Attention! Your ePaper is waiting for publication!
By publishing your document, the content will be optimally indexed by Google via AI and sorted into the right category for over 500 million ePaper readers on YUMPU.
This will ensure high visibility and many readers!
Your ePaper is now published and live on YUMPU!
You can find your publication here:
Share your interactive ePaper on all platforms and on your website with our embed function
Create successful ePaper yourself
Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.
Douglas R. Hofstadter
Gödel, Escher, Bach
un Eterno y Grácil Bucle
Metatemas - 14
Douglas R. HofstadterGödel, Escher, Bachun Eterno y Grácil BucleMetatemas - 14
Para M. y D.
- Page 2 and 3: Libro proporcionado por el equipoLe
- Page 6 and 7: Visión panorámicaParte I: GEBIntr
- Page 8 and 9: fugas y cánones que integran su Ar
- Page 10 and 11: Parte II: E G BPreludio y… Este d
- Page 12 and 13: respecto a la filosofía de la mate
- Page 14 and 15: mismo que la Tortuga, sólo que neg
- Page 16 and 17: ninguno de los idiomas implicados;
- Page 18 and 19: Me dejó verdaderamente estupefacto
- Page 20 and 21: traductor, y que incluso había ay
- Page 22 and 23: ejemplo primordial de las encantado
- Page 24 and 25: ingenioso, persistente y con sentid
- Page 26 and 27: por su aporte consistente en dispon
- Page 28 and 29: FIGURA 1. Johann Sebastian Bach en
- Page 30 and 31: inventarlas de repente, y Bach era
- Page 32 and 33: Federico solía organizar en su cor
- Page 34 and 35: falta de la necesaria preparación,
- Page 36 and 37: muy entendidos.La sonata-trío cons
- Page 38 and 39: FIGURA 4a. Canon Good King Wencesla
- Page 40 and 41: creación bellísima de la intelige
- Page 42 and 43: EscherLas más bellas y vigorosas r
- Page 44 and 45: que se llegue de nuevo al punto de
- Page 46 and 47: cosa es un bucle sino una manera de
- Page 48 and 49: GödelEn los ejemplos de Bucles Ext
- Page 50 and 51: Galería de grabados de Escher. ¿Y
- Page 52 and 53: Dicho sea de paso, esta aseveració
- Page 54 and 55:
matemáticos estar recobrándose de
- Page 56 and 57:
podría llamarse “teoría de la a
- Page 58 and 59:
trabazón de matemática y lógica.
- Page 60 and 61:
organilleros, por sacar de quicio a
- Page 62 and 63:
semejanzas que puedan vincularlas;s
- Page 64 and 65:
estar refiriéndome a tal o cual id
- Page 66 and 67:
Invención a tres vocesAquiles (un
- Page 68 and 69:
Aquiles: Oh, sí, y a recuerdo: el
- Page 70 and 71:
Aquiles: Hm… hm… hm… hm… hm
- Page 72 and 73:
Pese a que todas las precedentes so
- Page 74 and 75:
ordinaria: un Teorema es una afirma
- Page 76 and 77:
están bastante cerca de la inobser
- Page 78 and 79:
todo lo que se nos pueda ocurrir al
- Page 80 and 81:
0.1.2.3.MI12MIUMII212MUIU MIIU MIII
- Page 82 and 83:
FIGURA 12. Castillo celestial, de M
- Page 84 and 85:
convenientemente, llamémoslos A, B
- Page 86 and 87:
—Cualquier cosa que la LÓGICA te
- Page 88 and 89:
En consecuencia, vamos a definir lo
- Page 90 and 91:
Si se continúa en este retorno mil
- Page 92 and 93:
ventaja.En el presente caso, dispon
- Page 94 and 95:
parece ser ‘más’, pese a que s
- Page 96 and 97:
la cual sería así un teorema. Tal
- Page 98 and 99:
144, pero, ¿cuántos, de entre qui
- Page 100 and 101:
precisión entre aquellos casos don
- Page 102 and 103:
FIGURA 13. Liberación, de M. C. Es
- Page 104 and 105:
estos pasos parece obvio, el result
- Page 106 and 107:
marco de la teoría de los números
- Page 108 and 109:
FIGURA 14. Mosaico II, de M. C. Esc
- Page 110 and 111:
dígame, ¿cuál ES la solución?Aq
- Page 112 and 113:
con la pregunta anterior. Tendríam
- Page 114 and 115:
teoremas”. Ahora bien, si queremo
- Page 116 and 117:
pero si uno retrocede por etapas y
- Page 118 and 119:
