Crocetin Inhibits Invasiveness of MDA‑MB‑231 Breast Cancer Cells ...

146
Original Papers
Crocetin Inhibits Invasiveness of MDA‑MB‑231
Breast Cancer Cells via Downregulation of Matrix
Metalloproteinases
Authors Dimitra G. Chryssanthi 1 , Petros G. Dedes 2 , Nikos K. Karamanos 2 , Paul Cordopatis 1 , Fotini N. Lamari 1
Affiliations
Key words
l " crocetin
l " all‑trans‑retinoic acid
l " matrix metalloproteinases
l " invasion
l " MDA‑MB‑231
received April 22, 2010
revised June 21, 2010
accepted July 1, 2010
Bibliography
DOI http://dx.doi.org/
10.1055/s-0030-1250178
Published online August 27,
2010
Planta Med 2011; 77: 146–151
© Georg Thieme Verlag KG
Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Dr. Fotini N. Lamari
Department of Pharmacy
Laboratory of Pharmacognosy &
Chemistry of Natural Products
University of Patras
26504 Rion
Greece
Phone: + 30 2610 9693 35
Fax: + 3026 10 9932 78
flam@upatras.gr
1 Department of Pharmacy, Laboratory of Pharmacognosy & Chemistry of Natural Products,
University of Patras, Rion, Greece
2 Department of Chemistry, Laboratory of Biochemistry, University of Patras, Rion, Greece
Abstract
!
Crocetin is a carotenoid dicarboxylic acid which,
in nature, is esterified with glucose or gentiobiose
units forming the crocins, abundant components
of saffron (a spice with many reputed medicinal
uses). We have previously reported that saffron,
crocins and crocetin inhibit breast cancer cell proliferation.
In order to further study the effect of
crocetin on breast cancer cells, we used the highly
invasive MDA‑MB‑231 cells and measured the viability
with the WST-1 assay and the invasiveness
through a reconstituted basement membrane.
After 24 h incubation, crocetin significantly inhibited
not only proliferation but also invasion at 1
and 10 µM. Cancer invasiveness and metastasis
are associated with the expression of matrix metalloproteinases
(MMPs). In order to study the
Introduction
!
Saffron, the dried styles (also referred as stigmata)
of Crocus sativus L. flowers, is widely used as
a spice while its uses in traditional medicine are
well established and date back to ancient Greece
and Egypt. The main constituents of saffron are
the crocins, which are mono- and diglycosyl esters
of crocetin [(2E,4E,6E,8E,10E,12E,14E)-2,6,11,15tetramethyl-2,4,6,8,10,12,14-hexadecaheptaenedioic
acid]. Studies in mice showed that orally administered
crocins are hydrolyzed to crocetin before
or during intestinal absorption, and crocetin
is partly metabolized to mono- and diglucuronide
conjugates [1].
Treatment of human cervical epithelioid carcinoma
cells (HeLa) with saffron led to a significant inhibition
of growth [2, 3], whereas this action was
mainly attributed to crocin; crocetin was not cytotoxic
[2]. Tarantilis et al. reported inhibition of
growth and induction of differentiation of promyelocytic
leukemia (HL-60) cells; IC50 values of
Chryssanthi DG et al. Crocetin Inhibits Invasiveness… Planta Med 2011; 77: 146–151
molecular changes of MMP expression that might
accompany the observed crocetin effects, gene
expression of MMPs was studied by RT‑PCR,
whereas protein expression and gelatinolytic activity
were determined with Western blotting
and zymography, respectively. The gene and protein
expression of pro-MT1-MMP and pro-MT2-
MMP were greatly attenuated by both crocetin
and all-trans-retinoic acid (ATRA, used as control).
Incubation with 10 µM crocetin for 24 h in
serum-free conditions reduced pro-MMP‑9activity
and pro-MMP‑2/MMP‑2 protein levels. When
cultured in media with sera 2 and 5%, crocetin at
10 μΜ also reduced gelatinase activity. The above
findings show that crocetin, the main metabolite
of crocins, inhibits MDA‑MB‑231 cell invasiveness
via downregulation of MMP expression.
2 µM for crocins and crocetin were found after incubation
for 5 days [4]. Aung et al. showed inhibition
of the growth of colorectal cancer cells but
not of normal ones by saffron extract and crocin
[5], whereas crocin-treatment of female rats with
colon cancer enhances survival without major
toxic effects [6]. A number of other studies have
demonstrated the cytotoxic effects of saffron and
crocin on various malignant cells [7–9]. We have
previously reported that saffron inhibits the proliferation
of the breast cancer MCF-7 and
MDA‑MB‑231 cells via its crocin constituents;
trans-crocin-4 and crocetin were equally cytotoxic
in MDA‑MB‑231 cells, whereas in MCF-7
cells crocetin displayed a stronger antiproliferative
action than trans-crocin-4 [10]. In agreement,
Mousavi et al. reported that saffron extract
(200–2000 µg/mL) decreased cell viability in
MCF-7 cells in a concentration- and time-dependent
manner with an IC50 of 400 ± 18.5 µg/mL
after 48 h [11].

