrogen life technologies, UK). S. aureus 

CECT 976 [possessing aaphA3 gene] kindly provided by the 

Spanish Type Culture Collection] and the mecA-positive S. aureus

Table 2. Susceptibility of the clinical S. aureus isolates to the tested aminoglycosides by the agar dilution method. 

*S. aureus Number 

א No. (%) of isolates resistant to 

Gentamicin Tobramycin Kanamycin 

╪ Aminoglycoside 

susceptibility profile 

Bdour 5261 

א No. (%) aminoglycoside 

resistant isolates 

Gen 

MRSA 57 30 (52.6) 35 (61.4) 31 (54.4) 

R , Tob R , K R 26 (45.6) 

Gen R , Tob R , K S 2 (3.5) 

Gen R , Tob S , K R Gen 

1 (1.7) 

R , Tob S , K I 1 (1.7) 

Gen S , Tob R , K R 4 (7) 

Gen S , Tob R , K S 3 (5.3) 

Total 

. 

37(65) 

Gen 

MSSA 43 14 (32.5) 14 (32.5) 13 (30.2) 

R , Tob R , K R 13 (30.2) 

Gen R , Tob S , K I 1 (2.3) 

Gen I , Tob R , K I 1 (2.3) 

Total 15 (35) 

Overall total 100 44 (44) 49 (49) 44 (44) 52 (52) 

* MRSA: Methicillin Resistant S. aureus; MSSA: Methicillin Sensitive S. aureus. ╪ Abbreviations: Gen, gentamicin; Tob, tobramycin; K, 

kanamycin. R, resistant; I, intermediate; S, sensitive to the antibiotic. א The percentage is based on the number of MRSA (57) or MSSA (43) 

isolates. 

ATCC 43300 [possessing aac (6′)/aph(2′′) and ant(4',4") genes] strains 

were used as positive PCR controls throughout this study. 


The Z-test was used to compare the proportion of aminoglycoside 

resistance rate in MRSA and MSSA isolates. P < 0.05 was 

considered statistically significant (Johnson and Bhattacharyya, 

1996). 

RESULTS 

Susceptibility to the aminoglycosides 

The MICs of 100 S. aureus isolates to the tested 

aminoglycosides ranged from 0.25 to >256 µg/ml. A total 

of 48 (48%) isolates which included 20/57 (35%) MRSA 

and 28/43 (65%) MSSA isolates were sensitive to the 

three aminoglycosides. Fifty two (52%) S. aureus isolates 

were resistant to 1-3 aminoglycosides and included 37/57 

(65%) MRSA and 15/43 (35%) MSSA isolates. Of the 

100 S. aureus isolates, 44 (44%), 49 (49%) and 44 (44%) 

were resistant to gentamicin, tobramycin and kanamycin, 

respectively (Table 2). The aminoglycoside resistance 

rate in MRSA was significantly (P < 0.05) higher than that 

in MSSA isolates (Table 2). One MRSA isolate was 

intermediate resistant to kanamycin (MIC= 32 µg/ml). 

Two MSSA isolates were intermediate resistant to 

kanamycin and one was intermediate resistant to 

gentamicin (MIC = 8 µg/ml). 

Multi-resistance to three aminoglycosides (Gen R , Tob R , 

K R ) was observed in 26/57 (45.6%) MRSA isolates and 

was significantly (P


Table 3. The prevalence of the AME genes in the clinical S. aureus isolates. 

S. aureus 

*No. (%) of isolates harboring the AME genes 

aac(6′)/aph(2′′) ant(4', 4") aph(3') III 

MRSA (n = 57) 30 (52.6) 23 (40.3) 17 (29.8) 

Gen R 30 0 0 

Tob R 28 23 0 

K R 27 20 16 

MSSA (n = 43) 15 (34.8) 8 (18.6) 4 (9.3) 

Gen R 14 0 0 

Tob R 14 8 0 

K R 13 7 4 

╪ Total No. (%) 45 (45) 31 (31) 21 (21) 

AME, aminoglycoside modifying enzyme; R, resistant; Gen, gentamicin; Tob, tobramycin; K, 

kanamycin.* The percentage is based on the number of MRSA (57) or MSSA (43) isolates; ╪ Total 

number of MRSA and MSSA isolates harboring each AME gene and percentage per 100 S. aureus 

isolates. 

K R -MRSA and 30.7 % (4/13) K R -MSSA isolates (Table 3). 

AME gene combinations in the multi-resistant S. 

aureus isolates 

Table 4 shows the distribution of the AME genes in S. 

aureus isolates with different aminoglycoside susceptibility 

phenotype. A total of 41% of the S. aureus isolates 

including 30/57 (52.6%) MRSA and 11/43 (25.5%) MSSA 

isolates harbored the aac(6′)/aph(2′′) gene in combination 

with either ant(4',4") and/or aph(3′)III or carried ant(4',4") 

in combination with aph(3′)III only. The most frequent 

combination of AME genes was aac(6′)/aph(2′′) with 

ant(4',4"). The prevalence of this combination in 13/57 

(22.8%) MRSA isolates was significantly higher (P = 

0.0088) than that in 7/43 (16.2%) MSSA isolates. The 

second dominant gene combination was aac(6')/aph(2") 

with aph(3')III. The prevalence of this combination in 

10/57 (17.5%) MRSA isolates was not significantly higher 

(P = 0.1212) than that in 3/43 (6.9%) MSSA isolates. The 

ant(4',4") and aph(3′)III combination existed only in 4/57 

(7%) MRSA. 

Four AME gene profiles (i to iv) were detected in the 

multi-resistant MRSA and MSSA isolates with Gen R , 

Tob R , K R 

–phenotype (Table 4). The aac(6')/aph(2") and 

ant(4',4") gene combination was predominant in the four 

profiles and occurred in 13/26 (50%) Gen R , Tob R , K R - 

MRSA and in 6/13 (46%) Gen R , Tob R , K R -MSSA isolates. 

The second dominant AME gene profile in this phenotype 

included the aac(6')/aph(2") and aph(3')III combination in 

9/26 (34.6%) Gen R , Tob R , K R -MRSA and in 3/13 (23%) 

MSSA isolates. The 3 AME genes coexisted in 3/26 

(11.5%) multi-resistant Gen R , Tob R , K R -MRSA and in 1/13 

(7.7%) Gen R , Tob R , K R -MSSA isolates. These isolates 

were highly resistant to the tested aminoglycosides and 

most have MIC ≥128 µg/ml. 

Two AME gene profiles (i and ii) were detected in two 

MRSA isolates with Gen R , Tob R , K S 

–phenotype (Table 4). 

The aac(6')/aph(2") and aph(3')III combination was 

detected in one isolate only. However, aph(3')III and 

ant(4',4") combination was detected only in 4 multiresistant 

(Gen S , Tob R , K R ) MRSA isolates. The 

aac(6')/aph(2") and ant(4',4") combination was detected 

in one MSSA with Gen I , Tob R , K I phenotype (Table 4). 

On the other hand, one AME gene was detected in the 

remaining multi-resistant S. aureus isolates (Table 4). 

DISCUSSION 

Development of aminoglycoside resistance MRSA strains 

(Schmitz et al., 1999; Ida et al., 2001; Choi et al., 2003; 

Ardic et al., 2006; Nakaminami et al., 2008; 

Fatholahzadeh et al., 2009; Liakopoulos et al., 2011) has 

become a global threat to effective health care delivery 

(Klein et al., 2007; Nickerson et al., 2009). In the present 

study, 52% of S. aureus isolates were resistant to 1-3 

aminoglycosides which is higher than that in some 

European countries including Poland (38.1%) (Hauschild 

et al., 2008) and Greece (48.2%) (Liakopoulos et al., 

2011). The higher prevalence may be due to the misuse 

of antibiotics in Jordan (Al-Bakri et al., 2005). A total of 

44, 49 and 44% of the Jordanian isolates were resistant 

to gentamicin, tobramycin and kanamycin, respectively 

(Table 2), which is within the range reported in Europe 

and Korea for gentamicin (6.3 to 66%), tobramycin (12.9 

to 71%) and kanamycin (48.2 to 97.8%) (Liakopoulos et 

al., 2011; Schmitz et al., 1999; Choi et al., 2003; 

Hauschild et al., 2008). The aminoglycoside resistance 

rate in MRSA was almost double that in MSSA isolates 

(Table 2) and it was due to the presence of 1-3 AME

Table 4. Aminoglycoside resistance genes in the clinical S. aureus isolates with different susceptibility phenotypes. 

S. aureus 

MRSA 

MSSA 

* Aminoglycoside 

susceptibility phenotype 

╪ Aminoglycoside resistance genes † Number (%) of isolates 

aac(6')/aph(2") ant(4', 4") 

aph(3') III 

Gen S , Tob S , K S ND ND ND 20 (35) 

Gen R , Tob R , K R 

Gene profile 

Gen R , Tob R , K S 

Gene profile 

(i) + + – 13 (22.8) 

(ii) + – + 9 (15.8) 

(iii) + + + 3 (5.3) 

(iv) + – – 1 (1.7) 

(i) + – – 1 (1.7) 

(ii) + – + 1 (1.7) 

Gen R , Tob S , K R + – – 1 (1.7) 

Gen R , Tob S , K I + – – 1 (1.7) 

Gen S , Tob R , K R – + + 4 (7) 

Gen S , Tob R , K S – + – 3 (5.3) 

Total 30 23 17 57 

Gen S , Tob S , K S ND ND ND 28 (65) 

Gen R , Tob R , K R 

Gene profile 

(i) + + – 6 (14) 

(ii) + – + 3 (7) 

(iii) + + + 1 (2.3) 

(iv) + – – 3 (7) 

Gen R , Tob S , K I + – – 1 (2.3) 

Gen I , Tob R , K I + + – 1 (2.3) 

Total 15 8 4 43 

Overall total 45 (45) 31 (31) 21 (21) 100 (100) 

genes. The aac(6′)/aph(2′′) gene was the most dominant 

gene as reported in Europe, Korea, Japan and Middle 

East countries (Schmitz et al., 1999; Hauschild et al., 

2008; Choi et al., 2003; Nakaminami et al., 2008; Ardic et 

al., 2006; Fatholahzadeh et al., 2009) and in MSSA 

isolates in Korea (Choi et al., 2003). Detection of this 

gene in both MRSA and MSSA isolates in Jordan (Tables 

3 and 4) could be explained by the fact that it exists as a 

transposable genetic element (Tn4001) which is carried 

on different types of plasmids (Byrne et al., 1990; Udou, 

2004). The presumed horizontal transfer of this gene 

among MRSA and MSSA isolates in Jordan mediates 

resistance to gentamicin, tobramycin and kanamycin 

(Tables 3 and 4). 

The second prevalent AME gene was ant(4',4") and it 

was detected in 31% of S. aureus isolates (Tables 3 and 

4). Similarly, it was the second dominant gene detected 

in 26.7 to 48% of S. aureus isolates in Europe and Korea 

(Choi et al., 2003; Schmitz et al., 1999; Hauschild et al., 

Bdour 5263 

2008). In contrast, this gene was the least frequent AME 

gene (26%) among the Iranian MRSA isolates 

(Fatholahzadeh et al., 2009) and the most prevalent gene 

(84.5%) in MRSA isolated in Japan (Ida et al., 2001). In 

the present study, the prevalence of this gene in MRSA 

(40.3%) was 2 folds that in MSSA (18.6%) isolates 

(Tables 3) which is presumed to be due to the integration 

of pUB110 containing the ant (4', 4") gene in the mec 

element downstream of mecA gene (Ito et al., 1999; 

Chambers, 1997). However, mec elements lacking this 

plasmid have been described (Oliveira et al., 2000) which 

could explain the absence of this gene in our remaining 

tobramycin and kanamycin-resistant MRSA isolates and 

all MRSA isolates in Turkey (Ardic et al., 2006). In 

Jordan, the concordance between tobramycin and 

kanamycin resistance and the presence of this gene in 

MRSA isolates and in MSSA isolates (Table 3) was 

higher than that in the Korean isolates (45%) (Choi et al. 

2003) and lower than that in the Polish isolates (100%),


(Hauschild et al., 2008). 

The third prevalent AME gene was the aph(3')III gene. 