Existen allí formas reconocibles,
- Page 120 and 121:
equivalentes; pero en la may oría
- Page 122 and 123:
Fig ura y fond o en músicaTambién
- Page 124 and 125:
¿Cómo se llega a esto? Muy fácil
- Page 126 and 127:
zED x- es un teorema.Estas dos regl
- Page 128 and 129:
parque…Aquiles: Naturalmente. Est
- Page 130 and 131:
de reproducir los sonidos que lo de
- Page 132 and 133:
defectos de ninguna especie en su f
- Page 134 and 135:
que Ud. desee saber a quién le per
- Page 136 and 137:
226230235(1685 - 1750)FIGURA 19. Ú
- Page 138 and 139:
veamos…La Tortuga toma el Grial G
- Page 140 and 141:
El sig nificad o explícito d el Co
- Page 142 and 143:
¿Y qué pasa con los significados
- Page 144 and 145:
Unas pocas palabras acerca de El ar
- Page 146 and 147:
nuevo sistema? Difícilmente. He pr
- Page 148 and 149:
ocupó de disipar aquel género de
- Page 150 and 151:
injusto hacia Euclides, quien estab
- Page 152 and 153:
carácter de auténtica nueva cuali
- Page 154 and 155:
componente central sigue siendo la
- Page 156 and 157:
Zenón siempre da mate a Egbert en
- Page 158 and 159:
trazada entre la coherencia física
- Page 160 and 161:
conclusión final no es reconciliab
- Page 162 and 163:
Si suponemos que la lógica es part
- Page 164 and 165:
por lo que la completitud del mismo
- Page 166 and 167:
Pequeño laberinto armónicoLa Tort
- Page 168 and 169:
frases, ¿o sí? Quiero decir en es
- Page 170 and 171:
Tortuga: Correcto. Se tiene que sac
- Page 172 and 173:
Tortuga: El no habla español. Si q
- Page 174 and 175:
Aquiles: ¿Qué? ¿Quiere decir que
- Page 176 and 177:
Genio? ¿Cuál es tu deseo?Genio: T
- Page 178 and 179:
Aquiles: Gracias, oh Ğinn, y a DIO
- Page 180 and 181:
a otras. Pero ocasionalmente —de
- Page 182 and 183:
abatido. Eso es algo digno de aplau
- Page 184 and 185:
cae…)¡Oh, no! ¿Qué podemos hac
- Page 186 and 187:
Tortuga: Dicen —aunque personalme
- Page 188 and 189:
Aquiles: ¿Qu… qué es eso?Tortug
- Page 190 and 191:
sólo Ud., sino también esta miser
- Page 192 and 193:
REALMENTE quiero encontrar esa bote
- Page 194 and 195:
probablemente escuchando la espanto
- Page 196 and 197:
FIGURA 26. Diagrama de la estructur
- Page 198 and 199:
lo desorienta hasta enajenarle todo
- Page 200 and 201:
llamada NO MBRE que le seleccione u
- Page 202 and 203:
Como se ve, no se ha caído en una
- Page 204 and 205:
Diagrama D. En la figura 29a, el Di
- Page 206 and 207:
FIGURA 31. Una RTR de los números
- Page 208 and 209:
un 5 y un 6, señalados por las fle
- Page 210 and 211:
necesarias dos líneas: una para de
- Page 212 and 213:
G, así, ingresa a la familia INT.
- Page 214 and 215:
vacías de diferentes dimensiones q
- Page 216 and 217:
“diagramas de Fey nman”— son
- Page 218 and 219:
renormalizados. Así, para comprend
- Page 220 and 221:
FIGURA 36. Pez y escamas, de M. C.
- Page 222 and 223:
pregunta:¿Cuándo son similares do
- Page 224 and 225:
efectuarse. Ésta es la esencia de
- Page 226 and 227:
años aparecería una computadora (
- Page 228 and 229:
Canon por aumentación interválica
- Page 230 and 231:
Tortuga: ¿Más té, Aquiles?Aquile
- Page 232 and 233:
una pieza de tres movimientos consi
- Page 234 and 235:
C A P Í T U L O V ILa localizació
- Page 236 and 237:
Isomorfismos misteriosos e isomorfi
- Page 238 and 239:
Plantear si los fragmentos de un di
- Page 240 and 241:
mecanismo adecuado para interpretar
- Page 242 and 243:
método de desciframiento; igual oc
- Page 244 and 245:
En estos ejemplos de desciframiento
- Page 246 and 247:
tray ecto en espiral. Si desenroll
- Page 248 and 249:
invertida respecto a la anterior. L
- Page 250 and 251:
una teoría “gramola” de la sig
- Page 252 and 253:
era una propiedad intrínseca de es
- Page 254 and 255:
. . . . .. . . . . . . .. . . . . .
