Revealing the Mechanism of HSP104 Transcription Initiation in the ...

Revealing the Mechanism of HSP104 Transcription Initiation in
the Yeast S.cerevisiae
Thesis submitted for the degree of
“Doctor of Philosophy”
By
Melanie R. Grably
318013778
Submitted to the Senate of the Hebrew University
March 2008

This work was carried out under the supervision of:
Professor David Engelberg

This thesis is dedicated to my family for their support.
To the wonderful people I had the chance to work with throughout the years.
To Irith for her endless (motherly) advice friendship and loving support.
Finally to Dudi, for his endless PATIENCE, understanding, motivation, belief in this
project, and last but definitely not least his friendship.
Thank you.

Summary
All living organisms are continuously exposed to sub-optimal growth conditions and
have therefore developed appropriate responses in order to survive. The response to
many of these stressful conditions is mostly regulated at the level of transcription, leading
to up-regulation of the expression of many stress-related genes. Many genes are upregulated
in response to any given stress (the ‘general stress response’) and some of these
genes are induced most strongly in response to a specific stress (the ‘specific stress
response’). Important aspects of the co-regulation of many genes by the general response
and of specific regulation by the specific stress responses have been revealed. Yet, the
relationship between these two responses is not understood. In this thesis we study the
transcriptional regulation of HSP104 of the yeast S.cerevisiae, a gene highly expressed in
response to heat shock. An early analysis of the HSP104 promoter region, through its
analysis via 5’deletion, mutagenesis and heterologous studies, showed that two different
families of transcriptional activators regulate the expression of this gene. i) Hsf1, which
upon activation by heat shock binds Heat Shock Elements (HSEs). ii) Msn2/4, which
upon activation by a broad range of stresses, bind STress Response Elements (STREs)
and are negatively regulated by the Ras/cAMP/PKA pathway. This analysis also showed
that the promoter displays a highly flexible mode of activation. It is maximally activated
in the presence of both sets of transcriptional activators but can also be activated by either
one alone. We were also able to map the elements in the promoter responsible for basal
activity (the sequence between -334 to -300) and those essential for heat shock-regulated
activity (47). These results were obtained primarily during the course of my M.Sc.
studies.
In this thesis, I describe the continuation of the effort to reveal the mechanism of
transcriptional activation of the HSP104 promoter. I describe four experimental routes.
One, continuing the approach used in the studies described above, we proceeded with
additional 5’ deletions of the HSP104 promoter (particularly the fragment between -334
and -300) attempting to obtain a finely tuned map of the sequence(s) responsible for the
basal activity of HSP104 and for other unexpected properties of the sequence between -
334 to -300. Two, using chromatin immunoprecipitation (ChIP), we monitored some of
the major changes occurring in vivo on the promoter following stress. Three, using a
i

genetic approach, we identified components of the basal transcription machinery that are
important for HSP104 promoter activity. Four, using a combination of ChIP experiments
and a genetic approach, we sought possible regulators of Hsf1.
Through the deletion analysis, we found that important part of the properties of the
34bp between -334 and -300 could be accounted for by a short HSE-like sequence
residing in -305. Using ChIP assays we show that under optimal growth conditions
nucleosomes on the HSP104 promoter contain mostly acetylated H3 and H4. However,
following heat shock there is a rapid, but transient, decrease in the concentration of
acetylated histones on the promoter which seems to be partly mediated by Msn2/4.
Namely, the Ras/PKA pathway controls H3 and H4 acetylation state via Msn2/4, thereby
governing induction of the promoter. We further show that the decrease in acetylated H3
and H4 on the promoter occurs via two distinct mechanisms. Finally, we show that Hsf1
binding to the promoter is constitutive regardless of stress conditions, but is reduced in
ras2Δ cells. Using the genetic approach, we found that Rpb4, components of the
SRB/MED coactivator complex, or of the SAGA and SWI/SNF complexes are critical for
proper HSP104 transcription. We also identified components of the basal transcription
machinery (primarily of the SAGA complex) that are critical for Hsf1 activity.
These four approaches combined allow the establishment of a model describing
the series of molecular events occurring on the HSP104 promoter before and after heat
shock.
ii

Contents
Summary………………………………………………………………....................i-ii
Introduction
The cellular stress response………………………………………………………… 2-3
General mechanisms leading to transcription initiation……………………………..3-5
Transcription under stress in S.cerevisiae…………………………………………...6-7
The HSE/Hsf1 system……………………………………………………………….7-8
The STRE/Msn2/Msn4 system……………………………………………………..8-9
Hsf1 and Msn2/4 can exclusively or cooperatively activate the yeast HSP104 gene. 10
HSP104 promoter analysis…………………………………..................................10-18
Goals of Study…………………………………………………………………...18-19
Experimental Procedures
Yeast strains, plasmids and media………………………………………..............19-20
Chromatin immunoprecipitation………………………………………………….20-21
RNA preparation and S1 analysis……………………………………………………21
Preparation of cell lysates and western blot analysis……………………...................21
β-Galactosidase assay……………………………………………………..................22
Results
The upstream 34bp fragment of the HSP104 promoter possesses unusual modular
properties………………………………………………………………………….22-28
In response to heat shock, acetylated H3 histones dissociate from the promoter
whereas acetylated H4 histones undergo deacetylation…………………………..29-32
No specific HDAC is responsible for the deacetylation of H4 on the HSP104
promoter……………………………………………………………………………...33
Hsf1 constitutively binds the HSP104 promoter…………………………………34-36
SAGA, SRB/MED and SWI/SNF are important for HSP104 promoter activity....36-43
Regulation of Hsf1…………………………………………………………..........44-47
Discussion………………………………………………………………………...47-52
References………………………………………………………………………..52-61

INTRODUCTION
The cellular stress response
Cells are continuously exposed to suboptimal growth conditions, generally
termed cellular stresses. They have developed therefore various strategies in order to
survive and even further proliferate and function under these stresses. At the
molecular level these strategies include the activation of several biochemical
machineries. First, the machinery that imposes growth arrest (3, 54, 76, 101, 106,
111, 130) in order to prevent DNA synthesis and proliferation under stress and
damaging conditions. Second, the induction (primarily at the transcriptional level) of
a small number of genes whose protein products are involved in combating the stress
and in repairing the damage inflicted (16, 20, 44, 51, 69). Cell cycle arrest could be
relieved when repair activity is completed and protective systems are active. Third,
the activation of cell death systems, that occurs if the damage is not repairable (5, 11).
This thesis focuses on the mechanisms responsible for the induction of gene
expression in response to stress. The genes expressed in response to stress could be
categorized into two different groups. One group includes genes whose expression is
required to combat the specific stress inflicted (the “specific stress response”). The
other group includes genes that encode repair and protective proteins, but their
activity is not directly relevant to the stress inflicted. They probably serve as a “just
in case” protective measure (the “general stress response”). For example, upon heat
shock, there is specific expression of heat shock protein genes (HSPs) (14, 16, 51, 81,
85), most of which are chaperones that prevent protein aggregation and maintain
proteins in their soluble and active form. However, in parallel to the induction of
HSPs, the cell also induces expression of genes whose products are responsible for
dealing with oxidative stress and/or DNA damage (20, 44, 51, 85). Similarly, when
cells are exposed to DNA damaging agents, some HSPs are induced in parallel to the
induction of DNA repair systems. The induction of many stress-related genes,
including many that are not relevant to the specific stress inflicted, renders the cell
resistant to other stresses or to more severe stresses, a phenomenon known as crossprotection
and thermotolerance (81, 107, 108).
Although revealed to a certain level in prokaryotes, many aspects of the
molecular basis of the cellular stress response in eukaryotes are still enigmatic. It is
not understood, for example, how cells sense stresses such as heat shock (what
2

cellular receptor is responsible for sensing elevated temperature?), pH, or high
concentrations of free radicals. It is also far from understood how the stress signal is
transmitted to the nucleus and affects the relevant transcriptional activator(s). Finally,
it is not known how the transcriptional machinery functions under conditions in which
many proteins are denatured or inactivated. Does the same basal transcriptional
system function under optimal conditions and under stress?
This study approaches some of these unresolved matters by addressing the
mechanism of transcription initiation under stress of one single gene, HSP104 of the
yeast Saccharomyces cerevisiae. It begins by a comprehensive analysis of the
HSP104 promoter aimed at identifying the major cis-elements involved (most of this
work was carried out in my M.Sc. studies and is therefore presented primarily in the
"Introduction" section). It continues by measuring changes in chromatin organization
that occur on the promoter in response to stress and further continues to the
identification of components of the basal transcription machinery, specifically critical
for HSP104 transcription.
Prior to focusing on what was known about HSP104 transcription when this
thesis was initiated (see page 10), I shall describe our current understanding of
transcription regulation in general, and our current knowledge of stress signaling and
stress-activated transcription factors in yeast.
General mechanisms leading to transcription initiation
Transcription initiation in eukaryotes is a complex reaction involving dozens
of proteins. The complexity of the reaction is further increased by the fact that many
aspects of it could be specific for some groups of genes and even for any given gene.
Yet, there are several major common themes in transcription initiation of all genes
transcribed by RNA PolII. It is clear that transcription initiation of all these genes
requires the presence of the core RNA PolII (12 subunits in yeast) along with proteins
forming the so called preinitiation complex [(PIC), also known as basal transcriptional
complex, reviewed in (28, 78)]. There are still debates whether this complex is
actually preformed or whether the components forming PIC are sequentially recruited
to promoters upon activation. Included in this basal transcriptional complex is the
TATA binding protein (TBP). TBP is found in a multiprotein complex called TFIID
which includes the TBP in addition to 14 proteins known as TBP associated factors
(TAFs). Curiously, although most genes require the presence of one or more TAFs
3

for their transcription, some 16% of the genes of S.cerevisiae do not need TAFs for
their transcription (59, 71, 113). However, the majority of TAFs are essential for
viability [reviewed in (48)], as are 10 of the twelve subunits of RNA PolII (23, 24).
Following binding of TFIID, more protein complexes are recruited to the promoter,
i.e., the TFIIB complex, which assists RNA PolII in selecting the transcription start
site. Then, the RNA PolII holoenzyme along with TFIIF, TFIIE, and TFIIH associate
with the promoter and form the PIC. Following establishment of PIC, promoter
melting and transcription initiation occur and are followed by hyperphoshorylation of
the C-terminal domain (CTD) of the RNA polymerase through the TFIIH kinase
activity. This leads to promoter clearance and elongation of transcription [reviewed
in (28)].
All of the above events do not occur automatically since inactive promoters
(such as promoters of heat shock genes in cells not exposed to stress) are not
accessible to TBP and the subsequent complexes. Such promoters are part of DNA
that is wrapped around histone proteins (two H2A-H2B heterodimers and a H3-H4
tetramer) which form nucleosomal structures. These nucleosomal structures are
further compacted into tightly super-coiled structures called chromatin. Therefore,
the binding of the basal transcription machinery and the formation of PIC are
hindered by these nucleosomes that have to be remodeled to enable transcription
initiation to occur. Thus, many preceding steps should take place in order to allow the
formation of PIC and transcription initiation. There is no general mechanism(s)
leading to chromatin remodeling and transcription initiation of all genes and each
promoter is activated in its own unique and specific way (2, 29, 42). Nevertheless, a
general mechanism leading to gene activation is believed to be the following. Upon
an activating signal there is binding of proteins known as transcriptional activators to
enhancer elements (also called upstream activating sequences) in the relevant
promoter and unbinding (where applicable) of transcriptional repressors. When
bound to enhancers, transcriptional activators recruit chromatin modifying complexes.
The main purpose of these chromatin modifications is to induce “melting” of
nucleosomal structures in order to reduce the histone-DNA interaction which enables
the assembly of PIC. Chromatin modifying complexes could be divided into two
general groups: i) Factors that, through the hydrolysis of ATP molecules, induce
conformational and spatial changes of nucleosomes (1, 43). ii) Factors that covalently
modify histones by either acetylation, phosphorylation, sumoylation, or methylation
4

(70, 73, 79, 122). It is believed that one of the major events leading to the "opening"
of chromatin is the acetylation of histones on conserved lysine residues. This
acetylation probably reduces interactions between histones and DNA. Acetylated
histones (generally H3 and H4) then facilitate access of other chromatin remodeling
factors which impose additional spatial changes on chromatin, followed by the
recruitment of basal transcription factors and RNA PolII [reviewed in (28, 78)].
These modifications are actually critical for proper gene activation. The above
concept is supported by numerous studies (2, 13, 21, 36, 64, 100, 103), but recent
studies reported that on some promoters it is not histone acetylation, but rather histone
deacetylation, that is related to the activation of these promoters. Particularly,
Deckert and Struhl showed that in yeast, histones H3 and H4 undergo deacetylation
on some stress-activated and galactose-induced promoters (31). They further showed
that, depending on the inducer, one single promoter can undergo different chromatin
modifications. For example, an increase in histone acetylation in response to one
stress and a decrease in histone acetylation in response to another stimulus (31).
Following chromatin remodeling and establishment of the preinitiation
complex on the promoter, transcription initiation could be further enhanced by coactivator
complexes such as SRB/MED (8, 53, 63, 125). It should be appreciated that
a plethora of factors could join any of these multi-protein complexes changing their
composition and catalytic properties from one promoter to another. The
transcriptional activators responsible for initiating the cascade of events leading to
transcription initiation are even more specific, usually involved in activation of a
limited number of genes. Many different transcriptional activators are expressed in
the cell, each responding to a narrow subset of signals, and some to a single signal
(i.e., hormones, growth factors). The different modifications occurring on the
chromatin and the enzymes involved in these modifications are also different from
promoter to promoter. Similarly, components composing the co-activator complex
SRB/MED could also vary on promoters [reviewed in (8, 10)] and even components
making up the RNA PolII holoenzyme could differ according to cellular conditions
and the particular promoter. In fact, even one subunit of RNA PolII, Rpb4, is
dispensable for cell proliferation and seems to be required only under stress
conditions (23, 89, 97, 98).
5

Transcription under stress in S.cerevisiae
Although several signal transduction pathways and some stress-induced
transcriptional activators have been identified (37, 38, 41, 87, 92, 96, 102, 133), we
have only partial answers to some of the major questions raised above with respect to
sensing the stress and in turn activating transcription. This issue is nevertheless better
understood in S.cerevisiae than in any other experimental system. A large number of
stress responsive systems have been discovered in this organism including several
transcriptional activators whose activity is induced by specific stresses (e.g. yAP1,
Gcn4, Gln3) (41, 84, 88, 92). Another activator, Hsf1, that is induced mainly by
elevated temperature, but also by other stresses [(52, 83, 90, 133) and see below] and
yet two more activators, Msn2 and Msn4 that are activated in response to any stress
[(17, 87, 110) and see below]. As promoters are usually complex, containing several
enhancer elements, it is most probable that none of these activators is acting alone on
target promoters, but cooperate with one of the other stress-induced activators (4, 29,
47), or with other activators, not necessarily induced by stress (39, 53, 65, 72, 80, 93,
123). It is still unclear how two or more activators co-act on the same promoter.
Recent studies addressed the changes in the organization of chromatin that
occur on stress responsive promoters upon activation (21, 36, 128, 135, 136). It was
found that many promoters undergo extensive chromatin remodeling (i.e.,
nucleosomal disassembly following histone acetylation) upon activation and that the
complexes responsible for this modification are in fact recruited by transcriptional
activators (21, 36, 128, 135, 136). It should be noted that most studies address the
question at the whole genome level and their conclusions are therefore grossly
general. The epistatic relationships between recruitment of transcriptional activators
and changes in chromatin structure are not well established in many cases. Also, it is
also not fully understood how RNA PolII and the factors of the basal transcription
machinery function under stresses such as heat shock, when many proteins are
denatured. One of the RNA PolII subunits, Rpb4, is essential only under stress, and
seems to be involved in the induction of some stress related genes (23, 89, 97, 98). It
may also function as a stabilizer of RNA PolII under stress (23, 104). It is not clear
whether other components of the PIC are specifically important for transcription
under stress.
In an attempt to understand these aspects of the mechanisms of transcriptional
activation under stress, we have been focusing on the HSP104 promoter. This
6

promoter manifests some activity under non-stressed conditions that is dramatically
increased under stress [see Fig. 2 and (4, 16, 47, 121)]. In the first stage of the study,
we cloned and mapped the cis-elements responsible for basal promoter activity and
those for stress induced activity [see details below and in (47)]. We found that stress
responsive activity resides between -300 and -120, a fragment that contains binding
sites for the transcriptional activators Hsf1 and Msn2/4 [see details of promoter
analysis in (47) and below in page 10 under “Hsf1 and Msn2/4 can exclusively or
cooperatively activate the yeast HSP104 gene”]. The mechanisms by which Hsf1 and
Msn2/4 modulate the promoter and render it active are not known.
The HSE/Hsf1 system
Hsf1 binds the Heat Shock Element (HSE: a repeat of the pentanucleotide 5'-
nGAAnnTTCn-3') present in the enhancer region of promoters of many genes
encoding heat shock proteins as well as a few other promoters (81, 82, 85, 109).
There is a cluster of four HSEs in the HSP104 promoter (Fig. 1). The HSE/Hsf1
system was reported in all eukaryotes studied. In S.cerevisiae HSF1 is essential for
viability (119).
It is not known how Hsf1 is regulated in lower or in higher organisms, but
phosphorylation (25, 26, 55, 58, 66, 67, 83, 90, 119, 133), oxidation (77, 94, 137)
and/or sumoylation (6, 56, 57, 60) may be involved. Yet, none of these modifications
play a crucial role in Hsf1 activation (99). They are probably involved in just fine
tuning Hsf1’s activity. Thus, signal transduction cascades controlling Hsf1 in yeast or
mammals are not well defined (25, 26, 30, 40, 52, 66, 94, 105, 120). Recently,
however, HSR1, an RNA molecule, has been shown to be essential for the activity of
Hsf1 in mammalian cells, raising a novel and attractive way for regulating
transcriptional activators (112). In yeast, regulation of Hsf1 may also involve
phosphorylation (119), but as in mammalian cells, the kinase(s) involved and the
effect of phosphorylation on Hsf1 activity are not known. Also, it was recently
reported that in S.cerevisiae, trehalose, a disaccharide known to function as a
chemical chaperone in yeast cells, also regulates Hsf1’s activity in response to heat
shock (27). In addition, it was suggested that PKA is responsible for Hsf1 regulation
(40), but many other studies showed that PKA has just a minor effect on Hsf1 [see
more details below under “Hsf1 and Msn2/4 can exclusively or cooperatively activate
the yeast HSP104 gene” and in (35, 47)].
7

