Giri Narasimhan

More documents

Recommendations

Info

V-sis Oncogene - HomologiesScore ESequences producing significant alignments: (bits) Valuegi|332623|gb|J02396.1|SEG_SSVPCS2 Simian sarcoma virus v-si... 4591 0.0gi|61774|emb|V01201.1|RESSV1 Simian sarcoma virus proviral ... 4504 0.0gi|332622|gb|J02395.1|SEG_SSVPCS1 Simian sarcoma virus LTR ... 1283 0.0gi|885929|gb|U20589.1|GLU20589 Gibbon leukemia virus envelo... 1140 0.0gi|4505680|ref|NM_002608.1| Homo sapiens platelet-derived g... 954 0.0gi|20987438|gb|BC029822.1| Homo sapiens, platelet-derived g... 954 0.0gi|338210|gb|M12783.1|HUMSISPDG Human c-sis/platelet-derive... 954 0.01/29/08 CAP5510 8
Sequence Alignment>gi|4505680|ref|NM_002608.1| Homo sapiens platelet-derived growthfactor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)(PDGFB), transcript variant 1, mRNA Length = 3373 Score = 954 bits(481), Expect = 0.0 Identities = 634/681 (93%), Gaps = 3/681 (0%)Strand = Plus / PlusQuery: 1015 agggggaccccattcctgaggagctctataagatgctgagtggccactcgattcgctcct 1074|||||||||||||||| |||||||| ||| |||||||||||| ||||||||| |||||||Sbjct: 1084 agggggaccccattcccgaggagctttatgagatgctgagtgaccactcgatccgctcct 1143> 21 E G D P I P E E L Y E M L S D H S I R SQuery: 1075 tcgatgacctccagcgcctgctgcagggagactccggaaaagaagatggggctgagctgg 1134| ||||| ||||| ||||||||||| |||||| ||||| | ||||||||||| ||| |||Sbjct: 1144 ttgatgatctccaacgcctgctgcacggagaccccggagaggaagatggggccgagttgg 1203> 61 D L N M T R S H S G G E L E S L A R G R1/29/08 CAP5510 9
Page 1 and 2: CAP 5510: Introduction to Bioinform
Page 3 and 4: Sequence Alignment - Why?>gi|126435
Page 5 and 6: Implications of Sequence AlignmentM
Page 7: PDGF and v-sis One region of 31 ami
Page 11 and 12: Similarity vs. HomologyHomologous s
Page 13 and 14: Types of Sequence Alignments - 2Sem
Page 15 and 16: Why gaps?Example: Finding the gene
Page 17 and 18: BLAST & FASTAFASTA[Lipman, Pearson
Page 19 and 20: BLAST Strategy & ImprovementsLipman
Page 21 and 22: BLAST Variants Nucleotide BLASTStan
Page 23 and 24: BLAST Credits Stephen Altschul Jona
Page 25 and 26: Rules of Thumb Most sequences with
Page 27 and 28: Types of Sequence AlignmentsGlobalH
Page 29 and 30: Global Alignment:An exampleV: G A A
Page 31 and 32: Alternative TracebackV: G - A A T T
Page 33 and 34: Improved TracebackGAATTCAGTTA000000
Page 36 and 37: Generalizations of Similarity Funct
Page 38 and 39: Local Sequence Alignment Example: c
Page 40 and 41: Local Alignment: ExampleGAATTCAGTTA
Page 42 and 43: How to score mismatches?1/29/08 CAP

Giri Narasimhan

Create successful ePaper yourself

Delete template?

Save as template?