FR AB - Science Reference

VOLUME 11, ISSUE 4, DECEMBER 2000 

CONTAINS ABSTRACTS FROM ABRF 2001 MEETING 

JBTtgaacagatgatcaggtgaaatcacc 

gtctgaaatcacgtgaaatcacgtgaa 

THE aaatcaccaggtgaaaaatcacgtga 

caggtgaaagctaacagaggggggt 

OFFICIAL gacagtgctcggagaaattacaatac 

JOURNAL cgaggagaaatcctttcaatactcgag 

OF gagaaacttgacaatactagaaacttg 

THE acaatacagaaacttgacaatacaga 

Association aacctgaaaaatcaatcaggtgaaaa 

of atcaatcaggtgaaatcaatcaggtga 

Biomolecular aatcacatcaggtgaaatcacatcagg 

tgaaatcacatcaggtgagctaacgg 

Resource ggggttgacagtgctcgagaaatgttg 

Facilities acaatagaggagaaatttgaaataga 

ggagaaacttgaaatatcgaggagaa 

acttgatactcgaggagaaacttgac 

actcgaggagaaactgaatcacaga 

gatcaggtgaatcacagatgatcagg 

gatcacaaatgatcaggtgaatcacaa 

atgatcaggtgaaatcacaaatgatca 

ggtgaaatcacgaatgcaggtgaaag 

ctaacaaaggggggttgacagtgctc 

JOURNAL OF BIOMOLECULAR TECHNIQUES

RF AB 

JBT 

JOURNAL OF BIOMOLECULAR TECHNIQUES 

Clive A. Slaughter 

St. Jude Children’s Research Hospital 

332 North Lauderdale Street 

Memphis, TN 38105-2794 

Tel: (901) 495-4844 Fax: (901) 495-2945 

email: clive.slaughter@stjude.org 

Ruth Angeletti 

Albert Einstein College 

of Medicine 

Kalyan R. Anumula 

SmithKline Beecham 

Pharmaceutical 

Lynda Bonewald 

University of Texas 

Health Science Center 

at San Antonio 

Gerald Carlson 

University of Missouri 

Steven Carr 

SmithKline Beecham 

Pharmaceutical 

Dan Davison 

Bristol-Myers Squibb 

EDITOR-IN-CHIEF 

Clayton W. Naeve 



Memphis, TN 38105-2794 

Tel: (901) 495-3861 Fax: (901) 495-2945 

email: clayton.naeve@stjude.org 

ASSOCIATE EDITORS 

EDITORIAL BOARD 

Karen De Jongh 

Zymogenetics 

Greg Grant 

Washington University 

at St. Louis 

George Grills 

Albert Einstein College 

of Medicine 

Susan Hardin 

University of Houston 

Preston Hensley 

Pfizer, Inc. 

Harold Hills 

Iowa State University 

Paul Morrison 

Dana-Farber Cancer 

Institute 

COPPERPLATE PRESS, INC. 

85 East Stewart Avenue 

Lansdowne, Pennsylvania 19050 

Tel: (610) 284-5257 Fax: (610) 284-5258 

email: mconnors@copperplatepress.com 

http://www.copperplatepress.com 

David Speicher 

The Wistar Institute 

3601 Spruce Street 

Philadelphia, PA 19104-4268 

Tel: (215) 898-3972 Fax: (215) 898-0664 

email: speicher@wistar.upenn.edu 

Ron Niece 

Research Resources and 

Technologies 

Margaret Robertson 

University of Utah 

Richard Simpson 

Ludwig Institute for 

Cancer Research 

Laurey Steinke 

University of Nebraska 

Medical Center 

John Stewart 

University of Colorado 

Dan Strydom 

BioNebraska, Inc. 

John R. Yates 

University of Washington 

ASSOCIATION OF BIOMOLECULAR RESOURCE FACILITIES

JBT 


VOLUME 11, ISSUE 4, DECEMBER 2000 

METHODS & REVIEWS 

CONTENTS 

Implementation of Automation in a Small-Scale DNA Sequencing Core Facility 151 

Jennifer L. Ware, Laurie Moran, Ching-Lun Lin, and Barton Slatko 

RESEARCH GROUP REPORTS 

Strategies for the Synthesis of Labeled Peptides 155 

Lisa Bibbs, Nicholas P. Ambulos, Steven A. Kates, Ashok Khatri, 

Katalin F. Medzihradszky, George Ösapay, and Susan T. Weintraub 

REPORT 

Research Equipment and Resource Requirements of NIH-Supported Investigators: 166 

An Assessment of Current Conditions and Recommendations for 

Future Funding and Programs 

Tamara R. Zemlo, Howard H. Garrison, David Lester, Mustafa Lokhandwala, 

Fred Naider, Stephen White, and David W. Speicher 

BOOK REVIEWS 

Amino Acid Analysis Protocols, edited by Catherine Cooper, 177 

Nicolle Packer, and Keith Williams 

Reviewed by Alan Mahrenholz 

— continued — 

The Journal of Biomolecular Techniques (ISSN 1524-0215) is published quarterly by The Association of Biomolecular 

Resource Facilities, 1201 Don Diego Avenue, Santa Fe, NM 87505. Copyright © 2000 by The Association of Biomolecular 

Resource Facilities. All rights reserved. Periodicals postage paid at Bethesda, Maryland, and at additional mailing 

offices. 

Address for subscription information, orders, or changes of address: The Association of Biomolecular Resource 

Facilities, 1201 Don Diego Avenue, Santa Fe, NM 87505; Tel: (505) 983-8102; Fax: (505) 989-1073. 

Annual subscription rates: Members of the Association of Biomolecular Resource Facilities receive a subscription as 

part of their membership fee. Other subscribers are charged as follows. Within the United States: $75.00 individual, 

$100.00 institution. (All other countries add $21.00 for air freight shipping—delivery within 7 to 21 days, worldwide.) 

International subscriptions must be prepaid. Please add $4.00 to all rates above for handling. Single copies, when available, 

may be ordered from the publisher. Single copies: $25.00. Prices subject to change without notice. Copies will be 

replaced without charge if the publisher receives a request within 90 days of the mailing date, both U.S. and worldwide. 

POSTMASTER: Send address changes to The Association of Biomolecular Resource Facilities, 1201 Don Diego Avenue, 

Santa Fe, NM 87505.

CONTENTS 

NEWS & EVENTS 

Message From the Executive Board 179 

ABRF/ASBMB Joint Symposium 180 

ARTICLE WATCH 

Amino Acid Composition and Sequence Analysis 181 

Carbohydrates and Glycoproteins 181 

Phospholipids 181 

Nucleic Acids 182 

Mass Spectrometry 182 

Proteins—Purification and Characterization 183 

Microarrays 184 

Bioinformatics 184 

UPCOMING EVENTS 

Dates to Remember 185 

ABRF 2001: THE NEW BIOLOGY: TECHNOLOGIES FOR 

RESOLVING MACROMOLECULAR COMMUNICATIONS 

Abstracts 188 

Author Index 233 

INDEX TO VOLUME 11, 2000 

Author Index 237 

Subject Index 237 

The Association of Biomolecular Resource Facilities cannot be held responsible for errors or for any consequences arising 

from the use of the information contained in this journal. The appearance of advertising in this journal does not 

constitute an endorsement or approval by The Association of Biomolecular Resource Facilities for the quality or value 

of the product advertised or the claims made for it by its manufacturer. 

PERMISSION TO PHOTOCOPY ARTICLES: This publication is protected by copyright. Permission to photocopy must 

be secured in writing from Clayton Naeve, Editor-in-Chief, St. Jude Children’s Research Hospital, 332 North Lauderdale 

Street, Memphis, TN 38105-2794; Tel: (901) 495-3861; Fax: (901) 495-2945.

CORPORATE SPONSORSHIP 

ABRF corporate sponsors provide valuable financial support to the organization; however, they do not in any way 

influence the selection of articles for or the content of the Journal. All articles published in the Journal undergo a 

peer-review process to determine merit and accuracy before being accepted for publication. 

ABRF CORPORATE 

BENEFACTORS 

Applied Biosystems 

Bruker Daltonics, Inc. 

Genomic Solutions, Inc. 

Micromass 

Millipore Corporation 

ThermoQuest Corporation 

Waters Corporation 

ABRF CORPORATE PATRON 

SciQuest.com 

Corporations interested in supporting ABRF should contact Laurey Steinke, Protein Structure Core Facility, UNMC, 

Omaha, NE 68198-4525; Tel: (402) 559-6647; Fax: (402) 559-6650; email: lsteinke@molbio.unmc.edu 

MISSION STATEMENT 

FROM THE BY-LAWS OF THE ASSOCIATION OF 

BIOMOLECULAR RESOURCE FACILITIES 

The Association of Biomolecular Resource 

Facilities has been organized for the following 

purposes: 

• To promote and support resource facilities, 

research laboratories, and individual 

researchers regarding operation, 

research, and development in the areas 

of methods, techniques, and instrumentation 

relevant to the analysis and synthesis 

of biomolecules. 

• To provide mechanisms for the selfevaluation 

and improvement of procedural 

and operational accuracy, precision, 

and efficiency in resource facilities 

and research laboratories. 

• To provide a mechanism for the education 

of resource facility and research 

laboratory staff, users, administrators, 

and interested members of the scientific 

community. 

ABRF CORPORATE SPONSORS 

Affymetrix, Inc. 

Agilent Technologies 

Amersham Pharmacia Biotech, Inc. 

AnaSpec, Inc. 

Beckman Coulter, Inc. 

Biacore, Inc. 

Bio-Rad Laboratories, Inc. 

BioWhittaker Molecular Applications 

Edge BioSystems 

EM Science 

GeneMachines 

Genentech, Inc. 

Geospiza, Inc. 

Glen Research Corporation 

ABRF ELECTRONIC COMMUNICATIONS 

EMAIL AND WEB ADDRESSES FOR CONTACTING 

ABRF AND ACCESSING ABRF INFORMATION 

ELECTRONIC DISCUSSION GROUP 

abrf-request@aecom.yu.edu (Subscription) 

abrf@aecom.yu.edu (Correspondence) 

ombudsmn@aecom.yu.edu (Ombudsman) 

ELECTRONIC DISCUSSION GROUP 

ARCHIVES 

http://www.abrf.org/archives 

ABRF HOME PAGE 

http://www.abrf.org 

Hitachi Instruments, Inc. 

LC Packings, Inc. 

Michrom BioResources, Inc. 

Prolinx, Inc. 

Promega Corporation 

QIAGEN 

Rainin Instrument Company 

Sigma-Aldrich 

SynPep Corporation 

Transgenomic, Inc. 

Vydac/The Separations Group 

Wyatt Technology Corporation 

ZymoGenetics, Inc. 

JOURNAL OF BIOMOLECULAR 

TECHNIQUES 

http://www.abrf.org/JBT/JBT.html

ASSOCIATION OF BIOMOLECULAR RESOURCE FACILITIES 

RESEARCH GROUP MEMBERS 

Amino Acid Analysis 

Peter Hunziker (chair) David Chin Len Packman (EB liaison) 

Michail Alterman Reed Harris Karen West 

Carbohydrate Analysis 

Adriana Manzi (chair) Roberta Merkle Monica Palcic 

DNA Sequence 

Dina Leviten (chair) John Hawes Mark Lively (EB liaison) 

Duane Bartley (ad hoc) Tim Hunter Theodore Thannhauser 

George Grills (ad hoc) Emily Jackson-Machelski James Van Ee (ad hoc) 

Lawrence Hall Kevin Lee Knudtson 

Fragment Analysis 

Doug Bintzler (chair) Duane Bartley Caprice Rosato 

Pamela Scott Adams Laura Kasch Laurey Steinke (EB liaison) 

Linda Wood Ballard Lynn Petukhova Catherine E. Terrell 

Yongde Bao 

Microarray 

Chandi Griffin (co-chair) Jeffrey Delrow Aldo Massimi 

George Grills (co-chair) Kevin Knudtson Laurey Steinke (EB liaison) 

Yongde Bao (ad hoc) Kathryn Lilley James Van Ee (ad hoc) 

Roger Bumgarner 

Molecular Interactions 

Preston Hensley (chair) Ed Eisenstein Fred Schwarz 

Karen De Jongh (EB liaison) David Myszka Steven Swanson 

Mike Doyle 

Nucleic Acids 

Martha Gunthorpe (chair) Kathryn Lilley Theodore Thannhauser 

Scottie Adams (ad hoc) Mark Lively (EB liaison) (ad hoc) 

Jay Fox Kathy Mills Anthony Yeung 

Brian Holloway Stephen Scaringe 

Peptide Synthesis 

Nicolas Ambulos (chair) George Osapay Arpad Somogyi 

Lynda Bonewald (EB liaison) Henriette Remmer George Tsaprailis 

Steve Kates 

Protein Analysis 

Terry Lee (co-chair) David Arnott Rich Johnson 

Linda Siconolfi-Baez John Crabb Len Packman (EB liaison) 

(co-chair) Bryan Dunbar 

Quality and Compliance 

Elizabeth Fowler (chair) Michael Cohrs Ronald Niece (EB liaison) 

Ruth Angeletti (ad hoc) John Dougherty Nadine Ritter 

Eleanor Canova-Davis Timothy Hayes Alan Smith 

COMMITTEE MEMBERS 

Corporate Relations 

Barbara Merrill (chair) Elizabeth Fowler Len Packman 

Karen De Jongh (EB liaison) Preston Hensley Ray Paxton 

Joe Fernandez 

Membership 

John Crabb (chair) Marc Lemaitre Daniel J. Strydom 

Lowell Ericsson Ronald Niece (EB liaison) Satya Yadov 

Peter Hunziker 

Nominations 

Ruth Angeletti (chair) Lynda Bonewald (EB liaison) Paul Morrison 

Science Policy 

Ruth Angeletti (chair) Lynda Bonewald (ad hoc) David Speicher 

Thomas Anderson A. L. Burlingame (EB liaison) 

Publications 

Ralph A. Bradshaw (chair) Clayton Naeve (ad hoc) Al Smith 

Lynda Bonewald (EB liaison) Clive Slaughter (ad hoc) David Speicher (ad hoc) 

Ben Dunn 

Survey 

Katheryn Resing (chair) Charles Nicolet John Stults (EB liaison) 

Janice Bleibaum Gautam Sarath Satya Yadav 

Debra McMillen (ad hoc) 

ABRF Award 

Greg Grant (chair) Lynda Bonewald (EB liaison) 

Web Page Redesign 

Theodore Thannhauser Paul Morrison Laurey Steinke 

(chair) Len Packman James Van Ee 

Finance and Investments 

Karen De Jongh (chair) 

EXECUTIVE BOARD 


Research•Technology 

Communication•Education 

PRESIDENT 

Lynda F. Bonewald 

SA-Med-Endocrine Core Facility 

University of Texas Health Science Center 

7703 Floyd Curl Drive 

San Antonio, TX 78284 

Tel: (210) 567-6666 Fax: (210) 567-6693 

email: bonewald@uthscsa.edu 

A. L. Burlingame 

Department of Pharmaceutical Chemistry 

University of California San Francisco 

San Francisco, CA 94143-0446 

Tel: (415) 476-5641 Fax: (415) 476-0688 

email: alb@itsa.ucsf.edu 

TREASURER 

Karen De Jongh 

Zymogenetics, Inc. 

1201 Eastlake Avenue East 

Seattle, WA 98102 

Tel: (206) 442-6659 Fax: (206) 442-6608 

email: dejonghk@zgi.com 

Mark O. Lively 

Department of Biochemistry 

Bowman Gray School of Medicine 

Medical Center Boulevard 

Winston-Salem, NC 27157-3001 

Tel: (336) 716-2969 Fax: (336) 716-7200 

email: mlively@wfubmc.edu 

Ronald Niece 

Research Resources & Technologies 

58 Whitman Court 

Irvine, CA 92612 

Tel: (949) 856-0553 Fax: (949) 856-0564 

email: RLNiece@aol.com 

Len C. Packman 

Department of Biochemistry 

Cambridge University 

80 Tennis Court Road 

Cambridge, UK 

Tel: 44-122-333-3639 Fax: 44-122-376-6002 

email: lcp2@mole.bio.cam.ac.uk 

Laurey Steinke 

University of Nebraska Medical Center 

Protein Structure Core Facility 

600 South 42nd Street, Box 984525 

Omaha, NE 68798-4525 

Tel: (402) 559-6647 Fax: (402) 559-6650 

email: lsteinke@molbio.unmc.edu 

John T. Stults 

1 DNA Way, #63 

Genentech, Inc. 

460 Point San Bruno Boulevard 

South San Francisco, CA 94080 

Tel: (650) 225-1203 Fax: (650) 225-5945 

email: jts@gene.com 

ABRF BUSINESS OFFICE 

1201 Don Diego Avenue 

Santa Fe, NM 87505 

Tel: (505) 983-8102 Fax: (505) 989-1073 

email: abrf@abrf.org

Implementation of Automation 

in a Small-Scale DNA 

Sequencing Core Facility 

Jennifer L. Ware, Laurie Moran, 

Ching-Lun Lin, and Barton Slatko 

New England Biolabs, Inc., Beverly, MA 

METHODS 

REVIEWS 

New England Biolabs (NEB) sequencing core facility provides 

automated sequencing services to support various 

company-wide projects in house, but on a very small scale of 

about 1000 to1500 reactions per month. A procedure has 

been implemented at the NEB core sequencing facility to 

integrate simplified methods and robotics to provide a more 

efficient small-scale process. This has been done using a 

Beckman Biomek 2000 robot combined with an MJ DNA 

Engine, 96-well plate cycler (PTC-200), AB 373 and 377 

sequencers, BMA Singel gels, and several other materials that 

help reduce the time required for otherwise lengthy procedures 

in a cost-efficient manner. Protocols have also been 

developed for efficient sequencing of a variety of templates 

submitted to the NEB core facility. (J Biomol Tech 2000;11: 

151–154) 

KEY WORDS: automation, robotics, sequencing template 

cleanup, small-scale DNA sequencing. 

ADDRESS CORRESPONDENCE AND REPRINT REQUESTS TO: Jennifer L. 

Ware, New England Biolabs, Inc., 32 Tozer Road, Beverly, MA 

01915 (email: ware@neb.com). 

& 

Journal of Biomolecular Techniques 

11:151–154 © 2000 ABRF 


Genome sequencing and analysis technology 

has advanced in a manner that allows companies 

to generate enormous amounts of data 

per day, via automated processes, in an effort to complete 

genome projects and use that information as a 

source of possible disease treatment and control. 

Unfortunately, smaller core facilities, which have less 

of a need to produce such high-throughput data, are 

not the primary targets of application of these 

advanced technologies and are in need of simplified 

methods. The core sequencing laboratory at New 

England Biolabs, Inc. (NEB, Beverly, MA) has combined 

recent advances in sequencing technology to 

efficiently simplify the process from beginning to end. 

The sequencing core facility provides additional measures 

of quality control of appropriate DNA products 

for sale at NEB, such as sequencing primers and other 

oligonucleotides, cloning vectors by sequencing reaction 

assay, and vector and phage display products to 

ensure correct sequence. For our in-house research 

program, sequences are required from vector and 

overexpression constructs of clones, cDNA, polymerase 

chain reaction (PCR), phage display, and other 

sequencing templates, including our involvement in 

the Filarial Genome Project (http://www.neb.com/ 

fgn/filgen1.html). Among those templates submitted 

for analysis are plasmids, M13 derivatives, � phage, 

PCR products, cosmids, and bacterial artificial chromosomes 

(BACs), each of which requires a different 

amount of template and/or primer per reaction and 

sometimes different sequencing reaction conditions as 

well. 

ELECTRONIC SUBMISSION 

To make this process efficient from beginning to end, 

researchers start by submitting an electronic form to 

the core facility in which key information necessary to 

perform the sequencing is provided. The form is accessible 

on the DNA Sequencing Core Facility intranet 

JOURNAL OF BIOMOLECULAR TECHNIQUES, VOLUME 11, ISSUE 4, DECEMBER 2000 151

J. L. WARE ET AL. 

site (on a Unix server) through the user’s desktop 

Macintosh or PC. The intranet site provides the home 

base for submission and receipt of sequence information 

to and from the core facility. By selecting the 

“submit your template to DNASEQ lab” icon, the 

researcher can fill out an html form in which they 

describe the project, identify the type of template 

being submitted, and list any special instructions concerning 

the reaction (eg, “please include DMSO; high 

G�C content”). It is necessary that the instructions to 

the sequencing core be precise. We require both the 

templates and primers be submitted at the proper 

concentrations for the reaction conditions. The core 

facility maintains a stock of common “standard” 

primers such as T3, T7, SP6 promoter primers, and 

pUC-based forward and reverse primers, and the 

researcher need not provide them. The form also asks 

the submitter about the method of purification of the 

template to enable the core facility to track statistics of 

success and failure with different methods and to 

identify any failure correlations. In addition, the form 

requires some substantiation of DNA concentration to 

ensure that the submitter has indeed verified template 

concentration. One major class of reaction failures 

is the result of too much or too little DNA. A second 

class is suboptimal (or no) sequence data, usually 

attributable to template impurity or primer design 

issues. We consider a failure any sequence that does 

not give a reasonable amount of sequence (eg, 500– 

600 “good” nucleotide base calls for double-stranded 

plasmid DNA templates). 

After the form is submitted to and received by the 

core sequencing facility, a message to the sender 

thanks them for their submission. If the form is not 

completely filled out, it will not be submitted, and an 

error message appears to the submitter identifying 

the problem and asking them to “try again.” 

We chose a Unix-based server as the site for submission 

and return of sequence files because of its 

faster speed and higher data-handling capabilities, 

especially when downloading sequences to the end 

user. We also run CAP (Columbia Appletalk Package 

for Unix) on our Web server so the sequence data 

from the sequencers can be uploaded easily. The submission–data 

porting script was written at NEB and 

provides a rapid and simple way to handle data electronically. 

After the submission form is sent, the researcher 

physically submits the template and primer in a small 

plastic bag with their name on it by placing it in a 

box marked “TEMPLATES IN” in a small freezer in the 

core facility. Template and oligonucleotide are submitted 

in pairs—for every template submitted there 

must be a companion primer tube, and vice versa. 

The sequencing reactions are then performed accord- 

152 JOURNAL OF BIOMOLECULAR TECHNIQUES, VOLUME 11, ISSUE 4, DECEMBER 2000 

ing to the instructions on the submission sheet using 

the corresponding primers and templates submitted 

to the core facility. After the sequence data are 

obtained, and retracked and recalled if necessary, a 

copy of the raw data is directly ported through the 

server back to a folder automatically created at the 

DNA Sequencing Core Facility intranet site. Users 

simultaneously receive an email message, delivered 

to the email address they submitted on the form, 

stating, “Your DNA sequence data is ready.” By 

returning to the intranet site and choosing the “pick 

up your sequence” icon, the researcher can go 

directly to the server to download the sequences 

to his or her own computer for analysis. Sequenced 

templates and primers can then be picked up by the 

user from the core facility freezer “TEMPLATES OUT” 

box. 

The NEB core sequencing facility uses the Applied 

Biosystems (Foster City, CA) AB 373 and 377 

automated sequencers to process approximately 84 to 

96 dye terminator samples per day. Dye terminator 

sequencing chemistry is used to accommodate the 

variety of template types and vector constructs being 

sequenced and to maximize the number of primers 

that can be used. 

ROBOTICS AND REACTION 

PREPARATION 

The Biomek 2000 Robot (Beckman Instruments, Palo 

Alto, CA) is used to assemble the components of sequencing 

reactions. Using adaptors for 1.5-mL centrifuge 

tubes, the robot can build any number of desired 

reactions so that in-house customers can submit 

in standard-sized tubes. The reaction components are 

transferred directly into a 96-well tray on the MJ cycler 

with a Power Bonnet heated lid (MJ Research, Watertown, 

MA) attached to the robot and thermally cycled 

immediately on addition of all reagents, as specified 

by a preset program. 

The robot has limitations that affect volume per 

tube, namely, a lack of ability to withdraw small 

volumes of reagent. It is necessary to provide at least 

10 �L of reagent if 5 �L is to be withdrawn by the 

robot. Similarly, for 1 �L to be withdrawn, 5 �L must 

be present. For our sequencing protocol, doublestranded 

and single-stranded DNA templates must be 

at 100 ng/�L (5 �L is used, thus 10 �L must be submitted), 

and PCR products must be at 8 ng/�L (5 �L 

is used, thus 10 �L must be submitted). We require 

oligonucleotide concentrations to be 3.2 pmol/�L for 

double-stranded DNA, and 5 �L must be provided per 

primer tube although only 1 �L is added per reaction. 

For single-stranded DNA, primers are submitted at

0.8 pmol/�L with 5 �L per primer tube; again, only 

1 �L is added per reaction. 

To use the robot to assemble the components of 

these reactions, a simple program was composed to 

transfer samples between the robot benchtop platform 

and the 96-well plate on the connected MJ cycler. A 

script is available from Beckman, as well as from MJ 

Research, that allows the cycler to close the heated lid 

and start cycling on reaction setup completion. 

We have found that reactions containing one half 

of the manufacturer’s prescribed quantity of Amplitaq 

DNA Polymerase FS premix (AB PRISM Dye Terminator 

Cycle Sequencing Ready Reaction Kit using 4 �L 

premix per reaction with the AB recommended 

amount of DNA template and primer), yielding a total 

volume of 10 �L, works better and is more costefficient 

than the standard AB protocol that includes 

8 �L premix in each reaction, yielding a total volume 

of 20 �L. 1 

� PHAGE/COSMID/BAC 

SEQUENCING METHODS 

Protocols have been designed and optimized for 

sequencing reactions other than standard doublestranded 

or single-stranded DNA templates. These 

sequences are done manually and cycled on an MWG 

cycler (Biotech, High Point, NC), but can be done on 

the robot with the appropriate programming. 

With Amplitaq FS terminator chemistry, BAC sequencing 

requires a large-scale reaction for maximum 

output of at least 500 bases per reaction and minimum 

background. Sixteen microliters of premix is combined 

with 1 �g of DNA template and 50 pmol primer 

and dH2O to give a total volume of 40 �L. 2 

Cosmid and � phage reactions are performed 

using 500 ng DNA (the standard amount of DNA used 

in double-stranded and single-stranded reactions), but 

with 12.8 pmol of primer (approximately 4 times the 

standard 3.2 pmol amount) and 8 �L premix to provide 

a total reaction volume of 20 �L. 

For reaction product purification, Centrisep spin 

columns (Princeton Separations, Adelphia, NJ) are 

used on an individual basis for the reactions performed 

manually, as described in the product manual. 

A 96-well system (Edge Biosystems, Gaithersburg, 

MD) is used for product purification of the robotprepared 

automated sequencing reactions performed 

in the 96-well cycler. Product purification is also done 

with the assistance of the robot. A simple program 

was written to transfer the cycled sequencing reactions 

directly onto the center of each well of a 96-well 

separation plate with gel bed of hydrated sephadex 

mixture. After all reaction mixtures are transferred to 

AUTOMATION IN SMALL-SCALE DNA SEQUENCING FACILITY 

this separation plate, the plate is centrifuged at 800 

rpm in a Beckman GS-15 microtiter tray centrifuge 

with a collection tray underneath it to collect the purified 

sequencing sample. This tray is then placed in a 

Jouan R6-1010 vacuum centrifuge (Jouan, Winchester, 

VA) to dry the samples. The dried samples, as well as 

those dried samples prepared via Centrisep columns, 

are then resuspended in 2-�L Accutrac dye (3 �L for 

the AB 373 sequencer; Commonwealth BioTechnologies, 

Richmond, VA), which provides a unique dye 

marker for each lane on the gel image regardless of 

whether or not the reaction has failed. This reduces 

software errors in lane tracking. After the samples are 

resuspended in dye, they are vortexed and centrifuged 

at maximum speed for 30 seconds and then 

heat denatured at 90�C for 2 minutes. The samples are 

then loaded onto the sequencers in a staggered manner 

in which the odd samples are loaded first and 

subjected to electrophoreses for 10 minutes, and then 

the even samples are loaded. 

GELS 

Biowhitaker prepackaged Singel gels (Long Ranger 

Singel packs for AB 373 and 377; BMA, Rockland, ME) 

are used as a simple, efficient alternative to making 

our own gel solutions. It takes 12 minutes to prepare 

the gels for pouring. Using mild alkanox detergent 

and isopropanol to clean the glass plates, the gel solution 

is placed in a side-arm flask for pouring onto the 

plates using an Owl Scientific Otter sequencing gel 

caster (Owl Separation Systems, Portsmouth, NH). 

A period of 2 to 2.5 hours is necessary to allow the 

gels to completely polymerize; other steps in the 

process are performed during this period. 

DATA ANALYSIS 

The core facility currently processes 1000 to 1500 

sequence reactions per month, with about 60 facility 

users submitting templates for sequencing. Data from 

each sequence run is immediately backed up on a 

gigabyte tape drive and copied onto a CD for permanent 

storage. In addition, a summary of the sequencing 

results is transferred to tape for short-term storage. 

Gel image files are kept for 3 days to enable retracking 

or for use of alternative base-calling programs, if 

necessary. 

When novice users first submit templates for 

sequencing, they are given a written set of instructions 

concerning template preparation and quantitation. 

They are also instructed in how to configure their 

Netscape Navigator (Netscape Communications Corp., 

Mountain View, CA) to download sequences from the 


J. L. WARE ET AL. 

intranet site. Netscape Navigator must be configured 

using a sequence trace editor to view the sequence 

chromatogram files generated by the AB sequencers. 

They are also shown how to use the analysis programs. 

This information is also present on the intranet 

site, along with information on sequencing chemistry 

and helpful hints on reading sequences. Numerous 

copies of computer programs for analysis are mounted 

on individual Macintosh or Windows-based PC computers 

with access by limited user-number licenses. In 

addition, each user is given a copy of EditView for 

Macintosh users (available by FTP from the AB Web 

site) or Chromas for PC users (Techlysium, PTY LTD, 

Helensvale, Australia) to do simple editing and text 

file saving. The core facility provides support and 

training for certain computer programs for assembling 

sequencing projects, such as Autoassembler (AB), 

Sequencher (Gene Codes, Ann Arbor, MI), and GCG 

Programs (Pharmacopeia, Princeton, NJ). Other Macand 

PC-based programs are also in common use. 

CONCLUSIONS 

Despite the focus on high-throughput automated 

sequencing, many laboratories, such as NEB, have a 


medium-throughput level. From the submission/data 

porting script to the template cleanup, we have 

designed simplified methods to make each step more 

efficient and less time consuming for a small-scale 

core facility. Using this system has enabled us to efficiently 

perform DNA sequencing service, generally 

achieving a 2-day turnaround between submission 

and return of sequence information. 

ACKNOWLEDGMENTS 

This work was supported by New England Biolabs, Inc. 

(NEB). We sincerely thank the computer group at NEB for 

their essential aid in the core facility. All programs mentioned 

in this article can be obtained from Beckman, MJ 

Research, or NEB. 

REFERENCES 

1. ABI PRISM Dye Terminator Cycle Sequencing Ready 

Reaction Kit with Amplitaq DNA Polymerase FS Protocol, 

revision A. Foster City, CA: Applied Biosystems, 

August 1995. 

2. Boysen C, Simon M, Hood L. Fluorescence-based sequencing 

directly from bacterial and P1-derived artificial 

chromosomes. BioTechniques 1997;23:978–982.

RESEARCH GROUP 

REPORTS 

Strategies for the Synthesis 

of Labeled Peptides 

Lisa Bibbs, a Nicholas P. Ambulos, b 

Steven A. Kates, c Ashok Khatri, d 

Katalin F. Medzihradszky, e 

George Ösapay, f and 

Susan T. Weintraub g 

a The Scripps Research Institute, La Jolla, CA; 

b University of Maryland at Baltimore, 

Baltimore, MD; c PerSeptive Biosystems, Inc., 

Farmingham, MA; d Massachusetts General 

Hospital, Boston, MA; e University of California, 

San Francisco, CA; f University of California, 

Irvine, CA; g University of Texas Health Science 

Center at San Antonio, San Antonio, TX 

Labeled peptides synthesized by core facilities are frequently 

used by researchers for following trafficking of a peptide, for 

binding studies, to determine substrate specificity, and for 

receptor cross-linking studies.The membership of the Association 

of Biomolecular Resource Facilities was asked to participate 

in a study focusing on synthesis of a biotin-labeled 

peptide, and it was suggested that a new strategy, using Rink 

amide 4-methylbenzhydrylamine resin coupled with Fmoc- 

Lys(Dde)-OH, be used.This strategy can be used for addition 

of a variety of labels other than biotin and should prove useful 

to core facilities. Comparison of the new strategy to 

other strategies was performed. Biotin labeling has long been 

ADDRESS CORRESPONDENCE AND REPRINT REQUESTS TO: Lisa Bibbs, 

The Scripps Research Institute, Core Facility, SP-3, La Jolla, CA 

92037 (email: bibbs@scripps.edu). 

assumed to be routine and specific. Despite the assumed 

routine nature of synthesizing biotinylated peptides, 9 of the 

34 samples submitted did not contain any of the correct 

product. Although synthesis using Fmoc-Lys(Dde)-OH plus 

biotin generally gave the highest yields, other approaches 

also yielded a high percentage of the correct product.Therefore, 

the various strategies are generally comparable. The 

major advantage of this new approach is that other labels 

such as fluorescein, dansyl groups, methyl coumarin, and 

potentially fluorophores and quenchers used for fluorescence 

resonance energy transfer (FRET) can be directly 

incorporated into peptides. (J Biomol Tech 2000;11:155–165) 

KEY WORDS: biotin, labeled peptides, synthesis. 




Two approaches can be used to generate labeled 

peptides: the peptide can be synthesized 

using labeled amino acids, or the label can be 

added after peptide synthesis has been completed. 

When a peptide is labeled after synthesis, there occasionally 

are problems with the location of the label, 

depending on the composition of the peptide. The 

use of labeled amino acids during synthesis usually 

insures the correct positioning of the label. 

The ABRF Peptide Synthesis Research Group 

(PSRG) of the Association of Biomolecular Resource 

Facilities (ABRF) conducts annual studies to help 

member laboratories assess their peptide synthesis 

capabilities. 1 Concurrently, through careful design and 

synthesis of the test sequence, these studies also serve 

as an avenue to introduce new techniques to member 

laboratories. This study focused on the synthesis of 

side-chain–labeled peptides—specifically, a peptide 

with a C-terminal biotin-labeled lysine. Participating 

laboratories were asked to construct the following 

peptide: 

H-Ala-Glu-Lys-Gly-Lys-Leu-Arg-Phe-Lys(biotin)-NH 2 

Although use of Fmoc-Lys(biotin)-OH was an 

obvious choice for direct assembly of this sequence, 


L. BIBBS ET AL. 

one goal of the study was to acquaint member laboratories 

with a flexible strategy that could be used for 

introduction of a variety of different labels other than 

biotin. To make this endeavor especially valuable for 

core laboratories, it was suggested that the new 

approach, based on utilization of a side-chain protected 

lysine residue orthogonal to Fmoc/t-Bu that 

employs Rink amide MBHA resin coupled with Fmoc- 

Lys(Dde)-OH be used. 2 In this approach, first the 

peptide is synthesized, then the label is added for 

coupling to the Lys, followed by cleavage and deprotection. 

Participating laboratories were asked to submit 

the requested peptide without purification. The 

PSRG members used amino acid analysis, capillary 

electrophoresis, reverse-phase high-performance liquid 

chromatography (HPLC), matrix-assisted laser desorption/ionization 

time-of-flight mass spectrometry 

(MALDI-TOF/MS), and electrospray ionization mass 

spectrometry (ESI/MS) to analyze all peptides submitted 

from participating laboratories in addition to a 

test peptide synthesized by the PSRG in preparation 

for the study. In this report, the results from analysis 

of the PSRG test peptide and submitted peptides are 

presented, and the method used by the PSRG for synthesis 

of the test peptide is described. 

METHODS 

Synthesis of the Reference Peptide 

For testing by the PSRG, H-Ala-Glu-Gly-Lys-Leu-Arg- 

Phe-Lys(biotin)-NH 2 was synthesized on an AB 431A 

synthesizer (Applied Biosystems, Foster City, CA). 

Rink amide MBHA resin was coupled with Fmoc- 

Lys(Dde)-OH using HBTU/HOBt/DIEA activation. 3 All 

remaining residues except the N-terminal Ala were 

incorporated as Fmoc-amino acids with the same activation 

chemistry, using Pbf for Arg, Boc for Lys, and 

OtBu for Glu as the side-chain protecting groups. The 

N-terminal Ala was incorporated as t-Boc-Ala. After 

completion of the synthesis, the resin was washed 

twice with N,N-dimethylformamide (DMF). The Dde 

side-chain protection was removed by treatment with 

2% hydrazine (Sigma, St. Louis, MO) in DMF (7 mL/0.1 

mmole of the protected peptide resin; 2 times, 5 minutes 

each). The resin was then washed 3 times with 

DMF followed by 2 washes with DMF:dimethyl sulfoxide 

(DMSO; 1:1, v/v). A 10-fold molar excess of 

biotin (Aldrich, Milwaukee, WI) was dissolved in 5 mL 

of DMF:DMSO (1:1). It was necessary to warm the 

mixture and vortex it for several minutes to dissolve 

the biotin completely. The biotin solution was then 

treated with 2.1 mL of 0.45-M HBTU/HOBt in DMF followed 

by 0.3 mL of diisopropylethylamine (DIEA). 

The activated biotin solution was added to the resin, 


and the mixture was stirred overnight. The resin was 

washed with DMF:DMSO (1:1; 3 times) followed by 

dichloromethane:methanol (1:1; 2 times). After the 

resin was thoroughly dried, the peptide was cleaved 

and deprotected with Reagent-K. 

Amino Acid Analysis 

Crude peptide samples were hydrolyzed for 24 hours 

at 110�C using vapor-phase hydrolysis in 6-N HCl containing 

2% saturated phenol/water. The samples were 

then analyzed by Waters AccQ*Tag chemistry using a 

Waters Alliance HPLC system (Milford, MA) equipped 

with a fluorescence detector. 

High-Performance Liquid Chromatography 

Analyses were conducted on a Waters HPLC system 

consisting of two model 600 solvent delivery systems, 

a Wisp model 712 automatic injector, a model 490 programmable 

wavelength ultraviolet detector, and a DEC 

model 860 Networking Computer to control system 

operation and collect data. HPLC conditions were as 

follows: column, Delta Pak C18 (Waters), 3.9 � 150 

mm, 5 �m, 100 Å; buffer A, 0.1% trifluoroacetic acid 

(TFA) in water; buffer B, 0.1% TFA in acetonitrile; linear 

gradient, 5% B to 60% B in 45 minutes; flow rate, 

1.0 mL/minute; detector wavelengths, 220 and 279 nm. 

Capillary Electrophoresis 

Peptides were analyzed on a PACE-MDQ CE system 

(Beckman Instruments, Palo Alto, CA) using an aminecoated 

capillary and acetate buffer, pH 4.5. The capillary 

was preconditioned with an amine regenerator 

and a buffer rinse. Samples were applied by a 5-second 

pressure injection (2 psi) and separated at 30 kV 

for 10 minutes using reversed polarity. 

Electrospray Ionization Mass Spectrometry 

ESI/MS analyses were conducted on a ThermoFinnigan 

LCQ ion trap mass spectrometer (San Jose, CA). 

Samples were dissolved in 1 mL of water and diluted 

at least 100-fold in 70% aqueous acetonitrile/0.5% 

acetic acid. Peptide samples were introduced into the 

electrospray interface by flow injection at a rate of 

5 �L/minute. MS conditions were as follows: capillary 

temperature, 200�C; spray voltage, 5 kV; capillary voltage, 

30 V; tube lens offset, 18 V; sheath gas, 30 L/min. 

For MS n , the relative collision energy was 35%. Spectral 

averaging for 10 scans was used prior to data 

acquisition.

Matrix-Assisted Laser Desorption Ionization 

Time-of-Flight Mass Spectrometry 

One microliter of a sample solution of approximately 

10 to 50 pmole/�L was combined with 1 �L of 4hydroxy-alpha-cyano-cinnamic 

acid matrix solution 

(Hewlett-Packard, Palo Alto, CA), and the mixture 

was deposited on a stainless steel target (2 spots/sample). 

MALDI-TOF analyses were performed on either 

a Voyager Elite or a Voyager DE-STR mass spectrometer 

(Applied Biosystems) in reflectron mode with 

delayed extraction. A two-point external calibration 

based on angiotensin II (m/z 1046.54, MH � ) and 

adrenocorticotropic hormone (ACTH) 18 to 39 Clip 

peptide (m/z 2465.2, MH � ) was used for the molecular 

mass determinations. Post-source decay (PSD) experiments 

were performed on the Voyager DE-STR. 

Data were acquired in 10 consecutive frames, lowering 

the reflectron voltage by 25% at each step. Air was 

used as collision gas while focusing on the low mass 

region (m/z � 200). The data were smoothed to yield 

mostly average masses. ACTH-Clip peptide was used 

for PSD calibration. 

Sequence Analysis 

Selected peptides were sequenced by Edman degradation 

using an Applied Biosystems model 494 protein 

sequencer and an Applied Biosystems model 

120A HPLC analyzer fitted with a reverse-phase (RP) 

HPLC column. 

RESULTS AND DISCUSSION 

Analysis of the Test Peptide 

The integrity of the reference peptide was confirmed 

by amino acid analysis, capillary electrophoresis, 

Edman degradation, RP-HPLC, MALDI-TOF/MS, and 

STRATEGIES FOR SYNTHESIS OF LABELED PEPTIDES 

FIGURE 1 

Elution position of PTH-Lys(biotin) by 

Edman sequence analysis. The Lys(biotin) 

is well resolved from other amino acids 

and can easily be identified. 

ESI/MS. All analyses gave the anticipated results. As 

shown in Figure 1, PTH-Lys(biotin) was well resolved 

from the other amino acids during Edman degradation 

analysis. 

The ESI mass spectrum of the test peptide is 

shown in Figure 2. Three charge states of the peptide 

were readily detected: m/z 1173.7, [M�H] � , m/z 

587.5, [M�2H] 2� , and m/z 392.1, [M�3H] 3� . The tandem 

mass spectrometry (MS/MS) spectrum obtained 

by collision-induced dissociation of the 2� ion confirmed 

the expected sequence (Fig. 3). 

Analysis of Submitted Peptides 

Thirty-four peptides were submitted in crude form by 

participating laboratories. Eight different methods 

were used for the synthesis. The best crude material 

was found to be 96% pure by RP-HPLC. A summary 

of the analytical data for the submitted peptides is 

presented in Table 1. The following results were obtained: 

1. Nine of the peptides were constructed using a 

prelabeled Lys(biotin), yielding from 0% to 88% 

correct product by HPLC. In three of these peptides, 

the Lys(biotin) was not efficiently coupled. 

2. Eleven laboratories used Fmoc-Lys(Dde)-OH (as 

did the PSRG). Three of these submitted samples 

contained no correct product. One contained the 

Lys(biotin) but was missing the Arg. The other 

two samples contained two biotins. The attachment 

of the extra biotin was the result of the fact 

that Boc-Ala-OH was not employed as the N-terminal 

residue. These last two laboratories also 

used modified biotins. 

3. Nine laboratories used Fmoc-Lys(Mtt)-OH. Of 

these samples, one had no correct product and 

was missing the biotin, and another contained 

only low levels of the requested peptide. For this 

synthesis, the Mtt group must be selectively 



FIGURE 2 

FIGURE 3 

Electrospray ionization mass spectrum of the test peptide,AEGKLRFK(biotin).Three charge states of the peptide 

are readily detected, verifying a molecular mass of 1173 daltons. 

Tandem mass spectrum obtained by collision-induced dissociation of [M�2H] 2�(m/z 587.5) for the test peptide.The 

fragmentation pattern confirms the expected sequence. 

158 JOURNAL OF BIOMOLECULAR TECHNIQUES, VOLUME 11, ISSUE 4, DECEMBER 2000

TABLE 1 

Summary of Results from ABRF Peptide Synthesis Research Group Study 


Percentage 

Mass Spectrometry Data 

Correct Product Major Product 

Other Lys 

RP- Correct Compo- Protec- Cleavage 

Samplea HPLC CE Mass Identity nents tion Biotin Chemistry Instrument Reagent 

1340A 88.9 85.9 Yes Aloc D-Biotin Fmoc/HBTU Rainin 

Symphony 

Modified K 

4761 12.5 31 Yes Multiple Aloc EZ-link 

NHS 9050 

Biotin 

Fmoc Milligen R 

0715 86.4 88 Yes � Lys Biotin Fmoc/PyBOP/ Shimadzu R 

(biotin) HOBt Pssm-8 

1231 82.2 81.7 Yes � Glu, Biotin Fmoc/HBTU/ Rainin Modified B 

� Ala, 

� Lys 

(biotin) 

HOBt Symphony 

1354 54.9 76.8 Yes � Lys Biotin Fmoc/HBTU/ ABI 431 Modified B 

(biotin) HOBt 

4612 28.5 58.9 Yes peptide Biotin Fmoc/HBTU/ ABI 431A B 

�16, 

� Lys 

(biotin) 

HOBt 

8105 0 0 No � Lys Glu-to- Biotin Fmoc/HBTU/ ABI 433A Modified K 

(biotin) 

and Gluto-Gln 

Gln HOBt 

8398A 73.8 80.1 Yes Biotin Fmoc/HATU Rainin 

Symphony 

B 

8583 11.7 12.7 No � Lys Biotin Fmoc/HBTU/ ABI 433A K 

(biotin) HOBt 

MPCF 76.6 83.8 Yes � Pmc Biotin Fmoc/HBTU Rainin 

Symphony 

Modified B 

8398B 59.3 81.7 Yes (Biotin � Extra Biotin Fmoc/HATU Rainin B 

caproate) Lys(biotin caproate Symphony 

caproate) resin 

2958 50.4 47 Yes � 91 Amu, Boc-Lys D-Biotin Boc/HBTU/ AB 430 5 mL HF/ 

possible (2ClZ) HOBt 500 �L 

bzl on Glu Anisole 

0690 61.2 84 Yes (Biotin � Pmc Dde (�)Biotin Fmoc/HBTU/ AB 433A Reagent-K 

caproate) HOBt 

2311 0 0 No � Arg Dde Biotin Fmoc/HBTU/ 

HOBt 

AB 430 Reagent-K 

2913 52.9 71.1 Yes � Pbf Dde D-Biotin Fmoc/HBTU/ AB 431A Modified 

HOBt Reagent-B 

4005 0 0 No 2 Biotin 1902 Dde Biotin-- Fmoc/PyBOP AMS 422 Modified 

caproates b daltons c amido- Reagent-B 

caproate 

NHS ester 

4209D 61.7 65.6 Yes Dde (�)Biotin Fmoc/HBTU ACT Modified 

396MBS Reagent-B 

(continued) 



TABLE 1 

Summary of Results from ABRF Peptide Synthesis Research Group Study (continued) 

Percentage 

Mass Spectrometry Data 

Correct Product Major Product 

Other Lys 

RP- Correct Compo- Protec- Cleavage 

Samplea HPLC CE Mass Identity nents tion Biotin Chemistry Instrument Reagent 

IRBJ 0 0 No 2 Biotinsb Dde Biotin-N- Fmoc/HBTU ACT Modified 

hydroxysuccinimide 

MPS 396 Reagent-B 

1068 84.3 87.2 Yes � Pbf Dde NHS-LC- Fmoc/PyBOP Perseptive Reagent-K 

Biotin Pioneer 

1374 82.8 83.2 Yes � Ala Dde Succin- Fmoc/HBTU/ AB 431 Reagent-R 

imidyl 

D-Biotin 

HOBt 

5130 72.9 82.9 Yes Dde D-Biotin Fmoc/HOBt/ 

DCC 

AB 431A Reagent-K 

5557 96.1 90 Yes Dde D-Biotin Fmoc/HBTU/ 

HOBt 


9818 92.1 92.5 Yes Dde D-Biotin Fmoc/HBTU/ AB 432 Modified 

HOBt Reagent-B 

9453 81.6 81.5 Yes Peptide Fmoc (�)Biotin Boc AB 430 90:10 

� 90 HF:Anisole 

1340T 96 90 Yes MeOtrt D-Biotin Fmoc/HBTU Rainin Modified 

Symphony Reagent-K 

0775 85.1 84 Yes � Biotinb Mtt (�)Biotin Fmoc/TBTU Rainin Modified 

Symphony Reagent-B 

1524 33.7 63.4 Yes (Biotin � Biotin Mtt Sulfo-NHS- Fmoc/TBTU/ Milligen Reagent-K 

caproate) caproate LC-Biotin HOBt 9050 

1609 74.1 66.1 Yes � Biotinb Mtt D-Biotin Fmoc/HBTU/ 

HOBt 

AB 432 Reagent-R 

1633 60 55.8 Yes � Biotin Mtt EZ-link Fmoc/HOBt/ AB 431A Reagent-K 

NHS 

Biotin 

DCC 

3845 0 0 No � Biotin Mtt NHS-LC- Fmoc Opfp/ Milligen Modified 

Biotin HOBt 9050 Plus Reagent-B 

4209M 7 6.8 No � Biotin Mtt (�)Biotin Fmoc/HBTU ACT Modified 

396MBS Reagent-B 

7298 81.2 70.8 Yes � Biotinb Mtt D-Biotin Fmoc/HBTU/ 

HOBt 


7299 89.9 80.8 Yes Mtt D-Biotin Fmoc/HBTU/ 

HOBt 


7347 78 83.5 Yes � Biotinb Mtt (�)Biotin Fmoc/HBTU Perseptive 

Pioneer 

Reagent-B 

aThe samples are grouped according to Lys protection and then listed in numerical order. 

bDid not use Boc-Ala-OH. 

cThe extra mass is on the Lys(biotin) by tandem mass spectrometry. 

�, with and without; CE, capillary electrophoresis; RP-HPLC, reverse-phase high-performance liquid chromatography. 


FIGURE 4 

removed using dilute TFA or acetic acid/trifluoroethanol/methylene 

chloride (AcOH/TFE/DCM). 4 

4. Two laboratories used Fmoc-Lys(Aloc)-OH. One 

of these samples contained multiple components, 

with the product of interest at only 12.5%. For this 

synthesis, the Aloc group must be selectively 

removed using Pd(0),Bu 3 SnH, 5 or Pd(0), HOAc, 

N-methylmorpholine in chloroform. 6 

5. Two laboratories constructed their peptides using 

t-Boc chemistry. In both of these samples, the 

FIGURE 5 


Electrospray ionization mass spectrum of a submitted sample of AEGKLRFK(biotin) in which there was a caproyl 

linker between biotin and the C-terminal Lys.The three charge states detected for this peptide indicated a molecular 

mass of 1286 daltons. 

product of interest was the major component by 

HPLC. 

Overall, nine of the samples did not have the product 

of interest as the major component by HPLC. 

Two types of biotin were used by the participating 

laboratories: biotin and biotin caproate (b-c). The 

caproate arm increased the mass of the correct peptide 

to 1286 daltons (Fig. 4) and caused an extra peak 

in the amino acid analysis corresponding to the 

Amino acid analysis of a peptide constructed with a caproyl linker to biotin. An extra peak was observed at 

28.6 minutes between Met and Lys. 



FIGURE 6 

Elution position of PTH-Lys biotin caproate(Lys(BC)) 

by Edman sequence analysis. 

Lys(BC) was not readily resolved from 

PTH-Tyr using the gradient conditions 

described in Methods. 

derivatized caproate. (Fig. 5) The retention time of 

PTH-Lys(b-c) during Edman degradation analysis was 

within 0.1 minute of that of PTH-Tyr and therefore 

was not well resolved (Fig. 6). 

ESI/MS was a valuable tool in the analysis of 

these crude products. In peptide 8105, ESI/MS and 

subsequent ESI/MS/MS analysis rapidly identified a 

Glu-to-Gln substitution in the peptide in addition to a 

significant quantity of a truncated product (Figs. 7 

and 8). Analysis of this peptide illustrates the fact that 

tandem mass spectrometry can readily identify an 

amino acid substitution that would be undetected by 

amino acid analysis. 

