Characterising the CRISPR immune system in Archaea

ABSTRACT
Archaea, a group of microorganisms distinct from bacteria and
eukaryotes, are equipped with an adaptive immune system called
the CRISPR system, which relies on an RNA interference mechanism
to combat invading viruses and plasmids. Using a genome
sequence analysis approach, the four components of archaeal
genomic CRISPR loci were analysed, namely, repeats, spacers,
leaders and cas genes. Based on analysis of spacer sequences it
was predicted that the immune system combats viruses and plasmids
by targeting their DNA. Furthermore, analysis of repeats,
leaders and cas genes revealed that CRISPR systems exist as distinct
families which have key differences between themselves.
Closely related organisms were seen harbouring different CR-
ISPR systems, while some distantly related species carried similar
systems, indicating frequent horizontal exchange. Moreover, it
was found that cas genes of Type I CRISPR systems could be divided
into functionally independent modules which occasionally
exchange to form new combinations of Type I systems. Furthermore,
Type III systems were found to be genomically associated
with various combinations of accessory genes which may play a
role in functionally extending the activity of the Type III interference
complexes. This dynamic nature of the CRISPR immune
systems may be a prerequisite for their continued efficacy against
the ever changing threats they protect their hosts from.
iii

SUMMARY
Archaea comprise a group of microorganisms distinct from both
bacteria and eukaryotes. These organisms are equipped with an
adaptive immune system against invading viruses and plasmids.
The immune system works by taking up DNA from a virus, and
saving it on the host’s own chromosome as a template to produce
interference RNA. The RNA recognises the virus the next time
it infects and signals the degradation of its genetic material. All
the components of this system are encoded on the chromosomes
of the organisms, and by looking into these components using
genome sequence analysis, a number of insights were gained.
It was found that the immune system kills viruses by targeting
their DNA, first and foremost. Furthermore, different archaea
have different variants of the immune system, and most archaea
harbour several variants at the same time, probably to aid them
in targeting different types of viruses. The systems themselves
are composed of independent modules which are responsible for
different stages of the immune response. By combining the modules
in various combinations and extending them with additional
components as well as exchanging them with other archaea, the
organisms ensure that their immune systems are fit to handle
diverse and continuously evolving threats.
iv

SAMMENFATNING
Arkæa udgør en gruppe af organismer som er forskellige fra
både bakterier og eukaryoter. De er udstyrret med et adaptivt
immun system mod invaderende vira og plasmider. Immunsystemet
virker ved at optage virussens DNA, som bliver gemt i
værtens eget kromosom for derved at blive brugt som skabelon
til fremstilling af interferens RNA. RNA’et genkender virussen
næste gang den inficerer, og signalerer derved for nedbrydelsen
af virussens genetiske materiale. Alle immunsystemets komponenter
er indkodet i organismernes DNA, og ved at undersøge
komponenterne gennem genom sekvens analyse blev der gjort
en række opdagelser. Vi fandt ud af at immunsystemet dræber
vira ved først og fremmest at angribe deres DNA. Derudover
har forskellige arkæa forskellige varianter af immun systemet, og
de fleste arkæa besidder flere af varianterne på én gang, hvilket
sandsynligvis hjælper dem med at kunne tackle forskellige typer
vira. Selve immunsystemerne består af uafhængige moduler som
hver især står for forskellige stadier af immun reaktionen. Ved at
kombinere modulerne i forskellige kombinationer eller udvide
dem med yderligere komponenter samt at ombytte dem med
andre arkæa, sikrer organismerne sig at deres immun system
er opdateret til at kunne modstå de forskelligartede trusler som
hele tiden udvikler sig.
v

PREFACE
The work presented in this thesis was carried out at the Danish
Archaea Centre at the Department of Biology, University of
Copenhagen from May 2007 to July 2012 under the supervision
of Professor Roger A. Garrett.
The initial objective of the Ph.D. study was to characterise
the CRISPR immune system in Sulfolobus species using computational
methods, especially comparative genome sequence analysis.
Sulfolobus species have been extensively studied with regard to
the viruses and plasmids which infect them, with many genome
sequences available of hosts as well as their extrachromosomal
elements. Furthermore, Sulfolobus species harbour extensive and
diverse CRISPR immune systems. Thus there was more than
enough data to begin the analyses. After exhausting the possible
ways of analysing CRISPR spacer, repeat, leader and cas gene
sequences from Sulfolobales, the analyses were extended to the
rest of the available archaeal genomes in collaboration with Dr.
Gisle A. Vestergaard starting July 2010. Gisle worked with me on
the project until October 2011 after which I overtook it. Extending
the study to other archaea proved fruitful, but was also a big
mouthful, and these analyses are still in the process of being
completed. Preliminary results have, however, been included in
this thesis, to which especially the last part is dedicated.
The results from this Ph.D. study have been published throughout
many individual research papers, which are all enclosed,
and most of which have multiple co-authors. Therefore the extent
of my own contributions to each of these papers have been
stipulated on the sheet preceding every paper.
For the sake of clarifying the extent of my collaboration with
Dr. Gisle A. Vestergaard and its influence on what is presented
in this thesis, he was deeply involved in all work concerning
the classification of archaeal cas genes into separate functional
modules (aCas, iCas, etc.), and the classification of iCmr modules
into 5 families, A through E. In these studies our workload
was more or less equal. Some aspects of this work is already
published while others remain. As for the analysis of archaeal
CRISPR repeats and leaders, as well as the definition of iCmr
accessory genes, these analyses were conducted by my myself
after Gisle left the project and are still unpublished.
vi

ACKNOWLEDGEMENTS
First and foremost I’d like to thank my supervisor, Professor
Roger A. Garrett. We had many long, inspiring discussions. Also,
with Roger I saw how experience and wisdom go hand in hand.
But most importantly I want to thank him for having patience
and maintaining his trust in me during the challenges which
were faced.
During my Ph.D. I made friends. Chandra, Gisle, Chao and
Ling. Four friends in four years. It’s difficult not to be thankful
for that.
Also, I had the privilege of working in a lab full of absolutely
terrific people. I can’t think of a single exception. Despite many
of us having to deal with our own day-to-day challenges, between
us there was a genuinely positive and understanding atmosphere.
When comparing with most other workplaces you realise that
this is the kind of thing you mustn’t take for granted.
vii

LIST OF TABLES
Table 1 Features of Archaea, Bacteria and Eucarya 6
Table 2 Extremophile record-holders 9
Table 3 Sequenced Sulfolobales genomes 15
Table 4 Properties of Sulfolobus viruses & plasmids 18
Table 5 cas genes and their functions 25
Table 6 Overview of accessory iCmr genes 33
xi

LIST OF FIGURES
Figure 1 Haeckel’s tree of life 2
Figure 2 16S-RNA universal phylogenetic tree 4
Figure 3 RNA polymerases form the three domains 7
Figure 4 Archaeal 16S RNA phylogenetic tree 11
Figure 5 A Sulfolobus cell infected with a virus 13
Figure 6 Morphologies of select archaeal viruses 17
Figure 7 CRISPR immunity: mode of action 20
Figure 8 Gene maps of accessory iCmr genes 34
Figure 9 Tree of csx1 genes from Sulfolobales 37
xiii

3 DISCUSSION &
PERSPECTIVES
Although experimental studies resolving the mechanistic details
of the Cas interference complexes have started to gain momentum,
with more and more articles being published each month, there
are still many holes in our understanding of key parts of the interference
process. Despite this, there are some marked differences
which are already established between iCas and iCmr, such as the
manner in which self vs. non-self nucleic acid is distinguished1 ,
or the species of mature crRNA (long[10] vs. short[27]) utilised
by either system.
In addition to such specific differences, a deeper divergence
between the two systems is becoming increasingly apparent. For
the iCas protein complex, the findings[32, 67] first made for the
system in E. coli (Type E), are remarkably being rediscovered in
the diverse iCas systems (types A, D and F) of Sulfolobus, Bacillus
and Pseudomonas[39, 53, 81]. As for iCmr, the opposite seems to
be the case. Here we see surprising mechanistic diversity despite
the apparent homology between the systems. E. g. the Type
A iCmr system of Staphylococcus targets DNA[47], and while
two different Type B systems, in Pyrococcus[27] and Sulfolobus[86]
respectively, both target RNA, they do so in ways which are very
different2 . Furthermore, there is evidence now for a another
Sulfolobus Type B iCmr system targeting DNA (Deng et al., under
revision), obscuring the picture even further.
This tendency for iCas systems being mechanistically conserved,
and iCmr systems exhibiting diversity, is also reflected
on the genomic level. Although sequences of the individual iCas
genes have diverged considerably between the subtypes, some
even beyond recognition, the overall gene composition is constant,
with cas3, cas5, cas7 and cas8 comprising a universal core.
iCmr modules on the other hand vary with regard to the content
of RAMP genes depending on their being types A, B, C or D.
Also, and perhaps more importantly, very similar iCmr modules
are sometimes seen accompanied by different combinations of
accessory genes (Section 2.4.1) which encode proteins that may
be responsible for modifying the core functionality of the iCmr
complex, possibly accounting for the mechanistic diversity so far
35
1with PAMs[49] as
opposed to
base-pairing[48]
respectively
2 Both types utilise
crRNA to target
complementary
ssRNA, but while
the former always
cleaves the target
RNA at a fixed
position employing
some kind of
ruler-mechanism, the
latter cleaves the
target in a sequence
specific manner at
each ‘UA’
dinucleotide
encountered

4 CONCLUSION
During this Ph.D study the CRISPR systems in Sulfolobales have
been extensively characterised using a bioinformatical genome
sequence analysis approach. Later the analyses were extended
to all available archaeal genomes. The latter work is still in the
process of being concluded. To summarise:
• Sulfolobales CRISPR spacer sequences were analysed to
find matches to the large number of sequenced Sulfolobales
extrachromosomal elements. The matches obtained were
used to successfully predict the target nucleic acid of the
CRISPR system, back when the target nucleic acid was not
known.
• Analysis of Sulfolobales CRISPR repeats, spacers, leaders
and cas genes revealed that CRISPR systems exist in families,
where leader types, repeat types, cas gene types and
PAM motifs go hand in hand. At the time, this had not
been shown for any other organism.
• Analysis of the genomic contexts of Sulfolobales CRIS-
PR/Cas loci revealed that the systems are located in genomic
hyper-variable regions and subject to frequent horizontal
gene transfer, where transposable elements and
toxin-antitoxin loci play a role in modulating their mobility.
• Extending the analyses to other archaea outside Sulfolobales
revealed that the CRISPR interference modules (iCas
and iCmr) in particular are very diverse, while the adaptation
modules (aCas) are remarkably conserved. Individual
modules were also seen interchanging giving rise to CR-
ISPR/Cas loci with different combinations of functional
modules.
• iCmr modules of different types were found to be associated
with a rich array of various accessory genes which were
also found to exchange between different types of iCmr
modules. It was hypothesised that these accessory genes
extend the core functionality of the iCmr modules, e. g. by
conferring the ability to switch target nucleic acids.
39

5 PUBLICATIONS
The publications resulting from this PhD study are included in
this chapter in chronological order. As most of the publications
here have multiple authors with varying contributions, I have
rated my own level of contribution to each publication as either
‘major, ‘substantial’ or ‘minor’. ‘Major’ means that the majority
of the work behind the publication was carried out by myself.
‘Substantial’ means that my contribution comprised a smaller
but crucial part of the manuscript, while ‘minor’ means that
my contribution was small and non-crucial to that particular
manuscript, although still a part of my own Ph. D project. In
addition to my level of contribution, the exact nature of my
contribution is also stipulated.
A note on iCmr family nomenclature
In conformance with the recent update of cas gene nomenclature[45],
the iCmr families referred to in publications 5.7[25], 5.8[20] and
5.10[21] as ‘B’ and ‘C’ are now merged into ‘B’, while ‘E’ is now
‘A’, ‘A’ is now ‘C’, and ‘D’ remains ‘D’. The new nomenclature is
used throughout this thesis and in publications to come, whereas
the publications listed above contain the old nomenclature. So in
summary:
in thesis in [25], [20] and [21]
A E
B B and C
C A
D D
41

JOURNAL OF BACTERIOLOGY, Oct. 2008, p. 6837–6845 Vol. 190, No. 20
0021-9193/08/$08.000 doi:10.1128/JB.00795-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
Stygiolobus Rod-Shaped Virus and the Interplay of Crenarchaeal
Rudiviruses with the CRISPR Antiviral System †
Gisle Vestergaard, 1 Shiraz A. Shah, 1 Ariane Bize, 2 Werner Reitberger, 3 Monika Reuter, 3 Hien Phan, 1
Ariane Briegel, 4 Reinhard Rachel, 3 Roger A. Garrett, 1 and David Prangishvili 2 *
Danish Archaea Centre and Centre for Comparative Genomics, Department of Biology, Copenhagen University,
Ole Maaløes Vej 5, DK-2200 Copenhagen N, Denmark 1 ;MolecularBiologyoftheGeneinExtremophilesUnit,
Institut Pasteur, rue Dr. Roux 25, 75724 Paris Cedex 15, France 2 ; Department of Microbiology,
University of Regensburg, Universitätsstrasse 31, D-93053 Regensburg, Germany 3 ; and
Max-Planck-Institut of Biochemistry, Molecular Structural Biology, Am Klopferspitz 21,
D-82152 Martinsried, Germany 4
Received 6 June 2008/Accepted 11 August 2008
A newly characterized archaeal rudivirus Stygiolobus rod-shaped virus (SRV), which infects a hyperthermophilic
Stygiolobus species, was isolated from a hot spring in the Azores, Portugal. Its virions are rod-shaped, 702
( 50) by 22 ( 3) nm in size, and nonenveloped and carry three tail fibers at each terminus. The linear
double-stranded DNA genome contains 28,096 bp and an inverted terminal repeat of 1,030 bp. The SRV shows
morphological and genomic similarities to the other characterized rudiviruses Sulfolobus rod-shaped virus 1
(SIRV1), SIRV2, and Acidianus rod-shaped virus 1, isolated from hot acidic springs of Iceland and Italy. The
single major rudiviral structural protein is shown to generate long tubular structures in vitro of similar
dimensions to those of the virion, and we estimate that the virion constitutes a single, superhelical, doublestranded
DNA embedded into such a protein structure. Three additional minor conserved structural proteins
are also identified. Ubiquitous rudiviral proteins with assigned functions include glycosyl transferases and a
S-adenosylmethionine-dependent methyltransferase, as well as a Holliday junction resolvase, a transcriptionally
coupled helicase and nuclease implicated in DNA replication. Analysis of matches between known crenarchaeal
chromosomal CRISPR spacer sequences, implicated in a viral defense system, and rudiviral genomes
revealed that about 10% of the 3,042 unique acidothermophile spacers yield significant matches to rudiviral
genomes, with a bias to highly conserved protein genes, consistent with the widespread presence of rudiviruses
in hot acidophilic environments. We propose that the 12-bp indels which are commonly found in conserved
rudiviral protein genes may be generated as a reaction to the presence of the host CRISPR defense system.
Viruses of the hyperthermophilic crenarchaea are extremely
diverse in their morphotypes and in the properties
of their double-stranded DNA (dsDNA) genomes (reviewed
in references 19 and 23). Moreover, some of the virion
morphotypes are unique for dsDNA viruses from any domain
of life. Many of these viruses have been classified into
seven new families that include rod-shaped rudiviruses, filamentous
lipothrixviruses, spindle-shaped fuselloviruses,
and a bottle-shaped ampullavirus (reviewed in reference
24). The bicaudavirus Acidianus two-tailed virus (ATV) exhibits
an exceptional two-tailed morphology and the unique
viral property of developing long tail-like appendages independently
of the host cell (11). Crenarchaeal viral research
is still at an early stage of development, and insights into
basic molecular processes, including infection, replication,
packaging, and virus-host interactions, are limited. One of
the main reasons for this lies in the high proportion of
predicted genes with unknown functions (25).
* Corresponding author. Mailing address: Molecular Biology of the
Gene in Extremophiles Unit, Institut Pasteur, rue Dr. Roux 25, 75724
Paris Cedex 15, France. Phone: 33-(0)144-38-9119. Fax: 33-(0)145-68-
8834. E-mail: prangish@pasteur.fr.
† Supplemental material for this article may be found at http://jb
.asm.org/.
Published ahead of print on 22 August 2008.
6837
At present, viruses of the family Rudiviridae are the most
promising for detailed studies because they can be obtained in
reasonable yields, and there are already some insights into
their mechanisms of replication, transcriptional regulation,
and host cell adaptation (4, 12, 13, 20, 21). To date, three
rudiviruses have been characterized, all from the order Sulfolobales:
the closely related Sulfolobus rod-shaped virus 1
(SIRV1), and SIRV2, isolated on Iceland, which infect strains
of Sulfolobus islandicus (20, 22), and Acidianus rod-shaped
virus 1 (ARV1), isolated at Pozzuoli, Italy, which propagates in
Acidianus strains (34). Moreover, rudivirus-like morphotypes
and partial rudiviral genome sequences have been detected in
environmental samples collected from both acidic and neutrophilic
hot aquatic sites (27, 29, 32).
All rudiviral genomes carry linear dsDNA genomes with
long inverted terminal repeats (ITRs) ending in covalently
closed hairpin structures with 5-to-3 linkages (4, 20). The
terminal structure is important for replication, which presumably
is initiated by site-specific single-strand nicking
within the ITR, with the subsequent formation of head-tohead
and tail-to-tail intermediates, and the conversion of
genomic concatemers into monomers by a virus-encoded
Holliday junction resolvase (20). This basic replication
mechanism appears to be similar to that used by the eukaryal
poxviruses, Chlorella virus and African swine fever
virus, although there is no clear similarity between the se-
Downloaded from
jb.asm.org
by on October 1, 2008

6838 VESTERGAARD ET AL. J. BACTERIOL.
quences of the implicated archaeal and eukaryal proteins
(20, 25).
The transcriptional patterns of rudiviruses SIRV1 and
SIRV2 are relatively simple, with few temporal expression
differences. An exception is the gene encoding the major
structural protein that binds to DNA and, at an early stage
of infection, is expressed as a polycistronic mRNA but appears
as a single gene transcript close to the eclipse period (12). It
has also been shown that rudiviral transcription can be activated
by a Sulfolobus host-encoded protein, Sta1, that interacts
specifically with TATA-like promoter motifs in the viral genome
(13).
For SIRV1, a detailed study of the mechanism of adaptation
to foreign hosts was conducted. Upon passage of the virus
through closely related S. islandicus strains, complex changes
were detected that were concentrated within six genomic regions
(21, 22). These changes included insertions, deletions,
gene duplications, inversions, and transpositions, as well as
changes in gene sizes that often involved the insertion or deletion
of what appeared to be “12-bp elements.” It was concluded
that the virus generated a complex mixture of variants,
one or more of which were preferentially propagated when the
virus entered a new host (21).
Here we describe a novel rudivirus, Stygiolobus rod-shaped
virus (SRV), isolated from the Azores, Portugal, a location
geographically distant from the locations of the other characterized
rudiviruses (20, 34). SRV shows sufficient differences
from the other rudiviruses, both morphologically and genomically,
to warrant its classification as a novel species. The structural
and genomic properties of the rudiviruses are compared
and contrasted, and new data on the conserved virion structural
proteins are presented. Different rudiviruses were selected
for these studies on the basis of the virion or protein
yields that were obtained. Moreover, matches between the
spacer regions of the crenarchaeal chromosomal CRISPR repeat
clusters, which have been implicated in a viral defense
system (18) involving processed RNA transcribed from one
DNA strand (reviewed in references 16 and 17), and the rudiviral
genomes are analyzed and their significance, and possible
relationships to the 12-bp indels, are considered.
MATERIALS AND METHODS
Enrichment culture, isolation of viral hosts, and virus purification. An environmental
sample was taken from a hot acidic spring (93°C, pH 2) in the Furnas
Basin on Saõ Miguel Island, the Azores, Portugal. The aerobic enrichment
culture was established from the environmental sample and maintained at 80°C
under conditions described previously for cultivation of members of the Sulfolobales
(35). Single strains were isolated by plating on Gelrite (Kelco, San
Diego, CA) containing colloidal sulfur (35) and grown in the medium of the
enrichment culture. Cell-free supernatants of cultures were analyzed by transmission
electron microscopy for the presence of virus particles.
SRV was isolated from the growth culture of its host strain Stygiolobus sp.,
which was colony purified as described above. After cells were grown to the late
exponential phase and harvested by low-speed centrifugation (Sorvall GS3 rotor)
(4,500 rpm), virions were precipitated from the supernatant by adding NaCl (1
M) and polyethylene glycol 6000 (10% [wt/vol]) and maintaining the mixture at
4°C overnight. They were purified further by CsCl gradient centrifugation (34).
Transmission electron microscopy. Samples were deposited on carbon-coated
copper grids, negatively stained with 2% uranyl acetate (pH 4.5), and examined
in a CM12 transmission electron microscope (FEI, Eindhoven, The Netherlands)
operated at 120 keV. The magnification was calibrated using catalase crystals
negatively stained with uranyl acetate (28). Images were digitally recorded using
a slow-scan charge-coupled-device camera connected to a PC running TVIPS
software (TVIPS GmbH, Gauting, Germany). To some samples, 0.1% sodium
dodecyl sulfate (SDS) was added, and those samples were maintained at 22°C for
30 min in order to study the stability of the virion particles. Electron tomography
of intact, negatively stained virions was performed as described previously (10,
26). Visualization of the three-dimensional (3D) data was performed using
Amira software (Visage Imaging, Fürth, Germany).
Protein analyses. Proteins of SRV were separated in 13.5% SDS–polyacrylamide
gels (14) and stained with Coomassie brilliant blue R-250 (Serva,
Heidelberg, Germany). N-terminal protein sequences were determined by
Edman degradation using a Procise 492 protein sequencer (Applied Biosystems,
Foster City, CA).
SIRV2 proteins were separated in 4 to 12% SDS–polyacrylamide NuPAGE
gradient gels by the use of MES (morpholineethanesulfonic acid) buffer (both
from Invitrogen, Paisley, United Kingdom). The gels were stained with Sypro
Ruby (Invitrogen). Protein bands were analyzed by peptide mass fingerprinting
with matrix-assisted laser desorption ionization–time of flight mass spectrometry
using a Voyager DE-STR biospectrometry workstation (Applied Biosystems,
Framingham, MA) as described earlier (26). The analysis was performed in
conjunction with the proteomic platform at the Pasteur Institute.
Cloning and heterologous expression of ARV1-ORF134b and purification of
the recombinant protein and its self-assembly. ARV1-ORF134b was amplified
from purified viral DNA with primers ARV1ORF134F (GGAATTCCATATG
ATGGCGAAAGGACACACACC) and ARV1ORF134R (GGAATTCTCGA
GACTTACGTATCCGTTAGGAC). The PCR product was purified (PCR purification
kit; Roche, Mannheim, Germany) and cloned into pET30a expression
vector (Novagen, Madison, WI) between restriction sites for EcoRI and XbaI.
The protein was expressed overnight at 20°C in the Escherichia coli
Rosetta(DE3)pLysS strain. Protein expression was controlled by SDS-polyacrylamide
gel electrophoresis analysis and by performing a Western blot analysis
using anti-His-tag-specific antibodies (Novagen). The native protein was purified
on a Ni 2 -nitrilotriacetic acid (Ni 2 -NTA)-agarose column (Novagen) with elution
buffers containing 50 to 500 mM imidazole. The accuracy of its sequence was
confirmed. Self-assembly of the recombinant protein into filamentous structures
was performed at 75°C and pH 3.5 and observed by electron microscopy.
Preparation of cellular and viral DNA and DNA sequencing. DNA was extracted
from Stygiolobus azoricus cells as described previously (2), and the 16S
rRNA gene was amplified by PCR using primers 8aF and 1512 uR (6) and
sequenced.
Viral DNA was obtained by disrupting SRV particles with 1% SDS for 1hat
room temperature and extraction with phenol-chloroform (9). A shotgun library
was prepared by sonicating viral DNA to generate fragments of 2 to 4 kb and
cloning these into the SmaI site of the pUC18 vector. DNA was purified from
single colonies by the use of a Biorobot 8000 workstation (Qiagen, Westburg,
Germany) and sequenced in MegaBACE 1000 sequenators (Amersham Biotech,
Amersham, United Kingdom). The viral sequence was assembled using Sequencher
4.2 software (Gene Code, Ann Arbor, MI). PCR primers for gap
closing and resolving sequence ambiguities were designed using Primers for Mac,
version 1.0. Sequence alignments were obtained using MUSCLE software (7).
Open reading frames (ORFs) were defined with the help of ARTEMIS software
(30) and investigated in searches using the EMBL and GenBank (1), 3D-Jury (8),
and SMART (15) databases. Genome maps were generated and compared using
Mutagen software, version 4.0 (5).
Bioinformatical matching of crenarchaeal CRISPR spacers to rudiviral genomes.
CRISPRs were predicted for each of the 14 publicly available crenarchaeal
genomes in GenBank (NC_000854 [Aeropyrum pernix K1], NC_002754
[Sulfolobus solfataricus P2], NC_003106 [Sulfolobus tokodaii strain 7],
NC_003364 [Pyrobaculum aerophilum strain IM2], NC_007181 [Sulfolobus acidocaldarius
DSM 639], NC_008698 [Thermofilum pendens Hrk5], NC_008701
[Pyrobaculum islandicum DSM 4184], NC_008818 [Hyperthermus butylicus DSM
5456], NC_009033 [Staphylothermus marinus F1], NC_009073 [Pyrobaculum
calidifontis JCM 11548], NC_009376 [Pyrobaculum arsenaticum DSM 13514],
NC_009440 [Metallosphaera sedula DSM 5348], NC_009676 [Cenarchaeum symbiosum],
and NC_009776 [Ignicoccus hospitalis KIN4/I]). In addition, the six
sequenced repeat clusters from Sulfolobus solfataricus P1 (16) were added to the
data set as well as CRISPRs from five incomplete Sulfolobus islandicus genomes
publicly available through the Joint Genome Institute (http://genome.jgi.doe.gov
/mic_asmb.html) and unpublished genome sequences of Sulfolobus islandicus
HVE10/4 and Acidianus brierleyi from the Copenhagen laboratory. The repeat
cluster sequences were found using publicly available software (3, 7).
All predictions were curated manually. The orientation of each repeat cluster
was inferred from the repeat sequence and by locating the low-complexity flanking
sequence that generally resides immediately upstream from the cluster and
contains the transcriptional leader (16). All unique spacer sequences of the
Downloaded from
jb.asm.org
by on October 1, 2008

VOL. 190, 2008 CRENARCHAEAL RUDIVIRUSES 6839
FIG. 1. Electron micrographs of SRV virions negatively stained with 3% uranyl acetate. (A) A full virion particle, with a discontinuous central
line along the virion. (B) Six virions attached to liposome-like structures. (C) Enlargement of a portion of panel B displaying the terminal fibers.
(D to H) Electron tomography images of an SRV virion. (D) Horizontal x-y slice (0.7 nm) showing the accumulated stain in the central part of
the virion (white arrow). (E) Vertical y-z slice (0.7 nm) through the 3D data set of the reconstructed part of an SRV particle. (F) Visualization
of the 3D data set using Amira software. (G and H) Vertical x-z slice (0.7 nm) through the tomogram showing that the virion particles are
embedded in negative stain and that accumulated stain visible in panel D is absent from the plug (black arrows). Bars, 200 nm (A and B); 50 nm
(C); 20 nm (D, E, G, and H).
repeat clusters, corresponding to the processed spacer transcript sequence (16),
were aligned to the complete nucleotide sequences on each strand of all four
rudiviral genomes (SRV [accession no. FM164764], SIRV1 [AJ414696], SIRV2
[AJ344259], and ARV1 [AJ875026]) by use of Paralign, an MMX-optimized
implementation of the Smith-Watermann algorithm (31). Moreover, assuming
that the spacer DNA can be incorporated into the oriented CRISPRs in either
direction, we also translated the two strands of the spacer DNA into all the
reading frames, yielding six amino acid sequences per spacer. Reading frames
containing stop codons (ca. 50%) were omitted to make the subsequent search
more specific. Each translation was aligned against the amino acid sequences of
all the annotated ORFs in each of the four rudiviral genomes. Significant e-value
cutoffs were determined for both the nucleotide and amino acid sequence
searches using the genome sequence of Saccharomyces cerevisiae as a negative
control (data not shown).
RESULTS
SRV isolation and structure. The virus-producing strain was
colony purified from an enrichment culture established from a
sample collected from an acidic hot spring in the Azores (see
Rudivirus Origin
Virion
length (nm)
TABLE 1. Properties of the rudiviruses
Genome size
(bp)
Materials and Methods). Its 16S rRNA sequence represented
the genus Stygiolobus of the Sulfolobales crenarchaeal order
and was closely related to that of Stygiolobus azoricus. However,
it differs from S. azoricus, the type species of the genus, in
its capacity to grow aerobically, and a description of the new
species is in preparation. The virus particles produced constituted
flexible rods 702 ( 50) by 22 ( 3) nm in size, with three
short fibers at each terminus (Fig. 1A to C; Table 1). A Fourier
analysis of the virion (not shown) revealed the presence of
regular features with a periodicity of (4.2 nm) 1 , which probably
reflect a helical subunit arrangement. This feature is also
seen in the tomographic data set (Fig. 1D to H), which revealed
more structural details. The helical arrangement in the
virion core occurs in two different configurations. In the central
region, a zigzag structure with dark contrast, probably arising
from uranyl acetate staining, is surrounded by a protein shell
(Fig. 1D and E). In contrast, in the terminal plug, which is
Total no. of
ORFs
GC (%)
ITR length
(bp)
SRV Azores 702 28,097 37 29.3 1,030
ARV1 Pozzuoli 610 24,655 41 39.1 1,365 34
SIRV1 Iceland 830 32,308 45 25.3 2,032 20
SIRV2 Iceland 900 35,498 54 25.2 1,626 20
Reference
Downloaded from
jb.asm.org
by on October 1, 2008

6840 VESTERGAARD ET AL. J. BACTERIOL.
FIG. 2. Electron micrograph of a portion of an SRV virion after
treatment with 0.1% SDS for 30 min (see Materials and Methods).
White arrows indicate DNA or DNA-protein fibers lacking the protein
core. Bar, 100 nm.
about 50 nm in length, a helically arranged protein mass, with
no obvious uranyl acetate inclusions, is seen (Fig. 1D to F).
The three terminal fibers, anchored in the plug-like structure,
appear to be built up of multiple subunits ordered in a linear
array (Fig. 1D). The side view of the reconstructed virion
particle (Fig. 1E), as well as cross-sections of the negatively
stained virions obtained from the tomograms (Fig. 1G and H),
shows that the virion particles are embedded in negative stain
(Fig. 1G and H) and partially collapsed due to staining and air
drying; the height of the particles was about half of the apparent
diameter. Nevertheless, the accumulated central stain is
clearly visible in the cross-section (Fig. 1G) of the central part
of the virion (Fig. 1D), while this feature is absent from the
plug (Fig. 1G and H). The rod-shaped morphology of SRV,
with a regular helical core and tail fibers, is characteristic of
rudiviruses.
To investigate further the fine structure of the virion, virion
particles were incubated in buffer containing 0.1% SDS for 30
min at 22°C. Most of the virion remained undisturbed, with
the particles showing the same diameter as native virions and the
densely stained, helical core. However, in local regions the
protein shell had dissociated (Fig. 2) and a fine fiber with a
diameter of 3 to 4 nm that constituted either naked DNA or a
DNA-protein complex was visible.
Self-assembly of the major coat protein. The major rudiviral
structural protein is highly conserved in sequence and is glycosylated
(20, 22, 32a, 34). In order to study its possible selfassembly
properties, the ARV1 protein (ORF134b [34]) was
expressed heterologously in E. coli (see Materials and Methods)
and a His-tagged protein was purified to homogeneity on
an Ni 2 -NTA-agarose column. The protein was shown by
transmission electron microscopy to self-assemble to produce
filamentous structures of uniform widths and different lengths
(Fig. 3). The optimal conditions for the assembly, 75°C and pH
3, were close to those of the natural environment, and no
additional energy source was required for this process.
The transmission electron microscopy analysis revealed that the
filaments had structural parameters similar to those of the
native virions, with a diameter of 21 ( 3) nm and a periodicity
of (4.2 nm) 1 . Thus, the data suggest that the single major coat
protein alone can generate the body of the virion.
Minor rudiviral virion proteins. To date, the major coat
protein is the only rudiviral structural protein to have been
characterized. Given the closely similar structures of the different
rudiviruses, we attempted to identify minor structural
proteins for the SIRV2 virus, which can be produced in high
yields. Protein components of SIRV2 virions, separated on a
polyacrylamide gel, yielded six distinct major bands (Fig. 4),
and all except D2, which is the strongest band and corresponds
to ORF134 (gp26), were analyzed by mass spectrometry. Their
identities were as follows: band A contained ORF1070 (gp38),
band B contained ORF488 (gp33), and band C contained
ORF564 (gp39), while bands D1 and D3 both contained
ORF134 (gp26), probably in a glycosylated or, in the case of
D3, a proteolytically degraded form. Thus, three additional
SIRV2 structural proteins were identified, each highly conserved
in sequence in all rudiviruses (Table 2).
SRV genome content. A shotgun library of the viral genome
was prepared, sequenced, and assembled (see Materials and
Methods) to yield an approximately 10-fold coverage of a
26-kb contig. Since 1 to 2 kb of terminal sequence is always
absent from shotgun libraries of linear viral genomes, these
additional sequences were generated by primer walking using
viral DNA, or using PCR products obtained therefrom, until
subsequent rounds of walking yielded no further sequence.
FIG. 3. Electron micrograph images of the self-assembled major coat protein of ORF134 from ARV1 after negative staining with 3% uranyl
acetate. Bar, 100 nm.
Downloaded from
jb.asm.org
by on October 1, 2008

VOL. 190, 2008 CRENARCHAEAL RUDIVIRUSES 6841
FIG. 4. SIRV2 virion proteins separated by SDS-polyacrylamide
gel electrophoresis and stained with Sypro Ruby. Molecular masses of
protein standards are indicated in kilodaltons on the left.
The total sequence obtained was 28,096 bp, with a GC content
of 29% and an ITR of about 1,030 bp (Table 1). An EcoRI
restriction digest yielded fragments consistent with the genome
size (data not shown).
Thirty-seven ORFs were predicted for which start codons
were assigned on the basis of the upstream locations of TATAlike
and transcription factor B-responsive element (BRE) promoter
motifs and/or Shine-Dalgarno motifs. Details of the
putative genes and operon structures are presented in Table S1
in the supplemental material, and a comparative genome map
of SRV and rudiviruses SIRV1 and ARV1 is presented in Fig.
5; the genome map of SIRV2, which is closely similar to that of
SIRV1, is not included (12, 20). SRV differs from the other
rudiviruses in that fewer ORFs are organized in operons, and
it has a lower level of gene order conservation (Fig. 5). Moreover,
whereas for the other rudiviruses TATA-like motifs are
often directly preceded by a conserved GTC triplet (12, 20, 34),
in SRV the ensuing triplet sequence was GTA for 10 of the 30
putative TATA-like motifs (see Table S1 in the supplemental
material).
Homologs of 17 SRV ORFs are present in all rudiviruses,
and a further 10 SRV ORFs are conserved in some rudiviruses.
Each virus type carries a few genes which are unique, and these
are generally clustered near the ends of the linear genomes and
yield no matches to genes in public sequence databases. In
SRV, these are ORF145, -116a, -109, -59, -108, -97b, and -92
(left to right in Fig. 5). Although for SIRV1 and SIRV2 some
of these nonconserved ORFs have been shown to be transcribed
(12), further work is necessary to establish whether
they are all protein-coding genes. Some of the proteins carry
predicted structural motifs, and putative functions could be
assigned to some of the conserved ORFs on the basis of public
database searches; most of these are encoded in other crenarchaeal
genomes (Table 2).
The host-encoded transcriptional regulator Sta1, a winged
helix-turn-helix protein, was shown to bind to some SIRV1
promoters, including those of ORF134 and ORF399, and to
enhance their transcription (13). A similar regulation may occur
also for SRV, since the promoter regions of the homologs
of ORF134 and ORF399 contain putative Sta1 binding sites. In
contrast, in ARV1 only the ORF134 homolog is present in an
operon for which the first ORF is a putative transcriptional
regulator, and its promoter does not carry Sta1 binding motifs.
Genomic features. Sequence heterogeneities and other exceptional
properties were detected in the SRV genome and in
other rudiviral genomes that are described below.
(i) ITRs. For SRV, the 1,030-bp ITR is perfect, except for a
36-bp insert at positions 799 to 834 at the left end and inverted
tetramer sequences (AAAA [positions 425 to 428] and TTTT
[positions 27672 to 27669]). It shows little sequence similarity
to ITRs of the other rudiviruses, except for the 21-bp sequence
(AATTTAGGAATTTAGGAATTT) located at the terminus
that is predicted to be a Holliday junction resolvase binding
site occurring in all sequenced rudiviruses (34). The ITRs of
SRV and SIRV1 and -2 carry four to five degenerate copies of
this direct sequence repeat, while that of ARV1 carries multiple
degenerate copies of other diverse repeats of similar
sizes.
(ii) Genome heterogeneity in SRV and 12-bp indels. Sequence
heterogeneities were detected in the SRV genome,
within the 10-fold sequence coverage, and mutations were localized
to groups of subpopulations, including one 180-bp deletion
between positions 11896 and 12077 in two out of six
clones. Moreover, a 48-bp insertion was observed in one variant
(out of 18 clones) precisely at the C terminus of ORF533
(position 20285) that generated a third copy of a 16-amino-acid
direct repeat. Some changes corresponding to 12-bp indels
were also apparent in overlapping clones, and they are indicated
in Table 3 together with those observed earlier for
SIRV1 (4, 20, 21). Moreover, sequence comparison of highly
conserved ORFs present in the four rudiviral genomes revealed
several additional 12-bp indels. The locations of all the
identified indels which occur in conserved rudiviral genes or
sites corresponding to SRV ORF75, -104, -138, -163, -168,
-197, -199, -286, -294, -419, -440, -464, -533, and -1059 (Fig. 5)
are indicated in the SIRV1 genome map in Fig. 6.
Rudiviral matches to CRISPRs. The availability of four separate
rudiviral genome sequences provided a basis for analyzing
the frequency and distribution of the matches of CRISPR
spacer sequences to the viral genomes. Therefore, we analyzed
the repeat clusters of each of the available crenarchaeal genomes
in the public EMBL/GenBank and JGI sequence data-
Downloaded from
jb.asm.org
by on October 1, 2008

6842 VESTERGAARD ET AL. J. BACTERIOL.
SRV ORF category
Rudiviral
homolog(s)
Structural proteins
ORF134 All Structural protein
ORF464 All Structural protein
ORF581 All Structural protein
ORF1059 All Structural protein
bases and in our own unpublished genomes (see Materials and
Methods). Fourteen complete genomes and 8 partial genomes
were analyzed. In total, 82 repeat clusters from complete genomes
and 44 clusters, some incomplete, from partial genomes
TABLE 2. Rudiviral proteins with predicted functions
Predicted function or description Analysis tool E-value or score
Transcriptional regulators
ORF58 All RHH-1 SMART 2.0e-08 Many
ORF95 None “Winged helix” repressor DNA
binding domain
3D-Jury 64.00 None
Other crenarchaeal
virus(es)
Translational regulator
ORF294 SIRV1 and -2 tRNA-guanine transglycosylase 3D-Jury 167.57 STSV1
DNA replication
ORF440 All RuvB Holliday junction helicase
(Lon ATPase)
3D-Jury 53.71 AFV1, AFV2
ORF116c All Holliday junction resolvase
(archaeal)
SMART 2.4e-45
ORF199 All Nuclease 3D-Jury 63.86 AFV1, SIFV
DNA metabolism
ORF168 SIRV1 and -2 dUTPase SMART 1.5e-12 STSV1
ORF257 ARV1 Thymidylate synthase (Thy1) SMART 7.9e-46 STSV1
ORF159 All S-adenosylmethionine-dependent
methyltransferase
3D-Jury 73.67 SIFV
Glycosylation
ORF335 All Glycosyl transferase group 1 SMART 6.7e-09
ORF355 All Glycosyl transferase SMART 5.1e-04
Other
ORF419 SIRV1 and -2 11 transmembrane regions TMHMM
yielded 4,283 spacer sequences. Subsequently, 278 sequences
that are shared between S. solfataricus strains P1 and P2 (16)
were omitted from the data set, yielding a total of 4,005 spacer
sequences.
FIG. 5. Genome maps of SRV, SIRV1, and ARV1 showing the predicted ORFs and the ITRs (bold lines). SRV ORFs are identified by their
amino acid lengths. Homologous genes shared between the rudiviruses are color-coded. Genes above the horizontal line are transcribed from left
to right, and those below the line are transcribed in the opposite direction. Predicted functions or structural characteristics of the gene products
are indicated as follows: sp, structural protein; rhh, ribbon-helix-helix protein; wh, winged helix protein; tm, transmembrane; tgt, tRNA guanine
transglycosylase; hjh; Holliday junction helicase; hjr, Holliday junction resolvase; n, nuclease; du, dUTPase; ts, thymidylate synthase; sm,
S-adenosylmethionine-dependent methyltransferase; gt, glycosyl transferase.
Downloaded from
jb.asm.org
by on October 1, 2008

VOL. 190, 2008 CRENARCHAEAL RUDIVIRUSES 6843
ORF or ITR
TABLE 3. Occurrence of the 12-bp indels in overlapping rudiviral clone libraries
No. of 12-bp
clones
In the first analysis, each of the 4,005 spacer sequences was
compared to the four rudiviral genomes at the nucleotide level.
In total, 158 spacers yielded 268 rudiviral matches. The latter
number exceeds the former because (i) some spacers match to
more than one locus within repeat sequences of a given virus
and (ii) some spacers match to more than one virus. Second,
the analysis was performed at the protein level (see Materials
and Methods). This analysis revealed 148 additional matching
spacers and a further 427 rudiviral genome matches exclusively
at the protein level. (An additional 105 matching spacer sequences
from the latter analysis that overlapped, partially or
completely, with 158 of those detected within rudiviral ORFs
at the nucleotide level were not counted.) Only 6 of the 14
completed crenarchaeal genomes carried spacers yielding
matches to rudiviral genomes, and they are listed, together
with the results for the partial genomes, in Table 4. These
results reinforced the choice of criteria employed for determining
the significance of sequence matches (see Materials
and Methods).
The locations of the spacer sequence matches are superimposed
on the genome map of SIRV1 in Fig. 6. The matches are
not evenly distributed along the genome; some genes have no
matches, while others carry up to 18. Although there is no strict
correlation between the level of gene sequence conservation
and the number of matching spacers, the five most conserved
genes, ORF440, ORF1059, ORF134, ORF355, and ORF581,
exhibit the highest number of matches (18, 15, 14, 14, and 13,
respectively) (Fig. 3 and 6).
DISCUSSION
No. of 12-bp
clones
The morphological and genomic data for SRV and the other
characterized rudiviruses are summarized in Table 1. The conservation
of their morphologies and genomic properties contrasts
with that of other crenarchaeal viruses and, in particular,
Sequence
with that of the filamentous lipothrixviruses, which exhibit a
variety of surface, envelope, and tail structures and much more
heterogeneous genomes (24).
The virion length of SRV, 702 ( 50) nm, shows the same
direct proportionality to genome size (28 kb) as those for the
other rudivirus virions, which range in length from 610 ( 50)
nm (ARV1) to 900 ( 50) nm (SIRV2) (Table 1). A superhelical
core, with a pitch of 4.3 nm and a width of 20 nm,
terminates in 45-nm-long nonhelical “plugs,” and it correlates
with the internal structure observed earlier in electron micrographs
of SIRV1 (22). In order to determine whether a single
superhelical DNA can span the SRV virion length, we applied
the following formulae to estimate the sizes and length of the
superhelical DNA:
L turn p 2 c 2
where L turn represents the arc length of a turn, p represents the
pitch, and c represents the cylinder circumference, and
L total t L turn
Genome position
(reference)
SRV ORF58 5 1 AATTAAATTATG 26079–26068
SRV ORF95 8 8 TTTTGAATTATG 7112–7101
SIRV1 ORF335 7 3 AACATTCATTAA Variant (21)
SIRV1 ORF562 1 4 ATACAAATTTCA Variant (21)
SIRV1-ITR 10 29 TTTAGCAGTTCA (20)
where t represents the number of turns and L total represents
the arc length of entire helix.
Calculations using structural parameters for B-form DNA
yielded a genome size of 26 kbp without, and 30 kbp with,
terminal “plugs”. The estimated width (20 nm) is an upperlimit
estimate. A reciprocal calculation, with a 28-kbp genome,
yields a diameter of 21.2 nm without, and 18.5 nm with, the
“plugs.” Given that the major rudiviral coat protein is capable
of self-assembly into filamentous structures similar in width to
the native virion (Fig. 4), it is likely that the rod-shaped body
consists of a single superhelical DNA embedded within this
filamentous protein structure. Thus, the three newly identified
minor structural proteins probably contribute to conserved
terminal features of the virion; consistent with this, the largest
FIG. 6. CRISPR spacer sequence matches for SIRV1 are superimposed on the SIRV1 genome map. Protein-coding regions translated from
left to right are shown above the line, and those translated from right to left are shown below the line. Highly conserved coding genes are presented
in dark blue, while less-conserved or nonconserved genes are in light blue. The inverted terminal repeat is shaded in violet. Matches to spacers
are shown as vertical lines and are color-coded as indicated. Matches to the upper DNA strand are placed above the genome, and those to the
lower strand are located below the genome. The red vertical lines correspond to the nucleotide sequence matches, and the green vertical lines
correspond to matching amino acid sequences, after translation of the spacer sequences from both DNA strands. In total, there were 106 matches
to SIRV1 at the nucleotide level, some of them occurring more than once, and an additional 127 matches to SIRV1 ORFs at the amino acid level.
The black arrowheads indicate the positions of the 12-bp indels that occur in one or more conserved rudiviral genes.
Downloaded from
jb.asm.org
by on October 1, 2008

6844 VESTERGAARD ET AL. J. BACTERIOL.
TABLE 4. Number of CRISPR spacer sequences from complete
and partial crenarchaeal genomes which match
rudiviral genomes a
Strain
No. of matching
sequences at the
indicated level b
Nucleotide
Amino
acid
Accession no.,
reference,
or source
Complete genomes
S. solfataricus P2 22 (14) 31 (18) NC_002754
S. tokodaii 7 9 14 NC_003106
M. sedula 5 15 NC_009440
S. acidocaldarius 5 9 NC_007181
S. marinus F1 2 1 NC_009033
H. butylicus 0 1 NC_008818
Incomplete genomes
S. solfataricus P1 20 (14) 30 (18) 16
S. islandicus (5 strains) 39/12/4/2/1 26/7/2/2/0 See text
S. islandicus HVE10/4 36 11 Unpublished
A. brierleyi 15 14 Unpublished
a All the acidothermophilic organisms from the family Sulfolobaceae have
spacers matching those of the rudiviral genomes. However, the neutrophilic
hyperthermophiles S. marinus and H. butylicus produced very few matches.
Matches at the amino acid sequence level that overlapped with those at the
nucleotide sequence level were excluded from the data.
b Numbers in parentheses in columns 2 and 3 indicate the number of matches
that arose from spacers shared by S. solfataricus strains P1 and P2 (16).
structural protein (corresponding to SRV ORF1059) was localized
within the virion tail fibers of SIRV2 by studying functional
groups by the use of bioconjugation (Steinmetz et al.,
submitted).
We still have limited insight into functional roles of rudivirus-encoded
proteins (Table 2). The glycosyl transferases have
been implicated in the glycosylation of the structural proteins
(34). Moreover, a few proteins have been linked to viral replication.
Two of these, ORF440 and ORF199, lie within an
operon and are conserved in phylogenetically diverse lipothrixviruses
(33). The former yielded significant matches to RuvB,
the helicase facilitating branch migration during Holliday junction
resolution, while ORF199 yielded the best matches to
nucleases, including Holliday junction resolvases (Table 2).
Thus, they are likely to facilitate rudiviral replication, which, in
SIRV1, involves site-specific nicking within the ITR, formation
of head-to-head and tail-to-tail intermediates, and conversion
of genomic concatemers to monomers by a Holliday junction
resolvase (ORF116c) (20). In addition, SRV encodes a
dUTPase and a thymidylate synthase, both of which are involved
in thymidylate synthesis, whereas the other rudiviruses
encode only one of these enzymes, both of which are considered
helpful in maintaining of a low dUTP/dTTP ratio and thus
in minimizing detrimental effects of misincorporating uracil
into DNA. Two putative transcriptional regulators have been
identified, together with the putative tRNA transglycosylase
encoded by SRV, which has homologs in SIRV1 and -2 and in
other crenarchaeal viruses (Table 2) and is distantly related to
a tRNA-guanine transglycosylase implicated in archeosine formation.
The two approaches employed to analyze CRISPR spacers
matching the four rudiviral genomes demonstrated that about
10% of the 3,042 unique acidothermophile spacers yielded
positive matches. Employing alignments at the amino acid
level considerably increased the number of positive matches
detected, because nucleotide sequences diverge more rapidly.
Thus, the genomes of SRV and SIRV1 share almost no (4%)
similarity at the DNA level, whereas most homologous proteins
show, on average, 47% sequence identity or similarity.
When studying the distribution of the spacer matches in the
rudiviral genomes, some trends are evident. First, there is no
significant bias with regard to the DNA strand carrying the
matching sequence. In SIRV1, for example, 122 matches occur
on one strand and 111 on the other (Fig. 6). This is consistent
with our assumption that the incorporation of viral or plasmid
DNA into the orientated CRISPRs is nondirectional. Second,
in accordance with earlier analyses (16), for matches to coding
regions, there is no significant bias to matches occurring in a
sense or antisense direction. Thus, for SIRV1, 39% of the
matches are in the sense direction whereas 54% are antisense—the
remaining 7% constitute nucleotide matches to
non-protein-coding regions (Fig. 6). Third, when the latter
nucleotide sequence-based matches are considered, the proportion
of matches which occur in intergenic regions, as opposed
to those occurring in protein-coding regions, is not significantly
different from the overall coding percentage of the
virus. For SIRV1 19% of the nucleotide matches fall within
intergenic regions, whereas 20% of the genome is non-proteincoding.
Finally, some genes have many matches whereas others
have none at all. Five genes have 13 or more matches in
SIRV1; these genes correspond to SRV ORF440, ORF1059,
ORF134, ORF355, and ORF581. Apart from being conserved
in each rudivirus, their gene products have important structural
or functional roles (Table 2).
The results pose an important question as to how the host
distinguishes between more important and less important
genes when adding the spacers to its CRISPRs. Possibly, although
the de novo addition of spacers may well be an unbiased
process with respect to both viral genome position and
direction, the selective advantage provided by some spacers
would result in a population being enriched in hosts with
CRISPRs carrying spacers targeting crucial viral genes.
The 12-bp viral indels were originally shown to occur commonly
in SIRV1 variants that arose as a result of passage of an
SIRV1 isolate through different closely related S. islandicus
strains from Iceland, and it was inferred that this unusual
activity reflected adaptation of the rudivirus to the different
hosts (21). The positions of the 12-bp indels that have been
identified in conserved rudiviral protein genes are shown together
with the CRISPR spacer matches on the SIRV1 genome
map in Fig. 6. Many of the sites are very close or overlap.
This raises the possibility that lengthening or shortening of
conserved protein genes by 12 bp could be a mechanism to
overcome the host CRISPR defense system.
We conclude that the rudiviruses are excellent models for
studying details of viral life cycles and virus-host interactions in
crenarchaea. These viruses appear to be much more conserved
in their morphologies and genomes than, for example, the
equally ubiquitous lipothrixviruses. Moreover, they are relatively
stably maintained in their hosts and can be isolated in
reasonable yields for experimental studies.
Downloaded from
jb.asm.org
by on October 1, 2008

VOL. 190, 2008 CRENARCHAEAL RUDIVIRUSES 6845
ACKNOWLEDGMENTS
We are grateful to Georg Fuchs for providing the environmental
sample from Saõ Miguel Island, the Azores.
The research in Copenhagen was supported by grants from the
Danish Natural Science Research Council, the Danish National Research
Foundation, and Copenhagen University. The research in Paris
was partly supported by grant NT05-2_41674 from Agence Nationale
de Recherche (Programme Blanc).
REFERENCES
1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller,
and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation
of protein database search programs. Nucleic Acids Res. 25:3389–3402.
2. Bettstetter, M., X. Peng, R. A. Garrett, and D. Prangishvili. 2003. AFV1, a
novel virus infecting hyperthermophilic archaea of the genus Acidianus.
Virology 315:68–79.
3. Bland, C., T. L. Ramsey, F. Sabree, M. Lowe, K. Brown, N. C. Kyrpides, and
P. Hugenholtz. 2007. CRISPR recognition tool (CRT): a tool for automatic
detection of clustered regularly interspaced palindromic repeats. BMC
Bioinformatics 8:209.
4. Blum, H., W. Zillig, S. Mallok, H. Domdey, and D. Prangishvili. 2001. The
genome of the archaeal virus SIRV1 has features in common with genomes
of eukaryal viruses. Virology 281:6–9.
5. Brügger, K., P. Redder, and M. Skovgaard. 2003. MUTAGEN: multi-user
tool for annotating genomes. Bioinformatics 19:2480–2481.
6. Eder, W., W. Ludwig, and R. Huber. 1999. Novel 16S rRNA gene sequences
retrieved from highly saline brine sediments of Kebrit Deep, Red Sea. Arch.
Microbiol. 172:213–218.
7. Edgar, R. C. 2004. MUSCLE: a multiple sequence alignment method with
reduced time and space complexity. BMC Bioinformatics 5:113.
8. Ginalski, K., A. Elofsson, D. Fischer, and L. Rychlewski. 2003. 3D-Jury: a
simple approach to improve protein structure predictions. Bioinformatics
19:1015–1018.
9. Häring, M., X. Peng, K. Brügger, R. Rachel, K. O. Stetter, R. A. Garrett, and
D. Prangishvili. 2004. Morphology and genome organization of the virus
PSV of the hyperthermophilic archaeal genera Pyrobaculum and Thermoproteus:
a novel virus family, the Globuloviridae. Virology 323:233–242.
10. Häring, M., G. Vestergaard, K. Brügger, R. Rachel, R. A. Garrett, and D.
Prangishvili. 2005. Structure and genome organization of AFV2, a novel
archaeal lipothrixvirus with unusual terminal and core structures. J. Bacteriol.
187:3855–3858.
11. Häring, M., G. Vestergaard, R. Rachel, L. Chen, R. A. Garrett, and D.
Prangishvili. 2005. Virology: independent virus development outside a host.
Nature 436:1101–1102.
12. Kessler, A., A. B. Brinkman, J. van der Oost, and D. Prangishvili. 2004.
Transcription of the rod-shaped viruses SIRV1 and SIRV2 of the hyperthermophilic
archaeon Sulfolobus. J. Bacteriol. 186:7745–7753.
13. Kessler, A., G. Sezonov, J. I. Guijarro, N. Desnoues, T. Rose, M. Delepierre,
S. D. Bell, and D. Prangishvili. 2006. A novel archaeal regulatory protein,
Sta1, activates transcription from viral promoters. Nucleic Acids Res. 34:
4837–4845.
14. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of
the head of bacteriophage T4. Nature 227:680–685.
15. Letunic, I., R. R. Copley, B. Pils, S. Pinkert, J. Schultz, and P. Börk. 2006.
SMART 5: domains in the context of genomes and networks. Nucleic Acids
Res. 34:D257–D260.
16. Lillestøl, R. K., P. Redder, R. A. Garrett, and K. Brügger. 2006. A putative
viral defence mechanism in archaeal cells. Archaea 2:59–72.
17. Makarova, K. S., N. V. Grishin, S. A. Shabalina, Y. I. Wolf, and E. V. Koonin.
2006. A putative RNA-interference-based immune system in prokaryotes:
computational analysis of the predicted enzymatic machinery, functional
analogies with eukaryotic RNAi, and hypothetical mechanisms of action.
Biol. Direct 1:7.
18. Mojica, F. J., C. Diez-Villasenor, J. Garcia-Martinez, and E. Soria. 2005.
Intervening sequences of regularly spaced prokaryotic repeats derive from
foreign genetic elements. J. Mol. Evol. 60:174–182.
19. Ortmann, A. C., B. Wiedenheft, T. Douglas, and M. Young. 2006. Hot
crenarchaeal viruses reveal deep evolutionary connections. Nat. Rev. Microbiol.
4:520–528.
20. Peng, X., H. Blum, Q. She, S. Mallok, K. Brügger, R. A. Garrett, W. Zillig,
and D. Prangishvili. 2001. Sequences and replication of genomes of the
archaeal rudiviruses SIRV1 and SIRV2: relationships to the archaeal lipothrixvirus
SIFV and some eukaryal viruses. Virology 291:226–234.
21. Peng, X., A. Kessler, H. Phan, R. A. Garrett, and D. Prangishvili. 2004.
Multiple variants of the archaeal DNA rudivirus SIRV1 in a single host and
a novel mechanism of genomic variation. Mol. Microbiol. 54:366–375.
22. Prangishvili, D., H. P. Arnold, D. Gotz, U. Ziese, I. Holz, J. K. Kristjansson,
and W. Zillig. 1999. A novel virus family, the Rudiviridae: structure, virushost
interactions and genome variability of the Sulfolobus viruses SIRV1 and
SIRV2. Genetics 152:1387–1396.
23. Prangishvili, D., P. Forterre, and R. A. Garrett. 2006. Viruses of the Archaea:
a unifying view. Nat. Rev. Microbiol. 4:837–848.
24. Prangishvili, D., and R. A. Garrett. 2005. Viruses of hyperthermophilic
Crenarchaea. Trends Microbiol. 13:535–542.
25. Prangishvili, D., R. A. Garrett, and E. V. Koonin. 2006. Evolutionary genomics
of archaeal viruses: unique viral genomes in the third domain of life.
Virus Res. 117:52–67.
26. Prangishvili, D., G. Vestergaard, M. Häring, R. Aramayo, T. Basta, R.
Rachel, and R. A. Garrett. 2006. Structural and genomic properties of the
hyperthermophilic archaeal virus ATV with an extracellular stage of the
reproductive cycle. J. Mol. Biol. 359:1203–1216.
27. Rachel, R., M. Bettstetter, B. P. Hedlund, M. Häring, A. Kessler, K. O.
Stetter, and D. Prangishvili. 2002. Remarkable morphological diversity of
viruses and virus-like particles in hot terrestrial environments. Arch. Virol.
147:2419–2429.
28. Reilin, A. 1998. Preparation of catalase crystals. University of Illinois at Urbana-
Champaign, Urbana, IL. http://www.itg.uiuc.edu/publications/techreports/98-009.
29. Rice, G., K. Stedman, J. Snyder, B. Wiedenheft, D. Willits, S. Brumfield, T.
McDermott, and M. J. Young. 2001. Viruses from extreme thermal environments.
Proc. Natl. Acad. Sci. USA 98:13341–13345.
30. Rutherford, K., J. Parkhill, J. Crook, T. Horsnell, P. Rice, M. A. Rajandream,
and B. Barrell. 2000. ARTEMIS: sequence visualization and annotation.
Bioinformatics 16:944–945.
31. Sæbø, P. E., S. M. Andersen, J. Myrseth, J. K. Lærdahl, and T. Rognes. 2005.
PARALIGN: rapid and sensitive sequence similarity searches powered by
parallel computing technology. Nucleic Acids Res. 33:W535–W539.
32. Snyder, J. C., B. Wiedenheft, M. Lavin, F. F. Roberto, J. Spuhler, A. C.
Ortmann, T. Douglas, and M. Young. 2007. Virus movement maintains local
virus population diversity. Proc. Natl. Acad. Sci. USA 104:19102–19107.
32a.Steinmetz, N. F., A Bize, K. C. Findlay, G. P. Lomonossoff, M. Manchester,
D. J. Evans, and D. Prangishvili. Site-specific and spatially controlled addressability
of a new viral nanobuilding block: Sulfolobus islandicus rodshaped
virus 2. Adv. Funct. Mat., in press.
33. Vestergaard, G., R. Aramayo, T. Basta, M. Häring, X. Peng, K. Brügger, L.
Chen, R. Rachel, N. Boisset, R. A. Garrett, and D. Prangishvili. 2008.
Structure of the Acidianus filamentous virus 3 and comparative genomics of
related archaeal lipothrixviruses. J. Virol. 82:371–381.
34. Vestergaard, G., M. Häring, X. Peng, R. Rachel, R. A. Garrett, and D.
Prangishvili. 2005. A novel rudivirus, ARV1, of the hyperthermophilic archaeal
genus Acidianus. Virology 336:83–92.
35. Zillig, W., A. Kletzin, C. Schleper, I. Holz, D. Janekovic, H. Hain, M.
Lanzendörfer, and J. K. Kristjansson. 1994. Screening for Sulfolobales, their
plasmids and their viruses in Icelandic solfataras. System. Appl. Microbiol.
16:609–628.
Downloaded from
jb.asm.org
by on October 1, 2008

Biochemical Society Transactions www.biochemsoctrans.org
Distribution of CRISPR spacer matches in viruses
and plasmids of crenarchaeal acidothermophiles
and implications for their inhibitory mechanism
Molecular Biology of Archaea 23
Shiraz Ali Shah*, Niels R. Hansen† and Roger A. Garrett* 1
*Centre for Comparative Genomics, Department of Biology, Biocenter, Copenhagen University, Ole Maaløes Vej 5, DK-2200 Copenhagen N, Denmark, and
†Department of Mathematical Sciences, Copenhagen University, Universitetsparken 5, DK-2100 Copenhagen Ø, Denmark
Abstract
Transcripts from spacer sequences within chromosomal repeat clusters [CRISPRs (clusters of regularly
interspaced palindromic repeats)] from archaea have been implicated in inhibiting or regulating the
propagation of archaeal viruses and plasmids. For the crenarchaeal thermoacidophiles, the chromosomal
spacers show a high level of matches (∼30%) with viral or plasmid genomes. Moreover, their distribution
along the virus/plasmid genomes, as well as their DNA strand specificity, appear to be random. This is
consistent with the hypothesis that chromosomal spacers are taken up directly and randomly from virus and
plasmid DNA and that the spacer transcripts target the genomic DNA of the extrachromosomal elements
and not their transcripts.
Archaeal CRISPR system
CRISPRs (clusters of regularly interspaced palindromic repeats)
consist of identical repeats separated by unique spacer
sequences of constant length which occur in the sequenced
chromosomes of almost all archaea and approx. 40% of
bacteria (reviewed in [1]). The archaeal repeat clusters are generally
large and can constitute >1% of the chromosome. The
original observation that some spacers show close sequence
matches with archaeal viral genomes led to the hypothesis
that spacer regions have a regulatory effect on viral propagation
[2] and plasmid propagation [1], and this proposal
was subsequently reinforced by several studies on both
archaea and bacteria (reviewed in [1,3,4]). Moreover, a
mechanism for this putative inhibitory effect was suggested,
at an early stage, by the finding that RNA transcripts are
produced, and processed, from at least one strand of the
archaeal repeat clusters [5,6], with the smallest product
corresponding roughly in size to a single spacer transcript
[1]. This opened for the possibility of an antisense RNA
or RNAi (RNA interference)-like mechanism acting either
on the viral transcripts or directly on the viral DNA [1,3].
New spacer-repeat units are added at the end of the repeat
clusters adjoining a low-complexity flanking sequence [1,7],
by a process that probably involves Cas proteins which are
generally encoded adjacent to the clusters [3,5,8]. Experimental
evidence for such a virus-induced addition was
Key words: acidothermophile, archaeal plasmid, archaeal virus, cluster of regularly interspaced
palindromic repeats (CRISPR), crenarchaeon.
Abbreviations used: ATV, Acidianus two-tailed virus; CRISPR, cluster of regularly interspaced
palindromic repeats; ITR, inverted terminal repeat; ORF, open reading frame; SIRV1, Sulfolobus
islandicus rod-shaped virus 1; STIV, Sulfolobus turreted icosahedral virus.
1 To whom correspondence should be addressed (email garrett@bio.ku.dk).
Biochem. Soc. Trans. (2009) 37, 23–28; doi:10.1042/BST0370023
recently provided for bacteria on infecting Streptococcus
thermophilus with bacteriophages 858 and 2972 [9].
Hypothesis
In the present article, we explore and interpret trends
which emerge when collectively analysing chromosomal
CRISPR spacer matches to viral and plasmid genomes.
The crenarchaeal acidothermophiles were selected for the
analysis because they carry large and multiple repeat clusters
[1] and because many of their viruses and plasmids have been
sequenced [10]. The results should yield insights into both the
mechanism of uptake of new spacer regions in CRISPRs and
the mechanism of inhibition or regulation of the viruses
and plasmids. We assume that, if chromosomal spacer sequence
matches occur randomly on the virus or plasmid
genome, then the chromosomal spacer regions are generated
by DNA excision and insertion and not by reverse transcription
from virus/plasmid transcripts. In contrast, a
non-random distribution of matches biased to the genes
would favour the latter RNA-based mechanism. A random
distribution of spacer matches on the virus/plasmid genomes
would also favour a DNA-directed inhibitory mechanism
for the spacer transcripts, whereas a gene-biased distribution
would support the spacer transcripts inhibiting virus/plasmid
gene expression.
Previous studies on the archaeal CRISPRs of related
Sulfolobus solfataricus strains have suggested that individual
spacers are quite stable and that any selective pressure acts
on larger blocks of spacers [1], so we infer that any selective
pressures on CRISPR spacer contents will not influence our
results and interpretation significantly.
C○The Authors Journal compilation C○2009 Biochemical Society

24 Biochemical Society Transactions (2009) Volume 37, part 1
Selection of viruses, plasmids and CRISPRs
Five crenarchaeal virus families, a class of conjugative
plasmids and a family of cryptic plasmids were selected for the
study (Table 1). They include six β-lipothrixviruses, family
Lipothrixviridae;fourrudiviruses,familyRudiviridae;seven
fuselloviruses, family Fuselloviridae; a single bicaudavirus
ATV (Acidianus two-tailed virus), family Bicaudaviridae;
STIV (Sulfolobus turreted icosahedral virus), an unclassified
icosahedral virus (reviewed in [10]), seven members of a conjugative
plasmid family and four members of the pRN cryptic
plasmid family (reviewed in [11]). Each extrachromosomal
element can propagate in members of the related crenarchaeal
thermoacidophilic genera Sulfolobus or Acidianus. Spacer
sequences were derived from 13 whole crenarchaeal chromosomal
sequences, from both acidothermophiles and neutrothermophiles,
and the partial genomes of Acidianus brierleyi,
S. solfataricus P1 and Sulfolobus islandicus HVE10/4 from our
laboratory and of S. islandicus strains LD85, YG5714,
YN1551, M164 and U328 which were publicly available in
May 2008 (Table 1).
Identifying spacer matches
CRISPR regions were localized using publicly available
software [12,13] and examined for the occurrence of spacer
sequence matches to the selected viruses and plasmids. Two
approaches were employed. In one, matches were identified
at a nucleotide sequence level between the similarly oriented
spacer sequences (corresponding to the processed transcript
sequence [1,5,6]) and either strand of the virus/plasmid DNA.
In a second approach, we exploited the observation that
protein sequences are more highly conserved than gene
sequences and tried to detect significant matches additional
to those identified at a nucleotide sequence level. Each spacer
strand was translated into three amino acid sequences, and,
after removing sequences containing stop codons (about
50%), each translated sequence was aligned against amino
acid sequences of all annotated ORFs (open reading frames)
of all the viruses and plasmids. Implicit in this approach is
the assumption that the uptake of spacers in the oriented
CRISPRs is non-directional, and this is borne out by the
results (see below). A nucleotide sequence approach was
also applied to the whole acidothermophile chromosomes
by searching for exact matches to CRISPR spacers (Table 1).
Significant e-value cut-offs were determined for both the nucleotide
and amino acid sequence searches using the genome
sequence of Saccharomyces cerevisiae as a negative control
(results not shown). All sequence alignments were performed
using Paralign, an MMX-optimized implementation of the
Smith–Watermann algorithm [14].
Analysis of the distribution of
chromosomal spacer matches on
virus/plasmid genomes
In total, 82 repeat clusters, some incomplete (Table 1), yielded
4005 spacer sequences, after subtracting 278 spacer sequences
C○The Authors Journal compilation C○2009 Biochemical Society
shared between S. solfataricus strains P1 and P2 [1]. Approx.
30% of the spacers from the acidothermophile genomes
match to the virus and plasmid families (Table 1), whereas
only approx. 5% matched for the neutrothermophiles.
This difference probably reflects that the viruses and plasmids
only fall within the host specificity range for the acidothermophiles.
The locations of all the spacer matches are
superimposed on genome maps of representative genetic elements
in Figure 1. Spacers giving nucleotide sequence matches
to either DNA strand (red lines) occur mainly within genes,
but a few are located intergenically or within the non-proteincoding
region of the ITR (inverted terminal repeat).
Translated spacers yielding amino acid sequence matches,
additionally to the nucleotide sequence matches, occur
within annotated ORFs on either DNA strand (green lines).
In a series of three tests, we attempted to address the
question of whether or not the spacers present in host
chromosomal CRISPRs match the virus/plasmid genomes
in a biased non-random manner. Potential biases include the
preferential matching to certain regions of the virus/plasmid
genome and DNA strand biases. We exclusively used the nucleotide
sequence matching data because it covered the whole
genome.
First, we examined the distribution of spacer sequence
matches, at a nucleotide level, along the virus/plasmid
genomes. We assumed that a uniform distribution would
follow, roughly, a homogeneous Poisson process, whereas
an irregular distribution along the genome would yield a
deviation from the homogeneous Poisson process. We investigated
for this using Kolmogorov–Smirnov test statistics for
each virus and plasmid and we were generally unable to detect
any significant deviations from a homogeneous Poisson
distribution.
Secondly, we tested whether there was any detectable
bias in the spacer matches to the most conserved viral genes
given that they are more likely to be targets for inhibition
of propagation. The number of matches to each gene was
analysed using a Poisson regression model with the gene conservation
and length as explanatory variables. This analysis
showed that the number of matches to a given gene did not
depend significantly upon the degree of its conservation,
although, for SIRV1 (Sulfolobus islandicus rod-shaped
virus 1), we did observe a weak effect for the seven to ten
most conserved genes. Moreover, it was found that the
expected number of matches was proportional to the gene
length, in agreement with the homogeneous Poisson process.
Thirdly, we tested for any bias in the distribution of
spacer matches in coding compared with non-coding regions
or to the sense compared with antisense strands of the virus/
plasmid genes using a specific alternative of a Poisson process
with different intensities for matches occurring within,
and outside, protein-coding regions, treating each DNA
strand separately. We were unable to detect any significant
deviations from a homogeneous Poisson distribution for the
match intensities of the coding compared with non-coding
regions, with the exception of STIV, where there is a bias to
the antisense strand (Figure 1).

