SOUCHES AFRICAINES DU VIRUS DE LA ROUGEOLE : ETUDE ...

ifr128.prd.fr

SOUCHES AFRICAINES DU VIRUS DE LA ROUGEOLE : ETUDE ...

UNIVERSITE JOSEPH FOURIER-GRENOBLE 1

SCIENCES & GEOGRAPHIE

THESE

Pour obtenir le grade de

DOCTEUR DE L’UNIVERSITE JOSEPH FOURIER

DISCIPLINE : BIOLOGIE

(arrêté ministériel du 30 mars 1992)

présentée et soutenue publiquement

par

Diane NINKAM NGHEMNING

le 09 Juillet 2002

SOUCHES AFRICAINES DU VIRUS DE LA ROUGEOLE :

ETUDE DE L’INTERACTION VIRUS-CELLULE

ET ANALYSES PHYLOGENETIQUES

JURY

Pr P. Lebon, rapporteur

Pr P. Pothier, rapporteur

Pr J.M. Seigneurin

Dr. R. Ruigrok

Dr. T.F. Wild


REMERCIEMENTS

Je remercie le Dr. Fabian WILD pour m’avoir accueillie dans son laboratoire et dirigé cette

thèse. Il n’a pas hésité à me confier la mission d’aller isoler des souches de virus de la

rougeole au Cameroun. Ses conseils pratiques enrichissants, son expérience et sa disponibilité

m’ont aidée à mener à bien ce travail. Sans son aide matériel et financière, ce travail n’aurai

pas aboutit aussi vite.

Je remercie le Dr. Rob RUIGROK pour m’avoir initié à la virologie depuis le DEA à l’EMBL

et pour m’avoir suivi au long de ce travail. Qu’il trouve ici le témoignage de ma sincère

reconnaissance.

Je remercie la direction du Centre Pasteur de Yaoundé, notamment le Dr. Paul MARTIN V.

M. pour m’avoir aider à obtenir une aide financière, le Dr Jocelyn THONNON pour m’avoir

accueillie au Centre Pasteur de Yaoundé.

Je remercie Monsieur le Professeur LEBON de l’Hôpital Saint Vincent de Paul de Paris et

Monsieur le Professeur POTHIER de l’Université de Bourgogne qui m’ont fait l’honneur

d’accepter de juger ce travail, Monsieur le Professeur SEIGNEURIN de l’Université Joseph

Fourier de Grenoble pour avoir accepté de présider le jury de cette thèse.

Je remercie le Dr Eric NERRIENET pour ses conseils et toute l’équipe du laboratoire de

virologie du Centre Pasteur de Yaoundé pour son accueil chaleureux, le Pr TIECHE, le Dr

TENE, le Dr EWANE EKOYOL de l’Hôpital Centrale de Yaoundé pour le diagnostic

clinique et les prélèvements, le Dr TICHA JOHNSON MULUH de l’OMS de Yaoundé pour

avoir mis à ma disposition les données épidémiologiques de la rougeole au Cameroun.

Je remercie le Dr Robin BUCKLAND, pour avoir mis à ma disposition une paillase dans son

laboratoire. Ses conseils et son humour au cours de ce travail m’ont aidé à m’intégrer dans

l’équipe et à avancer dans mes travaux.


Je remercie le Dr Florence PRADEL et le Dr Glaucia BACCALA du laboratoire Biomérieux

pour m’avoir hébergé dans leur laboratoire pendant la réfection de notre laboratoire. Leur

accueil chaleureux et leurs conseils sont inoubliables.

Je remercie le Dr Laurent DURET pour m’avoir appris à utiliser les logiciels d’analyses

phylogénétiques.

Je remercie l’équipe d’immunobiologie des infections virales : le Dr Branka HORVAT pour

ses conseils scientifiques, le Dr Nathalie DAVOUST pour sa disponibilité et ses conseils,

Julien MARIE pour son humour et pour m’avoir appris tous les jours les nuances de la langue

française, Bariza BLANQUIER pour ses conseils en matière de séquençage, Anabelle

LEFEUVRE sur qui je peux compter à tout moment, Yann KERDILES et Olivier

TOUZELET qui sont le symbole de la jeunesse et du dynamisme de l’équipe. A vous tous,

merci pour l’ambiance chaleureuse qui règne dans l’équipe.

Je remercie tous les membres de l’INSERM U404 pour leur aide spontanée et leur

disponibilité au cours de ce travail.

Je remercie particulièrement Bernadette MARET pour sa disponibilité, pour m’avoir motivé

pour les cours de gymnastique et pour la relecture de cette thèse.

Merci à Jules, Lynda et Davy qui ont accepté mon humeur tout en m’encourageant tout au

long de ce travail.

Merci à Jean et Jeannine BOUTET, qui m’ont adopté et m’ont encouragé tout au long de ce

travail. Qu’ils trouvent ici l’expression de ma profonde gratitude.

Merci à ma famille pour son soutien moral tout au long de ce travail.


