CONTENTS

CONTENTS
PART I : PLANT SCIENCE
Adsorption desorption of Pendimethalin and Oxyfluorfen in Soils of Andhra Pradesh
A.Sireesha, P.C.Rao, P.V.Rao, Ch.S.Ramalakshmi and G.Swapna 1
Studies on the effect of Plant Growth Regulators on Flowering , Corm and Cormel Production
in Gladiolus Gladiolus Grandiflorus L. CV. White Prosperity
G.V. Subba Reddy, M.B. Nageswara rao, K. Umajyothi, K. Sasikala 11
Performance of Drum Seeder in Direct Sown Paddy under Puddled Condition
M.Visalakshi and A.Sireesha 16
Effect of Graded Levels and Time of Nitrogen Application on Nutrient Uptake, Yield and
Economics of Semi-dry Rice Oryza sativa L.
K. Jhansi Lakshmi Bai, K.V. Ramana Murthy and M.Venku Naidu 21
Assessment of Genetic Diversity in Capsicum Spp. by using Morphological and Molecular Tools
S. Joshi, C. Sarma, C. Jangid and H.V. Vijayakumarswamy 26
Estimation of Heterosis for Yield and its Attributing Characters and Study of Intra-spikelet
Competition for Seed Size in Finger Millet Eleusine coracana L.
Parashuram Patroti and Jayarame Gowda 33
Integrated Effect of Organic Manures and Inorganic Fertilizers on Soil Urease Activity
and Yield of Maize-spinach Cropping System
I. Usha Rani. G. Padmaja and P. Chandrasekhar Rao 42
Screening of Local Rhizobial Isolates for Plant Growth Promotion and Biocontrol
Properties against Soil Borne Fungal Pathogens
Bh. Sarvani, R. Subhash Reddy, S. Sumathi and P. Narayan Reddy 46
Characterization and Classification of Rice Growing Soils of Central
Telangana Region of Andhra Pradesh
M.Ramprasad, V.Govardhan, V.Praveen Rao, K.Surekha and M.H.V. Bhave 52
Identification of Superior Parents and Cross Combinations by Using Line X Tester
Analysis in Finger Millet Eleusine Coracana L.
Parashuram Patroti and Jayarame Gowda 59
PART II : SOCIAL SCIENCE
Effect of Front Line Demonstrations and Trainings on Knowledge and Adoption of Integrated Pest
Management Practices by Chickpea farmers of Prakasam District of Andhra pradesh
O. Sarada and G. V. Suneel Kumar 68
PART III : VETERINARY SCIENCE
Effect of Feeding Complete Feed Containg Poultry Litter on Rumen Nitrogen and
Total Volatile Fatty Acids in Sheep and Goats
J. Narasimha, V.Chinni Preetham and S.T.Viroji Rao 74
Efficacy of Controlled Internal Drug Releasing (CIDR) Device on Synchronization of
Estrus and Fertility in Ewes
K. Murali Mohan, K. Sadasiva Rao and K.G. Solmon Raju 78
Effect of NSP Enzymes and Prebiotics alone or in Combination on Performance, Egg Quality,
Nutrient Retention and Gut Health of Laying Hens Fed Corn-Soybean Meal Based Low Energy Diets
J. Narasimha, D. Nagalakshmi, Y. Ramana Reddy and S.T.Viroji Rao 86

Haematological and Biochemical Profile of Ewes Synchronized with Controlled Internal Drug Releasing
Device (CIDR)
K. Murali Mohan, K. Sadasiva Rao and K. Ramchandra Reddy 96
PART IV : HOME SCIENCE
Indian Bread Making Tools - Consumer Evaluation and Design Modification
P. Rajya Lakshmi, D. Ratna Kumari And V. Vijaya Lakshmi 100
PART V : RESEARCH NOTE
Crop Coefficients for Drip and Check Basin Irrigated Castor for Prediction of Evapotranspiration
B. R. Kumar, V. Praveen Rao, K. Avil Kumar, V. Ramulu, M. Uma Devi and P. Raghuveer Rao 107
Study on the Effect of Irradiation on Storage Quality of Tomato Puree
M. Kirthy Reddy and V. Vijayalakshmi 111
Evaluation of Defoliants on Mungbean Vigna radiata L. as Harvesting Tools
B. Padmaja, M. Malla Reddy, S. Malathi and D. Vishnu Vardhan Reddy 115
Yield, Nutrient uptake and Economics of Castor as Influenced by Integrated Nutrient
Management in Pongamia + Castor Agrisilvisystem
K. Indudhar Reddy, S. Hemalatha, G. Jayasree and V. Praveen Rao 118
Nano Food Colours for Product Formulations with Selected Fruits (Papaya and Black Grapes)
and Vegetables (Tomato and Beet Root)
P. Srilatha and K. Uma Maheswari 123
Effect of Organic Fertilisers on Growth, Yield and Quality of Tomato Lycopersicon Esculentum
S. Vani Anusha, P. Prabhu Prasadini, S. Sri Devi and K. Surya Prakash Rao 126
Nutrient Uptake of Microsprinkler Irrigated Wheat Cultivars under Varying Nitrogen Levels
Mathura Yadav, V. Praveen Rao and K. Suresh 131
Effect of Synergist, Triphenyl Phosphate on Resistant Guntur Strain of spodoptera
litura (Fab.) in Cotton
I. Aruna Sri and T. Madhumathi 135
Effect of Harvesting stages and drying methods on Alkaloid Content in Makoi
Solanum Nigrum L.
P.Brahma Sai, B.Amareswari and S.A Vijaya Padma 141
Response of Aerobic Rice to irrigation scheduling and Nitrogen Doses under Drip Irrigation
M . Malla Reddy, B. Padmaja, G .Veeranna and D .Vishnu Vardhan Reddy 144
Drip irrigation schedule for Castor based on Pan Evaporation
B. Ravi Kumar, V. Praveen Rao, V. Ramulu and K. Avil Kumar 149
Character Association and Path Coefficient Analysis for Seed Yield in Quality Protein Maize
Zea Mays L.
K. Vijay Kumar, M. R. Sudarshan, Kuldeep Singh Dangi and S. Madhusudan Reddy 153

J.Res. ANGRAU 41(2) 1-10, 2013
ADSORPTION DESORPTION OF PENDIMETHALIN AND OXYFLUORFEN
IN SOILS OF ANDHRA PRADESH
A.SIREESHA , P.C.RAO, P.V.RAO, CH. S. RAMALAKSHMI AND G. SWAPNA
AICRP on Weed Control, Acharya N.G. Ranga Agricultural University,
Rajendranagar, Hyderabad-500030
Date of Receipt : 19.01.2012 Date of Acceptance :05.01.2013
ABSTRACT
Adsorption desorption of pendimethalin and oxyfluorfen in soils was studied by batch equilibrium technique
at five different initial concentrations of pendimethalin and oxyfluorfen. Adsorption isotherms were confirmed to the
Freundlich equation. The desorption process exhibited pronounced hysteresis in all the soils, which was more
prominent when desorption was carried out at higher concentration of herbicide and the percent cumulative desorption
was high in soils with low organic carbon content of soil. The values of Freundlich constant, K f
were ranged from 0.28
to 2.83 for pendimethalin, and from 0.30 to 3.21 for oxyfluorfen. The Freundlich constants K and n increased with
increasing initial concentration of adsorbed herbicide thus confirming the irreversible nature of the adsorption of
pendimethalin and oxyfluorfen of these soils. The per cent cumulative desorption was high in soils with low organic
carbon content.
INTRODUCTION
When a herbicide is applied to soil, it
undergoes a number of processes which determine
its fate in soil. Herbicides may also remain on the
soil surface due to adsorption process and potentially
affect quality and yield of the next crop cultivated on
the same field. Stable herbicides may be taken up
by a plant forming unwanted residues. Herbicides
when applied to the crop undergo transformation
under the influence of environment. The persistence
of herbicides may cause health hazards and affects
non-target organisms. The fate of herbicides applied
in the soil is governed by various processes such as
adsorption, transformation and transportation in
addition to the influence of factors such as herbicide
application rate, crop type, agricultural practices and
climatic conditions (Arnold and Briggs, 1990; Cheng
1990; Sondhia 2009). Adsorption – desorption is an
important process for determining the ultimate fate
of herbicides in soil because detoxification
mechanisms such as degradation, metabolism,
microbial uptake and mobilization are operative only
on the non-sorbed fractions of the chemical to the
sites on soil mineral or organic surfaces. Adsorption
–desorption influences mobility, persistence,
degradation and volatility of pesticide in soil.(Kalpana
et al., 2002). Adsorption decreases the concentration
of chemical in solution and decrease bioavailability.
Desorption of herbicide is also critical in determining
the herbicide available to the target species or the
loss of herbicide through runoff and percolation which
causes ground water pollution. As there is lack of
information regarding the sorption of these pre
emergence herbicides (which are widely used as pre
emergence in vegetables) the present investigation
was conducted to study the adsorption- desorption
of pendimethalin and oxyfluorfen on four soil types
of Andhra Pradesh. Pendimethalin (N-(1-ethylpropyl)–
3,4-dimethyl-2,6-dinitrobenzenamine) belongs to
dinitroaniline group and Oxyfluorfen (2-chloro-1, (3
ethoxy –4 nitrophenoxy)-4- (triflouromethyl) benzene)
belongs to diphenyl ether group used as pre-plant or
pre emergence application for control of most of the
annual grasses and broad leaved weeds.
MATERIALS AND METHODS
Soil samples were collected from different
agro climatic zones of Andhra Pradesh and at each
selected location, the soil samples were collected
from 15-20 different spots at a depth of 0-22 cm ,
quartered and about 5 to 10 kg of each soil sample
email: sireesha_291@yahoo.co.in
1

SIREESHA et al
was brought to the laboratory , air dried under shade
and processed by passing through a 2mm size
sieve . These 2 mm sieved soils were properly labeled
and stored in cloth bags for further studies. The four
soils of varying in physico chemical characteristics
were used the study (Table 1). Technical grade
pendimethalin (94.5 % purity) obtained from M/S
BASF India Ltd., and technical grade oxyfluorfen
(97 % purity) obtained from M/s Indofil Chemicals
was used .
Adsorption-desorption was conducted by
equilibrating five grams of soils ( 2 mm) and treated
with initial pendimethalin concentrations of
0,10,20,30,40 and 50 µ g mL -1 in 1 X 10 –2 M CaCl 2
solution and incubated for 24 hrs at 27+1 o C . The
soil suspension was later centrifuged at 5000 rpm
for five minutes and five mL of supernatant was taken
out and absorbance of pendimethalin was measured
at 420 nm. To the remaining slurry containing 15 mL
solutions of pendimethalin solution and soil, 5 mL of
CaCl 2
solution (1 X 10 -2 M) was added to make
solution to 20 ml and again incubated for 24 hrs and
centrifuged at 5000 rpm for five minutes to determine
the equilibrium concentration. This process was
repeated for 5 consecutive days. Identical soil blanks
were also maintained simultaneously and the net
absorbance of equilibrium concentration at each stage
was obtained by subtracting the absorbance of
blanks. Similar procedure was followed for
oxyfluorfen and the absorbance was measured at
213nm for oxyfluorfen. The adsorption - desorption
experiment was carried out in quadruplicates. The
amount of herbicide desorbed was calculated as
follows:
Co n = Ce n-1 x 15/20
Where,
Co n = initial concentration of pendimethalin /
oxyfluorfen on n th day
Ce n-1 = equilibrium concentration on (n-1) th day
Amount desorbed on n th day is given by (Ce n – Co n )
x 20
The data obtained from studies on adsorption
of pendimethalin / oxyfluorfen was analysed by using
Freundlich equation and the Freundlich constants were
calculated.
RESULTS AND DISCUSSION
The adsorption isotherms of pendimethalin
and oxyfluorfen were found to be parabolic in nature
with an initial ‘S’ shaped curve. S shaped isotherm
indicates a stronger initial competition of water
molecules to the adsorbent as compared to the
herbicide, thereby indicating the initial resistance to
the adsorption of herbicides to be overcome later by
the co-operative effect of the adsorbed
molecule.(Arvind et al.,2000).
The desorption isotherms did not coincide
with adsorption isotherms. Desorption of both
herbicides from soils indicated that slope of
desorption isotherms was much lower than the slope
of adsorption isotherms and less amount of herbicide
was present in equilibrium solution than during
adsorption. (Fig.1&2 for pendimethalin, Fig.3&4 for
oxyfluorfen). The desorption processes exhibited
hysteresis and the isotherms showed consistent
hysteresis during desorption.(Amit Bist et al., 2005;
Nagamadhuri, 2003; Kalpana et al., 2002; Arvind et
al., 2000; Jenks et al., 1998; Prakash and Suseela
Devi, 1998; Mersie and Sey bold,1996).
The percent cumulative desorption of
pendimethalin varied from 36.8 % to 69.0% for 10 µg
mL -1 , from 29.7% to 53.8 % for 20 µg mL -1 from
21.9 % to 41.6 % for 30 µg mL -1 , from 21.2 % to
40.40 % for 40 µg mL -1 and from 19.0 % to 37.1 %
for 50 µg mL -1.
The percent desorption of oxyfluorfen varied
from 33.10 percent to 23.6 percent for 10 µg g -1 ; from
29.9 % to 19.8% for 20 µg g -1 ; from 21.85 % to 18.3
% for 30 µg g -1 ; from 21.4 % to 16.9 % for 40 µg g -1
and from 20.6 % to 15.4% for 50 µg g -1 . As the initial
2

ADSORPTION DESORPTION OF PENDIMETHALIN AND OXYFLUORFEN
concentration increased there was a gradual decrease
in desorption.
At low level of initial concentrations of the
adsorbed herbicides the desorption isotherms were
close to adsorption isotherms there by indicating an
increase in the degree of irreversibility in adsorption
– desorption. There was a consistent increase in K f
value as the initial concentration increased in all the
soils. Which is an indicative of difficult desorption.
The desorption of pendimethalin in selected
four soils varied in the order:S 3
> S 2
> S 4
> S 1
. The
higher adsorption on S 1
may be due to high organic
carbon and clay content. Freundlich ‘K f
’ values which
indicate the extent of binding of herbicide to the soil
constituents were positively and significantly
correlated with organic carbon (r = 0.94** for
pendimethalin and r = 0.80** for oxyfluorfen), clay
content (r = 0.91** for pendimethalin and r = 0.72**
for oxyfluorfen) and clay + OC (r = 0.92** for
pendimethalin and r = 0.71** for oxyfluorfen). The
role of organic carbon in the adsorption of
pendimethalin and oxyfluorfen is consistent with
reduced biological activity of these herbicides in soils
with high organic carbon content. Organic carbon
content has been shown to be the first critical
parameter positively and significantly correlated with
adsorption of pendimethalin and oxyfluorfen in soils
(Johnson and Sims, 1993; Moreau and Mouvet,
1997).Clay content of soil is said to be another critical
parameter in adsorption of pendimethalin and
oxyfluorfen in soils and its role is often masked by
that of organic matter and this can become a
significant factor when organic carbon content
decreases
The variation in percent desorbed may be
due to heterogeneity involved in different soils, that
vary widely in type and energy of bonding. In general,
higher amounts of herbicide was desorbed during first
washing and the amount progressively decreased
with each subsequent washings. The per cent
cumulative desorption revealed that the adsorption
of these herbicides is almost irreversible indicating
that the soil organic matter and clay content plays
an important role in the adsorption – desorption of
pendimethalin and oxyfluorfen from soil solution
affecting the bio availability of herbicides in soil.
Table 1. Physico-chemical characteristics of soils under study
Soil
pH
EC
(dS/m)
OC
(g/kg)
Sand Silt Clay Texture
S1 7.82 0.22 8.5 55.8 11.0 33.2 Clay loam
S2 8.65 0.29 4.5 84.4 2.0 13.6 Loamy sand
S3 7.71 0.24 3.1 74.40 13.00 12.60 Sandy loam
S4 6.57 0.16 5.3 76.00 0.60 23.40 Sandy clay loam
3

SIREESHA et al
Table 2. Desorption of adsorbed oxyfluorfen from Alfisol (S1)
Table 3. Desorption of adsorbed oxyfluorfen from Alfisol (S2)
4

ADSORPTION DESORPTION OF PENDIMETHALIN AND OXYFLUORFEN
Table 4. Desorption of adsorbed oxyfluorfen from Vertisol (S3)
Table 5. Desorption of adsorbed oxyfluorfen from Vertisol (S4)
5

SIREESHA et al
Table 6. Desorption of adsorbed pendimethalin from Alfisol (S1)
Table 7. Desorption of adsorbed pendimethalin from Alfisol (S2)
6

ADSORPTION DESORPTION OF PENDIMETHALIN AND OXYFLUORFEN
Table 8. Desorption of adsorbed pendimethalin from Vertisol (S3)
Table 9. Desorption of adsorbed pendimethalin from Vertisol (S4)
E.C : Equilibrium Concentration (µg mL -1 ), A.A : Amount Adsorbed (µg g -1 ), A.D: Amount Desorbed (µg g -1 ) C.D : Cumulative Desorbed (%),
C.A :Cumulative Adsorbed (%)
7

SIREESHA et al
O
Table 10. Freundlich K and n values for desorption isotherms of pendimethalin and oxyfluorfen in soil
8

ADSORPTION DESORPTION OF PENDIMETHALIN AND OXYFLUORFEN
30 .00
25 .00
20 .00
15 .00
10 .00
5 .00
0 .00
0.0 0 10 .00 20 .0 0 30.0 0 40 .00 5 0.00
Eq uil i bri um c once nt r a t i on ug/ m L
Amount Adsorbed ug/g
25
20
15
10
5
0
0 10 20 30 40 50
Equilibrium concentr ation ug/m L
Fig 1. Adsorption desorption isotherms of pendimethalin (Soil 1 and 2)
20
Amount Adsorbed ug/g
25
20
15
10
5
0
0 10 20 30 40 50
Equilibrium concentration ug/m L
Amount Adsorbed ug/g
18
16
14
12
10
8
6
4
2
0
0 10 20 30 40 50
Equilibrium concentration ug/mL
Fig 2. Adsorption desorption isotherms of pendimethalin (Soil 3 and 4)
Amount adsorbed ug/g
40
35
30
25
20
15
10
5
0
0 10 20 30 40 50
Equilibrium concentr ation ug/m L
30
25
20
15
10
5
0
0 10 20 30 40 50
Equi li bri um con cent rat io ug/ mL
Fig 3. Adsorption desorption isotherms of oxyfluorfen (Soil 1 and 2)
9

SIREESHA et al
/g
g
u
d
e
rb
s
o
d
a
t
n
u
o
m
A
40
35
30
25
20
15
10
5
0
0 10 20 30 40 50
Equilibrium concentration ug/mL
30
25
20
15
10
5
0
0 10 20 30 40 50
E qui li br iu m conce ntr at ion ug/ mL
Fig 4. Adsorption desorption isotherms of oxyfluorfen (Soil 3 and 4)
REFERENCES
Amit Bist, Anjali Sharma, Srivastava A, Baliram,
Srivastava, P. C and Govindea Singh 2005.
Effect of temperature on adsorption, desorption
of isoproturon on a clay soil. Indian Journal of
Weed Science. 37 (3&4): 247-250.
Aravind, K. Rai., Chhonkan P K and Agnihotri, N. P
2000. Persistence and degradation of
pendimethalin and anilofos in flooded versus non
flooded soils. J.I.S.S.S. 48(1) : 57-62.
Jenks, M. B., Roethy W F and Martin, A. R 1998.
Influence of surface and sub surface soil
properties on atrazine sorption and degradation.
Weed Science 46: 132-138.
Johnson, R .H and Sims, J. T 1993. Influence of
surface and subsoil properties on herbicide
sorption by Atlantic Coastal Plain Soils. Soil
Science 155: 339-348.
Kalpana, Agnihotri, N B and Gajbhiya, V. T 2002.
Adsorption Desorption of imidacloprid on five
tropical Indian soils. Pesticide Research Journal.
14(1): 63-68.
Mersie, W and Seybold, C 1996. Adsorption and
desorption of atrazine, deethylatrazine
deisopropylatrazine and hydroxyatrazine on levy
wetland soil. Journal of Agricultural Food
Chemistry 44: 1925-1929.
Moreau, C and Mouvet, C 1997. Sorption and
desorption of atrazine, deethylatrazine, and
hydroxyatrazine by soil and aquifer solids.
Journal of Environmental Quality 26: 416-424
Nagamadhuri, N .V 2003. Sorption, Presistence and
mobility of atrazine and isoproturaon a physico
chemical study Ph.D thesis submitted to
Acharya N.G. Ranga Agricultural University,
Hyderabad.
Prakash, N. B and Suseela Devi. L 1998. Effect of
organic matter on adsorption desorption of
pendimethalin in soils. Pesticide Research
Journal 10 (2): 202-208.
Singh, RP 1996. Adsorption, Movement and
distribution of carbofuran in different soils.
Pesticide Research Journal. 8 (2): 139-145.
10

J.Res. ANGRAU 41(2) 11-15, 2013
STUDIES ON THE EFFECT OF PLANT GROWTH REGULATORS ON FLOWERING ,
CORM AND CORMEL PRODUCTION IN GLADIOLUS (gladiolus grandiflorus L.)
CV. WHITE PROSPERITY
G.V. SUBBA REDDY, M.B. NAGESWARARAO, K. UMAJYOTHI and K. SASIKALA
Horticulture College and Research Institute
Dr.Y.S.R. Horticulture University, Venkataramannagudem - 534 101
Date of Receipt : 22.09.2012 Date of Acceptance : 12.03.2013
ABSTRACT
The present studies the effect of plant growth regulators on flowering, corm and cormel production in
gladiolus (Gladiolus grandiflorus L.) Cv. White Prosperity were carried out during 2010-2011at Horticulture College
and Research Institute, Dr. Y.S.R. Horticulture University, Venkataramannagudem, West Godavri district in
randomized block design with 9 treatments and 3 replications. Among the floral parameters, TIBA at 150 ppm
recorded minimum number of days to first floret appearance (82.56 days), and 50 percent flowering (90.93 days).
Similarly BA at 100 ppm recorded maximum number of spikes per corm (1.40). However, higher mean spike length
(137.98 cm) and number of florets per spike (14.06) were recorded with GA 3
at 100 ppm. The minimum spike length
and number of florets were observed with TIBA at 150 ppm. In case of corm and cormel parameters, GA 3
at 100 ppm
recorded maximum corm size and weight while BA at 100 ppm recorded maximum number of cormels .m (29.75)
and cormel weight per corm (14.00 g) with highest propagation coefficient (194.20).
INTRODUCTION
Gladiolus Gladiolus grandiflorus L. is
popularly known as ‘Queen of the bulbous flowers’
because of attractive spikes, having florets of
different colours and better keeping quality for 7 to
10 days. It is also known as “Sword lily” because of
the shape of its leaves. Availability of gladiolus cut
flowers round the year helps in better flower
production and marketing on commercial basis. In
recent years, it was found that growth regulators play
an important role in regulating the flower production
in Gladiolus to catch the early and late demands in
the cut flower market (Bhattacharjee, 1984 and
Sharma et al., 1995).
MATERIALS AND METHODS
The experiment was conducted during
2010-2011 at Horticulture college and Research
Institute, Dr. Y.S.R. Horticulture University,
Venkataramannagudem, West Godavari District. The
experiment, spraying of plant growth regulators at
different concentrations viz. GA 3
(100, 150 ppm), NAA
(200, 250 ppm), BA (50, 100 ppm) and TIBA ( 75,
150 ppm) six weeks after planting and the experiment
was laid out in randomized block design with 3
replications. Five plants were randomly selected and
tagged from the net plot area in each treatment and
replication for the purpose of recording the biometric
observations 40,60 and 80 days after planting. The
data was analyzed using computer software
programme by the method of variance outlined by
Panse and Sukhatme (1978).Statistical significance
was tested by F value at 5 per cent level of
significance. Critical difference at 0.05 level was
worked out for the effects that were significant.
RESULTS AND DISCUSSION
Among the plant growth regulators, TIBA
promoted earliness in flowering, however, the plant
growth regulators viz. GA 3
,NAA and BA delayed the
flowering. Delayed flowering was due to delay in flower
bud differentiation and excess vegetative growth. The
early flowering in growth retardant treated plants might
be due to the fact that such plants might have built
up sufficient food reserves at initial stages. These
reserve food could have been utilized for reproductive
growth with the restriction in vegetative growth. The
present findings were in accordance with Ravidas et
al. (1992) and Devi et al. (2007) in gladiolus. Activity
of GA 3
to delay flowering correlates with effectiveness
for promoting stem elongation (King et al., 1993).
Treatments with low concentrations, which showed
minimum leaf area during early growth stage, delayed
flowering significantly. This suggests that certain leaf
area threshold constant is required as an inductive
factor for flowering in gladiolus. This view gets support
email: gajjela.horti05@gmail.com
11

SUBBA REDDY et al
from the observations of Ravidas et al. (1992), Devi
et al. (2007) and Kumar et al. (2007) in gladiolus.
GA 3
, NAA and BA at different concentrations
significantly increased the mean spike length, number
of florets and number of spikes per plant. These
treatments were consistent and equally effective in
increasing the leaf area almost during the entire crop
growth period. The increase in leaf area thereby
increased the assimilate synthesis, might have
contributed to increase in spike length by these
treatments. The increased spike length with GA 3
might
be due to rapid inter nodal elongation as a result of
increased cell division and cell elongation in the
intercalary meristem. As GA 3
promotes vegetative
growth and increases the photosynthetic and
metabolic activities causing more transport and
utilization of photosynthetic products this might have
resulted in increased spike length. Mukhopadhyay
and Banker (1986) also reported significant increase
in spike length with GA 3
in the gladiolus cv.
Friendship. Similar results were also reported by
Ravidas et al. (1992), Devi et al. (2007), Rajesh
Bhalla and Ajay Kumar (2007). Flower inducing ability
of BA was reported by several workers under in vitro
as well as in vivo conditions. Induction of flowering
may be due to its ability to alter the assimilate
distribution (Ogawa and King, 1994) i.e. the theory of
nutrient diversion (Sachs et al., 1979).
TIBA recorded minimum spike length.
Reduced spike length with TIBA might be due to its
ability to inhibit polar transport of auxins in cell
elongation and reduced photosynthetic efficiency.
This view gets support from the observations of
Ravidas et al. (1992) and Devi et al. (2007) in
gladiolus. Number of florets per spike was maximum
with GA 3
, NAA and BA treatments. The lowest
number of florets were recorded with TIBA. Increase
in number of florets per spike with GA 3
treatments in
gladiolus have been reported by Rajesh Bhalla and
Ajay Kumar (2007), Dataram et al. (2001) and
PranavRana et al. (2005), who obtained the highest
number of florets per spike by application of GA 3
at
100 ppm. NAA treatments resulted in production of
maximum number of florets per spike which might
be due to short inter nodel length. The lowest number
of florets per spike with TIBA might be due to reduced
plant height and spike length. Devi et al. (2007) also
reported similar results while investigating with NAA
and TIBA in gladiolus.
Results from the present study indicated that
the number of replacement corms per mother corm
was significantly highest in GA 3
followed by BA and
NAA. PranavRana et al. (2005) reported similar
results with GA 3
treatments (100,250 and 500 ppm)
in gladiolus. Singh et al. (2002) also noticed highest
number of corms per plant by with GA 3
followed by
NAA at 200 ppm and BA at 100 ppm treatments in
gladiolus. TIBA recorded the lowest number of
replacement corms per mother corm. Devi et al.
(2007) also reported similar results with GA 3
, NAA
and TIBA in gladiolus. Gladiolus has two sources
for planting viz. corm and cormel which can serve as
reserve food material in the initial stages, and
photosynthesizing leaves in later stages. Likewise it
has two competing sinks,viz., flower spike and the
developing corm and cormels. Plant growth regulators
in all the concentrations recorded maximum number
of replacement corms, cormels and propagation
coefficient. They might have promoted the sink
activity of developing corm and cormels at the
expense of flower spike, which may be the reason
for increase in number of corms and cormels. Similar
results were also observed by Tawar et al. (2007) in
gladiolus. The increase in size and weight of corms
with the application of plant growth regulators could
be attributed to the ability to increase the number of
leaves which in turn increased the photosynthesis
and photosynthetic assimilates. These assimilates
were transported to the daughter corms, thereby,
increasing their size and weight. Supportively, lowest
values for corm weight were recorded with control.
Similar results of increase in size and weight of
gladiolus corms have been reported by Maurya and
Nagda (2002), Umarao et al. (2007 b) and Vijay Kumar
and Singh (2008). The data on number and weight of
cormels per corm revealed that both the parameters
differed significantly due to plant growth regulator
treatments. Among the plant growth regulator
treatments, more number and maximum weight of
cormels per corm were recorded with BA, followed
by TIBA , GA 3
and NAA. Tawar et al.(2007) and
Havale et al. (2008) have reported that BA 50 ppm
recorded the highest values for number of corms and
cormels, weight of corms and cormels. Maximum
number of cormels and weight of cormels was with
12

STUDIES ON THE EFFECT OF PLANT GROWTH REGULATORS ON FLOWERING
TIBA might be due to their general depression of
vegetative growth, rather than direct effect on
tuberization (Levy et al., 1993; Devi et al.,2007). The
data on propagation coefficient significantly differed
with plant growth regulator treatments. Highest
propagation coefficient was recorded with BA followed
by TIBA, GA 3
and NAA treatments. Similar results
with BA application was observed by Baskaran et al.
(2009).
Table 1. Effect of plant growth regulators
Treatments No. of days taken for No. of
spikes/
Plant Growth
Regulators
plant
Spike
length(cm)
Spike
growth
rate
No. of
florets/
spike
1 st Flower
appearance
50%
Flowering
GA 3 – 100 ppm 95.30 102.73 1.26 137.98 1.44 14.06
GA 3– 150 ppm 94.00 100.20 1.20 133.71 0.95 13.80
NAA- 200 ppm 89.76 94.50 1.33 127.32 0.92 13.13
NAA- 250 ppm 88.36 93.36 1.26 128.66 0.93 13.60
BA – 50 ppm 86.60 90.73 1.26 123.74 0.85 10.76
BA – 100 ppm 86.36 90.93 1.40 125.64 0.87 11.70
TIBA- 75 ppm 84.66 91.10 1.13 91.81 0.58 8.86
TIBA- 150 ppm 82.56 87.46 1.13 87.33 0.50 8.06
Control (Distilled
water)
96.43 104.56 1.06 114.25 0.70 9.53
‘ F ’ value Sig. Sig. Sig. Sig. Sig. Sig.
S E m ± 0.57 0.36 0.07 0.35 0.07 0.30
C D at 5% 1.75 1.10 N.S. 1.07 0.23 0.91
CV % 4.66 3.12 10.44 9.51 15.82 7.55
13

SUBBA REDDY et al
Table 2. Effect of plant growth regulators on number of replacement corms per mother corm, size
of the corm and weight of the corm in gladiolus cv. White Prosperity.
Treatments
Replacement
Size of
weight
No.of
Weight of the
Propagation
Plant Growth
Regulators
corms/
mother corm
the
corm
(cm)
of the
corm
(gm)
cormels /
corm
cormel/corm
(gm)
coefficient
GA 3 – 100
ppm
GA 3 – 150
ppm
NAA- 200
ppm
NAA- 250
ppm
1.49 5.03 34.23 23.58 10.30 147.26
1.25 5.02 31.80 24.80 11.59 157.31
1.16 4.40 28.17 18.84 9.63 127.51
1.16 4.78 29.20 19.20 9.96 127.96
BA – 50 ppm 1.06 4.39 28.52 28.52 13.26 182.39
BA – 100
ppm
1.20 4.39 28.06 29.75 14.00 194.20
TIBA- 75 ppm 1.06 3.50 26.95 26.95 12.14 152.28
TIBA- 150
ppm
Control
(Distilled
water)
1.03 4.11 25.05 28.06 12.31 171.87
1.10 3.39 19.58 12.92 8.06 125.99
‘ F ’ value Sig. Sig. Sig. Sig. Sig. Sig.
S E m ± 0.07 0.14 0.49 0.66 0.15 5.95
C D at 5% 0.23 0.42 1.49 1.25 0.48 18.00
CV % 11.68 5.65 3.11 4.86 7.82 6.69
REFERENCES
Baskaran, V, Misra ,R. L and Abirami K 2009. Effect
of plant growth regulators on corm production in
gladiolus, Journal of Horticultural Sciences
4 (1) :, 78-80.
Bhattacharjee, S. K 1984. The effect of growth
regulating chemicals on gladiolus. Gartenbn
Wissenchaft 49 (3): 103-106.
Dataram, Verma ,J. P and Verma H K 2001.
Preplanting soaking of corms with growth
regulators influences flowering in gladiolus.
Annals of Agri Bio Research 6 (2): 163-167.
Devi, D .U., Sekhar, R .C and Babu, J. D 2007. Effect
of growth regulators on flowering and corm
14

STUDIES ON THE EFFECT OF PLANT GROWTH REGULATORS ON FLOWERING
production in gladiolus cv. Jacksonvilla Gold.
Journal of Research ANGRAU 35 (1): 6-14.
Havale, V. B., Tawar, R. V., Hage, N .D., Kakad,
G. J., Fathepurkar, S .C and Sable, A .S 2008.
Effect of growth regulators and chemicals on
growth and flowering of gladiolus. Asian Journal
of Horticulture. 3(1) : 93-94.
King, R. W., Blundell, C and Evans, L .T 1993.
The behavior of shoot apices of
Liliumtemulentum in vitro as the basis of an
assay system for florigenic extracts. Australian
Journal of Plant Physiology 20 (3): 337-348.
Kumar, P .N., Reddy, Y N and Chandra shekar,
R. 2007. Flower induction in gladiolus cormels
by application of chemicals. Journal of
Ornamental Horticulture 9 (3):174-178.
Levy, D, Sea, brook, JEA and Coleman, S 1993.
Enhancement of tuberization of axillary shoots,
buds of potato Solanumtuberosem L. cultivars
cultured in vitro.J. Exp. Botany 44 : 381- 386.
Maurya, R. P and Nagda, C .L 2002. Effect of growth
substances on corm and cormel yield in gladiolus
Gladiolus grandiflorusL.cv. Friendship. Haryana
Journal of Horticultural Sciences 31(1-2): 60-61.
Mukhopadhyay, A and Banker, G. J 1986. Preplanting
soaking of corm with gibberellic acid modified
growth and flowering of gladiolus cultivar
‘Friendship’. Indian Agriculturist 30(4): 317-319
Ogawa, Y and King, R. W 1994. Flowering in seedlings
of Pharbitis nil induced by benzyladenine applied
under a non-inductive day length Plant Cell
Physiology, 21: 1109-1116.
Pranav Rana, Jitendra, Kumar and Mukesh, Kumar
2005 Response of GA 3,
plant spacing and planting
depth on growth, flowering and corm production
in gladiolus. Journal of Ornamental Horticulture
(New Series) 8 (1): 41-44.
Rajesh, Bhalla and Ajay Kumar 2007. Response of
plant bio-regulators on dormancy breaking in
gladiolus Journal of Ornamental Horticulture
10 (4) : 215-221.
Ravidas, L., Rajeevan, P K and ValasalaKumari
1992.Effect of foliar application of growth
regulators on the growth, flowering and corm yield
of gladiolus cv. Friendship. South Indian
Horticulture 40(6): 329-335.
Sachs, R. M., Hackett W. P., Ramina A and Maloof.
C 1979. Photosynthetic assimilation and nutrient
diversion as controlling factors in flower initiation
in Bougainvillea (San Diego Red) and
NIcotianfatabacum cv. WIs.38 In :MArcelle R,
clysters H and Van Poucke M (eds).
Photosynthesis and plant development. Dr. W.
Junk, The Hague p. 95-102.
Sharma, H. G., Verma, L. S., Jain and Tiwary, B .L.
1995. Effect of foliar application of some plant
growth regulators on growth and flowering of
chrysanthemum var. Move-in-Carvin. Orissa
Journal of Horticulture 23(1-2): 61-64.
Singh, M. K., Parmar, A .S and Rathore, S. V. S
2002. Corm production in gladiolus as affected
by size of cormels and GA 3
application. In:
Floriculture Research Trend in India. Misra R L
and SanyatMisara (eds.). Proceedings of the
National Symposium on Indian Floriculture in the
New Millenium held during 25-27 th February, 2002
at Bangalore. pp. 246-248.
Tawar, R .V., Sable, A .S., Kakad, G. J., Hage, N D
and Ingle M B 2007. Effect of growth regulators
on corms and cormels production of gladiolus
(cv. Jester). Annals of Plant Physiology 21 (2):
257-258.
Umrao, V .K., Vishal, Sharma and Baldev, Kumar
2007. Influence of Gibberellic acid spraying on
gladiolus cv. rose delight. Progressive Agriculture
7 (1-2): 187-188
Vijai, Kumar and Singh, A. R 2008. Effect of GA 3
and
growing medium on growth, flowering and corm
production in gladiolus. Progressive Agriculture
8 (2) :, 165-168.
15

J.Res. ANGRAU 41(2) 16-20, 2013
PERFORMANCE OF DRUM SEEDER IN DIRECT SOWN PADDY UNDER
PUDDLED CONDITION
M.VISALAKSHI and A.SIREESHA
Regional Agricultural Research Station, Acharya N.G.Ranga Agricultural University, Anakapalli -531 001
Date of Receipt : 02.11.2012 Date of Acceptance : 10 .05.2013
ABSTRACT
Field experiments were conducted on direct sown paddy using eight-row drum seeder under puddled
condition in farmers fields of Vizianagaram district, Andhra Pradesh during Kharif season for three years from 2007-
2008 to 2009-2010 to evaluate the efficiency of drum seeder at different seed rates. (20, 30 and 40 kg ha -1 ) and
optimum seed rate was quantified. The results showed that use of drum seeder at 30 kg seed ha -1 recorded increased
grain yield by 26 and 22 per cent (7.58 t ha -1 ) respectively over that of 20 and 40 kg ha -1 seed rate. It was also found
superior to normal transplanting and broadcasting of sprouted seed @ 75 Kg ha -1 . Drum seeder technology at 30 kg
seed per ha reduced the seed rate by 45 kg ha -1 compared to broadcasting of seed on puddled soil and resulted in
higher returns to farmers over normal transplanting/ broadcasting of sprouted seed.
Transplanting is the most common method
of crop establishment in rice cultivation under low
land situation and is highly labour-intensive and
expensive operation. In contrast, broadcasting of seed
causes uneven plant stand, low yields and returns.
In Vizianagaram district, Andhra pradesh, the major
rice area is under tanks and success of crop depends
on rainfall received. In many years overaged
seedlings are planted due to delayed monsoon.
Further, transplanting is not profitable due to high
labour wages and problem of non-availability of labour
during peak period of operation (Singh et al.,2005).
Transplanting alone costs about 15% of total rice
production cost and delayed transplanting due to
labour shortage causes sustainable loss in yield
(Ponnuswamy et al.,1999). Therefore, there is need
of alternative methods to replace transplanting to
tackle the problems of high cost of production and
labour scarcity.
Direct sowing of sprouted seed in puddled
fields using drum seeder reduces the input costs
i.e.,cost of seed, nursery raising, transplanting and
it is a good method under late onset of monsoon .
The present study was conducted in farmers
fields to fine tune drum seeder technology with
different seed rates for its large scale adoption and
higher yields.
MATERIALS AND METHODS
The DAATT Centre,Vizianagaram introduced
8 row paddy drum seeder made of fibre supplied by
KSNM marketing, Coimbatore through AGROS
during kharif, 2007 in Vizianagaram dsitrict. On farm
trials were conducted during kharif season of 2007,
2008 and 2009 to demonstrate the performance of
drum seeder for direct sown paddy under puddled
condition. Five villages were selected to carry out
on-farm trials on purposive random sampling. These
five villages were considered as five replications. Two
hectares was allotted as a representative area for
testing the performance of drum seeder in farmers
fields with 5 treatments viz.,T 1
, farmer’s practice of
transplanting; T 2
, farmer’s practice of broadcasting
seed using 75 kg ha -1 ; T 3
,seeding sprouted seed @
20 kg seed ha -1 using drum seeder; T 4
, seeding
sprouted seed @ 30 kg seed ha -1 using drum seeder;
T 5
, seeding sprouted seed @ 4 0 kg seed ha -1 using
drum seeder . Seeding of nursery was also done on
the same day and 30 day old seedlings were
transplanted in T 1
and 75 kg ha -1 dry seed was
broadcasted in T 2
. In treatments T 3,
T 4
and T 5
,
sprouted seeds were sown at three seed rates using
drum seeder. For direct sowing using drum seeder,
the paddy seeds are soaked in water for 24 hours
followed by incubation in gunny bags for 24-48 hours
depending upon the rice variety and prevailing
temperature. The field was well puddled and levelled
after draining the standing water before sowing to
avoid damage of sprouted seed and to enable water
to spread uniformly over the field. After puddling, the
field is left for 1-2 days for settling of the puddled
soil. Using drum seeder, seed rate required for direct
email: visalamahanthi@yahoo.co.in
16

PERFORMANCE OF DRUM SEEDER IN DIRECT SOWN PADDY UNDER PUDDLED CONDITION
sowing of sprouted seed in pudlled fields was
calibrated by adjusting the drum holes for seed rate
at 20,30 and 40 ha -1 and optimum seed rate required
was quantified by studying the yield parameters. The
pre germinated seeds are sown in 8 rows with 20 cm
spacing using drum seeder. Weeds were kept under
check by operating cono weeder at 10 days after
sowing or by using pre emergence herbicide
oxadiargyl @ 90 g ha -1 with sand mixture at 7 days
after sowing. The field was kept moist and wet, no
standing water in the field upto 20 days after sowing.
Yield attributes and grain yield were recorded in each
treatment plot and the data was statistically analysed
in randomised block design. Cost of cultivation and
net returns of each treatment were calculated on the
prevailing cost of inputs and market prices.
RESULTS AND DISCUSSIONS
Yield parameters
On-Farm trial studies on performance of drum
seeder for direct sown paddy in puddled fields showed
hightest tillers per m 2 ,panicles per m 2 and filled grains
per panicle in T 4
(seeding sprouted seed @ 30 kg ha -
1
seed using drum seeder) followed by T 3
and T 5.
Direct seeding using drum seeder was significantly
higher over transplanting and broadcasting methods.
The lowest tillers per m 2 , panicles per m 2 and filled
grains per panicle were observed with farmer’s
practice of transplanting (Table1).The transplanted
rice matured 10-20 days later than the direct seeded
rice. The higher number of panicle per m 2 in direct
sowing with drum seeder was due to higher number
of mother plants per unit area. Early establishment
of seedlings in direct sown sprouted seed might be
the reason for higher tillers per m 2 than conventional
transplanting. Similar findings were reported by Halder
and Patra (2007).
Grain yield
Grain yield was significantly influenced by
sowing methods. Farmer’s practice of transplanting
(T 1
) recorded the lowest grain yield (Table 2). The
highest grain yield was observed with treatment T 4
(seeding sprouted seed @ 30 kg seed ha -1 using drum
seeder) followed by T 5
(seeding sprouted seed @ 40
kg seed ha -1 using drum seeder). Shekar and Singh
(1991) stated that direct sowing of sprouted seeds
under puddled condition results in significant
improvement in yield attributes and grain yield. Direct
sowing of paddy using drum seeder @ 30 kg ha -1
recorded higher grain yield (26.33 % and 22.45%)
over sowing of sprouted seed @ 20 kg ha -1 and 40
kg ha -1 . Seeding sprouted seed @ 30 kg seed ha -1
using drum seeder recorded higher grain yield
(44.93% and 35.35%) over T 2
(Farmer’s practice of
broadcasting sprouted seed @ 75 kg ha -1 ) and T 1
(Farmer’s practice of transplanting with seed rate @
75kg ha -1 ). Halder and Patra (2007) stated that
seeding of sprouted seeds with 8-row seeder after
puddling increased grain yield (21.5%) over farmer’s
practice of transplanting. Higher grain yield in T 4
was
due to higher panicles per m 2 and filled grains per
panicle. Seeding of spouted seed using drum seeder
@ 30 kg ha -1 and 40 kg ha -1 recorded significantly
higher grain yield than both farmer’s practice of
transplanting and farmer’s practice of broadcasting .
Similar trend was observed during all the three years
of study (Table 2).
Economics
Highest net return was recorded when
sprouted seed @ 30 kg ha -1 was sown using drum
seeder. This was due to higher grain yield and low
cost of cultivation observed in all the three years.
Farmer’s practice of transplanting recorded the lowest
net returns due to low grain yield and higher cost of
cultivation. Highest benefit - cost ratio was recorded
with seeding of sprouted seed @ 30 kg ha -1 using
drum seeder due to higher yield and low cost of
cultivation(Table 2). Farmer’s practice of
transplanting recorded the lowest net return due to
low grain yield. Similar findings were reported by
Halder and Patra (2007). Thus, rice cultivation by
seeding of sprouted seed @ 30 kg ha -1 using drum
seeder under puddled condition gave higher rice grain
yield than farmer’s practice of transplanting /
broadcasting using 75 kg seed ha -1 .
With the adoption of direct sowing in paddy
with sprouted seed @ 30 kg ha -1 using drum seeder,
the paddy farmers could earn a net income of
Rs.36,697/- per hectare compared to that of
conventional transplanting (Rs. 16,261/ha). These
trials conducted at farmer’s fields clearly established
the advantage of direct sowing of paddy using drum
seeder in puddled condition with 30 kg seed ha -1 over
conventional method of transplanting.
17

VISALAKSHI and SIREESHA
Table 1 . Growth, yield attributes and grain yield of rice as influenced by crop establishment methods under puddled conditions
18

PERFORMANCE OF DRUM SEEDER IN DIRECT SOWN PADDY UNDER PUDDLED CONDITION
Table 2 . Grain yield and economics of rice cultivation as influenced by crop establishment methods under puddled conditions
19

VISALAKSHI and SIREESHA
REFERENCES
Halder, J and Patra, A.K. 2007 . Performance of
eight-row drum seeder in direct seeded rice Oryza
sativa under puddled condition. Indian Journal
of Agricultural Sciences. 77(12): 819-23.
Ponnuswamy, K., Santhi, P., Kempu Chetty, N and
Subramaniam, M. 1999. Effect of various
methods of establishment on growth and yield
of rice. Oryza.36(3): 294-5.
Shekar, J and Singh C.M. 1991. Influence of methods
and dates of stand establishment on growth
and yield of rice. Oryza. 28 : 45-48.
Singh, G., Singh, R. G., Singh, O. P.,Kumar, T.,
Mehta, R. K., Kumar, V and Singh, P. P.
2005. Effect of weed management practices on
direct seeded rice Oryza sativa under puddled
low lands. Indian Journal of agronomy. 50(1):
35-7.
20

J.Res. ANGRAU 41(2) 21-25, 2013
EFFECT OF GRADED LEVELS AND TIME OF NITROGEN APPLICATION ON
NUTRIENT UPTAKE, YIELD AND ECONOMICS OF SEMI-DRY RICE
Oryza sativa L.
K. JHANSI LAKSHMI BAI, K.V. RAMANA MURTHY and M.VENKU NAIDU
Department of Agronomy, Agricultural College,
Acharya N.G. Ranga Agricultural University, Naira-532185
Date of Receipt : 21.12.2012 Date of Acceptance : 28.03.2013
ABSTRACT
An investigation was conducted during Kharif 2011 at Agricultural College Farm, Naira to study the response
of semi-dry rice to nitrogen levels and its time of application on nutrient uptake, yield and economics of semi-dry rice.
The experiment was laid out in split-plot design with three replications. Treatments included four rates of nitrogen
application (60, 80,100 and 120 kg/ha) as main plot treatments and five varied timings of nitrogen application [(S!+
S! + S!), (¼+ ¼ + ¼ + ¼), (¼+ ½ + ¼), (¼+ ¼ + ¼ + ¼) at basal, active tillering/ conversion to wet, panicle initiation and
flowering and Leaf Colour Chart (LCC) based application] as sub plot treatments. Application of 120 kg N ha -1
resulted in the highest yield and nutrient uptake as well as higher monetary returns and was significantly superior
to other graded levels of nitrogen. With respect to the time of application, highest nutrient uptake, yield and returns
were recorded at harvesting stage with application of nitrogen in four splits ¼ each at basal, conversion to wet,
panicle initiation and flowering leading to higher productivity.
In India, rice is the principal food crop grown
in an area of 42.2 m.ha with a production 95.9 m.t
and productivity of 2.24 t ha -1 . In Andhra Pradesh, it
is grown in an area of 4.56 m.ha with a production of
7.51 m.t and productivity of 3.02 t ha -1 (Ministry of
Agriculture, 2010-2011). Semi-dry system
successfully exploits the pre monsoon showers
ensuring high water use efficiency and often confronts
moisture stress due to inadequate and ill distributed
rainfall leading to low productivity (Mohanasarida and
Jose Mathew, 2005). Dry seeding with early showers
has been found to produce similar grain yield as that
of transplanting with aged seedlings (Reddy and
Krishna, 1998). Specific management practices like
optimum dose and time of nitrogen application are
required to obtain good yields under semi-dry system.
The area under semi-dry rice is increasing
rapidly due to scarcity of labour in the North Coastal
districts of Andhra Pradesh. At present, the nitrogen
management recommended and adopted for semidry
rice is similar to that of conventionally grown
lowland rice. Improvement in nitrogen management
can be achieved only by planning strategies
responsive to the requirement and temporal variations
in crop nitrogen demand specific to the growing
environment and location. Hence, the present
investigation was taken up to evolve an efficient
nitrogen management strategy for semi-dry rice.
MATERIALS AND METHODS
A field experiment was conducted during
Kharif 2011, at the Agricultural College Farm, Naira
(18.24 0 N latitude, 83.84 0 E longitudes and at an
altitude of 27 m above mean sea level) in semi dry
rice with variety Vasundhara (RGL-2538). The soil of
the experimental field was sandy clay loam in texture,
low in organic carbon (0.31%) and available nitrogen
(180 kg ha -1 ), medium in available phosphorous (52
kg ha -1 ) and potassium (256 kg ha -1 ). Under average
climatic conditions, the area receives 482.9 mm of
total annual rainfall. The mean monthly temperatures
during the rice growing seasons varied from 25 0 C to
34 0 C.
The experiment was laid out in split-plot
design with three replications. Treatments mainly
comprised of four graded levels of nitrogen N 1
(60
kg N ha -1 ), N 2
(80 kg N ha -1 ), N 3
(100 kg N ha -1 ), N 4
(120 kg N ha -1 )] assigned to main plots and five varied
timings of nitrogen application [T 1
(S! at basal + S!
at active tillering + S! at panicle initiation), T 2
(¼ at
basal + ¼ at active tillering + ¼ at panicle initiation +
¼ at flowering), T 3
(¼ at basal + ½ at active tillering +
¼ at panicle initiation), T 4
(¼ at basal + ¼ at
conversion to wet + ¼ at panicle initiation + ¼ at
flowering), T 5
Leaf Colour Chart(LCC) based
application] allotted to sub plots. Nitrogen was
email: ramanaagro16@gmail.com
21