C○The Authors Journal compilation C○2009 Biochemical Society
Table 1 Summary of the chromosomal spacer matches to the virus and plasmid genomes of the crenarchaeal acidothermophiles
The number of CRISPR spacers are given which match virus/plasmid family genomes significantly at a nucleotide level, as well as additional matches detected at an amino acid level. Spacer matches to the
host’s own genome constitute only exact nucleotide matches. The total number of chromosomal spacers matching to virus/plasmid genomes differs from the number of spacers that match each plasmid and
virus family because some spacers match more than one family, but have been counted only once. Rudiviruses comprise SIRV1, SIRV2, ARV and SRV1; β-lipothrixviruses constitute AFV3, AFV6, AFV7, AFV8, AFV9
and SIFV, and fuselloviruses include SSV2, SSV4, SSV5, SSVrh, SSVk1 and SSV1. The pNOB8 family contains pNOB8, pARN3, pARN4, pHVE14, pING1, pKEF9, pSOG1 and pSOG2, and the pRN family consists of pHEN7,
pDL10, pRN1 and pRN2. The 278 spacers which S. solfataricus P1 shares with strain P2 were subtracted during the analysis, but have been reinserted in this Table. For the partial genomes, the total numbers of
spacers are approximate, since repeat clusters may not be fully sequenced. Genome sequences for S. solfataricus P1, S. islandicus HVE10/4 and A. brierleyi are unpublished work from our laboratory. Genomes
of S. islandicus strains LD85, YG5714, YN1551, M164 and U328 are publicly available from the JGI (Joint Genome Institute) database (http://www.jgi.doe.gov/). All neutrothermophile genomes were complete
and obtained through GenBank ® accession numbers NC_000854 (Aeropyrum pernix K1), NC_008818 (Hyperthermus butylicus DSM5456), NC_009776 (Ignicoccus hospitalis KIN4/I), NC_003364 (Pyrobaculum
aerophilum IM2), NC_009376 (Pyrobaculum arsenaticum DSM 13514), NC_009073 (Pyrobaculum calidifontis JCM11548), NC_008701 (Pyrobaculum islandicum DSM4184), NC_009033 (Staphylothermus marinus
F1) and NC_008698 (Thermofilum pendens Hrk5).
Spacers pNOB8 family pRN family Spacers Matches with GenBank ® /JGI accession
Strain (total) Rudiviruses β-Lipothrixviruses Fuselloviruses STIV ATV (conjugative) (cryptic) (total matching) own genome number/reference
Acidothermophiles (total) 3313 331 181 134 81 126 226 63 969 1 –
Sulfolobus solfataricus P2 415 53 24 15 9 20 26 12 135 0 NC_002754
Sulfolobus solfataricus P1 423 50 22 19 9 26 32 7 144 0 [1]
Sulfolobus islandicus HVE10/4 270 47 20 20 4 3 19 9 104 0 Unpublished
Sufolobus tokodaii 7 461 23 19 19 13 2 43 6 108 1 NC_003106
Sulfolobus acidocaldarius DSM639 223 14 5 2 1 2 15 4 38 0 NC_007181
Metallosphaera sedula DSM5348 386 20 9 8 6 59 31 4 110 0 NC_009440
Acidianus brierleyi 367 29 21 9 8 5 32 10 100 0 Unpublished
Sulfolobus islandicus LD85 287 65 39 10 6 1 6 6 114 0 4023472
Four Sulfolobus islandicus strains
(YG5714, YN1551, M164, U328)
481 30 22 32 25 8 19 5 116 0 4023468, 4005359,
Neutrothermophiles (total) 963 6 13 14 1 4 16 0 52 0 –
4023464, 4023466
Molecular Biology of Archaea 25

26 Biochemical Society Transactions (2009) Volume 37, part 1
Figure 1 CRISPR spacer matches superimposed on genomes of representative viruses and plasmids
SIRV1, rudiviruses; AFV9 (Acidianus filamentous virus 9), β-lipothrixviruses; SSV2 (Sulfolobus spindle-shaped virus 2),
fuselloviruses; STIV, unclassified icosahedral virus; ATV, bicaudavirus; pNOB8, conjugative plasmids; pHEN7, cryptic plasmids.
A preliminary version of the rudiviral data was presented in [15]. The circular genomes (SSV2, STIV, ATV, pNOB8 and pHEN7)
are presented in a linear format. Protein-coding regions are boxed and shaded, according to their levels of conservation
for those genomes for which comparative data are available (all except for STIV and ATV). Spacer sequence matches are
indicated by lines above and below the genomes for the two DNA strands and they are colour-coded according to whether
they occur exclusively at a nucleotide level (red) or additionally at an amino acid level (green).
Similar results for the first and third tests were obtained
when the analysis was limited to spacer matches from family
I CRISPRs (see below).
Classifying crenarchaeal acidothermophile
CRISPR families
CRISPRs are oriented and they generally carry a 300–600 bp
low-complexity flanking sequence immediately upstream of
the repeat cluster which contains the transcriptional leader
sequence [1]. Sequence analysis of the flanking sequences
by multiple alignment [16] and motif analysis [17], along
with sequence comparison of the repeat sequence from each
C○The Authors Journal compilation C○2009 Biochemical Society
cluster, suggested that the CRISPRs can be classified into
families. All crenarchaeal flanking sequences share a common
A/T-rich motif adjacent to the first repeat of the cluster,
whereas the remainder of the flanking sequence is familyspecific.
At least three distinct families, each with multiple
members, were found for the acidothermophiles by analysing
the flanking sequences alone (Figure 2A), and this finding
was reinforced by constructing a multiple alignment of repeat
sequences from the clusters (Figure 2B). Thus there is a
clear correlation between the nature of the flanking sequence
and the repeat sequence which constitutes a repeat cluster.
These CRISPR families cross species and genus barriers, and
most of the acidothermophile genomes contain clusters from

Figure 2 CRISPR families of crenarchaeal acidothermophiles
(A) Schematicrepresentationofthethreetypesofflankingsequence
associated with CRISPR families I, II and III. All three flanking se-
quences share a motif adjacent to the repeat cluster, whereas
the upstream region of the flank is specific for each family. (B)
Phylogenetic tree created using ClustalW [18] based on a multiple
alignment of a repeats from each acidothermophile repeat cluster.
The CRISPRs studied are labelled by a four-letter prefix based
on the genus and species name in addition to the number of
repeats carried by the repeat cluster. Abri, Acidianus brierleyi; Msed,
Metallosphaera sedula; Saci,Sulfolobus acidocaldarius; Sisl, Sulfolobus
islandicus; Ssol, Sulfolobus solfataricus; Stok, Sufolobus tokodaii.
S. islandicus HVE10/4 and A. brierleyi repeat clusters were not
Molecular Biology of Archaea 27
completely sequenced and the total number of repeats is not given.
The three major repeat cluster families are indicated by differently
shaded boxes. (C) Logo-plot (http://weblogo.berkeley.edu/) of the
motif located upstream of the area on a virus or plasmid genome
matched by a group I spacer. The CC motif was found at approx. 75% of
all matching sites.
different families. Therefore no families are specific to a given
species and no species is limited to a single family. These
results strongly reinforce the hypothesis that CRISPR–Cas
systems are acquired via horizontal gene transfer [1,19].
Over half of the acidothermophile repeat clusters belong
to family I, where, generally, the sequence just upstream of
the virus or plasmid site which matches a family I spacer
carries a CC motif (Figure 2C). Insufficient data precluded
our establishing whether such motifs occur adjacent to
family II and family III spacer matches.
Conclusions
The results demonstrate that CRISPR spacer matches are
uniformly distributed throughout the virus/plasmid genomes,
regardless of both gene location and degree of gene conservation.
Moreover, there is no significant bias to either sense
or antisense strands of genes (with the exception of STIV):
both strands are targeted to an equal degree. These findings
strongly suggest that the spacer regions of the CRISPR
are taken up randomly, and non-directionally, from the
virus or plasmid DNA and are not generated by reverse
transcriptase from virus/plasmid transcripts. The results are
also consistent with the hypothesis that the CRISPR spacer
transcripts target the virus/plasmid by hybridizing directly
to their DNA, possibly priming it for degradation.
The results also support a mechanism whereby virus or
plasmid propagation is inhibited primarily at a DNA level and
not at a gene-expression level. For example, the non-proteincoding
ITR region, which is implicated in rudiviral replication
[10], carries seven spacer matches in SIRV1 (Figure 1)
and other spacer matches occur in intergenic regions which
appear not to be involved in transcriptional regulation
(results not shown).
The inhibitory mechanism also appears to be highly
specific for virus/plasmid DNA, since only one perfect
spacer sequence match was detected within any of the acidothermophile
chromosomal sequences examined (Table 1).
This may be crucial for cell survival if the inhibitory
mechanism involves DNA degradation, but, given that
viruses and plasmids often integrate reversibly into archaeal
chromosomes [20], it suggests that the CRISPR–Cas system
selectively targets DNA of extrachromosomal elements,
whether circular or linear.
The CRISPR–Cas system has been primarily implicated
in viral inhibition in both archaea and bacteria [1,3,4], but it
is clear from the present analysis that, at least for archaea, its
role is more complex. The apparatus targets plasmids, both
conjugative and cryptic, with a similar frequency to viruses
(Figure 1). Moreover, some host CRISPR spacers match their
C○The Authors Journal compilation C○2009 Biochemical Society

28 Biochemical Society Transactions (2009) Volume 37, part 1
own viruses or plasmids, suggesting a regulatory, rather than
an inhibitory, role, and this possibility is reinforced by the low
copy numbers, and non-lytic properties, of most crenarchaeal
viruses [10]. Finally, the observation that a spacer sequence
in the repeat cluster of the conjugative plasmid pKEF9
[21] matches a rudiviral genome suggests that plasmids
themselves can also inhibit/regulate co-infecting viruses.
Acknowledgements
Dr Kim Brügger kindly provided unpublished genome sequence data.
Funding
Work was supported by the Danish National Research Foundation for
a Centre of Comparative Genomics and the Danish Natural Science
Research Council [grant number 272-06-0442].
References
1 Lillestøl, R.K., Redder, P., Garrett, R.A. and Brügger, K. (2006) A putative
viral defence mechanism in archaeal cells. Archaea 2, 59–72
2 Mojica, F.J., Diez-Villasenor, C., Garcia-Martinez, J. and Soria, E. (2005)
Intervening sequences of regularly spaced prokaryotic repeats derive
from foreign genetic elements. J. Mol. Evol. 60, 174–182
3 Makarova, K.S., Grishin, N.V., Shabalina, S.A., Wolf, Y.I. and Koonin, E.V.
(2006) A putative RNA-interference-based immune system in
prokaryotes: computational analysis of the predicted enzymatic
machinery, functional analogies with eukaryotic RNAi, and hypothetical
mechanisms of action. Biol. Direct 1, 7
4Sorek,R.,Kunin,V.andHugenholtz,P.(2008)CRISPR:awidespread
system that provides acquired resistance against phages in bacteria and
archaea. Nat. Rev. Microbiol. 6, 181–186
5Tang,T.-H.,Bachellerie,J.-P.,Rozhdestvensky,T.,Bortolin,M.-L.,
Huber, H., Drungowski, M., Elge, T., Brosius, J. and Hüttenhofer, A. (2002)
Identification of 86 candidates for small non-messenger RNAs from the
archaeon Archaeoglobus fulgidus. Proc. Natl. Acad. Sci. U.S.A. 99,
7536–7541
6Tang,T.-H.,Polacek,N.,Zywicki,M.,Huber,H.,Brügger, K., Garrett, R.A.,
Bachellerie, J. P. and Hüttenhofer, A. (2005) Identification of novel
non-coding RNAs as potential antisense regulators in the archaeon
Sulfolobus solfataricus. Mol. Microbiol. 55, 469–481
7 Pourcel, C., Salvignol, G. and Vergnaud, G. (2005) CRISPR elements in
Yersinia pestis acquire new repeats by preferential uptake of
bacteriophage DNA, and provide additional tools for evolutionary
studies. Microbiology 151, 653–663
C○The Authors Journal compilation C○2009 Biochemical Society
8 Jansen, R., Embden, J.D., Gaastra, W. and Schouls, L.M. (2002)
Identification of genes that are associated with DNA repeats in
prokaryotes. Mol. Microbiol. 43, 1565–1575
9 Barrangou, R., Fremaux, C., Deveau, H., Richards, M., Boyaval, P.,
Moineau, S., Romero, D.A. and Horvath, P. (2007) CRISPR provides
acquired resistance against viruses in prokaryotes. Science 315,
1709–1712
10 Prangishvili, D., Forterre, P. and Garrett, R.A. (2006) Viruses of the
Archaea: a unifying view. Nat. Rev. Microbiol. 11, 837–848
11 Lipps, G. (2006) Plasmids and viruses of the thermoacidophilic
crenarchaeote Sulfolobus. Extremophiles 10, 17–28
12 Edgar, R.C. (2007) PILER-CR: fast and accurate identification of CRISPR
repeats. BMC Bioinformatics 8, 18–24
13 Bland, C., Ramsey, T.L., Sabree, F., Lowe, M., Brown, K., Kyrpides, N.C.
and Hugenholtz, P. (2007) CRISPR Recognition Tool (CRT): a tool for
automatic detection of clustered regularly interspaced palindromic
repeats. BMC Bioinformatics 8, 209–217
14 Saebø, P.E., Andersen, S.M., Myrseth, J., Laerdahl, J.K. and Rognes, T.
(2005) PARALIGN: rapid and sensitive sequence similarity searches
powered by parallel computing technology. Nucleic Acids Res. 33,
535–539
15 Vestergaard, G., Shah, S.A., Bize, A., Reitberger, W., Reuter, M., Phan, H.,
Briegel, A., Rachel, R., Garrett, R.A. and Prangishvili, D. (2008) SRV, a
new rudiviral isolate from Stygiolobus and the interplay of crenarchaeal
rudiviruses with the host viral-defence CRISPR system. J. Bacteriol. 190,
6837–6845
16 Edgar, R.C. (2004) MUSCLE: multiple sequence alignment with high
accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797
17 Bailey, T.L., Williams, N., Misleh, C. and Li, W.W. (2006) MEME:
discovering and analyzing DNA and protein sequence motifs.
Nucleic Acids Res. 34, 369–373
18 Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTAL W:
improving the sensitivity of progressive multiple sequence alignment
through sequence weighting, position-specific gap penalties and weight
matrix choice. Nucleic Acids Res. 22, 4673–4680
19 Godde, J.S. and Bickerton, A. (2006) The repetitive DNA elements called
CRISPRs and their associated genes: evidence of horizontal transfer
among prokaryotes. J. Mol. Evol. 62, 718–729
20 Wang, Y., Duan, Z., Zhu, H., Guo, X., Wang, Z., Zhou, J., She, Q. and
Huang, L. (2007) A novel Sulfolobus non-conjugative extrachromosomal
genetic element capable of integration into the host genome and
spreading in the presence of a fusellovirus. Virology 363,
124–133
21 Greve, B., Jensen, S., Brügger, K., Zillig, W. and Garrett, R.A. (2004)
Genomic comparison of archaeal conjugative plasmids from Sulfolobus.
Archaea 1, 231–239
Received 6 August 2008
doi:10.1042/BST0370023

Molecular Microbiology (2009) 72(1), 259–272 doi:10.1111/j.1365-2958.2009.06641.x
First published online 2 March 2009
CRISPR families of the crenarchaeal genus Sulfolobus:
bidirectional transcription and dynamic properties
Reidun K. Lillestøl, Shiraz A. Shah, Kim Brügger, †
Peter Redder, Hien Phan, Jan Christiansen and
Roger A. Garrett*
Centre for Comparative Genomics, Department of
Biology, University of Copenhagen, Ole Maaløes Vej 5,
2200 Copenhagen N, Denmark.
Summary
Clusters of regularly interspaced short palindromic
repeats (CRISPRs) of Sulfolobus fall into three main
families based on their repeats, leader regions, associated
cas genes and putative recognition sequences
on viruses and plasmids. Spacer sequence matches
to different viruses and plasmids of the Sulfolobales
revealed some bias particularly for family III CRISPRs.
Transcription occurs on both strands of the five
repeat-clusters of Sulfolobus acidocaldarius and a
repeat-cluster of the conjugative plasmid pKEF9.
Leader strand transcripts cover whole repeat-clusters
and are processed mainly from the 3-end, within
repeats, yielding heterogeneous 40–45 nt spacer
RNAs. Processing of the pKEF9 leader transcript
occurred partially in spacers, and was incomplete,
probably reflecting defective repeat recognition by
host enzymes. A similar level of transcripts was generated
from complementary strands of each chromosomal
repeat-cluster and they were processed to
yield discrete ~55 nt spacer RNAs. Analysis of the
partially identical repeat-clusters of Sulfolobus solfataricus
strains P1 and P2 revealed that spacer-repeat
units are added upstream only when a leader and
certain cas genes are linked. Downstream ends of the
repeat-clusters are conserved such that deletions and
recombination events occur internally.
Introduction
Clusters of regularly interspaced short palindromic
repeats (CRISPRs) consist of identical repeats separated
by unique spacer sequences of constant length. They are
Accepted 14 February, 2009. *For correspondence. E-mail garrett@
bio.ku.dk; Tel. (+45) 35322010; Fax (+45) 35322228. † Present
address: Wellcome Trust Sanger Institute, Hinxton, UK.
©2009TheAuthors
Journal compilation © 2009 Blackwell Publishing Ltd
present in the sequenced chromosomes of almost all
archaea and about 40% of bacteria, as well as in some
plasmids (Lillestøl et al., 2006; Grissa et al., 2007; Sorek
et al., 2008). The original observation that some spacers
show close sequence matches to viral genomes and plasmids
(Mojica et al., 2005) led to the hypothesis that
spacer regions are incorporated into the chromosome
from the extra-chromosomal element and have a regulatory
or inhibitory effect on their propagation (Bolotin et al.,
2005; Mojica et al., 2005; Pourcel et al., 2005; Lillestøl
et al., 2006). Recently, this hypothesis was reinforced
experimentally for bacteria by showing that new spacers
deriving from phage genomes integrate into CRISPRs of
Streptococcus thermophilus in response to phage infection,
which in turn leads to phage resistance (Barrangou
et al., 2007; Deveau et al., 2008; Horvath et al., 2008a). In
both archaea and bacteria, new spacer-repeat units are
added at the end of the repeat-clusters adjoining a low
complexity leader sequence (Jansen et al., 2002; Tang
et al., 2002; Pourcel et al., 2005; Lillestøl et al., 2006;
Barrangou et al., 2007), presumably facilitated by Cas
proteins which are generally encoded adjacent to the
clusters (Jansen et al., 2002; Haft et al., 2005; Makarova
et al., 2006).
Despite the akaryotic nature of the CRISPR system
(Forterre, 1992), there are significant differences between
the archaeal and bacterial systems studied so far. First,
archaeal repeat-clusters tend to be very extensive and
can constitute more than 1% of the chromosome (Lillestøl
et al., 2006). Second, they often exhibit a low level of , or
no, dyad symmetry in their repeat sequences (Lillestøl
et al., 2006; Kunin et al., 2007). Third, some of the cas
genes implicated in RNA processing and spacer
sequence insertion are highly divergent between archaea
and bacteria (Haft et al., 2005). Fourth, the many archaeal
spacer sequences which match plasmids or viruses show
no clear bias to viruses (Shah et al., 2009).
A mechanism for the putative regulatory or inhibitory
effect in both euryarchaea and crenarchaea was suggested,
at an early stage, by the finding that RNA transcripts
are produced, and processed, from one strand of
archaeal repeat-clusters (Tang et al., 2002; 2005), with
the smallest product corresponding approximately in
both size and sequence to a single spacer transcript
(Lillestøl et al., 2006). Furthermore, it was demonstrated

260 R. K. Lillestøl et al.
experimentally for a bacterium that a complex of Cas
proteins was responsible for processing in the repeats to
generate the small RNAs encompassing the spacer
regions (Brouns et al., 2008) and for the euryarchaeon
Pyrococcus furiosus, it was shown that the Cas6 protein
binds to the 5′-end of the repeat transcript and cuts, by
a putative ruler mechanism, within the 3′-end (Carte
et al., 2008). In the crenarchaeon Sulfolobus acidocaldarius,
evidence was also presented for transcription
occurring from the complementary strand of the DNA
spacer (Lillestøl et al., 2006). These results opened for
the possibility of an antisense RNA or RNAi-like mechanism
acting either on the viral/plasmid transcripts or
directly on their DNA (Lillestøl et al., 2006; Makarova
et al., 2006). Recent studies on the P. furiosus have
shown that the leader strand spacer RNAs can generate
distinct RNA–protein complexes (Hale et al., 2008).
Moreover, bioinformatical studies on crenarchaeal
CRISPRs (Shah et al., 2009), as well as experimental
studies on bacteria (Brouns et al., 2008; Marraffini and
Sontheimer, 2008), support that spacer RNAs directly
target DNA of extra-chromosomal elements, rather than
their mRNAs.
Here, we characterize CRISPR families of the model
crenarchaeal genus Sulfolobus, and related members of
the Sulfolobales, for which several genomes and numerous
viruses and plasmids have been sequenced (Prangishvili
et al., 2006; Brügger, 2007). The families are
classified on the basis of their repeat sequences, leader
region motifs, associated cas genes, and conserved
dinucleotide motifs adjoining spacer matching sequences
on viruses and plasmids. Properties of transcripts from
each strand of repeat-clusters in S. acidocaldarius chromosomes
and the conjugative plasmid pKEF9 are examined,
as well as the possible formation of double-stranded
spacer RNAs. Moreover, sequencing and bioinformatical
analyses of the six repeat-clusters of Sulfolobus solfataricus
strains P1 and P2 were performed and conclusions
are drawn concerning the dynamics of repeat-cluster
development and functions of the different CRISPR
families.
Results
CRISPR families in Sulfolobales
The repeat-clusters of the Sulfolobales are quite diverse
structurally and we attempted to classify them into families
on the basis of their repeat sequences, leader properties,
associated cas genes and conserved sequences
adjoining spacer sequence matches on viruses/plasmids.
A total of 48 complete and eight incomplete repeatclusters
were identified for the Sulfolobales, of which at
least 51 carried putative leader sequences, and they
yielded 3685 spacer sequences. Phylogenetic tree building
based on repeat sequences revealed three main families
and some minor ones where family I dominates
(Fig. 1A). Each species typically carries representatives
of two repeat families (Fig. 1A). Analyses of all cas genes
associated with the repeat-clusters of the Sulfolobales
reinforced the family divisions. A phylogenetic tree built
from alignments of the most conserved cas1 gene, encoding
a predicted integrase or nuclease (Makarova et al.,
2006), yielded essentially the same family tree as in
Fig. 1A (data not shown). Moreover, in an all-against-all
comparison of cas genes adjoining repeat-clusters, each
gene generally yielded best matches to other genes of the
same family, despite family I genes being overrepresentative
(data not shown).
For the leader regions, alignment of 300 bp of each
sequence revealed a large fairly conserved downstream
region which carries multiple distinct sequence motifs,
most of which are specific for a given CRISPR family
(Fig. 1B). Moreover, these classes of motifs show significant
levels of sequence conservation despite some of
them exhibiting low sequence complexity. Of these, motif A
carries 70% adenines, motif B exhibits 95% purines, motifs
C, F, G and J contain 50–60% thymines, while motifs D, H
and I are more complex. For all families some motifs are
repeated (Fig. 1B). We infer that these motifs are likely to
provide, directly or indirectly, assembly sites for Cas proteins
involved in processing RNA and/or in extending the
repeat-clusters. Lastly, examination of spacer sequence
matches on viruses/plasmids of the Sulfolobales revealed
Fig. 1. Family classification of Sulfolobales CRISPRs.
A. Phylogenetic tree based on a multiple alignment of repeat sequences showing three main families I, II and III. CRISPRs are labelled by a
four-letter prefix denoting the species, and the number of repeats.
B. Motif maps for leader regions of the three main CRISPR families. The motifs constitute conserved sequences, 30–100 bp in length,
showing on average 80% sequence identity. Sequence motifs A, B and C occur in more than one family [motif C occurs in some unclassified
leaders (Fig. 1A)], whereas the other motifs are family specific. Thus motifs D, E, F and G occur only in family I leaders, motifs H and I are
present only in family II leaders and motif J is exclusive to family III leaders. Leaders of each family show some variation in the number and
order of the motifs present. Motif A overlaps with the transcriptional leader region.
C. Logo-plot (http://weblogo.berkeley.edu/) of the motif located immediately upstream of the spacer match on viral/plasmid genomes where CC
predominates in 129 matches for family I, TC in 23 matches for family II, and GT in 19 matches for family III CRISPRs, where one bit
corresponds to about 75% presence and two bits correspond to 100%. The logo plots are based exclusively on spacer matches which show a
maximum of five nucleotide mismatches.
©2009TheAuthors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 72, 259–272

©2009TheAuthors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 72, 259–272
Archaeal CRISPRs of Sulfolobus 261

262 R. K. Lillestøl et al.
A
Saci-133
Saci_1871
Saci-11
Saci-5
Saci_1974
B
- 6.5 kb
L
Saci_1975
conserved upstream dinucleotide motifs: CC for family I,
TC for family II and GT for family III which may direct DNA
incorporation into CRISPRs (Fig. 1C). These may constitute
an archaeal parallel to the AGAAA and GGNG motifs
located downstream from bacterial proto-spacers of
S. thermophilus (Horvath et al., 2008a).
Genome contexts of the repeat-clusters
L
cas1 cas4
L
Saci-2
cas3
csa3 Saci_2016
Repeat cluster Repeat sequence
The S. acidocaldarius chromosome carries five repeatclusters
with 133, 78, 11, 5 and 2 repeats which fall into
CRISPR families II and III (Fig. 1A). Saci-133 and Saci-78
(family III) are physically linked, with shared cas genes.
They exhibit 95% identical leader sequences adjoining
the first repeat and carry identical, non-palindromic
repeats (Fig. 2A and B). Saci-11 and Saci-2 (family II) are
physically linked by cas genes (Fig. 2A) and carry identi-
L
cas-genes
8.13 kb
pKEF-7
Saci-78
CAG38159 CAG38160
Saci-133/78 GTAATAACGACAAGAAACTAAAAC
Saci-11/2 GATGAATCCCAAAAGGGATTGAAAG
Saci-5 A T
pKEF-7 GTTGCAATTCCCTAAATGTGCGGG
L
- 3.8 kb
cas1 Saci_1882
Fig. 2. A. Diagram showing the genomic context of the S. acidocaldarius repeat-clusters, and of the pKEF9 cluster. Saci-133 and Saci-78
are physically linked on the chromosome, as are Saci-11 and Saci-2. Saci-5 and the plasmid cluster pKEF-7 are separate. L denotes the
leader region. Identities of genes bordering the clusters or their GenBank/EMBL assignments are given and their directions of transcription are
indicated.
B. Repeat sequences where inverted repeat sequences are underlined, and experimentally identified processing sites are marked with ‘ ’s.
1 kb
cal leader sequences while the more divergent Saci-5
(family II) exhibits a repeat with two base pair changes
and a leader sequence showing 75% sequence identity
(Chen et al., 2005; Lillestøl et al., 2006). All of the family II
repeats carry a 5 bp inverted repeat (Fig. 2B). Repeatclusters
Saci-5 and Saci-2 each carry a degenerate
repeat, distal to the leader region. The repeat-cluster
(pKEF-7) of conjugative plasmid pKEF9 carries no leader
sequence and no associated cas genes (Fig. 2A) (Greve
et al., 2004).
Repeat-clusters generate single transcripts covering the
whole cluster
In order to investigate transcripts formed during the
growth cycle, RNA was extracted from S. acidocaldarius,
and from S. solfataricus P2 conjugated with pKEF9, har-
©2009TheAuthors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 72, 259–272

exp. stat.
1 2 3 4
vested at different stages of exponential growth and,
for the former, stationary phase. Oligonucleotide probes
complementary to spacers of the repeat-clusters were
tested in Northern blot analyses. Initially, Saci-78 transcripts
were probed for spacer 4, adjacent to the leader
region, and the results demonstrate that processing
increased progressively as stationary phase was
approached (Fig. 3). The maximum transcript size, about
5000 nt, exceeds the size of the 4624 bp repeat-cluster,
indicating that the whole cluster was transcribed (Fig. 3).
However, the majority of detected transcripts fall in the
size range 3000–3500 nt suggesting that endogenous
degradation, processing or premature termination had
occurred towards the 3′-end. Evidence for the formation of
whole transcripts was also obtained for each of the small
repeat-clusters Saci-5 (Lillestøl et al., 2006), Saci-11 and
Saci-2 (data not shown), and pKEF-7 (see below).
Transcription from the leader strand
6.0
5.0
4.0
3.0
2.5
2.0
1.5
1.0
Fig. 3. Northern blot of Saci-78 transcripts using an
oligonucleotide probe against spacer 4. Ten microgram RNA was
isolated from S. acidocaldarius cells harvested at: (1) early log
phase, (2) late log phase, (3) early stationary phase and (4) late
stationary phase. RNA size markers (0.5–9 kb) were
co-electrophoresed and excised from the gel prior to RNA blotting.
In order to test whether transcription initiated at single or
multiple sites, we determined start sites at the leader of
Saci-133 and Saci-5 by identifying RNA fragments carrying
5′-terminal triphosphates using tobacco acid phos-
M
phatase in 5′-RLM RACE procedures. The results
demonstrate that start sites occur immediately upstream
from the first repeat sequence for both repeat-clusters
(Fig. 4A and B) and the start sites are preceded upstream
by archaeal BRE/TATA motifs (Torarinsson et al., 2005).
For Saci-133, transcription initiated at the sequence
GATGG, 17 nt upstream from the first repeat (Fig. 4A;
Table 1). An identical sequence/motif pattern occurs for
Saci-78. A different pattern was found for the family II
clusters Saci-11, Saci-5 and Saci-2 where transcription
initiates at the sequence AAGGG, 21 nt upstream from
the first repeat and is also preceded by archaeal promoter
motifs (Fig. 4B; Table 1).
We probed for transcripts initiating at the leader of Saci-
133 using oligonucleotides complementary to spacers 5,
6, 59 and 131. Strong signals were obtained for each
spacer (Fig. 5A) consistent with the whole cluster being
transcribed in fairly high yield, as was demonstrated for
Saci-78 (Fig. 3). The low level of larger transcripts
detected with probes against spacers 59 and 131 sug-
A Saci-133
M - +
©2009TheAuthors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 72, 259–272
0
500
400
300
200
100
Start
4(9)
5(3)
5(23)
6(3)
6(15)
B Saci-5
500
400
300
200
100
M - +
Archaeal CRISPRs of Sulfolobus 263
Start
1(8)
1(17)
C Saci-133
0
500
400
300
200
100
M
133(10)
132(11)
131(22)
Fig. 4. Determination of the transcriptional start sites, and
processing sites of RNA products generated from Saci-133 and
Saci-5 using the 5′-RLM RACE and 3′-RLM RACE procedures.
A. Determination of 5′-ends of transcripts from Saci-133 where
RNA was treated with (+) and without (-) tobacco acid phosphatase
to remove 5′-phosphates from the 5′-end of the initial transcript,
and an oligonucleotide primer specific for spacer 7 was employed.
Bands exclusive to the + lane retain the transcriptional start site
whereas bands present in both + and - lanes represent transcripts
which have been processed at the 5′-end.
B. Determination of 5′-ends of transcripts from Saci-5 using an
oligonucleotide primer specific for spacer 1. The band showing in
the + lane of about 160 bp is an artefact, where sequencing
revealed that two adapters had ligated to each other and to the
start site.
C. 3′-RLM RACE experiment performed on transcripts from
Saci-133 using a primer specific for spacer 130. The three bands
represent transcripts which have been processed within the
terminal repeats 131, 132 and 133. In each experiment processing
sites are indicated by number of the repeat (from the leader) where
the position of the 5′-nucleotide within the repeat is given in
brackets.

264 R. K. Lillestøl et al.
Table 1. Overview of promoters, transcriptional start sites and processing sites in repeat-clusters Saci-133, Saci-5 and pKEF-7 identified by the
5′-RLM RACE method.
Cluster BRE-TATA Start
gests that transcript processing occurs primarily from the
3′-end (Fig. 5A). Probing of the repeat also revealed a
similar series of bands except for the smallest RNAs
(Fig. 5A).
Distance from
first repeat Processing sites
Saci-133 GAAAATATTTATAAA GATGG +17 nt 4 (9), 5 (3), 5 (23), 6 (3), 6 (18)
Saci-5 GCAAAAGTTTATTAA AAGGG +21 nt 1 (8), 1 (17)
pKEF-7 GAAAAAGTTTATTA AATCT +32 nt +23, 1 (24)
Putative BRE and TATA motif sequences are located approximately 25 bp upstream from transcription start sites and the processing sites within
the repeats (numbered from the leader region) give the position of the 5′-nucleotide in brackets.
A
150
100
90
80
70
60
50
40
M1 repeat 133(5) 133(6) 133(59) 133(131) M2
B
M1 repeat 133(5) 133(6) 133(60) 133(131) M2
150
100
90
80
70
60
50
40
30
500
400
300
200
100
40-50
500
400
300
200
100
50-60
Fig. 5. Northern blot analyses of Saci-133 transcripts. The repeat
sequence and spacers at positions 5 (37 nt), 6 (42 nt), 59 (41 nt)
and 131 (36 nt) from the leader, were probed with oligonucleotides
to detect: (A) transcripts initiating within the leader sequence, and
(B) transcripts generated from the complementary strand. Twenty
microgram RNA was isolated from cells grown to stationary phase.
RNA size markers of 10–150 nt (M1) and 100–2000 nt (M2) are
aligned approximately with the transcript lanes.
The larger products observed with both spacer and
repeat probes correspond in size to transcripts of multiple
repeat-spacer units (Fig. 5A) whereas the smallest products
seen when using spacer probes range in size from a
single repeat-spacer unit (62–68 nt) to the spacer (40 nt)
suggesting that progressive exoribonuclease trimming
occurs within repeats flanking the spacer, consistent with
the inability to detect the smallest RNAs with the repeat
probe (Fig. 5A) and the earlier observation for Saci-5
(Lillestøl et al., 2006). Saci-11 and Saci-2 were also
probed with spacer-specific oligonucleotides, and Northern
blots yielded closely comparable patterns (data not
shown).
5′-RLM RACE analyses of Saci-133 and Saci-5 also
revealed processing sites (Fig. 4A and B). Multiple processing
sites were identified throughout the repeats for
Saci-133 but confined to the inverted repeat for Saci-5 at
positions 8 and 17 (Table 1; Fig. 2B).
3′-Termini of Saci-133 transcripts were also determined
by the 3′-RLM RACE method employing a probe against
spacer 130. Three main bands were produced which,
on sequencing, revealed processing sites distributed
throughout terminal repeats 131, 132 and 133, at positions
10, 11 and 22 (Fig. 4C). The absence of further
downstream bands suggested that the transcript terminus
had been efficiently excised.
In order to confirm that processing occurred exclusively
within repeat sequences, Saci-133 transcripts on
one membrane were probed, successively, by spacer
5-specific, and then repeat-specific, probes. Both probes
yielded similar patterns for the larger transcripts but the
smallest transcripts were only detected with spacerspecific
probes (Fig. 5A). Thus, the final processing step
occurs in the repeat leaving the spacer intact.
Complementary strand is transcribed
In a preliminary experiment, we demonstrated that Saci-5
transcripts are produced from both DNA strands (Lillestøl
et al., 2006). As this raised the possibility that dsRNA
intermediates could be formed, we studied these effects
more systematically for Saci-133 Saci-78, Saci-11, Saci-5
©2009TheAuthors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 72, 259–272

and Saci-2. Transcripts from the complementary DNA
strand of Saci-133 were probed for spacers 5, 6, 60 and
131 (numbered from the leader). Each showed strong
signals (Fig. 5B) but they differed from those of leader
strand transcripts in that products were less regular in size
and larger transcripts prevailed. Nevertheless, the
smallest product for each spacer probe was a discrete
band of about 55 nt (Fig. 5B). Similarly sized RNAs
were observed when probing each of the other four
S. acidocaldarius repeat-clusters (data not shown), consistent
with the earlier observation for Saci-5 (Lillestøl
et al., 2006). These small RNAs must contain all or most
of the spacer sequence because the strong band
observed with each spacer probe was not detected with a
repeat probe (Fig. 5B).
Northern analyses of each of the chromosomal repeatclusters
indicated strong signals for all tested spacer
probes, indicating that transcription from the complementary
strand occurred throughout each cluster, as is illustrated
for Saci-133 (Fig. 5B). This result was reinforced by
a Northern blot analysis in which the complementary
strand transcripts from the Saci-5 cluster were probed for
spacer 1, adjacent to the leader region, and the largest
transcript (430 nt) exceeds the minimal size of the repeatcluster
(300 bp) (Fig. 6). Moreover, each of the five clusters
carries at least one putative promoter BRE/TATA
motif within 50 bp of the terminal repeat of the repeatcluster.
In addition, there are no open reading frames
(ORFs) within at least 3 kb of the putative promoters, on
500
400
300
200
100
M Saci-5 0
430
190
Fig. 6. Northern blot analysis of transcripts from the
complementary strand of Saci-5, probing for spacer 1, adjacent to
the leader region. RNA size markers of 100–2000 nt (M1) are
aligned approximately with the transcript lanes. The size of the
smallest transcript was estimated using an independent,
co-electrophoesed, size maker as shown in Fig. 5.
52
©2009TheAuthors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 72, 259–272
Archaeal CRISPRs of Sulfolobus 265
the complementary DNA strand, for any chromosomal
repeat-clusters, except Saci-2 (Fig. 2B).
A comparison of transcript yields from the leader and
complementary strands indicated qualitatively similar
expression levels from both strands of Saci-133 (Fig. 5A
and B). This is difficult to quantify accurately because of
the complexity and diversity of the RNA fragment patterns
(Fig. 5A and B) but qualitatively similar transcription levels
were observed for all five repeat-clusters.
The possibility that functional dsRNAs were generated
between spacer transcripts from each DNA strand was
tested by a ribonuclease digestion approach using
ssRNA-specific enzymes RNase T1 and RNase U2 which
cleave preferentially 3′- to G and A residues respectively,
but do not cleave regular dsRNA (Christiansen et al.,
1990). Total RNA from S. acidocaldarius was treated with
increasing concentrations of each ribonuclease and
Northern blots were obtained by probing for spacer 6 of
Saci-133 transcripts from each strand. The results
revealed progressive cleavage of both the leader and
complementary strand transcripts at increasing ribonuclease
concentrations but no resistant dsRNA band of
about 40 bp was detected (data not shown). This may
reflect that specific protein–ssRNA complexes form as
was shown for the leading strand spacer RNA of
P. furiosus (Hale et al., 2008).
pKEF-7 transcripts are processed in both repeats
and spacers
Despite its lack of associated cas genes and leader
region, we considered the pKEF9 repeat-cluster to be a
CRISPR system because three of the six spacers match
to Sulfolobus viruses, spacer 3 to rudiviruses and
spacers 5 and 6 to fuselloviruses. This is consistent with
the conjugative plasmid regulating the viruses intracellularly.
Therefore, RNA was isolated from S. solfataricus
P2 14 h after conjugating with pKEF9 before plasmid
levels rapidly decline. For the predicted leader strand
(Fig. 2A), 5′-ends were determined by 5′-RLM RACE
analyses using a primer specific for spacer 1. The
results revealed a single transcript start site, 32 nt
upstream from the first repeat, preceded by promoter
motifs (Table 1). Processing sites were also identified
23 nt upstream from the first repeat, and at the junction
of the first repeat and spacer (Fig. 7A; Table 1). Northern
blotting experiments were then performed probing each
half of each spacer sequence, as well as the repeat
(Fig. 7B). The results for each probe revealed a largest
product of about 465 nt, corresponding in size to a transcript
from the whole repeat-cluster. The transcript patterns
indicated that smaller products disappeared,
stepwise, as one probed along the transcript in a 5′ to 3′
direction (Fig. 7B). The experiment was repeated, after

266 R. K. Lillestøl et al.
A
400
300
200
100
M - +
B
465
410
345
285
245
210
183
Start 165
+32
148
+23
145
139
1(24)
104
95
Fig. 7. Transcription from the pKEF-7 cluster.
A. 5′-RLM RACE analyses of the transcriptional start site and processing sites near the start of the transcript. RNA was treated with (+) and
without (-) tobacco acid phosphatase.
B. Northern blot analyses of transcripts from the pKEF-7 cluster using oligonucleotide probes specific for the left (L) and right (R) halves of
spacers 1, 2, 3, 4, 5, 6 and the repeat sequence respectively.
C. Northern blot analyses of transcripts from the complementary strand from the pKEF-7 cluster using oligonucleotide probes specific for
spacer 6 and the repeat sequence. RNA was isolated 14 h after conjugation in A, B and C. RNA size markers of 100–500 nt (M) are aligned
and approximate fragment sizes are given.
conjugating S. solfataricus P2 for 20 h, when the smaller
transcripts observed for spacer 1 were also seen for the
other spacers, consistent with increased processing
having occurred as stationary phase was approached
(data not shown).
The transcript patterns are complicated by the presence
of sets of weak and strong signals (Fig. 7B) where the
former match those of the S. acidocaldarius clusters
(above) in size and putative processing in repeats
(Table 2). For example, the 95 nt and 104 nt transcripts
observed for the spacer 1 probe are consistent in size with
their extending from the start site, or processing site 9 nt
downstream (Fig. 7A, Table 1), to a processing site in
repeat 2 (Table 2). For the stronger transcripts, differences
were observed when probing each half of the
spacer transcripts (Fig. 7B). Probes upstream halves (L)
revealed smaller fragments than probing downstream
halves (R), seen most dramatically for probes against
spacer 2 (139–148 nt) and spacer 3 (210 nt) (Fig. 7B).
The strong transcripts are consistent in size with their
extending from the initiation, or downstream processing,
site to the downstream (R) spacer halves (Table 2).
The repeat probe yielded a similar transcript pattern as
for spacer 2 and differed from that for spacer 1 (Fig. 7B)
probably because of non-annealing of the primer to the
degenerate first repeat. This was reinforced by the lack of
processing in the first repeat sequence, as determined by
the 5′-RLM RACE method (Fig. 7A). Transcripts from the
complementary DNA strand were also detected probing
for spacer 6 and the repeat sequence (Fig. 7C), and tran-
500
400
300
200
100
scripts in the size range 185–480 nt were observed for the
former and 145–480 nt for the latter, similar in size to
transcripts observed from the leader strand. The absence
of spacer-sized RNAs from either DNA strand could
reflect that the final RNA processing enzymes are activated
mainly in stationary phase (Fig. 3) or incompatibility
M1L 1R 2L 2R 3L 3R 4L 4R 5L 5R 6L 6R Rep
C
6
Rep
M
500
400
300
200
100
Table 2. Summary of transcriptional start sites and estimated sizes
and processing sites for transcripts deriving from pKEF-7 as illustrated
in Fig. 7B.
Transcript Start Stop
Weak (normal) Repeat/(position)
95/104 +23/+32 2 (9)
165/183 +23/+32 3 (22)
245 +23/+32 4 (19)
Strong (abnormal) Spacer (position)
139/148 +23/+32 2 (29)
210 +23/+32 3 (25)
285 +23/+32 4 (35)
345 +23/+32 5 (23)
410 +23/+32 6 (30)
Weak (abnormal)
145 1 (24) 3 (16)
Transcripts included in the normal/weak category appear to be
processed in the same manner as the S. acidocaldarius clusters.
Processing sites are localized by the repeat number and the
estimated nucleotide position in brackets. Transcripts in the abnormal
category are processed in the right half of spacers (position denoted
by the spacer number and the estimated nucleotide position in
brackets). +32 denotes the transcriptional initiation site and +23 and
1 (24) indicates processing sites identified by the 5′-RLM RACE
method.
©2009TheAuthors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 72, 259–272

Fig. 8. Patterns of repeat-spacer units in repeat-clusters A–F of S. solfataricus strain P1 are aligned with those from S. solfataricus strain P2
(She et al., 2001), where each arrowhead represents a single spacer-repeat unit, and the number to the right indicates the total number of
units. Grey boxed regions indicate sequences that are identical for a given pair of clusters. Blackened units lie within these conserved regions
but yield no matches to viruses/plasmids. Spacers which yield significant matches to viruses or plasmids are colour-coded as indicated on the
figure. Boxes to the left of the clusters represent leader regions that are coloured according to the leader family, blue – family I, purple –
family II (Fig. 1B). The larger arrowhead in cluster D of strain P1 represents a 899 bp pNOB8-like fragment, and the large arrowhead in cluster
F denotes a 106 bp insert with two atypical repeat sequences and abnormal spacer regions. Preliminary data on clusters B, C and E were
presented earlier (Lillestøl et al., 2006).
between processing enzymes and the plasmid repeat
sequence (Carte et al., 2008).
Functional properties of the CRISPR families
For S. acidocaldarius the 297 spacer sequences yield
only 44 (15%) significant matches to virus/plasmid
sequences, relatively few compared with up to 40% for
other Sulfolobales genomes (Lillestøl et al., 2006; Shah
et al., 2009). Therefore, to gain more insight into the functional
diversity of different CRISPR families, we completed
the sequencing of the six repeat-clusters A–F of
S. solfataricus strain P1 because, although repeatclusters
B, C and E share regions of perfectly conserved
spacer-repeat sequences with S. solfataricus strain P2,
they also yielded many additional virus/plasmid sequence
©2009TheAuthors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 72, 259–272
Archaeal CRISPRs of Sulfolobus 267
matches (Lillestøl et al., 2006). The primary structures of
repeat-clusters A–F of strain P1 are displayed together
with those of strain P2 (She et al., 2001) in Fig. 8, where
the locations and distributions of virus/plasmid matches
are indicated.
Repeat-clusters A and B represent family II CRISPRs,
while C, D, E and F belong to family I (Fig. 1A). Each
repeat-cluster of strains P1 and P2 shares identical
regions of sequence enclosed in grey boxes (Fig. 8).
While cluster pairs E and F are identical, the others all
show evidence of repeat-spacer units having been added
at the leader region, after separation of the strains,
although the repeat-cluster sizes and apparent rates of
extension differ greatly. Repeat-clusters B from strain P1
and D from strain P2 show evidence of putative deletions
of 21 and 45 repeat spacer units respectively, and there

268 R. K. Lillestøl et al.
Fig. 9. Pie plots for the main CRISPR families I, II and III of the Sulfolobales where the percentage of spacer sequence matches are given
for the different crenarchaeal viral families and plasmid classes which are colour-coded. Spacer matches investigated for each family: family I
(2031 spacers tested, 771 significant matches), family II (710 spacers tested, 230 significant matches) and family III (298 spacers tested, 88
significant matches).
are minor differences within the conserved regions of
cluster A. Moreover, cluster A shares a sequence of four
repeat-spacer units with cluster B of strain P1, suggesting
that homologous recombination has occurred between
different clusters of the same family. Importantly, the
downstream ends of each pair of repeat-clusters are conserved
which suggests that the clusters lose their repeatspacer
units primarily by internal deletions (Fig. 8).
Cluster D of strain P1 and cluster F of both strains carry
anomalous inserts. The former is an 899 bp region
showing a significant sequence match to the conjugative
plasmid pNOB8 (She et al., 1998) while the latter region
carries a degenerate repeat-spacer region with a different
repeat sequence and an abnormally sized spacer, possibly
also of plasmid origin.
The absence of newly added repeat-spacer units to
cluster F, and the lack of a leader region (Fig. 8), raised
the question as to whether the cluster was active. Therefore,
we probed for spacer 11 of cluster F of strain P2
using a Northern blot analysis. A similar fragment pattern
was obtained as for the S. acidocaldarius clusters
(Fig. 5A) except that small spacer RNAs (< 66 nt) were
absent (data not shown). This indicated, as for pKEF-7
(Fig. 7B), a defective final processing stage which could
be caused by the lack of a leader region and/or the
absence of some physically linked cas genes.
The number of significant spacer matches to viruses/
plasmids was 39% and 38% for strains P1 and P2 respectively,
which carry a total of 431 and 417 spacers
respectively. The colour coding of the matches (Fig. 8)
reveals some apparent biases. For example, there is a
high proportion of bicaudaviral matches in the newly
added spacers of cluster D (family I), for both strains,
which contrasts with the high proportion of rudiviral
matches in clusters A and B (family II) and suggests that
individual CRISPR families exhibit a preference for certain
extra-chromosomal elements. To test this hypothesis
further, data for significant spacer sequence matches to
viruses/plasmids for the three main CRISPR families of
the Sulfolobales were summarized in Pie plots (Fig. 9).
The overall ratios of spacer matches to viruses/plasmids,
for families I, II and III, are 3.5, 2.0 and 3.5 respectively,
suggesting that the family II CRISPRs have a relative bias
to plasmids. Although no absolute biases are apparent
(Fig. 9), rudiviral matches dominate for family III and conjugative
plasmid matches are enhanced for family II
CRISPRs. The rudiviruses, lipothrixviruses and conjugative
plasmids, which predominate in the Pie plot, are all
abundant environmentally (Greve et al., 2004; Bize et al.,
2008; Vestergaard et al., 2008).
Discussion
Biogenesis of small archaeal RNAs appears to proceed
from a full-length single-stranded primary transcript that is
cleaved by endoribonucleases as was recently reported
for the Cas6 protein in P. furiosus (Carte et al., 2008). This
suggests that the mechanism of cleavage in archaea
is distinct from the Dicer endoribonuclease-dependent
mechanism generating si- and miRNAs in eukarya.
However, eukarya also generate small RNAs by Dicerindependent
mechanisms such as seen for piRNA-like
species, and although the mechanism of biogenesis of the
latter in terms of trans-acting factors is unresolved, certain
aspects are reminiscent of the process observed in this
study. In particular, the presence of an independently processed
complementary RNA strand has been reported
(reviewed in Klattenhoff and Theurkauf, 2008). As there is
no evidence for an RNA-dependent RNA polymerase in
Sulfolobus, transcription of the complementary strand is
likely to be dictated by the putative promoter elements
located immediately downstream from the CRISPR loci.
Inspection of downstream elements of all CRISPR clusters
in S. acidocaldarius reveals BRE/TATA promoter
©2009TheAuthors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 72, 259–272

egions, that are likely to initiate full-length complementary
strand RNA products, as shown for the Saci-5 cluster
(Fig. 6). Further processing of the complementary transcripts
are likely to proceed by an endoribonuclease distinct
from that generating spacer RNAs from the leader
strand transcript, because the ‘handles’ in the repeats
must be different given their different RNA sizes (about
55 nt versus 40–45 nt). What is the functional significance
of the complementary small RNAs? One possibility is that
they neutralize the leader spacer RNAs in the absence of
invading extra-chromosomal elements, although we failed
to detect dsRNAs in the expected size range, but another
possibility is that loading of leader-spacer RNAs onto
an Argonaute-containing complex has to proceed via a
dsRNA intermediate, as observed for the si- and miRNA
pathways. The presence of Argonautes in archaea may
facilitate a distinct mode of guide RNA presentation from
that seen in bacteria, where there is no evidence of the
participation of a complementary RNA strand in CRISPR
function (Brouns et al., 2008; Marraffini and Sontheimer,
2008).
Cellular activity of CRISPRs
The observation that more than one CRISPR family is
generally present in one organism suggested that they
may provide added versatility in regulating or inhibiting
invading viruses or plasmids, and this supposition
received some support from the finding that putative recognition
signals upstream from predicted proto-spacer
sequences on viruses/plasmids are different for different
CRISPR families (Fig. 1C). Analysis of the repeat-clusters
of the two CRISPR families of S. solfataricus strains P1
and P2 revealed biases to bicaudaviruses for family I, and
to rudiviruses for family II, CRISPRs (Fig. 8). A study of
3039 spacers from the three main families of all the Sulfolobales
also showed significant biases, in particular a
preference of family III spacers for rudiviruses (Fig. 9).
This supports that the presence of multiple CRISPR families
may produce a more versatile response to invading
genetic elements.
The results also show that the CRISPR system of
S. acidocaldarius is primed to react rapidly to invasion in
that the large cluster transcripts are present despite the
absence of viruses and plasmids. The system only
requires that the RNA processing enzymes are rapidly
activated. The observation that processing of the leader
transcript strongly increases in the stationary phase
(Fig. 3) is also consistent with these cells being more
susceptible to external attack.
Generation of spacer RNAs
Transcripts on the leader strand initiate just upstream
from the first repeat, independently of the presence of a
©2009TheAuthors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 72, 259–272
Archaeal CRISPRs of Sulfolobus 269
leader region. Processing occurs primarily from the 3′-end
of a single transcript of the whole repeat-cluster, although
limited processing also occurs at the 5′-end (Fig. 4A), and
repeats are targeted to generate a series of fragments.
The small spacer RNAs from exponentially growing and
stationary phase cells, ranging in size from 40 to 52 nt
and 35 to 52 nt respectively, represent a spectrum of
fragments which anneal with spacer-specific, but not
repeat-specific probes (Fig. 5A), consistent with earlier
observations for archaea and bacteria (Lillestøl et al.,
2006; Brouns et al., 2008; Hale et al., 2008). Processing
activity initiates mainly at stationary phase, at least for
cells lacking extra-chromosomal elements (Fig. 3).
Recently, it was shown that the Cas6 endoribonuclease
binds to the 5′-end of a P. furiosus repeat, which can
generate a hairpin structure, and cuts near the 3′-end
(Carte et al., 2008). This result could explain the anomalous
processing of the pKEF-7 transcript (Fig. 7B; Table 2)
which exhibits an unusual 3′-terminal repeat sequence
(Fig. 2B). Nevertheless, given the wide sequence and
secondary structural diversity of repeat RNAs (Peng
et al., 2003; Kunin et al., 2007), the enzymes must exhibit
a wide range of recognition mechanisms.
Transcripts of the complementary strand were invariably
produced from each repeat-cluster and they ranged
in size from larger fragments to spacer RNAs of about
55 nt, about 16 nt larger than the probed spacer, and
consistent with the earlier observation for Saci-5 (Lillestøl
et al., 2006). Although no reproducible RNA expression
was observed from the complementary spacer strand for
the euryarchaeon P. furiosus (Hale et al., 2008), this could
have a technical explanation. For the cDNA libraries only
fragments < 50 nt were screened for, and in the Northern
blot analysis, the 12% polyacrylamide gels used would
not have resolved the large transcripts observed for
Sulfolobus (Fig. 5B).
Regular and irregular development of repeat-clusters
The pairs of repeat-clusters E and F from S. solfataricus
P1 and P2 are both identical and have not undergone
structural changes since the strains diverged (Fig. 8).
Cluster E (Ssol-8) carries a family I leader but a degenerate
first repeat, which may inhibit cognate enzyme recognition
of the repeat and, thereby, subsequent extension
of the repeat-cluster. In contrast, cluster F (Ssol-91) lacks
a leader sequence which could provide an assembly site
for DNA enzymes involved in cluster extension. In addition,
clusters E and F lack physically linked cas genes
which could be important for DNA insertion functions
(Cas1) or RNA processing (Cas2 and Cas4) (Makarova
et al., 2006; Beloglazova et al., 2008).
Irregularities in archaeal repeat-clusters are extremely
rare (Lillestøl et al., 2006). However, in cluster F of both

270 R. K. Lillestøl et al.
strains, a 106 bp region containing a half spacer preceded
by two atypical repeat sequences is followed by a regular
repeat sequence and no spacer (Fig. 8). These structures
maintain the precise size of the spacer-repeat units in the
cluster suggesting that some kind of ruler mechanism
regulates the insertion of new spacer-repeat units.
Another exceptional irregularity occurs in cluster D of
strain P1, where an 899 bp fragment carrying a pNOB8like
conjugative plasmid sequence (She et al., 1998) is
flanked by repeats. Both examples may reflect a mechanistic
defect whereby large plasmid regions, the former
carrying repeats, have been incorrectly excised and incorporated
into the repeat-cluster. Further examination of this
region may yield some insight into how DNA is obtained
from extra-chromosomal elements.
Mechanism of CRISPR transfer
The commonality of CRISPR families in different Sulfolobus
strains suggests that they can be transferred horizontally
(Lillestøl et al., 2006; Horvath et al., 2008b) but the
mechanism by which this could occur is unclear. For some
bacteria it was proposed that large plasmids could carry
and transmit the CRISPR apparatus (Godde and Bickerton,
2006) but known crenarchaeal cryptic plasmids are
quite small (5–10 kb) and the largest conjugative plasmids
are only 40–50 kb (Greve et al., 2004), insufficiently
large to carry complex CRISPR systems. One possibility
is that the system is transferred by chromosomal conjugation.
Both S. acidocaldarius and Sulfolobus tokodaii
chromosomes carry encaptured conjugative plasmids
where the genes implicated in the conjugative process are
maintained (Greve et al., 2004) and for S. acidocaldarius,
at least, conjugative transfer of chromosomal DNA has
been demonstrated experimentally (Aagaard et al., 1995;
Grogan, 1996).
Experimental procedures
Growth of Sulfolobus cells and preparation of DNA
Sulfolobus acidocaldarius cells were grown at 78°C in
complex medium containing 2% tryptone (Schleper et al.,
1995) and harvested at exponential or stationary phase by
centrifuging at 4000 r.p.m. and 4°C for 15 min. Cells of
S. solfataricus strains P1 and P2 were grown at 80°C in
complex medium containing 2% tryptone (Schleper et al.,
1995). Total DNA used for repeat-cluster sequencing was
isolated from S. solfataricus strain P1 using DNeasy Kit
(Qiagen, Westberg, Germany). Conjugation was initiated by
mixing a culture of S. islandicus strain Hi165 which harbours
the conjugative plasmid pKEF9, with S. solfataricus P2 cells
at a ratio of 1:10 000 at A600 = 0.17 (Schleper et al., 1995).
Cells were harvested at 14 h after conjugation and centrifuged
at 4000 r.p.m. for 6 min at 4°C. pKEF9 was isolated
using the Plasmid Mini Kit (Qiagen) and digested with EcoRI
to verify its presence (Greve et al., 2004).
RNA preparation, RNase digestion and Northern blotting
Total RNA from S. acidocaldarius cells, and S. solfataricus
cells conjugated with pKEF9, was prepared using Trizol
(Invitrogen, Paisley, UK) according to the Invitrogen protocol
essentially as used for extracting plant si-RNAs (Sunkar
et al., 2005) and treated with DNase I (Applied Biosystems/
Ambion, Austin, TX) according to the protocol from Ambion,
and essentially as used for extracting plant si-RNAs
(Sunkar et al., 2005). To detect dsRNA, 20 mg of RNA was
treated with various concentrations of RNase T1 (Ambion) in
RNase-digestion III buffer (Ambion), and RNase U2
(Sankyo, Japan) in digestion buffer 20 mM Na acetate
(pH 4.6), 2 mM MgCl2, 100 mM KCl, at 37°C for 30 min.
RNase was inactivated and the RNA was precipitated
with 225 ml of RNase inactivation/precipitation solution III
(Ambion) together with 150 ml ethanol at -20°C for 1 h or
overnight. For Northern blotting of small RNAs, 20 mg RNA
was mixed with 10 ml Gel Loading Buffer II (Applied
Biosystems/Ambion) and fractionated in a 6–10% polyacrylamide
gel containing 7 M urea, 90 mM Tris, 90 mM boric
acid, 2 mM EDTA, pH 8.3, together with a 10–150 nt ladder
(Decade Marker System, Ambion, Huntigdon, UK) or a
0.1–2.0 kb RNA ladder (Invitrogen). RNA was transferred
onto Hybond N + nylon membranes (GE Healthcare, Amersham,
UK) or GeneScreen plus nylon membranes (PerkinElmer
Life Sciences, Boston, USA) using the Bio-Rad
semidry blotting apparatus (Bio-Rad, Hercules, CA) and
0.5¥ TBE (45 mM Tris, 45 mM boric acid, 1 mM EDTA,
pH 8.3) as the blotting buffer. For Northern blotting with
large RNAs, 12 mg RNA was mixed with Northern Max-Gly
Sample Loading Dye (Applied Biosystems/Ambion) and
fractionated in a 1.5% agarose-BPTE (10 mM PIPES,
pH 6.5, 30 mM Bis-Tris, 1 mM EDTA) gel, together with a
0.5–9 kb Millenium Marker (Applied Biosystems/Ambion).
The RNA was transferred onto Hybond N + nylon membranes
(GE Healthcare) by capillary blotting with 0.2 M
NaH2PO4, pH 7.4, 3.0 M NaCl, 0.02 M EDTA. After immobilizing
the RNAs using a UV Crosslinker (Stratagene, La
Jolla, USA), the nylon membranes were pre-hybridized for
1 h in 6¥ SSPE buffer (0.9 M NaCl, 60 mM NaH2PO4,
4.6 mM EDTA, pH 7.4), 0.5% SDS and 5¥ Denhardt’s solution
at 5°C lower than the Tm of the probe (TH). Oligonucleotides
24–26-mers complementary to a spacer, or the
repeat, on either strand, were end-labelled with [g 32 P]-ATP
and T4 polynucleotide kinase. Hybridization was performed
at the TH of the probe in 6¥ SSPE, 0.5% SDS, 3¥ Denhardt’s
solution for 18 h. The samples were washed three
times at room temperature with 6¥ SSPE buffer and 0.1%
SDS for 15 min each and, subsequently, at the TH in the
same buffer. Membranes were exposed to Ultra UV-G X-ray
film (Dupharma, Kastrup, Denmark) for 1 h to 3 days.
Determination of transcript ends
The RLM-RACE kit (Applied Biosystems/Ambion) was used
to determine the ends of transcripts generated from repeatclusters
in S. acidocaldarius and pKEF9, with some modifications
in the kit-protocol. To identify 5′-ends, 5 mg RNA was
treated with tobacco acid pyrophosphatase (TAP) according
to the protocol. Both TAP-treated and untreated RNA were
©2009TheAuthors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 72, 259–272

then linked to a 5′-RLM RACE adapter with RNA ligase,
followed by reverse transcription from a spacer-specific
primer according to the protocol. Products were then amplified
by PCR with a 5′-RLM RACE adapter-specific primer
containing a BamHI restriction site at the 5′ end and a spacerspecific
primer carrying an EcoRI restriction site, in order to
facilitate cloning of the PCR products into pUC18. The PCRproducts
were run on a 2% low melting agarose gel and
purified with QIAquick Gel Extraction Kit (Qiagen). The fragments
were cloned into BamHI and EcoRI-digested pUC18 at
a molar ratio of 4:1 and sequenced.
Sequencing of clusters in S. solfataricus P1
Long range PCR products were obtained across the chromosomal
cluster regions of S. solfataricus strain P1 using the
Herculase II kit (Stratagene, La Jolla, CA) according to the
protocol, with 300 ng genomic DNA in 50 ml reactions. DNA
fragments were purified using Qiaquick PCR purification kit
(Qiagen) and sequenced. Sequences were analysed with
Sequencher (Gene Codes, Ann Arbor, MI). BLAST searches
were performed against the Sulfolobus Database (http://
sulfolobus.org).
Bioinformatical analysis of CRISPRs of the Sulfolobales
Repeat-clusters were identified using publicly available
software (Edgar, 2007; Bland et al., 2007) in all available
Sulfolobales genomes (S. solfataricus P2, S. tokodaii 7,
S. acidocaldarius DSM 639, Metallosphaera sedula
DSM5348 from GenBank (http://www.ncbi.nlm.nih.gov/
Genbank/), Sulfolobus islandicus strains LD85, YG5714,
YN1551, M164 and U328 from JGI (http://genome.jgi.doe.
gov/mic_asmb.html), and S. islandicus strains HVE10/4 and
REY15A and Acidianus brierleyi (unpublished data). Repeatcluster
names identify the species and number of repeats.
Repeat-cluster orientations were determined by locating the
upstream leader sequence and/or by examining the repeat
sequence. Leader sequences, when present, were limited to
300 bp for the multiple alignment analyses (Edgar, 2004) and
motif analyses (Bailey et al., 2006). Representative repeat
sequences from each identified repeat-cluster were aligned
(Edgar, 2004) and a phylogenetic tree was generated
(Higgins et al., 1994). Spacer sequences from each repeatcluster
were aligned (Sæbø et al., 2005) against the
genomes of extra-chromosomal elements of the Sulfolobales
(http://sulfolobus.org/; Brügger, 2007) at a nucleotide level
(Shah et al., 2009). Additionally, spacers were aligned
against amino acid sequences of annotated ORFs of the
extra-chromosomal elements, at an amino acid level (Shah
et al., 2009; Vestergaard et al., 2008). Significance cut-offs
were determined for both alignment types by using the
genome sequence of Saccharomyces cerevisiae as a negative
control.
Acknowledgements
The work was supported by grants from the Danish Natural
Science Research Council and the Danish National
Research Foundation.
References
©2009TheAuthors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 72, 259–272
Archaeal CRISPRs of Sulfolobus 271
Aagaard, C., Dalgaard, J., and Garrett, R.A. (1995) Intercellular
mobility and homing of an archaeal rDNA intron
confers selective advantage over intron- cells of Sulfolobus
acidocaldarius. Proc Natl Acad Sci USA 92: 12285–12289.
Bailey, T.L., Williams, N., Misleh, C., and Li, W.W. (2006)
MEME: discovering and analyzing DNA and protein
sequence motifs. Nucleic Acids Res 34: 369–373.
Barrangou, R., Fremaux, C., Deveau, H., Richards, M.,
Boyaval, P., Moineau, S., et al. (2007) CRISPR provides
acquired resistance against viruses in prokaryotes.
Science 315: 1709–1712.
Beloglazova, N., Brown, G., Zimmerman, M.D., Proudfoot,
M., Makarova, K.S., Kudritska, M., et al. (2008) A novel
family of sequence-specific endoribonucleases associated
with the Clustered Regularly Interspaced Short Palindromic
Repeats. J Biol Chem 29: 20361–20371.
Bize, A., Peng, X., Prokofeva, M., Maclellan, K., Lucas, S.,
Forterre, P., et al. (2008) Viruses in acidic geothermal environments
of the Kamchatka Peninsula. Res Microbiol 159:
358–366.
Bland, C., Ramsey, T.L., Sabree, F., Lowe, M., Brown, K.,
Kyrpides, N.C., and Hugenholtz, P. (2007) CRISPR
Recognition Tool (CRT): a tool for automatic detection of
clustered regularly interspaced palindromic repeats. BMC
Bioinformatics 8: 209.
Bolotin, A., Quinquis, B., Sorokin, A., and Ehrlich, S.D. (2005)
Clustered regularly interspaced short palindrome repeats
(CRISPRs) have spacers of extrachromosomal origin.
Microbiology 151: 2551–2561.
Brouns, S.J., Jore, M.M., Lundgren, M., Westra, E.R.,
Slijkhuis, R.J., Snijders, A.P., et al. (2008) Small CRISPR
RNAs guide antiviral defense in prokaryotes. Science 321:
960–964.
Brügger, K. (2007) The Sulfolobus database. Nucleic Acids
Res 35: D413–D415.
Carte, J., Wang, R., Li, H., Terns, R.M., and Terns, M.P.
(2008) Cas6 is an endoribonuclease that generates guide
RNAs for invader defense in prokaryotes. Genes Dev 22:
3489–3496.
Chen, L., Brügger, M., Skovgaard, M., Redder, P., She, Q.,
Torarinsson, E., et al. (2005) The genome of Sulfolobus
acidocaldarius, a model organism of the Crenarchaeota.
J Bacteriol 187: 4992–4999.
Christiansen, J., Egebjerg, J., Larsen, N., and Garrett, R.A.
(1990) Analysis of rRNA structure: experimental and theoretical
considerations. In Ribosomes and Protein
Synthesis. Spedding, G. (ed.). Oxford: Oxford University
Press, pp. 229–252.
Deveau, H., Barrangou, R., Garneau, J.E., Labonté, J.,
Fremaux, C., Boyaval, P., et al. (2008) Phage response to
CRISPR-encoded resistance in Streptococcus thermophilus.
J Bacteriol 190: 1390–1400.
Edgar, R.C. (2004) MUSCLE: multiple sequence alignment
with high accuracy and high throughput. Nucleic Acids Res
32: 1792–1797.
Edgar, R.C. (2007) PILER-CR: fast and accurate identification
of CRISPR repeats. BMC Bioinformatics 8: 18.
Forterre, P. (1992) Neutral terms. Nature 355: 305.
Godde, J.S., and Bickerton, A. (2006) The repetitive DNA
elements called CRISPRs and their associated genes: evi-

272 R. K. Lillestøl et al.
dence of horizontal transfer among prokaryotes. J Mol Evol
62: 718–729.
Greve, B., Jensen, S., Brügger, K., Zillig, W., and Garrett,
R.A. (2004) Genomic comparison of archaeal conjugative
plasmids from Sulfolobus. Archaea 1: 231–239.
Grissa, I., Vergnaud, G., and Pourcel, C. (2007) The CRISP-
Rdb database and tools to display CRISPRs and to generate
dictionaries of spacers and repeats. Bioinformatics 8:
172.
Grogan, D.W. (1996) Exchange of genetic markers at
extremely high temperatures in the archaeon Sulfolobus
acidocaldarius. J Bacteriol 178: 3207–3211.
Haft, D.H., Selengut, J., Mongodin, E.F., and Nelson, K.E.
(2005) A guild of 45 CRISPR-associated (Cas) protein
families and multiple CRISPR/Cas subtypes exist in
prokaryotic genomes. PLoS Comput Biol 1: 474–483.
Hale, C., Kleppe, K., Terns, R.M., and Terns, M.P. (2008)
Prokaryotic silencing (psi) RNAs in Pyrococcus furiosus.
RNA 14: 1–8.
Higgins, D., Thompson, J., Gibson, T., Thompson, J.D.,
Higgins, D.G., and Gibson, T.J. (1994) CLUSTAL W:
improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific
gap penalties and weight matrix choice. Nucleic Acids Res
22: 4673–4680.
Horvath, P., Romero, D.A., Coûté-Monvoisin, A.C., Richards,
M., Deveau, H., Moineau, S., et al. (2008a) Diversity, activity,
and evolution of CRISPR loci in Streptococcus
thermophilus. J Bacteriol 190: 1401–1412.
Horvath, P., Coûté-Monvoisin, A.C., Romero, D.A., Boyaval,
P., Fremaux, C., and Barrangou, R. (2008b) Comparative
analysis of CRISPR loci in lactic acid bacteria genomes. Int
J Food Microbiol doi:10.1016/j.ijfoodmicro.2008.05.030
Jansen, R., Embden, J.D., Gaastra, W., and Schouls, L.M.
(2002) Identification of genes that are associated with DNA
repeats in prokaryotes. Mol Microbiol 43: 1565–1575.
Klattenhoff, C., and Theurkauf, W. (2008) Biogenesis and
germline functions of piRNAs. Development 135: 3–9.
Kunin, V., Sorek, R., and Hugenholtz, P. (2007) Evolutionary
conservation of sequence and secondary structures in
CRISPR repeats. Genome Biol 8: R61.
Lillestøl, R.K., Redder, P., Garrett, R.A., and Brügger, K.
(2006) A putative viral defence mechanism in archaeal
cells. Archaea 2: 59–72.
Makarova, K.S., Grishin, N.V., Shabalina, S.A., Wolf, Y.I.,
and Koonin, E.V. (2006) A putative RNA-interferencebased
immune system in prokaryotes: computational
analysis of the predicted enzymatic machinery, functional
analogies with eukaryotic RNAi, and hypothetical mechanisms
of action. Biol Direct 1: 7.
Marraffini, L.A., and Sontheimer, E.J. (2008) CRISPR interference
limits horizontal gene transfer in Staphylococci by
targeting DNA. Science 322: 1843–1845.
Mojica, F.J., Diez-Villasenor, C., Garcia-Martinez, J., and
Soria, E. (2005) Intervening sequences of regularly spaced
prokaryotic repeats derive from foreign genetic elements.
J Mol Evol 60: 174–182.
Peng, X., Brügger, K., Shen, B., Chen, L., She, Q., and
Garrett, R.A. (2003) Genus-specific protein binding to the
large clusters of DNA repeats (Short Regularly Spaced
Repeats) present in Sulfolobus genomes. J Bacteriol 185:
2410–2417.
Pourcel, C., Salvignol, G., and Vergnaud, G. (2005) CRISPR
elements in Yersinia pestis acquire new repeats by preferential
uptake of bacteriophage DNA, and provide additional
tools for evolutionary studies. Microbiology 151: 653–663.
Prangishvili, D., Forterre, P., and Garrett, R.A. (2006) Viruses
of the Archaea: a unifying view. Nat Rev Microbiol 11:
837–848.
Sæbø, P.E., Andersen, S.M., Myrseth, J., Laerdahl, J.K.,
and Rognes, T. (2005) PARALIGN: rapid and sensitive
sequence similarity searches powered by parallel computing
technology. Nucleic Acids Res 33: 535–539.
Schleper, C., Holz, I., Janekovic, D., Murphy, J., and Zillig, W.
(1995) A Multicopy plasmid of the extremely thermophilic
archaeon Sulfolobus effects its transfer to recipients by
mating. J Bacteriol 177: 4417–4426.
Shah, S.A., Hansen, N.R., and Garrett, R.A. (2009) Distributions
of CRISPR spacer matches in viruses and plasmids
of crenarchaeal acidothermophiles and implications for
their inhibitory mechanism. Biochem Soc Trans 37: 23–28.
She, Q., Phan, H., Garrett, R.A., Albers, S.-V., Stedman,
K.M., and Zillig, W. (1998) Genetic profile of pNOB8 from
Sulfolobus: the first conjugative plasmid from an archaeon.
Extremophiles 2: 417–425.
She, Q., Singh, R.K., Confalonieri, F., Zivanovic, Y., Gordon,
P., Allard, G., et al. (2001) The complete genome of the
crenarchaeon Sulfolobus solfataricus P2. Proc Natl Acad
Sci USA 98: 7835–7840.
Sorek, R., Kunin, V., and Hugenholtz, P. CRISPR – a
widespread system that provides acquired resistance
against phages in bacteria and archaea. (2008) Nat Rev
Microbiol 6: 181–186.
Sunkar, R., Girke, T., and Zhu, J.K. (2005) Identification and
characterization of endogenous small interfering RNAs
from rice. Nucleic Acids Res 33: 4443–4454.
Tang, T.-H., Bachellerie, J.-P., Rozhdestvensky, T., Bortolin,
M.-L., Huber, H., Drungowski, M., et al. (2002) Identification
of 86 candidates for small non-messenger RNAs from
the archaeon Archaeoglobus fulgidus. Proc Natl Acad Sci
USA 99: 7536–7541.
Tang, T.-H., Polacek, N., Zywicki, M., Huber, H., Brügger, K.,
Garrett, R.A., et al. (2005) Identification of novel noncoding
RNAs as potential antisense regulators in the
archaeon Sulfolobus solfataricus. Mol Microbiol 55: 469–
481.
Torarinsson, E., Klenk, H.P., and Garrett, R.A. (2005) Divergent
transcriptional and translational signals in Archaea.
Environ Microbiol 7: 47–54.
Vestergaard, G., Shah, S.A., Bize, A., Reitberger, W., Reuter,
M., Phan, H., et al. (2008) SRV, a new rudiviral isolate from
Stygiolobus and the interplay of crenarchaeal rudiviruses
with the host viral-defence CRISPR system. J Bacteriol
190: 6837–6845.
©2009TheAuthors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 72, 259–272

Environmental Microbiology (2009) doi:10.1111/j.1462-2920.2009.02009.x
Four newly isolated fuselloviruses from extreme
geothermal environments reveal unusual morphologies
and a possible interviral recombination mechanismemi_2009 1..14
Peter Redder, 1 * Xu Peng, 2 Kim Brügger, 2
Shiraz A. Shah, 2 Ferdinand Roesch, 1 Bo Greve, 2
Qunxin She, 2 Christa Schleper, 3 Patrick Forterre, 1
Roger A. Garrett 2 and David Prangishvili 1
1 Unite de Biologie Moleculaire du Gene chez les
Extremophiles, Institut Pasteur, 25, rue du Dr Roux,
F-75015 Paris, France.
2 Danish Archaea Centre, Department of Biology,
Biocenter, Ole Maaløesvej 5, Copenhagen University,
DK-2200 Copenhagen N, Denmark.
3 Department of Genetics in Ecology, University of
Vienna, Althanstrasse 14, A-1090 Vienna, Austria.
Summary
Spindle-shaped virus-like particles are abundant in
extreme geothermal environments, from which five
spindle-shaped viral species have been isolated to
date. They infect members of the hyperthermophilic
archaeal genus Sulfolobus, and constitute the Fuselloviridae,
a family of double-stranded DNA viruses.
Here we present four new members of this family, all
from terrestrial acidic hot springs. Two of the new
viruses exhibit a novel morphotype for their proposed
attachment structures, and specific features of their
genome sequences strongly suggest the identity of
the host-attachment protein. All fuselloviral genomes
are highly conserved at the nucleotide level, although
the regions of conservation differ between viruspairs,
consistent with a high frequency of homologous
recombination having occurred between them.
We propose a fuselloviral specific mechanism for
interviral recombination, and show that the spacers of
the Sulfolobus CRISPR antiviral system are not
biased to the highly similar regions of the fusellovirus
genomes.
Received 2 April, 2009; accepted 18 June, 2009. *For correspondence.
E-mail peterredder@gmail.com; Tel. (+41) 774000253; Fax
(+41) 223795108.
©2009SocietyforAppliedMicrobiologyandBlackwellPublishingLtd
Introduction
In contrast to the rather uniform landscape of virion
morphotypes in aquatic systems under moderate environmental
conditions, mainly represented by tailed bacteriophages
(reviewed by Prangishvili, 2003), virus-like
particles observed in ecological niches at high temperatures,
low pH or high salinity reveal a high diversity of
complex morphotypes (Guixa-Boixareu et al., 1996; Oren
et al., 1997; Rice et al., 2001; Rachel et al., 2002; Häring
et al., 2005; Porter et al., 2007; Bize et al., 2008). About
40 virus species isolated from such environments, all
carrying double-stranded (ds) DNA genomes, have been
described, which infect members of the third domain of
life, the Archaea (reviewed in Prangishvili et al., 2006a).
Most common are viruses with an overall spindle-shaped
morphology, either tail-less, tailed or even two-tailed,
which taxonomically have been assigned to the viral
families Fuselloviridae (SSV1, SSV2, SSV4, SSVrh and
SSVk1, single-tailed), Bicaudaviridae (ATV, two-tailed)
and the genus Salterprovirus (His 1 and His 2) while some
still require classification (STSV1 and PAV1) (Schleper
et al., 1992; Bath and Dyall-Smith, 1998; Arnold et al.,
1999; Geslin et al., 2003; Wiedenheft et al., 2004; Xiang
et al., 2005; Bath et al., 2006; Prangishvili et al., 2006b;
Peng, 2008).
Five fuselloviruses have so far been isolated from
acidic geothermal environments in different locations in
Asia, Europe and North America, and they replicate in
species of the hyperthermophilic archaeal genus Sulfolobus,
which represents a significant percentage of the
microbial population in most acidic terrestrial hot springs.
Another major player in these environments is the genus
Acidianus, from which several viruses have been isolated,
including the linear filamentous and rod-shaped viruses
AFV1 and ARV1, respectively, which have close viral relatives
that also infect Sulfolobus (Prangishvili et al., 2006a;
Snyder et al., 2007). Although the two genera coexist, no
fusellovirus has yet been isolated from Acidianus, even
though it appears to be the most predominant Sulfolobus
viral type.
The circular dsDNA genomes of five known fuselloviruses
are highly similar at both nucleotide and amino acid
sequence levels, with the majority of gene products being

2 P. Redder et al.
Fig. 1. A. Representative electron microscopy images of SSV6, SSV7 and ASV1. The end-filaments of SSV7 are very sticky, and the virus is
almost always observed in ‘rosettes’ or attached to vesicles (white arrows). A rare single SSV7 is also shown (dotted white arrow). SSV6 and
ASV1 do not have sticky ends and are always single, even when lying close together. Furthermore, SSV6 and ASV1 exhibit a wide range of
morphotypes, varying from the standard spindle shape to an elongated sausage shape (indicated by dotted black arrows for SSV6).
B. Magnification of the end-filaments of the three viruses. The filaments of SSV6 and ASV1 are thick, and seem to form a crown around the
virus tips (black arrows) whereas SSV7 carries thinner filaments, that protrude directly from the virus tips. All samples were negatively stained
with 2% Uranyl acetate and the scalebars are all 100 nm.
of unknown function and lacking homologues in public
sequence databases other than in other archaeal viruses
(Wiedenheft et al., 2004). The viral DNA is protected
against the harsh environment, at temperatures above
80°C and pH values below 2, within a spindle-shaped
virion about 100 nm long and 60 nm wide, with a bunch of
short, thin fibres at one of the pointed ends (Martin et al.,
1984; Stedman et al., 2003; Wiedenheft et al., 2004;
Peng, 2008). In the electron microscopy, the body is
sometimes observed to be slightly elongated and more
‘cigar-shaped’, and the tail fibres appear to be quite sticky,
readily attaching to cellular fragments, as well as linking
virions to produce rosette-like aggregates (Fig. 1A –
SSV7).
SSV1 is the best studied fusellovirus, and the virion has
been shown to contain proteins VP1, VP2, VP3 and small
amounts of SSV1_D244 and SSV1_C792 (Reiter et al.,
1987a; Menon et al., 2008). VP1 and VP3 are thought to
be capsid proteins, whereas VP2 has been assigned a
DNA-binding role, organizing DNA, but it is not encoded
by other fuselloviruses (Stedman et al., 2003; Wiedenheft
et al., 2004). Four non-structural SSV1 proteins have
been characterized. SSV1_D63 is considered to link
two different protein complexes, while SSV1_F93 and
©2009SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology

Fig. 2. A. Graphical alignment of the nine circular fuselloviral genomes, linearized at the first nucleotide after the VP3 stop codon (following
the convention of Wiedenheft et al., 2004). All ORFs larger than 50 amino acids indicated by arrows. Shades of blue and green: 13 ‘core’
genes. Dark grey: ORFs found in two or more fuselloviruses. Light grey: ORFs only found in one fusellovirus. Black: VP2. Yellow:
SSV1_C792 homologues, both full length and partial. Red: SSV6_B1232 homologues. Orange: SSV1_B78 homologues. Light pink:
SSV1_D244 homologues associated with the Integrase operon in all but ASV1 and SSVk1. Dark violet and light violet: Rad3-like helicase and
Msed_2283 homologues substituting for a large part of the Integrase operon in ASV1, SSV7 and SSVk1. Dark pink: SSV1_F93 homologues.
Brown: Highly conserved SSV1_C84 homologue overlapping with some of the other ‘core’ genes. Magenta: SSV1-C80 homologues and
ASV1-A59. The transcripts identified by Fröls and colleagues (2007) are indicated below SSV1.
B. The two different putative end-filament modules, exemplified by SSV1 and SSV6.
SSV1_F112 are DNA binding proteins implicated in transcriptional
regulation (Kraft et al., 2004a,b; Menon et al.,
2008). The fourth protein is an integrase of the tyrosine
recombinase family, which catalyses site-specific integration
of the viral genome into the host chromosome. As the
viral recombination site (attP) is located within the integrase
gene, integration leads to gene partition (Palm
et al., 1991; Muskhelishvili et al., 1993). Despite this
highly specialized adaptation, the integrase was recently
©2009SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology
Fuselloviral diversity 3
shown to be non-essential for virus replication and basic
viral functions (Clore and Stedman, 2007).
Replication of SSV1 and SSV2 can be induced by UV
irradiation (Yeats et al., 1982; Stedman et al., 2003). The
SSV1 transcription cycle, following UV induction, has also
been elucidated by Northern analysis, physical mapping
and DNA microarrays, and transcripts were classified as
early (T5, T6 and T9), late (T3, Tx and T8) and UV inducible
(Tind) (Fig. 2) (Reiter et al., 1987b; Fröls et al., 2007).