In mammalian cells, Hsf1 is a monomeric cytoplasmic protein, that in
response to stress is recruited to the nucleus, trimerized and binds DNA (45, 90, 118,
133, 134). By contrast, in yeast, Hsf1 was shown to be constitutively homotrimerized
and to constitutively bind HSEs (61, 117). However, a more detailed study, that
analyzed Hsf1 binding in vivo using ChIP asays, suggested that some promoters bind
Hsf1 only following stress, similar to the case in mammalian cells (51, 135). It was
found that in Drosophila, upon activation, Hsf1 binds HSEs and recruits mediator
complexes to heat shock loci as part of a cascade of events leading to transcription
activation. In fact, this recruitment seems to involve direct interaction between Hsf1
and components of the mediator complex (95). In addition, Hsf1 of mammalian cells
has been shown to interact in vitro and in vivo with the chromatin remodeling
complex SWI/SNF (123). Chromatin remodeling activities on purified nucleosome
templates were also shown to be dependent upon their recruitment via Hsf1 (123).
These reports indeed lead to the finding that in yeast, interactions between Hsf1 and
components of the mediator do exist and that mediator complex can be recruited to
promoters via Hsf1 (39).
The STRE/Msn2/Msn4 system
As is shown in Figure 1, the promoter of HSP104 contains several repeats of
the sequence 5’ AGGGG 3’ or 5’ CCCCT 3’. These sequences are known as STress
Response Elements (STREs). STREs were originally identified in the promoters of
CTT1 and DDR2 genes [encoding the cytoplasmic catalase and DNA damage
response proteins respectively (68, 132)] whose transcription are highly induced
under oxidative stress and exposure to DNA damaging agents respectively.
Unexpectedly, it was found that CTT1 transcription was also elevated in response to
heat shock, although it does not contain any HSE (132). Furthermore, it has been
shown that DDR2 can be transcriptionally activated not only by DNA damaging
agents, but also by thirteen other stresses including osmotic shock, nitrogen starvation
oxidative stress and stationary phase (126). Promoter analysis of CTT1 and DDR2
revealed that transcription activation in response to all these stresses is dependent on
short sequences that were termed STREs (68, 86). STREs were then identified in the
promoters of hundreds of stress related genes (17, 91). The promoter of HSP104
contains three classical STREs positioned at -172, -220 and -252bp from the ATG
[Fig. 1 and ref. (47)].
8

Given that STREs are activated by many stresses and in turn induce the
transcription of hundreds of genes, many of them not to a full extent, they clearly
belong to the general, non-specific stress response (81, 107), part of the “just in case”
expression of genes, not directly relevant to the stress inflicted.
STREs serve as binding sites for two transcriptional activators, containing
Cys 2 His 2 zinc fingers, known as Msn2 and Msn4 (87, 110). Since Msn2/4 are able to
bind STREs, they are activators of the many STRE containing genes (e.g., CTT1,
DDR2, HSP12). Their transcriptional activity is stimulated by a broad range of
stresses. Indeed, the msn2∆msn4∆ double mutant shows up to ten fold reduction in
the basal and induced expression of many stress related genes and similar reduction in
the activity of STRE-dependent reporter genes (16, 44, 102, 115, 127). While the
means by which Msn2/4 are activated remain elusive, it is well established that the
Ras/cAMP/PKA pathway directly inhibits Msn2/4 translocation to the nucleus (46).
Therefore, in yeast cells deleted for RAS2 or in mutants with low cAMP levels [in
yeast, Ras proteins induce cAMP production and consequently PKA activity (18, 19)],
Msn2/4 are constantly localized to the nucleus and the cells exhibit high and relatively
constitutive expression of many stress related genes (9, 86, 116, 121, 129).
Conversely, cells expressing the constitutively active mutant of Ras2 (RAS2 val19 ) are
hypersensitive to stress and are defective in proper expression of stress related genes,
because Msn2/4 are constantly cytoplasmic (9, 46, 86, 116, 121, 129). Another level
of Msn2/4 regulation is probably protein stability. In response to numerous stresses
such as heat shock or ethanol, Msn2 has been shown to be highly unstable (33). The
instability of Msn2 is related to its nuclear localization as it is highly degraded in an
msn5 mutant [MSN5 encodes a nuclear exportin involved in the nuclear export of
many proteins (12, 32, 62)], demonstrating that constitutive nuclear localization is
detrimental to Msn2 stability (15, 33, 75). Interestingly, studies have also shown that
in response to heat shock, Msn2 is phosphorylated directly by Srb10 (Srb10 is a
component of the mediator co-activator complex SRB/MED with intrinsic kinase
activity) thereby downregulating its activity. Additional evidence demonstrating the
negative effects of Srb10 on the activity of Msn2 is that srb10 mutant cells have high
basal transcript levels of many Msn2 target genes (15, 22, 74).
9

Hsf1 and Msn2/4 can exclusively or cooperatively activate the yeast HSP104 gene
The results described in the following paragraph describe the first phase of my
analysis of HSP104 transcription initiation. As most of the data obtained in this phase
were achieved during the course of my M.Sc. studies, they are described in this
section of the “Introduction”. It should be appreciated however, that some
experiments were completed during the course of my Ph.D. studies and formed the
basis for the continuation of the work described in “Results”. These latter
experiments are also described here in order to maintain the coherence of the
“Introduction”.
HSP104 promoter analysis
As the first step towards analyzing the HSP104 promoter, we investigated the
sequence of the upstream region of HSP104 as it appears in the Saccharomyces
Genome Database (SGD website). We identified several putative cis-elements
reaching up to 700bp upstream of the first AUG codon. These putative elements
included various HSEs and STREs (Fig. 1).
-713
-750 AAGGGCACTG CTAGCTCAGC CGGAACCTAA ATTGATTAGA GTTAGCGCTA
-700 GAAACCGTGG ATGTTCAGGA CTAACGTACG ATCTACAATA TATCACCGAG
-641
-650 CCGGGGAAAT TCGATGAGGT AGTAGAACAA GATGGCGTTA AAATTGTCAT
-600 CGATTCAAAG GCGTTATTCA GCATCATTGG AAGTGAAATG GACTGGATCG
-531
-550 ACGACAAGTT GGCCTCTAAG TTTGTCTTCA AGAATCCAAA CTCCAAGGGC
-500
-500 ACATGCGGTT GTGGCGAGAG TTTCATGGTT TAAAAACCTT CTGCACCATT
-450 TTTAGAAAAA AAGAATCTAC CTATTCACTT ATTTATTCAT TTACTTATTT
-400 ATTTACATAT TTATCATACA TATTAACATT GAACCCTCCA TCGTGGTAGT
-334 -305
-350 GTTTGCTGTT CCTAACTTTT CTTTCGTTGT TCTTGTAGAT ATATATTTTT
-300 CCAGAATTTT CTAGAAGGGT TATTAATTAC AATCTTAAAC GTTCCATAAG
-250 GGGCCGCGAT TTTTTTGTTC AATTTTCAAC AGGGGGCCCA TCTCAAAGAA
-200 CTGCAAATTA TATCACAGTA AAAGGCAAAG GGGCGCAAAC TTATGCAACC
-150 TGCCAGATTA TTATATAAGG CATTGTAATC TTGCCTCAAT TCCTTCATAA
-100 TTCGTTCCTT TGTCACTTGT TCCTTTTTAC CCTTGAATCG AATCAGCAAT
-50 AACAAAGAAA AAAGAAATCA ACTACACGTA CCATAAAATA TACAGAATAT
+1 ATGAAC
Legend
STRE
HSE
STRE-like (PDS)
TATA box
Transcription initiation region
Figure 1. Sequence corresponding to 750bp of the HSP104 promoter region. Letters in green
correspond to the most 5’nucleotide in each of the deletion constructs used in our study. +1 is the first
nucleotide of the coding sequence. Putative STREs are shown in red italics, STRE-like elements in
pink and HSEs in blue; the putative TATA box is marked in green. The transcription initiation region
is underlined in black.
10

Using PCR on genomic DNA we cloned a fragment of 713bp of the promoter and
ligated it upstream to a β-galactosidase reporter gene (Fig. 2A). When introduced to
yeast cells, the -713LacZ reporter gene manifested basal activity under non heat shock
conditions which was induced 5.5 fold in response to heat shock (Fig. 2B). This
reporter activity reflected the levels of endogenous HSP104 mRNA that accumulated
thirty minutes after heat shock and dropped after one hour (Fig. 2C). We next
proceeded with 5’-deletions in order to determine the minimal promoter sequence
conferring basal and induced activities. This deletion analysis (Fig. 2A) showed that
a fragment of 334bp upstream from the first AUG gave rise to reporter activities
similar to the full length -713LacZ. A drastic decrease in basal (but not induced)
reporter activity was observed upon further removal of 34bp [-300LacZ (Fig. 2B)].
These results strongly suggested that 334bp of the promoter are essential and
sufficient for the basal activity of HSP104 promoter. 300bp of the promoter are
essential and sufficient for heat shock-induced activity. Namely, the 34bp between -
334 and -300 are dispensable for induced activity, but indispensable for HSP104
transcription under optimal growth conditions. Further analysis of those 34bp is
described below.
11

A)
5’-XhoI
-713
BamHI-3’
ATG
LacZ coding seq
-641 ATG
-531 ATG
-500 ATG
-334 ATG
-300 ATG
Legend
HSE
HSE cluster
STRE-like
STRE
100 bp
B) C)
600
500
400
SP1
30 0 C
39 0 C
Time in 39 0 C 0’ 15’ 30’ 60’ 5hrs
30 0 C
SP1
HSP104
ACTIN
300
200
100
0
-713 -641 -530 -500 -334 -300
Figure 2. A 334bp fragment of the HSP104 promoter is sufficient and essential for both basal
and induced activities in wild-type cells (the SP1 strain). A) Schematic view of various constructs
fused to LacZ coding sequence, ranging from -713bp to -300bp of the promoter. B) β-galactosidase
activity of the various constructs under optimal growth conditions (30 o C) and following heat shock
(39 o C for one hour). C) S1 analysis of endogenous HSP104 mRNA at various time points during heat
shock treatment or under optimal growth conditions.
In order to search for the cis-elements required for the heat shock induced
transcription of HSP104, the sequences downstream to -300 were further analyzed
through 5’deletions. The results are described in detail in (47). Briefly, we found that
upon deletion of the HSE cluster (Fig. 3) between -300 and -286, the reporter gene
remained responsive to heat shock due to the presence of the STREs of the promoter
(reflected by the -284LacZ construct). Removal of the first distal STRE positioned at
-252 (in the -248LacZ construct) almost abolished the responsiveness of the reporter
gene. Only residual activity remained that was just slightly induced in response to
heat shock. This induced activity of -248LacZ is due to the presence of the remaining
STREs positioned at -220 and -172 because their deletion completely abolished
reporter activity (Fig. 3B and 3C). As mentioned above, the general stress response
via the STRE/Msn2/4 system is negatively regulated by the Ras/cAMP/PKA pathway
and many stress related genes are upregulated in ras2∆ cells (9, 86, 116, 121, 129).
12

1
1
Indeed, as can be seen in Figure 4A, activity of -334LacZ under non-heat shock
conditions is derepressed and highly active in ras2∆ cells. Deletion of the HSE
cluster (-284LacZ reporter) had no effect on the activity of the promoter in ras2∆
cells. A decrease in promoter activity was in fact measured only following deletion of
sequences corresponding to STREs. These data indicated that in ras2∆ cells HSEs
play no role in HSP104 activation and that all STREs present are spontaneously
functional. These conclusions were further reinforced by mutating the various STREs
(singly and in combination) in the HSP104 promoter [data not shown; described in
(47)]. To further study the functionality of the STREs on the HSP104 promoter, we
measured the activity of the various reporter genes in msn2∆msn4∆ strain (Fig. 5A).
A)
5’-XhoI
BamHI-3’
-334 ATG
-300 ATG
-284 ATG
-280 ATG
-260 ATG
LacZ coding seq
-230 ATG
-222 ATG
-215
ATG
-200
ATG
-180
ATG
-160
ATG
100 bp
Legend
HSE
HSE cluster
STRE-like
STRE
-248 ATG
B) C)
450
400
350
300
250
200
150
SP1
5
5
4
4
3
3
2
2
1
1
0
30 0 C
39 0 C
-248 -222 -200 -160
-230 -215 -180
Fold
Activation
-334 3.6
-300 9.5
-284 9.1
-280 12.3
-260 10.5
-248 2.2
-230 1
100
50
0
-334 -284 -260
-300 -280
Figure 3. A 260bp region of the HSP104 promoter is responsible for the induced activity of the
promoter in SP1 cells. Deletion of STRE at -252 reduces overall activity and almost entirely
abolishes response of the reporter gene to heat shock. A) Schematic view of constructs whose
activities are shown in B). B) β-galactosidase activity of the various constructs at 30 o C and following
heat shock at 39 o C. The inset graph corresponds to the activity of the shorter constructs. Note the
different scale used. C) Fold induction of the activities of each construct in response to heat shock.
13

1
We first noticed that the activity of the full length -334LacZ was decreased
when compared to wild type, indicating some possible role for Msn2/4 in the basal
activity of HSP104 (compare Fig. 5 with Fig. 3). However, unexpectedly, the reporter
gene was induced to maximal levels even in the absence of these two transcriptional
activators suggesting that the induced activity could be solely provided by the
HSE/Hsf1 system. Indeed, when we deleted the HSE cluster (reflected by the -
284LacZ construct), and subjected msn2∆msn4∆ cells to heat shock, the reporter gene
was no longer induced in response to heat shock, confirming that in msn2∆msn4∆
cells, heat shock responsiveness of the reporter gene is due to the HSEs alone (Fig. 5).
This conclusion is further strengthened by measurements of the mRNA levels of
HSP104 in msn2∆msn4∆ cells which are normally induced in response to heat shock.
A) B)
900.00
800.00
700.00
600.00
500.00
400.00
ras2∆
40.00
35.00
6.5
30.00
25.00
20.00
-HS
Time in 39 0 C 0’ 15’ 30’ 60’
SP1ras2∆
SP1RAS2 val19
5hrs
30 0 C
HSP104
ACTIN
HSP104
ACTIN
300.00
200.00
100.00
3.3
15.00
10.00
5.00
6
3
1 0.00
-334 -284 -260
0.00
-300 -280 -248 -230 -222 -215 -200 -180
-160
Figure 4. HSP104 expression is derepressed in ras2∆ cells and is regulated exclusively through
STREs. A) Deletion of each STRE causes a decrease in basal (30 o C) β-galactosidase activity of the
promoter (compare 260 vs. 248; 222 vs. 215; and 180 vs. 160). The graphs shown are different in
scale. The numbers above some bars describe the fold reduction in activity as compared with the
previous bar. B) S1 analysis of HSP104 mRNA in ras2∆ and RAS2 val19 cells.
Our deletion analysis, in combination with the effects of the point mutations,
strongly suggests that the derepression of the HSP104 promoter in ras2∆ cells is
mediated exclusively via STREs. These STREs must be recognized by Msn2 and
Msn4, as they are not functional in msn2∆msn4∆ cells (see Fig. 5).
14

1
1
A) B)
350
300
msn2∆msn4∆
0.7
0.6
0.5
0.4
0.3
0.2
30 0 C
39 0 C
Time in 39 0 C 0’ 15’ 30’ 60’
Sp1msn2∆msn4∆
5hrs
30 0 C
HSP104
ACTIN
250
0.1
200
150
0.0
-284 -260 -230 -215 -180
-280 -248 -222 -200 160
100
50
0
-334 -300
Figure 5. Msn2/4 contribute to the basal and induced activities of the HSP104 promoter. A)
The β-galactosidase activity of each reporter was measured in msn2∆msn4∆ cells under optimal growth
conditions of 30 o C and following heat shock at 39 o C. Note that the scale used in the inset graph is
different. B) S1 analysis of HSP104 mRNA in msn2∆msn4∆ cells.
Hence, we expected that knocking out MSN2 and MSN4 genes in a ras2∆
background would eliminate the derepression observed in this strain. Unexpectedly,
the activity of the -334LacZ construct in ras2∆msn2∆msn4∆ was similar to its activity
in ras2∆ (compare Fig. 6A with Fig. 4A). Further intriguing was the severe decrease
in activity observed for the -300LacZ construct. Thus, in ras2∆msn2∆msn4∆ cells,
the region between -334bp and -300bp seems to have acquired some increased
activity although this sequence was absolutely dispensable for promoter activity in
ras2∆. This observation underscores the importance of the upstream 34bp. All
constructs, downstream of -300LacZ, also displayed very low activity in
ras2∆msn2∆msn4∆ cells (Fig. 6).
15