JHANSI et al
applied in splits as per the treatments except in T 4
where the first top dressing of nitrogen was applied
when the system was converted to wet. As per the
standard procedure for applying nitrogen based on
LCC (T 5
) in rice, first application of nitrogen (S! of the
nitrogen dose) was given at 21 DAS. Thereafter, the
observations were made at every 7 days and the top
dressing was scheduled whenever the colour of the
youngest fully expanded leaf fell below critical value
4 of the LCC. Accordingly, the top dressing of S! of
total nitrogen dose was at 54 DAS for all the nitrogen
levels and the remaining S! of the total nitrogen was
applied at 81 DAS for (N 1
) and (N 2
) and at 91 DAS for
(N 3
) and (N 4
). A fertilizer dose of 60 kg P 2
O 5
& 50 kg
K 2
O ha -1 was applied uniformly to all plots. Entire
phosphorous was applied as basal and potassium
was applied in two split doses i.e. T! at basal and S!
at panicle initiation stage. Crop was sown by adopting
a spacing of 20 cm × 10 cm. Nitrogen, phosphorus
and potassium content in plant samples was analysed
by adopting standard procedures as detailed by
Tandon (1993). The data recorded on various
parameters were analyzed following standard
statistical analysis of variance technique suggested
by Panse and Sukhatme (1978).
RESULTS AND DISCUSSION
At all the crop growth stages of observation
the uptake of nitrogen, phosphorous and potassium
were highest with the supply of nitrogen at 120 kg
ha -1 which was significantly superior to other nitrogen
levels tried (Table 1). The lowest uptake of all the
three nutrients was seen at the lower level of nitrogen
(60 kg ha -1 ) compared to that of at higher levels. The
increase in nitrogen uptake at higher levels may be
ascribed to the fact that plant absorbed nitrogen
proportionately as the pool of available nitrogen
improved in soil by the addition of higher amount of
nitrogen. Similar findings were reported by Sudhakar
et al. (2003), Dhurandher and Tripathi (1999) and
Lakpale et al. (1999).
At active tillering stage, Leaf Colour Chart
based nitrogen application recorded highest nutrient
uptake and was significantly superior to rest of the
nitrogen application timings (Table 1).Application of
nitrogen in four splits viz., ¼ each at basal, AT, PI
and flowering ; ¼ each at basal, conversion to wet,
PI and flowering and application of nitrogen in three
splits viz., ¼ at basal + ½ at AT + ¼ at PI were in
parity with each other. At panicle initiation stage,
highest uptake of nitrogen, phosphorous and
potassium were observed with application of nitrogen
in three splits ¼ at basal + ½ at AT + ¼ at PI which
was comparable with LCC based nitrogen application
and both of them were significantly superior to other
timings of nitrogen application. At flowering stage,
the highest nutrient uptake was obtained with
application of nitrogen in three splits S! each at basal,
AT and PI. However it was comparable to that of
nitrogen application in three splits ¼ at basal + ½ at
AT + ¼ at PI and LCC based nitrogen application
and was significantly superior to rest of the timing
of nitrogen application studied.
At crop harvest, application of nitrogen in
four splits ¼ each at basal, conversion to wet, PI
and flowering recorded highest uptake of
phosphorous, potassium and nitrogen by grain as well
as straw and was comparable with LCC based
nitrogen application and nitrogen application in four
splits ¼ each at basal, AT, PI and flowering. All
these were significantly superior to the rest of the
timings of nitrogen application. This might be due to
the improved root system and their foraging ability
which improved the nitrogen absorption. Application
of nitrogen in three splits S! each at basal, AT and
PI, recorded significantly higher uptake of
phosphorous, potassium and nitrogen by grain +
straw than nitrogen application in three splits ¼ at
basal + ½ at AT + ¼ at PI, which recorded the lowest
nutrient uptake.
Application of 120 kg N ha -1 gave highest
grain and straw yield as well as the monetary returns
and was significantly superior to other nitrogen levels
tested (Table 2). This was followed by application of
nitrogen at 100 kg ha -1 which was however,
comparable to that of 80 kg N ha -1 . The lowest grain
yield was registered with the supply of nitrogen at 60
kg ha -1 . Grain yield, straw yield and economic returns
were the highest with application of nitrogen in four
splits of ¼ each at basal, conversion to wet, panicle
initiation and flowering, which were on par with that
of LCC based application and as well as supply of
nitrogen in four splits ¼ each at basal, active tillering,
panicle initiation and flowering stages. Application
of nitrogen each at basal, active tillering and panicle
22

EFFECT OF GRADED LEVELS AND TIME OF NITROGEN APPLICATION
Table 1. Effect of graded levels and time of nitrogen application on nutrient uptake (kg ha -1 ) of semi-dry rice
23

JHANSI et al
Table 2. Effect of graded levels and time of nitrogen application on yield and economics of semi-dry
rice
Nitrogen levels
Grain yield
(kg ha -1 )
Straw yield
(kg ha -1 )
Gross returns
(Rs ha -1 )
Net returns
(Rs ha -1 )
B:C ratio
N 1 - 60 kg N ha -1 3734 5130 39903 23042 1.37
N 2 - 80 kg N ha -1 4275 5825 45682 28582 1.67
N 3 - 100 kg N ha -1 4400 6030 47014 29674 1.71
N 4 - 120 kg N ha -1 4695 6454 50175 32585 1.85
SEm ± 80.42 111.12 855.34 593.99 0.04
CD at 5% 278 384 2960 2055 0.12
CV (%) 7.28 7.34 7.25 8.08 8.15
Time of nitrogen application
T 1 - ⅓ at basal + ⅓ AT+ ⅓ PI 4063 5573 43418 26316 1.54
T 2 - ¼ at basal + ¼ AT + ¼ PI
+ ¼ flowering
4413 6062 47165 29763 1.73
T 3 - ¼ at basal + ½ AT + ¼ PI 3769 5178 40279 23176 1.35
T 4 - ¼ at basal + ¼ at
conversion to wet + ¼ PI + ¼
at flowering
4649 6375 49680 32278 1.85
T 5 - LCC based application 4484 6109 47924 30822 1.80
SEm ± _ 97.89 131.84 1045.21 975.68 0.05
CD at 5% 282 380 3011 2810 0.14
CV (%) 7.93 7.79 7.92 11.87 9.91
initiation produced significantly higher grain and straw
yield as well as economic returns than application of
nitrogen in three splits ¼ at basal + ½ at active tillering
+ ¼ at panicle initiation(Table 2). As yield is a
manifestation of the individual yield components, in
this case also the nitrogen dose and time of
application at critical stages resulted in highest grain
yield which in turn was due to the highest number of
panicles m -2 , number of filled grains panicle -1 and
thousand grain weight coupled with higher nitrogen
uptake and efficient translocation to sink. Similar
results were noticed by various researchers viz.,
Kayam Singh and Tripathi (2007) and Sudhakar et
al. (2003).
REFERENCES
Dhurandher, R. L and Tripathi, R. S. 1999.
Productivity of medium duration rice cultivar
under different sowing methods and nitrogen
levels. Agriculture Science Digest. 19 (3): 267-
271.
Kayam Singh and Tripathi, H. P. 2007. Effect of
nitrogen and weed-control practices on
performance of irrigated direct-seeded rice Oryza
sativa. Indian Journal of Agronomy. 52 (3): 231-
234.
24

EFFECT OF GRADED LEVELS AND TIME OF NITROGEN APPLICATION
Lakpale, R., Pandey, N and Tripathi, R. S. 1999.
Effect of levels of nitrogen and forms of preconditioned
urea on grain yield and N status in
plant and soil of rainfed rice Oryza sativa. Indian
Journal of Agronomy. 44 (1): 89-93.
Mohanasarida, K and Jose Mathew. 2005. Effect of
seed hardening on growth and yield attributes
and yield of semi-dry rice. Research on crops. 6
(1): 26-28.
Ministry of Agriculture, Government of India. 2010-
2011. http:// www.indiastat.com.
Panse, V. G and Sukhatme, P.V. 1978. Statistical
methods for agricultural workers. Indian Council
of Agricultural Research, New Delhi, pp. 361.
Reddy, M. D and Krishna, V. G. 1998. Studies on
crop establishment under different rice cultural
situations. Journal of Research ANGRAU. 26 (1):
66-68.
Sudhakar, G., Solomalai, A and Ravisankar, N. 2003.
Influence of cultivars and levels of nitrogen on
yield, nutrient uptake and residual nutrient status
of soil in semi – dry rice. Agriculture Science
Digest. 23 (2): 88-91.
Tandon, H. L. S. 1993. Methods of analysis of soils,
plants, waters and fertilizers. Fertilizers
Development and Consultation Organization,
New Delhi, India.pp:143
25

J.Res. ANGRAU 41(2) 26-32, 2013
ASSESSMENT OF GENETIC DIVERSITY IN Capsicum spp. BY USING
MORPHOLOGICAL AND MOLECULAR TOOLS
S. JOSHI, C. SARMA, C. JANGID AND H.V. VIJAYAKUMARSWAMY
Department of Plant Biotechnology, University of Agricultural Sciences, Bengaluru - 560065
Date of Receipt : 22.12.2013 Date of Acceptance : 16.03.2013
ABSTRACT
Chilli belongs to the genus Capsicum which possess enormous wealth of genetic diversity. Extent of
genetic diversity determines the success level of crop improvement programme. In the present study, genotypes
were taken from different eco-geographical regions to assess genetic diversity and variability at both morphological
and molecular level. For morphological characterization different yield attributing characters were studied. For
estimation of D2 values GENRES software was used and it was found that all the exotic genotypes and genotypes
from northern part of India clustered together while, two genotypes of southern part of India fell into separate cluster.
Genetic diversity was also estimated at molecular level with the help of capsicum specific SSR markers, Genotype
EC 362980 which belongs to Capsicum chinese and EC 121489 which belongs to Capsicum baccatum were far
apart in dendrogram which showed they were less relative to each other during course of evolution. However, the
remaining genotypes which belongs to Capsicum annum came in between those two species which showed they
might have originated from Capsicum chinense and Capsicum baccatum.
Capsicum is one of the most important spices
cum vegetable crops grown in India. It belongs to
family Solanaceae comprising twenty to thirty species
of new world tropic and subtropics. Modern
taxonomists recognize five major cultivated species
of hot pepper and mild types as Capsicum annum,
Capsicum fruitescense L., Capsicum chinense
jacquin, Capsicum pendulum Wildenow and Capsicum
pubescens Ruig and Pavon (Pickersgill, 1997). Chilli
valued for its characteristic pungency, color and
flavor, besides being rich source of vitamins viz. A,
C and E. India is the largest producer of chilli in the
world (Singh, 2007). An important way to increase
productivity in any crop plant is to first select
desirable genotypes from among the existing
variations and use them in the breeding programmes.
The extent of initial variability/genetic diversity
determines the level of success of crop improvement
programmes. Diversity based on morphological
marker has limitations because of their small number,
while diversity at biochemical level is stage
depending. Molecular markers has an advantage over
these limitations. However, the present study has
been designed to use both morphological and
molecular markers to study diversity among
Capsicum germplasm.
MATERIALS AND METHODS
The experimental material consists of
nineteen cultivars (Table.1) which were sown in poly
bags inside greenhouse and then transplanted to the
main field of Department of Plant Biotechnology, UAS-
GKVK, Bangalore at 30 DAS during Kharif 2010 and
molecular analysis with Capsicum specific primers
were carried out further. Genotypes were evaluated
for eight morphological characters i.e. plant height
(cm), days to 1st flowering, days to 50% flowering,
days to fruit maturity, seed weight (g), fruit length
(cm), fruit weight (g) and number of seeds per plant.
The layout of the experiment was Randomized Block
Design (RBD) with three replications. The mean
values of five randomly selected plants from each
replication were used for data analysis, range, GCV,
PCV, heritability and expected genetic advance as
percent of mean were analyzed. Morphological
diversity among the selected genotypes was
assessed with the help of GENRES software.
A total of twenty-five SSR markers which
are distributed across the genome used for
polymorphism studies (Table 2). For PCR reaction,
20l reaction mixture containing template DNA 2.0l
(20ng/l), 2.0l of both forward and reverse primer
respectively (5 pm/l). 0.20l Taq DNA polymerase
email: shourabhforbt@gmail.com
26

ASSESSMENT OF GENETIC DIVERSITY IN Capsicum spp.
(1U), 2.0l of dNTPs (1mM) and 2.0l of 10X PCR
buffer and remaining sterile water were used. The
bands were manually scored as ‘1’ for the presence
and ‘O’ for the absence and the binary data was used
for statistical analysis. This band data was subjected
to cluster analysis using STATISTICAL software. A
dendrogram was constructed by un-weighted pairgroup
arithmetic mean (UPGMA). The dissimilarity
martrix was developed using Squared Euclidean
Distance (SED), which estimated all the pair wise
differences in the amplification product. Only clear
and unambigous bands were taken into account and
the bands were not scored if they were faint or
diffused, as such fragments possess poor
reproducibility.
RESULTS AND DISCUSSION
All the eight characters under study varied
significantly among nineteen cultivars (Table 3). Plant
height for each cultivar was recorded when first fruit
had begun to ripen in 50 percent of the plants and
significant differences were observed among the
cultivars studied. The maximum plant height was
recorded with the line IC 361897 (45 cm) followed by
IC 397238 (44), while the minimum was recorded with
EC 362928 (32 cm) (Table 4). Significant differences
were observed for days to 50 percent flowering.
Among the cultivars studied IC 119275 (56) took
maximum days while, the line EC 382049 (45) took
minimum number of days to 50 percent flowering.
Considerable differences were observed for days
taken to fruit maturity. Arka suphal, took maximum
(97) days, while EC 362928 took minimum (70)
number to days for fruit maturity. Significant variance
indicated the role of non additive gene action in the
inheritance of all traits.
Fruit weight was highest in IC 119234 (31 g)
and least was in EC 362928 (9 g). Highest 10000
seed weight was recorded in cultivar Arka Suphal (6
g) followed by line IC 361897 (6 g) and lowest seed
weight was recorded in EC 121489 (3 g). Highest
number of seeds per fruit was recorded in line IC
119230 (90) and it was lowest in line IC 381108 (28).
All genotypes displayed considerable amount of
difference in their mean performance with respect to
all eight characters studied. This has also been
exemplified by significant values of mean sum of
square for these traits, which indicated that the lines
under study were genetically diverse.
The phenotypic variance was higher than
genotypic variance for all the characters. Phenotypic
coefficient of variation ranged form 10.06 (days taken
to maturity) to 36.04 (fruit weight). Genotypic
coefficient of variation ranged from 8.28 (days taken
to 50% flowering) to 32.04 (fruit weight). The
estimates of heritability ranged from 37.18 percent
(days taken to 50% flowering) to 98.75 percent (seed
weight). Genetic advance expressed as percentage
over mean ranged from 10.40 per cent (days to 50
percent flowering) to 58.66 percent (fruit weight).
Along with the variability information, genotypic and
phenotypic coefficient of variations and genetic
advance mean is much more essential because these
are more reliable for effective selection. The
phenotypic coefficient of variation (PVC) was higher
than genotypic coefficient of variation (GCV) for all
characters under study which suggest that these
traits studied had low environmental influence. Patel
et. al., 2004 and Kumar et. al, 2007 made similar
observations in their study in chilli. High values of
GCV and PCV were obtained for fruit length (cm),
fruit weight and seeds weight, indicating that variation
for these characters contributes markedly to the total
variability. Heritability value indicates only the
magnitude of inheritance of quantitative character
while genetic advance helps in deciding the selection
procedure to be adopted. However, in the present
study the high heritability along with high value of
genetic advance coupled with medium to high percent
mean of genotypic variance for characters i.e. seed
weight, fruit length (cm), fruit weight and number of
seeds per fruit are of great value for selection as
they are more likely to be controlled by additive gene
effect.
Based on D2 analysis nineteen genotypes
were grouped into two clusters. Among the clusters,
cluster-I was the largest with seventeen genotypes
and cluster-II contain only two genotypes (Arka
Suphal and Arka Lohit). The intra cluster distance in
cluster I was 14.68 and cluster II was 21.83. While,
the inter cluster distance between cluster-I and
cluster- II is 19.89.
Twenty- Five microstatillite primers were
used to amplify the repeated regions in the chilli
samples. Out of twenty five primes, all the primers
were successfully amplified. The dendrogram was
constructed by un-weighted pair-group arithmetic
27

JOSHI et al
mean (UPGMA). The dissimilarity martix was
developed using Squared Euclidean Distance (SED,
which estimated all the pair wise differences in the
amplification product. In the present study
dendrogram was generated for nineteen chilli
genotypes based on similarity coefficient. Based on
the simple matching coefficient, a similarity matrix
was constructed using SSR data to assess the
genetic relatedness among chilli genotypes. The
genotypes were grouped into two major clusters,
cluster I and cluster II containing five and fourteen
genotypes respectively. Cluster I includes line IC
119275, IC 397541, IC 397238 and Arka Suphal which
belongs to Capsicum annum species along with line
EC 362928 which belong to Capsicum chinense
species. All the remaining genotypes were grouped
into cluster II of which only the line EC 121489 belongs
to Capsicum bacctum species and the rest were of
Capsicum annum species.
To sustain high production and productivity
of chilli, a large number of high yielding varieties and
hybrids have been developed as a result of intensive
improvement programmes. In spite of these efforts,
the importance of local cultivars cannot be
underestimated as these are selected and
domesticated over a period of time and sometimes
across generations by the farmers for their adaptation
to different climatic conditions, superior quality,
resistance to biotic and abiotic stresses, medicinal
properties and high yield, Hence, these need to be
preserved and utilizied in crop improvement. It is also
suggested that as the molecular markets are not
affected by environment, they are reliable and rapid
means to assess genetic diversity and to identify
diverse genotypes among the population they have
immense potential in the field o f molecular breeding
for crop improvement.
Table 1. LIST OF GENOTYPES USED IN PRESENT STUDY
Sr.
no.
Botanical name
Identification
number
Origin/
source
1. Capsicum chinense EC 362928 USA
2. Capsicum annum EC 382049 USA
3. Capsicum annum IC 119220 NAR
4. Capsicum annum IC 119222 NAR
5. Capsicum annum IC 119228 NAR
6. Capsicum annum IC 119230 NAR
7. Capsicum annum IC 119232 NAR
8. Capsicum annum IC 119233 NAR
9. Capsicum annum IC 119234 NAR
10. Capsicum annum IC 119221 NAR
11. Capsicum bacctum EC 121489 NL
12. Capsicum annum IC 383136 NAR
13. Capsicum annum IC 119275 NAR
14. Capsicum annum IC 381108 NAR
15. Capsicum annum IC 361897 NAR
16. Capsicum annum IC 397541 NAR
17. Capsicum annum IC 397238 NAR
18. Capsicum annum Arka suphal IIHR
19. Capsicum annum Arka lohit IIHR
*NL: NETHERLAND
*NAR: NBPGR SATELLITE CENTRE, AMRAVATI.
*IIHR: INDIAN INSTITUTE OF HORTICULTRAL RESEASRCH
28

ASSESSMENT OF GENETIC DIVERSITY IN Capsicum spp.
Fig 1. Dendrogram of diversity of nineteen chilli genotypes revealed by SSR loci
Fig 2. SSR gel profile of chilli genotypes with the primer EPMS-683 primer ladder used was 100 bp
Lanes 1 to 19 indicate amplification of DNA of individual genotypes (order as given in Table 1)
ACKNOWLEDGMENT
We are grateful to the Department of Biotechnology (DBT-New Delhi) for providing the fellowship to
the first author and special thanks to the Head of the Department of Biotechnology, UAS-GKVK, Bangalore,
for providing the greenhouse main field and all other infrastructure facilities to carry out the research.
29

JOSHI et al
Table 2. Sequence of twenty-five SSR primer used for molecular characterization
Name Forward primer Reverse primer
EPMS-596 5’CTCGTGCCGTATTTCTGTCA3’ 5’AAGGGCGTGTTTGGTATGAA 3’
EPMS-600 5’ATGGGTACGTGTTTGGGGTA3’ 5’ACTTTATTCCTCGTGCCGAA3’
EPMS-601 5’AAATTGAGAACATCGGTGCC3’ 5’TAAAGAAAGAGCCTCGTGCC3’
EPMS-603 5’GCGGTTCCCTATTTGAAGAA3’ 5’ATAGGGGGAATTGGGTTCC3’
EPMS-628 5’TGCTCCTTAAGACTGGCACC3’ 5’GGGTTCGGCTCTGTTATTGA3’
EPMS-629 5’GCTCGAGGGAGAGAGACTGT3’ 5’GGTCATATGTTTCCATGGGC3’
EPMS-642 5’CAACTTCGCGTTATTGTCCA3’ 5’AGGGCGGACAAAGAAGATTT3’
EPMS-643 5’CCAAGATCAACTCTTACGCTAT3’ 5’CCCCTCAAGAATTCCCTCCAT3’
EPMS-648 5’TGTAAAATAAAATAAGGCTAAAGGCA3’ 5’CAAGAAAGTGTGCCCCAAAT3’
EPMS-649 5’AAGGGTTCTCGAGGAAATGC3’ 5’TCAATCCCAAAACCATGTGA3’
EPMS-650 5’CATGGGTGAGGGTACATGGT3’ 5’AGAGGGAAGGGTTATTTGCC3’
EPMS-654 5’TTCCACTCTTCGAAGCACCT3’ 5’GGTAGGGTTTAACACCGCCT3’
EPMS-658 5’CCTTGAGTAGGCGCACAAAT3’ 5’TTCCTCATTGCTTTTCCCAC3’
EPMS-670 5’TCACAAAGATGGAGAAGGGAA3’ 5’CAATCACTGTCACTGCTACTGCT3’
EPMS-683 5’AAATGGATCCCAACAACCAA3’ 5’GGAGTTGAAAACGGTGGAGA 3’
EPMS-697 5’ATGTCGCTCGCAATTTCACT3’ 5’CGTAGGGAGGAGCGATAGAG3’
EPMS-704 5’GGTCCTCTGATTGGCAACAT3’ 5’GACCTGAAATTGGAGCAAACA3’
EPMS-705 5’TCAACTAGATCCACCACGCA3’ 5’TAACCCGTTGCTCACACTCA3’
EPMS-725 5’TTGAATCGTTGAAGCCCATT3’ 5’ATCTGAAGCTGGGCTCCTTT3’
EPMS-745 5’GTTGTTGGGTGGTACTTGGG3’ 5’GGAAGATCTCAAATGGGTCG3’
EPMS-747 5’CATTGGACGGTTGGTTCTCT3’ 5’TGGAATTGGAACTTCAAGCA3’
EPMS-755 5’CGCTCGCTACCCTTTCATTA3’ 5’AATTTCGGAAGGGCAAAGAT3’
EPMS-762 5’CGGCGAGATATGGACTTGAT3’ 5’CCCACGTTATACCATCCAGG3’
30

ASSESSMENT OF GENETIC DIVERSITY IN Capsicum spp.
Table 3. Range, genotypic variability (GV), phenotypic variability (PV), genotypic coefficient of variation(GCV), phenotypic coefficient of variation(PCV),
heritability (h 2 ) and genetic advance (GA) for growth and yield quality parameters in nineteen genotypes of Capsicum
31

JOSHI et al
Table .4 Mean performance of chilli genotypes for different characters
REFERENCES
Kumar, L.R., Sridevi, O and Salimath, P.M. 2007. Combining ability studies in
chilli. Journal of Asian Horticulture. 3(3):141-147.
Patel, J.A., Pate, M.J., Acharya. R.R., Bhanvadia, A.S and Bhalala, M.K.
2004. Hybrid vigour, gene action and combining ability in chilli ( Capsicum
annum L.) Hybrids involving male sterile lines. Indian Journal of
Genetics. 64(1):81-82.
Pickersgill, B 1997. Genetic resources and breeding of Capsicum spp.
Euphytica 96: 1239-133.
Singh, A.K., Singh, M., Singh, R., Kumar, S and Kalloo, G.K. 2007. Genetic
diversity within the genus solanum (Solanaceae) as revealed by
RAPD markers. Current Science. 90(5): 121-128.
32

J.Res. ANGRAU 41(2) 33-41, 2013
ESTIMATION OF HETEROSIS FOR YIELD AND ITS ATTRIBUTING CHARACTERS
AND STUDY OF INTRA-SPIKELET COMPETITION FOR SEED SIZE IN FINGER
MILLET Eleusine coracana L.
PARASHURAM PATROTI and JAYARAME GOWDA
All India Coordinated Small Millets Improvement Project (AICSMIP),
ICAR, University of Agricultural Sciences, GKVK, Bangalore-560 065.
Date of Receipt : 18.01.2013 Date of Acceptance : 08.03.2013
ABSTRACT
An investigation was carried out at Zonal Agricultural Research Station, University of Agricultural Sciences,
Gandhi Krishi Vignana Kendra, Bengaluru during 2009-10 to estimate the extent of heterosis in hybrids and to
explore intra-spikelet competition for seed size in finger millet in two separate experiments. Heterosis for yield and
yield attributing characters were studied for the hybrids synthesized through Line x Tester mating design using four
lines and four testers. Among 16 hybrids developed, percent heterosis over mid parent and better parent was
negatively significant in most of the hybrids, suggesting the involvement of dominant gene action with negative
effects. The hybrid GE 4596 x L 5 and GE 4596 x GPU 69 had significant and superior per se performance for grain
yield per plant, straw yield per plant, finger length, peduncle length, number of fingers per ear, culm thickness and
number of productive tillers per plant. The five hybrids viz., GE 4596 x L 5, GE 4596 x GE 5095, GPU 28 x L 5, GPU
28 x GE 5095 and GE 4906 x GE 5095 showed significant heterosis for most of the traits over their parents. Three
promising varieties viz., HR 911, PR 202 and GPU 28 were included to know the intra-spikelet competition for seed
size. The results indicated that there was no significant difference in 1000 grain weight, collected from different
position of florets within a spikelet at different positions of spike, suggesting that there was no intra spikelet competition
for seed size under normal environmental conditions and the varieties need to be tested under moisture stress
environment.
Finger millet Eleusine coracana L. Geartn.
ranks first both in area and production among the
‘Nutricereals’ occupying 2.00 m.ha in India with the
highest productivity in the state of Karnataka
(AICSMIP, 2005). Its nature of low input requirement
in terms of labour, technology, costs and high drought
resistance and long storage life makes it a pro-poor
and marginal farmers’ crop. The seeds can be stored
safely for as long as 50 years without pest infestation,
which makes it a traditional component of farmers’
risk mitigation strategies in drought prone regions
(AICSMIP, 2007). It is highly valued as a reserve
food in times of famine. Despite all these merits, this
crop has been neglected from the main stream of
crop improvement programme.
Finger millet being a food crop, yield
improvement is the major goal. Information on
different traits of interest, especially their genetic
control is a prerequisite for planning the genetic
improvement strategies. Finger millet is a highly self
pollinated crop and hybridization in this crop is
restricted due to the small flower size which makes
emasculation a difficult task. In recent years, in spite
of persistent efforts, the newly evolved varieties are
not showing much yield advantage over the varieties
bred and released in earlier years. The efforts made
by Ravikumar et al. (1986) and Gurunathan (2006) in
finger millet, Srivatsav and Yadav (1977) in little millet,
Konstantinov and Linnik (1985), Kolyagin and
Garbatenko (1986) and Ramesh (1990) in proso millet
opens the way and scope for the exploitation of hybrid
vigour in minor millets. Keeping this in view in the
present investigation an effort was made to estimate
the heterosis in finger millet hybrids.
In any crop improvement programme,
breeding for uniform seed size is one of the objectives
and grains of uniform seed size will be preferred while
marketing. But many studies indicated that there is
a variation in seed size in most of the crops while
harvesting. Whether this is true for finger millet also,
is the question. So, in this regard an effort was also
made to know, whether there is any competition
between two florets for photosynthates during
physiological maturity which leads to variation in seed
size or the variation is due to environmental factors.
email: parashu.patroti@rediffmail.com
33

PARASHURAM and JAYARAME
MATERIALS AND METHODS
Heterosis for yield and its attributing traits
Four lines were crossed to four testers in a
line x tester mating design (Kempthorne, 1957) in
kharif-2009, to generate hybrids by following hot water
treatment (Rao and Rao, 1962) for emasculation then
contact method for crossing (Ayyangar and Warrior,
1934). Crossed seeds along with their parents were
sown in nursery during rabi-2009. The hybrids were
first identified in the nursery using purple plant
pigmentation as marker. All the eight parents (4 lines
and 4 testers) together with 16 crosses were evaluated
during rabi-2009. The material was grown in a single
row of 3 m length with a spacing of 30 x 10 cm in a
randomized block design and replicated twice. The
data were recorded on plant height, number of fingers
per ear, number of productive tillers per plant, finger
length, finger width, culm width, peduncle length,
days to 50 per cent flowering, days to maturity, straw
yield per plant, grain yield per plant and test weight
on five randomly selected plants. The analysis of
Randomised Block Design was carried out based on
the methods described by Panse and Sukhatme
(1967) and significance of heterosis was tested using
simple‘t’ test at five per cent and one per cent level
of significance. The magnitude of heterosis was
estimated over mid parent and better parent (Singh
and Chaudhary, 1985).
Intra Spikelet Competition for Seed Size
The material for this study comprised of
mature spike/fingers of three varieties viz., HR 911,
PR 2O2 and GPU 28. These varieties were grown
both in field and pots in green house. Each spike
was divided into three portions. The florets from 1/3 rd
position of top, 1/3 rd of middle and 1/3 rd of bottom
position of spike of each variety were taken
separately. Approximately 100 spikelets from each
portion were selected in all three varieties. In each
finger there are about 70 spikelets, each spikelet
having five to seven complete flowers. However, the
experimental varieties having six florets from each
spikelet from top to bottom of the spike. The positions
of florets in each spikelet were numbered (only six
florets hence numbered from one to six) and the
seeds of particular position were taken out which were
numbered from one to six to a particular bowl which
were also numbered as one to six. Thousand grain
weights of separately collected floret wise seeds of
three different positions was weighed and compared.
Analysis of variance for three factorial Completely
Randomized Design for floret wise seed weight of
three portions of three different varieties was
constructed. The varieties were considered as main
factors. Sub factors were portions (3), because each
variety has been divided into three portions and subsub
factors were 6, because each spikelet consists
of six florets, for which competition between florets
was studied.
RESULTS AND DISCUSSION
Heterosis for yield and related traits
The analysis of variance revealed significant
differences among the parents as well as crosses
for all the traits. Higher level of significance in the
variance of parents vs hybrids for all the characters
clearly indicated the existence of significant level of
average heterosis in the hybrids (Table 2). Non
additive gene action was noticed for all the characters
studied. The results support the findings of
Tamilcovane (1994), Madhusudhan et al. (1995) and
Patel (1994).
Among 16 hybrids developed, per cent
heterosis over mid parent and better parent was
negatively significant in most of the hybrids except
in crosses, GE 6216 x GPU 69 and GE 6216 x GE
5095 for days to 50 per cent flowering and except
GE 6216 x GPU 69 and GE 4906 x GE 5095 for days
to maturity suggesting the involvement of dominant
gene action with negative effects (Table 3). The earlier
reports suggest that early types can be obtained from
crosses which record negative heterosis. Similar
results were obtained by Konstantinov and Linnik
(1985) and Ramesh (1990) in proso millet. Significant
level of heterosis over mid parent and better parent
have been observed for the characters like plant
height, number of productive tillers per plant, straw
yield per plant and grain yield per plant.
From this study, it can be concluded that
the non additive gene action favouring hybridization
to some extent and the crosses, GE 4596 x L 5 and
GE 4596 x GPU 69 are the best crosses for grain
yield and most of the yield contributing characters.
34

ESTIMATION OF HETEROSIS FOR YIELD AND ITS ATTRIBUTING CHARACTERS
Table 1. Mean performance of F 1
’s and their parents for different agronomic traits
35

PARASHURAM and JAYARAME
Table 1. ( contd….)
PH : Plant height (cm) PL : Peduncle length (cm) NFE : Number of fingers/ear
DFL : Days to 50% flowering NPT : Number of tillers/plant DMT : Days to maturity
FL : Finger length (cm) SY : Straw yield (g) FW : Finger width (cm)
GY : Grain yield/ plant (g) CW : Culm width (cm) TW : Test weight/plant (g)
36

ESTIMATION OF HETEROSIS FOR YIELD AND ITS ATTRIBUTING CHARACTERS
Table 2. Analysis of variance for line x tester design with respect to yield and yield attributes in finger millet
* and ** : Significant at 5 and 1 per cent level, respectively
Where,
PLH : Plant height (cm) PL : Peduncle length (cm) NFE : Number of fingers/ear
DFL : Days to 50% flowering NPT : Number of tillers/plant DMT : Days to maturity
FL : Finger length (cm) SY : Straw yield (g) FW : Finger width (cm)
GY : Grain yield/ plant (g) CW : Culm width (cm) TW : Test weight/plant (g)
37

PARASHURAM and JAYARAME
Table 3. Percent heterosis over mid parent (MP) and better parent (BP) for yield and yield attributes in finger millet
38

ESTIMATION OF HETEROSIS FOR YIELD AND ITS ATTRIBUTING CHARACTERS
Table 3 . (Contd….)
Where,
PH : Plant height (cm) PL : Peduncle length (cm) NFE : Number of fingers/ear
DFL : Days to 50% flowering NPT : Number of tillers/plant DMT : Days to maturity
FL : Finger length (cm) SY : Straw yield (g) FW : Finger width (cm)
39

PARASHURAM and JAYARAME
Table 4. 1000 seed weight (g) from different positions of florets within the spikelet at different positions
of spike in three varieties of finger millet.
Genotypes
HR 911
PR-202
GPU-28
Position of
spike Floret-1 Floret-2 Floret-3 Floret-4 Floret-5 Floret-6
Top 3.63 3.62 3.64 3.71 3.78 3.68
Middle 3.71 3.76 3.76 3.81 3.68 3.70
Bottom 3.81 3.65 3.66 3.59 3.80 3.69
Top 3.75 3.78 3.68 3.73 3.64 3.68
Middle 3.78 3.64 3.62 3.67 3.59 3.80
Bottom 3.67 3.73 3.74 3.78 3.74 3.78
Top 3.72 3.76 3.71 3.75 3.78 3.67
Middle 3.56 3.67 3.70 3.74 3.76 3.72
Bottom 3.78 3.68 3.86 3.82 3.68 3.80
Table 5. Analysis of variance for three factorial completely randomized block design for intra spikelet
competition for seed size in finger millet.
Source of variation
Degrees of
freedom
Sum of
squares
Mean sum of
squares
F ratio
Varieties 2 0.0135 0.0068 4.1263**
Portions 2 0.0781 0.0391 2.4938
Florets 5 0.2124 0.0425 7.0620
Variety v/s Portion 4 0.3784 0.0946 15.7272
Variety v/s Florets 10 0.2825 0.0282 4.6958
Portion v/s florests 10 0.1683 0.0168 2.7984
Variety v/s Portion v/s
Florets
20 0.5670 0.0284 4.7131
Error 54 0.3248 0.0060
Total 107 2.0251 0.0189
* and ** : Significant at 5 and 1 per cent level, respectively
Intra Spikelet Competition for Seed Size
Three varieties viz., HR 911, PR 202 and
GPU 28 were studied for intra spikelet competition
for seed size. The seeds from six florets of three
different positions of spikelet were kept separately
in 6 different bowls. Thousand grain weights of
separately collected floret wise seeds of three
different portions weighed (Table 4) and analysis of
variance found non significant for seed weight
between the florets of all the three varieties studied
(Table 5). The results which indicated that there was
40

ESTIMATION OF HETEROSIS FOR YIELD AND ITS ATTRIBUTING CHARACTERS
no intra spikelet competition for seed size in all the
three varieties viz., HR 911, PR 202 and GPU 28, for
translocation of photosynthates under normal
conditions.
From the study it is evident that there is no
difference in translocation of photosynthates from first
seed set to last seed set in three finger millet varieties
under normal conditions. This confirms unlike in other
crops, finger millet shows synchronous blooming and
uniform seed setting where distribution of
photosynthates is uniform from source to sink. If
there is any variation found in seed size that may be
attributed due to environment and these varieties need
to be evaluated under moisture stress environments.
REFERENCES
AICSMIP, 2005. Annual Report of All India
Coordinated Small Millets Improvement Project,
ICAR, Bangalore. pp.24-35.
AICSMIP, 2007. Annual Report of All India
Coordinated Small Millets Improvement Project,
ICAR, Bangalore. pp.32-39.
Ayyangar, G. N. R and Wariar, U. A. 1934. Anthesis
and pollination in ragi, Eleusine coracana Gaertn.,
the finger millet; Indian Journal of Agricultural
Sciences. 4: 386- 393.
Gurunathan. 2006. Line x tester analysis in forage
sorghum, Introduction to sorghum and millets,
Millets News letter 35: 79-80.
Kempthorne, O. 1957. An introduction to genetic
statistics. John Wiley and Sons, New York,
USA. pp. 245-285.
Kolyagin, Y. S and Gorbatenko, T.A. 1986.
Inheritance of useful breeding characters in proso
millet, Ref. Zhu., 8: 65-248.
Konstantinov, S.I and Linnik, V.M. 1985. Utilizing
heterosis in proso millet breeding, Selekt, i.
Semen. USSR., 2: 15-17.
Madhusudan, K., Ramesh, S., Rao, A.M., Kulkarni,
R.S and Savithramma, D.L. 1995.
Combining ability in cowpea. Crop Management,
22(2): 241-243.
Patel, R.N., Godhani, P.R. and Fougat, R.S 1994.
Combining ability in cowpea (Vigina unguiculata
(L) Walp). Gujarat Agril. Univ. Res. J., 20(1): 70-
74.
Rama Rao, V and Rama Rao, K. V. 1962.
Emasculation of ragi flowers (Eluesine.
coracana) by hot water treatment for
hybridization work. The Andhra Agricultural
Journal. 9: 290-292.
Ramesh, S. 1990. Studies on heterosis and genetics
of qualitative characters in proso millet (Panicum
milliaceum L.). M.Sc. (Agri) Thesis submitted
to University of Agricultural Sciences, Bangalore,
India.
Ravikumar, R.L., Shankare Gowda, B.T and
Seetharam, A. 1986. Studies on heterosis in
finger millet. Millets Newsletter, 5: 26-27.
Singh, R.K and Chaudhary, B. D. 1985. Biometrical
methods in quantitative genetic analysis. 1 st Ed.
Kalyani publishers, Ludhiana. pp.58-64.
Srivastava, D.P and Yadav, A. 1977. Heterosis in
Panicum miliare lam. Curr. Res., 6(4): 66-67.
Tamilcovane, S and Jayaraman, N. 1994. Association
between yield components in ragi. J.
Phytological Research, 7(2):193-194.
Panse, V.G and Sukhatme. 1967. Statistical methods
for agricultural workers, ICAR, New Delhi, pp.
140- 145.
41

J.Res. ANGRAU 41(2) 42-45, 2013
INTEGRATED EFFECT OF ORGANIC MANURES AND INORGANIC
FERTILIZERS ON SOIL UREASE ACTIVITY AND YIELD OF
MAIZE-SPINACH CROPPING SYSTEM
I. USHA RANI. G. PADMAJA AND P. CHANDRASEKHAR RAO
Department of Soil Science and Agricultural Chemistry
Acharya N.G. Ranga Agricultural University, Rajendranagar, Hyderabad- 500 030
Date of Receipt : 26.11.2012 Date of Acceptance : 20.02.2013
ABSTRACT
A field experiment was conducted on a red sandy loam soil during rabi and summer seasons of 2009-2010
with a view to study the effect of organic manures, inorganic fertilizers and their integration on soil urease activity and
yield of maize (rabi) - spinach (summer)cropping system. Among the different treatments application of 75% RDF +
25% through vermicompost (VC) recorded significantly highest grain and stover yield (52.4, 60.8 q ha -1 ) at harvest
but, on par with 75% RDF + 25% through poultry manure and 75% RDF + 25% through FYM. The spinach crop
responded favourably to the residual and cumulative treatments and the highest fresh leaf yield (14.7 and 12.4 t ha -
1
) was recorded in cumulative and residual treatments. The soil urease enzyme activity at different growth stages of
maize and at final harvest of spinach revealed that there was increase in enzyme activities upto active growth stages
of crops and later showed a decrease. Significantly highest urease activity was found in T 4
(100% VC) with a value
of 246.7, 308.2 and 138.7 ìg of NH 4+
-N released g -1 soil h -1 at vegetative, tasseling and at harvesting stage of maize,
which was on par with T 8
, T 11
,T 12
, T 2
, T 6
and T 10
and was significantly different from other treatments in maize crop. The
cumulative and residual effects of spinach revealed that the urease activity was higher in cumulative than residual
treatments.
INTRODUCTION
Increased use of chemical fertilizers in an
unbalanced manner has created problem of multiple
nutrient deficiencies, diminishing soil fertility and
sustainable crop yields. Hence integration of organic
manures and inorganic fertilizers is imperative for
improving soil health in cropping systems.
The enzyme urease (urea amidohydrolase)
is an important extracellular enzyme which influences
the availability of plant utilizable forms of nitrogen in
soils. Urease is a unique enzyme because it catalyses
the hydrolysis of urea to ammonia (NH 3
) which is
subsequently transformed to ammonium (NH 4+
) and
nitrate (NO 3-
) ions. Nitrogen fertilizer use efficiency
is influenced by the activity of this enzyme, the
determination of urease activity in soils provides a
good index about the ability of soils to hydrolyze urea.
In general, the urease activity increases with increase
in organic carbon in soils.
Keeping in view the significance of integrated
nutrient management for better nitrogen management,
an experiment was conducted to study the effect of
organics, inorganics and their integration on urease
enzyme activity at different growth stages of maize
and at final harvest of spinach in maize-spinach
cropping system.
MATERIALS AND METHODS
A field experiment was conducted on a red
sandy loam soil at College Farm, College of
Agriculture, Rajendranagar, Hyderabad during rabi
and summer seasons of 2009-2010, with maize and
spinach, respectively. Field experiment was laid out
in randomized block design with 12 treatments,
replicated thrice. The treatments include, T 1
(Control),
T 2
(50% RDNF through inorganic fertilizer + 50%
RDNF through vermicompost), T 3
(75% RDNF
through inorganic fertilizer + 25% RDNF through
vermicompost), T 4
(100% RDNF through
vermicompost), T 5
(100% RDNF through inorganic
fertilizer), T 6
(50% RDNF through inorganic fertilizer
+ 50% RDNF through poultry manure), T 7
(75% RDNF
through inorganic fertilizer + 25% RDNF through
poultry manure), T 8
(100% RDNF through poultry
manure), T 9
(50% RDNF through inorganic fertilizer
+ 50% RDNF through farm yard manure), T 10
(75%
RDNF through inorganic fertilizer + 25% RDNF
through farm yard manure), T 11
(100% RDNF through
farm yard manure), and T 12
(25% RDNF through
inorganic fertilizer + 25% RDNF through
email: usha.soilscience@gmail.com
42

INTEGRATED EFFECT OF ORGANIC MANURES AND INORGANIC FERTILIZERS ON SOIL UREASE
vermicompost + 25% RDNF through poultry manure
+ 25% RDNF through farm yard manure). Maize was
the test crop during rabi season with RDF applied as
N: P 2
O 5
: K 2
O @120:60:60 kg ha -1 . All the manures
and fertilizers were applied as per the treatments. In
summer season, spinach was taken up as a test
crop and 75 percent of recommended dose of N, P
and K were applied in half of the plot pertaining to
each treatment. No fertilizers were applied to another
half of the plot to know the residual effects. Entire
quantity of phosphorus, half of nitrogen and potassium
were applied as basal in the form of single super
phosphate, urea and muriate of potash. Remaining
half of nitrogen and potassium were applied in two
equal splits at 15 and 30 DAS.
Soil of the experimental field is a sandy loam,
slightly alkaline in reaction (pH: 7.21, non saline (EC
: 0.19 dS m -1 ), medium in organic carbon (0.46%)
and available nitrogen (217.8 kg ha -1 ), medium in
available P 2
O 5
(28.7 kg ha -1 ) and K 2
O (285.6 kg ha -1 ).
Apart from the initial soil analysis, the organic
manures used for the study viz., FYM, poultry manure
and vermicompost were also analyzed for their
nutrient contents. Among all the organic manures,
poultry manure found to have highest nitrogen
(1.84%), phosphorus (0.82%) and potassium (1.12%)
followed by vermicompost (1.18, 1.07 and 0.85%)
and FYM (0.50, 0.75 and 0.75%). Urease activity
was assayed by measuring the rate of release of
NH 4
+
from the hydrolysis of urea as described by
Tabatabai and Bremner (1972) with some
modifications as suggested by Dorich and Nelson
(1983).
RESULTS AND DISCUSSION
Grain and Stover yield of maize
The grain and stover yield of maize was
significantly influenced by different levels of organic
manures and inorganic fertilizers (Table 1). The lowest
and highest grain and stover yields were recorded in
control and 75% RDNF + 25% VC, respectively.
However, the yield recorded at 75% RDNF + 25%
VC was on par with that recorded at 75% RDNF +
25% PM, 75% RDNF + 25% FYM and 100% RDNF
and significantly superior over all other treatments.
The percent increase in yield of 75% RDNF + 25%
VC over the control, 100% RDNF, 100% VC, 100%
PM and 100% PM was 143.4, 6.33, 18.9, 20.5, and
22.0, respectively. Conjunctive use of different levels
of chemical fertilizers with any one of the organics
produced higher yields compared to their individual
applications. This was due to the direct availability
of nutrients from inorganic fertilizers and also the
vermicompost containing higher available N, P and
K contents. The enrichment of biological activity and
release of organic acids might have degraded and
mobilized the occluded soil nutrients to available from
Reddy and Reddy (1998). Thus, favourable effect of
poultry manure and vermicompost in the root zone
resulted in increased availability and uptake of
nutrients by the plants which in turn was reflected
through increase in maize grain and stover yield.
Fresh green leaf yield of spinach
The spinach crop responded favourably to
the residual and cumulative treatments after harvest
of maize crop and the highest leaf yield (t ha -1 ) were
recorded in cumulative treatments than their
respective residual treatments (Table 1).
Among the cumulative and residual effects,
the green leaf yield of spinach ranged from 6.71 to
14.68 t ha -1 and 4.89 to 12.37 t ha -1 , respectively. In
both cumulative and residual effects, the treatments
received 100% organic manures (VC/PM/FYM) during
preceding maize crop showed higher leaf yields of
spinach than those with combined application of
organic manures and inorganic fertilizers.
Among the cumulative treatments, the
lowest and highest green leaf yield were observed
with T 1
and T 4
, respectively. The treatment which
received, 100% VC during previous rabi (T 4
) and 75%
RDF to spinach recorded highest fresh leaf yield but
was on par with T 8
and T 11
.
Among the residual effects, the green leaf
yield of spinach varied from 4.89 to 12.37 t ha -1 . The
lowest green leaf yield was recorded in control where
no fertilizers were applied. Though application of
100% VC to rabi maize (T 4
) resulted in highest green
leaf yield of 12.37 t ha -1 , it was on par with 100% PM
(T 8
) and 100% FYM (T 11
). But it was significantly
superior to all the other combined treatments.
The results clearly indicated that application
of 75% RDF to spinach apart from the application of
inorganic and organic manures to maize crop was
sufficient as it ensured ample supply of nutrients and
favoured better growth. The additional fresh green
leaf yield under cumulative effects might be because
of an adequate and balanced supply of nutrients with
43

