2012 Jiva April Cover 220 GSM Art Card Glossy ... - Jivaonline.net

Vol. 10 Issue 1 April 2012 ISSN 0975-5195JIVAJOURNAL OF INDIAN VETERINARY ASSOCIATION, KERALAAN OFFICIAL ORGAN OF INDIAN VETERINARY ASSOCIATION, KERALAwww.jivaonline.netEDITORIAL BOARDChairmanDr. K. R. Arun KumarPresident, IVA, KeralaEditorial AdvisorDr. K. Vijayakumar, M.V.Sc.,Ph.DJoint Commissioner, Govt. of IndiaConvenerDr. C. SreekumarGeneral Secretary IVA, KeralaChief EditorDr. A.P. Usha, M.V.Sc., Ph.DEditorDr. Laiju M. Philip, M.V.Sc.Website EditorDr. K. Magnus Paul, M.V.Sc.Associate EditorsDr. M. Ranjith Mohan, M.V.Sc.Dr. Hiron M Harshan, M.V.Sc.,Ph.DMembersDr. M.G. Sajesh, M.V.Sc.Dr. P.M. Hari Narayanan, M.V.Sc.Dr. Bindya Liz Abraham, M.V.Sc.,Ph.DINDEXED IN HINARI, EBSCO, SCOPEMED AND INDEX COPERNICUS INTERNATIONAL

JOURNAL OF INDIAN VETERINARY ASSOCIATION, KERALA (JIVA)Journal of Indian Veterinary Association, Kerala (JIVA), the official organ of Indian Veterinary Association,Kerala is a quarterly scientific periodical with international status (ISSN-0975-5195) which bring about the latestupdates in Veterinary Medicine and Animal Husbandry Practices. The journal covers almost all topics of Dairying andAnimal Husbandry besides special emphasis on Companion Animal Medicine and Surgery, Zoo and Wildlife Medicine,Meat and Feed industry, Diagnostics and Bioinformatics.The Journal JIVA is in wide circulation among all stakeholders of Veterinary Medicine and Animal Husbandrysector including the Veterinary Professionals working with Animal Husbandry Department, Kerala AgriculturalUniversity, Kerala Livestock Development Board, Milma, Techno Park, Veterinary and Medical Research Institutes ofthe country. The Online edition is available at www.jivaonline.netJIVA is indexed in HINARI (World Health Organization), EBSCO (World's Foremost Premium ResearchDatabase Service), SCOPE MED (International Medical Journal Management and Indexing System) and INDEXCOPERNICUS INTERNATIONAL.Guidelines to Authors1. For publishing in the journal, article may be sent by email to editorjiva@gmail.com or laijuphilip@rediffmail.com2. Article may be sent typewritten in double space in A4 size paper.3. Review article, Research article from all fields of veterinary and animal sciences, Clinical Article/ Case Reports and GeneralArticle are invited.4. Research Article and Clinical article may be in the following format; Title Author(s) Designation Abstract Keywords Introduction Materials and methods Result Discussion Acknowledgment References Contact details of Communicating Author5. Title of the article should be clear and concise.6. Introduction should clearly state the purpose/ aim/ objective of the article.7. Authors and their affiliations should be mentioned below the title.8. Word limit for Research and General Article is 2000 words, including tables, graphs etc.9. Word limit for Clinical Article/ Case Report is 1500 words, including tables, graphs etc.10. Tables, photographs, graphs etc. should bear the reference number (table 1, table 2 etc) and the title.11. References should be arranged in alphabetical order and numbered. Reference should be given in the format; Name of theauthor (s), followed by year, Title, Name of the Journal, Volume, Issue and Page Number.Eg. Vegad, J.L. 2008. Bird flu- an overview: JIVA: 8(1):1-1112. Articles are accepted on the understanding that these have neither been published nor submitted for publication in any otherjournal/ publication either in part or in full.13. Processing and Publication Fees (For Authors Inside India)Initial Processing Fee For Articles : Rs. 100/-Publication Fees : For Research Article and General Article :Rs. 200/- per author: For Clinical Reports/Article :Rs. 100/-per authorNon - Members of Indian Veterinary Association, Kerala : Should Remit an Additional Amount of Rs. 500/- (for each author)Processing and Publication Fees (For Authors outside India )Cheque for the amount Equalent to Rs. 2500/- to editor, JIVAPayment MethodsDemand draft to 'EDITOR, JIVA' PAYABLE AT MANNARKKAD orDirect REMITTANCE TO THE ACCOUNT NUMBER OF EDITOR, JIVA “0048053000106612”( IFSC CODE: SIBL0000048) THE SOUTH INDIAN BANK, MANNARKKAD.FOR COMMUNICATIONChief Editor : +919446337800Editor : +919447996512editorjiva@gmail.comPUBLISHERDr. Theodore JohnFor Indian Veterinary Association, KeralaVeterinarian's BuildingTC 25/2068, Dharmalayam RoadThiruvananthapuram- 695 001Printed at : Micro Printers, Mannarkkad, 04924-224318

JOURNAL OF INDIAN VETERINARY ASSOCIATION, KERALAVol. 10 Issue 1 April 2012CONTENTSRESEARCH ARTICLES 5 - 421.2.3.POLYMERASE CHAIN REACTION BASED DETECTION OFMycoplasma gallisepticum IN CHICKENSurya Sankar, G. Krishnan Nair, M. Mini and Hiron M. Harshan.........................................5DIETARY PHYTASE SUPPLEMENTATION ON EGG QUALITY TRAITS IN WHITELEGHORN STRAIN CROSS CHICKENSukumar. D and Jalaludeen. A................................................................................................9MOLECULAR DETECTION OF PORCINE FOOT BUSH WITH ANAEROBICETIOLOGIESLiya Anto, Siju Joseph, M. Mini, Sheethal. G. Mohan, S. Vamshi Krishna,Abraham Joseph Pellissery and A. P. Usha...........................................................................134. STATISTICAL TOOLS FOR THE PRICING ISSUES IN MILK PRODUCTIONIN KERALAUnnikrishnan T. and Ashok B...................................................................................................175.CLINICAL MANIFESTATIONS OF PROSTATIC DISEASES IN DOGSKiren Menon, Krishnaswamy A and Honnappa T.G.............................................................246. DEVELOPMENT OF LEAN BEEF LOAFNaseera. A .P and George T. Oommen....................................................................................277.8.ANALYSIS OF INFORMATION NEEDS FOR DEVELOPING A MEDIA PROTOCOLIN SELECTED DISTRICTS OF HARYANA IN ANIMAL HUSBANDRY PRACTICESS. Sreehari, H.K. Gulati and A.K. Varma..................................................................................31ANALYSIS OF SOCIO-PERSONAL PROFILE OF LIVESTOCK- BASED SELF HELPGROUP MEMBERS OF THRISSUR DISTRICTAnu George, P.J.Rajkamal and Jiji. R.S....................................................................................38CLINICAL REPORT 43 - 559.Oxyspirura mansoni IN BACKYARD POULTRY OF KERALADeepu Philip Mathew, Priya M .N., Deepa C.K., Syamala K., Ajithkumar K. G. andReghu Ravindran.......................................................................................................................43

10. BBILATERAL INGUINAL HERNIA WITH DISTINCT HYSTEROCELE ANDOMENTOCELE IN A DACHSHUND BITCHJohn Martin K. D., Susannah Bijee Philip, Sherin B. Sarangom and Ashay P. Kankonkar......4511.SURGICAL MANAGEMENT OF CERVICAL MUCOCELE IN A DOGBasavanagowda M.T., Joseph Cyrus, Md. AbidHussain and ShahidVaseem S.A..................4812. SURGICAL MANAGEMENT OF OVARIAN TUMOUR IN A BITCHAsha Abraham and P. Ravindran.............................................................................................4913. FETAL ANASARCA TWINS WITH HYDROALLANTOIS IN MALABARI DOESLaiju M Philip., M. Ranjith Mohan and P. Francis Bastin.....................................................5214.CLINICAL MANAGEMENT OF EXOCRINE PANCREATIC INSUFFICIENCY IN AGERMAN SHEPHERD DOGV. Dhanesh, Usha Narayanapillai, S. Yogeshpriya, Roshna RasheedKutty andS. Ajith Kumar...........................................................................................................................54GENERAL ARTICLES 56 - 7515. METHANE EMISSION FROM RUMINANTS ENVIRONMENTAL IMPLICATIONSAND STRATEGIES FOR REDUCTION.Lalu. K., Usha. A.P., Venkatachalapathy.R.T and Prasanth.V................................................5616. TERMINATION OF PREGNANCY IN BITCHESAbhilash.R.S, Anil kumar.K, Biju.S and Ajith.K.S...................................................................6017. HOW TO IMPROVE THE LIVESTOCK SECTOR IN KERALA:SOME NUTRITIONAL THOUGHTSAjith, K.S., Anil Kumar, K. and Dipu, M.T..............................................................................6618. EFFLUX PUMP INHIBITORS FOR ANTIBACTERIAL THERAPYSumithra T G, Chaturvedi V K, Susan Cherian, Binsila B Krishnan and Siju Susan Jacob.....69ASSOCIATION NEWS 76 - 80The editor/editorial board and referees are in no way responsible individually orcollectively for the views, data and technical details presented in the contributed papers

POLYMERASE CHAIN REACTION BASEDDETECTION OF Mycoplasma gallisepticum IN CHICKEN*RESEARCH ARTICLESurya Sankar, G. Krishnan Nair, M. Mini and Hiron M. HarshanDepartment of Veterinary Microbiology, College of Veterinary and Animal Sciences, Mannuthy*Part of PhD. thesis submitted by the first author to Kerala Agricultural University, ThrissurINTRODUCTIONAmong the prevailing diseases of poultry,mycoplasmosis has become one of the most seriousand frequently reported diseases throughout theworld, causing considerable economic losses.Among the mycoplasma affecting poultry,Mycoplasma gallisepticum is the most pathogenicand responsible for chronic respiratory disease(CRD) in chicken and infectious sinusitis in turkey.Although the mortality among birds affected by thedisease is not very high, the disease causessubstantial losses as a result of downgrading andcondemnation of carcasses, decreased eggproduction, poor hatchability, reduced feedconversion and retarded growth, as well asaggravation of various other disease conditions andalso the high cost incurred during control programme(Kleven, 1998). The severity of the disease is greatlyinfluenced by the degree of secondary infection withNewcastle disease and Infectious Bronchitis virusesand / or bacteria such as Escherichia coli.MATERIALS AND METHODSSource of samplesA total of 50 samples were obtained fromsick/apparently healthy birds of different age groupsfrom University Poultry Farm, Mannuthy; poultryfarms in different parts of Kerala; birds brought fordisease diagnosis to the Department of VeterinaryMicrobiology; birds necropsied in Centre ofExcellence in Pathology and College of Veterinaryand Animal Sciences, Mannuthy.Processing of SamplesFifty swab samples collected in Mycoplasmabroth were removed after four hour of incubation andone ml of the broth was transferred aseptically intosterile eppendorf tubes in a laminar airflow cabinetfor the preparation of template DNA for Mycoplasmagenus-specific PCR. The remaining broth mediawere further incubated till an appreciable colourchange of the broth to orange or yellow wasevidenced or up to 21 days, whichever was earlier.Twenty five samples were directly plated on to theMycoplasma agar plates also.Extraction of DNA from clinical samplesThe extraction of DNA was performedaccording to a previously described procedure (Liuet al., 2001).Extraction of DNA from other bacterial strainsPure colonies of Eschericia coli,Staphylococcus aureus and Pasturella multocidawere inoculated separately in to five ml of Brain0heart infusion (BHI) broth and incubated at 37 C for18 h. From this broth culture, 2 ml was transferred toan eppendorf tube and centrifuged at 3000 × g for 10min. The supernatant was discarded and the pelletwas washed twice with sterile PBS. The final pelletwas re-suspended in 50l of triple distilled water.The mixture was boiled for 10 min and immediatelychilled on ice for 30 min. The samples were thawedand centrifuged at 3000× g for 5 min and supernatant0was stored at -20 C for further use as template forPCR reactions.JIVA Vol. 10 Issue 1 April 20125

RESEARCH ARTICLEas the matrix. The gel was visualized under UV transilluminator(Hoefer, USA) and the results weredocumented on gel documentation system.RESULTS AND DISCUSSIONProcessing and detection of avianMycoplasma in clinical samplesThe samples were thoroughly agitated in thebroth and kept at 37°C under 5-10 percent CO 2tension in screw capped tubes. The agar platescontaining the same samples were also kept undersimilar conditions in a humid atmosphere. One ml ofbroth culture from each sample was taken after aperiod of four hours and processed for the extractionof genomic DNA. Remaining broth cultures wereincubated as mentioned above. The agar plates wereobserved daily under microscope (10x) for thepresence of any colonies. The genomic DNA of E.coli, S. aureus and P. multocida were also extractedfor checking the specificity of the selected primers.After extraction of the genetic material, PCR wascarried out using Mycoplasma genus specificprimers.Mycoplasma genus specific polymerasechain reactionThe primers GPO3 and MGSO were used inthis study for the amplification of DNA fromMycoplasma.The amplified products were visualized bysub-marine agarose gel electrophoresis. A positivePCR result for Mycoplasma was indicated by thepresence of a 270 bp fragment in electrophoresed gelunder UV transillumination, whereas, noamplification indicated a negative result. In negativecontrol, amplification was not detected and inpositive control (reference strain 6/85) 270 bp bandwas observed. The DNA prepared from E. coli, S.aureus and P. multocida did not evidence anyamplification with these primers, indicating thespecificity of the selected primers (Fig. 1).Out of the total 50 samples (collected inbroth and agar) subjected to genus-specific PCR, 12were found positive. These included eight samplescollected both in PPLO broth and streaked on to agar.Four more samples from agar plates also gave apositive result. Thus, a total of 12 samples werepositive for Mycoplasma genus specific PCR.Species differentiation of avianMycoplasma from clinical samplesThe positive samples in genus specific PCRwere subsequently subjected to a species specificPCR using another set of selected primers.Mycoplasma species specific PCR samplescollected in PPLO brothThe primers MG IGSR F and MG IGSR Rcould not amplify the DNA isolated from E. coli, S.aureus and P. multocida.Agar gel electrophoresis of the amplifiedPCR products were carried out along with a positivecontrol and negative control in 0.5 × TBE buffer. Apositive PCR was indicated by the presence of a bandin the 660 bp region in the test and positive controlsamples. Out of the eight genus-specific PCRpositive samples subjected to species specific PCR,only one sample was fount positive.Mycoplasma species specific PCR samplescultured on PPLO agarThe individual colonies observed after 3days on the 25 agar plates streaked with sampleswere picked up and put in PPLO broth and kept at37°C under 5-10 per cent CO2tension. The brothtubes were daily examined for colour change frompink to orange or yellow. Samples from those tubeswith colour change were used for extraction of DNA.The species specific PCR was carried out in abovementioned conditions.Among the twenty five samples swabbedonto agar, 12 were positive in genus specific PCRand these samples were further subjected to speciesspecific PCR. Out of these samples, three werepositive in species specific PCR. Specificity of theprimers was indicated by the absence ofamplification of DNA from other bacterial speciestested. (Fig. 2).JIVA Vol. 10 Issue 1 April 20127

RESEARCH ARTICLEJ. Ind. Vet. Assoc., Kerala. 10 (1)Among the samples inoculated in broth, onlyeight were found positive for genus specific PCRwhereas, in case of those plated onto PPLO agar, 12were positive. Out of these 12, four samples werenegative for PCR, when collected in broth. Thus, atotal of 12 samples (including the four samples thatwere additionally positive when collected ontoPPLO agar plates) were positive for genus specificPCR. This was in agreement with the finding thatfor the isolation of avian Mycoplasma, solid mediumwas found to be more effective than liquid medium(Ronglian et al., 1996).Isolation of Mycoplasma gallisepticum from PCRpositive samplesOut of the four samples which gave a positive resultfor species specific PCR, Mycoplasma could beisolated from three. This might be due to the fact thatthe viability of the organism in the sample did notFig. 1. Agarose gel electrophoresis ofMycoplasma genus specific PCR productLane M: Molecular weight markerLane 1, 2, 3, 4: Mycoplasma isolateLane 5: Reference strain 6/85Lane 6: Negative controlFig. 2. Agarose gel electrophoresis of Mycoplasmagallisepticum species specific PCR productsLane M: Molecular weight markerLane 1, 2, 3, 4: M. gallisepticum isolateLane 5: Reference strain 6/85Lane 6: Negative controlREFERENCESKleven, S.H. 1998. Mycoplasmas in the etiology ofmultifactorial respiratory disease. Poult. Sci.77:1146-1149.Liu, T., Garcia, M., Levisohn, S., Yogev, D. andKleven, S.H. 2001. Molecular variability of theadhesin-encoding gene pvpA amongMycoplasma gallisepticum strains and itsapplication in diagnosis. J. Clin.Microbiol. 39:1882-1888.Marois, C., Oufour-Gesbert, F. and Kempf, I. 2000.Detection of Mycoplasma synoviae in poultryenvironment samples by culture and polymerasechain reaction. Vet. Microbiol. 73: 311-318.Raviv, Z., Callison, S., Ferguson-Noel, N., Laibinis, V.,Wooten, R. and Kleven, S. H. 2007. TheMycoplasma gallisepticum 16S-23S rRNAIntergenic Spacer Region Sequence, as a NovelTool for Epidemiological Studies. Avian Dis. 51:555-560.Ronglian, H., Jun, H., Herong, D., Meuji, L., Xianwen,D., Jian, D., Shuilian, Y., Huang, J., Deng, H.R.,Lan, M.Y., Deng, X.W., Du, J. and Yang, S.L.1996. Isolation and identification of Mycoplasmagallisepticum in chicken flocks in Guangxi.Chinese J. Vet. Med. 22: 9-11.8

RESEARCH ARTICLEDIETARY PHYTASE SUPPLEMENTATION ON EGGQUALITY TRAITS IN WHITE LEGHORN STRAIN CROSS CHICKEN1 2Sukumar. D and Jalaludeen. ACollege of veterinary and Animal Sciences MannuthyABSTRACTOne hundred and fifty White Leghorn strain cross pullets (Athulya) were subjected to evaluate the effectof Phytase enzyme on certain egg quality parameters. The birds were grouped in to five treatments, viz., control(T1), fed with standard layer ration, T2, fed with low available Phosphorus layer ration. T3, T4 and T5 groupswere formed with supplementation of 200, 300 and 400 units of enzyme per kg feed, respectively in T2 diet.Significant improvement (p

RESEARCH ARTICLEcontaining phytase as the only component. The fivetreatments are as follows.T1 - Birds fed with Standard layer diet.T2 - Birds fed with Low available phosphorusLayer ration (0.3 percent)T3 - T2 + 200 units of PhytaseT4 - T2 + 300 units of PhytaseT5 - T2 + 400 units of PhytaseFeed and water were provided ad libitum.Egg weight , egg shell thickness, egg shell weightand egg specific gravity were recorded at the end ofeach 28-days period with 4 eggs randomly selectedfrom each replicate for three consecutive days. Eggshell thickness was measured using shell thicknessmeasure gauge and egg specific gravity wasobtained by Brain floatation technique developedby Tyler and Geake (1961).RESULTS AND DISCUSSIONMean egg weight, egg shell thickness, eggshell weight and egg specific gravity as influencedby phytase supplementation is given in Table.2 andFig 1 . Perusal of mean egg weight data indicatedthat birds fed a low available phosphorus layerration (Table 1) without enzyme (T2) laid eggs withsignificantly (p

RESEARCH ARTICLEdays).Mean values of 5 experimental periods (28*Significant (p

RESEARCH ARTICLEJ. Ind. Vet. Assoc., Kerala. 10 (1)All the enzyme supplemented groups hadsignificantly (p

RESEARCH ARTICLEMOLECULAR DETECTIONOF PORCINE FOOT BUSH WITH ANAEROBIC ETIOLOGIES1 2 3 4 5Liya Anto , Siju Joseph , M. Mini , Sheethal. G. Mohan , S. Vamshi Krishna ,6 7Abraham Joseph Pellissery and A. P. UshaCollege of Veterinary and Animal Sciences, Mannuthy.ABSTRACTFoot bush in most instances is more comparable to foot abscess in pigs. Foot rot is primarily causedby damage to the hooves or the tissue surrounding the hooves, which allows a bacterial infection to set in anddevelop. Multiple etiologies are involved in the commencement of this disease, which include both aerobicand anaerobic organisms. The most commonly detected anaerobic etiology in foot rot in pigs isFusobacteriumnecrophorum (F. necrophorum), followed by Dichelobacternodosus (D. nodosus). There wassevere lameness in pigs characterized by separation of hard horny wall from the heel, oedema andabscessation. 26 cases of pigs which showed severe foot lesions were reported, of which ten representativesamples were collected. All samples were processed and DNA was extracted. They were subjected topolymerase chain reaction using species specific 16S r RNA and lktA gene primer pairs for D. nodosus and F.necrophorum respectively. Out of the samples screened, none were positive for D. nodosus and two yielded anamplicon size of 402 bp of lktA gene indicating the presence of F. necrophorum.INTRODUCTIONFoot bush, which is also known as footrot inpigs is similar clinically to footrot in other species,like sheep, goat and cattle. Foot lesions are commonand have been reported in all age groups ofswine(Mouttotou et. al., 1999). But footrot isrelatively not common in pigs as compared to otherspecies. Factors which predispose pigs to foot bushinclude rough and abrasive flooring, wet underfoot,dietary deficiency and dirty environments(Mouttotou et. al., 1999; Radostits et. al., 2000).Foot bush in pigs is caused by multiple bacterialetiologies. Detection of Fusobacteriumnecrophorum (Zhou et al., 2010), Dichelobacternodosus,Staphylococcus spp., Streptococcus spp1,2,3,4,5Department of Veterinary Microbiology, College ofVeterinary and Animal Sciences, Mannuthy.6Department of Veterinary Biochemistry, College of Veterinaryand Animal Sciences, Mannuthy.7Centre for Pig Production and Research, College of Veterinaryand Animal Sciences, Mannuthy.(Teshale, 2005), Arcanobacterpyogenes(Radostits, 2000), Prevotella, Peptostreptococcus,Porphyromonas, Bacteroides and Eubacterium(Piriz et. al., 1996) from the lesions of limbs of pigshave been reported. Among these, two species ofanaerobic bacteria are constantly found associatedwith foot bush in pigs: Fusobacteriumnecrophorum (Radostits et. al., 2000; Zhou et. al.,2010) and Dichelobacternodosus (Radostits et al.,2000; Teshale, 2005).Traditionally the identification of D.nodosus and F. necrophorum are carried out byisolation of the organism from the hoof of affectedanimals, its staining and biochemicalcharacterization (Kortt et. al., 1983; Skerman,1989; Smith et. al., 1991; Falkler et. al., 1999).Isolation of these bacteria from clinical samples isless confirmatory, very difficult, time consumingand require additional growth supplements (Smithet. al., 1991; Falkler et. al., 1999; Gradin andJIVA Vol. 10 Issue 1 April 201213

RESEARCH ARTICLEJ. Ind. Vet. Assoc., Kerala. 10 (1)Schmithz, 1977). So recently molecular techniqueslike polymerase chain reaction using 16S rRNA(LaFontaine et al., 1993; Zakaria et al., 1998,Waniet al., 2004; Moore et al., 2005) or fimA genesequences (Dhungyel et. al., 2002) for D. nodosusand lktA gene sequences (Zhou et. al., 2009;Hickford et. al., 2010) for F. necrophorum weretried and observed to yield rapid, confirmatory andsensitive diagnosis of these bacteria in clinicalsamples. The present study was conducted toscreen the samples from animals of Centre for PigProduction and Research, Mannuthy, having severefoot lesions and lameness.MATERIALS AND METHODSCollection of samplesSevere lameness and foot lesions werereported in 26 pigs of Centre for Pig Productionand Research, Mannuthy. Lesions werecharacterized by hot, painful, swollen limbs,separation of hard horny wall from the heel andabscessation. Animals were unable to stand or takefeed. Representative samples were taken from 10pigs using sterile cotton swabs (Hi-Media,Mumbai) from the deeper portion of the lesion andwere transported quickly to the laboratory.Extraction of bacterial DNAThe samples were processed to isolate theDNA of the pathogens by crude method. Thesamples were suspended in 200µl of sterilephosphate buffered saline (PBS), boiled for 10min,immediately chilled on ice for 5 min andcentrifuged at 15000 rpm for 10min. Thesupernatant was collected and stored in 1.5mlmicrocentrifuge tubes, which were later used astemplates for PCR reaction.PCR detection of D. nodosusD. nodosus was detected by PCRamplification of 16S rRNA using primers5'CGGGGTTATGTAGCTTGC3' (forward)and5'TCGGTACCGAGTATTTCTACCCAACACCT3' (reverse)(La Fontaine et al., 1993; Moore etal., 2005; Wani et. al., 2007). The PCRamplifications were performed in 25µl volumes.The final concentration contained 2µl of template,2.5µl of 10X Taq buffer (10mM Tris-HCl (pH 9.0),50mM KCl, 15mM MgCl 2), 25pM each of forwardand reverse primer, 200µM of eachdeoxyribonucleotide triphosphate and 1IUTaqDNA polymerase. The amplification wascarried out in a thermal cycler (Eppendorf) with aninitial denaturing step of 94°C for 10min, followedby 35 cycles of 94°C for 1min, 58°C for 30s and72°C for 30s, with a final extension step at 72°Cfor 5min.PCR detection of F. necrophorumF. necrophorum was detected by PCRamplification of leukotoxin (lktA) gene usingprimers 5'AATCGGAGTAGTAGGTTCTG-3'(Forward) and 5'CTTTGGTAACTG CCACTGC3'(Reverse) (Zhou et al., 2009). The PCRamplifications were performed in 25µl volumes.The final concentration contained 2µl of templateDNA, 2.5µl of 10X Taq buffer (10mM Tris-HCl(pH 9.0), 50mM KCl, 15mM MgCl 2), 25pM of eachprimer,200µM of each deoxyribonucleotidetriphosphate and 1IU TaqDNA polymerase.Thermal profile for amplification of lktA geneconsisted of denaturation at 94°C for 2minfollowed by 35 cycles of 94°C for 30s, 58°C for 40sand 72°C for 30s, with a final extension step at72°C for 10min.Analysis of PCR productsThe PCR products were subjected toelectrophoresis in 1 percent agarose (Genei,Bangalore) gels, using 1x Tris Borate EDTA buffer,containing 200ng/ml of ethidium bromide. Thegels were visualized under ultraviolet illuminationand photographed using gel- documentationsystem.RESULTS AND DISCUSSIONOut of the ten hoof swabs examined, a total14