Detection of this gene among MRSA and MSSA isolates 

could be due to its existence on a transposable genetic 

element (Tn5405) (Derbise et al., 1996) which can be 

disseminated among the isolates. This gene was also the 

third frequently encountered AME gene in MRSA and 

MSSA isolates of Korea (Choi et al., 2003), Japan (Ida et 

al., 2001) and European countries (Schmitz et al., 1999; 

Hauschild et al., 2008). In contrast, this gene was the 

second prevalent AME gene in Iranian MRSA (71%) 

isolates (Fatholahzadeh et al., 2009), while all Turkish 

MRSA isolates were negative for this gene (Ardic et al., 

2006). The concordance between kanamycin resistance 

(K R ) and the presence of this gene was 51.6% in K R - 

MRSA and 30.7% in K R -MSSA isolates (Table 3) 

compared to 45% in the Korean (Choi et al., 2003) and 

100% in the Iranian MRSA (Fatholahzadeh et al., 2009) 

isolates. 

A total of 41% of the S. aureus isolates carried the 

aac(6′)/aph(2′′) gene in combination with either ant(4',4") 

and/or aph(3′)III or carried ant(4',4") in combination with 

aph(3′)III only (Table 4). In Korea, 50% of the S. aureus 

isolates carried the aac(6′)/aph(2′′) gene in combination 

with either ant(4',4") and/or aph(3′)III (Choi et al., 2003). 

In the present study, the most frequent combination of 

genes was aac(6′)/aph(2′′) with ant(4', 4") (Table 4) which 

is similar to that detected in Korea (Choi et al., 2003). 

The coexistence of these genes could be due to the fact 

that the ant(4', 4") gene is also carried next to the 

aac(6')/aph(2") gene on some plasmids (Byrne et al., 

1990). The second dominant AME gene combination was 

aac(6')/aph(2") with aph(3')III (Table 4) which could be 

due to harboring the transposons Tn4001 (Byrne et al., 

1990) and Tn5405 (Debrise et al., 1996). The ant(4',4") 

and aph(3′)III combination coexisted only in 4/57 (7%) 

MRSA which could harbor the integrated copy of pUB110 

carrying ant(4',4") (Ito et al., 1999; Chambers, 1997) and 

Tn405 carrying aph(3′)III (Debrise et al., 1996). The 3 

genes coexisted only in 3/57 (5.3%) MRSA and in 1/43 

(2.3%) MSSA isolates which were highly resistant to the 

3 tested aminoglycosides. 

There is a concordance between the AME gene 

combinations and the phenotypic multi-resistance of S. 

aureus isolates to 2 and 3 aminoglycosides (Tables 2 and 

4). Multi-resistance to three aminoglycosides (Gen R , 

Tob R , K R ) was observed in 26/57 (45.6%) MRSA and in 

13/43 (30.2%) MSSA isolates (Table 2) with four 

heterogenous AME gene profiles (i to iv) (Table 4). In 

these profiles, the aac(6')/aph(2") and ant(4',4") gene 

combination was predominant followed by aac(6')/aph(2") 

and aph(3')III combination. In contrast, the aac(6')/aph(2") 

and aph(3')III combination was dominant over the 

aac(6')/aph(2") and ant(4',4") gene combination in Iran 

(Fatholahzadeh et al., 2009). However, multi-resistance 

to two aminoglycosides was detected only in 7/57 

(12.3%) MRSA isolates (Tables 2 and 4) harboring the 

aac(6')/aph(2") gene only, the aph(3')III and ant(4',4") 

combination, and the aac(6")/aph(2") and aph(3')III 

combination. 

Four (7%) MRSA and two (4.6%) MSSA isolates 

demonstrated resistance to one of the aminoglycosides 

tested and most harbored the ant(4', 4") gene (Table 4). 

The finding of at least one AME gene is important in 

terms of showing the possibility of spreading of other 

AME genes to the aminoglycoside sensitive MRSA (35%) 

and MSSA (65%) isolates (Table 4). The speed of 

resistance development in these isolates could be linked 

to the absence of national antimicrobial use guidelines 

and regulations which control the community use of 

antibacterial drugs in Jordan. These drugs are dispensed 

with and without a prescription, either via self-medication 

or pharmacist recommendation (Al-Bakri et al., 2005). 

In conclusion, a high prevalence (52%) of aminoglycoside 

resistance was determined in the clinical S. 

aureus due to the presence of 1 to 3 AME genes. 

Emerging of MRSA isolates with heterogenous AME 

gene profiles, especially those which harbor the 3 types 

of AME genes, must not be ignored because it limits the 

choices in the number of aminoglycosides available to 

clinicians to treat staphylococcal infections in risk patients 

with either a β-lactam or a glycopeptide. Irrational use of 

antibiotics is likely behind the selection of these isolates 

in Jordan. There is a need to force regulations to control 

the use of antibiotics which could lead to parallel changes 

in resistance patterns and may favor the emergence of 

aminoglycosides susceptible-MRSA strains as reported in 

other countries (Mangeney et al., 2002). Therefore, 

periodic surveillance of aminoglycoside resistance and of 

the corresponding genes is recommended. 


We gratefully thank Mr Ahmed Abu-Mizer and Mr Ahmed 

Abu-Jafal for their technical assistance. The research 

was made possible by a grant from the Deanship of 

Scientific Research, University of Jordan. 

REFERENCES 

Al-Bakri AG, Bustanji Y, Yousef M (2005). Community consumption of 

antibacterial drugs within the Jordanian population: sources, patterns 

and appropriateness. Int. J. Antimicrob. Agents, 26: 389-395. 

Al-Zu’bi E, Bdour S, Shehabi AA (2004). Antibiotic resistance patterns 

of mecA-positive Staphylococcus aureus isolates from clinical 

specimens and nasal carriage. Microbial Drug Resistance, 10: 321- 

324. 

Ardic N, Sareyyupoglu B, Ozyurt M, Haznedaroglu T, Ilga U (2006). 

Investigation of aminoglycoside modifying enzyme genes in 

methicillin-resistant staphylococci. Microbiol. Res., 161: 49-54. 

Baddour LM, Wilson WR, Bayer AS, Fowler VG Jr, Bolger AF, Levison 

ME, Ferrieri P, Gerber MA, Tani LY, Gewitz MH, Tong DC, 

Steckelberg JM, Baltimore RS, Shulman ST, Burns JC, Falace DA, 

Newburger JW, Pallasch TJ, Takahashi M, Taubert KA (2005). 

Infective endocarditis: diagnosis, antimicrobial therapy, and 

management of complications: a statement for healthcare 

professionals from the Committee on Rheumatic Fever, Endocarditis, 

and Kawasaki Disease, Council on Cardiovascular Disease in the

Young, and the Councils on Clinical Cardiology, Stroke, and 

Cardiovascular Surgery and Anesthesia, American Heart Association: 

endorsed by the Infectious Diseases Society of America. Circulation, 

11: e394-434. 

Byrne ME, Gillespie MT, Skurray RA (1990). Molecular analysis of a 

gentamicin resistance transposon like element on plasmids isolated 

from North American Staphylococcus aureus strains. Antimicrob. 


Chambers HF (1997). Methicillin resistance in staphylococci: molecular 

and biochemical basis and clinical implications. Clin. Microbiol. Rev., 

10: 781-791. 

Choi SM, Kim SH, Kim HJ, Lee DG, Choi JH, Yoo JH, Kang JH, Shin 

WS, Kang MW (2003). Multiplex PCR for the Detection of Genes 

Encoding Aminoglycoside Modifying Enzymes and Methicillin 

Resistance among Staphylococcus species. J. Korean Med. Sci., 18: 

631-636. 

Cosgrove SE, Vigliani GA, Campion M, Fowler VG, Corey G, Abrutyn E, 

Levine DP, Rupp E, Chambers HF, Karchmer AW, Boucher HW 

(2009). Initial low-dose gentamicin for S. aureus bacteremia and 

endocarditis is nephrotoxic. Clin. Infect. Dis., 48: 713-721. 

Derbise A, Dyke KGH, El Solh N (1996). Characterization of a 

Staphylococcus aureus transposon, Tn5405, Located within Tn5404 

and carrying the aminoglycoside resistance genes, aphA-3 and aadE. 

Plasmid, 35: 174-188. 

Fatholahzadeh B, Emaneini M, Feizabadi MM, Sedaghat H, Aligholi M, 

Taherikalani M, Jabalameli F (2009). Characterisation of genes 

encoding aminoglycoside-modifying enzymes among meticillinresistant 

Staphylococcus aureus isolated from two hospitals in 

Tehran, Iran. Int. J. Antimicrob. Agents, 33: 264-265. 

Hauschild T, Sacha P, Wieczorek P, Zalewska M, Kaczyñska K, 

Tryniszewska E (2008). Aminoglycosides resistance in clinical 

isolates of Staphylococcus aureus from a University Hospital in 

Bialystok, Poland. Folia Histochem. Cytobiol., 46: 225-228. 

Ida T, Okamoto R, Shimauchi C, Okubo T, Kuga A, Inoue M (2001). 

Identification of aminoglycoside-modifying enzymes by susceptibility 

testing: Epidemiology of methicillin-resistant Staphylococcus aureus 

in Japan. J. Clin. Microbiol., 39: 3115-3121. 

Ito T, Katayama Y, Hiramatsu K (1999). Cloning and nucleotide 

sequence determination of the entire mec DNA of pre-methicillinresistant 

Staphylococcus aureus N315. Antimicrob. Agents 

Chemother., 43: 1449-1458. 

Johnson RA, Bhattacharyya GK (1996). Statistics Principles and 

Methods. 3 rd Edition. John Wiley and Sons, Inc. New York. 

Kim SW, Lee DG, Choi SM, Park C, Kwon JC, Kim SH, Park SH, Choi 

JH, Yoo JH, Shin WS (2010). Once-Daily Gentamicin Administration 

for Community-Associated Methicillin Resistant Staphylococcus 

aureus in an in vitro Pharmacodynamic Model: Preliminary Reports 

for the Advantages for Optimizing Pharmacodynamic Index. Yonsei 

Med. J., 51: 722-727. 

Klein E, Smith DL, Laxminarayan R (2007). Hospitalizations and 

Deaths Caused by Methicillin-Resistant Staphylococcus aureus, 

United States, 1999-2005. Emerging Infect. Dis., 13: 1840-1846. 

Kluytmans-Vanden Bergh MFQ, Kluytmans JAJW (2006). Communityacquired 

methicillin-resistant Staphylococcus aureus: current 

perspectives. Clin. Microbiol. Infect., 12: 9-15. 

Konno M (1995). Nosocomial infections caused by methicillin–resistant 

Staphylococcus aureus in Japan. J. Infect. Chemother., 1: 30-39. 

Bdour 5265 

Liakopoulos A, Foka A, Vourli S, Zerva L, Tsiapara F, Protonotariou E, 

Dailiana Z, Economou M, Papoutsidou E, Koutsia-Carouzou C, 

Anastassiou ED, Diza E, Zintzaras E, Spiliopoulou I, Petinaki E 

(2011). Aminoglycoside-resistant staphylococci in Greece: 

prevalence and resistance mechanisms. Eur. J. Clin. Microbiol. 

Infect. Dis., 30: 701-705. 

Mangeney N, Drollee K, Cloitre V, Bordes M, Faubert E (2002). 

Comparative pulsed-field gel electrophoresis typing of gentamicinresistant 

and -susceptible methicillin-resistant Staphylococcus aureus 

strains isolated in France between 1991 and 1998. Changes in 

antibiotic susceptibility. J. Hosp. Infect., 51: 262-268. 

Nakaminami H, Noguchi N, Ikeda M, Hasui M, Sato M, Yamamoto S, 

Yoshida T, Asano T, Senoue M, Sasatsu M (2008). Molecular 

epidemiology and antimicrobial susceptibilities of 273 exfoliative 

toxin-encoding gene-positive Staphylococcus aureus isolates from 

patients with impetigo in Japan. J. Med. Microbiol., 57: 1251-1258. 

Nickerson EK, Hongsuwan M, Limmathurotsakul D, Wuthiekanun V, 

Shah KR, Srisomang P, Mahavanakul W, Wacharaprechasgul T, 

Fowler VG, West TE, Teerawatanasuk N, Becher H, White NJ, 

Chierakul W, Day NP, Peacock SJ (2009). Staphylococcus aureus 

bacteraemia in a tropical setting: patient outcome and impact of 

antibiotic resistance. PLoS ONE, 4: e4308. 

Oliveira DC, Wu SW, de Lencastre H (2000). Genetic organization of 

the downstream region of the mecA element in methicillin-resistant 

Staphylococcus aureus carrying different polymorphisms of this 

region. Antimicrob. Agents Chemother., 44: 1906-1910. 

Schmitz F, Fluit AC, Gondolf M, Beyrau R, Lindenlauf E, Verhoef J, 

Heinz HP, Jones ME (1999). The prevalence of aminoglycoside 

resistance and corresponding genes in clinical isolates of 

staphylococci from 19 European hospitals. J. Antimicrob. 