TABLE DES MATIERES

CHAPITRE I. LE VIRUS DE LE ROUGEOLE………………………………..1

I.1 Historique …………………………………………………………………2

I.2. Classification……………………………………………………………...3

I.3. Structure du virion et organisation du génome…………………………...5

I.4. Structure et fonction des protéines du virus de la rougeole………………7

I.4.1. La nucléoprotéine (N)……………………………………………………………..7

I.4.2. Les protéines P, C et V……………………………………………………………7

I.4.3. La protéine de matrice (M)………………………………………………..………8

I.4.4. La protéine de fusion (F)………………………………….……………………….8

I.4.5. L'hémagglutinine (H)…………………………………………………...…………9

I.4.6. La protéine large ( L)…………………………………………………………….10

I.5. Cycle viral……………………………………………………...………..10

I.5.1. Attachement et pénétration du virus dans les cellules……………..……………..10

I.5.2. Transcription et réplication de l'ARN viral……………………………………....12

I.5.3. Encapsidation et bourgeonnement……………………...………………………..13

I.6. Pathologie………………………….……………………………………18

I.6.1. Réponses immunitaires………………………………………………………..…20

I.6.1.a. Réponses immunes cellulaires………….……………………………………….20

I.6.1.b. Réponse humorale…………………………………………………..……………21

I.6.2. Immunosuppression……………………….……………………………………22

I.6.3. Complications de la rougeole…………………………………………………..23

CHAPITRE II. LA VACCINATION…………………………………………..25

II.1 Les vaccins inactivés……………………………………………………26

II.2 Les vaccins vivants atténués…………………….. .…………………….28

II.3 Les nouvelles approches de vaccination ………………..………………31

II.3 1. Le vaccin actuel : quelques difficultés rencontrées…………….………………31


II.3 2. Les nouveaux vaccins……………………………………………………...…..33

II.3 2.a. Les vaccins utilisant les vecteurs viraux……………………………………..34

II.3 2.b. Les ISCOMs…………………………………….……………….……………….35

II.3 2.c. La vaccination ADN………………………………………………………….…35

II.4. Position actuelle de l’OMS : stratégie de vaccination……………………………36

CHAPITRE III. ETUDES EPIDEMIOLOGIQUES DE LA ROUGEOLE……38

III.1 .Propagation de l’infection au sein d’une population non vaccinée……39

III.1.1. Niveau d’exposition bas………………………………………………………..39

III.1.2. Niveau d’exposition élevé………………………………………...……………39

III.2. Propagation de la rougeole au sein d’une population vaccinée…….….41

III.3. Efficacité de la vaccination contre la rougeole………………..………43

III.4. Réponse à la vaccination : Production d’anticorps……………………43

III.4.1. Facteurs d’hôte…………………………………...…………………………….43

III.4.1.a. Age de l’hôte………………………….…………………………………………..43

III.4.1.b. Etat nutritionnel de l’hôte……………………………………………………….46

III.4.1.c. Etat de santé de l’hôte……………………………………………………………46

III.4.2. Facteurs génétiques……………………………………………………………..47

III.4.3. Facteurs associés au vaccin……………………………………………. .……..47

III.4.3.a. La souche………………………….………………………………………………48

III.4.3.b. La dose…………………………………….……………………………………….49

III.4.3.c. Le mode d’administration……………………………………………………….49

III.4.4.. Facteurs liés au programme de vaccination……………………………..……..49

III.5. Protection conférée par la vaccination…………………..…………...…..50

III.5.1. Taux protecteur d’anticorps………………………………………………………..50

III.5.2. Durée de la protection……………………………………………………………..51


CHAPITRE IV. EPIDEMIOLOGIE MOLECULAIRE DU VIRUS DE LA

ROUGEOLE……………………………………………………………………54

IV.1. Variabilité antigénique du virus de la rougeole……….………………54

IV.2. Variations génétiques du virus de la rougeole……………………..….56

IV.3. Classification génétique du virus de la rougeole………………….…..57

IV.4. Distribution géographique des différents génotypes…………….……59

IV.5. L’épidémiologie moléculaire comme outil de contrôle de

la stratégie de vaccination…………………………………… .……………59

IV.6. Application des campagnes intensives de vaccination…….…………61

IV.6.1. La Gambie……………………………………………………………………..62

IV.6.2. Les Etats-Unis……………………………………………………………..…..62

IV.6.3. L’Amérique du Sud………………………………………………….………...63

CHAPITRE V. LA ROUGEOLE EN AFRIQUE…………………….…..……65

V.1. La rougeole au Cameroun………………………………………….…..66

V.1.2. Situation géographique du Cameroun…………………………………….…….66

V.1.3. Historique de la vaccination au Cameroun……………………………………..66

V.1.4. Epidémies saisonnières de rougeole au Cameroun………………………..……67

V.1.5. Incidence et létalité de la rougeole…………………………………….………..69

V.2. La rougeole dans le continent africain……………..…………………..73

CHAPITRE VI. ETUDE DES SOUCHES AFRICAINES DE VIRUS DE LA

ROUGEOLE……………………………………………………………………75

VI.1 Interaction Virus-Cellules………………………….…………………..76

VI.1.1. Approche d’un virologiste à l’épidémiologie moléculaire……………………..76

VI.1.2. Résumé de l’article 1……………………………………………..…………….78

VI.1.3 Travaux additionnels à l’article…………………………………………….…...80

VI.1.4 Article 1…………………………………………………………………………82

VI.2. Etudes épidémiologiques……………………………………………...88

VI.2.1. Historique de la surveillance du virus de la rougeole en Afrique…………...…88