Cancer invasion and metastasis have been associated with overexpression
of matrix metalloproteinases (MMPs) by tumor and
stromal cells [12]. MMPs, which are synthesized as zymogens,
are a family of structurally and functionally related endoproteinases
that are involved in many physiological and pathological
processes, including the host immune response and the early
steps of tumor evolution [12, 13]. Kousidou et al. reported that
MMP-9 and MT2-MMP are highly expressed in all breast epithelial
cancer cells as compared to normal mammary cells, whereas
the expression of MT2-MMP (MMP-15) may well be associated
with the malignant transformation of breast cells [14].
The aim of this study was to investigate the effect of the aglycon
and main metabolite of crocins, i.e., crocetin on proliferation and
invasiveness of MDA‑MB‑231 cells (human breast adenocarcinoma,
ER-negative). The MDA‑MB‑231 cell line was selected since it
has a high invasive potential [15]. In an attempt to find out the
mechanism by which invasiveness is attenuated, the effect of crocetin
on the expression pattern of the main metalloproteinases in
MDA‑MB‑231 cells, i.e., MMP-2,‑9,‑14 (MT1) and ‑15 (MT2), was
examined. In all the experiments, all-trans-retinoic acid (ATRA)
was used as a control. ATRA, a representative of the retinoid family,
has been shown to inhibit the invasion of MDA‑MB‑231 cells
and to decrease gelatinolytic and collagenolytic (MMP-1 expression)
activity [16, 17].
Materials and Methods
!
Chemicals and materials
The MDA‑MB‑231 cell line was obtained from the American Type
Culture Collection (ATCC) and Dulbeccoʼs minimal essential medium
(DMEM) was from Biochrom KG Seromed ® . Fetal bovine serum
(FBS), L-glutamine, sodium pyruvate, sodium bicarbonate,
nonessential amino acids, and antimicrobial agents were also
from Biochrom KG Seromed ® . Bovine insulin, D-glucose and agarose
were purchased from Sigma-Aldrich. All-trans-retinoic acid
(≥ 98% purity) was also purchased from Sigma-Aldrich (R2625)
and stock solutions of ATRA were prepared in DMSO at a starting
concentration of 0.2 M. All reagents were of analytical grade.
Commercially available saffron (styles of C. sativus) was kindly
provided by the Cooperative de Safran (Krokos Kozanise). The
plant material was identified by Professor Gregorios Iatrou, Department
of Biology, University of Patras, Greece.
Crocetin preparation
Crocetin was prepared by saponification of saffron aqueous extract
as previously described [1, 10]. In brief, the extract was hydrolyzed
with 10% w/v sodium hydroxide at room temperature
for 2 h. The solution was then acidified with 1 N H2SO4 and the
formed precipitate was washed twice with water and then with
methanol. Crocetin was then crystallized with dimethylformamide
and dried under vacuum. Crocetin was further purified
with semipreparative HPLC on a Supelcosil C18 (5 µm,
25 cm × 4.6 mm, Sigma-Aldrich) column. Elution was performed
with a gradient of methanol (40–100%) for 40 min at a flow rate
of 1.5 mL/min. The purity and identity of crocetin was studied
with HPLC, ESI‑MS, NMR, UV‑vis and IR spectroscopy. The stock
solution of crocetin (purity > 98%) was prepared in DMSO at a
starting concentration of 1 M.
Original Papers
Cell culture
Cells were cultured as monolayers at 37 °C in a humidified atmosphere
of 5% (v/v) CO2 and 95% air and in DMEM supplemented
with 10% FBS, 2 mM L-glutamine, 1.0 mM sodium pyruvate, 1.5 g/
L sodium bicarbonate, 0.1 mM nonessential amino acids, 100 µg/
mL of insulin and a cocktail of antimicrobial agents (100 IU/mL
penicillin, 100 µg/mL streptomycin, 10 µg/mL gentamycin and
2.5 µg/mL amphoterecin B). For cell viability assays, cells were
seeded at an initial concentration of 5000 cells/well in 24-well
tissue culture plates and incubated in serum-free medium with
crocetin and ATRA at the concentrations of 1 μΜ and 10 μΜ for
24 h. Control cells were cultured in medium containing DMSO at
the same percentage (maximum 0.1% v/v) as in the treated cells.