4 P. Redder et al.
The proteins encoded in the early transcripts of SSV1,
and their homologues in other fuselloviruses, are often
cysteine-rich compared with proteins encoded in the late
transcripts (Palm et al., 1991; Stedman et al., 2003;
Wiedenheft et al., 2004). This has recently been proposed
to be due to intra- and extra-cellular localization of the
early and late proteins respectively (Menon et al., 2008).
Here we report on the isolation and properties of four
novel members of the Fuselloviridae, infecting species of
the hyperthermophilic archaeal genera Sulfolobus and
Acidianus, almost doubling the number of known fuselloviruses
and extending their host-range to a new genus,
Acidianus. This merited a revised comparative genomic
analysis of fuselloviruses, which provided insights into
functions of some viral proteins and addressed general
questions concerning the evolution of the viruses and
interactions with their hosts.
Results
Isolation of virus–host systems
Three different methods were used to acquire the new
viruses reported in this communication. SSV5 was discovered
as an extrachromosomal element within cells of
S. solfataricus P2 (DSM1617), infected as a result of
mixing the cells with an icelandic HVE14 enrichment
culture (see Experimental procedures). This traditional
method of isolating new viruses allows a large number of
viruses to be screened, but it restricts the search for
specific virus–host systems.
A different approach was used for SSV6 and SSV7,
where transmission electron microscopy analysis of the
supernatant from an enrichment of the G4 site at
Hveregedi, Iceland, revealed a large number of fuselloviruses.
Attempts to isolate single virus–host systems by
colony purification resulted in two pure strains, each harbouring
a different fusellovirus. Strain G4T-1 was a host
for Sulfolobus spindle-shaped virus 7 (SSV7) while strain
G4ST-T-11 was the natural producer of a pleiomorphic
virus named Sulfolobus spindle-shaped virus 6, SSV6.
The former was found to be produced in very low amounts
under normal growth conditions, but it was possible to
increase SSV7 production about 10-fold (as estimated by
counting viral particles in the electron microscope), either
by shifting the culture to a medium with lower tryptone
concentration, or by inducing with UV light. Strain G4T-1
and G4ST-T-11 may in fact be the same species, as their
partial 16S rRNA sequences were identical to S. islandicus
strain I7 (AY247894.1) with a single base substitution
to distinguish them from S. solfataricus P2. This virus
isolation approach did not impose any bias on the choice
of viral host (except for choosing the growth conditions),
and it provided a ‘natural’ virus–host system. However, a
bias is imposed on the virus, which excludes the possibility
of isolating single colonies of the host if the virus is
highly lytic under the chosen conditions.
Finally, the fourth virus described here, Acidianus
spindle-shaped virus 1, ASV1, was discovered as an
extrachromosomal and integrated element in the course
of sequencing the genome of Acidianus brierleyi
DSM1651, and the production of virions was subsequently
confirmed by electron microscopy (Fig. 1). While
this method for isolating new viruses is not generally
applicable, it is likely to become more common that extrachromosomal
elements are detected while sequencing
genomes from strain collections.
Morphology
The spindle-shaped virion of SSV7, ~90 nm long and
~50 nm wide, resembles virions of all previously known
fuselloviruses morphologically, as well as by its tendency
to form ‘rosettes’ by sticking to neighbouring viral particles
(Fig. 1). In contrast, negatively stained virions of SSV6
and ASV1, both appear much more pleiomorphic than the
other fuselloviruses, and assume shapes ranging from
thin cigar-like to pear-like, with tail fibres at the end corresponding
to where the pear ‘stalk’ would be (Fig. 1).
The virion bodies, and tail fibres of ASV1 and SSV6,
seem to differ from those of the other fuselloviruses.
Instead of multiple thin fibres, these virions carry 3 or 4
thicker and slightly curved, fibres that appear to protrude
sideways, not from the particle apex but from a point
slightly more towards the body (Fig. 1B). Furthermore, the
ASV1 and SSV6 fibres seem to be less ‘sticky’ than their
thin counterparts, and the characteristic ‘rosettes’ were
never observed for ASV1 and SSV6.
To exclude that the observed pleiomorphicity of SSV6
virions was an artifact caused by the purification process,
or by uranyl-acetate staining, two control experiments
were carried out. (i) The virions were analysed by EM
directly after removal of host cells by mild centrifugation at
4000 r.p.m. (Jouan S40 rotor), and although omitting the
concentration step yielded few virions, they exhibited the
normal pleiomorphicity. (ii) The virion pleiomorphicity was
also observed when we used phosphotungstenate as an
alternative contrasting agent (not shown), confirming that
the heterogeneity of the shape was an integral property of
the virions rather than a result of the experimental treatment.
Moreover, SSV7 virions, for which little to no pleiomorphicity
was observed, were routinely treated in exactly
the same manner as SSV6 and ASV1 virions (Fig. 1A).
Genomic organization and comparison
Owing to their special structural properties, we originally
suspected that ASV1 and SSV6 were representatives of
©2009SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology

a new spindle-shaped viral family. However, genome
analyses revealed that they, and the SSV5 and SSV7
isolates, are all closely related to known members of the
family Fuselloviridae, and we therefore assign the four
newly isolated viruses to this family. The similarities are
evident, both in terms of overall gene synteny and
sequence similarity (Table 1, Figs 2 and 3), and also
extends to the distribution of the cysteine codons in a
manner that supports the findings of Menon and
colleagues (2008).
Sequence similarity among the fuselloviruses
The genome of ASV1 carries 24 186 bp and is by far the
largest of the fuselloviruses, and one or two gene duplications
appear to have occurred (ASV1_B91 and
ASV1_C137), as well as the acquisition of new genes.
Most of the ASV1 genome is closely related to the other
fuselloviruses, with several regions of more than 75%
identity at the nucleotide level (Fig. 3). One 5.6 kb region
that is similar to SSV6, starts in the middle of ASV1_C213
and ends in ASV1_B90 (Fig. 3D).
An extreme example of how closely related some fuselloviruses
are, can be seen by comparing SSV4 and SSV5,
where a 7.9 kb region is almost 100% identical (Fig. 3B),
consistent with a recent recombination event having
occurred between the viruses. Moreover, the junctions of
nucleotide similarity regions are generally intragenic, such
that sections of high sequence similarity are mostly short,
distributed all over the genomes, and often start and stop
in the middle of open reading frames (ORFs) (Fig. 3).
These patterns of similarity raise interesting questions
concerning interplay and recombination between fuselloviral
genomes.
The presence of regions of nucleotide identity between
the fuselloviruses raises the question as to how they avoid
the extensive antiviral CRISPR systems present in all
sequenced Sulfolobus genomes. Therefore, we analysed
the correlation between sequence matching of CRISPRspacers
and fuselloviral genomes. A total of 3420
CRISPR spacer sequences were obtained from four complete
and nine incomplete Sulfolobales genomes (after
subtracting the 278 spacers which S. solfataricus P1 and
P2 have in common). Ninety-one of these spacers match
to one or more of the fuselloviruses on a nucleotide
sequence level. An additional 101 spacers were found
matching to one or more fuselloviruses when extending
the search to the amino acid sequence level. Thus out of
the 3420 Sulfolobales spacers, in total 192 spacers yield
436 significant matches to fuselloviral genomes. The latter
number exceeds the former because many spacers,
especially on the amino acid sequence level, yield
matches to more than one virus, and because some
spacers match to repeats within the same viral genome.
We found no biased correlation between conserved
regions and spacer matches, and it is possible that fuselloviruses
recombine frequently enough to reduce the
effectiveness of the CRISPR system. The results are
summarized in Fig. 4, exemplified by SSV2 which has the
highest number of spacer matches, and by the most distantly
related fusellovirus, ASV1. The spacer matches
occur on both strands of the viruses, consistent with DNA
recognition by the spacer transcripts, as recently proposed
(Marraffini and Sontheimer, 2008; Shah et al.,
2009).
Encoded proteins
©2009SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology
Fuselloviral diversity 5
Many of the ORFs encoded on ASV1 yield no, or very
weak, matches in public sequence databases, especially
ORFs found in the ‘extra’ ~6 kb that are not present in
other fuselloviruses. Exceptions are ASV1_B276 and
C106, which are homologous to genes from an integrated
virus in the Sulfolobus tokodaii chromosome (ST1724 and
ST1725), and ASV1_A59, which exhibits sequence similarity
to CopG transcriptional regulators in M. sedula and
S. acidocaldarius. Both SSV6 and ASV1 encode a homologue
of the structural protein SSV1_VP2, which is absent
from the other six fuselloviruses. Furthermore, SSV6 and
ASV1 do not encode a full-length SSV1_C792 homologue,
and SSV1_B78 homologue, as do all other fuselloviruses
(Fig. 2B). Instead, they carry two other genes: a
small gene (SSV6_C213 and ASV1_B208) homologous
only to the C-terminal 170 aa of SSV1_C792, and following
this gene, a large ORF (ASV1_A1231 and SSV6_
B1232), which is similar to Saci_1002 from Sulfolobus
acidocaldarius (49% identity, 65% similarity, for
SSV6_B1232). No other sequence similarity is found in
databases, but a clue to the function of both the
SSV1_C792 and SSV6_B1232 homologues is given by
the Phyre fold-prediction-server (Kelley and Sternberg,
2009), which suggest they both have a fold similar to
the adsorption protein P2 from bacteriophage prd1
(E-value < 0.5, estimated precision 85%).
ASV1, SSV7 and SSVk1 differ from the other fuselloviruses
by lacking all genes of the SSV1_T5 operon except
the integrase and, for ASV1 and SSVk1, a predicted
helix–turn–helix transcriptional regulator (Fig. 2). Instead,
the three viruses carry a set of ORFs on the plus-strand,
which encode a putative Rad3-like helicase, an Msed_
2283 homologue (hypothetical protein) and a few small
proteins (Fig. 2).
Beside these peculiarities of the individual genomes,
analyses have revealed 13 genes that are conserved in all
nine fuselloviruses. These ‘core’ genes include VP1 and
VP3, the integrase and three putative transcriptional regulators,
including one helix–turn–helix and two zinc-finger
proteins (Fig. 2). The attP sites within the integrase genes

6 P. Redder et al.
Table 1. Genes in SSV5, SSV6, SSV7 and ASV1, as well as the homologues from other fuselloviruses.
Size-range
(aa) Comments
ASV1
(24 186 bp)
SSV7
(17 602 bp)
SSV6
(15 684 bp)
SSVrh
(16 473 bp)
SSVk1
(17 385 bp)
SSV5
(15 330 bp)
SSV4
(15 135 bp)
SSV2
(14 796 bp)
SSV1
(15 465 bp)
Japan Iceland Iceland Iceland Kamchatka USA Iceland Iceland USA Isolated from
Russia
Arg (CCG) Gly (CCC) Glu (TTC) Gln (CTG) Asp (GTC), Leu (GAG) Gln (CTG) Gly (CCC) Lys (TTT) Matching S. solfataricus P2 tRNA of the attP site in
Glu (CTC),
the integrase gene (anticodon)
Glu (TTC)
VP2 C76 A82a 74–82 VP2 protein detected in the SSV1 virion and thought
to be the DNA binding protein (Reiter et al., 1987a)
A82 ORF83 ORF82 gp07 B83 A83 C83 C82 A83 82–83 Putative membrane proteina a
C84 ORF88c ORF81 gp08 B90 C78 B81 B83 C97 81–104
A92 ORF90 ORF89 gp09 A82 A93 C90 C90 A94 89–94 Overlaps other genes
B277 ORF276 ORF280 gp10 C279 C277 A269 A281 C263 269–281 Putative membrane proteina A154 ORF153 ORF152 gp11 C157 C154 B149 C150 C155 149–157 Also found in pSSVxa B251 ORF233 ORF233 gp12 A231 A247 C234 A255 A232 231–255 DnaA-like (Koonin, 1992)
Also in pSSVx, ATV and A. pernixa D335 ORF328 ORF330 Integrase F340 D355 F354 D336 D347 328–355 Integrasea E79 79
C176 176
A66* C72 A58a 58–72 Also found in AFV2 (gp06)
B204 A171 171–204
C74 B80 74–80
B494 A583 C559 494–583 Rad3-like helicase
A460 B471 C674 460–674 Similar to Metallosphera sedula protein Msed_2283
B192 192 Similar to C-terminal of ASV1_C674
A136 B119 119–154
B64 B102 64–102
D244 ORF211 ORF209 gp15 D212 F215 209–244 Similar to Saci_0475
D108 108 Similar to SIRV2gp12
F90 90 Similar to ORFs from pARN3 and pSOG1
E94 94
F93 E81 F110 D95 81–110 Putative HTH transcriptional regulator (Kraft et al.,
2004b)
D63 ORF57 ORF63 gp16 F61 E60 57–63 3D X-ray structure from SSV1 (Kraft et al., 2004a)
ORF159b gp18 E152 F185 152–185
ORF61 ORF61 gp21 F62 E61 61–62
ORF79a ORF73 gp23 E73 D77 73–79
A49 49 C-terminal similar to SSV7_B76
A100 ORF96 ORF96 gp24 C96 C93 C106 C96 93–106 Weak hit to ARV1
C48 C49 48–49
ORF88a B87 87–88
B92 92
A59 59 Similar to CopG from M. sedula and Saci_0942.
Possible functional homologue of SSV1_C80
©2009SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology

C80 ORF82A ORF79 gp26 C82 B64 A78 C80 64–82 RHH protein, CopG-likea A109 109 Paralogue of ASV1_B91
A79 ORF82B ORF80B gp27 A80 B79 B82 B82 B91 79–91 Zinc finger motif. Similar to ATV_gp28 and
pHVE14–51. ASV1_B91 is a paralogue of
ASV1_A109a C54 54
C102a ORF100 ORF100 gp29 B98 A102b C100 A101 98–102 B-block_TFIIC-domain, Zinc finger
ORF205 ORF206 gp30 A204 C287 B206 204–287 Similar to CRISPR associated gene Cas4 in
Staphylothermus marinus.
B129 ORF155 ORF124 gp31 B158 C150 B123 C128 C137 124–173 Two Zinc finger motifs. ASV1_C137 is a paralogue
of ASV1_C125
B99 99
ORF107b gp32 B111 C113 C113 107–113 Similar to ST1721 from S. tokodaii b
ORF311 gp33 B252 252–311 Similar to ST1722 from S. tokodaii
ORF111 gp35 C108 108–111 Similar to ST1723 from S. tokodaii
B85 C62 62–85
C247 A298 247–298
B74 C67 67–74
B276 276 Similar to ST1724 from S. tokodaii
C106 106 Similar to ST1725 from S. tokodaii
C125 125 Paralogue of ASV1_C137
A367 367
A137 137 Similar to STS262 from S. tokodaii
C806 806 558–785 similar to APE_0858 from Aeropyrum pernix
A96 96
C792 ORF809 ORF808 gp01 B793 B812 C213 C811 B208 208–812 ASV1_B208 and SSV6_C211 are similar to the
C-terminal of the C792 homologues
B78 ORF79 ORF80a gp02 A79 A79 B79 79–80 Part of the SSV1_C792 module
B68 A58b 58–68
B1232 A1231 1231–1232 Similar to Saci1002 from S. acidocaldarius
C166 ORF176 ORF167 gp03 B169 B170 C134 C170 B130 130–176 Gapped in ASV1 and SSV6. Putative membrane
protein
B115 ORF112 ORF107a gp04 A123 A113 A88 B112 A82b 82–123 Putative HTH transcriptional regulator
Shorter in ASV1 and SSV6a VP1 ORF88b ORF136 VP1 B137 A89 A143 C88 A140 88–143 VP1 structural protein in SSV1 (Reiter et al., 1987a) a
VP3 ORF92 ORF92 VP3 A93 C96 B94 C97 B90 92–96 VP3 structural protein in SSV1 (Reiter et al., 1987a)
©2009SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology
Fuselloviral diversity 7
A, B and C indicate genes on the three reading frames of the plus-strand, and D, E and F indicate genes on the minus-strand. The number following the letter is the number of encoded amino
acids. The 13 ‘core’ genes are in boldface, and proteins for which experimental data are available are underlined. The asterisk indicates an ad hoc ORF name for a gene which is not present in
the NCBI annotation.
a. Core gene in Held and Whitaker (2009).
b. The upstream 40 bp of the SSV7_C113 homologues are highly conserved in all fuselloviruses, with two copies in ASV1. In SSV1, this motif is immediately next to the BRE+TATA-box of the T3
transcript.

8 P. Redder et al.
Fig. 3. Similarity at the nucleotide level between selected representative pairs of fusellovirusal genomes.
A. Comparison between SSV1 and SSV5.
B. Between SSV5 and SSV4.
C. Between SSV4 and SSV6.
D. Between SSV6 and ASV1.
E. Between ASV1 and SSVk1.
F. Between SSVk1 and SSV7.
Regions of high (> 70%) pairwise identity on the nucleotide level (light grey boxes) are interspersed by regions with no detectable similarity
(white boxes). The dark grey box indicates an exceptional example of similarity between SSV4 and SSV5, where a 7.9 kb region is almost
100% identical between the two genomes. The junctions between similar regions and a dissimilar regions (indicated by dotted lines) often
occur in the middle of genes, and are not confined to intergenic regions. Short regions (< 100 bp) of similarity or dissimilarity are not shown.
Black arrows denote ‘core’ genes, dark grey arrows denote ORFs that are found in more than one fusellovirus, and light grey arrows denote
ORFs that have no homologues in the database, some of which may not be protein-coding.
all have their best hits to tRNAs from S. solfataricus, with
Gln, Gln, Gly and Lys for SSV5, SSV6, SSV7 and ASV1
respectively. Table 1 shows an overview of the genes in
SSV5, SSV6, SSV7 and ASV1, as well as the corresponding
homologues in the other fuselloviruses.
Discussion
In this paper we describe four new members of the family
Fuselloviridae, SSV5, SSV6, SSV7 and ASV1, isolated
from acidic hot springs of Iceland and USA, which infect
members of the hyperthermophilic archaeal genera
Sulfolobus and Acidianus.
Until now, fuselloviruses had only been found to replicate
in Sulfolobus species. Our discovery of ASV1 in
Acidianus brierleyi shows that fuselloviruses can propagate
in both the major culturable genera from aerobic,
acidic hot springs. Therefore, it is likely that fuselloviruses
also infect other host species from these environments,
such as Caldococcus, Vulcanisaeta and
Stygiolobus (Snyder et al., 2007). Furthermore, the
family Fuselloviridae presumably also extends its host
range into the vast number of currently uncultured
species found in other extreme environments, such
as the acid mine drainage ecosystem, where a VP2
homologue, recently found by community genomics
©2009SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology

Fig. 4. CRISPR spacer sequence matches for ASV1 and SSV2 are superimposed on linearized genome maps of ASV1 and SSV2
respectively. ORFs are shown as arrows above and below the line. Sequence matches to spacers are shown as vertical lines. The black
vertical lines denote the nucleotide sequence matches, and the grey vertical lines show matching amino acid sequences, after translation of
the spacer sequences from both DNA strands. The dark boxes below the genome maps indicate areas > 50 bp with nucleotide level sequence
similarity to other fuselloviruses (the relevant fusellovirus is indicated to the left of the dark boxes). In total, there are 12 spacer matches to
ASV1 and 22 matches to SSV2 at a nucleotide level. At an amino acid sequence level, there are 42 spacer matches to ASV1 and 28 matches
to SSV2.
(Andersson and Banfield, 2008), indicate the presence
of fuselloviruses.
‘Core’ genes
By almost doubling the number of described fuselloviruses,
we are refining the definion of ‘core’ genes of the
family. The 18 conserved, or ‘core’ genes, that were
defined for SSV1, SSV2, SSVk1 and SSVrh (Wiedenheft
et al., 2004) can now be reduced to 13 (Table 1) and
may have to be revised further as more fuselloviruses
are sequenced, but our findings correlate well with a
recent analysis of fuselloviral proviruses in S. islandicus
strains (Held and Whitaker, 2009). We exclude the
SSV1_C792 homologues from the list of ‘core’ genes,
because we do not consider SSV6_C213 and
ASV1_B208 to be able to fully complement the proteins
found in other fuselloviruses, which are about four times
larger (Table 1).
Six of the ‘core’ genes have no discernible function
based on their primary sequence, except for some of
them carrying predicted transmembrane segments
(Table 1), and experimental data will be needed to determine
their functional roles. Of the remaining seven, the
integrase function was characterized experimentally
(Muskhelishvili et al., 1993; Muskhelishvili, 1994; Serre
et al., 2002; Letzelter et al., 2004; Clore and Stedman,
2007). Moreover, VP1 and VP3 are virion components in
SSV1 virions, and VP1 is processed from the N-terminus
in SSV1, to a length of 73 aa (Reiter et al., 1987a), which
may explain the significant size difference we observe
among the VP1 genes (Table 1). The remaining
C-terminus of VP1 is similar in both length and sequence
to the VP3 protein, and their roles might be partially interchangeable
in the virion matrix. Bioinformatical analyses
predict DnaA-like activity for SSV1_B251 homologues
(Koonin, 1992) and transcriptional regulation activity for
three other ‘core’ genes: SSV1_A79 and SSV1_B129,
which are transcribed early, during infection and are probably
involved in controlling the hosts transcriptional apparatus,
and SSV1_B115, which is co-transcribed together
with VP1, VP2, VP3 and SSV1_C792, later in infection,
and may be involved in controlling the assembly and/or
packaging of virions.
‘Non-core’ genes
©2009SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology
Fuselloviral diversity 9
Genes that are highly conserved but present in a subset
of the fuselloviruses could provide a possible way of classifying
the fuselloviruses into subgroups, albeit subgroups
that overlap.
Thus, ASV1, SSV6 and SSV1, encode a VP2 homologue,
indicating that they all share a DNA packaging
system. However, the difference to the SSV1 protein in
the C-terminus may indicate an alternative mode of interaction
of the protein and viral DNA with the major virion
proteins, VP1 and VP3.
Another subgroup would be the SSVs, which all encode
a highly conserved homologue of SSV1_C80, a protein
containing the RHH 1 CopG domain. ASV1 does not
encode any gene with obvious sequence similarity to
SSV1_C80. However, ASV1_A59 also has an RHH 1
CopG domain, although it groups with other RHH1containing
genes, including a few Sulfolobus chromosomal
genes (e.g. Saci_0942). Furthermore, ASV1_A59
occupies the same genomic position as the SSV1_C80

10 P. Redder et al.
homologues do in the SSV genomes, and it very likely
acts as a functional homologue of SSV1_C80.
A third subgroup consists of ASV1, SSV7 and SSVk1,
which all encode the Rad3-like helicase protein and the
neighbouring Msed_2283 homologue (Fig. 2). The presence
of the helicase strongly suggests that these two
proteins are involved in DNA replication or recombination,
and it is possible that the other fuselloviruses recruit host
proteins to fulfill the same function.
A possible filament protein
The most striking genomic difference among the fuselloviruses
is the ‘replacement’ of the SSV1_C792 module
with the SSV6_B1232 module (Fig. 2B). It seems the
C-terminal 170 aa from SSV1_C792 are essential, since
they are retained as a small separate gene in both the
ASV1 and SSV6 genomes; however, the remaining
~620 aa of SSV1_C792 and the whole of SSV1_B78 are
substituted by SSV6_B1232. The presence of the
SSV6_B1232 module correlates with a difference in the
number and structure of the sticky terminal filaments of
the SSV6 and ASV1 virions, when compared with the
SSV1_C792 module viruses (Fig. 1B). Possibly, there is a
phenotype–genotype link, with the SSV1_C792 module
being responsible for the multiple, thin, sticky filaments
and the SSV6_B1232 module for the few, thick, less sticky
filaments. In support of this hypothesis, small amounts of
SSV1_C792 were recently found by mass-spectrometry
in SSV1 virions (Menon et al., 2008). Moreover, the Phyre
prediction tool suggested that both SSV1_C792 and
SSV6_B1232 had a similar fold to the P2 receptor binding
protein prd1, and it was recently shown that a large
protein is responsible for the sticky end-fibres in the rudivirus
SIRV2 (Steinmetz et al., 2008). Nevertheless,
further studies will be needed to determine the exact
functions of the SSV1_C792 and SSV6_B1232 modules
in fuselloviruses.
Fuselloviral nucleotide similarity and a putative
mechanism for interviral recombination
The multiple regions of high nucleotide similarity, or even
identity, between the fuselloviral genomes do not represent
a ‘core’ fusello-genome, since the regions of similarity
differ between the various pairs of viruses, and often do
not include the ‘core’ genes (Fig. 3). Instead, the pattern
of similar and non-similar sections of DNA indicates
frequent recombination events between fuselloviruses,
similar to that observed for some bacteriophages (Hendrix
et al., 1999). Possibly this occurs between pairs of fuselloviruses,
present in the same host; however, we do not
see a similar pattern of sequence similarity for the linear
non-integrating archaeal viruses (Vestergaard et al.,
2008a). Therefore, we suggest that a different mechanism
is more likely.
Integrated fusellovirus genomes have been found in the
Sulfolobus solfataricus P2 and in four S. islandicus chromosomes,
where no trace of the covalently closed circular
DNA (cccDNA) form was detected (Stedman et al., 2003;
Held and Whitaker, 2009). Once a virus has been
‘caught’, a second, slightly different, fusellovirus might
infect the same host, and insert itself into the same tRNA
gene, resulting in a concatamer of the two fuselloviruses
in the host chromosome (Fig. 5). This structure might be
maintained for a couple of generations, but it would be
inherently unstable if the two viral genomes are reasonably
similar, as there would be a high chance of homologous
recombination between the two integrated viruses.
Such a recombination event would lead to the formation of
one cccDNA virus and one inserted virus, both of which
would consist of a part of each of the original two viruses
(Fig. 5). Owing to the very short sequence similarity
required for homologous recombination in Sulfolobus
(Grogan, 2009), the cross-over point could potentially be
in many different places, and each of these recombination
events would form a unique mixture of the two viruses,
similar to meiosis in eukaryotes. Thus, this offers a
mechanism for rapidly generating a large number of
diverse viral offspring. Our model does not exclude direct
recombination between the cccDNA forms of fuselloviruses,
but we propose that this type of ‘tandem insertion’
event happens frequently (on an evolutionary scale) in
nature, and that repeated events, each involving a different
pair of ‘parent’ fuselloviruses, would eventually
produce the patchwork viral genomes we see today
(Fig. 3).
Our model also serves to explain why fuselloviruses
have developed an integrase that is inactivated upon integration.
The integrase is not essential for viral propagation
(Clore and Stedman, 2007) but if the proposed recombination
mechanism is correct, then the unique SSV-type
integrase will help the virus in the long term, by promoting
recombination with closely related viruses, since the inactivation
provides a high chance of the viral genome being
‘caught’ in an integrated form in the chromosome. Nevertheless,
inactivation of the integrase is not required for
recombination between tandem insertions. Studies of the
Sulfolobus plasmids pARN3 and pARN4 reveal stretches
of nucleotide identity, which might have been generated
by tandem insertions, even though these plasmids carry
non-inactivatable integrases (Greve et al., 2004).
The inherent instability of a tandem insertion makes it
difficult, if not impossible, to detect in nature. However, a
concatamer of inserted viral genomes, similar to the one
proposed in our model, was recently discovered in the
chromosome of Methanococcus voltae A3. There, the two
viral genomes integrated into the same tRNA gene are
©2009SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology

very different, preventing homologous recombination,
thus ‘trapping’ the viral concatamer in the host chromosome
(Krupovic and Bamford, 2008). The attP sites of
SSV2 and SSV7 as well as SSV5 and SSV6 match the
same tRNA in S. solfataricus P2 (Table 1), making it likely
that fuselloviruses are also able to integrate into the same
tRNA, forming concatamers, which are unstable due to
the similarity between the fuselloviruses. Moreover, it was
shown that SSVk1 is able to integrate into several different
sites in the host genome (Wiedenheft et al., 2004),
increasing the likelihood of finding a ‘partner’ for recombination.
Finally, examples of related viruses infecting the
same host at the same time are known for Sulfolobales,
such as AFV6, AFV7 and AFV8 in Acidianus convivator
(Vestergaard et al., 2008b).
If the ‘tandem insertion’ model is correct, then an evolutionary
tree of an entire viral genome has no meaning,
nor would that from individual ‘core’ genes (since two
halves of the same gene might originate from different
‘parent’ viruses). One might instead analyse genes,
described in the previous section, that are not shared
by all fuselloviruses, since these genes cannot serve
as cross-over points for homologous recombination.
Although for the moment, the data set is too small for a
phylogenetic analysis based on these genes, the presence
or absence of certain genes in a subset of the
viruses, has provided important clues to understanding
protein functions in the fuselloviruses, including the putative
filament proteins SSV1_C792 and SSV6_B1232.
With the current understanding of the CRISPR antiviral
system, high nucleotide similarity between viruses
should be disadvantageous, since a single spacer,
matching a conserved region, will provide a host with
immunity to several virus strains (Lillestøl et al., 2009).
Nevertheless, the puzzling fact remains that fuselloviruses
do possess highly similar, sometimes identical,
nucleotide regions, and it is possible that the integration
and/or the frequent recombination somehow provide the
fuselloviruses with the means to evade the CRISPR
system in their hosts.
It has been proposed that thermoacidophilic archaeal
viruses are highly mobile, even between distant hot
springs in the same geothermal area, and that different
fuselloviruses continuously infect a more-or-less stable
population of host species (Snyder et al., 2007). The high
nucleotide similarity we have found, even between
fuselloviruses isolated on different continents, seems to
confirm that they do manage to exchange genetic material
over the intercontinental distances that separate some of
the geothermal ‘islands’ in the cold ‘ocean’.
Experimental procedures
Sulfolobus and Acidianus medium
©2009SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology
Fuselloviral diversity 11
Fig. 5. Proposed model for recombination
between integrated fuselloviruses.
A. The first fusellovirus (SSVa) infects the
host, and integrates into the chromosome.
B. The second fusellovirus (SSVb) infects the
host, and integrates into the same tRNA as
SSVa.
C. The ‘tandem integration’ of SSVa and
SSVb. The dashed arrows indicate examples
of homologous recombination sites.
D. Examples of ‘offspring’ cccDNA
fuselloviruses from the recombination of SSVa
and SSVb.
Z medium: 25 mM (NH4)2SO4, 3 mM K2SO4, 1.5 mM KCl,
20 mM glycine, 4.0 mM MnCl2, 10.4 mM Na2B4O7, 0.38 mM
ZnSO4, 0.13 mM CuSO4, 62 nM Na2MoO4, 59 nM VOSO4,
18 nM CoSO4, 19 nM NiSO4, 0.1 mM HCl, 1 mM MgCl2,
0.3 mM Ca(NO3)2 adjusted to pH 3.5 with H2SO4. T medium:
Identical to Z medium, but with 0.2% Tryptone added. ST
medium: Identical to T medium, but with small amounts of
elemental sulphur added.

12 P. Redder et al.
Isolation and purification of hosts and viruses
Samples were collected from the Hveragerdi hot-spring area
in south-western Iceland and 1 ml was used to establish an
enrichment culture, by incubating in 50 ml ST medium for
9 days at 80°C, after which 1 ml was of the enrichment was
transferred to fresh ST medium and incubated for a further
4 days. Four millilitres of the enrichment (designated G4ST)
was then centrifuged at 4000 r.p.m. for 20 min (Jouan S40
rotor) to remove cells, whereupon the supernatant was spun
further at 38 000 r.p.m. for 3 h to pellet virions (Beckman
SW60 rotor). Finally, the pellet was resuspended in 50 ml of
the supernatant. The resuspension was then examined by
electron microscopy, and several different morphotypes of
virus-like particles were in evidence. Among these was a
group of fusellovirus-like particles, but with different filament
structures at the end, and a large diversity in their morphotypes,
ranging from sausage-shaped to an almost spindlelike
pear-shape (Fig. 1).
To isolate single host–virus systems, G4ST was spread on
a plate containing ST medium and solidified with Gel-rite
(Sigma-Aldrich, St Louis, USA). After 10 days of incubation
at 80°C, 30 colonies of representative sizes, shapes and
colours were transferred to 5 ml liquid ST medium and incubated
with vigorous shaking for 4 days. Each of the growing
strains was examined for virus in the electron microscope,
and the SSV6 and SSV7 were detected in the supernatant of
strain G4ST-T-11 and G4T-1 respectively. The 16S rRNA
genes of G4T-1 and G4ST-T-11 were amplified using the
primers 8aF: TCYGGTTGATCCTGCC and 1512uR: ACG
GHTACCTTGTTACGACTT (Accession number FJ870913
for G4ST-T-11 and FJ870914 for G4T-1).
SSV5 was present in HVE14, an enrichment culture, established
from a natural sample collected near the G4 site, but
10 years previously (Zillig et al., 1996). It was propagated in
S. solfataricus P2, by mixing a small amount of HVE14 with a
well-grown S. solfataricus P2 culture (1:1000), which was
then harvested and used for DNA isolation of extrachromosomal
elements using plasmid miniprep kit from Qiagen.
Acidianus brierleyi were cultured at 70°C in ST medium and
ASV1 was recovered from the supernatant by ultracentrifugation
(38 000 r.p.m. for 3 h in a Beckman SW41 rotor).
Electron microscopy
Ten microlitres of the samples was deposited on a carbon
and formvar coated grid (Ted Pella, Redding, CA, USA) and
left for 2 min before removing excess fluid. Ten microlitres of
2% Uranyl-acetate or phosphotunstenate (Sigma-Aldrich)
was allowed to stain the samples negatively for 10 s. Images
were taken on a JEOL1200EXII microscope with an 80 kV
beam, using a CCD camera.
DNA isolation and sequencing
Six litres of G4ST-T-11 was grown in a fermentor, and after
removing cells by centrifuging twice at 4000 r.p.m. for 20 min
(Sorvall GS-3 rotor), the virions in the supernatant were concentrated
using a Sartorius Vivaflow 200 filter cartridge (Sartorius,
Goettingen Germany). The resulting 15 ml was further
concentrated by spinning at 38 000 r.p.m. for 3 h using a
SW41 Beckman rotor, and finally the virions were treated with
Protease K and the DNA was extracted with Phenol, Phenol/
Chloroform and Chloroform extraction. The SSV6 DNA was
then treated as described below for SSV7.
In order to sequence SSV7, 5 ml of an exponential G4T-1culture
was pelleted by centrifugation, and resuspended in Z
medium. The SSV7 production was induced by 50 J cm -2 UV
radiation (254 nm) under constant mild agitation, and the cells
were then transferred to 45 ml T medium for over-night incubation.
Five millilitres was used for a miniprep (QIAprep Spin
Miniprep Kit, QIAGEN SA, Courtaboeuf, France), which was
used for amplification and subsequent library construction
based on the Linker Amplified Shotgun Library method described
at http://www.sci.sdsu.edu/PHAGE/LASL/index.htm.
Shot-gun library construction of SSV5 and SSV6, as well
as ASV1-containing A. brierleyi total DNA, was performed
as described previously using SmaI digested pUC18 as
cloning vector (Peng, 2008). Plasmid DNA of clones, from
all four libraries, were purified using a Model 8000 Biorobot
(Qiagen, Westburg, Germany) and sequenced in
MegaBACE 1000 Sequenators (Amersham Biotech, Amersham,
UK). Sequences were assembled using Sequencher
4.5 (http://www.genecodes.com). Genome annotations and
comparisons were done using the MUTAGEN software
(Brügger et al., 2003) with a minimum ORF-length set to
50 aa and allowing AUG, GUG and UUG as possible start
codons. Accession numbers are EU030939, FJ870915,
FJ870916 and FJ870917 for SSV5, SSV6, SSV7 and ASV1
respectively.
CRISPR spacer analysis
To obtain a list of spacer sequences from Sulfolobales, the
following partial or full genomes were used: S. solfataricus
P2, S. tokodaii 7, S. acidocaldarius DSM 639, Metallosphaera
sedula DSM5348 from GenBank (http://
www.ncbi.nlm.nih.gov/Genbank/), Sulfolobus islandicus
strains LD85, YG5714, YN1551, M164 and U328 from JGI
(http://www.jgi.doe.gov/genome-projects/), and S. islandicus
strains HVE10/4 and REY15A and Acidianus brierleyi (K.
Brügger and Q. She, unpubl. data). CRISPRs were identified
using publicly available software (Edgar, 2007; Bland et al.,
2007). Spacer sequences from each repeat-cluster were
aligned (Sæbø et al., 2005) against the fuselloviral genomes
at a nucleotide level (Shah et al., 2009). Additionally, spacers
were aligned against amino acid sequences of annotated
ORFs of the Fuselloviruses, at an amino acid level (Vestergaard
et al., 2008a; Shah et al., 2009). Significance cut-offs
were determined for both alignment types by using the
genome sequence of Saccharomyces cerevisiae as a negative
control.
Acknowledgements
P.R. was funded by grant VIRAR (NT05-2_41674) from the
Agence Nationale de la Recherche, France. The research in
Copenhagen was supported by grants from the Grundforskningsfond
and the Reseach Council for Natural Sciences. We
would also like to thank the Electron Microscopy Platform
at Institut Pasteur for helpful advice and use of their
JEOL1200EXII microscope.
©2009SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology

References
Andersson, A.F., and Banfield, J.F. (2008) Virus population
dynamics and acquired virus resistance in natural microbial
communities. Science 320: 1047–1050.
Arnold, H.P., She, Q., Phan, H., Stedman, K., Prangishvili,
D., Holz, I., et al. (1999) The genetic element pSSVx of
the extremely thermophilic crenarchaeon Sulfolobus is a
hybrid between a plasmid and a virus. Mol Microbiol 34:
217–226.
Bath, C., and Dyall-Smith, M.L. (1998) His1, an archaeal
virus of the Fuselloviridae family that infects Haloarcula
hispanica. J Virol 72: 9392–9395.
Bath, C., Cukalac, T., Porter, K., and Dyall-Smith, M.L. (2006)
His1 and His2 are distantly related, spindle-shaped haloviruses
belonging to the novel virus group, Salterprovirus.
Virology 350: 228–239.
Bize, A., Peng, X., Prokofeva, M., Maclellan, K., Lucas, S.,
Forterre, P., et al. (2008) Viruses in acidic geothermal environments
of the Kamchatka Peninsula. Res Microbiol 159:
358–366.
Bland, C., Ramsey, T.L., Sabree, F., Lowe, M., Brown, K.,
Kyrpides, N.C., and Hugenholtz, P. (2007) CRISPR Recognition
Tool (CRT): a tool for automatic detection of
clustered regularly interspaced palindromic repeats. BMC
Bioinformatics 8: 209–217.
Brügger, K., Redder, P., and Skovgaard, M. (2003)
MUTAGEN: multi-user tool for annotating genomes. Bioinformatics
19: 2480–2481.
Clore, A.J., and Stedman, K.M. (2007) The SSV1 viral integrase
is not essential. Virology 361: 103–111.
Edgar, R.C. (2007) PILER-CR: fast and accurate identification
of CRISPR repeats. BMC Bioinformatics 8: 18–24.
Fröls, S., Gordon, P.M., Panlilio, M.A., Schleper, C., and
Sensen, C.W. (2007) Elucidating the transcription cycle of
the UV-inducible hyperthermophilic archaeal virus SSV1 by
DNA microarrays. Virology 365: 48–59.
Geslin, C., Le Romancer, M., Erauso, G., Gaillard, M., Perrot,
G., and Prieur, D. (2003) PAV1, the first virus-like particle
isolated from a hyperthermophilic euryarchaeote, ‘Pyrococcus
abyssi’. J Bacteriol 185: 3888–3894.
Greve, B., Jensen, S., Brügger, K., Zillig, W., and Garrett,
R.A. (2004) Genomic comparison of archaeal conjugative
plasmids from Sulfolobus. Archaea 1: 231–239.
Grogan, D.W. (2009) Homologous recombination in Sulfolobus
acidocaldarius: genetic assays and functional properties.
Biochem Soc Trans 37 (Pt 1): 88–91.
Guixa-Boixareu, N., Calderon-Paz, J.I., Heldal, M., Bratbak,
G., and Pedros-Alio, C. (1996) Viral lysis and bacterivory
as prokaryotic loss factors along a salinity gradient. Aquat
Microb Ecol 11: 215–227.
Häring, M., Rachel, R., Peng, X., Garrett, R.A., and Prangishvili,
D. (2005) Viral diversity in hot springs of Pozzuoli,
Italy, and characterization of a unique archaeal virus, Acidianus
bottle-shaped virus, from a new family, the Ampullaviridae.
J Virol 79: 9904–9911.
Held, N.L., and Whitaker, R.J. (2009) Viral biogeography
revealed by signatures in Sulfolobus islandicus genomes.
Environ Microbiol 11: 457–466.
Hendrix, R.W., Smith, M.C.M., Burns, R.N., Ford, M.E., and
Hatfull, G.F. (1999) Evolutionary relationships among
©2009SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology
Fuselloviral diversity 13
diverse bacteriophages and prophages: all the world’s a
phage. Proc Natl Acad Sci USA 96: 2192–2197.
Kelley, L.A., and Sternberg, M.J.E. (2009) Protein structure
prediction on the web: a case study using the Phyre server.
Nature Protocols 4: 363–371.
Koonin, E.V. (1992) Archaebacterial virus SSV1 encodes a
putative DnaA-like protein. Nucleic Acids Res 20: 1143.
Kraft, P., Kümmel, D., Oeckinghaus, A., Gauss, G.H.,
Wiedenheft, B., Young, M., and Lawrence, C.M. (2004a)
Structure of D-63 from Sulfolobus spindle-shaped virus 1:
surface properties of the dimeric four-helix bundle suggest
an adaptor protein function. J Virol 78: 7438–7442.
Kraft, P., Oeckinghaus, A., Kümmel, D., Gauss, G.H.,
Gilmore, J., Wiedenheft, B., et al. (2004b) Crystal structure
of F-93 from Sulfolobus spindle-shaped virus 1, a wingedhelix
DNA binding protein. J Virol 78: 11544–11550.
Krupovic, M., and Bamford, D.H. (2008) Archaeal proviruses
TKV4 and MVV extend the PRD1-adenovirus lineage to
the phylum Euryarchaeota. Virology 375: 292–300.
Letzelter, C., Duguet, M., and Serre, M.C. (2004) Mutational
analysis of the archaeal tyrosine recombinase SSV1 integrase
suggests a mechanism of DNA cleavage in trans.
J Biol Chem 279: 28936–28944.
Lillestøl, R.K., Shah, S.A., Brügger, K., Redder, P., Phan, H.,
Christiansen, J., and Garrett, R.A. (2009) CRISPR families
ofthecrenarchaealgenusSulfolobus:bidirectionaltranscription
and dynamic properties. Mol Microbiol 72: 259–272.
Marraffini, L.A., and Sontheimer, E.J. (2008) CRISPR interference
limits horizontal gene transfer in Staphylococci by
targeting DNA. Science 322: 1843–1845.
Martin, A., Yeats, S., Janekovic, D., Reiter, W.-D., Aicher, W.,
and Zillig, W. (1984) SAV1, a temperate u.v.-inducible DNA
virus-like particle from archaebacterium Sulfolobus acidocaldarius
isolate B12. EMBO J 3: 2165–2168.
Menon, S.K., Maaty, W.S., Corn, G.J., Kwok, S.C., Eilers,
B.J., Kraft, P., et al. (2008) Cysteine usage in Sulfolobus
spindle-shaped virus 1 and extension to hyperthermophilic
viruses in general. Virology 376: 270–278.
Muskhelishvili, G. (1994) The archaeal SSV integrase promotes
intermolecular excisive recombination in vitro. Syst
Appl Microbiol 16: 605–608.
Muskhelishvili, G., Palm, P., and Zillig, W. (1993) SSV1encoded
site-specific recombination system in Sulfolobus
shibatae. Mol Gen Genet 237: 334–342.
Oren, A., Bratbak, G., and Hendal, M. (1997) Occurrence of
virus-like particles in the Dead Sea. Extremophiles 1: 143–
149.
Palm, P., Schleper, C., Grampp, B., Yeats, S., McWilliam, P.,
Reiter, W.D., and Zillig, W. (1991) Complete nucleotide
sequence of the virus SSV1 of the archaebacterium Sulfolobus
shibatae. Virology 185: 242–250.
Peng, X. (2008) Evidence for the horizontal transfer of an
integrase gene from a fusellovirus to a pRN-like plasmid
within a single strain of Sulfolobus and the implications for
plasmid survival. Microbiol 154 (Pt 2): 383–391.
Porter, K., Russ, B.E., and Dyall-Smith, M.L. (2007) Virus–
host interactions in salt lakes. Curr Opin Microbiol 10:
418–424.
Prangishvili, D. (2003) Evolutionary insights from studies on
viruses of hyperthermophilic archaea. Res Microbiol 154:
289–294.

14 P. Redder et al.
Prangishvili, D., Garrett, R.A., and Koonin, E.V. (2006a)
Evolutionary genomics of archaeal viruses: unique viral
genomes in the third domain of life. Virus Res 117: 52–67.
Prangishvili, D., Vestergaard, G., Häring, M., Aramayo, R.,
Basta, T., Rachel, R., and Garrett, R.A. (2006b) Structural
and genomic properties of the hyperthermophilic archaeal
virus ATV with an extracellular stage of the reproductive
cycle. J Mol Biol 359: 1203–1216.
Rachel, R., Bettstetter, M., Hedlund, B.P., Häring, M.,
Kessler, A., Stetter, K.O., and Prangishvili, D. (2002)
Remarkable morphological diversity of viruses and viruslike
particles in hot terrestrial environments. Arch Virol 147:
2419–2429.
Reiter, W.-D., Palm, P., Henschen, A., Lottspeich, F., Zillig,
W., and Grampp, B. (1987a) Identification and characterization
of the genes encoding three structural proteins of
the Sulfolobus virus-like particle SSV1. Mol Gen Genet
206: 144–153.
Reiter, W.D., Palm, P., Yeats, S., and Zillig, W. (1987b)
Gene expression in archaebacteria: physical mapping
of constitutive and UV-inducible transcripts from the
Sulfolobus virus-like particle SSV1. Mol Gen Genet 209:
270–275.
Rice, G., Stedman, K., Snyder, J., Wiedenheft, B., Willits, D.,
et al. (2001) Viruses from extreme thermal environments.
Proc Natl Acad Sci USA 98: 13341–13345.
Sæbø, P.E., Andersen, S.M., Myrseth, J., Laerdahl, J.K.,
and Rognes, T. (2005) PARALIGN: rapid and sensitive
sequence similarity searches powered by parallel computing
technology. Nucleic Acids Res 33: 535–539.
Schleper, C., Kubo, K., and Zillig, W. (1992) The particle
SSV1 from the extremely thermophilic archaeon
Sulfolobus is a virus: demonstration of infectivity and of
transfection with viral DNA. Proc Natl Acad Sci USA 89:
7645–7649.
Serre, M.-C., Letzelter, C., Garel, J.-R., and Duguet, M.
(2002) Cleavage properties of an archaeal site-specific
recombinase, the SSV1 integrase. J Biol Chem 277:
16758–16767.
Shah, S.A., Hansen, N.R., and Garrett, R.A. (2009) Distributions
of CRISPR spacer matches in viruses and plasmids
of crenarchaeal acidothermophiles and implications for
their inhibitory mechanism. Biochem Soc Trans 37: 23–
28.
Snyder, J.C., Wiedenheft, B., Lavin, M., Roberto, F.F.,
Spuhler, J., Ortmann, A.C., et al. (2007) Virus movement
maintains local virus population diversity. Proc Natl Acad
Sci USA 104: 19102–19107.
Stedman, K.M., She, Q., Phan, H., Arnold, H.P., Holz, I.,
Garrett, R.A., and Zillig, W. (2003) Relationships between
fuselloviruses infecting the extremely thermophilic
archaeon Sulfolobus: SSV1 and SSV2. Res Microbiol 154:
295–302.
Steinmetz, N.F., Bize, A., Kindlay, K.C., Lomonosoff, G.P.,
Manchester, M., Evans, D.J., and Prangishvili, D. (2008)
Site-specific and spatially controlled addressability of a
new viral nanobuilding block: Sulfolobus islandicus rodshaped
virus 2. Adv Funct Mater 18: 1–9.
Vestergaard, G., Shah, S.A., Bize, A., Reitberger, W., Reuter,
M., Phan, H., et al. (2008a) SRV, a new rudiviral isolate
from Stygiolobus and the interplay of crenarchaeal rudiviruses
with the host viral-defence CRISPR system.
J Bacteriol 190: 6837–6845.
Vestergaard, G., Aramayo, R., Basta, T., Häring, M., Peng,
X., Brügger, K., et al. (2008b) Structure of the acidianus
filamentous virus 3 and comparative genomics of related
archaeal lipothrixviruses. J Virol 82: 371–381.
Wiedenheft, B., Stedman, K., Roberto, F., Willits, D., Gleske,
A.K., Zoeller, L., et al. (2004) Comparative genomic analysis
of hyperthermophilic archaeal Fuselloviridae viruses.
J Virol 78: 1954–1961.
Xiang, X., Chen, L., Huang, X., Luo, Y., She, Q., and Huang,
L. (2005) Sulfolobus tengchongensis spindle-shaped virus
STSV1: virus–host interactions and genomic features.
J Virol 79: 8677–8686.
Yeats, S., McWilliam, P., and Zillig, W. (1982) A plasmid in the
archaebacterium Sulfolobus acidocaldarius. EMBO J 1:
1035–1038.
Zillig, W., Prangishvilli, D., Schleper, C., Elferink, M., Holz, I.,
Albers, S., et al. (1996) Viruses, plasmids and other
genetic elements of thermophilic and hyperthermophilic
Archaea. FEMS Microbiol Rev 18: 225–236.
©2009SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology

Environmental Microbiology (2010) 12(11), 2918–2930 doi:10.1111/j.1462-2920.2010.02266.x
Metagenomic analyses of novel viruses and plasmids
from a cultured environmental sample of
hyperthermophilic neutrophilesemi_2266 2918..2930
Roger A. Garrett, 1 * David Prangishvili, 2
Shiraz A. Shah, 1 Monika Reuter, 2,3 Karl O. Stetter 3
and Xu Peng 1
1 Archaea Centre, Department of Biology, Copenhagen
University, Ole Maaløes Vej 5, DK-2200 Copenhagen N,
Denmark.
2 Institut Pasteur, Molecular Biology of the Gene in
Extremophiles Unit, rue Dr. Roux 25, 75724 Paris
Cedex 15, France.
3 Department of Microbiology, Archaea Centre, University
of Regensburg, D-93053 Regensburg, Germany.
Summary
Two novel viral genomes and four plasmids were
assembled from an environmental sample collected
from a hot spring at Yellowstone National Park, USA,
and maintained anaerobically in a bioreactor at 85°C
and pH 6. The double-stranded DNA viral genomes
are linear (22.7 kb) and circular (17.7 kb), and derive
apparently from archaeal viruses HAV1 and HAV2.
Genomic DNA was obtained from samples enriched in
filamentous and tadpole-shaped virus-like particles
respectively. They yielded few significant matches in
public sequence databases reinforcing, further, the
wide diversity of archaeal viruses. Several variants of
HAV1 exhibit major genomic alterations, presumed to
arise from viral adaptation to different hosts. They
include insertions up to 350 bp, deletions up to 1.5 kb,
and genes with extensively altered sequences. Some
result from recombination events occurring at low
complexity direct repeats distributed along the
genome. In addition, a 33.8 kb archaeal plasmid pHA1
was characterized, encoding a possible conjugative
apparatus, as well as three cryptic plasmids of thermophilic
bacterial origin, pHB1 of 2.1 kb and two
closely related variants pHB2a and pHB2b, of 5.2 and
4.8 kb respectively. Strategies are considered for
assembling genomes of smaller genetic elements
from complex environmental samples, and for estab-
Received 10 February, 2010; accepted 20 April, 2010. *For correspondence:
E-mail garrett@bio.ku.dk; Tel. (+45) 35322010; Fax (+45)
35322128.
©2010SocietyforAppliedMicrobiologyandBlackwellPublishingLtd
lishing possible host identities on the basis of
sequence similarity to host CRISPR immune systems.
Introduction
Archaeal viruses exhibit a wide variety of morphotypes
and genomic properties. They have been isolated and
characterized primarily from terrestial acidic hot springs or
hypersaline lakes, in many different geographical locations.
Several viruses from terrestial acidic hot springs
have now been classified into new viral families while
others, together with a few haloarchaeal viruses from the
euryarchaeal kingdom, remain unclassified (Prangishvili
et al., 2006a; Porter et al., 2007; Lawrence et al., 2009).
Although some crenarchaeal and euryarchaeal virions
share similar morphotypes, their genomic properties show
little in common (Ortmann et al., 2006; Porter et al., 2007)
nor, with the exception of a few head-tail euryarchaeal
viruses, do they share many homologous genes with
either bacterial or eukaryal viruses (Prangishvili et al.,
2006b). Despite the broad diversity of characterized
archaeal viruses, as a group they probably constitute a
biased sample because most of them exclusively infect
thermoacidophilic members of the order Sulfolobales or a
few haloarchaeal strains.
Few studies, to date, have addressed the relative abundance
of different viral morphotypes in archaea-rich environments.
Electron microscopy studies of samples from
terrestial hot springs suggest that spindles, filaments,
rods and spheres predominate (Rachel et al., 2002; Bize
et al., 2008), while other morphotypes are much less
common. In hypersaline environments spindle-shaped
and spherical forms predominate (Oren et al., 1997; Diez
et al., 2000; Porter et al., 2007) while head-tail virus-like
particles (VLPs) are quite common and their proviruses
have been detected in some sequenced genomes of haloand
methanoarchaea (Porter et al., 2007; Krupovič and
Bamford, 2008; Krupovič et al., 2010).
Only four crenarchaeal viruses from extreme geothermal
environments at neutral pH values have been fully
characterized to date, the rod-shaped Thermoproteus
tenax lipothrixvirus, TTV1 (Janekovic et al., 1983), Pyrobaculum
spherical virus, PSV (Häring et al., 2004), the
closely related T. tenax spherical virus 1, TTSV1 (Ahn

et al., 2006), and the Aeropyrum pernix bacilliform virus 1,
APBV1 (Mochizuki et al., 2010). However, electron
microscopy studies of an enrichment culture from a
sample collected from Obsidian Pool, Yellowstone
National Park, USA, maintained at 85°C and pH 6 under
anaerobic conditions, revealed five morphologically
diverse VLPs (fig. 1 in Rachel et al., 2002), including
spherical virions of the virus PSV which was characterized
earlier (Häring et al., 2004). The enrichment culture
also carried a variety of genera, including crenarchaeal
Thermofilum, Thermoproteus and Thermosphaera, euryarchaeal
Archaeoglobus and the bacterial genera
Thermus, Geothermobacterium and Thermodesulfobacterium
(Rachel et al., 2002). The enrichment culture was
maintained in a bioreactor over a 2-year period and aliquots
were extracted at regular intervals over by this time
and screened for VLPs by electron microscopy. The different
VLP morphotypes observed including the spherical
PSV varied considerably in their relative yields over time
(Fig. 1).
In this study, we attempted to obtain genome sequences
associated with the remaining unidentified VLPs. To this
end, the samples extracted from the bioreactor at different
time intervals were investigated, as well as mixtures of
samples. A variety of approaches were used to generate
clone libraries and to distinguish viral from plasmid DNA,
and circular from linear DNA genomes and, for the VLPs, to
correlate genome-type with morphotype.
Since attempts to find hosts for the VLPs were unsuccessful,
we investigated potential hosts for the archaeal
viruses and plasmids by matching their genome
sequences to spacer sequences of the chromosomal
immune CRISPR/Cas system (Van der Oost et al., 2009).
These chromosomal spacers derive from infecting viruses
or plasmids (Barrangou et al., 2007) and are present
within all the available sequenced genomes of thermophilic
neutrophiles. The spacers represent a history of
invading viruses and plasmids and a close sequence
match implies that the host has been infected by a similar
virus or plasmid (Lillestøl et al., 2006; Andersson and
Banfield, 2008; Shah et al., 2009).
Results
An enrichment culture established from a sample collected
from Obsidian Pool at Yellowstone National Park,
USA, was maintained in a bioreactor at 85°C and pH 6.
Virus-like particles were concentrated from supernatant
aliquots taken from the bioreactor and subjected to CsCl
density gradient ultracentrifugation. Initially, shot-gun
clone libraries were prepared from a mixture of bioreactor
samples (bioreactor-mix) (Fig. 1A) which were deproteinized
after density gradient centrifugation without any pretreatment
but most clones were found to derive from
Novel viruses and plasmids from hyperthermoneutrophiles 2919
contaminating chromosomal DNA fragments. Therefore,
DNase I treatment was introduced to remove chromosomal
contamination before deproteinization. Moreover,
we examined samples collected at different times over a
2-year period, for which a given VLP type was dominant in
electron micrographs (Fig. 1B and C), in order to correlate
viral genome types with morphotypes. Furthermore, strategies
were developed for distinguishing viral from plasmid
DNA, and linear from circular DNA genomes (Table 1; see
also Experimental procedures).
Five main libraries were prepared to generate viral DNA
and plasmid clones (Table 1). These include the larger
library of supernatant DNA from the mix of bioreactor
samples collected at different time intervals (4000
sequences) (Fig. 1A), and an earlier library that was used
to sequence the partially purified Pyrobaculum spherical
virus PSV, isolated from the same bioreactor (Häring
et al., 2004). Moreover, samples enriched in two of the
novel VLPs were obtained (Fig. 1B and C) and used to
generate clone libraries. Thus, a shot-gun filament library
was prepared from two samples rich in short filamentous
VLPs (Fig. 1B), and further clone libraries were prepared
from samples rich in tadpole-shaped particles (Fig. 1C)
after selecting for (i) circular plasmids which were preferentially
amplified (tadpole-1) and (ii) circular viral
genomes after degrading chromosomal and plasmid DNA
and then deproteinizing virions and treating with circular
DNA-safe nucleases (tadpole-2). We also screened,
unsuccessfully, for RNA viral genomes by generating
cDNA libraries (data not shown).
Complete genomes from two putative archaeal viruses
HAV1 and HAV2 were assembled, the former 22.7 kb and
linear, and the latter 17.7 kb and circular, and, in addition,
four plasmids were sequenced pHA1 – 33.8 kb, pHB1 –
2.1 kb, and two variants of pHB2a and pHB2b of 4.8 kb
and 5.4 kb respectively. The approximate percentages of
clones from the five main libraries that were incorporated
into each assembled genetic element are given (Table 1),
and the numbers are consistent with the strategy
employed for distinguishing viral from plasmid genomes,
except that the relatively high percentage of clones of
plasmids pHB2a and pHB2b (20%), obtained from the
tadpole-2 library, probably reflects incomplete DNase-1
digestion of non-viral circular DNA (Table 1). The average
genome coverage was about fivefold for each element,
unless otherwise stated, and all sequence ambiguities
were resolved by primer walking on clones. The identities
and general properties of the sequenced genetic elements
are summarized in Table 2.
Filamentous VLPs
Two bioreactor samples rich in short filamentous VLPs
(Fig. 1B) were pooled and treated with DNase I at 37°C
©2010SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology, 12, 2918–2930

2920 R. A. Garrett et al.
A
B C
Fig. 1. Electron micrographs showing VLP morphotypes observed in the analysed bioreactor culture.
A. A mixture of all preparations of VLPs collected from the bioreactor.
B. Preparation enriched in filamentous VLPs.
C. Preparation enriched in tadpole-shaped VLPs.
The size marker corresponds to 500 nm.
©2010SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology, 12, 2918–2930

Table 1. Pre-treatment of viral samples before library construction and the approximate percentage of clone sequences assembled from each
library for each genetic element.
Clone libraries
Treatment Bioreactor mix PSV Filament Tadpole-1 Tadpole-2
Element Size (bp) i, iii i, iii i, iii, v i, iii, v i, ii, iii, iv, v
HAV1 22 743 5 95
HAV2 17 666 5 95
pHA1 33 795 40 57 3
pHB1 2 099 100
pHB2a/2b 4 780/5 370 80 20
Bioreactor supernatant extracts were subjected to the following treatments: i. CsCl gradient centrifugation of virions. ii. DNase I treatment of the
virion band from CsCl gradients. iii. Deproteinization with SDS and proteinase K followed by phenol extraction of DNA. iv. Plasmid-safe DNase
treatment of DNA. v. In vitro amplification of DNA.
The total number of sequenced clones that were assembled into the virus and plasmid genomes (prior to sequence polishing) were HAV1 – 956,
HAV2 – 195, pHA1 – 188, pHB1 – 49, pHB2a/2b which were co-assembled – 55.
for 15 min, to remove extraneous chromosomal and
plasmid DNA before extracting DNA from VLPs by phenol
treatment. A clone library was generated and DNA
sequencing yielded a non-circular contig of about 20 kb,
consistent with a linear genome. Since terminal
sequences are invariably absent from shot-gun clone
libraries of linear genomes (e.g. Vestergaard et al.,
2008a), libraries were produced using the Linker Amplified
Shotgun Library method (see Experimental procedures)
which yielded a high sequence coverage of the
DNA termini. The complete linear DNA genome consists
of 22 743 bp with a 21 bp inverted terminal repeat (ITR) of
sequence 5′-CGTCTCTCTGTGTGTATGGGA-3′. We
infer that both termini are free, blunt and unmodified,
because they were efficiently ligated with the blunt end of
the adaptor during library construction (see Experimental
procedures). Since only one major contig was assembled
from the filament-library sequences, we inferred that it
derived from the filamentous virus (Fig. 1B). Genome
analyses indicated that the virus was of archaeal origin
(Torarinsson et al., 2005), and all of the predicted genes
lie on one strand of the genome, similar to the highly
biased strand usage of the crenarchaeal thermoneutrophilic
viruses PSV and TTSV1 (Häring et al., 2004; Ahn
et al., 2006). A few clone sequences from the filament
library assembled into the PSV genome, indicating that
small amounts of that virus had co-purified with HAV1,
Table 2. Genomic properties of the thermoneutrophilic viruses and plasmids.
Novel viruses and plasmids from hyperthermoneutrophiles 2921
consistent with the low levels of spherical particles
observed in electron micrographs (Fig. 1B).
No genes yielded highly significant matches in public
sequence databases; only weak but persistent matches
were observed to a Cas4-like protein (DUF83) (ORF218),
possibly a nuclease, for which matches were also
observed in several crenarchaeal fuselloviruses (Redder
et al., 2009) and the filamentous lipothrixvirus virus AFV1
(Bettstetter et al., 2003), a parB-like partition protein
(ORF253) and a transcriptional regulator (ORF146)
(Table 3). Several ORFs carry putative transmembrane
motifs, some with predicted signal peptides, as illustrated
in Fig. 2A. The very low level of gene matches to public
sequence databases is a characteristic of the other
sequenced thermoneutrophilic viruses PSV, TTSV1 and
TTV1 (Janekovic et al., 1983; Bettstetter et al., 2003; Ahn
et al., 2006), and appears to be a general feature of many
crenarchaeal viral genomes (Prangishvili et al., 2006b).
HAV1 genomic variants
Although there is a low level of sequence heterogeneity
throughout the genome, there are numerous local heterogeneity
‘hot-spots’, present in almost half of the predicted
genes (17 out of 40) as indicated in Fig. 2A. In addition,
several genomic variants of HAV1 were assembled with
major alterations including gene insertions of up to 350 bp
Element ds DNA (kb) Form G+C content Domain GenBank accession number
HAV1 22 743 Linear 46.2 Archaea GU722196
HAV2 17 666 Circular 52.1 Archaea GU722197
pHA1 33 795 Circular 45.4 Archaea GU722198
pHB1 2 099 Circular 54.7 Bacteria GU722199
pHB2a 4 780 Circular 61.6 Bacteria GU722200
pHB2b 5 370 Circular 60.2 Bacteria GU722201
©2010SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology, 12, 2918–2930

2922 R. A. Garrett et al.
Table 3. Significant ORF matches within public sequence databases.
ORF e-value Match Origin
HAV1
ORF253 4e-06 parB-like partition Dethiobacter alkaliphilus AHT 1
ORF218 9e-05 Cas4-like (DUF83) Sulfolobus fusellovirus SSV2
ORF170 1e-06 Hypothetical – Tpen_1879 Thermofilum pendens Hrk 5
ORF146 5e-05 CopG/Arc/MetJ family transcriptional regulator Pyrobaculum aerophilum str. IM2
HAV2
ORF1767 2e-11 Hypothetical – ATV_gp60 (ORF710 – C-terminal 375 aa) Acidianus bicaudavirus ATV
ORF909 1e-125 Primase/DNA polymerase Sulfolobus neozealandicus pORA1
ORF506 2e-15 AAA-ATPase, CDC48-type (ORF618 N-terminal 210 aa) Acidianus bicaudavirus ATV
ORF263 2e-04 ORF731 N-terminal 100 aa Sulfolobus bicaudavirus STSV1
ORF122 3e-45 IS element Dka2 OrfA Desulfurococcus kamchatkensis
ORF420 2e-160 IS element Dka2 OrfB Desulfurococcus kamchatkensis
pHA1
ORF575 2e-08 Phage/plasmid primase COG3378 (C-terminal 300 aa) P4 family
ORF396 2e-25 C5-cytosine-specific methylase Thermus phage P23-45
ORF375 8e-42 Type III restriction enzyme, res subunit Thermofilum pendens Hrk 5
ORF337 2e-07 DEAD/DEAH box helicase Thermofilum pendens Hrk 5
ORF320 5e-18 Abortive infection protein Thermofilum pendens Hrk 5
ORF282 4e-74 Integrase Thermofilum pendens Hrk 5
ORF93 6e-06 Holliday junction resolvase Methanocaldococcus vulcanius M7
pHB1
ORF477 8e-14 Rep protein-rolling circle Bacterial plasmid pAB49
pHB2a+b
ORF399/557 8e-75 TraA-like, conjugal transfer Polaromonas naphthalenivorans CJ2
ORF269 2e-47 RepB protein Acinetobacter baumannii ACICU
pHB2a
ORF116 3e-18 Hypothetical – Veis_1406 Verminephrobacter eiseniae EF01-2
pHB2b
ORF115 2e-19 Hypothetical – StreC_09508 Streptomyces sp. C
and deletions of up to 1.5 kb, genes with altered
sequences, and duplications. The number of clone
sequences that assembled into each of the variant
regions (Table 4), relative to the number of clones in the
dominant genome, indicated that the original viral population
was very heterogeneous, and this was reinforced by
preparative gel electrophoresis pattern of the viral DNA
which revealed a broad heterogeneous band between
DNA size markers of 19.4 and 24 kb (Fig. 3).
Ten assembled contigs of HAV1 variants showed major
genomic changes with some carrying two to three independent
alterations (Table 4). Most of the deletions and
other major genomic changes occur at one or more of the
11 adjoining pyrimidine-rich and purine-rich sequences,
most of which are intergenic (Fig. 2A; Table 5). These
sites constitute partially conserved, low-complexity direct
repeats along the genome, and some carry inverted
repeats (Table 5). Only a quarter of the viral genes are
affected by these genomic changes. Of these, ORFs
123a, 156, 284, 102, 78a and 170 appear dispensable for
the virion, while ORFs 140, 174, 276 and 352 can
undergo large sequence variations, and ORF585, which
contains two putative recombination sites (Fig. 2A;
Table 5), has undergone insertions, partial deletions
and/or extensive sequence changes, and exhibits altered
start codon positions.
Tadpole-shaped VLPs
DNA was extracted from a purified viral preparation that
was rich in tadpole-shaped VLPs (Fig. 1C), and was
amplified using the f29 polymerase, before preparing a
shot-gun clone library (Table 1; see Experimental procedures).
Sequences were assembled, together with some
sequences from the bioreactor mix library (Table 1), into
a circular double-stranded (ds) DNA genome of 17 666
kb (Fig. 2B), where the predicted genes are preceded by
archaea-specific motifs (Torarinsson et al., 2005). There
was little sequence heterogeneity in the HAV2 genome
which almost certainly reflects the DNA amplification
step prior to cloning, such that an initial dominating component
was preferentially amplified. As for HAV1, only
one major contig was assembled and we inferred therefore
that it derived from the tadpole-shaped VLPs
(Fig. 1C).
In contrast to HAV1, a few significant matches to public
sequence databases were found (Table 3). Highly significant
matches occurred for an archaea-specific bifunctional
DNA primase-polymerase encoded on two plasmids
of Sulfolobus neozealandicus (Lipps et al., 2004; Greve
et al., 2005), and for an IS element of the IS 200/650
family present in Desulfurococcus kamchatkensis.
Moreover, two matches occurred to a crenarchaeal
©2010SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology, 12, 2918–2930

icaudavirus ATV which exhibits a similar spindle-shaped
morphology but with two tails (Prangishvili et al., 2006c).
Thus, the C-terminal 350 amino acids of HAV2-ORF1767
showed significant sequence similarity to the corresponding
region of ATV-ORF710, and HAV2-ORF506 also
carries an AAA-ATPase domain of the CDC48 type,
similar to that present in ATV-ORF618 (Fig. 2B).
Archaeal and bacterial plasmids
Plasmid sequences were assembled mainly from the
clone libraries of samples lacking DNase I treatment
Novel viruses and plasmids from hyperthermoneutrophiles 2923
Fig. 2. Genome maps of the HAV1 (A) and HAV2 (B) viruses where predicted genes are indicated by arrows and denoted by their amino acid
lengths. Significant predictions of gene product functions are indicated. Striated genes encode predicted transmembrane motifs. In (A) red
sections indicate gene regions carrying hot-spots for single-site mutations. Putative recombination sites are indicated (•).
before viral DNA extraction (Table 1). The 33 795 bp
pHA1 (Hyperthermophilic Archaeon) is of archaeal origin
and was assembled from different libraries of nonamplified
DNA, including that of the bioreactor mix and
the PSV virus (Häring et al., 2004) (Table 1). Minor
sequence heterogeneities occurred throughout the
genome but no larger genomic changes were observed.
About one-third of the 59 predicted genes are homologous
to genes in the 31 504 bp plasmid TPEN01 from
Thermofilum pendens Hrk5 (Anderson et al., 2008), and
they are clustered in the pHA1 genome (Fig. 4A). Several
genes encoding hypothetical proteins carry putative
©2010SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology, 12, 2918–2930

2924 R. A. Garrett et al.
Table 4. Properties of the HAV1 genomic variants.
HAV1 variant Number of clones Viral position Genome change ORF changes
1 2 492–1827 Deleted 1337 bp, 80–143 replaced Deleted ORFs123a/156
2 14 1032 65 bp partial duplication, T-C-rich region No ORF
1659–3188 Deleted 1529 bp Deleted ORFs284/102
3 6 3761 Altered gene ORF174 (ORF183, 36% identity/59% similarity)
4 9 8042 Insert 92 bp – 60 bp repeat in start ORF141 end extends 10 aa, ORF94 start extends 36 aa
5 41 8050 Insert 49 bp in C-rich region ORF141 end extends 9 aa, ORF94 start extends 10 aa
8868–8755 Altered gene ORF218 (ORF218, 88% identity/92% similarity)
9946–10757 Deleted 813 bp Deleted ORFs78a/170
6 19 14430–14699 270 bp duplication No ORF
15000 Insert 350 bp Variant ORF585, C-terminal half (ORF653)
7 7 14360–14498,14737–14885 Altered gene Heterogeneities ORF585
8 2 14995–15460 Deleted 375 bp Truncated ORF585
15717–16062 Altered gene ORF585, altered 345 bp centrally
9 8 17352–17899 Altered gene ORF276, altered central 170 aa (ORF259, 61% identity/71% similarity)
10 16 19439–20029 Altered gene ORF325 (ORF315, 72% identity/80% similarity)
Fig. 3. Characterization of DNA isolated from the purified
preparation of the filamentous virus VLP enriched preparation
(HAV1), after removal of plasmid and chromosomal DNA, and prior
to generating the filament library (Table 1). M – DNA size markers.
transmembrane motifs, some also exhibiting predicted
signal peptides, and these include a cluster of 10 tightly
linked genes some of which are probably co-transcribed
(Fig. 4A). Although there is no significant sequence similarity,
these proteins may generate a novel conjugative
apparatus, by analogy with a group of conjugative membrane
proteins encoded by a conserved gene cluster of
conjugative plasmids of the crenarchaeal thermoacidophiles
(Greve et al., 2004).
The three smaller plasmids were assembled exclusively
from the tadpole-1/2 libraries of amplified DNA (Table 1)
and the sequences are relatively homogeneous. Each
plasmid is of bacterial origin, as judged by promoter and
ribosome binding motifs (Torarinsson et al., 2005). The
2099 bp pHB1 (Hyperthermophilic Bacterium) encodes a
large replication protein, probably of the rolling circle type
(Table 3), and other predicted genes overlap on the two
DNA strands (Fig. 4B). pHB2a and pHB2b, of 4780 and
5370 bp, respectively, are variants sharing 3780 bp of
highly similar sequence but with two altered regions as
illustrated (Fig. 4B). Whereas the shorter altered regions
exhibit no sequence similarity, the larger regions of 781 bp
and 1257 bp for pHB2a and pHB2b, respectively, carry
about 300 bp with a low but significant level of sequence
similarity. These altered sequences resulted in ORF125
being exclusive to pHB2a, and ORFs 58, 60, 67, 68 and
97 being specific to pHB2b (Fig. 4B). In addition, ORFs
399 and 157 in pHB2a are fused in pHB2b (ORF557) and
©2010SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology, 12, 2918–2930

Table 5. Putative recombination sites associated with alterations in the variant HAV1 genomes.
Novel viruses and plasmids from hyperthermoneutrophiles 2925
Variant number Genome change Genome positions Recombination sites
1a 1337 bp deletion 474–496 CCCTCCCCTTTTTCTATGAAGTCGAAGGTGGA
1b Recombination 1805–1833 TTTTTTCTTTTTCCTCTTTTTTTCCCTTCGGAGAAAAG
2a 65 bp partial duplication 1014–1052 TCTTTTTTCCCCTCTTTTCCTTTCTTCATGATGAAAGGA
2b 1529 bp deletion 1650–1677 CCTCTTTTTTTCTAGCCGCACCTCCTTTGGAGAAAAA
2c 1529 bp deletion 3183–3193 TCTGACCCTTCGGAGAAAAA
5a 49 bp insertion 8060 CCCGTTCCCGGCGTCTCGGTGGAA
6b 350 bp altered 15000 CTCCTCACTCTTCTTCTCGCTGTTCAGGAGGAGGA
8b 345 bp replacement 16040–16065 CTTTGCTGTATCTATTGCGAGGAAGA
Similar sites exist also at genome positions 559–585, 2728–2748 and 2766–2778. Inverted repeats (underlined) are present in some recombination
sites. Details of the variants are given in Table 4.
Fig. 4. Genome maps of the circular plasmids (A) archaeal pHA1 and (B) three bacterial plasmids pHB1, pHB2a and pHB2b, where arrows
indicate predicted genes denoted by their amino acid lengths. Striated genes encode predicted transmembrane motifs while grey shaded
genes are homologous to genes in TPEN01. Shaded areas inside the circles for pHB2a and pHB2b indicate regions of different sequence.
©2010SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology, 12, 2918–2930

2926 R. A. Garrett et al.
ORF96 (pHB2a) and ORF98 (pHB2b), as well as ORF115
(pHB2a) and ORF116 (pHB2b), show limited sequence
differences (Fig. 4B). Both plasmid variants encode a replication
protein and a Tra-like conjugal protein and carry a
high G+C-rich region which may constitute an RNA gene
(Fig. 4B).
As for HAV2, there was little sequence heterogeneity for
the bacterial plasmids, which probably also reflects their
amplification prior to cloning. Detection of variants pHB2a
and pHB2b suggests that both were substantial components
in the original DNA preparation.
CRISPR spacer matches
RNAs transcribed from CRISPR repeat clusters, and processed
to spacer RNAs, can target and inactivate extrachromosomal
elements (reviewed in Van der Oost et al.,
2009). Thus, host repeat clusters maintain a record of
invading genetic elements. In principle therefore it should
be possible to determine a host of an isolated genetic
element by comparing its genome sequence with
CRISPR spacer sequences from chromosomes of potential
hosts. We attempted to do this for the newly characterized
viruses and plasmids by comparing their
sequences, and those of other available thermoneutrophilic
viruses and plasmids, with the 1321 spacer
sequences in the CRISPR clusters of the 13 sequenced
thermoneutrophilic genomes (see Experimental procedures).
Although a sequence comparison at a nucleotide
level yielded no significant matches, a few significant
matches were found when searching at the more conserved
amino acid sequence level, after translating the
spacers into all six reading frames, essentially as
described earlier (Shah et al., 2009). At an e-value cut-off
of 0.12, there are seven significant matches to the viruses
and plasmids which are listed in Table 6, and 35 matches
to annotated crenarchaeal proteins in the 13 genomes
(some of which may occur to integrated viruses or
plasmids which were not removed from the data set).
Given that viral/plasmid ORFs constituted only 0.8% of
sequences present in the search (corresponding to
54 684 out of a total of 6 317 506 amino acids), the results
show a 20-fold preference for spacers matching viral/
plasmid ORFs over crenarchaeal genome ORFs which
reinforces the significance of the matches (Table 6). A
similar, and significant, analysis of the bacterial plasmids
was not possible because of their small sizes and the
paucity of available bacterial thermophile CRISPR
sequences.
Of the four published genetic elements, PSV, TTSV1
and TPEN01 yielded one or more significant spacer
matches to a known host genus (Table 6). Moreover,
HAV1 gave a good match to a Pyrobaculum, while
HAV2 yielded good matches to Desulfurococcus and Table
6. Significant CRISPR spacer matches to crenarchaeal thermoneutrophilic viruses and plasmids.
Crenarchaeal genome Total spacers CRISPR Spacer Virus/plasmid Host genus ORF e-value Alignment
1LGRSYDTIRKYQ12
:: : :::. : : :.
114 AKILGREYDTVRKYRNAA 131
Pyrobaculum arsenaticum 126 90 47 HAV1 253 0.012
1 WLHWLYIYGASHTG 14
:..:::.::.:.::
568 RGKW IRWLYLYGSSKTGKTT 587
Desulfurococcus kamchatkensis 94 88 10 HAV2 909 0.023
1VVYVDETYTSATCP14
:::::.:::. ::
329 GITAVYVDEAYTSSKCPIHG 348
Thermoproteus neutrophilus 225 26 13 HAV2 420 0.067
1 DIWKIRWPEAIKS 13
:: : : . . : : :.. .
75 RNFDIWKVKWPTALRAQIA 93
97 0.017
Pyrobaculum
Thermoproteus
Thermoproteus neutrophilus 225 16 5 PSV
1 RCDLCGRRVSYET 13
:::.::: . .. :
40 PDTRCD I CGRK I GYGPYMV 58
Thermoproteus neutrophilus 225 38 5 TTSV1 Thermoproteus 100a 0.041
1 RCDLCGRRVSYET 13
::: .::: ... :
40 PDTRCD ICGRK I GYGPYMV 58
Thermoproteus neutrophilus 225 38 6 TTSV1 Thermoproteus 100a 0.041
1 AQYNSWLESRL 11
:::::: :::::
112 EVEAQYNSWLESRLAVL 128
©2010SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology, 12, 2918–2930
Thermofilum pendens 182 27 17 pTPEN01 Thermofilum 633 0.079
CRISPR repeat clusters are identified by the total number of repeats, and spacers are numbered from the leader end. e-values derive from searching translated spacers against a database with a length of
6.3 million amino acids, where the viral/plasmid ORFs comprise 0.8%, and the crenarchaeal genome ORFs constitute 99.2%, of the sequence database. A total of 1321 CRISPR spacers were extracted from
the 13 genomes which ranged from 39 repeats for Caldivirga maquilingensis IC-167 to 225 for T. neutrophilus.