Chemother., 43: 253-259. 

Vakulenko SB, Mobashery S (2003). Versatility of Aminoglycosides and 

Prospects for Their Future. Clin. Microbiol. Rev., 16: 430-450. 

Van De Klundert J, Vliegenthart J (1993). PCR detection of genes 

coding for aminoglycoside-modifying enzymes. In: Persing et al 

(editors) Diagnostic Molecular Microbiology: Principles and 

Applications. AMS press, Washington, D.C., pp. 547-552. 

Udou T (2004). Dissemination of nosocomial multiple-aminoglycosideresistant 

Staphylococcus aureus caused by horizontal transfer of the 

resistance determinant (aacA/aphD) and clonal spread of resistant 

strains. Am. J. Infect. Control, 32: 215-219. 

Woods LG, Washington JA (1995). Antimicrobial susceptibility tests: 

Dilution and disk diffusion methods. In: Murray PR, Baron EJ, Pfaller 

MA, Tenover FC, Yolken RH (editors), Manual of Clinical 

Microbiology, 6 th ed. AMS press, Washington, D.C., pp. 1327-1341. 

Woodford N (2005). Biological counterstrike: antibiotic resistance 

mechanisms of Gram-positive cocci. Clin. Microbiol. Infect., 11: 2-21.



DOI: 10.5897/AJMR11.968 



Evaluating the effect of acetic acid, furfural and 

catechol on the growth and lipid accumulation of 

Trichosporon fermentans by response surface 

methodology 

Chao Huang 1, 3 , Peng Wen 1 , Hong Wu 1 *, Wen-yong Lou 2 and Min-hua Zong 2 * 

1 Laboratory of Applied Biocatalysis, College of Light Industry and Food Sciences, South China University of Technology, 

Guangzhou 510640, China. 

2 State Key Laboratory of Pulp and Paper Engineering, College of Light Industry and Food Sciences, South China 

University of Technology, Guangzhou 510640, China. 

3 Key Laboratory of Renewable Energy and Gas Hydrate, Guangzhou Institute of Energy Conversion, Chinese Academy 

of Sciences, Guangzhou 510640, China. 


The effect of combination of acetic acid, furfural and catechol on the growth and lipid accumulation of 

oleaginous yeast Trichosporon fermentans was systematically studied by response surface 

methodology (RSM). A 5-level 3-factor central composite design (CCD) was used to build the statistical 

model. The results measured by RSM showed that each inhibitor exhibited significant negative effect on 

the biomass, lipid content, lipid yield, and sugar consumption of T. fermentans. However, for the binary 

and ternary combinations of these compounds, only the binary combination of acetic acid and catechol 

showed significant effect, indicating there are no synergistic effects for these inhibitors in most cases. 

This work offers a simple way to evaluate the complex effect of various inhibitors on the growth and 

lipid accumulation of oleaginous microorganisms. 

Key words: Central composite design, Trichosporon fermentans, acetic acid, furfural, catechol. 

INTRODUCTION 

For a long time, microbial oils, namely single cell oils 

(SCOs), were used as medically important polyunsaturated 

fatty acids like γ-linolenic acid, or substitutes 

of lipid with rare fatty acid composition or structure such 

as cocoa-butter (Papanikolaou et al., 2003). Recently, 

they were also proved to be a promising feedstock for 

biodiesel production due to their similarity in fatty acid 

composition to that of vegetable oils (Li et al., 2008). 

Unfortunately, the high cost of fermentation substrate 

limits their practical application. Using inexpensive media, 

such as agro-industrial residues, especially lignocellulosic 

materials like rice straw, wheat straw, corncob, rice hull 

*Corresponding author. E-mail: bbhwu@scut.edu.cn. 

btmhzong@scut.edu.cn. Tel: +86-20-87111452. Fax: +86-20- 

22236669. 

and etc., for lipid fermentation is one of the possible 

resolutions to this problem (Chen et al., 2012; Economou 

et al., 2011; Huang et al., 2009; Huang et al., 2012; Yu et 

al., 2011). However, during the dilute acid-treatment of 

lignocellulosic biomass, various inhibitory by-products 

such as organic acids, aldehydes and alcohols were 

generated (Palmqvist and Hahn-Hagerdal, 2000). All 

these compounds might cause negative effects on 

growth, metabolism, as well as product formation of 

microorganism cells during fermentation (Almeida et al., 

2007). 

In order to use lignocellulosic hydrolysates efficiently as 

substrate for lipid fermentation, it is critical to have an 

overall knowledge on the inhibitory effect of these 

compounds present in it on the growth and lipid 

accumulation of oleaginous microorganisms. The effects 

of individual inhibitor and binary combination of inhibitors 

on the growth and lipid accumulation of different

oleaginous microorganisms have been studied by many 

works (Chen et al., 2009; Hu et al., 2009; Huang et al., 

2011; Huang et al., 2012; Zhang et al., 2011). However, 

the lignocellulosic hydrolysates generally contain more 

than one inhibitor and the synergistic effect of different 

inhibitors was complex (Duarte et al., 2005; Oliva et al., 

2006; Sampaio et al., 2007). To date, little work has 

focused on the combined effect of several inhibitors on 

oleaginous microorganisms. 

Response surface methodology (RSM) is a collection of 

certain statistical techniques for designing experiments, 

building models, evaluating the effect of the factors and 

searching for optimal conditions for desirable responses 

(Myers et al., 2009). 

Acetic acid, furfural, and catechol are three typical 

inhibitors which represent organic acid, aldehyde and 

alcohol, the three kinds of inhibitors present in dilute acidtreated 

lignocellulosic hydrolysates, respectively (Oliva et 

al., 2006). Oleaginous yeast Trichosporon fermentans 

has been shown to be a potential strain for microbial oil 

production on lignocellulosic hydrolysates (Huang et al., 

2009). In this work, the effect of combination of acetic 

acid, furfural, and catechol on the growth and lipid 

accumulation of T. fermentans were systematically 

investigated by RSM. 


Microorganism and chemicals 

The oleaginous yeast T. fermentans CICC 1368 was obtained from 

the China Center of Industrial Culture Collection and kept on wort 

agar at 4°C. Furfural was purchased from Sigma (USA). Catechol 

was purchased from Alfa Aesar (UK). Acetic acid and other 

chemical compounds were from commercial source and were of the 

highest purity available. 

Medium, precultivation and cultivation 

The precultivation medium (pH 6.0) contained glucose and xylose 

(ratio 2:1) 20 g/l, peptone 10 g/l, yeast extract 10 g/l. And the 

fermentation medium (pH 6.5) contained glucose and xylose (ratio 

2:1) 100 g/l, peptone 1.8 g/l, yeast extract 0.5 g/l, MgSO4·7H2O 0.4 

g/l, KH2PO4 2.0 g/l, MnSO4·H2O 0.003 g/l, CuSO4·5H2O 0.0001 g/l. 

The preculture was performed in a 250 ml conical flask 

containing 50 ml precultivation medium at 28°C for 24 h in a rotary 

shaker (160 rpm). Seed culture (2.5 ml) was then inoculated to a 

250 ml conical flask containing 47.5 ml fermentation medium and 

the cultivation was carried out at 25°C for 7 days in a rotary shaker 

(160 rpm). 

Effects of inhibitors on growth and lipid accumulation 

Seed culture (2.5 ml) prepared on the precultivation medium as 

described above, was inoculated into 47.5 ml of fermentation 

medium containing the selected inhibitors. Without adding the 

tested inhibitor, the biomass, lipid content, lipid yield, and sugar 

consumption of T. fermentans after 7 days’ fermentation were 24.0 

g/l, 61.7%, 14.8 g/l and 84.3 g/l, respectively. All reported data were 

averages of experiments performed at least in triplicate. 

Experimental design and statistical analysis 

Huang et al. 5267 

A 5-level 3-factor central composite design (CCD) was adopted to 

evaluate the effects of acetic acid (X1), furfural (X2), and catechol 

(X3) on the growth and lipid accumulation of T. fermentans on a 

fermentation medium mentioned above and then a model was 

developed. The highest concentration of these three compounds 

was about 2-fold greater than the highest concentration that they 

could be in the common lignocellulosic hydrolysates (Almeida et al., 

2007). In this study, the experimental plan contained 20 trials and 

the independent variables were studied at five different levels, 

whose values were shown in Table 1. 

The fermentation performance was evaluated by using the 

following fermentation parameters (response Y): biomass (g/l), lipid 

content (%), lipid yield (g/l), and sugar consumption (g/l). The 

experimental design used in this work was shown in Table 1. The 

response variable was fitted by a second-order model in order to 

correlate the response variables to the independent variables. The 

second order polynomial coefficients were calculated and analyzed 

using the “Design Expert” software (Version 7.0, Stat-Ease Inc., 

Minneapolis, USA). The general form of the second-degree 

polynomial equation is: 

Y = b+ b1X1 + b2X2 + b3X3 + b12X1X2 + b13X1X3 + b23X2X3 + b11X1 2 + 

b22X2 2 + b33X3 2 + b123X1X2X3 + e (1) 

where Y is the predicted response (biomass, lipid content, lipid 

yield, and sugar consumption); b stands for offset term; X1, X2 and 

X3 represent the concentrations (g/l) of factors 1, 2, and 3, 

respectively; b1, b2, and b3 are the coefficients of linear effects; b11, 

b22 and b33 refer to the coefficients for the quadratic effects; b12, b13 

and b23 are the coefficients for the interactions of factors 1 and 2, 1 

and 3, and 2 and 3, respectively; and b123 is the coefficient for the 

interaction of factors 1, 2 and 3. 

Statistical analysis of the model was performed to evaluate the 

analysis of variance (ANOVA). This analysis included Fisher’s Ftest 

(overall model significance), it’s associated probability p(F), 

correlation coefficient R, determination coefficient R 2 , which 

measures the goodness of fit of regression model. For each 

variable, the quadratic models were represented as contour plots 

(3D) and response surface curves were generated using the Design 

Expert software. 

Analytical methods 

Biomass was harvested by centrifugation and its weight was 

determined in its lyophilized form. Lipid was extracted with a 

mixture of chloroform: methanol (2:1, v/v) for 1 h. The extracted lipid 

was centrifuged to obtain a clear supernatant and the solvent was 

removed by evaporation under vacuum at 55°C and 100 rpm (NE- 

Series rotary evaporator EYELA, Japan). Lipid yield is expressed 

as the amount of lipid extracted from the cells in per liter 

fermentation broth (g/l) and lipid content is defined as the 

percentage of lipid to dry biomass (%, w/w). 

Sugars were measured by High-performance liquid chromatography 

(HPLC) (Waters Corp., USA) with a RI detector (Waters 

2410) and an Aminex HPX-87P column (300 × 7.8 mm, Bio Rad 

Corp., USA) at 85°C. Deionized water was used as the mobile 

phase at 0.5 mL/min. 


After lipid fermentation, the actual values and the 

predicted values of responses were summarized in Table 

2. As shown in Table 2, the values for biomass (g/l), lipid


Table 1. Central composite design arrangement. 

Design point 

Code independent variable level Factors’ concentration 

A B C Acetic acid (g/l) Furfural (g/l) Catechol (g/l) 

1 -1 -1 -1 2 0.2 0.16 

2 1 -1 -1 8 0.2 0.16 

3 -1 1 -1 2 0.8 0.16 

4 1 1 -1 8 0.8 0.16 

5 -1 -1 1 2 0.2 0.64 

6 1 -1 1 8 0.2 0.64 

7 -1 1 1 2 0.8 0.64 

8 1 1 1 8 0.8 0.64 

9 -1.682 0 0 0 0.5 0.4 

10 1.682 0 0 10 0.5 0.4 

11 0 -1.682 0 5 0 0.4 

12 0 1.682 0 5 1 0.4 

13 0 0 -1.682 5 0.5 0 

14 0 0 1.682 5 0.5 0.8 

15 0 0 0 5 0.5 0.4 

16 0 0 0 5 0.5 0.4 

17 0 0 0 5 0.5 0.4 

18 0 0 0 5 0.5 0.4 

19 0 0 0 5 0.5 0.4 

20 0 0 0 5 0.5 0.4 

21 (Control) -1.682 -1.682 -1.682 0 0 0 

content (%, w/w), lipid yield (g/l), and sugar consumption 

(g/l), obtained in the fermentation experiments, varied 

with different concentrations of inhibitors. The coefficients 

of Equation 1 were calculated using regression analysis 

from the experimental results shown in Table 2. The 

values of R 2 for biomass, lipid content, lipid yield, and 

sugar consumption were 0.9904, 0.9633, 0.9826 and 

0.9843, respectively, showing a good model fit. 

