Complete issue - IMA Fungus

The Global
Mycological Journal
Volume 4 · No. 1 · June 2013
NEWS · REPORTS · AWARDS AND PERSONALIA · RESEARCH NEWS
BOOK NEWS · forthcoming MEETINGS · ARTICLES

Colofon
IMA Fungus
Compiled by the International
Mycological Association for the
world’s mycologists.
Scope: All aspects of pure and
applied mycological research and
news.
Aims: To be the flagship journal
of the International Mycological
Association. IMA FUNGUS is
an international, peer-reviewed,
open-access, full colour, fast-track
journal.
Frequency: Published twice per year
(June and December). Articles are
published online with final pagination
as soon as they have been
accepted and edited.
ISSN
E-ISSN
2210-6340 (print)
2210-6359 (online)
Websites: www. imafungus.org
www.ima-mycology.org
E-mail: d.hawksworth@nhm.ac.uk
Volume 4 · No. 1 · June 2013
Cover: Puccinia psidii on
Syzygium jambos leaves in
Australia. See pp. 155–159 of this
issue. Photo by Jolanda Roux.
EDITORIAL BOARD
Editor-in-Chief
Prof. dr D.L. Hawksworth CBE, Departamento de Biología Vegetal II, Facultad de Farmacia, Universidad Complutense
de Madrid, Plaza Ramón y Cajal, 28040 Madrid, Spain; and Department of Life Sciences, The Natural History
Museum, Cromwell Road, London SW7 5BD, UK; E-mail: d.hawksworth@nhm.ac.uk
Managing Editor
Prof. dr P.W. Crous, CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD Utrecht, The Netherlands;
E-mail: p.crous@cbs.knaw.nl
Layout Editors
M.J. van den Hoeven-Verweij & M. Vermaas, CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD
Utrecht, The Netherlands; E-mail: m.verweij@cbs.knaw.nl
Associate Editors
Dr T.V. Andrianova, M.G. Kholodny Institute of Botany, Tereshchenkivska Street 2, Kiev, MSP-1, 01601, Ukraine;
E-mail: tand@darwin.relc.com
Prof. dr D. Begerow, Lehrstuhl für Evolution und Biodiversität der Pflanzen, Ruhr-Universität Bochum, Universitätsstr.
150, Gebäude ND 03/174, 44780, Bochum, Germany; E-mail: dominik.begerow@rub.de
Dr S. Cantrell, Department of Plant Pathology and Crop Physiology, Louisiana State University, Agricultural Centre, 455 Life
Sciences Bldg., Baton Rouge, LA 70803, USA; E-mail: scantrel@suagm.edu
Prof. dr D. Carter, Discipline of Microbiology, School of Molecular Biosciences, Building G08, University of Sydney,
NSW 2006, Australia; E-mail: d.carter@mmb.usyd.edu.au
Prof. dr J. Dianese, Departamento de Fitopatologia, Universidade de Brasília, 70910-900 Brasília, D.F., Brasil; E-mail:
jcarmine@unb.br
Dr P.S. Dyer, School of Biology, Institute of Genetics, University of Nottingham, University Park, Nottingham NG7
2RD, UK; E-mail: paul.dyer@nottingham.ac.uk
Dr M. Gryzenhout, Dept. of Plant Sciences, University of the Free State, P.O. Box 339, Bloemfontein 9300, South
Africa; E-mail: Gryzenhoutm@ufs.ac.za
Prof. dr L. Guzman-Davalos, Instituto de Botánica, Departamento de Botánica y Zoología, Universidad de Guadalajara,
A.P. 1-139 Zapopan, 45101, México; E-mail: lguzman@cucba.udg.mx
Dr K. Hansen, Kryptogambotanik Naturhistoriska Riksmuseet, Box 50007, 104 05 Stockholm, Sweden; E-mail: karen.
hansen@nrm.se
Prof. dr K.D. Hyde, School of Science, Mae Fah Luang University, Tasud, Chiang Rai, Thailand; E-mail: kdhyde3@
gmail.com
Prof. dr L. Lange, Vice Dean, The Faculties of Engineering, Science and Medicine, Aalborg University; Director of
Campus, Copenhagen Institute of Technology (CIT), Lautrupvang 15, DK-2750 Ballerup, Denmark; E-mail: lla@
adm.aau.dk
Prof. dr L. Manoch, Department of Plant Pathology, Faculty of Agriculture, Kasetsart University, Bangkok 10900,
Thailand; E-mail: agrlkm@ku.ac.th
Prof. dr W. Meyer, Molecular Mycology Research Laboratory, CIDM, ICPMR, Level 3, Room 3114A, Westmead
Hospital, Darcy Road, Westmead, NSW, 2145, Australia; E-mail: w.meyer@usyd.edu.au
Dr D. Minter, CABI Bioservices, Bakeham Lane, Egham, Surrey, TW20 9TY, UK; E-mail: d.minter@cabi.org
Dr L. Norvell, Pacific Northwest Mycology Service, LLC, 6720 NW Skyline Boulevard, Portland, Oregon 97229-1309,
USA; E-mail: llnorvell@pnw-ms.com
Dr G. Okada, Microbe Division / Japan Collection of Microorganisms, RIKEN BioResource Center, 2-1 Hirosawa,
Wako, Saitama 351-0198, Japan; E-mail: okada@jcm.riken.jp
Prof. dr N. Read, Fungal Cell Biology Group, Institute of Cell and Molecular Biology, Rutherford Building, University
of Edinburgh, Edinburgh EH9 3JH, UK; E-mail: nick@fungalcell.org
Prof. dr K.A. Seifert, Research Scientist / Biodiversity (Mycology and Botany), Agriculture & Agri-Food Canada, K.W.
Neatby Bldg, 960 Carling Avenue, Ottawa, ON, K1A OC6, Canada; E-mail: seifertk@agr.gc.ca
Prof. dr J.W. Taylor, Department of Plant and Microbial Biology, University of California, 111 Koshland Hall, Berkeley,
CA 94720, USA; E-mail: jtaylor@berkeley.edu
Prof. dr M.J. Wingfield, Forestry and Agricultural Research Institute (FABI), University of Pretoria, Pretoria 0002,
South Africa; E-mail: mike.wingfield@fabi.up.ac.za
Prof. dr W.-Y. Zhuang, Systematic Mycology and Lichenology Laboratory, Institute of Microbiology, Chinese Academy
of Sciences, Beijing 100080, China; E-mail: zhuangwy@sun.im.ac.cn
ima fUNGUS

Mycospeak and Biobabble
“There are at least thirty kinds of biologist, each with a mutually incomprehensible ‘biobabble’.”
James Lovelock (The Times 65257 (3 May): 23, 1995).
Mycologists are often accused of
using terminologies that are not
immediately understood by biologists
as a whole. A topical example is that
of anamorph and teleomorph, rather than either
the immediately understood asexual and
sexual, or the now less-used alternative mitotic
and meiotic. In descriptions, there is also a
tendency to follow tradition. Some commonly
used adjectives likely to be understood
by those with some knowledge of Latin or
Greek, but not so readily by others. Amongst
numerous examples are coprophilous, corticolous,
epiphyllous, lignicolous, mycobiont, and
saxicolous rather than on dung, on bark, on
leaves, on wood, fungal partner, and on rock. In
descriptions examples are manifold, such as
moniliform for in chains, punctate for spotted,
reniform for kidney-shaped, and verrucose for
warty. It is good practice when editing or
reviewing papers, to always ask “is that term
really necessary or appropriate?”
Rambold et al. (2013) have argued
for the recognition of mycology as a
separate field in biology, and one element
of establishing that distinctness is the use
of special terms where they are justified.
This point is stressed by Jens H. Petersen,
author of The Fungal Kingdom (Petersen
2012), in an interview on pp. (21)–(22)
of this issue of IMA Fungus: “We have to
insist that fungi are not ‘Lower Plants’,
their occurrence in nature should not be
called flora but funga, they are not kept in
herbaria but in fungaria, etc. We have to
insist on their uniqueness, . . . “ – although
I personally prefer mycobiota to funga (and
also avoid mycota as a term indicating the
rank of phylum). As many mycologists
will perhaps be aware, I have also refrained
from publishing on mycological matters in
journals and books which have ‘botany’ in
their titles since IMC5 (Vancouver) in 1994
to help address this issue of subject identity
(Hawksworth 1995), and this practice is
advocated for adoption by all mycologists in
the MycoAction Plan (Hawksworth 2003).
At the same time, the adoption of terms
from other areas of biology for dissimilar
structures can mislead, and even give
subliminal impressions of affinity where
there is none. One term which continues
to mislead, and is still in widespread use by
mycologists, is fruiting and fruiting body.
This is so entrenched, and surely was an
oversight in Petersen’s book, but persists in
conveying the subliminal connotation that
these structures are comparable to the fruits
of plants. A fruit is a “seed bearing organ,
with or without adnate parts” (Beentje
2010). Fungi do not have seeds, so cannot
have fruits, so why do many mycologists
persist with using this anachronism? What
fungi do have is spores, so logically we
should always adopt either sporocarp or
sporophore for fruit body, and sporing for
fruiting? The term carpophore is better
avoided; it has been used both for the stipe
region of basidomes, and also the carpelbearing
structure in some plants.
Communication amongst mycologists,
with other biologists, and also citizen
scientists, will surely be facilitated if we
all resolve to: (1) use ‘mycospeak’ terms
when they are necessary, for either features
unique to fungi, to enhance precision, or
to assert the identity of the discipline; and
(2) simultaneously eliminate biobabble that
merely obfuscates.
Beentje H (2010) The Kew Plant Glossary: an
illustrated dictionary of plant terms. Kew: Kew
Publishing.
Hawksworth DL (1995) Challenges in mycology.
Mycological Research 99: 127–128.
Hawksworth DL (2003) Monitoring and
safeguarding fungal resources worldwide:
the need for an international collaborative
MycoAction Plan. Fungal Diversity 13: 29–45.
Petersen, JH (2012) The Kingdom of Fungi.
Princeton, NJ: Princeton University Press.
Rambold G, Stadler M, Begerow D (2013)
Mycology should be recognized as a field of
biology at eye level with other major disciplines
– a memorandum. Mycological Progress DOI:
10.1007/s11557-013-0902x.
David L. Hawksworth
Editor-in-Chief, IMA Fungus
(d.hawksworth@nhm.ac.uk)
Clavaria argillacea: fruit-body or sporophore?
EDITORIAL
volume 4 · no. 1
(1)

News
Novel Royal Penicillium Species
Colony texture on MEA, showing the large masses
of characteristic orange sclerotia produced by
P. vanoranjei.
Colonies of Penicillium vanoranjei (CBS 134406T) on CYA, MEA and YES from left to right (top = obverse,
bottom = reverse).
Scientists at the CBS-KNAW Fungal
Biodiversity Centre in Utrecht, The
Netherlands, part of the Royal Dutch
Academy of Sciences (KNAW), discovered
five new Penicillium species. Unique to this
small group and something very uncommon
for Penicillium, was the orange (Dutch
= oranje) colours produced in culture.
As a result, they decided to name one of
the orange penicillia after King Willem-
Alexander of The Netherlands to coincide
with his inauguration on 30 April 2013.
His family members, Queen Máxima and
their daughters, Princesses Amalia, Alexia
and Ariane were also honoured, with the
remaining species named after them.
This is not the first time that scientists
honoured royal patronage in such a fashion,
with Galileo naming the moons of Jupiter
as “The Medici Stars” after his royal patrons.
Other “royal” organisms include a mollusc
(Mitra kamehameha, named after King
Kamehameha I of the Hawaiian Islands),
a fruit-fly (Paroxyna messalina, named
after Cleopatra VII), squid (Lepidoteuthis
grimaldii, named after Prince Albert
I of Monaco), the tiger moth of Tibet
(Orontobia dalailama, named after the Dalia
Lama), a gazelle (Gazella bilkis, named
after the Queen of Sheba), and a water
lily (Victoria regina, named after Queen
Victoria of the United Kingdom of Great
Britain and Ireland). Also a protein, used for
predicting heart failures, was named after
former Queen Beatrix of The Netherlands
by researchers from Maastricht.
The research paper, “Five new
Penicillium species in section Sclerotiora:
a tribute to the Dutch Royal family” was
made available online on 9 April 2013
(Persoonia 31: 42–62, http://www.
persoonia.org). The online publication
coincided with the CBS Spring Symposium,
One Fungus:Which Gene(s) (1F = ?G),
where a framed description of P. vanoranjei
was handed over to the scientific director
of the KNAW, Theo Mulder. There was
also good press coverage on this remarkable
event – including numerous newspaper
articles, especially online reports, television
coverage, and also two radio interviews with
the authors. Social media sources, such as
Twitter, helped to quickly spread the news
internationally, leading to international
newspaper coverage. The positive impact
that Penicillium species can have on human
lives was also explained. For example,
that Penicillium species are used for the
production of antibiotics (penicillin),
and other drugs, as well as the production
Scanning electron microscope photo of
P. vanoranjei, showing the typical monoverticillate
conidiophore and its chains of finely roughened
conidia.
of fermented cheeses (P. roqueforti, P.
camemberti) and sausages (P. nalgiovense).
The media coverage was quite unexpected.
However, we consider the whole experience
extremely valuable for spreading public
awareness and to make people aware of this
important and fascinating kingdom.
Headline from the Dutch Newspaper "De
Volkskrant" (scientific section) reading "An orange
fungus for the new King and his family".
(2)
ima fUNGUS

Cultures of lichen-forming fungi available for experimental
work
NEWS
The availability of pure cultures of the
fungal partners of lichen associations has
been a major constraint on the range of in
vitro experiments possible to investigate
the biology of these intriguing and highly
successful mutualisms. Now, McDonald et
al. (2013) have announced the availability
of cultures of 25 species from 12 genera
belonging to five different orders of
ascomycetes. That these are of the species
indicated was verified by ITS and mSSU
sequence data. The cultures are all now
available from CBS, as well as from the
authors. Further, the whole genomes of
three of these cultures are indicated as
having been sequenced: those of Acarospora
strigata, Cladonia grayi, and Graphis scripta.
There are now possibilities for comparative
studies at the genomic level of the nature of
the lichen symbiosis and the interactions of
the fungal and photosynthetic partners. The
article also describes in detail the methods
of isolation and culture which have proved
so successful, and that information will be
of particular value to mycologists wishing to
isolate other species.
McDonald T, Gata E, Lutzoni F (2013) Twentyfive
cultures of lichenized fungi available for
experimental studies on symbiotic systems.
Symbiosis 59: 165–171.
Cultures of the lichen-forming fungi Acarospora cf.
contigua and Usnea strigosa. Bars = 2 mm. Photos
Tami McDonald.
Plant Health regulations can impede fungal research
and exploitation
Attention has been drawn to the anomalous
situation whereby, in order to obtain a
license to import live fungal cultures into
the UK, they first must be named, and
then have been assessed for their risk to
plant health (Hawksworth & Dentinger
2013). This means that, even if appropriate
permissions have been obtained from
originating countries in compliance with
regulations drawn up under the Convention
on Biological Diversity, no living cultures
of previously undescribed fungi can legally
be brought into the country. This applies
to cultures required for phylogenetic or
experimental study, or for assessments
for exploitable properties – and does not
involve any consideration of containment
facilities or the types or locations of
laboratories where they would be examined.
The authors consider the main risks for
plant health to be viable spores brought
into the country accidentally, for example in
dust and soil on vehicles, shoes, packaging,
migrating birds or insects, and horticultural
products. Imported fungi are surely likely to
pose the least risk to plants when confined
to laboratories where they are handled by
suitably trained mycologists or technicians
– the people likely to be most aware of any
potential risks. Fortunately, not all countries
have such stringent regulations, but where
they do the appropriate authorities need
to be aware that much of their effort may
be misdirected. As Colin Booth (1924–
2003), the first Secretary-General of the
IMA (1971–77), once remarked, perhaps
cynically, that “regulations never stopped
any fungus entering the country”.
Hawksworth DL, Dentinger BTM (2013)
Antibiotics: relax UK import rule on fungi.
Nature 496: 169.
Progress on preparing Lists of Protected Names
Progress on preparing Lists of Protected
Names was reviewed during the Spring
Symposia organized by the CBS-KNAW
Fungal Biodiversity Centre in Amsterdam
on 10–12 April 2013 1 . While considerable
progress was evident in some groups of
fungi, it was recognized that much needed
to be done if a series of lists was to be
ready in time for consideration at IMC10
in August 2014. If that slot is missed, it
may be difficult to achieve that status for
many names by the International Botanical
Congress in 2017 – if that occasion were
missed the next date for adoption under
the current rules would be 2023. In order
to accelerate the process, it was suggested
that a draft List of Protected Generic Names
be prepared as a basis for discussion, and
made available for comment as soon as
possible. That work is currently in progress,
drawing in particular on data in the Index
1
See also p. (7) in this issue.
volume 4 · no. 1
(3)

News
Fungorum and MycoBank databases,
and also the generic typification project
prudently initiated independently by Joost
A. Stalpers 1 .
The discussion session at the meeting also
favoured the:
(1) Use of the terms Protected vs Suppressed
Lists over Accepted vs Rejected and
some other possibilities suggested.
(2) Lists of Protected Names being
protected against unlisted names.
(3) Treatment names of morphs of a
species with the same epithet as new
combinations and not as new species,
with appropriate changes in author
citation 2 .
(4) Inclusion of lichen-forming fungi in the
Protected Lists.
Each of these four issues will necessitate
changes in the International Code of
Nomenclature for algae, fungi, and plants.
It is envisaged that formal proposals to
that end will be prepared for publication
in Taxon in early 2014, so that they can be
debated and considered in depth at IMC10.
1
See p. (19) in this issue.
2
See Hawksworth et al. (IMA Fungus 4 (1): 53–56,
June 2013)
APS-MSA joint meeting this summer
Downtown Skyline. Photo courtesy of Austin City Visitor’s Bureau (ACVB).
Texas State Capitol at Night. Austin City Visitor’s
Bureau (ACVB). Photo by Frederica Georgia.
The American Phytopathological Society
(APS) and the Mycological Society of
America (MSA) are looking forward to a
joint annual meeting from 10–14 August
in Austin, Texas. The meeting will begin
10 August with a foray to one of Austin’s
best outdoor destinations, the Barton
Creek Greenbelt. Novices and experts
alike will have a chance to foray for fungi
and at mid-morning, participants will
return to Austin’s Convention Center to
examine and identify specimens and listen
to a lecture about Texas mushrooms by
Clark Ovrebo (Department of Biology,
University of Central Oklahoma). The
annual Karling Lecture will feature
internationally recognized fungal
interactions expert Barbara Howlett
(University of Melbourne) presenting
“Evolution and virulence in fungal
pathogens of plants.” MSA President Mary
Berbee (University of British Columbia),
will give the annual Presidential Address
that is sure to be a meeting highlight.
Twenty-five symposia are being offered
that span the diversity of plant pathology
and mycology, including comparative
fungal genomics with MycoCosm,
genotyping-by-sequencing, fungal ecology,
fungal cell biology, plant symbiotic fungi,
graminicolous downy mildews, diversity of
wood decay systems, and impact of recent
changes in fungal nomenclature heralded
“one fungus, one name.” In addition to
the symposia, there will be 200 oral and
several hundred poster presentations. More
information can be obtained at http://
www.apsnet.org/meetings/annual/Pages/
default.aspx.
Known as the live music capital of the
world, Austin’s lively night life and broad
selection of fine dining establishments
should appeal to everyone in attendance.
Planning is also underway for the 2014
MSA meeting at Michigan State University
in July/Aug (dates to be determined) and
the International Mycological Congress
(IMC10) in Bangkok, Thailand from
3–8 August 2014. Keep your eye on the
MSA website (http://www.msafungi.
org) for more details! Information about
membership in MSA can be found at
http://msafungi.org/membership.
Lori Carris
Executive Vice-President, Mycological Society
of America (MSA)
(carris@wsu.edu)
(4)
ima fUNGUS

Interested in hosting IMC11 (2018)?
Under the Statutes of the IMA (http://
www.ima-mycology.org/society/statutes),
the deadline for receipt of pre-proposals
from Member Mycological Organizations
(MMOs) to host the next International
Mycological Congress is 12 months before
the date of the current IMC – 2 August
2013. The pre-proposals will then be
reviewed by the Executive Committee, and a
vote to solicit full proposals from not fewer
than two of the MMOs submitting preproposals
is due not later than 10 months
before the date of the current IMC – 2
October 2013.
Full proposals to host the next IMC
must then be received by the Secretary-
General for distribution to the Executive
Committee not later than six months
before the current IMC – 2 February 2014.
The venues and dates for the next IMC
will then be voted on by the Executive
Committee not later than three months
before the current IMC. The President and
Secretary-General will visit the proposed
venue selected by the Executive Committee
before final ratification by the Executive
Committee. The final decision will then be
announced to the General Assembly of the
IMA, to be held at the upcoming IMC.
For further information, or to submit
a pre-proposal, contact the IMA Secretary-
General, Dominik Begerow (dominik.
begerow@rub.de).
NEWS
IMA Fungus citations take-off
IMA Fungus was launched at the IMC9
meeting in Edinburgh (2010), with the
aim to grow to become the Nature of
mycology. The journal contains a range of
items including news, reports, upcoming
meetings, book launches, book news, etc.,
and of course, original research papers and
reviews. The IMA Executive Committee
decided to support the journal in the “Open
Access” model, with the IMA paying for the
online publication of content. The editorial
board rotates every four years (coinciding
with the IMC congresses). Furthermore,
the journal also has an Editor-in-Chief
(David L. Hawksworth), Managing Editor
(Pedro W. Crous), and Layout Editor
(Manon Verweij). The IMA chose to use
Ingenta Connect as online publisher,
but also obtained a listing in PubMed
Central for full content, in addition to
its own website from where PDFs can be
downloaded. Since the journal was launched
(the first issue containing the mammoth
article by Emory Simmons, dealing with
the turbulent history of the IMA), IMA
Fungus has attracted some influential
articles and editorials, namely “A new dawn
for the naming of fungi” (Hawksworth DL,
2011 – 62 citations in Google Scholar),
“The Amsterdam declaration on Fungal
Nomenclature” (Hawksworth DL, et al.,
2011 – 71 citations), “Cryptic species
in lichen-forming fungi” (Crespo A, et
al., 2010 – 34 citations), “Advances in
Glomeromycota taxonomy” (F. Oehl et al.,
2011 – 28 citations), and “How to describe
a new fungal species” (Seifert KA, Rossman
AY, 2011 – 29 citations), to name but a few.
The journal is well-read (judging from
the huge number of downloads), and papers
and content of IMA Fungus already account
for 16 700 citations in Google Scholar
( June 2013). IMA Fungus presently has an
H-index of 7 (Web of Knowledge), which
means it is already making progress in the
field mycology, compared to other new
journals in the field (e.g. Fungal Biology at
12).
IMA Fungus is presently being evaluated
for inclusion in Scopus, and the next three
issues will also be evaluated by Thomson
Reuters, meaning that if all goes well, IMA
Fungus should have its first official Impact
factor by 2015, to appear in the Journal
Citation reports ( JCR) to be published in
June 2016.
volume 4 · no. 1
(5)

REPORTS
IMA Executive Committee Meeting 2013
Members of the IMA Executive Committee
The IMA Executive Committee met for
its annual meeting on 12 April 2013 in
Utrecht in conjunction with the CBS
spring symposium “One Fungus : Which
Gene(s)?” Here, I wish to highlight topics
that stimulated the most active discussion.
The IMA Executive Committee
acknowledged the great progress of the Thai
organizers of IMC10 in Bangkok. IMC10
Steering Committee co-chair, Leka Manoch
reported on behalf of the committee and
co-chair, Morakot Tanticharoen, on the
efforts of the local team to make IMC10
a success. The conference will be held at
Queen Sirikit National Conference Center,
which is located in the heart of Bangkok
and provides the charm of Thailand and all
the needs of a modern conference centre.
Needless to say, major organizational steps
have been achieved and the professional
conference organizer (PCO), webpage
(http://www.imc10.kasetsart.org) and local
arrangements committees are already in
place and discharging their duties.
During the past few months, the
Scientific Committee of IMC10 was
established and the themes of the conference
have been set. To cover the broad interest
of mycologists, seven themes will guide the
conference and each of them will have its
own and interdisciplinary sessions. Thus
all aspects from cell biology, genomics,
pathogenesis, ecology, evolution, and
diversity to biotechnology will be addressed.
Your participation is welcomed and you
are strongly encouraged to visit the IMC10
webpage (http://www.imc10.kasetsart.org)
where you can register your interest and
propose symposia and workshop topics.
Beside the main focus on the scientific
quality of IMC, the steering committee
around Leka Manoch and Morakot
Tanticharoen has also started to organize
a social program to offer authentic Thai
experiences close to the conference venue,
as well as excursions and field surveys to
more distant locations. The IMA Executive
Committee was impressed by the efforts
the organizers have made to make IMC10
an interesting and successful meeting for
global mycology. Again, you are encouraged
to participate and post your ideas on the
IMC10 webpage (http://www.imc10.
kasetsart.org).
Apart from discussions about
IMC10, the IMA Executive Committee
concentrated on its structure and capacity
for communication to mycologists world
wide. Paramount in this regard is the newly
redesigned webpage of IMA (http://
www.ima-mycology.org). In addition,
IMA Fungus is seen as a major tool to
communicate our activities, which we trust
will be given its own impact factor from
ISI/Web of Science as soon as practicable.
There also is a pressing need for a regular
newsletter to apprise mycologists of the
latest updates on mycological conferences,
workshops and other activities around
the globe. For now, this function will
be carried out by updates to the IMA
webpage.
Although the finances of the IMA are
in good order, due to the efforts of Treasurer
Karen Hansen, we realize the need for
further external funding to increase our
capabilities. Various tools were discussed
and it was noted that we need more active
engagement amongst companies that rely
on fungi or fungal products. IMA Fungus as
well as the webpage could be used as tools
to attract patrons but we expect that a more
direct approach also will be needed.
During the intensive discussions by
the Executive Committee, a telephone
conference was arranged to facilitate the
participation of members who could not
attend in person. This effort to broaden
the basis for discussions and decisions can
only go so far. Mycology is global which led
Executive Committee member, Lene Lange,
to suggest that reports be solicited before
each annual meeting from the six Regional
Mycological Member Organizations (that
is, Africa, Asia, Australasia, Europe, North
America, and South America). Lene’s
leadership in this endeavour was endorsed by
the committee. The Executive Committee
also decided to evaluate the possibilities of
improved virtual participation in discussions
and meetings in the future.
Dominik Begerow
IMA Secretary-General
(dominik.begerow@rub.de)
(6) ima fUNGUS

International Commission on the Taxonomy of Fungi:
Preparing for IMC10
Keith Seifert.
The ICTF had a very busy 2012 as
subcommissions and nomenclatural
working groups continued preparations for
IMC10 next year. Most ICTF members are
involved in various aspects of the transition
to single name nomenclature. Both Keith
Seifert (Chair ICTF), and Scott Redhead
(Chair, Nomenclature Committee for
Fungi 1 ), were busy presenting the changes
in the Code to various conferences around
the world. These activities are continuing
in August 2013 with a symposium at the
American Phytopathological Society/
Mycological Society of America joint
annual meeting in Austin, Texas 2 . ICTF
members Keith Seifert, Pedro Crous, and
David Geiser are all scheduled to speak in
the symposium.
Plant pathologists in general have been
very concerned about the nomenclatural
changes, and Amy Rossman has been
actively developing information of
particular relevance to them. ICTF
member Ning Zhang is coordinating the
writing of an article for the American
Phytopathological Society website (www.
apsnet.org) on the changes in the Code
and how they will affect plant pathologists,
with contributions on individual groups
or genera from several ICTF members.
Votes on Bipolaris vs. Cochliobolus (www.
fungaltaxonomy.org/subcommissions/
vote), organized by Amy Rossman
and Dimuthu Manamgoda, and
Magnaporthe vs. Pyricularia (magnaporthe.
blogspot.ca), organized by Ning Zhang,
are now underway and are generating a
animated discussion on these particularly
controversial choices.
The Hypocreales Nomenclatural Working
Group, co-convened by Amy Rossman
(USA) and Priscila Chaverri (USA & Costa
Rica) met at the MSA meeting at Yale in
July, 2012, along with some members of the
International Subcommission on Fusarium
Taxonomy (Chair David Geiser,
USA), the International Subcommission
on Trichoderma and Hypocrea (ISTH,
Chair Irina Druzhinina, Austria) and
members of the Cordyceps working group.
The discussion document on the most
contentious problems for selecting generic
names in this order, recommending solutions
for each, is published in this issue of
IMA Fungus (4 (1): 41–51, June 2013). The
ISTH website (isth.info) is hosting an ongoing
vote on the choice between Trichoderma
or Hypocrea, with Trichoderma presently
favoured at a ratio of about 3: 1. A complete
nomenclator is being compiled to be used
for deriving a list of protected names.
The International Commission
on Penicillium and Aspergillus (ICPA, Chair
Robert A. Samson, The Netherlands;
Secretary Giancarlo Perrone, Italy)
has developed lists of accepted species
of Penicillium and Talaromyces for fungi
formerly included in the broad concept
of Penicillium, and the broadly defined
concept of Aspergillus, supported by the
majority of ICPA members, to maintain
the commonly used names of many
economically and medically important
species. The draft lists, to be used as the basis
for a list of protected names, include DNA
barcode accession numbers for all species,
and are available on the ICPA web site
(www.aspergilluspenicillium.org).
The newly constituted International
Subcommission on Colletotrichum
Taxonomy (Chair Lei Cai, China; Secretary
Bevan Weir, New Zealand) held their
inaugural meeting in September 2012
(minutes at www.fungaltaxonomy.org/
subcommissions), and their preliminary
discussions seem to favour the use
of Colletotrichum over Glomerella. They
are now actively preparing a complete
nomenclator with the goal of producing a
draft list of protected names before IMC10.
Andrew Miller is now maintaining
the Commission’s website (www.
fungaltaxonomy.org). “A Nomenclator
of all Fungal Names Sanctioned by Fries”,
the passion of Lee Crane (Illinois Natural
History Survey) for the past 15+ years, was
released on the ICTF website (http://www.
fungaltaxonomy.org/nomenclator/) earlier
this year, and will be a valuable resource for
those working on protected lists of names.
Several other subcommissions and
working groups, some affiliated with other
bodies, such as IUMS and ISHAM, have
formed and are expected to be very active
over the coming year. We hope that many of
them will be reporting on their deliberations
in the next issue of IMA Fungus.
IMC10 in Thailand next year will be
very important for mycology and the ICTF
is poised to play a significant role.
Keith A. Seifert (Chair, ICTF) and
Andrew N. Miller (Secretary, ICTF)
(keith.seifert@agr.gc.ca)
1
See “Organizing Mycology” (IMA Fungus 3 (2):
(43), December 2012) for the relationships of the
various international committees and organizations
concerned with mycology.
2
See this issue, p. (4).
REPORTS
volume 4 · no. 1
(7)

REPORTS
The First International Congress of Trufficulture
In the small city of Teruel in Spain, on
5–8 March 2013, more than 300 people
from 23 countries gathered for The
First International Congress on Truffle
Cultivation. Scientists who have been
working with hypogeous fungi of the genus
Tuber for many years attended – including
veteran researchers Gerard Chevalier
(the development of truffle-inoculated
seedlings), James Trappe (truffle taxonomy),
and Mattia Bencivenga (control and outplanting
of truffle seedlings). There were
many younger researchers as well, who
brought updates of recent research to the
wider truffle community, including the
role of mating types in truffle production,
patterns and quantification of Tuber mycelia
in soils of truffle orchards, genetic diversity
within populations of T. melanosporum,
and new molecular methods and challenges
for further understanding of the Tuber lifecycle.
New data and methods for studying
and preserving truffle aromas were also
presented.
The menu and courses from the Congress Dinner. Photos James A Trappe.
(8) ima fUNGUS

Sustainable, quality production, was
an important focus for this meeting. There
were presentations related to irrigation
needs, soil quality, and tillage treatments to
promote truffle production. Several studies
addressed the concerns for management
of disease and pests that have recently
been observed in areas of extensive truffle
plantations, with data on various species
of mites and beetles, notably Leiodes
cinnamoneus, and preliminary data on a
tumour-causing phytoplasma in Quercus ilex
trees.
Plenty of science, yes, but additionally,
what was outstanding for this meeting was
the active involvement of the truffle growers,
the commercial producers of seedlings
inoculated with black truffle mycorrhizas,
and local and regional politicians. All have
witnessed the amazing transformation of a
relatively poor agriculture-based region into
one of the most economically successful
black truffle production regions in the
world over the last 25 years. The province
of Teruel is a relatively remote region in
southern Aragon, with elevations near
1000 m. The region historically had
abundant natural black truffle production,
but a dramatic decline in wild production
had occurred, similar to that observed in
France and Italy. Although wild truffles
can still be found in the region today, this
resurgence is a result of new plantations.
Indeed, there are nearly 4,000 ha of truffle
plantations in the province established by
planting and maintaining, pruning and
irrigating oak and hazelnut trees inoculated
with T. melanosporum. The province has
become a model for the use of trufficulture
as a tool for management of reforestation
based on a non-wood forest product,
supporting economic and ecological
objectives. Black truffle cultivation
programmes have extended beyond the
native Mediterranean habitat of the species
to Australia, New Zealand, USA, South
Africa, Israel, and Chile.
Another special feature of this congress
was having a combined meeting hall for
both the display of scientific posters and
ISHAM Working Group Meetings
commercial stands. In this one place, all
participants had an opportunity to peruse
posters and also to meet with more than 15
businesses providing support to the trufflegrowers,
such as irrigation equipment,
and specialized planting substrates. Also
on display were truffle products from the
region, including cheeses, oils, and preserved
meats. The local people were generous in
their reception of the scientific community,
and invited participants to visit several of
the tree nurseries and retail sellers of truffle
products. Visits to truffle plantation were a
highlight of the organized field trips, where
trained truffle dogs became star performers
as they located mature truffles as deep as
15–20 cm below ground. And of course,
all dined on black truffles in good company
and in good spirits – as evidenced by the
pictures from the Congress dinner (kindly
provided by Jim Trappe).
Christine R. Fischer and Carlos Colinas
(christine.fischer@ctfc.es; carlos.colinas@
pvcf.udl.es)
REPORTS
The International Society for Human and
Animal Mycology (ISHAM) operates 23
active Working Groups covering divergent
themes in medical mycology. These
networks of clinicians and researchers
provide sufficient critical mass to cover also
some less current subjects, and as a result
particularly the knowledge of and interest in
orphan diseases has grown enormously over
the last decade. Some of them are no longer
orphan diseases.
Recently, three of the Working Groups
had very successful meetings. The Group
on Zygomycoses functions under the joint
auspices of the European Confederation of
Medical Mycology (ECMM) and ISHAM,
and held a two-day meeting in Utrecht on
8–9 April 2013, as a satellite of the CBS
Spring Symposium ‘One Fungus : Which
Gene(s)’, and organized by Kerstin Voigt
and Sybren de Hoog. The symposium title
‘Emerging Zygomycetes, a new problem in
the clinical lab’ referred not only to the
growing susceptible patient population
(diabetes, immune disorders), but also to the
successful prophylaxis against Aspergillus,
which seems to be accompanied by an
increase in mucoralean infections. The 97
participants listened to 40 presentations
divided over four sessions. Themes ranged
from clinical studies to virulence factors,
From the ISHAM Working group meeting on Zygomycoses in Utrecht, 8–9 April 2013.
animal models, and genomics. Many of
the major researchers in these areas were
present, and the interaction between
workers at bench and at bedside proved
stimulating. All participants received a free
copy of a special issue of Persoonia (30, June
2013) devoted to zygomycete phylogeny,
which had been initiated at the previous
Workshop. The 2013 Workshop will also
lead to a special issue in the journal Mycoses,
which has agreed to devote an issue to this
work in 2014. The presentations delivered
at Utrecht are available for members of the
Group at http://www.zygomycota.eu/.
On 12–13 April 2013, the ISHAM
Working Group on Medical Barcoding held
a workshop in Utrecht with 93 participants.
The organizers, Wieland Meyer and Sybren
volume 4 · no. 1
(9)

REPORTS
de Hoog, had chosen the title: The future of
barcoding: getting closer, or drifting further
away from clinical practice? The reason for
this somewhat odd title is the observation
that techniques to distinguish phylogenetic
entities are developing very fast, while
there is a limit to what is really clinically
relevant: should every routine diagnostic
laboratory invest in distinction of precise
clades even when this does not contribute
to improvement of patient care? The 37
speakers remained, however, practical. Many
presentations ended with a conclusion on
optimal primers for species distinction
in that particular group. This valuable
information is available for Group members
at http://www.isham.org/WorkingGroups/
barcoding/index.html. One afternoon
was devoted to MALDI-TOF, which
was confirmed as an emerging diagnostic
technique with a remarkable precision
and predictability. It was decided that
the next workshop, scheduled for 22–23
April 2014, will be organized in the form
of a ‘masterclass’, where possibilities and
limitations of a wide diversity of techniques
and approaches can be discussed on the basis
of an example of a single set of strains from
the genus Scedosporium.
Scedosporium was the subject of a third
ISHAM Working Group meeting. This
took place in Innsbruck, Austria, on 16–18
May 2013, had 36 participants, and was
organized by Johannes Rainer, Josef Kaltseis,
Astrid Mayr, and Walter Buzina. It was the
4 th meeting of this active Working Group.
All major themes of Scedosporium research
were addressed in 21 talks. An important
issue here remains the nomenclature of
this group of fungi, since teleomorphs
are regularly produced in some of the
species. The generic names Pseudallescheria
and Scedosporium are in current use. The
Working Group decided to give priority to
Scedosporium; a community paper will be
produced in due course. The working group
will organize its next meeting as s a satellite
symposium of the forthcoming ISHAM
congress in May 2015 in Melbourne,
Australia.
Sybren de Hoog
(de.hoog@cbs.knaw.nl)
One Fungus : Which Gene(s) symposium
This year the CBS Spring Symposium
(10–11 April 2013) in Amsterdam
formed part of a Spring Symposium week,
which was effectively sandwiched by a
Zygomycete meeting and DNA Barcoding
meeting, both of which were held at CBS
in Utrecht. More than 170 participants
registered for the Amsterdam meeting,
representing 23 different countries.
The successful CBS Spring Symposia,
One Fungus = One Name (2011) and
One Fungus = Which Name (2012)
had a great impact on the mycological
community. Following on from the
“Best Gene for Fungi” meeting held in
Amsterdam (2011), which resulted in
the ITS region being chosen as official
barcode for fungi (Schoch et al. 2012),
it was clear that additional gene(s) had
to be targeted to delimit taxa in specific
fungal groups. Other issues that needed
to be addressed concerned procedures for
obtaining ex-type or ex-epitype isolates
for whole genome analysis, and how
genomic information will provide a better
understanding of how fungi interact
in natural and synthetic communities.
The meeting was kicked off with talks
presented by the Dutch (Vincent Robert,
Benjamin Stielow) and Canadian (André
Levesque, Chris Lewis) teams who
presented two different approaches to
identifying novel genes, and data to show
the success rate of amplification and
species identification across the fungi.
The morning was rounded off by talks
from Francois Lutzoni (phylogenetics
in lichens), and Marcus Teixeira
(novel genes and species concepts in
Paracoccidioides). Following a light lunch
the second session dealing with medical
mycology saw excellent talks delivered
by Anderson Rodrigues (Sporothrix),
Wieland Meyer and coworkers (Candida)
and Joseph Heitman (mating types and
sexual reproduction). The third session
of the day focused on the “One fungus
= which name and protected lists”, and
saw talks by David Hawksworth (update
on the lists 1 ), Keith Seifert and Andrew
Miller (update on ICTF activities) 2 ,
and Joost Stalpers (the types of genera
and lists of fungi in MycoBank). The
day was rounded off by two book
launches, namely “Ophiostomatoid Fungi,
expanding frontiers” by Seifert et al. 3 , and
“Cultivation and diseases of Proteaceae:
Leucadendron, leucospermum and Protea”
by Crous et al. These works form numbers
12 and 13 in the CBS Biodiversity Series,
respectively.
Thursday started with a big surprise,
as a framed illustration of Penicillium
vanoranjei was handed to the scientific
director of the Academy, Theo Mulder.
A total of five Penicillium species were
named after members of the Dutch Royal
family, in preparation of the coronation of
the prince, Willem-Alexander (His Royal
Highness the Prince of Orange), who was
crowned as new King at the end of April.
The scientific paper describing the species
also went “live” that same morning,
being published in Persoonia (31: 42–62,
2013). This event subsequently led to
a flurry of national and international
press releases, interviews, and coverage in
newspapers, and on radio and television 4 .
The two CBS awards, namely the Johanna
Westerdijk and Josef von Arx Awards
were also made to respectively Martha
Christensen, and Kerry O’Donnell
(see pp. (14)–(15)). The first scientific
session of the day dealt with taxonomy
and genomics, and saw talks by Ulrick
Kuck (genomics), Joey Spatafora (F1000
project), Ronald de Vries (taxonomy vs.
ecology), Teun Boekhout et al. (yeast
systematics and nomenclature), Scott
Baker (post-genomic tools), and Christina
Cuomo (microsporidian genomic
analysis). David Hawksworth chaired
the session after lunch dealing with a
single nomenclature, which included
talks by Eleonara Egidi (diversity of
rock fungi), David Geiser & Kerry
O’Donnell (Fusarium), Robert Samson
(Trichocomataceae), and Wilhelm de Beer
et al. (ophiostomatoid fungi). The day was
rounded off by an ISHAM session dealing
with the nomenclature of medical fungi
as a showcase for stability, which saw
presentations by John Taylor, Tom Walsh,
Heide-Marie Daniel & Gerard Haase,
June Kwon-Chung and Teun Boekhout,
and a general discussion. On the Friday,
everyone again travelled to CBS in
Utrecht where several meetings were held,
1
See this issue, pp. (3)–(4).
2
See this issue, p. (7).
3
See this issue, pp. (24)–(25).
4
See this issue, p. (2).
(10) ima fUNGUS

REPORTS
Scenes from the One Fungus = Which Gene(s) symposium held in the Trippenhuis, headquarters of the Royal Netherlands Academy of Arts and Sciences, Amsterdam,
on 10–11 April 2013.
volume 4 · no. 1
(11)

REPORTS
Scenes from the One Fungus = Which Gene(s) symposium held in the Trippenhuis, headquarters of the Royal Netherlands Academy of Arts and Sciences, Amsterdam,
on 10–11 April 2013; the launch and presentation of the Diseases of Proteaceae and Ophiostomatoid Fungi to John W. Taylor (IMA President); and the committee
meetings on Friday 12 April, followed by the Fungal BBQ at the CBS.
(12) ima fUNGUS

which were, as is tradition, rounded off by
a fungal barbeque.
The next CBS Spring Symposium
will be held 24–25 April 2014, the topic
being “Genomes and Genera”, which will
effectively set the stage for IMC10 (3–8
August) in Bangkok, Thailand.
Schoch CL, Seifert KA, Huhndorf S, Robert V,
Spouge JL, Levesque CA, Chen W, et al.
(2012) Proceedings of the National Academy of
Sciences, USA 109: 6241–6246.
REPORTS
volume 4 · no. 1
(13)

AWARDS AND PERSONALIA
AWARDS
CBS-KNAW Fungal Biodiversity Centre Awards
On the second day of the “One Fungus = Which Genes” symposium in Amsterdam on Thursday 11 April 2013, the CBS-KNAW Fungal
Biodiversity Centre presented its two prestigious awards. The awards are made at irregular intervals by the institute following discussions by
its senior staff. This is the fourth time these awards have been made, and the citations were read, and the presentation of certificates made, by
the Centre’s Director, Pedro W. Crous.
Johanna Westerdijk Award:
Martha Christensen
Awarded on special occasions to an individual
who has made an outstanding contribution
to the culture collection of the CBS Fungal
Biodiversity Centre, marking a distinguished
career in mycology. Nominees for the
award will be evaluated on the basis of
quality, originality, and quantity of their
contributions to the collection, and on the basis
of associated mycological research in general.
Following graduate work at the University
of Wisconsin, Martha Christensen
accepted a faculty position in the
Department of Botany at the University
of Wyoming and remained in Laramie
until her retirement back to Madison
WI in 2003. Her primary research
interest throughout her career has been
to search for ecological patterns among
the soil microfungi that can be isolated
from native plant communities. In
her view, new species descriptions and
substantive contributions in Aspergillus and
Penicillium taxonomy have been essential
tools in her determination to describe and
understand soil microfungal communities
both qualitatively and in terms of the
relative prominence of the co-existing taxa.
In the course of that pursuit, she
with students and colleagues isolated
and examined soil fungi from more than
100 native plant communities, including
desert, grassland, forest, tundra and bog
communities, in five US states. Also, in
connection with holiday trips overseas,
she’s sampled native soils in Switzerland,
Namibia, Peru, and Fair Isle. The
“Christensen Soil Microfungal Collection”
(www.moldsforyou.org), consisting of
approximately 2000 cultures, is now a part
of the CBS Fungal Biodiversity Centre.
Accessioned strains can be located in the
CBS database using either the published and
permanent WSF or RMF culture number or
the original published name.
Martha’s non-professional activities
include travel, photography, and playing
Martha Christensen.
viola in string quartets. Because of her
fondness for playing and the scarcity of
violists in the four Midwestern states she’s
lived in, Martha claims to have played in 13
different community orchestras, including
the Panhandle Symphony of western
Nebraska!
Josef Adolf von Arx Award:
Kerry O'Donnell
Awarded on special occasions to an individual
who has made an outstanding contribution
to taxonomic research of fungal biodiversity,
marking a distinguished career in mycology.
Nominees for the award will be evaluated on
the basis of quality, originality, and quantity
of their contributions in the field of fungal
taxonomy.
It is no exaggeration to state that
Kerry O’Donnell’s name is universally
known within our field, especially in
phytomycology, and specifically in the
Fusarium community. Kerry completed his
post-graduate studies at ARS-USDA, Peoria
(Mucorales), Michigan State University
(Zygomycetes), the University of Minnesota
(ultrastructure of nuclear division in rusts
and smuts), Washington University in
St Louis (medical mycology), and the
University of Medicine and Dentistry of
New Jersey (molecular biology of the cell
cycle) before relocating to ARS-USDA,
Peoria, where he has studied Fusarium
molecular systematics and evolution for
more than 20 years. In the process,Kerry
has generated thousands of multigene DNA
datasets of Fusarium species, and also set up
online blast tools such as FUSARIUM-ID,
and Fusarium MLST to help others identify
these organisms.
He has published more than 160
scientific articles in diverse areas including
cell and molecular biology, molecular
systematics, phylogenetics, evolutionary
genetics, and fungal genomics. Several of
these papers have received hundreds of
citations to date.
Kerry O’Donnell has received
many awards, including the USDA-
ARS Administrator’s Postdoc Awards,
Kerry O'Donnell receiving his award from the
Director of the CBS-KNAW, Pedro Crous.
(14) ima fUNGUS

Alexopoulos Award for Research from
the Mycological Society of America
(MSA), and the Dr Hiratsuka Award
from the Mycological Society of Japan.
PERSONALIA
Richard P. Korf – Mi-shou
Richard “Dick” Korf celebrated his 88 th
birthday on 28 May 2013. He has had
a long association with the Institute of
Microbiology of the Chinese Academy of
Sciences, Beijing, since his first visit there in
1981. Further, he has done much to promote
Chinese mycology and increase the awareness
of mycologists in general to Chinese work,
particularly through the publication of
major books through Mycotaxon, of which
he is the founder. He has served on the
editorial board of Mycosystema, published
by the Institute, since its inception in 1987.
Just like Mycotaxon, which was initiated by
Dick in 1974, Mycosytema has gone from
strength to strength and developed into the
premier Chinese journal in mycology, mainly
publishing papers in English. Similarly, the
Institute has now gained recognition as the
State Key Laboratory of Mycology (see IMA
Fungus 3 (2): (8), June 2012).
1
Further information about Richard P. Korf ’s
contribution to mycology is given in the citation
accompanying the award of the second IMA
Ainsworth Medal in 2010 (see IMA Fungus 1 (2):
(15)–(16), December 2010).
He has been elected a Fellow of the
MSA, and has recently also received the
Distinguished Mycologist Award from
the MSA. He has acted as an editor for
In China, an 88 th birthday is regarded as
particularly special, and those that reach
it are called “Mi-shou”. In order to honour
Dick’s attainment of “Mi-shou” status, the
June issue of Mycosytema is appropriately
dedicated to him 1 . It comprises 17 papers
by his students, collaborators, and admirers,
mostly reflecting his primary interest
Mycologia, Mycoscience, Fungal Biology,
and Mycological Progress. Similar to von
Arx, Kerry O’Donnell has also moved the
goalposts in fungal taxonomic research.
Sanshi Imai Memorial Discomycete Workshop and Foray, IMC3, Nikko, Japan, 20–27 August 1983. Left to
right: “Dick” Korf, Linda Kohn, Trond Schumacher, and a Japanese colleague.
in discomycetes, but others concern
pyrenomycete groups.
IMA Fungus wishes to add its
congratulations to those of the Chinese
mycologists and contributors to the special
issue. Long may he continue to facilitate and
enjoy mycology!
AWARDS AND PERSONALIA
volume 4 · no. 1
(15)

RESEARCH News
The Human Microbiome Project: fungi on human
skin
Surely every mycologist, aware of
the universe of spores and mycelium
surrounding our bodies and engulfing every
living thing, has wondered what is really
hiding in the nooks and crannies of our
bodies. The considerable attention paid
to the human microbiome in the popular
press over the past year, emphasizing that
we are composed more of bacterial cells
than human cells, that our bacterial profiles
may define our individuality and influence
our health as much as our own genes, must
have left the average mycologist wondering,
“What about the human Mycobiome?” The
latest on-line issue of Nature includes an
article that begins to address this question.
Keisha Findley et al. (2013), of the US
National Institutes of Health, studied the
skin mycobiota of ten healthy Americans,
six men and four women. The subjects
were prohibited from using antibacterial or
antifungal soaps for seven days and strictly
forbidden from showering for 24 hours
beforehand before they had skin scraped
off. The researchers sampled fourteen
parts of these healthy bodies (see figure),
including moderately embarrassing regions
such as armpits, nostrils and the inguinal
crease, and subjected the resulting DNA
to 18S cloning to identify fungal genera,
ITS pyrosequencing to identify species, and
culturing on standard medical mycology
media supplemented with olive oil to
enhance recovery of the dandruff yeasts,
Malassezia spp.
They enumerated about 80 fungal
genera, including the potentially medically
significant Candida, Chrysosporium,
Cryptococcus and otherwise unnamed
dermatophytes assigned to the
Arthrodermataceae. Common saprobic
genera such as Aspergillus, Cladosporium,
Epicoccum, Leptosphaerulina, Penicillium,
Phoma, and Rhodotorula were also
frequently detected or isolated. In common
with bacterial microbiomes reported in
other studies, the mycobiomes differed
remarkably among the people sampled,
making statistical comparisons difficult.
It is tempting to speculate on how these
differences come about. In general, feet
yielded the greatest fungal diversity, the
bottom of the heel, the toenails, the webs
between the toes. One can perhaps look at
the mycobiomes of these feet and identify
the study participants who throw off their
shoes and run through meadows, or wallow
in mud, or judging by the Saccharomyces
populations of some, stomp on wine grapes.
The authors, of course, are more serious, and
consider the past use of antifungal drugs by
their subjects, noting that their sampling
sites are those most frequently associated
with fungal infections.
The big winner in all of this is
Malassezia, the genus of lipophilic
basidiomycetes that apparently coats
our bodies with an invisible yeasty slime,
especially those parts not encased in shoes
and socks. The authors detected three
species, M. globosa, M. restricta, and M.
sympodialis, in great profusion on hands,
backs, arms and in ears, and a few apparently
undescribed species besides. Most
mycologists know about these fungi and
Human skin fungal diversity. Figure courtesy of Darryl Leja and Julia Fekecs (National Human Genome Institute, NIH).
(16) ima fUNGUS

their involvement in dandruff, but really,
what is going on here? Could it be that we
are controlled by these yeasts, that our social
customs such as hugging and kissing evolved
as mechanisms for exchanging populations
of Malassezia? Could those aspects of our
behaviour that have evolved to promote
genetic exchange among our own personal
genomes, also enable mating of Malassezia?
It would probably be best not to speculate
about this too much in grant proposals, but
nevertheless, perhaps mycologists shaking
hands at conferences now can take hidden
pleasure at the idea that they are facilitating
the continuing genomic dance of these little
cells that call our bodies home.
Findley K, Oh J, Yang J, Conian S, Deming C, et
al. (2013) Topographic diversity of fungal and
bacterial communities in human skin. Nature
doi:10.1038/nature12171f (online 22 May
2013).
Selecting the “right” genes for phylogenetic
reconstruction
Keith A. Seifert
(keith.seifert@agr.gc.ca)
RESEARCH NEWS
It is now the normal practice in preparing
phylogenetic trees of fungal lineages to
use sequences of several different genes,
but testing whether the selected genes
are the most appropriate is necessarily
somewhat subjective. This is especially so as
incongruent trees can be produced. As more
complete fungal genomes become available,
the possibility of testing the efficacy of
particular gene sequences is becoming a
reality. In the case of the ascomycetous
yeasts, 23 whole genome sequences are now
available, across six genera. Salichos & Rokas
(2013) have investigated these to examine
phylogenomic practices where there is
incongruence from conflicting gene trees.
These researchers, from Vanderbilt
University (Nashville, TN) analysed
a staggering 1 070 orthologous genes
from across these genomes. They found
that concatenation, the compilation and
analysis of numerous genes as a single
data set, resolved the species phylogeny,
20 internodes having 100 % bootstrap
support, identical to trees recovered from
Bayesian and one type of maximumlikelihood
analysis tested. However, the
tree recovered disagreed with each of the
single gene trees. An extended majority-rule
consensus (eMRC) phylogeny of the 1 070
separate gene trees gave a tree with a similar
topology, but about half of the internodes
were only weakly supported. The position
of Candida glabrata was particularly
anomalous, appearing as a sister to
Saccharomyces castellii and other species of
the latter genus – even though only 214 of
the 1 070 gene trees favoured that topology.
A novel measure to take incongruence
into account is proposed, that of “internode
certainty” based on the frequency of that
node as opposed to the most conflicting
alternatives in the same set of trees. This
measure was found to be more informative
than that of gene-support frequency (GSF).
The problem of incongruence was greatest
deepest in the phylogeny, and the authors
conclude that inferences in ancient times are
dependent on the selection of markers with
strong phylogenetic signals. They consider
that a fundamental change in current
practices is required: (1) bootstrap support
should not be used for concatenation
analyses of large data sets; (2) the signal
in individual genes and trees derived from
them should be carefully examined; and
(3) internodes that are poorly supported
should be identified explicitly. Attention
needs to be focussed on the development of
new phylogenomic approaches and markers
for the resolution of ancient branches in
the genealogy of Life. This paper merits
careful scrutiny by all mycologists, and other
phylogeneticists, exploring early divergences.
Salichos L, Rokas A (2013) Inferring ancient
divergences requires genes with strong
phylogenetic signals. Nature 497: 327–331.
Candida albicans budding cell, CBS562 (scanning
electron micrograph).
Haploid Candida albicans strains and their
significance
The diverse mechanisms of reproduction
and reproductive strategies that evolved in
fungi have fascinated not only mycologists
but geneticists for generations as more and
more intriguing devices come to light. In
view of the intense attention that Candida
albicans has received in recent years from
fungal biologists, medical mycologists,
and genomics specialists, one might have
thought there was nothing basic yet to be
uncovered. Not so; there was one secret
of success that had remained hidden until
now. The yeast cells from clinical cases
are invariably diploid (Gow 2013), but
now Hickman et al. (2013) have found
that a halploid state serendipitously in the
course of in vitro experiments on the loss
of heterozygosity. They then used flow
cytometry, which enables the amount of
DNA in individual cells to be measured, to
screen isolates from a wide range of in vivo
and in vitro sources. They found another
haploid that had been growing in the halo
of the antifungal drug flucanizole, and
occurred in vivo at the rate of 1–3 haploid
cells in every 100 000 cells – no wonder
they had not been picked up before!
This finding is of especial significance
as it means that some genes that might
otherwise have arisen by mutation, and
volume 4 · no. 1
(17)

RESEARCH News
not been expressed in a diploid because
of suppression by genes on the other
chromosome set, may be. When a haploid
cell forms, that can continue to divide
mitotically, and then either form a diploid
by mating with a haploid with a different
chromosome set to form a regular diploid,
or with an identical haploid to form an
auto-diploid. In the auto-diploid, genes
not normally expressed can potentially be
perpetuated and spread in a population. In
the particular auto-diploids studied, growth
was less rapid than in normal diploid strains,
which may partly have caused it to be
overlooked by previous workers.
This newly discovered strategy for
generating diversity in this most versatile
yeast can now be added to those of
tetraploid formation with subsequent
chromosome loss back to diploid, the
production of aneuploids by duplicating
some chromosomes, and the mating of
compatible diploids (Gow 2013). I wonder
what other secrets this fungus still hides . .
. . .
Gow NAR (2013) Multiple mating strategies.
Nature 494: 45–46.
Hickman MA, Zeng G, Forche A, Hirakawa MP,
Abbey D, Harrison BD, Wang Y-M, Su C-H,
Bennett RJ, Wang Y, Berman J (2013) The
‘obligate diploid’ Candida albicans forms
mating-competent halploids. Nature 494:
55–59.
Candida albicans clusters of conidia, CBS562.
Candida albicans producing thick-walled clamydospores,
CBS562.
(18) ima fUNGUS

The road to stability
Stability and progress are antagonists.
Having both at the same time in a
developing science is impossible,
and consequently that also goes for
nomenclature. Nevertheless, the users
require the highest possible nomenclatorial
stability in order to facilitate the access to
related data. The transit from an anamorphteleomorph
system to the one-fungus-onename
principle will have consequences
for fungal names, and the mycological
community is taking its responsibility and
is working towards a solution with as little
changes as possible.
Nearly all changes are caused by the
definition of the generic concepts, and
– as the generic concept is based on the
characteristics of the type specimen – in
order to avoid later corrections with
nomenclatorial consequences, sufficient
details of the type species (including
molecular data) have to be known. Ideally
before implementing the one-fungus-onename
principle a full analysis of all type
specimens should be made in order to
establish the relations between the type
specimens and as a consequence of the
minimal generic concepts.
The first logical step is to have a
complete set of the available genera with
their type species. This project is nearing
completion and the results will be made
available to the mycological community for
comments, additions, and corrections. This
will be an on-going process and feed into
the development of a list of generic names
with their type species for consideration
foreventual protection. It is anticipated
that a first draft of that list will be available
shortly. This will result in a list where the
combination ‘generic name - type species
of the genus’ on that list will be protected.
That protection does not extend to the
circumscription of a genus. It only means
the generic name is tied to its generic type
species, and that can generally only be
changed by conservation of the name with
a different type or in some cases a different
specimen. The protection of any subset of
genera – even when considered in current
use – should be discouraged when the type
species are insufficiently characterized. If
that is not the case, a black box situation
is created, where the types of different
protected genera may turn out to be
congeneric.
The second step consists of collecting
the available data of the type specimen in a
database. That would include, for example,
the location, habitat, host or other substrate,
herbarium, culture collection (where
appropriate), descriptions, illustrations, and
molecular data. When no type specimen
has been designated or when it cannot be
located, a neotype has to be selected or
collected, preferably from or close to the
original location on the original host or
substrate. If the type material is unsuitable
for molecular research, an epitype can
be designated to integrate the type into
molecular databases. When it is evident
that type material does not agree with the
current concept of the genus, it may be
desirable to change the type by conservation
or the protected lists themselves.
It is clear that the ideal situation –
sufficient knowledge of all type specimens
– is not within reach. It is also clear, that
supposed generic anamorph-teleomorph
associations are only valid when the type
specimens of these genera are congeneric,
and that – in case sufficient molecular
data on the type species of these genera are
lacking – such associations are not a priori
acceptable. That means that mycologists,
provided they want short- to medium-term
results, have to find a practical solution. This
can be found in the critical mass concept:
• All data on type specimens present
in the database are compared, and
nomenclatorial decisions are made on
synonymous genera represented by
congeneric type specimens.
• Specialists of well-studied groups
(families, orders) can judge that the
material available is sufficient for the
classification they have in mind, even if
the data on type specimens of potential
genera of that group are not complete.
They may consider that the available
data have reached the critical mass for
this group, and that the clades they
consider to have generic status are
provided with generic names with wellresearched
type specimens. The names
in that group will then be declared
protected and any type specimen
from the remaining pool, that after
examination threatens an accepted
generic name will not get the protected
status and will be rejected (i.e. reduced
to synonymy). If the material is not
competitive with a protected genus, its
data will be added to the database and
the generic name will be acceptable.
• As soon as the total of available type
specimens is considered to have
reached the critical mass, the list
can be proposed for protection and
othergenera, including ones newly
described, can only be considered for
inclusion if their type specimens do
not threaten genera that are already
protected.
• As generic concepts change, as they
inevitably will in some cases, through
differing taxonomic opinions of
mycologists, or more often when new
data are obtained, the priority rules will
remain effective within the group of
protected names.
• Changes afterwards will still be
possible, but they will require either an
act of conservation or a revision of the
protected lists.
The advantages of this system are:
• Only genera with well-characterized
type species will occur on the list of
protected genera.
• Generic names not on the protected
list remain available for use unless
they are synonyms of protected genera
(assuming proposals to grant them that
status are approved).
• No generic names will be invalidated
through not being listed, as was the
case for bacterial names not on the
Approved List of Bacterial Names
(1980).
• The system can be applied to protect
specific groups, such as families
or orders, before a full list receives
protected status.
• The status of a protected generic name
can only be changed by conservation or
revision of the protected list.
• This way sizeable results can
be obtained and produced for
consideration and approval by the
IMA at IMC10 in 2014.
Joost A. Stalpers
(jastalpers@hotmail.com)
CORRESPONDENCE
volume 4 · no. 1 (19)

CORRESPONDENCE
Keys to genera
I write as an Assistant Professor in the
Department of Biotechnology in the
University of Pondicherry, India.
The Fungi (vols. IV A & B, 1973,
Ainsworth GC et al., eds) are classic
volumes and have served fungal taxonomists
for several generations in identification
of different genera of fungi. It is now
four decades since these volumes were
published. A huge amount of information
has accumulated during this period, with
numerous new genera described, and others
transferred or redisposed 1 . Though, in
recent times, molecular sequencing data
has been relied upon in many laboratories
for identification of fungi, many genera are
not represented in the DNA databases and
workers throughout the world still depend
on morphology for identification. Hence, I
feel that an updated treatise on all accepted
fungal genera, with identification keys, is not
only wanting, but also much-needed. This
would go a long way in helping both budding
and established fungal taxonomists in making
identifications.
Experts should be encouraged to come
forward for such a new venture, with a view
to publishing a series of keys to all accepted
fungal genera (including lichen-forming
genera) at an affordable price. I would like
to see the IMA facilitate such an initiative.
V. Venkateswara Sarma
(sarmavv@yahoo.com)
1
The number of accepted genera has risen from 5 100
in the 6 th edition of Ainsworth & Bisby’s Dictionary of
the Fungi (1973,) to 7 533 in the 10 th (2008) [Ed.]
Equipment for molecular mycology needed
I am a lichenologist studying the lichen
symbiosis, and focus on the genetic diversity
of the fungal and photosynthetic bionts and
their phylogenies.
On 1 October 2013, I will move from
the University of Graz, Austria, to start
a new unlimited research position at the
University of Trieste, Italy, shortly, but the
laboratory where I will work is still not set
up for my molecular biology research with
fungi. I will need to equip this with to
enable me to continue my studies. Therefore,
if any readers have machines which are no
longer used, but are still operable, and could
donate them to my new laboratory, that
would help enormously in initiating new
research in Trieste.
These are the items that that the laboratory
lacks:
1. PCR thermocycler (possibly with
heated lid)
2. Running chamber for agarose gels
3. Pipette set(s)
4. Culture chambers/incubator for
fungal (algal) cultures
5. Heating plate
6. Magnetic stirrer (possible also
coupled with the heating plate)
7. Thermomixer
8. Heating
9. Drying chamber/drying
cupboard/ cabinet dryer
10. UV light for DNA gel
visualization
11. Camera/digital camera system to
recorder gel photos
12. DNA analyser
13. Tissuelyser machine (for
fragmenting environmental
samples into powder)
14. Computer(s) McIntosh or PC
15. Stereo-microscope
16. Light-microscope
17. Digital camera for light/
stereomicroscope
Any assistance you are able to give would be
deeply appreciated.
Lucia Muggia
(lucia_muggia@hotmail.com; or lucia.
muggia@uni-graz.at)
(20)
ima fUNGUS

INTERVIEW
With Jens H. Petersen, author of The Kingdom of
Fungi 1
INTERVIEW
Fungi as a unique kingdom. The bookstores
are filled with books on edible and
poisonous fungi (I have written a couple
myself ), but there was a great need for a
book that could visualize the unique life of
fungi. We have to insist that fungi are not
“Lower Plants”, their occurrence in nature
should not be called flora but funga, they
are not kept in herbaria but in fungaria,
etc. We have to insist on their uniqueness,
their importance, their great number and
the need to explore them – the book is an
attempt to do this . . .
The fungal community has recently been
buzzing about the new book recently
published by Jens Petersen, which fills most
mycologists with awe, and again underlines
the wonders of the magical kingdom of
Fungi. However, many of us have been
asking ourselves, who is Jens Petersen, and
how exactly did he capture these incredible
photographs? To help answer some of these
questions, we managed to track him down
in Spain, where he just returned from a
fungal ascomycete (MycoAsco) workshop.
Sitting at the airport waiting for his flight
back to Denmark was perfect, as Jens had
time to give us some insight into his world.
Who is Jens H. Petersen?
I am a mycologist and photographer
living near Aarhus, Denmark. For 20 years
I taught mycology at the University of
Aarhus, but now I am a freelance mycologist
and author/photographer. I was originally
educated as a fungal taxonomist but found
a broader perspective more interesting than
solving species delimitation in Ramaria.
Together with my good friend and college
Thomas Læssøe, back in 1998 we started
1
See Book News in this issue of IMA Fungus, p. (26).
the genus identification project MycoKey
(www.mycokey.com). This is exactly the
kind of project that allows me to dig around
in all possible corners of mycology – and a
target for every good fungus photograph I
can produce.
Why did you write this book?
When I was teaching at the university I very
much wanted a better textbook than those
available. Thus, in 1995, I produced my
own book Svamperiget (transl. The Fungal
Kingdom) illustrated with lots of black
and white photographs and line drawings.
As the book was in Danish, it was much
appreciated by the Danish students, but
they always complained about the lack of
colour. My friends in the local mycological
society, on the other hand, claimed it was an
excellent book to keep beside the bed – it
made them fall asleep very fast! So, for some
years I played with the idea of compiling a
colourful and much more seductive book
dealing with fungi and their lifestyles.
I think most professional mycologists have
experienced how hard it is to get Fungi
recognised as equal to Plants and Animals.
This is partly due to tradition, and partly
due to the lack of a broader recognition of
Why so many pictures, and what is the
philosophy behind it?
As this book is mainly aimed towards
the nature-interested non-mycologist,
I wanted the book to have the smallest
possible amount of text, and – through the
illustrations – to be as self explanatory as
possible. I think that the first introduction
to the fungi – whether for students or the
broader public – works best in this more
intuitive way.
How did you select the different taxa to
include? Is there a story behind it, or did
you simply take what you came across?
I wanted to show fungal diversity by
presenting as many of the fungal form
groups as possible. That part was easy, as
I had already made loads of pictures in
connection with MycoKey and on various
expeditions to for example Greenland,
Ecuador, Burkina Faso, and Bhutan. But I
also wanted to present fungal biology and
ecology and this was much harder to do
through photographs. I worked for a couple
of years photographing mycelia, hyphae,
asexual morphs, etc. to prepare this part of
the book.
Do you ever culture these fungi?
No, I haven’t really got the facilities and
patience for this.
Who did the layout of the book, and the
graphics?
I did the layout and graphics myself. I have
been doing book and journal layout since
desktop publishing arose in the nineties
volume 4 · no. 1
(21)

interview
and I obtain great satisfaction working
directly in layout mode, so that I can get
the illustrations and text to interact in the
optimal way.
Which cameras do you use in the field? Are
there specific settings, and lenses? Any other
materials? It looks like you use a flash a lot.
The pictures in the book are made with
a range of cameras from an ancient
Nikkormat from the seventies to modern
digital cameras. I especially love to use small
digital cameras with articulated screens (like
the Coolpix 995 and 7700). The way these
cameras allow you to work very low, even
underneath the sporing bodies which gives
a lot of fresh angles to the illustrations and
the cameras are very fast to work with. The
smaller pixel counts of so called “prosumer”
cameras doesn’t bother me, since pictures
from even the old 3.5 MP Nikon CoolPix
995 can be printed in A4 (the background
Deflexula of the contents page of the book
is exactly such a picture made in 2004 in
Ecuador on a day when the more modern
cameras had given up due to condensation).
I very rarely use a flash in the field, but a
piece of white paper to reflect light onto the
darker areas is one of my best “tools”. This,
combined with a small aperture, a tripod
and the built-in self-release, will get you far.
How did you take photos in the laboratory?
And again, which cameras did you use?
For lab work, MycoKey owns a Leica
Macroscope purchased in 1998 which we
continuously optimized with better cameras,
led light, etc. At the moment I shoot with
flashes through a swan neck and use a Nikon
d90 controlled from a Mac on top of the
scope.
Do you enhance these photos via Photoshop,
or are they simply that good when you first
take them?
All photographs are optimized in
Photoshop. Even the best cameras rarely
get the colours just right, and in the end,
pictures must be scaled, colour separated
and sharpened. One of the latest software
trends is stacking: you take a great number
of pictures with different focus and the
software integrates it all into one picture
with a very large depth of field. This is
especially useful when photographing very
small fungi (like inoperculate discomycetes)
and I use it a lot.
Can we expect a sequel to this book, or was
this the one and only?
This book is a finished project, but there
may be others ahead. We (Thomas Læssøe
and I) would very much like to do a coffee
table book on amazonian fungi so the public
could be seduced by tropical fungi the way
they are by coloured frogs, birds and insects.
We still need an opportunity to make more
pictures, but there is a small teaser from
Ecuador (alas in Danish) available as a pdf
on the MycoKey webpage.
Pedro Crous
(p.crous@cbs.knaw.nl)
(22) ima fUNGUS

Fungal Biology in the Origin and Emergence of Life. By David Moore. 2013. Cambridge:
Cambridge University Press. Pp. vi + 231, illustr. 28, tables 2. ISBN 978-1-107-
65277-4. Price £ 27.99.
David Moore has made an immense
personal contribution to bringing mycology
to the fore, not least in a major textbook
(Moore et al. 2011; see IMA Fungus 2 (2):
(62), December 2011) and semi-popular
exposé (Moore 2001). In this new and
challenging book, David aims to place fungi
centre-stage in the origin and evolution
of life. Following discussions of earlier
theories of the origin of life, he argues that
biofilms formed from aerosols, storms,
volcanic plumes, and rain in volcanic caves
4 Bya (billion years ago). In a carefully
researched and argued series of chapters he
explains how these biofilms contributed
to the formation of the first prokaryotic
cells, and subsequently to basal eukaryotes
around 1.5 Bya, and the features of the Last
Universal Common Ancestor (LUCA) of
life as we know it. Tappania, dating from
just under 1.5 billion years, is interpreted
as a sclerotial fungus; the structure is
compared to sclerotia in Coprinopsis cinerea.
The enigmatic Ediacarian fossils (630–542
Mya), which some have interpreted as
fungal are not discussed. However, the mid-
Ordovician 8 m tall columns of Prototaxites,
which occur from around 460 Mya into the
Devonian, are accepted as fungal.
Attention is drawn to evidence that
the Eukaryotic Last Common Ancestor
(ELCA) emerged through the sequence:
free cell formation, filamentous growth, cell
fusion, and septum formation – all features
of modern fungi. He suggests that ELCA was
“very similar to what would today be called a
chytrid fungus” (p. 192). It is suggested that
present day animals and protozoa developed
from such fungal-like organisms after septum
formation had arisen, while plants (including
red algae) and chromists diverged from the
same common line at the earlier free cell
formation stage. Endosymbiosis of bacteria
and their development as organelles in
eukaryote cells is seen as a key phenomenon.
David, whose specialism is the developmental
biology of fungi, notes that the underlying
logic and principles of developmental biology
in animals, fungi, and plants are the same. His
evolutionary and development-based insights
to some extent remind me of the approaches
of Arthur H Church (Mabberley 1981) and
Corner (1964) to the origins of Life on land,
and I was surprised not to see their works in
the extensive list of references cited.
The original and stimulating thesis
presented here is sure to occasion
considerable debate amongst cell
biologists, molecular phylogeneticists, and
palaeontologists. There is much to reflect
on and to challenge workers in all these
fields, who should try and secure a copy
to consider, perhaps during a long journey
when time can be devoted solely to it.
Hopefully, this inspired book will lead to
a renewed search for, and new interest in,
putative fungal remains in the earliest fossil
deposits. Dated fossils are crucial to the
ground-truthing of the timing of events in
molecular chronologies of the whole tree of
Life, and it will be interesting to see whether
it becomes generally accepted over the next
5–10 years that ECLA was indeed a fungallike
organism.
Corner EJH (1964) The Life of Pants. London:
Weidenfeld & Nicolson.
Mabberley DJ (ed.) (1981) Revolutionary Botany:
‘Thalassiophyta’ and other essays of A. H. Church.
Oxford: Clarendon Press.
Moore D (2001) Slayers, Saviors, Servants, and
Sex: an exposé of Kingdom Fungi. New York:
Springer Verlag.
Moore D, Robson GR, Trinci APJ (2011) 21st
Century Guidebook to Fungi. Cambridge:
Cambridge University Press.
BOOK NEWS
Laboratory Protocols in Fungal Biology. Edited by Vijai Kumar Gupta, Maria G. Tuohy,
Manimaran Ayyachamy, Anthonia O’Donovan & Kevin M. Turner. 2013. [Current Methods
in Fungal Biology.] New York: Springer. Pp. xxv + 604, Illustr. 117. ISBN 978-1-
4614-2355-3 (hdbk), 978-1-4614-2356-0 (e-Bk). Price: £ 180.00 (hdbk). £ 144 (eBk).
Every subject needs a vademecum, a
sourcebook where everything is to be
found. For the laboratory mycologist,
this is a major step to that end – and
something not attempted in such depth
since the classic compendia of Booth
(1971) and Stevens (1974)! Such works
are especially valuable to mycologists
working in isolation with no mentors
to hand. In contrast to the discursive
overview of experimental methods by
Maheshwari (2005), this new book
is very much hands-on, and covers an
extraordinarily diverse range of topics. The
editors have marshalled 113 authors to
produce 57 chapters. The topics covered
include safe handling, cryopreservation,
mycotoxin detection, microscopic
methods, scanning electron microscopy,
atomic force spectroscopy, Fouriertransform
microscopy, media, screening,
staining methods, numerous PCR-based
methods, air sampling, molecular
fingerprinting of soils, transformations,
microsatellite markers, protoplast fusion,
enzyme production, volatile compound
detection, microarrarys, bioinformatics,
data mining, and genome/proteome
annotation. Of course everything could
not be covered, and there are excellent
volumes on methods relating to fungal
products (Keller & Turner 2012; see IMA
Fungus 3 (2): (60)–(61), December 2012),
volume 4 · no. 1
(23)

BOOK NEWS
and lichen-forming fungi (Kranner et al.
2002) from the same publishing group.
However, and perhaps deliberately, there
are no chapters on molecular phylogenetic,
mycorrhizal, experimental ecological,
or phytopathological methods; to do
justice to those areas would inevitably
have increased the size of the volume.
Considering the constraints of space, it did
surprise me, to find an attempt at a 16-
page artificial key to the genera of lichenforming
fungi; that seemed quite out of
place as no similar keys were included for
other fungi, and might have been better
omitted as it is not comprehensive and so
might mislead.
The editors have evidently been very
strict with their authors as wherever
appropriate material and equipment
required is enumerated, followed by
recipe-format step-wise methods, and often
also by data analysis and interpretation
– just what someone wishing to try a
new technique requires. They are to
be congratulated on this achievement!
Chapters are well-referenced to primary
literature, and there are numerous links to
websites. There are numerous illustrations,
most clearly presented, and in some cases
using colour.
This is a reference work that deserves to be
accessible in all mycology laboratories, but
I do wonder why Springer did not issue this
as a volume in The Mycota . . . .
Booth C (ed.) (1971) Methods in Microbiology. Vol.
4. London: Academic Press.
Keller NP, Turner G (eds) (2012) Fungal Secondary
Metabolism: methods and protocols. [Methods
in Molecular biology.] New York: Humana
Press.
Kranner I, Beckett RP, Varma AK (eds)
(2002) Protocols in Lichenology: culturing,
biochemistry, ecopysiology and use in
biomonitoring. [ Springer Lab Manuals.]
Berlin: Springer.
Maheshwari R (2005) Fungi. [Experimental
Methods on Biology vol. 24.] Boca Raton:
Taylor & Francis.
Stevens RB (ed.) (1974) Mycology Guidebook.
Seattle: University of Washington Press.
Ophiostomatoid Fungi: expanding frontiers. Edited by Keith A. Seifert, Z. Wilhelm de
Beer & Michael J. Wingfield. 2013. Utrecht: CBS-KNAW Fungal Biodiversity Centre. [CBS
Biodiversity Series no. 12.] Pp. ii + 337, illustr. ISBN 978-90-70351-94-6. Price: 75 €.
The ophiostomatoid fungi include some
particularly virulent tree pathogens and
wood-stainers, and so an authoritative
systematic treatment is of considerable
importance. An international workshop of
specialists working with these fungi was held
in association with IMC4 (Regensburg) in
1990, and led to the publication of a major
wide-ranging review (Wingfield et al. 1993).
With the advent of molecular phylogenetics,
and the accelerating discovery of new
species, an up-date was becoming long
overdue – and here it is! The basis of
this revision was a second international
workshop held in association with IMC6
(Cairns) in 2006, with updates since that
time made necessary by the ending of dual
nomenclature for pleomorphic fungi in
2011. The editors welcome the latter change,
and note that “a new era of nomenclatural
clarity and stability should emerge” (p. ii).
This volume is only a modest 44
pages (15 %) longer than its predecessor,
and the number of chapters has reduced
from 30 to 21. The contributions are
arranged in five sections: Taxonomy and
Phylogeny (5 chapters); Biodiversity (6);
Ecology and Pathology (4); Economic
and Applied Aspects (5); and Frontiers
(1) – plus a Nomenclator as an Appendix.
Molecular studies have confirmed the
placement of Ceratocystis in Microascales
(Sordariomycetidae), and Ophiostoma in
Ophiostomatales (Hypocreomycetidae),
and also enabled to position of numerous
taxa only known as conidial morphs
to be resolved. The disposition of all
genera referred to these groups in the
past is considered, and there are very
helpful diagrams of ascospore types and
asexual morphs. There is an overview of
Leptographium and Grosmannia, and
also the C. fimbriata complex which now
comprises an astonishing 26 species –
many described from different hosts but
not necessarily actually host specific. The
Biodiversity section is mainly concerned
with the associations with beetles in
different parts of the world, notably Africa,
Bhutan, China, Japan, New Zealand,
and North America. Conifer defence
mechanisms, pine decline in the southeastern
USA, associations with mites, and
those associated with Protea infructescences
feature in the Ecology & Pathology section.
Under Economic & Applied Aspects, there
are contributions on international spread
and regulation, wood market issues arsing
from blue-staining, albino strains that may
have applications in biocontrol and pulping,
considers. The Frontiers chapter focuses
on the new horizons genomics is starting
to open up, and the potential that arises
from progeny analysis of crosses between
Ophiostoma novo-ulmi and O. ulmi.
The Nomenclator that concludes the
volume is vastly expanded from that in the
(24) ima fUNGUS

1993 volume, and now covers 646 species
names that have been proposed, of which
397 are accepted and dispersed through
12 genera. Full bibliographic details of all
names and synonyms are provided, together
with references to published descriptions,
available phylogenetic data, and pertinent
Notes. With the addition of information
on the name-bearing types for the accepted
species, the data included here could
form the basis of lists to be proposed for
protection under the Melbourne Code.
As we have come to expect of all
publications from the CBS-KNAW Fungal
Biodiversity Centre, the production is
superb, and there are numerous colour
illustrations not just of the fungi, but
the damage they cause in forests and in
wood-staining. There were no coloured
photographs in the 1993 volume. The
editors have clearly put an immense amount
of effort into this work, and are to be
congratulated on their thoroughness and
attention to detail. However, some topics
in the 1993 work not revisited or updated
here, not least the synoptic key to species,
but also contributions on volatile products,
ultrastructure, and the medical importance
of some of these fungi. Those working with
these fungi will therefore surely wish to have
both works on their shelves.
Wingfield MJ, Seifert KA, Webber JF (1993)
Cearatocystis and Ophiostoma: taxonomy,
ecology, and pathogenicity. St Paul, MN:
American Phytopathological Society Press.
BOOK NEWS
Ascomycetes in Colour found and photographed in mainland Britain. By Peter I.
Thompson. 2013. Dartford: Xlibris Publishing. Pp. xxxvi + 367, illustr. colour. ISBN 978-
1-4797-4756-6, 978-1-4797-4755-9 (pbk). Price: £ 62.99 (hdbk), £ 42.99 (pbk).
Regional identification works are not
generally featured in IMA Fungus, but
an exception is made here because there
are so few modern illustrated works on
ascomycetes. Peter is a keen forayer who
had a long association with the Hampshire
Fungus Recording Group before moving
to the West Midlands in 2007. Having
gradually amassed a target of 700 species, he
presents these here to share his enthusiasm
for what are amongst the least-studied
fungi by field mycologists today. In the
Introduction, Peter describes how he
collects, examines, and identifies his finds –
information that will be valuable to others
wishing to engage with these fungi. The
scope is limited to ascomycetes with mature
ascomata over 0.1 mm diam, as that is
“about the size of the smallest fungus which
would be visible to the unaided eye” (p. v).
Also excluded are those in evidence only
through deformaties, or require culturing for
identification. In addition, lichen-forming
species are generally excluded, apart from
some crustose ones that might be mistaken
for non-lichenized fungi, such as species of
Coenogonium (here as “Dimerella”), Graphis
scripta, and Micarea prasina.
The format follows closely that of the
ascomycete volume of Fungi of Switzerland
(Breitenbach & Kränzlin 1984). Each
species entry has the accepted name,
sometimes selected synonyms, a single
colour macroscopic photograph (sadly
without a scale or indicated magnification),
a line drawing with 1–2(–3) spores (and
sometimes excipular hairs), and text covering
macroscopic features, substrates, size,
microscopic data, and the date and place of
the collection illustrated. Asexual morphs are
mentioned when figured, but not when they
are not which could cause some confusion on
occasion, as in Ascodichaena rugosa which is
rarely found with ascospores. No information
as to where vouchers are held is provided. The
authorities for scientific names are included,
always in full and never abbreviated, but not
with either places of publication or dates
appended. The arrangement of genera is
alphabetical, but within order rather than
through all entries; I found this frustrating,
especially as no synoptic classification is
included meaning that the index has to be
referred to to locate a particular genus or
species. Keys are provided to species within
genera, or groups of genera, in which four
or more species are treated, but there is no
key to the genera themselves. As in many
field guides, there is also no indication of
how many species are known in each genus,
which can serve to alert users that the fungus
they have may not be in the key. There are
no literature references in individual entries,
but there is a helpful table giving the page
numbers in five selected works where further
information can be found.
I was pleasantly surprised to find that
while apotheciate species predominated
(433 species), a considerable number of
perithecioid ones were also treated (267
species). This must be one of the largest sets
of colour photographs of pyrenomycetes
to have appeared in print in a single place.
The range of pyrenomycetes covered is
quite diverse, including, for example, some
erysiphalean, hypocrealean, xylariaceous,
and even microthyriaceous species. Some
of the illustrated species have rarely been
collected and never previously presented
in colour before, such as Paradidymella
clarkii. This should do much to stimulate
many more field mycologists to search for
and endeavour to identify even the smallest
visible ascomycetes.
The book is pleasingly presented and
a testimony to enthusiasm and dedication,
and is all the more remarkable as it has been
achieved by a “citizen scientist” rather than
a professional mycologist. Fortunately, Peter
has been able to draw on the expertise of
several other mycologists for identifications,
including Martyn Ainsworth, Zotto Baral,
Mariko Parslow, and Brian M. Spooner,
but many appear to be his own. This is
certainly a work all field mycologists
working in Europe will find of enormous
value, and also an important contribution
to the documentation of the diversity of
ascomycetes in the region.
Breitenbach J, Kränzlin F (1984) Fungi of
Switzerland. Vol. 1. Ascomycetes. Lucerne: Verlag
Mykologia.
volume 4 · no. 1
(25)

BOOK NEWS
The Kingdom of Fungi. By Jens H. Petersen. 2012. Princeton, NJ: Princeton University
Press. Pp. 265, illustr. colour. ISBN 978-0-691-15754-2. Price: US $ 29.95.
Many mycologists will already have
marvelled at the superb high-quality
full-colour macrophotography of Jens
Petersen in the MycoKey CD’s, prepared
with Thomas Læssøe; the latest version I
have to hand is that issued in the back of
the first edition of Funga Nordica (Læssøe
& Petersen 2008) which included over
4000 illustrations of basidiomycetes and
discomycetes. Now these have been built
on to produce what must surely be the most
wonderful celebration of the breadth of
fungal diversity yet to appear in print. Jens
points out that are “the last great unknown
among the multicellular organisms” (p.
4) and that “only one in every fourteen
species . . . has yet been described” (p. 254).
His aim is to reveal this kingdom and its’
inhabitants 1 , which he does superbly.
The introductory sections explain the
position of fungi amongst the kingdoms
of Life, and how fungi are built from
hyphae, reproduce, and disperse. Parallel
evolution of sporocarp shapes such as cups
and clubs, and gastroid forms is explained,
and the principle fungal phyla are exposed
one by one. Although a celebration of
fungi rather than an identification guide,
there is an intriguing circular wheel-like
key to the main “form groups” based
on sporocarp form (pp. 44–45). While
the tour occupies three-quarters of the
volume, the last sections are devoted
to a poignant introduction to the roles
of fungi in ecological processes and
world affairs. While fungi can be found
almost anywhere, areas with intensive
agrochemical-based agriculture are aptly
described as “agricultural deserts” where
“fungi have no chance”. Five actions to
protect the biodiversity of fungi for future
generations are highlighted and merit wide
attention (p. 256): (1) Work against rapid
climate change; (2) Protect the biodiversity
and continuity of forests; (3) Manage
grazed and unfertilized grassland; (4)
Stop the uninhibited use of fertilisers and
fungicides in agriculture and forestry; and
(5) Encourage research in fungal taxonomy
and biology. The book closes with a
telling Postscript figuring the “Amazonian
Mystery Tongue”, a fine pink jelly fungus
from Ecuador which is “outside any known
genus”, and “might be the fungus with the
enzyme system that could produce a cheap
and efficient transformation of straw into
biofuel or an agent against cancer” (p. 259).
Fungi of potential major benefit to human
well-being may be becoming extinct before
they are ever collected, assessed, and named.
Every page is in full-colour with minimal
but extremely pertinent modest or no text
areas. The extraordinarily fine photographs
are allowed to speak for themselves. Everyone
will have their own favourites amongst the
illustrations, and selecting even a top-fifty
would be an invidious task. Amongst the
contenders for a personal top ten have to
be those of ascospores of Acrospermum
compressum in flight, asci of Ascobolus
immersus, differently coloured exudates
of Lactarius gills, Cookeina tricholoma, an
unidentified red-apotheciate Cladonia from
Ecuador (double-page spread), the blueing
flesh and tubes of Gyroporus cyanescens,
exudates on Hydnellum ferugineum, the
five pages of calicioid fungi (lichenized
and not), Pilobolus crystallinus (x 70), and
Thamnomyces dendroidea. All but a handful
of the 800 or so stunning photographs are by
the author.
That such a lavish work can be made
available at such a modest price in the
21 st century, is clearly an indication of the
confidence the publishers have in its success.
It is a book with a message about both the
beauty and importance of fungi that should
be widely available in bookshops worldwide
and so help raise the global awareness of
kingdom Fungi. I cannot commend it too
strongly, and if you have not yet seen it you
are in for a real treat – perhaps a mycologist’s
equivalent of being a kid in a candy store.
Læssøe T, Petersen JH (2008) MycoKey. Version
3.1. Funga Nordica Edition. Copenhagen:
Nordsvamp.
1
See also the interview with the author on pp. (21)–
(22) of this issue of IMA Fungus.
Fungal Associations. Edited by Bertold Hock. 2012. Heidelberg: Springer. [The Mycota
Vol. 9, 2nd edn.] Pp. xxvi + 406, illustr. ISBN 978-3-642-30825-3 (hdbk), 978-3-642-
30826-0 (eBk). Price: £ 180.00 (hdbk), £ 144 (eBk).
The original edition of this volume, also
edited by Bertold Hock, appeared in 2001.
That volume comprised 13 chapters: nine
on mycorrhizas, three on lichens, and
one on fungal/bacterial interactions. This
new edition is 156 pages longer and has
18 chapters: 14 on mycorrhizas, three
on lichens, and one on fungal/bacterial
volatiles. Several chapters involve authors
from the first edition, often with different
co-authors, but others are fresh to the
volume.
As might be expected in view of the
huge amount of recent and most elegant
research on arbuscular mycorrhizas, five
chapters are devoted to them. These cover
aspects from genome exploration, interfaces
and signalling, to their importance in
sustainable ecosystems. Again there is a
chapter on the Geosiphon/Nostoc association,
including new information on the transport
of sugars and phosphate between the bionts.
There are also updates of those concerned
with lipids and carbohydrate exchange in
ectomycorrhizal fungi. I especially enjoyed
the challenge and vision in the contribution
of Plett and colleagues based on new
genomic analyses, working towards a blueprint
that could have predictive value for
the maintenance of forest sustainability
(26) ima fUNGUS

through ectomycorrhizal fungi. A term
I encountered for the first time here was
“stonesphere” (p. 171), for “rock fragments
in the rooted zone of the soil that interact
with the soil environment physically,
chemically, or biologically”.
The chapter on lichen-forming
ascomycetes by Rosmarie Honegger
has swelled from 23 to 52 pages, and is
enhanced by composite colour as well
as many fresh superb scanning electron
micrographs plates; with 14 pages of
references. Taken with the following
contribution by Franz Oberwinkler on
basidiomycetous lichens, this is now almost
a textbook of lichen biology. The former
chapter on the phylogeny of ascomyceteous
lichens has gone, but much of the key points
are now covered in volume 14 (Evolution
of Fungi and Fungal-like Organisms, 2011).
Particularly welcome, however, is the new
contribution on bacterial partners in lichen
thalli, many of which represent novel
lineages; this new area of study promises to
become increasingly exciting.
The standard of production is excellent,
and I welcome the placing of key points
within the text in bold type so they are
easily picked out. The Mycota is clearly
a reference work all major mycological
libraries should hold, including revisions
of earlier volumes, but as advances move
at different rates in diverse aspects of the
study of fungi, is this format the best way
to generate authoritative topical reviews?
As I have pointed out before, conversion
to a review journal might better fit the
needs of many mycologists who only want
a particular topic. There is also the problem
of what goes into which volume, and this
is a particular problem for the current one.
The patchy coverage of the full range of
associations in which fungi are involved
seen in this volume appears to be partly a
consequence of some fungal associations
being treated in other volumes of the
series, in particular in Environmental and
Microbial Relationships (vol. 4, 2 nd edn,
2007), Plant Relationships (vol. 5, 2 nd edn,
2009), Human and Animal Relationships
(vol. 6, 2 nd edn, 2008), Agricultural
Applications (vol. 11, 2002 1 ), and Human
Fungal Pathogens (vol. 12, 2004 1 ).
However, some major and widespread
associations seem to have fallen through
the cracks, or are treated rather cursorily,
such as algicolous fungi, fungicolous
fungi (other than some mycoparasites),
bryophilous fungi (including mycorrhizas),
and the full spectrum of invertebratefungal
relationships (which get but a few
pages in vol. 6). If the book format is the
paradigm to be followed, perhaps it would
have been better to restrict this volume
to mycorrhizas (and adding in bryophyte
mycorrhizas on which there is much
recent work), and have separate additional
volumes on each of lichen associations and
invertebrate associations. Interestingly,
Geoffrey Ainsworth informed me in the
1980s that an extra volume just on lichens
had been planned for inclusion in The
Fungi (5 vols, 1965–73), on which The
Mycota was modelled, but the invited
editor failed to deliver.
1
New editions of these volumes are advertised to
appear in 2013.
BOOK NEWS
Dimorphic Fungi: their importance as models for differentiation and fungal pathogenesis.
Edited by Jose Ruiz-Herrera. 2012. Sharjah, UAE: Bentham Science Publishers. Pp.
iv + 143, illustr. ISBN 978-1-608050510-4, 978-1-60805-364-3 (e-book). Price: US $ 83
(print) and US $ 69 (e-book).
Dimorphic fungi are defined for the purposes
of this book as “the property of different
fungal species to grow as budding yeasts or
mycelium depending on the environmental
conditions” (p. ii). As far as I am aware, this
issue was last the subject of a major multiauthored
book in 2000 (Ernst & Schmidt
2000), which, strangely, seems not to be cited
here. Although there have been important
advances in our understanding of the yeast/
mycelium switching/signalling process since
that time. Both works concentrate on human
pathogens, where the change in morphology
is such a critical part of the infection process
and subsequent pathology – and so a target
for remedial measures.
The work consists of eight chapters,
with 17 contributors drawn from Brazil,
India, Italy, Mexico, and Venezuela). This
spectrum reflects the particular problems
posed by these fungi in tropical regions,
and especially in South America where so
much important research on them has been
carried out. The book starts with a detailed
and wide-ranging overview of the subject
area, with much of the history and also
an extensive bibliography; that will be of
value to all entering these field or requiring
an authoritative synopsis. The remaining
seven chapters each deal with particular
species or species complexes: the human
pathogens Paracoccidiodes (P. brasilensis and
P. lutzii cryptic species), Candida albicans,
Histoplasma capsulatum, Yarrowia lipolytica,
Sporothrix schenckii, and zygomycetous
fungi; and also the plant pathogen Ustilago
volume 4 · no. 1
(27)

