No 3 - Polish Journal of Microbiology

POLSKIE TOWARZYSTWO MIKROBIOLOGÓW 

POLISH SOCIETY OF MICROBIOLOGISTS 

Polish Journal of Microbiology 

I am pleased to inform you that Polish Journal of Microbiology has been selected 

for coverage in Thomson Scientific products and customers information services. 

Beginning with No 1, Vol. 57, 2008 information on the contents of the PJM is 

included in: Science Citation Index Expanded (ISI) and Journal Citation Reports 

(JCR)/Science Edition. 

Stanisława Tylewska-Wierzbanowska 

Editor in Chief 

2011


formely Acta Microbiologica Polonica 

2011, Vol. 60, No 3 

MINIREWIEV 

CONTENTS 

An update on some structural aspects of the mighty miniwall 

MARKIEWICZ Z., POPOWSKA M. ......................................................................................... 181 

ORIGINAL PAPERS 

A new rapid and cost-effective method for detection of phages, ICEs and virulence factors encoded by Streptococcus pyogenes 

BOREK A.L.,WILEMSKA J., IZdEBSKI R., HRYNIEWICZ W., SITKIEWICZ I. ......... ....................................... 187 

Expression of Helicobacter pylori ggt gene in baculovirus expression system and activity analysis of its products 

MEI KONG, MING xU, YA-LONG HE, YOU-LI ZHANG ..................................................................... 203 

Extracellular xylanase production by Fusarium species in solid state fermentation 

ARABI M.I.E., BAKRI Y., JAWHAR M. ...................................................................................... 209 

Screening of Actinomycetes from mangrove ecosystem for L-asparaginase activity 

and optimization by response surface methodology 

USHA R., MALA K.K., VENIL C.K., PALANISWAMY M. ..................................................................... 213 

Chitin-glucan complex production by Schizophyllum commune submerged cultivation 

SMIRNOU d., KRCMAR M., PROCHAZKOVA E. ........................................................................... 223 

Inhibition of lactophage activity by quinolinilporphyrin and its zinc complex 

VOdZINSKA N., GALKIN B., ISHKOV Y., KIRICHENKO A., KONdRATYUK A., FILIPOVA T. ................................ 229 

A two-step strategy for molecular typing of multidrug-resistant Mycobacterium tuberculosis clinical isolates from Poland 

JAGIELSKI T., AUGUSTYNOWICZ-KOPEć E., PAWLIK K., dZIAdEK J., ZWOLSKA Z., BIELECKI J. .......................... 233 

A comparative study on the activity and antigenicity of truncated and full-length forms of streptokinase 

ARABI R., ROOHVANd F., NOROUZIAN d., SARdARI S., AGHASAdEGHI M.R., KHANAHMAd H., 

MEMARNEJAdIAN A., MONTEVALLI F. ................................................................................... 243 

Infections caused by RSV among children and adults during two epidemic seasons 

PANCER K., CIąćKA A., GUT W., LIPKA B., MIERZEJEWSKA J., MILEWSKA-BOBULA B., SMORCZEWSKA-KILJAN A., 

JAHNZ-RÓżYK K., dZIERżANOWSKA d., MAdALIńSKI K., LITWIńSKA B. ................................................ 253 

detection of Giardia intestinalis assemblages A, B and d in domestic cats from Warsaw, Poland 

JAROS d., ZYGNER W., JAROS S., WędRYCHOWICZ H. .................................................................... 259 

SHORT COMMUNICATIONS 

Evaluation of a rapid culture-based screening test for detection of methicillin resistant Staphylococcus aureus 

FWITY B., LOBMANN R., AMBROSCH A. .................................................................................. 265 

Inhibition of fibroblast apoptosis by Borrrelia afzelii, Coxiella burnetii and Bartonella henselae 

CHMIELEWSKI T., TYLEWSKA-WIERZBANOWSKA S. ............................................................................ 269 

LETTER TO THE EdITOR ......................................................................................................... 273 

INSTRUCTIONS TO AUTHORS ANd FULL TExT ARTICLES (IN PdF FORM) AVAILABLE AT: 

www.microbiology.pl/pjm


2011, Vol. 60, No 3, 181–186 

MINIREVIEW 

An Update on Some Structural Aspects of the Mighty Miniwall 

In 1884 Christian Gram devised a staining procedure 

that allowed classifying almost all bacteria to one 

of two groups, the Gram-positive and Gram-negative 

bacteria. The simple staining procedure is still widely 

used almost 130 years later, with practically all bacteria 

being classified to one group or the other. However, it 

was not until many years after Gram’s invention that 

light was shed on the complexity of bacterial cell envelopes 

and the structures forming them. Studies of bacterial 

cell surfaces began in earnest in the 1950s and 

1960s, following the isolation by Park and Johnston 

(1949) of what were later found to be cell wall PG precursors 

and the purification of bacterial cell walls by e.g. 

Salton (1952, 1957) and Work (1957). The term “microdermatology” 

was coined. It was found that all bacteria, 

except for some notable exceptions, i.e. mycoplasmas, 

Planctomyces and Orientia tsutsugamushi contain 

peptidoglycan (PG, syn. murein). PG has never been 

found in chlamydia either, although the bacteria have 

a functional pathway for meso-diaminopimelate, one of 

the unique structural building bricks of the macromolecule 

(Pavelka, 2007). More recently, an interesting new 

phylum of PG-free bacteria, the Verrucomicrobia, has 

been established (Yoon et al., 2010). 

There has been a resurgence in studies on PG in the 

past few years fired, amongst others, by the increased 

prevalence of antibiotic resistance among bacteria 

that cause life-threatening infections and the need to 

find new agents that inhibit bacterial cell-wall biosynthesis 

(Bugg et al., 2011); the interaction of PG with 

innate immunity proteins (PG Recognition Proteins, 

ZdZISŁAW MARKIEWICZ* and MAGdALENA POPOWSKA 

department of Applied Microbiology, Institute of Microbiology, Poland 

Received 15 July 2011, accepted 30 July 2011 

Abstract 

Peptidoglycan (PG), the mighty miniwall, is the main structural component of practically all bacterial cell envelopes and has been the 

subject of a wealth of research over the past 60 years, if only because its biosynthesis is the target of many antibiotics that have successfully 

been used in the treatment of bacterial infections. This review is mainly focused on the most recent achievements in research on the 

modification of PG glycan strands, which contribute to the resistance of bacteria to the host immune response to infection and to their 

own lytic enzymes, and on studies on the spatial organization of the macromolecule. 

K e y w o r d s: glycan strands, N-acetylglucosamine (GlcNAc) and N-acetylmuramic acid (MurNAc) modifications, 

peptidoglycan (PG), spatial organization 

* Corresponding author: Z. Markiewicz; e-mail: markiez@biol.uw.edu.pl 

PGRPs or PGLYRPs) that are conserved from insects 

to animals and the mechanisms that lead to bacterial 

cell death (dziarski and Gupta, 2010; Kietzman and 

Tuomanen, 2011); last but not least, the role of d-amino 

acids, which are a universal component of PG, in nature 

(Cava et al., 2011). 

The main structure of PG involves linear glycan 

strands cross-linked by short peptides. “Normal”, that 

is unaltered, glycan chains, have universally been found 

to be composed of alternating N-acetylglucosamine 

(GlcNAc) and N-acetylmuramic acid (MurNAc) residues 

linked by β-1 → 4 bonds. The d-lactoyl group of 

each MurNAc residue is substituted by a peptide stem 

whose composition is most often L-Ala-γ-d-Glu-meso- 

A2pm (or L-Lys)-d-Ala-d-Ala in nascent PG, the last 

d-Ala residue being lost in the mature macromolecule. 

Cross-linking of the glycan strands generally occurs 

between the carboxyl group of d-Ala at position 4 and 

the amino group of the diamino acid at position 3, 

either directly or through a short peptide bridge. The 

unique chemical traits of PG thus include the presence 

of N-acetylmuramic acid, γ-bonded d-Glu, L-d 

(and even d-d) bonds and non-protein amino acids, 

e.g. 2,6-diaminopimelic acid (A2pm) (e.g. Cummins, 

1956; Work, 1957, 1961, 1969; Rogers, 1974; Glauner, 

1988; Höltje and Glauner, 1990; Markiewicz et al., 1983; 

Markiewicz, 1993; Vollmer et al., 2011). These structural 

features are basically retained in all bacteria, though 

many differences in the glycan strands, composition 

of the stem peptide and/or interpeptide bridge are 

known and are taken into account in the tri-digital

182 

PG classification system established by Schleifer and 

Kandler (1972). In some cases the differences may 

be quite extreme like, for example, the occurrence of 

mostly (75%) A2pm → A2pm (i.e. 3 → 3) crosslinks in 

Clostridium difficile PG (Peltier et al., 2011) 

Variations in the structure of the glycan strands of 

PG have recently been elegantly reviewed by Vollmer 

(2008). A review by davis and Weiser (2011) focuses 

specifically on the role of peptidoglycan modifications 

and their effects on the host immune response to infection. 

A unique modification of glycan strands is the 

presence of muramic δ-lactam, which occurs e.g. in 

the thick PG of Bacillus sp. and Clostridium sporogenes 

endospores. In Bacillus subtilis approximately every 

second MurNAc residue along the glycan strands is 

modified to muramic δ-lactam. The modification 

of MurNAc involves the action of two enzymes, the 

MurNAc deacetylase PdaA and the amidase Cwld. 

Studies with mutants lacking these enzymes have shown 

that intact endospores are formed but that the spores 

are not able to germinate since unmodified spore PG 

is not recognized by germination-specific hydrolases 

(Popham et al., 1996, Atrih and Foster, 2001; Gilmore 

et al., 2004). More recently, it has been demonstrated 

that in Bacillus anthracis germination is mediated 

by the action of germination-specific lytic enzymes 

(GSLEs), one of which is SleB. SleB functions independently 

as a lytic transglycosylase on both intact and 

fragmented cortex. Most of the muropeptide products 

that SleB generates are large and are potential substrates 

for other GSLEs present in the spore, such as a glucosaminidase 

that cleaves between N-acetylglucosamine 

and muramic-δ-lactam. SleB has two domains, the 

N-terminal domain is required for stable PG binding, 

while the C-terminal domain is the region of PG hydrolytic 

activity, which is dependent on cortex containing 

muramic-δ-lactam in order to carry out hydrolysis 

(dowd et al., 2008; Heffron et al., 2011). 

PdaA, mentioned above, is an example of several 

N-deacetylases found in different Gram-positive bacteria, 

which carry out the N-deacetylation of MurNAc or 

GlcNAc (or both) in polymerized PG. N-deacetylation 

of MurNAc was found to protect bacterial cell walls from 

degradation by lysozyme, an important factor of the 

innate immune system (Araki et al., 1971). These enzy- 

mes, which have a predicted extracytoplasmic location 

in the cell, have been thoroughly reviewed by Vollmer 

(2008). The N-deacetylase of Streptococcus pneumoniae 

(PgdA) has been shown to be a putative virulence factor 

(Vollmer and Tomasz, 2002). deacetylation of PG 

increases the positive charge of the cell wall, possibly 

contributing to protection of the pathogens against the 

binding of cationic antimicrobial peptides of the host 

organism. Similar observations were made more recently 

by Popowska et al. (2009) who found that a pgdA mutant 

Markiewicz Z. and Popowska M. 3 

of Listeria monocytogenes was more prone to autolysis 

and was more susceptible to cationic antimicrobial pep- 

tides, and by Meyrand et al. (2007) for Lactococcus lactis. 

In other studies, a mutant strain of L. monocytogenes 

lacking PdaA activity induced a massive IFN-beta response 

in a TLR2 and Nod1-dependent manner and was 

rapidly destroyed within macrophage vacuoles (Boneca 

et al., 2007; Corr and O’Neill, 2009) and in bone-marrow 

derived macro phages, pgdA mutants of L. mono cytogenes 

demonstrated intracellular growth defects and 

increased induction of cytokine transcriptional respon- 

ses that emanated from a phagosome and the cytosol 

(Rae et al., 2011). In Streptococcus suis expression of 

the pgdA gene was increased upon interaction of the 

bacterium with neutrophils in vitro as well as in vivo in 

experimentally inoculated mice, suggesting that S. suis 

may enhance PG N-deacetylation under these conditions. 

Evaluation of the pgdA mutant in both the Cd1 

murine and the porcine models of infection revealed 

a significant contribution of the pgdA gene to the 

virulence traits of S. suis (Fittipaldi et al., 2008). In an 

interesting study, it was found that neither PgdA inactivation 

nor PgdA overexpression in Lactobacillus lactis 

leading to different levels of PG deacetylation confers 

any advantage in the persistence of this bacterium in 

the gastrointestinal tract and its ability to enhance host 

immune responses (Watterlot et al., 2010). Bacterial 

N-deacetylases have been considered to be exported 

enzymes but it has recently been reported that some of 

these enzymes may also be cytoplasmic, with a potential 

role in PG turnover and recycling (Popowska et al., 

2011, for a very good review on turnover and recycling, 

see Reith and Mayer, 2011). A similar N-deacetylase 

lacking a signal peptide for secretion into the periplasmic 

space has been found in Helicobacter pylori (Shaik 

et al., 2011). The enzyme showed no in vitro activity on 

the typical polysaccharide substrates of peptidoglycan 

and results from crystallization and structure studies 

suggest that it binds a small molecule at the active site, 

even though the peptidoglycan of a HP0310 (syn. HpPgdA) 

knock-out mutant was characterized by higher 

degree of acetylation compared to the wild-type, along 

with increased susceptibility to lysozyme degradation. 

O-acetylation of MurNAc, similarly to N-deacetylation, 

is typically associated with bacterial resistance 

to lysozyme PG from degradation by lysozyme as well 

as by endogenous autolytic enzymes, e.g. the lytic transglycosylases. 

As a protective modification it is more 

ubiquitous than N-deacetylation and has been found to 

occur in many different bacterial species, both Grampositive 

and Gram-negative (Vollmer, 2008). An additional 

acetyl group is linked to the C6-OH of MurNAc 

to form a 2,6-N,O-diacetylo muramic acid residue. The 

ester bond of O-linked acetate is significantly weaker 

than the amide bond of N-linked acetate.

3 Structural aspects of the mighty miniwall 

183 

Two types of unrelated O-acetyltransferases have 

been described, corresponding to different mechanisms 

of peptidoglycan O-acetylation (Clarke et al., 2000; Bera 

et al., 2005, Crisostomo et al., 2006). The first mechanism 

involves a single protein (an OatA-type enzyme) 

which performs both the transport of acetate across the 

membrane and its transfer onto the peptidoglycan. The 

second mechanism involves two proteins, one for acetate 

transport across the membrane and the other for 

catalyzing its transfer to MurNAc. The acetate transport 

genes of this system are unknown. There are several 

candidate genes for these O-acetyltransferases (named 

Pat). A new peptidoglycan O-acetyltransferase has been 

found in E. coli. The enzyme, named PatB, O-acetylates 

peptidoglycan within the periplasm. This activity was 

found to be dependent upon a second protein, PatA, 

which functions to translocate acetate from the cytoplasm 

to the periplasm, demonstrating that the O-acetylation 

of peptidoglycan in Neisseria gonorrhoeae, and 

other Gram-negative bacteria, requires a two component 

system (Moynihan and Clarke, 2010). 

The O-acetyltransferase reaction is reversed by 

peptidoglycan O-acetyl esterase activity (Weadge et al., 

2005; Vollmer, 2008). In Bacillus anthracis, in contrast 

to other bacteria, O-acetylation of peptidoglycan is 

combined with N-deacetylation to confer resistance 

of cells to lysozyme and is conferred by two unrelated 

O-acetyltransferases. Activity of the Pat O-acetyl-transferases 

is also required for the separation of the daughter 

cells following bacterial division and for anchoring of 

one of the major S-layer proteins (Laaberki et al., 2011). 

Until very recently it was thought that only the 

MurNAc residues in the PG polymer can be O-acetyl ated. 

However, the presence of O-acetylation on N-acetyl- 

glucosamine (GlcNAc) in Lactobacillus plantarum PG 

has just been reported (Bernard et al., 2011). detailed 

structural characterization of acetylated muropeptides 

released from L. plantarum PG revealed that both 

MurNAc and GlcNAc are O-acetylated in this species. 

These two PG modifications are carried out by two 

dedicated O-acetyltransferases, OatA and OatB, respectively. 

Analysis of the resistance of mutant strains to cell 

wall hydrolysis demonstrated that GlcNAc O-acetylation 

inhibits the activity of the major L. plantarum 

autolysin, N-acetylglucosaminidase Acm2. In this bac- 

terial species, inactivation of oatA, encoding MurNAc 

O-acetyltransferase, resulted in marked sensitivity 

to lysozyme. Moreover, MurNAc over-O-acetylation 

was shown to activate autolysis through the putative 

N-acetylmuramoyl-l-alanine amidase LytH enzyme. In 

L. plantarum, two different O-acetyltransferases seem 

to play original and antagonistic roles in modulating 

the activity of endogenous autolysins. 

Another kind of modification of muramic acid 

occurs in the PG of most genera of the order Actinomy- 

cetales that contain mycolic acids, e.g. Mycobacterium 

sp. In these bacteria muramic acid is N-glycolylated 

and not N-acetylated, and this modification is introduced 

during the synthesis of UdP-linked PG precursors, 

specifically into the last cytoplasmic precursor, 

UdP-MurNAc-pentapeptide. The N-glycolylated form 

arises through the action of an N-acetyl muramic acid 

hydroxylase (NamH) (Raymond et al., 2005) present 

only in the Actinomycetales. The importance of glycolylation 

has been elusive, with a hypothesis proposed 

based on studies with M. smegmatis namH mutants that 

it may protect PG from the action of lysozyme. However, 

recent findings (Coulombe et al., 2009) identify 

N-glycolyl MdP (Peptidoglycan-derived Muramyl 

dipeptide) as more stimulatory than N-acetyl MdP 

at eliciting NOd2-mediated immune responses in the 

context of both an intact bacterium and as a pure compound, 

consistent with early observations attributing 

exceptional immunogenic activity to the mycobacterial 

cell wall. disruption of namH in M. smegmatis 

nulled NOd2-mediated TNF secretion, which could 

be restored upon gene complementation. In mouse 

macrophages, N-glycolyl MdP was more potent than 

N-acetyl MdP at activating RIP2, nuclear factor kappaB 

and proinflammatory cytokine secretion. Finally, 

N-glycolyl MdP was found to be more efficacious than 

N-acetyl MdP at inducing ovalbumin-specific T cell 

immunity in a model of adjuvancy (Coulombe et al., 

2009; davis and Weiser, 2011). 

A different modification of the glycan strands that 

can be found in the PG of many Gram-negative bacteria, 

but also in some Gram-positive ones is the presence 

of a 1,6-anhydroMurNAc residue at the end of the 

chain. These are formed by the action of lytic transglycosylases 

(LTs), that have the same bond specificity 

as lysozyme (Höltje et al., 1975). These ubiquitous 

enzymes are classified to one of four distinct families, 

based on sequence similarities and identified consensus 

motifs (Blackburn and Clarke, 2001). The importance 

of these enzymes is reflected in the fact that the bacterium 

Escherichia coli has six of them, representing 

different families and subfamilies. LTs can be viewed as 

space-making enzymes. They cleave glycosydic bonds 

within the PG sacculus to allow for a number of different 

processes to occur. They play an important a critical 

role in the expansion of the sacculus and consequent 

cell growth by creating sites for the insertion of PG 

precursors (Höltje, 1998). They are also required for 

PG turnover and recycling. In concert with amidases 

LTs function to split the septum, thereby permitting the 

separation of dividing cells (Heidrich et al., 2002). LTs 

have also been suggested to contribute to pathogenesis 

(reviewed in Cloud-Hansen et al., 2006). An important 

question has always been how large structures, e.g. protein 

complexes, penetrate the PG layer (Scheurwater

184 

and Clarke, 2008). LTs have always been implicated in 

these processes. This topic has been very well reviewed 

by Scheurwater and Burrows (2011). 

Glycan strands of PG are also modified via the 

attachment of many different types of compounds and 

polymers to muramic acid, usually via a phosphodiester 

bond. The most notable of these are the teichoic and 

teichuronic acids as well as the arabinogalactans. Very 

rarely, structures are attached to GlcNAc, as in Streptococcus 

agalactiae. This topic is vast and well beyond the 

scope of this review. 

Even though the structure of PG and the various 

species-specific and function-determined modifications 

of its structural elements have been thoroughly 

investigated, there are still numerous unresolved fundamental 

questions regarding the architecture of the 

peptidoglycan, i.e. the orientation of the glycan strands 

and stem peptides in relation to the surface and axes of 

a cell (Vollmer and Seligman, 2010). Various models 

for the spatial organization of peptidoglycan have been 

proposed over the years and currently two opposing 

models are considered: a model in which the glycan 

strands run parallel to the cytoplasmic membrane (the 

“classical” or “classical” model, e.g. Höltje, 1998; Pink 

et al., 2000) recently supported by experimental data 

by Gan et al. (2008) and Hayhurst et al. (2008) and 

the opposing “scaffold” model in which the glycan 

strands are oriented perpendicularly to the membrane 

(dmitriev et al., 2003, 2004, 2005; Meroueh et al., 2006). 

Unraveling the architectural issues is compounded 

by the differences of the thickness of PG in Gramnegative 

versus Gram-positive cells, which is approximately 

5–10 times thicker in the latter compared to 

the former and the fact that structure may be affected 

by i.e. growth conditions, gene activity (e.g. Höltje and 

Glauner, 1990; Vollmer et al., 2008; Korsak et al., 2005, 

2010; Cava et al., 2011), antibiotic production or resistance 

(Sieradzki and Markiewicz, 2004; Schaberle et al., 

2011) and many other factors. Moreover, recent studies 

using cryo-transmission electron microscopy (cryo-EM) 

have conclusively demonstrated the existence of the 

equivalent of the Gram-negative periplasmic space in 

at least B. subtilis and Staphylococcus aureus (Matias and 

Beveridge, 2005; 2006), which also complicates interpretation 

in spatial structure studies. The technique 

reveals in Gram-positive bacteria two different cell 

wall layers: an inner wall zone (IWZ) of low-electron 

density, whose main component is lipoteichoic acid 

(Matias and Beveridge, 2008), and a high-electron 

density outer wall zone (OWZ). In the “layered” model 

the glycan strands are believed to run parallel to the 

plasma membrane, arranged as hoops or helices around 

the short axis of the cell, resulting in a woven fabriclike 

structure (Verwer et al., 1978; Vollmer and Höltje, 

2004; Vollmer et al., 2008). A recent study by Gan et al. 

(2008), in which frozen-hydrated sacculi from E. coli 


and Caulobacter crescentus were examined by electron 

cryotomography, confirmed the layered model, showing 

that in the Gram-negative PG sacculus a single layer 

of glycan strands lie parallel to the cell surface, roughly 

perpendicular to the long axis of the cell, encircling the 

cell in a disorganized hoop-like fashion. Their data also 

precluded the scaffold model. However, assuming that 

Gram-negative bacteria do have a single layer of PG, then 

how can one explain the difference in the thickness of 

E. coli PG versus Pseudomonas aeruginosa PG (approximately 

2 : 1, respectively, for either dry or hydrated 

isolated sacculi (Vollmer and Seligman, 2010)? The 

organization of PG in ovococcoidal mutant Lactobacillus 

lactis cells lacking cell wall exopolysaccharides was 

studied using AFM (Atomic Force Microscopy) topographic 

and recognition imaging. Topographic images 

showed periodic ridges on the mutant surface that 

always ran parallel to the short cell axis. Recognition 

imaging demonstrated that these ridges consisted of 

peptidoglycan. The results are consistent with a PG 

organization in the plane perpendicular to the long 

axis of the cell (Andre et al., 2010). It would thus seem 

that the 3-d architecture of PG in both Gram-negative 

and Gram-positive cells is of the layered type. However, 

observations of isolated Bacillus subtilis PG using AFM 

show that, at least in this species, spatial organization 

is more complex (Hayhurst et al., 2008). This may be 

related to the existence of the IWZ in B. subtilis (Matias 

and Beveridge, 2005; Zuber et al., 2006) and the finding 

that the glycan strands of the bacterium are longer 

50 times longer than previously calculated. The model 

of Hayhurst et al. (2008) proposes that during biosynthesis 

small numbers of glycan strands are polymerized 

and cross-linked to build a peptidoglycan “rope”, which 

is coiled into a helix to form inner surface cable structures. 

The nascent helix (cable) is inserted into the cell 

wall by cross-links between two existing cables and the 

overlying cable interface cleaved by autolysins known 

to be essential for cell growth. As part of cable maturation, 

the structure may become stabilized by inter/intra 

glycan strand cross-links. The model also predicts that 

the cell wall is likely only one intact cable thick with 

partially hydrolyzed cables also present externally. Solid- 

state NMR data obtained for Staphylococcus aureus PG, 

which contains an interpeptide pentaglycyl bridge, show 

that the spatial arrangement of the polymer in staphylococci 

may be even more complex. Partial charac- 

terization of the structure was achieved by measuring 

spin diffusion from (13) C labels in pentaglycyl crosslinking 

segments to natural-abundance (13) C in the 

surrounding intact cell walls. The measurements were 

performed using a version of Centerband-Only detection 

of Exchange (COdEx). The COdEx spin diffusion 

rates established that the pentaglycyl bridge of one 

peptidoglycan repeat unit of S. aureus is within 5 angstroms 

of the glycan chain of another repeat unit, which

3 Structural aspects of the mighty miniwall 

185 

shows surprising proximity compared to earlier theoretical 

considerations and was interpreted in terms of 

a model for the peptidoglycan lattice in which all peptide 

stems in a plane perpendicular to the glycan main 

chain are parallel to one another (Sharif et al., 2009). 

This minireview reflects the most recent achievements 

in research on peptidoglycan, with focus on 

modifications of the glycan chains and the spatial organization 

of the polymer. 

Literature 

Andre G., S. Kulakauskas, M.P. Chapot-Chartier, B. Navet, 

M. Deghorain, E. Bernard, P. Hols and Y.F. Dufrêne. 2010. Imaging 

the nanoscale organization of peptidoglycan in living Lactococcus 

lactis cells. Nat. Commun. 1: 1–8. 

Araki Y., S. Fukuoka, S. Oba and E. Ito. 1971. Enzymatic deacetylation 

of N-acetylglucosamine residues in peptidoglycan from Bacillus 

cereus cell walls. Biochem. Biophys. Res. Commun. 45: 751–758. 

Atrih A. and S.J. Foster. 2001. In vivo roles of the germination- 

spe cific lytic enzymes of Bacillus subtilis 168. Microbiology 147: 

2925–2932. 

Bera A., S. Herbert, A. Jakob, W. Vollmer and F. Gotz. 2005. Why 

are pathogenic staphylococci so lysozyme resistant? The peptidoglycan 

O-acetyltransferase OatA is the major determinant for lysozyme 

resistance of Staphylococcus aureus. Mol. Microbiol. 55: 778–787. 

Bernard E., T. Rolain, P. Courtin, A. Guillot, P. Langella, P. Hols 

and M.P. Chapot-Chartier. 2011 Characterization of O-Acetylation 

of N-Acetylglucosamine: A Novel structural variation of bacterial 

peptidoglycan. J. Biol. Chem. 286: 23950–23958. 

Blackburn N.T. and A.J. Clarke. 2001. Identification of four families 

of peptidoglycan lytic transglycosylases. J. Mol. Evol. 52: 78–84. 

Beveridge T.J. 1995. The periplasm space and the periplasm in 

gram-positive and gram-negative bacteria. ASM News. 61: 125–130. 

Boneca I.G., O. Dussurget, D. Cabanes, M.A. Nahori , S. Sousa 

et al. 2007. A critical role for peptidoglycan N-deacetylation in Listeria 

evasion from the host innate immune system. Proc. Natl. Acad. 

Sci. USA. 104: 997–1002. 

Bugg T.D.H., D. Braddick, C.G. Dowson and D. I. Roper. 2011. 

Bacterial cell wall assembly: still an attractive antibacterial target. 

Trends Biotech. 29: 167–173. 

Cava F., M.A. de Pedro, H. Lam, B.M. Davis and M.K. Waldor. 

2011. distinct pathways for modification of the bacterial cell wall 

by non-canonical d-amino acids. EMBO J. 30: 3442–3453. 

Cloud-Hansen K.A., S.B. Peterson, E.V. Stabb, W.E. Goldman, 

M.J. McFall-Ngai and J. Handelsman. 2006. Breaching the great 

wall: peptidoglycan and microbial interactions. Nat. Rev. Microbiol. 

9: 710–716. 

Corr S.C. and L.A. O’Neill. 2009. Listeria monocytogenes infection 

in the face of innate immunity. Cell. Microbiol. 11: 703–709. 

Coulombe F., M. Divangahi, F. Veyrier, L. de Léséleuc, J.L. Gleason 

et al. 2009. Increased NOd2-mediated recognition of N-glycolyl 

muramyl dipeptide. J. Exp. Med. 206: 1709–1716. 

Crisostomo M.I., W. Vollmer, A.S. Kharat, S. Inhulsen, F. Gehre, 

S. Buckenmaier and A. Tomasz. 2006. Attenuation of penicillin 

resistance in a peptidoglycan O-acetyl transferase mutant of Streptococcus 

pneumoniae. Mol. Microbiol. 61: 1497–1509. 

Cummins C.S. and H. Harris. 1956. The chemical composition of 

the cell wall in some gram-positive bacteria and its possible value as 

a taxonomic character. J. Gen. Microbiol. 14: 583–600. 

Davis K. M. and J.N. Weiser. 2011 Modifications to the peptidoglycan 

backbone help bacteria to establish infection. Infect. Immun. 

79: 562–570. 

Dmitriev B.A., F.V. Toukach, K.J. Schaper, O. Holst, E.T. Rietschel 

and S. Ehlers. 2003. Tertiary structure of bacterial murein: the scaffold 

model. J. Bacteriol. 185: 3458–3468. 

Dmitriev B.A., F.V. Toukach, O. Holst, E.T. Rietschel and S. Ehlers. 

2004. Tertiary structure of Staphylococcus aureus cell wall murein. 

J. Bacteriol. 186: 7141–7148. 

Dmitriev B.A., F. Toukach and S. Ehlers. 2005. Towards a comprehensive 

view of the bacterial cell wall. Trends Microbiol. 13: 569–754. 

Dowd M.M., B. Orsburn and D.L. Popham. 2008. Cortex peptidoglycan 

lytic activity in germinating Bacillus anthracis spores. 

J. Bacteriol. 190: 4541–4548. 

Dziarski R. and D. Gupta. 2010. Review: Mammalian peptidoglycan 

recognition proteins (PGRPs) in innate immunity. Innate 

Immun. 16: 168–174. 

Fittipaldi N., T. Sekizaki, D. Takamatsu, D.-P. M. de la Cruz, 

J. Harel, N.K. Bui, W. Vollmer and M. Gottschalk. 2008 Significant 

contribution of the pgdA gene to the virulence of Streptococcus suis. 

Mol. Microbiol. 70(5):1120–1135. 

Gan L., S. Chen and G. L. Jensen. 2008. Molecular organization 

of Gram-negative peptidoglycan. Proc. Natl Acad. Sci. USA 105: 

18953–18957. 

Gilmore M.E., D. Bandyopadhyay, A.M. Dean, S.D. Linnstaedt 

and D.L. Popham. 2004. Production of muramic delta-lactam in 

Bacillus subtilis spore peptidoglycan. J. Bacteriol. 186: 80–89. 

Glauner B. 1988 Separation and quantification of muropeptides 

with high-performance liquid chromatography. Anal. Biochem. 172: 

451–464. 

Graham L.L., T.J. Beveridge and N. Nanninga. 1991. Periplasmic 

space and the concept of periplasm. Trends. Biochem. Sci. 16: 

328–329. 

Gram H.C. 1884. Uber die isolierte Farbung der Schizomyceten in 

Schnitt- and Trockenpraparaten. Fortschritte der Medizin 2: 185–189. 

Hayhurst E. J., L. Kailas, J. K. Hobbs and S. J. Foster. 2008. Cell 

wall peptidoglycan architecture in Bacillus subtilis. Proc. Natl. Acad. 

Sci. USA 105: 14603–14608. 

Heffron J.D., N. Sherry and D.L. Popham. 2011. In vitro studies 

of peptidoglycan binding and hydrolysis by the Bacillus anthracis 

germination-specific lytic enzyme SleB. J. Bacteriol. 193: 125–131. 

Heidrich C., A. Ursinus, J. Berger, H. Schwarz and J.V. Höltje. 

2002. Effects of multiple deletions of murein hydrolases on viability, 

septum cleavage, and sensitivity to large toxic molecules in Escherichia 

coli. J. Bacteriol. 184: 6093–6099. 

Höltje J.V., D. Mirelman, D. Sharon and U. Schwarz. 1975. Novel 

type of murein transglycosylase in Escherichia coli. J. Bacteriol. 124: 

1067–1076. 

Höltje J.V. 1998 Growth of the stress-bearing and shape-maintaining 

murein sacculus of Escherichia coli. Microbiol. Mol. Biol. Rev. 

62: 181–203. 

Höltje JV and Glauner B. 1990. Structure and metabolism of the 

murein sacculus. Res. Microbiol. 141: 75–89. 

Kietzman C. and E. Tuomanen. 2011. PGRPs kill with an ancient 

weapon. Nat. Med. 17: 665–666. 

Korsak D., W. Vollmer and Z. Markiewicz. 2005. Listeria monocytogenes 

EGd lacking penicillin-binding protein 5 (PBP5) produces 

a thicker cell wall. FEMS Microbiol. Lett. 251: 281–288. 

Korsak D., Z. Markiewicz, G.O. Gutkind and J.A. Ayala. 2010. 

Identification of the full set of Listeria monocytogenes penicillinbinding 

proteins and characterization of PBPd2 (Lmo2812). BMC 

Microbiol. 10: 239. 

Laaberki M.H., J. Pfeffer, A.J. Clarke and J. Dworkin. 2011. 

O-Acetylation of peptidoglycan is required for proper cell separation 

and S-layer anchoring in Bacillus anthracis. J. Biol. Chem. 286: 

5278–5288. 

Markiewicz Z., B. Glauner and U.Schwarz. 1983. Murein structure 

and lack of dd- and Ld-carboxypeptidase activities in Caulobacter 

crescentus. J. Bacteriol. 156: 649–655.

186 

Markiewicz Z. 1993. The Structure and Functions of the Cell Envelope 

(in Polish). Polish Scientific Publishers PWN, Warsaw. 

Matias V.R. and T.J. Beveridge. 2005. Cryo-electron microscopy 

reveals native polymeric cell wall structure in Bacillus subtilis 

168 and the existence of a periplasmic space. Mol. Microbiol. 

56: 240–251. 

Matias V.R. and T.J. Beveridge. 2006. Native cell wall organization 

shown by cryo-electron microscopy confirms the existence of a periplasmic 

space in Staphylococcus aureus. J. Bacteriol. 188: 1011–1021. 

Matias V.R. and T.J. Beveridge. 2008. Lipoteichoic acid is a major 

component of the Bacillus subtilis periplasm. J. Bacteriol. 190: 

7414–7418. 

Merchante R., H.M. Pooley and D. Karamata. 1995. A periplasm 

in Bacillus subtilis. J. Bacteriol. 177: 6176–6183. 

Meroueh S.O., K.Z. Bencze, D. Hesek, M. Lee, J.F. Fisher, 

T.L. Stemmler and S. Mobashery. 2006 Three-dimensional structure 

of the bacterial cell wall peptidoglycan. Proc. Natl. Acad. Sci. 

USA 103: 4404–4409. 

Meyrand M., A. Boughammoura, P. Courtin, C. Mezange, 

A. Guillot and M-P. Chapot-Chartier. 2007. Peptidoglycan 

N-acetylglucosamine deacetylation decreases autolysis in Lactococcus 

lactis. Microbiology 153: 3275–3285. 

Moynihan P.J. and A.J. Clarke. 2010. O-acetylation of peptidoglycan 

in gram-negative bacteria: identification and characterization of 

peptidoglycan O-acetyltransferase in Neisseria gonorrhoeae. J. Biol. 

Chem. 285: 13264–13273. 

Park, J.T. and M.J. Johnson. 1949. Accumulation of labile phosphorus 

in Staphylococcus aureus grown in the presence of penicillin. 

J. Biol. Chem. 179:585–592. 

Pavelka M.S. Jr. 2007. Another brick in the wall. Trends Microbiol. 

15: 147–149. 

Peltier J., P. Courtin, I. El Meouche, L. Lemee, M.P. Chapot-Chartier 

and J.L. Pons. 2011. Clostridium difficile has an original peptidoglycan 

structure with high level of N-acetylglucosamine deacetylation 

and mainly 3–3 cross-links. J. Biol. Chem. 286: 20953–20962. 

Pink D., J. Moeller, B. Quinn, M. Jericho and T. Beveridge. 2000. 

On the architecture of the gram-negative bacterial murein sacculus. 

J. Bacteriol. 182: 5925–5930. 

Popham D.L., J. Helin, C.E. Costello and P. Setlow. 1996. Analysis 

of the peptidoglycan structure of Bacillus subtilis endospores. J. Bacteriol. 

178: 6451–6458. 

Popowska M., M. Kusio, P. Szymanska and Z. Markiewicz. 2009. 

Inactivation of the wall-associated de-N-acetylase (PgdA) of Listeria 

monocytogenes results in greater susceptibility of the cells to induced 

autolysis. J. Microbiol. Biotechnol. 9: 932–945. 

Popowska M., M. Osinska and M. Rzeczkowska. 2011. N-acetylglucosamine-6-phosphate 

deacetylase (NagA) of Listeria monocytogenes 

EGd, an essential enzyme for the metabolism and recycling 

of amino sugars. Arch. Microbiol. Accepted Aug. 27 dOI: 10.1007/ 

s00 203-011-0752-3. 

Rae C.S., A. Geissler, P.C. Adamson and D.A. Portnoy. 2011. 

Mutations of the Listeria monocytogenes peptidoglycan N-deacetylase 

and O-acetylase result in enhanced lysozyme sensitivity, bacteriolysis 

and hyper-induction of innate immune pathways. Infect. 

Immun. 79: 3596–3608. 

Raymond J.B., S. Mahapatra, D.C. and M.S. Jr. Pavelka. 2005. 

Identification of the namH gene, encoding the hydroxylase responsible 

for the N-glycolylation of the mycobacterial peptidoglycan. 

J. Biol. Chem. 280: 326–333. 

Reith J. and C. Mayer C. 2011. Peptidoglycan turnover and recycling 

in Gram-positive bacteria Appl. Microbiol. Biotechnol. Jul 28. 

[Epub ahead of print] 

Rogers H.J. 1974. Peptidoglycans (mucopeptides): structure, function, 

and variations. Ann. N. Y. Acad. Sci. 35: 29–51. 

Salton M. R.J. 1952. Cell Wall of Micrococcus Lysodeikticus as the 

substrate of lysozyme. Nature 170: 746–748. 


Salton M.R. and R.W. Horne. 1951 Studies of the bacterial cell 

wall. II. Methods of preparation and some properties of cell walls. 

Biochim. Biophys. Acta 7: 177–197. 

Salton M.R. 1957. Cell-wall amino-acids and amino-sugars. Nature 

180: 338–339. 

Schäberle T.F., W. Vollmer, H.J. Frasch, S. Hüttel, A. Kulik, 

M. Röttgen, A.K. von Thaler, W. Wohlleben and E. Stegmann. 

2011. Self-resistance and cell wall composition in the glycopeptide 

producer Amycolatopsis balhimycina. Antimicrob. Agents Chemother. 

55: 4283–4289. 

Scheurwater E.M. and Clarke A.J. 2008. The C-terminal domain 

of Escherichia coli Yfhd functions as a lytic transglycosylase. J. Biol. 

Chem. 283: 8363–8373. 

Scheurwater E.M. and L.L Burrows. 2011. Maintaining network 

security: how macromolecular structures cross the peptidoglycan 

layer. FEMS Microbiol. Lett. 318: 1–9. 

Schleifer K.H. and O. Kandler. 1972. Peptidoglycan types of bacterial 

cell walls and their taxonomic implications. Bacteriol. Rev. 36: 

407–477. 

Shaik M.M., L. Cendron, R. Percudani and G. Zanotti. 2011. The 

structure of Helicobacter pylori HP0310 reveals an atypical peptidoglycan 

deacetylase. PLoS One. 6: e19207. 

Sharif S., M. Singh, S.J. Kim and J. Schaefer. 2009. Staphylococcus 

aureus peptidoglycan tertiary structure from carbon-13 spin diffusion. 

J. Am. Chem. Soc. 131(20):7023–7030. 

Sharif S, Singh M., Kim S. J. and J Schaefer. 2009. Staphylococcus 

aureus peptidoglycan tertiary structure from carbon-13 spin diffusion. 

J. Am .Chem. Soc. 131: 7023–7030. 

Verwer R.W., N. Nanninga, W. Keck and U. Schwarz. 1978. 

Arrangement of glycan chains in the sacculus of Escherichia coli. 

J. Bacteriol. 136:723–729. 

Vollmer W., D. Blanot and M.A. de Pedro. 2008. Peptidoglycan 

structure and architecture. FEMS Microbiol. Rev. 322: 149–167. 

Vollmer W. and A. Tomasz. 2002. Peptidoglycan N-acetylglucosamine 

deacetylase, a putative virulence factor in Streptococcus pneumoniae. 

Infect. Immun. 70: 7176–7178. 

Vollmer W. and J.V. Höltje. 2004. The architecture of the murein 

(peptidoglycan) in gram-negative bacteria: vertical scaffold or horizontal 

layer(s)? J. Bacteriol. 186: 5978–5987. 

Vollmer W. and S.K.J. Seligman. 2010 Architecture of peptidoglycan: 

more data and more models. Trends Microbiol. 18: 59–66. 

Watterlot L., M. Meyrand, N. Gaide, P. Kharrat, S. Blugeon, 

J.J. Gratadoux, M.J. Flores, P. Langella, M.P. Chapot-Chartier 

and L.G. Bermúdez-Humarán. 2010. Variations of N-acetylation 

level of peptidoglycan do not influence persistence of Lactococcus 

lactis in the gastrointestinal tract. Int. J. Food Microbiol. 144: 29–34. 

Weadge J.T., J.M. Pfeffer and A.J. Clarke. 2005. Identification 

of a new family of enzymes with potential N-acetylpeptidoglycan 

esterase activity in both Gram-positive and Gram-negative bacteria. 

BMC Microbiol. 5: 49. 

Work E. 1957. Biochemistry of the bacterial cell wall. Nature 179: 

841–847. 

Work E. 1961. The mucopeptides of bacterial cell walls. A review. 

J. Gen. Microbiol. 25:169–189. 

Work E. 1969. Biochemistry of bacterial cell walls. Lab. Pract. 18: 

831–838. 

Yoon J, Y. Matsuo, S. Matsuda, H. Kasai and A. Yokota. 2010. 

Cerasicoccus maritimus sp. nov. and Cerasicoccus frondis sp. nov., 

two peptidoglycan-less marine verrucomicrobial species, and 

description of Verrucomicrobia phyl. nov., nom. rev. J. Gen. Appl. 

Microbiol. 56: 213–222. 

Zuber B., M. Haenni, T. Ribeiro, K. Minnig, F. Lopes, P. Moreillon 

and J. Dubochet. 2006. Granular layer in the periplasmic space of 

gram-positive bacteria and fine structures of Enterococcus gallinarum 

and Streptococcus gordonii septa revealed by cryo-electron 

microscopy of vitreous sections. J. Bacteriol. 188: 6652–6660.



ORIGINAL PAPER 

A New Rapid and Cost-Effective Method for Detection of Phages, ICEs 

and Virulence Factors Encoded by Streptococcus pyogenes 

ANNA L. BOREK1 , JOANNA WILEMSKA1,3 , RAdOSŁAW IZdEBSKI2 , WALERIA HRYNIEWICZ1 and IZABELA SITKIEWICZ1 * 

1 department of Epidemiology and Clinical Microbiology, National Medicines Institute, Warsaw, Poland 

2 department of Molecular Microbiology, National Medicines Institute, Warsaw, Poland 

3 Current address: department of Clinical Cytology, The Medical Centre of Postgraduate Education, Warsaw, Poland 

Received 27 June 2011, revised 12 July 2011, accepted 14 July 2011 

Introduction 

Streptococcus pyogenes (group A Streptococcus, GAS) 

is an important human pathogen that causes a broad 

spectrum of skin and mucosal surface infections. 

GAS diseases range from mild, such as streptococcal 

pharyngitis or impetigo, to severe toxin-mediated, 

among which are necrotizing fasciitis or toxic shock 

syndrome and postinfectious diseases (Cunningham, 

2000). GAS is responsible for over 600 millions of new 

infections every year and causes half a million deaths 

as a result of infections and post-infectional sequelae 

(Carapetis et al., 2005). 

The success of GAS as a pathogen relies on the production 

of multiple virulence factors involved in various 

aspects of host-pathogen interactions (Tart et al., 

2007). Initial contact between bacteria and the host is 

achieved by the activity of multiple adhesins produced 

by GAS which bind host proteins and extracellular 

matrix proteins such as plasminogen, collagen, keratin 

(for a review see Courtney et al., 2002; Cunningham, 

2000; Oehmcke et al., 2010; Smeesters et al., 2010). 

Abstract 

Streptococcus pyogenes (group A Streptococcus, GAS) is a human pathogen that causes diseases of various intensity, from mild strep throat 

to life threatening invasive infections and postinfectional sequelae. S. pyogenes encodes multiple, often phage encoded, virulence factors 

and their presence is related to severity of the disease. Acquisition of mobile genetic elements, carrying virulence factors, as phages or ICEs 

(integrative and cojugative elements) has been shown previously to promote selection of virulent clones. We designed the system of eight 

low volume multi- and one singleplex PCR reactions to detect genes encoding twenty virulence factors (spd3, sdc, sdaB, sdaD, speB, spyCEP, 

scpA, mac, sic, speL, K, M, C, I, A, H, G, J, smeZ and ssa) and twenty one phage and ICE integration sites described so far for S. pyogenes. 

Classification of strains based on the phage and virulence factors absence or presence, correlates with PFGE MLST and emm typing results. 

We developed a novel, fast and cost effective system that can be used to detect GAS virulence factors. Moreover, this system may become 

an alternative and effective system to differentiate between GAS strains. 

K e y w o r d s: Streptococcus pyogenes, GAS, superantigens, virulence factors, typing, phage 

After initial contact, bacteria invade host tissues and 

often disseminate causing systemic reaction (Tart et al., 

2007). Multiple classes of GAS virulence factors such as 

proteases, dNases and pyrogenic toxins (superantigens) 

are involved in interaction between bacteria and the 

host in post attachment phase. 

Major surface adhesin – M protein, is involved in 

tissue invasion and interaction with human immune 

system (Perez-Caballero et al., 2004). Other elements 

of the human immune system are inactivated by set 

of specialized proteases. ScpA a highly specific peptidase 

encoded by scpA gene degrades C5a factor of 

the complement (Cleary et al., 1992). SpeB is a cysteine 

protease that can inactivate C3b factor of the complement 

(Terao et al., 2008) and multiple other host factors 

involved in immune response such as interleukin-1b 

precursor and immunoglobulins (Chiang-Ni and 

Wu, 2008). In addition SpeB is involved in tissue 

destruction by activation of pro-matrix metallo-proteases 

and degradation of fibronectin, vitronectin, plasminogen 

and kininogen (Chiang-Ni and Wu, 2008). 

The protease MAC/IdeS cleaves specifically human IgG 

* Corresponding author: I. Sitkiewicz, department of Epidemiology and Clinical Microbiology, National Medicines Institute, 

Chełmska 30/34, 00-725 Warszawa, Poland; phone (+48 22) 841 12 22; fax (+48 22) 841 29 41; e-mail: isitkiewicz@cls.edu.pl

188 

(von Pawel-Rammingen et al., 2002). Recently discovered 

protease SpyCEP is involved in degradation of 

chemokines and chemotactic factors as interleukin-8, 

granulocyte chemotactic protein-2, growth related 

oncogene α and β and macrophage inflammatory protein 

2-α (Edwards et al., 2005; Kurupati et al., 2010; 

Sumby et al., 2008; Zinkernagel et al., 2008). 

dNases produced by GAS are involved in dissemination 

of bacteria and escape from neutrophil extracellular 

traps (Sumby et al., 2005; Walker et al., 2007). And 

finally, large group of toxins encoded by GAS genes 

(speL, speK, speM, speC, speI, speA, speH, speG, speJ, 

smeZ and ssa) is involved in systemic toxicity. 