Thermoproteus, consistent with the high sequence similarity
of the HAV2 genome to a Desulfurococcus IS
element (Table 3; Fig. 2B). The next two most significant
matches (not included in the table) were both between
pHA1 ORF68 and single spacers in T. pendens and T.
neutrophilus, with e-values of 0.64 and 0.67, respectively,
also consistent with the extensive gene homology
between pHA1 and the T. pendens plasmid TPEN01
(Fig. 4A). Thus, this approach appears to yield useful
insights into possible hosts for the newly characterized
archaeal genetic elements, and it should be more generally
applicable for such metagenomic studies as more
archaeal CRISPR repeat-cluster sequences, or whole
genome sequences become available.
Discussion
We characterized the genomic diversity of viruses and
plasmids in a bioreactor established from a sample from a
hot spring at Yellowstone National Park (Obsidian Pool)
and maintained at 85°C and pH 6 for 2 years (Rachel
et al., 2002). Using a variety of cloning strategies to select
for linear or circular genomes, and to distinguish viruses
from plasmids, the analyses yielded two novel viral
genomes, HAV1 and HAV2, from samples highly enriched
in filamentous and tadpole-shaped VLPs, respectively,
where the former yielded several genomic variants. No
additional longer genomic contigs were assembled, from
either sample, which could correspond to the other elongated
VLP that was observed in the original sample
(Fig. 1) (Rachel et al., 2002). Neither viral genome shows
any clear similarity to other known archaeal viruses; only
HAV2 shows morphological similarities with the two-tailed
bicaudavirus ATV, and limited sequence similarity
between two genes (Prangishvili et al., 2006c), and they
may be distantly related.
Electron microscopic visualization of bioreactor
samples taken at regular intervals indicated that the levels
of individual types of VLPs dramatically rose and fell over
time. This was also true for the HAV1 variants which
showed different yields with time as revealed by gel electrophoresis
(data not shown). Presumably this reflects a
reaction to: (i) the availability of receptive host cells, and
(ii) the ability to overcome the archaeal cellular CRISPR
immune systems (Lillestøl et al., 2006; Shah et al., 2009;
Van der Oost et al., 2009). We infer that the extensive
variety of HAV1 variants, which carry numerous sequence
changes and major genomic structural alterations, reflect
adaptation of the virus to these constraints. Moreover, the
fact that they were isolated as virions (Table 1) suggests
that they are all functional. These observations may be
relevant to an earlier study which demonstrated a selective
bias of viruses in laboratory cultures of environmental
samples which contained diverse crenarchaeal fusellovi-
Novel viruses and plasmids from hyperthermoneutrophiles 2927
ruses (Snyder et al., 2004). Possibly those that were
undetectable by viral DNA amplification in the laboratory
cultures had undergone genome rearrangements or were
present in very low amounts, or in integrated form, at the
time of testing.
Attempts were made to identify putative viral hosts by
isolating strains from the bioreactor using a laser microscope
and cell sorter but none of them were infected with
viruses and, moreover, no crenarchaeal strains were
found which were infected by the crude virus preparations
(Fig. 1B and C) except for the spherical PSV, characterized
earlier, which infected two Pyrobaculum and
Thermoproteus strains (Häring et al., 2004). Moreover, at
present no reliable practical procedures have been
developed for transfecting viral DNA into neutrophilic
crenarchaea.
Sequence heterogeneities occur throughout the HAV1
genome, such that the final sequence is necessarily a
consensus, where the dominant nucleotide is taken at
each position. Moreover, nearly half the predicted genes
carry regions that were particularly susceptible to
sequence change (Fig. 2A), and some of these also incur
deletions or insertions. We infer that their gene products
are most likely to be involved in virus–host interactions,
cell adhesion or viral extrusion mechanisms. These genes
include ORFs 140, 174, 276, 325 and 585 (Fig. 2A) and
ORF585 is by far the most susceptible to change and is
therefore a strong candidate for recognition of cellular
receptors. The latter is reminiscent of the hypervariable
ORFTPX of the Thermoproteus virus TTV1, although
ORFTPX sequence changes occurred by a different
mechanism (Neumann and Zillig, 1990a,b)
The most conserved genes of HAV1 (Fig. 2A) are
strong candidates for participation in the basic viral
mechanisms of DNA replication, transcriptional regulation
and virion packaging. Earlier studies on the filamentous
and rod-shaped viruses of crenarchaeal thermoacidophiles
concluded that the conserved core viral genes tend
to be concentrated at the centre of linear genomes (Vestergaard
et al., 2008a,b) and this is consistent with the
variants carrying deletions of combinations of the four
genes at the left end of the genome (Fig. 2A).
There is a precedent for the formation of multiple
genomic variants of a crenarchaeal virus. Earlier, the crenarchaeal
rudivirus SIRV1 was isolated and passed
through a series of closely related Sulfolobus islandicus
strains, before reisolating the virions and sequencing their
genomes. Several SIRV1 variants were detected which
also exhibited localized regions of insertions, deletions,
duplications and extensive gene sequence changes
(Peng et al., 2004). However, at least some of the underlying
mechanisms of genomic change appear to be different.
For example, HAV1 carries recombination sites
constituting low-complexity direct repeats, some of which
©2010SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology, 12, 2918–2930

2928 R. A. Garrett et al.
can generate hairpin structures (Table 5) and are possibly
related to the recombination sites characterized for plasmids
of Sulfolobus which can generate regular hairpin
structures (Peng et al., 2000; Greve et al., 2004). In contrast,
SIRV1 variants incurred multiple 12 bp indels,
mainly within genes (Peng et al., 2004) and they were not
observed for HAV1. Despite some mechanistic differences,
the overall genomic changes in the viral variants
are quite similar with some genes being conserved,
others dispensable and deleted, and a few genes are
radically changed in sequence.
In contrast to classical studies on virus characterization,
a degree of uncertainty necessarily exists in the interpretation
of metagenomic data. It is difficult to confirm
unambiguously a genome-type–morphotype relationship,
especially when so few archaeal viral families are characterized
although, as shown here, the uncertainty can be
minimized by first enriching VLPs. Moreover, attempts to
identify potential archaeal hosts, on the basis of the
CRISPR immune system, will become more robust as
more archaeal host chromosomes are sequenced but it
will always be limited by the ability of some crenarchaeal
viruses to infect a broader range of host species (Lillestøl
et al., 2006; 2009; Vestergaard et al., 2008b).
Experimental procedures
DNA isolation and sequencing
All virion preparations from CsCl density gradients were
dialysed against 10 mM Tris-acetate, pH 6 overnight. For
some libraries (Table 1) chromosomal and plasmid DNA contamination
was removed from viral samples (tadpole-2 and
filament) by treating first with DNase I (50 units ml -1 ) at 37°C
for 15 min. followed by heat inactivation of the DNase I at
85°C for 15 min. Nucleic acid was isolated from virions as
described earlier (Peng et al., 2004); briefly, virions were
disrupted by incubation with 1% SDS and 0.5 mg ml -1 proteinase
K at 50°C for 1 h, DNA was extracted by phenol and
phenol-chloroform treatment before precipitating with 0.1 vol.
of 3 M sodium acetate, pH 5.3, 0.8 vol. of isopropanol. The
DNA pellet was washed with 70% ethanol, air-dried and
resuspended in an appropriate volume of 10 mM Tris-HCl, pH
8.0, 1 mM EDTA. Clone libraries were prepared by sonicating
DNA to produce fragments of 2–3 kb and then constructing
shot-gun libraries using SmaI-digested pUC18 as cloning
vector (Peng, 2008) and, also, using the Linker Amplified
Shotgun Library method described at http://www.sci.
sdsu.edu/PHAGE/LASL/. DNA was extracted using a Model
8000 Biobot (Qiagen, Westburg, Germany) and sequenced in
MegaBACE 1000 sequenators (Amersham Biotech, Amersham,
UK). Viral and plasmid sequences were assembled
using Sequencher 4.9 (http://www.genecodes.com/).
Genome analyses and gene annotations were performed
using Artemis (http://www.sanger.ac.uk/Software/Artemis/).
Gene sequence searches were made in GenBank/EMBL
(http://www.ncbi.nlm.nih.gov/blast) and motifs were identified
using the SMART facility (http://smart.embl-heidelberg.de/).
Identifying spacer matches
CRISPR spacer sequences were extracted from the available
crenarchaeal thermoneutrophilic genomes: A. pernix
K1 (NC_000854), Caldivirga maquilingensis IC-167
(NC_009954), D. kamchatkensis 1221n (NC_011766),
Hyperthermus butylicus DSM 5456 (NC_008818), Ignicoccus
hospitalis KIN4/I (NC_009776), Nitrosopumilus maritimus
SCM1 (NC_010085), Pyrobaculum aerophilum IM2 (NC_
003364), Pyrobaculum arsenaticum DSM 13514
(NC_009376), Pyrobaculum calidifontis JCM 11548 (NC_
009073), Pyrobaculum islandicum DSM 4184 (NC_008701),
Staphylothermus marinus F1 (NC_009033), T. pendens Hrk 5
(NC_008698) and T. neutrophilus V24Sta (NC_010525).
They were aligned against HAV1, HAV2, pHA1, pHB1,
pHB2a and pHB2b, and published genomes of the viruses
PSV (AJ635161), TTSV1 (AY722806) and TTV1 (X14855),
and the plasmid pTPEN01 (NC_008696), using an MMX
optimized Smith-Waterman implementation (Saebø et al.,
2005). Alignments were performed at both a nucleotide level
and an amino acid sequence level by translating the spacers
in all seven reading frames essentially as described earlier
(Shah et al., 2009), where the false positive level was estimated
by aligning the spacers against all the above crenarchaeal
genomes (minus CRISPR repeat regions) and using
this as a negative control.
Acknowledgements
We thank Ariane Bize, Lanming Chen, Hien Phan, John
Smyth, Gisle Vestergaard and Kim Brügger for much help in
the early stages of this work. The research in Copenhagen
was supported by the Natural Science Research Council.
References
Ahn, D.G., Kim, S.I., Rhee, J.K., Kim, K.P., Pan, J.G., and Oh,
J.W. (2006) TTSV1, a new virus-like particle isolated from
the hyperthermophilic crenarchaeote Thermoproteus
tenax. Virology 351: 280–290.
Anderson, I., Rodriguez, J., Susanti, D., Porat, I., Reich, C.,
Ulrich, L.E., et al. (2008) Genome sequence of Thermofilum
pendens reveals an exceptional loss of biosynthetic
pathways without genome reduction. J Bacteriol 190:
2957–2965.
Andersson, A.F., and Banfield, J.F. (2008) Virus population
dynamics and acquired virus resistance in natural microbial
communities. Science 320: 1047–1050.
Barrangou, R., Fremaux, C., Deveau, H., Richards, M.,
Boyaval, P., Moineau, S., Romero D.A. and Horvath, P.
(2007) CRISPR provides acquired resistance against
viruses in prokaryotes. Science 315: 1709–1712.
Bettstetter, M., Peng, X., Garrett, R.A., and Prangishvili, D.
(2003) AFV1, a novel virus infecting hyperthermophilic
archaea of the genus Acidianus. Virology 315: 68–79.
Bize, A., Peng, X., Prokofeva, M., Maclellan, K., Lucas, S.,
Forterre, P., et al. (2008) Viruses in acidic geothermal environments
of the Kamchatka peninsula. Res Microbiol 159:
358–366.
Diez, B., Anton, J., Guixa-Boixereu, N., Pedros-Alio, C., and
Rodriguez-Valera, F. (2000) Pulse-field gel electrophoresis
©2010SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology, 12, 2918–2930

of virus assemblages present in a hypersaline environment.
Int Microbiol 3: 159–164.
Greve, B., Jensen, S., Brügger, K., Zillig, W., and Garrett,
R.A. (2004) Genomic comparison of archaeal conjugative
plasmids from Sulfolobus. Archaea 1: 231–239.
Greve, B, Jensen, S., Phan, H., Brügger, K., Zillig, W., She,
Q., and Garrett, R.A. (2005) Novel plasmids pTAU4,
pORA1 and pTIK4 from Sulfolobus neozealandicus.
Archaea 1: 319–325.
Häring, M., Peng, X., Brügger, K., Rachel, R., Stetter, K.O.,
Garrett, R.A., and Prangishvili, D. (2004) Morphology and
genome organisation of the virus PSV of the hyperthermophilic
archaeal genera Pyrobaculum and Thermoproteus:a
novel virus family, the Globuloviridae. Virology 323: 233–
242.
Janekovic, D., Wunderl, S., Holz, I., Zillig, W., Gierl, A., and
Neumann, H. (1983) TTV1, TTV2 and TTV3, a family of
viruses of the extremely thermophilic anaerobic, sulphur
reducing, archaebacterium Thermoproteus tenax. Mol Gen
Genet 192: 39–45.
Krupovic, M., and Bamford, D.H. (2008) Archaeal proviruses
TKV4 and MVV extend the PRD1-adenovirus lineage to
the phylum Euryarchaeota. Virology 375: 292–300.
Krupovic, M., Forterre, P., and Bamford, D.H. (2010) Comparative
analysis of the mosaic genomes of tailed archaeal
viruses and proviruses suggests a common themes for
virion architecture and assembly with tailed viruses of bacteria.
J Mol Biol 397: 144–160.
Lawrence, C.M., Menon, S., Eilers, B.J., Bothner, B., Khayat,
R., Douglas, T., and Young, M.J. (2009) Structural and
functional studies of archaeal viruses. J Biol Chem 284:
12599–12603.
Lillestøl, R.K., Redder, P., Garrett, R.A., and Brügger, K.
(2006) A putative viral defence mechanism in archaeal
cells. Archaea 2: 59–72.
Lillestøl, R.K., Shah, S.A., Brügger, K., Redder, P., Phan, H.,
Christiansen, J., and Garrett, R.A. (2009) CRISPR families
of the crenarchaeal genus Sulfolobus: bidirectional transcription
and dynamic properties. Mol Microbiol 72: 259–
272.
Lipps, G., Weinierzl, A.O., von Scheven, G., Buchen, C. and
Cramer, P. (2004) Structure of a bifunctional DNA primasepolymerase.
Nat Struct Mol Biol 11: 157–162.
Mochizuki, T., Yoshida, T., Tanaka, R., Forterre, P., Sako, Y.,
and Prangishvili, D.(2010) Diversity of viruses of the hyperthermophilic
archaeal genus Aeropyrum, and isolation of
the Aeropyrum pernix bacilliform virus 1, APBV1, the first
representative of the family ‘Clavaviridae’. Virology 402:
347–352.
Neumann, H., and Zillig, W. (1990a) Structural variability in
the genome of Thermoproteus tenax virus TTV1. Mol Gen
Genet 222: 435–437.
Neumann, H., and Zillig, W. (1990b) The TTV1-encoded viral
protein TPX: primary structure of the gene and the protein.
Nucleic Acids Res 18: 195.
Oren, A., Bratbak, G., and Hendal, M. (1997) Occurrence of
virus-like particles in the Dead Sea. Extremophiles 1: 143–
149.
Ortmann, A.C., Wiedenheft, B., Douglas, T., and Young, M.
(2006) Hot crenarchaeal viruses reveal deep evolutionary
connections. Nat Rev Microbiol 4: 520–528.
Novel viruses and plasmids from hyperthermoneutrophiles 2929
Peng, X. (2008) Evidence for the horizontal transfer of an
integrase gene from a fusellovirus to a pRN-like plasmid
within a single strain of Sulfolobus and the implications for
plasmid survival. Microbiology 154: 383–391.
Peng, X., Holz, I., Zillig, W., Garrett, R. A., and She, Q.
(2000) Evolution of the family of pRN plasmids and their
integrase-mediated insertion into the chromosome of the
Crenarchaeon Sulfolobus solfataricus. J Mol Biol 303:
449–454.
Peng, X., Kessler, A., Phan, H., Garrett, R.A., and Prangishvili,
D. (2004) Multiple variants of the archaeal DNA rudivirus
SIRV1 in a single host and a novel mechanism of
genome variation. Mol Microbiol 54: 366–375.
Porter, K., Russ, B.E.,and Dyall-Smith, M.L. (2007) Virus–
host interactions in salt lakes. Curr Opin Microbiol 10:
418–424.
Prangishvili, D., Forterre, P., and Garrett, R.A. (2006a)
Viruses of the archaea: a unifying view. Nat Rev Microbiol
4: 837–838.
Prangishvili, D., Garrett, R.A., and Koonin, E.V. (2006b)
Evolutionary genomics of archaeal viruses: unique viral
genomes in the third domain of life. Virus Res 117: 52–
67.
Prangishvili, D., Vestergaard, G., Häring, M., Aramayo, R.,
Basta, T., Rachel, R., and Garrett, R.A. (2006c) Structural
and genomic properties of the hyperthermophilic archaeal
virus ATV with an extracellular stage of the reproductive
cycle. J Mol Biol 359: 1203–1216.
Rachel, R., Bettstetter, M., Hedlund, B.P., Häring, M.,
Kessler, A., Stetter, K.O., and Prangishvili, D. (2002)
Remarkable morphological diversity of viruses and viruslike
particles in terrestrial hot environments. Arch Virol 147:
2419–2429.
Redder, P., Peng, X., Brügger, K., Shah, S.A., Roesch, F.,
Greve, B., She, Q., Schleper, C., Forterre, P., Garrett, R.A.,
and Prangishvili, D. (2009) Four newly isolated fuselloviruses
from extreme geothermal environments reveal
unusual morphologies and a possible interviral recombination
mechanism. Environ Microbiol 11: 2849–2862.
Saebø, P.E., Andersen, S.M., Myrseth, J., Laerdahl, J.K., and
Rognes, T. (2005) PARALIGN: rapid and sensitive
sequence similarity searches powered by parallel computing
technology. Nucleic Acids Res 33: 535–539.
Shah, S.A., Hansen, N.R., and Garrett, R.A. (2009) Distributions
of CRISPR spacer matches in viruses and plasmids
of crenarchaeal acidothermophiles and implications for
their inhibitory mechanism. Trans Biochem Soc 37: 23–
28.
Snyder, J.C., Spuhler, J., Wiedenheft, B., Roberto, F.F.,
Douglas, T., and Young, M.J. (2004) Effects of culturing on
the population structure of a hyperthermophilic virus.
Microbiol Ecol 48: 561–566.
Torarinsson, E., Klenk, H.-P., and Garrett, R.A. (2005) Divergent
transcriptional and translational signals in Archaea.
Environ Microbiol 7: 47–54.
Van der Oost, J., Jore, M.M., Westra, E.R., Lundgren, M.,
and Brouns, S.J. (2009) CRISPR-based adaptive and heritable
immunity in prokaryotes. Trends Biochem Sci 34:
401–407.
Vestergaard, G., Aramayo, R., Basta, T., Häring, M., Peng,
X., Brügger, K., Chen, L., Rachel, R., Boisset, N., Garrett,
©2010SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology, 12, 2918–2930

2930 R. A. Garrett et al.
R.A., and Prangishvili, D. (2008a) Structure of the Acidianus
filamentous virus 3 and comparative genomics of
related archaeal lipothrixviruses Acidianus. J Virol 82:
371–381.
Vestergaard, G., Shah, S.A., Bize, A., Reitberger, W., Reuter,
M., Phan, H., Briegel, A., Rachel, R., Garrett, R.A., and
Prangishvili, D. (2008b) SRV, a new rudiviral isolate from
Stygiolobus and the interplay of crenarchaeal rudiviruses
with the host viral-defence CRISPR system. J Bacteriol
190: 6837–6845.
©2010SocietyforAppliedMicrobiologyandBlackwellPublishingLtd,Environmental Microbiology, 12, 2918–2930

CRISPR/Cas and Cmr modules, mobility and evolution of adaptive immune
systems
Abstract
Shiraz A. Shah 1 , Roger A. Garrett* ,1
Archaea Centre, Department of Biology, Copenhagen University, DK2200 Copenhagen N, Denmark
Received 17 May 2010; accepted 22 July 2010
Available online 21 September 2010
CRISPR/Cas and CRISPR/Cmr immune machineries of archaea and bacteria provide an adaptive and effective defence mechanism directed
specifically against viruses and plasmids. Present data suggest that both CRISPR/Cas and Cmr modules can behave like integral genetic
elements. They tend to be located in the more variable regions of chromosomes and are displaced by genome shuffling mechanisms including
transposition. CRISPR loci may be broken up and dispersed in chromosomes by transposons with the potential for creating genetic novelty. Both
CRISPR/Cas and Cmr modules appear to exchange readily between closely related organisms where they may be subjected to strong selective
pressure. It is likely that this process occurs primarily via conjugative plasmids or chromosomal conjugation. It is inferred that interdomain
transfer between archaea and bacteria has occurred, albeit very rarely, despite the significant barriers imposed by their differing conjugative,
transcriptional and translational mechanisms. There are parallels between the CRISPR crRNAs and eukaryal siRNAs, most notably to germ cell
piRNAs which are directed, with the help of effector proteins, to silence or destroy transposons. No homologous proteins are identifiable at
a sequence level between eukaryal siRNA proteins and those of archaeal or bacterial CRISPR/Cas and Cmr modules.
Ó 2010 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Keywords: CRISPR/Cas; CRISPR/Cmr; crRNA; Evolution; Mobile elements; siRNA
1. Introduction
The CRISPR/Cas and CRISPR/Cmr systems provide the
basis for an adaptive and a heriditable immune system directed
against the DNA and RNA, respectively, of invading elements.
The former consists of CRISPR loci and physically linked
cassettes of cas genes which together appear to constitute
integral genetic modules. The cmr genes of Cmr modules are
also clustered and are sometimes linked directly to the
CRISPR/Cas modules. The CRISPR/Cas immune system
occurs in most archaea and about 70% of these also carry Cmr
modules, whereas only about 40% of bacteria contain
CRISPR/Cas modules and about 30% of these exhibit Cmr
modules. Moreover, the archaea CRISPR loci consist of
* Corresponding author. Tel.: þ45 35322010.
E-mail address: garrett@bio.ku.dk (R.A. Garrett).
1 The two authors contributed equally to the work.
Research in Microbiology 162 (2011) 27e38
0923-2508/$ - see front matter Ó 2010 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
doi:10.1016/j.resmic.2010.09.001
www.elsevier.com/locate/resmic
clusters of spacer-repeat units and can vary in size from one to
more than a hundred spacer-repeat units where each unit is
about 60e90 bp with repeats and spacers of, on average, 30 bp
and 40 bp, respectively (reviewed in Karginov and Hannon,
2010). The CRISPR loci are preceded by non-protein coding
leader regions of about 150e550 bp (Tang et al., 2002; Jansen
et al., 2002; Lillestøl et al., 2006, 2009), and they are generally
physically linked to a group of cas genes encoding Cas
proteins of diverse functions (Jansen et al., 2002; Haft et al.,
2005; Makarova et al., 2006).
Critical for the functioning of the immune systems are the
spacer sequences which derive from foreign invading elements
(Mojica et al., 2005; Pourcel et al., 2005; Bolotin et al., 2005;
Barrangou et al., 2007). Whole transcripts are produced from
CRISPR loci which initiate within the leader sequence adjacent
to the first repeat (Lillestøl et al., 2009), and they are
subsequently processed in the repeat regions to yield endproducts
corresponding to single spacer crRNAs (Tang et al.,
2002, 2005; Lillestøl et al., 2006). Regulation of formation

28 S.A. Shah, R.A. Garrett / Research in Microbiology 162 (2011) 27e38
of the whole CRISPR transcript is probably required to prevent
interference from promoter and terminator regions which are
randomly taken up in the spacers (Shah et al., 2009). The
processing is effected by specific Cas or Cmr proteins which,
at least for the latter, generate two discrete crRNAs each
carrying 8 bp of repeat at the 5 0 -end and lacking 2 nt and 8 nt,
from the 3 0 -end of each spacer (Hale et al., 2009). Combinations
of proteins then transport the processed crRNAs to target
and inactivate invading genetic elements for both CRISPR/Cas
and CRISPR/Cmr systems (Brouns et al., 2008; Hale et al.,
2008, 2009; Carte et al., 2008). Base pairing mismatches
occurring between the 5 0 8 nt repeat sequence of the crRNA
and the sequence adjacent to the targeted protospacer of the
invading DNA are essential for subsequent degradation of the
latter and for ensuring that the chromosomal CRISPR locus,
itself, is not targeted (Marraffini and Sontheimer, 2010).
Cas and Cmr proteins are phylogenetically and functionally
very diverse and are involved in at least two mechanistic pathways
which target invading genetic elements via the crRNAs.
The CRISPR/Cas system specifically targets DNA (Marraffini
and Sontheimer, 2008; Shah et al., 2009), while the CRISPR/
Cmr system targets RNA (Hale et al., 2009). The two pathways
require the products of the cas gene cassette adjoining a CRISPR
locus or the products of the Cmr module which is either directly
linked to a CRISPR/Cas module or lies separately on the chromosome
(Fig. 1) (Jansen et al., 2002; Makarova et al., 2006).
Although most bacterial CRISPR/Cas modules are unpaired,
different combinations of CRISPR/Cas and Cmr modules,
including paired CRISPR loci, are common amongst the crenarchaea
(Fig. 1D and E). Phylogenetic studies have demonstrated
that homologs of a few Cas proteins occur widely
throughout the archaeal and bacterial domains, while others are
predominantly archaeal or bacterial in character (Haft et al.,
2005; Makarova et al., 2006).
This article will consider the following issues relating to the
mobility and evolution of the CRISPR/Cas system, generally
using crenarchaeal CRISPR systems as representative examples:
(1) Whether CRISPR/Cas modules constitute integral
genetic units. (2) Phylogenetic relationships between CRISPR/
Cas and Cmr modules. (3) Diversification and degeneration of
CRISPR/Cas modules. (4) Mobilisation and loss of CRISPR/
Cas modules. (5) Transfer of CRISPR/Cas modules between
organisms. (6) Co-evolution of the CRISPR/Cas system in the
archaeal and bacterial domains. (7) A possible common
ancestry with the diverse eukaryal siRNA systems.
2. Methods
Amino acid sequences of Cas1 proteins were collected from
all publicly available archaeal and bacterial genomes by running
an in-house-constructed Cas1-specific HMM against NCBI’s
“non-redundant” protein database. All sequences were extracted
and an all-against-all SmitheWaterman sequence comparison
was made using the FASTA package (Pearson, 2000). After
taking into account the distribution of the resulting
SmitheWaterman scores, all matching sequence pairs were
assigned weights between 0 and 1 with 0 corresponding to
aSmitheWaterman score of 200 or less, and 1 corresponding to
1200 or more. This was used as an input for Markov clustering
(MCL) (Enright et al., 2002) with the default options (inflation
factor ¼ 2) as an input for BioLayout (Goldovsky et al., 2005).
Repeat sequences were clustered by a similar approach, but using
SmitheWaterman DNA sequence alignments. Leader sequences
were clustered using the same approach but with an MCL inflation
factor of 1.2 due to their very low sequence conservation.
With the exception of the genomes of Sulfolobus islandicus
strains HVE10/4 and Rey15A and Acidianus brierleyi from our
own lab, all other genomes are publicly available with the
accession numbers NC_009135, NC_009975, NC_009637,
NC_005791, NC_013769, NC_012589, NC_012588,
NC_012632, NC_012726, NC_012622, NC_012623, 4023466
Fig. 1. Scheme showing different arrangements of CRISPR/Cas and Cmr modules. A. Typical monomeric CRISPR/Cas structure. B. Linked Cmr and CRISPR/Cas
modules. C. Separated Cmr and CRISPR/Cas modules. D. Paired family I CRISPR/Cas modules carrying inverted CRISPR loci. Typical gene contents and order
for E. a paired crenarchaeal family I CRISPR/Cas module, and F. a crenarchaeal Cmr module.

(JGI project) CP001800, NC_002754. Dot-plots were constructed
using the MUMmer package (Kurtz et al., 2004).
CRISPR clusters were found using publicly available
software (Bland et al., 2007) and Cmr modules were found
using HMMs constructed in-house. The core genomes of
Sulfolobus solfataricus and S. islandicus strains were determined
by finding all orthologous genes occurring only once in
all the genomes. Orthologs were found by performing an allagainst-all
sequence similarity search for all the encoded
proteins with subsequent clustering using MCL (Enright et al.,
2002). A multiple alignment was made of the DNA sequence
corresponding to each ortholog (Edgar, 2004). All multiple
alignments, with gaps removed, were concatenated and the
resulting alignment was used to build a phylogenetic tree
(Thompson et al., 1994). The length of each family I leader
was determined using sequence alignments of different leaders
before constructing the leader tree.
3. Results and discussion
3.1. Do CRISPR/Cas modules constitute integral genetic
units?
Several studies have detected a broad phylogenetic correlation
between selected Cas proteins and repeat sequences of
CRISPR loci, with the reservation that the repeats are of
limited and variable size (Haft et al., 2005; Kunin et al., 2007).
For the Sulfolobales, phylogenetic analyses of sequences of
repeats, leaders and Cas1 proteins demonstrated that the
CRISPR/Cas modules could be classified into at least three
distinct families (Lillestøl et al., 2009). Here we extend this
analysis and present comparative results for the Cas1 protein,
the leader and the repeat sequences using unsupervised clustering.
MCL classifies nodes into clusters based on pairwise
distances to other nodes (Enright et al., 2002). Here, the nodes
comprise the sequences of Cas1, the repeat and the leader and
the distances correspond to the sequence alignment scores
between them. This approach is preferable to the use of
phylogenetic trees for the following reasons. Firstly, the
problem of delineating boundaries between neighbouring
families is determined by the algorithm itself, avoiding the
potential error and bias of manual definition. Moreover, more
than 1000 Cas1 sequences are available in public sequence
databases and they cannot be readily presented in phylogenetic
trees, whereas they can be visualised in a two- or threedimensional
space using the Biolayout program (Goldovsky
et al., 2005). Finally, leader sequences share significant
sequence similarity within, but not across, families such that
all leaders cannot be represented in one phylogenetic tree.
Thus, MCL clustering is the best approach for automated
classification of CRISPR leader sequences, and by using the
same method for Cas1 and repeat sequences, potential
inconsistencies arising from using different methodologies are
avoided.
The results are illustrated in Fig. 2 for the Sulfolobales and
they show closely similar clustering patterns for the Cas1, leader
and repeat sequences of the CRISPR/Cas families I to IV
S.A. Shah, R.A. Garrett / Research in Microbiology 162 (2011) 27e38
(Fig. 2BeD), consistent with earlier results (Lillestøl et al.,
2009), and they strongly suggest that the four CRISPR/Cas
families have evolved independently and that they do indeed
constitute discrete genetic modules. The results in Fig. 2A reveal
that each of the Sulfolobales families IeIVare components of an
earlier defined group of families, CASS1 þ5 þ 6 þ 7(Haft et al.,
2005; Makarova et al., 2006) that in Fig. 2A can be seen to merge
into a superfamily.
For bacteria, a comparative genomic analysis of strains
of Streptococcus thermophilus also revealed a putative
co-evolution of Cas proteins and CRISPR loci within the
CRISPR/Cas modules (Horvath et al., 2008), and a more
extensive study of CRISPR loci in 47 genomes of a variety of
genera and species of lactic acid bacteria revealed 8 different
classes of CRISPR/Cas modules with evidence for a phylogenetic
congruence between Cas1 protein sequences, the repeat
sequences, and the cas gene content and synteny but, with one
partial exception, no phylogenetic link was detected between
the leader regions and the rest of the CRISPR/Cas modules
(Horvath et al., 2009). Whether the latter reflects a real
difference in the significance of the leader between these
bacteria and the crenarchaea requires further clarification.
Amongst crenarchaea, there is a preference for paired
CRISPR loci which are inverted with respect to one another,
generally (see below) resulting in internalised leader regions
and some cas genes located between the leaders (Fig. 1D and
E) (Lillestøl et al., 2009). Moreover, for the Sulfolobales, at
least, the paired modules belong to the same family and share
a single set of cas genes. Family I CRISPR/Cas modules are
the most common amongst the Sulfolobales and other crenarchaea
and they are also the most conserved in structure. The
cas genes are partitioned, with one group located between the
leaders and another lying externally at one end of the module
(Fig. 1D and E). This separation may be functionally significant
with the internal cas genes adjacent to both leader regions
encoding proteins involved in processing and insertion of
DNA spacer-repeat units, while the external cas genes encode
RNA processing and guiding proteins. There are fewer identified
examples of paired family II and III CRISPR/Cas
modules and they appear to be less conserved in their genetic
organisation than the family I modules and, at this stage, it is
premature to propose a consensus structure. A similar familyspecific
cas gene content and synteny has also been observed
for CRISPR/Cas modules of lactic acid bacteria (Horvath
et al., 2009). Presumably, the pairing of the CRISPR/Cas
modules reflects a compromise between limiting the sizes of
individual CRISPR loci and avoiding the necessity of
producing very long transcripts while using only one set of cas
genes. Moreover, if one CRISPR locus becomes inactivated as
a result of, for example, mutations at the leader-repeat junction,
the other locus will still be active.
3.2. Phylogenetic relationships between CRISPR/Cas
and Cmr modules
The Cmr module has been implicated in directing processed
crRNAs to target the RNA of invading genetic
29

30 S.A. Shah, R.A. Garrett / Research in Microbiology 162 (2011) 27e38
Fig. 2. Results of MCL clustering of components of CRISPR/Cas modules visualised using BioLayout (Goldovsky et al., 2005). A. Clustering of all Cas1 proteins
found in public databases where 5 large clusters and 11 smaller ones emerge and are colour-coded. Sequences within a given cluster show as little as 25% amino
acid sequence identity. Three of the large clusters correspond directly to previously defined families, labelled CASS2 to 4 (Haft et al., 2005; Makarova et al., 2006).
B to D. Clustering of Sulfolobales CRISPR/Cas families I, II, III and IV: B - Cas1 proteins; C leaders where leaders from the same family share about 70%
nucleotide sequence identity and little or no nucleotide sequence conservation occurs between different families; D - repeats which show about 80% sequence
identity within a given family. The results for the four families in B to D show similar patterns. Colour-coding for the Sulfolobales CRISPR/Cas families: I - blue,
II - purple, III - yellow, and IV - green. Family IV represents the CRISPR/Cas modules in Metallosphaera sedula and Acidianus brierleyi which were previously
unclassified (Lillestøl et al., 2009).
elements, whether RNA genomes, transcripts, or both,
remains unclear (Hale et al., 2009). The cmr genes are
apparently co-transcribed in a distinct cassette which is
sometimes physically linked to the CRISPR/Cas module
(Fig. 1). It occurs less widely than CRISPR/Cas modules, and
is particularly prevalent in thermophilic archaea and bacteria.
Comparison of phylogenetic trees for the CRISPR/Cas and
Cmr modules, based on sequences of a Cas1 or Cas3 proteins
(the former is not present in all CRISPR/Cas modules) and
a predicted polymerase, respectively, revealed two major
branches for the Cmr modules, carrying distinctive gene
syntenies, but showing little congruence with the Cas1/Cas3based
tree (Makarova et al., 2006). This suggests that despite
their being interdependent mechanistically and sometimes
physically coupled, the DNA- and RNA-directed systems
have evolved independently. Both module types tend to be
located in variable genomic regions and their positions, and
copy numbers, vary even for the closely related Sulfolobus
species (see below).
3.3. Diversification and degeneration of CRISPR/Cas
modules
CRISPR loci vary considerably in size extending from
a single spacer bordered by repeats to a maximum, to date, of
375 spacers (Lillestøl et al., 2006; Grissa et al., 2008). All such
CRISPR loci that have been tested, including those lacking
leader regions, have been shown to produce transcripts which
are processed (Tang et al., 2002, 2005; Brouns et al., 2008;
Carte et al., 2008; Lillestøl et al., 2006, 2009). There is
evidence from studies of both archaea and bacteria that
CRISPR loci commonly undergo deletions without impairing
overall CRISPR/Cas functionality, and that the deletions can
range in size from single to several repeat-spacer units,
presumably resulting from recombination at the identical
direct repeats. There is a tendency to lose the central and
downstream regions of the CRISPR loci farthest from the
leader region, where the earliest spacer inserts are located, and
which are likely to be less important for the immune system,

on average, than the more recently inserted spacers (Lillestøl
et al., 2006, 2009; Tyson and Banfield, 2007; Deveau et al.,
2008; Horvath et al., 2008). However, in addition to the
spacer-repeat units added at the leader-repeat junction
(Pourcel et al., 2005; Lillestøl et al., 2006, 2009), there are
a few putative examples of duplications of spacer-repeat units,
or small groups thereof, occurring in mycobacteria and
methanoarchaea (Van Embden et al., 2000; Lillestøl et al.,
2006). Moreover, it has also been claimed, for two out of
four derivatives of S. thermophilus strain SMQ-301, that
a single new spacer-repeat unit was inserted internally within
the CRISPR locus at the exact position where seven spacerrepeat
units had been deleted, suggesting that the insertiondeletion
events had occurred concurrently (Deveau et al.,
2008). A related phenomenon occurs in the CRISPR loci of
S. solfataricus strains. Pairwise alignments of CRISPR locus
A of strains P1, P2 and 98/2 in Fig. 3 show shared spacers
(shaded), as well as different spacers adjoining the leader
region and considered to have been added after the strains
diverged. Deletions are apparent when pairs of CRISPR locus
A are compared, but there is one site in the P1 locus where six
spacer-repeat units (a) have been replaced by four (b) from the
CRISPR locus B, presumably in a single recombination event
(Fig. 3).
Earlier studies suggested that mobile elements or integrative
elements rarely target CRISPR/Cas modules in either
archaea or bacteria (Van Embden et al., 2000; Haft et al.,
2005; Lillestøl et al., 2006). Moreover, in the three closely
related strains of S. solfataricus P1, P2 and 98/2, which are
rich in active transposable elements and where extensive
genomic shuffling has been observed (Brügger et al., 2004;
Redder and Garrett, 2006), no IS insertions were detected in
their extensive CRISPR loci (350e450 spacer-repeat units)
(Fig. 3). Thus, although they do occur occasionally intergenically
in the cas and cmr gene clusters, there appears to be
a strong selective pressure to maintain the integrity of CRISPR
loci in crenarchaea. Nevertheless, recent studies of environmental
bacterial samples suggest that transpositions occur
commonly in some systems. In a study of two biofilms
carrying acidophilic Leptospirillum group II bacteria, for one
biofilm about 20% of the partially sequenced CRISPR loci
carried IS elements (Tyson and Banfield, 2007) and in a recent
study of many lactic acid bacterial strains, several CRISPR
loci and cas genes cassettes were found to be interrupted by IS
S.A. Shah, R.A. Garrett / Research in Microbiology 162 (2011) 27e38
elements, with some flanking either end of a CRISPR locus
(Horvath et al., 2009). Therefore, IS elements are likely to
generate changes in active CRISPR loci possibly particularly
in biofilms, or environments with low virus and/or plasmid
levels.
Thus, IS elements, or other transposable elements, may
induce shortening and/or degeneration of CRISPR loci by
inserting into CRISPR loci and causing transposition of
spacer-repeat clusters to other chromosomal sites. Many
chromosomes, with or without CRISPR/Cas modules, carry
short CRISPR-like clusters lacking associated leader regions
and cas genes (Grissa et al., 2008). Their repeats are often
phylogenetically divergent from the CRISPR loci in a given
genome, or in closely related genomes. Although there is no
consensus view as to their origin(s) or function(s), if they are
preceded by promoters, their transcripts can, in principle, be
processed and activated by Cas and/or Cmr proteins, if
present. For example, Sulfolobus conjugative plasmids
carrying CRISPR-like loci lack cas genes and leader
sequences (She et al., 1998; Greve et al., 2004) but for at least
one of them, pKEF9, the repeat cluster is transcribed and the
RNA is processed, which indicates that the active crRNAs can
be produced intracellularly if a complementary set of cas
genes (or cmr genes) is present in the host (Lillestøl et al.,
2009). Since three of the six spacers in the pKEF9 repeat
cluster have good sequence matches to archaeal fuselloviruses
(2) and a rudivirus (1), it was proposed that the genetic
elements may also exploit the host’s CRISPR/Cas (or
CRISPR/Cmr) immune system, to compete with co-invading
foreign elements (Lillestøl et al., 2009). This hypothesis is
consistent with the demonstration that infection of an Acidianus
strain, carrying the conjugative plasmid pAH1 (lacking
a CRISPR locus), with the lipothrixvirus AFV1, led to inhibition
of plasmid replication (Basta et al., 2009).
3.4. Mobilisation and loss of CRISPR/Cas modules
Genome analyses of closely related members of the Sulfolobales
revealed CRISPR/Cas modules at different positions
in genomes which show high levels of gene synteny, raising
the question as to whether they have moved within the
genome, or been lost and/or gained. There are also differences
in the contents of the CRISPR/Cas module families in the
sequenced genomes. For example, S. solfataricus carries
Fig. 3. Pairwise comparison of repeat-spacer units of CRISPR locus A of three strains of S. solfataricus P1, P2 and 98/2. Shaded spacer-repeat units which are
linked are identical in sequence between pairs of CRISPR loci. Six spacer-repeat units, indicated by a, are deleted from strain P1, while four spacer-repeat units,
denoted b, have apparently been acquired from CRISPR locus B (Lillestøl et al., 2009). Leader regions are indicated by L.
31

32 S.A. Shah, R.A. Garrett / Research in Microbiology 162 (2011) 27e38
family I and II modules while Sulfolobus acidocaldarius
carries modules of family II and III (Lillestøl et al., 2009).
To determine whether CRISPR/Cas modules are readily
mobilised, we investigated the presence or absence of
CRISPR/Cas modules in genomes of pairs of closely related
Sulfolobus, showing >99% DNA sequence identity, respectively
(Fig. 4). The Sulfolobus strains (She et al., 2001a; Reno
et al., 2009) exhibit differences in the numbers of modules, for
example, for the pair of closely related S. islandicus strains
HVE10/4 and REY15A; the former carries two CRISPR/Cas
modules and one Cmr module, whereas the latter has one
CRISPR/Cas module and two Cmr modules. CRISPR loci of
the five pairs of S. islandicus strains, in contrast to those of the
S. solfataricus strains (Fig. 3), share no common spacers.
However each strain carries one paired family I CRISPR/Cas
module so that it was possible to test whether the module had
persisted since the 10 strains diverged. The genomic position
of the module was compared between each strain pair and was
shown not to be conserved in position for 4 out of 5 pairs
(Fig. 4). However, the displacements, even for the most closely
related strains, could be attributed to the genomic region
carrying the module being variable and having undergone
complex rearrangements, rather than the module itself having
been mobilised. At present, there are insufficient closely
related genomes available, for archaea and bacteria, which
carry CRISPR/Cas modules to test for the generality of these
A B C
D E
results, although in an earlier study of two Thermatoga
genomes, CRISPR loci were found to be located close to
variable sites where chromosomal inversions had occurred
(DeBoy et al., 2006).
There are examples of CRISPR/Cas modules being lost from
genomes. For example, a variant strain of S. solfataricus P2
(P2A) was characterised that had lost four of the six CRISPR/
Cas modules (A, B, C and D) which were physically linked, in
total 124 kb, apparently via a single recombination event
between two bordering IS elements (Redder and Garrett, 2006),
and S. solfataricus 98/2 lacks two whole clusters (C and F)
(Lillestøl et al., 2009). Bordering IS elements also have the
potential to generate transposons carrying whole CRISPR/Cas
or Cmr modules and, rarely, paired family II CRISPR/Cas
modules are bordered by identical inverted leaders (e.g.,
CRISPR loci A and B of S. solfataricus) which could recombine,
leading to loss of the whole module. Examples of closely related
strains apparently losing CRISPR/Cas modules have also been
reported for some bacteria (e.g., Godde and Bickerton, 2006;
Horvath et al., 2008).
For S. solfataricus P2A, loss of CRISPR/Cas modules was
attributed to its being a laboratory strain where the CRISPR/
Cas immune system had become an unnecessary burden on the
cell’s energy resources in the absence of invading genetic
elements. Possibly in niches relatively poor in viruses and
plasmids, including numerous bacterial endosymbionts, there
Fig. 4. Dot-plots showing the degree of variability in gene syteny at the genomic sites of the CRISPR loci for closely related pairs of Sulfolobus strains (AeE). At
the top and right sides of each plot, I, II, III indicates the position of a CRISPR/Cas family and C denotes a Cmr module. For the Sulfolobus strains, CRISPR/Cas
modules and Cmr modules are invariably located within an approximately 0.75 Mb variable region containing many IS elements. In general, the gene synteny
bordering the modules, and the genomic locations of the modules, have changed, possibly due to transpositional activity.

is a tendency to offload the CRISPR/Cas system. For example,
many human/animal pathogens including Borrelia, Brucella,
Buchnera, Burkholderia, Chlamydia and Rikketsia lack
CRISPR loci while others, including Pseudomonas strains and
Staphylococcus aureus, either lack CRISPR loci or carry
apparently degenerate copies. This may partly explain why
about 60% of bacteria lack the CRISPR/Cas and CRISPR/Cmr
immune systems (Grissa et al., 2008; Mojica et al., 2009).
3.5. Transfer of CRISPR/Cas modules between
organisms
Various lines of evidence suggest that CRISPR loci have
been transferred between organisms. For example, the variety
and combinations of different families of CRISPR/Cas modules
that occur in closely related crenarchaeal genomes, with
a similar pattern for the lactic acid bacterial genomes (Horvath
et al., 2009; Lillestøl et al., 2009; Shah et al., 2009). This
underlines that exchange does occur between closely related
organisms. Other evidence derives from an analysis of the
euryarchaeon Pyrococcus furiosus, where a 155 kb fragment
bordered by CRISPR locus and a repeat shows significantly
different properties of G þ C content, third codon position and
codon usage from the rest of the genome (Portillo and
Gonzalez, 2009). Similarly, the lactic acid bacterium Bifidobacterium
adolescentis was shown to carry a cas gene cassette
with a much lower G þ C content (47%) than the average
chromosomal G þ C content (59.2%) (Horvath et al., 2009).
In order to examine the degree to which CRISPR/Cas
modules are subject to structural changes, we examined paired
family I CRISPR/Cas modules in several closely related Sulfolobus
strains. Phylogenetic trees were constructed for the
external and internal cas gene cassettes and the leader region
(Fig. 1E) and they were compared with a tree of the core
genomes (Fig. 5A). The tree of the external cas gene cassette
is similar to the core genome tree, suggesting that these genes
were retained in the genome after divergence of the strains
(Fig. 5C). However, the trees for the internal cas gene cassette
located between the two leaders (Fig. 5D) and the leader
regions (Fig. 5B), match one another fairly closely, and they
also match a tree derived from the repeat sequences (Lillestøl
et al., 2009). This indicates that the external cas genes, putatively
involved in RNA processing and crRNA mobility, have
been retained within the strains, whereas the internal cas gene
cassettes, which are functionally implicated in spacer addition
at the leader-repeat junction, seem to co-evolve, and be
mobilised with, the CRISPR loci.
Mechanisms of transfer of CRISPR/Cas modules are less
clear and may be diverse. CRISPR/Cas loci can vary in size
from about 7 kb for a cas gene cassette, a leader region and
a small CRISPR locus, to 25 kb or more for the paired family I
crenarchaeal CRISPR/Cas modules. Indirect evidence for the
transfer of CRISPR/Cas modules on conjugative plasmids
arose from the observation that a few bacterial conjugative
plasmids from Thermus thermophilus, Synechocystis and
Shewanella, carried CRISPR loci, sometimes associated with
afewcas genes (Godde and Bickerton, 2006) and, moreover,
S.A. Shah, R.A. Garrett / Research in Microbiology 162 (2011) 27e38
small CRISPR loci have been detected in two crenarchaeal
conjugative plasmids (She et al., 1998; Peng et al., 2003;
Greve et al., 2004). Although, for the latter, no physical
proximity of integrated conjugative plasmids and CRISPR loci
occurs within Sulfolobus chromosomes (Chen et al., 2005;
Kawarabayashi et al., 2001). To date, CRISPR loci have not
been detected in viral genomes, although they do occur within
prophages of the human pathogen Clostridium difficile
(Sebaihia et al., 2006).
At least for the paired crenarchaeal CRISPR/Cas modules,
they were considered to be too large to be borne on extrachromosomal
elements (Lillestøl et al., 2009). Another more
likely mechanism for transferring such large CRISPR/Cas
modules between closely related organisms is via chromosomal
conjugation. The archaea-specific integration mechanism,
generating a partitioned integrase gene, provides
a mechanism favouring encapturing genetic elements in
chromosomes (Muskhelishvili et al., 1993; She et al., 2001b)
and some Sulfolobus species that carry encaptured integrated
conjugative plasmids are also capable of conjugating their
chromosomal DNA (Aagaard et al., 1995; Grogan, 1996).
Possibly unknown transmission mechanisms may operate, for
example, within biofilms.
3.6. Co-evolution of the CRISPR/Cas system in the
archaeal and bacterial domains
Ever since the earliest studies on the CRISPR/Cas system,
the prevailing view has been that the archaeal and bacterial
systems are closely related. This view was underpinned by the
similar ordering of repeat-spacer units in the CRISPR loci and
by extensive comparative sequence studies of selected Cas
proteins (Haft et al., 2005; Godde and Bickerton, 2006;
Makarova et al., 2006). Moreover, it has been further reinforced
by the mechanism of elongation of CRISPR loci at the
leader-repeat junction as well as by processing and maturation
mechanisms of crRNAs in both domains (Tang et al., 2002,
2005; Brouns et al., 2008; Hale et al., 2008, 2009).
Nevertheless, there are distinctive features of the two
systems. CRISPR loci are much more common amongst
archaea and tend to be larger, more complex and more labile
(Lillestøl et al., 2006; Grissa et al., 2008). In addition, most
repeat sequences of bacterial CRISPR loci carry inverted
repeat motifs which can generate hairpin structures in transcripts;
these are less common amongst archaeal repeats
which, in turn, suggests that different RNA processing signals
occur within repeat regions of the transcripts (Lillestøl et al.,
2006; Kunin et al., 2007). Moreover, phylogenetic relationships
based on SmitheWaterman alignments show that most
families of archaeal and bacterial repeat sequences exhibit
minimal overlap (Kunin et al., 2007). A similar pattern arises
from sequence alignments of Cas proteins where phylogenetic
trees of Cas proteins show many archaeal genes clustering in
separate groups (Fig. 2A) (Haft et al., 2005; Godde and
Bickerton, 2006; Makarova et al., 2006). In addition, the
average synteny of the cas and cmr genes is quite conserved
within, but not between, major phyla (Haft et al., 2005). There
33

34 S.A. Shah, R.A. Garrett / Research in Microbiology 162 (2011) 27e38
Fig. 5. Phylogenetic trees of S. solfataricus and S. islandicus strains based on: (A) nucleotide sequence alignments of core genomes of the host organisms,
(B) leader sequences, (C) concatenated external cas genes, and (D) concatenated internal cas genes for paired family I CRISPR loci. Only bootstrap values less
than 100% are given. All 12 strains were too closely related to be distinguished on the basis of 16S rDNA sequences. For S. islandicus strains LS, LD, YG, YN and
M14 (Reno et al., 2009), it is evident that since they diverged from their closest relative, identical changes have occurred in both copies of the leader, possibly due
to the whole CRISPR/Cas module, or a part of it, having been replaced. In contrast, the external cas cassette appears to have resided on the genome since all strains
diverged because of the similarity of trees A and C. The internal cas cassette tree (D) follows that of the leader consistent with tight functional coupling.
is also a CRISPR repeat binding protein, of elusive function
that has only been detected amongst the crenarchaea (Peng
et al., 2003). Other mechanistic differences may surface as
the systems are studied more widely and in more depth.
Importantly, however, crenarchaeal viruses have radically
different virusehost relationships from those of bacteria and
eukarya (Prangishvili et al., 2006; Bize et al., 2009). Consistent
with this, there are putative archaeal virus-specific anti-
CRISPR systems (Peng et al., 2004; Vestergaard et al., 2008;
Garrett et al., 2010) and bacteria-specific CRISPR regulating
systems (Pühl et al., 2010). Therefore, it is likely that the
CRISPR/Cas and Cmr systems have maintained and/or
undergone domain-specific adaptations during evolution.
Assuming that a CRISPR/Cas-like system evolved prior to
the separation of the archaeal and bacterial lineages, at a time
when one assumes the activity of exchange of genetic
elements was rife, we are left with two main scenarios for their
subsequent development: (1) that the systems have remained
relatively conserved, and separated, and have gradually
developed specific archaeal, or bacterial, characteristics; or
(2) there has been periodic interdomain exchange, and thereby
co-evolution of the archaeal and bacterial systems.
Clearly, crossing domain boundaries would be a very
complex process given the basic differences between archaea
and bacteria in their transcriptional initiation, elongation and
termination mechanisms, and their translational initiation
mechanisms (Torarinsson et al., 2005; Santangelo et al., 2009)
and would be very unlikely to occur for modern cells. Transfer
by conjugation would also be unlikely given the differing
conjugative systems and the different membrane and cell wall

structures of archaea and bacteria (Greve et al., 2004; Veith
et al., 2009). For the CRISPR/Cas and Cmr modules, interdomain
transfer would seriously compromise both expression
of the numerous essential cas and cmr genes as well as transcription
of the CRISPR loci. In this context, the influential
claim of the large uptake of functioning archaeal genes in the
genome of the bacterium Thermotoga maritima (24% of the
total including a CRISPR locus) (Nelson et al., 1999), was
always highly controversial, not least because it would have
required the wholesale reprogramming of a large part of the
chimeric genome for transcriptional and translational signals.
A recent reevaluation of this genome, together with those of
four other members of the Thermatogales, has provided
a much more nuanced and cautious view of the phylogenetic
origins of these bacteria (Zhaxybayeva et al., 2009), thereby
underlining the perils of inferring phylogeny from BLAST
sequence searches. On the other hand, co-evolution of the
archaeal and bacterial CRISPR/Cas systems would only
require cross-domain events to succeed very rarely, after
which the transferred system could be under strong selective
pressure. Some limited interdomain transfer would be
consistent with the phylogenetic trees produced for Cas1 or
Cas3 proteins of the CRISPR/Cas modules and Cmr2 of the
Cmr module (Haft et al., 2005; Godde and Bickerton, 2006;
Makarova et al., 2006). Archaea-specific Cas proteins (Haft
et al., 2005) may be associated with CRISPR/Cas or Cmr
systems that have evolved more independently in environments
of high temperature, extremes of pH or hypersaline
conditions where bacterial levels tend to be relatively low, and
gradually become functionally incompatible with those living
in less extreme, bacteria-rich environments where limited
genetic exchange between archaea and bacteria is more likely.
3.7. A common ancestry with the diverse eukaryal siRNA
systems?
Diverse small interference RNA systems (siRNA) are
widespread in eukarya. Thus, in plants, small RNAs are
important for antiviral defence and regulation of transposons
and similar functions are common amongst invertebrates
(Hannon, 2002; Jinek and Doudna, 2009). Moreover, they
have been implicated in controlling repeat and transposon
contents of somatic nuclei in protozoa (Mochizuki and
Gorovsky, 2004). Although some mechanisms are confined
to certain eukaryal lineages, they all essentially provide
a mechanism for discriminating and targeting “foreign”
genetic elements or transposons. Moreover, there are broad
mechanistic similarities between the eukaryal siRNA systems
and the DNA- and RNA-targeting CRISPR systems. They all
have to discriminate foreign DNA from self-DNA, and target
nucleic acids which both show little sequence similarity and
can undergo continual sequence change.
There is a limited parallel between the CRISPR/Cmr RNAtargeting
and eukaryal antiviral systems. The latter cut and
process invading dsRNAviruses into small 21e22 bp dsRNAs by
an endonuclease (Dicer), and these are converted into ssRNAs
by the Argonaute proteineRISC complex. The proteineRNA
S.A. Shah, R.A. Garrett / Research in Microbiology 162 (2011) 27e38
complex locates and anneals to a viral mRNA carrying
a complementary sequence which is then inactivated by another
endonuclease (Slicer). However, the initial processing step
involving the Dicer endonuclease seems to be quite different in
the CRISPR/Cas system.
The closest parallel to the crRNAs and CRISPR loci
amongst the eukaryal siRNA systems are the Argonaute Piwiinteracting
RNAs (piRNAs) processed from piRNA cluster
transcripts which also do not require a Dicer-like endonuclease
(Lillestøl et al., 2009; Karginov and Hannon, 2010). This
eukaryal system has been studied primarily in insects, fish and
mammals and strong evidence has been provided for its
involvement in maintaining germline integrity and development
(Aravin et al., 2008; Klattenhoff and Theurkauf, 2008).
The piRNA clusters are rich in transposons and repeatsequence
elements and occur at specific chromosomal sites, as
for the CRISPR loci. The piRNA clusters increase their
informational capacity by the insertion of transposon
sequences which provide novel sequence content and become
fixed in the piRNA clusters by selection. Thus, continual
expansion of piRNA clusters occurs, as for CRISPR loci, but
the process is passive rather than directed. Moreover, as for the
CRISPR/Cas system, the newly incorporated DNA derives
exclusively from genetic elements that are to be targeted. Both
piRNA clusters and CRISPR loci yield large transcripts prior
to processing into smaller RNAs. The processed piRNAs are
24e30 nt in length while the crRNAs lie in the range 39e45
nt. piRNAs complex with the Argonaute Piwi/RISC protein
complex, similarly to crRNAs assembling in Cas or Cmr
protein complexes, and they target and control mobile
endogenous genetic elements primarily in germ cells. To date,
piRNA complexes have been exclusively associated with targeting
RNAs but this may reflect the fact that retrotransposons
predominate in those germ cells under study.
No homologous proteins have been detected from sequence
analyses between proteins of the eukaryl siRNA systems and
those of the CRISPR system, although similarities may appear
at a tertiary structural level. Moreover, despite Argonaute
Piwi-like domain proteins occurring in many archaea and
bacteria (Cerutti et al., 2000), they have not been implicated in
crRNA-targeting. There is also very limited evidence for
a functional targeting overlap between the two systems. A few
sequence matches have been observed between archaeal and
bacterial CRISPR spacers and transposons, consistent with the
CRISPR/Cas system targeting mobile elements (Lillestøl,
et al., 2006; Held and Whitaker, 2009; Mojica et al., 2009;
Shah et al., 2009). However, those reported have generally
been carried on virus or plasmid genomes including, for
example, spacer matches to each of the four transposase genes
carried by the bicaudavirus ATV (Shah et al., 2009), but these
transposase genes/IS elements are presumably indistinguishable
from any other viral/plasmid genomic target if they carry
appropriate sequence motifs adjacent to protospacer sites.
Moreover, in the archaeon S. solfataricus P2, which carries
about 350 putative mobile elements (Brügger et al., 2002),
there is evidence that chromosomal transpositional activity is
regulated, at least partly, by antisense RNAs (Tang et al.,
35

36 S.A. Shah, R.A. Garrett / Research in Microbiology 162 (2011) 27e38
2005), and very few close sequence matches were found to any
of the 417 CRISPR spacers (Lillestøl et al., 2006; Shah et al.,
2009).
Finally, the piRNA system, like the CRISPR/Cas and
CRISPR/Cmr systems, may be very ancient. Evolution of
genomic parasites occurred concurrently with the emergence
of self replicating genomes. Thus, the development of adaptive
and heritable systems would be important for maintaining
fitness.
4. Conclusion
The CRISPR/Cas and CRISPR/Cmr immune machineries
provide an effective defence mechanism in most archaea and
some bacteria. The system is dynamic and hereditable,
although the benefit for the cell in evolutionary terms is
transitional because DNA from extrachromosomal elements
taken up as spacers in CRISPR loci has a rapid turnover and is
lost again via recombination at repeats and/or transpositional
events. Current evidence suggests that CRISPR/Cas and Cmr
modules behave like integral genetic elements. They tend to be
located in the most variable regions of chromosomes and are
frequently displaced as a result of genome shuffling, including
possibly transposition of whole modules. CRISPR loci may be
broken up and dispersed in chromosomes with the potential for
creating genetic novelty. Small leaderless CRISPR-like loci
are commonly found in chromosomes and in plasmids, and
some can be transcribed, but it remains unclear whether they
derive from CRISPR loci or whether they have other origins
and/or other functions. The CRISPR/Cas and Cmr modules
appear to exchange readily between closely related organisms
where they may be subjected to strong selective pressure. It is
likely that this can occur via conjugative plasmids or chromosomal
conjugation. While universal phylogenetic trees for
Cas1/Cas3 proteins of the CRISPR/Cas module and Cmr2 of
the Cmr module suggest that interdomain transfers between
archaea and bacteria have occurred, the relatively large
number of archaea-specific Cas/Cmr proteins suggests that
these may have been very rare events, consistent with the
incompatibility of the transcription, translation and conjugative
systems.
There are parallels to the eukaryal siRNAs, most notably
for the germ cell piRNAs, which are also directed by effector
proteins to silence or destroy invading foreign DNA and
transposons. While some common effector proteins are
utilized in different eukaryal siRNA systems, no homologous
proteins are identifiable between the eukaryal siRNA proteins
and those of the archaeal and bacterial CRISPR/Cas and Cmr
modules. Possibly very distant phylogenetic relationships will
appear as more crystal structures of the siRNA and crRNA
effector proteins are determined.
Acknowledgements
Research at the Archaea Centre was supported by grants
from the Danish Natural Science Research Council and the
Danish Foundation for Basic Research. We appreciate helpful
discussions with Qunxin She, Soley Gudbergsdottir, Ling
Deng, Guo Li and Xu Peng.
References
Aagaard, C., Dalgaard, J., Garrett, R.A., 1995. Inter-cellular mobility and
homing of an archaeal rDNA intron confers selective advantage over
intron-cells of Sulfolobus acidocaldarius. Proc. Natl. Acad. Sci. U.S.A. 92,
12285e12289.
Aravin, A.A., Hannon, G.J., Brennecke, J., 2008. The Piwi-piRNA pathway
provides an adaptive defense in the transposon arms race. Science 318,
761e764.
Barrangou, R., Fremaux, C., Deveau, H., Richards, M., Boyaval, P.,
Moineau, S., Romero, D.A., Horvath, P., 2007. CRISPR provides acquired
resistance against viruses in prokaryotes. Science 315, 1709e1712.
Basta, T., Smyth, J., Forterre, P., Prangishvili, D., Peng, X., 2009. Novel
archaeal plasmid pAH1 and its interaction with the lipothrixvirus AFV1.
Mol. Microbiol. 71, 23e34.
Bize, A., Karlsson, E.A., Ekefjärd, K., Quax, T.E., Pina, M., Prevost, M.C.,
Forterre, P., Tenaillon, O., Bernander, R., Prangishvili, D., 2009. A unique
virus release mechanism in the Archaea. Proc. Natl. Acad. Sci. U.S.A. 106,
11306e11311.
Bland, C., Ramsey, T.L., Sabree, F., Lowe, M., Brown, K., Kyrpides, N.C.,
Hugenholtz, P., 2007. CRISPR Recognition Tool (CRT): a tool for automatic
detection of clustered regularly interspaced palindromic repeats.
BMC Bioinform. 8, 209.
Bolotin, A., Quinquis, B., Sorokin, A., Ehrlich, S.D., 2005. Clustered regularly
interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal
origin. Microbiology 151, 2551e2561.
Brouns, S.J., Jore, M.M., Lundgren, M., Westra, E.R., Slijkhuis, R.J.,
Snijders, A.P., Dickman, M.J., Makarova, K.S., Koonin, E.V., van der
Oost, J., 2008. Small CRISPR RNAs guide antiviral defense in prokaryotes.
Science 321, 960e964.
Brügger, K., Redder, P., She, Q., Confalonieri, F., Zivanovic, Y., Garrett, R.A., 2002.
Mobile elements in archaeal genomes. FEMS Microbiol. Lett. 206, 131e141.
Brügger, K., Torarinsson, E., Chen, L., Garrett, R.A., 2004. Shuffling of
Sulfolobus genomes by autonomous and non-autonomous mobile
elements. Biochem. Soc. Trans. 32, 179e183.
Carte, J., Wang, R., Li, H., Terns, R.M., Terns, M.P., 2008. Cas6 is an
endoribonuclease that generates guide RNAs for invader defense in
prokaryotes. Genes Dev. 22, 3489e3496.
Cerutti, L., Mian, N., Bateman, A., 2000. Domains in gene silencing and cell
differentiation proteins: the novel PAZ domain and redefinition of the Piwi
domain. Trends Biochem. Sci. 25, 481e482.
Chen, L., Brügger, K., Skovgaard, M., Redder, P., She, Q., Torarinsson, E.,
Greve, B., Awayez, M., Zibat, A., Klenk, H.F., Garrett, R.A., 2005. The
genome of Sulfolobus acidocaldarius, a model organism of the Crenarchaeota.
J. Bacteriol. 187, 4992e4999.
DeBoy, R.T., Mongodin, E.F., Emerson, J.B., Nelson, K.E., 2006. Chromosome
evolution in the Thermotogales: large-scale inversions and strain
diversification of CRISPR sequences. J. Bacteriol. 188, 2364e2374.
Deveau, H., Barrangou, R., Garneau, J.E., Labonté, J., Fremaux, C.,
Boyaval, P., Romero, D.A., Horvath, P., Moineau, S., 2008. Phage response
to CRISPR-encoded resistance in Streptococcus thermophilus. J. Bacteriol.
190, 1390e1400.
Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy
and high throughput. Nucleic Acids Res. 32, 1792e1797.
Enright, A.J., Van Dongen, S., Ouzounis, C.A., 2002. An efficient algorithm
for large-scale detection of protein families. Nucleic Acids Res. 30,
1575e1584.
Garrett, R.A., Prangishvili, D., Shah, S.A., Reuter, M., Stetter, K., Peng, X.,
2010. Metagenomic analyses of novel viruses, plasmids, and their variants,
from an environmental sample of hyperthermophilic neutrophiles cultured in
a bioreactor. Environ. Microbiol., doi:10.1111/j.1462-2920.2010.02266.x.
Godde, J.S., Bickerton, A., 2006. The repetitive DNA elements called
CRISPRs and their associated genes: evidence of horizontal transfer
among prokaryotes. J. Mol. Evol. 62, 718e729.