Cell viability was assessed using the WST-1 reagent from Invitrogen.
Each experiment was performed in triplicate and performed
at least three times.
Cell invasion assay
Cells were grown in plastic tissue culture flasks in serum-containing
media until they reached approximately 60–65% confluency.
Cells were then incubated for 24 h in serum-free medium
with or without the tested compounds. Invasiveness was measured
using the CHEMICON Cell Invasion Assay Kit ECM 550
(Chemicon ® International, Inc.). After 24 h pretreatment with
the tested compounds, cells were cultured in serum-free media
containing the tested compounds in microplate inserts with a
polycarbonate membrane, over which the reconstituted matrix
was dried. These inserts were dipped in serum-containing media
in 24-well tissue culture plates and incubated for 24 h. Invasive
cells migrate through the ECM layer and cling to the bottom of
the polycarbonate membrane. After the non-invading cells were
carefully removed, invading cells were stained, photographed
and quantitated through dilution in acetic acid 10%. Absorbance
was measured at 560 nm.
Culture conditions for studying the expression of MMPs
Cells were grown in 75-cm 2 plastic tissue culture flasks in serumcontaining
media until they reached approximately 60–65% confluency.
Cells were then incubated for 24 h in serum-free medium
with the tested compounds or with medium containing
DMSO at the same percentage as in the treated cells. Total cellular
RNA was isolated after cell lysis with guanidium isothiocyanate
using the SV total RNA isolation system (Promega GmbH). The
expression of mRNAs encoded for MMPs [‑2, ‑9, MT1-MMP
(MMP-14), MT2-MMP (MMP-15)] was examined by RT‑PCR.
RT‑PCR conditions
Reverse transcription of RNA was performed using the Qiagen ®
OneStep RT‑PCR kit (Qiagen GmbH), on a Perkin-Elmer 2400
Gene AMP PCR System. The sequences of the primers and the
respective conditions used were for MMP-2: upstream 5′-
ATGCTTCCAAACTTCACGCTCT‑3′ downstream 5′-CACAGCCAAC-
TACGATGACGA‑3′ (tann = 57 °C, 828 bp); MMP-9: upstream 5′-
GGCCCTTCTACGGCCACT‑3′ downstream 5′-TTCATGACCGCTAA-
GAGAC‑3′ (tann = 57 °C, 515 bp); MMP-14: upstream 5′-
CGCTACGCCATCCAGGGTCTCAAA‑3′ downstream 5′-CGGTCAT-
CATCGGGCAGCACAAAA‑3′ (tann = 62 °C, 497 bp); MMP-15: upstream:
5′-ACAACCACCATCTGACCTTTAGCA‑3′ downstream
5′-AGCTTGAAGTTGTCAACGTCCTTC‑3′ (tann = 62 °C, 454 bp);
GAPDH: upstream 5′-ACATCATCCCTGCCTCTACTGG‑3′ downstream
5′-AGTGGGTGTCGCTGTTGAAGTC (261 bp).
Chryssanthi DG et al. Crocetin Inhibits Invasiveness… Planta Med 2011; 77: 146–151
147

148
Original Papers
The amplification was performed through 35 PCR cycles while
PCR vials contained initially 1 µg RNA of the cells studied. The
RT‑PCR conditions were: annealing for 30 sec at annealing temperature,
primer extension for 1 min at 72 °C and denaturation
for 30 sec at 94 °C, while at the end of all cycles, an additional extension
cycle was performed at 72 °C for 10 min, before the reaction
mixture was cooled at 4°C. Glyceraldehyde phosphate dehydrogenase
(GAPDH) was amplified as an internal control. The
amplification products were separated by electrophoresis in a
2% agarose gel, containing Gel Star ® stain (BioWhittaker). Bands
were visualized on a UV lamp and gels were photographed with a
CCD camera whereas MMPs were compared to the band of
GAPDH. Image analysis was performed using the program
UNIDocMv version 99.03 for Windows (UVI Tech).