USHA et al
75% RDF application. It had favourable effect on leaf
and root growth resulting in improvement in the yield
attributes. Thus, the results revealed that though
spinach yield can be obtained without applying
fertilizers (residual treatments), there is a scope for
increasing its production potential by applying 75%
RDF and saving 25% inorganic fertilizers. Similar
observations were made by Reddy, 2007.
Urease enzyme activity
The urease enzyme activity was assayed
at different growth stages of maize and at final
harvest of spinach showed that urease enzyme
activity increased upto tasseling stage in maize and
later showed a decrease. The studies on soil enzyme
activities revealed that the microbial activity is
maximum upto active growth stage of the maize crop.
The sharp increase in the enzyme activities at
tasseling which coincides with the active growth stage
of the crop, enhanced root activity and the release of
extracellular enzymes like urease into soil solutions
during the active growth phase which resulted in
higher rate of mineralization of nutrients in the soil.
The results were in conformity with the findings of
Srirama Chandrasekharan et al., (1997) and Reddy
and Reddy (2008).
Significantly highest urease activity was
found in T 4
(100% VC) at vegetative, tasseling and
at harvesting stage of maize, which was on par with
T 8
, T 11
,T 12
, T 2
, T 6
and T 10
and was significantly different
from other treatments. The lowest urease activity
recorded in control (Table.2).The increase in urease
activity with integrated application of organic manures
and inorganic fertilizers may be attributed to the
increasing population of microorganisms like bacteria
etc., due to increased availability of substrate through
organic manures. Similar findings were reported by
Singaram and Kamala Kumari (2000) and Reddy
(2011).
The cumulative and residual treatments on
spinach revealed that irrespective of the treatments
cumulative showed higher urease activities than with
their corresponding residual treatments (Table 2). This
may be due to luxuriant root proliferation and large
amount of leaf fall leading to nutrient rich
environment, which was more conducive for
proliferation of the microflora for enhanced enzyme
synthesis. Among cumulative and residual
treatments, the treatments which received 100%
organic manures (VC, PM and FYM) to the preceding
maize crop has recorded significantly highest urease
activity at final harvest of spinach.
Table 1. Effect of INM on grain and stover yield of maize and fresh leaf yield of spinach in maizespinach
cropping system
Treatment Yield (q ha - 1 ) Fresh leaf yield (t ha -1 )
Grain Stover Cumulative Residual
T 1 Control 21.5 29.9 6.7 4.8
T 2 50% RDNF + 50% VC 48.1 55.4 12.8 10.7
T 3 75% RDNF + 25% VC 52.3 60.7 9.8 8.5
T 4 100% VC 44.0 48.1 14.6 12.3
T 5 100% RDNF 49.2 57.2 8.8 7.2
T 6 50% RDNF + 50% PM 47.3 53.4 12.2 10.3
T 7 75% RDNF + 25% PM 51.2 59.5 9.7 8.4
T 8 100% PM 43.4 47.4 14.5 12.1
T 9 50% RDNF + 50% FYM 46.8 53.0 12.7 10.4
T 10 75% RDNF + 25% FYM 50.4 58.4 9.4 8.2
T 11 100% FYM 42.9 46.8 14.3 12.0
T 12 25% RDNF + 25% VC + 25% PM +25%
FYM 44.6 50.1 13.3 11.6
SE(m) ± 1.7 1.9 0.6 0.5
CD at 5% 3.5 3.9 1.2 1.1
VC: Vermicompost; PM: Poultry manure; FYM: Farm yard manure; RDNF: Recommended dose of
nitrogen fertilizer
44

INTEGRATED EFFECT OF ORGANIC MANURES AND INORGANIC FERTILIZERS ON SOIL UREASE
Table 2. Effect of INM on urease activity (µg NH 4+
-N released g -1 soil h -1 ) at different growth stages of
maize and at final cutting of spinach in maize-spinach cropping system
Treatment Maize Spinach
Vegetative
stage
Tasseling
stage
Harvest Cumulative Residual
T 1 Control 17.87 20.34 9.45 10.05 7.32
T 2 50% RDNF + 50% VC 23.47 27.68 13.25 15.72 11.54
T 3 75% RDNF + 25% VC 21.25 25.55 11.85 13.54 9.87
T 4 100% VC 26.76 30.82 14.97 17.66 12.76
T 5 100% RDNF 19.24 22.65 10.54 12.49 8.95
T 6 50% RDNF + 50% PM 23.02 27.54 13.09 15.20 11.29
T 7 75% RDNF + 25% PM 21.03 25.29 11.67 13.35 9.76
T 8 100% PM 26.32 30.24 14.80 17.26 12.54
T 9 50% RDNF + 50% FYM 22.84 27.05 12.92 14.75 10.98
T 10 75% RDNF + 25% FYM 20.75 24.91 11.28 13.58 9.82
T 11 100% FYM 25.89 29.87 14.24 16.98 12.34
T 12 25% RDNF + 25% VC +
25% PM +25% FYM
24.62 28.72 13.95 16.32 11.85
SE(m) ± 2.30 2.51 1.39 0.37 0.33
CD at 5% 4.77 5.20 2.88 0.77 0.69
REFERENCES
Dorich, R.A and Nelson, D.W. 1983. Direct
colorimetric measurement of ammonium in
potassium chloride extracts of soils. Soil
Science Society of American Journal. 47 (4):
833-836.
Reddy, B.G and Reddy, M.S. 1998. Effect of organic
manures and nitrogen levels on soil available
nutrient status in maize-soybean cropping
system. Journal of Indian Society of Soil
Science. 46(3): 474-476.
Reddy, K.P.C. 2007. Effect of integrated use of
inorganic and organic sources of nutrients in
maize-groundnut cropping system of Alfisols.
Ph.D thesis submitted to Acharya N G Ranga
Agricutural University, Hyderabad.
Reddy, R.U and Reddy, M.S. 2008. Urease activity
in soil as influenced by integrated nutrient
management in tomato-onion cropping system.
Asian Journal of Soil Science 3 (1): 30-32.
Reddy, T.P., Padmaja, G and Rao, P.C. 2011.
Integrated effect of vermicompost and nitrogen
fertilizers on soil urease activity and yield of
onion-radish cropping system. Indian Journal of
Agricultural Research. 45(2):146-150.
Singaram, P and Kamala Kumari, K. 2000. Effect of
continuous application of different levels of
fertilizers with FYM on enzyme dynamics in soil.
The Madras Agricultural Journal. 87(4- 6): 364-
365.
Sriramachandrasekharan, M.V., Ramanathan, G and
Ravichandran, M. 1997. Effect of different
organic manures on enzyme activities in flooded
rice soil. Oryza. 34: 39-42.
Tabatabai, M.A and Bremner, J. M. 1972. Assay of
urease activity in soils. Soil Biology and
Biochemistry 4: 479-489.
45

J.Res. ANGRAU 41(2) 46-51, 2013
SCREENING OF LOCAL RHIZOBIAL ISOLATES FOR PLANT GROWTH
PROMOTION AND BIOCONTROL PROPERTIES AGAINST SOIL BORNE
FUNGAL PATHOGENS
BH. SARVANI, R. SUBHASH REDDY, S. SUMATHI and P. NARAYAN REDDY
Department of Agricultural Microbiology and Bioenergy
College of Agriculture, Rajendranagar, Hyderabad- 500 030
Date of Receipt : 23.11.2012 Date of Acceptance :06.02.2013
ABSTRACT
Ten bacterial isolates were obtained from fifteen rhizosphere soils of Groundnut and Redgram crops in the
Rangareddy district. These isolates were identified as Rhizobium, based on their cultural, morphological and
biochemical characteristics and were further evaluated for Plant growth promoting attributes like phosphate
solubilization, production of Indole Acetic Acid (IAA), Hydrogen Cyanide (HCN) and siderophore. All the isolates
showed positive results for IAA and HCN production, while 70% of the isolates produced siderophores. Further,
these isolates were subjected to in vitro antagonism against three common soil borne fungal pathogens viz.,
Rhizoctonia solani, Sclerotium rolfsii and Fusarium solani. Due to the production of HCN and siderophore, these
isolates inhibited the mycelial growth of Rhizoctonia solani, Sclerotium rolfsii and Fusarium solani in the range of
32.30- 50.73%.
Among the soil borne fungal diseases of
groundnut, Web blight, caused by Rhizoctonia solani
is the most common disease (Dubey, 2000).
Rhizoctonia solani is a wide spread and an
ecologically diverse soil-borne fungus, causing
different types of diseases in many plant species. It
causes root rot, stem rot, fruit and seed decay,
damping-off, foliar blight, stem canker and crown rot
in various crops (Guleria et al. 2007). Biological
control of plant diseases using antagonistic bacteria
may be considered as a promising alternative to the
use of some hazardous chemical fungicides. In the
present study, ten Rhizobium isolates were obtained
from the rhizosphere of groundnut and redgram crops
and were characterized, screened for IAA, Phosphate
solubilization, HCN, siderophore production and
finally for antagonistic activity with Rhizoctonia solani,
Sclerotium rolfsii and Fusarium solani under in vitro
conditions.
MATERIALS AND METHODS
Isolation of bacterial isolates
Bacterial isolates were obtained from the
rhizosphere of groundnut and redgram crop plants
using Yeast Extract Mannitol Agar (YEMA) as
described by the Vincent, (1970).
Screening of pure Rhizobium isolates for
Phosphate solubilization, production of indole acetic
acid, hydrogen cyanide and siderophores
Phosphate solubilization
This test was performed following spot
inoculation on Pikovskaya’s medium. Clear zone
around the colonies indicates phosphate
solubilization.
IAA production
Production of indole acetic acid (IAA) was
detected as described by Brick et al., (1991).
Bacterial isolates were grown for 72 h in yeast extract
broth tubes at 36±2 0 C. Fully grown cultures were
centrifuged at 3000rpm for 30min. the supernatant
(2ml) was mixed with two drops of Orthophosphoric
acid and 4ml of the Salkowaski reagent (50ml, 35%
of Per chloric acid, 1ml of 0.5M Fecl 3
solution).
Development of pink color indicates IAA production.
HCN production
HCN production was tested by the method
of Lorck (1948). Yeast extract mannitol broth was
amended with 4.4g glycine/lit and bacteria were
streaked on modified agar plate. A Whatman filter
paper no.1 soaked in 2% sodium carbonate in 0.5%
picric acid solution was placed at the top of the plate.
Plates were sealed with Para film and incubated at
36±2 0 C for 4 days. Development of orange to red
color indicates HCN production.
email: arvanibharathula@gmail.com
46

SCREENING OF LOCAL RHIZOBIAL ISOLATES FOR PLANT GROWTH PROMOTION
Siderophore production
Siderophores were detected quantitatively by
CAS Shuttle Assay (Schwyn and Neilands, 1987).
0.5% of cell free culture supernatant was added to
0.5% CAS (Chrome Azurol Sulphate) assay solution
and absorbance was measured at 630nm against a
reference consisting of 0.5ml uninoculated broth and
0.5ml CAS reagent. Siderophore content in the aliquot
was calculated by using the following formula:
% siderophore units =
Where, A r
= Absorbance of reference at 630nm
A s
= Absorbance of sample at 630nm.
Antagonistic activity against fungal pathogens
Antagonism against the fungal pathogens
was performed by dual culture assay (Skidmore and
Dickinson, 1976). One loopful of bacterial suspension
was streaked on potato dextrose agar plate at one
end, which was pre-inoculated with 5days old, 5mm
mycelial discs of test pathogen at the other end.
Control plate was maintained by placing only pathogen
mycelial disc on the plate without bacteria. The assay
plates were incubated at 28 1 0 C for 5 days and
observations were made on inhibition of mycelial
growth of the test pathogens. For each bacterial isolate
three replications were maintained with suitable
controls.
The per cent growth inhibition over control was
calculated by using the formula:
Percent Inhibition =
Growth of Pathogen in control (mm)-
Growth of Pathogen in treatment (mm)
Growth of Pathogen in control (mm)
(In this the percent inhibition in control was taken as
zero percent).
RESULTS AND DISCUSSION
Isolation of Rhizobium isolates
X 100
Fifteen soil samples were collected from
different places of Rangareddy district for the isolation
of Rhizobium isolates. The soil samples were mainly
collected from the rhizosphere of groundnut and
redgram crop plants. All the soil samples were
inoculated on the YEMA (Yeast Extract Mannitol
Agar), based on the colony morphology and cultural
characteristics of the isolates on the above media,
about ten colonies from above plates were selected,
purified on respective media and subjected to gram
staining for morphological examination. The isolates
were named according to village, crop and cultural
characters as SFGR to CFGR. All the isolates were
gram-ve, single isolated rods with gummy white,
round, non spreading, smooth, raised, translucent
mucoid colony and no pigmentation.
Kumar et al., (2010) isolated root nodulating
Sinorhizobium fredii KCC5 from nodules of Cajanus
cajan and disease suppressive soil of tomato
rhizosphere, respectively and studied their
physiological and biochemical characterization which
confirms the purity of these isolates. Joseph et al.,
(2007) isolated a total of one hundred and fifty isolates
from different soils of chickpea from the vicinity of
Allahabad and among them thirty five isolates were
identified as Rhizobium on the basis of morphological
and biochemical characterization. Deka and Azad
(2006) isolated one hundred and fifty seven isolates
of Rhizobium from six pulse crops Cowpea, Green
gram, Black gram, Pigeon pea, Soybean, Groundnut
and studied their physiological and biochemical
characterization which confirms the purity of these
isolates.
Screening of pure Rhizobium isolates for
Phosphate solubilization, production of indole
acetic acid, hydrogen cyanide and siderophores
All the ten Rhizobium isolates showed zone of
phosphate solubilization activity on Pikovskya’s
medium. Out of ten, SFGR showed highest zone of
16mm with 60% Solubilization Efficiency (SE),
followed by AGR, KRR and CFGR which showed
14mm zone with 40% S.E. Remaining isolates
showed SE of 20% with 12mm of solubilization zone.
All the Rhizobium isolates were identified as
IAA producers, of which SFRR was found to be strong.
Two isolates (DGR and CFGR) produced IAA in fewer
amounts, while the remaining showed moderate
production of IAA.
In case of HCN production, all the isolates
showed positive results, of which AGR and KRR
showed strong production. SFGR, SFRR, ARR, DRR,
KGR, SBGR showed moderate production, while other
two (DGR and CFGR) showed weak production.
47

SARVANI et al
Seven of the isolates showed positive results for
siderophore production. Kumar et al. (2010) screened
Sinorhizobium fredii KCC5 from Cajanus cajan and
reported that the strain produced IAA, solubilized
phosphorus and siderophore production. Verma et
al., (2010) evaluated Rhizobium spp. for in vitro PGP
properties and concluded that the bacterial strain was
found to be positive for IAA and phosphate
solubilization.
Joseph et al., (2007) isolated thirty five
Rhizobium spp. from the rhizosphere soils of
chickpea crop plants and screened in vitro for their
plant growth promoting characteristics. Results
revealed that 85.7% of Rhizobium isolates showed
IAA production.
Similarly, Chandra et al., (2007) isolated
Mesorhizobium loti MP6, from root nodules of Mimosa
pudica which induced growth and yield of Brassica
campestris through plant growth promoting attributes.
The isolate MP6 showed production of IAA, HCN,
phosphate solubilization and siderophore production.
Nabi et al. (2005) identified ten strains of Rhizobium
meliloti from the root nodules of Fenugreek (Trigonella
foenum- graceum) and studied for PGP properties.
They concluded that different strains of Rhizobium
meliloti exhibited the properties of IAA, HCN and
siderophore production.
In the present study, the rhizobial isolates can
be graded in the order SFGR>KRR=AGR>SFRR,
based on efficiency.
Antagonistic activity against fungal pathogens
All the ten isolates inhibited Rhizoctonia
solani except DGR, of which SBGR showed highest
% inhibition with 12.6mm zone, followed by DRGR
and CFGR with 44% inhibition and 11mm zone. Least
% inhibition was shown by AGR (39.2%) with 5.6mm
zone.
Six of the ten Rhizobium isolates exhibited
antagonistic activity against Sclerotium rolfsii viz.,
KRR (50.7%), SBGR (49.2%), SFGR (48%), AGR
(48.8%), DGR (45.1%) and SFRR (38.8%).
All the Rhizobium isolates showed potential
in the biocontrol of Fusarium solani. Among which
AGR recorded maximum inhibition of 44.6% with
25.3mm of inhibition zone. The isolates SFGR, SFRR
and CFGR were on par with AGR. DGR showed least
percent inhibition of 32.3% (14mm zone) inhibition.
These findings were found to be similar with those of
Shaban and El-Bramaway (2011) who studied the
biological control of damping off and root rot causing
fungi (Fusarium oxysporum, F. solani, Macrophomina
phaseolina, Rhizoctonia solani and Sclerotium rolfsii)
with antagonistic microorganism (Rhizobium spp and
Trichoderma sp). They revealed that combined effect
of both Rhizobium spp and Trichoderma sp was found
to be beneficial in controlling the fungal diseases of
legume crops.
Akthar et al., (2010), reported that combined
application of Bacillus pumilus and Pseudomonas
alcaligenes with Rhizobium spp. resulted in the
greatest increase in the plant growth, number of pods,
nodulation and root colonization by rhizobacteria, in
Lentil.
Yuan et al., (2008) isolated Sinorhizobium
freudii (L 396) from soybean root nodule and
evaluated antagonistic activity against Heterodera
glycines and pathogens of Soyabean (Glycine max)
root rot. Hatching inhibition rate of cysts treated with
the bacteria suspension at 7 days was 82.9%. L396
displayed antifungal activity to two soyabean root
rot pathogens, especially to Fusarium solani, with 4
mm inhibition zone.
In the present study, out of ten Rhizobium
isolates tested, all the isolates exhibited inhibition
potential against Rhizoctonia solani (Except DGR)
and Fusarium solani. Only six of the isolates showed
inhibition potential against Sclerotium rolfsii. The
isolates that showed maximum inhibition potential
against Rhizoctonia solani were also inhibitory to
Sclerotium rolfsii and Fusarium solani, based on
percent inhibition and vice-versa. Some of the
isolates that showed inhibition to one pathogen were
not inhibitory to the other two pathogens. All the ten
isolates showed HCN production, whereas seven of
the isolates produced siderophores. It can be inferred
that the Rhizobium isolates SFGR, SBGR, AGR and
KRR could be considered for their antagonistic activity
against the three soil borne pathogens. Though KRR
showed higher siderophore and HCN production, it
showed better inhibition to Sclerotium rolfsii.
Comparing the antagonistic activity against these
pathogens and production of siderophores and HCN,
the effectiveness of these isolates is in the order:
SBGR> AGR> SFGR> KRR.
48

SCREENING OF LOCAL RHIZOBIAL ISOLATES FOR PLANT GROWTH PROMOTION
Table 1. Plant growth promoting attributes of Rhizobium isolates
Phosphate solubilization
Isolate
Zone
diameter
(mm)
Solubilization
Efficiency (%)
Nodulation
IAA
HCN
Siderophore
production
SFGR 16 60 + ++ ++ +
SFRR 12 20 + +++ ++ +
AGR 14 40 + ++ +++ +
ARR 12 20 + ++ ++ -
DGR 12 20 + + + +
DRR 12 20 + ++ ++ -
KGR 12 20 + ++ ++ -
KRR 14 40 + ++ +++ +
SBGR 12 20 + ++ ++ +
CFGR 14 40 + + + +
HCN- Hydrogen cyanide IAA- Indole Acetic Acid Nodulation
+ Weak production ++ Moderate production + Nodulation
+++ Strong production “ No production “ No Nodulation
Table 2. Antagonistic activity of Rhizobium isolates against Rhizoctonia solani, Sclerotium rolfsii
and Fusarium solani.
ISOLATE
*Percent Inhibition (%)
Rhizoctonia solani Sclerotium rolfsii Fusarium solani
SFGR 39.62
(38.99)
SFRR 42.59
(40.71)
AGR 39.25
(38.77)
ARR 40.36
(39.42)
DGR 26.66
(31.07)
DRR 44.07
(41.57)
48.06
(43.87)
38.82
(38.53)
48.83
(44.31)
26.60
(31.02)
45.14
(42.18)
28.10
(31.99)
44.09
(41.59)
43.58
(41.29)
44.61
(41.88)
37.43
(37.68)
32.30
(34.60)
39.99
(39.14)
49

SARVANI et al
ISOLATE
*Percent Inhibition (%)
Rhizoctonia solani Sclerotium rolfsii Fusarium solani
KGR 42.96
(40.93)
KRR 39.99
(39.21)
SBGR 46.66
(43.06)
CFGR 44.07
(41.57)
27.73
(31.75)
50.73
(45.40)
49.23
(44.52)
26.60
(31.02)
33.33
(35.21)
38.97
(38.59)
34.35
(35.86)
42.56
(40.69)
Control 00 00 00
CV % 2.92 3.21 6.29
SEM± 0.66 0.71 1.40
CD CDat 0.05
5%
1.98 2.12 4.17
*Mean of three replications Figures in the parenthesis represent angular transformed values.
REFERENCES
Akhtar, M.S., Shakeel, U and Siddiqui, Z.A. 2010.
Biocontrol of Fusarium wilt by Bacillus pumilus,
Pseudomonas alcaligenes and Rhizobium sp.
on lentil. Turk J Biol. 34: 1-7.
Brick, J.M., Bostock R.M and Silverstone S. E.1991.
Rapid insitu assay for indole acetic acid
production by bacteria immobilized on
nitrocellulose membrane. Appl. Environ.
Microbiol. 57: 535–538.
Chandra, S., Choure, K., Dubey, R.C and Maheswari,
D.K. 2007. Rhizosphere competent
Mesorhizobium loti MP6 induces root hair curling,
inhibits Sclerotinia sclerotiorum and enhances
growth of Indian Mustard Brassica campestris.
Brazilian Journal of Microbiology. 38: 124-130.
Deka, A.K and Azad, P. 2006. Isolation of Rhizobium
strains: cultural and biochemical characteristics.
Legume Research. 29(3): 209-212.
Dubey, S.C. 2000. Biological management of web
blight of Groundnut Rhizoctonia solani . J Mycol
Pl Pathol, 30(1): 89 - 90.
Guleria, S. R. Aggarwal, T.S. Thind and Sharma, T.R.
2007. Morphological and pathological variability
in rice isolates of Rhizoctonia solani and
molecular analysis of their genetic variability.
Journal Phytopathology 155: 654-661.
Joseph, B., Patra, R.R and Lawrence, R. 2007.
Characterization of plant growth promoting
rhizobacteria with chickpea Cicer arietinum L.
International Journal of Plant Production. 1(2):
141-151.
Kumar, H., Bajpai, V.K., Dubey, R.C., Maheshwari,
D.K and Kang, S.C. 2010. Wilt disease
management and enhancement of growth and
yield of Cajanus cajan L var. Manak by bacterial
combinations amended with chemical fertilizer.
Crop Protection. 29: 591-598.
Lorck, H. 1948. Production of hydrocyanic acid by
bacteria. Plant Physiol. 1: 142 -146.
Nabi, A., Ahmad, I and Zargar, M.Y. 2005. Screening
of Rhizobium meliloti for plant growth promoting
activities. Applied Biological Research. 7(1/2):
14-17.
Schwyn, B and Neilands, J.B. 1987. Universal
chemical assay for detection and determination
of siderophores. Analytical Biochemistry. 16: 47-
56.
50

SCREENING OF LOCAL RHIZOBIAL ISOLATES FOR PLANT GROWTH PROMOTION
Shaban, W.I and El-Bramawy, M.A. 2011. Impact of
dual inoculation with Rhizobium and Trichoderma
on damping off, root rot diseases and plant
growth parameters of some legumes field crop
under greenhouse conditions. International
Research Journal of Agricultural Science. 1(3):
098-108.
Skidmore, A. M and Dickinson, C H 1976 Colony
interaction and hyphal interference between
Septoria nodorum and phylloplane fungi.
Transactions and Journal of the British Ceramic
Society. 66: 57-74.
Verma, J.P., Yadav, J and Tiwari, K.N. 2010.
Application of Rhizobium sp.BHURCO1 and
plant growth promoting rhizobacteria on
nodulation, plant biomass and yields of chickpea
Cicer arietinum L.. International Journal of
Agricultural Research. 5(3): 148-156.
Vincent, J.M. 1970. A manual for the practical study
of the root nodule bacteria. Blackwell Scientific
publications Oxford and Edinburgh. Pp: 1-3.
Yuvan, W.Y., Yuxi, D and Lijie, Chen. 2008.
Antagonism of Rhizobium against pathogens of
soybean root. Acta Phytopathologica Sinica.
38(6): 607-612.
51

J.Res. ANGRAU 41(2) 52-58, 2013
CHARACTERIZATION AND CLASSIFICATION OF RICE GROWING SOILS OF
CENTRAL TELANGANA REGION OF ANDHRA PRADESH
M.RAMPRASAD, V.GOVARDHAN, V.PRAVEEN RAO, K.SUREKHA and M.H.V. BHAVE
Department of Soil Science and Agricultural Chemistry, College of Agriculture, Rajendranagar,
Acharya N.G. Ranga Agricultural University, Hyderabad- 500 030
Date of Receipt : 20.09.2012 Date of Acceptance : 06.03.2013
ABSTRACT
Ten representative pedons from rice-growing soils of Central Telangana region were characterized and
classified. The results showed that the soils were of sandy loam to clayey in texture with low permeability. In general,
the soils were neutral to slightly alkaline in reaction, high to low in organic carbon, mixed in mineralogy and
moderately deep to very deep. Bulk density increased with depth and values ranged from 1.24 to 1.71 Mg m -3 . Water
retentions of soil at 0.33 bars and 15 bars ranged from 9.8 to 39.1 % and 4.7 to 23.6 %, respectively. Cation
Exchange Capacity and soil pH followed no definite distribution pattern with depth. While the status of available N
was low to medium, the status of available P and K ranged from low to high and the availability decreased with depth.
Based on soil characteristics, the soils of Gajwel (P6) were classified as Entisol, soils of Sanga Reddy (P4),
Eturnagaram (P9) and Ghanpur (P10) were classified as Alfisols, soils of Madhira (P1), Aswaraopeta (P2) and
Malyal (P8) as Inceptisols and soils of Pinapaka (P3) and Siddipeta (P5) as Vertisols.
Rice crop is being grown in Central Telangana
region in diversified soil and resource environs
predominantly under puddling and waterlogging
conditions in lowland systems. There is wide
heterogeneity in soils (red, lateritic, black, alluvial
and colluvial). Nutrient supplying capacity and
availability varied significantly in the waterlogged
environs of low land systems due to the different
farming situations adopted in locale. The consistent
variability and heterogeneity of soil and land resource
environs in the Telangana region is evidently not
supporting with the requirements of rice crop.
Soil characterization determines the soils
individual inherent potentials and constraints for crop
production besides giving detailed information about
the different soil properties. Characterization and
systematic classification of dominant soil groups is
an essential tool and a pre-requisite for soil fertility
evaluation and efficient soil-fertilizer-water
management practices and, thus, crop management.
It is important to standardize site-specific
technologies on the basis of soil types to improve
rice yields, which necessitates soil characterization.
The present study, therefore, was planned to
characterize and classify the rice growing soils of
the Central Telangana region.
MATERIALS AND METHODS
The Central Telangana region is located
between 17p 142 to 18p 212 N latitude and 78p 52
to 81p 62 longitude in south India with mean annual
rainfall of 1167.7 mm, of which 74 per cent which is
received through S-W monsoon (mid-June to mid-
September). Ten representative pedons (P1 to P10)
from Madhira, Aswaraopeta, Pinapaka, Sanga Reddy,
Siddipeta, Gajwel, Warangal, Malyal, Eturnagaram
and Ghanpur were exposed where all horizons were
visible. All pedons were examined morphologically
immediately after rice harvest. Soil samples collected
from each horizon were analysed for different soil
properties viz. particle-size distribution (hydrometer
method), bulk density (core method), water retention
characteristics (pressure plate apparatus), saturated
hydraulic conductivity (constant head method), pH
(1:2.5 soil water solution), organic carbon (Walkley
and Black, 1934), cation exchange capacity (CEC)
by neutral normal NH 4
OAc. The soils were classified
as per soil taxonomy (Soil Survey Staff, 1998 and
Soil Survey Staff, 2006).
RESULTS AND DISCUSSION
Morphology
The colour of the soils is in 10YR, 7.5YR
and 2.5YR hue and varied from brown to dusky red.
email: mullapudiramprasad@yahoo.co.in
52

CHARACTERIZATION AND CLASSIFICATION OF RICE GROWING SOILS
Texture varied from sandy loam to clayey. Texture
of surface horizons of P1, P3, P5, P7 were clayey
and P2, P4, P6, P8, P9, P10 were sandy clay loam.
The paddy soils under study had in general, massive
structure at the surface which broke in to subangular
blocky or angular blocky and ranged from granular to
subangular blocky in pedons. In all surface horizons
the structure was subangular blocky except in P6
which was granular structure and angular blocky in
P3, P5 (Table 1).
Physical characteristics
The silt content ranged from 7.9 to 24.2 per
cent and a gradual increase in clay content in lower
depths was observed in the pedons except P2 and
P6 (Table 2). The increase in clay content is an
indication of illuviation (Pardeep Kumar and Verma
2005; Ratnam et al., 2001). The aggregation in these
soils was poor in surface and sub-surface horizons.
As these soils were under rice cultivation since many
years, the repeated puddling during rice cultivation
could be one of the reasons for poor aggregation in
surface horizons. The poor aggregation in sub-surface
horizons might be because of clay illuviation under
continuous irrigation conditions. Rice soils have poor
aggregation because of puddling or wet tillage that
destroys soil structure (Dey and Sehgal, 1997).
The bulk density increased with depth in all
pedons barring P3 and P4 as exceptions, which
indicated that the lower layers in soil profiles
supporting rice cultivation system became compact
with time. These results are in conformity with the
findings of Ratnam et al., (2001). The farmers plough
with local (desi) plough which disturbs the soil up to
20 cm only and lower layers remain undisturbed for
years together which sometime result in pan
formation. Because of dominance of silt and clay,
the soils retained fairly good amount of water varying
from 9.8 to 39.1 per cent (at field capacity). The
saturated hydraulic conductivity of surface layers
followed the values varying from 1.2 to 10.4 cm hr -1 .
Similar findings were also reported by Reza et
al.,(2010).
Chemical properties
The chemical characteristics of pedons were
presented in table 3. The soils were neutral to slightly
alkaline at surface (pH 6.6 to 8.2) and sub-surface
(pH 6.1 to 8.78) depths. The organic carbon varied
from 7.0 to 11.4 g kg -1 in surface horizons and 2.0 to
9.0 g kg -1 in sub-surface horizons and decreased with
depth. The temperature during rice cultivation ranged
from 13.0 to 39.0 p C. High temperature during most
part of the year might be responsible for high rate of
decomposition and comparatively higher values of
organic carbon in surface horizons than sub-surface
horizons. The CEC values varied from 13.2 to 45.1
cmol(p+) kg -1 in surface horizons and from 16.5 to
51.3 cmol(p + ) kg -1 in sub-surface horizons which could
be in positive correlation with clay content. Similar
findings were also reported by Dhanorkar et al., 2010.
The available N varied from 116 to 385 kg
ha -1 in the surface horizons, whereas sub-surface
horizons had available N in the range of 85 to 257 kg
ha -1 . Majority of the soils fell into low to medium
category with respect to available nitrogen as per
the Muhr et al. 1965. The available P varied from 8
to 65 kg ha -1 in surface and 4 to 61 kg ha -1 in subsurface
horizons. Available K ranged from 108 to 475
kg ha -1 in surface horizons and 94 to 391 kg ha -1 in
sub-surface horizons and soils classified under low
to high in available K content.
Soil classification
Based on morphological, physical,
physico-chemical characteristics of the soils and
climate data, the pedon six was classified in to the
order Entisols (pedon6) which do not have any
diagnostic horizon and possesses lithic contact that
is shallower depth than 25 cm and above 1 m, having
an organic corbon content decreasing with increasing
depth and reaches a level of 0.2 per cent at a depth
of 1.25 m, not permanently saturated with water,
hence placed under the Orthents at sub order level.
As the moisture regime is Ustic, the pedon 6 was
classified as Ustorthents at great group level, but
categorised as Udic Ustorthents at great group level
53

RAMPRASAD et al
because of the present land use condition with good
irrigation practices for cultivation of crops in the last
three decades. The proper utilization of soil and land
resource environs influenced the moisture conditions
greatly leading to storing og moisture in the profile.
The pedons four, nine and ten were classified under
Alfisols because of the presence of an argillic (B t
)
sub-surface diagnostic horizon and the pedons 1, 2
and 8 were classified under the order Inceptisols
because of the absence of any other diagnostic
horizon other than cambic (B w
) horizon. As the
moisture regime is Ustic, the pedons 4, 9 and 10
were classified as Ustalfs, whereas the pedons 1, 2
and 8 were classified as Ustepts at sub order level
and were classified as Haplustepts at great group
level because the pedons have neither duripan nor
calcic horizon and the base saturation is more than
60 per cent at a depth between 0.2 to 0.7 m from the
soil surface. The pedons 2 and 8 were classified as
Typic Haplustepts at sub group level because these
pedons did not have vertic properties and lithic
contact with in 50 cm from the soil surface. The pedon
one was classified as Vertic Haplustepts at sub group
level, considering cracks with in 100 cm of mineral
soil surface.
The pedon four was classified as
“Paleustalfs” at great group level because of the
absence of densic, lithic or para lithic content within
15 cm of the mineral soil surface and the lower one
half of the argilic horizon, one or more sub horizons
with hue of 7.5YR and chroma of 5 or more in 50 per
cent or more of matrix. This pedon was classified as
Udic Paleustalfs at great group level because of the
present land use condition, essentially because of
good irrigation practices that one being followed for
last three decades. The soil and land resource
environs are utilized properly, economically providing
water from various sources and this might have
influenced the moisture conditions greatly. The pedon
nine was classified as “Rhodustalfs” at great group
level because of an argillic horizon that have hue of
2.5YR and the value, moist of three, The pedon 10
was classified as “Haplustalfs” at great group level
because it did have any horizons other than argillic
horizon. Further, these pedons 9 and 10 did not have
vertic properties and lithic contact within 50 cm from
the soil surface. Hence, these pedons are classified
as Typic Rhodustalfs and Typic Haplustalfs at
subgroup level respectively.
The pedons three, five and seven were
classified as Vertisols at order level as they
expressed their morphology very identical and have
clay texture (more than 30 % clay in fine earth fraction
in all the horizons). In these pedons clay exhibited
significant sink–source characteristics and had a
layer of 25 cm (or) more in thickness with an upper
boundary with in 100 cm of mineral soil surface , that
have slickensides which exhibited shiny and smooth
surfaces at interspace of peds and designated as
Bss. These soils had ustic soil moisture regime,
hence these pedons were classified as “Usterts” at
suborder level, At great group level these pedons
were calssified as Haplusterts as they did not have
either salic, gypsic and petrocalcic horizons within
100 cm depth. The pedons had EC less than 4 dS
m -1 and pH more than 4.5. The pedons three, five
and seven were classified as Typic Haplusterts at
subgroup level because these pedons had deep
cracks that remained open for more than 150
cumulative days for most years. Agarwal et al. (2012)
classified the soils of Wardha district of Vidharbha
region into Typic Haplusterts based on above
features.
The results lead to a conclusion that the
rice-growing soils of Central Telangana region of
Andhra Pradesh were shallow to very deep,
moderately well to poorly drained, neutral to slightly
saline, low to high in organic carbon, low to medium
in CEC, moderate to high base saturated and sandy
loam to clayey with variation in relation to
physiography. Regarding nutrient status, the soils
were low to medium in available nitrogen, low to high
in available phosphorous and potassium. Different
rice growing soils of Central Telangana region of
Andhra Pradesh were classified up to sub-group level.
54

CHARACTERIZATION AND CLASSIFICATION OF RICE GROWING SOILS
Location
Horizon
Table 1. Morphological properties of the pedons
Depth
(cm) Colour Mottels Texture Structure
Moist Wet C G T
P1: Fine, smectitic, iso-hyperthermic Vertic Haplustepts
Madhira Ap 0-18 7.5 YR 3/1 -- c m 2 sbk
Bwg 1 18-54 7.5 YR 4/1 -- c m 3 sbk
Bwg 2 54-100 7.5 YR 4/1 -- c m 3 abk
Bw 100-140 7.5 YR 4/1 -- c m 3 abk
P2: Fine-loamy, mixed, iso-hyperthermic Typic Haplustepts
Aswaraopeta Ap 0-12 2.5YR 6/4 2.5YR 3/3 scl m 2 sbk
Bw 1 12-26 2.5YR 6/4 2.5YR 3/3 scl m 2 sbk
Bw 2 26-60 2.5YR 7/6 5YR 3/4 sl f 2 sbk
Bw 3 60-95 2.5YR 6/8 5YR 5/6 scl f 2 sbk
P3: Fine, smectitic, iso-hyperthermic Typic Haplusterts
Pinapaka Ap 0-24 10YR 5/3 10YR 2/2 c m 3 abk
Bw 24-42 10YR 4/3 10YR 2/2 c m 2 sbk
Bss 1 42-89 10YR 4/3 10YR 3/2 c f 2 sbk
Bss 2 89-120+ 10YR 4/3 10YR 2/2 c f 2 abk
P4: Fine-loamy, mixed, iso-hyperthermic Udic Paleustalfs
Sangareddy Ap 0-14 7.5 YR 3/4 5 YR 3/4 scl m 3 sbk
Bw 14-28 7.5 YR 6/6 5 YR 5/6 scl f 3 abk
Bt 1 28-60 7.5 YR 5/4 7.5 YR 3/4 c m 3 sbk
Bt 2 60-95 7.5 YR 7/6 7.5 YR 4/1 c m 3 sbk
Bw 95-120+ 7.5 YR 7/6 7.5 YR 4/1 c m 3 sbk
P5: Fine, smectitic, iso-hyperthermic Typic Haplusterts
Siddipeta Ap 0-16 10YR 3/2 10YR 5/8 c f 3 abk
Bss 1 16-35 10YR 3/2 10YR 5/4 c f 3 abk
Bss 2 35-74 10YR 3/1 10YR 6/2 c f 3 abk
Bss 3 74-110+ 10YR 3/1 10YR 5/6 c f 3 abk
P6: Fine-loamy, mixed, iso-hyperthermic Udic Ustorthents
Gajwel A 0-25 7.5 YR 4/6 -- scl m 2 gr
AC 25-75+ 7.5 YR 4/6 -- scl f 2 gr
P7: Fine, smectitic, iso-hyperthermic Typic Haplusterts
Warangal Ap 0-16 10YR 4/2 7.5YR 6/8 c m 1 sbk
Bss 16-50 10YR 3/2 7.5YR 5/8 c m 2 abk
Bg 50-75 10YR 2/2 7.5YR 6/8 c m 2 abk
Bw 75-110+ 10YR 3/2 7.5YR 6/8 c m 2 abk
55

RAMPRASAD et al
Pedon No and
Location
P8: Fine-loamy, mixed, iso-hyperthermic Typic Haplustepts
Malyal Ap 0-18 10YR 4/2 7.5YR 4/4 scl m 2 sbk
Bw 1 18-30 10YR 4/3 7.5YR 4/4 scl m 2 sbk
Bw 2 30-66 10YR 4/4 7.5YR 4/4 scl m 3 sbk
C 66-155+ 10YR 4/5 7.5YR 4/4 scl f 3 sbk
P9: Fine-loamy, mixed, iso-hyperthermic Typic Rhodustalfs
Eturnagaram Ap 0-12 2.5YR 3/2 -- scl m 1 sbk
AB 12-50 2.5YR 4/6 -- scl f 1 sbk
Bt 1 50-86 2.5YR 4/8 -- scl m 2 sbk
Bt 2 86-98+ 2.5YR 4/6 -- scl m 2 sbk
P10: Fine, mixed, iso-hyperthermic Typic Haplustalfs
Ghanpur Ap 0-15 10YR 3/1 7.5YR 5/1 scl m 3 sbk
Btg 15-40 10YR 3/2 7.5YR 5/6 sc f 3 sbk
Bwg 40-80 10YR 3/1 7.5YR 6/8 sc f 3 sbk
Bg 80-110 10YR 3/1 10YR 5/8 sc f 3 sbk
Bt 110+ 10YR 3/1 10YR 3/2 c f 3 sbk
Table 2. Physical properties of the pedons
Mechanical composition
Bulk H.C
moisture
retention
Horizon (%) density
(%)
Sand Silt Clay
Mg m -3 cm hr -1 33 kPa
1500
kPa
P1: Madhira Ap 36 18 46 1.31 2.1 16.1 11.6
Bwg 1
31 20 49 1.36 1.6 21.8 12.4
Bwg 2
29 20 51 1.32 1.8 19.6 10.8
Bw 27 22 50 1.39 1.2 20.2 10.6
P2:Aswaraopeta Ap 52 22 26 1.38 3.4 14.1 9.8
Bw 1
52 20 28 1.44 1.9 18.6 11.1
Bw 2
64 16 20 1.55 2.1 18.8 12.6
Bw 3
60 19 22 1.71 1.6 19.2 14.7
P3:Pinapaka Ap 29 19 52 1.34 3.2 9.8 4.7
Bw 28 19 53 1.58 1.5 11.7 5.9
Bss 1
29 18 53 1.46 1.6 25.6 8.1
Bss 2
28 15 57 1.38 0.4 24.2 11.2
P4:Sangareddy Ap 53 21 26 1.45 4.2 19.1 11.2
Bw 51 17 32 1.68 2.6 20.1 9.6
Bt 1
35 11 54 1.64 1.8 26.7 13.4
Bt 2
33 12 55 1.54 2.2 29.3 16.6
Bw 35 13 52 1.68 1.6 30.1 14.8
56

CHARACTERIZATION AND CLASSIFICATION OF RICE GROWING SOILS
P5:Siddipeta Ap 20 23 57 1.24 1.2 26.3 14.4
Bss 1
17 24 59 1.3 1.6 34.5 13.1
Bss 2
13 21 66 1.31 1.2 38.3 16.1
Bss 3
14 17 69 1.33 1.1 39.1 16.5
P6:Gajwel Ap 59 12 29 1.56 4.4 16.8 12.6
AC 66 9 24 1.66 4.6 20.4 10.6
P7:Warangal Ap 44 15 41 1.41 1.6 23.1 12.5
Bss 40 15 45 1.41 0.6 25.7 14.2
Bg 39 16 45 1.45 0.1 27.6 15.2
Bw 43 13 45 1.48 0.1 32.9 17.7
P8:Malyal Ap 56 14 30 1.52 3.3 16.6 9.6
Bw 1
52 17 31 1.46 3.3 17.5 10.5
Bw 2
56 12 31 1.46 3.2 24.3 15.8
C 60 14 26 1.48 3.1 26.7 16.5
P9:Eturnagaram Ap 68 8 25 1.52 2.2 11 5.5
AB 68 8 24 1.59 1.4 14.2 8.1
Bt 1
63 8 29 1.6 1.9 15.9 9.7
Bt 2
62 10 29 1.6 1.1 16.2 9.9
P10:Ghanpur Ap 55 15 30 1.29 3.3 18 6.8
Btg 48 15 37 1.34 3.2 23.5 14.8
Bwg 50 14 36 1.36 2.8 33.4 22.6
Bg 48 13 39 1.41 2.4 37.4 21.7
Bt 41 17 43 1.42 0.4 35.8 23.6
REFERENCES
Agarwal, D. V., Ingle, S. R and Khambalkar, H. 2012.
Characterization of some cotton growing soils
of Wardha district of Vidharbha region (M.S.,
INDIA). Journal of Soils and Crops. 22(1): 159-
167.
Dey, J. K and Sehgal, J. L. 1997. Characteristics
and classification of some alluvium derived
paddy and associated non-paddy soils of
Assam. Agropedology. 7: 22-31.
Dhanorkar, B. A., Niranjana, K. V., Koyal, A., Naidu,
L. G. K., Reddy, R. S and Sarkar, D. 2010.
Soil resource inventory of lateritic terrain of
medak district, Andhra Pradesh for sustainable
crop planning. Agropedology. 20 (2): 97-102.
Muhr, G R., Datta, N. P., Subramone, H.S., Dever,
R.F., Leley, V. K and Dimahire, R. L. 1965.
Soil testing in India. United States Agency
for International Development Mission to India,
New Delhi.
Pardeep Kumar and Verma, T. S. 2005.
Characteristics and classification of some rice
growing soils of Palam Valley of Himachal
Pradesh. Agropedology.15(2): 80-85.
Ratnam, B.V., Rao, M. S and Rao, V.S. 2001.
Characteristics of rice growing and non-rice
growing Vertisols from Andhra Pradesh.
Journal of the Indian Society of Soil Science.
49(2): 371-373.
57

RAMPRASAD et al
Reza, S. K., Ahmed, N and Pal, S. 2010.
Characterization, classification and mapping
of soils of Panja-rao watershed, Saharanpur,
Utter Pradesh. Agropedology. 20(2): 124-132.
Soil Survey Staff, 2006 Keys to Soil Taxonomy. 10 th
Edition USDA, Natural Resources
Conservation Service, Washington D. C.
Soil Survey Staff. 1998. Keys to Soil Taxonomy.
Eighth edition, National Resource Conservation
Centre, USDA, Blacksburg, Virginia.
Walkley, A and Black, I.A. 1934. An examination of
the Dogiareff method for determination of soil
organic matter and a proposed modification of
the chromic acid situation method. Soil
Science. 37: 29-33.
58

J.Res. ANGRAU 41(2) 59-67, 2013
IDENTIFICATION OF SUPERIOR PARENTS AND CROSS COMBINATIONS BY
USING LINE x TESTER ANALYSIS IN FINGER MILLET Eleusine coracana L.
PARASHURAM PATROTI and JAYARAME GOWDA
All India Coordinated Small Millets Improvement Project (AICSMIP),
ICAR, University of Agricultural Sciences, GKVK, Bangalore-560 065
Date of Receipt : 07.03.2013 Date of Acceptance : 18.04.2013
ABSTRACT
Field experiment was conducted at Zonal Agricultural Research Station, University of Agricultural Sciences,
Gandhi Krishi Vignana Kendra, Bengaluru during 2009-10. The experimental material consisted of four lines viz.,
GE 4596, GE 6216, GE 4906 and GPU 28 and four testers viz., L 5, GE 5095, GPU 69 and GPU 48. The crosses were
affected in a Line x Tester fashion. The results revealed that among the lines GE 4596 and GPU 28 and among the
testers L 5 and GPU 69 had recorded high per se and gca for yield and most of the yield contributing characters.
Among the hybrid combinations GE 4596 x L 5 and GE 4596 x GPU 69 had significant and superior per se performance
for grain yield per plant, straw yield per plant, finger length, peduncle length, number of fingers per ear, culm
thickness and number of productive tillers per plant. Results from specific combining ability study, revealed that the
crosses viz., GE 4596 x L 5, GE 6216 x GPU 48 and GE 4906 x GPU 48 had significant sca effects for most of the
characters. The hybrids, GE 4596 x L 5, GE 4596 x GPU 69 and GPU 28 x L 5 were from parents with high x high gca
and GE 4596 x GE 5095, GE 6216 x GPU 69, GE 4906 x GPU 69 and GPU 28 x GE 5095 were from parents with high
x low gca combinations. Thus, six crosses are suggested for realization of transgressive segregants in F 2
and
subsequent generations.
Finger millet Eleusine coracana L. Gaertn.
also known as Ragi or African millet is an annual
plant widely grown as an important food crop in the
arid areas of Africa and South Asia. It ranks third in
importance among the millets after sorghum and pearl
millet in India. Finger millet ranks first both in area
and production among the ‘Nutricereals’ occupying
2.00 m.ha with a production of 2.6 million tons in
India with the highest productivity of 3600 Kg/ha in
the state of Karnataka (AICSMIP, 2005). Finger millet
provides staple food for a large section of farming
community and economically weaker sections in
many parts of India. Its nature of low input requirement
in terms of labour, technology, costs and high drought
resistance and long storage life makes it a pro-poor
and marginal farmers’ crop.
The newly evolved varieties are not showing
much yield advantage over the varieties bred and
released in earlier years. The efforts made by
Ravikumar et al. (1986) and Gurunathan (2006) in
finger millet, Srivatsav and Yadav (1977) in little millet,
Konstantinov and Linnik (1985) and Ramesh (1990)
in proso millet opens the way and scope to identify
superior parents and crosses to isolate desired
purelines for yield and other traits. Combining ability
analysis is usually employed to identify the desirable
parents and to study the nature of genetic variation.
Keeping this in view in the present investigation an
effort was made to hybridize the plants with different
geographical origins in order to assess the combining
ability for yield and its attributing traits.
MATERIALS AND METHODS
A field experiment was conducted during
kharif and rabi 2009-10 seasons at Zonal Agricultural
Research Station, University of Agricultural Sciences,
Gandhi Krishi Vignana Kendra, Bengaluru. The
experimental material consisted of eight finger millet
genotypes chosen from the working collection of
germplasm maintained at the Project Co-ordinating
Unit (Small millets), Bengaluru. Among the eight
genotypes four were selected as lines with purple
colour pigmentation at node, leaf juncture and glumes.
The rest four were selected as testers which are devoid
of purple pigmentation. The purple pigmentation is a
dominant character and a useful genetic marker in
identifying true crosses at the seedling stage.
Four lines were crossed to four testers in a
line x tester mating design (Kempthorne, 1957) in
kharif-2009, to generate hybrids by following hot water
treatment (Rao and Rao, 1962) for emasculation then
contact method for crossing (Ayyangar and Warrior,
email: parashu.patroti@rediffmail.com
59