Goldovsky, L., Cases, I., Enright, A.J., Ouzounis, C.A., 2005. BioLayout
(Java): versatile network visualisation of structural and functional relationships.
Appl. Bioinform. 4, 71e74.
Greve, B., Jensen, S., Brügger, K., Zillig, W., Garrett, R.A., 2004. Genomic
comparison of archaeal conjugative plasmids from Sulfolobus. Archaea 1,
231e239.
Grissa, I., Vergnaud, G., Pourcel, C., 2008. CRISPRcompar: a website to
compare clustered regularly interspaced short palindromic repeats. Nucleic
Acids Res. 36, 145e148.
Grogan, D.W., 1996. Exchange of genetic markers at extremely high
temperatures in the archaeaon Sulfolobus acidocaldarius. J. Bacteriol. 178,
3207e3211.
Haft, D.H., Selengut, J., Mongodin, E.F., Nelson, K.E., 2005. A guild of
45 CRISPR-associated (Cas) protein families and multiple CRISPR/
Cas subtypes exist in prokaryotic genomes. PloS Comput. Biol. 1,
474e483.
Hale, C., Kleppe, K., Terns, R.M., Terns, M.P., 2008. Prokaryotic silencing
(psi)RNAs in Pyrococcus furiosus. RNA 14, 1e8.
Hale, C.R., Zhao, P., Olson, S., Duff, M.O., Graveley, B.R., Wells, L.,
Terns, R.M., Terns, M.P., 2009. RNA-guided RNA cleavage by a CRISPR
RNA-Cas protein complex. Cell 139, 945e956.
Hannon, G.J., 2002. RNA interference. Nature 418, 244e251.
Held, N.L., Whitaker, R.J., 2009. Viral biogeography revealed by signatures in
Sulfolobus islandicus genomes. Environ. Microbiol. 11, 457e466.
Horvath, P., Romero, D.A., Coûté-Monvoisin, A.-C., Richards, M., Deveau, H.
, Moineau, S., Boyaval, P., Fremaux, C., Barrangou, R., 2008. Diversity,
activity, and evolution of CRISPR loci in Streptococcus thermophilus.
J. Bacteriol. 190, 1401e1412.
Horvath, P., Coûté-Monvoisin, A.-C., Romero, D.A., Boyaval, P., Fremaux, C.,
Barrangou, R., 2009. Comparative analysis of CRISPR loci in lactic acid
bacteria genomes. Int. J. Food Microbiol. 131, 62e70.
Jansen, R., Embden, J.D., Gaastra, W., Schouls, L.M., 2002. Identification of
genes that are associated with DNA repeats in prokaryotes. Mol. Microbiol.
43, 1565e1575.
Jinek, M., Doudna, J.A., 2009. A three dimensional view of the molecular
machinery of RNA interference. Nature 457, 405e412.
Karginov, F.V., Hannon, G.J., 2010. The CRISPR system: small RNA-guided
defense in bacteria and archaea. Mol. Cell 37, 7e19.
Kawarabayashi, Y., Hino, Y., Horikawa, H., Jin-no, K., Takahashi, M.,
Sekine, M., Baba, S., Ankai, A., Kosugi, H., Hosoyama, A., Fukui, S.,
Nagai, Y., Nishijima, K., Otsuka, R., Nakazawa, H., Takamiya, M.,
Kato, Y., Yoshizawa, T., Tanaka, T., Kudoh, Y., Yamazaki, J., Kushida, N.,
Oguchi, A., Aoki, K., Masuda, S., Yanagii, M., Nishimura, M.,
Yamagishi, A., Oshima, T., Kikuchi, H., 2001. Complete genome sequence
of an aerobic thermoacidophilic crenarchaeon, Sulfolobus tokodaii strain7.
DNA Res. 8, 123e140.
Klattenhoff, C., Theurkauf, W., 2008. Biogenesis and germline functions of
piRNAs. Development 135, 3e9.
Kunin, V., Sorek, R., Hugenholtz, P., 2007. Evolutionary conservation of
sequence and secondary structures in CRISPR repeats. Genome Biol. 8,
R611eR617.
Kurtz, S., Phillippy, A., Delcher, A.L., Smoot, M., Shumway, M.,
Antonescu, C., Salzberg, S.L., 2004. Versatile and open software for
comparing large genomes. Genome Biol. 5, R12.
Lillestøl, R.K., Redder, P., Garrett, R.A., Brügger, K., 2006. A putative viral
defence mechanism in archaeal cells. Archaea 2, 59e72.
Lillestøl, R.K., Shah, S.A., Brügger, K., Redder, P., Phan, H., Christiansen, J.,
Garrett, R.A., 2009. CRISPR families of the crenarchaeal genius Sulfolobus:
bidirectional transcription and dynamic properties. Mol. Microbiol.
72, 259e272.
Makarova, K.S., Grishin, N.V., Shabalina, S.A., Wolf, Y.I., Koonin, E.V., 2006.
A putative RNA-interference-based immune system in prokaryotes:
computational analysis of the predicted enzymatic machinery, functional
analogies with eukaryotic RNAi, and hypothetical mechanisms of action.
Biol. Direct 1, 7.
Marraffini, L.A., Sontheimer, E.J., 2008. CRISPR interference limits horizontal
gene transfer in Staphylococci by targeting DNA. Science 322,
1843e1845.
S.A. Shah, R.A. Garrett / Research in Microbiology 162 (2011) 27e38
Marraffini, L.A., Sontheimer, E.J., 2010. Self versus non-self discrimination
during CRISPR RNA-directed immunity. Nature 463, 568e571.
Mochizuki, K., Gorovsky, M.A., 2004. Small RNAs in genome rearrangements
in Tetrahymena. Curr. Opin. Genet. Dev. 14, 181e187.
Mojica, F.J., Diez-Villasenor, C., Garcia-Martinez, J., Soria, E., 2005. Intervening
sequences of regularly spaced prokaryotic repeats derive from
foreign genetic elements. J. Mol. Evol. 60, 174e182.
Mojica, F.J., Diez-Villasenor, C., Garcia-Martinez, J., Almendros, C., 2009.
Short motif sequences determine the targets of the prokaryotic CRISPR
system. Microbiology 155, 733e740.
Muskhelishvili, G., Palm, P., Zillig, W., 1993. SSV1-encoded site-specific
recombination system in Sulfolobus shibatae. Mol. Gen. Genet. 237,
334e342.
Nelson, K.E., Clayton, E., Gill, S.R., Gwinn, M.L., Dodson, R.J., Haft, D.H.,
Hickey, E.K., Peterson, J.D., Nelson, W.C., Ketchum, K.A., et al., 1999.
Evidence for lateral gene transfer between archaea and bacteria from
genome sequence of Thermotoga maritima. Nature 399, 323e329.
Pearson, W.R., 2000. Flexible sequence similarity searching with the FASTA3
program package. Methods Mol. Biol. 132, 185e219.
Peng, X., Brügger, K., Shen, B., Chen, L., She, Q., Garrett, R.A., 2003. Genusspecific
protein binding to the large clusters of DNA repeats (short regularly
spaced repeats) present in Sulfolobus genomes. J. Bacteriol. 185,
2410e2417.
Peng, X., Kessler, A., Phan, H., Garrett, R.A., Prangishvili, D., 2004. Multiple
variants of the archaeal DNA rudivirus SIRV1 in a single host and a novel
mechanism of genomic variation. Mol. Microbiol. 54, 366e375.
Portillo, M.C., Gonzalez, J.M., 2009. CRISPR elements in the thermococcales:
evidence for associated horizontal gene transfer in Pyrococcus furiosus. J.
Appl. Genet. 50, 421e430.
Pourcel, C., Salvignol, G., Vergnaud, G., 2005. CRISPR elements in Yersinia
pestis acquire new repeats by preferential uptake of bacteriophage DNA,
and provide additional tools for evolutionary studies. Microbiology 151,
653e663.
Prangishvili, D., Forterre, P., Garrett, R.A., 2006. Viruses of the Archaea:
a unifying view. Nat. Rev. Microbiol. 11, 837e848.
Pühl, Ü., Wurm, R., Arslan, Z., Geissen, R., Hofmann, N., Wagner, R., 2010.
Identification and characterisation of E. coli CRISPR-cas promoters and
their silencing by H-NS. Mol. Microbiol. 75, 1495e1512.
Redder, P., Garrett, R.A., 2006. Mutations and rearrangements in the genome
of Sulfolobus solfataricus P2. J. Bacteriol. 188, 4198e4206.
Reno, M.L., Hel, N.L., Fields, C.J., Burke, P.V., Whitaker, R.J., 2009.
Biogeography of the Sulfolobus islandicus pan-genome. Proc. Natl. Acad.
Sci. U.S.A. 106, 8605e8610.
Santangelo, T.J., Cubonová, L., Skinner, K.M., Reeve, J.N., 2009. Archaeal
intrinsic transcription termination in vivo. J. Bacteriol. 191, 7102e7108.
Sebaihia, M., Wren, B.W., Mullany, P., Fairweather, N.F., Minton, N., Stabler, R.
, Thomson, N.R., Roberts, A.P., Cerdeño-Tárraga, A.M., Wang, H., et al.,
2006. The multidrug resistant human pathogen Clostridium difficile has
a highly mobile mosaic genome. Nat. Genet. 38, 779e786.
Shah, S.A., Hansen, N.R., Garrett, R.A., 2009. Distributions of CRISPR spacer
matches in viruses and plasmids of crenarchaeal acidothermophiles and
implications for their inhibitory mechanism. Biochem. Soc. Trans. 37,
23e28.
She, Q., Phan, H., Garrett, R.A., Albers, S.-V., Stedman, K.M., Zillig, W.,
1998. Genetic profile of pNOB8 from Sulfolobus: the first conjugative
plasmid from an archaeon. Extremophiles 2, 417e425.
She, Q., Singh, R.K., Confalonieri, F., Zivanovic, Y., Gordon, P., Allard, G.,
Awayez, M.J., Chan-Weiher, C.C., Clausen, I.G., Curtis, B.A., et al.,
2001a. The complete genome of the crenarchaeon Sulfolobus solfataricus
P2. Proc. Natl. Acad. Sci. U.S.A. 98, 7835e7840.
She, Q., Peng, X., Zillig, W., Garrett, R.A., 2001b. Gene capture events in
archaeal chromosomes. Nature 409, 478.
Tang, T.-H., Bachellerie, J.-P., Rozhdestvensky, T., Bortolin, M.-L., Huber, H.,
Drungowski, M., Elge, T., Brosius, J., Hüttenhofer, A., 2002. Identification
of 86 candidates for small non-messenger RNAs from the archaeon
Archaeoglobus fulgidus. Proc. Natl. Acad. Sci. U.S.A. 99, 7536e7541.
Tang, T.-H., Polacek, N., Zywicki, M., Huber, H., Brügger, K., Garrett, R.,
Bachellerie, J.P., Hüttenhofer, A., et al., 2005. Identification of novel non-
37

38 S.A. Shah, R.A. Garrett / Research in Microbiology 162 (2011) 27e38
coding RNAs as potential antisense regulators in the archaeon Sulfolobus
solfataricus. Mol. Microbiol. 55, 469e481.
Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving
the sensitivity of progressive multiple sequence alignment through
sequence weighting, position-specific gap penalties and weight matrix
choice. Nucleic Acids Res. 22, 4673e4680.
Torarinsson, E., Klenk, H.P., Garrett, R.A., 2005. Divergent transcriptional and
translational signals in Archaea. Environ. Microbiol. 7, 47e54.
Tyson, G.W., Banfield, J.F., 2007. Rapidly evolving CRISPRs implicated in acquired
resistance of microorganisms to viruses. Environ. Microbiol. 10, 200e208.
Van Embden, J.D.A., Van Gorkom, T., Kremer, K., Jansen, R., Van Der
Zeijst, B.A.M., Schouls, L.M., 2000. Genetic variation and evolutionary
origin of the direct repeat locus of Mycobacterium tuberculosis complex
bacteria. J. Bacteriol. 182, 2393e2401.
Veith, A., Klingl, A., Zolghadr, B., Lauber, K., Mentele, R., Lottspeich, F.,
Rachel, R., Albers, S.V., Kletzin, A., 2009. Acidianus, Sulfolobus and
Metallosphaera surface layers: structure, composition and gene expression.
Mol. Microbiol. 73, 58e72.
Vestergaard, G., Shah, S.A., Bize, A., Reitberger, W., Reuter, M., Phan, H.,
Briegel, A., Rachel, R., Garrett, R.A., Prangishvili, D., 2008. SRV, a new
rudiviral isolate from Stygiolobus and the interplay of crenarchaeal rudiviruses
with the host viral-defence CRISPR system. J. Bacteriol. 190,
6837e6845.
Zhaxybayeva, O., Swithers, K.S., Lapierre, P., Fournier, G.P., Bickhart, D.M.,
DeBoy, R.T., Nelson, K.E., Nesbø, C.L., Doolittle, W.F., Gogarten, J.P.,
Noll, K.M., 2009. On the chimeric nature, thermophilic origin, and phylogenetic
placement of the Thermotogales. Proc. Natl. Acad. Sci. U.S.A. 106,
5865e5870.

JOURNAL OF BACTERIOLOGY, Apr. 2011, p. 1672–1680 Vol. 193, No. 7
0021-9193/11/$12.00 doi:10.1128/JB.01487-10
Copyright © 2011, American Society for Microbiology. All Rights Reserved.
Genome Analyses of Icelandic Strains of Sulfolobus islandicus, Model
Organisms for Genetic and Virus-Host Interaction Studies
Li Guo, 1 † Kim Brügger, 2 † Chao Liu, 2 † Shiraz A. Shah, 2 † Huajun Zheng, 3 Yongqiang Zhu, 3
Shengyue Wang, 3 Reidun K. Lillestøl, 2 Lanming Chen, 2 Jeremy Frank, 2 David Prangishvili, 4
Lars Paulin, 5 Qunxin She, 2 ‡ Li Huang, 1 ‡* and Roger A. Garrett 2 ‡*
State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, No. 1 West Beichen Road,
Chaoyang District, Beijing 100101, China 1 ; Archaea Centre, Department of Biology, Copenhagen University, Ole Maaløes Vej 5,
DK-2200N Copenhagen, Denmark 2 ;ShanghaiMOSTKeyLaboratoryofDiseaseandHealthGenomics,
Chinese National Human Genome Center at Shanghai, Shanghai 201203, China 3 ; Molecular Biology of
the Gene in Extremophiles Unit, Institut Pasteur, rue Dr Roux 25, 75724 Paris Cedex, France 4 ; and
DNA Sequencing and Genomics Laboratory, Institute of Biotechnology, University of
Helsinki, 00790 Helsinki, Finland 5
Received 10 December 2010/Accepted 16 January 2011
The genomes of two Sulfolobus islandicus strains obtained from Icelandic solfataras were sequenced and
analyzed. Strain REY15A is a host for a versatile genetic toolbox. It exhibits a genome of minimal size, is stable
genetically, and is easy to grow and manipulate. Strain HVE10/4 shows a broad host range for exceptional
crenarchaeal viruses and conjugative plasmids and was selected for studying their life cycles and host
interactions. The genomes of strains REY15A and HVE10/4 are 2.5 and 2.7 Mb, respectively, and each genome
carries a variable region of 0.5 to 0.7 Mb where major differences in gene content and gene order occur. These
include gene clusters involved in specific metabolic pathways, multiple copies of VapBC antitoxin-toxin gene
pairs, and in strain HVE10/4, a 50-kb region rich in glycosyl transferase genes. The variable region also
contains most of the insertion sequence (IS) elements and high proportions of the orphan orfB elements and
SMN1 miniature inverted-repeat transposable elements (MITEs), as well as the clustered regular interspaced
short palindromic repeat (CRISPR)-based immune systems, which are complex and diverse in both strains,
consistent with them having been mobilized both intra- and intercellularly. In contrast, the remainder of the
genomes are highly conserved in their protein and RNA gene syntenies, closely resembling those of other S.
islandicus and Sulfolobus solfataricus strains, and they exhibit only minor remnants of a few genetic elements,
mainly conjugative plasmids, which have integrated at a few tRNA genes lacking introns. This provides a
possible rationale for the presence of the introns.
Iceland has been a rich source of hyperthermophilic crenarchaea
over the past 3 decades and especially of acidothermophilic
members of the order Sulfolobales. Many Sulfolobus islandicus
strains (“Island” is German for “Iceland”) have also
yielded many novel viruses showing varied and sometimes
unique morphologies and exceptional genome contents. These
properties are consistent with these viruses constituting an
archaeal lineage distinct from those of bacteria and eukarya,
and they have now been classified into several new viral families
(38, 63). In addition, a family of conjugative plasmids has
been characterized, with most members deriving from Iceland,
which appear to conjugate by a mechanism unique to the
archaeal domain (18, 37).
Although the availability of genome sequences of Sulfolobus
* Corresponding author. Mailing address for R. A. Garrett: Archaea
Centre, Department of Biology, Copenhagen University, Ole Maaløes
Vej 5, DK-2200N Copenhagen, Denmark. Phone: 045-353-22010. Fax:
045-353-22128. E-mail: garrett@bio.ku.dk. Mailing address for L.
Huang: State Key Laboratory of Microbial Resources, Institute of
Microbiology, Chinese Academy of Sciences, No. 1 West Beichen
Road, Chaoyang District, Beijing 100101, China. Phone: 086-10-
64807430. Fax: 086-10-64807429. E-mail: huangl@sun.im.ac.cn.
† These authors contributed equally.
‡ The last three authors are joint senior authors.
Published ahead of print on 28 January 2011.
1672
strains and their genetic elements has yielded important insights
into the biology of these model crenarchaea, a major
impediment to more detailed insights has been the paucity of
robust and versatile vector-host systems for genetic studies. A
few Sulfolobus species have been successfully employed as
hosts for such systems, including Sulfolobus solfataricus strains
P1 and 98/2 (22, 58), Sulfolobus acidocaldarius (57), and S.
islandicus strain REY15A (54). To date, the genetic tools developed
for the latter host are the most versatile and include
the following: (i) Sulfolobus-Escherichia coli shuttle vectors
carrying either viral or plasmid replication origins (50); (ii)
conventional and novel gene knockout methodologies (14, 62),
and (iii) a D-arabinose-inducible expression system with a lacS
reporter gene system (35). The S. islandicus system has also
been employed successfully to demonstrate the dynamic character
of the clustered regular interspaced short palindromic
repeat (CRISPR)-based immune systems of Sulfolobus when
challenged with genetic elements carrying matching viral gene
and protospacers maintained under selection (20). These developments
necessitated the determination of the genome sequence
of S. islandicus strain REY15A as a prerequisite for
successful exploitation of the genetic systems.
A second Icelandic strain, S. islandicus strain HVE10/4, has
been employed as a broad laboratory host for propagating
diverse Sulfolobus viruses and conjugative plasmids (63) and

VOL. 193, 2011 GENOME ANALYSES OF ICELANDIC STRAINS OF S. ISLANDICUS 1673
FIG. 1. (A) Dot plot of the two Icelandic genomes showing the approximate levels of sequence synteny. The large variable regions extend from
about 0.35 to 1.0 Mb. Transposase genes are denoted by black lines along the axes. Putative origins of replication adjacent to the cdc6 and whiP
genes are indicated with red circles, while the families of the CRISPR/Cas (I and III) and Cmr (B) modules are indicated by blue squares. (B) Dot
plot of the S. islandicus REY15A and S. solfataricus P2 genomes.
was selected for in-depth studies of their life cycles and host
interactions. This effort received added impetus with the demonstration
that some genetic elements show exceptional and
sometimes unique properties of their viral life cycles or conjugative
mechanisms (3, 8, 18, 40). Therefore, the genome
sequence of S. islandicus strain HVE10/4 was also determined.
The genome sequences of two Icelandic strains, REY15A
and HVE10/4, were analyzed and compared and contrasted
with one another and with genomes of other S. solfataricus and
S. islandicus strains isolated from different geographical locations,
including Naples, Italy; Kamchatka, Russia; Lassen Volcanic
National Park; and Yellowstone National Park (44, 53).
MATERIALS AND METHODS
Genome sequencing. S. islandicus strains REY15A and HVE10/4 were colony
purified three times and cultured essentially as described earlier (11). Total DNA
was extracted from the cells using phenol-chloroform and further purified by
CsCl density-gradient centrifugation. For strain REY15A, sequencing of shotgun
libraries with a 454 GS FLX sequenator yielded 324,123 reads with 31-fold
genome coverage. For strain HVE10/4, DNA was sonicated to yield fragments in
the size range of 1.5 to 4.0 kb, and clone libraries were generated in pUC18 using
the SmaI site. Sequencing was performed on MegaBace 1000 sequenators to
yield approximately 3-fold sequence coverage, and the sequencing data were
combined with a sequencing run using a 454 FLX sequenator to yield approximately
10- to 15-fold coverage. The genome sequences were assembled using the
phred/phrap/consed package, contigs were linked by combinatorial PCR using
primers matching to each contig end, and the PCR products were sequenced to
close the gaps. Remaining ambiguous sequence regions in the genome were
identified and resolved by generating and sequencing PCR products. Both genomes
were annotated automatically and refined manually.
Sequence analyses. Open reading frames (ORFs) were predicted with Glimmer
(13). Frameshifts were detected and checked by sequencing after manual
annotation, and the remaining frameshifts were considered to be authentic.
Functional assignments of ORFs are based on searches against GenBank (http:
//www.ncbi.nlm.nih.gov/) and the Conserved Domain Database (CDD) (www
.ncbi.nlm.nih.gov/cdd/). tRNA genes were located with tRNAscan-SE (26). Potential
noncoding RNAs were predicted by comparison with the untranslated
RNAs characterized for S. solfataricus and S. acidocaldarius, in terms of sequence
similarity and gene context (see Results). Putative insertion sequence
(IS) elements were identified by BLASTN search against the IS Finder database
(http://www-is.biotoul.fr/). All annotations were manually curated using Artemis
software (47).
RESULTS
Genome general properties. Genomes of the two Icelandic
strains were sequenced using a combination of sequencing
strategies. S. islandicus REY15A was determined primarily by
454 sequencing, while strain HVE10/4 was obtained by a combination
of Sanger and 454 sequencing at approximately 30fold
and 10-fold coverage, respectively. Protein-coding genes
were annotated in Artemis (47), where start codons for single
genes and first genes of Sulfolobus operons were generally
located 25 to 30 bp downstream from the archaeal hexameric
TATA-like box and only genes within operons were preceded
by Shine-Dalgarno motifs, of which GGUG predominates
(56). Where alternative start codons were juxtapositioned, we
selected the most probable on the basis of its position relative
to the putative promoter and/or Shine-Dalgarno motifs or experimental
data from closely related organisms.
Dot plots of the two genomes demonstrate long sections of
gene synteny. One region of about 0.5 to 0.7 Mb exhibits
extensive gene shuffling, and there is a smaller region with a
200-kb inversion bordered by shuffled genes (Fig. 1A). Some of
the minor irregularities in the dot plot were attributable to
insertion or integration events. The synteny is maintained, to a
large degree, when each genome is compared to that of S.
solfataricus P2, despite the occurrence of a large inversion in
the latter, and this is illustrated in a dot plot for the genomes
of strain REY15A and S. solfataricus P2 (Fig. 1B). This extensive
gene synteny is surprising, given the high level of transpositional
activity occurring in S. solfataricus (Table 1) (7, 30, 41).
A similar pattern was also observed when other pairs of S.
islandicus genomes from different geographical locations were

1674 GUO ET AL. J. BACTERIOL.
TABLE 1. Summary of genetic properties obtained from genomes of two Icelandic S. islandicus strains and other available S. solfataricus and S. islandicus strains
Genetic properties obtained from genomes of b :
Characteristic
SsolP2 Ssol98/2 REY15A HVE10/4 LD8.5 LS2.15 M16.4 M16.27 M14.25 YG57.14 YN15.51
Origin Naples, Italy Unknown Reykjanes, Hvergaardi, Lassen, Lassen, Kamchatka, Kamchatka, Kamchatka, Yellowstone, Yellowstone,
Iceland Iceland USA USA Russia Russia Russia USA USA
GenBank accession no. AE006641 CP001402 CP002425 CP002426 CP001731 CP001399 CP001402 CP001401 CP001400 CP001403 CP001404
Genome size (Mb) 3.0 2.7 2.5 2.7 2.7 2.7 2.6 2.7 2.6 2.7 2.8
No. of:
Conserved genes (total, 1,679) 675 656 765 847 837 842 848 823 797 869 840
Unique single genes (total, 1,346) 190 138 118 114 209 100 100 75 49 113 140
Transporters (total, 15) 11 11 13 14 11 11 12 11 14 12 10
VapBC antitoxin-toxins 20 18 16 18 21 24 21 21 21 20 19
Glycosyl transferases (50-kb Absent Absent Absent 15 Absent 15 15 15 15 Absent 15
region)
Conserved noncoding RNAs 123 81 44 42 42 44 39 42 43 42 42
Transposases/IS elements 168 158 75 65 68 60 34 47 45 103 130
MITEs (families) 155 (6) 133 (6) 9 (2) 11 (2) 4 (1) 4 (1) 10 (2) 5 (2) 7 (2) 5 (1) 5 (1)
D, 2 B (B) B 2 B B B 2B, D B B, D B, D 3 B E
I, II (2 I) II (2 I) I I, III I, III (I) I (II) I I, II I, II I I
Cmr family(ies) a
CRISPR/Cas family(ies) a
a Letters and numbers in parentheses for the Cmr and CRISPR/Cas modules families (25, 48) denote the numbers and families of putatively defective modules generally lacking essential genes.
b Lassen, Lassen Volcanic National Park; Yellowstone, Yellowstone National Park.
FIG. 2. Neighbor-joining tree based on a gene content matrix, including
the conserved, core, and unique genes for each available S.
islandicus and S. solfataricus genome (Table 1). The branch lengths
represent the number of differences between the strains in terms of the
presence or absence of individual genes. The data for the tree were
prepared using methods described earlier (44, 48). Only bootstrap
values below 100% for the individual branches are given.
compared (48), consistent with a high level of conservation of
gene synteny for all the S. solfataricus and S. islandicus genomes.
A phylogenetic tree derived from the available genomes
clusters together S. islandicus strains from different geographical
locations (44), with S. solfataricus strains P2 and 98/2 being
more distantly related (Fig. 2 and Table 1). The nucleotide
sequence identity for the concatenated core genes of the two S.
islandicus genomes (Fig. 1A) is 99.6%, and between all the S.
islandicus genomes, it is about 99%. The relatively long
branches for individual strains (Fig. 2) arise mainly from differences
in gene content of the large variable regions (Fig. 1A).
The degree of sequence identity between the concatenated
core genes of the S. islandicus and S. solfataricus genomes is
about 90% (Fig. 2).
Three origins of chromosome replication, demonstrated experimentally
for S. solfataricus and S. acidocaldarius (27, 46),
are well conserved with respect to both the DNA sequence and
flanking gene organization in both of the genomes, albeit with
the origin oriC2 being inverted relative to the genomes of S.
solfataricus P2 and S. islandicus strain YN1551 (Fig. 1B). Origin
oriC1 lies immediately upstream of cdc6-1, oriC2 is close to
cdc6-3, while oriC3 is positioned downstream of the whiP gene
(Fig. 1A). The two cdc6 genes and the whiP gene encode
putative replication initiators (45).
Large variable region. The genomes carry two types of variable
regions. The large region, constituting 20 to 25% of each

VOL. 193, 2011 GENOME ANALYSES OF ICELANDIC STRAINS OF S. ISLANDICUS 1675
tRNA
TABLE 2. Integration events at tRNA genes showing the sizes and origins of the residual integrated genes
Intron
present
genome, extends approximately from positions encompassing
0.3 to 0.8 Mb and 0.3 to 1.0 Mb for strains REY15A and
HVE10/4, respectively (Fig. 1A). The other class is represented
mainly by regions downstream from tRNA genes, where
integration events have occurred (Table 1; also, see below).
The large variable region contains about 60% of the potentially
transposable IS elements and most of the nonautonomous
mobile elements, as well as many degenerate copies of the
former (Fig. 1A). It carries some gene clusters, which are
present in one or more of the Sulfolobus genomes, including
operons and gene cassettes associated with metabolic pathways,
and it contains the diverse CRISPR/Cas and Cmr modules
(Table 1; also, see below). It generally lacks essential
genes; for example, no tRNA genes or replication origins are
present, and thus, it appears to constitute a region where
nonessential genes are collected, interchanged, and exchanged
intercellularly and where genetic innovation occurs.
Integration sites. tRNA gene integration events in Sulfolobus
genomes predominantly involve conjugative plasmids and
fuselloviruses, and these were also the genetic elements most
commonly isolated from acidic hot springs in Iceland (63).
Most integration events occur via an archaea-specific mechanism,
whereby a viral/plasmid integrase gene recombines into a
host tRNA gene and partitions (32). The capture of a genetic
element in a chromosome leaves a trace because the intN
fragment overlapping the tRNA gene is generally maintained,
even if the remainder of the genetic element degenerates or is
deleted (51, 52) (Table 2).
For strains REY15A and HVE10/4, remnants of integrated
elements adjoin eight and five tRNA genes, respectively
(Table 2). Most of the integrated genes derive from conjugative
plasmids, and fuselloviral genes were detected only at
tRNA Thr [GGT] in each strain, with an integrated region of
unknown origin at tRNA Met [CAT] in strain REY15A. All of
the integrated elements are highly degenerate, with IS elements
or miniature inverted-repeat transposable elements (MITEs) inserted
downstream from the tRNA genes (Table 2). Given the
possibility of multiple integrations of genetic elements occurring
at a given tRNA gene, it is difficult to analyze unambiguously the
origins of residual integrated genes (42).
In contrast to the two Icelandic strains, the other S. solfataricus
and S. islandicus genomes carry intact genetic elements
bordered by intN and intC fragments that are all potentially
excisable (44, 52). They each show evidence of 2 to 7 tRNA
gene integration events, in which the most conserved sites are
tRNA Pro [GGG] and tRNA Ala [GGC], with less common events
Integration event a
REY15A HVE10/4
Conserved?
Val—TAC No SiRe1242-1247 conj plasmid No insert No
Phe—GAA No SiRe1321-1323 conj plasmid SiH1399-1402 conj plasmid Yes
Met—CAT Yes SiRe1465-1479, 12 kb IS, pNOB8 integrase, unknown No insert No
Glu—TTC No SiRe1484-1490 conj plasmid SiH1561-1574 conj plasmid Yes
Ala—GGC No intN fragment intN fragment Yes
Thr—GGT No SiRe2413-2417 IS/MITEs SSV SiH2464-24672 SSV Partly
Pro—GGG Yes intN fragment intN fragment Yes
His—GTG No SiRe1787-1792, 7 kb IS No insert No
a SSV, spindle-shaped fusellovirus; conj, conjugative; int, integrase.
at tRNA Leu [GAG] and different alleles of tRNA Arg (Table 2).
For the integrated tRNA genes of the Icelandic strains, there
was no significant correlation between the identity of the
tRNA anticodon and the frequency of codon usage or between
the encoded amino acid and the average number of amino
acids in the genome-encoded proteins.
Anti-integration role for tRNA introns. Each genome carries
45 tRNA genes and 2 to 3 pseudo-tRNA genes all located in
conserved regions. Sixteen of the tRNA genes contain introns
immediately 3 to the anticodon, varying in size from 12 to 65
bp, and in contrast to many archaeal tRNA genes, none were
detected at other sites (29), although putatively degenerate
introns, lacking the capacity to form splicing sites, occur in
D-loop regions of tRNA Glu [CTC] and tRNA Glu [TTC]. Moreover,
the tRNA genes and introns are highly conserved in
sequence between the two genomes, and also with the other six
S. islandicus genomes, with very few base changes occurring
between the introns of a given tRNA. This high level of tRNA
and intron sequence conservation extends to S. solfataricus P2,
with only very minor differences observed for about one-third
of the genes, and it reinforces the concept that the RNA
introns are functionally important (5).
ApossiblefunctionforthetRNAintrons,suggestedby
the above-described analyses, is that they provide protection
against integration of genetic elements into tRNA genes.
Integration can be disadvantageous in that pre-tRNA transcription
can be impaired. Only two intron-carrying tRNA
genes showed evidence of integration events (Table 2). For
the tRNA Met [CAT] gene copies, an intact integrase gene is
located downstream from the tRNA gene, while for the
tRNA Pro [GGG], an overlapping intN fragment is present,
but the overlapping sequence does not extend to the intron,
suggesting that the intron entered after the integration
event. This is consistent with the latter integration event
being the most conserved, and probably the most ancient,
among Sulfolobus species.
IS elements and the versatile orfB element. Each genome
carries a limited range of IS element types, with some in multiple
copies (Table 3). The IS elements are clustered in the
variable genomic region and also downstream from tRNA
genes that have undergone integration events (Fig. 1A). Many
of these elements appear to be intact, carrying the inverted
terminal repeats (ITRs) required for transposition, but exhibit
fragmented transposase genes, which are unlikely to be restored
by programmed translational frameshifting, as was observed
for some bacterial transposases of the IS1 and IS3

1676 GUO ET AL. J. BACTERIOL.
Element Family
TABLE 3. Properties of the IS elements, transposases, and MITEs in the Icelandic genomes a
ORFs
REY15A
copies
families (28). Although some of these elements may be mobilizable
by transposases acting in trans, for over one-third of the
IS families present, there is no encoded transposase (Table 3).
Potentially, the most active elements are ISC1200 and ISC1234
in both genomes and ISC1229 in strain HVE10/4 (Table 3).
The two Icelandic S. islandicus strains, together with those
from Kamchatka, Russia, carry the lowest number of IS elements
(Table 1), many of which are inactive.
orfB elements of family IS605, together with elements of the
IS6 family (Table 3), are considered to represent the few
classes of transposable elements that are ancestral to the archaeal
domain (16). orfB occurs alone, or together with a
transposase gene, orfA, in the IS200/605 family of transposable
elements. They lack ITRs, and both element types occur
commonly in viruses and conjugative plasmids of the Sulfolobales
(18, 40) (Table 3). Exceptionally, strain REY15A and
HVE10/4 genomes carry 11 and 16 nearly identical copies of
the single orfB elements in unconserved genomic positions,
respectively. This is consistent with these being the most active
transposable elements in each genome (Table 3), although it
remains uncertain whether they are autonomous or require an
OrfA in trans for mobility (16). In addition, the orfB elements
are exceptionally adaptable, because a further 8 and 2 copies
are physically coupled to copies of ISC1200 for strains
REY15A and HVE10/4, respectively (Table 3), and are potentially
cotransposable.
Sulfolobus MITEs. Only two MITE types were detected in
multiple copies in each genome, SMN1 (320 bp) and SM3A
(164 bp) (Table 3), and both of which are capable of nonautonomous
transposition in different S. islandicus strains, facilitated
by transposases of ISC1733 and ISC1058, respectively
(2, 4, 43). All SMN1 copies are located immediately downstream
from the sequence TTTAA, but none occur at conserved
positions within the two genomes. Clearly, the SMN1
Intact TPases
in REY15A
No. of:
HVE10/
4 copies
Intact TPases
in HVE10/4
ISC796 IS1 1 5 0 4 1 1
ISC1043 ISL3 1 1 0 1 0 1
ISC1048 IS630 1 10 0 12 0 3
ISC1058 IS5 1 2 0 1 0 1
ISC1078 IS630 1 1 0 1 0 0
ISC1190 IS110 1 3 1 1 0 0
ISC1200 ISH3 1 22 11 7 3 0
ISC1205 ISCNY 2 3 0 4 2 1
ISC1229 IS110 1 4 2 10 9 1
ISC1234 IS5 1 8 6 7 5 1
ISC1332 IS256 2 1 1 1 1 0
ISC1395 IS630 1/2 2 1 0 0 0
ISC1733 IS200/IS605 2 8 8 2 2 1
ISC1921 IS607 2 1 1 0 0 0
ISSis1 (pARN4) IS6 1 4 2 5 4 0
ISSto2 IS6 1 2 1 2 2 0
OrfB IS605 1 19 (8) 18 18 (2) 17 0
SM3A 0 2 0 2 0 2
SMN1 0 7 7 9 9 0
Conserved
genome
positions
a The nomenclature used for IS elements and MITEs follows that which was used previously (2, 6, 16). For the OrfB elements, the numbers in parentheses indicate
the numbers of copies that are physically linked to ISC1200 elements. TPase, transposase.
MITEs are active in both of the genomes, as is ISC1733, which
encodes the mobilizing transposase (Table 3), and they appear
to be cleanly excised when mobilized, in agreement with the
results of an earlier induced excision in the S. islandicus strain
REN1H1 (2). Although most SMN1 copies lie in intergenic
regions, and may or may not affect regulatory signals, some
appear to inactivate or alter genes. Thus, in strain REY15A,
an AAA ATPase (SiRe0883) and a hypothetical gene
(SiRe0925) have incurred insertions in their promoters, and in
strain HVE10/4, SMN1 copies partially overlap with two genes
(SiH0773/2472), generating altered ORF sequences.
In contrast, the two SM3A copies are conserved in position
in each genome, consistent with the mobilizing transposase
encoded in ISC1058 being degenerate in both genomes. Nevertheless,
each SM3A copy retains the conserved 8-bp inverted
terminal repeat of the ISC1058 element (and unconserved
9-bp direct repeats resulting from the transposition event) and
can potentially be mobilized if a transposase-encoding
ISC1058 element enters the cell. Their maintenance as intact
elements may result from one SM3A copy overlapping with the
start of a conserved C/D box RNA gene (3), which may alter its
transcriptional properties, while the other lies between promoters
of two conserved protein genes and may influence their
relative transcriptional levels. SM3A occurs in a few copies in
each of the sequenced S. islandicus genomes, whereas SMN1 is
limited to the Icelandic and three Kamchatka strains, where it
occurs in 1 to 5 copies (Table 1).
Strain-specific metabolic pathways. Each Icelandic strain
shows a few specific metabolic properties. Thus, the REY15/A
strain carries an operon (SiRe0441-0445) encoding enzymes
implicated in nitrate reduction and nitrite extrusion, suggesting
that it can use nitrate as a terminal electron acceptor for
anaerobic respiration. The operon is located in the variable
region and has been observed previously only for two other

VOL. 193, 2011 GENOME ANALYSES OF ICELANDIC STRAINS OF S. ISLANDICUS 1677
archaea, S. islandicus strains M.14.25 and M.16.27. The larger
genome of strain HVE10/4 exclusively carries a urease operon
(SiH0978-0983) predicted to encode enzymes involved in the
hydrolysis of urea to NH 4 and CO 2 and previously found only
in the archaea Sulfolobus tokodaii, Metallosphaera sedula, and
Cenarchaeum symbiosum. Moreover, uniquely for a Sulfolobus
species, strain HVE10/4 also carries several genes predicted to
encode hydrogenases and hydrogenase maturation enzymes
(SiH0883-0892) in the variable region, which suggests that the
strain may be able to grow anaerobically.
A 50-kb region of strain HVE10/4 in the variable region
(SiH0447-0489) is bordered by IS elements and carries 15
predicted glycosyl transferase genes (group 1 and family 2),
constituting about half of the genome copies, interspersed almost
exclusively with genes of unknown function and a gene
encoding a predicted polysaccharide biosynthesis enzyme. It is
well established that Sulfolobus S-layer proteins SlaA and SlaB
(SiRe1612/1 and SiH1691/0, respectively) are heavily glycosylated
(36), but the relatively low GC content of the region
suggests that it has been inserted and has an alternative unknown
function. The genome region is absent from strain
REY15A and from some of the other S. islandicus strains
(Table 1).
Transporters. Sulfolobus strains utilize different sugars and
carbohydrates as carbon and energy sources (19), consistent
with their coding capacity for solute ABC transporters. A total
of 15 different ABC transporters were identified, of which
strain REY15A carries 12 and strain HVE10/4 contains 14. Of
these, 11 ABC transporters are present in S. solfataricus P2
(53), 6 in S. tokodaii (23), but only 3 in S. acidocaldarius (9).
The other S. islandicus genomes each carry 10 to 14 ABC
transporters (44) (Table 1). In both of the Icelandic genomes,
many ABC transporter genes are located in the variable region
(Fig. 1A) and are often flanked by transposons, consistent with
their being subjected to loss or gain events.
The ABC transporters are diverse, and some of their solute
specificities have been identified for other Sulfolobus strains
(15, 24). Cellobiose, maltose, and arabinose transporters are
present in both of the Icelandic genomes and most other sequenced
S. solfataricus and S. islandicus genomes, although a
few S. islandicus strains lack one of the systems, as follows: the
arabinose system is absent from strain YG5714, while the maltose
system is not present in strains YN1551 and LD215. Strikingly,
the transporter of glucose, the preferred carbon source
for many microbes, is present only in the Icelandic strains, S.
islandicus strains M1415 and YG5714, and in S. solfataricus P2.
The lack of specific ABC transporters suggests either that
glucose is an uncommon nutrient in hot environments or that
another ABC transporter can facilitate glucose transport. One
ABC transporter encoded in the variable region of strain
HVE10/4 (SiH0899-0903), flanked by IS elements, appears to
be unique in public sequence databases.
Toxin-antitoxin systems. Four of the eight families of antitoxin-toxin
complexes characterized for free-living bacteria also
occur in archaea, of which the VapBC family is by far the most
abundant (34) and is the main antitoxin-toxin family that we
detected in the Sulfolobus strains. The Icelandic strains REY15A
and HVE10/4 carry 17 and 18 vapBC gene pairs, respectively
(Table 1), as well as 2 vapC-like gene copies coupled to other
genes. They are distributed throughout the genomes, with several
TABLE 4. Summary of Sulfolobus conserved noncoding RNA genes
located in the two Icelandic genomes
RNA Function/modification
No. of indicated RNAs in
genome of strain:
REY15A HVE10/4
C/D box rRNA 18 16
C/D box tRNA 4 4
C/D box Unknown 3 3
H/ACA box tRNA 2 2
Noncoding Unknown 31 27
Total 58 53
located in the variable region, and only five gene pairs are conserved
in sequence and gene contexts in both strains (SiRe0698/
SiH0636, SiRe2073/SiH2137, SiRe2171/SiH2227, SiRe2294/
SiH2344, and SiRe2626/SiH2689). Sequence alignments and treebuilding
exercises demonstrated that the sequences of both
antitoxins and toxins within each genome are very diverse and can
be classified into subtypes (data not shown), consistent with their
functional diversity and targeting of different cellular sites. These
data also indicate, for given gene pairs, that the subtypes of VapB
and VapC do not always correspond, implying that some gene
pairs may have exchanged partners.
Reading frame shifts and mRNA intron splicing. Examples
of translational reading frame shifts yielding single polypeptides
have been demonstrated experimentally for S. solfataricus
P2 (10). For two of these, a predicted transketolase
(SiRe1696/8 and SiH1776/8) and a putative O-sialoglycoprotein
endopeptidase (SiRe1569/70 and SiH1648/9), the S. islandicus
genes overlap in a similar way and are likely to undergo
reading frame shifts. In contrast to S. solfataricus P2, -fucosidase
(SiRe2185 and SiH2241) is a single gene, as is the
predicted dihydrolipoamide acyltransferase gene (SiH0582),
located only in strain HVE10/4. Very few transposase genes
present in IS elements (Table 3) carry a single reading frame
shift that could be expressed as a single protein via translational
reading frame shifts (28).
Transcripts of the intron-carrying cbf5 genes (SiRe1607/8
and SiH1686/7) have been demonstrated to be spliced by the
archaeal splicing enzyme at the mRNA level in some crenarchaea
(60). Other mRNAs, including those encoding the XPD
helicase (SiRe1685/SiH1765), have been predicted to undergo
splicing, but experimental support is lacking (5).
Noncoding RNAs. Many untranslated RNAs have been
characterized for S. solfataricus and S. acidocaldarius using a
variety of techniques, including probing cell extracts for RNA
with K-turn binding motifs and generating cDNA libraries of
total cellular RNA extracts, as well as numerous antisense
RNAs (33, 55, 59, 61). Most of these RNAs were characterized
for nucleotide length and partial sequence, and several were
detected by more than one experimental approach. We have
reanalyzed all these different RNA entities and have annotated
the S. islandicus RNA homologs which are conserved in both
sequence and gene contexts. The total number of RNA genes
and their putative functions are given (Table 4).
As for other archaeal hyperthermophiles, each genome carries
many C/D box RNAs that methylate primarily rRNAs and
tRNAs (Table 4). In strains REY15A and HVE10/4, 18 and 16

1678 GUO ET AL. J. BACTERIOL.
FIG. 3. (A) Phylogenetic tree of Cmr2 and its homologues in all sequenced archaeal genomes generates 5 families, A to E. The two Icelandic strains
carry family B Cmr modules, for which the gene order is shown. Other sequenced S. islandicus and S. solfataricus strains also carry Cmr modules of family
Band,lessfrequently,familiesDorE,asindicatedonthetree.(B)SchematicrepresentationsoftheCRISPR/CascassettesinthetwoIcelandicstrains,
together with the contents of their CRISPR loci. Strain REY15A carries a single family I CRISPR/Cas cassette (blue), whereas HVE10/4 carries cassettes
from families III and I (orange and blue, respectively). Compositions of the individual CRISPR loci are shown, where each triangle represents a
spacer-repeat unit. Significant spacer matches to sequenced viruses and plasmids are color coded (red, rudiviruses; orange, lipothrixviruses; yellow,
fuselloviruses; green, bicaudaviruses; turquoise, turreted icosahedral viruses; blue, conjugative plasmids; and violet, cryptic plasmids).
C/D box RNAs target rRNAs, respectively, while 4 modify
tRNAs and a further 3 have unknown targets. Two copies of
H/ACA RNA genes are present in each genome which, together
with the aPus7 protein (SiRe1836 and SiH1908), generate pseudouridine-35
in pre-tRNA Tyr transcripts (31). Each of these C/D
box and H/ACA box RNA genes can be detected in the other
available S. islandicus genomes, which underlines their functional
importance. Of these, only three RNA genes characterized for
other Sulfolobus strains, Sso-sR4, Sso-sR8, and Sso-92, were not
located in any S. islandicus genomes (33, 55). For the numerous
noncoding RNAs of unknown function, similar contents were
found for the two Icelandic strains (Table 4) and for the other S.
islandicus strains, with only a few variations (Table 1), thereby
underlining their functional importance.
Diversity of the CRISPR-based immune systems. The
CRISPR/Cas and Cmr modules all lie within the large variable
regions. They show marked heterogeneity in the number and
family (25, 48) and are unconserved in position between the
genomes (Fig. 1A). Whereas REY15A carries one paired
CRISPR/Cas module of the family I type and two family B
Cmr modules, HVE10/4 contains two paired CRISPR/Cas
modules of family I and III types and a single family B Cmr
module (48) (Fig. 3A and B). This diversity of CRISPR-based
systems also extends to the other S. solfataricus and S. islandicus
genomes (Table 1). Although the gene content and organization
of the paired family I CRISPR/Cas modules are quite
conserved among crenarchaea (48), exceptionally, for strain
HVE10/4, the internal group of cas genes located between the
two leader regions is inverted (Fig. 3B), indicative of a rearrangement
having occurred within the module, possibly via the
identical inverted repeat sequences of the bordering leader
regions (Fig. 3B).
The CRISPR loci of strain REY15A carry 115 and 93 spacerrepeat
units centered at position 733,000, while those of
HVE10/4 contain 116 and 101 repeat-spacer units and 35 and
14 repeat-spacer units centered at positions 364000 and
745000, respectively (Fig. 1A). No spacer sequence identity
was detected within, or between, the two Icelandic strains or
with the other S. solfataricus and S. islandicus genomes. None
of the available fully sequenced S. islandicus genomes (Table
1) have any spacers in common, in contrast to the S. solfataricus
strains P1, P2, and 98/2, which all share many identical
spacers (17, 25) despite their being as distant from one another,
phylogenetically, as the S. islandicus strains (Fig. 2).
Thus, it seems that diversification of genomic CRISPR loci can
occur either by simple spacer turnover or by horizontal transfer
of whole or partial CRISPR/cas cassettes. There is increasing
evidence for the latter mechanism being the most common one
in S. islandicus strains (17, 21).
Since many of the characterized viruses and plasmids of Sulfolobus
derive from Iceland, we analyzed the degree to which
CRISPR spacer sequences of the Icelandic strains yielded significant
matches to genetic element sequences using an earlier approach
examining nucleotide and translated sequences of the
spacers (25, 49). Several significant sequence matches were detected
for both of the genomes, primarily to rudiviruses, fuselloviruses,
and conjugative plasmids, all of which are abundant in
Icelandic hot springs (63), but also were detected in smaller numbers
to other viruses and cryptic plasmids (Fig. 3B).
DISCUSSION
The genome analyses underline the potential importance of
S. islandicus strain REY15A as a model organism for molec-

VOL. 193, 2011 GENOME ANALYSES OF ICELANDIC STRAINS OF S. ISLANDICUS 1679
ular genetic studies of the Sulfolobales, and crenarchaea in
general, for a variety of reasons. The genome size of 2.5 Mb is
minimal for a Sulfolobus species; moreover, the incidence of
mobile elements is relatively low (Table 1), and stable deletion
mutants can be readily isolated (14, 20). Furthermore, the high
incidence of diverse ABC transporter systems (Table 1) may
explain why S. islandicus (and S. solfataricus) is most commonly
isolated from enrichment cultures obtained from terrestrial
acidic hot springs, which is in contrast to, for example, S.
acidocaldarius, which carries only three ABC transporters (9,
44, 63).
The relatively high incidence of deletion mutants obtained
from strain REY15A occurs despite the presence of several
transposable elements. However, in both of the Icelandic
strains, many of the IS elements are degenerate or carry disrupted
transposase genes (Table 3), consistent with the “copyand-paste”
transpositional mechanism of most classes of Sulfolobus
IS elements and their undetectably low reversibility
rate (4, 41). The inability to remove the elements by spontaneous
deletion, which does occur in many bacteria (16), may
also explain the presence of antisense RNAs in Sulfolobus
species to regulate transposase activity (55). The Icelandic
strains do, however, carry many copies of orphan orfB elements
and SMN1 MITEs, which are mobilized by a “cutand-paste”
mechanism presumably through OrfA encoded
in IS element ISC1733 (2, 16). The SMN1 MITEs appear to
be specific to the Icelandic and Kamchatka strains (Table 1),
and they can generate genetic novelty, reversibly, by extending
open reading frames, in contrast to the other Sulfolobus
MITEs, which carry many potential stop codons in all reading
frames (43). The absence of most of the known Sulfolobus
MITEs, except SM3A, probably reflects the much lower
diversity of the mobilizing transposases present (Table 3).
Many of these elements are located in the large variable
region where genetic diversification occurs, including the
uptake and loss of operons and gene cassettes and rearrangements
of mainly nonessential genes. A similar variable
genetic region in many genetic elements of Sulfolobus has
also been observed (e.g., see reference 18).
Many questions concerning the exceptional molecular and
cellular properties of crenarchaeal organisms remain to be
resolved. They include the functions of the multiple and highly
diverse gene pairs encoding VapBC antitoxin-toxins. For hyperthermophilic
Sulfolobus species, in particular, their presence
and variety could be a prerequisite for adaptation to life
under extreme, and sometimes rapidly varying, temperature
and pH conditions, as well as to survival in nutrient-poor environments
possibly by optimizing the quality control of gene
expression (12, 34). They may also be related to the sulfolobicins
implicated in killing competitor Sulfolobus cells (39).
The crystal structure of a VapC toxin from the crenarchaeal
hyperthermophile Pyrobaculum aerophilum implicated the protein
in exonuclease activity (1), but the multiplicity and wide
sequence diversity of the vapBC genes suggest that the toxins
target different cellular or molecular sites.
Strain HVE10/4 has been used as a host for a variety of
genetic elements, mainly from Iceland, which were likely to be
genetically close to the Icelandic host (63). The genome analyses
provide few insights into why it is a good host, especially
since it appears to carry a type 1 restriction-modification sys-
tem (SiH1435 to SiH1437). Moreover, the CRISPR/Cas and
CRISPR/Cmr modules of strain HVE10/4 are relatively complex,
as they also are for strain REY15A and other Sulfolobus
strains. Their activities have also been demonstrated, at least
for strain REY15A, by challenging the CRISPR/Cas systems
with vector-borne matching protospacers maintained under
selection, which produced deletions of the matching spacers
(20). The puzzle remains as to why the Sulfolobus CRISPRbased
systems are so complex, given that many of the viruses
and plasmids coexist at low copy numbers and are nonlytic.
One possibility is that the CRISPR/Cmr system primarily has a
regulatory role, with antisense crRNAs (CRISPR RNAs) targeting
viral mRNAs. Whatever the reason, the genetic closeness
of strains REY15A and HVE10/4 suggests that the former
may also be a broad host for viruses and plasmids, with the
added advantage that genetic manipulation systems are now
available, and our preliminary studies with fuselloviruses and
conjugative plasmids support this supposition.
ACKNOWLEDGMENTS
This research was supported by grants from the National Natural
Science Foundation of China (grants 306210165, 30730003, and
30870058) to L.H., a grant from the Danish Research Council for
Technology and Production (grant 09-062932) to Q.S., and grants from
the Danish Natural Science Research Council (grant 272-08-0391) and
Danish National Research Foundation to R.A.G.
REFERENCES
1. Arcus, V. L., K. Bäckbro, A. Roost, E. L. Daniel, and E. N. Baker. 2004.
Distant structural homology leads to the functional characterisation of an
archaeal PIN domain as an exonuclease. J. Biol. Chem. 279:16471–16478.
2. Berkner, S., and G. Lipps. 2007. An active nonautonomous mobile element
in Sulfolobus islandicus REN1H1. J. Bacteriol. 189:2145–2149.
3. Bize, A., et al. 2009. A unique virus release mechanism in archaea. Proc. Natl.
Acad. Sci. U. S. A. 106:11306–11311.
4. Blount, Z. D., and D. W. Grogan. 2005. New insertion sequences of Sulfolobus:
functional properties and implications for genome evolution in hyperthermophilic
archaea. Mol. Microbiol. 55:312–325.
5. Brügger, K., X. Peng, and R. A. Garrett. 2007. Sulfolobus genomes: mechanisms
of rearrangement and charge, p. 95–104. In R. A. Garrett and H.-P.
Klenk (ed.), Archaea: evolution, physiology, and molecular biology. Blackwell
Publishing, Oxford, United Kingdom.
6. Brügger, K., et al. 2002. Mobile elements in archaeal genomes. FEMS
Microbiol. Lett. 206:131–141.
7. Brügger, K., E. Torarinsson, P. Redder, L. Chen, and R. A. Garrett. 2004.
Shuffling of Sulfolobus genomes by autonomous and non-autonomous mobile
elements. Biochem. Soc. Trans. 32:179–183.
8. Brumfield, S. K., et al. 2009. Particle assembly and ultrastructural features
associated with the replication of the lytic archaeal virus Sulfolobus turreted
icosahedral virus. J. Virol. 83:5964–5970.
9. Chen, L., et al. 2005. The genome of Sulfolobus acidocaldarius, a model
organism of the Crenarchaeota. J. Bacteriol. 187:4992–4999.
10. Cobucci-Ponzano, B., et al. 2010. Functional characterisation and highthroughput
proteomic analysis of interrupted genes in the archaeon Sulfolobus
solfataricus. J. Proteome Res. 9:2496–2507.
11. Contursi, P., et al. 2006. Characterisation of the Sulfolobus host-SSV2 virus
interaction. Extremophiles 10:615–627.
12. Cooper, C. R., A. J. Daugherty, S. Tachdjian, P. H. Blum, and R. M. Kelly.
2009. Role of vapBC toxin-antitoxin loci in the thermal stress response of
Sulfolobus solfataricus. Biochem. Soc. Trans. 37:123–126.
13. Delcher, A. L., K. A. Bratke, E. C. Powers, and S. L. Salzberg. 2007. Identifying
bacterial genes and endosymbiont DNA with Glimmer. Bioinformatics
23:673–679.
14. Deng, L., H. Zhu, Z. Chen, Y. X. Liang, and Q. She. 2009. Unmarked gene
deletion and host-vector system for the hyperthermophilic crenarchaeon
Sulfolobus islandicus. Extremophiles 13:735–746.
15. Elferink, M. G., S. V. Albers, W. N. Konings, and A. J. Driessen. 2001. Sugar
transport in Sulfolobus solfataricus is mediated by two families of binding
protein-dependent ABC transporters. Mol. Microbiol. 39:1494–1503.
16. Filée, J., P. Siguier, and M. Chandler. 2007. Insertion sequence diversity in
archaea. Microbiol. Mol. Biol. Rev. 71:121–157.
17. Garrett, R. A., et al. 2011. CRISPR-based immune systems of the Sulfolobales:
complexity and diversity. Biochem. Soc. Trans. 39:51–57.

1680 GUO ET AL. J. BACTERIOL.
18. Greve, B., S. Jensen, K. Brügger, W. Zillig, and R. A. Garrett. 2004. Genomic
comparison of archaeal conjugative plasmids from Sulfolobus. Archaea
1:231–239.
19. Grogan, D. W. 1989. Phenotypic characterization of the archaebacterial
genus Sulfolobus: comparison of five wild-type strains. J. Bacteriol. 171:6710–
6719.
20. Gudbergsdottir, S., et al. 2011. Dynamic properties of the Sulfolobus
CRISPR/Cas and CRISPR/Cmr systems when challenged with vector-borne
viral and plasmid genes and protospacers. Mol. Microbiol. 79:35–49.
21. Held, N. L., A. Herrera, H. Cadillo-Quiroz, and R. J. Whitaker. 2010.
CRISPR associated diversity within a population of Sulfolobus islandicus.
PLoS One 5:e12988.
22. Jonuscheit, M., E. Martusewitsch, K. M. Stedman, and C. Schleper. 2003. A
reporter gene system for the hyperthermophilic archaeon Sulfolobus solfataricus
based on a selectable and integrative shuttle vector. Mol. Microbiol.
48:1241–1252.
23. Kawarabayasi, Y., et al. 2001. Complete genome sequence of an aerobic
thermoacidophilic crenarchaeon, Sulfolobus tokodaii strain 7. DNA Res.
8:123–140.
24. Koning, S. M., S. V. Albers, W. N. Konings, and A. J. Driessen. 2002. Sugar
transport in (hyper)thermophilic archaea. Res. Microbiol. 153:61–67.
25. Lillestøl, R. K., et al. 2009. CRISPR families of the crenarchaeal genus
Sulfolobus: bidirectional transcription and dynamic properties. Mol. Microbiol.
72:259–272.
26. Lowe, T. M., and S. R. Eddy. 1997. tRNAscan-SE: a program for improved
detection of transfer RNA genes in genomic sequence. Nucleic Acids Res.
25:955–964.
27. Lundgren, M., A. Andersson, L. Chen, P. Nilsson, and R. Bernander. 2004.
Three replication origins in Sulfolobus species: synchronous initiation of
chromosome replication and asynchronous termination. Proc. Natl. Acad.
Sci. U. S. A. 101:7046–7051.
28. Mahillon, J., and M. Chandler. 1998. Insertion sequences. Microbiol. Mol.
Biol. Rev. 62:725–774.
29. Marck, C., and H. Grosjean. 2003. Identification of BHB splicing motifs in
iintron-containing tRNAs from 18 archaea: evolutionary implications. RNA
9:1516–1531.
30. Martusewitsch, E., C. W. Sensen, and C. Schleper. 2000. High spontaneous
mutation rate in the hyperthermophilic archaeon Sulfolobus solfataricus is
mediated by transposable elements. J. Bacteriol. 182:2574–2581.
31. Muller, S., et al. 2009. Deficiency of the tRNA Tyr :35-synthase aPus7 in
Archaea of the Sulfolobales order might be rescued by the H/ACA sRNAguided
machinery. Nucleic Acids Res. 37:1308–1322.
32. Muskhelishvili, G., P. Palm, and W. Zillig. 1993. SSV1-encoded site-specific
recombination system in Sulfolobus shibatae. Mol. Gen. Genet. 273:334–342.
33. Omer, A. D., M. Zago, A. Chang, and P. P. Dennis. 2006. Probing the
structure and function of an archaeal C/D-box methylation guide sRNA.
RNA 12:1708–1720.
34. Pandey, D. P., and K. Gerdes. 2005. Toxin-antitoxin loci are highly abundant
in free-living but lost from host-associated prokaryotes. Nucleic Acids Res.
33:966–976.
35. Peng, N., Q. Xia, Z. Chen, Y. X. Liang, and Q. She. 2009. An upstream
activation element exerting differential transcription activation on an
archaeal promoter. Mol. Microbiol. 74:928–939.
36. Peyfoon, E., et al. 2010. The S-layer glycoprotein of the crenarchaeote Sulfolobus
acidocaldarius is glycosylated at multiple sites with chitobiose-linked
N-glycans. Archaea pii:754101.
37. Prangishvili, D., et al. 1998. Conjugation in archaea: frequent occurrence of
conjugative plasmids in Sulfolobus. Plasmid 40:190–202.
38. Prangishvili, D., P. P. Forterre, and R. A. Garrett. 2006. Viruses of the
Archaea: a unifying view. Nat. Rev. Microbiol. 4:837–848.
39. Prangishvili, D., et al. 2000. Sulfolobicins, specific proteinaceous toxins produced
by strains of the extremely thermophilic archaeal genus Sulfolobus. J.
Bacteriol. 182:2985–2988.
40. Prangishvili, D., et al. 2006. Structural and genomic properties of the hyperthermophilic
archaeal virus ATV with an extracellular stage of the reproductive
cycle. J. Mol. Biol. 359:1203–1216.
41. Redder, P., and R. A. Garrett. 2006. Mutations and rearrangements in the
genome of Sulfolobus solfataricus P2. J. Bacteriol. 188:4198–4206.
42. Redder, P., et al. 2009. Four newly isolated fuselloviruses from extreme
geothermal environments reveal unusual morphologies and a possible interviral
recombination mechanism. Environ. Microbiol. 11:2849–2862.
43. Redder, P., Q. She, and R. A. Garrett. 2001. Non-autonomous elements in
the crenarchaeon Sulfolobus solfataricus. J. Mol. Biol. 306:1–6.
44. Reno, M. L., N. L. Held, C. J. Fields, P. V. Burke, and R. J. Whitaker. 2009.
Sulfolobus islandicus pan-genome. Proc. Natl. Acad. Sci. U. S. A. 106:8605–
8610. (Erratum, 106:18873.)
45. Robinson, N. P., and S. D. Bell. 2007. Extrachromosomal element capture
and the evolution of multiple replication origins in archaeal chromosomes.
Proc. Natl. Acad. Sci. U. S. A. 104:5806–5811.
46. Robinson, N. P., et al. 2004. Identification of two origins of replication in the
single chromosome of the archaeon Sulfolobus solfataricus. Cell 116:25–38.
47. Rutherford, K., et al. 2000. Artemis: sequence visualization and annotation.
Bioinformatics 16:944–945.
48. Shah, S. A., and R. A. Garrett. 2011. CRISPR/Cas and Cmr modules,
mobility and evolution of adaptive immune systems. Res. Microbiol. 162:
27–38.
49. Shah, S. A., N. R. Hansen, and R. A. Garrett. 2009. Distributions of CRISPR
spacer matches in viruses and plasmids of crenarchaeal acidothermophiles
and implications for their inhibitory mechanism. Trans. Biochem. Soc. 37:
23–28.
50. She, Q., et al. 2008. Host-vector systems for hyperthermophilic archaeon
Sulfolobus, p. 151–156. In S.-J. Liu and H. L. Drake (ed.), Microbes and the
environment: perspective and challenges. Science Press, Beijing, China.
51. She, Q., X. Peng, W. Zillig, and R. A. Garrett. 2001. Gene capture in archaeal
chromosomes. Nature 409:478.
52. She, Q., B. Shen, and L. Chen. 2004. Archaeal integrases and mechanisms of
gene capture. Biochem. Soc. Trans. 22:222–226.
53. She, Q., et al. 2001. The complete genome of the crenarchaeon Sulfolobus
solfataricus P2. Proc. Natl. Acad. Sci. U. S. A. 98:7835–7840.
54. She, Q., et al. 2009. Genetic analyses in the hyperthermophilic archaeon
Sulfolobus islandicus. Biochem. Soc. Trans. 37:92–96.
55. Tang, T.-H., et al. 2005. Identification of novel non-coding RNAs as potential
antisense regulators in the archaeon Sulfolobus solfataricus. Mol. Microbiol.
55:469–481.
56. Torarinsson, E., H.-P. Klenk, and R. A. Garrett. 2005. Divergent transcriptional
and translational signals in Archaea. Environ. Microbiol. 7:47–54.
57. Wagner, M., et al. 2009. Expanding and understanding the genetic toolbox of
the hyperthermophilic genus Sulfolobus. Biochem. Soc. Trans. 37:97–101.
58. Worthington, P., V. Hoang, F. Perez-Pomares, and P. Blum. 2003. Targeted
disruption of the alpha-amylase gene in the hyperthermophilic archaeon
Sulfolobus solfataricus. J. Bacteriol. 185:482–488.
59. Wurtzel, O., et al. 2010. A single-base resolution map of an archaeal transcriptome.
Genome Res. 20:133–141.
60. Yokobori, S., et al. 2009. Gain and loss of an intron in a protein-coding gene
in Archaea: the case of an archaeal RNA pseudouridine synthase gene. BMC
Evol. Biol. 9:198.
61. Zago, M. A., P. P. Dennis, and A. D. Omer. 2005. The expanding world of
small RNAs in the hyperthermophilic archaeon Sulfolobus solfataricus. Mol.
Microbiol. 55:1812–1828.
62. Zhang, C., et al. 2010. Revealing the essentiality of multiple archaeal pcna
genes using a mutant propagation assay based on an improved knockout
method. Microbiology 156:3386–3397.
63. Zillig, W., et al. 1998. Genetic elements in the extremely thermophilic
archaeon Sulfolobus. Extremophiles2:131–140.

Biochemical Society Transactions www.biochemsoctrans.org
CRISPR-based immune systems of the
Sulfolobales: complexity and diversity
Roger A. Garrett 1 ,ShirazA.Shah,GisleVestergaard,LingDeng,SoleyGudbergsdottir,ChandraS.Kenchappa,
Susanne Erdmann and Qunxin She
Archaea Centre, Department of Biology, University of Copenhagen, Ole Maaløes Vej 5, 2200N Copenhagen K, Denmark
Abstract
CRISPR (cluster of regularly interspaced palindromic repeats)/Cas and CRISPR/Cmr systems of Sulfolobus,
targeting DNA and RNA respectively of invading viruses or plasmids are complex and diverse. We address
their classification and functional diversity, and the wide sequence diversity of RAMP (repeat-associated
mysterious protein)-motif containing proteins encoded in Cmr modules. Factors influencing maintenance
of partially impaired CRISPR-based systems are discussed. The capacity for whole CRISPR transcripts to be
generated despite the uptake of transcription signals within spacer sequences is considered. Targeting of
protospacer regions of invading elements by Cas protein–crRNA (CRISPR RNA) complexes exhibit relatively
low sequence stringency, but the integrity of protospacer-associated motifs appears to be important.
Different mechanisms for circumventing or inactivating the immune systems are presented.
Introduction
The discovery of the widespread occurrence of CRISPR
(cluster of regularly interspaced palindromic repeat)-based
immune systems in archaea and bacteria has provided
important insights into how hosts can inactivate and
or regulate invading foreign DNA and, probably, RNA
genetic elements. In addition, these systems are likely to
influence how co-invading genetic elements can influence one
another [1,2]. The two main molecular apparatus involved
are structurally complex, partially independent and have
diversified functionally. Moreover, their capacity to facilitate
the continual uptake of foreign DNA into host chromosomes,
and their propensity for transfer between organisms, has
important implications for cellular evolution.
The genus Sulfolobus provides an important model system
for studying these immune systems. Most Sulfolobus species
carry complex and diverse CRISPR-based systems and appear
to be particularly active in the uptake of foreign DNA inserts
into their CRISPR loci. Furthermore, a broad collection
of Sulfolobus genetic elements is available that can be used
to challenge the CRISPR-based systems [3]. It includes
numerous diverse viruses many of which have been classified
into eight new viral families [4,5] as well as a family of
plasmids encoding an archaeal-specific conjugative apparatus
[6,7].
Many insights into the complexity of the CRISPRbased
immune systems, and their mechanistic diversity,
have emerged from detailed experimental studies of CR-
ISPR/Cas and CRISPR/Cmr systems of the archaeal genera
Key words: archaeal virus, cluster of regularly interspaced palindromic repeats/Cas module
(CRISPR/Cas module), Cmr module, CRISPR RNA (crRNA), protospacer-associated motif (PAM).
Abbreviations used: CRISPR, cluster of regularly interspaced palindromic repeats; crRNA,
CRISPR RNA; IS, insertion sequence; PAM, protospacer-associated motif; RAMP, repeat-associated
mysterious protein; SIRV1, Sulfolobus islandicus rod-shaped virus 1.
1 To whom correspondence should be addressed (email garrett@bio.ku.dk).
Biochem. Soc. Trans. (2011) 39, 51–57; doi:10.1042/BST0390051
Molecular Biology of Archaea II 51
Sulfolobus and Pyrococcus respectively, and from investigation
of bacterial CRISPR/Cas systems of Streptococcus
thermophilus [8,9], Staphylococcus epidermidis [10,11] and
Escherichia coli [12]. In the present article, we focus primarily
on current knowledge and ideas deriving from, and relating
to, the Sulfolobus immune systems.
CRISPR/Cas families: complexity,
classification and versatility
At an early stage, it was clear that the CRISPR/Cas and
Cmr systems were highly complex when approx. 45 different
proteins were implicated in their function [13], and the
number has continued to rise [14]. Genes of the two systems
are clustered into cas and cmr cassettes which are sometimes
linked physically. These cassettes encode a few core proteins,
but they also carry different combinations of other genes,
some occurring more commonly than others. Thus cassettes
vary markedly in their overall gene contents. To illustrate this,
core gene structures of the archaeal cas cassettes are shown
together with a more complex family I cas cassette from
Sulfolobus islandicus HVE10/4 (Figures 1A and 1B). The core
cas genes classify into cas group 1, implicated in CRISPR
acquisition of foreign DNA and insertion into CRISPR loci,
and cas group 2 associated with crRNA (CRISPR RNA)
processing and guidance (Figure 1A).
Families of CRISPR/Cas modules have been classified
on the basis of gene content and gene order within cas
cassettes, and on the basis of conserved sequences of cas genes,
leader regions and repeats within CRISPR/Cas modules. For
archaea, about eight families have been proposed, whereas
among the Sulfolobales, three are common (I–III) and one
less so (IV) [2,15,16,17].
Cmr modules carry two conserved core genes, cmr2
and cmr5 (Figure 2A), and a variable number of genes
C○The Authors Journal compilation C○2011 Biochemical Society

52 Biochemical Society Transactions (2011) Volume 39, part 1
Figure 1 Core genes of archaeal cas cassettes
(A) Core genes are divided into putative functional cas groups 1 and 2 (see the text) and the cas6 gene, which encodes
an RNA-processing enzyme [18]. (B) Genetic map of a family I CRISPR/Cas module of S. islandicus strain HVE10/4 carrying
several non-core cas genes.
encoding diverse proteins which carry RAMP (repeatassociated
mysterious protein) motifs. The Cmr modules
can be classified into five main families A, B, C, D and E
for archaea on the basis of phylogenetic tree building using
sequences of Cmr2 and its homologues Csm1 and Csx11
(Figure 2B), where most Sulfolobus Cmr modules fall within
families B or D. Further classification is complicated by
the presence of multiple diverse copies of genes coding for
RAMP-motif-containing proteins. Although these proteins
can be classified into families on the basis of these motifs,
the remainder of the protein sequences tend to be highly
divergent, as illustrated for four proteins encoded in a Cmr
family B module of Sulfolobus solfataricus P2 (Figure 2C).
Most Sulfolobus species carry multiple CRISPR/Cas
and/or Cmr modules and, given the high energy cost of
maintaining and expressing them, they must confer major
advantages on to the cell. Clearly, given the molecular
and mechanistic complexities of the systems, they can be
inactivated readily by incurring a defect in a component or
critical sequence motif. Moreover, the systems are potential
targets for incoming genetic elements which may attempt
to integrate into essential cas or cmr genes as has been
observed for a viral integration in a csa3 gene of S. islandicus
strain M.16.4 (see below) or modify their protein products
or otherwise interfere with transcription or maturation of
crRNAs. Therefore multiple systems will provide added security
against unwanted invasion. The pairing of many family
I CRISPR/Cas modules may reflect a compromise between
providing added security and generating more compact and
efficient systems which can potentially be mobilized and
transferred between organisms as single units [2].
A further advantage may arise from the presence
of different families of CRISPR/Cas modules which is
commonly observed for Sulfolobus (e.g. S. solfataricus carries
family I and II modules, whereas Sulfolobus acidocaldarius
carries those of family II and III) [16]. Their presence may
increase versatility in both the uptake of spacers and targeting
of protospacers with different PAMs (protospacer-associated
motifs).
The presence of multiple Cmr modules is also likely to
confer functional versatility, although they are subject to the
constraint that some encoded proteins must be able to
recognize part of the repeat sequence of the co-inhabiting
CRISPR/Cas module [18,19]. Cmr modules are sometimes
linked directly to CRISPR/Cas modules on chromosomes
C○The Authors Journal compilation C○2011 Biochemical Society
and, given their functional interdependence, there is likely
to have been some co-evolution of the coupled systems.
Consistent with this view, analysis of the Sulfolobales
suggests that Cmr family D modules (Figure 2B) are
commonly, but not exclusively, found together with family
II CRISPR/Cas modules.
CRISPR loci: structural and functional
complexity
CRISPR loci consist of regularly spaced direct repeat
sequences with intervening spacers deriving from invading
foreign DNA elements. Archaeal repeats fall in the size
range 23–37 bp and most spacers are 25–50 bp long [20].
CRISPR loci are preceded by a leader region which varies
in size from approx. 150 to 550 bp and shows levels of
sequence conservation which are only considered significant
within specific families of CRISPR/Cas modules. CRISPR
locus sizes can also vary considerably, suggesting that rates
of spacer turnover differ markedly for different CRISPR
loci within a given archaeon. But there is no support for
differences occurring between the CRISPR/Cas families of
the Sulfolobales, since large and small clusters exist for the
most common families I, II and III.
In organisms carrying several CRISPR/Cas modules,
including S. solfataricus strains P1 and P2 with six, and S.
acidocaldarius with five, they may not all be fully functional.
The CRISPR/Cas system exhibits two partially independent
functions with one group of Cas proteins responsible for
uptake of invader DNA into CRISPR loci and the other
for generating crRNAs and guiding them to the invading
genetic element (Figure 1). Only the latter proteins are
essential for the CRISPR/Cas system to function. Thus nonextending
CRISPR loci may still be useful to cells as long
crRNAs are generated. S. acidocaldarius carries two large
loci and three smaller ones of 11, five and two spacerrepeat
units. All five clusters were transcribed and processed
to mature crRNAs [16], but possibly the spacer addition
functions are defective for the small clusters. Similarly, for
S. solfataricus P1 and P2, of the six CRISPR loci, only four
appear to be active in elongation. Of the other two, the
smallest (locus E) carries six spacer-repeat units with a leader
and no cas genes [16] and does not appear to be transcribed
[21]. It carries spacers matching rudiviruses and a conjugative
plasmid and is conserved in three S. solfataricus strains (two

Figure 2 Classification of archaeal Cmr modules
(A) Gene map of an archaeal Cmr module showing the conserved core proteins Cmr2 and Cmr5, and the grey boxes represent
genes encoding different proteins which carry RAMP motifs. (B) Phylogenetic tree for archaeal Cmr modules based on the
Cmr2 protein sequence showing five main families: A, B, C, D and E. The total number of different proteins in each family
carrying RAMP motifs is given in parentheses. Trees were prepared using the MUSCLE and ClustalW programs as described
previously [17]. (C) MapsoffourRAMPmotif-containingproteinswithinasingleCmrfamilyBmoduleofS. solfataricus P2.
They illustrate the diverse locations of the two conserved amino acid sequence regions (1 and 2), determined using the
MEME program [45]. The remaining sequence regions show very low levels of sequence similarity.
Molecular Biology of Archaea II 53
C○The Authors Journal compilation C○2011 Biochemical Society