BOOK NEWS
maydis. It is always somewhat invidious to
single out particular chapters, but I did find
that on zygomycetous of especial interest
as it brings together information on all
pertinent genera of these fungi, which are
too often misunderstood or misidentified
in clinical situations. The inclusion of the
chapter on Ustilago maydis is justified by its
use as a model organism in fungal biology,
and a first-rate overview of our knowledge of
that fungus, but I wonder how much work
on a basidiomycete will prove also to apply
to the other fungi treated here which are all
from other phyla.
The book is well-presented and edited,
with some excellent photographs, though
some are not for the squeamish, and also the
use of colour in many of the line figures is
most helpful. It will surely become a benchmark
in the synthesis of our understanding
of the dimorphism phenomenon in human
pathogenic fungi. It is available as an e-book
and also by print-on-demand.
Ernst JF, Schmidt A (eds) (2000) Dimorphism in
Human Pathogens and Apathogenic Yeasts.
[Contributions in Microbiology Vol. 5.] Basel:
Karger.
Trüffeln: Mythos und Wirklichkeit. By Christian Vorlbracht. 2012. Wiesbaden: Tre Torri
Verlag. Pp. 183, illustr. ISBN 978-3-941641-85-3. Price: 150 € (limited edn), 24 € (hdbk).
Truffles are traditionally associated with
passion, whether exquisite chocolates
or underground fungi with reputation
as an aphrodisiac. They also fascinate
mycologists, and not least amongst these
is Christian Volbracht, whose name is
irrevocably linked to mycological books
and scholarly bibliography through his
trading name MycoLibri. He has a personal
mycolibrary that would be the envy of any
field or macro-mycologist (Volbracht 2006).
Christian has drawn on this extensively to
produce this delightful text, which includes
reproductions of title pages, texts, and
illustrations (including cartoons) from many
ancient works in his collection. The earliest
descriptive account was evidently by Pliny,
printed in 1481, and the first treatise was
by Alphonso Ciccarello, the Opusculum de
Tuberibus of 1564. The reputation as potent
aphrodisiacs, however, extends back much
further, to at least Leukadia who lived ca
435—380 BC. Christian considers this
reputation a myth, and while that might
be true for most truffles, this could perhaps
hold for the most prized, such as Tuber
magnatum. That truffle, the Piedmont
white truffle that has yet to be cultivated,
generally sells for around 2000–5000 € kg -1
1
, while the Tar truffle, T. mesentericum sells
for just 80—150 € kg -1 . There have certainly
been historic episodes of Trüffelmania, and
Gastrochauvinism in relation to truffles is
still about. Restauranteurs and gourmets
will pay seemingly absurd amounts for single
specimens, but anyone who has been in the
truffle shops and restaurants of Alba and
experienced the pervasive unique odour of T.
magnatum may well feel the prices justified.
There is a fascinating chapter on culture, and
I had not appreciated that the earliest attempt
was by an Englishman, Richard Bradley,
a professor of botany in the University of
Cambridge in 1731. There are sections on
truffle-hunting pigs and dogs, the Trüffelen
vs. Tartufellen distinction, a synopsis of the
different kinds of white and black truffles, a
glossary, numerous endnotes, and a selected
bibliography, but sadly no index. The
orientation is purposefully historical, and
this sets this volume apart from, and makes
it complementary, to the many other works
on truffles which focus on identification,
cultivation, or gastronomy (e.g. Dedulle & de
Coninck 2008, Hall et al. 2007).
The text is in German and the question
of whether Germany is overdue in becoming
a “Trüffelnation” is raised; this book should
address that issue, especially in view of the
low price of the regular edition. The limited
edition is of 100 copies, available from the
author, and has leather black truffle inserts
in the front cover, a leaf of paper made
from polypores with truffle slices, and the
signature of the author in Coprinus ink. A
really delightful book for anyone fascinated
by truffles, associated facts, and the stories
that surround them.
Dedulle A, de Coninck A (2009) Truffles: Earth’s
black diamonds. Buffalo, NY: Firefly Books.
Hall IR, Brown GT, Zambonelli A (2007) Taming
the Truffle: the history, lore, and science of the
ultimate mushroom. Portland, OR: Timber
Press.
Volbracht C (2006) MykoLibri: Die Bibliothek der
Pilzbücher. Hemburg: Christian Volbracht.
1
The record appears to be one weighing 1.5 kg sold
in Macau in 2007, at 130 900 € kg -1 . While another
of 0.9 kg went for 105 000 €, equivalent to 116 600
€ kg -1 , to a Master of Wine in Hong Kong in 2010
[Ed.].
Checklist of Fungi of Malaysia. By S. S. Lee, S. A. Alias, E. B. G. Jones, N. Zainudin & H. T.
Chan. 2012. Kepong, Selangor: Ministry of Natural Resources and Environment. [Research
Pamphlet no. 123.] Pp. ix + 556, CD [inside back cover]. ISBN 978-967-5221-82-
8. Price: Not indicated.
This is the first comprehensive checklist of
Malaysian fungi to have been compiled since
that of Chipp (1921), though there have
been lists of plant pathogens and various
special lists. The number of species recorded
has swelled from 861 to around 4000 over
(28) ima fUNGUS

that time. The new list covers all fungal
groups and fungal analogues, including
myxomycetes and oomycetes, and fungi
with all biologies are embraced, including
the lichen-forming fungi. The checklist
itself is preceded by a series of eight succinct
overviews the exploration and diversity of
the various phyla, which also in most cases
incorporate a disposition of the accepted
species by family, although the asexual fungi
were listed separately from sexual ones.
The main body of the work, however
is a checklist in which all species are,
conveniently, listed alphabetically. For
each species the current name is given
where that differs from that reported, and
there are columns detailing the substrate/
host, location, and literature reference. The
bibliography comprises 441 publications,
and also references to four websites. The
authors have clearly been at pains to
check the names, with which Paul M.
Kirk evidently assisted. There is also a CD
slipped into the inside back cover Paul
prepared which holds a 410-page PDF
with information on the 12 000 Malaysian
collections held in the living collections of
CABI Bioscience and reference specimens
of the former International Mycological
Institute (IMI; now housed at the Royal
Botanic Gardens, Kew); the collections are
arranged systematically with full details of
substrate/host, year of collection, locality,
and collector. Many of the IMI collections
were made by Anthony P. Johnston who
served as a plant pathologist in Malaysia
from 1946–64, prior to moving to IMI of
which he was the Director from 1968–83.
The authors stress that this is only the
starting point to an inventory of the fungi
of Malaysia; with some 15 000 recorded
vascular plants, the real total could be as
much as 90 000 so there is much still to be
done. Perhaps to tempt future mycologists
to undertake work in the region, there are
12 plates, mostly in colour, showing selected
species. This fine compilation is an excellent
example of what can be achieved by a
dedicated team with appropriate resources
and merits emulation more widely in
tropical countries to provide a spring-board
for future exploration and documentation of
the mycobiota.
Chipp TF (1921) A list of fungi of the Malay
Peninsula. Gardens’ Bulletin, Straits Settlements
2: 311–418.
BOOK NEWS
volume 4 · no. 1
(29)

International and regional meetings which are entirely mycological or have a major mycological component.
FORTHCOMING MEETINGS
2013
FEMS 2013: 5 th Congress of European Microbiologists
21–25 July 2013
Congress Center Leipzig, Messe-Allee 1, Leipzig, Germany
Contact: Kenes International, 1-3, rue de Chantepoulet, P.O. Box 1726, CH-1211 Geneva 1, Switzerland; fems@kenes.com
3 rd Annual World Congress of Microbes–2013 (WCM-2013): Non-Virus Microbes 2013
4–6 August 2013
Chongquing, China
Contact: BIT Congress Inc., Chongquing, China; chinajob.com
Asian Mycological Congress and 13 th International Marine and Freshwater Mycology Symposium
14–19 August 2013
Beijing International Convention Center, Beijing, China
Contact: Na Jiang; AMC2013@163.com
19 th Australasian Plant Pathology Congress: Protecting our Cops and Native Flora
25–28 August 2013
University of Auckland, Auckland, New Zealand
Contact: events@plantandfood.co.nz
Bio-security, Food Safety and Plant Pathology: The Role of Plant Pathology in a Globalized Economy
10 th International Congress of Plant Pathology
25–31 August 2013
Beijing International Convention Center, Beijing, China
and
6 th Trends in Medical Mycology (TIMM)
11–14 October 2013
Tivoli Hotel and Conference Center, Copenhagen, Denmark
Contact: Congress Care, P.O. Box 440, 5201 AK ’s-Hertogenbosch, The Netherlands; info@congresscare.com
3 rd International Crongress on Fungal Conservation
11–15 November 2013
G'kova Bay, M-la, Turkey
Contact: Congress Care, P.O. Box 440, 5201 AK ’s-Hertogenbosch, The Netherlands; info@congresscare.com
2014
6th Advances against Aspergillosis
27 February – 1 March 2014
Melía Castilla Conference and Convention Centre, Madrid, Spain
Contact: anne@hartleytaylor.co.uk
12 th European Conference on Fungal Genetics
23–27 March 2014
Silken Al-Anadalus Palace Hotel, Seville, Spain
Contact: ECFG12@viaje.seci.es
(30) ima fUNGUS

9 th International Conference on Cryptococcus and Cryptococcosis
15–19 May 2014
Royal Tropical Institute, Amsterdam, The Netherlands
IUMS XIV International Congress of Mycology
[with the Congresses of Bacteriology and Applied Microbiology, and also Virology]
27 July–1 August 2014
Montreal, Canada
Contact: e-mail: iums3014@nrc-cnrc.gc.ca
10 th International Mycological Congress (IMC10)
3–8 August 2014
Queen Sirikit National Convention Center, Bangkok, Thailand
Contact: Lekha Manoch; agrlkm@ku.ac.th
< http://www.imc10.kasetsart.org/>
FORTHCOMING MEETINGS
8 th International Congress on the Systematics and Ecology of Myxomycetes
11–15 August 2014
Jilin Agricultural, University in Jilin Province, China
Contact: Qi Wang; e-mail: qwang2003@hotmail.com
VIII Latin-American Congress of Mycology (VIII CLAM)
Colombia: the Crossroads of Latin-America’s Fungal Diversity
4–7 November 2014
Centro de Convenciones Plaza Mayor, Medellín, Colombia
Contact: Aida Vasco; almycol@gmail.com
NOTICES
IMA Fungus is compiled by David L. Hawksworth (Facultad de Farmacia, Universidad Complutense de Madrid) on behalf of
the Executive Committee of the International Mycological Association. All unsigned items in the journal are by, and may be
attributed to, him.
Items for consideration for inclusion in all sections of the journal should be submitted to him at d.hawksworth@nhm.ac.uk.
Books for possible coverage in the Book News section should be mailed to: IMA Fungus, Milford House, The Mead, Ashtead,
Surrey KT21 2LZ, UK.
volume 4 · no. 1
(31)

ARTICLE
ima fUNGUS

doi:10.5598/imafungus.2013.04.01.01
IMA Fungus · volume 4 · no 1: 1–4
Taiwanascus samuelsii sp. nov., an addition to Niessliaceae from
the Western Ghats, Kerala, India
Kunhiraman C. Rajeshkumar 1 , and Amy Y. Rossman 2
1
National Facility for Culture Collection of Fungi, Agharkar Research Institute, G.G. Agarkar Road, Pune, India; corresponding author e-mail:
rajeshfungi@gmail.com
2
Systematic Mycology & Microbiology Laboratory, Agriculture Research Service, United States Department of Agriculture Service, Beltsville,
Maryland, USA
ARTICLE
Abstract: A new species of Taiwanascus, T. samuelsii, was collected from southern parts of Western Ghats on dead
branches of Anacardium occidentale and is described. The new cleistothecial ascomycete is different from the type and
only species in Taiwanascus, T. tetrasporus, in cleistothecial size, setae, and ascospore characteristics.
Key words:
Ascomycota
Cleistothecia
Hypocreales
Stellate setae
Article info: Submitted: 12 January 2013; Accepted: 19 March 2013; Published: 4 April 2013.
INTRODUCTION
The southern parts of the Western Ghats are rich and diverse
in fungi due to the diverse forest ecosystem, geography, and
climatic conditions. Many new microfungi were reported from
this locality by mycologists at the National Fungal Culture
Collection of India (NFCCI) (Rajeshkumar et al. 2010, 2011a,
b, 2012). During early November 2011 an expedition was
made to natural forests and plantations of Karadka village
and adjoining areas (specifically northern Kerala) where no
mycologists have ever surveyed for microfungi. During this
survey, we discovered a rare specimen of Niessliaceae that
forms cleistothecial ascomata with stellate setae.
The family Niessliaceae was established by Kirschstein
(1939) to accommodate a group of taxa having small, dark,
superficial, saprobic, setose perithecioid ascomata. Later,
the new genus Taiwanascus (Sivanesan & Chang 1997) was
described with the following characteristics: cleistothecial
ascomata with aseptate setae, brown, thick-walled, straight,
smooth, and more or less 2–6 times dichotomously branched
at their apex with the upper branchlets possessing somewhat
darkly thickened, minute denticles. Sivanesan & Chang
(1997) also proposed a new family name Taiwanascaceae
that was later synonymised with the Niessliaceae (Lumbsch
& Huhndorf 2007). The characteristics of the only known
species, T. tetrasporus, were consistent with those of the
Niessliaceae (Samuels & Barr 1997).
MATERIAL AND METHODS
Cleistothecia were observed on the surface of a dead
twig under a Nikon binocular stereo microscope (Model
SMZ-1500 with Digi-CAM, Japan). For morphotaxonomic
studies and photomicrographs, Carl Zeiss (AXIO Imager 2,
Germany) and Olympus (Model CX-41, Japan) microscopes
were used. Asci and ascospores were mounted in lactic acid
with cotton blue and measured using an ocular micrometer
with 30 observations per structure (Crous et al. 2009).
The measurements were also confirmed with the software
available with the Carl Zeiss microscope. The material is
deposited in the Ajrekar Mycological Herbarium (AMH 9575).
TAXONOMY
Taiwanascus samuelsii Rajeshkumar & Rossman,
sp. nov.
MycoBank MB803434
(Figs 1–2)
Etymology: samuelsii, named in honour of Gary G. Samuels,
Mycologist (USDA-ARS, Beltsville, MD), for his scientific
contribution to this fungal family.
Diagnosis: Ascospores 5.5−10.5 × 2.5−4.0 µm, ovoid,
ellipsoidal to cylindrical, unlike those of T. tetrasporus with
ascospores filiform or aculeate, 15–30 µm long, 1.0–1.5 µm
thick.
Type: India: Kerala State: Kasaragod, Karadka, on
Anacardium occidentale, 5 Nov. 2011, K.C. Rajeshkumar
(AMH 9575 – holotype).
Description: Ascomata superficial, gregarious, cleistothecial
77–245 µm diam, globose to subglobose, dark brown textura
© 2013 International Mycological Association
You are free to share - to copy, distribute and transmit the work, under the following conditions:
Attribution:
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).
Non-commercial: You may not use this work for commercial purposes.
No derivative works: You may not alter, transform, or build upon this work.
For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get
permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.
volume 4 · no. 1
1

Rajeshkumar & Rossman
ARTICLE
Fig. 1. Taiwanascus samuelsii (holotype): A–C. Ascomata with stellate setae. D, E. Asci coming out from cleistothecia. F. Textura angularis wall
pattern of cleistothecia.
2
ima fUNGUS

Taiwanascus samuelsii sp. nov.
ARTICLE
Fig. 2. Taiwanascus samuelsii (holotype): A–D. Ascomatal setae/appendages. E–H. Asci with ascospores. I. Asci in group. J–M. Ascospores.
volume 4 · no. 1 3

Rajeshkumar & Rossman
ARTICLE
angularis. Setae stellate, 80–110 × 10–25 µm, arising from
entire ascomata, thick-walled, smooth at base, branched at
top with 4–7(–9) branchlets, with acute or pointed apices.
Peridium thin-walled. Hamathecium absent. Asci 32.5−44.0
× 7.0−9.0 µm, unitunicate, thin-walled, clavate, eight-spored,
apex simple or with a thin apical ring. Ascospores 5.5−10.5
× 2.5−4.0 µm, ovoid, ellipsoidal to cylindrical, hyaline or
pale yellow, mostly straight, smooth, thin-walled, guttulate,
rounded at apex, aseptate or 1-septate.
Asexual morph: not observed.
DISCUSSION
The monotypic genus Taiwanascus, with its type species
T. tetrasporus, is differentiated from Valetoniella on its
cleistothecial ascomata. Both genera have dark brown setae
on the ascomata that are cruciately branched at the apex
(Samuels & Barr 1997, Sivanesan & Chang 1997). The nonfissituniate
asci in T. tetrasporus each contain four filiform to
aculeate ascospores. The type species was collected as a
saprotrophic, lignicolous fungus on unidentified angiosperm
dead wood from Taipei, Taiwan (Chang WL1018-94, 18
Jan 1994; IMI 364835). This is the first record of the genus
Taiwanascus from India.
Taiwanascus samuelsii is described as new based on the
size of its cleistothecia, size and shape of the cleistothecial
setae, and ascospore characteristics when compared with T.
tetrasporus. Taiwanascus tetrasporus has cleistothecia 130–
150 µm diam with setae that are 2–6 dichotomously branched
with minute, apical branchlets, asci with four ascospores, and
long fusiform to aculeate ascospores that are 15–30 µm long,
1.0–1.5 µm thick.
REFERENCES
Crous PW, Verkley GJM, Groenewald JZ, Samson RA (eds) (2009)
Fungal Biodiversity. [CBS Laboratory Manual Series No. 1.]
Utrecht: Centraalbureau voor Schimmelcultures.
Kirschstein W (1939) Über neue, seltene und kritische Ascomyceten
und Fungi Imperfecti. II. Annales Mycologici 37: 88–140.
Lumbsch TH, Huhndorf SM (2007) Outline of Ascomycota - 2007.
Myconet 13: 1-58.
Rajeshkumar KC, Singh PN, Yadav LS, Swami SV, Singh SK (2010)
Chaetospermum setosum sp. nov. from the Western Ghats,
India. Mycotaxon 113: 397–404.
Rajeshkumar KC, Hepat RP, Gaikwad SB, Singh SK (2011a) Pilidiella
crousii sp. nov. from northern Western Ghats, India. Mycotaxon
115: 155–162.
Rajeshkumar KC, Sharma R, Hepat RP, Swami SV, Singh PN,
Singh SK (2011b) Morphology and molecular studies on
Pseudocercospora kamalii sp. nov. a foliar pathogen on
Terminalia from India. Mycotaxon 117: 227–237.
Rajeshkumar KC, Kajale S, Sutar SA, Singh SK (2012) Ellisembia
karadkensis sp. nov. from the Western Ghats, India. Mycotaxon
121: 181–186.
Samuels GJ, Barr ME (1997) Notes on and additions to the
Niessliaceae (Hypocreales). Canadian Journal of Botany 75:
2165–2175.
Sivanesan A, Chang HS (1997) A lignicolous ascomycete,
Taiwanascus tetrasporus gen. et sp. nov., and a new family
Taiwanascaceae. Mycological Research 101: 176–178.
Acknowledgements
We are indebted to the Department of Science and Technology
(DST), Government of India, New Delhi for providing financial support
for setting up the National Facility for Culture Collection of Fungi at
Agharkar Research Institute, Pune, India and the Director, Agharkar
Research Institute, for providing facilities.
4
ima fUNGUS

doi:10.5598/imafungus.2013.04.01.02
IMA Fungus · volume 4 · no 1: 5–19
Cryptic diversity in the Antherospora vaillantii complex on Muscari
species
Marcin Piątek 1 , Matthias Lutz 2 , and Arthur O. Chater 3
1
Department of Mycology, W. Szafer Institute of Botany, Polish Academy of Sciences, Lubicz 46, PL-31-512 Kraków, Poland; corresponding
author e-mail: m.piatek@botany.pl
2
Evolutionäre Ökologie der Pflanzen, Institut für Evolution und Ökologie, University of Tübingen, Auf der Morgenstelle 1, D-72076 Tübingen,
Germany
3
Windover, Penyrangor, Aberystwyth, SY23 1BJ, UK
ARTICLE
Abstract: The anther smut fungi in the ustilaginomycetous genus Antherospora (Floromycetaceae, Urocystidales)
that infect monocots, are currently placed in nine species. Against the background of the generally observed high
host specificity in smut fungi, the broad host range reported for some of the species suggests much higher diversity.
Antherospora vaillantii s. lato includes anther smuts on different Muscari species. In this study, specimens of anther
smuts on Muscari armeniacum, M. botryoides, M. comosum, and M. tenuiflorum were analysed by rDNA sequences
and morphology to determine whether they represented one polyphagous or several host specific species. The
molecular phylogeny revealed three distinct lineages that were correlated with host plants, yet had only slight
morphological differences. These lineages are assigned to three cryptic species: Antherospora hortensis sp. nov.
on Muscari armeniacum, A. muscari-botryoidis comb. nov. (syn. Ustilago muscari-botryoidis) on M. botryoides, and
A. vaillantii s. str. on M. comosum and M. tenuiflorum. All species on Muscari form a monophyletic group within
Antherospora, and the phylogenetic relations within this group coincide well with the subgeneric classification of the
respective host species. This indicates a common ancestry of Muscari anther smuts and co-evolution as a driver of
their diversification.
Key words:
Basidiomycota
Cryptic species
Molecular analysis
Muscari
Phylogeny
Plant pathogens
Smut fungi
Article info: Submitted: 27 January 2013; Accepted: 28 February 2013; Published: 4 April 2013.
INTRODUCTION
The anther smut fungus Ustilago vaillantii was described by
the Tulasne brothers at the beginning of systematic mycology
(Tulasne & Tulasne 1847). The specific epithet honoured
the pre-Linnean botanist Sébastien Vaillant (1669–1722),
the first collector of anther-infected Muscari comosum. In
the protologue, the Tulasne brothers included three host
species of Ustilago vaillantii in the following order: Muscari
comosum, Scilla anthericoides, and Scilla maritima. The two
latter names are synonyms of the species currently named
Charybdis maritima (Speta 1988, Euro+Med 2006-). The type
host was attributed to Muscari comosum by Liro (1924) and
Ciferri (1928), who reasonably explained this selection.
Subsequent to its description, Ustilago vaillantii became
a catch-all for different smut specimens sporulating in the
anthers of monocotyledonous plants that currently are placed
in Asparagaceae subfam. Scilloideae (syn. Hyacinthaceae,
APG III 2009, Chase et al. 2009). Some attempts to describe
separate taxa within this complex, such as Ustilago vaillantii
var. tourneuxii on Bellevalia trifoliata (Fischer von Waldheim
1880), U. albucae on Albuca sp. (Sydow & Sydow 1914a), U.
peglerae on Ornithogalum lacteum (Sydow & Sydow 1914b),
U. muscari-botryoidis on Muscari botryoides (Ciferri 1928),
U. scillae on Scilla bifolia (Ciferri 1931) or U. urgineae on
Charybdis maritima (Maire 1931), were based mostly on small
morphological differences and/or supposed host specificity,
and received moderate acceptance by smut researchers
(Zundel 1953). In general, most authors recognised anther
smuts on monocots as one species Ustilago vaillantii (Liro
1924, Vánky 1985) and such an approach was adopted until
very recently (Vánky 1994).
The first classification of smut fungi based on ultrastructure
and molecular phylogeny (Bauer et al. 1997, Begerow et al.
1997, Bauer et al. 2001) restricted the genus Ustilago to
species on Poaceae. Consequently, Ustilago vaillantii was
moved to the genus Vankya, typified by the foliicolous V.
ornithogali (Ershad 2000). Molecular analyses revealed that
the anther smuts on monocots were only distantly related to
the foliicolous representatives of Vankya, and a new genus
Antherospora, typified by A. vaillantii, was established for
the former group (Bauer et al. 2008). The genus Vankya
is currently restricted to host plants in Liliaceae subfam.
Lilioideae (Vánky 2009). In addition to describing a new
genus, Bauer et al. (2008) demonstrated that the evolution
of the anther smuts on monocots is related to host taxonomy,
© 2013 International Mycological Association
You are free to share - to copy, distribute and transmit the work, under the following conditions:
Attribution:
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).
Non-commercial: You may not use this work for commercial purposes.
No derivative works: You may not alter, transform, or build upon this work.
For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get
permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.
volume 4 · no. 1 5

Piątek, Lutz & Chater
ARTICLE
and consequently a narrow species concept within this group
was warranted, despite limited access to fresh specimens
for molecular analyses. The anther smuts on monocots are
uncommon and difficult to detect because the sori are often
hidden by the perianths, at least in some host genera (e.g.
Bellevalia, Muscari). In comparison, the anther smuts on
dicots (Lutz et al. 2005, 2008, Roets et al. 2008, Curran et al.
2009, Hood et al. 2010, Kemler et al. 2009, 2013, Piątek et al.
2012, 2013) are more often collected.
The species concept adopted by Bauer et al. (2008)
narrowed Antherospora vaillantii to smuts infecting Muscari
species (Vánky 2012). However, molecular analyses revealed
genetic divergences between smut collections from different
Muscari species (Bauer et al. 2008), which suggest that host
specialization may be higher than to the genus level and that
more than one species may have radiated on Muscari species.
Indeed, in addition to Antherospora vaillantii on Muscari
comosum, a second species was described for anther smuts
on Muscari, namely Ustilago muscari-botryoidis on Muscari
botryoides, although in recent monographs it was considered
a synonym of the former species (Vánky 1985, 1994, 2012,
Scholz & Scholz 1988, Karatygin & Azbukina 1989, Denchev
2001). The history of discovery and description of Ustilago
muscari-botryoidis well illustrates the approach leading to the
descriptions of different biological species by taxonomists
working at the beginning of 20 th century, prior to establishment
of molecular methods. In 1921, Ciferri (1928) discovered an
anther-infected population of Muscari botryoides in northern
Italy. The co-occurring Muscari comosum, flowering later,
was healthy. Subsequently, Ciferri (1928) made a three-year
observation of a co-cultivation of infected Muscari botryoides
with non-infected M. comosum and M. neglectum (as M.
racemosum). After the three years, Muscari botryoides was
still infected while M. comosum and M. neglectum remained
healthy. Consequently, the anther smut on Muscari botryoides
was described as a distinct biological species. In the study
of Bauer et al. (2008), anther smut collections on Muscari
botryoides were not available and the Antherospora vaillantii
species complex on Muscari, including the identity of Ustilago
muscari-botryoidis, remained unresolved. Misidentification of
some hosts may have added further confusion.
The present study is aimed at resolving the Antherospora
vaillantii species complex on Muscari, and testing whether
molecular phylogenetic lineages could be defined by
morphological and/or ecological characteristics. To achieve
this goal molecular phylogenetic analyses using rDNA
sequences were applied as well as light and scanning electron
microscope examination of different anther smut specimens,
including collections from type hosts of all species known to
infect Muscari.
MATERIALS AND METHODS
Specimen sampling and documentation
This study is based on specimens of the Antherospora vaillantii
complex from four different Muscari species, originating from
Germany, Israel, Slovenia, and the United Kingdom. The
voucher specimens are deposited in GLM, KR, KRAM F,
TUB, HAI and H.U.V. (Table 1). The latter abbreviation refers
to the personal collection of Kálmán Vánky, “Herbarium
Ustilaginales Vánky” currently held at his home (Gabriel-
Biel- Strasse 5, D-72076 Tübingen, Germany). The following
host plants previously misidentified (Bauer et al. 2008) were
re-identified during the present study using Flora Europaea
(Tutin et al. 1980): (1) the specimen from Slovenia (H.U.V.
21337) identified as M. neglectum is M. botryoides; (2)
the specimen from Germany (TUB 15838) identified as M.
comosum is M. armeniacum; (3) the specimen from Germany
(H.U.V. 21046) identified as M. neglectum is M. armeniacum.
Nomenclatural novelties were registered in MycoBank (www.
MycoBank.org, Crous et al. 2004). The genetype concept
follows the proposal of Chakrabarty (2010).
Morphological examination
Dried fungal teliospores of the investigated specimens were
mounted in lactic acid, heated to boiling point, and then
examined under a Nikon Eclipse 80i light microscope at a
magnification of ×1000, using Nomarski optics (DIC). Spores
were measured using NIS-Elements BR 3.0 imaging software.
The extreme measurements were adjusted to the nearest 0.5
µm. The spore size range, mean and standard deviation of 50
spore measurements from each specimen are shown in Table
1. The spore size values are presented in a scatter diagram to
show the distribution of the values. The species descriptions
include combined values from all measured specimens. The
specimens of the Antherospora vaillantii complex measured
in previous work in lactophenol (Bauer et al. 2008) were
measured again in lactic acid to minimize the error caused
by different mounting media. LM micrographs were taken
with a Nikon DS-Fi1 camera. The spores of Antherospora on
Muscari armeniacum (KRAM F-49437), on M. botryoides (KR
27962), on M. comosum (KRAM F-49438 = HAI 2857), and
on M. tenuiflorum (GLM 48095) were studied using scanning
electron microscopy (SEM). For this purpose, dry spores were
mounted on carbon tabs and fixed to an aluminium stub with
double-sided transparent tape. The tabs were sputter-coated
with carbon using a Cressington sputter-coater and viewed with
a Hitachi S-4700 scanning electron microscope, with a working
distance of ca. 12 mm. SEM micrographs were taken in the
Laboratory of Field Emission Scanning Electron Microscopy
and Microanalysis at the Institute of Geological Sciences,
Jagiellonian University, Kraków (Poland).
DNA extraction, PCR, and sequencing
For methods of isolation and crushing of fungal material,
DNA extraction, amplification of ITS 1 and ITS 2 regions of
the rDNA including the 5.8S rDNA (ITS) and the 5´-end of
the nuclear large subunit ribosomal DNA (LSU), purification
of PCR products, sequencing, and processing of the raw
data see Lutz et al. (2004), and Piątek et al. (2011). The
DNA sequences determined for this study were deposited in
GenBank (GenBank accession number are given in Table 1
and Fig. 1).
Phylogenetic analyses
In addition to the ITS and LSU sequences of Antherospora
sp. on Muscari spp. obtained in this study, sequences from
GenBank of the following species were used for molecular
6 ima fUNGUS

Antherospora on Muscari
phylogenetic analyses (Bauer et al. 2008, Piątek et al. 2011):
Antherospora scillae, A. tractemae, A. vaillantii, and A.
vindobonensis (GenBank accession numbers are included in
Fig. 1).
To elucidate the phylogenetic position of the Antherospora
specimens from Muscari spp. their concatenated ITS+LSU
sequences were analysed within a dataset covering all
Antherospora species available in GenBank. If present in
Table 1. List of Antherospora specimens examined, with host plants, GenBank accession numbers, spore size range, mean spore sizes with
standard deviation, and reference specimens.
ARTICLE
Species Host GenBank acc.
no.
A. hortensis M. armeniacum ITS: EF653982
LSU: EF653964
Spore size range
(µm)
(6.0–)7.0–10.0(–13.0)
× (5.5–)6.0–8.0
Mean spore size
with standard
deviation (µm)
8.6 ± 1.7 × 6.8 ±
0.7
Reference specimens 1
Germany, Baden-Württemberg,
Tübingen, Gabriel-Biel-Strasse 5,
17 Apr. 2005, C. & K. Vánky, H.U.V.
21046
A. hortensis M. armeniacum ITS: KC175333
LSU: KC175326
A. hortensis M. armeniacum ITS: EF653997
LSU: EF653979
A. hortensis M. armeniacum ITS: KC175334
LSU: KC175327
A. hortensis M. armeniacum ITS: KC175335
LSU: KC175328
A. hortensis M. armeniacum ITS: KC175336
LSU: KC175329
A. hortensis M. armeniacum ITS: KC175337
LSU: KC175330
A. muscari-botryoidis M. botryoides ITS: KC175332
LSU: KC175325
A. muscari-botryoidis M. botryoides ITS: EF653998
LSU: EF653980
A. vaillantii M. comosum ITS: KC175338
LSU: KC175331
A. vaillantii M. tenuiflorum ITS: EF653986
LSU: EF653968
A. vaillantii M. tenuiflorum ITS: EF653987
LSU: EF653969
A. vaillantii M. tenuiflorum ITS: EF653988
LSU: EF653970
(6.0–)7.5–10.5(–12.5)
× (5.5–)6.0–8.5(–9.0)
(5.5–)6.0–10.5(–12.5)
× 5.5–7.5(–8.0)
(6.5–)7.0–10.5(–12.5)
× 6.0–8.5(–9.5)
(5.5–)6.0–10.5(–11.0)
× 5.0–7.5(–8.5)
6.0–10.0(–11.0) ×
(5.5–)6.0–8.5
6.0–10.5(–12.5) ×
5.5–8.5(–9.0)
(5.0–)6.0–9.5(–11.0) ×
(4.5–)5.0–7.5(–8.0)
(6.5–)7.0–10.5(–11.0)
× (5.5–)6.0–8.5(–9.0)
(5.5–)6.0–10.5 ×
5.0–7.5(–8.0)
(5.5–)6.0–10.5(–13.0)
× 5.0–7.5(–9.0)
6.0–10.0(–11.0) ×
5.0–7.5(–8.0)
6.0–10.5(–12.0) ×
6.0–8.5
8.9 ± 1.2 × 7.5 ±
0.7
7.8 ± 1.5 × 6.5 ±
0.7
9.0 ± 1.4 × 7.6 ±
0.8
7.9 ± 1.4 × 6.7 ±
0.7
8.1 ± 1.2 × 7.1 ±
0.7
8.1 ± 1.7 × 6.9 ±
0.9
7.7 ± 1.4 × 6.3 ±
0.8
8.5 ± 1.1 × 7.2 ±
0.8
7.9 ± 1.4 × 6.3 ±
0.8
8.3 ± 1.6 × 6.9 ±
0.8
7.9 ± 1.2 × 6.5 ±
0.6
8.3 ± 1.4 × 7.0 ±
0.6
Germany, Baden-Württemberg,
Tübingen, garden, Stöcklestrasse
39, 22 Apr. 2011, M. Lutz, KR 27970
Germany, Baden-Württemberg,
Kirchheim/Teck, garden
Römersteinstrasse 12, 2 May 2006,
N. Böhling, TUB 15838
UK, Wales, Ceredigion, Aberystwyth,
Penglais Road, SN-590-818 [grid
reference on UK national grid], 7
Apr. 2009, A.O. Chater, KRAM
F-49434
UK, Wales, Ceredigion, Aberystwyth,
Plas Crug cemetery, SN-591-812
[grid reference on UK national grid],
16 Apr. 2010, A.O. Chater, KRAM
F-49435
UK, Wales, Ceredigion, Aberystwyth,
Cliff Terrace, garden of Northfield,
SN-585-826 [grid reference on UK
national grid], 15 Apr. 2010, A.O.
Chater, KRAM F-49436
UK, Wales, Ceredigion, Llanbadarn
Fawr, University campus, SN-604-
811 [grid reference on UK national
grid], 20 Apr. 2010, A.O. Chater,
KRAM F-49437 – holotype
Germany, Baden-Württemberg,
Hechingen, B32 in Richtung
Burladingen, 22 Apr. 2011, M. Lutz,
KR 27962 – neotype
Slovenia, Kras, 7 km ESE from
Sezana, 30 Apr. 2006, C. & K.
Vánky, H.U.V. 21337
Israel, Haifa district, Carmel National
Park, 2 Feb. 2011, K.G. Savchenko,
HAI 2857, KRAM F-49438
Germany, Sachsen-Anhalt,
Saalkreis, Löbejün, Schiedsberg, 25
May 2000, H. Jage, GLM 47396
Germany, Sachsen-Anhalt,
Saalkreis, Löbejün, Schiedsberg, 29
May 1999, U. Richter, GLM 48095
Germany, Sachsen-Anhalt,
Saalkreis, Löbejün, Schiedsberg, 24
May 1999, W. Durka, GLM 50411
1
GLM – Herbarium of the Senckenberg Museum für Naturkunde Görlitz, Germany; HAI – Herbarium of the Institute of Evolution, University
of Haifa, Israel; H.U.V. – Herbarium Ustilaginales Vánky, Gabriel-Biel-Str. 5, D-72076 Tübingen, Germany; KR – Herbarium of the Staatliches
Museum für Naturkunde Karlsruhe, Germany; KRAM F – Mycological Herbarium of the W. Szafer Institute of Botany, Polish Academy of
Sciences, Kraków, Poland; TUB – Herbarium of the Eberhard-Karls-Universität Tübingen, Germany.
volume 4 · no. 1
7

Piątek, Lutz & Chater
ARTICLE
100/70
9 1/-
A. on M. botryoides KC175332/KC175325
A. muscari-botryoidis
A. on M. botryoides EF653998/EF653980
A. on M. armeniacum EF653982/EF653964
A. on M. armeniacum KC175333/KC175326
A. on M. armeniacum EF653997/EF653979
8 7/63
100/66
A. on M. armeniacum KC175334/KC175327
A. on M. armeniacum KC175337/KC175330
A. on M. armeniacum KC175335/KC175328
A. hortensis
A. on M. armeniacum KC175336/KC175329
A. on M. comosum KC175338/KC175331
100/92
A. on M. tenuiflorum EF653987/EF653969
A. on M. tenuiflorum EF653986/EF653968
A. vaillantii
A. on M. tenuiflorum EF653988/EF653970
9 8/72
100/100
A. scillae EF653992/EF653974
A. scillae EF653983/EF653965
A. vindobonensis EF653989/EF653971
100/87
A. vindobonensis EF653995/EF653977
9 9/99
A. tractemae JN104589/JN104590
A. tractemae JN204283/JN204279
0.0030
Fig. 1. Hypothesis on phylogenetic relationships within the sampled Antherospora specimens based on Maximum Likelihood analysis of an
alignment of concatenated ITS+LSU base sequences using raxmlGUI invoking the GTRCAT and the rapid bootstrap option with 1000 replicates.
The topology was rooted with Antherospora scillae, A. tractemae, and A. vindobonensis. ML bootstrap support values are indicated on branches
before slashes, estimates for a posteriori probabilities are indicated after slashes. A. = Antherospora, M. = Muscari.
GenBank, the sequences of the respective type specimens
were used.
Sequence alignment was obtained using MAFFT 6.853
(Katoh et al. 2002, 2005, Katoh & Toh 2008) using the
L-INS-i option. The resulting alignment was used for both
the detection of species specific autapomorphic nucleotide
differences and the estimation of genetic distances within
species (intraspecific) and between species (interspecific)
using the software MEGA (Tamura et al. 2011). We calculated
p-distances and report distances as percentage genetic
distances. Gaps or different length of sequences were not
used for calculations as we chose the pair-wise deletion
option in MEGA.
To ensure reproducible phylogenetic analyses,
manipulation of the alignment by hand as well as manual
exclusion of ambiguous sites were avoided as suggested
by Giribet & Wheeler (1999) and Gatesy et al. (1993),
respectively. Highly divergent portions of the alignment
were omitted using GBlocks 0.91b (Castresana 2000) with
the following options: ‘Minimum Number of Sequences for a
Conserved Position’ to 10, ‘Minimum Number of Sequences
for a Flank Position’ to 10, ‘Maximum Number of Contiguous
Non-conserved Positions’ to 8, ‘Minimum Length of a Block’
to 5 and ‘Allowed Gap Positions’ to ‘With half’.
The resulting alignment [new number of positions: 1336
(73% of the original 1810 positions) number of variable sites:
35] was used for phylogenetic analyses using Maximum
Likelihood (ML) and a Bayesian Approach (BA). ML analysis
(Felsenstein 1981) was conducted with the RAxML 7.2.6
software (Stamatakis 2006), using raxmlGUI (Silvestro &
Michalak 2012), invoking the GTRCAT and the rapid bootstrap
option (Stamatakis et al. 2008) with 1000 replicates.
For BA a Bayesian approach to phylogenetic inference
using a Markov chain Monte Carlo technique was used
as implemented in the computer program MrBayes 3.2.1
(Ronquist et al. 2012). Two runs over 5 000 000 generations,
each consisting of four chains, were implemented using
the general time reversible model of DNA substitution with
8 ima fUNGUS

Antherospora on Muscari
gamma distributed substitution rates and estimation of
invariant sites, random starting trees and default starting
parameters of the DNA substitution model as recommended
by Huelsenbeck & Rannala (2004). Trees were sampled
every 100th generation, resulting in a sampling of 50 001
trees for each run. From these, the first 25 % of trees from
each run were discarded (burnin). The remaining trees were
used to compute a 50% majority rule consensus tree to
obtain estimates for the a posteriori probabilities of groups
of species. This Bayesian approach to phylogenetic analysis
was repeated five times to test the independence of the
results from topological priors (Huelsenbeck et al. 2002).
Trees were rooted with Antherospora scillae, A. tractemae,
and A. vindobonensis.
RESULTS
The mean spore length was variable between collections of
Antherospora on Muscari armeniacum, ranging from 7.8–9.0
µm, less variable in specimens on M. botryoides (7.7–8.5
µm), and quite uniform in specimens on M. comosum and
M. tenuiflorum (7.9–8.3 µm). Likewise, the mean spore width
was variable between collections of Antherospora on Muscari
armeniacum, ranging from 6.5–7.6 µm, and less variable in
specimens on M. botryoides (6.3–7.2 µm), and in specimens
on M. comosum and M. tenuiflorum (6.3–7.0 µm) (Table 1).
The combined mean spore length and width were similar in
Antherospora on Muscari botryoides and Antherospora on M.
comosum+M. tenuiflorum, while both values were somewhat
larger in Antherospora on M. armeniacum. The detailed
morphological characteristics of the anther smuts on Muscari
spp. are included in the species descriptions and depicted in
Figs 3–5.
ARTICLE
Phylogenetic analyses
Species specific autapomorphic nucleotide differences
are included in the species descriptions, intraspecific and
interspecific genetic distances of the ITS+LSU rDNA are
given in Table 2.
The different runs of BA that were performed and the
ML analyses yielded consistent topologies. To illustrate the
results, the phylogenetic hypothesis resulting from the ML
analysis is presented in Fig. 1. ML bootstrap support values
are indicated on branches before slashes, estimates for a
posteriori probabilities are indicated after slashes.
In all analyses, the Antherospora species included in
previous studies (Bauer et al. 2008, Piątek et al. 2011)
were inferred with high support values, and phylogenetic
relationships were as in Bauer et al. (2008), Piątek et al.
(2011), and Vánky et al. (2008). All Antherospora specimens
from Muscari spp. clustered together forming three well
supported subgroups: one contained all sampled specimens
from M. botryoides, another all specimens from M.
armeniacum, and the third specimens from both M. comosum
and M. tenuiflorum. The former two subgroups were revealed
as sister taxa.
Morphology
The morphology of the Antherospora specimens is presented
in accordance with the lineages obtained in the phylogenetic
analyses, namely Antherospora on Muscari armeniacum,
on M. botryoides and on M. comosum+M. tenuiflorum. The
specimens of Antherospora on Muscari spp. shared a similar
appearance of macroscopic symptoms of the infection as
well as a similar morphology of spores. In all specimens,
the olivaceous sori formed in all anthers of fertile flowers,
and the sori were enclosed by floral perianths. The spore
ornamentation and shape were regular in all collections:
the spores were finely verrucose or verruculose and usually
globose, subglobose, broadly ellipsoidal, or occasionally
allantoid, ovoid, pyriform, or tear-shaped. The spore sizes
of Antherospora specimens on Muscari armeniacum, M.
comosum and M. tenuiflorum were similar and grouped in
one “cloud” on the scatter diagram, while the spore sizes of
specimens on Muscari botryoides were shorter compared
to the specimens from the remaining hosts (Table 1, Fig. 2).
TAXONOMY
Antherospora hortensis M. Piątek & M. Lutz, sp. nov.
MycoBank MB803427
(Fig. 3)
Etymology: In reference to the occurrence of this fungus
on Muscari armeniacum in cultivated gardens, where all
specimens examined in this study were collected.
Type: UK: Wales: Ceredigion, Llanbadarn Fawr, University
campus, on Muscari armeniacum, 20 Apr. 2010, A.O. Chater
(KRAM F-49437 – holotype)
Description: Parasitic on Muscari armeniacum. Sori in the
anthers, producing a dark olive-brown, powdery mass of
spores inside the pollen sacs, enclosed by the perianths.
Infection systemic, all anthers in all fertile flowers in an
inflorescence are infected. Spores globose, subglobose,
broadly ellipsoidal, sometimes allantoid, tear-shaped or
asymmetrical, (5.5–)6.0–10.5(–13.0) × 5.0–8.5(–9.5) µm
[av. ± SD, 8.3 ± 1.5 × 7.0 ± 0.9 µm, n = 350/7], olive-brown,
sometimes lighter coloured on one side; wall even, ca. 0.5-
0.7 µm thick, finely, densely verruculose in LM, spore profile
almost smooth or finely wavy, wall finely verrucose in SEM.
Autapomorphic nucleotide differences in the ITS at the
positions 192, 193, and 437 and in the LSU at the position
1311 in the alignment.
The ITS/LSU hologenetype sequences are deposited in
GenBank as KC175337/KC175330, respectively.
Additional specimens examined: Germany: Baden-Württemberg:
Tübingen, Gabriel-Biel-Strasse 5, on Muscari armeniacum (as M.
neglectum), 17 Apr. 2005, C. & K. Vánky (H.U.V. 21046); Tübingen,
Stöcklestrasse 39, on M. armeniacum, 22 Apr. 2011, M. Lutz 2338
(KR 27970); Kirchheim/Teck, garden of Römersteinstrasse 12, on
M. armeniacum (as M. comosum), 2 May 2006, N. Böhling (TUB
15838). – UK: Wales: Ceredigion, Aberystwyth, Penglais Road,
on M. armeniacum, 7 Apr. 2009, A.O. Chater (KRAM F-49434);
Ceredigion, Aberystwyth, Plas Crug cemetery, on M. armeniacum, 16
Apr. 2010, A.O. Chater (KRAM F-49435); Ceredigion, Aberystwyth,
volume 4 · no. 1
9

Piątek, Lutz & Chater
Table 2. Intraspecific and interspecific genetic distances of the ITS+LSU rDNA in %.
ARTICLE
A. hortensis A. muscari-botryoidis A. vaillantii A. vindobonensis A. tractemae A. scillae
A. hortensis 0 0.4-0.5 0.9 1.9 1 1.9
A. muscari-botryoidis 0.1 0.7 1.8-1.9 1.1-1.2 1.8-1.9
A. vaillantii 0 1.8 1.1 1.8
A. vindobonensis 0 1.7 0.3
A. tractemae 0 1.6
A. scillae 0
10
9
8
7
6
5
4
3
2
1
0
0 2 4 6 8 10 12 14
Fig. 2. A scatter diagram showing the spore size distribution in Antherospora hortensis (blue squares), A. muscari-botryoidis (black spots), and
A. vaillantii (yellow triangles). Note that one point may include measurements of the respective length/width value from more than one spore.
Cliff Terrace, garden of Northfield, on M. armeniacum, 15 Apr. 2010,
A.O. Chater (KRAM F-49436).
Host and distribution: On Muscari armeniacum (Muscari
subgen. Botryanthus, Asparagaceae), Germany, UK. –
Antherospora vaillantii s. lato on M. armeniacum was
included in Vánky (2012), but no specific details are given
for the source of this record. The anther smut on Muscari
schliemannii (syn. M. armeniacum) from the Berlin Botanical
Garden (Magnus 1896, Scholz & Scholz 1988) and on M.
cyaneoviolaceum (syn. M. armeniacum) from the Royal
Botanic Gardens Kew (Kirk & Cooper 2013) most probably
belongs to this species.
Comments: This species is morphologically similar to
Antherospora vaillantii s. str., differing by a somewhat larger
(longer and wider) average size of spores and host plant
in Muscari subgen. Botryanthus. Antherospora hortensis
and A. vaillantii ITS+LSU sequences differ in 32–35
positions in 16 loci. Among the sequence differences there
10 ima fUNGUS

Antherospora on Muscari
ARTICLE
Fig. 3. Antherospora hortensis sp. nov. on Muscari armeniacum. A. General habit of infected plant. B–C. Healthy (to the left) and infected (to
the right) inflorescences, with fungus sporulating in the anthers. D. Close-up of the anthers with fungal spores. Note that ovary is not destroyed.
E–I. Spores seen by LM, median and superficial views (KRAM F-49437). J–L. Ornamentation of spores seen by SEM (KRAM F-49437). Bars:
A–C = 5 mm, D = 1 mm, E–I = 10 µm, J–L = 5 µm.
volume 4 · no. 1
11

Piątek, Lutz & Chater
ARTICLE
are autapomorphic nucleotide differences in the ITS at the
positions 192, 193, and 437 and in the LSU at the position
1311 in the alignment for Antherospora hortensis.
Antherospora muscari-botryoidis (Cif.) M. Piątek &
M. Lutz, comb. nov.
MycoBank MB803428
(Fig. 4)
Fig. 4. Antherospora muscari-botryoidis comb. nov. on Muscari botryoides. A. General habit of infected plant. B–C. Infected inflorescences, with
fungus sporulating in the anthers. D–G. Spores seen by LM, median and superficial views (KR 27962). H–J. Ornamentation of spores seen by
SEM (KR 27962). Bars: B–C = 5 mm, D–H = 10 µm, I–J = 5 µm.
12 ima fUNGUS

Antherospora on Muscari
Basionym: Ustilago muscari-botryoidis Cif., Ann. Mycol. 26:
14 (1928).
Type: Italy: Province of Cuneo: Alba, Moretta, towards
Santa Rosalia, on Muscari botryoides, [year and collector
unclear but probably 1921 and R. Ciferri, respectively] (type
not located, probably does not exist). – Germany: Baden-
Württemberg: Hechingen, B32 in Richtung Burladingen,
48º20’55”N, 09º00’12”E, on Muscari botryoides, 22 Apr. 2011,
M. Lutz (KR 27962 – neotype designated here).
Synonym: Antherospora neglecta Vánky, in Lutz & Vánky,
Lidia 7(2–3): 35 (2009), nom. nud.
Original material: Slovenia: Kras, 7 km ESE from Sezana, on
Muscari botryoides (as M. neglectum), 30 Apr. 2006, C. & K.
Vánky (H.U.V. 21337).
Parasitic on Muscari botryoides. Sori in the anthers, producing
a dark olive-brown, powdery mass of spores inside the pollen
sacs, enclosed by the perianths. Infection systemic, all
anthers in all fertile flowers in an inflorescence are infected.
Spores globose, subglobose, broadly ellipsoidal, sometimes
tear-shaped or asymmetrical, (5.0–)6.0–10.5(–11.0) × (4.5–)
5.0–8.5(–9.0) µm [av. ± SD, 8.1 ± 1.3 × 6.7 ± 0.9 µm, n =
100/2], olive-brown; wall even, ca. 0.5–0.8 µm thick, finely,
densely verruculose in LM, spore profile almost smooth or
finely wavy, wall finely verrucose in SEM. Autapomorphic
nucleotide difference in the LSU at the position 1078 in the
alignment.
The ITS/LSU neogenetype sequences are deposited in
GenBank as KC175332/KC175325, respectively.
Host and distribution: On Muscari botryoides (Muscari
subgen. Botryanthus, Asparagaceae), Germany, Italy, and
Slovenia. This species was described from Italy (Ciferri
1928), and the sequenced specimens are from Germany and
Slovenia. The different anther smut records and collections
on Muscari botryoides from Europe (Bulgaria, Germany, UK)
(Scholz & Scholz 1988, Denchev 2001, Kirk & Cooper 2013)
and Australasia (New Zealand) (Vánky & McKenzie 2002)
probably belong to this species. It was introduced to areas
outside the natural range of Muscari botryoides, for example
to UK and New Zealand.
ITS+LSU sequences differ in 22–26 positions in 11–12 loci.
Among the sequence differences there is an autapomorphic
nucleotide difference in the LSU at the position 1078 in the
alignment for Antherospora muscari-botryoidis.
The name “Antherospora neglecta Vánky, in prep.” was
assigned by Vánky to the Slovenian specimen in the checklist
of smut fungi from Slovenia (Lutz & Vánky 2009). This name
is a nomen nudum as it was never validated. The host plant
was originally identified as Muscari neglectum. However, its
re-identification revealed that it is Muscari botryoides (flowers
±globose, not elongated). Consequently, Antherospora
neglecta is listed as a synonym of A. muscari-botryoidis.
Antherospora vaillantii (Tul. & C. Tul.) R. Bauer et
al., Mycol. Res. 112: 1304 (2008).
(Fig. 5)
Basionym: Ustilago vaillantii Tul. & C. Tul., Ann. Sci. Nat.,
Bot., sér. 3, 7: 90 (1847).
Synonyms: Yenia vaillantii (Tul. & C. Tul.) Liou, Contrib. Inst.
Bot. Natl. Acad. Peiping 6: 45 (1949).
Vankya vaillantii (Tul. & C. Tul.) Ershad, Rostaniha 1: 69
(2000).
Type: France: on Muscari comosum, S. Vaillant (lectotype
designated by Lindeberg 1959: 141, but apparently without
seeing the herbarium specimen; despite the statement of
Vánky 2012: 8, who indicated that he studied the lectotype
from PC, such a specimen was not located in PC in the
course of the present study).
Parasitic on Muscari comosum and M. tenuiflorum. Sori in
the anthers, producing a dark olive-brown, semi-powdery to
powdery mass of spores inside the pollen sacs, enclosed
by the perianths. Infection systemic, all anthers in all fertile
flowers in an inflorescence are infected, flowers sometimes
deformed. Spores globose, subglobose, broadly ellipsoid,
sometimes ovoid, pyriform or asymmetrical, (5.5–)6.0–10.5(–
13.0) × 5.0–8.5(–9.0) µm [av. ± SD, 8.1 ± 1.4 × 6.7 ± 0.8 µm,
n = 200/4], olive-brown, sometimes lighter coloured on one
side; wall even, ca. 0.5-0.7 µm thick, often darker than the
rest of the spore, finely, densely verruculose in LM, spore
profile almost smooth or finely wavy, wall finely verrucose
in SEM. Autapomorphic nucleotide differences in the ITS at
the positions 95, 443-452, and 575 and in the LSU at the
positions 1292, and 1309 in the alignment.
ARTICLE
Comments: This species shares with Antherospora hortensis
the systematic position of its host plant in Muscari subgen.
Botryanthus, but differs by somewhat shorter spores and a
different host species (M. botryoides vs. M. armeniacum).
Antherospora muscari-botryoidis and A. hortensis ITS+LSU
sequences differ in 11–12 positions in 8 loci. Among the
sequence differences there is an autapomorphic nucleotide
difference in the LSU at the position 1078 in the alignment for
Antherospora muscari-botryoidis.
This species differs from Antherospora vaillantii s. str.
by somewhat shorter spores and its host plant in Muscari
subgen. Botryanthus. The host plants of Antherospora
vaillantii s. str. belong to Muscari subgen. Leopoldia.
Antherospora muscari-botryoidis and A. vaillantii s. str.
Specimens examined: Germany: Sachsen-Anhalt: Saalkreis,
Löbejün, Schiedsberg, on Muscari tenuiflorum, 25 May 2000,
H. Jage (GLM 47396); Saalkreis, Löbejün, Schiedsberg, on M.
tenuiflorum, 29 May 1999, U. Richter (GLM 48095); Saalkreis,
Löbejün, Schiedsberg, on M. tenuiflorum, 24 May 1999, W. Durka
(GLM 50411). – Israel: Haifa district: Carmel National Park, on M.
comosum, 2 Feb. 2011, K.G. Savchenko (HAI 2857, KRAM F-49438
– representative specimens).
Hosts and distribution: On Muscari comosum and M.
tenuiflorum (Muscari subgen. Leopoldia, Asparagaceae),
France, Germany, and Israel. – The type material was
collected in France (Tulasne & Tulasne 1847), and the
sequenced specimens are from Israel (Savchenko et al.
volume 4 · no. 1
13

Piątek, Lutz & Chater
ARTICLE
Fig. 5. Antherospora vaillantii s. str. on Muscari comosum and M. tenuiflorum. A–B. Spores seen by LM, median and superficial views (from M.
comosum, KRAM F-49438). C–F. Spores seen by LM, median and superficial views (from M. tenuiflorum, GLM 48095). G–J. Ornamentation of
spores seen by SEM (G – from M. tenuiflorum, GLM 48095, H–J – from M. comosum, KRAM F-49438). Bars: A–F = 10 µm, G–J = 5 µm.
2011) and Germany (Jage & Richter 2011). Most likely the
numerous Antherospora reports on Muscari comosum and
M. tenuiflorum belong to Antherospora vaillantii s. str. The
anther smut reports on Muscari comosum are from Europe
(Austria, Belgium, Bosnia and Herzegovina, Bulgaria,
Croatia, “Czechoslovakia”, France, Germany, Hungary,
Italy, Poland, Romania, Russia – European part, Serbia,
Slovenia, Switzerland, Ukraine) (e.g. Lindtner 1950, Zundel
1953, Kochman & Majewski 1973, Vánky 1985, Săvulescu
1955, Scholz & Scholz 1988, Karatygin & Azbukina 1989,
Denchev 2001, Zwetko & Blanz 2004, Savchenko &
Heluta 2012), from Africa (Algeria, Egypt, and Morocco)
14 ima fUNGUS

Antherospora on Muscari
(Zundel 1953, Zambettakis 1970), and from North America
(USA – Massachusetts) (Zundel 1953). The anther smut
reports on Muscari tenuiflorum are from Europe (Austria,
Bulgaria, “Czechoslovakia”, Germany, Poland, Romania,
Serbia, Montenegro, and Ukraine) (Lindtner 1950, Zundel
1953, Săvulescu 1955, Kochman & Majewski 1973, Vánky
1985, Scholz & Scholz 1988, Karatygin & Azbukina 1989,
Denchev 2001, Zwetko & Blanz 2004). The records from
outside the natural range of the two Muscari species, for
example in the USA, Belgium (M. comosum) or Poland (M.
tenuiflorum), are the result of the introduction of host plant
and fungus.
Comments: The type material of Ustilago vaillantii could not
be located, and the typification of this smut species needs
some clarification. In the protologue, Tulasne & Tulasne
(1847) included three host species in the following order:
Muscari comosum, Scilla anthericoides, and Scilla maritima,
but from the text it is apparent that they directly studied only
three smut specimens on Muscari comosum collected by
Vaillant, Delastre and Léveillé, respectively. The type host
was assigned to Muscari comosum by Liro (1924), and
accepted as such by Ciferri (1928). Furthermore, Liro (1924)
studied the Delastre specimen included in the protologue,
which was then deposited in the Persoon Herbarium in
Leiden (L), and confirmed that the host plant was indeed
Muscari comosum. That specimen should be treated as a
syntype, and cannot be considered as lectotype since it
was not indicated with the term “type” or an equivalent by
Liro (1924), thus not meeting the criteria of Article 7.10 of
the ICN. Liro (1924) only selected the type host of Ustilago
vaillantii from the three hosts mentioned by the Tulasne
brothers. Lindeberg (1959) designated Vaillant’s collection
as a lectotype of Ustilago vaillantii, but apparently she did
not see this material – the problem is that the specimen
probably does not now exist.
Vánky (2012) indicated that he studied the lectotype
specimen from PC (he included the symbol “!” at the
typification entry of Antherospora vaillantii) selected by
Lindeberg (1959). However, the examination of all materials
from PC labelled as Ustilago vaillantii made in the course
of the present study revealed no authentic specimen of this
smut fungus matching the data from the protologue (Tulasne
& Tulasne 1847). Likewise, the Delastre syntype specimen
mentioned in the protologue and later studied by Liro (1924)
was not found in the Persoon herbarium in L (G. Thijsse, pers.
comm.). It is reasonable to assume that no authentic collection
of Ustilago vaillantii is currently preserved and that a neotype
should be selected for this species. However, the neotype of
Antherospora vaillantii based on the Israeli specimen analysed
in the present study is not designated here, as in our opinion it
is better to select the neotype from a fresh European collection,
which is not available at present (most herbarium collections
are old and not useful for molecular analyses). Thus, in line
with Hawksworth (2012), the Israeli collection of Antherospora
vaillantii s. str. on the type host Muscari comosum is referred
to as a “representative specimen”.
DISCUSSION
In this study, morphological and molecular phylogenetic
analyses were performed in order to resolve the Antherospora
vaillantii species complex on different Muscari species. The
specimen sampling covers four of the six Muscari species
reported as hosts for Antherospora vaillantii s. lato in the
recent world monograph of smut fungi (Vánky 2012 1 ),
including the type hosts for both species that were described
for Muscari anther smuts, namely Ustilago vaillantii (M.
comosum) and U. muscari-botryoidis (M. botryoides).
In accordance with previous molecular phylogenetic
analyses based on a smaller sampling of Muscari anther
smuts (Bauer et al. 2008, Piątek et al. 2011), the present
analyses revealed that all anther smut specimens on Muscari
spp. form a monophyletic group within the Antherospora
clade. The phylogenetic relations within this lineage agree
well with the classification of the respective host species: the
basal group contains anther smuts on two hosts belonging to
Muscari subgen. Leopoldia (M. comosum, M. tenuiflorum),
while the derived group includes anther smuts on hosts
belonging to Muscari subgen. Botryanthus that is further
subdivided into two lineages correlated with the host plant
species M. armeniacum and M. botryoides, respectively. That
indicates a common ancestry of the Muscari anther smuts
and co-evolution as a driver of their diversification. Results
showing similar patterns in anther smuts on Scilla (Bauer
et al. 2008) and Tractema (Piątek et al. 2011) support this
hypothesis. However, confirmation of the monophyletic origin
of the Muscari anther smuts with a larger sampling of anther
smut specimens on diverse host plants, especially on the
related genus Bellevalia, is desirable.
The genetic divergence between three lineages of Muscari
anther smuts obtained does not correspond to differences
in phenotypic characteristics. The morphology of all anther
smut specimens was quite similar and, without support of
non-morphological data, the small differences in spore size
or average spore sizes observed between them could easily
be treated as phenotypic variability of one single species. In
contrast to the study of Bauer et al. (2008), where the spore
size of one collection on Muscari tenuiflorum (GLM 47396)
had much larger spores and deviated from the remaining
specimens on this host, the repeated measurement of the
same specimen in this study did not confirm such deviation.
They were similar to values obtained from the remaining
specimens on Muscari tenuiflorum. The different mounting
media (lactophenol used by Bauer et al. 2008 vs. lactic
acid used in this study) cannot explain this discrepancy
because the repeated measurements of the remaining
specimens used in the previous study did not reveal such
differences. This discordance may have resulted from
measuring spores from different sori. The examples from
other studies indicate that in some smut samples, the spores
measured from different sori within a collection may have a
different size or morphology, for example in Anthracoidea
1
M. alpinum and M. schliemannii listed in this monograph are
ARTICLE
excluded here as both are synonyms of other species (Euro+Med
2006-)
volume 4 · no. 1
15

Piątek, Lutz & Chater
ARTICLE
hostianae (Piątek & Mułenko 2010) or Farysia ugandana
(Vánky 2004a). Such anomalies between collections are
also known in other groups of basidiomycetes, for example
in polypores (Niemelä et al. 2001), and in ascomycetes, for
example in Calonectria (Crous et al. 2006). The large spore
size values of anther smut on Muscari tenuiflorum are not
included in this study. Using this example, Vánky (2008)
introduced the term pseudomorphospecies for smuts with
morphological differences showing no genetic differences.
This concept, however, does not take into account variation
of morphological characters within specimens of the same
species, as well as possible anomalies in spore morphology
such as discussed above.
Molecular phylogenetic analyses revealed all anther smut
specimens on Muscari botryoides, on M. armeniacum, and
on M. comosum and M. tenuiflorum, respectively, to be in
strongly supported monophyletic groups forming independent
lineages. Furthermore, each lineage had autapomorphic
nucleotide differences in the ITS and/or the LSU in the
alignment. In addition, pairwise genetic distances between
the lineages were found sufficient to support their separation
as distinct species. They ranged from 0.4–0.9 % (within the
lineages pairwise genetic distances ranged from 0–0.1 %).
Thus, in spite of weak morphological differences, the genetic
divergence and strict correlation with host species taxonomy
indicate that the three lineages of the Muscari anther smuts
in fact represent three different cryptic species. The host
plant species appear to be good taxonomic markers for this
group of parasites, as the collections from the same host
(Muscari armeniacum, M. botryoides) or closely related hosts
(M. comosum+M. tenuiflorum) grouped together, irrespective
of their geographic origin. This is in agreement with similar
results obtained for other smut fungi (Hendrichs et al. 2005,
Lutz et al. 2005, 2008, Piątek et al. 2012). Because of some
uncertainties concerning the effective description of species
on the basis of molecular characters (Tripp & Lendemer
2012), the descriptions of the three recognized Antherospora
species on Muscari include, in addition to the host plant
name and morphology, the species specific autapomorphic
nucleotides of the ITS and LSU.
The three lineages of anther smuts on Muscari correspond
to Antherospora vaillantii s. str., Ustilago muscari-botryoidis
and an undescribed species. The basal lineage containing
the collection on Muscari comosum from Israel is assigned
to Antherospora vaillantii s. str. The molecular results indicate
that this species is additionally able to infect the closely related
Muscari tenuiflorum. The clade represented by two specimens
on Muscari botryoides is referred to a second species, for
which the name Ustilago muscari-botryoidis is available
(Ciferri 1928). Because this is a species of Antherospora, a
new combination in this genus is introduced. In contrast to
other monographers who synonymized it with Antherospora
vaillantii (e.g. Vánky 1985, 1994, 2012, Scholz & Scholz 1988,
Karatygin & Azbukina 1989, Denchev 2001), the present study
confirms that Ciferri (1928) was correct in describing Ustilago
muscari-botryoidis. Compared to the remaining anther smuts
on Muscari, Antherospora muscari-botryoidis has somewhat
smaller spores. However, more specimens should be analysed
both morphologically and genetically to confirm this feature as
stable and taxonomically informative for this smut.
The third lineage, containing specimens on Muscari
armeniacum, represents a previously undescribed species.
The discovery of this species is unexpected as all antherinfected
Muscari armeniacum plants were found in gardens
outside the natural range of the host species. This special
habitat occurrence is reflected in the proposed epithet for
this species, Antherospora hortensis. Except for the brief
information in Vánky (2012), Muscari armeniacum was not
reported in any publication as a host for anther smuts, at
least under this species name. However, the old records
of Ustilago vaillantii on Muscari schliemannii from Berlin
Botanical Garden (Magnus 1896), where it was observed
during the years 1892–1897 (Scholz & Scholz 1988), most
probably belong to the same pathogen. Muscari schliemannii
is a synonym of M. armeniacum (Euro+Med 2006-).
Likewise, the 1931 collection of Ustilago vaillantii on Muscari
cyaneoviolaceum from Kew Gardens (Kirk & Cooper 2013)
probably also belongs to Antherospora hortensis. Muscari
cyaneoviolaceum is a synonym of M. armeniacum (Euro+Med
2006-). This indicates that Antherospora hortensis persisted
on cultivated plants in Germany and UK for a long time and
the recent findings in Baden-Württemberg and Wales are
probably only the result of special collecting activity directed
to smut fungi. The concentration of localities around Tübingen
in Germany as well as around Aberystwyth in UK may also
reflect local transmission of infected plants between gardens
by gardeners. The anther smuts on monocots may propagate
by bulbs or even by infected seeds (Massee 1914, Kochman
1936). The current data suggest that the distribution of
Antherospora hortensis is as yet localized. This could be also
supported by the observation that Antherospora hortensis
was not found in Kraków in Poland despite that Muscari
armeniacum is commonly cultivated in gardens and has been
examined by one of us (MP) for anther smuts every year
since 2007. At present Antherospora hortensis does not pose
a significant disease threat, although this may change since
ongoing climate change allows many pathogens to spread to
new geographical areas.
The origin of Antherospora hortensis is unclear. The
native occurrence of Muscari armeniacum is in the Balkan
Peninsula, but no smutted specimens have been reported
from this area. In this region there are reports of anther smuts
on Muscari neglectum (Lindtner 1950, Zundel 1953, Denchev
2001). These two Muscari species were often misidentified,
and according to Tutin et al. (1980), many records of M.
neglectum from the Balkan Peninsula in fact represent M.
armeniacum. The occurrence of anther smuts on Muscari
neglectum should be re-examined, preferably with fresh
collections as drying often affects flower colour, which is a
diagnostic character of M. neglectum.
Besides the host plants included in the current study or
discussed above, two further species have been reported for
Antherospora vaillantii s. lato in the recent world monograph
(Vánky 2012), namely Muscari alpinum and M. moschatum.
The identity of Muscari alpinum is uncertain since there are
two names with the same epithet: M. alpinum J. Gay ex
Baker and M. alpinum Szafer ex Racib., which are synonyms
of M. tenuiflorum and M. botryoides, respectively (Euro+Med
2006-). Although Vánky (2012) attributed this name to “J.
Gay”, in the original report the species name is given without
16 ima fUNGUS

Antherospora on Muscari
any authorities (Bubák 1916). The anther smut on Muscari
moschatum that was reported from Georgia (Karatygin &
Azbukina 1989), is a putative fourth distinct species within
the Antherospora vaillantii complex, a hypothesis based on
the isolated position of the host in Muscari subgen. Muscari.
Fresh materials for molecular and morphological analyses
are desirable to confirm this hypothesis.
In addition to resolving the species within the Antherospora
vaillantii complex on Muscari, this study gives further
evidence that host specificity may reveal cryptic diversity in
some smut fungi, to a greater degree than morphology. Past
assumptions were that host specificity was restricted to the
host family (Fischer & Shaw 1953), subtribe (Vánky 2004b)
or, mostly, genus level (Vánky 1994, 2012). Recent molecular
studies indicate that host specialization is, in most cases, at
the species level (Kemler et al. 2009, Lutz et al. 2008, 2012,
Piątek et al. 2012, 2013, Savchenko et al. 2013). This is not
an absolute rule since some smut species may infect two
or more host species from the same genus (Castlebury &
Carris 1999, Lutz et al. 2005, Curran et al. 2009, Kemler et
al. 2013), or two or more species from different but usually
phylogenetically closely related genera (Carris et al. 2007,
Vánky & Lutz 2007). Thus, the level of host specificity in
different smut species reported from multiple host species
and genera, including the other members of the genus
Antherospora, remains to be tested and is a challenge for
future studies.
ACKNOWLEDGEMENTS
We thank Michael Weiß, Sigisfredo Garnica, and Robert Bauer
(Tübingen, Germany) for providing facilities for molecular analyses,
Kyrylo G. Savchenko (Haifa, Israel) for sending a material, the
Curators of herbaria: Herbert Boyle (GLM), Bart Buyck (PC), Markus
Scholler (KR), and Kálmán Vánky (H.U.V.) for loan of specimens,
and Anna Łatkiewicz (Kraków, Poland) for her help with the SEM
pictures. Gerard Thijsse (Leiden, Netherlands) tried to locate the
Delastre collection of Ustilago vaillantii in the Persoon herbarium (L)
and we greatly appreciate his endeavours.
REFERENCES
APG III (2009) An update of the Angiosperm Phylogeny Group
classification for the orders and families of flowering plants: APG
III. Botanical Journal of the Linnean Society 161: 105–121.
Bauer R, Begerow D, Oberwinkler F, Piepenbring M, Berbee ML
(2001) Ustilaginomycetes. In: The Mycota. Vol. VII, Part B.
Systematics and Evolution (DJ McLaughlin, EG McLaughlin, PA
Lemke, eds): 57–83. Berlin: Springer-Verlag.
Bauer R, Lutz M, Begerow D, Piątek M, Vánky K, Bacigálová
K, Oberwinkler F (2008) Anther smut fungi on monocots.
Mycological Research 112: 1297–1306.
Bauer R, Oberwinkler F, Vánky K (1997) Ultrastructural markers and
systematics in smut fungi and allied taxa. Canadian Journal of
Botany 75: 1237–1314.
Begerow D, Bauer R, Oberwinkler F (1997) Phylogenetic studies on
nuclear LSU rDNA sequences of smut fungi and related taxa.
Canadian Journal of Botany 75: 2045–2056.
Bubák F (1916) Die Pilze Böhmens. II. Teil. Brandpilze (Hemibasidii).
Archiv für die Naturwissenschaftliche Landesdurchforschung
von Böhmen 15(3): 1–81.
Carris LM, Castlebury LA, Huang GM, Alderman SC, Luo JF, Bao XD
(2007) Tilletia vankyi, a new species of reticulate-spored bunt
fungus with non-conjugating basidiospores infecting species of
Festuca and Lolium. Mycological Research 111: 1386–1398.
Castlebury LA, Carris LM (1999) Tilletia walkeri, a new species on
Lolium multiflorum and L. perenne. Mycologia 91: 121–131.
Castresana J (2000) Selection of conserved blocks from multiple
alignments for their use in phylogenetic analysis. Molecular
Biology and Evolution 17: 540–552.
Chakrabarty P (2010) Genetypes: a concept to help integrate
molecular phylogenetics and taxonomy. Zootaxa 2632: 67–68.
Chase MW, Reveal JL, Fay MF (2009) A subfamilial classification
for the expanded asparagalean families Amaryllidaceae,
Asparagaceae and Xanthorrhoeaceae. Botanical Journal of the
Linnean Society 161: 132–136.
Ciferri R (1928) Quarta contribuzione allo studio degli Ustilaginales.
Annales Mycologici 26: 1–68.
Ciferri R (1931) Quinta contribuzione allo studio degli Ustilaginales.
Annales Mycologici 29: 1–74.
Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G (2004)
MycoBank: an online initiative to launch mycology into the 21 st
century. Studies in Mycology 50: 19–22.
Crous PW, Groenewald JZ, Risède JM, Simoneau P, Hyde
KD (2006) Calonectria species and their Cylindrocladium
anamorphs: species with clavate vesicles. Studies in Mycology
55: 213–226.
Curran HR, Roets F, Dreyer LL (2009) Anther-smut fungal infection
of South African Oxalis species: spatial distribution patterns and
impacts on host fecundity. South African Journal of Botany 75:
807–815.
Denchev CM (2001) Classis Ustomycetes (Ordines Tilletiales,
Ustilaginales et Graphiolales). Sofia: Pensoft.
Ershad D (2000) Vankya, a new genus of smut fungi. Rostaniha 1:
65–72.
Euro+Med (2006-) Euro+Med PlantBase - the information resource
for Euro-Mediterranean plant diversity. Published on the Internet
http://ww2.bgbm.org/EuroPlusMed/ .
Felsenstein J (1981) Evolutionary trees from DNA sequences: a
maximum likelihood approach. Journal of Molecular Evolution
17: 368–376.
Fischer GW, Shaw CG (1953) A proposed species concept in
the smut fungi, with application to North American species.
Phytopathology 43: 181–188.
Fischer von Waldheim A (1880) Über zwei neue aussereuropäische
Brandpilze. Verhandlungen des Botanischen Vereins der Provinz
Brandenburg 22: 65.
Gatesy J, DeSalle R, Wheeler W (1993) Alignment-ambiguous
nucleotide sites and the exclusion of systematic data. Molecular
Phylogenetics and Evolution 2: 152–157.
Giribet G, Wheeler WC (1999) On gaps. Molecular Phylogenetics
and Evolution 13: 132–143.
Hawksworth DL (2012) Addressing the conundrum of unavailable
name-bearing types. IMA Fungus 3: 155–158.
Hendrichs M, Begerow D, Bauer R, Oberwinkler F (2005) The
genus Anthracoidea (Basidiomycota, Ustilaginales): a molecular
phylogenetic approach using LSU rDNA sequences. Mycological
Research 109: 31–40.
ARTICLE
volume 4 · no. 1
17

Piątek, Lutz & Chater
ARTICLE
Hood ME, Mena-Alí JI, Gibson AK, Oxelman B, Giraud T, Yockteng
R, Arroyo MTK, Conti F, Pedersen AB, Gladieux P, Antonovics J
(2010) Distribution of the anther-smut pathogen Microbotryum
on species of the Caryophyllaceae. New Phytologist 187: 217–
229.
Huelsenbeck JP, Larget B, Miller RE, Ronquist F (2002) Potential
applications and pitfalls of Bayesian inference of phylogeny.
Systematic Biology 51: 673–688.
Huelsenbeck JP, Rannala B (2004) Frequentist properties of
Bayesian posterior probabilities of phylogenetic trees under
simple and complex substitution models. Systematic Biology 53:
904–913.
Jage H, Richter U (2011) 10 Jahre Exkursionen zum Erkunden
phytoparasitischer Kleinpilze (2000-2009) in Deutschland.
Zeitschrift für Mykologie 77: 243–258.
Karatygin IV, Azbukina ZM (1989) Opredeliteľ gribov SSSR. Porjadok
Golovnevye. Vyp. 1. Semejstvo Ustilagovye (Definitorium
fungorum URSS. Ordo Ustilaginales. Fasc. 1. Familia
Ustilaginaceae). Leningrad: Nauka.
Katoh K, Kuma K, Toh H, Miyata T (2005) MAFFT version 5:
improvement in accuracy of multiple sequence alignment.
Nucleic Acids Research 33: 511–518.
Katoh K, Misawa K, Kuma K, Miyata T (2002) MAFFT: a novel
method for rapid multiple sequence alignment based on fast
Fourier transform. Nucleic Acids Research 30: 3059–3066.
Katoh K, Toh H (2008) Recent developments in the MAFFT multiple
sequence alignment program (outlines version 6). Briefings in
Bioinformatics 9: 286–298.
Kemler M, Lutz M, Göker M, Oberwinkler F, Begerow D (2009)
Hidden diversity in the non-caryophyllaceous plant-parasitic
members of Microbotryum (Pucciniomycotina: Microbotryales).
Systematics and Biodiversity 7: 297–306.
Kemler M, Martín MP, Tellería MT, Schäfer AM, Yurkov A, Begerow
D (2013) Contrasting phylogenetic patterns of anther smuts
(Pucciniomycotina: Microbotryum) reflect phylogenetic patterns
of their caryophyllaceous hosts. Organisms Diversity and
Evolution (in press).
Kirk P, Cooper J (2013) The fungal records database of Britain and
Ireland. http://www.fieldmycology.net/FRDBI/FRDBI.asp.
Kochman J (1936) Ustilaginales Poloniae. Planta Polonica 4: 1–161.
Kochman J, Majewski T (1973) Basidiomycetes, Ustilaginales. In:
Flora Polska. Rośliny zarodnikowe Polski i ziem ościennych.
Grzyby (J Kochman, A Skirgiełło, eds) 5: 1–271. Warszawa–
Kraków: Państwowe Wydawnictwo Naukowe.
Lindeberg B (1959) Ustilaginales of Sweden (exclusive of the
Cintractias on Caricoideae). Symbolae Botanicae Upsalienses
16(2): 1–175.
Lindtner V (1950) Ustilaginales Jugoslaviae. Bulletin du Muséum
d’Historie Naturelle du Pays Serbe, Série B 3–4: 1–110.
Liro JI (1924) Die Ustilagineen Finnlands I. Annales Academiae
Scientiarum Fennicae, Series A 17(1): 1–636.
Lutz M, Bauer R, Begerow D, Oberwinkler F, Triebel D (2004)
Tuberculina, rust relatives attack rusts. Mycologia 96: 614–626.
Lutz M, Göker M, Piątek M, Kemler M, Begerow D, Oberwinkler F
(2005) Anther smuts of Caryophyllaceae: molecular characters
indicate host-dependent species delimitation. Mycological
Progress 4: 225–238.
Lutz M, Piątek M, Kemler M, Chlebicki A, Oberwinkler F (2008)
Anther smuts of Caryophyllaceae: molecular analyses reveal
further new species. Mycological Research 112: 1280–1296.
Lutz M, Vánky K (2009) An annotated checklist of smut fungi
(Basidiomycota: Ustilaginomycotina and Microbotryales) in
Slovenia. Lidia 7(2–3): 33–78.
Lutz M, Vánky K, Bauer R (2012) Melanoxa, a new genus in the
Urocystidales (Ustilaginomycotina). Mycological Progress 11:
149–158.
Magnus P (1896(1895) Die Ustilagineen (Brandpilze) der Provinz
Brandenburg. Verhandlungen des Botanischen Vereins der
Provinz Brandenburg 37: 66–97.
Maire R (1931) Champignons parasites africains nouveaux ou peu
connus. In: Recueil de Travaux Cryptogamiques dédiés à Louis
Mangin: 355–360. Paris.
Massee I (1914) Observations on the life-history of Ustilago Vaillantii
Tul. The Journal of Economic Biology 9: 9–14.
Niemelä T, Wagner T, Fischer M, Dai YC (2001) Phellopilus gen.
nov. and its affinities within Phellinus s. lato and Inonotus s. lato
(Basidiomycetes). Annales Botanici Fennici 38: 51–62.
Piątek M, Lutz M, Kemler M (2013) Microbotryum silenes-saxifragae
sp. nov. sporulating in the anthers of Silene saxifraga in southern
European mountains. IMA Fungus 4: 29–40.
Piątek M, Lutz M, Ronikier A, Kemler M, Świderska-Burek U (2012)
Microbotryum heliospermae, a new anther smut fungus parasitic
on Heliosperma pusillum in the mountains of the European
Alpine System. Fungal Biology 116: 185–195.
Piątek M, Lutz M, Smith PA, Chater AO (2011) A new species of
Antherospora supports the systematic placement of its host
plant. IMA Fungus 2: 135–142.
Piątek M, Mułenko W (2010) The calcareous mires in South-East
Poland are home to two rare Anthracoidea species. Acta
Mycologica 45: 175–184.
Roets F, Dreyer LL, Wingfield MJ, Begerow D (2008) Thecaphora
capensis sp. nov., an unusual new anther smut on Oxalis in
South Africa. Persoonia 21: 147–152.
Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna
S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes
3.2: efficient Bayesian phylogenetic inference and model choice
across a large model space. Systematic Biology 61: 539-542.
Savchenko KG, Heluta VP (2012) Smut fungi of Ukraine, a checklist.
Sydowia 64: 281–300.
Savchenko KG, Heluta VP, Wasser SP, Nevo E (2011) A contribution
to the study of smut fungi of Israel. Mycotaxon 118: 303–309.
Savchenko KG, Lutz M, Piątek M, Heluta VP, Nevo E (2013)
Anthracoidea caricis-meadii is a new North American smut
fungus on Carex sect. Paniceae. Mycologia 105: 181–193.
Săvulescu T (1955) Die Ustilaginales der Rumänischen Volksrepublik.
Bucureşti: Akademie Verlag.
Scholz H, Scholz I (1988) Die Brandpilze Deutschlands
(Ustilaginales). Englera 8: 1–691.
Silvestro D, Michalak I (2012) raxmlGUI: a graphical front-end for
RAxML. Organisms Diversity and Evolution 12: 335–337.
Speta F (1988) Systematische Analyse der Gattung Scilla L. s.l.
(Hyacinthaceae). Phyton 38: 1–141.
Stamatakis A (2006) RAxML-VI-HPC: maximum likelihood-based
phylogenetic analyses with thousands of taxa and mixed models.
Bioinformatics 22: 2688–2690.
Stamatakis A, Hoover P, Rougemont J (2008) A rapid bootstrap
algorithm for the RAxML web servers. Systematic Biology 57:
758–771.
Sydow H, Sydow P (1914a) Fungi. In: Wissenschaftliche Ergebnisse
der Deutschen Zentral-Afrika-Expedition 1907–1908 unter
18 ima fUNGUS

Antherospora on Muscari
Führung Adolf Friedrichs, Herzogs zu Mecklenburg. Band II.
Botanik (J Mildbraed, ed): 95–101. Leipzig: Verlag von Klinkhardt
und Biermann.
Sydow H, Sydow P (1914b) Beschreibungen neuer Südafrikanischer
Pilze. III. Annales Mycologici 12: 263–267.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S
(2011) MEGA5: molecular evolutionary genetics analysis using
maximum likelihood, evolutionary distance, and maximum
parsimony methods. Molecular Biology and Evolution 28: 2731–
2739.
Tripp EA, Lendemer JC (2012) Request for binding decisions on
the descriptive statements associated with Mortierella sigyensis
(fungi: Mortierellaceae) and Piromyces cryptodigmaticus (fungi:
Neocallimastigaceae). Taxon 61: 886–888.
Tulasne LR, Tulasne C (1847) Mémoire sur les Ustilaginées
comparées aux Urédinées. Annales des Sciences Naturelles,
Botanique, Série 3, 7: 12–127+Pls. 2–7.
Tutin TG, Heywood VH, Burges NA, Valentine DH, Walters SM, Webb
DA (1980) Flora Europaea. Vol. 5. Alismataceae to Orchidaceae
(Monocotyledones). Cambridge: Cambridge University Press.
Vánky K (1985) Carpathian Ustilaginales. Symbolae Botanicae
Upsalienses 24(2): 1–309.
Vánky K (1994) European Smut Fungi. Stuttgart-Jena-New York: G.
Fischer Verlag.
Vánky K (2004a) Taxonomic studies on Ustilaginomycetes. 24.
Mycotaxon 89: 55–118.
Vánky K (2004b) The smut fungi (Ustilaginomycetes) of Boutelouinae
(Poaceae). Fungal Diversity 16: 167–198.
Vánky K (2008) Smut fungi (Basidiomycota p.p., Ascomycota
p.p.) of the world. Novelties, selected examples, trends. Acta
Microbiologica et Immunologica Hungarica 55: 91–109.
Vánky K (2009) The genus Vankya (Urocystidaceae) revisited.
Mycologia Balcanica 6: 73–78.
Vánky K (2012) Smut Fungi of the World. St Paul, MN: American
Phytopathological Society Press.
Vánky K, Lutz M (2007) Revision of some Thecaphora species
(Ustilaginomycotina) on Caryophyllaceae. Mycological Research
111: 1207–1219.
Vánky K, Lutz M, Bauer R (2008) Floromyces, a new genus of
Ustilaginomycotina. Mycotaxon 104: 171–184.
Vánky K, McKenzie EHC (2002) Smut fungi of New Zealand. [Fungi
of New Zealand, vol. 2.] Hong Kong: Fungal Diversity Press.
Zambettakis C (1970) Recherches sur les Ustilaginales ďAfrique.
Bulletin de la Société Mycologique de France 86: 305–692.
Zundel GL (1953) The Ustilaginales of the world. Pennsylvania State
College School of Agriculture Department of Botany Contribution
176: 1–410.
Zwetko P, Blanz P (2004) Die Brandpilze Österreichs [Catalogus
Florae Austriae vol. III (3).] Wien: Österreichische Academie de
Wissenschaften.
ARTICLE
volume 4 · no. 1
19

ARTICLE
ima fUNGUS

doi:10.5598/imafungus.2013.04.01.03
IMA Fungus · volume 4 · no 1: 21–28
Molecular analyses confirm Brevicellicium in Trechisporales
M. Teresa Telleria 1 , Ireneia Melo 2 , Margarita Dueñas 1 , Karl-Henrik Larsson 3 , and Maria P. Paz Martín 1
1
Real Jardín Botánico (RJB-CSIC), Plaza de Murillo 2, 28014 Madrid, Spain; corresponding author e-mail: telleria@rjb.csic.es
2
Jardim Botânico (MNHNC), Universidade de Lisboa, CBA/FCUL. Rua da Escola Politécnica 58. 1250-102 Lisboa, Portugal
3
Natural History Museum, University of Oslo, P.O. Box 1172 Blindern, 0318 Oslo, Norway
ARTICLE
Abstract: The genus Brevicellicium encompasses wood-inhabiting corticioid fungi characterized by isodiametric
subhymenial hyphae, short basidia, and smooth, often subangular spores with a distinct apiculus. Eight new LSU nrDNA
sequences and 13 new ITS nrDNA of this genus, including the type species, were aligned with 47 and 42 accessions
respectively of species of Trechisporales obtained from GenBank, and phylogenetic analyses were performed. The order
Trechisporales was confirmed as a monophyletic group; the genera Porpomyces, Sistotremastrum, Subulicystidium and
Trechispora form a highly supported clade where all Brevicellicium sequences are included. Our analyses also support
that this genus belongs to Hydnodontaceae. A new species, Brevicellicium atlanticum from the Azores Archipelago, is
described.
Key words:
Basidiomycota
Agaricomycetes
Corticioid fungi
ITS
LSU nrDNA
Phylogeny
Taxonomy
Article info: Submitted: 28 November 2012; Accepted: 28 February 2013; Published: 4 April 2013.
Introduction
Brevicellicium was described by Larsson and Hjortstam
(Hjortstam & Larsson 1978) to accommodate Corticium
exile. At the time, two more species were transferred to the
new genus, Odontia olivascens and Athelopsis viridula. The
isodiametric subhymenial hyphae, short basidia and smooth,
often subangular, spores with a distinct apiculus were
emphasized as important morphological characteristics of
this genus of wood-inhabiting corticioid fungi.
Twelve species have been placed in this cosmopolitan
genus. Brevicellicium exile, originally described from Canada
(Jackson 1950) as Corticium exile, seems to be a rare
species in the Northern Hemisphere (Hjortstam 2001), and
is known from north Europe (Hjortstam & Larsson 1978),
France (Boidin & Gilles 1990), Spain (Telleria et al. 1993,
Telleria & Melo 1995), and Colombia (Hjortstam & Ryvarden
1997). Brevicellicium olivascens, described from Italy by
Bresadola (1892) as Odontia olivacea, is a cosmopolitan
species, widely distributed in temperate areas and less
frequent in tropical and subtropical regions (Hjortstam et al.
2005); it is common in Europe including the Iberian Peninsula
(Telleria & Melo 1995, Bernicchia & Gorjón 2010) and is also
reported from North America (Ginns & Lefebvre 1993), South
America, Burundi, and India (Hjortstam 2001, Hjortstam
& Ryvarden 2007) as well as from Iran (Hallenberg 1981),
and Japan (Maekawa 1993). It should also be noted that B.
exile and B. olivascens were also found in the Macaronesian
region: Canary Islands and Azores Archipelago (Ryvarden
1976, Hjortstam & Larsson 1978, Telleria et al. 2009a, b).
Brevicellicium viridulum, transferred to the genus when
it was described, was considered by Hjortstam et al.
(1988) as a colour morph of B. olivascens. Brevicellicium
permodicum, described from Canada by Jackson (1950) as
Corticium permodicum, and also reported from New Zealand
(Cunningham 1963, Hjortstam 2001), is the only species of
the genus without clamps known today. Its inclusion in the
genus is perhaps questionable. The other eight species have
a tropical distribution: Brevicellicium mellinum, originally
described from Brazil by Bresadola (1920) as Corticium
mellinum, is reported from Puerto Rico and Venezuela
(Hjortstam & Ryvarden 2007). Brevicellicium allantosporum,
described from Tanzania (Hjortstam & Ryvarden 1980), is
also known from Brazil, Colombia, Venezuela, Ecuador, and
Borneo (Hjortstam 2001, Hjortstam et al. 2005, Hjortstam &
Ryvarden 2008). Brevicellicium flavovirens, from Argentina
and Brazil (Hjortstam 2001), is morphologically similar to B.
exile but differs in basidiome colour and the shape and size
of the spores. Brevicellicium molle, described from Tanzania
(Hjortstam & Ryvarden 1980), is also reported from Colombia
and Brazil (Hjortstam & Ryvarden 1997, Hjortstam 2001). Four
species are only known from their type locality: B. asperum
from Venezuela (Hjortstam et al. 2005), B. udinum from Brazil
(Hjortstam 2001), B. uncinatum from Tanzania (Hjortstam &
Ryvarden 1980, Hjortstam 2001), and B. vulcanense from
Hawaii (Gilbertson et al. 2001). Complete or partial keys to
Brevicillicium have been published by Hjortstam & Larsson
(1978), Hjortstam & Ryvarden (1980), Hjortstam (2001), and
Hjortstam et al. (2005).
According to Hjortstam & Larsson (1978), Brevicellicium
is morphologically close to the smooth-spored species of
Trechispora (e.g. Trechispora amianthina, T. cohaerens, T.
confinis, T. byssinella), differing in the absence of ampullate
septa on the basal hyphae. Jülich (1982), placed both
© 2013 International Mycological Association
You are free to share - to copy, distribute and transmit the work, under the following conditions:
Attribution:
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).
Non-commercial: You may not use this work for commercial purposes.
No derivative works: You may not alter, transform, or build upon this work.
For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get
permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.
volume 4 · no. 1
21