PARASHURAM and JAYARAME
1934). Crossed seeds along with their parents were
sown in nursery during rabi-2009. The hybrids were
first identified in the nursery using purple plant
pigmentation as marker. All the eight parents (4 lines
and 4 testers) together with sixteen crosses were
evaluated during rabi-2009. The material was grown
in a single row of 3 m length with a spacing of 30 x
10 cm in a randomized block design and replicated
twice. The data were recorded on plant height, number
of fingers per ear, number of productive tillers per
plant, finger length, finger width, culm width, peduncle
length, days to 50 per cent flowering, days to
maturity, straw yield per plant, grain yield per plant
and test weight on five randomly selected plants.
The analysis of Randomised Block Design was
carried out based on the methods described by
Panse and Sukhatme (1967). The combining ability
analysis was done according to Kempthorne (1957).
RESULTS AND DISCUSSION
The analysis of variance revealed significant
differences among the parents as well as crosses
for all the traits. Higher level of significance in the
variance of parents vs hybrids for all the characters
clearly indicated the existence of significant level of
specific combining ability in the hybrids. Analysis of
variance for combining ability reveals that the mean
squares due to testers showed significant differences
for plant height, peduncle length, straw yield per plant
and grain yield per plant (Table 1),which indicates
that there was a good level of genetic difference
brought out by the testers. The variance due to line x
tester interaction was significant for all the characters
studied (Table 1). Non additive gene action was
noticed for all the characters studied. These results
supports the findings of Tamilcovane and Jayaraman
(1994) and Ravikumar et al. (1986) in finger millet
and Ramesh (1990) in proso millet.
The combining ability studies of the parents
had brought out the parents with high gca for different
traits. The line GE 4596 showed high gca for plant
height, number of fingers per ear, number of
productive tillers per plant, finger length, days to
maturity, straw yield per plant and grain yield per
plant. The line, GPU 28 showed high gca for finger
length, finger width, culm width, peduncle length and
days to 50 per cent flowering. The tester, L 5 was
identified for high gca effects for straw yield and grain
yield. The tester, GPU 69 showed high gca effects
for plant height, number of fingers per ear, finger
length, culm width, days to maturity, straw yield per
plant and grain yield per plant (Table 3).
Considering the overall assessment of yield
components for high gca and per se performance, a
close correspondence between mean performance
and gca effect was observed among parents. The
lines, GE 4596 and GPU 28 and the testers, L 5 and
GPU 69 had recorded high per se and gca for most
of the yield contributing characters studied (Table
2). These parents might be utilized in the hybridization
programme for selecting superior recombinants.
Tamilcovane and Jayaraman (1994) and Ravikumar
(1986) also identified this kind of good general
combiners in finger millet.
Specific combining ability is the deviation
from the performance predicted under general
combining ability. The sca was due to non-additive
genetic interactions. The hybrid, GE 4596 x L 5
possessed high sca effect for plant height, number
of tillers per plant, finger length, peduncle length, straw
yield per plant, grain yield per plant and 1000 grain
weight. The hybrid, GE 4906 x GPU 48 exhibited
high sca effect for plant height, number of fingers
per ear, finger length, finger width, culm width, grain
yield per plant and 1000 grain weight (Table 4).
Combination of favorable genes from the parents for
the corresponding traits might have resulted in high
sca effects. In the present study, hybrids were
identified with significant and high sca effects for
different characters. Many of these hybrids were from
either one of the parents with high gca or parents
with low x low general combiners. Hence it forms the
evidence that the parents with high or low gca will
have greater probability to have good
complementarily with other parents. Similar results
were obtained by Konstantinov and linnik (1985) and
Ramesh (1990) in proso millet.
For exploiting hybrid vigor, the components
like per se performance and sca effects are important.
Selection based on any of these criteria alone may
not be effective. So selection must be based on all
these parameters. In the present study, the hybrids
were also evaluated on the basis of above said
parameters. Among the 16 hybrids studied GE 4596
x L 5 and GE 4596 x GPU 69 were identified as the
60

IDENTIFICATION OF SUPERIOR PARENTS AND CROSS COMBINATIONS
Table 1. Analysis of variance for line x tester design with respect to yield and yield attributes in finger millet
* and ** : Significant at 5 and 1 per cent level, respectively
Where,
PH : Plant height (cm) PL : Peduncle length (cm) NFE : Number of fingers/ear
DFL : Days to 50% flowering NPT : Number of tillers/plant DMT : Days to maturity
FL : Finger length (cm) SY : Straw yield (g) FW : Finger width (cm)
GY : Grain yield/ plant (g) CW : Culm width (cm) TW : Test weight/plant (g)
61

PARASHURAM and JAYARAME
Table 2. Mean performance of Parents and Crosses for twelve characters in finger millet
62

IDENTIFICATION OF SUPERIOR PARENTS AND CROSS COMBINATIONS
Table 2. ( contd….)
63

PARASHURAM and JAYARAME
Table 3. General combining ability effects of parents for yield and yield contributing characters in finger millet
64

IDENTIFICATION OF SUPERIOR PARENTS AND CROSS COMBINATIONS
Table 4. Specific combining ability effects of crosses for yield and yield attributes
65

PARASHURAM and JAYARAME
Table 5. Proportional contribution of lines, testers and interaction of line x tester for various yield
and yield contributing characters in Finger millet
Characters
Contribution of
females (%)
Contribution of
males (%)
Contribution of
females (%) X
male (%)
Plant height 71.28 7.76 20.96
Number of fingers per ear 78.96 6.75 14.29
Number of productive tillers per plant 27.19 12.59 60.21
Finger length 57.48 14.42 28.1
Finger width 15.72 10.69 73.58
Culm width 32.64 14.75 52.61
Peduncle length 71.38 3.69 24.92
Days to 50% flowering 30.93 20.6 48.48
Days to maturity 59.04 22.5 18.46
Straw yield per plant 54.48 19.35 26.17
Yield per plant 64.17 13.58 22.25
1000 seed weight 48.71 5.29 46.01
Table 6. Estimates of variance components for yield and yield contributing characters in finger millet
Characters 2 gca 2 sca 2 gca/ 2 sca
Plant height 4.80 24.47 0.20 : 1
Number of fingers per ear 0.06 0.11 0.53 : 1
Number of productive tillers per plant 0.00 0.09 0.00: 1
Finger length 0.04 0.29 0.12 : 1
Finger width -0.00 0.01 -0.03 : 1
Culm width 0.00 0.00 0.02 : 1
Peduncle length 1.60 10.52 0.15 : 1
Days to 50% flowering 0.03 0.86 0.04 : 1
Days to maturity 0.17 0.20 0.84 : 1
Straw yield per plant 7.67 55.82 0.14 : 1
Yield per plant 2.68 14.65 0.18 : 1
1000 seed weight 0.00 0.03 0.03 : 1
best crosses since they possessed desirable per se
performance and sca for plant height, number of
productive tillers per plant, straw yield per plant and
grain yield per plant (Table 4).
For all the 12 characters studied, the
contributions of females were considerably more
compared to males to the variance for all the
characters (Table 5). With respect to estimates of
variance components, the variance due to specific
combining ability effects was more for all the traits
than variance due to general combining ability effects
but none of the characters were exceeded unity
66

IDENTIFICATION OF SUPERIOR PARENTS AND CROSS COMBINATIONS
indicating the predominance of non additive gene
action (Table 6). From this study, it can be concluded
that the non additive gene action favouring
hybridization to some extent and the crosses, GE
4596 x L 5 and GE 4596 x GPU 69 are the best
crosses for grain yield and most of the yield
contributing characters.
REFERENCES
All India Coordinated Small Millets Improvement
Project, Annual Report 2005. ICAR, Bangalore.
pp.24-35.
Ayyangar, G. N. R and Wariar, U. A. 1934. Anthesis
and pollination in ragi, Eleusine coracana
Gaertn., the finger millet; Indian Journal of
Agricultural Sciences. 4: 386- 393.
Gurunathan. 2006. Line x tester analysis in forage
sorghum, Introduction to sorghum and millets,
Millets News letter 35: 79-80.
Kempthorne, O. 1957. An introduction to genetic
statistics. John Wiley and Sons, New York,
USA. pp. 245-285.
Konstantinov, S.I and Linnik, V.M. 1985. Utilizing
heterosis in proso millet breeding, Selekt, i.
Semen. USSR., 2: 15-17.
Panse, V.G and Sukhatme. 1967. Statistical methods
for agricultural workers, ICAR, New Delhi, pp.
140- 145.
Rama Rao, V and Rama Rao, K. V. 1962.
Emasculation of ragi flowers (Eluesine.
coracana) by hot water treatment for
hybridization work. The Andhra Agricultural
Journal. 9: 290-292.
Ramesh, S. 1990. Studies on heterosis and genetics
of qualitative characters in proso millet
(Panicum milliaceum L.). M.Sc. (Agri) Thesis
submitted to University of Agricultural
Sciences, Bangalore, India.
Ravikumar, R.L., Shankare Gowda, B.T and
Seetharam, A. 1986. Studies on heterosis in
finger millet. Millets Newsletter, 5: 26-27.
Srivastava, D.P and Yadav, A. 1977. Heterosis in
Panicum miliare lam. Curr. Res., 6(4): 66-67.
Tamilcovane, S and Jayaraman, N. 1994. Association
between yield components in ragi. Journal of
Phytological Research, 7(2):193-194.
67

J.Res. ANGRAU 41(2) 68-73, 2013
EFFECT OF FRONT LINE DEMONSTRATIONS AND TRAININGS ON KNOWLEDGE
AND ADOPTION OF INTEGRATED PEST MANAGEMENT PRACTICES BY
CHICKPEA FARMERS OF PRAKASAM DISTRICT OF ANDHRA PRADESH
O. SARADA and G. V. SUNEEL KUMAR
Krishi Vigyan Kendra, Acharya N.G. Ranga Agricultural University, Darsi – 523 247
Date of Receipt : 21.01.2013 Date of Acceptance : 05.03.2013
ABSTRACT
The study was conducted in Prakasam District of Andhra Pradesh during 2012. The investigation included
50 chickpea farmers from two adopted villages of Krishi Vigyan Kendra who have participated in trainings and Front
Line Demonstrations on Integrated Pest Management practices and 50 other chickpea farmers who have not
undergone trainings and FLDs on IPM from a non-adopted village. More than fifty per cent of beneficiary chickpea
farmers had medium level of knowledge and adoption with respect to Integrated Pest Management practices,
followed by 32.00 and 36.00 per cent of beneficiary farmers under high category respectively. Whereas 40.00 and
48.00 per cent of the non-beneficiary farmers were in low knowledge and adoption categories, respectively. A large
majority of beneficiary chickpea farmers were fully adopting summer ploughing (100.00%), need based plant
protection measures (86.00%), growing of trap crop (78.00%), disease resistant cultivars (62.00%), seed treatment
(56.00%) and partially adopting spraying of neem formulations and erecting bird perches. The major constraints
faced by beneficiary farmers in adoption of recommended Integrated Pest Management practices of chickpea are
non-availability of disease resistant cultivars (98.00%), inputs like bacterial pesticides, pheromone traps (94.00%)
and complex and labor intensive practices of neem seed kernel extract and poison bait preparation (72.00%) etc.
Chickpea is the third most important grain
legume that accounts for nearly 40 per cent of the
total pulse production in India. In India, it is grown in
5.65 mha producing 4.15 m. ton annually with
productivity of 740 Kg ha -1 . In Andhra Pradesh, it is
grown in an area of 5.29 lakh ha with annual
production of 6.28 lakh tons and productivity of 842
Kg ha -1 (Ministry of Agriculture, 2009). Prakasam
district of Andhra Pradesh has highest acreage (0.95
lakh ha.) under chick pea and is rapidly increasing
for the last three or four years by replacing tobacco
and other commercial crops in view of their eroding
profitability when compared to chick pea. In order to
get highest yields from the crop, farmers are using
chemical inputs indiscriminately which has led to pest
resistance and environmental pollution.
The use of pesticides that are used by farmers
to improve production and productivity are beset with
conflicting interests between the farmers on one hand
and society on the other. Even though social
considerations would warrant the use of target
specific pesticides which degrade expeditiously in
the environment, the farmers use those pesticides
that are easily available, cheap and simple to use.
In this context, Front Line Demonstrations
(FLDs) and trainings on recommended Integrated Pest
Management (IPM) practices in chickpea were being
implemented by Krishi Vigyan Kendra (KVK), Darsi
in its adopted villages of Prakasam district for three
years from 2009 to 2011 with the twin objectives of
minimizing environmental pollution and maximizing
the cost benefit ratio. With this background in view,
to know the effect of FLDs and trainings on knowledge
and adoption levels of farmers, this particular study
was taken up with the following specific objectives.
To assess the overall knowledge and adoption
levels of beneficiary and non-beneficiary chickpea
farmers with respect to recommended IPM practices
in chickpea.
To assess the component wise knowledge and
adoption levels of beneficiary and non-beneficiary
chickpea farmers with respect to recommended IPM
practices in chickpea.
email: saradasuneel@gmail.com
68

EFFECT OF FRONT LINE DEMONSTRATIONS AND TRAININGS ON KNOWLEDGE
To elicit constraints of beneficiary farmers in
adoption of recommended IPM practices in chickpea.
MATERIALS AND METHODS
The present study was conducted in
Prakasam district of Andhra Pradesh during 2012.
Two adopted villages viz., Chinarikatla and
Pedarikatla of Konakanmitla mandal were purposively
selected for the study where FLDs and trainings on
IPM practices in chickpea were organized for three
consecutive years 2009-10, 2010-11 and 2011-12 by
KVK, Darsi. From each of the selected adopted
village, 25 beneficiary chickpea farmers who regularly
attended trainings, practically involved in FLDs and
visited IPM demonstration plots were selected. Thus
a total of 50 respondents were purposively selected
for the study. For comparison, another 50 nonbeneficiary
chickpea farmers who were not exposed
to FLD’s and trainings were selected from a nonadopted
village, Laxminagar of Darsi mandal. A total
of 100 (50 beneficiary and 50 non-beneficiary)
chickpea farmers constituted the sample size.
To measure the knowledge and adoption of
IPM practices by chickpea farmers recommended
IPM practices, a schedule comprising of ten
components demonstrated by KVK was developed
and administered to respondents. The data on
knowledge and adoption levels of beneficiary and nonbeneficiary
chickpea farmers was collected by using
pre tested schedule employing personal interview
method. The responses were scored, quantified,
categorized and tabulated using mean, standard
deviation, frequencies and per centage. Each
beneficiary chickpea farmer was also interviewed by
posing open ended questions so as to unearth
constraints he/she has experienced. Based on
frequency and percentage; the major constraints in
adoption of recommended IPM practices were
prioritized.
RESULTS AND DISCUSSIONS
Perusal of table 1 on overall knowledge level
of chickpea farmers on IPM practices gained through
demonstrations and trainings of KVK revealed that
54.00 per cent, 32.00 per cent and 14.00 per cent of
beneficiary farmers are in medium, high and low
categories of knowledge respectively. Whereas, 48.00
per cent of the non-beneficiary chickpea farmers were
with medium knowledge followed by 40.00 and 12.00
per cent with low and high knowledge levels,
respectively (Table 1). This clearly indicated that there
was a significant increase in the knowledge level of
beneficiary farmers with respect to IPM practices of
chickpea from which it can be inferred that when
efforts are made through trainings and FLDs, it is
possible to increase the knowledge level of farmers.
The findings of Vijaya (1995), Yavana Priya et. al.,
(2010) and Sarada and Suneel Kumar (2011) on
various subjects can be quoted to support the present
results.
The results in Table 2 on the practice wise
knowledge level of beneficiary and non-beneficiary
chickpea farmers regarding the technological impact
of FLDs and trainings on specific IPM practices
revealed that cent per cent of the beneficiary farmers
had correct knowledge about deep summer ploughing
as the best IPM practice in reducing the pest load in
chickpea. Also, 92.00 per cent of the beneficiary
farmers had knowledge on need based plant
protection operations. Majority of beneficiary farmers
had knowledge on practices such as sowing of
marigold as trap crop to attract Helicoverpa for egg
laying (88.00%), treating the seeds with a fungicide
before sowing to protect the crop from soil fungal
pathogens (84.00%) and erecting bird perches in the
field to harbor the predatory birds (72.00 %). It was
interesting to note that more than fifty per cent of the
beneficiary farmers had correct knowledge on use of
wilt disease resistant/tolerant varieties (64.00%),
spraying of 5% NSKE or commercially available neem
formulations immediately after noticing egg or early
larval instars of defoliating caterpillars on the crop
(54.00%), application of poisoned bait to protect the
crop defoliation from Spodoptera (52.00%). Less than
fifty per cent of beneficiary respondents had
knowledge with respect to Helicoverpa and
Spodoptera adult population monitoring through
pheromone traps (48.00%) and use of bacterial (Bt)
formulations against the Helicoverpa larval instars
(46.00%). The reason is that these are new practices
which are not practiced from the past and are not
traditional to farmers, hence farmers gained
comparatively less knowledge on these practices.
In case of majority of non-beneficiary
farmers, the knowledge with respect to IPM practices
of chickpea was incorrect for practices such as
spraying of Bt formulations and use of poison baits
(100.00%), need based spraying of plant protection
chemicals (96.00%), seed treatment (94.00%), adult
69

SARADA and SUNEEL KUMAR
population monitoring through pheromone traps
(92.00%), erecting bird perches and use of wilt
disease resistant/tolerant varieties (86.00%),
spraying of 5% NSKE or neem formulations at initial
stages (82.00%) and sowing of marigold as trap crop
for Helicoverpa (64.00%), while the correct response
about deep ploughing during summer was given by
88.00 per cent of respondents.
Results in Table 3 on overall adoption of
chickpea IPM practices by beneficiary and nonbeneficiary
farmers reveals that 36.00 per cent of
the beneficiary chickpea farmers were in high
adoption category as against only 8.00 per cent of
non-beneficiary farmers. Further, 52.00 per cent of
beneficiary farmers and 44.00 per cent of nonbeneficiary
farmers belonged to medium adoption
category in adopting IPM practices of chickpea at
farm level. However, only 12.00 per cent of beneficiary
farmers and 48 per cent of non beneficiary farmers
were found in low category in adopting IPM practices
respectively. This pointed out that the trainings and
FLDs have influenced the beneficiary chickpea
farmers as these efforts have increased the
knowledge levels of beneficiary farmers which in turn
positively influenced their adoption levels. These
findings are in agreement with the results reported
by Naresh (1996) on knowledge and adoption of
improved sericulture practices.
Component wise adoption pattern of specific
IPM practices by chickpea farmers revealed that good
per centage of beneficiary farmers were fully adopting
IPM practices of chickpea (Table 4). Cent per cent
of the beneficiary farmers were practicing deep
ploughing during summer months (100.00%), need
based plant protection measures against defoliators
and pod borers (86.00%), sowing of marigold to attract
the adults of Helicoverpa for egg laying and thereafter
grownup larvae to feed on trap crop (78.00%), growing
of Fusarium wilt disease resistant/tolerant varieties
(62.00%) and treating the seeds with a fungicide for
protection against wilt and root rot diseases (56.00%).
The full adoption response by beneficiary farmers on
the use of poison bait to attract and kill grownup
larvae of Spodoptera was 38.00 per cent only. The
information given during trainings and demonstrations
about these practices might have promoted the
beneficiary farmers to acquire knowledge and adopt.
Further, 64.00 per cent of beneficiary farmers were
partially adopting spraying of 5% NSKE or
commercially available neem formulations at initial
70
stages followed by erecting bird perches in the field
to harbor the predatory birds (56.00%). Thus, IPM
practices which are easy, simple, practicable and
profitable at farm level are adopted by beneficiary
farmers after getting exposed to FLDs and trainings
during the crop season. Also, the technical guidance
was made available to the beneficiary farmers to take
up timely IPM practices in chickpea. Whereas, great
majority of them were not adopting practices which
are complex and not available locally spraying of Bt
formulations (80.00%) and monitoring of adult
population using pheromone traps with lures
(48.00%). Majority of the farmers opined that the
reason behind this non adoption of trained and
demonstrated IPM practices were non-availability of
key inputs locally.
With respect to non-beneficiary farmers,
great majority of them were not adopting the principal
IPM components such as use of Bt formulations,
poison baits (100.00%), seed treatment (96.00%),
pheromone traps (94.00%), neem formulations
(82.00%), bird perches (72.00%) and disease
resistant/tolerant varieties (64.00%). It is noteworthy
to found that 68.00 per cent of non-beneficiary farmers
were fully adopting summer ploughing and practices
such as sowing of trap crop (40.00%) and need based
plant protection operations (34.00%) were partially
adopted by non-beneficiary farmers in chickpea. The
reasons could be, these are age old, traditional
practices followed from fore fathers. Hence though
non beneficiary farmers are not exposed to IPM
demonstrations and trainings, adoption is seen.
Hence, if the farmers are better exposed to IPM
technology through with trainings, field visits, skill
demonstrations and FLDs, with the observation and
analysis of each of the IPM components in chickpea,
it is possible to increase their knowledge levels and
in turn their adoption levels. These extension
methods create an environment in which all the
powerful senses are involved and also the individual
will be given an opportunity to discuss in group and
gain the confidence on IPM practices.
The constraints in adoption as expressed by
the beneficiary farmers while adopting the IPM
practices in chickpea are presented in Table 5. Nearly
cent per cent of the beneficiary farmers expressed
constraints in getting quality seed of disease
resistant/tolerant varieties (98.00%), Bt formulations
and pheromone traps with lures (94.00%). Complexity
in preparing NSKE at farm level (72.00%), labor

EFFECT OF FRONT LINE DEMONSTRATIONS AND TRAININGS ON KNOWLEDGE
intensive practice of preparing poison bait and
application in large area (64.00%), high cost of
pesticides (52.00%) and difficulty in remembering
pesticide dosage calculations (50.00%) were the other
major constraints expressed by beneficiary farmers.
It is logical to derive from the above findings and
discussion that the IPM practices in chickpea which
were disseminated through trainings and FLDs of
Table 1. Categorization of chickpea farmers according to their overall knowledge scores on selected
IPM practices of chickpea crop
S.
No.
Category Beneficiary farmers n=50 Non-beneficiary farmers n=50
Frequency % Frequency %
1 Low 7 14.00 20 40.00
2 Medium 27 54.00 24 48.00
3 High 16 32.00 6 12.00
Total 50 100.00 50 100.00
Table 2. Response analysis of knowledge of chickpea farmers on selected IPM practices
S.
IPM practices Beneficiary farmers N=50 Non- beneficiary farmers N=50
No recommended
CK ICK CK ICK
Frq % Frq % Frq % Frq %
1 Deep summer ploughing 50 100.00 0 0.00 44 88.00 6 12.00
2 Use of wilt disease
32 64.00 18 36.00 7 14.00 43 86.00
resistant/tolerant varieties
3 Seed treatment with
42 84.00 8 16.00 3 6.00 47 94.00
carbendazim/thiaram
4 Sowing of marigold as trap 44 88.00 6 12.00 18 36.00 32 64.00
crop for Helicoverpa
5 Helicoverpa and Spodoptera 24 48.00 26 52.00 4 8.00 46 92.00
adult population monitoring
through pheromone traps
6 Erection of bird perches 36 72.00 14 28.00 7 14.00 43 86.00
20/acre
7 Spraying of 5%NSKE or 27 54.00 23 46.00 9 18.00 41 82.00
neem formulations after
observing egg and early
larval stages of lepidopteran
caterpillars
8 Spraying of 400 gm of 23 46.00 27 54.00 0 0.00 50 100.00
bacterial formulation (Bt) in
200 lts of water twice with
one week interval
9 Use of poison baits for grown 26 52.00 24 48.00 0 0.00 50 100.00
up larvae of Spodoptera
10 Need based spraying of
Acephate 1gm / quinalphos
2.0 ml/ chloripyriphos 2.5 ml/
diflubenzuron 1.0 ml /
Thiodicarb 1.0gm/ lt. water
twice or thrice
46 92.00 4 8.00 2 4.00 48 96.00
CK - Correct Knowledge ICK - Incorrect Knowledge Frq - Frequency
71

SARADA and SUNEEL KUMAR
Table 3. Overall adoption scores of chickpea farmers on selected IPM practices
S. Category Beneficiary farmers n=50 Non-beneficiary farmers n=50
No.
Freq % Freq %
1 Low 6 12.00 24 48.00
2 Medium 26 52.00 22 44.00
3 High 18 36.00 4 8.00
Total 50 100.00 50 100.00
Table 4. Response analysis of adoption of chickpea farmers on selected IPM practices
S.
N
o.
IPM practices
recommended
1 Deep summer
ploughing
2 Use of wilt
disease
resistant/tolera
nt varieties
3 Seed treatment
with
carbendazim/th
iaram
4 Sowing of
marigold as
trap crop for
Helicoverpa
5 Helicoverpa
and
Spodoptera
adult
population
monitoring
through
pheromone
traps
6 Erection of bird
perches
20/acre
7 Spraying of
5%NSKE or
neem
formulations
after observing
egg and early
larval stages of
lepidopteran
caterpillars
8 Spraying of
400 gm of
bacterial
formulation (Bt)
in 200 lts of
water twice
with one week
interval
Beneficiary farmers N=50 Non-beneficiary farmers N=50
FA PA NA FA PA NA
Frq % Frq % Frq % Frq % Frq % Frq %
50 100 0 - 0 0 34 68 0 - 16 32
31 62 0 - 19 38 18 36 0 - 32 64
28 56 14 28 8 16 0 - 2 4 48 96
39 78 10 20 1 2 6 12 20 40 23 46
8 16 18 36 24 48 0 - 3 6 47 94
19 38 28 56 3 6. 3 6 11 22 36 72
14 28 32 64 4 8. 2 4 7 14 41 82
2 4 8 16 40 80 0 - 0 - 50 100.00
72

EFFECT OF FRONT LINE DEMONSTRATIONS AND TRAININGS ON KNOWLEDGE
S.
N
o.
IPM practices
recommended
9 Use of poison
baits for grown
up larvae of
Spodoptera
10 Need based
spraying of
Acephate 1gm
/ quinalphos
2.0 ml/
cloripyriphos
2.5 ml/
diflubenzuron
1.0 ml /
Thiodicarb
1.0gm/ lt. water
twice or thrice
Beneficiary farmers (N=50)
Non-beneficiary farmers (N=50)
FA PA NA FA PA NA
Frq % Frq % Frq % Frq % Frq % Frq %
19 38 15 30 16 32 0 0 0 - 50 100
43 86 7 14 0 - 7 14 17 34 26 52
FA - Fully Adopted PA - Partially Adopted NA - Not adopted Frq - Frequency
KVK were found to increase knowledge and
adoption levels of farmers largely. Hence all KVK’s,
NGO’s, DAATTC’s should intensify their efforts in
popularizing IPM practices and take steps to stand
by the farmer and solve all resource and other
constraints faced at the time of application.This
provides an ample scope for the improvement of
knowledge and adoption among the farmers with
respect to IPM practices in chickpea.
Table 5. Constraints of beneficiary farmers in adoption of recommended IPM practices
S. No. IPM technologies Number Per cent
REFERENCES
1 Non-availability of quality seed of disease resistant/tolerant
varieties
2 Non-availability of Bt bacterial formulations and pheromone
traps with lures locally
49 98.00
47 94.00
3 Complexity in preparing NSKE 36 72.00
4 labor intensive practice of preparing poison bait and
application for large holdings
32 64.00
5 Difficulty in remembering and calculating pesticide dosages 25 50.00
6 High cost of pesticides 26 52.00
Naresh, N. T. 1996. A study on knowledge and
adoption of improved sericulture practices
among trained women in Bangalore rural
district. M. Sc (Agri.) Thesis submitted to
University of Agricultural Sciences, Bangalore
Sarada, O and Suneel Kumar, G. V. 2011. Impact of
Front line demonstrations and trainings on
knowledge levels of brinjal growers with
respect to IPM practices. The Andhra
Agricultural Journal. 58 (4): 545-549
Vijaya, B. V. 1995. Impact of WYTEP training on
farm women in Bangalore district. M. Sc (Agri.)
Thesis submitted to University of Agricultural
Sciences, Bangalore.
Yavana Priya, D., Eswarappa, G and Manjunatha,
B. N. 2010. Knowledge level of farm women
participants of farmer field schools on tomato
cultivation. Mysore Journal of Agricultural
Sciences. 44 (4): 847-851
73

J.Res. ANGRAU 41(2) 74-77, 2013
EFFECT OF FEEDING COMPLETE FEED CONTAINING POULTRY LITTER ON
RUMEN NITROGEN AND TOTAL VOLATILE FATTY ACIDS
IN SHEEP AND GOAT
J. NARASIMHA, V.CHINNI PREETHAM and S.T.VIROJI RAO
All India Co-ordinated Research Project on poultry breeding, College of Veterinary Science,
Sri Venkateswara Veterinary University, Hyderabad-500030
Date of Receipt : 28.12.2012 Date of Acceptance : 22.02.2013
ABSTRACT
A complete feed containing poultry litter (35%) and other feed ingredients were formulated and processed
in to mash. The feed was tested on six each of Nellore rams and indigenous bucks in digestion cum-metabolism trial.
Rumen liquor samples were collected on two consecutive days at 0, 2, 4 and 6 hours of feeding. The H - ion and total
volatile fatty acid concentrations were significantly (P>0.01) higher in sheep than in goats. Irrespective of species
the concentration of total volatile fatty acid increased and attained peak values at 2 and 4 hours of post feeding, thus
showing an inverse relationship of H - ion concentration. The concentration of total nitrogen, TCA insoluble nitrogen,
food and protozoal nitrogen in strained rumen liquor was significantly higher in goats than in sheep. However,
ammonia and residual nitrogen concentrations did not differ significantly between sheep and goats. Time of sampling
had highly (P>0.01) significant effect on all the rumen parameters in both sheep and goats.
INTRODUCTION
The Poultry population in India is 489 million and the
manure availability is estimated to be 12.1 million
tons (Livestock census, 2003). Poultry waste is an
important source of energy as well as un-conventional
non protein nitrogen source for ruminants. In the
present experiment an attempt was made to efficiently
utilize poultry litter in complete feed of sheep and
goats and to study its effect on rumen fermentation
pattern.
MATERIALS AND METHODS
The layer poultry litter required for the present
study was obtained in a single lot from AICRP on
poultry breeding, Rajendra Nagar and was sun dried.
Six each of healthy Nellore rams and indigenous
bucks weighing 18.90±0.80 and 18.50±0.67
respectively were fed complete feed containing
poultry litter (35%), cotton seed hulls (40%), wheat
bran (15%), molasses (8.5%), mineral mixture (1.0%)
and salt (0.5%), Rovimix (vitamin supplement) 10 g
per 100kg. of the ration. The complete feed thus
prepared has protein and energy levels according to
ICAR (1985) recommendations. The experimental
feed was offered to each animal ad libitum (restricting
refusals to 3.5%) in a digestion and metabolism
experiment. The metabolism trial was conducted on
all the twelve animals. After three weeks of
adjustment period, the rumen liquor was collected
from each animal four times, once before feeding (0
hr) and at 2, 4 and 6 hours post feeding. The rumen
liquor samples were analyzed in accordance with
standard procedure for total nitrogen, TCA insoluble
protein nitrogen Cline et al., (1958), residual nitrogen,
food and protozoal nitrogen Singh et al.,
(1986),ammonia nitrogen Schwartz and Schoeman
(1964) and TVFA Bernett and Reid (1957)
concentrations. Feed samples were analyzed for
proximate principles and phosphorus (AOAC 2005)
and calcium by the method of Talapatra et al., (1940).
Statistical analysis of data was done as per the
methods suggested by Nageshwer Rao ( 1983).
RESULTS AND DISCUSSION
The experimental ration and poultry litter were
analyzed for proximate principles and the results are
presented in Table 1. The mean concentrations of
rumen metabolites as affected by species and time
of sampling are shown in Table 2. In the present study
pH was significantly (P>0.01) higher in sheep than in
goats. Irrespective of the species, the concentration
of total volatile fatty acid increased and attained peak
values at 2 hours of post feeding. There is an inverse
relationship of H - ion concentration and total volatile
fatty acids and similar findings were reported by
Venugopal et al., (1998). The concentration of total
nitrogen (105.21), TCA insoluble nitrogen (38.64), food
email: simha_vet@yahoo.com
74

EFFECT OF FEEDING COMPLETE FEED CONTAINING POULTRY LITTER ON RUMEN NITROGEN
and protozoal nitrogen (29.85) were significantly
(P>0.01) higher in goats than in sheep, which
indicated better digestibility of fiber in goats than
sheep. Similar findings were reported by
Shyamadayal et al., (1995) in goats. No significant
(P>0.01) difference in rumen ammonia concentration
was observed between sheep and goats. Time of
sampling had significant (P>0.01) effect both in sheep
and goats. The mean residual nitrogen and ammonia
concentrations did not differ significantly between
sheep and goats. The time of sampling had highly
significant (P>0.01) effect on all the rumen
parameters in both sheep and goats and attained peak
levels at 2 hours of post feeding.
Table 1. Proximate composition of experimental ration and poultry litter (%DM)
Proximate principle Experimental ration (%) Poultry litter (%)
Dry matter 91.25 93.45
Organic matter 80.00 63.21
Crude protein 12.18 15.70
Ether extract 1.87 0.87
Crude fibre 30.17 15.08
Total ash 20.00 36.78
Acid insoluble ash 6.19 12.39
Nitrogen free extract 35.78 31.57
Calcium 0.89 4.57
Phosphorous 0.76 3.7
Table 2. Rumen metabolic profile at different intervals in sheep and goats fed experimental ration
Species
Hours of collection
0 2 4 6 Overall mean pH
Sheep 6.87 6.54 6.85 6.95 6.80 a
± SE 0.34
Goat 6.69 6.39 6.65 6.83 6.64 b
± SE 0.15
Total Volatile Fatty Acids
Sheep 11.08 17.19 14.39 12.39 13.74 a
± SE 1.99
Goat 10.39 15.65 11.02 8.41 11.67 b
± SE 2.39
Total Nitrogen (mg/100ml)
Sheep 77.65 123.32 94.72 77.71 93.35 b
± SE 13.93
Goat 77.51 153.28 107.24 82.82 105.21 a
± SE 23.01
75

NARASIMHA et al
TCA Insoluble Protein Nitrogen (mg/100ml)
Sheep 27.02 38.19 31.48 27.73 31.10 a
± SE 4.02
Goat 27.37 51.06 43.48 32.67 38.64 b
± SE 7.14
Ammonia Nitrogen (mg/100ml)
Sheep 3.33 11.84 8.50 5.08 7.19 a
± SE 2.43
Goat 3.51 11.80 8.52 4.35 7.04 a
± SE 2.45
Food and Protozoal Nitrogen (mg/100ml)
Sheep 22.00 31.31 24.58 21.47 24.84 b
± SE 3.49
Goat 22.50 49.54 25.88 21.46 29.85 a
± SE 8.88
Residual Nitrogen (mg/100ml)
Sheep 25.28 42.39 29.86 23.44 30.24 a
± SE 6.25
Goat 24.14 42.21 29.36 27.78 30.37 a
± SE 7.31
NB: Values bearing different superscripts differ significantly.
REFERENCES
AOAC., 2005. Official methods of analysis.
Association of official analytical chemist.18 th
Ed. Washington. DC. USA.
Barnett, A. J. G. and Reid, R. L. 1957. Studies on
the production of volatile fatty acids from grass
by rumen liquor in an artificial rumen. The
volatile fatty acid production from grass. J.
Agric. Sci. Cam. 48, 315-321.
Cline Jack, H. T. V. Hershberger and Orville G.
Bentley. 1958. Utilization and/or Synthesis of
Valeric Acid during the Digestion of Glucose,
Starch and Cellulose by Rumen Micro-
Organisms in vitro. Journal of Animal Science.
17:284-292.
ICAR. 1985. Nutrient requirement of livestock and
poultry publications and information division
Indian Council of Agricultural Research, New
Delhi.
Livestock census,2003. Department of animal
husbandry, dairying and fisheries. Ministry of
Agriculture, Government of India. http: //dahd/
nic.in/census.htm.
Nageswera Rao,G. 1983. Statistics for Agricultural
sciences. Oxford and IBH Publishing
company, New Delhi.
Singh, B and Negi, S.S. 1986. Studies on the effect
of supplementing extra energy to poultry litter
76

EFFECT OF FEEDING COMPLETE FEED CONTAINING POULTRY LITTER ON RUMEN NITROGEN
rations of sheep. Indian Journal of Animal
Nutrition 3: 76-80.
Shyamadayal, J., Sreedhar, C., Janardhan Reddy,
T and Purushotham, N.P. 1995. Comparative
nutritive evaluation of maize husk in Sheep
and goats. Indian veterinary Journal 72:1045-
1049.
Schwartz, H.N and Schoeman, G.A. 1964. Utilization
of urea by sheep. 1 Rates of breakdown of
urea and carbohydrates in vivo and in vitro.
Journal of Agricultural Sciences 63:289.
.Talapatra, S.K.,Ray,S.C and Sen, K.C. 1940. The
analysis of mineral constituents in biological
materials. Indian Journal of Veterinary Science
and A.H. 10:243.
Venugopal Rao, D., Naidu, M.M and Raghavan G.V.
1998. Effect of feeding complete feed
containing Poultry droppings on rumen nitrogen
and total volatile fatty acids in sheep and goats.
Indian Veterinary Journal 75:662-664.
77

J.Res. ANGRAU 41(2) 78-85, 2013
EFFICACY OF CONTROLLED INTERNAL DRUG RELEASING (CIDR)
DEVICE ON SYNCHRONIZATION OF ESTRUS AND FERTILITY IN EWES
K. MURALI MOHAN, K. SADASIVA RAO and K.G. SOLMON RAJU
Department of Veterinary Gynaecology and Obstetrics, College of Veterinary Science,
Sri Venkateswara Veterinary University, Rajendranagar, Hyderabad – 5000 30
Date of Receipt : 23.01.2013 Date of Acceptance : 28.03.2013
ABSTRACT
The present study was aimed to determine the efficacy of CIDR for synchronization of estrus in ewes. The
ewes were synchronized with controlled internal drug releasing (CIDR) device containing 300 mg of progesterone.
A total of 120 post partum, parous, healthy ewes aged about 2 to 5 years were divided into 5 groups and each group
consists of 24 animals. Each group was further subdivided into 2 groups that consists of 12 animals and were
studied during breeding and non breeding seasons. Group I ewes were considered as untreated control. Ewes in
Group II were treated with CIDR and were left in place for 12 days followed by intramuscular injection of 400 IU of
PMSG at the time of device removal. Ewes in Group III were treated with CIDR and 600 IU of PMSG was given
intramuscularly at the time of removal of CIDR. Ewes in Group IV were treated as in Group II and additionally
supplementation 200 IU of hCG injection at the time of mating. Ewes in Group V were treated as in Group III and
additional injection of 200 IU of hCG at the time of mating. The percentage of ewes responded for synchronization
of estrus was 50.00, 83.33, 100.00, 91.67 and 100.00 in breeding season. While during non breeding season, the
same was 16.67, 83.33, 100.00, 83.33 and 100.00 per cent in Group I, II, III, IV and V, respectively. The time taken for
induction of estrus was low in ewes treated with CIDR during breeding season when compared to that of non
breeding season. The duration of estrus was ranged between 42.68±4.80 to 43.40±4.44 h in different treatment
groups during breeding season. The pregnancy rate was 50.00, 70.00, 83.33, 72.72 and 91.67 per cent in ewes
treated during breeding season and 50.00, 60.00, 75.00, 70.00 and 83.33 per cent during non breeding season in
Group I, II, III, IV and V, respectively. Statistical analysis revealed that treatment with CIDR and season of treatment
had significantly (P

EFFICACY OF CONTROLLED INTERNAL DRUG RELEASING (CIDR) DEVICE ON SYNCHRONIZATION
Group 1 (n=24) served as controls &
received no treatment.
In group 2 (n=24) The ewes were inserted
with the CIDR for 12 days and 400 IU of PMSG was
injected intramuscularly at the time of removal of
device.
In group 3 (n=24) the ewes were inserted
with CIDR for 12 days and 600 IU of PMSG was
administered intramuscularly at the time of removal
of CIDR.
In group 4 (n=24) The ewes were treated
with CIDR for 12 days, 400 IU of PMSG was injected
intramuscularly at the time of removal of vaginal
sponges and injected 200 IU of hCG intramuscularly
at the time of mating.
In group 5 24 ewes were inserted with CIDR
for 12 days and 600 IU of PMSG at the time of
removal of sponges and 200 IU of hCG at the time of
mating was given.
Ewes of all groups were monitored for the
symptoms of estrus by using a teaser ram daily 4
times with an interval of 6 hours for the duration of
30 minutes for five days after withdrawal of
intravaginal CIDR progestagen devices. The ewes
were subjected to pregnancy diagnosis by transabdominal
approach using real time B-mode
ultrasonography (5 to 7.5 MHz). The efficacy of
treatment was measured in terms of estrus response,
pregnancy, lambing, litter size and twinning rates.
RESULTS AND DISCUSSION
Estrus Response
The percentage of estrus response in ewes
synchronized with CIDR in breeding Vs. non breeding
seasons with overall mean in different therapeutic
Groups was presented in Table 1.
PMSG supplementation along with CIDR, the
estrus response rates were in line with the studies of
Sirjani et al. (2011) and Moakhar et al. (2012). But
the researchers used variable doses of PMSG,
progesterone and different kinds of progesterone
preparations in CIDR. Higher estrus response than
the present study was recorded by Ungerfeld and
Rubianes (2002). But Gungor et al. (2007) and Moeini
et al. (2007) observed lower estrus response than
the present study.
Variation in estrus response rate might be
differences in season, breed of sheep (Santos et al.,
2011), type of progesterone and device (Santos et
al., 2011), use of PMSG, time of PMSG injection
(Safdarian et al., 2006), presence of ram in the herd
(Moeini et al., 2007), body condition and management
system (Yadi et al., 2011), nutritional condition,
latitude (Santos et al., 2011) and length of
progesterone treatment (Ustuner et al., 2007).
PMSG was reported to increase synchrony
of estrus and ovulation with more predictability and
precise (Cline et al., 2001) in breeding and non
breeding seasons (Zonturlu et al., 2008). Estrus rates
were greater in ewes treated with hCG might be due
to stimulation of ovarian function in this study (Khan
et al., 2009).
Time taken for induction of estrus
The time taken for expressing estrus after
removal of CIDR in breeding Vs. non breeding season
with overall mean was 35.56±2.36 Vs. 38.53±3.21 h
with 37.05±1.68 h in Group II; 34.78±2.32 Vs.
36.82±2.14 h with 35.80±1.73 h in Group III;
35.63±2.84 Vs. 38.77±2.86 h with 37.20±1.72 h in
Group IV and 34.80±2.21 Vs. 36.27±1.85 h with
35.54±1.75 h in Group V Groups, respectively.
The present findings were in accordance with
the studies of Zonturlu et al. (2008) and Moakhar et
al. (2012). Contrary to this, shorter time for exhibition
of estrus than the present study was reported by
Hashemi et al. (2006). Longer period was taken for
exhibition of estrus than the present study was
observed by Sirjani et al. (2011). Variation in time
taken for expression of estrus might be attributed to
the exposure to ram as well as day of insertion of
vaginal devices in estrous cycle. The time taken for
exhibition of estrus also depends on rate of absorption
and metabolization of each progestagen device as
reported by Romano (2004).
Duration of Estrus
The duration of estrus in ewes synchronized
with CIDR in breeding Vs. non breeding season with
overall mean was 42.68±4.80 Vs. 33.36 ±3.10 h
with 38.02±2.41 h in Group II; 42.95±3.14 Vs.
36.45±2.08 h with 39.70±2.48 h in Group III;
42.86±4.34 Vs. 33.56±3.64 h with 38.21±2.38 h in
Group IV and 43.40±4.44 Vs. 36.81±3.95 h with
79

MOHAN et al
40.11±2.52 h in Group V, respectively. Whereas the
duration of estrus in breeding Vs. non breeding season
with overall mean in untreated control was 26.28±2.48
Vs. 24.87±2.23 h with 25.57±2.36 h. The duration of
estrus was significantly (P

EFFICACY OF CONTROLLED INTERNAL DRUG RELEASING (CIDR) DEVICE ON SYNCHRONIZATION
Table 1. Estrus response, time to onset of estrus and duration of induced estrus in ewes synchronized with CIDR during breeding and non
breeding season
Figures in parenthesis indicated angular values Means bearing different superscripts differed significantly ** P < 0.01 NS : Non Significant
81

MOHAN et al
Table 2. Pregnancy rate, lambing rate, litter size and twinning rate in ewes synchronized with CIDR during breeding and non breeding
season.
Figures in parenthesis indicated angular values Means bearing different superscripts differed significantly ** P < 0.01 NS : Non significant
82

EFFICACY OF CONTROLLED INTERNAL DRUG RELEASING (CIDR) DEVICE ON SYNCHRONIZATION
The increased litter size in the present study
with PMSG administration was in line with the studies
of Yadi et al. (2011) who observed that higher litter
size might be due to PMSG injections. However,
PMSG was believed to increase the number of follicles
and therefore raised twinning and triplets (Timurkan
and Yildiz, 2005) which might be responsible for
recording the higher twinning rate in this study. The
variation in litter size might be due to differences in
the management system, age of the dam, body
condition and breed of the experimental sheep (Moeini
et al., 2007), time and dose of PMSG administration
(Safdarian et al., 2006) and supplementation of hCG
at the time of mating (Timurkan and Yildiz, 2005).
Twinning Rate
The twinning rate in ewes synchronized with
CIDR during breeding Vs. non breeding with overall
mean was presented in Table 2. Significantly (P

MOHAN et al
ewe lambs. Journal of Reproduction and
Fertility. 23: 58 (abstract).
Khan, T.H., Beck, N.F.G and Khalid, M. 2007. The
effects of GnRH analogue (buserelin) or hCG
(Chorulon) on day 12 of pregnancy on ovarian
function, plasma hormone concentrations,
conceptus growth and placentation in ewes and
ewe lambs. Animal Reproduction Science.
102: 247-257.
Khan, T.H., Beck, N.F.G and Khalid, M. 2009. The
effect of hCG treatment on day 12 post mating
on ovarian function and reproductive
performance of ewes and ewe lambs. Animal
Reproduction Science. 116: 162-168.
Khan, T.H., Hastie, P.M., Beck, N.F.G and Khalid,
M. 2003. hCG treatment on day of mating
improves embryo viability and fertility in ewe
lambs. Animal Reproduction Science. 76: 81-
89.
Mandiki, S.N., Noel, B., Bister, J. L., Peeters, R.,
Beerlandt, G., Decuypere, E., Visscher, A.,
Suess, R., Haulfuss, K.H and Paquay, R.
2000. Pre-ovulatory follicular characteristics
and ovulation rates in different breed crosses,
carriers or non-carriers of the Booroola or
Cambridge fecundity gene. Animal
Reproduction Science. 63: 77-88.
Moakhar, H.K., Kohram, H., Shahneh, A.Z and
Saberifar, T. 2012. Ovarian response and
pregnancy rate following different doses of eCG
treatment in Chall ewes. Small Ruminant
Research. 102: 63-67.
Moeini, M.M., Alipour, F and Moghadam, A. 2009.
The effect of Human Chorionic Gonadotropin
on the Reproduction performance in Lory
sheep synchronized with different doses of
Pregnant Mare Serum Gonadotropin outside
the breeding season. Asian Journal of Animal
and Veterinary Advances. 4: 9-15.
Moeini, M.M., Moghaddam, A.A., Bahirale, A and
Hajarian, H. 2007. Effects of breed and
progestin source on estrus synchronization
and rates of fertility in Iranian Sanjabi and Lori
ewes. Pakistan Journal of Biological Sciences.
10: 3801-3807.
Naqvi, S.M.K., Joshi, A., Mathur, A.K., Bag, S and
Mittal, J.P. 1997. Intrauterine artificial
insemination of Malpura ewes in natural estrus
with ram semen. Indian Journal of Animal
Sciences. 69: 180-181.
Nephew, K.P., Cardenas, H., McClure, K.E., Ott,
T.L., Bazer, F. W and Pope, W.F. 1994.
Effects of administration of hCG or
progesterone before maternal recognition of
pregnancy on blastocycyst development and
pregnancy in sheep. Journal of Animal
Science. 72: 453-458.
Nosrati, M., Tahmorespoor, M., Vatandoost, M and
Behgar, M. 2011. Effects of PMSG doses on
reproductive performance of Kurdi ewes
artificially inseminated during breeding season.
Iranian Journal of Applied Animal Science. 1:
125-129.
Ozyurtlu, N., Kucukaslan, I and Cetin, Y. 2008.
Characterization of oestrous induction
response, oestrus duration, fecundity and
fertility in Awassi ewes during the non-breeding
season utilizing both CIDR and intravaginal
sponge treatments. Reproduction in Domestic
Animals. 45: 464-467.
Rhodes, L and Nathanielsz, P .W 1988. Comparison
of a controlled internal drug release device
containing progesterone with intravaginal
medroxyprogesterone sponges for estrus
synchronization in ewes. Theriogenolgy 30:
831-836.
Romano, J.E. 2004. Synchronization of estrus using
CIDR, FGA or MAP intravaginal pessaries
during the breeding season in Nubian goats.
Small Ruminant Research. 55: 15-19.
Safdarian, M., Kafi, M and Hashemi, M. 2006.
Reproductive performance of Karakul ewes
following different oestrous synchronization
treatments outside the natural breeding
season. South African Journal of Animal
Science. 36: 229-234.
Santos, G.M.G., Silva-Santos, K.C., Melo-Sterza,
F.A., Mizubuti, I.Y., Moreira, F.B and Seneda,
M.M. 2011. Reproductive performance of ewes
treated with an estrus induction/
84