Western blotting
The cellular extract was obtained after washing the cells with icecold
PBS solution. Cells were then lysed with RIPA buffer containing
proteinase inhibitors at 4°C for 30 min. Lysates were cleared
by centrifugation at 12 000 rpm for 10 min. Protein content was
determined with Bradford reagent. Samples (0.25 µg protein)
were analyzed by PAGE analysis after they were boiled for 4 min
in sample buffer supplemented with β-mercaptoethanol. Western
blotting for MMP-2 was performed in cell supernatants
(1.16 µg protein). The separated proteins were transferred to a
PVDF membrane and then blocked for 1 h in phosphate buffer
saline containing 0.5% Tween-20 (PBST) and 5% nonfat milk. The
membrane was then incubated with primary rabbit polyclonal
antibody for MT1-MMP (Μ3927, Sigma-Aldrich), for MT2-MMP
(ΑΒ851, Chemicon ® International, Inc., Serologicals ® Corporation)
and for MMP-2 (SC-10736, Santa Cruz), respectively. Membranes
were washed and then incubated for 1 h at room temperature
with secondary antibody. Bound antibody was detected using
enhanced chemiluminiscence reagent (Pierce). Quantification
was performed by comparing the density of MT1-MMP or MT2-
MMP band versus that of tubulin (ΑP132P, Chemicon ® International,
Inc., Serologicals ® Corporation).
Gelatin zymography
Cell supernatant (1 µg protein) was loaded on polyacrylamide gel
containing 1% gelatin. Electrophoresis was performed under
nonreducing conditions at 10 mA for 3 h. The gel was washed
twice in 2.5% Triton X-100 to remove SDS, incubated in 50 mM
Tris-HCl pH 7.5 containing 0.2 M NaCl and 10 mM CaCl2 for 72 h
at 37 °C. Gel was stained with 0.5% w/v Coomassie Brilliant Blue
in 40% v/v methanol and 10% v/v acetic acid for 45 min at room
temperature and destained (50% methanol, 40% water, 10% acetic
acid). The presence of pro-MMP-9, MMP-9 and MMP-2 was indicated
by unstained proteolytic zones of substrate at positions of
92, 82 and 62 kDa, respectively. Quantitative estimation of band
intensity was performed by the UNIDocMw software. In all cases,
the intensity of bands in media without cell conditioning and any
treatment was subtracted.
Results
!
After 24 h incubation of MDA‑MB‑231 cells with crocetin in serum-free
conditions, both proliferation and invasion of cells
through a reconstituted basement membrane were inhibited in
a dose-dependent way (l " Fig. 1).
Chryssanthi DG et al. Crocetin Inhibits Invasiveness… Planta Med 2011; 77: 146–151
Fig. 1 Crocetin and all-trans-retinoic acid induced changes in
MDA‑MB‑231 cell proliferation and invasion through a reconstituted basement
membrane. Cells were incubated with the compounds in serum-free
conditions for 24 h. Proliferation and invasiveness were then measured by
WST-1 and by a commercial kit, respectively, as described in Materials and
Methods (C: Control, I: + crocetin 1 μΜ, II: + crocetin 10 μΜ, III: + ATRA
10 μΜ). Data were normalized to % of untreated control. Each value
means ± SD of triplicate experiments. Asterisks indicate statistically significant
(p < 0.05) differences from control.
Fig. 2 Effect ofcrocetin and ATRA on gelatinase expression. Representative
pictures from agarose gel electrophoresis of the RT‑PCR 515 bp-product with
MMP-9 primers (A), Western blotting for MMP-2 (B) and gelatin zymography
of supernatants of MDA‑MB‑231 cells cultured in the presence of the tested
compounds for 24 h in media containing 0, 2 and 5%serum (C), are shown
out of three independent experiments (M: markers, C: Control, I: + crocetin
1 μΜ, II: + crocetin 10 μΜ, III: + ATRA 10 μΜ, IV: + ATRA 1 μΜ).
MMP-2 mRNA was not detectable in our study (data not shown)
whereas Western blotting showed the presence of pro-MMP-2
and MMP-2 only in control cells (l " Fig. 2B). Crocetin did not affect
MMP-9 gene expression whereas ATRA reduced MMP-9 ex-

Fig. 3 Effect of a 24-h incubation with crocetin and ATRA on MMP-14 (MT1-
MMP) mRNA (A) and protein (B) expression. Representative pictures from
agarose gel electrophoresis of the RT‑PCR (A) and Western blotting (B) are
shown on the right and semiquantification of those is shown on the left. Asterisks
indicate statistically significant (p < 0.05) differences from control.
pression by 30% (l " Fig. 2A). Gelatin zymography of cell supernatants
after incubation in serum-free conditions showed only the
presence of pro-MMP-9, which is reduced by crocetin at the concentration
of 10 μΜ by 41% (l " Fig. 2C). When the cells were cultured
in media containing serum 2% or 5%, gelatin zymography
showed the presence of pro-MMP-9, MMP-9 and MMP-2. In
comparison to control, the levels of latent MMP-9, active MMP-9
and active MMP-2 were reduced by crocetin at the concentration
of 10 μΜ by 52, 50 and 45% in the presence of serum 2% and by
23, 40 and 0% in the presence of 5% serum, respectively. Gelatinase
activities were not affected by 1 μΜ crocetin and ATRA
(l " Fig. 2C). Incubation of media containing 10% FBS with crocetin
and ATRA in the absence of cells for 24 h and gelatin zymography
showed that the tested compounds did not affect directly the
gelatinolytic activity of serum, i.e., pro-MMP-9, MMP-9 and
MMP-2 (data not shown).