VI.2.2. Résumé de l'article 2……………………………………………………………91

VI.2.3. Article 2…………………………………...……………………………………95


VI.3. La rougeole au Cameroun : Etude de 38 cas cliniques. Diagnostic

sérologique, isolements viraux et caractérisation génétique………………….110

VI.3.1 Introduction…………………………………………………………………..111

VI.3.2. Objectif………………………………………………………………………111

VI.3.3. Stratégie expérimentale……………………………………………… ……..112

VI.3.4. Matériels et méthodes………………………….……………………… ……114

VI.3.4.a. Patients……………………………………..…………………………………..114

VI.3.4.b. Echantillons…………………………………………………………………….114

VI.3.4.c. Sérologie………………………………………………….…………………….114

VI.3.4.d. Isolement du virus…………………………………………………………….115

VI.3.4.e. Extraction d’ARN……………………………………………………………..115

VI.3.4.f. RT-PCR………………………………………………………………………….115

VI.3.5. Résultats…………………………………….…….………….….116

VI.3.5.a. Diagnostic clinique…………………………………….….……………….…116

VI.3.5.b. Diagnostic sérologique………………………….………..…………………116

VI.3.5.c. Diagnostic virologique…………………………………..…………………..116

VI.3.5.d. RT-PCR…………………………………………………………………………117

VI.3.6. Discussion……………….………………………………………119

VI.3.7. Conclusion…………………….……………………………………..……120

CHAPITRE VII. DISCUSSION…………………………….………………..122

VII.1.Interaction virus-cellules…………………………… ….…………..123

VII.2. Epidémiologie…………………………………………………….....127

CHAPITRE VIII. CONCLUSION ET PERSPECTIVES…………………….132

ANNEXES…………………………………….……………………………………….……134

BIBLIOGRAPHIE……………………………………………………………………..……145

TABLE DES ILLUSTRATIONS………………………………… ……….………….….172

TABLE DES ANNEXES……………………………… …………………………………173

ABSTRACT…………………………………………………..……………………………..174


ABREVIATIONS

ADN : Acide déoxoribonucléique

ARN : Acide ribonucléique

ARNm : Acide ribonucléique méssager

ARNv : Acide ribonucléique viral

CD : cellule dendritique

CDC : «Center for disease control»

CMH : Complex majeur d’histocompatibilité

CTL : cytotoxic T-Lymphocyte

ELISA : enzyme linked immunosorbent assay

HLA human leucocyte antigen

IFN : interféron

Ig : Immunoglobuline

ISCOM : immune stimulating complex

OMS : Organisation mondiale de la santé

PBL : peripheral blod lymphocytes

PCR : polymerase chain reaction

PEV programme élargi de vaccination

PHA phytohémaglutinine

ROR : rougeole oreillon rubeole

SCR : Short concensus repeat

SLAM signaling lymphocytes activation molecule

VIH : virus de l’immunodéficience humaine


CHAPITRE I : LE VIRUS DE LA ROUGEOLE


I.Le virus de la rougeole

2. Classification

I.1. HISTORIQUE

La rougeole a été décrite pour la première fois par un médecin arabe appelé Rhazes de

Bagdad au IXe siècle. Il définit alors la maladie comme une forme atténuée de la variole. Des

épidémies répétées caractérisées par une éruption cutanée sont rapportées en Europe entre 1 et

1200 ans avant Jésus-Christ. et la rougeole serait arrivée en France par les Pyrénées avec

l’invasion des Sarrasins au VIIIe siècle. En 1224, la rougeole est mentionnée comme une

maladie infantile. L’introduction de la rougeole au sein de population non exposée au

préalable entraîna des taux élevés de mortalité et de morbidité.

Les principes de base de l’épidémiologie de la rougeole ont été décrits pour la

première fois en 1846 par un jeune médecin Danois nommé Peter Pannum. Ce médecin

présent dans les îles Faroé au cours d’une épidémie décrit alors les signes cliniques, la période

d’incubation, la nature infectieuse de la rougeole, l’immunité à vie chez les résidents les plus

âgés et la transmission par voie respiratoire (Panum, 1938).

En outre, les complications de la rougeole ont été décrites initialement au XVIIIe

siècle. En 1790, le chirurgien anglais James Lucas mentione le premier cas

d’encéphalomyélite post-infectieuse (EPI) (Lucas, 1790) et en 1933, le premier cas de

panencéphalite sclérosante subaiguë (PESS) est décrit par Dawson chez un garçon de 16 ans

(Dawson, 1933). Les travaux de Bouteille et al., 1965, montrent des corps d'inclusions dans

les cellules de patients souffrant de cette maladie.

Le virus de la rougeole fut isolé pour la première fois sur des cellules en culture en

1954 par Enders et Peebles, en inoculant des cellules primaires de rein humain avec un

échantillon sanguin prélevé sur un malade nommé David Edmonston, atteint de rougeole

(Enders & Peebles, 1954). Par contre, le virus associé aux cas de PESS n'a été isolé que vers

la fin des années 60 (Horta-Barbosa et al., 1969 ; Payne et al., 1969). Le virus de la rougeole

est par la suite adapté en culture in vitro à une variété de lignées cellulaires. Ces études ont

conduit à la mise au point de tests de diagnostic pour la rougeole et au développement d’un

vaccin vivant atténué par passage en culture. La lignée cellulaire Véro (cellules de rein de

singe) est la plus communément utilisée. Récemment, il a été rapporté que le virus de la

rougeole peut également être isolé en utilisant des lymphocytes B de ouistiti, transformés avec

le virus d’Epstein Barr (cellules B95a) (Kobune et al., 1990).

2


I.Le virus de la rougeole

2. Classification

I.2. CLASSIFICATION

Le virus de la rougeole est un membre de la famille des paramyxoviridae qui est

divisée en deux sous-familles : les paramyxovirinae et les pneumovirinae (Tableau 1). Les

pneumovirinae, subdivisés en pneumovirus et metapneumovirus, se distinguent des

paramyxovirinae par leurs nucléocapsides plus étroites et par leurs structures génomiques. La

sous-famille des paramyxovirinae quant à elle contient trois genres : les respirovirus, les

rubulavirus, et les morbillivirus. Ces derniers diffèrent des deux autres par l’absence de

l’activité neuraminidase. Les membres du genre des morbillivirus tels que par exemple, le

virus de la maladie de Carré et le virus de la rougeole ont souvent des réactions antigéniques

croisées.