EFFICACY OF CONTROLLED INTERNAL DRUG RELEASING (CIDR) DEVICE ON SYNCHRONIZATION
synchronization protocol during the spring
season. Animal Reproduction. 8: 3-8.
Sirjani, M.A., Shahir, M.H., Kohram, H and Shahneh,
A.Z. 2011. Effect of gonadotropin-releasing
hormone (GnRH) treatment on multiple births
in Afshari ewes. African Journal of
Biotechnology. 10: 12358-12362.
Timurkan, H and Yildiz, H. 2005. Synchronization of
oestrous in Hamdani ewes: The use of different
PMSG doses. Bull.Vet. Pulawy. 49: 311-314.
Ungerfeld, R and Rubianes, E. 2002. Short term
primings with different progestagen intravaginal
devices (MAP, FGA and CIDR) for eCGestrous
induction in anoestrus ewes. Small
Ruminant Research. 46: 63-66.
Ustuner, B., Gunay, U., Nur, Z and Ustuner, H. 2007.
Effects of long and short-term progestagen
treatments combined with PMSG on oestrus
synchronization and fertility in Awassi ewes
during the breeding season. ACTAVET,
BRNO. 76: 391-397.
Wheaton, J.E., Windels, H.F and Johnston, L.J. 1992.
Accelerated lambing using exogenous
progesterone and the ram effect. Journal of
Animal Science. 70: 2628-2635.
Yadi, J., Moghaddam, M.F., Khalajzadeh, S and
Solati, A.A. 2011. Comparison of estrus
synchronization by PGF 2
á, CIDR and sponge
with PMSG in Kalkuhi ewes on early
anoestrous season. International Conference
on Asia Agriculture and Animal, IPCBEE. 13:
61-65.
Zeleke, M., Greyling, J.P.C., Schwalbach, L.M.J.,
Muller, T and Erasmus, J.A. 2005. Effect of
progestagen and PMSG on oestrous
synchronization and fertility in Dorper ewes
during the transition period. Small Ruminant
Research. 56: 47-53.
Zonturlu, A.K., Aral, F., Ozyurtlu, N and Yavuzer, U.
2008. Synchronization of estrus using FGA
and CIDR intravaginal pessaries during the
transition period in Awassi ewes. Journal of
Animal and Veterinary Advances. 7: 1093-
1096.
85

J.Res. ANGRAU 41(2) 86-95, 2013
EFFECT OF NSP ENZYMES AND PREBIOTICS ALONE OR IN COMBINATION ON
PERFORMANCE, EGG QUALITY, NUTRIENT RETENTION AND GUT HEALTH OF
LAYING HENS FED CORN-SOYBEAN MEAL BASED LOW ENERGY DIETS
J. NARASIMHA, D. NAGALAKSHMI, Y. RAMANA REDDY and S.T.VIROJI RAO
Department of Animal Nutrition, College of Veterinary Science,
Sri Venkateswara Veterinary University, Rajendranagar, Hyderabad-500 030.
Date of Receipt : 14.05.2013 Date of Acceptance : 07.06.2013
ABSTRACT
A trial was conducted to evaluate pure NSP enzyme combination derived from in vitro studies and
commercially available prebiotic (MOS) to corn-soybean meal based low energy diets singly and combination of
both. The experiment was conducted by using completely randomized design on one hundred and fifty layer birds
(40 weeks) of uniform body weight and production with 5 treatments, six replicates and 5 hens in each replicate for
three laying periods with twenty eight days in each laying period. The performance was measured in terms of egg
production, feed intake, weight changes, feed efficiency, egg quality, nutrient retention, and gut health. The hen day
production (%) in birds fed BD supplemented with NSP enzymes and/or prebiotics were comparable among each
other and also with SD in all the three periods and the same trend was reflected in overall percent hen day
production. The feed intake (g/bird/d), FCR, body weight changes, egg quality traits, tibia ash, retentions of DM, OM,
CF, NFE, GE and phosphorus, in birds fed BD supplemented with NSP enzymes, prebiotics alone or combination of
both did not differ significantly and were comparable to SD. The retention of CP and EE improved (P

EFFECT OF NSP ENZYMES AND PREBIOTICS ALONE OR IN COMBINATION ON PERFORMANCE
health such as villi height (Loddi et al. 2002) and 3)
immune modulation (adjuvant effect) (Ferket et al.
2002). The current study aimed at evaluating the
performance and nutrient utilization and gut health of
white leghorn layers fed a conventional corn-soybean
meal based diet low in ME and supplemented with
NSP enzymes and prebiotics alone and or in
combination.
MATERIALS AND METHODS
Experimental birds and diets
A study was conducted on one hundred and fifty
layers (40 weeks) of uniform body weight and
production to asses the effect of supplementing NSP
enzymes and prebiotics to low energy corn-soybean
meal based diets on egg production, egg quality and
nutrient utilization by randomly allotting them to 5
dietary groups with six replicates per group and five
birds per replicate. The dietary treatments were
standard layer diet (2600 kcal ME/kg) (SD) and one
low energy diet (2300 kcal ME/kg) supplemented with
NSP enzyme complex (xylanase, 60000, cellulase,
400 and â -D glucanase 3200 IU/kg feed) and prebiotic
(MOS) at dose rates of 0.5g / kg. The details of the
experimental diets are presented in Table 1. The
ingredient and nutrient composition of experimental
diets is given in Table 2. Feed was offered ad libitum
to replicate groups of birds in cages for three periods
of 28 days each and reared under standard
management conditions.
Criteria of response
Data on daily egg production was recorded for
each period consisting of twenty-eight days. Percent
hen day (HD) egg production was calculated for each
treatment. Weekly feed intake was recorded and
efficiency of feed utilization was expressed as feed
intake / dozen eggs. The eggs laid during the last
four consecutive days of last laying period were
collected to assess egg quality parameters. Body
weight of each bird was recorded at the beginning
and end of laying period.
Nutrient retention studies
At the end of experiment, a metabolic trial of 4
days duration was conducted to determine the nutrient
utilization and balance of nutrients. The samples of
each feed, feed residue and feces pooled during 4
days period were ground and analyzed for proximate
principles as per the method of AOAC (2005).
Gut health
To study the effect of various dietary energy
concentrations, supplementary effect of NSP
enzymes with or without prebiotic on gut health, the
digesta was collected from distal portion of small
intestine during slaughter. Approximately two g of
digesta was taken in sterile eppendorf tubes for
enumeration of Escherichia coli. Another 2 g of
digesta was collected and centrifuged at 5000 rpm
for 10 minutes at 20 0 c. An aliquot of supernatant
(0.5 to 1 ml) was collected and stored in capped vials
for viscosity determination. The digesta collected in
centrifuge tubes was utilized for measuring the pH.
Histology of intestines
Representative pieces of duodenum of intestine
were collected in 10% formal saline and preserved
for histological studies. After proper fixation the
intestine tissue was trimmed and subjected to over
night washing, dehydration in various percentages
of alcohol, cleaning in xylol, embedding in paraffin
wax for preparation of blocks (Clayden, 1962). The
paraffin blocks were cut in to 5ì thick sections and
stained with routine H and E stain (Culling, 1957)
and used for microscopic examination.
Statistical Analysis
The data was subjected to appropriate statistical
analysis using Statistical Package for Social
Sciences (SPSS) 16 th version and comparison of
means was tested using Duncan’s multiple range
tests (Duncan’s 1955).
RESULTS AND DISCUSSION
Nutrient composition of experimental ration
Nutrient composition (% Dry matter basis) of
standard layer and basal diets is presented in
Table 3.
Hen day production (%)
Basal diet (BD) supplemented with NSP enzymes,
prebiotics or combination of both had no significant
effect on percent hen day production (Table 4) and
the same trend was reflected in all the three cycles
and overall egg production. Though statistically
87

NARASIMHA et al
comparable, the egg production in BD was lower by
6.10% compared to SD and supplementing NSP
enzymes to BD, increased the egg production by
4.15%, while no additional benefit was observed with
prebiotics addition. Sohail et al. (2003) reported
improvement in egg production by 1.2 % with NSP
enzymes (Avizyme containing xylanase, amylase
and protease) added at 0.075% level to corn soybean
based layer diets. Li et al. (2007) reported an
improvement in egg production with supplementation
of FOS at 2, 4 and 6 g/kg to corn soy based diets.
Contrary to the present findings, Scott and Mc Cann
(2005) reported reduced egg production on
supplementation of Avizyme (0.375 g/kg) compared
to control and other feed additives (Biomas 2 g/kg
and organic acid blend 4 g/kg).
Feed intake
Supplementation of NSP enzymes,
prebiotics and combination of both to BD had no
effect on feed intake (Table 4). Similar results were
reported by Ahsan et al. (2005) who observed non
significant effect of enzyme (xylanase 30 U/ml, endo
glucanase 2.5 U/ml and â glucosidase 1.5 U/ml)
added at different levels on feed intake. Scheideler
et al. (2005) also reported non significant effect of
dietary ME and enzyme (Avizyme 1500; xylanase
1000, protease 4000, and amylase 2000 IU/kg)
incorporated at the rate of 0.075% on feed
consumption. Scott and Mc Cann (2005) reported
non significant effect of enzyme Avizyme (0.375 g/
kg) and Biomas (2 g/kg) supplementation to wheat
based diets on feed intake.
Weight gain
In toto, at the end of the experiment all the
birds in all the treatment groups were in positive
weight gain (Table 4). The supplementation of NSP
enzymes, prebiotics to BD had no effect on body
weight gain and the overall weight gains recorded
were comparable among the experimental groups
including SD and BD. Wu et al. (2005) reported no
effect in weight gain in layers by reducing dietary
energy concentration from 2959 to 2719 kcal ME/kg
diet. Supplementing 1.2 % Avizyme (xylanase,
amylase and protease) added to corn soya diets did
not affect body weight gain (Sohail et al. 2003), while
El - Sheikh et al. (2009) observed significant increase
(P

EFFECT OF NSP ENZYMES AND PREBIOTICS ALONE OR IN COMBINATION ON PERFORMANCE
Shell weight (g) and shell thickness (mm)
Inclusion of NSP enzymes and prebiotics
alone or combination of both to BD had no effect on
shell weight and shell thickness (Table 5). These
results are in line with Li et al. (2007) who reported
non significant effect of supplementation of FOS to
layer diets on shell weight and shell thickness. Novak
et al. (2008) also reported no effect of dietary energy
or protein supplemented with or without cocktail
enzyme (800, 8000 and 1600 u/g amylase, protease
and xylanase, respectively) added at 0.0375% level.
Specific gravity
Specific gravity recorded among the
experimental groups i.e., SD, BD and BD
supplemented with NSP enzymes and prebiotics
alone or combination of both was comparable (Table
5) which were in line with the findings of Sohail et al.
(2003) who reported no interaction of enzyme
supplementation energy or lysine on specific gravity
of egg. Inclusion of avizyme 1500 in the diet or
increasing the dietary energy from 2820 to 2906 kcal
of ME/kg feed had no effect (p

NARASIMHA et al
supplementation to standard (ME 2595 kcal /kg and
18.08%) and low dense (ME 2478 kcal /kg and
17.16%) ration (5% less in ME and protein) than their
respective control. Supplementation of NSP enzymes
with prebiotics to low caloric layer diets (300 kcal
less ME than SD) significantly (P

EFFECT OF NSP ENZYMES AND PREBIOTICS ALONE OR IN COMBINATION ON PERFORMANCE
Fig 1. H & E section of deodenum showing congested, moderately short ruptured villi (x200)
Fig 2. H & E section of deodenum showing elongated villi with uniform distribution of goblet cell
activity (x200)
91

NARASIMHA et al
Table 3. Nutrient composition (% Dry matter basis) of layer diets (Analyzed)
Each value is an average of duplicate analysis
Table. 4. percent hen day production, feed intake, feed efficiency, cost per dozen eggs and weight gain of layers fed diets supplemented with
NSP enzymes and prebiotics
Each value is an average of 3 cycles of 28 days
Means with different superscripts in a column differ significantly (P>0.05)
92

EFFECT OF NSP ENZYMES AND PREBIOTICS ALONE OR IN COMBINATION ON PERFORMANCE
Table 5. Egg quality traits of layers fed low calorie diet supplemented with NSP enzymes and prebiotics
Means with different superscripts in a column differ significantly (P

NARASIMHA et al
REFERENCES
Aghaei, A., Tabatabaei, S., Chaji, M and Nazari, M.
2010. Effects of dried whey (Prebiotics) and
probiotics in laying hen’s performance and
intestinal flora. Journal of Animal and
Veterinary Advances 9 : 1996-2000.
Ahsan Ul Haq., Shahbaz, M., Atia Bashir and Shahid
Ur Rehman. 2005. Effect of enzyme
Chaetomium thermophile supplementation on
the production performance of leg horn layers.
Pakistan Journal of Life and Social Sciences
3 (1-2):10-12.
Aman, P and Graham, H. 1990. Chemical evaluation
of polysaccharides in animal feeds.In” feed
stuff evaluation” wise man, J and cole DJA
(eds.) Butterworth London. Pp.161-167.
AOAC. 2005. Official Methods of Analysis of
Association of official Analytical chemists 18 th
Edition (Virginia, USA, Association of official
Analytical chemists).
Clayden, E. C. 1962. Practical section cutting and
staining. 4 th Edition, J and Churchil limited,
Culling, C. F. A. 1957. Hand Book of Histopathological
Techniques. London Butterworth and company.
(publisher) Ltd.
Duncan, D. D. 1955. Multiple range and multiple ‘F’
test, Biometrics. 11:1-42.
El-Sheikh, A. M. H., Abdalla, E, A and Maysa, M. H.
2009. Study on productiveperformance,
hematological and immunological parameters
in a local strain of chicken as affected by
mannan oligosaccharide under hot climate
conditions. Egyptian Poultry Science Journal
29 (1): 287-305.
Ferket, P. R., Parks, C. W and Grimes, J. L. 2002.
Beneûts of dietary antibiotic and
mannoligosaccharide supplementation for
poultry. Proceedings of Multi-State Poultry
Feeding and Nutrition. Conference
Indianapolis, IN. www.feedinfo.com (Scientiûc
Reviews article dated June 19, 2002).
Grashorn, M.A. 2010. Use of phytobiotics in broiler
nutrition – an alternative to in feed antibiotics?
Journal of Animal and Feed Sciences. 19:338–
347.
Hooge, D. M., Sims, M. D., Sefton, A. E., Connolly,
A and Spring, P. 2003. Effect of dietary
mannan oligosaccharide with or without
Bacitracin or Virginiamycin, on live
performance of broiler chickens at relatively
high stocking density on new litter. Journal of
Applied Poultry Research 12: 461-467.
Kim, C. H., Shin, K. S., Woo, K. C and Paik, I. K.
2009. Effect of dietary oligosaccharides on the
performance, intestinal microflora and serum
immunoglobulin contents in laying hens.
Korean Journal of Poultry Science 36 (2): 125-
131.
Li X., Liu L., Li K., Hao, K and Xu, C. 2007. Effect of
Fructooligo saccharides and antibiotics on
laying performance of chickens and cholesterol
content of egg yolk. British Poultry Science
48 (2): 185-189.
Loddi, M. M., Nakaghi, L. S. O., Edens F., M Tucci,
F., Hannas, M. I., Moraes, V. M. B and Ariki,
J. 2002. Mannanoligosaccharide and organic
acids on intestinal morphology integrity of
broilers evaluated by scanning electron
microscopy. In: Proceedings11th European
Poultry Science Conference. Bremen,
Germany. Pp.21.
Novak, C. L., Yahout, H. M and Remus, J. 2008.
Response to varying dietary energy and protein
with or without enzyme supplementation on
leg horn performance and economics, laying
period. Journal of Applied Poultry Research
17: 17-33.
Oliveira, M. C., Rodrigues, E. A., Marques, R. H.,
Gravena, R., Guandolini, G. G and Moraes
V.M. B. 2008. Performance and morphology
of intestinal mucosa ofbroilers fed mannanoligosaccharides
and enzymes. Arquivo
Brasileiro de MedicinaVeterinaria e Zootecnia
60 (2): 442-448.
Ramesh, J and Chandrasekaran, D. 2011. Effect of
pure enzyme mixture supplementation on
performance of laying hens. Indian Journal of
Animal Nutrition 28(1):83-87.
94

EFFECT OF NSP ENZYMES AND PREBIOTICS ALONE OR IN COMBINATION ON PERFORMANCE
Rosen, A. Erin., Greg Blank., Bogdan, A., Slominski.,
Rick, M and Holley, A. 2007. Enzyme
supplements in broiler chicken diets: in vitro
and in vivo effects on bacterial growth. Journal
of the Science of Food and Agriculture. 87 (6):
1009–1020.
Scheideler, S. E., Beck, M. M., Abudabos, A and
Wyatt, C. L. 2005. Multiple enzyme (Avizyme)
supplementation of corn-soy-based layer diets.
Journal of Applied Poultry Research 14 : 77-
86.
Scott, M. D and Mc Cann, M. E. E. 2005. Effect of
wheat variety and enzyme additio on laying
hen performance. British Poultry Abstracts
1(1): 34.
Sohail, S. S., Bryant, M. M., Voitle, R. A and Roland,
D. A. 2003. Influence of dietary fat on
economic returns of commercial Leg horns.
Journal of Applied Poultry Research 12 : 356-
361.
Spring, P. C., Wenk, K. A., Dawson and K. E.
Newman. 2000. Effect of mannan oligosa
ccharide on different cecal parameters and on
cecal concentration of enteric bacteria in
challenged broiler chicks. Poultry Science.
79:205–211.
Switkiewicz, S., Koreleski, J., Arczewska, A. 2010.
Laying performance and eggshell qualityin
laying hens fed diets supplemented with
prebiotics and organic acids. Czech Journal
of Animal Science 55 (7): 294–306.
Wu, G., Bryant, M. M., Voitle, R. A and Roland, D.
A. 2005. Effect of dietary energy on
performance and egg composition of bovans
white and dekalb white hens during phase I.
Poultry Science 84 : 1610-1615.
95

J.Res. ANGRAU 41(2) 96-99, 2013
HAEMATOLOGICAL AND BIOCHEMICAL PROFILE OF EWES SYNCHRONIZED
WITH CONTROLLED INTERNAL DRUG RELEASING DEVICE (CIDR)
K. MURALI MOHAN, K. SADASIVA RAO and K. RAMCHANDRA REDDY
Department of Veterinary Gynaecology and Obstetrics, College of Veterinary Science
Sri Venkateswara Veterinary University, Rajendranagar, Hyderabad – 5000 30
Date of Receipt : 31.01.2013 Date of Acceptance : 18.03.2013
ABSTRACT
The present study was undertaken to study the haematological and blood biochemical parameters in ewes
synchronized with CIDR. The ewes were synchronized with Controlled Internal Drug Releasing (CIDR) device
containing 300 mg of progesterone. A total of 120 post partum, parous, healthy ewes aged about 2 to 5 years were
selected. The ewes were housed in thatched roof sheds with mud flooring and allowed for grazing in the fields and
fed on sufficient green fodder and concentrate feed as per the nutritional requirements. The haemoglobin (Hb), Total
Erythrocyte Count (TEC) were determined by the standard procedures. The serum samples were analysed for total
proteins, serum glucose, serum calcium and serum phosphorus by using standard methods. The total erythrocyte
counts were 8.48±0.12, 8.48±0.16, 8.48±0.17, 8.49±0.15 and 8.45±0.11 million/ml in control, CIDR4, CIDR6, CIDR4h
and CIDR6h groups, respectively. There was no significant difference observed in erythrocyte count during breeding
and non breeding seasons in the ewes treated with CIDR. The haemoglobin levels were 9.46±0.08, 9.47±0.09,
9.45±0.10, 9.47±0.07 and 9.48±0.09 g per cent in control, CIDR4, CIDR6, CIDR4h and CIDR6h groups, respectively.
The haemoglobin levels were significantly (P

HAEMATOLOGICAL AND BIOCHEMICAL PROFILE OF EWES SYNCHRONIZED
in group IV were treated as in group II with additional
treatment of 200 IU of hCG injection at the time of
mating. Ewes in group V were treated as in group III
with additional treatment of 200 IU of hCG injection
at the time of mating. The haemoglobin (Hb), Total
Erythrocyte Count (TEC) were determined by the
standard procedures. The serum samples were
analysed for total proteins, serum glucose, serum
calcium and serum phosphorus by using standard
methods.
RESULTS AND DISCUSSION
The haematological and biochemical values
of ewes synchronized with CIDR were presented in
Table 1. The total erythrocyte counts were 8.48±0.12,
8.48±0.16, 8.48±0.17, 8.49±0.15 and 8.45±0.11
million/ml in control, CIDR4, CIDR6, CIDR4h and
CIDR6h groups, respectively. There was no significant
difference observed in erythrocyte count during
breeding and non breeding seasons in the ewes
treated with CIDR. The total erythrocyte count
observed in present findings were comparable with
the studies of Selvaraj et al. (2004) and Devendran
et al. (2009) and higher values were reported in
Patanwadi sheep by Vinodh Kumar et al. (2009) and
Lipecka et al. (2010). Results of the present study
revealed that season, treatment or type of device
did not exert any effect on the total erythrocyte count
at any time of device kept in place.
The haemoglobin levels were 9.46±0.08,
9.47±0.09, 9.45±0.10, 9.47±0.07 and 9.48±0.09 g
per cent in control, CIDR4, CIDR6, CIDR4h and
CIDR6h groups, respectively. The haemoglobin levels
were significantly (P

MOHAN et al
Table 1. Haematological and Biochemical parameters (Mean ± S.E.) in the ewes synchronized with CIDR
98

HAEMATOLOGICAL AND BIOCHEMICAL PROFILE OF EWES SYNCHRONIZED
serum phosphorus were recorded in cyclic ewes by
Pradhan et al. (1991) and Ramprabhu and
Dhanapalan et al. (1998) who reported lower values
during rainy and winter seasons.
The variations in biochemical profiles were
attributed to seasons, availability of seasonal fodder
(Ramprabhu and Dhanapalan, 1998), availability of
shade area (Singh et al., 2008) and stage of
pregnancy (Obidike et al., 2009).
REFERENCES
Anurud, N.E., Babayemi, O.J and Ososanya, T. 2004.
Haematology of pregnant West African dwarf
ewes fed siam weed-base rations. Tropical
Journal of Animal Science.7:105-112.
Devendran, P., Jayachandran, S., Visha, P.,
Nanjappan, K and Panneerselvam, S. 2009.
Haematological and blood biochemical profile
of Coimbatore sheep. Indian Journal of Small
Ruminants. 15: 98-101.
Dhanotia, R.S. 2004. Text book of Veterinary
Biochemistry, 2 nd Ed. Jaypee Brother, New
Delhi.
Lipecka, C., Olech, M., Gruszecki, T.M., Junkuszew,
A and Kuzmak, J. 2010. Haematological and
biochemical parameters in blood of lambs born
to Maedi-Visna virus infected and uninfected
ewes. Bulletin of the Veterinary Institute in
Pulawy. 54: 135-139.
Mittal, J.P., Maurya, V.P., Anil Joshi and Naqvi,
S.M.H. 2004. Role of nutrition in augmentating
reproduction in sheep. In: Proceedings and
Challenges in Nutrition and feeding
management of sheep, goat and rabbit for
sustainable production. Feb.10-12, 2004
Avikanagar, Rajasthan, India. pp. 246-253.
Obidike, I.R., Aka, L.O and Okafor, C.I. 2009. Timedependant
peri-partum haematological,
biochemical and rectal temperature changes
in West African dwarf ewes. Small Ruminant
Research. 82: 53-57.
Pradhan, K.M., Mohanty, B.N., Ray, S.K.H and
Mohanty, D.N. 1991. A note on serum
biochemical constituents in cycling and
postpartum anoestrus ewes. Indian Journal of
Animal Reproduction. 12: 191-192.
Radostits, O.M., Blood, D.C., Gay, C.C., Arundel,
J.H., Ikede, B.O., McKenzie, R.A and
Tremblay, R.R.M. 1994. Veterinary Medicine:
A textbook of the diseases of cattle, sheep,
pigs, goats and horses. 8 th Ed. Bailliere Tindall,
London. pp. 1726-1727.
Ramprabhu, R and Dhanaphalan, P. 1998. Blood
biochemical profiles of Merino Nilgiri crossbred
sheep. Cherion. 27: 15-18.
Ravindra Reddy, Y., Sarjan Rao, K., Sudhakar, K.,
Ramesh Gupta, D and Gnana Prakash, M.
2010. Biochemical profile of Nellore sheep on
feeding of Azolla and Sheanut cake under
different management systems. Indian Journal
of Small Ruminants. 16: 54-57.
Sejian, V., Maurya, V.P and Naqvi, S.M.K. 2010.
Adaptive capability as indicated by endocrine
and biochemical responses of Malpura ewes
subjected to combined stresses (thermal and
nutritional) in a semi-arid tropical environment.
International Journal of Biometeorology. 54:
653-661.
Selvaraj, P., Mathivanan, R and Nanjappan, K. 2004.
Haematological and biochemical profile of
Mecheri sheep during winter and summer.
Indian Journal of Animal Sciences. 74: 718-
720.
Singh, D.N., Wadhwani, K.N., Arya, J.S., Sarvaiya,
N.P and Patel, A.M. 2008. Effect of housing
systems on blood constituents of ewes during
summer in a subtropical climate. Indian Journal
of Small Ruminants. 14: 252-254.
Vinodh Kumar, O.R., Swarnkar, C.P., Shinde, A.K
and Singh, D. 2009. Heamatological,
biochemical and mineral profile of adult
Patanwadi sheep. Indian Journal of Small
Ruminants. 15: 243-245.
99

J.Res. ANGRAU 41(2) 100-106, 2013
INDIAN BREAD MAKING TOOLS - CONSUMER EVALUATION AND
DESIGN MODIFICATION
P. RAJYA LAKSHMI, D. RATNA KUMARI and V. VIJAYA LAKSHMI
Department of Resource Management and Consumer Sciences,
College of Home Science, ANGRAU, Saifabad, Hyderabad- 500 004
Date of Receipt : 23.06.2012 Date of Acceptance : 24.01.2013
ABSTRACT
Cooking is the most common activity in all homes. Indian Breads made of wheat flour are served hot at
breakfast, lunch or dinner, and are eaten with dry and semi liquid vegetable preparations, as well as with gravies
and other adjuncts. The present study was planned to identify the design deficiencies of most commonly used Indian
bread making tools and suggest suitable design modifications. The four most commonly used tools of Indian bread
making identified from the household survey were evaluated ergonomically. The ergonomic evaluation was carried
out on a multi-parametric approach considering both the subject (sample or respondents) and object (product or
tool) aspects. The dimensions and design features were studied in terms of biomechanical, anthropometric and
psychological aspects of the subjects. As a part of the study, the object aspect, the availability and physical properties
of the existing rolling pins and rolling boards were analyzed to suggest design modifications. It can be concluded as
the ergonomically designed tools will fit the users comfort provide safety and efficiency, so there is a need to design
and develop the tools that are comfortable and efficient to the users.
Different varieties of Indian bread include:
Chapathi, puri, phulka, roti, parotta and bathura are
the main traditional products which form the staple
items in the diet of the majority of the population.
Diet consciousness of people in the present days
has lead to an increase in Indian bread consumption
irrespective of region. Indian breads are normally
made of wheat flour and served hot at breakfast,
lunch or dinner, and are eaten with dry and semi
liquid vegetable preparations, as well as with gravies
and other adjuncts in households. Indian bread making
tools come under the major section of hand tools as
classified based on purpose.
The common tools used in Indian bread making
are the Rolling board and Rolling pin, which are
available in a variety of materials and sizes. In India
these are must-haves in the kitchen. The rolling pin
is used in combination with rolling board (flat circular
chakla). A rolling pin is a cylindrical food preparation
tool used to shape and flatten dough. A rolling board
is an Indian kitchen tool which is a flat, usually
circular board used for rolling kneaded dough into
chapattis. It is vital that the dough does not stick to
the pin and board when rolling. Dough sticking to the
pin has few disadvantages. It takes more time to
complete the job and therefore is less efficient. To
prevent sticking before and during rolling, flour must
be added to the dough and
rubbed on the pins. This changes the texture of the
dough. When the dough sticks to the pin and needs
to be removed, the weight distribution of the dough
becomes inconsistent, thereby creating uneven
thicknesses and therefore uneven temperature when
baking, so that some parts become crisper than
others.
It would be desirable to develop an improved
rolling pin and rolling board to avoid these
disadvantages which allow dough to roll more easily
(Dua et al. 2010). Much work has been reported on
chapatti making machines, and the studies on Indian
bread making tools in India are scanty. Hence, a study
on Indian bread making tools was thought to be
appropriate which may fulfill the user requirements.
The twin cities of Andhra Pradesh i.e.
Hyderabad and Secunderabad were selected
purposively as a study area due to an ever-increasing
number of shopping malls and attractively laid out
stores, liberalisation of economy and a number of
exhibitions of consumer goods has given way to
several well-known brands of goods coming within
the reach of the people and various models of kitchen
tools are available among which Indian bread making
tools are also apart. Exploratory research design was
followed and hundred sample were selected. The tool
selected for collecting the information was an
email: rajiraju.laxmi@gmail.com
100

INDIAN BREAD MAKING TOOLS - CONSUMER EVALUATION AND DESIGN MODIFICATION
interview schedule to obtain a holistic picture of the
Indian bread making tools used by the respondents.
The schedule comprised of three sections was used-
First section covered the general information about
the respondents, second section included details
about various tools used by the respondents for roti
/ chapatti making, their frequency and purpose of
use and third section covered the information about
the tool design and its comfort in handling the tools,
which were felt inconvenient to use from the user’s
point of view. The four most commonly used tools of
Indian bread making were identified from the
household survey and were evaluated ergonomically
using a multi-parametric approach considering both
the subjective and objective aspects. Under subjective
aspects, the six samples from hundred respondents
were selected and the anthropometry, palm index,
grip strength, wrist angle, heart rate and energy
expenditure were the parameters adopted for
ergonomic evaluation. Under the objective aspects
the physical criteria of the identified tools were
considered. The dimensions and design features were
studied in terms of biomechanical, anthropometric
and psycho-physiological aspects of the respondents.
The data collected was coded, tabulated and analyzed
through frequencies and percentages.
The results of household survey carried out
one hundred respondents, showed that the majority
of the users faced problems of muscle fatigue, grip
fatigue, wrist pain and fore arm pain associated with
lack of grip of handles of rolling pin, instability of the
rolling board and sticky nature of the pin and board.
The four most commonly used Indian bread making
tools were identified and evaluated ergonomically
using a multi-parametric approach. The dimensions
and design features of the tools were studied in terms
of biomechanical, anthropometric and psychophysiological
aspects of the respondents. Different
parameters used were anthropometry, palm index
which is calculated by following formula:
Effective Palm area
Palm Index = X 100
Total Palm Area
Wrist angle by flexicurve of 100 cms, reduction in
grip strength by
Grip strength = Sr – Sw / Sr X 100
Heart rate which measured using Stethoscope.
Relative Heart Rate (RHR) is calculated using the
following equation (Robergs and Landwehr, 2002).
RHR = (HR Work – HR Rest) / (HR Max – HR Rest)
* 100
Where
RHR = Relative Heart Rate
HR
= Heart Rate
HR Max = 205.8 – (0.685 x Age)
And energy expenditure during work was calculated
from the given values of average heart rate by using
the regression equation given by Varghese et al.
(1994)
Energy Expenditure kJ/min=0.159
xAvg.working HR(b.min -1 )-8.72
With regard to the object aspect, the availability
and physical properties of the existing rolling pins
and rolling boards were analyzed. Based on the results
design modifications were suggested.
Ergonomic evaluation of existing tools
The selected tools were studied considering two
aspects, objective and subjective evaluation. The
objective aspects are the physical criteria and
features of the tools and subjective aspects are the
quantitative and qualitative information of the
respondents.
Product profile of rolling pin and rolling board
From the table 1 and 2, it is clear that rolling
pin 1 and 3 are of similar dimensions in almost all
aspects. The length of the handle of all the four rolling
pins was found to be uncomfortable. The handles
were devoid of any angle, resulting in wrist deviation.
The weight of rolling pin 2 and rolling board 2 and 4
was more compared to other models. (Figure – 1)
The handles of the pins 1 and 3, 2 and 4 were found
to be similar. The rolling pins of models 1, 2 and 4
are of wood material and model 3 is of plastic. The
rolling boards 1 and 2 are of wooden material and
models 3 and 4 are of plastic and marble. The weight
of the tool helps in rolling the dough easily when
compared to the other parts as mentioned by
Gelberman et al. (1994) in their study on the
ergonomic hand tools indicated that in the design of
hand operated tools, weight of the tool had to be given
due importance along with other parameters.
101

Lakshmi et al
Table 1. Dimensions of rolling pins selected for ergonomic evaluation
Model-1 Model-2 Model-3 Model-4
Material Wood Spindle Plastic Curved
Body length (cm) 16.7 15.2 16.7 17.7
Handle length (cm) 9.1 7.6 9.1 9.1
Total length (cm) 34.5 30.5 34.5 35.5
Body diameter (cm) 4.0 4.0 2.5 4.0
Inner handle diameter (cm) 1.5 1.5 1.5 1.5
Outer handle diameter(cm) 1.5 3.3 1.0 4.0
Weight (g) 148.2 192.8 154.0 171.8
Table 2. Dimensions of rolling boards selected for ergonomic evaluation
Model-1 Model-2 Model-3 Model-4
Material Wood Wood(Decolum) Plastic Marble
Diameter (cm) 25.4 24.3 24.3 24.3
Body height (cm) 1.5 2.5 2.5 1.5
Base height (cm) 4.0 1.5 7.6 1.5
Total height (cm) 5.0 4.0 10.1 2.5
Weight (g) 721.0 898.0 480.0 1480.0
3
1
1 = Model 1
2 = Model 2
3 = Model 3
4
4 = Model 4
2
Fig 1. Tools selected for ergonomic evaluation
102

INDIAN BREAD MAKING TOOLS - CONSUMER EVALUATION AND DESIGN MODIFICATION
Under subject aspect both the Quantitative
and Qualitative measurements like anthropometry,
palm length, palm width, grip diameter, palm index,
grip strength, elbow angles, time of operation
evaluation of user was done. Six willing respondents
were selected for ergonomic evaluation.
Anthropometry
Table 3. Average anthropometric measurements of respondents (N=6)
Dimensions
Measurements
Right hand
Left hand
Palm length (cm) 20.0 19.8
Palm width (cm) 11.4 11.4
Inner grip diameter(cm) 4.8 4.4
Anthropometric measurements that were
studied- palm length, palm width and inner grip
diameter of the sample, and length and width of the
tools. An anthropometer was used to measure the
dimensions i.e., anthropometry of the human body.
Table 3 shows a very minimal variation in palm length.
Palm Index
Table 4. Average Palm Index of the respondents (%) (N=6)
Rolling pin and rolling
board
Right hand
Left hand
Model 1 14.2 14.1
Model 2 18.5 18.8
Model 3 8.2 6.0
Model 4 18.8 17.5
The contact area of the hand with the handle
of the rolling pin is important, the greater the contact
area the better will be the grip. To measure it, the
working area of the handle was painted with lamp
black color and the subjects were asked to hold the
rolling pin as they generally hold them naturally in
the kitchen. An impression of the painted palm was
taken on a plain white paper. Outlines of the painted
area were marked and measured. The equipment
used to conduct the experiment was sliding calipers
and measuring tape. It is evident from the data in
table – 4, that while using model 2 and model 4 rolling
pins the force is distributed to larger area of the palm
compared to other models, increasing the efficiency
of model 3 compared to other models as when grip
force required is distributed to a large pressure
bearing area on the finger and palm to increase the
work efficiency. The result is in accordance with the
study by Hedge and Poncers, (1995) who revealed
that grip force required should get distributed to as
large pressure bearing area on the finger and palm
as possible to increase the work efficiency.
103

Lakshmi et al
Grip strength and wrist angle
As the deviation of the wrist increases the
pressure on the wrist increases therefore fatigue
increases which reduces the grip strength (Varghese
et al. 1994). The deviation of the wrist is more for
model 3 which reduced the grip strength as wrist bend
and hand movements affect interstitial fluid pressure
within the carpal tunnel, and any pressure increase
can compress the median nerve and other structures.
Pressure changes within the carpal tunnel show a
curvilinear relationship between vertical extension/
flexion hand movements and carpal tunnel pressure
increases resulting in increased fatigue and pain in
wrist and fore arm (Rempel et al. 1994). The force
generated decreased and more force has to be applied
while rolling with model 3 resulting in increase of carpal
tunnel pressure as with the hand in neutral posture,
carpal tunnel pressure typically remains below 30mm
Hg. Sustained increases in carpal tunnel pressure
above 30mm Hg are undesirable because they may
detrimentally affect functioning of the median nerve
(Gelberman et al. 1994). Flexion of the wrist beyond
15-40 degrees increases carpal tunnel pressure
beyond 40mm Hg.
Fig 2. Reduction in grip strength (kgs)
Figure 3. Wrist angle (degrees) in deviation
Time taken for Roti Making
The time taken to roll the dough while using
model 2 and 4 was higher when compared to the
other two models because the handles were not comfortable
to hold and roll. The time taken to roll the
dough by model 3 was less compared to others due
to the counter balance of the body and the handle.
The posture of the wrist adopted while using the rolling
pin also influences the force required which in
turn effects the time of operation, as the awkward
posture of wrist and weight of the tool both influences
the cumulative effect of the subject. The present findings
corroborates with the study of Konz (1990) who
reported that the tool should be shaped to allow normal
operation with the hand in neutral position and
as close to the body as possible. Avoiding awkward
postures will have positive effect on the performance
and output. More amount of time was taken to roll
Fig 2. Time taken for roti
the dough for model 4 as the shape of the handle of
the pin was not comfortable which created pressure
at the palm and made the task to complete at slower
pace
104

INDIAN BREAD MAKING TOOLS - CONSUMER EVALUATION AND DESIGN MODIFICATION
Table 5. Difference in heart rate (b.min -1 ) and energy expenditure (kilo joules)
Rolling pin and
rolling board
Heart rate
Energy
expenditure
Model 1 11.3 3.0
Model 2 13.9 4.6
Model 3 9.7 7.5
Model 4 15.1 6.9
Heart rate and energy expenditure of the user
were taken as the indicators to assess the
physiological status of the user. The physiological
evaluation was carried out while using the rolling pin
and rolling board to assess the workload of roti making
using the identified tools.
Energy consumption is the means by which
the severity of physical stress was estimated but it
is evident that energy consumption alone may not
be a sufficient measure. The degree of physical stress
not only depends on the number of kilojoules
consumed but also on the number of muscles
involved and on the extent to which they are under
static load. The same energy consumption by static
muscular effort is distinctly more tiring than if it is
applied to dynamic work. It is evident that work at a
given energy consumption can make different
demands on the heart.
In the present study there is an increase in
heart rate while using model 4. The difference of heart
rate was less pronounced using model 3. While using
model 3 the deviation from the neutral posture is more
resulting in increase of physical stress of rolling the
dough. There is minimum of increase in heart rate
for model 4, where the board is stable and the light
weight body pin. The results are in accordance with
the study by Kroemer and Grandjean (1997) who
mentioned that the heart rate increases linearly with
the work performed, provided it is dynamic, not static
and is performed with a steady rhythm and is
influenced by the posture adopted, force applied and
the type of product. As the heart rate increases energy
consumption also increases. From the experiments,
the problems identified and the suggested
modifications are as follows
Table 6. Design flaws and modifications of pins and boards
Problem Reason Suggested modification
- Decreased grip
strength
- Muscle fatigue
- Sticky nature
of rolling pin
and rolling
board
- Instability of
the rolling
board
- Pressure on
Palm area
while rolling
More force has to be applied by both
the hands due to lack of adequate grip
and light weight material of the rolling
pin in order to roll the dough on the
board.
The adding of flour in order to avoid
sticking the dough to the board and the
pin, the texture changes and the
frequent movement of hand for adding
flour creates pain in hand.
Due to the imbalance of base of the
board make the board move while
rolling
The shapes of the handles and the
length (7.6 cm) of the handles of the
rolling pin tends more force to be
applied on the palm to roll.
The length of the handles can be
increased which would be across the
palm width with the proper grip
diameter of the handles of the rolling
pin.
Provide non-stick finish to the rolling
pin and the rolling board
The board should be designed with
stoppers underneath to avoid
application of high force as the board
can be fixed to a position and roll.
The barrel shaped handles and
increase in length of the handles
across the palm area, avoid the
pressure on the palm while rolling.
105

Lakshmi et al
From the Table 6 it could be concluded that user’s
were not comfortable in handling the available tools
besides they were facing fatigue due to the ill design
features of the tools i.e., the tools were ergonomically
not designed. As the ergonomically designed tools
will fit the users comfort provide safety and efficiency.
So there is a need to design and develop the tools
that are comfortable and efficient to the users.
REFERENCES
Dua, C. G., Edward, J. B and Rick, S. 2010. Silicone
Rolling Pin. United States Patent. Patent
number - US 7,686,752 B2.
Gelberman, R.H., Szabo, R.H and Mortenson, W.W.
1994. Carpal tunnel pressures and wrist
position in patients with colle’s fractures.
Journal of trauma. 24(8):747-749.
Hedge, I and Poncers, R. 1995. Human factors data
guide for evaluation. Journal of Applied
Ergonomics. 11:35-42.
Konz, S. 1990. Bent hammer handles performance
and preference. Journal of Applied Ergonomics.
28:438-440.
Kroemer, K.H.E and Grandjean, E. 1997. The effects
of posture, duration and force on pinching
frequency. International Journal of Industrial
Ergonomics. V edition, Taylor & Francis
Limited. 20:267-275.
Robergs, R. A and Landwehr, R. 2002. The surprising
history of the HR Max = 220 – Age’ equation.
Journal of Exertion Physiology. 5(2). 1 – 10.
Rempel, D., Horie, S and Tal, R. 1994. Carpal tunnel
pressure changes during keying. Marconi
keyboard research conference proceedings
ergonomics laboratory, Berkeley. pp: 1-3.
Varghese, M.A., Atreya, N., Chatterjee, L and
Bhatnagar, A. 1994. Ergonomic Evaluation of
Household Activities. Departmental Research
Report (U.G.C). SNDT Women’s University.
Bombay. New Age International Publishers.
106

Research Notes
J.Res. ANGRAU 41(2) 107-110, 2013
CROP COEFFICIENTS FOR DRIP AND CHECK BASIN IRRIGATED CASTOR FOR
PREDICTION OF EVAPOTRANSPIRATION
B. R. KUMAR, V. PRAVEEN RAO, K. AVIL KUMAR, V. RAMULU,
M. UMA DEVI, AND P. RAGHUVEER RAO
Water Technology Centre, Acharya N.G. Ranga Agricultural University,
Rajendranagar, Hyderabad 500 030
Date of Receipt : 30.01.2013 Date of Acceptance :12.03.2013
The two-step crop coefficient (Kc) x
reference evapotranspiration (ETo) method has been
a successful and dependable means to estimate
evapotranspiration (ET) and crop water requirements
(Praveen Rao and Raikhelkar, 1994). The method
utilizes weather data to estimate ET for a reference
condition (ETo) and multiplies that estimate by a crop
coefficient (Kc) that represents the relative rate of
ET from a specific crop (ETc) and condition to that
of the reference. The reference condition is generally
ET from a clipped, cool season, well-watered grass
(ETo) or from a taller full-cover alfalfa crop (ETr). The
calculation of ET from these surfaces has been
standardized by FAO group of scientists (Allen et
al., 1998).The Kc x ETo approach provides a simple,
convenient and reproducible way to estimate ET from
a variety of crops and climatic conditions (Doorenbos
and Pruitt, 1977; Wright, 1982; Allen et al., 1998).
Developed Kc curves or values represent the ratios
of ETc to ETo during various growth stages. Crop
coefficient values have been reported for a wide range
of agricultural crops (Allen et al., 1998 and 2007).
The Kc is regarded as generally transferable among
regions and climates under the assumption that the
ETo accounts for nearly all variation caused by
weather and climate. Such data is lacking for castor
crop. Hence, the objective of present study was to
derive crop coefficients for drip irrigated castor at
different crop growth stages under variable water
supply levels. Also, methodology for determination
of periodic and peak irrigation requirements was
suggested.
The field experiment was conducted at
College Farm, College of Agriculture, Acharya N.G.
Ranga Agricultural University, Hyderabad (17.19° N,
78.23° E and 543 m altitude) in winter season of 2009
– 10 on a sandy clay soil. The soil was low in N,
medium in P and high in K status and alkaline in
reaction (pH 8.03). The soil water retention capacity
at “0.03 MPa and “1.5 MPa was 0.254 cm 3 cm -3 and
0.130 cm 3 cm -3 , respectively. The available water was
12.4 cm m -1 depth of soil. Soil bulk density was1.43
g cm -3 . The source of irrigation water was open well
with C 3
S 1
water quality. There were seven irrigation
treatments based on surface drip method of irrigation
and irrigation scheduling levels were in the form of
pan evaporation replenishment. The evaporation
replenishment factor viz., 0.4, 0.6 and 0.8 was either
kept constant throughout the crop life or was
combinations of the above at vegetative, flowering
and capsule development stages besides a treatment
of surface check basin irrigated crop at 0.8 IW/CPE
ratio with IW = 50 mm (Table 1). Eight irrigation
treatments were laid out in a randomized block design
with three replications. The dripperlines of 16 mm
diameter were laid out along the crop rows at 1.2 m
spacing with emitters spaced at 0.5 m having a flow
rate of 2 L hour -1 . Flow meters were used to measure
flow rates to each individual treatment according to
designated pan evaporation (Epan) replenishment
factor. Hybrid ‘PCH 111’ was planted on the 7 th of
November 2009 by adopting a row-to-row spacing of
1.2 m and plant to plant distance of 0.5 m in plots of
18.0 m x 7.2 m. A fertilizer dose of 60 kg N, 40 kg
P 2
O 5
and 30 kg K 2
O ha was applied through fertigation
at weekly intervals up to 100 days after sowing. The
crop was harvested in 4-pickings and the last picking
was on the 5 th of April, 2010. The total depth of
irrigation water applied in drip irrigated treatments
varied between 227 mm (0.4 Epan) to 453 mm (0.8
Epan), whereas in surface check basin irrigated crop
it was 450 mm.
email: v.prao@yahoo.com
107

KUMAR et al
For determination of crop ETc the soil moisture was
monitored by delta probe at four locations in various
depths before and after each irrigation and on
intermediate dates in case of incident precipitation.
Effective rainfall was estimated by following standard
procedure (Dastane, 1974) and it amounted to 13.05
mm during crop growing period. The groundwater
contribution (GWc) to ETc was nil. The reference crop
evapotranspiration (ETo) was estimated at specific
crop growth sub-periods based on Penman Monteith
equation (Allen et al., 1998). Thus the data obtained
on ETc of castor and ETo at specific crop growth
sub-periods were used to calculate the crop coefficient
(Kc) as follows
Kc = ETc ÷ ETo
For constructing the crop coefficient curve
(Fig. 1) the crop life of castor was divided into
germination and establishment, vegetative, flowering,
capsule development, seed filling and maturity
periods. To use Kc values for predicting crop ETc
(ETc = Kc.ETo) throughout the crop season, only
ETo estimates on Penman Monteith method from
the new planting site are needed.
As an application of this study in irrigation
water management, the estimates of ETc for castor
crop from the Kc values of highest yielding irrigation
treatment I 6
(drip irrigated at 0.6Epan up to flowering
i.e., 81 DAS and 0.8Epan later on) were used to
determine the actual irrigation requirements for a given
design as follows:
Ir = ETc x Growth period in days
In which, Ir is net irrigation requirement (cm)
for the growth period considered and ETc is crop
evapotranspiration (mm/day).
V at field inlet = (10 ÷ Ea) × (A.Ir ÷1 – LR) m 3
In which, V is gross irrigation requirement
for the period considered (m 3 ); Ea is field application
efficiency (0.9); A is area (1.0 ha); Ir is net irrigation
requirement (cm); LR is leaching requirement (nil);
and Ep is project efficiency under groundwater
irrigation through bore wells (0.9).
Crop Coefficients
Data on crop coefficients (K c
) calculated
based on castor crop ET c
and ET o
derived from
Modified Penman method are presented in Table 1.
The Kc values during the germination and
establishment period were not markedly different from
each other owing to uniform water application, since
the crop was subjected to variable water supply levels
only from 15 DAS. However, at the later growth stages
of vegetative, flowering, capsule development, seed
filling and maturity stages the Kc values were higher
under surface irrigation method as compared to them
under drip irrigated treatments owing to higher
irrigation water depth. The highest value of the Kc
was 1.206 and 1.108 under surface check basin
irrigation (0.8 IW/CPE ratio) and drip irrigation crop
(I 3
), respectively.Likewise the Kc values in I 6
treatment
were comparable to I 8
. Whereas, for I 1
treatment
irrigation at only 0.4Epan at all the crop growth subperiods
(15 to 150 days), the maximum value of the
Kc was 0.566. Thus, the K c
values were primarily a
function of evaporation replenishment factor during
a given crop growth sub-period under drip irrigated
crop and the amount of water applied under surface
check basin irrigated crop. Higher the replenishment
factor i.e., higher the water application level, greater
were the K c
values owing to higher ETc rates since
Kc is a ratio between ETc and ETo.
Crop Coefficient Curve
The crop coefficient curve shown in Fig. 1
was derived from Kc values of I 2
treatment registering
optimal bean yield, maximum net returns with higher
water productivity. For comparision, the Kc curve for
surface check basin irrigated crop (I 8
) raised irrigating
at 0.8 IW/CPE ratio is also depicted in Fig. 1. The
Kc values for I 8
and I 2
treatment varied between 0.436
to 1.206 and 0.411 to 0.804, respectively. The higher
Kc values for surface check basin irrigated castor
crop may be attributed to unavoidable deep
percolation losses and higher soil evaporation owing
to complete wetting of the soil surface (Bucks and
Nakayama, 1982). On the other hand irrigation
scheduling under drip irrigation is evapotranspiration
based with localized wetting pattern (Schwankl et al.,
1996 and Andreu et al., 1997) eliminating deep
percolation losses contributing to lower Kc values.
The Kc value from sowing to establishment was small
in view of very little (incomplete) canopy cover (LAI
= 0.067) and majority of the water loss may be
attributed to evaporation from the soil. Thereafter the
Kc value increased linearly due to increase in crop
ETc as the crop grew rapidly and developed more
108

CROP COEFFICIENTS FOR DRIP AND CHECK BASIN IRRIGATED CASTOR
Table 1. Crop coefficients of castor in relation to ETo by FAO Modified Penman method as influenced by different irrigation treatments
Table 2. Irrigation requirements of drip irrigated castor (variety PCH 111)
109