1
1
A) B)
700
600
500
ras2∆msn2∆msn4∆
16
14
12
30 0 C
Time in 39 0 C 0’ 15’ 30’ 60’
Sp1ras2∆msn2∆msn4∆
5hrs
30 0 C
HSP104
ACTIN
400
300
10
8
6
200
4
100
25.5
2
0
-334 -300 -284 -280 -260
0
-248 -230 -222 -215 -200 -180
Figure 6. HSP104 expression in ras2∆msn2∆msn4∆ cells. A) Sequences between 334 and 300bp
of HSP104 are important for the β-galactosidase activity of the promoter in ras2∆msn2∆msn4∆ cells at
30 o C. A change in scale used in the right hand graph. The 25.5 fold decrease in activity was obtained
by dividing the activity of -334LacZ by that of -300LacZ. B) S1 analysis of HSP104.
In order to unambiguously assess that the sequences identified in our study are
indeed independently responsible for the heat shock responsiveness of the HSP104
promoter, we fused the sequences from -334 to -160, or -305 to -160 (these sequences
contain all elements responsible for the induced activity, but lack the basal promoter
region) to the CYC1 minimal promoter and checked whether the sequences derived
from the HSP104 promoter could now render the CYC1 promoter heat shock
responsive [the native CYC1 promoter is normally not induced by heat shock (data not
shown)]. Briefly, we found that the HSP104 enhancer region is indeed sufficient for
rendering the heterologous promoter responsive to heat shock (Fig. 7A). Also, the
heterologous reporters were constitutively elevated in ras2∆ cells. Namely, the
sequence we defined as an enhancer is indeed, independently, necessary and sufficient
for promoter activation and regulation in response to heat shock and in response to the
Ras pathway. Notably however, we also observed that the heterologous promoters
displayed lower basal activity compared to their homologous counterparts (compare
Fig. 7A and 2B and data not shown). These results suggest that the element we
defined as essential for the basal transcription activity (i.e., the 34bp between -334
and -300) are specific for the HSP104 promoter and functions together with its own
basal promoter and cannot function with another.
16

1
1
A) B)
units
200
180
160
140
120
100
80
60
40
20
0
SP1
30 0 C
39 0 C
+334-CYC1min -334-CYC1min +305-CYC1min
units
700
600
500
400
300
200
100
0
ras2∆
+334-CYC1min
+305-CYC1min
30 0 C
39 0 C
Figure 7. Sequences between -334 and -160bp of the HSP104 promoter contain all elements
responsible for the heat shock response and the Ras response. A) β-galactosidase activity of the
chimeric -334HSP104-CYC1-LacZ and -305HSP104-CYC1-LacZ constructs were assayed in the wild
type strain SP1 at 30 o C and at 39 o C. ‘-‘ is the inverted and ‘+’ is the native orientation of the HSP104
insert with respect to the CYC1 promoter. B) Same constructs as in A) assayed in ras2∆ cells under the
same experimental conditions.
To summarize the results obtained (see Table 1), we showed, through a
combination of a genetic approach and a molecular approach (5’deletions of the
HSP104 promoter, point mutations, fusion to a heterologous promoter and the use of
several yeast mutants) that the HSE/Hsf1 and the STRE/Msn2/4 systems cooperate to
achieve maximal inducible expression. However, in the absence of one set of factors
(e.g., in msn2∆msn4∆ cells or in constructs lacking HSEs) proper induction of
HSP104 promoter is achieved exclusively through the other. We also showed that
HSP104 is constitutively derepressed in ras2 cells. This derepression is evoked
exclusively via STREs with no role for HSEs. Strikingly, in ras2∆msn2∆msn4∆ cells,
we observed that the HSP104 promoter is also derepressed via the upstream 34bp.
Thus, appropriate transcription of HSP104 is usually obtained through cooperation
between the STRE/Msn2/4 and HSE/Hsf1 systems, but each factor could activate the
promoter on its own, backing up the other. Transcription control of HSP104 is
therefore adaptive and robust, ensuring proper expression under extreme conditions
and in various mutants. Finally, we identified a 34bp fragment residing upstream to
the HSP104 enhancer that is critical for the promoter basal activity. This fragment is
highly specific to this promoter and can acquire, under particular conditions, Ras
responsive properties (i.e., in ras2∆msn2∆msn4∆ cells).
17

Table 1. Summary of the role of various fragments in HSP104 promoter
-300 to -285
Goals of Study
In this thesis, I describe the continuation of the effort to reveal the mechanism of
transcriptional activation of the HSP104 promoter. The overall goal is to obtain
sufficient data that will allow the establishment of a global model of the molecular
events leading to the activation of the HSP104 promoter. To achieve this goal, I
undertook four experimental routes. One, continuing the approach used in the studies
described above, we proceeded with additional 5’ deletions of the HSP104 promoter
(particularly the fragment between -334 and -300) attempting to identify the
sequence(s) responsible for the basal reporter activity of HSP104 and the unexpected
activity observed in the ras2∆msn2∆msn4∆ strain. Two, using chromatin
immunoprecipitation (ChIP), we monitored some of the major changes occurring in
vivo on the promoter following stress. Three, using a genetic approach, we identified
components of the basal transcription machinery that are important for HSP104
promoter activity. Four, using a combination of ChIP experiments and a genetic
approach, we sought possible regulators of Hsf1.
Through the deletion analysis, we found that important properties of the 34bp
between -334 and -300 could be accounted to a short HSE-like sequence residing in -
305. Using ChIP assays we show that under optimal growth conditions nucleosomes
on the HSP104 promoter contain mostly acetylated H3 and H4. However, following
heat shock there is a rapid, but transient, decrease in the concentration of acetylated
histones on the promoter which seems to be partly mediated by Msn2/4. It seems that
the Ras/PKA pathway controls H3 and H4 acetylation state via Msn2/4, thereby
governing induction of the promoter. We further show that the decrease in acetylated
H3 and H4 on the promoter occurs via two distinct mechanisms. Finally, we show
that Hsf1 binding to the promoter is constitutive regardless of stress conditions, but is
reduced in ras2∆ cells. Using the genetic approach, we found that Rpb4, components
18

of the SRB/MED coactivator complex, or of the SAGA and SWI/SNF complexes are
critical for proper HSP104 transcription. We also identified components of the basal
transcription machinery (primarily of the SAGA complex that are critical for Hsf1
activity.
These approaches combined allow the establishment of a model describing the
series of molecular events occurring on the HSP104 promoter before and after heat
shock.
EXPERIMENTAL PROCEDURES
Yeast strains, plasmids and media
Yeast strains used were from either the SP1 or the BY4741 genetic backgrounds
(Table 2). Yeast cultures were usually grown in YPD medium (1% yeast extract, 2%
peptone, 2% glucose). HA-Hsf1 containing the native HSF1 promoter was cloned in
pRS306 (114) expressed from its own promoter and was integrated in the URA3
locus. -334LacZ and -260LacZ were described in (47). The HSELacZ construct is
composed of the HSE cluster from HSP104 subcloned in 4 repeats upstream to the
CYC1 minimal promoter. Medium used for selecting transformants and for growth of
plasmid harboring cultures was the synthetic media, SD (0.17% yeast nitrogen base
without amino acids and NH 4 (SO 4 ) 2 , 0.5% ammonium sulphate, 2% glucose and 40
mg/ml of the required nutrients). If plasmid inserted was integrative, cells were
grown (following selection) in YPD medium. Single base pair deletions of the
HSP104 promoter from -305 to -286 were done using PCR and fused to β-
galactosidase reporter gene in -178trp using 5’XhoI and 3’BamHI restriction sites
(thereby removing the CYC1 minimal promoter). Constructs in which an internal
fragment of 78bp was deleted (∆78 promoter family) were obtained by subcloning the
various promoters into a modified pBluescript (SK+) in which the XbaI and ApaI
restriction sites were eliminated. Following subcloning, the plasmids were digested
using XbaI and ApaI enzymes thereby creating the ∆78 promoter family. Modified
promoters were then transferred back to the -178trp plasmid in XhoI and BamHI sites.
The HSFp-HA-HSF vector was constructed the following way. The promoter region
of HSF was obtained via PCR with 5’KpnI and 3’ClaI flanking restriction sites. The
HSF promoter was subcloned upstream of a BS-HA-HSF vector digested with the
19

same enzymes. BS-HA-HSF was obtained using a PCR fragment of HSF coding
region with 5’NcoI and 3’EcoRI flanking restriction sites. HSF coding region was
then cloned in frame to HA epitope in the pBluescript plasmid. The resulting HSFp-
HA-HSF was transferred to the pRS306 shuttling vector using KpnI-EcoRI restriction
sites. In order to integrate pRS306-HSFp-HA-HSF in the yeast genome, the vector
was digested with BsmI (which cuts uniquely in the URA3 marker).
Table 2. Strains used in this study
Strains Genotype Reference
SP1 MATa his3, leu2, ura3, trp1, ade8 Can. Toda et al.(1985)
TK161R2V Isogenic to SP1 but RAS2 val19 Toda et al.(1985)
Engelberg et al.
SP1ras2∆
Isogenic to SP1 but ras2::LEU2
(1994)
SP1msn2∆msn4∆ Isogenic to SP1 but msn2::HIS3 msn4::URA3 Stanhill et al.(1999)
SP1ras2mmsn2∆msn4∆ Isogenic to SP1 but ras2::LEU2 msn2::HIS3 msn4::URA3 Stanhill et al.(1999)
BY4741 MATa his3∆1, leu2∆0, ura3∆ Euroscarf collection
BY4741xª∆ Isogenic to BY4741 but x::KanMx Euroscarf collection
a represents knocked out gene
Chromatin immunoprecipitation
Cells were grown in YPD to A 600 of 0.8. Samples of 200ml were heat shocked at
39 o C and were collected at time points indicated in each experiment. Cultures were
then treated for cross linking with 40ml of 11% formaldehyde in 0.1M NaCl, 1mM
EDTA, 50mM Hepes-KOH pH7.5 (final concentration of 1% formaldehyde). Samples
were then incubated at room temperature for 20min with occasional swirling. 60ml of
3M glycine were added with an additional incubation of 5min. Cells were pelleted
and washed twice with cold TBS and once with 10ml cold FA lysis buffer/0.1%SDS
(50mM Hepes-KOH pH7.5, 150mM NaCl, 1mM EDTA, 1% Triton X-100, 0.1%
sodium deoxycholate, 1mM PMSF). Cells were then broken with glass beads
(vortexing 30" x 10) in 1ml cold FA lysis buffer/0.5%SDS. 6.5ml of cold FA lysis
buffer/0.1%SDS was added and the supernatant was centrifuged at 45 000 rpm in a 50
Ti Beckman rotor for 20min at 4 o C. Pellets were then "resuspended" in 1.2ml cold
FA lysis buffer/0.1%SDS and transferred to 1.5ml eppendorf tube. Samples were
then sonicated to get, in average, 400bp length DNA fragments (between 100-
1000bp). Samples were then centrifuged at 15000 xg for 10min at 4 o C. 3.25ml of
cold FA lysis buffer/0.1%SDS was added and samples were aliquoted and frozen in
liquid nitrogen. For IPs, 0.5ml of chromatin solution was incubated with Ab pre-
20

ound to protein G sepharose beads (Amersham) for 2hrs at 4 o C (Ab. used: 1µg anti-
HA 3F10 (Roche), 2µl anti-acetyl-Histone H4 (Upstate), 1µl anti-acetyl-Histone H3
(Upstate), 2µg anti-total H3 (abcam) and 8µl anti-histone H4 non-acetylated
(Serotec)). Beads were then washed, each time for 5min at room temperature in the
following order: twice in 1.4ml of FA lysis buffer/0.1%SDS, twice in 1.4ml FA lysis
buffer/0.1%SDS/500mM NaCl, once in 1.4ml 10mM Tris-HCl pH8, 250mM LiCl,
1mM EDTA, 0.5% NP-40, 0.5% sodium deoxycholate, and once in 1.4ml TE (10mM
Tris-HCl pH8, 1mM EDTA). Immunoprecipitated material was then eluted at 65 o C in
0.25ml of 50mM Tris-HCl pH7.5, 10mM EDTA, 1% SDS. The sup. was then
transferred to a fresh tube containing 0.250ml TE (in parallel, 50µl of chromatin
solution which had not undergone immunoprecipitation was used (and termed whole
cell extract,WCE) and followed same treatment as IP'ed material). 20µl of 20mg/ml
pronase (Boehringer Mannheim) was added and samples were incubated at 42 o C for
two hours and then transferred to 65 o C overnight for decrosslinking. 50µl of 4M LiCl
was then added and DNA was extracted with phenol-chloroform in LETS (0.1M LiCl,
0.5M EDTA, 0.01M Tris-HCl pH7.4, 0.2% SDS) and then chloroform. DNA was
then precipitated. IP's were resuspended in 200µl TE and a 1:500 stock dilutions were
prepared for input DNA. PCR reaction was done in 50µl.
RNA preparation and S1 analysis
Overnight cultures grown in YPD were diluted to A 600 of 0.25 and further grown to
A 600 of 0.8 at 30 o C. 20 ml samples were heat shocked at 39 o C for the specified time.
Protocols for RNA extraction and S1 analysis are described in (47).
Preparation of cell lysates and western blot analysis
100ml cell cultures were grown to an A 600 of 0.8. Cultures were split to 20ml samples
and each sample was treated for 5, 10, or 15 minutes at 39 o C and one sample was
maintained under control conditions of 30 o C. Cells were pelleted and the protocol
proceeded as described in (7). SDS-polyacrylamide gel electrophoresis, Western blot,
and ECL reaction were performed as described in (7). For HA-HSF, detection
antibody used was 12CA5 mouse anti-HA at a 1:1000 concentration. Secondary
antibody used was diluted to 1:10000 concentration.
21

β-Galactosidase assay
Overnight cultures were diluted to A 600 of 0.15 and further incubated at 30 o C until
cultures reached A 600 0.3-0.4. Following procedures were performed as described in
(47).
RESULTS
The upstream 34bp fragment of the HSP104 promoter possesses unusual
modular properties
Our previous analysis of the HSP104 promoter revealed that 334bp upstream
of the coding sequence are required for both basal and induced activities whereas
300bp are essential and sufficient for heat shock induced activity only. That is, the
34bp between -334 and -300 are indispensable for the basal activity of the promoter.
Yet, although supporting basal transcription, this 34bp are highly specific to the
HSP104 promoter because they played no role when the upstream fragment of the
HSP104 was fused to the minimal CYC1 promoter. Namely, when cloned upstream
to the CYC1, the fragment between -334 to -160 and the fragment between -305 to -
160 manifested the same, very low basal activity [Fig. 7 and (47)]. These results
suggest that, the activity of the 34bp fragment is not only specific to HSP104, but is
somehow cooperating with the HSP104 minimal promoter (-160-+1) to impose a
relatively high basal activity. Finally, under particular conditions (i.e., in the
ras2∆msn2∆msn4∆ strain) the 34bp acquire new properties and become Ras2
responsive (Fig. 6). Given the importance and the specificity of the 34bp, we
considered that perhaps, there is a shorter cis-element within this sequence. To
address this matter we designed a series of deletion constructs that were planned to
eliminate some potential HSEs present in the 34bp region, as well as a possibly
functional, although non-canonical, TATA box which is also present in this fragment
(Fig. 8A). We also planned a series of constructs that enabled us to monitor the
possible interplay between the 34bp and the minimal promoter. The latter was
achieved by deleting an internal 78bp fragment within the HSP104 promoter which
deletes the two most distal STREs (i.e., at -252 and -220), while leaving intact the
majority of the HSE cluster and the most proximal STRE, residing at -172 of the
22

promoter. This deletion created a promoter containing essentially only the elements
responsible for the promoter basal activity, i.e., the 34bp, separated by a short DNA
sequence, are fused to the basal promoter region (-160 to +1).
The various deletion constructs were tested first in wild type cells. As shown
in Figure 8B, sequential deletion of the putative HSEs in the 34bp (-328LacZ, -
317LacZ, -311LacZ) or further deletion of the putative TATA box (-305LacZ) did not
result in a significant decrease in the activity of the reporter genes (Fig. 8B see also
Fig. 9). Namely, we could not account the decrease in reporter activity upon removal
of the entire 34bp to the particular deletions of the sporadic HSEs or of the noncanonical
TATA box. We did observe a significant decrease in basal promoter
activity when we further removed the 5bp between -305 to -300 (Fig. 8B). All
deletion constructs lost their basal activity when the internal 78bp were removed
(compare the six bars at the left to the six bars at the right in Fig. 8B), but remained
nevertheless responsive to heat shock. These results show that the presence of the
34bp upstream fragment and the minimal -160-+1 fragment is not sufficient to impose
basal promoter activity. Perhaps these two fragments must reside in a very particular
spatial and distal orientation towards each other. An alternative explanation may be
that the missing downstream STREs are required not only for induced activity, but
also for the basal activity and are cooperating with the upstream 34bp. In addition,
when we mutated the STRE positioned at -172 we observed no further effect in the
activity of the reporter, suggesting that this STRE could be less functional or perhaps
may require the presence of the more distal STREs in order to be functional [compare
in Figure 8B 300∆78 and 300stre3m∆78; see also in (47)]. We next introduced the
various reporters to ras2∆ cells (Fig. 8C). As expected, we measured high and
spontaneous activity of the reporter gene under optimal growth conditions, which
could not be further induced in response to heat shock (upper panel). Notably, the
activity of the -300LacZ construct was lower, suggesting that in order to achieve full
response to the Ras system, the HSP104 promoter requires the 34bp upstream
fragment in addition to STREs (47). Upon deletion of the internal 78bp fragment
from all constructs, we observed two important changes in the activity of the reporters
(Fig. 8C lower panel). First, the spontaneous activity of the reporters was now
dramatically reduced; further reinforcing the fact that the HSP104 promoter is indeed
Ras responsive via two distal STREs. Second, deletion of the Ras responsive
sequences converted the reporter to being heat shock responsive, most probably due
23

to the fact that the HSEs are present and are not Ras-regulated (Fig. 8C lower panel;
compare with upper and note the difference in scale between the two graphs). We
next introduced these reporters to ras2∆msn2∆msn4∆ cells (Fig. 8D) and also
observed the high and spontaneous activity, but to levels that were about half of those
measured in ras2∆ (but still 4-6 fold higher compared to the activity in wild type). In
addition, there is some decrease in activity of most reporters as compared to -
334LacZ. Also, the decrease of the activity of the -300LacZ reporter (compared to its
activity in ras2∆ cells) is very dramatic in this strain (~30 units versus 700 units in
ras2∆). Namely, there are elements in the 34bp that are Ras responsive and can
compensate for the lack of STREs activity (due to the fact that Msn2/4 are missing).
Similar to the case in ras2∆ cells, the equivalent reporters lacking the 78bp
manifested lower basal activity, but were heat shock responsive (Fig. 8D, lower
panel). We also introduced these reporters to msn2∆msn4∆ cells (Fig. 8E) and like
we previously observed, the reporters in which we deleted the sporadic HSEs and
TATA elements do not behave any differently from their full length counterpart -
334LacZ, but the activity was significantly lower compared to that of wild type cells
(compare Figs. 8E to 8B). Also, in msn2∆msn4∆ cells the internal 78bp are not
significant clearly showing that the contribution of the 78bp fragment to basal
promoter activity requires intact Msn2/4.
24