RESEARCH ARTICLEof five (50 percent) gave an amplicon size of 402 bpfor lktA gene, which indicates the presence of F.necrophorum. None of the samples were found tobe positive for D. nodosus. The detection of F.necrophorum on 50 percent hoof lesions of pigssuggests F. necrophorum is the major contributingfactor for foot bush in pigs. This is consistent withthe findings of Hickford et al., 2010, wherein ahigher proportion of lame cattle were affected withF. necrophorum (53 percent), than D. nodosus (5percent).Fig.1: PCR amplification of lktA geneof F. necrophorumLane 1, 2 and 3: samples, Lane 3: positive controlLane 5: negative controlThis study may not be representative as thesample size was very low and was collected from asingle farm; in addition, samples from healthyanimals were not considered.This study suggests a hypothesis of anincreased association of F. necrophorum with footbush in pigs, than D. nodosus and has veryimportant implications in herd health management.Presence of F. necrophorum in affected pigs can actas a potential source of infection to healthy animalsin the farm, which on secondary infection with D.nodosus may lead to a much more severe condition.Outbreaks by mixed variants of F. necrophorum isnot common, in contrast to report of the presence ofupto seven strains of D. nodosus on a single claw(Zhou et al., 2001). Therefore this study can befurther expanded to identify the strains ofF. necrophorum prevalent in Kerala to develop aneffective vaccine against foot bush in pigs.REFERENCESDhungyel, O. P., Whittington, R. J. and Egerton, J.R. 2002.Serogroupspecifc single andmultiplex PCR with pre-enrichment cultureand immuno-magnetic bead capture foridentifying strains of D. nodosus in sheep withfootrot prior to vaccination. Mol. cellprobes.16: 285-296.Falkler, W. A., Ewonwu, C. O. and Idigbe, E. O.1999 Isolation of Fusobacteriumnecrophorum from cancrumoris (noma). Am.J. Trop. Med. Hyg. 60:150-156.Gradin, J. L. and Schmitz, J. A. 1977. Selectivemedium for isolation of Bacteroides nodosus.J. Clin. Microbiol. 6 (3) : 298-302.Hickford, J. G. H., Bennet, G. N and Zhou, H. 2010.The presence of DichelobacternodosusandFusobacterium necrophorum on the claws ofthlame cattle of New Zealand. Proceedings of 4Australasian Diary Science Symposium. pp.428-431.Kortt, A. A., Burns, J. E. & Stewart, D. J. 1983.Detection of the extracellular proteases ofBacteroides nodosus in polyacrylamide gels:a rapid method of distinguishing virulent andbenign ovine isolates. Res. Vet. Sci. 35: 171-174.JIVA Vol. 10 Issue 1 April 201215

RESEARCH ARTICLEJ. Ind. Vet. Assoc., Kerala. 10 (1)La Fontaine, S., Egerton, J. R. & Rood, J. I.1993. Detection of Dichelobacter n o d o s u susing species-specific oligonucleotides asPCR primers. Vet. Microbiol. 35: 101-117.Mouttotou, N., Hatchell, F. M., Lundervold, M. andGreen, L. E. 1997. Prevalence anddistribution of foot lesions in finishing pigs insouth-west England. Vet. Rec. 141(5): 115-20.Mouttotou, N., Hatchell, F. M. and Green, L. E.1999. Foot lesions in finishing pigs and theirassociations with the type of floor. Vet. Rec.144 (23): 629-32.Moore, L.J., Wassink, G.J., Green, L.E. andGrogono-Thomas, R. 2005. The detectionand characterisation of Dichelobacternodosusfrom cases of ovine footrot in England andWales. Vet. Microbiol.108: 57-67.Piriz, S., Hurtado, M. A., Valle, J., Mateos, E. M.,Martin-Palomino, P. and Vadillo.S. 1996.Bacteriological study of footrot in pigs: apreliminary note. Vet. Rec. 139: 17-19.Radostits, O. M., Gay, C. C., Blood, D. C. andHinchcliff, K. W. 2000. Veterinary Medicine:A textbook of the diseases of cattle, sheep,thpigs, goats and horses.9 ed. Saunders Ltd. pp.959-961.Skerman, T. M. 1989. Isolation and identificationof Bacteroidesnodosus. In: Egerton, J. R.,Yong, W. K., Riffkin, G. G. (Eds.), Footrot andFoot Abscess of Ruminants. CRC Press, Inc.,Boca Raton, Florida, pp. 85104.Teshale, S. 2005. Recent footrot outbreak inDebrezeit swine farm, central Ethiopia. J. Vet.Sci.6 (4): 367-368.Wani, S.A., Samanta I., Bhat M. A. and Buchh, A. S.2004: Molecular detection andcharacterization of Dichelobacternodosus inovine foot rot in India. Mol. Cell. Probes.18:289-291.Wani S. A., Samanta, I. and Kawoosa, S. 2007:Isolation and characterization ofDichelobacternodosus from ovine andcaprine footrot in Kashmir, India. Res. Vet.Sci. 83: 141-144.Zakaria, Z., Radu, S., Sheikh-Omar, A. R., Mutalib,A. R., Joseph, P. G. and Rusul, G. 1998.Molecular analysis of Dichelobacternodosusisolated from footrot in sheep in Malaysia.Vet. Microbiol. 62: 243-250.Zhou, H., Bennet, G. and Hickford, J. G. H. 2009.Variation of Fusobacterium necrophorumstrains present on the hooves of footrotinfected sheep, goats and cattle. Vet.Microbiol. 135: 363-367.Zhou, H, Dobbinsom, S. and Hickford, J. G. H.2010. Fusobacterium necrophorum varientspresent on the hooves of lame pigs. Vet.Microbiol. 141: 390.Zhou, H., Hickford, J. G. H. and Amstrong, K, F.2001. Rapid and accurate typing ofDichelobacternodosus using PCRamplification and reverse dot-blothybridization. Vet. Microbiol. 80: 149-162.16

RESEARCH ARTICLESTATISTICAL TOOLS FOR THE PRICING ISSUESIN MILK PRODUCTION IN KERALA1 2Unnikrishnan T. and Ashok B.Kerala Veterinary and Animal Science UniversityABSTRACTThe main objectives of this study included assessment of trend and growth rates of milkproduction, milk price and feed price, correlation between the variables and testing the linear regressionequations with the highly correlated variables for prediction purposes. Yearly secondary data on milkproduction, wage of labourer, human population, cattle population, milk price and feed price collectedfrom various economic reviews of Government of Kerala for the period from 1991-92 to 2009-10 wereused for the analysis.INTRODUCTIONDespite, Kerala's milk production has anincreasing nature; there was a huge gap between itsproductivity and demand for milk and milk products.The major demand for milk in the State is met byimport from neighboring states and reconstitutedmilk. Hence, the milk price is mainly controlled byorganized sectors which hold only 16 percent of thetotal milk produce and administrative authorities andsecondary market holders, where the price is oftenbased on the indices such as fat and SNF. The dairyfarmers, who are having a very marginal profitability,do not have control over the milk price fluctuations.Also the laborers are moving towards moreremunerative fields than the agricultural sector andthe social status of the youth who are expecting whitecollar jobs do not want to take up any type of animalhusbandry activity. This made the shortage of labourin the state so that the interested poor farmer who wasliving with the income moved away from this sectordue to increased cost of production and less profit. InKerala, the main problem for the farmer is concerned1. Academic Consultant, Dept. of Statistics, Kerala Veterinaryand Animal Science University2. Former Vice Chancellor, Kerala Veterinary and AnimalScience Universityevery time the farmers' price is hiked; the consumerprice has gone up, because the government does notoffer subsidy while nearby states Karnataka andTamil Nadu gives a subsidy of Rs 2 and Rs 2.50respectively per litre of milk.The other main problem behind the lowinterest in dairy farmers is the decreased cultivationof paddy also increased the need for cattle feeds.Almost 90 per cent of the raw materials needed forthe compounded cattle feed are coming from nearbystate. Hence there need to have a sustenancemechanism where in the milk price should bedetermined by the in farm factors which affects itsproduction such as rate of feed ingredients, labourcharge etc. Statistics on diverse facets of milkproduction are required both to focus on theproblems confronting farming as well as farmers inKerala in the context of emerging challenges in theeconomy, and to throw light on priority areas in needof policy intervention. One cannot spell out exactlywhere forecasts are more frequently needed as theforecasting techniques have become essentialfeatures in all the ministries, establishments, publicand private sectors. As the food security corner ofKerala is concerned, such a forecasting will cradlethe government to tide over grim situations withease.JIVA Vol. 10 Issue 1 April 201217

RESEARCH ARTICLEMETHODOLOGYAnnual data on milk production, milk price,cattle population, feed price and human populationare collected from the economic reviews of planningboard of Kerala. The Directorate of Economics andStatistics changed the Triennium Ending 1981-82base year to T.E. 1993-94 as a way of updating thebase to a recent year and keep it in harmony with theother series of indices such as Index of industrialproduction, whole sale price index and the series ofnational accounts statistics. Hence all the indexnumbers were calculated with 1993-94 as base year.thLet Pi - the price in the i year and P0that inbase year 1993-94 in Kerala. Then the index iscalculated using the formula I = P /P *100.i i 0Analysis of average annual growth rates,correlation study and regression analysis were alsodone to explore the relationship among the variables.commodity. Wide price fluctuations, on the otherhand, discourage farmers from taking up large-scaleinvestment to improve productivity. The study ofprice behavior assumes importance in this context.The significant and positive correlation betweenmilk price and milk production shows this. Thiscorrelation tend to the regression equation,Milk Production (in Lakh Tonnes) = 0.548*MilkPrice in Rs/Ltr +14.0042Which yields an R of 0.627 indicating 62.7Percent of the variation in the milk production inKerala can be explained by the variation in milk pricealone.302520Milk Production and Price per LitreRESULTS AND DISCUSSIONFrom Fig 1. it could be seen that both the milkproduction and the milk price shows an increasingtrend. In the case of agriculture, remunerative andsteady price for any agricultural produce plays acrucial role in increasing production of thatValues151050199019911992199319941995199619971998199920002001200220032004200520062007200820092010YearProduction (Lakh MT)Price (Rs/Ltr)Fig 1. Milk production and Price per litre in KeralaTable 1. Anova Table for regression between milk production and milk price(b)ANOVAModel Sum of Squares df Mean Square F Sig.aRegression 110.561 1 110.561 31.931 .000Residual 65.787 19 3.462Total 176.348 20J. Ind. Vet. Assoc., Kerala. 10 (1)Table 2. Table of regression coefficients milk production and milk priceUnstandardized StandardizedCoefficients CoefficientsB Std. Error BetatSig.(Constant)Milk Price (Rs/Ltr)14.004.5481.281.097 .79210.9285.651.000.00018

RESEARCH ARTICLEThe demand for milk does not increase themilk price very much as other substituting productslike milk powder are available in the market. But theincreasing milk price is a factor for increasing in milkproduction along with other parameters with aweightage of 0.548 to milk price.From the significant correlation betweenmilk price and feed price, the following linearrelationship could be observed by the model,Milk Price = 1.702*Price of Feed per Kg+1.641.The model explains 96.9% of the variationin the milk price with price of feed as explanatoryvariable. Thus when there is an annual increase ofone rupee in one kg of feed, there will be acorresponding increase of rupees 1.70 per one litre ofmilk.Table 3. Anova Table for regression between milk price and feed priceSum of SquaresDegree of FreedomMean SquareF ValueSig.Regression356.8971356.897594.928a.000Residual11.39819.600Total368.29620Table 4. Table of regression coefficients between milk price and feed priceStandardizedUnstandardized CoefficientsCoefficientst Sig.B Std. Error Beta(Constant)1.641 .4783.436 .003Feed Price (Rs/Kg)1.702.070.98424.391.000The other factors such as labour cost, production, demand, price of procurements like milk powder etc.do not come under the model. So there need to have a more scientific way of fixation of price so that bothconsumer and farmer are protected by considering all the factors affecting milk price. In this context, a futureJIVA Vol. 10 Issue 1 April 201219

Fig 3. Growth rates of milk production milk price and feed priceAverage annual growth ratesRESEARCH ARTICLEstudy by considering all the variables affecting milk production will help in Government policies and subsidyprogramme later.Analising the growth rates it could be observed that there occurred a sharp increase in feed price during1992-93, 1997-98 and during 2009-10. Due to this the growth rate in milk production declined well in 2009-10due to unavailability of sufficient straw due to less paddy cultivation and less grass production as summer washighly hot during that period. In this circumstances the annual growth rate of milk price was also didn't increased.These things make the farmer to move away from this sector.50.0040.00Growth Rate (%) Annual_Milk ProductionGrowth rate (% )Annual_Milk PriceGrowth rate (%) Annual_ Cattle Feed PriceGrowthrate30.0020.0010.000.00-10.001991-921992-931993-941994-951995-961996-971997-981998-991999-002000-012001-022002-032003-042004-052005-062006-072007-082008-092009-10-20.00YearAlso during the last few years the wage of labourer is increasing exponentially. The highly significantcorrelation between milk price and wage of paddy field labourer gives the linear regression,Milk Price (in Rs/Ltr) = 0.05* Wage of Men Labourer + 5.613.Since the model explains 95.2 percent variation in milk price with wage of men as explanatory variable, thewage of labourer is a main factor in determining the milk price.Table 5. Anova Table for regression between wage of labour and milk priceJ. Ind. Vet. Assoc., Kerala. 10 (1)Table 6. Table of regression coefficients between wage of labour and milk price20

A few years back the old families could maintain more than one animals. But when they split into nuclearfamilies the farmer couldn't control more and they have to pay for labourers for additional work. In this contextthe increased wage plays a major role in the decreasing cattle population.From Table (7) with base year as 1993-94, it could be observed that the feed price was increased 310.11percent and wage 645.04 percent where as the milk price to 274.36 percentTable 7. Index numbers of milk price, feed price, milk production and wageRESEARCH ARTICLETable 8. The Correlation between the variablesTable (8) shows the correlation between different variables influencing milk production. The highcorrelation between indigenous population and the total cattles and negative correlation between milk productionand total cattles in Table (8) reveals the paradox between decreasing cattle population and increasing milkproduction. This is due to the selling of low yielding indigenous cows and increased productivity with crossbred.JIVA Vol. 10 Issue 1 April 201221

RESEARCH ARTICLEThe high correlation between milk price and human population shows the increase in price with demand.There is significant correlation with the crossbred animals in milk and the milk production where as there is nosignificant correlation between milk production and indigenous animals in milk. It is also to be noted that theMilk price is directly correlated with feed price.Fig 4. Non increasing behavior of animals in milk during the last decadeFig 5. A small increasing behavior in milk production during the last few yearsJ. Ind. Vet. Assoc., Kerala. 10 (1)From fig 4 and 5 it could be observed that even though the animals in milk are almost steady, the milkproduction is moving upwards. This shows both the higher productivity of crossbred cows and the power ofincreasing trend of the use of frozen semen for the last few years. If it could be noted to increase the number ofanimals also, this will bring a good increase in milk production in Kerala.22

RESEARCH ARTICLECONCLUSIONHere an attempt is made to show therelationship between various factors that affectingdirectly and indirectly in determining the milk pricefor the last few years and also to estimate a regressionequation by considering various other factors thatinfluence the price of milk. The need for a morescientific way for fixation of price so that bothconsumer and farmer are protected by considering allthe factors affecting milk price is explained.REFERENCE[Anonymous].1999. Brochure on new series onnational accounts statistics (base year 1993-94). Central Statistical Organization.[Anonymous].2008. Eleventh Five Year Plan(20072012). Planning Commission,Government of IndiaBox, G.E.P. and Jenkins,G.M. 1970., Time SeriesAnalysis: Forecasting and Control,SanFrancisco: Holden-Day.thGujarati,D.N. 2009. Basic econometrics, 5 ed.,Boston, McGrawHill, 922p.Mandal,B.N.2004. Forecasting SugarcaneProduction In India With ARIMA Model(online), New Delhi [19-02-09].Unnikrishnan,T. and Ajitha,T.K. 2010. Applicationof ARIMA models and Co-integrationTechniques in Kerala Agriculture,Proceedings of the International Seminar onApplied Statistics, Maharajas College,Ernakulam.JIVA Vol. 10 Issue 1 April 201223

RESEARCH ARTICLECLINICAL MANIFESTATIONS OF PROSTATICDISEASES IN DOGSKiren Menon, Krishnaswamy A and Honnappa T.G.Department of Animal Reproduction Gynaecology and ObstetricsVeterinary College, Hebbal, BangaloreABSTRACTA study was conducted to note the major clinical signs of prostatic diseases in dogs. The major signsexhibited were constipation (66.7 per cent) followed by inappetence (53.3 per cent). Other signs includedhemorrhagic prepucial discharge and dysuria (46.7 per cent each), abnormal gait (40 per cent), vomiting andcachexia (33.3 per cent each). Hematuria, pyuria and purulent prepucial discharge were also noted in someanimals. Pyrexia and dehydration was seen in 33.3 per cent of the animals followed by 26.7 per cent of theanimals with a poor body condition. Caudal abdominal pain was very infrequent.J. Ind. Vet. Assoc., Kerala. 10 (1)INTRODUCTIONThe common clinical signs of prostaticdisease in dogs include constipation as evidencedby tenesmus, ribbon like feaces, dysuria, prepucialdischarge and abnormal gait (Kutzler and Yeager,2005). However, these clinical signs are oftenmisinterpreted and the disease is frequentlyoverlooked. If the condition remains untreated, itmay result in renal failure or toxemia. Therefore, itbecomes mandatory to rule out the existence ofprostatic diseases in all aged male dogs by aVeterinary Physician, particularly, when they arepresented with one or the other clinical signscommonly associated with prostatic disease.MATERIALS AND METHODSThe data pertaining to the presentinvestigation were generated following screeningof all the male dogs aged over five years which werepresented to the Out Patient Department of ClinicalMedicine, Veterinary College Hospital, Hebbal,stBangalore during the period between November 1th2007 and April 30 2008. Details about the signsexhibited were derived by both enquiries to theowners and general clinical examination of thepatient. The disease was confirmed in dogs by acombination of diagnostic techniques like rectalpalpation, ultrasonography and prostatic fluidexamination.RESULTS AND DISCUSSIONConstipation was the most commonpresenting sign seen in 66.7 per cent of the dogssuffering from the disease followed by inappetencein 53.3 per cent, hemorrhagic prepucial dischargeand dysuria in 46.7 per cent dogs each. Abnormalgait were noted in 40 per cent of the cases and signslike vomiting, and poor body condition were eachseen in 33.33 per cent of the affected animals.Hematuria was seen in 20 per cent of the cases andpyuria and presence of purulent urethral dischargewas each noted in 6.7 per cent of the cases (Table 1).Physical examination of dogs sufferingfrom prostatic disease revealed presence of pyrexiaand dehydration in 33.3 per cent of the affectedanimals and poor body condition in 26.7 per centanimals. Pain upon palpation of the caudal abdomenwas noted in 6.7 per cent of the diseased animals(Table 2).24

RESEARCH ARTICLEThe most commonest complaint in animalswith prostatic disease was constipation (66.7 percent) which has also been reported by Hornbuckleand co-workers (1978), Davidson (2003), Kutzlerand Yeager (2005) and Holt (2007) who stated thatconstipation characterized by tenesmus is one ofthe prominent clinical sign of prostatic disease inaged dogs, due to compression of the colon by theenlarged prostate gland. Hemorrhagic prepucialdischarge and dysuria were the observed in 46.7 percent each in the affected animals which has alsobeen reported in earlier studies (Hoeffer, 1977;Read and Bryden, 1995). Dilated prostatic urethralveins are considered to be the source ofhemorrhagic urethral discharge and the inwardgrowth of the gland into the urethra results inDysuria (Reihmann and Bruskewitz, 1993). Otherclinical signs observed in this study were abnormalgait (40 per cent) and loss of body condition (33.3per cent) which has also been described by Johnsonand Archibald (1974), Hornbuckle (1978),Davidson (2003) and Holt (2007). Abnormal gaitand loss of body condition are probably associatedwith either prostatic neoplasia or painful prostaticdiseases. Emesis was observed in 33.3 per cent ofanimals with prostatic disease. Vomiting has alsobeen reported in previous studies (Parry, 2006;Smith, 2008) and has been attributed to the rise inmetabolites in blood that fail to get excreted due todysuria. Hematuria, Pyuria, and purulent prepucialdischarges were clinical signs observed in thepresent study. Similar signs have been described byTable 1: Clinical History of dogs confirmed with prostatic diseasesSl No Clinical sign Number of Percentageanimalsexhibiting signs1 Constipation 10 66.72 Inappetence 8 53.33 Hemorrhagic Prepucial discharges 7 46.74 Dysuria 7 46.75 Gait abnormality 6 40.06 Vomiting 5 33.37 Loss of body condition 5 33.38 Hematuria 3 20.09 Pyuria 1 6.710 Purulent prepucial discharges 1 6.7Table 2: Clinical examination findings in prostatic diseasesSl No Nature of abnormality Number of animals Percentageobserved exhibiting abnormality1.0Pyrexia (>102.5 F) 5 33.32. Dehydration 5 33.33. Poor body condition 4 26.74. Caudal abdominal pain 1 6.7JIVA Vol. 10 Issue 1 April 201225

RESEARCH ARTICLEJ. Ind. Vet. Assoc., Kerala. 10 (1)Davidson (2003) and Kutzler and Yeager (2005).Hematuria which was observed in 20 per cent of theaffected animals may be a result of irritation causedby excess ammonia production in the bladder dueto retained urine (Johnson and Archibald, 1974).The common abnormalities on physicalexamination noted in the present study werepyrexia (33.3 per cent), dehydration (33.3 per cent),poor body condition (26.7 per cent) and caudalabdominal pain (6.7 percent). Cornell (1997),Davidson (2003), Parry (2007) and Smith (2008)described that signs like fever and cachexia arecommonly seen in infections of the prostate gland(Prostatitis/Abscess). Caudal abdominal pain(Kutzler and Yeager, 2005; Holt, 2007) is acharacteristic sign in acute inflammatory conditionof the prostate, shining a light on the fact that rest ofthe inflammatory conditions of the prostate couldbe of a chronic nature. Dehydration was one of thesigns in this study, as also noted by Parry (2006),can be attributed to the reflection of the systemicdisturbances like pyrexia and uneasiness caused bypain results in anorexia.REFERENCESCornell, K. K., Waters, D. J., Cooley, D. M., Pauli,B., Harvey, H. J., Hall, G., Render, J., Hendrick,M., Sweet, D. and Stoica, G., 1997. Canineprostate carcinoma; clinicopathologicalfindings in 168 cases. In: Proceedings, Ann.Meeting, Am. Coll. Vet. Radiol. pp.86.Davidson, J.R., 2003. Prostatic diseases of the dog,Waltham Focus, 13: 2, 4-10.Hoeffer, R.E., Dykes, N.L., and Greiner, T.P., 1977.J.Am.Anim.Hosp.Assoc., 13: 98.Holt, P.E., 2007. Prostate disease, In: SEVC(Southern European Veterinary Conference)Proceedings, (Eds). International VeterinaryInformation Service, Ithaca NY.Hornbuckle, W.E., MacCoy, D.M., Allan, G.A. andGunther,R., 1978. Prostatic disease in the dog.Cornell Vet , 68:284.Johnson, D.E. and Archibald, J., 1974. Male genitalsystem in canine surgery, American VetPublications, California, pp. 729.Krawiec, D.R. and Heflin, D., 1992. Study ofprostatic diseases in dogs: 177 cases (1981-1986). J Am Vet Med Assoc, 200:1119.Kutzler, M. and Yeager, A., 2005. ProstaticDiseases. In: (ed): Ettinger, Feldman Textbookof Veterinary Internal Medicine. 6th Edition,Elsevier Inc., p. 1809- 1819.Parry, N. M. A., 2006. Inflammatory diseases of thecanine prostate gland, UK Vet, 11: 8, 1-4.Parry, N. M. A., 2007. The canine prostate gland:Part 1:Non-inflammatory diseases, UK Vet, 12:1, 1-5.Read, R. A. and Bryden, S., 1995. Urethralbleeding as a presenting sign of benignprostatic hyperplasia in the dog: a retrospectivestudy (1979-1993). J Am Anim Hosp Assoc,31:261.Reihmann H., Bruskewitz R.C., 1993. Benignprostatic hyperplasia: manifestations andintervention. In: Lepor H, Lawson R, K. (eds):Prostate Diseases. Philadelphia, WB SaundersCo.108.Smith, J., 2008. Canine prostatic disease: A reviewof anatomy, pathology, diagnosis, andtreatment, Theriogenology, doi: 10.1016/j.theriogenology.04.039.26