Some of the GAS virulence factors, e.g. SpeB, ScpA, 

SpyCEP, Mac, SdaB and SpeG, are chromosomally 

encoded, however, large fraction of virulence factors 

such as majority of dNAses and superantigens e.g. 

SpeA, SpeC , SpeH and SSA are encoded by mobile 

genetic elements – phages and conjugative mobile elements 

integrated into the chromosome (ICEs – integrative 

and cojugative elements) (Beres and Musser, 

2007). Based on the comparison of genome sequences 

of multiple GAS strains, metagenome of GAS contains 

on average about 10% of exogenous elements (Beres 

and Musser, 2007; Ferretti et al., 2001). So far, 67 mobile 

elements (55 prophages and 12 ICE elements) integrated 

at 21 distinct loci of the core chromosome in 

the 12 GAS genomes have been identified (Beres and 

Musser, 2007) (Table I). 

Over the years, multiple serological, restriction fragment 

based and PCR based methods of GAS typing 

and virulence factors detection were used (Cleary et al., 

1988; Commons et al., 2008; Hartas et al., 1998; Koller 

et al., 2010; Lintges et al., 2007; Matsumoto et al., 2003; 

Maxted et al., 1973; Moody et al., 1965; Nandi et al., 

2008; Schmitz et al., 2003; Seppala et al., 1994; Swift 

et al., 1943). Each of the methods presents various 

advantages and disadvantages. Serological assays are 

usually less precise than molecular methods. Methods 

based on the analysis of restriction patterns, and methods 

based on random amplification, are often difficult 

for analysis and comparison. Multiple PCR assays utilizing 

specific targets were developed before the era of 

massive genome sequencing that allows including the 

knowledge of allelic variations between strains of various 

serotypes in the design of more specific systems. 

Also, multiple PCR based systems were designed mostly 

as singleplex reactions what increases screening costs in 

case of detection of multiple virulence factors. 

Currently, to determine the relationships between 

GAS isolates and strains, three major methods are 

typically used. The first method, which is regarded as 

a golden standard by many laboratories, is pulsed field 

gel electrophoresis (PFGE) typing (Bert et al., 1997). 

PFGE is often recommended as a reference method 

Borek A.L. et al. 3 

in outbreak investigations, especially for food borne 

diseases (http://www.cdc.gov/pulsenet/, http://www. 

medvetnet.org/cms/). PFGE is a method based on 

restriction fragment size polymorphism. Chromosomal 

dNA is released from bacteria and digested with 

rare cutting restriction enzyme directly in agarose gel 

and fragments are separated using alternating voltage 

gradient (for a review see (Herschleb et al., 2007; 

Slater, 2009)). PFGE typing detects rather large and 

recent evolutionary changes in bacterial dNA such as 

insertion or excision of a phage, large insertions and 

deletions and mutations resulting in a loss or appearance 

of a new restriction site (Tenover et al., 1995). Two 

strains are related to each other when the number of 

differences in restriction patterns is below 7 (Tenover 

et al., 1995). PFGE is a technique with high discriminatory 

power, but it is time consuming and available 

protocols require from minimum two days to over one 

week to determine PFGE type of the strain (Herschleb 

et al., 2007). What’s equally important, the technique 

requires relatively expensive equipment, skilled labor 

and the results of PFGE are often difficult to compare 

between laboratories. 

The second method used routinely in GAS epidemiology 

is emm typing. Emm typing, is a molecular 

equivalent of serotyping and allows grouping of GAS 

strains into serotypes/genotypes based on the type of 

the surface M protein (Facklam et al., 1999; Hoe et al., 

1999). It is an easy and straightforward method that 

utilizes sequencing of a portion of the emm gene, 

which encodes hypervariable region of the M protein. 

The major advantage of molecular emm typing is rapid 

identification of novel variants of M protein responsible 

for new serotypes. The emm typing requires PCR 

amplification, purification of the amplicon and single 

sequencing reaction as a next step (Beall et al., 2000). 

The third method, multi-locus sequence typing 

(MLST), is based on sequencing of seven housekeeping 

loci to detect allelic changes. differences in allelic 

profiles in isolates are assigned to known or new 

sequence types (STs) (Enright et al., 2001). Similarly 

to emm typing the method requires PCR amplification, 

purification of the product and sequencing. The 

method is relatively fast and reliable but in case of GAS, 

requires 14 sequencing reactions per isolate, which significantly 

increases the costs of typing. Because of the 

cost of MLST, alternative approaches to detect allelic 

changes in genes included in MLST scheme are developed, 

such as PCR assays with high resolution melting 

curves named Mini-MLST (Richardson et al., 2010). 

In this report, we present a rapid and cost effective 

method to detect virulence factors encoded by GAS 

and phages/ICE elements integrated into genome 

using set of multiplex PCR reactions. described system 

allows easy, simultaneous detection of 20 GAS virulence

3 Phages, ICEs, virulence factors in S. pyogenes 

189 

Table I 

Integration sites of phages and ICE elements in sequenced S. pyogenes genomes (Modified after Beres and Musser, 2007) 

Integration 

site 

Strain Exogenous 

Element 

Virulence 

Gene(s) 

CdS Start of the 

integrated element 

CdS Stop of the 


A MGAS10394 10394.1 sdn 0020 0068 

B MGAS8232 8232.1 speA1 0336 0394 

C SF370 370.1 speC-spd1 0655 0712 

C MGAS10270 10270.1 speC-spd1 0536 0598 

C MGAS10750 10750.1 speC-spd1 0560 0622 

C Manfredo man.4 speC-spd1 1263 1322 

C MGAS2096 2096.1 speC-spd1 0553 0602 

C MGAS9429 9429.1 speC-spd1 0532 0594 

C MGAS8232 8232.2 speC-spd1 0716 0779 

d MGAS10394 10394.2 speA4 0733 0741 

E SF370 370.2 speH-speI 0937 1008 

E MGAS10270 10270.2 spd3 0796 0853 

E MGAS10750 10750.2 spd3 0831 0889 

E Manfredo man.3 speH-speI 1021 1070 

E MGAS9429 9429.2 speH-speI 0795 0851 

F MGAS315 315.1 none 0681 0736 

F SSI SPsP5 none 0877 0937 

G SF370 370-Rd.1 srtA 1075 1088 

G MGAS5005 5005-Rd.1 srtA 0797 0816 

G MGAS10270 10270-Rd.1 srtA 0910 0932 

G MGAS10750 10750-Rd.1 srtA 0945 0967 

G MGAS2096 2096-Rd.1 srtA 0869 0890 

G MGAS9429 9429-Rd.1 srtA 0911 0934 

G MGAS6180 6180-Rd.0 srtA 0771 0793 

H MGAS5005 5005.1 speA2 0995 1052 

H MGAS315 315.2 ssa 0919 0978 

H SSI SPsP6 ssa 1118 1172 

H MGAS10394 10394. 3 speK-sla 0982 1026 

H MGAS8232 8232.3 speL-speM 1238 1309 

H MGAS6180 6180.1 speC-spd1 0967 1033 

I MGAS2096 2096-Rd.2 tet (O) 1103 1159 

I MGAS6180 6180-Rd.1 none 1079 1089 

J MGAS10394 10394.4 mef(A), R6 1123 1173 

K SF370 370.3 spd3 1436 1488 

K MGAS5005 5005.2 spd3 1168 1222 

K MGAS315 315.3 spd4 1094 1145 

K SSI SpsP4 spd4 0717 0771 

K MGAS10750 10750.3 ssa 1276 1328 

K Manfredo man.2 spd4 0631 0692 

K MGAS10394 10394.5 speC-spd1 1194 1242 

K MGAS8232 8232.4 spd3 1444 1506 

L MGAS10270 10270.3 speK-sla 1297 1361 

L MGAS315 315.4 speK-sla 1203 1266 

L SSI SPsP3 speK-sla 0597 0659 

L MGAS6180 6180.2 speK-sla 1220 1285 

M MGAS10270 10270-Rd.2 R28 1378 1411

190 

Integration 

site 

Strain Exogenous 

Element 

factors (VF) and screening of 21 phage and ICE integration 

sites. The described PCR based method combined 

with emm typing can be effectively used to differentiate 

between GAS strains. 

Experimental 

Materials and Methods 

Bacterial isolates. Over 650 highly diverse GAS 

isolates analyzed in the study were sent to KORLd 

(National Reference Center for Antibiotic Resistance) 

and KOROUN (National Reference Center for Infections 

of Central Nervous System) as a part of routine 

reference activity and as a part of BiNet network for 

monitoring invasive infections (http://www.koroun. 

edu.pl/binet_info01.php). Bacterial strains were sent 

from over 60 laboratories located in multiple geographical 

areas of Poland and were isolated from various 

forms of the GAS diseases (throat, skin and invasive 

infections). Emm types of the strains were determined 

as routine part of diagnostic work according to (Beall 

et al., 1996) and CdC’s recommendations. In addition, 

we used highly clonal population of strains which PFGE 

patterns, emm and ST types were previously determined 

(Szczypa et al., 2004). 


Virulence 

Gene(s) 

CdS Start of the 


Table I continued 

CdS Stop of the 


M MGAS6180 6180-Rd.2 R28 1302 1337 

N MGAS315 315.5 speA3 1300 1354 

N SSI SPsP2 speA3 0507 0561 

N Manfredo man.1 spd3 0471 0535 

N MGAS10394 10394.6 sda 1338 1366 

O MGAS315 315.6 sdn 1408 1458 

O SSI-1 SPsP1 sdn 0408 0456 

P MGAS5005 5005.3 sda 1414 1467 

P MGAS2096 2096.2 sda 1440 1492 

P MGAS9429 9429.3 sda 1415 1468 

P MGAS8232 8232.5 sda 1745 1808 

R MGAS10394 10394.7 spd3 1540 1562 

S MGAS10750 10750-Rd.2 erm(A) 1679 1719 

T SF370 370.4 none 2122 2147 

T MGAS10270 10270.4 none 1874 1896 

T MGAS10750 10750.4 none 1897 1921 

T Manfredo man.5 none 1764 1779 

T MGAS10394 10394.8 none 1804 1824 

T MGAS6180 6180.3 none 1789 1813 

U MGAS10270 10270.5 none 1917 1951 

U MGAS6180 6180.4 none 1840 1864 

PFGE. PFGE analysis was performed according to 

modified method by Stanley and co-workers (Stanley 

et al., 1995). Briefly, agarose plugs containing bacteria 

were incubated for 4 h at 37°C in lysis buffer with lysozyme 

(100 µg/ml, Sigma) and mutanolysin (40 µg/ml, 

Sigma), followed by overnight treatment with proteinase 

K (1 mg/ml). dNA embedded in plugs was digested 

with SmaI (Fermentas) for 4h, and separated at 14°C 

for 22 h in CHEF-dR III system (Bio-Rad) in 0.5x TBE 

buffer, with 6V/cm, initial pulse 1 s., final pulse 30 s. 

Isolation of chromosomal DNA. Chromosomal 

dNA was isolated from cells grown overnight on 

Columbia agar plates supplemented with 5% sheep 

blood (BioRad, BioMerieux) using the Genomic 

Mini Ax BACTERIA kit (A&A Biotechnology) or the 

Genomic Mini kit (A&A Biotechnology) according to 

the manufacturer’s protocol, with additional initial cell 

wall digestion with lysozyme (1 mg/ml, Sigma) and 

mutanolysin (500 U/ml, Sigma) for 30 min at 37°C, in 

the presence of RNAse. Chromosomal dNA used as 

a template for PCR reactions was diluted 10-fold. 

Primer design and specificity tests. Primer pairs 

were designed using the modified Primer3 software, 

available as the Primer-BLAST tool at NCBI (http:// 

www.ncbi.nlm.nih.gov/tools/primer-blast/). Primers 

were designed to conserved regions of detected genes 

(in case of virulence factors) or conserved regions


191 

Name Sequence 

Table II 

Primers used in this study 

Toxins MIx I 

SpeL F CCTGAGCCGTGAAATTCCCA 

657 

1041734–1041753 

SpeL R ACACCAGAATTGTCGTTTGGT 1042370– 1042390 

SpeK F CCTTGTGTGTGTATCGCTTGC 

39278 – 39298 

568 

SpeK R TTGCTGTCCCCCATCAAACT 39825 – 39844 

SpeM F ATCGCTCATCAAACTTTTCCT 

496 

1042875–1042895 

SpeM R CCTTGTGTGTGTATCGCTTGC 1043350–1043370 

SpeC F GCCAATTTCGATTCTGCCGC 

405 

617333–617352 

SpeC R TGCAGGGTAAATTTTTCAACGACA 617715–617737 

SmeZ F TTTCTCGTCCTGTGTTTGGA 

246 

1662332–1662351 

SmeZ R TTCCAATCAAATGGGACGGAGAACA 1662554 – 1662578 

SpeI F TTCATAGACGGCGTTCAACAA 

176 

819507–819527 

SpeI R TGAAATCTAGAGGAGCGGCCA 819662–819682 

Toxins MIx II 

ssa F AAGAATACTCGTTGTAGCATGTGT 

678 

39833–39856 

ssa R AATATTGCTCCAGGTGCGGG 40491–40510 

SpeA F AGGTAGACTTCAATTTGGCTTGTGT 

576 

331570–331594 

SpeA R GGGTGACCCTGTTACTCACGA 332125–332145 

SpeH F TGAGATATAATTGTCGCTACTCACAT 

480 

786364–786389 

SpeH R CCTGAGCGGTTACTTTCGGT 786824–786843 

SpeG F TGGAAGTCAATTAGCTTATGCAG 

183579 – 183601 

384 

SpeG R GCGAACAACCTCAGAGGGCAAA 183942 – 183962 

SpeJ F TCCTTGTACTAGATGAGGTTGCAT 

364343 – 364366 

286 

SpeJ R GGTGGGGTTACACCATCAGT 364609 – 364628 

dNases 

spd3 F ATCGTCGTACTTGGCAAGGTT 

784 

1146098–1146118 

spd3 R GCCGCTTCTTCAAACTCTTCG 1146861–1146881 

sdc F AAGCTTAGAAACTCTCTCGCCA 

600 

49–70 

sdc R AGTTCCAGTAATAGCGTTTTTCCGT 624–648 

sdaB F TATAGCGCATGCCGCCTTTT 

440 

1700383–1700402 

sdaB R TGATGGCGCAAGCAAGTACC 1700803–1700822 

sdad F TTTACGCTGAATCGGGCACT 

295 

1385864–1385883 

sdad R GGCTCTGGTTTGCTTTCCCA 1386139–1386158 

Proteases/inhibitors 

speB_F AGACGGAAGAAGCCGTCAGA 

1698752– 1698771 

952 

speB_R TCAAAGCAGGTGCACGAAGC 1699684–1699703 

spyCEP F GATCCGGCCCATCAAAGCAT 

786 

344582–344601 

spyCEP R AGCTGCCACTGATGTTGGTG 345348–345367 

scpA F GCTCGGTTACCTCACTTGTCC 

1669854 – 1669874 

622 

scpA R CAATAGCAGCAAACAAGTCACC 1670453–1670477 

Mac F TCTTGCCCTGTTGAAAGTGT 

389 

681947–681966 

Mac R CGAGGTGGTATTTTTGACGCC 682315–682335 

sic F TTACGTTGCTGATGGTGTATATGGT 

150 

1682672–1682696 

sic R TTTGATAGAGGGTTTTCAGCTGGC 1682798–1682821 

Phages MIx 1 

Size 

(bp) 

Position in reference 

sequence 

phageA_F AGCTTCGTCAGTTCATTGATGAGT 

343 

34380–34403 

phageA_R GGAGTTAATCTTTGTCTGATCACCGT 34723–34698 

Ref. sequence 

NC_003485 

NC_004587 

NC_003485 

NC_003485 

NC_007297 

NC_002737 

NC_004585 

NC_003485 

NC_011375 

NC_004070 

NC_007296 

NC_007297 

AF410852 

NC_007297 

NC_007297 

NC_002737 

AE004092 

NC_009332 

NC_011375 

NC_002737 

NC_007297

192 

Name Sequence 


phageG_F ACTTGAAGAAGCTGGAGCAACA 

477 

809606–809627 

phageG_R AGGCAATAGCATCTGGCGTC 810052–810033 

phageB_F ATCAGTCGCGCCTACCGTAT 

636 

301872–301891 

phageB_R TTACTAGAAGGGGCCTGCCG 302508–302489 

phageE_F TGAGACATGGTGGAAAGCAGA 

1022 

739495–739515 

phageE_R TGGTCGAAATAACCAAGGGCA 740517–740497 

phaged_F ACGCTTGACTGACTTCGGTG 

1168 

720561–720580 

phaged_R TGGGACTTATCCGTTGTCACG 721729–721709 

Phages MIx2 

phageK_F TGGTCTGCCATCCATTGTCT 

425 

1195963–1195982 

phageK_R AGCCTTCAAAGCTGGTAAAGCT 1196377–1196356 

NC_004070 

NC_007297 

NC_007297 

NC_007297 

NC_008022 

phageJ_F TGATCCATGGTGACCTGCTT 563 1123319–1123338 NC_007297 

phageJ_R TCGACATTGGCCAGGGAGAT 1123881–1123862 

phageC_F ATTGCAACAGGTAGCCCAGC 

670 

531240–531259 

phageC_R CTTCACGCGCAGAACGGATA 531910–531891 

phageH_F AGGCTTTTGAATTACGTTTTGTC 

870 

1058226–1058248 

phageH_R TGAATCAGACGGTTGAGGCT 1059095–1059076 

phageM_F CCACAGCTGTTTCAACACTTTCA 

1143 

1252437–1252459 

phageM_R AATTGGCGCTCGGACATGAT 1253579–1253560 

Phages MIx3 

phageN_F TCACCGTTAATTCCCATTCGCT 

349 

1282773–1282794 

phageN_R CCGTAGGACAGTTGGGCAAA 1283121–1283102 

phageO_F TCACAAAAGCCAGTTGGTCGAT 

452 

1341889–1341910 

phageO_R TATCGTCGTGACTACCGGCT 1342340–1342321 

phageP_F CTAAGGATGTAGTCACTACCCATTTTGTC 

544 

1493473–1493501 

phageP_R TCTGGCTTGACTTACACGCT 1494016–1493997 

phageI_F GGTGCCACGTAATGATAACTTGTTC 

666 

1069901–1069925 

phageI_R GTAGACCCGCCACGAAAAGG 1070566–1070547 

phageL_F GCCAACTGGCCATTTTCTGC 

899 

1236869–1236888 

phageL_R AAGCAAGGAAATGATCGCGG 1237767–1237748 

Phages MIx4 

phageQ_F CCAGCCATAATCTCAGTTGAGACAGTTG 

364 

1434160–1434187 

phageQ_R GGTTCCATCCAAATCAATGGCAATC 1434523–1434499 

phageR_F AACGACGTTGCCCTTCCGCA 

432 

1512239–1512258 

phageR_R TCCAAGCTCCTGGCTCGAATGT 1512670–1512649 

phageT_F CGCTGGCCTTTCTACAACTTCACCA 

555 

1772901–1772925 

phageT_R AGCAACGCTTGAAAAAGATGGCGAT 1773455–1773431 

phageU_F CTCTTCCCTTTTGTCTGCTAACGGT 

671 

1796895–1796919 

phageU_R CCACGGTCACATCCTTGTTGACGG 1797565–1797542 

phageS_F ACACTGACCTTTGAAAAACTCATCCA 

917 

1586507–1586532 

phageS_R ATGATAATAGTCGTAGGGATGCTTGTATTATAAAA 1587423–1587389 

PhageF_F 

Size 

(bp) 

Primers to detect integration into F site 

NC_007297 

NC_008022 

NC_007297 

NC_007297 

NC_007297 

NC_004070 

NC_007297 

NC_007297 

NC_007297 

NC_007297 

NC_007297 

NC_007297 

NC_007297 

CCCGAAGTGAAATCGATGATTGACA ~1000 – 778913–778937 NC_007297 

TCCCACGCTCACGCTCCAAA ~3000 780465–780446 NC_007297 

Control primers for phage detection 

Position in reference 

sequence 

dnaA_F TGCCGAAGCTATTCGCGCCA 

240 

1227–1246 

dnaA_R ACTGTTGAATGGTCTCTGCCACCA 1466–1443 

Table II continued 

Ref. sequence 

NC_007297


193 

Reagent Toxins MIx I 

Toxins MIx II 

and proteases 

dNAses 

Phages MIx 1,2 

and 4 

Phages 

MIx 3 

Phage F 

100 µM or 10 µM primers mix 0.6 µl 0.5 µl 0.4 µl 0.6 µl 0.7 µl 0.2 µl 

10x Taq polymerase buffer 

with (NH ) SO (Fermentas) 

4 2 4 

0.5 µl 0.5 µl 0.5 µl 0.5 µl 0.5 µl 0.5 µl 

25 mM MgCl2 0.5 µl 0.5 µl 0.5 µl 0.5 µl 0.5 µl 0.5 µl 

1 mM dNTP 0.5 µl 0.5 µl 0.5 µl 0.5 µl 0.5 µl 0.5 µl 

water – – – – – – – – – – – – – – – 2.15 µl 

10x diluted chromosomal 

dNA template 

2.8 µl 2.9µl 3.0 µl 2.8 µl 2.7 µl 1 µl 

Taq polymerase (Fermentas) 0.1 µl (0.5 U) 0.1 µl (0.5 U) 0.1 µl (0.5 U) 0.1 µl (0.5 U) 0.1 µl (0.5 U) 0.1 5µl (0.75 U) 

of genes surrounding phage integration site. Primer 

sequences, their chromosomal location and accession 

number of reference sequence are listed in Table II. 

Composition of the reaction and PCR conditions. 

To detect 20 virulence factors, four multiplex 

reactions were designed. To detect 21 mobile genetic 

element integration sites, four multiplex and one singleplex 

reaction were designed. Composition of all 

primer mixes and size of the amplicons generated in 

multiplex reactions are listed in Table II. For the ease 

of use, equal volumes of 100 µM primer stocks were 

mixed into appropriate mixes, namely: “Toxins MIx I”, 

“Toxins MIx II”, “proteases”, “dNAses”. For the case of 

use, equal volumes of 10 µM stocks were mixed into: 

“Phages MIx 1”, “Phages MIx 2”, “Phages MIx 3” and 

“Phages MIx 4”. To avoid degradation, primers premixes 

were aliquoted, so the single portion was sufficient 

to run the whole 96 well PCR plate without 

multiple freezing-thawing cycles. Final composition 

of each PCR reaction is presented in Table III. All PCR 

reactions were carried out in a total volume of 5 µl in 

a Veriti thermocycler (Applied Biosystems); conditions 

of PCR reaction are presented in Table IV. 

Statistical Analysis. Simpson’s Index of diversity, 

and the Wallace Coefficient were calculated using 

online tool http://darwin.phyloviz.net/ (Carrico et al., 

2006; Pinto et al., 2008). Analysis of strains was performed 

with Bionumerics package (Applied Maths). 

Table IV 

PCR reaction conditions used to amplify products 

in multiplex reactions 

denaturation 95°C 0:15 95°C 0:15 95o Toxins MIx I 

and II dnases 

Proteases mix 

Phages 1–4 

and phage F 

T t T t T t 

C 0:15 

Annealing 60°C 0:20 52.5°C 0:45 64°C 0:30 

Elongation 72°C 2:00 72°C 3:00 72°C 3:30 

All reactions were amplified for 40 cycles with initial denaturation was 

carried out for 3 min at 95°C, and final elongation for 7 min at 72°C 

T – temperature; t – time 

Table III 

PCR composition of the multiplex reactions 

Results and Discussion 

Detection of phages. Phages/ICEs of group A Streptococcus 

are major sources of genetic diversity in this 

group of organisms, carriers of antibiotic resistance 

genes and multiple proven and putative virulence factors 

(Beres and Musser, 2007). detection of integrated 

mobile elements can distinguish between GAS strains 

with closely related genetic backgrounds and with addition 

of other typing methods can be used in detailed 

epidemiological investigations (Beres et al., 2010; Beres 

et al., 2004). 

Comparison of multiple GAS genomic sequences 

revealed 21 potential integration sites for phages and 

ICE elements (Beres and Musser, 2007) and Table I. To 

screen all 21 integration sites (named from A through 

U as in (Beres and Musser, 2007)), we designed set of 

four multiplex PCR reactions that are able to amplify 

products only when no element is integrated between 

open reading frames flanking integration site. detection 

of the integrated phages and ICE elements is based 

on the assumption that in the standard PCR reaction, 

large (above 10 kb) element integrated into the chromosome 

cannot be efficiently amplified and furthermore 

detected. The designed primer pairs within single multiplex 

reaction had equal annealing temperatures and 

100 bp or more size difference between products for 

easy product tracing. Primers were tested individually 

using an annealing gradient of temperatures from 55 

to 72°C to select the optimal annealing temperature 

for multiplex PCR. Only primers that generated single 

amplicons were selected for composition of multiplex 

reactions (data not shown). 

Because the lack of the PCR product denotes positive 

detection of large integrated element into particular 

integration site, to avoid PCR errors resulting from negative 

PCR amplification, in all multiplex reactions positive 

control of amplification (240 bp fragment of dnaA 

gene) is included. Examples of phage profile (PP) typing 

of randomly chosen strains from our GAS collection are

194 

presented in Figure 1. To test primer specificity, we preformed 

PP typing using two reference strains of known 

genomic sequence: MGAS6180 (NC_007296.1 (Green 

et al., 2005)) and MGAS10270 (NC_008022 (Beres and 

Musser, 2007)). Based on the genomic sequence , strain 

MGAS6180 carries 7 elements integrated into sites G, 

H, I, L, M, T, U and MGAS10270 carries 7 elements 

integrated into sites C, E, G, L, M, T, U (Table I) ( Beres 

and Musser, 2007). In concordance with the predicted 

product presence and size, we were able to detect fragments 

that denote putative integration sites without 

inserted element, and we were not able to detect products 

that amplified large integrated element (Fig. 2). In 

some cases, such as for site G in strain MGAS10270 

and site L in strain MGAS6180, very weak bands are 

observed and are probably a signal derived from a dNA 

isolated from fraction of GAS cells where the element 

was excised from the chromosome. 

Two mobile elements 315.1 and SPsP5 are integrated 

into integration site “F” in M3 strain MGAS315 

(between ORFs SpyM3_0680 and SpyM3_0737) and 

SSI-1 (between ORFs SPs0876 and SPs0938), respectively 

(Beres and Musser, 2007). However, based on 

the BLAST searches in all sequenced GAS genomes, 

the region encompassed by ORFs flanking prophage 

integration site varies in length and gene content in different 

strains. Therefore, primers detecting integrated 


Table V 

Simpson’s Index of diversity (SdI) and Wallace’s coefficient (WC), calculated for strains analyzed by phage 

profiling (PP) and virulence factor profiling (VF) 

A. 

Typing Method # partitions Simpson’s Id C.I. (95%) 

Phage profile (PP) 185 0.965 (0.960–0.971) 

Virulence factor profile (VF) 95 0.943 (0.936–0.951) 

Virulence factor profile (VF) without “proteases mix” 94 0.944 (0.936–0.952) 

emm type 40 0.908 (0.899–0.917) 

B. 

PFGE ST emm VF PP 

PFGE 1.000 1.000 0.990 0.986 

(1.000–1.000) (1.000–1.000) (0.979–1.000) (0.974–0.997) 

ST 0.564 1.000 0.899 0.648 

(0.379–0.749) (1.000–1.000) (0.768–1.000) (0.472–0.824) 

emm 0.564 1.000 0.899 0.648 

(0.379–0.749) (1.000–1.000) (0.768–1.000) (0.472–0.824) 

VF 0.622 1.000 1.000 0.721 

(0.430–0.813) (1.000–1.000) (1.000–1.000) (0.556–0.886) 

PP 0.858 1.000 1.000 1.000 

(0.703–1.000) (1.000–1.000) (1.000–1.000) (1.000–1.000) 

Information about absence (0)/presence (1) of particular virulence factor or integrated element was concatenated into 

binary sequence of 20 or 21 digits and used for calculations with http://darwin.phyloviz.net/ComparingPartitions/. 

A SdI calculated for group of 656 divergent strains; B. WC calculated for group of highly clonal strains (PFGE pattern A 

from Szczypa, et al., 2004) 

element F amplify fragment of varying size, from about 

1 kb to over 3 kb in the absence of integrated prophage. 

We decided to exclude primers detecting integration in 

the F site from multiplex reaction to increase PCR specificity 

and efficiency and run the reaction separately 

(Fig. 1E). With additional optimization of the reaction, 

primers detecting F integration site can be included in 

“phage mix 3”, however detected bands are often weaker 

and gels more difficult for interpretation (Fig. 2). 

To determine resolution of the phage profile detection 

as a typing method, we calculated Simpson’s Index 

of diversity (SId) based on analysis of highly diverse 

656 GAS strains (Table VA). Among 40 emm types, we 

detected 185 distinct phage profiles with Simpson’s 

Index of diversity of 0.965 (CI 95% 0.960–0.971). 

Phage profile is also good predictor of emm type, 

with PP→emm Wallace’s coefficient (WC) equal 0.953 

(CI 95% 0.926–0.980). 

Insertion or excision of large dNA fragments such 

as phages/ICEs from the chromosome usually is reflected 

in PFGE analysis. To test if the presence of integrated 

elements correlates with PFGE pattern, we analyzed 

homogenous population of strains previously 

described by Szczypa and co-workers (Szczypa et al., 

2004). Performed PP analysis showed that detection of 

elements inserted into putative integration sites correlates 

with PFGE patterns, emm type and ST (Fig. 3AB).


195 

Fig. 1. detection of twenty one GAS phage and ICE integration sites in randomly chosen GAS strains. 

Each panel represents multiplex PCR reaction: A: Phage MIx1, B: Phage MIx2, C: Phage MIx3, d: Phage MIx4, E. Phage F Amplification of a product 

denotes lack of integrated element at the chromosomal location. Arrows denote expected product size based on the GAS genomic sequences, letters 

in parentheses denote the mobile element integration sites after (Beres and Musser, 2007) and Table I, 1.5% agarose/TBE, marker: GeneRuler 100 bp 

Plus dNA Ladder (Fermentas). 

Fig. 2. detection of integrated mobile genetic elements in reference strains MGAS6180 and MGAS10270. 

Capital letters denote the mobile element integration sites (after (Beres and Musser, 2007) and Table I) detected by each multiplex reaction and 

“+” denotes positive control – amplification of dnaA fragment. Amplification of a product denotes lack of integrated element at the chromosomal 

location. Black boxes denote locations without integrated element and white boxes denote chromosomal locations with integrated mobile elements as 

annotated for the genomic sequences of MGAS6180 (sites G, H, I, L, M, T, U) (Green, et al., 2005) and MGAS10270 (sites C, E, G, L, M, T, U). 1.5% 

agarose in TBE buffer, marker: GeneRuler 100 bp Plus dNA Ladder (Fermentas).

196 

We detected differences in phage content within single 

emm/ST groups that was reflected in described previously 

subtype of PFGE (Fig. 3). Although PFGE subtyping 

is the best predictor of phage content (WC PFGE→PP = 

0.986; CI 95% 0.974–0.997), conversely, PP typing can 

detect variants that reflect PFGE subtypes with over 

85% probablity (WC PP→PFGE =0.858; CI 95% 0.703–1.000) 

(Table VB). 

Detection of virulence factors. Multiple virulence 

factors produced by GAS such as superantigens, proteases 

and dNAses are linked to disease severity and 

clinical manifestations of infection (Bernal et al., 1999; 


Fig. 3A. 

Fraser et al., 2000; Proft et al., 2000). In particular, presence 

of speA gene is associated with streptococcal toxic 

like shock syndrome and scarlet fever (Hauser et al., 

1991; Musser et al., 1991; Stevens et al., 1989; Yu and 

Ferretti, 1989) and smeZ participates in repression of 

cognate anti-streptococcal responses (Unnikrishnan 

et al., 2002). Therefore, the detection of virulence factors 

can be used as a predictor of disease severity and 

as a diagnostic marker. 

We designed set of four, low volume, multiplex 

reac tions that allow simultaneous detection of 20 GAS 

virulence factors. Two multiplex reactions detect genes


197 

Fig. 3. Correlation between detected phage/ICE integration sites and virulence factors with M type (emm), sequence type (ST) and 

PFGE pattern (after (Szczypa et al., 2004)). 

A. A through K designations (with subtypes marked with arabic numerals) denote PFGE patterns detected by (Szczypa et al., 2004). Clusters and relationship 

between them are based on detected phages and ICE elements and were determined using Minimum Spanning Tree method of BioNumerics 

package by Applied Maths. Circle size indicates number of isolates in each PFGE group. B. Black rectangles denote phages/ICEs and virulence factors 

detected in analyzed strains. Strips of PFGE gels represent detected patterns and sub-patterns. 

encoding 11 superantigens: speL, speK, speM, speC, 

smeZ, speI and ssa, speA, speH, speG, speJ; one multiplex 

PCR detects dNases: chromosomal sdaB (named also 

streptodornase B, speF, MF, designated M5005_1738 

in strain MGAS5005) and phage encoded spd3 

(M5005_Spy1169), sdc, (sdalpha, SpyM3_1409), sdaD 

(M5005_1415); fourth multiplex reaction detects genes 

encoding proteases scpA, speB, mac, spyCEP and strepto- 

coccal inhibitor of complement sic. An example of the 

PCR products separation after detection of virulence fac- 

tors in four multiplex reactions is presented in Fig. 4 A-d. 

To assure that the possible negative result of amplification 

of multiplex reactions “Toxins MIx I” and 

“Toxins MIx II” was not caused by poor quality of 

dNA, results of the reactions were always cross-checked 

with the results of other reactions and the detection of 

chromosomally located genes served as positive control 

of dNA amplification. 

distribution of phage encoded virulence factors 

could be in majority of cases attributed to the detected 

integrated elements known to encode particular virulence 

factor (Beres and Musser, 2007). Therefore, 

detection of particular superantigens was routinely 

compared with detected phage profiles. Example of 

such comparison can be seen in Fig. 5. Lack of detected 

products in multiplex reaction “Toxins MIx I” correlates 

with detection of elements integrated into sites F, 

G and T that do not encode superantigens. In case of 

the same strain, detection spd3 gene correlates with the 

detection of the mobile element integrated into R site 

that can carry this type of dNAse. detection of virulence 

factors was validated using reference strains of

198 


Fig. 4. detection of twenty GAS virulence factors in randomly chosen strains. 

Each panel represents multiplex PCR reactions: A: dNAses, B: toxins I, C: proteases and sic, d: toxins II. 1.5% agarose/TBE, marker: GeneRuler 

100 bp Plus dNA Ladder (Fermentas). 

Fig. 5. Analysis of phage and virulence factors presence in a single M81 strain. 

Analysis of phage integration sites detected elements integrated into F, G, T and R chromosomal locations. Based on the genome sequences, the integration 

sites correspond with the elements not carrying any virulence factors (sites F, G and T) and encoding Spd3 dNase (site R) (Beres and Musser, 

2007). during the analysis of virulence factors, phage encoded spd3 dNAse was detected, as well as chromosomally encoded speG, speB, spyCEP, scpA, 

mac and sdaB.Marker: GeneRuler 100 bp Plus dNA Ladder (Fermentas).


199 

Fig. 6. detection of toxins and dNAses in sequenced reference GAS strains MGAS5005 (NC_007297.1), MGAS315 (NC_004070.1), 

MGAS10270 (NC_008022.1) and MGAS6180 (NC_007296.1). 

Each panel represents multiplex PCR reaction: A: toxins I , B:, toxins II C: dNAses. Chromosomally located speB, mac, spyCEP were detected in all 

cases sic gene was detected in MGAS5005 (data not shown). 1.5% agarose/TBE, marker: GeneRuler 100 bp Plus dNA Ladder (Fermentas). 

known genomic sequence and virulence factor profiles; 

the detected profile matched predicted profiles (Fig. 6). 

Analysis of 656 diverse GAS strains detected 

95 virulence factor profiles among 40 emm types and 

185 phage profiles (SId = 0.943; CI 95% 0.936–0.951). 

The number of detected VF profiles is lower than phage 

profiles because phages encoding certain virulence factors, 

such as SpeC or SpeK can be carried by phages 

integrated in various sites (Beres and Musser, 2007), 

so single virulence factor profiles can mach different 

phage profiles. 

Based on SId calculations (Table V) and the fact 

that chromosomally encoded proteases SpeB, SpyCEP, 

ScpA and Mac are detected in virtually all strains, the 

detection of virulence factors can be simplified. Abbreviated 

method (without “proteases mix”) has identical 

resolution as not abbreviated method (Table V). The 

mix, however, can be used for the analysis of emm type 

1 strains to detect variants of sic gene. As an alternative 

approach, primers detecting sic gene can be added to 

mixes “toxins II” or “dNases”. 

The group of strains chosen to further test the 

method of virulence factor detection, was highly clonal 

based on previous analyses (Szczypa et al., 2004) and 

this work). Analysis of genes encoding virulence factors 

shows that these strains have potential to produce 

almost identical virulence factors within each PFGE 

group. In addition particular virulence factors within 

each group seem to be encoded by the same phage and 

differences in virulence factor profiles are reflected by 

subgroups of PFGE patterns (Fig. 3B). 

In a conclusion, we developed two inexpensive 

methods that allow easy differentiation between S. pyogenes 

strains. In addition, detection of superantigens 

and other virulence factors in clinical strains can provide 

invaluable information for further epidemiological 

investigations. Comparing with PFGE and MLST, 

the method is fast (2–3 h of PCR amplification with 

additional time for electrophoresis) and cost of multiplex 

PCR reactions is much lower than sequencing. 

The discriminatory power of the system used as typing 

method is comparable with PFGE, and it can be used 

when rapid strain comparison is required. 

Acknowledgments 

We are thankful to members of KORLd and KOROUN for 

strain collection and to Katarzyna Szczypa for critical reading of 

the manuscript. 

The work was supported by: grant N N401 536140 from 

National Center for Science to W.H.; internal funding (dS.5.82 

and dS 5.67) to I.S.; National Program of Antibiotics Protection 

(NPOA-Moduł 1), unrestricted grant from GlaxoSmithKline Poland 

and Polish Ministry of Science grant for bacterial collection maintenance 

– Mikrobank. 

Literature 

Beall B., R. Facklam and T. Thompson. 1996. Sequencing emmspecific 

PCR products for routine and accurate typing of group A 

streptococci. J. Clin. Microbiol. 34: 953–958. 

Beall B., G. Gherardi, M. Lovgren, R.R. Facklam, B.A. Forwick 

and G.J. Tyrrell. 2000. emm and sof gene sequence variation in relation 

to serological typing of opacity-factor-positive group A streptococci. 

Microbiology 146: 1195–1209. 

Beres S.B., R.K. Carroll, P.R. Shea, I. Sitkiewicz, J.C. Martinez- 

Gutierrez, D.E. Low, A. McGeer, B.M. Willey, K. Green, G.J. Tyrrell, 

et al. 2010. Molecular complexity of successive bacterial epidemics 

deconvoluted by comparative pathogenomics. Proc. Natl. Acad. Sci. 

USA 107: 4371–4376. 

Beres S.B. and J.M. Musser. 2007. Contribution of exogenous 

genetic elements to the group A Streptococcus metagenome. PLoS 

One. 2: e800.

200 

Beres S.B., G.L. Sylva, D.E. Sturdevant, C.N. Granville, M. Liu, 

S.M. Ricklefs, A.R. Whitney, L.D. Parkins, N.P. Hoe, G.J. Adams, 

et al. 2004. Genome-wide molecular dissection of serotype M3 

group A Streptococcus strains causing two epidemics of invasive 

infections. Proc. Natl. Acad. Sci. USA. 101: 11833–11838. 

Bernal A., T. Proft, J.D. Fraser and D.N. Posnett. 1999. Superantigens 

in human disease. J. Clin. Immunol. 19: 149–157. 

Bert F., C. Branger and N. Lambert-Zechovsky. 1997. Pulsed-field 

gel electrophoresis is more discriminating than multilocus enzyme 

electrophoresis and random amplified polymorphic dNA analysis 

for typing pyogenic streptococci. Curr. Microbiol. 34: 226–229. 

Carapetis J.R., A.C. Steer, E.K. Mulholland and M. Weber. 2005. 

The global burden of group A streptococcal diseases. Lancet. Infect. 

Dis. 5: 685–694. 

Carrico J.A., C. Silva-Costa, J. Melo-Cristino, F.R. Pinto, 

H. de Lencastre, J.S. Almeida and M. Ramirez. 2006. Illustration 

of a common framework for relating multiple typing methods by 

application to macrolide-resistant Streptococcus pyogenes. J. Clin. 

Microbiol. 44: 2524–2532. 

Chiang-Ni C. and J.J. Wu. 2008. Effects of streptococcal pyrogenic 

exotoxin B on pathogenesis of Streptococcus pyogenes. J. Formos. 

Med. Assoc. 107: 677–685. 

Cleary P.P., E.L. Kaplan, C. Livdahl and S. Skjold. 1988. dNA 

fingerprints of Streptococcus pyogenes are M type specific. J. Infect. 

Dis. 158: 1317–1323. 

Cleary P.P., U. Prahbu, J.B. Dale, D.E. Wexler and J. Handley. 

1992. Streptococcal C5a peptidase is a highly specific endopeptidase. 

Infect. Immun. 60: 5219–5223. 

Commons R., S. Rogers, T. Gooding, M. Danchin, J. Carapetis, 

R. Robins-Browne and N. Curtis. 2008. Superantigen genes in 

group A streptococcal isolates and their relationship with emm 

types. J. Med. Microbiol. 57: 1238–1246. 

Courtney H.S., D.L. Hasty and J.B. Dale. 2002. Molecular mechanisms 

of adhesion, colonization, and invasion of group A streptococci. 

Ann. Med. 34: 77–87. 

Cunningham M.W. 2000. Pathogenesis of group A streptococcal 

infections. Clin. Microbiol. Rev. 13: 470–511. 

Edwards R.J., G.W. Taylor, M. Ferguson, S. Murray, N. Rendell, 

A. Wrigley, Z. Bai, J. Boyle, S.J. Finney, A. Jones, et al. 2005. 

Specific C-terminal cleavage and inactivation of interleukin-8 by 

invasive disease isolates of Streptococcus pyogenes. J. Infect. Dis. 192: 

783–790. 

Enright M.C., B.G. Spratt, A. Kalia., J.H. Cross and D.E. Bessen. 

2001. Multilocus sequence typing of Streptococcus pyogenes and 

the relationships between emm type and clone. Infect. Immun. 69: 

2416–2427. 

Facklam R., B. Beall, A. Efstratiou, V. Fischetti, D. Johnson, 

E. Kaplan, P. Kriz, M. Lovgren, D. Martin, B. Schwartz, et al. 

1999. Emm typing and validation of provisional M types for group 

A streptococci. Emerg. Infect. Dis. 5: 247–253. 

Ferretti J.J., W.M. McShan, D. Ajdic, D.J. Savic, G. Savic, K. Lyon, 

C. Primeaux, S. Sezate, A.N. Suvorov, S. Kenton, et al. 2001. Complete 

genome sequence of an M1 strain of Streptococcus pyogenes. 

Proc. Natl. Acad. Sci. USA 98: 4658–4663. 

Fraser J., V. Arcus, P. Kong, E. Baker and T. Proft. 2000. Superantigens 

– powerful modifiers of the immune system. Mol. Med. 

Today 6: 125–132. 

Green N.M., S. Zhang, S.F. Porcella, M.J. Nagiec, K.D. Barbian, 

S.B. Beres, R.B. LeFebvre and J.M. Musser. 2005. Genome 

sequence of a serotype M28 strain of group a streptococcus: potential 

new insights into puerperal sepsis and bacterial disease specificity. 

J. Infect. Dis. 192: 760–770. 

Hartas J., M. Hibble and K.S. Sriprakash. 1998. Simplification of 

a locus-specific dNA typing method (Vir typing) for Streptococcus 

pyogenes. J. Clin. Microbiol. 36: 1428–1429. 


Hauser A.R., D.L. Stevens, E.L. Kaplan and P.M. Schlievert. 

1991. Molecular analysis of pyrogenic exotoxins from Streptococcus 

pyogenes isolates associated with toxic shock-like syndrome. J. Clin. 

Microbiol. 29: 1562–1567. 

Herschleb J., G. Ananiev and D.C. Schwartz. 2007. Pulsed-field 

gel electrophoresis. Nat. Protoc. 2: 677–684. 

Hoe N., K. Nakashima, D. Grigsby, X. Pan, S.J. Dou, S. Naidich, 

M. Garcia, E. Kahn, D. Bergmire-Sweat and J.M. Musser. 1999. 

Rapid molecular genetic subtyping of serotype M1 group A Streptococcus 

strains. Emerg. Infect. Dis. 5: 254–263. 

Koller T., A.G. Manetti, B. Kreikemeyer, C. Lembke, I. Margarit, 

G. Grandi and A. Podbielski. 2010. Typing of the pilus-proteinencoding 

FCT region and biofilm formation as novel parameters 

in epidemiological investigations of Streptococcus pyogenes isolates 

from various infection sites. J. Med. Microbiol. 59: 442–452. 

Kurupati P., C.E. Turner, I. Tziona, R.A. Lawrenson, F.M. Alam, 

M. Nohadani, G.W. Stamp, A.S. Zinkernagel, V. Nizet, R.J. Edward, 

et al. 2010. Chemokine-cleaving Streptococcus pyogenes protease 

SpyCEP is necessary and sufficient for bacterial dissemination 

within soft tissues and the respiratory tract. Mol. Microbiol. 76: 

1387–1397. 

Lintges M., S. Arlt, P. Uciechowski, B. Plumakers, R.R. Reinert, 

A. Al-Lahham, R. Lutticken and L. Rink. 2007. A new closed-tube 

multiplex real-time PCR to detect eleven superantigens of Streptococcus 

pyogenes identifies a strain without superantigen activity. Int. 

J. Med. Microbiol. 297: 471–478. 

Matsumoto M., N.P. Hoe, M. Liu, S.B. Beres, G.L. Sylva, 

C.M. Brandt, G. Haase and J.M. Musser. 2003. Intrahost sequence 

variation in the streptococcal inhibitor of complement gene in 

patients with human pharyngitis. J. Infect. Dis. 187: 604–612. 

Maxted W.R., J.P. Widdowson, C.A. Fraser, L.C. Ball and 

D.C. Bassett. 1973. The use of the serum opacity reaction in the 

typing of group-A streptococci. J. Med. Microbiol. 6: 83–90. 

Moody M.D., J. Padula, D. Lizana and C.T. Hall. 1965. Epidemiologic 

Characterization of Group A streptococci by T-Agglutination 

and M-Precipitation Tests in the Public Health Laboratory. Health. 

Lab. Sci. 2: 149–162. 

Musser J.M., A.R. Hauser, M.H. Kim, P.M. Schlievert, K. Nelson 

and R.K. Selander. 1991. Streptococcus pyogenes causing toxicshock-like 

syndrome and other invasive diseases: clonal diversity 

and pyrogenic exotoxin expression. Proc. Natl. Acad. Sci. USA 88: 

2668–2672. 

Nandi S., N.K. Ganguly, R. Kumar, D.K. Bakshi, V.S. Vivek Sagar 

and A. Chakraborti. 2008. Genotyping of group A Streptococcus by 

various molecular methods. Indian. J. Med. Res. 127: 71–77. 

Oehmcke S., O. Shannon, M. Morgelin and H. Herwald. 2010. 

Streptococcal M proteins and their role as virulence determinants. 