Effect of combination of acetic acid, furfural and 

catechol on the biomass of T. fermentans 

The effect of combination of acetic acid, furfural and 

catechol on the biomass of T. fermentans was shown in 

Table 3. Base on these data, the resulting equation, 

which predicts the biomass in the linear regression model 

(1), is expressed as follows: 

Biomass=11.40-3.72*A-3.90*B-2.72*C-0.34*A*B+2.28*A* 

C-0.45*B*C-0.52*A 2 -1.75*B 2 -0.45*C 2 +0.37*A*B*C (2) 

As can be seen in Table 3, each inhibitor showed great 

negative effect on the biomass of T. fermentans. The 

inhibitory effect of acetic acid, furfural, and catechol on 

the growth of different microorganisms has been well 

known in many works (Palmqvist and Hahn-Hagerdal, 

2000) and the results in Table 3 further supported this. 

Interestingly, the effect of individual inhibitor on the 

growth of T. fermentans was more significant than the 

effect of binary or ternary combination of these compounds, 

indicating that no obvious synergistic inhibitory 

effect existed for these inhibitors. This was in contrast 

with the phenomenon observed in ethanologenic yeasts 

that the compounds mentioned above usually have 

strong synergetic effect on their growth (Palmqvist and 

Hahn-Hagerdal, 2000). 

It is worth noting that the binary interaction of furfural 

and other two compounds (AB and BC in Table 3) did not 

show statistically significant effects despite that the 

coefficients of AB and BC were negative. This means that 

the simultaneous presence of furfural and acetic acid or 

catechol in the lignocellulosic hydrolysates might affect 

little on the growth of T. fermentans. Surprisingly, the 

binary combination of acetic acid and catechol exhibited 

certain stimulated effect on the growth of T. femrentans 

and the P value showed this effect was significant, 

suggesting the inhibition was relieved in the case of 

binary combination of these two compounds. Similarly, 

the effect of ternary combination of these three 

compounds on the biomass of T. fermentans was 

positive, indicating no synergistic inhibitory effect was 

occurred. The three-dimensional response surface plots 

are shown in Figure 1. Despite that the P-value of AC 

was less than 0.0001, the relative flat surface and parallel 

contour lines reflected that the binary interaction among

Table 2. Actual and predicted value of different responses. 

Run 


Biomass (g/l) Lipid content (%) Lipid yield (g/l) Sugar consumption (g/l) 

Actual Predicted Actual Predicted Actual Predicted Actual Predicted 

1 19.1 20.2 51.9 65.2 9.9 11.2 65.6 68.2 

2 9.4 9.5 42.0 40.1 3.9 3.9 30.3 32.7 

3 14.6 14.7 44.6 45.9 6.5 7.0 46.3 48.8 

4 0.4 1.2 2.7 5.7 0.01 0.5 9.1 11.4 

5 12.7 11.8 39.9 38.9 5.1 4.8 41.8 43.0 

6 9.1 8.8 37.4 38.2 3.4 3.1 26.0 27.0 

7 3.3 3.0 9.0 13.0 0.3 0.5 21.1 22.3 

8 0.2 0.2 1.5 3.0 0.003 -0.2 6.5 7.5 

9 15.7 16.2 52.1 48.5 8.2 7.7 63.2 60.4 

10 3.9 3.7 16.3 16.8 0.6 0.9 19.4 17.1 

11 12.5 13.0 46.7 47.1 5.8 6.0 42.7 40.1 

12 0.2 -0.1 2.2 -1.1 0.004 -0.4 8.5 6.1 

13 15.4 14.7 57.0 54.7 8.6 7.8 54.2 50.1 

14 4.6 5.6 28.6 28.0 1.3 1.8 25.3 24.4 

15 11.8 11.4 49.8 48.8 5.9 5.7 41.3 39.6 

16 11.4 11.4 49.5 48.8 5.7 5.7 38.3 39.6 

17 10.6 11.4 48.8 48.8 5.2 5.7 35.7 39.6 

18 11.6 11.4 48.9 48.8 5.7 5.7 37.0 39.6 

19 12.7 11.4 51.8 48.8 6.6 5.7 44.1 39.6 

20 11.1 11.4 51.8 48.8 5.8 5.7 40.3 39.6 

21 24.0 23.6 61.7 57.2 14.8 14.5 84.3 84.3 

Table 3. Analysis of variance (ANOVA) for the quadratic model of biomass. 

Source 

Sum of 

Squares 

DF 

Source 

Source 

F-Value P-value 

Coefficient 

estimate 

Model 772.88 10 77.29 110.02 < 0.0001 11.40 

A-Acetic acid 192.98 1 192.98 274.70 < 0.0001 -3.69 

B-Furfural 209.25 1 209.25 297.86 < 0.0001 -3.87 

C-Catechol 105.37 1 105.37 149.99 < 0.0001 -2.74 

AB 0.82 1 0.82 1.16 0.3063 -0.30 

AC 45.53 1 45.53 64.81 < 0.0001 2.22 

BC 2.30 1 2.30 3.28 0.1003 -0.50 

A2 4.04 1 4.04 5.75 0.0375 -0.51 

B2 46.00 1 46.00 65.48 < 0.0001 -1.74 

C2 2.98 1 2.98 4.24 0.0666 -0.44 

ABC 1.28 1 1.28 1.82 0.2067 0.33 

Residual 7.03 10 0.70 

Lack of Fit 4.51 5 0.90 1.80 0.2682 

Pure Error 2.51 5 0.50 

Total 779.90 20 

R 2 =0.9904; Adj. R 2 =0.9808. 

the inhibitory compounds showed little synergetic effect 

on the growth of T. fermentans and thus might be 

beneficial for its lipid production on lignocellulosic 

hydrolysates. 

Effect of combination of acetic acid, furfural and 

catechol on the lipid accumulation of T. fermentans 

Besides the effect on the growth, inhibitors could also


Figure 1. Response surface plots showing binary interaction of different variables on the biomass of T. fermentans. Huang 

et al. (2012). 

affect the lipid accumulation of oleaginous yeasts (Hu et 

al., 2009; Huang et al., 2011). Similar to the effect of 

combination of acetic acid, furfural and catechol on the 

biomass, the effect of individual inhibitor on the lipid 

content of T. fermentans was also more significant than 

the binary or ternary combination of them (as depicted by 

their P-value in Table 4). Among these three inhibitors, 

furfural (with the highest F-value) showed the most 

significant effect on the lipid content of T. fermentans and 

the effect of catechol was the least (as indicated by its 

lowest F-value). Also, in the binary combination of the 

inhibitors, the interaction effect between acetic acid and 

catechol was significant (P-value

Table 4. Analysis of variance (ANOVA) for the quadratic model of lipid content. 

Source 

Sum of 

Squares 

DF Mean square F-Value P-value 


Coefficient 

estimate 

Model 7322.35 10 732.24 26.25 < 0.0001 

A-Acetic acid 1257.13 1 1257.13 45.07 < 0.0001 -9.43 

B-Furfural 2877.17 1 2877.17 103.15 < 0.0001 -14.34 

C-Catechol 887.19 1 887.19 31.81 0.0002 -7.96 

AB 83.98 1 83.98 3.01 0.1134 -3.02 

AC 418.16 1 418.16 14.99 0.0031 6.74 

BC 7.90 1 7.90 0.28 0.6062 -0.93 

A2 499.69 1 499.69 17.91 0.0017 -5.71 

B2 1270.63 1 1270.63 45.55 < 0.0001 -9.13 

C2 106.61 1 106.61 3.82 0.0791 -2.65 

ABC 6.20 1 6.20 0.22 0.6476 0.72 

Residual 278.94 10 27.89 

Lack of Fit 269.58 5 53.92 28.80 0.0011 

Pure Error 9.36 5 1.87 

Total 7601.29 20 

R 2 =0.9633; Adj. R 2 =0.9266. 

biomass and lipid content, the effect of individual inhibitor 

was negative to the lipid yield of T. fermentans, and the 

effect was of high significant (P-value


Figure 2. Response surface plots showing binary interaction of different variables on the lipid content of T. fermentans. 

Huang et al. (2012). 

Table 5. Analysis of variance (ANOVA) for the quadratic model of lipid yield. 

Source 

Sum of 

Squares 

DF 

Mean 

square 


Coefficient 

estimate 

Model 279.83 10 27.98 56.45 < 0.0001 5.72 

A-Acetic acid 58.02 1 58.02 117.03 < 0.0001 -2.03 

B-Furfural 49.92 1 49.92 100.69 < 0.0001 -1.89 

C-Catechol 44.46 1 44.46 89.68 < 0.0001 -1.78 

AB 0.48 1 0.48 0.96 0.3491 0.23 

AC 18.42 1 18.42 37.16 0.0001 1.41 

BC 0.00 1 0.00 0.00 0.9880 0.00 

A2 4.04 1 4.04 8.16 0.0171 -0.51 

B2 16.52 1 16.52 33.32 0.0002 -1.04 

C2 1.53 1 1.53 3.09 0.1091 -0.32 

ABC 0.02 1 0.02 0.04 0.8427 0.04 

Residual 4.96 10 0.50 

Lack of Fit 3.93 5 0.79 3.82 0.0838 

Pure Error 1.03 5 0.21 

Total 284.79 20 

R 2 = 0.9826; Adj. R 2 =0.9652.


Figure 3. Response surface plots showing binary interaction of different variables on the lipid yield of T. fermentans. Huang et al. 

(2012). 

Table 6. Analysis of variance (ANOVA) for the quadratic model of sugar consumption. 

Source 

Sum of 

Squares 

DF 

Mean 

square 


Coefficient 

estimate 

Model 7528.43 10 752.84 62.85 < 0.0001 

A-Acetic acid 2339.38 1 2339.38 195.29 < 0.0001 -12.86 

B-Furfural 1434.22 1 1434.22 119.73 < 0.0001 -10.12 

C-Catechol 820.01 1 820.01 68.45 < 0.0001 -7.65 

AB 0.06 1 0.06 0.00 0.9452 -0.08 

AC 250.91 1 250.91 20.95 0.0010 5.22 

BC 0.02 1 0.02 0.00 0.9703 0.04 

A2 1.42 1 1.42 0.12 0.7380 -0.30 

B2 519.26 1 519.26 43.35 < 0.0001 -5.84 

C2 10.64 1 10.64 0.89 0.3681 -0.84 

ABC 1.68 1 1.68 0.14 0.7156 0.37 

Residual 119.79 10 11.98 

Lack of Fit 72.64 5 14.53 1.54 0.3235 

Pure Error 47.16 5 9.43 

Total 7648.22 20 

R 2 = 0.9843; Adj. R 2 =0.9687.


Figure 4. Response surface plots showing binary interaction of different variables on the sugar consumption of T. fermentans. 

Huang et al. (2012). 

expressed as: 

Sugar consumption = 39.60-12.86* A -10.12 * B-7.65 * C- 

0.080 * A * B+5.22 * A * C+0.044 * B * C-0.30 * A 2 - 

5.84*B 2 -0.84* C 2 +0.37 * A * B * C (5) 

The three-dimensional response surface plots of 

responses were depicted in Figure 4. All these curves 

were similar to that in Figure 1. The flat response 

surfaces indicated the interaction effect among different 

inhibitors on the sugar consumption of T. fermentans was 

less significant than their individual effect. 

Conclusions 

The inhibitory laws of these inhibitors (acetic acid, 

furfural, and catechol) including their individual, binary, 

and ternary combinations on the biomass, lipid content, 

lipid yield and sugar consumption of T. fermentans are 

similar. There was little synergistic inhibition on the 

growth, lipid accumulation, and sugar metabolism of T. 

fermentans among these typical inhibitors. These results 

show that the complex effect of combination of many 

inhibitors on the growth and lipid accumulation of 

oleaginous microorganisms could be evaluated in a 

relatively simple way by RSM. 


Authors acknowledge the National Natural Science 

Foundation of China (Grant Nos. 31071559 and 

21072065), the New Century Excellent Talents in 

University (Grant Nos. NCET-11-0161 and NCET-10- 

0367), the Open Project Program of the State Key 

Laboratory of Pulp and Paper Engineering, SCUT (Grant 

No. 201138), and the Fundamental Research Funds for

the Central Universities (Grant No. 2012ZP0009) for 

financial support. 

REFERENCES 

Almeida J, Modig T, Petersson A, Hahn-Hagerdal B, Liden G, Gorwa- 

Grauslund M (2007). Increased tolerance and conversion of inhibitors 

in lignocellulosic hydrolysates by Saccharomyces cerevisiae. J. 