Quantification of the electrophoretic profile of the PCR products
and comparison to that of the housekeeping GAPDH gene showed
a high constitutive expression of MT1 and MT2-MMPs by control
cells. Crocetin and ATRA strongly reduced levels of MT1-MMP
gene expression by nearly 70% at the concentration of 10 μΜ
(l " Fig. 3A). Western blotting showed a significant reduction of
pro-MT1-MMP levels by nearly 30% by both ATRA and crocetin
(l " Fig. 3B). The effect of these compounds on MT2-MMP gene expression
was even more pronounced; 95% reduction by crocetin
and 90% by ATRA (l " Fig. 4A). The protein levels of pro-MT2-MMP
were also greatly attenuated by crocetin and ATRA, by 87% and
75%, respectively (l " Fig. 4B).
Discussion
!
We have previously shown that crocetin inhibits the proliferation
of breast cancer MDA‑MB‑231 and MCF-7 cells in media containing
10% serum; the effect was more pronounced in MCF-7 cells
whereas in MDA‑MB‑231 cells the effect was significant at concentrations
higher than 200 µM [10]. We now show that incubation
of MDA‑MB‑231 cells with physiologically relevant concentrations
of crocetin (1 and 10 μΜ) under serum-free conditions,
leads to a significant decrease in the proliferation and invasive-
Original Papers
Fig. 4 Effect of a 24-h incubation with crocetin and ATRA on MMP-15 (MT2-
MMP) mRNA (A) and protein (B) expression. Representative pictures from
agarose gel electrophoresis of the RT‑PCR (A) and Western blotting (B) are
shown on the right and semiquantification of those is shown on the left. Asterisks
indicate statistically significant (p < 0.05) differences from control.
ness of breast cancer cells. This divergence of results may be explained
by the fact that in the presence of sera, cell proliferation is
stimulated and thus the inhibitory effect of crocetin is evident at
higher concentrations. These findings also suggest that crocetin is
not cytotoxic at normal concentrations, which is supported by
the fact that saffron consumption (200 and 400 mg) is considered
safe for humans [18]. ATRA did not affect cell proliferation in both
conditions, which is in accordance to earlier findings suggesting
that MDA‑MB‑231 cells are resistant to retinoids [16, 19].
In accordance to Benbow et al., ATRA suppressed the invasive
phenotype of MDA‑MB‑231 cells [16], while it is shown for the
first time that crocetin at the same concentration is more effective
and inhibits invasion through a reconstituted basement
membrane by nearly 50% (l " Fig. 1). Accordingly, another openchain
carotenoid, lycopene, has recently been characterized as
an effective inhibitor of migration and has been found to reduce
experimental tumor metastasis in vivo [20].
MMPs are implicated in invasion and metastasis of human cancer
cells [12, 13]. In this report, the effect of crocetin on the expression
pattern of the major MMPs in breast cancer is investigated
for the first time. Both mRNA expression levels and protein abundance
were studied by RT‑PCR and Western blotting since it has
been shown that the results do not always correlate due to the
complex post-transcriptional mechanisms and differences in
protein turnover; in relation to MMPs the commonest post-transcriptional
mechanism is the stability of the mRNA transcripts
which is affected by various ligands, like ATRA [21].
MT1-MMP and mostly MT2-MMP are significantly decreased by
both crocetin and ATRA (l " Figs. 3, 4). Both at mRNA (RT‑PCR) and
at protein levels (Western blotting of their proforms), crocetin
and ATRA induce a dose-dependent downregulation. The significant
inhibitory effect of ATRA on pro-MT1- and pro-MT2-MMP in
MDA‑MB‑231 cells is shown for the first time. In agreement, Dutta
et al. observed a reduction in protein levels of MT1-MMP, after
incubation of MCF-7 cells with 30 μΜ ATRA under serum-free
conditions [22]. These findings are of great importance since
MT-MMPs play a dominant role in regulating cancer and stromal
cells trafficking through the extracellular matrix barriers. MT1-
MMP levels are higher in cell lines with elevated invasive and
metastatic activities like MDA‑MB‑231 [14, 16, 23]. MT1-MMP
Chryssanthi DG et al. Crocetin Inhibits Invasiveness… Planta Med 2011; 77: 146–151
149

150
Original Papers
appears to play a dual role in extracellular matrix remodeling
through activation of progelatinase A and procollagenase 3 and
direct cleavage of some ECM macromolecules [24]. MT1-MMP
and MT2-MMP were able to directly confer invasion-incompetent
cells with the ability to penetrate type I collagen matrices,
acting as pericellular collagenases [25]. Thus, their downregulation
by crocetin and ATRA possibly suggests that the induced decrease
in collagenolytic activity contributes to suppression of invasive
phenotypes.