Clin. Chim. Acta 411: 1172–1180. 

Perez-Caballero D., I. Garcia-Laorden, G. Cortes, M.R. Wessels, 

S.R. de Cordoba and S. Alberti. 2004. Interaction between complement 

regulators and Streptococcus pyogenes: binding of C4b-binding 

protein and factor H/factor H-like protein 1 to M18 strains involves 

two different cell surface molecules. J. Immunol. 173: 6899–6904 

Pinto F.R., J. Melo-Cristino and M. Ramirez. 2008. A confidence 

interval for the wallace coefficient of concordance and its application 

to microbial typing methods. PLoS One. 3: e3696. 

Proft T., S.L. Moffatt, K.D. Weller, A. Paterson, D. Martin and 

J.D. Fraser. 2000. The streptococcal superantigen SMEZ exhibits 

wide allelic variation, mosaic structure, and significant antigenic 

variation. J. Exp. Med. 191: 1765–1776. 

Richardson L.J., S.Y. Tong, R.J. Towers, F. Huygens, K. McGregor, 

P.K. Fagan, B.J. Currie, J.R. Carapetis and P.M. Giffard. 2010. 

Preliminary validation of a novel high resolution melt-based typing 

method based on the multilocus sequence typing scheme of 

Streptococcus pyogenes. Clin. Microbiol. Infect. in press.


201 

Schmitz F.J., A. Beyer, E. Charpentier, B.H. Normark, M. Schade, 

A.C. Fluit, D. Hafner and R. Novak. 2003. Toxin-gene profile 

hetero geneity among endemic invasive European group A streptococcal 

isolates. J. Infect. Dis. 188: 1578–1586. 

Seppala H., J. Vuopio-Varkila, M. Osterblad, M. Jahkola, 

M. Rummukainen, S.E. Holm and P. Huovinen. 1994. Evaluation 

of methods for epidemiologic typing of group A streptococci. 

J. Infect. Dis. 169: 519–525. 

Slater G.W. 2009. dNA gel electrophoresis: the reptation model(s). 

Electrophoresis 30 Suppl. 1: S181–187. 

Smeesters P. R., D.J. McMillan and K.S. Sriprakash. 2010. The 

streptococcal M protein: a highly versatile molecule. Trends. Microbiol. 

18: 275–282. 

Stanley J., D. Linton, M. Desai, A. Efstratiou and R. George. 1995. 

Molecular subtyping of prevalent M serotypes of Streptococcus pyogenes 

causing invasive disease. J. Clin. Microbiol. 33: 2850–2855. 

Stevens D.L., M.H. Tanner, J. Winship, R. Swarts, K.M. Ries, 

P.M. Schlievert and E. Kaplan. 1989. Severe group A streptococcal 

infections associated with a toxic shock-like syndrome and scarlet 

fever toxin A. N. Engl. J. Med. 321: 1–7 

Sumby P., K.D. Barbian, D.J. Gardner, A.R. Whitney, D.M. Welty, 

R.D. Long, J.R. Bailey, M.J. Parnell, N.P. Hoe, G.G. Adams, et al. 

2005. Extracellular deoxyribonuclease made by group A Streptococcus 

assists pathogenesis by enhancing evasion of the innate immune 

response. Proc. Natl. Acad. Sci. USA 102: 1679–1684. 

Sumby P., S. Zhang, A.R. Whitney, F. Falugi, G. Grandi, 

E.A. Graviss, F.R. Deleo and J.M. Musser. 2008. A chemokinedegrading 

extracellular protease made by group A Streptococcus 

alters pathogenesis by enhancing evasion of the innate immune 

response. Infect. Immun. 76: 978–985. 

Swift H.F., A.T. Wilson and R.C. Lancefield. 1943. Typing Group A 

Hemolytic streptococci by M precipitin reactions in capillary 

pipettes. J. Exp. Med. 78: 127–133. 

Szczypa K., E. Sadowy, R. Izdebski and W. Hryniewicz. 2004. 

A rapid increase in macrolide resistance in Streptococcus pyogenes 

isolated in Poland during 1996–2002. J. Antimicrob. Chemother. 54: 

828–831. 

Tart A.H., M.J. Walker and J.M. Musser. 2007. New understanding 

of the group A Streptococcus pathogenesis cycle. Trends. Microbiol. 

15: 318–325. 

Tenover F.C., R.D. Arbeit, R.V. Goering, P.A. Mickelsen, 

B.E. Murray, D.H. Persing and B. Swaminathan. 1995. Interpreting 

chromosomal dNA restriction patterns produced by pulsedfield 

gel electrophoresis: criteria for bacterial strain typing. J. Clin. 

Microbiol. 33: 2233–2239. 

Terao Y., Y. Mori, M. Yamaguchi, Y. Shimizu, K. Ooe, S. Hamada 

and S. Kawabata. 2008. Group A streptococcal cysteine protease 

degrades C3 (C3b) and contributes to evasion of innate immunity. 

J. Biol. Chem. 283: 6253–6260. 

Unnikrishnan M., D.M. Altmann, T. Proft, F. Wahid, J. Cohen, 

J.D. Fraser and S. Sriskandan. 2002. The bacterial superantigen 

streptococcal mitogenic exotoxin Z is the major immunoactive agent 

of Streptococcus pyogenes. J. Immunol. 169: 2561–2569. 

von U. Pawel-Rammingen, B.P. Johansson and L. Bjorck. 2002. 

IdeS, a novel streptococcal cysteine proteinase with unique specificity 

for immunoglobulin G. Embo. J. 21: 1607–1615. 

Walker M.J., A. Hollands, M.L. Sanderson-Smith, J.N. Cole, 

J.K. Kirk, A. Henningham, J.D. McArthur, K. Dinkla, R.K. Aziz, 

R.G. Kansal, et al. 2007. dNase Sda1 provides selection pressure 

for a switch to invasive group A streptococcal infection. Nat. Med. 

13: 981–985. 

C.E. Yu and J.J. Ferretti. 1989. Molecular epidemiologic analysis 

of the type A streptococcal exotoxin (erythrogenic toxin) gene 

(speA) in clinical Streptococcus pyogenes strains. Infect. Immun. 57: 

3715–3719. 

Zinkernagel A.S., A.M. Timmer, M.A. Pence, J.B. Locke, 

J.T. Buchanan, C.E. Turner, I. Mishalian, S. Sriskandan, E. Hanski, 

and V. Nizet. 2008. The IL-8 protease SpyCEP/ScpC of group A 

Streptococcus promotes resistance to neutrophil killing. Cell. Host. 

Microbe. 4: 170–178.




Expression of Helicobacter pylori ggt Gene in Baculovirus Expression System 

and Activity Analysis of its Products 

Introduction 

Helicobacter pylori is a common human pathogen 

that colonizes the gastric mucosa. Infection puts the 

individual at greater risk for developing gastritis, peptic 

ulcer disease, and gastric cancer (Marshall and Warren, 

1984; Bjorkholm et al., 2003; Sharma and Vakil, 2003). 

H. pylori produces a number of virulence factors that 

enable its pathogenesis. One of these is an enzyme, 

γ-glutamyltranspeptidase (GGT, EC 2.3.2.2), in the 

periplasm, which is involved in induction of host cell 

apoptosis (Shibayama et al., 2003) and plays an important 

role in colonization by H. pylori (Chevalier et al., 

1999; McGovern et al., 2001). 

GGTs are fairly ubiquitous with homologues observed 

in all kingdoms, and are generally considered to 

be involved in the metabolism of glutathione and in 

the salvaging of cysteine (Hanigan and Ricketts, 1993; 

Ikeda and Taniguchi, 2005). Although distant GGTs 

often share considerable sequence identity, significant 

catalytic differences exist between bacterial and nonbacterial 

homologues (Ikeda et al., 1995; Ikeda et al., 

1996). Mammalian GGTs are embedded in the plasma 

membrane by a single N-terminal transmembrane 

anchor and are heterologously glycosylated, bacterial 

homologs are soluble and localized to the periplasmic 

space. H. pylori GGT (HpGT) is a member of the 

N-terminal nucleophile hydrolase superfamily, and is 

translated as an inactive proenzyme that undergoes 

MEI KONG, MING xU, YA-LONG HE and YOU-LI ZHANG* 

department of Gastroenterology, the Affiliated Hospital of Jiangsu University 

Received 21 december 2010, revised 26 June 2011, accepted 6 July 2011 

Abstract 

The γ-glutamyltranspeptidase (GGT) of Helicobacter pylori (HpGT) is a newly found virulence factor. In an approach to gain insight into the 

gene function, the four domains of the HpGT were cloned and expressed in baculovirus expression system. The results of a functional assay 

showed that the HpGT products acted as GGT, even when the N-terminal 380 amino acids were deleted. However, only the full length open 

reading frame (ORF) of the HpGT gene was apparently effective on cell growth. This result indicated that the products of the full length ORF 

might have an important role in gastric carcinogenesis. In this paper, we are the first to report that changes of mitochondrial membrane 

potential can be detected using 5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazole carbocyanine iodide (JC-1) staining in insect cells. 

K e y w o r d s: glutamyltranspeptidase; Helicobacter pylori; membrane potential; virulence factor 

autoprocessing to become an active enzyme (Brannigan 

et al., 1995). despite its demonstrated involvement in 

H. pylori colonization, persistence, and disease progression 

(Boanca et al., 2007), the biochemical characterization 

of HpGT is still limited (Coloma and Pitot 1986). 

Although the general features of the function of HpGT 

can be inferred based on its classification as an N-terminal 

nucleophile hydrolase, many mechanistic details 

of the autoactivation and catalytic function of HpGT 

have not been addressed. In this paper, the domains of 

the HpGT gene were expressed in baculovirus expression 

system and subsequently analyzed. 

Experimental 


The E. coli dH10Bac/BmNPV cell line was provided 

by Professor E.Y. Park (department of Applied Biological 

Chemistry, Faculty of Agriculture, Shizuoka University, 

Shizuoka, Japan). 

FuGENE TM 6 transfection reagent was from Roche 

Company. Grace’s insect cell culture medium (GIBCO) 

was purchased from Invitrogen. The B. mori cell line 

BmN (originated from ovary) was preserved in our 

laboratory and cultured at 27°C in Grace’s insect cell 

culture medium. 

H. pylori culture. H. pylori strain was isolated from 

clinic tissues. The strains were grown on horse blood 

* Corresponding author: Y-L. Zhang, department of Gastroenterology, the Affiliated Hospital of Jiangsu University; Jiefang Road 438, 

Zhenjiang 212001, Jiangsu Province, China; e-mail: youlizhang1972@126.com

204 

agar plates (Oxoid Base) supplemented with vancomycin 

(5 mg/L), polymyxin B (2500 U/L), trimethoprim 

(5 mg/L) and amphotericin B (4 mg/L). Plates were 

incubated in an anaerobic jar with a microaerobic gas 

in the presence of a catalyst. E. coli strain dH5α was 

used as hosts for plasmid cloning experiments, and was 

grown in L-broth (10 g of tryptone, 5 g of yeast extract 

and 5 g of NaCl per litre, pH 7.0) or on L-agar plates 

(1.5% agar) at 37°C. 

Cloning of the domains of HpGT gene. According 

to the HpGT gene structure and the dNA sequence 

in GenBank (Access No: NC_000921), four domains 

were designed for the functional analysis, including full 

length of the HpGT ORF (open reading frame), HpGTd30a, 

HpGT-d80a, and HpGT-d380a (deletion of 30, 

80, 380 amino acids in the N-terminal, respectively). 

The specific primers for amplification of the four fragments 

are shown in Table I. 

The PCR conditions for amplification of the HpGT 

fragments were: 1 cycle at 94°C for 5 min; 35 cycles at 

94°C for 45 s, 55°C for 40 s, 72°C for 3 min; and 1 cycle 

at 72°C for 10 min. 

Construction of recombinant donor plasmids. 

According to the HpGT protein structure, we designed 

four fragments (full length, d30a, d80a, and d380a) to 

analyze enzymic activity. After PCR, four fragments 

were obtained (Fig. 1a). Sequencing results indicated 

that no no-sense mutations occurred. The fragments 

were inserted into the baculovirus transfer vector 

pFastBac1. Furthermore, to detect the expression of 

the fragments, the fusion proteins with the eGFP gene 

were constructed in the C-terminal of the fragments. 

The dNA of baculovirus donor plasmid pFastBac1 

was digested with EcoR I and Xho I, and ligated to the 

HpGT fragments digested with the same enzymes, 

respectively. To generate fusing ORFs with eGFP gene, 

the eGFP fragment was inserted into the constructed 

plasmids containing the HpGT fragments by digestion 

with Xho I and Hind III as well. 

Isolation of recombinant bacmid and baculoviruses. 

The recombinant bacmids were transformed 

into E. coli dH10Bac/BmNPV where transposition 

occurred. By screening the transformed clones, Bacmid 

Mei Kong et al. 3 

Table I 

The primers for amplification of HpGT fragments 

Fragmnent Primer Length (bp) 

Full length F: cgc gaa ttc atg aga cgg agt ttt tta aaa acg (EcoR I) 1704 

d30a F: cgc gaa ttc atg ccc att aaa aac act aaa gtg (EcoR I) 1614 

d80a F: cgc gaa ttc atg aat att ggt ggg ggg ggt ttt (EcoR I) 1464 

d380a F: cgc gaa ttc atg acg cat tat tct gta gcg ga (EcoR I) 564 

R: gac ctc gag aaa ttc ttt cct tgg atc cgt t (Xho I) 

eGFP F: gac ctc gag atg gtg agc aag ggc gag ga (Xho I) 693 

R: cgc aag ctt tta ctt gta cag ctc gtc ca (Hind I) 

dNA was isolated using the FlexiPrep kit (Amersham 

Pharmacia Biotech) and then analyzed by PCR with 

the M13 primers (Su et al., 2009). The PCR conditions 

were 1 cycle at 94°C for 5 min; 35 cycles at 94°C for 45 s, 

55°C for 45 s, and 72°C for 5 min; and 1 cycle at 72°C 

for 10 min. Recombinant bacmid dNA confirmed by 

PCR was transfected into Bm cells using transfection 

reagent according to the manual. 

γ-Glutamyltranspeptidase activity. After infection 

with the recombinant viruses p.i. 60 h, the BmN cells 

were collected and lysed. The lysate with 100 µg total 

protein was used for γ-Glutamyltranspeptidase activity 

assay. Qualitative detection of the GGT enzyme was 

achieved by a Clinic Biochemistry detector (Olympus 

AU2700), the tests were repeated 3 times. 

Western-blot. To comfirm the protein expression, 

the products of fusing gene (the HpGT fragment with 

eGFP) were detected by Western-blot. The first antibody 

was of anti-eGFP with a dilution of 1:1000. 

Analysis of mitochondrial membrane potential. 

After infected with the baculoviruses containing the 

HpGT fragment, respectively, mitochondrial membrane 

potential of the BmN cells was observed by fluorescence 

microscopy with JC-1 staining. The staining process 

was carried out by the protocol of the JC-1 Mitochondrial 

Membrane Potential detection Kit (Biotium, Inc., 

Cat: 30001). In brief, the living cells were stained red, 

and when the cells were going to die of apoptosis, the 

cells were stained green (Bowser et al., 1998). 

MTT assay. The MTT assay was performed using 

the cell proliferation kit I MTT (Roche Co.) according 

to the manufacturer’s protocol. In brief, after diverse 

treatments for 24 h, the gastric cancer cells (BGC-823) 

were subsequently prepared for assays. The absorbance 

was determined at 570 nm by an ELISA reader 

(Bio-tech Synergy HT). Each approach was replicated 

6 times and repeated 3 times with similar results. 

Results and discussion 

Identification and harvest of the recombinant 

bacmids. The HpGT fragments were amplified from 

Hp genomic dNA by PCR, and digested with EcoR I

3 Function of H. pylori ggt domains 

205 

and Xho I to be inserted into the baculovirus transfer 

vector digested with the same enzymes. After the plasmids 

were transferred into the Bm-dH10 bacteria, the 

bacmid dNAs were extracted, respectively. To confirm 

the fragment inserts, PCR was used to amplify the fragments. 

The results indicated that the HpGT fragments 

were inserted into the viral genome. 

To construct the fusing fragments with eGFP, the 

eGFP fragments were amplified and were digested with 

Xho I and Hind III, and then ligated to the recombinant 

vectors containing the HpGT fragment. 

A 

B 

Fig. 2a and 2b. detection of expression products of the fusing fragment 

of ggt and gfp in baculovirus by Western-blot. 

The lysates of BmN cells and of cells infected with wild baculovirus 

(BmNPV) were the negative controls. In Figure 2a, the products of the 

full length ggt fusing with eGFP gene were detected, and in Figure 2b, the 

products of the fragments of ggt fusing with eGFP gene were detected. 

Fig. 1. Observation of HpGT products fusing 

with eGFP under fluorescent microscope 

(200-fold). 

The GGT-d380a-eGFP products had different 

location in BmN cells. Bm-eGFP recombinant 

baculovirus, with egfp gene instead of the polyhedron 

gene, was a control. 

The recombinant bacmid dNAs were transfected 

into BmN cells to generate budded viruses. After 72 h 

infection, the symptoms of viral infection were observed 

using an inverted phase microscope and the medium 

was collected as viral stock. Green fluorescence was 

observed in the infected cells when the HpGT fragments 

fusing eGFP were expressed (Fig. 1). 

Confirmation of fusing expression. At of yet, the 

HpGT antibody has not been raised. Expression of 

the HpGT fragments was tested by tagging with eGFP 

gene. Using eGFP antibody, expression was confirmed 

by Western blot (Fig. 2a and 2b). After that, the location 

of the HpGT fragments in the cells was observed under 

an inverted fluorescent microscope. Interestingly, the 

fragments that lost N-terminal 380aa were concentrated 

in the cytoplasm (Fig. 1). 

GGT activity assay. The test of GGT activity assay 

showed that all the fragments used in this paper had 

GGT activity, even after deleting the N-terminal 380aa 

Fig. 3. GGT activity detection of the expression products 

of the fusing fragment of the ggt in baculovirus. 

The Bm-GFP virus was a negative control.

206 

(Fig. 3). The result indicated that the enzyme activity 

center was located in the C-terminal of the protein and 

the N-terminal of HpGT might have other functions. 

Mitochondrial membrane potential assay. To know 

the effect of the HpGT products on the cell cycle, the 

mitochondrial membrane potential of the infected 

BmN cells was compared. The results demonstrated that 

infection of HpGT fragments with full length, deleting 

30aa and 80aa changed the mitochondrial membrane 

potential significantly, but the wild type virus and the 

HpGT fragment with deletion of 380aa did not change 

Fig. 5. Growth inhibition assay of BGC-823 cells (from gastric cancer) 

induced with the GGT expression products using MTT method. 

Only the products of the full length GGT and that fusing with GFP affected 

cell activity at 24 hours time point.Table I. The primers for amplification 

of HpGT fragments 

Mei Kong et al. 3 

Fig. 4. detection of the membrane voltage 

change of the BmN cells post infection 

48 hours by dyeing with the reagent of 5, 

5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethyl 

benzimidazol carbocyanine iodide (JC-1). 

it apparently. This evidence denotes that the N-terminal 

domain is related to cell function (Fig. 4). This is the 

first report using JC-1 staining to detect cell changes 

in insect BmN cells. 

Effect of tumor cell growth. To check the impact 

of the HpGT products on cell survival, stomach cancer 

cells (BGC-823) were treated with the expression 

compound. Analysis of cell viability by MTT assay indicated 

that the cell growth was inhibited significantly 

by HpGT full length products at 24 h. However, when 

the incubation time lasted 48 h, cell growth showed 

recovery. These results indicate that only the full length 

HpGT might have the activity to inhibit cell growth 

(Fig. 5). Furthermore, the effect might be reversible. 

In this paper, we identified the HpGT activity and 

effect on cell growth using baculovirus expression system. 

Although the C-terminal domain of the HpGT has GGT 

activity, only the full length ORF affected cell growth. 

This indicates that the products of the full length ORF 

may have an important role in gastric carcinogenesis. 

Acknowledgements 

This work was funded by the Science and Technology development 

Foundation of Jiangsu University medicine and clinic 

(JLY2010106). 

Literature 

Bjorkholm B., P. Falk, L. Engstrand and O. Nyren. 2003. Helico bacter 

pylori: resurrection of the cancer link. J. Intern. Med. 253: 102–119. 

Boanca G., A. Sand, T. Okada, H. Suzuki, H. Kumagai, K. Fukuyama 

and J.J. Barycki. 2007. Autoprocessing of Helicobacter pylori

3 Function of H. pylori ggt domains 

207 

γ-Glutamyltranspeptidase Leads to the Formation of a Threonine- 

Threonine Catalytic dyad. J. Biol. Chem. 282: 534–541. 

Bowser D.N., T. Minamikawa, P. Nagley and D.A. Williams. 1998. 

Role of mitochondria in calcium regulation of spontaneously contracting 

cardiac muscle cells. Biophys. J. 75: 2004–2014. 

Brannigan J.A., G. Dodson, H.J. Duggleby, P.C. Moody, J.L. Smith, 

D.R. Tomchick and A.G. Murzin. 1995. A protein catalytic framework 

with an N-terminal nucleophile is capable of self-activation. 

Nature 378, 416–419. 

Chevalier C., J.M. Thiberge, R.L. Ferrero and A. Labigne. 1999. 

Essential role of Helicobacter pylori gamma-glutamyltranspeptidase 

for the colonization of the gastric mucosa of mice. Mol. Microbiol. 

31: 1359–1372. 

Coloma J. and H.C., Pitot. 1986. Characterization and sequence 

of cdNA clone of gamma-glutamyltranspeptidase. Nucleic. Acids. 

Res. 14: 1393–1403. 

Hanigan M.H. and W.A. Ricketts. 1993. Extracellular glutathione 

is a source of cysteine for cells that express gamma-glutamyl transpeptidase. 

Biochemistry 32: 6302–6306. 

Ikeda Y., J. Fujii and N. Taniguchi. 1996. Effects of substitutions 

of the conserved histidine residues in human γ-glutamyl transpeptidase. 

J. Biochem. 119: 1166–1170. 

Ikeda Y., J. Fujii, M.E. Anderson, N. Taniguchi and A. Meister. 

1995. Involvement of Ser-451 and Ser-452 in the catalysis of 

human gamma-glutamyl transpeptidase. J. Biol. Chem. 270: 22223– 

–22228. 

Ikeda Y. and N. Taniguchi. 2005. Gene expression of gamma-glutamyltranspeptidase. 

Methods. Enzymol. 401: 408–425. 

Marshall B.J. and J.R. Warren. 1984. Unidentified curved bacilli in 

the stomach of patients with gastritis and peptic ulceration. Lancet 

1: 1311–1315. 

McGovern K.J., T.G. Blanchard, J.A. Gutierrez, S.J. Czinn, 

S. Krakowka and P. Youngman. 2001. Gamma-glutamyltransferase 

is a Helicobacter pylori virulence factor but is not essential for colonization. 

Infect. Immun. 69: 4168–4173. 

Sharma P. and N. Vakil. 2003. Review article: Helicobacter pylori 

and reflux disease. Aliment. Pharmacol. Ther. 17: 297–305. 

Shibayama K., K. Kamachi, N. Nagata, T. Yagi, T. Nada, Y. Doi, 

N. Shibata, K. Yokoyama, K. Yamane, H. Kato, Y. Iinuma and 

Y. Arakawa. 2003. A novel apoptosis-inducing protein from Helicobacter 

pylori. Mol. Microbiol. 47: 443–451. 

Su W., W. Shen, B. Li, Y. Wu, G. Gao and W. Wang. 2009. A novel 

way to purify recombinant baculoviruses by using bacmid. Bioscience 

report 29: 71–75




Extracellular Xylanase Production by Fusarium species in Solid State Fermentation 

MOHAMMEd IMAd EddIN ARABI, YASSER BAKRI* and MOHAMMEd JAWHAR 

department of Molecular Biology and Biotechnology, damascus, Syria 

Received 4 May 2011, revised 11 July 2011, accepted 15 July 2011 

Introduction 

To date xylanase has gained increasing attention 

because of its various biotechnological applications. 

Endo-β-1, 4-xylanase plays important roles in animal 

feed, increasing the body weight gains of animals 

(Medel, et al., 2002). In pulp and paper industry, 

xylanases are employed in the prebleaching process 

to reduce the use of toxic chlorine chemicals (Wong 

et al., 2002). In bread and bakery industry, xylanases 

are used to increase dough viscosity, bread volume, and 

shelf life (Romanowska et al., 2003). Other potential 

applications include the conversion of xylan in wastes 

from agriculture and food industries into xylose, and 

the production of fuel and chemical feedstocks (Sunna 

and Antranikian, 1997). xylanolytic enzymes are produced 

by a wide variety of microorganisms, among 

which the filamentous fungi are especially interesting 

as they secrete these enzymes into the medium and 

their xylanase activities are much higher than those 

found in yeast and bacteria (Haltrich et al., 1996; Khan 

et al., 2003; Guimaraes et al., 2006). However, to reach 

commercial feasibility, enzyme production must be 

increased by introducing a more potent strain and by 

optimizing culture conditions. 

Fusarium is a large genus of filamentous fungi, and 

most Fusarium species are harmless saprobes and relatively 

abundant members of the soil microbial community 

(domsch et al., 1980; Nwanma et al., 1993). This 

ecological habitat of the fungus implies that Fusarium 

would be a useful resource of extracellular enzymes. 

Abstract 

Fusarium sp. has been shown to be a promising organism for enhanced production of xylanases. In the present study, xylanase production 

by 21 Fusarium sp. isolates (8 Fusarium culmorum, 4 Fusarium solani, 6 Fusarium verticillioides and 3 Fusarium equiseti) was evaluated 

under solid state fermentation (SSF). The fungal isolate Fusarium solani SYRN7 was the best xylanase producer among the tested isolates. 

The effects of some agriculture wastes (like wheat straw, wheat bran, beet pulp and cotton seed cake) and incubation period on xylanase 

production by F. solani were optimized. High xylanase production (1465.8 U/g) was observed in wheat bran after 96 h of incubation. 

Optimum pH and temperature for xylanase activity were found to be 5 and 50°C, respectively. 

K e y w o r d s: Fusarium sp., solid-state fermentation, xylanase 

However, information on the ability of xylanase production 

in Fusarium spp. is rarely reported. 

Among the processes used for xylanase production, 

solid state fermentation (SSF) is an attractive one 

because its presents many advantages, especially for 

fungal cultivations (Weiland, 1988; Bakri et al., 2003; 

Arabi et al., 2001). 

In SSF, the productivity per reactor volume is much 

higher compared to that of submerged culture (Haltrich 

et al., 1996). Also, the operation cost is lower, because 

simple plant, machinery and energy are required 

(Poorna and Prema 2007). Many SSF processes for 

enzyme production, including xylanase, are described 

in the literature (Pandey, 1994). 

The objectives of the present study were (i) to investigate, 

on artificial growth media, the xylanase production 

by Fusarium sp. Isolates collected from different 

regions of Syria, and (ii) study the effects of some agricultural 

wastes on xylanase production by the promising 

F. solani SYRN7 isolate under SSF. 

Experimental 


Fungal isolates. Over several years, more than 105 

isolates of Fusarium spp. were obtained from wheat 

seeds showing disease symptoms in different locations 

of Syria. Seeds were sterilized in 5% sodium hypochlorite 

(NaOCl) for 5 min. After three washings with sterile 

* Corresponding author: Y. Bakri, department of Molecular Biology and Biotechnology, AECS, P.O. Box 6091, damascus, Syria; 

e-mail: ascientific@aec.org.sy

210 

distilled water, the seeds were transferred onto Petri 

dishes containing potato dextrose agar (PdA, dIFCO, 

detroit, MI. USA) with 13 mg/l kanamycin sulphate 

added after autoclaving and incubated for 10 days, 

at 23 ± 1°C in the dark to allow mycelial growth and 

sporulation. All isolates were identified morphologically 

according to Nelson et al. (1983). In previous studies, 

different wheat genotypes had been inoculated with 

105 fungal isolates, evaluating host-pathogen reactions 

using the method described by Kiprop et al. (2002). 

Emphasis was placed on selecting isolates that induced 

differential reactions on specific genotypes (Alazem, 

2007), leading to selection of the 21 monosporic isolates 

(eight belonging to F. culmorum, four to F. solani, 

six to F. verticillioides and three to F. equiseti) used in 

this study. The Fusarium isolates, their host plants, and 

geographic origin are listed in Table I. The cultures were 

maintained on silica gel at 4°C until needed. 

Xylanase production medium. Enzyme production 

by the selected isolates was carried out in 250 ml Erlenmeyer 

flasks containing 5 g of solid substrate and nutrients 

(based on 100 ml of liquid medium) plus distilled 

water to adjust the moisture content to 75%. The fermentation 

medium consisted of: (g/L) Na 2 HPO 4 × 2H 2 O 10; 

KCl 0.5; MgSO 4 × 7H 2 O 0.15, and Yeast extract 5, as 

a nitrogen source. The influences of different lignocellulosic 

materials (wheat bran, beet pulp and cotton seed 

cake) on xylanase production were tested. Fresh fungal 

spores have been used as inoculums and 1 mL spore 

suspension (containing around 10 6 spores/mL) was 

added to sterilized medium and incubated at 30°C. The 

flasks were removed after cultivation and the enzyme 

was extracted by adding distilled water containing 0.1% 

Triton × 100 to make the volume in a flask 100 mL. The 

flasks’ contents were stirred for 1.5 hours on a magnetic 

stirrer. The clear supernatant was obtained by centrifugation 

(5000 × g for 15 min) followed by filtration 

(Whatman no 1 paper). 

Enzyme assay. xylanase activity was assayed by the 

optimized method described by Bailey et al. (1992), 

using 1% birchwood xylan as substrate. The solution 

of xylan and the enzyme at appropriate dilution were 

incubated at 55°C for 5 minutes and the reducing sugars 

were determined by the dinitrosalicylic acid procedure 

(Miller, 1959), with xylose as standard. The 

released xylose was measured spectrophotometrically 

at 540 nm. One unit (U) of enzyme activity is defined as 

the amount of enzyme releasing 1 µmol xylose/ml per 

minute under the described assay conditions. 

Effect of temperature and pH on enzyme activity. 

To determine temperature activity profile for xylanase 

enzyme, assay was carried out at several temperatures 

40, 45, 50, 55, 60, 65, 70, and 75°C at pH 5. The optimum 

pH was determined by measuring the activity 

at 50°C using the following buffers: 0.1M Citrate- 

Arabi M.I.E. et al. 3 

Table I 

Fusarium isolates, host, location and extracellular xylanse production 

in solid state fermentation after 5 days of incubation at 30°C 

Isolate Host Location 

F. culmorum 

Year of 

collection 

xylanase 

(U/g) 

SY1 wheat seeds north-west 2005 20.3 

2 wheat seeds north-west 2005 96.36 






14 wheat seeds middle region 

F. verticillioides 

2003 19.52 




17 wheat seeds middle region 2005 16.56 



21 wheat seeds middle region 

F. solani 

2003 102.3 

SY7 wheat root middle region 2003 908.2 


11 wheat root north-west 2005 112.16 

20 wheat root north-west 

F. equiseti 

2004 234.96 




LSd 5% 

LSd: Least Significant difference at P < 0.05 

phosphate (pH 4.0–6.0); 0.1 M potassium-phosphate 

(pH 7.0–8.0) and 0.1M Tris-HCl (pH 9.0). 

Statistical analysis. The experiments were repeated 

twice. Results were subjected to an analysis of variance 

(Anon., 1996) using the super ANOVA computer package 

to test for differences in xylanase production among 

isolates. 


Table I shows that all the Fusarium species were 

capable of producing xylanase activity but to varying 

degrees (Table I). Significant differences (P < 0.05) in 

the mean yield values were detected among isolates, 

with high values being consistently higher in the isolates 

F. solani SYRN7 and SYRN20 with mean value 

908.2 U/g and 234.69 U/g, respectively. Low enzyme 

activities of 12.16 and 16.56 U/g were detected for 

F. culmo rum SYRN4 and F. verticillioides SYRN17,

3 xylanase production by Fusarium sp. 

211 

Fig. 1. The effect of lignocellulosic materials (wheat straw, wheat 

bran, beet pulp, and cotton seed cake) on xylanase production by 

Fusarium solani F7. 

respectively (Table I). From this group, F.solani SYRN7 

isolate was selected for further studies. This isolate was 

isolated from infected wheat seeds showing disease 

symptoms, and screened among 105 isolates as the best 

xylanase producer in SSF culture. The isolate was grown 

on PdA medium and identified as described above. 

Since the cost of the substrate plays a crucial role 

in the economics of xylanase production process, 

the expensive substrate (pure xylan) is not suited for 

larger-scale production processes due to its high cost. 

Insoluble lignocellulosic materials offer a cost effective 

substrate for xylanaase production (Bakri et al., 2003; Li 

et al., 2007). To select a suitable carbon source and incubation 

time for xylanase production, Fusarium solani 

SYRN7 was cultivated in a basal medium containing 

some lignocellulosic materials wheat straw, wheat bran, 

beet pulp and cotton seed cake as carbon sources during 

6 days. We observed that maximum enzyme activity 

(1465 U/g) was obtained by using wheat bran after 

4 days of incubation (Fig. 1). This indicated that the 

choice of an appropriate substrate is of great importance 

for the successful xylanase production. The substrate 

not only serves as a carbon and energy source, but 

also provides the necessary inducing compounds for 

the organism. Wheat bran proved to be the best carbon 

source followed by cotton seed cake. In some fungi, 

high xylanase production has been shown to be linked 

strictly to the ratio of cellulose to xylan of the growth 

substrate and substrate degradation due to time course 

or incubation period (Haltrich et al., 1996; Chirstakopoullos 

et al., 1999; Kang et al., 2004). 

Enzyme activity is markedly affected by pH. This 

is because substrate binding and catalysis are often 

dependent on charge distribution on both substrate 

and, in particular, enzyme molecules (Kulkarni et al., 

1999). A pH range from 4 to 10 was used to study the 

effect of pH on xylanase activity and the results are 

given in Fig. 2. The favorable pH range for xylanase 

activity of Fusarium solani SYRN7 was between 5.0 

and 6.0, with optimum pH at 5.0. A significant drop 

in enzyme activity was observed below pH 5.0 and 

above pH 6.0. A sharp decrease of xylanase activity was 

observed between pH 5.0 (100%) and pH 8.0 (47.16%). 

The enzyme behaviour clearly indicates that it is more 

suitable for any application in the pH range of 5.0–6.0. 

Similar results were observed for other microorganisms. 

Aspergillus sp. (Khanna et al., 1995), A.oryzae 

(Kitamoto et al., 1999), Fusarium verticillioides (Saha, 

2003), Penicillium citrinum (Tanaka et al., 2005) and 

Penicillium sp. AH-30 (Li et al., 2007), presented xylanase 

with maximum activities at similar pH. 

The effect of temperature on the xylanase activity 

from Fusarium solani SYRN7 is shown in Fig. 3. The 

Fig. 2. Optimum pH activity of xylanase produced by Fusarium 

solani F7 grown on wheat bran under solid state culture. 

Relative activity was determined at 55°C. 

Fig. 3. Optimal temperature of xylanase produced by Fusarium 

solani F7 in solid state culture. 

Relative activity was determined at pH 5.

212 

optimum temperature was 50°C. When the temperature 

reached 60°C, relative xylanase activity retained 

was about 64.75% under the assay conditions used. 

The optimum temperature for xylanases from fungal 

sources has been found to be similar or slightly higher. 

Penicillium citrinum (Tanaka et al., 2005), Penicillium 

sp. AH-30 (Li et al., 2007), Aspergillus sydowii SBS 45 

(Nair et al., 2008) and Aspergillus niveus RS2 (Sudan 

and Bajaj, 2007) presented xylanase with maximum 

activities at 50°C. Penicillium purpurogenum (Belancic 

et al., 1995), Aspergillus orysae (Kitamoto et al., 1999) 

and Aspergillus niger (Coral et al., 2002) presented xylanase 

with maximum activities at 60°C. 

The present study demonstrated that significant 

improvement of xylanase production by F. solani SYRN7 

isolate could be obtained by selective use of nutrients 

and growth conditions. Since xylan is an expensive substrate 

for commercial scale xylanase production, the 

possibility of using wheat bran for xylanase production 

was investigated. Wheat bran (5% by mass per volume) 

could be used as a less expensive substrate for efficient 

xylanase production (1465.8 U/g). This observation is 

interesting due to the low cost of this carbon source. 

The F. solani SYRN7 isolate proved to be a promising 

microorganism for xylanase production. 

Acknowledgements 

The authors thank the director General of AECS and the Head 

of the Molecular Biology and Biotechnology department for their 

continuous support throughout this work. Thanks also extended to 

dr. A. Aldaoude for critical reading of the manuscript. 

Literature 

Alazem M. 2007. Characterization of Syrian Fusarium species by 

cultural characteristics and aggressiveness. Thesis, University of 

damascus, Faculty of Agriculture. pp. 72. 

Anon. 1996. Statview 4.5. USA: Abacus Concepts Corporation. 

Arabi M.I.E., M. Jawhar and Y. Bakri. 2001. Effect of additional 

carbon sources and moisture level on xylanase production by 

Cochliobolus sativus in solid fermentation. Microbiology 80: 1–4. 

Bailey M.J., P. Baily and R. Poutanen. 1992. Interlaboratory testing 

of methods for assay of xylanase activity. J. Biotechnol. 23: 257–270. 

Bakri Y., P. Jacques and P. Thonart. 2003. xylanase production 

by Penicillium canescens 10–10c in solid-state fermentation. Appl. 

Biochem. Biotech. 108: 737–748. 

Belancic A., J. Scarpa, A. Peirano, R. Diaz, J. Steiner and 

J. Eyzaguirre. 1995. Penicillium purpurogenum produces several 

xylanase: Purification and properties of two of the enzymes. J. Biotechnol. 

41: 71–79. 

Chirstakopoullos P., D. Mamma, W. Nerinckxw, D. Kekos and 

B. Macris. 1999. Production and partial characterization of xylanase 

from Fusarium oxysporum. Bioresour. Technol. 58: 115–119. 

Coral G., B. Arikan, M.N. Ünaldi and H. Korkmaz-Güvenmez. 

2002. Some properties of thermostable xylanase from an Aspergillus 

niger strain. Ann. Microbiol. 52: 299–306. 

Domsch K.H., W. Gams and T. H. Anderson. 1980. Compendium 

of soil fungi. Academic Press, London. 

Guimaraes L.H.S., P.S. Nogueira, M. Michelin, A.C.S. Rizzatti, 

V.C. Sandrim, F.F. Zanoela, A.C.M.M. Aquino, A.B. Junior and 

M.L.T.M. Polizeli. 2006. Screening of filamentous fungi for produc- 

Arabi M.I.E. et al. 3 

tion of enzymes of biotechnological interest. Brazil. J. Microbiol. 

37: 474–480. 

Haltrich D., B. Nidetzky, K.D. Kulbe, W. Steiner and S. Zupaneie. 

1996. Production of fungal xylanases. Biores. Technol. 58: 137–161. 

Kang S.W., Y.S. Park, J.S. Lee, S.I. Hong and S.W. Kim. 2004. Production 

of cellulose and hemicellulases by Aspergillus niger KK2 

from lignocellulosic biomass. Bioresour. Technol. 91: 153–156. 

Kiprop E. K., J.P. Baudoin, A.W. Mwangómbe, P.M. Kimani, 

G. Mergeai and A. Maquet. 2002. Characterization of Kenyan 

isolates of Fusarium udum from Pigeonpea [Cajanus cajan (L.) 

Millsp.] by cultural characteristics, aggressiveness and AFLP analysis. 

J. Phyto pathol. 150: 517–527. 

Kitamoto N., S. Yoshino, K. Ohmiya and N. Tsukagoshi. 1999. 

Purification and characterization of overexpressed Aspergillus 

oryzae xylanase xynF1. Biosc. Biotechnol. Biochem. 63: 1791–1794. 

Khan A., I. Ul-Haq, W.A. Butt and Ali S. 2003. Isolation and 

screening of Aspergillus isolates for xylanase biosynthesis. Biotech. 

2: 185–190. 

Khanna P., S.S. Sundari and N.J Kumar. 1995. Production, isolation 

and partial purification of xylanase from an Aspergillus sp. 

World J. Microbiol. Biotechnol. 11: 242–243. 

Kulkarni N., A. Shendye and M. Rao. 1999. Molecular and biotechnological 

aspects of xylanases. FEMS Microbiol. Rev. 23: 411–456. 

Li Y., Z. Liu, F. Cui and Y.X.H. Zhao. 2007. Production of xylanase 

from a newly isolated Penicillium sp. ZH-30. World J. Microbiol. 

Biotechnol. 23; 837–843. 

Medel, P., F. Baucells, M.I. Gracia, C. Blas and G.G. Mateos. 2002. 

Processing of barley and enzyme supplementation in diets for young 

pigs. Animal Feed Sci. Technol. 95: 113–122. 

Miller G.L. 1959. Use of dinitrosalicylic acid reagent for determination 

of reducing sugars. Ann. Chem. 31: 426–428. 

Nair S.G., R. Sindhu and S. Shashidhar. 2008. Purification and biochemical 

characterization of two xylanases from Aspergillus sydowii 

SBS 45. Appl. Biochem. Biotechnol. 149: 229–243. 

Nelson P.E., T.A. Toussoun and W.F.O. Marasas. 1983. Fusarium 

Species: An Illustrated Manual for Identification. The Pennsylvania 

State Univ. Press, University Park. 

Nwanma B., N. Onyike and P. E. Nelson. 1993. The distribution of 

Fusarium species in soils planted to millet and sorghum in Lesotho, 

Nigeria and Zimbabwe. Mycopathologia 121: 105–114. 

Pandey A. 1994. Solid state fermentation: an overview, In: Solid 

state fermentation. Ashok Pandey, Wiley Eastern, New deli. 

Poorna C.A. and P. Prema. 2007. Production of cellulose-free 

endoxylanase from novel alkalophilic thermotolerent Bacillus pumilus 

by solid-state fermentation and its application in waste paper 

recycling. Bioresour Technol. 98: 485–490. 

Romanowska A., K.P. Janowska and S. Bielecki. 2003. The application 

of fungal endoxylanase in bread-making. Commun. Agric. Appl. 

Biol. Sci. 68: 317–320. 

Saha B.C. 2003. Hemicellulose bioconversion. J. Ind. Microbiol. 

Biotechnol. 30: 279–291. 

Sudan R. and B.K. Bajaj. 2007. Production and biochemical characterization 

of xylanase from an alkalitolerant novel species Aspergillus 

niveus RS2. World J. Microbiol. Biotechnol. 23: 491–500. 

Sunna A. and G. Antranikian. 1997. xylanolytic enzymes from 

fungi and bacteria. Crit. Rev. Biotechnol. 17: 39–67. 

Tanaka H., N. Toshihide., H. Sachio and O. Kazuyoshi. 2005. Purification 

and properties of an extracellular endo-1,4-β-xylanase from 

Penicillium citrinum and characterization of the encoding gene. 

Journal of Bioscience and Bioengineering. 100: 623–630. 

Weiland P. 1988. Principles of solid state fermentation. In: F. Zadrazil, 

P. Reiniger (Eds), Treatment of lignocellulosics with white rot fungi, 

Elsevier, London, pp. 64–76. 

Wong K.K.Y., C.S. James and S.H. Campion. 2002. xylanase pre 

and post-treatments of bleached pulps decrease absorption coefficient. 

J. Pulp pap. Sci. 26: 377–383.




Screening of Actinomycetes from Mangrove Ecosystem for L-asparaginase Activity 

and Optimization by Response Surface Methodology 

RAJAMANICKAM USHA*, KRISHNASWAMI KANJANA MALA, CHIDAMBARAM KULANDAISAMY VENIL 

and MUTHUSAMY PALANISWAMY 

Department of Microbiology, School of Life Science, Karpagam University, Tamil Nadu, India 

Received 2 September 2010, revised 12 May 2011, accepted 15 May 2011 

Introduction 

Mangrove ecosystems are rich in bacterial flora. Fertility 

of the mangrove water results from the microbial 

decomposition of organic matter and recycling 

of nutrients. Among the microbes, the bacterial population 

in mangrove is many folds greater than the 

fungi. The bacteria performed various activities in 

the mangrove ecosystems like photosynthesis, nitro- 

gen fixation, methanogenesis, production of antibio - 

tics and enzymes (arysulphatase, L-glutamine, chitinase, 

L-asparaginase, cellulase, protease, phosphatase) 

etc. (Sahoo et al., 2008). 

The enzyme L-asparaginase (L-asparagine aminohydrolase 

E.C.3.5.1.1) has been intensively investigated 

over the past two decades owing to its importance as 

anti neoplastic agent. Although the enzyme has been 

found in a variety of bacteria, fungi, actinomycetes 

and also in mammals, few of the purified preparations 

have shown to possess antitumor activity (Paul, 1983). 

Like bacteria, actinomycetes are also good source for 

the production of L-asparaginase (Dhevendran et al., 

1999; Savitri et al., 2003). 

Abstract 

Marine actinomycetes were isolated from sediment samples collected from Pitchavaram mangrove ecosystem situated along the southeast 

coast of India. Maximum actinomycete population was noted in rhizosphere region. About 38% of the isolates produced L-asparaginase. 

One potential strain KUA106 produced higher level of enzyme using tryptone glucose yeast extract medium. Based on the studied 

phenotypic characteristics, strain KUA106 was identified as Streptomyces parvulus KUA106. The optimization method that combines the 

Plackett-Burman design, a factorial design and the response surface method, which were used to optimize the medium for the production 

of L-asparaginase by Streptomycetes parvulus. Four medium factors were screened from eleven medium factors by Plackett-Burman design 

experiments and subsequent optimization process to find out the optimum values of the selected parameters using central composite design 

was performed. Asparagine, tryptone, d))extrose and NaCl components were found to be the best medium for the L-asparaginase production. 

The combined optimization method described here is the effective method for screening medium factors as well as determining their 

optimum level for the production of L-asparaginase by Streptomycetes parvulus KUAP106. 

K e y w o r d s: Streptomyces parvulus KUAP106, L-asparaginase, mangrove ecosystem, optimization by RSM 

In the last decade, statistical experimental methods 

such as Plackett-Burman and Response surface methodology 

(RSM) have been applied to optimize media for 

industrial purposes. RSM is a collection of statistical 

techniques for designing experiments, building models, 

evaluating the effects of various factors and searching 

for the optimum conditions. RSM has been successfully 

used in the optimization of bioprocesses (Majumdar 

et al., 2008). No defined medium has been established 

for the optimum production of L-asparaginase from 

different microbial sources. Each organism has its own 

special conditions for maximum enzyme production. 

A statistical approach has been employed in which 

a Plackett-Burman design is used for identification significant 

variables influencing L-asparaginase production 

by Serratia marcescens SB 08 (Venil et al., 2009). 

Thereby, in this investigation L-asparaginase producing 

strain KUA106 was isolated from the pichavaram 

mangrove ecosystem and characterized to belong 

to Streptomyces parvulus (Shirling and Gottlieb, 1966) 

by morphology and biochemical characters. The levels 

of the significant variables were further optimized for 

L-asparaginase using response surface methodology. 

* Corresponding author: R. Usha, 113II nd D, Tatabad, Sivanandha colony, Coimbatore12; phone: 9865068286; fax: 0422-2611043; 

e-mail: ushaanbu2007@rediffmail.com

214 

Experimental 


Sample collection. Sediment samples were collected 

from different stations of the pichavaram mangrove 

ecosystem (Lat, 11°27’ N; Long. 79°47’ E), situated along 

the southeast coast of India. Sediment samples were 

collected from rhizosphere areas of mangrove plants. 

The central portion of the 5–15 cm sediment sample 

was taken. This sample was then transferred to a sterile 

bag and transported immediately to the laboratory. 

Isolation of mangrove actinomycetes. The samples 

thus collected were air dried aseptically. After a week, 

sediment samples were incubated at 55°C for five minutes 

in order to facilitate the isolation of Actinomycetes. 