L’hôte naturel de la rougeole est l’homme, on suppose cependant que le virus de la

rougeole aurait évolué à partir d’un morbillivirus animal. Le virus de la rougeole est plus

proche du virus de la peste bovine. Il aurait été engendré dans un environnement où les

humains et les bovins cohabitaient. De la même façon, le virus de la maladie de Carré aurait

émergé suite à la consommation de carcasses de bovins par des canins. Le virus de la maladie

de Carré bien qu’ayant des parents communs avec le virus de la rougeole, possède une

épidémiologie différente, en ce sens que la taille de la population n’est pas importante pour sa

propagation, probablement parce qu’il peut traverser la barrière d’espèce pour maintenir

l’infection. Par contre, le virus de la rougeole nécessite une communauté d’individus

suffisamment grande pour se maintenir et se propager au sein d’une population. Des études

dans des communautés isolées suggèrent qu’au minimum 300 à 400 000 personnes sont

nécessaires pour maintenir la transmission du virus de la rougeole (McNeil, 1976). Comptetenu

de ce fait, on pense que la rougeole aurait évolué il y a 4000 ans dans les civilisations du

Moyen-Orient, de l’Inde et de la Chine où la densité de la population était alors suffisament

forte pour maintenir la transmission du virus.

Récemment, de nouveaux virus appartenant à la famille des paramyxovirus ont été

découverts : les metapneumovirus humains (van den Hoogen et al., 2001), proches du virus

respiratoire syncytial, les virus Nipah et Hendra (Murray et al., 1995 ; Wang et al., 1998). Ces

derniers forment un nouveau genre et se distinguent des autres membres de la famille des

paramyxoviridae par leur capacité à infecter aussi bien les hommes que les animaux.

3


I.Le virus de la rougeole

2. Classification

Table 1 : Classification des paramyxovirus

Sous-famille

Pneumovirinae

Genre

Pneumovirus

Quelques exemples

Virus humains

Virus animaux

Virus respiratoire syncytial bovin

Virus respiratoire syncytial

Virus respiratoire syncytial caprin

humain

Virus respiratoire syncytial ovin

Metapneumovirus

Respirovirus

Metapneumovirus humains

Parainfluenzavirus humains

1, 3

Virus de la rhinotrachéite de la dinde

Virus de la pneumonie de la souris

Virus de Sendai

Parainfluenza virus bovin 3

Paramyxovirinae

Rubulavirus

Henipa?

Virus des oreillons

Parainfluenzavirus humains

2, 4a,4b

Virus Simien 5

Virus de la maladie de Newcastle

Virus Hendra

Virus Nipah

Morbillivirus

Virus de la rougeole

Morbillivirus des cétacées

Virus de la peste des petits ruminants

Virus de la maladie de Carré

Virus de la peste bovine

4


I.Le virus de la rougeole

3. Structure du virion et organisation du génome

I.3. STRUCTURE DU VIRION ET ORGANISATION DU GENOME

Le virus de la rougeole a une forme généralement sphérique, parfois pléiomorphique,

dont le diamètre est compris entre 150 et 350nm. On peut également, bien que beaucoup plus

rarement, observer des formes filamenteuses. L'enveloppe virale est constituée d'une bicouche

lipidique provenant de la membrane de la cellule hôte lors du bourgeonnement. Dans la

bicouche lipidique sont ancrées deux glycoprotéines : l'hémagglutinine (H) et la protéine de

fusion (F). La protéine matrice (M) tapisse la surface interne de la membrane virale

Le génome du virus de la rougeole est constitué d'un brin d'ARN de polarité négative.

L'ARN viral est encapsidé par la nucléoprotéine (N) sous forme d'une particule de

ribonucléoprotéine hélicoïdale ou nucléocapside. A la nucléocapside sont associées la

phosphoprotéine (P) et la protéine large (L) qui sont deux sous-unités de la polymérase virale

(Figure 1).

Le génome viral a été entièrement séquencé et l'organisation des gènes a pu être

déterminée (Galinski & Wechsler, 1991). Ce génome, d’une longueur d’environ 15 894

nucléotides, contient six gènes (Lamb & Kolakofsky, 1996), ce qui n’est pas le cas pour les

autres paramyxovirus tels que les rubulavirus (7 gènes) et les pneumovirus (10 gènes). A

l’extrémité 3’ du génome se trouve une séquence « leader » de 55 nucléotides qui possède un

degré élevé de complémentarité avec 40 nucléotides présents à l’extrémité 5’ du génome, ce

qui suggère une formation possible d’une structure « en lasso». L’organisation des gènes dans

le génome est 3'NP(CV) MFHL5' avec un trinucléotide intergénique GAA entre les différents

gènes (Figure 2). Notons que la longueur de la séquence intergénique est identique pour les

virus parainfluenza et les morbillivirus, mais qu’elle est variable chez les rubulavirus (1 à 47

nucléotides ) et les pneumovirus (1 à 56 nucléotides) (Lamb & Kolakofsky, 1996).

Le génome du virus de la rougeole code pour six protéines structurales à partir de six

gènes. De plus, comme les autres paramyxovirinae, le virus de la rougeole possède une

capacité de transcription étendue grâce à l’ajout de nucléotides dans les transcrits et

l’utilisation des cadres de lecture chevauchant dans le gène P. Ainsi, deux protéines non

structurales (C et V) sont codées à l'intérieur du gène P du virus de la rougeole. De la même

façon, le gène P des rubulavirus code pour une protéine supplémentaire (V). Le virus

parainfluenza bovin de type 3 (respirovirus) peut engendrer jusqu'à 3 protéines

supplémentaires (C,V,D) à partir de son gène P. Contrairement aux paramyxovirinae, les

pneumovirinae ont un gène P qui code pour une seule protéine P.

5


Hémagglutinine (H)

Protéine de fusion (F)

Bicouche lipidique

Protéine de mactrice (M)

Figure 1: Représentation schématique du virus de la rougeole.