FIGURE 7 


Peptide 8398B was synthesized using a prelabeled 

resin. ESI/MS analysis indicated that, in addition 

to the expected biotin caproate peptide, there was an 

additional product which presumably corresponds to 

the peptide plus an extra Lys(b-c) (Fig. 9). This was 

verified by subsequent MS/MS analysis (Fig. 10). The 

mono-Lys(b-c) peptide constituted 17.5% of the sample 

by RP-HPLC. 

It is interesting to note that a variety of different 

cleavage cocktails were developed in the 1990s. 

These reagents contain different scavengers in TFA to 

reduce side reactions of the reactive cations generated 

from cleaved protecting groups. Reagent-K 

Electrospray ionization mass spectrum of sample 8105 containing a Glu-to-Gln substitution in the requested 

biotin-labeled peptide (A) in addition to a substantial quantity of a truncated product (B).

FIGURE 8 

FIGURE 9 

Tandem mass spectrum obtained by collision-induced dissociation of [M�2H] 2� (m/z 587.0) for the biotincontaining 

peptide in sample 8105 indicating the Glu-to-Gln substitution. 

Electrospray ionization mass spectrum of sample 8398B indicating the presence of peptides containing one (A) 

and two (B) residues of biotin caproate. 



FIGURE 10 

Tandem mass spectrum obtained by collision-induced dissociation of [M�2H] 2� (m/z 877.5) for the (biotin 

caproate) 2 -containing peptide in sample 8398B.The fragmentation pattern verifies the presence of two adjacent 

biotin caproates. 

(TFA-phenol-H 2 O-thioanisole-1,2-ethandithiol 

82.5:5:5:5:2.5), 7 Reagent-B (TFA-phenol-H 2 O-triisopropylsilane 

88:5:5:2), 8 and Reagent-R (TFA thioanisole-1,2-ethanedithiol-anisole 

(90:5:3:2) 9 are the 

most commonly used. Reagent-B is becoming more 

popular because it provides clean, highly efficient 

cleavage and does not contain any malodorous thiol 

components. Forty-one percent of the respondents 

used cleavage Reagent-B for this study. 

The results of this study showed that use of either 

a prelabeled amino acid or resin did not guarantee a 

good product; 37% of the peptides constructed using 

prelabeled starting materials were failures. It is also 

clear that when an Fmoc-Lys(Dde)-OH derivative is 

employed to introduce a label into a peptide, a Boc 

amino acid must be utilized for the N-terminus because 

the 2% hydrazine 3 employed for selective deprotection 

of the Dde group will also remove all Fmoc groups 

on the peptide. Finally, for characterization of synthetic 

peptides, MALDI-TOF/MS and ESI/MS were extremely 

valuable for qualitative, but not quantitative, analysis. 


Considerable potential exists for the use of the 

Rink amide MBHA resin coupled with the Fmoc- 

Lys(Dde)-OH approach for the incorporation of various 

labels into peptides. One new and exciting application 

would be in the synthesis of peptides for FRET. 

FRET is based on the ability of molecules called 

quenchers to block fluorescence when in close proximity 

to fluorescent dyes. FRET has been used for the 

identification of novel proteases. 10 Incorporating a 

fluorophore and a quencher during peptide synthesis 

would avoid labeling and purification problems in 

peptides used for future FRET studies. It is hoped 

that core facilities will be able to make use of this 

strategy. 


We thank all the ABRF core facilities that participated in this 

study and Lynda Bonewald, our ABRF Executive Board liaison, 

for her valuable advice.

REFERENCES 

1. Angeletti RH, Bonewald LF, Fields G. Six-year study 

of peptide synthesis. Methods Enzymol 1997;289:697– 

717. 

2. Blackburn C, Kates SA. Solid-phase synthesis of cyclic 

homodetic peptides. Methods Enzymol 1997;289:175– 

197. 

3. Bycroft BW, Chan WC, Chhabra SR, Hone ND. A novel 

lysine protecting procedure for continuous flow solid 

phase synthesis of branched peptides. J Chem Soc Chem 

Commun 1993;778–779. 

4. Aletras A, Barlos K, Gatos D, Koutsogianni S, Mamos P. 

Preparation of the very acid-sensitive Fmoc-Lys(Mtt)- 

OH. Application in the synthesis of side-chain to sidechain 

cyclic peptides and oligolysine cores suitable for 

the solid-phase assembly of MAPs and TASPs Int J Pept 

Protein Res 1995;45:488–496. 

5. Loffet A, Zhang HX. Allyl-based groups for side-chain 

protection of amino-acids. Int J Pept Protein Res 1993; 

42:346–351. 


6. Kates SA, Daniels SB, Albericio F. Automated allyl 

cleavage for continuous-flow synthesis of cyclic and 

branched peptides. Anal Biochem 1993;212:303–310. 

7. King DS, Fields CG, Fields GB. A cleavage method 

which minimizes side reactions following Fmoc solid 

phase peptide synthesis. Int J Pept Protein Res 1990;36: 

255–266. 

8. Sole NA, Barany G. Optimization of solid-phase synthesis 

of [Ala 8]-dynorphin A. J Org Chem 1992;57:5399– 

5403. 

9. Albericio F, Kneib-Cordonier N, Biancalana S, Gera L, 

Masada RI, Hudson D, Barany G. Preparation and application 

of the 5-(4-(9-fluorenylmethyloxycarbonyl)aminomethyl-3,5-dimethoxyphenoxy)valeric 

acid (PAL) handle 

for the solid phase synthesis of C-terminal peptide 

amides under mild conditions. J Org Chem 1990;55: 

3730–3743. 

10. Olsen MJ, Stephens D, Griffiths D, Daugherty P, Georgiou 

G, Iverson BL. Function-based isolation of novel 

enzymes from a large library. Nat Biotechnol 2000;18: 

1071–1074. 


Research Equipment and 

Resource Requirements of 

NIH-Supported Investigators: 

An Assessment of 

Current Conditions and 

Recommendations for 

Future Funding 

and Programs 

Tamara R. Zemlo, PhD, MPH; 

Howard H. Garrison, PhD; 

David Lester, PhD; Mustafa 

Lokhandwala, PhD; Fred Naider, 

PhD; Stephen White, PhD; 

and David W. Speicher, PhD 

The Federation of American Societies for 

Experimental Biology, Bethesda, MD 

Reprinted with permission from FASEB © 2000. 

ADDRESS CORRESPONDENCE AND REPRINT REQUESTS TO: The Federation 

of American Societies for Experimental Biology, Office of 

Public Affairs, 9650 Rockville Pike, Bethesda, MD 20814-3998 

(www.faseb.org/opar). 


REPORT 

EXECUTIVE SUMMARY 


11:166–176 


In response to a growing level of concern over 

unmet needs for advanced instrumentation, the Science 

Policy Committee of the Federation of American 

Societies for Experimental Biology (FASEB) decided 

to undertake a systematic look at the way in which 

current programs were meeting researchers’ needs 

for major equipment. In November of 1999, a questionnaire 

was mailed to 1,000 recipients of R01 

awards from the National Institutes of Health (NIH) 

to determine the researchers’ views about the following 

issues: degree of dependence on instrumentation; 

current funding arrangements; access to 

equipment; and adequacy of funding for instrumentation, 

particularly the Shared Instrumentation Grants 

(SIG) program; and priorities for future federal funding. 

508 scientists, representing 51 percent of the 

sample, returned completed surveys. Survey respondents 

were similar to all NIH R01 grantees in terms of 

institutional affiliations, experience as principal investigators 

and laboratory budgets. 

There was strong agreement about the importance 

of advanced instrumentation for NIH-funded 

research. Most of the survey respondents (84 percent) 

responded that, “shared equipment and core facilities 

at my institution are extremely important for my 

research.” However, a substantial number of scientists 

reported difficulty in obtaining adequate access to 

these critical technologies. Almost half of the respondents 

(48 percent) felt that their institutions were not 

able to implement new, shared research instrumentation 

and resources in a timely manner. Only a small 

percentage of the respondents (5 percent) were 

strongly supportive of the view that their institutions 

were able to adopt new technologies in a timely 

manner. 

A sizeable portion of the survey respondents also 

questioned the adequacy of current funding for

shared research equipment. When asked if current 

funding for the SIG Program was adequate, 42 percent 

of the respondents responded that it was not. 

A smaller fraction of the respondents (26 percent) 

felt that the current level of support for the SIG budget 

was adequate. Survey respondents expressed 

even more dissatisfaction over the funds available for 

shared equipment not covered by the SIG program 

(instruments costing less than $100,000 involving multiple 

users). In this case, 55 percent of the respondents 

did not believe that “the level of funding support 

from NIH was adequate” and only 17 percent of 

the researchers supported this statement. Consistent 

with these findings, the survey respondents placed a 

high priority on having NIH increase the level of funding 

for research equipment. A majority of them (65 

percent) indicated that increased funding for equipment 

and equipment-related categories should be one 

of the top priorities in an expanding federal research 

budget. In contrast, only 13 percent of the respondents 

disagreed with this position. Consistent with this perception, 

survey respondents also placed a very high 

priority on increased funding for new specialized research 

equipment within their own research laboratories. 

For shared equipment and resources, respondents 

indicated that NIH should invest more funds in 

establishing new resource facilities employing emerging 

technologies. 

The overall perception of the survey respondents 

was that equipment and equipment-related needs 

were unmet and represented a serious problem in the 

extramural research community. Data from the survey 

indicates that NIH should invest additional funds to 

meet these needs. 

RECOMMENDATIONS 

• FASEB recommends that NIH increase its level of 

support for shared equipment costing $100,000 or 

more to $150 million per year for FY2001 with 

appropriate incremental increases thereafter. 


support within the context of existing grant mechanisms 

such as R01s and P01s for equipment costing 

less than $100,000 to $50 million per year for 

FY2001. 

These amounts actually reflect the minimum 

funding requirements that exist in the biomedical 

research community because the survey results were 

extrapolated to only the NIH R01-population and do 

not capture the needs of investigators supported by 

other NIH funding mechanisms or non-NIH funded 

scientists. 

INSTRUMENTATION NEEDS 

FASEB also proposes that an expanded SIG program 

be improved by: 

• Decreasing the time from receipt of application to 

award from the current approximately one year to 

six months. 

• Increasing the number of review cycles from one 

to three per year. 

• Raising the caps to at least $1 million to authorize 

the purchase of more expensive equipment and 

to compensate for inflation pressures. 

• Allowing applicants to bundle two or more unrelated 

pieces of equipment that together cost more 

than $100,000. 

• Providing support for a maintenance agreement 

for up to three years if included in the instrument 

purchase price. 

• Permitting the establishment of facilities using 

components rather than strictly commercial instruments. 

• Using standing rather than ad hoc study sections 

for reviewing SIG grant proposals so that consistency 

in the review process is maintained. 

• Selecting peer reviewers with adequate expertise 

in emerging technologies. 

THE SHARED INSTRUMENTATION 

GRANTS PROGRAM 

For almost twenty years, the Shared Instrumentation 

Grant (SIG) program has allowed scientists to obtain 

equipment and equipment-related items that would 

be too expensive to purchase with research project 

grant funding. In existence since 1982 and administered 

by the National Center for Research Resources 

(NCRR), the SIG program has provided researchers 

with grants ranging between $100,000 to $500,000 to 

procure state-of-the-art instrumentation. Instruments 

purchased with SIG funds must be shared by at least 

three National Institutes of Health (NIH)-supported 

researchers. 

The budgets of the SIG Program have not kept 

pace with the expansion of biomedical research in the 

1990s. SIG awards totaled $32.5 million per year in 

1990 and 1991, with no appreciable growth in program 

funds since 1985. In 1992, SIG funds were reduced 

to $8.8 million and did not rise above $10 million 

per year until 1996. Only in 1999 did the SIG 

budget return to the 1990 level. But the 1999 budget 

for SIG grants ($34.2)—after adjusting for inflation— 

had less purchasing power than the 1990 budget. In 

2000, the SIG budget rose to $43.1 million. But when 

expressed in 1990 dollars ($30.3 million), it is still 

below the purchasing power of the program in 1990. 


FEDERATION OF AMERICAN SOCIETIES FOR EXPERIMENTAL BIOLOGY 

Moreover, during this same period the number of 

research project grants funded by NIH grew from 

23,177 in 1990 to a projected 32,942 in 2000 (42 percent), 

while the research project grant budget increased 

from $4,640 million to $7,103 million in 1990 

dollars (53.1 percent). 1 

THE ORIGIN OF THE STUDY 

Over the past several years, the leadership of the Federation 

of American Societies for Experimental Biology 

(FASEB) and its member societies have been 

hearing reports of unmet instrumentation needs. 

These concerns have been raised in society council 

meetings, in letters from concerned scientists and at 

consensus conferences. The shared instrumentation 

issue has been reviewed in nearly every FASEB Federal 

Funding Consensus Conference from 1993–1999. 

In the face of these persistent but informal indicators 

of a more general problem, the Instrumentation and 

Infrastructure Subcommittee of the Science Policy 

Committee (David Lester, PhD; Mustafa Lokhandwala, 

PhD; Fred Naider, PhD; Stephen White, PhD; and 

David Speicher, PhD, chair) decided to conduct a 

detailed investigation into this issue. Representatives 

of the committee met with Judy Vaitukaitis, MD, 

Director of the NCRR, who provided an overview of 

NCRR initiatives and data on the Center’s programs. 

The committee also collected available information 

on instrumentation assessments conducted by the 

National Science Foundation (NSF) and co-sponsored 

by the NIH. 2 

After reviewing the existing data, the committee 

concluded that there was a shortage of current information 

on investigators’ instrumentation needs. The 

last NSF/NIH instrumentation survey, published in 

1994, was based on the views of institutional administrators 

and did not necessarily reflect the views of 

individual practicing scientists. Another instrumentation 

study, an NCCR-contracted overview of the SIG 

program, was conducted using data from 1993. 3 Due 

to the relative paucity of current data, the committee 

decided to take a more systematic look at the way in 

which current programs were meeting researchers’ 

needs for advanced equipment. 

To derive an objective standard of “need,” the 

committee chose to focus on a major group of scientists 

whose work had already been deemed meritorious: 

recipients of NIH R01 awards. A series of questions 

was developed to determine the researchers’ 

views about the importance of instrumentation, current 

funding arrangements, access to equipment, and 

adequacy of funding for instrumentation and priorities 

for future federal funding. 


This report contains the results of the survey of 

R01 funded investigators. Under the direction of 

David W. Speicher, of the Wistar Institute in Philadelphia, 

PA, and with the collaboration of Tamara R. 

Zemlo and Howard H. Garrison of the FASEB Office 

of Public Affairs, the Instrumentation and Infrastructure 

Subcommittee developed the survey report. The 

FASEB Science Policy Committee reviewed the final 

report. On June 6th the FASEB Public Affairs Executive 

Committee on behalf of the FASEB Board of 

Directors accepted it. 

SURVEY METHODS 

FASEB obtained a file listing the names and addresses 

of all FY 1998 recipients of research project grants 

from NIH. 4 From this file containing the records for 

21,145 R01s awarded to 14,745 investigators, a random 

sample of 1,000 principal investigators was selected. 

In November of 1999, each member of the 

sample was sent a short letter announcing the study. 5 

Two weeks later the NIH-funded investigators 

received a copy of the survey questionnaire asking 

them for their views on the adequacy of federal support 

for instrumentation, the availability of shared 

resources, and their recommendations regarding federal 

funding priorities for equipment. 

Completed surveys were returned by 508 scientists, 

51 percent of the sample when the survey closed 

in February of 2000. Some members of the sample 

(e.g., behavioral scientists, epidemiologists, and some 

clinical researchers) may have not returned questionnaires 

because their research did not make extensive 

use of instrumentation. To address the possibility of 

selection bias in survey responses, characteristics of 

the survey respondents were compared to those of 

the entire grantee population and/or the survey nonrespondents 

on three dimensions: experience as head 

of a laboratory, institutional affiliation and laboratory 

budgets. On all three measures, no evidence of selection 

bias was found. 6 

RESULTS 

Importance of Shared Equipment 

Most of the survey respondents (61 percent) strongly 

agreed with the statement “shared equipment and 

core facilities at my institution are extremely important 

for my research” (Fig. 1). Another 23 percent agreed 

with this statement for a combined total of nearly 

84 percent. This overwhelming appreciation of the 

importance of shared equipment is very notable and

provides a striking endorsement of the role of advanced 

instrumentation in NIH-funded research. 

Access to Equipment 

While NIH-funded investigators reported that shared 

equipment was very important to their research programs, 

large numbers encountered difficulties obtaining 

access to such instrumentation. Only one half of 

the survey respondents felt that their institutions adequately 

supported shared research resources such as 

common use equipment and specialized core facilities 

(12 percent strongly agreed and 38 percent agreed) 

FIGURE 2 

My institution adequately supports shared 

research resources. 

FIGURE 1 


Shared equipment and core facilities are 

essential to my research. 

(Fig. 2). One third of the respondents indicated that 

their institutions have not adequately supported 

shared research resources (12 percent strongly disagreed 

and 21 percent disagreed with the survey 

question). 

A large fraction of the researchers polled (48 percent) 

felt that their institutions were not able to 

implement new shared research technologies and 

required associate equipment in a timely manner (13 

percent strongly disagreed and 35 percent disagreed) 

(Fig. 3). Only 5 percent of the respondents 

strongly agreed and 24 percent agreed with a 

statement indicating that their institutions were able 

to adopt new technologies in a timely fashion. 



FIGURE 3 

New shared resource technologies are 

implemented in a timely manner at my 

institution. 

Funding for Instrumentation 

Substantial numbers of survey respondents expressed 

concern about the adequacy of current funding for 

research equipment. When asked if current funding 

and management of the NIH SIG program was adequate, 

10 percent strongly disagreed and another 

32 percent of the respondents disagreed (Fig. 4). 

Just over one-quarter of the respondents felt that the 

SIG program was adequately funded and managed 

(4 percent strongly agreed and 22 percent agreed). 

The survey respondents expressed even more 

dissatisfaction over the funds available for shared 

equipment costing less than $100,000. In this case, 

55 percent of the respondents disputed the statement 

that the level of support from NIH was adequate: 


17 percent strongly disagreed and nearly two in 

five respondents—38 percent—disagreed (Fig. 5). 

Only 17 percent of the researchers polled strongly 

agreed or agreed with the statement that NIH funding 

for this equipment category was adequate. Results 

were very similar for a question about support 

for equipment used within the researchers’ own laboratory 

costing less than $100,000. Over half of the 

respondents (52 percent) rejected the statement that 

the level of support from NIH for smaller equipment 

for individual laboratories was adequate (Fig. 6). Of 

these respondents, 17 percent strongly disagreed 

and 35 percent disagreed. A much smaller fraction, 

32 percent, reported that funding in this area was 

adequate (28 percent strongly agreed and 4 percent 

agreed). 

FIGURE 4 

NIH’s current level of support and management 

of the SIG program is adequate.

Survey Respondents’ Priorities for 

Federal Funding 

When asked if increased funding for equipment and 

equipment-related categories should be one of the top 

priorities in an expanding federal research budget, 24 

percent strongly agreed and another 41 percent of 

the sample agreed with the statement (Fig. 7). Only 

13 percent of the respondents dissented from this 

position. Consistent with the perception that increased 

equipment funding should be a major priority, a high 

percentage of survey respondents indicated that there 

should be increased funding for new specialized 

research equipment 7 within their own research laboratories 

(Fig. 8). Following this, they identified having 

adequate funds to either replace or purchase new 

FIGURE 6 

NIH’s current level of support for 

equipment in my own laboratory costing 

$5–$100K is adequate. 

FIGURE 5 


NIH’s current level of support for shared 

equipment �$100K is adequate. 

routine use equipment 8 as the next highest set of 

priorities for their own laboratories. For shared equipment 

and resources, respondents indicated that the 

most important priority for government funding 

would be to establish new resource facilities employing 

emerging technologies (Fig. 9). The next most 

important categories respondents believed should 

merit support were purchasing new specialized 

shared equipment and providing adequate technical 

and/or maintenance support for shared resources. 

Survey respondents were asked to specify the 

shared equipment and equipment-related items they 

would need to carryout their research programs 

between 2000 and 2002 (Fig. 10). For items costing 

less than $100,000, PCR systems were identified as the 

greatest unmet need, and for items costing $100,000 



FIGURE 7 

Increased federal funding for equipment 

should be a top priority. 

or more imaging technologies such as ultrasound, 

MRI and CT were identified as the greatest unmet 

need. To estimate the total cost of the annual shared 

equipment needs of NIH investigators, the sum of the 

cost for all the items survey respondents identified as 

necessary for their future research was extrapolated to 

the entire R01 population. The responses were divided 

into two categories: those items costing less 

than $100,000 and those items costing $100,000 or 

more. From information provided by the National 

Center for Research Resources on the average number 

of users for shared instrumentation in the SIG program, 

the number of users for each equipment category 

was estimated. 9 From these approximations and 

the survey data, FASEB calculates that approximately 

$75 million annually would be needed to meet the 

equipment and equipment-related needs for those 


items costing less than $100,000, and $150 million 

annually would be needed for those items costing 

$100,000 or more for the next three years. 

CONCLUSIONS 

The overwhelming majority of the respondents to the 

survey of R01 grantees indicated that shared research 

resources are important elements of their research 

programs. Yet nearly one half of the respondents 

(48 percent) indicated that their institutions were 

unable to meet their shared equipment needs in a 

timely manner. Nearly two-thirds of the respondents 

reported that increased funding for shared equipment 

should be a top priority in an expanding research 

budget. 

FIGURE 8 

Choices for government-supported 

equipment spending within my laboratory.

FIGURE 9 

FIGURE 10 

Choices for government-supported equipment spending for shared resources. 

Survey Respondents’ Shared Equipment Needs: 

Top Ten Categories Ranked by Cost a 

Rank Order b


These views described above were consistent 

across subsets of the survey sample, reflecting general 

rather than isolated sentiments. Comparisons across 

categories of seniority (number of years in charge of 

a laboratory), primary research institution (medical 

school, university, etc.), research budget, percentage 

of funding from NIH, total cost of equipment or percentage 

of equipment budget from NIH revealed very 

few statistically significant differences of opinions. 

The perception that instrumentation needs were 

unmet and represented a serious problem was widespread 

and pervasive in the extramural research community. 

It was not a phenomenon limited to newer 

investigators, scientists with smaller grants, or researchers 

with modest equipment budgets. 

FASEB RECOMMENDATIONS 

FASEB recommends that NIH significantly increase 

resources to meet the equipment and equipmentrelated 

needs of the researchers it funds. While it 

believes NIH’s foremost obligation is still to support 

investigator-initiated research, FASEB recognizes that 

having access to the appropriate equipment is essential 

for conducting investigator-initiated research. 

These research tools include routine-use items like 

incubators and centrifuges and specialized equipment 

like micro array instruments and x-ray diffractometers. 

Bioinformatic hardware and software packages are 

also important to fund since they interface multiple 

high-tech pieces of equipment and store and process 

large volumes of data. To catalyze the pace of discovery 

in biomedicine, NIH should provide greater 

opportunities for SIG program funding. This critical 

infusion of support will maximize the rate of return 

on our investment in scientific research. 

• FASEB recommends that NIH increase their level 

of support for shared equipment costing $100,000 

or more to $150 million10 per year for FY2001 

with appropriate incremental increases thereafter 


support within the context of existing grant mechanisms 

such as R01s and P01s for equipment costing 

less than $100,000 to $50 million11 per year 

for FY2001. 

In this era of enhanced support for biomedical 

research, FASEB recommends that NIH equipmentfunding 

mechanisms be substantially expanded to 

provide for a broader range of new technologies in 

order to make the most of promising research opportunities. 

A greatly expanded and more responsive SIG 

program would allow scientists to procure necessary 

equipment in a timelier manner. To help achieve 


these objectives, FASEB proposes that the program be 

improved by: 

• Decreasing the time from receipt of application to 

award from the current approximately one year to 

six months. 

• Increasing the number of review cycles from one 

to three per year. 

• Raising the caps to at least $1 million to authorize 

the purchase of more expensive equipment and 

to compensate for inflation pressures. 

• Allowing applicants to bundle two or more unrelated 

pieces of equipment that together cost more 

than $100,000. 

• Providing support for a maintenance agreement 

for up to three years if included in the instrument 

purchase price. 

• Permitting the establishment of facilities using 

components rather than strictly commercial instruments. 

• Using standing rather than ad hoc study sections 

for reviewing SIG grant proposals so that consistency 

in the review process is maintained. 

• Selecting peer reviewers with adequate expertise 

in emerging technologies. 


The FASEB Office of Public Affairs wishes to thank the 

members of the Instrumentation and Infrastructure Subcommittee 

of the Science Policy Committee for the valuable 

time they devoted to this report. 

The FASEB Science Policy Committee 

David L. Brautigan, Ph.D., Center for Cell Signaling, University 

of Virginia. (FASEB Vice President for Science 

Policy) 

Joseph R. Haywood, Ph.D. Professor, Department of Pharmacology, 

University of Texas Health Science Center. 

(American Physiological Society) 

Frederick Grinnell, Ph.D. Professor, Department of Cell 

Biology and Neuroscience, University of Texas Southwestern 

Medical Center. (American Society for Biochemistry 

and Molecular Biology) 

*Mustafa F. Lokhandwala, Ph.D. Dean and Professor, 

Department of Pharmacology, University of Houston 

College of Pharmacy. (American Society for Pharmacology 

and Experimental Therapeutics) 

Richard G. Lynch, M.D. Professor and Head, Department 

of Pathology, University of Iowa College of Medicine. 

(American Society for Investigative Pathology) 

Patsy M. Brannon, Ph.D. Dean, College of Human Ecology, 

Cornell University. (American Society for Nutritional 

Science) 

Jeffrey A. Frelinger, Ph.D. Kenan Professor and Chairman, 

University of North Carolina, Chapel Hill. (The 

American Association of Immunologists) 

Samuel C. Silverstein, M.D. Professor and Chairman, 

Department of Physiology and Cell Biophysics, Colum-

FIGURE 11 

Distribution of NIH Research Project Grants by Institution, 1998 

bia University College of Physicians and Surgeons. 

(American Society for Cell Biology) 

*Stephen H. White, Ph.D. Professor, Department of Physiology 

and Biophysics, University of California–Irvine. 

(Biophysical Society) 

*David S. Lester, Ph.D. Pharmacologist, Food and Drug 

Administration. (American Association of Anatomists) 

Tony E. Hugli, Ph.D. Professor, Department of Immunology, 

Scripps Research Institute. (The Protein Society) 

Nicola C. Partridge, Ph.D. Professor, Department of Pharmacology 

and Physiological Science, St. Louis University 

School of Medicine. (The American Society for 

Bone and Mineral Research) 

Edward J. Benz, M.D. Department of Medicine, Johns Hopkins 

University. (American Society for Clinical Investigation) 

Henry M. Kronenberg, M.D. Professor of Medicine and 

Chief, Endocrine Unit, Massachusetts General Hospital. 

(The Endocrine Society) 

Philip R. Reilly, M.D., J.D., President/CEO, Eunice 

Kennedy Shriver Center, Waltham, Mass. (The American 

Society of Human Genetics) 

Associate Members (non-voting) 

Margaret S. Saha, Ph.D. Professor, Department of Biology, 

College of William and Mary. (Society for Developmental 

Biology) 

*Fred R. Naider, Ph.D. Professor, Department of Chemistry, 

College of Staten Island, CUNY. (American Peptide 

Society) 

*David W. Speicher, Ph.D. Professor, The Wistar Institute, 

University of Pennsylvania. (ABRF) 

Barry R. Zirkin, Ph.D. Department of Biochemistry, Division 

of Reproductive Biology, Johns Hopkins University 

School of Hygiene and Public Health. (Society for 

the Study of Reproduction) 

Thomas B. Knudsen, Ph.D. Professor, Department of Anatomy, 

Jefferson Medical College. (Teratology Society) 

Ex Officio (non-voting) 

David G. Kaufman, M.D., Ph.D. Professor, Department of 

Pathology and Laboratory Medicine, University of 

North Carolina, Chapel Hill. (FASEB President) 


1998 NIH Research Project Grants FASEB Survey 

Institution Number Percentage Dollar, K Percentage Percentage 

Medical School 14,898 54.3% 4,141,424 54.3% 52% 

University 7,661 27.9% 2,129,645 27.9% 37% 

For-Profit 103 0.4% 28,632 0.4% 1.1% 

Hospital 2,157 7.9% 599,614 7.9% 2.4% 

Nonprofit 2,641 9.6% 734,159 9.6% 7.5% 

Totals 27,460 100.0% 7,633,474 100.0% 100% 

Distribution of NIH research project grants by institution, 1998. 

Sue P. Duckles, Ph.D. Professor and Associate Dean, Department 

of Pharmacology, University of California– 

Irvine College of Medicine. (FASEB Vice-President Elect 

for Science Policy) 

Mary J.C. Hendrix, Ph.D. Professor and Head, Department 

of Anatomy and Cell Biology, University of 

Iowa—College of Medicine. (FASEB President Elect) 

Sidney H. Golub, Ph.D. (FASEB Executive Director) 

*Members of the Instrumentation and Infrastructure Subcommittee. 

ENDNOTES 

1. NIH Competing and Noncompeting Research Project 

Grants by Type at http://silk.nih.gov/public/cbz2zoz. 

@www.trends99.rpgtype.fy9099.html and FY2001 President’s 

Budget Press Briefing at http://www4.od.nih.gov/ 

ofm/budget/fy2001Pressbriefing.htm 

2. The National Survey of Academic Research Instruments 

and Instrumentation Needs (Instrumentation Survey) is 

a congressionally mandated program that collects data 

concerning scientific research instruments and the academic 

departments and facilities in which they are located. 

3. Evaluation of NIH Shared Instrumentation Grant Program: 

Reports From Users, published in 1996. 

4. The authors would like to thank Bob Moore of the NIH 

Office of Extramural Research for assistance in obtaining 

information on NIH R01 recipients. 

5. Bohne Silber and colleagues at Silber & Associates, 

Clarksville, MD conducted the survey and data tabulation. 

6. The respondents’ primary professional appointment 

and their annual direct cost laboratory budgets corresponded 

closely with the profile of the NIH R01 population. 

Just over one-half of the survey respondents 

(52%) reported that their primary appointment was in 

a medical school. A nearly identical fraction of all 

research project grants from the NIH (54%) were made 

to investigators with medical school affiliations (Fig. 

11). There is a slight over-representation of universitybased 

researchers in the survey respondent sample, 

but in all other categories the distribution of survey 



respondents is very similar to that of all NIH grantees. 

The over-representation of university-based researchers 

in the survey sample may reflect the fact that this group 

was selected only from the population of R01 grantees 

rather than recipients of all types of research project 

grants. 

The median direct cost laboratory budget for the survey 

respondents is $300K. By taking the median direct 

cost of all competing R01 awards in FY 1999, which 

was $171K and multiplying it by 1.43 (the average 

number of R01s per laboratory) and dividing it by 77% 

(the average percentage of the direct cost budget from 

NIH), one can obtain an estimate of the direct cost laboratory 

budget for NIH R01-supported investigators. 

This amount is $319K, which compares reasonably 

with the $300K amount from the survey. 

It was also possible to compare the survey respondents 

and non-respondents in terms of the length of 

time a particular R01 award was retained. Each NIH 

grant is assigned a unique identification number, part 

of which consists of a “year of support” field. This field 

indicates the number of continuous years of support 

for that grant. For survey respondents, the distribution 

was 54% for R01s held for less than five years, 25% for 

R01s held between five and ten years, and 21% for 

R01s held for greater than 10 years. For the nonrespondents, 

these percentages were 54%, 28% and 

18%, respectively. [If an investigator had multiple R01 

grants, only the longest-held grant was used in the 

analysis.] 

7. Specialized equipment refers to instruments found in 

limited numbers in a department or entire institution. 

Examples are biosensors, cell sorters, mass spectrometers, 

NMR instruments, confocal microscopes, biomedical 

imagers, DNA sequencers, X-ray diffractometers, 

analytical ultracentrifuges, microarray instruments and 

bioinfomatics hardware/software. 


8. Routine use equipment is common research equipment 

items typically found in most labs and/or departmental 

common use rooms. Examples are tissue culture hoods 

and incubators, preparative centrifuges, UV spectrophotometers, 

scintillation counters and freezers. 

9. From the Evaluation of NIH Shared Instrumentation 

Grant Program: Reports From Users (NCRR), the average 

number of major users per instrument is 5.2. A 

major user is defined as a Public Health Service (PHS)supported 

investigator who accounts for a significant 

fraction of instrument use time. The average number of 

minor users per instrument is 9.0. A minor user may be 

either PHS-sponsored investigators whose individual 

share does not constitute a significant percentage of 

average use time, or investigators whose instrument 

research is not supported by PHS. Because most of the 

instruments costing $100,000 or more will likely be 

shared, the committee assumed that the number of 

users should be a minimum of five and a maximum of 

fourteen (five major users and nine minor users). However, 

it is unlikely that all of the minor users would be 

R01 recipients. Therefore, the committee estimated ten 

users (five major users and five minor users) for instruments 

costing $100,000 or more. For instruments costing 

less than $100,00, some instruments would be 

shared and some would not be, so the committee estimated 

that the average number of users is approximately 

five. 

10. Since funding for high-end equipment (instrumentation 

costing more than $100,000) is extremely limited, 

FASEB recommends that NIH provide funding for the 

total estimated need of the research community: $150 

million. 

11. For equipment costing less than $100,000 (for which 

there are other sources of support) FASEB recommends 

that NIH fund two-thirds of the $75 million estimated 

need: $50 million.

BOOK REVIEWS 

Amino Acid Analysis Protocols. Edited by Catherine Cooper, 

Nicolle Packer, and Keith Williams. Methods in 

Molecular Biology series number 159.Totowa, NJ: Humana 

Press, September 2000. Hardcover, 280 pp, $84.50 

US. 

This volume is what the title states; it is intended 

as a benchtop reference that provides recipes and 

procedures for amino acid analysis. An introductory 

chapter by Margaret Tyler provides guidance to the 

topics found among the 17 other chapters of the 

book. Of these, several focus on standard amino acid 

analysis strategies commonly found in core facilities: 

postcolumn ninhydrin and AQC (AccuTag). The former, 

by Macchi and colleagues, is focused on modifications 

that occur (at low levels) during protein 

expression in a pharmaceutical setting. Here the ninhydrin 

system is well suited to resolving minor components 

(e.g., norleucine, hydroxylysine, amino sugars, 

and carboxmethylCys) amidst the high levels 

analyzed. One useful feature of this article is a clear 

illustration of typical (Excel) spreadsheet calculations 

employed to obtain protein amino acid compositions. 

The article on AQC by S. A. Cohen is clear and helpful, 

particularly in providing the buffer recipes for the 

analysis using Waters’ proprietary column. Shindo and 

colleagues describe an application of AQC analysis to 

identify blotted protein using the ExPASy Web Site. 

The authors correctly emphasize the need for good 

hygiene in sample handling and provide diagrams for 

an isolation box and their version of a hydrolysis 

vessel. In several places, the reader is reminded that 

desalting protein samples is important for accurate 

compositional analysis. To address this issue, there is 

a brief contribution from Zhang and Denslow that 

details simple desalting protocols. 

Phenylisothiocyanate (PITC) as detection reagent 

is discussed in comparison with new reagents and in 

the analysis of complex biologic matrices. Woo presents 

a comparison between butyl-isothiocyanate– 

(BITC-) and benzyl-isothiocyanate– (BZITC-) derivatized 

amino acids and the familiar PITC approach. 




The primary motive was to shorten analysis time and 

increase convenience by finding a volatile reagent. In 

contrast to PTC chromatography, both BITC and 

BZITC compounds provide separation of cysteine 

and cystine. Although BITC possessed the desired 

volatility, resolution on-column suffered (i.e., benzylthiocarbamyl 

[BTC]-Asn and BTC-Ser co-eluted) 

and sample stability was only about 8 hours. The 

BTC derivatives appeared to provide superior resolution 

in the same system relative to PTC compounds, 

but the volatility of the reagent was similar to PITC. 

It would be surprising indeed if laboratories abandoned 

the established PITC reagent in favor of a new 

reagent to gain incremental advantages, particularly 

because the authors admit that analysis of cysteine 

and cystine is undependable without prior derivatization 

of thiols to stabilize them. Stark and Johansson 

discuss PITC analysis in the context of lipid-containing 

samples. 

Two chapters provide examples of electrochemical 

detection. One of these, by Jandik and colleagues, 

competently discusses integrated pulsed amperometric 

detection (IPAD) coupled to ion-exchange chromatrography, 

which is widely used for carbohydrate 

analysis. The balance of the chapters discuss techniques 

that diverge from the norm, either in instrumentation 

or sample source. Instrumentation and detection 

strategies include a quick, universal approach 

using Marfey’s reagent, the amperometric methods 

noted previously, capillary electrophoresis detection, 

precolumn and postcolumn OPA, and elegant flame 

photometry/gas chromatography techniques (used for 

analysis of O-phospho-amino acids and thiol-amino 

acids). Among this last group of chapters, analysis of 

blood plasma, foods, and modified amino acids are 

the predominent subjects. The final chapter on protein 

glycation products introduces mass spectrometry 

as the detection device and provides a concise introduction 

to this side reaction. 

Although the chapters present disparate approaches 

to amino acid analysis, editorial consistency 

is maintained through the use of extensive footnotes 

that, in many cases, provide useful general information. 


BOOK REVIEWS 

It may be in these details that the book will serve the 

widest audience by suggesting specific reagents and 

protocols. Generally, more specialized topics have 

been emphasized in this volume; readers seeking background 

or introductory information will find copious 

references to earlier literature. Conversely, those con- 


cerned with problematic amino acid analyses, such as 

complex biologic samples or posttranslational modifications, 

will want to mine this volume for helpful 

insights and sample-handling tips. 

Reviewed by Alan Mahrenholz

MESSAGE FROM THE 

EXECUTIVE BOARD 

ABRF Annual Meetings 

ABRF2001, to be held February 24 through 27 in San 

Diego, California, is fast approaching. Paul Tempst 

and David Schwartz have put together an exciting 

program. Plenary speakers include Ronald Evans, 

Roger Brent, Andrew Marks, Allan Wolffe, and Roger 

Kornberg. Considerable interest has been expressed 

in John Quakenbush’s pre-meeting course on microarray 

analyses. The ABRF Award Recipient this year is 

Csabo Horvath. He is being recognized for his accomplishments 

in the development of High-Pressure 

Liquid Chromatography, which is essential for many 

of our technologies. Mark your calendars for ABRF 

2002, to be held March 9 through 12 in Austin, Texas. 

Plans are being made to incorporate proteomics as a 

major theme. 

Research Group Studies 

The Research Group Guidelines are being revised for 

presentation at the Research Group Chairs–Executive 

Board meeting at ABRF 2002. The following is a suggested 

timeline: 

January 

Recruit new members for the committee, 

Executive Board approval of new members 

ABRF Meeting 

Old and prospective new members meet at 

the conference 

Poster presentation 

Final manuscript due 

March 

Elect new chair for group. 

June 1 

New research project defined and submitted to 

the Executive Board (may be a 2-year study, 

but must be in proposal) 

NEWS 

EVENTS 

June/July 

Project details finalized 

September 1 

Study disseminated 

November 1 

Data in 

November–January 

Data analyzed and manuscript drafted; poster 

should be derived from manuscript 

It has also been suggested that the following 

points be included: that the September issue of JBT be 

dedicated to Research Group studies, that members 

be recruited based on writing skills as well as technical 

skills, that studies be designed for introduction of 

new techniques and assessment of a laboratory performance, 

and that more challenging studies be 

designed for those who have the appropriate facilities 

and equipment. The focus of the latter group would 

be on cutting-edge technology. The Executive Board 

welcomes additional comments and suggestions for 

the Research Group Guidelines. 

JBT and HighWire 

& 

Ralph Bradshaw, chair of the Publications Committee, 

has been instrumental in promoting JBT online 

through HighWire. HighWire was recommended 

because of their vast stable of journals, including the 

Journal of Biological Chemistry, among others. ABRF 

members will be able to access HighWire through a 

hyperlink on our Web Site. ABRF members will also 

be able to view abstracts or contents of all other High- 

Wire journals. Members will use a password for 

access to the articles in JBT. JBT articles will be available 

online prior to print publication, allowing faster 

dissemination of information. 

New Editor-in-Chief Sought for JBT 




Clayton Naeve has announced his resignation as 

Editor-in-Chief of JBT. Clayton’s enthusiasm and drive 

have been responsible for the establishment of JBT as 

a new vehicle for the growth of knowledge in the 


NEWS & EVENTS 

field of biotechnology and as a mouthpiece for ABRF 

in the larger scientific community. He will be keenly 

missed by all associated with the Journal. Both Lynda 

Bonewald, retiring President of ABRF, and Mark 

Lively, incoming President, have expressed their gratitude 

to Clayton for services to the Society. The Publications 

Committee, chaired by Ralph Bradshaw, is 

seeking nominations from the membership of ABRF 

for a new Editor-in-Chief, and asks that these be sent 

in writing to Ralph at rablab@uci.edu. 

Dave Speicher will join Clive Slaughter as the 

newest Associate Editor for JBT. He and Clive will be 

reorganizing the review process and restructuring the 

editorial board. ABRF members can support JBT by 

submitting their best work to our society’s journal. 

Often, articles published in the field of biomolecular 

techniques present “results” but not detailed methods. 

ABRF members are encouraged to publish articles 

providing detailed techniques in JBT to be referenced 

in other articles. JBT will also publish Research Group 

reports targeted to ABRF members and including current 

and future technologies. 

ABRF Web Page 

Ted Thannhauser, chair of the Web Site Committee, 

has presented a plan to secure bids from commercial 

companies to update our Web Site. A list of desired 

features for the redesigned ABRF Web Page includes 

the following: the Web Site should serve as a window 

to other resources; Research Groups should be able to 

do online updates; there should be hyperlinks to corporate 

sponsors’ sites; and laboratories should be able 

to do online updates of their entries in the “yellow 

pages.” The option of banner advertising to generate 

revenue will be explored. 

New Board Members 

It is with regret that we bid farewell to John Stults and 

Karen DeJongh as they rotate off of the Executive 

Board as of January 1, 2001. John has provided insight 

and wisdom concerning ABRF operations in his usual 

quiet yet effective manner. Karen has been absolutely 

invaluable as treasurer of the organization and leaves 

this position with ABRF in good financial shape. Laurey 

Steinke will assume the Treasurer’s position, and 

Mark Lively will become President. We are looking 


forward to the participation of our newest board 

members, Ted Thannhauser and Preston Hensley. 

ABRF/ASBMB JOINT SYMPOSIUM 

The ABRF/American Society of Biochemistry and Molecular 

Biology (ASBMB) Joint Symposium will be 

presented at the 2001 ASBMB Annual and Satellite 

Meetings held in conjunction with Experimental Biology 

2001, to be held March 31 through April 4 in 

Orlando, Florida. This is a continuing series sponsored 

by both ABRF and ASBMB. The goal of these 

joint symposia is to bring emerging technologies to 

biochemists and molecular biologists, who can then 

use the new techniques in their research programs. 

“High-Throughput Genomic Technologies: Decisions 

Based on Science and Reality” is scheduled for 

9:45 A.M. on Wednesday, April 4. Michael R. Sussman, 

Director of University of Wisconsin Biotechnology 

Center, and Ronald L. Niece, Research Resources and 

Technologies, organized the symposium, which covers 

several different applications of developing technologies. 

The symposium includes an introduction 

highlighting the role of resource laboratories in contemporary 

research and illustrating how the instrumentation 

and experience of the core laboratory can 

expedite research programs. Dr. Sussman will discuss 

progress in the development of saturation 

reverse genetics using knockout plants and will 

describe a maskless array synthesizer for producing 

high-density DNA oligonucleotide arrays “on the fly.” 

Hundreds of thousands of lines can be screened for 

knockout plants for any gene of interest. Combinatorial 

chemistry comes to the laboratory benchtop in 

the form of high-density oligonucleotide arrays. Dr. 

Smith addresses the problem of complexity in mass 

spectral data. His laboratory’s approach is to reduce 

complex spectra by controlling the charge state of the 

ion to a small number. Using electrospray ionization 

and an orthogonal time-of-flight mass spectrometer, 

the aerosol is exposed to a bipolar ionizing gas. In 

mixtures of proteins or nucleic acids, spectra are simplified 

and chemical noise minimized.

AMINO ACID COMPOSITION AND 

SEQUENCE ANALYSIS 

Sechi S, Chait BT.A method to define the carboxy terminal 

of proteins. Anal Chem 2000;72:3374–3378. 

Proteins are first digested with lysylendopeptidease. 

Anydrotrypsin, a catalytically inert derivative of 

trypsin in which serine-195 is converted to dehydroalanine, 

is used to bind peptides containing a 

lysine (or arginine) residue at their C-termini. The 

peptide derived from the C-terminus of the intact protein, 

lacking a C-terminal lysine or arginine, is not 

retained by anhydrotrypsin and is collected for subsequent 

analysis. Matrix-assisted laser desorption/ionization 

(MALDI) is used to identify the peptide, and 

tandem mass spectrometry is used to sequence it. 

CARBOHYDRATES AND 

GLYCOPROTEINS 

Charlwood J, Skehel JM, Camilleri P.Analysis of N-linked 

oligosaccharides released from glycoproteins separated 

by two-dimensional gel electrophoresis. Anal Biochem 

2000;284:49–59. 

Protocols are described for analysis of N-linked 

carbohydrates on glycoproteins that have been sub- 

ARTICLE 

WATCH 

This column highlights recently published articles that are of interest to the 

readership of this publication. We encourage ABRF members to forward 

information on articles they feel are important and useful to Clive A. Slaughter, 

St. Jude Children’s Research Hospital, 332 North Lauderdale Street, Memphis, 

TN 38105-2794; Tel: (901) 495-4844; Fax: (901) 495-2945; email: clive.slaughter@ 

stjude.org; or to any member of the editorial board. Article summaries reflect the 

reviewers’ opinions and not necessarily those of the Association. 

jected to two-dimensional gel electrophoresis. Glycans 

are released from the proteins by digestion with 

protein N-deglycosidase F (PNGase F), derivatized 

with 3-acetamido-6-aminoacridine, and analyzed by 

matrix-assisted laser desorption/ionization (MALDI)– 

time-of-flight mass spectrometry. Enzymic release of 

the glycan is demonstrated using in-gel digestion of 

the excised gel spot, with or without prior tryptic 

digestion, and also using glycoproteins electroblotted 

to polyvinylidene difluoride membranes. 

PHOSPHOLIPIDS 




Taguchi R, Hayakawa J,Takeguchi Y, Ishida M.Two-dimensional 

analysis of phospholipids by capillary liquid chromatography/electrospray 

ionization mass spectrometry. 

J Mass Spectrom 2000;35:953–966. 

A strategy for analysis of phospholipids extracted 

from cultured cells is described. The strategy uses 

capillary liquid chromatography combined with tandem 

mass spectrometry in a quadrupole mass analyzer. 

More than 500 species of phospholipids are 

included by the method. Positive molecular ions, 

negative molecular ions, positive fragment ions, and 

negative fragment ions are monitored, consecutively, 

in 11-second cycles. Positive molecular ions indicate 

choline-containing phospholipids such as phosphatidylcholine, 

sphingomyelin, lysophosphatidylcholine, 

and phosphatidylethanolamine. Negative 


ARTICLE WATCH 

molecular ions indicate acidic phospholipids such as 

phosphatidylinositol. Positive fragment ions indicate 

diradylglycerol and derivatives of 1-alkyl and 2alkenyl 

cyclic phosphatidic acid from phosphatidylethanolamine 

and phosphorylcholine from cholinecontaining 

phospholipids. Negative fragment ions 

indicate ions from the acyl fatty acid and phosphorylcholine, 

phosphorylethanolamine, and cyclic inositol 

phosphate. 

NUCLEIC ACIDS 

Premstaller A, Oberacher H, Huber CG. High-performance 

liquid chromatography-electrospray ionization 

mass spectrometry of single- and double-stranded 

nucleic acids using monolithic capillary columns. Anal 

Chem 2000;72:4386–4393. 

High-performance liquid chromatography (HPLC) 

columns are most commonly filled with microparticulate 

stationary phases, but these suffer from the relatively 

large void volumes between the packed particles 

and the slow diffusion of solutes into and out of 

the stagnant mobile phase present in the pores of the 

separation medium. These problems are alleviated by 

using stationary phases consisting of a continuous 

rod of rigid, porous polymer with no interstitial volume 

and only internal porosity. This report uses such 

“monolithic” stationary phases, packed into capillary 

columns, to improve the separation of oligonucleotides. 

A mobile phase using 100-mM triethylammonium 

acetate as an ion pairing reagent is employed, 

and elution is performed with a gradient of acetonitrile. 

The method is adapted for online electrospray 

mass spectrometry by using 25-mM triethylammonium 

bicarbonate as the ion pairing reagent, with only a 

small reduction in chromatographic performance. 

Acetonitrile is supplied postcolumn to enhance the 

elecrospray process. Good-quality mass spectra of 

femtomole amounts or 3-mers to 80-mers are presented 

showing little cation adduction. Doublestranded 

DNA fragments from 51 to 587 base pairs 

are separated and detected. 

Xu G, Enderle H, Liebich H, Lu P. Study of normal and 

modified nucleosides in serum by RP-HPLC. Chromatographia 

2000;52:152–158. 

A high-performance liquid chromatography 

(HPLC) method is employed for separating nucleoside 

mixtures containing both modified and unmodified 

components that are present in serum and urine of 


normal individuals and cancer patients. The method 

uses a KH 2 PO 4 buffer (pH 4.65), and elution is performed 

with a 45-minute period of a gradient of 

methanol. The nucleosides are detected by their absorption 

at 260 and 280 nm. 

Puapaiboon U, Jai-nhuknan J, Cowan JA. Rapid and direct 

sequencing of double-stranded DNA using exonuclease 

III and MALDI-TOF MS. Anal Chem 2000;72:3338–3341. 

A strategy for sequencing double-stranded DNA 

by matrix-assisted laser desorption/ionization (MALDI) 

mass spectrometry is reported. The strategy uses 

exonuclease III to degrade phosphodiester bonds 

from the 3�-end of the double-stranded DNA. The 

enzyme requires the addition of appropriate divalent 

cations. A cation exchange column is then used in 

conjunction with an ammonium citrate additive to 

reduce formation of alkali salt adducts. 

MASS SPECTROMETRY 

Timperman AT,Aebersold R. Peptide electroextraction 

for direct coupling of n-gel digests with capillary LC- 

MS/MS for protein identification and sequencing. Anal 

Chem 2000;72:4115–4121. 

An electrophoretic method for extracting proteins 

from in-gel digests is described for use in mass spectrometric 

protein identification. A small-scale cell is 

fabricated for electroextraction, and peptides are 

trapped on a strong cation-exchange resin housed in 

a fused silica capillary tube. Immobilized in this way, 

they can be stored for several days without loss. The 

design of the system is suitable for direct interfacing 

with capillary liquid chromatography in tandem liquid 

chromatography/mass spectrometry analyses. Significant 

enhancements in sensitivity are realized for 

digests of proteins at the low nanogram level (ie, the 

limits of sensitivity of silver staining). 

Doucette A, Craft D, Li L. Protein concentration and 

enzyme digestion on microbeads for MALDI-TOF peptide 

mass mapping of proteins from dilute solutions. 

Anal Chem 2000;72:3355–3362. 

A method for digesting proteins available in solutions 

of low concentration is presented for the acquisition 

of peptide mass fingerprint data. The protein 

is first concentrated by adsorption to POROS R2 

reverse-phase polymeric beads (Applied Biosystems, 

Foster City, CA). The beads may then be washed to

emove contaminants. The bound proteins are subsequently 

digested with trypsin. The beads retain peptides 

during digestion and may be deposited directly 

on a target for matrix assisted laser desorption/ionization 

(MALDI). On-target washing may also be performed 

to remove substances inhibiting ionization. 