Then tenfold serial dilution was prepared with one 

gram of sediment sample using filtered and sterilized 

50% seawater. Samples were inoculated on the starch 

casein agar plates in triplicate petriplates. Nalidixic acid 

(20 µg/ml) and cycloheximide (50 µg/ml) were added 

to the medium in order to retard the growth of bacteria 

and fungi, respectively. All the plates were incubated 

at 28 ± 2°C, and observed from 5 th day onwards for 

25 days. Colonies with suspected Actinomycetes morphology 

were purified using yeast extract-malt extract 

agar medium. The pure cultures of the Actinomycetes 

were maintained as slant culture on ISP2 agar as well 

as in glycerol broth at 4°C. 

Screening of mangrove isolates for L-asparaginase 

production by rapid-plate assay. The isolates were 

screened for asparaginase activity using the method of 

rapid plate assay (Gulati et al., 1997). The medium used 

was modified M-9 media with pH indicator (phenol 

red). L-asparaginase activity was identified by formation 

of a pink zone around colonies. Two control plates 

were also prepared using modified M-9 media – one 

was without dye while the other was without asparagine. 

All plates were incubated at 30°C. Pink zone 

radius and colony diameter were measured from positive 

isolates after 48 hrs. 

Identification of the selected L-asparaginase positive 

Actinomycetes. The large pink zone formed isolate 

was taken for further characterization. The microscopic 

characterization was done by cover slip culture method 

(Kawato and Sinobu, 1979). The mycelium structure, 

color and arrangement of conidiospore and arthrospore 

on the mycelium were observed through the oil immersion 

(1000X). The observed structure was compared 

with Bergey’s manual of determinative bacteriology, 

ninth edition (2000). Various biochemical tests were 

performed for the identification of the potent isolate. 

Hydrogen sulphide production, citrate utilization, 

coagulation of milk (Cowan, 1974), catalase test (Jones, 

Usha R. et al. 3 

1949), melanin pigment (Pridham, 1957), nitrate reduction 

(Gordon, 1966). The utilization of different carbon 

and nitrogen sources (Pridham, 1948). Cell wall was 

performed by the method of Lechevalier (1968). The 

cultural characteristics were studied in accordance with 

the guidelines established by the International Streptomyces 

Project (Shirilling, 1966). 

Production of L-asparaginase. An amount (100 ml) 

of tryptone glucose yeast extract (TGY) broth (production 

medium, pH 7.0) comprising of glucose, 0.1 g; 

K 2 HPO 4 , 0.1 g; yeast extract, 0.5 g; tryptone, 0.5 g; water, 

to 100 ml, and contained in a 250 ml Erlenmeyer flask, 

was inoculated separately with the screened isolates and 

incubated at 28°C in a shaker-incubator oscillating at 

200 rev/min for 24 h. At the end of the fermentation 

period, the crude enzyme was prepared by centrifugation 

at 1000x g for 20 min. The cell-free supernatant was 

taken as the crude enzyme. 

Enzyme assay. L-asparaginase activity was determined 

by measuring the amount of ammonia formed 

by nesslerization (Wriston and Yellin, 1973). 0.5 ml 

sample of crude enzyme, 1.0 ml of 0.1 M sodium borate 

buffer (pH 8.5) and 0.5 ml of 0.04 M L-asparagine solution 

were mixed and incubated for 10 min at 37°C. The 

reaction was then stopped by the addition of 0.5 ml of 

15% trichloroacetic acid. The precipitated protein was 

removed by centrifugation, and the liberated ammonia 

was determined by direct nesslerization. 

Suitable blanks of substrate and enzyme-containing 

samples were included in all assays. The yellow color 

was read in a spectrophotometer (Shimadzu UV2450) 

at 500 nm. One unit (U) of L-asparaginase activity is 

that amount of enzyme, which liberates 1 μmole of 

ammonia in 1 min at 37°C. 

Screening of important nutrient components 

using Plackett-Burman design. This study was done 

by Plackett-Burman design for screening medium 

components with respect to their main effects and not 

their interaction effects (Plackett and Burman, 1946) 

on L-asparaginase production by Streptomycetes sp. The 

medium components were screened for eleven variables 

at two levels, maximum (+) and minimum (–). According 

to the Plackett-Burman design, the number of positive 

signs (+) is equal to (N+1)/2 and the number of 

negative signs (–) is equal to (N-1)/2 in a row. A column 

should contain equal number of positive and negative 

signs. The first row contains (N+1)/2 positive signs and 

(N-1)/2 negative signs and the choice of placing the 

signs is arbitrary. The next (N-1) rows are generated by 

shifting cyclically one place (N-1) times and the last row 

contains all negative signs. The experimental design and 

levels of each variable is shown in Table I. The medium 

was formulated as per the design and the flask culture 

experiments were performed. Response was calculated

3 L-asparaginase of Actinomycetes from mangrove ecosystems 

215 

Table I 

Plackett-Burman experiments design for evaluating factors influencing L-asparaginase by Streptomycetes sp. 

Run A B C D E F G H J K L 

L-asparaginase 

U/mL 

1 10 50 0 0.5 4 5 0.01 5 2 0.1 0.1 56 

2 4 50 150 1 4 1 0.01 5 0.5 0.3 0.1 36 

3 10 50 0 1 10 5 0.01 0.5 0.5 0.3 0.05 39 

4 4 50 150 0.5 10 5 0.05 0.5 0.5 0.1 0.1 66 

5 10 20 150 1 10 1 0.01 0.5 2 0.1 0.1 19 

6 4 20 0 1 4 5 0.05 0.5 2 0.3 0.1 45 

7 4 20 150 0.5 10 5 0.01 5 2 0.3 0.05 20 

8 10 20 150 1 4 5 0.05 5 0.5 0.1 0.05 23 

9 4 50 0 1 10 1 0.05 5 2 0.1 0.05 32 

10 4 20 0 0.5 4 1 0.01 0.5 0.5 0.1 0.05 25 

11 10 20 0 0.5 10 1 0.05 5 0.5 0.3 0.1 53 

12 10 50 150 0.5 4 1 0.05 0.5 2 0.3 0.05 36 

A: pH; B:Temperature (°C); C: Agitation (rpm); D: Inoculum concentration (%); E: Incubation time (days) F: Dextrose (%); G: Asparagine (%); 

H: Yeast extract (%); J: Tryptone (%); K: KH 2 PO 4 (%); L: NaCl (%) 

at the rate of enzyme production and expressed as 

U/mL. All experiments were performed in triplicate 

and the average of the rate of enzyme production was con- 

sidered as the response. The effect of each variable was calculated 

using the following equation: E = (ΣΜ + − Μ − )/Ν. 

Where E is the effect of tested variable, M + and M – are 

responses of trials at which the parameter was at its 

higher and lower levels respectively and N is the number 

of experiments carried out. The standard error 

(SE) of the variables were the square root of variance 

and the significance level (p-value) of each variables 

calculated by using Student’s t-test. t = Exi/SE, where 

Exi is the effect of tested variable. The variables with 

higher confidence levels were considered to influence 

the response or output variable. 

Optimization of concentration of the selected 

medium components using response surface methodology. 

The screened medium components affecting 

enzyme production were optimized using central composite 

design (CCD) (Box and Wilson, 1951; Box and 

Hunter, 1957). According to this design, the total number 

of treatment combinations is 2k + 2k + n0 where 

‘k’ is the number of independent variables and n0 the 

number of repetitions of the experiments at the center 

point. For statistical calculation, the variables Xi have 

been coded as xi according to the following transformation: 

xi = X i – X 0 /δX. where: X i is dimensionless coded 

value of the variable. X i , X 0 the value of the X i at the 

center point, and δX is the step change. A 2k-factorial 

design with eight axial points and six replicates at the 

center point with a total number of 30 experiments 

were employed for optimizing the medium components. 

The behavior of the system was explained by the 

2 following quadratic equation: Y = β + Σβ x + Σβ x + 

0 i i ii i 

+ Σβ x x where Y is the predicted response, β the inter- 

ij ij j. 0 

cept term, β the linear effect, β the squared effect, and 

i ii 

β is the interaction effect. The regression equation was 

ij 

optimized for maximum value to obtain the optimum 

conditions using Design Expert Version. 

Validation of the experimental model. The statistical 

model was validated with respect to L-asparaginase 

production under the conditions predicted by the 

model in shake flask conditions. Samples were withdrawn 

at the desired intervals and L-asparaginase assay 

was determined as described above. 


Isolation and screening of mangrove actinomycetes 

for L-asparaginase production by rapid-plate 

assay. Samples were examined for Actinomycetes. After 

5 th day to 25 th day, 63 colonies were found on starch 

casein agar plate. These 63 isolates were screened for 

L-asparaginase activity. Only 24 isolates showed positive 

in rapid plate assay method (Fig. 1). The plate study 

is advantageous as the method is quick and L-asparaginase 

production visualized directly from the plates. The 

studies with different concentration of the dye revealed 

that as the concentration of the dye increases, the clarity 

and visibility of the pink zone increased. 

Mangroves have very specialized adaptations that 

enable them to live different condition. It exists under 

very hostile and inhospitable conditions (Khan and 

Ali, 2007). So far no reports are available on Actinomycetes 

isolated from mangrove sediments exhibiting

216 

Fig. 1. Isolation and screening of mangrove Actinomycetes 

for L-asparaginase production. 

prominent L-asparaginase production. Hence it is suggested 

that the strain isolated from pichavaram mangrove 

environment, possessing L-asparaginase activity. 

Identification of the selected L-asparaginase positive 

Actinomycetes. The large pink zone formed isolate 

produced grey and white colonies with yellow pigmentation 

and showed fast growth within two days on yeast 

extract malt extract agar (International Streptomyces 

Project 2 medium). The morphological, physiological 

and biochemical characteristics of actinomycete isolate 

KUA 106 was summarized in Table II. The cell wall 

hydrolysate contains L-diaminopimelic acid (LL-DAP) 

and sugar pattern were not detected. 

The physiological characteristic studies revealed that 

the isolate KUA 106 did produce melanoid pigments. 

This strain hydrolysed starch, reduced nitrate and liquefied 

gelatin but it did not produce H 2 S. It utilized glucose, 

arabinose, mannose, maltose, xylose, inositol and 

starch. It could not utilize lactose, raffinose, sucrose, 

galactose and mannitol. As nitrogen sources, it utilized 

cystein, phenyl alanine, lysine, serine and hydroxy 

proline, and histidine are poorly utilized. It could not 

utilize valine. Well growth was recorded at a temperature 

range of 15 to 37°C and pH range of 6 to 9. The 

utilization of various carbohydrates by the selected 

isolate suggests a good pattern of carbon assimilation. 

Glucose, xylose and inositol sugars were well utilized. 

These results emphasized that the Actinomycetes isolate 

is related to a group of Streptomyces parvulus. 

Plackett-Burman design. The influence of eleven 

(11) factors namely pH, temperature, agitation, inoculum 

concentration, incubation time, dextrose, asparagine, 

yeast extract, tryptone, KH 2 PO 4 and NaCl in 

the production of L-asparaginase was investigated in 


Table II 

The morphological, physiological and biochemical characteristics 

of the Actinomycetes isolate KUAP 106 

Characteristic Result 

Spore mass gray 

Spore surface smooth 

Spore chain spiral 

Diffusible pigment produced 

Melanin pigment – 

Diaminopimelic acid (DAP) LL-DAP 

Hydrolysis of Protein + 

Catalase test – 

Production of melanin pigment + 

Starch hydrolysis + 

Liquefied gelatin + 

H2S Production – 

Nitrate reduction + 

Citrate utilization + 

Urea test – 

Coagulation of milk 

Utilization of: 

- 

D-Xylose + 

D-Mannose + 

D-Glucose + 

D-Galactose + 

Rhamnose + 

Raffinose + 

Mannitol – 

L-Arabinose ++ 

meso-Inositol – 

Lactose – 

Maltose ++ 

D-fructose – 

Sucrose ++ 

Starch +++ 

L-Cycteine + 

L-Valine + 

L-Histidine – 

L-Phenylalanine – 

L-Hydroxproline + 

L-Lysine + 

L-Arginine – 

L-Serine + 

L-Tyrosine 

Growth with 

+ 

Sodium azide (0.01) + 

Phenol (0.1) 

Enzyme activity 

+ 

α-amylase + 

Gelatinase, + 

Protease + 

Lecithinase – 

L-asparaginase + 

– = Negative; + = Positive; ++ = moderate growth; +++ = good growth results.


217 

Fig. 2. Pareto chart for Plackett-Burman design for 11 medium factors on L-asparaginase 

production by Streptomycetes parvulus KUA106. 

12 runs using Plackett-Burman design. Table I represents 

the Plackett-Burman design for 11 selected variables 

and the corresponding response for L-asparaginase 

production. Variations ranging from 19 to 66 U/mL 

in the production of L-asparaginase in the 12 trials were 

observed by Plackett-Burman design. 

The Pareto chart illustrates the order of significance 

of the variables affecting L-asparaginase production 

(Fig. 2). Among the variables screened, the most effective 

factors with high significance level indicated by 

Pareto chart were in the order asparagine, tryptone, 

dextrose and NaCl. 

Asparagine showed a remarkable support for the 

growth of Streptomycetes parvulus. Tryptone, dextrose 

and NaCl were also identified as most potent significant 

variables in L-asparaginase production from Streptomycetes 

parvulus and selected for further optimization 

while pH, temperature, agitation, inoculum concentration, 

incubation time, yeast extract and KH 2 PO4 

concentration which exhibited less significant level 

were omitted in further experiments. Statistical analysis 

of the Plackett-Burman design demonstrated that 

the model F value of 7.24 is significant. The values of 

p < 0.05 indicate model terms are significant (Table II). 

Regression analysis was performed on the results 

and first order polynomial equation was derived representing 

L-asparaginase production as a function of 

the independent variables. Y = 43.94G + 10.07J – 6.28F 

– 4.98L. Where Y is the response value (L-asparaginase 

production) and A, B, C and D are the coded levels of 

asparagine, tryptone, dextrose and NaCl respectively. 

The magnitude of the effects indicated the level of the 

significance of the variables on L-asparaginase production 

consequently, based on the results from the experiment, 

statistically significant variables (i.e.) asparagine, 

tryptone, dextrose and NaCl with positive effect were 

further investigated with central composite design to 

find the optimal range of these variables. 

Central composite design. Based on Plackett-Burman 

design, asparagine, tryptone, dextrose and NaCl 

were selected for further optimization using response 

surface methodology. To examine the combined effect 

of these factors, a central composite design (CCD) was 

employed within a range of –2 to +2 in relation to production 

of L-asparaginase (Table III). Run 4 showed 

maximum L-asparaginase production of 135 U/mL 

(asparagine – 0.05%, tryptone – 0.5%, dextrose – 5%, 

NaCl – 0.05%). 

The results obtained from the central composite 

design were fitted to a second order polynomial equation 

to explain the dependence of L-asparaginase production 

on the medium components. L-asparaginase = 

= 115.67 + 19.17A – 5.08B + 11.83C + 0.83D – 6.38AB + 

+ 8.13AC + 1.63AD – 8.00BC + 0.50BD – 4.25CD – 

– 19.42A 2 – 17.67B 2 – 14.54C 2 – 9.29D 2 . Where Y is the 

Table III 

Analysis of variance for L-asparaginase production 

by Streptomycetes parvulus KUA106 

Source 

Sum of 

square 

ource 

DF 

Mean 

square 

F 

– Value 

p 

– Value 

Model 2281.25 4 570.313 7.24958 0.0124 

G-Asparagine 294.03 1 294.03 3.73758 0.0945 

J-Tryptone 1216.05 1 1216.05 15.458 0.0057 

F-Dextrose 473.763 1 473.763 6.02228 0.0438 

L-NaCl 297.406 1 297.406 3.78049 0.0929 

Residual 550.679 7 78.6685 

Cor Total 2831.93 11

218 

Run 

predicted response of L-asparaginase production G, J, 

F and L are the coded values of asparagine, tryptone, 

dextrose and NaCl respectively. For the production of 

this L-asparaginase enzyme there is the need for the 

presence of carbon source, nitrogen source and also 

small amount of mineral nutrients for the remarkable 

production of the enzyme particularly on the large scale 

production. 

The analysis of variance of the quadratic regression 

model suggested that the model is very significant as 

was evident from the Fisher’s F-test (Table IV). The 

model’s goodness to fit was checked by determination 

coefficient (R 2 ). In the case, the value of R 2 (0.84) closer 

to 1 denotes better correlation between the observed 


Table IV 

Experimental plan for optimization of L-asparaginase production using central composite design 

A: Asparagine 

% 

B: Tryptone 

% 

C: Dextrose 

% 

D: NaCl 

% 

L-asparaginase U/mL 

Experimental Predicted 

1 0.03 1.25 3 0.525 55 53 

2 0.03 1.25 –1 0.525 21 22 

3 0.03 –0.25 3 0.525 37 37 

4 0.05 0.5 5 0.05 135 132 

5 0.05 2 1 0.05 38 37 

6 0.03 2.75 3 0.525 48 44 

7 0.05 0.5 5 1 121 119 

8 0.01 2 1 1 21 19 

9 0.05 2 1 1 87 89 

10 0.05 2 5 1 54 52 

11 0.01 0.5 1 0.05 34 33 

12 –0.01 1.25 3 0.525 12 10 

13 0.05 0.5 1 0.05 67 67 

14 0.07 1.25 3 0.525 59 54 

15 0.05 0.5 1 1 54 54 

16 0.03 1.25 3 –0.425 65 67 

17 0.01 0.5 5 0.05 32 31 

18 0.03 1.25 3 0.525 129 130 

19 0.03 1.25 3 0.525 124 125 

20 0.03 1.25 3 0.525 130 128 

21 0.03 1.25 3 1.475 87 86 

22 0.01 2 5 1 22 21 

23 0.03 1.25 7 0.525 89 88 

24 0.01 2 1 0.05 37 35 

25 0.01 2 5 0.05 42 40 

26 0.01 0.5 1 1 36 35 

27 0.03 1.25 3 0.525 125 121 

28 0.03 1.25 3 0.525 131 134 

29 0.05 2 5 0.05 75 74 

30 0.01 0.5 5 1 41 43 

and predicted responses. The coefficient of variation 

(CV) indicates the degree of precision with which the 

experiments are compared. The lower reliability of the 

experiment is usually indicated by high value of CV 

(4.06) denotes that the experiments performed are 

highly reliable. The p value denotes the significance 

of the coefficient and also important in understanding 

the pattern of the mutual interactions between the 

variables. 

The fitted responses for the above regression model 

were plotted in Figure 3. 3D graphs were generated for 

the pair wise combination of four factors for L-asparaginase 

production. Graphs highlight the roles played 

by various factors affecting L-asparaginase production.


219 

Fig. 3. Three dimensional response surface plot for the effect of (A) asparagine, tryptone (B) asparagine, dextrose (C) asparagine, 

NaCl (D) tryptone, dextrose (E) tryptone, NaCl (F) dextrose, NaCl. 

The experimental values were found to be very close 

to the predicted values hence, the model was successfully 

validated. The L-asparaginase production showed 

about 2.04 fold increases over the central point and 

5.50 fold increases over the basal medium. 

Validation model. The maximum experimental 

response for L-asparaginase production was 135 U/mL 

whereas the predicted value was 132 U/mL indicating 

a strong agreement between them. The scale-up study 

was carried out in jar fermentation by using medium 

under optimized conditions. The maximum production 

of 146 U/ml L-asparaginase was achieved in this scaleup 

study. The result of optimization study under flask 

conditions was 135 U/mL was observed in the scale up 

study with higher volume of fermentation. 

Conclusions. Based on screening results, it has 

been shown that mangrove sediments of pichavaram 

possess L-asparaginase producing Actinomycetes and

220 

this ecosystem exists as one of the potential source of 

L-asparaginase enzyme. Smaller and less time consuming 

experimental designs will generally suffice for 

the optimization of fermentation process. The isolated 

Streptomycetes parvulus KUAP106 can be used for 

the production of L-asparaginase enzyme. Further it 

is important to discover newer Streptomycetes sp. that 

produce enzymes that could be of industrial value. 

Acknowledgement 

The authors are grateful to Karpagam University, Coimbatore, 

Tamil Nadu, and India for providing the infrastructure facilities 

for this study. 

Literature 

Abdel-Fattah Y.R., H.M. Saeed, Y. Gohar and E.L. Baz-ma. 2005. 

Improved production of Pseudomonas aeruginosa uricase by optimization 

of process parameters through statistical experimental 

designs. Process Biochem. 40: 1707–1714. 

Aguilar G., J. Morlon-Guyot, B. Trejo-Aguilar and J.P. Guyot. 

2000. Purification and characterization of an extra cellular alpha 

amylase produced by Lactobacillus manihotivorans LMG 1801 (T), 

an amylolytic lactic acid bacterium. Enzyme Microb. Technol. 27: 

406–413. 

Box G. and J.S. Hunter. 1957. Multi-factor experimental designs for 

exploring response surfaces. Ann. Math. Stat. 28: 195–241. 

Box G. and K.B.Wilson. 1951. On the experimetal designs for 

exploring response surfaces. Ann. Math. Stat. 13: 1–45. 


Table V 

ANOVA for the experimental results of the central composite design (quadratic model) 

Source Sum of squares df Mean square F-value p-value 

Model 35586.45 14 2541.889 4.129386 0.0050 

A-Asparagine 8816.667 1 8816.667 14.32298 0.0018 

B-Tryptone 620.1667 1 620.1667 1.007482 0.3314 

C-Dextrose 3360.667 1 3360.667 5.459518 0.0337 

D-NaCl 16.66667 1 16.66667 0.027076 0.8715 

AB 650.25 1 650.25 1.056353 0.3203 

AC 1056.25 1 1056.25 1.715914 0.2099 

AD 42.25 1 42.25 0.068637 0.7969 

BC 1024 1 1024 1.663523 0.2167 

BD 4 1 4 0.006498 0.9368 

CD 289 1 289 0.46949 0.5037 

A2 10340.76 1 10340.76 16.79892 0.0009 

B2 8560.762 1 8560.762 13.90725 0.0020 

C2 5800.048 1 5800.048 9.422375 0.0078 

D2 2368.048 1 2368.048 3.846974 0.0687 

Residual 9233.417 15 615.5611 

Lack of Fit 4778.083 10 477.8083 0.536221 0.8122 

Pure Error 4455.333 5 891.0667 

Cor Total 44819.87 29 

CV = 4.06; R 2 = 0.84 

Cowan S.T. 1974. Cowan and Steel Manual for the Identification of 

Medical Bacteria 2 . Edition Cambridge, Univ. Press. 

Dhevandran K. and K. Annie. 1999. Antibiotic and L-asparaginase 

of Streptomycetes isolated from fish, shellfish, and sediments of veli 

estuarine along Kerala coast. Indian J. Mar. Sci. 28: 335–337. 

Gordon R.E. 1966. Some criteria for the recognition of Nocardia 

madura (Vincent) Blanchord. J. Gen. Microbiol. 45: 355–364. 

Gulati R., R.K. Saxena and R. Gupta. 1973. A rapid screening for 

L-asparaginase and glutaminase activities of microorganisms. J. Gen. 

Microbiol. 76: 85–99. 

Jones K. 1949. Fresh isolates of actinomycetes in which the presence 

of sporogenous aerial mycelia is a fluctuating characteristics. 

J. Bacteriol. 57: 141–145. 

Kim H.O, J.M. Lim, J.H. Joo, S.W. Kim, H.J. Hwang, J.W. Choi 

and J.W. Yun. 2005. Optimization of submerged culture condition 

for the production of mycelial biomass and exopolysaccharides by 

Agrocybe cylindracea. Bioresour. Technol. 96: 1175–1182. 

Khan A.S and M.S. Ali. 2007. Mangroves- an ecosystem in peril. 

J. Curr. Sci. 10: 419–420. 

Kawato M and R. Shinobu. 1959. A simple technique for the microscopical 

observation. Mem. Osaka Unit. Lib. Arts. Educ. B Nat. Sci. 

8: 114–119. 

Lechevalier M.P. and H.A. Lechevalier. 1968. Chemical composition 

as a criterion in the classification of aerobic actinomycetes. 

J. Sys. Bacteriol. 20: 435–443. 

Le Mense E.H., J. Corman, J.M. Van Lanen and A.F. Langlykke. 

1947. Production of mold amylases in submerged culture. Biochem. 

54: 149–159. 

Lee K.M. and D.F. Gilmore. 2005. Formulation and process modeling 

of biopolymer (polyhydroxyalkanoates: PHAs) production from 

industrial wastes by novel crossed experimental design. Process Biochem 

40: 229–246.


221 

Locci R. 1989. Streptomyces and related genera. Bergey’s manual of 

systematic bacteriology. William and Wilkins company. Baltimore 

4: 2451–2508. 

Majumdar A. and A. Goyal. 2008. Enhanced production of exo- 

cellular glucansucrase from Leuconostoc dextranicum NRRL 

B-1145 using response surface method. Bioresour. Technol. 99, 

3685–3691. 

McTigue M.A., C.T. Kelly, W.M. Fogarty and E.M. Doyle. 1994. 

Production studies on the alkaline amylases of three alkalophilic 

Bacillus sp. Biotechnology Lett. 16: 569–574. 

Nawani N.N. and B.P. Kapadnis. 2005. Optimization of chitinase 

production using statistics based experimental designs. Process Biochem. 

40: 651–660. 

Paul J.H. 1982. Isolation and characterization of a chlamydomonas 

L-asparaginase. Biochem. J. 203: 109–115. 

Plackett R.L. and J.P. Burman. 1946. The design of optimum multifactorial 

experiments. Biometrika 33: 305–325. 

Pridham T.G., P. Anderson, C. Foley, L.A. Lindenfelser, C.W. 

Hesselting and R.G. Benedict. 1957. A section of media for maintenance 

and taxonomic study of Streptomycetes. Antibiotics Ann., 

pp. 947–953. 

Pridham T.G. and D. Gottlieb. 1948. The utilization of carbon compounds 

by some actinomycetes as an aid for species determination. 

J. Bacteriol. 56: 107–114. 

Sahoo K. and N.K. Dhal. 2009. Potential microbial diversity in 

mangrove ecosystems. A review. Indian J. Marine Sci. 38: 249–256. 

Santamaria R.I., G. Del Rio, G. Saab, M.E. Rodriguez, X. Soberon 

and A. Lopez Marguia. 1999. Alcoholysis reactions from starch 

with alpha-amylases. FEBS Lett. 452: 346–350. 

Savitri A.N. and W. Azmi. 2003. Microbial L asparaginase: A potent 

antitumor enzyme. Indian. J. Biotechnol. 2: 184–194. 

Senthilkumar S.R., B. Ashokkumar, K. Raj Chandra and 

P. Gunasekaran. 2005. Optimization of medium composition for 

alkali-stable xylanase production by Aspergillus fischeri Fxn 1 in 

solid state fermentation using central composite rotary design. Bioresour 

Technol. 96: 1380–1386. 

Shirling E.B. and D. Gottlieb. 1966. Methods for characterization 

of Streptomyces species. Int. J. Syst. Bacteriol. 16: 313–340. 

Venil C.K., K. Nanthakumar, K. Karthikeyan and P. Lakshmanaperumalsamy. 

2009. Production of L-asparaginase by Serratia marcescens 

SB08: Optimization by response surface methodology. Iranian 

J. Biotechnol. 7: 10–18. 

Wang Y.X. and Z.X. Lu. 2005. Optimization of processing parameters 

for the mycelial growth and extracellular polysaccharide 

production by Boletus spp. ACCC 50328. Process Biochem. 40: 

1043–1051. 

Wriston J.C and T.O. Yellin. 1973. L-asparaginase: a review. Adv. 

Enzymol. 39: 185–248.




Chitin-Glucan Complex Production by Schizophyllum commune 

Submerged Cultivation 

DZIANIS SMIRNOU*, MARTIN KRCMAR and EVA PROCHAZKOVA 

Introduction 

Chitin-glucan complex (CGC) is general name for 

a wide variety of biological copolymers composed of 

chitin macromolecules with covalently linked β-Dglucan 

chains. The complex naturally occurs in the cellular 

walls of filamentous fungi, where it forms rigid 

microfibers that contribute cell wall mechanical strength. 

CGC can be extracted from fungal mycelium by various 

physiochemical and enzymatic methods, with the use 

of inorganic reagents, organic solvents, detergents, etc. 

(Ivshina, 2007). Traditionally CGC is recovered as an 

insoluble residue after mycelium successive treatments 

with alkali and acid. Fungal CGC is considered as an 

alternative source of chitin/chitosan (Wu et al., 2005; 

Teslenko and Woewodina, 1996) as well as a potent agent 

for application in medicine for wound-healing management 

(Teslenko and Woewodina 1996; Valentova et al., 

2009), for improvement of desquamation process and 

xerosis reduction in diabetic patients (Quatresooz et al., 

2009), for reduction of aortic fatty streak accumulation 

(Berecochea-Lopez et al., 2009), etc. 

Traditionally waste mycelium of Aspergillus niger 

from citric acid production is considered as an indus- 

CPN Ltd., Dolní Dobrouč, Czech Republic 

Received 10 March 2011, revised 5 May 2011, accepted 15 June 2011 

Abstract 

Chitin-glucan complex is a fungal origin copolymer that finds application in medicine and cosmetics. Traditionally, the mycelium of 

Micromycetes is considered as an industrial chitin-glucan complex source. Basidiomycete Schizophyllum commune submerged cultivation for 

chitin-glucan complex production was studied. In different S. commune strains chitin-glucan complex composed 15.2 ± 0.4 to 30.2 ± 0.2% 

of mycelium dry weight. Optimized conditions for chitin-glucan complex production (nutrient medium composition in g/l: sucrose 

– 35, yeast extract – 4, Na 2 HPO 4 *12H 2 O – 2.5, MgSO 4 *7 H 2 O – 0.5; medium initial pH 6.5; aeration intensity 2 l of air per 1 l of medium; 

144 hours of cultivation) resulted in 3.5 ± 0.3 g/l complex yield. Redirection of fungal metabolism from exopolysaccharide synthesis to 

chitin-glucan complex accumulation was achieved most efficiently by aeration intensity increase. Chitin-glucan complex from S. commune 

had the structure of microfibers with diameter 1–2 µm, had water-swelling capacity of 18 g/g, and was composed of 16.63% chitin and 

83.37% glucan with a degree of chitin deacetylation of 26.9 %. S. commune submerged cultivation is a potent alternative to Micromycetes 

for industrial-scale chitin-glucan complex production. 

K e y w o r d s: Schizophyllum commune, chitin-glucan, optimized cultivation 

List of abbreviations: CGC – chitin-glucan complex, IPA – isopropanol, PDA – potato dextrose agar, rpm – rotations per minute, 

vvm – air volume per broth volume per minute, YE – yeast extract 

trial chitin(chitosan)-glucan complex source. There 

are several reports on other Micromycetes belonging to 

genus Ascomycota and Zygomycota utilization for CGC 

production (Wu et al., 2005; Teslenko and Woewodina 

1996). Basidiomycetes have been rarely considered as 

CGC producers, though they are capable of intensive 

growth in submerged culture as well. Schizophyllum 

commune is Basidiomycete used for β-(1,3;1,6)-Dglucan 

schizophyllan production. S. commune can be 

a promising culture for industrial scale CGC production 

if mycelium growth and CGC content in mycelium 

is increased and exopolysaccharide synthesis suppressed. 

The aim of the work was to characterize CGC 

from S. commune submerged mycelium and to study 

the possibility of fungal metabolism redirection from 

exopolysaccharide synthesis to CGC formation. 

Experimental 


S. commune strains from different microorganism 

collections were used: F-795 (Czech Collection of 

Microorganisms), 11223, 1024, 1025 and 1026 (German 

* Corresponding author: D. Smirnou, CPN Ltd., Dolní Dobrouč 401, 561 02 Dolní Dobrouč, Czech Republic; phone: + (420) 465 519 539; 

e-mail: smirnou@contipro.cz

224 

Collection of Microorganisms and Cell Cultures), 127 

(Collection of Microorganisms CPN Ltd.). The strains 

were stored on agar slants with PDA at + 4°C and 

subcultured regularly. Prior to experiment the strains 

were inoculated to Petri dishes that were cultivated for 

7 days at 29°C. 250 ml Erlenmeyer flasks with 100 ml 

medium (Inoculum I) were inoculated with 10 pieces 

0.5 × 0.5 cm of mycelium from the Petri dishes and 

incubated in rotary shakers at 29°C, 200 rpm for 5 days. 

Inoculum I was then homogenized by T 25 digital 

Ultra-TURRAX (IKA, Germany) and 50 ml of homogenate 

were used for inoculation of 1000 ml Erlenmeyer 

flasks with 500 ml medium. 1000 ml Erlenmeyer flasks 

were cultivated in rotary shakers at 29°C, 200 rpm for 

7 days. In case of cultivations in 50 l fermenter 1000 ml 

Erlenmeyer flasks with 500 ml medium were cultivated 

for 3 days and then used as seed culture for fermenter 

inoculation (5% amount of inoculum). Fermenters with 

working volume 0.3 l were inoculated with 20 ml of 

homogenized Inoculum I and cultivation lasted 4 days. 

Medium for the seed cultures and production 

culti vations contained (in g/l): 35 – sucrose, 3 – YE, 

2.5 – Na 2 HPO 4 *12H 2 O, 0.5 – MgSO 4 *7 H 2 O, initial 

pH 5.5, unless otherwise specified. Effects of nutrient 

medium composition and pH were studied in 1000 ml 

Erlenmeyer flasks with 500 ml medium. Medium pH 

was adjusted by NaOH or HCl prior to sterilization. 

Influence of aeration was studied in Sixfors fermenters 

(INFORS AG, Switzerland) with working volume 

0.3 l. The cultivation conditions were as follows: temperature 

29°C, agitation 150 rpm, aeration 0.5–2.0 vvm. 

Effect of cultivation time was studied in fermenter 

(INFORS AG, Switzerland) with working volume 50 l 

under the following conditions: temperature 29°C; 

aeration 2 vvm; agitation 150 rpm. Cultivation medium 

(in g/l): 35 – sucrose, 4 – YE, 2.5 – Na 2 HPO 4 *12H 2 O, 

0.5 – MgSO 4 *7 H 2 O, pH 6.5. 

Mycelium and schizophyllan yields were measured 

as follows: 500 ml of cultural broth were centrifuged 

(10 000 × g, 25°C, 20 min), supernatant was collected 

and used for schizophyllan precipitation. Sediment 

(mycelium) was resuspended in 250 ml of demineralised 

water, centrifuged again and supernatant was discarded. 

The process of mycelium washing was repeated 

2 more times. The mycelium was placed into a Petri 

dish, freeze-dried in Heto PowerDry PL 3000 freeze 

dryer (Thermo Scientific, USA) to constant weight, 

and mycelium yield in grams of dry mycelium per 

1 liter of cultural broth was calculated. Schizophyllan 

was precipitated from supernatant with triple amount 

of IPA, dried under 60°C for 24 hours, weighted and 

schizophyllan yield in grams of dry polysaccharide per 

1 liter of supernatant was calculated. CGC amount in 

mycelium was determined as follows: 2 g of freeze-dried 

mycelium were resuspended in 60 ml of 4.2 M NaOH. 

Smirnou D. et al. 3 

The mixture was heated to 90°C and incubated under 

this temperature for 3 hours under constant mixing. 

The mixture was then centrifuged (10 000 × g, 25°C, 

10 min), the supernatant was discarded and sediment 

was resuspended in 300 ml of demineralised water by 

Ultra-Turrax T25 Digital (IKA, Germany) and centrifuged 

again. The process was repeated until supernatant 

pH 7. The sediment was then mixed with 60 ml of 

0.25 M HCl, resuspended by Ultra-Turrax T25 Digital 

(IKA, Germany) and incubated for 2 hours at 50°C. 

The resulting CGC was centrifuged (10 000 × g, 25°C, 

10 min), supernatant was discarded, sediment was 

resuspended in 300 ml of demineralised water by Ultra- 

Turrax T25 Digital (IKA, Germany) and centrifuged 

again. The process was repeated until supernatant pH 7. 

The CGC was dehydrated by IPA, dried under 60°C 

for 24 hours and weighed. CGC content is presented as 

mass fraction (%) in dry mycelium. Residual sucrose in 

the medium was calculated from glucose that resulted 

from sucrose degradation by baker’s yeast invertase 

(Sigma, USA). Glucose was measured by L-Glucose 

assay kit GOD-POD (BioVendor, Czech Republic). pO 2 

in the cultivation broth was measured by optical probe 

Hamilton-Visiferm DO 120 (Hamilton, Switzerland). 

CGC swelling capacity was measured as follows: 

0.5 grams of sample were placed into spherical container 

45 mm diameter made of wire screen. The container 

was deep into water for 40 sec. to let the substance swell. 

Then the container was removed from the water, left 

for 30 sec. to drain and weighed. Swelling capacity 

(g of water/1 g of sample) was calculated as follows: 

(weight of container with swelled sample – weight of 

wet container – 0.5)* 2. 

Hydrogen bromide titrimetric analysis was conduc 

ted by modified method described by Khan et al. 

(2002) with utilization of 500 mg CGC suspended in 

100 ml 0.2 M HBr. Elementary analyses were made 

on FISONS EA-1108 CHN elemental analyzer (Italy). 

Electron-scanning microscope image was made by 

Tescan VEGA II LSU electron microscope (Tescan USA 

Inc.) under the following conditions: high voltage 5 kV, 

working distance 4.4 mm, magnification 5000, display 

mode secondary electrons, high vacuum, room temperature. 

A15 nm layer of gold particles was applied on 

the sample by SC7620 Mini Sputter Coater (Quorum 

Technologies, UK). All experiments were repeated at 

least 3 times. The data is presented as value ± standard 

deviation. 


Mycelium growth and CGC production by submerged 

culture of six S. commune strains was studied. 

Cultivation lasted 7 days, corresponding to late

3 Chitin-glucan production by S. commune 

225 

Table I 

Mycelium yield, CGC content in mycelium, 

CGC and schizophyllan production by different S. commune strains 

S. commune 

strain 

Mycelium 

yield 

g/l 

CGC in 

mycelium 

% 

CGC 

production 

g/l 

Schizophyllan 

production 

g/l 

F-795 6.0 ± 0.2 15.2 ± 0.4 0.9 ± 0.1 2.3 ± 0.5 

11223 11.0 ± 0.4 17.4 ± 0.2 1.9 ± 0.2 1.7 ± 0.2 

1024 8.5 ± 0.1 16.1 ± 0.1 1.4 ± 0.3 0.7 ± 0.1 

1025 8.6 ± 0.5 17.1 ± 0.1 1.5 ± 0.2 0.7 ± 0.1 

1026 12.3 ± 0.3 20.3 ± 0.3 2.5 ± 0.2 1.2 ± 0.3 

127 11.4 ± 0.7 30.2 ± 0.2 3.4 ± 0.4 0.5 ± 0.1 

stationary growth phase. S. commune mycelium yield 

varied between 6.0 ± 0.2 g/l and 12.3 ± 0.3 g/l (Table I). 

For comparison, mycelium yields of chitin producers 

A. niger and Mucor rouxii are reported about 7 g/l and 

5 g/l respectively (Wu et al., 2005; Tan et al., 1996). CGC 

content in mycelium of different S. commune strains 

ranged within 15.2 ± 0.4% and 30.2 ± 0.2% and was 

similar to that reported for Aspergillus and Mucor (Wu 

et al., 2005, Arcidiacono and Kaplan 1992, Muzzarelli 

et al., 1980). CGC production by S. commune reached 

3.4 ± 0.4 g/l that is superior to many reported production 

values of Micromycetes. 

The microstructure and chemical composition of 

CGC from S. commune mycelium (Strain 127) were analyzed. 

The copolymer was a cotton-like substance white 

to creamy in color without odor. Electron-scanning 

microscopy showed that even after harsh extraction 

that removes alkali soluble cell wall polysaccharides, 

CGC from S. commune was composed of microfibers 

with diameter 1–2 µm, similar to fungal hypha (Fig. 1). 

Highly developed microstructure determined remarkable 

swelling capacity of the complex that was 18 grams 

of water per 1 gram of CGC and was comparable with 

that measured for cotton wool (35 g/l). This characteristic 

makes CGC from S. commune a valuable product 

for application in bandages. 

Elementary analyses of the complex showed nitrogen 

content 1.22 ± 0.10%, carbon 42.20 ± 0.24% and 

hydrogen 6.61 ± 0.15%. Glucosamine in the complex 

comprised 4.5 ± 0.4%. When these two analyses were 

combined, the composition of CGC from S. commune 

can be assumed as follows: 16.6% chitin and 83.4% of 

glucan with chitin deacetylation degree 27%. Although, 

chitin portion in S. commune CGC is lower than in 

A. niger, where chitin content is reported to be about 

30% (Wu et al., 2005; Machova et al., 1999), utilization 

of S. commune for chitin production is promising due 

to high CGC yield. 

Fungal mycelium separation from cultivation me - 

dium is an essential technological step in CGC production. 

From this point, filtration of S. commune cultural 

broth is a rather complicated process due to exopolysaccharide 

content. The possibilities of CGC production 

increase together with exopolysaccharide synthesis 

suppression by variation of cultivation technique were 

studied. The study was conducted on S. commune F-795. 

CGC accumulation by fungi can be effected by 

nitrogen source in nutrient medium. Sousa et al. (2003) 

reported that when Mucor circinelloides was cultivated 

in synthetic medium with L-asparagine as single nitrogen 

source, chitin content in mycelium depended upon 

amino acid concentration. There was studied effect of 

yeast extract (YE) in the medium on CGC production 

by S. commune. The amount of YE was varied from 2 g/l 

up to 5 g/l and CGC content in mycelium, mycelium 

yield and schizophyllan synthesis were measured. It 

was found, that CGC content in S. commune mycelium 

is little affected by YE, and it varied in the range 

of 15.4 ± 0.3% under all studied YE concentrations. 

Increase of YE content from 2 to 4 g/l increased mycelia 

biomass production more than 1.5 times (Fig. 2). Further 

supplementation of the medium with YE increased 

mycelium growth only slightly. As distinct from mycelium, 

schizophyllan synthesis was suppressed by YE 

concentrations over 4 g/l (Fig. 2). 

Amorim et al. (2001) reported medium pH as 

a regulating agent for chitosan production by Mucor 

racemosus and Cunninghamella elegans. The effect can 

be due to chitin deacetylase activity modification. It 

can be expected that medium pH may effect activity 

of enzymes, involved in S. commune CGC formation 

as well. CGC production by S. commune in medium 

with different initial pH was studied. Again, CGC 

Fig. 1. Electron-scanning microscope image of CGC 

from S. commune submerged mycelium (High voltage 5 kV, working 

distance 4.4 mm, magnification × 5000).

226 

Fig. 2. Effect of YE in nutrient medium on mycelium yield (■) g/l 

and schizophyllan production (■) g/l by S. commune. 

Fig. 3. Effect of initial medium pH on mycelium yield (■) g/l and 

schizophyllan production (■) g/l by S. commune. 

content in mycelium was not significantly affected by 

pH and varied in the range of 15.1 ± 0.4%. Mycelium 

yield reached highest values at medium initial pH 6.5 

(Fig. 3). Medium neutralization from pH 5 to pH 6 

increased schizophyllan production 1.5 times. Further 

increase of medium pH left schizophyllan synthesis 

practically unchanged. 


Fig. 4. Effect of aeration intensity on S. commune mycelium yield 

(■) g/l, and CGC content in mycelium (■) %. 

Fig. 5. Effect of aeration intensity on S. commune schizophyllan 

synthesis, grams of schizophyllan per gram of mycelium 

in the cultural broth. 

It is reported (Aguilar-Uscanga et al., 2003) that 

aeration intensity effects cell walls formation in fungi. 

In agreement with this, our study showed very significant 

changes in CGC production by S. commune during 

cultivation under different aeration rates. CGC content 

in mycelium rose from 12.4 ± 0.3% to 15.5 ± 0.3% 

when aeration increased to 1 vvm (Fig. 4). Further 

Fig. 6. Change of mycelium yield (g/l), CGC content in mycelium (%), CGC 

and schizophyllan production (g/l) during S. commune cultivation.

3 Chitin-glucan production by S. commune 

227 

Fig. 7. Change of medium pH, pO 2 (%) and sucrose content in medium (g/l) during 

S. commune cultivation. 

aeration increase up to 2 vvm increased CGC content 

to 16.3 ± 0.3% only. Mycelium yield increased more 

than 2 times with increase of aeration from 0.5 vvm to 

2 vvm and reached the maximum value of 13.7 ± 0.6 g/l 

(Fig. 4). From the data above, there was calculated 

maximal CGC production of 2.2 ± 0.2 g/l under 2 vvm 

aeration. 

When the amount of schizophyllan was related to 

mycelium yield, it was found that the most intensive 

exopolysaccharide synthesis takes place at aeration of 

1 vvm (Fig. 5). These indicate that aeration intensity 

can be used as the key regulator for redirection of 

S. commune metabolism from schizophyllan synthesis 

to CGC accumulation. 

Cultivation conditions that favored high CGC production 

(YE 4 g/l, pH 6.5, aeration 2 vvm) were combined 

and effect of cultivation time on CGC and schizophyllan 

accumulation was studied in fermenter with 

50 l working volume. The culture reached stationary 

growth phase in 96 hours, the highest mycelium yield 

of 15.9 ± 0.9 g/l was recorded at that cultivation time as 

well (Fig. 6). Amount of CGC in mycelium increased 

during all cultivation and reached maximum value of 

28.1 ± 0.2% in 168 hours. The highest CGC production 

of 3.5 ± 0.3 g/l was recorded in 144 hours of cultivation. 

The amount of schizophyllan in medium increased 

until 144 h of cultivation when it reached 2.4 ± 0.6 g/l, 

whereupon it started to decrease (Fig. 6). 

S. commune acidified medium to pH 4.9 in first 

72 hours, however then medium pH started to increase 

and reached 6.3 at the end of cultivation (Fig. 7). All 

sucrose was consumed within the first 96 hours. pO 2 

probe indicated 0% medium oxygen saturation beginning 

from 48 hours of cultivation (Fig. 7). 

By means of cultivation conditions optimisation 

CGC production by S. commune was increased more 

than 3.8 times. CGC content in mycelium was little 

sensitive to medium composition, but was increased 

by aeration intensification and cultivation time prolongation. 

Mycelium yield was increased by adjustment 

of YE content in the medium, medium initial pH and 

aeration intensity. Redirection of fungal metabolism 

from schizophyllan synthesis to CGC accumulation 

was achieved most efficiently by aeration intensity 

increase. The study showed the potential of S. commune 

submerged cultivation for industrial-scale CGC 

production. CGC from S. commune can find application 

in medicine and chitin/chitosan production as an 

alternative to CGC from Micromycetes. 

Acknowledgement 

We thank prof. Ing. Radim Hrdina (Institute of Organic Chemistry 

and Technology, University of Pardubice, Czech Republic) for 

elementary analyses. This work was supported by a grant from EU 

funds and national budget of the Czech Republic under project 

Nr. FR-TI 1/151 “New Wound Dressings Based On Micro- and 

Nano- Carriers” covered by TIP platform. 

Literature 

Aguilar-Uscanga B. and J.M. Francois. 2003. A study of the yeast 

cell wall composition and structure in response to growth conditions 

and mode of cultivation. Lett. Appl. Microbiol. 37: 268–274. 

Amorim R.V.S., W. de Souza, K. Fukushima and G.M. Campos- 

Takaki. 2001. Faster chitosan production by Mucoralean strains in 

submerged culture. Braz. J. Microbiol. 32: 20–23. 

Arcidiacono S. and D.L. Kaplan. 1992. Molecular weight distribution 

of chitosan isolated from Mucor rouxii under different culture 

and processing conditions. Biotechnol. Bioeng. 39: 281–286. 

Berecochea-Lopez A., K. Decordé, E. Ventura, M. Godard, 

A. Bornet, P.L. Teissèdre, J.P. Cristol and J.M. Rouane. 2009. Fungal 

chitin-glucan from Aspergillus niger efficiently reduces aortic 

fatty streak accumulation in the high-fat fed hamster, an animal 

model of nutritionally induced atherosclerosis. J. Agric. Food Chem. 