KUMAR et al
leaf area (LAI = 0.067 to 2.05) from establishment
through vegetative to flowering period to attain Kc
values of 0.760 and 1.049 under I 3
(drip irrigated) and
I 8
(surface check basin irrigated), respectively. From
flowering to capsule development period the Kc
almost remained constant and varied between 0.760
to 0.804 and 1.049 to 1.206. This could be attributed
to full leaf canopy cover (LAI = 2.6) and its
persistence (leaf area duration = 42.3 m 2 days)
intercepting maximum photosynthetically active
radiation. During the final 33-days of crop life the Kc
value decreased precipitously reaching a low value
of 0.320 in I 3
and 0.466 in I 8
treatment. This could be
due to reduction in crop ETc owing to unproductive/
senescence of leaves (LAI = 1.95) and partly due to
reduced root activity.
REFERENCES
Allen, R.G., Pereira, L.S., Raes, D and Smith, M.
1998. Crop evapotranspiration: guidelines for
computing crop water requirements. Irrigation
and Drainage Paper No. 56, FAO, Rome, pp.
300.
Allen, R.G., Wright, J.L., Pruitt, W.O and Pereira,
L.S. 2007. Water requirements. In: Design and
operation of farm irrigation systems, Chapter
8, 2 nd edition. ASAE Monograph.
Andreu, L., Hopmans, J.W and Schwankl, L.J. 1997.
Spatial and temporal distribution of soil water
balance for a drip-irrigated almond tree.
Agricultural Water Management 35:123 – 146.
Bucks, D. A and Nakayama, F. S. 1982.Principles,
practices and potentialitiesof trickle (drip)
irrigation. Advances in Irrigation 1: 219 – 298.
Dastane, N.G. 1974. Effective Rainfall. Irrigation and
Drainage Paper No. 25. FAO, Rome, pp. 62.
Doorenbos, J and Pruitt, W.O. 1977. Crop water
requirements. Irrigation and Drainage Paper No.
24 (revised) FAO, Rome, pp. 144.
Praveen Rao, V and Raikhelkar, S.V. 1994.
Evapotranspiration of sesame in relation to pan
evaporation. Indian Journal of Agricultural
Sciences 64: 771 – 774.
Schwankl, L. J., Edstrom, J. P and J. W. Hopmans.
1996. Performance of microirrigation systems
in almonds. Proceedings of Seventh
International Conference on Water and
Irrigation. Tel Aviv, Israel, pp. 123 – 132.
Wright, J.L. 1982. New evapotranspiration crop
coefficients. Journal of Irrigationand Drainage
Division ASCE 108:57–74.
110

Research Notes
J.Res. ANGRAU 41(2) 111-114, 2013
STUDY ON THE EFFECT OF IRRADIATION ON STORAGE QUALITY
OF TOMATO PUREE
M. KIRTHY REDDY and V. VIJAYALAKSHMI
College of Home Science, Acharya N.G. Ranga Agricultural University, Saifabad, Hyderabad-500004
Date of Receipt : 20.11.2012 Date of Acceptance : 10.05.2013
Fruits and vegetables are living entities and
undergo several physiological changes (Haard and
Salunkhe, 1980). Even five per cent loss of water
causes many vegetables to appear wilted or shriveled
and eventually unmarketable. These characters
significantly limit the storage life of increasing rapidly
both at domestic and international market with major
portion of it being used in preparation of convenience
food. Thus, there exists a need to develop a suitable
technology for processing and preservation of this
valuable produce in a way that will not only check
losses but also generate additional revenue.
Food irradiation is a processing technology
aimed at the improvement of food safety, which has
gained interest of researchers in the fields of food
science and consumer research worldwide during the
past few decades. This technology is already
recognized as a technically feasible method for
reducing postharvest food losses, ensuring the
hygienic quality of food, longer storage of food,
therefore facilitating wider food trade (Jyoti et al.
2009).
As tomato is most important source of
lycopene, a study was undertaken to understand the
effect of irradiation on storage quality of tomato puree.
Fully riped 618 local tomato variety was
purchased from the local market. These tomatoes
were processed into puree using standard method
(Srivastava, 2004).
150 guage polythene bags of size 5x6 inches
were used for packing and storing of the products.
Processed products were subjected to four
treatments. T 1
– Control product in which chemical
preservatives (0.5g of sodium benzoate per kg) is
added and remaining three samples without chemical
preservatives were irradiated using gamma irradiations
at dosages of 0.50 kGy (T 2
), 1.00 kGy (T 3
), 2.00 kGy
(T 4
). Non irradiated and irradiated samples were kept
for storage up to 60 days at ambient temperature.
Samples were analyzed for physico – chemical and
microbial analysis on the day of preparation i.e on 0
day, 30 th day and 60 th day.
Titrable acidity, vitamin C and Total Soluble
Solids was determined by the method developed by
Ranganna (1986), moisture was analysed by the
method AOAC (1990), lycopene content was analysed
by method developed by Ranganna (2001), reducing
sugars were determined by Lane and Eynon method
(AOAC, 1965) and microbial analysis (Total Bacterial
Count, Total Mould Count) was carried out by
Cruikshank et al. (1975). All these were estimated
on 0 day, 30 th day and 60 th day. All the reported values
are the mean of triplicates and the experimental
results were subjected to two way analysis of
variance at (p < 0.05).
Preparation of tomato puree Tomatoes were
thoroughly washed and blanched at 85 o C for 2-3 min.
Tomatoes were passed through pulper to get the
pulp and strained to remove seeds. The strained pulp
was concentrated to 12 percent total soluble solids
(heavy tomato puree).In the control product 0.5g of
sodium benzoate per kg was added as a preservative
in the final stage of preparation and after cooling
packed in polyethylene bags.
Titrable acidity In tomato puree the titrable acidity
increased significantly (p < 0.05) during the storage
period. The acidity values were lower on 0 day
(0.61%) and higher on 60 th day (0.67%). Among all
the treatments highest acidity was observed in T 1
(0.68%), followed by T 3
(0.64%) and lower acidity in
T 2
(0.62%) which was almost same with T 4
(0.63%).
No significant changes were observed among the
observed among the interactions between treatments
and periods. According to Iqbal et al. (2001) the
reason for the increase in acidity could be oxidation
email: kirthy88@gmail.com
111

REDDY and LAKSHMI
of reducing sugars (sucrose), formation of acids by
break down of polysaccharides and by degradation
of pectic compounds and uronic acid. (Table1)
Total soluble solids TSS increased from 0 day
(12.00%) to 60 th day (12.09%) Table 1. A study
conducted by Zindarcic and Pozrl (2006) reported
similar results that soluble solids increased slightly
from 5.06 % to 6.92 % at 5 0 C (during 28 days period)
and from 5.06 % to 6.26 % at 10 0 C (during 21 days
period). Significant differences (p < 0.05) were
observed among treatments of but T 1
(12.05%)
followed by T 2
(12.02%) and T 3
(12.01%) whereas
sample T 4
did not record any changes and retained
same TSS content (12.00%) throughout the period
of study. A slight increase in TSS was observed in
all the products which may be due to loss of moisture
leading to increased concentration of the product
Moisture content The results in Table 1 show that
there was significant difference (p < 0.05) in the
moisture content of puree from 0 day (81.24%) to
30 th day (80.18%). As the storage period increased
moisture content decreased in all treatments.
Decrease in the moisture content of the product may
be due to high temperature and low humidity in the
ambient conditions. Other reason for decrease can
also be attributed to 150 gauge polythene bags, used
for packing the products.
Vitamin C According to Table 1 significant
differences (p < 0.05) were observed in vitamin C
content during the period of storage. Tomato puree
had high vitamin C content on 0 day (38.71mg %)
which then decreased significantly by the 60 th day
(4.17mg %). Rapid decrease in vitamin C content
was observed from 0 day (48.71mg %) to 30 th day
(8.88mg %).
Among all the treatments T 1
recorded higher
vitamin C content (19.03mg %) followed by T 2
(17.97mg %) and least in T 4
(15.19mg %). Vitamin C
content decreased significantly as the irradiation
dosages and days of storage increased. This was
confirmed by Tobback (1977) that ascorbic acid is
very sensitive to ionizing radiation. The ascorbic acid
gets converted to dehydroascorbic acid on irradiation
treatment, which becomes highly unstable leading
to loss of vitamin C.
Lycopene: Results showed that significant changes
(p < 0.05) were recorded in lycopene content. There
112
was a drastic decrease from 0 day (13,318.46 µg %)
to 30 th day (8143.11 µg %) which further decreased
to 3688.80 µg % on 60 th day. Significant changes (p
< 0.05) were noticed among the treatments in which
lycopene content was highest in T 1
(9.462.75 µg %)
and lowest in T 4
(7,527.58 µg %). Significant
differences (p < 0.05) were observed between
treatments and periods. (Table 2). This was justified
by Capanoglu et al. (2008) claimed that the losses in
lycopene of 4.6%, was caused by the removal of
seed and skin during the processing. The additional
loss is presumably attributable to oxidation reactions
taking place during processing treatments.
Reducing sugars Significant changes (p < 0.05)
were observed in reducing sugars in tomato puree
during the storage periods. Tomato puree had higher
reducing sugars on 60 th day (10.37%) when compared
to 30 th day (7.36%) and 0 day (4.41%). (Table 2).
The increase in reducing sugars may be due to
hydrolysis of sugars by acids or due to degradation
of disaccharides to monosaccharides (Reddy,
2004).The values of reducing sugars varied
significantly (p < 0.05) among the treatments.
Reducing sugars were more in T 1
(7.49%) followed
by T 2
(7.44%) and T 3
(7.30%). Lowest reducing sugars
were observed in T 4
(7.28%). Significant changes were
observed in the interaction effects. Reducing sugars
increased on storage period in all the treatments.
Total Bacterial Count and Total Mould
Count On 0 day no bacterial count was recorded in
T 3
and T 4
but T 1
recorded 0.13 cfu g/ml (cfu = Colony
Forming Units) and T 2
recorded 0.10 cfu g/ml. On
30 th day bacterial count was more than double of that
was noticed on 0 day. Highest bacterial count was
recorded in T 1
(0.43 cfu g/ml) and in T 4
nil count was
observed proving that at higher irradiation dosage
bacterial growth could be controlled. Higher bacterial
count was observed in T 1
(0.80 cfu g/ml), followed
by T 2
(0.70 cfu g/ml) and least was recorded in T 4
(0.16 cfu g/ml) on 60 th day (Fig 1). Traces of bacteria
can be attributed to non-sterilization of the
polyethylene covers. No mould growth was noticed
in both tomato puree and crush samples in the entire
period of storage study of 60 days. Similar results
were reported by Langerak and Damen (1978) in
prepacked soup-green stored at 10 0 C.

STUDY ON THE EFFECT OF IRRADIATION ON STORAGE QUALITY OF TOMATO PUREE
Table 1. Physico- chemical parameters of Tomato puree
Table 2. Lycopene and reducing sugar content of Tomato puree
Where T1 = control, T2 = 0.5 kGy, T3 = 1.00 kGy, T4 = 2.00 kGy *significant
113

REDDY and LAKSHMI
Fig. 1. Total bacterial count of tomato puree
REFERENCES
AOAC,1990. Official methods of analysis for
moisture. Association of Official Analytical
Chemists, 14 th Ed. Washington, DC. Vol.2.
AOAC, 1965 Official Methods of Analysis,
Association of Official Analytical Chemists,
Washington, D C 12 th Edition 31.054, 22 :109.
Capanoglu, E., Beekwilder, J., Boyacioglu, D., Hall,
R.D and De Vos, C.H.R. 2008. Changes in
antioxidants and metabolite profiles during
production of tomato paste. Journal of
Agricultural and Food Chemistry 56 (3): 964–
973.
Cruickshank, R., Duguid, J P., Marmion, B P and
Surain, R H A. 1975. Medical Microbiology.
The practice of medical microbiology. Churchill
Livingstone, Edinbargh, London and Newyork
p. 306.
Haard N. F and Salunkhe D.K. 1980. Perspectives
of post harvest physiology. In symposium:
post harvest biology and handling of fruits and
vegetables. AVI publishing Company,
USA.pp:1-4.
Iqbal, S.A., S.Yasmin, Wadud and Shah. W.H. 2001.
Production storage packing and quality
evaluation of Gouva Nectar. Pakistan Journal
of Food Science. 11: 33-36.
Jyoti, P. M., Sukalyan, C., Sandeep, K., Subrata,
P., Jiin-Shuh, J., Alok, C. S., Anindita, C and
Subhas, C. S. 2009. Effects of gamma
irradiation on edible seed protein, amino acids
and genomic DNA during sterilization. Food
Chemistry. 114: 1237–1244.
Langerak, D. I and Damen, G. A. 1978. Influence of
irradiation on the keeping quality of prepacked
soup-greens stored at 10 0 C. In: food
preservation of irradiation. Vol 1 Proc. Series
International Atomic Energy Agency. Vienna,
Austria pp:221: 275-282.
Ranganna, S. 1986. Hand book of Analysis and
Quality control for fruit and vegetable products.
Tata McGraw Hill., New Delhi. 7-12.
Ranganna S, 2001. Handbook of Analysis and quality
control for fruit and vegetable products II
Edition Tata McGraw Hill.
Reddy, G.N.V.V. 2004. Studies on methods on
extraction of sapota juice for optimum yield
and quality. MSc. Thesis submitted to
Acharya N.G. Ranga Agricultural University,
Hyderabad, India.
Srivastava, R.P. 2007. Fruits and Vegetable
preservation. Principles and practices. Tomato
processing. 265-266.
Tobback, P.P. 1977. Radiation chemistry of vitamins.
In : P S. Elias and A.J.Lohen (eds) Radiation
chemistry of major food components. Elsevier
Scientific Publishing Co., New York. PP.213
Žnidarèiè, D., Trdan, S and Zlatiè, E. 2003. Impact
of various growing methods on tomato
(Lycopersicon esculentum Mill.) yield and
sensory quality. Res. Rep., Biotech. Fac.,
Univ. Ljublj., Agric. issue 2. 81: 341-348.
114

Research Notes
J.Res. ANGRAU 41(2) 115-117, 2013
EVALUATION OF DEFOLIANTS ON MUNGBEAN Vigna radiata L.
AS HARVESTING TOOLS
B. PADMAJA, M. MALLA REDDY, S. MALATHI and D. VISHNU VARDHAN REDDY
AICRP on Pigeon pea, Regional Agricultural Research Station,
Acharya N.G.Ranga Agricultural University, Warangal – 506 007
Date of Receipt : 06.12.2012 Date of Acceptance : 10.05.2013
India is the largest producer and consumer of
mungbean and it alone accounts for about 65% of
the world acreage and 54% of the world production
(Singh and Singh, 2011). It is cultivated across the
country throughout the year. Manual harvesting of
mungbean is labour-intensive and hence mechanical
harvesting is an option to overcome labour shortage
and reduce production costs. Mungbean foliage does
not dry or abscise when pods are mature. This is the
major limiting factor in mechanical harvesting. Hence,
plants must be defoliated to facilitate mechanical
harvesting. Moreover, it aids in the addition of organic
matter to the soil through leaf fall before harvesting.
Defoliation is shedding of leaves that usually
occur when the leaves become physiologically
mature. Leaf shedding (abscission) results from
activity of special cells in the abscission layer at the
base of the leaf petiole where it joins the stem.
Several factors like frost, disease, drought and
mineral deficiency cause defoliation. It also can be
artificially induced by the use of certain chemicals
called “defoliants”. Desiccation is drying of plant
tissues due to disruption of cell membranes and rapid
loss of moisture, often resulting in “stuck leaves”.
Defoliants or desiccators are widely used in cotton
production. There are many categories of defoliants.
Hormonal defoliants enhance ethylene production and
/ or inhibit auxin transport in the plant (Gwathmey
and Craig, 2007). The balance of these hormones
affects leaf abscission. Cells in the abscission layer
in the petiole separate due to cell wall degrading
enzymes that respond to decreasing auxin-toethylene
ratio. Herbicidal defoliants injure the plant
causing it to produce ethylene in response. Ethylene
promotes leaf abscission by increasing the activity
of enzymes such as pectinase and cellulase, which
degrade cell walls and middle lamellae in the
abscission zone of the petiole. Defoliation response
of hormonal defoliants is generally more sensitive to
temperature and crop conditions than that of
herbicidal defoliants.
The indeterminate flowering habit of mungbean
coupled with accumulation of more dry matter during
rainy season, can pose many harvesting problems.
Further, in mechanical harvesting, weeds in the field
may also pose problems to the performance of
harvesting machines. Hence herbicides like
Glyphosate (4.0 lit/ha) and Paraquat (2.5 lit/ha) can
be used to remove weeds and to achieve defoliation
(Copur et al., 2010). Bi et al. (2005) reported that
other chemicals like CuEDTA and ZnSO 4
also
promote defoliation of leaves in plants. The ideal
stage of harvesting is when majority of pods are
physiologically mature, and 90% of the pods have
turned either yellow or black. At this stage the crop
attains maximum maturity and will be at optimum
yield and quality. At this stage the crop should be
considered ready for either desiccant or defoliant
application. Available literature indicates that
information on defoliants in mungbean is scanty.
Therefore, an experiment was conducted to assess
the effect of certain chemicals on the defoliation of
mungbean.
The experiment was carried out at Regional
Agricultural Research Station, Warangal during rainy
season of 2009. The soil was sandy loam with a P H
of 7.9 and EC of 0.2 d Sm -1 , low in organic carbon
(0.3%) and available N (263 kg/ha), medium in
available P 2
O 5
(28 kg/ha) and available K 2
O (295 kg/
ha). Mungbean crop variety, WGG-37 was sown on
June 30 th 2009. All the cultivation practices were
followed as per the recommendations to the region.
The experiment was laid out in a Randomized Block
Design comprising seven treatments with three
replications each in plot size of 6.0 x 6.0 m. Spraying
of test chemicals was done at physiological maturity
email: maduri_agron@yahoo.com
115

PADMAJA et al
stage i.e., on 16-09-2009 (78 days after sowing). The
treatments consisted of T 1
: Control (No spray), T 2
:
Urea @ 10%, T 3
: Diammonium Phosphate (DAP)
@ 10%, T 4
: DAP @ 10% + ZnSO 4
@ 0.2%,T 5
:
Paraquat @ 5 ml/lt, T 6
: Glyphosate @ 10 ml/lt
and T 7
: Etherel @ 10 ml/lt. Leaf count/m 2 was taken
before spraying and at 7 and 15 days after spraying.
Mean minimum and maximum temperatures of 25.0-
27.0 C 0 and 32.2-39.0 C 0 , respectively and an amount
of 301.5 mm of rainfall were recorded in 22 rainy days
during the study period.
Results showed that among all the treatments,
spraying of Paraquat @ 5 ml/lt at physiological
maturity caused drying and fall of mungbean leaves
to 96% by the first week and 99% by the end of
second week after spraying, followed by Glyphosate
@ 10 ml/lt which influenced the defoliation to 93 and
97 per cent, respectively (Table 1). These two
herbicides were significantly superior to control as
well as other treatments. These results are in
agreement with Cothren et al. (1999) and Santi et al.
(2000). Spraying of Urea or DAP or Etherel could not
influence defoliation as they were at par with control.
Between the two herbicides, the cost incurred (Rs. /
ha) was lowest with Paraquat (Rs. 1,150/- per ha)
compared to Glyphosate (Rs. 2,175/- per ha). The
cost of application of Etherel was the highest (Rs.
8,250/- per ha) among all the treatments. Deosarkar
et al. (2009) also reported that etherel @ 6000 ppm
could influence complete drying of leaves by 6-7 days
after spraying but leaves remained attached to plant
in cotton.
The seed yield of mungbean was not significantly
affected by spraying of the defoliants. But the cost
of harvesting was reduced in Paraquat applied
treatment (Rs. 2,200/- per ha) followed by Glyphosate
Table 1. Influence of certain chemicals on the defoliation, seed yield and economics of mungbean
Treatment
T 1 : Control (No
spray)
T 2 : Urea @
10%
Before
spraying
% defoliation Seed
yield
(kg/ha)
1
week
after
sprayi
-ng
Two
weeks
after
spraying
One
week
after
spraying
286 112 87 60.84
(50.85)
344 129 87 62.50
(52.02)
T 3 : DAP @ 10% 323 85 54 73.68
(58.99)
T 4 : T 3 + ZnSO 4
@ 0.2%
T 5 : Paraquat @
5 ml/lt
T 6 : Glyphosate
@ 10 ml/lt
T 7 : Etherel @
10 ml/lt
334 79 59 76.35
(62.08)
355 13 3 96.34
(81.26)
428 32 14 92.52
(78.83)
480 121 88 74.79
(61.87)
Two
weeks
after
spraying
69.58
(56.28)
74.71
(60.41)
83.28
(66.25)
82.33
(67.38)
99.15
(87.16)
96.73
(88.03)
81.67
(66.90)
* Values in the parentheses are the arc sine transformation of the percentage
** Labour cost for harvesting (Rs. /day): 100
*** Number of labourers engaged for harvesting in control was 43 man days per ha
Harves
ting
cost
(Rs./ha)
Addition
al cost
incurred
over
control
(Rs./ha)
485 4250 -
497 3400 501
503 3450 736
510 3500 691
490 2200 1150
495 2450 2175
506 2700 8250
SEm+ - - - 5.32 5.37 20.8 - -
CD at 5% - - - 16.39 16.55 NS - -
116

EVALUATION OF DEFOLIANTS ON MUNGBEAN Vigna radiata L. AS HARVESTING TOOLS
treatment (Rs. 2,450/- per ha) due to increased labour
efficiency because of less interference of leaves in
harvesting of pods (Table 1). These results
corroborate with the findings of Rajni et al. (2011) in
Bt cotton. Thus herbicidal defoliants can be
successfully applied for aiding the harvest of
mungbean.
REFERENCES
Bi G, Scagel, C. F., Cheng, L Fuchigani, I. H. 2005.
Effects of defoliants (CuEDTA and ZnSO 4
) and
foliar urea on defoliation, nitrogen reserves and
regrowth performance of almond nursery plants.
Journal of Horticultural Science and
Biotechnology 80: 746-750.
Copur, O., Dernirel, U., Polat, R and Gur, M. A. 2010.
Effect of different defoliants and application
times on the yield and quality components of
cotton in semi-arid conditions. African Journal
of Biotechnology 9(14): 2095-2100.
Cothren, J. T., Jost, P. H and Biles, S. P. 1999.
Cotton desiccation and defoliation
by Paraquat influenced by time of day. Crop
Science 39(3):859-862.
Deosarkar, D. B., Gaikwad, A. R and Patil, S. G.
2009. Effect of etherel defoliant on cotton
variety NH-615 In: Proceedings of National
Symposium on Bt cotton: Opportunities and
prospects, 15-17 November 2009,CICR,
Nagpur, India. Pp 87.
Gwathmey,C.O and Craig, C. C. 2007. Defoliants for
cotton. In: P David (Eds), Encyclopedia of
Pest Management, Volume II, CRC Press,
USA. Pp 135-137.
Rajni, Deol, J. S and Brar, A. S. 2011. Effect of
chemical defoliation on boll opening
percentage, yield and quality parameters of
Bt cotton Gossypium hirsutum . Indian Journal
of Agronomy 56(1): 74-77.
Singh, D. P and Singh, B. B. 2011. Breeding for
tolerance to a biotic stresses in mungbean.
Journal of Food Legumes 24(2): 83-90.
Santi, P., Wilaiwan, P., Suwimol, T and Sumana, N.
2000. Effect of rate and time of Paraquat and
urea applications on mungbean defoliation
before harvesting. In: Proceedings of National
Mungbean Research Conference VIII, 18-20
January 2000, Nakhan Pathom,Thailand. Pp
85-92.
117

Research Notes
J.Res. ANGRAU 41(2) 118-122, 2013
YIELD, NUTRIENT UPTAKE AND ECONOMICS OF CASTOR AS
INFLUENCED BY INTEGRATED NUTRIENT MANAGEMENT IN
PONGAMIA + CASTOR AGRISILVISYSTEM
K. INDUDHAR REDDY, S. HEMALATHA, G. JAYASREE and V. PRAVEEN RAO
Department of Forestry, College of Agriculture, Rajendranagar, Hyderabad- 500 030
Date of Receipt : 04.07.2012 Date of Acceptance : 05.03.2013
One of the need based alternative land use
system replacing the traditional farming system is a
tree based system of cropping i.e., agroforestry which
acts as sustainable land management system
especially in dry land areas.
Pongamia pinnata is a multipurpose tree species
(MPTS) and it is a good nitrogen fixing tree also.
This tree species is sustainable for agroforestry
farming because of its fast growth and nitrogen
fixation. It is the best suited tree for energy
plantations.
Since the gestation period is high in Pongamia
and because of wider spacing between the trees the
interspaces can be effectively used for intercropping.
Castor (Ricinus communis L.) being one of the
important non edible oil seed crop of the country and
also A.P., is largely cultivated under rain fed
condition. Castor is the second most important
oilseed crop of Andhra Pradesh in terms of acreage
and economy after groundnut. The average yields of
the crop were 1346 kg ha -1 and 510 kg ha -1 for India
and Andhra Pradesh respectively (CMIE, 2010) which
was regarded as very low though occupying first rank
in area in the country. For improved production of
castor, application of required quantities of fertilizer
is imperative through sustained soil health. Soil
fertility build up through agroforestry and practice of
integrated nutrient management were suggested as
potential means to increase the soil fertility especially
in dry lands (Reddy et al. 1993).For efficient
production and management of castor in dry lands it
is necessary to seek alternate practices like
integrated nutrient management and soil and moisture
conservation.
Keeping these facts in view, a comprehensive
study is therefore planned in which different
combinations of organic manures and inorganic
fertilizers were applied to Pongamia + Castor agrisilvi
system.
The experiment was conducted during Kharif
2010-11 in alfisols at students’ farm, College of
Agriculture, Rajendranagar, Hyderabad. The soil was
red sandy loam in texture and neutral in soil reaction,
low in organic carbon and available nitrogen and
medium in available phosphorous and potassium. The
experiment was laid out in Randomized block design
with three replications and nine treatments viz., T1-
Control; T2-100% Recommended Dose of Nitrogen
(RDN) (Inorganic);T3-75% RDN (Inorganic); T4-75%
RDN (Inorganic) + 25% RDN (FYM); T5-75% RDN
(Inorganic) + 25% RDN (Neem cake); T6-75% RDN
(Inorganic) + 12.5% RDN (FYM) +12.5% RDN (Neem
cake); T7-50% RDN (Inorganic) + 25% RDN (FYM);
T8-50% RDN (Inorganic) + 25% RDN (Neem cake);
T9-50% RDN (Inorganic) + 12.5% RDN (FYM)
+12.5% RDN (Neem cake) and the requisite amount
of nitrogen was applied through urea as per the
treatments based on the recommended dose i.e., 60
kg N ha -1 . The nitrogen was applied in three equal
splits, first dose as basal and the remaining doses
at 30 and 60 days after sowing (DAS). Whereas
uniform dose of 40 kg P 2
O 5
and 30 kg K 2
O per hectare
were applied through single superphosphate and
muriate of potash respectively as basal dose to all
the experimental plots. The amount of rainfall
received during crop growth period (877.8 mm in 55
rainy days) was adequate for normal growth of crop.
The vegetative stage of crop was healthy due to
uniform distribution of rains but the incessant rains
received during crop growth coincided with flowering
and capsule formation stages and contributed to
severe incidence of castor semilooper and Botrytis,
this in turn affected the seed yield of castor drastically
and hence low yields were recorded in this
experiment.
Seed Yield
Integrated nutrient management treatments
have brought about significant differences in the seed
email: hemalathasingana@gmail.com
118

YIELD, NUTRIENT UPTAKE AND ECONOMICS OF CASTOR
yield of the castor. The seed yields were analysed
statistically and presented in Table 1 and illustrated
in Figure 1.
Among the integrated nutrient management
treatments, maximum seed yield was recorded in T 6
(75% RDN-Inorganic + 12.5% RDN-FYM +12.5%
RDN-Neem cake) (346.30kg ha -1 ) which was on par
with T 2
(100% RDN-Inorganic) (319.60 kg ha -1 ) and
T5 (75% RDN-Inorganic + 25% RDN-Neem cake)
(324.17 kg ha -1 ) and significantly higher over the other
treatments. Significantly lower seed yield was
recorded in T 1
(control) (120.10 kg ha -1 ) than the other
treatments. The reduction may be due to the severe
competition with Pongamia for nutrients and moisture.
The results were in agreement with Mutanal et al.
(2009). Data on correlation coefficients also indicated
that all growth characters and yield attributes were
positively and significantly correlated with seed yield
as it was evident from Table 4.15.
The higher seed yield in T 6
(75% RDN-Inorganic
+ 12.5% RDN-FYM +12.5% RDN-Neem cake)
(346.30kg ha -1 ) could be attributed to conjunctive use
of organic and inorganic sources of nitrogen which
increased the availability of nitrogen for favourable
plant growth and further nitrogen fertilization
increases the cation exchange capacity of plant roots
and thus became efficient in absorption of nutrient
ions (Mathukia and Modhwadia, 1995).
Comparatively low yields of castor were due to
heavy infestation of Botrytis grey mold disease and
more number of rainy days in the crop growth period
(55 rainy days) which coincided with capsule formation
stage. These results were also in conformity with
the findings of Baby and Reddy (1998), Patel et al.
(2005) and Kumar and Kanjana (2009).
Stalk Yield
The stalk yield recorded under different
integrated nutrient management treatments was
analysed statistically and presented in Table 1 and
illustrated in Figure 1.
Integrated nutrient management treatments
have brought about significant differences in the stalk
yield of the castor. Among the integrated nutrient
management treatments, maximum stalk yield was
recorded in T 6
(75% RDN-Inorganic) + 12.5% RDN-
FYM +12.5% RDN-Neem cake) (1423.93 kg/ha) and
it was on par with T 2
(100% RDN-Inorganic) (1361.73
kg ha -1 ) and T 5
(75% RDN-Inorganic + 25% RDN-
Neem cake) (1347.31 kg ha -1 ) and significantly higher
119
over the other treatments. Significantly lower stalk
yield was noticed in T 1
(control) (568.66 kg ha -1 ) than
all the other treatments.
Higher stalk yield in T 6
(75% RDN-Inorganic +
12.5% RDN-FYM +12.5% RDN-Neem cake) (1423.93
kg ha -1 ) was mainly attributed to the increased
availability of major and micronutrients due to
cumulative effect of organic manures like FYM and
neem cake and also due to higher plant height, leaf
area, number of branches and dry matter production
in the treatment. The results were in agreement with
Kumar and Kanjana (2009), Reddy et al. (1993) and
Raghavaiah and Babu (2000).
Harvest Index
The harvest index recorded under different
integrated nutrient management treatments was
analysed statistically and presented in Table 1.
Maximum harvest index was recorded in T 6
(75% RDN-Inorganic + 12.5% RDN-FYM +12.5%
RDN-Neem cake) (24.32%) and statistically it was
on par with all the treatments except with T 1
(control)
(21.12%). Maximum harvest index of castor in T 6
was mainly attributed to partitioning of dry matter
towards seed due to high availability of nutrients by
application of organic manures like FYM and neem
cake. The results were in agreement with Kumar and
Kanjana (2009), Reddy et al. (1993) and Raghavaiah
and Babu (2000).
Oil Content and Oil Yield
The oil content recorded under different
integrated nutrient management treatments was
analysed statistically and presented in Table 1.
Integrated nutrient management practices did
not influence the oil content of castor. Maximum oil
content was recorded in T 7
(50% RDN-Inorganic +
25% RDN-FYM) (52.43%) and it was followed by T 1
(control) (52.37%) and T 8
(50% RDN-Inorganic +
25%RDN-Neem cake) (51.98%). Minimum oil content
was noticed in T 2
(100% RDN-Inorganic) (50.63%).
However, the oil yield was significantly influence by
the INM treatments. T 6
(75% RDN-Inorganic + 12.5%
RDN-FYM +12.5% RDN-Neem cake) (181.57 kg ha -
1
) recorded significantly higher oil yield over all the
other treatments. The increase in the oil yield in T 6
was attributed to higher seed yield obtained in this
treatment.
The oil content in oilseeds is often a genetically
controlled parameter and may not be altered much

INDUDHAR et al
due to external inputs. Similar results were observed
by Baby and Reddy (1998) and Patel et al. (2010).
Seed Yield
Integrated nutrient management treatments
have brought about significant differences in the seed
yield and stalk yield of castor. Among the integrated
nutrient management treatments, maximum seed
yield was recorded in T 6
(75% RDN-Inorganic + 12.5%
RDN-FYM +12.5% RDN-Neem cake) (346.30kg ha -
1
) which was on par with T 2
(100% RDN-Inorganic)
(319.60 kg ha -1 ) and T5 (75% RDN-Inorganic + 25%
RDN-Neem cake) (324.17 kg ha -1 ) and significantly
higher over the other treatments. Significantly lower
seed yield was recorded in T 1
(control) (120.10 kg
ha -1 ) than the other treatments. The reduction may
be due to the severe competition with Pongamia for
nutrients and moisture. The results were in agreement
with Mutanal et al. (2009). The higher seed yield in
T 6
(75% RDN-Inorganic + 12.5% RDN-FYM +12.5%
RDN-Neem cake) (346.30kg ha -1 ) could be attributed
to conjunctive use of organic and inorganic sources
of nitrogen which increased the availability of nitrogen
for favorable plant growth and further nitrogen
fertilization increases the cation exchange capacity
of plant roots and thus became efficient in absorption
of nutrient ions (Mathukia and Modhwadia, 1995).
Higher stalk yield in T 6
(75% RDN-Inorganic +
12.5% RDN-FYM +12.5% RDN-Neem cake) (1423.93
kg ha -1 ) was mainly attributed to the increased
availability of major and micronutrients due to
cumulative effect of organic manures like FYM and
neem cake and also due to higher plant height, leaf
area, number of branches and dry matter production
in the treatment. The results were in agreement with
Kumar and Kanjana (2009), Reddy et al. (1993) and
Raghavaiah and Babu (2000).
Harvest Index
The harvest index recorded under different
integrated nutrient management treatments was
analyzed statistically and presented in Table
Maximum harvest index was recorded in T 6
(75% RDN-Inorganic + 12.5% RDN-FYM +12.5%
RDN-Neem cake) (24.32%) and statistically it was
on par with all the treatments except with T 1
(control)
(21.12%). Maximum harvest index of castor in T 6
was mainly attributed to partitioning of dry matter
towards seed due to high availability of nutrients by
application of organic manures like FYM and neem
cake. The results were in agreement with Kumar and
Kanjana (2009), Reddy et al. (1993) and Raghavaiah
and Babu (2000).
Oil Content and Oil Yield
The oil content recorded under different
integrated nutrient management treatments was
analyzed statistically and presented in Table 1.
Integrated nutrient management practices did
not influence the oil content of castor. Maximum oil
content was recorded in T 7
(50% RDN-Inorganic +
25% RDN-FYM) (52.43%) and it was followed by T 1
(control) (52.37%) and T 8
(50% RDN-Inorganic +
25%RDN-Neem cake) (51.98%). Minimum oil content
was noticed in T 2
(100% RDN-Inorganic) (50.63%).
However, the oil yield was significantly influence by
the INM treatments. T 6
(75% RDN-Inorganic + 12.5%
RDN-FYM +12.5% RDN-Neem cake) (181.57 kg ha -
1
) recorded significantly higher oil yield over all the
other treatments. The increase in the oil yield in T 6
was attributed to higher seed yield obtained in this
treatment.
The oil content in oilseeds is often a genetically
controlled parameter and may not be altered much
due to external inputs. Similar results were observed
by Baby and Reddy (1998) and Patel et al. (2010).
Significant increase in the seed yield and stalk yield
was recorded in the INM treatments over the control
(Fig 1). Among the treatments, significantly higher
seed yield (346 kg/ha) and stalk yield (1424 kg/ha)
was recorded with the application of 75% RDN through
urea and 12.5% RDN through FYM and 12.5% RDN
through neem cake, but was on par with 100% RDN
through urea (320 and 1362 kg/ha) and 75% RDN
through urea and 25% RDN through neem cake (324
and 1347 kg/ha) (Fig.2). However, harvest index was
not influenced by INM treatments. The influence of
INM on the oil content was found not significant.
Similar results were also observed by Baby and
Reddy (1998). But the oil yield per hectare was
significantly higher with the application of 75% RDN
through urea and 12.5% RDN through FYM and
12.5% RDN through neem cake over all the other
treatments.
Hence it can be concluded that for improving
the yield and quality of castor with the sustained soil
productivity, combined usage of organic manures and
chemical fertilizers in the Pongamia based
alleycropping was found to be beneficial.
120

YIELD, NUTRIENT UPTAKE AND ECONOMICS OF CASTOR
Fig.1 Seed and stalk yield of castor as influenced by different INM treatments
Table 1. Growth parameters of castor as influenced by INM treatments in Pongamia based agrisilviculture
system
Treatments
Plant
height
cm
Leaf
area cm 2
Leaf
area
index
Dry matter
production
g/plant
No.of
branches
/plant
T1-Control 95 321.2 0.159 36.30 5.3
T2-100% Recommended Dose of
Nitrogen (RDN) (Inorganic) 149 684.2 0.346 54.50 9.6
T3-75% RDN (Inorganic) 123 464.1 0.229 45.50 7.0
T4-75% RDN (Inorganic) + 25% RDN
(FYM) 144 402.1 0.199 49.07 8.4
T5-75% RDN (Inorganic) + 25% RDN
(Neem cake) 145 666.3 0.353 55.01 8.5
T6-75% RDN (Inorganic) + 12.5% RDN
(FYM) +12.5% RDN (Neem cake) 154 736.4 0.364 58.50 10.4
T7-50% RDN (Inorganic) + 25% RDN
(FYM) 125 439.6 0.217 41.60 8.0
T8-50% RDN (Inorganic) + 25% RDN
(Neem cake) 127 546.1 0.270 42.53 8.2
T9-50% RDN (Inorganic) + 12.5% RDN
(FYM) +12.5% RDN (Neem cake) 142 511.4 0.253 43.67 8.4
S.Em.± 4.2 24.5 0.003 1.51 0.4
CD (P=0.05) at 5%
11.1 74.2 0.021 4.34 0.9
Mean 133.8 530.2 0.265 47.41 8.32
121

INDUDHAR et al
Table 2. Yield parameters of castor as influenced by INM treatments in pongamia based agrisilviculture
system
Treatments
Spike
length
(cm)
Number
of
spikes
per
plant
Number
of
capsules
per
spike
100 seed
weight(g)
Oil
content
(%)
T1-Control 11.3 5.2 11.8 16.2 52.37
T2-100% Recommended Dose of
Nitrogen (RDN) (Inorganic) 19.3 8.7 22.3 21.0 50.63
T3-75% RDN (Inorganic) 14.5 6.0 17.4 18.3 52.53
T4-75% RDN (Inorganic) + 25%
RDN (FYM) 15.8 8.9 20.0 19.8 50.96
T5-75% RDN (Inorganic) + 25%
RDN (Neem cake) 17.1 9.1 21.9 20.0 50.78
T6-75% RDN (Inorganic) + 12.5%
RDN (FYM) +12.5% RDN (Neem
cake) 19.7 9.7 23.1 21.2 52.43
T7-50% RDN (Inorganic) + 25%
RDN (FYM) 14.4 7.3 17.1 19.6 51.64
T8-50% RDN (Inorganic) + 25%
RDN (Neem cake) 16.4 7.4 20.2 18.4 51.98
T9-50% RDN (Inorganic) + 12.5%
RDN (FYM) +12.5% RDN (Neem
cake) 18.2 7.7 20.8 18.7 52.07
S.Em.± 1.0 0.9 0.53 0.9 1.64
CD (P=0.05) 3.0 2.1 1.6 3.0 N.S.
Mean 16.35 7.78 19.4 18.9
REFERENCES
Baby, A and Reddy, T.B. 1998. Integrated nutrient
management in rainfed castor. Journal of
Oilseeds Research. 15 (1): 115-117.
CMIE. 2010. Agriculture. Centre for Monitoring Indian
Economy (CMIE), Private Limited. Mumbai.
June, 2010. 183.
Raghavaiah, C.V and Babu, S.N. 2000. Effect of
seedling time, female: male row proportion and
nitrogen on certified seed production of GCH
4 (VP-1 × 48-1) castor hybrid Ricinus
communis L. Journal of Oilseeds Research.
17(1): 100-106.
Rao, M.M.V.S., Bheemaiah, G and Subrahmanyam,
M.V.R. 2000. Growth and yield of rainfed
groundnut Arachis hypogaea alley cropped with
Albizia lebbeck under integrated nutrient
management. Indian Journal of Agricultural
Sciences. 70 (11): 786-790.
Reddy, G.S., Venkateshwarlu, B and Sankar, G.R.M.
1993. Effect of different organic materials as
source of nitrogen on growth and yield of castor.
Journal of Oilseeds Research. 10 (1): 151-152.
122

Research Notes
J.Res. ANGRAU 41(2) 123-125, 2013
NANO FOOD COLOURS FOR PRODUCT FORMULATIONS WITH SELECTED
FRUITS (PAPAYA AND BLACK GRAPES) AND VEGETABLES
(TOMATO AND BEET ROOT)
P. SRILATHA and K. UMA MAHESWARI
Department of Food and Nutrition, PGRC, Acharya N. G. Ranga Agricultural University
Rajendranagar, Hyderabad-500030.
Date of Receipt : 15.06.2012 Date of Acceptance : 28.12.2012
Colorants become the most sensitive part
of any commodity not only for its appeal as it also
enhances consumer acceptability (Clydesdale, 1993).
With reference to food, colour is a means of
identification, a method of judging quality and a base
for aesthetic value. Colour being the first quality
attribute perceived by the senses, besides flavor,
the colour perception appear to be closely linked to
enjoyment of food. The general objective of adding
colour to foods was to make them appealing and
recognizable (Sampathu et al. 1981).
Nanotechnology commonly refers to any
engineered materials, structures and systems that
operate at a scale of 100 nanometers or less (one
nano meter is one billionth of a meter). Today, major
industrial countries are incorporating nanotechnology
in their innovation systems as they see it as an
engine for wealth creation in the near future (Roco,
2002).
Food companies are currently producing
nanoparticles in emulsions in an attempt to control
the material properties of foodstuffs, such as in the
manufacture of ice cream to increase texture
uniformity (Rowan, 2004). An attempt was made in
the present investigation to incorporate nano particles
into food products and evaluate sensory scores for
colour, flavour, appeal and overall acceptability of
the prepared products.
Two fruits papaya and black grapes and two
vegetables tomato and beetroot were selected as
these fruits are rich sources of natural colours such
as carotenes in papaya, anthocyanins in black
grapes, lycopene in tomato and betalains in beet root.
One kg of each selected fruits and vegetables were
thoroughly washed in hot water and were cut into
thin pieces. These pieces are placed in separate trays
and were subjected to Infrared (IR) drying. After drying,
the samples were cooled and grinded in a conventional
grinder into fine powder. These dehydrated powders
are used for synthesis of Zinc nanoparticles using
oxalate decomposition method.
Two Products viz., kesari and soup mix were
prepared using the nano food colours (NFCs) to
evaluate intensity of extracted colour in foods and
prepared products were kept for sensory evaluation.
Kesari was prepared with fruit (papaya &
black grapes) NFCs and soup mix was prepared with
vegetable (tomato & beet root) NFCs for sensory
evaluation.
Each product was incorporated with 10% NFC
(T 1
)
, 15% NFC (T 2 ) and 20% NFC (T 3 ) .
The sensory scoring was done by a panel of 10
members in the laboratory of Post Graduate and
Research Center using a score card developed for
the purpose. Score card was prepared keeping in view
the quality characteristics of the products. Descriptive
terms were given to various quality attributes like
colour, flavour, appeal and overall acceptance.
Numerical scores were assigned to each
attribute (Joshi, 2006). 5-point hedonic scale was
adopted to score each of the attributes. While scoring,
highest score (5) was assigned to most preferred
characteristic and least score (1) to the least desired
characteristics.
The data regarding sensory evaluation of finished
products was subjected to statistical analysis as per
the procedure described by Panes and Sukhatme
(1985). The experimental design was complete
randomized block design with factorial concept.
email: srilatha2708@gmail.com
123

SRILATHA and UMA
Kesari prepared by incorporating different
concentrations of NFCs from selected fruits (papaya
and black grapes) was subjected to sensory
evaluation.
Colour scores of the treatments showed
significant variations (P < 0.05) in which T 3
(4.40%)
scored highest followed by T 2
(3.20%) and T 1
(4.20%)
in NFC with papaya.
With regard to black grapes also colour
scores among the treatments, showed significant
variations (P< 0.05) in which T 3
(4.70%) scored
highest followed by T 2
(4.0%) and T 1
(3.10%).
Significant (P > 0.05) difference was not
observed in sensory scores for flavour. Among the 3
variations, T 3
(3.80%) recorded highest and T 2
scored
lowest (3.60%) in NFC with papaya and T 3
(4.50%)
recorded highest and lowest score was observed for
T 1
(3.30%) in NFC with black grapes.
In case of product appeal, significant
variation (P < 0.05) was recorded in sensory scores.
T 3
(4.3%) was found to have maximum score for
appeal in comparison to T 1
(3.20%) and T 2
(3.90%)
samples in NFC with papaya. However, in NFC with
black grapes T 3
(4.0%) and T 2
(4.0%) were found to
have equal and good appeal in comparison to T 1
(2.90%) samples.
The overall acceptability scores showed
significant variation (P < 0.05) in which T 3
(4.3%)
scored higher followed by T 2
(4.0%) and lowest score
was observed for T 1
(3.1%) in NFC with papaya and
T 2
(4.5%) scored higher followed by T 3
(4.2%) and
lowest score was observed for T 1
(3.1%) in NFC with
black grapes.
Fig 1. Mean sensory scores for Kesari prepared by incorporating NFCs from fruits (papaya & black
grapes)
T 1
- 10% NFC T 2 -
15% NFC T 3
- 20% NFC
Soup mix prepared by incorporating different
concentrations of NFCs from selected fruits (papaya
and black grapes) was subjected to sensory
evaluation.
Colour scores of the treatments showed
significant variations (P < 0.05) in which T 3
(4.50%)
scored highest followed by T 2
(4.40%) and lowest
score was observed for T 1
(3.10%) in NFC with
tomato.
With regard to beet root, it was observed
that the colour scores among the treatments, showed
significant variations (P< 0.05) in which T 2
(4.30%)
scored highest followed by T 3
(4.10%) and lowest
score was observed for T 1
(2.60%).
Significant (P > 0.05) difference was not
observed in sensory scores for flavour. However
among the treatments T 3
(4.10%) recorded higher
and lower score was observed for T 1
(3.90%) in NFC
with tomato and T 3
(4.0%) recorded highest and
lowest score was observed for T 1
(3.40%) in NFC
with beet root.
On sensory evaluation, significant variation (P <
0.05) was recorded in sensory scores for appeal. T 3
(4.0%) was found to have maximum score for appeal
in comparison to T 2
(3.7%) and T 1
(2.9%) samples
in NFC with tomato. However, in NFC with beet root
T 3
(4.5%) and T 2
(3.9%) were found to have good
appeal in comparison to T 1
(2.40%) samples.
124

NANO FOOD COLOURS FOR PRODUCT FORMULATIONS WITH SELECTED FRUITS
The overall acceptability scores showed
significant variation (P < 0.05) in which T 3
(4.5%)
scored higher followed by T 2
(4.2%) and lowest score
was observed for T 1
(2.6%) in NFC with tomato and
T 3
(4.3%) scored higher followed by T 2
(3.9%) and
lowesr score was observed for T 1
(2.5%) in NFC with
beet root.
Fig 2. Sensory evaluation scores for soup mix prepared by incorporating NFCs from vegetables
(tomato & beet root)
T 1
- 10% NFC T 2 -
15% NFC T 3
- 20% NFC
For the preparation of products T 3
sample
scored highest for all attributes such as colour, flavor,
appeal and overall acceptability for kesari prepared
with NFCs synthesized from papaya and black
grapes. In soup mix prepared by incorporating NFCs
synthesized from tomato and beet root T 3
and T 2
scored highest for colour attribute in tomato and beet
root respectively. Among all T 3
scored highest i.e.,
20% NFC was most acceptable to the panelists. In
both Kesari and Soup mix the quantity of NFCs used
(10%, 15% and 20%) for sensory evaluation was high
because it is assumed that prepared particles (NFCs)
could release the colour into the food material over
an extended period of time which can be considered
as slow-release of the colour. Hence these NFCs
can be used in preserved products which have longer
shelf life for slow release of colour.
REFERENCES
Clydesdale, F. M. 1993. Color as a factor in food
choice. Critical Review of Food Science and
Nutrition. 33: 83-101.
Joshi, V. K. 2006. Sensory Science-Principles and
Applications in Food Evaluation. Agrotech
Publishing Academy, Udaipur.
Panes, V. G and Sukhatme, P. V. 1985. Statistical
methods for agricultural workers, ICAR, New
Delhi.
Roco, M.C. 2002. Government Nanotechnology
Funding: An International Outlook. National
Nanotechnology Initiative. Senate of the United
States (January 16, 2003). 21st Century
Nanotechnology Research and Development
Act.http://www.nano.gov/intpersp_roco.html.
Rowan, D. 2004. “How Technology is Changing our
Food.” The Observer, Sunday, May 16.
Sampathu, S. R., Krishna murthy, N., Shivashankar.
S., Shankaranarayan, R., Srinivasa Rao, P.
N and Lewis, Y. S. 1981. Natural Food
Colours. Indian Packer. March-April: 97-105.
125