The method provides high-quality peptide mass fingerprint 

data for protein samples of only 100 nM. 

PROTEINS—PURIFICATION 

AND CHARACTERIZATION 

Zuo X, Speicher DW. Quantitative evaluation of protein 

recoveries in two-dimensional electrophoresis with 

immobilized pH gradients. Electrophoresis 2000;21:3035– 

3047. 

Protein recoveries are systematically evaluated at 

the various steps of separation by two-dimensional 

gel electrophoresis using immobilized pH gradients 

(IPGs) for the isoelectric focusing stage. The Multiphor 

and IPGphor systems from Amersham Pharmacia 

Biotech (Uppsala, Sweden) are used for the separation 

of metabolically radiolabeled proteins from 

Escherichia coli. With the Multiphor system, in which 

sample application to the IPG strips and subsequent 

electrofocusing are performed in separate vessels, 

sample application from cups gives better protein 

recoveries than sample loading by IPG rehydration. In 

the IPGphor system, in which sample loading and 

electrofocusing are performed in the same vessel, the 

rehydration method gives better recoveries. In all 

cases, carrier ampholytes in the sample buffer increase 

protein recoveries. Thiourea does not affect 

protein recoveries, but does improve protein resolution 

during electrofocusing. 

Zuo X, Speicher DW. A method for global analysis of 

complex proteomes using sample prefractionation by 

solution isoelectofocusing prior to two-dimensional 

electrophoresis. Anal Biochem 2000;284:266–278. 

Increasing the protein load on immobilized pH 

gradient (IPG) strips in an attempt to improve the 

number of visible spots resolved by two-dimensional 

electrophoresis is limited by the tendency of proteins 

to aggregate or precipitate when high protein loads 

are used, causing smearing in the isoelectric focusing 

dimension. The use of solution-phase isoelectric focusing 

to minimize such smearing is discussed, and an 

isoelectric focusing apparatus for prefractionating proteins 

for this purpose is described. 

ARTICLE WATCH 

Gygi SP, Corthals GL, Zhang Y, Rochon Y, Aebersold R. 

Evaluation of two-dimensional gel electrophoresis-based 

proteome analysis technology. Proc Natl Acad Sci USA 

2000;97:9390–9395 

It is widely assumed that two-dimensional gel 

electrophoresis, coupled with mass spectrometric 

identification of spots, enables a broad coverage of 

the proteome. Consistent with this view is the observation 

that the number of spots observed by twodimensional 

electrophoresis approaches the number 

of proteins predicted for a given organism or tissue. 

This study examines an arbitrarily selected section 

from a narrow pH range (4.9–5.7) two-dimensional 

display of yeast proteins in which more than 1500 

spots are visualized by silver staining. Fifty spots were 

digested with trypsin and analyzed by liquid chromatography 

combined with tandem mass spectrometry, 

and a total of 39 different proteins were identified 

from a region where the yeast genome is predicted to 

encode 57 gene products. However, these represent 

only the proteins predicted on the basis of codon 

usage to be the most abundant. Furthermore, only 14 

of the proteins identified were predicted to appear in 

the analyzed section. Additionally, single genes produced 

multiple spots, and the products of up to six 

genes were found to make up a single spot, presenting 

problems for both quantitative protein expression 

comparisons and database-matching studies. It is concluded 

that the method is unsuited for the analysis of 

low-abundance proteins and that statements about 

the feasibility and straightforwardness of proteome 

analysis based on the two-dimensional electrophoresis 

mass spectrometry strategy should be rethought. 

[This article has also received comment by Smith RD. 

Probing proteomics—seeing the whole picture. Nat 

Biotechnol 2000;18:1041–1042.] 

Ghaemmaghami S, Fitzgerald MC, Oas TG. A quantitative, 

high-throughput screen for protein stability. Proc 

Natl Acad Sci USA 2000;97:8296–8301 

The use of mass spectrometric measurements of 

hydrogen/deuterium exchange to compare the rates of 

denaturation of different but related proteins is 

described. Matrix-assisted laser desorption/ionization 

(MALDI) is employed to measure the rates of exchange 

of amide hydrogen atoms with deuterium in 

solution as a function of denaturant concentration to 

provide a measure of protein stability. The method 

permits large numbers of protein samples to be 

screened in a short time, does not demand that the 

proteins of interest are pure or available in large quantities, 

and is forgiving of the presence of denaturants. 

Mutants of the � repressor are studied to illustrate the 


ARTICLE WATCH 

utility of the method, and the stabilization of maltosebinding 

protein on binding to maltose is also demonstrated. 

MICROARRAYS 

Lee MT, Kuo FC,Whitmore GA, Sklar J. Importance of 

replication in microarray gene expression studies: statistical 

methods and evidence from repetitive cDNA 

hybridizations. Proc Natl Acad Sci USA 2000;97:9834– 

9839 

This study investigates the inherent variability in 

gene expression data and assess the extent to which 

replication in an experiment produces more consistent 

and reliable findings. The results show that any 

single microarray output is subject to substantial variability, 

even though, by design, variability as a result 

of multiple preparations of probe, arrays on different 

slides, or arrays generated at different times is not 

admitted. A single output yields numerous misclassifications. 

Replications are not consistent and therefore 

produce different lists of expressed genes. Modeling 

the random variation in gene expression indicates 

that the probability that mRNA in the sample tissue 


either fails to be represented as probe or fails to 

hybridize to the cDNAs on the slide may be as large 

as 5% (false-negatives). The probability that ghost 

genes are expressed may be as large as 10% (falsepositives). 

When microarray data from several replicates 

are combined, however, a more accurate picture 

of gene expression is produced. It is recommended 

that at least three replicates be included in the design 

of experiments using cDNA microarrays. 

BIOINFORMATICS 

Fenyö D. Identifying the proteome: software tools. Curr 

Opin Biotechnol 2000;11:391–395. 

This article reviews the various software tools that 

are available on the internet for searching protein 

sequence databases using mass spectral information. 

Both peptide mapping data listing the mass values of 

proteolytic peptides and fragment ion data derived by 

collisional dissociation of peptides to yield sequenceinformative 

ions are included. Attention is paid to the 

methods used by the various tools to rank protein 

candidates and the methods by which the quality of 

identifications are assessed.

2001 

DATES TO 

REMEMBER 

Jan 13–18 HPCE 2001, 14th International Symposium 

on Microscale Separations and Analysis, 

Boston, MA. Contact: Joan Oefner, Symposium 

Manager, Rhema Association Management, 

156 South Spruce Avenue, Suite 207A, South 

San Francisco, CA 94080-4556; Tel: (650) 

876-0792; Fax: (650) 876-0793 (email: 

joefner@casss.org). 

Jan 29–30 IBC’s Process Validation for Biologicals, 

San Diego, CA. Contact: Jim Prudhomme, Lifesciences 

Marketing Division, IBC USA Conferences, 

Inc., 1 Research Drive, Suite 400A, 

Southborough, MA 01581. Tel: (508) 616-5550 

X205; Fax: (508) 616-5533 (email: 

jprudhomme@ibcusa.com; URL: 

http://www.ibcusa.com/2532). 

Feb 8–9 IBC’s 9th Annual Conference on Alzheimer’s, 

Atlanta, GA. Contact: Julie Anderson, 

Marketing Manager—Life Sciences, IBC USA 

Conferences, Inc., 1 Research Drive, Suite 400A, 

Westborough, MA 01581. Tel: (508) 616-5550 

X423; Fax: (508) 616-5533 (email: 

janderson@ibcusa.com; URL: 

www.ibcusa.com/2579). 

UPCOMING 

EVENTS 

ABRF members and Corporate Sponsors are encouraged to make announcements 

about pertinent meetings, workshops, etc. that are beneficial to our 

members and open to the public. Send items to be listed to Daniel J. 

Strydom, BioNebraska, Inc., 3820 NW 46th St., Lincoln, NE 68524-1637 (Tel: 

402-470-2100; Fax: 402-470-2345; Email: strydom@inetnebr.com). 




Feb 15–16 IBC’s Chemo * Bio Informatics, 

San Diego, CA. Contact: Jim Prudhomme, 

Lifesciences Marketing Division, IBC USA Conferences, 

Inc., 1 Research Drive, Suite 400A, 


X205; Fax: (508) 616-5533 (email: 

jprodhomme@ibcusa.com; URL: 


Feb 20–23 WCBP 2001, 5th Symposium on the 

Interface of Regulatory and Analytical Sciences 

for Biotechnology Products, Washington, DC. 

Contact: Joan Oefner, Symposium Manager, 

Rhema Association Management, 156 South 

Spruce Avenue, Suite 207A, South San Francisco, 

CA 94080-4556; Tel: (650) 876-0792; 

Fax: (650) 876-0793 (email: joefner@casss.org; 

URL: http://www.casss.org/wcbp). 

Feb 24–27 ABRF 2001: The New Biology: Technologies 

for Resolving Macromolecular Communications, 

San Diego, CA. Contact: ABRF Meeting 

Management, FASEB, Office of Scientific 

Meetings, 9650 Rockville Pike, Bethesda, MD 

20814. Tel: (301) 530-7010; Fax: (301) 

530-7014 (email: marcella@faseb.org; URL: 

http://www.faseb.org/meetings/abrf2001/). 

Feb 26–28 IBC’s Enzyme Technologies 2001, 

San Diego, CA. Contact: Jim Prudhomme, 

Lifesciences Marketing Division, IBC USA 

Conferences, Inc., 1 Research Drive, Suite 400A, 


X205; Fax: (508) 616-5533 (email: 


UPCOMING EVENTS 

jprodhomme@ibcusa.com; URL: 


Mar 6–8 IBC’s Formulation Strategies for Biopharmaceuticals, 

San Diego, CA. Contact: Julie 

Anderson, Marketing Manager—Life Sciences, 

IBC USA Conferences, Inc., 1 Research Drive, 

Suite 400A, Westborough, MA 01581. Tel: 

(508) 616-5550 X423; Fax: (508) 616-5533 

(email: janderson@ibcusa.com; URL: 


Mar 12–16 IBC’s ScreenTech 2001, San Diego, CA. 

Contact: Jim Prudhomme, Lifesciences Marketing 

Division, IBC USA Conferences, Inc., 

1 Research Drive, Suite 400A, Southborough, 

MA 01581. Tel: (508) 616-5550 X205; Fax: (508) 


616-5533 (email: jprodhomme@ibcusa.com; 

URL: http://www.ibcusa.com/screentech). 

Apr 4–6 Conservation Genetics Symposium, 

New York, NY. Contact: Fiona Brady, Center 

for Biodiversity and Conservation, American 

Museum of Natural History, Central Park West 

at 79th Street, New York, NY 10024; Tel: 

(212) 769-5742; Fax: (212) 769-5292 

(email: brady@amnh.org; URL: 

http://research.amnh.org/biodiversity/ 

conservation-genetics.html). 

Jun 9–14 17th American Peptide Symposium, 

San Diego, CA. Contact: Doris Rice. Tel: 

(858) 455-4752 (email: drice@tpims.org; 

URL: http://www.5z.com/aps/).

ABRF 2001 

THE NEW BIOLOGY 

Technologies for Resolving 

Macromolecular Communications 

An International Symposium Sponsored by 

The Association of Biomolecular Resource Facilities 

Town & Country Resort 

San Diego, California 

February 24–27, 2001 


Research•Technology 

Communication•Education 

ABSTRACTS

ABRF 2001 ABSTRACTS 

P1-S 

Compatibility of the RapXtract Dye Terminator Removal Kit with 

purification of sequencing reactions for the applied biosystems 

Prism 3100 Capillary Sequencer. 

A.L. Springer, L.R. Booth, K.A. Hughes, R.J. Kaiser, D.A. Spicer; 

Prolinx, Inc., 22322 20th Avenue SE, Bothell, WA 98021 

Successful automated DNA sequence analysis requires that sequencing reactions 

be purified of excess unincorporated dye terminators. Common methods 

for purifying sequencing reactions involve several steps and require 

processes that are not easily automated. Prolinx, ® Inc. has developed the 

unique RapXtract Dye Terminator Removal Kit for this application that is 

rapid, easy to perform, yields high quality product and does not require modified 

primers. The RapXtract kit uses a magnetic particle format to remove 

dye terminator contaminants by mass action. The protocol has three steps: 

1. Remove storage buffer from particles, 2. Add sequencing reactions and 

mix, and 3. Remove purified extension products. The ABI PRISM 3100 

Genetic Analyzer is a 16-capillary instrument that utilizes technology from 

other ABI capillary sequencers in a medium-throughput format. RapXtractpurified 

samples analyzed on the ABI PRISM 3100 yielded sequences with 

good Phred quality scores and signal strength. The RapXtract kit has been 

optimized to minimize the use of expensive sequencing reagents and can be 

performed on reactions containing as little as 1 �l of Big Dye Reaction Mix 

and as little as 5 �l total volume. The RapXtract kit has been used successfully 

with double-stranded plasmid, PCR product or single-stranded DNA 

templates. RapXtract purification can also be used for dye primer reactions. 

The ease of use and versatility of the RapXtract kit make it a good choice for 

manual or automated purification of sequencing reactions. 

P3-T 

Improved signal strength on ABI Prism 377 DNA Sequencer and 

310 Genetic Analyzer by using a new sequencing run module. 

S-M. Chen, H. Zielke, G. Amparo, S. Spurgeon; Applied Biosystems, 

850 Lincoln Centre Dr., Foster City, CA 94404 

In many sequencing labs DNA sample template quality varies greatly due to 

the diverse sources of these samples and the different DNA preparation 

methods used. This variable DNA template quality results in variable sequencing 

data quality. Many low quality data are associated with low quality 

or quantity of DNA templates. This frequently results in low signal strength 

and low signal to noise ratio. A new sequencing module was developed for 

the ABI PRISM 377 and 310 systems that will generate greater signal strength 

during DATA collection. With the use of this module in data collection we 

were able to improve signal to noise ratio and were able to improve success 

rate in data analysis. 

POSTER ABSTRACTS 


P2-M 

Serial analysis of gene expression using the Applied Biosystems 

capillary electrophoresis platforms. 

K.M. Gunning, B. Nutter, A. Swei, J. Zon; Applied Biosystems, 

850 Lincoln Centre Dr., Foster City, CA 94404 

In today’s genomic environment, the draft completion of the human genome 

has allowed researchers access to a wealth of information with respect to 

gene identity and gene expression profiles. Scientists have developed novel 

ways in which to elucidate this information and SAGE is deemed one of the 

more comprehensive methods available for rapid, detailed analysis of large 

numbers of cellular transcripts. To further enhance the rapidity at which one 

can determine this global gene expression profile, one needs more efficient 

and precise methods for analyzing these transcripts and for assessing their 

abundance. Automated capillary electrophoresis provides a platform whereby 

the sequence of these many transcripts can be determined with speed and 

precision. The ABI PRISM. ® 3700 and the ABI PRISM. ® 3100, the most recent 

addition to the CE family of platforms, provide the SAGE researcher with a 

means by which they can determine quickly and reliably, the transcript 

information necessary to build these gene expression profiles. These platforms 

partnered with the uniformity of signal strength and length of read of 

BigDye Terminators, are the labor saving answer to large scale transcript 

analysis using the SAGE method. We will demonstrate the ease of use and 

flexibility of these platforms as a preferred method for the sequence analysis 

of ditags in the SAGE process. 

P4-S 

Two steps cycle-sequencing improves base ambiguities and signal 

dropouts in certain BigDye DNA sequencing reactions. 

L. Wen; San Diego State Univ., 5500 Campanile Drive, San Diego, 

CA 92182-4614 

The use of automated fluorescent DNA sequencer systems and PCR-based 

DNA sequencing methods play an important role in the actual effort to 

improve the efficiency of large-scale DNA analysis. While dideoxy-terminators 

labeled with energy-transfer dyes (BigDye; PE/ABI) provide the most 

versatile method of automated DNA sequencing, premature terminations 

results in a substantially reduced reading length of the DNA sequence. Premature 

terminations are usually evidenced by base ambiguities and are often 

accompanied by diminished signal intensity after that point. I studied a twostep 

protocol for Taq cycle sequencing using the ABI BigDye terminator for 

reducing premature terminations in DNA sequences. I demonstrated that 

combining the annealing step with the extension step at one temperature 

(60�C) reduces premature terminations in DNA sequences that regularly contain 

premature terminations when the three temperature steps is used. This 

procedure can be significantly improved sequence quality in our core facility. 

Sequence results from initial studies are still forthcoming and will be presented.

P5-M 

Using high speed data collection on the ABI Prism 377XL 

to improve core facility DNA sequencing throughput. 

F. Lach, J. Medalle, M. Randesi, B. Imai; Rockefeller Univ., 

1230 York Avenue, Box 105, New York, NY 10021 

The variety of samples subjected to a core facility presents a challenge when 

it comes to achieving high throughput DNA sequencing. Any given run can 

exhibit different degrees of success based on template type and size, template 

base content and arrangement, primer design, and overall sample quality. 

Although the ABI Prism 3700 DNA Analyzer excels in high throughput 

capabilities, the instrument still requires stricter sample management that is 

harder to achieve in the core facility environment. The ABI Prism 377XL continues 

to be an important resource since it requires less sample stringency 

than the 3700. Modification of the 377XL module parameters and new polyacrylamide 

premixes give the potential for increased sample throughput 

with minimal loss of resolution. This study will investigate the conditions 

required to obtain quality data using the 4X high speed data collection module 

on the 377XL. A data comparison will be made between the 2X standard 

speed and 4X high speed modules using various samples and polyacrylamide 

premixes. 

P7-S 

Automated transfer of DNA sequencing files to an ftp site. 

K.M. Ivanetich, R. Taylor, W. Yan, F. Sandifer, D. Wolber; 

UCSF, Box 0541, San Francisco, CA 94143 

The Organize Samples program has been developed to automate the renaming, 

consolidation, and transfer of sequencing data from Applied Biosystems 

373, 377 and 3700 DNA sequencers directly onto the facility’s ftp site. The 

program accesses (1) information in the Applied Biosystems sequencer’s 

analysis file, (2) the Applied Biosystems Tool Kit, (3) a file containing a list 

of user’s names paired with their laboratory’s principal investigator’s names, 

and (4) the compression program DropStuffit. Using the above, the program 

compresses all sequence files for one user into one document, names the 

document with the user’s name and the date, and places the compressed file 

into the appropriate laboratory’s folder on the facility’s ftp server. The laboratory’s 

folders are password protected. Users can access their laboratory’s 

folder, download the file, and uncompress it with a single click. The result 

is a set of uncompressed files, with one file for each sequence analysis file. 

The uncompressed files are named with the run and lane numbers or coordinate 

and capillary numbers plus the user’s template and primer names. Separate 

sequence text files are handled equivalently by Organize Samples, and 

are differentiated by a “.seq” suffix. Users can access the ftp site and download 

their DNA sequencing data from their own computer 24 hours/day– 

7 days/week. 



P6-T 

Update on the continuation of the DNA Sequencing Research Group 

2000 Study: an evaluation of methods used to sequence and isolate 

bacterial artificial chromosomes. 

T. Thannhauser1, L.S. Hall2, J. Hawes3, T. Hunter4, E. Jackson-Machelski5, K. Knudtson6, D. Leviten7, M.A. Robertson8; 1Cornell Univ., Rm 149 

Biotechnology Bldg, Ithaca, New York 14853-2703, 2Albert Einstein 

Col. of Med., 1695 Poplar Street, NewYork, NY 10464, 3Indiana Univ. 

Sch. of Med., 4Univ. of Vermont, 5Washington Univ. Sch. of Med., 

6Univ. of Iowa, 7ICOS Corp., 8Univ. of Utah 

Recent emphasis on BACs as a primary source of template has created significant 

challenges for those who operate DNA sequencing facilities. Due to 

their large size (80–350 KB) BACs behave differently in sequencing reactions 

than do plasmid clones. To achieve optimal performance, standard sequencing 

reactions have to be modified. Moreover, due to their low copy number 

it is difficult to isolate enough BAC template using standard miniprep protocols. 

Using data submitted to part1 of the original DSRG 2000 BAC study, 

the DSRG extracted a recommended protocol for BAC sequencing and performed 

carefully controlled experiments in an internal study to test the efficiency 

and reliability of the protocol. This protocol was made available 

along with a standard BAC template and primer for testing in the community. 

Part 1 of the study examines the effect of a DSRG recommended sequencing 

protocol on the quality of the results obtained on a standard BAC template 

sent to participating laboratories. The sequencing results are analyzed 

for quality and length of read on the wide variety of instrumention used by 

the DNA sequencing community. The success rate of the standard protocol 

is compared to the internal study results and to the original results where 

applicable. 

Part 2 of the study continues to assess and evaluate the quality of BAC isolation 

methods commonly used in DNA sequencing facilities with the goal 

of providing a recommended isolation protocol. The isolated BAC DNA is 

sequenced using the DSRG recommended protocol. Results will be analyzed 

for quality and length of read on standard instrumentation to determine the 

success of the different BAC isolation procedures. 

P8-M 

Sequencing performance of the ABI Prism 3100 Genetic Analyzer. 

P.A. Baybayan, B. Johnson, K. Roy, R. Pingue, Q. Liwei; Applied 

Biosystems, 850 Lincoln Centre Drive, Foster City, CA 94404 

The new ABI Prism 3100 Genetic Analyzer is the latest addition to the suite 

of capillary electrophoresis platforms offered by Applied Biosystems. This 16capillary 

electrophoresis platform employs complete automation designed to 

meet the demands of mid to high-throughput sequencing and genotyping 

laboratories. 

The ABI Prism 3100 Genetic Analyzer offers flexibility by providing options 

for a variety of applications. In de novo sequencing where throughput, consistency 

and efficiency are important, several arrays (including 36 cm, 50 cm, 

and 80 cm) are available. These arrays require different run parameters and 

therefore, perform differently. The user will have the option to an array 

depending on their requirements (readlength and throughput). In comparative 

sequencing where accuracy and sensitivity are required for the detection 

and identification of polymorphisms, a 36-cm array is sufficient. Here, we will 

present the performance (readlength, accuracy, consistency) of the ABI Prism 

3100 Genetic Analyzer in the area of de novo and comparative sequencing 

and demonstrate how this instrument is the platform to best accommodate 

to your research needs. 



P9-T 

A comparison of alternative methods for sequencing through 

difficult templates. 

D.A. Bintzler, Y. Song; Univ. of Cincinnati, 231 Bethesda Avenue, 

Cincinnati, OH 45267-0524 

Template DNA that has a seventy percent or greater content of guanosine 

and cytosine bases (GC rich) has been a potential problem for automated fluorescent 

DNA sequencing. Two well-known strategies for improving the base 

read length of the GC rich template include the addition of dimethyl sulfoxide 

(DMSO) or betaine to the PCR amplification of the template. Applied 

Biosystems Incorporated (ABI) has offered a third method with dGTP big dye 

chemistry. The dGTP chemistry has been significantly effective for extending 

through templates that contain a chain of ten or more guanosine bases. 

The dRhodamine chemistry (ABI) has also been effective for some problematic 

templates. However, no single method has been effective for all problematic 

templates in this facility. Therefore, research has continued to find an 

alternative method. A PCR additive available from Qiagen, Q buffer, was 

introduced as a potential method for improving the base read length of the 

GC rich template. Preliminary studies showed that Q buffer had improved 

PCR extension through difficult templates that were not successfully 

sequenced with the other methods previously mentioned. However, a thorough 

investigation of the Q buffer compared to DMSO, betaine, dRhodamine 

and dGTP big dye chemistry was required. The results of the investigation 

are reported here. 

P11-M 

Integration of new sequencing technologies into the W.M. Keck 

Biotechnology/HHMI Biopolymer Lab. at Yale. 

K.M. Hager; Yale Univ., 295 Congress Ave., New Haven, CT 06536 

In the past year, we have successfully integrated the Applied Biosystems 3700 

DNA Sequencer into our DNA sequencing service. This machine utilizes 96 

capillaries and a proprietary polymer rather than polyacrylamide slab gels to 

separate fluorescently-labeled DNA termination fragments. Because of 3700’s 

unattended robotic sample loading from as many as four sample plates per 

operator interaction, we have increased the lab’s overall sequencing throughput 

by 25% with no increase in staff and lowered the average sample turnaround 

time. In addition, the 3700’s automation has allowed us to initiate 

Genescan and SNAPSHOT single-nucleotide polymorphism (SNP) detection 

assays as new services. At present, about 75% of our total DNA sequencing 

samples are run on the 3700 with the remainder run on one 377 (slab gel). 

About 2–5% of the samples run on the 3700 give a poor separation and these 

samples are rerun on the 377. Such poor separations are due to either 

improper loading of the separation polymer into the capillary or overloading 

of the capillary with excessive amounts of DNA. On the vast majority of 

runs, our pgem standards yield 650–750 bases of sequence data at �99% 

accuracy (POP-6 polymer). 

Recently, we have begun an evaluation of Pyrosequencing, a non-electrophoretic 

DNA sequencing technology using an enzyme coupled assay 

where light is ultimately generated by luciferase from PPI released following 

nucleotide incorporation (Science 281, pp. 363–364 (1998)). Our initial applications 

for Pyrosequencing will include sequence tag (20–40 base) determination 

and SNP detection. 



P10-S 

Fragment and sequence analysis in Portugal: a survey of facilities 

and applications. 

L.M. Souto; Univ. de Aveiro, Portugal, Departamento de Biologia, 

Universidade de Aveiro, Aveiro, Aveiro 3810 Portugal 

Since 1992, with the first unit of Automated Sequencers starting to work in 

Portugal, a significant improvement in the number of equipments and institutions 

dealing with sequencing and fragment analisys has been registered. 

The leading groups are the forensic institutes which deal with a heavy routine 

work, namely in paternity cases. These groups are using very standardised 

techniques and markers, in accordance to the EDNAP (European DNA 

Profiling Group) and the Portuguese and Spanish Working Group of the ISFH 

(GEPISFH). 

Recently, the universities as well as some private research and diagnostic labs 

began to use DNA Sequencers, opening the spectrum of applications. 

We present in this poster the state of the art of Automated Sequence and 

Fragment Analysis in Portugal and its relationship with other iberian and 

latin-american countries, with a special emphasis onto the forensic genetics 

field. 

P12-T 

Investigation of the entire spectrum of genes induced by staphylococcal 

enterotoxin B in human lymphoid cells using differential 

display-PCR. 

C.A. Mendis, C. Sanchez, R. Das, M. Jett; Walter Reed Army Inst. of Res., 

503 Forney Drive, Silver Spring, MD 20910 

Since its introduction in 1991, Differential Display has evolved into a powerful 

and efficient technique in analyzing differentially expressed genes in 

various cells under altered conditions. Here we used differential display not 

only to screen the entire gene population in human lymphoid cells induced 

by SEB but also to understand the specificity of the expression pattern of 

altered genes by comparing it to the expression by Cholera Toxin (CT). In 

order to approach our goal in a systematic manner as well as to increase the 

efficiency of cDNA product recovery we used a set of arbitrary and anchored 

primers to further subdivide the gene population. Out of the 750 altered 

genes, at least 200 genes showed a SEB specific expression pattern when 

compared to CT exposure. The altered genes were then subjected to a high 

throughput cloning procedure and sequenced. Out of the 250 genes that 

were sequenced, 150 genes matched with available sequences in the Gene 

Bank and EMBL databases. Unique to SEB are genes involved in ancillary 

functions as adhesion molecules, regulators of vascular tone, wound healing, 

inflammation, heat shock, cell death and T-cell proliferation. Altered genes 

that matched with known sequences were verified by northern blots, RT-PCR 

or real time PCR. Genes that were specific for SEB were then placed on glass 

chips for use with other cell lines or to understand the gene expression profile 

of other toxins. In the quest for finding a set of genes that can be used 

as surrogate markers, differential display has shown to be a proven technique 

as it has the capability to look at the whole gene spectrum irrespective of 

wide use or availability of individual genes.

P13-S 

Microsatellite analysis using fluorescent PCR primers synthesized 

in tandem. 

S.L. Wegener, G.J. Wiebe, S. Yu, R.T. Pon; Univ. of Calgary, 

3330 Hospital Drive N.W., Calgary, AB T2N 4N1, Canada 

A new procedure for solid-phase synthesis of multiple oligonucleotides 

linked end-to-end (tandem synthesis) on the same solid-phase support has 

recently been developed in our laboratory. Upon cleavage and deprotection, 

the oligonucleotides are released from each other yielding a mixture of two 

or more sequences in the same solution. This procedure has practical benefits 

for applications requiring large sets of oligonucleotides, especially PCR 

amplification, since the number of individual oligonucleotide syntheses to be 

set-up and the number of individual oligonucleotide samples handled is 

reduced by half. Fluorescently labelled primer pairs for automated genotyping 

are also possible by incorporating a fluorescent dye phosphoramidite 

onto the 5�-end of the terminal oligonucleotide. PCR primer pairs with FAM, 

HEX, and TET fluorescent labels have been prepared by tandem synthesis 

and used to amplify known microsatellite markers from (C57BL/6 � NOD) 

mouse genomic DNA. Automated microsatellite analysis using GeneScan 

and an Applied Biosystems Prisim 377 DNA sequencer was then performed. 

P15-T 

Quality control in a core oligonucleotide synthesis facility. 

R.R. Muhlhauser, C.G. Miller, A. Yeung; Fox Chase Cancer Ctr., 

7701 Burholme Avenue, Philadelphia, PA 19111 

Our facility makes about 400 oligonucleotides each month. For the past 16 

years, we have done quality control on each oligonucleotide prior to delivery. 

Our users do not want the quality of oligonucleotides to ever be a variable 

for troubleshooting in their experiments. Even a failure rate of 1% in 

oligonucleotide synthesis would have caused four experiments to fail each 

month. Such a low rate of synthesis failure is difficult to isolate in a statistical 

approach of quality control by random sampling. Analyzing every 

oligonucleotide also allows us to catch instrument and reagent problems 

more quickly. By analyzing each oligonucleotide immediately after deprotection, 

we reject 1 to 3% of the oligonucleotides we make that do not meet 

our quality standard. These oligonucleotides are resynthesized without delay. 

The oligonucleotide analysis method we use is anion-exchange at pH 12.5, 

using the Mono Q system on an FPLC (Yeung, A. T. and Miller, C. G. Anal. 

Biochem. 187:6675, 1990), assisted by a home-made autosampler and autoinjector. 

At that pH, both n-1’s and deprotection problems are visible. We 

highly recommend this practice because it does not add appreciable expense 

or effort to the cost of the oligonucleotide, but provides the facility personnel 

with assurance in the quality of their products. 



P14-M 

Economical usage of value-added phosphoramidites. 

J.B. Hobbs; Univ. of British Columbia, #237-6174 University Boulevard, 

Vancouver, BC V6T 1Z3, Canada 

A method is described for economical use of value-added (dye, biotin, etc.) 

phosphoramidites. The method was developed on an Applied Biosystems 

380B synthesizer. The amidite is placed in a glass autosampler vial which is 

located in a plastic jacket inside a 10 ml glass vial. The amidite is dissolved 

in situ using a user-variable microdilution adapted from a bottle-change procedure. 

Typically 5 mg. of amidite are dissolved in 100 microlitres of acetonitrile. 

The amidite is used in conjunction with Applied Biosystems LV 

columns and synthesis cycles adapted for use with LV columns which use a 

similar “multiple-coupling” approach to that seen in “LV cycles” on later (392, 

394, etc.) Applied Biosystems synthesizer models. These cycles are also 

described. Good tagging efficiency can be obtained for 40 nmole or 200 

nmole scales using 5 mg. of amidite in this way, and the wastage of large 

quantities of expensive amidites is avoided. While the methods are applicable 

to later model synthesizers, the relatively modest flow rates, gas pressures 

and line volumes of the 380B render it a good platform for processes of this 

type. 

P16-S 

Incorporation of pseudouridine and 4-thio-uridine into RNA 

oligonucleotides using 5�silyl-2�-ACE-orthoester chemistry. 

S.A. Scaringe1, D. Kitchen2, J. Qui2; 1Dharmacon Res. Inc., 

3200 Valmont Road #5, Boulder, CO 80301, 2Dharmacon Res., Inc., 

Boulder 

The ability to incorporate a wide range of modified ribonucleotides into RNA 

oligos is an essential requirement for RNA chemical synthesis methodologies. 

Many modified bases have already been incorporated into RNA oligos using 

5�-Silyl-2�-ACE-orthoester chemistry. We report here the incorporation of 

two more important modified bases, pseudouridine and 4-thio-uridine. 

Pseudouridine was converted from the nucleoside to the protected nucleoside 

phosphoramidite in five steps in 45% overall yield. During synthesis the 

amidite coupled in 99% stepwise yields. The high yields for both the amidite 

synthesis and the oligonucleotide coupling have allowed pseudouridine to 

be incorporated into RNA on a routine basis. For example, a series of RNA 

oligonucleotides containing 1–3 pseudouridines were synthesized to study 

the 1920 loop region of E. coli 23S RNA. 

4-Thio-uridine was incorporated into RNA oligos using the convertible nucleoside 

approach. The protected 4-triazole-uridine phosphoramidite was synthesized 

from uridine in six steps in 32% yield. The amidite coupled in 99% 

yields. Following oligo synthesis the support bound oligonucleotide was 

treated with thioacetic acid, buffered to pH 8.0, for 6 hours at 55�C. The support 

was washed and then treated with 10% DBU methanol at room temperature 

for 24 hours. The oligonucleotide was desalted and 2�hydroxyl 

protecting groups were removed using a pH 3.8 aqueous buffer for 30 minutes 

at 55�C. The resulting oligonucleotides contained 98% 4-thio-uridine at 

the desired position as assayed by anion exchange HPLC analysis. This is significantly 

higher than the results using cyanoethyl protection of 4-thiouridine. 

All oligonucleotides containing 4-thio-uridine clearly exhibited the 

characteristic 330 nm absorption peak. 4-Thio-uridine is now being routinely 

incorporated in RNA oligonucleotides for use in several collaborative 

studies. 



P17-M 

New methods for the synthesis of multiple oligonucleotide 

sequences either singly or linked end-to-end in tandem. 

R.T. Pon1, S. Yu1, Y.S. Sanghvi2; 1Univ. of Calgary, 3350 Hospital Dr. NW, 

Calgary, AB T2N 4N1 Canada, 2Isis Pharmaceut. 

Solid-phase oligonucleotide synthesis requires attachment of the 3�-terminal 

nucleoside to the support, usually through a 3�-ester linkage. Phosphoramidite 

methods for performing this attachment through a phosphate linkage 

on “Universal” supports have been developed. However, these methods 

introduce a terminal 3�-phosphate residue which is difficult to remove. We 

have developed new linker phosphoramidite reagents which eliminate this 

problem by incorporating a cleavable 3�-ester linkage within the linker arm. 

Thus, only products with 3�-OH ends are produced and no extra conditions 

for 3�-dephosphorylation are required. These new reagents provide an alternative 

to our previous method for automated nucleoside attachment using 

HBTU and DMAP (Pon and Yu, Synlett 1999, 1778). The linker phosphoramidites 

are especially suited to high-throughput synthesis in 96-well plates 

since inexpensive, underivatized CPG can be used as a “Universal” support. 

Nucleoside attachment to the 5�-OH group of a prior sequence is also possible. 

This allows multiple oligonucleotides linked end-to end in tandem to 

be prepared in a single synthesis. The linked oligonucleotides are released 

from each other upon cleavage from the support and used together as a mixture. 

Sequences prepared in tandem can be PCR primers, forward and 

reverse sequencing primers, or duplex DNA fragments. The total number of 

bases is only limited by the support’s pore size. We have prepared strings of 

oligonucleotides up to 96 bases long (4 � 24 base primers) and combinations 

of up to ten shorter sequences. 

P19-S 

Production of antigen specific MHC class I tetramers as a core 

facility service. 

P.S. Adams, T.B. Miller, M.J. Dobrzanski, R.J. Hogan, D.L. Woodland; 

Trudeau Inst., 100 Algonquin Avenue, Saranac Lake, NY 12983 

Major Histocompatibility Complex (MHC) Class I tetramers are composed of 

a tetrameric complex of the MHC Class I molecule and a specific antigenic 

peptide. The Class I heavy chain has been modified to contain a BirA 

sequence that allows biotinylation and subsequent tetramerization of the 

complex with a fluorescently tagged strepavidin. These tetramers can be used 

to identify antigen specific CD8� T cells involved in immune responses using 

flow cytometry. The Molecular Biology Core Facility prepares these tetramers 

as a core facility service to aid the researchers at the Trudeau Institute. One 

project involves the characterization of the underlying mechanisms and 

immunoregulatory roles of tumor antigen-reactive Tc1 and Tc2 effector cell 

sub-populations, which can provide insight into the modification and/or 

development of novel immunotherapeutic approaches to disseminated malignancies. 

Another project involving viral immunity has demonstrated that a 

substantial population of antigen specific CD8� T cells can be found not 

only in the secondary lymphoid organs, but also in the peripheral tissues after 

resolution of a primary respiratory virus infection. These data have significant 

implications for vaccines that induce systemic rather than local immunity. The 

production procedure and examples of the usefulness of MHC Class I 

tetramer technology will be presented. 



P18-T 

Performance of high-speed oligonucleotide synthesizer in 96-well 

format. 

D. Luk, A. Tuyet-Doan, S. Hall, J. Koh, R. Guettler; GeneMachines, 

935 Washington St., San Carlos, CA 94070 

Oligonucleotides are essential elements of genomic research. The Poly- 

PlexTM oligonucleotide synthesizer makes 96 different oligos in standard 96well 

format, which is amenable to downstream high-throughput processing 

and handling. Operator time is minimal and synthesis time is less than 3 

hours for a 96-well plate of 20-mers. By eliminating flushing of reagent lines 

through a parallel dispensing technology, optimal synthesis time and reagent 

consumption are achieved. PolyPlex’s low reagent consumption generates 

oligos quickly, at low costs and small scales as low as 10 nmol. Synthesis 

costs, including all consumables, are less than $0.10 per base. The PolyPlex 

synthesis chamber provides an inert-gas environment where synthesis 

progress can be monitored by using full-plate trityl collection after any base 

addition. PolyPlex utilizes fully licensed chemistry and generates oligos with 

greater than 98% coupling efficiency. Versatile, easy-to-use software provides 

powerful synthesis control along with extreme simplicity. 

P20-M 

Advantages of directionally immobilized 6xHis-tagged proteins 

for capture assays. 

K. Steinert, F. Schäfer, S. Wahle, A. Hoffer, P. Söhnlein, J. Ribbe; QIAGEN 

GmbH, Max-Volmer-Strasse 4, Hilden, Nordrhein-Westfalen 40724, 

Germany 

Assay signals and reproducibility can be greatly enhanced by immobilizing 

the assay components in a directed manner. For example, to set up an interaction 

assay it is essential that the immobilization of the capture molecule 

occurs in active conformation to allow binding of the interaction partner. Similarly, 

oriented binding in immunoassays results in optimal accessibility of 

antigenic regions and therefore increased signal strengths. Directed immobilization 

of assay components can easily be achieved by using 6xHis-tagged 

recombinant proteins and immobilizing them via their 6xHis tags. The use of 

this interaction is well established for efficient purification of 6xHis-tagged 

proteins, but is also advantageous for immobilization of recombinant proteins 

in highly sensitive and reproducible protein-based assays. In addition, relying 

on the 6xHis-Ni-NTA interaction for immobilization of assay components 

simplifies assay development, because immobilization conditions no 

longer have to be optimized for each individual protein, but rely on the same 

biochemical characteristics of the 6xHis-Ni-NTA interaction for each protein. 

As an alternative to Ni-NTA, monoclonal antibodies recognizing the 6xHis tag 

can be used for highly specific and oriented immobilization of 6xHis-tagged 

proteins. The effect of specifically oriented binding on assay results is demonstrated 

by comparison of ELISA experiments employing proteins passively 

adsorbed to polystyrene plates and proteins immobilized via their 6xHis tags, 

as well as by a study on the interaction of two chaperones and development 

of a protease assay.

P21-T 

Versalinx chemical affinity tools for purification in protein analysis. 

J.P. Wiley, M.D. Ferguson, A. Gall, K.A. Hughes, G. Li, K.P. Lund, 

M.L. Stolowitz; Prolinx, Inc., Bothell, WA, 22322 20th Ave. SE, Bothell, 

WA 98072-8341 

Fractionating complex biological mixtures is one of the challenges in proteome 

analysis. MALDI-TOF (matrix assisted laser desorption ionization time 

of flight) mass spectrometry analysis, for instance, has a high mass accuracy 

but requires a relatively pure sample for positive structural identification. Prolinx 

® Inc. has developed Versalinx Chemical Affinity Tools, and has demonstrated 

success using this technology to isolate and purify proteins of interest 

from complex mixtures. Versalinx Chemical Affinity Tools are based upon 

the interaction of phenyldiboronic acid (PDBA) and salicylhydroxamic acid 

(SHA) to form a complex that is reversible under certain conditions. Immobilization 

of PDBA-modified proteins can occur on a variety of SHA-modified 

surfaces. The system is stable over a wide pH range and is compatible with 

a number of denaturants, detergents and organic solvents. With Versalinx 

Chemical Affinity Tools, purification of biological molecules is rapid and 

reproducible. 

P23-M 

Detection of residual isopropyl-1-thio-�-D-galactopyranoside 

in proteins by HPLC with pulsed amperometric detection. 

X. Ji, L. Couch, A. Pennetti, K. Venkat, J. Mozdzanowski; SmithKline 

Beecham Pharmaceut., 709 Swedeland Road, King of Prussia, Pa 19406 

Isopropyl-1-thio-�-D-galactopyranoside (IPTG) is an inducer of the lac 

operon and may be used in fermentation processes for the production of protein 

biopharmaceuticals in E. coli. Use of this compound in the fermentation 

process creates the need for the determination of residual IPTG in the final 

product. Chemical and optical properties of IPTG (e.g. absorbance in the UV 

region) do not permit sensitive detection using traditional techniques. Hemiacetal 

group of galactose is substituted by a 2-thiopropyl group and thus 

eliminates an option for simple derivatization reactions leading to fluorescent 

derivatives. IPTG is a sulfur-containing galactoside, and therefore, properties 

of sulfur and sugar may be utilized for electrochemical detection. With this 

mode of detection, residual IPTG can be detected in the presence of high 

concentrations of protein. This required development of a modified HPLC 

separation method permitting the use of high concentrations of acetonitrile 

to remove protein from the column during a wash step. HPLC conditions 

developed for the separation are free from interference with protein and a 

so-called “oxygen dip” typically observed with the gold electrode. The waveform 

developed by William LaCourse for the Dionex electrochemical detector 

(ED-40) with the gold electrode can be used for the determination of 

IPTG at a concentration as low as 0.05 �M (12 ng/mL). 

Reference: 

William LaCourse, Determination of Isopropyl-�-D-thiogalactoside (IPTG) by 

HPLC-Pulsed Electrochemical Detection. Pittcon-2000 presentation. 



P22-S 

Fully automated 96-well protein purification and magnetic beadbased 

assay using 6xHis-Ni-NTA technology. 

K. Steinert, H. Lubenow, S. Wahle, R. Stoll, J. Ribbe; QIAGEN GmbH, 

Max-Volmer-Strasse 4, Hilden, Nordrhein-Westfalen 40724 Germany 

The purification of proteins from expression libraries requires a method that 

performs reliably regardless of the characteristics of the proteins to be purified. 

Using Ni-NTA for purification of 6xHis-tagged recombinant proteins provides 

a one-step purification method that is robust and meets the challenge 

presented by the need to purify thousands of proteins with differing structure 

and characteristics. To allow this method to be performed in highthroughput 

applications, automated protocols were developed which run on 

BioRobot systems. 

Ready-to-run protocols covering a wide range of protein assay and purification 

applications are available. They rely on 6xHis-Ni-NTA technology based 

on the high affinity and specificity of nickel ions immobilized on matrices 

bearing nitrilotriacetic acid (NTA) for recombinant biomolecules with a tag 

of six consecutive histidine residues (6xHis tag). 

Ni-NTA Magnetic Agarose Beads allow flexible interaction or diagnostic 

assays with structurally active immobilized 6xHis-tagged proteins as well as 

micro-scale purification of up to 15 �g of 6xHis-tagged protein. The purification 

and assay protocols based on Ni-NTA Magnetic Agarose Beads may 

even be carried out directly in series. 

If much larger amounts of purified proteins are needed, the Ni-NTA Superflow 

96 BioRobot Protocol provides a convenient high-throughput method 

for purification of approximately 100 �g of 6xHis-tagged protein per well in 

a 96-well format. Examples of purification and assay applications using both 

methods are shown and data on reproducibility and cross-contamination free 

processing are given. 

P24-T 

Construction of a tagging system for subcellular localization of 

proteins encoded by newly discovered open reading frames. 

W-J. Syu; Natl. Yang Ming Univ., 155 Sec 2, Li-Long St., Pai-Tao, 

Taipei, Taiwan 112, Taiwan 

We have previously characterized a monoclonal antibody (SC1D7) that is 

directing to maltose-binding protein (MBP) of Escherichia coli and other 

closely related enteric bacteria. SC1D7 does not cross-react with proteins in 

eucaryotes and appears to be a highly specific tool in immunochemical 

analyses. To better map the epitope, we took advantage of an available plasmid 

pMAL-c2 that encodes E. coli MBP-coding sequence and constructed 

plasmids to express MBP fragments. A construct containing the N-terminal 

portion of MBP does not react with SC1D7 whereas a second construct 

expressing glutathione-S-transferase fused with the C-terminal half of MBP 

does react with SC1D7. To precisely define the epitope, random peptides displayed 

on M13 were used to react with SC1D7. Sequences of reactive peptides 

were aligned, and a consensus sequence of XDXRIPX was deduced. 

This sequence matches to MBP with an amino acid stretch of KDPRIAA. To 

consolidate the mapping result, a sequence encoding this epitope was 

inserted into an expression vector and the resulted recombinant protein did 

react with SC1D7. Thereafter, this epitope was incorporated into an eucaryotic 

expression plasmid that contains a previously defined hepatitis delta 

virus epitope for protein tagging. The so constructed two-epitope-tagging 

vector is useful in various molecular analyses. We demonstrated its usage in 

localization of a bacterial virulence factor in host cells. This vector should be 

applicable for high throughput characterization of new open reading frames 

found in genome sequencing. 



P25-S 

Truncated midkine (tMK): its molecular cloning and expression in 

Escherichia coli, and the detection of native tMK in Wilms’ tumor 

by an anti-tMK monoclonal antibody. 

S. Paul1, W. Dansithong1, T. Mitsumoto1, Y. Asano1, M. Kato2, M. Kato2, T. shinozawa1; 1Gunma Univ., Japan, 1-5-1 Tenjin-cho, Kiryu, Gunma 

376-8515 Japan, 2Tottori Univ., Japan 

Midkine (MK) is a heparin binding growth factor identified as a product of 

a retinoic acid-responsive gene; it is frequently expressed at high levels in 

many human carcinomas. Although the expression of the mRNA encoding 

truncated MK (tMK) in unique human cancer cells has been reported, the 

tMK polypeptide itself has not yet been identified. In order to clarify the biological 

role of tMK, recombinant tMK was expressed in Escherichia coli and 

purified. Purified recombinant tMK showed the same extent of proliferative 

activity for the Wilms’ tumor (G401) cells as full length human MK. A mouse 

hybridoma cell line producing an IgG2b monoclonal antibody (mab) against 

this purified recombinant tMK was also established. This anti-tMK mab 

(MiStMK-V3) did not crossreact with synthetic full length (or c-half) human 

MK. A native tMK, showing the same apparent molecular mass as the recombinant 

tMK in SDS-PAGE, was identified in G401 cells using this mab. These 

results suggest that the structure of the recombinant tMK is same as that of 

native tMK. The expression of tMK in Wilms’ tumor patient specimens was 

also detected in an immunohistochemical study using the anti-tMK mab. The 

usefulness of this mab (MiStMK-V3) for the detection of tMK in Wilms’ tumor 

was demonstrated. 

P27-T 

Performance evaluation of a novel application for comparative 

DNA sequencing analysis and mutation detection. 

C.A. Kosman, L. Johnston-Dow, H. Breu, G. Chappell, S. Kumar, 

B. Iasnopolski, B. Kshirsagar, P.A. Suri, R. Paul, G. Mason, D. Siu, 

E. Sword, M. Schoppe, V. Bawge; Applied Biosystems, 850 Lincoln Centre 

Drive, Foster City, CA 94404 

Various software tools are available for the analysis and interpretation of denovo 

DNA sequencing data. While such applications work well for sequencing 

for discovery many of the underlying assumptions in these tools are not 

valid when applied to comparative sequencing data. 

We have developed a new practical application for comparative DNA 

sequencing analysis. The focus of this new application is the discovery or 

identification of sequence variants in a dataset of sequence derived from a 

single locus in various individuals. This tool allows for the rapid and accurate 

analysis and alignment of multiple sequence comparisons containing 

mixed base positions against a reference sequence. While NT-based, this software 

is compatible with data generated from all of Applied Biosystems 

sequencing platforms (ABI PRISM ® 373, 377, 310, 3100 and 3700). 

This application uses procedures and algorithms better suited to the unique 

nature of comparative sequencing data. Specifically, the prior knowledge of 

a reference sequence available in many comparative sequencing projects is 

used to streamline and automate portions of the analysis. The software performs 

sequence analysis and aligns the analyzed sequence to a reference 

sequence. It also aligns imported sequences that contain variants. It will then 

analyze the compared sequences, provide protein translation and report the 

analysis in a convenient format. 

Here, we present the results from the performance evaluation of this new 

software tool on several types of comparative sequencing datasets. For these 

analyses, this new application produced results concordant with those previously 

obtained using standard DNA analysis tools while providing substantial 

performance advantages over these tools. In all cases the analyses 

were completed in significantly less time and required less manual manipulation 

of the data. The innovative approaches employed in this tool result in 

less user intervention needed to achieve a better level of mutation detection. 



P26-M 

Information management systems for molecular biology. 

T.M. Smith, D. Campbell, R. Connelly, A. Leonard, S.G. Porter, J. Slagel; 

Geospiza, Inc., Seattle, 2442 NW Market St. #344, Seattle, WA 98107 

Technological advances in molecular biology have made it possible for laboratories 

to generate unprecedented amounts of data. DNA sequencing, for 

example, has seen an increase in throughput of over 400-fold in recent 

years. The accelerated production of data has produced a corresponding 

need for better data management. 

The increased need for data management is partly due to institutional 

changes. Many institutions have been able to economize by establishing core 

facilities which offer laboratory services to researchers on a per sample or 

project basis. Core facilities are cost-effective because they provide several 

researchers with access to expensive equipment and skilled personnel. 

Because these core facilities handle a variety of data types and a large number 

of samples from multiple sources, their information management needs 

provide a worthwhile model for laboratory information management systems 

(LIMS). 

LIMS are collections of software, communication devices, and computers that 

acquire, store, analyze, and present data and information about laboratory 

samples and their processing. LIMS centralize data storage, automate data 

analysis, and provide quality assurance reports for process monitoring. The 

central component of a LIMS is a database with software interfaces for entering, 

viewing, and processing information. 

The level of complexity needed in a LIMS depends on factors such as the 

mission of the laboratory, the number of samples to be processed, analysis 

requirements, and workflow complexity. LIMS development presents many 

challenges and may take years to complete. Most labs have no need for a 

custom LIMS and lack the wherewithal to create one, and thus will benefit 

from commercial LIMS 

The general features of LIMS will be presented along with case studies of 

Geospiza’s Finch-Suite LIMS solution illustrating how a commercially available 

software system can be used to meet the information management 

needs of DNA sequencing facilities. 

P28-S 

A Web interface for BioLIMS System—data and user management 

for sequencing core facility. 