54 Biochemical Society Transactions (2011) Volume 39, part 1
Figure 3 A map of the CRISPR locus E
Locus E is found in S. solfataricus strains P1, P2 and 98/2 and the
S. islandicus strain L.D.8.5 [22]. Triangles represent spacer-repeat units
that are colour-coded for matching sequences: red, rudivirus and blue,
conjugative plasmid. The shaded spacer-repeat units carry identical
sequences. L represents the leader region. The 36 kb genomic region
flanking the locus (grey region) is conserved at >99% sequence identity
in all four strains.
from Naples, Italy) with only the final downstream spacer
differing between the P1/P2 strains and strain 98/2 (Figure 3).
Moreover, it is also found on a highly conserved 36 kb
chromosomal fragment (99% sequence identity) in the S.
islandicus strain L.D.8.5 (from Lassen, CA, U.S.A.) [22],
with an almost identical leader region (one mismatch) and
identical repeat sequence but different spacers (Figure 3). The
maintenance and spreading of locus E, lacking a cas cassette,
would suggest that the CRISPR module can be activated and
generate crRNAs. The inference that Cas proteins encoded
in one CRISPR/Cas module can activate other CRISPR loci
would also be consistent with the inference that the group
1 cas genes (Figure 1A) can exchange between CRISPR/Cas
modules [2].
The large inactive locus F with 88 spacer-repeat units,
is completely conserved in sequence between S. solfataricus
strains P1 and P2, but it lacks a leader region, and, although
transcription occurs internally within the CRISPR locus,
mature crRNAs are not generated [21,23]. Thus the latter,
which has been lost from S. solfataricus strain 98/2, may be
of little use when a viral infection occurred.
Generally for Sulfolobus species, loss of mobile DNA
elements is difficult, thus IS (insertion sequence) elements
tend to degenerate rather than be deleted [24], and
this may also apply to CRISPR/Cas and Cmr modules,
and explain the maintenance of defective CRISPR systems
over long periods, although in a variant strain of S. solfataricus
P2 (P2A), four physically linked CRISPR/Cas modules (A–
D) were apparently lost via a single recombination event
between bordering IS elements [25].
Transcription of CRISPR loci and processing
Processed CRISPR transcripts were first observed for
the euryarchaeon Archaeoglobus fulgidus and crenarchaeon
S. solfataricus, and these studies revealed the regular pattern
of the RNA processing, using probes specific for repeat
sequences [26,27]. Subsequently, the smallest Sulfolobus
RNA product of approx. 40 bp was identified covering
primarily a single spacer sequence [20]. S. acidocaldarius
CRISPR loci are transcribed upstream from the first repeat
within the leader region and termination occurs downstream
C○The Authors Journal compilation C○2011 Biochemical Society
from the final repeat. Even for the locus carrying 78 spacerrepeat
units (4930 bp), a substantial proportion of transcripts
were approx. 5000 nt long with another large portion in the
size range 3000–3500 nt [16].
This raised an important question as to how transcription
continues throughout CRISPR loci apparently unimpeded by
the presence of spacers carrying archaea-specific promoter or
terminator motifs, given that the DNA uptake mechanism
is essentially statistically random [15]. A compilation of
potential promoter and terminator motifs on the leader
(crRNA) strand of the available Sulfolobus genomes revealed,
for a total of 4505 spacers, 2560 carrying archaeal-type
hexameric TATA boxes (at least six consecutive A and Ts
with at least two As) and 725 with T-rich pyrimidine motifs
(at least six consecutive T and Cs with at least five Ts) [28,29].
Although many of these may at best be weakly effective,
nevertheless, given the high gene density in the Sulfolobus
viral and plasmid genomes and the low frequency of operon
structures, the probability of taking up such active motifs is
significant. The conclusion that transcripts do not normally
start within CRISPR loci is also supported by examination
of CRISPR transcripts from S. solfataricus P2 transcriptome
data [21], which indicate that most of the detectable 5 ′ -ends
are attributable to processing sites within repeats [21]. A
possible explanation for the unimpeded transcription through
the CRISPR loci could be the presence of the CRISPRbinding
protein of Sulfolobus and other crenarchaea [30]; it
could act as a transcription factor inhibiting transcriptional
starts and stops within the spacer sequences, and repeats.
Full-length transcripts are also produced from the opposite
DNA strand of CRISPR loci of S. acidocaldarius which yield
discrete 50–60 bp fragments carrying spacer sequences, albeit
at lower molar levels than for the crRNAs [16], and antisense
RNA transcripts also were detected for CRISPR loci of
S. solfataricus P2 [21]. Failure to detect similar transcripts
in the euryarchaeon Pyrococcus and bacterium E. coli [12,19]
suggests that this may be a specific property of Sulfolobus
or crenarchaea. Analyses of cDNA libraries of S. solfataricus
demonstrated previously that antisense RNAs are commonly
produced especially against transposase mRNAs [27], and
several other antisense RNAs have been detected for this
organism [21]. Given that mature crRNAs are produced in the
absence of infecting genetic elements in different Sulfolobus
species [16,20,23], one possible explanation is that these
antisense RNAs protect at least a fraction of the crRNAs
against degradation before their activation.
Maturation of crRNAs and stringency of
targeting mechanisms
Details of RNA-processing mechanism have been elucidated
for a euryarchaeal CRISPR/Cmr system and an E. coli
CRISPR/Cas system where Cas6 homologues cut in the
repeat, 8 nt 5 ′ from the start of the spacer sequence, whereas
the 3 ′ -processing sites differ [12,18]. For S. solfataricus,many
5 ′ -ends, and putative processing sites, are detectable 6–8 nt
from the spacer start [21], suggesting that a similar mechanism

operates. Processing at the 3 ′ -end of the crRNA is less clearly
defined, but for the CRISPR/Cmr system of Pyrococcus, a
14 nt ruler mechanism enables the processing ribonuclease to
generate dual cuts at 5 and 11 nt into the spacer sequence
[31]. Presumably, crRNA-binding Cas and Cmr proteins
distinguish between the different crRNA products before
targeting the foreign DNA or RNA respectively.
Until recently, attention focused on targeting of doublestranded
DNA elements, but probably single-stranded DNA
will also be targeted by the CRISPR/Cas system. It remains
an open question whether the CRISPR/Cmr system targets
both mRNA and viral RNA, and incorporation of viral RNA
into CRISPR loci would require reverse transcriptase activity.
Nevertheless, all evidence suggests that the primary targets
of the Sulfolobus immune systems are viruses and plasmids
and, probably, their mRNAs. There is no support for a
general targeting of transposable elements. Spacers matching
transposase genes are occasionally found in CRISPR loci
[16,20,32], but they can generally be attributed to transposase
genes present in viruses or plasmids, in particular orphan orfB
elements (family IS605/200) for Sulfolobus [2,15].
Effective targeting of genetic elements requires that the
mature crRNA anneals to the protospacer DNA region.
Although, for the bacterium S. thermophilus, a perfect
sequence match was required to elicit a response from the CR-
ISPR/Cas system [9], studies on different Sulfolobus strains
have shown that a less stringent recognition system prevails.
Challenging Sulfolobus cells with viral genes carrying one
to three mismatches still produced a strong response from
the CRISPR/Cas system [23]. Another important factor is
the motif known as PAM. Targeted genetic elements carry
this short sequence motif which creates a mismatch with
the 5 ′ -end of the crRNA [16,33,34]. For Sulfolobus, this was
defined as a family-specific dinucleotide, displaced 1 nt from
the spacer sequence [15,16]. Potentially, this can be involved
in both selection of protospacers for excision by Cas proteins
and crRNA targeting. Whereas a study of the bacterium
S. epidermidis concluded that the PAM was not important for
protospacer targeting and that any mismatched base pairing
would suffice [11], for S. islandicus strain REY15A, altering
the PAM led to a loss of crRNA targeting [23].
Anti-immmune systems
Although a few archaeal viruses have been shown to be
lytic and to elicit strong immune responses, many Sulfolobus
viruses and plasmids coexist in a stable relationship, at low
copy numbers, over longer periods. Although these genetic
elements do not appear to be targeted by the host CRISPR
systems, the latter could nevertheless have a regulatory role
possibly by targeting mRNAs.
Another special feature of archaeal genetic elements is
that they often carry an integrase gene which partitions
on chromosomal integration. Consequently, the integrated
element can only be excised when the free element is
present to generate an intact integrase/excision enzyme [35].
Molecular Biology of Archaea II 55
Thus targeting and degradation of the free genetic element
by the host CRISPR/Cas system could actually favour
entrapment of the integrated element, and such a process
could enhance viral and plasmid evolution in archaea. The
Redder Model [36] for archaeal viral evolution hypothesized
that, since more than one type of fusellovirus can integrate
at a given att site within a tRNA gene, the encaptured
concatenated viruses would tend to recombine thereby
generating, and subsequently releasing, hybrid fuselloviruses
[36]. A similar process may occur for Sulfolobus-specific
conjugative plasmids. They are also integrative, and their
DNA is regularly incorporated into CRISPR loci as
spacers [16,20]. Moreover, this could explain why some of
the different Icelandic conjugative plasmids cultivated in
Wolfram Zillig’s laboratory [37] often carry large regions of
almost identical nucleotide sequence [6,7]. Thus, indirectly,
the CRISPR/Cas systems could be fuelling production of
new viral and plasmid variants which they may subsequently
be required to inactivate.
Some insights into how genetic elements undermine or
avoid the CRISPR immune systems were gained by passing
the rudivirus SIRV1 (Sulfolobus islandicus rod-shaped virus
1) through a series of closely related S. islandicus strains.
This generated many sequence changes in the viral genes,
but striking was the frequent occurrence of genes that were
altered by 12 bp indels, probably deletions [38]. When similar
12 bp indels were observed among related lipothrixviruses,
it was inferred that these might occur at crRNA-targeting
protospacers on the viral genomes [39]. In another study of a
hyperthermophilic archaeal virus, HAV1 (hyperthermophilic
archaeal virus 1), cultured in a bioreactor over a 2-year period,
samples taken at different times showed genome sequence
changes, not unlike those observed earlier for SIRV1, but also
a series of recombination sites were detected along the linear
genome at which frequent rearrangements had occurred to
generate viral variants with altered sequences [40].
Although accumulating specific sequence changes in
genetic elements is an effective way of avoiding, at least
temporarily, crRNA targeting, more direct methods must
also have evolved. Thus, for the S. islandicus strain M.16.4,
an M164 provirus 1 has inserted into, and disrupted, the
csa3 gene considered to encode the transcriptional regulator
of the group 1 cas genes (Figure 1A) associated with new
spacer uptake [17]. This has the advantage for the virus that
other infecting viruses will still be attacked by crRNAs if
matching spacers are already present in the CRISPR locus, but
new spacers cannot be generated from M164 provirus itself.
Other possible mechanisms were discerned from a study
in which CRISPR systems of Sulfolobus were challenged
directly by vectors carrying viral genes or protospacers
showing various degrees of matching to host CRISPR spacers
which mimicked, to a degree, the continual infection of a host
cell with a given virus [23]. In many viable transformants,
CRISPR locus deletions, including the matching spacer, had
occurred, whereas in others, whole CRISPR/Cas cassettes
were lost. However, several transformants revealed no
changes in either CRISPR/Cas modules or vector constructs,
C○The Authors Journal compilation C○2011 Biochemical Society

56 Biochemical Society Transactions (2011) Volume 39, part 1
suggesting that other unknown regulatory mechanisms, can
inactivate the immune system [23].
CRISPR/Cas and Cmr module mobility
Sulfolobus CRISPR/Cas and Cmr modules generally occur
within variable chromosomal regions where extensive gene
shuffling has occurred [2,41], often attributable to high levels
of transposable elements. Recombination at bordering IS
elements can also lead to loss of CRISPR/Cas or Cmr
modules [25]. There is also strong evidence in support of
the transfer of whole modules between organisms based on
comparative studies of CRISPR/Cas module families and
their locations, although the transfer mechanisms remain
unclear [2]. For bacteria, evidence was provided for transfer
of these modules on large plasmids [42], but many archaeal
CRISPR/Cas modules are large, up to 25 kb, and the
largest conjugative plasmids are only approx. 40 kb [6].
Chromosomal conjugation may provide a vehicle, possibly
facilitated by encaptured Sulfolobus conjugative plasmids
[43,44] or presently unknown mechanisms may operate,
possibly within biofilms. Finally, although phylogenetic
analyses support the transfer of CRISPR/Cas and Cmr
modules between archaea and bacteria, the basic differences
in archaeal and bacterial transcriptional and translational
mechanisms and in the unique cell wall, membrane structures
and conjugative system of archaea provide formidable
barriers to transfer between domains [2].
Funding
Research was supported by grants from the Danish Natural Science
Research Council [grant number 272-08-0391], the Danish Research
Council for Technology and Production [grant number 274-07-0116]
and the Danish National Research Foundation.
References
1 Karginov, F.V. and Hannon, G.J. (2010) The CRISPR system: small
RNA-guided defense in bacteria and archaea. Mol. Cell 37, 7–19
2 Shah, S.A. and Garrett, R.A. (2010) CRISPR/Cas and Cmr modules,
mobility and evolution of an adaptive immune system. Res. Microbiol.,
doi:10.1016/j.resmic.2010.09.001
3 Zillig, W, Arnold, H.P., Holz, I., Prangishvili, D., Schweier, A., Stedman, K.,
She, Q., Phan, H., Garrett, R. and Kristjansson, J.K. (1998) Genetic
elements in the extremely thermophilic archaeon Sulfolobus.
Extremophiles 2, 131–140
4Prangishvili,D.,Forterre,P.andGarrett,R.A.(2006)Virusesofthe
Archaea: a unifying view. Nat. Rev. Microbiol. 11, 837–848
5 Lawrence, C.M., Menon, S., Eilers, B.J., Bothner, B., Khayat, R., Douglas, T.
and Young, M.J. (2009) Structural and functional studies of archaeal
viruses. J. Biol. Chem. 284, 12599–12603
6 Greve, B., Jensen, S., Brügger, K., Zillig, W. and Garrett, R.A. (2004)
Genomic comparison of archaeal conjugative plasmids from Sulfolobus.
Archaea 1, 231–23
7 Erauso, G., Stedman, K.M., van de Werken, H.J.G., Zillig, W. and van der
Oost, J. (2006) Two novel conjugative plasmids from a single strain of
Sulfolobus. Microbiology152, 1951–1968
8 Barrangou, R., Fremaux, C., Deveau, H., Richards, M., Boyaval, P.,
Moineau, S., Romero, D.A. and Horvath, P. (2007) CRISPR provides
acquired resistance against viruses in prokaryotes. Science 315,
1709–1712
C○The Authors Journal compilation C○2011 Biochemical Society
9Horvath,P.,Romero,D.A.,Coûté-Monvoisin, A.-C., Richards, M.,
Deveau, H., Moineau, S., Boyaval, P., Fremaux, C. and Barrangou, R.
(2008) Diversity, activity, and evolution of CRISPR loci in Streptococcus
thermophilus. J. Bacteriol. 190, 1401–1412
10 Marraffini, L.A. and Sontheimer, E.J. (2008) CRISPR interference limits
horizontal gene transfer in staphylococci by targeting DNA. Science 322,
1843–1845
11 Marraffini, L.A. and Sontheimer, E.J. (2010) Self versus non-self
discrimination during CRISPR RNA-directed immunity. Nature 463,
568–571
12 Brouns, S.J., Jore, M.M., Lundgren, M., Westra, E.R., Slijkhuis, R.J.,
Snijders, A.P., Dickman, M.J., Makarova, K.S., Koonin, E.V. and van der
Oost, J. (2008) Small CRISPR RNAs guide antiviral defense in prokaryotes.
Science 321, 960–964
13 Haft, D.H., Selengut, J., Mongodin, E.F. and Nelson, K.E. (2005) A guild of
45 CRISPR-associated (Cas) protein families and multiple CRISPR/Cas
subtypes exist in prokaryotic genomes. PloS Comput. Biol. 1, 474–483
14 Makarova, K.S., Grishin, N.V., Shabalina, S.A., Wolf, Y.I. and Koonin, E.V.
(2006) A putative RNA-interference-based immune system in
prokaryotes: computational analysis of the predicted enzymatic
machinery, functional analogies with eukaryotic RNAi, and hypothetical
mechanisms of action. Biol. Direct 1, 7
15 Shah, S.A., Hansen, N.R. and Garrett, R.A. (2009) Distributions of CRISPR
spacer matches in viruses and plasmids of crenarchaeal
acidothermophiles and implications for their inhibitory mechanism.
Biochem. Soc. Trans. 37, 23–28
16 Lillestøl, R.K., Shah, S.A., Brügger, K., Redder, P., Phan, H., Christiansen, J.
and Garrett, R.A. (2009) CRISPR families of the crenarchaeal genus
Sulfolobus: bidirectionaltranscriptionanddynamicproperties.Mol.
Microbiol. 72, 259–272
17 Shah, S.A., Vestergaard, G. and Garrett, R.A. (2011) CRISPR/Cas and
CRISPR/Cmr immune systems of archaea. In Regulatory RNAs in
Prokaryotes (Marchfelder, A. and Hess, W., eds), Springer, Berlin,
in the press
18 Carte, J., Wang, R., Li, H., Terns, R.M. and Terns, M.P. (2008) Cas6 is an
endoribonuclease that generates guide RNAs for invader defense in
prokaryotes. Genes Dev. 22, 3489–3496
19 Hale, C., Kleppe, K., Terns, R.M. and Terns, M.P. (2008) Prokaryotic
silencing (psi)RNAs in Pyrococcus furiosus. RNA14, 1–8
20 Lillestøl, R.K., Redder, P., Garrett, R.A. and Brügger, K. (2006) A putative
viral defence mechanism in archaeal cells. Archaea 2, 59–72
21 Wurtzel, O., Sapra, R., Chen, F., Zhu, Z.Y., Simmons, B.A. and Sorek, R.
(2010) A single-base resolution map of an archaeal transcriptome.
Genome Res. 20, 133–141
22 Reno, M.L., Hel, N.L., Fields, C.J., Burke, P.V. and Whitaker, R.J. (2009)
Biogeography of the Sulfolobus islandicus pan-genome. Proc. Natl. Acad.
Sci. U.S.A. 106, 8605–8610
23 Gudbergsdottir, S., Deng, L., Chen, Z., Jensen, J.V.K., Jensen, L.R., She, Q.
and Garrett, R.A. (2011) Dynamic properties of the Sulfolobus
CRISPR/Cas and CRISPR/Cmr systems when challenged with
vector-borne viral and plasmid genes and protospacers. Mol. Microbiol.
79, 35–49
24 Blount, Z.D. and Grogan, D.W. (2005) New insertion sequences of
Sulfolobus: functionalpropertiesandimplicationsforgenomeevolution
in hyperthermophilic archaea. Mol. Microbiol. 55, 312–325
25 Redder, P. and Garrett, R.A. (2006) Mutations and rearrangements in the
genome of Sulfolobus solfataricus P2. J. Bacteriol. 188, 4198–4206
26 Tang, T.-H., Bachellerie, J.-P., Rozhdestvensky, T., Bortolin, M.-L.,
Huber, H., Drungowski, M., Elge, T., Brosius, J. and Hüttenhofer, A. (2002)
Identification of 86 candidates for small non-messenger RNAs from the
archaeon Archaeoglobus fulgidus. Proc. Natl. Acad. Sci. U.S.A. 99,
7536–7541
27 Tang, T.-H., Polacek, N., Zywicki, M., Huber, H., Brügger, K., Garrett, R.A.,
Bachellerie, J.P. and Hüttenhofer, A. (2005) Identification of novel
non-coding RNAs as potential antisense regulators in the archaeon
Sulfolobus solfataricus. Mol.Microbiol.55, 469–481

28 Torarinsson, E., Klenk, H.P. and Garrett, R.A. (2005) Divergent
transcriptional and translational signals in Archaea. Environ. Microbiol. 7,
47–54
29 Santangelo, T.J., Cubonová, L., Skinner, K.M. and Reeve, J.N. (2009)
Archaeal intrinsic transcription termination in vivo. J. Bacteriol. 191,
7102–7108
30 Peng, X., Brügger, K., Shen, B., Chen, L., She, Q. and Garrett, R.A. (2003)
Genus-specific protein binding to the large clusters of DNA repeats (short
regularly spaced repeats) present in Sulfolobus genomes. J. Bacteriol.
185, 2410–2417
31 Hale, C.R., Zhao, P., Olson, S., Duff, M.O., Graveley, B.R., Wells, L., Terns,
R.M. and Terns, M.P. (2009) RNA-guided RNA cleavage by a CRISPR
RNA–Cas protein complex. Cell 139, 945–956
32 Held, N.L. and Whitaker, R.J. (2009) Viral biogeography revealed by
signatures in Sulfolobus islandicus genomes. Environ. Microbiol. 11,
457–466
33 Deveau, H., Barrangou, R., Garneau, J.E., Labonté, J., Fremaux, C.,
Boyaval, P., Romero, D.A., Horvath, P. and Moineau, S. (2008) Phage
response to CRISPR-encoded resistance in Streptococcus thermophilus.
J. Bacteriol. 190, 1390–1400
34 Mojica, F.J., Diez-Villasenor, C., Garcia-Martinez, J. and Almendros, C.
(2009) Short motif sequences determine the targets of the prokaryotic
CRISPR system. Microbiology 155, 733–740
35 She, Q., Peng, X., Zillig, W. and Garrett, R.A. (2001) Gene capture events
in archaeal chromosomes. Nature 409, 478
36 Redder, P., Peng, X., Brügger, K., Shah, S.A., Roesch, F., Greve, B.,
She, Q., Schleper, C., Forterre, P., Garrett, R.A. and Prangishvili, D. (2009)
Four newly isolated fuselloviruses from extreme geothermal
environments reveal unusual morphologies and a possible interviral
recombination mechanism. Environ. Microbiol. 11, 2849–2862
37 Prangishvili, D., Albers, S.V., Holz, I., Arnold, H.P., Stedman, K., Klein, T.,
Singh, H., Hiort, J., Schweier, A., Kristjansson, J.K. and Zillig, W. (1998)
Conjugation in archaea: frequent occurrence of conjugative plasmids in
Sulfolobus. Plasmid 40, 190–202
Molecular Biology of Archaea II 57
38 Peng, X., Kessler, A., Phan, H., Garrett, R.A. and Prangishvili, D. (2004)
Multiple variants of the archaeal DNA rudivirus SIRV1 in a single host
and a novel mechanism of genomic variation. Mol. Microbiol. 54,
366–375
39 Vestergaard, G., Shah, S.A., Bize, A., Reitberger, W., Reuter, M., Phan, H.,
Briegel, A., Rachel, R., Garrett, R.A. and Prangishvili, D. (2008) SRV, a
new rudiviral isolate from Stygiolobus and the interplay of crenarchaeal
rudiviruses with the host viral-defence CRISPR system. J. Bacteriol. 190,
6837–6845
40 Garrett, R.A., Prangishvili, D., Shah, S.A., Reuter, M., Stetter, K. and Peng,
X. (2010) Metagenomic analyses of novel viruses, plasmids, and their
variants, from an environmental sample of hyperthermophilic
neutrophiles cultured in a bioreactor. Environ. Microbiol. 12, 2918–2930
41 Brügger, K., Torarinsson, E., Chen, L. and Garrett, R.A. (2004) Shuffling of
Sulfolobus genomes by autonomous and non-autonomous mobile
elements. Biochem. Soc. Trans. 32, 179–183
42 Godde, J.S. and Bickerton, A. (2006) The repetitive DNA elements called
CRISPRs and their associated genes: evidence of horizontal transfer
among prokaryotes. J. Mol. Evol. 62, 718–729
43 Aagaard, C., Dalgaard, J. and Garrett, R.A. (1995) Inter-cellular mobility
and homing of an archaeal rDNA intron confers selective advantage over
intron-cells of Sulfolobus acidocaldarius. Proc. Natl. Acad. Sci. U.S.A. 92,
12285–12289
44 Grogan, D.W. (1996) Exchange of genetic markers at extremely high
temperatures in the archaeon Sulfolobus acidocaldarius. J. Bacteriol.
178, 3207–3211
45 Bailey, T.L., Williams, N., Misleh, C. and Li, W.W. (2006) MEME:
discovering and analyzing DNA and protein sequence motifs. Nucleic
Acids Res. 34, 369–373
Received 30 September 2010
doi:10.1042/BST0390051
C○The Authors Journal compilation C○2011 Biochemical Society

Extremophiles (2011) 15:487–497
DOI 10.1007/s00792-011-0379-y
ORIGINAL PAPER
Genomic analysis of Acidianus hospitalis W1 a host for studying
crenarchaeal virus and plasmid life cycles
Xiao-Yan You • Chao Liu • Sheng-Yue Wang • Cheng-Ying Jiang • Shiraz A. Shah •
David Prangishvili • Qunxin She • Shuang-Jiang Liu • Roger A. Garrett
Received: 4 March 2011 / Accepted: 26 April 2011 / Published online: 24 May 2011
Ó The Author(s) 2011. This article is published with open access at Springerlink.com
Abstract The Acidianus hospitalis W1 genome consists
of a minimally sized chromosome of about 2.13 Mb and a
conjugative plasmid pAH1 and it is a host for the model
filamentous lipothrixvirus AFV1. The chromosome carries
three putative replication origins in conserved genomic
regions and two large regions where non-essential genes are
clustered. Within these variable regions, a few orphan orfB
and other elements of the IS200/607/605 family are concentrated
with a novel class of MITE-like repeat elements.
There are also 26 highly diverse vapBC antitoxin–toxin gene
pairs proposed to facilitate maintenance of local chromosomal
regions and to minimise the impact of environmental
Communicated by L. Huang.
X.-Y. You and C. Liu contributed equally to this work.
X.-Y. You C.-Y. Jiang S.-J. Liu (&)
State Key Laboratory of Microbial Resources and Center
for Environmental Microbiology, Institute of Microbiology,
Chinese Academy of Sciences,
Bei-Chen-Xi-Lu No. 1 Chao-Yang District,
Beijing 100101, People’s Republic of China
e-mail: liusj@sun.im.ac.cn
C. Liu S. A. Shah Q. She R. A. Garrett (&)
Archaea Centre, Department of Biology,
Copenhagen University, Ole Maaløes Vej 5,
2200 N Copenhagen, Denmark
e-mail: garrett@bio.ku.dk
S.-Y. Wang
Shanghai-MOST Key Laboratory of Health and Disease
Genomics, Chinese National Human Genome Center,
Shanghai, People’s Republic of China
D. Prangishvili
Molecular Biology of the Gene in Extremophiles Unit,
Institut Pasteur, rue Dr Roux 25, 75724 Paris Cedex, France
stress. Complex and partially defective CRISPR/Cas/Cmr
immune systems are present and interspersed with five
vapBC gene pairs. Remnants of integrated viral genomes
and plasmids are located at five intron-less tRNA genes and
several non-coding RNA genes are predicted that are conserved
in other Sulfolobus genomes. The putative metabolic
pathways for sulphur metabolism show some significant
differences from those proposed for other Acidianus and
Sulfolobus species. The small and relatively stable genome
of A. hospitalis W1 renders it a promising candidate for
developing the first Acidianus genetic systems.
Keywords Toxin–antitoxin VapBC CRISPR
Sulphur metabolism OrfB element MITE
Introduction
The Acidianus genus consists of acidothermophiles which
grow optimally and slowly in the temperature range
65–95°C and at pH 2–4 and belongs to the order Sulfolobales.
Acidianus species are chemolithoautotrophic and
facultatively anaerobic and are generally versatile physiologically.
Depending on the culturing conditions, they can
either reduce S° to H2S, catalysed by a sulphur reductase
and hydrogenase, or oxidise S° to H2SO4 utilising the
sulphur oxygenase-reductase holoenzyme (Kletzin 1992,
2007). In contrast to several Sulfolobus species, the genomic
properties of an Acidianus species have not been
analysed. The Sulfolobales have been a rich source of
genetic elements, including novel conjugative plasmids
(Prangishvili et al. 1998; Greve et al. 2004) and several
exceptional and diverse viruses many of which have now
been classified into eight new viral families (Rachel et al.
2002; Prangishvili et al. 2006; Lawrence et al. 2009).
123

488 Extremophiles (2011) 15:487–497
Acidianus hospitalis W1 is the first Acidianus strain to be
isolated carrying a conjugative plasmid pAH1 which is a
member of the plasmid family predicted to generate an
archaea-specific conjugative apparatus (Greve et al. 2004;
Basta et al. 2009). These plasmids are also integrative
elements and in an encaptured state have been implicated in
facilitating chromosomal DNA conjugation for some Sulfolobus
species (Chen et al. 2005b). A. hospitalis is also a
viable host for the model Acidianus alpha lipothrixvirus
AFV1, a filamentous virus carrying exceptional claw-like
structures at its termini which is currently the subject of
detailed structural studies (Bettstetter et al. 2003; Goulet
et al. 2009). Infection of A. hospitalis with AFV1 was shown
to lead to a loss of the plasmid pAH1 and this contrasts with
observations in bacteria where endogenous plasmids tend to
determine the fate of an incoming phage (Basta et al. 2009).
In order to study further the metabolic capability of an
Acidianus species and to examine the molecular mechanisms
involved in virus–plasmid–host interactions, it was
important to sequence and annotate the A. hospitalis genome.
To date, most genomic studies of the Sulfolobales
have concentrated on Sulfolobus species that have revealed
relatively large genomes generally exhibiting high levels of
transposable and integrated genetic elements, as well as
considerable genetic diversity (Guo et al. 2011). Analysis
of the A. hospitalis genome revealed a minimally sized
chromosome that appeared relatively stable with few
transposable elements and no evidence of recent integration
events, apart from the reversible integration of pAH1
into a tRNA Arg gene (Basta et al. 2009). Potentially,
therefore, A. hospitalis W1 could provide a suitable host
for developing genetic systems for the Acidianus genus.
Materials and methods
Genome sequencing and gap closure
Genomic DNA of A. hospitalis was sequenced using a
Roche 454 Genome Sequencer FLX instrument (Titanium)
with an average 19-fold coverage. All useful reads were
initially assembled into seven contigs ([500 bp) using the
Newbler assembler software (http://www.454.com/). Gaps
were closed by a Multiplex PCR strategy and PCR products
were gel purified and sequenced using an ABI3730 DNA
sequenator. Raw sequence data were assembled into contigs
using phred/phrap/consed software and the final consensus
quality for each base was above 30 (http://www.phrap.org).
Sequence analysis and gene annotation
Initially, ORFs were predicted using the programmes
Glimmer and FgeneSB and protein function predictions
123
were obtained from the following searches: (1) homology
searches in the GenBank (http://www.ncbi.nlm.nih.gov/)
and UniProt protein (http://www.ebi.ac.uk/uniprot/) databases,
(2) function assignment searches in the Sulfolobus
database (http://www.Sulfolobus.org/), and (3) domain or
motif searches in the local CDD database (http://www.
ncbi.nlm.nih.gov/cdd/), the InterPro and the Pfam databases.
The KEGG database (http://www.genome.jp/kegg/)
was used to reconstruct metabolic pathways in silico.
Membrane proteins were predicted by Phobius, TMHMM
and ConPred II programmes. Secretory proteins were
divided into two groups; those with a signal peptide were
predicted using the SignalP 3.0 (http://www.cbs.dtu.dk/
services/SignalP/) and non-classical secretory proteins,
lacking a signal peptide, were predicted by the SecretomeP
2.0 programme (http://www.cbS.dtu.dk/services/SecretomeP/).
Transporters were predicted by searching the TCDB database
(http://www.tcdp.org) using BLASTP with E values
lower than 1e-05. Insertion sequence (IS) elements and
transposases were identified by BLASTN searches against
the IS Finder database (http://www-is.biotoul.fr/). The
MITE-like elements were detected using the programme
LUNA (Brügger K, unpublished). Potential frameshifts
were checked by sequencing after manual annotation and
any remaining frameshifts were considered to be authentic.
tRNA genes and their introns were identified using
tRNAScan-SE (Lowe and Eddy 1997). All annotations
were manually curated using Artemis software (Rutherford
et al. 2000). Start codons for single genes and first genes of
Sulfolobus operons were generally located 25–30 bp
downstream from the archaeal hexameric TATA-like box.
Only genes within operons were preceded by Shine–
Dalgarno motifs, where GGUG dominated (Torarinsson
et al. 2005). Where alternative start codons occur, a
selection was made on the basis of experimental data when
available or on its location relative to a putative promoter
and/or Shine–Dalgarno motif. The genome sequence
accession number at Genbank/EMBL is CP002535.
Results
Genomic properties
The A. hospitalis genome consists of a circular chromosome
of 2,137,654 bp and a circular conjugative plasmid
pAH1 of 28,644 bp. The chromosome has a GC content of
34.2% and carries 2,389 predicted open reading frames
(ORFs), of which about half are assigned putative functions
with many of the conserved hypothetical proteins being
archaea-specific or specific to the Sulfolobales. About 320
of the encoded proteins are putative membrane proteins
and a further 182 are predicted to be secretory proteins.

Extremophiles (2011) 15:487–497 489
The plasmid sequence is identical to that of the conjugative
plasmid pAH1 isolated earlier from the A. hospitalis strain
W1, except that it is 4 bp shorter (Basta et al. 2009).
Comparison of the A. hospitalis genome with those of
other members of the Sulfolobales provided no evidence of
extensive conservation of gene synteny, in contrast to that
observed for large regions of several Sulfolobus genomes
(Guo et al. 2011), and consistent with A. hospitalis being
relatively distant phylogenetically from these strains (Basta
et al. 2009). Nevertheless, the genome carries two major
regions that are predicted to be relatively labile. They
extend approximately from positions 75,000–444,500 and
from 1,300,000–1,870,000 and carry most of the transposable
elements, all of the CRISPR loci and cas and cmr
family genes, most of the vapBC toxin–antitoxin gene
pairs, and many genes involved in transport-related functions
and metabolism, as well as a degenerate fuselloviral
genome (Fig. 1). These two regions lack genes essential for
informational processes including DNA replication, transcription
and translation and they appear to constitute sites
where non-essential genes are collected, interchanged,
exchanged intercellularly and where genetic innovation
may occur, similarly to a single variable region observed in
several Sulfolobus genomes (Guo et al. 2011).
Three origins of chromosomal replication, demonstrated
experimentally for Sulfolobus species (Robinson et al. 2004;
Lundgren et al. 2004), were also predicted to occur in the
Acidianus genome. The Y component of a Z curve analysis
(Zhang and Zhang 2003) revealed two major peaks corresponding
to the cdc6-3 gene (Ahos0001), and the whiP/cdt1
gene (Ahos1370) and a broader peak coinciding with the
cdc6-1 gene (Ahos0780) (Fig. 1), where the three genes
encode putative replication initiators (Robinson and Bell
2007). The sequences of the cdc6 genes and whiP gene
are quite conserved relative to the S. solfataricus and
y - component
10K
8K
6K
4K
2K
0
-2K
-4K
2
Family II CRISPRs
transposable elements
toxin/antitoxin systems
Fig. 1 The Y component of a Z curve plot for the A. hospitalis
chromosome showing the three putative replication origins. The
positions of the cdc6-3 gene (origin 2), cdc6-1 gene (origin 3) and
the whiP/cdt1 gene (origin 1) are indicated as well as locations of the
S. islandicus genomes, as is the synteny of the flanking genes
except for the region immediately downstream from cdc6-3.
Integrated genetic elements
Integration of genetic elements, generally fuselloviruses or
conjugative plasmids at tRNA genes, occurs commonly for
genomes of the Sulfolobales (She et al. 1998; Guo et al.
2011). Most integration events occur via a reversible
archaea-specific mechanism whereby the integrase gene
partitions into two sections which border the integrated
element and the N-terminal-encoding region carrying the
intN sequence overlaps with the tRNA gene (Muskhelishvili
et al. 1993). Elements that become encaptured within the
chromosome subsequently degenerate and are gradually
lost, but will nevertheless leave a trace because the intN
fragment overlapping the tRNA gene is generally retained
(She et al. 1998) (Table 1).
Earlier plasmid pAH1 was sequenced and shown to
integrate reversibly into a tRNA Arg gene (Basta et al.
2009). Genome sequencing of A. hospitalis revealed that a
low fraction of reads matched to the junctions of the
integrated plasmid whilst the majority matched the
unpartitioned integrase gene of pAH1, consistent with both
integrated and free forms being present in the culture. The
integration site of pAH1 was located at genome positions
1,075,876–1,075,946 bp within the gene of tRNA Arg
[TCG] (Table 1). In addition, the chromosome carries
remnants of integrated elements adjoining another five
intron-less tRNA genes, each consisting of a few genes or
pseudogenes (Table 1). Three derive from fuselloviruses,
one from a pDL10-like plasmid of the pRN family of
cryptic plasmids (Kletzin et al. 1999) and another originates
from an unknown element (Table 1). Whether these
all derive from single integration events remains unclear
0.5M 5S 3 16S 23S 1M 1
1.5M 2M
genome length
Family I CRISPRs
ribosomal RNA genes, the CRISPR-based systems, transposable
elements of the IS200/605/607 family, and vapBC antitoxin–toxin
gene pairs
123

490 Extremophiles (2011) 15:487–497
Table 1 Integration events at tRNA genes showing the numbers of
residual integrated genes
tRNA Intron Ahos W1
Arg–TCG No pAH1
Pro–TGG No intN fragment
Glu–CTC No 0986a–0988
because, in principle, successive integrations can occur at a
given tRNA gene (Redder et al. 2009). An additional 8–10
genes and pseudogenes, most of which are fusellovirusrelated,
are clustered distantly from a tRNA gene and they
may have become displaced from one of the three tRNAintegrated
elements.
Transposable elements
The A. hospitalis genome carries five IS elements
belonging to the IS200/607 family, only three of which
carry intact transposase genes, and there are 11 copies of
orphan orfB elements of the IS605 family, 10 of which
carry intact orfB genes. None of these elements carry
inverted terminal repeats and they all appear to be transposed
by ‘‘cut-and-paste’’ mechanisms, with the orfB elements,
at least, transposing via circular single stranded
intermediates and inserting after TTAC sequences (Filée
et al. 2007; Ton-Hoang et al. 2010).
Sulfolobus genomes generally carry IS elements from a
wide variety of families most of which carry inverted terminal
repeats and are mobilised by ‘‘copy-and-paste’’
mechanisms, and tend to be lost by gradual degeneration
and not by deletion (Blount and Grogan 2005; Redder and
Garrett 2006). None of these IS element classes were
detected in the A. hospitalis genome and this suggests that
the genome has rarely, if ever, taken up any of these IS
element classes.
A new class of MITE-like elements
fusellovirus
Arg–TCT No 1232–1238
unknown element
Cys–GCA No 1550–1558
plasmid pDL10
Leu–GAG No 2147–2151
fusellovirus ASV1
1604–1609 kb (no tRNA) – 1778–1786
fusellovirus SSV
ASV1 Acidianus spindle-shaped virus, SSV Sulfolobus spindle-shaped
virus
Although none of the MITE elements that are common to
other Sulfolobus genomes were detected (Redder et al.
123
2001; Guo et al. 2011), the A. hospitalis genome carries 10
copies of a repeat sequence resembling a MITE-like element
(Fig. 3). At one end, it carries a short open reading
frame corresponding in amino acid sequence to the
downstream end of an OrfB protein (Fig. 3). The conserved
terminal sequence and the internal similarity to the orfB
element suggests that it could be a transposable element.
This supposition is reinforced by the presence of 10 full
copies in the genome (and a few degenerate copies), and
also by the presence of multiple copies in some Sulfolobus
and other crenarchaeal genomes (unpublished data).
Non-coding RNAs
Many untranslated RNAs have been characterised experimentally
for different Sulfolobus species using a variety of
techniques including probing cellular RNA extracts for
K-turn-binding motifs and generating cDNA libraries of
total cellular RNA extracts, as well as numerous antisense
RNAs (Tang et al. 2005; Omer et al. 2006; Wurtzel et al.
2010). Most of these RNAs were characterised for partial
sequence and nucleotide length, and several were detected
by more than one experimental approach. Based on the
genome sequence comparisons and gene contexts, 23
putative conserved non-coding RNAs were annotated in the
A. hospitalis genome. Genes for 12 C/D box RNAs were
localised of which 7 were predicted to modify rRNAs, 2 to
target tRNAs and a further 2 to modify unknown RNAs. In
addition, a single copy of a gene for an H/ACA box RNA
was located which together with aPus7 should generate
pseudouridine-35 in Sulfolobus pre-tRNA Tyr
transcripts
(Muller et al. 2009). However, in A. hospitalis, the aPus7
gene (Ahos0631) is degenerate. A further 10 genes were
assigned to encode RNAs of unknown function. The relatively
high conservation of sequence and gene synteny for
these RNAs between Sulfolobus and Acidianus species
underlines their potential functional importance.
Reading frame shifts and mRNA intron splicing
Examples of translational reading frame shifts yielding
single polypeptides have been demonstrated experimentally
for S. solfataricus P2 (Cobucci-Ponzano et al. 2010).
For two of these, a transketolase (Ahos1219/1218) and a
putative O-sialoglycoprotein endopeptidase (Ahos0695/
0696), the A. hospitalis genes overlap in a similar way, and
are likely to undergo translational frame shifts. Moreover,
transcripts of the intron-carrying cbf5 gene (Ahos0734/
0735) are likely to undergo splicing at the mRNA level by
the archaeal splicing enzyme complex (Ahos0689/0798/
1417) as has been demonstrated experimentally for different
crenarchaea (Yokobori et al. 2009).

Extremophiles (2011) 15:487–497 491
Metabolic pathways
Genome analyses indicate the presence of versatile metabolic
pathways in A. hospitalis. They suggest that it can
grow autotrophically by fixing CO2 or heterotrophically
using yeast extract, as has been demonstrated experimentally
(Basta et al. 2009). Genome analyses also revealed
genes encoding sugar transporters and glycosidases suggesting
that A. hospitalis can assimilate carbohydrates,
such as starch, glucose, mannose and galactose. Moreover,
enzymes are encoded that are implicated in energy generation
from oxidising elemental sulphur, hydrogen sulphides
and other reduced inorganic sulphide compounds, but not
ferrous ions. However, no hydrogenase genes were detected
suggesting that A. hospitalis cannot use H2 as electron
donor for growth.
Enzymes were identified for a complete TCA cycle that
is important for generating different intermediates for the
biosynthesis of many cellular components, as well as producing
reduced electron carriers, such as NAD(P)H,
reduced ferredoxin (FdR) and FADH2. Formation of acetyl-
CoA from pyruvate and the formation of succinyl-
CoA from 2-oxoglutarate were predicted to be catalysed,
respectively, by pyruvate ferredoxin oxidoreductase (Ahos
1949-1952) and 2-oxoglutarate ferredoxin oxidoreductase
(Ahos0089/0090/0300/0301). Moreover, both enzymes
were predicted to use ferredoxin instead of NAD ? as a
cofactor.
Genes encoding enzymes involved in pathways for fixing
atmosphere N2, or reducing nitrate and nitrite, as
nitrogen sources were absent, as observed for other Acidianus
species, and the genome analyses suggest that
ammonium is an exclusive source of nitrogen that is
Fig. 2 Model of pathways for
oxidation and reduction of
sulphur in A. hospitalis
indicating the predicted
functions of genes in the
A. hospitalis genome and
corresponding gene numbers are
given for each step. The
following abbreviations are
used: OM outer membrane,
IM inner membrane,
SQR sulphide:quinone
oxidoreductase,
Fcc flavocytochrome c sulphide
dehydrogenase, SOR sulphur
oxygenase-reductase,
TetH tetrathionate hydrolase,
TQO thiosulphate–quinone
oxidoreductase; SulP sulphate
transporter permease,
QH 2 quinol pool
assimilated via formation of carbamoyl phosphate, glutamine
and glutamate. Genes encoding putative carbamoyl
phosphate synthetase (Ahos1106/1107), glutamine synthetase
(Ahos0460, Ahos1272, Ahos2233) and glutamate
dehydrogenase (Ahos0494) are present.
Sulphur metabolism
A. hospitalis encodes several enzymes involved in sulphur
metabolism, including the oxidation and reduction of sulphur,
the thiosulphate–tetrathionate cycle which generates
sulphate, and the participation of sulphur in electron
transport. However, genes for some sulphur metabolism
enzymes, including sulphite-acceptor oxidoreductase,
adenosine phosphosulphate reductase, sulphate adenylyl
transferase and adenylylsulphate phosphate adenyltransferase
were not found which suggested that A. hospitalis
has some pathways differing from those of other Acidianus
and Sulfolobus species (Kletzin 2007). Therefore, based on
the gene annotations, a model is presented for the proposed
sulphur oxidation and reduction pathways in A. hospitalis
(Fig. 2). Extracellular H2S is oxidised by a secretory-type
sulphide:quinone oxidoreductase (Ahos0513) and flavocytochrome
c sulphide dehydrogenase (Ahos0188) to produce
a surface layer of sulphur on the outer cell membrane.
Elemental sulphur is then transported into the cell by
putative-SH radical transporter(s) using an unknown
mechanism. Subsequently, sulphur is oxidised by sulphur
oxygenase-reductase (Ahos0131) to yield sulphite, thiosulphate
and hydrogen sulphide. Sulphite and elemental
sulphur convert spontaneously and non-enzymatically to
thiosulphate and elemental sulphur and, consistent with this
mechanism, no candidate gene encoding sulphite:acceptor
123

492 Extremophiles (2011) 15:487–497
oxidoreductase was identified in the A. hospitalis genome.
Thiosulphate enters the putative thiosulphate/tetrathionate
cycle and is finally oxidised to sulphate. The enzymes
involved in this cycle were all annotated: thiosulphate:
quinone oxidoreductase (Ahos0112-0113 and Ahos0238-
0239) and tetrathionate hydrolase (Ahos1670). H2S is
either oxidised by the sulphide:quinone oxidoreductase
(Ahos1014) in the cytoplasm with quinone-cytochrome as
electron acceptor or it reacts with tetrathionate spontaneously
under the high temperature growth conditions.
Finally, sulphate generated from sulphur oxidation is
effluxed from the cell by a putative sulphate transport
permease (Ahos1256). Electrons generated from sulphur
oxidation enter the electron transport chain via quinone.
Terminal quinol oxidase receives electrons from quinone
and transfers them to O2 coupled with ATP generation.
Some electrons may be transmitted to the NADH complex
to produce NADH for use in other pathways.
Transporters and proteolytic enzymes
Twenty-eight gene products were predicted to be involved in
the transport of amino acids, oligopeptide/dipeptides and
ammonium. Of these, 19 are implicated in amino acid
transport, including 5 amino acid transporters (Ahos0100/
0163/0197/0986/1721), three amino acid permeases (Ahos
0328/0439/1725) and 11 amino acid permease-like proteins
(Ahos0272/0276/0958/1040/1086/1868/1891/1907/1953/
2065/2251) of unknown specificity for amino acid uptake.
Genes encoding an ammonium transporter (Ahos1467) and
two oligopeptide/dipeptide ABC transporter gene clusters
(Ahos0337-0342 and Ahos0170-0175) are present. In
addition, 21 genes were predicted to encode proteolytic
enzymes, including 20 peptidases. Of these, four are
endopeptidases (Ahos0428/0516/0695-6/0800), three are
aminopeptidases (Ahos0013/0588/1941), two are pepsins
(Ahos1929/2087) and one is a carboxypeptidase (Ahos
0991). Five of the proteolytic enzymes are predicted to be
membrane-bound and are designated secretory proteins.
These results suggest that A. hospitalis, like Acidianus
brierleyi (Segerer et al. 1986), Acidianus tengchongensis
(He and Li 2004) and Acidianus manzaensis (Yoshida et al.
2006), can grow on organic compounds, such as yeast
extract, peptone, tryptone and casamino acids.
Toxin–antitoxin systems
VapBC complexes constitute the main family of antitoxin–
toxins that are encoded by members of the Sulfolobales
(Pandey and Gerdes 2005; Guo et al. 2011), and they occur
mainly in variable genomic regions where they may
undergo loss or gain events (Guo et al. 2011). The A.
hospitalis genome carries 26 vapBC gene pairs that are
123
concentrated in the genomic regions 350–410 and
1,374–1,912 kb with a single vapC-like gene lying in an
operon (Fig. 1). The VapB antitoxins, in contrast to VapC
toxins, could be classified into three families of transcriptional
regulators, AbrB, CcdA/CopG and DUF217 (Fig. 4a), whilst
no subclassification was observed for the VapC proteins
(Fig. 4b). Tree building based on the sequence alignments
demonstrated that the sequences of these antitoxins and
toxins are highly diverse, with sequence identities between
them rarely exceeding 30%, as indicated by all the proteins
exhibiting long branches (Fig. 4). This result contrasted
with the finding that VapBC complexes with closely similar
sequences are commonly found when comparing different
genomes of the Sulfolobales. For example, 11 of the 26
VapBC protein pairs have closely similar homologs encoded
in at least 7 of the 13 available Sulfolobus genomes
(Fig. 4b). This indicates that there is likely to be a selection
against the uptake of closely similar vapBC gene pairs in a
given genome, despite the abundance of such gene pairs in
the environment.
The A. hospitalis genome also encodes six copies of
RelE-related toxin proteins, in common with other Sulfolobus
genomes (Pandey and Gerdes 2005, unpublished
results). At least three of the relE genes occur in integrated
regions carrying degenerated conjugative plasmids, and
they show sequence similarity to proteins encoded in
Sulfolobus conjugative plasmids pKEF9 (ORF69b), pING1
(ORF98) and pL085 (gene no. 3195) (Greve et al. 2004;
Stedman et al. 2000; Reno et al. 2009). However, none of
the putative toxin genes are linked physically to antitoxin
relB genes and their function remains unknown.
Diverse CRISPR-based immune systems
The CRISPR-based immune systems of A. hospitalis can
be classified into two main types based on analyses of their
Cas1 protein, leader and repeat sequences (Shah et al.
2009; Lillestøl et al. 2009). In total, there are six CRISPR
loci, carrying 129 spacer-repeat units none of which are
identical (Fig. 5). The first three loci in the genome (Ahos-
53, -13 and -9a) are physically linked by cassettes of cmr
and cas family genes, each of which contains a vapBC
antitoxin–toxin gene pair, and they constitute a family II
CRISPR/Cas system (Fig. 5a). The last two CRISPR loci
(Ahos-9b and 5) are coupled into a typical family I paired
CRISPR/Cas module (Fig. 5b) and there is a vapBC gene
pair immediately upstream. Preceding the latter CRISPR/
Cas module, there is a single unclassified locus (Ahos-40)
that lacks both cas genes and a leader region (Fig. 5c)
(Shah and Garrett 2011).
We analysed the degree to which CRISPR spacers
exhibited sequence matches to the many diverse genetic
elements available from Acidianus and Sulfolobus species

Extremophiles (2011) 15:487–497 493
using an earlier approach examining nucleotide and translated
sequences of the spacers (Shah et al. 2009; Lillestøl
et al. 2009). Relatively few significant sequence matches
were found and most of these were to conjugative plasmids,
with a few matches to members of five different viral
families (Fig. 5).
Discussion
At about 2.1 Mbp, the genome of A. hospitalis is much
smaller than other sequenced genomes of members of the
Sulfolobales. Although this partly reflects the presence of
low levels of transposable elements and few genes deriving
from integrated elements, it also results from a lower
diversity of metabolic and transporter genes (Guo et al.
2011). The Z curve analysis suggests that the chromosome
carries three replication origins as for Sulfolobus species
(Fig. 1), although in contrast to the sequenced strains of S.
solfataricus and S. islandicus, the whiP/cdt1 and cdc6-2
genes are widely separated.
Although no systematic analysis has been performed
experimentally on the metabolic capacity of A. hospitalis,
genome analyses revealed that A. hospitalis possesses the
capacity to assimilate a broad range of organic compounds,
including different amino acids and proteolytic products,
which is similar to some other Acidianus and Sulfolobus
species (Segerer et al. 1986; Grogan 1989; He et al. 2004;
Yoshida et al. 2006; Plumb et al. 2007). The analyses also
support that A. hospitalis can assimilate various carbohydrates,
similarly to several Sulfolobus species (Grogan
1989) but in contrast to some Acidianus species (Yoshida
et al. 2006; Plumb et al. 2007).
A. hospitalis, like other Acidianus and Sulfolobus species,
obtains energy for growth mainly via oxidation of
reduced inorganic sulphuric components (RISCs), and the
enzymes involved were predicted from the genome analyses
(Fig. 2). A sulphur oxygenase-reductase was identified
showing amino acid sequence similarity to other
Acidianus and Sulfolobus SORs of 67–99%, and we
inferred that it is important for elemental sulphur oxidation
and reduction, as occurs in both Acidianus and Sulfolobus
species (Kletzin 1989, 1992; Sun et al. 2003; Chen et al.
2005a). One product of sulphur oxygenase-reductase
catalysis is sulphite. Owing to the apparent lack of the four
enzymes, sulphite-acceptor oxidoreductase, adenosine
phosphosulphate reductase, sulphate adenylyl transferase
and adenylylsulphate phosphate adenyltransferase, A.
hospitalis must have adopted a strategy for sulphite oxidation
that differs from the currently known pathway
(Kletzin 2007). Here, we propose that sulphite is channelled
to thiosulphate in A. hospitalis via a spontaneous
reaction with elemental sulphur, but this remains to be
tested experimentally. Some Acidianus species, such as
A. manzaensis (Yoshida et al. 2006) and A. sulfidivorans
(Plumb et al. 2007) grow chemolithoautotrophically with
oxidation of molecular hydrogen, but this cannot occur in
A. hospitalis because it apparently lacks an encoded
hydrogen dehydrogenase.
Transposable elements include a few IS200/607 elements
and several orphan orfB elements which all belong to the
IS200/605/607 family. They lack inverted terminal repeats
and are mobilised by ‘‘cut-and-paste’’ mechanisms (Filée
et al. 2007; Ton-Hoang et al. 2010). No representatives of
other transposable element families were found, common to
other Sulfolobus genomes, which carry inverted terminal
repeats and are mobilised by ‘‘copy-and-paste’’ mechanisms
(Blount and Grogan 2005; Redder and Garrett 2006). It
remains uncertain whether the OrfB protein is responsible
for transposition of the orfB elements or whether they are
mobilised in trans by the TnpA transposase encoded by the
IS200/607 elements (Filée et al. 2007; Guo et al. 2011). The
IS200/607 and orfB elements have been detected in Sulfolobus
conjugative plasmids and orfB elements also occur in a
few viruses of the Sulfolobales including four copies in the
Acidianus two-tailed bicaudavirus ATV (She et al. 1998;
Greve et al. 2004; Prangishvili et al. 2006). Thus, they are
likely to be transmitted intercellularly, and enter chromosomes,
via such genetic elements.
MITEs are common in Sulfolobus species and have been
predicted to be mobilised by transposases encoded in different
IS element families (Redder et al. 2001). The novel
MITE-like elements in the A. hospitalis genome (Fig. 3)
may derive from orfB elements and be mobilised by a
similar mechanism but at present we can provide no evidence
for their mobility. In this respect, they may be
similar to other Sulfolobus MITEs which show a low level
of transpositional activity (Redder and Garrett 2006). This
is consistent with the hypothesis that MITEs drive the
evolutionary diversification of their mobilising transposases
to the point that they are no longer recognised which
leads to their immobilisation and subsequent degeneration
(Feschotte and Pritham 2007).
All of the integrated elements, except one, could be
identified as originating from fuselloviruses or a pDL10like
member of the pRN family of cryptic plasmids
(Kletzin et al. 1999), and the conjugative plasmid pAH1
was already shown to reversibly integrate at a tRNA Arg
[TCG] gene (Basta et al. 2009). None of these events
occurred within any of the 15 tRNA genes carrying introns
and this observation is consistent with the hypothesis that
archaeal introns protect tRNA genes against integration
events (Guo et al. 2011).
VapBC constitutes the predominant antitoxin–toxin
family found amongst the Sulfolobales and the A. hospitalis
genome carries 26 vapBC gene pairs, more than occur
123

494 Extremophiles (2011) 15:487–497
Fig. 3 Alignment of 10 MITE-like repeat elements present in the genome of A. hospitalis. The shaded area denotes to a small open reading
frame corresponding to the downstream part of the OrfB found within transposable orfB elements
A antitoxins [VapB] B toxins [VapC]
5%
ORF
0374
2101
0399
0394
0264
0209
0412
1712
1520
1610
0183*
0356
class
0361
1738
1728
0354
1673
1997
1644 CcdA/CopG
1587
2059
0206
1524
1582
1978 DUF217
Fig. 4 VapBC trees. Phylogenetic trees for a VapB antitoxins and
b VapC toxins. They demonstrate that VapBs, despite their high
sequence diversity, can be classified into three main families AbrB,
CcdA/CopG and DUF217, whereas the VapCs are highly diverse in
their sequences but cannot be classified into major subgroups. The
Ahos gene numbers are given for each protein. Moreover, the class of
the VapB corresponding to each VapC is given in b. The degree of
conservation of the VapC proteins in the available 13 Sulfolobus
in more rapidly growing Sulfolobus species (Pandey and
Gerdes 2005; Guo et al. 2011). Moreover, the groups of
VapB and VapC proteins are highly diverse in sequence
(Fig. 4). Antitoxin–toxins were originally shown to
enhance plasmid maintenance as a consequence of the
growth of plasmid-free cells being preferentially inhibited
by free toxins which are inherently more stable than the
antitoxins (Gerdes 2000). By analogy with this mechanism,
123
AbrB
5%
ORF
0712
1521
0210
0355
0353
1674
1737
0362
1729
1996
0400
0265
0183
1583
1979
0375
1611
0205
1713
2058
0395
0413
1645
2102
1586
1663
1525
antitoxin
class
N/A
AbrB
AbrB
AbrB
CcdA
CcdA
CcdA
CcdA
CcdA
CcdA
AbrB
AbrB
AbrB
DUF217
DUF217
AbrB
AbrB
DUG217
AbrB
CcdA
AbrB
AbrB
CcdA
AbrB
CcdA
unknown
Duf217
other
genomes
12
3
1
6
8
1
12
7
0
0
4
13
7
7
2
4
0
4
0
13
7
7
0
1
8
4
0
genomes is indicated in b where 0 indicates it is absent from all the
genomes whilst 13 indicates that it is present in all. The antitoxin
corresponding to VapC-0183 is not annotated in the genome because
it lacks a start codon but it is included in the figure. The VapC-like
protein (Ahos0712) is part of the operon with a translation-related
protein and lacks a VapB. The Ahos1664/1663 pair are variant ORFs
where both VapB and VapC are longer than usual and the VapB does
not cluster with the families in a
it was proposed that chromosomally encoded toxins may
facilitate maintenance of local DNA regions where vapBC
gene pairs are located that might otherwise be prone to loss
(Magnuson 2007; Van Melderen 2010). This hypothesis is
consistent with the observation that most of the A. hospitalis
vapBC gene pairs lie within the two variable genomic
regions where DNA regions are exchanged (Fig. 1).
Moreover, it receives strong support from both the high

Extremophiles (2011) 15:487–497 495
A
Family II
+ RAMP
B
Family I
C
unknown
vapBC vapBC
353
354
363
vapBC
1737
1738
355
356
diversity, and the uniqueness of all the VapC proteins
encoded within the A. hospitalis chromosome (Fig. 4b),
because any similar VapBC complexes would compensate
for the loss of one another, thereby undermining any DNA
maintenance activity.
In slowly growing organisms, from nutrient poor environments,
multiple toxins are also assumed to be involved
in stress response and/or quality control (Gerdes 2000;
Pandey and Gerdes 2005). Involvement in stress response
entails that the more stable toxins inhibit growth and allow
the host to lie in a dormant state during the period of
environmental stress (Gerdes 2000). However, there may
also be a negative effect on host growth due to the continuous
presence of low levels of free toxin (Wilbur et al.
2005). Thus, the presence of many vapBC gene pairs
in A. hospitalis could reflect a compromise between the
ability to survive different environmental stresses and
maintaining an adequate growth rate under normal conditions.
This would be also consistent with the presence of
three families of VapB proteins and high sequence diversity
of the VapC proteins, since functionally overlapping
systems would be redundant for stress responses and they
would confer an unnecessary burden on host growth. The
proposed dual roles of maintenance of local chromosomal
DNA regions and providing resistance to stress and are not
mutually exclusive.
Although the mechanism of action of VapC toxins
remains unknown (Arcus et al. 2011), in A. hospitalis, a
single vapC-like gene (Ahos0712) is directly coupled to
genes encoding proteins involved in transcription and initiator
tRNA binding to the ribosome, and this gene cassette
53
CRISPR
cas4 csx1 vapBC
csm1 csm2 csm3
CRISPR
csa1 vapBC PaREP cas2 cas1 CRISPR
cas6
1739
364
365
52 12 8
cas6 csaX casHD cas3 cas5 csa2 csa5csa3 csa1 cas1 cas2 cas4 csa3
8 4
Fig. 5 Schematic representations of the CRISPR loci of A. hospitalis.
a Family II CRISPR module carrying three CRISPR loci and Cmr and
Cas family gene cassettes which are both interrupted by, or bordered
by, four vapBC gene pairs (orange). b Paired family I CRISPR/Cas
system flanked by one vapBC gene pair, and c. an unclassified
CRISPR locus lacking a leader region and adjacent cas genes. csm1 is
a homolog of cmr2, csm2 is a homolog of cmr5 and csm3 is a
357
1740
1741
366
1742
367
368
1743
358
369
39
1744
359
370
371
1745
1746
360
13
1747
9b
361
362
372
1748
1749
373
*
1750
1751
374
375
376
1752
5
homolog of cmr4. The light blue genes each carry two short RAMP
motifs. a–c Structures of the individual CRISPR loci are shown
together with the leader region (L) where each triangle represents a
spacer-repeat unit. Significant spacer matches to sequenced viruses
and plasmids are colour coded: red rudivirus, orange lipothrixvirus,
yellow fusellovirus, green bicaudavirus, turquoise turreted icosahedral
virus, blue conjugative plasmid and violet cryptic plasmid
is highly conserved in gene content and sequence in other
Sulfolobus genomes (Guo et al. 2011). This suggests that
this VapC protein, at least, may also regulate or inhibit
translational initiation by binding at the ribosomal A-site,
as demonstrated recently for a RelE type toxin (Neubauer
et al. 2009). A similar inactivation mechanism would be
plausible for the VapC toxins, if one assumes that
expression of the individual VapBC complexes is stimulated
by either the requirement to maintain different local
regions of chromosomal DNA or different environmental
stresses.
Despite the complexity of the CRISPR-based immune
systems present in the genome, they appear to be, at best,
only partially functional. Thus, the family II CRISPR/Cas
system is coupled with an archaeal family D Cmr module
in A. hospitalis, but is apparently defective, retaining only
its putative RNA, but not DNA, targeting function. The
system lacks the group 2 cas genes (cas3, cas5, csa2, csa5,
csaX) which encode proteins implicated in targeting and
inactivating foreign DNA elements (Fig. 5). However, the
cas group 1 genes (cas1, cas2, cas4, csa1), putatively
involved in integrating new spacers from invading DNA
elements are present, and the Cmr module implicated in
RNA targeting are also present (Garrett et al. 2011; Shah
et al. 2011). The family I system exhibits small CRISPR
loci, with intact leader regions and group 2 cas genes.
However, the cas2 gene in the group 1 cas gene cassette is
truncated, having incurred a point mutation which produces
a premature stop codon. Thus, this system has apparently
lost the ability to integrate new spacers. This suggests that
neither CRISPR-based system is fully functional, despite
377
378
9a
379
123

496 Extremophiles (2011) 15:487–497
their apparent complexity. The presence of five vapBC
gene pairs located either within the cmr and cas gene
cassettes of the family II CRISPR/Cas module, or immediately
upstream from the modules of both families, may
reflect that they help to maintain these gene cassettes on the
chromosome (see above).
Although a range of genetic systems have been developed
for Sulfolobus species, at present no genetic systems
are available for the Acidianus genus and A. hospitalis
provides a promising candidate for such studies. It has a
minimal size and the relative stability of its chromosome
suggests that it is likely to generate stable deletion mutants.
This, combined with its ability to host different plasmids
and viruses provides a promising starting point for developing
a genetic system.
Acknowledgments We thank Mery Pina and Tamara Basta for help
with the DNA preparation. The work was supported by the National
Nature Science Foundation of China (30621005) and the Ministry of
Science and Technology (2010CB630903), and by the Danish Natural
Science Research Council (Grant no. 272-08-0391) and Danish
National Research Foundation.
Open Access This article is distributed under the terms of the
Creative Commons Attribution Noncommercial License which permits
any noncommercial use, distribution, and reproduction in any
medium, provided the original author(s) and source are credited.
References
Arcus VL, McKenzie JL, Robson J, Cook GM (2011) The PINdomain
ribonucleases and the prokaryotic VapBC toxin–antitoxin
array. Prot Engin Design Select 24:33–40
Basta T, Smyth J, Forterre P, Prangishvili D, Peng X (2009) Novel
archaeal plasmid pAH1 and its interactions with the lipothrixvirus
AFV1. Mol Microbiol 71:23–34
Bettstetter M, Peng X, Garrett RA, Prangishvili D (2003) AFV1, a
novel virus infecting hyperthermophilic archaea of the genus
Acidianus. Virology 315:68–79
Blount ZD, Grogan DW (2005) New insertion sequences of
Sulfolobus: functional properties and implications for genome
evolution in hyperthermophilic archaea. Mol Microbiol 55:312–
325
Chen Z-W, Jiang C-Y, She Q, Liu S-J, Zhou P-J (2005a) Key role of
cysteine residues in catalysis and subcellular localization of
sulfur oxygenase reductase of Acidianus tengchongensis. Appl
Environ Microbiol 71:621–628
Chen L, Brügger K, Skovgaard M, Redder P, She Q, Torarinsson E,
Greve B, Awayez M, Zibat A, Klenk HP, Garrett RA (2005b)
The genome of Sulfolobus acidocaldarius, a model organism of
the Crenarchaeota. J Bacteriol 187:4992–4999
Cobucci-Ponzano B, Guzzini L, Benelli D, Londei P, Perrodou E,
Lecompte O, Tran D, Sun J, Wei J, Mathur EJ, Rossi M, Moracci
M (2010) Functional characterisation and high-throughput
proteomic analysis of interrupted genes in the archaeon Sulfolobus
solfataricus. J Proteome Res 9:2496–2507
Feschotte C, Pritham EJ (2007) DNA transposons and the evolution
of eukaryotic genomes. Annu Rev Genet 41:331–368
123
Filée J, Siguier P, Chandler M (2007) Insertion sequence diversity in
archaea. Microbiol Mol Biol Revs 71:121–157
Garrett RA, Shah SA, Vestergaard G, Deng L, Gudbergsdottir S,
Kenchappa CS, Erdmann S, She Q (2011) CRISPR-based
immune systems of the Sulfolobales—complexity and diversity.
Biochem Soc Trans 39:51–57
Gerdes K (2000) Toxin-antitoxin modules may regulate dynthsis
of macromolecules during nutritional stress. J Bacteriol 182:561–
572
Goulet A, Blangy S, Redder P, Prangishvili D, Felisberto-Rodrigues
C, Forterre P, Campanacci V, Cambillau C (2009) Acidianus
filamentous virus 1 coat proteins display a helical fold spanning
the filamentous archaeal viruses lineage. Proc Natl Acad Sci
USA 106:21155–21160
Greve B, Jensen S, Brügger K, Zillig W, Garrett RA (2004) Genomic
comparison of archaeal conjugative plasmids from Sulfolobus.
Archaea 1:231–239
Grogan DW (1989) Phenotypic characterization of the archaebacterial
genus Sulfolobus: comparison of five wild-type strains. J Bacteriol
171:6710–6719
Guo L, Brügger K, Liu C, Shah SA, Zheng H, Zhu Y, Wang S,
Lillestøl RK, Chen L, Frank J, Prangishvili D, Paulin L, She Q,
Huang L, Garrett RA (2011) Genome analyses of Icelandic
strains of Sulfolobus islandicus: model organisms for genetic and
virus-host interaction studies. J Bacteriol 193:1672–1680
He Z-G, Zhong H, Li Y (2004) Acidianus tengchongensis sp. nov., a
new species of acidothermophilic archaeon isolated from an
acidothermal spring. Curr Microbiol 48:156–193
Kletzin A (1989) Coupled enzymatic production of sulfite, thiosulfate,
and hydrogen sulfide from sulfur: purification and properties of a
sulfur oxygenase reductase from the facultatively anaerobic
archaebacterium Desulfurolobus ambivalens.JBacteriol171:1638–
1643
Kletzin A (1992) Molecular characterization of the sor gene, which
encodes the sulfur oxygenase/reductase of the thermoacidophilic
Archaeum Desulfurolobus ambivalens. J Bacteriol 174:5854–
5859
Kletzin A (2007) Oxidation of sulfur and inorganic sulfur compounds
in Acidianus ambivalens. In: Dahl C, Friedrich CG (eds)
Microbial sulfur metabolism. Springer, Heidelberg, pp 184–199
Kletzin A, Lieke A, Urich T, Charlebois RL, Sensen CW (1999)
Molecular analysis of pDL10 from Acidianus ambivalens reveals
a family of related plasmids from extremely thermophilic and
acidophilic archaea. Genetics 152:1307–1314
Lawrence CM, Menon S, Eilers BJ, Bothner B, Khayat R, Douglas T,
Young MJ (2009) Structural and functional studies of archaeal
viruses. J Biol Chem 284:12599–12603
Lillestøl RK, Shah SA, Brügger K, Redder P, Phan H, Christiansen J,
Garrett RA (2009) CRISPR families of the crenarchaeal genus
Sulfolobus: bidirectional transcription and dynamic properties.
Mol Microbiol 72:259–272
Lowe TM, Eddy SR (1997) tRNAscan-SE: a program for improved
detection of transfer RNA genes in genomic sequence. Nucleic
Acids Res 25:955–964
Lundgren M, Andersson A, Chen L, Nilsson P, Bernander R (2004)
Three replication origins in Sulfolobus species: synchronous
initiation of chromosome replication and asynchronous termination.
Proc Natl Acad Sci USA 101:7046–7051
Magnuson RD (2007) Hypothetical functions of toxin–antitoxin
systems. J Bacteriol 189:6089–6092
Melderen LV (2010) Toxin-antitoxin systems: why so many, what
for? Curr Opin Microbiol 13:781–785
Muller S, Urban A, Hecker A, Leclerc A, Branlant C, Motorin Y
(2009) Deficiency of the tRNA Tyr :W35-synthase aPus7 in
archaea of the Sulfolobales order might be rescued by the

Extremophiles (2011) 15:487–497 497
H/ACA sRNA-guided machinery. Nucleic Acids Res 37:1308–
1322
Muskhelishvili G, Palm P, Zillig W (1993) SSV1-encoded sitespecific
recombination system in Sulfolobus shibatae. Mol Gen
Genet 273:334–342
Neubauer C, Gao YG, Andersen KR, Dunham CM, Kelley AC,
Hentschel J, Gerdes K, Ramakrishnan V, Brodersen DE (2009)
The structural basis for mRNA recognition and cleavage by the
ribosome-dependent endonuclease RelE. Cell 139:1084–1095
Omer AD, Zago M, Chang A, Dennis PP (2006) Probing the structure
and function of an archaeal C/D-box methylation guide sRNA.
RNA 12:1708–1720
Pandey DP, Gerdes K (2005) Toxin-antitoxin loci are highly abundant
in free-living but lost from host-asscoiated prokaryotes. Nucleic
Acids Res 33:966–976
Plumb JJ, Haddad CM, Gibson JAE, Franzmann PD (2007) Acidianus
sulfidivorans sp nov., an extremely acidophilic, thermophilic
archaeon isolated from a solfatara on Lihir Island, Papua New
Guinea, and amendation of the genus description. Int J Syst Evol
Microbiol 57:1418–1423
Prangishvili D, Albers SV, Holz I, Arnold HP, Stedman K, Klein T,
Singh H, Hiort J, Schweier A, Kristjansson JK, Zillig W (1998)
Conjugation in archaea: frequent occurrence of conjugative
plasmids in Sulfolobus. Plasmid 40:190–202
Prangishvili D, Forterre P, Garrett RA (2006) Viruses of the Archaea:
a unifying view. Nat Rev Microbiol 4:837–848
Rachel R, Bettstetter M, Hedlund BP, Häring M, Kessler A, Stetter
KO, Prangishvili D (2002) Arch Virol 147:2419–2429
Redder P, Garrett RA (2006) Mutations and rearrangements in the
genome of Sulfolobus solfataricus P2. J Bacteriol 188:4198–4206
Redder P, She Q, Garrett RA (2001) Non-autonomous elements in the
crenarchaeon Sulfolobus solfataricus. J Mol Biol 306:1–6
Redder P, Peng X, Brügger K, Shah SA, Roesch F, Greve B, She Q,
Schleper C, Forterre P, Garrett RA, Prangishvili D (2009) Four
newly isolated fuselloviruses from extreme geothermal environments
reveal unusual morphologies and a possible interviral
recombination mechanism. Environ Microbiol 11:2849–2862
Reno ML, Held NL, Fields CJ, Burke PV, Whitaker RJ (2009)
Sulfolobus islandicus pan-genome. Proc Natl Acad Sci USA
106:8605–8610
Robinson NP, Bell SD (2007) Extrachromosomal element capture and
the evolution of multiple replication origins in archaeal
chromosomes. Proc Natl Acad Sci USA 104:5806–5811
Robinson NP, Dionne I, Lundgren M, Marsh VL, Bernander R, Bell
SD (2004) Identification of two origins of replication in the
single chromosome of the archaeon Sulfolobus solfataricus. Cell
116:25–38
Rutherford K, Parkhill J, Crook J, Horsnell T, Rice P, Rajandream
MA, Barrell B (2000) Artemis: sequence visualization and
annotation. Bioinformatics 16:944–945
Segerer A, Neuner A, Kristjansson JK, Stetter KO (1986) Acidanus
infernus gen. nov., sp. nov., and Acidianus brierleyi comb. nov.:
facultatively aerobic, extremely acidophilic thermophilic sulfurmetabolizing
archaebacteria. Int J Syst Bacteriol 36:559–564
Shah SA, Garrett RA (2011) CRISPR/Cas and Cmr modules, mobility
and evolution of adaptive immune systems. Res Microbiol
162:27–38
Shah SA, Hansen NR, Garrett RA (2009) Distributions of CRISPR
spacer matches in viruses and plasmids of crenarchaeal acidothermophiles
and implications for their inhibitory mechanism.
Trans Biochem Soc 37:23–28
Shah SA, Vestergaard G, Garrett RA (2011) CRISPR/Cas and
CRISPR/Cmr immune systems of archaea. In: Marchfelder A,
Hess W (eds) Regulatory RNAs in prokaryotes. Springer, Berlin
She Q, Phan H, Garrett RA, Albers S-V, Stedman KM, Zillig W
(1998) Genetic profile of pNOB8 from Sulfolobus: the first
conjugative plasmid from an archaeon. Extremophiles 2:417–
425
Stedman KM, She Q, Phan H, Holz I, Singh H, Prangishvili D, Garrett
RA, Zillig W (2000) The pING family of conjugative plasmids
from the extremely thermophilic archaeon Sulfolobus islandicus:
insights into recombination and conjugation in Crenarchaeota.
J Bacteriol 182:7014–7020
Sun CW, Chen ZW, He ZG, Zhou PJ, Liu SJ (2003) Purification and
properties of the sulphur oxygenase/reductase from the acidothermophilic
archaeon, Acidianus strain S5. Extremophiles
7:131–134
Tang TH, Polacek N, Zywicki M, Huber H, Brügger K, Garrett R,
Bachellerie JP, Hüttenhofer A (2005) Identification of novel
non-coding RNAs as potential antisense regulators in the
archaeon Sulfolobus solfataricus. Mol Microbiol 55:469–481
Ton-Hoang B, Pasternak C, Siguier P, Guynet C, Hickman AB, Dyda
F, Sommer S, Chandler M (2010) Single-stranded DNA
transposition is coupled to host replication. Cell 142:398–408
Torarinsson E, Klenk H-P, Garrett RA (2005) Divergent transcriptional
and translational signals in Archaea. Environ Microbiol
7:47–54
Wilbur JS, Chivers PT, Mattison K, Potter L, Brennan RG, So M
(2005) Neisseria gonorrheae FitA interacts with FitB to bind
DNA through its ribbon–helix–helix motif. Biochemistry 44:
12515–12524
Wurtzel O, Sapra R, Chen F, Zhu ZY, Simmons BA, Sorek R (2010)
A single-base resolution map of an archaeal transcriptome.
Genome Res 20:133–141
Yokobori S, Itoh T, Yoshinari S, Nomura N, Sako Y, Yamagishi A,
Oshima T, Kita K, Watanabe Y (2009) Gain and loss of an intron
in a protein-coding gene in Archaea: the case of an archaeal
RNA pseudouridine synthase gene. BMC Evol Biol 9:198
Yoshida N, Nakasato M, Ohmura N, Ando A, Saolo J, Ishii M,
Igarashi Y (2006) Acidianus manzaensis sp. nov., a novel
thermoacidophilic Archaeon growing autotrophicallly by the
oxidation of H 2 with the reduction of Fe 3? . Curr Microbiol
53:406–411
Zhang R, Zhang CT (2003) Multiple replication origins of the
archaeon Halobacterium species NRC-1. Biochem Biophys Res
Comm 302:728–734
123

Review
Archaeal CRISPR-based immune
systems: exchangeable functional
modules
Roger A. Garrett, Gisle Vestergaard and Shiraz A. Shah
Archaea Centre, Department of Biology, Ole Maaløes Vej 5, University of Copenhagen, DK2200 Copenhagen N, Denmark
CRISPR (clustered regularly interspaced short palindromic
repeats)-based immune systems are essentially
modular with three primary functions: the excision and
integration of new spacers, the processing of CRISPR
transcripts to yield mature CRISPR RNAs (crRNAs), and
the targeting and cleavage of foreign nucleic acid. The
primary target appears to be the DNA of foreign genetic
elements, but the CRISPR/Cmr system that is widespread
amongst archaea also specifically targets and
cleaves RNA in vitro. The archaeal CRISPR systems tend
to be both diverse and complex. Here we examine evidence
for exchange of functional modules between archaeal
systems that is likely to contribute to their
diversity, particularly of their nucleic acid targeting
and cleavage functions. The molecular constraints that
limit such exchange are considered. We also summarize
mechanisms underlying the dynamic nature of CRISPR
loci and the evidence for intergenomic exchange of
CRISPR systems.
Archaea and CRISPR immunity
The early evolutionary history of archaea remains unresolved.
Archaea could have descended directly from a
universal common ancestor, undergone a shared period
of descent with eukarya, or have been streamlined from a
more complex (and eukaryal-like) ancestor [1,2]. Although
many cellular processes of archaea and eukarya share
common features that are absent from bacteria [1], the
uniqueness of archaea appears to lie in their successful
adaptation to extreme environmental conditions including
high temperature, extremes of pH, high salt, high pressures,
and strictly anaerobic conditions. These environments
tend to be low in sources of energy consistent with
the hypothesis that some unique archaeal properties were
maintained through adaptation to chronic energy stress
via, for example, their catabolic pathways and mechanisms
of energy conservation facilitated by low permeability
ether-linked lipid membranes [3].
This exceptional biology is reflected in the properties of
the archaeal viruses. Most of those characterized, especially
from extreme thermophilic and halophilic environments,
show morphotypes and genomic properties distinct from
viruses of bacteria and eukarya [4–6]. There are also
preliminary indications that levels of free viruses, at least
Corresponding author: Garrett, R.A. (garrett@bio.ku.dk).
in extreme thermoacidophilic environments, tend to be low
relative to cellular levels, suggesting that these viruses
prefer to remain ‘inside’ cells [7]. Moreover, archaeal
viruses generally exist in stable relationships with their
hosts at low copy-numbers and rarely cause cell lysis
[4,6,8,9].
CRISPR systems (Box 1) provide immunity against
invasion by viruses and conjugative plasmids, are present
in most studied archaea and in about 40% of bacteria, and
have a common evolutionary origin [10,11]. The CRISPR
systems in many archaea are unusual in that they tend to
be both diverse and complex, suggesting that they have the
potential to be more versatile functionally and with more
possibilities for regulation than in many bacteria [11,12].
Given the tendency of many archaeal viruses and conjugative
plasmids to maintain stable relationships with their
hosts, and to avoid targeting by the CRISPR system,
different regulatory systems might play an important role
[4,6,13]. For example, the immune response may only be
activated at certain levels of viral DNA replication or
transcription.
All CRISPR systems have three basic functions. First,
the excision of protospacer DNA from invading genetic
elements and insertion into CRISPR loci, a process termed
adaptation. Second, transcripts from complete CRISPR
loci are processed to yield crRNAs that are then assembled
into protein complexes. Third, these complexes target and
cleave the DNA or RNA of invading genetic elements,
termed interference. These steps are illustrated in
Figure 1 and the main components are defined in Box 1.
CRISPR-based systems have recently been reclassified
into three main types, of which only types I and III occur
in archaea (Box 2). Protein components of CRISPR systems
are manifold and highly diverse. Several core protein
functions have been predicted from sequence analyses or
crystal structures [14,15] but with few exceptions their
detailed mechanistic roles remain to be determined experimentally
(Box 1). Similarities of essential components and
core mechanisms of archaeal and bacterial CRISPR systems
are consistent with their having a common evolutionary
origin [10,11].
Attempts to classify CRISPR systems phylogenetically
have previously involved sequence alignments of the most
conserved Cas1 protein [14,16]. This protein is almost
ubiquitous and is associated with the adaptation step
(Figure 1). Phylogenetic studies on crenarchaeal systems
0966-842X/$ – see front matter ß 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.tim.2011.08.002 Trends in Microbiology, November 2011, Vol. 19, No. 11 549