57: 1093–1098. 

Ivshin V.P., S.D. Artamonova, T.N. Ivshina and F.F. Sharnina. 

2007. Methods for isolation of chitin-glucan complexes from higher 

fungi native biomass. Polym. Sci. 49: 305–310. 

Khan T.A., K.K. Peh and H.S. Ch’ng. 2002. Reporting degree of 

deacetylation values of chitosan: the influence of analytical methods. 

J. Pharm. Pharmaceut. Sci. 5: 205–212. 

Machova E., G. Kogan, D. Chorvatovicova and J. Sandula. 1999. 

Ultrasonic depolymerization of the chitin-glucan complex from 

Aspergillus niger and antimutagenic activity of its product. Ultrason. 

Sonochem. 6: 111–114.

228 

Muzzarelli R.A.A., F. Tanfani and G. Scarpini. 1980. Chelating, 

filmforming, and coagulating ability of the chitosan-glucan complex 

from Aspergillus niger industrial wastes. Biotechnol. Bioeng. 22: 

885–896. 

Quatresooz P., C. Piérard-Franchimont, G. Szepetiuk, C. Devillers 

and G.E. Piérard. 2009. Fungal chitin-glucan scaffold for managing 

diabetic xerosis of the feet in menopausal women. Expert. Opin. 

Pharmacother. 10: 2221–2229. 

Sousa A.V., N.B. de Barros, K. Fukushima and T.G.M. Campos. 

2003. Effect of medium components and time of cultivation on chitin 

production by Mucor circinelloides (Mucor javanicus IFO 4570) 

– a factorial study. Rev. Iberoam. Micol. 20: 149–53. 


Tan C.S., K.T. Tan, M.S. Wong and E. Khor. 1996. Chitosan yield 

of zygomycetes at their optimum harvesting time. Carbohydr. Polym. 

30: 239–242. 

Teslenko A. and I. Woewodina. 1996. Process for producing chitosan-glucan 

complexes, compounds producible therefrom and their 

use. United States patent US 6333399 B1. 

Valentová Z., H. Bilerová, R. Suláková and V. Velebný. 2009. Preparation 

for wound healing and prevention of bandage adhesion to 

the wound, containing chitosan-glucan. Patent WO/2009/043319. 

Wu T., S. Zivanovic, F.A. Draughon, W.S. Conway and C.F. Sams. 

2005. Physicochemical Properties and Bioactivity of Fungal Chitin 

and Chitosan. J. Agric. Food Chem. 53: 3888–3894.




Inhibition of Lactophage Activity by Quinolinilporphyrin and Its Zinc Compex 

NATALIA VODZINSKA 1 *, BORIS GALKIN 1 , YURIY ISHKOV 1 , ANNA KIRICHENKO 1 , 

ALEXANDRA KONDRATYUK 2 and TETIANA FILIPOVA 2 

1 Biotechnological Scientific-Educational Centre of I.I. Mechnikov Odessa National University, Odessa, Ukraine 

2 Department of Microbiology and Virology, I.I. Mechnikov Odessa National University, Odessa, Ukraine 

Received 28 March 2011, revised 26 June 2011, accepted 5 July 2011 

Introduction 

Various lactic acid bacteria have been used for centuries 

in the preservation and production of fermented 

foods and feeds of plant and animal origins. One of the 

most critical problems in these processes is the contamination 

of the starters by bacteriophages that cause 

bacterial lysis and leads to failed or slow fermentation, 

decrease in acid production, reduction of milk products 

quality, e.g. taste and texture (Coffey and Ross, 2002), 

which all result in profound economical losses. 

Recognition of the phage problem in the dairy 

industry led to the design and application of a variety 

of practical measures for its alleviation, such as direct 

inoculation of the starters in closed fermentation vats, 

use of antiphage media for starter propagation, rotation 

of starter cultures, application of genetic techniques to 

improve the phage-resistance of starter cultures (however, 

European legislation requires the labelling such 

of starters as GMO that were modified by self-cloning 

and thus contain only species-specific DNA) (Kutter 

and Sulakvelidze, 2005). 

Porphyrins are one of the challenging compounds 

for infectious disease treatment (Nitzan et al., 1994). 

Nowadays they are widely used in anticancer photodynamic 

therapy. This method is based on the use of 

a photosensitizer, which after light exposure can cause 

different derangements of cell structures. It was shown 

Abstract 

The influence of free base of quinolinilporphyrin and its Zn complex on infectivity of lactophages E3, E5 and E17 has been studied. The 

results of our investigations show that inhibition of lactophage activity by Zn complex of quinolinilporphyrin at concentration 10 μM and 

20 μM was in the range 53–62% and 65–85%, respectively. The presence of this porphyrin in nutrient medium prevents the propagation 

of bacteriophage infection in Lactococcus lactis, but does not affect the phage adsorption process. The free base of quinolinilporphyrin 

slightly inhibits the activity of lactophages. 

K e y w o r d s: Lactococcus lactis, lactophage, quinolinilporphyrin 

that porphyrins have good antibacterial effect even 

without activation by light (Philippova et al., 2003). 

Porphyrins and their derivatives appear to be effective 

virucidal agents in vitro (Cowsert, 1994; Grandadam 

et al., 1995). Most of the work on viruses in vitro has 

been oriented to the use for sterilization of blood or 

blood products (North et al., 1993). In some works bacteriophages 

were used as a model of viruses to study 

mechanisms of porphyrin action (Zupan et al., 2004; 

Vodzinska et al., 2008). These compounds showed good 

effect as inhibitors of phytoviral infection in plant tissue 

culture and in vivo (Krulko et al., 2008; 2009). 

The aim of this work was to test the ability of new 

synthetic porphyrins to inhibit the activity of lactophages, 

namely phage E3, E5 and E17 of Lactococus 

lactis, without activation by light. 

Experemental 


Bacterial and phage strains. Lactococcus lactis 

subsp. lactis 502 and bacteriophages E3, E5 and E17 

were obtained from the collection of Belarusian State 

Technological University. Bacterial strains were grown 

and maintained at 30°C in M17 medium (Merck) with 

the following composition (Terzaghi and Sandine, 

1975) (g/l): peptone from soymeal (5.0), peptone from 

* Corresponding author: N. Vodzinska, Biotechnological Scientific-Educational Centre of I.I. Mechnikov Odessa National University; 

str. Dovzhenko 7а, 65058 Odessa, Ukraine; e-mail: nsvod@ukr.net

230 

meat (2.5), peptone from casein (2.5), yeast extract 

(2.5), meat extract (5.0), lactose monohydrate (5.0), 

ascorbic acid (0.5), sodium β-glycerophosphate (19.0), 

magnesium sulfate (0.25), supplemented with 0.5% glucose. 

When necessary, the medium was solidified with 

agar-agar (5 g/l for top agar, 10 g/l for bottom agar). 

Preparation of phage stocks was carried out in liquid 

medium M17 in the presence of 5 mM CaCl 2 . 

Chemicals. The antiphage activity of free base of 

quinolinilporphyrin (TQP) and its complex with Zn 

(Zn(II)TQP) (Fig. 1), synthesized in PLMS-5 of Odessa 

National University named after I.I. Mechnikov, has 

been studied. They were stored at 4°C in powder form 

or as a stock solution in distilled water. 

Plaque reduction assay. The direct action of porphyrins 

on the viral particles was studied by using the 

plaque reduction assay (Ramezani et al., 2008). Bacteriophage 

was incubated with compound in medium 

M17 24 hours at 4°C, then plated using standard double-layer 

method and incubated at 30°C overnight. The 

antiphage activity was expressed in percents of inactivation, 

which were calculated by means of formula: 

A = (1 – N s /N k ) × 100%, where N s is a number of plaque 

forming units in test sample, N k is the number of plaque 

forming units in the control. 

Inhibition of bacteriophage infection in the 

liquid medium. To check the influence of porphyrin 

on bacteriophage infection in L. lactis bacterial cells 

(1 × 10 3 cfu cm –3 ) and bacteriophage (5 × 10 4 pfu cm –3 ) 

were simultaneously added to test tubes which contained 

liquid medium M17 with different concentrations 

of compound. Test tubes without the studied compounds 

were used for determination of normal course 

of phage infection. Test tubes to which only L. lactis 

was added were used as a control. After 24 hours of 

incubation the optical density of samples was measured 

and compared with that in the control. Optical density 

measurements were made on spectrophotometer “Spekol-10” 

at λ = 540 nm (Philippova at al., 2003). 

Vodzinska N. et al. 3 

Fig. 1. Quinolinilporphyrin and its zinc complex structure. 

Inhibition of bacteriophage adsorption. To study 

the influence of porphyrins on the phage adsorption 

process the bacterium was incubated with bacteriophage 

in the presence of the compounds at 30°C for 

15 min. Test tubes without compounds were used as 

control for determination of phage adsorption inhibition. 

After 15 minutes the incubation was stopped 

by diluting (1:100) in normal saline solution and the 

mixture was centrifuged for 5 min 5000x g. The supernatants 

were assayed for non-adsorbed phages by standard 

double-layer method, and the results compared 

with the titer of a control without bacterial cells. Phage 

adsorption was calculated as follows: Percentage adsorption 

= (сontrol titre – residual titre)/сontrol titre × 100%. 


The main property for all antiviral agents is the 

absence of toxic effect on a host-cell. So for the start the 

influence of studied porphyrins on the growth of Lactococcus 

lactis culture has been checked. The porphyrin 

concentrations which not inhibit bacterial growth have 

been chosen. For both compounds those were concentrations 

0.1 µM, 1 µM, 10 µM, 20 µM. To determinate 

direct porphyrin action on the viral particles the bacteriophages 

were incubated with these compounds and 

then plated by the standard double-layer method. 

The results show that Zn complex of quinolinilporphyrin 

was the most effective against all studied bacteriophages. 

Maximal antiphage activity was observed in 

the presence of 20 µM of this compound. The inhibition 

of phage infectivity was in the range 65–85%. Bacteriophage 

E3 was the most sensitive to this porphyrin 

concentration. The antiphage effect of Zn complex at 

the concentration of 10 μM was equal to 53% for E5 

and reached 62% for E3 and E17 bacteriophages. Other 

concentrations of this porphyrin decreased bacteriophage 

activity by 3–25%. The inhibition of lactophage

3 Inhibition of lactophage activity by porphyrin 

231 

activity by free base of quinolinilporphyrin was in the 

2–25% range (Fig. 2). 

Data obtained in the experiments with liquid 

medium demonstrate similarity to data obtained in the 

plaque reduction assay. The results of these experiments 

show that the presence of quinolinilporphyrin Zn complex 

in the nutrient medium prevents the propagation 

of bacteriophage infection in L. lactis. 

Growth intensity of this bacterium in the presence 

of bacteriophage E3 and concentrations 10 µM and 

20 µM of quinolinilporphyrin Zn complex reached up 

111%, as compared with control. These concentrations 

of compound were also effective against bacteriophages 

E5 and E17, wherein the bacterium growth intensity 

reached up 104% and 102%, respectively. The presence 

of 1 µM of this compound in the nutrient medium also 

inhibited phage activity and bacterial growth was in the 

range 43–82%. The minimal concentration of this porphyrin 

wasn’t effective in prevention of bacteriophage 

infection (Tabele I). 

Table I 

Lactococcus lactis subsp. lactis 502 growth intensity in presence 

of bacteriophages and different concentrations 

of porphyrins, OD 540 ×10 –3 

Quinolinilporphyrins E3 E5 E17 

TQP 0.1 μM 87 ± 24 351 ± 88 93 ± 7 

1 μM 65 ± 3 298 ± 66 59 ± 3 

10 μM 56 ± 8 261 ± 57 77 ± 20 

20 μM 236 ± 49 707 ± 93 292 ± 5 

Zn(II)TQP 0.1 μM 77 ± 7 391 ± 52 88 ± 6 

1 μM 818 ± 128 1945 ± 197 805 ± 104 

10 μM 1918 ± 69 2466 ± 106 1913 ± 53 

20 μM 1955 ± 21 1587 ± 94 1925 ± 29 

С1 105 ± 13 295 ± 53 71 ± 6 

С2 1757 ± 93 2364 ± 57 1890 ± 32 

Note: С 1 – L. lactis + bacteriophage in medium without porphyrins, 

С 2 – L. lactis without addition of bacteriophages 

Fig. 2. Inhibition of bacteriophage activity in plaque reduction assay. 

The free base of quinolinilporphyrin slightly inhibited 

the activity of lactophages only in its maximal 

concentration. Other concentrations of this compound 

didn’t affect the phage infection course in L. lactis. 

Taking into consideration that the studied compounds 

have antiviral effect it was reasonable to check 

their ability to affect the initial stage of infection. The 

influence of porphyrin on viral adsorption was studied 

by determination of unadsorbed phage. 

The obtained results show that though quinolinilporphyrin 

Zn complex had a good effect in lactococcal 

infection inhibition it didn’t influence the phage 

adsorption process. The free base of quinolinilporphyrin 

showed only slight inhibition of lactophage 

adsorption in concentration 10 µM and 21–37% at 

20 µM. (Table II). Perhaps this delay of bacteriophage 

adsorption can be mediated by aggregation with viral 

peptides. At the same time the Zn complex may have 

another mechanism of antiphage action. The target of 

this porphyrin action can be bacteriophage DNA. It 

has been described that porphyrins can bind to DNA 

by intercalation between base pairs or external binding 

in a groove (Pasternack et al., 1983). Studies of cationic 

Table II 

Effect of porphyrins on lactophages adsorption 

to Lactococcus lactis subsp. lactis 502 

Quinolinilporphyrins 

E17 

Phage adsorption, % 

E17 E17 

TQP 0.1 μM 91 ± 2 96 ± 3 77 ± 3 

1 μM 88 ± 4 95 ± 1 84 ± 4 

10 μM 69 ± 1 72 ± 3 68 ± 1 

20 μM 59 ± 2 67 ± 2 68 ± 3 

Zn(II)TQP 0.1 μM 91 ± 2 97 ± 1 78 ± 2 

1 μM 92 ± 3 96 ± 2 85 ± 4 

10 μM 90 ± 1 96 ± 4 83 ± 3 

20 μM 90 ± 3 95 ± 1 85 ± 1 

Control 94 ± 2 97 ± 2 86 ± 3

232 

porphyrin binding to the isolated and encapsidated 

DNA of T7 bacteriophage have shown that the presence 

of the protein capsid in the phage particle does 

not exclude the interaction between porphyrin and 

intraphage DNA (Zupan et al., 2004). Besides, Duwat 

et al. (2001) have patented a process for preparing lactic 

acid bacteria starter cultures which comprises culturing 

bacteria under aeration and in an appropriate 

nutrient medium in the presence of some porphyrins. 

They suggest that the molecule of porphyrin can protect 

cells from oxidative damage. Their studies show that 

respiration conditions result in improved growth and 

a remarkable increase in long-term survival compared 

to growth under conventional fermentation conditions. 

Thus, the results of our investigation show that the 

Zn complex of quinolinilporphyrin can be considered 

a perspective antiphage agent and in taking into 

account the preceding information additional studies 

can be used as a medium component for starters in 

dairy industry. 

Literature 

Coffey A. and R.P. Ross. 2002. Bacteriophage-resistance systems in 

dairy starter strains: molecular analysis to application. Antonie van 

Leeuwenhoek 82: 303–321. 

Cowsert L.M. 1994. Treatment of papillomavirus infections: recent 

practice and future approaches. Intervirology 37: 226–230. 

Duwat P., S. Sourice, B. Cesselin, G. Lamberet, K. Vido, P. Gaudu, 

Y. Le Loir, F. Violet, P. Loubière and A. Gruss. 2001. Respiration 

capacity of the fermenting bacterium Lactococcus lactis and its positive 

effects on growth and survival. Journal of Bacteriology. 183: 

4509–4516. 

Vodzinska N. et al. 3 

Grandadam M., D. Ingrand and J.M. Huraux. 1995. Photodynamic 

inactivation of cell-free HIV strains by a red absorbing chlorin-type 

photosensitizer. Journal of Photochemistry and Photobiology B: Bio- 

logy 31: 171–177. 

Krulko I.V., A.V. Kharina, N.S. Vodzinska, T.O. Filipova and 

V.P. Polischuk. 2008. Antifitoviral activity of synthetic porphyrins in 

system in vivo. Ukrainian journal of agroecology. Spec. issue: 138–139. 

Krulko I.V., S.A. Zaika, A.V. Kharina, N.S. Vodzinska and 

V.P. Polischuk. 2009. Porphyrins as the inhibitors of viral infection 

in plant tissue culture. Microbiology & Biotechnology 2: 47–52. 

Kutter Elizabeth and Alexander Sulakvelidze (eds). 2005. Bacteriophages 

: biology and applications. CRC Press, Boca Raton – London 

– New York – Washington. 

Nitzan Y., H.M. Wexler and S.M. Finegold. 1994. Inactivation 

of anaerobic bacteria by various photosensitized porphyrins or by 

hemin. Current Microbiology 29: 125–131. 

North J., H. Neyndorff and J.G. Levy. 1993. Photosensitizers 

as virucidal agents. Journal of Photochemistry and Photobiology B: 

Bio logy. 17: 99–108. 

Pasternack R.F., E.J. Gibbs and J.J. Villafranca. 1983. Interactions 

of porphyrins with nucleic acids. Biochemistry 22: 2406–2414. 

Philippova T.O., B.N. Galkin, O.Yu. Zinchenko, M.Yu. Rusakova, 

V.A. Ivanitsa, Z.I. Zhilina, S.V. Vodzinskij and Yu.V. Ishkov. 2003. 

The antimicrobial properties of new synthetic porphyrins. Journal 

of Porphyrins and Phthalocyanines 11–12: 737–742. 

Ramezani M., J. Behravan, M. Arab and S. Amel Farzad. 2008. 

Antiviral activity of Euphorbia helioscopia extract. Journal of Biological 

Sciences 8: 809–813. 

Terzaghi, B.E. and W.E. Sandine. 1975. Improved medium for 

lactic streptococci and their bacteriophages. Applied Microbiology 

29: 807–813. 

Vodzinska N.S., T.O. Filipova, B.M. Galkin, Yu.V. Ishkov and 

G.M. Kirichenko. 2008. Staphylococcal bacteriophage inactivation 

in the presence of synthetic porphyrins. Microbiology & Biotechnology 

3: 82–88. 

Zupan K., L. Herenyi, K. Toth, Z. Majer and G.G. Csık. 2004. 

Binding of cationic porphyrin to isolated and encapsidated viral 

DNA analyzed by comprehensive spectroscopic methods. Biochemistry 

43: 9151–9159.




A Two-Step Strategy for Molecular Typing of Multidrug-Resistant 

Mycobacterium tuberculosis Clinical Isolates from Poland 

TOMASZ JAGIELSKI 1,2 *, EWA AUGUSTYNOWICZ-KOPEĆ 2 , KRZYSZTOF PAWLIK 3,4 , 

JAROSŁAW DZIADEK 5 , ZOFIA ZWOLSKA 2 and JACEK BIELECKI 1 

1 Department of Applied Microbiology, Institute of Microbiology, Faculty of Biology, 

University of Warsaw, Warsaw, Poland 

2 Department of Microbiology, National Tuberculosis and Lung Diseases Research Institute, Warsaw, Poland 

3 Department of Microbiology, Institute of Immunology and Experimental Therapy, 

Polish Academy of Sciences, Wrocław, Poland 

4 Department of Toxicology, Wrocław Medical University, Wrocław, Poland 

5 Laboratory of Mycobacterium Genetics and Physiology, Institute for Medical Biology, 

Polish Academy of Sciences, Łódź, Poland 

Received 1 February 2011, revised 13 April 2011, accepted 30 April 2011 

Introduction 

Tuberculosis (TB) continues to be one of the greatest 

public health problems in the world. Despite significant 

improvements in diagnosis and treatment procedures, 

every year TB kills about 2 million people, while an 

estimated 9 million develop the disease (WHO, 2006). 

Of the major contributors to the global TB burden is 

the appearance and spread of drug-resistant (DR), and, 

particularly, multidrug-resistant Mycobacterium tuberculosis 

strains (MDR; defined as resistant to at least 

isoniazid [H] and rifampicin [R] – two major anti-TB 

drugs). In Poland, the phenomenon of drug resistance 

in TB has been closely monitored since the mid 1990s, 

when Poland joined the World Health Organization 

(WHO) and International Union Against Tuberculosis 

and Lung Disease (IUATLD) global project on anti-TB 

drug resistance surveillance, and performed in 1996 the 

Abstract 

Tuberculosis (TB) continues to be one of the most challenging public health problems in the world. An important contributor to the global 

burden of the disease is the emergence and spread of drug-resistant and particularly multidrug-resistant Mycobacterium tuberculosis strains 

(MDR), defined as being resistant to at least isoniazid and rifampicin. In recent years, the introduction of different DNA-based molecular 

typing methods has substantially improved the knowledge of the epidemiology of TB. The purpose of this study was to employ a combination 

of two PCR-based genotyping methods, namely spoligotyping and IS6110-Mtb1/Mtb2 PCR to investigate the clonal relatedness 

of MDR M. tuberculosis clinical isolates recovered from pulmonary TB patients from Poland. Among the 50 isolates examined, 28 (56%) 

were clustered by spoligotyping, whereas IS6110-Mtb1/Mtb2 PCR resulted in 16 (32%) clustered isolates. The isolates that clustered in both 

typing methods were assumed to be clonally related. A two-step strategy consisting of spoligotyping as a first-line test, performed on the 

entire pool of isolates, and IS6110-Mtb1/Mtb2 PCR typing as a confirmatory subtyping method, performed only within spoligotype-defined 

clusters, is an efficient approach for determining clonal relatedness among M. tuberculosis clinical isolates. 

K e y w o r d s: Mycobacterium tuberculosis, multidrug resistance, spoligotyping, IS6110-Mtb1/Mtb2 PCR 

first prospective, country-wide survey (Zwolska et al., 

2000). Based on the data of the 3 rd national survey on 

TB drug resistance conducted in 2004, the number of 

DR- and MDR-TB cases was 246 (7.6%) and 51 (1.6%), 

respectively, placing Poland among the countries with 

relatively low DR-TB rates in the world (WHO and 

IUATLD, 2008). 

Over the last several years, the application of different 

DNA-based molecular typing methods has substantially 

improved our knowledge of the epidemiology 

of TB (Mathema et al., 2006). The usefulness of those 

methods has been demonstrated primarily as epidemiological 

markers to discriminate the pathogen at the 

genus, species, and subspecies level. The strain-level differentiation 

is of crucial importance for disclosing the 

sources of infection (exogenous vs endogenous acquisition), 

elucidating its potential routes of transmission, 

determining whether the infection is caused by a single 

* Corresponding author: T. Jagielski, Department of Applied Microbiology, Institute of Microbiology, Faculty of Biology, University 

of Warsaw; Miecznikowa 1, 02-096 Warsaw; phone: +48 22 5541311; fax: +48 22 5541402; e-mail: t.jagielski@biol.uw.edu.pl

234 

strain or by multiple strains (homogeneous vs mixed 

infection), and whether recurrence of the disease is 

attributable to treatment failure, that is relapse of infection 

with the original strain, or infection with a new 

strain of M. tuberculosis (endogenous reactivation vs 

exogenous reinfection). Furthermore, strain typing 

can be used to study the molecular mechanisms that 

mediate host-pathogen interactions or to identify the 

genotype-specific differences in the phenotypic characteristics, 

such as virulence, sensitivity to antimicrobial 

agents, organ tropism, transmissibility etc. (Mathema 

et al., 2006). 

The purpose of this study was to employ a combination 

of two PCR-based genotyping methods, namely 

spoligotyping and IS6110-Mtb1/Mtb2 PCR to investigate 

the clonal relatedness of MDR M. tuberculosis 

clinical isolates recovered from pulmonary TB patients 

(PTB) from Poland. 

Experimental 

Material and Methods 

Patients and bacterial strains. The study included 

a total of 50 MDR M. tuberculosis isolates recovered 

from 46 unrelated adult PTB patients from Poland 

(two isolates were obtained from each of four patients). 

The MDR-TB cases included in this study represen ted 

all bacteriologically-confirmed MDR-TB cases reported in 

Poland throughout 2004. Patients (40 men and 6 women; 

age range, 31 to 79 years; median age, 50.5 years) were 

recruited in 20 TB clinics in 11 Polish voivodeships: ku- 

jawsko-pomorskie (8 patients), mazowieckie (8), dolno- 

śląskie (7), lubelskie (7), śląskie (5), małopolskie (4), 

łódzkie (2), pomorskie (2), podlaskie (1), świętokrzys- 

kie (1) zachodnio-pomorskie (1), during a 1-year period 

(i.e. from 1 January 2004 to 31 December 2004). Primary 

isolation, species identification, and drug susceptibility 

testing (DST) were done at the regional mycobacteriology 

laboratories. The isolates were subcultured 

and sent to the National TB Reference Laboratory 

(NTRL) at the National Tuberculosis and Lung Diseases 

Research Institute in Warsaw, where confirmatory identification 

and DST were performed. Susceptibility testing 

to the first-line drugs was carried out according to 

the 1% proportion method, in Löwenstein-Jensen (L-J) 

medium, with the following critical concentrations: isoniazid 

[H] (0.2 µg/ml), rifampicin [R] (40 µg/ml), streptomycin 

[S] (4 µg/ml), and ethambutol [E] (2 µg/ml). 

Patient demographic and clinical characteristics were 

collected from the hospitalization records. 

Apart from the patient clinical isolates, two reference 

strains were used for spoligotyping, i.e.: M. tuberculosis 

H 37 Rv and M. bovis BCG. 

Jagielski T. et al. 3 

DNA isolation. Genomic DNA was obtained from 

M. tuberculosis colonies on L-J slants by the cetyltrimethyl-ammonium 

bromide (CTAB) method (van 

Embden et al., 1993). 

Genotyping methods. Spoligotyping was performed 

with a commercially available kit (Isogen Bioscience 

BV, Maarssen, The Netherlands) according 

to the instructions provided by the manufacturer and 

as described previously (Kamerbeek et al., 1997). The 

IS6110-Mtb1/Mtb2 PCR typing was performed according 

to the methodo logy described earlier (Kotłowski 

et al., 2004). Briefly, 2 μl of PvuII-restricted genomic 

DNA was used for two PCR assays, using a combination 

of primers IS1 and IS2, binding to the inverted repeats 

flanking IS6110, and either Mtb1 or Mtb2 primers, 

targeted to the repeated GC-rich sequences. The PCR 

products were resolved electrophoretically on 2% agarose 

gels and visualized under UV light after ethidium 

bromide staining. 

Analysis of genotyping results. The spoligotyping 

results were read independently by two observers, 

expressed as an octal code, entered in an Excel spreadsheet 

file and compared to the international spoligotype 

database (SpolDB4) at the Pasteur Institute of Guadeloupe 

(www.pasteur-guadeloupe.fr/tb/spoldb4), which 

at the time of matching analysis contained 39,295 patterns 

split into 1,939 shared types and 3,370 orphan 

profiles from 122 countries (Brudey et al., 2006b). 

A spoligotype cluster (the term „cluster” always 

referred to a group of at least two isolates that derived 

from different patients) was defined as two or more 

isolates exhibiting 100% identity of their spoligotype 

patterns, whereas those non-clustered were referred to 

as unique. The isolates whose spoligotype patterns were 

already recorded in the database, were assigned “shared 

types”, whereas those of spoligotypes identified for the 

first time, were designated either as “new shared types” 

(if 2 or more) or as “orphans” (if occurred only once). 

The SpolDB4 was also used to assign genotype 

families to the spoligotypes obtained. The spoligotypes 

absent in the SpolDB4 database, or of unknown family 

(“U”), were identified at a family level by the “Spot- 

Clust” program, which implements a mixture model 

built on the SpolDB3 database (Vitol et al., 2006; http:// 

cgi2.cs.rpi.edu/~bennek/SPOTCLUST.html). 

In IS6110-Mtb1/Mtb2 PCR typing, the patterns 

obtained in each of the two PCR assays, dependently on the 

primer combination (Mtb1-IS1-IS2 or Mtb2-IS1-IS2), 

were analysed separately with LabWorks 4.5 software 

(UVP, Inc., Upland, CA, USA) and by visual inspection. 

The molecular sizes of the PCR fragments were 

calculated using a 50-bp DNA ladder (Promega) as 

a molecular weight standard. Strains whose band patterns 

were identical (with a 5.0% band size tolerance) 

were defined as indistinguishable. However, isolates

3 A two-step strategy for M. tuberculosis typing 

235 

with less than 5 bands were defined as different, even 

if there was a single-band difference. Only if indistinguishable 

upon IS6110-Mtb1 and IS6110-Mtb2 PCR 

typing, the strains were considered clustered. The isolates 

were assumed clonally related only if clustered by 

both genotyping methods. 

A spoligotype-based dendrogram was generated 

with BioNumerics software (Applied Maths, Kortrijk, 

Belgium), whereas dendrograms based on IS6110- 

Mtb1/Mtb2 PCR analyses were drawn using the Gel- 

Quest/ClusterVis (Sequentix, Klein Raden, Germany). 

Similarity between fingerprints was each time calculated 

with the Dice’s coefficient, and clustering was 

performed using UPGMA (Unweighted Pair Group 

Method with Arithmetic Averages) algorithm. 

Results 

Spoligotyping of the analysed M. tuberculosis isolates 

produced a total of 27 different spoligotype patterns. 

Of these, 7 patterns defined as many clusters, 

including 28 (56%) isolates from 26 (56.5%) patients 

(the size of the clusters ranged from 2 to 8 isolates). The 

remaining 20 spoligotypes were unique, being found 

in 22 (44%) isolates from 20 (43.5%) patients (in two 

cases, both isolates from the same patient had identical 

spoligotypes). 

By comparison with the international spoligotype 

database (SpolDB4), 40 isolates from 37 (80.4%) 

patients harboured spoligotypes that had already been 

reported. For those isolates, specific international 

Fig. 1. Spoligotype dendrogram drawn for the 50 M. tuberculosis isolates used in this study. 

A, spoligotype hybridization pattern; B, isolate number; C, drug resistance profile; D, molecular family; E, shared type (ST) designation, according to 

the SpolDB4; H, isoniazid; R, rifampicin; E, ethambutol; S, streptomycin; C1-C3, reference strains: M. tuberculosis H Rv (C1, C2), M. bovis BCG (C3); 

37 

Nf – not found (in the SpolDB4); Unk, family unknown. Note the double isolates from the same patient were put in frames (1–4).

236 

shared-type (ST) designations could be assigned 

(Fig. 1). The most prevalent among the 19 SpolDB4defined 

spoligotypes found in this study were: ST53, 

ST891, ST1, ST1557, and ST1051, embracing 8, 5, 4, 4, 

and 3 isolates, respectively. 

Nine (19.6%) patients had isolates whose spoligotypes 

did not match any existing ST. Two of those spoligotypes 

were defined as new STs, as they were common 

in 2 isolates from one patient or 2 isolates from two 

different patients. Those new STs were designated “A”, 

and “B”, respectively. Another 6 spoligotypes (designated 

“C”-“H”) that were unrecorded in the SpolDB4 

occurred only once, and were thus defined as orphan 

types (Table I). 

Analysis of the geographical distribution of the spoligotypes 

found in this study revealed that 16 (59.2%) 

spoligotypes, representative of 37 (74%) isolates, had 

been observed in Poland previously (in past studies). 


Table I 

Spoligotypes unrecorded in the SpolDB4 and their family assignment by SpotClust analysis 

Spoligotype a Family b P c N d 

Binary Octal 

1. A ■■■■■■■■■■■■■ oooo■ ooooooo■■■■■■■ oooo■■■■■■■ 777741003760771 LAM9 0.94 2 (11420; 12489) 

2. B oooooooooooooooo■ ooooooooooooooooooooo■ oo■■ 000002000000111 LAM7 0.69 2 (1324; 4832) * 

3. C ooo■■■■■oo■■■■■■■■■■■o■■■■■■■■■■oooo■■■■■■■ 076377737760771 S 0.78 1 (469) 

4. D ■■■■■■■■■ooooooooooooooooo■■■■■■oooo■■■■■■■ 777000001760771 T4 0.97 1 (2575) 

5. E ■■■■■■■■■■■■■■■■■■■■■■■■■oooooo■oooo■■■oo■■ 777777774020711 H1 0.99 1 (1377) 

6. F ■■■■■■■■■■■■o■■■■■■■■■■■■■■■■oooooooooooo■■ 777737777600011 T2 0.91 1 (5895) 

7. G ■■■■■■o■oo■ooooo■o■■■■■■■■■■■■■■oooo■■■■■■■ 772202777760771 S 0.95 1 (124) 

8. H ■■■■■■■■■■■■■■■o■■oooo■■■■■■■■■■oooo■■■■■■■ 777773037760771 H Rv 37 0.98 1 (4991) 

9. 775 ■■■■■■■■■■■■■■■■■■■■■■■■■■■oooooooooo■■■■■■ 777777777000371 H3 0.69 1 (101) 

a Spoligotype, A-H, arbitrary spoligotype designation; 

b SpotClust-assigned family; 

c P, probability of the spoligotype pattern to belong to the family; 

d N, number of isolates; in brackets are given isolate numbers; an asterisk indicates isolates from the same patient. 

The family assignment, based upon SpolDB4 and 

SpotClust analysis revealed that 42% of the isolates 

belonged to the T family, 22% to the Latin American 

Mediterranean (LAM) family, and 18% to the Haarlem 

(H) family. Four other minor families, that is Beijing, 

S, X, and H 37 Rv family accounted for 8%, 6%, 2%, and 

2% of all isolates, respectively. 

With the aim of further differentiation, all patient 

isolates were subjected to IS6110-Mtb1/Mtb2 PCR typing. 

The results showed that 10 (35.7%) isolates being 

part of spoligotype clusters produced unique banding 

patterns. Thus, one spoligotype cluster (ST37) 

was ruled out. Another cluster (ST53), containing 8 

isolates from 6 patients was split into two subgroups; 

the first was composed of two isolates from the same 

patient, while the second was comprised of 3 isolates, 

of which 2 belonged to one patient. (The latter group 

met the criterion of a cluster). The IS6110-Mtb1/Mtb2 

Fig. 2. IS6110-Mtb1/Mtb2 PCR patterns for two selected spoligotype-defined clusters: ST53 (A) and ST1557 (B). 

I and II designate two PCR assays with IS1-IS2-Mtb1 (I) and IS1-IS2-Mtb2 (II) primer combination; MW, molecular weight marker. Numbers above the 

gel lines are isolate numbers. Asterisks (*; **) indicate isolates from the same patient. Note that isolates with identical DNA fingerprints were put in frames.


237 

Table II 

Clustering results of the two genotyping methods used 

in this study 

Method 

No of 

clustered 

isolates 

(%) 

No of 

clusters 

Size of 

cluster 

Spoligotyping 28 (56) 7 2–8 0.9535 

IS6110-Mtb1 PCR 17 (34) 6 2–4 0.9837 

IS6110-Mtb2 PCR 16 (32) 6 2–4 0.9853 

IS6110-Mtb1/Mtb2 PCR 16 (32) 6 2–4 0.9853 

HGDI 

PCR patterns of the remaining three isolates from the 

spoligotype cluster ST53 were unique (Fig. 2A). In three 

clusters, the number of clustered isolates dropped from 

5 to 4 (ST891), and from 4 to 2 (ST1, ST1557). Only 

2 spoligotype clusters (ST1051, “A”), containing 3 and 

2 isolates respectively, were identical with IS6110-Mtb1/ 

Mtb2 PCR. 

For the 22 isolates with unique spoligotypes, the patterns 

generated by IS6110-Mtb1/Mtb2 PCR were also 

found unique. 

In IS6110-Mtb1/Mtb2 PCR typing, the clustering of 

the patterns generated from each of the two PCR assays, 

with either Mtb1-IS1-IS2 or Mtb2-IS1-IS2 primer combination 

was highly concordant (Fig. 3). The only difference 

was in the subtyping within the ST1557 cluster. 

Three or two isolates clustered when IS6110-Mtb1- or 

-Mtb2 PCR was performed (Fig. 2B). 

In all four cases, double isolates from the same 

patient were identical with respect to their spoligotypes 

and IS6110-Mtb1/Mtb2 PCR patterns. 

Clustering results obtained with each of the two typing 

methods are compared in Table II. 

Overall, a combined analysis of spoligotyping and 

IS6110-Mtb1/Mtb2 PCR resulted in 6 clusters comprising 

of 16 isolates (32% of all isolates) from 15 patients 

(32.6% of all patients). The isolates within those clusters 

were assumed to be clonally related. 

Discussion 

Although M. tuberculosis constitutes a remarkably 

genetically homogeneous species, various repetitive 

DNA elements have been found in the M. tuberculosis 

genome that contribute to strain variation, thus providing 

excellent targets for molecular typing methods. 

The method most widely used for M. tuberculosis strain 

differentiation, considered the “gold standard” in the 

molecular epidemiology of TB, has been the IS6110based 

restriction fragment length polymorphism 

(RFLP) analysis, which detects, through Southern blotting, 

a specific repetitive element insertion sequence 

IS6110, whose number of copies and distribution 

throughout the mycobacterial chromosome varies 

between the strains (Thierry et al., 1990; van Embden 

et al., 1993). Other repetitive element-based DNA fingerprinting 

techniques include spoligotyping, which 

relies on determining the presence or absence of unique 

spacer sequences interspersing the direct repeats (DRs) 

within the DR locus of the M. tuberculosis chromosome 

(Kamerbeek, et al., 1997), DRE-(double-repetitiveelement) 

PCR, based on the detection of inter-IS6110- 

PGRS (polymorphic GC-rich sequence) polymorphism 

(Friedman et al., 1995) or more recently MIRU-VNTR 

(mycobacterial interspersed repetitive unit-variable 

number of tandem repeats) typing, which targets the 

polymorphism of different tandem DNA repeats scattered 

in various intergenic loci in the mycobacterial 

genome (Supply et al., 2000; Supply et al., 2001). 

In the molecular epidemiology studies of TB, the 

choice of the most appropriate typing method is of the 

utmost importance. First of all, such a method should 

have high enough discriminatory power to clearly discriminate 

among unrelated isolates of M. tuberculosis 

and at the same time to establish a clonal relationship 

between related strains. The higher the discriminatory 

power of the method, the greater the probability that 

the isolates within the clusters are truly related. The use 

of a poorly discriminative technique will overestimate 

the number of clustered isolates, thus leading to a false 

reconstruction of the transmission patterns within the 

population studied. Spoligotyping, which has important 

advantages of technical simplicity, robustness, time- and 

cost-effectiveness, portability and high reproducibility, 

has been repeatedly shown to overestimate clustering 

(Kremer et al., 1999; Gori et al., 2005). For instance, 

in a study of Gori et al. (2005), the number of isolates 

with identical spoligotypes was twice the number of 

isolates with identical IS6110-RFLP patterns. The low 

discriminatory capacity of the spoligotyping precludes 

its use as a sole genotyping method for epidemiological 

studies. However, spoligotyping has been found highly 

efficient when used in association with a second-line 

test, such as IS6110-RFLP (Goyal et al., 1997; Gori et al., 

2005) or a PCR-based method, such as DRE-PCR (Sola 

et al., 1998) or MIRU-VNTR typing (Sola et al., 2003; 

Oelemann et al., 2007). 

Although the IS6110-RFLP is the reference technique 

for genotyping M. tuberculosis, because of its 

high discriminatory index, several limitations and 

drawbacks have been demonstrated for this method. 

First, it requires large amount of extracted and highly 

purified DNA, necessitating lengthy subculturing of 

M. tuberculosis. Second, it provides insufficient discrimination 

among isolates carrying six or fewer copies of 

IS6110 (Bauer et al., 1999; Kremer et al., 1999). Finally, 

IS6110-RFLP suffers from the difficulty of analysing and

238 

interpreting of complex banding patterns. Databasing 

and interlaboratory comparison of the IS6110-RFLP 

profiles are technically demanding, requiring specialized 

software and expertise in its operation. Consequently, 

there is still a need for novel genetic markers 

that would unambiguously distinguish genetically 

related from genetically distinct (unrelated) isolates. 

A strategy integrating two rapid PCR-based methods 

has been suggested as a potential alternative to IS6110- 


Fig. 3A. 

RFLP for genotyping of M. tuberculosis (Goguet de la 

Salmonière et al., 1997). The best results were achieved 

when combining spoligotyping with MIRU-VNTR typing. 

The discrimination ability of such a system was 

found to be higher that that of IS6110-RFLP analysis 

(Oelemann et al., 2007; Allix-Beguec et al., 2008). 

In this study, we evaluated the applicability of another 

two-step strategy in typing M. tuberculosis clinical isolates. 

The strategy involved two PCR-based methods:


239 

Fig. 3. Dendrogram generated for the 50 M. tuberculosis isolates, based on computer-assisted comparison of DNA fingerprints obtained 

in two PCR assays with IS1-IS2-Mtb1 (A) and IS1-IS2-Mtb2 (B) primer combination. 

Roman numerals (I–IX; i–ix) indicate groups of 2 or more isolates harbouring identical banding patterns. Only groups indicated I–V, and VIII, as well 

as groups indicated ii–iv, and vi–viii are clusters. Note the double isolates from the same patient were put in frames (1–4). 

spoligotyping and IS6110-Mtb1/Mtb2 PCR. The latter 

method has been proposed as a new marker system for 

strain differentiation of tubercle bacilli by Kotłowski 

et al. (2004). The strength of this method is that it is fast, 

fairly robust, and easy to perform. More importantly, it 

possesses high discriminatory power, higher that that of 

spoligotyping and MIRU-VNTR typing, and comparable 

to that of IS6110-RFLP, as indicated in preliminary 

studies (Sajduda et al., 2006). The superiority of the 

IS6110-Mtb1/Mtb2 PCR over spoligotyping, in terms 

of discriminatory potential, was further demonstrated 

in two studies by Augustynowicz-Kopeć et al. (2007;

240 

2008b). This was also confirmed in the present study. 

The clustering rate for spoligotyping and IS6110-Mtb1/ 

Mtb2 PCR was 56% and 32%, respectively. It should 

also be stressed here that in all studies utilizing IS6110- 

Mtb1/Mtb2 PCR typing, carried out so far (including 

the present one), isolates with unique spoligotypes also 

bore unique IS6110-Mtb1/Mtb2 PCR patterns. This 

observation justifies the performance of IS6110-Mtb1/ 

Mtb2 PCR typing only within spoligotype clusters (i.e. 

for differentiation of isolates belonging to spoligotype 

clusters). A two-step protocol, in which spoligotyping 

is used as a preliminary screening test, and is followed 

by another typing method, of greater discriminatory 

capacity, performed on isolates with the same spoligotypes, 

has already been deployed by other investigators 

(Goguet de la Salmonière et al., 1997; Sola et al., 1998; 

Brudey et al., 2006a). 

Accurate assessment of genetic relatedness between 

M. tuberculosis isolates depends on cluster definition. 

Most studies, including the current one, define “clustered 

isolates” as those sharing an identical DNA fingerprint. 

In general, the more lenient the criteria, the 

higher chance of finding clusters, but the lower the likelihood 

that a cluster represents clonally related isolates, 

being part of the same chain of TB transmission (Glynn 

et al., 1999). However, in certain studies a single band 

difference between two DNA fingerprints is an allowable 

criterion to define a cluster (Goyal et al., 1997; Lari 

et al., 2007). This tolerance is supported by the documented 

cases of TB transmission between patients 

whose isolates had similar but not identical genotypic 

patterns (Ijaz et al., 2002). Based on the results from 

this study, the situation described above might have 

occurred only in one case. Among four isolates belonging 

to the ST1557 spoligotype cluster, two isolates had 

identical IS6110-Mtb1/Mtb2 PCR patterns, whereas 

one isolate differed from them by a single band, in 

only one PCR assay (with Mtb2-IS1-IS2 primer set) 

(Fig. 2B). Hence, in this particular situation, not two 

but three isolates could make up the final cluster. In all 

the remaining cases, the patterns resulted from subtyping 

of spoligotype clusters were either identical or 

differed by at least two bands. 

Regarding the phylogenetic structure of the M. tuber- 

culosis population studied, inferred by confronting the 

spoligotyping results with the international spoligotype 

database (SpolDB4), three families: T, LAM, and 

Haarlem were shown predominant, accommodating 

82% of the patients’ isolates. Overall, the genetic structure 

of Polish MDR M. tuberculosis isolates was characteristic 

of a European country (Brudey et al., 2006a; 

David et al., 2007; Lari et al., 2007). It was also similar 

to what had been reported for DR-TB in Poland in the 

past years (Sajduda et al., 2004; Augustynowicz-Kopeć 

et al., 2008a). The finding that 74% of the isolates from 


the MDR-TB cases studied displayed spoligotypes that 

had previously been shown in Poland may suggest that 

strains with these genotypes have been circulating in 

Poland for a long time and have been actively transmitted 

within the country. The presence of unique spoligotypes, 

hitherto unreported in the spoligotype database 

may suggest their specificity to the study setting. 

In conclusion, this study demonstrates the usefulness 

of a two-step strategy consisting of spoligotyping 

as a first-line test, performed on the entire pool of 

isolates, and IS6110-Mtb1/Mtb2 PCR typing as a confirmatory 

subtyping method, performed only within 

spoligotype-defined clusters, for determining the clonal 

relatedness among M. tuberculosis clinical isolates. 

Literature 

Allix-Beguec C., M. Fauville-Dufaux and P. Supply. 2008. Threeyear 

population-based evaluation of standardized mycobacterial 

interspersed repetitive-unit-variable-number tandem-repeat typing 

of Mycobacterium tuberculosis. J. Clin. Microbiol. 46: 1398–1406. 

Augustynowicz-Kopeć E., M. Kozińska, A. Zabost, S. Brzezińska, 

M. Anielak, T. Jagielski, D. Krawiecka, R. Grzesica, W. Szymkowicz, 

L. Maciak and Z. Zwolska. 2007. Molecular epidemiology of 

pulmonary tuberculosis among closely related people (in Polish). 

Pneumonol. info 4: 14–22. 

Augustynowicz-Kopeć E., T. Jagielski and Z. Zwolska. 2008a. 

Genetic diversity of isoniazid-resistant Mycobacterium tuberculosis 

isolates collected in Poland and assessed by spoligotyping. J. Clin. 

Microbiol. 46: 4041–4044. 

Augustynowicz-Kopeć E., T. Jagielski, M. Kozińska, A. Zabost, 

M. Klatt and Z. Zwolska. 2008b. Molecular analysis of drug-resistant 

Mycobacterium tuberculosis isolates collected in central Poland. 

Clin. Microbiol. Infect. 14: 605–607. 

Bauer J., A.B. Andersen, K. Kremer and H. Miorner. 1999. Usefulness 

of spoligotyping to discriminate IS6110 low-copy-number 

Mycobacterium tuberculosis complex strains cultured in Denmark. 

J. Clin. Microbiol. 37: 2602–2606. 

Brudey K., I. Filliol, S. Ferdinand, V. Guernier, P. Duval, 

B. Maubert, C. Sola and N. Rastogi. 2006a. Long-term populationbased 

genotyping study of Mycobacterium tuberculosis complex isolates 

in the French departments of the Americas. J. Clin. Microbiol. 

44: 183–191. 

Brudey K., J.R. Driscoll, L. Rigouts, W.M. Prodinger, A. Gori, 

S.A. Al-Hajoj, C. Allix, L. Aristimuño, J. Arora, V. Baumanis 

and others. 2006b. Mycobacterium tuberculosis complex genetic 

diversity: mining the fourth international spoligotyping database 

(SpolDB4) for classification, population genetics and epidemiology. 

BMC Microbiol. 6: 23. 

David S., D.R. Ribeiro, A. Antunes, C. Portugal, L. Sancho and 

J.G. de Sousa. 2007. Contribution of spoligotyping to the characterization 

of the population structure of Mycobacterium tuberculosis 

isolates in Portugal. Infect. Genet. Evol. 7: 609–617. 