L. Liu, L. Roinishvili; Univ. of Illinois, Urbana, 330 ERML, 

1201 W. Gregory Dr., Urbana, IL 61801 

Sequencing core facility serves many customers. Samples in a sequencing 

core facility are very heterogeneous although the volume of samples from 

each customer is relatively small. Data and user management can be a challenge 

task. The BioLIMS database system from PE Bioinformatics provides a 

smooth data flow from sequencer to database. However, it really lacks of 

friendly user interface for both core facility and customers. To provide an 

easy management system for the core facility at the W. M. Keck Center for 

Comparative and Functional Genomics, we implemented a web interface for 

BioLIMS system. This interface serves two purposes in the core facility. One 

is for core facility staff to manage customers and their data. The other is for 

customers to view and retrieve their own data from the web. In customer 

management, we allow super user and sub user relationship. Super user will 

have access to all the data of his or her sub users. In data management, a customer 

can only view and retrieve his or her own data unless others give him 

or her privilege to view their data. The most convenient feature is web 

based. Customers can access their data from anywhere at anytime.

P29-M 

Protein/DNA technology DSL version 2000 is a set of shareware 

protocols for sample and data management. 

J. Medalle, M. Randesi, B. Imai; Rockefeller Univ., 1230 York Ave., 

Box 105, New York, NY 10021 

Physical sample and data management are major concerns for a DNA 

sequencing core facility. Especially one with a small staff and limited space 

are affected the most. Samples can overtake the limited freezer space. Paper 

trail can overfill office and lab spaces. Both can cause a quick turnover of 

DNA sequencing staff. DNA Sequencing Lab’s (DSL) version 2000 objectives 

are to alleviate repetitive computer tasks for DNA Sequencing staff and eliminate 

physical paper trail. DSL 2000 is a set of protocols for sample and data 

management. Its major components are comprised of online submittal forms 

at http://protein13-pc.rockefeller.edu/, scripts from Apple Script, and standardized 

forms and macros from Microsoft Excel 98, and Outlook Express 5. 

The DSL funnels the online sample submissions into sample statements for 

each investigator. This is a file containing sample IDs, names, account numbers, 

primer info, template info, etc. DSL also transforms the web submissions 

into logs for prep and for slab or capillary sequencing reactions. These logs 

direct the staff on how to process incoming samples. The set of protocols 

streamlines the sample flow from the investigator to the machine as well as 

the data flow from machine back to the investigator. DSL’s protocols are 

“hands on” to help the staff create e-mails for investigator notifications and 

“a click of a button” to compress and to transfer investigator’s sample statements 

or data files into their web account. DSL 2000 is a freeware application 

and can be integrated into other small core facilities with a limited budget. 

P31-S 

The analysis of complex tryptic peptide mixtures by multidimensional 

LC-MS/MS on a hybrid quadrupole orthogonal 

acceleration time-of flight (Q-TOF) mass spectrometer. 

A. Millar1, C. Hughes1, T. Andresson2, T. Hemesath2, J.I. Langridge1; 1Micromass UK Ltd., Floats Road, Wythenshawe, Manchester M23 9LZ, 

United Kingdom, 2deCODE genetics Inc., Reykjavik 

Advances in both HPLC and mass spectrometry instrumentation have allowed 

the analysis of protein complexes which have not been separated on a two 

dimensional gel. These experiments involve separation of the complex digest 

mixture by microcapillary liquid chromatography connected to an instrument 

capable of data directed switching between the MS and MS/MS modes. Protein 

identification is then achieved via databank searching of the ESI-MS/MS, 

providing qualitative information on the proteins that are present. Hundreds 

of MS/MS spectra can be acquired in a fully automated fashion, resulting in 

the identification of significant numbers of proteins, including low copy 

number proteins, from a single LC-MS/MS experiment1. If, however, a complex protein mixture is to be investigated then a fractionation 

step prior to separation of the peptides on the basis of their hydrophobicity 

is advantageous. We have, therefore, adopted a 2D LC-MS/MS approach 

using a capillary LC system (CapLC) operating at nanoliter per min 

flow rates coupled to a Q-Tof 2 mass spectrometer. By placing a strong cation 

exchange (SCX) cartridge followed by a C18 trap cartridge it is possible to 

pre-fractionate the peptides before separation on an analytical C18 column. 

After loading the sample, discreet fractions are sequentially eluted from the 

cation exchange cartridge using a salt step gradient; the eluted peptides are 

then retained on the trapping C18 cartridge whilst they are desalted. Finally 

the peptides are eluted from the C18 pre-column, at 200 nL/min, onto a 75 

�M ID � 10 cm Waters Symmetry analytical column for separation and elution 

into the mass spectrometer. 

This analytical approach will be discussed with examples where this methodology 

has been used for the analysis of standard protein mixtures and for the 

analysis of cell lysates and sub-cellular fractions. 

1. Yates et al., Nature Biotechnology (1999);17, (7), 676–682. 



P30-T 

A laboratory information management system for a small 

DNA sequencing core facility. 

M.J. Miller; NCI, NIH, Bldg 37, Rm 3C28, MSC 4255, Bethesda, 

MD 20817-4255 

The DNA Sequencing MiniCore facility of the NCI’s Division of Basic Sciences 

currently services over 300 investigators. The facility is designed to support 

small scale, short-term sequencing. In the past year we ran over 25,000 samples 

with an average turnover time of less than one day. While this represents 

a 60% increase in samples over the year before, it is still a relatively 

modest operation. 

Keeping all these users and their data organized, as well as minimizing the 

amount of paperwork involved is a major concern. Although several Laboratory 

Information Management (LIM) System software packages exist, they 

are often too expensive or too inflexible for a small operation such as ours. 

I describe here a LIM system built using components of the Microsoft Office 

software package. Users enter sample information data into an Internet form 

and this data is automatically entered into the database after inspection by 

the MiniCore staff. Programs built into the database determine which sample 

sets can be run together on the same gel, and what parameters (such as 

which virtual filter and which dye/primer set settings) should be used with 

each sample. Samples are assigned to a particular gel and the “sample sheet” 

for that gel is automatically generated by the database. By keeping track of 

when samples are submitted, how many samples there are, and how many 

basepairs of read the user requests, the database aids the facility’s operators 

in determining sample priority. An email message is automatically sent when 

samples have been processed and data deposited in the user’s data-destination 

directory. The database also keeps track of charges and automatically 

sends this data to the NIH’s accounting system. The facility thus runs in a virtually 

“paperless” environment. There are no hardcopy forms to fill out. All 

information is maintained by the computer system. 

P32-M 

Identification of in vivo phosphorylation sites in 

Drosophila armadillo by tandem mass spectrometry. 

C.S. Raska, R.M. Pope, D. Rubenstein; Univ. of North Carolina at 

Chapel Hill, 4 Casabelle Ct, Durham, NC 27713 

Phosphorylation is one of the most important reversible modifications of 

eukaryotic proteins. Often, proteins which are associated with uncontrolled 

cell growth, and ultimately cancer show an anomaly in their phosphorylation/dephosphorylation 

pathways. In humans, a protein, �-catenin, plays a 

central role in the development, organization, and regulation of epithelial tissues. 

Aberrant regulation of �-catenin is associated with malignancies. For 

example, alterations in �-catenin gene structure have been identified in colorectal 

and breast carcinoma, and in a large number of melanoma cell lines. 

Specifically, �-catenin signaling function is constitutively active in many 

melanomas due to mutations that remove phosphoresidues at the amino terminus 

of the protein. Armadillo, a protein found in Drosophila melanogaster, 

is 71% identical to �-catenin at the amino acid level. �-catenin from Drosophila 

and from human keratinocytes binds to armadillo and �-catenin, 

respectively, and this binding has been found to be influenced by phosphorylation. 

Thus, we have been using armadillo as a model system to study 

�-catenin regulation. To further define the regulatory function of phosphorylation, 

we are using mass spectrometry to map post-translationally modified 

amino acids in armadillo. Armadillo was isolated by immuno-affinity and 

ion exchange chromatography. 1-D SDS-PAGE, and in-gel tryptic digestion 

were performed to produce a mass spectral fingerprint on a triple quadrupole 

instrument using nanoelectrospray. MS scans confirmed peptides matching 

both armadillo and �-catenin from one gel spot. Neutral loss scans 

identified potentially phosphorylated peptides. MS/MS generated enough 

sequence coverage to specifically identify phosphorylated residues. We note 

that phosphoresidues are located within the region where binding sites for 

cadherin, dTCF, and dAPC are located. We plan mutation studies to further 

elucidate the role of phosphorylation in these systems. 



P33-T 

A targeted approach for more sensitive and accurate protein 

identification. 

D.K. Leung, M.J. Horn; BioMolecular Technol., Inc., 525F Del Rey Ave., 

Sunnyvale, CA 94086 

Selective isolation of peptides containing low abundance amino acids such 

as tryptophan, offers a direct way to simplify protein digest mixtures prior to 

mass spectrometric analysis. This approach provides benefits for both in-gel 

digests and digests of protein mixtures. 

To this end a solid phase reagent capable of selectively binding to tryptophan 

has been developed. This solid support material binds covalently to tryptophan 

or tryptophan containing peptides, allowing for their selective separation 

from mixtures of peptides and proteins. Bound peptides can be released 

from the solid-support by a reducing reagent to give analytical samples for 

further analysis (LC, MS, etc.). The specificity of the binding chemistry coupled 

with mass spectrometric analysis by MALDI affords improved accuracy 

in data base search and in protein identification. 

References 

1. Shechter, Y., Rubinstein, M. and Patchornik, A. (1976), Biochemical and 

Biophysical Research Comm. {4} (70), 1257. 

2. Early, S. L., Magil, S. G., Novak, C. and Horn, M. J. (1989), Techniques in 

Protein Chemistry, Academic Press, Inc., 439. 

3. McEldoon, W., and Horn, M.J. (2000), 14th Protein Society Symposium, 

{August}. 

P35-M 

Guanylation of lysines as a means to enhance confidence of protein 

identification in proteomics. 

S. Krishnan1, M. Lin2, K. Waddell1; 1Applied Biosystems, Foster City, CA, 

500 Old Connecticut Path, Framingham, MA 01701, 2Applied Biosystems, 

Framingham, MA 

The completion of several genomes, including that of the human, has shifted 

the emphasis to determining the proteome counterpart of biological systems. 

The current approach for such a proteomic analysis is the mass fingerprinting 

of tryptic digests of proteins (generated by ingel digest of 1 or 2-D gel 

spots or of chromatographic fractions) using MALDI-Tof mass spectrometry 

followed by database searching of the masses so obtained. It has recently 

been noticed that the arginine containing peptides ionize better under MALDI 

conditions compared to lysine containing peptides. We present here an 

approach to use this as an advantage in enhancing confidence of the database 

search matches by modifying the lysines to homoarginines. The increase 

in confidence is achieved due to increase in the number of peptides seen in 

the mass spectrum resulting from the guanylation of lysine e-amino group 

(addition of 42 Da) and also the fact that such a modification indicates the 

lysine containing peptides in the tryptic digest mix. Tryptic digests of BSA, 

Enolase, alpha lactalbumin, and cytochrome C were generated by routine 

procedures and mixed in various combinations. The digest mixtures were 

than analyzed by MALDI-Tof mass spectrometry followed by database searching 

of the peptide masses for identification of proteins. A portion of the digest 

mixture was then reacted with O-methyl isourea sulfate to convert the lysines 

to homoarginines. The modified digest mixtures were analyzed by MALDI- 

Tof mass spectrometry followed by database searching. The analysis before 

and after the modification helped identify the lysine containing peptides in 

the digest and hence a more comprehensive identification of the protein mixture. 



P34-S 

Approaches to validating SEQUEST database search results. 

R.E. Moore, M.K. Young, T.D. Lee; Beckman Res. Inst., City of Hope, 

1450 E. Duarte Rd., Duarte, CA 91010 

Tandem mass spectrometry and database searching is a very powerful 

approach to protein identification. Unfortunately, the wealth of data that 

makes the technique so powerful also requires extensive analyst time for data 

reduction and validation of search results. When analyzing complex samples, 

it can easily take more time to validate and reduce the data than it did to generate 

it. This time requirement is a serious problem because the technique 

is otherwise well suited to high throughput analysis. 

Two aspects of result validation are analyzed: validation of search results for 

individual tandem mass spectra and validation of composite results for sets 

of individual spectral matches. Statistical analysis and experiments with falsified 

databases demonstrate that there is a significant chance of generating 

multiple incorrect matches to the same protein when examining large data 

sets. This makes it imperative to validate the individual spectral matches, as 

simple reliance on multiplicity of matches to a single protein does not guarantee 

a correct result. 

Several approaches to validating individual spectral matches were tried and 

compared to the existing standard of manually comparing actual and predicted 

spectra. The most successful approach was to search each spectrum 

twice, once using tryptic specificity and once using no enzyme specificity, 

and correlate the results. When both searches generate the same result, that 

result is almost always validated by manual examination. When the non-specific 

search generated a higher cross-correlation score the result of the search 

using tryptic cleavage was almost never manually validated. Surprisingly, 

there were a large number of searches in which the search using tryptic 

cleavage resulted in a higher cross-correlation score than the search using 

non-specific cleavage. This third group yielded a moderate number of spectra 

that were manually validated. 

P36-T 

Automated analysis of single nucleotide polymorphism using mass 

spectrometry. 

M.S. Minkoff1, P. Ross1, L. Hall1, R. Jones2, D. Ledman1, L. Haff1; 1Applied 

Biosystems, 500 Old Connecticut Path, Framingham, MA 01701, 2Inst. for 

Child Hlth. 

Single nucleotide polymorphisms (SNPs) are increasingly employed as 

genetic markers for associated studies of many inherited diseases and traits. 

It is apparent that approximately 3 million putative SNPs will be found in the 

Human Genome. In order to tackle the task of validating the significance of 

any of these putative SNPs the chemistry and analytical platforms must meet 

demanding throughput and cost requirements. The SNP assay developed to 

meet these criteria incorporates the use of simple, inexpensive primers and 

unlabeled nucleotides for single base extensions, thus keeping down the cost 

of analysis. Multiplexing the analysis of SNPs enhances affordability of genotyping 

studies as well as significantly improving throughput. The use of 

high throughput automated Mass Spectrometry with integrated data acquisition, 

genotyping, sample handling software package simplifies and speedsup 

the task. In addition the top-level software application package tracks 

sample information throughout the workflow and stores all information in a 

central database. Data in support of multiplexed, automated sample handling, 

acquisition, analysis and reporting is presented.

P37-S 

Data-directed real-time instrument feedback and control: 

creation of dynamic peptide include and exclude lists from 

on-the-fly databank searching. 

A. Millar, J.B. Hoyes, R.A. Carruthers, C. Jones, A. Millar, C. Hughes, 

S. Leicester, J.I. Langridge; Micromass UK Ltd., Floats Road, Wythenshawe, 

Manchester M23 9LZ, United Kingdom 

An alternative approach to 2D gel electrophoresis for the qualitative analysis 

of complex protein mixtures is the use of tryptic digestion followed by 

electrospray LC-MS/MS. This approach has been shown to increase the 

dynamic range of protein identification and identify low copy number proteins. 

However there is often a large degree of redundant sequence information 

acquired, as in theory one peptide MS/MS spectrum is sufficient to 

identify a protein from a sequence databank. If a protein identification is 

obtained from a databank search of an MS/MS spectrum, excluding the rest 

of the theoretical tryptic peptides during an LC-MS/MS experiment may 

allow deeper “mining” into the protein complex being studied. 

We have introduced a new search engine capable of matching a tryptic peptide 

from the Swissprot/TrEMBL databank to an MS/MS spectrum in one second. 

Based upon these results, we are able to generate dynamic include or 

exclude lists, based upon the theoretical tryptic peptides from the identified 

protein. These can be passed to the acquisition software of our Q-Tof mass 

spectrometer in real time. Thus, we are able to automatically steer the Q-Tof 

during acquisition to select and switch to the MS/MS mode only on those 

peaks that meet the modified selection criteria. Therefore precursor ions that 

belong to a protein already identified during acquisition can be avoided. This 

exclusion list is based upon m/z, charge state and a user defined mass tolerance. 

Mass measurement on the Q-Tof 2 mass spectrometer is typically better 

than 10ppm and therefore a tight mass tolerance can be selected, making 

the exclude list extremely specific. 

To illustrate this methodology we present examples where Q-Tof data acquisition 

has been directed based upon the results from a databank search. This 

data will be compared and contrasted to data acquired in the normal automated 

LC-MS/MS mode. 

P39-T 

Automated software for identification and relative quantification 

of differentially expressed proteins from isotope coded 

affinity tag LC-MS data. 

A. Millar, P. Young, R. O’Malley, A. Millar, J.I. Langridge; Micromass UK 

Ltd., Floats Road, Wythenshawe, Manchester M23 9LZ, United Kingdom 

Whilst LC-MS/MS has been utilised for the identification of proteins from 

complexes and cell lysates (qualitative proteomics), the quantitative study of 

gene expression using differential display has until recently been the preserve 

of a 2D gel based proteomic experiment. However, recently a great deal of 

interest has been generated on the use of isotope coded affinity tags (ICAT) 

1 for the quantitative study of gene expression at the proteome level. 

The technique is based upon chemically modifying the cysteine residues of 

proteins isolated from cells in two different states with light and heavy isotopically 

labeled reagents. The two cell states are then combined, digested 

with trypsin and the cysteine containing peptides preferentially selected by 

binding to an avidin column, prior to analysis by mass spectrometry. The eluent 

from this column is then analysed by capillary LC ESI-MS/MS. Interrogation 

of the eluting peptides by tandem mass spectrometry and databank 

searching results in the identification of the associated protein. 

We describe how ICAT data analysis has been automated within a software 

environment. The MS and MSMS data acquired using the QTof instrument are 

processed and analysed using a new algorithm which recognises related isotope 

clusters and quantifies their relative intensities. Based on a user defined 

ratio threshold the software will automatically carry out an LC-MS/MS experiment 

and databank search in a client-server mode and provide a report of 

the identified proteins and their expression ratio in the two cell states. 

1. Gygi et al. Nature Biotechnology (1999) 17, 994–999. 



P38-M 

Routine identification of large (�5 kDa) peptides derived from 

biological sources using an ESI-quadrupol-TOF mass spectrometer. 

M. Kellmann, S. Neitz, M. Juergens; BioVisioN GmbH & Co KG, 

Hannover, Feodor-Lynen-Str. 5, Hannover, Lower Saxony 30625, Germany 

Investigating the peptide portion of a proteom results in a multitude of peptides/small 

proteins in the mass range from 5 to 15 kDa [1]. We developed a 

routine procedure for direct identification exploiting the relatively high parent 

and daughter ion resolution (�7500) and mass accuracy (�50 ppm) of 

a hybrid ESI-quadrupol-time-of-flight mass spectrometer. Data processing 

was made with automated charge state deconvolution based on Zhang and 

Marshall´s Zscore algorithm [2] and a deisotoping algorithm included in the 

Voyager 5.0 software from Applied Biosystems. Database searching was performed 

by the MASCOT search engine [3]. 

We will illustrate that this procedure will lead to a fast and reliable identification 

of several large peptides in the mass range from 5 to 15 kDa derived 

from blood filtrate. 

[1] Kellmann, M, et al., Proceedings of the 48th Conference on Mass Spectrometry 

and Allied Topics, 2000, Long Beach 

[2] Zhang, Z and Marshall, AG. A universal algorithm for fast and automated 

charge state deconvolution of electrospray mass-to-charge ratio spectra. J Am 

Soc Mass Spectrom 9(3): 225–33 (1998). 

[3] Perkins, DN, Pappin, DJ, Creasy, DM and Cottrell, JS, Probability-based 

protein identification by searching sequence databases using mass spectrometry 

data. Electrophoresis 20(18) 3551–67 (1999). 

P40-S 

New method for preparation of DNA for MALDI-MS analysis. 

I.P. Smirnov, L.A. Haff, P.L. Ross, L.R. Hall, D.W. Ledman; 

Applied Biosystems, 500 Old Connecticut Path, Framingham, 

MA 01701 

In recent years, matrix assisted laser desorption ionization mass spectrometry 

(MALDI MS) became one of the main analytical tools for short DNA fragments 

and synthetic oligonucleotides. The application of mass spectrometry 

for genetic analysis (such as SNP typing) offers, compared to other methods, 

higher sensitivity, higher accuracy and lower costs by removing the necessity 

for fluorescent- labeled primers. Still, the susceptibility of MALDI-MS to 

the presence of salts of alkali metals requires careful and often tedious 

desalting procedures which complicates and slows the throughput of the MS 

based methods. To overcome that obstacle we have developed a novel 

approach to sample preparation. The idea is to extract DNA out of the solution 

on a solid surface coated with an anion exchange polymer (e.g. polyethyleneimine). 

The observed binding is strong enough to remove and concentrate 

DNAs from buffer solutions and hold them on the plate through 

extensive washing procedures if necessary. The properties of anion exchange 

films make possible to perform purification, desalting and concentration in 

a single fast step. After the DNA is immobilized on the surface and supernatant 

solution is removed, subsequent addition of MALDI matrix releases 

material from the surface, which co-crystallizes with matrix. The MS analysis 

can then be performed directly from that support. Such surfaces may be 

obtained upon glass, plastic, or metal MALDI plates. Analysis of oligonucleotides 

and complex multiplexed SNP typing reactions (Sequazyme-Pin- 

Point) performed by this method shows greatly improved sensitivity and 

excellent resolution for wide range of DNA lengths, together with high tolerance 

to various buffers components, such as alkali metals and surfactants. 

The importance and role of different factors have been studied, such as composition 

of ion exchange film and compatibility of the MALDI matrix in 

order to obtain the best performance. 



P41-M 

Review of gel- and column-based separation technologies for 

the identification of yeast proteins using MS/MS. 

V.C. Wasinger, G.L. Corthals; Garvan Inst. of Med. Res., 384 Victoria St., 

Sydney, NSW 2010, Australia 

Proteome analysis involves the identification and quantitation of expressed 

proteins by a given cell type, tissue or organism and most commonly involves 

2-dimensional electrophoresis (2-DE) followed by mass spectrometry (MS) 

for protein separation and identification. While 2-DE is unequalled in its ability 

to separate and resolve thousands of proteins in complex solutions, we 

have recently shown that many proteins of biological significance lay beyond 

the detection limits of 2-DE. The application of 2-D gels becomes ineffective 

when proteins co-migrate to the same grid coordinates, merge to become 

one large spot or are not displayed because their concentration is simply too 

low for visualisation and subsequent biochemical MS analysis. 

Two important biological aspects prevent us from fully exploiting the power 

of the 2-DE technology: 1) Firstly, protein expression exists for up to 12 

orders of magnitude (in serum). This broad range of expression critically limits 

the current 2-DE approach, as at best only 5 orders of magnitude difference 

in expression can be displayed; 2) “functional” proteins operate in association 

with other proteins; such that research must be directed toward the 

analysis of multiply interacting proteins or functional modules that regulate 

complex biological networks and pathways. 

Alternative fractionation methods such as chromatography exist and allow 

proteins/peptides to be separated based on similar (charge, size) or alternative 

(affinity, hydrophobicity) properties to 2-DE. Used in series with MS, 

these technologies have the potential to fractionate large numbers of proteins 

and peptides to enable the comprehensive, comparative and relational analysis 

of proteins. Yeast is an ideal choice for this study as both genome, proteome 

and transcriptome data is available for evaluation. 

A comparison of the separation potential based on protein numbers, protein 

classes and properties are described using 2-D gel electrophoresis, size 

exclusion and cation exchange chromatography followed by protein identification 

using ESI-MS/MS. 

P43-S 

Characterization of differential protein expression between wild 

type and Rce1 knockout mouse embryonic fibroblasts using 

2-D SDS PAGE and MALDI TOF mass spectrometry. 

S.C. Hall1, D. Smith-Beckerman2, M. Lobo2, S.G. Young3; 1Applied 

Biosystems, 850 Lincoln Centre Drive, Foster City, CA 94404, 

2San Francisco State Univ., 3UCSF 

Ras proteins play an important role in transmitting growth signals from membrane 

receptors to the nucleus, triggering the transcription of genes involved 

in cellular proliferation. Ras proteins are membrane bound, guanine 

nucleotide-binding proteins with GTP-ase activity. Many human cancers contain 

mutationally activated Ras proteins that transmit growth signals in an 

uncontrolled manner, triggering neoplastic transformation and uncontrolled 

cellular proliferation. The proper intracellular location of the Ras proteins 

depends on a series of posttranslational modifications: isoprenylation of a Cterminal 

cysteine, endoproteolytic release of the carboxyl-terminal three 

amino acids, and methyl esterification of the carboxyl-terminal isoprenylcysteine. 

Each of these processing steps represents a potential target for cancer 

therapy. The endoproteolytic cleavage step is carried out by the product 

of the Rce1 gene. Recently, the Rce1 gene was inactivated in mice, completely 

blocking the endoproteolytic processing of the Ras proteins. We used 

2D-PAGE to assess differences in protein expression in primary embryonic 

fibroblasts from wild-type and Rce1 knockout mice. First, we wanted to 

detect substrates for Rce1. Altered electrophoretic mobility of individual protein 

spots on the gel indicated the possibility of aberrant post-translational 

processing. Second, we wanted to detect proteins whose expression level 

was affected by the Rce1 knockout mutation. MALDI TOF mass spectrometry 

was used to generate peptide mass fingerprints to identify several proteins 

having identical molecular weight, pI, and relative abundance in both wildtype 

and Rce1 knockout mice. Additional confirmation of the identities of 

these proteins was obtained by performing post-source decay analysis on 

selected tryptic peptides. It was important to identify these “marker” proteins 

as they will be used as migration reference points when comparing future 

2D-gel separations. Furthermore, they permitted optimization of protocols for 

the MS analysis of Ras proteins from wild-type and Rce1 knockout fibroblasts. 



P42-T 

Quantitative analysis of tumor antigens by mass spectrometry. 

A. Kishiyama, D. Arnott; Genentech, 1 DNA Way, South San Francisco, 

CA 94080 

Both genomics and proteomics are useful for comparing gene expression 

patterns. The discovery of receptors overexpressed on tumor cells has lead 

to effective cancer therapies, for example. Techniques such as DNA arrays 

can be used to measure mRNA levels with great sensitivity and speed. More 

detailed information can be obtained through 2D gels, western blotting, and 

immunohistochemistry, but these protein-based approaches are time-consuming, 

prone to biases, or require generating antibodies. A method has 

therefore been developed, called the mass western experiment in analogy to 

the western blot, to better bridge genomics and proteomics. 

In this experiment, a variation on the ICAT experiment described by Gygi et 

al. (Nature Biotech. 1999 v.17 p.994), specific proteins (such as those found 

to be of interest from DNA array experiments) are detected and compared 

between samples. Proteins extracted from two samples are labeled with a 

custom ICAT reagent. The samples are mixed, digested, and the labeled peptides 

collected. LC-MS/MS is performed on an ion trap instrument; anticipated 

tryptic peptides from the protein of interest are continuously subjected to 

CID. Heavy and light ICAT-labeled peptides are simultaneously trapped and 

fragmented. Both identification and quantitation is thus obtained in one 

experiment. 

This approach has been validated by the comparison of cell lines expressing 

known tumor antigens in different amounts. Overexpression of the 

receptor Her-2 in breast cancer cell lines was shown, and by factors in 

agreement with other measurements. Other potential tumor antigens have 

likewise been detected. 

P44-M 

Intelligent data acquisition and automated sample analysis via 

orthogonal MALDI- QqTOF, a new tool for protein identification. 

C.M. Lock; MDS-Sciex, 71 Four Valley Drive, Concord, Ontario 

L4K 4V8, Canada 

The application of a novel UV-MALDI ionisation source coupled to an 

Applied Biosystems/MDS-Sciex QSTAR Pulsar QqTof mass spectrometer for 

protein sequencing and identification is described. The coupling of these two 

devices enables collision induced dissociation spectra of singly charged 

MADLI ions to be generated, with all the associated QqTof benefits of high 

mass accuracy and resolution. The inherent pulsed nature of the o-MALDI 

source is converted into a pseudo continuous beam of ions by collisional 

cooling in the Q0 region. The o-MALDI source is completely decoupled from 

and has no influence on the orthogonal Tof analyser. 

High mass accuracy and resolution is thus maintained simultaneously over 

the full mass range when switching between MS and MS/MS modes as 

opposed to conventional MALDI post source decay experiments. 

The application of the technique to the analysis of low femtomole unseparated 

protein tryptic digests is demonstrated using an automated data acquisition 

approach. The software developed enables the intelligent acquisition 

of data from sample plates with minimal user intervention. 

The high speed data acquisition capabilities of the o-MALDI source in combination 

with the high performance of the QqTof offers unique possibilities 

for rapid identification of proteins. Rapid analysis and identification of proteins 

via a peptide-mass fingerprinting approach and MS/MS sequence information 

will be shown.

P45-T 

Identification of changes in protein expression in Deinoccocus 

radiodurans using isotope-coded affinity tags. 

E.A. Panisko1, T.P. Conrads1, T. Veenstra1, L. Pasa-tolic1, G.A. Anderson1, R. Aebersold2, R.D. Smith1; 1Pacific Northwest Natl. Lab., P.O. Box 999, 

K8-98, Richland, WA 99352, 2Univ. of Washington 

The isotope-coded affinity tag (ICAT) strategy was used to identify the 

effects of irradiation on relative protein abundances in the highly radioresistant 

organism, Deinococcus radiodurans (D. radiodurans). The ICAT strategy 

uses two distinct isotopic versions of a cysteine-specific reagent; a “light” 

version and a “heavy” version in which eight hydrogen atoms are substituted 

for deuterium atoms. Proteome samples extracted from the organisms just 

prior to, as well as 30 min. and 3 hours after treatment with ionizing radiation 

were labeled with either the heavy or light isotopic version of the 

ICAT reagent. After mixing the samples in various combinations the cysteine 

containing polypeptides (Cys-polypeptides) were extracted using immobilized 

avidin chromatography. The Cys-polypeptides were initially identified 

by capillary reverse phase liquid chromatography (LC) using a 

conventional mass spectrometer (MS) operating in the tandem mass spectrometry 

(MS/MS) mode. The masses of the identified peptides were subsequently 

identified in a capillary LC separation coupled on-line with Fourier 

transform ion cyclotron resonance (FTICR) MS. Changes in relative protein 

expression were measured using the results obtained by LC/FTICR. The 

results show that most proteins undergo a decrease in expression when D. 

radiodurans is subjected to ionizing radiation. 

P47-M 

Use of stable isotope amino acid labels to simplify MS/MS peptide 

analysis. 

S.J. Berger, S-W. Lee, Y. Shen, G.A. Anderson, R.D. Smith; Pacific 

Northwest Natl. Lab., 902 Battelle Blvd. Box 999 MS: K8-98, 

Richland, WA 99352 

Tandem mass spectrometry (MS/MS) is a primary analysis tool for the identification 

of peptides from proteolytic sample digests. When coupled with 

online separations, one or more peptides from a single 2D-gel spot digest can 

uniquely identify a given protein, or more complex digests can yield a global 

view of the proteome. The identification of individual fragment ions from a 

parent peptide is indirect, and the resulting peptide identification is strictly 

correlative. The ability to add sequence and composition constraints to 

assign peptide identity should significantly narrow the possible assignments 

of ions, and simplify interpretation of MS/MS spectra. Here we describe an 

application of stable isotope labeling in conjunction with MS/MS analysis of 

proteolytic digests that permit significant improvements assigning ions in the 

resultant MS/MS spectrum. Auxotrophic cells grown in parallel in the presence 

of a labeled or unlabeled amino acid are combined prior to cell disruption. 

Peptides derived from proteolytic digests generate pairs of peaks 

separated by a known mass difference during an initial LC/MS scan. These 

identified peptide pairs are isolated, and analyzed by LC/MS/MS in subsequent 

scans. When using a protease that cuts adjacent to the labeled amino 

acid, the paired/unpaired daughter ion pattern permits simplified identification 

of the parent peptide. 

This work was supported by OBER (U.S. DOE) and PNNL Laboratory 

Directed R&D. Battelle Memorial Institute operates PNNL for the U.S. DOE 

under Contract DE-AC06-76RLO 1830. 



P46-S 

Quantification of neurosteroids using NCI GC/MS. 

R.L. Fitzgerald; VA Med. Ctr., UCSD, VAMC-113, 3350 La Jolla Village Dr., 

San Diego, CA 92161 

Electron capture negative chemical ionization (NCI) is one of the most sensitive 

ionization techniques available and is especially well suited for quantitative 

analysis of target compounds in biological extracts. For the analysis 

of small molecules, NCI is often several orders of magnitude more sensitive 

than traditional techniques such as electron ionization or positive chemical 

ionization. There are several important prerequisites for performing quantitative 

analysis using NCI, including an electronegative functional group, stable 

isotopic internal standards, and good method validation. We synthesized 

deuterium labeled analogs of neurosteroids and developed a NCI GC/MS 

method for quantification of neurosteroids in biological samples using isotope 

dilution. 

Neurosteroids have distinct neurotransmitter mediated effects and consequently 

it is important to be able to identify and quantify individual compounds. 

Previously, the determination of neurosteroids in biological matrices 

involved complicated purification protocols or did not use appropriate 

internal standards. We added deuterium-labeled internal standards to brain 

(100 mg of cortex homogenate) or plasma (300 �L). Samples were homogenized 

in methanol, centrifuged and diluted to contain 5% methanol and then 

applied to C-18 columns. After washing the column with methanol/water 

(50/50), steroids were eluted with methanol. Following evaporation, steroids 

were converted to pentafluorobenzyl oxime/trimethylsilyl ether derivatives. 

The extracts were analyzed using SIM. The present method allows simultaneous 

quantification of pg amounts (100 pg in 300 �L of plasma and 250 pg 

in 100 mg of brain tissue) of neurosteroids and will be helpful in elucidating 

the role of neurosteroids in health and disease. 

P48-T 

A comprehensive proteomic analysis of human cilia using 

nanoscale capillary LC/MS/MS. 

M. Moyer1, K. Blackburn1, W. Burkhart1, A. Moseley1, L. Ostrowski2, R. Boucher2; 1Glaxo Wellcome, 5 Moore Drive, Research Triangle Park, 

NC 27709, 2Univ. of North Carolina 

Ciliated cells play an integral role in the defense mechanisms of the respiratory 

system. By the coordinated beating of their cilia they provide the force 

necessary to clear potentially harmful material from the airways. In order to 

better understand the protein composition of cilia, human cilia were subjected 

to a comprehensive proteomic analysis. Cilia were isolated from cultures 

of airway epithelial cells and component proteins separated by 1D or 

2D gel electrophoresis. Bands or spots were excised, subjected to in-gel proteolytic 

digestion, and component proteins identified by nanoscale capillary 

LC/MS/MS. Alternatively, proteolytic digests of intact cilia were analyzed 

directly by nanoscale capillary LC/MS/MS with or without the use of cysteinespecific 

affinity tags. Data will be presented on proteins identified as components 

of cilia as well as details of the analytical methodologies. 



P49-S 

4-(4-Hydroxystyryl)pyridine, a rationally designed negative ion 

matrix for MALDI-TOF mass spectrometry. 

J.C. Lopez, P.A. Liddell, J.W. Lippert, D.C. Brune; Arizona State Univ., 

PO Box 871604, Tempe, AZ 85287-1604 

To date, most matrices for MALDI-TOF mass spectrometry have been discovered 

by trial and error experiments, and through broad investigation of 

compounds chemically related to known matrix molecules. The most widely 

used matrices have been used to analyze proteins and other analytes in the 

positive ion mode. We chose to work with negative ion matrices because this 

area has received less attention, and because we occasionally analyze samples 

for which a good negative ion matrix is required. In this investigation, 

we synthesized and studied 4-(4-hydroxystyryl)pyridine. This compound 

resembles those derived from 4-hydroxycinnamic acid in having an electronwithdrawing 

moiety (in this case a pyridyl group) separated from a 4-hydroxyphenyl 

moiety by a vinyl group. In the electronically excited state, charge 

density delocalized across the vinyl group onto the pyridyl group will make 

the latter more strongly basic, favoring abstraction of protons from both the 

analyte and other matrix molecules. Preliminary experiments on Fmoc and 

other modified amino acids have shown that this matrix works as well as 

3-aminoquinoline, one of the best negative ion matrices reported so far. Further 

comparisons involving structurally related matrix molecules are in progress 

and will be reported. A characteristic for negative ion matrices is a shift 

to longer wavelengths under acidic conditions. 

P51-T 

Advances in quantitation and identification of proteins using 

isotope-coded affinity tags and LC/MS/MS using informationdependent 

acquisition. 

T.A. Settineri, C.L. Hunter, L. Nuwaysir, A. Patel, A. Tomaney, B. Halpern; 

Applied Biosystems, 850 Lincoln Ctre. Dr., Foster City, CA 94404 

Recently, Aebersold et al. introduced a method in which proteins are labeled 

with an isotope-coded affinity tag (ICAT), digested, and the resulting labeled 

peptides separated and analyzed by mass spectrometry. The advantage to 

this technique is that the ICAT approach precludes the use of 2D gels while 

allowing complete automation of the entire process. In addition, the ICAT 

technique is generally applicable and can be applied to the global analysis 

of protein expression. In this study we investigate the ICAT approach using 

an API-QSTAR (hybrid quadrupole time-of-flight) mass spectrometer fitted 

with a nano-electrospray source, ICAT reagents synthesized in-house, and 

novel data reduction algorithms to both quantitate protein expression and 

identify proteins from MS/MS data acquired by using information dependent 

acquisition (IDA) 

This approach will be demonstrated for the analysis of proteins arising from 

various cell lines including E. coli and Arabidopsis treated in different ways. 

After treatment with ICAT reagent and purification, samples are analyzed by 

LC/MS/MS using a QSTAR mass spectrometer using information dependent 

acquisition (IDA). Two new algorithms developed to identify and quantitate 

ICAT expression pairs are applied to the MS scans while a third new algorithm 

is applied to the MS/MS data to identify proteins. The first two algorithms 

cluster the data based on ICAT fragments, and optimally collapse adjacent 

spectra for maximum signal to noise. The third algorithm then identifies 

the protein using the MS/MS fragment ion data to perform a database search. 



P50-M 

LC-MS of oligonucleotides using polystyrene supports and 

API-TOF mass spectrometry. 

D.H. Hawke1, J.S. Nelson2, R. Vinayak2, W. Xiao3, P.J. Oefner3; 1Applied 

Biosystems, 850 Lincoln Ctr. Dr., Foster City, CA 94404, 2Applied 

Biosystems, 3Stanford Genome Res. Ctr. 

Oligonucleotides may be analyzed by either Maldi or electrospray methods 

after suitable desalting of samples. Maldi methods are convenient and offer 

high-speed analysis, while electrospray methods can be directly coupled to 

HPLC separations. A classical application for these methods is oligonucleotide 

synthesis, in this case there is usually enough material available that 

sensitivity is not a major problem. LCMS (1) is advantagous if UV detection 

is required, and desalting is effectively performed on-line. A newer area is 

that of genotyping. In this application separation may be required prior to 

analysis and current ion-pairing methods have remarkable separating power 

for these molecules (2). We have coupled this separation technology to a 

high-resolution API-TOF MS system (Mariner) to give both high resolution 

separations and high mass accuracy measurements of oligonucleotides and 

labeled oligos. 

1. Huber C.G., Krajete A., Anal. Chem. (1999), 71:3730–3739. 

2. Underhill, P.A., L. Jin, A.A. Lin, S.Q. Mehdi, T. Jenkins, D. Vollrath, R.W. 

Davis, L.L. Cavalli-Sforza and P.J. Oefner. Genome Res. (1997), 7:996–1005. 

P52-S 

High-throughput SNP genotyping by MALDI-TOF MS. 

M. Kostrzewa1, T. Fröhlich1, T. Wenzel1, C. Franke1, W. Pusch2, K-O. Kräuter2, Y. Stalgies2; 1Bruker Saxonia Analytik GmbH, Permoserstrasse 

15, Leipzig, Saxonia D-04318 Germany, 2Bruker Daltonik GmbH, 

Bremen 

One of the great challenges of the upcoming postgenomic era is the determination 

of sequence variations, in particular single nucleotide polymorphisms 

(SNPs). These polymorphisms are believed to have an enormous 

impact in diagnosis of diseases, improvement of drugs, and forensic analysis 

in future. In contrast to the increasing demand for SNP genotyping, there 

is still a lack of highly reliable high-throughput SNP typing techniques. 

Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry 

(MALDI-TOF MS) is a powerful advanced technology capable of the accurate 

and cost-effective typing of many thousands of SNPs per day. The “GOOD 

assay”, a novel sample preparation procedure for MALDI-TOF typing of 

SNPs was recently presented (Sauer et al., Nucleic Acids Research, methods 

online, 2000, 28, e13). This preparation uses sensitivity enhancing, chemical 

modifications of the allele specific products. Main advantage of the GOOD 

assay over other SNP genotyping preparation methods with MALDI detection 

is that this protocol does not require solid phase purification of the products 

prior MALDI analysis. SNP typing starts with a PCR encompassing a region 

containing a known SNP. Thereafter dNTPs are digested with shrimp alkaline 

phosphatase. In the following primer extension reaction using a charge tag 

containing extension primer, a conditioned set of ddNTPs and a DNA polymerase 

of allele specific products are generated. The 5� part of the extension 

primer is removed by an exonuclease. By alkylation the backbone phosphate 

groups are neutralised. This results in small singly charged product molecules 

which are transferred onto non-protonating matrix on the MALDI target. 

Mass spectra of 384 samples were acquired in less than one hour. Allele calling 

was performed automatically by the novel genotools SNP manager software, 

online during spectra acquisition or offline. The resulting genotypes are 

stored in a table in the ASCII format together with a quality asse.

P53-M 

Nano-LC ion-trap mass spectrometry for the investigation of 

low-fmol protein amounts. 

U. Schweiger-Hufnagel1, A. Schneider1, A. Ingendoh1, S. Liedtke2, R. van Soest3; 1Bruker Daltonik GmbH, Bremen, Fahrenheitstr. 4, 

Bremen, Bremen 28359 Germany, 2Bai GmbH, 3LC Packings NL 

Ion trap mass spectrometry is a powerful tool for the proteomic research 

since it is predestined for the connection to a liquid chromatography system, 

which allows the simple fragmentation of all separated peptides in one 

experiment. However, the limiting factor for the protein analysis so far was 

the chromatography, which, due to the high inner column diameter and high 

flow rates reduced the detection limit of the mass spectrometer. To improve 

this, we connected a nano-LC system to the ion trap mass spectrometer to 

investigate the applicability of this setup for the proteomic research. 

The peptides were separated on a 75 �m ID RP column at a flow rate of 160 

nl/min. To achieve the LC-MS coupling fused-silica spray needles in combination 

with interfaces that support the use of peek based HPLC fittings (New 

Objective, USA) were used. The ion trap mass spectrometer was equipped 

with an online-nanospray device. 

Using this setup, a detection limit in the low fmol range is achieved (about 

1/100 of the detection limit for a capillary HPLC column). Thus, this powerful 

technique can be applied to those protein amounts which are provided 

by the proteome researcher (e.g. obtained from 2-D gels). Therefore, the 

nano-LC ion trap mass spectrometer meets the sensitivity requirements of 

proteomic research, and it enables the use of the ion trap for diverse analytical 

questions. Those include protein identification, the analysis of protein 

mixtures, the analysis of post-translational modifications and the sequence 

analysis. 

P55-S 

ESI-ion trap mass spectrometry for the analysis of PCR products. 

S. Hahner, A. Schneider, A. Ingendoh; Bruker Daltonik GmbH, Bremen, 

Fahrenheitstr. 4, Bremen, HB 28359 Germany 

The polymerase chain reaction (PCR) is an important tool used in many 

applications in molecular biology for the generation and amplification of specific 

DNA sequences from very small sample material. PCR products are commonly 

analyzed by means of gel electrophoresis. Major disadvantage of this 

technique is that the size of a PCR product is determined by comparison of 

the relative electrophoretic mobility in the gel matrix to an internal size 

standard. In addition, a labelling of the analyte is required for detection. 

Mass spectrometry (MS) has been proven to be a useful technique for the 

determination of both the length and sequence variations of PCR products 

based on the accurate determination of molecular weights. So far, PCR products 

have been analyzed using either matrix-assisted laser desorption- 

(MALDI) or electrospray ionization- (ESI) MS. The performance of both techniques 

is less labour- and time consuming compared to gel electrophoretic 

techniques. However, the application of MS is mainly limited due to the tendency 

of the DNA molecules for the formation of multiple salt adducts which 

complicate the data. 

The development of a purification approach based on the adsorption of PCR 

products on magnetic particles has been found to be efficient for purification 

of PCR products prior to MS. In addition, this approach is amenable to full 

automated handling. The application of the magnetic bead purification technique 

in combination with ESI ion trap MS yields mass spectra with a resolution 

and accuracy sufficient to assign single nucleotide sequence deviation 

in PCR products up to a size of 90 bp. 



P54-T 

Characterization of the proteome of Oryza sativa. 

P.A. Haynes, A. Koller, N. Andon, J. Wei, J.R. Yates, III; Novartis Agr. 

Discovery Inst., San Diego, 3115 Merryfield Row, San Diego, CA 92121 

As part of our ongoing efforts to enhance our understanding of plant biology 

in cereal crops, we have undertaken the characterization of the proteome 

of the major tissues and subcellular fractions of Oryza sativa (Rice). The tissues 

analyzed include leaf, root and seed. These were chosen because, 

despite certain similarities, each tissue performs very different functions in the 

plant life cycle and interacts with unique environmental factors. Further fractionation 

of leaf tissue has allowed the analysis of organelles including 

nuclei, chloroplasts and mitochondria, and subcellular fractions including 

cytosol and membrane preparations. Further fractionation of seed has allowed 

the analysis of endosperm and embryo fractions. Protein extracts 

were prepared from each sample, and proteins were visualized by two 

dimensional electrophoresis using immobilized pH gradient–SDS-PAGE. Proteins 

were then excised from the gel and digested in-gel with trypsin. Peptide 

mixtures were separated and analyzed using liquid chromatography– 

tandem mass spectrometry, and peptides were identified using computer 

database searching of uninterpreted fragment ion mass spectra. 

We have identified several hundred proteins by searching our data against 

publicly available sequence data from various plant species. These include 

proteins common to several tissues as well as those which are unique to a 

particular tissue. This data represents the most comprehensive picture to date 

of the proteome of tissues and organelles from cereals, and in particular rice 

plants. The knowledge of the identity and distribution of expressed proteins 

will add value to our genomic sequencing efforts, and will be used to provide 

a baseline for future studies of which proteins are up- or down-regulated 

in response to environmental stress. 

P56-M 

Hydrophilic anchors enable high throughput protein identification 

in the subfemtomole range. 

P. Hufnagel, M. Schürenberg, C. Köster, K-O. Kräuter; Bruker Daltonik 

GmbH, Bremen, Fahrenheitstr. 4, Bremen, Bremen D-28359, Germany 

Research strategies in the Proteomics field rely on both high sensitivity and 

high throughput spectra acquisition. In addition, there is a strong need for 

convenient analysis tools that allow high throughput processing, database 

searches and the assessment of a high number of search results. 

Hydrophobically coated targets equipped with small hydrophilic anchors 

have shown 10–100-fold higher sensitivity for MALDI TOF MS than conventional 

steel targets. A droplet (0.5–3 �l) containing matrix and analyte is 

applied onto a hydrophilic anchor and shrinks down to the anchor’s size, 

thereby restricting the formation of matrix crystals to an exactly defined 

area. This drying process increases the concentration of the analyte by a factor 

that depends on the droplet’s and on the anchor’s size. The fact that the 

matrix crystals are restricted to the area of the anchor is a big advantage of 

anchor targets when it comes to automation. 

Using an eight-channel pipetting robot for sample preparation (approx. 2 sec/ 

sample) arrays of hydrophilic anchors (as well as standard metal targets) were 

loaded with protein digests of varying sample amounts. The combination of 

automatic spectra acquisition with batchwise database searching led to an 

overview of the sensitivity increase (a factor of approx. 100) achieved by the 

anchor technology. The database search results have been automatically 

assessed by a fuzzy-control-based algorithm. 

Here, high throughput capabilities of preparation, acquisition and analysis 

have been used to compare the sensitivity of standard sample preparation 

with the hydrophilic anchor technology on a statistical basis. Furthermore, 

this analysis serves as a model for the application of these fundamental 

techniques for the fast achievement and analysis of search results coming 

from proteomic research tasks. 



P57-T 

Optimization of a procedure for labeling proteins with isotopecoded 

affinity tags. 

K. Parker, S. Pillai, S. Daniels, W. Stanick, R. Lotti, B. Purkayastha, 

T. Nadler; Applied Biosystems, 500 Old Connecticut Path, Framingham, 

MA 01701 

The use of the isotope coded affinity tag (ICAT), developed by the laboratory 

of R. Aebersold (Nat. Biotechnol. 1999 Oct 17(10):994–9), allows one 

to compare the relative protein abundance between two samples by mass 

spectrometry. The reagent used is essentially cysteine reactive biotinylation 

reagent into which stable isotopes have been incorporated. One of the two 

samples is treated with the light reagent while the other sample is treated 

with the same reagent containing 8 deuterium atoms such that the samples 

are chemically equivalent but differ only in mass. In this way two peptides 

may be monitored in the mass spectrometer and quantified relative to one 

another by peak intensity. 

A number of imporant questions concerning the use of this technique are 

addressed in this presentation. The reagent has been extensively characterized 

and the recommended protocol for its use has been optimized for ease 

of use and robustness. Experiments were carried out to determine the purity, 

stability, and reaction kinetics of the reagent. Additional experiments were 

performed to optimize the derivatization protocol, including measurements 

of the degree of alkylation obtained, determining the optimal reduction 

reagent, how to remove excess reagent, and measurements of stability, 

capacity, carryover, and recovery of biotinylated peptides from monomeric 

avidin columns, Finally, the reproducibility of quantitative measurements in 

the mass spectrometer was addressed and will be presented. 

P59-M 

Quantitative proteomic and mRNA expression analysis of 

S. cerevisiae via metabolic labeling and multidimensional 

protein identification technology. 

M.P. Washburn1, G. Oshiro2, D. Wolters1, D. Schieltz1, C. Deciu1, E. Winzeler2, J.R. Yates, III1; 1Novartis Agr. Discovery Inst., 3115 Merryfield 

Row Suite 100, San Diego, CA 92121, 2Genomics Inst. of Novartis Fndn., 

San Diego 

Proteomic technologies are being developed to determine large-scale 

changes in protein expression levels. Several quantitative proteomic methods 

have recently been published where the protein expression levels are compared 

between two different growth conditions by metabolic isotopic labeling 

of proteins or post-growth isotopic labeling of proteins in a sample. To 

fully understand how growth conditions effect biological systems, both protein 

and mRNA expression levels must be analyzed. We have applied metabolic 

labeling strategies to S. cerevisiae in order to determine the changes in 

protein and mRNA expression levels. S. cerevisiae was grown in 15N enriched 

minimal media and compared to S. cerevisiae grown in rich media. Each sample 

was analyzed via mRNA expression array and multidimensional protein 

identification technology. By combining these methods we were able to correlate 

the changes in protein and mRNA expression levels of several hundred 

gene products. 



P58-S 

Rapid genotyping using spectrometrically monitored selections. 

J. Stoerker1, J.D. Mayo2, C.N. Tetzlaff3, D.A. Sarracino4, C. Richert3; 1Bruker Daltonics, 15 Fortune Drive, Billerica, MA 01821, 2Tufts Univ., 

3Univ. of Konstanz, 4Variagenics, Inc. 

Presented here is an inexpensive and rapid method for genotyping single 

nucleotide polymorphisms (SNPs) on PCR products using spectrometrically 

monitored selection from probe libraries. We have previously reported nuclease 

selections of modified oligonucleotides with increased RNA or DNA targets. 

This methodology relies on the selection of short hybridization probes 

complementary to the target sequence with a single-strand specific nuclease 

that does not attack duplexes. Conditions are described where the matched 

duplex is profoundly better protected from enzymatic digestion than single 

base mismatches. Semi-quantitative MALDI-TOF MS is used to identify the 

selected probes after a 10-minute digestion reaction with snake venom phosphodiesterase. 