- Page 256 and 257:
sistematización, y tan poca intele
- Page 258 and 259:
CTCTTATGACGCTGACAACCGTCCTTTACTTGTCA
- Page 260 and 261:
Fantasía cromática y furiaDespué
- Page 262 and 263:
contradicción ocurre cuando alguie
- Page 264 and 265:
Aquiles: ¡Ud. estaba tratando de e
- Page 266 and 267:
pequeñoenciclotitánica Verdad Ete
- Page 268 and 269:
C A P Í T U L O V I IEl cálculo p
- Page 270 and 271:
~P~~PQ ′~Q ′<P∧~Q ′>~<P∧~
- Page 272 and 273:
Así y todo, aún podemos preguntar
- Page 274 and 275:
]<Q ⊃<P∧Q >>]<P⊃<Q ⊃<P∧Q
- Page 276 and 277:
Probablemente, el lector hay a adve
- Page 278 and 279:
lago”, lo cual podría ser dicho,
- Page 280 and 281:
6) <~Q⊃~~P>7) [8) ~Q9) <~Q⊃~P>1
- Page 282 and 283:
Este ejemplo manifiesta el poder de
- Page 284 and 285:
obtiene el teorema xU. ¿Puede uste
- Page 286 and 287:
Atajos y reg las d erivad asCuando
- Page 288 and 289:
Reflexiones sobre la fortaleza y la
- Page 290 and 291:
7) P traslado de llínea 38) ~~P do
- Page 292 and 293:
<P⊃<Q ⊃P>><P⊃<Q ∨~P>><<P∧
- Page 294 and 295:
hacia atrás. Pero temo que siempre
- Page 296:
Figura 43. He aquí una corta secci
- Page 299 and 300:
Tortuga: Muchas gracias.Aquiles: A
- Page 301 and 302:
rama de la matemática que es la te
- Page 303 and 304:
Variables y términosNaturalmente,
- Page 305 and 306:
2 más 2no esigual a3:Si 1 esigual
- Page 307 and 308:
(b·b)=SSO~∃b:(b·b)=SSO(abierta)
- Page 309 and 310:
O, como sabemos que la igualdad es
- Page 311 and 312:
al número 7, sino con respecto a t
- Page 313 and 314:
∀c:~∃b:(SSO ·b)=c∀c:∃b:~(S
- Page 315 and 316:
COMBINACIONESSi x e y son fórmulas
- Page 317 and 318:
AXIOMA 1: ∀a:~Sa=OAXIOMA 2: ∀a:
- Page 319 and 320:
variable que esté cuantificada en
- Page 321 and 322:
Apliquemos la regla —como es usua
- Page 323 and 324:
2) ∀b:(SO·Sb)=((SO·b)+SO)3) (SO
- Page 325 and 326:
(a+O)=a2) ∀a:a= simetría(a+O)3)
- Page 327 and 328:
1) ∀a:a=a teoremaanterior2) Sa=Sa
- Page 329 and 330:
expresivas son mucho más amplias,
- Page 331 and 332:
acerca de las nociones que aquéllo
- Page 333 and 334:
Con esta nueva notación, podemos f
- Page 335 and 336:
10) S(d+Sc)=S(Sd+c) adición11) (d+
- Page 337 and 338:
* * * * *28) ∀c:∀d:(d+Sc)=(Sd+c
- Page 339 and 340:
(Sd+c)47) ] sacar48) <∀c:(c+d)=(d
- Page 341 and 342:
[En consecuencia, todos los d conmu
- Page 343 and 344:
teorema. En ese caso, el lector pue
- Page 345 and 346:
mostró que no se puede usar una cu
- Page 347 and 348:
Tortuga: Yo los encuentro muy atrac
- Page 349 and 350:
llamado Jōshū que vivió hasta la
- Page 351 and 352:
FIGURA 45. La Mezquita, de M. C. Es
- Page 353 and 354:
Tortuga: ¡Qué delicioso! Como si
- Page 355 and 356:
kōan ⇒ mensajerotranscripcióntr
- Page 357 and 358:
sobre sus manos.Tortuga: Se ve igua
- Page 359 and 360:
de Buda es algo sumamente elusivo,
- Page 361 and 362:
escuchar lo que ha escrito?Tortuga:
- Page 363 and 364:
sobre un precipicio. Sus manos no e
- Page 365 and 366:
interesante advertir que las existe
- Page 367 and 368:
Quienes se aproximen al Mumonkan co
- Page 369 and 370:
maestro enseñó nunca?”.Nansen r
- Page 371 and 372:
propensión lógica”. También el
- Page 373 and 374:
Mostrando su corto cay ado,Imparti
- Page 375 and 376:
FIGURA 50. Corteza, de M. C. Escher
- Page 377 and 378:
el mundo exterior?El zen y Tumbolia
- Page 379 and 380:
viejo cubo de madera ceñido con ta
- Page 381 and 382:
FIGURA 53. Tres esferas II, de M. C
- Page 383 and 384:
interrupciones, tal logro será com
- Page 385 and 386:
Conviene reparar en que, aun tomado
- Page 387 and 388:
REGLA ARITMÉTICA Ia: Un número cu
- Page 389 and 390:
n =1)3) 31111 regla2 (m= 2,n =11)4)
- Page 391 and 392:
generalizada a través de la siguie
- Page 393 and 394:
observación, en el Capítulo VIII,
- Page 395 and 396:
pertenecientes a la teoría de los
- Page 397 and 398:
) ....... 323 terminaen 3paresforma
- Page 399 and 400:
: ....... 636 dos puntos, dosseispu
- Page 401 and 402:
momento, por favor! Según la Propo
- Page 403 and 404:
Lógica Matemática, y representán
- Page 405 and 406:
no es un teorema de TNT”, luego,
- Page 407 and 408:
FIGURA 54. Cinta de Möbius II, de
- Page 409 and 410:
Aquiles: Muy bien, entonces. (Hace
- Page 411 and 412:
FIGURA 55. Pierre de Fermat.Aquiles
- Page 413 and 414:
problema y llegó a comprender que
- Page 415 and 416:
entonces, comienza la primera voz
- Page 417 and 418:
convertirse en hoy os —y vicevers
- Page 419 and 420:
[ATTACCA]
- Page 421 and 422:
Bloques y pericia en ajed rezUno de
- Page 423 and 424:
confusiones cuando un mismo sistema
- Page 425 and 426:
de treinta y seis. Desde el punto d
- Page 427 and 428:
observación de una molécula de AD
- Page 429 and 430:
El siguiente nivel de la jerarquía
- Page 431 and 432:
propio enunciado Lisp, como es lóg
- Page 433 and 434:
cierto núcleo mínimo de un compil
- Page 435 and 436:
los usuarios a la máquina misma (p
- Page 437 and 438:
cercenará lo que sigue.Si ha sido
- Page 439 and 440:
Los prog resos en materia d e intel
- Page 441 and 442:
sostenido y re bemol, provocan sent
- Page 443 and 444:
de que uno se ha dedicado a las com
- Page 445 and 446:
Se me ocurren otras dos preguntas.