Telleria et al.
ARTICLE
genera in Hydnodontaceae, and later Larsson (2007), in his
phylogenetic classification of corticioid fungi, confirmed this
arrangement and included the family in Trechisporales.
Recently, the genus Brevicellopsis has been segregated
from Brevicellicium (Hjorstam & Ryvarden 2008), with
Brevicellicium allantosporum as type species. Both genera
share similar isodiametric subhymenial hyphae, but they can
be distinguished by the hymenophore appearance and shape
of the spores. In Brevicellicium, the hymenophore is granular
to almost smooth, and the spores are subangular or short
ellipsoid, whereas Brevicellopsis has a distinctly odontioid
hymenophore and allantoid spores.
The aim of this study was to identify, characterize and
analyze, using morphological and molecular data, 11
collections of Brevicellicium from the Iberian Peninsula
(Spain and Portugal) and the Azores Archipelago, as well as
to evaluate the phylogenetic circumscription of the genus.
The ITS and LSU nrDNA sequences of all collections were
compared with sequences of Trechispora and Sistotremastrum
generated by our research group within the framework of
other studies, and with sequences deposited in GenBank, in
order to establish their phylogenetic relationships. As a result,
a new species is described and the phylogenetic position of
Brevicellicium as member of Trechisporales is confirmed
(Larsson 2007).
Materials and methods
Sampling, morphological studies and line
drawings
Twelve specimens of Brevicellicium from the Iberian
Peninsula (Spain) and the Azores Archipelago, and two from
Sweden, were studied (Table 1). Vouchers are deposited
in MA-Fungi, LISU, TFCMic, and GB. Measurements and
drawings were made from microscopic sections mounted in
3 % aqueous solution of potassium hydroxide and examined
at magnifications up to ×1250 using an Olympus BX51
microscope. The length and width of 30 spores and 10
basidia were measured from each sample. Colours of dried
basidiomes are given according to the ISCC–NBS Centroid
Color Charts. The drawing was made with aid of a drawing
tube.
DNA isolation and sequencing
Genomic DNA was extracted from 13 collections (Table 1)
using the E.Z.N.A® Fungal DNA Miniprep Kit (Omega Biotek,
Doraville, USA) or the DNeasy Plant Mini Kit (Qiagen,
Valencia, CA), following the manufacturer’s instructions; lysis
buffer incubation was overnight at 55 ºC.
Total DNA was used for PCR amplification of the 5’-
1450-base region of the large subunit (LSU nrDNA) and the
internal transcribed spacer region (ITS nrDNA) of the nuclear
ribosomal gene. The primers LR0R (Rehner & Samuels 1994)
and LR7 (Vilgalys & Hester 1990) were used to amplify the
Table 1. Specimens of Brevicellicium studied with GenBank accession numbers.
Species/Specimen Country/Locality Habitat Acc. no.
B. atlanticum sp. nov.
ITS
28S
LISU 178590, 9090IM
LISU 178566, 9065IM
B. exile (H.S. Jacks.) K.H. Larss. &
Hjortstam
MA-Fungi 76132, 16118Tell.
Portugal, Azores Archipelago, Terceira
Island
Portugal, Azores Archipelago, Terceira
Island
Portugal, Azores Archipelago, Pico
Island
Juniperus brevifolia subsp. HE963775 HE963776
azorica
Erica azorica HE963773 HE963774
Pittosporum undulatum HE963779 —
MA-Fungi 26554, 5217MD Spain, Huesca Buxus sempervirens HE963777 HE963778
GB, KHL 12130 Sweden, Västergötland conifer — HE963780
B. olivascens (Bres.) K.H. Larss. &
Hjortstam
MA-Fungi 75998, 17370Tell.
Portugal, Azores Archipelago, Flores Pittosporum undulatum HE963790 —
Island
TFCMic 15272
Portugal, Azores Archipelago, Pico Pittosporum undulatum HE963791 —
Island
MA-Fungi 19016, 7743Tell. Spain, Asturias Quercus robur HE963789 —
MA-Fungi 13843, 3491MD Spain, Asturias Castanea sativa HE963782 HE963783
MA-Fungi 5674, 239Tell. Spain, Barcelona Fagus sylvatica HE963781 —
MA-Fungi 21444, 3881MD Spain, Guadalajara Rosmarinus officinalis HE963784 —
MA-Fungi 41366, 6910MD Spain, Madrid Corylus avellana HE963785 HE963786
MA-Fungi 23496, 4611MD Spain, Toledo Ulmus sp. HE963787 HE963788
GB, KHL 8571 Sweden, Bohuslän hardwood HE963792 HE963793
22 ima fUNGUS

Brevicellicium in Trechisporales
region of the LSU nrDNA and the primers ITS1F (Gardes &
Bruns 1993) and ITS4 (White et al. 1990) were used to obtain
amplifications of both ITS regions, including the 5.8S of the
ribosomal RNA gene cluster and flanking parts of the small
subunit (SSU) and large subunit (LSU) nuclear ribosomal
genes. Individual reactions to a final volume of 25 µm were
carried out using illustra PuReTaq Ready-To-Go PCR
Beads (GE Healthcare, Buckingham) with a 10 pmol µL
primer concentration following the thermal cycling conditions
used in Martín & Winka (2000). When these pair of primers
failed, the LSU nrDNA region was amplified in two parts using
LR5 and LR3R (Vilgalys & Hester 1990), in the combination
LR0R/LR5 and LR3R/LR7. The ITS1 nrDNA region and the
beginning of 5.8S with primers ITS1F and ITS2 (White et
al. 1990), and ITS2 nrDNA region and the end of 5.8S with
primer ITS3 (White et al. 1990) and ITS4.
Negative controls lacking fungal DNA were run for each
experiment to check for contamination. The reactions were
run with the following parameters for the LSU nrDNA: initial
denaturation at 94 ºC for 5 min, then 36 cycles of denaturation
at 94 ºC for 30 s, annealing at 52 ºC for 30 s, and extension
at 72 ºC for 1 min and 30 s, with a final extension at 72 ºC for
10 min, and 4 ºC soak; for the ITS nrDNA: initial denaturation
at 95 ºC for 5 min, then 5 cycles of denaturation at 95 ºC for
30 s, annealing at 54 ºC for 30 s, and extension at 72 ºC for 1
min, followed by 33 cycles of denaturation at 72 ºC for 1 min,
annealing at 48 ºC for 30 s, and extension at 72 ºC, with a
final extension at 72 ºC for 10 min and 4 ºC soak.
The PCR products were subsequently purified using the
QIAquick Gel PCR Purification (Qiagen) kit according to
the manufacturer’s instructions. The purified PCR products
were sequenced using the same amplification primers. When
products were only faintly visible on agarose gels (less that
20 ng µL -1 ), cloning was conducted with a pGEM®-T Easy
Vector System II cloning kit (Promega Corporation, Madison,
WI). From each cloning reaction, up to six clones were
selected for sequencing. To confirm that the inserted product
was correct, 2 µL of the purified plasmid DNA was digested
with Eco RI prior to sequencing following the instructions of
the manufacturers. Both strands were sequenced separately
using vector specific primers T7 and SP6 at Secugen S.L.
(Madrid, Spain) or Macrogen (Seoul, Korea).
Sequencher v. 4.2 (Gene Codes Corporation, Ann Arbor,
MI) was used to edit the resulting electropherograms and
to assemble contiguous sequences. BLAST searches with
megablast option were used to compare the sequences
obtained against the sequences in the National Center of
Biotechnology Information (NCBI) nucleotide databases
(Altschul et al. 1997).
Sequence alignment and phylogenetic
analyses
The LSU nrDNA and ITS nrDNA sequences obtained were
aligned separately using Se-Al v. 2.0a11 Carbon (Rambaut
2002) for multiple sequences. The sequences were compared
with homologous sequences retrieved from the EMBL/
GenBank/DDBJ databases (Cochrane et al. 2011); many of
the sequences were generated by our research group within
the framework of other studies (Sistotremastrum: JX310442–
JX310445; Trechispora and other Trechisporales: JX392812–
JX392856). In the LSU nrDNA analyses, Sistotrema and
Repetobasidium (cantharelloid and hymenochaetoid
clade respectively, Binder et al. 2005) sequences were
included as outgroups. In order to root the ITS analyses,
six Sistotremastrum sequences (Sistotremastrum family in
Larsson 2007) were included as outgroups because they
appear as the sister group of the clade formed by Porpomyces,
Subulicystidium, and Trechispora in the trechisporoid clade
(Binder et al. 2005, Larsson 2007). Where ambiguities in
the alignment occurred, the alignment generating the fewest
potentially informative characters were chosen (Baum &
Sytsma 1994). Alignment gaps were marked “–”, unresolved
nucleotides and unknown sequences were indicated with “N”.
From each data set a maximum parsimony analysis (MP)
was carried out; minimum length Fitch trees were constructed
using heuristic searches with tree–bisection–reconnection
(TBR) branch swapping, collapsing branches if maximum
length was zero and with the MulTrees option on in PAUP v.
4.0b10 (Swofford 2003). Gaps were treated as missing data.
Nonparametric bootstrap (bs) support (Felsenstein 1985)
for each clade, based on 10 000 replicates using the fast–
step option, was tested. The consistency index, CI (Kluge &
Farris 1969), retention index, RI (Farris 1989), and rescaled
consistency index, RC (Farris 1989) were obtained.
For each dataset a second analysis was done using a
Bayesian approach (Larget & Simon 1999, Huelsenbeck
et al. 2001) with MrBayes v. 3.1 (Ronquist & Huelsenbeck
2003). The analyses were performed assuming the general
time reversible model (Rodríguez et al. 1990), including
estimation of invariant sites and assuming a discrete gamma
distribution with six categories (GTR+I+G) as selected by
MrModeltest v. 2.3 (Nylander 2004). According to Rodríguez
et al. (1990), only reversible models allow the calculation of
the substitution rates. Two independent and simultaneous
analyses starting from different random trees were run for
2 000 000 generations with four parallel chains and trees
and model scores saved every 100th generation. The default
priors in MrBayes were used in the analysis. Every 1 000 th
generation tree from the two runs was sampled to measure
the similarities between them and to determine the level of
convergence of the two runs. The potential scale reduction
factor (PSRF) was used as a convergence diagnostic
and the first 25 % of the trees were discarded as burn–in
before stationary was reached. Both the 50 % majority-rule
consensus tree and the posterior probability (pp) of the nodes
were calculated from the remaining trees with MrBayes.
Phylogenetic trees were drawn using TreeView (Page 1996).
RESULTS
In general, only amplifications in parts of the LSU nrDNA,
with primers LR0R/LR5 and LR3R/LR7, and ITS nrDNA, with
primers ITS1F/ITS2 and ITS3/ITS4 were successful. Weak
products (faintly visible on agarose gels; less that 20 ng µL -1
after gel purification) or purified product, which sequences
showed double peaks, were cloned. Thus, from LISU 178566,
LISU 178590 and MA–Fungi 26554, good LSU sequences
were obtained after cloning; the six cloned sequences
from each fragment/collection were identical and only one
ARTICLE
volume 4 · no. 1
23

Telleria et al.
ARTICLE
was selected for analyses. The BLAST search of the LSU
nrDNA and ITS nrDNA sequences obtained (both direct or
after cloning), excluding uncultured/environmental samples,
showed more than 100 % and 85 % similarity respectively
with Trechisporales sequences published in GenBank,
mainly from Larsson et al. (2004). Sequences were located
in EMBL/GenBank/DDBJ and UNITE (Abarenkov et al. 2011,
http://unite.ut.ee/cite.php) databases.
LSU nrDNA
Eight LSU nrDNA sequences generated for this study were
aligned with 47 sequences downloaded from GenBank
to produce a matrix of 1 358 unambiguously aligned
nucleotide position characters. Among them, 908 positions
were constant, 167 were parsimony–uninformative and 283
were parsimony-informative. In the maximum parsimony
analysis under heuristic search, 100 most parsimonious
trees (MPTs) were obtained (tree length=1085, consistency
index CI = 0.5512, retention index RI = 0.7105, rescaled
consistency index RC = 0.3916). The trees obtained from
the MP (strict consensus tree, data not shown) and the
Bayesian analyses (Fig. 1) show similar topologies. In both
analyses, the complete ingroup forms a highly supported
monophyletic clade (bs = 78 %, pp = 1.0), and includes
all Brevicellicium sequences. The Trechisporales clade is
divided in two well-supported clades, one with the three
Sistotremastrum accessions (bs = 78 %, pp = 1.0) and
the other, with the remaining sequences (bs = 88 %, pp =
0.99). The latter are distributed over three subclades that
either lack support or get support by the Bayesian analysis
only. Subclade I (bs < 50 %, pp = 0.52) is formed by
Porpomyces and Subulicystidium. Subclade II (bs = 58%,
pp = 1.0) includes all Brevicellium collections and is the
sister group of subclade III (bs = 56, pp = 1.0) formed by
34 Trechispora spp. sequences. However, this sister-group
relationship is not highly supported (bs < 50 % and pp =
100/1.0
/1.0
100/1.0
Repetobasidium mirificum AY293208
Repetobasidium conicum DQ873647
Trechisporales (KHL12604)
I
Trechisporales (LISU178537, 9035IM)
/0.52
Trechisporales (MA-Fungi 73985, 12959IS)
Subulicystidium longisporum AJ406423
Subulicystidium longisporum AJ406422
Porpomyces mucidus AF347093
Brevicellicium olivascens (KHL8571)
Brevicellicium olivascens (MA-Fungi 13843, 3491MD)
Brevicellicium olivascens (MA-Fungi 23496, 4611MD)
II
Brevicellicium olivascens (MA-Fungi 41366, 6910MD)
58/1.0
Brevicellicium exile (KHL12130)
Hydnodontaceae
Brevicellicium exile (MA-Fungi 26554, 5217MD)*
Jülich (1982)
Brevicellicium atlanticum (LISU178566, 9065IM)*
88/0.99
Brevicellicium atlanticum (LISU178590, 9090IM)*
Trechispora sp. FJ232041
Trechispora sp. FJ232042
Trechispora sp. FJ232043
Trechispora sp. (Oslo Herb. F909645)
Trechispora farinacea AF347083
Trechispora incisa AF347085
Trechispora confinis AY586719
Trechispora subsphaerospora AF347080
Trechispora confinis AF347081
Trechispora sp. AF347088
/0.82
Trechispora kavinioides AF347086
Trechispora hymenocystis AF347090
Trechispora sp. (MA-Fungi 74082, 12981IS)
Trechispora sp. (MA-Fungi 82478, 17615Tell)
Trechispora araneosa AF347084
Trechisporales
Trechispora sp. (MA-Fungi 82485, 13858Tell1)
Trechispora sp. (MA-Fungi 82485, 13858Tell4)
78/1.0
Trechispora sp. (MA-Fungi 82485, 13858Tell4b)
Trechispora sp. (MA-Fungi 82486, 13861Tell3)
Trechispora sp. (MA-Fungi 82486, 13861Tell1)
Trechispora farinacea AF347082
Trechispora farinacea EU909231
Trechispora sp. (MA-Fungi 79474, 12168IS)
III
Trechispora sp. (MA-Fungi 70669, 11069MD)
56/1.0
Trechispora sp. (MA-Fungi 70645, 11096MD)
Trechispora sp. (MA-Fungi 82484, 13644Tell)
Trechispora nivea AY586720
Trechispora sp. (MA-Fungi 74044, 12828IS)
Trechispora sp. (MA-Fungi 76238, 17430Tell)
Trechispora sp. (MA-Fungi 76257, 17482Tell)
Trechispora sp. (MA-Fungi 82479, 11392MD)
Trechispora sp. (MA-Fungi 82480, 11409MD)
Sistotremastrum
Trechispora sp. (MA-Fungi 82481, 11394bisMD)
family
Trechispora sp. (MA-Fungi 76254, 17621Tell)
78/1.0
Sistotremastrum suecicum EU118667
Sistotremastrum niveocremeum AF347094
Sistotremastrum sp. (MA-Fungi 12915, 3668Tell)
Sistotrema confluens AY586712
Sistotrema farinaceum DQ898707
0.06
Fig. 1. The 50 % majority-rule consensus tree of Bayesian analysis based on nuclear D1/D2 sequences (LSU nrDNA). Bootstrap (> 50 %) and
posterior probability values indicated on the branches to the main clades. The topology was rooted with Sistotrema and Repetobasidium species.
The three main clades in Hydnodontaceae discussed in the text are designated I-III. The position of Brevicellicium atlanticum is indicated in
bold. * Sequences obtained after cloning (from each sample, six identical sequences were obtained after cloning, but only one per sample was
included in the analyses and sent to GenBank).
24 ima fUNGUS

Brevicellicium in Trechisporales
0.82). The Brevicellicium clade is separated in two strongly
supported groups; one (bs = 100, pp = 1.0) that includes two
collections from Terceira Island in Azores Archipelago (LISU
178566 and LISU 178590) and another (bs = 93, pp = 1.0)
consisting of six accessions: four of B. olivascens clade (bs
= 96 %, pp = 1.0) and two of B. exile (bs < 50 %, pp = 1.0).
ITS nrDNA
Thirteen new ITS nrDNA sequences were aligned
with 42 sequences available in GenBank including six
Sistotremastrum sequences serving as outgroup. The
resulting matrix consisted of 871 unambiguously aligned
nucleotide position characters. Among them, 314 positions
were constant, 127 were parsimony–uninformative and 410
were parsimony-informative. In the maximum parsimony
analysis under exhaustive search, 100 most parsimonious
trees (MPTs) were obtained (tree length = 1407, CI = 0.6041,
RI = 0.8113, and RC = 0.491). The trees obtained from the
MP (strict consensus tree, data not shown) and Bayesian
analyses show similar topologies (Fig. 2). Similar to the LSU
analyses the Brevicellicium sequences form a clade (bs = 90
%, pp = 0.90), in a sister-group relationship to all Trechispora
sequences (bs < 50 %, pp = 1.0). Sequences from LISU
178566 and LISU 178590 form a highly supported clade (bs =
100, pp = 1.0), sister group of B. exile and B. olivascens clade
(bs = 90 %, pp = 1.0). The nine B. olivascens sequences
form a highly supported clade (bs = 99 %, pp = 1.0), with
low genetic variability (uncorrected “p” distances from 0.0
to 0.018), whereas the two B. exile sequences do not group
together and show a high genetic variability (uncorrected “p”
distance equal 0.139); apparently here are more taxonomical
problems hidden that needs to be addressed.
Since LISU 178566 and LISU 178590 also have unique
morphological characters we find reasons to describe them
as a new species: Brevicellicium atlanticum.
ARTICLE
90/0.90
Trechisporales (MA-Fungi 82476, 17494Tell)
100/1.0
Brevicellicium atlanticum (LISU178590, 9090IM)
Brevicellicium atlanticum (LISU178566, 9065IM)
Brevicellicium olivascens (MA-Fungi 13843, 3491MD)
Brevicellicium olivascens (MA-Fungi 21444, 3881MD)
Brevicellicium olivascens (MA-Fungi 23496, 4611MD)
Brevicellicium olivascens (KHL8571)
99/1.0 Brevicellicium olivascens (MA-Fungi 75998, 17370Tell)
Brevicellicium olivascens (TFCMic. 15272)
Brevicellicium olivascens (MA-Fungi 5674, 239Tell)
90/1.0
Brevicellicium olivascens (MA-Fungi 19016, 7743Tell)
Brevicellicium olivascens (MA-Fungi 41366, 6910MD)
Brevicellicium exile (MA-Fungi 76132, 16118Tell)
Brevicellicium exile (MA-Fungi 26554, 5217MD)
86/1.0
/1.0
Hydnodontaceae
Jülich (1982)
/1.0
/0.70
33 Trechispora
specimens
Porpomyces mucidus AF347093
Trechisporales (LISU178537, 9035IM)
Sistotremastrum
family
/0.61
98/0.61
5 Sistotremastrum
specimens
Sistotremastrum suecicum EU186667
0.2
Fig. 2. The 50 % majority-rule consensus tree of Bayesian analysis based on ITS nrDNA sequences. Bootstrap (> 50 %) and posterior
probability values indicated on the branches. The topology was rooted with Sistotremastrum species. Trechispora and Sistotremastrum clades
not discussed in the text are indicated as triangles. The position of Brevicellicium atlanticum is indicated in bold.
volume 4 · no. 1
25

Telleria et al.
ARTICLE
subhymenial hyphae richly branched, wider, some
isodiametric and up to 6.0 μm diam. Cystidia absent.
Basidia short clavate to short cylindrical, basally clamped,
8.0–10.0 × 4.5–5.5 μm, with 4 sterigmata up to 4.5 μm
long. Basidiospores short ellipsoid with a prominent
apiculus, smooth, thin-walled, (3.8) 4.0–4.5 × (2.0) 2.3–2.5
μm, inamyloid, indextrinoid, acyanophilous.
Substratum: On live trunk of Erica azorica and on decayed
branch of Juniperus brevifolia ssp. azorica, both endemic
plants from the Azores Archipelago.
Additional specimen examined: Portugal: Azores: Terceira, Angra do
Heroismo, Mistérios Negros, 26SMH7587, 630 m asl, on decayed
branch of Juniperus brevifolia ssp. azorica, 2 Mar 2005, I. Melo & J.
Cardoso 9090IM (LISU 178590).
Fig. 3. Brevicellicium atlanticum (LISU 178566). a. Vertical section
through basidiome; b–c, spores.
Taxonomy
Brevicellicium atlanticum Melo, Telleria, M. Dueñas
& M.P. Martín, sp. nov.
MycoBank MB800016
(Fig. 3)
Etymology: The Azores Archipelago is situated in the middle
of the North Atlantic and atlanticum is derived from Atlantic
Ocean.
Diagnosis: Basidiome resupinate, membranaceous, smooth,
whitish. Hyphal system monomitic, hyphae with clamps,
subhymenial hyphae to 6.0 μm diam. Basidia clavate to
short cylindrical, 8.0–10.0 × 4.5–5.5 μm, with 4 sterigmata.
Basidiospores short ellipsoid with a prominent apiculus, (3.8–)
4.0–4.5 × (2.0–) 2.3–2.5 μm.
Type: Portugal: Azores: Terceira, Angra do Heroismo, Terra-
Chã, Matela de Baixo, 26SMH7783, 470m asl, on live trunk
of Erica azorica, 10 Mar. 2005, I. Melo & J. Cardoso 9065IM
(LISU 178566 – holotype).
Description: Basidiome resupinate, effused, adnate, very
thin, porose, membranaceous; hymenophore smooth,
whitish; margin indeterminate. Hyphal system monomitic,
hyphae with clamps, subiculum very thin, consisting of
a few thin-walled, uniform, 2.5–3.5 μm diam. hyphae,
Notes: Overall, Brevicellicium atlanticum is morphologically
most similar to B. exile, but the latter has wider basidia and
larger spores, 9–11 × 5–6.5 μm and 4.5–5 × 2.5–3.5 μm
respectively (Jackson 1950); 9–12 × 5.5–8 μm and 4.5–6
× 2.5–3.5 μm in specimens from the Iberian Peninsula
(Telleria & Melo 1995) or 10–15 × 5–6.5 μm and 5–6.5 ×
3.5–4 μm from the Azores Archipelago (Telleria et al. 2009
a, b). Also, B. flavovirens and B. udinum have a similar spore
morphology, but the former has a yellowish grey basidiome
and wider spores (4.5–5.0 (–5.5) × 3.0–3.5 μm). In B. udinum
the basidiome is thick, cracked when dry, and the spores are
narrowly ellipsoid, 5.0–5.5 (–6.0) × 2.5–2.75 μm.
Boidin & Gilles (1990) reported a specimen morphologically
similar to Brevicellicium exile from France, Landes, Carcen-
Ponson, on Alnus glutinosa, LY 13883, but differing in the
narrower basidia (8–14 × 4–5 μm) and smaller spores (3.5–
4.5 × 2–2.5 μm). This material was not available to us but
could well represent B. atlanticum.
Discussion
Trechisporales is a rather small order described by
Larsson (Hibbett et al. 2007) and placed in the subphylum
Agaricomycotina, class Agaricomycetes, with three
exemplar genera included in the original description:
Trechispora, Sistotremastrum, and Porpomyces. In his
molecular phylogenetic classification of the corticioid
fungi, Larsson (2007) included sequences of Trechispora
farinacea (AF347089), T. hymenocystis (AF347090),
Subulicystidium (AY463468/AY586714), Porpomyces
mucidus (AF347091) and Sistotremastrum niveocremeum
(AF347094), and preliminarily recognized two families
in the order: Hydnodontaceae (Jülich 1982) with
the genera Brevicellicium, Fibriciellum, Fibrodontia,
Luellia, Porpomyces, Subulicystidium, Trechispora and
Tubulicium; and the Sistotremastrum family with the
genus Sistotrematrum. Besides, he listed the genera
Dextrinocystis, Dextrinodontia and Litchauerella as possible
candidates to be included in Hydnodontaceae. The new
genus Brevicellopsis, segregated from Brevicellicium
(Hjortstam & Ryvarden 2008), could be another possible
candidate to be included in this family.
26 ima fUNGUS

Brevicellicium in Trechisporales
The molecular phylogenetic analyses of the present study
support Trechisporales as a monophyletic group with the
species of Porpomyces, Sistotremastrum, Subulicystidium,
and Trechispora forming a highly supported monophyletic clade
where all Brevicellicium sequences are included. Our results
also support the two families of this order: Hydnodontaceae
where Brevicellicium and Trechispora are included and the
Sistotremastrum family (Jülich 1982, Larsson 2007). Most
species of Brevicellicium have yet to be included in molecular
phylogenetic analyses. Only then can outstanding issues like
the independent status of Brevicellopsis and the uncertain
position for Brevicellicium permodicum be resolved.
Acknowledgments
We are grateful to Esperanza Beltrán-Tejera and J. Laura Rodríguez-
Armas for kindly providing us Brevicellicium olivascens specimen
from Pico Island, Azores Archipelago (TFCMic 15272), and Fátima
Durán for technical assistance. Financial support was provided by
DGI project CGL2009–07231.
References
Abarenkov K, Nilsson RH, Larsson K-H, Alexander IJ, Eberhardt U,
Erland S, Høiland K, Kjøller R, Larsson E, Pennanen T, Sen R,
Taylor AFS, Tedersoo L, Ursing BM, Vrålstad T, Liimatainen K,
Peintner U, Kõljalg U (2011) The UNITE database for molecular
identification of fungi – recent updates and future perspectives.
New Phytologist 186: 281–285.
Altschul SF, Madden TL, Schäffer AA, Zhan J, Zhan GZ, Millar W,
Lipman DJ (1997) Gapped BLAST and PSI–BLAST: a new
generation of protein database search programs. Nucleic Acid
Research 25: 3389–3402.
Baum DA, Sytsma KJ (1994) A phylogenetic analysis of Epilobium
(Onagraceae) based on nuclear ribosomal DNA sequences.
Systematic Botany 19(3): 363–388.
Bernicchia A, Gorjón SP (2010) Corticiaceae s.l. Fungi Europaei 12.
Ed. Candusso. Italia.
Binder M, Hibbet DS, Larsson K-H, Larsson E, Langer E,
Langer G (2005) The phylogenetic distribution of resupinate
forms across the major clades of mushroom-forming fungi
(Homobasidiomycetes). Systematics and Biodiversity 3: 1–45.
Boidin J, Gilles G (1990) Corticiés s.l. intéressants ou nouveaux pour
la France (Basidiomycotina). Bulletin Trimestrel de la Société
Mycologique de France 106: 135–167.
Bresadola G (1892) Fungi Tridentini II. Ed. J. Zippei. Italia.
Bresadola G (1920) Selecta mycologica. Annales Mycologici 18:
26–70.
Cochrane G, Karsch-Mizrachi I, Nakamura Y (2010) The International
Nucleotide Sequence Database Collaboration. Nucleic Acids
Research 39: D15–18.
Cunningham GH (1963) The Telephoraceae of Australia and New
Zealand. New Zealand Department of Scientific and Industrial
Research Bulletin 145: 1–359.
Farris JS (1989) The retention index and the rescaled consistency
index. Cladistics 5: 417–419.
Felsenstein J (1985) Confidence limits on phylogenies: an approach
using the bootstrap. Evolution 39: 783–791.
Gardes M, Bruns TD (1993) ITS primers with enhanced specifity for
basidiomycetes –application to the identification of mycorrhizae
and rusts. Molecular Ecology 2: 113–118.
Gilbertson RL, Desjardin DE, Rogers JD, Hemmes DE (2001) Fungi
from Mamane –Naio vegetation zone from Hawaii. Fungal
Diversity 6: 35–69.
Ginns J, Lefebvre MNL (1993) Lignicolous Corticioid Fungi
(Basidiomycota) of North America. Systematics, Distribution, and
Ecology. Mycologia Memoir 19: 1–247.
Hallenberg N (1981) Synopsis of Wood-Inhabiting Aphyllophorales
(Basidiomycetes) and Heterobasidiomycetes from Iran.
Mycotaxon 12: 473–502.
Hibbett DS, Binder M, Bischoff JF, Blackwell M, Cannon PF, Eriksson
OE, Huhndorf S, James T, Kirk PM, Lücking R, Thorsten
Lumbsch H, Lutzoni F, Brandon Matheny P, McLaughlin DJ,
Powell MJ, Redhead S, Schoch CL, Spatafora JW, Stalpers JA,
Vilgalys R, Aime MC, Aptroot A, Bauer R, Begerow D, Benny
GL, Castlebury LA, Crous PW, Dai Y-C, Gams W, Geiser DM,
Griffith GW, Gueidan C, Hawksworth DL, Hestmark G, Hosaka
K, Humber RA, Hyde KD, Ironside JE, Kõljalg U, Kurtzman CP,
Larsson K-H, Lichtwardt R, Longcore J, Miądlikowska J, Miller A,
Moncalvo J-M, Mozley-Standridge S, Oberwinkler F, Parmasto E,
Reeb V, Rogers JD, Roux C, Ryvarden L, Sampaio JP, Schüßler
A, Sugiyama J, Thorn RG, Tibell L, Untereiner WA, Walker C,
Wang Z, Weir A, Weiss M, White MM, Winka K, Yao Y-J, Zhang
N (2007) A higher-level phylogenetic classification of the Fungi.
Mycological Research 111: 509–547.
Hjortstam K (2001) Two new species of Brevicellicium and a survey of
tropical and subtropical species in the genus (Basidiomycotina,
Aphyllophorales). Mycotaxon 79: 181–187.
Hjortstam K, Larsson K-H (1978) Notes on Corticiaceae
(Basidiomycetes) II. Mycotaxon 7: 117–124.
Hjortstam K, Larsson K-H, Ryvarden L (1988) The Corticiaceae of
North Europe. Vol. 8. Fungiflora. Norway.
Hjortstam K, Ryvarden L (1980) Studies in Tropical Corticiaceae
(Basidiomycetes) II. Mycotaxon 12: 168–184.
Hjortstam K, Ryvarden L (1997) Corticioid species (Basidiomycotina,
Aphyllophorales) from Colombia collected by Leif Ryvarden.
Mycotaxon 64: 229–241.
Hjortstam K, Ryvarden L (2007) Studies in corticioid fungi from
Venezuela III (Basidiomycotina, Aphyllophorales). Synopsis
Fungorum 23: 56–107.
Hjortstam K, Ryvarden L (2008) Some corticioid fungi
(Basidiomycotina) from Ecuador. Synopsis Fungorum 25: 14–27.
Hjortstam K, Ryvarden L, Iturriaga T (2005) Studies in corticioid fungi
from Venezuela II (Basidiomycotina, Aphyllophorales). Synopsis
Fungorum 20: 42–78.
Huelsenbeck JP, Ronquist F, Nielsen R, Bollback JP (2001) Bayesian
inference of phylogeny and its impact on evolutionary biology.
Science 294: 2310–2314.
Jackson HS (1950) Studies of Canadian Thelephoraceae. VII. Some
new species of Corticium sect. Athele. Canadian Journal of
Research, Sect C, Botanical Sciences 28: 716–725.
Jülich W (1982) Higher Taxa of Basidiomycetes. Bibliotheca
Mycologica 85: 1–485.
Kluge AG, Farris JS. 1969. Quantitative phyletics and the evolution of
anurans. Systematic Zoology 18: 1–32.
Larget B, Simon DL (1999) Markov chain Monte Carlo algorithms for
the Bayesian analysis of phylogenetic trees. Molecular Biology
and Evolution 16: 750–759.
ARTICLE
volume 4 · no. 1
27

Telleria et al.
ARTICLE
Larsson K-H (2007) Re-thinking the classification of corticioid fungi.
Mycological Research 111: 1040–1063.
Larsson K-H, Larsson E, Kõljalg U (2004) High phylogenetic diversity
among corticioid homobasidiomycetes. Mycological Research
108: 983–1002.
Maekawa N (1993) Taxonomic study of Japanese Corticiaceae
(Aphyllophorales) I. Report of the Tottori Mycological Institute 31:
1–149.
Martín MP, Winka K (2000) Alternative methods of extracting and
amplifying DNA from lichens. Lichenologist 32: 189–196.
Nylander JAA (2004) MrModeltest v. 2. Program distributed by the
author. Uppsala: Evolutionary Biology Center, Uppsala University.
Page RDM (1996) TreeView, an application to display phylogenetic
trees on personal computers. Computer Applications in the
Biosciences 12: 357–358.
Rambaut A (2002) Se-Al: sequences alignment editor v. 2.0a11.
Edinburgh: Institute of Evolutionary Biology. http: //tree.bio.ed.ac.
uk/software/
Rehner SA, Samuels GJ (1994) Taxonomy and phylogeny of
Gliocladium analyzed from nuclear large subunit ribosomal DNA
sequences. Mycological Research 98: 625-634.
Rodríguez F, Oliver JF, Martín A, Medina JR (1990) The general
stochastic model of nucleotide substitution. Journal of Theoretical
Biology 142: 485–501.
Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic
inference under mixed models. Bioinformatics 19: 1572–1574.
Ryvarden L (1976) Studies in the Aphyllophorales of the Canary
Islands. 3. Some species from the western islands. Cuadernos
de Botánica Canaria 20: 3–8.
Swofford DL (2003) PAUP* : phylogenetic analysis using parsimony
(*and other methods). Version 4. Sinauer Associates, Sunderland,
Massachusetts. USA.
Telleria MT, Melo I (1995) Aphyllophorales resupinatae non poroides,
I. Acanthobasidium – Cystostereum. Flora Mycologica Iberica 1:
1–223.
Telleria MT, Melo I, Dueñas M (1993) Aphyllophorales (Basidiomycetes)
of the National Park of “Ordesa y Monte Perdido”
(Spain). Nova Hedwigia 57: 207–217.
Telleria MT, Melo I, Dueñas M, Rodríguez-Armas JL, Beltrán-Tejera E,
Cardoso J, Salcedo I (2009a) Diversity and richness of corticioid
fungi (Basidiomycota) on Azores Islands: a preliminary survey.
Nova Hedwigia 88: 285–308.
Telleria MT, Melo I, Dueñas M, Salcedo I, Cardoso J, Rodríguez-Armas
JL, Beltrán-Tejera E (2009b) Corticioid fungi (Basidiomycota) from
Azores Islands: Flores and São Miguel. Mycotaxon 109: 141–144.
Vilgalys R, Hester M (1990) Rapid genetic identification and
mapping of enzymatically amplified ribosomal DNA from several
Cryptococcus species. Journal of Bacteriology 172: 4238–4246.
White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics.
In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds), PCR
protocols: a guide to methods and applications: 315–322. San
Diego: Academic Press.
28 ima fUNGUS

doi:10.5598/imafungus.2013.04.01.04
IMA Fungus · volume 4 · no 1: 29–40
Microbotryum silenes-saxifragae sp. nov. sporulating in the
anthers of Silene saxifraga in southern European mountains
Marcin Piątek 1 , Matthias Lutz 2 , and Martin Kemler 3
1
Department of Mycology, W. Szafer Institute of Botany, Polish Academy of Sciences, Lubicz 46, PL-31-512 Kraków, Poland; corresponding
author e-mail: m.piatek@botany.pl
2
Evolutionäre Ökologie der Pflanzen, Institut für Evolution und Ökologie, University of Tübingen, Auf der Morgenstelle 1, D-72076 Tübingen,
Germany
3
Centre of Excellence in Tree Health Biotechnology, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria
0002, South Africa
ARTICLE
Abstract: Currently, the monophyletic lineage of anther smuts on Caryophyllaceae includes 22
species classified in the genus Microbotryum. They are model organisms studied in many disciplines
of fungal biology. A molecular phylogenetic approach was used to resolve species boundaries within
the caryophyllaceous anther smuts, as species delimitation based solely on phenotypic characters
was problematic. Several cryptic species were found amongst the anther smuts on Caryophyllaceae,
although some morphologically distinct species were discernible, and most species were
characterized by high host-specificity. In this study, anther smut specimens infecting Silene saxifraga
were analysed using rDNA sequences (ITS and LSU) and morphology to resolve their specific status
and to discuss their phylogenetic position within the lineage of caryophyllaceous anther smuts. The
molecular phylogeny revealed that all specimens form a monophyletic lineage that is supported by
the morphological trait of reticulate spores with tuberculate interspaces (observed in certain spores).
This lineage cannot be attributed to any of the previously described species, and the anther smut on
Silene saxifraga is described and illustrated here as a new species, Microbotryum silenes-saxifragae.
This species clusters in a clade that includes Microbotryum species, which infect both closely and
distantly related host plants growing in diverse ecological habitats. It appears possible that host shifts
combined with changes to ecological host niches drove the evolution of Microbotryum species within
this clade.
Key words:
Anther smuts
Caryophyllaceae
Microbotryales
Microbotryum violaceum complex
Molecular phylogenetics
Plant pathogens
Pseudo-cryptic species
Article info: Submitted: 27 January 2013; Accepted: 21 March 2013; Published: 4 April 2013.
Introduction
Plant parasitic fungi sporulating in the anthers of their hosts
evolved independently in several genera/species of two
major phylogenetic basidiomycetous lineages, including the
pucciniomycotinous genera Bauerago (Vánky 1999, 2012)
and Microbotryum (Vánky 1998, 2012, Kemler et al. 2006,
2009), and the ustilaginomycotinous genera Antherospora
(Bauer et al. 2008, Piątek et al. 2011, 2013), Thecaphora
(Roets et al. 2008, 2012, Vánky & Lutz 2007) and Urocystis
(Vánky 2012). The anther smuts of Caryophyllaceae,
commonly referred to as the Microbotryum violaceum
complex, form a monophyletic lineage within the genus
Microbotryum. They are model organisms studied in many
disciplines of fungal biology, for example, ecology (Thrall
et al. 1993), genomics (Hood 2005, Yockteng et al. 2007),
population studies (Lee 1981, Alexander & Antonovics 1995,
Alexander et al. 1996), life cycle studies (Schäfer et al. 2010),
geographic distribution (Hood et al. 2010, Fontaine et al.
2013), phylogeography (Vercken et al. 2010), evolutionary
history (López-Villavicencio et al. 2005, Refrégier et al. 2008),
speciation (Devier et al. 2010, Gladieux et al. 2011), and
phylogeny and systematics (Lutz et al. 2005, 2008, Denchev
et al. 2009, Piątek et al. 2012, Kemler et al. 2013).
The assignment of organisms to the appropriate species
is critically important in every biological discipline, however
challenging as in cases of complexes of morphologically similar
species. Delimitation of species within the Microbotryum
violaceum complex is a good example where morphology
(of spores) alone is inadequate. The vast majority of species
and specimens within this complex have reticulate spores
of similar size, with only a few exceptions from this general
morphological pattern (Vánky 2004, 2012). The oldest
available species name for anther smuts on Caryophyllaceae,
that is, Microbotryum violaceum (syn. Ustilago violacea), has
been usually assigned to morphologically similar specimens
© 2013 International Mycological Association
You are free to share - to copy, distribute and transmit the work, under the following conditions:
Attribution:
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).
Non-commercial: You may not use this work for commercial purposes.
No derivative works: You may not alter, transform, or build upon this work.
For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get
permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.
volume 4 · no. 1 29

Piątek, Lutz & Kemler
ARTICLE
on diverse host plants worldwide. However, cross infection
experiments (Zillig 1921a, Liro 1924) and molecular analyses
(Bucheli et al. 2000, Freeman et al. 2002, Le Gac et al. 2007)
have indicated that many of such specimens are biologically
and genetically distinct.
In order to break the limitation of phenotype-based
species identification, Lutz et al. (2005) provided a robust
phylogenetic framework for species delimitation based on the
nuclear ribosomal ITS region, which recently was proposed
as barcode marker for Fungi (Schoch et al. 2012). ITS well
resolves species boundaries in the Microbotryum violaceum
complex, and the obtained resolution agrees well with that
obtained with other phylogenetic markers (ß-tub, g-tub,
Ef1a, pheromone receptors pr-MatA1, pr-MatA2) (Le Gac
et al. 2007, Refrégier et al. 2008, Devier et al. 2010). This
phylogenetic framework has subsequently been improved
by adding further species and specimens from diverse host
plants and incorporating the nuclear LSU rDNA, combined
with the ITS, as an additional phylogenetic marker (Lutz
et al. 2008, Piątek et al. 2012). The resultant molecular
phylogeny and genetic divergences between specimens on
different hosts, together with ecological and, if available,
morphological data confirm that multiple species are hidden
within the Microbotryum violaceum morphotype, with most
specific to single host species. ITS and LSU sequences are
available for 18 out of 22 recognized Microbotryum species
in the anthers of caryophyllaceous plants. One species
(Microbotryum savilei) is not sequenced yet, and for three
species (M. carthusianorum, M. coronariae, M. dianthorum s.
str.) sequences are available for some nuclear DNA regions
(ß-tub, g-tub, Ef1a, ITS, pheromone receptors pr-MatA1, pr-
MatA2) (Lutz et al. 2005, Le Gac et al. 2007, Refrégier et al.
2008, Denchev et al. 2009, Devier et al. 2010, Kemler et al.
2013), but not for the LSU. Microbotryum violaceum s. str.
is currently restricted to Silene nutans and its taxonomy is
stabilized by the sequenced neotype specimen (ITS and LSU)
from material collected in Germany (Lutz et al. 2008). It is likely
that many undescribed species of anther smuts remain to be
discovered amongst the large number of specimens reported
from different hosts worldwide, especially considering that
anther smuts from 108 different caryophyllaceous hosts listed
in recent smut world monograph (Vánky 2012) are still not
analysed with molecular methods. The re-collection of fresh
materials is desirable since many of herbarium materials are
too old for effective isolation of DNA.
The anther smut on Silene saxifraga (incl. S. hayekiana,
Tutin et al. 1993) reported from several European countries
(Zillig 1921b, Zundel 1953, Scholz & Scholz 1988, Vánky
1994, 2012, Almaraz & Durrieu 1997, Zwetko & Blanz 2004,
Lutz & Vánky 2009, as Microbotryum violaceum, M. violaceum
s. l. or Ustilago violacea) is a putative distinct species. In the
molecular studies of Lutz et al. (2005, 2008), the sequences
from two specimens of the anther smut on Silene saxifraga
(as S. saxifraga subsp. hayekiana) clustered together in
a sister position to the lineage containing Microbotryum
silenes-inflatae on Silene maritima and S. vulgaris, and M.
aff. violaceum on Lychnis flos-cuculi (as S. flos-cuculi) and
S. dioica, the latter smut now referred to as M. coronariae.
The limited number of samples was the main reason why the
new species for the anther smut on Silene saxifraga was not
described at that time. Additionally, only LM morphology was
assessed, and SEM studies were not conducted for these
two specimens.
The present study aims to resolve the specific status
of the anther smut on Silene saxifraga using molecular
phylogenetic analyses of concatenated ITS + LSU rDNA
sequences as well as light and scanning electron microscope
examination of specimens from several populations. A
further aim is to discuss the phylogenetic position of the
anther smut on Silene saxifraga within the lineage of anther
smuts on Caryophyllaceae, and to expand the number of
ITS and LSU sequences available for genetic analyses and
comparisons.
Materials and methods
Host plant nomenclature, specimen sampling
and documentation
In accordance with Tutin et al. (1993), and supported by
molecular phylogenetic data (Kemler et al. 2013), the host
species names Silene saxifraga and S. hayekiana are
accepted as single species Silene saxifraga. All examined
host plant specimens were assigned to this species.
This study is based on phylogenetical and/or
morphological analyses of specimens of Microbotryum sp.
on Silene saxifraga originating from nine populations in three
main European high mountain ranges, namely the Alps,
the Dinaric Alps, and the Pyrenees. Six specimens were
freshly collected in the field, three were received from fungal
herbaria, and three were found by screening the sheets
with Silene saxifraga (eight sheets labelled as S. hayekiana
– none infected, 40 sheets labelled as S. saxifraga – three
infected) preserved in the phanerogamic Herbarium of the
W. Szafer Institute of Botany, Polish Academy of Sciences,
Kraków, Poland (KRAM). Additionally, the LSU and ITS
+ LSU, respectively, of two specimens of Microbotryum
coronariae on Lychnis flos-cuculi were newly sequenced for
phylogenetic analyses. The voucher specimens are deposited
in KR-M, KRAM, KRAM F, TUB, and H.U.V. (Table 1). The
latter abbreviation refers to the personal collection of Kálmán
Vánky, “Herbarium Ustilaginales Vánky” currently held at his
home (Gabriel-Biel-Straße 5, D-72076 Tübingen, Germany).
Nomenclatural novelty was registered in MycoBank (www.
MycoBank.org, Crous et al. 2004). The genetype concept
follows the proposal of Chakrabarty (2010).
Morphological examination
Dried fungal spores of the investigated specimens were
mounted in lactic acid, heated to boiling point, and then
examined under a Nikon Eclipse 80i light microscope at a
magnification of ×1000, using Nomarski optics (DIC). Spores
were measured using NIS-Elements BR 3.0 imaging software.
The extreme measurements were adjusted to the nearest 0.5
µm. The spore size range, mean and standard deviation of
50 spore measurements from each specimen are shown in
Table 1. The species description includes combined values
from all measured specimens. LM micrographs were taken
with a Nikon DS-Fi1 camera. The infected anthers of Silene
saxifraga (KRAM F-49440), and the spore ornamentation in
30 ima fUNGUS

Microbotryum silenes-saxifragae sp. nov.
specimens from different populations (H.U.V. 19570, KR-M-
23890, KRAM 1760, KRAM F-49439, 49440, TUB 11790)
were analysed using scanning electron microscopy (SEM).
For this purpose, infected anthers and dry spores were
mounted on carbon tabs and fixed to an aluminium stub with
double-sided transparent tape. The tabs were sputter-coated
with carbon using a Cressington sputter-coater and viewed with
a Hitachi S-4700 scanning electron microscope, with a working
distance of ca. 12 mm. SEM micrographs were taken in the
Laboratory of Field Emission Scanning Electron Microscopy
and Microanalysis at the Institute of Geological Sciences,
Jagiellonian University, Kraków (Poland).
DNA extraction, PCR, and sequencing
The methods of isolation of fungal material, DNA extraction,
amplification of the ITS 1 and ITS 2 regions of the rDNA
including the 5.8S rDNA (ITS, about 690 bp) and the 5’-end
of the nuclear large subunit ribosomal DNA (LSU, about
625 bp), purification of PCR products, sequencing, and
processing of the raw data followed Lutz et al. (2004) and
Piątek et al. (2012). DNA sequences determined for this study
were deposited in GenBank. GenBank accession numbers
are given in Table 1 and Fig. 1.
Phylogenetic analyses
The Microbotryum specimens examined in this study are
listed in Table 1. To elucidate the phylogenetic position
of the Microbotryum specimens on Silene saxifraga their
concatenated ITS + LSU sequences were analysed within
a dataset that covered all caryophyllaceous anther smut
species of which ITS and LSU sequences were available
(Freeman et al. 2002, Lutz et al. 2005, 2008, Hood et al. 2010,
Sloan et al. 2008, Piątek et al. 2012) or that were sequenced
in the present study (Microbotryum coronariae, Table 1),
comprising 19 of the 22 currently recognized species. For
the final analysis the dataset was reduced to a maximum
of two sequences per species. All sequences available in
GenBank that clustered both within the Microbotryum sp. on
Silene saxifraga clade and its sister clade (M. coronariae,
M. silenes-inflatae) and which could not be assigned to any
Microbotryum species (compare Fig. 1) were kept.
Sequence alignment was obtained using MAFFT
6.845b (Katoh et al. 2002, Katoh & Toh 2008) and the
L-INS-I option. In the final alignment we retained conserved
alignment positions using GBlocks (Castresana 2000) with
the following options: ‘Minimum Number of Sequences for a
Conserved Position’: 25, ‘Minimum Number of Sequences for
a Flank Position’: 25, ‘Maximum Number of Contiguous Nonconserved
Positions’: 8, ‘Minimum Length of a Block’: 5 and
‘Allowed Gap Positions’ to ‘With half’.
The resulting alignment [new number of positions: 1276
(57% of the original 2232 positions) variable sites: 212]
was used for phylogenetic analyses. Bayesian Analysis
(BA) was performed using MrBayes 3.1.2 (Huelsenbeck &
Ronquist 2001, Ronquist & Huelsenbeck 2003) applying the
same settings as in Piątek et al. (2012). Four incrementally
heated chains were run for 10,000,000 generations, sampled
every 100 th generation, thereby resulting in 100,001 trees
of which the first 25,001 sampled trees were discarded.
Maximum Likelihood (ML) was performed using RAxML 7.2.6
(Stamatakis 2006) via the raxmlGUI (Silvestro & Michalak
2012). We used the GTRGAMMA and rapid bootstrap option
(Stamatakis et al. 2008). Trees were rooted with Microbotryum
scabiosae following Kemler et al. (2006).
Results
Morphology
The specimens on Silene saxifraga developed sori in all
anthers of an inflorescence and within a plant clump most (but
not all) flowers contained anthers with smut spores (Fig. 2).
The smut sporulated inside the pollen sacs, which at first were
completely covered by the anther’s epidermis and later split
longitudinally by the stomia revealing a dark brownish violet,
powdery mass of spores. Pollen was not produced by infected
anthers (Fig. 2). The spores in all specimens were reticulate
under the light microscope, regular in shape and uniform in size
within each collection, and highly uniform in shape, size range
and average size between different collections (Fig. 3, Table
1). In scanning electron microscope, the spores were reticulate
with variably ornamented interspaces. The interspaces usually
ranged from almost smooth to rough or verruculose, but certain
spores had more or less well-developed tuberculate warts
on the interspaces or lower parts of the muri (Figs 3–4). The
spores with tuberculate warts constituted a small but regular
fraction of spores. Tuberculate warts were most apparent in
the material from Kanzianiberg (Austria) that is designated
here as holotype of the new species.
Phylogenetic analyses
For both the ITS and LSU, the sequences of the Silene
saxifraga anther smut specimen from Montenegro (KRAM
F-49440) differed in one position from the remaining
sequences, which were identical among each other.
The different runs of the BA that were performed and the
ML analyses yielded consistent topologies. To illustrate the
results, the consensus tree of one run of the BA is presented
(Fig. 1).
In all analyses, the known species were inferred with high
support values except for Microbotryum dianthorum s. l.,
for which the sequences clustered in two different lineages.
With high to moderate support in all analyses the sequences
of anther smut specimens on Silene saxifraga clustered
together, forming the sister lineage to Microbotryum sp.
on S. campanula. That clade formed a monophylum with
M. coronariae, M. silenes-inflatae, M. sp. on S. ciliata, and
M. violaceum s. str. However the phylogenetic relations
between those taxa received only low support values. Within
the cluster of anther smut on Silene saxifraga, the specimen
from Montenegro (KRAM F-49440) was revealed in a sister
position to the remaining S. saxifraga anther smut specimens,
which were identical among each other.
Considering groups that received considerable support
in all analyses the phylogenetic relationships between the
species inferred here were in contrast to the results discussed
by Piątek et al. (2012) in two aspects: Microbotryum violaceoverrucosum
clustered as sister taxon to M. heliospermae and
M. lagerheimii, and M. saponariae was revealed as sister
taxon to the Dianthus and Petrorhagia anther smuts.
ARTICLE
volume 4 · no. 1
31

Piątek, Lutz & Kemler
ARTICLE
Table 1. List of examined Microbotryum specimens, with host plants, GenBank accession numbers, spore size range, mean spore sizes with
standard deviation and reference specimens.
Species Host plants GenBank acc. no. Spore size range
(µm)
Microbotryum coronariae Lychnis flos-cuculi ITS: KC684887
LSU: KC684886
Mean spore size
with standard
deviation (µm)
Reference specimens 1
Not analysed Not analysed Germany, Bayern, Allgäu,
Ks. Oberallgäu, Oberjoch,
Kematsriedmoos, Westteil, ca.
1150 m a.s.l., 25 Jun. 2008, M.
Scholler, KR-M-23797
Microbotryum coronariae Lychnis flos-cuculi 2
ITS: AY877417
LSU: KC684885
Not analysed Not analysed Norway, Kristiansund, Farstad, 14
Aug. 2002, M. Lutz, TUB 012115
Microbotryum silenessaxifragae
Microbotryum silenessaxifragae
Microbotryum silenessaxifragae
Microbotryum silenessaxifragae
Microbotryum silenessaxifragae
Silene saxifraga – 6.5–9.5(–10.5) ×
6.0–8.5
Silene saxifraga
Silene saxifraga
Silene saxifraga
ITS: AY588102
LSU: JN000077
ITS: JN000073
LSU: JN000079
ITS: JN000071
LSU: JN000075
5.5–8.5(–9.5) ×
5.0–6.5(–7.0)
7.6 ± 0.9 × 7.1 ±
0.6
6.7 ± 0.8 × 6.0 ±
0.5
5.0–8.5 × 5.0–8.0 6.7 ± 0.8 × 6.2 ±
0.6
5.0–8.0(–9.0) ×
(4.5–)5.0–7.5
Silene saxifraga – (5.5–)6.0–7.5(–8.5)
× 5.0–7.5
6.6 ± 0.8 × 6.1 ±
0.8
6.8 ± 0.6 × 6.2 ±
0.6
Austria, Carinthia, Karawanken,
7 km WSW of Bad Eisenkappel,
Trögern valley, 22 Jul. 1962, H.
Teppner, KR-M-34470 (Dupla
Graecensia Fungorum 237)
Austria, Carinthia, Villach,
Finkenstein, Kanzianiberg, 18 Jun.
2003, M. Lutz, TUB 11791
Austria, Carinthia, Villach,
Finkenstein, nort of Kanzianiberg,
7 Jul. 2005, M. Lutz, KR-M-23889
Austria, Carinthia, Villach,
Finkenstein, southern part of the
Kanzianiberg, near the church, 24
Jun. 2006, M. Lutz, KR-M-23890
– holotype
France, Central Pyrenees, rocks
between Gavarnie village and
Cirque de Gavarnie, 11 Jul. 1961,
S. Batko, KRAM 1762
Microbotryum silenessaxifragae
Silene saxifraga
ITS: JN000074
LSU: JN000078
5.5–7.5 × 5.0–6.5
(–7.0)
6.4 ± 0.5 × 5.8 ±
0.5
Germany, Baden-Württemberg,
Tübingen, Botanical Garden,
cultivated (originating from
Slovenia, Bovec, Vas na Skali, 17
Jul. 1994), 11 Jun. 1999, C. Vánky
& K. Vánky, H.U.V. 19570
Microbotryum silenessaxifragae
Microbotryum silenessaxifragae
Microbotryum silenessaxifragae
Microbotryum silenessaxifragae
Microbotryum silenessaxifragae
Microbotryum silenessaxifragae
Silene saxifraga – 6.0–7.5 × 5.5–7.5 6.7 ± 0.4 × 6.3 ±
0.5
Silene saxifraga – 6.5–8.5(–9.5) ×
6.0–8.0
Silene saxifraga – 6.0–8.0(–8.5) ×
6.0–7.5
Silene saxifraga
ITS: JN000072
LSU: JN000080
6.0–8.5(–9.5) ×
5.5–8.5(–9.0)
Silene saxifraga – 6.5–8.5(–9.5) ×
(5.5–)6.0–7.5(–9.0)
Silene saxifraga
ITS: AY588101
LSU: JN000076
7.4 ± 0.7 × 6.9 ±
0.5
7.0 ± 0.5 × 6.5 ±
0.5
7.0 ± 0.8 × 6.5 ±
0.8
7.3 ± 0.7 × 6.8 ±
0.6
5.5–7.5 × (4.5–)5.0– 6.7 ± 0.5 × 6.2 ±
6.5(–7.0)
0.5
Germany, Baden-Württemberg,
Tübingen, Botanical Garden,
cultivated (originating from
Slovenia, Bovec, Vas na Skali, 17
Jul. 1994), 24 May 2011, M. Lutz,
KRAM F-49439
Italy, Tridentum, Doss Trento, 25
May 1893, Evers, KRAM 1760
Italy, Alpi Maritime, Valle de
Gosso, 7 Jun. 1992, M. Schubert,
KR-M-23949
Montenegro, Dinaric Alps,
Durmitor Mts, along trail Sedlo-
Bobotov Kuk, Surutka valley,
10 Aug. 2009, A. Ronikier & M.
Ronikier, KRAM F-49440
Slovenia, Carniola,
“Schibeneggergraben bei
Ratschach”, 3 Jun. 1885, J.C.
Eques Pittoni a Dannenfeldt,
KRAM 108297
Slovenia, Bovec, Trenta, Juliana
Alpine Botanical Garden,
cultivated, 7 Aug. 2001, D.
Begerow & M. Lutz, TUB 11790
32 ima fUNGUS

Microbotryum silenes-saxifragae sp. nov.
M. silenes-saxifragae on S. saxifraga JN000074/JN000078
90/75
81/88
90/83
M. silenes-saxifragae on S. saxifraga JN000073/JN000079
M. silenes-saxifragae on S. saxifraga AY588101/JN000076
M. silenes-saxifragae on S. saxifraga AY588102/JN000077
M. silenes-saxifragae on S. saxifraga JN000071/JN000075
M. silenes-saxifragae on S. saxifraga JN000072/JN000080
97/99
62/- M. sp. on S. campanula JN942212/JN939377
M. coronariae on Lychnis flos-cuculi KC684887/KC684886
92/- M. coronariae on Lychnis flos-cuculi AY877417/KC684885
100/100 M. silenes-inflatae on S. vulgaris AY588105/DQ366884
97/79
M. silenes-inflatae on S. vulgaris AY588106/DQ366879
71/-
M. sp. on S. ciliata AF038833
81/96
M. violaceum s.str. on S. nutans DQ640065/DQ640070
100/99
100/77
98/82
M. violaceum s.str. on S. nutans DQ640071/DQ640069
M. lychnidis-dioicae on S. latifolia ssp. alba AY588096/DQ366886
M. lychnidis-dioicae on S. latifolia ssp. alba AY588097/DQ366865
91/97
M. silenes-dioicae on S. dioica AY877416/DQ366868
69/-
100/98
M. silenes-dioicae on S. dioica AY588094/DQ366859
51/-
M. minuartiae on Minuartia recurva DQ366853/DQ366862
50/ M. minuartiae on Minuartia recurva DQ366852/DQ366863
- M. bardanense on S. moorcroftiana DQ366856/DQ366877
59/ M. violaceo-irregulare on S. vulgaris AY588104/DQ366875
60
100/ M. chloranthae-verrucosum on S. chlorantha AY877421/DQ366883
52/- 100 M. chloranthae-verrucosum on S. chlorantha AY877404/DQ366878
100/
91
100/87
84/54
99/62
100/
100
96/83
100/
91
M. majus on S. otites AY877419/DQ366858
M. majus on S. otites AY877418/EF621986
M. silenes-acaulis on S. acaulis DQ366846/DQ366870
M. silenes-acaulis on S. acaulis DQ366854/DQ366888
M. adenopetalae on S. adenopetala DQ366848/DQ366876
98/79 M. shykoffianum on D. sylvestris AY588082/DQ366857
57/72 M. shykoffianum on D. carthusianorum AY588079/DQ366889
100/100 M. dianthorum s.l. on D. monspessulanus AY588080/DQ366871
100/100
M. superbum on D. superbus AY588081/DQ366867
M. dianthorum s.l. on Petrorhagia saxifraga DQ366845/DQ366866
98/88 M. dianthorum s.l. on D. jacquemontii DQ366844/DQ366869
100/
100
100/100
96/77
87/
88
M. saponariae on Saponaria officinalis AY588089/DQ366887
M. saponariae on Saponaria pumila AY588091/DQ366864
M. heliospermae on Heliosperma pusillum HQ832084/HQ832085
M. heliospermae on Heliosperma pusillum HQ832082/HQ832083
M. lagerheimii s.str. on Viscaria vulgaris AY877413/AY512864
M. lagerheimii s.l. on Atocion rupestre HQ832090/HQ832091
100/100
M. violaceo-verrucosum on S. viscosa AY588103/DQ366882
M. violaceo-verrucosum on S. italica AF045874/-
100/ M. stellariae on Stellaria graminea AY588108/DQ366873
100 M. stellariae on Stellaria graminea AY588109/DQ366872
100/100 M. sp. on S. virginica AY014235/-
M. sp. on S. caroliniana ssp. caroliniana AY014239/-
M. scabiosae AY588083/DQ366861
1 substitution/site
ARTICLE
Fig. 1. Bayesian inference of phylogenetic relationships between the sampled Microbotryum species: Markov chain Monte Carlo analysis of an
alignment of concatenated ITS + LSU base sequences using the GTR+I+G model of DNA substitution with gamma distributed substitution rates and
estimation of invariant sites, random starting trees and default starting parameters of the DNA substitution model. A 50% majority-rule consensus
tree is shown computed from 75 000 trees that were sampled after the process had reached stationarity. The topology was rooted with Microbotryum
scabiosae. Bold branches indicate support values higher than 80 in all analyses. Numbers on branches before slashes are estimates for a posteriori
probabilities; numbers on branches after slashes are ML bootstrap support values. Branch lengths were averaged over the sampled trees. They are
scaled in terms of expected numbers of nucleotide substitutions per site. D. = Dianthus, M. = Microbotryum, S. = Silene.
1
H.U.V. – Herbarium Ustilaginales Vánky, Gabriel-Biel-Str. 5, D-72076 Tübingen, Germany; KR-M – Mycological Herbarium of the Staatliches
Museum für Naturkunde Karlsruhe, Germany; KRAM – Phanerogamic Herbarium of the W. Szafer Institute of Botany, Polish Academy of
Sciences, Kraków, Poland; KRAM F – Mycological Herbarium of the W. Szafer Institute of Botany, Polish Academy of Sciences, Kraków, Poland;
TUB – Herbarium of the Eberhard-Karls-Universität Tübingen, Germany.
2
Taken from Lutz et al. (2005).
volume 4 · no. 1
33

Piątek, Lutz & Kemler
ARTICLE
Taxonomy
Microbotryum silenes-saxifragae M. Lutz, M. Piątek
& Kemler, sp. nov.
MycoBank MB800823
(Figs 2–4)
Etymology: The name of the species refers to the host plant
species, Silene saxifraga.
Description: Parasitic on Silene saxifraga. Sori in anthers;
all anthers of the inflorescence infected, and most flowers
in a clump contain smut spores; spore mass powdery,
dark brownish violet. Spores pale violaceous or violaceous
in transmitted light, regular in shape and size, globose,
subglobose, broadly ellipsoidal, or rarely ovoid, 5.0–8.5
(–10.5) × (4.5–)5.0–7.5(–9.0) µm; wall reticulate, ca. 0.5–0.7
µm high, meshes more or less polyhedral, usually irregular,
rarely regular, 5–8 (usually 6–7) meshes per spore diameter,
interspaces usually smooth as observed by LM (sometimes
weak tubercles are visible at very high magnification using
Nomarski optics), almost smooth, rough, verruculose or
tuberculate as observed by SEM.
Type: Austria: Carinthia: Villach, Finkenstein, southern part
of the Kanzianiberg, near the church, [630 m a.s.l.], on Silene
saxifraga, 24 June 2006, M. Lutz (KR-M-23890 – holotype).
The ITS/LSU hologenetype sequences are deposited in
GenBank as JN000071/JN000075, respectively.
France, Germany, Italy, Montenegro, Slovenia). The localities
in Austria, Italy and Slovenia are placed in the Alps, the locality
in France in the Pyrenees and the locality in Montenegro in
the Dinaric Alps. The locality in Germany is artificial as plants
were cultivated.
Ecology: The infected plants were found from May to August in
the natural localities, in May and June cultivated in the Botanical
Garden in Tübingen (Germany), and in August cultivated in
the Juliana Alpine Botanical Garden in Trenta (Slovenia). At
the type locality, the Kanzianiberg (Austria), large populations
of infected plants were observed between 2003 and 2006
in different places on the limestone hill. In other localities for
which data on the habitat are available, Microbotryum silenessaxifragae
occurred on plants growing on rocks, together with
Rhamnus pumila (France: between Gavarnie and Cirque de
Gavarnie), between limestone rocks (Austria: Karawanken)
and on grassland (Montenegro: Surutka valley). Altitude data
were available for few of the examined specimens, and the
approximate altitude data (included in square brackets in
the list of specimens examined) for most of the remaining
specimens were obtained through Google Earth (google.
earth.com). The lowest locality was recorded at 300 m a.s.l.,
and the highest locality at 2090 m a.s.l., which indicates that
Microbotryum silenes-saxifragae is a submontane-montane
species with wide altitudinal amplitude.
Discussion
Additional specimens examined (paratypes): Austria: Carinthia:
Karawanken, 7 km WSW of Bad Eisenkappel, Trögern valley, 700–800
m a.s.l., on Silene saxifraga, 22 July 1962, H. Teppner (KR-M-34470,
Dupla Graecensia Fungorum 237); Villach, Finkenstein, Kanzianiberg,
[630 m a.s.l.], on Silene saxifraga, 18 June 2003, M. Lutz (TUB
11791); Villach, Finkenstein, north of Kanzianiberg, [630 m a.s.l.], on
Silene saxifraga, 7 July 2005, M. Lutz (KR-M-23889); France: Central
Pyrenees: rocks between Gavarnie village and Cirque de Gavarnie,
[between 1400 and 1600 m a.s.l.], on Silene saxifraga, 11 July 1961,
S. Batko (KRAM 1762). – Germany: Baden-Württemberg: Tübingen,
Botanical Garden (originating from Slovenia, Bovec, Vas na Skali, 17
July 1994), [440 m a.s.l.], on cultivated Silene saxifraga, 11 June 1999,
C. Vánky & K. Vánky (H.U.V. 19570); Tübingen, Botanical Garden
(originating from Slovenia, Bovec, Vas na Skali, 17 July 1994), [440
m a.s.l.], on cultivated Silene saxifraga, 24 May 2011, M. Lutz (KRAM
F-49439). – Italy: Tridentum: Doss Trento, [300 m a.s.l.], on Silene
saxifraga, 25 May 1893, Evers (KRAM 1760); Alpi Maritime: Valle de
Gosso, [? – site not located in Google Earth], on Silene saxifraga, 7
June 1992, M. Schubert (KR-M-23949). – Montenegro: Dinaric Alps:
Durmitor Mts, along trail Sedlo-Bobotov Kuk, Surutka valley, ca. 2090
m a.s.l., on Silene saxifraga, 10 August 2009, A. Ronikier & M. Ronikier
(KRAM F-49440). – Slovenia: Carniola: “Schibeneggergraben bei
Ratschach”, [Ratschach - 870 m a.s.l., Schibeneggergraben not
located in Google Earth], on Silene saxifraga, 3 June 1885, J.C. Eques
Pittoni a Dannenfeldt (KRAM 108297); Bovec, Trenta, Juliana Alpine
Botanical Garden, [600 m a.s.l.], on cultivated Silene saxifraga, 7
August 2001, D. Begerow & M. Lutz (TUB 11790).
Host range and distribution: On Silene saxifraga
(Caryophyllaceae subfam. Silenoideae); Europe (Austria,
Silene saxifraga is widely distributed on rocks and screes
in southern European mountains, extending northwards to
West Austria (Tutin et al. 1993). The anther smut of Silene
saxifraga, although reported in the literature and referred to
the catch-all name Microbotryum violaceum (syn. Ustilago
violacea), is poorly known and has never been critically
examined using samples from different populations. In this
study, molecular phylogenetic analyses and morphological
data were used to resolve the systematic position of the
anther smut on Silene saxifraga.
The phylogenetic analyses of the concatenated ITS +
LSU dataset showed that the analysed specimens on Silene
saxifraga from three geographically distinct populations
(Austria, Slovenia, and Montenegro; the German specimen
derived from a Slovenian population) form a well supported
independent evolutionary lineage of caryophyllaceous anther
smuts. The genetic divergence of the lineage is comparable
to genetic distances between the remaining anther smuts
on caryophyllaceous hosts (Lutz et al. 2005, 2008, Piątek
et al. 2012) or between Microbotryum species on noncaryophyllaceous
hosts (Kemler et al. 2006, 2009). Within
this lineage, the anther smut specimen on Silene saxifraga
from Montenegro (Dinaric Alps) revealed some sequence
divergence in comparison to the specimens from populations
in Austria and Slovenia (Alps). A similar phylogeographic split
between specimen from the Alps and specimens from the
Carpathians and the Dinaric Alps has been observed in another
montane species, namely Microbotryum heliospermae, a
parasite on Heliosperma pusillum (Piątek et al. 2012). This is
congruent with a similar phylogeographical pattern observed in
34 ima fUNGUS

Microbotryum silenes-saxifragae sp. nov.
ARTICLE
Fig. 2. Microbotryum silenes-saxifragae sp. nov. on Silene saxifraga. A. The type locality at the Kanzianiberg, Austria. B. The clump of Silene
saxifraga with infected flowers in the Botanical Garden of Tübingen, Germany. C–E. Infected inflorescences, with the fungus sporulating in the
anthers in the Botanical Garden of Tübingen, Germany. F. Infected anther: an open pollen sac filled with teliospores seen at the foreground,
made in SEM (KRAM F-49440). G. Teliospores inside the pollen sac and the anther’s epidermis, seen by SEM. (KRAM F-49440). Bars: C–E =
5 mm, F = 500 µm, G = 50 µm.
several vascular plant species (Ronikier 2011). It may indicate
long-term separation and different evolutionary histories of
populations in the Alps and the Dinaric Alps (and South-East
European mountains in general).
The closest phylogenetic relative of the analysed anther
smut specimens on Silene saxifraga may be the anther smut
on Silene campanula assigned by Schoch et al. (2012) to
Microbotryum violaceum 1 . However, it does not belong to
this species, which is restricted to Silene nutans. According
to our molecular phylogenetic analyses, the anther smut on
Silene campanula occupies a sister position to the anther
smut on Silene saxifraga, well separated from Microbotryum
violaceum s. str. (incl. neogenetype ITS/LSU sequences
DQ640065/640070, Lutz et al. 2008).
The morphological examination of the anther smut
specimens on Silene saxifraga revealed some characteristics,
such as a reticulate ornamentation of spores, spore shape
and size, that are shared with other Microbotryum species
in anthers of caryophyllaceous hosts (Lutz et al. 2005, 2008,
Denchev et al. 2009, Piątek et al. 2012, Vánky 2012). However,
in contrast to other species of the caryophyllaceous anther
smuts lineage, the interspaces in spores (= bottom of the
muri) were variably ornamented from almost smooth to rough,
verruculose or, in some spores, distinctly tuberculate. This
feature is almost invisible in LM (sometimes weak tubercles
are visible at very high magnification using Nomarski optics),
1
see: http://www.fungalbarcoding.org/BioloMICS.aspx?Table=Fungal
%20barcodes&Fields=All&Rec=2110 -- data retrieved on 1 March
2013; the specimen is deposited in private herbarium and it was not
possible to re-examine it during the course of this study.
volume 4 · no. 1
35

Piątek, Lutz & Kemler
ARTICLE
Fig. 3. Microbotryum silenes-saxifragae sp. nov. on Silene saxifraga (KR-M-23890 – holotype). A–B. Spores seen by LM, median and superficial
views. C. Hardly visible tubercles in LM at very high magnification using Nomarski optics, indicated by arrows. D–G. Spores with tuberculate,
rough and verruculose interspaces seen by SEM. H. Close-up of spore ornamentation seen by SEM. Bars: A–B = 10 µm, C–E = 5 µm, F = 4
µm, G = 3 µm, H = 1 µm.
but visible in SEM. The reason for morphological variation
in different specimens is uncertain, but it might be related to
different developmental stages or environmental conditions.
In conclusion, the genetic divergence, the host plant
and the distinct spore morphology indicate that the anther
smut on Silene saxifraga represents a new species that is
36 ima fUNGUS

Microbotryum silenes-saxifragae sp. nov.
ARTICLE
Fig. 4. Variability of interspaces ornamentation in different spores and specimens of Microbotryum silenes-saxifragae sp. nov. seen by SEM.
A–B. From KRAM F-49439. C–D. From KRAM F-49440. E–F. From KRAM 1760. Bars: A, C = 4 µm, B, D–E = 3 µm, F = 1 µm.
described in this work as Microbotryum silenes-saxifragae.
The genetic divergence and only one sequenced specimen
of the anther smut on Silene campanula do not allow the
possible assignment of this specimen to Microbotryum
silenes-saxifragae.
The distinct morphological trait of tuberculate interspaces
observed in a certain portion of reticulate spores of
Microbotryum silenes-saxifragae is unique in the lineage of
caryophyllaceous anther smuts. Most species of this clade
have spores with reticulate ornamentation but with smooth
interspaces (Lutz et al. 2005, 2008, Piątek et al. 2012,
Vánky 2012), exceptionally rough or at most verruculose
interspaces (Microbotryum adenopetalae, Lutz et al. 2008, M.
carthusianorum, M. shykoffianum, Denchev et al. 2009). There
are only four evident exceptions from this general pattern,
namely two species have verrucose spores (Microbotryum
chloranthae-verrucosum, M. violaceo-verrucosum, Lutz
et al. 2005, Vánky 2012) and two species have irregularly
verrucose-reticulate spores (M. bardanense, M. violaceoirregulare,
Deml & Oberwinkler 1983, Chlebicki & Suková
2005, Vánky 2012). Microbotryum silenes-saxifragae adds a
new type of ornamentation to the lineage of caryophyllaceous
anther smuts.
The development of reticulate spores having tuberculate
interspaces is a common feature in other Microbotryum species,
and it is especially widespread in many species infecting
flowers of different plants from the family Polygonaceae that
cluster in Microbotryum group II resolved in the phylogenetic
study of Kemler et al. (2006). The reticulate spores with
tuberculate interspaces are also produced by some anther
smuts on non-caryophyllaceous hosts (Vánky 2012) and
are developed in some Microbotryum species sporulating in
the ovaries of caryophyllaceous plants (Piątek 2005, Vánky
2012). Most of these species cluster in Microbotryum group II
(Kemler et al. 2006), though not for all of them sequence data
are available. It seems that the feature of reticulate spores
volume 4 · no. 1
37

Piątek, Lutz & Kemler
ARTICLE
with tuberculate interspaces is a homoplasy that evolved
convergently in different Microbotryum species.
Microbotryum silenes-saxifragae is embedded in a well
supported clade composed of three other described species,
M. coronariae on Lychnis flos-cuculi, M. silenes-inflatae on
S. vulgaris and M. violaceum s. str. on Silene nutans, as well
as the unresolved Microbotryum sp. on Silene campanula
and Microbotryum sp. on S. ciliata. In accordance with the
studies of Lutz et al. (2005, 2008), where only two sequences
of anther smut on Silene saxifraga were available,
Microbotryum violaceum s. str. is revealed as sister taxon to
all other clades of this group. All other phylogenetic relations
received only moderate to low support with one exception,
the sister relation of Microbotryum sp. on Silene campanula
and M. silenes-saxifragae. The host plant phylogenetic
relations and ecology indicate a complex evolutionary
history within this clade of caryophyllaceous anther smuts.
While Silene campanula, S. nutans and S. saxifraga are
phylogenetically closely related (Greenberg & Donoghue
2011, Kemler et al. 2013), S. ciliata and especially Lychnis
flos-cuculi and Silene vulgaris have distant phylogenetic
relations (Greenberg & Donoghue 2011, Kemler et al.
2013). Moreover, the host plants ocuppy different ecological
niches, Silene campanula, S. ciliata, S. nutans and S.
saxifraga occur on calcareous rocks, mostly in mountains,
Lychnis flos-cuculi on wet meadows, in mountains and
lowlands, and S. vulgaris on dry meadows or disturbed
places (roadsides, fields) in mountains and lowlands. It
appears possible that the evolution of Microbotryum species
within this clade was driven by host shifts combined with the
changes in the ecological niches of the hosts. Host shifts,
both evolutionary ancient (Refrégier et al. 2008) or recent
(Antonovics et al. 2002, López-Villavicencio et al. 2005,
Kummer 2010), were often reported in caryophyllaceous
anther smuts. Furthermore, artificial cross-inoculation
experiments indicate that the potential host range of some
Microbotryum species is larger than the actual host range
observed in natural populations, but the ability to infect nonhost
plants is higher for plants that are phylogenetically
closer related to the original host (de Vienne et al. 2009).
This phenomenon could promote higher speciation rates
in this group of plant parasites. In this respect, the clade
warrants further study with increased sampling of anther
smut specimens, especially on other hosts, likely to reveal
other closely related species.
The lineage of caryophyllaceous anther smuts is
predominantly composed of cryptic species, with only a few
species differing morphologically (Lutz et al. 2005, 2008). In
some species (Microbotryum adenopetalae, M. heliospermae,
M. minuartiae) subtle morphological features were found
after their initial detection by molecular methods (Lutz et al.
2008, Piątek et al. 2012). In the absence of molecular support
or cross infection experiments, these features could easily be
considered as phenotypic variation within a single species.
In contrast, the tuberculate interspaces observed in a certain
portion of reticulate spores of Microbotryum silenes-saxifragae
are rather evident, although not previously noticed (probably
due to the absence of SEM studies of anther smut specimens
on Silene saxifraga). Species that have only been recognized
as morphologically distinct after application of methods other
than comparative morphology, usually methods of molecular
biology, are called pseudo-cryptic species in different studies
on systematically diverse organisms (Knowlton 1993, Amato
& Montresor 2008, Luttikhuizen & Dekker 2010, Medina et al.
2012). The species mentioned in this paragraph, including
Microbotryum silenes-saxifragae, match that concept very
well.
The discovery of morphological species showing genetic
differences that are comparable with genetic divergences
between cryptic species embedded within the lineage of
caryophyllaceous anther smuts supports the narrow species
concept for this group of smut fungi advocated by Liro (1924)
and confirmed by recent molecular studies (Lutz et al. 2005,
2008, Le Gac et al. 2007, Refrégier et al. 2008, Devier et al.
2010, Piątek et al. 2012). Furthermore, the strict correlation
of Microbotryum silenes-saxifragae with its host species
confirms the earlier conclusion that host-specific species
delimitation might reflect the evolution of many anther smut
parasites best (Lutz et al. 2005). It is likely that the uncharted
species diversity of anther smuts is much higher and that, in
addition to cryptic species, also pseudo-cryptic species still
could be detected as forming part of caryophyllaceous anther
smuts lineage.
Acknowledgements
We thank Michael Weiß, Sigisfredo Garnica, and Robert Bauer
(Tübingen, Germany) for providing facilities for molecular analyses,
Günther Deml (Braunschweig, Germany) for sending rare literature,
the Curators of herbaria: Markus Scholler (KR-M), and Kálmán Vánky
(H.U.V.) for loan of specimens, Anna and Michał Ronikier (Kraków,
Poland) for collecting material, and Anna Łatkiewicz (Kraków,
Poland) for her help with the SEM pictures.
References
Alexander HM, Antonovics J (1995) Spread of anther-smut disease
(Ustilago violacea) and character correlations in a genetically
variable experimental population of Silene alba. Journal of
Ecology 83: 783–794.
Alexander HM, Thrall PH, Antonovics J, Jarosz AM, Oudemans PV
(1996) Population dynamics and genetics of plant disease: A
case study of anther-smut disease. Ecology 77: 990–996.
Almaraz T, Durrieu G (1997) Ustilaginales from the Spanish Pyrenees
and Andorra. Mycotaxon 65: 223–236.
Amato A, Montresor M (2008) Morphology, phylogeny, and sexual
cycle of Pseudo-nitzschia mannii sp. nov. (Bacillariophyceae):
a pseudo-cryptic species within the P. pseudodelicatissima
complex. Phycologia 47: 487–497.
Antonovics J, Hood ME, Partain JL (2002) The ecology and genetics
of a host shift: Microbotryum as a model system. The American
Naturalist 160: S40–S53.
Bauer R, Lutz M, Begerow D, Piątek M, Vánky K, Bacigálová
K, Oberwinkler F (2008) Anther smut fungi on monocots.
Mycological Research 112: 1297–1306.
Bucheli E, Gautschi B, Shykoff JA (2000) Host-specific differentiation
in the anther smut fungus Microbotryum violaceum as revealed
by microsatellites. Journal of Evolutionary Biology 13: 188–198.
38 ima fUNGUS

Microbotryum silenes-saxifragae sp. nov.
Castresana J (2000) Selection of conserved blocks from multiple
alignments for their use in phylogenetic analysis. Molecular
Biology and Evolution 17: 540–552.
Chakrabarty P (2010) Genetypes: a concept to help integrate
molecular phylogenetics and taxonomy. Zootaxa 2632: 67–68.
Chlebicki A, Suková M (2005) Two Microbotryum species from the
Himalayas. Mycotaxon 93: 149–154.
Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G (2004)
MycoBank: an online initiative to launch mycology into the 21 st
century. Studies in Mycology 50: 19–22.
De Vienne DM, Hood ME, Giraud T (2009) Phylogenetic
determinants of potential host shifts in fungal pathogens. Journal
of Evolutionary Biology 22: 2532–2541.
Deml G, Oberwinkler F (1983) Studies in Heterobasidiomycetes, Part
31. On the anther smuts of Silene vulgaris (Moench) Garcke.
Phytopathologische Zeitschrift 108: 61–70.
Denchev CM, Giraud T, Hood ME (2009) Three new species of
anthericolous smut fungi on Caryophyllaceae. Mycologia
Balcanica 6: 79–84.
Devier B, Aguileta G, Hood ME, Giraud T (2010) Using phylogenies
of pheromone receptor genes in the Microbotryum violaceum
species complex to investigate possible speciation by
hybridization. Mycologia 102: 689–696.
Fontaine MC, Gladieux P, Hood ME, Giraud T (2013) History of the
invasion of the anther smut pathogen on Silene latifolia in North
America. New Phytologist (in press)..
Freeman AB, Doung KK, Shi T, Hughes CF, Perlin MH (2002)
Isolates of Microbotryum violaceum from North American host
species are phylogenetically distinct from their European hostderived
counterparts. Molecular Phylogenetics and Evolution 23:
158–170.
Gladieux P, Vercken E, Fontaine MC, Hood ME, Jonot O, Couloux
A, Giraud T (2011) Maintenance of fungal pathogen species
that are specialized to different hosts: allopatric divergence and
introgression through secondary contact. Molecular Biology and
Evolution 28: 459–471.
Greenberg AK, Donoghue MJ (2011) Molecular systematics and
character evolution in Caryophyllaceae. Taxon 60: 1637–1652.
Hood ME (2005) Repetitive DNA in the automictic fungus
Microbotryum violaceum. Genetica 124: 1–10.
Hood ME, Mena-Alí JI, Gibson AK, Oxelman B, Giraud T, Yockteng
R, Arroyo MTK, Conti F, Pedersen AB, Gladieux P, Antonovics J
(2010) Distribution of the anther-smut pathogen Microbotryum on
species of the Caryophyllaceae. New Phytologist 187: 217–229.
Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference
of phylogenetic trees. Bioinformatics 17: 754–755.
Katoh K, Misawa K, Kuma K, Miyata T (2002) MAFFT: a novel
method for rapid multiple sequence alignment based on fast
Fourier transform. Nucleic Acids Research 30: 3059–3066.
Katoh K, Toh H (2008) Recent developments in the MAFFT multiple
sequence alignment program. Briefings in Bioinformatics 9: 286–
298.
Kemler M, Göker M, Oberwinkler F, Begerow D (2006) Implications
of molecular characters for phylogeny of the Microbotryaceae
(Basidiomycota: Urediniomycetes). BMC Evolutionary Biology
6: 35.
Kemler M, Lutz M, Göker M, Oberwinkler F, Begerow D (2009)
Hidden diversity in the non-caryophyllaceous plant-parasitic
members of Microbotryum (Pucciniomycotina: Microbotryales).
Systematics and Biodiversity 7: 297–306.
Kemler M, Martín MP, Tellería MT, Schäfer AM, Yurkov A, Begerow
D (2013) Contrasting phylogenetic patterns of anther smuts
(Pucciniomycotina: Microbotryum) reflect phylogenetic patterns
of their caryophyllaceous hosts. Organisms Diversity and
Evolution (in press).
Knowlton N (1993) Sibling species in the sea. Annual Review of
Ecology and Systematics 24: 189–216.
Kummer V (2010) Bemerkenswerte Pilzfunde auf der 38.
Brandenburgischen Botanikertagung in Groß Pinnow/Uckermark
2007. Verhandlungen des Botanischen Vereins von Berlin und
Brandenburg 142: 223–245.
Le Gac M, Hood ME, Fournier E, Giraud T (2007) Phylogenetic
evidence of host-specific cryptic species in the anther smut
fungus. Evolution 61: 15–26.
Lee JA (1981) Variation in the infection of Silene dioica (L.) Clairv.
by Ustilago violacea (Pers.) Fuckel in North West England. New
Phytologist 87: 81–99.
Liro JI (1924) Die Ustilagineen Finnlands I. Annales Academiae
Scientiarum Fennicae, Series A 17: 1–636.
López-Villavicencio M, Enjalbert J, Hood ME, Shykoff JA, Raquin C,
Giraud T (2005) The anther smut disease on Gypsophila repens:
a case of parasite sub-optimal performance following a recent
shift? Journal of Evolutionary Biology 18: 1293–1303.
Luttikhuizen PC, Dekker R (2010) Pseudo-cryptic species Arenicola
defodiens and Arenicola marina (Polychaeta: Arenicolidae) in
Wadden Sea, North Sea and Skagerrak: Morphological and
molecular variation. Journal of Sea Research 63: 17–23.
Lutz M, Bauer R, Begerow D, Oberwinkler F, Triebel D (2004)
Tuberculina, rust relatives attack rusts. Mycologia 96: 614–626.
Lutz M, Göker M, Piątek M, Kemler M, Begerow D, Oberwinkler F
(2005) Anther smuts of Caryophyllaceae: molecular characters
indicate host-dependent species delimitation. Mycological
Progress 4: 225–238.
Lutz M, Piątek M, Kemler M, Chlebicki A, Oberwinkler F (2008)
Anther smuts of Caryophyllaceae: molecular analyses reveal
further new species. Mycological Research 112: 1280–1296.
Lutz M, Vánky K (2009) An annotated checklist of smut fungi
(Basidiomycota: Ustilaginomycotina and Microbotryales) in
Slovenia. Lidia 7: 33–78.
Medina R, Lara F, Goffinet B, Garilleti R, Mazimpaka V (2012)
Integrative taxonomy successfully resolves the pseudo-cryptic
complex of the disjunct epiphytic moss Orthotrichum consimile
s.l. (Orthotrichaceae). Taxon 61: 1180–1198.
Piątek M (2005) Taxonomic position of the smut fungus Ustilago
alsines. Polish Botanical Journal 50: 7–10.
Piątek M, Lutz M, Chater AO (2013) Cryptic diversity in the
Antherospora vaillantii complex on Muscari species. IMA Fungus
4: 5–19.
Piątek M, Lutz M, Ronikier A, Kemler M, Świderska-Burek U (2012)
Microbotryum heliospermae, a new anther smut fungus parasitic
on Heliosperma pusillum in the mountains of the European
Alpine System. Fungal Biology 116: 185–195.
Piątek M, Lutz M, Smith PA, Chater AO (2011) A new species of
Antherospora supports the systematic placement of its host
plant. IMA Fungus 2: 135–142.
Refrégier G, Le Gac M, Jabbour F, Widmer A, Shykoff JA, Yockteng
R, Hood ME, Giraud T (2008) Cophylogeny of the anther smut
fungi and their caryophyllaceous hosts: prevalence of host
shifts and importance of delimiting parasite species for inferring
cospeciation. BMC Evolutionary Biology 8: 100.
ARTICLE
volume 4 · no. 1
39