Friedman C.R., M.Y. Stoeckle, W.D. Johnson and L.W. Riley. 1995. 

Double-repetitive-element PCR method for subtyping Mycobacterium 

tuberculosis clinical isolates. J. Clin. Microbiol. 33: 1383–1384. 

Glynn J.R., J. Bauer, A.S. de Boer, M.W. Borgdorff, P.E.M. Fine, 

P. Godfrey-Faussett and E. Vynnycky. 1999. Interpreting DNA 

fingerprint clusters of Mycobacterium tuberculosis. Int. J. Tuberc. 

Lung Dis. 3: 1055–1060.


241 

Goguet de la Salmonière Y.O., H.M. Li, G. Torrea, A. Bunschoten, 

J.D.A. van Embden and B. Gicquel. 1997. Evaluation of spoligotyping 

in a study of the transmission of Mycobacterium tuberculosis. 


Gori A., A. Bandera, G. Marchetti, A. Degli Esposti, L. Catozzi, 

G.P. Nardi, L. Gazzola, G. Ferrario, J.D.A. van Embden, D. van 

Soolingen and others. 2005. Spoligotyping and Mycobacterium 

tuberculosis. Emerg. Infect. Dis. 11: 1242–1248. 

Goyal M., N.A. Saunders, J.D.A. van Embden, D.B. Young and 

R.J. Shaw. 1997. Differentiation of Mycobacterium tuberculosis isolates 

by spoligotyping and IS6110 restriction fragment length polymorphism. 


Ijaz K., Z. Yang, H.S. Matthews, J.H. Bates and M.D. Cave. 

2002. Mycobacterium tuberculosis transmission between cluster 

members with similar fingerprint patterns. Emerg. Infect. Dis. 8: 

1257–1259. 

Kamerbeek J., L. Schouls, A. Kolk, M. van Agterveld, D. van 

Soolingen, S. Kuijper, A. Bunschoten, H. Molhuizen, R. Shaw, 

M. Goyal and J.D.A. van Embden. 1997. Simultaneous detection 

and strain differentiation of Mycobacterium tuberculosis for diagnosis 

and epidemiology. J. Clin. Microbiol. 35: 907–914. 

Kotłowski R., I.C. Shamputa, N.A. El Aila, A. Sajduda, L. Rigouts, 

A. van Deun and F. Portaels. 2004. PCR-based genotyping of 

Mycobacterium tuberculosis with new GC-rich repeated sequences 

and IS6110 inverted repeats used as primers. J. Clin. Microbiol. 42: 

372–377. 

Kremer K., D. van Soolingen, R. Frothingham, H.W. Haas, 

P.W. Hermans, C. Martin, P. Palittapongarnpim, B.B. Plikaytis, 

L.W. Riley, M.A. Yakrus and others. 1999. Comparison of methods 

based on different molecular epidemiological markers for typing of 

Mycobacterium tuberculosis complex strains: interlaboratory study 

of discriminatory power and reproducibility. J. Clin. Microbiol. 37: 

2607–2618. 

Lari N., L. Rindi, D. Bonanni, N. Rastogi, C. Sola, E. Tortoli and 

C. Garzelli. 2007. Three-year longitudinal study of genotypes of 

Mycobacterium tuberculosis isolates in Tuscany, Italy. J. Clin. Microbiol. 

45: 1851–1857. 

Mathema B., N.E. Kurepina, P.J. Bifani and B.N. Kreiswirth. 

2006. Molecular epidemiology of tuberculosis: current insights. 

Clin. Microbiol. Rev. 19: 658–685. 

Oelemann M.C., R. Diel, V. Vatin, W. Haas, S. Rusch-Gerdes, 

C. Locht, S. Niemann and P. Supply. 2007. Assessment of an optimized 

mycobacterial interspersed repetitive-unit-variable-number 

tandem-repeat typing system combined with spoligotyping for 

population-based molecular epidemiology studies of tuberculosis. 


Sajduda A., A. Brzostek, M. Popławska, N. Rastogi, C. Sola, 

E. Augustynowicz-Kopeć, Z. Zwolska, J. Dziadek and F. Portaels. 

2004. Molecular epidemiology of drug-resistant Mycobacterium 

tuberculosis strains isolated from patients with pulmonary tuberculosis 

in Poland: a 1-year study. Int. J. Tuberc. Lung Dis. 8: 1448–1457. 

Sajduda A., J. Dziadek, R. Kotłowski and F. Portaels. 2006. Evaluation 

of multiple genetic markers for typing drug-resistant Mycobacterium 

tuberculosis strains from Poland. Diagn. Microbiol. Infect. 

Dis. 55: 59–64. 

Sola C., I. Filliol, E. Legrand, S. Lesjean, C. Locht, P. Supply and 

N. Rastogi. 2003. Genotyping of the Mycobacterium tuberculosis 

complex using MIRUs: association with VNTR and spoligotyping 

for molecular epidemiology and evolutionary genetics. Infect. Genet. 

Evol. 3: 125–133. 

Sola C., L. Horgen, J. Maisetti, A. Devallois, K.S. Goh and 

N. Rastogi. 1998. Spoligotyping followed by double-repetitive-element 

PCR as rapid alternative to IS6110 fingerprinting for epidemiological 

studies of tuberculosis. J. Clin. Microbiol. 36: 1122–1124. 

Supply P., E. Mazars, S. Lesjean, V. Vincent, B. Gicquel and 

C. Locht. 2000. Variable human minisatellite-like regions in the 

Mycobacterium tuberculosis genome. Mol. Microbiol. 36: 762–771. 

Supply P., S. Lesjean, E. Savine, K. Kremer, D. van Soolingen 

and C. Locht. 2001. Automated high-throughput genotyping for 

study of global epidemiology of Mycobacterium tuberculosis based 

on mycobacterial interspersed repetitive units. J. Clin. Microbiol. 

39: 3563–3571. 

Thierry D., A. Brisson-Noël, V. Vincent-Lévy-Frébault, S. Nguyen, 

J.L. Guesdon and B. Gicquel. 1990. Characterization of a Mycobacterium 

tuberculosis insertion sequence, IS6110, and its application 

in diagnosis. J. Clin. Microbiol. 28: 2668–2673. 

van Embden J.D.A., M.D. Cave, J.T. Crawford, J.W. Dale, 

K.D. Eisenach, B. Gicquel, P. Hermans, C. Martin, R. McAdam, 

T.M. Schinnick and P.M. Small. 1993. Strain identification of Mycobacterium 

tuberculosis by DNA fingerprinting: recommendations for 

a standardized methodology. J. Clin. Microbiol. 31: 406–409. 

Vitol I., J. Driscoll, B. Kreiswirth, N. Kurepina and K.P. Bennett. 

2006. Identifying Mycobacterium tuberculosis complex strain families 

using spoligotypes. Infect. Genet. Evol. 6: 491–504. 

World Health Organization (WHO) & International Union 

against Tuberculosis and Lung Disease (IUATLD). The WHO/ 

IUATLD Global Project on Anti-Tuberculosis Drug Resistance Surveillance 

2002–2007: anti-tuberculosis drug resistance in the world: 

4 th global report. WHO, Geneva, Switzerland, 2008. WHO/HTM/ 

TB/2008.394. 

World Health Organization (WHO). 2006. Global tuberculosis con - 

trol: surveillance, planning, financing. WHO, Geneva, Switzerland. 

Zwolska Z., E. Augustynowicz-Kopeć and M. Klatt. 2000. Primary 

and acquired drug resistance in Polish tuberculosis patients: results 

of a study of the national drug resistance surveillance programme. 

Int. J. Tuberc. Lung Dis. 4: 832–838.




A Comparative Study on the Activity and Antigenicity of Truncated 

and Full-Length forms of Streptokinase 

REZA ARABI1 , FARZIN ROOHVAND1, 2 *, DARYOUSH NOROUZIAN3 , SOROUSH SARDARI4 , 

MOHAMMAD REZA AGHASADEGHI1 , HOSEIN KHANAHMAD5 , ARASH MEMARNEJADIAN1 1, 2 

and FATEMEH MOTEVALLI 

1 Hepatitis and AIDS Dept., 2 NRGB, 3 Bacterial vaccine Dept., 4 Biotechnology Dept. 

5 BCG vaccine Dept., Pasteur Institute of Iran 

Received 15 February 2011, revised 30 April 2011, accepted 30 May 2011 

Introduction 

Several thrombolytic drugs (plasminogen activators; 

PAs) with different pharmacokinetic and pharmacodynamic 

properties have been developed for treating diseases 

such as stroke, pulmonary embolism, deep vein 

thrombosis and acute myocardial infarction , among 

which streptokinase (SK) and tissue plasminogen(Plg) 

activator (tPA) are the most commonly used agents 

(Banerjee et al., 2004; Baruah et al., 2004). Although no 

predominant thrombolytic drug has been introduced 

to be used for every indication so far (Banerjee et al., 

2004), however, several clinical trials comparing the 

efficacy of SK and tPA generally suggested that streptokinase 

is the drug of choice for thrombolytic therapy 

especially in resource limited countries (Banerjee et al., 

2004; Baruah et al., 2004). 

Streptokinase is produced by different strains of 

β-hemolytic streptococci and due to its non human 

origin, is immunogenic and can evoke the immune 

Abstract 

Application of streptokinase (SK) as a common and cost-effective thrombolytic drug is limited by its antigenicity and undesired hemorrhagic 

effects. Prior structural/functional and epitope-mapping studies on SK suggested that removal of 59 N-terminal residues led to its 

fibrin dependency and identified SK antigenic regions, respectively. Following in silico analyses two truncated SK proteins were designed 

and compared for their fibrin specificity and antigenicity with the full-length SK. Computer-based modeling was used to predict the 

effect of vector (pET41a)-born protein tags on the conformation of SK fragments. SK60-386, SK143-386 and full-length SK (1–414) were 

separately cloned, expressed in BL21 E. coli cells and confirmed by Western-blotting. Functional activity of the purified proteins was evaluated 

with chromogenic and clot lysis assays and their antigenicity was tested by ELISA assay using rabbit anti-streptokinase antibody. As 

expected, chromogenic bioassay showed a major activity decline for SK60-386 and SK143-386 (83 and 91 percent, respectively), compared to 

SK1-414. However, in clot lysis assay, which is a fibrin-dependent pharmacopoeia-approved test, SK60-386 and SK143-386 were respectively 

35 and 31 percent more active though lysed the clots slower than full-length SK. Antigenic analysis also indicated significant decrease 

in ELISA signals obtained for truncated proteins compared to SK1-414 (45 and 28 percent less reactivity for SK143-386 and SK60-386, 

respectively, p < 0.0001). The results of this study for the first time pointed to SK143-386 and SK60-386, as improved SK derivatives with 

increased fibrin-selectivity and decreased antigenicity as well as acceptable bioactivity profiles in a pharmacopoeia-based analysis, which 

deserve more detailed pharmacological studies. 

K e y w o r d s: antigenicity, fibrin specificity, protein modeling, truncated streptokinase 

system; hence, frequent administrations of SK can 

result in production of neutralizing antibodies, which 

in turn reduces the efficacy of therapy, and eventually 

may lead to extensive allergic reactions (Banerjee et al., 

2004; Baruah et al., 2004; Parhami-Seren et al., 1997; 

Parhami-Seren et al., 1995; Reed et al., 1993; Torrèns 

et al., 1999). Besides, SK function is not fibrin-specific; 

therefore its infusion to patients’ blood may result in 

rapid activation of plasminogen and subsequent ectopic 

emergence of plasmin in circulatory system. This 

unspecific action of SK has undesirable consequences 

such as general depletion of plasminogen (Plg) concentration 

in circulatory system, rapid production of 

bradykinin resulting in hypotension (Reed et al., 1999) 

and elevating the risk of hemorrhage (Banerjee et al., 

2004; Baruah et al., 2004; Mundada et al., 2003; Reed 

et al., 1999; Sazonova et al., 2004). Therefore, there is 

high interest in providing modified or truncated SK 

molecules with improved fibrin-dependency and less 

immunogenicity. 

* Corresponding Author: F. Roohvand, Hepatitis and AIDS Dept. and NRGB, Pasteur Institute of Iran, Pasteur Ave., Tehran 1316943551, 

Iran; phone/fax: +98.21.66969291; e-mail: rfarzin@pasteur.ac.ir

244 

Streptokinase with a molecular mass of 47 kDa, is 

a 414 amino acid single strand peptide which lacks 

cystine, cystein, phosphorous, conjugated carbohydrates 

and lipids (Banerjee et al., 2004). SK forms an 

equimolar complex with plasminogen or plasmin and 

this complex converts plasminogen substrates to plasmin 

by hydrolyzing the amide bound between Arg 561 

and Val 562 . Eventually the resulted plasmin can degrade 

and solubilize the fibrin clots (Wang et al., 1998). Crystallography 

analysis of streptokinase structure (Wang 

et al., 1998) has shown that it is composed of 3 domains 

known as α, β and γ (residues 12–150, 151–287 and 

287–372 respectively) domains (Reed et al., 1999). All 

three domains of the protein are involved directly or 

indirectly in the SK interaction with Plg (Conjero-Lara 

et al., 1998). γ domain which has a close contact with 

Plg active site (Wang et al., 1998) plays a central role in 

amidolytic activity of the activator complex (Conjero- 

Lara et al., 1998) while β domain is known as the region 

responsible for high affinity interaction between SK and 

Plg. Although the exact role of α domain is not clearly 

defined, but the first 59 residues of this domain are 

important for streptokinase accurate conformation and 

full activity (Shi et al., 1994). In fact, deletion of these 

first 59 amino acids of the N-terminal segment (SKΔ59 

or SK60-414) resulted in major reduction of SK activity 

in the absence of fibrin, but interestingly in the presence 

of fibrin the activity was shown to be restored albeit in 

a longer period of time. In other words, SKΔ59 showed 

a fibrin-dependent full-activity characteristic when 

SK-Plg reaction were awaited for longer times (Mundada 

et al., 2003; Sazonova et al., 2004). Further studies 

indicated that presence of plasmin is an essential element 

for efficient activation of SKΔ59 (Mundada et al., 

2003; Sazonova et al., 2004). In fact, addition of trace 

amounts of plasmin markedly increased plasminogen 

activity of SKΔ59 and declined the previously reported 

lag time of the reaction. Moreover, in contrast to the 

wild type SK which protected plasmin from inhibition 

by α 2 -antiplasmin, SKΔ59 is more prone to such haemostatic 

regulations to prevent the risk of hemorrhage. 

Therefore, since in the real physiological condition, only 

plasminogen substrates on the surface of fibrin can be 

fully activated by SK60-414*plasmin complex (Mundada 

et al., 2003; Reed et al., 1999; Sazonova et al., 2004) and 

just fibrin-bound plasmin is protected from inhibitory 

action of α 2 -antiplasmin (Mundada et al., 2003), thus 

this truncated form of streptokinase was considered as 

a fibrin targeted plasminogen activator and a potentially 

improved SK for thrombolytic therapy (Mundada et al., 

2003; Sazoana et al., 2009; Sazonova et al., 2004). However, 

to our knowledge there is no prior study addressing 

a standard pharmacopoeia comparative analysis based 

on clot lyses assay between full length SK and SKΔ59 

in allowed reaction period of times to approve the efficiency 

of this truncated SK as a thrombolytic drug. 

Arabi R. et al. 3 

It is also well shown that during in vivo and in vitro 

Plg activation, SK is cleaved into three fragments spanning 

amino acid residues of 1–59, 60–386 and 387–414 

(Reed et al., 1999). While the N-terminal fragment 

remains tightly attached to the main segment, the 

C-terminal part, i.e. amino acids 387–414 is released 

during Plg activation, implying that this part may not be 

important for SK activity (Reed et al., 1999). Although 

the SK60-386 may be even a potentially more improved 

fibrin-dependent PA drug because of losing some immu- 

nogenic segments of SK located in its C-terminal (compared 

to SK60-414) but no prior study has addressed 

evaluation of its activity by fibrin based methods either. 

It was previously demonstrated that 143–386 fragment 

of streptokinase has only 60 percent of maximal 

activity over even a longer period of time compared to 

both full-length streptokinase and SK60-414 (Rodriguez 

et al., 1995). This fragment lacks the so-called nonessential 

C terminal part similar to SK60-386 and moreover 

has an extra 83 residue deletion in the N terminal 

region. Although SK143-386 has a dramatic reduction of 

activity in the absence of fibrin, but fibrin degradation 

potential of this fragment (which lacks more immunodominant 

regions of SK) or changes of its activity in 

the presence of fibrin was not previously studied either. 

Different regions of streptokinase have been identified 

as antigenic epitopes by using murine and human 

monoclonal antibodies as well as sera of patients treated 

with SK. Many of these regions, including residues 4 to 

8 and 96–99 (Coffey et al., 2001), 120–140 (Parhami- 

Serena et al., 2003), 353–414 (Reed et al., 1993) and 

373–414 (Torrèns et al., 1999), are located in regions 

which are marked out for SK truncations in our study 

( that is 1–59, 1–142 and 387–414) with the expectation 

that removal of these parts may result in the reduction 

of antigenicity in truncated SK molecules. 

In the present study, with the final aim of improving 

the potential therapeutic efficacy of streptokinase 

by development of more fibrin-specific SKs with less 

antigenicity, we sought to produce two recombinant 

truncated streptokinase derivatives spanning the residues 

of either 143–386 or 60–386 and analyzed their 

clot lyses activity by a standard pharmacopoeia fibrinbased 

method with that of full length SK. We also provide 

comparative data for improved and less antigenic 

profiles of these truncated molecules. 

Experimental 


Computer-based modeling. To evaluate the impact 

of the protein tags derived from pET41a (used for 

expression of SKs and its derivatives in this study) on 

the conformation of full length and truncated forms of

3 Truncated forms of streptokinase 

245 

Fig. 1. Schematic illustration for insertion site of 3 different forms of skc in pET41a vector. 

Truncated (143–386 and 60–386) and full-length(1–414) forms of skc were inserted into BamH1 and Pst1 sites of MCS of pET41a; ATG and Kan stands 

for start translation codon and kanamycin resistance respectively; MCS stands for for multiple cloning sites; GST-tag, S-tag and His-tag are the tags 

derived from the vector. 

SKs , three-dimensional structure of the SK proteins 

fused to the vector derived-tags were modeled using 

MODELLER program (version 9v5, 2008) which is 

a non-graphical, command-line based software. To this 

end, 1bmlC.pdb and 1m9A.pdb atom files (as templates 

for streptokinase and GST proteins respectively) were 

downloaded from Protein Data Bank (http://www.rcsb. 

org) and multiple template script files of MODELLER 

program were used for modeling. Visualization of the 

models was performed by Deep View Spdb-viewer (version 

4.0.1, 2009) and WebLab viewer Lite (version 4, 

2000) softwares. The resulted models were evaluated 

based on three methods: 1. Energy level comparison: in 

which energy calculation of residues of model and template 

was performed by applying DOPE potential command 

line of MODELLER program and energy level 

of the residues were compared in a graphing program. 

2. Root Mean Square Deviation (RMSD) calculation: 

in which the 3D structures of templates and models 

were superimposed in Deep View spdb-viewer program 

(version 4.0.1, 2009) and the quality of the fits were 

evaluated by calculating Root Mean Square Deviation 

(RMSD) between carbon α of the residues. 3. Ramachandran 

plot assessment: which was used to visualize 

dihedral angles ψ against φ of amino acid residues in 

protein structure by using RAMPAGE server (Lovell 

et al., 2002). 

Bacterial strains and culture media. Plasmid 

propagation and preparation was performed in E. coli 

DH5α (Novagen, USA) and E. coli BL21 (DE3) (Novagen, 

USA) was used for protein expression of cloned 

genes by IPTG induction. Bacteria were cultivated in 

LB (Luria-Bertani) broth or TY2X for plasmid extraction 

and expression induction, respectively. All strains 

were stored in 20% (v/v) glycerol and stab culture of 

LB Agar. 

Gene amplification, cloning and expression. 

Streptokinase gene (skc), from a standard streptococcus 

strain (S. equisimilis, ATCC 9542) which is also known 

as skc2 (Estrada et al., 1992), was PCR amplified by 

Pfu DNA polymerase. Various BamHI-tailed forward 

and PstI-tailed reverse primers (Table I) were used to 

amplify the nucleotide sequences corresponding to 

full length (SK1-414) and truncated SKs (SK60-386, 

SK143-386). In this regard Pf1 and Pf414 were used as 

primers for amplification of skc1-414 and pairs of Pf60, 

Pf386 and Pf143, Pf386 were applied for amplification 

of skc60-386 and skc143–386, respectively. Thermal 

program was set as 30 cycles of 95°C for 60 sec, 58°C 

for 45 sec and 72°C for 90 sec, which was followed by 

a final extension at 72°C for 5 min. 

The amplicons, after digestion with BamHI/PstI 

restriction enzymes, were separately cloned into the 

same sites of pET41a vector (Novagen, USA) downstream 

and in frame of the vector-derived tags (GST, 

S and His-tag), under the control of a T7 promoter 

(Fig. 1) to construct three recombinant plasmids of 

pETSK1, pETSK60 and pETSK143. The constructs 

which respectively encoded SK1-414, SK60-386 and 

SK143-386 were confirmed by sequencing (SeqLab, 

Germany) and subsequently were transformed into 

the E. coli BL21 cells. Single colony transformants were 

Table I 

Nucleotide sequence of primers designed for amplification of truncated 

and full-length streptokinase molecules. 

Pf60 (forward) 5’-CGAGGATCCAGTCCAAAATCAAAACC-3’ 

Pf143 (forward) 5’-ATAGGATCCCATGTGCGCGTTAGAC-3’ 

Pr386 (reverse) 5’-CCGCTGCAGTTACTAGGCTAAATGATAGCTAG-3’ 

Pf1 (forward) 5’-GAAGGATCCATTGCTGGACCTGAGTG-3’ 

Pr414 (reverse) 5’-ATCTGCAGTTATTTGTCGTTAGGGTTATCAGG-3’ 

Underlined sequences denote the restriction sites.

246 

inoculated in TY2X medium (OD 600 = 0.6) to express 

the recombinant protein for 3–5 hrs following induction 

by 0.1 mM IPTG (Isopropyl-thiogalactoside). 

Protein analysis and purification. Pellets of induced 

bacteria (5 ml) were lysed in 50 μl of lysis buffer (100 mM 

NaH 2 Po 4 , 10 mM Tris.Cl and 8 M Urea), resuspended 

in 50 μl Laemmli buffer (0.09 M Tris-HCl, 20% (v/v) 

Glycerol, 2% (v/v) SDS, 0.02% (v/v) bromophenol 

blue and 2% (v/v) β-ME) and heated at 80°C for 5 min. 

The supernatants were electrophoresed in 12% SDS- 

PAGE gel and separated proteins were either stained 

by coommasie Brilliant Blue or transferred to nitrocellulose 

membrane. After blocking the membrane in 3% 

(w/v) bovine serum albumin (BSA) and application of 

proper dilution of mouse anti-His antibody (Qiagen, 

Germany) and washing steps, HRP-conjugated goat 

anti-mouse IgG (Sigma, USA) was utilized as tracking 

antibody. The bands related to the recombinant SK 

proteins were finally visualized by application of DAB 

(3.3’ Diaminobenzidine) substrate. 

Recombinant proteins harboring the N-terminally 

tagged 6xHis amino acids were purified in denaturing 

condition by the application of Nickel-TitriloTriacetic 

Acid (Ni-NTA) agarose columns (Qiagen, Germany), 

according to manufacturer protocol. Briefly, the pellets 

of 200 ml of induced bacterial culture were lysed in 

5 ml of lysis buffer (100 mM NaH2Po4, 10 mM Tris.Cl 

and 8 M Urea) for 15 minutes. After centrifugation for 

20 minutes at 10000 rpm, the upper lysate was mixed 

with 2 ml of Ni-NTA resin for 30 minutes in a Falcon 

tube. The mixture was subsequently loaded into appropriate 

column (Qiagen, Germany), washed with 4 ml 

of washing buffer (containing the same lysis buffer, 

pH 6.3) twice and finally the SK proteins were eluted by 

elution buffer (containing the same lysis buffer, pH 4.5) 

in four fractions (0.5 ml each one). Purity and concentration 

of protein fractions were analyzed by SDS-PAGE 

and Bradford methods, respectively. 

Bioassay of recombinant SK proteins. Streptokinase 

activity was determined by three methods: 

Caseinolysis – In this semiquantitative standard 

method (Saksella, 1981) a plate containing 5% (w/v) 

skim-milk, 1% (w/v) agarose, 10 mM NaCl and 50 mM 

Tris base was prepared and different dilutions of standard 

SK (B. Braun, Germany) and the same amounts of 

eluted proteins were applied in the 5-mm wells previously 

prepared in the plate. All the standard and test 

wells were filled with 1 mg ml –1 concentration of plasminogen 

solution (Fluka, Sweden) to have the plasminogen 

in an excess molarity. Two other wells containing 

standard SK alone or plasminogen alone were also 

prepared as negative controls. After 24 h incubation at 

room temperature the caseinolysis diameter surrounding 

the wells, reflecting the functional activity of SK, 

was measured. 


Chromogenic assay – This method that monitors 

the amount of formed plasmin by an endpoint assay 

of a synthetic substrate (British Pharmacopoeia, 1998) 

(Couto et al., 2004) was conducted with slight modifications. 

In brief, recombinant SK molecules (0.4 nM) 

and Plg (1 nM) were mixed together in 96-well plates 

and incubated at 37°C for 10 min to construct activator 

complexes. 0.75 mM S2251 (H-D-valyl-L-leucyl-Llysine-ρ-nitroanalide) 

was added to the enzymatic complex 

as substrate and the mixture was incubated at 37°C 

for 20 min. The reaction was stopped with 20% (v/v) 

acetic acid and absorbance was read in 405 nm. Biological 

activity (IU ml –1 ) and specific activity (IU mg –1 and 

IU nM –1 ) of the samples were calculated according to 

OD 405 of reference streptokinase with known biological 

activity (B. Braun, Germany). 

Clot lysis assay – This method measures the SK 

activity in the presence of fibrin (British Pharmacopoeia, 

1998). Briefly, 0.2 ml of SK (0.8 nM) (either reference 

or purified recombinant proteins) was mixed 

with 0.2 ml of citric-phosphate buffer, 0.1 ml of thrombin 

(20 IU ml –1 ) and 0.5 ml of euglobulin (10 mg ml –1 ), 

which was purified according to the method used by 

Couto et al. (Couto et al., 2004), in a test tube. After 

the formation of clots, the required times for complete 

dissolution of clots was noted. Biological activity of the 

unknown purified samples was determined based on 

the plotted standard curve showing the clot lysis time 

against the IU ml –1 of different concentrations of reference 

SK. Biological activity (IU ml –1 ) and specific activity 

(IU mg –1 and IU nM –1 ) of samples were calculated 

according to reference streptokinase plot with known 

biological activity (B. Braun, Germany). 

Antibody preparation and Enzyme-Linked Immunosorbent 

Assay (ELISA). ELISA was used to evaluate 

antigenic discrepancy between full-length and truncated 

SK using polyclonal anti-SK antibodies generated 

in rabbits. Full length purified SK (SK1-414) emulsified 

in Complete Fraunds’ Adjuvant (CFA, Sigma) was 

intramuscularly injected to six female New Zealand 

rabbits (0.25 mg/rabbit). Booster administration was 

performed with the same amount of SK mixed with 

Incomplete Fraunds’ Adjuvant (IFA, Sigma) 4 wks 

later. The anti-sera were prepared at 4 wk post-booster 

injection and used in an indirect ELISA to detect the 

truncated SK molecules. ELISA plate was coated with 

0.4 nM of the 3 proteins (SK143-386, SK60-386 and 

SK1-414). After blocking with 3% (w/v) BSA, serial 

dilutions of anti-sera from individual injected rabbits 

(1/800, 1/1600, 1/3200, 1/6400, 1/12800) were added 

to streptokinase coated wells. Following the washing 

steps, horse-radish peroxidase (HRP)-conjugated antirabbit 

antibody was applied to the wells. Finally and 

after further washes, addition of the chromogenic substrate; 

TMB (Tetramethyl-benzidine) led to the color


247 

Fig. 2. Analysis of the expressed SK proteins. 

(A) SDS-PAGE and (B) western blot analysis of crude lysis of E. coli BL21 cells expressing truncated and intact forms of streptokinase; lane M: molecular 

weight marker, lane 1–3: SK143-386, SK60-386 and SK1-414 respectively; (C) SDS-PAGE analysis of purified proteins; lane M: molecular weight marker, 

lane 1–3: SK143-386, SK60-386 and SK1-414 respectively. 

appearance that was stopped by 10% (w/v) acetic acid. 

While the background absorbance resulting from the 

pre-immune sera was subtracted from the tests, the 

means of OD 450 for different groups were statistically 

compared using student t-tets. 

Results 

Modeling of truncated and full-length proteins. 

Expression of N-terminally truncated proteins is shown 

to be usually less efficient (Nihalani et al., 1998; Reed 

et al., 1999). We hypothesized that expression of N-terminally 

truncated SK proteins fused with N-terminal 

tags (derived from vectors such as pET41a) that are 

efficiently expressed may be facilitated. Although Reed 

et al. (Reed et al., 1999) previously reported that maltose 

binding protein (MBP) fused to streptokinase did 

not affect its activity, however for us an existing concern 

with this strategy was the risk of unwanted changes in 

the configuration of these proteins. To gain insights 

into this possibility we took advantage of computerbased 

modeling using the MODELLER software. 

To avoid complexity in modeling, the small 6His-tag 

(6 residues) and S-tag (15 residues) were ignored but 

GST tag, a protein with 220 amino acids was included 

in the modeling procedure. Several models were created 

by using ‘multiple- template’ scripts of MODELLER 

software and subsequently models with the lowest 

energy were selected for assessments (data not shown). 

DOPE scores of models resulted from model evaluation 

scripts of MODELLER software were compared 

with DOPE scores of templates by depicting the data as 

plots (Fig. 3). There are gaps in the DOPE plots due to 

deletion of some residues in 1bmlC (template of SK), 

which is obtained from Protein Data Bank, however 

analogous points related to these gaps in the models 

show good level of energy (less than – 1E –2 ). Fortunately 

residues related to γ domain, which is in close 

contact with catalytic site of plasminogen in the complex 

(Wang et al., 1998), in all 3 models of streptokinase 

had very near level of energy to their template (Fig. 3). 

Assessment of selected models by Ramachandran plot 

showed that residues of outlier region for full-length SK 

(SK1-414), SK60-386 and SK143-386 were 4.9%, 2.9% 

and 3.5% respectively. These scores compared to the 

scores of their templates (6.1% for 1bmlC and 1% for 

1m9A) seemed very reasonable. 

RMSD of selected models for the 3 proteins after 

superimposing to 1bmlC as template for streptokinase 

and from 1m9aA as template GST-tag, were calculated 

separately. These results indicated that SK143-386 

model has the least RMSD in comparison to the other 

models which means it was the best model (RMSD less 

than 2 Å is considered as excellent, between 2 and 6 Å as 

reasonable and more than 6 Å as improper). Altogether 

the results of all three kinds of evaluations showed that 

the fusion tags may not have considerable impact on 

the conformation of our proteins. 

Cloning, expression and purification of recombinant 

full length and truncated streptokinase proteins. 

Two truncated SK genes encoding 143–386 and 60–386 

amino acid residues (skc143-386 and skc60-386, respectively) 

in addition to the full-length SK gene (skc1-414) 

were PCR-amplified from the previously isolated skc2 

template (Estrada et al., 1992). The amplicons were 

cloned into the BamH1/Pst1 sites of pET41a plasmid, 

in the same open reading frame (ORF) of vector-born 

N-terminal fusion-tag (Fig. 1). Transformation and 

subsequent expression by IPTG induction of plasmids 

in E. coli BL21 (DE3) resulted in the appearance of 

protein bands with expected molecular weights for 

vector derived tags fused to the proteins (57, 66 and 

78 kDa for SK143-386, SK60-386 and SK1-414, respectively) 

in SDS-PAGE (Fig. 2A) and Western-blot analyses 

(Fig. 2B). 

Induction of protein expressions in large scale cultures 

(200 ml) and purification of His-tagged SK proteins 

using Ni-NTA affinity chromatography finally 

provided us with approximately 150 mg of full length 

and truncated proteins with a purity of more than 

90 percent for each protein that was shown by SDS- 

PAGE (Fig. 2C). These proteins were further evaluated 

for bioactivity and antigenicity.

248 

Comparison of biological activity for truncated 

and full length purified SK proteins. The caseinolysis 

method (Saksella, 1981) was used for preliminary activity 

assessment of the recombinant SK proteins. Two 

other methods used in this study were chromogenic 

plasminogen activation assay and a fibrin clot lysis assay 

which are recommended assays for biological activity 

assessment of streptokinase in British Pharmacopoeia 

(BP, 1998). Caseinolysis zones, surrounding the wells 

of samples together with different amounts of standard 

streptokinase, indicated that full length and truncated 

forms of SK proteins were biologically active (data not 

shown). Following this primary screening, specific 

activities of proteins were measured in terms of International 

Unit per milligram and per nanomole. The 

quantitative chromogenic assay indicated that, compared 

to SK1-414, specific activities of SK60-386 and 

SK143-386 had respectively reduced by 81 and 88 percent 

in terms of IU mg –1 83 and 91 percent in terms of 

IU nM –1 (Table II). Similarly, the clot lysis assay (lysis 

of one milliliter of clot by one microgram or nanomole 

streptokinase) showed a reduction of 68 and 80% of 

IU µg –1 and 72 and 85% of IU nM –1 , respectively, compared 

to SK1-414 (Table III). This method that mea- 


Fig. 3. DOPE score profiles of streptokinase models. 

A: SK1-414, B: SK60-386, C: SK143-386; all three models totally show good 

(almost residues less than –1.00E –2 ) energy level when compared to their 

template, especially in C terminus which has close contact with catalytic 

site on plasminogen. The gaps in some parts of DOPE plot of template are 

related to deletion of some residues of template downloaded from Protein 

Data Bank (1bmlC). 

sures the activity of SK in the presence of fibrin may 

be considered as a criterion for the fibrin dependency 

of SK molecule in physiologic condition (Reed et al., 

1999). Of note, all SK proteins (both full length and 

truncated SKs) were able to completely lyse the clots 

during 20 minutes which was acceptable and allowed 

time for a thrombolytic drug with potential therapeutic 

Table II 

Biologic and specific activity of truncated and full-length 

streptokinase molecules measured by chromogenic method. 

Biological activity (IU ml –1 ) 3758 634 346 

Specific activity (IU mg –1 ) 11743 2186 1443 

Specific activity (IU nMol –1 SK1-414 SK60-386 

SK143-386 

) 952 158 88 

Table III 

Biologic and specific activity of truncated and full-length 

streptokinase molecules measured by clot lysis method. 

Biological activity (IU ml –1 ) 3211 1464 1011 

Specific activity (IU mg –1 ) 10703 3405 2106 

Specific activity (IU nMol –1 SK1-414 SK60-386 SK143-386 

) 868 244 128


249 

Fig. 4. Antigenicity analysis of truncated forms of streptokinase in comparison to full length SK. 

(A) Reactivity of five serial dilutions of anti-SK polyclonal antisera on SK143-386, SK60-386 and SK1-414 by indirect ELISA. (B) Comparison of ELISA 

signals obtained with 1/12800 dilution of antisera in pairs of SK1-414 & SK143-386, SK1-414 & SK60-386 and SK60-386 & SK143-386. Deletion of 

residues 1–59, 1–142 and 387–414 in streptokinase resulted in significantly less antigenic proteins (p < 0.0001 for all comparisons). 

efficacy in the British pharmacopoeia. Comparison of 

the results obtained from clot lysis and chromogenic 

assays (in terms of IU nM –1 ) also indicated that while 

the specific activity of full length SK in the presence 

of fibrin was reduced approximately by 9%, but both 

truncated molecules showed an increased activity of 

35% and 31% for SK60-386 and SK143-386 respectively. 

Although there was significant difference in the 

specific activity between truncated and full-length 

streptokinase it was observed that by equal amount 

(0.8 nM), SK60-386 and SK143-386 completely lysed 

the clot approximately in 12 and 16 minutes, respectively, 

whereas SK1-414 solubilized the clot in about 

3 minutes; i.e. the truncated molecules had full activity 

in longer times but still in the range of allowed time for 

a thrombolytic drug with potential therapeutic efficacy 

in the British pharmacopoeia (20 minutes). 

Antigenicity analysis of full length and truncated 

SK molecules. Immunological characteristics of 

streptokinase can be evaluated by developing anti-SK 

antisera in different animals, including rabbits (Houba 

and Hana, 1966) and monkeys (Torrèns et al., 1999). 

In this study for comparison of antigenicity of the proteins, 

rabbit polyclonal antisera raised against purified 

SK1-414, were used to analyze antigenicity of truncated 

streptokinase proteins. Reactivity of five serial dilutions 

(1/800, 1/1600, 1/3200, 1/6400 and 1/12800) of the antisera 

with SK143-386, SK60-386 and SK1-414 which was 

measured by indirect ELISA pointed to lower signals 

(OD 450 ) in the case of truncated molecules (Fig. 4A). 

Dilution of 1/12800 was selected to statistically compare 

the observed differences of antigenicity between 

the 3 proteins (Fig. 4B). Interestingly, this analysis 

showed a significant decrease of reactivity for both 

truncated molecules in comparison with full length 

SK. SK143-386 showed to be 45% less reactive to anti- 

SK than SK1-414 (P < 0.0001) and SK60-386 had 28% 

lower reactivity in comparison to SK1-414 (P < 0.0001). 

Also reactivity of SK60-386 to anti-SK was 23% higher 

than SK143-386 (P < 0.0001). These data, in accordance 

with previous study (Torrèns et al., 1999) on evaluation 

of C terminally mutated streptokinase, indicated that 

removal of the selected fragments ( 59 or 142 residues 

of N terminal and 28 residues of C terminal) from full 

length SK leads to the production of considerably less 

immunogenic SK derivatives. 

Discussion 

Streptokinase is one of the most important drugs 

for thrombolytic therapy; however, it has shortcomings 

such as immunogenicity and fibrin-non specificity 

(Banerjee et al., 2004; Baruah et al., 2004; Reed 

et al., 1999; Sazonova et al., 2004). In the present study, 

based on previous reports on antigenic mapping and 

functional characteristics of SK regions, two truncated 

SK-molecules lacking the 59 N-terminal or the 

142 N-terminal amino acids plus 28 C-terminal residues 

(SK60-386 and SK143-386 respectively) were considered 

for construction and analysis of antigenicity/ 

activity. To the best of our knowledge there was no prior 

report on evaluation of activity of SK143-386 and SK60- 

386 as potential thrombolytic drugs for their therapeutic 

efficacy by a fibrin based and pharmacopoeia 

approved method. Further, no prior study addressed 

for comparison of the antigenicity of these truncated 

SK proteins with full-length SK. 

Bioassay of truncated SK proteins by chromogenic 

method indicated a dramatic decline of activity compared 

to the full length SK (up to 84 and 91 percents 

for SK60-386 and SK143-386, respectively (Table II). 

According previous reports, on structure/function analysis 

of streptokinase, this lower activity of truncated SK

250 

proteins in chromogenic assay was expectable (Reed 

et al., 1999; Rodriguez et al., 1995). Analysis by fibrin 

clot lysis assay also evidenced for significant activity 

reduction for truncated SK proteins compared to fulllength 

SK (Table III), but comparison of activities by 

two methods (Chromogenic assay versus fibrin clot 

assay) indicated 35% and 31% increase of activity for 

SK60-386 and SK143-386 respectively and reduction 

of 9% for full-length SK by clot lysis assay compared 

to chromogenic assay (Tables II, III). These observations 

are somehow in accordance with prior studies 

which demonstrated SK lacking N terminal 59 amino 

acids restores the activity in the presence of fibrin, 

however in the present study the truncated SK proteins 

did not restored full activity. Accordingly, while 

it was already shown that during a long analyzing time 

(6 hours) SK60-414 is more active than full-length SK 

in all ranges of the tested concentrations (0–50 nM), 

(Reed et al., 1999), other studies showed that SK60-414 

is superior than full-length SK only in high concentrations 

(Mundada et al., 2003). The results of our clot 

lysis test are consistent with the later report in that our 

truncated proteins had less activity than full-length SK 

using a lower concentration (0.8 nM). 

The lag time in fibrinolysis, which was the major 

reason for lower activity in our clot lysis assay, may be 

explained by the fact that both truncated molecules 

(lacking 59 first residues) were only able to form efficient 

activator complexes with plasmin and not with 

plasminogen (Mundada et al., 2003; Sazonova et al., 

2004) which were generated in trace amount in the 

beginning of the interaction. By more plasmin formation, 

further plasminogen substrates would be subsequently 

activated in a time manner. Delay in fibrin degradation 

can be, in fact, a positive feature, since it gives 

the opportunity to SK to become active only when it 

reaches to the loci occluded by fibrin clots. This feature 

can minimize activity of the SK protein in the regions 

lacking fibrin clots and may potentially reduce the risk 

of hemorrhage. 

The other side of our rationale for the truncation 

of streptokinase was to reduce its antigenicity. Antigenicity 

analysis by ELISA which was carried out in 

our study was based on methods previously developed 

for evaluation of the immunological characteristics of 

streptokinase using anti-SK antisera developed in different 

animals, including rabbits (Houba and Hana, 

1966 and Torrèns et al., 1999). These analyses showed 

a less reactivity of the SK-specific rabbit polyclonal 

antisera against the truncated SK molecules (Fig. 5), 

so that a significant decrease in the obtained signals 

was observed for truncated molecules in comparison 

with the full length protein, which was still significantly 

lower for SK143-386 compared to the SK60-386. These 

findings were somehow expected and compatible with 


other studies (Parhami-Serena et al., 2003; Reed et al., 

1993; Torrèns et al., 1999) which mapped and analyzed 

antigenic epitopes of streptokinase. Accordingly, 

lower reaction of anti-SK1-414 antibodies with truncated 

molecules confirmed the accumulation of antigenic 

determinants in the excised regions. Moreover, 

in a confirmatory experiment we prepared anti-truncated 

SK antibodies by immunizing the rabbits with 

SK60-386 and SK143-386 molecules and found that in 

comparison with anti-full length SK antibodies, antisera 

raised against the shortened molecules generally 

had a lower reactivity with their corresponding proteins 

(data not shown). Overall, these findings verified the 

less antigenicity/immunogenicity of the truncated SK 

proteins introduced in this study. 

Altogether, based on the available structure/function 

and antigenic mapping reports of SK molecule, 

to our knowledge the present study for the first time 

attempted to engineer truncated recombinant SK molecules 

with a simultaneous more fibrin specificity and 

less antigenicity. According to the obtained results, 

truncation of SK in both N- and C-terminal ends was 

successful to create fibrin targeted SKs with comparable 

activities and considerably lower antigenic properties. 

In a preliminary analysis, both of these proteins 

(SK143-386 and SK60-386) passed the pharmacopoeia 

standard for streptokinase activity assessment by a clot 

lysis assay for evaluation of a thrombolytic drug with 

potential therapeutic efficacy and hence may be considered 

for further pharmacological assessments. 


This study was financially supported by the Education Office of 

Pasteur Institute of Iran. The authors would like to thank Mr. Hendi 

for his technical assistance in biological activity assays. This paper 

is a partial fulfillment of a Ph.D. thesis by R.A. 

Literature 

Banerjee A., C. Chisti and U.C. Banerjee. 2004. Streptoki- 

nase – a clinically useful thrombolytic agent. Biotechnol. Adv. 22: 

287–307. 

Baruah D.B., R.N. Dash, M.R. Chaundhari and S.S. Kadam. 2004. 

Plasminogen Activators: A comparison. Vascul. Pharmacol. 44: 1–9. 

Coffey J.A., K.R. Jennings and H. Dalton. 2001. New antigenic 

regions of streptokinase are identified by affinity directed mass 

spectrometry. Eur. J. Biochem. 268: 5215–5221. 

Conjero-Lara F., J. Parrado, A.I. Azuaga, C.M. Dobson and 

P.C. Paula. 1998. Analysis of the interactions between streptokinase 

domains and human plasminogen. Protein Sci. 7: 2190–2199. 

Couto L., J.L. Donato and G. Nucci. 2004. Analysis of five streptokinase 

formulations using the euglobulin lysis test and the plasminogen 

activation assay. Brazil J. Med. Biol. Res. 37: 1889–1894. 

Estrada M., L. Hernández, A Pérez, P. Rodríguez, R. Serrano, 

R. Rubiera, A.Pedraza, G. Padrón, W. Antuch, J. de la Fuente and 

L. Herrera. 1992. High level expression of streptokinase in Escherichia 

coli. Biotechnol. Adv. 10: 1138–1142.


251 

Houba V. and I. Hana. 1966. The difference in immunological characteristics 

of two streptokinases. Immunol. 11: 387–397. 

Lovell S.C., I.W. Davis, W.B. Arendall, P.I.W. de Bakker, 

J.M. Word, M.G. Prisant, J.S. Richardson and D.C. Richardson. 

2002. Structure validation by Calpha geometry: phi,psi and Cbeta 

deviation. Proteins: Struct. Funct. and Genet. 50: 437–450. 

Mundada L.V., M. Prorok, M.E. DeFord, M. Figuera, F.J. Castellino 

and W.P. Fay. 2003. Structure-function analysis of the 

streptokinase amino terminus (residues 1–59). J. Biol. Chem. 278: 

24421–24427. 

Nihalani D., R. Kumar, K. Rajagopal and G. Shan. 1998. Role of 

the amino-terminal region of streptokinase in the generation of 

a fully functional plasminogen activator complex probed with synthetic 

peptides. Protein Sci. 7: 637–648. 

Parhami-Seren B., K. Keel and G.L. Reed. 1997. Sequences of 

antigenic epitopes of streptokinase identified via random peptide 

libraries displayed on phage. J. Mol. Biol. 271: 333–341. 

Parhami-Serena B., M. Lynch, H.D. Whites and G.L. Reed. 1995. 

Mapping the antigenic regions of streptokinase in humans before 

and after streptokinase therapy. Mol. Immunol. 32: 111–724. 

Parhami-Serena B., M. Seaveya, J. Krudysza and P. Tsantili. 2003. 

Structural correlates of a functional streptokinase antigenic epitope: 

serine 138 is an essential residue for antibody binding. J. Immunol. 

Methods. 272: 93–105. 

Reed G., P. Kussie and B. Parhami-Seren. 1993. A functional analysis 

of the antigenicity of streptokinase using monoclonal antibody 

mapping and recombinant streptokinase fragments.The J. Immunol. 

150: 4407–4415. 

Reed G., B. Parhami-Seren, S. Wang and L. Hedstrom. 1999. 

A catalytic switch and the conversion of streptokinase to a fibrin 

targeted plasminogen activator. PANAS 96: 8879–8883. 

Rodriguez P., P. Fuentes, M. Barro, J.G. Alvarez, M. Mwozz, 

D.C. Collen and H.R. Lunen. 1995. Structural domains of streptokinase 

involved in the interaction with plasminogen. Eur. J. Biochem. 

229: 83–90. 

Saksella O. 1981. Radial caseinolylis in agarose: a simple method 

for detection of plasminogen activator in the presence of inhibitory 

substances and serum. Anal. Biochem. 111: 276–282. 

Sazoana I.Y., R.A. Mcanmee, A.K. Houng, S.M. King, L. Hedstorm 

and G.L. Reed. 2009. Reprogrammed streptokinases develop 

fibrin-targeting and dissolve blood clots with more potency than tissue 

plasminogen activator. J. Thromb. and Haemostasis 7: 1321–1328. 

Sazonova I.Y., B.R. Robinson, I.P. Gladysheva, F.J. Castellino and 

G.L. Reed. 2004. Alpha domain deletion converts streptokinase into 

a fibrin-dependent plasminogen activator through mechanisms akin 

to staphylokinase and tissue plasminogen activator. J. Biol. Chem. 

279: 24994–5001. 

Shi G., B. Chang, S. Chen, D. Wu and H. Wu. 1994. Function 

of streptokinase fragments in plasminogen activation. Biochem. 