1
1
1
1
1
1
A)
34bp 5’ ttttctttcgttgttcttgtagatatatatttttcc 3’
putative HSE
putative TATA box
B)
500.00
SP1 (WT) cells
30 o C
39 o C
450.00
400.00
350.00
300.00
250.00
200.00
150.00
100.00
50.00
0.00
334 328 317 311 305 300 334 317 311 305 300 300Stre3m
∆78 ∆78 ∆78 ∆78 ∆78 ∆78
1800
1600
1400
1200
1000
800
600
400
200
0
C) D)
ras2∆ cells
334 328 317 311 305 300
30 o C
39 o C
800
700
600
500
400
300
200
100
0
ras2∆msn2∆msn4∆ cells
334 328 317 311 305 300
30 o C
39 o C
160
140
120
100
30 o C
39 o C
300
250
200
30 o C
39 o C
80
60
150
40
100
20
0
50
334 317 311 305 300 300stre3m
∆78 ∆78 ∆78 ∆78 ∆78 ∆78
msn2∆msn4∆ cells
0
334 317 311 305 300 300stre3m
∆78 ∆78 ∆78 ∆78 ∆78 ∆78
30 o C
E)
300
250
39 o C
200
150
100
50
0
334 328 317 311 305 300 334 317 311 305 300 300Stre3m
∆78 ∆78 ∆78 ∆78 ∆78 ∆78
Figure 8. Deletion analysis of the 34bp fragment. A) Sequence of the 34bp fragment of HSP104
required for proper basal activity. B) Activity of the various deletions of the 34bp and their ∆78
counterparts (missing enhancer elements) in wild type SP1. C) Same as in B but measured in ras2∆
cells. Note the difference in scale used in upper and lower graphs. D) Same as above but in
ras2∆msn2∆msn4∆. Note the difference in scale used in upper and lower graphs. E) Same as above
but measured in msn2∆msn4∆ cells. These are the results of duplicates in a single assay; hence no STD
could be calculated.
25

The systematic 5’ deletion analysis of the upstream 34bp pointed at the
sequence between -305 and -300 as important. This 5bp contains a single HSE site.
Although HSEs are normally active in response to heat shock, this site seems to
partially contribute to the basal transcription activities of the promoter and even to its
Ras2-mediated response. It may also be part of the HSE cluster residing (according
to our original mapping) between -300 and -285. To test the role of these 5bp and the
downstream cluster of HSEs in a most fine tuned manner, we continued and
proceeded with additional 5’deletions in which we systematically deleted a single
nucleotide at a time from -305 to -286 (Fig. 9A). In wild type cells, deletions between
-305 and -302 had no effect. The -302LacZ construct still contains the full putative
HSE sequence. The -301LacZ construct, which lacks only one nucleotide of the
perfect HSE cis-element, demonstrated reduced activity that was actually similar to
that of -300LacZ. We further verified the activity of these deletions in msn2∆msn4∆
cells (Fig 9B). Thus, we were able to map most properties of the 34bp to the single
HSE element at -302. In other words, the HSE positioned at -302 is essential for the
high basal activity of the HSP104 promoter. This result could also be interpreted by
suggesting that the HSE cluster (-302 to -285) should be intact to support basal
transcription. Since Hsf1 is known to be the sole regulator in the absence of Msn2/4
[Fig. 5 and (47)], we also measured the ability of the various constructs to respond to
heat shock in the absence of Msn2/4. Our previous, somewhat crude, mapping
showed that this heat shock response requires the HSE cluster residing between -300
to -285. Our current, fine tuned mapping showed, quite strikingly, that HSEs
upstream to -294 are essential for the heat shock response of HSP104. Additional
constructs downstream to -294bp displayed no activity even though still containing
some HSEs (Fig. 9B). As mentioned in the “Introduction”, the activity of the -
334LacZ reporter in ras2∆msn2∆msn4∆ cells was similar if not identical to that in
ras2∆ cells, but -300LacZ showed very low activity in ras2∆msn2∆msn4∆ and high in
ras2∆ (47). We tested therefore the activity of -302LacZ in ras2∆msn2∆msn4∆ cells.
As shown in Fig 9C, the pattern of activity of the -301LacZ and -302LacZ reporters is
quite similar to that in wild type cells but levels are slightly higher. Importantly, in
ras2∆msn2∆msn4∆ cells, the activity of the -302LacZ reporter is about 10 fold higher
than the activity of -300LacZ. In fact, results obtained in ras2∆msn2∆msn4∆
certainly suggest a role for the HSE at -302 in explaining the high spontaneous
activity of the promoter in ras2∆ cells. Namely, in cells lacking Ras2, and in the
26

absence of Msn2/4, the HSE takes over and allows high spontaneous promoter
activity.
27

1
A)
units
100.00
90.00
80.00
70.00
60.00
50.00
40.00
30.00
20.00
10.00
0.00
30 o C
SP1 (WT) cells
334 303 301 299 297 295 293 291 289 287 285 280
305 302 300 298 296 294 292 290 288 286 284 260
B)
msn2∆msn4∆ cells
30 o C
39 o C
400.00
350.00
300.00
250.00
units
200.00
150.00
100.00
50.00
0.00
334 305 303 302 301 300 299 298 297 296 295 294
C)
900.00
800.00
700.00
600.00
ras2∆msn2∆msn4∆ cells
30 o C
strains
500.00
400.00
300.00
200.00
100.00
0.00
334 303 301 299 297 295 293 291 289 287 285 280
305 302 300 298 296 294 292 290 288 286 284 260
Figure 9. Fine tune (single base deletion) analysis of the -305 to -284 fragment. The activity of
single base deletions of HSP104 reporters were measured in SP1 (A), in msn2∆msn4∆ (B) and in
ras2∆msn2∆msn4∆ (C).
28

In response to heat shock, acetylated H3 histones dissociate from the promoter
whereas acetylated H4 histones undergo deacetylation
The genetic and molecular evidence obtained so far show that Hsf1 and
Msn2/4 are responsible for both basal and inducible activities of the HSP104
promoter [Figs. 2, 3, 5 and further details in (47)]. We do not know, however, how
these transcriptional activators directly affect the promoter to render it active. As the
major effect of transcriptional activators is remodeling of the chromatin, particularly
imposing histone acetylation or deacetylation, we monitored the acetylation state of
histones H3 and H4 residing on the HSP104 promoter. We performed ChIP assays
that allow in vivo monitoring of the promoter-bound histones. We first tested the
status of H3 histones (Fig. 10). Using anti-acetylated H3 antibodies in the ChIP
assay, we observed that under optimal growth conditions acetylated H3 molecules
occupy the promoter in all strains tested (Fig. 10A). Importantly, however, the
HSP104 promoter in ras2∆ cells is less occupied with acetylated H3 under non-heat
shock conditions (Fig. 10A).
Next, we measured the status of H3 histones following stress. ChIP analysis
shows that in all strains tested, acetylated H3 histones are scarcely detectable on the
promoter, five to seven minutes following heat shock (Fig. 10B). The decrease
observed in acetylated histone H3 on the promoter was very short lived in wild type
and in ras2∆ cells (Fig. 10B). Fifteen minutes after the beginning of heat shock,
acetylated histone H3 was again occupying the promoter at the same level as before
heat shock. In strains with deleted MSN2 and MSN4, acetylated histones did not
reoccupy the promoter indicating that Msn2/4 may have a role in the process (Fig.
10B).
The loss of acetylated H3 from the HSP104 promoter shortly after heat shock
could be achieved by either of the following mechanisms: 1) Histone deacetylation.
2) Specific removal of acetylated histones from nucleosomes. 3) Total disassembly of
nucleosomes. To distinguish between these possibilities, we performed a ChIP assay
using anti H3 antibodies. As shown in Figure 10C, we observed partial reduction in
H3 promoter occupancy following heat shock. At the same time, acetylated H3
molecules are not detected (Figs. 10B and 10C). The results strongly suggest that
acetylated H3 is specifically removed from the promoter in response to heat shock
whereas non-acetylated H3 remains bound. Namely, there seems to be partial
29

nucleosome disassembly involving specifically the removal of only acetylated H3
molecules from the HSP104 promoter in response to heat shock.
A)
Strain
W.T.
msn2∆msn4∆
ras2∆
ras2∆msn2∆msn4∆
RAS2 val19
IP:ace H3
WCE
B) C)
Strain
W.T.
msn2∆msn4∆
Heat Shock
-
7’
10’
15’
-
5’
10’
15’
SP1
IP: ace H3
IP: ace H3
Heat Shock
-
5’
10’
15’
WCE
WCE
IP:totH3
IP:aceH3
Strain
ras2∆
ras2∆msn2∆msn4∆
WCE
Heat Shock
-
5’
10’
15’
-
5’
10’
15’
IP: ace H3
IP: ace H3
WCE
WCE
Figure 10. Under non-heat shock conditions, some histone H3 molecules are acetylated on the
HSP104 promoter and in response to heat shock, acetylated H3 histones dissociate from
nucleosomes. A) ChIP analysis using anti-acetylated H3 antibodies, to monitor the presence of the
protein on the HSP104 promoter of the indicated strains, grown under optimal growth conditions. B)
Acetylated state of histones H3 was monitored via ChIP assays on the HSP104 promoter of wild type,
ras2∆, msn2∆msn4∆ and ras2∆msn2∆msn4∆ cells in response to heat shock. Cross-linking and further
processes of the ChIP analysis were performed at the indicated time points. C) Histone H3 undergoes
transient remodeling in response to heat shock. Antibody recognizing total histone H3 was used in
ChIP assays as well as antibody recognizing acetylated histone H3. WCE= whole cell extract.
30

Next we tested the status of H4 histones on the HSP104 promoter (Fig. 11).
Just like we observed in the case of histone H3, acetylated H4 molecules occupy the
HSP104 promoter under optimal growth conditions (Fig. 11A). Also, we detected
that less acetylated H4 histones occupy the HSP104 promoter in ras2∆ cells. These
results strongly indicate a role for Ras2 in promoting acetylated histone occupancy on
the HSP104 promoter. We next monitored the changes occurring to acetylated H4
molecules on the promoter of HSP104 following heat shock (Fig. 11B). Similarly to
acetylated H3 histones, we also observed a transient decrease in acetylated H4
molecules on the promoter in response to heat shock. In wild type cells, following a
fifteen minutes heat shock, acetylated H4 molecules reoccupied the promoter, but not
to the same level as before heat shock. Very little acetylated H4 reoccupied HSP104
promoter in strains with deleted MSN2 and MSN4, just like the case for H3 histones
(Fig. 10B). In an attempt to identify the mechanism leading to the decrease in
acetylated H4 histones in response to heat shock, we measured the presence of nonacetylated
histone H4 on the promoter in response to heat shock. As shown in Figure
11C, we could not measure non-acetylated H4 molecules in wild type cells not
exposed to heat shock (Fig. 11C, left lane). However, five minutes following heat
shock, this promoter becomes occupied with non-acetylated H4. This result is a clear
mirror image to that in Figure 11B, showing the disappearance of acetylated H4 from
the promoter. We therefore conclude that in response to heat shock, histones H4
remain associated with the promoter but undergo extensive deacetylation. A similar
mirror image is observed for the ras2∆ strain. The HSP104 promoter in this strain is
occupied with low levels of acetylated H4 under optimal conditions (Fig. 11A) and in
contrast contains increased levels of non-acetylated H4 (Fig. 11C, lane 5). As in this
strain the promoter is spontaneously active (47), it seems that reduced levels of
acetylated H4 and increased levels of non-acetylated H4 is important for promoter
activity. In summary, H3 and H4 population on the promoter is modified via two
different mechanisms. Acetylated H4 molecules undergo deacetylation whereas
acetylated H3 are removed altogether. These changes that occur in response to heat
shock and in ras2∆ cells correlate with promoter activity.
31

A)
Strain
W.T.
msn2∆msn4∆
ras2∆
ras2∆msn2∆msn4∆
RAS2 val19
IP:ace H4
WCE
B)
Strain
W.T.
msn2∆msn4∆
Heat Shock
-
7’
10’
15’
-
5’
10’
15’
15’
IP: ace H4
IP: ace H4
WCE
WCE
Strain
ras2∆
ras2∆msn2∆msn4∆
Heat Shock
-
5’
10’
15’
-
5’
10’
15’
IP: ace H4
IP: ace H4
WCE
WCE
C)
Strain
Heat Shock
msn2∆msn4∆ ras2∆ ras2∆msn2∆msn4∆
wt
- 5’ - 5’ - 5’ 10’ 15’ - 5’ 10’ 15’
IP:nonace H4
WCE
Figure 11. Under non-heat shock conditions, all histone H4 molecules are acetylated on the
HSP104 promoter and in response to heat shock, acetylated H4 histones are deacetylated. A)
ChIP analysis using anti-acetylated H4 antibodies, to monitor the presence of the protein on the
HSP104 promoter of the indicated strains, grown under optimal growth conditions. B) Acetylated state
of histones H4 was monitored via ChIP assays on the HSP104 promoter of wild type, ras2∆,
msn2∆msn4∆ and ras2∆msn2∆msn4∆ cells in response to heat shock. Cross-linking and further
processes of the ChIP analysis were performe at the indicated time points. C) Histone H4 undergoes
extensive deacetylation in response to heat shock. Antibody recognizing non-acetylated histone H4
was used for ChIP assays as well as antibody recognizing acetylated histone H4.
32

No specific HDAC is responsible for the deacetylation of H4 on the HSP104
promoter
In an attempt to identify the histone deacetylase(s) responsible for the initial
dramatic decrease in histone H4 acetylation, we used a battery of mutants, each
deleted in a gene encoding a known histone deacetylase (taken from the S.cerevisiae
knock-out library). We systematically determined the acetylation state of histone H4
following a five minute heat shock in each of the mutants. As is shown in Figure 12,
in all strains tested, we observed disappearance of acetylated H4 from the HSP104
promoter, as was also observed in the isogenic wild type strain BY4741. Thus there
seems to be no single HDAC responsible for H4 deacetylation on the HSP104
promoter. Some histone deacetylases are probably redundant (34, 73) for
deacetylating H4 on the HSP104 promoter. It may also be that yet another HDAC,
not yet identified and therefore not tested by us, is responsible for H4 deacetylation of
the HSP104 promoter.
Strain
WT
rpd3∆
hst1∆
hst2∆
hst3∆
hst4∆
Strain
WT
hda1∆
hos1∆
hos2∆
hos3∆
sir2∆
Heat Shock
- 5’ - 5’ - 5’ - 5’ - 5’ - 5’
Heat Shock - 5’ - 5’ - 5’ - 5’ - 5’ - 5’
IP:ace H4
IP:ace H4
WCE
WCE
Figure 12. None of the deletion mutants of histone deacetylases compromises the deacetylation
effect on histone H4. Mutants in which known histone deacetylases are deleted were assayed for the
level of acetylated histones H4 in response to heat shock.
33