Chem. Technol. Biotechnol., 82: 340-349. 

Chen XF, Huang C, Xiong L, Chen XD, Ma LL (2012). Microbial oil 

production from corncob acid hydrolysate by Trichosporon cutaneum. 

Biotechnol. Lett., 34: 1025-1028. 

Chen X, Li Z, Zhang X, Hu F, Ryu D, Bao J (2009). Screening of 

oleaginous yeast strains tolerant to lignocellulose degradation 

compounds. Appl. Biochem. Biotechnol., 159: 1-14. 

Duarte LC, Carvalheiro F, Neves I, Girio FM (2005). Effects of aliphatic 

acids, furfural, and phenolic compounds on Debaryomyces hansenii 

CCMI 941. Appl. Biochem. Biotechnol., 121: 413-425. 

Economou CN, Aggelis G, Pavlou S, Vayenas D (2011). Single cell oil 

production from rice hulls hydrolysate. Bioresour. Technol., 102: 

9737-9742. 

Hu C, Zhao X, Zhao J, Wu S, Zhao Z (2009). Effects of biomass 

hydrolysis by-products on oleaginous yeast Rhodosporidium 

toruloides. Bioresour. Technol., 100: 4843-4847. 

Huang C, Chen XF, Xiong L, Chen XD, Ma LL (2012). Oil production by 

the yeast Trichosporon dermatis cultured in enzymatic hydrolysates 

of corncobs. Bioresour. Technol., 110: 711-714. 

Huang C, Wu H, Liu QP, Li YY, Zong MH (2011). Effects of aldehydes 

on the growth and lipid accumulation of oleaginous yeast 

Trichosporon fermentans. J. Agric. Food Chem., 59: 4606-4613. 

Huang C, Wu H, Liu ZJ, Cai J, Lou Wy, Zong MH (2012). Effect of 

organic acids on the growth and lipid accumulation of oleaginous 

yeast Trichosporon fermentans. Biotechnol. Biofuels, 5: 4. 

Huang C, Zong MH, Wu H, Liu QP (2009). Microbial oil production from 

rice straw hydrolysate by Trichosporon fermentans. Bioresour. 

Technol., 100: 4535-4538. 


Li Q, Du W, Liu DH (2008). Perspectives of microbial oils for biodiesel 

production. Appl. Microbiol. Biotechnol., 80: 749-756. 

Myers R, Montgomery D, Anderson-Cook C (2009). Response Surface 

Methodology: Product and Process Optimization Using Designed 

Experiments. John Wiley & Sons, New York. 

Oliva J, Negro M, Sáez F, Ballesteros I, Manzanares P, González A, 

Ballesteros M (2006). Effects of acetic acid, furfural and catechol 

combinations on ethanol fermentation of Kluyveromyces marxianus. 

Process Biochem., 41: 1223-1228. 

Palmqvist E, Hahn-Hagerdal B (2000). Fermentation of lignocellulosic 

hydrolysates. II: inhibitors and mechanisms of inhibition. Bioresour. 

Technol., 74: 25-33. 

Papanikolaou S, Muniglia L, Chevalot I, Aggelis G, Marc I (2003). 

Accumulation of a cocoa-butter-like lipid by Yarrowia lipolytica 

cultivated on agro-industrial residues. Curr. Microbiol., 46: 124-130. 

Ratledge C (2004). Fatty acid biosynthesis in microorganisms being 

used for single cell oil production. Biochimie, 86: 807-815. 

Sampaio FC, Torre P, Passos FML, De Moraes CA, Perego P, Converti 

A (2007). Influence of inhibitory compounds and minor sugars on 

xylitol production by Debaryomyces hansenii. Appl. Biochem. 

Biotechnol., 136: 165-181. 

Yu X, Zheng Y, Dorgan KM, Chen S (2011). Oil production by 

oleaginous yeasts using the hydrolysate from pretreatment of wheat 

straw with dilute sulfuric acid. Bioresour. Technol., 102: 6134-6140. 

Zhang G, French WT, Hernandez R, Alley E, Paraschivescu M (2011). 

Effects of furfural and acetic acid on growth and lipid production from 

glucose and xylose by Rhodotorula glutinis. Biomass Bioenergy, 35: 

734-740.



DOI: 10.5897/AJMR12.1229 



Purification and characterization of Aspergillus niger 

α-L-rhamnosidase for the biotransformation of naringin 

to prunin 

Hui Ni 1,2,4 , An Feng Xiao 1,3 , Hui Nong Cai 1,3,4 *, Feng Chen 2 , Qi You 2 and Yun Zheng Lu 1 

1 College of Bioengineering, Jimei University, Fujian Province, People’s Republic of China. 

2 Department of Food, Nutrition and packaging Science, Clemson University, Clemson, SC 29634, USA. 

3 The Research Center of Food Biotechnology, Xiamen, Fujian 361021, China. 

4 Research Center of Food Microbiology and Enzyme Engineering Technology of Fujian Province, Fujian 361021, China. 


An α-L-rhamnosidase, which was extracted from the fermented broth of Aspergillus niger was purified, 

characterized and confirmed via biotransformation of naringin to prunin. After being purified to 

homogeneity by ammonium sulphate fractionation and chromatography on diethylaminoethanol (DEAE) 

Sepharose and Sephacryl S-200 HR columns, the enzyme was determined by the exclusive gel 

chromatography and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE) to have a 

molecular weight of approximately 87 kDa. Its optimal pH and stable pH values were within the range of 

4.5 to 5 and 3.5 to 7.5, respectively while its optimal temperature was in 50 to 60°C. In addition, the 

enzyme was strongly inhibited by Fe 2+ , Fe 3+ , Zn 2+ , Al 3+ , Mn 2+ , Cu 2+ , Ag + , Hg 2+ ions and sodium dodecyl 

sulfate (SDS) and slightly activated by K + and Ba 2+ ions. Its Km towards naringin was 0.27 mM and the 

Vmax was 9805.15 U/mg. The enzyme could efficiently convert naringin to prunin with a transforming rate 

above 97%. These results indicate that the α-L-rhamnosidase separated from A. niger could be a 

promising candidate for its commercial application in food and pharmaceutical industries. 

Key words: Aspergillus niger, α-L-rhamnosidase, naringinase, naringin, pruning, transformation. 

INTRODUCTION 

Naringin (4′,5,7′-trihydroxyflavanone-7-rhamnoglucoside) 

and naringenin (4′,5,7′-trihydroxyflavanone) are two 

flavonoids, which possess strong anti-inflammatory, 

antiulcer, anticancer and antioxidative activities (Parmar, 

1983; Chen et al., 1990; Martin et al., 1994; Gordon et al., 

1995; So et al., 1996; Heim et al., 2002; Calgarotto et al., 

2007; Ekambaram et al., 2008). However, they also have 

some undesirable properties. For example, naringin has 

an intense bitter taste with a low bitter taste threshold of 20 

μg/ml (Ribeiro and Ribeiro, 2008). Naringenin hardly 

dissolve in water (Tommasini et al., 2004). 

Prunin (4′,5,7′-trihydroxyflavanone-7-β-D-glucoside) is a 

*Corresponding author. E-mail: nihui1973@yahoo.com.cn or 

chn@jmu.edu.cn. Tel: 86-592-6181764 

structure analogue of naringin and naringenin (Kaul et al., 

1985; Choi et al., 1991a, b; Chang et al., 2011). It exhibits 

combined advantages of both naringin and naringenin, 

that is, strong bioactivity, good solubility and little bitter 

taste (Puri et al., 1996). However, prunin naturally exists in 

a low quantity. As a result, much effort has been tried to 

develop an efficient process to transform naringin to prunin, 

taking advantage of the naringin that is commercially 

available in a large quantity as a citrus byproduct. Fox et al. 

(1953) reported a procedure by acidic transformation of 

naringin to prunin, but it needed strict reaction conditions 

and complicated purification steps. In contrast, enzymatic 

method is more desirable due to its simpler process and 

lower production cost because the enzymatic reaction can 

be controlled under a milder and more environmentally 

friendly condition with high efficiency and high specificity. 

Although some studies (Roitner et al., 1984; Soria and

Figure 1. Mechanism of enzymatic conversion of naringin to pruning. 

Ellenrieder, 2002; Kaur et al., 2010) have demonstrated 

the possibility of preparing prunin by the enzymatic 

method, so far prunin has not been commercially 

produced due to the lack of industrial biocatalyst. The 

enzyme, α-L-rhamnosidase (E. C. 3.2.1.40) which cleaves 

the α-1, 2-glycosidic bond is responsible for the 

biotransformation of naringin to prunin (Figure 1) (Yadav et 

al., 2010). It has been reported that α-L-rhamnosidase 

usually joins together with β-D-glucosidase to form 

naringinase (Figure 1) (Yadav et al., 2010). Naringinase 

and α-L-rhamnosidase has been reported from some 

microorganisms (Yoshikazu et al., 1973; Manzanares et 

al., 1997; Spagna et al., 2000; Yadav et al., 2010; Puri, 

2011), among which Aspergillus niger is considered the 

most potential and promising resource for industrial 

practice because this fungus not only has been listed in 

the Food and Drug Administration (FDA’S) approved 

microbial category and proven safe for food and medicinal 

use, also is able to be induced to efficiently produce some 

food-grade enzymes (Pel et al., 2007), including the 

naringinase and the α-L-rhamnosidase. Moreover, the 

fermentation process is easy to be scaled up because its 

technology is pretty mature and has been widely used in 

industry (Pel et al., 2007). 

Studies have concerned in the purification of 

α-L-rhamnosidase from Aspergillus niger and other 

microorganisms (Yadav et al., 2010; Chang et al., 2011; 

Puri, 2011; Ribeiro, 2011), but α-L-rhamnosidase has 

been seldom investigated in the preparation of prunin. 

Recently, a new strain DB056 of A. niger that could 

produce a high yield of naringinase (complex of 

α-L-rhamnosidase and β-D-glucosidase) has been 

screened, along with a successful optimized scale-up 

process for naringinase production in a 200 L fermentor 

(data not shown) in our laboratory in Jimei University, 

China. Therefore, it presented a commercially available 

source of α-L-rhamnosidase. In this context, it is valuable 

to purify and characterize the α-L-rhamnosidase for the 

enzymatic preparation of prunin. The 

p-nitrophenyl-α-L-rhamnopyranoside (pNPR) method 

(Romero et al., 1985) is commonly used to monitor the 

Ni et al. 5277 

activity of α-L-rhamnosidase. However, it could not 

monitor the biotransformation of prunin. In the present 

study, the α-L-rhamnosidase was purified and 

characterized to transform the prunin by using a high 

performance liquid chromatography (HPLC) method 

enabled to simultaneously differentiate naringin, prunin 

and naringenin instead of the pNPR method. 


Reagent and chemical 

Diethylaminoethanol (DEAE)-Sepharose, Sephacryl S-200 HR, 

acrylamide and sodium dodecyl sulfate (SDS) were purchased from 

Amersham Biosciences (Uppsala, Sweden). Protein markers for 

sodium dodecyl sulfate polyacrylamide gel electrophoresis 

(SDS–PAGE) were from Fermentas VAB (Vilnius, Lithuania). 

Naringin, prunin, naringenin, ethylene diamine tetraacetic acid 

(EDTA), dithiothreitol (DTT), pNPR, bovine serum albumin, 

Coomassie brilliant blue, ammonium persulfate and substrates were 

purchased from Sigma (St. Louis, MO). Methanol, acetonitrile were 

HPLC grade and purchased from Tedia Company Inc. (Fairfield, 

Ohio, USA). All other reagents were of analytical grade. 

Cultivation of A. niger for producing naringinase 

The strain A. niger DB056 was inoculated onto slant media in 

composition (g/L) of MgSO4·7H2O 1.0, KH2PO4 1.0, (NH4)2SO4 1.5, 

KCl 0.5, KNO3 1.5, CaCl2 0.1, yeast extract 2.0, naringin 2.5 and agar 

20. The spores were grown at pH 6.0 and 28°C for 3 days before they 

were washed and adjusted to make spore suspension to OD600 0.2. 

Then they were inoculated into a NBS Bioflo-110 7 L fermentor which 

contained 5 L of fermental media accordingi to Puri and Kalra (2005) 

with minor modification. The medium composition was (g/L): naringin 

10, MgSO4·7H2O 0.5, KH2PO4 1.5, (NH4)2SO4 4.0, ZnSO4·7H2O 0.09, 

CaCl2 0.1, yeast extract 1.0, soybean powder 2.0 and peptone 2.0. 