Review Trends in Microbiology November 2011, Vol. 19, No. 11
Box 1. Core components of CRISPR systems
Here we summarize the main components of CRISPR systems.
Leaders: all active CRISPR loci to date are preceded by a leader of
about 300–400 bp, carrying some low complexity sequence and
conserved regions, that is likely to be involved in the adaptation step
at or near the first repeat [16,17]. The CRISPR proximal region of the
leader also carries the main promoter for CRISPR transcription [16].
CRISPR loci: these consist of arrays of identical direct repeats of 24–
37 bp in size and, in archaea, often contain up to 100 repeat units.
These are interspaced with similarly sized spacers (35–44 bp) carrying
unique sequences that derive from invading DNA genetic elements.
They are dynamic structures that undergo loss and exchange of
spacer-repeat units, probably via recombination events at repeats
[16,35]. Thus they provide a record, albeit incomplete, of previous
invading genetic elements, although if CRISPR loci have recently
exchanged between related organisms, as occurs for S. islandicus
[17], the record will be erroneous. There is currently no evidence to
indicate whether spacers can originate from RNA viruses.
Protospacer: a segment of the invading DNA genetic element that is
incorporated into a CRISPR locus at or near the first repeat, and in a
direction predetermined by the location of the adjacent protospacerassociated
motif.
Protospacer-associated motif (PAM): this motif is essential for the
immune response [19]. It corresponds to a short sequence, positioned at
approximately –2 to –4 bp from the end of the protospacer that becomes
leader-proximal on insertion into a CRISPR locus. This suggests that the
base-paired motif influences protospacer selection from genetic
elements [16,19,31]. Another proposed function of the PAM motif is
that it ensures the presence of mismatched base-pairs between 5 0 ends
of crRNAs and targeted DNA as a prerequisite for avoiding selfinterference
of CRISPR loci [46]. The PAM motif may also play a more
specific role in DNA interference, although how it is recognized and the
degree of PAM sequence stringency required remain unknown [35,41].
crRNAs: the final products of processing of pre-CRISPR RNAs, many
of which exhibit short inverted repeats [58]. They are produced for
DNA targeting by introducing single cuts in adjacent repeats, and
provided evidence for coevolution of Cas1 protein and the
leader and repeat sequences, strongly suggesting that
these structural components are functionally interdependent
in adaptation [16,17]. However, when attempts were
made to extend these analyses to conserved crenarchaeal
CRISPR components implicated in RNA processing or
nucleic acid interference, divergent trees were obtained,
suggesting that CRISPR systems are non-integral and that
modular exchange can occur [17,18].
DNA
Virus V
Plasmid
aCas complex
DNA
excision
Adaptation
Leader
New spacer
each crRNA carries a spacer sequence flanked by repeat sequence
fragments [20,32]. In Cmr-based RNA targeting, crRNAs are further
processed at the 3 0 end by an unknown enzyme [21,22]. crRNA
complexes with Cas, Csm or Cmr proteins target invading nucleic
acids by base-pairing to highly similar sequences, where perfect
matching of the 5 0 terminal spacer sequence of the crRNA can be
especially important for DNA targeting [35,40,43].
CRISPR-associated proteins (Cas): although many functions have
been predicted bioinformatically for core Cas proteins, few have been
tested experimentally [14,15]. Cas1 and Cas2 are universally involved
in adaptation and the proteins exhibit metal-dependent DNA and RNA
endonuclease activity, respectively [59,60]. Cas4 carries a predicted
RecB nuclease domain and is sometimes fused to Cas1, and is
thereby implicated in adaptation. DNA interference by the CRISPR/Cas
system requires at least three core proteins (Cas5, Cas7, and Cas3),
which carry helicase and single-stranded DNA nuclease activities and
are associated with invader DNA cleavage [61]. A large group of RNA
recognition motif-containing proteins (RAMPs) also carry small
glycine-rich motifs, including the diverse Cas6 proteins involved in
CRISPR RNA processing and many of the proteins making up the Csm
and Cmr protein targeting complexes for DNA and RNA, respectively
[23,46].
CASCADE (CRISPR-associated complex for antiviral defense): first
characterized for the E. coli CRISPR/Cas system, this constitutes a
protein complex of Cas5e, Cas6, Cas7 (six copies) and two subtype
specific proteins Cse1 and Cse 2 (two copies) [20,45]. It generates a
seahorse-shaped structure encompassing the crRNA and specifically
targets the complementary strand of protospacer-like DNA (and
unspecifically ssRNA) but does not cleave it. The presence of a Cas6
homolog underlines an additional link to processing [45]. A similar
structure was modeled for a Sulfolobus complex containing Cas5e,
multiple copies of Cas7 and crRNA, that also targeted DNA but only
interacted weakly with Cas6 and other Cas proteins [42]. The similarity
of the two structures suggests that this may be a universal structure
for DNA targeting.
In this review we focus primarily on archaeal CRISPR
systems. The degree of functional and structural interdependence
of the functional modules is summarized and
evidence is provided for modular exchange. Further, molecular
and sequence constraints that limit the capacity for
exchange are considered and it is inferred that advantages
of exchange lie primarily in generating interference diversity.
Further, we summarize the evidence for CRISPR
loci being dynamic structures and describe factors that
Repeat
pCas poly-crRNA
Processing
iCas-crRNA
iCmr-crRNA
Interference
DNA
Viral/plasmid
DNA
Cleavage
Interference
RNA
Cleaved
mRNA
Cleav Cleaved
viral RRNA
TRENDS in Microbiology
Figure 1. Scheme for the three primary functions of CRISPR systems. In the adaptation step, Cas proteins excise the protospacer sequence from a foreign DNA genetic
element and insert it into the repeat adjacent to the leader of the CRISPR locus. Pre-CRISPR RNAs are then transcribed from within the leader and are subsequently
processed into crRNAs each carrying a single spacer sequence and part of the adjoining repeat sequence. At the interference stage, crRNAs are assembled into protein
targeting complexes that anneal to, and cleave, matching spacer sequences on either invading elements or their transcripts.
550

Review Trends in Microbiology November 2011, Vol. 19, No. 11
Box 2. Classification and nomenclature
CRISPR-related proteins have been classified into eight types of
CRISPR systems and up to 45 families of associated proteins [14,61].
An attempt was recently made to simplify both the CRISPR
classification and protein nomenclature and the results pertaining
especially to archaeal systems (summarized below) are presented
together with a suggested terminology that we use for labeling the
diverse functional modules present in archaea [16].
CRISPR systems: these are now grouped into three major classes –
types I to III (with a few subtypes) – based primarily on sequences of
the Cas1 and Cas2 proteins implicated in adaptation, but also taking
into account gene cassette contents [15]. Type I systems have been
implicated in DNA targeting (exemplified in Figure 2a) and are
generally characterized by a Cas3 endonuclease considered to cleave
invading foreign DNA [61]. Type II are bacteria-specific and require a
CRISPR-associated trans-encoded small RNA (tracrRNA) and hostencoded
RNase III for processing. The large multifunctional Cas9
protein alone appears to facilitate the final processing and interference
steps [36]. Type III systems are over-represented in archaea
and include all CRISPR systems carrying Cmr or Csm proteins,
illustrated for archaea in Figure 2b–f. Some of these proteins (Cmr2/
Csm1 and Cmr4/Csm3) are homologs, whereas others show minimal
sequence conservation but carry RNA recognition and glycine-rich
motifs (RAMP proteins) [12,14]. The Csm and Cmr protein complexes
contribute to their structural changes and, finally, evidence
for intergenomic exchange of CRISPR systems is
discussed. Detailed experimental data pertaining to the
mechanisms involved in the core functional steps in archaea
and bacteria have recently been reviewed [11] and
will not be covered in depth here.
Functional modules
CRISPR systems all exhibit three basic functional steps
illustrated in Figure 1. (i) Adaptation involves recognition
and degradation of foreign DNA by Cas proteins and
incorporation of a DNA fragment into the CRISPR locus
as a new spacer presumed to occur at the repeat adjacent to
the leader [16,19]. (ii) In the second step, the complete
CRISPR locus is transcribed from within the leader and
processed into multiple CRISPR RNAs (crRNAs) each
carrying a single spacer sequence and one or more adjoining
repeat regions. Proteins implicated in the archaeal
RNA processing are the core protein Cas6 and at least
one other unidentified protein [20–22]. (iii) Interference
(or invader silencing) of DNA or RNA occurs when a
protein–crRNA complex targets and cleaves a highly similar
sequence of the genetic element [23–25]. At present
three interference systems have been identified based on
Cas and Csm protein complexes each targeting DNA in
vivo and Cmr proteins targeting RNA in vitro. Here we
introduce terms for the main molecular components involved
in each functional step to simplify the discussion of
functional module exchange as follows: aCas for adaptation;
pCas for processing, and iCas, iCsm and iCmr for
nucleic acid interference (Box 2).
Currently about 165 CRISPR systems from 110 archaeal
genomes are available in public sequence databases and
have provided a basis for analyzing gene organization
patterns of different functional modules [12,15,26]. They
reveal six major combinations of gene cassettes illustrated
with color-coded functional modules in Figure 2. Whereas
the aCas cassette is relatively conserved in the first four
combinations, the interference modules are diverse in
are implicated in targeting and cleavage of DNA and RNA, respectively
[23,25]. In archaea the type I and type III systems are often
functionally interdependent [17,44].
Protein nomenclature: the names of proteins Cas1 to Cas6 are
retained but they are extended to include many disparate homologs
in different organisms. Cas7 to Cas10 represent new categories, each
of which brings together a group of differently named homologs. The
changes especially relevant to archaeal CRISPR systems are: Cas7 for
Csa2, Cas8 for Csa4, and Cas10 is proposed for homologs Cmr2 and
Csm1 of type III systems (Figure 3). Cas9 is exclusive to the bacteriaspecific
type II system.
Functional module nomenclature: the following terms are introduced
for the central mechanistic steps: adaptation, aCas; processing, pCas;
and interference, iCas, iCmr, and iCsm, which are generally genetically
discrete units but are also functionally interdependent (Figure 2). These
terms are considered to provide a useful label for all components of the
genetically diverse archaeal functional modules. Gene cassettes of all
the functional modules often carry additional proteins that are
conserved for different CRISPR subtypes, and gene cassettes for the
three types of interference module are particularly diverse (Figures 2
and 4). The terms are applied to components that are specifically
involved in the main functional steps of different CRISPR systems, but
exclude transcriptional regulators (Figures 2 and 4).
both their gene contents and in their combinations
(Figure 2a–d). About half of the archaeal iCmr and iCsm
gene cassettes are physically separated on genomes from
CRISPR loci and aCas genes (Figure 2e,f).
Adaptation
New spacer uptake involves excision of a protospacer from
an invading DNA genetic element and its integration as a
new spacer at the repeat sequence adjacent to the leader,
resulting in duplication of the repeat. It has only been
observed under laboratory conditions for Streptococcus
thermophilus [27]. For archaea, evidence is limited to
comparative genomic studies of closely related Sulfolobus
strains where more recently incorporated spacers are clustered
adjacent to the leader [16,28–30]. The short PAM
motif adjacent to the protospacer (Box 1) has been implicated
in determining the orientation of inserted spacers
[16,26,31]. Most aCas modules are relatively conserved in
content, generally carrying proteins Cas1, Cas2 and Cas4
(Figure 2), of which the first two appear to be essential.
Moreover, spacer integration at the first repeat, combined
with phylogenetic evidence for coevolution of cas1, leader
and repeat sequences, suggest that the leader is cofunctional
[16,17].
RNA processing
Transcripts initiate within leaders and terminate downstream
from CRISPR loci [16]; early work on Archaeoglobus
fulgidus indicated that processing occurs within
adjacent repeats [32]. The primary processing enzyme is
the ubiquitous and diverse Cas6 protein and, at least in
Pyrococcus furiosus, the CRISPR transcript wraps around
the Cas6 endonuclease and is cut once in each adjacent
repeat [23,33]. The order and direction of processing
remains unclear. Early work on Sulfolobus solfataricus
suggested that, in contrast to A. fulgidus, initially every
third repeat is cut and that processing occurs primarily
from the 3 0 end of the CRISPR transcript, but this remains
to be confirmed [16,34]. Moreover, processing levels were
551

Review Trends in Microbiology November 2011, Vol. 19, No. 11
(a)
S. islandicus
(b)
P. furiosus
(c)
C. subterranum
(d)
T. volcanium
(e)
H. butylicus
(f)
M. vulcanius
17
R
CRISPR
115 93
cas6 cmr2 cmr3 csx1 cmr5 cas8 cas7 cas5 cas3 cas4 cas1 cas2
csx1
csx1
R R R R R R R
csx1
R
cmr5
cas6
R
csm1
higher in Sulfolobus during stationary phase when the
cells are more vulnerable to viral attack [16,28]. Patterns of
archaeal crRNAs are often complex, extending over the
approximate size range 35–60 nt, and this probably reflects
the diversity of CRISPR systems present [28,35]. To date,
all the characterized crRNAs carry an 8 nt repeat sequence
at the 5 0 end. Larger crRNAs implicated in DNA targeting
in vivo are 60–65 nt in length and carry partial repeat
sequences at each end, whereas smaller crRNAs which can
target RNA in vitro are 37–45 nt in length and lack repeat
and partial spacer sequences at the 3 0 end [20–22]. Processing
at the 3 0 end of these RNAs is performed by an
unknown enzyme [21,22]. Processing within repeats in
Streptococcus pyrogenes is effected by a trans-encoded
RNA and host-encoded RNase III [36]. This type II
CRISPR/Cas system does not occur in archaea [15] where
the cellular functions of RNase III appear to be performed
by a general intron-splicing enzyme with a different substrate
specificity [37].
In most studies archaeal CRISPR loci are constitutively
expressed and processed into mature crRNAs in the absence
of invading DNA elements, but it remains unclear
whether the CRISPR systems require further activation
[16,21]. Bacterial studies have revealed diverse CRISPR
regulatory mechanisms which can be activated on viral
infection producing elevated expression [38,39].
DNA interference
Independent lines of evidence support that DNA is the
primary target for most CRISPR systems. Putative protospacer
sequences are essentially distributed randomly on
R
csm1
csm2
R
R R R
R R
csx1 csm1 csm2
csx1
cas2 t.r. t.r.
csa1 cas1 cas4
CRISPR
csa5 cas7 cas5 cas3'
R
cmr2
R
csx1 cas1cas2
cmr3
19
42
cas2
t.r.
cas4 cas1 cas6
18
Key:
9
archaeal virus and plasmid DNA with no significant bias of
matching crRNAs to either genes relative to intergenic
regions or to coding versus non-coding strands [26,28].
Moreover, genetic studies on different Sulfolobus species
have provided strong evidence for DNA targeting in vivo,
presumably involving iCas rather than iCmr modules
[35,40]. For bacteria, experimental evidence for DNA targeting
in vivo was provided for the CRISPR/Csm system of
Staphylococcus epidermidis [41] (equivalent to Figure 2d),
the CRISPR/Csn (bacterial type II) system of S. thermophilus
[25] and for the CRISPR/Cas system of Escherichia
coli [20], although none of these studies precluded additional
RNA targeting.
A large protein complex, containing multiple protein
components, was first characterized for an E. coli CRISPR/
Cas system that participates in crRNA maturation and
that facilitates annealing of the crRNA to the DNA target,
but not cleavage [41]. It generates a seahorse form and is
defined as a CASCADE complex (Box 1). A related structure
is produced for a S. solfataricus CRISPR/Cas system
made up of only Cas5e and multiple copies of Cas7, and
which appears to be involved primarily in DNA targeting
[42]. This is therefore likely to be a universal structure, at
least for iCas targeting systems.
Studies on S. thermophilus demonstrated that effective
interference requires perfect matches between crRNA and
protospacers [19]. However, recent work on Sulfolobus species
has demonstrated that three or more mismatches located
near the centre of the protospacer or at the distal end from
the PAM motif do not prevent interference [35,40]. Moreover,
a systematic study of the E. coli CRISPR/Cas system
22
csa5 cas7
aCas
iCas
pCas
iCsm or iCmr
cas3" csaX cas6
csaXa
cas5 csaXb cas3' cas3"
CRISPR / no. of repeats
TRENDS in Microbiology
Figure 2. Representative gene maps of six main classes of archaeal CRISPR systems. (a) CRISPR/aCas-pCas-iCas, common in archaea; in this example those of S. islandicus
are shown. (b) CRISPR/aCas-pCas-iCas-iCmr; studied experimentally in P. furiosus. (c) CRISPR/aCas-pCas-iCas-iCsm; from Caldiarchaeum subterranum. (d) CRISPR/aCasiCsm;
shown for Thermoplasma volcanium. (e) iCmr from Hyperthermus butylicus. (f) iCsm from Methanocaldococcus vulcanius. Genes encoding the functional domains
are color-coded: aCas module, light blue; pCas gene, orange; iCas module, yellow; iCsm and iCmr modules, red. t.r. genes in green encode putative transcriptional regulator
genes that are not considered to be part of the functional modules. R indicates proteins carrying RNA-recognition motifs (RAMPs). (a) belongs to the type I CRISPR system;
(b) and (c) are mixtures of type I and type III, whereas (d–f) are classified as type III [15].
552

Review Trends in Microbiology November 2011, Vol. 19, No. 11
has shown that only six of the seven nucleotides of the
targeted protospacer strand proximal to the PAM motif
must match the crRNA perfectly, and this was proposed
to act as a recognition site, or seed, for the interference
reaction [43]. Whether this is a general property of the
CRISPR DNA targeting systems remains to be determined.
RNA interference
In the CRISPR/Cmr system of P. furiosus (Figure 2b), a
complex of Cmr proteins encompassing a small crRNA,
lacking the 3 0 end of the spacer sequence, targets and
cleaves complementary single-stranded RNA (ssRNA) in
vitro [24]. To date there is no evidence for or against in vivo
RNA targeting, and it is too early to establish whether
mRNAs, non-coding RNAs (ncRNAs), and/or RNA viruses
can be targets. Nevertheless, iCmr modules are common in
archaea and are encoded either together with aCas modules
and CRISPR loci or as separate genetic entities
(Figure 2c,e). Paradoxically, some Cmr proteins show significant
sequence similarity to Csm proteins implicated in
DNA targeting in S. epidermidis [41], and both are common
in archaea. A phylogenetic tree of archaeal Cmr2 (Cas10)
homologs shows five main subfamilies, four of which represent
iCmr and iCsm modules (Figure 3) [12,44]. The fifth
subfamily, A (represented by Csx11), is present in a few
bacteria and methanoarchaea but has not been studied
experimentally, and is therefore not considered further.
Other components of iCmr and iCsm modules include the
small conserved Cmr5/Csm2 protein and three to seven
copies of highly diverse RNA binding motif-containing
proteins (RAMP proteins denoted R in Figure 2)
[12,14,44]. In summary, the degree of cofunctionality of
Euryarchaea
(c)
Archaeaspecific
Cmr2
(d)
Crenarchaea
bias
(b)
Csm1
(e)
10%
(a)
Csx11
Euryarchaea
Euryarchaea
bias
TRENDS in Microbiology
Figure 3. Phylogenetic tree of the archaeal Cas10 subtypes Cmr2, Csm1 and Csx11.
These are the largest and most conserved sub components of the interference
modules of type III CRISPR systems, where the iCmr module has been implicated
in RNA targeting [23] and the iCsm system in DNA targeting [41]. The deep
branching reflects the very divergent sequences. Analysis of the five subfamilies
A–E indicates strong biases in their distributions among crenarchaea and
euryarchaea, and family D is archaea-specific and is present in crenarchaea,
euryarchaea and unclassified archaea. The Figure is reproduced with permission
from [44]. 10% indicates the amount of amino acid sequence change for the given
length on the tree branches.
the partly homologous iCmr and iCsm modules remains
unclear.
Module exchange
Attempts to classify archaeal CRISPR/Cas systems of the
Sulfolobales on the basis of the cas1, leader and repeat
sequences provided evidence for four families that were
conserved in gene content and synteny and they appeared
to constitute integral genetic units [16,26]. However, more
detailed phylogenetic analysis of the aCas and iCas genes
of family I CRISPR/Cas systems of different Sulfolobus
islandicus strains (Figure 2a) revealed that the aCas tree
diverges from the iCas tree as well as from trees generated
from all the concatenated genes of each host genome,
consistent with exchange of aCas modules having occurred
[17]. The results of this analysis are illustrated in
Figure 4a for two divergent pairs of CRISPR/Cas systems
from four selected S. islandicus strains [17]. For each
similar pair the concatenated homologous Cas proteins
showed about 99% amino acid sequence identity. However,
when the protein sequences of the two pairs were compared
whereas the iCas modules maintained their high sequence
identity (99%), the aCas identity was reduced to 74%
(Figure 4a), consistent with the aCas module having been
exchanged [17]. Using the same approach, similar
CRISPR/Cas systems of two divergent pairs of strains of
the thermoneutrophile Pyrobaculum were compared. All
the concatenated homologous Cas protein components of
each similar pair showed 70% amino acid sequence identity.
However, when the two pairs were compared aCas
(a) aCas exchange (S. islandicus)
Group 1
vs
Group 2
(b)
Group 1
vs
Group 2
cas2 t.r.
csa1 cas1 cas4
74%
70%
C
C
90%
aCas iCas
iCas exchange (Pyrobaculum sp.)
cas2
cas4 cas1 csa1
t.r.
csa5 cas7 cas5 cas3'
csa5
t.r. cas7 cas5 n.d.
n.d. cas7 cas5
28%
cas3" csaX cas6
cas3' cas3"
cas3' cas3" n.d.
TRENDS in Microbiology
Figure 4. Examples of genetic exchange of functional modules where amino acid
sequences from shared genes in each functional module are compared [17]. (a)
Comparison of the aCas and iCas modules for type I CRISPR/Cas systems of four
closely related S. islandicus strains. Pairwise they show a high sequence identity of
99% for two modules, but when the two pairs are compared the combined iCas
proteins remain almost identical in sequence, whereas the aCas modules show
only 74% sequence similarity between the pairs, consistent with the aCas module
having been exchanged for one of the group of strains [17]. (b) A similar study was
performed for shared genes of four thermoneutrophilic Pyrobaculum strains,
where two pairs each show similar levels of amino acid sequence similarity for
their aCas and iCas modules (about 70%), but when the two pairs are compared the
aCas sequences remain constant at about 70% whereas the iCas module yields
only 28% similarity – indicative of the iCas modules having been exchanged. Gene
contents of the two pairs of iCas modules also indicate that they belong to different
subtypes. Gene modules are color-coded as in Figure 2. Abbreviations: C, CRISPR
locus; t.r., transcriptional regulator (in green); n.d., gene identity not determined.
553

Review Trends in Microbiology November 2011, Vol. 19, No. 11
protein sequence identity remained at 70%, but a much
lower value of 28% was observed for the iCas proteins,
indicative of exchange of the latter (Figure 4b).
Constraints on modular exchange
Specific interactions with the repeat sequence, either at
the DNA or RNA level, are crucial for the function of the
aCas, pCas and interference modules, and the capacity of
some protein components to interact specifically with the
repeat sequence might be a major constraint on modular
exchange. Integration of new spacers thus probably
depends on Cas protein recognition of the first repeat
and adjoining leader region [16,19]. Cas6 associates specifically
with, and cleaves, the repeat during processing
[20,22] and is sometimes cofunctional with different interference
modules. The iCas complex recognizes repeat sequence
elements at the ends of crRNA for DNA targeting,
and the iCmr complex binds to the repeat sequence at the 5 0
end of crRNAs targeting RNA [23,45,42]. The small PAM
motif also differs in sequence for different CRISPR/Cas
systems, and the motif is likely to be important for protospacer
selection, for determining its orientation on insertion
in CRISPR loci [16,19,31] and, at some level, to be
important for DNA targeting [19,35,46]. Moreover, the
length of the crRNA spacer sequence may influence the
targeting and cleavage by the iCas module [42]. Taken
together, there appear to be multiple sequence and structural
constraints on modular exchange that are likely to be
offset partly by the relatively conserved sequence at the
leader-distal end of repeats. In support, putative examples
of modular exchange, including those shown in Figure 4,
exhibit fairly conserved repeat sequences, spacer sizes and
predicted PAM motifs. These examples also show that on
modular exchange the repeat invariably follows the aCas
and not the iCas modules [17].
Natural dynamics of CRISPR loci
Changes can occur in CRISPR loci by a variety of mechanisms
without compromising their overall viability. New
spacer-repeat units are added, intermittently, at or near
the repeat adjacent to the leader [16,19,28,29]. Moreover,
comparative analyses of closely related archaeal species
support: (i) the occurrence of large indels, generally deletions;
(ii) duplication of sets of spacer-repeat units, and (iii)
intracellular exchange of spacer-repeat units between
CRISPR loci [12,16,28]. Changes can also be induced in
CRISPR loci by invading genetic elements carrying, for
example, essential metabolic genes or, possibly, toxin–
antitoxin maintenance systems [35,47]. Such changes were
demonstrated by challenging CRISPR loci of different
Sulfolobus species with plasmids carrying matching protospacers
and appropriate PAM motifs maintained under
selection [35]. This resulted in loss of either CRISPR
regions containing matching spacers or complete
CRISPR/Cas systems. In S. islandicus, 50% of viable
transformants had specifically lost the matching spacerrepeat
unit, suggesting that feedback and interference of
matching spacers might occur rarely, followed by recombinational
repair via adjacent repeats or by slippage occurring
during DNA replication [35]. Furthermore, some
challenged spacers of S. solfataricus were inactivated by
554
the direct insertion of insertion sequence (IS) elements
[35]. Bioinformatic analyses have also provided support for
spacers being inactivated by mutation of the bordering
repeats, and this could generate defective crRNAs [48].
Thus the integrity of CRISPR loci can be compromised by
many different mechanisms.
Anti-CRISPR mechanisms and defective CRISPR/Cas
and Cmr modules
Specific ways in which archaeal viruses and plasmids
might circumvent CRISPR systems remain speculative,
including the observation that genomes of crenarchaeal
rudiviruses and lipothrixviruses accrue 12 bp indels, probably
deletions, when passed through different hosts [49].
However, given the complexity of many archaeal CRISPR
systems, they are also vulnerable to mutation, rearrangements
or transposition events [30,50]. The multiple transcriptional
regulators present in many archaeal CRISPR
systems (Figures 2 and 4) are obvious targets. For example,
in an S. islandicus strain the putative provirus M164 is
integrated into the gene for Csa3, the putative transcriptional
regulator of the aCas gene cassette, but apparently
leaves the pCas and iCas modules unaffected [12,17].
Moreover, bacteriophage EPV1 characterized in a metagenomics
study encodes the proteobacterial transcriptional
repressor H-NS [51] that can inactivate the entire E. coli
CRISPR system [38]. Many archaeal systems lack core
genes, and CRISPR loci sometimes lack leaders
[16,30,50]. It remains unclear whether these defective
modules can be complemented by Cas proteins of another
module of a similar type within a given organism. S.
solfataricus strains P1 and P2 carry a CRISPR locus E
lacking an aCas module that is not complemented by aCas
proteins associated with the phylogenetically similar
CRISPR loci C and D, but this could reflect sequence
differences in the leaders [16]. There might also be advantages,
at least temporarily, in maintaining cofunctional
processing and interference modules despite defective adaptation
[26,28].
Genomic mobility
Comparative studies of the Sulfolobales indicated that
CRISPR systems are invariably located in genomic regions
variable in gene content and often rich in transposable
elements [44,52]. Furthermore, nine genomes of closely
related S. islandicus strains from different geographical
locations carried two to four apparently viable combinations
of different subfamilies of both CRISPR/Cas, and
independent iCmr and iCsm modules, indicative of their
having been transferred between strains [44]. Strong evidence
for specific intergenomic transfer of CRISPR loci
carried on larger chromosomal fragments is available for
Pyrococcus and Sulfolobus strains [12,53] and for lactic
acid bacteria [50]. Whether such exchange is common for
all archaea remains unclear because for strains of S.
solfataricus, more distantly related than those of S. islandicus,
CRISPR/Cas systems have been largely retained
and share many identical spacer sequences [12,16].
Given the potential for mobility of CRISPR systems, it
was speculated that toxin–antitoxin systems, encoded near
CRISPR loci, could help to stabilize the CRISPR genetic

Review Trends in Microbiology November 2011, Vol. 19, No. 11
vapBC vapBC
53 13 9
systems within chromosomes [52]. An extreme example of
this occurs in Acidianus hospitalis, a slowly growing organism
carrying 26 vapBC antitoxin–toxin gene pairs, four
of which are interwoven with the CRISPR/Cas/Csm system
(Figure 5) and the fifth is associated with a separate
CRISPR/Cas system [52]. The absence of any encoded
VapB or VapC proteins with similar sequences in this
organism is essential for the proposed capacity to maintain
a CRISPR/Cas system when loss of the DNA region could
lead to VapC-induced cell death [52].
Interdomain mobility
Genetic exchange between archaea and bacteria is restricted
by many factors, including basic incompatibility of their
virus–host interactions and radically different conjugative
mechanisms [4,6,54]. Moreover, even after successful DNA
exchange, basic differences in the mechanisms of transcriptional
initiation and termination, and of translational
initiation, would present formidable barriers to viable gene
expression [55,56]. Furthermore, as argued above, many
archaea have adapted to extreme low-energy environments
where levels of bacterial cells are low or nonexistent.
In an attempt to interpret the extent to which interdomain
exchange has influenced the evolution of archaeal CRISPR
systems, Markov clustering algorithm (MCL) techniques
based on Cas1 sequences were used to compare phylogenetically
the CRISPR/Cas systems of archaea and bacteria.
The results support the absence of type II CRISPR/Cas
systems in archaea and revealed clusters specific to, or
strongly biased to, archaea or bacteria, with one cluster
carrying multiple archaeal, predominantly methanoarchaeal,
and bacterial members [17,18,57]. Qualitatively, the
analysis suggests that interdomain exchange of aCas modules
occurs rarely and then predominantly in environments
where archaea and bacteria are both abundant.
There is limited evidence for homologous CRISPR-like
mechanisms operating in eukaryotes. The RNA-targeting
CRISPR/Cmr system shows some mechanistic similarity to
RNAi, the viral RNA interference system of eukarya
[14,23]. Moreover, DNA-targeting CRISPR/Cas systems,
in general, share features of the Piwi/Argonaute-interacting
(piRNA) system where RNA-encoding DNA accumulates
passively in a small number of chromosomal loci.
Transcripts from these loci are processed into small
ssRNAs that complex with Piwi/Argonaute proteins and
can inhibit DNA transposition activity [10,16,31]. Although
early in evolution there may have been limited
coevolution of these interference systems for all three
domains, the archaeal and bacterial systems have clearly
coevolved and interchanged to a significant degree, with
the exception of the type II CRISPR/Cas system dependent
on the bacteria-specific RNase III enzyme for processing
[36].
cas4 csx1 vapBC iCsm
csa1 vapBC cas2 cas1 cas6
TRENDS in Microbiology
Figure 5. A type III CRISPR system of the acidothermophile A. hospitalis carrying four interwoven antitoxin–toxin vapBC gene pairs that are highly divergent in sequence
[52]. Functional module genes are color-coded as in Figure 2, and include genes of unknown function (grey). Numbers of repeats are indicated for each CRISPR locus.
Concluding remarks
One of the puzzles concerning archaeal CRISPR systems is
why they are so diverse and complex. There are often
multiple CRISPR loci within a given archaeon carrying
hundreds of unique spacer sequences with multiple significant
spacer matches to a given type of virus or conjugative
plasmid [26,28,30,44]. Possibly the diversity and complexity
reflects the large variety of different virus families
characterized for extreme thermophiles, and to a lesser
extent haloarchaea [4–6]. Another possibility is that, given
their modular structures, and the diversity of their putative
transcriptional regulators, the CRISPR systems may
not necessarily eliminate genetic elements. For example,
the immune systems might only be activated when replication
or transcription of genetic elements reaches a certain
level, consistent with many viruses being stably
maintained at low copy-numbers within cells [4–6].
In addition to determining the detailed mechanistic roles
of most of the core proteins, many uncharacterized CRISPRrelated
proteins remain, some which are archaea-specific
and that are commonly associated with interference modules
(Figure 4a), and these might generate diversity in
targeting or cleavage mechanisms. Some unclassified
CRISPR-related proteins are likely to have secondary roles,
as suggested for the antitoxin–toxin system of A. hospitalis
helping to stabilize CRISPR/Cas systems on chromosomes
[52]. Function(s) of the iCmr and iCsm modules need to be
examined more extensively in vivo to establish whether
RNA viruses and/or transcripts of DNA viruses are targeted.
Targeting of transcripts could be a means of regulating and
stabilizing DNA viruses in vivo. At least for Sulfolobus
species, robust genetic systems are now available to resolve
these questions [35,40]. Questions remain as to whether
crRNAs are selected for DNA or RNA targeting or whether
any spacer RNA potentially can be used for either system,
and to what extent Cas6 proteins are interchangeable between
the different interference systems within a given
organism [42]. Another pressing question is the extent to
which defective functional modules are complemented by
components of other CRISPR systems; a high priority will be
to experimentally test a broad range of phylogenetically
diverse CRISPR systems to establish the extent of their
structural and functional diversity.
Acknowledgments
We thank Luciano Marraffini, Mark Young, Qunxin She and Malcolm
White for helpful discussions and the referees for their constructive input.
Research was supported by the Danish Natural Science Research
Council.
References
1 Gribaldo, S. et al. (2010) The origin of eukaryotes and their relationship
with the Archaea: are we at a phylogenomic impasse? Nat. Rev.
Microbiol. 8, 743–752
555

Review Trends in Microbiology November 2011, Vol. 19, No. 11
2 Kurland, C.G. et al. (2006) Genomics and the irreducible nature of
eukaryotic cells. Science 312, 1011–1014
3 Valentine, D.L. (2007) Adaptations to energy stress dictate the ecology
and evolution of archaea. Nat. Rev. Microbiol. 5, 316–323
4 Prangishvili, D. et al. (2006) Viruses of the Archaea: a unifying view.
Nat. Rev. Microbiol. 11, 837–848
5 Porter, K. et al. (2007) Virus–host interactions in salt lakes. Curr. Opin.
Microbiol. 10, 418–424
6 Lawrence, C.M. et al. (2009) Structural and functional studies of
archaeal viruses. J. Biol. Chem. 284, 12599–12603
7 Snyder, J.C. et al. (2010) Use of cellular CRISPR (clusters of regularly
interspaced short palindromic repeats) spacer-based microarrays for
detection of viruses in environmental samples. Appl. Environ.
Microbiol. 76, 7251–7258
8 Brumfield, S.K. et al. (2009) Particle assembly and ultrastructural
features associated with replication of the lytic archaeal virus
Sulfolobus turreted icosahedral virus. J. Virol. 83, 5964–5970
9 Bize, A. et al. (2009) A unique virus release mechanism in the archaea.
Proc. Natl. Acad. Sci. U.S.A. 106, 11306–11311
10 Karginov, F.V. and Hannon, G.J. (2010) The CRISPR system: small
RNA-guided defense in bacteria and archaea. Mol. Cell 37, 7–19
11 Terns, M.P. and Terns, R.M. (2011) CRISPR-based adaptive immune
systems. Curr. Opin. Microbiol. 14, 1–7
12 Garrett, R.A. et al. (2011) CRISPR-based immune systems of the
Sulfolobales: complexity and diversity. Biochem. Soc. Trans. 39, 51–57
13 Prangishvili, D. et al. (1998) Conjugation in archaea: frequent occurrence
of conjugative plasmids in Sulfolobus. Plasmid 40, 190–202
14 Makarova, K.S. et al. (2006) A putative RNA-interference-based immune
system in prokaryotes: computational analysis of the predicted
enzymatic machinery, functional analogies with eukaryotic RNAi, and
hypothetical mechanisms of action. Biol. Direct 1, 7
15 Makarova, K.S. et al. (2011) Evolution and classification of the
CRISPR-Cas systems. Nat. Rev. Microbiol. 9, 467–477
16 Lillestøl, R.K. et al. (2009) CRISPR families of the crenarchaeal genus
Sulfolobus: bidirectional transcription and dynamic properties. Mol.
Microbiol. 72, 259–272
17 Shah, S.A. and Garrett, R.A. (2011) CRISPR/Cas and Cmr modules,
mobility and evolution of adaptive immune systems. Res. Microbiol.
162, 27–38
18 Shah, S.A. et al. (2011) CRISPR/Cas and CRISPR/Cmr immune
systems of archaea. In Regulatory RNAs in Prokaryotes
(Marchfelder, A. and Hess, W., eds), pp. 163–181, Springer Press
19 Deveau, H. et al. (2008) Phage response to CRISPR-encoded resistance
in Streptococcus thermophilus. J. Bacteriol. 190, 1390–1400
20 Brouns, S.J. et al. (2008) Small CRISPR RNAs guide antiviral defense
in prokaryotes. Science 321, 960–964
21 Hale, C. et al. (2008) Prokaryotic silencing (psi)RNAs in Pyrococcus
furiosus. RNA 14, 1–8
22 Carte, J. et al. (2010) Binding and cleavage of CRISPR RNA by Cas6.
RNA 16, 2181–2188
23 Hale, C.R. et al. (2009) RNA-guided RNA cleavage by a CRISPR RNA–
Cas protein complex. Cell 139, 945–956
24 Wang, R. et al. (2011) Interaction of Cas6 riboendonuclease with
CRISPR RNAs: recognition and cleavage. Structure 19, 257–264
25 Garneau, J.E. et al. (2010) The CRISPR/Cas bacterial immune system
cleaves bacteriophage and plasmid DNA. Nature 468, 67–71
26 Shah,S.A.etal.(2009)DistributionsofCRISPRspacermatchesinviruses
and plasmids of crenarchaeal acidothermophiles and implications for
their inhibitory mechanism. Biochem. Soc. Trans. 37, 23–28
27 Barrangou, R. et al. (2007) CRISPR provides acquired resistance
against viruses in prokaryotes. Science 315, 1709–1712
28 Lillestøl, R.K. et al. (2006) A putative viral defence mechanism in
archaeal cells. Archaea 2, 59–72
29 Held, N.L. et al. (2010) CRISPR associated diversity within a
population of Sulfolobus islandicus. PLoS ONE 5, e12988
30 Andersson, A.F. and Banfield, J.F. (2008) Virus population dynamics
and acquired resistance in natural microbial communities. Science 320,
1047–1049
31 Mojica, F.J. et al. (2009) Short motif sequences determine the targets of
the prokaryotic CRISPR system. Microbiology 155, 733–740
32 Tang, T-H. et al. (2002) Identification of 86 candidates for small nonmessenger
RNAs from the archaeon Archaeoglobus fulgidus. Proc.
Natl. Acad. Sci. U.S.A. 99, 7536–7541
556
33 Haurwitz, R.E. et al. (2010) Sequence and structure-specific RNA
processing by a CRISPR endonuclease. Science 10, 1355–1358
34 Tang, T-H. et al. (2005) Identification of novel non-coding RNAs as
potential antisense regulators in the archaeon Sulfolobus solfataricus.
Mol. Microbiol. 55, 469–481
35 Gudbergsdottir, S. et al. (2011) Dynamic properties of the Sulfolobus
CRISPR/Cas and CRISPR/Cmr systems when challenged with vectorborne
viral and plasmid genes and protospacers. Mol. Microbiol. 7, 35–49
36 Deltcheva, E. et al. (2011) CRISPR RNA maturation by trans-encoded
small RNA and host factor RNase III. Nature 471, 602–607
37 Lykke-Andersen, J. et al. (1997) Archaeal introns: splicing,
intercellular mobility and evolution. Trends Biochem. Sci. 22, 326–331
38 Pul, U. et al. (2010) Identification and characterisation of E. coli
CRISPR-cas promoters and their silencing by H-NS. Mol. Microbiol.
75, 1495–1512
39 Agari, Y. et al. (2011) Transcription profile of Thermus thermophilus
CRISPR systems after phage infection. J. Mol. Biol. 395, 270–281
40 Manica, A. et al. (2011) In vitro activity of CRISPR-mediated virus
defence in a hyperthermophilic archaeon. Mol. Microbiol. 80, 481–491
41 Marraffini, L.A. and Sontheimer, E.J. (2008) CRISPR interference
limits horizontal gene transfer in Staphylococci by targeting DNA.
Science 322, 1843–1845
42 Lindtner, N.G. et al. (2011) Structural and functional characterisation
of an archaeal CASCADE complex for CRISPR-mediated viral defense.
J. Biol. Chem. 85, 6287–6292
43 Semenova, E. et al. (2011) Interference by clustered regularly
interspaced short palindromic repeat (CRISPR) RNA is governed by
a seed sequence. Proc. Natl. Acad. Sci. U.S.A. 108, 10098–10103
44 Guo, L. et al. (2011) Genome analyses of Icelandic strains of Sulfolobus
islandicus, model organisms for genetic and virus–host interaction
studies. J. Bacteriol. 193, 1672–1680
45 Jore, M.M. et al. (2011) Structural basis of CRISPR-guided RNA
recognition. Nat. Struct. Mol. Biol. 18, 529–537
46 Marraffini, L.A. and Sontheimer, E.J. (2010) Self versus non-self
discrimination during CRISPR RNA-directed immunity. Nature 463,
568–571
47 Dyall-Smith, M. (2011) Dangerous weapons: a cautionary tale of
CRISPR defence. Mol. Microbiol. 79, 3–6
48 Stern, A. et al. (2010) Self-targeting by CRISPR: gene regulation or
autioimmunity? Trends Genet. 26, 335–340
49 Vestergaard, G. et al. (2008) SRV, a new rudiviral isolate from
Stygiolobus and the interplay of crenarchaeal rudiviruses with the
host viral-defence CRISPR system. J. Bacteriol. 190, 6837–6845
50 Horvath et al. (2009) Comparative analysis of CRISPR loci in lactic acid
bacteria genomes. Int. J. Food Microbiol. 131, 62–70
51 Skennerton, C.T. et al. (2011) Phage encoded H-NS: a potential achilles
heel in the bacterial defence system. PLoS ONE 6, e20095
52 You, X-Y. et al. (2011) Genomic studies of Acidianus hospitalis W1 a
crenarchaeal host for studying virus and plasmid life cycles.
Extremophiles 15, 487–497
53 Portillo, M.C. and Gonzalez, J.M. (2009) CRISPR elements in the
Thermococcales: evidence for associated horizontal gene transfer in
Pyrococcus furiosus. J. Appl. Genet. 50, 421–430
54 Greve et al. (2004) Genomic comparison of archaeal conjugative
plasmids from Sulfolobus. Archaea 1, 231–239
55 Torarinsson, E. et al. (2005) Divergent transcriptional and
translational signals in Archaea. Environ. Microbiol. 7, 47–54
56 Santangelo, T.J. et al. (2009) Archaeal intrinsic transcription
termination in vivo. J. Bacteriol. 191, 7102–7108
57 Haft, D.H. et al. (2005) A guild of 45 CRISPR-associated (Cas) protein
families and multiple CRISPR/Cas subtypes exist in prokaryotic
genomes. PLoS Comput. Biol. 1, 474–483
58 Kunin, V. et al. (2007) Evolutionary conservation of sequence and
secondary structures in CRISPR repeats. Genome Biol. 8, R611–R617
59 Wiedenheft, B. et al. (2009) Structural base for DNase activity of a
conserved protein implicated in CRISPR-mediated genome defense.
Structure 17, 904–912
60 Beloglazova, N. et al. (2008) A novel family of sequence-specific
endoribonucleases associated with clustered regularly interspaced
short palindromic repeats. J. Biol. Chem. 283, 20361–20371
61 Sinkunas, T. et al. (2011) Cas3 is a single-stranded DNA nuclease and
ATP-dependent helicase in the CRISPR/Cas immune system. EMBO J.
30, 1335–1342

Chapter 10
CRISPR/Cas and CRISPR/Cmr Immune
Systems of Archaea
Shiraz A. Shah, Gisle Vestergaard and Roger A. Garrett*
1 Introduction
The CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats/
CRISPR-Associated Genes) and CRISPR/Cmr systems (Cmr: Cas module-RAMP
(Repeat-Associated Mysterious Proteins)) provide the basis for adaptive and hereditable
immune responses directed against the DNA and RNA, respectively, of invading
elements. The former consists of CRISPR loci physically linked to a cassette of
cas genes which together appear to constitute integral genetic modules. cmr genes,
clustered in Cmr modules, are sometimes physically linked to CRISPR/Cas modules.
The CRISPR/Cas immune system occurs in almost all archaea and about 40 %
of bacteria. Cmr modules are less common, occurring in only about one third of
genomes carrying CRISPR/Cas modules. An outline of how the CRISPR/Cas and
CRISPR/Cmr systems function is indicated in Figure 1 where the former targets
DNA and the latter RNA (mRNA and/or viral RNA) of the genetic elements.
Archaeal CRISPR loci consist of clusters of spacer-repeat units varying in size
from one to more than one hundred spacer-repeat units where each unit is about
60 – 90 bp with repeats and spacers of, on average, 30 bp and 40 bp, respectively
(Lillestøl et al., 2006; Grissa et al., 2008). CRISPR loci are preceded by a non
protein coding leader region which varies in size from about 150 to 550 bp and is
invariably physically linked to a cas gene cassette (Jansen et al., 2002; Haft et al.,
2005; Makarova et al., 2006; Lillestøl et al., 2006; Lillestøl et al., 2009). Cas and
Cmr proteins, involved in the two different targeting pathways, are functionally and
phylogenetically diverse. The CRISPR/Cas system specifically targets DNA elements
(Marraffini and Sontheimer, 2008;; Shah et al., 2009) while the CRISPR/Cmr
system targets RNA, although whether mRNA and/or viral RNA remains unclear
(Hale et al., 2009). CRISPR/Cas modules have been classified into families on the
basis of sequences of their cas genes, leaders and repeats. Although these modules
* Adress
53

54
CRISPR/Cas and CRISPR/Cmr Immune Systems of Archaea
show a capacity for transfer between phyla of the archaeal and bacterial Domains,
and supposedly rarely across Domain boundaries, archaea-specific features are nevertheless
apparent.
Crucial for the functioning of the immune systems are the spacer sequences
which derive from foreign invading elements (Mojica et al., 2005; Pourcel et al.,
2005; Bolotin et al., 2005; Lillestøl et al., 2006; Barrangou et al., 2007). The
CRISPR loci generate whole transcripts which initiate within the leader sequence
adjacent to the first repeat (Lillestøl et al., 2009). These are subsequently processed
in their repeat regions yielding end-products that constitute single spacer-containing
crRNAs (Tang et al., 2002; Tang et al., 2005; Lillestøl et al., 2006; Lillestøl et al.,
2009). Processing is effected by specific Cas or Cmr proteins and, at least for the
leader
virus
new spacer
viral DNA
repeat
viral DNA
Cas-crRNA complex
Cmr-crRNA complex
DNA
excision
Cas complex
cleaved viral DNA
cleaved
viral mRNA
cleaved
viral RNA
Fig. 1. Diagram illustrating how CRISPR/Cas and CRISPR/Cmr systems target genetic elements
invading a host cell. crRNAs are processed from whole transcripts of CRISPR loci.
For the CRISPR/Cas system Cas proteins complex with the crRNA and guide it to the complementary
protospacer sequence in the invading DNA element where they anneal prior to
DNA degradation. Cmr proteins also complex with crRNA and guide them to either mRNA
or viral RNA, targeting them for degradation

Shiraz A. Shah, Gisle Vestergaard and Roger A. Garrett 55
latter, two discrete archaeal crRNAs are produced each carrying 8 nt of the repeat
at the 5’-end and lacking 5 nt or 11 nt from the 3’-end of each spacer (Carte et al.,
2008; Hale et al., 2009). Complexes of Cas or Cmr proteins transport the processed
crRNAs to target, and inactivate, DNA or RNA, respectively, of invading genetic
elements (Brouns et al., 2008; Hale et al., 2008; Carte et al., 2008; Hale et al.,
2009). Base pairing mismatches occurring between the 5’ 8 nt repeat sequence of
the crRNA and the Protospacer-Associated Motif (PAM) sequence adjacent to the
targeted protospacer of the invading DNA are essential for subsequent degradation
of the latter and for ensuring that the chromosomal CRISPR locus, itself, is not
targeted (Horvath and Barrangou, 2010;; Marraffini and Sontheimer, 2010;; Lillestøl
et al., 2009; Gudbergsdottir et al., 2010).
2 Archaeal Viruses and Plasmids
and Chromosomal Evolution
Although few comprehensive studies have been performed on the relative abundance
of different virus-like particle (VLP) morphotypes in archaea-rich environments,
available results indicate that spindles, filaments, rods and spheres predominate
in terrestial hot springs and hydrothermal vents, while spindle-shaped and
spherical virus-like particles (VLPs) prevail in hypersaline environments (Rachel
et al., 2002; Porter et al., 2007; Bize et al., 2008). Bacteriophage-like head-tail
VLPs are found infrequently, although their proviruses have been detected in a few
halo- and methanoarchaeal genomes (Porter et al., 2007; Krupovic et al., 2010).
Several viruses, mainly from terrestial hot springs have been classified into eight
new viral archaeal families and examples of their diverse morphotypes are illustrated
in Figure 2. Other viruses including several haloarchaeal viruses remain to be
classified (Porter et al., 2007). The latter process is complicated by the absence of
a consistent relationship between morphology and genomic properties for euryarchaeal
and crenarchaeal viruses. Overall these discoveries underline the major differences
between the archaeal and bacterial virospheres (Prangishvili et al., 2006a;
Lawrence et al., 2009).
Archaeal viral genomes fall in the size range 15 to 75 kb dsDNA and are circular
or linear. Some linear genomes have free ends whereas others, including those of
rudiviruses and some lipothrixviruses have modified ends or are covalently closed
and some genomes carry base-specific modifications (Zillig et al., 1998;; Peng et al.,
2001). Consistent with the unusual and sometimes unique viral morphologies (Figure
2), the viral genomes yielded very few significant sequence matches with genes
in public sequence databases (Prangishvili et al., 2006b). These results are summarised
in histograms of the major hyperthermophilic crenarchaeal viruses in Figure
3 where a large percentage of the genes are classified as unique for each virus.
The most extreme case was for genes of the thermoneutrophilic virus PSV which
yielded almost no significant sequence matches in the original study (Bettstetter
et al., 2003).

56
a b c
e
d
f
h
CRISPR/Cas and CRISPR/Cmr Immune Systems of Archaea
Fig. 2. Typical morphologies of representatives of different families of archaeal viral families.
a, SNDV; b, STSV1; c, ATV; d, SIFV; e, AFV1; f, PSV; g, SSV4; h, ARV1. Bars are
100 nm
With the availability of an increasing number of archaeal genome sequences,
it has become clear that archaeal viruses and plasmids have played a major role
in the evolution of host genomes. This process has apparently been fuelled by the
entrapment of foreign DNA elements in host chromosomes via an archaea-specific
integrative process. Many archaeal integrase genes partition on integration such
that, if the free form of the element is lost, the integrase will not be expressed
and cannot effect excision of the genetic element from the chromosome (She et al.,
2001). Many of the encaptured elements are recognisable as intact or degenerate
genetic entities and Markov-model analyses of whole archaeal genomes suggest
that such genes of viral or plasmid origin contribute disproportionately to the genes
of unknown function in archaeal chromosomes (Cortez et al., 2009).
Archaeal viruses and plasmids have also evolved complex relationships as dependents
or antagonists. Thus, in the presence of a fusellovirus, pRN family plasmids
g

Shiraz A. Shah, Gisle Vestergaard and Roger A. Garrett 57
Fig. 3. Histogram showing a summary of archaeal viral gene homologies to other viruses
(virus only genes) and cellular chromosomes (cellular); unique indicates no detectable homologs.
Homologs in closely related viruses, including the rudiviruses ARV1 and SIRV1 and
the spherical viruses PSV and TTSV1 are not included (Prangishvili et al., 2006b)
pSSVx and pSSVi are packaged into fusellovirus-like particles and spread through
Sulfolobus host cultures as satellite viruses (Arnold et al., 1999; Wang et al., 2007).
In contrast, when a strain of Acidianus hospitalis carrying the conjugative plasmid
pAH1 was infected with the lipothrixvirus AFV1, plasmid replication appeared to
be inhibited (Basta et al., 2009). Moreover, as mentioned below, Sulfolobus conjugative
plasmids pNOB8 and pKEF9 carry CRISPR loci which may directly target
and inactivate archaeal viruses (She et al., 1998; Greve et al., 2004).
3 Diversity of Archaeal CRISPR/Cas and CRISPR/Cmr
Immune Systems
Bioinformatic analyses have demonstrated that homologs of a few core Cas proteins
occur widely throughout the archaeal and bacterial domains while others occur less
commonly and some are predominantly archaeal or bacterial in character. Core
gene sets typify the cas and cmr gene cassettes (Figure 4). For the former, the cas
genes fall into groups 1 and 2. This division is based on different factors including
co-occurrence, co-regulation and synteny of the genes and, possibly, functional differences
for the groups of proteins (see below). The cas6 gene can occur in either
group and is likely to be cofunctional with both CRISPR/Cas and CRISPR/Cmr

58
CRISPR/Cas and CRISPR/Cmr Immune Systems of Archaea
systems (Hale et al., 2009). For the cmr cassette, the two most conserved genes
cmr2 and cmr5 are interspersed with diverse RAMP-motif containing proteins
(Figure 4B).
It has also been shown that there is a consistent phylogenetic linkage between
sequences of selected Cas proteins and CRISPR locus repeats for archaea and
bacteria (Haft et al., 2005; Makarova et al., 2006; Kunin et al., 2007; Shah et al.,
2009). Furthermore for the Sulfolobales, a broader analysis of sequences of repeats,
leader regions, and of Cas1 proteins, demonstrated that the CRISPR/Cas modules
could be classified into distinct CRISPR/Cas families I to IV (Lillestøl et al., 2009;;
Shah and Garrett, 2010) which are components of an earlier more broadly defined
group of families CASS1 + 5 + 6 + 7 from archaea and bacteria (Haft et al., 2005;
Makarova et al., 2006). Spatial distributions of all the archaeal and bacterial families
are illustrated in Figure 5A using a Markov clustering approach based on Cas1
protein sequences. Whereas the crenarchaeal families I, II and III tend to cluster
separately, the archaeal family IV sequences, which derive mainly from mesophilic
euryarchaea, fall together with a family of bacterial sequences (in green). A closely
similar spatial distribution is also observed when crenarchaeal families I to IV are
Fig. 4. Gene maps of A. cas cassettes and B. a Cmr module showing only conserved core
genes. Many other genes that occur less frequently are not included. The cas genes are divided
into two groups 1 and 2 (see text). The Cmr module contains the highly conserved
cmr2 and cmr5 genes and genes a to e, shaded grey, which correspond to different genes
encoding RAMP motif-containing proteins which are present in 3 to 5 copies in the different
Cmr module families (Garrett et al., 2010b)
► Fig. 5. CRISPR/Cas modules can be divided into families based on their unique characteristics,
including the Cas1 protein sequence and nucleotide sequences of the repeat and
leader regions.
a) Spheres represent Cas1 protein sequences from different organisms. Small distances between
spheres reflects higher sequence similarity between them. All Cas1 sequences that are
currently publicly available are represented. Markov clustering reveals that all the sequences
fall within about 20 families (each coloured differently), 5 of which are very large. Strongly
coloured spheres represent archaeal Cas1 sequences while bacterial sequences are shown in
faded colours. It is evident that some families are specific to bacteria, whereas others are
archaea-specific. A few CRISPR/Cas families are shared between both archaea and bacteria.
Sulfolobales families I – IV are marked (Lillestøl et al. 2009) and others remain to be formally
classified. An earlier broader classification, CASS1 to 7, is also included (Haft et al.
2005; Makarova et al. 2006).
b) Leaders from the Sulfolobales are clustered based on their sequence similarities and they
fall into the same group of families (I–IV) as those found for the Cas1 proteins, and a similar
result is obtained when repeat sequences are clustered (Lillestøl et al. 2009)

Shiraz A. Shah, Gisle Vestergaard and Roger A. Garrett 59
clustered on the basis of their leader sequences (Figure 5B). Clearly, there are other
archaea-specific families (strongly coloured in Figure 5A) which remain to be analysed
and classified.
Family I CRISPR/Cas modules are the most common amongst the Sulfolobales
and other crenarchaea, and the most conserved in structural organisation. The two
conserved groups of cas genes are located between the leaders and externally at
one end of the module. The separation may be functionally significant with the former
involved in processing and insertion of DNA spacer-repeat units and the latter
encoding RNA processing and effector proteins (Shah and Garrett, 2010).
a
b

60
CRISPR/Cas and CRISPR/Cmr Immune Systems of Archaea
The methanoarchaea and haloarchaea, which carry the majority of the family
IV CRISPR/Cas modules show the least conservation in their cas gene contents. In
particular, their group 2 cas genes range from those typical of crenarchaea to those
common amongst bacteria. Putative genetic exchange between archaea and bacteria
has generally been attributed to the methanoarchaea and haloarchaea thriving in
environments rich in bacteria.
Cmr modules invariably coexist with, and are sometimes physically linked to,
CRISPR/Cas modules but they occur less widely than the latter. For archaea they
are found in about 70 % of genomes carrying CRISPR/Cas modules, more prevalent
than for CRISPR/Cas carrying bacterial genomes (about 30 %). Both CRISPR/Cas
modules and Cmr modules frequently occur in multiple copies in a given archaeal
genome. cmr genes are mainly co-transcribed and their protein products have been
implicated in processing of crRNAs and in the guiding of crRNAs to target RNA of
invading genetic elements, whether viral RNA, transcripts, or both, remains unclear
(Hale et al., 2009).
Comparison of phylogenetic trees for the CRISPR/Cas and Cmr modules, based
on archaeal and bacterial sequences of Cas1 and the Cmr2 protein, and its homologs
Csm1 and Csx11, revealed five major families of Cmr modules, named A to E,
showing distinctive gene syntenies (Garrett et al., 2010b).
Given that Cmr and CRISPR/Cas modules are sometimes physically linked and
can potentially be mobilised as a unit, and that they have to recognise CRISPR
repeat sequences of similar sequence, it is likely that some degree of coevolution
has occurred. In support of this idea, there are many examples of family II CRISPR/
Cas modules coexisting with family D Cmr modules amongst the Sulfolobales and
this relationship extends to other archaea including for example, the euryarchaeon
Methanospirillum hungatei.
Sizes of CRISPR loci vary from a single spacer bordered by repeats to more
than 100 spacer-repeat units (Lillestøl et al., 2006; Grissa et al., 2008). New spacerrepeat
units are added at the leader-repeat junction and the CRISPR loci also
undergo deletions of spacer-repeat units, probably via recombination at the direct
repeats, without impairing the overall CRISPR/Cas functionality, and the deletions
can range from one to several spacer-repeat units. Moreover, there are also putative
examples of duplications of spacer-repeat units, or small groups thereof, occurring
and exchange between CRISPR loci within a genome (Lillestøl et al., 2006; Lillestøl
et al., 2009; Shah and Garrett, 2010; Gudbergsdottir et al., 2010).
4 Development and Stability of CRISPR Loci
CRISPR loci generally appear to be quite stable, gradually adding spacer-repeat
units at the junction with the leader, albeit at different rates for different loci within
an organism. There is also a compensatory mechanism for gradual loss of internal
spacers which probably involves recombination between the identical direct
repeats of a given locus, and occasionally between loci carrying identical repeats
(Lillestøl et al., 2009;; Shah and Garrett, 2010). A specific example of such changes

Shiraz A. Shah, Gisle Vestergaard and Roger A. Garrett 61
is illustrated in Figure 6, showing the pairwise alignments of CRISPR locus A of
Sulfolobus solfataricus strains P1, P2 and 98/2 where shared spacers are shaded, as
well as spacers added adjacent to the leader region after these strains diverged. The
pattern of shared spacers for each pair of organisms demonstrate that strain 98/2
separated prior to the divergence of strains P1 and P2 which carry more common
spacers. Those spacers which show significant matches to known genetic elements
are also colour-coded (Figure 6A,B) indicating a wide variety of matches especially
to rudiviruses, bicaudaviruses and conjugative plasmids (Lillestøl et al., 2009).
Earlier evidence suggested that CRISPR loci were strongly resistant to integrative
events (Lillestøl et al., 2006). For example, three strains of S. solfataricus P1,
P2 and 98, which carry multiple large CRISPR loci, in addition to locus A in Figure
6. They are also extremely rich in active transposable elements (about 350 in strain
P2) which have contributed to extensive genome shuffling (Brügger et al., 2004) but
no IS insertions were detected in the extensive CRISPR loci (Lillestøl et al., 2009;
Shah and Garrett, 2010). Thus, although they do occasionally occur intergenically
in the cas and cmr gene clusters, there appears to be a strong selective pressure to
maintain the integrity of CRISPR loci which are essential for the function of both
CRISPR/Cas and CRISPR/Cmr systems. Whether this is a general rule for archaea
or is dependent on environmental conditions, including the levels of viruses and
plasmids present, is unclear. A different picture has emerged from bacterial studies.
For example, in a biofilm carrying acidophilic Leptospirillum group II bacteria,
about 20 % of the partially sequenced CRISPR loci contained IS elements (Tyson
and Banfield, 2008).
Many archaeal and bacterial chromosomes, with or without CRISPR/Cas modules,
carry short CRISPR-like clusters lacking associated leader regions and cas
genes (Grissa et al., 2008). Although their origin(s) remain unknown, they may
have separated from intact CRISPR/Cas modules, possibly via transposable elements.
If preceded by promoters their transcripts can, in principle, be processed
and activated. Such CRISPR loci are present in Sulfolobus conjugative plasmids
pNOB8 and pKEF9 (She et al., 1998; Greve et al., 2004) and at least for the latter,
Fig. 6. Pairwise comparison of the spacer-repeat units of CRISPR A locus of three closely
related strains of S. solfataricus P1, P2 and 98/2. Shaded regions indicate identical spacerrepeat
units shared by two CRISPR loci. Colour-coded spacer-repeat units indicate that spacers
have significant sequence matches to the viruses or plasmid families indicated on the
Figure

62
CRISPR/Cas and CRISPR/Cmr Immune Systems of Archaea
the spacer-repeat cluster is transcribed and RNA processed in a S. solfataricus host,
suggesting that at least some of these small clusters can be activated and functional
if complementary Cas or Cmr proteins are present (Lillestøl et al., 2009; Shah and
Garrett, 2010).
5 Mobility of CRISPR/Cas and Cmr Modules
Genomic analyses of closely related Sulfolobus species have provided strong evidence
for CRISPR/Cas modules being mobilised given that they occur at different
genomic positions even when there is high level of gene synteny present and they
are generally confined to the variable genetic regions (Shah and Garrett, 2010).
Their ability to transfer between organisms is also supported by the different combinations
of CRISPR/Cas families found in closely related organisms (Lillestøl
et al., 2009; Shah and Garrett, 2010). For example, in S. islandicus strains HVE10/4
and REY15A, the former carries family I and III CRISPR/Cas modules and one
Cmr module, while the latter exhibits a family I CRISPR/Cas module and two family
B Cmr modules (Shah and Garrett, 2010; Guo et al., 2010). Further support for
such transfer was provided by analysis of the Pyrococcus furiosus genome where
a 155 kb fragment bordered by a CRISPR locus and a repeat showing significantly
different properties of G+C content, third codon position and codon usage from the
rest of the genome (Portillo and Gonzalez, 2009).
Evidence for gene exchange within the CRISPR/Cas modules derived from
examination of the structural integrities of the paired family I CRISPR/Cas modules
of several closely related Sulfolobus strains. The results indicated that the
internal group 1 cas genes, which are functionally implicated in spacer addition at
the leader-repeat junction (Figure 4) seem to coevolve, and be mobilised, with the
CRISPR locus whereas the group 2 cas genes, putatively involved in RNA processing
and crRNA mobility (Figure 4), were retained within the strains, suggesting that
some exchange within cas gene cassettes can occur (Shah and Garrett, 2010).
The mechanism(s) of transfer of CRISPR/Cas modules, varying in size from
about 7 kb to 25 kb, remains unclear. The larger CRISPR/Cas modules, at least,
may be too large to be borne on the plasmids as has been proposed for bacteria
(Godde and Bickerton, 2006). At least for the crenarchaea, genetic elements are
relatively small and, although small CRISPR loci have been detected in crenarchaeal
conjugative plasmids, transfer is more likely to result from chromosomal
conjugation which may well be facilitated by integrated conjugative plasmids (Lillestøl
et al., 2009).
6 Targets of the CRISPR/Cas and CRISPR/Cmr Systems
Bioinformatic evidence indicated that the spacer crRNAs carrying significant
sequence matches to the protospacer sequence were complementary to either strand

Shiraz A. Shah, Gisle Vestergaard and Roger A. Garrett 63
of genes implying that they were not exclusively targeting mRNAs (Lillestøl et al.,
2006). Moreover, extensive analyses of significant matches to the many known
viruses and plasmids of the Sulfolobales revealed several matches to protospacers
lying between genes. They demonstrated, further, that the locations of the protospacers
were randomly distributed along, and on either strand of, the genetic elements.
This is illustrated in Figure 7 for five crenarchaeal viruses and two plasmids,
where the positions of the significant matches are shown in relation to the annotated
gene locations. A similar conclusion that DNA, and not mRNA, was targeted by the
Fig. 7. Significant CRISPR spacer matches to protospacer sequences are superimposed on
genomes of the following representative viruses and plasmids: SIRV1 – rudiviruses, AFV9 –
betalipothrixviruses, SSV2 – fuselloviruses, STIV turreted icosahedral viruses, ATV – bicaudavirus,
pNOB8 – conjugative plasmids. and pHEN7 – cryptic plasmids where circular
genomes (SSV2, STIV, ATV, pNOB8 and pHEN7) are presented in a linear form. Protein
coding regions are boxed and shaded, as indicated on the Figure, according their levels of
conservation for those genomes. No comparative genomic data were used for ATV. Spacer
sequence matches are indicated by lines above and below the genomes for the two DNA
strands and they are colour-coded according to whether they occur exclusively at a nucleotide
level (red) or additionally at an amino acid level (green). Significant spacer matches
were found by setting an e-value cut off corresponding to a 10 % false positive ratio, which
was estimated by using the genome of S. acidocaldarius as a negative control (Chen et al.,
2005). These data are updated from an earlier study (Shah et al., 2009)

64
CRISPR/Cas and CRISPR/Cmr Immune Systems of Archaea
CRISPR/Cas system of the bacterium Staphylococcus epidermidis was achieved
experimentally (Marraffini and Sontheimer, 2008).
However, more recently it was demonstrated that crRNAs complexed with Cmr
proteins target RNA carrying matching protospacers (Hale et al., 2009) but it is still
unclear whether this includes both mRNAs and viral RNAs. For archaea, this will
only be resolved when the first archaeal RNA viruses have been characterised.
A few sequence matches have been detected between archaeal CRISPR spacers
and IS elements suggesting that CRISPR/Cas system can target transposable elements
(Lillestøl et al., 2006; Held and Whitaker, 2009; Mojica et al., 2009; Shah
et al., 2009). However, most of those reported can be attributed to transposase
genes carried on viral genomes or plasmids, including, for example, spacer matches
to each of the four transposase genes of the bicaudavirus ATV (Figure 7) but these
transposase genes/IS elements are presumably indistinguishable from any other
viral/plasmid genomic target if they carry appropriate PAM motifs adjacent to protospacer
sites.
7 Formation of crRNAs and Targeting of Foreign Elements
The few archaeal CRISPR loci that have been tested experimentally for transcription,
including some lacking intact leader regions, produced processed transcripts
(Tang et al., 2002; Tang et al., 2005; Lillestøl et al., 2006; Carte et al., 2008; Lillestøl
et al., 2009). Sulfolobus acidocaldarius carries five CRISPR loci with sizes of
133, 78, 11, 5 and 2 spacer-repeat units. For the four smaller clusters, whole length
transcripts were detected experimentally and for locus-78, the maximum transcript
size of about 5000 nt, exceeded the size of the 4930 bp CRISPR locus, consistent
with the whole transcript extending from within the leader region and terminating
downstream from the locus (Lillestøl et al., 2006; Lillestøl et al., 2009). However,
a large fraction of the transcripts also fell in the size range 3000–3500 nt suggesting
that endogenous degradation, premature termination or processing had occurred
towards the 3’-end of the transcript. Given that promoter and terminator motifs will
be randomly taken up in spacers of CRISPR loci (Shah et al., 2009), there must be
some form of transcriptional regulation to ensure the formation of whole CRISPR
transcript from the foreign genetic elements, possibly involving the Sulfolobus
CRISPR repeat binding protein (Peng et al., 2003).
In the euryarchaeon P. furiosus and in Escherichia coli RNA transcripts are processed
within repeats, 8 nt from the spacer start by the Cas6-type endonuclease.
The processing of the 3’-end is less clear but for P. furiosus it occurs at two sites
within the spacer, at 5 nt and 11 nt from the 3’-end of the spacer sequence. Complexes
of Cas or Cmr proteins guide the mature crRNAs to their targets (Brouns
et al., 2008; Hale et al., 2009). Annealing of the spacer sequence of the crRNA to
the protospacer of the invading element is crucial for the recognition and inactivation
of the target. For the bacterium Streptococcus thermophilus it was claimed that
100 % sequence matching between the crRNAs and protospacer RNAs was essential
for target inactivation (Barrangou et al., 2007; Horvath and Barrangou, 2010).

Shiraz A. Shah, Gisle Vestergaard and Roger A. Garrett 65
However, for S. solfataricus and Sulfolobus islandicus the requirements appear to
be much less stringent because even with 3 mismatches between crRNA and protospacer
targeting was still effective (Gudbergsdottir et al., 2010).
There may also be differences between some archaea and bacteria in the role
of the family specific Protospacer-Associated Motif (PAM) complementary to part
of the 5’-repeat sequence of the crRNA which, in Sulfolobus species constitutes a
conserved dinucleotide (Lillestøl et al., 2009). For S. islandicus it was shown that
altering the PAM motif inhibited protospacer targeting (Gudbergsdottir et al., 2010)
whereas for the bacterium Staphylococcus epidermidis it was concluded that any
sequence mismatch with the 5’-end of the crRNA ensured protospacer targeting and
that sequence complementarity to the PAM motif was not essential (Marraffini and
Sontheimer, 2010).
The CRISPR-like locus of pKEF9 lacks an associated cas cassette and leader
region but when transformed into S. solfataricus P2 it produced transcripts covering
the whole CRISPR locus initiating 32 bp upstream from the first repeat and
these were found to be processed. Processing sites were detected within each repeat
spacer unit but some of the sites occurred within the spacer. At the time it was
presumed that some inaccurate processing had occurred, possibly reflecting mismatches
occurring between the plasmid repeat sequence and the host Cas proteins
(Lillestøl et al., 2009), but it was not known then that Cmr proteins process within
the 3’-ends of spacers (Hale et al., 2009).
In contrast to reports on the euryarchaeal CRISPR transcripts (Carte et al., 2008)
and a bacterium (Brouns et al., 2008) transcripts were detected from both DNA
strands of each of the five CRISPR loci of S. acidocaldarius (Lillestøl et al., 2006;;
Lillestøl et al., 2009). The largest CRISPR locus Saci-133 was probed against spacer
sequences distributed along the cluster and each yielded clear signals in Northern
analyses. The smallest processed products in the size range 55–60 nt were larger
than those of leader strand crRNAs and were less regularly processed. These small
RNAs were observed for all five S. acidocaldarius repeat-clusters and must contain
most or all of the spacer sequence because the corresponding band was not detected
when the spacer probe was replaced by a repeat probe. Whether these have a role in
protecting the mature crRNAs when there are no invading elements present remains
unclear.
8 Anti CRISPR/Cas and CRISPR/Cmr Systems
Examples have been recorded of archaeal CRISPR/Cas modules being lost from
genomes. For example, a variant strain of S. solfataricus P2 (strain P2A) was characterised
that had lost four closely linked CRISPR/Cas modules, A to D, apparently
via a single recombination event between bordering IS elements (Redder and Garrett,
2006). Bordering IS elements also have the potential to generate transposons
carrying whole CRISPR/Cas or Cmr modules. Possibly this loss reflects S. solfataricus
P2A being a laboratory strain where the immune system had become an unnecessary
burden on the cell’s energy resources in the absence of invading genetic ele-

66
CRISPR/Cas and CRISPR/Cmr Immune Systems of Archaea
ments and this may be analogous to the many bacterial endosymbionts which lack
functional CRISPR/Cas systems (Grissa et al., 2008; Mojica et al., 2009).
There are also examples of viruses, which circumvent or interfere with the
CRISPR systems. Some members of the viral families Rudiviridae and Lipothrixviridae,
carry 12 bp indels, probably deletions, in their genomes often lying within,
but not disrupting, open reading frames (Peng et al., 2004; Vestergaard et al., 2008).
Although the function of these elements is unknown they may be generated in
response to the CRISPR-based immune systems to avoid crRNA targeting. The
presence of multiple recombination sites in some archaeal viruses and conjugative
plasmids may also facilitate genomic rearrangements and sequence changes (Greve
et al., 2004; Garrett et al., 2010a).
Analysis of the genome of S. islandicus strain M.16.4 isolated in Kamchatka,
Russia (Reno et al., 2009), revealed the presence of a more direct viral interference
where an M164 provirus 1, has integrated into, and disrupted, the csa3 gene encoding
a putative transcriptional regulator of the group 1 cas genes (Figure 8). The
insertion event seems to be recent since the truncated parts of the csa3 gene show
high sequence similarity to genes of closely related species, and it may be reversible.
The closely related strain M.16.27 carries and intact csa3 gene (Figure 8A) but
also, unlike strain M.16.4, carries a CRISPR spacer sequence perfectly matching
the provirus.
a M1627
b
c
M164
attL
attR
csa1 cas1 cas2 cas4 csa3
csa1 cas1 cas2 cas4
GTAAATTTTCTTCTGCACAGAAAGAAGAT----------AATCTT
CGAAA----CTTCTGCACAGAAAGAGTATTTGACGTCAAAACATT
*** **************** ** **
sugar binding
integrase
phospholipase D
M164 provirus I
13,908 bp
DNA primase/polymerase
csa provirus 3
attL attR
Fig. 8. An example of a cas gene
cassette that has been inactivated
in the gene for the putative transcriptional
regulator csa3 of S.
islandicus M.16.4 by the integration
of an M164 provirus 1.
a) Strain M.16.27, lacking the
integrated provirus, carries a
CRISPR spacer with a perfect
match to the provirus whereas S.
islandicus M.16.4, carrying the
integrated provirus, contains no
spacer sequence matching the
proviral sequence.
b) The integration att site in the
csa3 gene.
c) Gene map of the integrated
provirus showing some predicted
functional assignments

Shiraz A. Shah, Gisle Vestergaard and Roger A. Garrett 67
9 Evolutionary Considerations
The view that archaeal and bacterial CRISPR/Cas systems are closely related
has prevailed since their discovery and was underpinned by the similar ordering
of spacer-repeat units in the CRISPR loci and by extensive sequence similarities
between Cas proteins (Haft et al., 2005; Godde and Bickerton, 2006; Makarova
et al., 2006). This view has been reinforced by the shared mechanism of elongation
of CRISPR loci at the leader-repeat junction as well as similarities in the processing
mechanisms of crRNAs in both Domains (Tang et al., 2002; Tang et al., 2005;
Brouns et al., 2008; Hale et al., 2008; Hale et al., 2009). Nevertheless, there are
distinctive features. CRISPR/Cas modules are more common amongst archaea and
tend to be larger, structurally more complex and more labile (Lillestøl et al., 2006;
Grissa et al., 2008; Shah and Garrett, 2010). Many repeat sequences show a bias to
archaea or bacteria CRISPR loci, and many archaeal repeats lack inverted repeats
common to those of bacteria suggesting that different RNA processing signals occur
within transcript repeats (Lillestøl et al., 2006; Kunin et al., 2007). Moreover, many
crenarchaea encode the CRISPR repeat binding protein of elusive function (Peng
et al., 2003).
Phylogenetic analyses imply that periodic inter-Domain exchange of CRISPR/
Cas modules has occurred (Haft et al., 2005; Godde and Bickerton, 2006; Makarova
et al., 2006). Clearly, crossing Domain boundaries would be a very complex process
given the basic differences in the transcriptional and translational mechanisms of
archaea and bacteria (Torarinsson et al., 2005; Santangelo et al., 2009). Moreover,
conjugal DNA transfer would also have to overcome the major barriers of different
membrane and cell wall structures, and different conjugative systems, of archaea
and bacteria (Greve et al., 2004; Veith et al., 2009). Nevertheless, coevolution
of archaeal and bacterial CRISPR/Cas systems would only require cross domain
events to succeed rarely. The more archaea-specific components may be associated
with systems that have evolved in environments of high temperature, extremes of
pH, or hypersaline conditions where levels of bacteria are relatively low, which is
also supported by the cas gene compositions of different CRISPR/Cas families.
Other mechanistic differences may surface as the different systems are studied in
more depth. Importantly, however, crenarchaeal viruses have radically different
virus-host relationships from those of bacteria that may require altered responses
from the immune systems (Prangishvili et al., 2006a; Bize et al., 2009) and it is
likely that the CRISPR-based immune systems have maintained and/or undergone
Domain-specific adaptations during evolution.
Small interference RNA systems (siRNA) are widespread in eukarya where they
have multiple roles including the discrimination and targeting of “foreign” genetic
elements including viruses and transposons (Hannon 2002; Jinek and Doudna,
2009). There are broad mechanistic parallels between these eukaryal siRNA systems
and the DNA- and RNA-targeting CRISPR systems. They all have to distinguish
foreign DNA from self-DNA, and target nucleic acids which show little
sequence similarity and can undergo continual sequence change. However, whereas
the CRISPR systems employ ssRNAs for targeting foreign elements, the eukaryal

68
CRISPR/Cas and CRISPR/Cmr Immune Systems of Archaea
anti-viral systems generate small 21–22 bp dsRNAs for targeting viruses which are
subsequently converted to ssRNAs by an Argonaute protein-RISC complex.
The closest parallel to the crRNAs and CRISPR loci amongst the eukaryal siRNA
systems are the Argonaute Piwi-interacting RNAs (piRNAs) directly processed
from large transcripts of piRNA clusters which are rich in transposons and repeatsequence
elements and, as for the CRISPR loci, occur at specific chromosomal sites
(Lillestøl et al., 2009; Karginov and Hannon, 2010). This eukaryal system probably
plays a role in maintaining germline integrity and development (Aravin et al., 2007;
Klattenhoff and Theurkauf, 2008). As for CRISPR loci, the piRNA clusters increase
their informational capacity by the insertion of transposon sequences which provide
novel sequence content and are maintained in the piRNA clusters by selection.
Thus, continual expansion of piRNA clusters occurs, as for CRISPR loci, but the
process is passive rather than directed. Moreover, as for the CRISPR/Cas system,
the newly incorporated DNA derives exclusively from genetic elements that are to
be targeted. No homologous proteins have been detected from sequence analyses
between proteins of the eukaryal siRNA systems and those of the CRISPR system,
although similarities may appear at a tertiary structural level.
10 Conclusions
The CRISPR/Cas and CRISPR/Cmr immune machinery provide an effective
defence against foreign genetic elements in archaea and some bacteria. The system
is dynamic and hereditable, although the benefit for the cell in evolutionary terms is
transitional because DNA from extra chromosomal elements taken up as spacers in
CRISPR loci, have a rapid turnover and are lost again via recombination at repeats
and/or transpositional events. Current evidence suggests that CRISPR/Cas and Cmr
modules can behave like integral genetic elements. They tend to be located in the
most variable regions of chromosomes, sometimes physically linked, and are frequently
displaced as a result of genome shuffling, including possibly transposition
of whole modules. CRISPR loci may be broken up, and dispersed, in chromosomes
with the potential for creating genetic novelty. Small leaderless CRISPR-like loci
are commonly found in chromosomes, and in plasmids, and some can be transcribed
and processed and therefore constitute potentially functional accessories to
the CRISPR-based immune systems. Both CRISPR/Cas and Cmr modules appear
to exchange readily between closely related organisms, possibly via chromosomal
conjugation, where they may be subjected to strong selective pressure. While universal
phylogenetic trees based on the Cas1 and Cmr2 proteins of the CRISPR/
Cas and CMR modules, respectively, suggest that transfers between archaea and
bacteria have occurred, the relatively large number of archaea-specific Cas/Cmr
proteins suggests that these may have been very rare events, consistent with the
incompatibility of the transcriptional, translational and conjugative systems of the
two Domains (Shah and Garrett, 2010). Parallels to the eukaryal siRNAs exist, and
especially germ cell piRNAs which are also directed by effector proteins to silence
or destroy invading foreign DNA and transposons.