ARN

Complexe Transcriptase

- Protéine large (L)

- Nucléoprotéine (N)

- Phosphoprotéine (P)

GAA

S

E I S

E

Génome

N P/C/V M F H L

3’ L


T’ 5’

ARNm

Figure 2 : Organisation et transcription du génome du virus de la rougeole.

La position et l’organisation des séquences intergéniques (S : initiation, I: séqence intergénique, E : Terminaison),

L’ : région leader, T’ : région trailer sont indiquées. La quantité de transcrits diminue en fonction de la distance du

siite d’initiation du premier gène. Un “gradient” est ainsi observé.


I.Le virus de la rougeole

4. Structure et fonction des protéines du VR

I.4. STRUCTURE ET FONCTION DES PROTEINES DU VIRUS DE LA

ROUGEOLE

I.4.1. La nucléoprotéine (N)

L’ARNm de la protéine N est transcrit en premier. Cette protéine est la plus abondante

de toutes les protéines virales, avec un poids moléculaire de 60kDa. Elle est synthétisée dans

le cytoplasme et s’associe à l’ARN génomique (Udem & Cook, 1984) constituant ainsi des

particules ribonucléoprotéiques (RNP). Ces dernières servent de modèle pour la réplication et

la transcription. Cette association avec l’ARN génomique est très stable et l’ARN ainsi

encapsidé est résistant à la digestion par la nucléase. La protéine N dans les RNP s’associe par

ailleurs aux protéines P et L.

I.4.2. Les protéines P, C et V

La protéine P est une protéine phosphorylée ; elle se lie à la protéine N et fait partie du

complexe transcriptase/réplicase (Huber et al., 1991). La protéine P de masse moléculaire

72kDa est abondante dans les cellules infectées. Cependant, elle est très sensible à la

protéolyse et seule une petite quantité est présente dans le virion (Griffin & Bellini, 1996).

Son domaine de liaison à la protéine N est situé entre les acides aminés 204 et 321.

Le gène P du virus de la rougeole, comme chez la plupart des paramyxoviridae code

au moins pour trois protéines. Deux d’entre elles, P et C sont codées par le même ARNm,

mais sont traduites à partir de codons d'initiation différents et des cadres de lecture ouverts

chevauchants. Le codon d’initiation utilisé pour la synthèse de la protéine C est situé 19

nucléotides plus loin que celui utilisé pour la protéine P (Bellini et al., 1985). En revanche, la

protéine V partage avec la protéine P le même codon d'initiation ainsi que 231 résidus de la

partie N-terminale. L' « editing » de l'ARN pendant la transcription ajoute un nucléotide

supplémentaire de guanosine en position 751, ce qui engendre un décalage dans le cadre de

lecture. De ce fait, les 276 acides aminés de l'extrémité C-terminale de la protéine P sont

remplacés dans la protéine V par 68 acides aminés, riches en cystéines et possédant des

propriétés d'attachement au zinc (Liston & Briedis, 1994). La protéine V est phosphorylée et

est distribuée de façon diffuse dans le cytoplasme des cellules infectées. Aucune fonction

7


I.Le virus de la rougeole

4. Structure et fonction des protéines du VR

précise n'a été assignée aux protéines C et V, mais on pense qu'elles jouent un rôle dans la

transcription et/ou la réplication.

I.4.3. La protéine de matrice (M)

La protéine M tapisse la surface interne de la membrane virale. C'est une protéine

basique contenant plusieurs régions hydrophobiques conservées. Son ARNm contient une

séquence non codante d’environ 400 nucléotides de fonction inconnue à son extrémité 3’. La

protéine M joue un rôle central dans la morphogénèse virale. D'une part, elle a un rôle

structural, car elle interagit avec les régions intracytoplasmiques des glycoprotéines

membranaires et avec le feuillet interne de la bicouche lipidique, conférant ainsi sa rigidité à

l'enveloppe virale (Tyrell & Ehrnst, 1979). D'autre part, elle aurait un rôle fonctionnel au sein

de la cellule infectée où elle est associée aux nucléocapsides (Hirano et al., 1992). Ces

différentes associations sont très importantes pour la formation de nouvelles particules virales

par bourgeonnement. Lorsque la protéine M se lie au complexe ribonucléoprotéique, elle

inhibe la transcription (Suryanarayana et al., 1994). Il a été montré que dans le cas des

infections persistantes telle que la panencéphalite sclérosante subaiguë, où le processus de

bourgeonnement est défectueux, la protéine M est soit inactivée, auquel cas elle perd sa

capacité à se lier aux nucléocapsides et à inhiber la transcription (Hirano et al., 1993), soit elle

n’est pas synthétisée.

I.4.4. La protéine de fusion (F)

La protéine de fusion (F) est une glycoprotéine transmembranaire de type I. Elle est

responsable de la fusion membranaire au cours de l'infection. Son ARNm contient une région

riche en G-C (580 nucléotides) non traduite en son extrémité 5' possédant des structures

secondaires (Evans et al., 1990 ; Richardson et al., 1986). La protéine de fusion est

synthétisée sous forme de polyprotéine inactive d'environ 60kDa (F0). Elle est clivée dans

l’appareil de Golgi par une protéase cellulaire de l’hôte, engendrant ainsi deux fragments F1

(41kDa) et F2 (18 kDa) actifs reliés par un pont disulfure. Le site de clivage est constitué de

cinq acides aminés basiques (résidus 108 à 112). L’arginine 112 est un déterminant critique

pour le clivage car sa mutation entraîne une aberration dans le processus de clivage de F0 et

abolit son activité fusogénique (Alkhatib et al., 1994a).