The strain was cultured at 28°C, pH 6.0, in 300 rpm for 7 days for 

yielding enough amount of naringinase. The broth was centrifuged at 

4500 rpm for 15 min to remove the cells and collect the supernatant. 

Determination of enzymatic activity of α-L-rhamnosidase 

A HPLC method which was developed based on the principle of 

Yadav et al. (2010) was applied to simultaneously determine naringin


prunin and naringenin so that the α-L-rhamnosidase activity could be 

determined. Detailed procedure is described as follows; Two 

milliliters of 300 μg/mL naringin solution was mixed with 1.9 ml of 10 

mM citric acid buffer (pH 5.0) and warmed up in a 40°C water bath for 

5 min. Then, the reaction was immediately initiated by adding 100 µl 

of properly diluted enzyme solution and incubated at 40°C for 15 min. 

The reaction solution was heated to 100°C to denature the enzyme. 

The mixture was then filtered through 0.22 µm membranes prior to 

the HPLC analysis. A Waters 1525 HPLC instrument equipped with a 

2487 UV detector and a Symmetry C18 reversed-phase column (4.6 

×1 50 mm, 3.5 μm) was controlled by the Breeze Chromatographic 

software. The mobile phase was composed of 11.4% methanol, 26.6% 

acetonitrile and 62% purified deionized water, with an isocratic 

elution flow at 0.4 ml/min. Sample injection was in a volume of 20 µl. 

The column temperature was at 35°C, the detective wavelength was 

at 280 nm and the running time was 28 min under an isocratic elution 

procedure. One unit of α-L-rhamnosidase was defined as the 

enzyme degraded 1 μg naringin within 1 min. 

Determination of protein concentration 

For the purification, the protein was estimated by measuring the 

absorbance at 280 nm. While for the characterization, the protein 

was analyzed by the method of Bradford (1976) using bovine serum 

albumin (BSA) as standard. 

Purification of α-L-rhamnosidase 

The broth was centrifuged at 4°C, 10,000 g for 30 min in a centrifuge 

(Avanti J-25, Beckman Coulter, USA). The supernatant was 

fractionated with ammonium sulphate from 50 to 80% concentration. 

The resulting pellet was dissolved in a minimum volume of 10 mM 

sodium citrate buffer (pH 5.5) containing 5 mM DTT and dialyzed 

against the same buffer extensively. The dialysate was subsequently 

applied to a DEAE-Sepharose Fast Flow column (2.5 × 16 cm), 

which was previously equilibrated with the dialysis buffer. 

Unabsorbed fractions were removed by washing the column with the 

dialysis buffer 5 times of volume of the column. Then, binding 

proteins were eluted with a linear gradient of NaCl from 0 to 0.5 M in 

a total volume of 420 ml. 

Fractions were collected in 3 ml/tube for analyses of the 

α-L-rhamnosidase activity and content of the protein. Those fractions 

showing the α-L-rhamnosidase activity (that is, displaying the ability 

to degrade naringin to prunin) were pooled together and dialyzed 

against 10 mM sodium citrate buffer (pH 5.5) containing 5 mM DTT. 

The pooled fractions from the DEAE-Sepharose Fast Flow column 

were concentrated by ultra filtration using a YM-30 membrane 

(Millipore, MA, USA) and applied to a Sephacryl S-200 HR 

gel-filtration column (1.5 × 98 cm) equilibrated and washed with 20 

mM citric acid buffer (pH 5.5) containing 0.15 M NaCl and 5 mM DTT 

at 0.5 ml/min. The fractions were collected in 2 ml/tube for analyses 

of the α-L-rhamnosidase activity and the concentration of protein. 

The eluted active fractions were pooled for enzyme characterization. 

SDS–PAGE electrophoresis and molecular weight measuring 

Molecular weight (MW) of the α-L-rhamnosidase was determined 

both by gel filtration chromatography (GFC) and SDS–PAGE. GFC 

was performed on the same Sephacryl S-200 HR column as 

aforementioned, while the SDS–PAGE was carried out in a 

Mini-protean III dual-slab cell electrophoresis according to the 

method of Laemmli (1970), using a 10% gel. The proteins were 

stained with the Coomassie brilliant blue R-250. 

Effects of pH and temperature 

Enzymatic activities of the purified α-L-rhamnosidase over the pH 

range of 3.0 to 8.5 were determined at the temperature of 40°C for 15 

min using 50 mM of the following buffers: sodium citrate buffer (pH 

3.0 to 5.5), sodium phosphate buffer (pH 6.0 to 7.0) and Tris–HCl 

buffer (pH 7.5 to 8.5). For temperature profile study, the activities 

were assayed at a temperature range between 20 and 65°C for 15 

min at pH 5.0 using the 50 mM sodium citrate buffer. 

pH and thermal stability 

Effect of pH on stability of the purified α-L-rhamnosidase was 

evaluated by measuring the residual enzymatic activity after 

incubation under various pH values at 4°C for 24 h. The pH values 

(3.0 to 8.5) were kept by 50 mM sodium citrate buffer of pH 3.0 to 5.5, 

sodium phosphate buffer of pH 6.0 to 7.0 and Tris–HCl buffer of pH 

7.5 to 8.5. To investigate the thermal stability, the purified 

α-L-rhamnosidase dissolved in 50 mM sodium citrate buffer (pH 5.0) 

was incubated at different temperatures from 4 to 60°C and sampled 

in different intervals depending on the temperature. Then the 

samples were immediately cooled in ice water before the residual 

activity was determined. 

Effects of metal ions and reagents 

The purified α-L-rhamnosidase were incubated with Fe 2+ , Fe 3+ , Zn 2+ , 

Ca 2+ , K + , Al 3+ , Mg 2+ , Ba 2+ , Mn 2+ , Cu 2+ , Na + , Ag + , Hg 2+ , EDTA-Na2, 

DTT, SDS, urea, dimethylsulfoxide (DMSO), mercaptoethanol, 

glycerol and citric acid at final concentrations of 1 and 5 mM in the 50 

mM sodium citrate buffer (pH 5.0) at room temperature (25 ± 1°C) for 

24 h. Then, the residual enzymatic activity was measured as 

aforementioned. The experimental control was performed without 

any addition of metal ions or chemical reagents. 

Determination of Michaelis constant 

The reaction solutions were prepared to contain 0.06 mg/mL of the 

enzyme and 300, 200, 100, 50, 25, 12.5 and 6.25 μg/ml of naringin, 

respectively. The reaction was performed at 40°C for 3 min. 

Thereafter, the amount of consumed naringin was determined to 

calculate the enzymatic activities. The Vmax and Km were determined 

based on the Lineweaver–Burk plot. 

Enzymatic transformation of naringin to prunin 

The purified α-L-rhamnosidase at final concentration of 18.23 U/ml 

was applied to hydrolyze naringin under the condition described. The 

reaction mixture was sampled every 8 min to measure the content 

change of naringin, prunin and naringenin by the same HPLC 

method described. Meanwhile, the transforming rate was calculated 

according to the remaining amount of naringin. 

RESULTS 

Purification of α-L-rhamnosidase 

The α-L-rhamnosidase was purified from the fermented 

broth of A. niger by ammonium sulfate precipitation and 

column chromatographies of DEAE-Sepharose Fast Flow 

column and Sephacryl S-200 HR. As shown in Figure 2A,

Enzymatic activity (U/mL) 

Enzymatic activity (U/mL) 

1000 

800 

600 

400 

200 

0 

0 

0 50 100 150 200 

1800 

1500 

1200 

900 

600 

300 

B 

A 

Fraction No. (3ml/tube) 

0 

0 

0 20 40 60 80 100 

Fraction No. (3ml/tube) 

Figure 2. Chromatographic purification and analysis of 

α-L-rhamnosidase. (A) DEAE-sephrose column chromatography. 

(B) Sephacryl-S200 chromatography. Absorbance is at 280 nm. (○); 

α-L-Rhamnosidase activity (●); concentration of NaCl (--); collected 

fractions (―). 

a total number of 4 protein peaks were eluted from the 

DEAE-sepharose separation. The expected 

α-L-rhamnosidase was eluted out with NaCl concentration 

of 0.18 to 0.28 M and detected mainly in the second 

protein peak. All the peaks were separated well without 

overlaying, indicating that the DEAE-Sepharose Fast Flow 

chromatography was efficient to be able to separate the 

α-L-rhamnosidase from other proteins. 

The active fractions collected from the ion exchange 

chromatography were further applied to the Sephacryl 

S-200 column. The result (shown in Figure 2B) 

demonstrated that a single protein peak concurrently 

exhibited the enzyme activity. The molecular weight of this 

peak (that is, α-L-rhamnosidase) was measured around 

87 kDa both by the SDS-PAGE (Figure 3) and Sephacryl 

S-200 (data not shown) after comparison with the standard 

protein markers. After the purification steps 

aforementioned, the α-L-rhamnosidase was purified by 

77.68 fold with yield (recovery) of 36.53% and had a 

specific activity at 7678.8 U/mg (Table 1). Only one protein 

band shown in the SDS-PAGE analysis (Figure 3) 

indicated that the protein had been sufficiently purified to 

0.8 

0.6 

0.4 

0.2 

0.15 

0.12 

0.09 

0.06 

0.03 

A 280 (mAU); NaCl (M) 

A 280 (mAU) 

homogeneity. 

pH optimum and stability 


The purified α-L-rhamnosidase (Figure 4) exhibited its 

maximal activity in pH range of 4.5 to 5.0. Also, it showed 

stabilities over a broad pH range of 3.5 to 7.5 (Figure 4), 

especially within pH 5 to 6, where the relative activity was 

maintained around 90% after 24 h. However, the enzyme 

became unstable when pH approached below 3.0 and 

above 8.0, where the relative activity showed a significant 

loss. 

Temperature optimum and stability 

The maximal activity of the α-L-rhamnosidase was at 50 to 

60°C (Figure 5A). For its thermal stability, slight changes 

in activity were observed at 4°C after 10 days (Figure 5B). 

However, activities of the α-L-rhamnosidase tended to 

decrease at 25 and 37°C after 4 days (Figure 5B), at 50 

and 55°C within 1 h (Figure 5C), at 60°C within 10 min 

(Figure 5D), respectively. 

Effects of metal ions and reagents 

As shown in Tables 2 and 3, the α-L-rhamnosidase was 

strongly inhibited by Fe 2+ , Fe 3+ , Al 3+ , Cu 2+ , Ag + , Hg 2+ ions 

and SDS and 5 mM citric acid; slightly restricted by Zn 2+ , 

Ca 2+ , Mg 2+ and Mn 2+ . However, it was slightly activated by 

K + , Ba 2+ ions at 1 mM and 5 mM, as well as DTT, urea, 

DMSO, glycerol and citric acid at 1 mM. Na + , EDTA-Na2 

and mercaptoethanol seemed having no significant effect 

on α-L-rhamnosidase. 

Validity of the α-L-rhamnosidase for transformation of 

naringin to prunin 

The specific activity of the α-L-rhamnosidase increased 

with the increment of substrate concentration within 0 to 

100 μg/ml (Figure 6). The Michaelis constants, Km and 

Vmax of the α-L-rhamnosidase for hydrolysis of naringin 

were determined (Figure 6) at 156.74 μg/ml (0.27 mM) 

and 9805.15 U/mg, respectively. Almost all the naringin 

was hydrolyzed (Figures 7B and 7C). No naringenin was 

observed during this process (Figure 7C). After the 

hydrolysis, 97% of the naringin was transformed to prunin 

(Figure 7D). 

DISCUSSION 

As described in the introduction, the α-L-rhamnosidase 

from A.niger naringinase was possibly the best feasible 

and practical option for industrial catalyses of naringin to


Table 1. Purification of α-L-rhamnosidase. 

Purification step 

Figure 3. SDS-PAGE of the purified α-L-rhamnosidase. Lane 1 is the 

broth supernatant, lane 2 is the ammonium sulphate precipitation 

fraction, lane 3 is the dialysate of the ammonium sulphate precipitation, 

lane 4 is the fraction from DEAE-sephrose column, and lane 5 is the 

fraction from Sephacryl-S200 column. 