Hsf1 constitutively binds the HSP104 promoter
Our previous promoter analysis and genetic studies revealed that HSP104
transcriptional induction is mediated by some cooperation between Hsf1 and Msn2/4
[(47); see also Figs. 2 and 3]. The dynamics of promoter occupancy by each of these
activators and the mutual relationship between them are not known. To reveal the
dynamics of promoter occupancy by Hsf1, we employed ChIP assays in wild type and
various mutant strains grown under optimal growth conditions and in response to heat
shock. We found that Hsf1 binding is constitutive under all conditions tested in wild
type cells and in the msn2∆msn4∆, ras2∆ and ras2∆msn2∆msn4∆ strains (Fig. 13A).
Notably, basal binding of Hsf1 to the HSP104 promoter in ras2∆ cells is reduced
compared to its binding in other strains (Figs. 13A and B). In order to rule out the
possibility that lower binding of Hsf1 in ras2∆ cells reflects lower steady state levels
of Hsf1 in these cells, we performed western blot analysis and observed that steady
state levels of Hsf1 are in fact identical in all strains and are not affected by heat
shock (Fig. 13C). The lower Hsf1 promoter occupancy in ras2∆ cells may be
interpreted as if the Ras cascade positively regulates Hsf1's DNA binding ability. We
believe, however, that the weaker Hsf1 binding in ras2∆ cells is a result of
constitutive binding of Msn2/4 to the promoter in this strain [(47); and Fig. 4) that
partially disturbs Hsf1’s binding. Indeed, removal of Msn2/4 from ras2∆ cells
(ras2∆msn2∆msn4∆) results in resumption of efficient binding of Hsf1 to the
promoter (Fig. 13A and B). Also, as shown above in ras2∆ cells, Hsf1 is dispensable
for HSP104 promoter activity as in these cells promoter activity was constitutively
high even after all HSEs were deleted [(47); and Fig. 4].
34

A)
Strain
W.T.
Strain
ras2∆
Integrated vector
HSFp-HA-HSF
Integrated vector
empty
HSFp-HA-HSF
Heat Shock
-
5’
10’
15’
15’
Heat Shock
-
15’
-
5’
10’
15’
IP: HA-HSF
IP: HA-HSF
WCE
WCE
Strain
msn2∆msn4∆
Strain
ras2∆msn2∆msn4∆
Integrated vector
empty
HSFp-HA-HSF
Integrated vector
empty
HSFp-HA-HSF
Heat Shock
-
15’
15’
-
5’
10’
15’
15’
Heat Shock
-
15’
-
5’
10’
15’
IP: HA-HSF
IP: HA-HSF
WCE
WCE
B) C)
Strain
Integrated vector
Heat Shock
W.T.
msn2∆msn4∆
HSFp-HA-HSF
ras2∆
- - - -
ras2∆msn2∆msn4∆
Strain
Integrated vector
Heat Shock
IB: α-HA
empty
HSFp-HA-HSF
- -
W.T.
5’
5’
10’ 15’
10’ 15’
msn2∆msn4∆
empty
HSFp-HA-HSF
- -
5’
10’ 15’
IP: HA-HSF
Strain ras2∆ ras2∆ msn2∆msn4∆
WCE
Integrated vector
Heat Shock
empty
HSFp-HA-HSF
- -
5’
10’ 15’
empty
HSFp-HA-HSF
- -
5’
10’ 15’
IB: α-HA
Figure 13. HSF constitutively binds to the HSP104 promoter. A) Wild type, ras2∆, msn2∆msn4∆
and ras2∆msn2∆msn4∆ strains were crosslinked at the indicated time points following heat shock and
ChIP was performed on HA tagged Hsf1. B) Samples of ChIP experiments shown in A (from non-heat
shocked cells) were loaded on the same gel to compare HSF binding under basal conditions in different
strains. C) Western analysis on HA-tagged Hsf1 showing similar protein level in all strains and under
all conditions.
35

Next, we attempted to directly measure the occupancy of Msn2 and Msn4 on
the promoter. Similarly to Hsf1, we constructed Ha-tagged proteins and inserted them
in the yeast genome at the URA3 locus. We were unfortunately unsuccessful in
detecting either Msn2 or Msn4 on the HSP104 promoter under normal or heat shock
conditions. Furthermore, we could not measure via ChIP assays Msn2/4 binding in
ras2∆ cells in which these two transcriptional activators are believed to constitutively
bind STREs (data not shown). We tried different variations of tagging Msn2 (either
at the N-terminus or C-terminus) and we also tried to over-express Msn2 under the
Alcohol Dehydrogenase 1 (ADH1) promoter known to be a strong constitutive
promoter. We also tried growing cells in minimal media (YNB) as opposed to rich
media (YPD). In all cases, DNA binding of the proteins was not detected although
the Msn2/4 proteins were confirmed to be expressed and active. It seems that the
inability to measure Msn2/4 binding via ChIP is not specific to our laboratory. There
is no report in the literature on successful ChIP on Msn2 or Msn4. Some reports (part
of all genome binding assay) do report on Msn2/4 binding to some promoter, (but
with very low affinity) (135). We still do not know whether the reason is technical or
conceptual (reflecting no direct association of Msn2/4 with DNA).
SAGA, SRB/MED and SWI/SNF are important for HSP104 promoter activity
The experiments described above analyzed the HSP104 promoter and
provided an insight into the events occurring on nucleosomes located on the HSP104
promoter. The experiments further showed that these events are controlled, at least in
part, by the activators Msn2/4. Having identified the major activators of the promoter
and some of their effects on chromatin organization we sought to identify the basal
transcription factors required for heat shock induced HSP104 transcription. To
uncover these factors, we tested HSP104 promoter activity in various mutants from
the Saccharomyces Genome Deletion Project. Mutants included those lacking a gene
encoding a basal transcription factor. Into each of these mutants we introduced
(separately) three reporter genes: i) -334LacZ, ii) STRE-LacZ and iii) HSE-LacZ.
Activity of the -334LacZ manifests the activity of the full length promoter. Activity
of STRE-LacZ [-260LacZ in (47)] manifests the function of the promoter activity
dependent on Msn2/4. The HSE-LacZ reporter contains the HSE cluster of HSP104
in four repeats fused to the CYC1 minimal promoter. This reporter reflects the
activity of Hsf1. 69 strains (Table 3) were tested with the three different plasmids.
36

Of those, 17 strains demonstrated lowered -334LacZ reporter activity, either under
physiological conditions or under stress conditions (Table 4), while 10 mutant strains
displayed higher activity of -334LacZ (Table 5). Nine mutant strains had no influence
on the activities of neither of the reporters and 34 strains showed reduced HSE-LacZ
activity (see details below in the next section).
37

Table 3. List of mutants in which reporter activity was measured.
β-Gal activity (% of WT) β-Gal activity (% of WT) β-Gal activity (% of WT)
Strain Cofatctor complex Uninduced Induced Uninduced Induced Uninduced Induced
HSP104 HSP104 STRE-LacZ STRE-LacZ HSE-LacZ HSE-LacZ
ahc1∆ ADA 45 66 94 70 84 80
ada2∆ ADA,SAGA 56 117 57 17 27 65
ada3∆ ADA,SAGA 42 74 8 7 2 1
gcn5∆ ADA,SAGA 23 69 99 17 13 20
ada1∆ SAGA 60 88 72 81 56 84
spt3∆ SAGA 41 81 213 52 22 34
spt7∆ SAGA 58 16 325 37 6 8
spt8∆ SAGA 59 101 77 31 26 37
yer049∆ NuA3 68 89 70 55 71 64
yer1101∆ NuA3 75 115 74 206 79 75
sas3∆ NuA3 3 7 0 2 7 6
eaf3∆ NuA4 49 93 215 173 86 74
bdf1∆ TFIID 225 135 742 122 46 67
bdf2∆ TFIID 48 72 91 127 90 101
elp3∆ HAT 116 185 227 140 156 111
ayt1∆ HAT 52 62 172 96 67 53
hpa2∆ HAT 43 55 124 83 52 53
hpa3∆ HAT 62 88 88 157 29 32
sas2∆ HAT 71 90 0 35 59 60
rpd3∆ HDAC 56 70 142 93 69 65
hda1∆ HDAC 40 58 162 224 44 44
hos1∆ HDAC 56 61 97 132 111 92
hos2∆ HDAC 36 64 33 55 35 26
hos3∆ HDAC 64 65 77 47 23 30
sir2∆ HDAC 38 71 29 77 38 46
hst1∆ HDAC 36 55 80 105 72 56
hst2∆ HDAC 59 85 109 116 54 41
hst3∆ HDAC 59 76 92 82 60 45
hst4∆ HDAC 74 118 87 92 66 62
tfg3∆ Multiple 62 69 259 91 4 23
swi3∆ SWI/SNF 46 96 143 95 2 14
snf5∆ SWI/SNF 60 75 150 133 187 148
snf6∆ SWI/SNF 13 50 0 0 10 23
snf11∆ SWI/SNF 47 75 40 43 121 99
rsc1∆ RSC 70 71 337 212 107 121
rsc2∆ RSC 76 50 300 129 55 72
isw1∆ ISW1 105 125 169 257 99 89
isw2∆ ISW2 40 41 65 53 133 63
chd1∆ Homodimer 74 156 143 152 149 84
not3∆ CCR4-NOT 111 125 111 209 71 56
not4∆ CCR4-NOT 111 109 1161 118 35 39
caf1∆ CCR4-NOT 227 60 237 87 15 13
38

Table 3. Con’t.
β-Gal activity (% of WT) β-Gal activity (% of WT) β-Gal activity (% of WT)
Strain Cofatctor complex Uninduced Induced Uninduced Induced Uninduced Induced
HSP104 HSP104 STRE-LacZ STRE-LacZ HSE-LacZ HSE-LacZ
caf4∆ CCR4-NOT 51 71 47 60 35 31
caf16∆ CCR4-NOT 61 65 56 83 39 38
caf40∆ CCR4-NOT 103 109 88 142 44 45
caf130∆ CCR4-NOT 65 100 86 82 102 69
dbf2∆ CCR4-NOT 62 51 342 415 32 23
dhh1∆ CCR4-NOT 319 67 873 132 17 7
srb9∆
SRB/MED,CCR4-
NOT
150 59 723 104 52 38
srb10∆
SRB/MED,CCR4-
NOT
72 15 469 41 13 6
srb2∆ SRB/MED 33 110 154 69 32 94
srb5∆ SRB/MED 10 23 78 23 12 29
srb8∆ SRB/MED 60 28 614 90 69 28
med1∆ SRB/MED 154 107 715 229 42 38
med9∆ SRB/MED 179 93 1550 484 29 32
nut1∆ SRB/MED 135 68 580 249 101 78
rox3∆ SRB/MED 86 41 1605 251 4 16
cdc73∆ Paf1 complex 11 20 11 17 4 12
rtf1∆ Paf1 complex 49 52 100 51 34 28
leo1∆ Paf1 complex 21 29 37 51 34 28
ccr4∆ CCR4-NOT,Paf1 157 43 399 107 11 5
hpr1∆ Paf1,THO/TREX 0.1 1 0 1.5 0 0.1
mft1∆ THO/TREX 4 3 5 0.1 0.4 0.5
tex1∆ THO/TREX 34 38 44 61 32 33
thp2∆ THO/TREX 48 74 192 148 68 57
dst1∆ TFIIS 25 36 182 111 58 40
spt4∆ SPT 10 2 62 8 0.5 0.3
rpb9∆ RNA PolII core 48 62 169 41 34 30
rpb4∆ RNA PolII core 2 0.4 17 0.6 1 0.4
39

Table 4. Strains required for positive regulation of HSP104.
β-Gal activity (% of WT) β-Gal activity (% of WT) β-Gal activity (% of WT)
Strain Cofatctor complex Uninduced Induced Uninduced Induced Uninduced Induced
HSP104 HSP104 STRE-LacZ STRE-LacZ HSE-LacZ HSE-LacZ
bdf1∆ TFIID 225 135 742 122 46 67
elp3∆ HAT 116 185 227 140 156 111
chd1∆ Homodimer 74 156 143 152 149 84
caf1∆ CCR4-NOT 227 60 237 87 15 13
dhh1∆ CCR4-NOT 319 67 873 132 17 7
srb9∆
SRB/MED,CCR4-
NOT
150 59 723 104 52 38
med1∆ SRB/MED 154 107 715 229 42 38
med9∆ SRB/MED 179 93 1550 484 29 32
nut1∆ SRB/MED 135 68 580 249 101 78
β-Gal activity (% of WT) β-Gal activity (% of WT) β-Gal activity (% of WT)
Strain Cofatctor complex Uninduced Induced Uninduced Induced Uninduced Induced
HSP104 HSP104 STRE-LacZ STRE-LacZ HSE-LacZ HSE-LacZ
gcn5∆ ADA,SAGA 23 69 99 17 13 20
spt7∆ SAGA 58 16 325 37 6 8
sas3∆ NuA3 3 7 0 2 7 6
hos2∆ HDAC 36 64 33 55 35 26
sir2∆ HDAC 38 71 29 77 38 46
hst1∆ HDAC 36 55 80 105 72 56
snf6∆ SWI/SNF 13 50 0 0 10 23
srb10∆
SRB/MED,CCR4-
NOT
72 15 469 41 13 6
srb2∆ SRB/MED 33 110 154 69 32 94
srb5∆ SRB/MED 10 23 78 23 12 29
srb8∆ SRB/MED 60 28 614 90 69 28
dst1∆ TFIIS 25 36 182 111 58 40
rpb4∆ RNA PolII core 2 0.4 17 0.6 1 0.4
cdc73∆ Paf1 complex 11 20 11 17 4 12
leo1∆ Paf1 complex 21 29 37 51 34 28
hpr1∆ Paf1,THO/TREX 0.1 1 0 1.5 0 0.1
mft1∆ THO/TREX 4 3 5 0.1 0.4 0.5
Table 5. Strains which induced an up-regulation of HSP104 (i.e. downregulate
HSP104).
In order to confirm that the decreased or increased reporter activities measured
in the mutants reflect indeed defects in expression of endogenous HSP104, we
performed S1 analysis to detect endogenous mRNA levels of HSP104. We first
measured RNA levels in strains which demonstrated a decrease in the β-galactosidase
activity of -334LacZ. Most strains listed in Table 4 indeed had lower RNA levels
40

either under physiological conditions or under heat shock conditions when compared
to wild type (Fig. 14). In some strains, however, such correlation was not observed.
The sas3∆ strain is an extreme case of such discrepancy. When we measured β-
galactosidase activity of the various constructs in sas3∆ cells very little or no activity
was detected. We were therefore surprised to see that an impressive amount of
HSP104 mRNA accumulated in these cells in response to heat shock. Other strains in
which RNA levels were not fully correlated to levels of reporter assays are snf6∆ and
srb2∆ that exhibited very low levels of HSP104 mRNA, but normal or close to
normal levels of β-galactosidase induced activity. In addition, in the hos2∆ and sir2∆
strains that showed some decrease in promoter activity (Table 4) endogenous HSP104
mRNA levels were not affected (data not shown). Finally, hpr1∆ cells which showed
very low or non-inducible reporter activity, expressed HSP104 mRNA at basal levels
(not induced) significantly higher than those in wild type cells (Fig. 16). We therefore
considered Hpr1 as a negative regulator of HSP104 rather than a positive regulator.
A
B
time
wt
-
Heat shock
5’
10’
15’
60’
5hrs 30 0
HSP104-LacZ(units)
-HS
+HS
51.2 273
time
hst1∆
-
5’
10’
15’
60’
5hrs 30 0
HSP104-LacZ(units)
-HS
+HS
28.1 161.2
time
wt
-
5’
Heat shock
10’
15’
60’
5hrs 30 0
time
hst1∆
-
Heat shock
5’
10’
15’
60’
5hrs 30 0
srb2∆
15.7 271.7
gcn5∆
12.8 185.4
srb2∆
srb5∆
gcn5∆
spt7∆
srb5∆
4.7 56.3
spt7∆
31.5 43.6
srb8∆
dst1∆
srb8∆
24.2 56.0
dst1∆
15.4 103.1
srb9∆
srb10∆
mft1∆
cdc73∆
srb9∆
59.9 179.6
mft1∆
2.0 5.8
med1∆
rpb4∆
srb10∆
37.4 56.1
cdc73∆
6.1 55.0
snf6∆
ACTIN
sas3∆
ACTIN
med1∆
60.6 288.4
rpb4∆
1.01 1.35
snf6∆
HSP104
7.4 175.6
sas3∆
HSP104
1.82 12.6
Figure 14. Components from the SRB/MED, SAGA and SWI/SNF complexes and RNA PolII
subunit, Rpb4, are important for proper transcription of HSP104. A) S1 RNA analysis of
HSP104 mRNA was performed on the indicated yeast strains following heat shock at the marked time
points. Table indicates β-galactosidase activity units obtained with the -334LacZ reporter in the same
strains before and after heat shock. B) Same RNAs as in A were used to measure ACTIN mRNA levels
via S1 analysis as control.
41

Overall, the results nevertheless show a general correlation between reporter
activity and mRNA levels. Namely, the genes deleted in 15 strains out of the 17
tested, encode proteins that are required for proper induction of the HSP104 promoter.
Our results strongly suggest the involvement of the SAGA complex (represented by
the spt7∆, gcn5∆ mutants), the SRB/MED coactivator complex (represented by the
srb2∆, srb5∆, srb8∆, srb9∆, srb10∆, and med1∆ mutants) as well as the SWI/SNF
chromatin remodeling complex (snf6∆ mutant) in mediating HSP104 transcription
initiation (Table 4). In addition, we also measured promoter activity and mRNA
levels of HSP104 in rpb4∆ cells and observed that HSP104 is barely, if at all, induced
in this strain in response to heat shock. Rpb4 is a RNA PolII subunit which is not
essential for growth under optimal growth conditions, but essential under stress and is
important for the activation of PolII under heat shock conditions (23, 24, 89, 97, 98).
As the components identified are part of the basal machinery we wondered whether
the defective induction of HSP104 in these mutants is specific to HSP104, or whether
the mutants demonstrate a general abnormality in inducing stress genes in response to
heat shock. To this end we measured the mRNAs of HSP26 and SSA3, two HSP
encoding genes known to be induced in response to heat shock. As shown in Figure
15, most of the mutants tested induced HSP26 and SSA3 normally, suggesting that the
failure of the mutants to properly induce HSP104 is specific. We did notice however,
that some mutants, like rpb4∆ and snf6∆, seem to have more general defects in
inducing stress genes. Curiously, SSA3 mRNA levels were spontaneously elevated in
most mutants.
WT
dst1∆
hst1∆
srb8∆
srb10∆
spt7∆
gcn5∆
srb2∆
HS - + - + - + - + - + - + - + - +
HS
srb5∆
snf6∆
rpb4∆
sas3∆
mft1∆
cdc73∆
med1∆
srb9∆
- + - + - + - + - + - + - + - +
HSP26
HSP26
SSA3
SSA3
Figure 15. Most factors required for proper induction of HSP104 are specific for this gene.
RNA from mutants that demonstrated impaired HSP104 induction in response to heat shock, were used
to measure mRNA levels of HSP26 (sample of no heat shock and ten minutes heat shock were used)
and SSA3 (sample of no heat shock and fifteen minutes heat shock were used).
42