RESEARCH ARTICLEDEVELOPMENT OF LEAN BEEF LOAF1 2Naseera. A .P and George T. OommenCollege of Veterinary and Animal Sciences, MannuthyABSTRACTExcessive intake of dietary fat has been implicated as a cause of chronic degenerative diseasesuch as coronary heart disease and cancers. It is accepted that it would be beneficial to reduce the dietaryfat energy to about 30 percent of the total daily energy intake. The present study was aimed at formulatinga low calorie lean beef loaf and to assess its nutritional value. The loaf was formulated with 65 percentextra lean beef, 13 percent added chilled water, 8 percent plain flour, 5.5 percent beef tallow, 1.3 percentsalt, 85ppm NaNO 2, 500ppm sodium ascorbate, 2 percent sucrose, 1.4 percent spice mix and 4percentcondiment mixture including garlic, ginger and onion. Ground beef and fat were mixed with other0ingredients and tumbled. The batter in the loaf pan was cooked to an internal temperature of 82 C in aconvection oven. The proximate composition of the product was determined and sensory evaluation wasconducted using an eight point Hedonic scale. The product constituted of 57.96 ± 0.05percent moisture,9.8 ± 0.1percent fat,16.5 ± 0.04 percent protein, 2.35 ± 0.01percent ash, 13.4 ± 0.04percent carbohydrateand a gross energy value of 207.8kcal /50kJ per cent. The contribution of energy from fat was only4percent of the Recommended Daily Level. The yield of the loaf was 85.7 percent and the mean overallacceptability score was 7.3 ± 0.05.INTRODUCTIONMany consumers associate meat with anegative image that it contains high fat and red meatis regarded as a cancer promoting food disregardingthe important physiological functions of meat due tothe presence of meat based bioactive compounds.The nutrients supplied by meat and meat products arebeneficial to human health especially the high qualityprotein and a range of B vitamins and minerals. Butthe relatively high fat content of some of theseproducts is a barrier to their wide spreadacceptability. Diets high in saturated fat are believedto increase risk of cardiovascular disease, certain1Veterinary Surgeon, Animal Husbandry Department, Kerala2Professor& Head, Dept.of Livestock Products Technology,College of Veterinary & Animal Sciences, Pookot, Keralacancers, and obesity (Southgate, 1997). Citing apoor diet as one of the major causes of morbidity andmortality, the 2005 Dietary Food Guidelines stressthe importance of a diet low in fat. Total fat intakeshould represent 20 to 35 percent of calories;saturated fat should not exceed 10 percent of totalcaloric intake. The guidelines also state thatconsumers should choose lean, low-fat, or fat-freeoptions when selecting and preparing meats.Along with its high level of consumption,ground beef has also been a major contributor of fat.It is a challenge to formulate a low-fat ground beefproduct in which the organoleptic qualities are notcompromised, because researches indicate thatpeople prefer ground beef with 15-20 percent fat.Low fat meat products with fat content starting below15 percent tend to have less beefy flavor intensity,JIVA Vol. 10 Issue 1 April 201227

RESEARCH ARTICLEJ. Ind. Vet. Assoc., Kerala. 10 (1)juiciness, and tenderness (Pearson et al., 1987). Thedifferent strategies for developing low fat meat andmeat products include modification of carcasscomposition, manipulation of meat raw materialsand reformulation of meat products. Maintenance ofacceptable palatability must remain an importantconsideration in any effort to reduce fat in meatproducts. So manufacturing further processed meatproducts with beef cuts with excess fat trimmed offand by reformulation with nonmeat and fat replaceringredients provide greatest opportunity to reduce fatand the problems encountered with the reduction offat (Colmenero et al.,2001). Carbohydrate based fatreplacers are probably the most widely used class ofreplacers in low fat meat product manufacture(Shand et al., 1990). These achieve fat replacementby stabilizing the added water in a gel-like matrix,resulting in lubricity and moisture release similar tohigher fat products (Glicksman, 1991). Skog et al.(1992) reported that adding both starch and glucoseto the beef patties inhibited mutagenic activity by upto 54 percent. Processed starches like plain flour,rice starch, modified potato, and tapioca are commonin meat formulations. Therefore, the present studywas aimed at developing a low fat lean beef loafutilizing lean beef cut after trimming excess fat, plainflour and other non-meat ingredients and to assess itsproximate composition, yield, nutritional value andsensory qualities.MATERIALS AND METHODSLean beef loaf development and formulationLean meat from a bull hygienicallyslaughtered and dressed in the Department ofLivestock Products Technology, College ofVeterinary & Animal Sciences, Mannuthy wasutilized for the study. The meat, after removal ofall visible fat, blood clots, tendons and visibleconnective tissue, was coarsely ground throughkidney plate and a 9mm plate in a meat mincer(MADO Primus Model MEW 613, Germany). Allthe non-meat ingredients were taken on ground leanmeat weight basis (Table 1).Table 1.Lean beef loaf formulation.(AMSA, 1983).IngredientsLevel ofaddition (percent)Extra lean beef 65Plain flour 8Water (g) 13Salt (g) 1.3Sugar (g) 2Sodium nitrite (ppm) 85Sodium ascorbate (ppm) 500Chopped onion, Garlic pasteand Ginger paste 1.4Black pepper, Anise,Cinnamon, Red Chillypowder and Turmeric powder 4beef tallow 5.5The raw spices like black pepper, anise,cinnamon, red chilly and turmeric were freshlyground just before use. Onion, ginger and garlicwere made into a paste. Minced meat was then mixedwith salt, sugar, sodium nitrite and sodium ascorbatedissolved in chilled water, plain flour, ground spices,chopped onion, ginger and garlic paste using a handheld mixer into a uniform batter. This was tumbledin a double drum vacuum tumbler (BIRO ModelVTS43, Germany) for 1 h (15 min. on and 5 min. off)at 7 rpm and 20” of Hg. The tumbled mix was thenstuffed into stainless steel loaf pan and cooked in aoconvection oven to an internal temperature of 85 C,ochilled to 1- 4 C and sliced. The loaf was thenanalysed for its proximate composition (AOAC,1990). Total calories and calories from fat, proteinand carbohydrate were determined as per FAO(2002). Per cent RDA (Recommended DailyAllowance) for calories from fat, protein, andcarbohydrate was calculated based on a 2200 kcaldiet (ICMR, 1990). Per cent daily value of nutrientin the loaf was calculated as per cent nutrient in theloaf divided by RDA of the nutrient. RDA of proteinwas taken as 60g (ICMR, 1990). Cooking yield28

RESEARCH ARTICLEpercentage (CY) was calculated as follows,CY = (weight of loaf after cooking / weightof loaf before cooking) x 100.The sensory panel evaluation of the loaf wasconducted by a semi trained panel consisting ofseven panelistsThe experiment was repeated six times andthe average of the values were taken.RESULTS AND DISCUSSION.The average values of proximatecomposition, nutritional value and the panel scoresof sensory qualities of cooked lean beef loaf ispresented in the Table 2, 3 and 4 respectively. Theproduct constituted of 57.96 ± 0.05 percent moisture,9.8 ± 0.1 percent fat,16.5 ± 0.04 percent protein, 2.35± 0.01 percent ash, 13.4 ± 0.04 percent carbohydrateand a gross energy value of 207.8kcal/50kJ per cent.The contribution of energy from fat was only 4percent of the RDA. The mean overall acceptabilityscore of the product was 7.3 ± 0.05. The yield of theloaf was 85.7 percent.Table 2. Proximate composition, theirpercentage contribution to RDA and cooking yield oflean beef loafParameterPercentage in leanbeef loafMoisture 57.96 ± 0.05Protein 16.5 ± 0.04Fat 9.8 ± 0.1Carbohydrate 13.4 ± 0.04Ash 2.35 ± 0.01Cooking Yield 85.7 PercentTable 3. Calorific value of nutrients and their percent contribution to the RDAParameter Calorific value % Contribution(kcal/100g) to RDAProtein 66 3Fat 88.2 4Carbohydrate 53.6 2Total 207.8 9Table 4. Sensory evaluation scores of lean beef loafAttributesScoreAppearance and colour 6.62 ± 0.03Flavour 7.55 ± 0.07Texture 7.17 ± 0.02Saltiness 7.00 ± 0.01Juiciness 7.50 ± 0.06Mouth coating 8.00 ± 0.00Overall acceptability 7.3 ± 0.05The percentage contribution of total caloriesand calories from fat to the RDA based on a 2,200kcal diet was 9 and 4, respectively in the loaf. Thecontribution of calories from carbohydrate andprotein to the total calories in the loaf wassignificantly more than that from fat. Keeton (1994)and Pearson and Gillet (1997) reported that low fatproducts must contain no more than 10 per cent fat,while extra lean product must be under 5 per cent fat.In the present study it was able to achieve a less than10 per cent of fat for the loaf. So the productprepared could be labeled as 'low fat'.More over thecontribution of calories from fat to the RDA was farbelow the recommended 30 percent (NRC, 1989) inthe formulation. So consumption of this product willnot cause any health hazard related with high fatconsumption, but will provide 27 percent of RDA ofprotein of high biological value. The overallacceptability of the product was also excellent.Brester et al (1993) also developed a low fat groundbeef and reported that the product was as palatable asbeef products that contain significantly higher levelsof fat.SUMMARYThe recipe for a lean beef loaf with fatpercentage less than 10 and with high nutritionalquality was developed using lean beef, plain flourand other non meat ingredients. The percentage of fatin this was 9.8 and the percentage RDA of caloriesfrom fat was only 4 which is far below therecommended 30 per cent. The per cent contributionJIVA Vol. 10 Issue 1 April 201229

RESEARCH ARTICLEJ. Ind. Vet. Assoc., Kerala. 10 (1)of protein to the RDA was 27. The nutritioninformation on label would enable the consumers inchoosing the meat product depending on theirrequirement. Lean beef from Indian breeds of cattleand buffaloes could well be utilised for theproduction of low fat meat loaf using suitablecombination of added water and other carbohydratebased fat replacers, without compromising thesensory attributes, yield and with reducing theincidence of health hazards related with high fatconsumption.ACKNOWLEDGMENTSThe authors are thankful to the Dean,College of Veterinary and Animal Sciences,Mannuthy and to the Professor and Head,Department of Livestock Products Technology,College of Veterinary and Animal Sciences,Mannuthy for providing facilities for the work.REFERENCESAMSA, 1983. Guidelines of sensory, physical andchemical measurements in ground beef.Recip. Meats Conf. Proc. 36:221-228AOAC, 1990. Meat and meat products. OfficialMethods of Analysis of Analytical Chemists,Fifteenth edition. Association of OfficialAnalytical Chemists. Washington D.C., p.587Brester, G.W., Lhermite, P., Goodwin, B.K. andHunt, M.C. 1993. Quantifying The EffectsOf New Product Development: The CaseOf Low-Fat Ground Beef. Journal ofAgricultural and Resource Economics. 18:2.Colmenero, J.F., Carballo, J. and Cofrades, S. 2001.Healthier meat and meat products: their roleas functional foods. Meat Sci.59: 5-13.Cooper, Kathyrn and John Michaelides. “FatReplacers and Extenders.” www.gftc.ca/articles/2004/fat-replacers-extenders.cfm.Dietary Food Guidelines 2005, Executive Summary.www.health.gov/dietaryguidelines/dga2005/document/html/executivesummary.htmFAO, 2002. Food energy methods of Analysis andconversion factors. Report of a technicalworkshop.FAO Food and Nutrition. Paper77Glicksman, M. 1991. Hydrocolloids and the starchfor the 'oily Grail'. Food Technol., 45(10): 94ICMR, 1990. Report of committee on dietaryallowances, ICMR, New DelhiKeeton, J.T. 1994. Low fat Meat productstechnological problems with processing.Meat Sci. 36: 261-276NRC, 1989. Recommended Dietary Allowances,Tenth Edition, National Academy ofSciences, Washington, D.CPearson, A. M. and Gillet, T. A. 1997. ProcessedMeats. Third Edition. CBS Publishers andDistributors, New Delhi. pp 53-425Pearson, A. M., Asghar, A., Gray, J.I. and Booren,A.M. 1987. Impact of fat reduction onpalatability and consumer acceptance ofprocessed meats. Proc. Recip. MeatConf.,40: 105Shand, P.J., Schmidt, G.R., Mandigo, R.W. andClaus, J.R. 1990. New technology for klowfat meat products. Proc. Recip. Meat Conf.,43: 37Skog, K., Jägerstad, M. and Laser, A.R. 1992.Inhibitory effect of carbohydrates on theformation of mutagens in fried beef patties.Food and Chemical Toxicol. 30:8.pp. 681-688Southgate, D.A.T. 1997. Demand for healthful meat,poultry and fish products. In. Productionand Processing of Healthy meat, poultry andfish products.(Eds. Pearson, A.M. andDutson, T.R.). Blackei AcademicProfessional, New York, pp. 1-3130

RESEARCH ARTICLEANALYSIS OF INFORMATION NEEDS FOR DEVELOPING A MEDIAPROTOCOL IN SELECTED DISTRICTS OFHARYANA IN ANIMAL HUSBANDRY PRACTICES*1 2 3S. Sreehari , H.K. Gulati and A.K. VarmaLala Lajpat Rai University of Veterinary & Animal Sciences, Hisar*Part of Ph.D thesis submitted by first author to LLRUVAS, HisarABSTRACTThe present study was conducted in Haryana state. Sixty rural women from each Khoka, Sadalpur,Purkhas and Harsana villages were selected randomly for assessing information needs of rural womenregarding animal husbandry practices. On the basis of weighted mean scores and ranks messages having highfive ranks and three sub-messages from each selected messages got higher rank were finally selected for mediapreparation. Selected messages were breeding, balanced feeding, animal diseases and their prevention, farmmanagement and accounting and clean milk production in descending order of mean scores. Under balancedfeeding, feeding management got ranked second with weighted mean score 2.79. Balanced ration and itscomposition ranked third with weighted mean score 2.70. Mineral mixture feeding in animal feed withweighted mean score 2.9 got ranked first. Time of insemination got rank first with weighted mean score 2.15and the sub-message symptoms of heat got rank second with weighted mean score 2.19 among sub-messagesrelated to breeding. Among sub-messages related to animal diseases first three ranks went to foot and mouthdisease (I, 2.69), Wound treatment (II, 2.50) and Tympany/bloat (III, 2.15).INTRODUCTIONWomen in India play a predominant role inagriculture and food provisioning and subsistenceagricultural activities. The 'silent majority' of theworld's poor are women. They face peculiar social,cultural, educational, political and allied problems.Studies have shown that although rural womenproduce up to 80 per cent of food in developingcountries, yet they have title to only a fraction of farmland and access to ten percent of credit and five per1. Veterinary Surgeon , Veterinary Dispensary, Pudukad,Thrissur.2. Professor, Department of Livestock ProductionManagement, College of Veterinary Sciences, Hisar.3. Professor & Head, Department of Livestock ProductionManagement, College of Veterinary Sciences, Hisar.cent of extension advice (Agarwal, 2003). Ruralwomen's access to agricultural extension servicesworldwide is only about 1/20th of that of men, andtechnology is rarely designed specifically to addressthe women's needs. In India, out of 88,000 villageextension workers, only about 10 percent (9,000) arefemale (NRCWA, 2007). No training would bringdesirable changes in the behaviour of farm womenunless it is need and interest based. The media isplaying an important role in passing on meaningfulinformations at faster rate to the large number of farmwomen in our country. It has emerged as one of thepowerful sources of seeking relevant scientificinformation by our farm women, therefore, tappingand utilizing media for transferring the newlygenerated technologies in agriculture and animalJIVA Vol. 10 Issue 1 April 201231

RESEARCH ARTICLEJ. Ind. Vet. Assoc., Kerala. 10 (1)husbandry among the Indian farm women is crucialand of significant importance. The present study wastherefore conducted to assess the information needsof rural women in Hisar and Sonepat districts ofHaryana for selecting the messages to be included inan internet based media package on animalhusbandry practices for rural women of Haryana.MATERIALS AND METHODSTo assess the information need of ruralwomen regarding animal husbandry practicesfollowing methodological steps were followed.Hisar and Sonepat districts of Haryana state wereselected randomly. There are 9 blocks in Hisardistrict and 7 blocks in Sonipat district. Out of these,two blocks from each district viz., Hisar I andAdampur blocks were selected at random from Hisardistrict while, Ganaur and Sonepat blocks wereselected from Sonepat district, randomly. From eachof the selected blocks a list of all villages of blockconcerned was prepared and from that list one villagefrom each block viz., Khoka village from Hisar Iblock, Sadalpur village from Adampur block,Purkhas village from Ganaur block and Harsanavillage from Sonepat block were selected randomly.60 rural women who involved in dairy activities fromeach village were selected purposively. Theinterview was conducted only from one female offamily who had been actively involved in rearingbuffaloes. In this way, the total sample for this studywas 240 women. Need was operationalized as theneed of the each respondent related to selectedanimal husbandry practices. For assessing the needof the rural women an inventory pertaining to thecritical messages and sub-messages was prepared inconsultation with experts, relevant literature, libraryand package of practices. In this way, total ninemessages were listed. Each message was ascertainedunder three categories i.e. most needed, needed andleast needed with scores 3, 2 and 1 respectively.Weighted mean scores were worked out for each ofthe nine messages and sub-messages separately. Theranks were assigned according to weighted meanscore and fifty per cent of messages having top fiveranks and 3 sub-messages from each selectedmessages got upper rank were finally selected formedia preparation. Frequency and percentageswhere used to study the profile of the respondents.RESULTSInvolvement of rural women clientele inmessage designing and media production is ofparamount importance in media preparation to avoidany loss of communication. Media effectiveness canbe enhanced only when the messages selected are intune with the need and interest of target audience.Therefore, in present study attempts were made toselect the messages and sub-messages according tothe need of the rural women in consultation withexperts and relevant literature of animal husbandry.In this way total nine messages viz., breeding,feeding, management of cattle shed, health care,preservation of green fodder, clean milk production,farm management and accounting, marketing,animal diseases and their prevention were listed(Table 1) and each message was further divided intosub-messages (Table 2). It was revealed that out ofthese five messages i.e., balanced feeding, breeding,animal diseases and their prevention, farmmanagement and accounting and clean milkproduction had above 2.46 weighted mean scoresand ranked I to V respectively. Thus these fivemessages were selected for media preparation,identified as most needed messages by rural women(Table 1).32

RESEARCH ARTICLETable 1:Selection of the messages according to the need of the rural women regarding animal husbandrypracticesS. No. Messages Most Least Total weightedneeded Needed needed mean score Rank1. Farm managementand accounting 160 33 47 2.47 IV2. Breeding 180 38 22 2.65 II3. Marketing 14 181 45 1.87 VI4. Management ofcattle shed 33 75 132 1.59 VII5. Animal diseasesand their prevention 159 38 43 2.48 III6. Balanced feeding 210 29 1 2.87 I7. Health care 40 38 162 1.5 IX8. Preservation ofgreen fodder 40 44 156 1.51 VIII9. Clean milk production 161 29 50 2.46 VSelection of sub-messagesThe selected messages were further divided into sub-messages. They were then ranked in a similarmanner to find out which of the submessages have to be included and those to be eliminated. The results areshown in Table 2.Table 2: Selection of various sub-messagesS. No. Messages Most Least Total weightedneeded Needed needed mean score Rank1. Selection of sub-messages related to balanced feeding (M1)1. Calf feeding 195 36 9 2.77 III2. Change required in feedingof animals before and afterparturition/claving 176 50 14 2.67 IV3. Feeding management 198 34 8 2.79 IIJIVA Vol. 10 Issue 1 April 201233

RESEARCH ARTICLE4. Balanced ration andits composition 181 47 12 2.70 III5. Essential nutrients inanimal feed 47 49 144 1.59 VI6. Feeding of pregnant cow 179 39 22 2.65 V7. Feeding management ofmilch animals 178 42 20 2.65 V8. Mineral mixture feeding 219 19 2 2.90 I2. Selection of sub-messages related to breeding (M ) 21. Symptoms of heat 73 129 38 2.14 II2. Heat cycle and timeof breeding 97 49 94 2.01 VII3. Pregnancy diagnosis 61 108 71 1.95 VIII4. Artificial insemination 68 119 53 2.06 IV5. Time of insemination 94 90 56 2.15 I6. Importance of insemination 65 118 57 2.03 VI7. Care during pregnancy 61 137 42 2.07 III8. Care during parturition 82 95 63 2.07 III9. Care after parturition 78 97 65 2.05 V10. Care of calf 67 123 50 2.07 III3. Selection of sub-messages related to animal diseases and their prevention (M ) 3J. Ind. Vet. Assoc., Kerala. 10 (1)1. Anestrus 112 23 105 2.03 IV2. Ectoparasite infestation 60 122 58 2.01 V3. Retained placenta 98 44 98 2.00 VI4. Diarrhoea 56 108 76 1.92 IX5. Repeat breeding 59 97 84 1.90 VI34

RESEARCH ARTICLE6. Endoparasite infestation 57 127 56 2.00 VIII7. Intoxication 79 64 97 1.93 VII8. Tuberculosis 100 25 115 1.94 VIII9. Haemorrhagicsepticemia (HS) 64 109 67 1.99 VII10. Abortion 124 28 88 2.15 III11. Pneumonia 63 98 79 1.93 IX12. Milk fever 101 45 94 2.03 IV13. Foot and mouth disease 196 14 30 2.69 I14. Constipation 60 91 89 1.88 XII15. Cow pox 57 87 96 1.84 XIV16. Tympany/bloat 62 85 93 1.87 XIII17. Mastitis 80 79 81 2.00 VII18. Tail necrosis 46 60 134 1.63 XVI19. Wound treatment 146 67 27 2.50 II20. Coughing 49 69 122 1.70 XV4. Selection of sub-messages related to Farm management and accounting (M ) 41. Purchase of milch animals 200 16 24 2.73 IV2. Purchase of feed ingredients 48 34 158 1.54 VI3. Sale of produce 147 89 4 2.59 V4. Sale of animal manure 20 60 160 1.41 VII5. Characteristics ofMurrah buffalo 194 40 6 2.78 II6. Age estimation of animalsfrom teeth 198 29 13 2.77 III7. Credit facilities 213 10 17 2.81 IJIVA Vol. 10 Issue 1 April 201235

RESEARCH ARTICLE5. Selection of sub-messages related to clean milk production (M ) 51. Fat testing at home 15 48 177 1.32 VI2. Prevention of damage of teats77 161 2 2.31 V3. Right method of milking 203 25 12 2.79 I4. Usefulness of clean milkproduction 145 89 6 2.57 II5. Health symptoms fordecline in milk 132 84 24 2.45 IV6. Care to be taken aftermilking 117 117 6 2.46 III7. Cleaning before milking 206 19 15 2.79 IJ. Ind. Vet. Assoc., Kerala. 10 (1)DISCUSSIONIn the present study among nine main messagesbalanced feeding ranked highest in information needas compared to breeding (Rank II), Marketing (RankVI), Management of cattle shed (Rank VII) etc. Sincethe major farm operations of breeding, health careand marketing and finance require outside contact,the involvement of farm women was less. This mightbe the reason for the farm women to perceive thesemajor farm operations as the least preferred areas oftraining. Similar findings were reported by Manjusha(1990), Sheela and Swamy (1993), Prakash et. al.(1995) and Singh et. al. (2001). Due to constraints oftime and resource there was no other alternative thantone down the number of messages. Among breedingpractices time of insemination ranked first followedby heat symptoms, care during pregnancy, care durinparturition and calf care. Similar studies have beenreported by Durgga Rani and Subhadra, (2009) whoreported selection of breeds ranked first for bothknowledge and skill oriented training needs. Thefarm women might have perceived, selecting asuitable breed as one of the primary factors inachieving productivity in dairy animals. This findingis in line with those of Fulzele and Meena (1995) and36Raju et. al. (1999) who reported that selection ofbreed was a most needed area of training. Perhaps thefact that need assessment was done by a veterinarianprompted the respondents to pin point theirinformation needs in the form of specific diseaseslike Foot and mouth disease, wound treatment andcommon conditions like Tympany. Among submessagesrelated to farm management andaccounting information regarding credit facilitiesranked first. Capital is an important prerequisite forstarting a dairy farm. Limited or non-availability ofcapital among the respondents might be the reasonfor their highest preference for informationregarding credit facilities. Similar studies have beenreported by Jothilakshmi et. al. (2009). Breedidentification especially that of Murrah was rankedsecond among sub-messages related to managementand accounting perhaps because of awarenessamong farmers that such knowledge is mostimportant during purchase of animals. Similar tothese findings Fulzele and Meena (1995) reportedthat selection of breeds were considered as importantareas of training by farm women. Regarding healthcare, vaccination was ranked first for knowledgeneed. The farm women might have been interested toknow about the control and identification of

RESEARCH ARTICLEimportant diseases. The results are in par with thefindings of Umarani and Thangamani (2000), Dasand Mishra (2002) and Gupta and Tripathi (2002).About the information need with respect to the minoroperations of marketing and finance, the farmwomen needed training the most in banking andinsurance. This might be because the farm womenhad limited information regarding the varioussources from which they could obtain financialassistance and also about the insurance policies. Inthe present study the women expressed need to knowabout practices to be followed to obtain clean milk(Rank V) as main message. This perhaps is becauseof lesser awareness about hygiene in ruralsurroundings.REFERENCESAgarwal, S. 2003. Technology model for women'sempowerment. Sonepat, May, 2003: 18-28.Durgga Rani, V. and Subhadra, M.R. 2009. Trainingneeds of farm women in dairy farming.Veterinary World, 2(6): 221-223Fulzele, R.M. and Meena, B.L. 1995. Training needsof dairy tribal women. Ind. J. Dairy Sci., 48:551-553.Gupta, M. and Tripathi, H. 2002. Assessment oftraining needs of rural women in dairyenterprise. Indian J. Dairy Sci., 55 (3): 178-182.Jothilakshmi, M., Krishnaraj, R. and Sudeepkumar,N.K. 2009. Empowering the Members ofWomen SHGs in Livestock Farmingthrough Need-Based Trainings. Asia-Pacific Journal of Rural Development.19(2):17-30.Manjusha 1990. Time utilization pattern of ruralwomen in dairy farming. M.Sc. Thesis,Haryana Agricultural University, Hisar,Haryana.NRCWA. 2007. Vision 2025 Perspective Plan.National Research Centre For Women InAgriculture, Bhubaneswar. Retrieved from,http://www.nrcwa.org/downloadfiles/nrcwavision2025.pdfPrakash, O., Mahipal, R.L. and Kherde. 1995. Astudy of perception of training needs oflandless farm women in scientific dairyfarming practices. Advances in Agriculturalresearch in India, 4: 196-209.Raju, L.D., Nataraju, M.S. and Niranjan, M. 1999.Women in animal production an ex- postfacto analysis. Agricultural Extn. Rev.,11(3): 3-8.Sheela, B. and Swamy, S. 1993. Training needs fordairy practicing women. Maha. J. Ext. Edu.,12(3&4): 345-347.Singh, M., Mishra, S. and Rani, S. 2001. Trainingneeds of rural women. Ind. J. Ext. Edu.,37(1&2): 92-94.Umarani, K. and Thangamani, K. 2000:Technological needs of women in dairying.J. Ext. Edu., 11(2): 2812-2814.JIVA Vol. 10 Issue 1 April 201237