MMP-2 is not present in the zymogram in serum-free conditions,
while, at the same time, the mRNA for MMP-2 was not detected
(data not shown), suggesting its expression in trace levels. Western
blotting (a more sensitive technique) shows the presence of
pro-MMP-2 and MMP-2 only in control cells. In accordance,
when cells are cultured in serum-containing media, MMP-2 is
present at the zymograms. Although serum contains low
amounts of MMP-2, comparison of band intensities confirms that
cells do produce MMP-2, which can be explained by further stimulation
of MMP-2 expression by macromolecules, e.g., growth
factors, present in serum. Indeed, it has been shown that in
MDA‑MB‑231 cells MMP-2 and MMP-9, in contrast to other
MMPs, can be susceptible to upregulation [26]. In previous studies
in MDA‑MB‑231 cells under serum-free conditions, Kousidou
et al. suggested that MMP-2 is present in very low levels, whereas
Singer et al. reported a total absence of MMP-2 [14, 27]. In serumfree
conditions, crocetin and ATRA treatment of MDA‑MB‑231
cells causes a great reduction (disappearance) of the already low
pro-MMP-2/MMP-2 protein levels and in the presence of serum
(2%), crocetin induces reduction of MMP-2 activity. However, it
has been shown that in the tumor microenvironment MMPs are
mainly expressed by stromal fibroblasts, vascular cells, or by the
inflammatory cells that infiltrate tumors, rather than by cancer
cells [28]. Thus, crocetin not only induces downregulation of
MMP-2 by cancer cells but also might reduce its levels in the tumor
microenvironment indirectly via inhibition of cancer cell
MT1- and MT2-MMP expression which would activate pro-
MMP-2 produced by the surrounding cells.
Crocetin does not affect MMP-9 gene expression although it suppresses
activity of pro-MMP-9/MMP-9 as shown by zymography.
The suppression of gelatinase activity is not due to direct enzymic
inhibition of MMP-9 and MMP-2 activity as shown by experiments
conducted in cell-free conditions (data not shown), but
may be the result of post-transcriptional regulation or upregulation
of inhibitor molecules, like endogenous tissue inhibitors
(TIMPs). In our experiments, ATRA downregulated MMP-9
mRNA, in agreement with previous reports performed in
MDA‑MB‑231 cells [17], and reduced pro-MMP-2/MMP-2 levels,
even though no effect was observed in the zymograms in serumplus
conditions.
The mechanisms underlying crocetin effects on cancer cells are
largely unknown. It has been shown that crocetin interacts with
nucleic acids [29, 30]. Ashrafi et al. reported that crocetin binds
histones, therefore inducing alterations in the transcription process
[31]. Abdullaev reported a dose-dependent inhibition of nucleic
acid and protein-synthesis and suppression of the activity of
purified RNA polymerase II by crocetin in HeLa, A549 and VA13
cells [32]. Magesh et al. showed in mice that the antitumor function
of crocetin relates to its scavenging of free radicals [33]. Recently
Dhar et al. reported that crocetin downregulated growth
and proliferation, stimulated apoptosis and resulted in significant
growth regression in in vivo pancreatic tumors; in particular
treatment of pancreatic cancer cells with crocetin significantly
Chryssanthi DG et al. Crocetin Inhibits Invasiveness… Planta Med 2011; 77: 146–151
inhibited cell distribution in the S phase, accumulation of cells in
the G2-M phase and stimulated apoptosis [34].
Overall, crocetin not only inhibits the proliferation but also the
invasiveness of the highly invasive MDA‑MB‑231 cells. This
change of cell behavior is accompanied by distinct changes of
MMP expression; i.e., reduction in pro-MT1- and pro-MT2-MMP
protein levels and suppression of pro-MMP-2/MMP-2 protein
levels and gelatinase (MMP-2 and MMP-9) activity. Although
cancer cell invasiveness is a complex process requiring the disruption
of normal cell-cell interaction (e.g., reduced E-cadherin),
cell-ECM (e.g., altered integrin expression) and proteolytic enzyme
expression (mainly MMPs, cathepsins and plasminogen activator)
[35], these results suggest that the aglycon part and main
metabolite of crocins, crocetin, might be of value as concerns
breast cancer and deserves further investigation in order to establish
if it could be used as a chemopreventive agent or for the
development of new anticancer therapeutics.