Next, we monitored HSP104 mRNA levels in strains which, in the reporter
assay, demonstrated an increase in activity (Table 5) and are therefore mutated in
putative suppressors of HSP104 transcription. Most of these strains did demonstrate
spontaneous elevation of HSP104 mRNA levels (Fig. 16) and also manifested higher
induced levels when compared to wild type. bdf1∆, caf1∆, and srb9∆ strains,
however, demonstrated induced levels of HSP104 mRNA close to those of wild type,
and therefore were considered as non-regulators of HSP104 (data not shown).
Combining the results obtained we note that a total of 6 strains are considered to be
mutated in negative regulators of HSP104 transcription. Two of them are mutated in
components of the SRB/MED complex (med9∆ and nut1∆) the same complex that is
also involved in positively regulating HSP104. The fact that components of the same
complex both positively and negatively regulate HSP104 transcription, strongly
suggests that the SRB/MED complex may play a role in the fine tuning of the
transcription initiation of HSP104. The other four mutated strains cannot be grouped.
time
-
5’
Heat shock
10’
15’
60’
5hrs 30 0
wt
ccr4∆
chd1∆
elp3∆
med9∆
hpr1∆
ACTIN
nut1∆
HSP104
Figure 16. Some components are involved in down-regulating the transcription of HSP104. A)
S1 RNA analysis of HSP104 mRNA was performed on the indicated yeast strains following heat shock
at the marked time points (left panel). The right panel shows same RNAs as in the left panel was used
to measure ACTIN mRNA levels via S1 analysis as control.
43

Regulation of Hsf1
As explained in “Introduction”, mechanisms underlying Hsf1
activation/regulation are not revealed. Many regulators of Hsf1 have been identified,
that impose phosphorylation, sumoylation, and oxidation, but none of these
modifications seems critical. Furthermore, elements of the basal transcription
machinery that are required for Hsf1 activity were hitherto not identified. As
described in the previous section, we monitored the activity of the HSE-LacZ reporter
gene in various mutants. This reporter reflects the activity of Hsf1 only, because it
contains only HSEs upstream to the minimal promoter. Therefore, in a strain
demonstrating poor activity of this reporter, Hsf1 activity is compromised (Table 6, of
which 20 mutant strains exclusively affect activity of the HSE-LacZ reporter). Thirty
nine such strains were identified. We did not find even one strain with spontaneous
increased HSE-LacZ activity. Since strains identified are mutated in components of
the basal transcription machinery, they may be compromised in activation of many
stress-induced activators and not specifically Hsf1. In order to assess whether the
effects observed are specific to Hsf1, we tested in some of the strains the activity of
the SV40-LacZ reporter which is activated solely by the yAP-1 transcriptional
activator (Table 7). Except for one strain (sas3∆), all other 11 strains with reduced
HSE-LacZ activity that were tested, showed activity levels of the SV40-LacZ gene
similar to that of wild type (Table 7).
44

Table 6. Strains which down-regulated HSE-LacZ reporter activity (not exclusive).
Strain Cofatctor complex β-Gal activity (% of WT)
Uninduced Induced
HSP104 HSP104
β-Gal activity (% of WT)
Uninduced Induced
STRE-LacZ STRE-LacZ
β-Gal activity (% of WT)
Uninduced Induced
HSE-LacZ HSE-LacZ
ada2∆ ADA,SAGA 56 117 57 17 27 65
ada3∆ ADA,SAGA 42 74 8 7 2 1
gcn5∆ ADA,SAGA 23 69 99 17 13 20
spt3∆ SAGA 41 81 213 52 22 34
spt7∆ SAGA 58 16 325 37 6 8
spt8∆ SAGA 59 101 77 31 26 37
sas3∆ NuA3 3 7 0 2 7 6
hpa3∆ HAT 62 88 88 157 29 32
hos2∆ HDAC 36 64 33 55 35 26
hos3∆ HDAC 64 65 77 47 23 30
sir2∆ HDAC 38 71 29 77 38 46
hst2∆ HDAC 59 85 109 116 54 41
tfg3∆ Multiple 62 69 259 91 4 23
swi3∆ SWI/SNF 46 96 143 95 2 14
snf6∆ SWI/SNF 13 50 0 0 10 23
not4∆ CCR4-NOT 111 109 1161 118 35 39
caf1∆ CCR4-NOT 227 60 237 87 15 13
caf4∆ CCR4-NOT 51 71 47 60 35 31
caf16∆ CCR4-NOT 61 65 56 83 39 38
dbf2∆ CCR4-NOT 62 51 342 415 32 23
dhh1∆ CCR4-NOT 319 67 873 132 17 7
srb9∆
SRB/MED,CCR4-
NOT
150 59 723 104 52 38
srb10∆
SRB/MED,CCR4-
NOT
72 15 469 41 13 6
srb2∆ SRB/MED 33 110 154 69 32 94
srb5∆ SRB/MED 10 23 78 23 12 29
srb8∆ SRB/MED 60 28 614 90 69 28
med1∆ SRB/MED 154 107 715 229 42 38
med9∆ SRB/MED 179 93 1550 484 29 32
rox3∆ SRB/MED 86 41 1605 251 4 16
cdc73∆ Paf1 complex 11 20 11 17 4 12
rtf1∆ Paf1 complex 49 52 100 51 34 28
leo1∆ Paf1 complex 21 29 37 51 34 28
ccr4∆ CCR4-NOT,Paf1 157 43 399 107 11 5
hpr1∆ Paf1,THO/TREX 0.1 1 0 1.5 0 0.1
mft1∆ THO/TREX 4 3 5 0.1 0.4 0.5
tex1∆ THO/TREX 34 38 44 61 32 33
spt4∆ SPT 10 2 62 8 0.5 0.3
rpb9∆ RNA PolII core 48 62 169 41 34 30
rpb4∆ RNA PolII core 2 0.4 17 0.6 1 0.4
45

Table 7. Comparison between HSE-LacZ and SV40-LacZ in various mutant strains.
Strains Cofactor complex
β-Gal activity (% of WT) β-Gal activity (% of WT)
Uninduced Induced
Uninduced Induced
HSE-LacZ HSE-LacZ SV40-LacZ SV40-LacZ
ada2∆ ADA,SAGA 32 89 125 149
ada3∆ ADA,SAGA 0.5 0.4 111 111
gcn5∆ ADA,SAGA 25 40 137 126
spt3∆ SAGA 32 57 350 194
spt7∆ SAGA 6 10 169 92
spt8∆ SAGA 32 54 313 168
sas3∆ NuA3 8 6 10 9
hpa3∆ HAT 40 45 101 103
hos2∆ HDAC 35 28 67 72
hos3∆ HDAC 40 43 132 101
sir2∆ HDAC 43 47 165 102
hst2∆ HDAC 64 50 102 90
To begin and address the mechanism of action of the mutations responsible for
reduced Hsf1 activity, we tested in some of the strains the ability of Hsf1 to bind in
vivo to the HSP104 promoter. Since we showed that Hsf1 constitutively binds HSEs
on the HSP104 promoter regardless of heat shock conditions, we predicted reduced
DNA binding activity of Hsf1 in strains in which HSE-LacZ activity was low. Quite
surprisingly, we actually observed an inverse correlation between the transcriptional
activity of Hsf1 and its DNA binding activity. As is shown in Figure 17, gcn5∆,
spt7∆, caf1∆, and ccr4∆ cells which demonstrated very poor reporter activity of HSE-
LacZ (Table 6), displayed stronger binding of Hsf1 on the HSP104 promoter
compared to wild type. Perhaps in these strains stronger Hsf1 DNA binding activity
is inhibitory. Transcription repression activity of Hsf1 was previously suggested
(131). It should be noted that the studies on the mechanism of action of the mutants is
only at its beginning and a large scale study is required for revealing the role of each
factor on Hsf1 activity. Nevertheless, the finding of elements of the basal
transcription machinery that are highly specific to Hsf1 is novel and unexpected.
46

Integrated Vector empty HSFp-HA-HSF
empty
HSFp-HA-HSF
empty
HSFp-HA-HSF
empty
HSFp-HA-HSF
empty
HSFp-HA-HSF
Heat Shock - - 5’
- - 5’
- - 5’
- - 5’
- - 5’
IP: HA-HSF
WCE
Strain
BY4741
caf1∆
ccr4∆
gcn5∆
spt7∆
Figure17. Hsf1 shows stronger binding in some HSE-LacZ inefficient strains. Indicated strains
were crosslinked at the indicated time points following heat shock and ChIP was performed on HA
tagged Hsf1.
DISCUSSION
In response to stress, or to fluctuations in optimal growth conditions, cells halt
transcription of most genes. Yet, genes involved in combating stresses are
upregulated. The molecular mechanisms responsible for transcription initiation of
this group of genes are not fully revealed. This work described a systematic study
aimed at revealing these mechanisms in the S.cerevisiae HSP104 gene. This
experimental approach (elaborating on just one promoter) is somewhat different than
current prevailing strategies in the field. Common studies reported in recent years on
transcription initiation in general and in response to stress in particular, addressed coregulation
of many genes searching for common themes in their regulation (21, 36,
59, 103, 128, 135, 136). These approaches lead on one hand to important discoveries,
but on the other hand major matters are left unresolved. Most important, data
accumulated so far suggest that although common regulatory themes do exist, each
promoter is induced via specific processes. Our long-term intention is therefore to
dissect the processes of transcription initiation under stress of one gene in order to
understand its specific and unique regulation at high resolution and in a highly
detailed manner.
This thesis presents the data obtained so far in the long run toward this
ultimate goal. This data was obtained via three approaches I undertook: I) Promoter
analysis, i.e., identification of various cis-elements which are essential for regulating
promoter activity of HSP104. In order to identify the important elements and the
relationships between them for HSP104 transcription we proceeded with 5’deletions
of the promoter, point mutations and the establishment of heterologous reporter genes.
II) Monitoring modifications of histones occurring on the promoter of HSP104 in
response to heat shock. We also monitored the binding activity of the transcriptional
activator Hsf1 and attempted to measure the binding of Msn2/4 on the HSP104
47

promoter. III) The identification of components of the basal transcription machinery
involved specifically in transcriptionally activating HSP104.
The results obtained allow us to draw a detailed working model for the
molecular events occurring on the HSP104 promoter in response to heat shock (see
details in the last section of the Discussion). The first aspect of our promoter analysis
dealt with, as mentioned above, analyzing the promoter through 5’deletion [most
aspects of promoter analysis are thoroughly described in (47)]. We sought at this
stage of our study, to identify sequences which are required for the high basal activity
of -334LacZ reporter. We found the putative single HSE site between (-304 and -300)
to have an important role in this promoter activity. In fact, our fine-tuned mapping
effort did not point at an additional particular sequence within the 34bp as responsible
for the activity. We further conclude that the 34bp (particularly the HSE between -
304 and -300) may possibly be required to interact with the specific basal
transcription machinery of HSP104 (this conclusion is also based on the results with
the heterologous promoter, Fig. 7). We therefore attempted to analyze the interaction
between the 34bp with the basal transcription machinery by deleting an internal
fragment of 78bp, thereby bringing the 34bp close to the minimal promoter. The
various ∆78 constructs manifested low basal activity, suggesting that perhaps the
spatial organization between the 34bp and the basal transcription machinery is critical
for the basal activity of the HSP104 promoter. It could also be that STREs, removed
with the internal 78bp, are required for basal activity. The ∆78 constructs provided
important information about the flexibility and modularity of the promoter (Fig. 8).
Normally, there is complete cooperation between STRE/Msn2/4 and HSE/Hsf1
systems for optimal promoter activity. Yet, under specific conditions, such as in
msn2∆msn4∆ cells, HSP104 is solely activated by the HSE/Hsf1 system. Conversely,
in ras2∆ cells, the HSE/Hsf1 system is not required for the activation of HSP104
promoter activity. High activity of HSP104 in this strain is due to the hypothesized
constitutive binding of Msn2/4 to the STREs present on the promoter. This
flexibility and back-up capabilities of the HSE/Hsf1 and STRE/Msn2/4 systems are
now further expanded and include the upstream 34bp that become Ras2 responsive in
cells lacking Msn2/4 and the internal 78bp, that under various conditions, affect not
only induced, but also basal promoter activity. Namely, promoter flexibility is much
stronger than we previously suggested and many cis and trans-elements are backing
up each other to allow promoter activity under various circumstances. Measuring
48

HSP104 mRNA in different mutants show, indeed, the robustness of HSP104
transcription that is rarely affected by the absence of activators and other transcription
factors.
Through monitoring the acetylation states of histones, we suggest that
induction of HSP104 transcription requires that acetylated H3 and H4 molecules be
absent. We observed that under optimal growth conditions all H4 histones on the
HSP104 promoter are acetylated as well as major fractions of H3 histones. Under
these conditions, only in ras2∆ cells, concentrations of acetylated H3 and H4 are
lower and the promoter is even occupied with non-acetylated H4. As in this strain the
HSP104 promoter is constitutively active, there is clear correlation between promoter
activity and non-acetylated histones. Current dogma of gene activation claims that
acetylation of histones followed by the dissociation of nucleosomes from promoters is
required for promoter activation (28, 49, 50). The case for HSP104 is different.
There is no global dissociation of histones from the promoter, but rather a specific
dissociation of acetylated H3 molecules from nucleosomal structures and
deacetylation of H4 molecules. Non-acetylated H3 proteins remain associated with
nucleosomes even in response to heat shock and so do histone H4 molecules that are
now not acetylated. Although not very common, the disassembly and deacetylation
patterns we observe for HSP104 in response to heat shock should not be that
surprising. As described in Deckert et al (31) histone deacetylation can also lead to
transcription initiation of several stress-responsive genes. Also, a recent study also
demonstrated that some promoters, namely GAL induced promoters, are activated by
histone deacetylation (31).
However, our conclusion differs somewhat from that of Deckert and Struhl
(31). These investigators also monitored a dramatic decrease in acetylated histones
on the HSP104 promoter in response to heat shock [18 fold decrease of acetylated H4
and 10 fold decrease in acetylated H3 (31)]. Yet, as there was some decrease in the
level of unacetylated H4 occupancy (30%) they concluded that there is altogether
chromatin remodeling or disassembly of the nucleosomes. We suggest that the
changes on the chromatin should not be taken as all-or-non activity (disassembly, or
deacetylation). There seems to be a series of different events which we partly
revealed; i.e., histones H4 are deacetylated, and acetylated H3 molecules are
disassembled from nucleosomes. Also, these changes are transient and reflect the
dynamic nature of the changes occurring on the promoter during continuous exposure
49

to stress. This change in nucleosome composition may also be part of the shift of the
cell’s response from acute stage to adaptive stage. Perhaps fifteen minutes after heat
shock, nucleosomes are reassembled in a different combination of modified histones
and transcription continues through a different mechanism than that of the first fifteen
minutes following heat shock.
In spite of mass research it is still not possible to describe in fine details events
leading to transcription activation. To a certain extent, it is possible for some
promoters. For instance, the transcription of the HO gene, transcribed during the G1
phase of the cell cycle includes the recruitment (by a transcriptional activator) of the
chromatin remodeling complex SWI/SNF which is followed by the recruitment of
Gcn5 that acetylates histones on the nucleosomes present on the promoter.
Acetylation via Gcn5 then induces the recruitment of another transcriptional activator
to the HO promoter (29). Another study showed that within a group of HSP genes,
thought to be co-regulated, there are differences in the steps leading to their
transcription initiation (36). For instance, HSP12 which showed the highest level of
nucleosome displacement also showed highest level of histone H3 acetylation (36).
SSA4 which showed the lowest nucleosome displacement also demonstrated the
lowest acetylation state. Finally HSP82 also showed an increase in nucleosome
displacement which correlated with an increase with histone acetylation (36) and yet
all three genes are activated in response to heat shock in an Hsf1 dependent manner.
For the first time, we show that transcriptional activation of a single promoter
involves a combination of mechanisms for remodeling nucleosomes; histone
displacement (partial nucleosome disassembly) and histone deacetylation.
What factor(s) is responsible for inducing the changes observed on the HSP104
promoter? Results from our small genetic screen indicate a role for SWI/SNF in
regulating promoter activity and transcription of HSP104. The main role for
SWI/SNF is to promote nucleosome disassembly raising the question whether
SWI/SNF is responsible for disassembling acetylated histone H3 from the HSP104
promoter in response to heat shock. ChIP assays may answer this question by
monitoring acetylation state of histone H3 in response to heat shock in mutant
SWI/SNF strains (snf6∆, for example). Another open question is the identity of the
histone deacetylases (HDACs) involved in deacetylating histone H4 on the promoter
of HSP104 in response to heat shock. It is clear that these enzymes display some
redundancy in the cell (34, 73). In order to target which family of histone deacetylase
50