RESEARCH ARTICLEANALYSIS OF SOCIO-PERSONAL PROFILE OF LIVESTOCK-BASED SELF HELP GROUP MEMBERS OF THRISSUR DISTRICT*1 2 3Anu George , P.J.Rajkamal and Jiji.R.SCollege of Veterinary and Animal Sciences, Mannuthy, Kerala*Part of M.V.Sc thesis submitted by the first author to Kerala Agricultural UniversityABSTRACTThe personal, socio-economic and socio-psychological characteristics of selected livestock basedSelf Help Group (SHG) members were analysed in the study. Majority of the respondents were middle aged (86percent), females (81 percent) and had formal education of 5-8 years (77 percent). Livestock rearing was themajor occupation for most of the SHG members (72 percent) and majority had an income of less than 5000 perannum (62 percent). Maximum number of the respondents owned less than four animals (44 percent). Nonehad more than one hectare of land. Family size of most of the respondents was less than five (72 percent). Morethan half of the respondents had less than five years of experience in livestock farming (58 percent).More thanthree-forth had less than 5 years of experience as SHG members (81 percent). Majority of the respondents werein the medium category with regard to the socio psychological variables such as economic motivation (71percent), social participation (68percent), achievement motivation (65 percent) and cosmopoliteness (57percent).Maximum number of respondents (43 percent) had medium level of risk orientation.J. Ind. Vet. Assoc., Kerala. 10 (1)INTRODUCTIONSelf Help Group (SHG) is a small group ofrural people, usually 10-20 in number, gatheredvoluntarily to undertake some common incomegenerating activities through mutual trust and mutualhelp (Arunkumar, 2005). Its formation in each blockpanchayat is envisaged through SwarnajayanthiGrama Swarozgar Yojana (SGSY), a centrallysponsored, comprehensive rural developmentprogramme of Ministry of Rural Development.Under SGSY, assistance is given to poor families,living below poverty line, for taking up selfemployment. The beneficiaries are calledSwarozgaris.SGSY promotes group approach morethan individual approach and majority of the funds1 2 3PhD Scholar, Professor and Head and Associate ProfessorDepartment of Veterinary and Animal Husbandry Extensionare given for SHGs. The major objective of SHGs ispoverty eradication and their formation is facilitatedby non-government organisations also. Furthermore,the poverty eradication mission of Keralagovernment, Kudumbasree is also organizingwomen SHGs including that of livestock basedSHGs.In each block, 4-5 key income generatingactivities are identified based on the local resources,occupational skills of the people and availability ofthe markets. For successful self employment, it isnecessary to take up the right activity. Training willbe provided to the group members for microenterprise development. Also income generatingassets and inputs will be provided to the groupsthrough a package of assistance in the form ofsubsidy and bank loan. In Kerala, SHGs are gainingmore impetus nowadays and many are takinglivestock rearing as the key activity.38

RESEARCH ARTICLEThe SHG members can work together toaddress issues that affect not only their ownmembers, but others in their community also. TheSHG members reflect a diverse membershipcovering different social and economic categories.Hence the present study was undertaken to assess thepersonal, socio-economic and socio-psychologicalcharacteristics of the SHGs involved in livestockrearing.RESULTS AND DISCUSSIONTable 1 Distribution of SHG members based on personal characters n=100Sl.No Characteristic Category Percentage1 Age 50 years 22 Sex Male 19Female 813 Education 8 years 84 Caste ForwardCommunity 32SC/ST 38OBC 305 Family size 8 members 056 Experience in Livestock Farming 10years 97 Experience inSHGs 5years 19JIVA Vol. 10 Issue 1 April 201239

RESEARCH ARTICLETable 1 shows that 86 percent of the respondents werein the age group of 35-50 years, 12 percent of themless than 35 years old and the remaining 2 percentwere above 50 years old. Almost similar report wasgiven by Anon (2009) where, 70 percent of themembers were of age group 26-50 years. This trend isbecause, under SGSY, training is imparted to the agegroup of 35-50. It is evident that 81 percent of themembers were female and the rest 19 percent weremale. The finding was in close conformity with Anon(2009). According to the SGSY guidelines, atleast 40percent of the swarozgaris should be female. Moreoften than not, in a block half of the SHGs areexclusive women groups. It is clear in the table 1, that77 percent of the members were having formaleducation of 5-8 years, 15 percent had less than 5years of formal education and only 8 percent of themembers had more than 8 years of formal education.In general, SGSY prescribes no educationalqualifications for the swarozgaris. Among therespondents, 32 percent belonged to forwardcommunity, 38 percent were SC/ST and theremaining 30 percent were other backwardcommunity. According to Anon (2006), theproportion of SC/ST was 55 percent of the totalmembers. SGSY focuses on the most vulnerablegroups of the rural poor. As per the SGSY guidelines,atleast 50 percent of the members should be fromSC/ST community and 15 percent should be fromminority. Family size was less than five for 72percent of the SHG members. In the case of 23percent, family size was between 5-8 and for 5percent it was large with more than 8 members.Contradictory results were shown by Anon (2009),that is, 56 percent of the respondents had family sizeof 6-10 members. With regard to livestock farming,58 percent of the members were having less than 5years of experience, 33 percent had 5-10 years ofexperience and the remaining 9 percent only hadmore than 10 years of farming experience. Majorityof them started livestock rearing after the SHGformation. Since capacity building through trainingis an important component of these group activities,even a non-experienced person can start a microenterprise, if really motivated. Experience in SelfHelp Groups was less than five years for 81 percentof the members. The rest 19% had more than 5 yearsof experience as SHG members.J. Ind. Vet. Assoc., Kerala. 10 (1)Table 2 Distribution of SHG members based on socio-economic characters n=100Sl.No Characteristic Category Percentage1 Major occupation Agriculture 10Livestock rearing 72Business 03Labourer 152 Income from Livestock < Rs.5000 62Rs.5000-10000 37>Rs.10000 013 Livestock Owned 8 numbers 264 Land owned

RESEARCH ARTICLETable 2 shows that livestock rearing was themajor occupation for 72 percent of the SHGmembers, 15 percent were labourers, 10 percentagriculturists, and 3 percent were doing business.While studying the SHGs in the country, Anon(2006) reported that 38 percent of SHG membersworked as casual labourers, 29 percent worked inown agriculture, and 17 percent were engaged in anon-farm enterprise. For 62 percent of the members,income from livestock was less than Rs.5000 perannum and 37 percent had Rs.5000-10000. Onepercent of the SHG members claimed to earn morethan Rs.10000 annually from livestock. Cent percent of the respondents were having less than onehectare of land. As per the SGSY guidelines, smalland marginal farmers are the target groups in thescheme. It is shown that 44 percent of therespondents were rearing less than four animals, 30percent reared 4-8 numbers, and 26 percent rearedabove 8 animals. Less availability of land may be thereason for small holding units. But now a days thereis a new trend that even though small holdings arereducing, there are many new entrepreneurs comingto the sector to start commercial farms.Table 3 Distribution of SHG members based on socio-psychological characters N=100Sl.No Characteristic Category Percentage1 Economic motivation Low 10Medium 71High 192 Social participation Low 10Medium 68High 223 Achievement motivation Low 15Medium 65High 204 Cosmopoliteness Low 21Medium 57High 225 Risk orientation Low 37Medium 43High 20It is seen in the table 3, that 71 percent of theSHG members were in the medium category foreconomic motivation, 19 percent were in the highcategory and only 10 percent were in the lowcategory. For social participation, 68 percent of SHGmembers were in the medium, 22 percent in high and10 percent in low categories. Similarly forachievement motivation, 65 percent of the memberswere in medium 20 percent in high and 15 percent inthe low categories. This finding is in closeconformity with that of Devalatha (2005) andArunkumar (2005). For cosmopoliteness, 57 percentof the members were in medium, 22 percent in highand 21 percent in low categories. Finally for riskorientation, 43 percent in medium 37 percent in lowand 20 percent in high category. The pattern is almostsimilar in the case of the first four sociopsychologicalcharacters. Above half of the SHGmembers were in the medium category. This findingwas in close agreement with those of SreedayaJIVA Vol. 10 Issue 1 April 201241

RESEARCH ARTICLE(2000) and Fayas (2003). More than three-forth ofthe members were in the medium and high categoriestaken together. But in the case of risk orientation,only less than half of them were in the mediumcategory. Surprisingly, 80 percent of the SHG were inthe low and medium categories taken together. Thisshows that risk taking behaviour of innovators are notshown by SHG members of these blocks. Onlyrecognized profitable businesses are taken by them.REFERENCESAnon 2006 Self Help Groups in India-A study of thelights and shades. Executive summary of EDARural systems Pvt.Ltd in association withAPMAS for CRS, USAID, CARE,GTZ/NABARD 20pAnon 2009 Evaluation Report on SwarnajayanthiGram Swarozgar Yojana(SGSY), Jammu &Kashmir, Planning Commission, Governmentof India, 68p.Arunkumar D 2005 A critical analysis of Swa-Shaktiprogramme in Karnataka, M.Sc (Agri) Thesis,University of Agricultural Sciences, Dharwad,112pDevalatha, C.M 2005 Profile study of women selfhelp groups in Gadag District of NorthernKarnataka, M.Sc (Agri) thesis ,University ofAgricultural Sciences, Dharwad 74pFayas, A.M 2003 Viability of Self-Help groups invegetable and fruit promotion council KeralaAn multidirectional analysis. MSc (Agri)Thesis, Kerala Agricultural University,Thrissur 126pSreedaya,G.S. 2000 Performance analysis of theSelf-Help groups in vegetable production inThiruvananthapuram District. MSc (Agri)Thesis, Kerala Agricultural University,Thrissur 154pSwarnajayanti Gram Swarozgar Yojana Guidelines,retrieved from http:// megcnrd.gov.in/forms/SGSY.pdf on 10/03/2012J. Ind. Vet. Assoc., Kerala. 10 (1)REMEMBRANCE DAY OBITUARYDr. K. S. Jayaram, Retired Deputy Director of Animal Husbandry Department,Kerala passed away on 06/01/2012 at Ambalavayal , Wayanad. He belongs to 1972batch of Veterinary College, Mannuthy. He was the member of First GeneralCouncil of Kerala Agricultural University. He held different positions in AnimalHusbandry Department , Kerala and Retired from Service as Chief VeterinaryOfficer , District Veterinary Centre , Kalpetta. He was an active member of IVAand held various positions in the association including that of state vice president.He was also the district president of KGOA Wayanad during 1983-84. He issurvived by his wife Dr.Radhamma Pilla (Professor and Head, KVKAmbalavayal), two daughters and one son. May his soul rest in peace.Dr. P.V. Pradeepan, remembrance day was arranged at Valancheri MES collegeauditorium on 19/01/2012 at 3pm.Dr Ajayakumar P N President IVA Malappuramdistrict welcomed the gathering. Dr K R Arunkumar IVA State President presidedover the function. Dr K Udayavarman, Director Zoo and Museum inaugurated thefunction. IVA State President in his presidential address mentioned about theformation of Pradeepan Memorial Trust to offer a helping hand for the beststudents of Irumblium Govt. High School, where Dr Pradeepan had studied. DrHaroon Abdul Rasheed, Dr Abdul Asees, Dr Pradeepan’s friends Mr Madhu, Abdusalam and Radhakrishnan shared their memories about Dr Pradeepan.42

CLINICAL REPORTOxyspirura mansoniIN BACKYARD POULTRY OF KERALA1 2 2 2Deepu Philip Mathew , Priya M .N ., Deepa C.K ., Syamala K .,2 2Ajithkumar K. G . and Reghu RavindranCollege of Veterinary and Animal Sciences, PookotABSTRACT:A few birds reared by a private owner as backyard poultry were brought to the Veterinary Dispensary,Thiruvanvandoor, with the complaint of inability to open the eyes. Irritation and secretion of tears from the eyesof birds were observed. White, small, thread like nematode worms recovered from the eyes, The worms wereidentified as Oxyspirura mansoni based on morphology.INTRODUCTION:Despite a tremendous increase in the commercialrearing, rural poultry still constitutes 80 per cent ofour total poultry population. Though the prevalenceof parasitic infections are less in commercialsystem due to the non availability of intermediatehosts, helminth infections are high in free range andbackyard systems due to exposure to reservoirhosts and unscientific management practices(Permin et al., 1999). The present study deals withthe occurrence of Oxyspirura mansoni, the eyeworm of chicken.MATERIALS AND METHODS:The birds were brought to VeterinaryDispensary, Thiruvanvandoor, Alappuzha with thecomplaint of inability to open the eyes andprotrusion of the nictitating membrane. The ownercomplained of irritation and inflammation withsecretion of tears from the eyes of birds. The birdswere reared as back yard poultry by the farmer.Examination of eyes revealed the presence of largenumber of live worms under the nictitatingmembrane. Worms recovered from the eyes weresent to the Department of Veterinary Parasitology,1. Veterinary surgeon, Veterinary Dispensary,Thiruvanvandoor, Alapuzha2. Assistant Professor Department of Veterinary Parasitology,College of Veterinary and Animal Sciences, Pookot, Lakkidi,P. O., Wayanad.College of Veterinary and Animal Sciences, Pookotfor identification.These parasites were then processed bydehydrating in ascending grades of alcoholfollowed by clearing using creosote. The specieswas identified based on morphology according toSoulsby (1982).RESULT:The worms were white, small and threadlike measuring a little over half an inch in length.The male worms were smaller than the females.Microscopically, the mouth opening was large,circular and devoid of lips. The pharynx wasobserved to be hourglass shaped (Fig.1). The tailend of the male was curved ventrally while infemales it was straight. Two unequal spicules werepresent on the posterior end of the males. One of thespicule was long and slender while the other wasshort and thick (Fig. 2). There were six pairs ofgenital papillae on the posterior end of the male. Inthe female, the vulva was located ventrally in theposterior half of the body.The worms wereidentified as Oxyspirura mansoni based on Soulsby(1982). The affected birds were treated withAlbendazole 2.5 percent suspension topically byinstilling a drop each into the eyes two times a dayfor 3 days consecutively. The complete flockincluding the affected birds was dewormed withJIVA Vol. 10 Issue 1 April 201243

CLINICAL REPORTJ. Ind. Vet. Assoc., Kerala. 10 (1)Fig.1: Oxyspirura mansoni- anterior end-Hour glass shaped pharynxFig.2: Oxyspirura mansoni- male tail end- longleft spicule and short right spiculeAlbendazole 2.5 per cent suspension orally at thedose rate of 25 mg/kg body weight. The treatmentregimen resulted in complete recovery of all theaffected birds.DISCUSSION:Previously, Pillai and Peter (1971) andNadkal et al., (1972) have reported the occurrenceof O. mansoni in Kerala. Based on availableliterature, there is no report of the parasite from thestate since 1972. This may be due to the lack ofsurveys for detection of worms from poultry.44Eventhough the prevalence of mostparasitic diseases in poultry has reducedsignificantly due to commercial poultryproduction, a number of helminth species areobserved in rural scavenging poultry (Pandey et al.,1992, Permin et. al., 1997 and Kabatange andKatule, 1990). Larvae of Oxyspirura mansonidevelop in the body cavity of the cockroach oningestion of embryonated eggs that are passedthrough faeces of affected birds. Ingestion ofinfected cockroaches leads to infection (Soulsby,1982). The movement of the worms in the eye,results in irritation ophthalmitis and abundantsecretion of tears leading to self inflicted injury.The nictitating membrane becomes swollen andmay protrude out of the corner of the eye (Flynn,2007).REFERENCES:Kabatange, M.A, and Katule, A.M 1990 Ruralpoultry production systems in Tanzania. In:Proceedings of an international workshop onrural poultry in Africa, African Network onRural Poultry Development, Nigeria. pp.171-176Nadkal, A.M., John, K.C., Muraleedharan, K andMohandas, A. 1972 Qualitative analysis ofgastrointestinal helminths of domestic fowlin southern Kerala. Ind. J. Anim. Health 11:5-9.Permin A, Magwisha H, Kassuku AA, Nansen P,Bisgaard M, Frandsen F, Gibbons L (1997) Across-sectional study of helminths in ruralscavenging poultry in Tanzania in relation toseason and climate. J. Helminthol. 71: 233-240.Pillai, K.M., Peter, C.T. 1971 Studies on tapewormscommonly encountered in fowls. Ind. Vet. J.48: 430-431.Robert, J. Flynn and David, G. Baker 2007 Flynn'sndparasites of laboratory animals. 2 Edn.American College of Laboratory AnimalMedicine Blackwell publishing pp: 250-251Soulsby, E.J.L. 1982 Helminthes, arthropods andprotozoa of domesticated animals. 7th Edn.Bailliere Tindall, London pp: 291WATTpoultry statistical yearbook 1996 Poultry Intl35: 8

CLINICAL REPORTBILATERAL INGUINAL HERNIA WITH DISTINCT HYSTEROCELEAND OMENTOCELE IN A DACHSHUND BITCH1 2 3John Martin K. D. , Susannah Bijee Philip , Sherin B. Sarangom4and Ashay P. KankonkarCollege of Veterinary and Animal Sciences, Mannuthy, Thrissur, Kerala 680651INTRODUCTIONInguinal hernias may be congenital or acquiredof which the former in dogs occur as a result of adefect in the inguinal ring through which theabdominal contents protrudes into the subcutaneousspace (Pratschke, 2002). Inguinal hernias may becongenital or acquired. The former are rare in dogsand may co-exist with the umbilical hernias (Fossum,2007), while the latter are often seen in middle agedintact bitches (Waters et al., 1993). The potentialfactors involved in the development of inguinalhernias might be anatomical, hormonal andmetabolic in nature. However, the exact etiopathogenesisis still unknown (Smeak, 2003).Polygenic inheritance of inguinal hernia had beendescribed in Cocker Spaniels and Dachshunds byRoberts (1986). The usual contents of inguinal herniamay include omentum, fat, ovary, uterus, smallintestine, colon, bladder and spleen, with omentumbeing the commonest. (Bellenger, 1996). Herniationof gravid uterus and pyometra uterus through theinguinal ring are also report (Munro and Stead, 1993;Byers, 2007). The present paper reports bilateralinguinal hernia in a dachshund bitch and its surgicalmanagement.CASE HISTORY AND OBSERVATIONSA five year old nulliparous dachshund bitch waspresented to the Kerala Veterinary and AnimalSciences University Hospital, Kokkalai with abilateral swelling in the inguinal region. The swellingwas noticed since one month, which increased in sizeover the last two weeks. The animal was in estrus onemonth back and had no previous history of any1 2,3&4Associate Professor, M.V.Sc. ScholarDepartment of Veterinary Surgery and Radiologytrauma. The animal was bright, active and alert. Allthe physiological parameters were within the normalrange. On palpation, the swellings were non-painful,soft and doughy in consistency. The left inguinalswelling was bigger in size compared to the rightone. The contents of both the swelling were nonreducible,even on application of moderate pressure.The bladder was catheterized, urine was relieved andthus the possibility of vesicocele was ruled out.Ultrasonographic examination of the left inguinalmass could revealed strands of hypoechoic regionwith areas of normal echogenicity and the rightinguinal mass with moderate echogenicity. Based onhistory, physical inspection and ultrasonographicexamination, the condition was diagnosed as anacquired bilateral inguinal hernia. The reduction ofthe hernial contents and herniorrhaphy under generalanaesthesia were resorted to.SURGICAL INTERVENTIONAND TREATMENTThe dog was premedicated with atropineasulphate at the rate of 0.045 mg/kg body weightbfollowed by xylazine hydrochloride at the rate of 1.5mg/kg body weight, both given intramuscularly. Thethe surgical site ware shaved, scrubbed and paintedwith Tr Iodine for aseptic surgery. Generalanaesthesia was induced with ketaminechydrochloride at the rate of 5 mg/kg body weightintramuscularly and was maintained by incrementalintravenous injection of a combination of xylazinehydrochloride and ketamine hydrochloride, equaldquantity by volume and diazepam given 'to effect'.The dog was positioned on dorsal recumbency. Thesite was painted with Tincture iodine and the patientJIVA Vol. 10 Issue 1 April 201245

CLINICAL REPORTJ. Ind. Vet. Assoc., Kerala. 10 (1)was draped. A four centimeter long cutaneousincision was made over the lateral aspect of the leftinguinal swelling parallel to the flank fold. Theincision was deepened through the subcutaneoustissue to expose hernial sac by blunt dissection. Thehernial sac was opened and the contents were foundto be non-gravid uterine horns with the broadligaments (Fig.1). The kelotomy was performed byincising the inguinal ring in a cranio-medial directionto reduce whole non- gravid uterus with the broadligaments into the abdominal cavity. The hernial sacwas ligated as close to the internal inguinal ring aspossible and was sectioned distal to it. Both internaland external inguinal rings and the kelotomy woundwere closed in separate layers by simple continuoussutures followed by a layer of subcutaneous sutureseusing 3.5 metric polyglactin 910 . The skin woundwas apposed with horizontal mattress sutures using3.0 metric nylon. A similar procedure was repeatedon the right inguinal ring to reduce omentum. (Fig.2). A sterile gauze stent was sutured over both skinwounds and Tr. benzoin was applied.fPostoperatively, ceftriaxone was administered at therate of 25 mg/kg body weight intravenously. Oralantibiotic therapy was continued for six more days.The animal had an uneventful recovery except for aseroma on the right side. The skin sutures werethremoved on the 9 post-operative day (Fig. 3) and theseroma subsided subsequently. Ovariohysterectomyat another date was recommended to avoidcomplication is future.2.46Fig. 1: The exposed contents of the left hernial sac,the uterus and the broad ligamentFig. 2: The exposed content of the righthernial sac, the omentumFig. 3: Healed skin wound after bilateral hernialrepair with a seroma on right sideRESULT AND DISCUSSIONAcquired inguinal hernias are relatively commonin dogs and may often met with middle aged intactbitches. Although certain toy breeds are overrepresented, no breed predilection has beendocumented (Waters et al., 1993). According toMunro and Stead (1993), the potential fordevelopment of inguinal hernia is more in femalesbecause of the normal extension of the vaginalprocess through the inguinal canal. Furthermore,accumulation of fat around the round ligament maydilate the vaginal process and inguinal canalallowing herniation. The contents of the hernial sac

CLINICAL REPORTin bitches most often consist of broad ligament anduterine horns (Formston, 1990).In the present case, the history and the clinicalsigns were similar to the reportes of Jahromi et al.(2009). Byers et al. (2007) had reported a case ofinguinal hernia in a dog with signs of oestrusapproximately three to four weeks beforepresentation and substantial increase in size ofinguinal swelling two to three weeks prior topresentation. The condition has to be differentiallydiagnosed from mammary tumours, cysts, lipomas,enlarged lymph nodes, abscesses and hematomas.The chances of traumatic inguinal hernia were alsoruled out as the dog was in normal body conditionand had no history of trauma. Though a diagnosis ofbilateral inguinal herniation could be diagnosedbefore surgery, the hernial contents could beconfirmed only through surgical correction. Insteadof a midline approach for bilateral inguinal herniarepair in bitches, the conventional approach wasselected as it could facilitate better visualisation ofboth inguinal rings (Waters et al., 1993). Thecontents of the left and right hernial sacs were almostthe same as in the report of Jahromi et al. (2009).Ovariohysterectomy was also recommendedconsidering (Fossum, 2007) the probable heritablenature of this disease (Roberts, 1986). The mostcommon post-operative complications observed indogs undergone surgical repair of inguinal herniaincluded hematoma or seroma formation, incisionalinfection, wound dehiscence, hernia recurrence,peritonitis, sepsis and death (Pratschke, 2002).However, the follow up study did not reveal anypotential post-operative complications and theanimal had an uneventful recovery.utrine horn and omentum in a beagle dog. J.Vet. Emerg. Crit. Care. 17:86-92Fossum, T. W. 2007. Surgery of the abdominal cavity.In: Small animal surgery (ed. Fossum, T. W.).rd3 Ed. Mosby Elsevier, Philadelphia, pp: 317-338Hayes, H. M. 1974. Congenital umbilical andinguinal hernias in cattle, horse, swine, dogs,and cats: Risk by breed and sex amonghospital patients. Am. J. Vet. Res. 35: 839-842.Jahromi, A. R., Nazhvani, S. D., Gandmani M. J. andMehrshad, S. 2009. Concurrent bilateralinguinal and umbilical hernias in a bitch-a casereport. Vet. Arhiv. 79: 517-522.Munro, E. and Stead, C. 1993. Ultrasonographicdiagnosis of uterine entrapment in an inguinalhernia. J. Small Anim. Pract. 34: 139-141.Pratschke, K. 2002. Management of hernias andruptures in small animals. In Pract. 24: 570-581Roberts, S. J. 1986. Veterinary Obstetrics and genitalrddiseases (Theriogenology), 3 Ed. Woodstock,VT. 981pSmeak, D. D. 2003. Abdominal hernias. In: Text bookrdof small animal surgery (ed. Slatter, D.). 3 Ed.W. B. Saunders, Philadelphia, pp: 449-470Waters, D. J., Roy, R. G. and Stone, E. A. 1993. Aretrospective study of inguinal hernia in 35dogs. Vet. Surg. 22: 44-49aAtropine Sulphate 1ml amp, MorvelbXylaxin 10 ml vial, Indian ImmunologicalsREFERENCESBellenger, C. R. 1996. Inguinal and scrotalherniation in 61 dogs. Aust. Vet. Practitioner.26: 58-59Byers, C. G., Williams, J. E. and Saylor, D. K. 2007.Pyometra with inguinal herniation of the leftcAneket 10 ml vial, Neon Laboratories Ltd.dCalmpose 2 ml ampoule, RanbaxyeVicryl 90 cm, EthiconfIntacef 500 mg vial, Intas PharmaceuticalsJIVA Vol. 10 Issue 1 April 201247