J. 304: 235–241. 

Torrèns I., A.G. Ojalvo, A. Seralena, O. Hayes and J. Fuente. 1999. 

A mutant streptokinase lacking the C-terminal 42 amino acids is less 

immunogenic. Immunol. Lett. 70: 213–218. 

Wang X., X. L i n, J.A. Lay, J. Tang and X.C. Zhang. 1998. Crystal 

structure of the catalytic domain of human plasmin complexed with 

streptokinase. Science 281: 1662–1665.




Infections Caused by RSV Among Children and Adults During 

Two Epidemic Seasons 

KATARZYNA PANCER *1 , AGNIESZKA CIĄĆKA1 , WŁODZIMIERZ GUT1 , BOŻENA LIPKA2 , 

JUSTYNA MIERZEJEWSKA3 , BOGUMIŁA MILEWSKA-BOBULA2 , ANNA SMORCZEWSKA-KILJAN2 , 

KARINA JAHNZ-RÓŻYK3 , DANUTA DZIERŻANOWSKA2 , KAZIMIERZ MADALIŃSKI1 and BOGUMIŁA LITWIŃSKA1 1 Department of Virology, National Institute of Public Heath – National Institute of Hygiene, Warsaw, Poland 

2 The Children’s Memorial Health Institute, Warsaw, Poland 

3 Department of Immunology and Clinical Allergology, Military Institute of Medicine, Warsaw, Poland 

Received 2 June 2011, revised 15 July 2011, accepted 16 July 2011 

Introduction 

Respiratory syncytial virus (RSV) is a member of Paramyxoviridae 

family, structured with ss-RNA of negative 

polarity, and lipid bilayer envelope that is derived from 

membrane of the host cell. On the surface of the envelope 

there are two glycoproteins: fusion protein (F) and 

G protein (G) (Lamb and Parks, 2007). 

RSV is the most common etiological agent of viral 

lower respiratory tract infections among infants and 

young children in the world. RSV is the most frequent 

cause of bronchiolitis and pneumonia in hospitalized 

children below 9 months of age (Iwane et al., 

2004). It has been counted that over one-third of all 

infants below 1 year old admitted to the hospital due 

to lower respiratory tract infection were infected by 

RSV. Overall, 4–5 millions of young children (< 4 y.) 

per year in USA acquire an RSV infection and among 

Abstract 

Respiratory Syncytial Virus (RSV) is one of the most common causes of lower respiratory tract infections in young children, immunocompromised 

patients (children and adults), patients with chronic respiratory diseases and elderly people. Reinfections occur throughout the 

life, but the severity of disease decreased with subsequent infection. The aim of this study was to analyze the frequency of RSV infections 

in two selected subpopulations: young children (below 5 y.) and adults with chronic respiratory diseases (25–87 y.). Nasopharyngeal swabs 

(334) collected from October 2008 to March 2010 were examined. The presence of RSV genome was determined by RT-PCR and the presence 

of RSV antigen by quick immunochromatographic test. Positive results of RT-PCR were found in 45.2% of all swabs: 48.6% samples in 

2008; 41.5% in 2009; 50.8% in 2010. The highest frequency of RSV-positive samples was in fall-winter months, but differences in RSV epidemic 

seasons were found. In the first season (2008–2009) an increased number of RSV infections was observed from November 2008, but 

in the second season – from January 2010. Generally, the frequency of RSV-positive RT-PCR among children was 53%, among adults 25%. 

The highest difference was observed in the first three-month period of 2010. RT-PCR positive samples were found in 68.5% of children and 

5.9% of adults. However, the RSV antigen was found in 44.4% of samples collected from adults in this period. Our results indicate that the 

contribution of RSV infections during epidemic season of respiratory tract infections in Poland was really high among children and adults. 

K e y w o r d s: RSV, epidemic seasons, high risk groups 

them ~ 125 000 are hospitalized due to this infection 

and ~ 450 die (Iwane et al., 2004; Black, 2003; Krilov, 

http://emedicine.medscape.co./article/971488). It might 

be estimated that 3–9 per 1000 children below 1 y. were 

hospitalized because of severe RSV infections. Probably, 

every child in early childhood got at least one infection 

caused by RSV but may have been asymptomatic or 

with moderate symptoms. In Thailand, 417.1/100 000 

incidences of pneumonia per year were connected 

with RSV infections in children below 5 y. (Olsen et al., 

2010). Meta-analysis performed by Nair et al. (2010) 

indicated, that 33.8 million of new episodes of RSV 

infections were occurred worldwide in children < 5 y. 

in 2005. Among them, 3.4 million cases were associated 

with acute lower respiratory infections (ALRI) which 

required hospitalization. The authors also estimated 

that 66 000–199 000 children (< 5 y.) died from ALRI 

associated with RSV in 2005. The majority of deaths 

* Corresponding author: K. Pancer, National Institute of Public Health-National Institute of Hygiene, Chocimska 24, 00-791 Warsaw, 

Poland; phone: +48 22 5421308; fax: +48 22 5421385; e-mail:kpancer@pzh.gov.pl

254 

were in developing countries (estimated 99%) (Nair 

et al., 2010). 

RSV was not found as a potential agent of severe 

infections in adults until 1970s, when outbreaks of RSV 

infections in long-term care facilities were recognized 

(Falsey et al., 1992). Next studies showed that RSV 

should be treated as an important cause of illness of 

elderly people (+ 65 y.) especially in community-dwelling 

(nursing houses, hospitals etc.) (Falsey et al., 2005). 

The mortality rate due to RSV infections is dependent 

on the age of patient and presence of risk factors. 

Among younger children hospitalized with RSV infection 

– without additional risk factors- the mortality rate 

is less than 1%. High-risk mortality rate occurs among: 

1. infants with chronic lung disease (e.g. bronchopulmonary 

dysplasia), congenital heart disease, prematurity, 

low birth weight, artificial nutrition – 3–5% 

(Black, 2003; Krilov, http://emedicine.medscape.co./ 

article/971488; Sullender, 2000) 

2. immunocompromised patients, elderly people 

with underlying disease – 8% of hospitalized (Falsey 

et al., 1992). 

Data regarding RSV infections in Poland are rather 

modest or/and incomplete (Belino-Studzińska and 

Pancer, 2008; Światły, 2001; Tranda et al., 2000). The 

majority of publications on RSV infection in Poland 

were based on results of serological examinations 

(Tranda et al., 2000; Łuczak et al., 2003). The problems 

of serological diagnosis of RSV infection were discussed 

previously (Pancer et al., 2010b). Briefly the problems 

of interpretation of specific to RSV IgM or IgG level 

determinations, especially among the youngest children 

(< 6 months), may be connected with necessity of cutoff 

value correction. Moreover the most of researches 

in Poland were focused only on one group of high risk 

of RSV infection – young children. 

The aim of this study was to analyze the frequency 

of RSV infections in two selected high risk groups: 

young children and adults with chronic respiratory 

tract diseases. 

Experimental 

Material and Methods 

Clinical specimens. Nasopharyngeal swabs from 

patients with viral respiratory tract infection (lower 

respiratory tract infection or upper respiratory tract 

infection or both) were collected and stored at –70°C. 

Selection of patients, based on clinical symptoms of 

infection, was done by clinicians. All patients or their 

parents were informed about the project (subject, 

scientific targets, limits) and they agreed to partici- 

pate in this study (according to decision of The Bioethics 

Committee in the Military Institute of Medicine, 

Pancer K. et al. 3 

n° 87/WIM/2006, and decision of The Bioethics Committee 

in The Children’s Memorial Health Institute, 

n° 100/KBE/2007). 

The samples were collected in the period from October 

2008 to March 2010. In total 352 nasopharyngeal 

swabs were collected, among them – 254 from children 

and 98 – from adults. Eighteen samples were excluded 

because of use for nasopharyngeal specimen collection 

out of the procedure. Finally, 334 samples were examined 

(228 from children and 96 from adults). 

There were two groups of high risk of RSV infection 

formed: 

1. Young children – aged from 1 day of life to 5 y. 

with acute viral respiratory infection hospitalized in 

the Children’s Memorial Health Institute. Sixty percent 

of the children were ≤ 6 months old. The majority 

of young patients (84%) were admitted to the hospital 

because of acute viral respiratory infections, in 16% 

of children viral respiratory infection was recognized 

during hospitalization. 

2. Adult patients with chronic respiratory diseases 

– aged from 27 y. to 87 y., half of them (54%) were 

≥ 60 y. The samples were collected from the outpatients 

of the Immunology and Clinical Allergology Department, 

Military Institute of Medicine. They visited their 

doctor because of acute respiratory infection or exacerbation 

of the symptoms of respiratory tract disease. 

Classical RT-PCR. RNA was isolated from samples 

using QIAamp Viral RNA Mini kit (Qiagen) and 

stored at –70°C. Classical nested RT-PCR (Pancer et al., 

2010a; Roca et al., 2001) for detecting viral RNA was 

performed in all clinical specimens (nasopharyngeal 

swabs). Briefly, nested RT-PCR reaction was done using 

Access RT-PCR System kit (Promega), at the C1000 

Thermal Cycler (Biorad). The primers and conditions 

of reactions for the first and second step of nested PCR 

were described previously (Roca et al., 2001). 

Detection of RSV antigen. The immunochromatografic 

test for qualitative detection of RSV antigen 

(Biotrin RSV Solo Assay, Ireland) was used for examination 

of 125/334 samples (collected from 57 children 

and 68 adults). 

Statistical analysis. The Statgraphic Centurion v.XV 

was used for analysis of correlation between obtained 

results and data of age, gender, onset date. 

Results 

In total, the genome of RSV was detected in 151 swab 

samples (45.2%). The frequency of detected RSV RNA 

was higher among children (53%) than among adults 

(25%). Genome of RSV was found in 50% of samples 

obtained from children in 2008; 43.8% in 2009 and in 

68.5% in the first quarter of 2010. Among adults posi-

3 Frequency of RSV infections 

255 

Fig. 1. Determination of RSV genome (PCR) and RSV antigen (Ag) in children and adults by quarter of onset 

in comparison to final diagnosis of RSV infection (RSV-pos). 

tive PCR samples were determined in 0%; 36.7% and 

5.9% respectively, but only few samples collected from 

adults were examined in 2008. 

Detection of RSV antigen by immunochromatografic 

test (RSV Ag) in selected 125 swab samples 

(57 chil dren, 68 adults) was performed. Among 

125 samples 64 were positive (51.2%) in total. The frequency 

of RSV Ag positive samples in children and 

adults were similar: 54.4% and 50%. Among 64 examined 

samples 36 (56%) were RSV Ag positive in 2009 

and 28/59 (47.5%) in the first 3 months of 2010. 

The final laboratory diagnosis of RSV infection 

was posed on the base of both results of examinations: 

RT-PCR and RSV Ag. Among 334 patients 182 cases 

of RSV infection (54.5%) were confirmed by RNA 

PCR and/or presence of RSV antigen, among them 

138 children and 44 adults. The relation of results by 

RT-PCR or RSV Ag to final RSV diagnosis are presented 

in figure 1. As it was shown, the highest percentage of 

RSV(+) diagnosis was obtained by RT-PCR method. 

The analysis of gender of patients and detection 

of RSV genome/antigen showed lack of influence 

of sex on the RSV infection in all examined people 

(Po = 0.1434), as well as in adults and children (respectively 

Po = 0.2076 and Po = 0.2762). RSV infection was 

found in 67% of examined boys and 57% of girls and 

53% of examined men and 39% women. 

An analysis of age of RSV infected patients was 

also performed. There was no correlation between 

the age of patients and detection of RSV infection 

(Po = 0.0903), also among children (Po = 0.1486) and 

adults (Po = 0.2889). The highest frequency of RSV 

positive samples (65.0%) was found among the youngest 

children (≤ 6 months). In this group the diagnosis 

of RSV infection was mainly based on RT-PCR results 

(60.7%). In the second high risk group to RSV infection, 

≥ 60 y., the frequency of RSV infections was 43.3%, 

positive results by RSV-PCR were obtained in 19.2% 

of 96 patients, but by RSV Ag test as much as 50% 

of 68 persons. The number of patients from the first 

group of risk was two times higher than number of 

elder patients. The RNA PCR results and final RSV 

diagnosis by age groups and number of patients are 

presented in figure 2. 

The significant correlations between detection of 

RSV infection by RT-PCR method, time of samples 

collection and time of onset were found: by quarter; by 

months and by weeks (Po = 0.0000 – 0.0015). The highest 

percentage of positive results were in March (30.5% 

of all positive), February (28.5%), January (14.6%), 

December and April (both 9%). Only 8.4% of all positive 

RT-PCR samples were found in other seasons/ 

months. However, there were some differences depending 

on the particular years of testing. RSV was found

256 

Fig. 2. Percentage of RSV positive samples by RT-PCR method 

(PCR+) and final RSV diagnosis (final RSV pos) by age group and 

number of examined patients. 

Fig. 3. Differences in frequency of RSV-positive samples 

(by RT-PCR) in two RSV epidemic seasons 

(2008–2009 and 2009–2010). 

in 48.5% of swabs collected in 2008; 41.5% in 2009 and 

50.8% of samples collected in the first three months of 

2010 year. In the first season (December 2008 – March 

2009) the increased percentage of positive RSV swabs 

was observed in December, but peak of RSV infections 

was in March 2009. In the second season there were no 

RT-PCR positive samples collected in December 2009. 

The percentage of positive results slowly rose during 

January but a high level of infections was observed in 

March 2010 (74% positive samples) (Fig. 3). 

Discussion 

RSV is one of the most widespread viruses. The high 

risk factors of RSV infection are indicated: prematurity, 

especially birth at less than 35 weeks gestation; multiple 


birth; chronic lung disease (bronchopulmonary dysplasia, 

cystic fibrosis); congenital heart diseases, especially 

with increased pulmonary blood flow; primary immunodeficiency, 

including symptomatic HIV infections, 

immunocompromised treatment (Iwane et al., 2004; 

Krilov http://emedicine.medscape.co./article/971488; 

Belino-Studzińska and Pancer, 2008). However, the 

other risk factors of RSV infections are: attendance at 

daycare centers, crowded living conditions, living in 

community-dwelling, presence of school-age siblings at 

home and smoking habit or exposure to passive smoking 

(Black, 2003). 

Clinical symptoms of RSV infection in general are 

not specific. Common RSV infections start usually as 

upper respiratory tract infections and during 1–2 days 

progress to diffuse small airway disease: cough, coryza, 

wheezing and rales and moderate fever (38°C and 

below) (Black, 2003; Krilov http://emedicine.medscape. 

co./article/971488) In more advanced stage cyanosis 

and higher fever may be observed. Reinfections of RSV 

occur throughout life, but they are mainly limited to 

upper respiratory tract infections, like common cold 

(7–10 days of illness) (Black, 2003; Falsey et al., 2005). 

Nonspecific symptoms, usually limited to upper respiratory 

tracts, caused that the diagnosis of RSV infection 

was performed only in patients of high group of risk. 

Moreover, problems of diagnosis of RSV infection are 

also connected to time of sample collection, transport 

and store conditions, choice of laboratory methods. 

Detection of RSV genome in clinical samples from 

patients suspected to have RSV infections is limited 

only to a short period after onset (until 3–6 days), due 

to very fast degradation of RNA (Schultzle et al., 2008). 

This is a reason why we were able to found very significant 

correlation between the time of onset, time of 

sample collection and results of PCR with reverse transcriptase 

step method (RT-PCR), especially in examinations 

of children. The sensitivity of this method was 

very high (3–5 Units/ml). However, RT-PCR method is 

not able to differentiate between productive and abortive 

infection of RSV, because both, RNA of infectious 

as well as defective RSV particles, was detected. 

Antigen of RSV was found in clinical samples 

through longer time from onset than virus RNA. Generally, 

the immunochromatographic tests for RSV Ag 

are not such sensitive as RT-PCR method is (Jaguś et al., 

2010; Mahony, 2008; Mills et al., 2010). In our study, 

100–1000 times differences in examinations performed 

with reference RSV strains were found. This test was 

less sensitive than RT-PCR, but no abortive infections 

were found. 

Finally, only 23.2% among the 125 samples examined 

by RT-PCR and RSV Ag test were positive by both 

methods (52% were positive in RT-PCR, 36% in RSV 

Ag assay). Agreement of positive results obtained in

3 Frequency of RSV infections 

257 

RT-PCR and RSV Ag detection method was observed 

in 19% of samples from adults and 28% from children. 

Detection of RSV infection among children was 

mainly based on positive results of RT-PCR. The predominance 

of positive results obtained by this method 

was very high in that group. In opposite, the method 

based on RSV antigen detection was better for identification 

of infections among adults, caused by this virus. 

It was especially visible in the first three-month period 

of 2010. This phenomenon might be explained by space 

of time between onset and sample collection. The children 

were hospitalized, thus nasopharyngeal swabs 

were collected in a few days after onset. The majority 

of adults were outpatients and the time of swab collection 

depended on scheduled of medical examinations 

by the specialist. 

Our results indicated that the frequency of RSV 

infection among children and adults with chronic 

respiratory diseases was really high (60.5% and 45.8%, 

respectively), especially in epidemic seasons. High frequency 

of RSV infection among young children hospitalized 

with acute respiratory infection determined in 

our study, correspond to data of other authors (Ivane 

et al., 2004; Black, 2003; Krilov http://emedicine.medscape.co./article/971488; 

Olsen et al., 2010; Nair et al., 

2010). RSV infection was found in 46.8% of children 

< 2 y. with respiratory symptoms visiting emergency 

department in Edinburgh in winter season 2008–2009 

(Mills, 2010). Also, RSV was the predominant etiological 

agent (61.3%) among children with bronchiolitis, 

during a three-years study in Madrid (Calvo 

et al., 2010). Moreover, RSV was also recognized as an 

important cause of community-acquired pneumonia 

among hospitalized adults (Murata and Falsey, 2007). 

Among adult patients, 4.4% in RSV season and 1.0% in 

off-season were admitted with RSV infections of lower 

respiratory tract to the hospital in Ohio (Dowell et al., 

1996). RSV was an etiological agent of pneumonia in 

16.7% of 1730 patients (adults and children) in Thailand 

(Olsen et al., 2010). Generally, it was estimated 

that 3–7% of healthy elderly people and 4–10% of highrisk 

adults develop every year infections caused by RSV 

in USA (Falsey et al., 1992; Falsey et al., 2005; Hashem 

and Hall, 2003). 

According to our analysis no difference in gender 

of patients with RSV infection was observed. However, 

other authors found that among hospitalized children 

frequency of boys was 2 – times higher than girls, but 

the difference was not significant (Black, 2003; Krilov 

http://emedicine.medscape.co./article/971488). 

The obtained results suggest no difference in the 

prevalence of RSV infections in the studied groups of 

high risk: young children and adults with chronic respiratory 

tract infections. The peak of epidemic activity 

of RSV during 18 months of observation was the same 

in children and in adults. In Europe the season of RSV 

infections occurs in winter months, however, the peak 

of epidemic activity may be different. For example, 

in Greece the most of RSV infections were noted in 

February, in Italy in February during one season and 

in March in another season, in Croatia in January (one 

season) and April (another one) (Mlinaric-Galinovic 

et al., 2008). The season of RSV infection occurs in 

Poland in the winter months, usually from November 

to April. In both analyzed seasons the peak of epidemic 

activity of RSV was in March, however, there were 

some differences. In the first analyzed season number 

of RSV positive samples/patients increased slowly in 

November 2008 through December to one high peak 

in January 2009 and second peak in March 2009. In the 

second season (2009–2010) there were no positive RSV 

samples in December 2009 and suddenly the number 

of RSV (+) samples increased in January to the peak 

in March 2010. Such kind of seasonal variations were 

also described in Norway (Fjaerli et al., 2004) In the 

season 1998–99 the number of RSV positive samples 

increased very slowly from November to January and 

suddenly a very high peak of RSV (+) was in February. 

In another season, 1999–2000, two peaks were found: 

December 1999 – January 2000 and lower peak in 

April 2000. Results of our study show similarity rather 

to data obtained in Scandinavia and described by Fjaerli 

et al. (2004). 

Conclusions. The results of our study indicate that 

the contribution of RSV infections to spectrum of 

respiratory tract diseases suspected to viral etiology in 

winter epidemic seasons (2008–2009 and 2009–2010) 

in Poland was even higher than expected. Diagnosis 

of RSV infection is further complicated by the concurrent 

influence of other common viral respiratory 

pathogens (especially influenza, parainfluenza, hMPV), 

which co-circulate with RSV during winter months. 

Analysis of RSV infections during subsequent seasons 

should be continued for better knowledge of epidemiological 

situation concerning the viral respiratory infections 

in Poland. 


This study was supported by grants of Polish Ministry of Science 

and Education NN 404 165 534 (2008 – 2011) and NN 404 169 934 

(2008–2011). 

Literature 

Belino-Studzińska P. and Pancer K. 2008. Respiratory syncytial 

virus: as an etiological agent of respiratory tract infection in children 

and adults (in Polish). Przegl. Epidemiol. 62: 767–75. 

Black C.P. 2003. Systematic review of the biology and medical management 

of Respiratory syncytial virus infection. Respiratory Care 

48: 209–233.

258 

Calvo C., F. Pozo, M.L. Garcia-Garcia, M. Sanchez, M. Lopez- 

Valero, P. Pérez-Breña and I. Casas. 2010. Detection of new respiratory 

viruses in hospitalized infants with bronchiolitis: a three-year 

prospective study. Acta Paediatr. 99: 883–887. 

Dowell S.F., L.J. Anderson, H.E. Jr Gary, D.D. Erdman, J.F. Plouffe, 

T.M. Jr File, B.J. Marston and R.F. Breiman. 1996. Respiratory 

syncytial virus is an important cause of community-acquired lower 

respiratory infection among hospitalized adults. J. Infect. Dis. 174: 

456–462. 

Falsey A.R., P.A. Hennessey, M.A. Formica, M.S.C. Cox and 

E.E. Walsh. 2005. Respiratory syncytial virus infection in elderly and 

high-risk adults. N. Engl. J. Med. 352: 1749–1759. 

Falsey A.R., J.J. Treanor, R.F. Betts and E.E. Walsh. 1992. Viral 

respiratory infections in the institutionalized elderly: clinical and 

epidemiological findings. J. Am. Geriatr. Soc. 40: 115–119. 

Fjaerli H.O., T. Farstad and D. Bratlid. 2004. Hospitalizations 

for Respiratory syncytial virus bronchiolitis in Akershus, Norway, 

1993–2000: a population-based retrospective study. BMC Pediatric 

4: 25–31. 

Hashem M. and C.B. Hall. 2003. Respiratory syncytial virus in 

healthy adults: the cost of cold. J. Clin. Virol. 27: 14–21. 

Iwane M.K., K.M. Edwards, P.G. Szilagyi, S.G. Humiston, R. Barth, 

T. McInerny, L. Shone and B. Schwartz. 2004. Population-based 

surveillance for hospitalizations associated with Respiratory syncytial 

virus, Influenza virus, and Parainfluenza viruses among young 

children. Pediatrics 113: 1758–1764 updated 2010: http://www.pediatrics.org/cgi/content/full/113/6/1758. 

Jaguś P., J. Chorostowska-Wynimko and A. Roży. 2010. Diagnostics 

of some viral infections of respiratory tract (in Polish). Pneumonol. 

Alergol. Pol. 78: 47–53. 

Krilov L.R. Respiratory Syncytial Virus (RSV) infection. eMedicine 

Pediatrics. http://emedicine.medscape.com/article/971488. 

Lamb R.A. and G.D. Parks. 2007. Paramyxoviridae. The Viruses 

and their Replication. pp. 1449–1496 In: Knipe D.M, Howley P.M 

(eds.) Fields of virology Lippincott Williams& Wilkins, Wolters Kluwer 

Business. 

Łuczak G., E. Kozielska, J. Tyl, A. Borkowska, A. Galińska, 

W. Radys and Z. Bohdan. 2003. Role of Respiratory syncytial virus 

in respiratory tract infections pathogenesis in infants and small children. 

Med. Sci. Monit. 9: 44–47. 

Mahony J.B. 2008. Detection of respiratory viruses by molecular 

methods. Clin. Microbiol. Rev. 21: 716–747 

Mills J.M., J. Harper, D. Broomfield and K.E. Templeton. 2010. 

Rapid testing for Respiratory syncytial virus in a pediatric emergency 

department: benefits for infection control and bed management. 

J. Hosp. Infect. doi:10.1016/j.jhin.2010.11.019 


Mlinaric-Galinovic G., R.C. Wellver, T. Vilibic-Cavlek, S. Ljubin- 

Sternak, V. Drazenovic, I. Galinovic and V. Tomic. 2008. The 

biennial cycle of Respiratory syncytial virus outbreaks in Croatia. 

Virology Journal. 5: 18–23. 

Murata Y. and A.R. Falsey. 2007. Respiratory syncytial virus infection 

in adults. Antivir. Ther. 12: 659–670. 

Nair H., D.J. Nokes, B.D. Gessner, M. Dherani, S.A. Madhi, 

R.J. Singleton, K.L. O’Brien, A. Roca, P.F. Wright, N. Bruce and 

others. 2010. Global burden of acute lower respiratory infections 

due to Respiratory syncytial virus in young children: a systematic 

review and meta-analysis. Lancet 375: 1545–1555. 

Olsen S.J., S. Thamthitiwat, S. Chandra, M. Chittaganpitch, 

A.M. Fry, J.M. Simmerman, H.C. Baggett, T.C. Peret, D. Erdman, 

R. Benson and others. 2010. Incidence of respiratory pathogens in 

persons hospitalized with pneumonia in two provinces in Thailand. 

Epidemiol. Infect. 21: 1–12. 

Pancer K., A. Panasik, W. Gut, B. Lipka, D. Puchta, B. Milewska- 

Bobula, D. Dzierżanowska and B. Litwińska. 2010a. Infections 

caused by RSV – problems of diagnostic based on serological examinations. 

pp. 115–122. In: M. Polz-Dacewicz (ed.) Viral Infectiondiagnostics, 

prevention and control. The role of viral infection in public 

health. Uniwersytet Medyczny w Lublinie, Polskie Towarzystwo 

Wirusologiczne, DA Studio 

Pancer K., A. Panasik, A. Makówka, P. Belino-Studzińska, 

W. Gut, D. Puchta, D. Dzierżanowska and B. Litwińska. 2010b. 

The influence of preanalytical factors on detection of RNA viruses 

by reverse transcription – polymerase chain reaction (RT-PCR). 

pp. 105–113. In: M. Polz-Dacewicz (ed.) Viral Infection-diagnostics, 

prevention and control. The role of viral infection in public health. 

Uniwersytet Medyczny w Lublinie, Polskie Towarzystwo Wirusologiczne, 

DA Studio. 

Roca A., M.P. Loscertales, L. Quintó, P. Pérez-Breña, N. Vaz, 

P.L. Alonso and J.C. Saiz. 2001. Genetic variability among group A 

and B Respiratory syncytial viruses in Mozambique: identification of 

a new cluster of group B isolates. J. Gen. Virol. 82: 103–11. 

Schutzle H., J. Weigl, W. Puppe, J. Forster and R. Berner. 2008. 

Diagnostic performance of a rapid antigen test for RSV in comparison 

with a 19-valent multiplex RT-PCR ELISA in children with 

acute respiratory tract infections. Eur. J. Pediatr. 167: 745–749. 

Sullender W.M. 2000. Respiratory syncytial virus genetic and antigenic 

diversity. Clin. Microbiol. Rew. 13: 1–15. 

Światły A. 2001. Acute bronchitis (in Polish). Przew Lek. 4: 6, 89–91. 

Tranda I., J. Wilczyński, M. Wróblewska-Kałużewska and 

E. Torbicka. 2000. Epidemiology of respiratory tract acute viral 

infections in children during first two years (in Polish). Ped. Pol. 

75: 619–623.




Detection of Giardia intestinalis Assemblages A, B and D 

in Domestic Cats from Warsaw, Poland 

DOROTA JAROS* 1,2 , WOJCIECH ZYGNER 2 , SŁAWOMIR JAROS 3,4 and HALINA WĘDRYCHOWICZ 2,3 

1 Institute for Medical Biology of the Polish Academy of Sciences, Łódź, Poland 

2 Division of Parasitology and Parasitic Diseases, Department of Preclinical Sciences, Faculty of Veterinary Medicine, 

Warsaw University of Life Sciences, Warsaw, Poland 

3 Laboratory of Molecular Parasitology, W. Stefanski Institute of Parasitology PAS, Warsaw, Poland 

4 Laboratory of Molecular Biology, Mabion Ltd., Łódź, Poland 

Received 7 February 2011, revised 30 June 2011, accepted 10 July 2011 

Introduction 

The protozoan parasite Giardia intestinalis infects 

vertebrates including humans, domestic and wild animals. 

This parasite can cause gastrointestinal infections 

ranging from mild to severe as well as chronic diseases. 

Giardia is one of the most common causes of diarrhoea 

in humans and the most frequent parasite of companion 

animals. Usually symptoms occur in six to fifteen 

days after infection. In the acute stage symptoms can 

last from two to four days, and after that a chronic phase 

can appear and can last from a few weeks to several 

years. However the disease is usually self-limiting and 

asymptomatic infections are common (Flanagan, 1992; 

Farthing, 1997; Singer and Nash, 2000; Adam, 2001). 

The potential health risk to humans from gastrointestinal 

parasites remains a significant problem throughout 

the world (Schantz, 1994). The main origin of infection 

is water contaminated with Giardia cysts (Karanis et al., 

2007). However, food, especially raw vegetables, may be 

also contaminated with Giardia cysts. In addition, infection 

may be transmitted by direct person-to-person or 

person-to-animal contact, especially in communities 

Abstract 

Giardia intestinalis is a complex species divided into 7 assemblages (A – G). Two of them (A and B) are infective for both humans and 

animals. In cats four assemblages can occur: A, B, D, and F. Assemblages A and B infect either cats, dogs and humans, assemblage D infects 

cats and dogs and assemblage F only cats. The purpose of this study was to determine the prevalence and genotypes of G. intestinalis in cats 

from Warsaw. From November 2006 to March 2007 a hundred sixty samples of stool were collected and examined by light microscopy. 

G. intestinalis cysts were detected in 3.75% of samples. DNA extracted from positive samples was used as template for PCR-RFLP using 

Giardia specific primers and the amplicons were sequenced. A comparison of the obtained DNA sequences with the Giardia sequences in 

the GeneBank database revealed assemblage A in 1.25% of the investigated cats, assemblage B in 1.25% and D in 1.25%. 

K e y w o r d s: Giardia intestinalis, assemblage in cats, genotype, PCR-RFLP, zoonosis 

with poor standards of hygiene (Hunter and Thompson, 

2005). The prevalence of human giardiosis in the world 

ranges from 0.004% to almost 100%, and the most 

prevalent infections are detected in children < 2 years in 

developing countries. The mean prevalence in Europe, 

North America and Australia is 0–32%, depending 

on region and age group. In Poland the prevalence of 

Giardia infection observed in humans is 0.04–9%, but 

children are infected more frequently than adults. In 

cats the prevalence of infection observed in the world 

is 0.6 to 80%, but in Poland the prevalence is rather low 

(1.3%). However only a few studies were performed 

(Zygner and Wędrychowicz 2008; Bajer et al., 2009). 

The species G. intestinalis includes seven assemblages 

A-G, that can be characterized using, for 

example, the glutamate dehydrogenase (gdh), smallsubunit 

(SSU) rRNA, and triosephosphate isomerase 

(tpi) genes (Monis et al., 1999; van Keulen et al., 2002; 

Read et al., 2004; Caccio et al., 2005; Papini et al., 2007). 

Assemblages A and B infect humans and other hosts, 

including cats (Monis et al., 1998; Monis et al., 1999; 

Thompson et al., 2000; van Keulen et al., 2002; Monis 

et al., 2003). Assemblage C infects only dogs, D infects 

* Corresponding author: D. Jaros, Division of Parasitology and Parasitic Diseases, Department of Preclinical Sciences, Faculty of 

Veterinary Medicine, Warsaw University of Life Sciences; Ciszewskiego Str. 8, 02-786 Warsaw, Poland; phone +48 22 5936044; fax +48 22 593648; 

e-mail: djaros@cbm.pan.pl

260 

dogs and cats and assemblage F infects cats alone 

(Santíni et al., 2006; Souza et al., 2007; Palmer et al., 

2008). Zoonotic transmission of G. intestinalis is still 

under consideration despite increasing knowledge of 

the molecular identification of Giardia from different 

hosts (Monis et al., 2003; Thompson, 2004; Hunter and 

Thompson, 2005). Although Majewska (1994) showed 

zoonotic potential of Giardia, the reservoir of infection 

for humans is still unknown. In Poland assemblages A 

and B were detected in faecal samples from humans. 

However, in that study Giardia cysts were not detected 

in humans who had had permanent contact with animals 

(Solarczyk et al., 2010). 

The aim of this study was to analyse the genetic 

diversity of Giardia isolates from clinical cases among 

cats in Warsaw, Poland by gdh PCR-(RFLP) assay and 

the single gdh gene PCR assays. The different sequences 

were used to construct a database so it was possible to 

compare the result of this study with sequences previously 

published and available in the GenBank database. 

Experimental 


Giardia cysts were identified in the Division of 

Parasitology and Parasitic Diseases, Faculty of Veterinary 

Medicine, Warsaw University of Life Sciences. 

Fecal samples were collected from November 2006 to 

May 2007 in the Small Animal Clinic, Department of 

Clinical Sciences, Faculty of Veterinary Medicine, Warsaw 

University of Life Sciences. In total 160 cat stool 

samples were collected. Giardiosis was diagnosed by 

detection of cysts in fecal samples using Meridian 

MeriFluor® Cryptosporidium/Giardia test according to 

manufacturer procedure (Meridian Diagnostics Inc.). 

DNA was extracted from all positive fecal samples 

using a stool extraction kit (QIAamp DNA stool kit, 

QIAGEN). A DNA fragment (about 770 bp) of the gdh 

gene was amplified using PCR-RFLP with primer GDH1 

(5’ ATC TTC GAG AGG ATG CTT GAG 3’) and 

GDH4 (5’ AGT ACG CGA CGC TGG GAT ACT 3’) 

as reported Homan et al. (1998). This method allowed 

to distinguish between assemblages A and B by RFLP 

analysis. Amplification was performed on a total reaction 

volume of 50 μl, containing template DNA and the 

following PCR mixture: 10 × Taq Reaction buffer, 2 mM 

MgCl 2 , 0.2 mM dNTPs, 1.25 units of Taq DNA polymerase 

(Fermentas) and 0.5 μM of each primer. The 

conditions of PCR were as follows: initially 94°C for 

3 min, then 35 cycles of 94°C for 30 s, 56°C for 30 s and 

72°C for 60 s, and finally, after these cycles, 72°C for 

10 min (Homan et al., 1998). The reactions were performed 

in a PTC 200 Thermal Cycler (MJ Research). 

Jaros D. et al. 3 

The PCR products were visualized by electrophoresis 

in 1% agarose gel with ethidium bromide. In all cases, 

the PCR products were gel purified using a gel extraction 

kit (Macherey – Nagel), and sequenced using an 

AbiPrism 3100 and GeneScan Analysis Software. The 

PCR products were sequenced in both directions using 

either GDH1 or GDH4 primers. Results were compared 

with sequences available in the GenBank database. 

The PCR products were purified using a gel extraction 

kit (Macherey – Nagel), and then digested with 

DdeI in a reaction mixture of 2 μl of 10 × buffer, 1 μl of 

DdeI, 5 μl purified PCR products and distilled water 

to a final volume of 20 μl at 37°C for 1 hr. The digested 

mixtures were analysed by electrophoresis in 2% agarose 

gel with ethidium bromide (Homan et al., 1998). 

To be able to amplify and distinguish all assemblages, 

a distinct fragment of the gdh gene (220 bp) was 

amplified. The gdh gene fragment was amplified using 

the forward primer GDHF3 (5’-TCC ACC CCT CTG 

TCA ACC TTT C-3’) and the reverse primer GDHB5 

(5’-AAT GTC GCC AGC AGG AAC G-3’) as reported 

Itagaki et al. (2005). PCR reaction mixtures consisted 

of 0.5 μM of each primer, 0.2 mM of each dNTP, 2 mM 

MgCl 2 , 1 unit of Taq DNA polymerase (Fermentas) and 

10 × Taq Reaction buffer (Fermentas). The reactions 

were performed on a total reaction volume of 25 μl. The 

conditions of the PCR were as follows: initially 94°C for 

3 min, then 35 cycles of 94°C for 30 s, 59°C for 30 s and 

72°C for 30 s, and finally, after all these cycles, 72°C for 

10 min (Itagaki et al., 2005). The reactions were performed 

in a PTC 200 Thermal Cycler (MJ Research). 

The products of PCR were visualized by electrophoresis 

in 2% agarose gel with ethidium bromide. The PCR 

products were gel purified using the same kit mentioned 

above and sequenced using an AbiPrism 3100 

and GeneScan Analysis Software. PCR products were 

sequenced in both directions using either GDHF3 or 

GDHB5. The results were compared with sequences 

available in the GenBank database. 

Results 

Microscopic analysis of the 160 samples proved 

that only 6 (3.75%) were positive for Giardia cysts. In 

PCR-RFLP 770 bp products were obtained (Fig. 1a) in 

4 cases. After RFLP analysis two of them were recognized 

as assemblage A and another two as assemblage B 

(Fig. 1b). A comparison of all four sequences from 

PCR-RFLP with those from the GeneBank database 

allowed to identify them as fragments of G. intestinalis 

gdh gene and confirmed RFLP analysis. The sequencing 

and genotyping of two amplicons (220 bp) obtained 

from PCR using starters GDHF3 and GDHB5 revealed 

assemblage D (Fig. 1c).

3 Detection of G.intestinalis in cats 

261 

Discussion 

Fig. 1A. Detection of Giardia 

ghd gene by PCR-RFLP with 

primers GDH1 and GDH4. 

Lanes: M – 1 kb molecular weight 

marker (Fermentas); 1–4 – cat 

samples 770 bp. 

Fig. 1C. Restriction patterns of gdh 

gene amplified with GDH1 and GDH4. 

Lanes: M, 1 kb molecular weight marker 

(Fermentas); lane 1 izolate (B) from cat. 

The potential risk to human health from G. intestinalis 

infections remains a meaningful problem all over 

the world. Recent studies on parasites of dogs and cats 

have demonstrated that the levels of Giardia infections 

were higher than expected (Johnson and Gasser, 1993; 

Bugg et al., 1999; Itoh et al., 2006). Previous studies on 

feline giardiosis suggested a significant problem for 

human health because of the potential risk for zoonotic 

transmission (Robertson et al., 2000; Thompson 

et al., 2000; van Keulen et al., 2002; Read et al., 2004; 

Thompson, 2004). However, many scientists claimed 

that most cat infections were caused by assemblages 

D or F, non-pathogenic for human (Monis et al., 1998; 

Monis et al., 1999; van Keulen et al., 2002; Monis et al., 

2003). In European countries, the genotypic characterization 

of G. intestinalis infections in cats has received 

little attention and very few isolates have been characterized 

(Berrilli et al., 2004; Lalle et al., 2005; Papini 

et al., 2007). In this study, four out of six Giardia positive 

cats had assemblages A or B potentially pathogenic 

for human. Therefore, the results of this study suggest 

that the population of Warsaw cats may pose a risk to 

Fig. 1B. Restriction patterns of 

gdh gene amplified with GDH1 

and GDH4. 

Lanes: M, 1 kb molecular weight 

marker (Fermentas); lane 1, izolate 

(B) from cat. 

human health because of the possibility of zoonotic 

transmission. 

Feline giardiosis has been found all over the world 

and detection rates in particular regions fluctuate from 

0.58% to 60%. In USA, 0.58% of cats out of 631021 

examined possessed Giardia infection (De Santis-Kerr 

et al., 2006), in Japan 40% of cats were infected out of 

600 examined (Itoh et al., 2006), in Turkey 22.4% of cats 

had it out of 100 examined (Cirak and Bauer, 2004). The 

prevalence may depend to a high degree on the method 

used for diagnosis. For instance, in Australia 5.6% or 

60% of cats out of 40 were reported to be infected, 

using PCR and ELISA respectively (McGlade et al., 

2003). Also, in the Czech Republic 0.74% or 56.9% out 

of 107 investigated cats were found to be infected using 

conventional microscopic techniques or ELISA, respectively 

(Svobodova et al., 1995). These differences result 

from the different specificity and sensitivity of the tests. 

Last study showed that specificity and sensitivity of an 

ELISA test compared with fluorescent antibody test 

amounted 0.96 and 0.51 respectively. However, positive 

predictive value was rather poor at prevalence rates 10% 

or less (Rishniw et al., 2010). Thus, it is highly probable 

that the results of that test may be false positive rather 

than true positive. Moreover, Cirak and Bauer (2004) 

showed that another ELISA test was more often positive 

in microscopically Giardia-negative fecal samples 

in which Isospora spp. oocysts were detected than in 

samples without any parasites. This result may indicate 

cross-reactions in ELISA tests used in animals. 

The sensitivity and specificity of light microscopy 

used in this study highly depends on the experience 

and knowledge of technician or researcher, but PCR 

tests are more objective, highly sensitive and specific 

(Prichard and Tait 2001; Barr, 2006; Allenspach and 

Gaschen, 2008). Nantavisai et al. (2007) showed that 

the sensitivity and specificity of PCR method for detection 

of Giardia DNA is 97.3% (95% confidence interval, 

87.9–99.9%) and 100% (95% confidence interval,

262 

91.3–100%), respectively. However, sensitivities of different 

PCR tests are also variable. This depends on primers 

used for amplification of different target gene locus. 

Nantavisai et al. (2007) showed that PCR test with primers 

compatible for SSU rRNA gene fragment detected 

Giardia DNA in concentration of 10 pg/µl DNA per 

PCR mixture while PCR test with primers compatible 

for Triosephosphate isomerase gene fragment detected 

Giardia DNA in minimal concentration of 1000 pg/µl. 

The primers compatible for glutamate dehydrogenase 

gene fragment used in this study were moderately sensitive. 

This primer set allows to detect Giardia DNA in 

minimal DNA concentration of 1000 pg/µl, but minimal 

Giardia cyst concentration detected by this primer 

set was 337 cysts/ml of fecal sample, while primers 

compatible for Triosephosphate isomerase gene fragment 

allowed to detect Giardia DNA when minimal 

cyst concentration was 3368 cysts/ml. 

The results of this study differ from the results of 

previous studies. In Japan and Australia all or all but 

one cats were infected with non-pathogenic for humans 

assemblage F (Itagaki et al., 2005, Palmer et al., 2008). 

However, in Brazil 42.1% Giardia infections were caused 

by assemblage A, and the remaining cats were infected 

with assemblage F (Souza et al., 2007). In Italy Papini 

et al. (2007) detected only assemblage A in all examined 

samples of cat feces. These differences can result from 

the fact that there are few researches on genotyping of 

G. intestinalis infections in cats. The importance of Warsaw 

cats in the transmission of G. intestinalis to humans 

cannot be finally evaluated because of the small number 

of positive samples. However, the results of this work 

and that from Brazil (Souza et al., 2007) show there 

is a potential risk of human infection. Therefore, it is 

necessary to assume that a cat infected with Giardia 

possesses potentially zoonotic assemblages. 

Literature 

Adam R.D. 2001. Biology of Giardia lamblia. Clin. Microbiol. 14: 

447–475. 

Allenspach K. and F.P. Gaschen 2008. Small Intestinal Disease, 

pp.187–202. In: Steiner J.M. (ed). Small Animal Gastroenterology. 

Schlütersche Verlagsgesellschaft mbH & Co.KG, Hannover. 

Bajer A., M. Bednarska and E. Siński. 2009. Twenty years of 

Crypto sporidium spp. and Giardia spp. investigations in Poland (in 

Polish). Wiad Parazytol 55: 301–304. 

Barr S.C. 2006. Giardiasis, pp. 736–742. In: Greene C.E. (ed). Infectious 

Diseases of the Dog and Cat. Saunders Elsevier, St. Louis, M.O. 

Berrilli F., D. Di Cave, C. D’Orazi, P. Orecchia, L. Xhelilaj, 

D. Bejko, P. Caça, D. Bebeci, F. Cenko, D. Donia and others. 2004. 

Prevalence and genotyping of human isolates of Giardia duodenalis 

from Albania. Parasitol. Int. 55: 295–297. 

Bugg R.J., I.D. Robertson, A.D. Elliot and R.C.A. Thompson. 

1999. Gastrointestinal parasites of urban dogs in Perth, Western 

Australia. Vet. J. 157: 295–301. 

Jaros D. et al. 3 

Caccio S.M., R.C.A. Thompson, J. McLaughlin and H.V. Smith. 

2005. Unravelling Cryptosporidium and Giardia epidemiology. 

Trends. Parasitol. 21: 430–437. 

Cirak V.Y. and C. Bauer. 2004. Comparison of conventional coproscopical 

methods and commercial coproantigen ELISA kits for the 

detection of Giardia and Cryptosporidium infections in dogs and 

cats. Berl. Munch. Tierarztl. Wochenschr. 117: 410–413. 

De Santis-Kerr A.C., M. Raghavan, N.W. Glickman, R.J. Caldanaro, 

G.E. Moore, H.B. Lewis, P.M. Schantz and L.T. Glickman. 

2006. Prevalence and risk factors for Giardia and coccidia species 

of pet cats in 2003–2004. J. Feline. Med. Surg. 8: 292–301. 

Farthing M.J. 1997. The molecular pathogenesis of giardiasis. 

J. Pediatr. Gastroenterol. Nutr. 24: 79–88. 

Flanagan P.A. 1992. Giardia – diagnosis, clinical course and epidemiology. 

Epidemiol. Infect. 109: 1–22. 

Homan W.L., M. Gilsing, H. Bentala, L. Limper and F. van Knapen. 

1998. Characterization of Giardia duodenalis by polymerase-chainreaction 

fingerprinting. Parasitol. Res. 84: 707–714. 

Hunter P.R. and R.C.A. Thompson. 2005. The zoonotic transmission 

of Giardia and Cryptosporidium. Int. J. Parasitol. 35: 1–10. 

Itagaki T., S. Kinoshita, M. Aoki, N. Itoh, H. Saeki, N. Sato, J. Uetsu ki, 

S. Izumiyama, K. Yagita and T. Endo. 2005. Genotyping of Giardia 

intestinalis from domestic and wild animals in Japan using glutamete 

dehydrogenase gene sequencing. Vet. Parasitol. 144: 283–287. 

Itoh N., N. Muraoka, J. Kawamata, M. Aoki and T. Itagaki. 2006. 

Prevalence of Giardia intestinalis infection in household cats of 

Tohoku District in Japan. Parasitology 68: 161–163. 

Johnson J. and R.B. Gasser. 1993. Copro-parasitological survey of 

dogs in South-Victoria. Aust. Vet. Pract. 23: 127–131. 

Karanis P., C. Kourenti and H. Smith. 2007. Waterborne transmission 

of protozoan parasites: a worldwide review of outbreaks and 

lessons learnt. J. Water. Health. 5: 1–38. 

Lalle M., E. Pozio, G. Capelli, F. Bruschi, D. Crotti and S.M. Cacciò. 

2005. Genetic heterogeneity at the beta-giardin locus among 

human and animal isolates of Giardia duodenalis and identification 

of potentially zoonotic subgenotypes. Int. J. Parasitol. 35: 207–213. 

Majewska A.C. 1994. Successful experimental infections of a human 

volunteer and Mongolian gerbils with Giardia of animal origin. 

Trans. R. Soc. Trop. Med. Hyg. 88: 360–362. 

McGlade T.R., I.D. Robertson, A.D. Elliot and R.C. Thompson. 

2003. High prevalence of Giardia detected in cats by PCR. Vet. Parasitol. 

110: 197–205. 

Monis P.T., R.H. Andrews, G. Mayrhofer, J. Mackrill, J. Kulda, 

J.L. Isaac-Renton and P.L. Ey. 1998. Novel lineages of Giardia intestinalis 

identified by genetic analysis of organisms isolated from dogs 

in Australia. Parasitology 116: 7–19. 