Piątek, Lutz & Kemler
ARTICLE
Roets F, Curran H, Dreyer LL (2012) Morphological and reproductive
consequences of an anther smut fungus on Oxalis. Sydowia 64:
267–280.
Roets F, Dreyer LL, Wingfield MJ, Begerow D (2008) Thecaphora
capensis sp. nov., an unusual new anther smut on Oxalis in
South Africa. Persoonia 21: 147–152.
Ronikier M (2011) Biogeography of high-mountain plants in the
Carpathians: An emerging phylogeographical perspective. Taxon
60: 373–389.
Ronquist F, Huelsenbeck JP (2003) MRBAYES 3: Bayesian
phylogenetic inference under mixed models. Bioinformatics 19:
1572–1574.
Schäfer AM, Kemler M, Bauer R, Begerow D (2010) The illustrated
life cycle of Microbotryum on the host plant Silene latifolia.
Botany 88: 875–885.
Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque
CA, Chen W, Fungal Barcoding Consortium (2012) Nuclear
ribosomal internal transcribed spacer (ITS) region as a universal
DNA barcode marker for Fungi. Proceedings of the National
Academy of Sciences, USA 109: 6241–6246.
Scholz H, Scholz I (1988) Die Brandpilze Deutschlands
(Ustilaginales). Englera 8: 1–691.
Silvestro D, Michalak I (2012) raxmlGUI: a graphical front-end for
RAxML. Organisms Diversity and Evolution 12: 335–337.
Sloan DB, Giraud T, Hood ME (2008) Maximized virulence in a
sterilizing pathogen: the anther-smut fungus and its co-evolved
hosts. Journal of Evolutionary Biology 21: 1544–1554.
Stamatakis A (2006) RAxML-VI-HPC: maximum likelihood-based
phylogenetic analysis with thousands of taxa and mixed models.
Bioinformatics 22: 2688–2690.
Stamatakis A, Hoover P, Rougemont J (2008) A rapid bootstrap
algorithm for the RAxML web servers. Systematic Biology 57:
758–771.
Thrall PH, Biere A, Antonovics J (1993) Plant life-history and disease
susceptibility – the occurrence of Ustilago violacea on different
species within the Caryophyllaceae. Journal of Ecology 81:
489–498.
Tutin TG, Burges NA, Chater AO, Edmondson JR, Heywood VH,
Moore DM, Valentine DH, Walters SM, Webb DA (1993) Flora
Europaea 1: Psilotaceae to Platanacae. Ed. 2. Cambridge:
Cambridge University Press.
Vánky K (1994) European Smut Fungi. G. Fischer Verlag, Stuttgart–
Jena–New York.
Vánky K (1998) The genus Microbotryum (smut fungi). Mycotaxon
67: 33–60.
Vánky K (1999) The new classificatory system for smut fungi, and
two new genera. Mycotaxon 70: 35-49.
Vánky K (2004) Anther smuts of Caryophyllaceae. Taxonomy,
nomenclature, problems in species delimitation. Mycologia
Balcanica 1: 189–191.
Vánky K (2012) Smut Fungi of the World. American Phytopathological
Society, St Paul, Minnesota, USA.
Vánky K, Lutz M (2007) Revision of some Thecaphora species
(Ustilaginomycotina) on Caryophyllaceae. Mycological Research
111: 1207–1219.
Vercken E, Fontaine MC, Gladieux P, Hood ME, Jonot O, Giraud T
(2010) Glacial refugia in pathogens: European genetic structure
of anther smut pathogens on Silene latifolia and Silene dioica.
PloS Pathogens 6: e1001229. doi:10.1371/journal.ppat.1001229
Yockteng R, Marthey S, Chiapello H, Gendrault A, Hood ME,
Rodolphe F, Devier B, Wincker P, Dossat C, Giraud T (2007)
Expressed sequences tags of the anther smut fungus,
Microbotryum violaceum, identify mating and pathogenicity
gene. BMC Genomics 8: 272.
Zillig H (1921a) Über spezialisierte Formen beim Antherenbrand,
Ustilago violacea (Pers.) Fuck. Zentralblatt für Bakteriologie II
53: 33–74.
Zillig H (1921b) Unsere heutigen Kenntnisse von der Verbreitung
des Antherenbrandes (Ustilago violacea (Pers.) Fuck.). Annales
Mycologici 18: 136–153.
Zundel GL (1953) The Ustilaginales of the world. Pennsylvania State
College School of Agriculture Department of Botany Contribution
176: xi+1–410.
Zwetko P, Blanz P (2004) Die Brandpilze Österreichs. Catalogus
Florae Austriae III/3. Österreichische Akademie der
Wissenschaften, Wien.
40
ima fUNGUS

doi:10.5598/imafungus.2013.04.01.05
IMA Fungus · volume 4 · no 1: 41–51
Genera in Bionectriaceae, Hypocreaceae, and Nectriaceae (Hypocreales)
proposed for acceptance or rejection
Amy Y. Rossman 1 , Keith A. Seifert 2 , Gary J. Samuels 3 , Andrew M. Minnis 4 , Hans-Josef Schroers 5 , Lorenzo Lombard 6 , Pedro
W. Crous 6 , Kadri Põldmaa 7 , Paul F. Cannon 8 , Richard C. Summerbell 9 , David M. Geiser 10 , Wen-ying Zhuang 11 , Yuuri Hirooka 12 ,
Cesar Herrera 13 , Catalina Salgado-Salazar 13 , and Priscila Chaverri 13
ARTICLE
1
Systematic Mycology & Microbiology Laboratory, USDA-ARS, Beltsville, Maryland 20705, USA; corresponding author e-mail: Amy.Rossman@
ars.usda.gov
2
Biodiversity (Mycology), Eastern Cereal and Oilseed Research Centre, Agriculture & Agri-Food Canada, Ottawa, ON K1A 0C6, Canada
3
321 Hedgehog Mt. Rd., Deering, NH 03244, USA
4
Center for Forest Mycology Research, Northern Research Station, USDA-U.S. Forest Service, One Gifford Pincheot Dr., Madison, WI 53726,
USA
5
Agricultural Institute of Slovenia, Hacquetova 17, 1000 Ljubljana, Slovenia
6
CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands
7
Institute of Ecology and Earth Sciences and Natural History Museum, University of Tartu, Vanemuise 46, 51014 Tartu, Estonia
8
Jodrell Laboratory, Royal Botanic Gardens, Kew, Surrey TW9 3AB, UK
9
Sporometrics, Inc., 219 Dufferin Street, Suite 20C, Toronto, Ontario, Canada M6K 1Y9
10
Department of Plant Pathology and Environmental Microbiology, 121 Buckhout Laboratory, The Pennsylvania State University, University Park,
PA 16802 USA
11
State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China
12
Forestry & Forest Products Research Institute, Department of Forest Microbiology, 1 Matsunosato, Tukuba, Ibaraki, 305-8687, Japan
13
University of Maryland, Department of Plant Sciences and Landscape Architecture, 2112 Plant Sciences Building, College Park, Maryland
20742, USA
Abstract: With the recent changes concerning pleomorphic fungi in the new International Code of
Nomenclature for algae, fungi, and plants (ICN), it is necessary to propose the acceptance or protection
of sexual morph-typified or asexual morph-typified generic names that do not have priority, or to propose
the rejection or suppression 1 of competing names. In addition, sexual morph-typified generic names, where
widely used, must be proposed for rejection or suppression in favour of asexual morph-typified names that
have priority, or the latter must be proposed for conservation or protection. Some pragmatic criteria used
for deciding the acceptance or rejection of generic names include: the number of name changes required
when one generic name is used over another, the clarity of the generic concept, their relative frequencies
of use in the scientific literature, and a vote of interested mycologists. Here, twelve widely used generic
names in three families of Hypocreales are proposed for acceptance, either by conservation or protection,
despite their lack of priority of publication, or because they are widely used asexual morph-typified names.
Each pair of generic names is evaluated, with a recommendation as to the generic name to be used, and
safeguarded, either through conservation or protection. Four generic names typified by a species with a
sexual morph as type that are younger than competing generic names typified by a species with an asexual
morph type, are proposed for use. Eight older generic names typified by species with an asexual morph
as type are proposed for use over younger competing generic names typified by a species with a sexual
morph as type. Within Bionectriaceae, Clonostachys is recommended over Bionectria; in Hypocreaceae,
Hypomyces is recommended over Cladobotryum, Sphaerostilbella over Gliocladium, and Trichoderma
over Hypocrea; and in Nectriaceae, Actinostilbe is recommended over Lanatonectria, Cylindrocladiella
over Nectricladiella, Fusarium over Gibberella, Gliocephalotrichum over Leuconectria, Gliocladiopsis over
Glionectria, Nalanthamala over Rubrinectria, Nectria over Tubercularia, and Neonectria over Cylindrocarpon.
Key words:
Anamorph-typified genera
Article 59
New combinations
Nomenclature
Teleomorph-typified genera
Article info: Submitted: 9 December 2012; Accepted: 23 March 2013; Published: 4 April 2013.
© 2013 International Mycological Association
You are free to share - to copy, distribute and transmit the work, under the following conditions:
Attribution:
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).
Non-commercial: You may not use this work for commercial purposes.
No derivative works: You may not alter, transform, or build upon this work.
For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get
permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.
volume 4 · no. 1 41

Rossman et al.
ARTICLE
Introduction
The International Code of Nomenclature for algae, fungi and
plants (ICN) states that “…for a taxon of non-lichen-forming
Ascomycota and Basidiomycota… [all names] compete for
priority” regardless of their particular morph (Article 59.1,
McNeill et al. 2012). This stipulates that only one scientific
name be used for each species of fungi, contrary to previous
editions of the International Code of Botanical Nomenclature
and its predecessors. The preceding Code “…provided for
separate names for mitotic asexual morphs (anamorphs) of
certain pleomorphic fungi …” (Note 2. McNeill et al. 2006,
2012; Norvell 2011). As a result, the nomenclature of fungi
must now conform to the principle of priority that applies
to other groups of organisms governed by this Code. This
change came into effect on 30 July 2011, when the decisions
of the Nomenclature Section were ratified by the plenary
session of the Melbourne Congress, although the application
of some aspects was delayed until 1 January 2013.
In determining which binominal to use for a fungal species,
it is necessary first to give priority to the oldest generic name
when different sexual morph-typified and asexual morphtypified
names apply to the same taxon. For example, the
sexual morph-typified name Calonectria De Not. 1867 (type:
C. pyrochroa (Desm.) Sacc. 1878) and asexual morph-typified
name Cylindrocladium Morgan 1892 (type: Cyl. scoparium
Morgan1892) circumscribe the same group of species.
Following the principle of priority, Calonectria is the older
name and thus should be used for this genus. The genus
Cylindrocladium is considered a synonym of Calonectria.
All species names that belong to this genus, whether or
not their type species exhibits the sexual or asexual morph,
must be placed in Calonectria (Lombard et al. 2010). Even
species that do not show evidence of a sexual morph, but are
recognized as congeneric with the type species, are placed
in that genus. Within a single genus, all species names now
compete for priority regardless of their morph, and thus the
oldest species epithet should be placed in the genus that has
priority.
In some cases it may be useful to make an exception
to the principle of priority allowing the use of a generic
name or species epithet that is not the oldest. For example
Cladobotryum varium Nees 1816, the type species of
the genus, is the asexual morph of Hypomyces aurantius
(Pers.) Tul. & C. Tul. 1860. Cladobotryum Nees 1816 is
older than Hypomyces (Fr.) Tul. & C. Tul. 1860, typified by
H. lactifluorum. Thus, the ICN stipulates that Hypomyces
is considered a later synonym of Cladobotryum. However,
because Hypomyces is far more commonly used than
Cladobotryum, it is preferable to preserve the younger name.
Such exceptions could be made, for example, in the case
1
The terms “conservation” and “rejection” are used here for names
ruled as nomina conservanda or nomina rejicienda under the ICN
(Arts 14.1, 56.1). In contrast, “protected” and “suppressed” are terms
used here for names to be placed on lists of fungal names under Arts
14.3, 56.3). The terms “list-accepted” and “list-demoted” proposed by
Gams et al. (2012) are equivalent to “protected” and “suppressed”,
respectively, as used in this article
of long established scientific names of fungi judged to be
important in some respect. The ICN allows for this in several
ways, as described in Arts 14 and 56. As for all organisms
covered by this Code, generic and/or species names may
be conserved by writing a conservation proposal that is
published in Taxon and eventually approved or rejected
by the Nomenclatural Committee for Fungi (NCF) and the
General Committee (GC) of the International Association
for Plant Taxonomy (IAPT). Alternatively, according to Art.
14.13, “…lists of names may be submitted to the General
Committee….Accepted names…are to be listed with their
types together with those competing synonyms against
which they will be treated as conserved…”. These lists will
be reviewed and approved by the appropriate bodies of the
IAPT. Similarly, names may be proposed for rejection under
Art. 56.1 or put on a list to be treated as rejected under Art.
56.3, where they are processed in the same manner as Arts
14.1 and 14.13. Rejected names may not be used unless
later conserved under Art. 14, thus the use of rejection should
be considered seriously.
According to Art. 57.2 “…in cases where…both
teleomorph-typified and anamorph-typified names were
widely used for a taxon, an anamorph-typified name that has
priority is not to displace the teleomorph name(s) unless and
until a proposal to reject the former under Article 56.1 or 56.3
or to deal with the latter under Article 14.1 or 14.13 has been
submitted and rejected.” This requires that use of an asexual
morph-typified generic or species name must be approved or
at least the use of the sexual morph-typified name rejected
prior to the use of the asexual morph-typified name for the
taxon.
A number of criteria have been suggested for determining
the accepted status of a generic name (Hawksworth 2011).
These include the number of name changes required when
one generic name is used over another. For example, in
the case of Cochliobolus Drechsler 1934 versus Bipolaris
Shoemaker 1959, Cochliobolus is the older generic name, but
most of the species were described in Bipolaris. If the older
name Cochliobolus is used, many of the species described
in Bipolaris would have to be transferred into Cochliobolus,
while if Bipolaris were protected over Cochliobolus, only one
scientific name would have to be changed (Manamgoda et
al. 2012).
Another important criterion concerns the clarity of the
generic concept. Some fungi have a reduced morphology,
such as yeast fungi or those having simple phialides
and non-septate hyaline conidia (i.e an acremonium-like
morphology). Generic names have been applied that refer
only to the morphology rather than to a well-defined genus.
Thus the name Acremonium Link 1809 has been used for
a range of species that are phylogenetically diverse with
species now placed in Leotiomycetes and at least 12 orders
of Sordariomycetes (Summerbell et al. 2011). Noting the
critical and careful work of Gams (1971) in collecting cultures
compatible with the well preserved type specimen of the type
species, Acremonium alternatum Link 1809, Summerbell et
al. (2011) designated an epitype that places that species,
and so the generic name Acremonium, in the core group
of medically and phytopathologically important species.
This group has no well established contending names.
42 ima fUNGUS

Genera in Hypocreales proposed for acceptance or rejection
Therefore, it is recommended that this name remain in active
biosystematic use despite the reduced morphology. On the
other hand, the generic name Uredo Pers. 1801 has been
used for a diverse range of asexual morphs of rust fungi
and will most likely be abandoned. Names such as uredolike
can be maintained for use as a descriptor of common
but phylogenetically uninformative characters. That format
separates such terms from classification or formal binominals
and is not regulated by the ICN.
The relative frequencies of use of each generic name in
the scientific literature has been mentioned as a criterion for
deciding the most appropriate generic or species name for
protection (Hawksworth 2012). A comprehensive evaluation
of peer-reviewed scientific literature allows the context of
name usage to be determined. For example, the generic
name Botryotinia, with a type species typified by a sexual
morph, is frequently used in the literature but almost always
in direct association with the much more broadly used name
Botrytis, which has a type species typified by an asexual
morph. Similarly, for generic concepts that are not precisely
defined, high numbers of citations can arise because the
name has been widely applied but very imprecisely. In
another case, and if using the inaccurate number of Google
“hits”, the name may have more than one meaning such as
for Valsa in which Google hits include those that refer to the
Valsavar maneuver. Searches of scholarly databases are
useful indicators if the scientific name is widely known in the
literature, such as a scientific name that refers to a common
plant disease as for Venturia inaequalis, cause of apple scab,
or Clonostachys rosea, a widely reported biocontrol agent. If
a comprehensive literature review is not possible, searches
of scholarly databases such as Scopus, Biological Abstracts,
or CAB Abstracts are likely to be far more robust than Google.
Another approach is to request input from the community
of scientists interested in a particular name and discuss the
advantages/disadvantages of the adoption of each name.
This may result in agreement on the best choice with a straw
poll or voting on the issue. For some of the genera discussed
here, such as Hypocrea vs. Trichoderma, considerable
discussion has taken place. In cases where the number of
votes for each name are about equal, it would seem expedient
to apply the principle of priority, provided that those voting
include users of names and not only systematists.
Here we discuss 12 genera from three families of
Hypocreales, namely Bionectriaceae, Hypocreaceae,
and Nectriaceae, that are proposed for acceptance either
because they are typified by a sexual morph and do not
have priority, or have priority but are asexual morph-typified.
Some asexual morph-typified genera that have priority and
will displace a sexual morph-typified genus are proposed for
approval, i.e. the sexual morph-typified name is proposed
for abandonment. For each genus, the type species is given
along with the competing name(s) and rationale for using
the proposed generic name. These generic names are
summarized in Table 1, and some affected family names are
treated in Table 2. We do, however, point out that there is
no objection under the ICN to the name of a family based
on the stem of a now synonymized generic name being
used, as in the case of Ceratostomataceae G. Winter 1885
where Ceratostoma Fr. 1818 has long been recognized as
a synonym of Melanospora Corda 1837. These proposed
exceptions to the application of the principle of priority will
now need to be evaluated by the procedures established by
the ICN.
NOMENCLATURAL PROPOSALS
Bionectriaceae
Clonostachys Corda 1839 vs. Bionectria Speg. 1919
Clonostachys is an asexual morph-typified genus that has
priority over the sexual morph-typified genus Bionectria. The
type species of Clonostachys is C. araucaria Corda 1839,
now considered a synonym of C. rosea (Link) Schroers et al.
1999 (basionym Penicillium roseum Link 1816), anamorph
of B. ochroleuca (Schwein.) Schroers & Samuels 1997.
The type species of Bionectria is B. tonduzi Speg. 1919.
Bionectria tonduzi is not well characterized; it is known only
from the type specimen and has not been cultured. According
to Schroers (2001), the type specimen of B. tonduzi
includes a Clonostachys macrospora-like asexual morph.
Although they have different species as their types, these
two genera have consistently been considered congeneric.
Neither genus name has a taxonomically or phylogenetically
confused history that would confound interpretation of the
historical literature. Clonostachys rosea (syn. Gliocladium
roseum Bainier 1907) is a biocontrol agent (Schroers et
al. 1999) that is commonly isolated from soil and found
growing on woody substrates. Its sexual morph is frequently
encountered only in tropical regions, and mainly on recently
dead woody hosts. The name Clonostachys rosea has a well
defined species concept, is well established in the literature,
and is of importance to applied mycologists. Bionectria has
seldom been used outside the taxonomic literature. Based on
the monograph of Bionectria and Clonostachys by Schroers
(2001), no matter which generic name is used, the number
of required name changes is equal, specifically 16; however,
not all of the 43 names in Bionectria nor the 67 names in
Clonostachys were considered in that study. Because the
name Clonostachys rosea is commonly used in biocontrol
studies, we propose the protection of the older asexual
morph-typified name Clonostachys for this genus.
Bionectria typifies the fungal family Bionectriaceae
Samuels & Rossman 1999, which has been frequently cited.
By contrast the family name Spicariaceae Nann. 1934, based
on Clonostachys solani (Harting) Schroers & W. Gams 2001
(basionym Spicaria solani Harting 1846), has hardly been
used in literature. We suggest protecting this family name,
despite the synonymy of Bionectria and Clonostachys, and
maintaining the use of the name Bionectriaceae for the family.
Hypocreaceae
Hypomyces (Fr.) Tul. & C. Tul. 1860 vs. Sepedonium
Link 1809 vs. Mycogone Link 1809 vs. Cladobotryum
Nees 1817 vs. Stephanoma Wallr. 1833
Hypomyces is typified by H. lactifluorum (Schwein.) Tul. & C.
Tul. 1860, a species growing on basidiomes of Russulaceae
that has no known asexual morph. Most conidial morphs of
ARTICLE
volume 4 · no. 1
43

Rossman et al.
ARTICLE
Table 1. Proposals for protected or suppressed generic names and their type species in Hypocreales[1]. Names to be protected are in bold
type 2 .
Bionectriaceae
Clonostachys Corda, Pracht-Fl. Eur. Schimmelbild.: 31 (1839) (=) Bionectria Speg. in Boln Acad. nac. Cienc. Córdoba 23: 563 (1919)
Typus: C. rosea (Link) Schroers et al. (1999) (C. araucaria Corda
(1839), now considered a synonym of basionym Penicillium roseum
Link (1816)
Typus: B. tonduzi Speg.
Hypocreaceae
Hypomyces (Fr.) Tul. & C. Tul. in Annls Sci. Nat., Bot., sér. 4 13: 11 (=) Cladobotryum Nees, Syst. Pilze (Würzburg): 56 (1816) 1817.
(1860) (Hypocrea subg. Hypomyces Fr., Syst. orb. veg. (Lundae) 1:
105 (1825).
Typus: H. lactifluorum (Schwein.) Tul. & C. Tul. (Sphaeria lactifluorum Typus: C. varium Nees
Schwein.)
(=) Gliocladium Corda, Icon. fung. (Prague) 4: 30 (1840)
Sphaerostilbella (Henn.) Sacc. & D. Sacc., Syll. fung. (Abellini) 17:
778 (1905) (Sphaerostilbe subgen. Sphaerostilbella Henn. in Bot. Jb.
30: 40 1901)
Typus: S. lutea (Henn.) Sacc. & D. Sacc. (Sphaerostilbe lutea Henn.) Typus: G. penicillioides Corda
Trichoderma Pers., in Neues Mag. Bot. 1: 92 (1794)
Typus: T. viride Pers.
(=) Hypocrea Fr., Syst. orb. veg. (Lundae) 1: 104 (1825)
Typus: H. rufa (Pers.) Fr. (Sphaeria rufa Fr.)
Nectriaceae
Actinostilbe Petch in Ann. R. bot. Gdns Peradeniya 9: 327 (1925). (=) Lanatonectria Samuels & Rossman in Stud. Mycol. 42: 137 (1999) .
Typus: A. vanillae Petch
Typus: L. flocculenta (Henn. & E. Nyman) Samuels & Rossman
(Nectriella flocculenta Henn. & E. Nyman)
Cylindrocladiella Boesew. in Can. J. Bot. 60: 2289 (1982). (=) Nectricladiella Crous & C.L. Schoch in Stud. Mycol. 45: 54 (2000).
Typus: C. parva (P.J. Anderson) Boesew.
Typus: N. camelliae (Shipton) Crous & C.L. Schoch
Fusarium Link in Mag. Gesell. naturf. Freunde, Berlin 3: 10 (1809). (=) Gibberella Sacc. in Michelia 1: 43 (1877).
Typus: F. roseum Link, synonym of F. sambucinum Fuckel, nom. Typus: G. pulicaris (Fr.) Sacc.
cons.
Gliocephalotrichum J.J. Ellis & Hesselt. in Bull. Torrey bot. Club
89: 21 (1962).
Typus: G. bulbilium J.J. Ellis & Hesselt.
(=) Leuconectria Rossman & al. in Mycologia 85: 686 (1993).
Typus: L. clusiae (Samuels & Rogerson) Rossman & al. (Pseudonectria
clusiae Samuels & Rogerson)
Gliocladiopsis S.B. Saksena in Mycologia 46: 663 (1954). (=) Glionectria Crous & C.L. Schoch in Stud. Mycol. 45: 58 (2000).
Typus: G. sagariensis S.B. Saksena
Typus: Gn. tenuis Crous & C.L. Schoch
Nalanthamala Subram. in J. Indian Bot. Soc. 35: 478 (1956). (=) Rubrinectria Rossman & Samuels 1999 in Stud. Mycol. 42: 164 (1999).
Typus: N. madreeya Subram.
Typus: R. olivacea (Seaver) Rossman & Samuels (Macbridella olivacea
Seaver)
Nectria (Fr.) Fr., Summa veg. Scand., Section Post. (Stockholm):
387 (1849).
(Hypocrea sect. Nectria Fr. Syst. orb. veg. (Lundae) 1: 105 (1825).
Typus: N. cinnabarina (Tode : Fr. ) Fr. (Sphaeria cinnabarina Tode :
Fr.)
(=) Tubercularia Tode, Fung. mecklenb. sel. (Lüneburg) 1: 18 (1790).
Typus: T. vulgaris Tode
Neonectria Wollenw. in Annls mycol. 15: 52 (1917). (=) Cylindrocarpon Wollenw. in Phytopathology 3: 225 (1913).
Typus: N. ramulariae Wollenw.
Typus: C. cylindroides Wollenw.
2
The entries are formatted here as in the Appendices of the Vienna Code (McNeill et al. 2006) except that dates of publication are placed in
parentheses.
44 ima fUNGUS

Genera in Hypocreales proposed for acceptance or rejection
Table 2. Proposals for protected or suppressed familial names and their type genera in Hypocreales. Names proposed for protection are in
bold.
Bionectriaceae Samuels & Rossman in Stud. Mycol. 42: 15 (1999). (=) Spicariaceae Nann. in Repert. Mic. Uomo: 451 (1934).
Typus: Bionectria Speg.
Typus: Spicaria Harting
Hypocreaceae De Not. in G. Bot. Ital. 2: 48 (1844) as “Hypocreacei”.
Typus: Hypocrea Fr.
(=) Trichodermataceae Fr., Syst. Orb. Veg. (Lundae) 1: 144 (1825) as
“Trichodermacei”.
Typus: Trichoderma Pers. : Fr.
ARTICLE
Nectriaceae Tul. & C. Tul., Select. Fung. Carpol. (Paris) 3: 3 (1865)
as “Nectriei”.
Typus: Nectria (Fr.) Fr.
(=) Tuberculariaceae Fr., Syst. Orb. Veg. (Lundae) 1: 169 (1825) as
“Tubercularini”.
Typus: Tubercularia Tode : Fr.
Hypomyces and related species without sexual morphs are
classified in Cladobotryum typified by C. varium Nees 1816,
the anamorph of H. aurantius (Pers. : Fr.) Tul. & C. Tul.
The type species of Cladobotryum is closely related to and
considered congeneric with the type species of Hypomyces,
thus Cladobotryum has priority over Hypomyces. Hypomyces
is a well-known genus with 197 names, of which 68 have been
included in monographic studies over the past three decades
(Rogerson & Samuels 1985, 1989, 1993, 1994, Põldmaa et
al. 1997, Põldmaa 2003, 2011, Põldmaa & Samuels 1999,
2004). Cladobotryum includes 67 names, with a majority
applying to species without a known sexual morph. Based
on the usage and familiarity of the names, we propose that
Hypomyces be protected against Cladobotryum.
No comprehensive phylogenetic analysis of most species
of Hypomyces exists, but species in the genus have diverse
asexual morphs that tend to be restricted to specific groups
of host fungi. Published results reveal that the genus is most
likely paraphyletic (Põldmaa 2000, Põldmaa & Samuels
2004) or may be too broadly circumscribed. The asexual
morph of Hypomyces cervinigenus Rogerson & Simms 1971
has been described in Mycogone Link 1809, typified by M.
rosea Link 1809, a species lacking a known sexual morph.
Another genus typified by an asexual morph, Sepedonium
Link 1809 based on S. mycophilum (Pers.) Link 1809,
has been connected with species of Hypomyces growing
exclusively on Boletales. Stephanoma Wallr. 1833, typified by
S. strigosum Wallr. 1833, is connected with H. stephanomatis
Rogerson & Samuels 1985. These three asexual morphtypified
genera are more distantly related to the type species
of Hypomyces than most members of Cladobotryum, and
thus may not be congeneric. In its current circumscription,
the generic name Hypomyces should also be protected
against the other asexual morph-typified genera Mycogone,
Sepedonium, and Stephanoma.
Sphaerostilbella (Henn.) Sacc. & D. Sacc. 1905 vs.
Gliocladium Corda 1840
The genus Sphaerostilbella is based on S. lutea (Henn.)
Sacc. & D. Sacc. 1905 and produces an asexual morph
referred to as Gliocladium aurifilum (Gerard) Seifert et al.
1985 (basionym Stilbum aurifilum Gerard 1874). The genus
Gliocladium is based on G. penicillioides Corda 1840, the
asexual morph of Sphaerostilbella aureonitens (Tul. & C.
Tul.) Seifert et al. 1985, a parasite of Stereum (Seifert 1985).
Phylogenetic analyses indicate that Sphaerostilbella lutea and
G. penicillioides are congeneric (Rehner & Samuels 1994),
and it presently seems unlikely that these two species would
ever be classified in different genera. Although Gliocladium
has priority over Sphaerostilbella, Gliocladium was used
historically for species with penicillate conidiophores and slimy
aseptate conidia that are now known to be phylogenetically
diverse. Among the 63 named species, the most commonly
cited species are G. roseum (see discussion of Clonostachys
above) and G. virens Miller et al. 1958, both involved in
research on the biological control of soil borne plant diseases.
Gliocladium roseum is now regarded as Clonostachys rosea,
the asexual morph of Bionectria ochroleuca (Bionectriaceae;
see above). Gliocladium virens is placed in Trichoderma
as T. virens (Miller et al.) Arx 1987, the asexual morph of
Hypocrea virens Chaverri & Samuels 2011 (Chaverri et al.
2001). Gliocladium deliquescens Sopp. 1912 (syn. G. viride
Matr. 1893, non T. viride Pers. 1794) is the asexual morph
of Hypocrea lutea (Tode) Petch 1937. Other species of
Gliocladium are now known to be species of Cephalotheca 3
(G. prolificum), Clonostachys, Gliocephalis (Gliocladium
pulchellum), Metarhizium (M. viridicolumnare), Myrothecium,
Nalanthamala, Nectriopsis broomeana (G. microspermum),
Tolypocladium, or Trichoderma. The majority of Gliocladium
species have not been re-evaluated in modern terms but,
apart from those accepted by Seifert (1985), are unlikely to
be species of Sphaerostilbella. Although the morphological
concept of Gliocladium was useful for identification, the
polyphyletic distribution of the included species and its
frequent use in the historical literature in a form-genus sense,
calls into question its continued use. From a taxonomic
perspective, it has been used in a phylogenetically consistent
sense for the past 25 years, but this has not been true in
the applied literature, where the form-genus concept still
predominates.
Sphaerostilbella was an obscure sexual morph-typified
genus until reintroduced by Seifert (1985). Sphaerostilbella
has therefore appeared much less often in the mycological
literature and is a name recognizable to far fewer applied
mycologists than Gliocladium. However, since 1985,
this name has been used for a consistent morphological
and biological concept that molecular data confirm is
monophyletic. Presently, there are seven named species,
five with named and one with unnamed Gliocladium morphs,
3
Author citations and dates are not provided for names of fungi
mentioned in this article unless pertinent to the issues of priority and
typification under discussion.
volume 4 · no. 1
45

Rossman et al.
ARTICLE
and one with a verticillium-like anamorph. Among the nine
species known in this clade, seven have known sexual
morphs. Adoption of either name for this clade would require
four new combinations. We suggest that the continued
use of the generic name Gliocladium will lead to confusion
interpreting the literature and function as a “persistent source
of error”. Because use of the younger name Sphaerostilbella
would favour clarity of communication, we propose to protect
Sphaerostilbella against Gliocladiium.
Trichoderma 1794 vs. Hypocrea Fr. 1825
Trichoderma Pers. 1794 typified by T. viride Pers. 1794 is an
asexual morph-typified name and has priority over Hypocrea
Fr. 1825 typified by H. rufa (Pers.) Fr. 1825, a sexual morphtypified
name. Over the past ten years, considerable systematic
research has been conducted on Trichoderma and Hypocrea
(Bissett 1984, 1991a, b, Chaverri et al. 2003, Degenkolb et
al. 2008a, Jaklitsch 2009, 2011, Samuels et al. 2012). Both
Trichoderma and Hypocrea are in one monophyletic clade.
Trichoderma includes a number of species that have proven
useful in the biocontrol of fungal diseases and biotechnology
as a source of industrial enzymes and species are frequently
isolated as endophytes (Harman & Kubicek 1998, Kubicek &
Harman 1998, Evans et al. 2003, Degenkolb et al. 2008b).
Commercially available biocontrol products such as SoilGard
(T. virens); and Rootshield (Bioworks Inc., T. harzianum)
are based on named Trichoderma species and several US
patents have been issued for Trichoderma species in diverse
projects, including cellulose production, biofuels production,
inhibition of nematodes, plant growth stimulation, and
biopesticides to name a few. Specimens of Hypocrea are
macroscopic, frequently collected on rotting wood, and thus
are often included in fungal surveys (Dingley 1957, Doi 1972,
Jaklitsch 2009, 2011).
Against the selection of Trichoderma over Hypocrea
is that far more names of Hypocrea (approximately 1000)
have been proposed than in Trichoderma (approximately
215), potentially necessitating considerable nomenclatural
disruption if Trichoderma is accepted. A second reason for
not preserving Trichoderma over Hypocrea is that, while
Hypocrea as a genus is morphologically conservative and
easily recognized, the asexual morphs of several species
are morphologically unlike the type species, Trichoderma
viride, or other divergent species such as T. polysporum.
They would not be immediately recognized as Trichoderma
despite their phylogenetic inclusion in the genus. Moreover,
some holomorphic species, such as H. peltata Jungh. and H.
spinulosa, are not known to have asexual morphs.
In the case of Trichoderma vs. Hypocrea, considerable
disruption will result regardless of which genus is given
priority. If Hypocrea is adopted, there will be relatively
few nomenclatural changes, but the impact on the user
communities will be tremendous and the morphological
concept of the phylogenetic Trichoderma will be greatly
modified. On the other hand, if Trichoderma is selected, a
potentially daunting number of transfers from Hypocrea
into Trichoderma are possible, but the impact on the user
communities will be minimal. For several months of 2011–
2012 a vote was organized by the International Subcomission
on Trichoderma and Hypocrea taxonomy (www.isth.info)
to determine the will of the Trichoderma/Hypocrea user
communities as regards adoption of Trichoderma. As of
30 Nov. 2012, 75 people had voted, of whom 54 favored
Trichoderma and 22 favored Hypocrea. Thus the clear
preference of the Trichoderma user communities is for
adoption of Trichoderma rather than Hypocrea. Although
Hypocrea typifies the family Hypocreaceae and order
Hypocreales, these familial and ordinal names are retained
despite the synonymy of Hypocrea with Trichoderma (Art.
11). Given the preponderance of Trichoderma usage in the
applied literature, and given that few Hypocrea species
have been reported more than once, we recommend that
the use of the name Hypocrea be discontinued in favour of
Trichoderma.
Nectriaceae
Actinostilbe Petch 1925 vs. Lanatonectria Samuels
& Rossman 1999
The sexual morph-typified genus Lanatonectria was
established for nectria-like species having red ascomata with
distinct yellow, curly hairs, and Actinostilbe asexual states
(Rossman et al. 1999). The type species of Actinostilbe, A.
vanillae Petch 1925, has distinctive yellow hairs, although no
sexual state is known for this species. The type species of
Lanatonectria, L. flocculenta (Henn. & E. Nyman) Samuels &
Rossman 1999, is the asexual state A. macalpinei (Agnihothr.
& G.C.S. Barua) Seifert & Samuels 1999. Five species have
been placed in Lanatonectria, two of which have Actinostilbe
asexual states; these species are relatively common in the
tropics. Given the relative obscurity of these genera, the
recent date of the sexual morph generic name, and the few
names involved, we propose to that the name Lanatonectria
be abandoned in favour of the older and more widely used
asexual morph-typified generic name Actinostilbe. Three new
combinations are required and made below 4 .
Cylindrocladiella Boesew. 1982 vs. Nectricladiella
Crous & C. L. Schoch 2000
The generic name Cylindrocladiella Boesew. 1982 was
proposed by Boesewinkel (1982) to accommodate
cylindrocladium-like species with small conidia and aseptate
stipe extensions with C. parva (P.J. Anderson) Boesew.
4
Actinostilbe flocculenta (Henn. & E. Nyman) Rossman, Samuels
& Seifert, comb. nov.
MycoBank MB802534
Basionym: Nectriella flocculenta Henn. & E. Nyman, in Warburg,
Monsunia 1:160 (1899).
Actinostilbe flavolanata (Berk. & Broome) Rossman, Samuels &
Seifert, comb. nov.
MycoBank MB802535
Basionym: Nectria flavolanata Berk. & Broome, J. Linn. Soc., Bot.
14: 114 (1873).
Actinostilbe oblongispora (Y. Nong & W.Y. Zhuang) Rossman,
Samuels & Seifert, comb. nov.
MycoBank MB802536
Basionym: Lanatonectria oblongispora Y. Nong & W.Y. Zhuang,
Fungal Diversity 19: 98 (2005).
46 ima fUNGUS

Genera in Hypocreales proposed for acceptance or rejection
1982 as type species. Although Peerally (1991) contested
the placement of several Cylindrocladium species in
Cylindrocladiella, Schoch et al. (2000) were able to confirm
the separate generic status of Cylindrocladiella. The sexual
morph-typified genus Nectricladiella Crous & C.L. Schoch
2000 was introduced with N. camelliae (Shipton) Crous
& C.L. Schoch 2000 as type species. Recently, Lombard
et al (2012) were able to show that N. infestans Boesew.
1982 was incorrectly linked to the asexual morph-typified
species C. infestans, and therefore introduced the name C.
pseudoinfestans L. Lombard & Crous 2012 as a replacement
for N. infestans auct. Currently there are 26 names accepted
in Cylindrocladiella and only one name in the genus
Nectricladiella (N. camelliae linked to C. microcylindrica
Crous & D. Victor 2000), and therefore we propose to
that the generic name Cylindrocladiella be protected over
Nectricladiella.
Fusarium Link 1809 vs. Gibberella Sacc. 1877
The genus Fusarium Link 1809 : Fr. is typified by Fusarium
roseum Link 1809, now considered to be F. sambucinum Fuckel
1870 nom. cons. The genus Gibberella Sacc. 1877 is typified
by Gibberella pulicaris (Fr.) Sacc. 1887 having an asexual
state referred to as Fusarium sambucinum, an important
pathogen on potatoes. The genus Fusarium includes many
important plant pathogens. Fusarium oxysporum Schltdl.
1824 has no known sexual state, but has been shown to
belong in Fusarium in the strict sense including those species
that have Gibberella sexual states. There is no question that
the genera Fusarium and Gibberella are synonyms. The
genus Fusarium is well characterized phylogenetically and
can be considered as one large genus (Geiser et al., 2012) or
as several major clades some of which have sexual morphtypified
generic names (Rossman et al. 1999, Schroers et al.
2011). None of these names compete with Fusarium in the
narrow sense. They include Albonectria Rossman & Samuels
1999, Cyanonectria Samuels & Chaverri 2009, Geejayessia
Schroers et al. 2011, and Neocosmospora E. F. Sm. 1899
(Gräfenhan et al. 2011, Schroers et al. 2011). Although
opinions differ on how to circumscribe the genus Fusarium,
there is universal agreement that the asexual morph-typified
generic name Fusarium should be used instead of the sexual
morph-typified Gibberella. It is proposed here that Gibberella
be suppressed in favour of Fusarium.
Exclusion of the Fusarium episphaeria-group from
the genus Fusarium is widely accepted based on the
phylogenetic distance of these species from the core species
of Fusarium mentioned above. These species have sexual
states placed in Cosmospora Rabenh. 1862 sensu lato,
although this genus has been divided into additional genera
(Gräfenhan et al. 2011). Their biology differs from the species
of Fusarium discussed above in being primarily fungicolous
and insecticolous, rather than plant pathogenic.
was described with the type, L. clusiae Samuels & Rogerson)
Rossman et al. (1993) (basionym: Pseudonectria clusiae
Samuels & Rossman 1990). Species of Gliocephalotrichum
have been widely reported from soils. Given the relative
obscurity of Leuconectria, with only two species, and the
need to make name changes if Leuconectria were used,
we propose that the sexual morph-typified generic name
Leuconectria be suppressed in favour of the asexual morphtypified
name Gliocephalotrichum, which has priority by date.
Only a single new combination is required by this decision 5 .
Gliocladiopsis S.B. Saksena 1954 vs. Glionectria
Crous & C.L. Schoch 2000
The genus Gliocladiopsis S.B. Saksena 1954, based on
G. sagariensis S.B. Saksena 1954, was introduced by
Saksena (1954) to accommodate a fungal isolate from soil
that has penicillate conidiophores resembling Penicillium
and Gliocladium. This genus was initially synonymized under
Cylindrocarpon (Agnihothrudu 1959) and Cylindrocladium
(Barron 1968), but resurrected by Crous & Wingfield (1993)
and characterized by dense, penicillate conidiophores
producing aseptate to 1-septate cylindrical conidia and
lacking sterile stipe extensions distinguishing it from
Cylindrocladiella and Cylindrocladium. The generic status of
Gliocladiopsis was further confirmed by Schoch et al. (2000),
who introduced the generic name Glionectria Crous & C. L.
Schoch 2000, with the type species G. tenuis Crous & C. L.
Schoch 2000, the presumed sexual morph of Gliocladiopsis.
tenuis (Bugn.) Crous & M.J. Wingf. 1993. Lombard & Crous
(2012) distinguished G. sagariensis from G. tenius based
on phylogenetic inference. That study also proposed G.
pseudotenuis as a new name for the asexual morph of
Gliocladiopsis tenuis, which was shown to be distinct from
G. tenuis. Therefore we propose the protection of the genus
name Gliocladiopsis over the generic name Glionectria.
Nalanthamala Subram. 1956 vs. Rubrinectria
Rossman & Samuels 1999
The sexual morph-typified genus Rubrinectria was established
for nectria-like species having red perithecioid ascomata
with “a green-tinged, warted wall, golden-brown, coarsely
striate ascospores,…” (Rossman et al. 1999) and a complex
anamorph including penicillium-like and sporodochial
structures bearing conidia in chains and an acremonium-like
synanamorph forming conidial heads (Schroers et al. 2005).
The type and only species, R. olivacea (Seaver) Rossman
& Samuels 1999 (basionym: Macbridella olivacea Seaver
1910), is a relatively common tropical fungus that occurs on
dead woody stems of palms and other woody substrates.
The sexual morph of R. olivacea was later identified as an
unnamed Nalanthamala species by Schroers et al. (2005),
who included seven species in that asexual morph-typified
genus. The type species of Nalanthamala, N. madreeya
ARTICLE
Gliocephalotrichum J.J. Ellis & Hesselt. 1962 vs.
Leuconectria Rossman et al. 1993
The genus Gliocephalotrichum J.J. Ellis & Hesselt. 1962,
typified by G. bulbillium J.J. Ellis & Hesselt. 1962, includes
seven described species. When a sexual state was
discovered for the type species, a new genus, Leuconectria,
5
Gliocephalotrichum grande (Y. Nong & W.Y. Zhuang) Rossman &
L. Lombard, comb. nov.
MycoBank MB802537
Basionym: Leuconectria grandis Y. Nong & W.Y. Zhuang, Fungal
Diversity 24: 349 (2007).
volume 4 · no. 1
47

Rossman et al.
ARTICLE
Subram. 1956, is relatively unknown and there is no extant
culture, but, based on the original description, Schroers et al.
(2005) concluded that three economically important species
should be recognized in Nalanthamala: N. diospyri (Crandall)
Schroers & M.J. Wingf. 2005, the persimmon wilt fungus; N.
psidii (Sawada & Kurosawa) Schroers & M.J. Wingf. 2005,
cause of wilt disease of guava; and N. vermoesenii (Biourge)
Schroers 2005, cause of necrosis and blight of palms. They
demonstrated using LSU sequences that this genus belongs
in Nectriaceae and further, inferred monophyly of six cultured
species using ITS and LSU and partial beta-tubulin gene
introns and exons. Only one name is currently combined in
Rubrinectria and, if that name were taked up, it would result
in several names changes including the three of economic
importance noted above. We therefore proposed that
Rubrinectria be suppressed in favor of the older and more
widely used generic name Nalanthamala 6 .
Nectria (Fr.) Fr. 1849 vs. Tubercularia Tode 1790
For about 150 years, the generic name Nectria was used
for bright-coloured, uniloculate, perithecial ascomycetes.
Following the informal designation of the N. cinnabarinagroup
by Booth (1971) as presumptive type of the genus,
the concept of Nectria was gradually refined to coincide with
that group, and is now restricted to only 29 species (Hirooka
et al. 2012). Many of the 1104 described names in Nectria
have been allocated to other genera, including Bionectria,
Haematonectria, Lanatonectria, Leuconectria, Neonectria,
and Sphaerostilbella; several of these names are considered
elsewhere in the present article. Nectria is also the nominal
genus of the family Nectriaceae Tul. & C. Tul. 1865, one of
the most economically important families in the Hypocreales.
The accepted type species of Nectria is the wellknown
N. cinnabarina (Tode ) Fr. 1849 , the sexual morph
of Tubercularia vulgaris Tode 1790, cause of coral spot
of hardwood trees. Tubercularia is typified by the same
species, T. vulgaris, the asexual morph of N. cinnabarina.
Thus these generic names are congeneric and changes in
taxonomic concepts or phylogenetic analyses will not alter
their synonymy. About 247 species of Tubercularia have been
described and the form-taxon concept of this genus included
pale-coloured, sporodochial fungi with slimy aseptate
conidia; it has never been monographed. Thirty asexual
morph names associated with the N. cinnabarina complex
were revised by Seifert (1985); although unpublished, his
subsequent revision of additional names uncovered species
that would now be classified in Clonostachys, Colletotrichum,
Coryne, Fusarium, and Hymenella. Tubercularia is the
nominal genus of the family name Tuberculariaceae Fr.
1825, which is no longer used but is widely associated
with Saccardo’s sporophore and spore-based taxonomy
of conidial fungi. Both Nectria and Tubercularia have been
used in a broad sense historically, and their modern concepts
have developed more or less in synchrony over the last 40
years. Both names are well-known to mycologists, though
not all may be aware of the nuances that now restrict the
generic concept. If the genus Nectria in the strict sense were
protected against Tubercularia, only three species would
require name changes. There is a possibility that some of
the older asexually typified epithets might supplant the newly
described Nectria epithets in the segregate species of the
N. cinnabarina complex proposed by Hirooka et al. (2011),
but that could perhaps be avoided by their inclusion in a list
of suppressed names. If the name Tubercularia were used,
most of the 29 names accepted by Hirooka et al. (2012) would
have to be recombined in that genus. We propose that the
generic name Nectria be protected against Tubercularia by
suppression of the latter generic name. Further, the important
family name Nectriaceae Fr. 1849 will need to be protected
by suppression of Tuberculariaceae Fr. 1825.
Species names in Nectria
Nectria cinnabarina based on Sphaeria cinnabarina 1791 vs.
Tubercularia vulgaris 1790.
As noted above, these two names are the types of their
respective genera. Although the species is of limited
significance as a plant pathogen, it is also well-known by field
mycologists. Both names are used in the plant pathology and
mushroom-guide literature, often with explicit statements
that they are a sexual-asexual pair. Although T. vulgaris is an
older epithet, the epithet is pre-occupied in Nectria by Nectria
vulgaris Speg. 1881. None of the other asexual-morph
synonyms of T. vulgaris listed by Seifert (1985) predate
Sphaeria cinnabarina. Therefore, the name N. cinnabarina
should be used for this species; it does not need to be
protected or conserved against T. vulgaris.
We also take the opportunity to clarify the nomenclature of
one species, and find a name change is necessary in another:
(1) Nectria pseudotrichia Berk. & M. A. Curtis 1854 (based
on “ Sphaeria pseudotrichia Schwein.” nom. inval. (Art. 29.1)
vs. Tubercularia lateritia (Berk.) Seifert 1985 (basionym
Stilbum lateritium Berk. 1840).
This is the most common tropical species of this genus.
Seifert (1985) transferred Stilbum lateritium to Tubercularia,
replacing the name Stilbum cinnabarinum Mont. 1837
(syn. Stilbella cinnabarina (Mont.) Wollenw.1926), which is
listed as a nomen rejiciendum under Art. 56.1. Although N.
pseudotrichia and S. cinnabarinum were frequently used for
this species in the historical literature, T. lateritia has been
used for the asexual morph of this fungus only since 1985.
However, as this epithet is pre-occupied in Nectria by N.
lateritia (P. Karst.) Rossman 1983, there is no need for N.
pseudotrichia to be protected over S. lateritium.
(2) Nectria grayana (Sacc. & Ellis) Hirooka & Seifert 2013 7
(basionym: Ciliciopodium grayanum Sacc. & Ellis 1882) vs
Nectria canadensis Ellis & Everh. 1884. The name used for
6
Nalanthamala olivacea (Seaver) Rossman, comb. nov.
MycoBank MB803882
Basionym: Macbridella olivacea Seaver, Mycologia 2: 178 (1910).
7
Nectria grayana (Sacc. & Ellis) Hirooka & Seifert, comb. nov.
MycoBank MB802538
Basionym: Ciliciopodium grayanum Sacc. & Ellis, Michelia 2: 581
(1882).
48 ima fUNGUS

Genera in Hypocreales proposed for acceptance or rejection
this species in the monograph of Nectria by Hirooka et al.
(2012) is Nectria canadensis. This poorly known species
has an earlier epithet in the genus Ciliciopodium Corda
1831. That genus was based on C. violaceum Corda 1831,
described from dog faeces, and is not congeneric with Nectria
(Seifert1985). Given the obscurity of this species, it seems
acceptable to use the earliest epithet for this species.
Neonectria Wollenw. 1917 vs. Cylindrocarpon
Wollenw. 1913
The genus Cylindrocarpon Wollenw. 1913, based on C.
cylindroides Wollenw. 1913, has been circumscribed in a
broad sense to include all species having cylindrocarpon-like
conidia. Many of these species are known to have nectrialike
sexual states (Booth 1966). Rossman et al. (1999)
resurrected Neonectria Wollenw. 1917 for the sexual state
of species of Cylindrocarpon. Recently several new genera
were segregated from Neonectria, all of which have asexual
morphs belonging to Cylindrocarpon in the broad sense
(Chaverri et al. 2011). Both the type species of Neonectria,
N. ramulariae Wollenw. 1917, and Cylindrocarpon, C.
cylindroides, belong to the same genus in the restricted sense
(Castlebury et al. 2006, Chaverri et al. 2011). Neonectria in
the strict sense includes the cause of European beech bark
disease, N. coccinea (Pers.) Rossman & Samuels 1999;
American beech bark disease, N. faginata (M. L. Lohman et
al.) Castl. & Rossman 2006; and hardwood canker disease,
N. ditissima (Tul. & C. Tul.) Samuels & Rossman 2006
(Castlebury et al. 2006). A number of other important plant
pathogenic fungi are included in Cylindrocarpon in the broad
sense. The most commonly encountered species, previously
known as Cylindrocarpon destructans (Zinssm.) Scholten
1964 is now placed in a segregate genus as Ilyonectria
radiciola (Gerlach & L. Nilsson) P. Chaverri & Salgado 2011
(Cabral et al. 2012). Given the broad classical concept of
the genus Cylindrocarpon and the well-circumscribed genus
Neonectria that includes a number of plant pathogenic
species, we recommend that the generic name Neonectria
be protected against Cylindrocarpon.
REFERENCES
Agnihothrudu V (1959) Notes on fungi from north-east India.
Transactions of the British Mycological Society 42: 458–462.
Barron GL (1968) The Genera of Hyphomycetes from Soil. Baltimore,
MD: Williams & Wilkins.
Bissett J (1984) A revision of the genus Trichoderma. I. Section
Longibrachiatum, sect. nov. Canadian Journal of Botany. 62:
924–931.
Bissett J (1991a) A revision of the genus Trichoderma. II. Infrageneric
classification. Canadian Journal of Botany 69: 235–2372.
Bissett J (1991b) A revision of the genus Trichoderma. III. Section
Pachybasium. Canadian Journal of Botany 69: 237–2416.
Boesewinkel HJ (1982) Cylindrocladiella, a new genus to
accommodate Cylindrocladium parvum and other small-spored
species of Cylindrocladium. Canadian Journal of Botany 60:
2288–2294.
Booth C (1966) The genus Cylindrocarpon. Mycological Papers 104:
1–56.
Booth C (1971) The Genus Fusarium. Kew: Commonwealth
Mycological Institute.
Cabral A, Rego C, Nascimento T, Oliveira H, Groenewald JZ,
Crous PW (2012) Multi-gene analysis and morphology reveal
novel Ilyonectria species associated with black foot disease of
grapevines. Fungal Biology 116: 62–80.
Castlebury LA, Rossman AY, Hyten AS (2006) Phylogenetic
relationships of Neonectria/Cylindrocarpon on Fagus in North
America. Canadian Journal of Botany 84: 1417–1433.
Chaverri P, Salgado C, Hirooka Y, Rossman AY, Samuels GJ (2011)
Delimitation of Neonectria and Cylindrocarpon (Nectriaceae,
Hypocreales, Ascomycota) and related genera with
Cylindrocarpon-like anamorphs. Studies in Mycology 68: 57–78.
Chaverri P, Samuels GJ, Stewart EL (2001) Hypocrea virens sp. nov.,
the teleomorph of Trichoderma virens. Mycologia 93: 1113–1124.
Chaverri P, Castlebury LA, Overton BE, Samuels GJ (2003).
Species of Hypocrea and Trichoderma with green conidia,
and conidiophore elongations and related species in sect.
Pachybasium. Mycologia 95: 1100–1140.
Chen SF, Lombard L, Roux J, Xie YJ, Wingfield MJ, Zhou XD (2011)
Novel species of Calonectria associated with Eucalyptus leaf
blight in Southeast China. Persoonia 26: 1–12.
Crous PW (2002) Taxonomy and Pathology of Cylindrocladium
(Calonectria) and allied genera. St Paul, MN: American
Phytopathological Society Press.
Crous PW, Wingfield MJ (1993) A re-evaluation of Cylindrocladiella,
and a comparison with morphologically similar genera.
Mycological Research 97: 433–448.
Degenkolb T, Dieckmann R, Nielsen KF, Gräfenhan T, Theis C, Zafari
D, Chaverri P, Ismaiel A., Brückner H, von Döhren H, Thrane U,
Petrini O, Samuels GJ (2008a) The Trichoderma brevicompactum
clade: a separate lineage with new species, new peptaibiotics,
and mycotoxins. Mycological Progress 7: 177–219.
Degenkolb T, Döhren H von, Nielsen KF, Samuels GJ, Brückner H
(2008b) Recent advances and future prospects in peptaibiotics,
hydrophobins, and mycotoxin research, and their importance for
chemotaxonomy of Trichoderma and Hypocrea. Chemistry &
Biodiversity 5: 671–680.
Dingley JM (1957) Life history studies in the genus Hypocrea.
Transactions and Proceedings of the Royal Society of New
Zealand 84: 689–693.
Doi Y (1972) A revision of the Hypocreales with cultural observations
IV. The genus Hypocrea and its allies in Japan (2) Enumeration
of the species. Bulletin of the National Science Museum, Tokyo
15: 649–751.
Evans HC, Holmes KA, Thomas SE (2003) Endophytes and
mycoparasites associated with an indigenous forest tree,
Theobroma gileri, in Ecuador and a preliminary assessment
of their potential as biocontrol agents of cocoa diseases.
Mycological Progress 2: 149–160.
Gams W (1971) Cephalosporium-artige Schimmelpilze
(Hyphomycetes). Stuttgart: Gustav Fischer Verlag.
Gams W, Baral H-O, Jaklitsch WM, Kirschner R, Stadler M (2012)
Clarifications concerning the new Article 59 dealing with
pleomorphic fungi. IMA Fungus 3: 175–177.
Geiser DM, Aoki T, Bacon CW, Baker SE, Bhattacharayya MB,
Brandt M, Burgess LW, Chulze S, Coleman JJ, Correll JC, Covert
SF, Crous PW, Cuomo CA, de Hoog GS, Di Pietro A, Elmer WH,
Epstein L, Frandsen RJN, Freeman S, Gagkaeva T, Glenn AE,
Gordon TR, Gregory NF, Hammond-Kosack KE, Hanson LE,
ARTICLE
volume 4 · no. 1
49

Rossman et al.
ARTICLE
Jimenez-Gasco MD, Kang S, Kistler HC, Kuldau GA, Leslie
JF, Logrieco A, Lu G, Lysoe E, Ma L, McCormick SP, Migheli
Q, Moretti A, Munaut F, O’Donnell K, Pfenning LH, Ploetz RC,
Proctor RH, Rehner SA, Robert VARG, Rooney AP, Salleh B,
Scandiani MM, Scauflaire J, Short DPG, Steenkamp ET, Suga
H, Summerell BA, Sutton DA, Thrane U, Trail F, van Diepeningen
A, VanEtten HD, Viljoen A, Waalwijk C, Ward TJ, Wingfield MJ,
Xu J, Yang X, Yli-Mattila T, Zhang N (2013) One Fungus, One
Name: defining the genus Fusarium in a scientifically robust way
that preserves longstanding use. Phytopathology: (in press). DOI
10.1094/PHYTO-07-12-0150-LE.
Gräfenhan T, Schroers H-J, Nirenberg HI, Seifert KA (2011) An
overview of the taxonomy, phylogeny, and typification of
nectriaceous fungi in Cosmospora, Acremonium, Fusarium,
Stilbella, and Volutella. Studies in Mycology 68: 79–113.
Harman GE, Kubicek CP (eds.) (1998) Trichoderma and Gliocladium.
Vol. 2. Enzymes, Biological Control and Commercial Applications.
London: Taylor & Francis
Hawksworth DL (2011) A new dawn for the naming of fungi: impacts of
decisions made in Melbourne in July 2011 on the future publication
and regulation of fungal names. IMA Fungus 2: 155–162.
Hawksworth DL (2012) Managing and coping with names of
pleomorphic fungi in a period of transition. Mycosphere 2: 143–
155; IMA Fungus 3: 15–24.
Hirooka Y, Rossman AY, Chaverri P (2011) A morphological and
phylogenetic revision of the Necria cinnabarina species complex.
Studies in Mycology 68: 35–56.
Hirooka Y, Rossman AY, Samuels GJ, Lechat C, Chaverri P (2012)
A monograph of Allantonectria, Nectria, and Pleonectria
(Nectriaceae, Hypocreales, Ascomycota) and their pycndial,
sporodochial, and synnematous anamorphs. Studies in Mycology
71: 1–210.
Jaklitsch WM (2009) European species of Hypocrea Part I. The
green-spored species. Studies in Mycology 63: 1–91.
Jaklitsch WJ (2011) European species of Hypocrea part II: species
with hyaline ascospores. Fungal Diversity 48: 1–250.
Kubicek CP, Harman GE (eds.) (1998) Trichoderma and Gliocladium.
Vol.1. Basic Biology, Taxonomy and Genetics. London: Taylor &
Francis.
Lombard L, Crous PW (2012) Phylogeny and taxonomy of the genus
Gliocladiopsis. Persoonia 28: 25–33.
Lombard L, Crous PW, Wingfield BD, Wingfield MJ (2010) Phylogeny
and systematics of the genus Calonectria. Studies in Mycology
66: 31–69.
Lombard L, Polizzi G, Guarnaccia V, Vitale A, Crous PW (2011)
Calonectria spp. causing leaf spot, crown and root rot of
ornamentals in Tunisia. Persoonia 27: 73–79.
Lombard L, Shivas RG, To-Anun C, Crous PW (2012) Phylogeny and
taxonomy of the genus Cylindrocladiella. Mycological Progress
11: 835–868.
Manamgoda DS, Cai L, McKenzie EHC, Crous PW, Madrid H,
Chukeatirote E, Shivas RG, Tan YP, Hyde KD (2012) A phylogenetic
and taxonomic re-evaluation of the Bipolaris - Cochliobolus -
Curvularia complex. Fungal Diversity 56: 131–144.
McNeill J, Barrie FF, Buck WR, Demoulin V, Greuter W, Hawksworth
D L, Herendeen PS, Knapp S, Marhold K, Prado J, Prud’homme
van Reine WF, Smith GF, Wiersema J, Turland NJ (eds.) (2012)
International Code of Nomenclature for algae, fungi, and plants
(Melbourne Code). [Regnum vegetabile no. 154.] Königstein:
Koeltz Scientific Books.
McNeill J, Barrie FR, Burdet HM, Demoulin V, Hawksworth DL,
Marhold K, Nicolson DH, Prado J, Silva PC, Skog JE, Wiersema
JH, Turland NJ. (eds) (2006) International Code of Botanical
Nomenclature (Vienna Code). [Regnum vegetabile no. 146.]
Ruggell: A. R. G. Gantner Verlag.
Norvell L (2011) Fungal nomenclature. 1. Melbourne approves a new
Code. Mycotaxon 116: 481–490.
Peerally A (1991) The classification and phytopathology of
Cylindrocladium species. Mycotaxon 40: 323–366.
Põldmaa K (2003) Three species of Hypomyces growing on
basidiomata of Stereaceae. Mycologia 95: 921–933.
Põldmaa K (2011) Tropical species of Cladobotryum and Hypomyces
producing red pigments. Studies in Mycology 68: 1–34.
Põldmaa K, Samuels GJ, Lodge DJ (1997) Three new polyporicolous
species of Hypomyces and their Cladobotryum anamorphs.
Sydowia 49: 80–93.
Põldmaa K, Samuels GJ (1999) Aphyllophoricolous species of
Hypomyces with KOH-negative perithecia. Mycologia 91: 177–
199.
Põldmaa K, Samuels GJ (2004) Fungicolous Hypocreaceae
(Ascomycota: Hypocreales) from Khao Yai National Park,
Thailand. Sydowia 56: 79–130.
Rehner SA, Samuels GJ (1994) Taxonomy and phylogeny of
Gliocladium analyzed by large subunit rDNA sequences.
Mycological Research 98: 625–634.
Rogerson CT, Samuels GJ (1985) Species of Hypomyces and
Nectria occurring on discomycetes. Mycologia 77: 763–783.
Rogerson CT, Samuels GJ (1989) The boleticolous species of
Hypomyces. Mycologia 81: 413–432.
Rogerson CT, Samuels GJ (1993) Polyporicolous species of
Hypomyces. Mycologia 85: 231–272.
Rogerson CT, Samuels GJ (1994) [1995] Agaricicolous species of
Hypomyces. Mycologia 86: 839–866.
Rossman AY (1979) Calonectria and its type, C. daldiniana, a later
synonym of C. pyrochroa. Mycotaxon 8: 321–328.
Rossman AY, Samuels GJ, Lowen R (1993) Leuconectria clusiae
gen. nov. and its anamorph Gliocephalotrichum bulbilium with
notes on Pseudonectria. Mycologia 85: 685–704.
Rossman AY, Samuels GJ, Rogerson CT, Lowen R (1999) Genera of
Bionectriaceae, Hypocreaceae, and Nectriaceae (Hypocreales,
Ascomycetes). Studies in Mycology 42: 1–248.
Rossman AY, Seifert KA (2011) Phylogenetic revision of taxonomic
concepts in the Hypocreales and other Ascomycota – A tribute to
Gary J. Samuels. Studies in Mycology 68: 1–247.
Saksena SB (1954) A new genus of Moniliaceae. Mycologia 46:
660–666.
Samuels GJ, Ismaiel A, Mulaw TB, Szakacs G, Druzhinina IS,
Kubicek CP, Jaklitsch WM (2012) The Longibrachiatum Clade
of Trichoderma: a revision with new species. Fungal Diversity
55: 77–108.
Schoch CL, Crous PW, Wingfield MJ, Wingfield BD (2000) Phylogeny
of Calonectria and selected hypocrealean genera with cylindrical
macroconidia. Studies in Mycology 45: 45–62.
Schroers H-J, Samuels GJ, Seifert KA, Gams W (1999) Classification
of the mycoparasite Gliocladium roseum in Clonostachys as
C. rosea, its relationship to Bionectria ochroleuca, and notes on
other Gliocladium-like fungi. Mycologia 91: 365–385.
Schroers H-J (2001) A monograph of Bionectria (Ascomycota,
Hypocreales, Bionectriaceae) and its Clonostachys anamorphs.
Studies in Mycology 46: 1–214.
50 ima fUNGUS

Genera in Hypocreales proposed for acceptance or rejection
Schroers H-J, Geldenhuis MM, Wingfield MJ, Schoeman MH, Yen
Y-F, Shen W-C, Wingfield BD (2005) Classification of the guava
wilt fungus Myxosporium psidii, the palm pathogen Gliocladium
vermoesenii, and the persimmon wilt fungus Acremonium
diospyri in Nalanthamala. Mycologia 97: 375–395.
Schroers H-J, Gräfenhan T, Nirenberg HI, Seifert KA (2011) A revision
of Cyanonectria and Geejayessia gen. nov. and related species
with Fusarium-like anamorph. Studies in Mycology 68: 115–138.
Seifert KA (1985) A monograph of Stilbella and some allied
hyphomycetes. Studies in Mycology 27: 1–234.
Summerbell RC, Gueidan C, Schroers H-J, de Hoog GS, Starink M,
Rosete YA, Guarro J, Scott JA (2011) Acremonium phylogenetic
overview and revision of Gliomastix, Sarocladium, and
Trichothecium. Studies in Mycology 68: 139–162.
ARTICLE
volume 4 · no. 1
51

ARTICLE
ima fUNGUS

doi:10.5598/imafungus.2013.04.01.06
IMA Fungus · volume 4 · no 1: 53–56
Names of fungal species with the same epithet applied to different morphs:
how to treat them
David L. Hawksworth 1 , John McNeill 2 , Z. Wilhelm de Beer 3 , and Michael J. Wingfield 3
1
Departamento de Biología Vegetal II, Facultad de Farmacia, Universidad Complutense de Madrid, Plaza Ramón y Cajal, Madrid 28040, Spain;
Department of Life Sciences, The Natural History Museum, Cromwell Road, London SW7 5BD, UK; Department of Biology and Chemistry,
Birkbeck University of London, Malet Street, Bloomsbury, London WC1E 7HX, UK; corresponding author e-mail: d.hawksworth@nhm.ac.uk
2
Royal Botanic Garden Edinburgh, 20A Inverleith Row, Edinburgh EH3 2LR, UK; Royal Ontario Museum, Toronto, Canada
3
Department of Microbiology and Plant Pathology, Forestry and Agricultural Biotechnology Institute, University of Pretoria, Pretoria 0002, South
Africa
ARTICLE
Abstract: The abolition of the separate naming of different morphs of the same fungal species in 2011 will inevitably
result in many name changes in some genera. The working practices commended here are intended to minimize
one category of these changes, that which can arise as a consequence of an author using the epithet of an asexual
morph when describing the sexual morph of the same species. We consider that name proposed for the sexual
morph in such cases should be treated as a formal error for a new combination and not as a new species, and so be
corrected. This is interpreted as applying even where the author indicated that a new species was being described
and designated a type. We argue that those formalities were a result of the requirements of the rules then in force,
as the author recognized that a morph of a named species was being described, and not a new hitherto unnamed
species was being reported – but was barred from making a new combination so used the same epithet for the
new morph name instead. Where a type with the sexual morph was designated for the sexual morph, under this
interpretation that no longer has nomenclatural status, the type being that of the basionym. The material for the sexual
morph indicated as a type, would be available for designation as an epitype, though a modern sequenced sample with
both sexual and asexual morphs would be more informative as an epitype in many cases. A proposal to regularize
the working practice commended here, and also the converse situation where the sexual morph typified name is the
earlier, will be made to the 2017 Shenzhen Congress.
Key words:
Anamorph
Article 59
Epitype
New combinations
Pleomorphic fungi
Teleomorph
Typification
Article info: Submitted: 24 March 2013; Accepted: 1 April 2013; Published: 4 April 2013.
INTRODUCTION
From 1912 until 2011, the various editions of the Rules
and Codes that regulated the names of fungi, provided for
the separate naming of asexual and sexual morphs of the
same species. The detailed requirements varied markedly
under different sets of provisions, especially before and
after the decisions of the 1981 Sydney Congress. While
the mycologists present at the Melbourne Congress in 2011
worked to provide rules that would minimize the disruption
of well-established and familiar names, now included in the
International Code of Nomenclature for algae, fungi, and
plants (ICN; McNeill et al. 2012) 1 , not all situations could be
resolved satisfactorily at that time. Here we draw attention to
one of those situations, and propose a possible solution.
1
For summaries of these changes, and discussion of pertinent
issues, see Braun (2012), Gams et al. (2012b), Hawksworth (2011,
2012), Norvell (2011), and Wingfield et al. (2012).
NAMES OF MORPHS OF A SPECIES WITH
THE SAME EPITHET
Some of the previous sets of rules governing the names of
different morphs of a single fungus species, include one that
stated that species names typified by an asexual morph could
not be combined legitimately into a genus, the name of which
was typified by a sexual morph. However, under later versions
of the rules, such a combination would be legitimate but only
apply to the morph of the basionym, regardless of the generic
name used. For many years, where new combinations were
made under a generic name with a sexually typified type,
they were ruled instead as names of new species provided
that the other requirements of valid publication were met.
This was so even though the author had clearly indicated that
a new combination was being made and not a new species
described.
That situation can be illustrated by a case given in
various editions of the Codes. Mycosphaerella aleuritidis
(Miyake) S. H. Ou 1940, published as a new combination on
© 2013 International Mycological Association
You are free to share - to copy, distribute and transmit the work, under the following conditions:
Attribution:
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).
Non-commercial: You may not use this work for commercial purposes.
No derivative works: You may not alter, transform, or build upon this work.
For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get
permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.
volume 4 · no. 1
53

Hawksworth et al.
ARTICLE
discovery that the fungus had a sexual morph belonging to
Mycosphaerella, but with the asexually typified Cercospora
aleuritidis Miyake 1912 as basionym, was nevertheless
treated as a new species Mycosphaerella aleuritidis S. H. Ou
1940, attributed to Ou alone, as a Latin description of the
sexual morph had been included (e.g. Vienna Code Art. 59
Ex. 6; McNeill et al. 2006). With the changes effected at the
Melbourne Congress in 2011, enabling names to compete
regardless of the morph represented by their name-bearing
types, Ou’s combination can be accepted as legitimate and
the original citation has to be reinstated as Mycosphaerella
aleuritidis (Miyake) S. H. Ou 1940 (Melbourne Code Art. 59
Ex. 2).
Some mycologists, especially ones working with plant
and human pathogens, were conscious of the importance
of minimizing the disruption of names when sexual morphs
were discovered and sought to retain a thread of familiarity.
They achieved this by using the same species epithet in
the sexually typified generic name, but with a sexual morph
designated as type of that name. Indeed, this was commended
as good-practice by many mycologists, and became the
norm in the case of plant pathogens. Examples are: the
coffee pathogen Gibberella stilboides W. L. Gordon & C.
Booth 1971, introduced for the sexual morph of the asexually
typified Fusarium stilboides Wollenw. 1924 (Vienna Code Art.
59 Ex. 3); and Neosartorya fumigata O’Gorman et al. 2009
introduced on discovery of a sexual morph in the asexually
typified Aspergillus fumigatus Fresen. 1863, the primary
agent of sometimes fatal human aspergillosis. In these and
similar cases, the sexual morph names are accompanied by
a Latin description or diagnosis and designation of a namebearing
type in which the sexual stage is present.
Under the Melbourne Code (McNeill et al. 2012), names
typified by a sexual or an asexual morph compete on an equal
footing for priority. As names such as Gibberella stilboides
and Neosartorya fumigata have different types than Fusarium
stilboides and Aspergillus fumigatus respectively, they are
nomenclaturally independent and have priority only from 1971
not 1924, and 2009 not 1863, respectively. This means that it
would not be possible to recombine the earliest epithet in the
same rank into a genus considered appropriate on taxonomic
grounds as it would be pre-occupied. A problem arises in
these two examples if there is an asexual morph-typified and
legitimate name with a different epithet, which is a synonym
published before 1971 and 2009, respectively. Under the
Melbourne Code, such a name would be priorable and have
to be combined into the desired genus. This is irrespective of
how unfamiliar that name might be and, unless it is formerly
proposed for rejection or included in one of the proposed lists
of protected fungal names, it would have to be taken up. The
following two examples illustrate these different situations.
(1) An instance where two identical epithets are
involved, but where a type was not explicitly designated
for the sexual morph, is provided by Ceratocystis paradoxa
(Dade) C. Moreau 1952, a species which causes stem and
other rots in banana, cocoa, coconut, oil palm, pineapple,
sugarcane and other mainly tropical plants. Moreau’s
combination was based on Ceratostomella paradoxa Dade
1928, a name introduced on discovery of the sexual morph
of Sporoschisma paradoxum De Seynes 1886 (syn. Chalara
paradoxa (De Seynes) Sacc. 1892; Thielaviopsis paradoxa
(De Seynes) Höhn. 1904) in artificial culture. De Seynes’s
name was listed as a synonym (i.e. as the asexual morph),
a Latin description was provided, and Dade did not include
“De Seynes” in his ascription. It is also clear that he was only
introducing a new taxon name without “De Seynes” as that
was required by the rules in force at the time (Brussels Rules,
Briquet 1912). Dade used a single isolate for his experiments,
but he did not use the word “type”. But under the current rules,
in which names of pleomorphic fungi must in general conform
to the same provisions as other names, Dade should indeed
have published a new combination based on Sporoschisma
paradoxum De Seynes. However, because Dade used “the
epithet that ought to have been adopted” (Art. 52.1), he did
not create a superfluous name; consequently, as no other
provisions of the Melbourne Code apply, his supposed new
species name can be treated as a new combination. This
would apply regardless of the organism involved, for example
whether a plant or fungus
A problem would arise, however, had Dade designated
a different type, because under Art. 9.1 and Note 1, the
author’s designation of a type “is final”, the name cannot
simply be treated as a new combination homotypic with De
Seynes’s name. Moreover, if De Seynes’s and Dade’s names
are treated as nomenclaturally separate with different types,
although the earliest name for the species under the ICN is
that of De Seynes, it could not be combined into Ceratocystis
as the binominal is pre-occupied by Moreau’s heterotypic
name. Thus the epithet “paradoxa” in Ceratocystis would
date from 1928 and not from 1886. As there is a pre-1928
synonym available, Stilbochalara dimorpha Ferd. & Winge
1910, that would mean that the correct name for this fungus
would be a new combination based on S. dimorpha, unless
that name was proposed formally for rejection or suppresion.
(2) A case in which a species has two identical epithets,
one with a sexual morph type and one with an asexual
morph type, and the new rules would mean that a different
unfamiliar name would have to be used, is that of Venturia
carpophila E. E. Fisher 1966. That fungus is responsible for
freckle or scab diseases in almonds, apricots, peaches, and
plums. Fisher discovered the sexual morph on overwintering
leaves, and designated a type with the sexual morph, while
listing Cladosporium carpophilum Thüm. 1877, typified
by the asexual morph, as if a synonym. In this instance,
Thümen’s name, although the earliest for the fungus, cannot
be combined into Venturia because it is preoccupied there
by that of Fisher. A consequence of this situation is that the
earliest available epithet at species rank for this plant pathogen
in Venturia becomes the almost unused Fusicladium pruni
Ducomet 1907. Ducomet’s name would have to be combined
into Venturia by a strict application of the Melbourne Code
as it has priority of 59 years over Fisher’s name, unless
Ducomet’s name was proposed for rejection or suppression.
THE PROBLEM AND A PRAGMATIC
SOLUTION
In principle it would be possible to deal with such cases under
the Melbourne Code, either through the conservation/rejection
54 ima fUNGUS

Names of fungal species with the same epithet
or protected/suppressed lists. However, formal proposals
for conservation and rejection under the ICN are timeconsuming
to prepare, involve voting by the Nomenclature
Committee for Fungi (NCF), and often take more than a year
to a recommendation. The adoption of lists of protected and
suppressed names will similarly be a protracted one, to judge
from experience to date. Against this background, mycologists
working in diverse applied aspects of the subject are becoming
impatient to desperate to know now what names should be
used in their current publications, and in plant quarantine,
health and safety, and other legal documents.
We consider that an alternative approach that could
be applied automatically and immediately is required, and
would not require any committee action or the publication of
separate proposals. In cases where a different morph is being
described, the authors recognize that they are not describing
a new species, only a morph of an already known species,
even where different types were designated. We suggest that
the principles adopted in the Mycosphaerella aleuritidis case
in previous Codes, noted above, are extrapolated to ones
where a name was introduced as a new species using the
same epithet as that of a previously named different morph
listed as a synonym. That is, that names such as Dade’s
and Fisher’s which were originally cited with them as the
sole authors, have to be treated as errors to be corrected
to that of new combinations and not independently typified
new species names. Implementation of this proposal in the
principle nomenclatural databases, MycoBank and Species
Fungorum, will necessarily be a piecemeal process given
the limited resources available, and it would be helpful if
mycologists encountering such cases altered the curators so
that they could implement the changes.
The principle argument in support of this interpretation
is that such names were introduced not because the author
considered that a new species had been found, but because
this was a requirement of the Code then in force. However,
unless limited by date, it is a regular practice for rules
adopted by one Congress to be retroactive. Indeed, in the
case of mycology, this has been the situation with regard
to issues such as the starting point dates for nomenclature,
the acceptance of metabolically inactive cultures as namebearing
types, and the different versions of Art. 59.
We consider, therefore, that an author’s use of the same
epithet is evidence which, had the possibility to make a
combination been permitted by the rules in force at the time,
a combination would have been made. Indeed, it must be
viewed as ironic that the consequence of an author using
the same epithet for a newly found sexual morph with
the intention of avoiding a change in epithet of a species
previously known only as an sexual morph, can lead to that
epithet no longer being available under the Melbourne Code.
The proposal made here must, therefore, be seen as in line
with the intent of the author of the later name. In particular, it is
also in accord with the thrust of the Code as expressed in Art.
41.4, in which “if no reference to a basionym is given but the
conditions for its valid publication as the name of a new taxon
or replacement name are fulfilled, that name is nevertheless
treated as a new combination or name at new rank when this
was the author’s presumed intent and a potential basionym
applying to the same taxon exists.”
PROPOSALS
Formal proposals for changes to the Melbourne ICN are not
being accepted for publication in Taxon until 2014, and even
if then supported by the Nomenclature Committee for Fungi
(NCF) and the General Committee on Nomenclature, any
rule change would not be ratified until the 2017 Shenzhen
Congress 2 . We consider that interim action is necessary to
avoid the disruption of familiar epithets in such instances.
Consequently, in anticipation of approval of an eventual
change in the ICN at the Congress in 2017, we suggest that
mycologists now confronted with this situation adopt the
following working practice:
If, prior to 1 January 2013, an author in introducing
a new species name for the sexual morph of a fungus
which had an earlier name typified by an asexual
morph, adopted the same species epithet as that of the
previously described asexual morph, the author’s name
is to be treated as a new combination and not that of a
new species with a separate type. Designations such as
“sp. nov.” and ascriptions excluding the earlier asexuallytypified
name are to be treated as formal errors requiring
correction. We further propose that this same practice
be adopted in the converse situation, i.e. where the name
typified by a sexual morph was the first published and
the same epithet was used for the subsequently named
asexual morph.
In cases where an author designated a holotype,
lectotype, or neotype, as the name is being treated as a new
combination under the working practice proposed here, that
designation would have no nomenclatural standing. The type
would be that of the basionym (Art. 7.3). In some cases it
may be convenient to designate the type indicated by the
author introducing the new name, or that of a later author in
the case of a lecto- or neo-typification, as an epitype to show
the sexual morph of the basionym. However, in perhaps a
majority of cases, it would be more helpful to designate a
modern culture or specimen, especially one that has been
sequenced and also has the sexual morph, as an epitype for
the type of the basionym. Each case will have to be examined
individually with respect to the issue of epitypification.
This proposal would go some way to addressing the
legitimate concern of Gams et al. (2012a) that established
and much-used combinations under the generic name now
of choice may be liable to disruption, because of priorable
names hitherto treated as being restricted to asexual morphs
of the same species.
We regret that this particular case was not covered in the
changes made with respect to the naming of pleomorphic
fungi at the Melbourne Congress in 2011, and that a final
decision will now have to await the 2017 Shenzhen Congress.
2
There could be advantages in the formal proposal to be made to
the Congress not being restricted to fungi, as there are some cases
in plants where such a provision would also be beneficial. The
proposals to be formulated in due course, therefore, could be general
ones applying to all similar cases in organisms governed by the ICN.
ARTICLE
volume 4 · no. 1
55

Hawksworth et al.
ARTICLE
ACKNOWLEDGEMENT
This contribution was completed while D.L.H. was in receipt of
funding from the Spanish Ministerio de Ciencia e Innovación project
CGL2011-25003. We are also indebted to Werner Greuter, Nicholas
J. Turland, and John H. Wiersema for stimulating and insightful
exchanges on the issues addressed in this contribution and their
positive suggestions as to how to resolve them, as well as for the
thoughtful comments of two referees.
REFERENCES
Braun U (2012) The impacts of the discontinuation of dual
nomenclature of pleomorphic fungi: the trivial facts, problems,
and strategies. IMA Fungus 3: 81–86.
Briquet J (1912) Règles internationales de la nomenclature botanique
. . . deuxième édition mise au point d’après les décisions du
Congrès International de Botanique de Bruxelles 1910. Jena:
Gustav Fischer Verlag.
Gams W, Baral H-O, Jaklitsch WM, Kirschner R, Stadler M (2012a)
Clarifications concerning the new Article 59 dealing with
pleomorphic fungi. IMA Fungus 3: 175–177.
Gams W, Humber RA, Jaklitsch WM, Kirschner R, Stadler M (2012b)
Minimizing the chaos following the loss of Article 59: suggestions
for a discussion. Mycotaxon 119: 501–512.
Hawksworth DL (2011) A new dawn for the naming of fungi: impacts
of decisions made in Melbourne in July 2011 on the future
publication and regulation of fungal names. MycoKeys 1: 7–20;
IMA Fungus 2: 155–162.
Hawksworth DL (2012) Managing and coping with names of
pleomorphic fungi in a period of transition. Mycosphere 3: 52–64;
IMA Fungus 3: 15–24.
McNeill J, Barrie FR, Burdet HM, Demoulin V, Hawksworth DL,
Marhold K, Nicolson DH, Prado J, Silva PC, Skog JE, Wiersema
JH, Turland NJ (eds) (2006) International Code of Botanical
Nomenclature (Vienna Code). [Regnum vegetabile no. 146.]
Ruggell: ARG Gantner Verlag.
McNeill J, Barrie FR, Buck WR, Demoulin V, Greuter W, Hawksworth
DL, Herendeen PS, Knapp S, Marhold K, Prado J, Prud’homme
van Reine WF, Smith GF, Wiersema J, Turland NJ (eds) (2012)
International Code of Nomenclature for algae, fungi, and plants
(Melbourne Code). [Regnum vegetabile no. 154.] Königstein:
Koeltz Scientific Books.
Norvell LL (2011) Fungal nomenclature. 1. Melbourne approves a
new Code. Mycotaxon 116: 481–490.
Wingfield MJ, de Beer ZW, Slippers B, Wingfield BD, Groenewald JZ,
Lombard L, Crous PW (2012) One fungus, one name promotes
progressive plant pathology. Molecular Plant Pathology 13: 604–
613.
56 ima fUNGUS

doi:10.5598/imafungus.2013.04.01.07
IMA Fungus · volume 4 · no 1: 57–69
Theissenia reconsidered, including molecular phylogeny of the type
species T. pyrenocrata and a new genus Durotheca (Xylariaceae,
Ascomycota)
Thomas Læssøe 1 , Prasert Srikitikulchai 2 , J. Jennifer D. Luangsa-ard 2 , and Marc Stadler 3, *
ARTICLE
1
Department of Biology, University of Copenhagen, Universitetsparken 15, Copenhagen, DK-2100 Ø, Denmark
2
National Center for Genetic Engineering and Biotechnology, 113 Thailand Science Park, Phahonyothin Road, Klong 1, Klong Luang, Pathumthani
12120, Thailand
3
Helmholtz Centre for Infection Research GmbH, Dept. Microbial Drugs, Inhoffenstraße 7, 38124 Braunschweig, Germany; corresponding author
e-mail: marc.stadler@helmholtz-hzi.de
Abstract: The genus Durotheca is introduced with D. depressa sp. nov., as type. Hypoxylon comedens is transferred to
Durotheca, based on its morphology with further evidence from molecular phylogenetic studies; a combined b-tubulin and
a-actin gene dataset. Theissenia cinerea is synonymized with D. comedens, and the type of Theissenia, T. pyrenocrata,
is shown to occupy a basal, rather distant position in a monotypic clade in relation to sequenced taxa of Durotheca. This
clade has an unresolved position in relation to the two informal subfamilies “Xylarioideae” and “Hypoxyloideae” within
the Xylariaceae. New distributional data for D. comedens and T. pyrenocrata are presented, with the former found to be
widespread in South-East Asia and the latter is reported as new from western Amazonia (Ecuador). One further species
described in Theissenia, T. rogersii, is transferred to Durotheca, whilst T. eurima is accepted in Theissenia.
Key words:
a-actin
ß-tubulin
Biodiversity
SEM
Thailand
Article info: Submitted: 10 March 2013; Accepted: 2 April 2013; Published: 14 May 2013.
Introduction
The genus Theissenia was introduced by Maublanc (1914)
for Ustulina pyrenocrata. Læssøe (1994) accepted this
genus within Xylariaceae, and Ju et al. (2003) recognized
three species in their monographic treatment. Subsequently,
another species was added and a phylogenetic analysis
based on DNA sequences from two of the accepted taxa,
but not the type species T. pyrenocrata, was provided (Ju et
al. 2007). The inclusion in Xylariaceae was confirmed, and
data were presented to show affinities within the subfamily
“Hypoxyloideae” 1 , a position never previously proposed. Ju et
al. (2003) had previously accepted, ad interim, a placement
within the Xylariaceae based on a Nodulisporium-morph
found in cultures of T. cinerea, but noted that the aleurisporous
asexual morph found in T. eurima was not as expected for
such a position. Furthermore, a similar asexual morph had
been observed in T. pyrenocrata. Ju et al. (2003) also noted
the extreme variability displayed among the four recognized
species, such as the absence/presence of germ slits, surface
ornamentation, and variability in ascospore wall thickness and
asexual morphs. In our continuing studies on the biodiversity
of Thai Xylariaceae, we have repeatedly encountered a
1
This subfamily name does not appear to have been validly published,
but is nevertheless widely used.
fungus that we identified as Hypoxylon comedens based
on a comparison with type material. Læssøe et al. (1989)
excluded H. comedens from both Camillea and Hypoxylon,
but were unable to suggest a revised placement. Also, the
new material, including cultures, did not provide sufficient
information to suggest a placement with confidence, not least
due to our cultures failing to produce an asexual morph. Ju et
al. (2003) shed some light on the situation, and we recognized
that our fungus was a member of Theissenia in the sense of
these authors.
Hypoxylon comedens was originally described from the
Malaysian state Sarawak on Borneo (Cesati 1879), and has
since been reported from China (Tai 1979, Zhuang 2001).
Material determined as “Hypoxylon cf. comedens” was
also reported from Mexico (San Martín González & Rogers
1993). Martin (1969) also published on a presumed H.
comedens from Mexico, including data on the asexual state,
but the material he used is evidently a species of Camillea.
The cardinal features that excludes H. comedens from
Hypoxylon, and its segregate genera, are the combination of
the highly carbonized and large perithecia seated directly on
the substrate, the clavate, deliquescing asci, and the peculiar
spore shape and pale pigmentation. Furthermore, most
collections yield no extractable pigments (with KOH) unlike
most members of Hypoxylon.
Here we report on further morphological and molecular
studies on material referable to H. comedens s.l. or Theissenia
© 2013 International Mycological Association
You are free to share - to copy, distribute and transmit the work, under the following conditions:
Attribution:
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).
Non-commercial: You may not use this work for commercial purposes.
No derivative works: You may not alter, transform, or build upon this work.
For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get
permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.
volume 4 · no. 1 57

Læssøe et al.
ARTICLE
from Thailand and other parts of South-East Asia, and most
importantly, on sequenced material of the type species of
Theissenia from Ecuador.
Material and methods
Sampling and culturing
Herbarium and genetic resource collection acronyms
follow Thiers (2010). Field collected stromata of Hypoxlon
comedens s.lat. and other xylariaceous species were taken
to sites where isolation work could be carried out within a few
hours. Within 2–3 d, ascospores germinated, and the resulting
cultures were transferred to fresh plates (in Thailand) and later
transferred to the collections at BCC. In Ecuador no culture
work was carried out, and attempts to culture Theissenia
pyrenocrata from dried material failed. All dried voucher
collections are held at BBH, with cultures deposited in BCC
(Thai material), or C and QCNE (Ecuadorian material).
Growth for DNA extraction
Cultures of Xylariaceae were grown on Potato Dextrose Agar
(PDA) Petri plates. These plates were incubated at room
temperature in darkness for 3–4 wk. A few small blocks of
PDA with sterile or sporulating mycelium of each sample
were taken from a plate and placed in 50 mL Sabouraud
Dextrose Broth (Sigma; SDB) in 250 mL Erlenmeyer flasks,
and incubated at 25 °C in darkness for 4 wk. The mycelial
mass on SDB was then harvested over a sterile Whatman
filter paper and washed with sterile, distilled water.
DNA extraction
Total DNA of each mycelial sample, or in the case of
Theissenia pyrenocrata from perithecial contents, was
extracted using Cetyltrimethyl-ammonium bromide (CTAB)
following the procedure described in Mackill & Bonman
(1995), with minor modifications (to adapt the procedure to
the study of fungal material): Lyophilized mycelium (40–50
mg) was placed into a microcentrifuge tube and ground to
powder. This mycelial powder was suspended in 700 µL of
extraction buffer (NaCl 0.7 M; Tris-HCl 50 mM pH 8.0; EDTA
2 mM pH 8.0, 1 % CTAB) preheated to 65 °C. The suspension
was thoroughly mixed and incubated for 1 h at 65 °C. After
the suspension had cooled, 500 µL of chloroform/isoamyl
alcohol (24:1 v/v) was added. The supernatant was gently
mixed until an emulsion was obtained and centrifuged at
10 000 rpm for 20 min. The aqueous phase was transferred
to a new sterile tube. A 10 % CTAB solution was added at one
tenth of the volume of the aqueous phase and mixed. The
supernatant was transferred to a new tube after a spin-down
of 20 min. 700 µL of precipitation buffer (CTAB 1 %; Tris-
HCl 50 mM pH 8.0; EDTA 10 mM pH 8.0) was then added to
the supernatant, left at room temperature for 5–10 min and
centrifuged. The aqueous phase was discarded and 300 µL
of TEHS buffer (NaCl 1M; Tris-HCl 10 mM pH 8.0; EDTA 1
mM pH 8.0) was added to the pellet to remove the CTAB
from the DNA. The pellet was treated with ribonuclease A,
incubated at 37 °C for 30 min, followed by addition of 750 µL
of cold absolute ethanol and centrifuged at 10 000 rpm for
20 min. The supernatant was discarded and the pellet was
washed in 500 µL 70 % (v/v) ethanol and air-dried at room
temperature. The DNA pellet was then dissolved in 50 µL TE
buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA pH 8.0).
PCR and sequencing
PCR amplification was done in a 50 µL volume consisting
of 1× PCR buffer, 200 µM of each of the four dNTPs, 2.5
mM MgCl 2
, 1 U Taq DNA polymerase (Promega, Madison,
Wisconsin) and 0.5 µM of each primer. Amplification of the
partial β-tubulin gene and a-actin were done using the primer
pairs T1/T22 (O’Donnell & Cigelnik 1997) and ACT-512F/ACT-
783R (Carbone & Kohn 1999), respectively. Amplifications
were performed using a MJ Research DNA Engine ALD1244
thermal cycler following the procedure described in Ju et al.
(2007). PCR products were purified using a QIAquick PCR
purification Kit (Qiagen, Hilden, Germany), following the
manufacturer’s instructions. Purified PCR products were sent
to Macrogen (Korea) for sequencing.
Sequence analysis
Each DNA sequence was checked for ambiguous bases,
assembled using BioEdit v. 6.0.7 (Hall 2004), and submitted
to GenBank (Table 1). Proofed sequences were then aligned
using ClustalW (Larkin et al. 2007) incorporated in BioEdit v.
6.0.7 and alignments were refined by directed examination.
Parsimony and Bayesian analyses were first carried out for
each gene on individual datasets. Potential conflicts were
assessed by comparing individual parsimony bootstrap trees.
In case two different relationships for the same set of taxa
were both supported by bootstrap values greater than 70 %
from different genes, it was assumed that the incongruence
was signicant (Wiens 1998). Parsimony (PAUP v. 4.0b10,
Swofford 2002) and Bayesian (MrBayes v. 3.0, Huelsenbeck
& Ronquist 2001) phylogenetic analyses were performed on
the combined data set of the β-tubulin and a-actin genes.
The maximum parsimony analysis was performed using
the heuristic search, starting with trees obtained via 1000
random stepwise addition sequences, and tree-bisectionreconnection
as the branch-swapping algorithm. All
characters were given equal weights and gaps were treated
as missing data. No topological constraints were enforced
and the ‘Multrees’ option was in effect. Relative support for
the branches was obtained from bootstrap proportions (BP)
using 1000 heuristic searches using the aforementioned
parsimony settings and 10 random sequence additions per
bootstrap replicate. Prior to conducting the Bayesian analysis
MrModeltest v. 2.2 (Nylander 2004) was used to determine the
best nucleotide substitution model. After the best nucleotide
substitution model was determined for each gene partition
and combined dataset, Bayesian analysis was conducted
using MCMC using a GTR+I+G model. Four default chains
were sampled every 100 generations and run for a total of
2 M generations. Bayesian posterior probabilities (PP) were
calculated on the posterior distribution of trees excluding the
initial set of burn-in trees.
SEM and HPLC
Scanning electron microscopy (SEM) was carried out using
a conventional procedure as described in Stadler et al.
(2002). Analytical HPLC of stromatal methanol extracts was
58 ima fUNGUS

Durotheca gen. nov. and Theissenia (Xylariaceae)
Amphilogia gyrosa
100
1.00
H
Theissenia s.l.
97
1.00
X
99
1.00
97
1.00
50
0.92
67
0.99
93
1.00
100
1.00100
84 1.00
1.00
100
1.00
100
1.00
65
1.00
97
1.00
100
1.00
66
0.92
100
1.00
100
1.00
100
1.00
100
1.00
Annulohypoxylon bovei var. microsporum
Annulohypoxylon nitens
Annulohypoxylon squamulosum
Annulohypoxylon moriforme var. microdiscum
Annulohypoxylon cohaerens
Daldinia caldariorum
Daldinia fissa
Daldinia loculata
Hypoxylon rubiginosum
Hypoxylon shearii var. minor
Biscogniauxia anceps
Biscogniauxia capnodes
Biscogniauxia arima
Biscogniauxia simplicior
Biscogniauxia cylindrospora
100 Biscogniauxia latirima
1.00
Biscogniauxia philippinensis var. microspora
Biscogniauxia mediterranea
Whalleya microplaca
Theissenia cinerea – ex holotype
Durotheca comedens BCC 22770
Durotheca comedens BCC 25014
Durotheca comedens BCC 25152
Durotheca comedens BCC 28080
99
Durotheca comedens BCC 25155
Durotheca depressa BCC 23016
Durotheca depressa BCC 28073 – ex holotype
62
Durotheca depressa BCC 28079
Durotheca rogersii – ex holotype
Theissenia pyrenocrata TL-11480
Kretzschmaria clavus
1.00
Kretzschmaria lucidula
Kretzschmaria megalospora
100 Xylaria bambusicola
1.00
Xylaria venosula
Nemania illita
Nemania primolutea
Rosellinia lamprostoma
Rosellinia necatrix
100
1.00
99 100
1.00
98
1.00
94
1.00
71
1.00
74
1.00
100
1.00
100
1.00
Stilbohypoxylon quisquiliarum 172
Stilbohypoxylon quisquiliarum 89091608
Stilbohypoxylon elaeicola
Cryphonectria macrospora
Durotheca
ARTICLE
50 changes
Fig. 1. Phylogenetic relationships of Theissenia and Durotheca species within Xylariaceae generated from a combined b-tubulin and a-actin
gene dataset. Numbers above each branch represent bootstrap values and those below the branch are posterior probabilities.
performed using the standardized method, comprising diode
array detection as described by Hellwig et al. (2005) and
TUB+ACT
mass spectrometric detection in the positive and negative
electrospray mode, using a comprehensive library of reference
compounds (Bitzer et al. 2007). The HPLC reference library
included, among numerous other pure natural products,
lepraric acid (Læssøe et al. 2010) and various metabolites
of the Xylariaceae as authentic standards, allowing for their
unambiguous detection in crude extracts by comparison of
their retention times, diode array spectra and mass spectra.
volume 4 · no. 1
59