CLINICAL REPORTSURGICAL MANAGEMENT OFCERVICAL MUCOCELE IN A DOGBasavanagowda M.T., Joseph Cyrus, Md. AbidHussain and Shahid Vaseem S.A.Compassion Unlimited Plus Action (CUPA) Animal Care Hospital, R. T. Nagar, BangaloreJ. Ind. Vet. Assoc., Kerala. 10 (1)CLINICAL HISTORY AND PROCEDUREA one year old mongrel male dog waspresented in the hospital with a ventral neck swellingfor the past two weeks without any evidence ofdysphagia or sialosis. Physical examination revealedthat the mass was due to collection of saliva in thedeeper structures of the intermandibular space andcondition was diagnosed as cervical mucocele.Palpation was not associated with any pain and wassoft and fluctuant. Imaging with radiography wasused to rule out foreign bodies or neoplasia.Complete blood counts and biochemistry assessmentwere within normal physiological values. Surgicalmanagement was opted.A complete excision of the gland ductcomplex and drainage of the mucocele was planned.A stab incision was made in the lumen of themucocele and digitally the lumen was palpated. Themandibular and sublingual pairs of the glands wereresected and the wound was closed leaving a drain insitu. Ceftriaxone injections at 20mg/kg. bwt. b.i.d.and liquid feeding were followed with dailythdressings. The drain was removed after the 5 dayand the wound was left to heal by second intention.The recovery was uneventful. No evidence ofxerostomia or other complications wereencountered.DISCUSSIONMucoceles are common in dogs of any agehowever male dogs are more predisposed. Most dogswith cervical or inter mandibular mucoceles areusually asymptomatic (Spangler and Culbertson,1991). They are usually caused by a salivary ductrupture or obstructions. Complete surgical removalof the affected salivary ducts and associated gland isassociated with complete resolution (DeBowes,2005).REFERENCESDeBowles, L.J., 2005. Disorders of the oral cavity.In: BSAVA Manual of Canine and FelinendGastroenterology, 2 Ed., Edt. Hall, E.J., Simpson,J. W. And Williams, D. A., BSAVA.Spangler, W.L. and Culberston, M.R. 1991 Salivarygland disease in dogs and cats: 245 cases (1985-1988), J. Am. Vet. Med. Assoc. 198:46548

CLINICAL REPORTSURGICAL MANAGEMENT OFOVARIAN TUMOUR IN A BITCHAsha Abraham¹ and P. Ravindran²District Veterinary Centre, KottayamCLINICAL HISTORYA nine years old, black female Pomeraniandog, of 8 kg bodyweight was brought to the DistrictndVeterinary Centre, Kottayam, on 22 of July 2010with the complaint of not taking food. Abdominalenlargement was noticed. As reported by the owner,the dog was off-feed since three days and showedreduced water intake. The dog was found inactiveand dull throughout these days. Defecation andurination were normal. The animal was given regularvaccinations and was dewormed at regular intervals.CLINICAL OBSERVATIONS0Temperature : 101.6 FPulseMucous membraneRespiration: 60/min.: Pale: PantingPhysical examination revealed abdominaleffusions and presence of abdominal mass. Ondetailed examination, blood tinged exudates could beaspirated from the abdomen (haemo-abdomen),which was positive for protein test. Wet filmexamination of the peripheral blood taken from theear tip was found negative for any moving parasites.Severe ascites limited the diagnostic quality ofabdominal radiography. On ultrasound scanning, theovarian tumors were fount to be large, contained1. MVSc Scholar, College of Veterinary and Animal Sciences,Mannuthy2. Veterinary Surgeon, District Veterinary Centre, Kottayammultiple anechoic cystic structures and had irregularmargins.DIAGNOSISDiagnosis was made from the history, clinicalsigns, haematologic investigations, radiographicexamination and ultrasound scanning and the diseasewas diagnosed as an ovarian tumour.TREATMENTTreatment adopted was removal of tumour byovaro-hysterectomy. In addition, chemotherapy isadvisable to reduce the chances of re occurrence.Anaesthesia and controlAnaesthesia was induced afterpremedicating with 0.4ml Glycopyrrolate and 0.4mlXylazine hydrochloride and maintained using 1.6mlKetamine hydrochloride. The dog was controlled ondorsal recumbency.Preparation of the siteSite of incision - midventral from a point,behind the umbilicus backwards along the midline,over a length of 5 inches.The site was shaved, scrubbed with savlon,mopped dry with cotton and painted tincture iodineover the site to make it aseptic. Draped themidventral area of the dog exposing the site ofincision.JIVA Vol. 10 Issue 1 April 201249

CLINICAL REPORTSurgical TechniqueIncised the skin on the midventral site. Dividedsubcutaneous tissue on midline to expose linea alba.Incised the linea alba to its full thickness and exposedthe abdominal viscera. Retracted the laparotomyedges using tissue forceps. Exposed the uterinehorns, ovary and the bursa. Large, numerousneoplastic growths could be identified in bothovaries. Anterior ovarian ligament was cut andanterior utero-ovarian vessels are ligatured. Theovarian bursa is cut across its middle to expose theovary. The ovary was disconnected from its anteriorattachment. After both ovaries were freed in thismanner, the posterior uterine arteries were ligatedand cut in level with the cervix. The broad ligamentof uterus is torn to liberate the uterine cornua.Applied two clamps anterior to the cervix and cut inbetween them to finally disconnect and remove theuterus with the ovaries. The stump was also ligated.Simple continuous sutures using catgut no. 2 wereused to close the wound. Abdominal incision wasclosed with simple continuous double row with lockstitch for linea alba. The skin was sutured using nylonin horizontal mattress pattern. Applied tincturebenzoin gauze to prevent bleeding over the suturelineExteriosed tumor mass with uterus &ovariesAnimal presented in the hospitalafter complete recoveryRESULTAnimal made a uneventful recovery and wasthpresented in the veterinary hospital on 7 postoperative day for suture removal.J. Ind. Vet. Assoc., Kerala. 10 (1)Ovaries with large tumour massPost operative care given with Inj. Ampoxin and Inj.Taxim intravenously for 5 days.DISCUSSIONOvarian tumours are uncommon in bitches,which accounts for approximately 1 percent of allneoplasms. Ovarian tumors are prone formetastasizing (spreading), and some are capable ofproducing hormones. The peak incidence ofepithelial tumors is between 4 to 15 years, with apredisposition among Pointers for epithelial tumors.50

CLINICAL REPORT(Withrow and Susaneck, 1986). In this case, the ageof affected animal is 9 years. Except for teratomas,ovarian neoplasms are found in middle aged to olderanimals. Breeds like Boxers, German Shepherds,Lhasa apso, Pomeranians, Yorkshire, EnglishBulldogs to be at an increased risk for granulosathecacell tumors, a type of sex cord stromal celltumour. In this case, a Pomeranian bitch is affected.There are three kinds of ovarian tumors inbitches-Epithelial tumors (skin/tissue), Germ celltumors (sperm and ova) and Stromal tumors(connective tissue). The most common type ofovarian tumor in dogs is ovarian carcinomas.(Moulton, J.E.1978).In ovarian tumors like epithelial tumors,granulosa cell tumors, dysgerminomas, teratomasand germ cell tumors the clinical signs includesmalignant ascites ,fever, anorexia, weight gain/lossand pleural effusions, in case of thoracic metastasis.Lack of sexual heat and menstruation, persistentestrus, cystic endometrial hyperplasia/pyometracomplex and squamous metaplasia of uterinemucosa, vulvar and vaginal hyperplasia,sanguineous vulvar discharge, secondary sex organchanges like gynecomastia, receptivity to male dogsare also seen.Ovarian tumors are generally treated withovariohysterectomy. (Morrison, W.B.1990). Fortreatment for metastatic ovarian carcinoma, sincemost result in carcinomatosis, intracavitary cisplatin2(50 mg/m every 3 weeks for five to six treatments) isrecommended which has survival times rangingfrom 6 months up to 5 years. (Moore A.S. et al,1991).REFERENCESMoore, A.S.1991.Intracavitary cisplatinchemotherapy experience with six dogs. J.Vet. Intern. Med. 5:227p.KERALA VETERINARY SCIENCE CONGRESS- 2012FIRST ANNOUNCEMENT AND INVITATION FOR PAPERSScientific Papers, Clinical Reports and Research Articles are invited from allfields of Veterinary and Animal Sciences for the Kerala Veterinary Science Congressthth2012 scheduled to be held on 10 and 11 of November in Palakkad. Itinerary will beintimated shortly.Articles and Papers are to be send to vetsciencecongress@gmail.com.BEST SCIENTIFIC PAPER AWARD OFINDIAN VETERINARY ASSOCIATION, KERALAIndian Veterinary Association, Kerala has decided to give best scientific paperawards annually for the best papers published in Journal of Indian VeterinaryAssociation, Kerala from the year 2012. The awards will be for a best Clinical paper anda best Research paper. The award consists of a citation and a cash award which will bedistributed in the Veterinarians Annual Convention.JIVA Vol. 10 Issue 1 April 201251

CLINICAL REPORTFETAL ANASARCA TWINS WITHHYDROALLANTOIS IN MALABARI DOES2 3Laiju M Philip., M. Ranjith Mohan and P. Francis Bastin .Animal Husbandry Department, KeralaJ. Ind. Vet. Assoc., Kerala. 10 (1)INTRODUCTIONDystocia is considered to be the majorreproductive disorder in does presented to theVeterinary Hospital. The complications includefetal death, fetal mummification and fetalmaceration or developmental abnormalities likefetal monsters, fetal dropsy and ectopic location ofthe fetus. The etiology of most fetal gestationalcomplications except abortions continues to bepoorly understood. Anasarca means generalizededema all over the body. The condition is seencommonly in cattle but may affect sheep,(Roberts,1985), goat (Tamuli et. al.,1987; Sharma et al.,2002; Purohit et. al.,2006) and also rarely reportedin the buffalo (Devanathan et. al., 1990).Hydrallantois is characterized by a larger thannormal accumulation of allantoic fluid during a 5-to 20-day period in the last trimester of pregnancythat occurs mainly in the bovine and rarely in maresand ewes (Milton et al., 1989). Most fetuses ofanimals with hydrallantois may have congenitaldefects, are underdeveloped, or are apparentlynormal but not viable (Milton et al., 1989, andMorin et. al., 1994).The details of surgicalmanagement fetal anasarca twins withhydrallantois in Malabari does are mentioned.MATERIALS AND METHODSA Malabari goat and its dam were presentedat different times to the Veterinary Polyclinic,Veterinary Surgeon, Veterinary Polyclinic, Mannarkkad(corresponding author: phone 09447996512Email: laijuphilip@rediffmail.com)2Veterinary Surgeon, Veterinary Dispensary, Karakurissi3Senior Veterinary Surgeon, Veterinary Polyclinic, MannarkkadMannarkkad with the complaint of difficulty inparturition. Both the goats were presented withabnormally large abdomen. The dam was presentedfor its second kidding and the doe, for the firstkidding. Per vaginal examination of both theanimals revealed fetal anomalies as the cause fordystocia. So it was decided to do surgicalintervention in both the cases. Caesarean sectionwas carried out. The animals were restrained in leftlateral recumbancy. The surgical site was preparedaseptically. Intravenous infusion Ringers Lactatewere started to prevent hypovolumic shock. Localinfiltration anesthesia was done around the surgicalsite with 2 percent lignocaine. Incised the skin andthe fascia. Exteriorized the abnormally sized thinwalled uterus after the separation of the abdominalmuscles. Incision was made on the body of uterus.About six litres of watery and amber colouredallantoic fluid was drained out. Two anasarca kidswere taken out in both the cases after reducing thehydro allantois. The uterus was rinsed with copiousamounts of Normal Saline solution. The incision onthe uterus was closed in Cushing's followed byLambert's pattern of suturing using chromic catgutsize 1/0. The peritoneum and the separatedabdominal muscles were apposed using chromiccatgut size 1 in a simple continuous suture patternfollowed by subcuticular suturing using braidedsilk size 1. The skin was apposed in interruptedhorizontal mattress fashion using nylon. Theanimals were maintained on intravenous fluids forhalf an hour post operatively. Parenteral antibioticsand tetanus toxoid injection were given. Owner wasadvised oral antibiotic therapy for a week. Both theanimals recovered uneventfully.52

CLINICAL REPORTor fetotomy or forced extraction to deliver thefetus. Rarely caesarean section may be indicated.Morin et al. (1994) reported the recovery ofapparently normal but non-viable twin fetuses aftercaesarean section. The antenatal diagnosis of mostof the commonly occurring fetal complications ofgestation is partly possible with ultrasonographyand such pregnancies should be carefullymonitored or terminated. As a recommendation it issuggested to perform karyotyping of the breedingstockDISCUSSIONHydro allantois treatment is directed atevacuation of the uterus by cesarean section orinduced termination of pregnancy withprostaglandin (Braun Jr., 1997). If a large volumeof allantoic fluid in the uterus is expelled rapidly,circulatory shock can develop (Misri and Singh,2001).Most anasarcous fetuses are expelled dead.When the fetus poses difficulty in its delivery, cutsmust be given over many places to release the fluidREFERENCESBraun Jr., W. 1997. Periparturient Infection andStructural Abnormalities. In:YOUNGQUIST, R. S Current Therapy inLarge Animal Theriogenology.1 Ed., W BSaunders p. 530-537Devanathan, T.G., Asokan, S.A. and Veerapandian,Sheshagiri, V.N. 1990. A note on fetalascites with mild anasarca in buffalo. Ind. JAnim. Reprod., 11:68.J. R. Peiró, A. S. Borges, R. Yanaka, M. B.Koivisto,l. C. N. Mendes,F. L. F. Feitosa, J.O. Abujamra, C. A. Rodrigues 2007.Hydrallantois in an Ewe (Case Report). ArsVeterinaria, Jaboticabal, Sp, Vol. 23,116-119.Milton. A., Welker, B., Modransky, P.1989.Hydrallantois in an Ewe J. Am. Vet. Med.Assoc.195 (10), p.1385-86Misri, J. and Singh,N. 2001. Hydrallantois in agoat. Ind. Vet. J. 78, p 255-256Morin, D. E. Hornbuckle II, T., Rowan, L.L.,Whiteley, H.E.1994.Hydrallantois in aCaprine Doe J. Am. Vet. Med. Assoc. 204,(l), p.108-111Roberts, S.J. 1985. Eds Veterinary Obstetrics andGenital Diseases. Indian EditionSharma, S.S., Bishnoi, B.L., Yadav, R.C., Garg, N.,Purohit, G.N. 2002.Foetal anasarca in agoat. Vet Pract., 3:47.Tamuli, M.K., Rajkonwar, C.K. and Borghain,B.N. 1987. Foetal anasarca in a kid.A causeof dystocia. Ind. J. Anim. Reprod., 8:6353JIVA Vol. 10 Issue 1 April 2012

CLINICAL REPORTFETAL ANASARCA TWINS WITHHYDROALLANTOIS IN MALABARI DOES2 3Laiju M Philip., M. Ranjith Mohan and P. Francis Bastin .Animal Husbandry Department, KeralaJ. Ind. Vet. Assoc., Kerala. 10 (1)INTRODUCTIONDystocia is considered to be the majorreproductive disorder in does presented to theVeterinary Hospital. The complications includefetal death, fetal mummification and fetalmaceration or developmental abnormalities likefetal monsters, fetal dropsy and ectopic location ofthe fetus. The etiology of most fetal gestationalcomplications except abortions continues to bepoorly understood. Anasarca means generalizededema all over the body. The condition is seencommonly in cattle but may affect sheep,(Roberts,1985), goat (Tamuli et. al.,1987; Sharma et al.,2002; Purohit et. al.,2006) and also rarely reportedin the buffalo (Devanathan et. al., 1990).Hydrallantois is characterized by a larger thannormal accumulation of allantoic fluid during a 5-to 20-day period in the last trimester of pregnancythat occurs mainly in the bovine and rarely in maresand ewes (Milton et al., 1989). Most fetuses ofanimals with hydrallantois may have congenitaldefects, are underdeveloped, or are apparentlynormal but not viable (Milton et al., 1989, andMorin et. al., 1994).The details of surgicalmanagement fetal anasarca twins withhydrallantois in Malabari does are mentioned.MATERIALS AND METHODSA Malabari goat and its dam were presentedat different times to the Veterinary Polyclinic,Veterinary Surgeon, Veterinary Polyclinic, Mannarkkad(corresponding author: phone 09447996512Email: laijuphilip@rediffmail.com)2Veterinary Surgeon, Veterinary Dispensary, Karakurissi3Senior Veterinary Surgeon, Veterinary Polyclinic, MannarkkadMannarkkad with the complaint of difficulty inparturition. Both the goats were presented withabnormally large abdomen. The dam was presentedfor its second kidding and the doe, for the firstkidding. Per vaginal examination of both theanimals revealed fetal anomalies as the cause fordystocia. So it was decided to do surgicalintervention in both the cases. Caesarean sectionwas carried out. The animals were restrained in leftlateral recumbancy. The surgical site was preparedaseptically. Intravenous infusion Ringers Lactatewere started to prevent hypovolumic shock. Localinfiltration anesthesia was done around the surgicalsite with 2 percent lignocaine. Incised the skin andthe fascia. Exteriorized the abnormally sized thinwalled uterus after the separation of the abdominalmuscles. Incision was made on the body of uterus.About six litres of watery and amber colouredallantoic fluid was drained out. Two anasarca kidswere taken out in both the cases after reducing thehydro allantois. The uterus was rinsed with copiousamounts of Normal Saline solution. The incision onthe uterus was closed in Cushing's followed byLambert's pattern of suturing using chromic catgutsize 1/0. The peritoneum and the separatedabdominal muscles were apposed using chromiccatgut size 1 in a simple continuous suture patternfollowed by subcuticular suturing using braidedsilk size 1. The skin was apposed in interruptedhorizontal mattress fashion using nylon. Theanimals were maintained on intravenous fluids forhalf an hour post operatively. Parenteral antibioticsand tetanus toxoid injection were given. Owner wasadvised oral antibiotic therapy for a week. Both theanimals recovered uneventfully.52

CLINICAL REPORTor fetotomy or forced extraction to deliver thefetus. Rarely caesarean section may be indicated.Morin et al. (1994) reported the recovery ofapparently normal but non-viable twin fetuses aftercaesarean section. The antenatal diagnosis of mostof the commonly occurring fetal complications ofgestation is partly possible with ultrasonographyand such pregnancies should be carefullymonitored or terminated. As a recommendation it issuggested to perform karyotyping of the breedingstockDISCUSSIONHydro allantois treatment is directed atevacuation of the uterus by cesarean section orinduced termination of pregnancy withprostaglandin (Braun Jr., 1997). If a large volumeof allantoic fluid in the uterus is expelled rapidly,circulatory shock can develop (Misri and Singh,2001).Most anasarcous fetuses are expelled dead.When the fetus poses difficulty in its delivery, cutsmust be given over many places to release the fluidREFERENCESBraun Jr., W. 1997. Periparturient Infection andStructural Abnormalities. In:YOUNGQUIST, R. S Current Therapy inLarge Animal Theriogenology.1 Ed., W BSaunders p. 530-537Devanathan, T.G., Asokan, S.A. and Veerapandian,Sheshagiri, V.N. 1990. A note on fetalascites with mild anasarca in buffalo. Ind. JAnim. Reprod., 11:68.J. R. Peiró, A. S. Borges, R. Yanaka, M. B.Koivisto,l. C. N. Mendes,F. L. F. Feitosa, J.O. Abujamra, C. A. Rodrigues 2007.Hydrallantois in an Ewe (Case Report). ArsVeterinaria, Jaboticabal, Sp, Vol. 23,116-119.Milton. A., Welker, B., Modransky, P.1989.Hydrallantois in an Ewe J. Am. Vet. Med.Assoc.195 (10), p.1385-86Misri, J. and Singh,N. 2001. Hydrallantois in agoat. Ind. Vet. J. 78, p 255-256Morin, D. E. Hornbuckle II, T., Rowan, L.L.,Whiteley, H.E.1994.Hydrallantois in aCaprine Doe J. Am. Vet. Med. Assoc. 204,(l), p.108-111Roberts, S.J. 1985. Eds Veterinary Obstetrics andGenital Diseases. Indian EditionSharma, S.S., Bishnoi, B.L., Yadav, R.C., Garg, N.,Purohit, G.N. 2002.Foetal anasarca in agoat. Vet Pract., 3:47.Tamuli, M.K., Rajkonwar, C.K. and Borghain,B.N. 1987. Foetal anasarca in a kid.A causeof dystocia. Ind. J. Anim. Reprod., 8:6353JIVA Vol. 10 Issue 1 April 2012

CLINICAL MANAGEMENT OF EXOCRINE PANCREATICINSUFFICIENCY IN A GERMAN SHEPHERD DOGCLINICAL REPORT1 2 3V. Dhanesh , Usha Narayana pillai ,S.Yogeshpriya ,4 5Roshna Rasheed Kutty and S.Ajith KumarDepartment of Clinical Veterinary Medicine,College of Veterinary and Animal Sciences , MannuthyINTRODUCTION:Exocrine pancreatic insufficiency is theinability to digest food properly due to the lack ofdigestive enzyme made by the pancreas. animal willshow clinical sign if there is greater than 85 percentloss of the pancreatic acinar which has ability tosecrete digestive enzyme and it is clinicallycharacterized by loss of weight , pica, coprophagia,poor quality hair coat etc. Consistency of the facesbecomes oily, smooth, and soft. Perineal region willbe oily stained because of steatorrhea.ray film test and history the case was clinicallydiagnosed as exocrine pancreatic insufficiency.J. Ind. Vet. Assoc., Kerala. 10 (1)CASE HISTOY AND CLINICALINVESTIGATIONA three year old GSD was presented in theuniversity hospital Mannuthy with a history of foulsmelling diarrhea of three month duration. Theanimal was treated with anthelmintics and Sulfa TMPcombination (Septran) by local veterinarian. Ownerreported that there is considerable weight loss eventhough the animal was take normal quantity of food.On examination, physiological parameters like0temperature((103 F) , heart rate (108 beats / min),pulse rate (107/min) and mucous membrane (paleroseate) were found to be normal consistency of thefecal sample was found to be oily and semisolidstandard parasitological examination was done andno ova of parasitic important could be detected. Butlarge number fat globules were present in the sample.No change could be detected in Haemogram. Fecalsample was positive for X- ray film test. Based on X-1. 3, 4- P.G Scholar, 2. Associate Professor , 5.Professor andHeadTREATMENT AND DISCUSSIONTreatment was carried out with Tab. Enzarforte, 1 tab twice daily along with this Tab. Flagyl400 mg, 1 tab twice daily and Tab. Rantac 150 mg, ½tab twice daily. Advised the owner to review the caseafter 10 days. Owner reported that animal is showingmuch improvement in the condition. Consistency ofthe feces becomes normal without any foul smell.In dog Exocrine pancreatic insufficiency ismainly due to pancreatic acinar atrophy and in cat itis due to destruction of the acinar tissue associatedwith subclinical or chronic pancreatitis. (Nelson et.al 2003). Pancreatic enzyme had a antibacterialproperty and in Exocrine pancreatic insufficiencylead to over growth of different type of bacteria insmall intestine. Over growth of the bacteria will leadto changes in the small intestine like villous atrophy,alteration in the mucosal enzymatic activity etc.Bacterial count in the small intestine will be more54

6than 10 colony forming unit / gram of intestinalcontent which is much higher than the normal value(Regan, 1977). So to avoid these, oral antibiotics likeMetronidazole at dose rate of 7.5-15 mg/kg BWtwice daily or Tylosin at a dose rate of 20-30 mg/kgBW / day for 6 week were advocated. Fresh rawpancreas of beef can be advisable for animals whichare suffering from exocrine pancreatic insufficiency.Porcine pancreas is not preferable because there is achance of Aujezk's disease. (Khan et al 2005).Confirmatory test for the exocrine pancreaticinsufficiency is estimation of the serum trypsin likeimmunoreactive (TLI) protein. In normal range forthe TLI are 5- 32 micro g / L. If the concentration isless than 2 micro g/ L, it is considered as the animal issuffering from the exocrine pancreatic insufficiency(Westermarck, 2003). In most of the case animalneed a lifelong treatment.CLINICAL REPORTREFERRENCE:Khan, C.M 2005: the Merck Veterinary Manual,ninth edn, Merks & Co., INC, Whitehousestation, U.S. 2712ppNelson, R.W., Couto, C.G. 2003: Small InternalMedicine, Third edn, Mosby, Missouri,U.S. 1362ppWestermarck, E., Wiberg, M. 2003: Exocrinepancreatic insufficiency in dogs, Vet ClinNorth Am Small Anim Pract. 33: 1165-1179ppRegan, P.T., Malagelada, J.R., Dimango, E.P.,Glanzman S.L., and Vay, L.W. 1977:Comparative Effect of Antacids,Cimetidine and Enteric Coating on theTherapeutic Response to Oral Enzyme InSevere Pancreatic Insufficiency. N Engl JMed. 297: 854-858ppINDEXING AND ARCHIVING IN CAB ABSTRACTS -JOURNAL OF INDIAN VETERINARY ASSOCIATION, KERALAFrom : Uma Sabapathy Allen Subject : Indexing and archiving in CAB Abstracts - Journal of Indian Veterinary Association, KeralaTo : "vijikumaran@yahoo.com" Date : Tuesday, 28 February, 2012, 21:34Dr. K.Vijaya KumarChief Editor, Journal of Indian Veterinary Association, Kerala (ISSN 0975-5195)I am writing on behalf of CAB International regarding the Journal of Indian Veterinary Association, Kerala.We recently evaluated the journal according to our internal selection criteria of potential yield, scientific valueand geographic origin and judged its content to be both novel and important, and deemed to be very relevant to the CABAbstracts database produced by CABI.We would therefore like to request permission not just to abstract and index the title but also to archive thejournal's full-text content in the CABI Full-Text Repository. For the latter we would only require non-exclusive internetpublishing rights; copyright remains with the publisher/author, allowing them to publish the material through anyinternet site/publication.I understand the JIVA is an open access publication. By including the JIVA and as many publications aspossible in the full-text repository, we hope to ensure that they are preserved and easily located by researchers andprofessionals throughout the world, both now and in the future. This would also be a valuable way of promoting thepublications amongst the global users of CAB Abstracts. A list of documents currently available in the repository can beviewed at http://www.cabi.org/fulltextPlease let me know if you require further information to support this request.Uma AllenContent Editor, CABI Head Office, Nosworthy Way,Wallingford, Oxfordshire, OX10 8DE, United KingdomTelephone: +44 (0)1491 829458, Fax: +44 (0)1491 833508Email: u.allen@cabi.org Visit us at: www.cabi.orgThank you.Uma AllenJIVA Vol. 10 Issue 1 April 201255