Monis P.T., R.H. Andrews, G. Mayrhofer and P.L. Ey. 1999. Molecular 

systematics of the parasitic protozoan Giardia duodenalis. Mol. 

Biol. Evol. 16: 1135–1144. 

Monis P.T., P.T. Andrews, G. Mayrhofer and P.L. Ey. 2003. Genetic 

diversity within the morphological species Giardia intestinalis and 

its relationship to host origin. Infect. Genet. Evol. 3: 29–38. 

Nantavisai K., M. Mungthin, P. Tan-ariya, R. Rangsin, T. Naaglor 

and S. Leelayoova. 2007. Evaluation of the Sensitivities of DNA 

Extraction and PCR Methods for Detection of Giardia duodenalis 

in Stool Specimens. J. Clin. Microbiol. 45: 581–583. 

Papini R., G. Cardini, B. Paoletti and A. Giangaspero. 2007. 

Detection of Giardia assemblage A in cats in Florence, Italy. Parasitol. 

Res. 100: 653–656. 

Palmer C.S., R.J. Traub, I.D. Robertson, G. Devlin, R. Rees and 

R.C. Thompson. 2008. Determining the zoonotic significance of 

Giardia and Cryptosporidium in Australian dogs and cats. Vet. Parasitol. 

154: 142–147. 

Prichard R. and A. Tait. 2001. The role of molecular biology in 

veterinary parasitology. Vet Parasitol 98: 169–194.

3 Detection of G.intestinalis in cats 

263 

Read C.M., P.T. Monis and R.C.A. Thompson. 2004. Discrimination 

of all genotypes of Giardia duodenalis at the glutamate dehydrogenase 

locus using PCR-RFLP. Infect. Genet. Evol. 4: 125–130. 

Rishniw M., J. Liotta, M. Bellosa, D. Bowman and K.W. Simpson. 

2010. Comparison of 4 Giardia Diagnostic Tests in Diagnosis of 

Naturally Acquired Canine Chronic Subclinical Giardiasis. J. Vet. 

Intern. Med. 24: 293–297. 

Robertson I.D., P.J. Irwin, A.J. Lymbery and R.C. Thompson. 

2000. The role of companion animals in the emergence of parasitic 

zoonoses. Int. J. Parasitol. 30: 1369–1377. 

Santíni M., J.M. Trout, J.A. Vecino, J.P. Dubey and R. Fayer. 2006. 

Cryptosporidium, Giardia and Enterocytozoon bieneusi in cats from 

Bogota (Colombia) and genotyping of isolates. Vet. Parasitol. 141: 

334–339. 

Schantz P.M. 1994. Of worms, dogs and human hosts: continuing 

challenges for veterinarians in prevention of human disease. J. Am. 

Vet. Med. Assoc. 204: 1023–1028. 

Singer S.M. and T.E. Nash. 2000. The role of normal flora in Giardia 

lamblia infection in mice. J. Infect. Dis. 181: 1510–1512. 

Solarczyk P., A. Werner and A.C. Majewska. 2010. Genotyping hu- 

man isolates from west-central Poland. Wiad. Parazytol. 56: 171–177. 

Souza S.L.P., S.M. Gennari, L.J. Richtzenhain, H.F. Pena, 

M.R. Funada, A. Cortez, F. Gregori and R.M. Soares. 2007. Molecular 

identification of Giardia duodenalis isolates from humans, dogs, 

cats and cattle from the state of São Paulo, Brazil, by sequence analysis 

of fragments of glutamate dehydrogenase (gdh) coding gene. Vet. 

Parasitol. 149: 258–264. 

Svobodova V., M. Svoboda and J. Konvalinova. 1995. Comparison 

of the detection of Giardia intestinalis cysts with the presence of 

specific antibodies in dogs and cats. Vet. Med. 40: 141–146. 

Thompson R.C.A., R.M. Hopkins and W.L. Homan. 2000. Nomenclature 

and genetic groupings of Giardia infecting mammals. Parasitol 

Today 16: 210–213. 

Thompson R.C.A. 2004. The zoonotic significance and mole- 

cular epidemiology of Giardia and giardiasis. Vet. Parasitol. 126: 

15–35. 

van Keulen H., P.T. Macechko, S. Wade, S. Schaaf, P.M. Wallis and 

S.L. Erlandsen. 2002. Presence of human Giardia in domestic, farm 

and wild animals, and environmental samples suggests a zoonotic 

potential for giardiasis. Vet. Parasitol. 108: 97–107. 

Zygner W. and H. Wędrychowicz. 2008. Animals as giardiasis reservoir 

for humans (in Polish). Post. Mikrobiol. 47: 287–291.



SHORT COMMUNICATION 

Evaluation of a Rapid Culture-Based Screening Test for Detection 

of Methicillin resistant Staphylococcus aureus 

BOUSHRA FWITY 1 , RALF LOBMANN 2 and ANDREAS AMBROSCH 1 * 

1 Institute of Laboratory Medicine and Microbiology, St.Joseph Hospital, Bremerhaven, Germany 

2 Dept. of Endocrinology, Diabetology and Geriatrics, Stuttgart General Hospital, Germany 

Received 22 November 2010, revised 4 May 2011, accepted 24 May 2011 

Active screening and compliance to appropriate 

infection control activities have been shown to play an 

important role in the control of MRSA (Kluytmans, 

2007). Rapid diagnostic tests have the potential to make 

efforts even more effective. Thus, infection prevention 

has taken a step forward with the introduction of various 

tests for rapid identification of MRSA carriers and 

infections (Harbarth et al., 2006). However, a variety of 

increasingly sophisticated DNA-based tests have been 

developed to detect MRSA more rapidly (Francois et al., 

2003; Huletsky et al., 2004). Most of these assays are 

based on the detection of Staphylococcus aureus specific 

sequences and the mecA gene. Despite the technical 

improvements in molecular based assays, their 

high cost and relatively high operator skill requirement 

remains obstacle to their widespread routine use. In 

addition, in a metaanalysis of ten studies on the effect 

of MRSA detection by rapid molecular screening tests 

compared to culture alone, no evidence was found on 

the effect of rapid testing on hospital-acquired MRSA 

infections and acquisition rate (Tacconelli et al., 2009). 

However, one problem might be the high sensitivity 

by amplification of bacterial sequences leading to an 

overestimation of MRSA colonization. This is assay 

immanent, since bacterial sequences were detected and 

not viable strains. 

The present study describes the evaluation of a commercially 

available rapid culture based test – the Baclite 

Rapid MRSA test – which has been developed to detect 

Abstract 

The performance of a culture based assay, BacLite Rapid MRSA for the rapid detection (5 hours) of methicillin resistant Staphylococcus 

aureus (MRSA) from specimens (n = 377) obtained from nares, throat, wounds and perineum was investigated. Compared to culture based 

reference methods (chromogenic MRSA ID (bioMerieux)), selective enrichment broth, PBP2’ latex agglutination (Oxoid) and VITEK 2 

identification (bioMerieux), an overall sensitivity of 71% with a 82% specificity and a negative predictive value (NPV) of 95% was provided. 

The Baclite test is rapid and easy to use and has the advantage of a culture-based detection method for MRSA. 

K e y w o r d s: Baclite Rapid MRSA test, chromogenic agar, test evaluation 

ciprofloxacin resistant MRSA strains within 5 hours. 

This new test was compared to a second generation 

chromogenic agar media combined with a selective 

enrichment broth for detection of viable MRSA. Sensitivities 

and specificities of the reference method were 

nearly that found for molecular methods (Perry et al., 

2004; Reverdy et al., 2005). 

The Baclite Rapid MRSA test measures Adenylate 

Kinase (AK) activity, which is an essential house 

keeping enzyme found inside all cells, which regulates 

energy provision by catalyzing the equilibrium reaction 

of ATP + AMP → 2 ADP. By supplying purified ADP in 

vitro, the reaction can be driven to generate up to thousands 

ATP molecules per minute. The amplified levels 

of ATP produced during minutes can then be measured 

using the bioluminescence reaction of firefly luciferase. 

In the present assay, AK detection is combined with 

selective broth enrichment, magnetic microparticle 

extraction and selective lyse of S. aureus to add target 

organism specificity. In the extraction step, paramagnetic 

micro-particles coupled with a mouse anti- 

Staphylococcus aureus monoclonal antibody are used 

to capture MRSA. The unbound fraction is removed 

by washing procedures. Capture and washing occur as 

automated steps inside the automated wash module. 

In the lyses step, a reagent containing lysostaphin and 

ADP is added and the S. aureus in the sample lysed to 

release AK. The AK then catalyses the conversion of 

ADP to ATP (Squirrel et al., 2002). 

* Corresponding author: A. Ambrosch, Institute of Laboratory Medicine and Microbiology, Wienerstr. 1, 27568 Bremerhaven; 

phone: 0049-471-4805539; fax: 0049-471-4805668; e-mail dr.ambrosch@josephhospital.de

266 

← 

← 

← 

Up to now, only a few studies were done with the 

Baclite Rapid MRSA assay. One study has dealt with 

its reliability to discriminate MRSA from a well characterized 

S. aureus strain collection (Von Eiff et al., 

2007), and two others analyzing the clinical performance 

for nasal and groin swabs (O’Hara et al., 2007; 

Johnson et al., 2006). However, no data exists on the 

overall sensitivity and specificity of this new assay for 

the detection of MRSA from swabs obtained from the 

perineum and the side of chronic wound infection. 

This is of interest, since national hygiene guidelines 

for the surveillance of MRSA also provide swabbing 

of the perineum and chronic ulcers as potential sides 

of MRSA colonization. These sides have the diagnostic 

disadvantage of a high density of multiple microbial 

bystanders potentially interfering with the sensitivity 

or specificity of culture based MRSA tests. 

In the present study, swabs were collected from the 

anterior nares (n = 143), the throat (43), the perineum 

(113) and chronic ulcers (78). All swabs (cotton swabs 

with non-charcoal Amies transport medium, bioMerieux, 

La Balme Les Grottes, France) were taken as part 

of routine screening for MRSA colonization or infection 

according to the German national guideline for 

the infection control policies (www.rki.de). Specimens 

were transported rapidly and tested on the same day of 

sampling. Two single swabs from each site were elected, 

one for the Baclite Rapid MRSA assay and the second 

one for the culture reference methods. 

A flow diagram of the processing protocol for swabs 

is depicted in Fig. 1: one swab sample was first spread 

on chromogenic MRSA ID medium (bioMerieux) and 

then washed out in a selective MRSA-Ident bouillon 

containing cefoxitine/sulbactam (Heipha). After incubation 

at 37°C for 18–24 hours, green colonies on MRSA 

agar were regarded as presumptive S. aureus isolates. 

Fwity B. et al. 3 

← 

← 

← 

Fig. 1. The diagnostic algorithm for the identification of MRSA: inoculation of swabs to Baclite Rapid MRSA assay 

compared to chromogenic MRSA ID agar and the subsequent procedure. 

The selective broth was plated on chromogenic MRSA 

ID and then incubated for an addition 24 h to increase 

sensitivity for detection of MRSA. S. aureus isolates 

were confirmed and identified using the PBP2’ latex 

agglutination test (Oxoid), a coagulase test (Oxoid) and 

the Vitek 2 identification and resistance testing system 

(GP card and AST-P554 card, bioMerieux). 

The second set of swabs was processed by the 

Baclite Rapid method according to the manufactures 

instructions. MRSA plates were inoculated first followed 

by the Baclite Rapid MRSA assay within 2 hours 

to avoid processing delay. Positive and negative control 

strains (MRSA and MSSA) were included as procedural 

controls in each run. Swab samples were vortexed in 

the proprietary Baclite selective broth (containing ciprofloxacin 

(6 mg/L) for two times and followed by an 

incubation period for 2.5 h at 37°C. Before the assay 

procedure was continued, the selective broth was subcultured 

on MRSA ID. This was done to evaluate the 

selectivity of the broth and to confirm the results of the 

rapid MRSA assay. However, following the manufactures 

instructions, MRSA were captured and washed 

in the Baclite sample processor. The bound fraction 

was resuspended in the selective broth and aliquots 

of each sample were placed into two adjacent wells of 

a 96 well assay plate. One well of each sample was used 

to determine a baseline signal in the Baclite reader. 

After a further incubation period of 2 hours at 37°C, 

the second well for each sample was processed in the 

same way. The result was determined by subtraction the 

second from the first result and scored automatically as 

positive or negative to a software embedded algorithm. 

Of the 377 surveillance specimens, S. aureus MRSA 

was isolated and confirmed from 49 samples by the reference 

methods. By the Baclite MRSA test, 89 of the 

samples were positive and 288 were detected as nega-

3 Short communication 

267 

Table I 

Comparison of Baclite Rapid MRSA test results with those obtained by reference methods. 

Baclite Rapid MRSA/ref. 

methods 

No of positive 

samples 

All swabs (n=377) 89/49 288/328 71 82 36 95 

From nares / throat (n=186) 38/27 148/159 70 84 43 93 

From chronic wounds (n=78) 25/13 53/65 69 74 33 94 

Perineum (n=113) 26/9 87/104 77 81 27 98 

tive. Since 35 out of the 49 confirmed MRSA samples 

were detected by the Baclite assay, 14 results were 

defined as false negative and 40 as false positive. From 

these data, a diagnostic sensitivity of 71%, a specificity 

of 82%, positive and negative predictive values (PPV 

and NPV) of 47% and 95%, respectively, were calculated 

from all sample results (Table I). Specificity, sensitivity, 

PPV and NPV for nares, chronic wounds and 

perineum were also calculated and given in Table I. The 

statistical performance of the test did not depend on 

the side of swabbing. 

However, in 12 samples defined as MRSA negative 

by the reference methods, MRSA was confirmed, 

when the enriched Baclite broth was subcultured onto 

MRSA ID agar. When these samples were included in 

the statistical performance of the Baclite MRSA test, 

an overall sensitivity of 77% with a specificity of 87% 

was calculated for the new MRSA assay. 

Hospitals and other health care facilities across 

the world are faced with alarming rates of infections 

caused by MRSA. Continuous spread of this pathogen 

requires efficient strategies for infection control, 

moreover since a 16-times higher transmission rate 

was suggested for MRSA carriers which are not subjected 

to contact isolation (Jernigan et al., 1996). However, 

conventional screening methods – as shown in 

the present study – require prolonged incubation and 

confirmatory testing up to 48 hours. During this time 

MRSA negative patients may be held in unnecessary 

isolation, whereas unidentified MRSA-positive individuals 

remain a hidden reservoir for cross-infection. 

To reduce the time taken for this evaluation, wards were 

selected (e.g. patients with previously reported MRSA 

in the last 3 months, chronic ulcers, antibiotic use in the 

last month) thus increasing the apparent prevalence of 

MRSA in the hospital. In this context, rapid identification 

or exclusion of MRSA colonization is essential for 

the effective control of MRSA. The majority of MRSA 

screening is carried out in clinical microbiological laboratories 

using culture based methods with or without 

prior broth enrichment. Broth based enrichment 

media enhance test sensitivity (Nahimana et al., 2006; 

Nonhoff et al., 2009), but adds an extra day to testing. 

As in the present study, the chromogenic MRSA ID 

No of negative 

samples 

PPV – positive predictive value; NPV – negative predictive value 

Sensitivity 

(%) 

Specificity 

(%) 

PPV 

(%) 

NPV 

(%) 

agar medium supplemented with 4 mg of cefoxitin/L is 

a widely used screening medium for MRSA. Although 

there is no one solid medium that is clearly superior, 

MRSA ID has demonstrated specificities and sensitivities 

of > 90% when compared to mecA PCR (Perry 

et al., 2004; Reverdy et al., 2005). Since an additional 

broth enrichment was used, the sensitivity and specificity 

of the reference methods is suggested to be similar 

to PCR methods. 

Compared to the reference methods, a high NPV 

(95%) of the Baclite Rapid MRSA test was obtained 

allowing negative results to be confidently reported 

within 5 h. In this view, our results are in line with 

the assay evaluation by Johnson et al. (2006) reaching 

a NPV of 98.7% for nasal screening swabs using mannitol 

salt agar plates containing oxacillin (MSAO agar) 

as a reference method. The diagnostic specificity and 

sensitivity for nasal swabs in our study was given with 

70 and 84%, respectively, and therefore lower (94.6% 

and 96.9%, respectively) as published by O’Hara et al. 

(2007). However, as negative samples make up the vast 

majority of MRSA screening tests particular in wards 

with a low MRSA prevalence, the high NPV evaluated 

for the Bacliteassay might represent a significant benefit 

to laboratories and the hygiene management. In 

contrast, in clinical settings with a high MRSA pressure, 

screening methods with a higher sensitivity and PPV 

should be used. 

A useful feature of the assay is that it has been 

designed to retain a sample of the broth containing 

enriched MRSA from which to perform direct sensitivity 

tests and confirm presumptive positive or negative 

results. However, there were 12 Baclite MRSA positive 

samples confirmed by MRSA ID from the enriched 

selective Baclite broth, which were negative by the reference 

method. Although they were classified as “false 

positive” as the results were distinct from the reference 

method, they could not be considered as false positive 

in the usual sense of the term. When these samples were 

included in the statistical performance of the Baclite 

MRSA test, an overall sensitivity of 77% with a specificity 

of 87% was calculated for the new MRSA assay. The 

better performance of the Baclite test in these samples 

compared to the reference might be due to two major

268 

reasons: 1) an overgrowth of commensal organisms on 

the selective reference broth might mask the presence 

of MRSA as also discussed with regard to the selective 

MSAO agar used by Johnson et al. (2006). 2) Distinctive 

quality of swabbing could also be reasonable for test 

variations when two methods are compared (Kljakovic, 

1992; Kingsley and Winfield-Davies, 2003). 

As observed by Johnson et al. (2006) ciprofloxacin 

sensitivity of Staphylococcus aureus usually found 

in community acquired MRSA (CA-MRSA) could be 

a reason for the failed detection by the Baclite assay. 

However, the frequency of CA-MRSA was 1.74% of all 

MRSA isolates in a German study, and therefore far 

less than reported from the USA (Witte et al., 2007). 

In general, ciprofloxacin supplemented medium seem 

to be a useful method for the detection of ciprofloxacin 

resistant MRSA. As shown by Davies and Zadik (1996), 

ciprofloxacin (8 mg/L) supplemented Baird-Parker 

medium (BPC) demonstrated a higher sensitivity for 

selection of MRSA than methicillin-supplemented 

mannitol salt agar (MMSA). 

The material costs of the Baclite are near to 15 EURO 

per single test, which is higher than a culture based 

method (around 1 EURO), but lower than commercial 

molecular based tests (> 20 EURO) (Tacconelli et al., 

2009). The Baclite test requires a relative low level of 

expertise and can be performed by a trained laboratory 

assistant, whereas the skill mix required to operate 

a PCR system may not be readily available in the 

diagnostic laboratory. 

Taken together, we report a non molecular MRSA 

screening test, which is useful for the detection of MRSA 

from nares, throat, chronic wounds and perineum 

within 5 h and retains the advantages of a culture-based 

method. However, since the test has a high NPV of 95% 

but is less sensitive and specific for the detection of ciprofloxacin 

resistant MRSA, the Baclite Rapid MRSA 

test seems to be more useful for wards with a low MRSA 

prevalence. 

Literature 

Davies S. and P.M. Zadik. 1997. Comparison of methods for the 

isolation of methicillin resistant Staphylococuus aureus. J. Clin. 

Pathol. 50: 257–258. 

Diederen B.M.W., M.L. van Leest, I. van Duijn, P. Wilemse, 

P.H.J. van Keulen and J.A. Kluytmans. 2006. Performance of 

MRSA ID, a new chomogenic medium for detection of methicillinresistant 

Staphylococcus aureus. J. Clin. Microbiol. 44: 568–588. 

Francois P., D. Pitet, M. Bento, B. Pepey, P. Vaudaux, D. Lew and 

J. Schrenzel. 2003. Rapid detection of methicillin-resistant Stapyhlococcus 

aureus directly from sterile or non-sterile clinical samples by 

a new molecular assay. J. Clin. Microbiol. 41: 254–260. 

Gurran C., M.G. Holliday, J.D. Perry, M. Ford, S. Morgan and 

K.E. Orr. 2002. A novel selective medium for the detection of methicillin-resistant 

Staphylococcus aureus enabling result reporting in 

under 24 h. J. Hosp. Infect. 52: 148–151. 

Fwity B. et al. 3 

Harbarth S., C. Masuet-Aumatell and J. Schrenzel. 2006. Evaluation 

of rapid screening and pre-emptive contact isolation for detecting 

and controlling methicillin-resistant Staphylococcus aureus in 

critical care: an interventional cohort study. Crit. Care 10: R25. 

Huletsky A., R. Giroux, V. Rossbach, M. Gagnon, M. Vaillancourt, 

M. Bernier and F. Gagnon. 2004. New real time PCR assay 

for rapid detection of methicillin resistant Staphylococcus aureus 

directly from specimens. J. Clin. Microbiol. 42: 1875–1884. 

Jernigan J.A, M.G. Titus, D.H. Gröschel, S. Getchell-White and 

B.M. Farr. 1996. Effectiveness of contact bisolation during hospital 

outbreak of methicillin-resistant Staphylococcus aureus. Am. J. Epidemiol. 

143: 496–504. 

Johnson G., M.R. Millar, S. Matthews, M. Skyrme, P. Marsh, 

E. Barringer, S.O’Hara and M. Wilks. 2006. Evaluation of BacLite 

Rapid MRSA, a rapid culture based screening test for the detection 

of ciprofloxacin and methicillin resistant S. aureus (MRSA) from 

screening swabs. BMC Microbiology 6: 83–88. 

Kingsley A.M. and A. Winfield-Davies. 2003. Audit of wound 

swab sampling: why protocols could improve practice. Prof. Nurse 

18: 338–343. 

Kljakovic M. 1992. The quality of a laboratory test in general practice: 

the throat swab example. N.Z. Med. J. 105: 355–357. 

Kluytmans J. 2007. Control of methicillin-resistant Staphylococcus 

aureus (MRSA) and the value of rapid tests. J. Hosp. Infect. 65: 

Suppl. 2, 100–104. 

Nahimana I., P. Francioli and D.S. Blanc. 2006. Evaluation of three 

chromogenic media (MRSA-ID, MRSA-select and CHROMagar 

MRSA) and ORSAB for surveillance cultures of methicillin-resistant 

Staphylococcus aureus. Clin. Microbiol. Infect. 12: 1168–74. 

Nonhoff C., O. Denis, A. Brenner, P. Buidin, C. Thiroux, 

M. Dramaix and M.J. Struelens. 2009. Comparison of three chromogenic 

media and enrichment broth media for the detection of 

methicillin-resistant Staphylococcus aureus from mucocutaneus 

screening specimens: comparison of MRSA chromogenic media. 

Eur. J. Clin. Microbiol. Inf. Dis. 28: 363–9. 

O’Hara S., S. Gregory and D. Taylor. 2007. Evaluation of the 3M 

Baclite Rapid MRSA test for the direct detection of MRSA from 

nasal and groin surveillance specimens. Abstract of the Annual 

Meeting of the Infectious Disease Society of America, San Diego, 

CA, A540, 162–163. 

Perry J.D., A. Davies, L.A. Butterworth, A.L.J. Hopley, A. Nicholson 

and F. K. Gould. 2004. Development and evaluation of a chromogenic 

agar medium for methicillin-resistan)t Staphylococcus 

aureus. J. Clin. Micobiol. 4: 4519–4523. 

Reverdy M.E., S. Orenga, J.M. Roche, S. Delorme and J. Etienne. 

2005. Multiresistant bacteria screening: clinical evaluation of MRSA ID, 

a new chromogenic medium for the screening of methicillin-resistant 

Staphylococcus aureus. abstr. P1383, 15 th European Congress 

Clin. Microbiol. Infec. Dis. 2005, ECCMID Copenhagen Denmark 

Squirrel D.J., M.J. Murphy, R.L. Leslie and J.C.D. Green. 2002. 

A comparison of ATP and adenylate kinase as bacterial cell markers: 

correlation with agar plate counts pp. 115–.123. In: R.A. Stanley and 

L.J. Kricka (eds). 2002. Bioluminescence and chemiluminescence 

progress and current applications. John Wiley and Sons. 

Tacconelli E, G. De Angelis, M.A. Cataldo, G. La Torre and 

R. Cauda. 2009. Rapid screening tests for methicillin-resistant 

Staphylococcus aureus at hospital admission: a systematic review 

and meta-analysis. Lancet Inf. Dis. 9: 546–54. 

Von Eiff C., D. Maas, G. Sander, A.W. Friedrich, G. Peters and 

K. Becker. 2007. Microbial evaluation of a new growth based 

approach for rapid detection of methicillin resistant Staphylococcus 

aureus. J. Antimicrob. Chemother. 61: 1277–1280. 

Witte W., C. Braulke and B. Strommenger. 2007. Methicillin resistant 

Staphylococcus aureus containing the Panton-Valentine leucocidin 

gene in Germany in 2005 and 2006. J. Antimicrob. Chemotherap. 

60: 1258–1263.



SHORT COMMUNICATION 

Inhibition of Fibroblast Apoptosis by Borrelia afzelii, Coxiella burnetii 

and Bartonella henselae 

TOMASZ CHMIELEWSKI* and STANISŁAWA TYLEWSKA-WIERZBANOWSKA 

Laboratory of Rickettsiae, Chlamydiae and Spirochetes, National Institute of Public Health 

– Natonal Institute of Hygiene, Warsaw, Poland 

Apoptosis is a genetically controlled mechanism of 

cell death involved in the regulation of tissue homeostasis. 

It has been found that some viral, bacterial and 

parasitic pathogens affect the viability of the host cell, 

inhibiting or promoting apoptosis (Carmen et al., 2006; 

Clifton et al., 1998; Fischer et al., 2004; Radulovic et al., 

2002). In this process, activation of mediators called 

caspases plays a key role in the destruction phase of 

cell apoptosis. At least 13 different caspases have been 

identified, which belong to three different subfamilies, 

depending on their substrate specificity. 

Caspase 3 is a cytosolic protein found in cells as an 

inactive 32 kDa proenzyme, and it is activated by various 

death signals into 20 kDa (p20) and 11 kDa (p11) 

active subunits. Both subunits contribute to substrate 

binding and catalysis. This protein cleaves and activates 

caspases 6, 7, and 9; moreover the protein itself is processed 

by caspases 8, 9, and 10 (Gołąb 2009). 

The aim of our studies was to investigate the influence 

of Borrelia afzelii, Coxiella burnetii, and Bartonella 

henselae bacteria on apoptosis measured as the level of 

caspase 3 activity in human fibroblast cells. 

A suspension of B. henselae bacterial cells (ATCC 

49882) used for evaluations was obtained by growing 

on chocolate agar containing 5% defibrinated sheep 

blood in a humid atmosphere with 5% CO 2 at 35°C 

and harvested after 5 days when bacterial growth was 

sufficient. A final inoculum of 10 6 cfu/spot was used 

for inoculation in HEL-299 (Dörbecker et al., 2006). 

Received 2 June 2011, accepted 10 July 2011 

Abstract 

Apoptosis is a genetically controlled mechanism of cell death involved in the regulation of tissue homeostasis. The aim of this study was to 

investigate the influence of Borrelia afzelii, Coxiella burnetii, and Bartonella henselae bacteria on apoptosis measured as the level of caspase 3 

activity in human fibroblast cells HEL-299. Our findings show that C. burnetii bacteria may inhibit the process of apoptosis in the host cells 

for a long time. This can permit intracellular survival in the host and mediatingthe development of chronic disease. 

Key words: Borrelia afzelii, Coxiella burnetii, Bartonella henselae, fibroblasts, apoptosis 

Borrelia afzelii strain VS 461 (ATCC 51567) was grown 

at 35°C in BSK-H Medium Complete (Sigma-Aldrich, 

USA) to a cell density of 10 7 /ml (Pollack et al., 1993). 

C. burnetii (strain Henzerling) was cultured in 

HEL-299 (ATCC-CCL-137) human fibroblast cells 

in shell-vials containing 5 ml of Eagle’s Minimum 

Essential Medium (EMEM) medium with Earle’s BSS, 

2 mM L-glutamine and supplemented with 5% fetal 

bovine serum for 14 days. Cells were infected with 

the supernatant containing C. burnetii to a fresh monolayer 

and incubated in 5% CO 2 atmosphere at 35°C 

(Raoult et al., 1990). 

HEL-299 – human fibroblasts cells (ATCC-CCL-137) 

were cultured in shell-vials (Bibby Sterilin, Staffordshire, 

United Kingdom) containing 2 ml of EMEM with 

Earle’s BSS, 1 mM sodium pyruvate, 2 mM L-glutamine 

(ATCC, Manassas, Canada) and supplemented with 

5% fetal bovine serum. After two days the cells were 

infected with 100 μl C. burnetii, B. henselae and B. afzelii 

cultures. As a control, uninfected HEL299 cells were 

tested. Both infected and uninfected cells were incubated 

in 5% CO 2 atmosphere at 35°C. 

The course of human fibroblast apoptosis was evaluated 

by determination of caspase-3 activity at the same 

time in infected cell cultures after six hours post infection, 

on 7 th , 14 th 21 st and 28 th day of infection. All tests 

were run in triplicate. 

The presence of enzyme activity in cells lysates was 

determined with a Human Caspase-3 Instant ELISA 

* Corresponding author: T. Chmielewski, National Institute of Public Health – National Institute of Hygiene, ul. Chocimska 24, 

00-791 Warszawa; phone: 022-5421261; e-mail: tchmielewski@pzh.gov.pl

270 

(Bender MedSystems, Austria) according to the manufacturer’s 

protocol. Infected and uninfected cells adhering 

to cover slips in shell-vials were washed twice with 

PBS. Cells were incubated 60 minutes at room temperature 

with gentle shaking in lysing buffer (Lysis buffer, 

Bender MedSystems, Austria), then centrifuged 

at 1000 g for 15 minutes. Supernatants were stored at 

–80°C and assayed at the same time. Absorbance of 

each sample was measured in duplicate on spectrophotometer 

at wavelength 450 nm. Concentration was 

calculated from a standard curve, created by plotting 

the mean absorbance for each standard concentration. 

Data were compared with the Mann-Whitney’s statistical 

test, and p-value less than 0.05 (level of significance) 

was considered statistically significant. Calculations 

were performed using the statistical package R 

Development Core Team, 2011 (Vienna, Austria). 

Caspase 3 activity in HEL299 cell line infected with 

B. afzelii, B. henselae and C. burnetii was compared. 

During 28 days a slight increase from 0.43 to 0.48 ng/ml 

was detected in uninfected cells. 

In cells infected with B. afzelii strain, the initial level 

of caspase 3 activity was 0.43 ng/ml. It showed a steady 

increase from 0.41 ng/ml, 0.44 ng/ml, 0.55 ng/ml to 

0.56 ng/ml on 7 th , 14 th , 21 st and 28 th days after infection, 

respectively. 

In cell cultures infected with B. henselae strain, 

a decrease of caspase-3 activity was observed, from 

0.45 ng/ml on the first day of infection to 0.34 ng/ml 

and 0.36 ng/ml after 7 and 14 days, followed by an 

increase to 0.48 ng/ml and 0.49 ng/ml after 21 and 

28 days of incubation. 

In cell culture inoculated with C. burnetii a decrease 

in the level of the enzyme activity from 0.45 ng/ml on 

the 1 st day to the level of 0.35 ng/ml on 7 th day and 

0.31 ng/ml on 14 th day was observed. After 21 and 

Chmielewski T. and Tylewska-Wierzbanowska S. 3 

Table I 

Levels of caspase 3 activity (ng/ml) in cultures HEL 299 infected 

with Bartonella henselae, Borrelia afzelii, Coxiella burnetii 

28 days the level stabilized at 0.34 ng/ml and 0.35 ng/ 

ml (Table I). 

Comparing caspase 3 activity levels on the 1 st and 

28 th day, a 17% increase in B. afzelii infected HEL299 

cultures (p = 0.1) and 2% increase in cell cultures 

infected with B. henselae (p = 0.4) was observed, compared 

to uninfected HEL-299. 

In cell culture infected with Coxiella burnetii a 27% 

decrease in caspase 3 activity was detected (p = 0.1). 

The p-values greater than 0.05 and equal or less than 

0.10 may be treated as the border of statistical significance 

due to the small number of tests. 

In the present studies, the process of apoptosis on 

the basis of caspase 3 activity in human fibroblasts in 

vitro was monitored. In C. burnetii infected HEL 299 

caspase activity decreased after 7 days and was 22% 

less after 28 days than the initial level on the first day 

of infection. Inhibition was observed throughout the 

incubation period. At the same time, caspase 3 activity 

increased during four weeks of incubation in uninfected 

cell culture and in cells infected with B. azelii and 

B. henselae (Fig. 1). 

Several reports have described interactions between 

B. burgdorferi bacteria and various host cells. It has 

been shown that the spirochetes can enter mammalian 

immune cells and other cells as well as tick tissue. This 

process allows the pathogen to survive in host tissues, 

to infect them and to escape the host defense (Hu and 

Klempner, 1997; Klempner et al., 1993; Linder et al., 

2001; Peters and Benach, 1997; Sigal 1997; Szczepanski 

et al., 1990; Thomas and Comstock 1989). Our study 

reveals that B. afzelii bacteria have the ability to inhibit 

apoptosis only for a short period of time compared to 

C. burnetii. Electron microscopic studies have revealed 

the consecutive steps of the B. burgdorferi life cycle 

in vitro. The spirochetes penetrate into fibroblasts. 

Caspase 3 activity measured in ng/ml with standard Caspase 3 activity 

Day 

deviation in cultures HEL 299 infected with 

Bartonella Borrelia Coxiella 

measured in ng/ml 

in uninfected 

henselae afzelii burnetii HEL 299 culture 

1 0.45 ± 0.04 0.39 ± 0.04 0.45 ± 0.04 0.43 ± 0.047 

7 0.34 ± 0.04 0.43 ± 0.07 0.35 ± 0.03 0.41 ± 0.04 

( 17%)* ( 5%)* ( 15%)* 

14 0.36 ± 0.06* 0.44 ± 0.03 0.31± 0.03 0.43 ± 0.04 

( 18%) ( 2%)* ( 28%)* 

21 0.48 ± 0.04 0.55 ± 0.04 0.34 ± 0.02 0.46 ± 0.04 

( 4%)* ( 20%)* ( 26%)* 

28 0.49 ± 0.03 0.56 ± 0.04 0.35 ± 0.03 0.48 ± 0.04 

( 2%)* ( 17%)* ( 27%)* 

← 

← 

→ 

→ 

* percentage of increase ( ) or decrease ( ) of caspase 3 activity levels calculated as a ratio 

of the levels in infected to uninfected HEL299 cells 

→ 

→ 

→ → 

→ 

← 

← 

← ← 

←

3 Short communication 

271 

Fig. 1. Caspase 3 activity in uninfected HEL-299 cells and in cells 

infected with B. henselae, B. afzelii and C. burnetii 

They have been observed in the fibroblasts and after 

48 hours they are released to the extracellular space. 

This indicates that they stay in a cell only a short time 

(Chmielewski and Tylewska-Wierzbanowska, 2010). 

Thus, their ability to inhibit apoptosis is limited. 

Bacteria of the genus Bartonella, in the human body 

attach to epithelial cells and in the process of phagocytosis, 

they penetrate into the cells and multiply 

inside. They have an ability to form large aggregates. 

This structure creates perfect conditions for bacterial 

replication, protecting them from the host immune 

defense and degrading enzymes, present in lysosomes. 

Next, these organisms are released into the cytoplasm, 

in which produce and secrete factors stimulatinge cell 

proliferation, activation of pro-inflammatory factors 

and inhibiting apoptosis. After 4 days of infection, 

bacteria are released to the blood stream and penetrate 

into the erythrocytes and multiply intracellularly (Guz 

and Goroszkiewicz, 2009; Kordick et al., 1999). Ability 

to inhibit apoptosis in fibroblast culture in vitro, was 

observed especially between 7 to 14 days of infection. 

C. burnetii after successfully evading host defense 

mechanisms is able to inhibit apoptosis to survive and 

to multiply inside the cells. Inhibition of apoptosis has 

been observed among intracellular pathogens with 

characteristic slow multiplication to establish a productive 

infection. (Carmen et al., 2006; Clifton et al., 

1998; Fischer et al., 2004). C. burnetii infection affects 

the expression of multiple apoptosis-related genes and 

resulting in increased synthesis of the antiapoptotic 

proteins such as A1/Bfl-1 and c-IAP2, prosurvival 

kinases Akt and Erk1/2 (extracellular signal-regulated 

kinases 1 and 2). C. burnetii infection of THP-1 

human macrophage-like cells caused increased levels of 

phosphorylated c-Jun, Hsp27, Jun N-terminal protein 

kinase, and p38 protein. This pathogen can interfere 

with the intrinsic cell death pathway during infection 

by producing proteins that either directly or indirectly 

prevent release of cytochrome c from mitochondria. 

To summarize, these results indicate the importance of 

C. burnetii modulation of host signaling in successful 

intracellular parasitism and maintenance of host cell 

viability (Voth et al., 2007; Voth and Heinzen, 2009; 

Lührmann and Roy 2007). 

C. burnetii is the one of the obligate intracellular 

pathogens that can infect mammalian monocytes and 

macrophages in vivo and can grow in Vero, fibroblast 

and macrophagelike cells in vitro. Our findings show 

that C. burnetii bacteria may inhibit the process of 

apoptosis in the host cells for a long time. It can be 

the crucial pathogenic mechanism which permits the 

pathogen to survive intracellularly in the host and to 

mediate the development of chronic disease. 

C. burnetii has to inhibit host cell death to provide 

a stable, intracellular niche for the course of the pathogen’s 

infectious cycle. In cultures C. burnetii-infected 

cells can be maintained for weeks. 

Literature 

Carmen J.C., L. Hardi and A.P. Sinai. 2006. Toxoplasma gondii 

inhibits ultraviolet light-induced apoptosis through multiple interactions 

with the mitochondrion-dependent programmed cell death 

pathway. Cell Microbiol. 8: 301–315. 

Chmielewski T. and S. Tylewska-Wierzbanowska. 2010. Interactions 

between Borrelia burgdorferi and mouse fibroblasts. Pol. 

J. Microbiol. 59: 157–160. 

Clifton D.R., R.A. Goss, S.K. Sahni, D. van Antwerp, R.B. Baggs, 

V.J. Marder, D.J. Silverman and L.A. Sporn. 1998. NF-kappa 

B-dependent inhibition of apoptosis is essential for host cell survival 

during Rickettsia rickettsii infection. Proc. Natl. Acad. Sci. USA 

95: 4646–4651. 

Dörbecker C., A. Sander, K. Oberle and T. Schülin-Casonato. 

2006 In vitro susceptibility of Bartonella species to 17 antimicrobial 

compounds: comparison of Etest and agar dilution. J. Antimicrob. 

Chemother. 58: 784–788. 

Fischer S.F., J. Vier, S. Kirschnek, A. Klos, S. Hess, S. Ying and 

G. Häcker. 2004. Chlamydia inhibit host cell apoptosis by degradation 

of proapoptotic BH3-only proteins. J. Exp. Med. 200: 905–916. 

Gołąb J. 2009. Immunologia. (in Polish) Wydawnictwo Naukowe 

PWN, Warszawa 

Guz K. and W. Goroszkiewicz. 2009. Biology ecology and pathogenesis 

of Bartonella sp. (in Polish). Post. Mikrobiol. 48, 43–54. 

Hu L.T. and M.S. Klempner. 1997. Host-pathogen interactions 

in the immunopathogenesis of Lyme disease. J. Clin. Immunol. 17: 

354–365. 

Klempner M.S., R. Noring and R.A. Rogers. 1993. Invasion of 

human skin fibroblasts by the Lyme disease spirochete, Borrelia 

burgdorferi. J. Infect. Dis. 167: 1074–1081. 

Kordick D.L., T.T. Brown, K. Shin and E.B. Breitschwerdt. 1999. 

Clinical and pathologic evaluation of chronic Bartonella henselae 

or Bartonella clarridgeiae infection in cats. J. Clin. Microbiol. 37: 

1536–1547.

272 

Linder S., C. Heimerl, V. Fingerle, M. Aepfelbacher and B. Wilske. 

2001. Coiling phagocytosis of Borrelia burgdorferi by primary 

human macrophages is controlled by CDC42Hs and Rac 1 and 

involves recruitment of Wiskott-Aldrich syndrome protein and 

Arp2/3 complex. Infect. Immun. 69: 1739–46. 

Lührmann A. and C.R. Roy. 2007. Coxiella burnetii inhibits activation 

of host cell apoptosis through a mechanism that involves 

preventing cytochrome c release from mitochondria. Infect. Immun. 

75: 5282–5289. 

Peters J.D. and J.L. Benach. 1997. Borrelia burgdorferi adherence 

and injury to undifferentiated and differentiated neural cells in vitro. 

J. Infect. Dis. 176: 470–477. 

Pollack R.J., S.R. Teleford III and A. Spielman. 1993. Standardization 

of medium for culturing Lyme disease spirochetes. J. Clin. 

Microbiol. 31: 1251–1255. 

Radulovic S., Price P.W., Beier M.S., Gaywee J., Macaluso J.A., and 

Azad A. 2002. Rickettsia-macrophage interactions: host cell responses 

to Rickettsia akari and Rickettsia typhi. Infect. Immun. 70: 2576–2582. 

Chmielewski T. and Tylewska-Wierzbanowska S. 3 

Raoult D., G. Vestris and M. Enea. 1990. Isolation of 16 strains of 

Coxiella burnetii from patients by using a sensitive centrifugation 

cell culture system and establishment of the strains in HEL cells. 

J. Clin. Microbiol. 28(11): 2482–2484. 

Sigal L.H. 1997. Lyme disease: a review of aspects of its immunology 

and immunopathogenesis. Ann. Rev. Immunol. 15: 63–92. 

Szczepanski A., M.B. Furie, J.L. Benach, B.P. Lane and B. Fleit. 

1990. Interaction between Borrelia burgdorferi and endothelium in 

vitro. J. Clin. Invest. 85: 1637–1647. 

Thomas D.D. and L.E. Comstock. 1989. Interaction of Lyme disease 

spirochetes with cultured eucaryotic cells. Infect. Immun. 57: 

1324–1326. 

Voth D.E. and R.A. Heinzen. 2009. Sustained activation of Akt and 

Erk1/2 is required for Coxiella burnetii antiapoptotic activity. Infect. 

Immun. 77: 205–213. 

Voth D.E., D. Howe and R.A. Heinzen. 2007. Coxiella burnetii 

inhibits apoptosis in human THP-1 cells and monkey primary 

alveolar macrophages. Infect. Immun. 75: 4263–4271.


2011, Vol. 60, No 3, 273 

Dear Editor, 

I have read the article with great interest by Abou- 

Dobara et al. in the third issue 2010 Polish Journal of 

Microbiology, about antibiotic susceptibility and genotype 

patterns of Escherichia coli, Klebsiella pneumoniae 

and Pseudomonas aeruginosa isolated from patients 

with urinary tract infection (UTI) (Abou-Dobara 

et. al., 2010). UTIs are among the most frequent bacterial 

diseases both in community-acquired and nosocomial 

infections with high morbidity and mortality rates. 

Gram negative bacilli including E. coli, K. pneumoniae 

and P. aeruginosa are encountered as the leading causative 

agents in this disease (Thomas J.G., 2000). The 

antimicrobial resistance patterns of these bacteria are 

important so as to start an appropriate empirical treatment 

in order to avoid complications. In the present 

study although Abou-Dobara et al. aimed to examine 

the antimicrobial susceptibility of the isolates, but there 

are some points conflicting with our classical micro- 

biology knowledge: 

In the article, Abou-Dobara et al. separated P. aeruginosa 

isolates into three patterns; 1. Resistant to amikacin, 

piperacillin/tazobactam, nitrofurantoin (NF), cefotaxime, 

norfloxacin and trimethoprim-sulfametoxazole 

(SXT); 2. Resistant to NF, cefotaxime, norfloxacin and 

SXT; 3. Resistant to NF and SXT. The authors stated that 

they have examined the susceptibility of SXT and NF 

for P. aeruginosa in order to classify this species according 

to antibiotic resistance patterns. However, P. aeruginosa 

is already resistant to SXT due to MexAB-OprM 

porin (Livermore D.M., 2002). Likewise, NF has no 

effect on Pseudomonas spp. (Joseph D.C., et al., 2003). 

In addition, the authors noted that they evaluated the 

antimicrobial susceptibility tests according to National 

Committee for Clinical Laboratory Standards. This 

institution is currently named as “Clinical and Laboratory 

Standards Institute-(CLSI)”, has no recommendations 

for P. aeruginosa about SXT and NF susceptibility 

break points. (CLSI, 2008) On this account SXT and 

NF susceptibilty should not be tested for P. aeruginosa. 

Thereby, the antibiotic pattern classification of P. aeruginosa 

would be in two patterns. 

LETTER TO THE EDITOR 

This letter has been sent to the Editorial Office on January 2011. It concerns with the article of Abou-Dobara MI, 

Deyab MA, Elsawy EM, Mohamed HH. “Antibiotic susceptibility and genotype patterns of Escherichia coli, 

Klebsiella pneumoniae and Pseudomonas aeruginosa isolated from urinary tract infected patients”, published in 

No 3/2010 Polish Journal of Microbiology. It has been passed imediately to the authors of disccussed article asking 

them to respond to the comments. We have never got an answer. 

Secondly, the authors denoted that the have used 

some methods including Gram staining in the division 

of bacterial isolates into three groups – E. coli isolates 

as group 1, K. pneumoniae isolates as group 2, and 

P. aeruginosa isolates as group 3. Owing to the fact that 

all these three species are Gram negative bacilli, Gram 

staining method can not be performed for the differention 

of these bacteria (Ayers L.W. 2000). 

Thirdly, ideally, type cultures of E. coli, K. pneumoniae 

and P. aeruginosa should be used for such 

a study so as to standardize the identification and antimicrobial 

susceptibility tests of these bacteria. 

References 

1. Abou-Dobara M.I., Deyab M.A., Elsawy E.M. and Mohamed H.H. 

2010. Antibiotic susceptibility and genotype patterns of Escherichia 

coli, Klebsiella pneumoniae and Pseudomonas aeruginosa 

isolated from urinary tract infected patients. Pol. J. Microbiol. 

59(3): 207–12. 

2. Ayers L.W. 2000. Microscopic examination of infected materials, 

pp. 261–280. In: Mahon C.R., Manuselis G. (eds). Textbook of 

Diagnostic Microbiology. 2 nd ed. W.B. Saunder Company, USA. 

3. Clinical Laboratory Standarts Institute. 2008. Performance 

Standards for Antimicrobial Susceptibility Testing; Eighteenth 

Informational Supplement. CLSI document M100–S18. Pennsylvania, 

USA. 

4. Joseph D.C., Yao and Robert C., Moellering J.R. 2003. Antibacterial 

agents, pp. 1039–1073. In: Murray P.R., Baron E.J., Jorgensen 

J.H., Pfaller MA., Yolken RH.(eds). Manual of Clinical 

Microbiology. 8 th ed. ASM Press, Washington, D.C. 

5. Livermore DM., 2002. Multiple Mechanisms of Antimicrobial 

Resistance in Pseudomonas aeruginosa: our worst nightmare? 

Clin. Infect. Dis. 34(5): 634–40. 

6. Thomas J.G. 2000. Urinary Tract Infections, pp. 1011–1032. In: 

Mahon C.R., Manuselis G. (eds). Textbook of Diagnostic Microbiology. 

2 nd ed. W.B. Saunder Company, USA. 

Adress for corespondance: 

Malatya State Hospital 

Central Microbiology Laboratory 

44100 Malatya-TURKIYE 

E-mail: selbir@hacettepe.edu.tr 

Phone: 0 90 505 488 13 04 

Fax: 090 422 325 34 38 

Sibel AK, MD 

Clinical Microbiologist

No 3 - Polish Journal of Microbiology

Create successful ePaper yourself

Delete template?

Save as template?