Læssøe et al.
ARTICLE
Table 1. List of specimens used for the molecular phylogenetic study (Fig. 1).
Taxon Original code Culture acc. no. Origin Locality/Collecting data (or origin in case of reference sequences
retrieved from GenBank)
GenBank Acc. no.
Alpha-Actin Beta-Tubulin
Ootheca comedens XY00290 BCC22770 Thailand Phu Hin Rong Kla National Park, Phitsanulok; BBH18116 GQ160478 GQ160486
Ootheca comedens XY00513 BCC25014 Thailand Khao Nan National Park, Nakhon Si Thammarat; BBH25875 GQ160479 GQ160487
Ootheca comedens XY00531 BCC25152 Thailand Khao Nan National Park, Nakhon Si Thammarat; BBH25876 GQ160480 GQ160488
Ootheca comedens XY00534 BCC25155 Thailand Khao Ban That Wildlife Sanctuary Wildlife Sanctuary, Trang; BBH25877 GQ160481 GQ160489
Ootheca comedens XY00638 BCC28080 Thailand Kaeng Krachan National Park, Phetchaburi; BBH19755 GQ160482 GQ160490
Ootheca depressa XY00402 BCC23016 Thailand Doi Inthanon National Park, Chiang Mai; BBH18222 GQ160483 GQ160491
Ootheca depressa XY00619 BCC28073 Thailand Doi Inthanon National Park, Chiang Mai; BBH19737 GQ160484 GQ160492
Ootheca depressa XY00636 BCC28079 Thailand Doi Inthanon National Park, Chiang Mai (no specimen) GQ160485 GQ160493
Theissenia pyrenocrata TL-11480 none Ecuador Orellana, TL-11480 (QCNE, C) GQ247716 GQ247717
Amphilogia gyrosa none BCRC34145 Taiwan Ju & Hsieh 91123101 (HAST) (Ju et al. 2007) EF025600 EF025615
Annulohypoxylon bovei var. none BCRC34012 Taiwan Ju & Hsieh 90081914 (HAST) (Hsieh et al. 2005) AY951765 AY951654
microsporum
Annulohypoxylon cohaerens none BCRC34013 France Fournier JF-03041 (Hsieh et al. 2005) AY951766 AY951655
Annulohypoxylon moriforme var. none BCRC34018 Taiwan Ju & Hsieh 90080807 (HAST) (Hsieh et al. 2005) AY951769 AY951660
microdiscus
Annulohypoxylon nitens none BCRC34021 Taiwan Guu 91022108 (HAST) (Hsieh et al. 2005) AY951772 AY951663
Annulohypoxylon squamulosum none BCRC34022 Taiwan Holotype (HAST), see Ju et al. (2004) as Hypoxylon squamulosum. and AY951774 AY951665
Hsieh et al. (2005)
Biscogniauxia anceps none BCRC34029 France Candoussau (Rogers et al. 1996, (Hsieh et al. 2005) AY951783 AY951671
Biscogniauxia arima none BCRC34030 Mexico Isotype (Ju et al.. 1998, Hsieh et al. 2005) AY951784 AY951672
Biscogniauxia capnodes none BCRC34032 Taiwan Ju 77031509 (Ju et al. 1998, (Hsieh et al. 2005) AY951787 AY951675
Biscogniauxia cylindrispora none BCRC33717 Taiwan Holotype (Ju & Rogers 2001, (Hsieh et al. 2005) AY951791 AY951679
Biscogniauxia latirima none BCRC34036 Taiwan Ju & Hsieh 90080703 (HAST) (Hsieh et al. 2005) AY951795 AY951683
Biscogniauxia mediterranea none BCRC34037 France Candoussau 366 (Ju et al. 1998, Hsieh et al. 2005) AY951796 AY951684
Biscogniauxia philippinensis var. none BCRC33720 Taiwan Ju 89041101 (HAST) (Ju & Rogers 2001, Hsieh et al. 2005) AY951797 AY951685
microspora
Biscogniauxia simplicior none BCRC34038 France Candoussau 5354A (Ju et al. 1998, Hsieh et al. 2005) AY951798 AY951686
Cryphonectria macrospora none BCRC34146 Taiwan Ju & Hsieh 94031513 (HAST) (Ju et al. 2007) EF025587 EF025618
Daldinia caldariorum none BCRC34042 Taiwan Chen 957 (HAST) (Hsieh et al. 2005) AY951802 AY951690
Daldinia vernicosa none BCRC34048 Germany Wollweber 2899 (Ju et al. 1999 and Bitzer et al. 2008; as D. fissa); now AY951809 AY951697
deposited in KR 0026318
Daldinia loculata none KC1525 (Kew) UK K[M] 24541 (Stadler et al. 2001, Hsieh et al. 2005) AY951810 AY951698
Hypoxylon rubiginosum none BCRC34116 UK J.D. Rogers (Ju & Rogers 1996, (Hsieh et al. 2005)) AY951862 AY951751
60 ima fUNGUS

Durotheca gen. nov. and Theissenia (Xylariaceae)
Table 1. (Continued).
GenBank Acc. no.
Alpha-Actin Beta-Tubulin
Taxon Original code Culture acc. no. Origin Locality/Collecting data (or origin in case of reference sequences
retrieved from GenBank)
Hypoxylon shearii var. minor none BCRC34093 Mexico Isotype (WSP) (San Martin et al. 1999, (Hsieh et al. 2005)) AY951864 AY951753
Kretzschmaria clavus none BCRC34147 French Guiana Huhndorf 803 (WSP) (Rogers & Ju 1998, Hsieh et al. 2009) EF025596 EF025611
Kretzschmaria lucidula none BCRC34148 French Guiana Huhndorf 677 (Rogers & Ju 1998, Hsieh et al. 2009) EF025595 EF025610
Kretzschmaria megalospora none N / A Malaysia M. Whalley FH 64-97 (JDR) (Hsieh et al. 2009) EF025594 EF025609
Nemania illita none BCRC34150 USA Missouri, Columbus, S.J. Tsai (JDR) (Hsieh et al. 2009) EF025593 EF025608
Nemania primolutea none BCRC34151 Taiwan Holotype (WSP) (Ju et al. 2005, Hsieh et al. 2009) EF025592 EF025607
Rosellinia lamprostoma none BCRC34152 Taiwan Ju & Hsieh 89112602 (HAST) (Hsieh et al. 2009) EF025589 EF025604
Rosellinia necatrix none BCRC34153 Taiwan Ju & Hsieh 89062904 (HAST) (Hsieh et al. 2009) EF025588 EF025603
Stilbohypoxylon elaeicola none BCRC34154 French Guiana Huhndorf 928 (Rogers and Ju 1997, as S. moelleri; Hsieh et al. 2009) EF025601 EF025616
Stilbohypoxylon quisquiliarum none BCRC34155 French Guiana Huhndorf 940 (Rogers & Ju 1997) (Hsieh et al. 2009) EF025590 EF025605
Stilbohypoxylon quisquiliarum none BCRC34156 Taiwan Ju & Hsieh 89091608 (HAST) (Hsieh et al. 2009) EF025591 EF025606
Theissenia (Ootheca) cinerea none BCRC34157 Taiwan Holotype (HAST) (Ju et al. 2003) EF025598 EF025613
Theissenia (Ootheca) rogersii none BCRC34158 Taiwan Holotype (HAST) (Ju et al. 2007) EF025597 EF025612
Whalleya microplaca none BCRC34159 Taiwan Ju & Hsieh 91111215 (HAST) (Hsieh et al. 2009) EF025599 EF025614
Xylaria bambusicola none BCRC34102 Taiwan Holotype (WSP) (Ju & Rogers 1999, Hsieh et al. 2009)) AY951873 AY951762
Xylaria venosula none BCRC34160 USA Hawaii, Ju & Hsieh 94080508 (HAST) (Hsieh et al. 2009) EF025602 EF025617
Results and Discussion
Phylogenetic analysis
Fifty-four strains were used in the analysis, 17 of
which were Thai material sequenced in this study.
From the 17 strains, eight represented isolations
from Hypoxylon comedens s.l., five strains from
Xylaria, and one strain each from Annulohypoxylon,
Biscogniauxia, Hypoxylon, and Kretzschmaria.
The remaining 38 sequences across Xylariaceae
used were taken from GenBank. Two species
ancestral to Xylariales, Cryphonectria macrospora
and Amphilogia, were used as outgroup taxa. All
17 strains were sequenced for the a-actin and the
β-tubulin gene (Table 1) for comparison with the data
in Ju et al. (2007). After initially examining individual
trees for a-actin (247 parsimony-informative
characters; CI = 0.390, RI = 0.650, RC = 0.253, HI
= 0.610) and β-tubulin (1165 parsimony-informative
characters; CI = 0.384, RI = 0.588, RC = 0.226, HI
= 0.616) these were combined based on the similar
topologies of the individual trees.
Of the 2528 characters in the combined alignment,
1412 characters were parsimony informative.
Maximum parsimony analyses yielded four most
parsimonious trees that had similar topologies except
for the terminal branches. One of the four trees
generated from maximum parsimony (CI = 0.383, RI
= 0.597, RC = 0.229, HI = 0.617) is shown in Fig. 1.
The result of MrModeltest selected the General Time
Reversible (GTR) model with proportion in invariable
sites (I) and gamma distribution (G) (GTR+I+G;
Tamura & Nei 1993). This model was then used in
MrBayes. Four MCMC chains were run in MrBayes
for 2 M generations, sampling every 100 generations.
From the 20 K trees obtained the first 2 K trees were
discarded as ‘burn-in’. The remaining 18 K trees
were pooled and a consensus tree was created.
The Bayesian analysis gave a similar result to the
maximum parsimony analysis and the PP results
were shown as numbers below the branches of the
tree (Fig. 1).
The eleven H. comedens s.l. and Theissenia
sequences all fall in a well-supported clade without
other elements. The relationship to other groups
within Xylariaceae is less clear, but the clade is
definitely outside the subfamily ‘Xylarioideae’ that
constitute a highly supported cluster. Moreover, the
H. comedens s.l. material falls in two well-supported
sister clades, with one clade further divided in two
based on a limited number of substitutions. T.
pyrenocrata falls in a well-supported, rather distant
basal position. Theissenia rogersii constitutes a
sister group to the combined H. comedens s.l. and T.
cinerea clades. On molecular phylogenetic evidence
in combination with morphological evidence, we
thus recognize two genera and four species in the
H. comedens/Theissenia complex, with a further
possible separation in the H. comedens complex.
ARTICLE
volume 4 · no. 1
61

Læssøe et al.
ARTICLE
Scanning electron microscopy (SEM)
The images obtained from spores of Thai Hypoxylon
comedens material (Fig. 5) confirm the results in Læssøe et
al. (1989), i.e. that the spores are completely smooth as they
also appear to be in KOH mounts at 1200× (including the
type material). The possible germ slit observed in that study
could not be found in these better preserved ascospores,
Since definite germ sites have not been observed by LM,
we can conclude that this species lacks obvious germ sites.
Occasionally, some of the ascospores, when mounted in 10
% KOH, appeared to have germ slit-like features, but this
may have been due to an artefact created by creasing or
folding when the spores collapse (or longitudinal ruptures
may occur before germination). In any case, even meticulous
observations of ascospores of these materials have not
revealed a germ slit, as generally observed in many other
xylariaceous species. Nevertheless, an ascospore showing
a very faint germ slit-like structure, that could just be about
to germinate, was observed in the type of D. depressa (see
below)
HPLC analyses
Young as well as mature stromata of specimen BBH 15200,
identified as Hypoyxlon comedens, were studied for extrolites
by HPLC. As previously reported for Biscogniauxia species
and various other members of ‘Xylarioideae’ (Stadler et al.
2001, Stadler & Hellwig 2005), none of the characteristic
compounds usually encountered in species of Hypoxylon and
its immediate allies were found. Not even very young stromata
contained binaphthalene BNT, azaphilones, cytochalasins,
and other products that occur in various species of Daldinia
and Hypoxylon, as well as in their cleistocarpous relatives,
Pyrenomyxa, Phylacia, and Rhopalostroma (Stadler et al.
2004, 2005; 2010a,b). These results, in conjunction with
morphological features and that the species is devoid of
visible and extractable stromatal pigments, indicate that
the closest chemical relationships of H. comedens within
Xylariaceae are with Biscogniauxia and Camillea, and that
the above-mentioned taxa containing pigments are more
distantly related. It should, nevertheless, be noted that there
are no strong chemotaxonomical syndromes connecting
H. comedens with species of Biscogniauxia and Camillea.
We observed some minor components, especially in the
young, freshly collected stromata, that were apparently
absent in the latter genera as well, but could not be safely
assigned to any of the known Xylariaceae metabolites.
Recently, Læssøe et al. (2010) examined some peculiar taxa
assigned to Xylariaceae that deviate from the mainstream
of the family in having conspicuous green or blue stromatal
surfaces, i.e. H. aeruginosum and representatives of
the genus Chlorostroma. Aside from specimens growing
fungicolously on stromata of Hypoxylon, the above taxa did
not yield any known compounds of the `Hypoxyloideae´, but
the substituted chromone, lepraric acid, which had hitherto
only been found in lichenized ascomycetes, and derivatives
thereof, were detected as major stromatal components of both
Chlorostroma and H. aeruginosum. Due to these findings,
our attention was directed toward such compounds, also
in other Xylariaceae that we examined during our ongoing
study using the well-established HPLC profiling technique.
One of the recently collected specimens of H. comedens
(XY01706/BBH26963) yielded particularly high amounts of
yellowish pigments in KOH and was also studied by HPLC.
Surprisingly, it yielded lepraric acid, too. The amounts of the
compound present in the stromata were estimated to be at
least ten times lower in H. comedens than in Chlorostroma
and H. aeruginosum, but its identity with lepraric acid (or
an isomer thereof) was established by matching DAD and
mass spectra. The compound was not detectable at all in
mature stromata, suggesting that its biosynthesis only occurs
in the initial stages of stromatal formation and ceases as
the stromata become mature and carbonaceous. However,
traces of lepraric acid were also found in BBH15200 (the one
studied by SEM). No molecular data and no DNA suitable
for PCE were so far obtained for Chlorostroma and H.
aeruginosum. The ascospores of these fungi do not easily
germinate, and their stromata are very rarely observed
and collected. Therefore, the significance of these findings
remains to be confirmed by means of molecular phylogeny,
and by studying their conidiogenous structures (in those
species that produce them).
Morphology and TAXONOMY
Durotheca Læssøe, Srikitikulchai, Luangsa-ard & M.
Stadler, gen. nov.
MycoBank MB803610
Etymology: Indicative of the highly carbonized perithecia
without surrounding tissue, easily seen on the underside of
detached stromata.
Description: Stromata more or less erumpent through bark
or wood, bipartite in nature, initially covered in white pruina,
highly carbonaceous including encasement of large, globose
to cylindrical perithecia without or with an indistinct basal
columella; crust without extractable pigments or with yellow
pigmentation. Paraphyses filiform, attenuating towards
the apex, distantly septate, without obvious contents. Asci
more or less clavate, thin-walled without apical apparatus,
deliquescent early, the spores in a tight cluster. Ascospores
moderate to very thick-walled, pale to medium brown at
maturity, ellipsoid-oblong to allantoid, with or without a
germ slit. Asexual morph, where known nodulisporium-like.
Lignicolous, terrestrial.
Type species: Durotheca depressa Læssøe & Srikitikulchai
2013.
Durotheca depressa Læssøe & Srikitikulchai, sp.
nov.
MycoBank MB803611
(Figs 2–3)
Etymology: Based on the deeply seated ostioles.
Diagnosis: Differs from Durotheca comedens in narrow
stromata with deeply seated ostioles in crater like depressions.
62 ima fUNGUS

Durotheca gen. nov. and Theissenia (Xylariaceae)
ARTICLE
Fig. 2. Durotheca depressa (BCC23016). A. Stromata. B. Stromata with ostioles, arrow = ostioles. C. Deep ostiole: arrow = deep ostiole. D.
Perithecia. E–G. Ascospore: arrow = germination slit. Bars: A = 1.5 mm; B = 0.7 mm; C = 0.5 mm; D = 1.0 mm; E–G = 6.0 µm.
Type: Thailand: Prov. Chiang Mai: Doi Inthanon National
Park, Pun Churee study trail, on indet. angiosperm wood, 9
May 2006, P. Srikitikulchai XY00402 (BBH 18222 – holotype;
BBC 23016 – culture ex-holotype).
Description: Stromata seen from above very narrow
and often undulating, effused-pulvinate, with beveled
margins, 0.5–6 cm long, 0.5–2 cm broad, up to 2 mm
thick; at first chalky white creamy owing to the presence
of a thin pruina with mature surface light grey, plane with
umbilicate ostioles deep in crater-like depressions; crust
highly carbonaceous extending downward to encase each
perithecium; tissue between perithecia scarce, fibrous and
soft, extending into interstices of overlying carbonaceous
stroma; tissue beneath perithecia thin and fibrous to almost
absent. Perithecia globose-ovoid, 2.5 mm diam, with
conspicuous basal columella. Paraphyses not observed.
Asci deliquescing, not observed. Ascospores light brown
to brown (absent pigmentation in KOH), unicellular, oblong
to allantoid in side view, smooth, wall thick, (19–)20–24
(–26) × 8–11 µm (av. 21.9 × 9.3 µm, n = 10), with straight,
inconspicuous germ slit spore length; perispore nondehiscent
in 10 % KOH.
Cultures: No conidiogenous structures were produced in
cultures derived from the type and paratypes. The morphology
of the cultures resembled those of Durotheca rogersii (Ju et
al. 2003). The mycelia were initially whitish, melanising with
age, the reverse attained a brownish colour with age and
even the bramble like structures described by Ju et al. (2003)
were evident in ageing cultures.
Host: Unidentified, huge log (possibly Dipterocarpaceae).
Distribution: Only known from a single site at the Doi Inthanon
Mountain in northern Thailand.
Additional material (from the same log): Thailand: Prov. Chiang Mai:
Doi Inthanon National Park, Pun Churee study trail, alt. 1679 m, on
indet. angiosperm wood, 28 May 2006, P. Srikitikulchai XY00619
(BBH 19737, BCC 28073).
Notes: This new species has been repeatedly collected
from the same very big log and is so far only known from
this material at mid-elevation at the Doi Inthanon Mountain.
Durotheca comedens has been collected on an adjacent
trail so the two species co-exist at this site. Already in
the field the peculiar features of D. depressa were noted
volume 4 · no. 1
63

Læssøe et al.
ARTICLE
Fig. 3. Durotheca depressa (BCC28073). A. Stromata. B. Stromata with ostioles: arrow = ostioles. C. Deep ostiole: arrow= deep ostiole. D.
Perithecia. E–H. Ascospores. Bars: A = 1.5 mm; B = 1.0 mm; C = 0.5 mm; D = 1.0 mm; E–H = 5.0 µm.
(i.e. the narrow, undulating stromata with ostioles in deep
depressions), and the phylogenetic data corroborates the
distinction. We have chosen this taxon as type of Durotheca
since we consider it of value to have DNA sequences from
type material.
Durotheca comedens (Ces.) Læssøe & Srikitikulchai,
comb. nov.
MycoBank MB803613
(Figs 4–5)
Basionym: Hypoxylon comedens Ces., Atti Accad. Sci. fis.
mat. Napoli 8: 19 (1879).
Synonyms: Nummularia comedens (Ces.) Cooke, Grevillea
11 (no. 60): 126 (1883)
Nummulariola comedens (Ces.) P. Martin, Jl S. Afr. Bot. 35:
318 (1969) [basionym as “Nummularia comedens Ces.”].
Type: Malaysia: Borneo: Sarawak, [O. Beccari] 218 (K -
several, incl. one presumed to be in Cesati handwriting
–isotypes).
Theissenia cinerea Y.M. Ju et al., Mycologia 95: 111 (2003).
Type: Taiwan: Pingtung Co., Heng-chun, Ken-ting, on
wood stump, 16 July 2001, Hsieh & Ju 90071615 (HAST
– holotype).
Description: Stromata erumpent, often sunk rather deep in the
decorticated wood, possibly reflecting repeated sporulation
in the same position, from above rather variable in outline,
from almost circular to very elongate and somewhat irregular,
applanate or slightly convex, with abrupt, bevelled dark
margins; initially covered by a black, outer, dehiscent layer,
exposing a thin white, fairly fugacious, pruinose layer on top
of the black, highly carbonised upper stroma, with ostioles
in dark pits. Perithecia globose, highly carbonized, densely
packed below the crust with hardly any surrounding tissue,
or sometimes with a small amount of fibrous tissue below
some of them; the base of the perithecia convex to concave,
evident in remnants left on the wood when stromata are
dislodged, 2.5 mm in diam. Paraphyses as in Hypoxylon/
Xylaria (not filled with lipids as in most Camillea species) with
distant septation and gradually tapering upwards.
Asci clavate-pedicellate, very early deliquescent and thinwalled,
8-spored. Ascospores in a densely packed cluster,
young spores appearing very thick-walled with a central
granular part, older spores with pale yellow-brown walls (in
water, olivaceous in KOH), suballantoid to allantoid in side
view and oblong in front view, few to many guttulate, 15–23
(–26) x (5.5–)6–9(–11) µm (av. 16.1–22.4 x 5.9–7 µm, n =
90).
64 ima fUNGUS

Durotheca gen. nov. and Theissenia (Xylariaceae)
ARTICLE
Fig. 4. Durotheca comedens BBH15200. A. Stromata. B. Stromata with ostioles, arrow: ostioles. C. Perithecia. D–E. Ascospores. Bars: A = 1.0
mm; B = 0.7 mm; C = 1.0 mm; D = 5.0 µm; E = 5.0 µm.
Conidiogenous structures: None were found in cultures
from the Thai material, but Ju et al. (2003) reported a
nodulisporium-like state with long, slender conidia in the
Taiwanese material of T. cinerea.
Host: Stromata appear to be restricted to large, fallen,
decorticated dicotyledoneous logs in “wet tropical forests”
at low altitudes. No specific hosts have been identified but
members of Dipterocarpaceae are likely candidates.
Distribution: Apparently restricted to South-East Asia, where
it appears to be widespread, although unrecorded in many
places within the region. Tai (1979) and Zhuang (2002)
reported it from China. Ju & Rogers (1999) did not include this
species in their detailed account of Taiwanese Xylariaceae.
Material reported as Hypoxylon cf. comedens from Mexico
by San Martín González & Rogers (1993) should be reevaluated
as it may represent a species of Theissenia.
Specimens examined: China: Yunnan:, Xichou, 18 May 1959, Wang
Quing-zhi 194 (HMAS 33628(S). – Malaysia: Malay Peninsula: State
of Perak, Maxwell’s Hill, alt. 3800 ft, on dead trunk, growing where
the bark is removed, 23 Mar 1924, J. H. Burkill 13193 (K); Borneo:
Sarawak, Gunong Mulu NP, 4 th Division, Baram District, between
Melinau Gorge and ca 2 km upstream on S side of Sungei Melinau, alt.
ca 150-170 m, on leaning decorticate trunk in alluvial forest, no date, B.
J. Coppins 5168 (E, C); Sabah, Danum Valley, Field Centre, West Trail/
Rhino Ridge Trail, on old, decorticated trunk in lowland dipterocarp rain
forest, alt. 150-200 m, 3 Feb 1999, T. Læssøe & J. Omar, TL-6118 [old,
weathered material] (C, UMS). – Thailand: [* indicates that specimens
are included in the phylogenetic analysis, Fig. 1] Prov. Chaiyaphum:
Phu Khiao Wildlife Sanctuary, Ban Chak Kha, on indet. wood, 23 Oct
2007, P. Srikitikulchai XY00854 (BBH 22419). Prov. Chiang Mai: Doi
Inthanon National Park, Pa Mek – Pa Tonnam Lamthan Nature Trail,
on indet. angiosperm wood, 26 Nov 2008, P. Srikitikulchai XY001464
(BBH 25163 (BCC 34524)). Prov. Kamphaeng Phet: Khlong Lan
National Park, indet. dicot. wood, 7 Nov 2007, P. Srikitikulchai
XY00771, XY00834, -835, -836 & -837 (BBH 22341 (BCC 28439),
22400 (BCC 28746), 22401 (BCC 28747), 22402 (BCC 28748) [22401
and 22402 from the same log], 22403 (BCC 28749)). Prov. Nakhon Si
Thammarat: Khao Nan National Park, Sunantha Waterfall, on indet.
dicot. wood, 20 Feb 2007, P. Srikitikulchai XY00513 & XY00531* (BBH
25875 (BCC 25014), 25876 (BCC 25152)); ibid., Pa Pra nature trail, on
indet. dicot. wood, 30 Oct 2008, P. Srikitikulchai XY01412 (BBH 25466
(BCC 33654)). Prov. Phattalung: Khao Puu-Khao Ya National Park, a
mixture of young white stromata and very old grey to black stromata,
on blackened, very thick, hard-wooded, but very wet, decorticated,
dicot log in calcareous lowland, wet evergreen forest, 22 Feb 2006,
T. Læssøe & P. Srikitikulchai XY00212 (BBH 15200 (BCC 21319));
ibid., Khao Ban That Wildlife Sanctuary, Khao Chet Yot, 19 Mar 2007,
volume 4 · no. 1
65

Læssøe et al.
ARTICLE
Fig. 5. SEM of mature ascospores of O. comedens (BBH 15200). A, B. 2000x. C, D. 5000x. Fig. 5D shows disruptions on the surface of the
spores in the center, and the spore to the left has been ripped open. Bars: A = 10.0 µm; B = 10.0 µm; C = 5.0 µm; D = 5.0 µm.
P. Srikitikulchai XY00866 (BBH 22430,(BCC 28891)). Prov. Phet Buri:
Kaeng Krachan National Park, Paneontung, indet. dicot. wood, 28
June 2007, P. Srikitikulchai XY00638* (BBH 19755 (BCC 28080));
ibid., Ban Krang, indet. dicot. wood, 26 July 2007, P. Srikitikulchai
XY00535 (BBH19738). Prov. Phitsanulok,: Phu Hin Rong Kla National
Park, on indet. dicot. wood, 8 Sep 2006, P. Srikitikulchai XY00290*,
XY00291 (BBH 1816 & 18117). Prov. Surat Thani. Khao Sok National
Park, Sanyang Roi nature trail, 14 Oct 2008, on indet. dicot. wood, P.
Srikitikulchai XY01415 (BBH 25469 (BCC 33657)). Prov. Trang: Khao
Ban That Wildlife Sanctuary, indet. wood, 17 Mar 2007, P. Srikitikulchai
XY00534*, XY00535 (BBH 25877 (BCC 25155), BBH 25878 (BCC
25156)).
Notes: We found the material from a wide geographical
area to be morphologically identical, including the isotypes
of Hypoxylon comedens, the type of Theissenia cinerea,
and material from peninsular Malaysia, the Bornean part of
Malaysia, Thailand, and China. The only deviating material
is described above as Durotheca depressa. Ju et al. (2003)
stated that the perispores of D. comedens (as T. cinerea)
ascospores were dehiscent in 10 % KOH and they also
provide a picture to support this statement. In all the material
we studied of D. comedens, and likewise in the type of T.
cinerea, dehiscence was neither observed upon addition of
KOH to water mounts, nor when perithecial contents were
mounted directly in 10 % KOH. A similar phenomenon, i.e.
the occurrence of material with dehiscent and indehiscent
perispores in different specimens assigned to the same
species, was also attributed to other Xylariaceae in the past
(cf. Daldinia fissa, Ju et al. 1997). As we did not find any other
deviating criterion to distinguish D. comedens and T. cinerea,
we regard these species names as synonyms.
Durotheca rogersii (Y.M. Ju & H.M. Hsieh) Srikitikulchai
& Læssøe, comb. nov.
MycoBank MB803632
Basionym: Theissenia rogersii Y.M. Ju & H.M. Hsieh, in Ju et
al., Mycologia 99: 613 (2007).
66 ima fUNGUS

Durotheca gen. nov. and Theissenia (Xylariaceae)
Notes: Durotheca rogersii is placed here based on the
description and molecular data provided by Ju et al. (2007),
which leave no doubt on the affinities of this species to
Durotheca.
Notes on Theissenia pyrenocrata
Theissen (1908) described this new species, from southern
Brazil (Rio Grande do Sul), as Ustulina pyrenocrata.
Maublanc (1914) coined a new generic name for it, and
reported it from further north in São Paulo State, and Ju et al.
(2003) even from northeastern Brazil. Dennis (1964) and Ju
et al. (2003) reported it from Africa (`Zaire´, now Democratic
Republic of Congo), while Miller (1961) and Ju et al. (2003)
confirmed its presence in Sri Lanka based on the type of
Nummularia porosa that Dennis (1964) considered a likely
additional Theissenia species with smaller spores. Here we
add a record from western South America that agrees in all
morphological characters with those reported in the cited
references. It grew on a very large, unidentified hardwood log
in black water, inundated lowland rainforest in the eastern part
of Ecuador, and was used for sequence analysis. Despite the
wide distribution, very few records are known of this rather
conspicuous and characteristic species. Ju et al. (2003)
discovered the striate-furrowed nature of the ascospores that
had been overlooked by previous workers.
Specimens examined: Ecuador: Prov. Orellana: along small black
water tributary to Río Tiputini near Tiputini Field Station, alt. 190-270
m, 16 July 2004, T. Læssøe, J.H. Petersen, A. Alsgård Jensen TL-
11480 (C, QCNE).
Notes on Theissenia eurima
Theissenia eurima was described from Brazil by Ju et al.
(2003). We accept this taxon in Theissenia at present, since
it apparently produces an asexual morph equivalent to that
of T. pyrenocrata, both taxa occur in South America, and
since we have no other morphological or molecular data to
suggest another position. There are several other examples
of xylariaceous genera that encompass species with and
without germ slits, Nemania being an obvious well-known
example, aside from the new genus established here.
ARTICLE
Key to taxa in the Theissenia-Durotheca clade (Fig. 1)
1 Ascospores striate, almost cylindrical with one side slightly flattened, without germ slit ............................ T. pyrenocrata
Ascospores smooth, with or without germ slit, ellipsoid to slightly allantoid ...................................................................... 2
2 (1) Ascospores with short germ slit; known from Amazonian Brazil .......................................................................... T. eurima
Ascospores with very faint germ slit, or without obvious germ slit; known from SE Asia Durotheca ..........................….. 3
3 (2) Ascospores broadly ellipsoid, wall very thick, 25–36 µm long; perithecia cylindrical ......................................... D. rogersii
Ascospores ellipsoid-cylindrical to allantoid, usually less than 25 µm long, wall moderately thickened; perithecia subglobose
............................................................................................................................................................................................ 4
4 (3) Stromata with variable outline, not narrowly linear, ostioles in shallow depressions .................................... D. comedens
Stromata more or less linear with ostioles in crater-like depressions ............................................................. D. depressa
Discussion
As already noted, the clade with Theissenia pyrenocrata
and taxa placed in Durotheca here (Fig. 1) has a rather
unresolved position within Xylariaceae. However, the
clade has very limited affinities to the ‘Xylarioideae’
subclade, whilst it is difficult to speculate on affinities to the
‘Hypoxyloideae’, but such relationships cannot be ruled out
at present. The highly carbonized, very thick, and layered
ascomatal wall more or less seated directly on the substrate
is a common feature of all currently recognised members
of Theissenia and Durotheca. The two genera are also
separated on several stromatal characters and, possibly,
in the type of asexual morph. The molecular phylogenetic
data show two very distinct groups with T. pyrenocrata
in a well-supported basal position. Further phylogenetic
analyses would probably benefit from an expanded taxon
sampling and from the inclusion of other genes. Ju et al.
(2007), in their analysis, placed Theissenia s.lat. within
the `Hypoxyloideae´ in a clade containing species with a
bipartite stromatal development.
The chemotaxonomic data so far available on these
fungi are rudimentary at best, since the cultures have not
been studied for metabolites, and the surprising detection
of lepraric acids in young stromata of some representatives
merely provides a hint as to their possible affinities to
other Xylariaceae. Due to the study by Bitzer et al. (2008),
a rather comprehensive overview of chemical traits in
cultures of the hypoxyloid clade have become available, but
Biscogniauxia, Camillea, as well as the xylarioid Xylariaceae,
were underrepresented in this work. In addition, no cultures
and no molecular data on Hypoxylon aeruginosum and
Chlorostroma species have so far been available, and,
therefore, it is at present difficult to assess whether the
production of lepraric acid derivatives has a common history
in the taxa with green and blue coloured stromatal surfaces
and Durotheca. Interestingly, these substituted chromones
seem to be very rare even in lichenised ascomycetes,
where they have hitherto only been found in members of
the rather distantly related genera Lepraria and Roccella,
aside from the above mentioned Xylariaceae (cf. Huneck &
Yoshimura 1996, Læssøe et al. 2009). Notably the previous
volume 4 · no. 1
67

Læssøe et al.
ARTICLE
studies on lichen chemotaxonomy mostly relied on thin layer
chromatography, rather than the much more sophisticated
and sensitive HPLC-MS technique, and the data presented
here are actually based on studies of several thousands of
Xylariaceae specimens. On the other hand, the absence of the
typical pigments of Hypoxylon and allies in all the above taxa,
as well as in Biscogniauxia and Camillea may support the
molecular phylogeny. It is too early to draw final conclusions
on the affinities of basal groups of Xylariaceae as inferred
from molecular phylogenetic studies. However, studies based
on rDNA and other DNA sequence data (Pelaez et al. 2008,
Tang et al. 2009) have also suggested that Biscogniauxia
and Camillea might be basal to both the xylarioid and the
hypoxyloid lineages. Unfortunately, these studies, as well as
other phylogenetic work cited above, have dealt with different
isolates, different genes, and, to some extent, even different
species concepts. These issues mean that results cannot
be directly compared. Possibly, Durotheca, Theissenia, and
even Chlorostroma and H. aeruginosum may represent
hitherto unknown lineages that separated quite early from
the ancestors of mainstream Xylariaceae. The availability of
living cultures of Durotheca and Theissenia will now facilitate
further testing of such hypotheses.
Acknowledgements
This study was supported by Bioresources Research Network
(BRN), the TRF/BIOTEC special programme for biodiversity
research and training (BRT), and the National Center for Genetic
Engineering and Biotechnology (BIOTEC) who provided working
facilities. We wish to thank Nigel Hywel-Jones, Somsak Sivichai,
and Sumalee Supothina for their help with logistics and with the
project, including the handling of cultures. The aid of Klaus Ide
(BIS, Leverkusen, Germany) with performing SEM is gratefully
acknowledged, as is the help of the curators at C, E, HMAS, K,
and QCNE. Brian J. Coppins (Edinburgh) is thanked for supplying
material from Sarawak. Research in Ecuador was sponsored by
Danish government grant RUF 91056, and co-operation with the
Herbario Nacional (Quito) is duly recognized.
References
Bitzer J, Köpcke B, Stadler M, Hellwig V, Ju YM, Seip S, Henkel T
(2007) Accelerated dereplication of natural products, supported
by reference libraries. Chimia 51: 332–338.
Bitzer J, Læssøe T, Fournier J, Kummer V, Decock C, Tichy HV,
Piepenbring M, Peršoh D, Stadler M (2008) Affinities of Phylacia
and the daldinioid Xylariaceae, inferred from chemotypes of
cultures and ribosomal DNA sequences. Mycological Research
112: 251–270.
Carbone I, Kohn LM (1999) A method for designing primer sets for
speciation studies in filamentous ascomycetes. Mycologia 91:
553–556.
Cesati V (1879) Mycetum in itinere Borneensi lectorum a cl. Od.
Beccari. Atti della Real Accademia delle Scienze Fisiche e
Matematiche, Napoli 8: 1–28.
Dennis RWG (1964) Further records of Congo Xylariacae. Bulletin de
Jardin Botanique de l’État, Bruxelles 34: 231–241.
Hall T (2004) BioEdit. Version 6.0.7. Durham: Department of
Microbiology, North Carolina State University.
Hellwig V, Ju YM, Rogers JD, Fournier J, Stadler M (2005) Hypomiltin,
a novel azaphilone from Hypoxylon hypomiltum, and chemotypes
in Hypoxylon sect. Hypoxylon as inferred from analytical HPLC
profiling. Mycological Progress 4: 39–54.
Hsieh HM, Lin CR, Fang MJ, Rogers JD, Fournier J, Lechat C, Ju YM
(2010) Phylogenetic status of Xylaria subgenus Pseudoxylaria
among taxa of the subfamily Xylarioideae (Xylariaceae) and
phylogeny of the taxa involved in the subfamily. Molecular
Phylogenetics and Evolution 54: 957–969.
Huelsenbeck JP, Ronquist FR (2001) MRBAYES: Bayesian inference
of phylogenetic trees. Biometrics 17: 754–755.
Huneck S, Yoshimura I (1996) Identification of Lichen Substances.
Berlin: Springer.
Ju YM, Hsieh H-M, Ho M-C, Szu D-H, Fang M-J (2007) Theissenia
rogersii sp.nov. and phylogenetic position of Theissenia.
Mycologia 99: 612–621.
Ju YM, Rogers JD (1994) Kretzschmariella culmorum (Cooke) comb.
nov. and note on some other monocot-inhabiting xylariaceous
fungi. Mycotaxon 51: 241–255.
Ju YM, Rogers JD (1999) The Xylariaceae of Taiwan (excluding
Anthostomella). Mycotaxon 73: 343–440.
Ju YM, Rogers JD, Hsieh HM (2003) The genus Theissenia: T.
pyrenocrata, T. cinerea sp. nov., and T. eurima sp. nov. Mycologia
95: 109–116.
Ju YM, Rogers JD, Hsieh HM (2004) New Hypoxylon species and
notes on some names associated with or related to Hypoxylon.
Mycologia 96: 154–161.
Ju YM, Rogers JD, San Martín F, Granmo A (1998) The genus
Biscogniauxia. Mycotaxon 66: 1–98.
Ju YM, Rogers JD (2001) New and interesting Biscogniauxia taxa,
with a key to the world species. Mycological Research 105:
1123–1133.
Læssøe T (1994) Index ascomycetum 1. Xylariaceae. Systema
Ascomycetorum 13: 43–112.
Læssøe T, Srikitikulchai P, Fournier J, Köpcke B, Stadler M (2010)
Lepraric acid derivatives as chemotaxonomic markers in
Hypoxylon aeruginosum Chlorostroma subcubispora and C.
cyaninum, sp. nov. Fungal Biology 114: 481–489.
Laessøe T, Rogers JD, Whalley AJS (1989) Camillea, Jongiella and
light-spored species of Hypoxylon. Mycological Research 93:
121–155.
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA,
McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson
JD, Gibson TJ, Higgins DG (2007) ClustalW and ClustalX version
2. Bioinformatics 23: 2947–2948.
Mackill DJ, Bonman JM (1995) Classifying japonica rice cultivars
with RAPD markers. Crop Science 35: 889–894.
Martin P (1969) Studies in the Xylariaceae. VI Daldinia, Nummulariola
and their allies. Journal of South African Botany 35: 267–320.
Maublanc A (1914) L’Ustulina pyrenocrata Theissen, type du genre
nouveau Theissenia. Bulletin de la Societé mycologique de
France 30: 48–53.
Miller JH (1961) A Monograph of the World Species of Hypoxylon.
Athens, GA:University of Georgia Press.
Nylander JAA (2004) MrModeltest 2.2. Uppsala: Distributed by the
author, Evolutionary Biology Centre, Uppsala University.
O’Donnell K, Cigelnik E (1997) Two divergent intragenomic rDNA
ITS2 types within a monophyletic lineage of the fungus Fusarium
68 ima fUNGUS

Durotheca gen. nov. and Theissenia (Xylariaceae)
are nonorthologous. Molecular Phylogenetics and Evolution 7:
103–116.
Peláez F, González V, Platas G, Sánchez-Ballesteros J, Rubio
V (2008) Molecular phylogenetic studies within the family
Xylariaceae based on ribosomal DNA sequences. Fungal
Diversity 31: 111–134.
Rogers JD, Ju YM (1998) The genus Kretzschmaria. Mycotaxon 68:
345–393.
San Martín González F, Rogers JD (1993) Biscogniauxia and
Camillea in Mexico. Mycotaxon 47: 229–258.
Stadler M, Wollweber H, Mühlbauer A, Asakawa Y, Hashimoto T,
Rogers JD, Ju YM, Wetzstein H-G, Tichy H-V (2001) Molecular
chemotaxonomy of Daldinia and other Xylariaceae. Mycological
Research 105: 1191–1205.
Stadler M, Baumgartner M, Ide K, Popp A, Wollweber H (2002)
Importance of ascospore ornamentation in the taxonomy of
Daldinia. Mycological Progress 1: 31–42.
Stadler M, Hellwig V (2005) Chemotaxonomy of the Xylariaceae
and remarkable bioactive compounds from Xylariales and their
associated asexual stages. Recent Research and Development
in Phytochemistry 9: 41–93.
Stadler M, Ju Y-M, Rogers JD (2004) Chemotaxonomy of Entonaema,
Rhopalostroma and other Xylariaceae. Mycological Research
108: 239–256.
Stadler M, Læssøe T, Vasilyeva L (2005) The genus Pyrenomyxa
and its affinities to other cleistocarpous Hypoxyloideae as
inferred from morphological and chemical traits. Mycologia 97:
1129–1139.
Stadler M, Fournier J, Gardt S, Peršoh D (2010a) The phylogenetic
position of Rhopalostroma as inferred from a polythetic approach.
Persoonia 25: 11–21.
Stadler M, Fournier J, Læssøe T, Chlebicki A, Lechat C, Flessa
F, Rambold G, Peršoh D (2010b) Chemotaxonomic and
phylogenetic studies of Thamnomyces (Xylariaceae).
Mycoscience 51: 189–207.
Swofford DL (2003) PAUP*. Phylogenetic Analysis Using Parsimony
(*and Other Methods). Version 4.0b10. Sunderland, MA: Sinauer
Associates.
Tai FL (1979) Sylloge fungorum sinicorum. Science Press, Peking.
Tamura K, Nei M (1993) Estimation of the number of nucleotide
substitutions in the control region of mitochondrial DNA in
humans and chimpanzees. Molecular Biolology and Evolution
10: 512–526.
Tang AMC, Jeewon R, Hyde KD (2009) A re-evaluation of the
evolutionary relationships within the Xylariaceae based on
ribosomal and protein-coding gene sequences. Fungal Diversity
34: 155–153.
Theissen F (1908) Novitates riograndenses. Annales Mycologici l6:
341–352.
Thiers B (2010) (continuously updated) Index Herbariorum: A global
directory of public herbaria and associated staff. New York: New
York Botanical Garden’s Virtual Herbarium. http://sweetgum.
nybg.org/ih.
Wiens JJ (1998) Combining data sets with different phylogenetic
histories. Systematic Biology 47: 568–581.
Zhuang WY (2001) Higher Fungi of Tropical China. Beijing:
Mycotaxon.
ARTICLE
volume 4 · no. 1
69

ARTICLE
ima fUNGUS

doi:10.5598/imafungus.2013.04.01.08
IMA Fungus · volume 4 · no 1: 71–87
Gelatinomyces siamensis gen. sp. nov. (Ascomycota, Leotiomycetes,
incertae sedis) on bamboo in Thailand
Niwat Sanoamuang 1,2 , Wuttiwat Jitjak 2 , Sureelak Rodtong 3 , and Anthony J.S. Whalley 4
1
Applied Taxonomic Research Center, Khon Kaen University, Khon Kaen 40002, Thailand; corresponding author e-mail: niwatsanoa@gmail.com
2
Department of Plant Sciences and Agricultural Resources, Faculty of Agriculture, Khon Kaen University, Khon Kaen 40002, Thailand
3
School of Microbiology, Institute of Science, Suranaree University of Technology, Nakhon Ratchasima 30000, Thailand
4
The Institute of Biotechnology and Genetic Engineering, Chulalongkorn University, Institute Bldg. 3, Phayathai Rd., Pathumwan, Bangkok
10330, Thailand
ARTICLE
Abstract: Gelatinomyces siamensis gen. sp. nov., incertae sedis within Leotiomycetes, the Siamese jelly-ball, is
described. The fungus was collected from bamboo culms and branches in Nam Nao National Park, Phetchabun,
Thailand. It presents as a ping-pong ball-sized and golf ball-like gelatinous ascostroma. The asci have numerous
ascospores, are thick-walled, and arise on discoid apothecia which are aggregated and clustered to form the
spherical gelatinous structures. An hyphomycete asexual morph is morphologically somewhat phialophoralike,
and produces red pigments. On the basis of phylogenetic analysis based on rRNA, SSU, and LSU gene
sequences, the lineage is closest to Collophora rubra. However, ITS sequences place the fungus on a wellseparated
branch from that fungus, and the morphological and ecological differences exclude it from Collophora.
Key words:
Bambusa
Bambusicolous fungi
Collophora
Gelatinous ascostroma
Kao-niew ling
Siamese jelly-ball
Molecular phylogeny
Polyspored asci
Red pigments
Article info: Submitted: 25 June 2012; Accepted: 8 April 2013; Published: 14 May 2013.
INTRODUCTION
Five specimens of a rarely encountered fungus were
collected by N. S. from twigs of a bamboo (“Bong”; Bambusa
nutans) in Nam-Nao National Park, Thailand, in August and
September 2009–2011. The local name, “Siamese jellyball”
or “kao-niew ling”, recalls the dark, golf ball-like and
gelatinous ascostromata, and it is claimed to be edible. It
has only been found on bamboo, and was not seen on any
other plants in the area. It occurs at 390–840 m, where the
average temperature is generally less than at lower and
flatter localities.
Numerous bambusicolous fungi have been reported,
with the number of fungal genera reportedly greater in the
tropical regions than other regions due to the higher number
of bamboo species. More than 630 species of fungi are known
from bamboo, most of which are ascomycetes; Eriksson &
Yue (1998) discuss 587 names of pyrenomycetes described
on bamboo, and approximately 200 species occur in southeast
Asia (Hyde et al. 2002). However, few produce distinctive
to sometimes very large ascostroma similar to those seen in
the Thai fungus. Daldinia bambusicola (Ju et al. 1997) has a
black, smooth surface, and relatively smaller ascostromata.
Engleromyces goetzei produces very large ascostromata,
up to 4.5 kg in weight, and E. sinensis is also considerably
larger than Gelatinomyces; these two species appear to be
confined to particular bamboo species normally found on
very high mountains (Whalley et al. 2010). The hypocrealean
fungi, Ascopolyporus philodendrus (Bischoff et al. 2005),
Moelleriella gaertneriana (Chaverri et al. 2008), and
Mycomalus bambusinus (Bischoff & White 2003), produce
rather pale, smooth-walled or brain-like ascostromata and
are probably associated with insects. Munkia martyris,
Neomunkia sydowii and Ustilaginoidea virens are other
hypocrealean fungi in the tribe Ustilaginoideae producing
large asexual stromata on bamboo twigs but their
relationships have not yet been resolved (Bischoff et al.
2005). In addition, Shiraia bambusicola (Dothideomycetes,
Pleosporomycetidae) produces spectacular pinkish orange
ascostromata (Liu et al. 2012). All taxa mentioned above
have perithecoid or flask-shaped ascomata, 8-spored asci,
ascospores that are not to several septate, may or may
not have interascal filaments, and occur on living leaves or
branches.
Since the Siamese jelly-ball fungus is distinct from any
previously scientifically named fungus, it is described as a
monotypic new genus here. It does, however, have some
affiliation to Collophora, but molecular evidence supports its
separation.
© 2013 International Mycological Association
You are free to share - to copy, distribute and transmit the work, under the following conditions:
Attribution:
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).
Non-commercial: You may not use this work for commercial purposes.
No derivative works: You may not alter, transform, or build upon this work.
For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get
permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.
volume 4 · no. 1
71

Sanoamuang et al.
ARTICLE
MATERIALS AND METHODS
Collecting and field sites
Five specimens were collected from Bambusa nutans, along
creeks in Nam Nao National Park, Thailand, at an altitude
of 390–840 m. The first specimen was found behind the
Nam Nao Tourist Service area in late September 2009, and
the next four specimens were from bamboo along the main
road in August and September 2011. Bamboo branches or
culms with specimens were cut off from the main culms,
wrapped in newspaper and brought back to the Plant
Pathology Laboratory, Faculty of Agriculture, Khon Kaen
University, for isolation into pure culture. Dried reference
specimens and living cultures have been deposited at the
Khon Kaen University Culture Collection (KKUK), at Biotec
Culture Collection (GESIASCO), CBS and the Royal Botanic
Gardens Kew (K; GESI).
Isolation, spore discharge, and germination
Two isolation techniques were employed to obtain pure
cultures: tissue transplanting from parts of ascomata, and
ascospores forced to eject directly from asci by exposing a
piece of ascomata to incandescent light, Phillips 220V, 15W,
for a few minutes. Ejected ascospores were collected on
PDA plates or in sterile Petri dishes. The ejected ascospores
on PDA plates were allowed to germinate directly to form
colonies, while those in the empty Petri dishes were diluted
in sterilized water and subsequently plated out on PDA
plates to obtain single ascospore isolates. All white colonies
forming within 3–4 d, with diffusible red pigment in the agar
on the reverse side of these colonies were then selected and
maintained for further study.
Morphological investigation
Fresh gelatinous ascostromata and thin sections of ascomata
embedded in paraffin wax were examined by light microscopy
(Olympus Model BX51 and DP21-LPT) equipped with
anOlympus Nomarski Slider for Transmitted Light U-DICT
(Olympus Model U-DICT) to record the detailed morphology
of the sexual and asexual morphs. Slide cultures of
representative isolates, from stroma, single ascus, and single
ascospore isolations, were also examined microscopically for
the development of asexual structures and for the production
of crystals of insoluble pigment. Structures were mounted
in water, and 30 measurements (at 1 000 ×) made of each
feature. The 5 th and 95 th percentiles were defined for all
measurements, and the extremes are given in parentheses,
including the value of the mean ± SD and L/W ratio (Damm
et al. 2008, Gramaje et al. 2012). To investigate discrete
conidiomata production, water agar culture plates with
sterile pine needles were placed under conditions defined by
Gramaje et al. (2012) for 4–5 wk. Ascospores and conidia
were suspended in distilled water then air dried on cellulose
acetate filter paper (Sartorius Stedim Biotech, Bohemia, NY)
for scanning electron microscopy. The samples were sputtercoated
with a film of gold using a Polaron Range SC7620
sputter coater and examined under a LEO 145OVP scanning
electron microscope.
DNA extraction, PCR amplification, DNA
sequencing, and phylogenetic analysis
The genomic DNA of representative strains isolated
from single asci and single ascospores was extracted
from active growing mycelia on PDA plates using a
cetyltrimethylammonium bromide (CTAB) protocol (Jeewon
et al. 2004, Cai et al. 2006). The whole and partial sequences
from three different regions of the rDNA molecules; the
ribosomal small subunit (SSU), large subunit (LSU), and
internal transcribed spacer (ITS), characterised by different
rates of evolution, were amplified by PCR using primers
having sequences and target regions shown in Table 1.
Whole sequences of SSU were cloned using pGEM-T Easy
Vector (Promega, Promega Corporation, Madison, WI) and
Escherichia coli DH5α as a host. The amplification conditions
were performed in a 50 µL reaction volume as follows: 1 ×
PCR buffer (Invitrogen Life Technologies, Foster, CA), 0.2
mM each dNTP, 0.3 µM of each primer, 1.5 mM MgCl 2
, 0.8
units Tag DNA Polymerase (Invitrogen Life Technologies),
and 100 ng DNA. PCR parameters for all the regions were
as follows: initial denaturation at 94 º C for 3 min, 30 cycles of
94 ° C for 1 min, 52 ° C for 50 s, and 72 ° C for 1 min, and final
extension of 72 ° C for 10 min. The PCR amplified products
were examined by electrophoresis using 1 % agarose gel
containing ethidium bromide (0.5 μg mL). The separated
PCR products were then observed under short wavelength
UV light. DNA sequencing was performed using the primers
as mentioned above in an Applied Biosystems 3730 DNA
Analyser at Macrogen Inc (#60-24, Gasan-dang, Geumchengu,
Seoul, Korea). Since we could not assign or differentiate
the fungus to known taxa, we used SSU, LSU and ITS for
sequence comparisons and in BLASTn searches (www.
ncbi.nlm.nih.gov). The rDNA sequences of the new fungus
have been deposited in GenBank under accession numbers
JX219377 and JX219378 (SSU), JX219381 and JX219382
(LSU), and JX219379 and JX219380 (ITS regions including
5.8S rDNA) for isolates KKUK1 and KKUK2, respectively.
To construct the phylogenetic tree, the analysis was
modified from Greif et al. (2007), instead of using two taxa,
Orbilia auricolor and Scutellinia scutellata as outgroup,
only O. auricolor was employed. The sequence data of the
Siamese Jelly-ball were aligned by ClustalX2 with sequences
of 60 species retrieved from GenBank (www.ncbi.nlm.nih.gov)
representing different classes of ascomycete fungi, including
Arthoniomycetes, Dothideomycetes, Eurotiomycetes, Lecanoromycetes,
Leotiomycetes, Lichinomycetes, and Sordariomycetes,
where both SSU and LSU sequences data
were available (Table 2), and manually edited by MEGA 5.05.
A data set comprising all known species of Collophora with
available ITS sequences (Table 3) was used for comparison
and the outgroups for this dataset were Neobulgaria pura and
Leotia lubrica. A maximum parsimony analysis was conducted
using PAUP v. 4.0b10 (Swofford 1998). A heuristic search
was performed using parsimony as the optimality criterion.
Gaps were treated as missing data. Starting trees were
obtained at random via stepwise addition with tree-bisectionreconnection
as the branch-swapping algorithm, and with
the MulTrees option in effect. After 100 stepwise additional
sequences were completed, confidence in the branches
of the resulting trees was evaluated by bootstrap analysis
72 ima fUNGUS

Gelatinomyces siamensis gen. sp. nov. on bamboo in Thailand
Table 1. PCR primers used for obtaining DNA sequences of the Gelatinomyces siamensis.
Name Sequence (5’-3’) Target region a Reference
NS1 GTAGTCATATGCTTGTCTC SSU 20-38 White et al. (1990)
NS4 CTTCCGTCAATTCCTTTAAG SSU 1150-1131 White et al. (1990)
SR8R GAACCAGGACTTTTACCTT SSU 732-749 Vilgalys & Hester (1990)
NS8 TCCGCAGGTTCACCTACGGA SSU 1788-1768 White et al. (1990)
ITS4 TCCTCCGCTTATTGATATGC Internal transcribed spacer (ITS) regions LSU 60-41 White et al. (1990)
ITS5 GGAAGTAAAAGTCGTAACAAGG SSU 1744-1763 White et al. (1990)
NL1 GCATATCAATAAGCGGAGGAAAAG Domain of large subunit (LSU) rDNA O’Donnell (1993)
NL4 GGTCCGTGTTTCAAGACGG D1/D2 domain of LSU rDNA O’Donnell (1993)
a
Saccharomyces cerevisiae numbering.
ARTICLE
Table 2. Fungal taxa used for phylogenetic analysis with GenBank accession numbers for small subunit (SSU) and large subunit (LSU)
sequences, including their main characteristics.
Ingroup
GenBank accession
no. (SSU, LSU)
Origin (substrate,
country)
Main characteristics
Reference
Class Sordariomycetes
Cainia graminis AF431948, AF431949 Sesleria albicans,
France
Chaetomium globosum AB048285, AY346272 Indoor environment,
Germany
Diatrype disciformis DQ471012, DQ470964 Decayed wood,
Netherlands
Hypocrea americana AY544693, AY544649 Fomitopsis pinicola,
USA
Stromatic perithecial,
unitunicate with pore,
saprophytic, plant parasitic
or endophytic
Lumbsch et al. (2005)
Huhndorf et al. (2004),
Okane et al. (2001)
Spatafora et al. (2006)
Lutzoni et al. (2004)
Sordaria fimicola AY545724, AY545728 Dung, Canada Cai et al. (2006)
Xylaria acuta AY544719, AY544676 Decayed wood, USA Rogers (1984)
Xylaria hypoxylon AY544692, AY544648 Downed rotting wood,
USA
Class Leotiomycetes
Spatafora et al. (2006)
Botryotinia fuckeliana AY544695, AY544651 Apothecial or cleistothecial,
unitunicate and inoperculate,
saprophytic, plant parasitic,
Hirschhauser & Frohlich
(2007)
Bulgaria inquinans DQ471008, DQ470960 Germany
some species known only
Spatafora et al. (2006)
Collophora rubra GQ154628, GQ154608
anamorphic i.e. Collophora
Wood necrosis close to
Damm et al. (2010)
pruning wound, South
Africa
Crinula calciiformis AY544729, AY544680 Lutzoni et al. (2004)
Monilinia fructicola AY544724, AY544683 Fruit, USA Fulton & Brown (1997)
Neofabraea malicorticis AY544706, AY544662 Apples, USA Lutzoni et al. (2004)
Pezicula carpinea DQ471016, DQ470967 Carpinus caroliniana,
Spatafora et al. (2006)
Canada
Potebniamyces pyri DQ470997, DQ470949 Cankered bark, USA Spatafora et al. (2006)
Class Lecanoromycetes
Diploschistes thunbergianus AF274112, AF274095 Australia Apothecial, unitunicate, Lumbsch et al. (2005)
rostrate asci, mostly
Lobaria scrobiculata AY584679, AY584655 USA
lichenized
Lutzoni et al. (2004)
Trapella placodioides AF119500, AF274103 Wall, UK Lumbsch et al. (2005)
Class Lichinomycetes
Lempholemma polyanthes AY548805, AF356691 USA Apothecial, fissitunicate,
lichenized
Lutzoni et al. (2004)
volume 4 · no. 1
73

Sanoamuang et al.
Table 2. (Continued).
ARTICLE
Ingroup
GenBank accession
no. (SSU, LSU)
Origin (substrate,
country)
Main characteristics
Reference
Peltula auriculata DQ832332, DQ832330 Miadlikowska et al. (2006)
Peltula umbilicata DQ782887, AF356689 Miadlikowska et al. (2006)
Class Eurotiomycetes
Eremascus albus M83258, AY004345 Dried fruit, UK Cleistothecial, nonfissitunicate,
Berbee & Taylor (1992)
Eurotium rubrum U00970, AY004346 saprophytic or
plant parasitic
Lumbsch et al. (2005a)
Penicillium expansum DQ912698, AF003359 Fruit, USA Seifert & Louis-Seize (2000)
Exophiala dermatitidis DQ823107, DQ823100 Human, USA James et al. (2006)
Glyphium elatum AF346419, AF346420 Salix, USA Lindemuth et al. (2001)
Ramichloridium anceps DQ823109, DQ823102 Soil under Thuja
plicata, Canada
Class Dothideomycetes
Order Botryosphaeriales
Botryosphaeria ribis DQ678000, DQ678053 Ribes, USA Pseudothecial, fissitunicate
asci, saprophytic or plant
Botryosphaeria stevensii DQ678012, DQ678064 Fraxinus excelsior, parasitic
Netherlands
Guignardia bidwellii DQ678034, DQ678085 Parthenocissus
tricuspidata
Order Capnodiales
James et al. (2006)
Schoch et al. (2006)
Schoch et al. (2006)
Schoch et al. (2006)
Catenulostroma abetis DQ678040, DQ678092 Abies, Germany Pseudothecial, fissitunicate
asci, saprophytic or plant
parasitic
Schoch et al. (2006)
Cercospora beticola DQ678039, DQ678091 Beta vulgaris, Italy Schoch et al. (2006)
Microxyphium citri AY016340, AY004337 Fruit of Citrus sinensis,
Lumbsch et al. (2005)
Spain
Mycosphaerella punctiformis DQ471017, DQ470968 Dead fallen leaves
Spatafora et al. (2006)
of Quercus robur,
Netherlands
Scorias spongiosa DQ678024, DQ678075 Aphid Schoch et al. (2006)
Order Dothideales
Aureobasidium pullulans DQ471004, DQ470956 Fruit of Vitis vinifera,
France
Pseudothecial, fissitunicate
asci, pseudoparaphyses
absent, mainly saprophytic
Spatafora et al. (2006)
Delphinella strobiligena AY016341, AY016358 Cone of Pinus
Lumbsch & Lindemuth (2001)
halepensis, Greece
Discosphaerina fagi AY016342, AY016359 Leaf of Populus, UK Lumbsch & Lindemuth (2001)
Dothidea ribesia AY016343, AY016360 Cult of Ribes,
Switzerland
Stylodothis puccinioides AY016353, AY004342 Viburnum lantana,
Switzerland
Order Myriangiales
Cladosporium cladosporioides DQ678004, DQ678057 Leaf of Arundo,
England
Davidiella tassiana DQ678022, DQ678074 Human skin,
Netherlands
Elsinoe centrolobi DQ678041, DQ678094 Centrolobium
robustum, Brazil
Pseudothecial, fissitunicate
globose asci, non-ostiolar,
saprophytic or plant parasitic
Lumbsch et al. (2005)
Lumbsch et al. (2005)
Schoch et al. (2006)
Schoch et al. (2006)
Schoch et al. (2006)
74 ima fUNGUS

Gelatinomyces siamensis gen. sp. nov. on bamboo in Thailand
Table 2. (Continued).
Ingroup
GenBank accession
no. (SSU, LSU)
Origin (substrate,
country)
Myriangium duriaei AY016347, DQ678059 Chrysomphalus
aonidium, Argentina
Main characteristics
Reference
Lumbsch & Lindemuth (2001)
ARTICLE
Order Pleosporales
Arthopyrenia salicis AY538333, AY538339 Bark of Salix,
Netherlands
Perithecoid pseudothecial,
ostiolar, non-lichenized or
lichenized with fissitunicate
asci and pseudoparaphyses
present
Lumbsch et al. (2005)
Cucurbitaria elongata DQ678009, DQ678061 Cytisus sessilifolius,
Schoch et al. (2006)
France
Dendrographa leucophaea AY548803, AY548810 Lutzoni et al. (2004)
Lecanactis abietina AY548805, AY548812 Lutzoni et al. (2004)
Neotestudina rosatii DQ384069, DQ384107 Seed of Cuminum
Kruys et al. (2006)
cyminum imported from
India, Japan
Pleospora herbarum DQ247812, DQ247804 Leaf of Medicago
Schoch et al. (2006)
sativa, India
Setosphaeria monoceras AY016352, AY016368 Lumbsch & Lindemuth (2001)
Trematosphaeria heterospora AY016354, AY016369 Iris, Switzerland Lumbsch et al. (2005)
Westerdykella cylindrica AY016355, AY004343 Cow dung, Kenya Lumbsch et al. (2005)
Order Incertae sedis, Family Tubeufiaceae
Helicomyces lilliputeus AY856942, AY856899 Rotten dicotyledonous Pseudothecial, fissitunicate Tsui & Berbee (2006)
wood, USA
Helicomyces roseus DQ678032, DQ678083 Submerged bark,
Schoch et al. (2006)
Switzerland
Tubeufia cerea AY856947, AY856903 Tsui & Berbee (2006)
Class Arthoniomycetes
Arthonia dispersa AY571379, AY571381 Syringa vulgaris,
Sweden
Fissitunicate, mostly
lichenized
Lumbsch et al. (2005)
Dendrographa leucophaea AY548803, AY548810 Lutzoni et al. (2004)
Lecanactis abietina AY548805, AY548812 Lutzoni et al. (2004)
Unknown
Gelatinomyces siamensis
Isolate KKUK1
JX219377, JX219381
Bambusa nutans,
Thailand
Apothecial, aggregated,
embedded in gelatinous ball
This study
Isolate KKUK2
JX219378, JX219382
Outgroup Class Orbiliomycetes
Orbilia auricolor DQ471001, DQ470953 Soil, UK Apothecial, non-fissitunicate Spatafora et al. (2006)
(Felsenstein 1985) using 1000 replicates. The resultant
tree was visualized using PAUP v. 4.0b10 (Swofford 1998).
Additionally, Bayesian analysis using MrBayes version 3.2.1
which approximates posterior probabilities of clades using a
Markov chain-Monte Carlo (MCMC) method (Huelsenbeck &
Ronquist 2001) were performed. Four chains for a total of 2
500 000 generations for SSU and LSU datasets and 600 000
generations for ITS dataset with phylogenetic trees sampled
every 100 generations were applied to all searches. The
general time-reversible model with invariant sites and gamma
distribution (GTR + I + Γ) were used. Scores in Baysian
analyses were estimated as posterior probabilities calculated
from the posterior distribution of trees excluding 25 % burnin
trees (Huelsenbeck & Rannala 2004). Nodes obtained
from both analysis were considered well supported by
bootstrap values greater than or equal to 70 % and posterior
probabilities greater than or equal to 0.95 (Spatafora et al.
2007).
volume 4 · no. 1
75

Sanoamuang et al.
ARTICLE
Table 3. Fungal taxa in the Collophora species, Leotiomycetes used for phylogenetic analysis with GenBank accession numbers for ITS
sequences, including their main characteristics.
Species
GenBank accession no.
(ITS)
Origin (substrate,
country)
Main characteristics
Reference
Order Incertae sedis, Family Incertae sedis
Collophora africana GQ154570 Prunus salicina, Hyphae carry short necks or mere
South Africa
collarettes that release conidia;
discrete conidiomata present
Damm et al. (2010)
C. capensis GQ154571 Prunus salicina, As above Damm et al. (2010)
GQ154572
South Africa
GQ154573
GQ154574
C. hispanica JN808840 Prunus dulcis, As above Gramaje et al. (2012)
JN808841
Spain
JN808842
C. paarla GQ154586 Prunus salicina, As above Damm et al. (2010)
South Africa
C. pallida GQ154578 Prunus salicina, As above Damm et al. (2010)
GQ154580
South Africa
GQ154582
GQ154584
C. rubra GQ154562 Prunus salicina, As above Damm et al. (2010)
GQ154564
South Africa
GQ154566
GQ154568
Gelatinomyces siamensis Bambusa nutans Sexual morph present, asexual
Isolate KKUK1 JX219379 Thailand
conidia produced on short and long
conidiogenous cells
Isolate KKUK2
JX219380
This study
Outgroup-Leotiales
Leotia lubrica
Neobulgaria pura
GU222296
HM051080
RESULTS
The total number of characters in the SSU analysis was
2954, including gaps. All characters were given equal weight.
The number of constant characters was 1122, and 1039 were
parsimony-informative. The maximum parsimony analysis
yielded a single tree with 4968 characters. The scores of
the tree were as following; Consistency index (CI) = 0.623,
Retention index (RI) = 0.468, Rescaled consistency index
(RC) = 0.291, and Homoplasy index (HI) = 0.377. In the
partial LSU sequence, the total number of characters from
the alignment was 644 with gaps; 268 and 299 out of these
644 characters were constant and parsimony-informative,
respectively. Only one tree was generated by maximum
parsimony analysis from the LSU data set, with CI = 0.338,
RI = 0.635, RC = 0.215, and HI = 0.622.
In the SSU tree, only members of one class of fungi grouped
in the same clade as isolates KKUK1 and KKUK2. These
belonged to Leotiomycetes, with a bootstrap score of 70 (Fig.
1). This suggests that the two isolates KKUK1 and KKUK2 are
Leotiomycetes. To ascertain their closest sequenced relatives,
the SSU sequences were also compared to those available
in GenBank using the standard nucleotide-nucleotide BLAST
program. Isolates KKUK1 (JX219377) and KKUK2 (JX219378)
had the highest sequence similarity with Collophora rubra
(GQ154628) at 97 %. The LSU tree gave a similar result, with the
studied isolates KKUK1 and KKUK2 clustered in Leotiomycetes,
with a bootstrap score of 72 (Fig. 3). BLASTn searches of SSU
and LSU sequences of the isolates confirmed these results.
To determine whether the bamboo fungus was a
Collophora species or not, an additional ITS tree was
constructed; this had 638 characters, of which 380 were
constant characters and 100 parsimony informative. The
tree was parsimoniously constructed with Neobugaria pura
and Leotia lubrica as outgroups (CI = 0.893, RI = 0.886,
RC = 0.791, and HI = 0.107). KKUK1 and KKUK2 clustered
together (bootstrap score = 100) and were separated from
six Collophora species with bootstrap support at 99 (Fig. 5).
76 ima fUNGUS

Gelatinomyces siamensis gen. sp. nov. on bamboo in Thailand
ARTICLE
Fig. 1. Phylogenetic tree from maximum parsimony analysis based on SSU sequences showing the position of Gelatinomyces siamensis
isolates KKUK1&2 (arrow), which is grouped closely in Leotiomycetes. Bootstrap support values > 50 % are shown above branches.
The SSU and LSU trees inferred by Bayesian analysis
gave phylogenetic relationship results similar to those
employed by maximum parsimony, although the topologies of
the trees were different (Figs 2, 4). The KKUK1 and KKUK2
isolates were grouped in Leotiomycetes, with posterior
probability values of 1.0. Similarly, the additional tree inferred
from ITS information using the same dataset employed in Fig.
5 produced a tree with similar topology and support values
which indicated that Collophora species were clustered
separately from KKUK1 and KKUK2.
On the basis of the DNA sequence analyses from the
SSU, LSU, and ITS regions, and the sexual and asexual
characters of the fungus, we conclude that Siamese jellyball,
found on bamboo in Nam Nao National Park, Thailand,
is new to science and represents a previously undescribed
genus and species, named Gelatinomyces siamensis here.
Taxonomy
Gelatinomyces Sanoamuang, Jitjak, Rodtong &
Whalley, gen. nov.
MycoBank MB804026
Diagnosis: Ascostromata ball-shaped, ping pong ball-sized,
gelatinous, dark coloured when mature, with red pigmentation
volume 4 · no. 1
77

Sanoamuang et al.
ARTICLE
Fig. 2. Phylogenetic tree obtained from Bayesian analysis inferred from SSU sequences showing phylogenetic relationship among fungal
species selected from Ascomycota and Gelatinomyces siamensis isolates KKUK1&2. Posterior probability values ≥ 0.95 yielded from a Bayesian
analysis shown at nodes. Gelatinomyces siamensis is grouped in Leotiomycetes (arrow).
78 ima fUNGUS

Gelatinomyces siamensis gen. sp. nov. on bamboo in Thailand
ARTICLE
Fig. 3. Phylogenetic tree from maximum parsimony analysis based on LSU sequences showing the position of Gelatinomyces siamensis isolates
KKUK1&2 (arrow), which clusters very close to Leotiomycetes. Bootstrap support values > 50 % are shown above branches.
inside. Ascomata apothecia, aggregated, containing thickwalled
multi-spored asci.
Etymology: Recalling the gelatinous nature of the ball shaped
ascostromata, and myces = fungus.
Type: Gelatinomyces siamensis N. Sanoamuang et al. 2013.
Description: Stromata present, pale grey to dark coloured,
soft gelatinous in texture. Ascomata apothecia, aggregated
but well separated, translucent, pale grey, convex or cushionshaped,
± globose or pulvinate when young, later becoming
brown-black to black and discoid, flattened or slightly
depressed when mature. Apothecia sessile, the exciple dark
and gelatinous, well-developed, ± glabrous. Hymenial layer
composed of interascal filaments, asci, and with a gelatinous
layer at the surface; interascal tissue poorly developed,
composed of simple, branched paraphyses. Asci cylindrical,
tapered at the base, without an operculum or any opening
characters at the tip, non-amyloid apical ring, multi-spored,
persistent. Ascospores minute, hyaline, globose to ovoid
shaped with smooth walls.
volume 4 · no. 1
79

Sanoamuang et al.
ARTICLE
Fig. 4. Phylogenetic tree obtained from Bayesian analysis inferred from LSU sequences showing phylogenetic relationship among fungal
species selected from Ascomycota and Gelatinomyces siamensis isolates KKUK1&2. Posterior probability values ≥ 0.95 shown at nodes.
Colonies slow-growing, white, moist at first then becoming
dry with age, lacking aerial mycelium. Conidiophores
hyaline, of two types, either with very short conidiogenous
cells on hyphal cells, or longer conidiogenous cells arising
at branching points where a septum forms. Conidia vary in
shape and size at first, aggregated in masses around hyphae
on the agar surface, becoming ovoid, minute, and powdery
with age. No discrete conidiomata observed on sterilized pine
needles on the surface of water agar.
Gelatinomyces siamensis Sanoamuang, Jitjak,
Rodtong & Whalley, sp. nov. MycoBank MB804027
(Figs 6–7)
Diagnosis: Stromata gelatinous, ball shaped, 3-4 cm diam,
surface with many discoid ascomata, aggregated but
separate, pale greenish to pinkish grey, becoming black
when mature, a band of red pigmented in the interior.
Asci clavate with a short stipe, unitunicate in structure,
multispored. Ascospores tiny, globose to slightly ovoid.
Asexual morph Phialosphora-like, conidia produced on very
short conidiogenous cells on hyphal cells and also on longer
80 ima fUNGUS

Gelatinomyces siamensis gen. sp. nov. on bamboo in Thailand
ARTICLE
Fig. 5. Phylogenetic tree from maximum parsimony analysis based on ITS sequences showing the position of Gelatinomyces siamensis isolates
KKUK1&2 (arrow) which clusters very close to Collophora spp. Bootstrap support values > 50 % are shown above the branches.
conidiogenous cells. Colonies white, but with a distinctive
red pigmented underside, the red pigment diffusing into
agar.
Etymology: Named after the country of origin.
Type: Thailand: Phetchabun Province: Nam Nao National
Park, on bamboo culms and branches, 11 Sept. 2011,
Sanoamuang (KKUK – holotype; KKUK1, 2, 3, 4…. 100 – exholotype
cultures; Biotec Culture Collection codes: Gesiasco
6, 11, 18, and 19; CBS 135071, 135072, 135073 and 135074;
K – Gesi01, 02 and 03 – isotypes).
Description: Stromata, 3–4 cm across, pale grey to brown
black, soft and highly gelatinous, inner tissue repeatedly
folded, up to golf-ball size when fresh, dark to black, hard
and sclerotium-like when dry; 300–560 discoid ascomata
aggregated, but separate, embedded in the surface of a
single gelatinous stromatic ball. Ascomata apothecia, usually
100–200 µm tall and 340–600 µm diam in surface view,
translucent, greyish green, sometimes pale pink, convex
or cushion-shaped when young, ± globose or pulvinate,
brown-black to black, discoid, flattened or slightly depressed
when mature, sessile. Hymenium dark and gelatinous,
well-developed, the exciple is smooth, interascal ascal
tissues poorly developed, composed of simple, branched
paraphyses. Asci (79.5–)84.5–175(–178) × (15–)15.5–31(–
31.5) µm, clavate, tapered at the base, without an operculum
or any opening structures at the tip, apical ring non-amyloid,
multispored, persistent, thick walled but unitunicate in
structure, 1–3 µm (av. 1.5 ± 0.5 µm) measured at the central
part of asci, slightly thickening towards the tip, penetrating
through the gelatinous layer covering asci to forcibly eject
ascospores. Ascospores hyaline, globose to ovoid, smoothwalled,
2–2.5 × 1.5–2.5 µm, mean ± SD = 2.2 ± 0.25 × 1.8 ±
0.19 µm, L/W=1.2:1.
Colonies slow-growing, white, moist at first then dry
with age, lacking aerial mycelium. Conidiophores hyaline,
of two types: (1) Conidiophores reduced to very short
conidiogenous cells or conidiogenous pegs arising from
hyphal cells, ~1 µm long; and (2) Longer conidiogenous
cells, (10–)12.0–46.0(–48) × 2.0–3.0 µm, produced at the
branching points where the septum appears. Conidia are
single-celled and colourless. Conidia produced on very
short conidiogenous cells on hyphal cells, vary in shape
and size, (2.5–)3–11.5(–12) x 2.0–5.0 µm, mean ± SD
= 6.29 ± 0.32 × 2.79 ± 0.25 µm, L/W=2.3:1, aggregated
in masses around the hyphae or around the apex of,
volume 4 · no. 1
81

Sanoamuang et al.
ARTICLE
Fig. 6. Sexual morph of Gelatinomyces siamensis (A–C, F, G holotype; D, E isotype). A. Ascostromata. B. Apothecia. C. Red pigments
accumulated inside ascostroma. D. Ascal arrangement on gelatinous apothecium covered by dark matter. E. Asci and paraphyses. F. Single
ascus. G. Ascospores under scanning electron microscope (arrow).
annellide-like conidiogenous cells and on the agar surface
from conidiogenous pegs. Conidia produced on the longer
conidiogenous cells, nearly ovoid, 2.0–4.0 × 2–2.5 µm,
mean ± SD = 2.27 ± 0.19 x 2.12 ± 0.16 µm, L/W=1.1:1,
similar to conidia obtained from old cultures. Swollen
hypha also present.
An unidentified red pigment is always associated with
ascostromatic structures and the asexual morph in artificial
culture. Patches of red pigment are accumulated inside the
ascostroma, visible when cut. The red pigment appears in
culture as both diffusible and water insoluble substances.
The soluble red pigment stains the medium soon after the
82 ima fUNGUS

Gelatinomyces siamensis gen. sp. nov. on bamboo in Thailand
ARTICLE
Fig. 7. Microscopic characteristics of the asexual morph of Gelatinomyces siamensis (ex-holotype). A, B. Fungal colonies on PDA producing red
pigments into the media. C. Red crystals generated by mycelia. D. Hyphal coil. E. Hyphal pairing, condia from short conidiogenous cells directly
from mycelium. F. Conidia cluster at the apex of the tapered annellides and long, thick-walled, septate conidiophores. G. Conidia with internal
inclusions. H. Swollen hypha. I. Dried conidia under scanning electron microscope (arrow).
establishment of the colony starting under the fungal colonies
and covers the whole Petri dish within a week, whereas the
insoluble red pigment appears as crystals on the surface of
the fungal colony (Fig. 7a–c).
DISCUSSION
Bamboos are the only known habitat for a wide range of
fungi, to which can be added Gelatinomyces siamensis. As
mentioned in the Introduction, the majority of bamboo fungi
reported to produce large stromata are in Sordariomycetes
and Dothideomycetes, whereas molecular analyses show
that G. siamensis belongs in Leotiomycetes (Figs 1–4),
with bootstrap values of 70 and 72 in both SSU and LSU
trees, respectively. Further, all the previously reported
taxa with large stromata produce perithecioid structures
immersed in ascostromatic tissue, whereas G. siamensis
produces discoid apothecia on the surface of a gelatinous
ascostromatic ball. The discoid apothecia are sessile or very
short stalked, and contain thick-walled asci with numerous
ascospores originating from the same level in a single layer
volume 4 · no. 1
83

Sanoamuang et al.
ARTICLE
Table 4. Ecological and morphological characteristics of Collophora spp. in comparison to Gelatinomyces siamensis.
Characteristics
Species
Gelatinomyces
Collophora
Associated plant Bamboo species Prunus spp. and almond
Position
Attached to the point where bud breaks, culms or
branches
Teleomorph Apothecia aggregate in a ball-like cluster Unknown
Red pigment crystalline in
pure culture
Conidiogenous pegs,
intercalary
Conidiogenous cells at the
septal point
Swollen hypha as conidial
mother cells
Numerous, parallelogram or rhombus in shape
Present
Present
Present
Deep inside the heart of the wood, with heart rot symptom
Absent, not mentioned
Present
Absent
Absent
Conidia
Various sizes and shapes but turn slightly ovoid in
shape and minute in size when age
Consistency in shape and size
Table 5. Characteristics of Collophora spp. in culture media in comparison to Gelatinomyces siamensis.
Species Spore size (μm) Discrete Pigment Endo-conidia Sexual morph
conidiomata
C. africana (2.5–)3.5–5.5(–8) × 1–2(–2.5) Present Red Present Unknown
L/W = 3:1
C. capense (4–)4.5–6.5(–9) × 1–1.5(–2) Present Red Present Unknown
L/W = 3.7:1
C. hispanica (2.5–)3.5–5(–6.5) × (1–)1.5(–2) Present Red Present Unknown
L/W = 2.9:1
C. paarla (3–)4–7.5(–11) × (0.5–)1–2(–3) Present Yellow, red Present Unknown
L/W = 4.1:1
C. pallida (2.5–)3–5(–7) × 1–1.5(–2) Present None Present Unknown
L/W = 3.5:1
C. rubra (3.5–)4–5.5(–8) × 1–2(–3.5) Present Red Present Unknown
L/W = 3.2:1
G. siamensis (2.0–)2.1–3.9(–4) × (2–)2–2.5(–2.5)
L/W=1.1:1
Absent Red Absent Apothecia
inside the apothecium. Branched and septate interascal
filaments grow between the asci. In the parsimonious tree
derived from SSU sequence data, Leotiomycetes diverged
before Dothideomycetes and Sordariomycetes.
The ascus type is one of the essential morphological
characters used to classify and identify ascomycete fungi.
There is a wide range of ascus types, e.g. operculate, poricidal,
non-poricidal, deliquescent, fissitunicate and rostrate, based
on how ascospores are discharged (Bellemère 1994, Schoch
et al. 2009). In Gelatinomyces siamensis, the ascospores
are forcibly released when exposed under light through the
thick-walled, and apparently multi-layered ascus which is
functionally unitunicate. However, there is no evidence that
the asci are operculate or porous. Therefore, the G. siamensis
ascus is best termed rostrate because when discharging
ascospores, the apical part of the ascus is broken to release
the spores (Schoch et al. 2009).
In terms of the ascostromatal texture, the gelatinous
nature of apothecia is one of the key characteristics
mentioned by Wang et al. (2006a, b) to indicate membership
of Helotiaceae, and is seen, for example, in Ascocoryne,
Ascotremella and Neobulgaria (Seaver 1930, Petersen &
Læssøe 2012). An additional feature recognized in this family
is an endophytic lifestyle. However, G. siamensis does not
appear to be endophytic as the ascostromata are superficially
attached to the pole surface and are easily removed without
any apparent damage to either the trees or the ascostromata.
Gelatinomyces siamensis seems to be associated only with
bamboo and its biological role requires further investigation.
Generally, the number of ascospores in an ascus is
eight, whereas G. siamensis has numerous ascospores in
a single mature ascus. Polyspored asci can originate as a
result of one of several different mechanisms: fragmentation
of eight originally multiseptate spores, repeated mitotic
divisions following meiosis leading to numerous spores
being then cut simultaneously from the ascus protoplast, or
the direct formation of conidia from ascospores while still in
the ascus (Hawksworth 1987, Raju 2002). Polyspory is a
84 ima fUNGUS

Gelatinomyces siamensis gen. sp. nov. on bamboo in Thailand
diagnostic character in some families and genera in diverse
classes and orders of ascomycetes, while in other cases it is
phylogenetically informative only at the species level, arising
in particular species within genera otherwise comprising
8-spored species. An example from the Leotiomycetes is
Thelebolus stercoreus (de Hoog et al. 2005). This feature
should, therefore, not be over-emphasized in the recognition
of the genus Gelatinomyces, especially as the ontogeny of
ascosporogenesis in this fungus has not yet been determined
As the phylogenetic trees obtained from SSU and LSU
sequence data and BLASTn results hinted that Collophora
rubra was the most closely related species, an ITS dataset
containing various ITS sequences from all six known
Collophora species was compiled (Table 3). Maximum
parsimony and Bayesian analysis of these data confirmed
that Gelatinomyces siamensis occupied an isolated position
well-separated from the Collophora clade. The separation
was supported by bootstrap scores of 99 (Fig. 5). As no sexual
morph is currently known in any of the described Collophora
species, we speculated that G. siamensis could be a sexual
morph of Collophora, but this possibility is excluded by
molecular and morphological comparisons.
Further, while bamboos are the natural habitat for G.
siamensis, and the ascostromata can easily be detached
from the poles, Collophora species live inside peach
and almond trees and can be pathogenic. We attempted
induction of conidiomata in our cultures, under conditions
applied to C. hispanica (Gramaje et al. 2012). Gelatinomyces
siamensis did not produce any discrete conidiomata, but only
separate tiny conidia instead. In addition, the development
of internal conidia inside hyphae, as seen in Collophora, did
not occur. On the other hand, conidiogenous cells arose at
septal points and swollen hypha were microscopically seen
in G. siamensis, whereas Collophora species have not been
shown to have either of these characteristics. A comparison
of the significant features exhibited by G. siamensis and
Collophora species is presented in Tables 4 and 5.
On the grounds of morphological characteristics and
molecular phylogeny of the fungus, G. siamensis belongs
in phylum Ascomycota, class Leotiomycetes, but cannot be
referred to any accepted order at this time; i.e. it has to be
treated as incertae sedis within the class. It is conceivable
that future molecular data on this and other genera of
Leotiomycetes might indicate that a new order is appropriate,
but we consider that this would be premature at this time.
ACKNOWLEDGEMENTS
Grateful acknowledgement is made to the Higher Education
Research Promotion and National Research University Project of
Thailand, Office of the Higher Education Commission, through the
Holistic Watershed Management Cluster of Khon Kaen University.
We are deeply grateful to SUT Research Center for Microbial
Cultures for Food and Bioplastics Production, and Narumol Mothong
for supporting and assisting with the DNA work. Acknowledgement
is extended to Khon Kaen University and the Faculty of Agriculture
for providing financial support for manuscript preparation activities.
REFERENCES
Bellemère A (1994) Asci and ascospores in ascomycete systematics.
In: Ascomycete Systematics: problems and perspectives in the
nineties (DL Hawksworth, ed.): 111–126. New York: Plenum
Press.
Berbee ML, Taylor JW (1992) Two ascomycete classes based
on fruiting-body characters and ribosomal DNA sequences.
Molecular Biology and Evolution 9: 278–284.
Bischoff JF, Chaverri P, White jr JF (2005) Clarification of the host
substrate of Ascopolyporus and description of Ascopolyporus
philodendron sp. nov. Mycologia 97: 710–717.
Bischoff JFB, White jr JF (2003) The plant-infecting clavicipitaleans.
In: Clavicipitalean Fungi: evolution, biology, chemistry,
biocontrol, and cultural impacts (JF White jr, CW Bacon, NL
Hywel-Jones, JW Spatafora, eds): 119–145. Marcel Dekker:
New York.
Cai L, Jeewon R, Hyde KD (2006) Phylogenetic investigations
of Sordariaceae based on multiple gene sequences and
morphology. Mycological Research 110: 137–150.
Chaverri P, Liu M, Hodge KT (2008) A monograph of the
entomopathogenic genera Hypocrella, Moelleriella, and
Samuelsia gen. nov. (Ascomycota, Hypocreales, Clavicipitaceae),
and their aschersonia-like anamorphs in the neotropics. Studies
in Mycology 60: 1–66.
Damm U, Crous PW, Fourie PH (2008) A fissitunicate ascus
mechanism in the Calosphaeriaceae, and novel species of Jattaea
and Calosphaeria on Prunus wood. Persoonia 20: 39–52.
Damm U, Fourie PH, Crous PW (2010) Coniochaeta (Lecythophora),
Collophora gen. nov. and Phaeomoniella species associated
with wood necroses of Prunus trees. Persoonia 24: 60–80.
de Hoog GS, Gottlich E, Platas G, Genilloud O, Leotta G, van
Brummelen J (2005) Evolution taxonomy and ecology of the
genus Thelebolus in Antarctica. Studies in Mycology 51: 33–76.
Eriksson OE, Yue J-Z (1998) Bambusicolous pyrenomycetes, an
annotated checklist. Myconet 1 (2): 25–78.
Felsenstein J (1985) Confidence limits on phylogenies: an approach
using the bootstrap. Evolution 39: 783–791.
Fulton CE, Brown AE (1997) Use of SSU rDNA group-I intron to
distinguish Monilinia fructicola from M. laxa and M. fructigena.
FEMS Microbiology Letters 157: 307–312.
Gramaje D, Agusti-Brisach C. Pérez-Sierra A, Moralejo E, Olmo D,
Mosrt L, Damm U, Armengol J (2012) Fungal trunk pathogens
associated with wood decay of almond trees on Mallorca (Spain).
Persoonia 28: 1–13.
Gramaje D, Mostert L, Armengol J (2011) Characterization of
Cadophora luteo-olivacea and C. melinii isolates obtained
from grapevines and environmental samples from grapevine
nurseries in Spain. Phytopathology Mediterraneana 50 (Suppl.):
112–126.
Greif MD, Gibas CFC, Tsuneda A, Currah RS (2007) Ascoma
development and phylogeny of an apothecioid dothideomycete,
Catinella olivacea. American Journal of Botany 94: 1890–1899.
Hawksworth DL (1987) The evolution and adaptation of sexual
reproductive structures in the Ascomycotina. In: Evolutionary
Biology of the Fungi (ADM Rayner, CM Brasier, D Moore, eds):
179–189. Cambridge: Cambridge University Press.
Hirschhauser S, Frohlich J (2007) Multiplex PCR for species
discrimination of Sclerotiniaceae by novel laccase introns.
International Journal of Food Microbiology 118: 151–157.
ARTICLE
volume 4 · no. 1
85

Sanoamuang et al.
ARTICLE
Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference
of phylogenetic trees. Bioinformatics 17: 754–755.
Huelsenbeck JP, Rannala B (2004) Frequentist properties of
Bayesian posterior probabilities of phylogenetic trees under
simple and complex substitution models. Systematic Biology 53:
904–913.
Hyde KD, Zhou D, Dalisay T (2002) Bambusicolous fungi: a review.
Fungal Diversity 9: 1–14.
James TY, Kauff F, Schoch CL, Matheny PB, Hofstetter V, Cox CJ,
Celio G, Gueidan C, Fraker E, Miadlikowska J, Lumbsch HT,
Rauhut A, Reeb V, Arnold AE, Amtoft A, Stajich JE, Hosaka K,
Sung GH, Johnson D, O’Rourke B, Crockett M, Binder M, Curtis
JM, Slot JC, Wang Z, Wilson AW, Schussler A, Longcore JE,
O’Donnell K, Mozley-Standridge S, Porter D, Letcher PM, Powell
MJ, Taylor JW, White MM, Griffith GW, Davies DR, Humber RA,
Morton JB, Sugiyama J, Rossman AY, Rogers JD, Pfister DH,
Hewitt D, Hansen K, Hambleton S, Shoemaker RA, Kohlmeyer
J, Volkmann-Kohlmeyer B, Spotts RA, Serdani M, Crous PW,
Hughes KW, Matsuura K, Langer E, Langer G, Untereiner WA,
Lucking R, Budel B, Geiser DM, Aptroot A, Diederich P, Schmitt
I, Schultz M, Yahr R, Hibbett DS, Lutzoni F, McLaughlin DJ,
Spatafora JW, Vilgalys R (2006) Reconstructing the early evolution
of Fungi using a six-gene phylogeny. Nature 443: 818–822.
Jeewon R, Liew ECY, Hyde KD (2004) Phylogenetic evaluation
of species nomenclature of Pestalotiopsis in relation to host
association. Fungal Diversity 17: 39–55
Ju YM, Rogers JD, San Martín F (1997) A revision of the genus
Daldinia. Mycotaxon 61: 243–293.
Kruys A, Eriksson OE, Wedin M (2006) Phylogenetic relationships of
coprophilous Pleosporales (Dothideomycetes, Ascomycota), and
the classification of some bitunicate taxa of unknown position.
Mycological Research 110: 527–536.
Lindemuth R, Wirtz N, Lumbsch HT (2001) Phylogenetic analysis of
nuclear and mitochondrial rDNA sequences supports the view
that Loculoascomycetes (Ascomycota) are not monophyletic.
Mycological Research 105: 1176–1181.
Liu Y, Liu Z, Wongkaew S (2012) Developing characteristics and
relationships of Shiraia bambusicola with bamboo. Sonklanakarin
Journal of Science and Technology 34: 17–22.
Lumbsch HT, Lindemuth R (2001) Major lineages of Dothideomycetes
(Ascomycota) inferred from SSU and LSU rDNA sequences.
Mycological Research 105: 901–908.
Lumbsch HT, Schmitt I, Lindemuth R, Miller A, Mangold A, Fernandez
F, Huhndorf S (2005) Performance of four ribosomal DNA regions
to infer higher-level phylogenetic relationships of inoperculate
euascomycetes (Leotiomyceta). Molecular Phylogenetics and
Evolution 34: 512–524.
Lutzoni F, Kauff F, Cox CJ, McLaughlin D, Celio G, Dentinger B,
Padamsee M, Hibbett DS, James TY, Baloch E, Grube M, Reeb
V, Hofstetter V, Schoch C, Arnold AE, Miadlikowska J, Spatafora
J, Johnson D, Hambleton S, Crockett M, Shoemaker R, Sung
GH, Lucking R, Lumbsch T, O’Donnell K, Binder M, Diederich
P, Ertz D, Gueidan C, Hansen K, Harris RC, Hosaka K, Lim YW,
Matheny B, Nishida, H, Pfister D, Rogers J, Rossman A, Schmitt
I, Sipman H, Stone J, Sugiyama J, Yahr R, Vilgalys R (2004)
Assembling the fungal tree of life: progress, classification, and
evolution of sub-cellular traits. American Journal of Botany 91:
1446–1480.
Miadlikowska J, Kauff, F, Hofstetter V, Fraker E, Grube M, Hafellner
J, Reeb V, Hodkinson BP, Kukwa M, Lucking R, Hestmark
G, Otalora MG, Rauhut A, Budel B, Scheidegger C, Timdal
E, Stenroos S, Brodo I, Perlmutter GB, Ertz D, Diederich P,
Lendemer JC, May P, Schoch CL, Arnold AE, Gueidan C,
Tripp E, Yahr R, Robertson C, Lutzoni F (2006) New insights
into classification and evolution of the Lecanoromycetes
(Pezizomycotina, Ascomycota) from phylogenetic analyses of
three ribosomal RNA and two protein-coding genes. Mycologia
98: 1088–1103.
Minter DW, Peredo HL, Watson AT (2007) Acrospermum chilense
sp. nov. from Chile and the Acrospermales ord. nov. Boletín de la
Sociedad Argentina de Botánica 42: 107–112.
O’Donnell K (1993) Fusarium and its near relatives. In: The Fungal
Holomorph: mitotic, meiotic and pleomorphic speciation in
fungal systematics (DR Reynolds, JW Taylor, eds): 225–233.
Wallingford: CAB International.
Okane I, Nakagiri A, Ito T (2001) Surculiceries rugispora gen. et
sp. nov., a new endophytic mitosporic fungus from leaves of
Bruguiera gymnorrhiza. Mycoscience 42: 115–122.
Petersen JH, Læssøe T (2012) MycoKey 4.0. www. mycokey.com.
Raju NB (2002) Meiosis and ascospore development in nonlinear
asci of Neurospora pannonica. Mycologia 94: 99–104.
Rogers JD (1984) Xylaria acuta, Xylaria cornu-damae and Xylaria
mali in continental United States. Mycologia 76: 23–33.
Schoch CL, Shoemaker RA, Seifert KA, Hambleton S, Spatafora JW,
Crous PW (2006) A multigene phylogeny of the Dothideomycetes
using four nuclear loci. Mycologia 98: 1041–1052.
Schoch CL, Sung GH, Giráldez FL, Townsend JP, Miadlikowska
J, Hofstetter V, Robbertse B, Matheny PB, Kauff F, Wang Z,
Gueidan C, Andrie RM, Trippe K, Ciufetti LM, Wynns A, Fraker E,
Hodkinson BP, Bonito G, Groenewald JZ, Arzanlou M, Sybren de
Hoog G, Crous PW, Hewitt D, Pfister DH, Peterson K, Gryzenhout
M, Wingfield MJ, Aptroot A, Suh SO, Blackwell M, Hillis DM,
Griffith GW, Castlebury LA, Rossman AY, Lumbsch HT, Lücking
R, Büdel B, Rauhut A, Diederich P, Ertz D, Geiser DM, Hosaka
K, Inderbitzin P, Kohlmeyer J, Volkmann-Kohlmeyer B, Mostert L,
ÓDonnell K, Sipman H, Rogers JD, Shoemaker RA, Sugiyama
J, Summerbell RC, Untereiner W, Johnson PR, Stenroos S,
Zuccaro A, Dyer PS, Crittenden PD, Cole MS, Hansen K, Trappe
JM, Yahr R, Lutzoni F, Spatafora JW (2009) The Ascomycota tree
of life: a phylum-wide phylogeny clarifies the origin and evolution
of fundamental reproductive and ecological traits. Systematic
Biology 58: 224–239.
Seaver FJ (1930) Photographs and descriptions of cup-fungi
X. Ascotremella. Mycologia 22 (2): 51–54.
Seifert KA, Louis-Seize G (2000) Phylogeny and species concepts
in the Penicillium aurantiogriseum complex as inferred from
partial beta-tubulin gene DNA sequences. In: Integration of
Modern Taxonomic Methods for Penicillium and Aspergillus
Classification (RA Samson, JI Pitt, eds): 189–198. London:
Taylor and Francis.
Skinner SJ, Tsuneda A, Currah RS (2006) Morphology and
development of the reticuloperidial ascomata of Auxarthron
conjugatum. Mycologia 98: 447–454.
Spatafora JW, Sung GH, Johnson D, Hesse C, O’Rourke B, Serdani
M, Spotts R, Lutzoni F, Hofstetter V, Miadlikowska J, Reeb V,
Gueidan C, Fraker E, Lumbsch T, Lucking R, Schmitt I, Hosaka K,
Aptroot A, Roux C, Miller AN, Geiser M, Hafellner J, Hestmark G,
Arnold AE, Budel B, Rauhut A, Hewitt D, Untereiner WA, Cole MS,
Scheidegger C, Schultz M, Sipman H, Schoch CL (2006) A fivegene
phylogeny of Pezizomycotina. Mycologia 98: 1018–1028.
86 ima fUNGUS