Le fragment F1 contient le domaine transmembranaire proche de son extrémité C-

terminale et une région hydrophobe qui constitue le peptide-fusion, situé à son extrémité C-

terminale. Entre ces deux régions se trouvent deux domaines en hélice ; l’un proche du

8


I.Le virus de la rougeole

4. Structure et fonction des protéines du VR

peptide-fusion, et l’autre, plus proche de la région transmembranaire, contient un motif

« leucine zipper ». Ce dernier est très important car la mutation des leucines dans ce motif

affecte la fusion (Buckland et al., 1992). De plus, le fragment F1 comporte une région riche

en cystéines (résidus 337 à 381) qui est impliquée dans l’interaction avec la protéine H (Wild

et al., 1994).

Le fragment F2 comporte une séquence-signal d'environ 28 résidus en son extrémité

N-terminale. De plus, il possède tous les sites de N-glycosylation (résidus asparagine 29, 61 et

67), la glycosylation étant importante pour le transport vers la surface cellulaire. La mutation

de ces asparagines altère la conformation de F et la capacité fusogénique de la protéine

(Alkhatib et al., 1994b). Présente au niveau de la membrane sous forme de trimère, la protéine

de fusion agit conjointement avec l'hémagglutinine au moment de la fusion membranaire

(Wild et al., 1991).

I.4.5. L'hémagglutinine (H)

L'hémagglutinine est une glycoprotéine transmembranaire de type II. C'est la protéine

d'attachement du virus au récepteur cellulaire. Contrairement aux virus parainfluenza et aux

rubulavirus, la protéine d’attachement des morbillivirus ne possède pas d’activité

neuraminidase ou estérase. La protéine H comporte dans son ectodomaine 13 résidus de

cystéine très conservés entre les paramyxovirus. Parmi ceux–ci, les résidus

287,300,381,394,494, 579, et 583 auraient un rôle important dans l’oligomérisation, le

repliement de la protéine et participeraient probablement à la formation des ponts disulfures

inter et intramoléculaire (Hu & Norrby, 1995). La protéine H est présente à la surface du

virion sous forme de tétramère constitué de deux dimères. Les dimères sont formés de deux

protéines reliées entre elles par des ponts disulfures et sont associés en tétramères grâce à des

liaisons non covalentes. La protéine H aurait cinq sites potentiels de N-glycosylation

(Alkhatib & Briedis, 1986). La glycosylation au niveau du résidu 215 serait hétérogène, ce

qui pourrait expliquer l’observation régulière de deux types de protéines H sur gel de

polyacrylamide (Ogura et al., 1991). La glycosylation est nécessaire pour le repliement,

l’antigénicité, la dimérisation et l’exportation de la protéine de l’appareil de Golgi vers la

menbrane cellulaire.

9


I.Le virus de la rougeole

5. Cycle viral

I.4.6. La protéine large ( L)

La protéine L est la protéine la moins abondante de toutes les protéines structurales

(environ 50 copies par virion). Sa grande taille (2183 acides aminés) et sa localisation dans le

complexe actif de transcription viral suggèrent qu’elle jouerait le rôle de polymérase virale

(Hamaguchi et al., 1983). Elle serait également responsable des activités guanilyl et méthyl

transférase requises lors de la mise en place de la coiffe en position 5’ des ARNm.

I.5. CYCLE VIRAL

I.5.1. Attachement et pénétration du virus dans les cellules

La glycoprotéine hémagglutinine H joue un rôle primordial dans l’attachement du

virus à la cellule hôte. Elle interagit avec les récepteurs membranaires présents à la surface de

la cellule. La spécificité de cette interaction définit le spectre d’hôte et le tropisme du virus.

Le virus de la rougeole à l’état naturel n’infecte que l’homme. Les singes peuvent être

infectés expérimentalement.

La molécule CD46 a été identifiée en premier lieu comme le récepteur des souches

vaccinales du virus de la rougeole (Dorig et al., 1993 ; Naniche et al., 1993a). Cette protéine

connue pour sa fonction régulatrice du complément est exprimée de façon ubiquitaire dans les

tissus humains. Les singes possèdent un homologue de CD46 (Liszewski & Atkinson, 1992,

Naniche et al., 1992), par contre, aucune protéine homologue n’a été identifiée chez la souris.

Cette protéine comporte une queue cytoplasmique située en son extrémité C-terminale suivie

d’une région transmenbranaire. Le domaine STP riche en sérine, thréonine, et proline, est

proche de la membrane et constitue le site de O-glycosylation (Maisner et al., 1994). La partie

N-terminale, extracellulaire est constituée de 4 séquences répétées (SCR). La protéine H

interagit avec les deux SCR les plus extérieurs du récepteur CD46 (Figure 3). Plusieurs

isoformes de CD46 sont obtenus par épissage alternatif des ARNm qui codent pour cette

protéine. Il existe 14 isoformes de la molécule CD46 qui diffèrent par la longueur et la

composition de leur domaine STP et de leur queue cytoplasmique (Johnstone et al., 1993).

L’épissage au niveau du domaine STP génère les formes BC ou C, alors qu’au niveau de la

queue cytoplasmique, il génère soit un fragment de 16 acides aminés (cyt1), soit un fragment

de 23 acides aminés (cyt2). Quatre isoformes (BC1, BC2, C1 et C2) sont présents dans les

cellules humaines et servent tous de récepteur pour le virus de la rougeole (Gerlier et al.,

10


I.Le virus de la rougeole

5. Cycle viral

1994, Manchester et al., 1994). La distribution des différents isoformes varie en fonction des

tissus. Il a été montré que le rein et les glandes salivaires expriment préférentiellement

l’isoforme BC2. Dans le cerveau on trouve préférentiellement l’isoforme C2, par contre dans

les organes comme le foie, la rate, la prostate, le rein, le cœur, le poumon, la thyroïde, on

trouve un mélange de différents isoformes (Johnstone et al., 1993).