is responsible for deacetylating histone H4 it will be necessary to construct many
strains with combined deletions of various HDACs. Many transcriptional activators,
such as Hsf1 (in mammals), Gcn4 and Swi5 have been shown to recruit chromatin
remodeling complexes to promoters in vitro and in vivo (29, 124). Does Hsf1 in yeast
play such a role on heat shock induced promoters? As Hsf1 constitutively binds
HSP104 regardless of stress conditions, perhaps some post-translational modification
of the protein could target chromatin modifying complexes to the HSP104 promoter.
An alternative explanation is that Msn2/4 recruit the nucleosome remodeling
enzymes. The fact that the lower levels of acetylated H3 or H4 are found in ras2∆, in
which Msn2/4 are constitutively active and probably constitutively bound, supports
the notion that Msn2/4 are responsible for these changes.
Studies show that in Drosophila, Hsf1 is responsible for recruiting the
mediator complex to heat shock promoters (95). Hsf1 in S.cerevisiae was also shown
to have a role in recruiting the SRB/MED co-activator complex to Hsf1 dependent
promoters (39). Hsf1 may recruit the SRB/MED complex to the HSP104 since we
find that SRB/MED is involved in transcription initiation of HSP104. The
confirmation of such a hypothesis could be achieved by performing a successive
immunoprecipitation followed by PCR (i.e., double ChIP assays, one
immunoprecipitation against Hsf1 followed by another one against a component of
the SRB/MED complex) as components of the mediator complex have been shown to
be associated with the HSP104 promoter in response to heat shock and to other Hsf1
target genes (39). The Srb10 component of the SRB/MED complex seems to be
involved in transcription of HSP104 (Table 4). We observed that at the level of the
reporter gene activity and, more importantly, at the level of RNA production.
However, our reporter studies demonstrated that the activity of a STRE-LacZ reporter
in srb10∆ was significantly up-regulated even under non-heat shock conditions. This
result is in agreement with studies showing that Msn2 is degraded in a Srb10-
dependent manner (39). Regarding HSP104 transcription, this suggests that other
mechanisms seem to override the loss of Srb10 and that probably Srb10 in the context
of the SRB/MED complex has another function.
Through the genetic screen, we also found that Rpb4, a RNA PolII subunit, is
required for HSP104 as well as for HSP26 and SSA3 transcription [Figs. 14 and 15
and (24)]. Indeed, DNA micro array studies show that 98% of genes are
downregulated in response to heat shock in RPB4 null cells (89). Interestingly and
51

perhaps not surprisingly, overexpression of Msn2 could suppress the growth
phenotype observed for Rpb4, but only at 34 o C. It would be interesting to test
whether in rpb4∆ cells, Hsf1 binds the HSP104 promoter and whether the
modifications of histones H3 and H4 still take place.
The study presented in this thesis allows establishment of a model describing
the molecular events leading to the transcriptional activation of the HSP104 promoter:
under optimal growth conditions, the promoter is occupied by Hsf1 and acetylated
histones. Under these conditions, the promoter is only partially active via the 34bp
(most probably via the HSE at -304 to -300), but also partially via downstream STREs
(because lower basal levels are measured in msn2∆msn4∆ cells or in constructs
lacking internal STREs, the ∆78 constructs). Upon lowering cAMP levels,
permanently, such as in ras∆2 cells or under stress conditions, cells remove the
negative regulation imposed by the Ras/cAMP/PKA pathway on Msn2/4. This
enables the nuclear localization of the STRE-binding transcriptional activators which
subsequently leads to the transcriptional activation of STRE-containing genes. In
parallel, upon heat shock (which also activates Msn2/4), HSE containing promoters
are transcriptionally activated through the binding of Hsf1. In the case of HSP104,
the binding of both transcriptional activators leads to proper transcriptional activation
of this gene via the recruitment of chromatin modifying complexes (in an Msn2/4
dependent manner) which promote histone H4 deacetylation and disassembly of
acetylated H3 histones from nucleosomes. In addition to these chromatin
modifications, proper transcriptional induction could be enhanced through the
recruitment of the SRB/MED complex [perhaps via Hsf1 (39)]. Finally, the RNA
PolII is recruited, but it must be in its holoenzyme form (i.e., containing all subunits
including Rpb4)
Thus, we now have a comprehensive working model that describes the major
molecular steps leading to the transcriptional activation of the HSP104 gene.
REFERENCES
1. Aalfs, J. D., and R. E. Kingston. 2000. What does 'chromatin remodeling'
mean? Trends Biochem Sci 25:548-55.
2. Agalioti, T., S. Lomvardas, B. Parekh, J. Yie, T. Maniatis, and D. Thanos.
2000. Ordered recruitment of chromatin modifying and general transcription
factors to the IFN-beta promoter. Cell 103:667-78.
52

3. Alexander, M. R., M. Tyers, M. Perret, B. M. Craig, K. S. Fang, and M. C.
Gustin. 2001. Regulation of cell cycle progression by Swe1p and Hog1p
following hypertonic stress. Mol Biol Cell 12:53-62.
4. Amoros, M., and F. Estruch. 2001. Hsf1p and Msn2/4p cooperate in the
expression of Saccharomyces cerevisiae genes HSP26 and HSP104 in a geneand
stress type-dependent manner. Mol Microbiol 39:1523-32.
5. Amundson, S. A., T. G. Myers, and A. J. Fornace, Jr. 1998. Roles for p53 in
growth arrest and apoptosis: putting on the brakes after genotoxic stress.
Oncogene 17:3287-99.
6. Anckar, J., V. Hietakangas, K. Denessiouk, D. J. Thiele, M. S. Johnson, and L.
Sistonen. 2006. Inhibition of DNA binding by differential sumoylation of heat
shock factors. Mol Cell Biol 26:955-64.
7. Ausubel, F., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith,
J.A., and Struhl, K. 1991. Current Protocols in Molecular Biology. John Wiley
& Sons, New York.
8. Biddick, R., and E. T. Young. 2005. Yeast mediator and its role in
transcriptional regulation. C R Biol 328:773-82.
9. Bissinger, P. H., R. Wieser, B. Hamilton, and H. Ruis. 1989. Control of
Saccharomyces cerevisiae catalase T gene (CTT1) expression by nutrient
supply via the RAS-cyclic AMP pathway. Mol Cell Biol 9:1309-15.
10. Bjorklund, S., and C. M. Gustafsson. 2005. The yeast Mediator complex and
its regulation. Trends Biochem Sci 30:240-4.
11. Blank, M., and Y. Shiloh. 2007. Programs for cell death: apoptosis is only one
way to go. Cell Cycle 6:686-95.
12. Blondel, M., P. M. Alepuz, L. S. Huang, S. Shaham, G. Ammerer, and M.
Peter. 1999. Nuclear export of Far1p in response to pheromones requires the
export receptor Msn5p/Ste21p. Genes Dev 13:2284-300.
13. Boeger, H., J. Griesenbeck, J. S. Strattan, and R. D. Kornberg. 2003.
Nucleosomes unfold completely at a transcriptionally active promoter. Mol
Cell 11:1587-98.
14. Boorstein, W. R., and E. A. Craig. 1990. Transcriptional regulation of SSA3,
an HSP70 gene from Saccharomyces cerevisiae. Mol Cell Biol 10:3262-7.
15. Bose, S., J. A. Dutko, and R. S. Zitomer. 2005. Genetic factors that regulate
the attenuation of the general stress response of yeast. Genetics 169:1215-26.
16. Boy-Marcotte, E., G. Lagniel, M. Perrot, F. Bussereau, A. Boudsocq, M.
Jacquet, and J. Labarre. 1999. The heat shock response in yeast: differential
regulations and contributions of the Msn2p/Msn4p and Hsf1p regulons. Mol
Microbiol 33:274-83.
17. Boy-Marcotte, E., M. Perrot, F. Bussereau, H. Boucherie, and M. Jacquet.
1998. Msn2p and Msn4p control a large number of genes induced at the
diauxic transition which are repressed by cyclic AMP in Saccharomyces
cerevisiae. J Bacteriol 180:1044-52.
18. Broach, J. R. 1991. RAS genes in Saccharomyces cerevisiae: signal
transduction in search of a pathway. Trends Genet 7:28-33.
19. Broach, J. R., and R. J. Deschenes. 1990. The function of ras genes in
Saccharomyces cerevisiae. Adv Cancer Res 54:79-139.
20. Causton, H. C., B. Ren, S. S. Koh, C. T. Harbison, E. Kanin, E. G. Jennings,
T. I. Lee, H. L. True, E. S. Lander, and R. A. Young. 2001. Remodeling of
yeast genome expression in response to environmental changes. Mol Biol Cell
12:323-37.
53

21. Chandy, M., J. L. Gutierrez, P. Prochasson, and J. L. Workman. 2006.
SWI/SNF displaces SAGA-acetylated nucleosomes. Eukaryot Cell 5:1738-47.
22. Chi, Y., M. J. Huddleston, X. Zhang, R. A. Young, R. S. Annan, S. A. Carr,
and R. J. Deshaies. 2001. Negative regulation of Gcn4 and Msn2 transcription
factors by Srb10 cyclin-dependent kinase. Genes Dev 15:1078-92.
23. Choder, M. 2004. Rpb4 and Rpb7: subunits of RNA polymerase II and
beyond. Trends Biochem Sci 29:674-81.
24. Choder, M., and R. A. Young. 1993. A portion of RNA polymerase II
molecules has a component essential for stress responses and stress survival.
Mol Cell Biol 13:6984-91.
25. Chu, B., F. Soncin, B. D. Price, M. A. Stevenson, and S. K. Calderwood.
1996. Sequential phosphorylation by mitogen-activated protein kinase and
glycogen synthase kinase 3 represses transcriptional activation by heat shock
factor-1. J Biol Chem 271:30847-57.
26. Chu, B., R. Zhong, F. Soncin, M. A. Stevenson, and S. K. Calderwood. 1998.
Transcriptional activity of heat shock factor 1 at 37 degrees C is repressed
through phosphorylation on two distinct serine residues by glycogen synthase
kinase 3 and protein kinases Calpha and Czeta. J Biol Chem 273:18640-6.
27. Conlin, L. K., and H. C. Nelson. 2007. The natural osmolyte trehalose is a
positive regulator of the heat-induced activity of yeast heat shock transcription
factor. Mol Cell Biol 27:1505-15.
28. Cosma, M. P. 2002. Ordered recruitment: gene-specific mechanism of
transcription activation. Mol Cell 10:227-36.
29. Cosma, M. P., T. Tanaka, and K. Nasmyth. 1999. Ordered recruitment of
transcription and chromatin remodeling factors to a cell cycle- and
developmentally regulated promoter. Cell 97:299-311.
30. Dai, R., W. Frejtag, B. He, Y. Zhang, and N. F. Mivechi. 2000. c-Jun NH2-
terminal kinase targeting and phosphorylation of heat shock factor-1 suppress
its transcriptional activity. J Biol Chem 275:18210-8.
31. Deckert, J., and K. Struhl. 2001. Histone acetylation at promoters is
differentially affected by specific activators and repressors. Mol Cell Biol
21:2726-35.
32. DeVit, M. J., and M. Johnston. 1999. The nuclear exportin Msn5 is required
for nuclear export of the Mig1 glucose repressor of Saccharomyces cerevisiae.
Curr Biol 9:1231-41.
33. Durchschlag, E., W. Reiter, G. Ammerer, and C. Schuller. 2004. Nuclear
localization destabilizes the stress-regulated transcription factor Msn2. J Biol
Chem 279:55425-32.
34. Ekwall, K. 2005. Genome-wide analysis of HDAC function. Trends Genet
21:608-15.
35. Engelberg, D., E. Zandi, C. S. Parker, and M. Karin. 1994. The yeast and
mammalian Ras pathways control transcription of heat shock genes
independently of heat shock transcription factor. Mol Cell Biol 14:4929-37.
36. Erkina, T. Y., and A. M. Erkine. 2006. Displacement of histones at promoters
of Saccharomyces cerevisiae heat shock genes is differentially associated with
histone H3 acetylation. Mol Cell Biol 26:7587-600.
37. Estruch, F. 2000. Stress-controlled transcription factors, stress-induced genes
and stress tolerance in budding yeast. FEMS Microbiol Rev 24:469-86.
54

38. Estruch, F., and M. Carlson. 1993. Two homologous zinc finger genes
identified by multicopy suppression in a SNF1 protein kinase mutant of
Saccharomyces cerevisiae. Mol Cell Biol 13:3872-81.
39. Fan, X., D. M. Chou, and K. Struhl. 2006. Activator-specific recruitment of
Mediator in vivo. Nat Struct Mol Biol 13:117-20.
40. Ferguson, S. B., E. S. Anderson, R. B. Harshaw, T. Thate, N. L. Craig, and H.
C. Nelson. 2005. Protein kinase A regulates constitutive expression of small
heat-shock genes in an Msn2/4p-independent and Hsf1p-dependent manner in
Saccharomyces cerevisiae. Genetics 169:1203-14.
41. Fernandes, L., C. Rodrigues-Pousada, and K. Struhl. 1997. Yap, a novel
family of eight bZIP proteins in Saccharomyces cerevisiae with distinct
biological functions. Mol Cell Biol 17:6982-93.
42. Fry, C. J., and C. L. Peterson. 2002. Transcription. Unlocking the gates to
gene expression. Science 295:1847-8.
43. Fyodorov, D. V., and J. T. Kadonaga. 2001. The many faces of chromatin
remodeling: SWItching beyond transcription. Cell 106:523-5.
44. Gasch, A. P., P. T. Spellman, C. M. Kao, O. Carmel-Harel, M. B. Eisen, G.
Storz, D. Botstein, and P. O. Brown. 2000. Genomic expression programs in
the response of yeast cells to environmental changes. Mol Biol Cell 11:4241-
57.
45. Georgopoulos, C., and W. J. Welch. 1993. Role of the major heat shock
proteins as molecular chaperones. Annu Rev Cell Biol 9:601-34.
46. Gorner, W., E. Durchschlag, M. T. Martinez-Pastor, F. Estruch, G. Ammerer,
B. Hamilton, H. Ruis, and C. Schuller. 1998. Nuclear localization of the C2H2
zinc finger protein Msn2p is regulated by stress and protein kinase A activity.
Genes Dev 12:586-97.
47. Grably, M. R., A. Stanhill, O. Tell, and D. Engelberg. 2002. HSF and
Msn2/4p can exclusively or cooperatively activate the yeast HSP104 gene.
Mol Microbiol 44:21-35.
48. Green, M. R. 2000. TBP-associated factors (TAFIIs): multiple, selective
transcriptional mediators in common complexes. Trends Biochem Sci 25:59-
63.
49. Gregory, P. D. 2001. Transcription and chromatin converge: lessons from
yeast genetics. Curr Opin Genet Dev 11:142-7.
50. Gregory, P. D., K. Wagner, and W. Horz. 2001. Histone acetylation and
chromatin remodeling. Exp Cell Res 265:195-202.
51. Hahn, J. S., Z. Hu, D. J. Thiele, and V. R. Iyer. 2004. Genome-wide analysis
of the biology of stress responses through heat shock transcription factor. Mol
Cell Biol 24:5249-56.
52. Hahn, J. S., and D. J. Thiele. 2004. Activation of the Saccharomyces
cerevisiae heat shock transcription factor under glucose starvation conditions
by Snf1 protein kinase. J Biol Chem 279:5169-76.
53. Han, S. J., Y. C. Lee, B. S. Gim, G. H. Ryu, S. J. Park, W. S. Lane, and Y. J.
Kim. 1999. Activator-specific requirement of yeast mediator proteins for RNA
polymerase II transcriptional activation. Mol Cell Biol 19:979-88.
54. Harris, S. L., and A. J. Levine. 2005. The p53 pathway: positive and negative
feedback loops. Oncogene 24:2899-908.
55. Hashikawa, N., and H. Sakurai. 2004. Phosphorylation of the yeast heat shock
transcription factor is implicated in gene-specific activation dependent on the
architecture of the heat shock element. Mol Cell Biol 24:3648-59.
55