GENERAL ARTICLEMETHANE EMISSION FROM RUMINANTSENVIRONMENTAL IMPLICATIONS AND STRATEGIESFOR REDUCTION.Lalu. K., Usha. A.P., Venkatachalapathy.R.T and Prasanth.V.Centre for Pig Production and Research, MannuthyINTRODUCTIONMethane, the simplest aliphatichydrocarbon, is one of the gaseous end products offermentative digestion in ruminants. It is releasedinto the atmosphere by eructation. It is twenty timesmore potent than carbon dioxide as green house gas.Its atmospheric concentration has doubled sinceindustrial revolution. About 22 Percent ofanthropogenic methane is from ruminants.Continuous release of methane is a matter of worry. Italso contributes to green house effect by the processcalled radiative forcing leading to global warmingwhich in turn result in erratic weather patterns,desertification and rising of sea level due to meltingof polar ice cap.METHANE PRODUCTION BY INDIANLIVESTOCKIndian livestock contribute about 14 Percentof total methane emitted by world livestock.According to Khan et al., (1996) methane productionper head of animal (cattle/buffalo) is only 170liters/day which is much less than in the developedcountries where animals are managed in factorystyle. Comparative emission of methane fromanimals is presented in Table 1. The energy content ofmethane is very high (13.25 Kcal/g) and the amountof methane belched by Indian cattle is equivalent tothe feed costing to Rs 2.7 crores per day.J. Ind. Vet. Assoc., Kerala. 10 (1)ENVIRONMENTAL HAZARDS DUE TOMETHANEAmong the entire green house gasesmethane is one of the most dangerous as its radiativeforcing effect is very high that the greenhousepotential of one unit of methane is expressed as 7.5 Cequivalent. Moreover the rate of production ofmethane is higher when compared to any other greenhouse gases. Methane has both direct and indirecteffect on climate. It interacts directly with chlorine inpresence of infrared energy in the upper troposphere56

and lower stratosphere leading to depletion of ozonelayer. Indirectly it reacts with carbon dioxide a greenhouse gas. The reaction is complex as 1) methane hasabsorption band in the infrared region 2) It isoxidized in troposphere by free hydroxyl radical 3) Itis sizeable source of carbon monoxide throughoxidation. 4) Stratospheric methane can react withchlorine from hydrochloric acid which destroysozone layer.METHANOGENESIS IN RUMINANTSMethane is produced in rumen strictly underanaerobic condition and serves as a hydrogen sink.Most of the methane is produced in rumen by thereduction of carbon dioxide and some is derived fromformate. Methanogenic bacteria are mainlyresponsible for methane production, which involvesa specialized biochemical function.Methanogenesis is a very intricate processthat involves vitamin B 12, folic acid, coenzyme (2Mercapto ethane sulfonic acid), fatty acid and methylbutyrate. Half of the hydrogen produced duringfermentation of carbohydrate is used for propionateproduction , biohydrogenation of unsaturated fattyacid and the other half for methane productionThe fermentation reaction are given below1. C6H 12O6 2CH3COOH + 2CO2+ 8(H)(Acetate) (Methanogenic)2. C6H12O6 2CH3CH 2COOH + 2H2O + 4(H)(Propionate) (Glucogenic)3. C6H 12O6 CH3CH2-CH-COOH + 2CO2+ 4(H)(Butyrate) (Methanogenic)Of the sixteen hydrogen molecules producedduring the fermentation of carbohydrate, eighthydrogen molecules are utilized for propionateformation and other eight is converted to methane asshown.4H + COCH + 2H O2 2 4 2Ruminants produce about 20g of methane foreach kg of dry matter intake. Methane production incattle is affected by variety of nutritional factorsincluding level of intake, type of carbohydrate,forage processing, and change in the rumenmicroflora. Diet favoring propionate production inrumen causes decrease in methane and diet likeroughage favours acetate production, whichincreases methane production. The molar proportionof volatile fatty acid plays a key role because fibrousfeed results in higher methanogenic VFA (Prestonand Leng 1987). So narrowing of the acetate:propionate ratio would increase performance inruminants.Table.2. Methanogenic bacteria and their substrates for methane productionBacteria Substrates ProductsMethanobacterium ruminantium CO , H and HCOOH CH , CO and H O2 2 4 2 2Methanobacterium formicicum HCOOH CH , CO and H O4 2 2Methanobrevibacter ruminantium HCOOH CH , CO and H O4 2 2Methanobacterium mobile HCOOH CH , CO and H O4 2 2Methanosarcina barkerii Methanol, Acetate CH , CO and NH4 2 4METHANE MITIGATION -A BOON TOFARMERS AND ENVIRONMENTIt is desirable to maximally utilize fibre forruminant production, because plant fibre is the mostabundant organic matter that is available, and thegreatest merit of ruminants is the ability to utilizeGENERAL ARTICLEfibre. As the current practice of feeding highconcentratediets to cattle is a luxury that futuregenerations may not experience. An improvement infibre utilization will become increasingly important.Therefore, it is critical to develop strategies aimed atreducing ruminal methanogenesis withoutJIVA Vol. 10 Issue 1 April 201257

GENERAL ARTICLEJ. Ind. Vet. Assoc., Kerala. 10 (1)depressing fibre digestion.Reduction in methane emission byruminants may be one of the means to achieve animalproductivity in environment friendly manner.Reducing methane up to 70 Percent will be beneficialfor reducing fodder wastage, increase in milkproduction, better fat percentage, and for betteranimal health.METHODS OF METHANE MITIGATIONThere are different methods to reducemethane from ruminants which includesI. Proper managemental practicesII. Manipulation of rumen ecosystemIII. Using vaccine against methanogensI. PROPER MANAGEMENTAL PRACTICESa. Controlled grazingIt is cheap and simple strategy to keepanimals in smaller area to graze. Such controlledgrazing decreases methane production and shouldformulate an ideal grazing schedule that minimizemethane and maximize efficiency (USEPA, 1998).b. Selective breedingStudies in New Zealand have shown thatthere are significant differences in methane emissionbetween individual sheep on same diet. This suggeststhat breeding for low methane out put may be astrategy for methane mitigation. But such selectivebreeding of ruminants for low methane output is stillat preliminary stage.c. Animal health and sanitary measuresChronic disease in livestock is a persistentproblem in developing countries. In diseasecondition like foot and mouth disease andtuberculosis, there is less feed efficiency and moremethane production .So better health managementreduces methane production.d. Improving digestibility of dietThe use of chopped straw, treatment ofcereal straw with alkali or ammonia increases theintake and digestibility and reduces methaneproduction per kg organic matter digested.Supplementation of Urea molasses mineral block(UMMB) reduces the methane release by increasedutilization of diet(Turnbull et. al., 2000).II MANIPULATION OF RUMENECOSYSTEMhere are many techniques to manipulate therumen ecosystem. Feeding of antibiotics, methaneanalogues and using genetic engineering tools cancontrol methanogenesis in rumen.a. DefaunationDefaunation is a term used for theelimination of protozoa from the rumen. Anaerobicprotozoa lack mitochondria, but containhydrogenosomes, in which hydrogen is producedwhen pyruvate is converted to acetyl Coenzyme Aand carbon dioxide. Defaunation reducesmethanogenesis in rumen to an extent of 20 to 50percent depending upon diet composition (Kreuzeret. al., 1986).b. Suppression of ruminal methanogenesis bychemicalsOver the years extensive attempts have beenmade to reduce ruminal methanogenesis, includingthe addition of chemicals such as halogencompounds and antibiotics. The polyetherionophores, such as monensin and lasalocid, havebeen considered to be the most useful modifiers ofruminal fermentation, because propionate redectionis increased and hence reduction in methanogenesis.A peptide ionophore, aibellin was found to reducemethanogenesis and augment propionate productionin the rumen without decreasing protozoal numbers,the digestibility of neutral detergent fibre, or theproduction of total volatile fatty acids (Hino et al.,1993). Recently, it has been reported that as low as 4nmol of mevastatin and lovastatin, inhibited in vitrogrowth and methane production of ruminalmethanogenic bacteria.c. Suppression of Ruminal methanogenesis byfatsIt has long been known that methanogenesisis reduced by the addition of fats or long-chain fatty58

GENERAL ARTICLEacids in the rumen, especially unsaturated fatty acids(UFAs) such as linoleic and linolenic (Czerkawski,1986). UFAs have toxic effects on methanogens andthe reduction in methanogenesis appears to be mostlya secondary effect on fermentation. Both in vivo andin vitro experiments have showed that addition of fatsand oils containing UFAs depressed fibre digestionas cellulolytic bacteria are sensitive to UFAs.Addition of alpha-tocopherol and beta-carotenealleviates the toxic effect of UFAs, and improvesfibre digestion.d. Halogenated Methane AnaloguesChlorinated methane analogues such aschloroform, carbon tetrachloride and methylenechloride inhibit methanogenesis in rumen.Halogenated alkanes also block the function ofcorrinoid enzymes (Vitamin B12dependent enzymes)in methanogenesis. Bromoethane sulfonic acid(BES) is a potent inhibitor of methanogenesis andgrowth of M. ruminantium. Among the halogenatedmethane analogues bromochloromethane (BCM)seems to be the most potent. (Trei et al., 1970;Sawyer et al., 1971; Chalupa, 1984).IIIVACCINESRecently scientists of CSIRO (Australia)developed vaccine against methanogens usingpseudumurein layer of its cell wall. This vaccinesuppress the growth of methanogens subsequentlyreduces methane production.CONCLUSIONRuminants are evidently major source ofmethane emission and so methane abundance wouldcontinue to grow in the atmosphere with rise inanimal number and production. Reduction ofmethane emission from ruminants can be achievedby several methods viz., supplementation of criticalnutrient through concentrate or green fodder, feedingurea molasses mineral block, defaunation variationof roughage: concentrate ratio, ammoniation ofcereal crop residues, feeding of halogenatedmethane, use of vaccines etc. If proper feedingstrategy and managemental practices are followed,methane production from ruminants can be reduced.It will improve the energy utilization /productionperformance of ruminants and protect theenvironment by reducing global warming.REFERRENCESChalupa, W. 1984. Manipulation of rumen fermentation.In: Recent Advances in Animal Nutrition (edited byharesign, W., Cole, D.), London, UK, Butterworths,pp 143-160.Czerkawski, J.W. 1986. Transfer of metabolic hydrogen inthe rumen. In: An introduction to rumen studies.Oxford, UK; Pergamon Press, pp. 173-188.Hino, T., Saitoh, H., Miwa, T., Kanda, M. and Kumazawa,S. 1993. Effect of aibelin, a peptide antibiotic, onpropionate production in the rumen of goats. J.Dairy Sci., 77: 3426-3431.Khan, M.Y., Murari Lal, Biswas, J.C., Haque, N. andGirdhar, N. 1996. Methane production from Indianlivestock. National Symposium. Prospects oflivestock and poultry development in 21st Century.CARI, Izatnagar, India, pp 41.Kreuzer, M., Kirchgessner, J. and Muller, H.L. 1986.Effect of defaunation on the loss of energy inweathers fed different quantities of cellulose andnormal or steam-flaked maize starch. Anim. FeedSci. Technol., 16: 233-241.Leng, R.A. 1991. Improving ruminant production andreducing methane emission from ruminants bystrategic supplementation. EPA, Washington, D.C.Preston, T.R. and Leng, R.A. 1987. Matching ruminantproduction system with available resources in thetropics and subtropics penumble books. ArmidaleAustralia.Sawyer, M.S., Hoover, W.H. and Sniffen, C.J. 1971.Effects of methane inhibitor on growth and energymetabolism in sheep. J. Dairy Sci., 34: 1191-1199.Trei, J.E., Singh, Y.K. and Scot, G.C. 1970. Effects ofmethane inhibition on rumen metabolism. J. Anim.Sci., 31: 256.Turnbull, G.W., Cripe, K. and Mishra, S. 2000. Effects ofmolasses urea supplementation of buffalo diet inGujarat state. India on work production, butterfat,animal weight and methane loss. In: Proceedings ofII International Methane Mitigation Conference,June 18-23; Novosibirsk, Russia.USEPA 1998. Small steps make a difference: Improvingyour cow-calf business and the emission of thesoutheastern USEPA 430-K-98-001, 12P.JIVA Vol. 10 Issue 1 April 201259

GENERAL ARTICLETERMINATION OF PREGNANCY IN BITCHESAbhilash.R.S, Anil kumar.K, Biju.S and Ajith.K.S,Livestock Research Station, Thiruvazhamkunnu, PalakkadJ. Ind. Vet. Assoc., Kerala. 10 (1)INTRODUCTIONTermination of pregnancy is one of the mostcommon requests from dog owners. The usualreasons include too young age, too old age,disproportionate size of mating partners or unwantedor accidental mating. Over the last 20 years manynew drugs have been used for termination ofpregnancy in canines. There are different treatmentprotocols such as oestrogen therapy, PGF2 and itsanalogues, dopamine agonists, combination ofprostaglandins and dopamine agonists, anti progestintherapy etc. Although most of these drugs havealready been used for years in other species, only feware widely marketed or approved for use in dogs. Theaim of the present article is to briefly review the stepsto be taken before proceeding with termination ofpregnancy, the drugs available for the termination ofpregnancy in bitches, their pharmacologicalproperties and availability.INITIAL EXAMINATIONA thorough history is valuable prior toattempt termination of pregnancy in bitch. Confirmwhether the animal has actually mated or not. Avaginal smear is the best diagnostic tool forevaluating mating and to find the stage of the cycle.The presence of sperm or sperm head confirmsmating whereas absence of sperm does not indicatethat a fertile breeding did not occur. Pregnancyshould be confirmed by ultrasound scanning aroundday 30 of the last breeding before starting thetreatment. The points to ponder in planning to abort abitch include its pregnancy confirmation and the60safety, reliability and the ease of administration ofthe drug used.The first stage of pregnancy begins atfertilization and ends a few days after implantation.During this time pregnancy cannot be confirmed andinduction of abortion is difficult because of therefractory nature of corpus luteum to exogenousmedications. Termination of pregnancy at this stagecan be attempted with medications like estrogens,prostaglandins and anti progestins. During thesecond stage, pregnancy can be confirmed andabortion can be induced if necessary. Abortion can beinduced with prostaglandins, antiprolactin agents(dopamine agonists such as bromocriptine orcabergoline), combination of prostaglandins anddopamine agonists or with inhibitors of progesteronesecretions (epostane) or antiprogestins (mifepristoneor aglepristone). Third stage is one that begins withthe calcification of fetal structures and abortion isalways associated with expulsion of foetus. In thisstage abortion might induce premature parturitionwith delivery of live pups. Hence the best time forinitiation of abortion protocols in bitches is betweendays 30 and 35 from the date of last breedingINDUCTION OF ABORTION PRIOR TOIMPLANTATIONFertilization of eggs and the initial 6-10 daysof embryonic development take place in theoviducts. Large doses of estrogens can prolongretention time of embryo within the oviduct thatleads to the degeneration and death of embryo. Themechanism of action of oestrogen is in two ways,firstly it tightens uterotubal junction and thus

GENERAL ARTICLEprolong oviductal retention of embryos and secondlyoestrogen has direct degenerative effects on ova andmay alter the endometrium.1. OESTROGENSOestrogens are widely used to preventunwanted pregnancies. They act by altering thetransport time of zygotes and thus interfering withimplantation. In some bitches estrogens given duringoestrus results in early luteolysis and this effect maybe mediated either directly upon luteal progesteroneproduction or by inhibition of LH release which isluteotrophic.a. Diethyl Stilbesterol (DES)Injection of DES at a dose rate of 2mg/kgbody weight, up to 25mg once or twice within 5 daysof mating is found to be highly effective interminating pregnancy. However injectable DES isnot available for veterinary practice. Oral DES hasbeen recommended at a dosage of 1 to 2 mg/day for 7days after mating, but oral therapy has not been foundto be completely reliable.b. Oestradiol cypionateIt was an oestrogen compound commonlyused by veterinarians for the management ofunwanted mating. The treatment protocol involved isadministration of 0.25 to 1 mg total dose within 3days of mating. A dose rate of 0.04 mg /kg is 100percent successful in preventing pregnancy inbitches. The total dose should not exceed 1mg.Despite the potentially favourable action ontermination of pregnancy, it has major side effectssuch as permanent bone marrow suppression ordestruction resulting in severe anaemia, leukopenia,thrombocytopenia and death.c. Conjugated oestrogenConjugated oestrogens can be used for thetreatment of misalliance in dogs within 5 daysfollowing breeding. They are mainly isolated frommare's urine and hence it can be called as conjugatedequine oestrogen. Most commonly used for thetreatment of osteoporosis, atrophic vaginitis,atrophic urethritis etc as a complication ofmenopause in woman. Commonly availablepreparation is PREMARIN 0.625mg and 1.25mgtablets. Dosage 1.875mg daily for 3 daysHowever estrogens can result in thedevelopment of pyometra by causing cervicalrelaxation thus allowing the vaginal bacteria to enterthe uterus. Estrogens may also produce dose relatedbone marrow suppression. Diethyl stilbesterol,oestradiol benzoate and estradiol cypionate havebeen widely used to prevent implantation.But oestrogen preparations are notrecommended in veterinary practice because of theirharmful side effects. Oestrogen is thought topredispose pyometra in bitches by sensitizingprogesterone receptors and enhancing binding ofprogesterone to the endometrium. It has been alsoreported that excess serum estrogens can lead tooestrogen- induced bone marrow destruction.2. PROSTAGLANDINS ANDITS ANALOGUESPregnancy in the bitch depends onprogesterone secretion from corpora lutea. Manystudies indicate that bitches that have corpora luteaare relatively resistant to the luteolytic effects ofprostaglandins during the first 14 to 28 days ofpregnancy. PGF2 (Natural Prostaglandins ieDinoprost) is luteolytic and uterotonic, inducingintense uterine contractions due to the smoothmuscle contraction effects and may lead to adversereactions. Synthetic analogs (cloprostenol sodium)characterized by more specific activity on the corpusluteum and less on smooth muscle stimulationproperties have fewer side effects.A. Natural Prostaglandin: - Prostaglandins arefound to be highly effective for termination ofpregnancy in bitches after 30 days of gestation. Itsuse prior to 30 day is not recommended. Mostpreferred treatment protocol is 0.1 mg/kg s/c every 8hours for 2 days and then 0.2 mg/kg given s/c every 8hours until abortion complete, the average wasJIVA Vol. 10 Issue 1 April 201261

GENERAL ARTICLEJ. Ind. Vet. Assoc., Kerala. 10 (1)approximately 5-7 days (Feldman et.al, 1993 andRenukaradhya et.al, 2008). This protocol resulted inthe least side effects. After administration of drug,the dog should be observed for 30 minutes for anyside effects. The dog should be fed 1-2 hours afterprostaglandin injection so as to avoid vomiting. It hasbeen observed that plasma progesterone less than 2.0ng / ml result in pregnancy termination and pretreatment concentration of plasma progesterone ismore than 6ng/ml (Feldman et.al, 1993). Most of theanimals treated will exhibit some of the followingside effects like panting, respiratory distress, excesssalivation, vomiting, defecation, stranguria andurination. Normally these side effects start within 30seconds to 3 minutes and usually persist for 5-20minutes. Side effects are usually severe during thefirst few injections and side effects will bediminishing after each subsequent injection.Preparation - LUTALYSE 5ml &10ml vials areavailable. Concentration 5mg/mlb. Prostaglandin analogs:- It has greater luteolyticeffectiveness at relatively low doses and decreasesthe occurrence of myometrial contractions andseverity of side effects compared to naturalprostaglandins. It has much greater affinity for theprostaglandin receptors and has a longer half life thannatural prostaglandin. It can be given at the dose rateof 2.5µg/Kg body weight subcutaneously every 48hours for 3 to 4 times (Reddy et.al, 2010). In order toreduce the side effects atropine sulphate can be givenat the rate of 0.04 mg/kg body weight subcutaneously10-15 minutes prior to the administration of drug.Preparation Inj.Clostenol 2ml, Inj.Pragma2ml,Inj.Cyclix 2ml, Inj. Estropur 2ml Concentration-250µg/ml3. DOPAMINE AGONISTSDopaminergic agonists are ergotinederivativealkaloid compounds that exert an antiprolactinergiceffect. The ability of dopamineagonists to inhibit prolactin secretion makes themoptimal for milk suppression, either during overtpseudopregnancy episodes or in the post-partumperiod. It is well known that prolactin is a requiredluteotropic hormone during the second half of canineluteal phase. Therefore, anti-prolactins can also beused to suppress luteal function in progesteronedependent conditions such as pyometra, unwantedpregnancy and mammary tumors. Two of the mostwidely used dopamine agonists in dogs arebromocriptine and cabergoline, which have a directaction on D2-dopamine receptors of the lactotrophiccells of the anterior pituitary gland.a. Bromocriptine: - It has been reported to be aneffective abortifacient after 35 days of gestation butnot prior to day 30. Two different treatment protocolshave been adopted. In one protocol 0.1mg/kg bodyweight daily or BID for 6 consecutive daysbeginning on day 30 of gestation. In the secondprotocol, 0.03 mg/kg twice daily for 4 daysbeginning after day 30 of gestation. Bromocriptinecommonly causes inappetence, anorexia, vomitingand depression. Also the drug is not 100% effectivein terminating pregnancy. Emesis is presumably dueto interaction with dopaminergic elements in theemesis centre of the brain and the ability of the drugto cross the blood brain barrier. The emetic effectmay reduce the absorption of the total doseadministered, and thus compromise efficacy.Because of above reasons the drug has not been usedextensively. Preparation ENCRIPT 2.5 mg tab,PROCTINAL 1.25 & 2.5 mg tabs.b. Cabergoline: - It is a long acting dopaminereceptor agonist and prolactin inhibitor. It is highlyeffective orally and parenterally. A dose of 5µg/kgonce daily cause a sharp decline in serum prolactinconcentration and result in abortion without muchside effects (Reddy et.al, 2010).. The side effects ofcabergoline are milder (compared to those ofbromocriptine) presumably due to the fact that itappears to be a more specific D-2 dopamine receptoragonist and is less able to cross the blood-brainbarrier and have CNS effects.Preparation CABGOLIN Tab 0.25 & 0.5mg, CAMFORTE Tab 0.5 & 1mg62

GENERAL ARTICLE4. COMBINATION OF PROSTAGLANDINAND DOPAMINE AGONISTSimultaneous administration of prostaglandinand dopamine agonist is found to be highly effective.Therapy begins 28 days after first breeding.Cloprostenol is administered subcutaneously onalternative days at a dose rate of 1 µg/kg and the drughas to be administered three times. Oral cabergolinehas to be given at a dose rate of 5µg/kg body weightfor 9 days. This regimen reduces the adverse effectsof prostaglandin therapy alone and increases theefficacy of prolactin antagonists. When the bitcheswere treated for approximately 9 days, 100 percentshowed resorption and there was generally no sideeffects except sanguinous vaginal discharge (Onclinet.al, 1995).5. ANTI PROGESTERONE THERAPYAnti-progestins are synthetic steroids thatbind with great affinity to progesterone receptors,preventing progesterone from exerting its biologicaleffects. After administration of the drug peripheralprogesterone concentration remains unaltered but itsaction is blocked. In dogs, the anti-progestinsmifepristone and aglepristone have been used forexperimental and clinical purposes, includingpregnancy termination and management ofpyometra.a. Mifepristone: -Mifepristone is a progesterone andglucocorticoid antagonist. It is more potent as ananti-progestin than as an anti-corticoid. In pregnantwomen, mifepristone is able to interrupt earlypregnancy in 80 percent of cases without any majorside effects. To improve its efficacy, mifepristone iscurrently used in combination with low doses ofprostaglandin analogs such as misoprostol. Theefficacy of combined treatment (mifepristone plusmisoprostol) is 96 percent in humans. The drug act asa progesterone receptor antagonist at the level of theuterus independent of any additional effects on lutealfunction. Premature cessation of luteal function mayhave occurred secondary to the termination ofpregnancy or may represent a luteolytic effect oftreatment independent of pregnancy status.Mifepristone has been demonstrated to induce directluteolysis and has an anticorticoid activity.This drug is orally active and has beenshown to be safe and effective in terminatingpregnancy after 30 days of gestation. The treatmentprotocol involved oral administration of drug at therate of 2.5 mg/kg twice daily for 4-5 days or untilabortion or resorption occurred (Concanoon et.al,1990). It is a competitive antagonist of progesteroneon the receptor level thus having most clinical effectsin the presence of progesterone. Preparation Tab.MTPILL 200mg, MEFIPIL 200mg, UNWANTED200mgB. Aglepristone: - This is a relatively newantiprogesterone drug developed for animal use.Aglepristone can be used any time up to day 45 forsafe effective termination of pregnancy (Fieni et. al,2001). Aglepristone does not modify plasmaconcentrations of progesterone, prostaglandins,oxytocin or cortisol within 24 hours after itsadministration but induces an increase inconcentrations of prolactin within 12 hours in bitchestreated in mid pregnancy (Galac, et. al, 2000). Thiscan explain the mammary gland congestion typicallyobserved after mid pregnancy termination.Shortening of the inter-oestrous interval andprolactin release seems to prove a direct or indirectaction of aglepristone on hypothalamic-pituitaryaxis. As an abortifacient, aglepristone acts like aprogesterone antagonist, at the uterus level and doesnot have direct and immediate luteolysis properties.Termination of pregnancy occurs in the presence ofhigh plasma progesterone concentrations (Baanet.al, 2005)..The early administration of aglepristone at 0to 25 days after mating always resulted in preventionof pregnancy. The later administration ofaglepristone at day 26 to 45 after mating inducedresorbtion or abortion within seven days in 96percent of cases. There were no untoward sideeffects. The drug can be administered at a dosage ofJIVA Vol. 10 Issue 1 April 201263