- Page 447 and 448:
elaboradas con partículas virtuale
- Page 449 and 450:
síntesis, al usar modelos de bloqu
- Page 451 and 452:
las paredes no se vengan abajo, en
- Page 453 and 454:
… furmiga… y entonces, introduc
- Page 456 and 457:
FIGURA 60. [Adaptación del dibujo
- Page 458 and 459:
reduccionista de una colonia de hor
- Page 460 and 461:
árboles y no ver el bosque, Aquile
- Page 462 and 463:
ocurre en la excitación de las neu
- Page 464 and 465:
incluso ellas quienes afrontan la m
- Page 466 and 467:
Aquiles: ¿Y COMO encuentra Ud. las
- Page 468 and 469:
señal NO tiene finalidad. La típi
- Page 470 and 471:
FIGURA 61. Furmiga, de M. C. Escher
- Page 472 and 473:
equipos, cuy os miembros eran otros
- Page 474 and 475:
inferior o en un nivel superior. Un
- Page 476 and 477:
por el estilo.Aquiles: Eso suena co
- Page 478 and 479:
arriba. El cuadro MU es probablemen
- Page 480 and 481:
que lo hay a pasado por alto.Cangre
- Page 482 and 483:
colonias de hormigas más creativas
- Page 484 and 485:
FIGURA 63. Cuando se producen emigr
- Page 486 and 487:
mantenido así.Tortuga: ¿Qué tipo
- Page 488 and 489:
C A P Í T U L O X ICerebro y pensa
- Page 490 and 491:
correspondiente. Las descripciones
- Page 492 and 493:
FIGURA 65. Dibujo esquemático de u
- Page 494 and 495:
FIGURA 66. El cerebro humano, visto
- Page 496 and 497:
descubrió que todas las ratas que
- Page 498 and 499:
del nervio óptico, a la articulaci
- Page 500 and 501:
Figura 67. Respuestas de determinad
- Page 502 and 503:
sistema visual tenga completo, ante
- Page 504 and 505:
parece obvio que no percibimos simp
- Page 506 and 507:
estado cerebral no bastaría con de
- Page 508 and 509:
consiguiente, los símbolos represe
- Page 510 and 511:
película, mi interlocutor comenzar
- Page 512 and 513:
muy lejos de haber sido resuelto, a
- Page 514 and 515:
de alguien, habría que incluir tod
- Page 516 and 517:
analogía como para sugerir que tod
- Page 518 and 519:
FIGURA 69. La construcción de un a
- Page 520 and 521:
imagina mundos hipotéticos: varian
- Page 522 and 523:
simultáneamente de las neuronas qu
- Page 524 and 525:
programa ‘sabe’ escribir oracio
- Page 526 and 527:
algún punto crítico, se cierre un
- Page 528 and 529:
Il brilgue: les tôves lubricillSe
- Page 530 and 531:
«Garde-toi du Jaseroque, moLa gueu
- Page 532 and 533:
Son glaive vorpal en main, iT-à la
- Page 534 and 535:
Pendant qu’il pense, tout uffuLe
- Page 536 and 537:
Un deux, un deux, par le miliLe gla
- Page 538 and 539:
«As-tu tué le Jaseroque?Viens à
- Page 540 and 541:
Il brilgue: les tôves lubricillSe
- Page 542 and 543:
C A P Í T U L O X I IMente y pensa
- Page 544 and 545:
Así, por una parte, podemos abando
- Page 546 and 547:
traducir es más directa y a que, g
- Page 548 and 549:
imaginación para ayudarnos a repro
- Page 550 and 551:
Ahora que hemos llevado bien lejos
- Page 552 and 553:
nivel tecnológico, etc. Por ejempl
- Page 554 and 555:
que los establezcamos como rutina p
- Page 556 and 557:
de los modos coloquiales de expresi
- Page 558 and 559:
contaremos entonces con alguna arti
- Page 560 and 561:
enumerar las clases de pensamientos
- Page 562 and 563:
conceptos anteriores, y se podría
- Page 564 and 565:
mismo tiempo que lo hago y o. Por e
- Page 566 and 567:
divorciar los subsistemas del cereb
- Page 568 and 569:
una forma que no es accesible a una
- Page 570 and 571:
Aria con variaciones diversasAquile
- Page 572 and 573:
Variaciones Goldberg. De modo que a
- Page 574 and 575:
Aquiles: Por cierto, volvamos. Quer
- Page 576 and 577:
Aquiles: Bueno, está bien…Tortug
- Page 578 and 579:
Tortuga: Y el número de hechos imp
- Page 580 and 581:
justifica. Por supuesto, en muchos
- Page 582 and 583:
16, apenas uno más que el 15, el n
- Page 584 and 585:
tienen poco que ver con el tema ori
- Page 586 and 587:
¿Quién puede estar tocando a esta
- Page 588 and 589:
otras por el estilo, han aflorado m
- Page 590 and 591:
ver por qué el del orden versus ca
- Page 592 and 593:
haremos a través del lenguaje BuD.