56. Hietakangas, V., J. K. Ahlskog, A. M. Jakobsson, M. Hellesuo, N. M.
Sahlberg, C. I. Holmberg, A. Mikhailov, J. J. Palvimo, L. Pirkkala, and L.
Sistonen. 2003. Phosphorylation of serine 303 is a prerequisite for the stressinducible
SUMO modification of heat shock factor 1. Mol Cell Biol 23:2953-
68.
57. Hilgarth, R. S., Y. Hong, O. K. Park-Sarge, and K. D. Sarge. 2003. Insights
into the regulation of heat shock transcription factor 1 SUMO-1 modification.
Biochem Biophys Res Commun 303:196-200.
58. Holmberg, C. I., V. Hietakangas, A. Mikhailov, J. O. Rantanen, M. Kallio, A.
Meinander, J. Hellman, N. Morrice, C. MacKintosh, R. I. Morimoto, J. E.
Eriksson, and L. Sistonen. 2001. Phosphorylation of serine 230 promotes
inducible transcriptional activity of heat shock factor 1. Embo J 20:3800-10.
59. Holstege, F. C., E. G. Jennings, J. J. Wyrick, T. I. Lee, C. J. Hengartner, M. R.
Green, T. R. Golub, E. S. Lander, and R. A. Young. 1998. Dissecting the
regulatory circuitry of a eukaryotic genome. Cell 95:717-28.
60. Hong, Y., R. Rogers, M. J. Matunis, C. N. Mayhew, M. L. Goodson, O. K.
Park-Sarge, and K. D. Sarge. 2001. Regulation of heat shock transcription
factor 1 by stress-induced SUMO-1 modification. J Biol Chem 276:40263-7.
61. Jakobsen, B. K., and H. R. Pelham. 1988. Constitutive binding of yeast heat
shock factor to DNA in vivo. Mol Cell Biol 8:5040-2.
62. Kaffman, A., N. M. Rank, E. M. O'Neill, L. S. Huang, and E. K. O'Shea. 1998.
The receptor Msn5 exports the phosphorylated transcription factor Pho4 out of
the nucleus. Nature 396:482-6.
63. Kang, J. S., S. H. Kim, M. S. Hwang, S. J. Han, Y. C. Lee, and Y. J. Kim.
2001. The structural and functional organization of the yeast mediator
complex. J Biol Chem 276:42003-10.
64. Katan-Khaykovich, Y., and K. Struhl. 2002. Dynamics of global histone
acetylation and deacetylation in vivo: rapid restoration of normal histone
acetylation status upon removal of activators and repressors. Genes Dev
16:743-52.
65. Keaveney, M., and K. Struhl. 1998. Activator-mediated recruitment of the
RNA polymerase II machinery is the predominant mechanism for
transcriptional activation in yeast. Mol Cell 1:917-24.
66. Kim, J., A. Nueda, Y. H. Meng, W. S. Dynan, and N. F. Mivechi. 1997.
Analysis of the phosphorylation of human heat shock transcription factor-1 by
MAP kinase family members. J Cell Biochem 67:43-54.
67. Knauf, U., E. M. Newton, J. Kyriakis, and R. E. Kingston. 1996. Repression
of human heat shock factor 1 activity at control temperature by
phosphorylation. Genes Dev 10:2782-93.
68. Kobayashi, N., and K. McEntee. 1990. Evidence for a heat shock transcription
factor-independent mechanism for heat shock induction of transcription in
Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 87:6550-4.
69. Koerkamp, M. G., M. Rep, H. J. Bussemaker, G. P. Hardy, A. Mul, K.
Piekarska, C. A. Szigyarto, J. M. De Mattos, and H. F. Tabak. 2002.
Dissection of transient oxidative stress response in Saccharomyces cerevisiae
by using DNA microarrays. Mol Biol Cell 13:2783-94.
70. Kouzarides, T. 2007. Chromatin modifications and their function. Cell
128:693-705.
56

71. Kuras, L., P. Kosa, M. Mencia, and K. Struhl. 2000. TAF-Containing and
TAF-independent forms of transcriptionally active TBP in vivo. Science
288:1244-8.
72. Kuras, L., and K. Struhl. 1999. Binding of TBP to promoters in vivo is
stimulated by activators and requires Pol II holoenzyme. Nature 399:609-13.
73. Kurdistani, S. K., and M. Grunstein. 2003. Histone acetylation and
deacetylation in yeast. Nat Rev Mol Cell Biol 4:276-84.
74. Lallet, S., H. Garreau, C. Garmendia-Torres, D. Szestakowska, E. Boy-
Marcotte, S. Quevillon-Cheruel, and M. Jacquet. 2006. Role of Gal11, a
component of the RNA polymerase II mediator in stress-induced
hyperphosphorylation of Msn2 in Saccharomyces cerevisiae. Mol Microbiol
62:438-52.
75. Lallet, S., H. Garreau, C. Poisier, E. Boy-Marcotte, and M. Jacquet. 2004.
Heat shock-induced degradation of Msn2p, a Saccharomyces cerevisiae
transcription factor, occurs in the nucleus. Mol Genet Genomics 272:353-62.
76. Lee, J., A. Romeo, and D. J. Kosman. 1996. Transcriptional remodeling and
G1 arrest in dioxygen stress in Saccharomyces cerevisiae. J Biol Chem
271:24885-93.
77. Lee, S., T. Carlson, N. Christian, K. Lea, J. Kedzie, J. P. Reilly, and J. J.
Bonner. 2000. The yeast heat shock transcription factor changes conformation
in response to superoxide and temperature. Mol Biol Cell 11:1753-64.
78. Lemon, B., and R. Tjian. 2000. Orchestrated response: a symphony of
transcription factors for gene control. Genes Dev 14:2551-69.
79. Li, B., M. Carey, and J. L. Workman. 2007. The role of chromatin during
transcription. Cell 128:707-19.
80. Li, X. Y., A. Virbasius, X. Zhu, and M. R. Green. 1999. Enhancement of TBP
binding by activators and general transcription factors. Nature 399:605-9.
81. Lindquist, S. 1986. The heat-shock response. Annu Rev Biochem 55:1151-91.
82. Lindquist, S., and E. A. Craig. 1988. The heat-shock proteins. Annu Rev
Genet 22:631-77.
83. Liu, X. D., and D. J. Thiele. 1996. Oxidative stress induced heat shock factor
phosphorylation and HSF-dependent activation of yeast metallothionein gene
transcription. Genes Dev 10:592-603.
84. Lucchini, G., A. G. Hinnebusch, C. Chen, and G. R. Fink. 1984. Positive
regulatory interactions of the HIS4 gene of Saccharomyces cerevisiae. Mol
Cell Biol 4:1326-33.
85. Mager, W. H., and A. J. De Kruijff. 1995. Stress-induced transcriptional
activation. Microbiol Rev 59:506-31.
86. Marchler, G., C. Schuller, G. Adam, and H. Ruis. 1993. A Saccharomyces
cerevisiae UAS element controlled by protein kinase A activates transcription
in response to a variety of stress conditions. Embo J 12:1997-2003.
87. Martinez-Pastor, M. T., G. Marchler, C. Schuller, A. Marchler-Bauer, H. Ruis,
and F. Estruch. 1996. The Saccharomyces cerevisiae zinc finger proteins
Msn2p and Msn4p are required for transcriptional induction through the stress
response element (STRE). Embo J 15:2227-35.
88. Minehart, P. L., and B. Magasanik. 1991. Sequence and expression of GLN3,
a positive nitrogen regulatory gene of Saccharomyces cerevisiae encoding a
protein with a putative zinc finger DNA-binding domain. Mol Cell Biol
11:6216-28.
57

89. Miyao, T., J. D. Barnett, and N. A. Woychik. 2001. Deletion of the RNA
polymerase subunit RPB4 acts as a global, not stress-specific, shut-off switch
for RNA polymerase II transcription at high temperatures. J Biol Chem
276:46408-13.
90. Morimoto, R. I. 1998. Regulation of the heat shock transcriptional response:
cross talk between a family of heat shock factors, molecular chaperones, and
negative regulators. Genes Dev 12:3788-96.
91. Moskvina, E., C. Schuller, C. T. Maurer, W. H. Mager, and H. Ruis. 1998. A
search in the genome of Saccharomyces cerevisiae for genes regulated via
stress response elements. Yeast 14:1041-50.
92. Moye-Rowley, W. S., K. D. Harshman, and C. S. Parker. 1989. Yeast YAP1
encodes a novel form of the jun family of transcriptional activator proteins.
Genes Dev 3:283-92.
93. Neely, K. E., A. H. Hassan, C. E. Brown, L. Howe, and J. L. Workman. 2002.
Transcription activator interactions with multiple SWI/SNF subunits. Mol Cell
Biol 22:1615-25.
94. Ozaki, M., S. S. Deshpande, P. Angkeow, S. Suzuki, and K. Irani. 2000. Rac1
regulates stress-induced, redox-dependent heat shock factor activation. J Biol
Chem 275:35377-83.
95. Park, J. M., J. Werner, J. M. Kim, J. T. Lis, and Y. J. Kim. 2001. Mediator,
not holoenzyme, is directly recruited to the heat shock promoter by HSF upon
heat shock. Mol Cell 8:9-19.
96. Pedruzzi, I., N. Burckert, P. Egger, and C. De Virgilio. 2000. Saccharomyces
cerevisiae Ras/cAMP pathway controls post-diauxic shift element-dependent
transcription through the zinc finger protein Gis1. Embo J 19:2569-79.
97. Pillai, B., V. Sampath, N. Sharma, and P. Sadhale. 2001. Rpb4, a non-essential
subunit of core RNA polymerase II of Saccharomyces cerevisiae is important
for activated transcription of a subset of genes. J Biol Chem 276:30641-7.
98. Pillai, B., J. Verma, A. Abraham, P. Francis, Y. Kumar, U. Tatu, S. K.
Brahmachari, and P. P. Sadhale. 2003. Whole genome expression profiles of
yeast RNA polymerase II core subunit, Rpb4, in stress and nonstress
conditions. J Biol Chem 278:3339-46.
99. Pirkkala, L., P. Nykanen, and L. Sistonen. 2001. Roles of the heat shock
transcription factors in regulation of the heat shock response and beyond.
Faseb J 15:1118-31.
100. Pnueli, L., I. Edry, M. Cohen, and Y. Kassir. 2004. Glucose and nitrogen
regulate the switch from histone deacetylation to acetylation for expression of
early meiosis-specific genes in budding yeast. Mol Cell Biol 24:5197-208.
101. Raboy, B., A. Marom, Y. Dor, and R. G. Kulka. 1999. Heat-induced cell cycle
arrest of Saccharomyces cerevisiae: involvement of the RAD6/UBC2 and
WSC2 genes in its reversal. Mol Microbiol 32:729-39.
102. Rep, M., M. Krantz, J. M. Thevelein, and S. Hohmann. 2000. The
transcriptional response of Saccharomyces cerevisiae to osmotic shock. Hot1p
and Msn2p/Msn4p are required for the induction of subsets of high osmolarity
glycerol pathway-dependent genes. J Biol Chem 275:8290-300.
103. Robert, F., D. K. Pokholok, N. M. Hannett, N. J. Rinaldi, M. Chandy, A.
Rolfe, J. L. Workman, D. K. Gifford, and R. A. Young. 2004. Global position
and recruitment of HATs and HDACs in the yeast genome. Mol Cell 16:199-
209.
58

104. Rosenheck, S., and M. Choder. 1998. Rpb4, a subunit of RNA polymerase II,
enables the enzyme to transcribe at temperature extremes in vitro. J Bacteriol
180:6187-92.
105. Rossi, A., G. Elia, and M. G. Santoro. 1998. Activation of the heat shock
factor 1 by serine protease inhibitors. An effect associated with nuclear factorkappaB
inhibition. J Biol Chem 273:16446-52.
106. Rowley, A., G. C. Johnston, B. Butler, M. Werner-Washburne, and R. A.
Singer. 1993. Heat shock-mediated cell cycle blockage and G1 cyclin
expression in the yeast Saccharomyces cerevisiae. Mol Cell Biol 13:1034-41.
107. Ruis, H., and C. Schuller. 1995. Stress signaling in yeast. Bioessays 17:959-
65.
108. Sanchez, Y., and S. L. Lindquist. 1990. HSP104 required for induced
thermotolerance. Science 248:1112-5.
109. Santoro, N., N. Johansson, and D. J. Thiele. 1998. Heat shock element
architecture is an important determinant in the temperature and transactivation
domain requirements for heat shock transcription factor. Mol Cell Biol
18:6340-52.
110. Schmitt, A. P., and K. McEntee. 1996. Msn2p, a zinc finger DNA-binding
protein, is the transcriptional activator of the multistress response in
Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 93:5777-82.
111. Schwartz, D., and V. Rotter. 1998. p53-dependent cell cycle control: response
to genotoxic stress. Semin Cancer Biol 8:325-36.
112. Shamovsky, I., M. Ivannikov, E. S. Kandel, D. Gershon, and E. Nudler. 2006.
RNA-mediated response to heat shock in mammalian cells. Nature 440:556-
60.
113. Shen, W. C., S. R. Bhaumik, H. C. Causton, I. Simon, X. Zhu, E. G. Jennings,
T. H. Wang, R. A. Young, and M. R. Green. 2003. Systematic analysis of
essential yeast TAFs in genome-wide transcription and preinitiation complex
assembly. Embo J 22:3395-402.
114. Sikorski, R. S., and P. Hieter. 1989. A system of shuttle vectors and yeast host
strains designed for efficient manipulation of DNA in Saccharomyces
cerevisiae. Genetics 122:19-27.
115. Simon, J. R., J. M. Treger, and K. McEntee. 1999. Multiple independent
regulatory pathways control UBI4 expression after heat shock in
Saccharomyces cerevisiae. Mol Microbiol 31:823-32.
116. Smith, A., M. P. Ward, and S. Garrett. 1998. Yeast PKA represses
Msn2p/Msn4p-dependent gene expression to regulate growth, stress response
and glycogen accumulation. Embo J 17:3556-64.
117. Sorger, P. K. 1991. Heat shock factor and the heat shock response. Cell
65:363-6.
118. Sorger, P. K., M. J. Lewis, and H. R. Pelham. 1987. Heat shock factor is
regulated differently in yeast and HeLa cells. Nature 329:81-4.
119. Sorger, P. K., and H. R. Pelham. 1988. Yeast heat shock factor is an essential
DNA-binding protein that exhibits temperature-dependent phosphorylation.
Cell 54:855-64.
120. Stanhill, A., V. Levin, A. Hendel, I. Shachar, D. Kazanov, N. Arber, N.
Kaminski, and D. Engelberg. 2006. Ha-ras(val12) induces HSP70b
transcription via the HSE/HSF1 system, but HSP70b expression is suppressed
in Ha-ras(val12)-transformed cells. Oncogene 25:1485-95.
59

121. Stanhill, A., N. Schick, and D. Engelberg. 1999. The yeast ras/cyclic AMP
pathway induces invasive growth by suppressing the cellular stress response.
Mol Cell Biol 19:7529-38.
122. Strahl, B. D., and C. D. Allis. 2000. The language of covalent histone
modifications. Nature 403:41-5.
123. Sullivan, E. K., C. S. Weirich, J. R. Guyon, S. Sif, and R. E. Kingston. 2001.
Transcriptional activation domains of human heat shock factor 1 recruit
human SWI/SNF. Mol Cell Biol 21:5826-37.
124. Swanson, M. J., H. Qiu, L. Sumibcay, A. Krueger, S. J. Kim, K. Natarajan, S.
Yoon, and A. G. Hinnebusch. 2003. A multiplicity of coactivators is required
by Gcn4p at individual promoters in vivo. Mol Cell Biol 23:2800-20.
125. Thompson, C. M., A. J. Koleske, D. M. Chao, and R. A. Young. 1993. A
multisubunit complex associated with the RNA polymerase II CTD and
TATA-binding protein in yeast. Cell 73:1361-75.
126. Treger, J. M., T. R. Magee, and K. McEntee. 1998. Functional analysis of the
stress response element and its role in the multistress response of
Saccharomyces cerevisiae. Biochem Biophys Res Commun 243:13-9.
127. Treger, J. M., A. P. Schmitt, J. R. Simon, and K. McEntee. 1998.
Transcriptional factor mutations reveal regulatory complexities of heat shock
and newly identified stress genes in Saccharomyces cerevisiae. J Biol Chem
273:26875-9.
128. Uffenbeck, S. R., and J. E. Krebs. 2006. The role of chromatin structure in
regulating stress-induced transcription in Saccharomyces cerevisiae. Biochem
Cell Biol 84:477-89.
129. Varela, J. C., U. M. Praekelt, P. A. Meacock, R. J. Planta, and W. H. Mager.
1995. The Saccharomyces cerevisiae HSP12 gene is activated by the highosmolarity
glycerol pathway and negatively regulated by protein kinase A.
Mol Cell Biol 15:6232-45.
130. Wanke, V., K. Accorsi, D. Porro, F. Esposito, T. Russo, and M. Vanoni. 1999.
In budding yeast, reactive oxygen species induce both RAS-dependent and
RAS-independent cell cycle-specific arrest. Mol Microbiol 32:753-64.
131. Westwood, J. T., J. Clos, and C. Wu. 1991. Stress-induced oligomerization
and chromosomal relocalization of heat-shock factor. Nature 353:822-7.
132. Wieser, R., G. Adam, A. Wagner, C. Schuller, G. Marchler, H. Ruis, Z.
Krawiec, and T. Bilinski. 1991. Heat shock factor-independent heat control of
transcription of the CTT1 gene encoding the cytosolic catalase T of
Saccharomyces cerevisiae. J Biol Chem 266:12406-11.
133. Wu, C. 1995. Heat shock transcription factors: structure and regulation. Annu
Rev Cell Dev Biol 11:441-69.
134. Zandi, E., T. N. Tran, W. Chamberlain, and C. S. Parker. 1997. Nuclear entry,
oligomerization, and DNA binding of the Drosophila heat shock transcription
factor are regulated by a unique nuclear localization sequence. Genes Dev
11:1299-314.
135. Zanton, S. J., and B. F. Pugh. 2006. Full and partial genome-wide assembly
and disassembly of the yeast transcription machinery in response to heat
shock. Genes Dev 20:2250-65.
136. Zhao, J., J. Herrera-Diaz, and D. S. Gross. 2005. Domain-wide displacement
of histones by activated heat shock factor occurs independently of Swi/Snf and
is not correlated with RNA polymerase II density. Mol Cell Biol 25:8985-99.
60

137. Zhong, M., A. Orosz, and C. Wu. 1998. Direct sensing of heat and oxidation
by Drosophila heat shock transcription factor. Mol Cell 2:101-8.
61