Shiraz A. Shah, Gisle Vestergaard and Roger A. Garrett 69
References
Aravin AA, Hannon GJ, Brennecke J (2007) The Piwi-piRNA pathway provides an adaptive
defense in the transposon arms race. Science 318: 761–764
Arnold HP, She Q, Phan H, Stedman K, Prangishvili D, Holz I et al. (1999) The genetic element
pSSVx of the extremely thermophilic crenarchaeon Sulfolobus is a hybrid between a plasmid
and a virus. Mol Microbiol 34: 217–226
Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S et al. (2007) CRISPR
provides acquired resistance against viruses in prokaryotes. Science 315: 1709–1712
Basta T, Smyth J, Forterre P, Prangishvili D, Peng X (2009) Novel archaeal plasmid pAH1 and its
interactions with the lipothrixvirus AFV1. Mol Microbiol 71: 23–34
Bettstetter M, Peng X, Garrett RA, Prangishvili D (2003) AFV1, a novel virus infecting hyperthermophilic
archaea of the genus Acidianus. Virology 315: 68–79
Bize A, Karlsson EA, Ekefjard K, Quax TE, Pina M, Prevost MC et al. (2009) A unique virus
release mechanism in the Archaea. Proc Natl Acad Sci U S A 106: 11306–11311
Bize A, Peng X, Prokofeva M, Maclellan K, Lucas S, Forterre P et al. (2008) Viruses in acidic
geothermal environments of the Kamchatka Peninsula. Res Microbiol 159: 358–366
Bolotin A, Quinquis B, Sorokin A, Ehrlich SD (2005) Clustered regularly interspaced short palindrome
repeats (CRISPRs) have spacers of extrachromosomal origin. Microbiology 151:
2551–2561
Brouns SJ, Jore MM, Lundgren M, Westra ER, Slijkhuis RJ, Snijders AP et al. (2008) Small
CRISPR RNAs guide antiviral defense in prokaryotes. Science 321: 960–964
Brügger K, Torarinsson E, Redder P, Chen L, Garrett RA (2004) Shuffling of Sulfolobus genomes
by autonomous and non-autonomous mobile elements. Biochem Soc Trans 32: 179–183
Carte J, Wang R, Li H, Terns RM, Terns MP (2008) Cas6 is an endoribonuclease that generates
guide RNAs for invader defense in prokaryotes. Genes Dev 22: 3489–3496
Chen L, Brugger K, Skovgaard M, Redder P, She Q, Torarinsson E et al. (2005) The genome of
Sulfolobus acidocaldarius, a model organism of the Crenarchaeota. J Bacteriol 187: 4992–
4999
Cortez D, Forterre P, Gribaldo S (2009) A hidden reservoir of integrative elements is the major
source of recently acquired foreign genes and ORFans in archaeal and bacterial genomes.
Genome Biol 10: R65
Garrett RA, Prangishvili D, Shah SA, Reuter M, Stetter KO, Peng X (2010a) Metagenomic analyses
of novel viruses and plasmids from a cultured environmental sample of hyperthermophilic
neutrophiles. Environ Microbiol doi: 10.1111/j.1462–2920.2010.02266.x
Garrett RA, Shah SA, Vestergaard G, Deng L, Gudbergsdottir S, Kenchappa CS et al. (2010b)
CRISPR-based immune systems of the Sulfolobales – complexity and diversity. Biochem
Soc Trans in press
Godde JS and Bickerton A (2006) The repetitive DNA elements called CRISPRs and their associated
genes: evidence of horizontal transfer among prokaryotes. J Mol Evol 62: 718–729
Greve B, Jensen S, Brugger K, Zillig W, Garrett RA (2004) Genomic comparison of archaeal conjugative
plasmids from Sulfolobus. Archaea 1: 231–239
Grissa I, Vergnaud G, Pourcel C (2008) CRISPRcompar: a website to compare clustered regularly
interspaced short palindromic repeats. Nucleic Acids Res 36: W145-W148
Gudbergsdottir S, Deng L, Chen Z, Jensen JVK, Jensen LR, She Q et al. (2010) Dynamic properties
of the Sulfolobus CRISPR/Cas and CRISPR/Cmr systems when challenged with vectorborne
viral and plasmid genes and protospacers. Mol Microbiol under review
Guo L, Brugger K, Chao Liu C, Shah SA, Zheng H, Zhu Y et al. (2010) Comparative genomics of
two strains of Sulfolobus islandicus from Iceland: Hosts for studying crenarchaeal genetics
and virus life cycles. submitted
Haft DH, Selengut J, Mongodin EF, Nelson KE (2005) A guild of 45 CRISPR-associated (Cas)
protein families and multiple CRISPR/Cas subtypes exist in prokaryotic genomes. PLoS
Comput Biol 1: e60

70
CRISPR/Cas and CRISPR/Cmr Immune Systems of Archaea
Hale C, Kleppe K, Terns RM, Terns MP (2008) Prokaryotic silencing (psi)RNAs in Pyrococcus
furiosus. RNA 14: 2572–2579
Hale CR, Zhao P, Olson S, Duff MO, Graveley BR, Wells L et al. (2009) RNA-guided RNA cleavage
by a CRISPR RNA-Cas protein complex. Cell 139: 945–956
Hannon GJ (2002) RNA interference. Nature 418: 244–251
Held NL and Whitaker RJ (2009) Viral biogeography revealed by signatures in Sulfolobus islandicus
genomes. Environ Microbiol 11: 457–466
Horvath P and Barrangou R (2010) CRISPR/Cas, the immune system of bacteria and archaea.
Science 327: 167–170
Jansen R, Embden JD, Gaastra W, Schouls LM (2002) Identification of genes that are associated
with DNA repeats in prokaryotes. Mol Microbiol 43: 1565–1575
Jinek M and Doudna JA (2009) A three-dimensional view of the molecular machinery of RNA
interference. Nature 457: 405–412
Karginov FV and Hannon GJ (2010) The CRISPR system: small RNA-guided defense in bacteria
and archaea. Mol Cell 37: 7–19
Klattenhoff C and Theurkauf W (2008) Biogenesis and germline functions of piRNAs. Development
135: 3–9
Krupovic M, Forterre P, Bamford DH (2010) Comparative analysis of the mosaic genomes of
tailed archaeal viruses and proviruses suggests common themes for virion architecture and
assembly with tailed viruses of bacteria. J Mol Biol 397: 144–160
Kunin V, Sorek R, Hugenholtz P (2007) Evolutionary conservation of sequence and secondary
structures in CRISPR repeats. Genome Biol 8: R61
Lawrence CM, Menon S, Eilers BJ, Bothner B, Khayat R, Douglas T et al. (2009) Structural and
functional studies of archaeal viruses. J Biol Chem 284: 12599–12603
Lillestøl RK, Redder P, Garrett RA, Brugger K (2006) A putative viral defence mechanism in
archaeal cells. Archaea 2: 59–72
Lillestøl RK, Shah SA, Brugger K, Redder P, Phan H, Christiansen J et al. (2009) CRISPR families
of the crenarchaeal genus Sulfolobus: bidirectional transcription and dynamic properties.
Mol Microbiol 72: 259–272
Makarova KS, Grishin NV, Shabalina SA, Wolf YI, Koonin EV (2006) A putative RNA-interference-based
immune system in prokaryotes: computational analysis of the predicted enzymatic
machinery, functional analogies with eukaryotic RNAi, and hypothetical mechanisms
of action. Biol Direct 1: 7
Marraffini LA and Sontheimer EJ (2008) CRISPR interference limits horizontal gene transfer in
staphylococci by targeting DNA. Science 322: 1843–1845
Marraffini LA and Sontheimer EJ (2010) Self versus non-self discrimination during CRISPR
RNA-directed immunity. Nature 463: 568–571
Mojica FJ, Diez-Villasenor C, Garcia-Martinez J, Almendros C (2009) Short motif sequences
determine the targets of the prokaryotic CRISPR defence system. Microbiology 155: 733–
740
Mojica FJ, ez-Villasenor C, Garcia-Martinez J, Soria E (2005) Intervening sequences of regularly
spaced prokaryotic repeats derive from foreign genetic elements. J Mol Evol 60: 174–182
Peng X, Blum H, She Q, Mallok S, Brugger K, Garrett RA et al. (2001) Sequences and replication
of genomes of the archaeal rudiviruses SIRV1 and SIRV2: relationships to the archaeal
lipothrixvirus SIFV and some eukaryal viruses. Virology 291: 226–234
Peng X, Brugger K, Shen B, Chen L, She Q, Garrett RA (2003) Genus-specific protein binding
to the large clusters of DNA repeats (short regularly spaced repeats) present in Sulfolobus
genomes. J Bacteriol 185: 2410–2417
Peng X, Kessler A, Phan H, Garrett RA, Prangishvili D (2004) Multiple variants of the archaeal
DNA rudivirus SIRV1 in a single host and a novel mechanism of genomic variation. Mol
Microbiol 54: 366–375
Porter K, Russ BE, Dyall-Smith ML (2007) Virus-host interactions in salt lakes. Curr Opin Microbiol
10: 418–424
Portillo MC and Gonzalez JM (2009) CRISPR elements in the Thermococcales: evidence for
associated horizontal gene transfer in Pyrococcus furiosus. J Appl Genet 50: 421–430

Shiraz A. Shah, Gisle Vestergaard and Roger A. Garrett 71
Pourcel C, Salvignol G, Vergnaud G (2005) CRISPR elements in Yersinia pestis acquire new
repeats by preferential uptake of bacteriophage DNA, and provide additional tools for evolutionary
studies. Microbiology 151: 653–663
Prangishvili D, Forterre P, Garrett RA (2006a) Viruses of the Archaea: a unifying view. Nat Rev
Microbiol 4: 837–848
Prangishvili D, Garrett RA, Koonin EV (2006b) Evolutionary genomics of archaeal viruses:
unique viral genomes in the third domain of life. Virus Res 117: 52–67
Rachel R, Bettstetter M, Hedlund BP, Haring M, Kessler A, Stetter KO et al. (2002) Remarkable
morphological diversity of viruses and virus-like particles in hot terrestrial environments.
Arch Virol 147: 2419–2429
Redder P and Garrett RA (2006) Mutations and rearrangements in the genome of Sulfolobus solfataricus
P2. J Bacteriol 188: 4198–4206
Reno ML, Held NL, Fields CJ, Burke PV, Whitaker RJ (2009) Biogeography of the Sulfolobus
islandicus pan-genome. Proc Natl Acad Sci U S A 106: 8605–8610
Santangelo TJ, Cubonova L, Skinner KM, Reeve JN (2009) Archaeal intrinsic transcription termination
in vivo. J Bacteriol 191: 7102–7108
Shah SA and Garrett RA (2010) CRISPR/Cas and Cmr modules, mobility and evolution of adaptive
immune systems. Res Microbiol
Shah SA, Hansen NR, Garrett RA (2009) Distribution of CRISPR spacer matches in viruses and
plasmids of crenarchaeal acidothermophiles and implications for their inhibitory mechanism.
Biochem Soc Trans 37: 23–28
She Q, Peng X, Zillig W, Garrett RA (2001) Gene capture in archaeal chromosomes. Nature 409:
478
She Q, Phan H, Garrett RA, Albers SV, Stedman KM, Zillig W (1998) Genetic profile of pNOB8
from Sulfolobus: the first conjugative plasmid from an archaeon. Extremophiles 2: 417–425
Tang TH, Bachellerie JP, Rozhdestvensky T, Bortolin ML, Huber H, Drungowski M et al. (2002)
Identification of 86 candidates for small non-messenger RNAs from the archaeon Archaeoglobus
fulgidus. Proc Natl Acad Sci U S A 99: 7536–7541
Tang TH, Polacek N, Zywicki M, Huber H, Brugger K, Garrett R et al. (2005) Identification of
novel non-coding RNAs as potential antisense regulators in the archaeon Sulfolobus solfataricus.
Mol Microbiol 55: 469–481
Torarinsson E, Klenk HP, Garrett RA (2005) Divergent transcriptional and translational signals in
Archaea. Environ Microbiol 7: 47–54
Tyson GW and Banfield JF (2008) Rapidly evolving CRISPRs implicated in acquired resistance of
microorganisms to viruses. Environ Microbiol 10: 200–207
Veith A, Klingl A, Zolghadr B, Lauber K, Mentele R, Lottspeich F et al. (2009) Acidianus, Sulfolobus
and Metallosphaera surface layers: structure, composition and gene expression. Mol
Microbiol 73: 58–72
Vestergaard G, Shah SA, Bize A, Reitberger W, Reuter M, Phan H et al. (2008) Stygiolobus rodshaped
virus and the interplay of crenarchaeal rudiviruses with the CRISPR antiviral system.
J Bacteriol 190: 6837–6845
Wang Y, Duan Z, Zhu H, Guo X, Wang Z, Zhou J et al. (2007) A novel Sulfolobus non-conjugative
extrachromosomal genetic element capable of integration into the host genome and spreading
in the presence of a fusellovirus. Virology 363: 124–133
Zillig W, Arnold HP, Holz I, Prangishvili D, Schweier A, Stedman K et al. (1998) Genetic elements
in the extremely thermophilic archaeon Sulfolobus. Extremophiles 2: 131–140

Chapter 7
Archaeal Type II TA Loci
Shiraz A. Shah and Roger A. Garrett
Corresponding: garrett@bio.ku.dk
Archaea Centre, Department of Biology, Ole Maaløes Vej 5, DK-2200
Copenhagen N, Denmark
Abstract A few of the bacterial type II TA systems, primarily those
involved in tranaslational inhibition, occur widely throughout the
archaeal domain. Using a bioinformatic approach, the frequency and
diastribution of these diverse TA loci were examined within
completed genomes of 124 archaea, that are distributed fairly evenly
throughout the major archaeal phyla. Results for the frequency and
diversity of TA loci are summarised for archaea isolated from
environmental niches generally characterised by extreme conditions
including high temperature, high salt concentrations, high pressures,
extremes of pH or strictly anaerobic conditions. No clear correlations
were found between the number of TA loci present and either the
genome size or particular environmental conditions. Multiple TA loci
tend to be concentrated in variable genomic regions where the
occurrence of intra- or inter-genomic gene transfer is most prevalent.
For members of the Sulfolobales which are uniformly rich in TA loci,
a case is made for some TA systems facilitating maintenance of
important genomic regions.
7.1. Introduction
Until recently, type II TA systems have received relatively little
attention in comparative genomic studies of archaea. This reflects a
general uncertainty regarding their functions, the significance of
their structural diversity and, to some degree, their identities.
Moreover, this uncertainty was compounded by the small gene sizes,
especially for the antitoxins, which rendered their annotation
difficult. This widespread deficiency was first highlighted by Gerdes'
1

group who identified large numbers of non annotated TA loci in
archaeal and bacterial genomes and demonstrated the structural
diversity of the protein components within different TA families
(Pandey et al., 2005; Gerdes et al., 2005; Jørgensen et al., 2009). This
development, combined with contemporary insights gained into
molecular mechanisms of toxin inhibitory activity (reviewed in
Gerdes et al., 2005), served to focus attention on the profound
importance of TA systems for cellular viability and survival.
Genome-based surveys of bacterial type II TA systems,
carrying two genes, have identified eight major families denoted
vapBC, relBE, hicBA, mazEF, phd/doc, parDE, ccdAB and higBA with an
additional system in a Streptococcus plasmid carrying three genes (,
and , a repressor, antitoxin and toxin, respectively). VapC, RelE,
MazE and HicA toxins have all been demonstrated experimentally to
inhibit translation and Doc has also been implicated, at least
indirectly, in affecting translation. In contrast, ParE and CcdB target
the bacterial DNA gyrase thereby blocking DNA replication
(reviewed in Gerdes et al., 2005).
Only three of these toxin families VapC, RelE and HicA, each
targeting translation, occur commonly amongst archaea and this
chapter is mainly focussed on these three TA systems. In the
bacterium Shigella flexneri VapC toxins act by cleaving initiator tRNA
within the anticodon loop thereby inhibiting translational initation
(Dienemann et al. 2011; Winther and Gerdes, 2011), while RelE binds
at the ribosomal A-site cutting the bound mRNA within the codon
(Neubauer et al., 2009), and HicA is a translation-dependent mRNA
transferase (Jørgensen et al., 2009; Makarova et al., 2009a). MazF and
Doc have also been implicated in targeting translation, but their
homologs are rarely found amongst archaea (Pandey and Gerdes,
2005; Makarova et al., 2009b). Most archaea do not carry a homolog
of the bacterial gyrase, the target of the ParE and CcdB toxins,
employing instead the archaea-specific topoisomerase VI (Gadelle et
al., 2003; Yamashiro and Yamagishi, 2005).
An extensive genomic survey of bacterial and archaeal type II TA
systems by Makarova et al., (2009b), that did not take into account the
many non annotated genes, reinforced the considerable structural
diversity of the major TA families and identified additional subtypes,
especially of the antitoxin components. This study also provided
bioinformatical evidence for a possible additional TA locus encoding
MNT (Minimal Nucleotidyl Transferase) and HEPN (Higher
Eukaryote and Prokaryote Nucleotide binding). Although there is
currently no experimental support for any toxin activity (Makarova
et al., 2009b), we nevertheless included MNT/HEPN gene pairs in the
2

present analysis because they occur commonly in archaea, especially
amongst the hyperthermophiles and, moreover, their frequency of
genome occurrence mirrors partially that of vapBC gene pairs.
A bioinformatical approach was employed to identify archaeal
type II TA loci within 124 completed archaeal genomes. Exhaustive
searches were made for the major families of TA gene loci, vapBC,
relBE, and hicAB and for the HEPN/MNT gene pairs and attempts
were made to identify non annotated antitoxin and toxin genes.
7.2. The archaeal perspective
Archaea differ from bacteria in their cellular biology in
fundamental ways and they share many cellular processes
exclusively with eukaryotes albeit generally in less complex forms.
Although the evolutionary history of archaea and their relationship
to early eukarya remains enigmatic (Gribaldi et al., 2010; Kurland,
2006), the maintenance of unique cellular properties amongst archaea
is likely to be due to their successful adaptation to extreme
environmental conditions. These include high temperature, extremes
of pH, high salt, high pressures and strictly anaerobic conditions;
and such environments that also tend to be low in energy sources
(Kletzin, 2007). It has been argued that some of the properties unique
to archaea arose from adaptation to chronic energy stress through
modifying catabolic pathways and by conserving energy via their
low permeability ether-linked lipid membranes (Valentine, 2007).
Thus, stress in bacteria and archaea cannot simply be equated when
considering the modes of action of toxins.
TA systems that are shared between bacteria and archaea appear
primarily to inhibit translation, cleaving either mRNA bound in the
ribosomal A-site (RelE), the anticodon of the initiator tRNA (VapC)
or mRNA directly (HicA). The ribosomal tRNA binding sites,
decoding site and peptidyl transferase centre constitute the most
conserved regions of the translational apparatus, in both bacteria and
archaea (and also in eukarya), as judged by their shared sensitivities
to a wide range of antibiotics which specifically target these sites in
both Domains (e.g. Rodriguez-Fonseca et al., 1995). Experimental
studies indicate that bacterial TAs have alternative cellular targets,
including the bacterial DNA gyrase, but it remains unknown
whether there are unidentified archaeal toxins which bind to
archaea-specific cellular sites.
7.3 A bioinformatical approach
All archaeal genomes publicly available at the beginning of 2012
were screened for the presence
of type TA loci of the superfamilies
3

vapBC, relBE and hicAB, as well as gene pairs of the predicted
HEPN/MNT TA locus, by first
constructing toxin-specific hidden
markov models (HMMs), using the
jackhmmer program (Eddy,
2011), against the genomes using known toxin genes as queries.
Subsequently, all open reading frames (ORFs)
between 50 and 250
aa that did not overlap previously
annotated ORFs above 250 aa in
length were extracted and screened
using the constructed HMMs.
Every upstream or downstream ORF, depending on the TA family
type, located within a fixed
distance of the matching toxin ORF,
was
extracted and clustered according to sequence similarity. Some
of these clusters were judged to comprise antitoxin gene families
based on manual inspection of their genomic contexts, and they were
paired with the corresponding
toxin genes to generate TA
loci.
Subsequently, we found that significant numbers of TA loci
were partially overlapping with larger annotated ORFs, particularly
for members of the Thermococcales and, therefore, we extended the
analyses to include these genes, which involved extensive manual
inspection of the genomes.
7.4. Phylogenetic distribution and frequency of archaeal TA loci
A phylogenetic tree based on 16S rRNA sequences was
generated for 124 archaea for which genome sequences were
available. The genome size and natural habitat is given for each
organism, and thermophiles are distinguished from mesophiles with
a border for optimal growth of 50 o C (Table 1). More details of the
natural environments and optimal growth conditions for many of
the organisms are given by Kletzin (2007). Some orders, including
the hyperthermophilic Sulfolobales, Thermoproteales and
Thermococcales, are relatively overrepresented by closely related
organisms including several Sulfolobus islandicus, Pyrobaculum and
Thermococcus strains, while the less well characterised Korarchaea (K)
and Thaumarchaea (T) are underrepresented. This bias primarily
reflects that the former group are relatively easy to isolate and
culture and that some of them have been employed as model
organisms for molecular, cellular and genetic studies. The total
numbers of identified TA loci are given for vapBC, relBE and hicAB
families and for the HEPN/MNT gene pairs in Table 1.
The results reveal a wide range of type II TA contents. Several
organisms carry 30 or more TA loci but many have very few or no
detectable loci. vapBC constitute the dominant TA family and they
are most prevalent amongst thermophiles, in particular in members
of the thermoacidophilic Sulfolobales (Pandey and Gerdes, 2005; Guo
et al., 2011) and in some Thermococcus species. In contrast relBE or
4

hicAB gene pairs are quite rare especially amongst the 40
crenarchaeal genomes. For the euryarchaea relBE gene pairs were
observed in about half of the genomes and several of these carried 1
to 9 copies. Similarly, hicAB pairs were identified in about half the
euryarchaeal genomes with multiple copies occurring mainly
amongst the Methanomicrobiales and Methanosarcinales.
MNT/HEPN gene pairs occur much more frequently but are
irregularly distributed. They are most common amongst
crenarchaeal thermoacidophiles and thermoneutrophiles and the
euryarchaeal hyperthermophiles (Table 1).
7.5. TA loci frequency and their relationship to genome size and
environmental factors
Generally, there is no simple correlation between genome
size and TA 
 locus frequency for the different archaeal phyla.
For example, for most members of 
 the Sulfolobales the
estimated number of TA loci varies from 17 to 49 but the
minimal genome of Acidianus hospitalis (2.2 Mb) carries 38
while
 the largest genome of Sulfolobus solfataricus P2 (3 Mb)
contains 33. For 
 other phyla, a clearer picture emerges when
comparing strains within
 the same genus e.g. the seven
Thermococcus strains which have genome 
 sizes ranging from
1.8 to 2.1 Mb. When ordered according to increasing
approximate size (Table 1), these genomes carry 4, 10, 24, 25, 26,
47
 and 58 TA loci respectively, showing that the TA frequency
increases 
 disproportionately with genome size. A similar
pattern is seen with 
 Pyrobaculum strains. These results also
underline the often large 
 differences in the TA contents of
pairs of closely related organisms.
There is little correlation between TA loci numbers and optimum
growth temperatures. Although Hyperthermus butylicus which can
grow up to 108 o C has a relatively high TA locus content of 18 (mainly
vapBC loci) for a member of the Thermoproteales, Methanopyrus
kandleri growing up to 110 o C has no detectable TA loci and some of
the hyperthermophilic Methanocaldococcus strains also exhibit few TA
loci.
More difficult to assess is the impact of the natural environments
and the available nutrients, although in this respect the S. islandicus
strains may be informative (Reno et al., 2009; Guo et al., 2011). They
were all isolated from terrestial acidic hot springs with similar
maximum growth temperatures and pH ranges but widely
5

separated, and isolated, geographically; on Iceland, in Kamchatka,
Russia and in Yellowstone and Lassen National Parks, USA while the
related S. solfataricus P2 strain derives from Naples, Italy. Each of the
strains carry 26 to 36 TA loci which suggests that the nature of the
environment is important. Moreover, active terrestial hot springs are
likely to be particularly challenging for cells because temperatures
can continuously change from maxima of around 80 o C to 0 o C, if
surrounded by ice, and pH values and nutrient availability can also
change rapidly. A definitive answer to the effect of environmental
factors on TA activity would require detailed and time consuming
experimental analyses of archaea cultivated under a wide range of
conditions.
7.6. Orphan toxin and antitoxin genes
Many orphan toxin and some orphan antitoxin genes were
detected in the genomes and the numbers tend to be proportional to
the numbers of type II TA loci. For example, there are many orphan
toxin genes amongst the Sulfolobales. Some of these may have been
classed as orphans because the adjacent antitoxin protein gene was
not identified (Pandey and Gerdes, 2005) and others may be located
adjacent to unidentified type III RNA antitoxin genes (see Chapter
14).
Presumably, over time, antitoxins or toxins may become
associated with other cellular functions by selection. One such
example could be provided by a single vapC-like gene (Ahos0712) of
A. hospitalis. It lies in an operon with genes encoding proteins
involved in transcription and initiator tRNA binding to the ribosome
(You et al., 2011). This gene cassette is highly conserved in gene
content, gene synteny and sequence in other Sulfolobus genomes
(Guo et al. 2011). A possible explanation is that this orphan VapC-like
protein acts as a VapC competitor and may regulate or inhibit
initiator tRNA cleavage.
7.7. Locations within genomes
Earlier comparative genomic analyses of closely related Sulfolobus
species indicated that TA gene pairs tend to be concentrated in
relatively large genomic regions (0.7 to 1 Mbp). These regions are the
most variable in gene synteny and gene content (Guo et al., 2011)
consistent with the extensive exchange of genes having occurred
intra- and/or inter-genomically. This is illustrated for the genomes of
S. islandicus REY15A and the related S. solfataricus P2 where a high
level of gene synteny is maintained throughout about two thirds of
the genome while the remaining one third is extensively shuffled
6

Figure 7.1. Comparison of genomes from pairs of closely related archaea. Dot
plots of (A) Sulfolobus species S. islandicus REY15A and S. solfataricus P2, and (B)
Thermococcus species T. onnurineus and T. kodakarensis showing regions of gene
synteny (red) and inverted synteny (blue). The total genome sizes are given and
the large variable regions in each genome are shaded. TA loci are denoted by black
lines along the corresponding genome axes.
Figure 7.2. Phylogenetic trees for VapB antitoxins and VapC toxins of the
acidothermophile A. hospitalis W1. (A) The VapB tree demonstrates that the
highly diverse antitoxins can be classified into three main subfamilies AbrB,
CcdA/CopG and DUF217. In (B) the VapC tree shows the highly diverse toxin
sequences falling into one major grouping. The VapB subfamily linked to each
VapC is given. Moreover the number of closely similar VapC proteins present in
the available 13 Sulfolobales genomes (Table 1) is listed - 0 indicates that no VapC
with a similar sequence is encoded in the genomes, while 13 indicates that a VapC
with a closely similar sequence is encoded in each the genomes. Ahos Genbank
numbers are given for each protein. Modified from You et al., (2011).
7

(Figure 1A). Most of the TA loci of both species fall within the
variable region. Although few pairs of genome sequences from
closely related archaeal species are available which show extensive
gene synteny, a comparable analysis was possible for the genomes of
two Thermococcus species. T. kodakarensis carrying many TA loci and
T. onnurineus that exhibits very few TA loci (Figure 1B). Here the
gene synteny is more limited and extends only over about one half of
the genome but again the TA loci of T. kodakarensis are concentrated
in the shuffled genome region. The latter example also illustrates the
stark differences in the numbers of TA loci between some fairly
closely related species.
Although several genomes, including some Sulfolobus species,
contain many transposable elements and TA loci there is no general
proportionality between the two. For example, both Thermococcus
genomes carry few IS elements but one of the species, T. kadakarensis,
exhibts several TA loci (Figure 1B). Moreover, several of the genomes
carry many transposable elements but few TA loci (e.g. Pyrococcus
furiosus, Halobacterium NRC1 and Thermoplasma volcanium) while
others exhibit few transposable elements but contain many TA loci
(e.g. Sulfolobus acidocaldarius, H. butylicus and Thermococcus sp. AM4)
(Brügger et al., 2002; Filée et al., 2007).
7.8. TA sequence diversity within genomes
The A. hospitalis genome carries 24 vapBC loci concentrated within
the genomic regions 350-410 kb and 1,374-1,912 kb (You et al., 2011).
Whereas the VapC toxins are all PIN domain proteins (PilT Nterminal
domain), the VapB antitoxins were classified into three
families of transcriptional regulators, AbrB, CcdA/CopG and
DUF217 (Figure 2A) (You et al., 2011). Tree building based on
sequence alignments demonstrated that the sequences of these
antitoxins and toxins are all highly diverse, with sequence identities
between them rarely exceeding 30%, as indicated by all the long tree
branches for each protein (Figure 2). A parallel tree building study of
the closely related S. islandicus strains REY15A and HVE10/4 carrying
18 and 19 vapBC gene pairs, respectively, yielded a similar pattern of
long branches for each VapB and VapC protein (Guo et al., 2011).
Thus all antitoxins and toxins within each archaeon are highly
diverse in sequence.
In contrast, when intergenomic comparisons were made for other
members of the Sulfolobales, isolated from both closely and distantly
separated geographical terrestial hot springs, several VapBC
complexes showed high sequence similarity. For example, 11 of the
24 VapBC protein pairs identified in A. hospitalis (Figure 2), exhibit
8

closely similar sequences to homologs encoded in at least seven of
the 13 available Sulfolobus genomes (You et al., 2011). A further
example is illustrated for the VapC toxins of Pyrococcus species
(Figure 3A) and for the predicted MNT toxin of the MNT/HEPN
gene pairs for Pyrobaculum species (Figure 3B). The result shows that
the VapC and MNT sequences within each cluster of short branches
derive from different species. Thus, there is apparently selection
against the uptake of closely similar vapBC loci or MNT/HEPN gene
pairs in a given genome, despite the abundance of many similar gene
pairs in the environment.
The tree-building results of the analysis demonstrated further that
for given gene pairs the subtypes of VapB and VapC do not always
correspond implying that gene pairs exchange partners thereby
potentially creating increased functional diversity of the TA systems
(You et al., 2011), consistent with an earlier hypothesis (Gerdes et al.,
2005).
Figure 7.3 Phylogenetic trees for the toxin VapC and the predicted toxin MNT.
(A) VapC proteins encoded in different in Pyrococcus species, and (B) MNT
proteins encoded in diverse Pyrobaculum species. Proteins that fall within the small
clusters of short branches derive from different organisms. Trees generated for
proteins deriving exclusively from one organism yield long branches. Gene
numbers are given for each of the genomes analysed (see Table 1).
9

7.9. Stress response
Antitoxin-toxins were originally shown to enhance plasmid
maintenance as a consequence of the growth of plasmid-free cells
being preferentially inhibited, post segregation, by free toxins that
are inherently more stable than antitoxins (Gerdes et al. 2005). To
date, relatively few archaeal plasmids have been sequenced and
there is no current evidence for type II TA loci occurring widely in
plasmids. Nevertheless, the plasmid maintenance mechanism led to
the hypothesis that the TA systems encoded widely in chromosomes
facilitate retention of local DNA regions carrying important genes
that might otherwise be prone to loss (Magnuson, 2007; Van
Melderen 2010).
This hypothesis receives support from the observation that vapBC
loci and the HEPN/MNT gene pairs are concentrated within variable
genomic regions of members of the Sulfolobales and Thermococcales
where intergenomic DNA exchange appears to be most active
(Figure 1). Furthermore, the hypothesis is reinforced by the high
sequence diversity of each of the numerous VapC proteins encoded
within these genomes, exemplified for A. hospitalis (Figure 2). For any
pair of similar VapBC complexes, the loss of one would be
compensated for by the presence of the other, thereby undermining
any DNA maintenance capability.
For bacteria which grow slowly in nutrient poor environments,
multiple toxins are strongly implicated in responding to different
types of nutrient deficiency and/or in enhancing quality control
(Gerdes, 2000; Pandey and Gerdes, 2005). Involvement in stress
response entails that the toxins inhibit growth, allowing the host to
lie in a dormant state during the period of environmental stress
(Pedersen et al., 2002; Gerdes et al. 2005). In this context, toxins have
also been implicated in producing persistent cells which are able to
remain dormant for longer periods and to withstand prolonged
exposure to stress factors including antibiotics (Maisonneuve et al.,
2011).
There may well be a negative effect on host growth as a
consequence of carrying large numbers of TA loci (30 to 40 TA loci
for some Sulfolobus species and a few other archaea (Table 1))
because of the likelihood of the continuous presence of low levels of
free toxin (Wilbur et al. 2005). Although only highly diverse vapBC
loci are present, presumably in order to avoid redundancy, the total
number of TA loci present per genome may reflect a compromise
between the ability to maintain important genes and to survive
10

different environmental stresses while retaining an adequate growth
rate under normal conditions.
In conclusion, there is a major deficit in experimental work on
archaeal TA systems, especially with regard to stress responses.
Almost all research to date has focussed on bacteria. One exception
was the demonstration that the mode of action of a bacterial RelE
toxin in M. jannaschii and bacteria were similar in vitro (Christensen
and Gerdes, 2003). Moreover, heat shock of S. solfataricus (from 80 o C
to 90 o C) was shown to induce expression of some TA loci while
knockout of a single vapBC locus increased heat shock lability
(Cooper et al., 2009). Clearly, however, many challenging
experiments remain to be performed in this rapidly developing field.
7.10. Type II TA systems and viral defence
It has been proposed that bacterial TA systems could be involved
in combating bacteriophage infection by, for example, blocking
ribosomes and preventing the viruses from dominating the
translational apparatus, prior to their propagating and lysing cells
(see Chapter 5). The inferred result would be that only the phageinfected
cells would die. In principle, archaeal TA systems which
primarily target translation could act similarly. However most
archaeal viruses, and especially those from extremely thermophilic
and halophilic environments, show morphotypes and genomic
properties distinct from bacterial and eukaryal viruses and they
generally exist in stable relationships with their hosts at low copy
numbers, infrequently, if ever, causing cell lysis (Prangishvili et al.,
2006; Porter et al., 2007). Consistent with these properties,
circumstantial evidence suggests that the level of free viruses, at least
in extreme thermoacidophilic environments, tend to be low relative
to cellular levels suggesting that these viruses prefer to remain
within cells under these challenging conditions (Snyder et al., 2010).
Another intriguing possibility arises from juxtapositioning of TA
loci and CRISPR loci (Clustered Regularly Interspaced Short
Palindromic Repeats) in some archaea. CRISPR-based adaptive
immune systems target invading genetic elements, primarily viruses
and conjugative plasmids, and they have been classified into three
major types, of which only two (types I and III) occur in archaea,
often with both major types present in the same archaeon (Garrett et
al., 2011). The CRISPR arrays carry spacer regions taken up from
invading genetic elements and their processed transcripts are able to
facilitate targeting and cleavage of genetic elements with matching
sequences. An example of a complex assembly of a type III CRISPRbased
system, present in the A. hospitalis genome, is shown in Figure
11

4. The CRISPR arrays and associated gene cassettes are interwoven
with four vapBC loci for which all the antitoxins and toxins carry
highly divergent sequences (Figure 2). Thus, these CRISPRassociated
TA systems could play a secondary role in combating
invading genetic elements by helping to maintain the functional
CRISPR immune systems, which also tend to be located within the
variable chromosomal regions. Another interesting aspect of this
system is that one vapBC locus associated with the type III
interference system in A. hospitalis (Figure 4B) shows a high level of
sequence identity with vapBC loci specifically associated with a
different subclass of type III interference systems found in the S.
islandicus strains REY15A and HVE10/4 (Figure 4C) (Guo et al., 2011)
suggesting that individual types of TA loci may coevolve with genes
exhibiting specific functions.
Figure 7.4 Type III CRISPR systems linked to vapBC gene pairs. (A) CRISPR loci
and genes of the acidothermophile A. hospitalis W1. CRISPR loci (black) show the
numbers of repeats present. Genes encode proteins involved in uptake of new
spacers (adaptation) labelled aCas, a gene encoding the RNA processing enzyme
Cas6, and a gene cassette encoding type III interference proteins. Four vapBC gene
pairs that are highly divergent in sequence are also present. (B) Expansion of the
type III interference cassette of A. hospitalis, and (C) location of a highly similar
vapBC gene pair located next to a different class of type III CRISPR interference
cassette (denoted Cmr) in S. islandicus HV E10/4. Numbers of repeats are indicated
for each CRISPR locus.
7.11. Conclusions
Clearly, these are early days for studies of archaeal TA loci.
Almost all of the experimental work to date has been performed on
different bacterial TA systems some of which have no equivalent
amongst archaea. Support is provided here for a role in maintaining
important regions of chromsomal DNA for those organisms,
particularly members of the Sulfolobales and Thermococcales, which
exhibit large variable genomic regions and often carry many TA loci.
Involvement in response to nutrient deficiency and other stress
factors are highly probable and these potential functional roles are
not mutually exclusive. A rationale is provided for parts of the
highly conserved translational apparatus being the primary target
for some toxins that archaea share with bacteria. Finally, it remains to
12

e seen whether there are undiscovered archaea-specific TA systems,
or possibly hybrid systems with bacterial and archaeal antitoxintoxin
components, which exclusively target archaeal cellular
components.
References
Brügger,K., Redder,P., She,Q., Confalonieri,F., Zivanovic,Y. and
Garrett,R.A. (2002) Mobile elements in archaeal genomes. FEMS
Microbiol Letts 206: 131-141.
Christensen,S.K., and Gerdes,K. (2003) RelE toxins from bacteria and
Archaea cleave mRNAs on translating ribosomes which are
rescued by tmRNA. Mol Microbiol 48: 1389-1400.
Cooper,C.R., Daugherty,A.J., Tachdjian,S., Blum,P.H., and Kelly,R.M.
(2009) Role of vapBC toxin-antitoxin loci in the thermal stress
response of Sulfolobus solfataricus. Biochem Soc Trans 37: 123-126.
Dienemann,C., Bøggild,A., Winther,K.S. , Gerdes,K., and
Brodersen,D. (2011) Crystal structure of VapBC toxin-antitoxin
complex from Shigella flexneri reveals a hetero-octameric DNAbinding
assembly. J. Mol Biol 414: 713-722.
Eddy,S.R. (2011) Accelerated profile HMM searches. PLoS Comput
Biol 7: 10.
Filée,J., Siguier,P., and Chandler,M. (2007) Insertion sequence
diversity in archaea. Microbiol Molec Biol Revs 71: 121-157.
Gadelle,D., Filee,J., Buhler,C., and Forterre,P. (2003) Phylogenomics
of type II DNA topoisomerases. Bioessays 25: 232-242.
Garrett,R.A., Vestergaard,G., and Shah,S.A. (2011) Archaeal CRISPRbased
immune systems: exchangeable functional modules. Trends
Microbiol 19: 549-556.
Gerdes,K. (2000) Toxin-antitoxin modules may regulate synthsis of
macromolecules during nutritional stress. J Bacteriol 182: 561-572.
Gerdes,K., Christensen,S.K., and Lobner-Olesen,A. (2005)
Prokaryotic toxin-antitoxin stress response loci Nat Rev Microbiol 3:
371-382.
Gribaldo,S., Poole,A.M., Daubin,V., Forterre,P., and Brochier-
Armanet,C. (2010) The origin of eukaryotes and their
relationship with the Archaea: are we at a phylogenomic
impasse? Nat Rev Microbiol 8: 743-752.
Guo,L., Brügger,K., Liu,C., Shah,S.A., Zheng,H., Zhu,Y., et al. (2011)
Genome analyses of Icelandic strains of Sulfolobus islandicus:
Model organisms for genetic and virus-host interaction studies. J
Bacteriol 193: 1672-1680.
13

Jørgensen,M.G., Pandey,D.P., Jaskolska,M., and Gerdes,K. (2009)
HicA of Escherichia coli defines a novel family of translationindependent
mRNA transferases in bacteria and archaea. J
Bacteriol 191: 1191-1199.
Kletzin,A. (2007) General characteristics and important model
organisms. In: Archaea Molecular and Cellular Biology (Ed. R.
Cavicchioli) pp. 14-92. ASM press, Wash. DC, USA
Kurland,C.G., Collins,L.J., and Penny,D. (2006) Genomics and the
irreducible nature of eukaryotic cells. Science 312: 1011-1014.
Magnuson,R.D. (2007) Hypothetical functions of toxin-antitoxin
systems. J Bacteriol 189: 6089-6092.
Maisonneuve, E., Shakespeare,L.J., Jørgensen,M.G., and Gerdes,K.
(2011) Bacterial persistence by RNA endonucleases. Proc Natl Acad
Sci USA 108: 13206-13211.
Makarova,K.S., Grishin,N.V., and Koonin,E.V. (2009a) The HicAB
cassette, a putative novel, RNA targeting toxin-antitoxin system in
archaea and bacteria. Bioinformatics 22: 2581-2584.
Makarova,K.S., Wolf,Y.I., and Koonin,E.V. (2009b) Comprehensive
comparative-genomic analysis of Type 2 toxin-antitoxin systems
and related mobile stress response systems in prokaryotes. Biol
Direct 4: 19.
Melderen,L.V. (2010) Toxin-antitoxin systems: why so many, what
for? Curr Opin Microbiol 13: 781-785.
Neubauer,C., Gao,Y.G., Andersen,K.R., Dunham,C.M., Kelley,A.C.,
Hentschel,J., et al. (2009) The structural basis for mRNA
recognition and cleavage by the ribosome-dependent
endonuclease RelE. Cell 139: 1084-1095.
Pandey,D.P., and Gerdes,K. (2005) Toxin-antitoxin loci are highly
abundant in free-living but lost from host-associated prokaryotes.
Nucleic Acids Res 33: 966-976.
Pedersen,K., Christensen,S.K., and Gerdes,K. (2002) Rapid induction
and reversal of a bacteriostatic condition by controlled expression
of toxins and antitoxins. Mol Microbiol 45: 501-510.
Porter,K., Russ,B.E., and Dyall-Smith,M.L. (2007) Virus-host
interactions in salt lakes. Curr Opin Microbiol 10: 418-424.
Prangishvili,D., Forterre,P., and Garrett,R.A. (2006) Viruses of the
Archaea: a unifying view. Nat Rev Microbiol 11: 837-848.
Reno,M.L., Held,N.L., Fields,C.J., Burke,P.V., and Whitaker,R.J.
(2009) Sulfolobus islandicus pan-genome. Proc Natl Acad Sci USA
106: 8605-8610.
Rodriguez-Fonseca,C., Amils,R., and Garrett,R.A. (1995) Fine
structure of the peptidyl transferase centre on 23 S-like rRNAs
14

deduced from chemical probing of antibiotic-ribosome complexes.
J Molec Biol 247: 224-235.
Snyder,J.C. Bateson M.M., Lavin M., and Young M.J. (2010) Use of
cellular CRISPR (clusters of regularly interspaced short
palindromic repeats) spacer-based microarrays for detection of
viruses in environmental samples. Appl Environ Microbiol 76:
7251-7258.
Valentine,D.L. (2007) Adaptations to energy stress dictate the
ecology and evolution of archaea. Nat Rev Microbiol 5: 316-323.
Wilbur,J.S., Chivers,P.T., Mattison,K., Potter,L., Brennan,R.G., and
So,M. (2005) Neisseria gonorrheae FitA interacts with FitB to bind
DNA through its ribbon-helix-helix motif. Biochem 44: 12515–
12524.
Winther,K.S., and Gerdes,K. (2011) Enteric virulence associated
protein VapC inhibits translation by cleavage of initiator tRNA.
Proc Natl Acad Sci USA 108: 7403-7407.
Yamashiro,K., and Yamagishi,A. (2005) Characterization of the DNA
gyrase from the thermoacidophilic Archaeon Thermoplasma
acidophilum. J Bacteriol 8531-8536.
You,X-Y., Liu,C., Wang,S-Y., Jiang,C-Y., Shah,S.A., Prangishvili,D. et
al. (2011) Genomic studies of Acidianus hospitalis W1 a host for
studying crenarchaeal virus and plasmid life cycles. Extremophiles
15: 487-497.
15

Table 1 Phylogenetic tree of archaea for which complete genome
sequences are available together with the estimated number of TA
loci of the vapBC, relBE and hicAB families, and the numbers of
MNT/HEPN gene pairs. In the kingdom phyla column (P) C denotes
Crenarchaeota, E - Euryarchaeota, T - Thaumarchaeota, K -
Korarchaeota and N - Nanoarchaeota. In the Order column (O) S
denotes Sulfolobales, D - Desulfurococcales, O - Acidolobales, P -
Thermoproteales, Y - Methanopyrales, T - Thermococcales, A -
Archaeoglobales, C - Methanococcales, B - Methanobacteriales, M -
Methanomicrobiales, N - Methanosarcinales, E - Methanocellales, H -
Halobacteriales and L - Thermoplasmatales. The ecological niches of
the different organisms are indicated together with their degree of
thermophilicity, with a border of optimal growth of 50 o C. The
numbers of the different TA loci and MNT/HEPN gene pairs are
colour-shaded extending from bright red (> 20), light red (20 to 11),
pink (10 to 6), violet (5 to 3) and light blue (2 to 1). Approximate
genome sizes and the Genbank/EMBL accession numbers are given
for the genomes.
17

BIBLIOGRAPHY
[1] A F Andersson and J F Banfield. Virus population dynamics
and acquired virus resistance in natural microbial communities.
Science, 320(5879):1047–1050, May 2008.
[2] Kathryne S Auernik, Yukari Maezato, Paul H Blum,
and Robert M Kelly. The genome sequence of the
metal-mobilizing, extremely thermoacidophilic archaeon
metallosphaera sedula provides insights into bioleachingassociated
metabolism. Appl Environ Microbiol, 74(3):682–92,
Feb 2008.
[3] R Barrangou, C Fremaux, H Deveau, M Richards, P Boyaval,
S Moineau, D A Romero, and P Horvath. Crispr provides
acquired resistance against viruses in prokaryotes. Science,
315(5819):1709–1712, Mar 2007.
[4] Elizabeth R Barry and Stephen D Bell. Dna replication in
the archaea. Microbiol Mol Biol Rev, 70(4):876–87, Dec 2006.
[5] C Bath and M L Dyall-Smith. His1, an archaeal virus of
the fuselloviridae family that infects haloarcula hispanica. J
Virol, 72(11):9392–5, Nov 1998.
[6] David L Bernick, Courtney L Cox, Patrick P Dennis, and
Todd M Lowe. Comparative genomic and transcriptional
analyses of crispr systems across the genus pyrobaculum.
Front Microbiol, 3:251, 2012.
[7] A Bolotin, B Quinquis, A Sorokin, and S D Ehrlich. Clustered
regularly interspaced short palindrome repeats (crisprs)
have spacers of extrachromosomal origin. Microbiology,
151(Pt 8):2551–2561, Aug 2005.
[8] Celine Brochier, Simonetta Gribaldo, Yvan Zivanovic, Fabrice
Confalonieri, and Patrick Forterre. Nanoarchaea: representatives
of a novel archaeal phylum or a fast-evolving
euryarchaeal lineage related to thermococcales? Genome
Biol, 6(5):R42, 2005.
[9] C Brochier-Armanet, B Boussau, S Gribaldo, and P Forterre.
Mesophilic crenarchaeota: proposal for a third archaeal
195

196 Bibliography
phylum, the thaumarchaeota. Nat Rev Microbiol, 6(3):245–
252, Mar 2008.
[10] S J Brouns, M M Jore, M Lundgren, E R Westra, R J Slijkhuis,
A P Snijders, M J Dickman, K S Makarova, E V Koonin, and
J van der Oost. Small crispr rnas guide antiviral defense in
prokaryotes. Science, 321(5891):960–964, Aug 2008.
[11] Kimberly K Busiek and William Margolin. Split decision:
a thaumarchaeon encoding both ftsz and cdv cell division
proteins chooses cdv for cytokinesis. Mol Microbiol, 82(3):535–
8, Nov 2011.
[12] J Carte, R Wang, H Li, R M Terns, and M P Terns. Cas6 is
an endoribonuclease that generates guide rnas for invader
defense in prokaryotes. Genes Dev, 22(24):3489–3496, Dec
2008.
[13] L Chen, K Brügger, M Skovgaard, P Redder, Q She, E Torarinsson,
B Greve, M Awayez, A Zibat, H P Klenk, and R A
Garrett. The genome of sulfolobus acidocaldarius, a model
organism of the crenarchaeota. J Bacteriol, 187(14):4992–4999,
Jul 2005.
[14] Benoît Dayrat. The roots of phylogeny: how did haeckel
build his trees? Syst Biol, 52(4):515–27, Aug 2003.
[15] Ling Deng, Haojun Zhu, Zhengjun Chen, Yun Xiang Liang,
and Qunxin She. Unmarked gene deletion and host-vector
system for the hyperthermophilic crenarchaeon sulfolobus
islandicus. Extremophiles, 13(4):735–46, Jul 2009.
[16] James G Elkins, Mircea Podar, David E Graham, Kira S
Makarova, Yuri Wolf, Lennart Randau, Brian P Hedlund,
Céline Brochier-Armanet, Victor Kunin, Iain Anderson, Alla
Lapidus, Eugene Goltsman, Kerrie Barry, Eugene V Koonin,
Phil Hugenholtz, Nikos Kyrpides, Gerhard Wanner, Paul
Richardson, Martin Keller, and Karl O Stetter. A korarchaeal
genome reveals insights into the evolution of the archaea.
Proc Natl Acad Sci U S A, 105(23):8102–7, Jun 2008.
[17] Susanne Erdmann and Roger A Garrett. Selective and hyperactive
uptake of foreign dna by adaptive immune systems
of an archaeon via two distinct mechanisms. Mol Microbiol,
Jul 2012.

Bibliography 197
[18] Thijs J G Ettema, Ann-Christin Lindås, and Rolf Bernander.
An actin-based cytoskeleton in archaea. Mol Microbiol,
80(4):1052–61, May 2011.
[19] Roger A Garrett, David Prangishvili, Shiraz A Shah, Monika
Reuter, Karl O Stetter, and Xu Peng. Metagenomic analyses
of novel viruses and plasmids from a cultured environmental
sample of hyperthermophilic neutrophiles. Environ
Microbiol, 12(11):2918–30, Nov 2010.
[20] Roger A Garrett, Shiraz A Shah, Gisle Vestergaard, Ling
Deng, Soley Gudbergsdottir, Chandra S Kenchappa, Susanne
Erdmann, and Qunxin She. Crispr-based immune systems
of the sulfolobales: complexity and diversity. Biochem Soc
Trans, 39(1):51–7, Jan 2011.
[21] Roger A Garrett, Gisle Vestergaard, and Shiraz A Shah.
Archaeal crispr-based immune systems: exchangeable functional
modules. Trends Microbiol, 19(11):549–56, Nov 2011.
[22] Aurore Gorlas, Eugene V Koonin, Nadège Bienvenu, Daniel
Prieur, and Claire Geslin. Tpv1, the first virus isolated
from the hyperthermophilic genus thermococcus. Environ
Microbiol, 14(2):503–16, Feb 2012.
[23] I Grissa, G Vergnaud, and C Pourcel. The crisprdb database
and tools to display crisprs and to generate dictionaries of
spacers and repeats. BMC Bioinformatics, 8(1):172–172, May
2007.
[24] Soley Gudbergsdottir, Ling Deng, Zhengjun Chen, Jaide
V K Jensen, Linda R Jensen, Qunxin She, and Roger A
Garrett. Dynamic properties of the sulfolobus crispr/cas
and crispr/cmr systems when challenged with vector-borne
viral and plasmid genes and protospacers. Mol Microbiol,
79(1):35–49, Jan 2011.
[25] Li Guo, Kim Brügger, Chao Liu, Shiraz A Shah, Huajun
Zheng, Yongqiang Zhu, Shengyue Wang, Reidun K Lillestøl,
Lanming Chen, Jeremy Frank, David Prangishvili, Lars
Paulin, Qunxin She, Li Huang, and Roger A Garrett. Genome
analyses of icelandic strains of sulfolobus islandicus,
model organisms for genetic and virus-host interaction studies.
J Bacteriol, 193(7):1672–80, Apr 2011.

198 Bibliography
[26] D H Haft, J Selengut, E F Mongodin, and K E Nelson. A
guild of 45 crispr-associated (cas) protein families and multiple
crispr/cas subtypes exist in prokaryotic genomes. PLoS
Comput Biol, 1(6), Nov 2005.
[27] Caryn R Hale, Peng Zhao, Sara Olson, Michael O Duff,
Brenton R Graveley, Lance Wells, Rebecca M Terns, and
Michael P Terns. Rna-guided rna cleavage by a crispr rnacas
protein complex. Cell, 139(5):945–56, Nov 2009.
[28] M Häring, R Rachel, X Peng, R A Garrett, and D Prangishvili.
Viral diversity in hot springs of pozzuoli, italy, and characterization
of a unique archaeal virus, acidianus bottleshaped
virus, from a new family, the ampullaviridae. J Virol,
79(15):9904–9911, Aug 2005.
[29] P Horvath, A C Coûté-Monvoisin, D A Romero, P Boyaval,
C Fremaux, and R Barrangou. Comparative analysis of crispr
loci in lactic acid bacteria genomes. Int J Food Microbiol, Jul
2008.
[30] Y Ishino, H Shinagawa, K Makino, M Amemura, and A Nakata.
Nucleotide sequence of the iap gene, responsible
for alkaline phosphatase isozyme conversion in escherichia
coli, and identification of the gene product. J Bacteriol,
169(12):5429–33, Dec 1987.
[31] R Jansen, J D Embden, W Gaastra, and L M Schouls. Identification
of genes that are associated with dna repeats in
prokaryotes. Mol Microbiol, 43(6):1565–1575, Mar 2002.
[32] Matthijs M Jore, Magnus Lundgren, Esther van Duijn, Jelle B
Bultema, Edze R Westra, Sakharam P Waghmare, Blake
Wiedenheft, Umit Pul, Reinhild Wurm, Rolf Wagner, Marieke
R Beijer, Arjan Barendregt, Kaihong Zhou, Ambrosius
P L Snijders, Mark J Dickman, Jennifer A Doudna, Egbert J
Boekema, Albert J R Heck, John van der Oost, and Stan J J
Brouns. Structural basis for crispr rna-guided dna recognition
by cascade. Nat Struct Mol Biol, 18(5):529–36, May
2011.
[33] Y Kawarabayasi, Y Hino, H Horikawa, K Jin-no, M Takahashi,
M Sekine, S Baba, A Ankai, H Kosugi, A Hosoyama,
S Fukui, Y Nagai, K Nishijima, R Otsuka, H Nakazawa,
M Takamiya, Y Kato, T Yoshizawa, T Tanaka, Y Kudoh,
J Yamazaki, N Kushida, A Oguchi, K Aoki, S Masuda,

Bibliography 199
M Yanagii, M Nishimura, A Yamagishi, T Oshima, and
H Kikuchi. Complete genome sequence of an aerobic thermoacidophilic
crenarchaeon, sulfolobus tokodaii strain7.
DNA Res, 8(4):123–140, Aug 2001.
[34] M Kessel and F Klink. Archaebacterial elongation factor is
adp-ribosylated by diphtheria toxin. Nature, 287(5779):250–1,
Sep 1980.
[35] Eugene V Koonin and Kira S Makarova. Crispr-cas: an
adaptive immunity system in prokaryotes. F1000 Biol Rep,
1:95, Dec 2009.
[36] V Kunin, R Sorek, and P Hugenholtz. Evolutionary conservation
of sequence and secondary structures in crispr
repeats. Genome Biol, 8(4), Apr 2007.
[37] R K Lillestol, P Redder, R A Garrett, and K Brügger. A
putative viral defence mechanism in archaeal cells. Archaea,
2(1):59–72, Aug 2006.
[38] R K Lillestol, S A Shah, K Brügger, P Redder, H Phan,
J Christiansen, and R A Garrett. Crispr families of the
crenarchaeal genus sulfolobus: bidirectional transcription
and dynamic properties. Mol Microbiol, 72(1):259–272, Apr
2009.
[39] Nathanael G Lintner, Melina Kerou, Susan K Brumfield,
Shirley Graham, Huanting Liu, James H Naismith, Matthew
Sdano, Nan Peng, Qunxin She, Valérie Copié, Mark J
Young, Malcolm F White, and C Martin Lawrence. Structural
and functional characterization of an archaeal clustered
regularly interspaced short palindromic repeat (crispr)associated
complex for antiviral defense (cascade). J Biol
Chem, 286(24):21643–56, Jun 2011.
[40] G Lipps. Plasmids and viruses of the thermoacidophilic
crenarchaeote sulfolobus. Extremophiles, 10(1):17–28, Feb
2006.
[41] Li-Jun Liu, Xiao-Yan You, Huajun Zheng, Shengyue
Wang, Cheng-Ying Jiang, and Shuang-Jiang Liu. Complete
genome sequence of metallosphaera cuprina, a metal
sulfide-oxidizing archaeon from a hot spring. J Bacteriol,
193(13):3387–8, Jul 2011.

200 Bibliography
[42] M Lundgren, A Andersson, L Chen, P Nilsson, and
R Bernander. Three replication origins in sulfolobus species:
synchronous initiation of chromosome replication and asynchronous
termination. Proc Natl Acad Sci U S A, 101(18):7046–
7051, May 2004.
[43] K S Makarova, N V Grishin, S A Shabalina, Y I Wolf, and E V
Koonin. A putative rna-interference-based immune system
in prokaryotes: computational analysis of the predicted
enzymatic machinery, functional analogies with eukaryotic
rnai, and hypothetical mechanisms of action. Biol Direct,
1:7–7, 2006.
[44] Kira S Makarova, L Aravind, Yuri I Wolf, and Eugene V
Koonin. Unification of cas protein families and a simple
scenario for the origin and evolution of crispr-cas systems.
Biol Direct, 6:38, 2011.
[45] Kira S Makarova, Daniel H Haft, Rodolphe Barrangou, Stan
J J Brouns, Emmanuelle Charpentier, Philippe Horvath,
Sylvain Moineau, Francisco J M Mojica, Yuri I Wolf, Alexander
F Yakunin, John van der Oost, and Eugene V Koonin.
Evolution and classification of the crispr-cas systems. Nat
Rev Microbiol, 9(6):467–77, Jun 2011.
[46] Aron Marchler-Bauer, Shennan Lu, John B Anderson,
Farideh Chitsaz, Myra K Derbyshire, Carol DeWeese-Scott,
Jessica H Fong, Lewis Y Geer, Renata C Geer, Noreen R
Gonzales, Marc Gwadz, David I Hurwitz, John D Jackson,
Zhaoxi Ke, Christopher J Lanczycki, Fu Lu, Gabriele H
Marchler, Mikhail Mullokandov, Marina V Omelchenko,
Cynthia L Robertson, James S Song, Narmada Thanki, Roxanne
A Yamashita, Dachuan Zhang, Naigong Zhang, Chanjuan
Zheng, and Stephen H Bryant. Cdd: a conserved
domain database for the functional annotation of proteins.
Nucleic Acids Res, 39(Database issue):D225–9, Jan 2011.
[47] L A Marraffini and E J Sontheimer. Crispr interference limits
horizontal gene transfer in staphylococci by targeting dna.
Science, 322(5909):1843–1845, Dec 2008.
[48] Luciano A Marraffini and Erik J Sontheimer. Self versus
non-self discrimination during crispr rna-directed immunity.
Nature, Jan 2010.

Bibliography 201
[49] F J Mojica, C Díez-Villaseñor, J García-Martínez, and C Almendros.
Short motif sequences determine the targets of
the prokaryotic crispr defence system. Microbiology, 155(Pt
3):733–740, Mar 2009.
[50] F J Mojica, C Díez-Villaseñor, J García-Martínez, and E Soria.
Intervening sequences of regularly spaced prokaryotic repeats
derive from foreign genetic elements. J Mol Evol,
60(2):174–182, Feb 2005.
[51] F J Mojica, C Díez-Villaseñor, E Soria, and G Juez. Biological
significance of a family of regularly spaced repeats in
the genomes of archaea, bacteria and mitochondria. Mol
Microbiol, 36(1):244–246, Apr 2000.
[52] Sabin Mulepati, Amberly Orr, and Scott Bailey. Crystal
structure of the largest subunit of a bacterial rna-guided
immune complex and its role in dna target binding. J Biol
Chem, 287(27):22445–9, Jun 2012.
[53] Ki Hyun Nam, Charles Haitjema, Xueqi Liu, Fran Ding,
Hongwei Wang, Matthew P Delisa, and Ailong Ke. Cas5d
protein processes pre-crrna and assembles into a cascadelike
interference complex in subtype i-c/dvulg crispr-cas
system. Structure, 20(9):1574–84, Sep 2012.
[54] Takuro Nunoura, Yoshihiro Takaki, Jungo Kakuta, Shinro
Nishi, Junichi Sugahara, Hiromi Kazama, Gab-Joo Chee,
Masahira Hattori, Akio Kanai, Haruyuki Atomi, Ken Takai,
and Hideto Takami. Insights into the evolution of archaea
and eukaryotic protein modifier systems revealed by the genome
of a novel archaeal group. Nucleic Acids Res, 39(8):3204–
23, Apr 2011.
[55] Maija K Pietilä, Elina Roine, Lars Paulin, Nisse Kalkkinen,
and Dennis H Bamford. An ssdna virus infecting archaea:
a new lineage of viruses with a membrane envelope. Mol
Microbiol, 72(2):307–19, Apr 2009.
[56] André Plagens, Britta Tjaden, Anna Hagemann, Lennart
Randau, and Reinhard Hensel. Characterization of the crispr/cas
subtype i-a system of the hyperthermophilic crenarchaeon
thermoproteus tenax. J Bacteriol, 194(10):2491–500,
May 2012.

202 Bibliography
[57] C Pourcel, G Salvignol, and G Vergnaud. Crispr elements
in yersinia pestis acquire new repeats by preferential uptake
of bacteriophage dna, and provide additional tools for
evolutionary studies. Microbiology, 151(Pt 3):653–663, Mar
2005.
[58] D Prangishvili, P Forterre, and R A Garrett. Viruses of the
archaea: a unifying view. Nat Rev Microbiol, 4(11):837–848,
Nov 2006.
[59] D Prangishvili, G Vestergaard, M Häring, R Aramayo,
T Basta, R Rachel, and R A Garrett. Structural and genomic
properties of the hyperthermophilic archaeal virus atv
with an extracellular stage of the reproductive cycle. J Mol
Biol, 359(5):1203–1216, Jun 2006.
[60] G Pühler, H Leffers, F Gropp, P Palm, H P Klenk, F Lottspeich,
R A Garrett, and W Zillig. Archaebacterial dnadependent
rna polymerases testify to the evolution of the
eukaryotic nuclear genome. Proc Natl Acad Sci U S A,
86(12):4569–73, Jun 1989.
[61] Marco Punta, Penny C Coggill, Ruth Y Eberhardt, Jaina
Mistry, John Tate, Chris Boursnell, Ningze Pang, Kristoffer
Forslund, Goran Ceric, Jody Clements, Andreas Heger, Liisa
Holm, Erik L L Sonnhammer, Sean R Eddy, Alex Bateman,
and Robert D Finn. The pfam protein families database.
Nucleic Acids Res, 40(Database issue):D290–301, Jan 2012.
[62] P Redder, X Peng, K Brügger, S A Shah, F Roesch,
B Greve, Q She, C Schleper, P Forterre, R A Garrett, and
D Prangishvili. Four newly isolated fuselloviruses from
extreme geothermal environments reveal unusual morphologies
and a possible interviral recombination mechanism.
Environ Microbiol, Jul 2009.
[63] W D Reiter, P Palm, S Yeats, and W Zillig. Gene expression
in archaebacteria: physical mapping of constitutive and uvinducible
transcripts from the sulfolobus virus-like particle
ssv1. Mol Gen Genet, 209(2):270–5, Sep 1987.
[64] M L Reno, N L Held, C J Fields, P V Burke, and R J Whitaker.
Biogeography of the sulfolobus islandicus pan-genome. Proc
Natl Acad Sci U S A, 106(21):8605–8610, May 2009.
[65] Christine Rousseau, Jacques Nicolas, and Mathieu Gonnet.
Crispi: a crispr interactive database. Bioinformatics, Oct 2009.

Bibliography 203
[66] Rachel Y Samson, Takayuki Obita, Stefan M Freund, Roger L
Williams, and Stephen D Bell. A role for the escrt system in
cell division in archaea. Science, 322(5908):1710–3, Dec 2008.
[67] Ekaterina Semenova, Matthijs M Jore, Kirill A Datsenko,
Anna Semenova, Edze R Westra, Barry Wanner, John van der
Oost, Stan J J Brouns, and Konstantin Severinov. Interference
by clustered regularly interspaced short palindromic repeat
(crispr) rna is governed by a seed sequence. Proc Natl Acad
Sci U S A, 108(25):10098–103, Jun 2011.
[68] S A Shah, N R Hansen, and R A Garrett. Distribution of
crispr spacer matches in viruses and plasmids of crenarchaeal
acidothermophiles and implications for their inhibitory
mechanism. Biochem Soc Trans, 37(Pt 1):23–28, Feb 2009.
[69] Shiraz A Shah and Roger A Garrett. Crispr/cas and cmr
modules, mobility and evolution of adaptive immune systems.
Res Microbiol, 162(1):27–38, Jan 2011.
[70] Q She, R K Singh, F Confalonieri, Y Zivanovic, G Allard,
M J Awayez, C C Chan-Weiher, I G Clausen, B A Curtis,
A De Moors, G Erauso, C Fletcher, P M Gordon, I Heikampde
Jong, A C Jeffries, C J Kozera, N Medina, X Peng, H P
Thi-Ngoc, P Redder, M E Schenk, C Theriault, N Tolstrup,
R L Charlebois, W F Doolittle, M Duguet, T Gaasterland, R A
Garrett, M A Ragan, C W Sensen, and J Van der Oost. The
complete genome of the crenarchaeon sulfolobus solfataricus
p2. Proc Natl Acad Sci U S A, 98(14):7835–7840, Jul 2001.
[71] Daan C Swarts, Cas Mosterd, Mark W J van Passel, and Stan
J J Brouns. Crispr interference directs strand specific spacer
acquisition. PLoS One, 7(4):e35888, 2012.
[72] T H Tang, J P Bachellerie, T Rozhdestvensky, M L Bortolin,
H Huber, M Drungowski, T Elge, J Brosius, and A Hüttenhofer.
Identification of 86 candidates for small nonmessenger
rnas from the archaeon archaeoglobus fulgidus.
Proc Natl Acad Sci U S A, 99(11):7536–7541, May 2002.
[73] David L Valentine. Adaptations to energy stress dictate the
ecology and evolution of the archaea. Nat Rev Microbiol,
5(4):316–23, Apr 2007.
[74] John van der Oost, Matthijs M Jore, Edze R Westra, Magnus
Lundgren, and Stan J J Brouns. Crispr-based adaptive

204 Bibliography
and heritable immunity in prokaryotes. Trends Biochem Sci,
34(8):401–7, Aug 2009.
[75] G Vestergaard, S A Shah, A Bize, W Reitberger, M Reuter,
H Phan, A Briegel, R Rachel, R A Garrett, and D Prangishvili.
Stygiolobus rod-shaped virus and the interplay of crenarchaeal
rudiviruses with the crispr antiviral system. J Bacteriol,
190(20):6837–6845, Oct 2008.
[76] Michaela Wagner, Silvia Berkner, Malgorzata Ajon, Arnold
J M Driessen, Georg Lipps, and Sonja-Verena Albers. Expanding
and understanding the genetic toolbox of the hyperthermophilic
genus sulfolobus. Biochem Soc Trans, 37(Pt
1):97–101, Feb 2009.
[77] Finn Werner and Dina Grohmann. Evolution of multisubunit
rna polymerases in the three domains of life. Nat Rev
Microbiol, 9(2):85–98, Feb 2011.
[78] Edze R Westra, Benedikt Nilges, Paul B G van Erp, John
van der Oost, Remus T Dame, and Stan J J Brouns. Cascademediated
binding and bending of negatively supercoiled
dna. RNA Biol, 9(9), Sep 2012.
[79] Edze R Westra, Paul B G van Erp, Tim Künne, Shi Pey Wong,
Raymond H J Staals, Christel L C Seegers, Sander Bollen,
Matthijs M Jore, Ekaterina Semenova, Konstantin Severinov,
Willem M de Vos, Remus T Dame, Renko de Vries, Stan
J J Brouns, and John van der Oost. Crispr immunity relies
on the consecutive binding and degradation of negatively
supercoiled invader dna by cascade and cas3. Mol Cell,
46(5):595–605, Jun 2012.
[80] Blake Wiedenheft, Gabriel C Lander, Kaihong Zhou, Matthijs
M Jore, Stan J J Brouns, John van der Oost, Jennifer A
Doudna, and Eva Nogales. Structures of the rna-guided surveillance
complex from a bacterial immune system. Nature,
477(7365):486–9, Sep 2011.
[81] Blake Wiedenheft, Esther van Duijn, Jelle B Bultema, Jelle
Bultema, Sakharam P Waghmare, Sakharam Waghmare,
Kaihong Zhou, Arjan Barendregt, Wiebke Westphal, Albert
J R Heck, Albert Heck, Egbert J Boekema, Egbert Boekema,
Mark J Dickman, Mark Dickman, and Jennifer A Doudna.

Bibliography 205
Rna-guided complex from a bacterial immune system enhances
target recognition through seed sequence interactions.
Proc Natl Acad Sci U S A, 108(25):10092–7, Jun 2011.
[82] C R Woese and G E Fox. Phylogenetic structure of the
prokaryotic domain: the primary kingdoms. Proc Natl Acad
Sci U S A, 74(11):5088–90, Nov 1977.
[83] C R Woese, O Kandler, and M L Wheelis. Towards a natural
system of organisms: proposal for the domains archaea,
bacteria, and eucarya. Proc Natl Acad Sci U S A, 87(12):4576–
9, Jun 1990.
[84] Ido Yosef, Moran G Goren, and Udi Qimron. Proteins and
dna elements essential for the crispr adaptation process in
escherichia coli. Nucleic Acids Res, 40(12):5569–76, Jul 2012.
[85] Xiao-Yan You, Chao Liu, Sheng-Yue Wang, Cheng-Ying Jiang,
Shiraz A Shah, David Prangishvili, Qunxin She, Shuang-
Jiang Liu, and Roger A Garrett. Genomic analysis of acidianus
hospitalis w1 a host for studying crenarchaeal virus
and plasmid life cycles. Extremophiles, 15(4):487–97, Jul 2011.
[86] Jing Zhang, Christophe Rouillon, Melina Kerou, Judith
Reeks, Kim Brugger, Shirley Graham, Julia Reimann,
Giuseppe Cannone, Huanting Liu, Sonja-Verena Albers,
James H Naismith, Laura Spagnolo, and Malcolm F White.
Structure and mechanism of the cmr complex for crisprmediated
antiviral immunity. Mol Cell, 45(3):303–13, Feb
2012.