- Page 594 and 595:
más extensos. Una instrucción de
- Page 596 and 597:
Explicaremos ahora otros dos aspect
- Page 598 and 599:
Así, la función 2 3n es una funci
- Page 600 and 601:
preguntas, aplicadas a la maravillo
- Page 602 and 603:
de tal sistema. ¿Qué significa el
- Page 604 and 605:
Llamaremos Programa Azul a este gé
- Page 606 and 607:
Azul, tendría que tener un número
- Page 608 and 609:
r(4): ,4 1 4 2 1 3 5 6 2 . .. . . .
- Page 610 and 611:
FIGURA 73. Georg Cantor.Esto puede
- Page 612 and 613:
cogida en sus propias redes.La repe
- Page 614 and 615:
y además con la respuesta SI en to
- Page 616 and 617:
que existe un número que tiene la
- Page 618 and 619:
pero que, aparentemente, no puede s
- Page 620 and 621:
Frecuentemente, se habla de “recu
- Page 622:
torre.Tortuga: Oh, qué agradable.(
- Page 625 and 626:
Qué hermosa vista, Aquiles. Me ale
- Page 627 and 628:
Tortuga: Creo que llamaré “quine
- Page 629 and 630:
ESTA ESCRITO EN VIEJAS JARRAS DE MO
- Page 631 and 632:
Gracias, Sr. T, por su lúcido escl
- Page 633 and 634:
Ahora, describiremos una noción ma
- Page 635 and 636:
626.262.636.223.123.262.111.666.611
- Page 637 and 638:
A fin de ser más concretos, vamos
- Page 639 and 640:
propiedad, y representarla. La prop
- Page 641 and 642:
ahora todas lasvariables librespor
- Page 643 and 644:
que aparece en el Aire en la cuerda
- Page 645 and 646:
Se ve claramente cuán profundament
- Page 647 and 648:
menos) una verdad que no es un teor
- Page 649 and 650:
al sistema y una afirmación acerca
- Page 651 and 652:
todos los enunciados de la familia
- Page 653 and 654:
Si es que vamos a incorporar a ~G c
- Page 655 and 656:
como 24”. Se tiene que decir, “
- Page 657 and 658:
nuestro primer contacto con ella. S
- Page 659 and 660:
extensión de TNT! Los banqueros no
- Page 661 and 662:
debe ser rechazado sin análisis. H
- Page 663 and 664:
Cantatatata… de cumpleañosUn bon
- Page 665 and 666:
ignorante y ansiosa por tomar en cu
- Page 667 and 668:
deberíamos arbitrariamente denomin
- Page 669 and 670:
¿Hay algún motivo para confiar o
- Page 671 and 672:
toda clase de bifurcaciones en teor
- Page 673 and 674:
PAR D E PRUEBA (TNT+G ω ){a,a′}U
- Page 675 and 676:
sistema no consigue capturar, en un
- Page 677 and 678:
irrefutable en contra de la posibil
- Page 679 and 680:
sentido, precisamente porque la men
- Page 681 and 682:
siempre se pierde determinada “es
- Page 683 and 684:
programa que elabore nuevos program
- Page 685 and 686:
iniciación, por lo cual no puede s
- Page 687 and 688:
perjuicio que en beneficio de Simpl
- Page 689 and 690:
FIGURA 77. Las sombras, de René Ma
- Page 691 and 692:
Magdalena, y se llamaPensamientos e
- Page 693 and 694:
permanecerá;Cual cuando me llame l
- Page 695 and 696:
Así, mi pipacontemplando,Tantas co
- Page 697 and 698:
¡Encantador! Sólo hay una cosa qu
- Page 699 and 700:
FIGURA 79. Virus del mosaico del ta
- Page 701 and 702:
Aquiles: Me pregunto si era ése el
- Page 703 and 704:
al derecho? Nunca he oído nada que
- Page 705 and 706:
Cangrejo: Creo que puedo adivinar e
- Page 707 and 708:
(h) Ha nacido una “galaxia”.(k)
- Page 709 and 710:
FIGURA 82. El aire y la canción, d
- Page 711 and 712:
C A P Í T U L O X V IAutorref y au
- Page 713 and 714:
FIGURA 83.La figura 84, que exhibe
- Page 715 and 716:
.......es infinitamente extenso”e
- Page 717 and 718:
valor de MO LD E será el de cierta
- Page 719 and 720:
autorreproducción autodirigida, mi
- Page 721 and 722:
que el programa, en alguna medida,
- Page 723 and 724:
ello, ¿dónde habría algo válida
- Page 725 and 726:
cantidad de simplificaciones, y por
- Page 727 and 728:
El paso 1 suprime la A, así que no
- Page 729 and 730:
las dos cadenas complementarias (pr
- Page 731 and 732:
derecha de estaunidadinc ———
- Page 733 and 734:
donde la flecha señala la unidad a
- Page 735 and 736:
FIGURA 87. El Código Tipogenético
- Page 737 and 738:
Adviértase el giro a la izquierda
- Page 739 and 740:
“cadenas hijas”, las cuales atr
- Page 741 and 742:
genética verdadera.AD N y nucleót
- Page 743 and 744:
FIGURA 92. La estructura del ADN se
- Page 746 and 747:
FIGURA 93. Modelo molecular de la d
- Page 748 and 749:
asp ——— ácido aspárticocis
- Page 750 and 751:
UCAGU C Afen ser tirfen ser tirleu
- Page 752 and 753:
compleja que en la Tipogenética. E
- Page 754 and 755:
de partículas es tan desmesurado q
- Page 756 and 757:
El nombre verdadero del mencionado
- Page 758:
proteínas adquieren sentido sólo
- Page 761 and 762:
que pase consecutivamente por las c
- Page 763 and 764:
Una enzima actualiza determinados r
- Page 765 and 766:
1. desentrelazar ambas cadenas;2.