GENERAL ARTICLEJ. Ind. Vet. Assoc., Kerala. 10 (1)10mg/kg body weight (0.33ml/kg/day)subcutaneously twice at 24 hour interval. Efficacy oftreatment for termination of pregnancy is reported tobe 95 percent. No side effects were observed exceptmammary development and lactation. PreparationALIZIN 10 ml vial 30 mg/ml.6. OGESTERONE SYNTHESIS INHIBITORSProgesterone production can be blocked bythe hydroxyl steroid dehydrogenase isomeraseenzyme inhibitors, which prevent the conversion ofprognenelone to progesterone. Prognenelone isbiologically inactive, and therefore progesteronesupport for the pregnancy is lost, resulting inresorption or abortion (Simpson, 1998). Epostane isone such enzyme inhibitor that has no intrinsicoestrogenic, androgenic or progestogenic activity.When administered subcutaneously at the onset ofmetoestrus (dioestrus), epostane will prevent orterminate pregnancy. It can be given at a dose rate of5mg/kg body weight orally for 7 days (Keister et. al,1989).7. TAMOXIFEN CITRATEIt acts as an antiestrogen in premenopausalwomen but has estrogenic activity in dogs. It mayinterfere with zygote transport and/or implantation.Relatively high doses of drug are given twice dailyduring proestrus, oestrus, and early metoestrus. Thedrug was effective in preventing or terminatingpregnancy if administration began during proestrusor estrus or on day 2 of estrus. Efficacy was muchpoor in if the treatment commenced on day 15onwards. It can be given at a dose rate of 1mg/kgorally twice a day for 10 days. A high incidence ofpathological changes in the bitch's reproductive tractis induced by tamoxifen, including ovarian cysts andendometritis, and the compound is of little value forpotential breeding animals (Bowen et.al, 1988).Preparation TAMOFEN Tab 10 mg, TAMOXIFENTab 10, 20 and 40 mg.8. EMBRYOTOXIC AGENTSSeveral novel embryotoxic agents such asphenyltriazole isoindole and isoquinolinecompounds have been evaluated in the bitch. Theyare most effective when given around the time ofimplantation and often only a single administration isrequired. A single sub cutaneous or intra muscularinjection of 2-(3-ethoxy-phenyl)-5, 6-dihydro-striazole[5,1-a]isoquinoline(DL 204-IT) dissolved orsuspended in an oily vehicle is sufficient. Theoptimal time of treatment was found to be day 20 ofgestation, at which time the smallest effective dosewas 6.25 ng/kg (Galliani et. al, 1982). Howevermany of these agents have toxic side effectsincluding vomiting, diarrhoea, weight loss, pyrexia,lethargy and immunosuppression.9. DEXAMETHAZONEDexamethasone administered beginning atmid-gestation can terminate pregnancy in dogs,presumably by activating endogenous mechanismssimilar to those involved in parturition. It can resultin the production of oestrogen and prostaglandin bythe fetoplacental unit. Single dose of glucocorticoidsare not efficacious in the bitch. It can be given at adose rate of 200µg/kg body weight for 7 days andthen at a tapering dose of 10-20 µg/kg for next 3 days(Wanke et. al, 2002). Advantages of such a therapyfor pregnancy termination include the fact that itinvolves only oral administration of a relativelyinexpensive drug; however repeated administrationand high doses make the method impractical.Preparation: - DEXONA Tab 0.5mg, WYMESONETab 0.5 mgCONCLUSIONBefore deciding treatment for misalliance,vaginal cytology should be performed to make surethat mating had taken place. Aglepristone,oestrogens and tamoxifen citrate are the drugs whichcan be preferred for the treatment of misalliance in64

GENERAL ARTICLEdogs. Among these aglepristone is the best drug ofchoice. Due to adverse side effects diethylstilbesterol and tamoxifen citrate are not preferred.During mid gestation from 28-30 days onwardssynthetic prostaglandins, anti prolactins andantiprogesterone therapy are found to be effective. Acombination of prostaglandin and antiprolactin(cabergoline) is found to be highly effective interminating pregnancy. This treatment has theadvantages of being free of side effects, it inducesabortions by resorption, and it works as early as day25. The embryo toxic agents such as phenyltriazoleisoindole and isoquinoline compounds are drugswhich can be tried for pregnancy termination but thetoxic side effects limits its use in dogs.REFERENCEBaan, M, Taverne, M.A.M, Kooistra,H.S, J. deGier, Dieleman, S.J and Okkens, A.C (2005)“Induction of parturition in the bitch with theprogesterone-receptor blocker aglépristone”Theriogenology Volume 63, Issue 7 , Pages1958-1972, 15 April 2005Bowen RA, Olson PN, Young S, Withrow SJ. 1988“Efficacy and toxicity of tamoxifen citrate forprevention and termination of pregnancy inbitches” Am. J. Vet. Res. Jan; 49 (1):27-31.Concannon PW, Yeager A, Frank D, Iyampillai A.1990 “Termination of pregnancy and inductionof premature luteolysis by the antiprogestagen,mifepristone, in dogs” J. Reprod. Fertil. Jan;88(1):99-104.Feldman EC, Davidson AP, Nelson RW, Nyland TG,Munro C 1993 Prostaglandin induction ofabortion in pregnant bitches after misalliance J.Am. Vet. Med. Assoc. Jun 1;202(11):1855-8.Fieni,F, J.F. Bruyas, I. Battut and D. Tainturier 2001“Clinical Use of Anti-Progestins in the Bitch”International Veterinary Information Service,Ithaca NY (www.ivis.org), A1219.0201Galac,S, H.S. Kooistra,J. Butinar, M.M. Bevers, S.J.Dieleman, G. Voorhout, A.C. Okkens 2000Termination of mid-gestation pregnancy inbitches with aglepristone, a progesteronereceptor antagonist. Theriogenology, Volume53, Issue 4 , Pages 941-950.Galliani, G, Lernerm, L.J, Caramel, C., Maraschin.R, Nani, S., Nava, A, Nava, A. 1982 “Pregnancytermination in dogs with novel non-hormonalcompounds. Studies of 2-(3-ethoxy-phenyl)-5,6-dihydro-s-triazole [5,1-a] isoquinoline (DL204-IT)” Arzneimittelforschung. 32 (2): 123-7.Gilian, M. Simpson. 1998 Basava Manual of SmallAnimal Reproduction and Neonatology.Published by British Small Animal VeterinaryAssociation, United Kingdom pp 121-124Keister DM, Gutheil RF, Kaiser LD, D'Ver AS 1989Efficacy of oral epostane administration toterminate pregnancy in mated laboratory bitchesJ. Reprod. Fertil. Suppl. 39:241-9.Onchn, K., L. D. M. Silva and J. P. Verstegen 1995Termination of unwanted Pregnancy in dogswith the dopamine agonist, cabergoline, incombination with a synthetic analog ofpcxzalpha, either cloprostenol or alphaprostol.Theriogenology 43:813-622.Reddy,R.C.K., Sadasiva Rao,K, Solomon Raju, K.G,K.B.Raghavender and A. Gopal Reddy 2010Ind. J. Anim. Reprod. 31(2) 19-22Renukaradhya, G.J, Krishnaswamy, A. andHonnappa,T.G (2008) Studies on thetermination of pregnancy in bitches usingnatural prostaglandins. National Symposium onRecent trends and Future Strategies forimproved Reproduction of Livestock,Companion and wild animals pp - 186Wanke, M.M, S. Romagnoli, J. Verstegen and P. W.Concannon 2002 Pharmacological Approachesto Pregnancy Termination in Dogs and CatsIncluding the Use of Prostaglandins, DopamineAgonists, and Dexamethasone InternationalVeterinary Information Service (www.ivis.org),Ithaca, New York, USAJIVA Vol. 10 Issue 1 April 201265

GENERAL ARTICLEHOW TO IMPROVE THE LIVESTOCK SECTOR IN KERALA:SOME NUTRITIONAL THOUGHTS1 2 3Ajith K.S ., Anil Kumar, K and Dipu, M.T .Livestock Research Station, Thiruvizhamkunnu.J. Ind. Vet. Assoc., Kerala. 10 (1)Challenges and OpportunitiesWhy the cattle population is decreasing inKerala in spite of the increasing demand of milk isbeing debated in every animal husbandry seminars.There is a decline in total cattle population and thebuffalo population shows a more rapid decliningtrend. The demand by consumers are not met byproduction within the state and the human populationis increasing day by day. There is always a deficit of25 percent in milk as far as requirement is considered.In Kerala, out of the total geographical area of 38.86lakh hectare, 18 percent of the land area is barren landor uncultivated land area or cultivable waste areawhich can be utilized in one way or other forimproving the livestock sector.One major problem faced by Kerala is theweak feed and fodder base. With the shift in croppingpattern of Kerala, the area under rice cultivation hascome down by more than 50 percent over the last twodecades leading to drastic reduction in theavailability of straw for feeding cattle. It is estimatedthat the state produces only 60 per cent of theroughage requirement for cattle in Kerala.(economicreview, Kerala 2010) As a result roughage in the formof straw is being brought in to the state from adjacentstates at an exorbitant rate.Kerala has got a unique distinction amongIndian states that, it is the only state which usesreadymade concentrate as the major feed resource,1. Asistant Professor, Livestock Research Station,Thiruvizhamkunnu.2. Associate Professor & Head, Livestock Research Station,Thiruvizhamkunnu.3. Assistant Professor, Department of Animal Nutrition, Collegeof Veterinary & Animal Sciences , Mannuthy.instead of depending on “homemade” feeds.Regarding the cattle feed concentrate, which willhave to supplement the shortage in quality fodderproduction, the current level of production is notenough to satisfy the requirement. Now KCMMF,Kerala Feeds Ltd. and a few private players aretaking conscious steps for facing this challenge.Dairy farmers in Kerala have tried to adjustwith the situation by restricting the number of cattleand by preferring high yielding cross breds. This isevident from the steady increase in the proportion ofcrossbred animals, which Kerala achieved during thelast three decades.What is the way out ?A joint effort by the researchers, policymakers and implementing agencies is the need of thehour. Some thoughts which may be valuable arenarrated here.Development of “local” feeding standardsMost of the feeding standards which arebeing used today are developed for conditions notdirectly related to feeding practices prevailed underKerala conditions. Farmers in Kerala use a widerange of low quality and unconventional feeds. Asthe partitioning of nutrients are complex and aregoverned by a number of factors including thegenotype of the animal, quantity and quality of feedand the environment, the possible solution is to givenutritional recommendation to the farmers under ourmanagemental conditions and some efforts are beingdone by the Department of Animal Nutrition,KVASU.66

GENERAL ARTICLEPrecision Feeding and Total Mixed Ration (TMR)conceptConsidering the cost of production involved,farmers are very conscious of increasing theproductivity of their animals. Considering thedeficiency of fodder and the increasing price of feedingredients, it is possible to go for precision feedingand one such method is total mixed ration. Totalmixed ration is a concept of delivering nutrients toanimals as a complete balanced ration. Total mixedration consists of concentrate, roughage andmicronutrients / feed additives. The concentrate androughage are added in different levels, according tothe stage of lactation and physiological stage of theanimal. Roughage part is generally crop residue orhay. The concentrate portion includes oilcakes,molasses, grains or grain byproducts. Bypassproteins or bypass fat can also be added depending onthe requirement of the animal. Micro nutrients,vitamins, trace minerals, binders, probiotics,antioxidants, antitoxins and herbal extracts are alsoincluded to promote proper body function. Theseingredients are made into blocks using hydraulicpress and as a result of densification process theconcentrate matter get attached to the roughage alongwith molasses which facilitates the cellulolyticmicrobes to grow faster and enhance cellulolyticactivity in rumen.(Walli,T.K. 2010)Advantages of Total Mixed Ration It is the best way to feed balanced ration toruminants. Less feed wastage. Saves time and labor. Easy for transportation and storage. Crop residues can be effectively utilized Reduces methane production. Improved productive and reproductiveefficiency.Use of Agricultural or Industrial byproducts ornovel feedsDuring 2009-10, the price of cow milk hasincreased only by 6 percent in Kerala. On the inputside, the price of grass, gingelly oil cake, coconut oilcake and ground nut cake recorded an increase of 20percent, 12 percent, 3 percent and 12.5 percentrespectively during 2009-10. The increased cost ofinputs is a serious threat affecting profitability ofdairy farming. Since feed cost accounts to about 70percent of the cost of the livestock farming, researchshould be focused on measures to reduce the cost offeeding. Researches on nutritional and possibleinclusion of tapioca leaves, tapioca starch waste,rubber seed, coffee husk, neem seed, coconut pith,plantain rhizome, cashew apple waste, pepper waste,African payal, palm leaves, frog meal, prawn waste,jack fruit waste, cocoa pods, etc in cattle feed hadbeen undertaken at the Department of Animalnutrition, Kerala Veterinary And Animal SciencesUniversity. These results should be popularizedamong farmers and the farmers should beencouraged to produce of low cost feed using thelocally available feed resources at their door steps.Agricultural by products and crop residues which areavailable in plenty can be effectively utilized eitherby physical treatment (chopping of straw or watersoaking), chemical treatment (Urea treatment ofstraw) or by biological treatment (using fungi ortreatment with exogenous fibrolytic enzymes).Since there is emergence of more and morehuman food industries, their byproducts can formexcellent substances to be included in cattle feed.Notable examples being brewery waste, pine applewaste, spent ginger, tea waste, flours of breadindustry, etc. Much nutritional studies in this regardhave to be conducted in future.Use of bypass technologyRuminants have advantage over nonruminantsin that they can digest large amount offiber and they can utilize non protein nitrogen.However there are also some constraints as themicrobial nutrients may be insufficient for a higherproducing animal and the concept of bypass protein,bypass fat and by pass starch comes in to picture.Steps have to be taken for educating the farmers forjudicious use of the feed available to them.JIVA Vol. 10 Issue 1 April 201267

GENERAL ARTICLEJ. Ind. Vet. Assoc., Kerala. 10 (1)How to increase the fodder base? Role of sociallycommitted NGOsAs stated elsewhere in this article, 18% oftotal geographic area in Kerala state laysunderutilized. Self help groups and otherunemployed youths can venture in to production ofgreen grass, legume crops or tree fodders by adoptingvarious silvi pastural systems and sell it to farmers aspreserved form or fresh. The required technical knowhow should be provided to them. Many suchendeavors have been started in many parts of Kerala.Thrust on tree fodder.Various tree species which can be used astree fodders include Mullan kaini (Bridelia retusa),Murukku (Erythrina indica), Chamba (Eugeniajambosa), Kumbil (Gmelina arborea), Aval(Holoptelia integrifolia), Subabul (Leucaenaleucocephala), Venga (Pterocarpus marsupium),Agathi (Sesbania grandiflora), Njaval (Syzygiumcumini), Malayan chamba (Syzygium malaccense)etc. Various silvipastural and agro forestrytechniques can be tried for increasing the fodder baseas it will not only supply forage but also providemulch, acting as a control to soil erosion andenhancing soil fertility.Forage ConservationKerala is blessed with abundant rain fall. Theforages which are produced in excess during rainyseason should be preserved for use in the leanperiods. Preservation can be done in the form of hayor silage and many self help groups can venture intosuch activities.Improvement of forage quality is also asimportant as forage conservation and many ways toimprove the inferior crop residues are wellestablished.Residual feedConsider a case where two animals which areequal in all aspects are receiving same feed but oneanimal is yielding more milk … the point here is thefeed efficiency and those animal which eat more iseating the residual feed. In other sense the feed eatenextra is a waste. So to reduce the wastage what are thesolutions? Genetic selection of animals having morefeed efficiency. Vigorous culling policy should beinitiated in those animals used for progeny testing toeliminate the character from the population.Feed additivesProbiotics, prebiotics, enzymes (exogenousenzymes like Cellulases, Xylanases,Hemicellulases, Pentosanases and amylases),organic acids and modifiers of rumen fermentation(ionophores) will help in improving the feedefficiency and reduce methane production.Intake strategiesA nutritionally balanced ration is essentialfor an animal to perform at its optimum level. It isalso necessary that animal should sufficientlyconsume the feed. Often the feed supplied may beimbalanced in minerals, vitamins and other nutrients.Supplementation poses two questions: what tosupply? and how to supply? Multinutrient feedblocks is an answer to this as they will supplyrequired nutrients in an easy way.Some points are narrated here which mayinvoke interest in the minds of the stake holders ofanimal husbandry activities and hopefully generateenthusiasm for the betterment of this nobleprofession in Kerala.REFERENCES1. Kerala Economic review, 2010. Kerala StatePlanning Board, Thiruvananthapuram.2. Walli,T.K. 2010, Densified complete feedblock technology and its role in enhancingruminant production, including buffaloes,Proceedings of international BuffaloConference :294-30068

GENERAL ARTICLEEFFLUX PUMP INHIBITORS FORANTIBACTERIAL THERAPYSumithra T G, Chaturvedi V K, Susan Cherian,Binsila B Krishnan and Siju Susan JacobIndian Veterinary Research Institute, Izatnagar, U.PINTRODUCTIONFor the past seventy years, antibiotics arethe best weapons against bacteria which haveturned bacterial infections from life-threateningsituations into treatable conditions. Butindiscriminate use of antibiotics again changed thescenario by leading to the emergence of multi-drugresistant bacteria. Though this is not a new problem,it is becoming more dangerous these days and canbe best contemplated by news from Science daily(2011) stating that drug resistant bacterialinfections cause more than 25,000 deaths and €1.5billion in extra healthcare costs every year inEuropean Union alone. According to U.S. Centerfor Disease Control and Prevention (CDC, 2010),each year 90,000 people in the United States diebecause of drug-resistant bacteria indicating thenecessity for the discovery of new antibacterialsand resistance-modifying agents. But the pace ofanti-infective research is dramatically slow andonly one new class of antibacterials(oxazolidinones) has reached the market recently(Marquez, et. al., 2005). The rapid emergence ofantibiotic resistant pathogens and slow arrival ofnew antibiotics threatens the present and futuremedical and veterinary science. So novel alternatetherapeutic approaches must be looked upon to facethis threat and one of such option is efflux pumpinhibitors.EFFLUX PUMPSThree main mechanisms are involved inantibiotic resistance which include modification ofthe drug target, enzymatic inactivation of theantibiotics and default of its accumulation withinbacteria due to efflux systems.Efflux is the pumping of a solute out of acell. Efflux pumps (EPs) are membrane-associatedactive transporters promoting the extrusion of toxiccompounds including antibiotics. This decreasestheir intracellular concentration resulting in lesssusceptibility. Simultaneously this predisposes theemergence of higher level adaptive resistancemechanisms, as target mutations (Zechini andVersace, 2009). Mainly there are two types of EPsin bacteria. Those systems which confer resistanceto a specific drug (specific drug resistance (SDR)transporters) or to class of drugs (MDR effluxpumps) (Marquez, 2005). Multi Drug Resistant(MDR) EPs can handle a wide variety ofstructurally unrelated compounds.The microbial drug efflux was firstreported by Ball et al. (1980) and Mc Murry et al.(1980) for tetracycline in E. coli. The multidrugefflux systems have recently been identified assignificant determinants of resistance by Poole(2002). Phylogenetically, bacterial antibiotic EPsbelong to five super families that are classified intwo distinct types as primary transporters (drugextrusion by ATP hydrolysis) and secondarytransporters (by trans-membrane electrochemicalgradients) (Stavri et al., 2007). MDR among Grampositivebacteria is mainly conferred by MFS(major facilitator super family) and that for Gramnegativebacteria is RND (resistance nodulationand cell division) family.EFFLUX PUMPS INHIBITORS (EPIs) -The study of EPs in bacteria shows that itsinhibitors can be used for-JIVA Vol. 10 Issue 1 April 201269

GENERAL ARTICLEJ. Ind. Vet. Assoc., Kerala. 10 (1)1. Reversal of acquired antibiotic resistanceconferred by over expression of an EP.2. Removal of intrinsic antibiotic resistancecontributed by EPs3. To reduce the frequency of emergence ofresistant mutant strains.4. For reduction of bacterial virulence in vivo-Recent studies show that S. enterica Subsp.enterica serovar Typhimurium, E. coli, and C.jejuni overexpressing EPs are resistant to highconcentrations of bile salts. In addition, overexpression of EP in N. gonorrhoeae enhancesthe bacterial survival inside host (Piddock,2006). Moreover, outer channel components ofRND EPs are involved in seceretion of bacterialtoxins. Thus EPIs can be used as new weaponagainst secretion of virulence factors and toreduce the bacterial survival in vivo.5. Provide a new method for screening newantibiotics.TARGETS - Inhibition of pump activity may beachieved by different ways.1. Changing the chemical design of previousantibiotics to reduce its affinity for efflux.Tigecycline is a new antibiotic exhibitingreduced affinity for Tet pumps (Someya et al.,1995).2. Repressing the expression of EP genes byaltering its regulatory steps using antisenseoligonucleotides or small interfering RNA. Thispatented strategy was used for the inhibition ofAcrAB EP in E. coli (Van Bambeke et al., 2006).3. Inhibiting the functional assembly of the multicomponentpump- Globomycin can remove thelipoprotein signal sequence of exportedmembrane proteins. Mallea et al. (2002)reported that globomycin at selectedconcentrations restore chloramphenicolintracellular accumulation in MDR E. aerogeneswhich overproduces EP.4. Blocking the outermembrane channel with aplug- Use of nano-antibodies or a moleculeexhibiting strong affinity for the channel areaexposed at the cell-surface may achieve it(Zechini and Versace, 2009). Although this mayyield an efficient EPI, it remains as an attractivehypothesis at this moment.5. By collapsing the energy of efflux- Carbonylcyanide m-chlorophenylhydrazone (CCCP) andpotassium cyanide are used in the laboratory tototally abolish the efflux of drugs (Pages et al.,2005). But it raises the question, whether it istheir direct effect on EP activity or the alterationof cell envelope induces bacterial death.Although no molecule belonging to this categoryhas been currently developed for clinical use orhas been patented, phenothiazines may servethis need in future.6. By creating competitive or non-competitiveinhibition to the affinity sites of EP (Mahamoudet al., 2007).CLASSIFICATION OF EPIs1. ANTIBIOTIC ANALOGUESChemical modification of substrates of EPs byincorporating structural motifs of inhibitors is aninteresting approach for identifying new and potentEPIs. Nelson and Levy (1999) demonstrated theability of 13-cyclopentylthio-tetracycline to inhibitTetB in E. coli. German et al. (2008) showed that acore of ofloxacin conjugated with bisaryl urea is apotent inhibitor of NorA and MepA in S. aureus.2. DRUGS OTHER THAN ANTIBIOTICSDrugs other than antibiotics having EPIactivity are summarized in the Table No.13. NATURAL SOURCESNatural products that have been identified asEPIs are given in the Table 2.4. SYNTHETIC COMPOUNDSDuring this decade, various compounds have70

een designed to inhibit the activity of EPs whichincludesa. PAN and their derivatives - Renau et al.(2003) showed that Phe-Arg--naphthylamine(PAN) effectively inhibits the effluxmechanism of quinolones. The modification ofthis chemical series by Yoshida et al. (2006)through the addition of various hydrophilic chainshas yielded pyridopyrimidine compounds. Amongthese an ammonium acetic acid analogue hadpotent efficacy, high solubility, and a good safetyprofile in acute toxicity assay in animal model ofP. aeruginosa infection.b. Quinoline derivatives- Alkoxy- andthioalkoxy-quinolines increased the susceptibilityof E. aerogenes MDR strains to chloramphenicol(Mahamoud et al., 2006). More studies arenecessary to determine the therapeutic propertiesof these compounds.c. Arylpiperidines and arypiperazines -Schumacher et al. (2006) demonstrated EPIacitivity of anthryl piperazines and naphthylpiperazines. However, due to “serotonin agonist”properties of arylpiperazines, they are likely to betoxic in man and animals (Kern et al., 2006)Table 1. Drugs having EPI activityd. Amide derivatives- 5,9-dimethyl-deca-2,4,8-trienoic acid amides and 9-formyl-5methyldeca-2,4,8-trienoic acid amides enhance theactivity of ciprofloxacin by blocking EP in S.aureus.e. Substituted polyamines- Gill et al. (1999)showed the EPI ability of N-benzylatedpolyazaalkanes, N-benzylated polyaminoalkanesin H. influenzaeOther synthetic compounds having EPI activityare given in table 3.CONCLUSIONNargotra et al. (2009) pointed out theapplication of quantitative structure-activityrelationship (QSAR) analysis to identify thepharmacophoric groups involved in theinhibition of EP. This can be applied for designingnew EPIs. Currently, no EPIs has been licensed fortherapeutic use in human or veterinary practice.But one program involving co-administration ofan EPI (aerosolized formulation of a PANderivative)with ciprofloxacin has reached phaseII human clinical trials for the treatment ofpulmonary exacerbations in cystic fibrosis due toMDR Gram-negative bacterial pathogens by MpexPharmaceuticals.Drug EP Bacteria ReferencesReserpine Bmr B. subtilis Neyfakh et al., 1991tetK MRSA Gibbons and Udo, 2000Verapamil LmrA L. lactis VanVeen et al., 199611 pyrroloquinaxolinederivatives of Omeprazole NorA G+ve bacteria Vidaillac et al., 2007Phenothiazines MFS S. aureusAnti-tubercular drugs M. tuberculosis Chan et al., 2007BpeAB-OprB,AmrAB-OprA B. pseudomallei Chan et al., 2005RNDE. coli, P. aeruginosa,S. Typhimurium Martins et al., 2008P-SSRI MFS and RND G+ve and G-ve bacteria Wei et al., 2004GENERAL ARTICLEJIVA Vol. 10 Issue 1 April 201271