We have examined sequences from exon 10 of the cystic 

fibrosis transmembrane regulatory (CFTR) gene, using a probe library representing 

a number of alleles, including: native, I506S, 1651 benign polymorphism, 

I506S/1651 dual polymorphism, and dF508, and dI507. Probe 

libraries composed of 8-mers and 9-mers annealing to PCR products have 

been used in our experiments. DNA from blood or cheekbrush samples was 

used from 10 genomic sources. The method discriminates both alleles of a 

heterozygote pair in a single experiment, and can discriminate alleles from 

multiple loci in the same sample. 

P60-T 

A software algorithm for automated quantitation of ICAT labeled 

peptides analyzed by mass spectrometry is described. 

J. Eng, J. Ranish, R. Aebersold; Inst. for Systems Biol., 4225 Roosevelt 

Way NE, #200, Seattle, WA 98105 

We describe a software program which automatically generates quantitation 

ratios of Isotope Coded Affinity Tag (ICAT) labeled peptides analyzed in an 

LC-MS/MS experiment performed on an LCQ ion trap mass spectrometer. The 

peptides are initially identified via a sequence database search. Quantitation 

of each ICAT-labeled peptide pair is then performed by integrating over the 

peptide’s light and heavy elution profiles. An interactive, graphical program 

displays the light and heavy elution traces and allows the researcher to 

adjust the area of integration as needed. This program should enable and 

facilitate large scale, quantitative proteomics studies.

P61-S 

Genopure: a novel magnetic bead DNA purification system for 

MALDI-TOF MS analysis. 

M. Kostrzewa1, J. Bimmler2, I. Thomas2, T. Wenzel1, E. Nordhoff3, H. Rauth3, T. Fröhlich1; 1Bruker Saxonia Analytik GmbH, Permoserstrasse 

15, Leipzig, Saxonia D-04318 Germany, 2Bruker Saxonia Analytik 

GmbH, Leipzig, 3Max Planck Inst. of Molec. Genet., Berlin 

MALDI-TOF mass spectrometry has a high potential for high throughput DNA 

analyses because of its accuracy, speed, automation capabilities, and costeffectiveness. 

Unfortunately, molecular biological reactions are performed in 

the presence of high amounts of salts and detergents which form adducts 

with DNA or interfere with matrix crystallization, respectively. Therefore, 

effective DNA purification is indispensable for successful and valid MALDI- 

TOF MS analysis. We present a novel magnetic DNA purification system 

which gives excellent results in subsequent mass spectrometric measurement. 

Small double stranded PCR products were precipitated on paramagnetic 

beads using an appropriate binding solution. The binding of DNA to the particles 

did not require any labeling of primers or dNTPs. After several washing 

steps with buffers containing either ethanol or isopropanol, DNA was 

eluted and measured with 3-HPA matrix in a MALDI-TOF mass spectrometer. 

Residual PCR primers were removed while PCR products down to about 

50 bp in size were recovered with high yield. Quality of the acquired spectra 

was superior to that of alternative purification protocols. 

Alternatively, eluted PCR-Products were used for subsequent reactions like 

primer extension or restriction enzyme digest. Primer extension products or 

very small restriction enzyme digest products (about 20 bp) were again purified 

by the magnetic bead system to MALDI quality with high recovery using 

a dedicated binding buffer. The combination of both purification procedures 

enabled the genotyping of SNPs by performing PCR, purification of the 

PCR product, primer extension or digest, and clean-up of the allele specific 

products in one reaction tube. High quality spectra could be acquired for several 

model systems allowing the unambiguous determination of genotypes. 

The bead handling can easily be automated on standard pipetting robots 

thereby enabling the processing of thousands of samples per day. 

P63-T 

Bioinformatics assessment of mass spectrometric chemical 

derivatisation techniques for proteome database searching. 

K.S. Sidhu1, P.J. Lester1, S.J. Gaskell1, O.V. Wolkenhauer1, S.G. Oliver2, F. Brancia1, A.G. Sullivan1, P. Sangvanich1, S.J. Hubbard1; 1UMIST, UK, 

PO Box 88, Manchester, Lancashire M60 1QD, United Kingdom, 

2Manchester Univ. 

Identification of proteins from the mass spectra of peptide fragments generated 

by proteolytic fission and subsequent database searching is one of the 

most powerful techniques in proteome science. Using computer simulation, 

we have studied how various chemical derivatisation techniques developed 

in the Michael Barber Centre for Mass Spectrometry at UMIST can improve 

the efficiency of protein identification from mass spectrometric data. The 

impact of these different derivatization strategies, which promote and stabilise 

certain fragmentation pathways yielding additional database search 

information has been assessed. For example, by reliably promoting fragmentation 

at aspartic acid residues after homoarginine derivatisation, 85% of 

yeast proteins can be unambiguously identified from a single peptide with a 

measured mass accuracy of 500 ppm by using the associated fragment ion 

data. We present results here for 3 alternative techniques, both for single proteins 

and for simple mixtures. Additional data have also been generated to 

compare these “partial sequencing” methods with high accuracy mass spectrometry 

where peptide mass accuracy can be achieved at 50 ppm and 

beyond. Interestingly, for protein mixture analysis, the inclusion of limited 

sequence information for the peptides can compensate and exceed the 

search efficiency available via high accuracy searches of around 20 ppm, suggesting 

the particular use of this experimental approach for the simple protein 

mixtures that are routinely obtained from 2D-gels. 



P62-M 

Industrial scale high throughput proteomics. 

J. Brown, D. Gostick, P. Young, J. Langridge; Micromass UK Ltd, 

Floats Road, Wythenshawe, Manchester M23 9LZ, United Kingdom 

With the completion of the Human Genome sequence MALDI-TOF-MS is 

increasingly becoming an established method for identification of proteins 

separated by 2D gel electrophoresis. Mono-isotopic peptide mass fingerprinting 

(PMF) has been previously shown to be amenable to full automation 

encompassing the process of acquisition, data processing and databank 

searching under full software control. 

Until now the throughput of MALDI-TOF-MS for proteomics has been limited 

to several hundred samples in a working day and this represents approximately 

5–10% of the total proteins resolved by a large format 2D gel. To 

reduce the number of proteins to be identified the 2D gels are imaged and 

analysed to determine differences in expression levels within a set of gels. 

Although much of the image processing is semi-automated the comparison 

is labour intensive as manual pattern matching has a role in the gel alignments 

(land marking). Increased MS sample throughput allows the possibility 

of identifying every protein spot in a 2D gel within a day. This could eliminate 

the potentially erroneous step of human gel image alignment, whereby 

land marking could be achieved using the MS data. 

Increased sample throughput requires greater capacity and robust unattended 

instrument operation. In this poster we describe an integrated robotic 

multiple plate loader that allows overnight unattended MS operation. Other 

improvements include an increased laser repetition rate that allows the data 

capture rate to increase four fold. Sample tracking, data archiving and data 

reporting are essential attributes of this new technology and these aspects are 

outlined in the present 

P64-S 

Automated high throughput protein identification on a hybrid 

quadrupole orthogonal acceleration time-of-flight mass 

spectrometer coupled with a MALDI ion source. 

A. Millar, R. Tyldesley, J.I. Langridge, J.B. Hoyes, Y. Philip, R. O’Malley, 

R. Bateman; Micromass UK Ltd., Floats Road, Wythenshawe, Manchester 

M23 9LZ, United Kingdom 

The mass spectrometry technique providing the highest throughput in terms 

of samples per hour, is currently MALDI-TOF-MS. This technique provides a 

peptide mass fingerprint of the protein digests and allows rapid and accurate 

identification of the parent protein by comparison to a databank. However, 

under some circumstances, for example if the number of peptides detected 

is small or if the sequence coverage is poor, it is advantageous to be able to 

include even a short piece of sequence information to provide added specificity. 

In a conventional MALDI-TOF-MS instrument post source decay (PSD) 

can be used to try and generate sequence information, however this 

approach is notoriously unreliable in producing good quality MS/MS data. 

One reason for this is that the peptide does not undergo fragmentation in a 

controlled environment such as a gas cell. 

An alternative approach is to couple a MALDI ion source to a hybrid quadrupole 

orthogonal acceleration time-of-flight (Q-Tof) mass spectrometer, which 

results in predictable fragmentation. In contrast to a conventional MALDI- 

TOF-MS instrument the resolution and mass measurement accuracy of the 

data is comparable between the MS and MS/MS modes. This allows superior 

data acquisition in the MS-MS mode compared to other MALDI-TOF systems. 

In this paper we demonstrate the application of the MALDI Q-TOF instrument 

for high throughput proteomics. A number of modifications have been 

made to optimise the system for high throughput proteomics, these include 

a MALDI source with a high-density target plate and software that has been 

developed for automated data acquisition in both the MS mode and the MS 

to MS/MS switching mode. Dedicated processing software has been developed 

to fully automate the post acquisition and databank searching. This software 

has been optimised to consider the unique nature of the data acquired 

from this configuration of instrument. 



P65-M 

Single scan PSD-MALDI-TOF analysis at high speed and sensitivity. 

D. Suckau, A. La Rotta, A. Holle, P. Hufnagel, D. Suckau; Bruker Daltonik 

GmbH, Bremen, Fahrenheitstr. 4, Bremen 28359, Germany 

The typical approach to Proteomics measurements involves the MALDI-TOF 

fingerprint analysis of protein digests, which allows the identification of a significant 

fraction of samples. PSD as it is available on a reflector TOF instrument 

is in our hands a very sensitive technique (1–10 fmol level) and is automated; 

therefore it principally is the ideal technique to continue MS/MS 

analysis from the same prepared sample. However, it suffers from the fact 

that each PSD spectrum is pasted together from a set of ca. 10 voltage segments, 

each consisting of 100–200 laser shots. Sample consumption is such 

that a maximum of 2–3 peptides can be submitted to MS/MS analysis and the 

process is time consuming. Here we report on the usability of single scan 

PSD spectra from digests for protein identification. 

The acquisition of the entire fragment spectrum has been achieved for a 

MALDI reflector TOF mass spectrometer by introducing a “potential lift”, a 

precursor selection device consisting of a pulsed HV cell with acceleration 

grid. An HV poten-tial is applied to the lift cell at the moment the precursor 

ion and its PSD fragment ions have entered it. By the subsequent acceleration, 

the energies of the fragment ions are compressed into the operating 

window of the reflector, which allows analysing them in a single spectrum. 

With this device LIFT-PSD spectra from proteolytic digest mixture were 

obtained and evaluated with respect to sensitivity, mass accuracy, speed of 

analysis and number of PSD spectra per sample. It potential use in Proteomics 

is discussed. 

P67-S 

Proteomics approach to investigate the toxicity of diclofenac. 

L.J. Alward, O.V. Nemirovskiy, G.S. Cavey, J.E. Carlson, W.R. Mathews, 

J.A. Ware; Pharmacia, 301 Henrietta Street, Kalamazoo, MI 49007 

Diclofenac, a nonselective inhibitor of cyclooxygenase, is a widely used 

non-steroidal anti-inflammatory drug. It has been shown to produce 

hemolytic anemia in sensitive individuals. A proteomics approach was used 

to determine the mechanism of diclofenac-induced hemolytic anemia in the 

mouse. A flexible, high performance proteomics laboratory was assembled 

using commercially available instrumentation. The system used was validated 

with protein standards and included robotic spot excision from 2D gels, automated 

in-gel digestion, robotic sample preparation, automated MALDI-Tof 

analysis, automated nanoLC-MS/MS analysis, and automated database searching. 

Diclofenac was administered to mice by gavage. Liver, plasma, and RBC 

proteins were separated using 1D and 2D gels, and diclofenac-protein 

adducts were visualized by either radiolabel or immunoblot. Proteins of 

interest were excised, reduced, alkylated, and trypsin digested. Successful 

protein identification was accomplished via MALDI-Tof MS peptide mass fingerprint 

analysis using 20% of digest sample. Nanoscale LC-MS/MS provided 

comprehensive identification using 50% of digest sample. The results 

obtained by nano-LC-MS/MS analyses were in a good agreement with those 

obtained by MALDI-Tof. Many proteins were identified including fibrinogen 

alpha and beta, hemoglobin beta and delta chains, and RBC anion exchanger 

(AE1). Abnormalities in AE1 have been shown to accelerate membrane 

destruction. Preliminary data from these experiments is promising and may 

help explain diclofenac toxicity. 



P66-T 

Quantitative proteomic analysis using a MALDI quadrupole 

time-of-flight mass spectrometer. 

T.J. Griffin1, S.P. Gygi2, B. Rist3, H. Zhou1, H. Lee1, A. Loboda4, A. Jilkine5, W. Ens6, K.G. Standing6, R. Aebersold1; 1Inst. for Systems Biol., Seattle, 

4225 Roosevelt Way N., Seattle, WA 98105, 2Harvard Med. Sch., 3BioVisioN 

GmbH and Co. KG, Hannover, 4MDS Sciex, Concord, Canada, 5Univ. of 

Manitoba, 6Univ. of Manitoba 

We describe an approach to the quantitative analysis of complex protein mixtures 

using a MALDI quadrupole time-of-flight (MALDI QqTOF) mass spectrometer 

and isotope coded affinity tag (ICAT) reagents. Proteins in mixtures 

are first labeled on cysteinyl residues using an ICAT reagent, the proteins are 

enzymatically digested, and the labeled peptides are purified using a multidimensional 

separation procedure, with the last step being the elution of the 

labeled peptides from a microcapillary reverse-phase liquid chromatography 

column directly onto a MALDI sample target. After addition of matrix, the 

sample spots are analyzed using a MALDI QqTOF mass spectrometer, by first 

obtaining a mass spectrum of the peptides in each sample spot in order to 

quantify the ratio of abundance of pairs of isotopically tagged peptides, followed 

by tandem mass spectrometric analysis to ascertain the sequence of 

selected peptides for protein identification. The effectiveness of this approach 

is demonstrated in the quantification and identification of peptides from a 

control mixture of proteins of known relative concentrations, and also in the 

comparative analysis of protein expression in Saccharomyces cerevisiae 

grown on two different carbon sources. Additionally, we have demonstrated 

the utility of this approach for the quantitative analysis of isotopically labeled 

phosphorylated proteins, and we are currently working on automating the 

sample preparation procedures for high-throughput applications. 

P68-M 

Selective separation of methionine-containing peptides 

combined with mass spectrometry: a high accuracy technique 

for identification of proteins. 

W.L. McEldoon, M.J. Horn; BioMolecular Technol., Inc., 

525F Del Rey Ave., Sunnyvale, CA 94085 

Although MALDI-TOF MS is a widely accepted technique for identification of 

proteins and peptides in proteomic and genomic analyses, rapid and accurate 

identification of a large number of proteins is still a great challenge. Previously, 

we reported an easy method, which uses a novel water-insoluble 

reagent that selectively separates methionine-containing peptides from peptide 

mixtures. This method, combined with MALDI-TOF analysis, demonstrates 

a significantly improved accuracy in the identification of proteins. In 

the present study, we present a total methodology for the separation and 

identification of methionine-containing peptides generated from 2D gel 

digestion mixtures. The methodology provides a “one-pot” method for sample 

desalting and concentration after the isolation process, giving cleaned-up 

samples ready for multiple MALDI or other analytical analyses.

P69-T 

Efficient detergent and Coomassie blue dye removal from peptide 

samples prior to MALDI-TOF MS. 

W. Kopaciewicz, E. Kellard; Millipore, 17 Cherry Hill Drive, Danvers, 

MA 01923 

Advancements in Mass Spectrometry (MS) instruments over the last 5 years 

have reduced the amount of sample required and expanded the molecular 

weight analysis range. As such, MS is an increasingly valuable tool for the 

analysis of biomolecules in areas of proteomics and functional genomics. 

However, the presence of salts, detergents and dyes can decrease macromolecular 

ionization and/or obscure mass peaks, thus decreasing instrument 

performance. As such, numerous methods and devices have been 

developed for sample preparation prior to MS analysis. 

Millipore ZipTip sample preparation devices containing C18 and C4 media 

reversed phase media have been demonstrated to be effective for the concentration 

and desalting of microliter volumes of peptide, protein and 

oligonucleotide samples prior to MALDI-TOF MS. Although reversed phase 

chromatography meets the vast majority of the sample preparation needs, 

there are cases where it isn’t totally effective. This is especially evident when 

the contaminants have similar hydrophobic character as the solutes and thus 

co-purify. 

Alternatively, a subset of normal phase chromatography termed hydrophilic 

interaction chromatography has been shown to be an efficient sample preparation 

technique for certain biomolecules in those cases where reversed 

phase struggles (1,2,3). The method utilizes a highly hydrophilic adsorbent 

that binds sample out of a high organic mobile phase (e.g. 90% acetonitrile). 

After washing with this solvent, bound molecules are then eluted by decreasing 

the organic content (e.g. 50% acetonitrile). In this poster, we demonstrate 

the use of a ZipTip with hydrophilic interaction media (ZipTipHPL). The 

device was very effective for the removal of detergents and coomassie blue 

dye from sub-picomole quantities of peptides. The resulting mass spectra 

demonstrated good signal strength and fidelity of peptide capture. 

1. Alpert, A.J., J. Chromatogr. 499 (1990) p.177 

2. Zhu, B.Y., et al., J. Chromatogr. 548 (1991) p.13 

3. Scherer, J.P., et al., Anal. Biochem. 215 (1993) p.292 

P71-M 

Factors affecting rapid sample processing for protein capture 

chips analyzed by MS. 

J. Chan1, P.T. Jedrzejewski1, P. Wagner1, S. Nock2; 1Zyomyx, Inc, 

3911 Trust Way, Hayward, CA 94545, 2Zyomyx, Inc. 

Robust, sensitive, and comprehensive methodologies for systemic approaches 

to proteome analysis analogous to genomics methods (e.g., gene chips) are 

not available. Current methodologies (e.g., 2D-PAGE and multi-dimensional 

chromatographic methods) suffer from fundamental limitations. In order to 

overcome these limitations, we as well as others have focused on the development 

of alternative methods (e.g., protein capture chips) for proteomics. 

Protein capture chips, consisting of arrayed capture molecules (e.g. protein, 

DNA, or small molecule), allow for rapid and comprehensive micropurification 

and analysis of proteins. Protein chips may be readily interrogated by 

mass spectrometric analysis. Data on the post-translational modifications 

(PTM), protein identification, and quantitation may be obtained with a single 

detection scheme without labeling of analytes. 

We have been successful in microfabricating protein capture arrays, the 

accompanying microfluidics devices, and implementing MS analysis. We 

have investigated various parameters which have an effect on the utility and 

efficacy of the overall system for proteomics. In this presentation, we will 

demonstrate data on parameters affected by the type of capture molecules, 

digest efficiency (e.g., time), and sensitivity of analysis (e.g., LC-MS conditions). 



P70-S 

Improved proteome coverage through the use of affinity tags 

with nanoscale capillary LC/MS/MS. 

K. Blackburn1, W. Burkhart2, R. Davis2, M. Moyer2, A. Moseley2; 1Glaxo Wellcome, 5 Moore Drive, PO Box 13398, Research Triangle Park, 

NC 27709, 2Glaxo Wellcome 

Because of the inherent difficulties associated with 2D gel electrophoresis 

(low throughput, bias against certain classes of proteins, poor peptide recovery 

from in-gel digests, etc.), numerous groups have explored ways to analyze 

complex protein mixtures directly by mass spectrometry, avoiding the 

gel separation altogether. In proteomic experiments where qualitative and/or 

quantitative data is required for complex biological samples such as protein 

complexes, organelles, or tissue samples, the number of proteins potentially 

encountered may range from tens to thousands. The number of proteolytic 

peptides generated from digests of such complex protein mixtures precludes 

“complete” proteome coverage by any 1D-LC/MS/MS analysis. Following on 

the work of Aebersold and Patterson, we have investigated the use of cysteine-modifying 

“affinity” tags with avidin affinity chromatography for the 

simplification of complex peptide mixtures prior to nanoscale capillary 

LC/MS/MS analysis. This approach reduces the number of peptides presented 

to the mass spectrometer to a more reasonable number, thus allowing 

improved proteome coverage. Data will be presented on improved sample 

handling procedures for labeling and digestion steps as well as qualitative 

and quantitative applications to complex biological samples. 

P72-T 

High throughput in-gel peptide digestion and microscale sample 

preparation for MALDI-MS analysis of the resulting peptide 

mass fingerprint. 

M.G. Pluskal1, A.M. Pitt2; 1Proteome Systems, Inc., 14 Gill St., 

Woburn, MA 01801, 2Millipore Corp. 

In-gel peptide digestion has become a widely used technique for characterizing 

proteins resolved by two dimensional gel electrophoresis. Peptides 

generated from gel pieces are frequently contaminated with detergent and 

salts. Prior to MALDI-MS analysis, these contaminants are removed using 

microscale C18 sample preparation columns. In this poster, data will be presented 

to demonstrate the application of a solvent resistant Multiscreen 96 

well plate with an optimized low peptide binding membrane and ZipTip C18 

micropipet based sample preparation. Recoveries of peptides (Mz range of 

1000 to 5000 Dalton) derived from standard protein protease digests, were 

estimated at various stages of the analytical process. An optimized protocol 

has been established and all the reagents and consumables have been packaged 

in a ready to use commercial kit. Data will be presented to show application 

of this technology package to accelerate the throughput of protein 

characterization by protease fragmentation. 



P73-S 

Rapid and high throughput proteomics by protein capture chips 

combined with MS analysis. 

J. Chan1, P.T. Jedrzejewski1, P. Zwahlen2, P. Indermuhle2, P. Wagner1, S. Nock3; 1Zyomyx, Inc, 3911 Trust Way, Hayward, CA 94545, 

2Zyomyx, Inc., Hayward, CA, 3Zyomyx, Inc. 

The study of the proteome is a critical step towards the function determination 

of each gene since proteins are the agents of life’s work. However, 

robust, sensitive, and comprehensive methodologies for systemic approaches 

to proteome analysis similar to genomics methods (e.g., gene arrays) are not 

available. Current methodologies such as 2D-PAGE and multi-dimensional 

chromatographic methods (e.g., LC-LC, LC-CE) suffer from fundamental limitations. 

In order to overcome these limitations, we as well as others have 

focused on the development of alternative methods (e.g., protein capture 

chips) for proteomics. 

Consisting of arrayed capture molecules, protein chips allow for rapid and 

comprehensive micropurification and analysis of proteins. Protein chips may 

be readily analyzed by optical methods; however, detailed data may be 

obtained when arrays are interrogated by MS. Data on the post-translational 

modifications (PTM), protein identification (especially important when complexes 

are isolated), and quantitation may be obtained with a single detection 

scheme without labeling of analytes. In this presentation, we will show 

our efforts in this area. 

We have been successful in microfabricating protein capture arrays, the accompanying 

microfluidics devices, and implementing MS analysis. These mircrofluidic 

devices offer a number of advantages (e.g., high density elements, 

integration of operations). We have devised a microfluidic device capable of 

performing a number of sample preparation operations prior to MS analysis. 

In this presentation, we will demonstrate the functionality and utility of these 

devices through the identification and characterization of proteins captured 

from mixtures. Various assay types will be demonstrated (e.g., protein-protein, 

small molecule-protein, protein-DNA). The overall system performance characteristics 

will be presented: low femtomole sensitivity, high dynamic range, 

and selectivity. The utility of rapid protein identification through database 

searching and PTM characterization will be highlighted in various applications. 

P75-T 

Rapid protein identification of blocked proteins using dilute acid 

cleavage and automated Edman sequencing. 

S. Wong, A. Kishiyama, V. Pham, W.J. Henzel; Genentech 

We have developed a method for rapidly cleaving and identifying proteins 

electroblotted onto polyvinylidene difluoride (PVDF) membranes. Cleavage 

is performed with 10% acetic acid in 7 M guanidine chloride at pH 2.5 for 

1 hour at 90�C, resulting in fragmentation primarily at aspartyl-prolyl bonds. 

Peptides resulting from non Asp-Pro cleavage are N-terminally blocked by 

reaction with orthophthalaldehyde (OPA) prior to automated Edman degradation. 

Reaction with OPA after cleavage blocks all amino acids containing 

primary amino groups. Only peptides containing an N-terminal amino acid 

with a secondary amino group (proline) will be available for reaction with 

the Edman reagent. The sequences obtained are used for protein database 

searching. Using this approach, proteins that are found to be N-terminally 

blocked can be removed from the sequencer, cleaved with acetic acid, 

blocked with OPA and reapplied to the sequencer. The protein can then be 

identified from a database search using the sequence mixture obtained. 



P74-M 

Reflector in-source-decay MALDI TOF MS: a powerful tool for 

N-terminal sequence characterization of proteins. 

D. Suckau, A. Resemann, M. Witt; Bruker Daltonik GmbH, Bremen, 

Fahrenheitstr. 4, Bremen 28359, Germany 

MS-characterization of proteins can simply be initiated by intact molecular 

weight determinations. If the experimental value doesn’t agree with the 

anticipated structure, a closer investigation of the termini is a must—besides 

modifications. In particular N-terminal modifications impose a significant 

analytical problem, since Edman sequencing fails and MS/MS of digested 

peptides generates a tremendous amount of (useless) information to address 

this question and might even not contain the N-terminal peptide. 

We introduce ISD measurements on a standard reflector MALDI-TOF instrument 

to obtain near-N-terminal sequence information (residues �10–30). 

C-type MS/MS fragment ions generated from intact proteins of up to 60 kDa 

using this approach allow to read the sequence with a �0.04 Da mass accuracy. 

This sequence information can directly be used for sequence database 

searches. This information was sufficient to characterize the N-terminus, i.e., 

to identify the fusion protein system and the unexpected N-terminal Metmethylation, 

which was confirmed by additional PSD and fingerprint analysis. 

ISD seem to be an ideal technique to characterize the N-terminus of proteins 

and in particual of N-terminally blocked proteins, provided they are available 

on the 10 pmol level and not contaminated by other proteins in a mixture. 

P76-S 

Quantitation of gel separated proteins at the low picomole level. 

S.W. Yuen, L.R. Zieske, K-L. Hsi, T.L. Schlabach; Applied Biosystems, 

850 Lincoln Centre Drive, Foster City, CA 94404 

Comparative proteomics depends on the ability to quantify changes in cellular 

protein levels between the control state and the abnormal or treated 

state. The most widely accepted method for protein quantitation is amino 

acid analysis, but this method performs poorly at low picomole levels and 

below, which are most common in proteomics studies. 

Edman chemistry is a nearly stoichometric method for removing amino acid 

residues from a protein with typical repetitive yields of greater than 90%. The 

problem is the initial yield is not stoichometric and shows variability that is 

dependent on protein sequence. 

Cleavage of an unknown protein into numerous fragments reduces the 

impact of variability in the initial yield of any one fragment and removes 

much of variability associated with sequence dependence. We examine both 

chemical and enzymatic digestion techniques for fragmentation. 

We report in this presentation on the relative and absolute accuracy of protein 

sequencing for determining protein concentration. Both solution and gel 

isolated proteins will be studied and the results compared with sequence 

analysis of intact proteins.

P77-M 

The utilities of N-terminal sequencing in the post-genomic era. 

L.R. Zieske1, S.W. Yuen1, T.A. Settineri1, D. Hawke1, C. Bloch2; 1Applied Biosystems, 850 Lincoln Centre Drive, Foster City, CA 94404, 

2Embrapa-Cenargen, Brazil 

Mass spectrometry continues to develop and improve methods and procedures 

to make it the primary tool to identify proteins for “proteome analysis”. 

The high mass accuracy and sensitivity of instruments such as hyphenated 

quadrupole TOF mass spectrometers has made low level sequencing of 

peptides and proteins possible. Yet even with these advancements in MS the 

need for chemical sequencing still exists! 

MS sequencing is very powerful, but exact location of the fragmentation patterns 

are not predictable. Thus creating difficulty in assigning the exact N-termini. 

The need for exact N-terminal sequence information is especially 

important in determining mRNA editing and/or determining the true open 

reading frames when EST database searching. Edman chemistry is the one 

sure way of determining this type of information. Complementary to this is 

the use of “multiple peptide sequencing” which simultaneously provides multiple 

amino acid information per residue cycle. Thus providing very high 

quality sequence information with which to interrogate the error prone databases 

now used for searching. In addition, chemical sequencing provides the 

necessary information to determine quality assurance of cloned products; 

again making sure no frame shifts occurred in the processing. Another complementary 

need for chemical sequencing is in assisting the assignment of the 

correct ion series patterns being generated even when relatively complete 

fragmentation data is recorded. Chemical sequencing also identifies difficult 

to discern or unusual amino acids easily such as I/L and/or hydroxyproline. 

In this work we will show some examples of how N-terminal analysis was 

used in concert with mass spectrometry to unravel protein/peptide structural 

information. In addition, we will show demonstration of “multiple peptide 

sequencing” in inspecting the various databases available. 

P79-S 

Microsatellite analysis using fluorescent PCR primers synthesized 

in tandem. 

J. Fernandez, M. Kirchner, J. Brito, T-J. Daley, G. Dolios, B. Imai; 

Rockefeller Univ., 1230 York Ave., New York, NY 11021 

SDS-PAGE is typically the final purification step for isolation of small amounts 

of proteins for further chemical characterization. Proteins are digested in-gel 

with trypsin and the resultant peptides analyzed by 1) MALDI-TOF mass 

spectrometry for tentative protein identification using database search programs 

such as ProFound (http://prowl.rockefeller.edu) and/or 2) capillary 

HPLC followed by Edman sequence analysis to obtain definitive primary 

sequence information. While this strategy works well for Coomassie stained 

proteins it poses a problem for the more sensitive silver staining method. A 

technique has been published for protein identification using MALDI-TOF 

mass spectrometric analysis after reversal of the silver stain (Gharahdaghi et 

al., Electrophoresis 1999 20, 601–605). We have employed this technique for 

preparation of proteins for internal Edman sequence analysis. Because of the 

usually low amount of silver stained proteins, peptides need to be isolated 

by capillary HPLC and collection techniques need to minimize peptide loss. 

Silver stained gels, MALDI-TOF mass spectra, capillary HPLC, and Edman 

sequence data will be presented as well as guidelines for sample handling. 



P78-T 

Increasing the capacity of a commercial Edman sequencer: 

a protein auto sampler. 

W. Shillinglaw, S. Wong, T. Moreno, W.J. Henzel; Genentech 

We have designed an implemented a high throughput autosampler to 

increase the capacity and speed of protein sequencing. The autosampler 

attaches to a standard ABI Procise sequencer, enabling a single separate sample 

cartridge to now hold up to six separate samples. The autosampler is 

used in combination with faster Edman cycles and a rapid 12 minute PTH 

separation to significantly increase the speed of sample analysis. The reaction 

cartridges on the autosampler are composed of disposable Teflon tubing, 

allowing for a significantly cleaner background when compared to the 

reusable glass cartridge blocks, which are standard on the ABI sequencers. 

The lower background reduces the ambiguity of identifying the amino acids 

in the first few cycles, which is often a problem. A low cost program logic 

controller which is connected through an external relay to the protein 

sequencer controls the autosampler. 

P80-M 

Amino acid analysis 2000: a collaborative study from the 

ABRF AAA Research Group. 

M.A. Alterman1, P. Hunziker2, K. West3, R. Harris4, D. Chin5; 1Univ. of 

Kansas, 6038 Malott Hall, Lawrence, KS 66045, 2Univ. of Zurich, 

3Cleveland Clin. Fndn., 4Genentech, 5Univ. of Missouri 

The AAA Research Group of the ABRF periodically provides member laboratories 

with test samples in order to assist members in maintaining and 

improving the quality of AAA and assess the reliability of AAA. The latest 

study consists of two parts: Internet-based survey of equipment and technique 

currently used for AAA, and experimental data from this year’s test 

sample. The experimental part of 2000 study focused on quantitation and 

identification of proteins. The participating laboratories received solutions of 

4 pure proteins for the determination of their concentration by AAA as well 

as by a colorimetric method (BCA, Bradford, or similar). Data obtained will 

be used to examine the use of AAA for determining of the exact amount of 

protein in the sample and the use of compositional data to identify the protein. 

The relative precision and accuracy of the colorimetric assays will be 

compared with the AAA values. The comparison of the results of this study 

with the results from previous studies will show changes and improvements 

in the practice of AAA. 



P81-T 

How to obtain reproducible gradient capillary/nano LC for ultrahigh 

sensitivity MS detection of biological macromolecus with 

and without flow splitting. 

Y-H. Jou, C. Wu, C. Wu, Y.W. Hong, F.J. Yang; Micro-Tech Scientific, 

Sunnyvale, CA, 140 South Wolfe Road, Sunnyvale, CA 94086 

The applications of gradient capillary column LC for biological macromolecular 

analysis and drug discovery research have increased significantly in 

recent years. As a result of this increasing need for sub-picomole detection, 

capillary column LC with eletro-spray and nano-spray MS is increasingly 

important. 

Flow stream splitting technique introduced in 1983 by van der Wal and Yang 

(1) has been utilized by many users for rapid evaluation and realization of 

the advantages of capillary LC and capillary LC-MS. However, the flow stream 

splitting technique has suffered from inherent poor retention time and gradient 

slope reproducibility when the following condition(s) occurred: high 

pressure, high split ratios, large sample amount of viscose sample solvent is 

injected, column inlet flow restriction change, or splitter flow restriction 

change. 

Splitless flow capillary LC allows the same performance and ease of validation 

for routine work as the conventional 4.6 mm id. gradient HPLC. However, 

it requires each pump to deliver accurate/reproducible flow rates at 

sub-�l/min. It also requires high pressure mixer(s) with small volume for fast 

gradient generation and minimum solvent gradient delay time from the mixer 

to the column inlet. 

This poster will discuss design concepts of a new reciprocating pump that 

delivers sub-�l/min flow rates for routine capillary/Nano LC applications. 

Performance of the system in terms of long-term retention time reproducibility 

for flow rates from 0.01 to 50 �l/min will be compared to a flow 

stream splitting system. Practical considerations in terms of gradient regeneration, 

system liquid end volume, mixer volume, mixing noise, and sample 

clean up, desalt, and concentrating will also be discussed. 

1. Sj. van der Wal and F. J. Yang, J. Resolut. Chromatogr. Chromatogr. Commun. 

6, 216 (1983). 

P83-M 

An automated sequence assignment and multiple database 

searching. 

T. Sasagawa, Y. Matsumoto, M. Kojima, Y. Mizuno; Toray Res. Ctr., 

1111 Tebiro, Kamakura, Kanagawa 2488-8555, Japan 

Mass spectrometry and Edman degradation are complementary to each other 

and are indispensable techniques in proteomics in which systematic analysis 

of a large number of expressed proteins is required. In order to facilitate 

the interpretation of these data, automated data analysis and multiple database 

search programs linked together are developed. PepMs is for de novo 

sequencing based on a new algorithm. The sequence information can be 

obtained even if a few gaps are present. Post-translationally modified amino 

acid and ambiguous Edman sequence data can be used to aid the sequence 

determination. 

Seq is for the automated interpretation of Edman sequence data and for multiple 

database searching. By correcting raw data with extraction efficiency of 

PTH amino acids and with lag due to incomplete cleavage, unambiguous 

sequence assignment is possible. The assigned data are automatically subjected 

to database searching. A minor second sequence can be also determined. 

The program also has a routine to generate theoretically possible 

amino acid sequences based on observed PTH amino acids, when equal 

amount of multiple sequences are observed. Using the generated pairs of 

sequences, the correct pair of the sequence can be found by multiple database 

searching. The result is confirmed mass spectrometry and de novo 

sequence routine. 



P82-S 

Proteomics: identification of low abundance proteins 

by MDLC/MALDI-TOF analysis. 

M. Meys, S. Krishnan, K.C. Parker, M. Lin, M.D. Lynch, R. Carberry, 

K. Waddell; Applied Biosystems, Foster City, CA, 500 Old Connecticut 

Path, Framingham, MA 01701 

The study of proteome components commonly involves the separation of a 

protein extract on a 2-D gel followed by the analysis of the protein spots. 

This analysis is currently being done by proteolytic digestion of the spots followed 

by mass spectrometric techniques. Although this approach has proven 

to be useful, it has several limitations. The main limitations are the inability 

to analyze low abundance proteins, proteins of extreme pI’s and molecular 

weights. We present here a method that can overcome these limitations by 

eliminating the 2-D gel separation step. The process involves performing a 

multidimensional chromatographic separation of the protein extract followed 

by proteolytic digestion and MALDI-TOF mass spectrometric analysis of the 

digests. The removal of the gel step in the process offers accessibility to all 

classes of proteins, makes the process amenable for automation and enhances 

speed of analysis. The use of chromatography also improves peptide 

recovery. In addition, the use of the chromatographic separation enables the 

removal of the highly abundant proteins from the extract and aids in the 

identification of the low abundance proteins. In the present study Escherichia 

coli is used as a model to validate this approach. The crude extract was 

fractionated over a cation exchange column followed by further fractionation 

on a reverse phase column. The fractions from the reverse phase column 

were then digested with trypsin and subjected to MALDI-TOF mass spectrometric 

analysis. Using this approach we identified several low abundance 

proteins such as maltodextrin phosphorylase, leucine aminopeptidase, phosphate 

starvation inducible protein precursor. These proteins to our knowledge 

have not been located on 2-D gels of E coli indicating the validity and 

usefulness of the approach. 

P84-T 

Amino acid specific effects on C-terminal sequencing efficiency: 

comparison of activation chemistries. 

D.R. Dupont1, S.W. Yuen1, R.L. Noble1, K.S. Graham2; 1Applied 

Biosystems, 850 Lincoln Centre Drive, Foster City, CA 94404, 

2Beckman Res. Inst., City of Hope 

Efficient initial activation of the C-terminus of a protein or peptide is essential 

to successful C-terminal sequencing. To facilitate the evaluation of activation 

chemistries, we have synthesized sets of peptides that contain each of 

the genetically coded amino acids (except proline) in three sequence positions, 

at the C-terminus, penultimate to the C-terminus and third from the 

C-terminus. The peptides are sequenced in groups of four or five to limit the 

number of sequencing runs necessary to evaluate the behavior of each of the 

amino acids in each sequence position. Included in each group are several 

amino acids with reactive side chains together with amino acids with unreactive 

side chains. The peptides are covalently attached to modified PVDF 

membrane to minimize the effect of sample loss due to washout. 

In the ATH method, the C-terminus is reacted with acetic anhydride to form 

an oxazolone, which is then reacted with tetrabutylammonium thiocyanate 

in the presence of TFA vapor to form a C-terminal thiohydantoin. An alternative 

approach is the use of a reagent that can form thiohydantoin without 

first forming oxazolone, which should minimize the potential for side reactions 

and improve the sequencing initial yield. In the C-terminal sequencing 

chemistry developed at the Beckman Research Institute, one such reagent, 

diphenylphosphoroisothiocyanatidate (DPP-ITC), is used for activation and 

thiohydantoin formation. Several years ago we presented a preliminary comparison 

of these activation chemistries using several model proteins. Here we 

compare the activation chemistries for all the amino acids (except proline) 

using the peptide sets and outline the effects of incorporating DPP-ITC activation 

into the ATH chemistry. In addition, we compare the efficiency of the 

activation chemistries on a variety of proteins at different sample amounts.

P85-S 

Rapid oligosaccharide mapping using fluorescent 

anthranilic acid detection. 

S.T. Dhume, S.A. Batz; SmithKline Beecham, 709 Swedeland Rd, 

Mailcode UW2960, King of Prussia, PA 19406 

Oligosaccharide mapping and characterization methods based on fluorescent 

Anthranilic acid (AA, 2-aminobenzoic acid) labeling affords high resolution 

and high sensitivity detection of glycans (1). The AA tagging method offers 

a significant improvement over other methods and is being rapidly adopted 

in the area of glycoprotein analysis. 

The oligosaccharide mapping method starting with an N-linked glycoprotein 

requires an overnight enzymatic digestion, 1 hour reaction with AA, a purification 

step followed by a 2 hour chromatographic run. It is the intent of this 

work to allow rapid detection of oligosaccharides while retaining the quality 

and reproducibility of the original method. 

The enzymatic release of oligosaccharides with the amounts of substrate and 

enzyme used is essentially complete in 3 hours. The glycan profiles obtained 

with PNGase F incubations between 30 min and 72 hours are similar except 

for the lower peak intensities at shorter (�2.5 hours) incubation times. 

The purification step to remove excess AA may be omitted. The mapping is 

directly applicable to fetuin, a highly sialylated glycoprotein but needed gradient 

changes for neutral glycan species to retain resolution, tailing and 

quality of maps as those from the original method. 

Oligosaccharide mapping was carried out on a short (2.1 mm � 15 cm) polymeric 

amine-bonded column allowing reduction in the time of analysis to 

about an hour. Initial results with reverse phase chromatography are promising 

and also allow 1 hour runs per sample. 

The modifications may be used alone or in any combination. Without consideration 

of the time for enzyme incubation, the total time saved is more 

than 50%. In addition, 80% of HPLC solvent consumption is avoided. The 

reproducibility and universal applicability of this method for other oligosaccharides 

will be discussed in detail. 

1. Anumula, K. R. and Dhume, S. T. (1998) Glycobiology, 8, 685–694. 

P87-T 

FMN is covalently attached to a specified threonine residue 

via phosphate group in the NqrB and NqrC subunits of 

Na�-translocating NADH-quinone reductase from 

Vibrio alginolyticus. 

M. Maeda1, M. Hayashi2, Y. Nakayama2, M. Yasui2, K. Furuishi3, T. Unemoto2; 1Applied Biosystems, Framingham, MA, 2Chiba Univ., 

3Applied Biosystems, 4-5-4 Hatchobori, Chuo-ku, Tokyo 104-0032, Japan 

Na �-translocating NADH-quinone reductase (NQR) from Vibrio alginolyticus 

is composed of six subunits (NqrA to NqrF). We previously demonstrated that 

both NqrB and NqrC subunits contain a flavin cofactor covalently attached 

to a threonine residue. Fluorescent peptide fragments derived from the NqrB 

and NqrC subunits were applied to a matrix-assisted laser desorption time of 

flight (MALDI-TOF) mass spectrometer and covalently attached flavin was 

identified to be FMN in both subunits. From post-source decay (PSD) fragmentation 

analysis, it was concluded that FMN is attached via phosphate 

group to Thr-235 in the NqrB and to Thr-223 in the NqrC subunits. The ester 

binding of FMN to the threonine residue reported here is a new type of flavin 

attachment to polypeptide. 



P86-M 

GlycoSuiteDB—a database of glycan structures. 

C.A. Cooper, M.J. Harrison, M.R. Wilkins, N.H. Packer; Proteome Systems 

Ltd., North Ryde, Australia, 1/35-41 Waterloo Rd, North Ryde, NSW 2113, 

Australia 

GlycoSuiteDB is a relational database that contains information from the scientific 

literature on glycoprotein derived glycan structures, their biological 

sources, the literature references used to obtain the information, and the 

methods used to determine each glycan structure. The main aims in the construction 

of GlycoSuiteDB are to present a consistent, up-to-date and reliable 

source of information. The database provides an essential resource for the 

glycobiologist and the protein chemist. 

GlycoSuiteDB is available on the web at http://www.glycosuite.com. The 

web site allows the user to search the database using a combination of composition, 

monoisotopic or average mass, protein name, SWISS-PROT/TrEMBL 

accession number, species, biological system, tissue or cell type. There are 

at present no restrictions on the use of GlycoSuiteDB by non-profit organisations 

as long as its content is not modified in any way. Usage by and for 

commercial entities will require a licence after the initial free trial period on 

the web. Full conditions of use will be made available on the web site and 

through GeneBio (www.genebio.com), the exclusive worldwide distributor 

of GlycoSuiteDB. 

P88-S 

Disulfide bridge determination of SETI-IIa, a squash 

trypsin inhibitor. 

V.M. Faca, L.J. Greene; FMRP-USP, Av. Bandeirantes, 3900, Ribeirao Preto, 

Sao Paulo 14049-900 Brazil 

The squash trypsin inhibitor SETI-IIa, one of the smallest strong inhibitors 

described in the literature, contains 31 aminoacids residues of which 6 are 

cysteine residues. Its amino acid sequence is: EDRKCPKILMRCKRDSDCLAKC 

TCQESGYCG. It forms a compact tridimensional structure maintained by 

three disulfide bonds. Due to its small size, this inhibitor can be synthesized, 

using Fmoc chemistry. The reoxidation step which requires formation of the 

correct disulfide bonds is a critical step in obtaining the active inhibitor and 

knowledge of the correct disulfide pairing is required. We describe a procedure 

to determine the disulfide pairing of SETI-IIa using small amounts of 

protein. About 50 nmol (175 �g) of native SETI was submitted to digestion 

with thermolysin for 72 hours at 45�C in a 0.5 M MES buffer pH 6.5. The fragments 

obtained were submitted to RP-HPLC in a C18 column (4.6 � 220 mm) 

in a TFA/Acetonitrile elution system. The major fragments were collected an 

identified by amino acid composition and sequencing by Edman degradation. 

The disulfide bridges obtained from native SETI-IIa and their yields were: 

Cys1–Cys4 (50%), Cys2–Cys5 (10%) and Cys3–Cys6 (38%). This procedure 

will permit us to characterize refolded synthetic analogs of SETI-IIA 

Supported by FAPESP. Faça, V.M. has a FAPESP pre-doctoral fellowship. 



P89-M 

Identification of posttranslational modifications using 

MALDI-TOF-TOF. 

J.P. DeGnore, J. Campbell, P. Juhasz, J. Peltier, M. Vestal; Applied 

Biosystems, 500 Old Connecticut Path, Framingham, MA 01701 

To realize the full potential of proteomics, large numbers of proteins must be 

rapidly identified, usually separated by 2D gels. To investigate the function 

of these identified proteins it is important to determine the potential posttranslational 

modifications. It has been estimated that 80% of mammalian 

cells contain posttranslational modifications (1) and up to one-third of proteins 

expressed in a typical mammalian cell are thought to be phosphorylated 

(2). Identification of the site and type of modification in a protein provides 

insight into the activity and regulation of the posttranslationally modified protein. 

The location of posttranslational modifications within a peptide fragment 

can be determined from mass shifts of the fragment ions in tandem mass 

spectrum. Often the expression of posttranslationally modified proteins is 

low, requiring sensitive detection. Tandem mass spectrometry has become 

the method of choice for identification of posttranslational modifications 

due to it sensitivity and speed. The new MALDI-TOF-TOF mass spectrometer 

allows both rapid protein identification and the determination of the precise 

site of posttranslational modifications. For example, signature ions in the 

low mass range can serve as a tool to screen for phosphopeptides in a high 

throughput experiment. Typical fragmentation patterns will be presented for 

posttranslational modifications including phosphorylation. A number of processing 

tools developed to allow quality peak lists to be derived from the raw 

mass spectra will be presented. 

(1) Kornfield, R.; Kornfield, S., Annu. Rev. Biochem. 1985, 54, 631–664. 

(2) Hubbard, M.J.; Cohen, P. Trends Biochem. Sci. 1993, 18, 172–177. 

P91-S 

The application of a novel precursor ion discovery method for 

the characterisation of phosphoproteins. 

J.I. Langridge1, J.B. Hoyes1, R.H. Bateman1, R.A. Carruthers1, C. Jones1, A. Millar1, O.N. Jensen2; 1Micromass UK Ltd., Floats Road, Wythenshawe, 

Manchester M23 9LZ, United Kingdom, 2Univ.of Southern Denmark, 

Odense Univ. 

The huge increase in genomic sequence information available, combined 

with the increased sensitivity and selectivity provided by mass spectrometry, 

has allowed large-scale protein identification. However the analysis of the 

post translational modifications present on the identified proteins is a more 

challenging problem. 

In this paper we describe a method that allows specific post translationally 

modified peptides to be identified and sequenced during the course of an 

HPLC experiment on the Q-Tof mass spectrometer. During the HPLC run the 

instrument is switched alternately at one-second intervals between low and 

high collision energy with argon in the collision cell. The quadrupole, MS1 

operates in the rf only mode allowing the full mass range to be passed to the 

Tof. The first data set at low energy (4 eV) shows only the normal pseudo 

molecular ions. The second at higher energy contains all their fragments. 

Wherever a product ion of interest occurs in the high-energy data all its possible 

precursors are present in the corresponding low energy data. The mass 

spectrometer may then switch to MS/MS mode selecting the potential precursors 

in turn to reveal the true parent. In addition to creating a mass list of 

precursors from the low energy spectra the computer may also make a list 

of neutral losses from these precursors. The exact mass capability of orthogonal 

Tof’s increase the specificity of the neutral loss particularly in the case 

of a mass deficient loss such as is observed with phosphopeptides. Appearance 

of the neutral loss causes the spectrometer to switch to MS/MS mode 

to acquire additional sequence information and confirmation of the neutral 

loss. 

Examples of this methodology and its application to protein phosphorylation 

will be presented. 



P90-T 

Immunoprecipitation as a method to enrich phosphoproteins 

destined for 2-D gel analysis. 

T.R. Shephard1, A. Ducret2; 1Concordia Univ., Canada, 1455 de Maisonneuve 

West, Montreal, Quebec H3G 1M8, Canada, 2Merck Frosst 

Our lab is interested in the construction of 2D phosphoprotein maps for 

determining the substrates of protein tyrosine phosphatase-1B (PTP-1B), a 

protein believed to play a role in the down regulation of the insulin receptor. 

The construction of 2D phosphoprotein maps is made difficult by the fact 

that 1) phosphoproteins are intermixed with all cellular proteins, complicating 

gel analysis, and 2) phosphoproteins often show relatively low abundance, 

which can result in important proteins being overlooked. 

To overcome the difficulties listed above, we attempted to enrich the phosphoprotein 

content of our cell lysates [obtained from control and insulin stimulated 

immortalized fibroblast cell lines derived from PTP-1B �/� and PTP- 

1B �/� mice (Elchebly, M. et al. 1999 Science. 283, 1544–1548)] through 

immunoprecipitation procedures before proceeding with our 2D gel analysis. 

This was accomplished by pre-clearing total cell lysates and then 

immunoprecipitating under native conditions with a mix of i) monoclonal 

4G10 antibody coupled to agarose beads and ii) biotin-conjugated RC20 antibody, 

as previously described by Lodish et al. (1999 Proc. Nat. Acad. Sci. USA 

97, 179–184). This poster will illustrate the 1D and 2D gel analysis of tyrosine 

phosphorylated proteins immunoprecipitated under a variety of conditions 

from PTP-1B �/� and PTP-1B �/� cell lines. 

P92-M 

Protein modifications in diabetics and individuals taking aspirin 

studied by mass spectrometric and functional assays of fibrinogen. 

A.H. Henschen-Edman; Univ. of California, Irvine, Biological Sciences 2, 

Irvine, CA 92697-3900 

It is a well-known fact that proteins are modified posttranslationally both 

intracellularly and extracellularly. Certain protein modifications may be specifically 

caused by diseases or drugs. In the case of the human blood plasma 

protein fibrinogen, a central protein in blood coagulation, both structural and 

functional properties are altered by glucose in diabetics and by aspirin in 

individuals on that kind of medication. For the structure analysis fibrinogen 

was S-pyridylethylated, cleaved with cyanogen bromide and the resulting 36 

fragments partly separated by gel filtration chromatography; the pools were 

then analyzed by MALDI-TOF mass spectrometry. Glucose and aspirin modify 

amino groups by glycation and acetylation respectively, thereby adding 

the corresponding 162 and 42 amu to the original mass of the fragment. 

Under in vitro conditions extensive modifications and dose-dependent 

increases in the degrees of modification were observed. Additional evidence 

for the reaction with glucose was obtained by sequence analysis of tryptic 

fragments retained by a boronate affinity column; several predicted lysines 

were missing, as they were present in the glycated form. For the function 

analysis fibrinogen was clotted with thrombin and the proteolytic cleavage 

as well as the polymerization-dependent increase in absorbance monitored. 

The effect of glycation and acetylation on the proteolysis was marginal, but 

both caused an extensive and dose-dependent decrease in the polymerization 

reaction. These effects are expected to be of pathophysiological relevance.