- Page 767 and 768:
isomórficamente el proceso físico
- Page 769 and 770:
licencia poética, el “Dogma Cent
- Page 771 and 772:
(ARN ⇒proteínas)⇔(N ⇒metaTNT
- Page 773 and 774:
FIGURA 99. El Correspondogma Centra
- Page 776 and 777:
FIGURA 100. El Código Gödel. Bajo
- Page 778 and 779:
sonidos⇔sonidos producidospor el
- Page 780 and 781:
“Siempre existe undisco inejecuta
- Page 782 and 783:
“en código” (es decir, el Cód
- Page 784 and 785:
estructuralesque forman los“cuerp
- Page 786:
moléculas (o estructuras de nivel
- Page 789 and 790:
∃a:∃a′:<PAR D E PRUEBA TNT{a,
- Page 791 and 792:
medio preciso de descripción del m
- Page 793 and 794:
naturaleza, aparentemente, ¡ama la
- Page 795 and 796:
que el “organismo” total —el
- Page 797 and 798:
empleado en el desarrollo de lengua
- Page 799 and 800:
pasteles. Tengo tanta hambre que se
- Page 801 and 802:
no había tenido nunca algún entre
- Page 803 and 804:
Cangrejo: Es triste decirlo, pero e
- Page 805 and 806:
componer es muy diferente a como y
- Page 807 and 808:
gran esfuerzo de concentración, es
- Page 809 and 810:
Tortuga: Es una música peculiar,
- Page 811 and 812:
C A P Í T U L O X V I IChurch, Tur
- Page 813 and 814:
—El otro día leí en el periódi
- Page 815 and 816:
Hay quienes pueden pensar que esta
- Page 817 and 818:
FIGURA 105. Srinivasa Ramanuyan y u
- Page 819 and 820:
u 3 + v 3 = x 3 + y 3a lo largo de
- Page 821 and 822:
Después, Hardy compara a Ramanuy a
- Page 823 and 824:
Church-Turing:TESIS CHURCH-TURING,
- Page 825 and 826:
quemada son todos elementos con una
- Page 827 and 828:
Personalmente, me inclinaría por c
- Page 829 and 830:
organización— que, pongamos por
- Page 831 and 832:
se trata de un acto, en principio,
- Page 833 and 834:
modo en que el funcionamiento sin e
- Page 835 and 836:
hecho de que las neuronas siempre e
- Page 837 and 838:
interior el cálculo preposicional.
- Page 839 and 840:
fórmula de TNT; en consecuencia, d
- Page 841 and 842:
cuando observamos una pintura y sen
- Page 843 and 844:
en parte desencadenadores y en part
- Page 845 and 846:
y sus excitaciones, y sobre la form
- Page 847 and 848:
FIGURA 110. “Toma un bloque rojo
- Page 849 and 850:
nominales pueden contener números
- Page 851 and 852:
SHRDLU: DE ACUERDO.Dr. Rony W. Tige
- Page 853 and 854:
SHRDLU: PORQUE UD. ME LO PIDIÓ.Dr.
- Page 855 and 856:
42. Eta Oin: ¿por qué lo dejaste
- Page 857 and 858:
disfrutó mucho con esta actividad.
- Page 859 and 860:
fácilmente si quien responde es un
- Page 861 and 862:
puede suceder.(3) La objeción mate
- Page 863 and 864:
atención el hecho de que el trabaj
- Page 865 and 866:
Hablando más seriamente, tengo la
- Page 867 and 868:
manipulación simbólica de expresi
- Page 869 and 870:
complicaciones aparecidas en la tra
- Page 871 and 872:
movida, los parámetros variables e
- Page 873 and 874:
FIGURA 114. PruebaPons Asinorum(des
- Page 875 and 876:
escala, es discordante; sin duda, u
- Page 877 and 878:
responsables de la compleja noción
- Page 879 and 880:
FIGURA 115. Árbol sin fin del obje
- Page 881 and 882:
bicicleta, tengo que efectuar una c
- Page 883 and 884:
aleja de MU mediante la construcci
- Page 885 and 886:
perfeccionar su propio sentido de l
- Page 887 and 888:
genética en la forma modular, y se
- Page 889 and 890:
a las de TNT, y conectivos y cuanti
- Page 891 and 892:
contradicción, inclusive— alberg
- Page 893 and 894:
considerar a cada categoría como c
- Page 895 and 896:
individual, se extrae la impresión
- Page 897 and 898:
CONFUNDIDO MAESTRO CAMINÓ DESDE UN
- Page 899 and 900:
¿Gramáticas d e la música?Tenemo
- Page 901 and 902:
manipulación de los bloques;4. div
- Page 903 and 904:
Oigamos otros comentarios de Winogr
- Page 905 and 906:
FIGURA 118. Representación procedi
- Page 907 and 908:
incorporada una orden para que se h
- Page 909 and 910:
ContrafactusEl Cangrejo ha invitado
- Page 911 and 912:
piel. Ha estado lloviznando toda la
- Page 913 and 914:
Cangrejo: Ninguno en especial. Simp
- Page 915 and 916:
pelota. Fortunatos arranca botando
- Page 917 and 918:
ejemplo, ¿cómo se habría visto l
- Page 919 and 920:
C A P Í T U L O X I XIntelig encia
- Page 921 and 922:
Creo que las situaciones “casi”
- Page 923 and 924:
tanto matemáticos como físicos y
- Page 925 and 926:
La estructura autoincluida de un ma
- Page 927 and 928:
El problema es: “¿En qué difier
- Page 929 and 930:
oun círculo con formas similares e
- Page 931 and 932:
repetir este proceso hasta descubri
- Page 933 and 934:
FIGURA 123. Una pequeña porción d
- Page 935 and 936:
otras cosas. ¡Pero en esto reside
- Page 937 and 938:
capaz de contraer los conceptos, cu
- Page 939 and 940:
Metad escripcionesLlegamos ahora a
- Page 941 and 942:
todo otro aspecto. Así, ambas noci
- Page 943 and 944:
FIGURA 129. Problema de Bongard 61.