Acknowledgements
!
The authors acknowledge with thanks the Research Committee
of the University of Patras for financial support under the “K. Karatheodoris”
Grant N° C178 and Professor Gregorios Iatrou for his
kind contribution in identifying the plant material.
References
1 Asai A, Nakano T, Takahashi M, Nagao A. Orally administered crocetin
and crocins are absorbed into blood plasma as crocetin and its glucuronide
conjugates in mice. J Agric Food Chem 2005; 53: 7302–7306
2 Escribano J, Alonso GL, Coca-Prados M, Fernandez JA. Crocin, safranal
and picrocrocin from saffron (Crocus sativus L.) inhibit the growth of
human cancer cells in vitro. Cancer Lett 1996; 100: 23–30
3 Tavakkol-Afshari J, Brook A, Mousavi SH. Study of cytotoxic and apoptogenic
properties of saffron extract in human cancer cell lines. Food
Chem Toxicol 2008; 46: 3443–3447
4 Tarantilis PA, Morjani H, Polissiou M, Manfait M. Inhibition of growth and
induction of differentiation of promyelocytic leukemia (HL‑60) by carotenoids
from Crocus sativus L. Anticancer Res 1994; 14: 1913–1918
5 Aung HH, Wang CZ, Ni M, Fishbein A, Mehendale SR, Xie JT, Shoyama CY,
Yuan CS. Crocin from Crocus sativus possesses significant anti-proliferation
effects on human colorectal cancer cells. Exp Oncol 2007; 29:
175–180
6 Garcia-Olmo DC, Riese HH, Escribano J, Ontanon J, Fernandez JA, Atienzar
M, García-Olmo D. Effects of long-term treatment of colon adenocarcinoma
with crocin, a carotenoid from saffron (Crocus sativus L.):
an experimental study in the rat. Nutr Cancer 1999; 35: 120–126
7 Thatte U, Bagadey S, Dahanukar S. Modulation of programmed cell
death by medicinal plants. Cell Mol Biol 2000; 46: 199–214
8 Abdullaev FI, Riveron-Negrete L, Caballero-Ortega H, Manuel Hernandez
J, Perez-Lopez I, Pereda-Miranda R, Espinosa-Aguirre JJ. Use of in vitro
assays to assess the potential antigenotoxic and cytotoxic effects of saffron
(Crocus sativus L.). Toxicol In Vitro 2003; 17: 731–736
9 Abdullaev FI. Cancer chemopreventive and tumoricidal properties of
saffron (Crocus sativus L.). Exp Biol Med (Maywood) 2002; 227: 20–25
10 Chryssanthi DG, Lamari FN, Iatrou G, Pylara A, Karamanos NK, Cordopatis
P. Ιnhibition of breast cancer cell proliferation by style constituents
of different Crocus species. Anticancer Res 2007; 27: 357–362
11 Mousavi SH, Tavakkol-Afshari J, Brook A, Jafari-Anarkooli I. Role of caspases
and Bax protein in saffron-induced apoptosis in MCF‑7 cells.
Food Chem Toxicol 2009; 47: 1909–1913
12 Konjevic G, Stankovic S. Matrix metalloproteinases in the process of invasion
and metastasis. Arch Oncol 2006; 14: 136–140
13 Murray GI. Matrix metalloproteinases: a multifunctional group of molecules.
J Pathol 2001; 195: 135–137
14 Kousidou OC, Roussidis AE, Theocharis AD, Karamanos NK. Expression of
MMPs and TIMPs genes in human breast cancer epithelial cells depends
on cell culture conditions and is associated with their invasive
potential. Anticancer Res 2004; 24: 4025–4030

15 Thompson EW, Paik S, Brünner N, Sommers CL, Zugmaier G, Clarke R, Shima
TB, Torri J, Donahue S, Lippman ME, Martin GR, Dickson RB. Association
of increased basement membrane-invasiveness with absence of
estrogen receptor and expression of vimentin in human breast cancer
cell lines. J Cell Physiol 1992; 150: 534–544
16 Benbow U, Schoenermark MP, Orndorff KA, Givan AL, Brinckerhoff CE.
Human breast cancer cells activate procollagenase-1 and invade type I
collagen: invasion is inhibited by all-trans retinoic acid. Clin Exp Metastasis
1999; 17: 231–238
17 Liu H, Zang C, Fenner MH, Possinger K, Elstner E. PPARgamma ligands
and ATRA inhibit the invasion of human breast cancer cells in vitro.