P93-T 

Analytical strategies for the identification of phosphorylation 

and O-linked glycosylation sites in proteins. 

A. Furtos-Matei1, J. Kihlberg2, P. Thibault1; 1Natl. Res. Council, Canada, 

2Umea Univ. 

Glycosylation and phosphorylation are between the most common posttranslational 

modifications in proteins. Over the past decade, tandem mass 

spectrometry has become the method of choice for mapping attachment sites. 

In contrast with N-linked glycans, oligosacharides attached to ser/thr residues 

tend to fragment at the glycosidic bond on MS-MS to leave an unmodified 

peptide backbone, thereby making assignment of modification sites more difficult. 

A similar situation is also encountered for phosphopeptides analysis 

where the interpretation of positive ion MS-MS can be more complicated in 

view of fragment showing a loss of H 3 PO 4 moiety. In this work, synthetic glycopeptides 

and phosphopeptides were used to develop a method that allows 

simultaneous determination of phosphorylation and O-linked glycosylation 

sites at serine and threonine residues. The approach we propose is based on 

a ?-elimination reaction followed by a Michael type addition of a nucleophilic 

reagent, which is further used as a marker of the modification site. Among 

other reagents, the volatile triethylamine was selected to induce the elimination 

of both, phosphate groups and O-linked glycans. Several nucleophilic 

reagents have been tested and evaluated by mass spectrometry and capillary 

electrophoresis methods with respect to the chemical yield and the specificity 

toward the targeted functional groups. The relative reactivity of different 

attachment sites as a function of the amino acid nature and the type of modification 

is also discussed. This approach has been applied to enzymatic digestion 

mixtures of model glyco- and phosphoproteins. 

P95-M 

Structural properties of DsRed, a fluorescent protein from coral. 

L.A. Gross1, G.S. Baird1, D.A. Zacharias1, R.C. Hoffman1, K.K. Baldridge2, R.Y. Tsien1; 1UCSD, 9500 Gilman Dr., La Jolla, CA 92093-0647, 2San Diego 

Supercomputer Ctr. 

With the cloning of a red fluorescent protein from the Discosoma species of 

marine corals (Matz et al. 1999), an entire spectrum of colors are now available 

as gene reporters in cell microscopy. Similar to green fluorescent protein 

(GFP) derived from the jellyfish Aequorea, with which it shares only 30% 

homology, DsRed develops its fluorescence without the need for exogenous 

enzymes or co-factors. Studies are on-going to optimize its properties, especially 

for applications involving fluorescence resonance energy transfer 

(FRET). 

DsRed is an oligomer of four �-barrels, as shown by analytical ultracentrifugation 

(Baird et al. 2000). Tandem mass spectrometry has shown that formation 

of the red chromophore involves a second step of oxidation, in comparison 

to the cyclization and oxidation which forms GFP (Gross et al. 2000). 

This extends the conjugation by adding an acylimine functional group at the 

2-position of the imidazolidinone ring of the GFP chromophore. Initially 

upon expression, DsRed emits at green wavelengths. The green color diminishes 

as the protein matures to its red fluorescent form, in a process taking 

3 to 4 days. However, the protein appears not to convert the total population 

of chromophores to the mature, red form. In the tetramer, FRET occurs 

between immature green (as donors of resonance energy) and mature red 

emitters (as acceptors), accounting for the observed fluorescence spectra. 

Matz, M. V., Fradkov, A. F., Labas, Y. A., Savitsky, A. P., Zaraisky, A. G., 

Markelov, M. L. & Lukyanov, S. A. (1999) Nature Biotechnology 17, 969–973. 

Baird, G. S., Zacharias, D. A. & Tsien, R. Y. (2000) Proc. Natl. Acad. Sci. USA 

97, 11984–89. 

Gross, L. A., Baird, G. S., Hoffman, R. C., Baldridge, K. K. & Tsien, R. Y. 

(2000) Proc. Natl. Acad. Sci. USA 97, 11990–95. 



P94-S 

Comparative phosphopeptide mapping from gel-derived proteins 

using a multidimensional mass spectrometry approach. 

R.S. Annan, M.J. Huddleston, F. Zappacosta, C.I. Susan, S.A. Carr; 

SmithKline Beecham Pharmaceut., Box 1539, King of Prussia, PA 19406 

Within the last ten years mass spectrometry has emerged as a key technology 

in the difficult task of mapping protein phosphorylation sites. Previously 

we have described a comprehensive multidimensional phosphopeptide mapping 

strategy which uses mass spectrometry to isolate and identify phosphorylated 

peptides. We have now significantly improved the sensitivity of 

this approach by incorporating capillary HPLC chromatography (0.18 mm 

i.d.) and micro-ionspray mass spectrometer. The current configuration allows 

us to detect and identify less than 200 fmol of phosphopeptides from SDS- 

PAGE derived proteins. Because the first dimension of the analysis utilizes an 

LC separation coupled to on-line phosphopeptide detection, it generates a 

phosphopeptide profile. In this report we will show how such a profile can 

be used for comparative purposes, providing a semi quantitative evaluation 

of how the phosphorylation state of a protein changes under a given set of 

differing conditions. The comparative profile makes it easier to identify and 

concentrate analysis efforts on those phosphorylation sites which are relevant 

to the changing conditions and ignore those which are not. 

P96-T 

Mass spectrometry analysis of the kinetics of in vivo rhodopsin 

phosphorylation. 

K.A. Lee, G.A. Niemi, J.B. Hurley; Univ. of Washington, Howard Hughes 

Medical Institute, Box 357370 Health Sciences Building, Seattle, WA 98195 

Upon light stimulation, rhodopsin, the light-sensing protein in the rod cells 

of the retina, is phosphorylated at several sites as the first step in its deactivation. 

We developed a mass spectrometry-based method to determine the 

kinetics of this phosphorylation in vivo by quantitating the extent of phosphorylation 

at each site. After exposing a freshly dissected mouse retina to 

a flash of light, we use a rapid-quench device is used to quickly terminate 

phosphorylation and dephosphorylation reactions by homogenizing the 

retina in 8 M urea. The samples are washed and proteolyzed to release the 

carboxyl-terminus of rhodopsin, which contains all known phosphorylation 

sites. The resultant peptides are analyzed by LCMS. Synthetic monophosphorylated 

and unphosphorylated peptide standards were used to show 

that the mass spectral response to the rhodopsin peptides is linear over a 

range from 10 fmol to 100 pmol. The relative sensitivities of the mass spectrometer 

to unphosphorylated, singly, doubly, and triply phosphorylated 

peptides were determined using synthetic peptide standards. The resultant 

correction factors were used to determine the relative quantities of the peptides 

in the actual retinal samples. LCMS/MS was utilized to identify three primary 

sites of phosphorylation, S334, S338, and S343. Peptides monophosphorylated 

on S334 were separable from those monophosphorylated on 

S338 and S343 by reverse phase HPLC with our standard C18 column chromatography 

conditions. However, the S338 and S343 monophosphorylated 

peptides coeluted. We demonstrated that the relative amounts of each species 

in the single peak could be determined by monitoring the ratio of specific 

daughter ions characteristic of each peptide. 



P97-S 

An improved procedure using immobilized metal-ion affinity 

chromatography for isolation and characterization of 

phosphopeptides from phosphoproteins. 

K-L. Hsi, D.R. Dupont, S.W. Yuen, C.A. Settinery; Applied Biosystems, 

Foster City, CA, 850 Lincoln Center Drive, Foster City, CA 94404 

It has become clear that phosphorylation is the most common and important 

reversible regulatory modification of proteins. Defining the sites of phosphorylation 

is necessarily important for the mechanism studies of cell regulation. 

However, methods to specifically isolate and characterize phosphopeptides 

remain challenged, especially for those proteins separated from 

1D/2D gel at low concentration. An attempt is thus made to improve the procedure 

based upon immobilized metal-ion affinity chromatography (IMAC) 

for working with sub-microgram amount of phosphoproteins. 

A protease digest of gel-separated phosphoprotein was treated with immobilized 

Fe�� on a chelating resin. The affinity bound phosphopeptides were 

then eluted from the resin with ammonium acetate buffer. We use a mini-size 

(250 �l) of cartridge to perform all the processes of isolation of phosphopeptides 

including washing of the resin, binding and elution of the phosphopeptides, 

instead of an open column as previously reported. 

This improved procedure provides some advantages over the previously 

reported open column method: 1. Fast, i.e. 30 minutes or less. 2. High washing 

efficiency, thus high recovery of pure phosphopeptides. 3. Sensitive 

working level, i.e. sub-microgram of gel separated phosphoproteins. 

Several phosphoproteins with different types of phosphorylation (Ser, Thr 

and Tyr) have been studied using the improved procedure. The effectiveness 

of the procedure was demonstrated by chemical sequencing and MS/MS 

analysis of MicroBlotter-collected phosphopeptides. 

P99-T 

Synthesis of lactam-bridged dipeptides mediated by 

aminoacylpyroglutamates. 

I. Rodionov, A. Chulin, V.T. Ivanov; Br. of Shemyakin-Ovchinnikov Inst. 

of Bioorganic Chem., 8 Academy Avenue, Pushchino, Moscow Region 

142290, Russian Federation 

Aminoacyl incorporation reaction (AI) discoverd about 40 years ago by Shemyakin 

et al. has been evaluated as a general synthetic route to variously 

constrained lactam-bridged dipeptides. The AI is effectively a ring enlargement, 

which involves intramolecular acylation of amino group (or different 

nucleophilic functions like HS- and HO-) by the activated cyclic diacylamino 

moiety via intermediate formation of bicyclic azacyclols. The most straightforward 

models for studying AI are aminoacylated pyroglutamates derived 

from diaminoacids 

R-Xaa-Glp-OR� (I), Xaa � Lys, Orn, Dab and Dpr, 

a class of unusual peptides, which remains unexplored as yet. We have studied 

3 different synthetic approaches to I: 

direct acylation of sodium derivative of Glp-OR�; 

pyrrolidone ring closure in the plain dipeptides R-Xaa-Glu(OX)-OR� promoted 

by bases and/or by activation of side chain carboxyl of Glu; 

selective oxidation of the related proline dipeptides Boc-Xaa-Pro-OR� by 

ruthenium tetroxide/sodium periodate. 

Scope and limitation of the above approaches will be discussed and exemplified 

by the synthesis of 26 protected dipeptides I. As expected, deprotection 

of amino or hydroxy functions followed by exposure to potassium carbonate 

buffer, pH 9.5 (water-acetonitrile) resulted in smooth AI for the 

majority of the synthesized dipeptides I. No oligomerization products were 

detected. In this way a number of bridged dipeptides (9–12 membered 

cycles) were obtained in 35–70% yield and characterized by NMR and MS 

data. NMR data suggested that in 4 cases stable azacyclols have been isolated. 



P98-M 

Postsynthesis labeling of agiotensin II peptide with d-rhodamine 

for fluorescence monitoring of receptor binding. 

S.P. Yadav, W-Z. Shen, Y. Luo, J. Zhang, S. Karnick; Lerner Res. Inst., 

Cleveland, Mail Code NC10, 9500 Euclid Avenue, Cleveland, OH 44195 

Solid-phase peptide synthesis is now routinely used for drug discovery and 

immunological research and for studying the structure-function relationships 

of proteins. Protein-protein interactions play an important role in a wide variety 

of biochemical and physiological processes and generally involve large 

interfaces with many intermolecular contacts. In addition, protein-protein 

interaction may also occur through small surface binding epitopes such as in 

the case of human growth hormone-receptor binding and erythropietinreceptor 

complex formation. Therefore, the rational design of relatively small 

molecular size peptide activators/inhibitors for receptor surfaces has long 

been considered a formidable challenge. These findings convincingly open 

up the possibility that small peptides that mimic such small binding epitopes 

may help to block a large protein-protein interface. Usefulness of this hypothesis 

in drug design rationale remains to be further tested in different biological 

systems. Furthermore rationalization of general approach of inhibition of 

protein-protein interaction will of course have a tremendous impact on 

development of new therapeutic strategies for several human diseases. That 

is where fluorescent dye labeling of synthetic peptides becomes important. 

Studies on labeling of a peptide with fluorescent dyes in a manner without 

altering functional characteristics of the peptide are of considerable interest 

for studying the peptide-receptor interactions. Strategy for synthesis of an 

octa-mer angiotensin II by Fmoc chemistry and subsequent labeling of the 

cleaved peptide with Rhodamine dye are discussed in this report. The results 

of double labeling are presented here to show that the removal of excess free 

Rhodamine is critically important in confocal microscopy. 

P100-S 

The characterization of prostate specific antigen activating peptide. 

M. Pakkala1, P. Wu2, J. Leinonen2, U-H. Stenman2, J. Vepsäläinen1, A. Närvänen1; 1Univ. of Kuopio, P.O. Box 1627, Kuopio 70211, Finland, 

2Univ. Central Hosp., Helsinki 

Prostate specific antigen (PSA) is widely used as a marker of prostate cancer. 

PSA is a 30 kD serine protease and belongs to Kallikrein family. Peptides 

with specific binding properties to PSA were studied by using phage display 

peptide libraries. Four different PSA binding clones were isolated and characterized. 

One of the clones, containing 13 amino acids sequence with four 

cysteines, showed the highest affinity for PSA. This peptide (C4), as a fusion 

protein with glutathione-S-transferase (GST), increased the protease activity 

of PSA against a synthetic substrate (Wu et al. (2000), Eur. J. Biochem. 267, 

1–10) 

We have synthesized the active peptide C4 (CVAYCIEHHCWTC) and its modifications 

by using conventional solid phase peptide synthesis method (SPPS). 

Two cysteines (2. And 3.) were protected by using Acm protecting group, 

which remains uncleaved during the removal of the peptide from the resin. 

The final cyclization was made during the removal of the Acm-group from 

cysteines by Iodine treatment. The synthetic analog showed same activity to 

PSA than the original GST fusion protein where as the activity of the peptide 

with two Acm groups was less than 50% from the fully cyclized form. The 

acetylation of the ?-amino group did not affect to the activity. In addition we 

synthesized cyclic version with amide bond VAYCIEHHCWT instead of the 

cysteines 1. and 4. by using Allyl protected E(6) (Fmoc-L-Glu-OAll) as a starting 

amino acid. The final peptide was cyclic with one disulfide bond. This 

modification was totally inactive. 

The results suggest that the correct secondary structure of the peptide C-4 

plays an important role in increased activation of PSA. Structure analysis by 

NMR is under study. Based on the preliminary NMR results the prepared peptides 

are rather flexible and the structures are strongly dependent on the temperature.

P101-M 

Implementing surface plasmon resonance biosensors in 

drug discovery. 

D.G. Myszka; Univ. of Utah, 50 N. Medical Dr./School of Medicine Rm 

4A417, Salt Lake City, UT 84132 

Recent improvements in instrument hardware, experimental design, and 

data processing make it possible to utilize surface plasmon resonance (SPR) 

biosensor technology in the discovery and development of small-molecule 

drugs. The key features of SPR biosensors, real-time binding analysis and lack 

of labeling requirements, make this technology suitable for a wide range of 

applications. Current instruments have a throughput of �100–400 assays per 

day, providing a complement to high-throughput screening. The ability to 

collect kinetic data on compounds binding to therapeutic targets yields new 

information for lead optimization. Small-molecule analysis and emerging 

applications in the areas of ADME and proteomics have SPR biosensors 

poised to play a significant role in the pharmaceutical industry. 

P103-S 

Mapping of protein-protein interactions using mass spectrometry. 

D. Figeys, H. Duewel; MDS-Ocata, Toronto, 480 University Avenue 

Suite 401, Toronto, Ontario M5G 1V2, Canada 

Functional proteomics is becoming the next generation of large-scale proteomic 

approaches. It is based on the concept that the function of a protein 

is defined by its interactions. Therefore, large-scale approaches for the mapping 

of protein-protein interactions at the cellular level will be essential to 

the comprehensive understanding of the interactome, i.e. the protein-protein 

interactions related to a proteome. Here we will present an approach for the 

large-scale screening of the interactome using mass spectrometry. This technology 

identifies proteins involved in specific protein-protein interactions 

using protein identification by mass spectrometry. We will also discuss the 

incorporation in the process of novel technology, such as the ICATtm technology, 

for the rapid and relative quantitation of proteins by mass spectrometry. 



P102-T 

Study of the protein-DNA interaction responsible of the carbon 

catabolite repression in Lactobacillus casei. 

C.D. Esteban1, K. Mahr2, G. Pérez-Martínez1, W. Hillen2, F. Titgemeyer2; 1Agrochem. and Food Technol. Inst., Burjassot, Spain, Apartado de 

correos 73, Burjassot, Valencia 46100 Spain, 2Erlangen-Nürnberg Univ. 

In the industrially relevant lactic acid bacterium Lactobacillus casei the preferential 

utilization of carbon sources is controlled by the mechanism of carbon 

catabolite repression (CCR). As in other low-G�C gram-positive bacteria, 

CCR takes place through the binding of the transcriptional repressor, 

CcpA, to an operator called cre (catabolite responsive element). CcpA binding 

to cre sequences is enhanced by its correpressor HPr-ser46-P. 

It was our aim to characterize this protein-DNA interaction by Surface Plasmon 

Resonance (SPR). For this purpose CcpA was overexpressed and purified 

both with an N-terminal poly-histidine tag and without this tag. HPr was 

overexpressed, purified and in vitro phosphorylated. A synthetic biotinylated 

double stranded oligonucleotide containing the cre sequence present in the 

promoter of the lac operon of L. casei was immobilized on a streptavidin sensor 

chip. SPR experiments were performed flowing a range of CcpA (with 

and without his tag) concentrations over the chip in the presence and 

absence of saturating amounts of HPr-ser46-P. The experimental parameters 

for data acquisition were optimized and equilibrium and semiquantitative 

kinetic analysis allowed the calculation of KD and estimation of kinetic association 

and dissociation rate constants for protein-DNA interaction. 

The experimental parameters for the study of this protein-DNA interaction by 

SPR have been established. Binding of unmodified CcpA to the cre sequence 

was characterized by equilibrium and kinetic rate constants. The presence of 

the his tag was shown not to interfere (results with and without his tag are 

comparable). In conclusion, we have developed a powerful system to accurately 

characterize the intermolecular relationships of histidine tagged CcpA 

that could allow efficiently characterizing mutations in CcpA in the near 

future. 

P104-M 

Affinity chromatography and mass spectrometry in dissecting 

EGFr signaling interdicted by the quinazoline EGFr inhibitor 

OSI-774. 

J.D. Haley1, A. Thelemann1, H. Pan1, D. Fenyo2; 1OSI Pharmaceut. Inc., 

106 Charles Lindbergh Blvd., Uniondale, NY 11553, 2Proteometrics LLC 

The blockade of EGFr signaling by the quinazoline tyrosine kinase inhibitor 

OSI-774 was investigated by direct affinity chromatography, reverse-phase 

chromatography and mass finger-printing. Phosphotyrosine complexes from 

OSI-774 and control treated HN5 squamous carcinoma cells were prepared 

by both Triton X-100 and RIPA lysis. Protein fractionation by SDS-PAGE was 

compared with capillary HPLC. Protein fractions were proteolytically digested 

with either trypsin, GluC or LysC, desalted by microC18 reverse phase tips 

and subjected to matrix assisted laser desorption- time of flight mass spectrometry. 

C4 chromatography greatly improved the signal strength and resolution 

of the peptide spectra obtained, when compared to direct MALDI MS 

of digested immunoaffinity fractions. 

Eighty-eight spectra were evaluated from five HN5 phosphotyrosine protein 

complex chromatography separations. Mass analysis was performed using a 

PerSeptive DE-Pro mass spectrometer using a-cyano-4-hydroxycinnamic acid 

or dihydrobenzoic acid matrices. Data were analyzed using RADARS, a SQL 

compliant database search engine allowing comparison across experiments 

of proteins identified under different experimental conditions (e.g. trypsin vs. 

GluC). The predominant protein identified was the epidermal growth factor 

receptor (EGFr) which was found in the major C4 HPLC protein fraction. 

Phosphorylation on both P1 and P2 C-terminal tyrosines was readily observed 

by mass spectrometry. A large number of well known and less defined 

proteins which either (1) contain phosphotyrosine or (2) form stable complexes 

with targets proteins were identified from multiple experiments. The 

Triton X100 lysis and affinity capture methodology allows the identification 

of known and novel protein complexes not detected by gel-based techniques. 



P105-T 

Innovations in proteome analysis: biomolecular interaction 

analysis mass spectrometry. 

R.W. Nelson, D. Nedelkov; Intrinsic Bioprobes Inc., 625 S. Smith Rd. 

Suite 22, Tempe, AZ 85281 

The relative ease and fast pace by which the genomic data has been gathered 

stands out against the complexity of the proteome world and the 

involvedness required for protein characterization. Even though significant 

strides have been made lately in several protein characterization techniques, 

novel technologies and multiplexation of the existing ones are required to 

fully address the many sides of the proteome. 

Biomolecular Interaction Analysis Mass Spectrometry (BIA/MS) is a twodimensional 

chip-based analytical technique geared toward quantitative and 

qualitative detection and analysis of small volumes of biological samples. In 

the first (functional) dimension, BIA/MS takes a form of micro-scale planaraffinity 

chromatography performed on a sensor-active surface. Surface plasmon 

resonance (SPR) is used for detection of biorecognition events that 

occur at a sensor surface/solution interface between an immobilized biomolecule 

(the ligand) and its interacting partner (the analyte) present in the 

sample solution. For the second (structural) dimension, BIA/MS employs 

MALDI-TOF MS analysis. With minimal physical modifications and thorough 

application of MALDI matrix, SPR-active sensor surfaces are converted to 

amenable MALDI target. The ensuing mass spectrometry analysis serves the 

purpose of validating the SPR sensing data by providing the molecular mass 

of the retained analyte and it yields other qualitative information about the 

SPR-monitored interaction, such as identification of non-specific binding, 

binding of analyte variants/fragments and multi analyte binding. Presented 

here are results from the utilization of BIA/MS in detection of a number of 

biological markers found in complex biological fluids. Small volumes of 

human plasma and urine were analyzed for cystatin C, beta-2-microglobulin, 

urinary protein 1, retinol binding protein and transthyretin, exploring the 

effectiveness of BIA/MS in simultaneous detection of clinically related biomarkers. 

Issues such as limit of detection, recognition of protein complexes 

and delineation of non-specific binding were also explored. 

P107-M 

Miniature integrated surface plasmon resonance biosensor for 

characterization of protein-protein interactions. 

M.L. Stolowitz, G. Li, K.P. Lund, J.P. Wiley; Prolinx, Inc., 

22322 20th Avenue SE, Bothell, WA 98021 

The utility of a miniature integrated surface plasmon resonance biosensor is 

described. The disposible device is approximately the size of a thumbnail and 

houses all of the optics and electronics needed to acquire surface plasmon 

resonance sensorgrams. The gold sensor surface has been modified so as to 

minimize nonspecific binding and utilizes Versalinx Chemical Affininty Tools 

to facilitate the immobilization of macromolecular targets for binding studies. 

The utility of the biosensor is demonstrated in conjunction with a prototype 

data acquisition interface and a simple orbital shaking device. 



P106-S 

Dissecting structure-function relationships in RNA/protein 

interaction using biocore. 

I.A. Laird-Offringa1, P.S. Katsamba1, D.G. Myszka2; 1Univ. of Southern 

California, 1441 Eastlake Ave., Los Angeles, CA 90089-9176, 2Univ. of Utah 

RNA-binding proteins play critical roles in gene expression and regulation at 

the post-transcriptional level. While much is known about the various naturally 

occurring RNA-binding motifs, and co-crystal structures of a number of 

RNA/protein complexes are available, very little is known about the dynamics 

of RNA/protein interactions. We have used the spliceosomal protein U1A 

and its RNA target in the U1 small nuclear RNA (U1hairpinII or U1hpII) as a 

model to study the kinetics of RNA/protein interaction. Using the previously 

solved structure of the U1A/U1hpII complex, we have engineered a series of 

mutants designed to probe the roles of electrostatics, hydrogen bonding, aromatic 

stacking, and RNA loop length, all of which have been implicated in 

formation of the U1A/U1hpII complex. The effects of these mutations on the 

binding dynamics were studied using BIACORE, which yielded high quality 

kinetic data about the interaction. We determined that neutralization of positive 

charges on the protein slows the association rate and reduces the deleterious 

effect of salt on complex formation. In contrast, removal of hydrogenbonding 

or stacking interactions within the RNA/protein interface, or 

reducing the size of the RNA loop, increases the dissociation rate. Our data 

support a mechanism of binding consisting of a rapid initial association 

based on electrostatic interactions and a subsequent locking step based on 

the hydrogen bonding and stacking interactions that occur during the 

induced fit of RNA and protein. Our results demonstrate the power of BIA- 

CORE to dissect the functional differences between structural features of two 

interacting macromolecules. 

P108-T 

The study of peptide-peptide interaction by ion-mobility MALDI. 

A.S. Woods1, J. Koomen2, M.A. Huestis1, K.J. Gillig2, D.H. Russell2, A.J. Schultz3, K. Fuhrer3, M. Gonin3; 1NIDA, NIH, 5500 Nathan Shock 

Drive, Baltimore, MD 21224, 2Texas A&M Univ., 3Ionwerks Inc. 

We showed in previous work that MALDI could be used to study peptidepeptide 

interactions. Matrices such as ATT [pH 5.4] do not disrupt non-covalent 

interactions, while more acidic matrices such as CHCA [pH 2.0] do. Our 

study found that one peptide had to have 2 adjacent Arg [RR] or an Arg-Lys- 

Arg [RKR] motif and the other had to have a minimum of two adjacent Glu 

[EE] or Asp [DD] in order to form a complex. 

In this work we used MALDI/mobility/TOF mass spectrometry to further 

study the formation of these non-covalent complexes [NCX]. The instrument 

consists of a short drift tube (the ion-mobility cell) in which is applied an 

electric field which causes the MALDI ions to drift through a Helium carrier 

gas (2 torr) into an orthogonal TOF mass spectrometer. Ion-mobility [IM] separates 

gas phase ions on the basis of their collision cross section-to-charge 

ratio, when combined with mass spectrometry it can be a powerful instrument 

for structural studies to determine the conformations of biomolecules. 

Dynorphin (a 17 a.a. peptide that contains an RR motif) and several other 

peptides containing two RR or RKR motifs formed NCX with acidic peptides 

(containing 2 or more adjacent Glu or Asp) and were detected by IM and 

TOF MS. We discuss the capabilities and limitations of this new instrument 

when applied to the gas phase conformational study of MALDI desorbed 

NCX, as well as the advantages of looking at peptide mixtures by IM in addition 

to MALDI-TOF MS

P109-S 

Protein molecular communications involving two or more 

different ligands studied by microcalorimetry. 

M.L. Doyle; Bristol-Myers Squibb Pharmaceut. Res. Inst., Mail Stop H13-07, 

206 Provinceline Rd., Princeton, NJ 08543-4000 

Biophysical methods are capable of characterizing the functional chemistry 

of protein-ligand interactions at a high, molecular level of resolution. Typically, 

biophysical studies have focused on interactions involving one protein 

with a single ligand. However, the biological roles of many proteins are likely 

to be regulated by interactions with multiple ligands. In this tutorial we 

describe how biophysical methods, particularly Isothermal Titration Calorimetry 

(ITC), can be used to begin to deconvolute the interdependency that 

different multiple ligands have on a protein’s function. Two examples will be 

presented. One case involves comparing the binding interactions of a TNF 

cytokine with four different members of the TNF receptor superfamily in 

order to predict which receptor may be most biologically relevant (1). The 

other example describes a case where two different small molecules regulate 

the binding of one another to an enzyme (2). 

References 

1) Truneh, A., Sharma, S., Silverman, C., Khandekar, S., Reddy, M.P., Deen, 

K.C., Mclaughlin, M.M., Srinivasula, S.M., Livi, G.P., Marshall, L.A., Alnemri, 

E.S., Williams, W.V. and Doyle, M.L. (2000) J. Biol. Chem. 275, 23319–23325. 

2) Du, W., Liu, W-S., Payne, D.J. and Doyle, M.L. (2000) Biochemistry 39, 

6003–6011. 

P111-T 

Long-range fragment sizing on MegaBACE genotyping instrument. 

M. Minarik, K. Pirkola, M. Mahtani; Molecular Dynamics, 

928 E. Arques Ave., Sunnyvale, CA 94085 

Over the past decade, DNA fragment analysis by capillary electrophoresis has 

become a powerful alternative to classic sizing by slab gel electrophoresis. 

The most important applications include microsatellite genotyping, AFLP 

fingerprinting, differential display and SNP typing. Due largely to slab gel limitations, 

most current protocols are based on fragment sizing only 300–500 

bp. Extending this size range is desirable in order to accelerate throughput 

by increasing either the depth of microsatellite multiplexing, or the effectiveness 

of fingerprinting and differential display applications. Recently published 

results from long-read DNA sequencing suggest a possibility to separate 

DNA fragments over a large size range with high resolution (Zhou et al., 

Anal Chem 2000). The key factors are proper composition of separation 

matrix and optimal selection of experimental parameters defining injection 

and separation conditions. 

In the present work, we have evaluated a sizing precision of large fragments 

up to several kilobases. Using optimized running conditions, we demonstrate 

routine sizing up to 1 kb with 2 base resolution in 120 minutes. For longer 

fragments, the sizing resolution was between 5 and 10 bases with analysis 

times under 3 hours. We present the influence of various experimental conditions 

on the peak resolution and its impact on the overall quality of sizing. 



P110-M 

Protein biochips: powerful new tools in proteomics. 

K.L. Witte1, F. Zaugg1, P. Indermuhle1, L. Ruiz-Taylor1, N. Tolani1, B. Muehlbauer1, P. Wagner1, S. Nock2; 1Zyomyx, Inc., 3911 Trust Way, 

Hayward, CA 94545, 2Zyomyx, Inc. 

With the imminent sequencing of the human genome there is a growing 

need for technologies, which can study the resulting wealth of gene products. 

While technological innovation has adapted the analysis of genetic 

material to a highly parallel and miniaturized format, the more delicate 

nature of protein structures has precluded the development of analogous 

devices. However, to achieve a fundamental understanding of biochemical 

pathways, high-throughput biology has to be expanded to protein analysis, 

proteomics and multi-target screening. 

We have developed high-density protein microarrays for quantification of 

multiple proteins in complex mixtures. These microarrays contain 10.000 individually 

addressable features in a 1 cm � 1cm area. The implementation 

of new surface chemistries allows the immobilization of exactly defined 

quantities of proteins on each spot while retaining the activity of the protein. 

Using this platform we have developed a multiplexed, microchip-based 

immunoassay to analyze expression levels of serum proteins. We demonstrate 

the binding of proteins of interest with very low non-specific binding 

from non-cognate proteins using fluorescence as readout. Detection limits on 

this microassay are equal to or lower than commercial ELISA tests and reduce 

the sample volume by many orders of magnitude. 

P112-S 

High throughput SNP genotyping on MegaBACE using multiple, 

time-spaced injections. 

A. Shuster1, D. Shen1, Y. Tsunoi1, M. Minarik1, K. Pirkola1, K. Jones1, T. Deldot1, R. Belcinski1, A. Mamone2, K. Dains1, M. Mahtani1; 1Molecular 

Dynamics, 928 E. Arques Ave., Sunnyvale, CA 94085, 2Molecular Dynamics 

We have developed a method for high throughput SNP genotyping on the 

MegaBACE 1000 capillary electrophoresis platform. The system takes 

advantage of the instrument’s flexibility to load 12 96-well sample plates over 

a period of about 30 minutes, using a proprietary method of repeated, timespaced 

injections. Samples are prepared in a single-tube SNuPe (Single 

Nucleotide Primer Extension) reaction which contains the four different fluorescently-labeled 

dideoxynucleotides (terminators), Thermosequenase enzyme 

and optimized reaction buffer. After single base extension and cleanup, 

SNP products are loaded onto the MegaBACE by automated electrokinetic 

injection. Multiple, pulsed injections of up to 12 different SNP marker plates 

are then loaded into the same polymer matrix, spaced at two minute electrophoresis 

intervals. Separation provides the advantage of excellent signalto-noise, 

predictable and characteristic marker genotype patterns, and good 

discrimination of negative controls over sample failures. 1300 SNP genotypes 

can be obtained with a turnaround time of less than 2 hours; we expect that 

further color and size multiplexing will greatly increase throughput. A characteristic 

injection marker is added to each sample prior to injection, acting 

both as internal control and also demarcating each injection from the next. 

A separate software package, SNP Profiler automatically processes the signal 

data and outputs the maximum likelihood SNP genotypes, and includes a 

user interface for editing and verification. The system can be completely 

switched between any three applications—high throughput sequencing, SNP 

typing or microsatellite genotyping—in less than five minutes. 



P113-M 

An automatable magnetic particle-based kit for the removal of 

dye terminators. 

D.A. Spicer, K.A. Hughes, R.J. Kaiser, A.L. Springer; Prolinx, Inc., 

22322 20th Avenue South East, Bothell, WA 98021 

Prolinx ® Inc. has developed the RapXtract dye terminator removal system 

that is fully automatable for high throughput purification of cycle sequencing 

reactions. The kit is based on a novel magnetic particle format allowing 

for rapid purification of up to 384 samples at one time, depending on the 

robotic platform. The kit provides reproducible, high-quality results without 

the need for modified primers. The RapXtract kit is easily automated, as it 

does not require centrifugation, vacuum filtration, or multiple wash steps. 

The kit has been automated on several platforms including the TECAN Genesis, 

and the Tomtec Quadra 384 model 320. 

P115-S 

Systematic validation and optimization of capillary electrophoresis 

for high performance genotyping and fragment analysis. 

D. Shen, M. Minarik, A. Shuster, K. Pirkola, S. Gopalan, K. Dains, 

M. Mahtani; Molecular Dynamics, 928 E. Arques Ave., Sunnyvale, CA 94085 

Capillary electrophoresis systems have quickly replaced traditional fluorescent 

slab gels for DNA analysis in many laboratory environments. The technology 

transition has been abrupt and, on the up-side, has excitingly 

advanced the Human Genome Project. On the down-side, the transition for 

many labs has occurred without a clear understanding of the strengths and 

weaknesses of the new technology, methods for troubleshooting, and experience 

in setting benchmarks. We have spent the past year validating and 

optimizing the capillary electrophoresis platform, the MegaBACE for high 

throughput genotyping and fragment analysis. In the development of the system, 

we have devised a set of metrics and guidelines that predict the system 

performance. 

We present data and benchmarks on variables including optical response, 

dynamic range, sizing precision and reproducibility, resolution, throughput, 

capillary and sample success rates, and other critical parameters of system 

performance. These metrics offer a better understanding of proper system 

function, and indices for perturbations of that function. We also provide data 

on the performance of the software and the effects of modifications to the 

workflow on the genotype outputs. In addition, we present a process control 

system (including software and chemistry) that can be used to evaluate 

the system performance or to test new methods and protocols before integrating 

them in a production environment. In collaboration with others, we 

will present data on the system’s performance for fragment analysis applications 

including microsatellite genome scanning, AFLP analysis, SNP genotyping, 

and differential display. 



P114-T 

Applications of an electric field-assisted capillary LC technique 

and instrumentation for biological macromolecules analysis. 

F.J. Yang, Y-H. Jou, C. Wu, C. Wu, Y.W. Hong; Micro-Tech Scientific, 

140 South Wolfe Road, Sunnyvale, CA 94086 

Recent rapid growth in the needs for biological macromolecules analysis and 

drug discovery research has increased significantly the utilization of capillary 

column separation techniques such as capillary column LC, capillary column 

electrophoresis, and capillary column electro-chromatography etc. The 

growth in the applications of capillary column separation techniques is also 

driven by the commercialization of electro-spray and nano-spray LC-MS 

interfacing techniques that allow mass spectra-analysis of biological macromolecules. 

Major advantages of capillary column separation techniques are: 

1). Improvement of detection limit by more than 2000 times in comparison 

to that possible using conventional 4.6 mm id columns. The smaller the column 

diameter, the lower the detection limits. It allows femto-mole detection 

of trace amount of biological samples. 

2). Direct interface to MS has greatly increased the applications of MS for biological 

sampler analysis. 

3). It reduces solvent consumption by more than 2000 times. 

4). 2D LC-MS can be easily configured for rapid sample clean up, de-salt, 

matrix elimination, and sample concentrating. It allows fast capillary LC-MS 

for high through put sample analysis. 

5). Capillary columns are common to capillary LC, CE, and CEC, it facilitates 

an unified methodology and instrumentation for harness the advantages of 

capillary column separation utilizing both differential electrophoretic migration 

of charge molecules and the differential mobility of the sample molecular 

zones carried by either electro-osmosis flow or hydrodynamic flow. 

This presentation will discuss the concept of an unified capillary column separation 

methodology and the design of the instrumentation that can perform conventional 

CE and CEC. It can also be utilized for both low pressure and high 

pressure gradient (pH, buffer strength, and organic composition gradient) CE 

and CEC applications. Examples for the applications of the unified capillary separation 

system in the electrical- field assisted high pressure capillary gradient LC 

applications for biological macromolecules analysis will also be presented. 

P116-M 

Long sequence readlengths with the MegaBACE 1000 

DNA Analysis System. 

J. Ellerbrock1, M. Reagin1, A. Mamone2, J. Nelson1, B. McArdle1, C. Fuller1; 1AP Biotech, 800 Centennial Ave., Piscataway, NJ 08855, 

2Molecular Dynamics 

MegaBACE 1000 DNA Analysis System is a high-throughput, fluorescencebased 

DNA sequencer that utilizes capillary electrophoresis with 96 capillaries 

operating in parallel. The system automates gel matrix replacement, sample 

injection, DNA separation, and data analysis with integrating software. 

The sensitivity of DYEnamic ET energy transfer terminators and the superior 

resolving power of linear polyacrylamide (LPA) separation matrix allow 

detection over a broader range of template amounts. Likewise, the robust 

performance of Thermo Sequenase II DNA polymerase improves success 

rates. 

The MegaBACE 1000 has the ability to sequence 96 samples in just 2 hours, 

perform up to 9 runs per day, and can be used in both high-throughput and 

core DNA analysis facilities. In high-throughput facilities it can produce as 

much as 500,000 raw sequence bases a day. We have developed protocols 

that allow reads of over 1000 bases ideally suited for final overnight runs (4–6 

hours) when such sustained high-throughput is not required. We will present 

a variety of examples and protocols to obtain optimal results on the system. 

Data will be presented showing long DNA readlengths on a variety of different 

templates (BAC, plasmid, M13, high GC, or PCR product) using the 

DYEnamic ET terminator cycle sequencing kit and the MegaBACE 1000 system.

P117-T 

New separation medium for the ABI Prism ® 3700 DNA Analyzer 

and ABI Prism ® 3100 Genetic Analyzer. 

B.F. Johnson1, K.O. Voss2, J.N. Tian2, J.A. Fisher2; 1Applied Biosystems, 

850 Lincoln Centre Drive, Foster City, CA 94404, 2Applied Biosystems, 

Foster City, CA 

A new separation medium for the ABI PRISM ® 3700 DNA Analyzer and ABI 

PRISM ® 3100 Genetic Analyzer has been developed. The new polymer formulation 

has a viscosity similar POP-5 and POP-6 formulations previously 

released for DNA separations on our capillary instruments and consequently 

has similar capillary filling times and sheath flow characteristics. High quality 

separations can still be obtained with bare capillaries with a minimum of 

100 separations before cleaning or replacement of the capillary array. Compared 

to POP-5 separation medium using the default run conditions for 

POP-5 on the ABI PRISM ® 3700 DNA Analyzer, the new separation medium 

results in a 20% decrease in electrophoretic separation time while increasing 

one-base peak resolution by 100 bases. On the ABI PRISM ® 3700 DNA Analyzer 

with a 50 cm array the new polymer formulation under these conditions 

results in an average length of read of 850 bases at 10 runs per day. On the 

ABI PRISM ® 3100 Genetic Analyzer the new polymer formulation results in 

an average length of read of 825 bases in a 50 cm array at 16 runs per day. 

Basecalling length of reads obtained from ABI PRISM ® Sequencing Analysis 

(1% error) and from TraceTuner 1.1 analysis software will be compared at different 

separation voltages, distances, and temperatures. Run parameters that 

yield the maximum length of read or maximum number of runs per day will 

be presented. 

P119-M 

Converting from slab gel to capillary electrophoresis: 

a user’s guide for genotyping. 

C.L. Brown, B.F. Johnson, C. Wike, K. Roy, A. Wheaton, Y. Wang, 

N. Caffo; Applied Biosystems, 850 Lincoln Centre Drive, MS 404-1, 

Foster City, CA 94404 

Capillary electrophoresis has rapidly become the platform of choice for 

human disease research, clinical diagnostics and population genetics studies 

due to its ease of operation, automation and increased throughput. Historically, 

most protocols were developed on slab gel instruments due to their 

flexibility, high throughput and consistency, yet required considerable cost 

and labor. The ABI PRISM ® 3100 Genetic Analyzer, a 16-capillary electrophoresis 

instrument, was introduced to match the throughput and reproducibility 

of slab gels while offering lower run costs, less human intervention 

and greater sensitivity. Laboratories considering the conversion from slab gel 

systems should be mindful of a few distinctions between these two platforms. 

Herein, we will discuss modified sample preparation, fragment mobility differences 

and suggestions for multiplexing schemes. We will also highlight 

enhancements to data analysis, which reduce existing rate limiting steps. 



P118-S 

Modifications to 96-well DNA preparation kits for the 

MegaBACE 1000. 

R. Dhulipala1, B. McArdle1, A. Mamone2; 1AP Biotech, 

800 Centennial Ave., Piscataway, NJ 08855, 2Molecular Dynamics 

With the introduction of high-throughput DNA sequencing instruments, 

methods for simultaneous preparation of template samples have come into 

common usage. Several groups have developed plasmid preparation methods 

enabling the user to easily decrease the time to prepare 96 DNA samples 

and thus increase sequencing throughput. The majority of these kits are 

based upon traditional alkaline lysis of bacterial culture yet differ in their 

method of purification of DNA. We have evaluated several of these methods 

for preparing templates for the MegaBACE 1000 capillary instrument. We find 

that results obtained with capillary sequencing instruments are dependent 

upon the quality and amount of the starting template. Hence, results might 

vary greatly due to the method of DNA preparation. 

We have found that most of the preparation methods and kits are configured 

to optimize DNA yield, not well-to-well consistency. Fortunately, the DNA 

yields are greater than necessary and simple modifications to the standard 

protocols can be made that improve consistency without reducing yields significantly. 

Each purification method is evaluated for amount and consistency 

of DNA yield, and sequencing performance using DYEnamic ET terminators 

and the MegaBACE 1000. In addition, we make recommendations 

for each method to achieve optimal success rates with the system. 

P120-T 

Sequencing reaction purification of BAC DNA using a combination 

of molecular weight cut-off membrane and a new grade of 

Sephadex G-50. 

R. Dhulipala, A. Kumar; AP Biotech, 800 Centennial Ave., Piscataway, 

NJ 08855 

The purification of DNA sequencing reactions by ethanol precipitation or gel 

filtration prior to the loading of automated fluorescent DNA sequencing 

instruments is a standard technique for the removal of unincorporated dye 

terminators. One standard gel filtration method that we have developed into 

a ready-to-use 96-well format with pre-swollen DNA Grade Sephadex 

G-50 is AutoSeq96 (please see our companion poster). AutoSeq96 purification 

is six times faster than ethanol precipitation, is easy to use, and minimizes 

handling because samples are purified directly into 96-well collection 

plates. However, one aspect of DNA sequencing reaction purification that has 

remained cumbersome for some types of samples containing large DNA 

constructs is the additional removal of template DNA. 

We have developed a new type of gel filtration method for purifying DNA 

sequencing reactions using the basic format of the AutoSeq96 plate but with 

the added benefit of template removal. Elimination of template DNA prior to 

electrophoresis can both increase the overall success rate of the reactions and 

improve read lengths for large plasmids and BACs. This new gel filtration 

method, called PureSeq96, has been optimized in 96-well format using a 

high molecular weight cut-off membrane (MWCOM) combined with preswollen 

low conductivity Capillary Electrophoresis Grade Sephadex G-50. 

The combination of the unique properties of the MWCOM and this new 

grade of G-50 are expected to improve sequencing success rates of both large 

construct plasmids and BACs using MegaBACE 1000. Described in this 

poster are the results of our studies and some of the development issues considered 

during the design of this gel filtration method for DNA sequencing 

reaction purification. 



P121-S 

DYEnamic ET terminator reagents and protocols for the 

ABI 3700 DNA sequencer. 

C. Palaniappan1, L. Hosta1, M. Zahn1, G. Kaput1, J. Hockenberry1, M. Campion1, A. Brito1, B. McArdle1, A. Mamone2; 1AP Biotech, 

800 Centennial Ave., Piscataway, NJ 08855, 2Molecular Dynamics 

DYEnamic ET terminator sequencing products have long been available for 

the MegaBACE 1000 sequencing instrument and the ABI 310, 373, 377 instruments. 

The method offers several significant advantages for routine DNA 

sequencing. DYEnamic ET terminators afford high sensitivity sequencing 

through energy transfer technology. Thermo Sequenase II DNA polymerase 

has unprecedented tolerance to salt and contaminants that may be present 

in template preparations. Rapid and efficient incorporation of dITP by this 

enzyme allows short cycle times and robust, compression-free sequencing of 

GC rich templates. 

We have developed sequencing reagents incorporating ThermoSequenase II 

DNA polymerase and ET terminators for the ABI 3700 DNA sequencer. An 

optimized mobility file for DYEnamic ET terminator dyes, spectral matrix 

standards and protocols have been optimized for this instrument. Data will 

be presented that allow direct comparison of this chemistry on the ABI 3700 

DNA sequencer with other available chemistries and instruments. 

MegaBACE, DYEnamic and Sequenase are registered trademarks of Amersham 

Pharmacia Biotech. 

P123-T 

Whole mass determination of two-dimensional gel separated lens 

crystallins by electrospray ionization mass spectrometry. 

Y. Ueda, L.L. David; Oregon Hlth. Sci. Univ., 611 SW Campus Dr., 

Portland, OR 97201 

Crystallins, the major proteins of the eye lens, have long half-lifes, and the 

accumulation of post-translational modifications can cause insolubilization 

and cloudiness in the lens, a condition called cataract. The identity of modified 

crystallins on two-dimensional electrophoresis (2-DE) gels can be determined 

by peptide mass finger printing, but the incomplete recovery of peptide 

fragment sometimes limits the determination of protein modification. The 

purpose of this study was to develop a method to efficiently elute modified 

crystallins from 2-DE gels so that their masses could be measured by LC- 

ESI-MS. 

Proteins from rat lens were separated by 2-DE and visualized by negative 

zinc stain. Excised spots were incubated in 0.1% SDS and then finely crushed 

to 20 mm particles by forcing them through a metal frit. Proteins were then 

allowed to diffuse into a non-detergent containing solution during sonication. 

The masses of eluted proteins were determined using a 1 mm C4 reversephase 

column (Vydac) to remove bound SDS and on-line ESI-MS. Using this 

method, we were able to determine the cleavage sites of either N-terminally 

or C-terminally truncated crystallins, and also identify phosphorylated species 

from single spots of moderately abundant proteins. The method was much 

simpler and resulted in higher yields compared to electroelution, and should 

be useful for analyzing a wide range of 2-DE separated proteins. We are currently 

testing whether �LC columns can be used to increase the sensitivity 

of the method. 



P122-M 

Development of a fifth-dye labeled short size standard for 

SNP interrogation. 

S.S. Kuo, G. Ayanoglu, D. Wei, C-a. Chang, R. Brown, A.B. Tomaney, 

P. Dong; Applied Biosystems, 850 Lincoln Centre Drive, Foster City, 

CA 94404 

We describe the development of a short size standard for analyzing small 

fragments on fluorescent detection systems. This standard contains 9 fragments 

ranging from 15 to 120 nucleotides, and is labeled with a fifth dye. 

During rigorous testing with various media on gel or capillary electrophoresis 

platforms, we are able to achieve excellent precision and curve-fitting 

cross-platform. The fifth dye is spectrally well resolved from other dyes. 

This standard is designed in particular to enable automated data analysis in 

methods for single nucleotide polymorphism (SNP) detection such as singlebase 

extension (SNE) assays. The presence of the size standard will minimize 

the need for manual data analysis especially in multiplexed electrophoresis 

assays. In our poster, we will demonstrate its utility in SNE assays. With the 

combination of different fragment lengths and four-color chemistry, the 

potential for multiplexing SNP loci exists for large-scale genotyping with minimal 

optimization. 

P124-S 

Protein separation optimization in large-format 

NuPAGE bis-tris gels. 

R.A. Bogoev, J.W. Amshey; Invitrogen Corp., San Diego, 

1600 Faraday Avenue, Carlsbad, CA 92008 

Large format gels are frequently employed to obtain better resolution of proteins 

that have similar apparent molecular weights in SDS-PAGE. We have 

quantitatively determined the resolution of proteins using the distance of separation 

and the band width to establish a relationship between the run distance 

and the resolution for NuPAGE ® bis-tris gels. Resolution increased in 

a nonlinear fashion. Increasing the run distance three-fold led to less than a 

2-fold increase in resolution. Increased run length did not improve the resolution 

of larger proteins with the 10% acrylamide concentration used. 

Increasing crosslinker concentration 3-fold led to an improvement in resolution 

for medium and small proteins but led to a decrease in resolution of 

larger proteins. Further increase did not improve the resolution for medium 

and small proteins and further reduced resolution for larger proteins. Over 

the range of 10–50�C, resolution was optimal at a temperature of 20 degrees. 

Decreasing the buffer concentration in the NuPAGE bis-tris gels provided a 

faster separation with no effect on resolution. For most applications, due to 

the relatively small increase in resolution with increasing run length, shorter 

gels may be preferable because they are more convenient for post-run processing.

P125-M 

A high sensitivity silver stain without glutaraldehyde sensitization 

for protein gels used in mass spectrometry. 

S.E. Whitney, A. Bautista, J.W. Amshey; Invitrogen Corp., San Diego, 

1600 Faraday, San Diego, CA 92008 

Conventional sensitive silver stains use glutaraldehyde as a sensitizer to 

enhance silver deposition in the protein zone. This sensitizer reacts with basic 

amino acids (i.e. Lysine) which are target sites for trypsin cleavage, and can 

result in reduced yields of peptides when the protein is processed for identification 

by mass spectrometry. A silver stain kit (SilverQuest) has been 

developed which provides high sensitivity and good peptide recovery when 

stained gel bands are used for protein identification in mass spectrometry. 

Following staining and isolation of a protein band, the silver is removed by 

oxidation with potassium ferricyanide and complexation of Ag � with sodium 

thiosulfate. At the 5 picomole level of BSA oxidation of metallic silver resulted 

in an increase in the number of identified peptides from 11 to 32, compared 

to 17 with a conventional glutaraldehyde-sensitized stain. Percent coverage 

rose from 22 to 41% of the sequence. For L-glutamate dehydrogenase we 

observed 24 peptides and 48% sequence coverage while 31 peptides and 

34% coverage was found for Phosphorylase B. In addition, a rapid and sensitive 

procedure employing the use of a microwave has been developed 

which allows for sensitive staining in �30 min. The typical sensitivity of this 

new silver stain was found to be 0.2 ng for BSA, 0.4 ng for Ovalbumin, 0.3 

ng for Soybean trypsin inhibitor and 0.4 ng for a-Lactalbumin. 

P127-S 

Identification of endosperm proteins by peptide mass mapping: 

patterns of accumulation during wheat grain development. 

W.H. Vensel, W.J. Hurkman, C.K. Tanaka; USDA, 800 Buchanan Street, 

Albany, CA 94710 

As part of a project with the goal of decreasing the impact of environmental 

conditions on wheat productivity and quality, we are using proteomics to 

identify key events and metabolic pathways in wheat grain development. 