Gelatinomyces siamensis gen. sp. nov. on bamboo in Thailand
Swofford DL (1998) PAUP*: phylogenetic analysis using parsimony
(*and other methods). Version 4. Sunderland, MA: Sinauer
Associates.
Tsui CK, Berbee ML (2006) Phylogenetic relationships and
convergence of helicosporous fungi inferred from ribosomal DNA
sequences. Molecular Phylogenetics and Evolution 39: 587–597.
Vilgalys R, Hester M (1990) Rapid genetic identifcation and
mapping of enzymatically amplifed ribosomal DNA from several
Cryptococcus species. Journal of Bacteriology 172: 4238–4246.
Wang Z, Binder M, Schoch CL, Johnston PR, Spatafora JW,
Hibbett DS (2006a) Evolution of helotean fungi (Leotiomycetes,
Pezizomycotina): a nuclear rDNA phylogeny. Molecular
Phylogenetics and Evolution 41: 295–312.
Wang Z, Johnson PR, Takamatsu S, Spatafora JW, Hibbett DS
(2006b) Toward a phylogenetic classification of the Leotiomycetes
based on rDNA data. Mycologia 98: 1065–1075.
Whalley MA, Khalil AMA, Wei TZ, Yao YJ, Whalley AJS (2010) A new
species of Engleromyces from China, a second species in the
genus. Mycotaxon 112: 317–23.
White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics. In:
PCR Protocols: a guide to methods and applications (MA Innis,
DH Gelfand, JJ Sninsky, TJ White, eds): 315–322. San Diego:
Academic Press.
ARTICLE
volume 4 · no. 1
87

ARTICLE
ima fUNGUS

doi:10.5598/imafungus.2013.04.01.09
IMA Fungus · volume 4 · no 1: 89–102
Auxarthronopsis, a new genus of Onygenales isolated from the vicinity of
Bandhavgarh National Park, India
Rahul Sharma 1 , Yvonne Gräser 2 , and Sanjay K. Singh 1
1
National Facility for Culture Collection of Fungi, MACS’ Agharkar Research Institute, G. G. Agarkar Road, Pune - 411 004, India; corresponding
author e-mail: singhsksingh@gmail.com
2
Institute of Microbiology and Hygiene (Charité), Humboldt University, Dorotheenstr 96, Berlin 10117 Germany
ARTICLE
Abstract: An interesting onygenalean ascomycete was isolated from soil collected from a hollow tree near
Bandhavgarh National Park situated in central India. The keratinophilic nature associated with a malbranchealike
asexual morph, appendaged mesh-like reticuloperidia, and subglobose to oblate, punctate ascospores,
support the inclusion of this isolate in Onygenaceae. Further, the pale cream ascomata, punctate ascospores,
and swollen septa in the peridial hyphae suggested that this was a new species of Auxarthron. However,
phylogenetic study of LSU, SSU and ITS sequences, and presence of more than three swollen septa on the
peridial appendages, do not support a placement within Auxarthron, and the new generic name Auxarthronopsis
is introduced to accommodate this new fungus. The distinguishing features of this new taxon are the multiple
(≥10) swollen septa on the appendages attached to its reticulate, loosely mesh-like peridium, the finely and
regularly punctate ascospores, and the production of arthroconidial and aleurioconidial asexual forms. Sequence
analysis of ITS1-5.8S-ITS2, SSU and LSU regions clearly separate this fungus from monophyletic Auxarthron
and other taxa bearing some morphological similarity. Phylogenetically, Auxarthronopsis bandhavgarhensis
gen. sp. nov. is closest to Amauroascus purpureus, A. volatilis-patellis, Nannizziopsis albicans, and Renispora
flavissima, but differs morphologically.
Key words:
Auxarthron
Knuckle-joints
Molecular phylogeny
Multiseptate appendages
Onygenaceae
Article info: Submitted: 19 February 2012; Accepted: 17 April 2013; Published: 10 June 2013.
INTRODUCTION
Onygenales is an assemblage of fungi which has evolved
to utilize keratin that forms part of the integument of birds,
reptiles, and mammals. This substrate, like cellulose, is
abundant in soil as it is regularly shed by large number of
vertebrates either as effete integumental elements or as
ingested materials mixed into excreta. Burrows actively
inhabited by small mammals are excellent habitats for
these fungi since they contain ample substrate, hair – and
moisture – at all times of the year, and even in hot dry summers.
The unusual form of the ascomata in most onygenalean
members, a mesh-like reticuloperidium with various types
of appendages, is suggested to be an adaptation to active
dispersal via attachment to arthropods, birds, and mammals
(Currah 1985). During our studies on keratinophilic fungi
from different geographical regions of India, an interesting
ascomycete was isolated from a burrow-like habitat, in this
case a hollow tree, near Bandhavgarh National Park which
has one of the highest densities of wild tigers in the world.
The most recent monographic treatment of Onygenales
was devoted to evolutionary and molecular phylogenetic
studies (Guarro et al. 2002). It included four new genera, 14
new species, and six new combinations based on sequence
analysis of one or more rDNA regions (ITS, LSU and SSU).
Unlike several other groups of fungi where the rDNA locus
fails to resolve the phylogeny of taxa, onygenalean fungal
phylogeny was mostly well resolved with rDNA gene
comparisons (Gräser et al. 1999, Sole et al. 2002c, Sugiyama
et al. 2002). An exception lay in some recently evolved
asexual dermatophyte lineages, where little variation is
observed even in the ITS region, and where microsatellites or
other highly labile loci are necessary for species delimitation
by molecular methods.
The order Onygenales contains a few genera that have
mesh-like peridia, the reticuloperidium (sensu Currah 1988),
bearing elongate appendages; these include Auxarthron,
Pectinotrichum, and Uncinocarpus (Currah 1988). Castanedomyces
is another genus of Onygenales that forms
elongate appendages, but differs in having a membranous
peridium similar to that in Aphanoascus. The generic name
Auxarthron was established by Orr et al. (1963) for species
with “enlargements at the septa in the peridial hyphae; lightly
coloured, elongate appendages which are non-septate
except for one, two or three basal septa with characteristic
swellings at such septa”. The generic name means ‘swollen
joints’, and the genus now comprises 13 species (Sole et al.
2002a, b, Sigler et al. 2002). The monophyly of Auxarthron
© 2013 International Mycological Association
You are free to share - to copy, distribute and transmit the work, under the following conditions:
Attribution:
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).
Non-commercial: You may not use this work for commercial purposes.
No derivative works: You may not alter, transform, or build upon this work.
For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get
permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.
volume 4 · no. 1
89

Sharma, Gräser & Singh
ARTICLE
was demonstrated by Sole et al. (2002a) based on ITS
sequence data. Another morphologically similar genus,
Amauroascus, has ascomata composed of loosely woven
hyphae, and, unlike Auxarthron, it forms incompositoperidia 1 .
That genus was found to be polyphyletic (Sole et al. 2002a).
Morphological study of the material from the Bandhavgarh
area suggested that it might be accommodated in Auxarthron,
if the existing circumscription was extended to include
species with more than three septate peridial appendages.
To determine if such a change was supported by sequence
data, we conducted molecular studies using three different
regions of rDNA to establish the phylogenetic relationships
of our taxon.
MATERIALS AND METHODS
Sample origin and isolation of fungus
A soil sample (S214) was collected from around Bandhavgarh
National Park (23.5°N, 80.25°E), Umariya, Madhya
Pradesh, India during 2001. Collections were made from the
subsurface using sterile spatulas in sterile sealed polythene
bags. On return to the laboratory, the samples along with the
polythene bags were directly stored in plastic boxes at room
temperature (range 10 °C in winter to >40 °C in summer). The
present isolate was obtained from the samples in February
2007 by the hair-baiting technique (Vanbreuseghem 1952)
and the microdilution drop-trail method (Sharma et al. 2002).
The growth rate was determined at 28 °C on Sabouraud
Dextrose Agar (SDA; peptone 10 g, 40 g dextrose, agar 20
g L -1 ), dilute Sabouraud Dextrose Agar (dSDA; peptone 1 g,
dextrose 4 g, agar 20 g L -1 ), Oatmeal Agar (OA) (HiMedia,
Mumbai), Cornmeal Agar (CMA) (HiMedia, Mumbai), Potato
Carrot Agar (PCA) (HiMedia, Mumbai) and Potato Dextrose
Agar (PDA; 200 g potato (extract), dextrose 20 g, agar 20 g
L -1 ). The morphological structures were measured in warmed
lactophenol mounts.
The specimen is deposited in the Ajrekar Mycological
Herbarium (AMH), with pure cultures deposited in the
National Fungal Culture Collection of India (NFCCI–WDCM
932), Maharashtra Association for Cultivation of Sciences’
Agharkar Research Institute, Pune, India, and at CBS-KNAW
Fungal Biodiversity Centre, Utrecht, The Netherlands (CBS
134524).
Light and Scanning Electron Microscopy
(SEM)
Light microscopy was performed using lactophenol mounts.
Photographs were taken either with a Nikon Eclipse E800
research microscope (Nikon, Tokyo) mounted with a Nikon HIII
camera or a Zeiss Axio Imager A-2 (Carl Zeiss MicroImaging,
Gottingen) research microscope. Stereomicroscopic study
of the ascomata was undertaken using a Nikon SMZ1500
microscope with an attached Nikon 8400 camera. For SEM
analysis, naturally dried ascomata on baited hair were directly
mounted onto stubs and briefly dried under vacuum (15–20
1
A term used by Currah (1985) for globose ascomata having a loose
and incomplete network of hyphae.
min), then coated with gold-paladium/platinum mixture and
visualized under JEOL 610 and JEOL JSM 6360A (JEOL,
Tokyo) microscopes at varying magnification and accelerating
voltages.
DNA extraction and PCR amplification
DNA was extracted using the CTAB (N-cetyl-N, N,
N-trimethylammonium bromide) method (Gräser et al.
1999) after the fungus had been grown on Sabouraud
glucose agar (Difco Laboratories) for 21 d at 28 ºC. The
ITS1-5.8S-ITS2, 18S, and 28S rRNA genes were amplified
using universal primers. PCR was performed with primer
pairs Mass 266/V9D, ITS1/ITS4 (ITS), 5.8SR, LROR,
LR7, LR7R, LR12 (LSU), and NS1, NS4, NS3, NS8 (SSU)
(Rehner & Samuels 1994, Vilgalys & Hester 1990, White
et al. 1990). For the ITS region, 50 µL of the PCR reaction
mixture contained 28 µL H 2
O, 5 µL PCR buffer (10x), 4 µL
dNTPs (250 mM each), 1 µL primer (50 pmole µL -1 ), 0.4
µL Taq polymerase (5 U µL -1 ) (Applied Biosystems Roche,
NJ), and 5 µL genomic DNA (10 ng µL -1 ). The mixture
was overlaid with one drop of light mineral oil (Sigma,
Steinheim). PCR was performed in a Perkin Elmer 9600
thermocycler (PerkinElmer, Roche Molecular Systems,
Branchburg, NY) with the following reaction conditions: 95
°C for 5 min, (95 °C for 1 min, 55 °C for 1 min, 72 °C for
1 min) ×30; final extension 72 °C for 10 min. For 18S and
28S rRNA, 25 µL of the PCR reaction mixture contained
16 µL H 2
O; 2.5 µL PCR buffer (10x); 1 µL dNTPs (250 mM
each); 0.5 µL primer (50 pmol µL -1 ); 1 µL Taq polymerase
(1 U µL -1 ) (Genei, Bangalore); 2.5 µL genomic DNA (10
ng µL -1 ); and was overlaid with one drop of light mineral
oil (Genei, Bangalore). The PCR reaction was performed
in an Eppendorf Mastercycler (Eppendorf, Hamburg) with
the following conditions: 95 °C for 5 min, (95 °C 1 min, 51
°C or 65 °C for 1 min, 72 °C 1 min) ×30; final extension
72 °C for 10 min. The amplification product was checked
on 1.2 % agarose gel stained with ethidium bromide and
photographed under UV.
Sequencing and phylogenetic analysis
The resulting amplification products were cleaned with
QIAquick PCR purification kit (Qiagen, Hilden) or Axygen
PCR Cleanup kit (Axygen Scientific, CA) and sequenced
using the same primers (White et al. 1990) on an automated
sequencer (Beckman-Coulter, Fullerton, California or ABI
3100 Avant, Applied Biosystems, Foster City, California).
For phylogenetic analysis, sequences of material used in
previous studies and ex-type strains were retrieved in FASTA
format from GenBank. Phylogenetic analyses using the
Neighbour-Joining (NJ) method (Saitou & Nei 1987) were
performed with the MEGA v. 5 computer program (Tamura
et al. 2011). The phylogenetic tree was constructed using
the Kimura two-parameter distance model (Kimura 1980)
with the ‘pairwise deletion of gaps option’. The robustness
of branches was assessed by bootstrap analysis with 1000
replicates. The ITS, LSU, and SSU sequences of our isolate
(NFCCI 2185) have been deposited in GenBank (Table 1)
and sequence alignments have been submitted to TreeBase
(Submission ID 12372).
90
ima fUNGUS

Auxarthronopsis gen. sp. nov.
Table 1. Fungal species and LSU, SSU and ITS nrDNA GenBank accession numbers used in the study.
Classification Taxon ITS SSU LSU
Arthrodermataceae Arthroderma cajetani AY176736.1
A. ciferri EF413624.1 EF413625.1
A. curreyi AJ315165.1
A. otae AY176735.1
Ctenomyces serratus AJ877222.1 U29391.1 AY176733.1
Gymnoascaceae Gymnoascus aurantiacus AB015772.1 AY176747.1
G. littoralis FJ358272.1
G. marginosporus AJ315168.1
G. petalosporus AY176748.1
G. reesii AY176749.1
G. ruber AY177296.1 AY176746.1
Onygenaceae Amauroascopsis reticulatus AJ271418
Amauroascus aureus AJ271433 AY176705.1
Am. echinulatus
AJ271562
Am. mutatus AJ271567 AB075321.1
Am. niger AJ271563 AY176706.1
Am. oblatus
AJ271421
Am. purpureus AJ271564 AY176707.1
Am. queenslandicus AB361646.1 AJ315175.1
Am. volatilis-patellis AJ133435 AB075324.1
Aphanoascus fulvescens
AJ315172.1
A. mephitalis AB015779.1 AJ176725.1
Apinisia racovitzae
AJ271429
Auxarthron alboluteum AB361630.1 AY124494.1 AB359411.1
A. californiense AF038352.1 AY176711.1
A. chlamydosporum AJ271425
A. concentricum AJ271428
A. conjugatum AJ271573 AB075325.1
A. compactum AJ271574 AB015767.1
A. filamentosum AY177298.1 AY124501.1 AB359417.1
A. kuehnii AB040691 AB015766.1 AB040691.1
A. pseudoauxarthron AJ271572
A. pseudoreticulatus AJ271420
A. reticulatum AJ271568 AB359430.1
A. umbrinum (A. thaxteri) AJ271571 AY124498.1
A. zuffianum AJ271569 AY124492.1 AY176712.1
Auxarthronopsis bandhavgarhensis HQ164436 JQ048939 JQ048938
Byssoonygena ceratinophila
AJ315176.1
Chlamydosauromyces punctatus
AY177297.1
Nannizziopsis albicans
AJ271432
Neogymnomyces demonbreunii AJ315842.1 AY176716.1
Onygena corvina
AB075364.1
O. equina U45442.1
Pectinotrichum llanense AJ390391.1 AJ315178.1
Renispora flavissima AF299348.1 AB015784.1 AY176719.1
Shanorella spirotricha
AJ271430
Uncinocarpus reesii AJ271419 L27991.1 AY176724.1
Trichocomaceae Byssochlamys nivea GU733368.1 AY176750.1
Eurotium herbariorum GU733351.1 AY176751.1
Petromyces alliaceus AB002071.1 AY176752.1
ARTICLE
volume 4 · no. 1
91

Sharma, Gräser & Singh
Table 2. A comparison of morphological characters of the genus Auxarthron, Auxarthronopsis, and Amauroascus.
ARTICLE
Character Auxarthron Auxarthronopsis Amauroascus
Ascomata Colour Yellow-brown to brown White to pale cream White, yellow or brown
Size

Auxarthronopsis gen. sp. nov.
in the analysis because SSU sequences were not available
in GenBank. The strong LSU and SSU sequence similarity
of NFCCI 2185 to other members of Onygenales suggests
membership in this order.
Sequencing of the ITS region of NFCCI 2185 yielded
a 613 bp long nucleotide sequence that included 242 bp
of ITS1, 150 bp of 5.8S and 166 bp of ITS2. In contrast to
the LSU and SSU, the ITS sequence of the undescribed
fungus was distant from other species it was compared with.
It showed maximal sequence similarities of only 84 % with
two quite distinct species: Amauroascus purpureus (IFO
32622, AJ271564) and Nannizziopsis albicans (IMI 155645,
AJ271432), with 90 % and 88 % query coverage, respectively.
The next most closely associated sequences in the BLAST
results had similar similarities of 85 %, but show very low
query coverage of less than 75 %. These sequences included
a mixture of Eurotiales and Onygenales. The ITS sequence
of NFCCI 2185 was also compared with sequences of 29
species from ten genera of related Onygenaceae (Table 1)
and a phylogenetic tree (NJ) was constructed using Kimura-2
parameter model (Fig. 6).
Phenotypically, the new taxon superficially resembles
Auxarthron in having peridial hyphae with swollen septa, but
it is distinct genetically. This is evident in the LSU, SSU, and
ITS trees where Auxarthron forms a monophyletic clade (Figs
4–6). A morphological comparison of the newly designated
Auxarthronopsis with Auxarthron and Amauroascus is shown
in Table 2.
Description: Ascomata discrete, globose, white to
pale cream, reticuloperidium 500–1000 µm diam, with
appendages. Peridial hyphae branched and anastomosed to
form reticulate network with knuckle-joints 2.0–2.5 µm wide.
Peridial appendages pale, numerous, elongated, straight or
bifurcated, multiseptate (≥10) with distinct swollen septa 2–2.5
µm wide, tapering to acute hyaline apex indistinguishable
from vegetative hyphae, up to 400 µm long. Asci globose,
eight-spored, hyaline, evanescent 5 × 5.5 µm. Ascospores
unicellular, hyaline, globose to subglobose, smooth under
light microscopy, finely and regularly punctate under SEM,
globose in polar view but oblate in equatorial view, 1.5–2.5
× 2.5–3.0 µm.
Asexual morph: Conidia malbranchea-like, arthric, intercalary
or terminal on short branches, abundant, hyaline, solitary,
aseptate, 2.0–4.5 × 4.5–11.5 µm, separated by autolytic
connective cells.
Cultures: Colonies after 3 wk at 28 °C (Figs 2a, b) on SDA,
white, slow growing (3 cm), cottony, slightly raised at the
centre; reverse uncoloured to pale brown; on CMA, OA, and
dilute SDA, slow growing (3 cm diam), mostly submerged
with sparse mycelium, pale brown, reverse uncoloured to
pale brown; on PCA and PDA slow growing (2 cm diam),
pale coloured at the centre and white in the peripheral region,
slightly cottony, and the reverse pale brown. Ascomata
produced sparsely on PCA and abundantly on PDA (Figs 2c,
d), but without elongate appendages.
ARTICLE
Taxonomy
Auxarthronopsis Rahul Sharma, Y. Gräser & S.K. Singh,
gen. nov.
MycoBank MB563744
Etymology: Named after its phenotypic similarity to the genus
Auxarthron.
Description: Ascomata solitary, globose to subglobose,
white to pale cream. Peridium made of mesh of interwoven
hyphae with swollen septa. Appendages straight, tapering at
the apex, sometimes branched, with multiple (≥10) swollen
septa. Asci globose to subglobose, hyaline, evanescent, 8–
spored. Ascospores unicellular, hyaline, oblate, with finely
and regularly punctate walls. Asexual morph terminal and
intercalary hyaline arthroconidia and aleurioconidia.
Type: Auxarthronopsis bandhavgarhensis Rahul Sharma et
al. (2013).
Auxarthronopsis bandhavgarhensis Rahul Sharma,
Y. Gräser & S. K. Singh, sp. nov.
MycoBank MB563745
GenBank HQ164436, JQ048938, JQ048939
(Figs 1–3)
Etymology: bandhavgarhensis- referring to the locality where
the soil collection was made, Bandhavgarh National Park,
India.
Type: India: Madhya Pradesh: Umariya, buffer zone of
Bandhavgarh National Park, ascomata growing on horse hair
(keratin bait) in soil S214 collected from inside a big hollow
tree, 16 June 2001, R. Sharma (AMH 9405 – holotype;
NFCCI 2185 = CBS 134524 – cultures ex-type).
Substratum: Isolated on horse hair from soil.
Distribution: Known only from the type locality, Bandhavgarh,
India.
DISCUSSION
The typical mesh-like peridium of Auxarthronopis
bandhavgarhensis and other features, including the ability
to grow on horse hair (keratinophilic nature), make this
fungus a relatively typical member of Onygenales (Currah
1985). However, it could not be placed in the morphologically
similar genus Auxarthron, which never forms multi-septate
appendages. The new genus Auxarthronopsis shows
a resemblance to Auxarthron in its mesh-like reticuloperidium
and in its possession of knuckle joints; however,
the ascomata of Auxarthron are mostly yellow to brown at
maturity, while the ascomata of the new taxon are white to
pale cream. The peridial hyphae of Auxarthron species are
dark coloured, rigid, and relatively broad, while those of the
new taxon are pale, narrow, and flexible. Also, the ascospores
of the new species are finely and regularly punctate (with
circular punctae), a morphology that differs from the minutely
volume 4 · no. 1
93

Sharma, Gräser & Singh
ARTICLE
Fig. 1. Auxarthronopsis bandhavgarhensis (AMH 9405). A–B. Stereomicroscopic-view of mature ascoma growing on horse hair. C. Light
microscopic view of unmounted ascomata with elongate appendages picked up from hair bait. D. Mesh-like reticuloperidium with central
ascospore mass. E. Base of elongate appendage showing inverted Y-shaped arch with swollen septa (arrows). F. Phase contrast image of
ascoma showing multiseptate peridial appendages. G. Bifurcate branching of perdial appendages (arrows). H. Dichotomously branched perdial
hyphae showing knuckle joints (arrows). Bars: A = 600 µm; B = 200 µm; C = 100 µm; D = 80 µm; E = 6 µm; F = 80 µm; G = 80 µm; H = 10 µm.
94
ima fUNGUS

Auxarthronopsis gen. sp. nov.
ARTICLE
Fig. 2. Auxarthronopsis bandhavgarhensis (NFCCI 2185 T ). Colonies at 28 °C after 3 wk of incubation. A. Colony front on different media.
B. Reverse of colony on different media. C. Enlarged view of the colony on PDA with abundant ascomata near peripheral region. D. Developing
ascomata on the periphery of colony on PDA. Bars: C = 1 cm; D = 300 µm.
volume 4 · no. 1
95

Sharma, Gräser & Singh
ARTICLE
Fig. 3. Auxarthronopsis bandhavgarhensis (AMH 9405). Peridial appendages, ascospores and asexual morph. A. Multiple septa on peridial
appendages (arrows). B. Elongate appendages radiating from reticuloperidia on horse hair. C. Sparsely asperulate basal portion of perdial
appendage with two swollen septa. D. Enlarged portion of septa with ring of tubercles. E. Asci and ascospores. F. Finely and regularly punctate
ascospores showing circular punctae. G, H. Slide culture preparation showing sessile and stalked aleurioconidia and arthroconidia (NFCCI
2185). Bars: A = 40 µm; B = 100 µm; C = 10 µm; D = 1 µm; E = 2 µm; F = 1 µm; G–H = 20 µm.
96
ima fUNGUS

Auxarthronopsis gen. sp. nov.
ARTICLE
Fig. 4. Neighbour-joining tree based on nucleotide sequences of 28S rDNA gene of the 25 stains of Arthrodermataceae, Gymnoascaceae
and Onygenaceae listed in Table 1 along with Auxarthronopsis bandhavgarhensis (NFCCI 2185 T ). Three strains belonging to Trichocomaceae
Byssochlamys nivea (AY176750.1), Eurotium herbariorum (AY176751.1), and Petromyces alliaceus (AY176752.1) served as outgroup. The
branch lengths are proportional to distance values calculated in MEGA 5 and values at nodes represents bootstrap percentage of 1000 replicates.
Bootstrap values above 50 % are shown.
asperulate to punctate-reticulate ascospores of Auxarthron.
Ascospores of A. pseudoauxarthron possess similar circular
pits on the ascospore walls, but in that species the spores are
spherical and the ascomatal appendages lack knuckle joints.
In general, species of Auxarthron do not possess more than
three septa in the peridial appendages, whereas those of
volume 4 · no. 1
97

Sharma, Gräser & Singh
ARTICLE
Fig. 5. Neighbour-joining tree based on nucleotide sequences of 18S rDNA gene of the 22 stains of Arthrodermataceae, Gymnoascaceae
and Onygenaceae listed in Table 1 along with Auxarthronopsis bandhavgarhensis NFCCI 2185 T . Three strains belonging to Trichocomaceae
Byssochlamys nivea (GU733368.1), Eurotium herbariorum (GU733351.1), and Petromyces alliaceus (AB002071.1) served as outgroup. The
branch lengths are proportional to distance values calculated in MEGA 5 and values at nodes represents bootstrap percentage of 1000 replicates.
Bootstrap values above 50 % are shown.
98
ima fUNGUS

Auxarthronopsis gen. sp. nov.
ARTICLE
Fig. 6. Neighbour-joining bootstrap consensus tree based on nucleotide sequences of internal transcribed spacer (ITS) region and 5.8S rDNA
gene of the 30 strains listed in Table 1 which includes reference strains of Auxarthron species and other onygenalean genera along with
Auxarthronopsis bandhavgarhensis (NFCCI 2185 T ). The unrooted phylogenetic tree was drawn using 611 nucleotide of the ITS1, 2 and 5.8S
rRNA gene using MEGA 5 software. The branch lengths are proportional to distance values calculated in MEGA 5 and values at nodes represents
bootstrap percentage of 1000 replicates. Bootstrap values above 50 % are shown.
volume 4 · no. 1
99

Sharma, Gräser & Singh
ARTICLE
Auxarthronopsis have more than 10 septa. The phylogenetic
interrelationships of Auxarthron and Amauroascus have
been studied by Sole et al. (2002a) using ITS sequences,
who found the former genus to be monophyletic and the
latter polyphyletic. Our nrSSU and nrLSU trees also showed
Auxarthron as monophyletic. The new taxon was excluded
from the Auxarthron clade (Figs 4– 5), and the ITS sequence
comparisons also showed Auxarthronopsis as distinct
from Auxarthron, but closer to Amauroascus purpureus,
Nannizziopsis albicans, and Amauroascus volatilis-patellis.
The ITS similarity of Auxarthronopsis bandhavgarhensis to
the nearest neighbour, Amauroascus purpureus, was less
than 85 % (119 bp out of 620 bp; 92 substitutions and 27
indels). Morphologically, A. purpureus is also distinct in
possessing purple ascomata that lack knuckle joints and
peridial appendages, and forming globose, frilled ascospores
(Ito & Nakagiri 1995). The other phylogenetically closest
neighbour, Nannizziopsis albicans (Fig. 6), differs from the
new taxon in having a peridium of undifferentiated peridial
hyphae without appendages, and in lacking a well-developed
reticuloperidium (Guarro et al. 1991). Phylogenetically these
two species differ at 128 of 627 nucleotide positions, including
74 substitutions and 54 indels. Another phylogenetically
related species, Amauroascus volatilis-patellis, differs from
Auxarthronopsis bandhavgarhensis in forming a peridium
of undifferentiated hyphae lacking appendages, and in
producing ascospores which are punctate-reticulate. It also
differs at 166 of 623 nucleotide positions, 102 of which are
substitutions and 64 of which are indels.
In the nrLSU and nrSSU trees (Figs 5–6), Auxarthronopsis
was placed close to Amauroascus, Renispora, and
Neogymnomyces. However, the new taxon is morphologically
inconsistent with these genera in the distinctness of the
ascomata, with a mesh-like reticuloperidium with swollen
septa. Renispora flavissima has ascomata of poorly
differentiated hyphae, which lack appendages, and forms
finely pitted reniform or bacilliform ascospores. The type
species of Neogymnomyces, N. demondreunii, forms
discrete, spherical golden-yellow ascomata with hyaline,
thick-walled, smooth and septate peridial hyphae, along
with long, hyaline, peridial appendages. Recently, a new
species of Neogymnomyces, N. virgineus, was described by
Doveri et al. (2011) based on morphological and molecular
data; however, it could not be included in our analysis as its
ITS and LSU sequences (JN038187, JN038186) were not
available to us. Neogymnomyces virgineus forms irregularly
globose to pulvinate ascomata with pale yellow, fairly thick
walled, verruculose septate hyphae along with two kinds of
peridial appendages: one long, tapering and smooth, and the
other comparatively short, often branched, verruculose, and
rounded at the tips. Neogymnomyces also differs in lacking
swollen septa in the peridial hyphae and the appendages,
and in possessing an arthro- and aleurioconidial asexual
morph characterised by frequent swollen cells.
Another genus that possesses knuckle joints is the
monotypic Pectinotrichum (Varsavsky & Orr 1971).
Pectinotrichum llananse forms a reticuloperidium with
long appendages and knuckle joints, but differs from
Auxarthronopsis in having pectinate hyphae, large tubercules
on the appendages and peridial hyphae, a Chrysosporium
asexual morph, and almost smooth ascospores. Currah
(1994) transferred Pectinotrichum llanense to Auxarthron,
but its distance from Auxarthron was substantiated by the
molecular studies of Sugiyama et al. (1999). Phylogenetically
that species is distant from Auxarthronopsis as it separates
out from the main Onygenaceae clade in SSU analysis (Fig.
5) and clusters with Ctenomyces serratus. Varsavsky & Orr
(1971), who originally noted that the pectinate hyphae of P.
llanense resemble the ctenoid appendages of Ctenomyces
serratus, suggested that genetic studies of these genera
would provide more evidence of a close relationship between
them (Varsavsky & Orr 1971).
Knuckle-joints are a common feature in species with
well developed reticuloperidia, viz. Gymnoascus reesii,
Pectinotrichum llananse, and almost all Auxarthron species.
Their purpose may be to provide strength to the mesh-like
spherical peridium which protects the central ascospore
mass from mite grazing in nature (Summerbell 2000). The
swollen septa in Auxarthronopsis are slightly different in
that they have a ring of tubercles visible under SEM (Fig.
3c, d) making knuckle joints relatively prominent in LM even
though they are found on thin, smooth or sparsely asperulate,
peridial hyphae.
Currah (1985) suggested that the morphological
discontinuity seen in several genera of Onygenales might be
bridged by as yet unrecorded forms. Perhaps Auxarthronopsis
represents one such intermediate genus.
The order Onygenales now comprises 18 genera that
have peridial appendages. These are usually borne on either
a membranous cleistoperidium or a completely hyphal,
mesh-like reticuloperidium. They may also be formed on an
incomplete hyphal mesh-like incompositoperidium. A key to
all appendaged genera of the order is provided, including
Ctenomyces, the peridium of which includes membranous as
well as hyphal elements.
Key to the genera of Onygenales with peridial appendages
1 Ascomata cleistoperidium type ......................................................................................................................................... 2
Ascomata reticuloperidium or incompositoperidium type .................................................................................................. 3
2(1) Ascomata made of only cleistoperidium ................................................................................................. Castanedomyces
Ascomata made of inner layer cleisto-type, outer layer reticulo-type ............................................................. Ctenomyces
3(1) Peridial appendages straight with simple or curved apices, branched or unbranched, uncinate, never coiled ................ 4
Peridial appendages coiled .............................................................................................................................................. 11
100
ima fUNGUS

Auxarthronopsis gen. sp. nov.
4(3) Peridial hyphae or appendages with knuckle joints .......................................................................................................... 5
Peridial hyphae or appendages without knuckle joints ..................................................................................................... 7
5(4) Peridial appendages without or up to 3 septa .................................................................................................. Auxarthron
Peridial appendages multi-septate .................................................................................................................................... 6
ARTICLE
6(5) Peridium with short pectinate appendages ............................................................................................... Pectinotrichum
Peridium lacking pectinate appendages, swollen septa on appendages ............................................... Auxarthronopsis
7(4) Peridial appendages straight, rarely branched .................................................................................................................. 8
Peridial appendages, if present, branched or uncinate ..................................................................................................... 9
8(7) Peridial appendages with acute apices, ascospores smooth ............................................................................... Acitheca
Peridial appendages with blunt apices, ascospores ornamented ............................................................... Nannizziopsis
9(7) Ascospores smooth ......................................................................................................................................................... 10
Ascospores pitted, pitted-reticulate ........................................................................................................ Neogymnomyces
10(9) Peridial appendages if present, smooth, roughened (uncinate or boat-hook shaped apices) ...................... Gymnoascus
Peridial appendages ornamented with numerous short fine hairs, dichotomously branched, with blunt apices
....................................................................................................................................................................... Bifidocarpus
11(3) Peridial appendages coiled ............................................................................................................................................ 12
Peridial appendages uncinate ..................................................................................................................... Uncinocarpus
12(11) Ascospores hyaline ......................................................................................................................................................... 13
Ascospores yellow to orange ......................................................................................................................................... 14
13 (12) Ascospores smooth ....................................................................................................... Histoplasma (syn. Ajellomyces)
Ascospores irregularly ridged ........................................................................................................................... Kuehniella
14(12) Ascospores ellipsoidal or oblate ...................................................................................................................................... 15
Ascospores globose, finely echinulate .................................................................................................................. Apinisia
15(14) Peridial hyphae made up of ossiform cells .................................................................................................... Arthroderma
Peridial hyphae not made up of ossiform cells ................................................................................................................ 16
16(15) Peridial appendages thin walled, ascospores minutely roughened, pitted ........................................................ Shanorella
Peridial appendages thick walled .................................................................................................................................... 17
17(16) Ascospores smooth ......................................................................................................................................... Spiromastix
Ascospores regularly punctate-muricate ........................................................................................................... Polytolypa
ACKNOWLEDGEMENTS
REFERENCES
R.S. is indebted to Tiger Trust, India, for organising a two- day
Workshop on Tiger Conservation at Tiger Lodge, near Bhandhavgarh
National Park, that made the collection of soil samples possible, to
Madan L. Sharma (Regional Sophisticated Instrumentation Centre,
Panjab University, Chandigarh) and Sugat V. Shende (SEM Facility,
Department of Physics, University of Pune, Pune) for assistance with
the scanning electron microscopy. Ram C. Rajak and Akhilesh K.
Pandey are acknowledged for support during the initial stages of
this study. We thank the Department of Science and Technology
(DST), Government of India, New Delhi for financial support ( No.
SR/FT/L-36/2005 and No. SP/SO/PS-55/2005), and the Director,
MACS’Agharkar Research Institute, Pune, for extending facilities.
Currah RS (1985) Taxonomy of the Onygenales: Arthrodermataceae,
Gymnoascaceae, Myxotricaceae, and Onygenaceae. Mycotaxon
24: 1–216.
Currah RS (1988) An annonated key to the genera of the Onygenales.
Systema Ascomycetum 7: 339–350.
Currah RS (1994) Peridial morphology and evaluation in the
prototunicate ascomycetes. In: Ascomycete Systematics:
problems & perspectives in the nineties (Hawksworth DL, ed.):
281–293. [NATO ASI Series no. 269.] New York: Plenum Press.
Doveri F, Pecchia S, Vergara M, Sarrocco S, Vannacci G (2011)
A comparative study of Neogymnomyces virgineus, a new
keratinophilic species from dung, and its relationships with the
Onygenales. Fungal Diversity 52: 13–34.
volume 4 · no. 1
101

Sharma, Gräser & Singh
ARTICLE
Gräser Y, El Fari M, Vilgalys R, Kuijpers AFA, de Hoog GS,
Presber W, Tietz HJ (1999) Phylogeny and taxonomy of family
Arthrodermataceae (dermatophytes) using sequence analysis of
the ribosomal ITS region. Medical Mycology 37: 105–114.
Guarro J, Cano J, de Vroey Ch (1991) Nanniziopsis (Ascomycotina)
and related genera. Mycotaxon 42: 193–200.
Guarro J, Summerbell RC, Samson RA (eds) (2002) Onygenales:
the dermatophytes, dimorphics and keratin degraders in their
evolutionary context. Studies in Mycology 47: 1–220.
Ito T, Nakagiri A (1995) Amauroascus purpureus, a new species of
the Amauroascaceae (Ascomycotina). Mycotaxon 55: 347–352
Kimura M (1980) A simple method for estimating evolutionary rates
of base substitutions through comparative studies of nucleotide
sequences. Journal of Molecular Evolution 16: 111–120.
Orr GF, Kuehn HH, Plunkett OA (1963) A new genus of the
Gymnoascaceae with swollen peridial septa. Canadian Journal
of Botany 41: 1439–1456.
Rehner SA, Samuels GS (1994) Taxonomy and phylogeny of
Gliocladium analyzed for nuclear large subunit ribosomal DNA
sequences. Mycological Research 98: 625–634.
Sharma R, Rajak RC, Pandey AK (2002) Teaching technique for
mycology 19: A micro-dilution drop-trail method for isolating
onygenalean ascomycetes from hair baits. Mycologist 16: 153–
158.
Sharma R (2002) Taxonomic studies on keratinolytic fungal diversity
of Central India. PhD thesis, Rani Durgavati University, Jabalpur.
Sautou N, Nei M (1987) The neighbor-joining method: a new method
for reconstructing phylogenetic trees. Molecular Biology and
Evolution 4: 406–425.
Sigler L, Hambleton S, Flis AL, Pare JA (2002) Auxarthron
teleomorphs for Malbranchea filamentosa and Malbranchea
albolutea and relationships within Auxarthron. Studies in
Mycology 47: 111–112.
Sole M, Guarro J, Cano J (2002a) Molecular phylogeny of
Amauroascus, Auxarthron and morphologically similar
onygenalean fungi. Mycological Research 106: 388–396.
Sole M, Cano J, Stchigel AM, Guarro J (2002b) Two new species of
Auxarthron morphologically and genetically close to A. kuehnii.
Studies in Mycology 47: 103–110.
Sole M, Cano J, Pitarch LB, Stchigel AM, Guarro J (2002c) Molecular
phylogeny of Gymnoascus and related genera. Studies in
Mycology 47: 141–152.
Sugiyama M, Ohara A, Mikawa T (1999) Molecular phylogeny of
onygenalean fungi based on small subunit ribosomal DNA (SSU)
sequences. Mycoscience 40: 251–258.
Sugiyama M, Summerbell RC and Mikawa T (2002) Molecular
phylogeny of onygenalean fungi based on small subunit (SSU)
and large subunit (LSU) ribosomal DNA sequences. Studies in
Mycology 47: 5–23.
Summerbell RC (2000) Form and function in the evolution of
dermatophytes. In: Biology of Dermatophytes and other
Keratinophilic Fungi Kushwaha RKS, Guarro J, eds): 30–43.
Bilbao: Revista Iberoamericana de Micología.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S
(2011) MEGA5: Molecular evolutionary genetics analysis using
maximum likelihood, evolutionary distance, and maximum
parsimony methods. Molecular Biology and Evolution 28: 2731–
2739.
Vanbreuseghem R (1952) Technique biologique pour l’isolement des
dermatophytes du sol. Annales de la Societe Belge de Medicine
Tropicale 32: 173–178.
Varsavsky E, Orr GF (1971) A new genus of the Gymnoascaceae.
Mycopathologia et Mycologia Applicata 43: 229–234.
Vilgalys R, Hester M (1990) Rapid genetic identification and
mapping of enzymatically amplified ribosomal DNA from several
Cryptococcus species. Journal of Bacteriology 172: 4238–4246.
White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics. In:
PCR Protocols: a guide to methods and applications (Innis MA,
Gelfand DH, Sninsky JJ, White TJ, eds): 315–322. San Diego:
Academic Press.
102
ima fUNGUS

doi:10.5598/imafungus.2013.04.01.10
IMA Fungus · volume 4 · no 1: 103–109
The identity of Cintractia carpophila var. kenaica: reclassification of a North
American smut on Carex micropoda as a distinct species of Anthracoidea
Marcin Piątek
Department of Mycology, W. Szafer Institute of Botany, Polish Academy of Sciences, Lubicz 46, PL-31-512 Kraków, Poland; corresponding
author e-mail: m.piatek@botany.pl
ARTICLE
Abstract: Cintractia carpophila var. kenaica, a neglected taxon described from Alaska more than half a century
ago, is re-described and illustrated. Its nomenclature and taxonomic status are discussed. This smut species is
characterised by small spores with a very finely verruculose surface rarely enclosed by a thin, hyaline, mucilaginous
sheath, a wall with 2–5 distinct internal swellings, and parasitism on Carex micropoda (Carex sect. Dornera). It
is reallocated to the genus Anthracoidea as a distinct species, Anthracoidea kenaica comb. nov., and assigned
to Anthracoidea section Leiosporae which includes species having smooth or very finely verruculose spores.
Morphological and biological characteristics of the five most similar Anthracoidea species are contrasted and
discussed.
Key words:
Anthracoidea
Carex
Cintractia
Historical collections
North America
Smut fungi
Ustilaginales
Article info: Submitted: 16 May 2013; Accepted: 25 May 2013; Published: 10 June 2013.
INTRODUCTION
Anthracoidea is the most species-rich genus of smut fungi
on Cyperaceae. Currently, 106 species are accepted in this
genus (Denchev & Denchev 2011a, 2011b, 2012, Vánky
& Abbasi 2011, Vánky 2012, Savchenko et al. 2013), but
this is certainly not a final number. The magnitude of host
plants reported in different publications for some putative
species complexes suggests that more species are likely to
exist, some of which may be well-delimited morphological
species, while others are probably cryptic species that could
be uncovered by molecular methods. Some species of
Anthracoidea were recently included in molecular systematic
studies (Hendrichs et al. 2005, Begerow et al. 2007, Bauer
et al. 2007, Lutz et al. 2012, Savchenko et al. 2013, Vánky
et al. 2013), but sequence data are not available for the vast
majority. Distinct species could still be hidden under different
generic names, especially under historical names that have
not been reassessed in recent years (Piątek 2012). Such
historical names should be critically re-examined in addition
to any comprehensive molecular studies directed to the
description of novel Anthracoidea species.
Cintractia carpophila var. kenaica is such a neglected
taxon name and a likely candidate to be a distinct member
of Anthracoidea. This smut was described from a specimen
of Carex pyrenaica subsp. micropoda collected in the Kenai
Peninsula of Alaska. That sedge is now accepted as a distinct
species, Carex micropoda, belonging to Carex sect. Dornera
(syn. sect. Callistachys) (Murray 2002a). Savile (1952)
provided the following description of Cintractia carpophila
var. kenaica: “Teliosporae 16.0–23.5 × 11.5–19.5 µm,
compressae, ellipsoideae, nunquam angulater. Episporium
0.6–1.3 µm, castaneum, leve; saepius interne gibberibus 2–5
munitum.” Zambettakis (1978) included it in Anthracoidea, as
“Anthracoidea heterospora Kukkonen var. kenaica (Saville)
nov. comb.”, but without any indication of the basionym or a
reference to the place of its valid publication, rendering the
combination invalid (Art. 41.5). Likewise, Kukkonen (1963)
and Piepenbring (2000) considered this fungus to be a
member of Anthracoidea, but again without further treatment
and any formal nomenclatural and taxonomic decisions.
Vánky (2012) included this smut in two places in his
monograph: first as a synonym of Anthracoidea heterospora
and later under excluded or invalidly published taxa, in both
cases without detailed observations.
The aim of the present work is to clarify the nomenclatural
and taxonomic status of Cintractia carpophila var. kenaica,
and to provide a detailed characterization of this smut fungus
as it lacks a detailed description and any iconography.
MATERIALS AND METHODS
Sori and spore characteristics were studied using dried
herbarium material deposited in DAOM, S, and WRSL.
Specimens were examined either by light microscopy (LM)
and scanning electron microscopy (SEM) or only by light
microscopy (LM).
For light microscopy (LM), hand-cut sections of sori
or small pieces of sori were mounted in lactic acid, heated
© 2013 International Mycological Association
You are free to share - to copy, distribute and transmit the work, under the following conditions:
Attribution:
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).
Non-commercial: You may not use this work for commercial purposes.
No derivative works: You may not alter, transform, or build upon this work.
For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get
permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.
volume 4 · no. 1
103

Piątek
ARTICLE
Table 1. Spore size range, and mean spore sizes with standard deviation of Anthracoidea kenaica specimens examined in this study.
Spore size range (µm) Average spore size with
standard deviation (µm)
Specimen
(14.5–)15.0–20.5(–21.5) ×
12.0–17.5(–18.5)
17.0–20.5(–22.0) × 12.0–
18.0(–20.5)
(14.0–)15.0–20.5(–21.0) ×
(11.5–)12.0–17.5(–18.5)
18.1 ± 1.6 × 15.2 ± 1.7 USA, Alaska, Kenai Peninsula, Head of Palmer Creek Valley, 26 July 1951,
J.A. Calder 6229 (DAOM 28108 – holotype)
19.2 ± 1.3 × 16.1 ± 1.8 Same locality, date and collector (S F-36682 – isotype)
18.2 ± 1.7 × 15.2 ± 1.8 USA, Alaska, St. Paul, Pribilof Island, 22 Aug. 1914, J.M. Macoun (DAOM
66925)
(14.5–)17.0–20.5(–22.0) ×
13.5–18.5(–19.0)
18.5 ± 1.2 × 15.9 ± 1.4 Canada, British Columbia, Bella Coola, Mt. Fougner, 23 Aug. 1956, J.A.
Calder, J.A. Parmelee & R.L. Taylor (DAOM 70101)
to boiling point and cooled, then examined under a Nikon
Eclipse 80i light microscope. LM micrographs were taken
with a Nikon DS-Fi1 camera. Spores were measured using
NIS-Elements BR v. 3.0 imaging software. Spore size range,
mean spore size, and standard deviation of 50 measured
spores of each investigated specimen were calculated (Table
1). The species description includes combined values from
all measured specimens. The spores were measured in
plane view and measurements were adjusted to the nearest
0.5 µm. Spore size ranges were assigned to one of the three
groups distinguished by Savile (1952): (1) small-sized spores,
13–21(–23) × 9–17(–20) µm; (2) medium-sized spores, 15–
25(–27) × 10–21 µm; and (3) large-sized spores, 18–33 ×
13–28 µm.
For scanning electron microscopy (SEM), spores taken
directly from dried specimens were dusted onto carbon tabs
and fixed to an aluminium stub with double-sided transparent
tape. The stubs were sputter-coated with carbon using a
Cressington sputter-coater and viewed under a Hitachi
S-4700 scanning electron microscope, with a working
distance of ca. 11 mm. SEM micrographs were taken in the
Laboratory of Field Emission Scanning Electron Microscopy
and Microanalysis at the Institute of Geological Sciences of
Jagiellonian University (Kraków).
RESULTS
Detailed morphological characteristics of the holotype,
isotype, and two non-type specimens of Cintractia carpophila
var. kenaica are embraced in the species description and
illustrated (Figs 1–2). The internal soral structure in the
holotype was typical of species of Anthracoidea in that
the spores were produced directly on the outer surface of
the achene, and not within U-shaped cavities embedded
in sterile stroma, a characteristic of Cintractia (Kukkonen
1963, Kukkonen & Vaissalo 1964, Piepenbring 2000).
This indicated this smut fungus was better placed in
Anthracoidea, as was suggested in other studies (Kukkonen
1963, Zambettakis 1978, Piepenbring 2000). The spores
were uniform in shape and size ranges between collections
(Table 1). My examination of specimens of Cintractia
carpophila var. kenaica matched well the short description
given by Savile (1952), although the spore surface was
not smooth as stated in the protologue, but smooth or
very finely punctate in LM, and very finely verruculose in
SEM. The very fine ornamentation of spores was probably
outside the limits of resolution of Savile’s light microscope.
In general, the present examination confirms the decision
of Savile (1952) to consider this smut as distinct. However,
a specific status seems to be appropriate for this taxon.
This is in line with the conclusion of Kukkonen (1963), who,
however, did not formally make the transfer. Accordingly, a
new combination is necessary.
TAXONOMY
Anthracoidea kenaica (Savile) M. Piątek, comb. nov.
MycoBank: MB804512
(Figs 1–2)
Basionym: Cintractia carpophila var. kenaica Savile, Can. J.
Bot. 30: 419 (1952).
Synonym: Anthracoidea heterospora var. kenaica (Savile)
Zambett., Bull. trimest. Soc. mycol. Fr. 94: 177 (1978),
nom. inval. (Art. 41.5).
Type: USA: Alaska: Kenai Peninsula, Head of Palmer Creek
Valley, 60°49’N, 149°33’W, on Carex micropoda (syn. Carex
pyrenaica subsp. micropoda), 26 July 1951, J.A. Calder 6229
(DAOM 28108 – holotype, S F-36682 – isotype).
Description: Sori in all or single ovaries of the inflorescence,
black, globose or ovoid, about 1–1.5 mm diam, at first covered
by a silvery membrane and perigynium that later ruptures
revealing agglutinated spores, powdery on the surface, the sori
are partly hidden by the perigynium and scales. Sori develop
around reduced achenes that are consecutively surrounded
by a thin dark layer of the remnants of achene epidermis, a
hyaline layer of sporogeneous hyphae with young spores, a
layer of gradually maturing dark spores, and a thin membrane
of host origin. Spores usually more or less flattened, chestnut
brown, reddish brown to dark brown, quite regular in shape
and size, globose, subglobose or broadly ellipsoidal, small,
(14.0–)15.0–20.5(–22.0) × (11.5–)12.0–18.5(–20.5) µm [av.
± SD, 18.5 ± 1.5 × 15.6 ± 1.7 µm, n = 200/4], rarely enclosed
by a thin, hyaline, mucilaginous sheath; wall even, 1.0–1.5
µm thick, somewhat darker than the rest of the spore, without
protuberances and light-refractive spots, but with 2–5 distinct
internal swellings; surface smooth or very finely punctate in
LM, spore profile smooth, surface very finely verruculose in
SEM.
104 ima fUNGUS

Anthracoidea kenaica comb. nov. on Carex micropoda
ARTICLE
Fig. 1. Anthracoidea kenaica on Carex micropoda. A. Sori in the ovaries (S F-36682). B. Transverse section through the sorus showing reduced
achene surrounded by spores (DAOM 28108). C–D. Enlarged area close to the achene surface (DAOM 28108). E. The spore formation (DAOM
28108). F. Cells of the soral membrane, indicated by arrows (DAOM 28108). Abbreviations: n – achene, e – dark layer of the remnants of the
achene epidermis, s – layer of young hyaline spores, m – layer of gradually maturing dark spores. Bars: A = 1 mm, B = 500 µm, C–D = 20 µm,
E–F = 10 µm.
Additional specimens examined: Canada: British Columbia: Bella
Coola, Mt. Fougner, on Carex micropoda, 23 Aug. 1956, J.A. Calder,
J.A. Parmelee & R.L. Taylor (DAOM 70101). – USA: Alaska: St. Paul,
Pribilof Island, on Carex micropoda, 22 Aug. 1914, J.M. Macoun
(DAOM 66925).
Host and distribution: On Carex micropoda (Carex sect.
Dornera); Canada (British Columbia) and USA (Alaska).
Notes: The nomenclature of Cintractia carpophila var. kenaica
needs some clarification. The name Uredo carpophila
volume 4 · no. 1
105

Piątek
ARTICLE
Fig. 2. Anthracoidea kenaica on Carex micropoda (S F-36682). A–C. Spores seen by LM, median and superficial views, note internal swellings
indicated by arrows. D–E. Spores seen by SEM. F. Spore wall seen by SEM. Bars: A–E = 10 µm, F = 3 µm.
Schum. (Schumacher 1903) was introduced as superfluous
replacement of Uredo caricis Pers. (Nannfeldt & Lindeberg
1965) and is therefore illegitimate and to be rejected
(Art. 52.1). Consequently, the name Cintractia carpophila
(Schum.) Liro (Liro 1938), based on Uredo carpophila, is also
illegitimate. Also, Liro’s treatment cannot constitute a valid
description of a new species to be attributed to him alone due
to the absence of a Latin diagnosis (Nannfeldt & Lindeberg
1965), required in the period 1 January 1935 to 31 December
2011 (Art. 39.1). Vánky (2012) considered Uredo carpophila
as an illegitimate name, which is correct, but also as a nomen
nudum, which is not correct, since Schumacher (1903)
provided a short description of this species: “U. carpophyla,
pulvere nigro capsulas subnude ambiente. Ured. Caricis Pers.
Synops. pag. 225. In capsulis Caricis caespitosae. Julio”.
Furthermore, Vánky (2012) considered the name Cintractia
106 ima fUNGUS

Anthracoidea kenaica comb. nov. on Carex micropoda
carpophila var. kenaica also as illegitimate, but the varietal
name Cintractia carpophila var. kenaica is legitimate since an
infraspecific name may be legitimate even if its final epithet
was originally placed under an illegitimate species name.
Similarly, Cintractia carpophila var. verrucosa Savile (Savile
1952), was accepted as a legitimate varietal name that was
elevated to the species rank as Anthracoidea verrucosa
(Savile) Nannf. (Nannfeldt 1977, Vánky 2012). Therefore,
the name Cintractia carpophila var. kenaica is used here to
elevate this taxon to species rank.
The type host of A. kenaica is Carex micropoda, but in
addition Savile (1952) assigned a single smut collection
on Carex deweyana (in Carex sect. Deweyanae; Naczi
2002) to his concept of Cintractia carpophila var. kenaica.
Zambettakis (1978) included two SEM pictures of spores
from a specimen on C. deweyana and they are distinctly
verrucose, unlike spores of specimens on C. micropoda.
Indeed, the Anthracoidea on Carex deweyana represents
a distinct species – Anthracoidea deweyanae (Denchev
& Denchev 2012). Anthracoidea kenaica was previously
reported from the type locality on the Kenai Peninsula and
two other collections from the same region (Savile 1952).
Here the smut is newly reported from Pribilof Island (AK)
and from Mt Fougner in British Columbia; this last collection
represents the first record of this species in Canada.
DISCUSSION
Cintractia carpophila var. kenaica cannot be treated as a
synonym or variety of Anthracoidea heterospora since this
species is different in having spores with better developed
ornamentation, thicker walls (1–2.5 µm), and occurs on host
plants belonging to Carex sect. Phacocystis (Vánky 2012).
It can be assigned to Anthracoidea sect. Angulosporae
(Kukkonen 1963). In contrast, the morphology of Anthracoidea
kenaica is characteristic of members of Anthracoidea sect.
Leiosporae, which includes species with smooth or very
finely verruculose spores (Kukkonen 1963). Within this
section, Anthracoidea kenaica may be comparable only
to five Anthracoidea species having spores similar in size
and with a smooth or very finely verruculose (not papillate)
surface: A. elynae, A. externa, A. macranthae, A. nardinae,
and A. scirpi. The main morphological differences between
these species include differences in wall thickness, the
presence and the number of internal swellings, and the
presence of a hyaline mucilaginous sheath enclosing the
spores. Furthermore, all of them are restricted to host species
belonging to different sections of Carex, or to different genera
(Kobresia, Trichophorum), which could be used as supportive
taxonomic characters. Characters used to discriminate these
five species of Anthracoidea from A. kenaica (Table 2) are
contrasted and discussed below.
Anthracoidea elynae is distinguished from A. kenaica by
the mostly smooth spores with a thicker wall, fewer internal
swellings, a more or less evident mucilaginous sheath, and
occurrence on Kobresia. The internal swellings in A. elynae
are weakly visible in LM (Savile 1952, Kukkonen 1961,
Vánky 1994, 2012), and recent TEM studies of spores from a
Romanian collection did not report internal swellings (Parvu
et al. 2009). In fact, the spore presented in figure 3 of the
latter study has a shallow thickening on the lower flattened
side, which may be interpreted as a weak internal swelling.
By contrast, internal swellings of Anthracoidea kenaica are
prominent and clearly visible in LM. Anthracoidea externa is
morphologically distinct in having absolutely smooth spores
surrounded by a thick mucilaginous sheath, a thicker spore
wall without internal swellings, and occurrence on species of
Carex sect. Filifoliae (Mastrogiuseppe 2002). Anthracoidea
macranthae differs from A. kenaica as it has completely
smooth spores with prominent and common hyaline caps
(a mucilaginous sheath) on the flattened sides, an absence
of internal swellings, a somewhat thinner spore wall, and
in occurring on Kobresia (Guo & Wang 2005). Although
not discussed in the protologue, the occurrence of a
mucilaginous sheath in the form of hyaline caps is the most
valuable diagnostic character of Anthracoidea macranthae.
The combination of characters seen places this species close
to A. externa.
Anthracoidea nardinae appears to be most similar to A.
kenaica. It is distinguished by nearly smooth spores, a thicker
spore wall, fewer internal swellings, and occurrence on Carex
sect. Nardinae (Murray 2002b). The type host of A. nardinae
is C. nardina, but Kukkonen (1963) assigned this smut to two
collections on C. elynoides, which belongs to a different Carex
section (sect. Filifoliae). The examination of one collection of
Anthracoidea on C. elynoides [“Plants of Southern Colorado,
Carex elynoides Holm n. sp., near Pagosa Peak, Aug. 1899,
leg. C.F. Baker”, WRSL s.n., extracted from the isotype of C.
elynoides in WRSL (phanerogamic herbarium)], had globose,
subglobose to broadly ellipsoidal spores, (14.5–)15.0–19.5 ×
(11.0–) 12.0–17.5 µm, av. ± SD, 17.2 ± 1.2 × 14.8 ± 1.7 µm, n =
50, wall even, 1.0–1.5 µm, without internal swellings, surface
smooth without mucilaginous sheath], though different from
those studied by Kukkonen, revealed a complete absence
of internal swellings typical of A. nardinae. It could be yet
another distinct species or a form of A. externa without a
hyaline sheath.
Anthracoidea scirpi is distinguished from A. kenaica by
the minutely punctate spores, which are usually surrounded
by hyaline, mucilaginous sheaths on the flattened sides, a
thicker spore wall, the absence of internal swellings, and
occcurrence on Trichophorum species (Vánky 1994, 2012).
Differences between smut specimens in the ovaries
of Carex micropoda and all aforementioned Anthracoidea
species from sect. Leiosporae support A. kenaica as a distinct
species specialised to a host in Carex sect. Dornera. Except
for the host of A. scirpi, host plants of these Anthracoidea
species are placed in one of the four/five major clades of
the tribe Cariceae, the so called “Core Unispicate Clade”,
which includes Carex subgen. Psyllophora p.p., Kobresia,
and Uncinia (Starr & Ford 2009). Whether this may indicate a
close evolutionary relation between members of Anthracoidea
sect. Leiosporae is uncertain, and the problem remains open
for future studies using molecular methods. In a recent
molecular phylogenetic study, by Hendrichs et al. (2005),
the only accessioned smooth-spored species, A. elynae,
was recovered as sister to the verrucose-spored species A.
curvulae on Carex curvula, which is also a member of the
“Core Unispicate Clade”.
ARTICLE
volume 4 · no. 1
107

Piątek
ARTICLE
Table 2. Host plants and morphological characters of Anthracoidea kenaica and the five most similar species of the section Leiosporae.
Species Host plant(s) Spores (µm) Wall (µm) Internal swellings Spore ornamentation Mucilaginous sheath References
1
Anthracoidea elynae Kobresia humilis, K. laxa, K.
macrolepis, K. myosuroides,
K. schoenoides, K. sibirica, K.
smirnovii
Anthracoidea externa Carex filifolia (Carex sect.
Filifoliae)
Anthracoidea kenaica Carex micropoda (Carex sect.
Dornera)
Anthracoidea
macranthae
(14–)16–22(–25) × (9–)
10–20(–22)
1–2.5(–3) frequent 1–2(–3)
weak internal
swellings
(14–)16–22(–26) 2–3 weak but frequent almost smooth, only
dotted
17–22(–25) × (14–)15–18.5 1–2.5(–3) often with 1–3 weak
internal swellings
smooth, seldom dotted usually covered by a gelatinous
sheath
smooth to finely punctate
on the flat sides
Kukkonen (1963)
no data Nannfeldt (1979)
more or less evident hyaline sheath Vánky (1994,
2012)
15–22(–23) × 11–20 0.7–2.5 absent absolutely smooth always covered by a gelatinous
sheath
Kukkonen (1963)
17–21 × 15–20 0.8–1.5 absent apparently smooth present in most of the spores Vánky (2012)
this study
(14–)15–20(–22) ×
(11.5–)12–18.5(–20.5)
1–1.5 2–5 distinct internal
swellings
smooth to very finely
punctate in LM,
verruculose in SEM
rarely enclosed by a thin
mucilaginous sheath
Kobresia macrantha 15–18(–19.5) × 13–17.5 0.5–1 absent smooth hyaline caps common on the
flattened side
15–18.5(–20.5) × 13.5–16 1 absent smooth present on the flattened sides and
often around the entire spore
Guo & Wang
(2005)
Vánky (2012)
Anthracoidea nardinae Carex nardina (Carex sect.
Nardinae), ?Carex elynoides
(Carex sect. Filifoliae)
Anthracoidea scirpi Trichophorum cespitosum, T.
pumilum
(15–)16–22(–23) × (10–)
11–20(–21)
1–3 always 1–3 more or
less clear internal
swellings
smooth, sometimes
obscurely dotted
(15–)16–23 × 13–20(–21) ca. 2 1–3 clearly seen almost smooth, only
dotted by hardly
discernible dots
(15–)16–22(–23) × 13–20
(–21)
(16–)17–24(–25) × 12–20
(–23)
1.5–2 1–3 more or less
clear internal
swellings
almost smooth or
sometimes obscurely
punctate
1–2.5(–3) absent smooth or rarely very
slightly verrucose
17–23 × 14–21 1.5–2 absent smooth or very minutely
punctate
absent, or at most, rare Kukkonen (1963)
no data Nannfeldt (1979)
no data Vánky (1994,
2012)
often covered by a gelatinous sheath Kukkonen (1963)
often covered by gelatinous sheaths
on the flattened sides
Vánky (1994,
2012)
1
Host plants taken from Vánky (2012), but at least some of them may harbour different Anthracoidea species.
108 ima fUNGUS

Anthracoidea kenaica comb. nov. on Carex micropoda
ACKNOWLEDGEMENTS
I thank Andrew M. Minnis (Center for Forest Mycology Research,
Madison, USA) for nomenclatural advice, Anna Łatkiewicz (Kraków,
Poland) for her assistance with the SEM micrographs, and the
curators of DAOM, S, and WRSL for the loan of specimens. This
study was supported in part by the Polish Ministry of Science and
Higher Education (grant no. 2 P04G 019 28) and through the statutory
fund of the W. Szafer Institute of Botany of the Polish Academy of
Sciences, Kraków, Poland.
REFERENCES
Bauer R, Lutz M, Piątek M, Vánky K, Oberwinkler F (2007)
Flamingomyces and Parvulago, new genera of marine smut fungi
(Ustilaginomycotina). Mycological Research 111: 1199–1206.
Begerow D, Stoll M, Bauer R (2007) [“2006”] A phylogenetic
hypothesis of Ustilaginomycotina based on multiple gene
analyses and morphological data. Mycologia 98: 906–916.
Denchev CM, Denchev TT (2011a) Anthracoidea eburneae, sp. nov.
(Anthracoideaceae). Mycologia Balcanica 8: 83–85.
Denchev CM, Denchev TT (2011b) Anthracoidea melanostachyae
sp. nov. (Anthracoideaceae). Mycologia Balcanica 8: 153–155.
Denchev CM, Denchev TT (2012) New records of smut fungi. 7.
Mycotaxon 121: 425–434.
Guo L, Wang SR (2005) A new species and a new record of
Anthracoidea (Ustilaginales) from China. Mycotaxon 93: 159–
162.
Hendrichs M, Begerow D, Bauer R, Oberwinkler F (2005) The
genus Anthracoidea (Basidiomycota, Ustilaginales): a molecular
phylogenetic approach using LSU rDNA sequences. Mycological
Research 109: 31–40.
Kukkonen I (1961) The smuts of the genus Cintractia parasiting
Kobresia species. Canadian Journal of Botany 39: 155–164.
Kukkonen I (1963) Taxonomic studies on the genus Anthracoidea
(Ustilaginales). Annales Botanici Societatis Zoologicae Botanicae
Fennicae ‘Vanamo’ 34(3): 1–122.
Kukkonen I, Vaissalo T (1964) An electron microscope study on
spore formation in a smut. Annales Botanici Fennici 1: 236–249.
Liro JI (1938) Die Ustilagineen Finnlands. II. Annales Academiae
Scientiarum Fennicae, Serie A, 42(1): 1–720.
Lutz M, Vánky K, Piątek M (2012) Shivasia gen. nov. for the
Australasian smut Ustilago solida that historically shifted through
five different genera. IMA Fungus 3: 143–154.
Mastrogiuseppe J (2002) Carex Linnaeus sect. Filifoliae (Tuckerman)
Mackenzie in N.L. Britton et al. In: Flora of North America North
of Mexico 23: 566–568. New York: Oxford University Press.
Murray DF (2002a) Carex Linnaeus sect. Dornera Heuffel. In: Flora
of North America North of Mexico 23: 528–530. New York: Oxford
University Press.
Murray DF (2002b) Carex Linnaeus sect. Nardinae (Tuckerman)
Mackenzie in N.L. Britton et al. In: Flora of North America North
of Mexico 23: 568–569. New York: Oxford University Press.
Naczi RFC (2002) Carex sect. Deweyanae (Tuckerman ex Mackenzie)
Mackenzie in N.L. Britton et al. In: Flora of North America North
of Mexico 23: 321–325. New York: Oxford University Press.
Nannfeldt JA (1977) The species of Anthracoidea (Ustilaginales) on
Carex subgen. Vignea with special regard to the Nordic species.
Botaniska Notiser 130: 351–375.
Nannfeldt JA (1979) Anthracoidea (Ustilaginales) on Nordic
Cyperaceae-Caricoideae, a concluding synopsis. Symbolae
Botanicae Upsalienses 22(3): 1–41.
Nannfeldt JA, Lindeberg B (1965) Taxonomic studies on the
ovariicolous species of Cintractia on Swedish Caricoideae.
II. The species on Carex sect. Acutae Fr. sensu Kük. Svensk
Botanist Tidskrift 59: 189–210.
Parvu M, Parvu AE, Craciun C, Barbu-Tudoran L, Puscas M
(2009) Ultrastructure and development of Anthracoidea elynae
ustilospores. Notulae Botanicae Horti Agrobotanici Cluj-Napoca
37: 41–44.
Piątek M (2012) The identity of Cintractia disciformis: reclassification
and synonymy of a southern Asian smut parasitic on Carex sect.
Aulocystis. IMA Fungus 3: 39–43.
Piepenbring M (2000) The species of Cintractia s.l. (Ustilaginales,
Basidiomycota). Nova Hedwigia 70: 289–372.
Savchenko KG, Lutz M, Piątek M, Heluta VP, Nevo E (2013)
Anthracoidea caricis-meadii is a new North American smut
fungus on Carex sect. Paniceae. Mycologia 105: 181–193.
Savile DBO (1952) A study of the species of Cintractia on Carex,
Kobresia, and Scirpus in North America. Canadian Journal of
Botany 30: 410–435.
Schumacher CF (1803) Enumeratio plantarum in partibus Saellandiae
septentrionalis et orientalis. Part 2. Copenhagen: Brummer.
Starr JR, Ford BA (2009) Phylogeny and evolution in Cariceae
(Cyperaceae): current knowledge and future directions. Botanical
Review 75: 110–137.
Vánky K (1994) European Smut Fungi. Stuttgart: G. Fischer Verlag.
Vánky K (2012) Smut Fungi of the World. St Paul, MN: American
Phytopathological Society Press.
Vánky K, Abbasi M (2011) Anthracoidea songorica sp. nov. on Carex
songorica from Iran. Rostaniha 12: 181–185.
Vánky K, Shivas RG, Barrett MD, Lutz M (2013) Eriocortex eriocauli,
gen. et sp. nov. (Ustilaginomycetes) from Australia. Mycobiota
1: 9–16.
Zambettakis C (1978) Les Anthracoidea des Carex et les Ustilaginées
aberrantes. Bulletin de la Société Mycologique de France 94:
109–260.
ARTICLE
volume 4 · no. 1
109

ARTICLE
ima fUNGUS

doi:10.5598/imafungus.2013.04.01.11
IMA Fungus · volume 4 · no 1: 111–122
Luteocirrhus shearii gen. sp. nov. (Diaporthales, Cryphonectriaceae)
pathogenic to Proteaceae in the South Western Australian Floristic Region
Colin Crane 1 , and Treena I. Burgess 2
1
Science Division, Department of Environment and Conservation, Locked Bag 104, Bentley Delivery Centre, WA 6983, Australia; corresponding
author e-mail: colin.crane@dec.wa.gov.au
2
Centre of Excellence for Climate Change, Woodland and Forest Health, School of Veterinary and Life, Murdoch University, Perth, 6150, Australia
ARTICLE
Abstract: Morphological and DNA sequence characteristics of a pathogenic fungus isolated from branch
cankers in Proteaceae of the South West Australian Floristic Region elucidated a new genus and species within
Cryphonectriaceae (Diaporthales). The pathogen has been isolated from canker lesions in several Banksia
species and Lambertia echinata subsp. citrina, and is associated with a serious decline of the rare B. verticillata.
Lack of orange pigment in all observed structures except cirrhi, combined with pulvinate to globose black semiimmersed
conidiomata with paraphyses, distinguishes the canker fungus from other genera of Cryphonectriaceae.
This was confirmed by DNA sequence analysis of the ITS regions, ß-tubulin, and LSU genes. The fungus (sexual
morph unknown) is described as Luteocirrhus shearii gen. sp. nov. Lesions in seedlings of Banksia spp. following
wound inoculation and subsequent recovery confirm Koch’s postulates for pathogenicity. This pathogen of native
Proteaceae is currently an emerging threat, particularly toward B. baxteri and B. verticillata.
Key words:
Australia
Banksia
Cryphonectriaceae
Emerging pathogen
Fungal pathogen
Canker
Natural ecosystems
Phylogenetics
Proteaceae
Zythiostroma
Article info: Submitted: 19 December 2012; Accepted: 25 May 2013; Published: 10 June 2013.
INTRODUCTION
In a previous study of twig and branch cankers in Banksia
coccinea, Shearer et al. (1995) isolated several pathogens
including a purported Zythiostroma sp. (IMI 336153). The
Zythiostroma sp. was shown to be a virulent pathogen of both
B. baxteri and B. coccinea.
Recent studies on the causal agents of severe canker
disease affecting Banksia communities and Lambertia
spp. across the South West Australian Floristic Region
(SWAFR) consistently returned Neofusicoccum australe,
N. macroclavatum, and Cryptodiaporthe melanocraspeda,
along with an undescribed species (Crane et al. 2012) which
shared morphology and ITS sequences with the purported
Zythiostroma sp. previously reported by Shearer et al. (1995).
Based on GenBank searches this undescribed species
grouped within Cryphonectriaceae, and thus its taxonomic
status, needs to be revised as Zythiostroma resides in
Nectriaceae and not Cryphonectriaceae.
Species of Cryphonectriaceae living within the bark and
wood of trees have a worldwide distribution, include some
of the world’s most important pathogens of trees, such as
chestnut blight (Cryphonectria parasitica) and serious canker
diseases of plantation eucalypts (Gryzenhout et al. 2009).
Approximately one species in each of the recognised genera
within the family are virulent pathogens, while the remainder
are either facultative parasites or saprophytes (Gryzenhout
et al. 2009).
Symptoms of the Zythiostroma sp. cankers on Proteaceae
in the SWAFR. include sunken lesions initially visible on one
side of a twig or branch (Fig.1a), cracking and splitting of
bark before girdling, and death of the branch. The fungus
may kill only one branch before being contained by the host.
However, infection can cause multiple branch deaths (Fig.1b),
with complete crown dieback of individuals, and in the case
of B. baxteri and B. verticillata infrequent collapse of entire
communities. This occurs when pathogen growth within an
individual continues unchecked until discrete twig cankers
coalesce to girdle the main collar or basal stem, ensuing in
death of the host.
The South West Australian Floristic Region is one of
the worlds Biodiversity hotspots (Myers 2001) comprising
at least 5710 described plant species, 79 % of which are
endemic (Beard et al. 2000). The vegetation is predominantly
shrubland or woodland, with Banksia species (Proteaceae)
often being dominant larger perennials, together with other
trees of low diversity and an understory of predominantly
woody shrubs (Beard 1989, Shearer & Dillon 1996, Pate &
Bell 1999). Several Banksia spp. are widespread throughout
the region though some, such as B. verticillata, occupy
narrow ecological niches resulting in restricted geographic
distributions. Lambertia species (Proteaceae) occur as
© 2013 International Mycological Association
You are free to share - to copy, distribute and transmit the work, under the following conditions:
Attribution:
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).
Non-commercial: You may not use this work for commercial purposes.
No derivative works: You may not alter, transform, or build upon this work.
For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get
permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.
volume 4 · no. 1
111

Crane & Burgess
ARTICLE
Fig. 1. A. Young canker of Luteocirrhus shearii in petiole scar of Banksia baxteri. B. Multiple branch death impact in Banksia grandis.
112 ima fUNGUS

Luteocirrhus shearii gen. sp. nov.
shrubs or small trees, often within Banksia woodland and can
also be major ecosystem components within the communities
in which they occur. Proteaceous flowers provide nectar for
birds and mammals (Hopper 1980, Wooller et al. 2000). The
climate of the SWAFR is Mediterranean with long hot dry
summers and the soils are infertile with little structure and
low phosphorus. The impact of the introduced plant pathogen
Phytophthora cinnamomi is a major threat to the Banksia
woodland communities within the region (Shearer et al. 2007)
and further threats could thus be more devastating. Since the
mid-1970s, the rainfall in the SWAFR has decreased by 14 %
(Bates et al. 2008). Forecast climate change scenarios may
place 5–20 % of the endemic plant species of south-western
Australia into range declines severe enough to threaten
their persistence (Fitzpatrick et al. 2008). Concomitant
shifts in corresponding pathogen impacts and distributions
could reasonably be expected. Opportunistic sampling and
observations suggest that an increase in canker incidence
and severity across the region is possibly related to changing
climate (Crane et al. 2012).
Comparisons of DNA sequence data from the rDNA internal
transcribed spacer regions (ITS), ß-tubulin and LSU gene
regions placed the new species in the Cryphonectriaceae,
and different to currently described genera (Gryzenhout et al.
2009, Vermeulen et al. 2011, Chen et al. 2012). In this study
sequence data was used in combination with morphological
characteristics of the asexual morph to describe this new
pathogenic genus and species.
MATERIALS AND METHODS
Collection and isolation
Twig samples from proteaceous plants exhibiting canker
symptoms were collected across the SWAFR from Nambung
National Park near Cervantes in the north to Cape Arid
National Park near Esperance in the southeast (Fig. 2, Table
1). Opportunistic sampling of cankered plants began in 1990
(Shearer et al. 1995) and culminated in 2011with an intensive
survey of cankers in B. baxteri and B. coccinea across their
respective geographic ranges (Crane et al. 2012).
Cankered branches were removed and transported to the
laboratory, and samples containing mature conidiomata were
examined under the microscope. Cankers with no visible
conidiomata had the bark scraped away and diseased tissue
pieces of approximately 3 mm 2 spanning the lesion-healthy
margin were removed and surface sterilised in 70 % ethanol
for 1 min, followed by washing in two changes of sterile
distilled water then blotted dry and plated onto half-strength
potato-dextrose agar (PDA) medium (19.5 g of Difco Tm PDA
and 7.5 g Bacto agar in 1 L of distilled water). The plated
tissue was then incubated at 20 °C in the dark for 24 h then
under near-UV light at 20 °C for 2 wk. This treatment usually
resulted in formation of mature conidiomata for microscopic
examination. Isolates obtained were then subcultured
from colony margins and stored using 5 mm 2 agar pieces
containing conidiomata, placed under sterile distilled water
(Boesewinkel 1976) in glass McCartney bottles and stored at
room temperature.
Morphology
Conidiomata in bark from naturally infected cankers were
used for morphological comparison and characterisation.
Stems were initially examined at 250× under a Wild
Heerbrugg stereo microscope and gross morphology of
characteristic fruiting structures measured and described.
Conidiomata were then hand sectioned and mounted in
3 % potassium hydroxide (KOH) and 85 % lactic acid for
microscopic observation under a compound Olympus BH - 2
microscope. Detailed gross morphology was recorded for 15
representative cankers and 80 conidial measurements each
from 30 conidiomata under oil immersion at 1000 ×.
Optimal growth conditions for two isolates (CBS 130776
and WAC13426) of the Zythiostroma sp. were determined
in the dark on half-strength PDA medium for temperatures
between 1–40 ºC at 5 ºC intervals. Isolates were in a
randomised design with four replicates. Growth was measured
at 4, 6, and 11 d along two perpendicular lines intersecting at
the centre of the agar inoculum plug. Plates showing no growth
at 1 and 40 °C were returned to 20 °C to determine isolate
viability.
DNA sequence comparisons
Representative isolates (Table 1) were grown on half-strength
PDA medium (Becton, Dickinson, Sparks, MD; 19.5 g PDA,
7.5 g of agar and 1 L of distilled water) at 20 °C for 2 wk
and the mycelium was harvested by scraping from the agar
surface with a sterile blade and placed in a 1.5 mL sterile
Eppendorf ® tube. Harvested mycelium was frozen in liquid
nitrogen, ground to a fine powder and genomic DNA was
extracted according to Andjic et al. (2007).
For each isolate the region spanning the internal
transcribed spacer (ITS1-5.8S-ITS2) region of the ribosomal
DNA was amplified using the primers ITS-1 and ITS-4 (White
et al. 1990). b-tubulin (BT) was amplified with primer pairs
BT1a/BT1b and Bt2a/Bt2b respectively (Glass & Donaldson
1995). The large sub-unit (LSU) of the ribosomal DNA was
amplified using the primers LR0R and LR5 (Vilgalys & Hester
1990). The PCR reaction mixture and conditions were as
described by Andjic et al. (2007). The clean-up of products
and sequencing were as described by Sakalidis (2011) with
the DNA fragments being sequenced with the same primer
pairs used in the PCR amplification.
Sequence data were initially cleaned and subsequent
manual adjustments made in Geneious v. R6 (Biomatters;
http://www.geneious.com/). Sequences were aligned to
those published for fungi in Cryphonectriaceae (Gryzenhout
et al. 2009; Begoude et al. 2010, Chen et al. 2011, Vermeulen
et al. 2011) in Geneious. The alignments were deposited in
TreeBASE SN14068 (www.treebase.org).
Parsimony analysis was performed in PAUP (Swofford
2003). After the exclusion of the uninformative sites, the
most parsimonious trees were obtained using heuristic
searches with random stepwise addition in 100 replicates,
with the tree bisection-reconnection branch-swapping option
on and the steepest-descent option off. Maxtrees were
unlimited, branches of zero length were collapsed and all
multiple, equally parsimonious trees were saved. Estimated
levels of homoplasy and phylogenetic signal (retention and
consistency indices) were determined (Hillis 1992). Branch
ARTICLE
volume 4 · no. 1
113

Crane & Burgess
ARTICLE
Fig. 2. Distribution of Luteocirrhus shearii from cankered branches in the South Western Australian Floristic Region.
and branch node support was determined using 1000
bootstrap replicates (Felsenstein 1985). Analyses were
done for the ITS, BT, conserved BT exon data and LSU
regions separately and for conserved BT exon data and
ITS combined after a 1000 replicate partition homogeneity
test was performed to test the null hypothesis that the data
sets were homologous and could be combined. Diaporthe
ambigua was used as the out-group taxon for the combined
ITS-BT data set and D. eres and D. fibrosa were used as the
outgroup taxa for the LSU dataset.
Bayesian analysis was conducted on the same datasets as
that used in the parsimony analysis. First, JModeltest v. 0.1.1
(Posada 2008) was used to determine the best nucleotide
substitution model. Bayesian analyses were performed
with MrBayes v. 3.1 (Ronquist & Heuelsenbeck 2003). Two
independent runs of Markov Chain Monte Carlo (MCMC)
using four chains were run over 1 000 000 generations. Trees
were saved each 1 000 generations, resulting in 1 000 trees.
Burn-in was set at 100 000 generations (i.e. 100 trees), well
after the likelihood values converged to stationary, leaving
900 trees from which the consensus trees and posterior
probabilities were calculated.
Pathogenicity testing
One-year-old potted seedlings of Banksia attenuata, B.
baxteri, B. coccinea and B. verticillata were stem wound
inoculated in a shadehouse using two isolates (CBS 130776
and WAC13426) with three single plant/pot replicates of each.
Prior to inoculation, isolates were grown on half-strength
PDA medium in the dark for 4 d. A 4 mm diam agar disk of
each test fungus was inserted into a fresh cut made to the
vascular cambium of each stem and bound with moist cotton
wool and tape. A sterile agar disk was inserted in control
inoculations. Stems were harvested, the outer bark shaved
off and lesions measured 3 wk post inoculation after Shearer
et al. (1995). Lesion lengths were compared by analysis of
variance (ANOVA) with lesion length the random factor and
host the fixed factor. The ANOVA assumptions of normality
were checked by plotting residuals (Kirby 1993). Where
appropriate means and standard errors of the mean (mean
± s.e.) were calculated.
RESULTS
Collection and isolation
Ninety-two isolates were collected from cankered branches
of Banksia baxteri, B. coccinea, B. grandis, B. ilicifolia, B.
littoralis, B. pteridifolia, B. quercifolia, B. sessilis, B. speciosa,
B. sphaerocarpa, B. verticillata, and Lambertia echinata
subsp. citrina across the SWAFR. Symptoms on all hosts with
cankers were cracking of periderm with diffuse or contained
lesions in twigs and stems. In B. baxteri there was also a 14
% (n = 21) recovery of the purported Zythiostroma sp. from
analogue healthy branches.
114 ima fUNGUS

Luteocirrhus shearii gen. sp. nov.
Morphology and taxonomy
Luteocirrhus C. Crane & T. I. Burgess, gen. nov.
MycoBank MB563390
Etymology: Latin, luteus, yellow; cirrhus, a tendril like mass of
forced out spores referring to the characteristic conidiophore
mass extruded by the conidiomata.
Type species: Luteocirrhus shearii C. Crane & T.I. Burgess
2013
Diagnosis: Luteocirrhus shares entirely black conidiomata with
mature Celoporthe and Crysoporthe in the Cryphonectriaceae
as described previously (Gryzenhout et al. 2009), but differs in
having some semi-immersed conidiomata, paraphyses within
the locules and cylindrical conidia. Tissues stain purple in 3 %
KOH and yellow in 85 % Lactic acid. This genus is separated
from other genera in the Cryphonectriaceae primarily on ITS,
BT and LSU DNA sequences.
conidiomata on older growth topped with orange yellow cirrhi,
optimum 25 ºC no growth at 1 and 40 ºC (Fig. 4).
Additional specimens examined: Australia: Western Australia: Mt
Groper, -34.51084, 118.79974 (lat/long), isolated from canker on B.
baxteri, 19 Apr. 2010, C. Crane ( PERTH 08355347, WAC 13426);
Cape Riche, -34.567100, 118.707881, isolated from canker on B.
baxteri, 24 May 2010, C. Crane (PERTH 08355339); Waychinicup
National Park, -34.882433, 118.412117, isolated from canker on
B. baxteri, 7 Nov. 2009, C. Crane ( PERTH 08355282); Mt Groper,
-34.510000, 118.800867, isolated from canker on B. baxteri, 19
Nov. 2009, C. Crane (PERTH 08355312); Cape Riche, -34.883417,
118.399850, isolated from canker on B. baxteri, 17 Nov. 2009, C.
Crane (CBS 130775); South Sister Nature Reserve, -34.801100,
118.192400, isolated from cankers on B. grandis, 17 Nov. 2009, C.
Crane (PERTH 08355266); Bremer Bay, -34.473717, 119.373683,
isolated from cankers on B. pteridifolia, 18 Nov. 2009, C. Crane
(PERTH 08355304); Hassell National Park, -34.576050, 118.515450,
isolated from cankers on Lambertia echinata ssp. citrina, 19 Nov.
2009, C. Crane (PERTH 08355320).
ARTICLE
Description: Conidiomata pulvinate with or without neck,
typically separate, fuscous black, subcortical semi-immersed
or sometimes superficial erupting through bark, ostiolate,
uni- to multiloculate, convoluted, paraphyses present and
base cell tissue of textura globulosa. Conidiophores phialidic,
enteroblastic, hyaline, channel and collarette minute. Conidia
hyaline, aseptate, cylindrical or slightly allantoid, exuded as
orange/yellow cirrhi, bright luteus on mass, exuded as cirrhi
or tendrils. Ascotromata not seen.
Luteocirrhus shearii C. Crane & T. I. Burgess. sp. nov.
MycoBank MB563472
(Fig. 3)
Etymology: shearii – taken from Bryan Shearer, who
discovered the fungus on Banksia baxteri, and shortened for
phonetic simplicity.
Type: Australia: Western Australia: Mettler Lake Nature
Reserve, -34.55962, 118.62395 (lat/long), isolated from
pycnidia in branch canker on Banksia baxteri, 17 Nov. 2009,
C. Crane, (PERTH 08439362 – holotype; cultures exholotype,
CBS 130776 = WAC 13425).
Description: Conidiomata pulvinate with or without neck,
typically 200–600 µm high, 200–690 µm diam, separate,
fuscous black, subcortical semi-immersed or sometimes
superficial erupting through bark, ostiolate, uni- to multiloculate,
convoluted, paraphyses present, 20–40 µm long and base
cells tissue of textura globulosa. Conidiophores 8–18 × 2–3
µm, phialidic, enteroblastic, hyaline, channel and collarette
minute. Conidia 3–4 × 1 µm, hyaline, aseptate, cylindrical or
slightly allantoid, exuded as orange cirrhi, bright luteus on
mass, exuded as cirrhi or tendrils. Ascotromata not seen.
Culture characteristics: Mycelium in culture (half-strength
PDA), immersed, septate, initially hyaline turning pale brown
(Mu 7.5YR4/4 “brown”; Munsell 1994) to olive green (Mu
5Y4/4 “olive”), squiggly appearance, producing copious
Hosts: Banksia baxteri, B. coccinea, B. grandis, B. ilicifolia, B.
littoralis, B. pteridifolia, B. quercifolia, B. sessilis, B. speciosa,
B. sphaerocarpa, B. verticillata, and Lambertia echinata ssp.
citrina (Proteaceae).
Notes: Morphologically, L. shearii shares entirely fuscous
black conidiomata with Chrysoporthe and mature
conidiomata of Celoporthe, being distinct from other genera
within the family which contain some orange colour. With
Celoporthe, L. shearii shares conidiomatal shape, presence
of paraphyses, absence of periphyses, conidial shape and
colour in mass. Luteocirrhus shearii differs from Celoporthe
in having basal textura globulosa conidiomatal stromatic
tissue. With Chrysoporthe, L. shearii shares the absence of
periphyses, conidial colour en mass, and differs by having
semi-immersed conidiomata, paraphyses and cylindrical or
slightly allantoid conidia (Table 2).
The LSU data aligned L. shearii most closely to Aurifilum
marmelostoma and Latrunclla aurorae, which differ
morphologically in having orange pigment in most structures
including conidiomata (Begoude et al. 2010, Vermeulen
et al. 2011). ITS-BT sequences showed close alignment
with Cryphonectria radicalis which shares pulvinate semiimmersed
neckless conidiomata, paraphyses and differs in
having orange conidiomata and cylindrical conidia.
Optimal temperature for both isolates was 25 ºC with no
growth at 1 and 40 ºC (Fig. 4). Both isolates incubated at 1
ºC and WAC13426 incubated at 40 ºC resumed growth when
returned to 20 ºC, though CBS 130776 failed to grow after 2
d at 40 ºC.
Phylogenetic analysis
The LSU data set (Fig. 5) consisted of 495 characters of
which 44 were parsimony informative. Heuristic searches
resulted in over 125 most parsimonious trees of 95 steps
(CI = 0.58, RI = 0.84) (TreeBASE SN14068, Fig. 6). The
topology of the Bayesian tree was very similar. Sequences
of all Luteocirrhus shearii isolates were identical and reside
in a highly supported terminal clade. Interestingly, many
volume 4 · no. 1
115

Crane & Burgess
ARTICLE
Fig. 3. Luteocirrhus shearii (PERTH 08355274). A. Conidiomata with cirrhi. B. Vertical section of conidiomata. C. Horizontal cross section of
conidiomata. D. Paraphyses protruding from hymenium. E. Conidiomatal tissue of textura globosa. F. Conidia. Bars A = 1 mm; B and D = 100
µm; C and E = 10 µm; and F = 5 µm.
genera within the Cryphonectriaceae such as Celoporthe,
Cryponectria, Holocryphia, Immersiporthe, and Microthia
could not be separated based on LSU alone.
The intron data for BT is highly variable and difficult to
align and thus only the exon data was considered in the
phylogenetic analysis. The aligned datasets for ITS and
BT exons (Fig. 5) consisted of 612 and 603 characters,
respectively. Based on partition homogeneity tests in
PAUP, the ITS and BT datasets were congruent (P = 0.17)
and were concatenated resulting in a combined dataset of
116 ima fUNGUS