Le second récepteur du virus de la rougeole est la molécule humaine SLAM

(signalling lymphocyte activation molecule) aussi connue sous le nom de CD150 (Tatsuo et

al., 2000). C’est une glycoprotéine de type 1 appartenant à la superfamille des

immunoglobulines et à la fammille de la protéine immunorégulatrice CD2. Elle est exprimée

par les cellules T, les cellules B et les cellules dendritiques activées. La molécule SLAM,

contrairement à CD46, sert de récepteur aussi bien aux souches sauvages qu’aux souches

vaccinales du virus de la rougeole. Elle est constituée d’un domaine variable (V) situé à

l’extrémité de la partie N-terminale et d’un domaine constant (C) proche de la membrane,

suivi des régions transmembranaires et cytoplasmiques (Figure 3). Il a été montré que le

domaine V est nécessaire et suffisant pour l’interaction avec la protéine H du virus de la

rougeole (Ono et al., 2001b). Il faut ici noter que les récepteurs viraux appartenant à la superfamille

des immunoglobulines ont le plus souvent leur site de liaison au virus dans leur

extrémité N-terminale (partie la plus distale de la membrane). C’est le cas de la molécule CD4

pour le virus de l’immunodéficience acquise (Moebius et al., 1992) et ICAM-1 pour la plupart

des rhinovirus humains (Staunton et al., 1990). De plus, la souche Edmonston du virus de la

rougeole se lie aux SCR1 et SCR2 de CD46. Dans ces molécules, la partie la plus distante de

la membrane s’avère plus accessible et peu donc servir de site de liaison du virus. Cependant,

le site de liaison de la protéine H à la molécule CD46 serait différent du site de liaison à la

molécule SLAM. En effet, les études de Erlenhofer et al., (2002) montrent que la mutation de

l’acide aminé 481de la protéine H (N481Y) détermine si CD46 peut être utilisé ou pas. Par

contre, l’altération de cet acide aminé n’a aucun effet sur l’utilisation de SLAM comme

récepteur cellulaire. Ceci suggère que les sites de liaison à CD46 et à SLAM sont distincts.

L’interaction de la protéine H avec le récepteur cellulaire entraîne un changement de

conformation dans cette protéine qui, à son tour, active la protéine F. L’activation de la

protéine F entraîne une rupture de la liaison entre les deux hélices permettant au peptide

fusion de s’orienter vers la membrane cellulaire et d’interagir avec celle-ci. Les deux hélices

se réasssocient et le rapprochement des membranes virales et cellulaires a lieu au cours de

ce processus, favorisant ainsi la fusion (Figure 4). Il a été montré que le processus de fusion

11


I.Le virus de la rougeole

5. Cycle viral

peut être bloqué avec des peptides correspondant aux régions hélices et leucine zipper

(Wild & Buckland, 1997, Young et al., 1997). Un peptide ayant des effets similaires a été

découvert pour le VIH. Il s’agit d’un peptide de 36 acides aminés appelé T-20 qui se lie au

niveau des hélices de la protéine gp41, (l’équivalent de la protéine de fusion) et empêche la

fusion membranaire (Kilby et al., 1998). Les auteurs ont constaté une diminution de la charge

virale chez des personnes infectées après injection de la molécule T-20 par voie sous-cutanée.

Ce type de peptides présente de ce fait un intérêt important pour la lutte contre la rougeole. Le

processus de fusion permet l’injection du génome viral dans le cytoplasme où ont lieu la

transcription et la réplication.

I.5.2. Transcription et réplication de l'ARN viral

Contrairement à ce qui se passe dans les virus à ARN (+), où l'ARN génomique

(ARNv) est utilisé comme ARN messager (ARNm), les virus à ARN (-) effectuent la synthèse

de l'ARNm grâce à leurs propres polymérases (Figure 5). La synthèse de l’ARNm commence

aussitôt que le génome viral rencontre les ribonucléosides triphosphates dans le cytoplasme.

La polymérase /transcriptase virale LP 4 transcrit uniquement l'ARN encapsidé. L'initiation de

la transcription a lieu à l'extrémité 3' de l'ARNv. Pendant la transcription, l’ARNm de la

région-leader est synthétisé et la polymérase recommence au début du premier gène. Cette

réinitiation est un événement critique car elle fait la différence entre la polymérase qui

transcrit le génome en ARNm et celle qui réplique le génome. La réinitiation conduit à la

formation de transcrits (ARNm) monocystroniques possédant une coiffe en leur extrémité 5’

et polyadénylés en 3’. La fréquence avec laquelle la polymérase réinitie la synthèse de

l’ARNm à chaque jonction est élevée mais imparfaite. Il en découle un gradient de la quantité

d’ARNm et de protéines codées produites lié à la position du gène par rapport au point de

départ de la transcription. De ce fait, L'ARN de la nucléoprotéine représente plus de 50% des

transcrits et celui de la protéine L est le moins abondant. La variation de la fréquence

d’initiation des différents gènes est une astuce utilisée par les virus pour réguler l’expression

des gènes au niveau de la transcription. Le virus de la rougeole utiliserait cette technique dans

les infections du cerveau humain et des cellules neurales (Cattaneo et al., 1987a). En effet,

dans ce type d’infection, le gradient est plus fort que dans les infections de lignées cellulaires

où le virus est lytique.

La phase de réplication commence juste après la traduction des premiers transcrits et

l’accumulation de protéines virales. C’est la même polymérase, jusqu'ici engagée dans la

transcription qui copie le génome viral, mais ignore cette fois-ci les jonctions entre les gènes.