- Page 945 and 946:
Conexiones con otros tipos d e pens
- Page 947 and 948:
mensaje; luego, la significación d
- Page 949 and 950:
pueden servir como modelo de la man
- Page 951 and 952:
descubrimiento un tanto obvio, toda
- Page 953 and 954:
lámina sin título era una versió
- Page 955 and 956:
considerados en forma abstracta. ¿
- Page 957 and 958:
refacción es “redonda e inflada
- Page 959 and 960:
etapas; primero, advertí la existe
- Page 961 and 962:
anterioridad, pero estos actos son
- Page 963 and 964:
Infortunadamente, no se abrió.Afor
- Page 965 and 966:
(En lo que sigue, la expresión “
- Page 967 and 968:
serían muy rápidas, pero su desem
- Page 969 and 970:
sean a Bach lo que Bach es a las to
- Page 971 and 972:
Canon perezosoEsta vez, encontramos
- Page 973 and 974:
por supuesto. Ese piano-perezoso se
- Page 975 and 976:
C A P Í T U L O X XBucles Extraño
- Page 977 and 978:
las disparatadas objeciones de la T
- Page 979 and 980:
Un jueg o automodificanteUna primer
- Page 981 and 982:
diversos perfeccionamientos de TNT.
- Page 983 and 984:
Jerarquía Enredada; abajo, está e
- Page 985 and 986:
software, el de los símbolos, se s
- Page 987 and 988:
del sistema, en búsqueda de una au
- Page 989 and 990:
¡como si todo el mundo estuviese d
- Page 991 and 992:
una gran cantidad de incoherencias
- Page 993 and 994:
hasta la cual puede penetrar en su
- Page 995 and 996:
al análisis de las curiosas consec
- Page 997 and 998:
FIGURA 137. Sentido común, de Ren
- Page 999 and 1000:
la pintura interior, recogemos el m
- Page 1001 and 1002:
FIGURA 140. Papirotada. [Dibujo del
- Page 1003 and 1004:
para piano que para juzgar una pied
- Page 1005 and 1006:
propias palabras, Magritte asienta
- Page 1007 and 1008:
debemos dar respuesta es: “¿Por
- Page 1009 and 1010:
con la traducción de enunciados te
- Page 1011 and 1012:
queremos decir cuando decidimos des
- Page 1013 and 1014:
respuesta sería “no”. A fin de
- Page 1015 and 1016:
FIGURA 142. Galería de grabados, d
- Page 1017 and 1018:
FIGURA 144. Una versión reducida d
- Page 1019 and 1020:
FIGURA 146. Otra forma de reducció
- Page 1021 and 1022:
FIGURA 147. El esquema de modulaci
- Page 1024 and 1025:
FIGURA 148. Dos ciclos completos de
- Page 1026 and 1027:
está nuestro anfitrión?Tortuga: C
- Page 1028 and 1029:
Aquiles: Oh, ¡qué vergüenza!Cang
- Page 1030 and 1031:
Tortuga: Nada de trucos, Aquiles, n
- Page 1032 and 1033:
voluntad. Es como si mi mente, cuan
- Page 1034 and 1035:
fervientemente poder llegar a conoc
- Page 1036 and 1037:
medio tercio de segundo, aparece un
- Page 1038 and 1039:
Cangrejo: Hmm… debo decir que es
- Page 1040 and 1041:
caso…Cangrejo: ¡Las piezas en el
- Page 1042 and 1043:
todo listo; puse tazas, cucharas, y
- Page 1044 and 1045:
(En la pantalla aparece una imagen
- Page 1046 and 1047:
Pantalla X: EL PUENTE DE FORTH A FI
- Page 1048 and 1049:
escribir una fuga sin ellos. ¿Empl
- Page 1050 and 1051:
Aquiles: Hay algo que no me satisfa
- Page 1053 and 1054:
FIGURA 152. Última página del Ric
- Page 1055 and 1056:
finalmente me estoy acostumbrando a
- Page 1057 and 1058:
14. Mosaico II, de M. C. Escher.15.
- Page 1059 and 1060:
39.40.41.42.43.44.45.46.47.48.49.50
- Page 1061 and 1062:
119. Problema de Bongard 51.120. Pr
- Page 1063 and 1064:
BibliografíaLa presencia de dos as
- Page 1065 and 1066:
filosóficas, etc. Es una obra muy
- Page 1067 and 1068:
New York: Harper & Row, 1972. Una a
- Page 1069 and 1070:
utilizados y violados los límites
- Page 1071 and 1072:
descripción fascinante de cómo se
- Page 1073 and 1074:
Mass.: Sinauer Associates, 1976. Pa
- Page 1075 and 1076:
Mass.: Harvard University Press, Be
- Page 1077 and 1078:
de teoría de conjuntos y de teorí
- Page 1079 and 1080:
escala del cerebro a fin de elabora
- Page 1081 and 1082:
Melnechuk, y F. O. Schmitt, eds. Th
- Page 1083 and 1084:
CréditosFiguras: Fig. 1, Johann Se
- Page 1085 and 1086:
adaptado de Modelos de computación
- Page 1087 and 1088:
Notas
- Page 1089 and 1090:
[1] H. T. David y A. Mendel. The Ba
- Page 1091 and 1092:
[3] Ibíd., p. 260. <<
- Page 1093 and 1094:
[5] Lady A. A. Lovelace, comentario
- Page 1095 and 1096:
[7] Ibíd., p. 40. <<
- Page 1097 and 1098:
[1] Lewis Carroll, “What the Tort
- Page 1099 and 1100:
[1] Herbert Meschkowski, Non-Euclid
- Page 1101 and 1102:
[1] George Steiner, After Babel, pp
- Page 1103 and 1104:
† Secuencia obtenida de la web de
- Page 1105 and 1106:
[2] Ibíd., p. 178. <<
- Page 1107 and 1108:
† Véase la nota del Editor Digit
- Page 1109 and 1110:
[1] Paul Reps, Zen Flesh, Zen Bones
- Page 1111 and 1112:
[3] Ibíd., pp. 111-12. <<
- Page 1113 and 1114:
[5] Reps, p. 124. <<
- Page 1115 and 1116:
[7] Reps, p. 121. <<
- Page 1117 and 1118:
[9] Zen Buddhism, p. 31. <<
- Page 1119 and 1120:
[11] Ibíd., p. 120. <<
- Page 1121 and 1122:
[13] Reps, pp. 89-90. <<
- Page 1123 and 1124:
[2] Steven Rose, The Conscious Brai
- Page 1125 and 1126:
[4] Dean Wooldridge, Mechanical Man
- Page 1127 and 1128:
[2] Frank L. Warrin, The New Yorker
- Page 1129 and 1130:
[4] Versión española de Jaime de
- Page 1131 and 1132:
[2] C. H. MacGillavry, Symmetry Asp
- Page 1133 and 1134:
[1] J. M. Jauch, Are Quanta Real?,
- Page 1135 and 1136:
[1] El título del artículo de Gö
- Page 1137 and 1138:
[2] Ibíd., p. 48. <<
- Page 1139 and 1140:
[4] M.C. Escher, The Graphic Work o
- Page 1141 and 1142:
[6] E. Goffman, Frame Analysis, p.
- Page 1143 and 1144:
[1] Stanislaw Ulam, Adventures of a
- Page 1145 and 1146:
[3] Ibíd., p. 375. <<
- Page 1147 and 1148:
[5] Newman, p. 375. <<
- Page 1149 and 1150:
[7] Ibíd., p. 375-6. <<
- Page 1151 and 1152:
[9] Lucas en Anderson, p. 44. <<
- Page 1153 and 1154:
[11] Ibíd., p. 53. <<
- Page 1155 and 1156:
[1] Alan M. Turing, “Computing Ma
- Page 1157 and 1158:
[3] Ibíd., p. 6. <<
- Page 1159 and 1160:
[5] Ibíd., p. 6. <<
- Page 1161 and 1162:
[7] Ibíd., p. 14-24. <<
- Page 1163 and 1164:
[9] Vinton Cerf, “Parry Encounter
- Page 1165 and 1166:
[11] Ibíd., p. 9-10. <<
- Page 1167 and 1168:
[13] Ibíd., p. 106. <<
- Page 1169 and 1170:
[15] Art-Language, Vol. 3, No. 2, m
- Page 1171 and 1172:
[17] Ibíd., p. 175. <<
- Page 1173 and 1174:
[19] Terry Winograd, Understanding
- Page 1175 and 1176:
[21] Ibíd., p. 171-2. <<
- Page 1177 and 1178:
[2] Ibíd., p. 140. <<
- Page 1179 and 1180:
[4] David E. Rumelhart, “Notes on
- Page 1181 and 1182:
[6] Marvin Minsky, “Steps Toward
- Page 1183 and 1184:
[1] A. L. Samuel, “Some Moral and
- Page 1185 and 1186:
[3] Suzi Gahlik, Magritte, p. 97. <
- Page 1187:
[5] H. T. David, J. S. Bach’s Mus
Inappropriate
Loading...
Inappropriate
You have already flagged this document.
Thank you, for helping us keep this platform clean.
The editors will have a look at it as soon as possible.
Mail this publication
Loading...
Embed
Loading...
Delete template?
Are you sure you want to delete your template?
DOWNLOAD ePAPER
This ePaper is currently not available for download.
You can find similar magazines on this topic below under ‘Recommendations’.