Total protein 

(mg) 

Total activity 

(U) 

Specific activity 

(U/mg) 

Yield 

(%) 

Purified 

fold 

Broth supernatant 922.96 91243.8 97.2 100 1 

Ammonium sulphate precipitation 161.5 54442.8 334.8 59.67 3.41 

Dialysis 32.7 44857.8 1371.6 49.17 13.88 

DEAE-Sepharose chromatography 5.64 40294.8 7144.2 44.16 72.27 

Sephacryl S-200 chromatography 4.34 33328.8 7678.8 36.53 77.68 

Figure 4. Effect of pH on α-L-rhamnosidase activity: pH optimum (■); pH 

stability(□).

prunin so far. By using the HPLC method to facilitate 

detection of the enzymatic activity (Figure 7A), the 

α-L-rhamnosidase from A. niger has been purified to 

homogeneity (Figures 2 and 3) by ammonium sulphate 

precipitation and chromatographies on DEAE-sepharose 

and Sephacryl S-200 HR columns. The MW of the purified 

α-L-rhamnosidase was measured to be around 87 kDa, 

similar to a previously reported α-L-rhamnosidase from 


A. niger (Manzanares et al., 1997). Although our purified 

α-L-rhamnosidase had similar pH optimal value in range of 

pH 4.0 to 5.0 as the previously reported 

α-L-rhamnosidases determined by the pNPR method 

(Manzanares et al., 1997; Spagna et al., 2000; Yoshikazu 

et al., 1973), their stable pH values are significantly 

different. In addition, our α-L-rhamnosidase showed an 

optimal temperature within 50 to 60°C, which was also 

different from other reported α-L-rhamnosidases from A. 

niger (Yoshikazu et al., 1973; Manzanares et al., 1997). 

Yet, its optimal pH, stable pH, optimal temperature and 

stable temperature were all in agreement with those of the 

naringinase from A. niger (Puri and Kalra, 2005). 

Moreover, the molecular weight of our 

α-L-rhamnosidase which was similar to the SDS-PAGE 

analysis of the naringinase from A. niger, but less than the 

result of gel filtration analysis of the same naringinase (168 

kDa) (Puri and Kalra, 2005), suggesting it was a subunit 

from naringinase. This enzyme was easy to be purified. 

Based on the chromatogram, remaining enzymatic activity 

and calculated purified fold (Figure 2B, Table 1), it is 

obvious that the ion exchange chromatography was so 

efficient to purify the α-L-rhamnosidases that further 

purification procedures, for example, gel filtration 

chromatography and affinity chromatography, were not 

necessary. Its Km value (0.27 mM) indicating that our 

purified α-L-rhamnosidase has a high affiliation to naringin. 

Furthermore, the transforming rate and the residual 

naringin (Figure 7) were above 97% and less than 4%, 

respectively revealing the high efficiency and validity of the 

new purified α-L-rhamnosidase. These properties suggest 

our α-L-rhamnosidase was in high purity that can be used 

in food and pharmaceutical industries. 

The purified enzyme and its process possessed the 

following three advantages: the enzyme that displayed a 

strong enzymatic activity and good stability in a wide pH 

and temperature range (Figures 3 and 4) would facilitate 

the bioconversion of naringin to prunin, It also facilitated 

the purification of prunin because the transforming rate 

was very high and the remaining naringin was left in small 

amount (Figure 7) and the enzymatic reaction can be 

promoted by K + ion and some other chemicals (Tables 2 

and 3 ). Moreover, this α-L-rhamnosidase can be applied 

to eliminate the bitter taste of citrus juice, which is 

expected to having the following four advantages: the 

Figure 5. Effect of temperature on α-L-rhamnosidase activity. (A) 

Temperature profiles; (B) temperature Fig.5 stability at 4(■), 25(▲), 

37°C(○); (C) temperature stability at 50(□), 55°C(◆); (D) thermal process is safe; it will not cause other nutritional loss, for 

ature profiles; stability (B) temperature at 60°C. stability at 4(■), 25(▲), 37 ºC(○); (C) temperature the enzyme only specifically hydrolyzes naringin; it can 

at 50(□), 55 ºC(◆); (D) thermal stability at 60 ºC. 

hydrolyze naringin at natural and weak acidic pH value of 

the juice and unlike naringinase, it would not convert 

naringin to non-soluble naringenin which has to be 

removed by centrifuge and filtration during the juice 

processing. 

Conclusion 

The α-L-rhamnosidase from a fermented broth of A. niger 

was purified and characterized in light of its MW, optimal


Table 2. Effect of metal ions on the α-L-rhamnosidase activity. 

Metal ion 

Fe 2+ 

Relative activity of α-L-rhamnosidase (%) 

1 mmol/L 5.0 mmol/L 

41.81 ± 0.15 h 32.75 ± 2.68 f 

Fe 3+ 10.51 ± 0.28 i 5.79 ± 2.14 gh 

Zn 2+ 79.47 ± 0.86 f 72.14 ± 0.98 e 

Ca 2+ 87.67 ± 0.66 e 94.65 ± 1.27 c 

K + 119.49 ± 2.19 a 107.58 ± 1.04 a 

Al 3+ 8.93 ± 2.78 i 5.26 ± 2.69 gh 

Mg 2+ 80.39 ± 3.74 f 85.71 ± 3.23 d 

Ba 2+ 113.58 ± 2.64 b 106.01 ± 0.46 a 

Mn 2+ 96.87 ± 2.35 d 83.64 ± 1.98 d 

Cu 2+ 58.79 ± 2.30 g 7.26 ± 0.14 g 

Na + 102.39 ± 2.61 c 104.06 ± 4.30 ab 

Ag + 9.40 ± 1.83 i 4.00 ± 0.57 h 

Hg 2+ 8.33 ± 1.21 i 5.74 ± 1.46 hg 

Control 100 ± 2.20 c 100 ± 1.40 b 

Means with different superscript letters within the same column are significantly different (P

Figure 7. Enzymatic conversion of naringin to prunin by the α-L-rhamnosidase. A. The 

chromatogram of naringin, prunin and naringenin. B. The chromatogram of the control of 

the conversion experiment. C. The chromatogram of the sample of the conversion 

experiment. D. The concentration change of naringin and pruning. 

pH value and its stable range, optimal temperature and its 

thermal stability, activators, inhibitors, substrate specificity, 

kinetic parameters and its ability to hydrolyze naringin to 

prunin. The present α-L-rhamnosidase showed a MW of 

about 87 kDa, with optimal pH 4.5 to 5.0, stable pH range 

of 3.5 to 8.0 and optimal temperature of 55 to 60°C. This 

enzyme could be inhibited by Fe 2+ , Fe 3+ , Zn 2+ , Al 3+ , Mn 2+ , 

Cu 2+ , Ag + , Hg 2+ ions and SDS. It had a higher specificity to 

naringin than pNPR. Its Km was 0.27 mM; the Vmax was 

9805.15 U/mg. This enzyme was highly efficient to convert 

the naringin to prunin with a transforming rate greater than 

97%. These results suggest that this α-L-rhamnosidase 

from A. niger naringinase can have meaningful 

applications in food and pharmaceutical industries. 

REFERENCES 


Bradford MM (1976). A rapid and sensitive method for the quantitation of 

microgram quantities of protein utilizing the principle of protein-dye 

binding. Anal. Biochem., 72: 248-254. 

Calgarotto AK, Miotto S, Honorio KM, da Silva ABF, Marangoni S, Silva 

JL, Comar JM, Oliveira KMT, da Silva SL (2007). A multivariate study 

on flavonoid compounds scavenging the peroxynitrite free radical. J 

Mol. Struc. Theochem., 808: 25-33. 

Chang H, Lee Y, Bae H, Huh J, Nam S, Sohn H, Lee HJ, Lee S (2011). 

Purification and characterisation of Aspergillus sojae naringinase: The 

production of prunin exhibiting markedly enhanced solubility with in 

vitro inhibition of HMG-CoA reductase. Food Chem., 124: 234-241. 

Chen YT, Zheng RL, Jia ZJ (1990). Flavonoids as superoxide 

scavengers and antioxidants. Free Radical Biol. Med., 9: 19–21. 

Choi JS, Yokozawa T, Oura H (1991a). Improvement of hyperglycemia 

and hyperlipemia in streptozotocin-diabetic rats by a methanolic


extract of Prunus davidiana stems and its main component, Prunin. 

Planta Med., 57: 208-211. 

Choi JS, Yokozawa T, Oura H (1991b). Antihyperlipidemic effect of 

flavonoids from Prunus Davidiana. J. Nat. Prod., 54: 218-224. 

Ekambaram G, Rajendran P, Magesh V, Sakthisekaran D (2008). 

Naringenin reduces tumor size and weight lost in 

n-methyl-N′-nitro-N-nitrosoguanidine–induced gastric carcinogenesis 

in rats . Nutr. Res., 28: 106-112. 

Fox DW, Savage WL, Wender SH (1953). Hydrolysis of some flavonoid 

rhamnoglycosides to flavonoid glucosides. J. Am. Chem. Soc., 75: 

2504-2505. 

Gordon PB, Holen I, Seglen PO (1995). Protection by naringin and some 

other flavonoids of hepatocytic autophagey and endocytosis against 

inhibition by okadaic acid. J. Biol. Chem., 270: 5830-5838. 

Heim KE, Tagliaferro AR, Bobilya DJ (2002). Flavonoid antioxidants: 

chemistry, metabolism and structure-activity relationships. J. Nutr. 

Biochem., 13: 572–584. 

Kaul TN, Middleton EJrMD, Ogra PL (1985). Antiviral effects of flavonoids 

on human viruses. J. Med. Virol.,15: 71-79. 

Kaur A, Singh S, Singh RS, Schwarz WH, Puri M (2010). Hydrolysis of 

citrus peel naringin by recombinant α-L-rhamnosidase from 

Clostridium stercorarium. J. Chem. Technol. Biot., 85: 1419–1422. 

Laemmli UK (1970). Cleavage of structural proteins during the assembly 

of the head of bacteriophage T4. Nature, 277: 680-685. 

Manzanares P, de Graff LH, Visser J (1997). Purification and 

characterization of an α-L-rhamnosidase from Aspergillus niger. FEMS 

Microbiol. Lett., 157: 279-283. 

Martin MJ, Marhuenda E, Perez GC, France JM (1994). Antiulcer effect 

of naringin on gastric lesions induced by ethanol in rats. Pharmacology, 

49: 144–150. 

Parmar NS (1983). The gastric anti-ulcer activity of naringenin, a specific 

histidine decarboxylase inhibitor. Intl. J. Tissue React., 5: 415–420. 

Pel HJ, de Winde JH, Archer DB, Dyer PS, Hofmann G, Schaap PJ 

(2007). Genome sequencing and analysis of the versatile cell factory 

Aspergillus niger CBS 513.88. Nat. Biotechnol., 25: 221-231. 

Puri M (2012). Updates on naringinase: structural and biotechnological 

aspects. Appl. Microbiol. Biotechnol., 93: 49-60. 

Puri M, Kalra S (2005). Purification and characterization of naringinase 

from a newly isolated strain of Aspergillus niger 1344 for 

transformation of flavonoids. W. J. Microbiol. Biotechnol., 21: 753-758. 

Puri M, Marwaha SS, Kothari RM (1996). Studies on the applicability of 

alginate-entrapped naringiase for the debittering of kinnow juice. 

Enzyme Microb. Tech., 18: 281-285. 

Ribeiro IA, Ribeiro MHL (2008). Naringin and naringenin determination 

and control in grapefruit juice by a validated HPLC method. Food 

Control, 19: 432–438. 

Ribeiro MH (2011). Naringinases: occurrence, characteristics, and 

applications. Appl. Microbiol. Biotechnol., 90: 1883-1895. 

Roitner M, Schalkhammer TH, Pittner F (1984). Preparation of prunin 

with the help of immobilized naringinase pretreated with alkaline buffer. 

Appl. Biochem. Biotechnol., 9: 483-488. 

Romero C, Manjon A, Bastida J, Iborra JL (1985). A method for assaying 

rhamnosidase activity of naringinase. Anal. Biochem., 149: 566-571. 

So FV, Guthrie N, Chambers AF, Moussa M, Carroll KK (1996). Inhibition 

of human breast cancer cell proliferation and delay of mammary 

tumorigenesis by flavonoids and citrus juices. Nutr. Cancer, 26: 

167–181. 

Soria F, Ellenrieder G (2002). Thermal inactivation and product inhibition 

of Aspergillus terreus CECT 2663 α-L-rhamnosidase and their role on 

hydrolysis of naringin solutions. Biosci. Biotechnol. Biochem., 66: 

1442-1449. 

Spagna G, Barbagallo RN, Martino A, Pifferi PG (2000). A Simple method 

of purifying glycosidases: α-L-rhamnopyranosidase from Aspergillus 

niger to increase the aroma of Moscato wine. Enzyme Microb. Tech., 

27: 522-530. 

Tommasini S. Calabrò ML, Raneri D, Ficarra P, Ficarra R (2004). 