Wheat (Triticum aestivum L. cv. Butte 86) plants were grown in a climatecontrolled 

greenhouse that had an average daily maximum daytime temperature 

of 25�C and nighttime temperature of 17�C. Water and fertilizer were 

supplied by drip irrigation. Developing heads were tagged at anthesis. Grain 

was harvested at pre-selected time points and endosperm collected. Salt soluble 

proteins were extracted and separated by 2-D gel electrophoresis. Gel 

patterns for the different developmental stages were characterized using 

computer-based image analysis. As expected, a number of proteins increase, 

decrease, and were newly synthesized during grain development. Interestingly, 

basic proteins increased significantly throughout the developmental 

time course. Proteins were identified using Western blots, Edman degradation, 

and MALDI mass spectrometry. These proteins are involved in storage 

protein biosynthesis, protein folding, glycolysis, starch biosynthesis, and pest 

protection. 



P126-T 

Proteomics of brown spider venom. 

M.V. Sousa1, C.A.O. Ricart1, W. Fontes1, K.C. Barbaro2, L. Machado1, R.B. Cunha1; 1Univ. of Brasilia, Campus Universitario, Brasilia, 

DF 70910-900, Brazil, 2Butatan Inst. 

Brown spiders are found in several regions of the world. In Brazil, the 

brown spider Loxosceles gaucho is very common, and have caused severe 

accidents due to a potent dermonecrotic and lethal venom. Little is known 

about the composition of the venom proteome. Proteomic analysis was 

employed to identify some proteins in the venom in order to gain new 

insights on its mechanism of action. 

Venon was separated by two-dimensional electrocphoresis using IPG gels in 

the first dimension and SDS-PAGE for the second dimension. The resulting 

gels were scanned and analysed via the ImageMaster software. Sixty protein 

spots were detected. Most of the spots were found in the 25–35 kDa range. 

Proteins such as insectotoxins, dermonecrotic toxin and annexin IV were 

identified by either mass spectrometry or chemical sequencing. The dermonecrotic 

toxin was purified by gel filtration, anion exchange FPLC and RP- 

HPLC. At least four isoforms of the toxin exist in the venom. The construction 

of a venom gland cDNA bank is under way. 

P128-M 

Proteomics: facts, fictions and applications. 

S.J. Cordwell; Macquarie Univ., Australia, Level 4, Building F7B, 

Macquarie University, New South Wales 2109, Australia 

Proteomics as a science is dependent on finding molecules of significance 

from amongst highly complex biological mixtures. Technically, however, 

the protein ‘pool’ from which information can be gathered is dramatically 

lower than that predicted by genome sequencing. This is due to limiting factors 

defined by protein abundance, hydrophobicity, mass and pI, in association 

with two-dimensional gel electrophoresis. Furthermore, the variable 

nature of gene expression in vivo means that predicting the ‘functional’ proteome 

under a given set of conditions is dependent upon a thorough knowledge 

of biochemical pathways encoded by a genome and influenced by the 

surrounding environment. We have now begun to define the physical boundaries 

determined by these parameters to predict whether proteins will be visible 

using 2-D gel ‘arrays’ consisting of cellular pre-fractionation via relative 

protein solubility or cellular location, in combination with narrow-range 

immobilised pH gradients. The latter allows lower abundance proteins to be 

characterised utilising the sensitivity of mass spectrometry. Furthermore, we 

can now predict whether proteins are expressed via knowledge of physical 

characteristics within given detection parameters and upon the presence or 

absence of pathway components determined via nearest-neighbour predictions. 

Such predictions are based upon defining each translated gene within 

four theoretical sets. These interacting sets provide the real ‘pool’ from which 

2-D electrophoresis can be expected to provide utility, while proteins outside 

the ‘pool’ must be annotated via alternative means. Such predictions of biologically 

significant molecules that remain outside the scope of 2-D electrophoresis 

then allow the researcher to target single proteins or sets of proteins 

utilising complementary technologies including peptide labelling or 

monoclonal antibodies. Here we present the advantages and disadvantages 

of 2-DGE-MS proteomics in comparison and in complement to alternative 

technologies and describe the application of high-throughput technologies 

for biological experimentation in a variety of microorganisms. 



P129-T 

Isolation and identification of rat liver proteins using ultracentrifugation 

with Nycodenz and 1D/2D-SDS-PAGE. 

K. Murayama1, T. Fujimura1, M. Morita2, N. Shindo1; 1Juntendo Univ. Sch. 

of Med., 2-1-1, Hongo, Bunkyo-ku, Tokyo, Tokyo 113-8421, Japan, 2Hitachi 

Koki Co., Ltd. 

The use of 2D-SDS-PAGE as a clinical molecular scanner of various tissues 

and physiological fluid samples has proved useful. However, each organ contains 

more than 4,000 proteins and accordingly, it is almost impossible to 

study the functional role of these proteins unless separated. Our ultimate goal 

is to use 2D-SDS-PAGE as a clinical molecular scanner to define each 

organelle in various organs. 

In this study, we report the isolation of rat liver organelles by density gradient 

centrifugation using Nycodenz. Nycodenz solution at 10, 20, or 30% concentration, 

containing 0.25 M sucrose (as an osmotic balancer), was added 

to each centrifuge tube and allowed to stand overnight at �20 to �80�. The 

solution was thawed at room temperature (�2 h), and analyzed to construct 

a density gradient curve. When used in a 5-ml tube, Nycodenz gradient densities 

from the top to the bottom without any centrifugation were 1.0334 to 

1.2188 at 10%, 1.0506 to 1.2878 at 20% and 1.0856 to 1.3199 at 30%. Liver 

homogenate (0.4 ml, 4 mg) was loaded on the Nycodenz gradient solution 

and centrifuged at 28,000 rpm for 20 min using a Hitachi ultracentrifuge 

CP100�-RPS40T-2. The mixture was fractionated by a fractionator, DGF-U, its 

absorbance measured at 360 nm with a spectrophotometer and density with 

an Abbe refract meter. Next, 5 �l of each fraction was applied onto 10% gel 

for 1D-SDS-PAGE, electrophoresis, and the gel was stained by silver nitrate. 

Another 1D-SDS-PAGE was erector-blotted to a PVDF membrane and the 

presence of organelles was confirmed using antibody of the marker protein 

for each organelle. 

P131-M 

Selective depletion of major serum proteins and fractionation prior 

to 2-dimensional differential gel electrophoresis. 

J.J. Cummings, E. Rohde, P.R. Griffin; Merck Res. Labs., RY800-B210, Rahway, 

NJ 07065 

Two dimensional differential gel electrophoresis (2DIGE) is a powerful technique 

for the study of protein expression in physiological fluids such as 

serum. However, the presence of a few major proteins interferes with the 

separation and detection of many low abundant, yet physiologically important 

proteins. Albumin (52%), IgG (20%), IgA (2.5%), IgM (1.6%), transferrin 

(3.6%) and �1-antitrypsin (1.6%) are the major constituents of serum in many 

species. 

Our objective was to selectively remove abundant proteins in a few sequential 

steps followed by the division of the depleted sera into multiple fraction 

based on their hydrophobicity (RP-HPLC) and/or charge (IEX-HPLC) prior to 

pre-electrophoresis fluorescent labeling. 

The effective removal of albumin was accomplished using Cibachron blue 

dye spin columns. Immunoglobulins (IgG, IgM) were removed by gel filtration 

over protein A and G columns. Affinity resins specific to transferrin and 

�1 antitrypsin were prepared in house and used for the depletion of the 

respective proteins. Chromatographic fractionation was carried out on largebore 

columns (4.6 � 100 mm). During all depletion and fractionation steps 

emphasis was placed on maximizing protein recovery. The protein concentration 

was monitored spectrophotometrically and effectiveness of depletion 

was assessed by SDS-PAGE. 

The separation of the depleted and fractionated sera by 2DIGE resulted in a 

significant increase in the dynamic range of the separation. Utilizing this 

approach proteins were detected in areas previously obscured by major 

serum constituents. Furthermore an increased number of proteins was 

observed. Combined with the power of differential protein mapping using 

fluorescent dyes the procedure has shown great utility in the search for differentially 

expressed proteins. We present examples of coupling 2DIGE with 

�LC-MS/MS and database searching for the identification of surrogate markers 

in sera. 



P130-S 

Rapid and simple single nanogram detection of glycoproteins 

in polyacrylamide gels and on electroblots. 

W.F. Patton, T.H. Steinberg, K.N. Berggren, K. Pretty On Top, C. Kemper, 

Z. Diwu, R.P. Haugland; Molecular Probes Inc., 4849 Pitchford Avenue, 

Eugene, OR 97402 

The fluorescent hydrazide, Pro-Q Emerald 300 dye, may be conjugated to 

glycoproteins by a periodic acid Schiff’s (PAS) mechanism. The glycols present 

in glycoproteins are initially oxidized to aldehydes using periodic acid. 

The dye then reacts with the aldehydes to generate a highly fluorescent conjugate. 

Reduction with sodium metabisulfite or sodium borohydride is not 

required to stabilize the conjugate. Though glycoprotein detection may be 

performed on transfer membranes, direct detection in gels avoids electroblotting 

and glycoproteins may be visualized 2–3 hours after electrophoresis. 

This is substantially more rapid than PAS labeling with digoxigenin 

hydrazide followed by detection with an anti-digoxigenin antibody conjugate 

of alkaline phosphatase, or PAS labeling with biotin hydrazide followed by 

detection with horseradish peroxidase or alkaline phosphatase conjugates of 

streptavidin, which require more than eight hours to complete. Pro-Q Emerald 

300 dye is spectrally compatible with SYPRO Ruby protein gel stain, 

allowing two-color detection of glycosylated and nonglycosylated proteins on 

the same gel or blot. Both fluorophores are excited with mid-range UV illumination. 

Pro-Q Emerald 300 dye maximally emits at 530 nm (green) while 

SYPRO Ruby dye maximally emits at 610 nm (red). As little as 300 pg of a1acid 

glycoprotein (40% carbohydrate) and 1 ng of avidin (10% carbohydrate) 

or glucose oxidase (12% carbohydrate) are detectable in gels after staining 

with Pro-Q Emerald 300 dye. Besides detecting glycoproteins, as little as 2–8 

ng of lipopolysaccharide is detectable in gels using Pro-Q Emerald 300 dye 

while 250–1000 ng is required for silver staining. Detection of glycoproteins 

may be achieved in 1-D or 2-D gels and on PVDF or nitrocellulose membranes. 

P132-T 

Rice tissue proteomics: towards a functional analysis of the 

rice genome. 

S. Komatsu, S. Shen, Z. Li, G. Yang, H. Konishi, M. Yoshikawa, R. Rakwal; 

Natl. Inst. of Agrobiol. Resources, 2-1-2 Kannondai, Tsukuba, Ibaraki 

305-8602, Japan 

The technique of proteome analysis with two-dimensional polyacrylamide 

gel electrophoresis (2D-PAGE) has the power to monitor global changes that 

occur in the protein expression of a tissue, an organism, and/or under 

stresses. In this study, proteins extracted from endosperm, embryo, root, callus, 

green shoot, etiolated shoot, leaf sheath and panicle of rice were separated 

by 2D-PAGE. The separated proteins were electroblotted onto a 

polyvinylidene difluoride membrane. The N-terminal amino-acid sequences 

of 117 out of 377 proteins were determined in this manner. N-terminal 

regions of the remaining proteins could not be sequenced and they were 

inferred to have a blocking group at N-terminus. Internal amino-acid 

sequences of 260 proteins were determined using the protein sequencer or 

matrix-assisted laser desorption/ionization time-of-flight mass spectrometry 

after enzyme digestion of proteins. Finally, a data-file of rice proteins was 

constructed, which included information on amino-acid sequence and 

sequence homology. Using this experimental approach, we could identify the 

major proteins involved in growth and development of rice. Some of these 

proteins, including a calcium-binding protein, which turned out to be carleticulin 

in rice, have functions in signal transduction pathway. The information 

thus obtained from amino-acid sequence of these proteins will be 

helpful in predicting the function of the proteins and for their molecular 

cloning in future experiments. 

This work was supported in part by a grant of Rice Genome Project PR-1201, 

MAFF, Japan.

P133-S 

Application of human cDNA microarray for the assessment of 

gene expression in mouse livers. 

G.S. Huang, M-Y. Hong, P-C. Yang; Pig Res. Inst., Taiwan, PO Box 23, 

Chunan, Miaoli, Taiwan, ROC 350, Taiwan 

A genomic survey for differentially expressed genes was performed to livers 

of ApoE deficient mice using human cDNA microarray containing approximately 

9,000 human cDNA clones. Due to the homology between mouse and 

human, hybridization was performed at lower stringency condition, 10 degrees 

below the regular hybridizing temperature. Gene expression profiles 

of livers corresponding to high levels of blood cholesterol were generated at 

genomic scale. Thirty-seven genes were randomly selected from a pool of 

differentially expressed genes and subjected to semi-quantitative RT-PCR, further 

confirmed the result from microarray hybridization. These included 

genes associated with atherosclerosis, and novel genes that implied novel 

pathways correlated to high levels of blood cholesterol. It is promising using 

human cDNA microarray, the most complete collection among all species, to 

study other mammalian systems with satisfying speed and accuracy. 

P135-T 

Meeting the demands for high throughput custom microarray 

production with the GeneMachines ® OmniGrid. 

K.S. Small, D. Henninger, G. Barragan, J. Dabrowiak, J. Fayet-Faber; 

GeneMachines, 935 Washington St., San Carlos, CA 94070 

As researchers in both independent labs and core facilities continue to 

approach the developing field of genomics with custom microarray production, 

the need for microarrayer instruments that maximize flexibility and 

throughput without compromising cost has become critical. 

The OmniGrid microarrayer offers a fully integrated and automated solution 

for creating custom DNA arrays. The OmniGrid is capable of printing 20,000 

spots/slide onto 100 slides using 48 pins in under 7 hours. Key components 

of the instrument’s flexibility include software features that allow random 

access of unique samples within a microtiter plate and inter-plate access 

among the 74 microtiter plates for production of fully customized microarrays. 

Data attesting to the instrument’s throughput, precision, and accuracy 

are discussed. Solutions to ensure microarray consistency during extended 

print runs through minimizing the effect of environmental variables are also 

explored. 



P134-M 

Planar waveguide microarrays for increased sensitivity in 

gene expression monitoring. 

W. Price1, A.P. Abel2, N.G. Scharer-Hernandez2, A.M. Zrolka1, A. Schafer1, H. Schwarz1; 1QIAGEN GmbH, 28159 Avenue Stanford, Valencia, 

CA 91355, 2Zeptosens AG 

The successful use of current microarray technology is impacted by its limited 

sensitivity, low signal to noise ratio and problems in reproducibility. In 

many bioanalytical applications—especially in toxicology, drug metabolism, 

and disease diagnostics—the amount of biological material that is available 

for an assay is limited. Reliable and robust methods for the quantitative 

detection of less than 1 �g of total RNA (equivalent to about 1 mg of tissue 

or 100,000 cells) are required in order to obtain valid experimental data. To 

fulfill these requirements currently available microarray detection approaches 

apply enzymatic target or signal amplification schemes, which bear among 

others the risk of biased amplification and non-linearity of the result. By combining 

Zeptosens’ planar wave guide (PWG) gene chip technology with 

QIAGEN’s expertise in sample preparation, extremely high levels of sensitivity 

and enhanced signal to noise ratios can be achieved. With this integrated 

approach, mRNA derived from the equivalent of 100 HeLa cells could 

be monitored without signal and/or target amplification. 

P136-S 

An investigation on reproducibility of GenChip expression 

methodology in UVa BMRF. 

B.P. Dragulev, P. Gallagher, Y. Bao, J.F. Fox; Univ. of Virginia, 

Jordan Hall, Box 441, Charlottesville, VA 22908 

A new service for microarray gene expression analysis based on the Affymetrix 

Gene Chip System is being developed in the Biomolecular Research 

Facility at University of Virginia. Concerns from investigators over the reproducibility 

of this high cost procedure have been raised that need to be 

addressed. In order to gain certain insight of the systematic performance of 

this system, we conducted a study focusing on reproducibility of the expression 

profiles obtained from repetition of one experiment under the same 

conditions. We used as a model VMM5 human melanoma cell line as the 

source of RNA. Five total RNA samples were extracted from five flasks of 

VMM5 cells grown under the same conditions. Labeled cRNAs were synthesized 

following Affymetrix procedure and hybridized to Affymetrix test chips. 

Statistical analyses were performed on the data based on differential intensity 

on both normal and log scales. The reliability of the data sets was assessed 

by SPSS Reliability Analysis software and other software. Another goal 

of this study was to compare the results produced from two different types 

of GeneChips, i.e., HuGene FL arrays and Human Genome U95A arrays in 

order to access the feasibility of cross-type comparison. 



P137-M 


interaction. 

P.S. Katsamba1, I.A. Laird-Offringa1, D.G. Myszka2; 1Univ. of Southern 

California, Norris Cancer Center/1441 Eastlake Ave., Los Angeles, 

CA 90089-9176, 2Univ. of Utah, 50 N. Medical Dr./School of Medicine 

Rm 4A417, Salt Lake City, UT 84132 





















induced fit of RNA and protein. Our results demonstrate the power of kinetics 

to dissect the functional differences between structural features of two interacting 

macromolecules. 

P139-S 

Automation for reliable RNA purification using 

silica-gel–membrane technology. 

F. Siegman, C. Schade, A. Wehren; QIAGEN Inc., 28159 Avenue Stanford, 

Valencia, CA 91355 

An automated system has been specially developed for laboratories requiring 

purification of high-quality RNA from animal and human cells for highthroughput 

gene-expression analysis, including microarray and real-time RT- 

PCR. This robotic workstation is designed to maximize reproducibility for all 

sample preparation steps (e.g., cell lysis, RNA purification, reaction setup), 

ensuring reliable results in subsequent analysis. CVs of less than 3% are consistently 

observed for quantitative TaqMan analysis when using this system 

for sample preparation. RNA purification using silica-gel–membrane technology 

allows recoveries of more than 90%, even with limiting starting material 

(e.g., as few as 10 cells). Purified RNA is free from enzyme-inhibiting 

impurities for excellent performance in the most sensitive quantitative applications. 

Optimized, ready-to-run protocols allow up to 192 samples to be 

purified in 90 minutes. The accurate liquid-handling system provides crosscontamination–free 

pipetting and small-volume liquid transfer, making it 

suitable for reaction setup and other liquid-handling tasks such as sample 

rearray. The easy-to-use operating system automatically tracks samples and 

records all process data generated in each run for complete documentation. 

Data is stored in standard formats and can be exchanged with other instruments, 

such as thermal cyclers or gridding robots, via network or disk. 



P138-T 

A rapid and efficient BAC DNA purification method for high 

throughput applications. 

C.M. Smith, A. Pryor; Princeton Separations, 920 HW 33, Building 7, 

Suite 6, Freehold, NJ 08724 

We have developed a method for the rapid and efficient purification of BAC 

DNA. Typical yields range from 0.5 to 1.0 �g from an overnight culture with 

Absorbance (OD600) � 5.0. BAC DNA was purified from an overnight culture 

of E. coli in 5 mL Terrific Broth (Cm 20 �g/mL). The culture was subject 

to gentle alkaline lysis, mixed with one volume of binding buffer, bound 

to a solid phase membrane, then eluted in a low salt buffer. Purified BAC 

DNA contains little or no chromosomal DNA or RNA visible after agarose gel 

electrophoresis and is suitable for downstream applications including restriction 

enzyme digestion and sequencing. A discussion of the protocol and 

accompanying data will be presented. The simplicity of the method makes 

it suitable for tailoring to a 96 well format providing a reliable method for 

high throughput applications 

P140-M 

Cotton biotechnology in China. 

B-H. Zhang; Cotton Res. Inst., Chinese Acad. of Agr. Sci., Baibi, 

Anyang, Henan 455112, People’s Republic of China 

During the past two decades, China has made great progress in cotton 

biotechnology and genetic engineering. Obtaining firstly regenerative plants 

from cotton anther and protoplast culture, and also obtaining regenerative 

plants from many domestic elite cotton varieties. After transgenic cotton carrying 

the insect-resistant (Bacillus thuringiensis: B.t.) gene was commercialized 

in 1996, at least ten Bt-cotton varieties were planted in China. In 1998, 

there were over 100,000 hectares of Bt-cotton were planted. Two kinds of 

bivalent insect-resistant transgenic cotton have been obtained. These new 

bivalent insect-resistant transgenic cotton carried two insecticidal genes, B.t. 

gene and CpTI gene, or pea lectin (P-Lec) gene and soybean Kunitz trypsin 

inhibitor (SKTI) gene respectively, and will be commercialized in 2000. Herbicide-resistant 

varieties for 2,4-D and Bromoxynil are under development 

and are expected to reach the market by 2001 or 2002. Disease-resistant 

transgenic cotton is under development and testing in lab and fields, and is 

expected to reach the market by 2000 or 2001. Fiber improvements, stress 

resistance, and male sterility and fertility for hybrid cotton are the next targets 

for cotton biotechnology. Several genes for fiber improvement and 

hybrid cotton are being tested in various laboratories. New genes for insect, 

herbicide and disease resistance are being sought.

P141-T 

Somatic embryony patterns and plant regeneration in cotton. 

B-H. Zhang; Cotton Res. Inst., Chinese Acad. of Agr. Sci., Baibi, Anyang, 

Henan 455112, People’s Republic of China 

Globular, heart, torpedo and cotyledon stages of development were observed 

in cotton somatic embryos, and only late torpedo and cotyledon stage somatic 

embryos could germinate into plantlets, the others could only produce 

advanentive embryos or adventive roots. Various developmental stage 

somatic embryos existed in cotton tissue cultue, and the number of the 

globular and heart-shaped stage was more than that of cotyledon embryos. 

The germination of cotton somatic embryos could be classified into three 

kinds and were affected by many factors such as hormons, basis medium et 

al. Resting phenomenon esists in cotton somatic embryos. 

P143-M 

Relationship between sexual maturation, serum leptin and 

sex hormone levels in obese and normal children. 

S.C. Hao, Y.C. Yuan; Harbin Med. Univ., China, 199 Dazhi Street,Harbin, 

Harbin, Heilongjiang 150001, People’s Republic of China 

In order to study the relationship between sexual maturation, serum leptin 

and sex hormone levels, the sexual maturation of 300 obese children and 300 

normal children not taking any medication or having evidence of endocrine 

or metabolic disease were questioned and their serum leptin and sex hormone 

levels were measured. Serum leptin levels were significantly increased 

(P � 0.01) in obese children compared with controls, while the sexual maturation 

of obese children was much earlier than that of controls (P � 0.01). 

Serum leptin levels were significantly increased (P � 0.01) in female compared 

with male, while the sexual maturation of female was much earlier 

than that of male (P � 0.01). There was significant negative correlation 

between testosterone and leptin in male (obese group: r � �0.83, P � 0.01; 

control group: r � 0.93, P � 0.01), while the estradiol was positive correlated 

with leptin in female (obese group: r � 0.84, P � 0.01; control group: r � 

0.95, P � 0.01). This study shows that leptin can promote sexual development 

in children and may be regulated by sex hormone. There are gender 

differences in the correlations between leptin and sex hormone, which may 

cause the differences of sexual maturation in male and female. This study 

also suggests that leptin play a more important role than sex hormones in the 

sexual development. 



P142-S 

The novel protein patterning method and its application 

for protein-protein interactions. 

B-G. Kim, C-S. Lee; Sch. of Chem. Engin., Seoul Natl. Univ., Seoul 

National University, Kwanak-Gu, Seoul, Seoul 151-742, 

Republic of Korea 

This research describes the new protein patterning method for the formation 

of highly defined two-dimensional protein arrays onto very hydrophobic thin 

film coated silicon substrate expressing protein functional activity at its patterned 

surface. 

In protein patterning process, Because very critical problem is non-specific 

protein binding onto undesirable region, We had tried a spin coated FluoroCarbon 

thin film, very hydrophobic surface property, which was expected 

to protect non-specific protein binding in our patterned silicon chip which 

was made from the lift-off process. From this simple method, we had obtained 

very high ordered protein patterns (180 �m, 300 �m, 500 �m diameter 

circle and 100 �m by 200 �m rectangular square) and also discarded 

nonspecific protein binding and blocking proteins which were generally 

used for protecting nonspecific binding such as bovine serum albumin(BSA) 

and skim milk proteins et al. 

Patterned micron-scale arrays were shown by fluorescence tagging proteins 

and had successfully obtained reliable quantitative data with confocal microscopy. 

And We also could create a versatile patterned protein surfaces for 

protein-protein interactions such as sandwich immuno-assay and indirect 

immuno-assay. 

From the these results, We have developed miniaturized assay systems showing 

the rapid, low sample volumes and high sensitivity. 

P144-T 

Experiences in implementing single nucleotide extension in a 

high throughput genotyping core facility. 

R. Scholl, L.W. Ballard; Univ. of Utah, 50 North Medical Dr. 4A430A, 

School of Medicine, Salt Lake City, UT 84132 

This poster will discuss some of our problems and successes in implementing 

single nucleotide extension (SNE) in a high throughput genotyping core 

facility as a method for DNA fragment analysis of SNP’s. We will discuss 

primer selection, PCR protocols, cleanup methods, quality control issues, and 

loading methods used. Product contamination and multiplexing of the samples 

will also be addressed. 



POSTER AND RESEARCH GROUP ABSTRACTS 

P145-S 

Effects of irradiation on the structure of proteins. 

K. Balamurugan, D-H. Chin; Natl. Changhua Univ. of Educ., Post Doctor, 

c/o Prof. Der-Hang Chin, Department of Chemistry, National Changhua 

University of Education, Changhua 50058, Taiwan 

In this study, we investigate the effects of irradiation on protein samples in 

optical spectrometers. The protein samples exposed to light in a spectrofluorometer 

are found to undergo in situ photoreactions. Continuous irradiation 

of proteins resulted in progressive decrease in the emission intensity. The 

light-induced changes are irreversible and appear to be oxygen-dependent. 

Continuous exposure to light renders the protein susceptible to cleavage. The 

secondary structural contents in proteins show appreciable decrease upon 

irradiation. In addition, the temperature-induced unfolding of proteins appear 

to be significantly influenced by the photoreactions caused due to irradiation. 

R1-M 

Fragment Analysis Research Group Study 2001: enhancing 

automated allele calling by tailing dinucleotide repeat markers 

to eliminate nontemplate driven nucleotide addition seen with 

Taq polymerase. 

D.A. Bintzler1, P.S. Adams2, L.W. Ballard3, Y. Bao4, D. Bartley5, L. Kasch6, L.O. Petukhova7, C. Rosato8, C.E. Terrell1; 1Univ. of Cincinnati, 

231 Bethesda Avenue, Cincinnati, OH 45267-0524, 2Trudeau Inst., 

100 Algonquin Avenue, Saranac Lake, NY 12983, 3Univ. of Utah, 

4Univ. of Virginia, 5Johns Hopkins Univ., 6John Hopkins Univ., 

7Rockefeller Univ., 8Oregon State Univ. 

Fragment analysis is a growing field in the genetic sciences. Some basics in 

methodology may provide useful tools to the many service facilities expanding 

to include fragment analysis. This tutorial will be an instruction based discussion 

covering basic methodology and challenges associated with fragment 

analysis using slab gel and capillary electrophoresis. Topics will include 

methods for producing clean PCR products through PCR optimization for single 

markers and multiplexing markers before and after PCR. Instrument 

related factors that may affect the quality of the data would be discussed for 

both slab gel and capillary electrophoresis platforms. Finally, a section covering 

analysis of the results will discuss improving accuracy through selecting 

correct size standard peaks and developing the best standard curve. 

Methods of calculation will be compared. Means to properly identify the correct 

fragment peak from the multiple peaks commonly seen during the fragment 

analysis run will be demonstrated. Participants in the tutorial will come 

away with methods designed to improve their capabilities to start, or continue 

Fragment Analysis in their laboratory. 


P146-M 

Improving productivity in core facilities using the BioRobot 3000. 

F. Siegman, H. Kijenski, C. Schade, A. Wehren; QIAGEN Inc., 

28159 Avenue Stanford, Valencia, CA 91355 

Core facilities providing molecular biology services often require automated 

systems to perform routine tasks. To meet the various demands faced by a 

core facility, these workstations should provide the flexibility to automate a 

wide variety of applications as well as the ability to exchange data with other 

laboratory instruments and data management systems. The BioRobot 3000 is 

a series of custom-designed workstations for automating routine tasks such 

as nucleic acid purification, protein purification and assay, and other liquidhandling 

tasks including reaction setup and sample rearray. Each workstation 

is tailor-made to meet individual application requirements. Different BioRobot 

3000 configurations designed for different applications will be described. 

A high-throughput sample purification system with 4 integrated vacuum 

manifolds provides rapid processing of 384 samples in a single run. Up to 

6 �g DNA (plasmids, cosmids, BACs, PACs, or P1 constructs) are purified per 

well in about 1 hour and 15 minutes using optimized protocols which minimize 

operator interaction and runtimes. Areas outside the BioRobot 3000 

worktable can be accessed using configurations with an extended arm. This 

arm allows the robotic handling system to move labware to external instruments, 

such as spectrophotometers and thermal cyclers. The operating system 

uses standard data formats to facilitate data exchange with these instruments 

as well as data management systems, allowing samples to be tracked 

as they move through various processing and analysis steps. 

R2-M 

PSRG 2001 Study: synthesis of difficult sequences. 

N.P. Ambulos, Jr. 1, L. Bonewald2, S. Kates3, G. Osapay4, H. Remmer5, A. Somogyi6, G. Tsaprailis6, S. Vigil-Cruz7; 1Univ. of Maryland Sch. of Med., 

655 W. Baltimore St. BRB13-009, Baltimore, MD 21201, 2Univ. of Texas 

Hlth. Sci. Ctr., San Antonio, 3Consensus Pharmaceut., Inc., 4Univ. of 

California, Irvine, 5Univ. of Illinois, 6Univ. of Arizona, 7Univ. of 

Connecticut 

Particular peptide sequences are inherently a challenge to solid-phase synthetic 

methodologies as a result of concomitant side-reactions and/or conformational 

issues that may result in the failure to generate the desired product. 

Development of improved synthetic methodologies, reagents and amino 

acid derivatives are offering new solutions to the old problem of difficult 

sequences. This year’s ABRF Peptide Synthesis Research Group designed a 

study to evaluate how participating laboratories solve the challenge of correctly 

synthesizing these troublesome peptides. The laboratories were asked 

to prepare the following peptide that has several potential synthetic obstacles. 

H-Gln-Thr-Ser-Ser-Gly-Thr-Thr-Ser-Trp-Val-Thr-Ser-Arg-Arg-Asp- 

Gly-Ala-Gly-Ala-Gly-Pro-OH 

The peptide was synthesized and both crude and purified material was analyzed 

and characterized by the members of the Peptide Synthesis Research 

Group by HPLC, AAA, MALDI-MS and ESI-MS. Both crude and purified samples 

were requested from participating laboratories and were also characterized 

by HPLC, AAA, MALDI-MS and ESI-MS. Analysis of the samples also 

included a comparison of yield of correct product during purification. The 

results of these analyses will be presented.

R3-M 

A current profile of microarray laboratories: results of the 

2000–2001 ABRF Microarray Research Group Survey of Laboratories 

using microarray technologies. 

G.S. Grills1, C. Griffin2, A. Massimi1, K. Lilley3, K. Knudtson4, J. VanEe5; 1Albert Einstein Col. of Med., 1300 Morris Park Avenue, Bronx, 

NY 10461-1602, 2UCSF, 3Cambridge Univ., 4Univ. of Iowa, 

5Cornell Univ. 

The goal of this survey study was to build a current picture of the microarray 

analysis world. Microarray analysis is a fast developing field. New methods 

and instrumentation are being constantly introduced and the number of investigators 

using the technology is rapidly expanding. We focused on Affymetrix 

GeneChip and on cDNA, oligonucleotide and protein microarray 

spotting technologies. Data was requested from laboratories using these 

technologies by posting instructions for participation on microarray related 

electronic discussion groups. A web based survey form was used to collect 

information such as instrumentation, protocols, staffing, funding, and 

throughput. The survey was geared toward gathering information from academic, 

pharmaceutical, and commercial laboratories that offer microarray 

technologies as a shared resource. Individual laboratories that have these 

technologies were also invited to participate. This study is part of a continuing 

survey. The data from this survey was analyzed to build a current profile 

of microarray analysis laboratories. 

R5-S 

Preliminary results from the DNA Sequencing Research Group 2001 

Study: factors that affect the sequencing and detection of mixed 

base sequences in PCR products. 

M.A. Robertson1, L. Hall2, J. Hawes3, T. Hunter4, E. Jackson-Machelski5, K. Knudtson6, D. Leviten7; 1Univ. of Utah, 4A 438, School of Medicine, 

50 N. Medical Drive, Salt Lake City, UT 84132, 2Albert Einstein Col. of 

Med., 3Indiana Univ. Sch. of Med., 4Univ. of Vermont, 5Washington Univ. 

Sch. of Med., 6Univ. of Iowa, 7ICOS Corp. 

With the imminent release of the draft Human Genome Sequence, many laboratories 

are seeing increased demand for comparative sequencing. However, 

detection of mixed bases in a DNA population is a very demanding technique 

for many DNA Sequencing Core Laboratories. The DSRG will report on a 

study to test the ability of the ABRF DNA sequencing community to sequence 

PCR products containing several different kinds of base pair mutations, insertions 

and/or deletions. To limit variables, PCR products and sequencing 

primers were supplied along with a wild type reference sequence as a text 

file. Members were asked to sequence the PCR products using their choice 

of chemistry for mutation/mixed base detection. The set of PCR products 

contained mutations of varying difficulty. The PCR products were amplified 

from primers that contained universal forward and reverse primers to allow 

testing of both dye terminator and dye primer sequencing chemistries. Results 

were submitted as ABI chromatogram files with a short survey to gather relevant 

information. Analysis of the study will address: 

a) The ability of participants to be able to correctly identify the mutations. 

b) The accuracy of dye primer versus dye terminator sequencing for correct 

mutation detection. 

c) The ability to detect mutations from only one primer sequence. 

d) The differences in instrumentation in the abilty to detect mutations, e.g., 

capillary vs slab gel instruments. 

e) The software/sequence alignment tools being used for mutation analysis. 

RESEARCH GROUP ABSTRACTS 


R4-T 

NARG 2000–2001 DNA Synthesis Study: Part I. Surveys of trends 

and strategies of DNA synthesis core facilities. Part II. Evaluation of 

oligonucleotide synthesis in core facilities utilizing homopolymers 

of A(20), G(20), C(20), T(20) and one heteropolymer. 

M.E. Gunthorpe1, J.F. Fox2, B.P. Holloway3, K.S. Lilley4, M. Lively5, K. Mills6, S.A. Scaringe7, T. Thannhauser8, A. Yeung9; 1Howard Hughes 

Med. Inst., UCSF, 533 Parnassus Ave. at 3rd Ave. Rm U436, San Francisco, 

CA 94143-0793, 2Univ. of Virginia, 3Ctrs. for Dis. Control and Prevent., 

4Univ. of Cambridge, 5Wake Forest Univ. Sch. of Med., 6Millennium 

Pharmaceut. Inc., 7Dharmacon Res. Inc., 3200 Valmont Road #5, 

Boulder, CO 80301, 8Cornell Univ., 9Fox Chase Cancer Ctr. 

The Nucleic Acids Research Group (NARG) of the Association of Biomolecular 

Resource Facilities (ABRF) invited subscribers to the ABRF electronic discussion 

group to participate in our 2000–2001 study, which was accessed 

online at the web address listed below. Part I was a general survey regarding 

various aspects and issues pertaining to DNA synthesis core facilities, 

such as quality control, work philosophy and the future. Part II was an evaluation 

of oligonucleotide synthesis from core facilities by using a novel 

approach: Isolation of synthesis problems by analysis of homopolymer 

oligonucleotides. In this approach, the synthesis problems are magnified 

19�–20� depending on the chemical properties of the individual bases. 

Oligonulceotides submitted by participating labs will be analyzed by a range 

of analytical methods including HPLC, capillary electrophoresis, MALDI-TOF 

and ESI mass spectrometry to assess the quality of each product. The results 

of the evaluation of oligonucleotides from participants utilizing different 

instrumentation and protocols will be presented. 

Web address: http://www.abrf.org/ and choose “Nucleic Acids Research 

Group (NARG) 2000–2001 Study” under the category “Open Research Group 

Studies”. 

R6-S 


interaction. 

I.A. Laird-Offringa1, D.G. Myszka2, P.S. Katsamba1; 1Univ. of Southern 

California, Norris Cancer Center, Room NOR 6420/1441 Eastlake Ave., 

Los Angeles, CA 90089-9176, 2Univ. of Utah, 50 N. Medical Dr./School of 

Medicine Rm 4A417, Salt Lake City, Utah 84132 





















induced fit of RNA and protein. Our results demonstrate the power of kinetics 

to dissect the functional differences between structural features of two 

interacting macromolecules. 



RESEARCH GROUP AND SPEAKER ABSTRACTS 

R7-S 

On the development of standards for quantitative molecular 

interaction analysis: the interaction of barnase with its 

inhibitor barstar. 

E. Eisenstein; NIST, 9600 Gudelsky Drive, Rockville, MD 20850 

Virtually all biological processes rely on specific molecular interactions. Consequently, 

there is a growing need not only for useful tools for the analysis 

of molecular interactions, but also for standards to evaluate results with new 

experimental systems, and to assure comparability among different measurement 

techniques. Recently, the Molecular Interactions Research Group 

(MIRG) of ABRF focused on the interaction of barnase with barstar as a possible 

standard for reversible molecular interactions. Preliminary analyses 

were undertaken to clone, express, purify and characterize two barnase and 

barstar variants, and to measure the equilibrium constant for their association 

using three common experimental approaches: analytical ultracentrifugation, 

isothermal titration calorimetry and surface plasmon resonance using a 

BIAcore biosensor. Excellent agreement of the results obtained from the three 

techniques, as well as other experimental attributes of the proteins, suggests 

that the barnase-barstar system may be a useful standard for quantitative 

molecular interaction analysis. 

S2 

High throughput small molecule analysis using LC/MS and SFC/MS. 

M.J. Greig, W. Farrell, M. Ventura, J. Robinson, K.E. Milgram, K. Tivel, 

C. Aurigemma, X. Xiong, C. Pham, R. Lopez, A. Yanovsky; Pfizer—La Jolla, 

3550 General Atomics Ct., San Diego, CA 92121 

In our high-throughput discovery research, we use both commercial and custom 

mass spectrometry techniques to analyze tens of thousands of different 

compounds per month. Atmospheric pressure ionization sources have 

allowed the routine coupling of HPLC and recently supercritical fluid chromatography 

(SFC) to mass spectrometers for the analysis of a wide variety 

of small compounds. Electrospray ionization (ESI) is used not only for large 

biomolecules, but also for peptides, oligonucleotides, and a wide range of 

small polar molecules. Atmospheric pressure chemical ionization (APCI) 

extends the scope of mass spectrometry applications to include many small 

(�1000 daltons) polar and neutral molecules. The differences in these 

sources and their applicability to both LC/MS and SFC/MS will be described. 

The addition of quantitative parallel detectors such as nitrogen chemiluminescence 

detectors (NCD) and evaporative light scattering detectors (ELSD) 

will also be discussed. Finally, the benefits of SFC/MS in a high throughput 

environment will be discussed as well as strategies for high throughput data 

analysis. 


S1 

Mass spectrometry of neurosteroids. 

R.L. Fitzgerald1, A. Alomary2, J.D. Rivera1, R.H. Purdy3, G.F. Koob4, M. Vallee4; 1VA Med. Ctr., UCSD, VAMC-113, 3350 La Jolla Village Dr., 

San Diego, CA 92161, 2VA Med. Ctr., UCSD, Scripps Res. Inst., 

3VA Med. Ctr., Scripps Res. Inst., 4Scripps Res. Inst. 

Electron capture negative chemical ionization (NCI) is one of the most sensitive 

ionization techniques available and is especially well suited for quantitative 

analysis of target compounds in biological extracts. For the analysis 

of small molecules, NCI is often several orders of magnitude more sensitive 

than traditional techniques such as electron ionization or positive chemical 

ionization. There are several important prerequisites for performing quantitative 

analysis using NCI, including an electronegative functional group, stable 

isotopic internal standards, and good method validation. We synthesized 

deuterium labeled analogs of neurosteroids and developed a NCI GC/MS 

method for quantification of neurosteroids in biological samples using isotope 

dilution. 

Neurosteroids have distinct neurotransmitter mediated effects and consequently 

it is important to be able to identify and quantify individual compounds. 

Previously, the determination of neurosteroids in biological matrices 

involved complicated purification protocols or did not use appropriate 

internal standards. We added deuterium-labeled internal standards to brain 

(100 mg of cortex homogenate) or plasma (300 uL). Samples were homogenized 

in methanol, centrifuged and diluted to contain 5% methanol and then 

applied to C-18 columns. After washing the column with methanol/water 

(50/50), steroids were eluted with methanol. Following evaporation, steroids 

were converted to pentafluorobenzyl oxime/trimethylsilyl ether derivatives. 

The extracts were analyzed using SIM. The present method allows simultaneous 

quantification of pg amounts (100 pg in 300 �L of plasma and 250 pg 

in 100 mg of brain tissue) of neurosteroids and will be helpful in elucidating 

the role of neurosteroids in health and disease. 

S3 

Algorithms and systems for high throughput structural biology. 

B.D. Randall1, T.A. Neubert2, H. Erdjument-Bromage3, S.A. Hefta4, R.S. Johnson5, J.T. Stults6; 1Dartmouth, 6211 Sudikoff Lab., Rm. 113, 

Dartmouth, Hanover, NH 03755-3510, 2New York Univ., 540 First Avenue, 

Lab 5-18, New York, NY 10016, 3Mem. Sloan-Kettering Cancer Ctr., 

1275 York Avenue, New York, NY 10021, 4Bristol-Meyers Squibb, 

5Immunex Corp., 6Genentech, Inc. 

In the post-genomic era, key problems in molecular biology center on the 

determination and exploitation of three-dimensional protein structure and 

function. For example, modern drug design techniques use protein structure 

to understand how a drug can bind to an enzyme and inhibit its function. 

Large-scale structural and functional genomics will require high-throughput 

experimental techniques, coupled with sophisticated computer algorithms for 

data analysis and experiment planning. This talk will introduce techniques 

my lab is developing in two key areas: (1) data-directed computational protocols 

for high-throughput protein structure determination with nuclear magnetic 

resonance spectroscopy, and (2) experiment planning and data interpretation 

algorithms for reducing mass degeneracy in mass spectrometry for 

protein complex binding mode identification. These techniques promise to 

lead to fast, automated tools to aid the pursuit of deep structural and functional 

understanding of biopolymer interactions in systems of significant 

biochemical and pharmacological interest.

S4 

A crack in the egg: protein-protein interactions in failing hearts. 

A.R. Marks; Columbia Univ., 630 West 168th Street, New York, NY 10032 

Calcium (Ca 2�) ions are second messengers in numerous signaling pathways 

in all cell types. In the heart Ca 2� regulates muscle contraction, electrical signals 

that determine the cardiac rhythm, and probably plays a role in controlling 

cell growth. In the past decade elucidation of the molecular structure 

of the intracellular Ca 2� release channels on the sarcoplasmic and endoplasmic 

reticulum (SR/ER) has lead to an understanding of how these molecules 

regulate Ca 2� homeostasis in the heart. Consequently the role of 

these channels (ryanodine receptors, RyR, and inositol 1,4,5-trisphosphate 

receptors, IP3R) in cardiac pathophysiology is beginning to be understood. 

Intracellular Ca 2� release channels form a unique class of ion channels distinguished 

on the basis of structure size, and function. RyRs and IP3Rs have 

large cytoplasmic domains that are involved in the regulation of the channel 

pore located in the carboxy terminal 10% of the channel sequence. These 

enormous cytoplasmic domains serve as scaffolds for targeting proteins that 

bind kinases and phosphatases to the channels. Protein kinase A (PKA) 

phosphorylation of RyR2 dissociates the channel regulatory protein FKBP12.6 

and regulates the channel open probability (Po). We have defined a macromolecular 

complex comprised of RyR2, FKBP12.6, PKA, the protein phosphatases 

PP1 and PP2A, and an anchoring protein mAKAP. In failing human 

hearts RyR2 is PKA hyperphosphorylated resulting in defective channel function 

due to increased sensitivity to Ca 2�-induced activation resulting in 

impaired excitation-contraction (EC) coupling in failing hearts. 

S6 

VLiPs: a technique to study ligand binding to GPCRs in their 

natural environment. 

T.H. Jessen, N. Hunt; EVOTEC BioSystems AG, Hamburg, Schnackenburgallee 

114, Hamburg, Hamburg 22525, Germany 

Virus Like Particles (VLiPs) are generated by insect cells or mammalian cells 

through an engineering process of the retroviral export mechanism and the 

respective G-protein coupled receptor (GPCR). The retroviral gag protein 

interacts non-covalently but tightly and specifically with the C-terminus of the 

receptor of interest. The interaction leads to an enrichment of the receptor 

in its natural environment, the cell membrane, before budding of the VLiPs 

into the supernatant occurs. 

VLiPs carry up to 100 receptor molecules and turn out to be ideally suited 

for screening due to their robustness, long lived stability and physiological 

binding properties. Data obtained in binding and competition experiments 

are identical to data from literature. Currently, functional receptor screens are 

under investigation. The method allows to explore a number of other protein 

classes as well. 

SPEAKER ABSTRACTS 


S5 

Distinguishing agonist and antagonist binding to GPCRs using 

coupled plasmon-waveguide resonance analysis. 

G. Tollin, Z. Salamon, S. Cowell, V. Hruby; Univ. of Arizona, 

Biosciences West, Tucson, AZ 85721 

Structural changes accompanying the binding of ligands to the cloned human 

�-opioid receptor immobilized in a solid-supported lipid bilayer have been 

investigated using coupled plasmon-waveguide resonance spectroscopy. 

This highly sensitive new technique directly monitors mass density, conformation, 

and molecular orientation changes occurring within a single bilayer, 

and also allows direct determination of binding constants without structural 

modification of materials. Although both agonist binding and antagonist 

binding to the receptor cause increases in molecular ordering within the proteolipid 

membrane, only agonist binding induces an increase in thickness 

and molecular packing density of the membrane. This is a consequence of 

mass movements perpendicular to the plane of the bilayer occurring within 

the lipid and receptor components. These results are consistent with models 

of receptor function that involve changes in the orientation of transmembrane 

helices. 

S7 

A knockout for every gene and a chip for every purpose. 

M. Sussman; Univ. of Wisconsin, 425 Henry Mall, Madison, WI 53706 

We will report on progress in the development of two genomic technologiessaturation 

reverse genetics using a collection of insertionally mutagenized 

‘knockout’ Arabidopsis plants, and a maskless array synthesizer (MAS) for 

producing high density DNA oligonucleotide arrays ‘on the fly’. Our reverse 

genetic approach involves the rapid screening of several hundred thousand 

insertionally mutagenized Arabidopsis lines, for the isolation of knockout 

plants for any gene of interest. The bias of T-DNA for insertion at particular 

regions of the genome will be described and compared to published 

accounts of transposon bias. We have previously reported on a mathematical 

treatment required to isolate a knockout in every gene (Krysan et al., 

1996), and we extend this analysis by taking into account our observations 

on the small but significant bias for the distributiion of T-DNA sites. Progress 

towards the establishment of a computer database for T-DNA insertions, 

using TAIL PCR to generate flanking sequences, will also be described. As a 

general tool for genotyping and for discerning the effects of a particular 

mutation on global genome expression, we have been testing existing and 

new technologies based on high density oligonucleotide arrays. Recent 

experiments utilizing a maskless array synthesizer (Singh-Gasson et al., 1999) 

which is capable of generating a half million different oligonucleotides on a 

2 cm squared glass surface, will be described. The MAS uses a digital 

micromirror device developed by Texas Instruments, to generate virtual 

masks for use in photolithography and is a powerful tool for bringing combinatorial 

chemistry to the benchtop in research laboratories. Krysan, P.J., 

Young, J.C., Tax, F. and Sussman, M.R. 1996 Identification of T-DNA insertions 

within Arabidopsis genes involved in signal transduction and ion transport. 

Proc. Natl. Acad. Sci. 93:8145–8150. Singh-Gasson, S., Green, R.D,, 

Yue, Y., Nelson, C., Blattner, F., Sussman, M.R. and Cerrina, F. 1999. Maskless 

fabrication of light-directed oligonucleotide microarrays usig a digital 

micromirror array. Nature Biotechnology 17:974–978. 



S8 

Assaying single cells to single organelles using mass spectrometry. 

J.V. Sweedler; Univ. of Illinois, Urbana, 600 S. Mathews Ave. 63-5, 

Urbana, IL 61801 

Understanding the interactions of relatively simple networks of neurons is 

hampered by a lack of knowledge of the full complement of neuropeptides 

involved in most neuronal systems. Using matrix-assisted laser desorption/ionization 

(MALDI) time-of-flight mass spectrometry, neuropeptides can 

be identified in single cells and even in individual neuronal processes. Mass 

spectrometric imaging methods are described that can provide spatial “maps” 

of the neuropeptides found in simple invertebrate networks, as well as identify 

new neuropeptides. Using these techniques, multiple novel neuropeptides 

have been discovered in the common neuronal model Aplysia californica. 

Approaches for direct de novo sequencing of peptides in single cells 

are demonstrated. A unique sampling protocol has been developed that 

allows the peptides in single attoliter to femtoliter volume vesicles to be measured 

using mass spectrometry. Using the atrial gland of Aplysia as a model, 

more than ten bioactive peptides are found in individual vesicles indicating 

the complexity of such hormonal signaling. Methods which combine capillary 

electrophoresis, fluorescence detection and mass spectrometry on the 

same sample are described. 

S10 

Chemical sensors for monitoring secretory and metabolic dynamics 

at single cells: application to pancreatic beta cells. 

R.T. Kennedy, W-j. Qian, M.G. Roper, L.S. Kauri, G.D. Dalgren; 

Univ. of Florida, PO Box 117200, Gainesville, FL 32611-7200 

Microscale electrochemical sensors that allow detection of insulin, glucose, 

and oxygen at single cells or small groups of cells have been developed. The 

insulin electrodes have been used to detect insulin secretion at the level of 

single exocytosis events while the glucose and oxygen electrodes have been 

used to monitor the dynamics of glucose and oxygen consumption. Such 

measurements, in combination with pharmacological probes and gene 

knock-outs, have been used to characterize secretory pathways and the 

interaction of metabolism with secretion. In one study, it was demonstrated 

that glyoclytic and respiratory oscillations occur in single islets of Langerhans 

and these oscillations require Ca 2� entry into the cell for proper feedback. 

Such oscillations provide a mechanism for oscillatory insulin secretion seen 

in vivo. In another study, using the single cell approach, we have shown that 

activation of insulin receptors leads to insulin secretion suggesting that positive 

feedback contributes to the mechanism for the first phase of insulin 

secretion. The signaling pathway by which insulin stimulates insulin secretion 

has been further studied revealing critical roles for IRS-1 and PI3-K in 

mediating insulin-stimulated insulin secretion. These studies have demonstrated 

that temporally resolved measurements at single cells or cell clusters 

are useful in evaluating mechanisms of signal transduction. The temporal 

measurements, especially of multiple key analytes, allow sequences of events 

to be evaluated and new mechansims to be uncovered. 

SPEAKER ABSTRACTS 


S9 

Profiling signal transduction networks in mammalian cells. 

N.L. Allbritton, C.E. Sims, G. Meredith; Univ. of California, Irvine, 

Medical Sciences I, Rm D380, Irvine, CA 92697-4560 

A central goal of genomics and proteomics is to catalog the biological molecules 

present in different organisms and cell types under various conditions. 