Research Notes
J.Res. ANGRAU 41(2) 126-130, 2013
EFFECT OF ORGANIC FERTILISERS ON GROWTH, YIELD AND
QUALITY OF TOMATO Lycopersic esculentum
S. VANI ANUSHA, P. PRABHU PRASADINI, S. SRI DEVI and K. SURYA PRAKASH RAO
Department of Environmental Science and Technology,
College of Agriculture, Acharya N.G. Ranga Agricultural University, Rajendranagar, Hyderabad-500030
Date of Receipt : 28.01.2013 Date of Acceptance : 03.05.2013
Post green revolution chemical fertilizers are
being commonly used by farming community
indiscriminately to meet the population demand for
food. Intensification of fertilization (Hrivna et al., 2002)
and a wide range of fertilizers, imposes the
necessities for detailed analysis on the effect of their
application upon crop yield and nutritional value of
the obtained yield (Domske et al., 2001). However,
organic products use has also been increasing for
various reasons. Organic manures continue to be the
major substances that maintain congenial soil
environment for root growth and would supply
nutrients required for proper growth and development
of plants. However, the lack of supply to meet the
demand paved the way for alternate options such as
use of organic wastes, biofertilisers and organic
fertilizers.
A pot culture experiment was conducted in
the green house of the Department of Soil Science &
Agricultural Chemistry, College of Agriculture,
Hyderabad during kharif 2010 by using medium
textured soil, tomato as test crop, to study the effect
of organic fertilizers on growth, yield and quality. The
experiment was laid out in completely randomized
design. The treatments consists of T 1
(control), T 2
(Inorganic NPK @120-60-60 kg ha -1 ), T 3
(T 2
+ ZnSO 4
@ 25 kg ha -1 ), T 4
(Inorganic N @ 120 kg ha -1 + Bio
Phos @75 kg ha -1 + Bio Potash @75 kg ha -1 ), T 5
(T 2
+ Bio Zn @ 13 kg ha -1 ) and T 6
(T4 + Bio Zinc @ 13 kg
ha -1 ), T 7
(New Suryamin @ 25 kg ha -1 ), T 8
(T 2+
T 7
), T 9
(Aishwarya @ 125 kg ha -1 ) and T 10
(T 2
+ T 9
). Inorganic
N, P and K were supplied through urea, single super
phosphate and muriate of potash, respectively.
The organic inputs used in the pot culture
experiment were analyzed for physico-chemical and
chemical properties by using standard procedures
(Tandon, 1995). Phosphorus, potassium and zinc
were estimated in the triacid extract from finely
ground sample (0.5 gm) digested with 20 ml triacid
mixture consisting of HNO 3
: H 2
SO 4
: HClO 4
in 9:4:1.
Phosphorus content
was determined by
vanadomolybdo phosphoric method, using double
beam UV Spectrophotometer model UV5704SS at
420 nm; K by using flame photometer model CL 361
and
Zinc by using Atomic Absorption
Spectrophotometer model NOVAA300.
Different organic fertilizers with and without
inorganic fertilizers were mixed in the soil before
transplanting as per prescribed treatments. Two plants
were maintained in each pot. Plant samples were
collected at two stages i.e., at vegetative phase (30
DAT) and harvesting phase (90 DAT). Plant
parameters like plant height and drymatter production
were recorded at both the stages whereas chlorophyll
content (with SPAD meter) and leaf area (with model
LICOR-3100) were recorded only at vegetative stage.
Fruit weight was recorded at harvest. Fruit samples
at 90DAT were analyzed for lycopene content
(Ranganna, 1986). The results of pot culture studies
were subjected for statistical analysis as per the
procedures outlined by Snedecor and Cochran (1973).
Characteristics of Bio Phos, Bio Potash, Bio
Zinc, New Suryamin and Aiswarya are shown in Table
1 which indicated that all were acidic and contained
organic carbon, nitrogen, phosphorus, potassium and
zinc. The organic carbon content ranged from 3.05
to as high as 27.8 % in Aishwarya, which was similar
to organic manures as reported in poultry manure as
20.12%, farm yard manure as 17.3% and EM
compost as 15.01% by Mallesh (2009).
email: prabhuprasadini@rediffmail.com
126

EFFECT OF ORGANIC FERTILISERS ON GROWTH, YIELD AND QUALITY OF TOMATO
Table 1. Salient characteristics of organic fertilisers
S. No. Characteristics
Bio
Phos
Bio
potash
Bio Zinc
New
Suryamin
Aishwarya
I. Physico-chemical properties
a) pH 5.03 6.54 6.31 5.77 6.02
b) EC (dS m -1 ) 4.88 6.66 6.45 1.19 5.05
II.
Chemical properties
a) Total Organic carbon (%) 3.23 3.97 4.42 3.05 27.8
Nutrient content
b) Nitrogen (% N) 0.016 0.042 0.032 0.95 1.2
c) Phosphorus (% of P) 1.91 0.4 0.49 0.91 0.68
d) Potassium (% of K) 1.0 2.0 1.25 0.59 2.3
c) Zinc(mg/kg) 1136 1520 2300 1244 1378
Plant growth in terms of height and dry matter
production recorded at vegetative (30 DAT) and
harvest stages (90 DAT) of tomato are presented in
Table 2. Data set out in the Table revealed significant
difference in plant height due to the application of
various treatments. The plant height at vegetative
stage was recorded highest by T 3
(Inorganic NPK
and Zn) and at 90DAT by T 6
(Inorganic N + Bio Phos
+ Bio Potash + Bio Zinc). Combination of organic
inputs along with inorganics also increased the plant
height significantly over organics alone. Similar
benefits with organic fertilizers were reported in green
gram crop by Anuradha (2010). Supply of P, K
through organic fertilizers (T 6
) resulted in increase of
plant height by 14.1 cm i.e., 32% over Inorganic P K
(T 3
). And also it was observed that supply of zinc
through Bio Zinc recorded higher values by 7.8%
compared to that when supplied through inorganic
ZnSO 4.
This could be due to the nutrient composition
of the organic fertilizers viz., Bio Phos, Bio Potash,
Bio Zinc, New Suryamin and Aishwarya which
contained organic carbon, nitrogen and zinc besides
their main nutrient. Makinde (2007) reported highest
maize plant height of 111 cm with organo mineral
fertilizer which was 44 % more than the control plot.
Drymatter production was significantly higher
compared to control in both the stages of crop growth.
Plant dry matter production is a result of Growth
Environment interaction through leaves, stems, roots
and reproductive parts which contribute to dry matter.
Highest dry matter was produced with integrated
approach of application of nutrients as in T 10
(Aishwarya + Inorganic NPK) at 30DAT and in T 6
(Inorganic N + Bio Phos + Bio Potash + Bio Zinc) at
90 DAT, which recorded 11.8 g higher dry matter
when compared to T 3
(Inorganic NPK and Zn ).
Marimuthu et al. (2003) recorded the highest growth
of green gram by the application of 25 Kg P 2
O 5
ha -1
as Mussorie rock phosphate along with enriched
biodigested slurry.
Leaf area recorded at vegetative stage (30
DAT) presented in Table 2 showed significant
127

Vani et al
Table 2. Effect of organic fertilizers on tomato growth, yield and quality
T 1
T 2
T 3
T 4
T 5
T 6
T 7
T 8
T 9
T 10
128

EFFECT OF ORGANIC FERTILISERS ON GROWTH, YIELD AND QUALITY OF TOMATO
variation among different treatments. The highest
mean leaf area (1178.6 cm 2 ) was found in T 6
(Inorganic N + Bio Phos + Bio Potash + Bio Zinc)
where organic fertilizers were applied for P, K and
Zn. There was an increase of 73% in leaf area when
combination of organic and inorganic sources were
used as in T 10
(Aishwarya + Inorganics NPK) when
compared to only application of inorganic NPK (T 2
)
and it was 8.9% when compared to T 9
(Aishwarya
alone). There was 7.2% increase in leaf area when
combination of organic fertilizers and inorganics, T 8
(New Suryamin + Inorganic NPK) were used instead
of organics alone, T 7
(New Suryamin). Organic
fertilizers alone or in combination with inorganics
proved superior to inorganic fertilizers for the reason
that organic fertilizers are multi nutrient sources which
supply different nutrients as shown in Table 1.
Addition of fertilizers either organic or inorganic
increased chlorophyll content also significantly.
Similar results were reported by Anuradha (2010) on
greengram in a pot culture study.
Yield in terms of fruit weight varied from 67.7
to 212 g plant -1 among different treatments (Table 2).
The highest fruit weight was obtained by the treatment
wherein all nutrients were supplied through inorganic
sources along with carbon rich Aishwarya (T 10
)
followed by T 6
(Inorganic N + Bio Phos + Bio Potash
+ Bio Zinc) and T 8
(New Suryamin + Inorganic NPK).
Any organic source either alone or in combination
with Inorganic NPK significantly increased yield over
inorganic NPK. The treatment where only inorganic
NPK (T 2
) was used has recorded 162.4 g per plant -1
which was increased by 10.4 g (6.4%) by the addition
of zinc sulphate in T 3
(Inorganic NPK and Zn) and a
further increase by 18.8 g (10.8%) with replacing zinc
sulphate by Bio zinc (T 5
). An increase of 11.7 % of
fruit was observed when inorganic P and K (T 2
-
Inorganic NPK) were replaced by organic fertilisers
T 4
(Inorganic N + Bio Phos + Bio Potash). Makinde
(2007) reported that the multi nutrients content and
35.5 g kg -1 of organic carbon in organo- mineral
fertilizer resulted in higher yield of 812 kg ha -1 of
melons with 4 t ha -1 of organo mineral fertilizer
compared to control which yielded 347 kg ha -1 . The
superior performance of organic treated plants might
be owing to improvement in physical, chemical and
microbiological environment of soil favoring increased
availability of plant nutrients (Hossain et al., 2009)
which effect the translocation of sugars to the fruits
and hence the weights.
The lycopene content as influenced by
different treatments is presented in Table 2 revealed
the significant effect of organic and inorganic
fertilizers on the lycopene content of tomato. The
highest lycopene content (49 µg g -1 ) was observed in
the treatment T 6
(Inorganic N + Bio Phos + Bio Potash
+ Bio Zinc), followed by T 10
(Aishwarya + Inorganic
NPK).
The study concludes the recommendation
of the use of these organic fertilizers as a part of
INM, either alone or along with inorganics owing to
the beneficial effects observed on growth, yield and
quality of tomato.
REFERENCES
Anuradha, Ch. 2010. Studies on the effect of organic
agricultural inputs on growth, development and
nutrient accumulation in green gram Phaseolus
Aureus Wilczek. M.Sc Thesis submitted to
Acharya N. G. Ranga Agricultural University,
Hyderabad.
Domske, D., Bobrezecka, D., Wojtkowiak, K.,
Warzechowska, A and Sokolowski, Z. 2001.
Influence of fertilization technique on triticale
yield and grain quality. Folia of University of
Agriculture, Stetin, 223, Agriculture, 89:35-40.
(In Polish)
Hossain, M. F., Bhuiya, M.S.U., Ahmed, M and Mian,
M.H. 2009. Effect of organic and inorganic
fertilizer on the milling and physicochemical
properties of Aromatic rice. Thai Journal of
Agricultural Science. 42 (4): 213-218.
Hrivna, L., Richter, T., Losak, T and Hlusek, 2002.
Effect of increasing dose of nitrogen and
129

Vani et al
Sulphur on chemical composition of plants,
yields seed quality in winter rape. Rostlinna
Vyroba. 48: 1-6.
Makinde, E. A. 2007. Effects of an organomineral
fertilizers application on the growth and yield
of maize. Journal of Applied Science Research
3(10):1152-1155.
Mallesh, 2009. Studies on impact of Enriched
microbial (EM) compost application on paddy
and maize. M.Sc Thesis submitted to Acharya
N. G. Ranga Agricultural University,
Hyderabad.
Marimuthu, R., Babu, S and Vairavan, K. 2003.
Response of bio-organic fertilizers with
mussoorie rock phosphate on the yield of
greengram on red lateritic soils. Legume
Research 26 (1): 66-68.
Ranganna, S. 1986. Hand book of Analysis and
Quality Control for Fruit and Vegetable
Products, second edition. Tata Mc Graw-Hill
publishing company limited, New Delhi.
Snedecor, G. W and Cochran, W. G. 1973. Statistical
methods. 6 th Edition. Iowa state University Soil
Analysis. Arner Society Agronomy Publisher.
Tandon, H. L. S. 1995. Methods of analysis of soils,
plants, waters and fertilizers. FDCO, New
Delhi. Pp143.
130

Research Notes
J.Res. ANGRAU 41(2) 131-134, 2013
NUTRIENT UPTAKE OF MICROSPRINKLER IRRIGATED WHEAT CULTIVARS
UNDER VARYING NITROGEN LEVELS
MATHURA YADAV, V. PRAVEEN RAO and K. SURESH
Department of Agronomy,
College of Agriculture, Acharya N.G. Ranaga Agricultural University, Rajendranagar, Hyderabad-500 030
Date of Receipt : 16.03.2013 Date of Acceptance : 11.06.2013
Fertilizers constitute an integral part of
improved crop production technology. Proper amount
of fertilizer application is considered a key to the
higher crop production. Nitrogen (N) is major factor
limiting yield of wheat (Andrews et al. 2004). Optimum
N management to wheat is important for maximum
yield and minimum contamination to environment.
The efficiency of wheat cultivars to N use has become
increasingly important to allow reduction in N fertilizer
use without decreasing yield.
Keeping the above facts in view, a field
experiment was conducted during rabiseason of
2010–11 at Agricultural Research Station, Basantpur,
Medak district in Central Telangana Zone of Andhra
Pradesh. The soil was loamy sand in texture with a
soil pH of 6.4 and had S 1
salinity class (EC 0.96 dS
m -1 ). The experimental soil was low in available
nitrogen (265 kg N ha -1 ), phosphorus (19.59 kg
P 2
O 5
ha -1 ) and medium in available potassium (219.4
kg K 2
O ha -1 ). The treatments consisted of five wheat
cultivars viz.,Sonalika (V 1
), NIDW295 (V 2
),UAS415
(V 3
),NIAW 917 (V 4
) and DWR 162 (V 5
)as main plot
treatments and five levels of nitrogen 0, 80, 120, 160
and 200 kg N ha -1 as sub-plot treatments summing
up to 25 treatment combinations laid out in split-plot
design with three replications. The crop was sown
on 1 st November, 2010. The crop was irrigated based
on 1.0 IW/CPE ratio with 50 mm irrigation water depth
(IW) using micro sprinkler irrigation system. The
seasonal irrigation water depth was 350 mm. The
wheat cultivars were harvested between 15 to 20 th
February 2011.
Plant samples collected for estimation of dry
matter accumulation (grain and straw) at harvest were
analysed for N, P, and K by adopting standard
procedures. Total uptake of N/P/K was calculated
separately by the following formula:
Nutrient uptake (NPK kg ha -1 ) =
Nutrient content % X Dry matter (kg ha -1 )
100
Further the application of fertilizer N and the efficiency of its use by wheat crop were evaluated by
calculating the following fertilizer use efficiency criteria (Crasswell and Godwin, 1984):
Agronomic Efficiency (kg grain Kg -1 N) =
Y N
- Y O
Where, Y N
and Y 0
are crop yields (kgha -1 ) at a certain level of N application [F (kg ha -1 )] and in the
control treatment, respectively.
F N
Recovery Efficiency (kg grain N Kg -1 N) =
U N
- U O
F N
Physiological Efficiency (kg grain Kg -1 N) =
Y N
- Y O
U N
- U O
email: v.prao@yahoo.com
131

MATHURA et al
Where U N
and U 0
are total plant N uptake
(kgha -1 ) in the above ground biomass at a certain
level of fertilizer application [F (kg ha -1 )] and in the
control treatment, respectively.
The mean uptake of nitrogen, phosphorus
and potassium by was 64.91, 22.34 and 38.1 kg
ha -1 , respectively (Table 1). Nutrient (NPK) uptake
was influenced by different cultivars. Variety V 2
(NIDW 295) and V 3
(UAS 415) registered similar
nitrogen, phosphorus and potassium uptake but
significantly higher in comparison to other varieties
viz., V 1
(Sonalika), V 4
(NIAW 917) and V 5
(DWR 162)
owing higher yield. Among the latter varieties V 1
had
performed well in terms of nutrient (NPK) uptake over
V 4
and V 5
, which were on par. Variation in NPK uptake
among varieties differing in their genetic makeup was
Table 1. Nutrient (NPK) uptake (kg ha -1 ) of wheat as influenced by varieties and nitrogen levels at
harvest
Cultivars
Treatments
Seed yield
(kg ha -1 )
Total NPK uptake (grain +Straw)
N P K
V 1 – Sonalika 2569.7 55.36 9.74 30.01
V 2 – NIDW 295 3169.5 73.91 11.24 37.02
V 3 – UAS 415 3091.1 70.28 11.11 36.04
V 4 – NIAW 917 2374.3 43.98 8.50 26.86
V 5 – DWR 162 2447.0 47.85 8.51 28.67
SEd±
141.4
2.17
0.45
0.93
CD at 5%
326.2
5.01
1.03
2.15
Nitrogen Levels
N 0 – 0 kg N ha -1 1645.7 24.13 5.52 18.29
N 80 – 80 kg N ha -1 2734.6 54.57 9.77 31.60
N 120 – 120 kg N ha -1 2930.7 63.98 10.63 34.55
N 160 – 160 kg N ha -1 3168.6 74.49 11.26 36.99
N 200 – 200 kg N ha -1 3172.3 74.72 11.32 37.16
SEd ±
76.8
1.52
0.25
0.86
CD at 5%
155.3
3.08
0.51
1.74
Interaction effect (V x N)
Sub at same level of main treatment
SEd±
171.7
3.41
0.56
1.93
CD at 5%
NS
NS
NS
NS
Main treatment at same or different levels of sub treatment
SEd±
208.8
3.74
0.67
1.96
CD at 5%
NS
NS
NS
NS
General mean 2730.3 64.91 22.34 38.10
132

NUTRIENT UPTAKE OF MICROSPRINKLER IRRIGATED WHEAT CULTIVARS
reported by Mukherjee (2008) and Singh et al. (2010)
owing to their genetic makeup and yield potential.
Each higher level of nitrogen significantly
increased the nitrogen, phosphorus and potassium
uptake over its lower level up to 160 kg N ha -1 (N 160
)
(Table 1) due to increased grain yield. Application of
200 kg N ha -1 (N 200
) did not prove to be advantageous
over N 160
in improving the nutrient uptake. These
results are in conformity with those of Singh et al.
(2011). The interaction effect (V x N) was significant
on nitrogen, phosphorus and potassium uptake. The
NPK uptake pattern in relation to applied N is shown
in Fig. 1. The explained total variation (R 2 ) in NPK
uptake by applied N was significant and amounted
to 99.5%, 99.9% and 99.8%, respectively suggesting
that the nutrient uptake increased with increase in
applied N, but the increase in uptake was not
proportional to the applied N at higher levels (Fig. 1).
The maximum N uptake was not bracketed within
the administered N levels. The predicted maximum
N uptake of 74.6 kg ha -1 was obtained with 214.6 kg
applied N ha -1 . Whereas, the maximum uptake of P
(10.9 kg ha -1 ) and K (35.9 kg ha -1 ) occurred at applied
N levels of 163.7 kg and 171.0 kg ha -1 . Further the
nutrient uptake function did not emerge through the
origin and the value of regression constant (a) was
positive, indicating that some amount of nutrients
are taken up by the wheat crop from native fertility
status.
Fig. 1. Nutrient uptake as a function of applied nitrogen
The agronomic efficiency (AEN), recovery
efficiency (RE) and physiological efficiency (PE) as
influenced by different nitrogen levels is presented
in Fig. 2. Perusal of the Fig. 2 suggests that each
higher level of nitrogen linearly decreased the AEN,
RE and PE. The mean values of AEN, REN and PEN
were 10.37 kg grain kg -1 N, 0.32 kg N kg -1 N, 32.12
kg grain kg -1 N absorbed, respectively.
133

MATHURA et al
Fig. 2. Nitrogen fertilizer use efficiencies for wheat
Thus, it can be concluded that variety NIDW 295 and UAS 415 registered higher NPK uptake at 160
kg N ha -1 . However, fertilizer use efficiencies tended to decrease with increase in N levels.
REFERENCES
Andrews, M., Leap, J., Raven, J.A and Lindsey, K.
2004. Can genetic manipulation of plant
nitrogen assimilation enzymes result in
increased crop yield and greater n-use
efficiency? An assessment. Annals of Applied
Biology 145: 25 – 40.
Crasswell, E.T and Godwin, D.C. 1984. The efficiency
of nitrogen fertilizers applied to cereals in
different climates. Advances in Plant Nutrition
1: 1 – 55.
Mukherjee, D. 2008. Effect of levels of nitrogen on
different wheat cultivar under Mid Hill
situation.RAU Journal of Research. 18: 37 –
40.
Singh, C.M., Sharma, P.K., Kishore, P., Mishra,
P.K., Singh, A.P., Verma, R and Raha, P.
2011. Impact of integrated nutrient
management on growth, yield and nutrient
uptake by wheat. Asian Journal of Agricultural
Research 5: 76 – 82.
Singh, P., Singh, P., Singh, K.N., Singh R., Bahar,
F and Raja, W. 2010. Evaluation wheat
(Triticumaestivum) genotypes for productivity
and economics under graded levels of nitrogen
in Kashmir. Indian Journal of Agricultural
sciences 80: 380 – 384.
134

Research Notes
J.Res. ANGRAU 41(2) 135-140, 2013
EFFECT OF SYNERGIST, TRIPHENYL PHOSPHATE ON RESISTANT GUNTUR
STRAIN OF Spodoptera litura (fab.) IN COTTON
I. ARUNA SRI and T. MADHUMATHI
Department of Entomology, Agricultural College,
Acharya N.G Ranga Agricultural University, Bapatla -522101
Date of Receipt : 12.01.2012 Date of Acceptance : 28.06.2013
Spodoptera litura (Fab.) is the first
lepidopterous pest and second agricultural pest
developed resistance in India. It has the ability to
develop resistance to insecticides used for its control.
Strains of S. litura resistant to cyclodienes,
organophosphates and carbamates have been
detected in all areas where intensive control
operations were carried out with these insecticides.
Synergists increase the lethality of insecticides by
inhibiting insecticide detoxifying enzymes. This
enables synergists to be used as tools for elucidating
resistance mechanisms, especially if they are
specific inhibitors of a particular resistance conferring
mechanism such as detoxification of enzymes and
also play a significant role in enhancing toxicity on
the resistant strain to a greater extent (Kranthi, 2005).
Mechanisms of insecticide resistance can be
identified based on differential mortalities by
combining various categories of synergists with
insecticides (Prabhakar et al., 1988). The synergists
act as useful indicators of metabolic mechanisms of
resistance such as TPP for esterases (Casida, 1970).
The synergist, Triphenyl phosphate (TPP) was tested
with chlorpyriphos, quinalphos, endosulfan,
cypermethrin and methomyl to know their synergistic
effect. Synergists may also affect penetration of
toxicants into insects. Hence, this study was taken.
Experiments were carried out in the
Department of Entomology, Agricultural College,
Bapatla, Guntur district, Andhra Pradesh during two
years viz., 2007-08 and 2008-09. The third instar
larvae weighing 30 mg ± 0.011 S.E. of Guntur strain
of S.litura was selected as the test insect in this
study because it showed higher degree of resistance
to the insecticides compared to Prakasam strain.
Chlorpyriphos, quinalphos, endosulfan, cypermethrin
and methomyl were the test insecticides and
synergist used in the study was Triphenyl phosphate
(TPP) for esterase activity.
Bioassay was done by topical application
method (FAO, 1971). Initially 2.0 per cent stock
solution of the test insecticides and synergist, TPP
was prepared from the technical grade by dissolving
the required quantities after accurate weighment in
acetone. The stock solution thus prepared was
preserved in refrigerator for further use. Individual
working concentrations for each of the test
insecticides (chlorpyriphos, quinalphos, endosulfan,
cypermethrin and methomyl) were prepared from the
2.0 per cent stock solution through serial dilution
technique using acetone as solvent. Two microlitres
of the respective test insecticidal solution was
applied on the dorsum of second thoracic segment
by micro applicator. Three replications were
maintained for each insecticidal concentration with
10 larvae in each replication. Mortality of the larvae
was recorded at 24, 48 and 72 hours after treatment
(HAT). Further test insecticide in combination with
TPP mixture in the ratio of 1:10 i.e., the concentration
of synergist (TPP) was ten times more than that of
the test insecticide was prepared and from that two
microlitres was applied to the third instar S.litura larvae
by topical application method. Three replications were
maintained for each insecticidal concentration with
10 larvae in each replication.
Mortality of the larvae was recorded at 24,
48 and 72 hours after treatment (HAT). The
experiments were repeated so as to get mortality in
the range of 5 – 90 per cent and the data were
subjected to probit analysis (Finney, 1971) using MLP
3.08 software (Ross, 1987) and the respective LD 50,
LD 90
and other parameters were calculated. The log
dose probit (ldp) lines were drawn by plotting log dose
(x) on x-axis and probits of respective doses on y-
axis (Finney, 1971).
email: issaiaruna@gmail.com
135

ARUNA SRI and MADHUMATHI
Assessment of Synergistic Effect
The Synergistic factor (SF) was calculated by dividing
the LD 50
and LD 90
value of the individual test insecticide
with the corresponding LD 50
and LD 90
value of the test
insecticide + synergist mixture at 72 HAT.
Synergistic ratio = LD 50
of the insecticide alone
If the synergistic ratio is
Chlorpyriphos + TPP
LD 50
of the (insecticide + synergists)
1 – Synergistic effect
=1 – Additive effect
During 2007-08, the LD 50
and LD 90
values of
chlorpyriphos in combination with TPP to the third
instar larvae of Guntur strain of S. litura were 0.3336
and 2.5708; 0.1836 and 1.3946; 0.1643 and 0.9616
µg / larva at 24, 48 and 72 HAT, respectively.
The Guntur strain of S. litura recorded the
LD 50
and LD 90
values of 0.3040 and 1.9340 µg / larva
for chlorpyriphos alone at 72 HAT The synergistic
factor due to TPP at LD 50
and LD 90
levels was 1.85
and 2.01, respectively at 72HAT during 2007-08 (Table
1&3).
During 2008-09, the LD 50
and LD 90
values of
chlorpyriphos were 0.2026 and 2.3066; 0.1708 and
1.8280; 0.1596 and 0.6638 µg / larva at 24, 48 and
72 HAT, respectively. The Guntur strain of S. litura
recorded the LD 50
and LD 90
values of 0.2620 and
1.2000 µg / larva for chlorpyriphos alone at 72 HAT .
The synergistic factor at 72 HAT due to TPP at LD 50
and LD 90
levels were 1.64 and 1.81, respectively
during 2008-09 (Table 2&3).
Quinalphos + TPP
During 2007-08, the LD 50
and LD 90
values of
quinalphos in combination with TPP to the third instar
larvae of Guntur strain of S. litura were 0.4186 and
3.1906; 0.2414 and 2.9340; 0.1720 and 0.9379 µg /
larva at 24, 48 and 72 HAT, respectively.
The Guntur strain of S. litura recorded the
LD 50
and LD 90
values of 0.3600 and 2.2160 µg / larva
for quinalphos alone at 72 HAT. The synergistic factor
at 72 HAT due to TPP at LD 50
and LD 90
levels was
2.09 and 2.36, respectively during 2007-08 (Table
1&3).
During 2008-09, the LD 50
and LD 90
values of
quinalphos were 0.3304 and 4.9804; 0.1888 and
2.4928; 0.1588 and 0.7571 µg / larva at 24, 48 and
72 HAT, respectively. The Guntur strain of S. litura
recorded the LD 50
and LD 90
values of 0.3500 and
1.7100 µg / larva for quinalphos alone at 72 HAT.
The synergistic factor at 72 HAT due to TPP at LD 50
and LD 90
levels was 2.20 and 2.26, respectively during
2008-09 (Table 2&3).
Endosulfan + TPP
During 2007-08, the LD 50
and LD 90
values of
endosulfan in combination with TPP to the third instar
larvae of Guntur strain of S. litura were 2.2266 and
27.6715; 1.9179 and 8.7985; 1.7190 and 3.0661 µg /
larva at 24, 48 and 72 HAT, respectively.
The Guntur strain of S. litura recorded the
LD 50
and LD 90
values of 2.0425 and 3.3052 µg / larva
for endosulfan alone at 72 HAT. The synergistic factor
at 72 HAT due to TPP at LD 50
and LD 90
levels was
1.18 and 1.07, respectively during 2007-08 (Table
1&3).
During 2008-09, the LD 50
and LD 90
values of
endosulfan were 1.2456 and 3.3512; 1.0960 and
3.0789; 0.6985 and 1.1452 µg / larva at 24, 48 and
72 HAT, respectively. The Guntur strain of S. litura
recorded the LD 50
and LD 90
values of 1.7072 and
3.2882 µg / larva for endosulfan alone at 72 HAT.
The synergistic factor at 72 HAT due to TPP at LD 50
and LD 90
levels was 1.90 and 2.19, respectively during
2008-09 (Table 2&3).
Cypermethrin + TPP
During 2007-08, the LD 50
and LD 90
values of
cypermethrin in combination with TPP to the third
instar larvae of Guntur strain of S. litura were 0.3550
and 2.0685; 0.2208 and 1.9155; 0.2099 and 1.5215
µg / larva at 24, 48 and 72 HAT, respectively.
The Guntur strain of S. litura recorded the
LD 50
and LD 90
values of 0.4700 and 3.1680 µg / larva
for cypermethrin alone at 72 HAT. The synergistic
factor at 72 HAT due to TPP at LD 50
and LD 90
levels
was 2.24 and 2.08, respectively during 2007-08 (Table
1&3).
136

EFFECT OF SYNERGIST, TRIPHENYL PHOSPHATE ON RESISTANT GUNTUR STRAIN
Table.1. Toxicity of Triphenyl phosphate (TPP) with test insecticides to the resistant larvae of S. litura
during 2007 - 08
Hours
S.No after
treatment
Chlorpyriphos + TPP
1 24
2 48
3 72
Quinalphos + TPP
1 24
2 48
3 72
Endosulfan + TPP
1 24
2 48
3 72
Cypermethrin + TPP
1 24
2 48
3 72
Methomyl + TPP
1 24
2 48
3 72
LD 50
µg / larva
( 95% FL)
0.3336
(0.2538 –
0.4688)
0.1836
(0.1296 –
0.2992)
0.1643
(0.1324 –
0.4500)
0.4186
(0.2890 –
0.7424)
0.2414
(0.1680 –
0.3660)
0.1720
(0.1425 –
0.3560)
2.2266
(1.2280-
12.9480)
1.9179
(1.2348 –
4.1963)
1.7190
(0.9400 –
3.6642)
0.3550
(0.2424 –
0.7146)
0.2208
(0.1510 –
0.4036)
0.2099
(0.1580 –
0.3740)
0.5724
(0.3800 –
0.9740)
0.3580
(0.2420 –
0.5380)
0.3350
(0.2100 –
0.4692)
LD 90
µg / larva
( 95% FL)
2.5708
(0.9632 -
3.5668)
1.3946
(0.6644 –
6.1970)
0.9616
(0.5501 –
2.9204)
3.1906
(1.4474 -
17.6330)
2.9340
(0.9920 -
7.1640)
0.9379
(0.5428 –
2.8430)
27.6715
(8.6443-
386.690)
8.7985
(2.9380-
67.8720)
3.0661
(1.6200-
12.1620)
2.0685
(0.9338–
12.3670)
1.9155
(0.8212-
12.8903)
1.5215
(0.5828 –
5.7600)
5.7162
(2.5780–
27.5760)
3.0340
(1.6240 –
9.2420)
2.8000
(1.9200 –
4.5684)
Hetero
geneity
(χ 2 )
Slope ± S.E
(b)
Regression
equation
Y = a+bx
2.59 1.91 ± 0.27 Y = 5.91 + 1.91x
3.20 1.47 ± 0.28 Y = 6.08 + 1.47x
1.54 1.67 ± 0.28 Y = 6.31 + 1.67x
3.71
1.45 ± 0.29 Y = 5.55 + 1.45x
1.98 1.42 ± 0.25 Y = 5.88 + 1.42x
1.58 1.74 ± 0.23 Y = 6.33 + 1.74x
2.15 1.18 ± 0.35 Y = 4.58 + 1.18 x
2.56 1.95 ± 0.44 Y = 4.44 + 1.95x
1.36 5.10 ± 0.34 Y = 3.8 + 5.10x
0.82
0.70
1.67 ± 0.34 Y = 5.75 + 1.67x
1.37 ± 0.28 Y = 5.90 + 1.37x
1.28 1.49 ± 0.31 Y = 6.01 + 1.49x
6.15
1.22
1.28 ± 0.23 Y = 5.31 + 1.28x
1.38 ± 0.22 Y = 5.62 + 1.38x
4.76 1.39 ± 0.19 Y = 5.66 + 1.39x
137

ARUNA SRI and MADHUMATHI
Table 2. Toxicity of Triphenyl phosphate (TPP) with test insecticides to the resistant larvae of S. litura
during 2008 – 09
Hours
S.No after
treatment
Chlorpyriphos + TPP
1 24
2 48
3 72
Quinalphos + TPP
1 24
2 48
3 72
Endosulfan + TPP
1 24
2 48
3 72
Cypermethrin + TPP
1 24
2 48
3 72
Methomyl + TPP
1 24
2 48
3 72
LD 50
µg / larva
( 95% FL)
0.2026
(0.1140 –
0.3532)
0.1708
(0.1150 –
0.3018)
0.1596
(0.1038 –
0.2942)
0.3304
(0.2060 –
0.5680)
0.1888
(0.1320 –
0.3140)
0.1588
(0.0424 –
0.2460)
1.2456
(1.0320 –
1.5260)
1.0960
(0.9090 –
1.3214)
0.6985
(0.4240 –
0.9350)
0.3324
(0.2140 –
0.5200)
0.1862
(0.1160 –
0.2820)
0.1224
(0.0968 –
0.4620)
0.3582
(0.2260 –
0.6000)
0.2202
(0.1400 –
0.3340)
0.1912
(0.1214 –
0.4260)
LD 90
µg / larva
( 95% FL)
2.3066
(1.3746–
13.8060)
1.8280
(0.7576 -
13.7550)
0.6638
(0.2040 –
4.9200)
4.9804
(2.1020-
26.1480)
2.4928
(0.6980 –
7.6180)
0.7571
(0.4800 –
2.0968)
3.3512
(2.4760–
5.7740)
3.0789
(2.2714 –
5.4748)
1.1452
(0.9600 –
1.4513)
3.6844
(1.8240-
13.2580)
1.9308
(1.0640 –
5.2400)
0.7835
(0.5243 –
1.4240)
5.1174
(2.2180-
25.9560)
2.3152
(1.2340 –
6.8640)
1.5283
(1.0721 –
6.8240)
138
Hetero
geneity
(χ 2 )
Slope ± S.E
(b)
Regression
equation
Y = a+bx
5.38 1.08 ± 0.19 Y = 5.75 + 1.08x
1.46 1.25 ± 0.26 Y = 5.96 + 1.25x
3.20 2.07 ± 0.26 Y = 6.65 + 2.07x
1.38 1.09 ± 0.19 Y = 5.52 + 1.09x
1.64 1.43 ± 0.28 Y = 6.03 + 1.43x
2.13 1.89 ± 0.23 Y = 6.51 + 1.89x
4.04 2.98 ± 0.49 Y = 4.72 + 2.98x
4.42 2.86 ± 0.50 Y = 4.89 + 2.86x
3.14 5.97 ± 0.46 Y = 5.93 + 5.97x
0.16 1.23 ± 0.20 Y = 5.59 + 1.23x
0.53 1.26 ± 0.19 Y = 5.92 + 1.26x
0.46 1.59 ± 0.21 Y = 6.45 + 1.59x
4.49 1.11 ± 0.20 Y = 5.49 + 1.11x
1.46 1.25 ± 0.20 Y = 5.82 + 1.25x
4.03 1.42 ± 0.19 Y = 6.02 + 1.42x

EFFECT OF SYNERGIST, TRIPHENYL PHOSPHATE ON RESISTANT GUNTUR STRAIN
During 2008-09, the LD 50
and LD 90
values of
cypermethrin were 0.3324 and 3.6844; 0.1862 and
1.9308; 0.1224 and 0.7835 µg / larva at 24, 48 and
72 HAT, respectively. The Guntur strain of S. litura
recorded the LD 50
and LD 90
values of 0.4200 and
2.4540 µg / larva for cypermethrin alone at 72 HAT.
The synergistic factor at 72 HAT due to TPP at LD 50
and LD 90
levels was 3.43 and 3.13, respectively during
2008-09 (Table 2&3).
Methomyl + TPP
During 2007-08, the LD 50
and LD 90
values of
methomyl in combination with TPP to the third instar
larvae of Guntur strain of S. litura were 0.5724 and
5.7162; 0.3580 and 3.0340; 0.3350 and 2.8000 µg /
larva at 24, 48 and 72 HAT, respectively.
The Guntur strain of S. litura recorded the
LD 50
and LD 90
values of 0.5247 and 4.2922 µg / larva
for methomyl alone at 72 HAT. The synergistic factor
at 72 HAT due to TPP at LD 50
and LD 90
levels was
1.57 and 1.53, respectively during 2007-08 (Table
1&3).
During 2008-09, the LD 50
and LD 90
values of
methomyl were 0.3582 and 5.1174; 0.2202 and
2.3152; 0.1912 and 1.5283 µg / larva at 24, 48 and
72 HAT, respectively. The Guntur strain of S. litura
recorded the LD 50
and LD 90
values of 0.5140 and
3.5895 µg / larva for methomyl alone at 72 HAT. The
synergistic factor at 72 HAT due to TPP at LD 50
and
LD 90
levels was 2.69 and 2.35, respectively during
2008-09 (Table 2&3).
From the above results it was evident that
synergism with TPP was observed more in
cypermethrin followed by quinalphos, chlorpyriphos,
methomyl and endosulfan at LD 50
level revealing that
the levels of resistance to cypermethrin followed by
quinalphos, chlorpyriphos, methomyl and endosulfan
Table 3. Synergism in S. litura to the test insecticides during two years, 2007 – 08 and 2008 - 09
Insecticide LD 50 LD 90
Synergistic ratio
( 2007 – 08) LD 50 LD 90 (2008 – 09)
Synergistic ratio
LD 50 LD 90 LD 50 LD 90
Chlorpyriphos 0.3040 1.9340 -- -- 0.2620 1.2000 -- --
Chlorpyriphos + TPP
0.1643 0.9616 1.85 2.01 0.1596 0.6638 1.64 1.81
Quinalphos 0.3600 2.2160 -- -- 0.3500 1.7100 -- --
Quinalphos +TPP
0.1720 0.9379 2.09 2.36 0.1588 0.7571 2.20 2.26
Endosulfan 2.0425 3.3052 -- -- 1.7072 3.2882 -- --
Endosulfan + TPP
1.7190 3.0661 1.18 1.07 0.8970 1.5015 1.90 2.19
Cypermethrin 0.4700 3.1680 -- -- 0.4200 2.4540 -- --
Cypermethrin + TPP
0.2099 1.5215 2.24 2.08 0.1224 0.7835 3.43 3.13
Methomyl 0.5247 4.2922 -- -- 0.5140 3.5895 -- --
Methomyl + TPP
0.3350 2.8000 1.57 1.53 0.1912 1.5283 2.69 2.35
139

ARUNA SRI and MADHUMATHI
could be brought down successfully with the synergist
TPP.
The present study was in accordance with
Radhika et al. (2004) who reported that cypermethrin
was synergized by TPP through topical application
in S. litura. Radhika et al. (2005) also reported
REFERENCES
Casida, J. E. 1970. Mixed function oxidase
involvement in the biochemistry of
insecticides. Journal of Agriculture and Food
Chemistry. 18:753-772.
FAO (Food and Agricultural Organization). 1971.
Recommended methods for the detection and
measurement of pest resistance to pesticides.
Tentative method for larvae of Egyptian cotton
leafworm Spodoptera littoralis Biosd. F.A.O
method No.8 Food and Agricultural
Organization. Plant Protection Bulletin. 19:32-
35.
Finney, D. J. 1971. Probit analysis, Cambridge
University, London. Pp. 333..
Kranthi, K. R. 2005. Insecticide resistance –
monitoring, mechanisms and management
manual. Central Institute for Cotton Research,
Nagpur. Pp. 80-94.
synergism of endosulfan in combination with TPP,
conforming the synergistic effect in the present
findings. From the present investigations it was
evident that synergism of chlorpyriphos, quinalphos
and endosulfan was more with TPP which clearly
indicated that TPP could effectively reduce the
esterase activity in the detoxification of
chlorpyriphos, quinalphos and endosulfan.
Prabhakar, N., Coudriet, D. L and Toscano, N. C.
1988. Effect of synergists on organophosphate
and permethrin resistance in sweet potato
whitefly (Homoptera : Aleyrodidae). Journal of
Economic Entomology. 81:34-39.
Radhika, P., Subbaratnam, G. V and Punnaiah, K.
C. 2004 .Role of mixed function oxidases
(MFO) and esterases in the larval population
of Spodoptera litura (Fabr.) to cypermethrin
resistance. Pest Management and Economic
Zoology 12 (2):113-122.
Radhika, P., Subbaratnam, G. V and Punnaiah, K.
C. 2005. Possible mechanisms of resistance
to endosulfan in the larval population of
Spodoptera litura Fab. Annals of Plant
Protection Sciences. 13 (1):14-18.
Ross, G. J. S. 1987. Maximum likely hood program.
The numerical Algorithms Group. Rothamsted
Experimental Station, Harpenden, UK.
140

Research Notes
J.Res. ANGRAU 41(2) 141-143, 2013
EFFECT OF HARVESTING STAGES AND DRYING METHODS ON ALKALOID
CONTENT IN MAKOI Solanum Nigrum L.
P.BRAHMA SAI, B.AMARESWARI and S.S VIJAYA PADMA
College of Horticulture, Dr.YSR Horticultural University, Rajendranagar, Hyderabad-500030
Date of Receipt : 03.10.2012 Date of Acceptance : 12.03.2013
Medicinal plants have been used to cure
human ailments since ancient times. However, today
we find a renewed interest in traditional medicine.
Black nightshade (Solanum nigrun L.), is an annual
herb belonging to the family Solanaceae. The leaves,
berries and the whole herb of this plant are
economically important. The alkaloids, á- solamargine
and á-solasodine have been isolated and identified
from the green, unripe fruits (Ridout et al., 1989). The
berries also contain four steroidal glycol-alkaloids like
á-solanigrine, â-solanigrine, solanourgine and
solarodine. The total alkaloid content of the fruits and
leaves is 0.101 and 0.431 percent, respectively . The
solasodine content of diploid(0.04%) and tetraploid
forms (0.06%) of Solanum nigrum have also been
reported (Banik et al.,1990).
However, no information is available with
regard to appropriate harvesting stage and effect of
drying and storage practices on alkaloid content of
makoi under Hyderabad conditions. Hence, in the
present investigation, it is proposed to identify the
correct stage of harvesting and appropriate drying
methods to obtain maximum amount of alkaloid
recovery per unit area.
A field experiment was carried out to study,
the effect of harvesting stages and drying methods
on alkaloid content of Solanum nigrum L. at College
of Horticulture, Rajendra nagar, Hyderabad, A.P
during December 2009 to May 2010.
The experimental area was ploughed,
harrowed and brought to a fine tilth. Weeds and
stubbles were removed and clods were crushed. The
land was divided into plots (3.0m x 2.25 m) with bunds
of 45 cm were laid out as per plan. Individual plots
were leveled and FYM was applied to each plot and
mixed thoroughly with the soil. Ridges and furrows
were made at 60 cm apart. The recommended dose
of NPK was supplied in the form of straight fertilizers.
N in the form of Urea, P in the form of Single Super
Phosphate and K in the form Murate of Potash. Of
these nutrients, 50% N, full dose of P and K were
supplied as basal dose just before transplanting.
Remaining 50% N was applied as top dressing at 30
days after transplanting. The fertilizers were applied
in the furrows and mixed thoroughly with the soil.
The soil of the experimental site has been
categorized as red sandy loam. The experiment was
laid out in a Completely Randomized Block Design
(CRBD) with three replications. The experiment
consisted of four harvesting stages viz., 100%
flowering stage, Fruiting stage, Mature green berry
stage and Berry ripening stage and three drying
methods viz., Sun drying, Shade drying and Oven
drying at 45 0 C ± 1 0 C, there were 12 treatment
combinations ( Table 1) employed in this study.
Alkaloid yield in main and ratoon crop
The observations recorded on alkaloid yield per
hectare as influenced by harvesting stages and drying
methods in main crop has been presented in Table
2.
Harvesting the crop at mature green berry
stage recorded highest alkaloid yield (48.96 kg ha -1 )
which differed significantly with other stages of
harvesting and the least alkaloid yield (4.03 kg ha -1 )
was recorded when the plants were harvested at 100%
flowering stage. Among drying methods significant
difference were noticed, where in maximum mean
alkaloid yield (30.21 kg ha -1 ) was obtained by shade
drying (D 2
), minimum (17.62 kg ha -1 ) when dried under
sun(D 1
).
email: brahmasai08@gmail.com
141

BRAHMA et al
Table 1. Details of treatments imposed
Treatment
Combination of treatments
T 1
T 2
T 3
T 4
T 5
T 6
T 7
T 8
T 9
T 10
T 11
T 12
H 1 D 1 (100% Flowering stage + Sun drying)
H 1 D 2 (100% Flowering stage + Shade drying)
H 1 D 3 (100% Flowering stage + Oven drying)
H 2 D 1 (Fruiting stage + Sun drying)
H 2 D 2 (Fruiting stage + Shade drying)
H 2 D 3 (Fruiting stage + Oven drying)
H 3 D 1 (Mature green berry stage + Sun drying)
H 3 D 2 (Mature green berry stage + Shade drying)
H 3 D 3 (Mature green berry stage + Oven drying)
H 4 D 1 (Berry ripening stage + Sun drying)
H 4 D 2 (Berry ripening stage + Shade drying)
H 4 D 3 (Berry ripening stage + Oven drying)
Table 2. Effect of harvesting stages and drying methods on alkaloid content in main crop (dry) (kg/ha)
of makoi Solanum nigrum L.
Treatment D 1 D 2 D 3 Mean
H 1 2.25 5.90 3.95 4.03
H 2 8.93 25.04 16.46 16.81
H 3 44.88 53.95 48.05 48.96
H 4 14.44 35.98 23.82 24.74
Mean 17.62 30.21 23.07 23.63
F-test SEm CD@5%
H * 0.52 1.55
D * 0.45 1.34
H×D * 0.91 2.68
The perusal of data presented in Table 3
indicates that of alkaloid yield in ratoon crop as
influenced by harvesting stages and drying methods
followed same trend as in the main crop.
Makoi crop harvested at 100% flowering stage that
gave lowest alkaloid yield (1.93kg ha -1 ) has differed
significantly with the crop harvested at mature green
berry stage that registered maximum alkaloid yield
142

EFFECT OF HARVESTING STAGES AND DRYING METHODS ON ALKALOID
(26.46kg ha -1 ). In ratoon crop, among drying methods
maximum alkaloid content was recovered at mature
green berry stage. Among the drying methods adopted
for recovery of alkaloid content in different parts of
makoi, the optimum recovery was in shade drying
irrespective of stage of harvesting while minimum
recovery was observed in sun drying method. Hence
the quality and quantity of alkaloid recovery was
optimum under shade drying only.
Table 3. Effect of harvesting stages and drying methods on alkaloid content in ratoon crop (dry) (kg/
ha) of makoi (Solanum nigrum L.)
TREATMENT D 1 D 2 D 3 Mean
H1 0.94 2.95 1.90 1.93
H2 2.80 7.78 4.25 4.94
H3 23.91 30.15 25.32 26.46
Mean 9.22 13.62 10.49 11.11
F-test SEm CD@5%
H * 0.17 0.52
D * 0.17 0.52
HD * 0.30 0.91
There was steady increase in total alkaloid
content from 100% flowering stage to mature green
berry stage. Drying methods also influenced the
alkaloid content, where as under sun drying, the
lowest alkaloid content was recorded irrespective of
the stage of harvest. This might be due to
deterioration or decomposition of constituents in the
drying of produce when exposed directly to sun light.
Oven drying has reduced the yield and recorded lesser
alkaloid content when compared to shade dried
herbage. This may be due to the damage to the
tissues or degradation of alkaloid due to high light
intensity. The crop was dried in the oven at 45 0 C ±
1 0 C temperature, but they had low alkaloid, when
compared to shade dried produce. These findings
are in confirmation with the earlier reports of Leela
and Angadi (1992) in mints.
REFERENCES
Banik, A .S., Mukhopahyay D.L.K and Chaudhari,
R.K 1990. Content and purity of extracted
solasodine in some available species of
Solanum. Science and Culture 56 (5): 214-
216.
Ridout,C.L., Price, K.R., Coxon, D.T and Fenwick
G.R 1989. Glyco-alkaloids from Solanum
nigrum L solamargine and alpha solasonine.
Pharmazie 44(10): 732-733.
Leela, N. K and Angadi, S.P 1992. Effect of post
harvest drying of herbage on yield and quality
of essential oil in the Metha sp EC41911.
Indian Perfumer 36(4): 235-237.
143