Luteocirrhus shearii gen. sp. nov.
Fig. 4. Radial growth rates of two isolates of Luteocirrhus shearii on
half-strength potato dextrose medium.
1215 characters of which 359 were informative. Heuristic
searches resulted in 172 most parsimonious trees of 1041
steps (CI=0.53, RI=0.82) (TreeBASE SN14068, Fig. 6). The
topology of the Bayesian tree was very similar. All isolates
of Luteocirrhus shearii were identical and reside in a highly
supported terminal clade. Luteocirrhus shearii is separated
from the phylogenetically closest genera Immersioporthe and
Microthia by 120 and 115 steps respectively. All other genera
in the Cryphonectriaceae, with the exception of Cryphonectria
also form coherent highly supported groups. Cryphonectria
radicalis does not group with the other Cryphonectria species.
While the support for individual genera (terminal clades) is
high there is little support for higher level clustering.
Pathogenicity testing
All stems (mean 5 mm diam) except controls and one of
Banksia baxteri were girdled by brown-black lesions within
21 d. Shade house mean daily maximum and minimum
temperatures were 24 o C and 14 o C respectively with
an average of 74 % humidity for the duration of the trial.
Relative susceptibility of the hosts to the disease is indicated
by lesion extension rates that were significantly (P ≤ 0.5)
greater in B. verticillata and B. baxteri, than B. attenuata
and B. coccinea (Fig. 7). Wounds healed over in control
inoculations with no accompanying lesion. Where lesions had
produced conidiomata (Fig. 3) their identity was confirmed
morphologically or subsequently by culturing from the lesion
margin and producing conidiomata as previously described.
Recovery of L. shearii from these lesions confirmed Koch’s
postulates for pathogenicity.
DISCUSSION
This study describes a novel and serious pathogen of
Proteaceae in the SWAFR of Western Australia. Phylogenetic
analysis and morphological features place Luteocirrhus
as a new monotypic genus in the Cryphonectriaceae.
Luteocirrhus shearii shares entirely black conidiomata with
other members of the Cryphonectriaceae, Celoporthe and
Chrysoporthe, but differs by being semi-immersed. The
occurrence of paraphyses also separates L. shearii from
Chrysoporthe. Aurapex, which also has black conidiomata,
could be confused with these genera should its characteristic
orange neck break off, therefore, multiple conidiomata should
be examined.
Luteocirrhus shearii was first reported in 1991 as
Zythiostroma sp. causing canker disease in Proteaceae
(Shearer & Fairman1991). Concurrent studies of cankers in
the region document the increasing incidence and severity
of the pathogen in stressed environments, and the role the
pathogen may play in a drying climate is of great concern
(Crane et al. 2012).
The family Cryphonectriaceae has a global distribution
with a rapidly growing number of genera and species
recognized (Lumbsch & Huhndorf 2007, Gryzenhout et al.
2009, Vermeulen et al. 2011, Chen et al. 2012, Crous et al.
2012) and contains many virulent pathogens affecting some
100 tree species in over 14 families (Gryzenhout et al. 2009).
Apart from Cryphonectria parasitica in non-endemic chestnuts
and oak of Victoria, the Australian members of the family
have to date been recorded only from myrtaceous hosts.
With a few exceptions, the fungi occurring on Myrtaceae
have been largely host family specific (Cheewangkoon et
al. 2009). Luteocirrhus shearii appears to be host family
specific to Australian native Proteaceae (19 species to date)
while absent from concurrent samples of myrtaceous species
within the SWAFR.
Cryphonectriaceae affecting the Australian Myrtaceae,
Aurantiosacculus spp. (Crous et al. 2012a), and Foliocryphia
eucalypti (Cheekwangkoon et al. 2009), are found on the
eastern side of the continent and in Tasmania to the southeast,
Chrysochrypta corymbiae in the Northern Territory
(Crous et al. 2012) and the stem canker pathogen Holocryphia
eucalypti across continental Australia including the SWAFR
(Nakabonge et al. 2008). Population studies of H. eucalypti
have shown it to be native to Australia (Nakabonge et al.
2008), though whether it is native to Western Australia is not
known. While little is known of the continental distribution of
L. shearii, which could reflect low sampling effort within the
Proteaceae, a single Zythiostroma sp. has been reported
causing canker disease in eucalypts in Tasmania (Yuan &
Mohammed 1997). There is regional widespread distribution
of L. shearii within the geographically isolated SWAFR on a
diverse range of native Proteaceous hosts. Absence in the
literature to date and being found only within the SWAFR
suggests L. shearii may be endemic and host family specific
to the Proteaceae within the region. Historical records of the
incidence in B. coccinea also indicate this fungus is a long
established endemic or at least well adapted ecologically
prior to first isolation by Shearer in 1985.
Alternatively, the absence of the sexual morph on native
hosts in the SWAFR suggests that the center of diversity
for L. shearii is elsewhere. This behaviour is similar to H.
eucalypti, where only the asexual morph has been found in
Western Australia though the fungus is native to the Australian
continent (Nakabonge et al. 2008).
Shearer et al. (1995) previously demonstrated the
pathogenicity of L. shearii (as a Zythiostroma sp.) by girdling
and killing B. baxteri and B. coccinea inoculated stems followed
by 100 % recovery of the pathogen. Luteocirrhus shearii was
ARTICLE
volume 4 · no. 1
117

Crane & Burgess
ARTICLE
100
98
Diaporthe eres AR3538 AF408350
Diaporthe fibrosa AR3425 AF408351
1 change
Chrysocrypta corymbiae CPC19279 JX069851
Aurifilum marmelostoma CMW28285 HQ171215
Aurifilum marmelostoma CMW28288 HQ171216
57
Latruncellus aurorae CMW28275 HQ171214
Latruncella aurorae CMW28276 HQ171213
Luteocirrhus shearii Bb11.4 KC197017
93
Luteocirrhus shearii CBS 130776 KC197019
Luteocirrhus shearii CBS 130775 KC197018
Foliocryphia eucalypti CBS 124779 GQ303307
69 Aurantiosacculus acutatum CPC13704 JQ685520
Aurantiosacculus eucalyptorum CPC13229 JQ685521
Rostraureum tropicale CMW9972 AY194092
Ursicollum fallax CMW18119 EF392860
Immersiporthe knoxdaviesiana CMW37314 JQ862755
Immersiporthe knoxdaviesiana CMW37315 JQ862756
Microthia havanensis CMW11299 AY194087
Microthia havanensis CMW11300 AY194088
Celoporthe dispersa CMW9978 AY194094
Celoporthe eucalypti CMW26900 HQ730862
50
Celoporthe guangdongensis CMW12750 HQ730856
Celoporthe indonesiensis CMW10781 HQ730855
Celoporthe sysygii CMW34023 HQ730857
67 Cryptodiaporthe corni ATCC 66834 AF277133
Cryptodiaporthe corni CBS 245.90 AF408343
58 Endothia gyrosa CMW10442 AY194115
Endothia gyrosa CMW2091 AY194114
Cryphonectria japonica CMW10528
Cryphonectria macrospora CMW10914 JQ862749
62 Chrysoporthe austroafricana CMW2113 JN940852
Chrysoporthe syzygiicola CMW29941 JN940848
Chrysoporthe cubensis CBS101281 AF408338
71 Chrysoporthe doradensis CMW11287 JN940844
Chrysoporthe hodgesiana CMW10625 JN940842
Chrysoporthe inopina CMW12731 JN940841
Chrysoporthe zambiensis CMW29929 JN940846
Cryphonectria decipiens CMW10436 JQ862750
Cryphonectria radicalis CMW10477 AY308951
Cryphonectria parasitica CMW7048 JN938760
Atersuperfici longiparaphysata CMW37320 JQ862826
Atersuperfici longiparaphysata CMW37321 JQ862827
63 Aurapex penicillata CMW10030 AY194103
Aurapex penicillata CMW11295 AY194089
66 Cryptometrion aestuescens CMW18790 HQ730869
Cryptometrion aestuescens CMW18793 HQ730870
Holocryphia eucalypti CMW7035 JQ862795
Holocryphia eucalypti CMW7036 JQ862796
Holocryphia longiascospora CMW11689 JQ862800
Holocryphia longiascospora CMW37338 JQ862799
Holocryphia longiconidia CMW37334 JQ862791
Holocryphia longiconidia CMW37335 JQ862792
Holocryphia metrosiderosi CMW37341 JQ862822
Holocryphia metrosiderosi CMW37342 JQ862823
Amphilogia gyrosa CMW10469 AY194107
Amphilogia gyrosa CMW10470 AY194108
Fig. 5. One of 125 most parsimonious trees of 92 steps based on analysis of LSU gene region. Bootstrap values are given above the line. Trees
are rooted to Diaporthe eres and D. fibrosa.
118 ima fUNGUS

Luteocirrhus shearii gen. sp. nov.
100
Amphilogia gyrosa CMW10470
75
Amphilogia gyrosa CMW10469
100 Rostraureum tropicale CMW9972
Rostraureum tropicale CMW10796
100 Cryptodiaporthe corni AR2814
Cryptodiaporthe corni AR2814B
ARTICLE
100
Endothia gyrosa CMW2091
87
Endothia gyrosa CMW10442
Chrysoporthe austroafricana CMW2113
Chrysoporthe syzygiicola CMW29941
Chrysoporthe zambiensis CMW29929
Chrysoporthe doradensis CMW11287
100
Chrysoporthe inopina CMW12731
Chrysoporthe cubensis CMW8651
Chrysoporthe hodgesiana CMW10625
100
Aurapex penicillata CMW10035
75
Aurapex penicillata CMW10030
Celoporthe dispersa CMW9978
99
Celoporthe eucalypti CMW26900
100
Celoporthe guangdongensis CMW12750
Celoporthe indonesiensis CMW10780
Celoporthe syzygii CMW34023
Luteocirrhus shearii CBS 130775
Luteocirrhus shearii CBS 130774
100
Luteocirrhus shearii CBS 130776
Luteocirrhus shearii BB16.7
Luteocirrhus shearii BB11.4
Luteocirrhus shearii WAC13426
Cryphonectria radicalis CMW10455
100
Immersiporthe knoxdaviesiana CMW37314
64
Immersiporthe knoxdaviesiana CMW37315
100
Microthia havanensis CMW14550
Microthia havanensis CMW11300
100
Cryptometrion aestuescens CMW18793
Cryptometrion aestuescens CMW28535
84
98
Cryphonectria japonica CMW13747
Cryphonectria macrospora CMW10914
Cryphonectria parasitica CMW7048
88
74
100
Aurifilum marmelostoma CMW28285
Aurifilum marmelostoma CMW28288
100
Latruncellus aurorae CMW28275
Latruncellus aurorae CMW28274
100
Ursicollum fallax CMW18119
100
100
Ursicollum fallax CMW18115
Holocryphia eucalypti CMW7033
Holocryphia eucalypti CMW7035
Diaporthe ambigua CMW5587
Diaporthe ambigua CMW5288
10 changes
Fig. 6. One of 172 most parsimonious trees of 1041 steps based on analysis of combined DNA sequence data set of gene regions of the partial
exon 4, exon 5, exon 6 and exon 7 of the BT genes, and the ITS gene region. Bootstrap values are given above the line. The trees are rooted
to Diaporthe ambigua.
volume 4 · no. 1
119

Crane & Burgess
ARTICLE
Table 1. Isolates and reference specimens of Luteocirrhus shearii used in the phylogenetic, morphological analysis.
Isolate Western Australian Host Location ITS BT1 BT2 LSU
Herbarium specimen
Bb7.2 Banksia baxteri Waychinicup KC197020 KC197011 KC197005
National Park WA
CBS 2 130774
Bb8.2 PERTH 08355347 B. baxteri Mt Groper WA KC197025 KC197016 KC197010
WAC 3 13426
Bb11.4 B. baxteri Stokes National KC197022 KC197013 KC197007 KC197017
Park WA
Bb16.7 PERTH 08355339 B. baxteri Cape Riche WA KC197023 KC197014 KC197008
Bb16H PERTH 08355290 B. baxteri Cape Riche WA KC197024 KC197015 KC197009 KC197018
CBS 130775
Bb17.5 PERTH 08439362 B. baxteri Mettler Lake KC197021 KC197012 KC197006 KC197019
CBS 130776
WAC 13425 1
CC1572 PERTH 08355274 B. grandis
Nature Reserve
WA
Palmdale rd
Albany WA
CC1577 PERTH 8355266 B. grandis South Sister
Nature reserve
WA
CC1579 PERTH 08355282 B. baxteri Waychinicup
National Park WA
CC1587 PERTH 08355304 B. pteridifolia Bremer Bay WA
CC1589 PERTH 08355312 B. baxteri Mt Groper WA
CC1590 PERTH 08355320 Lambertia echinata
subsp. citrina
Hassel National
Park WA
1
Ex-type culture.
2
CBS, Centaalbureau voor Schimmelcultures, Utrecht, the Netherlands.
3
WAC, Department Agriculture Plant Pathogen Collection, Department of Agriculture Western Australia.
Table 2. Morphological characteristics of Luteocirrhus compared with other genera of Cryphonectriaceae having entirely black conidiomata.
Morphological characteristics Celoporthe Chrysoporthe Luteocirrhus
Conidiomatal colour Entirely fuscous black when mature Entirely fuscous black Entirely fuscous black
Conidiomatal position in bark Superficial Superficial Semi immersed
Conidiomatal shape Pulvinate to conical/globose, ± neck Pyriform to pulvinate, one to four Pulvinate to globose, ± neck
attenuated necks
Conidiomatal stromatic tissue
Prosenchyma and
pseudoparenchyma
Textura globulosa and textura
porrecta
Basal textura globulosa
Paraphyses Present Absent Present
Periphyses Absent Absent Absent
Conidial shape Cylindrical Oblong Cylindrical or slightly allantoid
Condial colour on mass Luteous Luteous Luteous
not considered a major cause of death in B. coccinea due to
infrequent isolation. Pathogenicity has now been demonstrated
in a further seven Banksia spp. (Shearer & Crane, unpubl.
data) and the fungus has been recorded as occurring naturally
across a wide geographic area within the range of Proteaceae
in the SWAFR. The isolation of L. shearii from 14 % of healthy
B. baxteri stems suggests that the fungus is capable of a latent
phase or has some type of endophytic stage in the disease
epidemiology, which warrants further investigation.
Worldwide, the incidence of canker diseases caused by or
associated with these types of fungi and other endophytes has
been steadily increasing. Climate change is seen as the driving
force in the apparent emerging pathogenicity of these normally
minor diseases (Desprez-Loustau et al. 2006, Jurc & Ogris
2006, Daikin et al. 2010). Concurrent studies of the influence
of climate on canker disease in Proteaceae in the SWAFR has
shown that L. shearii is one of the causal organisms frequently
isolated from aggressive cankers. Neofusicoccum australe,
120 ima fUNGUS

Luteocirrhus shearii gen. sp. nov.
Fig. 7. Mean (+ standard error) visible lesion growth rates of
Luteocirrhus shearii following stem wound inoculation of four Banksia
hosts. Wounds healed over in control inoculations.
N. macroclavatum, and Cryptodiaporthe melanocraspeda,
along with L. shearii, are forming a disease complex that is
having an increasing impact across many proteaceous species
in the region (Crane et al. 2012). This increasing impact has
so far been positively correlated with minimum temperatures
(Crane et al. 2012) and the complex appears to be an emerging
disease issue in a changing environment.
ACKNOWLEDGEMENTS
We are grateful to Bryan Shearer, Sarah Barrett, Chris Dunne,
Richard Fairman, Malcolm Grant, Eddie Lim, Peter Scott, and
Meridith Spencer for assistance in isolate collection, Diane White for
sequencing, Louise Ratcliff for inoculation and harvesting assistance
and Jane Crane for reviewing an earlier version of the manuscript.
REFERENCES
Andjic V, Hardy GEStJ, Cortinas MN, Wingfield MJ, Burgess TI
(2007) Multiple gene genealogies reveal important relationships
between species of Phaeophleospora infecting Eucalyptus
leaves. FEMS Microbiology Letters 268: 22–33.
Bates BC, Hope P, Ryan B, Smith I, Charles S (2008) Key findings
from the Indian Ocean Climate Initiative and their impact on
policy development in Australia. Climatic Change 89: 339–354.
Beard JS (1989) Definition and location of Banksia woodlands.
Journal of the Royal Society of Western Australia 71: 85–86.
Beard JS, Chapman AR, Gioia P (2000) Species richness
and endemism in the Western Australian flora. Journal of
Biogeography 27: 1257–1268.
Begoude BAD, Slippers B, Wingfield MJ, Roux J (2010)
Botryosphaeriaceae associated with Terminalia catappa in
Cameroon, South Africa and Madagascar. Mycological Progress
9: 101–123.
Boesewinkel HJ (1976) Storage of fungal cultures in water.
Transactions of the British Mycological Society 66: 183–185.
Cheewangkoon R, Groenewald JZ, Summerell BA, Hyde KD,
To-anun C, Crous PW (2009) Myrtaceae, a cache of fungal
biodiversity. Persoonia 23: 55–85.
Chen SF, Gryzenhout M, Roux J, Xie YJ, Wingfield, MJ, Zhou XD (2011)
Novel species of Celoporthe from Eucalyptus and Syzygium trees
in China and Indonesia. Mycologia 103: 1384–1410.
Chen SF, Wingfield MJ, Roets F, Roux J (2012) A serious canker
disease caused by Immersiporthe knoxdaviesiana gen. et sp. nov.
(Cryphonectriaceae) on native Rapanea melanophloeos in South
Africa. Plant Pathology Doi: 10.1111/j.1365-3059.2012.02671.
62: 667–678.
Crane CE, Shearer BL, Barrett S, Dunne CP (2012) Influence of
climate on canker disease in the Proteaceae of the Southwest
Australian Floristic Region. In Proceedings of the Australasian
Systematic Botany Society Conference: 26.
Crous PW, Summerell BA, Shivas RG, Burgess TI, Decock CA et
al. (2012) Fungal Planet description sheets: 164–165. Persoonia
28: 138–182.
Crous PW, Summerell BA, Alfenas AC, Edwards J, Pascoe IG et al.
(2012a) Coelomycetous genera associated with leaf spots of
tree hosts. Persoonia 28: 66–75.
Daikin N, White D, Hardy G, Burgess T (2010) The opportunistic
pathogen, Neofusicoccum australe, is responsible for crown
dieback of peppermint (Agonis flexuosa) in Western Australia.
Australasian Plant Pathology 39: 202–206.
Desprez-Laustau ML, Marcais B, Nageleisen LM, Piou D, Vannini
A (2006) Interactive effects of drought and pathogens in forest
trees. Annals of Forest Science 63: 597–612.
Drummond AJ, Ashton B, Buxton S, Cheung M, Cooper A, Duran C,
Field M, Heled J, Kearse M, Markowitz S, Moir R, Stones-Havas
S, Sturrock S, Thierer T, Wilson A (2011) Geneious. Version 5.4.
.
Felsenstein J (1985) Confidence intervals on phylogenetics: an
approach using bootstrap. Evolution. 39: 783–791.
Fitzpatrick MC, Gove AD, Sanders NJ, Dunn RR (2008) Climate
change, plant migration, and range collapse in a global
biodiversity hotspot: the Banksia (Proteaceae) of Western
Australia. Global Change Biology 14: 1337–1352
Glass NL, Donaldson GC (1995) Development of primer sets
designed for use with the PCR to amplify conserved genes
from filamentous Ascomycetes. Applied and Environmental
Microbiology 61: 1323–1330.
Gryzenhout M, Wingfield BD, Wingfield MJ (2009) Taxonomy,
phylogeny, and ecology of bark-inhabiting and tree-pathogenic
fungi in the Cryphonectriaceae. St Paul, MN: American
Phytopathological Society Press.
Hillis DM, Huelsenbeck JP (1992) Signal, noise and reliability in
molecular phylogenetic analysis. Journal of Heredity 83: 189–195.
Hopper SD (1980) Bird and mammal pollen vectors in Banksia
communities at Cheyne Beach, Western Australia. Australian
Journal of Botany 28: 61–75
Jurc D, Ogris N (2006) First reported outbreak of charcoal disease
caused by Biscogniauxia mediterranea on Turkey oak in
Slovenia. Plant Pathology 55: 299.
Kirby KN (1993). Advanced data analysis with SYSTAT. Van Nostrad
Reinhold, New York.
Lumbsch HT, Huhndorf SM (2007) Notes on ascomycete systematics.
Nos 4408–4750. Myconet 13: 59–99.
ARTICLE
volume 4 · no. 1
121

Crane & Burgess
ARTICLE
Munsell C (1994) Munsell Soil Color Charts. New Windsor, NY:
Kollmorgen Instruments.
Myers N (2001) Mediterranean-climate regions: glowing hotspots of
diversity. Journal of Mediterranean Ecology 2: 157–163.
Nakabonge G, Burgess T, Gryzenhout M, Wingfield B, Wingfield
M, Roux J (2008). Population structure of the fungal pathogen
Holochryphia eucalypti in Australia and South Africa. Australasian
Plant Pathology 37: 154–161.
Pate JS, Bell TL (1999) Application of the ecosystem mimic concept
to the species-rich Banksia woodlands of Western Australia.
Agroforestry Systems 45: 303–341.
Posada D (2008) jModelTest: Phylogenetic Model Averaging.
Molecular Biology and Evolution 25: 1253–1256.
Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian
phylogenetic inference under mixed models. Bioinformatics 19:
1572–1574.
Sakalidis ML, Hardy GESt.J, Burgess TI (2011) Class III endophytes,
clandestine movement amongst hosts and habitats and their
potential for disease; a focus on Neofusicoccum australe.
Australasian Plant Pathology 40: 510–521.
Shearer BL, Crane CE, Barrett S, Cochrane A (2007) Phytophthora
cinnamomi invasion, a major threatening process to conservation
of flora diversity in the South-west Botanical Province of Western
Australia. Australian Journal of Botany 55: 225–238.
Shearer BL, Dillon M (1996) Impact and disease centre characteristics
of Phytophthora cinnamomi infestations of Banksia woodlands
on the Swan Coastal Plain, Western Australia. Australian Journal
of Botany 44: 79–90.
Shearer BL, Fairman RG (1991) Aerial canker fungi threaten
Banksia coccinea. In: Proceedings of the Conservation Biology
in Australia and Oceania Conference, University of Queensland:
Abstract 85/C16.
Shearer BL, Fairman RG, Bathgate JA (1995) Cryptodiaporthe
melanocraspeda canker as a threat to Banksia coccinea on the
South Coast of Western Australia. Plant Disease 79: 637–641.
Swofford DL (2003) PAUP*: phylogenetic Analyses using parsimony
(* and other methods). Version 4.0b10. Sunderland, MA: Sinauer
Associates.
Vermeulen M, Gryzenhout M, Wingfield MJ, Roux J ( 2011) New
records of the Cryphonectriaceae from southern Africa including
Latruncellus aurorae gen. sp. nov. Mycologia 103: 554–569.
Vilgalys R, Hester M (1990) Rapid genetic identification and
mapping of enzymatically amplified ribosomal DNA from several
Cryptococcus species. Journal of Bacteriology 172: 4239–4246.
White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct
sequencingof fungal ribosomal RNA genes for phylogenetics. In:
PCR Protocols: a guide to methods and applications (Innis MA,
Gelfand DH, Sninsky JJ, White TJ, eds.: 315–322. San Diego:
Academic Press.
Wooller RD, Richardson KC, Garavanta CAM, Saffer VM, Bryant KA
(2000) Opportunistic breeding in the polyandrous honey possum,
Tarsipes rostratus. Australian Journal of Zoology 48: 669–680.
Yuan, Zi-Qing, Mohammed C (1997) Investigation of fungi
associated with stem cankers of eucalypts in Tasmania Australia.
Australasian Plant Pathology 26: 78–84.
122 ima fUNGUS

doi:10.5598/imafungus.2013.04.01.12
IMA Fungus · volume 4 · no 1: 123–131
Surveys of soil and water reveal a goldmine of Phytophthora diversity in
South African natural ecosystems
Eunsung Oh 1,4 , Marieka Gryzenhout 2 , Brenda D. Wingfield 1 , Michael J. Wingfield 3 , and Treena I. Burgess 1,3,5
1
Department of Genetics and Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria 0002, South Africa
2
Department of Plant Sciences, University of the Free State, Bloemfontein 9301, South Africa
3
Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria 0002, South Africa
4
Current address: E-Planet Co. Ltd. 345-9 Gasandong Gumcheongu, 153-802, Seoul, Republic of Korea.
5
Center for Phytophthora Science and Management, Murdoch University, Perth, Australia, 6150; corresponding author e-mail: t.burgess@
murdoch.edu.au
ARTICLE
Abstract: Phytophthora species are well-known as destructive plant pathogens, especially in natural ecosystems. It is
ironic, therefore, how little is known regarding the Phytophthora diversity in South African natural woody ecosystems.
In this study, Phytophthora species were isolated using standard baiting techniques from 182 soil and water samples
and these were identified based on ITS and coxI sequence data. The 171 resulting Phytophthora isolates resided in 14
taxa including six known species (P. multivora, P. capensis, P. cryptogea, P. frigida, P. cinnamomi, P. cinnamomi var.
parvispora), the known but as yet unnamed Phytophthora sp. PgChlamydo, P. sp. emzansi, and P. sp. Kununurra and
five novel taxa referred to as P. sp. stellaris, P. sp. Umtamvuna P. sp. canthium, P. sp. xWS, P. sp. xHennops. Four of the
new taxa were found exclusively in water and two of these are hybrids. The most commonly isolated species from soil
was P. multivora, a species recently described from Western Australia. Phytophthora frigida was isolated for the first time
from stream water. With the exception of P. cinnamomi, very little is known regarding the biology, epidemiology or origin
of Phytophthora in South Africa.
Key words:
Oomycetes
Phytophthora
ITS
nrDNA
coxI
Phylogeny
Taxonomy
Article info: Submitted: 1 April 2013; Accepted: 30 May 2013; Published: 10 June 2013.
INTRODUCTION
Less than 2 % of the land surface of South Africa is covered
with indigenous forests. The larger part of the country is
grassland and dry savanna woodland such as semi-dessert
with small shrubs and Acacia trees (Grundy & Wynberg
2001). Savanna woodlands cover 35–40 %, while plantation
forests cover 1.5 % of the land area. Before 1940, small
privately-owned plantations of Acacia or Eucalyptus species
in Western Cape were associated with agriculture to
protect crops from wind erosion and subsequent sand drift.
After 1945, the Department of Forestry was established
to protect indigenous forest by establishing a plantation
industry based on non-native species such as Eucalyptus
spp. from Australia and Pinus spp. from north and central
America (Burgess & Wingfield 2001, Grundy & Wynberg
2001). South Africa is also home to three of the world’s 25
Biodiversity host-spots (http://www.biodiversityhotspots.
org) and many studies have been conducted to document
and conserve animal and plant biodiversity. In contrast,
there has been relatively little work on fungal biodiversity
(Crous et al. 2006, Marincowitz et al. 2008) and almost
nothing is known regarding the endemic Oomycetes, which
are broadly treated with the fungi.
Several common Phytophthora species have been
recovered from agricultural landscapes in South Africa,
notably P. cinnamomi, P. cactorum, P. citrophthora, P.
citricola, P. megasperma, P. cryptogea, P. drechsleri, P.
infestans, P. nicotianae, P. syringae, and P. porri (Crous et
al. 2000). Eight Phytophthora spp. have been recovered
from plantations of non-native species, mainly located
in KwaZulu-Natal, Eastern and Western Cape, and
Mpumalanga. These include P. boehmeriae, P. cinnamomi,
P. cryptogea, P. nicotianae, P. meadii, P. frigida, and P.
alticola (Zeijlemaker 1971, Bumbieris 1976, Wingfield &
Knox-Davies 1980, Linde et al. 1994, Roux & Wingfield
1997, Maseko et al. 2001, Maseko et al. 2007). All the
Phytophthora species commonly found in agriculture and
forestry are considered introductions to South Africa.
Phytophthora alticola and P. frigida are the only species
known exclusively from South Africa, and they could be
endemic to the region.
The species most studied from natural ecosystems in
South Africa is the devastating pathogen P. cinnamomi (von
Broembsen 1984a, von Broembsen & Kruger 1985). It is
also commonly recovered from dying Proteaceae, including
commercially cultivated members such as Protea spp.,
Leucodendron spp., and Leucospermum spp., mostly in the
© 2013 International Mycological Association
You are free to share - to copy, distribute and transmit the work, under the following conditions:
Attribution:
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).
Non-commercial: You may not use this work for commercial purposes.
No derivative works: You may not alter, transform, or build upon this work.
For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get
permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.
volume 4 · no. 1
123

Oh et al.
ARTICLE
Fig. 1. Diversity and distribution of Phytophthora species from six sampling sites in South Africa.
Cape Province (Knox-Davies 1975, von Broembsen 1984b,
von Broembsen & Kruger 1985).
In 2010, P. capensis and P. sp. emzansi 1 were identified
from the cultivated endemic shrubs Agathosma betulina,
Olea capensis, and Curtisia dentate, and also stream
water, in Cape Province (Bezuidenhout et al. 2010). The
original isolates of P. capensis had been reported as “P.
citricola complex” (CIT4) in an earlier study (Oudemans
et al. 1994). Additionally, P. cinnamomi, P. cinnamomi
var. parvispora, P. citricola, P. cryptogea, P. dreschsleri,
P. multivora, P. nicotianae, and P. plurivora were identified
on diseased Agathosma spp. in commercial fields and
nurseries (Bezuidenhout et al. 2010). In a recent study, P. sp.
PgChlamydo and several hybrid species have recently been
reported from a stream within a botanical garden in Gauteng
(Nagel et al. 2013b). Other than the latter two studies and the
considerable body of literature on the impact of P. cinnamomi
in natural and managed ecosystems in South Africa, there
have been no recent studies examining the diversity, biology
or impact of Phytophthora species in natural ecosystems. The
aim of the present study was thus to broaden our knowledge
of the genus in the country by collections of the genus from
such environments.
1
Informal names have been used in the past for some species
discussed here, and also for some that are newly reported. This
practice is adopted pending fuller information being obtained, and
formal names will be introduced where appropriate in a future
publication
MATERIALS AND METHODS
Sampling and isolation
Sampling was conducted in five provinces of South Africa
in different climatic zones (Table 1, Fig. 1): Mpumulunga
(MP; sub-tropical climate), 26 soil samples and 3 water
samples from natural vegetation (one soil sample was from
a Eucalyptus plantation); Gauteng (GT; temperate climate,
over 2000 m elevation), 4 water samples from a botanical
garden; Western Cape (WC; Mediterranean climate), 6
soil samples and 2 water samples from natural vegetation;
Eastern Cape, Umtamvuna Nature Reserve (UM; temperate
climate), 21 soil samples and 6 water samples for filtering
from natural vegetation; KwaZulu-Natal, Pietermaritzburg
(PMB; temperate climate), 16 soil samples, 12 water samples
for filtering and 13 water samples for baiting from a botanical
garden; and KwaZulu-Natal, Ingeli Forest Reserve (ING; subtropical
climate), 52 soil samples, 9 water samples for filtering
and one water sample for baiting from natural forest.
For soil baiting, 2–300 g of soil was placed in a container
(12 × 22 cm stainless steel, Sunnex, UK) containing 800 mL of
non-sterile distilled water. Floating litter was removed, and two
intact and edge-excised Rhododendron (R. indioum Claude
Goyet) and pear leaves were floated on the surface of water
for up to 7 d until lesions appeared. The margin of the necrotic
regions was excised and cut into to small pieces (5 × 5 mm) and
placed onto Phytophthora selective medium, NARPH (Hüberli
et al. 2000). The plates were incubated at room temperature,
of approximately 22 o C for 3–7 d, and mycelium on the plates
was transferred to cornmeal agar (CMA).
Water samples (1 L) were baited in the laboratory using
a technique modified from Jung et al. (1996), where stream
124 ima fUNGUS

Phytophthora diversity in South Africa
Table 1. Isolates of Phytophthora species collected from soil and water in this study.
Province Location Source No. No. No. isolates
samples +ve samples
Mpumulunga Lydenburg Forest soil 15 3 5
Schagen Stream water (baiting) 3 2 2
Schagen Soil near stream 9 2 3
ARTICLE
Schagen Forest soil 1 1 1
Jonkershoek Forest soil 5 2 2
Jonkershoek Stream water (baiting) 1 0 0
Western Cape Betty’s Bay, Harold Potter NBG Garden soil 2 2 3
Betty’s Bay, Harold Potter NBG Stream water (baiting) 1 0 0
Gauteng
Roodepoort, Crocodile, River, Stream water (baiting) 2 2 10
Walter Sisulu NBG
Centurion, Hennops River Stream water (baiting) 2 2 5
Kwa Zulu Natal Pietermaritzburg Stream water (filtering) 13 8 25
Pietermaritzburg Stream water (baiting) 13 7 14
Pietermaritzburg Soil 16 13 25
Kwa Zulu Natal Ingeli Forest Stream water (filtering) 9 5 9
Ingeli Forest Stream water (baiting) 8 1 1
Ingeli Forest Soil 58 22 30
Eastern Cape Umtamvuna Stream water (filtering) 6 3 7
Umtamvuna Soil 23 15 29
water was placed in a 12 × 22 cm stainless steel container
(Sunnex, UK), baited with Rhododendron indioum leaves and
whole pear and apple fruits (previously washed and surfacesterilized
with 95 % ethanol). The leaves were collected after
3–4 d when necrotic symptoms were visible, and the fruits
after 7 d. The baits were rinsed with sterilized dH 2
O and
placed on paper towels to remove excess water, sterilized
in 95 % ethanol for 10–20 s, rinsed in sterilized dH 2
O and
dried with paper towel. Sections containing lesions were then
excised and plated onto NARPH medium and purified as
described above. Other water samples were filtered shortly
after collection, through a 47 mm circle filter paper with
0.45 µm pore size (Whatman, Kent, UK) using a filtering
funnel and glass flask connected to a vacuum pump. Filters
were then placed topside down onto the surface of NARPH
medium for 2 d, after which they were removed and individual
colonies were transferred to new plates.
Single hyphal tips of all putative Phytophthora spp.
from the isolations using the various techniques were
transferred to V8 agar. After purification, they were stored in
the culture collection (CMW) of the Forestry and Agricultural
Biotechnology Institute at the University of Pretoria.
Identification of Phytophthora species
Mycelium of isolates grown in 10 % V8 broth was harvested,
washed with sterile distilled water, removed of excess water
with filter paper, placed in a 2 mL microfuge tubes, and
lyophilised with VirTris Advantage BenchTop Tray Lyophilizer
(SP Scientific, UK) overnight. The dried mycelium was then
transferred to new microfuge tubes with two 3 mm metal
beads. Extraction of total genomic DNA and amplification of
target genes by polymerase chain reaction was carried out
using a modification of the protocol described by Winton &
Hansen (2001).
The Internal Transcribed Spacer regions of the rDNA
(ITS1, 5.8S, and ITS2) were amplified using the primers ITS6
(Cooke & Duncan 1997) and ITS4 (White et al. 1990) and the
cytochrome oxidase subunit I (coxI) was amplified using the
primers FM84 and FM83 (Martin & Tooley 2003) with annealing
temperatures of 55 ºC and 50 ºC respectively. Amplified DNA
was purified with a high pure PCR product purification kit
(Roche, RSA) and sequenced with the same primers. Cloning
was carried out using pGEM-T® Easy vectors (Promega, USA)
following manufacturer’s instructions when the sequences of
the isolates could not be read due to DNA polymorphism.
Sequences of the isolates were uploaded and aligned
in Geneious v. R6 (Biomatters; available from http://www.
geneious.com/). The most appropriate substitution model
was determined using jModelTest (Posada 2008). The
TIM3+G (ITS) and GTR+I+R (coxI) model were selected
and used in the Bayesian analysis (Ronquist & Huelsenbeck
2003). All sequences for the isolates considered in this study
were submitted to GenBank and given in Figs 2–3.
RESULTS
Isolation
Isolation success varied between sites and the methods used
(Table 1); soil samples from the Western Cape, Mpumulunga,
volume 4 · no. 1
125

Oh et al.
ARTICLE
Ingeli Forest Reserve, Umtamvuna and Pietermaritzburg
yielded a success rate of 100, 28, 38, 65 and 81 % respectively.
Isolation success from water-baited samples in the Western
Cape, Mpumulunga, Gauteng, Ingeli Forest Reserve, and
Pietermaritzburg gave a success rate of 0, 50, 100, 12.5 and
53.8 % respectively. Isolation by water filtering from Ingeli
Forest Reserve, Umtamvuna and Pietermaritzburg gave
success rates of 55 %, 50 % and 61 % respectively. In total,
171 Phytophthora isolates were recovered; 98 from soil, 32
from water baiting and 41 from water filtering (Table 1).
Identification of Phytophthora isolates
ITS sequence data were obtained for all isolates, and their
identity confirmed by firstly conducting BLAST searched in
GenBank (www.ncbi.nlm.nih.gov/genbank/) and secondly
by alignment to sequences of type isolates from original
publications or, if these were unavailable, to the representative
isolates selected for the oomycete barcode paper of Robideau
et al. (2011). A maximum of three sequences per taxa were
selected for inclusion in the complete ITS phylogenetic
analysis (TreeBASE 14082). There were three taxa for which
the ITS could not be directly sequenced; one group residing
in Clade 6 and two in Clade 9 of the phylogeny (Fig. 2). In
each case, the ITS product of representative isolates from
each group were cloned and 10 cloned fragments sequenced
(11 isolates of P. sp. xWS, 8 isolates of P. sp. xHennops
and 3 isolates of P. sp. stellaris). These were then aligned
to known taxa and ITS alleles representing each of the taxa
were selected for inclusion in the complete ITS phylogenetic
analysis.
The aligned ITS dataset consisted of 945 characters of
which 492 were parsimony informative. Analysis resulted
in 24 trees of 1887 steps (CI = 0.54, RI = 0.91) (Fig. 2).
Fourteen Phytophthora spp. were identified from amongst
the 173 isolates (Table 1, Fig. 2). Of these, six were of known
species (P. multivora, P. capensis, P. frigida, P. cinnamomi,
P. cinnamomi var. parvispora, and P. cryptogea), three
species matched previously designated taxa (P. sp. emzansi,
P. sp. PgChlamydo, P. sp. Kununurra) and five taxa did
not correspond to any known species and are designated
here as P. sp. xWS, P. sp. stellaris, P. sp. xHennops, P. sp.
Umtamvuna and P. sp. canthium.
For three of the unknown taxa, P. sp. xWS, P. sp. xHennops
and some isolates of P. sp. stellaris, direct sequencing of the
ITS region failed. After cloning of ITS amplicons, each of
these species yielded at least ITS alleles corresponding in the
phylogenetic analysis to other taxa. For P. sp. xWS, alleles
corresponding to P. thermophila and P. amnicola in Clade
6 were obtained (12 SNPs). For P. sp. xHennops, alleles
corresponding to P. hydropathica and an unknown species
in Clade 9 were obtained (24 SNPs). For P. sp. stellaris,
direct sequencing was not possible due to a 1bp indel in
one of the ITS alleles, however the remaining variation (3
bp) between the ITS alleles was considered to be within the
range of intraspecific variation. P. sp. stellaris is most similar
to P. insolata but differs by 36 bp (4.4 %), P. sp Umtamvuna
differs from P. hydropathica by 23 bp (2.55 %) and from P. sp.
Kununurra by 19 bp (3.05 %) and P. sp. canthium differs from
P. kernoviae by 42 bp (5.1 %). In the phylogenetics analysis
Clade 9, separates into four sub-clades (Fig. 2).
coxI sequence data were obtained for most isolates and
those of P. multivora, P. capensis, P. cryptogea, P. frigida, P.
cinnamomi, P. cinnamomi var. parvispora and P. sp. emzansi
returned 100 % matches to corresponding species in Blast
searches on GenBank (data not shown). Phylogenic analyses
was conducted including all related species in Clade 6 (Nagel
et al. 2013), and those for which sequence data was available
from Clade 9 (Fig. 3). All isolates designated as P. sp. stellaris
had identical coxI alleles. Isolates designated as P. sp. xWS
based on ITS sequence data had coxI alleles corresponding
to either P. thermophila or P. amnicola. Isolates designated as
P. sp. xHennops had coxI alleles corresponding to either P.
sp. Kununurra or P. hydropathica. The latter two taxa, P. sp.
xWS and P. sp. xHennops are considered to be hybrids and
are designated as such by the use of the “x”.
Distribution of Phytophthora isolates
With the exception of three isolates of Phytophthora multivora
recovered from dying Rapanea collected in the Harlod Porter
Botanical Garden in Western Cape Province, all other isolates
were recovered from soil associated with asymptomatic
plants or from water (Table 2, Fig. 1). Phytophthora multivora
was the most frequently isolated species (40 % of all isolates)
and was recovered from all locations except GT (Fig. 1). It
was almost always recovered from the soil, except for three
isolates recovered from filtered water (Table 2). P. cinnamomi
(9.25 % of the isolates) was also recovered only from soil
in UM, PMB and MP (Table 2, Fig. 1). Of the other known
species, P. capensis (4.6 % of the isolates) was recovered
from soil at PMB, UM and ING and once from filtered water in
ING, P. cryptogea was recovered once from soil in ING and P.
cinnamomi var parvispora was recovered once from filtered
water in UMT (Table 2, Fig. 1).
Of the previously designated taxa, P. sp. emzansi (2.9 %
of the isolates) was recovered only from Ingeli forest, where it
was found in both soil and filtered water, P. sp. PgChlamydo
(5.2 % of the isolates) was recovered from ING, PMB and MP,
predominantly from water, but the isolate from MP was from
soil on a riverbank (Table 2, Fig. 1). An isolate with a 100 %
ITS sequence match to P. sp. Kununurra was recovered once
from soil in MP.
The remaining isolations, with the exception of the isolate
designated as P. sp. canthium from Umtamvuna, were of
previously undescribed taxa recovered from water either
through baiting or filtering (Table 2). Phytophthora sp. stellaris
(4 % of the isolates recovered from MP and PMB) and P. sp.
Umtamvuna (rarely recovered in UM), both represent novel
species residing in ITS Clade 9. Hybrid taxon P. sp. xWS (20
% of the isolates) was recovered from PMB and GT and P.
sp. xHennops was recovered from UMT, PMB and GT (Table
2, Fig. 1).
DISCUSSION
Fourteen Phytophthora taxa were isolated from soil and
water associated with asymptomatic vegetation in natural
ecosystems of South Africa. Six of the taxa were of the known
species, P. multivora, P. capensis, P. frigida, P. cinnamomi, P.
cinnamomi var. parvispora, and P. cryptogea, and three match
126 ima fUNGUS

Phytophthora diversity in South Africa
Table 2. Distribution of Phytophthora species across sampling substrates and locations.
Locality
Substrate
Phytophthora multivora
Phytophthora capensis
Phytophthora sp. emzansi
Phytophthora sp. xWS
Phytophthora sp. PgChlamydo
Phytophthora frigida
Phytophthora cinnamomi
Phytophthora cinnamomi var parvispora
Phytophthora cryptogea
Phytophthora sp. stellaris
Phytophthora sp. Kununurra
Phytophthora sp. Umtamvuna
Phytophthora sp. xHennops
Phytophthora sp. canthium
ARTICLE
Ingeli Forest (ING) Soil 21 5 2 1 1
Water bait 1
Water filter 2 1 3 3
Umtamvuna (UTM) Soil 15 1 12 1
Water filter 1 1 5
Pietermaritzburg (PMB) Soil 20 1 1 2 1
Water bait 11 1 1 1
Water filter 1 15 3 2 4
Western Cape (W C) Soil 5
Mpumulunga (MP) Soil 4 1 1 2 1
Water bait 2
Gauteng (GT) Water bait 8 3 4
previously informally designated taxa, P. sp. emzansi, P. sp.
PgChlamydo, P. sp. Kununurra. The remaining five taxa did
not correspond to any known species. Two of these taxa, found
exclusively from water sampling, are thought to be hybrids.
Phytophthora multivora is a species recently described
causing disease in natural ecosystems in Western Australia
where it has a wide distribution and host range and is a
pathogen of Eucalyptus spp., Banksia spp., and Agonis
flexuosa (Burgess et al. 2009, Scott et al. 2009). This species
was previously misidentified as P. citricola (Burgess et al.
2009) and in Western Australia it has a wider distribution
within natural ecosystems than P. cinnamomi (Burgess et
al. 2009, Scott et al. 2009). It is also the dominant species
in the urban environment on numerous hosts in Myrtaceae
and Proteaceae (Barber et al. 2012). The variability within
the coxI region led Scott et al. (2009) to hypothesize that
P. multivora was endemic to Western Australia. However,
similar variability was seen among isolates from South Africa
in this study. Additionally, P. multivora was routinely isolated
from the rhizosphere of non-symptomatic vegetation in South
Africa, while in Australia it is associated with dead or dying
vegetation. This is obviously an important species and further
studies should be undertaken to determine its origin.
Phytophthora capensis and P. sp. emzansi have been
recognized only recently from cultivated endemic plant species
in the Western Cape (Bezuidenhout et al. 2010). The recovery of
these species in other locations in South Africa shows they have
a wider distribution within the region and additional isolates of P.
sp. emanzsi will facilitate its formal description. Both species are
related to P. multivora, and their presence in soil from natural
forests where the vegetation was asymptomatic suggests they
are probably endemic in South Africa.
Phytophthora frigida was first recovered from diseased
roots or the rhizosphere of dying Eucalyptus in South Africa
(Maseko et al. 2007). This species was not highly pathogenic
to Eucalyptus when compared to P. cinnamomi, a known and
serious root pathogen of Eucalyptus in South Africa (Linde
et al. 1994). However, it may be a potential threat to other
plants in the native vegetation, plantations or in agriculture
due to the presence of inoculum in waterways. To date this
species has not been recovered elsewhere in the world and it
could be endemic to southern Africa. Interestingly, a recently
described species from Western Australia, P. elongata, highly
pathogenic to young Eucalytus marginata, is the closest
relative of P. frigida (Rea et al. 2010).
Since the first report of P. cinnamomi in South Africa
in 1933, this species has been the most widely studied
Phytophthora species in the country. It is also the most
destructive species in native vegetation of the Western Cape
Province and in forestry plantations and fruit orchards widely
distributed in South Africa (von Broembsen 1984a, 4b, Linde
et al. 1994). Thus, the isolation of P. cinnamomi in this study
was not surprising. Phytophtora cryptogea, although rarely
encountered in this study has also been commonly isolated in
volume 4 · no. 1
127

Oh et al.
ARTICLE
9a
9b
85
10 changes
100
100
99
9c
100
9d
10
100
87
75
2
6
78
99
7
8
Phytophthora plurivora CBS 124093 FJ665225
85 Phytophthora pini US10 FJ665235
Phytophthora citricola CBS 221.88 FJ237526
CBS 124094 FJ237521
97
CMW35841 HQ292669
CMW35217 KC855164
100
CMW35330 KC855165
CMW35268 KC855166
CMW35225 KC855167
CMW35271 KC855168
98
P1822 GU191219
CMW35265 KC855169
95 CMW35510 KC855170
CMW35264 KC855171
STEU 6269 GU191228
CMW33381 HQ292656
100
CMW33383 HQ292658
99
CMW19433 DQ988179
Phytophthora elongata CBS 125799 EU121961
Phytophthora gonapodyides CBS 113346 HQ643236
Phytophthora megasperma DDS3432 HQ012949
Phytophthora fluvialis CBS 129424 JF701436
Phytophthora amnicola VHS19503 JQ029958
91 allele 2 KC855177
97 Phytophthora amnicola VHS19503 KC855175
allele 1 KC855176
96
93
90
Phytophthora thermophila CBS 127954 EU301155
allele 3 KC855178
Phytophthora litoralis CBS 127953 HQ012948
100
CMW35276 KC855172
94 CMW35257 KC855173
CMW35278 KC855174
P510 AF541902
Phytophthora lacustris HSA1959 HQ012956
P2159 AY302164
100
CMW33384 HQ292650
99 CMW33385 HQ292660
100
100 CBS 41196 HQ643200
CMW35227 KC855179
Phytophthora cambivora P0592 GU259073
Phytophthora lateralis ATCC MYA-­‐3898 FJ196746
97
97 IMI045168 AF266796
100 CMW35262 KC855180
Phytophthora drechsleri SCRP232 AY659442
Phytophthora insolita P6195 HQ261591
CMW35288 KC855184
CMW35289 KC855185
69 CMW35288 KC855186
CMW35289 KC855187
Phytophthora polonica UASWS0198 DQ396410
95
97
Phytophthora lagoariana P8223 EF590256
Phytophthora sp. zentmyerii P8618 EU164426
98 EF437222
81 CMW33379 GU799655
CMW35233 KC855181
89
CMW33363 GU799640
100
CMW33364 GU799641
allele 1 KC855182
allele 2 KC855183
98
Phytophthora hydropathica ATCC MYA-­‐4461 FJ196761
Phytophthora hydropathica 5D1 EU583793
100 Phytophthora parsiana C25 AY659739
Phytophthora sp. thermophilum EF680321
Phytophthora aquimorbida 40A6 FJ666127
100
Phytophthora macrochlamydospora PNG1 KC855188
Phytophthora richardiae RICH-­‐P6875 AB367499
100
Phytophthora cap8osa NZFS310.35 DQ297405
Phytophthora constricta CBS125801 HQ013225
Phytophthora gallica P16826 GU983636
100
100
CMW35236 KC855189
100
83
Phytophthora morindae Ph701-­‐P07.05 GQ166766
Phytophthora kernoviae P10958 FJ801530
Phytophthora boehmeriae SCRP23 DQ297406
Phytophthora multivora
Phytophthora capensis
Phytophthora sp. emzansi
Phytophthora frigida
Phytophthora sp. xWS
Phytophthora sp. PgChlamydo
Phytophthora cinnamomi
Phytophthora cinnamomi var parvispora
Phytophthora cryptogea
Phytophthora sp. stellaris
Phytophthora sp. Kununurra
Phytophthora sp. Umtamvuna
Phytophthora sp. xHennops
Phytophthora sp. canthium
Fig. 2. A phylogram based on ITS sequence data indicating the placement of the 14 Phytophthora species recovered in this study in relation to
closely related taxa. Numbers in circles represent the Clade as designated by Cooke et al. (2000). Numbers above the branch represent the
bootstrap support based on parsimony analysis.
128 ima fUNGUS

Phytophthora diversity in South Africa
A
100
83
5 changes
62
70
78
Phytophthora amnicola CBS131652 JQ029948
100
Phytophthora amnicola VHS19503 JQ029950
CMW33367 GU799667
CMW33368 GU799668
CMW33369 GU799669
100
Phytophthora fluvialis CBS129424 JF701441
99
Phytophthora fluvialis VHS17350 JF701440
100
Phytophthora litoralis CBS127953 HQ012866
100
100
Phytophthora bilorbang CBS 161653 JQ256375
Phytophthora lacustris HSA1959 HQ012880
Phytophthora lacustris P245 AY564181
Phytophthora litoralis VHS17085 HQ012864
Phytophthora thermophila CBS127954 HQ012872
Phytophthora thermophila VHS16164 HQ012875
CMW33366 GU799666
CMW35290 KC855156
CMW35292 KC855158
CMW35315 KC855162
100
CMW35313 KC855160
CMW35316 KC855163
CMW35314 KC855161
CMW35291 KC855157
CMW35293 KC855159
68
CMW35277 KC855154
CMW35278 KC855154
65 Phytophthora sp. PgChlamydo VHS3753 HQ012878
Phytophthora sp. PgChlamydo VHS6595 HQ012879
Phytophthora sp. PgChlamydo IMI389731 JF935968
Phytophthora sp. PgChlamydo SLPA121 JN547652
Phytophthora sp. xWS
Phytophthora sp. xWS
Phytophthora sp. PgChlamydo
ARTICLE
B
79
5 changes
92
100
77
100
Phytophthora boehmeriae CBS291.29 AY564165
CMW35236 KC855134
95 Phytophthora quininea CBS407.48 AY564200
Phytophthora macrochlamydospora PNG1 KC855135
Phytophthora richardiae CBS 240.30 AY564201
Phytophthora aquimorbida 40A6 KC855136
Phytophthora irrigata 23J7 KC855137
87 Phytophthora parsiana Rf6 AY659760
Phytophthora parsiana HQ261386
97 CMW33379 HQ292671
CMW35228 KC855141
CMW35229 KC855142
CMW35282 KC855143
CMW35284 KC855144
CMW35283 KC855145
CMW35286 KC855146
CMW35230 KC855147
CMW35231 KC855148
85
CMW35232 KC855149
CMW33362 GU799662
CMW33363 GU799663
CMW33364 GU799664
CMW33365 GU799665
Phytophthora hydropathica 5D1 KC855138
Phytophthora hydropathica NDAR-­‐F KC855139
CMW35233 KC855150
100
Phytophthora insolita HQ261337
Phytophthora insolita IMI288805 AY564188
CMW33376 GU799670
CMW33378 GU799672
CMW35287 KC855151
100 CMW35288 KC855152
CMW35289 KC855153
CMW33377 GU799671
Phytophthora cap9osa CBS119107 KC855140
100
Phytophthora constricta VHS16127 HQ013106
Phytophthora constricta CBS125801 HQ013207
Phytophthora sp. canthium
Phytophthora sp. Kununurra
Phytophthora sp. xHennops
Phytophthora sp. Umtamvuna
Phytophthora sp. stellaris
Fig. 3. Phylograms based on coxI sequence data indicating the placement of undescribed Phytophthora taxa recovered in this study in relation
to closely related taxa in (A) Phytophthora Clade 6 and (B) Phytophthora Clade 9. Bootstrap support is given above the line. Numbers above the
branch represent the bootstrap support based on parsimony analysis.
volume 4 · no. 1
129

Oh et al.
ARTICLE
agricultural systems in South Africa (Crous et al. 2006, Nagel
et al. 2013a).
Phytophthora sp. PgChlamydo has been recovered from
stream water, soil, dying plants in many parts of the world
including countries of Europe, North and South America,
Australia and South Africa (Brasier et al. 2003, Greslebin
et al. 2005, Burgess et al. 2009, Reeser et al. 2011, Nagel
et al. 2013b, Hüberli et al. 2013). It is morphologically very
similar to P. gonapodyides and differs only in its production
of chlamydospores. Both species are frequently present in
waterways and it is considered a weak pathogen and litter
decomposer (Brasier et al. 2003, Jung et al. 2011).
Phytophthora sp. xWS differs from all known species
or designated taxa in ITS Clade 6 (Jung et al. 2011).
Polymorphism is observed in the ITS sequence data and two
separate coxI alleles are obtained, one of which corresponds
to P. thermophila and the other corresponds to P. amnicola;
both these species have been described recently from
Western Australia (Jung et al. 2011, Crous et al. 2012).
Phytophthora sp. xWS appears to match a stable hybrid
recently characterized from both Australia and South Africa
(Hüberli et al. 2013, Nagel et al. 2013b).
One isolate designated as P. sp. canthium was recovered
from soil in Umtamvuna Nature Reserve. This isolate is
interesting because, based on ITS and cox1 sequence data,
it resides in Clade 10. This is a sparsely populated Clade,
basal to the Phytophthora phylogeny, presently comprising
of only four species, P. morindae, P. kernoviae, P. gallica,
and P. boehmeriae. Phytophthora boehmeriae is a species
with a global distribution, including South Africa (Roux &
Wingfield 1997). The other species in this Clade have a
limited geographic distribution, with P. kernoviae being an
invasive and damaging pathogen on ornamental and wild
plant species in the UK (Brasier et al. 2005).
Four undescribed taxa found in this study reside in ITS
Clade 9; one is an exact match for P. sp. Kunnunara, P. sp
Umtamvuna is closely related to P. hydropathica and P. sp.
stellaris resides in the sub-clade containing P. insolata and P.
polonica. The remaining taxon, P. sp. xHennops, appears to be
a hybrid; it has two ITS alleles, one of which is an exact match
for the type isolate of P. hydropathica. There are also two alleles
of the coxI among isolates of P. sp. xHennops (i.e. each isolate
only has one coxI allele but was designated as P. sp. xHennops
based on having two distinct ITS alleles), one is identical to P.
hydropathica, the other to P. sp. Kununurra. Several species
belonging to ITS Clade 9 have recently been described from
irrigation water (Hong et al. 2008, Hong et al. 2010), however,
the pathogenicity of those species is unknown and, like many
Clade 6 Phytophthoras, they may be saprophytes of green litter
(Brasier et al. 2003, Jung et al. 2011).
Phytophthora sp. stellaris has a single coxI allele, but two
ITS alleles. Similarly, P. amnicola returned single alleles for
five gene regions, while two ITS alleles, differing by a single
indel of 5bp, were obtained (Crous et al. 2012). For P. sp.
stellaris, an indel in the ITS allele of some isolates of P. sp.
stellaris precluded direct sequencing, however the alleles
differed by only by 3–5b p and we consider this to represent
intraspecific variation.
This study has contributed considerably to the knowledge
of Phytophthora species associated with natural vegetation
in South Africa. Given that the relatively few locations
considered resulted in a large number of undescribed taxa,
additional surveys will undoubtedly reveal an even more
substantial Phytophthora biodiversity in South Africa.
ACKNOWLEDGEMENTS
We are grateful to the Department of Science and Technology (DST)/
National Science Foundation (NRF) Centre of Excellence in Tree
Health Biotechnology (CTHB) for financial assistance to undertake this
study. We also acknowledge support from the University of Pretoria
that provided a post-doctoral fellowship for E. O. Various students
and colleagues provided technical support, particular regarding the
collections of samples and we specially acknowledge Jan Nagel and
Hugh Glen in this regard. We kindly thank Chuan Hong and Patricia
Richardson for providing coxI sequence data for several Phytophthora
aquimorbida, P. hydropathica, P. irrigate, and P. parsiana.
REFERENCES
Barber P, Burgess TI, Paap T, Hardy GESJ (2012) Phytophthora
species associated with disease in peri-urban woodland and
forest ecosystems. In: 6th International Meeting IUFRO Working
Party 7.02.09. Phytophthora in Forests and Natural Ecosystems,
9–14th September Cordoba, Spain: 84.
Bezuidenhout CM, Denman S, Kirk SA, Botha WJ, Mostert L,
McLeod A (2010) Phytophthora taxa associated with cultivated
Agathosma, with emphasis on the P. citricola complex and P.
capensis sp. nov. Persoonia 25: 32–49.
Brasier CM, Beales PA, Kirk SA, Denman S, Rose J (2005)
Phytophthora kernoviae sp. nov., an invasive pathogen causing
bleeding stem lesions on forest trees and foliar necrosis of
ornamentals in the UK. Mycological Research 109: 835–859.
Brasier CM, Cooke DEL, Duncan JM, Hansen EM (2003) Multiple
new phenotypic taxa from trees and riparian ecosystems in
Phytophthora gonapodyides–P. megasperma ITS Clade 6, which
tend to be high-temperature tolerant and either inbreeding or
sterile. Mycological Research 107: 277–290.
Bumbieris M (1976) The role of Phytophthora cryptogea and
waterlogging in a decline of Pinus radiata. Australian Journal of
Botany 24: 703–709.
Burgess TI, Wingfield MJ (2001) Exotic pine forestry in the Southern
Hemisphere: a brief history of establishment and quarantine
practices. South African Forestry Journal 192: 79–84.
Burgess TI, Webster JL, Ciampini JA, White DW, Hardy GESJ, Stukely
MJC (2009) Re-evaluation of Phytophthora species isolated
during 30 years of vegetation health surveys in Western Australia
using molecular techniques. Plant Disease 93: 215–223.
Cooke DEL, Drenth A, Duncan JM, Wagels G, Brasier CM (2000)
A molecular phylogeny of Phytophthora and related oomycetes.
Fungal Genetics and Biology 30: 17–32.
Cooke DEL, Duncan JM (1997) Phylogenetic analysis of Phytophthora
species based on ITS1 and ITS2 sequences of the ribosomal
RNA gene repeat. Mycological Research 101: 667–677.
Crous PW, Summerell BA, Shivas RG, Burgess TI, Decock CA, Dreyer
LL, Granke LL, Guest DI, Hardy GESJ, Hausbeck MK, Hüberli D,
Jung T, Koukol O, Lennox CL, Liew ECY, Lombard L, McTaggart
AR, Pryke JS, Roets F, Saude C, Shuttleworth LA, Stukely MJC,
130 ima fUNGUS

Phytophthora diversity in South Africa
Vánky K, Webster BJ, Windstam ST, Groenewald JZ (2012) Fungal
Planet description sheets: 107–127. Persoonia 28: 138–182.
Crous PW, Phillips AJL, Baxter AP (2000) Phytopathogenic Fungi
from South Africa. Stellenbosch: University of Stellenbosch
Printers.
Crous PW, Rong IH, Wood A, Lee S, Glen H, Botha WJ, Slippers B,
de Beer WZ, Wingfield MJ, Hawksworth DL (2006) How many
species of fungi are there at the tip of Africa? Studies in Mycology
55: 13–33.
Greslebin AG, Hansen EM, Winton LM, Rajchenberg M (2005)
Phytophthora species from declining Austrocedrus chilensis
forests in Patagonia, Argentina. Mycologia 97: 218–228.
Grundy I, Wynberg R (2001) Integration of biodiversity into
national forest planning programmes: the case of South Africa.
International Workshop of Integration of Biodiversity into National
Forest Planning Programmes. CIFOR Headquarters, Bogor,
Indonesia, 13–16 August, 2001: 1–34.
Hong C, Gallegly ME, Richardson PA, Kong P, Moorman GW (2008)
Phytophthora irrigata, a new species isolated from irrigation
reservoirs and rivers in eastern United States of America. FEMS
Microbiology Letters 285: 203–211.
Hong C, Gallegly ME, Richardson PA, Kong P, Moorman GW,
Lea-Cox JD, Ross DS (2010) Phytophthora hydropathica, a
new pathogen identified from irrigation water, Rhododendron
catawbiense and Kalmia latifolia. Plant Pathology 59: 913–921.
Hüberli D, Hardy GES, White D, Williams N, Burgess TI (2013)
Fishing for Phytophthora from Western Australia’s waterways:
A distribution and diversity survey. Australasian Plant Pathology
42: 251–260.
Hüberli D, Tommerup IC, Hardy GES (2000) False-negative isolations
or absence of lesions may cause mis-diagnosis of diseased
plants infected with Phytophthora cinnamomi. Australasian Plant
Pathology 29: 164–169.
Jung T, Stukely MJC, Hardy GES, White D, Paap T, Dunstan WA,
Burgess TI (2011) Multiple new Phytophthora species from
ITS clade 6 associated with natural ecosystems in Australia:
evolutionary and ecological implications. Persoonia 26: 13–39.
Knox-Davies PS (1975) Decline of silver trees and other indigenous
species. Veld and Flora 61: 20–22.
Linde C, Kemp GHJ, Wingfield MJ (1994) Pythium and Phytophthora
species associated with eucalypts and pines in South Africa.
European Journal of Forest Pathology 24: 345–356.
Marincowitz S, Crous PW, Groenewald JZ, Wingfield MJ (2008)
Microfungi occurring on the Proteaceae in the Fynbos. [CBS
Biodiversity Series no. 7.] Utrecht: CBS-KNAW Fungal
Biodiversity Centre.
Martin FN, Tooley PW (2003) Phylogenetic relationships among
Phytophthora species inferred from sequence analysis of
mitochondrially encoded cytochrome oxidase I and II genes.
Mycologia 95: 269–284.
Maseko B, Burgess TI, Coutinho T, Wingfield MJ (2001) First report
of Phytophthora nicotianae associated with Eucalyptus die-back
in South Africa. Plant Pathology 50: 413.
Maseko B, Coutinho TA, Burgess TI, Wingfield BD, Wingfield MJ
(2007) Two new species of Phytophthora from South African
eucalypt plantations. Mycological Research 111: 1321–1338.
Nagel JH, Gryzenhout M, Slippers B, Wingfield MJ (2013a) The
occurrence and impact of Phytophthora on the African continent.
In: Phytophthora Diseases: a global perspective (Lamour K, ed.):
pp. 204–214. Wallingford: CAB International.
Nagel JH, Gryzenhout M, Slippers B, Wingfield MJ, Hardy
GESJ, Stukely MJC, Burgess TI (2013b) Characterization of
Phytophthora hybrids 1 from ITS clade 6 associated with riparian
ecosystems in South Africa and Australia. Fungal Biology:
10.1016/j.funbio.2013.1003.1004
Oudemans PV, Förster H, Coffey MD (1994) Evidence for distinct
isozyme subgroups within Phytophthora citricola and close
relationships with P. capsici and P. citrophthora. Mycological
Research 98: 189–199.
Posada D (2008) jModelTest: phylogenetic model averaging.
Molecular Biology and Evolution 25: 1253–1256.
Rea A, Jung T, Burgess TI, Stukely MJC, Hardy GESJ (2010)
Phytophthora elongata sp. nov. a novel pathogen from the
Eucalyptus marginata forest of Western Australia. Australasian
Plant Pathology 39: 477–491.
Reeser PW, Sutton W, Hansen EM, Remigi P, Adams GC (2011)
Phytophthora species in forest streams in Oregon and Alaska.
Mycologia 103: 22–35.
Robideau GP, de Cock AWAM, Coffey MD, Voglmayr H, Brouwer
H, Bala K, Chitty DW, Désaulniers N, Eggertson QA, Gachon
CMM, Hu C-H, Küpper FC, Rintoul TL, Sarhan E, Verstappen
ECP, Zhang Y, Bonants PJM, Ristaino JB, Lévesque CA (2011)
DNA barcoding of oomycetes with cytochrome c oxidase subunit
I and internal transcribed spacer. Molecular Ecology Resources
11: 1002–1011.
Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian
phylogenetic inference under mixed models. Bioinformatics 19:
1572–1574.
Roux J, Wingfield MJ (1997) Survey and virulence of fungi occurring
on diseased Acacia mearnsii in South Africa. Forest Ecology and
Management 99: 327–336.
Scott PM, Burgess TI, Barber PA, Shearer BL, Stukely MJC, Hardy
GESJ, Jung T (2009) Phytophthora multivora sp. nov., a new
species recovered from declining Eucalyptus, Banksia, Agonis
and other plant species in Western Australia. Persoonia 22: 1–13.
von Broembsen S (1984a) Distribution of Phytophthora cinnamomi
in rivers of the southwestern Cape province. Phytophylactica 16:
227–229.
von Broembsen S (1984b) Occurrence of Phytophthora cinnamomi
on indigenous and exotic hosts in South Africa, with special
reference to the southwestern Cape Province. Phytophylactica
16: 221–225.
Von Broembsen SL, Kruger FJ (1985) Phytophthora cinnamomi
associated with mortality of native vegetation in South Africa.
Plant Disease 69: 715–717.
White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics. In:
PCR Protocols: a guide to methods and applications (MA Innes,
DH Gelfand, JJ Sninsky, TJ White (eds): 315–322. San Diego:
Academic Press.
Wingfield MJ, Knox-Davies PS (1980) Observations on diseases in
pine and eucalyptus plantations in South Africa. Phytophylactica
12: 57–63.
Winton LM, Hansen EM (2001) Molecular diagnosis of Phytophthora
lateralis in trees, water, and foliage baits using multiplex
polymerase chain reaction. Forest Pathology 31: 275–283.
Zeijlemaker FCJ (1971) Black-butt disease of black wattle caused
by Phytophthora nicotianae var. parasitica. Phytopathology 61:
144–145.
ARTICLE
volume 4 · no. 1
131

ARTICLE
ima fUNGUS

doi:10.5598/imafungus.2013.04.01.13
IMA Fungus · volume 4 · no 1: 133–154
A phylogenetic re-evaluation of Arthrinium
Pedro W. Crous 1, 2, 3 , and Johannes Z. Groenewald 1
1
CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands; corresponding author e-mail: p.crous@cbs.knaw.nl
2
Microbiology, Department of Biology, Utrecht University, Padualaan 8, 3584 CH Utrecht, The Netherlands
3
Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, The
Netherlands
ARTICLE
Abstract: Although the genus Arthrinium (sexual morph Apiospora) is commonly isolated as an endophyte from a
range of substrates, and is extremely interesting for the pharmaceutical industry, its molecular phylogeny has never
been resolved. Based on morphology and DNA sequence data of the large subunit nuclear ribosomal RNA gene (LSU,
28S) and the internal transcribed spacers (ITS) and 5.8S rRNA gene of the nrDNA operon, the genus Arthrinium is
shown to belong to Apiosporaceae in Xylariales. Arthrinium is morphologically and phylogenetically circumscribed, and
the sexual genus Apiospora treated as synonym on the basis that Arthinium is older, more commonly encountered,
and more frequently used in literature. An epitype is designated for Arthrinium pterospermum, and several well-known
species are redefined based on their morphology and sequence data of the translation elongation factor 1-alpha
(TEF), beta-tubulin (TUB) and internal transcribed spacer (ITS1, 5.8S, ITS2) gene regions. Newly described are A.
hydei on Bambusa tuldoides from Hong Kong, A. kogelbergense on dead culms of Restionaceae from South Africa, A.
malaysianum on Macaranga hullettii from Malaysia, A. ovatum on Arundinaria hindsii from Hong Kong, A. phragmites
on Phragmites australis from Italy, A. pseudospegazzinii on Macaranga hullettii from Malaysia, A. pseudosinense on
bamboo from The Netherlands, and A. xenocordella from soil in Zimbabwe. Furthermore, the genera Pteroconium and
Cordella are also reduced to synonymy, rejecting spore shape and the presence of setae as characters of generic
significance separating them from Arthrinium.
Key words:
Apiospora
Apiosporaceae
ITS
LSU
Ascomycota
Sordariomycetes
Systematics
Article info: Submitted: 15 May 2013; Accepted: 4 June 2013; Published: 24 June 2013.
Introduction
The genus Arthrinium (sexual morph Apiospora; Ellis 1971,
Seifert et al. 2011) is widespread and ecologically diverse.
It commonly occurs as a saprobe on grasses, and also on
leaves, stems and roots of a range of different plant substrates
(Agut & Calvo 2004). Arthrinium is ecologically diverse, and
has been reported as a plant pathogen, with A. arundinis
causing kernel blight of barley (Martínez-Cano et al. 1992),
and A. sacchari causing damping-off of wheat (Mavragani
et al. 2007). It is reported as an endophyte in plant tissue
(Ramos et al. 2010), lichens (He & Zhang 2012), and marine
algae (Suryanarayanan 2012). Arthrinium phaeospermum
causes cutaneous infections of humans (Rai 1989, Zhao et
al. 1990, de Hoog et al. 2000).
Isolates of Arthrinium produce a range of interesting
extrolites in culture, some of which exhibit significant toxicity
against human cancer cell lines (Klemke et al. 2003), or
inhibit a broad range of human pathogenic filamentous fungi,
yeasts, and bacteria (Cabello et al. 2001, Ramos et al. 2010).
An endophytic isolate of A. phaeospermum produces growthpromoting
substances in Carex kobomugi, a plant surviving
under extreme conditions on sand dunes in Korea (Khan et
al. 2009).
The genus Arthrinium was described in 1817 and has
numerous generic synonyms (Seifert et al. 2011). One
such generic name with uncertain status is Pteroconium,
introduced in 1892, which Ellis (1971, 1976) and Seifert et
al. (2011) retained as separate from Arthrinium, in spite of
its Apiospora sexual morph. Cordella is another potential
synonym of Arthrinium, distinguished chiefly by possessing
setae. During this study several interesting isolates were
collected, including ones of P. pterospermum, the type
species of Pteroconium. The decision to move to a single
nomenclature is explained elsewhere (Hawksworth et al.
2011, Wingfield et al. 2012), and adopted here in accordance
with the current Code. Although both genera (Arthrinium and
Apiospora) have a similar number of species, Arthrinium is
older and more commonly encountered and referred to in
the literature than Apiospora introduced in 1875. Following
the principles advocated by Hawksworth (2012) for dealing
with names in the present period of transition, we propose
that in future Arthrinium be used when referring to these
taxa. No in-depth phylogenetic analysis has thus far been
published on Arthrinium, which is placed in Apiosporaceae
(Sordariomycetes) (Hyde et al. 1998, Lumbsch & Huhndorf
2010). The aims of the present study were to resolve the
potential synonymy of Arthrinium, Cordella, and Pteroconium,
© 2013 International Mycological Association
You are free to share - to copy, distribute and transmit the work, under the following conditions:
Attribution:
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).
Non-commercial: You may not use this work for commercial purposes.
No derivative works: You may not alter, transform, or build upon this work.
For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get
permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.
volume 4 · no. 1
133

Crous & Groenewald
ARTICLE
elucidate the higher classification and phylogeny of
Apiosporaceae, and at the same time provide a more robust
tree for species of Arthrinium.
Materials and methods
Isolates
Fresh collections were made from debris of diverse hosts by
placing material in damp chambers for 1–2 d. Single conidial
colonies were established from sporulating conidiomata on
Petri dishes containing 2 % malt extract agar (MEA; Crous
et al. 1991, 2009b). Additional strains were obtained from
the culture collection of the CBS-KNAW Fungal Biodiversity
Centre (CBS) Utrecht, The Netherlands. Colonies were
subcultured onto potato-dextrose agar (PDA), oatmeal agar
(OA), MEA (Crous et al. 2009b), and pine needle agar (PNA)
(Smith et al. 1996), and incubated at 25 °C under continuous
near-ultraviolet light to promote sporulation. Reference
strains are deposited in CBS.
DNA isolation, amplification and analyses
Genomic DNA was extracted from fungal colonies growing
on MEA using the UltraClean TM Microbial DNA Isolation Kit
(MoBio Laboratories, Solana Beach, CA, USA) according
to the manufacturer’s protocol. The primers V9G (de Hoog
& Gerrits van den Ende 1998) and LR5 (Vilgalys & Hester
1990) were used to amplify the nuclear rDNA operon
spanning the 3’ end of the 18S rRNA gene, the first internal
transcribed spacer (ITS1), the 5.8S rRNA gene, the
second ITS region and the 5’ end of the 28S rRNA gene.
The primers ITS4 (White et al. 1990) and LSU1Fd (Crous
et al. 2009a) were used as internal sequence primers to
ensure good quality sequences over the entire length
of the amplicon. Part of the translation elongation factor
1-alpha (TEF) was amplified and sequenced using primers
EF1-728F (Carbone & Kohn 1999) and EF-2 (O’Donnell et
al. 1998), while T1 (O’Donnell & Cigelnik 1997) and Bt-2b
(Glass & Donaldson 1995) were used for the beta-tubulin
gene region (TUB). Amplification conditions for ITS, LSU
and TEF followed Crous et al. (2013) and for TUB, Lee
et al. (2004). Megablast searches (Altschul et al. 1997)
using the ITS and LSU sequences were performed in
NCBI’s GenBank nucleotide sequence database to identify
the closest matching sequences, which were added to
the sequence alignment. The sequence alignment and
subsequent phylogenetic analyses for all the above were
carried out using the methods in Crous et al. (2006). Gaps
longer than 10 bases were coded as single events for the
phylogenetic analyses (only for ITS and TEF; see alignment
in TreeBASE: ID 14349); the remaining gaps were treated
as “fifth state” data in the parsimony analyses. For the
LSU alignment, MrModeltest v. 2.2 (Nylander 2004) was
used to determine the best nucleotide substitution model
settings prior to the Bayesian analysis in MrBayes v. 3.2.1
(Ronquist et al. 2012). Sequences derived in this study
were lodged at GenBank, the alignments and trees in
TreeBASE (www.treebase.org/treebase/index.html), and
taxonomic novelties in MycoBank (www.MycoBank.org;
Crous et al. 2004).
Morphology
Observations were made with a Zeiss V20 Discovery stereomicroscope,
and with a Zeiss Axio Imager 2 light microscope
using differential interference contrast (DIC) illumination and
an AxioCam MRc5 camera and software. Measurements and
photographs were made from structures mounted in clear
lactic acid. The 95 % confidence intervals were derived from
30 observations (× 1000 magnification), with the extremes
given in parentheses. Ranges of the dimensions of other
characters are given. Colony characters and pigment
production were noted after 2 wk of growth on MEA, PDA and
OA (Crous et al. 2009b) incubated at 25 ºC. Colony colours
(surface and reverse) were rated according to the colour
charts of Rayner (1970). Morphological descriptions were
based on cultures sporulating on PDA.
RESULTS
Phylogeny
Amplicons of approximately 1700 bases were obtained of the
partial 18S rRNA, full length ITS and partial 28S rRNA (LSU)
genes for the isolates in Table 1, and approximately 750 bp
and 450 bp for TUB and TEF, respectively. The LSU alignment
was used to resolve the generic placement of strains (Fig.
1) and the ITS to determine species identification (Fig. 2;
discussed in species notes where applicable). The combined
TEF and TUB alignment (Fig. 3) was used to confirm
the species resolution of ITS and that no cryptic species
complexes were present. As each alignment addressed a
specific research question (LSU: genera, ITS: species as
the standard barcode region, and TEF and TUB to resolve
species complexes, if any), a combined tree based on all
four loci was not generated. In addition, such a combined
tree would be based on an alignment which includes some
missing sequences and would, therefore, not be as robust as
the phylogenetic trees presented in Figs 1–3.
The manually adjusted LSU alignment contained 80
sequences (including the outgroup sequence), and 791
characters including alignment gaps (available in TreeBASE)
were used in the phylogenetic analysis; the data partition
contained 199 unique site patterns. Based on the results
of MrModeltest, the following priors were set in MrBayes:
dirichlet base frequencies and the GTR+I+G model with
inverse gamma-distributed. The Bayesian analysis lasted
2 655 000 generations and the 50 % consensus trees and
posterior probabilities were calculated from the 3984 trees left
after discarding 1328 trees (the first 25 % of generations) for
burn-in (Fig. 1). All Apiospora and Arthrinium strains clustered
in a well-supported clade indicated in Fig. 1 as the family
Apiosporaceae.
The manually adjusted ITS alignment contained 72
sequences (including the outgroup sequence), and 514
characters including alignment gaps (available in TreeBASE)
were used in the phylogenetic analysis. Of these characters,
157 were parsimony-informative, 51 variable and parsimonyuninformative,
and 306 constant. The parsimony analysis
of the ITS alignment yielded 72 equally most parsimonious
trees (TL = 552 steps; CI = 0.621; RI = 0.938; RC = 0.583).
Some species, e.g. A. marii and A. sacchari, are not well-
134 ima fUNGUS

Re-evaluation of Arthrinium (syn. Apiospora)
supported in the ITS phylogeny (Fig. 2), but well-supported in
the combined TUB and TEF phylogeny (Fig. 3).
The manually adjusted combined TUB and TEF alignment
contained 39 sequences (including the outgroup sequence)
and 1288 characters including alignment gaps (available
in TreeBASE) were used in the phylogenetic analysis; 565
of these were parsimony-informative, 51 were variable
and parsimony-uninformative, and 486 were constant. The
parsimony analysis of the ITS alignment yielded four equally
most parsimonious trees (TL = 2003 steps; CI = 0.703; RI =
0.875; RC = 0.616). All included species were well-supported
in the combined TUB and TEF phylogeny (Fig. 3).
Taxonomy
The species treated below are those that were available in
culture. Several other names exist, but these await to be
recollected and subjected to DNA analysis.
Apiosporaceae K. D. Hyde et al., Sydowia 50: 23
(1998).
Description: Conidiophores frequently arising from hyphae or
aggregated in a brown stroma, forming black sporodochia,
brown to dark brown, forming conidia laterally and terminally.
Setae present or absent, brown, smooth, erect, sparsely
septate, intermingled among conidiophores. Conidiogenous
cells discrete, doliiform to ampulliform to subcylindrical,
subhyaline to pale brown, smooth to finely verruculose,
aggregated on aerial hyphae, giving rise to clusters of conidia;
at times reduced to lateral pegs on hyphae, proliferating
sympodially or percurrently. Conidia aseptate, brown to
dark brown, smooth to verruculose, guttulate to granular,
frequently with equatorial slit of lighter pigment. Stromata
immersed in epidermis, becoming erumpent through a
longitudinal split, revealing rows of densely arranged
perithecial ascomata. Paraphyses broadly filiform, septate,
deliquescing early. Ascomata globose with papillate ostioles;
wall composed of multiple layers of pseudoparenchymatous
cells. Asci 8-spored, unitunicate, clavate to broadly cylindrical.
Ascospores bi- to tri-seriate, ellipsoidal, inequilateral, tapered
at both ends, apiosporous, 1-septate near the lower end,
smooth, hyaline, with or without mucoid sheath.
Cordella Speg., Anales Soc. Ci. Argent. 22: 210 (1886).
Type species: C. coniosporioides Speg. 1886
Pteroconium Sacc., Syll. Fung. 10: 570 (1892).
Type species: P. pterospermum (Cooke & Massee) Grove
1914
Additional synonyms are listed in Ellis (1965) and Seifert et
al. (2011).
Description: Colonies compact, black to dark brown,
superficial to erumpent. Mycelium immersed and
superficial. Conidiophores arising from basal cells that are
subcylindrical, subhyaline with refractive, thick transverse
septa, brown to dark brown, forming conidia laterally
and terminally; conidiophores frequently aggregated in a
brown stroma, forming black sporodochia on the host and
in culture. Setae present or absent, brown, smooth, erect,
sparsely septate, tapering to subcute apex, intermingled
among conidiophores. Conidiogenous cells discrete,
doliiform to ampulliform to subcylindrical, subhyaline to
pale brown, smooth to finely verruculose, aggregated
on aerial hyphae, giving rise to clusters of conidia; at
times reduced to lateral pegs on hyphae, holoblastic,
proliferating sympodially (at times clearly phialidic with
periclinal thickening, rarely with percurrent proliferation).
Conidia aseptate, brown to dark brown, smooth to
verruculose, guttulate to granular, with distinctive shape
(round, curved, curved with two horns, oblong, irregular,
limoniform, fusiform, navicular, dentate or lobed), at
times flattened, with equatorial slit of lighter pigment.
Sterile cells when formed replace conidia, usually smaller
and paler than conidia, with different shape, frequently
containing refractive cubical bodies. Stromata immersed in
epidermis, becoming erumpent through a longitudinal split,
revealing rows of densely arranged perithecial ascomata.
Ascomata globose with papillate ostioles; wall composed
of 6–9 layers of pseudoparenchymatous cells. Paraphyses
broadly filiform, septate, deliquescing early. Asci 8-spored,
unitunicate (appearing bitunicate when young), clavate
to broadly cylindrical. Ascospores smooth, hyaline, bi- to
tri-seriate, ellipsoidal, inequilateral, tapered at both ends,
apiosporous, 1-septate near the lower end, with the lower,
smaller cell subglobose; ascospores with our without mucoid
sheath.
ARTICLE
Type genus: Apiospora Sacc. 1875 (syn. Arthrinium Kunze
1817).
Note: Based on morphology, Hyde et al. (1998) regarded
Dictyoarthrinium, Endocalyx, Scyphospora and Spegazzinia
as possible members of this family, though this remains to be
confirmed, pending molecular studies.
Arthrinium Kunze, in Kunze & Schmidt, Mykol. Hefte
1: 9 (1817) : Fr., Syst. Mycol. 1: xliv (1821).
Type species: A. caricicola Kunze & J.C. Schmidt 1817
Synonyms: Apiospora Sacc., Atti Soc. Veneto-Trent. Sci.
Nat., Padova 4: 85 (1875).
Type species: A. montagnei Sacc. 1875
Notes: The conidiogenesis of Arthrinium species is of particular
interest. Conidiogenous cells are generally aggregated on a
pale brown stroma, forming sporodochia. They tend to be
doliiform to subcylindrical, pale brown, with clear periclinal
thickening, as illustrated in Ellis (1965). Given moist
conditions, they develop further and become ampulliform,
with a promonent, elongated neck. The neck can give rise to
conidia either sympodially (appearing as holoblastic loci), or
in some cases percurrently, with annelations aggregated at
the apex. This variation in conidiogenesis makes it difficult to
compare these characters among taxa, as conidiophores can
either be hyphae with lateral loci, or be reduced to doliiform
conidiogenous cells that can be seen to develop further (or
not), and are frequently aggregated in sporodochia. Conidia
themselves, however, do not appear to differ between those
volume 4 · no. 1
135

Crous & Groenewald
ARTICLE
Table 1. Details of strains included in the phylogenetic analyses.
Species Strain
Substrate of isolation Origin Collector GenBank accession numbers 3
accession
number 1,2 ITS LSU TUB TEF
Arthrinium arundinis CBS 106.12 — Germany: Bromberg E. Schaffnit KF144883 KF144927 KF144973 KF145015
CBS 114316 Leaf of Hordeum vulgare Iran: Shabestar B. Askari KF144884 KF144928 KF144974 KF145016
CBS 124788 Living leaves of Fagus sylvatica Switzerland: Basel M. Unterseher KF144885 KF144929 KF144975 KF145017
CBS 133509
= NRRL 13883
Aspergillus flavus sclerotium buried
in sandy field
USA: Kilbourne — KF144886 KF144930 KF144976 KF145018
CBS 449.92 Culm of cultivated Sasa Canada: Vancouver R.J. Bandoni KF144887 KF144931 KF144977 KF145019
CBS 450.92 Stem of cultivated bamboo Canada: Vancouver R.J. & A.A. Bandoni AB220259 KF144932 KF144978 KF145020
CBS 464.83 Dead culms of Phragmites australis The Netherlands: Harderbos W. Gams KF144888 KF144933 KF144979 KF145021
CBS 732.71 Dung India B.C. Lodha KF144889 KF144934 KF144980 KF145022
Arthrinium aureum CBS 244.83 ET Air Spain: Barcelona A. Calvo & J. Guarro AB220251 KF144935 KF144981 KF145023
Arthrinium hydei CBS 114990 ET Culms of Bambusa tuldoides Hong Kong: Tai Po Kau K.D. Hyde KF144890 KF144936 KF144982 KF145024
Arthrinium kogelbergense CBS 113332 Dead culms of Cannomois virgata South Africa S. Lee KF144891 KF144937 KF144983 KF145025
CBS 113333 ET Dead culms of Restionaceae South Africa S. Lee KF144892 KF144938 KF144984 KF145026
CBS 113335 Dead culms of Restio quadratus South Africa S. Lee KF144893 KF144939 KF144985 KF145027
CBS 114734
= UPSC 3251
Juncus gerardi Sweden: Börstil par. K. & L. Holm KF144894 KF144940 KF144986 KF145028
CBS 117206 Unknown algae Croatia E. Eguereva KF144895 KF144941 KF144987 KF145029
Arthrinium malaysianum CBS 102053 ET Macaranga hullettii stem colonised
by ants
Malaysia: Gombak W. Federle KF144896 KF144942 KF144988 KF145030
CBS 251.29 Stembase of Cinnamomum
camphora
— — KF144897 KF144943 KF144989 KF145031
Arthrinium marii CBS 113535 Oats Sweden C. Svenson KF144898 KF144944 KF144990 KF145032
CBS 114803
= HKUCC 3143
Culm of Arundinaria hindsi Hong Kong: Lung Fu Shan K.D. Hyde KF144899 KF144945 KF144991 KF145033
CBS 200.57 Leaf of Beta vulgaris The Netherlands Unknown KF144900 KF144946 KF144992 KF145034
CBS 497.90 ET =
MUCL 31300
Beach sand Spain: Barcelona J.V. Larrondo &
A. Calvo
AB220252 KF144947 KF144993 KF145035
CPC 18902 Stems of Phragmites australis Italy: Bomarzo W. Gams KF144901 KF144948 — —
CPC 18904 Stems of Phragmites australis Italy: Bomarzo W. Gams KF144902 KF144949 KF144994 KF145036
Arthrinium ovatum CBS 115042 ET Arundinaria hindsii Hong Kong K.D. Hyde KF144903 KF144950 KF144995 KF145037
Arthrinium phaeospermum CBS 114314 Leaf of Hordeum vulgare Iran: Marand B. Askari KF144904 KF144951 KF144996 KF145038
CBS 114315 Leaf of Hordeum vulgare Iran: Shabestar B. Askari KF144905 KF144952 KF144997 KF145039
CBS 114317 Leaf of Hordeum vulgare Iran: Marand B. Askari KF144906 KF144953 KF144998 KF145040
CBS 114318 Leaf of Hordeum vulgare Iran: Marand B. Askari KF144907 KF144954 KF144999 KF145041
136 ima fUNGUS

Re-evaluation of Arthrinium (syn. Apiospora)
Table 1. (Continued).
Species
Strain
accession Substrate of isolation Origin Collector GenBank accession numbers 3
number 1,2
ITS LSU TUB TEF
CBS 142.55 Soil Japan: Tiba prefecture K. Tubaki KF144908 KF144955 KF145000 KF145042
Arthrinium phragmites CPC 18900 Culms of Phragmites australis Italy: Bomarzo W. Gams KF144909 KF144956 KF145001 KF145043
= CBS 135458 ET
Arthrinium pseudosinense CPC 21546 Leaf of bamboo The Netherlands: Utrecht U. Damm KF144910 KF144957 — KF145044
= CBS 135459 ET
Arthrinium
pseudospegazzinii
CBS 102052 ET Macaranga hullettii stem colonised
by ants
Malaysia: Gombak W. Federle KF144911 KF144958 KF145002 KF145045
Arthrinium pterospermum CBS 123185
= CPC 15380
Leaf lesion of Machaerina sinclairii New Zealand: Auckland C.F. Hill KF144912 KF144959 KF145003 —
CPC 20193 Leaf of Lepidosperma gladiatum Australia: Adelaide W. Quaedvlieg KF144913 KF144960 KF145004 KF145046
= CBS 134000 EE
Arthrinium rasikravindrii CBS 337.61
= MUCL 8428
Cissus The Netherlands H.A. van der Aa KF144914 KF144961 — —
CPC 21602 Rice Thailand P.W. Crous KF144915 — — —
Arthrinium sacchari CBS 212.30 Phragmites australis United Kingdom: Cambridge E.W. Mason KF144916 KF144962 KF145005 KF145047
CBS 301.49 Bamboo Indonesia K.B. Boedijn &
J. Reitsma
KF144917 KF144963 KF145006 KF145048
CBS 372.67 Air — — KF144918 KF144964 KF145007 KF145049
CBS 664.74 Soil under Calluna vulgaris The Netherlands H. Linder KF144919 KF144965 KF145008 KF145050
Arthrinium saccharicola CBS 191.73 Air The Netherlands H.A. van der Aa KF144920 KF144966 KF145009 KF145051
CBS 334.86 Dead culms of Phragmites australis France: Etang d’Hardy H.A. van der Aa AB220257 KF144967 KF145010 KF145052
CBS 463.83 Dead culms of Phragmites australis The Netherlands: Harderbos W. Gams KF144921 KF144968 KF145011 KF145053
CBS 831.71 — The Netherlands M. van Schothorst KF144922 KF144969 KF145012 KF145054
CPC 18977 Phragmites australis The Netherlands P.W. Crous KF144923 — — —
Arthrinium sp. CPC 21866 Bamboo Vietnam U. Damm KF144924 — — —
Arthrinium xenocordella CBS 478.86 ET Soil from roadway Zimbabwe: Matopos J.C. Krug KF144925 KF144970 KF145013 KF145055
CBS 595.66
= MUCL 10009
Soil Austria: Plaseckerjoch M.A.A. Schipper KF144926 KF144971 — —
1
CBS: CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands; CPC: Culture collection of Pedro Crous, housed at CBS; HKUCC: The University of Hong Kong Culture Collection, Hong Kong,
China; MUCL: Université Catholique de Louvain, Louvain-la-Neuve, Belgium; NRRL: National Center for Agricultural Utilization Research, Peoria, Illinois, U.S.A.; UPSC: Uppsala University Culture
Collection of Fungi, Botanical Museum University of Uppsala, Uppsala, Sweden.
2
EE: ex-epitype strain; ET: ex-type strain.
3
ITS: internal transcribed spacers and intervening 5.8S nrDNA; LSU: 28S nrDNA; TEF: translation elongation factor 1-alpha; TUB: partial beta-tubulin gene.
ARTICLE
volume 4 · no. 1
137