A greater challenge for accurate and comprehensive characterization, however, 

lies in determining the activities and functional relationships of the biological 

molecules, particularly the enzymes, as they occur within the complex 

cellular networks that comprise biological systems. To accomplish this task, 

new technologies must be developed to measure multiple chemical species 

within intact intracellular networks. We have demonstrated a new method, 

the laser micropipet system, for the simultaneous measurement of the activation 

of key regulatory enzymes in small groups of cells, a single cell, or 

portions of a cell. This assay strategy should be broadly applicable to measurements 

of a broad range of enzymes, including kinases, phosphatases, 

proteases, and nucleases. 

S11 

Genetic analysis by mass spectrometry. 

L.M. Smith; Univ. of Wisconsin–Madison, 1101 University Ave., 

Madison, WI 53706-1396 

In the last decade two powerful new tools for the mass spectrometric analysis 

of biomolecules have been developed, Matrix-Assisted Laser Desorption 

Mass Spectrometry (MALDI-MS), and Electrospray Ionization Mass Spectrometry 

(ESI-MS). The power of these methods lies in their ability to produce 

and mass analyze intact gas phase ions from very large molecules such as 

proteins and nucleic acids. The speed, accuracy, and sensitivity of the technologies 

make them well-suited to address a number of problems in genetic 

analysis, including the analysis of DNA sequence, genetic variations, and 

gene expression. Results in these areas will be presented, including recent 

work in which single nucleotide polymorphisms (SNPs) in genomic DNA 

may be analyzed without need for a prior PCR amplification step.

T1 

Oligonucleotide synthesis chemistry. 

R.T. Pon; Univ. of Calgary, 3350 Hospital Drive NW, Calgary, 

AB T2N 4N1, Canada 

Solid-phase oligonucleotide synthesis remains one of the most important 

technology platforms in the life sciences. It has been twenty years since the 

first automated DNA synthesizers were commercialized and phosphoramidite 

synthesis chemistry is well established. However, demand for increasing 

numbers and quantities of oligonucleotides continues to drive improvements 

to this technology. This presentation will provide an overview of DNA and 

RNA synthesis chemistry as it relates to a core facility operation. Alternative 

reagents for various synthetic steps will also be reviewed. This will include 

the Q-Linker and Linker Phosphoramidites reagents developed at the University 

of Calgary. These reagents have been used to improve synthesis productivity, 

recycle solid-phase supports, and perform tandem oligonucleotide 

synthesis. Such reagents may find future application in large scale or high 

throughput synthesis facilities. 

T3 

Practical aspects of DNA synthesizer operation. 

T.J. Demmitt; Biolytic Lab Performance, Inc., 39120 Argonaut Way, #229, 

Fremont, CA 94538 

Solid-phase oligonucleotide synthesis is typically performed via automated 

instrumentation. The quality of the product produced is related to many 

things one of which is the ability of the synthesis instrument to perform the 

chemistry consistently with quality. Maintenance, troubleshooting, repair 

and validation is key to keeping any instrumentation operating at peek efficiency. 

Maintaining these workhorse instruments has typically been entrusted 

to highly trained factory service engineers. The high level of expertise 

required to perform maintenance is defined at the instrument design stage, 

however it is entirely possible to perform many maintenance tasks with 

minimal electro-mechanical expertise. The focuses of this presentation is to 

show that a typical lab can perform much of its own service and thus minimize 

the need for high level maintenance engineering services. 

TUTORIAL ABSTRACTS 


T2 

Oligonucleotide synthesis quality control. 

A.T. Yeung, C.G. Miller, R.R. Muhlhauser; Fox Chase Cancer Ctr., 

7701 Burholme Ave., Philadelphia, PA 19111 

Solid-phase oligonucleotide synthesis using automated DNA synthesizers 

and phosphoramidite synthesis chemistry produces high quality oligonucleotides 

most of the time. However, a variety of situations can compromise 

the quality of the DNA products. These situations include synthesizer malfunctions, 

reagent and column problems, incomplete reagent delivery and 

inadequate wash steps. The purpose of quality control is to prevent products 

of inferior quality from becoming variables in the users’ experiments. This 

presentation will discuss the wide range of oligonucleotide quality control 

methods in use in various laboratories. The semi-automated procedure in our 

facility, using Mono Q column anion-exchange on a FPLC unit, will be 

shown. A modification of the DNA synthesis procedure on the ABI model 

394 synthesizer to improve product quality will be discussed. 

T4 

Tutorial/practical aspects of DNA synthesizer operation: 

a look at high throughput DNA synthesizers. 

M.E. Gunthorpe; Howard Hughes Med. Inst., UCSF, 533 Parnassus Ave. 

at 3rd Ave., Rm U436, San Francisco, CA 94143-0793 

Tough competition from commercial companies require DNA synthesis core 

facilities to continuously provide excellent products and services. One possible 

solution to ideally meet the challenge is to purchase high-throughput 

instrumentation. In doing so, the facility would easily increase their capacity 

without additional personnel and would be able to reduce the base cost so 

that prices can be lowered to match those of the commercial market. The current 

choices for high-throughput DNA synthesizers provide a variety of features. 

A review of these instruments would help to delineate which choice 

would adequately match the facility’s unique needs. The features, advantages/disadvantages 

and viewpoints regarding these instruments will be discussed 

in an open format. 



T5 

Technology resource grant opportunities. 

M.T. Marron1, M.A. Tingle1, N. Pearson2, M.J. Saunders3; 1NCRR, 

NIH, 6705 Rockledge Drive, Bethesda, MD 20892-7965, 2CSR, NIH, 

3Natl. Sci. Fndn. 

Federal funding is critical for equipping university-based Biomolecular 

Resource Facilities with state-of-the-art technologies. In this session, representatives 

from two Federal agencies, NSF and NIH, with day-to-day responsibility 

for administration of instrumentation grants, will discuss the review 

and funding of their various competitive grant programs. 

The tutorial session will be split into two parts. The first half of the session 

will provide an overview of the various instrumentation programs at NSF and 

NIH of interest to ABRF members. The second half of the session will focus 

on the preview processes at both agencies. Discussion will focus on practical 

tips on how to prepare a successful NSF and NIH proposal. Formal presentations 

will be followed by a question and answer period. 

T7 

Advances in DNA sequencing. 

L.S. Hall1, E. Thomas1, K. Lilley2, G. Grills1; 1Albert Einstein Col. of Med., 

1695 Poplar Street, NewYork, NY 10464, 2Cambridge Univ. 

This tutorial will review past advances in DNA sequencing and present new 

techniques for sequencing difficult templates. Significant advances have 

taken place in DNA sequencing in the past four years by virtue of improved 

instrumentation, advances in the sequencing chemistries and alternative reaction 

formats for sequencing difficult clones. In particular, the replacement of 

Rhodamine terminators with Big Dye terminators increased the range of signal 

strengths compatible with good data and eliminated many of the peak 

height errors associated with rhodamine terminators; such as base calling 

ambiguities linked to the pattern of a small ‘G’ following an ‘A’. 

The recent introduction of dGTP terminators has improved the quality of data 

from templates with high GC content or regions of secondary structure. 

Data will be presented demonstrating the effectiveness of dGTP compared 

to Big Dye. In addition, the efficacy of betaine (NNN Trimethylglycine) versus 

DMSO will be discussed. New data will be presented demonstrating that 

a combination of Big dye and dGTP can sequence through regions of high 

G-C content without incurring compressions, a disadvantage of dGTP terminators 

by themselves. 

Finally, studies are in progress to evaluate the ability of different techniques 

to sequence through various types of difficult motifs by addition of commercial 

additives, such as the new GIBCO Rx Enhancer buffers. In general 

difficult motifs, such as repeats, induce stalling of Taq and loss of signal 

beyond the offending region. Depending upon the type of template, these 

buffers can restore the processivity of the enzyme and resolve regions of secondary 

structure. Results will be presented from studies that identify combinations 

of additives that work well with particular motifs. 



T6 

Advances in DNA sequencing. 

M.A. Robertson; Univ. of Utah, 4A 438 School of Medicine, 

50 N. Medical Drive, Salt Lake City, UT 84132 

The Human Genome Project has been a major driving force for the development 

of new instrumentation and methodology for high throughput 

sequencing. During the last five years we have seen major advances both in 

instrumentation and sequencing chemistries. This tutorial will present user 

insight into one of the newer capillary instruments that promises to fit well 

into a core laboratory setting. The tutorial will also look at the changes in sequencing 

chemistry and present some solutions for difficult templates using 

these new chemistries. This tutorial is designed to be interactive. There will 

be a 30 minute question/answer session after the two main speakers, with a 

panel comprising the speakers and members of the DNA Sequencing Research 

Group. Please come armed with your most difficult sequencing problems 

and help spark a lively discussion session. 

T8 

Incorporating a 16 capillary electrophoresis DNA sequencer 

into a core facility. 

P.T. Morrison; Dana-Farber Cancer Inst., 44 Binney St., JFB216, 

Boston, MA 02115 

In the past few years the Human Genome Project (HGP) has driven innovation 

in DNA sequencing chemistry and instrumentation. For the most part this 

has been beneficial for all types of DNA sequencing projects both large and 

small. Recently manufacturers are now filling a void for instrumentation that 

is better suited for facilities that sequence less than 100,000 templates per 

year. 

The incorporation of an Applied Biosystems Model 3100 Genetic Analyzer 

into a core facility environment will be discussed.

T9 

More than one way to capture a phosphopeptide. 

H. Erdjument-Bromage; Mem. Sloan-Kettering Cancer Ctr., 

1275 York Avenue, New York, NY 10021 

Despite the advances made during the past few years, mapping the phosphorylation 

sites on a protein often proves to be quite challenging. In this 

tutorial, several issues concerning sample preparation will be discussed, 

namely the choice of proteases and chromatographic media (both reversedphase 

and metal affinity). To illustrate the importance of sample preparation, 

“failed” mapping experiments will be used to highlight possible steps where 

the capturing may go wrong. The optimal approach to affinity capture is a 

combination of (1) one or more different proteases with careful planning of 

the “pre-affinity” buffer exchange steps, and (2) specific, micro-preparative 

capture of the phosphorylated fragments on immobilized metal ions (e.g. 

Ga 3�), followed by a desalting/concentration step. Critical examination of all 

sequential steps will be considered in turn. 

T11 

Affinity capture of DNA-binding proteins. 

M. Yaneva; Mem. Sloan-Kettering Cancer Ctr., 1275 York Ave. Box 137, 

New York, NY 10021 

Regulatory nuclear proteins and their complexes bind to cis-regulatory elements 

depending on the gene activities. These proteins can be isolated from 

cell nuclei and captured in vitro using specific DNA oligonucleotides (or their 

multimers) immobilized on solid supports (e.g. beads). The successful capture 

of these proteins depends on: 1) abundance of the protein in the cell; 

2) efficiency of protein extraction; 3) stability of the protein in extract; 4) 

maintenance of post-translational modification during extraction; 5) conditions 

used for in vitro DNA binding; 6) affinity of the protein for the isolated 

control element. The conditions for sample preparation and characterization 

as well as the optimization of the affinity capture on DNA beads will be discussed. 

Finally, the captured proteins are displayed on SDS PAGE and stained 

proteins bands are subjected to identification by MS. 



T10 

Immunocapture of proteins—hints and tricks. 

R.M. Goetz; Mem. Sloan-Kettering Cancer Ctr., 1275 York Avenue, 

Box 137, New York, NY 10021 

Immunoprecipitation is a classical technique for capturing proteins from cell 

and tissue samples. Its sensitivity and specificity may be greater than those 

offered by any other technique, but critically depend on the experimental 

conditions applied. In this tutorial, various aspects of protein immunocapture 

will be discussed including the choice of sample buffer (detergents, chelators, 

enzyme inhibitors, reducing agents), the choice of antibody (monoclonal 

versus polyclonal; bivalent versus monovalent) and the choice of capture of 

formed immune complexes. 

T12 

Preparing and delivering an effective presentation. 

L.A. Steinke1, A. Smith2; 1Univ. of Nebraska Med. Ctr., Omaha, 

NE 68198-4525, 2Stanford Univ. Med Ctr. 

As scientists, we are often expected to present our data orally, accompanied 

by slides or a computer presentation. Many of us receive little training in public 

speaking, and see a microphone only at national meetings. Too often, 

important results are obscured by a poorly planned or poorly executed presentation. 

Sometimes, as speakers, we do not even know how to appropriately 

use the audio visual equipment that is available to us. Al Smith, Stanford 

University will present “How to get the message across—do’s, dont’s, 

and maybe’s”. The audiovisual department of the Town and Country will 

then present a short overview of the equipment found at most meeting 

places, and demonstrate its proper use. A professional speech coach will then 

cover “Organizing and Preparing a Scientific Presentation. Topics to be covered 

in this session will include overview of a presentation, organization and 

analysis of data, and the importance of a conclusion and a take home message. 



T13 

Fragment Analysis Research Group Tutorial 2001: a practical 

discussion of fragment analysis: sample preparation, 

instrumentation and analysis of the results. 

D.A. Bintzler1, L.O. Petukhova2, C. Rosato3; 1Univ. of Cincinnati, 

271 Bethesda Avenue, Cincinnati, OH 45267-0524, 2Rockefeller Univ., 

3Oregon State Univ. 

Fragment analysis is a growing field in the genetic sciences. Some basics in 

methodology may provide useful tools to the many service facilities expanding 

to include fragment analysis. This tutorial will be an instruction based discussion 

covering basic methodology and challenges associated with fragment 

analysis using slab gel and capillary electrophoresis. Topics will include 

methods for producing clean PCR products through PCR optimization for single 

markers and multiplexing markers before and after PCR. Instrument 

related factors that may affect the quality of the data would be discussed for 

both slab gel and capillary electrophoresis platforms. Finally, a section covering 

analysis of the results will discuss improving accuracy through selecting 

correct size standard peaks and developing the best standard curve. 

Methods of calculation will be compared. Means to properly identify the correct 

fragment peak from the multiple peaks commonly seen during the fragment 

analysis run will be demonstrated. Participants in the tutorial will come 

away with methods designed to improve their capabilities to start, or continue 

Fragment Analysis in their laboratory. 



Key to Abstract 

Numbering 

Prefixes: 

P = Poster 

R = Research Group 

S = Speaker 

T = Tutorial 

A 

Abel, A.P., P134-M 

Adams, P.S., P19-S, R1 

Aebersold, R., P45-T, P60-T, P66-T 

Allbritton, N.L., S9 

Alomary, A., S1 

Alterman, M.A., P80-M 

Alward, L.J., P67-S 

Ambulos, Jr., N.P., R2 

Amparo, G., P3-T 

Amshey, J.W., P124-S, P125-M 

Anderson, G.A., P45-T, P47-M 

Andon, N., P54-T 

Andresson, T., P31-S 

Annan, R.S., P94-S 

Arnott, D., P42-T 

Asano, Y., P25-S 

Aurigemma, C., S2 

Ayanoglu, G., P122-M 

B 

Baird, G.S., P95-M 

Balamurugan, K., P145-S 

Baldridge, K.K., P95-M 

Ballard, L.W., P144-T, R1 

Bao, Y., P136-S, R1 

Barbaro, K.C., P126-T 

Barragan, G., P135-T 

Bartley, D., R1 

Bateman, R., P64-S 

Bateman, R.H., P91-S 

Batz, S.A., P85-S 

Bautista, A., P125-M 

Bawge, V., P27-T 

Baybayan, P.A., P8-M 

Belcinski, R., P112-S 

Berger, S.J., P47-M 

Berggren, K.N., P130-S 

Bimmler, J., P61-S 

Bintzler, D.A., P9-T, R1, T13 

Blackburn, K., P48-T, P70-S 

Bloch, C., P77-M 

Bogoev, R.A., P124-S 

Bonewald, L., R2 

Booth, L.R., P1-S 

Boucher, R., P48-T 

Brancia, F., P63-T 

Breu, H., P27-T 

Brito, A., P121-S 

Brito, J., P79-S 

Brown, C.L., P119-M 

Brown, J., P62-M 

Brown, R., P122-M 

AUTHOR INDEX 

Brune, D.C., P49-S 

Burkhart, W., P48-T, P70-S 

C 

Caffo, N., P119-M 

Campbell, D., P26-M 

Campbell, J., P89-M 

Campion, M., P121-S 

Carberry, R., P82-S 

Carlson, J.E., P67-S 

Carr, S.A., P94-S 

Carruthers, R.A., P37-S, P91-S 

Cavey, G.S., P67-S 

Chan, J., P71-M, P73-S 

Chang, C-A., P122-M 

Chappell, G., P27-T 

Chen, S-M., P3-T 

Chin, D., P80-M 

Chin, D-H., P145-S 

Chulin, A., P99-T 

Connelly, R., P26-M 

Conrads, T.P., P45-T 

Cooper, C.A., P86-M 

Cordwell, S.J., P128-M 

Corthals, G.L., P41-M 

Couch, L., P23-M 

Cowell, S., S5 

Cummings, J.J., P131-M 

Cunha, R.B., P126-T 

D 

Dabrowiak, J., P135-T 

Dains, K., P112-S, P115-S 

Daley, T-J., P79-S 

Dalgren, G.D., S10 

Daniels, S., P57-T 

Dansithong, W., P25-S 

Das, R., P12-T 

David, L.L., P123-T 

Davis, R., P70-S 

Deciu, C., P59-M 

DeGnore, J.P., P89-M 

Deldot, T., P112-S 

Demmitt, T.J., T3 

Dhulipala, R., P118-S, P120-T 

Dhume, S.T., P85-S 

Diwu, Z., P130-S 

Dobrzanski, M.J., P19-S 

Dolios, G., P79-S 

Dong, P., P122-M 

Doyle, M.L., P109-S 

Dragulev, B.P., P136-S 

Ducret, A., P90-T 

Duewel, H., P103-S 

Dupont, D.R., P84-T, P97-S 

E 

Eisenstein, E., R7 

Ellerbrock, J., P116-M 

Eng, J., P60-T 

Ens, W., P66-T 

Erdjument-Bromage, H., S3, T9 

Esteban, C.D., P102-T 

F 

Faca, V.M., P88-S 

Farrell, W., S2 

Fayet-Faber, J., P135-T 

Fenyo, D., P104-M 

Ferguson, M.D., P21-T 

Fernandez, J., P79-S 

Figeys, D., P103-S 

Fisher, J.A., P117-T 

Fitzgerald, R.L., P46-S, S1 

Fontes, W., P126-T 

Fox, J.F., P136-S, R4 

Franke, C., P52-S 

Fröhlich, T., P52-S, P61-S 

Fuhrer, K., P108-T 

Fujimura, T., P129-T 

Fuller, C., P116-M 

Furtos-Matei, A., P93-T 

Furuishi, K., P87-T 

G 

Gall, A., P21-T 

Gallagher, P., P136-S 

Gaskell, S.J., P63-T 

Gillig, K.J., P108-T 

Goetz, R.M., T10 

Gonin, M., P108-T 

Gopalan, S., P115-S 

Gostick, D., P62-M 

Graham, K.S., P84-T 

Greene, L.J., P88-S 

Greig, M.J., S2 

Griffin, C., R3 

Griffin, P.R., P131-M 

Griffin, T.J., P66-T 

Grills, G., R3, T7 

Gross, L.A., P95-M 

Guettler, R., P18-T 

Gunning, K.M., P2-M 

Gunthorpe, M.E., R4, T4 

Gygi, S.P., P66-T 


H 

Haff, L.A., P36-T, P40-S 

Hager, K.M., P11-M 

Hahner, S., P55-S 

Haley, J.D., P104-M 

Hall, L.R., P36-T, P40-S 

Hall, L.S., P6-T, R5, T7 

Hall, S., P18-T 

Hall, S.C., P43-S 

Halpern, B., P51-T 

Hao, S.C., P143-M 

Harris, R., P80-M 

Harrison, M.J., P86-M 

Haugland, R.P., P130-S 

Hawes, J., P6-T, R5 

Hawke, D.H., P77-M, P50-M 

Hayashi, M., P87-T 

Haynes, P.A., P54-T 

Hefta, S.A., S3 

Hemesath, T., P31-S 

Henninger, D., P135-T 



Henschen-Edman, A.H., P92-M 

Henzel, W.J., P75-T, P78-T 

Hillen, W., P102-T 

Hobbs, J.B., P14-M 

Hockenberry, J., P121-S 

Hoffer, A., P20-M 

Hoffman, R.C., P95-M 

Hogan, R.J., P19-S 

Holle, A., P65-M 

Holloway, B.P., R4 

Hong, M-Y., P133-S 

Hong, Y.W., P114-T, P81-T 

Horn, M.J., P33-T, P68-M 

Hosta, L., P121-S 

Hoyes, J.B., P37-S, P64-S, P91-S 

Hruby, V., S5 

Hsi, K-L., P76-S, P97-S 

Huang, G.S., P133-S 

Hubbard, S.J., P63-T 

Huddleston, M.J., P94-S 

Huestis, M.A., P108-T 

Hufnagel, P., P56-M, P65-M 

Hughes, C., P31-S, P37-S 

Hughes, K.A., P1-S, P21-T, P113-M 

Hunt, N., S6 

Hunter, C.L., P51-T 

Hunter, T., P6-T, R5 

Hunziker, P., P80-M 

Hurkman, W.J., P127-S 

Hurley, J.B., P96-T 

I 

Iasnopolski, B., P27-T 

Imai, B., P29-M, P5-M, P79-S 

Indermuhle, P., P73-S, P110-M 

Ingendoh, A., P53-M, P55-S 

Ivanetich, K.M., P7-S 

Ivanov, V.T., P99-T 

J 

Jackson-Machelski, E., P6-T, R5 

Jedrzejewski, P.T., P71-M, P73-S 

Jensen, O.N., P91-S 

Jessen, T.H., S6 

Jett, M., P12-T 

Ji, X., P23-M 

Jilkine, A., P66-T 

Johnson, B., P8-M 

Johnson, B.F., P8-M, P117-T, P119-M 

Johnson, R.S., S3 

Johnston-Dow, L., P27-T 

Jones, C., P37-S, P91-S 

Jones, K., P112-S 

Jones, R., P36-T 

Jou, Y-H., P114-T, P81-T 

Juergens, M., P38-M 

Juhasz, P., P89-M 

K 

Kaiser, R.J., P113-M, P1-S 

Kaput, G., P121-S 

Karnick, S., P98-M 

Kasch, L., R1 

AUTHOR INDEX 

Kates, S., R2 

Kato, M., P25-S 

Kato, S., P25-S 

Katsamba, P.S., P106-S, P137-M, R6 

Kauri, L.S., S10 

Kellard, E., P69-T 

Kellmann, M., P38-M 

Kemper, C., P130-S 

Kennedy, R.T., S10 

Kihlberg, J., P93-T 

Kijenski, H., P146-M 

Kim, B-G., P142-S 

Kirchner, M., P79-S 

Kishiyama, A., P42-T, P75-T 

Kitchen, D., P16-S 

Knudtson, K., P6-T, R3, R5 

Koh, J., P18-T 

Kojima, M., P83-M 

Koller, A., P54-T 

Komatsu, S., P132-T 

Konishi, H., P132-T 

Koob, G.F., S1 

Koomen, J., P108-T 

Kopaciewicz, W., P69-T 

Kosman, C.A., P27-T 

Köster, C., P56-M 

Kostrzewa, M., P52-S, P61-S 

Kräuter, K-O., P52-S, P56-M 

Krishnan, S., P35-M, P82-S 

Kshirsagar, B., P27-T 

Kumar, A., P120-T 

Kumar, S., P27-T 

Kuo, S.S., P122-M 

L 

La Rotta, A., P65-M 

Lach, F., P5-M 

Laird-Offringa, I.A., P106-S, P137-M, 

R6 

Langridge, J., P62-M 

Langridge, J.I., P31-S, P37-S, P39-T, 

P62-M, P64-S, P91-S 

Ledman, D.W., P36-T, P40-S 

Lee, C-S., P142-S 

Lee, H., P66-T 

Lee, K.A., P96-T 

Lee, S-W., P47-M 

Lee, T.D., P34-S 

Leicester, S., P37-S 

Leinonen, J., P100-S 

Leonard, A., P26-M 

Lester, P.J., P63-T 

Leung, D.K., P33-T 

Leviten, D., P6-T, R5 

Li, G., P107-M, P21-T 

Li, Z., P132-T 

Liddell, P.A., P49-S 

Liedtke, S., P53-M 

Lilley, K.S., R3, R4, T7 

Lin, M., P35-M, P82-S 

Lippert, J.W., P49-S 

Liu, L., P28-S 

Lively, M., R4 


Liwei, Q., P8-M 

Lobo, M., P43-S 

Loboda, A., P66-T 

Lock, C.M., P44-M 

Lopez, J.C., P49-S 

Lopez, R., S2 

Lotti, R., P57-T 

Lubenow, H., P22-S 

Luk, D., P18-T 

Lund, K.P., P107-M, P21-T 

Luo, Y., P98-M 

Lynch, M.D., P82-S 

M 

Machado, L., P126-T 

Maeda, M., P87-T 

Mahr, K., P102-T 

Mahtani, M., P111-T, P112-S, 

P115-S 

Mamone, A., P112-S, P116-M, 

P118-S, P121-S 

Marks, A.R., S4 

Marron, M.T., T5 

Mason, G., P27-T 

Massimi, A., R3 

Mathews, W.R., P67-S 

Matsumoto, Y., P83-M 

Mayo, J.D., P58-S 

McArdle, B., P116-M, P118-S, P121-S 

McEldoon, W.L., P68-M 

Medalle, J., P29-M, P5-M 

Mendis, C.A., P12-T 

Meredith, G., S9 

Meys, M., P82-S 

Milgram, K.E., S2 

Millar, A., P31-S, P37-S, P37-S, P39-T, 

P39-T, P64-S, P91-S 

Miller, C.G., P15-T, T2 

Miller, M.J., P30-T 

Miller, T.B., P19-S 

Mills, K., R4 

Minarik, M., P111-T, P112-S, P115-S 

Minkoff, M.S., P36-T 

Mitsumoto, T., P25-S 

Mizuno, Y., P83-M 

Moore, R.E., P34-S 

Moreno, T., P78-T 

Morita, M., P129-T 

Morrison, P.T., T8 

Moseley, A., P48-T, P70-S 

Moyer, M., P48-T, P70-S 

Mozdzanowski, J., P23-M 

Muehlbauer, B., P110-M 

Muhlhauser, R.R., P15-T, T2 

Murayama, K., P129-T 

Myszka, D.G., P101-M, P106-S, 

P137-M, R6 

N 

Nadler, T., P57-T 

Nakayama, Y., P87-T 

Närvänen, A., P100-S 

Nedelkov, D., P105-T

Neitz, S., P38-M 

Nelson, J., P116-M 

Nelson, J.S., P50-M 

Nelson, R.W., P105-T 

Nemirovskiy, O.V., P67-S 

Neubert, T.A., S3 

Niemi, G.A., P96-T 

Noble, R.L., P84-T 

Nock, S., P110-M, P71-M, P73-S 

Nordhoff, E., P61-S 

Nutter, B., P2-M 

Nuwaysir, L., P51-T 

O 

Oefner, P.J., P50-M 

Oliver, S.G., P63-T 

O’Malley, R., P39-T, P64-S 

Osapay, G., R2 

Oshiro, G., P59-M 

Ostrowski, L., P48-T 

P 

Packer, N.H., P86-M 

Pakkala, M., P100-S 

Palaniappan, C., P121-S 

Pan, H., P104-M 

Panisko, E.A., P45-T 

Parker, K.C., P57-T, P82-S 

Pasa-tolic, L., P45-T 

Patel, A., P51-T 

Patton, W.F., P130-S 

Paul, R., P27-T 

Paul, S., P25-S 

Pearson, N., T5 

Peltier, J., P89-M 

Pennetti, A., P23-M 

Pérez-Martínez, G., P102-T 

Petukhova, L.O., R1, T13 

Pham, C., S2 

Pham, V., P75-T 

Philip, Y., P64-S 

Pillai, S., P57-T 

Pingue, R., P8-M 

Pirkola, K., P111-T, P112-S, P115-S 

Pitt, A.M., P72-T 

Pluskal, M.G., P72-T 

Pon, R.T., P13-S, P17-M, T1 

Pope, R.M., P32-M 

Porter, S.G., P26-M 

Pretty On Top, K., P130-S 

Price, W., P134-M 

Pryor, A., P138-T 

Purdy, R.H., S1 

Purkayastha, B., P57-T 

Pusch, W., P52-S 

Q 

Qian, W-j., S10 

Qui, J., P16-S 

R 

Rakwal, R., P132-T 

Randall, B.D., S3 

AUTHOR INDEX 

Randesi, M., P29-M, P5-M 

Ranish, J., P60-T 

Raska, C.S., P32-M 

Rauth, H., P61-S 

Reagin, M., P116-M 

Remmer, H., R2 

Resemann, A., P74-M 

Ribbe, J., P20-M, P22-S 

Ricart, C.A.O., P126-T 

Richert, C., P58-S 

Rist, B., P66-T 

Rivera, J.D., S1 

Robertson, M.A., P6-T, R5, T6 

Robinson, J., S2 

Rodionov, I., P99-T 

Rohde, E., P131-M 

Roinishvili, L., P28-S 

Roper, M.G., S10 

Rosato, C., R1, T13 

Ross, P., P36-T 

Ross, P.L., P40-S 

Roy, K., P119-M, P8-M 

Rubenstein, D., P32-M 

Ruiz-Taylor, L., P110-M 

Russell, D.H., P108-T 

S 

Salamon, Z., S5 

Sanchez, C., P12-T 

Sandifer, F., P7-S 

Sanghvi, Y.S., P17-M 

Sangvanich, P., P63-T 

Sarracino, D.A., P58-S 

Sasagawa, T., P83-M 

Saunders, M.J., T5 

Scaringe, S.A., P16-S, R4 

Schade, C., P139-S, P146-M 

Schafer, A., P134-M 

Schäfer, F., P20-M 

Scharer-Hernandez, N.G., P134-M 

Schieltz, D., P59-M 

Schlabach, T.L., P76-S 

Schneider, A., P53-M, P55-S 

Scholl, R., P144-T 

Schoppe, M., P27-T 

Schultz, A.J., P108-T 

Schürenberg, M., P56-M 

Schwarz, H., P134-M 

Schweiger-Hufnagel, U., P53-M 

Settineri, T.A., P51-T, P77-M 

Settinery, C.A., P97-S 

Shen, D., P112-S, P115-S 

Shen, S., P132-T 

Shen, W-Z., P98-M 

Shen, Y., P47-M 

Shephard, T.R., P90-T 

Shillinglaw, W., P78-T 

Shindo, N., P129-T 

Shinozawa, T., P25-S 

Shuster, A., P112-S, P115-S 

Sidhu, K.S., P63-T 

Siegman, F., P139-S, P139-S, 

P146-M 


Sims, C.E., S9 

Siu, D., P27-T 

Slagel, J., P26-M 

Small, K.S., P135-T 

Smirnov, I.P., P40-S 

Smith, A., T12 

Smith, C.M., P138-T 

Smith, L.M., S11 

Smith, R.D., P45-T, P47-M 

Smith, T.M., P26-M 

Smith-Beckerman, D., P43-S 

Söhnlein, P., P20-M 

Somogyi, A., R2 

Song, Y., P9-T 

Sousa, M.V., P126-T 

Souto, L.M., P10-S 

Spicer, D.A., P113-M, P1-S 

Springer, A.L., P113-M, P1-S 

Spurgeon, S., P3-T 

Stalgies, Y., P52-S 

Standing, K.G., P66-T 

Stanick, W., P57-T 

Steinberg, T.H., P130-S 

Steinert, K., P20-M, P22-S, P22-S 

Steinke, L.A., T12 

Stenman, U-H., P100-S 

Stoerker, J., P58-S 

Stoll, R., P22-S 

Stolowitz, M.L., P21-T, P107-M 

Stults, J.T., S3 

Suckau, D., P65-M, P65-M, P74-M 

Sullivan, A.G., P63-T 

Suri, P.A., P27-T 

Susan, C.I., P94-S 

Sussman, M., S7 

Sweedler, J.V., S8 

Swei, A., P2-M 

Sword, E., P27-T 

Syu, W-J., P24-T 

T 

Tanaka, C.K., P127-S 

Taylor, R., P7-S 

Terrell, C.E., R1 

Tetzlaff, C.N., P58-S 

Thannhauser, T., P6-T, R4 

Thelemann, A., P104-M 

Thibault, P., P93-T 

Thomas, E., T7 

Thomas, I., P61-S 

Tian, J.N., P117-T 

Tingle, M.A., T5 

Titgemeyer, F., P102-T 

Tivel, K., S2 

Tolani, N., P110-M 

Tollin, G., S5 

Tomaney, A., P51-T 

Tomaney, A.B., P122-M 

Tsaprailis, G., R2 

Tsien, R.Y., P95-M 

Tsunoi, Y., P112-S 

Tuyet-Doan, A., P18-T 

Tyldesley, R., P64-S 



U 

Ueda, Y., P123-T 

Unemoto, T., P87-T 

Vallee, M., S1 

V 

van Soest, R., P53-M 

VanEe, J., R3 

Veenstra, T., P45-T 

Venkat, K., P23-M 

Vensel, W.H., P127-S 

Ventura, M., S2 

Vepsäläinen, J., P100-S 

Vestal, M., P89-M 

Vigil-Cruz, S., R2 

Vinayak, R., P50-M 

Voss, K.O., P117-T 

W 

Waddell, K., P35-M, P82-S 

Wagner, P., P71-M, P73-S, P110-M 

Wahle, S., P20-M, P22-S 

Wang, Y., P119-M 

Ware, J.A., P67-S 

Washburn, M.P., P59-M 

Wasinger, V.C., P41-M 

Wegener, S.L., P13-S 

Wehren, A., P139-S, P146-M 

Wei, D., P122-M 

Wei, J., P54-T 

AUTHOR INDEX 

Wen, L., P4-S 

Wenzel, T., P52-S, P61-S 

West, K., P80-M 

Wheaton, A., P119-M 

Whitney, S.E., P125-M 

Wiebe, G.J., P13-S 

Wike, C., P119-M 

Wiley, J.P., P21-T, P107-M 

Wilkins, M.R., P86-M 

Winzeler, E., P59-M 

Witt, M., P74-M 

Witte, K.L., P110-M 

Wolber, D., P7-S 

Wolkenhauer, O.V., P63-T 

Wolters, D., P59-M 

Wong, S., P75-T, P78-T 

Woodland, D.L., P19-S 

Woods, A.S., P108-T 

Wu, C., P81-T, P114-T 

Wu, D., P81-T, P114-T 

Wu, P., P100-S 

X 

Xiao, W., P50-M 

Xiong, X., S2 

Y 

Yadav, S.P., P98-M 

Yan, W., P7-S 

Yaneva, M., T11 


Yang, F.J., P81-T, P114-T 

Yang, G., P132-T 

Yang, P-C., P133-S 

Yanovsky, A., S2 

Yasui, M., P87-T 

Yates, III, J.R., P54-T, P59-M 

Yeung, A., P15-T, R4 

Yeung, A.T., T2 

Yoshikawa, M., P132-T 

Young, M.K., P34-S 

Young, P., P39-T, P62-M 

Young, S.G., P43-S 

Yu, S., P13-S, P17-M 

Yuan, Y.C., P143-M 

Yuen, S.W., P76-S, P77-M, P84-T, 

P97-S 

Z 

Zacharias, D.A., P95-M 

Zahn, M., P121-S 

Zappacosta, F., P94-S 

Zaugg, F., P110-M 

Zhang, B-H., P140-M, P141-T 

Zhang, J., P98-M 

Zhou, H., P66-T 

Zielke, H., P3-T 

Zieske, L.R., P76-S, P77-M 

Zon, J., P2-M 

Zrolka, A.M., P134-M 

Zwahlen, P., P73-S

Admon, Arie, 92 

Bibbs, Lisa, 1 

Bintzler, Douglas A., 122 

Carr, Steve A., 92 

Croker, Curtis G., 135 

Davis, Gary, 92 

De Jongh, Karen, 92 

Denslow, Nancy, 1 

Devaney, Joseph M., 67 

Girard, James, 67 

Haqqi, Talat, 111 

Harper, Sandra, 74 

Hathaway, Gary M., 1 

Henzel, William J., 92 

ABRF-98SEQ, 92 

automated sample analysis, 135, 151 

biotechnology core laboratories, 1, 151 

capillary electrophoresis (CE), 67 

core facilities, biotechnology, 1, 151 

data-controlled analysis, 135 

desalting samples, 12 

differential display polymerase chain reaction 

(DD-PCR), 87 

digestion, in-gel, 74 

dimethyl sulfoxide (DMSO), 111 

DNA 

sequencing of at core facilities, 1 

sequencing telomeric, 111 

small-scale sequencing of, 151 

synthesis of at core facilities, 1, 122 

expert systems, 135 

genes, differentially expressed, 87 

genetic testing, 67 

JBT 


hemochromatosis, detection of, 67 

high-performance liquid chromatography (HPLC), 

purifying primers with, 87 

INDEX TO VOLUME 11, 2000 

AUTHOR INDEX 

Ivanetich, Kathryn M., 1 

Keen, Denise A., 135 

Kolbas, Olivera, 74 

Lane, William, 92 

Lee, Terry D., 135 

Liang, Qi, 67 

Lin, Ching-Lun, 151 

McMillen, Debra A., 1 

Moore, Roger E., 135 

Moran, Laurie, 151 

Naeve, Clayton, 1 

Niece, Ronald L., 1 

Pearcy, John O., 135 

Rohde, Michale, 92 

SUBJECT INDEX 

in-gel digestion, 74 

laser-induced fluorescence capillary electrophoresis 

(LIF-CE), 67 

liquid chromatography (LC), protein analysis using, 135 

mass analysis, core facilities capable of, 1 

mass spectrometry (MS) 


core facility use of, 1 

desalting and concentrating samples for, 12 

peptide sequencing with, 92 

tandem mass (MS/MS), 92, 135 

matrix-assisted laser desorption and ionization (MALDI) 

mass spectrometry 


core facilities using, 1 

desalting samples for, 12 

variations in peptide signals for, 75 

messenger RNA, amplification of, 87 

oligonucleotide synthesis, 87, 122 

Rusnak, Felicia, 1 

Simpson, John T., 67 

Slatko, Barton, 151 

Speicher, David W., 74 

Speicher, Kaye D., 74 

Stahl, Douglas C., 135 

Steinke, Laurey, 92 

Terrell, Catherine E., 122 

Thompson, Barry H., 67 

Tindall, Stephen, 1 

Ware, Jennifer L., 151 

Wen, Long, 87 

Yadav, Satya P., 111 

Zhao, Xiaolan, 111 

peptide adsorption, 74 

peptide, tryptic, 74 

polymerase chain reaction, differential display 

(DD-PCR), 87 


post-source decay (PSD), 92 

primers 


HPLC purification of, 87 

DNA synthesis using, 122 

protein 


automated analysis of, 135 

identification using in-gel digestion, 74 

sequencing and purification of at core facilities, 1, 92 

standards for consistency of recovery of, 77 

proteolytic digests, desalting of, 12 

proteome, analysis using in-gel digestion, 74 


repeat sequences, 111 

robotics, DNA sequencing using, 151 

single-nucleotide extension, 67 

single-nucleotide polymorphism (SNP), 67 

synthesis, oligonucleotide, 87 

telomeric DNA, 111 

tandem mass spectometry (MS/MS), 92, 135 

tryptic peptides, 75 

virtual instruments, 135 

INDEX TO VOLUME 11, 2000

JBT 


EDITORIAL POLICY AND CALL FOR ARTICLES 

The Journal of Biomolecular Techniques (JBT) is a peer-reviewed publication issued quarterly by 

the Association of Biomolecular Resource Facilities. It was established to promote the central role 

biotechnology plays in contemporary research activities, to disseminate information among biomolecular 

resource facilities, and to communicate the biotechnology research conducted by the 

Association’s Research Groups, Association Members, and interested investigators. 

The publication has an international audience and is intended for professionals engaged 

in biotechnology research and service. We welcome contributions from specialists in protein 

and nucleic acid chemistry, mass spectrometry, bioinformatics, biomolecular resource facilities 

operations and management, and related areas. To keep the publication focused on topics of 

interest, articles are often solicited by the Editorial Board. Direct submissions or inquiries about 

the suitability of proposed articles may be directed to the Editor, Clayton W. Naeve, Ph.D., St. 

Jude Children’s Research Hospital, Memphis, TN 38101; Tel: (901) 495-3861; Fax: (901) 495- 

2945; email: clayton.naeve@stjude.org 

JBT is published in English and features three types of articles: Methods & Reviews, Tips 

Articles, and Research Communications. The purpose and requirements of all three types 

of articles are discussed below in the “Instructions for Authors.” JBT is also published electronically 

on the Association’s Web site at http://www.abrf.org 

All material submitted for publication in the Journal 

should be sent to 

Clayton W. Naeve 



Memphis, TN 38105-2794 

Tel: (901) 495-3689 

Fax: (901) 495-2945 

email: Clayton.Naeve@stjude.org 

Queries can be addressed to the above address until 

notification of acceptance is received. Once the article 

is in production, address questions to 

Molly Connors 

Copperplate Press, Inc. 

85 East Stewart Avenue 

Lansdowne, PA 19050 

Tel: (610) 284-5257 

Fax: (610) 284-5258 

email: mconnors@copperplatepress.com 

INSTRUCTIONS FOR AUTHORS 

JOURNAL SECTIONS 

Please indicate to which section you wish to submit 

your manuscript. However, the publisher reserves the 

right to place articles in whichever sections the Editorial 

Board deems appropriate. 

Methods and Reviews: Methods and Reviews articles 

are communications reviewing and detailing existing 

or emerging technologies or providing comprehensive 

descriptions of bioanalytical techniques. Research 

articles are also welcomed. 

Tips: Tips articles are shorter communications focusing 

on bioanalytical techniques or providing detailed descriptions 

of new methodologies or new modifications 

to techniques that improve the performance of the 

method being discussed. 

Research Communications: Research communications 

articles are very short. They are intended to foster 

the rapid dissemination of new information and


developments in bioanalytical methodology. They 

may consist of new techniques, improvements to 

existing methods, or solutions to common problems. 

Research Communications are submitted by email, 

receive expedited on-line review, and, on acceptance, 

are immediately posted on the ABRF Web Server. 

These articles are then printed in the next edition of 

the Journal. Detailed instructions for submitting Research 

Communications can be obtained from the 

ABRF Web site at http://www.abrf.org 

SUBMISSION REQUIREMENTS 

Please include a cover letter indicating the name, 

address, telephone and fax numbers, and email 

address of the individual to whom correspondence 

and proofs are to be addressed. Also indicate to 

which section of the Journal the manuscript is being 

submitted (see Journal Sections). Wrap the package 

well and use extra-strength envelopes if possible. All 

manuscripts will be acknowledged on receipt at the 

editorial office. After peer review is completed, 

authors will receive notification of acceptance or 

rejection, or articles may be returned for revision and 

resubmission. 

Submissions should contain the following materials. 

See respective sections below for details. 

• Cover letter 

• Four copies of manuscript, including title page, 

abstract, references, and figure legends 

• Manuscript on disk, labeled 

• Four copies of original art, labeled 

• Four copies of tables 

• Copyright release form 

All material submitted for publication, including 

solicited articles and supplements, is subject to peer 

review and revision and editorial review. Only previously 

unpublished material will be considered for 

publication. Material submitted to the Journal must 

not be under consideration for publication elsewhere. 

All accepted manuscripts become the property 

of the Journal and may not be reproduced or 

published without the written permission of the Publisher. 

Per United States Copyright Law of 1978, the 

transfer of copyright from author to publisher must be 

explicitly stated in writing to enable the publisher to 

ensure maximum dissemination of the author’s work, 

including, but not limited to, electronic formats. A 

copy of this agreement, executed and signed by all 

authors, is required before an article can be published. 

FORMAT FOR ARTICLES 

Four copies of the manuscript should be submitted in 

English. Include a disk, making certain that the version 

on the disk matches the hard copy. Use standard 

8 1 /2- � 11-inch paper and 1-inch margins. Do not use 

“erasable” bond. All copy, including figure legends, 

tables, and references, must be typed double-spaced 

and on one side of the sheet only. Include page numbers 

at the top of the page. 

The title page should include the title of the article, 

all authors’ names and affiliations, a complete 

description of any grants supporting the research, 

notation of any possible conflict of interest, a shortened 

version of the title to use as a running head (40 

characters maximum), and complete contact information 

for the corresponding author as outlined previously. 

The second page of the article should contain an 

abstract of approximately 200 words. This page 

should also contain three to five descriptive nouns or 

key words for indexing purposes. 

The body of the article should be placed next, followed 

in turn by the references, figure legends, and 

tables. 

STYLE 

Dorland’s Illustrated Medical Dictionary, 28th Edition, 

and Merriam Webster’s Collegiate Dictionary, 

10th Edition, should be used as standard references. 

Scientific (ie, generic) names of drugs should be 

used when possible. Copyrighted or trade names of 

drugs or devices should be capitalized, and the 

name of the manufacturer and the manufacturer’s 

location (city, state, and country) should be supplied 

in parentheses after first mention. It is not 

necessary to insert trademark or registration symbols. 

Units of measure should be expressed in the 

metric system. Temperatures should be expressed in 

degrees Celsius. In general, style should be patterned 

after the American Medical Association Manual 

of Style, 9th Edition. 

REFERENCES 

References should be cited in order in the text by 

superscript number; citations should follow punctuation 

when possible. A corresponding list of references 

numbered in order of citation should appear, doublespaced, 

at the end of the manuscript. Unpublished 

data, personal communications, or articles submitted

ut not yet accepted for publication should not be 

numbered references but should be cited parenthetically 

in the text. (eg, Jones SA, personal communication, 

April 1998). If there are up to six authors, all 

should be listed; if there are more than 6 authors, the 

first three should be listed, followed by et al. Journal 

titles should be abbreviated as in Index Medicus. References 

should conform the following style: 

Journal Article: Doe HT, Smith MA, Jones SA, et al. 

Subjective evaluations of proteases and mass 

spectrometry. N Engl J Med 1998;25:311–322. 

Book: Williams DW. Molecular Weight Markers, 2nd 

ed, vol 1. Philadelphia: WB Saunders, 1997:113– 

215. 

Chapter in Book: Brown PG, Miller FB. Equilibration 

of the first dimension. In Williams DW (ed): 

Molecular Weight Markers, 2nd ed, vol 1. Philadelphia: 

WB Saunders, 1997:216–228. 

ILLUSTRATIONS 

Four sets of camera-ready, high-quality illustrations 

should be provided. Label each piece of art on the 

back with the first author’s name, abbreviated title, 

figure number, and an arrow indicating the top of the 

piece. Any lettering on the art should be large enough 

to be legible after necessary reduction. Shading 

should be used sparingly in line art and should not be 

dark. For computer-generated graphics, provide highquality 

original laser output. Legends should be supplied 

on a separate typewritten sheet at the end of the 

manuscript. 

Black and white illustrations will be reproduced 

without charge. The cost of reproduction of color 

illustrations may be charged to the author; an estimate 

will be provided to the author for approval 

before the article enters production. There is no 

charge for converting color illustrations to black and 

white. The publisher reserves the right to establish a 

reasonable limit on the number of illustrations in 

each article. 

INSTRUCTIONS FOR ELECTRONIC 

MANUSCRIPT SUBMISSIONS 

The preferred storage medium is a 3 1 /2-inch disk in a 

PC format; however, files in a Macintosh-compatible 

format will also be accepted. Files should be submitted 

in a standard word-processing format such as 


Microsoft Word or WordPerfect. Although we can convert 

from other word-processing formats, the vagaries 

of the conversion process may introduce errors, especially 

with special characters (eg, Greek or accented 

letters). Do not submit ASCII text files. 

Each submitted disk must be clearly labeled with 

the name of the first author, abbreviated article title, 

journal title, type of equipment used to generate the 

disk (PC or Mac), word-processing format (including 

version number), and filename used. 

It is imperative that the file submitted on disk be 

the final corrected version of the manuscript and 

agree with the final accepted version of the submitted 

paper manuscript. The disk submitted should contain 

only the final version of the manuscript. Delete all 

other material from the disk. 

Because we will typeset directly from the electronic 

version, it should not contain any extraneous 

formatting instructions. For example, 

Use hard carriage returns only at the end of paragraphs 

or display lines (eg, titles, heads). 

Do not use an extra hard return between paragraphs. 

Do not use tabs or extra spaces at the start of a 

paragraph or for list entries. 

Do not indent runover lines in references. 

Turn off hyphenation and justification. 

Do not specify page breaks or headers. 

Do not specify typeface. 

Take care to correctly enter “one” (1) and lower 

case “el” (l). 

Take care to correctly enter “zero” (0) and capital 

“oh” (O). 

Do not embed references in footnote functions of 

your word-processing program. 

Nonstandard characters (eg, Greek letters, math symbols) 

should be coded consistently throughout. 

Tables will be typeset from author-provided files 

and should be submitted in word-processing format; 

do not provide graphics files for tables. Illustrations 

will be shot from hard copy; do not include them on 

the disk. For computer-generated graphics, provide 

high-quality original laser output. Figure legends 

should be included at the end of the electronic manuscript 

file. 

REPRINTS 

All contributors will be offered the opportunity to 

purchase reprints of their articles when they receive 

proofs. Reprints are offered in 100-copy increments.


AUTHORSHIP RESPONSIBILITY, FINANCIAL DISCLOSURE, AND COPYRIGHT TRANSFER 

Manuscript Title: _________________________________________________________________________________________________ 

Manuscript Authors: ______________________________________________________________________________________________ 

Each author must read and sign the following statement. If necessary, photocopy this document and distribute to 

coauthors for their original ink signatures. Please compile all forms and include them with the manuscript. 

CONDITIONS OF SUBMISSION 

Retained Rights: Other than copyright, all proprietary rights (such as patent rights) are retained by the authors. 

Originality: The authors warrant that this submission is an original work. Neither this work nor a similar work has been 

published or will be submitted for publication elsewhere while under consideration by the Journal. 

Authorship Responsibility: The authors certify that they have participated sufficiently in the intellectual content, the 

analysis of data, if applicable, and the writing of this work to take public responsibility for it. They have reviewed the final 

version of the work, believe it represents valid work, and approve it for publication. Moreover, should the editors of the Journal 

request the data on which the work is based, they shall produce it. 

Disclaimer: The undersigned warrant that this work contains no libelous or unlawful statements and does not infringe 

on the rights or others. If excerpts (text or figures) from copyrighted works are included, written permission will be secured 

by the authors before submission, and credit will be properly acknowledged. 

Institutional Review Board/Animal Care Committee Approval: The undersigned authors certify that their institutions 

have approved the protocol for any investigation involving humans or animals and that all experimentation was conducted 

in conformity with ethical and humane principles of research. 

TRANSFER OF COPYRIGHT 

Authors’ Own Work: The undersigned authors hereby transfer, assign, or otherwise convey all copyright ownership 

worldwide, in all languages, and in all forms of media now or hereafter known, to the Association of Biomolecular Resource 

Facilities in the event that such work is accepted for publication in the Journal. To reproduce any figure or text from this article 

in future works of their own, the authors must obtain written permission. Such permission cannot be unreasonably withheld 

by the copyright holder. 

Government Employees: 

❏ If this article exists in the public domain because it was written as part of the official duties of the authors as employees 

of the U.S. Government, check this box. 

Note to Government Employees: If this work has been written in the course of employment by the U.S. Government, the 

box should be checked above and a copy of the relevant departmental statement of policy attached. A work prepared by a government 

employee as part of his/her official duties is called a “work of the U.S. Government” and is not subject to copyright. If 

the work is not prepared as part of the employee’s official duties, it may be copyrighted. 

Financial Disclosure: The undersigned authors certify that they have no commercial associations (eg, consultancies, stock 

ownership, equity interest, patent-licensing arrangements) that may pose a conflict of interests in connection with the submitted 

article, except as disclosed on a separate attachment. All funding sources supporting the work and all institutional or 

corporate affiliations of the authors should be acknowledged in the article. 

Signature Printed Name Date 

❏ Author’s own work ❏ Work for hire ❏ Government 






❏ Author’s own work ❏ Work for hire ❏ Government

FR AB - Science Reference

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?