Research Notes
J.Res. ANGRAU 41(2) 144-148, 2013
RESPONSE OF AEROBIC RICE TO IRRIGATION SCHEDULING AND NITROGEN
DOSES UNDER DRIP IRRIGATION
M . MALLA REDDY, B. PADMAJA, G .VEERANNA and D .VISHNU VARDHAN REDDY
Regional Agricultural Research Station,
Acharya N.G.Ranga Agricultural University, Warangal – 506 007
Date of Receipt : 08.01.2013 Date of Acceptance : 10.05.2013
In Andhra Pradesh, rice is the major crop
grown in an area of 4.4 M ha with a production of
14.2 M t and productivity of 3.2 t ha -1 (CMIE, 2011).
Lowland rice requires around 1000 to 5000 litres of
water for producing one kg grain which is about twice
or even more than wheat or maize water
requirement(Cantrell and Hettel, 2005). However, the
increasing scarcity of fresh water for agriculture and
the equal demand from the non-agricultural sector
threaten the sustainability of the irrigated rice
ecosystem. One of the recent developments is to
grow rice as an upland crop viz. wheat or maize and
named as ‘aerobic’ cultivation. Aerobic rice cultivation
saves water input and increases water productivity
by reducing water use during land preparation and
limiting seepage, percolation and evaporation (Peng
et al., 2012). To make aerobic rice successful, new
varieties and management practices need to be
developed. Optimum irrigation scheduling and nitrogen
nutrition is critical for profitable yield realization of
aerobic rice (Maheswari et al., 2007). Drip irrigation
and fertigation methods have been proved to be the
water and nutrient efficient methods, respectively in
most of the crops apart from increasing the
productivity. Information is not available on the
response of aerobic rice to drip irrigation and
fertigation. Hence, the present investigation was
carried to find out the influence of irrigation scheduling
and nitrogen doses on aerobic rice under drip irrigation
in sandy loam soils.
Field experiment was conducted during
kharif, 2010 at Regional Agricultural Research Station,
Warangal, Andhra Pradesh. The soil of the
experimental site was sandy loam in texture, medium
in organic carbon (0.5), low in available nitrogen (279
kg ha -1 ), available phosphorus (7.7 kg ha -1 ) and
available potassium (74 kg ha -1 ) and electrical
conductivity (EC) as 0.2 d Sm -1 with a pH of 8.1. The
values of field capacity, permanent wilting point and
bulk density were 13%, 5.6% and 1.4 g/cm 3 ,
respectively at a soil depth of 60 cm. The experiment
was laid out in a split plot design with irrigation
schedules (3) as main plots and nitrogen doses (3)
as sub plots. The irrigation schedules consisted of
I 1
: 100 % PE through drip irrigation, I 2
: 150 % PE
through drip irrigation and I 3
: Field saturation and
nitrogen doses were N 1
: 120 kg ha -1 , N 2
: 150 kg
ha -1 and N 3
: 180 kg ha .1 which were replicated thrice.
Rice variety ‘WGL-32100’ (Warangal Sannalu) of 135
days duration was sown by dibbling at 30 cm row
spacing as solid rows with a seed rate of 40 kg ha -1
on 18 th June, 2010. Two common irrigations of 60
mm each were given, one at pre-sowing for good
germination and second at 10 th day after sowing for
crop establishment. Thinning and gap filling was done
at 14 days after sowing. Nitrogen was applied as per
the treatments in the form of urea as fertigation. The
entire dose was split up into six equal parts and
applied through drip with a Ventury fixed to the drip
system at ten days interval starting from 15 days
after sowing. For I 3
treatment, it was applied in three
splits, 1/3 rd each at sowing, active tillering and panicle
initiation stages. Phosphorous @ 60 kg P 2
O 5
ha -1 as
single super phosphate and potassium @ 40 kg K 2
O
ha -1 as muriate of potash were applied to all the
treatments uniformly at the time of sowing as basal
dose. These fertilizers were applied as bands in the
seed furrow. Drip irrigation was given as per the
recommended schedule based on the evaporation
from Open Pan Evaporimeter situated at Regional
Agricultural Research Station, Warangal discounting
the rainfall received. The plot size was 9.6 × 6.0 m.
The experiment was laid out by providing wider
irrigation channels and individual plots were
demarcated by bunds. Irrigation control valve was
provided for each plot. In I 3
treatment irrigation was
email: maduri_agron@yahool.com
144

RESPONSE OF AEROBIC RICE TO IRRIGATION SCHEDULING AND NITROGEN
given as and when required to maintain the soil in
saturation condition throughout the crop growth
period. The amount of water given every time was
measured and summed up. The drip system was
established keeping 60 cm between two lateral lines
to accommodate aerobic rice. One lateral line is lied
between two crop rows. Distance between two
drippers is 50 cm. The discharge rate of drippers is 4
Lph. The diameter of lateral in-line was 16 mm. The
system was operated under a pressure of 1.2-1.5
kg/cm 2 . The source of irrigation water is open well
fitted with 3 H.P. electrical motor. Quantity of water
applied was measured treatment wise with water
meter fixed to the system. Amount of water applied
in I 1
was 220 mm, I 2
: 330 mm and I 3
: 450 mm (9
irrigations each at 50 mm depth). To control the
weeds, pendimethalin @ 1.2 kg a.i. ha -1 was applied
at 24 hours after sowing fb post-emergence
application of pyrazosulfuron ethyl @ 30 g a.i. ha -1 at
25 DAS in rice. They were sprayed using 500 litres
of water ha -1 with flood jet nozzle. A range of mean
minimum temperature of 23.4 to 24.6 0 C and mean
maximum temperature of 29.2 to 34.6 0 C was
recorded during the crop growth period. A total rainfall
of 827 mm was received during the crop season in
46 rainy days. The crop was harvested on 27 th
October, 2010. Pre and post-harvest observations in
respect of both growth and yield parameters were
recorded following standard procedures. Net returns
(Rs. ha .1 ) were calculated by deducting the cost of
cultivation (Rs. ha .1 ) from the gross returns (Rs. ha .1 )
excluding the cost incurred towards installation of
drip system. Nitrogen uptake (kg ha -1 ) was calculated
by considering nitrogen content (%) in grain / straw
at harvest. The other recommended cultural and pest
management practices were adopted.
Application rate of
drip system (mm/hr) = Lph (litres per hour) /
Distance between laterals x
Distance between dippers
= 4 Lph / 0.6 m x 0.5 m
= 13.33 mm/hr
Maintenance of soil under saturated condition
throughout the crop growth period resulted in
significantly taller plants (Table 1) compared to
scheduling irrigation at 100 or 150 % PE. Similarly,
significant number of tillers was recorded with soil
saturation over the other two schedules both at 30
and 60 days after sowing (DAS). In comparision,
scheduling irrigation at 150% PE was found to be
superior to 100% PE with respect to plant height and
tillers/m 2 . Among the nitrogen doses, application of
180 kg N ha -1 resulted in taller plants over 150 kg N
ha -1 which in-turn was significant over 120 kg N ha -1 .
The tiller number/m 2 was also significantly enhanced
with increase in N application i.e., from 120 to 180
kg N ha -1 both at 30 and 60 DAS.
The number of panicles/m 2 was significantly
higher with soil saturation compared to 100 % PE
but at par with 150 % PE (Table 2). The proportion
of unproductive tillers to total number of tillers tend
to increase at 100% PE compared 150% PE or soil
saturation both of which were at par with each other.
Maintenance of soil at saturation significantly
increased the number of filled grains / panicle with
corresponding decreases in chaffyness over 150 %
PE or 100 % PE. In-turn 150% PE differed
significantly with 100 % PE with higher number of
filled grains / panicle but reduced chaffyness.
Significantly longer panicles were recorded with soil
saturation compared to 100 % PE but at par with 150
% PE. However, the 1000- grain weight (g) did not
differ significantly among the different irrigation
schedules. The above results on plant growth and
yield attributes were in accordance with Maheswari
et al. (2007); Ghosh et al. (2012); Mahajan et al.
(2012) and Sridharan and Vijayalakshmi (2012).
Increased dose of N i.e., 180 kg N ha -1 resulted in
higher number of panicles over 120 kg N ha -1 but at
par with 150 kg N ha -1 . Contribution of unproductive
tillers gradually reduced with increase in N dose from
120 to 180 kg N ha -1 . There was a consistent and
significant increase in the number of filled grains /
panicle from 120 to 150 kg N ha -1 and then to 180 kg
N ha -1 . Chaffyness registered the reverse trend to
that of filled grains. Application of 180 kg N ha -1
produced significantly longer panicles than 120 kg N
ha -1 but at par with 150 kg N ha -1 which in-turn was
superior to 120 kg N ha -1 . However, the test weight
was similar with all the three doses of nitrogen. These
results corroborate the findings of Lateef (2010); Devi
and Sumathi (2011) and Rani (2012).
In general, the yield levels are low probably
due to severe Fe deficiency and termites incidence.
The grain yield of aerobic rice recorded with the
irrigation regime of maintenance of just soil saturation
145

Malla Reddy et al
throughout the crop growth period was significantly
higher than the other two schedules i.e., 150 % PE
and 100 % PE which were at par with each other. It
was increased by 20 per cent with the soil saturation
over 150% PE and 46 per cent over 100% PE with
an increased input of 120 and 230 mm of water over
the later two treatments, respectively (Table 3).
However, the difference in straw yield due to different
irrigation schedules was not significant. Scheduling
the irrigation through drip system at 100% PE resulted
in a 25 and 42 per cent increase in water use
efficiency (WUE) over 150% PE and soil saturation,
respectively due to less water input in the former
treatment. But, the net returns (Rs. /ha) were higher
with the irrigation schedule of maintaining soil
saturation compared to 150% PE which was again
better than 100% PE. Maheswari et al. (2007) and
Sridharan and Vijayalakshmi (2012) also reported
increased yields of aerobic rice with increased
frequency and input of water i.e., at 1.2 IW/CPE ratio
compared with microsprinkler irrigation. Nitrogen
doses applied through drip irrigation i.e., fertigation
differed among themselves with respect to grain and
straw yield of aerobic rice (Table 3). Application of
180 kg N ha -1 significantly increased the grain and
straw yield of aerobic rice over 120 kg N ha -1 but at
par with 150 kg N ha -1 . The nitrogen doses 120 and
150 kg N ha -1 were again at par with each other.
Similarly, the higher dose of N resulted in an
improvement of 10 and 24 per cent in WUE, over
150 and 120 kg N ha -1 , respectively. The net returns
also increased by Rs. 2,557/- per ha at 180 kg N ha -
1
compared to 150 kg N ha -1 .
Nitrogen uptake (kg ha -1 ) by the grain as well
as straw was gradually increased with the water input
from 100% PE to soil saturation treatment, even
though the difference was not statistically significant
with respect to the N uptake by straw (Table 4). The
nitrogen doses of 180 and 150 kg ha -1 were at par
with each other with respect to the N uptake both by
grain and straw. Similarly, both 120 and 150 kg N ha -
1
were at par with each other. Interaction effect
between the irrigation schedules and nitrogen dose
with respect to growth, yield attributes, yield and
nitrogen uptake by aerobic rice is not significant.
Similar findings were reported by Devi and Sumathi
(2011), Rani (2012) and Sridharan and Vijayalakshmi
(2012).
Thus, the above results indicated that the
better performance of aerobic rice was possible when
the soil is maintained at saturation throughout the
growth period in sandy loam soils of Telangana region.
Further, application of 150 kg N ha -1 is sufficient for
realising good yields in aerobic rice.
Table 1. Influence of irrigation schedules and nitrogen doses on growth parameters of aerobic rice
under drip irrigation
Treatment
Irrigation schedules (I)
Plant height at
harvest (cm)
Tillers/m 2 at 30
DAS
Tillers/m 2 at
60 DAS
I 1 : 100% PE 78.2 251 308
I 2 : 150% PE 80.1 289 341
I 3 : Soil Saturation 82.4 320 373
SEm+ 0.4 6.8 7.0
CD at 5 % 1.5 26.8 27.6
Nitrogen doses (N) (kg/ha)
N 1 : 120 79.6 266 321
N 2 : 150 80.3 287 340
N 3 : 180 81.4 306 361
SEm+ 0. 5 5.7 5.4
CD at 5 % 1.4 17.6 16.6
Interaction
SEm+ 0.8 9. 9 9.3
CD at 5 % NS NS NS
146

RESPONSE OF AEROBIC RICE TO IRRIGATION SCHEDULING AND NITROGEN
Table 2. Yield attributes of aerobic rice as influenced by irrigation schedules and nitrogen doses
under drip irrigation
Treatment
Panicles/
m 2
Un
productive
tillers/ m 2
at harvest
Filled
grains/
panicle
Chaffy
grains/
panicle
Panicle
length
(cm)
1000-
grain
weight
(g)
Irrigation schedules (I)
I 1 : 100% PE 254 44 128 71 22.0 11.5
I 2 : 150% PE 284 35 146 61 22.6 11.8
I 3 :Soil Saturation 318 31 168 53 23.1 11.6
SEm+ 11.2 2.2 4.2 3.3 0.14 0.07
CD at 5 % 43.8 8.5 16.3 12.8 0.56 NS
Nitrogen doses (N) (kg/ha)
N 1 : 120 266 41 136 67 22.2 11.6
N 2 : 150 285 37 147 65 22.6 11.6
N 3 : 180 304 32 158 56 22.9 11.8
SEm+ 9.2 3.0 2.9 4.0 0.10 0.11
CD at 5 % 28.3 9.4 8.9 12.4 0.31 NS
Interaction
SEm+ 15.9 5.3 5.0 6.9 0.17 0.11
CD at 5 % NS NS NS NS NS NS
Table 3. Yield, Water use efficiency (WUE) and Net returns (Rs. /ha) of aerobic rice as influenced by
irrigation schedules and nitrogen doses under drip irrigation
Treatment
Irrigation schedules (I)
Grain yield
(kg/ha)
Straw yield
(kg/ha)
WUE
(kg/ha mm)
Net returns
(Rs./ha)
I 1 : 100% PE 2450 3755 11.30 4,755
I 2 : 150% PE 2983 4288 9.03 7,318
I 3 : Soil Saturation 3571 4872 7.93 9,282
SEm+ 142 301 - -
CD at 5 % 558 NS - -
Nitrogen doses (N) (kg/ha)
N 1 : 120 2682 3969 8.33 6,639
N 2 : 150 3021 4340 9.41 9,900
N 3 : 180 3300 4607 10.35 12,457
SEm+ 170 179 - -
CD at 5 % 524 550 - -
Interaction
SEm+ 294 309 - -
CD at 5 % NS NS - -
Price (Rs./kg) Grain: 10.3 and Straw : 1.0
147

Malla Reddy et al
Table 4. Influence of irrigation schedules and nitrogen doses on nitrogen uptake (kg/ha) in aerobic
rice under drip irrigation
Treatment
Nitrogen uptake (kg/ha)
Irrigation schedules (I) Grain Straw Total
I 1 : 100% PE 22.31 17.50 39.81
I 2 : 150% PE 28.04 21.64 49.69
I 3 : Soil Saturation 35.29 25.16 60.45
SEm+ 1.32 1.50 2.60
CD at 5 % 5.19 NS 10.21
Nitrogen doses (N) (kg/ha)
N 1 : 120 24.89 19.33 44.22
N 2 : 150 28.66 21.43 50.09
N 3 : 180 32.10 23.54 55.64
SEm+ 1.56 0.87 1.99
CD at 5 % 4.57 2.55 5.84
Interaction
SEm+ 2.71 1.51 3.45
CD at 5 % NS NS NS
REFERENCES
Cantrell, R.P and Hettel, G.P. 2005. Research
strategy for rice in the 21 st century. In:
Toriyama et al., (eds) Rice is life: Scientific
perspectives for the 21 st century. Proceedings
of the World Rice Research Conference,
Tokyo and Tsukuba, Japan, 4-7 November
2004.
CMIE. 2011. Agriculture. Centre for Monitoring Indian
Economy (CMIE), Pvt. Ltd., Mumbai, June,
Pp.183.
Devi, M.G and Sumathi, V. 2011. Effect of nitrogen
management on growth, yield and quality of
scented rice under aerobic conditions. Journal
of Research ANGRAU 39 (3): 81-83.
Ghosh, A., Dey, R and Singh, O.N. 2012. Improved
management alleviating impact of water stress
on yield decline of tropical aerobic rice.
Agronomy Journal 104 (3): 584-588.
Latheef, P.M.D. 2010. Performance of aerobic rice
under different levels of irrigation, nitrogen and
weed management. M.Sc. Thesis, submitted
to Acharya N G Ranga Agricultural University,
Hyderabad.
Mahajan, G., Chauhan, B.S., Timsina, J., Singh, P.P
and Singh, K. 2012. Crop performance and
water and nitrogen use efficiencies in dryseeded
rice in response to irrigation and
fertilizer amounts in northwest India. Field
Crops Research 134: 59-70.
Maheswari, J., Maragatham, N and Martin, G.J. 2007.
Relatively simple irrigation scheduling and N
application enhances the productivity of
aerobic rice Oryza sativa L.: American Journal
of Plant Physiology 2 (4): 261-268.
Peng, N.L., Bing, S., Chen, M.X., Shah, F., Huang,
J.L., Cui, K.H and Jing, X. 2012. Aerobic rice
for water-saving agriculture-A review.
Agronomy for Sustainable Development 32
(2):411-418.
Rani, K.S. 2012. Influence of nitrogen and weed
management on growth and yield of aerobic
rice Oryza sativa L., M.Sc. Thesis, submitted
to Acharya N G Ranga Agricultural University,
Hyderabad.
Sridharan, N and Vijayalaxmi, C. 2012. Crop
performance, nitrogen and water use in aerobic
rice cultivation. Plant Archives 12 (1):79-83.
148

Research Notes
J.Res. ANGRAU 41(2) 149-152, 2013
DRIP IRRIGATION SCHEDULE FOR CASTOR BASED ON PAN EVAPORATION
B. RAVI KUMAR, V. PRAVEEN RAO, V. RAMULU AND K. AVIL KUMAR
Water Technology Centre, Acharya N.G. Ranga Agricultural University,
Rajendranagar, Hyderabad 500 030
Date of Receipt : 16.03.2013 Date of Acceptance :10.06.2013
Raising castor during winter (rabi) season
under irrigation using high yielding varieties and
hybrids is a new dimension in castor production in
Andhra Pradesh for greater stability and higher
productivity. However, shortage of water for irrigation
is being increasingly felt due to pressures from
depleting groundwater levels, rising alternative
demands, water quality degradation and economics.
Therefore, farmers are switching over to drip irrigation
to improve irrigation application efficiency, water
productivity and bean yields. Hence, an experiment
was conducted to study the effect of drip irrigation
schedules based on pan evaporation on castor
performance.
A field experiment was conducted at College
Farm, College of Agriculture, Acharya N.G. Ranga
Agricultural University, Hyderabad (17.19° N, 78.23°
E and 543 m altitude) in winter season of 2009 – 10
on a sandy clay soil. The soil was low in N, medium
in P and high in K status and alkaline in reaction (pH
8.03). The soil water retention capacity at “0.03 and
“1.5 MPa was 0.254 cm 3 cm -3 and 0.130 cm 3 cm -3 ,
respectively. The available water was 12.4 cm m -1
depth of soil. Soil bulk density was 1.43 g cm -3 . The
source of irrigation water was open well with C 3
S 1
water quality. There were seven irrigation treatments
based on surface drip method of irrigation based on
pan evaporation replenishment (Epan) factor. The
Epan factor throughout the crop life were: I 1
, 0.4;I 2
,
0.6 and I 3
, 0.8. Their combinations at vegetative,
flowering and capsule development stages were: I 4
,
0.4 up to flowering (81 days after sowing)and 0.6 later;
I 5
, 0.4 up to flowering (81 days after sowing) and 0.8
later; I 6
, 0.6 up to flowering (81 days after sowing)
and 0.8 later; I 7
, 0.4 up to 50 days after sowing, 0.6
from 51 to 95 days after sowing and 0.8 later. Besides
the above,a check treatment I 8
, surface check basin
method irrigated at 0.8 IW/CPE ratio with IW = 50
mm was included. The eight irrigation treatments were
laid out in randomized block design with three
replications. The dripperlines of 16 mm diameter were
laid out along the crop rows at 1.2 m spacing with
emitters spaced at 0.5 m having a flow rate of 2 l
hour -1 . Flow meters were used to measure flow rates
to each individual treatment according to designated
pan evaporation replenishment factor. Hybrid ‘PCH
111’ was planted on the 7 th of November 2009 by
adopting a row-to-row spacing of 1.2 m and plant to
plant distance of 0.5 m in plots of 18.0 m x 7.2 m. A
fertilizer dose of 60 kg N, 40 kg P 2
O 5
and 30 kg K 2
O
ha was applied through fertigation at weekly intervals
up to 100 days after sowing. The crop was harvested
in 4-pickings and the last picking was on the 5 th of
April, 2010. The total depth of irrigation water applied
in drip irrigated treatments varied between 227 mm
(0.4 Epan) to 453 mm (0.8 Epan), whereas in surface
check basin irrigated crop it was 450 mm.
For determination of crop ETc, the soil
moisture was monitored by delta probe at four
locations and various depths before and after every
irrigation event and on intermediate dates in case of
incident precipitation. Effective rainfall was estimated
by following standard procedure (Rahmanet al., 2008)
and it amounted to 13.05 mm during crop growing
period. The reference crop evapotranspiration (ETo)
was estimated at specific crop growth sub-periods
based on Penman Monteith equation (Allen et al.,
1998). Thus the data obtained on ETc of castor and
ETo at specific crop growth sub-periods were used
to calculate the ETc :ETo ratios.
Average castor bean yield was highest (4281
kg ha -1 ) when irrigations were scheduled by drip daily
at 0.6Epan up to flowering and 0.8Epan later on (I 6
)
with a seasonal water requirement of 399.9 mm, but
it was statistically on par with I 3
(daily drip irrigation
at 0.8Epan throughout the crop life with a seasonal
ETc of 428.1 mm) and I 2
(daily drip irrigation at
0.6Epan throughout the crop life with a seasonal ETc
of 334.5 mm) and significantly superior over I 1
, I 4
, I 5
,
email: v.prao@yahoo.com
149

KUMAR et al
I 7
and I 8
irrigation treatments (Table 1).However, the
crop in I 2
used 93.6 mm and 65.4 mm less water in
comparison to I 3
and I 6
,respectively.Further the crop
in I 2
treatment on an average registered 104.6%,
33.5%, 37.1%, 30.7% and 49.2% more yield over I 1
,
I 4
, I 5
, I 7
and I 8
, respectively. Among all the treatments
lowest castor bean yield was observed in I 1
(daily
drip irrigation at 0.4Epan throughout the crop lifewith
a seasonal ETcof 239.3 mm) treatment. Bean yield
under surface check basin irrigation at 0.8 IW/CPE
ratio throughout the crop life (I 8
) with a seasonal water
requirement of 445.9 mm produced significantly lower
bean yield in comparison to drip irrigation treatments
(I 2
to I 7
) except I 1
. These trends were traced to
favourable soil water balance as evident from crop
evapotranspiration (ETc) : reference crop
evapotranspiration (ETo) ratio (> 1.0 at flowering and
capsule development stage) an indicator of soil water
deficit (Nair et al., 2013) under drip irrigated I 2
,I 3
and
I 6
irrigation treatments. Further the regression of bean
yield on seasonal ET c
revealed a significant
correlation with an explained total variation of 99%
in bean yield as evident from the following equation.
Y = – 9535 + 68.603ETc – 0.0895
ETc 2 (R 2 = 0.99 F-value = 35.7 * )
This favourable soil water balance under I 6
,
I 3
and I 2
treatments aided the crop plants to put forth
improved performance over other treatments, since
water plays a vital role in the carbohydrate
metabolism, protein synthesis, cell wall synthesis
and cell enlargement (Chaveset al., 2002). Therefore,
crop plants in I 6
, I 3
and I 2
treatments had more plant
height, which in turn helped the plants to put forth
more canopy i.e., LAI (Table 1) and dry matter. It is
well documented that cell enlargement is very
sensitive to water deficits and the consequence is a
marked reduction in leaf area (Pettigrew, 2004).
Sudhakar and Rao (1996) opined that the LAI was
the growth characteristic which limited the rate of
dry matter accumulation of castor under soil water
deficits. This improved growth performance in the
form of plant height, LAI and dry matter by the crop
in I 6
, I 3
and I 2
treatments in turn may have contributed
more number of spikes plant -1 with longer spike
length, more number of capsules plant -1 , seeds
capsule -1 and test weight (Table 1). The dependence
of bean yield on growth and yield components was
apparent from the positive and significant (P=0.01)
correlation it had with plant height (r = 0.95), LAI (r =
0.69), dry matter (r= 0.82), spikes plant -1 (r= 0.94),
spike length (r= 0.64), capsules plant -1 (r = 0.90),
seeds capsule -1 (r= 0.84) and test weight (r= 0.91).
The cumulative effect of all these increased growth
and yield traits was well marked on bean yield of drip
irrigated crop in I 2
, I 3
and I 6
treatments.
On the other hand, irrigations at lower
evaporation replenishment factor in I 1
, I 4
, I 5
and I 7
drip irrigated treatments during individual growth subperiods
of vegetative, flowering and capsule
development induced soil water deficits in the crop
root zone. This caused ET c
to fall below in I 1
, I 4
, I 5
and I 7
drip irrigated treatments relative to ET c
under
I 2
, I 3
and I 6
treatments. This unfavourable soil
moisture environment not only reduced the plant
height, LAI, and dry matter but also brought
significant reduction in yield contributing characters
like number of spikes plant -1 , spike length, capsules
plant -1 and test weight (Table 1).The greater sensitivity
of flowering and capsule development period to ET c
deficits in I 1
, I 4
, I 5
and I 7
treatments could be partly
related to the fact that crop reached its peak ET c
requirement (3.97mm day -1 ) during this period.
Additionally, this is the period in which the potential
spike size and capsule number is determined. Thus,
water deficits at flowering period might have caused
abortion of flowers as is evident from the number of
spikes, spike length and capsules plant -1 in I 1
, I 4
, I 5
and I 7
treatments, which limited the total number of
seeds per plant and possibly non-availability of
assimilates to capsules might have reduced the bean
weight(Sudhakar and Rao,1996). All these effects
finally reduced the bean yield in I 1
, I 4
, I 5
and I 7
treatments and the effect of water deficits is well
marked (Table 1).
Whereas, under conventional check basin
irrigation method (I 8
treatment) due to longer irrigation
interval (8 – 12 days)the fluctuations in soil matric
potentials are relatively large as compared to high
frequency (1 – 2 days interval) drip irrigation (Rao,
2011) and this might have affected the crop growth
and yield contributing characters resulting in reduced
crop yields.
Thus, it could be concluded that for higher
bean yield of castor crop grown during winter season
daily drip irrigationat 0.6Epan throughout the crop life
with a seasonal ETcof 334.5 mm is recommended.
150

DRIP IRRIGATION SCHEDULE FOR CASTOR BASED ON PAN EVAPORATION
Table 1. Growth, yield attributes and bean yield of castor as influenced by different irrigation treatments
151

KUMAR et al
REFERENCES
Allen, R.G., Pereira, L.S., Raes, D and Smith, M.
1998. Crop evapotranspiration–Guidelines for
computing crop water requirements. Irrigation
and Drainage Paper No. 56, FAO, Rome, 300p.
Chaves, M.M., Pereira, J.S., Maroco, J., Rodriguez,
M.L., Ricardo, C.P.P., Osorio, M.L., Carvalho,
I., Faria, T and Pinheiro, C. 2002. How plants
cope with water stress in the field.
Photosynthesis and growth. Annals of Botany
89: 907-916.
Nair, S., Johnson, J and Wang, C. 2013. Efficiency
of Irrigation Water Use: A Review from the
Perspectives of Multiple Disciplines.
Agronomy Journal 105 : 351 – 363
Pettigrew, W.T. 2004. Physiological consequences
of moisture deficit stress in cotton. Crop Sci.
44:1265-1272.
Rahman, M.M., Islam, M.O and Hasanuzzaman,
M. 2008. Study of Effective Rainfall for
Irrigated Agriculture in South-Eastern Part of
Bangladesh.World Journal of Agricultural
Sciences 4: 453-457
Rao, V.P. 2011. Drip irrigation of castor pays.
AgroNet News Letter 55.NetafimYiftah, Israel.
Sudhakar, C and Rao, V. P. 1996 Performance of
different crops during post rainy season under
varied moisture regimes in Southern Telangana
region. Journal of Research ANGRAU 22: 113
– 115.
152

Research Notes
J.Res. ANGRAU 41(2) 153-157, 2013
CHARACTER ASSOCIATION AND PATH COEFFICIENT ANALYSIS FOR SEED
YIELD IN QUALITY PROTEIN MAIZE Zea mays L.
K. VIJAY KUMAR, M. R. SUDARSHAN, KULDEEP SINGH DANGI and S. MADHUSUDAN REDDY
Department of Genetics and Plant breeding, College of Agriculture,
Acharya N.G. Ranga Agricultural University, Rajendranagar, Hyderabad-500030
Date of Receipt : 21.02.2013 Date of Acceptance : 25.07.2013
Maize Zea mays L. is an important cereal
crop, next to wheat and rice and it is staple food in
many developing countries (Morries et al 1999).
Maize crop is of great significance due to its demand
for food, feed and industrial utilization. It plays an
important role in world economy and trade. Since
maize protein lacks two essential amino acids lysine
and tryptophan and protein deficiency is characterized
by many growth and health related complications in
humans. Therefore, considerable importance has
been given to Quality Protein Maize (QPM) breeding.
The material for the present study comprised
of sixty three quality protein maize genotypes
(numbered BQML-101 to BQML-163) that were
obtained from Maize Research Centre, Agricultural
Research Institute, Rajendranagar, Hyderabad. The
experiment was carried out at College Farm, College
of Agriculture, ANGRAU, Rajendranagar, Hyderabad
during rabi 2008-09 in a randomized block design with
three replications. Each genotype in each replication
consisted of a single row of fifteen plants with a
spacing of 75cm X 20 cm. Five representative plants
were selected at random from each line and
observations were recorded on each plant for sixteen
traits viz., days to 50 per cent tasseling, days to 50
per cent silking, plant height, ear height, days to
maturity, ear length, ear girth, number of kernel rows
per ear, number of kernel per row, 100-seed weight
(g), ear weight (g), shelling (%), protein content (%),
oil content (%), starch content (%) and grain yield
per plant (g). The correlation coefficients were
calculated as per the method suggested by Johnson
et al. (1955). Path analysis was worked out as per
method suggested by Deway and Lu (1959).
The Correlation coefficients between yield,
its component characters and quality parameters are
presented in Table 1. In this study the values of
correlation coefficients indicated that in general, the
magnitude of genotypic correlation coefficients were
higher than phenotypic correlation coefficients for all
the traits which implied negligible influence of
environmental factors and strong inherent association
between the traits. Grain yield was significantly and
positively correlated with ear weight, number of
kernels per row, ear girth, shelling per cent, 100 seed
weight, number of kernel rows per ear, ear length
and oil content, while days to 50 per cent tasseling,
days to 50 per cent silking, and days to maturity had
negative association with grain yield. The remaining
characters, plant height, ear height, protein content
and starch content did not indicate any association
with seed yield. This indicated that seed yield can
be improved by making selection on the basis of ear
weight, number of kernels per row, ear girth, shelling
per cent, 100 seed weight, number of kernel rows
per ear, ear length and oil content. The traits ear
weight, number of kernels per row, ear girth, shelling
per cent, number of kernel rows per ear and 100 seed
weight which had strong positive correlation with seed
yield could be exploited in breeding programmes.
Similar results were reported by Jayakumar et al
(2007), Hemavathy et al (2008) and Shinde et al
(2009).
Path coefficient analysis that partitions the
correlation coefficient into direct and indirect effects
was worked out and is presented in Table 2. Among
the characters studied, days to 50% silking, ear
height, oil content and starch content had negative
direct effect on grain yield and the remaining
characters had positive direct effect. The character,
ear weight had the highest direct effect on seed yield
and it was followed by days to 50% silking and
shelling per cent. The traits, ear weight and shelling
per cent with high direct effect also had positive
correlation with seed yield while days to 50% tasseling
had significant negative correlation with seed yield.
Days to 50 per cent tasseling had negative indirect
effects through days to 50 per cent silking, ear height,
email: vijay.kk410@gmail.com
153

VIJAY et al
ear length, ear girth, number of kernels per row, ear
weight and shelling per cent. This trait had positive
indirect effects through plant height, days to maturity,
protein content and oil content. Days to 50 per cent
silking showed negative direct effects on grain yield.
This trait had negative indirect effect through ear
height, ear length, ear girth, number of kernels per
row, ear weight, and shelling per cent. This trait had
positive indirect effects through plant height, days
to maturity, protein content and oil content. Starch
content had positive indirect effect.
Plant height had positive direct effects on
grain yield and negative indirect effects on grain yield
through ear height, ear length, number of kernels per
row and ear weight. This trait had positive indirect
effects through days to maturity, ear girth, 100 seed
weight, shelling per cent, protein content and oil
content. Ear height had positive indirect effects
through days to 50 per cent tasseling, plant height,
days to maturity, ear girth, 100 seed weight, shelling
per cent, protein content and oil content. Days to
maturity showed positive direct effect on grain yield.
This trait had negative indirect effects on grain yield
through days to 50 % silking, ear height, ear length,
number of kernels per row, ear weight, 100 seed
weight, and shelling per cent whereas, oil content.
This trait had positive indirect effects through days
to 50 per cent tasseling, plant height, ear girth,
number of kernel rows per ear and protein content.
Ear length had positive direct effects on grain
yield and had positive indirect effects through days
to 50 per cent silking, ear height, ear girth, number
of kernel rows per ear, number of kernels per row,
ear weight, 100 seed weight and shelling per cent.
Starch content had negative indirect effect. Ear girth
had positive direct effect on grain yield. This trait
had positive indirect effects through days to 50 per
cent silking, plant height, days to maturity, ear length,
number of kernel rows per ear, number of kernels per
row, ear weight, 100 seed weight and shelling per
cent.
Number of kernel rows per ear had positive
direct effect on grain yield. This trait had negative
indirect effects on grain yield through days to 50%
tasseling, plant height, protein content and oil content
and had positive correlation with days to 50 per cent
silking, ear height, days to maturity, ear length, ear
girth, number of kernels per row, ear weight, 100 seed
weight, and shelling per cent. Number of kernels per
row had positive direct effects on grain yield and
showed negative indirect effects on grain yield
through days to 50 per cent tasseling, plant height,
days to maturity, protein content and oil content. This
trait showed positive indirect effects on grain yield
through days to 50 per cent silking, ear height, ear
length, ear girth, number of kernel rows per ear, ear
weight, 100 seed weight, and shelling per cent.
Ear weight had positive direct effect on grain
yield. 100 seed weight had positive direct effect on
grain yield. Positive direct effect was shown by
shelling per cent on grain yield. This trait had negative
indirect effects on grain yield through days to 50 per
cent tasseling, ear height, days to maturity and oil
content and had positive indirect effect through
remaining characters viz., days to 50 per cent silking,
plant height, ear length, ear girth, number of rows
per ear, number of seeds per row, ear weight, 100
seed weight, protein content and starch content.
Positive direct effect on grain yield was shown by
protein content. This trait had negative indirect effect
on grain yield at phenotypic level through number of
kernel rows per ear and starch content.
Oil content had negative direct effect on grain
yield. This trait had positive indirect effect through
days to 50 per cent silking, ear height, days to
maturity, ear length, ear girth, number of kernel rows
per ear, number of kernels per row, ear weight and
shelling per cent. Negative indirect effects on grain
yield was exhibited by days to 50 per cent tasseling,
plant height, days to maturity, 100 seed weight,
shelling per cent and protein content and had positive
indirect effect through days to 50 per cent silking,
ear height, ear length, ear girth, number of kernels
per row, ear weight and oil content. Similar results
were reported by Kumar et al. (2006), Jay kumar et
al. (2007), Brar et al. (2008) and Saidaiah et al. (2008).
Among the characters studied, ear length,
ear girth, number of kernel rows per ear, number of
kernels per row, ear weight, 100 seed weight, shelling
per cent and oil per cent had positive and significant
correlation coefficient with grain yield and had positive
direct relationship with ear weight and shelling per
cent. Hence, it might be regarded as these characters
contributed maximum to the seed yield. Thus,
selection based on these characters would result in
improvement in seed yield .
154

CHARACTER ASSOCIATION AND PATH COEFFICIENT ANALYSIS FOR SEED
Table 1. Correlation coefficients among yield and yield attributes in sixty-three genotypes of Quality Protein Maize (Zea mays L.)
* Significant at 5 per cent level, ** Significant at 1 per cent level.
155

VIJAY et al
Table2. Path coefficient analysis indicating direct and indirect effects of components characters on grain yield in sixty-three genotypes of Quality
Protein Maize (Zea mays L.)
Phenotypic residual effect =0.1438 Genotypic residual effect = 0.1057; Bold figures are direct effects
156

CHARACTER ASSOCIATION AND PATH COEFFICIENT ANALYSIS FOR SEED
REFERENCES
Brar, S. P. S., Chawla, J. S.and Pritpal Singh, 2008.
Studies on different selection indices and Path
analysis in Maize Zea mays L. Crop
Improvement 35: 16-19.
Dewey, D. R and Lu, K. H. 1959. A correlation and
path coefficient analysis of components of
crested wheat grass seed production.
Agronomy Journal 51: 515-518.
Hemavathy, A. T., Balaji, K., Ibrahim, S. M., Anand,
G and Deepa Sankar 2008. Genetic
variability and correlation studies in Maize
Zea mays L. Agricultural Science Digest 28:
112-114.
Jayakumar, J., Sundaram, T., Raguramarajan, A.,
and Kannan, S. 2007. Studies on path
analysis in Maize Zea mays L. for grain yield
and other yield attributes. Plant Archives 7:
279-282.
Jayakumar, J., Sundaram, T., Prabu, D. A and Rajan,
A. R. R. 2007. Correlation studies in Maize
Zea mays L. evaluated for grain yield and other
yield attributes. International Journal of
Agricultural Sciences 3: 57-60
Johnson, H. W., Robison, H. F and Comstock, R. E.
1955. Estimates of genetic and
environmental variability in Soybean. Agron.
J. 47: 314-18
Kumar, S., Shahi, J. P., Singh, J and Singh, S. P,
2006. Correlation and path analyis in early
generation inbreds of Maize (Zea mays L.).
Crop Improvement 33: 156-160.
Morries, M. L., Risopous, J and Beck, D. 1999.
Genetic changes in future recycled Maize
seed. A review of the evidence CIMMYT econ.
Working paper no.99-07 Mexico D.E. CIMMYT
P.1.
Saidaiah, P., Satyanarayana, E and Sudheer Kumar,
S. 2008. Association and path coefficient
analysis in Maize Zea mays L. Agricultural
Science Digest 28: 2
Shinde, S. A., Shelki, D. K and Sawargaonkar, G. L.
2009. Intercharacter associations and path
analysis of yield components in rabi Maize.
International Journal of Plant Sciences 4: 49-
51.
157

THE JOURNAL OF RESEARCH ANGRAU
DECLARATION CERTIFICATE TO BE SUBMITTED BY THE AUTHOR(S)
Certified that the article entitled ___________________________________________________________
____________________________________________________________________________________
1. is based on my / our original research work / M.Sc / Ph.D thesis (strike off whichever is not applicable)
2. The article has been seen by all the authors and the order of authorship is agreed.
3. The results presented have not been published or submitted for publication else where in part or full
under the same or other title
4. The names of the authors are those who made a notable contribution.
5. No authorship is given to anyone who did not make a notable contribution.
S.No. Name/s Present address Permanent address Signature
1.
2.
3.
CERTIFICATE BY THE COMPETENT AUTHORITY
( Professor & Head of the Department/ Principal Scientist of the station/ Associate Director of Research).
Certified that the article —————————————————————————————————
——————————————————————————————————————————————
authored by ——————————————————————————————————————————
——————————————————————— is fit for publication. It fulfills all the requirements for
publication in the Journal of Research ANGRAU.
Name :
Signature :
Office seal :
Note:
In case it is not possible to obtain the signature of a particular author for reasons beyond his/her
reach, the reasons thereof should be explained.

Statement about ownership and other particulars about
THE JOURNAL OF RESEARCH ANGRAU
Form IV (See Rule 8)
1. Place of Publication : The Acharya N.G. Ranga Agricultural University,
Rajendranagar, Hyderabad - 500 030
2. Periodicity of Publication : Quarterly
3. Printer’s Name : Dr. P. Chandrasekhar Rao
Nationality : Indian
Address : Professor & University Head , Department of SSAC and
Editor of Journal of Research, ANGRAU
Acharya N.G. Ranga Agricultural University
Rajendranagar, Hyderabad.
4. Publisher’s Name : Dr. P. Chandrasekhar Rao
Nationality : Indian
Address : Professor & University Head , Department of SSAC and
Editor of Journal of Research, ANGRAU
Acharya N.G. Ranga Agricultural University
Rajendranagar, Hyderabad.
5. Editor’s Name : Dr. P. Chandrasekhar Rao
Nationality : Indian
Address : Professor & University Head , Department of SSAC and
Editor of Journal of Research, ANGRAU
Acharya N.G. Ranga Agricultural University
Rajendranagar, Hyderabad.
6. Name and address of the : The Acharya N.G. Ranga Agricultural University,
individuals who own the Rajendranagar, Hyderabad - 500 030 (A.P.)
newspaper & partners or
share holders holding more
than one per cent of the
total capital
I, P. Chandrasekhar Rao hereby declare that the particulars given above are true to the
best of my knowledge and belief.
Dated :
Signature of Publisher

SUBSCRIPTION ENROLLING FORM
I/we, herewith enclose D.D. No...................................................................................
dated..................................for Rs. ............................... drawn in favour of Managing Editor, Journal of
Research ANGRAU, Agricultural Information & Communication Centre, ARI Campus, Acharya N.G. Ranga
Agricultural University, Rajendranagar, Hyderabad - 500 030 as individual annual/individual life/Institutional
annual Membership for Journal of Research ANGRAU for the calendar year (January - December) ..................
S.No. Name of the Address for Name of the article Signature
authors Correspondence contributed
1.
2.
3.
4.
Note :
The receipt of payment will be sent only if a self addressed and stamped envelope is enclosed
along with your DD.

GUIDELINES FOR THE PREPARATION OF MANUSCRIPT
1. Title of the article should be short, specific, phrased to identify the content and indicate the nature of
study.
2. Names should be in capitals prefixed with initials and separated by commas. For more than two authors
the names should be followed by ‘and’ in small letters before the end of last name. Full address of the
place of research in small letters should be typed below the names. Present address and E-mail ID of
the author may be given as foot note.
3. The full length paper should have the titles ABSTRACT, MATERIALS AND METHODS, RESULTS
AND DISCUSSION, REFERENCES-all typed in capitals and bold font - 12. The research note will
have only one title REFERENCES.
4. ABSTRACT: The content should include the year, purpose, methodology and salient findings of the
experiment in brief not exceeding 200 words. It should be so framed that the reader need not refer to
the article except for details.
5. INTRODUCTION : Should be without title and indicate the reasons which prompted the research,
objectives and the likely implication. The review of recent literature should be pertinent to the problem.
The content must be brief and precise.
6. MATERIALS AND METHODS : Should include very clearly the experimental techniques and the
statistical methods adopted. Citation of standard work is sufficient for the well known methods.
7. RESULTS AND DISCUSSION : Great care should be taken to highlight the important findings with
support of the data well distinguished by statistical measures like CD, r, Z test etc. Too descriptive
explanation for the whole data is not desirable. The treatments should be briefly expressed instead of
abbreviations like T 1
, T 2
etc. The discussion should be crisp and relate to the limitations or advantages
of the findings in comparison with the work of others.
8. REFERENCES : Literature cited should be latest. References dating back to more than 10 years are
not desirable. Names of authors, their spelling and year of publication should coincide both in
the text and references. The following examples should be followed while listing the references from
different sources.
Journals and Bulletins
Abdul Salam, M and Mazrooe, S.A. 2007. Water requirement of maize (Zea mays L.) as influenced by
planting dates in Kuwait. Journal of Agrometeorology. 9 (1) : 34-41
Hu, J., Yue, B and Vick, B.A. 2007. Integration of trap makers onto a sunflower SSR marker linkage map
constructed from 92 recombinant inbred lines. Helia. 30 (46) :25-36.
Books
AOAC. 1990. Official methods of analysis. Association of official analytical chemists. 15 th Ed. Washington
DC. USA. pp. 256
Federer, W.T. 1993. Statistical design and analysis for intercropping experiments. Volume I: two crops.
Springer – Verlag, Cornell University, Ithaca, New York, USA. pp. 298-305
Thesis
Ibrahim, F. 2007. Genetic variability for resistance to sorghum aphid (Melanaphis sacchari, Zentner) in
sorghum. Ph.D. Thesis submitted to Acharya N.G. Ranga Agricultural University, Hyderabad.

Seminars / Symposia / Workshops
Naveen Kumar, P.G and Shaik Mohammad 2007. Farming Systems approach – A way towards organic
farming. Paper presented at the National symposium on integrated farming systems and its role
towards livelihood improvement. Jaipur, 26 – 28 October 2007. pp.43-46
Proceedings of Seminars / Symposia
Bind, M and Howden, M. 2004. Challenges and opportunities for cropping systems in a changing climate.
Proceedings of International crop science congress. Brisbane –Australia. 26 September – 1 October
2004. pp. 52-54
(www.cropscience 2004.com 03-11-2004)
Tables and Graphs : The data in tables should not be duplicated in graphs and vice versa. Mean data for
main treatment effects should be presented with appropriate SE± and CD values wherever necessary.
The 2 or 3 way tables should be furnished only if the results are consistent over years and are
distinguished to have consideration of significant practical value. SE± and CD values however,
should be furnished in the tables for all interactions and should be explained in the results and
discussion. The treatments should be mentioned atleast in short forms if they are lengthy, but not
abbreviated as T 1
, T 2
and T 3
etc. The weights and measures should be given in the metric system
following the latest units eg. kg ha -1 , kg ha –1 cm, mg g -1 , ds m -1 , g m -3 , C mol kg -1 etc.
Typing :
Note :
The article should be typed in 12 pt font on A 4
size paper leaving a margin of 2 cm on all sides.
There should be a single line space between the rows in abstract and double line in rest. Verify
the manuscript thoroughly for errors before submitting it for publication.
Latest issue of the Journal may be consulted. Further details can be obtained from the book
“Editors style Manual, edn 4. American Institute of Biological Sciences, Washington DC”.
URL : http://www.angrau.ac.in/Publications.aspx
ESSENTIAL REQUIREMENTS FOR CONSIDERATION OF PUBLICATION OF ARTICLES
1. Research of not less than 2 years and of high standard will be considered as full length paper.
If necessary, it will be considered for short communication.
2. MSc. Research of one year should be submitted in the style and format of short communication.
3. The total number of pages should not exceed 10 for full paper and 5 pages for short communication
including tables and figures. The figures should be legible.
4. Previous research of 5 years old before the date of submission will not be considered.
5. All the authors should subscribe for the Journal
6. The manuscript should be submitted in duplicate as per the guidelines of the Journal to Managing
Editor, The Journal of Research ANGRAU, AICC & ANGRAU Press, ARI Campus, Rajendranagar,
Hyderabad – 500 030.
7. The manuscript should accompany the declaration certificate and subscription enrolment form.
8. The authors should accept the editorial / referees comments until the quality of the paper is improved.
9. The revised manuscript should be submitted in duplicate along with a compact disk.
REVIEW PROCESS
The articles will be initially screened by the editors. It will be sent to an expert for peer review only if
it contains adequate original information and is prepared as per the guidelines. The author, then, may also be
asked to revise it if the expert desires. After getting the article suitably revised and edited, it will be placed
before the editor for a final decision. The accepted article will be finally checked for language and grammar by
the English editor before being sent to the press. The decision however to publish the paper lies with the
editor. Any article which is not able to meet the expected standard or is not prepared in conformity with
guidelines will be rejected without assigning any reason.

ESSENTIAL REQUIREMENTS
FOR CONSIDERATION OF PUBLICATION OF ARTICLES
1. Research of not less than 2 years and of high standard will be considered as full length paper. If
necessary, it will be considered for short communication.
2. M.Sc. Research of one year should be submitted in the style and format of short communication.
3. The total number of pages should not exceed 10 for full paper and 5 pages for short communication
including tables and figures. The figures should be legible.
4. Previous research of 5 years before the date of submission will not be considered.
5. All the authors should subscribe for the Journal
6. The manuscript should be submitted in duplicate as per the guidelines of the Journal to Managing
Editor, the Journal of Research of Research ANGRAU, AI&CC and ANGRAU Press, ARI Campus,
Rajendranagar, Hyderabad.
7. The manuscript should accompany the declaration certificate and subscription enrolment form.
8. The authors should accept the editorial / references comments until the quality of the article is improved.
9. The revised manuscript should be submitted in duplicate along with a compact disk.
10. DD may be drawn in favour of “Managing Editor, Journal of Research, ANGRAU” Payable at Hyderabad.
SUBSCRIPTION TARIFF
ANNUAL
Individual : Rs. 300/- author
Institution : Rs. 1200/-
LIFE
Individual (till retirement) : Rs. 1200/-
Reprints Charges : Rs. 100/- per page
1. Publications : Managing Editor - Journal of Research ANGRAU, AI&CC and ANGRAU Press,
ARI Campus, Rajendranagar, Hyderabad.
2. Publications : The DD should be mailed to the Managing Editor - Journal of Research, ANGRAU
- Press Agricultural Research Institute, Rajendranagar, Hyderabad - 500 030.
least in short forms if they are lengthy, but not abbreviated as T 1
, T 2
and T 3
etc. The weights and
measures should be given in the metric system following the latest units eg. kg ha -1, kg ha -1 cm, mg
g -1 , ds m -1 , g m -3 , C mol kg -1 etc.
Typing : The article should be typed in 12pt font on A 4
size paper leaving a margin of 2 cm on all sides.
There should be a single line space between the rows in abstract and double line in rest.
Note : Latest issue of the Journal may be consulted. Further details can be obtained from the book
“Editors style Manual, edn 4. American Institute of Biological Sciences, Washington DC”.
URL : http://www.angrau.ac.in/Publications.aspx