Crous & Groenewald
ARTICLE
0.57
0.73
0.85
0.54
Rosellinia necatrix AY083824
0.64
Astrocystis cocoes AY083823
0.96
0.71
0.1
Xylaria frustulosa JN673055
Anthostomella leucospermi EU552100
Anthostomella brabeji EU552098
Halorosellinia oceanica AY083822
0.87
Anthostomella eucalyptorum DQ890026
0.83
0.93
0.99
0.97
1
Cryptosphaeria eunomia var. eunomia AY083826
Eutypa sp. AY083825
Clypeosphaeria uniseptata AY083830
Phlogicylindrium eucalypti DQ923534
0.58 Subramaniomyces fusisaprophyticus EU040241
0.75
Parapleurotheciopsis inaequiseptata EU040235
0.96
Seiridium banksiae JQ044442
1 Immersidiscosia eucalypti AB593723
0.93
1
0.98
0.51
Seiridium phylicae KC005809
0.97
Seimatosporium eucalypti JN871212
0.97 0.68
Seimatosporium elegans AB593733
1
Seimatosporium mariae AB593740
0.95 Sarcostroma bisetulatum EU552155
0.82
Sarcostroma restionis DQ278924
Oxydothis frondicola AY083835
Appendicospora hongkongensis AY083833
Hyponectria buxi AY083834
CPC 20193 Arthrinium pterospermum
CBS 123185 Arthrinium pterospermum
CBS 115042 Arthrinium ovatum
1
Apiospora tintinnabula DQ810217
Apiospora setosa DQ810214
Apiospora bambusae DQ368630
Apiospora setosa AY346259
CBS 113335 Arthrinium kogelbergense
CBS 113333 Arthrinium kogelbergense
CBS 117206 Arthrinium kogelbergense
CBS 114734 Arthrinium kogelbergense
CBS 113332 Arthrinium kogelbergense
CBS 102053 Arthrinium malaysianum
CBS 251.29 Arthrinium malaysianum
1
CBS 595.66 Arthrinium xenocordella
CBS 478.86 Arthrinium xenocordella
CBS 133509 Arthrinium arundinis
CBS 732.71 Arthrinium arundinis
CBS 464.83 Arthrinium arundinis
CBS 449.92 Arthrinium arundinis
CBS 114316 Arthrinium arundinis
CBS 124788 Arthrinium arundinis
CBS 450.92 Arthrinium arundinis
Arthrinium arundinis AB470555
CBS 106.12 Arthrinium arundinis
Hypocrea gelatinosa JN941453
Xylariaceae
Diatrypaceae
Clypeosphaeriaceae
Incertae sedis
Amphisphaeriaceae
Incertae sedis
Hyponectriaceae
Apiosporaceae
Fig. 1. Consensus phylogram (50 % majority rule) of 3 984 trees resulting from a Bayesian analysis of the LSU sequence alignment using
MrBayes v. 3.2.1. Bayesian posterior probabilities are indicated at the nodes and the scale bar represents the expected changes per site.
Families are indicated in coloured blocks and species names in black text. GenBank accession numbers for downloaded sequences are shown
after species names and culture collection numbers before species names. The tree was rooted to Hypocrea gelatinosa (GenBank JN941453).
138 ima fUNGUS

Re-evaluation of Arthrinium (syn. Apiospora)
0.81
0.98
0.1
CPC 18900 Arthrinium phragmites
CBS 337.61 Arthrinium rasikravindrii
1
CBS 114990 Arthrinium hydei
0.97
CBS 244.83 Arthrinium aureum
0.84
CBS 102052 Arthrinium pseudospegazzinii
CBS 831.71 Arthrinium saccharicola
0.82 CBS 463.83 Arthrinium saccharicola
1
CBS 334.86 Arthrinium saccharicola
CBS 191.73 Arthrinium saccharicola
CPC 21546 Arthrinium pseudosinense
1
CBS 142.55 Arthrinium phaeospermum
1
CBS 114317 Arthrinium phaeospermum
CBS 114315 Arthrinium phaeospermum
CBS 114318 Arthrinium phaeospermum
CBS 114314 Arthrinium phaeospermum
CBS 497.90 Arthrinium marii
CPC 18902 Arthrinium marii
CBS 200.57 Arthrinium marii
1 CPC 18904 Arthrinium marii
Apiospora montagnei DQ471018
CBS 301.49 Arthrinium sacchari
Apiospora montagnei DQ414530
CBS 372.67 Arthrinium sacchari
CBS 664.74 Arthrinium sacchari
0.62 CBS 113535 Arthrinium marii
CBS 212.30 Arthrinium sacchari
CBS 114803 Arthrinium marii
Apiospora sinensis DQ810215
Arthrinium phaeospermum AY083832
Apiospora sinensis AY083831
Apiosporaceae
(continued)
ARTICLE
Fig. 1. (Continued).
observed in aerial mycelial strands (conidiophores sensu
Ellis 1965) or conidiogenous cells situated on a stroma in a
black sporodochium.
Arthrinium arundinis (Corda) Dyko & B. Sutton,
Mycotaxon 8: 119 (1979).
Basionym: Gymnosporium arundinis Corda, Icon. fung. 2: 1
(1838).
Synonym: Apiospora montagnei Sacc., N. Giorn. bot. Ital. 7:
306 (1875).
(Fig. 4)
For further synonyms see Ellis (1965).
Description: Mycelium consisting of smooth, hyaline,
branched, septate, 2–3 µm diam hyphae. Conidiophores
reduced to conidiogenous cells. Conidiogenous cells
aggregated in clusters on hyphae, pale brown, smooth,
ampulliform, 6–12 × 3–4 µm, apical neck 3–5 µm long, basal
part 4–6 µm long. Conidia brown, smooth, globose in surface
view, (5–)6–7 µm, lenticular in side view, 3–4 µm diam, with
pale equatorial slit.
Culture characteristics: Colonies flat, spreading, with
moderate aerial mycelium. On PDA, MEA and OA surface
iron-grey with patches of dirty white, reverse iron-grey.
Specimens examined: Canada: British Columbia: Vancouver,
University of British Columbia campus, culm of cultivated Sasa, 13
July 1988, R. J. Bandoni (CBS 449.92); loc. cit., stem of cultivated
bamboo, 7 May 1992, R. J. & A. A. Bandoni (CBS 450.92). –
Germany: Bromberg, 1912, E. Schaffnit (CBS 106.12). – India:
dung, Dec. 1971, B.C. Lodha (CBS 732.71). – Iran: Shabestar, leaf
of Hordeum vulgare, B. Askari (CBS 114316). – The Netherlands:
Flevoland: Harderbos, dead culms of Phragmites australis, 15 May
1983, W. Gams (CBS 464.83). – Switzerland: Basel, living leaves of
Fagus sylvatica, 8 Jan. 2008, M. Unterseher (CBS 124788). – USA:
Illinois: Kilbourne, Aspergillus flavus sclerotium buried in sandy field
(NRRL 25634 = CBS 133509; isolate submitted for whole genome
sequence analysis; http://genome.jgi-psf.org/pages/search-forgenes.jsf?organism=Apimo1).
Notes: The present cultures closely fit the original description
and concept of Arthrinium arundinis, inclusive of the sexual
morph, which is a commonly occurring, widely distributed
volume 4 · no. 1
139

Crous & Groenewald
ARTICLE
Seiridium phylicae KC005787
CPC 18900 Phragmites australis, Italy
CPC 21546 Bamboo, The Netherlands
95 EU326200 Soil, Unknown
CBS 191.73 Air, The Netherlands
66 CPC 18977 Phragmites australis, The Netherlands
AJ279456 Phragmites australis, Germany
82
CBS 831.71 Unknown substrate, The Netherlands
CBS 463.83 Phragmites australis, The Netherlands
65
CBS 334.86 Phragmites australis, France
66 CBS 142.55 Soil, Japan
CBS 114317 Hordeum vulgare, Iran
100 CBS 114315 Hordeum vulgare, Iran
74 CBS 114318 Hordeum vulgare, Iran
CBS 114314 Hordeum vulgare, Iran
62
AB220267 Soil, Unknown
CBS 102052 Macaranga hullettii, Malaysia
AB220243 Sand, Spain
93 HQ914946 Sea sand, China
CPC 18902 Phragmites australis, Italy
CBS 200.57 Beta vulgaris, The Netherlands
95 CBS 114803 Arundinaria hindsi, Hong Kong
CPC 18904 Phragmites australis, Italy
CBS 497.90 Beach sand, Spain
CBS 113535 Oats, Sweden
100 AB220278 Phragmites australis, UK
CBS 664.74 Soil under Calluna vulgaris, The Netherlands
86 CBS 372.67 Air, Unknown
CBS 212.30 Phragmites australis, UK
CBS 301.49 Bamboo, Indonesia
87 AB220244 Food, Spain
92
CBS 244.83 Air, Spain
76 AB220246 Myroxylon pereira, India
100
CBS 114990 Bambusa tuldoides, Hong Kong
CPC 21886 Bamboo, Vietnam
HM008624 Oryza granulata, China
99
CPC 21602 Rice,Thailand
HM008625 Oryza granulata, China
JF326454 Soil, Norway
CBS 337.61 Cissus, The Netherlands
AB220272 Coffea arabica, Japan
JN198505 Taxus chinensis var. mairei, China
GU266274 Submerged wood, China
JF793538 Wild rice rhizosphere, China
50 CBS 251.29 Cinnamomum camphora, Unknown
100 AB220241 Bambusa, Bangladesh
65
CBS 102053 Macaranga triloba, Malaysia
GU566268 Phalaris arundinacea rhizosphere, Czech Republic
CBS 450.92 Bamboo, Canada
CBS 124788 Fagus sylvatica, Switzerland
54 CBS 464.83 Phragmites australis, The Netherlands
CBS 106.12 Unkown substrate, Germany
55 CBS 449.92 Sasa, Canada
CBS 114316 Hordeum vulgare, Iran
CBS 732.71 Dung, India
AB220281 Soil, China
JN628182 Leaf litter, China
CBS 133509 A. flavus sclerotium, USA
JF440582 Pinus mugo, Lithuania
CBS 115042 Arundinaria hindsii, Hong Kong
100 CBS 123185 Machaerina sinclairii, New Zealand
CPC 20193 Lepidosperma gladiatum, Australia
100 CBS 478.86 Soil from roadway, Zimbabwe
CBS 595.66 Soil, Austria
FJ466728 Trixis vauthieri, Brazil
CBS 117206 Unknown algae, Croatia
100
CBS 114734 Juncus gerardi, Sweden
30 changes
CBS 113333 Restionaceae, South Africa
100 AM922206 Elymus farctus, Spain
AM262394 Dactylis glomerata, Spain
CBS 113332 Cannomois virgata, South Africa
CBS 113335 Restio quadratus, South Africa
Arthrinium phragmites
Arthrinium pseudosinense
Arthrinium sp.
Arthrinium saccharicola
Arthrinium phaeospermum
Arthrinium pseudospegazzinii
Arthrinium marii
Arthrinium sacchari
Arthrinium aureum
Arthrinium hydei
Arthrinium sp.
Arthrinium rasikravindrii
Arthrinium sp.
Arthrinium malaysianum
Arthrinium arundinis
Arthrinium ovatum
Arthrinium pterospermum
Arthrinium xenocordella
Arthrinium kogelbergense
Fig. 2. The first of 72 equally most parsimonious trees obtained from an analysis of the ITS sequence alignment (TL = 552 steps, CI = 0.621, RI
= 0.938, RC = 0.583). The numbers at the nodes represent bootstrap support values based on 1000 resamplings and thickened lines indicate
those branches present in the strict consensus tree. Type and ex-type strains are indicated in bold and the scale bar indicates 30 changes. The
culture collection or GenBank accession number is indicated for each sequence, followed by the isolation source and country of origin. The tree
is rooted to Seiridium phylicae (GenBank accession KC005787).
140 ima fUNGUS

Re-evaluation of Arthrinium (syn. Apiospora)
Seiridium phylicae CPC 19965
100
CBS 117206 Unknown algae, Croatia
CBS 113335 Restio quadratus, South Africa
CBS 113332 Cannomois virgata, South Africa
CBS 113333 Restionaceae, South Africa
Arthrinium kogelbergense
ARTICLE
100
CBS 478.86 Soil from roadway, Zimbabwe
100 CBS 102053 Macaranga triloba, Malaysia
CBS 251.29 Cinnamomum camphora, Unknown
Arthrinium xenocordella
Arthrinium malaysianum
71
100 CBS 732.71 Dung, India
100
CBS 464.83 Phragmites australis, The Netherlands
CBS 450.92 Bamboo, Canada
100 86
CBS 449.92 Sasa, Canada
88
CBS 114316 Hordeum vulgare, Iran
Arthrinium arundinis
63
CBS 124788 Fagus sylvatica, Switzerland
90
66
CBS 106.12 Unknown substrate, Germany
CBS 133509 A. flavus sclerotium, USA
30 changes
90
100
99
90
CPC 18900 Phragmites australis, Italy
CBS 114990 Bambusa tuldoides, Hong Kong
CBS 244.83 Air, Spain
CPC 20193 Lepidosperma gladiatum, Australia
CBS 115042 Arundinaria hindsii, Hong Kong
Arthrinium phragmites
Arthrinium hydei
Arthrinium aureum
Arthrinium pterospermum
Arthrinium ovatum
89
100
99
100
CBS 191.73 Air, The Netherlands
CBS 831.71 Unknown substrate, The Netherlands
CBS 463.83 Phragmites australis, The Netherlands
CBS 334.86 Phragmites australis, France
Arthrinium saccharicola
CBS 142.55 Soil, Japan
93
99
100 86
CBS 114315 Hordeum vulgare, Iran
CBS 114317 Hordeum vulgare, Iran
CBS 114318 Hordeum vulgare, Iran
Arthrinium phaeospermum
CBS 102052 Macaranga hullettii, Malaysia
Arthrinium pseudospegazzinii
CBS 664.74 Soil under Calluna vulgaris, The Netherlands
93
CBS 301.49 Bamboo, Indonesia
100
CBS 212.30 Phragmites australis, UK
Arthrinium sacchari
100
100
CBS 372.67 Air, Unknown
CBS 114803 Arundinaria hindsi, Hong Kong
100
CBS 113535 Oats, Sweden
CBS 497.90 Beach sand, Spain
Arthrinium marii
99
CBS 200.57 Beta vulgaris, The Netherlands
CPC 18904 Phragmites australis, Italy
Fig. 3. The first of four equally most parsimonious trees obtained from an analysis of the combined TUB and TEF sequence alignment (TL =
2003 steps, CI = 0.703, RI = 0.875, RC = 0.616). The numbers at the nodes represent bootstrap support values based on 1 000 resamplings and
thickened lines indicate those branches present in the strict consensus tree. The scale bar indicates 30 changes. The culture collection number
is indicated for each sequence, followed by the isolation source and country of origin. The tree is rooted to Seiridium phylicae (strain CPC 19965;
GenBank accessions KC005821 and KC005817 for TUB and TEF, respectively).
volume 4 · no. 1
141

Crous & Groenewald
ARTICLE
Fig. 4. Arthrinium arundinis (CBS 133509). A. Colony on PDA. B–F. Conidiogenous cells giving rise to conidia. G. Globose conidia. Bars = 10
µm; B = C, D = E, F.
species. Although this present taxon needs to be epitypified,
we refrain for doing it here, as we have not yet traced the
holotype specimen.
Arthrinium aureum Calvo & Guarro, Trans. Br. mycol.
Soc. 75: 156 (1980)
(Fig. 5)
Type: Spain: Barcelona, from air, 1977, A. Calvo & J. Guarro
(CBS 244.83 – ex-type culture).
Description: Calvo & Guarro (1980).
Arthrinium hydei Crous, sp. nov.
MycoBank MB804339
(Fig. 6)
Etymology: Named in honour of Kevin D. Hyde, who collected
this fungus in Hong Kong, and has published extensively on
the genus.
Diagnosis: Conidia brown, finely roughened, globose in
surface view, lenticular in side view, (15–)17–19(–22) µm
diam in surface view, (10–)11–12(–14) µm diam in side view.
Fig. 5. Arthrinium aureum (CBS 244.83). A. Colony on MEA. B–G. Conidiogenous cells giving rise to conidia. H. Conidia. Scale bars = 10 µm;
B = C–G.
142 ima fUNGUS

Re-evaluation of Arthrinium (syn. Apiospora)
ARTICLE
Fig. 6. Arthrinium hydei (CBS 114990). A. Colony on OA. B–E. Conidiogenous cells giving rise to conidia. F. Globose conidia in surface view.
G. Lenticular in side view, with pale equatorial slit. Bars = 10 µm; B = C, E = F.
Type: Hong Kong: New Territories: Tai Po Kau, on culms of
Bambusa tuldoides, 19 Apr. 1999, K. D. Hyde ( CBS H-21272
– holotype; CBS 114990 – ex-type culture).
Description: Mycelium consisting of smooth, hyaline to
pale brown, branched, septate, 2–3 µm diam hyphae.
Conidiophores pale brown, smooth, subcylindrical,
transversely septate, branched, 20–40 × 3–5 µm.
Conidiogenous cells aggregated in clusters on hyphae,
brown, smooth, subcylindrical to doliiform to lageniform, 5–8
× 4–5 µm. Conidia brown, roughened, globose in surface
view, lenticular in side view, with pale equatorial slit, (15–)17–
19(–22) µm diam in surface view, (10–)11–12(–14) µm diam
in side view, with a central scar, 1.5–2 µm diam.
Culture characteristics: Colonies flat, spreading, with sparse
aerial mycelium. On PDA surface and reverse pale luteous.
On OA surface dirty white with patches of olivaceous-grey,
reverse pale luteous. On MEA surface and reverse pale
luteous.
Notes: Originally identified as Apiospora sinensis, a species
described from a dead petiole of Trachycarpus fortune
collected in China (Hyde et al. 1998), but the conidia of A.
hydei are much larger than that reported for A. sinensis, 9–12
× 6–8 µm; those of the latter species fall in the range of A.
phaeospermum.
Arthrinium kogelbergense Crous, sp. nov.
MycoBank MB804340
(Fig. 7)
Etymology: Named after the Kogelberg Nature Reserve,
where the ex-type strain of this fungus was collected.
Diagnosis: Conidia brown, smooth, finely guttulate, globose
to ellipsoid in surface view, lenticular in side view, (8–)9–10 ×
7–8(–9) µm in surface view, 4–5 µm diam in side view.
Type: South Africa: Western Cape Province: Kogelberg
Nature Reserve, dead culms of Restionaceae, 11 May 2001,
Fig. 7. Arthrinium kogelbergense (CBS 113333). A–C. Conidiogenous cells giving rise to conidia. D. Globose to ellipsoid conidia. Bars = 10 µm.
volume 4 · no. 1
143

Crous & Groenewald
ARTICLE
Fig. 8. Arthrinium malaysianum (CBS 102053). A. Colony on OA. B–E. Conidiogenous cells giving rise to conidia. F. Globose conidia in surface
view. Bars = 10 µm.
S. Lee (CBS H-21271 – holotype; CBS 113333 – ex-type
culture).
Description: Mycelium consisting of smooth, hyaline, branched,
septate, 3–5 µm diam hyphae. Conidiophores reduced to
conidiogenous cells. Conidiogenous cells aggregated in clusters
on hyphae, pale brown, smooth, doliiform to subcylindrical, 5–12
× 4–5 µm. Conidia brown, smooth, finely guttulate, globose
to ellipsoid in surface view, lenticular in side view, with pale
equatorial slit, (8–)9–10 × 7–8(–9) µm in surface view, 4–5 µm
diam in side view, with central scar, 1.5–2 µm diam.
Culture characteristics: Colonies flat, spreading, with moderate
aerial mycelium. On PDA, MEA and OA surface dirty white,
reverse pale luteous to sienna.
Additional specimens examined: Croatia: Adriatic Coast, unknown
alga, E. Eguereva (CBS 117206). – South Africa: Western Cape
Province: Jonkershoek Nature Reserve, dead culms of Cannomois
virgata, 15 July 2001, S. Lee (CBS 113332; Helderberg Nature
Reserve, dead culms of Restio quadratus, 13 Apr. 2002, S. Lee (CBS
113335). – Sweden: Uppland: Börstil par., on Juncus gerardi, 2 Aug.
1990, K. & L. Holm (CBS 114734 = UPSC 3251).
Notes: Arthrinium kogelbergense is morphologically close to
A. phaeospermum, which has conidia that are slightly longer,
(9–)10(–12) µm diam in surface view, and wider, 6–7 µm
diam in side view.
Arthrinium malaysianum Crous, sp. nov.
MycoBank MB804342
(Fig. 8)
Etymology: Named after the country where one of the strains
was collected, Malaysia.
Diagnosis: Conidia brown, smooth, globose in surface view,
lenticular in side view, 5–6 diam in surface view, 3–4 µm diam
in side view.
Type: Malaysia: Gombak, on Macaranga hullettii stem
colonised by ants, Aug. 1999, W. Federle (CBS H-21269 –
holotype; CBS 102053 – ex-type culture).
Description: Mycelium consisting of smooth, hyaline,
branched, septate, 2–3 µm diam hyphae. Conidiophores
reduced to conidiogenous cells. Conidiogenous cells
aggregated in clusters on hyphae, hyaline to pale brown,
smooth, doliiform to clavate to ampulliform, 4–7 × 3–5 µm.
Conidia brown, smooth, globose in surface view, lenticular
in side view, with pale equatorial slit, 5–6 µm diam in surface
view, 3–4 µm diam in side view.
Culture characteristics: Colonies flat, spreading, with fluffy
aerial mycelium. On PDA surface dirty white, with patches of
iron-grey due to sporulation, reverse luteous to sienna.
Additional specimen examined: Unknown country: stem base of
Cinnamomum camphora, CBS 251.29.
Notes: Conidial dimensions are close to, but slightly longer
than those of Arthrinium euphorbiae, (4–)4.7(–5.5) µm in
surface view, (3–)3.2(–4) µm in side view (from Euphorbia,
collected in Zambia; Ellis 1965). Arthrinium malaysianum is
the second species collected from the same source, namely
Macaranga hullettii stems colonised by ants in Malaysia (see
CBS 102052).
Arthrinium marii Larrondo & Calvo, Mycologia 82:
397 (1990).
(Fig. 9)
Type: Spain: Barcelona, from beach sand, Nov. 1990, J.V.
Larrondo & A. Calvo (IMI 326872 – holotype; CBS 497.90 =
MUCL 31300 – ex-type culture).
Description: Mycelium consisting of smooth, hyaline, branched,
septate, 1.5–4 µm diam hyphae. Conidiophores reduced
to conidiogenous cells. Conidiogenous cells aggregated in
144 ima fUNGUS

Re-evaluation of Arthrinium (syn. Apiospora)
ARTICLE
Fig. 9. Arthrinium marii (CBS 497.90). A. Colony on PDA. B, F. Conidiogenous cells giving rise to conidia. C–E. Elongated conidia (sterile
cells?). G. Lenticular conidia in side view. H. Globose to ellipsoid conidia in surface view. Bars = 10 µm; B = C, D = E.
clusters on hyphae, brown, smooth, ampulliform, 5–10 × 3–4.5
µm. Conidia brown, smooth, granular, globose to elongate
ellipsoid in surface view, 8–10(–13) µm diam, lenticular in side
view, with pale equatorial slit, (5–)6(–8) µm diam in side view;
with central basal scar, 1 µm diam. Brown, elongated cells
(sterile cells?) at times intermingled among conidia.
Culture characteristics: Colonies flat, spreading, with
sparse aerial mycelium. On OA pale luteous with patches of
olivaceous-grey due to sporulation. On PDA olivaceous-grey
on surface, reverse smoke-grey with patches of olivaceousgrey.
On MEA luteous with patches of umber, reverse sienna
with patches of luteous.
Additional specimens examined: Italy: Bomarzo, Footpath Santa
Lecilia, Mugana, Viterbo, on stems of Phragmites australis, 24 Nov.
2010, W. Gams (CPC 18904, 18902). – The Netherlands: on leaf of
Beta vulgaris, Apr. 1957, Gerold (CBS 200.57). – Sweden: oats, Nov.
1985, C. Svenson (CBS 113535). – Hong Kong: Lung Fu Shan, on
culm of Arundinaria hindsii, 30 July 1998, K. D. Hyde (CBS 114803
= HKUCC 3143).
Note: Based on the results obtained here (Figs 1–3), it
appears that Arthrinium marii is quite a commonly occurring
species on different hosts in Europe, with a single report from
Hong Kong.
Fig. 10. Arthrinium ovatum (CBS 115042). A. Colony on PDA. B–E. Curved or irregularly angled or lobed sterile cells. F. Conidiogenous cells
giving rise to conidia. G, H. Conidia. Bars = 10 µm; B = C–E.
volume 4 · no. 1
145

Crous & Groenewald
ARTICLE
Fig. 11. Arthrinium phaeospermum (CBS 142.55). A. Colony on OA. B, C. Conidiogenous cells giving rise to conidia. D, E. Conidia in surface
and side view. F. Conidia and sterile cells. Bars = 10 µm; B = C, D = E.
Arthrinium ovatum Crous, sp. nov.
MycoBank MB804343
(Fig. 10)
Etymology: Named after the ovoid shape of its conidia.
Diagnosis: Conidia oval to broadly ellipsoid, medium brown,
finely roughened, 18–20 µm diam in surface view, 12–14 µm
diam in side view.
Type: Hong Kong: on Arundinaria hindsii, 10 Feb. 2004,
K. D. Hyde (CBS H-21273 – holotype; CBS 115042 – ex-type
culture).
Description: Mycelium consisting of branched, septate,
hyaline, 3–5 µm diam hyphae, becoming brown closer to
conidiogenous region. Conidiophores aggregated in black
sporodochia, multiseptate, branched, to 60 µm long, 5–7 µm
diam. Conidiogenous cells pale brown, smooth, aggregated,
ampulliform, 7–12 × 4–6 µm, in clusters on aerial mycelium,
or forming black sporodochial conidiomata on agar surface.
Sterile cells terminal on hyphae, pale brown, elongated
ellipsoidal to clavate, 20–35 × 10–15 µm, or somewhat
curved or irregularly angled or lobed, up to 80 µm long, 5–20
µm diam. Conidia oval to broadly ellipsoid, medium brown,
finely roughened, 18–20 µm diam in surface view, 12–14 µm
diam in side view, with equatorial slit of lighter pigment, and
central scar, 2–3 µm diam.
Culture characteristics: Colonies flat, spreading, with
moderate aerial mycelium. On MEA surface ochreous with
patches of dirty white, reverse sienna. On PDA surface and
reverse dirty white, with patches of umber. On OA surface
dirty white with patches of olivaceous-grey, reverse iron-grey.
Notes: Based on the larger conidia, Arthinium ovatum
appears to represent an undescribed species (Ellis 1965,
1976, Gjaerum 1967, Pollack & Benjamin 1969, Hudson &
McKenzie 1976, Calvo & Guarro 1980, Khan & Sullia 1980,
Samuels et al. 1981, von Arx 1981, Koskela 1983, Kirk 1986,
Larrando & Calvo 1990, 1992, Müller 1992, Bhat & Kendrick
1993, Hyde et al. 1998, Jones et al. 2009, Singh et al. 2012).
Arthrinium phaeospermum (Corda) M.B. Ellis, Mycol.
Pap. 103: 8 (1965)
Basionym: Gymnosporium phaeospermum Corda, Icon.
fung. 1: 1 (1837).
Synonym: Botryoconis sanguinea Tubaki, Nagaoa 1: 7
(1952).
(Fig. 11)
For further synonyms see Ellis (1965).
Description: Mycelium consisting of smooth, hyaline,
branched, septate, 3–4 µm diam hyphae. Conidiophores
reduced to conidiogenous cells. Conidiogenous cells
aggregated in clusters on hyphae, medium brown, smooth,
ampulliform, 5–10 × 3–5 µm, apical neck 2–4 µm long, basal
part 3–6 µm long. Conidia brown, smooth, granular, globose
to ellipsoid in surface view, (9–)10(–12) µm diam, lenticular in
side view, with pale equatorial slit, 6–7 µm diam in side view;
with central basal scar, 2 µm diam.
Culture characteristics: Colonies flat, spreading, with sparse
aerial mycelium. Surface iron-grey on OA and MEA, iron-grey
with patches of dirty white and sienna on PDA.
Specimens examined: Iran: Marand, on leaf of Hordeum vulgare, B.
Askari, CBS 114314, 114317, 114318; Shabestar, on leaf of Hordeum
146 ima fUNGUS

Re-evaluation of Arthrinium (syn. Apiospora)
ARTICLE
Fig. 12. Arthrinium phragmites (CPC 18900). A. Ascoma with oozing ascospores. B. Colony on OA. C–E. Asci with ascospores. F–H.
Conidiogenous cells giving rise to conidia. I, J. Conidia. Bars = 10 µm; C = D, F = G, H.
vulgare, B. Askari, CBS 114315. – Japan: Tiba Prefecture: soil,
1951, K. Tubaki (CBS 142.55 – isotype of Botryoconis sanguinea).
Notes: Although Arthrinium phaeospermum is common and
widely distributed, many isolates in the literature have been
incorrectly identified as representing this taxon. The present
phylogenetic data show that A. phaeospermum represents
a species complex, and that minute differences in conidial
dimensions correlate with distinct taxa. Singh et al. (2012)
incorrectly cite the isotype strain of Botryoconis sanguinea
as isotype of A. phaeospermum, a species to which B.
sanguinea is synonymous. Although we accept the same
clade as representative of A. phaeospermum, this species
presently does not have any ex-type strains available for
study, and needs to be epitypified.
Arthrinium phragmites Crous, sp. nov.
MycoBank MB804344
(Fig. 12)
Etymology: Named after the host from which it was isolated,
Phragmites.
Diagnosis: Conidia brown, smooth, but finely roughened on
surface, ellipsoid to ovoid, 9–10(–12) µm in surface view,
(5–)6(–7) µm in side view. Ascospores apiosporous, basal
cell smaller, hyaline, straight to curved, smooth, lacking
mucilaginous sheath, 22–25 × 7–9 µm; basal cell 4–6 µm
long.
Type: Italy: Viterbo Province: Bomarzo, footpath from Santa
Cecilia to Nugnano, on culms of Phragmites australis, 24
Nov. 2010, W. Gams (CBS H-21267 – holotype; CPC 18901,
18900 = CBS 135458 – ex-type culture).
Description: Occurring on dead stem stalks. Mycelium
consisting of hyaline, smooth, branched, septate, 2–3 µm
diam hyphae. Conidiophores reduced to conidiogenous cells.
Conidiogenous cells erect, ampulliform to doliiform, pale
brown, smooth, 12–15 × 3–5 µm. Conidia brown, smooth
to finely roughened, ellipsoid to ovoid, with equatorial slit of
paler pigment, 9–10(–12) µm in surface view, (5–)6(–7) µm
in side view. Sterile cells forming on solitary loci on hyphae,
brown, finely roughened, ellipsoid to clavate, 13–15(–17) ×
(5–)6 µm. Ascomata immersed beneath a pseudostroma,
1–3 mm long, 0.5–1 mm diam, dark brown to black,
becoming erumpent, splitting along its length, revealing a row
of separate, subglobose, brown ascomata, each exuding a
white cirrhus of ascospores; ascomata subglobose, arranged
in rows, medium to dark brown, 150–200 µm diam, 200–300
µm tall; wall consisting of 3–4 layers of textura angularis;
ostiole single, central, 10–25 µm diam, with a periphysate
channel 20–40 µm long. Paraphyses intermingled among
asci, not very prominent, hyphae-like, hyaline, smooth,
septate, sparingly branched, thin-walled, up to 4 µm diam, at
times breaking into segments. Asci hyaline, smooth, clavate
with a short basal pedicel, unitunicate, thin-walled, obtusely
rounded apex lacking an apical mechanism, 70–110 × 17–25
µm. Ascospores hyaline, smooth, 2–3-seriate, apiosporous,
straight to curved, ellipsoid to reniform, some ascospores
showing remnants of mucoid sheath covering length of
spore; ascospores granular or not, widest in middle of apical
cell, (20–)22–24(–25) × (7–)8–9(–10) µm; basal cell obtusely
rounded, hyaline, smooth, 5–6 × 5 µm.
volume 4 · no. 1
147

Crous & Groenewald
ARTICLE
Fig. 13. Arthrinium pseudosinense (CPC 21546). A. Erumpent ascomata on host surface. B–D. Asci and ascospores. E–H. Conidiogenous cells
giving rise to conidia. Bars = 10 µm; B = C, E = F, G.
Culture characteristics: Colonies flat, spreading, with
moderate aerial mycelium. On PDA surface dirty white with
patches of pale luteous, reverse luteous.
Notes: Based on its conidial dimensions, Arthrinium phragmites
is close to A. phaeospermum, which has conidia that are
9–12 µm diam in surface view, and 6–7 µm diam in side view.
However, conidia of A. phragmites are somewhat narrower in
side view, and more ellipsoid in shape. The ascospores are
also smaller than those attributed to Apiospora sinensis, the
purported sexual morph of Arthrinium phaeospermum (see
below). Many published reports of A. phaeospermum may
however belong to A. phragmites.
Arthrinium pseudosinense Crous, sp. nov.
MycoBank MB804347
(Fig. 13)
Etymology: Named after its morphological similarity to
Apiospora sinensis.
Diagnosis: Conidia brown, smooth, ellipsoid, 8–10 × 7–10 µm
diam in surface view, 7–8 µm diam in side view. Ascospores
2–3 seriate, apiosporous, basal cell smaller, hyaline, straight
to curved, smooth, surrounded by a thin mucilaginous sheath,
(25–)27–30(–33) × (6–)8(–10) µm; basal cell 3–6 µm long.
Type: The Netherlands: Utrecht: Utrecht Botanical Garden,
on leaves of bamboo, 6 Oct. 2012, U. Damm (CBS H-21268
– holotype; CBS 135459 = CPC 21546, CPC 21547 – ex-type
culture).
Description: Associated with leaf tip blight, occurring on
dead leaf tissue. Mycelium consisting of pale brown, smooth,
branched, septate, 2–3 µm diam hyphae. Conidiophores
reduced to conidiogenous cells. Conidiogenous cells
ampulliform to doliiform or subcylindrical, pale brown,
smooth, 5–12 × 3–5 µm. Conidia brown, smooth, ellipsoid,
with equatorial slit of paler pigment, 8–10 × 7–10 µm diam in
surface view, 7–8 µm diam in side view. Ascomata immersed,
subepidermal becoming erumpent, solitary or arranged in
linear rows, splitting epidermis via longitudinal slit; globose
to subglobose, somewhat papillate, to 300 µm diam, brown,
with central periphysate ostiole to 50 µm diam. Paraphyses
hyaline, smooth, septate, prominently constricted at septa,
3–5 µm diam at basal part, apex frequently swollen, to 10
µm diam. Asci unitunicate, 8-spored, thin-walled, clavate,
stipitate, apex lacking apical mechanism, 85–100 × 15–20
µm. Ascospores 2–3 seriate, apiosporous, basal cell smaller,
hyaline, straight to curved, smooth, surrounded by a thin
mucilaginous sheath, (25–)27–30(–33) × (6–)8(–10) µm;
basal cell 3–6 µm long.
Culture characteristics: Colonies flat, spreading. On MEA
surface and reverse dirty white with patches of umber, and
with sparse aerial mycelium. On OA surface moderately fluffy,
with dirty white aerial mycelium. On PDA aerial mycelium
sparse, surface concolorous with agar, with patches of
umber, reverse umber.
Notes: Morphologically, Arthinium pseudosinense closely
resembles Apiospora sinensis (ascospores (26–)31(–34) ×
(6–)7.6(–8.4) µm; conidia ellipsoid, 9–12 × 6–8 µm; Hyde
et al. 1998), except that the ascospores are on average
148 ima fUNGUS

Re-evaluation of Arthrinium (syn. Apiospora)
ARTICLE
Fig. 14. Arthrinium pseudospegazzinii (CBS 102052). A. Colony on PDA. B–E. Conidiogenous cells giving rise to conidia. F. Conidia. Bars = 10
µm; D = E.
shorter and wider, have a less prominent sheath, and
the conidia are smaller. A fresh collection of A. sinensis
from China (south-west Huhei Province, Xuanen, on dead
petiole of Trachycarpus fortunei) would be needed to
facilitate a molecular comparison, with what is obviously
a species complex, as other isolates originally identified
as Apiospora sinensis in the CBS collection also clustered
apart.
Arthrinium pseudospegazzinii Crous, sp. nov.
MycoBank MB804346
(Fig. 14)
Etymology: Named after its morphological similarity to A.
spegazzinii.
Diagnosis: Conidia brown, guttulate, roughened, globose
in surface view, lenticular in side view, (7–)8–9 µm diam in
surface view, 5–6 µm diam in side view.
Type: Malaysia: Gombak, on Macaranga hullettii stem
colonised by ants, Aug. 1999, W. Federle (CBS H-21276 –
holotype; CBS 102052 – ex-type culture).
Description: Mycelium consisting of smooth, hyaline to
pale brown, branched, septate, 3–4 µm diam hyphae.
Conidiophores reduced to conidiogenous cells.
Conidiogenous cells aggregated in clusters on hyphae,
brown, smooth, ampulliform with elongated neck, 8–13 µm
long, basal part 3–5 × 3–5 µm, neck 3–7 × 1.5–2 µm. Conidia
brown, guttulate, finely roughened, globose in surface view,
lenticular in side view, with pale equatorial slit, (7–)8–9 µm
diam in surface view, 5–6 µm diam in side view, with central
scar, 1.5–2 µm diam.
Culture characteristics: Colonies flat, spreading, with
moderate aerial mycelium. On PDA surface pale luteous,
reverse luteous. On OA surface dirty white with patches
of olivaceous-grey, reverse olivaceous-grey. On MEA
surface dirty white, with patches of grey-olivaceous, reverse
olivaceous-grey.
Notes: Although conidia were observed to be finely roughened,
they were not as rough, more globose in surface view, and
were much smaller than those of Arthinium spegazzinii (5–8
× 3–6 µm; Ellis 1965).
Arthrinium pterospermum (Cooke & Massee) Arx,
Gen. Fungi Spor. Pure Cult, 3 rd edn: 331 (1981).
Basionym: Coniosporium pterospermum Cooke & Massee,
Hedwigia 19: 90 (1880).
Synonym: Pteroconium pterospermum (Cooke & Massee)
Grove, Hedwigia 55: 146 (1914).
(Fig. 15)
Type: Australia: Victoria: on Lepidosperma sp., Martin 778 (K
(M) 179237 – holotype, ex herb. M. C. Cooke as Coniosporium
pterospermum and annotated by W. G. Grove); Adelaide, on
leaf of Lepidosperma gladiatum, 4 Jan. 2012, W. Quaedvlieg
(CBS H-21275 – epitype designated here "MBT 175265";
CPC 20194, 20193 = CBS 134000 – cultures ex-epitype).
Description: Mycelium consisting of branched, septate, hyaline,
2–4 µm diam hyphae, becoming brown closer to conidiogenous
region. Conidiophores aggregated in black sporodochia,
transversely multiseptate, branched, brown, smooth, to 150 µm
long, 3–5 µm diam. Conidiogenous cells lateral and terminal
on conidiophores, brown, finely roughened, aggregated,
doliiform to ampulliform, 5–10 × 4–5 µm. Conidia brown, finely
roughened, with equatorial slit of lighter pigment, and central
scar, polygonal, lobed or dentate, irregular in surface view, 15–
25 µm diam; in side view, 8–10 µm diam.
Culture characteristics: Colonies flat, spreading, with sparse
aerial mycelium. On MEA surface pale olivaceous-grey,
reverse olivaceous-grey. On OA surface olivaceous-grey,
with patches of dirty white, reverse olivaceous-grey.
volume 4 · no. 1
149

Crous & Groenewald
ARTICLE
Fig. 15. Arthrinium pterospermum (CPC 20194). A. Sporodochium on host surface. B–F. Conidiogenous cells giving rise to conidia. G, H.
Dentate conidia. Bars = 10 µm; B = C–F.
Additional specimen examined: New Zealand: Auckland, Auckland
University, leaf lesion of Machaerina sinclairii, 27 Jan. 2008, C. F. Hill
(CBS 123185 = 2008/423-X = CPC 15380).
Notes: From the Australian specimens available of this fungus
in BRIP and VPRI, it seems that Arthinium pterospermum
is common on leaves of Lepidosperma gladiatum
(Cyperaceae). The decision by von Arx (1981) to dispose
Pteroconium pterospermum to Arthrinium is supported by
the present phylogenetic analysis (Fig. 1), which widens
the circumscription of Arthrinium to also include conidia with
irregular, lobed or dentate conidia.
Arthrinium sacchari (Speg.) M.B. Ellis, Mycol. Pap.
103: 11 (1965).
Basionym: Coniosporium sacchari Speg., Revista Fac.
Agron. Univ. Nac. La Plata 2(19): 248 (1896).
(Fig. 16)
Fig. 16. Arthrinium sacchari (CBS 301.49). A. Colony on PDA. B–F. Conidiogenous cells giving rise to conidia. G, H. Conidia. Bars = 10 µm;
D = E–G.
150 ima fUNGUS

Re-evaluation of Arthrinium (syn. Apiospora)
ARTICLE
Fig. 17. Arthrinium saccharicola (CBS 831.71). A. Colony on MEA. B–G. Conidiogenous cells giving rise to conidia. H. Globose conidia. Bars =
10 µm; B = C, D = E, F.
Description: Mycelium consisting of smooth, hyaline,
branched, septate, 1.5–4 µm diam hyphae. Conidiophores
reduced to conidiogenous cells. Conidiogenous cells
aggregated in clusters on hyphae, brown, smooth,
ampulliform to doliiform, 5–12 × 2.5–4 µm; conidiogenous
cells proliferating sympodially and also percurrently. Conidia
brown, smooth, granular, globose in surface view, (6–)7(–8)
µm diam, lenticular in side view, with pale equatorial slit,
(3.5–)4 µm diam in side view; with central basal scar, 1 µm
diam.
Culture characteristics: Colonies flat, spreading, with sparse aerial
mycelium. Surface iron-grey on OA and MEA, umber on PDA.
Specimens examined: Indonesia: on bamboo, Feb. 1949, K. B.
Boedijn & J. Reitsma (CBS 301.49). – The Netherlands: soil under
Calluna vulgaris, June 1974, H. Linde (CBS 664.74). – UK: England:
near Cambridge, on Phragmites australis, Oct. 1930, E. W. Mason
(CBS 212.30). – Unknown country: from air, Aug. 1967, collector
unknown (CBS H-8805, CBS 372.67).
Notes: Morphologically, Arthinium arundinis (syn. Apiospora
montagnei) and Arthrinium sacchari are very similar, and best
distinguished by the A. sacchari having wider conidiophores
(1–1.5 µm) than A. arundinis (0.5 µm). Unfortunately, this
feature was not useful in culture. However, based on the
slightly larger conidia and wider hyphae with conidiogenous
loci, we chose to apply the name A. sacchari to this clade,
rather than the clade we attribute to A. arundinis.
Arthrinium saccharicola F. Stevens, J. Dept. Agric.
Porto Rico 1(4): 223 (1917).
(Fig. 17)
Description: Mycelium consisting of smooth, hyaline,
branched, septate, 3–5 µm diam hyphae. Conidiophores
reduced to conidiogenous cells. Conidiogenous cells
aggregated in clusters on hyphae, medium brown, finely
verruculose, ampulliform, 5–10 × 3–5 µm, apical neck 2–4
µm long, basal part 3–6 µm long. Conidia brown, smooth,
granular, globose to ellipsoid in surface view, (7–)8–9(–10)
µm diam, lenticular in side view, with pale equatorial slit (at
times appearing like a ridge of paler pigment), (4–)5(–6) µm
diam in side view; with central basal scar, 2 µm diam.
Culture characteristics: Colonies flat, spreading, with sparse
aerial mycelium. Surface iron-grey on OA, on MEA and PDA
umber, with patches of olivaceous grey.
Specimens examined: France: Landes, Seignosse, Etang d’Hardy,
on dead culms of Phragmites australis, 11 June 1986, H. A. van der
Aa (CBS 334.86). – The Netherlands: Dec. 1971, M. van Schothorst
(RIVM, CBS H-8889, CBS 831.71); on Phragmites australis, Jan.
2011, P. W. Crous (CPC 18977); from air, Sept./Oct. 1972, H. A. van
der Aa (CBS 191.73); Z. Flevoland, Harderbos, on dead culms of
Phragmites australis, 15 May 1983, W. Gams (CBS 463.83).
Notes: Conidial morphology and dimensions of isolates in
this clade (Fig. 1) closely match those ascribed to Arthinium
saccharicola. Unfortunately, no flexuous conidiophores
developed in culture, thus the width of conidiophores could
not be confirmed. However, hyphae are similar in width to that
observed by Ellis (1965) for this species, 2–5 µm thick, which
is wider than that observed in other species of Arthrinium.
Arthrinium xenocordella Crous, sp. nov.
MycoBank MB804348
(Fig. 18)
Etymology: Not a member of the genus Cordella.
Diagnosis: Conidia brown, smooth, guttulate, globose to
somewhat ellipsoid in surface view, lenticular in side view,
(7–)9–10(–11) µm diam in surface view, 6–7 µm diam in side
volume 4 · no. 1
151

Crous & Groenewald
ARTICLE
Fig. 18. Arthrinium xenocordella (CBS 478.86). A. Colony on PDA. B–D. Conidiogenous cells giving rise to conidia. E–G. Setae intermingled
among conidia on agar surface. H. Conidia. Bars = 10 µm; B = C, E = F.
view. Setae erect, brown, smooth, subcylindrical, tapering
in apical cell to subobtuse or obtuse apex, 1-septate, base
truncate, to 100 µm tall, 5–8 µm diam.
Type: Zimbabwe: Pomongwe Cave, Matopos, soil from
roadway, 21 Dec. 1985, J. C. Krug (CBS H-21274 – holotype;
CBS 478.86 – ex-type cultures).
Description: Mycelium consisting of smooth to finely
verruculose, hyaline to pale brown, branched, septate, 3–5
µm diam hyphae. Conidiophores reduced to conidiogenous
cells. Conidiogenous cells aggregated in clusters on hyphae,
brown, verruculose, globose to clavate to doliiform, 5–7 × 4–5
µm. Conidia brown, smooth, guttulate, globose to somewhat
ellipsoid in surface view, lenticular in side view, with pale
equatorial slit, (7–)9–10(–11) µm diam in surface view, 6–7
µm diam in side view, with central scar, 1.5–2 µm diam. Setae
erect, brown, smooth, subcylindrical, tapering in apical cell to
subobtuse or obtuse apex, 1-septate, base truncate, to 100
µm tall, 5–8 µm diam, straight to irregularly curved.
Culture characteristics: Colonies flat, spreading, with
moderate aerial mycelium. On PDA surface pale luteous with
patches of olivaceous-grey, reverse pale luteous. On OA
surface dirty white, reverse pale luteous. On MEA surface
pale luteous, reverse luteous.
Additional specimen examined: Austria: Plaseckerjoch, soil, Aug
1966, M. A. A. Schipper (CBS H-8885, CBS 595.66 = MUCL 10009).
Notes: Arthrinium xenocordella is presently known from
two strains, both isolated from soil. Based on morphology,
A. xenocordella closely resembles A. phaeospermum,
but the conidia tend to be globose to ellipsoid in surface
view, and also form brown setae, which are not present in
A. phaeospermum. That a species with setae clusters in
Arthrinium, suggests that the generic name Cordella (Ellis
1965, Seifert et al. 2011), which has Apiospora sexual morphs
(Samuels et al. 1981), should be reduced to synonymy with
Arthrinium.
Discussion
The higher phylogenetic classification of Arthrinium (syn.
Apiospora) has been the topic of much debate. Theissen
& Sydow (1915) placed it in Dothideales, Müller & von Arx
(1962) assigned it to Amphisphaeriaceae (Xylariales), and
at first Barr chose Hyponectriaceae (Barr 1976), but later
Lasiosphaeriaceae (Sordariales; Barr 1990). Following
this debate, Hyde et al. (1998), introduced the family
name Apiosporaceae to accommodate Apiospora and
Appendicospora, based on the unique sexual morphology and
their unusual asexual morphs (i.e. basauxic conidiophores
with terminal and intercalary polyblastic conidiogenous cells,
and unicellular conidia with germ slits). Data derived from
a phylogenetic study (SSU and LSU rDNA) incorporating
species of Apiospora and Appendicospora, led Smith et al.
(2003) to conclude that Apiosporaceae represented one
of seven families which, at that time could be resolved in
Xylariales, namely Amphisphaeriaceae, Apiosporaceae,
Clypeosphaeriaceae, Diatrypaceae, Graphostromataceae,
Hyponectriaceae, and Xylariaceae. However, in the latest
outline of the Ascomycota, Lumbsch & Huhndorf (2010) still
list Apiosporaceae as fam. incertae sedis (Sordariomycetes).
Based on the results we obtained in this study (Fig. 1),
Apiosporaceae is confirmed as a family within Xylariales, and
a sister to Amphisphaeriaceae.
152 ima fUNGUS

Re-evaluation of Arthrinium (syn. Apiospora)
The generic name Appendicospora (asexual morph
unknown; Hyde 1995) was introduced to accommodate
Apiosporella coryphae (Rehm 1913). Appendicospora chiefly
differs from Apiospora in having ascospores with bifurcate
appendages. A second species, A. hongkongensis, was
subsequently introduced to accommodate a taxon occurring
on Livistona chinensis in Hong Kong (Yanna et al. 1997). Our
results suggest, however, that although Appendicospora is a
member of Xylariales, it does not belong to Apiosporaceae,
but represents an as yet undefined family within the order.
The generic circumscription of Arthrinium has for some
time been regarded as too narrow, ignoring the similar sexual
morphology exhibited by various other asexual genera
(von Arx 1981). The decision to reduce both Cordella and
Pteroconium to synonymy with Arthrinium here is based on
newly available molecular data (Fig. 1). From these data we
can conclude that features such as conidium shape and the
presence of setae do not appear to be reliable at the generic
level in this complex.
We also introduce eight novel species here, most of
which would have formerly been treated as belonging to
Arthinium arudinis (syn. Apiospora montagnei) or Arthrinium
phaeospermum, two commonly occurring species that that
have evidently been too widely circumscribed morphologically.
Arthrinium malaysianum and A. pseudospegazzinii are
two novel co-occurring species on Macaranga hullettii from
Malaysia. Species of bamboo have always been known as good
substrates for Arthrinium, and three species are described from
this host here: A. hydei and A. ovatum from Hong Kong, and A.
pseudosinense from The Netherlands. In general most grasses
and reeds appear to harbour species of Arthrinium as endophytes,
and hence it is not surprizing that the additional novel species
include A. kogelbergense on dead culms of Restionaceae from
South Africa, and A. phragmites on Phragmites australis from
Italy. Furthermore, species of Arthrinium are also commonly
isolated from soil, as demonstrated by the description of A.
rashikravindrii from soils in Norway (Singh et al. 2012), but also
now shown to occur on diverse substrates in China, Japan,
Thailand, and The Netherlands, and A. xenocordella from soil in
Austria and Zimbabwe.
This study shows that isolates representing distinct
species of Arthrinium can co-occur on the same substrate,
meaning that links between sexual and asexual morphs
need to be confirmed by DNA or the culture of single
spores. Furthermore, Arthrinium species are highly variable
morphologically, depending on the substrate and period of
incubation, and the morphological features exhibited in vitro
do not always match those observed in vivo. Fresh collections
are therefore required to stablise the application of many
older, well-established names. As a further complication,
many well-known taxa unfortunately also appear to represent
species complexes.
Acknowledgements
We thank the technical staff, Arien van Iperen (cultures), Marjan
Vermaas (photographic plates), and Mieke Starink-Willemse
(DNA isolation, amplification, and sequencing) for their invaluable
assistance.
References
Agut M, Calvo MA (2004) In vitro conidial germination in Arthrinium
aureum and Arthrinium phaeospermum. Mycopathologia 157:
363–367.
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller
W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucleic Acids
Research 25: 3389–3402.
Arx JA von (1981) The Genera of Fungi Sporulating in Pure Culture.
3 rd edn. Vaduz: J. Cramer.
Barr ME (1976) Buergenerula and the Physosporellaceae. Mycologia
68: 611–621.
Barr ME (1990) Prodomus to nonlichenized; pyrenomycetous
members of the class Hymenoascomycetes. Mycotaxon 39:
43–184.
Bhat DJ, Kendrick B (1993) Twenty-five new conidial fungi from the
Western Ghats and the Andaman Islands (India). Mycotaxon 49:
19–90.
Cabello MA, Platas G, Collado J, Díez MT, Martín I, et al. (2001)
Arundifungin, a novel antifungal compound produced by fungi:
biological activity and taxonomy of the producing organisms.
International Microbiology 4: 93–102.
Calvo MA, Guarro J (1980) Arthrinium aureum sp. nov. from Spain.
Transactions of the British Mycological Society 75: 156–157.
Carbone I, Kohn LM (1999) A method for designing primer sets for
speciation studies in filamentous ascomycetes. Mycologia 91:
553–556.
Crous PW, Braun U, Hunter GC, Wingfield MJ, Verkley GJM, Shin
H-D, Nakashima C, and Groenewald JZ (2013) Phylogenetic
lineages in Pseudocercospora. Studies in Mycology 75: 37–114.
Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G (2004)
MycoBank: an online initiative to launch mycology into the 21st
century. Studies in Mycology 50: 19–22.
Crous PW, Schoch CL, Hyde KD, Wood AR, Gueidan C, et al.
(2009a) Phylogenetic lineages in the Capnodiales. Studies in
Mycology 64: 17–47.
Crous PW, Slippers B, Wingfield MJ, Rheeder J, Marasas WFO,
et al. (2006) Phylogenetic lineages in the Botryosphaeriaceae.
Studies in Mycology 55: 235–253.
Crous PW, Verkley GJM, Groenewald JZ, Samson RA (eds) (2009b)
Fungal Biodiversity. [CBS Laboratory Manual Series no. 1.]
Utrecht: CBS-KNAW Fungal Biodiversity Centre.
Crous PW, Wingfield MJ, Park RF (1991) Mycosphaerella nubilosa a
synonym of M. molleriana. Mycological Research 95: 628–632.
Ellis MB (1965) Dematiaceous Hyphomycetes. VI. Mycological
Papers 103: 1–46.
Ellis MB (1971) Dematiaceous Hyphomycetes. Kew: Commonwealth
Mycological Institute.
Ellis MB (1976) More Dematiaceous Hyphomycetes. Kew:
Commonwealth Mycological Institute, Kew.
Gjaerum HB (1967) Arthrinium morthieri, A. fuckelii n. sp., and A.
ushuvaiense. Nytt magasin for Botanikk 14: 1–6.
Glass NL, Donaldson G (1995) Development of primer sets designed
for use with PCR to amplify conserved genes from filamentous
ascomycetes. Applied and Environmental Microbiology 61:
1323–1330.
Hawksworth DL (2012) Managing and coping with names of
pleomorphic fungi in a period of transition. Mycosphere 3: 143–
155; IMA Fungus 3: 15–24.
ARTICLE
volume 4 · no. 1
153

Crous & Groenewald
ARTICLE
Hawksworth DL, Crous PW, Redhead SA, Reynolds DR, Samson
RA, et al. (2011) The Amsterdam Declaration on Fungal
Nomenclature. IMA Fungus 2: 105–112.
He Y, Zhang Z (2012) Diversity of organism in the Usnea
longissima lichen. African Journal of Microbiology Research
6: 4797–4804.
Hoog GS de, Gerrits van den Ende AHG (1998) Molecular diagnostics of
clinical strains of filamentous Basidiomycetes. Mycoses 41: 183 –189.
Hoog GS de, Guarro J, Gené J, Figueras MJ (2000) Atlas of Clinical
Fungi, 2nd ed. CBS, Utrecht, Netherlands, and Universitat Rovira
i Virgili, Reus, Spain.
Hudson HJ, McKenzie EHC (1976) Conidial states of Apiospora Sacc
Transactions of the British Mycological Society 66: 359–362.
Hyde KD (1995). Fungi from palms. XXVIII. Appendicospora coryphae,
a new name for Apiosporella coryphae. Sydowia 47: 31–37.
Hyde KD, Fröhlich J, Taylor JE (1998) Fungi from palms. XXXVI.
Reflections on unitunicate ascomycetes with apiospores.
Sydowia 50: 21–80.
Jones EBG, Sakayaroj J, Suetrong S, Somrithipol S, Pang KL (2009)
Classification of marine Ascomycota, anamorphic taxa and
Basidiomycota. Fungal Diversity 35: 1–187.
Khan KR, Sullia SB (1980) Arthrinium phaeospermum var. indicum
var. nov., a new market pathogen of cowpea, gardenpea and
Frenchbean. Acta Botanica Indica 8: 103–104.
Khan SA, Hamayun M, Kim H-Y, Yoon H-J, Seo J-C, et al. (2009)
A new strain of Arthrinium phaeospermum isolated from
Carex kobomugi Ohwi is capable of gibberellin production.
Biotechnological Letters 31: 283–287.
Kirk PM (1986) New or interesting microfungi. XV. Miscellaneous
hyphomycetes from the British Isles. Transactions of the British
Mycological Society 86: 409–428.
Klemke C, Kehraus S, Wright AD, König GM (2003) New secondary
metabolites from the marine endophytic fungus Apiospora
montagnei. Journal of Natural Products 67: 1058–1063.
Koskela P (1983) Arthrinium glahosum, a new hyphomycetous
species. Karstenia 23: 13–14.
Larrando JV, Calvo MA (1990) Two new species of Arthrinium from
Spain. Mycologia 82: 396–398.
Larrando JV, Calvo MA (1992) New contributions to the study of the
genus Arthrinium. Mycologia 84: 475–478.
Lumbsch HT, Huhndorf SM (2010) Outline of Ascomycota – 2009.
Fieldiana, Life and Earth Sciences 1: 1–42.
Lee S, Groenewald JZ, Crous PW (2004) Phylogenetic reassessment
of the coelomycete genus Harknessia and its teleomorph
Wuestneia (Diaporthales), and the introduction of Apoharknessia
gen. nov. Studies in Mycology 50: 235–252.
Martínez-Cano C, Grey WE, Sands DC (1992) First report of
Arthrinium arundinis causing kernel blight on barley. Plant
Disease 76: 1077.
Mavragani DC, Abdellatif L, McConkey B, Hamel C, Vujanovic V
(2007) First report of dampingoff of durum wheat caused by
Arthrinium sacchari in the semi-arid Saskatchewan fields. Plant
Disease 91: 469.
Müller E (1992) A new parasitic species of Apiospora. Boletin de la
Sociedad Argentina de Botanica, La Plata 28: 201–203.
Müller E, Arx JA von (1962) Die Gattungen der didymosporen
Pyrenomyceten. Beiträge zur Kryptogamenflora der Schweiz
11(1): 1–922.
Nylander JAA (2004) MrModeltest v2.2. Uppsala: distributed by the
author. Evolutionary Biology Centre, Uppsala University.
O’Donnell K, Cigelnik E (1997) Two divergent intragenomic rDNA ITS2
types within a monophyletic lineage of the fungus Fusarium are
nonorthologous. Molecular Phylogenetics and Evolution 7: 103–116.
O’Donnell K, Kistler HC, Cigelnik E, Ploetz RC (1998) Multiple
evolutionary origins of the fungus causing Panama disease of
banana: concordant evidence from nuclear and mitochondrial
gene genealogies. Proceedings of the National Academy of
Sciences, USA 95: 2044–2049.
Pollack FG, Benjamin CR (1969) Arthrinium japonicum and notes on
Arthrinium kamtschaticum. Mycologia 61: 187–190.
Rai MK (1989) Mycosis in man due to Arthrinium phaeospermum var.
indicum. First case report. Mycoses 32: 472–475.
Ramos HP, Braun GH, Pupo MT, Said S (2010) Antimicrobial activity
from endophytic fungi Arthrinium state of Apiospora montagnei
Sacc. and Papulaspora immerse. Brazilian Archives of Biology
and Technology 53: 629–632.
Rayner RW (1970) A Mycological Colour Chart. Kew: Commonwealth
Mycological Institute.
Rehm H (1913) Ascomycetes Philippinenses, III. Philippine Journal
of Science, Section C, Botany 8: 391–405.
Ronquist F, Teslenko M, Mark P van der, Ayres DL, Darling A, Höhna
S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes
3.2: efficient Bayesian phylogenetic inference and model choice
across a large model space. Systematic Biology 61: 539–542.
Samuels GJ, McKenzie EHC, Buchanan DE (1981) Ascomycetes
of New Zealand. 3. Two new species of Apiospora and their
Arthrinium anamorphs on bamboo. New Zealand Journal of
Botany 19: 137–149.
Seifert K, Morgan-Jones G, Gams W, Kendrick B (2011) The Genera
of Hyphomycetes. [CBS Biodiversity Series 9]. Utrecht: CBS-
KNAW Fungal Biodiversity Centre.
Singh SM, Yadav LS, Singh PN, Hepat R, Sharma R, Singh SK
(2012) Arthrinium rasikravindrii sp. nov. from Svalbard, Norway.
Mycotaxon 122: 449–460.
Smith GJD, Liew ECY, Hyde KD (2003) The Xylariales: a monophyletic
order containing 7 families. Fungal Diversity 13: 185–218.
Smith H, Wingfield MJ, Crous PW, Coutinho TA (1996) Sphaeropsis
sapinea and Botryosphaeria dothidea endophytic in Pinus spp.
and Eucalyptus spp. in South Africa. South African Journal of
Botany 62: 86–88.
Suryanarayanan TS (2012) Fungal endosymbionts of seaweeds. In:
Biology of Marine Fungi (Raghukumar C, ed.): 53–70. Dordrecht:
Springer.
Theissen F, Sydow H (1915) Die Dothideales. Kritisch-systematische
Original untersuchungen. Annales Mycologici 13: 149–746.
Vilgalys R, Hester M (1990) Rapid genetic identification and
mapping of enzymatically amplified ribosomal DNA from several
Cryptococcus species. Journal of Bacteriology 172: 4238–4246.
White TJ, Bruns T, Lee J, Taylor SB (1990) Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR
Protocols: a Guide to Methods and Applications (Innis MA, Gelfand
DH, Sninsky JJ, White TJ eds): 315–322. San Diego: Academic Press.
Wingfield MJ, Beer ZW de, Slippers B, Wingfield BD, Groenewald
JZ, et al. (2012) One fungus, one name promotes progressive
plant pathology. Molecular Plant Pathology 13: 604–613.
Yanna, Hyde KD, Fröhlich J (1997) A new species of Appendicospora
from Hong Kong. Mycoscience 38: 391–393.
Zhao YM, Deng CR, Chen X (1990) Arthrinium phaeospermum
causing dermatomycosis, a new record of China. Acta Mycologica
Sinica 9: 232–235.
154 ima fUNGUS

doi:10.5598/imafungus.2013.04.01.14
IMA Fungus · volume 4 · no 1: 155–159
The Myrtle rust pathogen, Puccinia psidii, discovered in Africa
Jolanda Roux 1 , Izette Greyling 1 , Teresa A. Coutinho 1 , Marcel Verleur 2 , and Michael J. Wingfield 1
1
Forestry and Agricultural Biotechnology Institute (FABI), Department of Microbiology and Plant Pathology, University of Pretoria, Pretoria, South
Africa; corresponding author e-mail: jolanda.roux@fabi.up.ac.za
2
Sappi Forests Ltd., Pietermaritzburg, South Africa
ARTICLE
Abstract: Puccinia psidii, the cause of a disease today commonly referred to as Myrtle rust, is considered a high priority
quarantine threat globally. It has a wide host range in the Myrtaceae and it is feared that it may result in significant
damage to native ecosystems where these plants occur. The fungus is also of considerable concern to plantation forestry
industries that propagate Australian Eucalyptus species. In May 2013, symptoms of a rust disease resembling those of
P. psidii were observed on an ornamental Myrtaceous shrub in a garden in South Africa. The fungus was identified
based on DNA sequence data of the ITS and 5.8S nrRNA gene regions and here we report, for the first time, the
presence of P. psidii in Africa.
Key words:
Guava rust
Eucalyptus rust
Myrtus communis
Pucciniaceae
Uredo rangellii
Article info: Submitted: 13 June 2013; Accepted: 14 June 2013; Published: 24 June 2013.
INTRODUCTION
Puccinia psidii (Uredinales, Pucciniaceae) has been
considered as an important quarantine threat to many
countries (Glen et al. 2007). It was first described from native
guava (Psidium guajava) in Brazil in 1884 and gained notoriety
when it was found to infect various other members of the
Myrtaceae, an unusual feature for most rust fungi (Coutinho
et al. 1998, Glen et al. 2007, Carnegie et al. 2010a, Morin
et al. 2012). Puccinia psidii became particularly prominent
in the literature when it was found causing disease on nonnative
Eucalyptus species in Brazil (Jollify 1944) and it was
rapidly considered as a significant threat to the commercial
production of Eucalyptus species globally (Coutinho et al.
1998). It was also feared to threaten the survival of native
Myrtales in countries such as Australia where this order
represents a mega-diverse group of plants (Glen et al. 2007,
Morin et al. 2012).
Since the first report of P. psidii in Brazil, the rust has
been recorded in several countries of South and Central
America, including the Caribbean (Coutinho et al. 1998,
Glen et al. 2007, Graça et al. 2011, Morin et al. 2012).
It has moved, increasingly rapidly, to new environments
including California, Florida and Hawaii in the USA (Marlatt
& Kimbrough 1979, Rayachhertry et al. 1997, Uchida et al.
2006), Japan (Kawanishi et al. 2009), Australia (Carnegie
et al. 2010), and China (Zhuang & Wei 2011). Rusts in the
guava/eucalyptus rust complex are native to South and
Central America (Alfenas et al. 2005) and are feared because
of their wide host range in Myrtaceae, including over 125
species (Morin et al. 2012). Thus, the recent appearance of
P. psidii in Australia has resulted in many studies to consider
its likely long-term impact (Carnegie & Cooper 2011, Morin et
al. 2012, Kriticos et al. 2013).
Several common names have been used for the disease
caused by P. psidii. That it was first found on guava led
to it being known as Guava rust, but its appearance on
more commercially important Eucalyptus species led to
it commonly being referred to as Eucalyptus rust. When it
first appeared in Australia, there was debate regarding its
taxonomy and whether the fungus infecting a wide range
of trees in Myrtaceae might not be the rust that had been
described as Uredo rangelii (Carnegie et al. 2010, Carnegie
& Cooper 2011). While there are clearly taxonomic issues
relating to this fungus that remain to be resolved, such as
that it is not phylogenetically related to other members of the
genus Puccinia (M. Wingfield & W. Maier, unpubl. data), the
disease caused by the fungus currently treated as P. psidii is
best referred to as Myrtle rust. This captures the occurrence of
the pathogen on a very wide host range including, numerous
genera and species of Myrtales.
In May 2013, an ornamental Myrtus communis plant
growing in a residential garden in the KwaZulu-Natal province
of South Africa was discovered showing typical symptoms of
infection by P. psidii. The aim of this study was to identify the
fungus using DNA sequence data and to determine whether
one of the globally most important invasive alien plant
pathogens might have entered South Africa, which would
represent the first confirmed record of this pathogen on the
African continent.
MATERIALS AND METHODS
Leaves and shoots were taken from the infected Myrtus
communis plant, collected in brown paper bags, and
transported to the laboratory for study. The plant showed
typical symptoms of infection by Puccinia psidii. These
© 2013 International Mycological Association
You are free to share - to copy, distribute and transmit the work, under the following conditions:
Attribution:
You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).
Non-commercial: You may not use this work for commercial purposes.
No derivative works: You may not alter, transform, or build upon this work.
For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get
permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.
volume 4 · no. 1 155

Roux et al.
ARTICLE
Fig. 1. Puccinia psidii on Myrtus communis in South Africa. A. Leaf spot on Myrtus communis. B. Yellow masses of urediniospores covering a dying
M. communis shoot tip. C–D. Urediniospores with echinilations and smooth pathes (tonsures).
included leaf spots and cankers on young shoots/petioles (Fig.
1). Infected tissues were covered with yellow urediniospores.
Spores were collected directly from infected material and
used for morphological and DNA sequence studies (Table 1).
For DNA sequence studies, urediniospores were scraped
from the surface of infected material into 18 µL sterile SABAX
water. The SABAX water containing urediniospores were
incubated at 94 ºC for 10 minutes and used as template
in subsequent reactions for amplification of the ITS1, 5.8S
and ITS2 gene regions of the Internally Transcribed Spacer
regions of the nuclear rDNA. Amplification reactions were
performed in a final reaction volume of 25 µL containing: 5
µL 5× MyTaq Reaction Buffer (Bioline, London), 0.2 mM
of each of the universal primers ITS 1-F (Gardes & Bruns
1993) and ITS 4 (White et al. 1990) and 1 U of MyTaq
DNA polymerase. The PCR conditions were as follows:
Initial denaturation at 94 ºC for 3 min followed by 30 cycles
of denaturation at 94 ºC for 1 min, annealing at 53 ºC for 1
min, and elongation at 72 ºC for 1 min. A final elongation step
at 72 ºC for 10 min followed. Products were separated using
gel electrophoresis and visualised using GelRed (Biotium,
CA).
PCR Amplification products were purified using the
Zymo research DNA Clean & Concentration - 5 kit (CA).
Fragments were sequenced, using forward and reverse
primers as described above, using the ABI Prism ® Big
Dye TM Terminator 3.0 Ready Reaction Cycle sequencing
Kit (Applied Biosystems, Foster City, CA). Sequences were
determined with an ABI PRISM 3100 Genetic Analyzer
(Applied Biosystems). DNA sequences of opposite strands
were edited and consensus sequences obtained using CLC
Main workbench v. 6.1 (CLC Bio, www.clcbio.com) and
MEGA v. 5 (Tamura et al. 2011). Sequences obtained were
submitted to NCBI’s GenBank (http://www.ncbi.nlm.nih.gov/
Genbank/index.html) with accession numbers KF220289 –
KF220293.
Sequences obtained for the rust fungus from South Africa
were subjected to a Blastn search on the NCBI database
(http://www.ncbi.nlm.nih.gov) and thereafter incorporated
into a dataset of closely related sequences for phylogenetic
analyses. After online alignment using MAFFT v. 7 (http://
mafft.cbrc.jp/alignment/server/), the programme MEGA v.
5.1 (Tamura et al. 2011) was used to check the alignments
and conduct a Maximum Likelihood analysis of the data set.
156 ima fUNGUS

Puccinia psidii in Africa
Table 1. List of Puccinia isolates used in DNA sequence analyses.
Species Origin GenBank Accession nr. Host
Puccinia psidii Australia HM448900 Agonis flexuosa
Brazil AJ536601 Psidium guajava
Brazil AJ421801 Eugenia uniflora
Brazil AJ421802 Melaleuca quinquenervia
Colombia EU711423 Syzygium jambos
Hawaii EF599768 Metrosideros polymorpha
Hawaii EU071045 Melaleuca quinquenervia
Florida AJ535659 Pimenta dioca
Japan AB470483 Metrosideros polymorpha
South Africa KF220289 Myrtus communis
South Africa KF220290 M. communis
South Africa KF220291 M. communis
South Africa KF220292 M. communis
South Africa KF220293 M. communis
Uruguay EU348742 Eucalyptus grandis
Uruguay EU348743 E. globulus
P. cygnorum EF490601 Kunzea ericifolia
ARTICLE
P. hordei AF511086 n/a
P. recondita AF511082 Triticum turgidum
Puccinia cygnorum (EF490601), P. hordei (AF511086), and
P. recondita (AF511082) were used as outgroup species in
the analyses.
Measurements of 20 urediniospores were made using
a Zeiss Axioscop compound microscope and photographic
images were captured using a Zeiss Axiocam MRc digital
camera and the AxioVision v. 4.8 (Carl Zeiss) software.
Scanning electron micrographs (SEM) were obtained directly
from urediniospores scraped from infected material using a
JSM-840 SEM (JEOL, Tokyo) at 5 kV and images captured
with Orion v. 6.60.4 (E.L.I. s.p.r.l., Brussels, Belgium).
RESULTS
The infected Myrtus communis plant showed symptoms of
leaf spot, with red margins, and the presence of abundant
yellow spore masses on young shoots and leaves (Fig. 1).
Infection resulted in the death of shoots and leaves. Only
urediniospores were observed on the plant. These ranged in
size from 15–20 (av = 19) × 12–16 (av = 14) µm. SEM of the
urediniospores revealed the presence of tonsures (smooth
patches) on the surfaces of some spores (Fig. 2).
Amplification reactions of the ITS and 5.8S gene regions
resulted in fragments of ~700 bp in length. The Blast search
on the NCBI database showed that the rust fungus from South
Africa (KF220289 – KF220293) was most closely related to
Puccinia psidii. Subsequent comparisons using ML in MEGA,
of a dataset comprising 17 sequences (Table 1) of 626 bp
in length, showed that there were no differences in the ITS
sequences between the South African collection and those
from other parts of the world. All P. psidii isolates grouped
together in a single clade, separately from the other Puccinia
species included in the analyses.
DISCUSSION
This is the first confirmed report of the Myrtle rust pathogen,
Puccinia psidii, from South Africa. There have been two
previous reports of a rust fungus on Eucalyptus in South
Africa (Knipscheer & Crous 1990, Maier et al. 2010), but
both were morphologically different to P. psidii. The present
study provides robust evidence that P. psidii is now present
in South Africa. This is an important discovery and it is one
that is of considerable concern, especially as the species is
unrecorded elsewhere in Africa.
The discovery of P. psidii in South Africa is significant
to both the commercial plantation forestry industry, as
well as the conservation of native plants and associated
ecosystems. The impact of P. psidii on plantation grown
Eucalyptus species has been shown in several previous
studies (Tommerup et al. 2003, Graça et al. 2011, Silva et al.
2013). More recently, a number of studies have shown the
broad host range of the pathogen on other Myrtaceae and the
fungus has been described as a significant threat to native
ecosystems in Australia (Morin et al. 2012). Importantly, a
study has also shown that native South African Heteropyxis
natalensis (Myrtales, Heteropyxidaceae) is highly susceptible
to infection by P. psidii (Alfenas et al. 2005).
The majority of P. psidii hosts reside in the subfamily
Myrtoideae of the Myrtaceae (Morin et al. 2012). The
susceptibility, in greenhouse studies, of South African
H. natalensis in Heteropyxidaceae, clearly shows the potential
volume 4 · no. 1
157

Roux et al.
ARTICLE
KF220289 South Africa
EU711423 Colombia
KF220291 South Africa
AJ535659 Florida Pimenta
KF220293 South Africa
100
KF220292 South Africa
KF220290 South Africa
EU348742 Uruguay Eucalyptus
HM448900 Australia Agonis
EU071045 Hawaii Melaleuca
EF599768 Hawaii Metrosideros
AB470483 Japan
AJ421802 Brazil Melaleuca
AJ421801 Brazil Eugenia
AJ536601 Brazil Psidium guajava
Puccinia psidii
EF490601 Puccinia cygnorum
AF511082 Puccinia recondita
99
AF511086 Puccinia hordei
0.02
Fig. 2. Phylogenetic tree of ITS sequence data showing identity of South Africa Puccinia psidii isolates. Maximum likelihood tree based on 626
bp from 17 taxa. Numbers below branches indicate bootstrap support values.
damage that the pathogen might pose to other families in
Myrtales. South Africa is home to three families in Myrtales
(Palgraves & Palgraves 2002), including species that are
endemic and thus of significant conservation importance.
Of these, five genera (Eugenia, Heteropyxis, Memecylon,
Syzygium, and Warneckeae) occur in the KwaZulu-Natal
Province where P. psidii has now been detected. Clearly,
much work has yet to be done to consider the potential
impact that P. psidii might have in South Africa. It is known
that P. psidii has considerable race specialisation (Coelho
et al. 2001, Aparecido et al. 2003) and it will be necessary
to determine the host range of the fungus now present, but
known only on a single host species from a single locality in
South Africa.
The fungus on Myrtus communis in South Africa is
morphologically similar to P. psidii from elsewhere in the
world. Urediniospores of the South African collection were,
however, smaller than those reported for P. psidii from
Uruguay (Perez et al. 2011) and for Uredo rangelii (Simpson
et al. 2006). SEM showed the presence of typical spines as
well as tonsures on the urediniospores. There have been
previous arguments that these tonsures are characteristic of
U. rangelii, and not P. psidii (Simpson et al. 2006, Carnegie
et al. 2010a). However, they are common on the rust now
considered to be P. psidii in Australia (Carnegie et al. 2011)
and this is also true for collections that infect Eucalyptus and
native Myrtaceae in Uruguay (Carnegie et al. 2010, Perez et
al. 2011). Although P. psidii might represent a suite of related
cryptic species (Wingfield, personal observation), in-depth
studies are needed to elucidate this question.
There are relatively limited options to manage the P. psidii
infection. Eradication of this new invasion is unlikely to be
effective because rust fungi produce abundant air-borne
spores, and will be highly dependent on rapid action. Selection
of resistant plant material will be the most durable approach.
For example, considerable variation has been identified
in susceptibility of Eucalyptus genotypes to infection by
P. psidii (Carvalho et al. 1998, Junghans et al. 2003, Silva et
al. 2012), which implies that it will be possible to restrict the
damage that might occur in commercial plantation situations.
The deployment of resistant native Myrtaceae, if present, will,
however, be more complicated than that of a commercial crop
such as Eucalyptus in South Africa. Dealing with the disease
in native ecosystems will be much more complex. Therefore,
great effort should be made to slow the movement of the
pathogen into native ecosystems, particularly in areas such
as the Western Cape, where only a single, endemic species
of Myrtaceae (Metrosideros angustifolia) occurs. In Australia,
Puccinia psidii was described as “the pinnacle of pathogens
we wanted to keep out of Australia” (Dayton & Higgins 2011).
Its appearance in South Africa is likely to have substantial
negative long-term consequences for both forestry and plant
conservation. South Africa is also likely to now provide the
bridge for P. psidii to move northwards in Africa.
158 ima fUNGUS

Puccinia psidii in Africa
ACKNOWLEDGMENTS
We thank members of the Tree Protection Co-operative
Programme (TPCP), DST/NRF Centre of Excellence in Tree Health
Biotechnology (CTHB) and the University of Pretoria for funding and
facilities to undertake this work. We also thank Mr. Alan Hall of the
microscopy unit of the University of Pretoria for the SEM photos of
the urediniospores.
REFERENCES
Alfenas AC, Zauza EAV, Wingfield MJ, Roux J, Glen M (2005)
Heteropyxis natalensis, a new host of Puccinia psidii rust.
Australasian Plant Pathology 34: 285–286.
Aparecido CC, Figueiredo MB, Furtado EL (2003) Groups of
physiological variability in Puccinia psidii populations. Summa
Phytopathologica 29: 234–238.
Booth TH, Old KM, Jovanovic T (2000) A preliminary assessment
of high risk areas for Puccinia psidii (Eucalyptus rust) in
the Neotropics and Australia. Agriculture, Ecosystems and
Environment 82: 295–301.
Carnegie AJ, Lidbetter JR, Walker J, Horwood MA, Tesoriero L, Glen
M, Priest M (2010) Uredo rangelii, a taxon in the guava rust
complex, newly recorded on Myrtaceae in Australia. Australasian
Plant Pathology 39: 463–466.
Carnegie AJ, Cooper K (2011) Emergency response to the incursion
of an exotic myrtaceous rust in Australia. Australasian Plant
Pathology 40: 346–359.
Carvalho ADO, Alfenas AC, Maffia LA, Carmo MGF (1998) Resistance
of Eucalyptus species, progenies and provenances to Puccinia
psidii. Pesquisa Agropecuária Brasileira 33: 139–147.
Coelho L, Alfenas AC, Ferreira FA (2001) Physiologic variability of
Puccinia psidii – the rust of Eucalyptus. Summa Phytopathologica
27: 295–300.
Coutinho TA, Wingfield MJ, Alfenas AC, Crous PW (1998) Eucalyptus
rust – a disease with the potential for serious international
implications. Plant Disease 82: 819–825.
Ferreira FA (1981) Ferrugem do eucalipto ocorrencia, temperatura
para geminatio de uredosporos produlfao de teliosporos,
hospedeiro alternativo e resistencia. Fitopatologia Brassileira 6:
603–604.
Dayton L, Higgins E (2011) Myrtle rust “biggest threat to ecosystem”.
The Australian, 9 April 2011, http://www.theaustralian.com.au/
news/health-science/myrtle-rust-biggest-threat-to-ecosystem/
story-e6frg8y6-1226036247221.
Glen M, Alfenas AC, Zauza EAV, Wingfield MJ, Mohammed C
(2007) Puccinia psidii, a threat to the Aus tralian environment and
economy – a review. Australasian Plant Pathology 36: 1–16.
Graça RN, Aun CP, Guimarães LMS, Rodrigues BVA, Zauza EAV,
Alfenas AC (2011) A new race of Puccinia psidii defeats the
Ppr-1 resistance gene in Eucalyptus grandis. Australasian Plant
Pathology 40: 442–447.
Graça RN, Alfenas AC, Ross-Davis, AL, Klopfenstein NB, Kim
M-S, Peever TL, Cannon PG, Uchida JY, Kadooka CY, Hauff
RD (2011) Multilocus genotypes indicate differentiation among
Puccinia psidii populations from South America and Hawaii. In:
Proceedings of the 58 th Annual Western International Forest
Disease Work Conference; 2010 October 4–8; Valemount, BC:
131–134. Flagstaff, AZ: US Forest Service, AZ Zone Forest
Health.
Joffily J (1944) Ferrugem do eucalipto. Bragantia 4: 475–487.
Junghans DT, Alfenas AC, Brommonschenkel SH, Oda S, Mello EJ,
Grattapaglia D (2003) Resistance to rust (Puccinia psidii Winter)
in Eucalyptus: mode of inheritance and mapping of a major effect
locus with RAPD markers. Theoretical and Applied Genetics
108: 175–180.
Kawanishi T, Uemastu S, Kakishima M, Kagiwada S, Hamamoto H,
Horie H, Namba S (2009) First report of rust disease on ohia and
the causal fungus in Japan. Journal of Genetic Plant Pathology
75: 428–431.
Knipscheer NS, Crous PW (1990) First record of a rust disease on
Eucalyptus. Forestry News 90(2): 22–23.
Kriticos DJ, Leriche A (2008) The current and future potential
distribution of guava rust, Puccinia psidii in New Zealand.
[MAF Biosecurity new Zealand Technical Paper no.: 2009/28].
Wellington: Ministry of Agriculture and Forestry.
Kriticos DJ, Morin L, Leriche A, Anderson RC, Caley P (2013)
Combining a climatic niche model of an invasive fungus with
its host species distributions to identify risks to natural assets:
Puccinia psidii sensu lato in Australia. PLoS ONE 8: e64479.
Doi:10.1371/journal.pone.0064479.
Maier W, Roux J, Wingfield BD, Coetzee MPA, Wingfield MJ (2010)
A new Eucalyptus rust from Mozambique and South Africa.
Proceedings of the 4th International Rusts of Forest Trees
Conference, Florence, Italy, 3–6 May 2010: 423.
Marlatt RB, Kimbrough JW (1979) Puccinia psidii on Pimenta dioica
in south Florida. Plant Disease Reporter 63: 510–512.
Morin L, Aveyard R, Lidbetter JR, Wilson PG (2012) Investigating the
host-range of the rust fungus Puccinia psidii sensu lato across
tribes of the family Myrtaceae present in Australia. PLoS ONE 7:
e35434, doi: 10.1371/journal.pone.0035434.
Palgraves KC [with Drummond RB, Moll EJ, eds] (2002) Palgrave’s
Trees of Southern Africa. Cape Town: Struik Publishers.
Perez CA, Wingfield MJ, Altier NA, Simeto S, Blanchette RA (2011)
Puccinia psidii infecting cultivated Eucalyptus and native
myrtaceae in Uruguay. Mycological Progress 10: 273–282.
Silva PHM, Miranda AC, Moraes MLT, Furtado EL, Stape JL, Alvares
CA, Sentelhas PC, Mori ES, Sebbenn AM (2013) Selecting for
rust (Puccinia psidii) resistance in Eucalyptus grandis in São
Paulo State, Brazil. Forest Ecology and Management 303: 91–
97.
Simpson JA, Thomas K, Grgurinovic CA (2006) Uredinales species
pathogenic on species of Myrtaceae. Australasian Plant
Pathology 35: 549–562.
Tommerup IC, Alfenas AC, Old KM (2003) Guava rust in Brazil – a
threat the Eucalyptus and other Myrtaceae. New Zealand Journal
of Forestry Science 33: 420–428.
Zhuang J-Y, Wei S-X (2011) Additional materials for the rust flora of
Hainan Province, China. Mycosystema 30: 853–860.
ARTICLE
volume 4 · no. 1
159

All submitted materials must be digitized and submitted electronically to d.hawksworth@nhm.ac.uk and p.crous@cbs.knaw.nl, with the
manuscript ideally in Microsoft Word. Illustrations (Line drawings (600 dpi or higher) and half tone pictures (300 dpi or higher) should be
submitted separately, never embedded in Word files. Phylogenetic trees will only be accepted when submitted as Powerpoint files, or in Adobe
(never as pictures).
The corresponding author should confirm that: (a) all named authors have agreed to publication of the work; and (b) the manuscript does
not infringe any personal or other copyright or property rights.
Papers cited as “in press” should be provided for the benefit of the referees.
The content should be structured as follows: ABSTRACT, INTRODUCTION, MATERIALS AND METHODS, RESULTS,
TAXONOMY, DISCUSSION, ACKNOWLEDGEMENTS and REFERENCES. Key words and a Running Head should also be
provided.
English-English is preferred, and used for all non-article material. Authors of articles can use American-English, provided that it is
consistent within their contributions. Words of non-English origin, like bona fide, prima facie, in vitro, in situ, should be placed in italic,
together with scientific names of any rank (e.g. Ascomycota, Dothideales, Mycosphaerellaceae, Mycosphaerella nubilosa).
Common abbreviations are as follows: h, min, s, mL, µL, mg/L, °C, Fig., d, wk, but also ITS, RPD, RFLP, rDNA, 18S etc.
Authorities of fungal taxa should be omitted from the general text, unless novelties and synonymies are listed, or nomenclatural
issues discussed. In these cases, authorities for taxa should follow the list of authors’ names, see http://www.speciesfungorum.org/
AuthorsOfFungalNames.htm, followed by the year of publication of the name. Journal abbreviations in the text (species
synonymies, descriptions, etc.) should follow the International Plant Name Index (see http://www.ipni.org/index.html).
Experimental procedures must be reproducible and must follow Good Cultural Practice (Mycological Research 106: 1378–1379), with
sequences lodged at GenBank, alignments in TreeBASE, voucher specimens in a public reference collection recognized in Index, or another
recognized in Index Herbariorum (online) or the World Directory of Collections and Cultures of Microorganisms (online), with acronym and
accession numbers (where allocated), and ex-type and other representative cultures in long-term genetic resource depositaries or collections.
For new scientific names a MycoBank number is required (see www.MycoBank.org), and should be obtained on acceptance for publication.
Collections must be cited as:
Specimens examined. Country: State/Province/County: location, substratum, date (e.g. 10 Dec. 1993), collector (e.g. S. Uper & F. Ungus)
(COLLECTION ACRONYM and ACCESSION NUMBER -- holotypus; cultures ex-holotype COLLECTION ACRONYM(S) and
ACCESSION NUMBER(S)).
Reference citation in text: References in the text should be chronological, and given in the following form: “Smith & Jones (1965) have
shown ...”, or, “some authors (Zabetta 1928, Taylor & Palmer 1970, Zabetta 1970) consider that ...”. The names of collaborating authors are
joined by an ampersand (&). Where there are three or more authors, names should be cited by the first name only, adding “et al.”, e.g. “Bowie,
Black & White (1964)” are given as “Bowie et al. (1964)” or “(Bowie et al. 1964)”. Where authors have published more than one work
in a year, to which reference is made, they should be distinguished by placing a, b, etc. immediately after the date, e.g. “Dylan (1965a, b)”.
Reference citations in text should be in ascending order of year first, followed by authors’ names. Each reference should include the full title
of the paper and journal, volume number, and the final as well as the first page number. In the case of chapters in books, the names of editors,
first and last page numbers of the articles, publisher and place of publication are needed.
Examples:
Black JA, Taylor JE (1999a) Article title. Studies in Mycology 13: 1–10.
Black JA, Taylor JE (In press) Article title. Fungal Biology.
Black JA, Taylor JE, White DA (1981) Article title. In: Book Title (KA Seifert, W Jones & P. Jones, eds): 11–30. Town (and country if not
well-known): Press.
Simpson H, Seifert KA (2000) Book Title. 2nd edn. Town (and country if not well-known): Press.
White DA (2001) Dissertation Title. PhD thesis, Department, University, Country.
Copyright / Proprietary Rights Notice:
Unless otherwise noted, the IMA holds the copyright on all materials published in IMA Fungus, whether in print or electronic form, both
as a compilation and as individual articles. All Journal content is subject to ‘fair use’ provisions of U.S. or applicable international copyright
laws (see http://www.copyright.gov/title17/92chap1.html). The following guidelines apply to individual users:
A. Individuals may view, download, print, or save Journal content for the purposes of research, teaching, and/or private study. Systematic
downloading (by robots or other automatic processes) is prohibited without explicit Publisher approval.
B. Individuals may not reproduce, post, redistribute, sell, modify or create a derivative work of any Journal content, without prior, express
written permission of the Publisher. Permission is granted, however, to provide a limited amount of print or electronic Journal content for
purposes of regulatory approval, patent and/or trademark applications or other legal or regulatory purposes.
C. Any use and/or copies of this Journal in whole or in part, must include the customary bibliographic citation, including author
attribution, date, article title, the Journal name and its URL (web site address) and MUST include the copyright notice. Individuals may
not remove, cover, overlay, obscure, block, or change any copyright notices, legends, or terms of use.
D. For permissions to reprint or copy Journal content beyond that permitted by Section 107 or 108 of the U.S. Copyright Law, contact
the Copyright Clearance Center. The fee code for users of the Transactional Reporting Service appears in each abstract and full text
article.
INSTRUCTIONS TO AUTHORS
EDITORIAL BOARD

Editorial
Mycospeak and Biobabble (1)
News
Novel Royal Penicillium Species – Cultures of lichen-forming fungi available for experimental work – Plant Health
regulations can impede fungal research and exploitation – Progress on preparing Lists of Protected Names – APS-MSA
joint meeting this summer – Interested in hosting IMC11 (2018)? – IMA Fungus citations take-off
Reports
IMA Executive Committee Meeting 2013 – International Commission on the Taxonomy of Fungi: Preparing for
IMC10 – The First International Congress of Trufficulture – ISHAM Working Group Meetings – One Fungus :
Which Gene(s) symposium
Awards and Personalia
Johanna Westerdijk Award: Martha Christensen (14)
Josef Adolf von Arx Award: Kerry O’Donnell (14)
Richard P. Korf – Mi-shou (15)
Research News
The Human Microbiome Project: fungi on human skin – Selecting the “right” genes for phylogenetic reconstruction
– Haploid Candida albicans strains and their significance
(16)
Correspondence
The road to stability – Keys to genera – Equipment for molecular mycology needed (19)
Interview
With Jens H. Petersen, author of The Kingdom of Fungi (21)
Book News (23)
Forthcoming Meetings (30)
Notices (31)
Articles
“Taiwanascus samuelsii sp. nov., an addition to Niessliaceae from the Western Ghats, Kerala, India” by Kunhiraman C. 1
Rajeshkumar, and Amy Y. Rossman
“Cryptic diversity in the Antherospora vaillantii complex on Muscari species” by Marcin Piątek, Matthias Lutz, and
5
Arthur O. Chater
“Molecular analyses confirm Brevicellicium in Trechisporales” by M. Teresa Telleria, Ireneia Melo, Margarita Dueñas, 21
Karl-Henrik Larsson, and Maria P. Paz Martín
“Microbotryum silenes-saxifragae sp. nov. sporulating in the anthers of Silene saxifraga in southern European
29
mountains” by Marcin Piątek, Matthias Lutz, and Martin Kemler
“Genera in Bionectriaceae, Hypocreaceae, and Nectriaceae (Hypocreales) proposed for acceptance or rejection” by Amy 41
Y. Rossman, Keith A. Seifert, Gary J. Samuels, Andrew M. Minnis, Hans-Josef Schroers, Lorenzo Lombard, Pedro
W. Crous, Kadri Põldmaa, Paul F. Cannon, Richard C. Summerbell, David M. Geiser, Wen-ying Zhuang, Yuuri
Hirooka, Cesar Herrera, Catalina Salgado-Salazar, and Priscila Chaverri
“Names of fungal species with the same epithet applied to different morphs: how to treat them” by David L.
53
Hawksworth, John McNeill, Z. Wilhelm de Beer, and Michael J. Wingfield
“Theissenia reconsidered, including molecular phylogeny of the type species T. pyrenocrata and a new genus Durotheca 57
(Xylariaceae, Ascomycota)” by Thomas Læssøe, Prasert Srikitikulchai, J. Jennifer D. Luangsa-ard, and Marc Stadler
“Gelatinomyces siamensis gen. sp. nov. (Ascomycota, Leotiomycetes, incertae sedis) on bamboo in Thailand” by Niwat 71
Sanoamuang, Wuttiwat Jitjak, Sureelak Rodtong, and Anthony J.S. Whalley
“Auxarthronopsis, a new genus of Onygenales isolated from the vicinity of Bandhavgarh National Park, India” by
89
Rahul Sharma, Yvonne Gräser, and Sanjay K. Singh
“The identity of Cintractia carpophila var. kenaica: reclassification of a North American smut on Carex micropoda as a 103
distinct species of Anthracoidea” by Marcin Piątek
“Luteocirrhus shearii gen. sp. nov. (Diaporthales, Cryphonectriaceae) pathogenic to Proteaceae in the South Western 111
Australian Floristic Region” by Colin Crane, and Treena I. Burgessr
“Surveys of soil and water reveal a goldmine of Phytophthora diversity in South African natural ecosystems” by
123
Eunsung Oh, Marieka Gryzenhout, Brenda D. Wingfield, Michael J. Wingfield, and Treena I. Burgess
“A phylogenetic re-evaluation of Arthrinium” by Pedro W. Crous, and Johannes Z. Groenewald 133
“The myrtle rust pathogen, Puccinia psidii, discovered in Africa” by Jolanda Roux, Izette Greyling, Teresa A.
155
Coutinho, Marcel Verleur, and Michael J. Wingfield
(2)
(6)