Table 2. Drugs having EPI activityEPI SOURCE BACTERIA REFERENCEPheophorbide A and 5'-MHC Berberis plants S. aureus Stermitz et al., 20006-dimethyl-4-phenylpyridine-3,5-dicarboxylicacid diethyl ester Jatropha elliptica S. aureus Marquez et al., 2005Isopimarane derivatives Lycopus europaeus E. aerogenes Gibbons et al., 2003Epicatechin-gallate andepigallocatechin gallate Green tea extracts S. aureus Roccaro et al., 2004-{[(E)-5-(3,3-dimethyl-2-oxiranyl)-3-methyl-2-pentenyl]oxy}-7H-furo[3,2-g]chromen-7-one Grapefruit MRSA Abulrob et al., 2004Polyacylatedneohesperidosides G. caespitosum S. aureus Stermitz et al., 2003Phenolic metabolites Dalea versicolor S. aureus Belofsky et al., 2004Piperine Piperaceae S. Aureus Pages et al., 2003Thanathin Podisus maculiventris S. Aureus Khan et al., 2006GENERAL ARTICLEFermentation productsStreptomycesMF-EA-371-NS1 P. aeruginosa Lee et al., 2001Table. 3. Synthetic EPI CompoundsEPI EP/ antibiotic Bacteria ReferencesIron-chelators (nocardamine) TetB and TetK S.aureus Rothstein et al., 1993Arylated benzothiophenesand tiophenes NorA S. aureus Chabert et al., 2007J. Ind. Vet. Assoc., Kerala. 10 (1)Indole derivatives(INF-55 and INF-271) NorA S. aureus Ambrus et al., 2008GG918, biricodar (VX-710)and timcodar (VX-853) Fluoroquinolone S.aureus, Mullin et al., 2004S. pneumoniae,E. faecalis72

GENERAL ARTICLEREFERENCESAbulrob, A.N., Suller, M.T. E., Gumbleton, Simons,M.C., Russell, A.D. 2004. Identification andbiological evaluation of grapefruit oilcomponents as potential novel efflux pumpmodulators in methicillin-resistant S. aureusbacterial strains. Phytochemistry, 65:3021-7Ambrus, J. I., Kelso, M. J., Bremner, J. B., Ball, A.R. Casadei, G. and Lewis, K. 2008.StructureActivity Relationships of 2-Aryl-1HindoleInhibitors of the NorA Efflux Pump inS. aureus. Bioorg. Med. Chem. Lett., 18 (15):4294-4297.Ball, P. R., S. W. Shales. and I. Chopra. 1980. Plasmidmediated tetracycline resistance in E. coliinvolves increased efflux of the antibiotic.Biochem. Biophys. Res. Commun. 93: 74-81.Belofsky, G., Percivill, D. and Lewis, K. 2004.Phenolic metabolites of Dalea versicolor thatenhance antibiotic activity against modelpathogenic bacteria. J. Nat. Prod., 67: 48.Centers for Disease Control (CDC) 2010. Food borneDiseases Active Surveillance Network(FoodNet), United States.Chabert, F. D., Marquez, B., Neville, L., Joucla, L.,Broussous, S., Bouhours, P., David, E., Pellet-Rostaing, S., Marquet, B, Moreau, N. andLemaire, M. 2007. Synthesis and evaluation ofnew aryl benzothiophene and diarylthiophenederivatives as inhibitors of the NorA multidrugtransporter of S. aureus. Bioorg. Med.Chem.,15 (13):4482-97Chan, Y.Y., Ong, Y.M. and Chua, K.L. 2007.Synergistic interaction betweenphenothiazines and antimicrobial agentsagainst B. pseudomallei. Antimicrob. AgentsChemother., 51: 623-630.Chan, Y. Y., and K. L. Chua. 2005. The B.pseudomallei BpeAB-OprB efflux pump:expression and impact on quorum sensing andvirulence. J. Bacteriol. 187:4707-4719German, N., Wei, P., Kaatz, G.W. and Kerns, R.J.2008. Synthesis and evaluation offluoroquinolones derivatives as substratebasedinhibitors of bacterial efflux pumps.Eur. J. Med. Chem.Gibbons, S., Oluwatuyi, M., Veitch, N.C. and Gray,A.I. 2003. Bacterial resistance modifyingagents from Lycopus europaeus.Phytochemistry, 62: 83-87.Gibbons, S and Udo, E.E. 2000. The effect ofreserpine, a modulator of multidrug effluxpumps, on the in vitro activity of tetracyclineagainst clinical isolates of methicillin resistantS. aureus (MRSA) possessing the tet(K)determinant. Phytother Res.,14: 139-140.Gill, M.J., Brenwald, N.P. and Wise, R. 1999.Identification of an efflux pump gene,pmrA, associated with fluoroquinolonesresistance in S. pneumoniae. Antimicrob.Agents Chemother., 43: 187-189.Kern, W.V., Steinke, P., Schumacher, A., Schuster,S., von Baum, H. and Bohnert, J.A. 2006.Effect of 1-(1-naphtylmethyl)-piperazine, anovel putative efflux pumps inhibitor, onantimicrobial drug susceptibility in clinicalisolates of E. coli. J. Antimicrob. Chem., 57:339-343.Khan, I.A., Mirza, Z.H. and Kumar, A. 2006.Piperine, a phytochemical potentiator ofciprofloxacin against S. aureus. Antimicrob.Agents Chemother., 50: 10-12.Lee, M.D., Galazzo, J.L. and Staley, A.L . 2001.Microbial fermentation-derived inhibitorsof efflux-pump-mediated drug resistance.Farmaco., 56: 815.Mahamoud, A., Chevalier, J., Alibert-Franco, S.,Kern, W.V. and Pagès, J.M. 2007. Antibioticefflux pumps in Gram-negative bacteria: theinhibitor response strategy. J. Antimicrob.Chemother., 59: 1223-1229.Mahamoud, A., Chevalier, J., Davin-Regli, A.,JIVA Vol. 10 Issue 1 April 201273

GENERAL ARTICLEJ. Ind. Vet. Assoc., Kerala. 10 (1)Barbe, J. and Pages, J.M. 2006. Quinolinederivatives as promising inhibitors ofantibiotic efflux pump in multidrug resistantEnterobacter aerogenes isolates. CurrentDrug Targets, 7 (7): 843-847.Malléa, M., Chevalier, J., Eyraud, A. and Pagès, J.M.2002. Inhibitors of antibiotic efflux pumpinresistant Enterobacter aerogenes strains.Biochem. Biophys. Res. Comm., 293: 1370-1373.Marquez, B., Neuville, L., Moreau, N.J., Genet, J.P.,dos Santos, A.F., Caño de Andrade, M.C. andSant'Ana, A.E. 2005. Multidrug resistancereversal agent from Jatropha elliptica.Phytochemistry, 66(15):1804-11.Martins, M., Dastidar, S. G. and Fanning, S. 2008.Potential role of non-antibiotics (helpercompounds) in treatment of multidrugresistantgram-negative infections:mechanisms for their direct and indirectactivities. Int. J. Antimicrob. Agents., 31: 198-208.Mc Murry, L., R. E. Petrucci, Jr., and S. B. Levy.1980. Active efflux of tetracycline encoded byfour genetically different tetracyclineresistance determinants in Escherichia coli.Proc. Natl. Acad. Sci. U.S.A. 77: 3974-3977.Mullin,S., Mani, N. and Grossman, T. H. 2004.Inhibition of Antibiotic Efflux in Bacteria bythe Novel Multidrug Resistance InhibitorsBiricodar (VX-710) and Timcodar (VX-853).Antimicrob. Agents Chemother., 48(11): 4171-4176Nargotra, A., Sharma, S., Koul, J.L., Sangwan, P.L.,Khan, I.A., Kumar, A., Taneja, S.C. and Koul,S. 2009. Quantitative structure activityrelationships (QSAR) of piperine analogs forbacterial NorA efflux pump inhibitors. Eur. J.Med. Chem., 44(10): 4128-35Nelson, M.L. and Levy, S.B. 1999. Reversal oftetracycline resistance mediated by differentbacterial tetracycline resistance determinantsby an inhibitor of the Tet(B) antiport protein.Antimicrob. Agents Chemother., 43: 1719-1724.Neyfakh, A.A., Bidnenko, V.E. and Bo Chen, L.1991. Efflux-mediated multidrug resistancein Bacillus subtilis: similarities anddissimilarities with the mammalian system.Proc. Natl. Acad. Sci. USA., 88: 4781-4785Pagès, J.M., Dimarcq, J.L., Quenin, S. and Hetru, C.2003. Thanatin activity on multidrug resistantclinical isolates of Enterobacter aerogenesand Klebsiella pneumonia. Int. J. Antimicrob.Agents., 22: 265-269.Pages, J. M., Muriel Masi. and Jacques Barbe. 2005.Inhibitors of efflux pumps Gram-negativebacteria.Trends in Molecular Medicine,11(8):382-389.Piddock, L.V. 2006. Clinically relevantchromosomally encoded multi drug resistanceefflux pumps in bacteria. Clin. Microbiol.Rev.,19: 382-402.Poole, K. 2002. Mechanisms of bacterial biocide andantibiotic resistance. J. Appl.Microbiol.,92(suppl 1): 55-64Renau, T.E., Léger, R., Filonova, L., Flamme, E.M.,Wang, M., Yen, R., Madsen, D., Griffith, D.,Chamberland, S., Dudley, M.N., Lee, V.J.,Lomovskaya, O., Watkins, W.J., Ohta, T.,Nakayama, K. and Ishida, Y. 2003.Conformationally-restricted analogues ofefflux pump inhibitors that potentiate theactivity of levofloxacin in Pseudomonasaeruginosa. Bioorg. Med. Chem. Lett., 13:2755-2758.Roccaro, S.A., Blanco, A.R., Giuliano, F., Rusciano,D. and Enea, V. 2004. Epigallocaechingallateenhances the activity of tetracyclinesin staphylococci by inhibiting its efflux frombacterial cells. Antimicrob. AgentsChemother., 48: 1968-1973.Rothstein, D.M., McGlynn, M. and Bernan, V.74

GENERAL ARTICLE1993. Detection of tetracyclines and effluxpump inhibitors. Antimicrob. AgentsChemother., 37: 1624-1629.Science Daily. New Antibiotics Against ResistantBacterial Infections Discovered. Science Daily(April 8, 2011).Schumacher,A., Steinke, P. and Bohnert, J.A. 2006.Effect of 1-(1-naphthylmethyl)-piperazine, anovel putative efflux pump inhibitor, onantimicrobial drug susceptibility in clinicalisolates of Enterobacteriaceae other than E.coli. J. Antimicrob. Chemother., 57:344- 348Someya, Y., Yamaguchi,A. and Sawai, T. 1995. Anovel glycylcycline, 9-(N,N-dimethylglycylamido)-6-demethyl-6-deoxytetracycline,isneither transported nor recognized by thetransposon Tn10-encoded metaltetracycline/Hantiporter. Antimicrob. AgentsChemother., 39: 247-249.Stavri, M., Piddock, L.J.V. and Gibbons, S. 2007.Bacterial efflux pump inhibitors from naturalsources. J. Antimicro. Chemother., 59: 1247-1260.Stermitz, F.R., Cashman, K.K. and Halligan,K.M. 2003. Polyacylated neohesperidosidesfrom Geranium caespitosum: bacterialmultidrug resistance pump inhibitors. Bioorg.Med. Chem. Lett., 13: 19-25.Stermitz, F.R., Lorenz, P., Tawara, J.N.,. Zenewicz,L.A. and Lewis, K. 2000. Synergy in amedicinal plant: antimicrobial action ofberberine potentiated by 5'-methoxyhydnocarpin, a multi drug pumpinhibitor. Proc. Natl. Acad. Sci. USA., 97:1433-1437.Van Bambeke, F., Pagès, J.M. and Lee, V.J. 2006.Inhibitors of bacterial ef?ux pumps asadjuvants in antibiotic treatments anddiagnostic tools for detection of resistance byefflux, Recent Patents Anti-Infect Drug Disc.,1: 157-175.VanVeen, H.W., Venema, K., Bolhuis, H., Oussenko,I., Kok, J. and Poolman, B. 1996. Multi drugresistance mediated by a bacterial homolog ofthe human multidrug transporter MDR1. Proc.Natl. Acad. Sci. USA., 93: 10668-10672.Vidaillac, C., Guillon, J. and Arpin, C. 2007.Synthesis of omeprazole analogues andevaluation of these as potential inhibitors ofmulti drug efflux pump NorA ofStaphylococcus aureus. Antimicrob. AgentsChemother., 51: 831-838.Wei, P., Kaatz, G.W. and Kerns, R.J. 2004. Structuraldifferences between paroxetine andfemoxetine responsible for differentialinhibition of Staphylococcus aureus effluxpumps, Bioorg. Med. Chem. Lett., 14: 3093-3097.Yoshida, K., Nakayama, K., Yokomizo, Y., Ohtsuka,M., Takemura, M., Hoshino, K., Kanda, H.,Namba, K., Nitanai, H., Zhang, J.Z., Lee,V.J. and Watkins, W.J. 2006. MexAB-OprMspecific efflux pump inhibitors inPseudomonas aeruginosa, part 6: explorationof aromatic substituents. Bioorg. Med. Chem.,14: 8506-8518.Zechini, B and Versace, I. 2009. Inhibitors ofmultidrug resistant efflux systems in bacteria.Recent Pat. Anti infect. Drug Discov., 4(1):37-50.JIVA Vol. 10 Issue 1 April 201275

ASSOCIATION NEWSVETERINARIANS ANNUAL CONVENTION 2011 HELD AT KANNUR"Utharayanam-2011,the Veterinarian'sAnnual Convention was inauguratedbyHonourable MLA Sri. Abdullakutty,on 30-12-2011 at Kannur. The inauguralceremony was presided by Dr. K.R.Arunkumar, President, IVA, Kerala. Thegathering was welcomed by Dr. C.Sreekumar, President, KVSSA. Sri.Abdullakutty MLA, in his inauguralladdressed the need for a different viewwith regard to development in Kerala.He called for the development for minidairy farms and requested that moreemphasis should be given todevelopment of meat breeds forKerala. He released the third issue ofJIVA. Director of Animal HusbandryDepartment Dr. R. Vijayakumar,Director and Registrar of KSVC, Dr.N.N.Sasi, Dr. Udayavarman, Directorof Zoos and Museums,Dr. SukumaraPillai, President, AHOAK and Dr.Mohandas spoke on the Occasion.J. Ind. Vet. Assoc., Kerala. 10 (1)Dr.E.K.Easwaran, General secretary, IVA, Keralaexpressed vote of thanks.The kalasandhya was inaugurated by reknownedpoet Prof. V.Madhusoodanan Nair. He had a very warminteraction with the audience and gave a very passionateand thought provoking speech on the need for love andaffection for all living beings. He introduced the kids intothe art of writing poems. The meeting was welcomed byDr. Kurien K Jacob, Secretary, AHOAK. Meeting waspresided by Dr. EK.Easwaran, General Secretary, IVA,Kerala. Dr. S.Yohannan felicitated the meeting. Vote ofthanks was offered by Dr. Sisy Philip , Vice President,IVA, Kerala. The inaugural ceremony was followed by acolorful, melodious and beautiful cultural programme byVets and their family members.The gathering was welcomed by Dr.AbdulSalim, DAHO of Kannur. The seminar was inauguratedby Honorable Minister fir AH, Sri. K.P.Mohanan. Themeeting was presided by Dr. K.R. Arunkumar, President,IVA, Kerala. He sought the intervention of the Hon.Minister in some pressing issues before our communitylike Pay revision, reduction of the loan lending rates ofBanks to farmers, purchase of quality medicines etc. TheHon. Minister in his inaugural addresss appreciatedwhole heartedly IVA's decision to help the bereavedfamilies of dairy farmers who have committed suicide inPalakkad and pathanamthitta. IVA will raise funds fromVets and give good quality Milch animals and feed for ayear free of cost to the affected families. The minister alsostressed the need for improvement of physical assets ofour institutions and farms. He also clarified that the Oneman commission will start functioning at the earliest andthe just demands of officers working in AHD, shall belooked into by the government in a positive way. Hestressed the need for doing away with beaurocratichurdles for implementation of a decision. He called uponvets to work hard for the farming community and stayaway from controversies. He released the AHD calendarprepared by LMTC, Kannur and the Souvenir ofUtharayanam 2011. Seminar was handled by Prof. Dr.A.P.Nambi, Ph.D., Professor and Head, Dept. of ClinicalMedicine, Madras veterinary College.The function was presided by Dr. K.R.Arunkumar.The meting was inaugurated by Hon.District Panchayat president, Prof.K.A. Sarala. Shewished peace, prosperity and relaxation for all Vets andtheir family members. Later she released the IVA Diaryfor 2012 and also gave away awards and recognitions ofIVA, KVSSA and AHOAK. Dr. Unnikrishnan, Generalconvenor, Utharayanam 2011 offered Vote of Thanks.IVA AWARDS 2011Best Veterinarian :Dr. Laiju. M. Philip(Palakkad)76

ASSOCIATION NEWSINDIAN VETERINARY ASSOCIATION, KERALASTATE OFFICE BEARERS - 2012PresidentDr K R ArunkumarPH : 9846075281, 9446572255Email : drarun1965@yahoo.comGeneral SecretaryDr C SreekumarPH : 94475 86773, 0471-2486777Email : ceeyeskay_1618@yahoo.co.inVice President (North Zone)Dr Mohammed HaneefaPH : 0466-2263217, 9447632370E-mail : anivet84@gmail.comVice. President (South Zone)Dr Kurian K JacobPh : 94471 05222Vice. President (Lady)Dr R SairaPh : 94953 91367Joint Secretary (South Zone)Dr. S. SaiprasadPhone : 9447441627E-mail :drsai33@gmail.comJoint Secretary (North Zone)Dr V PrasanthPh : 94472 63687Joint Secretary (Lady) :Dr. R. UshaPh : 0481-25150509446396881TreasurerDr L RajeshPh : 94461 70888E-mail : rajeshvety@yahoo.comBuilding Committee MemberDr S YohannanPh : 94476 56166JIVA Vol. 10 Issue 1 April 201277

INSTALLATION OF IVASTATE OFFICE BEARERS - 2012ASSOCIATION NEWSInstallation ceremony of state office bearers of IVA for the year2012 was conducted on14/01/2012 at Veterinarian’s building,Thiruvananthapuram. Dr P Bahuleyan administered the oath tothe IVA State President, Dr K R Arunkumar. The other officebearers also took charge of their respective positions on theday.J. Ind. Vet. Assoc., Kerala. 10 (1)STATE LEVEL PROGRAMME FOR DISTRIBUTION OF RELIEF TO BEREAVEDFAMILIES OF DAIRY FARMERS WHO COMMITTED SUICIDE IN PALAKKAD DISTRICTA commendable ceremony was organized byIndian Veterinary Association, Kerala to mark thedistribution of relief to bereaved families of dairyfarmers who committed suicide in Palakkad district atMalampuzha Block Panchayat Hall, Palakkad on03/02/2012.The families of two dairy farmers who havecommitted suicide due to debt were given the IVARELIEF PACKAGE which included the distributionof two elite cows free of cost; free cattle feed for 10months, free 3 year insurance coverage and freeveterinary assistance for the period.Families of Sri. Chandran of Peruvambu and Sri.Ramakrishnan kottekkad of Marutha Road were given theassistance.Indian Veterinary Association, Kerala took a landmarkdecision to provide help to these dairy farmers. Thedecision was taken in the state convention of IndianVeterinary Association, Kerala held at Kannur chaired byDr. K.R. Arunkumar, State IVA president.The function started with a welcome speech by Dr. S.Selva Murugan, President, IVA Palakkad. Dr. K.R.Arunkumar, State IVA president did the presidentialaddress. The inauguration of the glittering ceremony andthe distribution of the IVA RELIEF PACKAGE was doneby Sri. V.S. Achyuthanandan, Honorable leader ofopposition, Kerala legislative assembly. Sri. K. Achuthan,M.L.A was the chief guest on the occasion. Sri. M. SivaKumar, President, Marutha Road Grama Panchayat, Sri.P. Babu, President, Peruvambu Grama Panchayat, Sri. T.Radhakrishnan, President, Malampuzha BlockPanchayat, Dr. M. Sumangala, District AnimalHusbandry Officer were among the galaxy of dignitariesand officials who were present on the occasion. Theprogramme came to an end with the vote of thanks by Dr.B. Biju, President KVSSA Palakkad.78

ASSOCIATION NEWSMOVE TO REGULARISE CONTRACT POSTINGS BY KVASU DRAWS WIDE PROTESTThe move of KVASU statute to regularizethe temporary appointment of academicconsultants made last year is drawing wide protest.IVA views that the decision to appoint facultythrough back door flouting the UGC norms is adirect infringement on the rights of qualifiedprofessionals eligible for appointment as assistantprofessors.It was in 2011 that KVASU invitedapplication to post academic consultants. It wassaid that the posting of academic consultants will bepurely on contract basis for a period of 3 years or tilla permanent hand is posted. A Masters degree in theconcerned subject was the only qualificationrequired for the appointment.Now KVASU statute has come out with adraft proposing to regularize the appointments ofacademic consultants and to post them as assistantprofessors. This is a serious violation of theagreement and is against the interest of manyeligible qualified professionals. The decision ofKVASU to move ahead with the statute is totallydisregarding the basic qualification and standardsset for appointment of faculty in any University.Convention of post graduate veterinarianswas convened by IVA at Thrissur on 10/03/2012.More than 60 members attended the meeting and amemorandum to immediately stop thebeaurocratic conspiracy to “The decision toappoint faculty through back door, flouting UGCnorms will be viewed as a direct infringement onthe rights of qualified professionals eligible forappointment as assistant professors.” In a relatedmovement IVA has also demanded that a wholetimevice-chancellor be posted for KVASUobserving existing norms. IVA demands that thevicechancellor should be a whole-time officer ofthe University and should be appointed fromamongst the distinguished veterinarians in thestate. regularize the appointment of academicconsultants was represented to the Registrar,KVASU and to Dr K Jayakumar, acting Vice-Chancellor of KVASU. The convention decided toseek all possible legal and political means to stopthe move by KVASU.A workshop on KVASU Draft Statute washeld on 13/03/2012 at COVAS, Mannuthy underthe auspices of IVA. More than 50 members fromMannuthy, Pookot and other units attended theworkshop. The workshop went through the draftstatute page by page and made necessaryamendments and submitted the recommendationsto the Registrar, KVASU. A positive decision fromthe registrar is expected in theserecommendations.JIVA Vol. 10 Issue 1 April 201279

ASSOCIATION NEWSSIGN POST & ACHIEVEMENTSDr. K. Vijayakumar, Associate Professor, Department of Veterinary Epidemiology andPreventive Medicine, College of Veterinary and Animal Sciences, Mannuthy has been appointedas Joint Commissioner, Livestock Health, Department of Animal Husbandry, Dairying andFisheries, Ministry of Agriculture, Government of India. He holds his office in Krishi Bhawan,New Delhi. He was the state executive member of Indian Veterinary Association, Kerala. He wasalso the chief editor of Journal of Indian Veterinary Association, Kerala. IVA, Kerala wishes allsuccess in his new venture.Dr. K Rajankutty is a native of Kulathupuzha, Kollam District. He is 1978 batch graduatefrom CoVAS, Mannuthy. He was the Prof and Head, Univesity Veterinary Hospital,Kokkalai during 2009 August. In 2011 he became the Professor and Head, Department ofVeterinary Surgery and Radiology, CoVAS, Mannuthy. He has 65 scientific publications inhis credit. He has guided 1 PhD and 12 MVSc students. He is currently the Professor andHead, Department of Veterinary Surgery and Radiology, CoVAS, Pookode.Dr. T. Prakash, Assistant director (P), Regional Poultry Farm, Malampuzha received BESTFARM OFFICER AWARD instituted Government of Kerala. He is presently working asAssistant Rinderpest Officer, Regional Disease Diagnostic Laboratory, Palakkad. Dr. T.Prakash was the recipient of best veterinarian award for 2006 instituted by Indian VeterinaryAssociation, Kerala.Dr. S. Sharmila, Veterinary Surgeon, Veterinary Dispensary, Akathethara received BESTVETERINARY SURGEON AWARD instituted Government of Kerala. Dr. S. Sharmila wasthe recipient of best veterinarian award for 2010 instituted by Indian Veterinary Association,KeralaDr Ajith Kumar K G, Assistant Professor, Department of Veterinary Parasitology, College ofVeterinary and Animal Sciences, Pookode, bagged the Best Poster award for his poster entitled”Survey of myiasis in wild animals of Kerala” in the XXII National Congress of IndianAssociation for the Advancement of Veterinary Parasitology and National Symposium onIntegrated Research Approach in Veterinary Parasitolgy: From Basic to Molecular Techniquesheld on 15-17 March, 2012 at Department of Parasitology, College of Veterinary Science & A.H.,DUVASU, Mathura, Uttar PradeshJ. Ind. Vet. Assoc., Kerala. 10 (1)thDr.AneesCherukunnath: Won the Young Scientist Awards during the 24 Kerala ScienceCongress held at RRII, Kottayam in the category of Fishery and Veterinary Science. The awardcomprises of cash prize of Rs.25000/- and One lakh Research Grant and Certificate of Merit. Dr.Anees's paper was on “Caprine foetus-A novel source of stem cells for research and therapeuticsin Veterinary Science”. He is currently working as Academic Consultant in the Department ofVeterinary Physiology, COVAS, Pookode. He is 2005 batch graduate from CoVAS, Mannuthy.Dr.Nandakumar. S, Veterinary Surgeon and Officer in charge of All India Coordinated ResearchProject on FMD, Chief Disease Investigation Office, Palode participated in the FAO-ICARInternational Conference on Scientific Developments and Technical challenges in the ProgressivethControl of Foot & Mouth Disease in South Asia during 13 to 15 February 2012 at New Delhi.80