Breast Cancer Res Treat 2003; 79: 63–74
18 Modaghegh MH, Shahabian M, Esmaeili HA, Rajbai O, Hosseinzadeh H.
Safety evaluation of saffron (Crocus sativus) tablets in healthy volunteers.
Phytomedicine 2008; 15: 1032–1037
19 Ng JH, Nesaretnam K, Reimann K, Lai LC. Effect of retinoic acid and palm
oil carotenoids on oestrone sulphatase and oestradiol-17beta hydroxysteroid
dehydrogenase activities in MCF‑7 andMDA‑MB‑231 breast
cancer cell lines. Int J Cancer 2000; 88: 135–138
20 Huang CS, Liao JW, Hu ML. Lycopene inhibits experimental metastasis
of human hepatoma SK‑Hep-1 cells in athymic nude mice. J Nutr
2008; 138: 538–543
21 Yan C, Boyd DD. Regulation of matrix metalloproteinase gene expression.
J Cell Physiol 2007; 211: 19–26
22 Dutta A, Sen T, Banerji A, Das S, Chatterjee A. Studies on multifunctional
effect of all-trans-retinoic acid (ATRA) on matrix metalloproteinase-2
(MMP‑2) and its regulatory molecules in human breast cancer cells
(MCF‑7). J Oncol, advance online publication 19 July 2009; doi:
10.1155/2009/627840
23 Figueira RC, Gomes LR, Neto JS, Silva FC, Silva ID, Sogayar MC. Correlation
between MMPs and their inhibitors in breast cancer tumor tissue
specimens and in cell lines with different metastatic potential. BMC
Cancer 2009; 9: 20
24 Polette M, Birembaut P. Membrane-type metalloproteinases in tumor
invasion. Int J Biochem Cell Biol 1998; 11: 1195–1202
Original Papers
25 Hotary K, Allen E, Punturieri A, Yana I, Weiss SJ. Regulation of cell invasion
and morphogenesis in a three-dimensional type I collagen matrix
by membrane-type matrix metalloproteinases 1, 2, and 3. J Cell Biol
2000; 149: 1309–1323
26 Bartsch JE, Staren ED, Appert HE. Matrix metalloproteinase expression
in breast cancer. J Surg Res 2003; 110: 383–392
27 Singer CF, Kronsteiner N, Marton E, Kubista M, Cullen KJ, Hirtenlehner K,
Seifert M, Kubista E. MMP‑2 and MMP‑9 expression in breast cancerderived
human fibroblasts is differentially regulated by stromal-epithelial
interactions. Breast Cancer Res Treat 2002; 72: 69–77
28 Bissell MJ, Radisky D. Putting tumours in context. Nat Rev Cancer 2001;
1: 46–54
29 Kanakis CD, Tarantilis PA, Pappas C, Bariyanga J, Tajmir-Riahi HA, Polissiou
MG. An overview of structural features of DNA and RNA complexes
with saffron compounds: models and antioxidant activity.
J Photochem Photobiol B 2009; 95: 204–212
30 Bathaie SZ, Bolhasani A, Hoshyar R, Ranjbar B, Sabouni F, Moosavi-Movahedi
AA. Interaction of saffron carotenoids as anticancer compounds
with ctDNA, Oligo (dG.dC)15, and Oligo (dA.dT)15. DNA Cell Biol 2007;
26: 533–540
31 Ashrafi M, Bathaie SZ, Taghikhani M, Moosavi-Movahedi AA. The effect
of carotenoids obtained from saffron on histone H1structure and H1-
DNA interaction. Int J Biol Macromol 2005; 36: 246–252
32 Abdullaev FI. Inhibitory effect of crocetin on intracellular nucleic acid
and protein synthesis in malignant cells. Toxicol Lett 1994; 70: 243–251
33 Magesh V, Singh JP, Selvendiran K, Ekambaram G, Sakthisekaran D. Antitumour
activity of crocetin in accordance to tumor incidence, antioxidant
status, drug metabolizing enzymes and histopathological studies.
Mol Cell Biochem 2006; 287: 127–135
34 Dhar A, Mehta S, Dhar G, Dhar K, Banerjee S, Van Veldhuizen P, Campbell
RD, Banerjee KS. Crocetin inhibits pancreatic cancer cell proliferation
and tumor progression in a xenograft mouse model. Mol Cancer Ther
2009; 8: 315–323
35 Brooks AS, Lomax-Browne JH, Carter MT, Kinch EC, Hall MSD. Molecular
interactions in cancer cell metastasis. Acta Histochem 2010; 112:
3–25
Chryssanthi DG et al. Crocetin Inhibits Invasiveness… Planta Med 2011; 77: 146–151
151