Combined effect of pH and polysorbates with cyclodextrins on 

solubilization of naringenin. J. Pharm. Biomed. Anal., 3: 327–333. 

Yadav V, Yadav PK, Yadav S, Yadav KDS (2010). α-L-Rhamnosidase: a 

review. Process Biochem., 45: 1226-1235. 

Yoshikazu K, Kayoko I, Fujio E (1973). α-L-rhamnosidase of the live of 

Turbo cornutus and Aspergillus niger. J. Biochem., 73: 31-37.



DOI: 10.5897/AJMR11.1110 


Short Communication 

Prevalence of Hepatitis B and C among hemodialysis 

and thalassemic patients in a special medical center in 

East Tehran in 2011 

Mohammad Aminianfar 1 *, Ali-Asghar Saidi 1 , Alireza Fallah 2 and Amin Barghi 3 

1 Department of Infectious and Tropical disease, Medical Faculty, Army University of Medical Science, Be'sat Hospital, 

Tehran, Iran. 

2 Special Medical Center in East of Tehran, Tehran, Iran. 

3 Young Researchers Club, Lahijan Branch, Islamic Azad University, Lahijan, Iran. 


The blood born transmitted viral hepatitis occurs after frequent blood infusions among patients with 

thalassaemia and hemodialysis disease, and in a large number of these patients severe and chronic 

liver disease developed. This study aimed to determine the prevalence of hepatitis B and C serology 

among hemodialysis and thalassemic patients in a special medical center in East of Tehran in 2011. 

This was a descriptive cross-sectional study performed on 62 patients (49 hemodialysis and 13 

thalassemic patients) in the same center. Initially, demographic information and data associated with 

possible risk factor were collected for each patient followed by testing blood samples for presence of 

anti-hepatitis C virus antibody (anti-HCV-Ab), anti-hepatitis B virus antibody (anti-HCV-Ab), and other 

serologic tests. By using SPSS software, t test and chi-square statistics data were analyzed. Anti-HCV- 

Ab (ELISA) was positive in 4 patients (6.1%). Confirmation of positive samples was carried out using 

HCV RNA PCR but the results in all patients (100%) were negative. Serologic markers of hepatitis B 

such as hepatitis B surface antigen (HBs-Ag), hepatitis B surface antibody (HBs-Ab) and hepatitis B 

core antibody (HBcAb)HBc-Ab were negative in all patients. Regarding the current practice of safe 

blood-transfusion program in our country, it is concluded that eliminating of risk factors and the use of 

screening tests with higher sensitivity could be among the key elements in controlling the prevalence 

of HCV/HBs infection among thalassemia/hemodialysis patients. Serologic markers of hepatitis B and C 

should be evaluated in periodic manner and HCV-RNA PCR should be evaluated yearly in all patients, 

because defect of cellular and humoral immune system could be present in these patients. 

Key words: Prevalence, thalassemia/hemodialysis patients, hepatitis B and C. 

INTRODUCTION 

According to significant increase in the number of 

patients with hemodialysis, infection control and maintain 

good quality of life in these patients is important. 

However, with regard to increasing number of these 

individuals, percentage of people with hepatitis B and C 

has decreased. On the other hand, thalassemic patients 

due to the frequent blood infusion are at risk of hepatitis 

*Corresponding author. E-mail: m_aminianfar@yahoo.com. Tel: 

+98 21 39955650. Fax: +98 2133240308. 

(Alavian et al., 2003; Alter, 1997). In America, according 

to WHO records 6.1% of people have hepatitis C virus 

(HCV) infection. But in the Iranian population less than 

200,000 (less than 1%) persons have HCV (Alavian et al, 

2005). In Iran before 1996, due to repeated transfusions, 

the risk of hepatitis C is 12.5 times higher today in 

thalassemic patients (Kabir et al., 2006). 20 to 40% of 

thalassemic patients have HCV infection (Mirmomen et 

al., 2006). A study in 2004 in the Rasht (city in north of 

Iran) showed that HCV antibody (HCV-Ab) is positive in 

25% of thalassemic patients, in another study in 2001 in 

the Qazvin and Semnan, 24.2 and 39% of these patients,


Table 1. Information of individuals of the study. 

Information Total Male Female 

Thalassemic patients 13 10 3 

Hemodialysis patients 49 37 13 

Blood transfusion before 1995 11 4 7 

Family history of viral hepatitis 4 3 1 

HBV vaccination history 53 32 21 

Table 2. Serologic markers of viral hepatitis B and C among hemodialysis and thalassemic patients in 

the Special Medical Center in East of Tehran in 2011. 

Infection Hemodialysis patients Thalassemic patients 

HCV-Ab 3 patients positive 1 patient positive 

HBs-Ab Negative in all patients Negative in all patients 

HBs-Ag Negative in all patients Negative in all patients 

HBc-Ab Negative in all patients Negative in all patients 

respectively, were seropositive for HCV-Ab. In all these 

reports, prevalence of HCV has significant relationship 

with a mean age, duration and number of blood infusions 

(Alavian et al., 2002, 2007; Ansar, 2002). 

Accordingly, the underlying disease in these patients 

largely impaired the humoral and cellular immunity. For 

this reason, antibody response against diseases and 

vaccinations is impaired in these patients and on the 

other hand antibody detection against these diseases will 

have false negative results, therefore in diagnosis of 

these diseases other methods such as polymerase chain 

reaction (PCR) should be used (Kato et al., 2008). 

Viral hepatitis infection in hemodialysis patients has the 

same pattern of these diseases that is seen in the 

country’s population. The prevalence of hepatitis B virus 

(HBV) in North America and Western Europe is 3%, 

Central America, Eastern Europe and Africa sometimes 

up to 20%, and in Iran about 6.2% of the people have 

HBV infection. In different countries, 4 to 59% of 

hemodialysis patients were infected with HCV. HCV 

infection was reported in 7.61% of hemodialysis patients 

in Iran (Ehsani et al., 2009). 

HCV-Ab test is required once every three months in 

hemodialysis patients and HCV-RNA PCR is required 

yearly. In this study, we determine the prevalence of 

hepatitis B and C in hemodialysis and thalassemic 

patients in the Special Medical Center in East of Tehran 

in 2011. 

METHODOLOGY 

A descriptive cross-sectional study was performed on 62 patients 

(49 hemodialysis patients and 13 thalassemic patients) in the same 

center. Initially, demographic information and data associated with 

possible risk factor (frequency of blood transfusion and surgery, 

tattoo, underlying diseases) was collected for each patient followed 

by testing blood samples for presence of anti-HCV-Ab, anti-HBc-Ab, 

and other serologic tests. By using SPSS software, t test and chisquare 

statistics data were analyzed. 

RESULTS 

This study was performed on 62 patients in this center, 

40 (65%) males and 22 (35%) females, mean age is 44 ± 

19 years, the minimum age is 9 and maximum is 79 

years. Patients in this study are 49 hemodialysis patients 

(37 males and 13 females) and 13 thalassemic patients 

(3 males and 10 females). Forty patients have two or 

more co-morbidity (such as hypertension, renal failure, 

and diabetes mellitus) (Table 1). 

In this study, 10 patients (9 males and 1 female) had no 

history of vaccination against hepatitis B. Table 2 shows 

serologic markers of viral hepatitis in population of study. 

According to the results of viral hepatitis serological 

tests, HCV-RNA PCR performed in all patients of this 

center and the later test were negative for all patients. 

DISCUSSION 

This study was performed for the first time in this center. 

Four patients were seropositive for HCV but HCV-RNA 

PCR was negative in these patients. This revealed that 

the patients were infected in the past, but the infection 

was resolved at present. This is a warning for the dialysis 

centers, and isolation of these patients is necessary. In 

patients of this center, HCV-Ab test is required once 

every three months and HCV-RNA PCR is required 

yearly (Shamshirsaz et al., 2004). 

Despite full course vaccination with double dose HBV

vaccine, HBs-Ab is negative in all patients. It is 

worrisome among these patients and other techniques 

such as intradermal injection of HBV vaccine and multiple 

dose of vaccine are recommended. 


Thanks to the medical employees of dialysis centers in 

Special Medical Center in East of Tehran. 

REFERENCES 

Alavian SM, Adibi P, Zali M (2005). Hepatits C viruse in Iran: 

Epidemiology of an emerging infection. Arch. Iran. Med., 8(2): 84-90. 

Alavian SM, Hajariazdeh B, Malekzadeh R (2003). Hepatitis C in 

hemophiliacs. Govaresh, 8: 139-148. [In Persian]. 

Alavian SM, Kafaei J, Yektaparast B, Hajarizadeh B, Kamali A, Sadri M 

(2002). The prevalence of Hepatitis B and C among Thalassemia 

major patients in Qazvin. Kowsar Med. J., 4: 319-325. 

Alavian SM, Fallahian F, Lankarani KB (2007). The changing 

epidemiology of viralHepatitis B in Iran. J. Gastrointestin. Liver Dis., 

16: 403-406. 

Alter MJ (1997). Epidemiology of Hepatitis C. Hepatology, 26: 62S-65S. 

Ansar MM, Kooloobandi A (2002). Prevalence of Hepatitis C virus 

infection in thalassemia and hemodialysis patients in north Iran. 

Rasht. J. Viral Hepat., 9: 390-392. 

Aminianfar et al. 5287 

Ehsani MJ, Alavian SM, Ashrafijo M, Afhami S, Razaghi M, Mansori D 

(2009). A practical guideline for physician on diagnosis,treatment and 

control of viral Hepatitis in hemodialysis and renal transplantation. 

Afrang publication. 2 nd edited 15. 

Kabir A, Alavian SM, Keyvani H (2006). Distribiution ofHepatitis C virus 

genotypes in patients infected by different sources and its correlation 

with clinical and virological parameters:a preliminary study. Comp. 

Hepatol., 5: 4. 

Kato S, Chmielewski M, Honda H, Pecoits-Filho R, Matsuo S, Yuzawa 

Y, Tranaeus A, Stenvinkel P, Lindholm B (2008). Aspects of Immune 

Dysfunction in End-stage Renal Disease. Clin. J. Am. Soc. Nephrol., 

3: 1526-1533. 

Mirmomen S, Alavian SM, Hajarizadeh B, Kafaee J, Yektaparast B, 

Zahedi MJ, Zand V, Azami A, Ali Hosseini M, Faridi A, Davari K, 

Hajibeigi B (2006). Epidemiology of HepatitisB,HepatitisC and HIV in 

patient withβ thalassemia in Iran: A multicenter study. Arch. Iran. 

Med., 9: 319-323. 

Shamshirsaz A, Kamgar K, Bekheirnia M, Ayazi F, Hashemi R, Bouzari 

N, Habibzadeh MR, Pourzahedgilani N, Broumand V, Shamshirsaz 

AA, Moradi M, Borghei M, Haghighi N, Broumand B (2004). The role 

of hemodialysis machines dedication in reducing HepatitisC 

transmission in the dialysis setting in Iran: A multicenterprospective 

interventional study. BMC Nephrol., 5: 13.

UPCOMING CONFERENCES 

7th Conference of the World Mycotoxin Forum and 

XIIIth IUPAC International Symposium on Mycotoxins and Phycotoxins, 

Rotterdam, Netherlands, 5 Nov 2012 

13th International Congress on Yeasts, Madison, USA, 

26-30 Aug 2012

Conferences and Advert 

August 2012 

13th International Congress on Yeasts, Madison, USA, 26 Aug 2012 

September 2012 

6th International Congress on Biocatalysis, Hamburg, Germany, 2 Sep 2012 

9th International Congress on Extremophiles, Sevilla, Spain, 10 Sep 2012 

October 2012 

Actinobacteria within Soils: Capacities for Mutualsim, Symbiosis and Pathogenesis, 

Muenster, Germany, 25 Oct 2012 

November 2012 

7th Conference of the World Mycotoxin Forum and XIIIth IUPAC International 

Symposium on Mycotoxins and Phycotoxins, Rotterdam, Netherlands, 5 Nov 2012 

December 2012 

Marine Microbiology and Biotechnology: Biodiscovery, Biodiversity and 

Bioremediation, Cork, Ireland, 19 Dec 2012 

International Conference on Pathology and Microbiology, Bangkok, Thailand, 26 Dec 

2012

African Journal of 

Microbiology Research 

Related Journals Published by Academic Journals 

■ Journal of Cell and Animal Biology 

■ African Journal of Biotechnology 

■ Biotechnology and Molecular Biology Reviews 

■ African Journal of Food Science 

■ African Journal of Biochemistry Research 

■ Journal of Bacteriology Research

Microbiology Research - Academic Journals

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?