12


I.Le virus de la rougeole

5. Cycle viral

L’encapsidation de l’ARN néo-synthétisé par la nucléoprotéine oblige probablement la

polymérase à traverser les jonctions sans marquer l’arrêt. De plus, ce couplage

transcription/encapsidation conduit à un système d’autorégulation des niveaux de

transcription et de réplication.

La réplication consiste donc en la synthèse d'ARN de taille génomique et de polarité

positive (ARN complémentaire ou ARNc) qui sert à son tour de matrice à la synthèse d'ARN

génomique de polarité négative. L'ARN génomique nouvellement synthétisé et encapsidé sert

soit dans un nouveau cycle de transcription, soit est transporté vers la membrane plasmique

pour la formation de nouvelles particules virales. L'ARNv et L'ARNc sont encapsidés par les

nucléoprotéines, ce qui n'est pas le cas pour l'ARNm.

I.5.3. Encapsidation et bourgeonnement

La synthèse des protéines virales a lieu dans le cytoplasme. L’assemblage des

constituants du virion se fait en plusieurs parties. Durant la réplication, la nucléoprotéine libre

s’associe d’abord à l’ARN génomique pour former les particules ribonucléoprotéiques. A ces

particules s’associe le complexe protéique P-L. Les protéines H et F sont transportées à

travers le réticulum endoplasmique et l'appareil de Golgi où elles sont oligomérisées et

glycosylées, puis gagnent ensuite la membrane plasmique.

La protéine M s'attacherait aux nucléocapsides ainsi qu'aux extrémités cytoplasmiques

des glycoprotéines. Cette association faciliterait alors la formation de nouvelles particules

virales qui sont par la suite libérées par bourgeonnement. La présence de la protéine H à la

surface cellulaire entraîne ;

i) la régulation négative des récepteurs CD46 (Naniche et al., 1993b) et SLAM (Tanaka

et al., 2002). La molécule CD46 a pour rôle de protéger la cellule contre la protéolyse

par le complément C3b et C4b. De ce fait, si CD46 disparaît de la surface de la

cellule, celle-ci est susceptible d’être lysée par le complément (Liszewski &

Atkinson, 1992). La molécule SLAM ayant un rôle de co-stimulateur de l’actvation

des lymphocytes T (Cocks et al., 1995), sa régulation négative affecte cette fonction

d’activation, ce qui favorise l’immunosuppression induite par le virus de la rougeole

(Griffin, 2001).

ii) L’attachement de la protéine H aux récepteurs cellulaires entraîne l’activation de la

protéine F qui induit la fusion cellule-cellule, aboutissant à la formation de cellules

multinucléées appelées syncytia, caractéristiques de la rougeole.

13


NH2

SCR 1

SCR 2

SCR 3

CD46

SCR 4

Domaine STP

Cyt 1

Région transmenbranaire

Queue cytoplasmique

Cyt 2

NH2

Domaine V

SLAM

Domaine C

Région transmembranaire

COOH

Domaine intracytoplasmique

Figure 3 : Représentation schématique des récepteurs cellulaires du virus de la rougeole.

Les différentes queues cytoplasmiques de la molécule CD46 sont représentées


Récepteur

cellulaire

Etat natif

H F1+F 2

Liaison de la protéine H au

récepteur cellulaire

Premier intermédiaire

Activation de la fusion

Deuxième intermédiaire

Fusion

Etat post-fusion

Figure 4 : Processus de fusion adapté d’après Russel et al., 2001


Réplication

Leader N P L Trailler

ARN viral (-)

3’ 5’ 5’

3’

ARN complémentaire (+)

Transcription

Leader N

ARNm

P L

5’

Leader N P L Trailler

3’ 5’

ARN viral (-)

Protéines virales

Nouvelles particules virales

Figure 5 : Transcription et réplication du génome du virus de la rougeole


I.Le virus de la rougeole

6. Pathologie

I.6. PATHOLOGIE

Le virus de la rougeole se transmet par des gouttelettes de sécrétions respiratoires.

L'infection initiale se produit dans les cellules du tractus respiratoire ou des bronches et dans

les cellules épithéliales de la muqueuse respiratoire. Le virus est ensuite transporté,

probablement par les monocytes ou les cellules dendritiques, jusqu’aux ganglions

lymphatiques locaux. La réplication du virus dans les ganglions aboutit à une virémie et à

l'infection d'une grande variété d'organes. La première cellule infectée dans le sang est le

monocyte, mais d'autres leucocytes peuvent être infectés par la suite et contribuer à la

diffusion de l'infection. Les stades tardifs de la virémie sont accompagnés d’une leucopénie

(Sergiev et al., 1960). Les sites importants de réplication virale sont le thymus, la rate, les

ganglions lymphatiques, l'appendice et les amygdales.

L’étape initiale de la maladie est cliniquement silencieuse. C’est la phase d’incubation

qui dure de 8 à 12 jours et qui correspond à la dissémination du virus vers les organes

lymphoïdes. La phase prodromique se caractérise ensuite par une période de fièvre, malaise,

conjonctivite, rhume et trachéo-bronchite. Le virus diffuse vers de nombreux autres organes

(peau, conjonctives, reins, tubes digestifs, foie, muqueuses respiratoires et génitales). Dans

ces différents sites, le virus se réplique d'abord dans les cellules épithéliales endothéliales

et/ou dans les monocytes et macrophages.

Après infection des cellules endothéliales de la peau, le virus se répand dans

l'épiderme. L'infection des cellules épithéliales dans la couche granuleuse conduit à un

œdème. Des cellules épithéliales géantes se forment et un infiltrat périvasculaire mononucléé

s'accumule, donnant naissance à l'éruption caractéristique de la rougeole.

Un ou deux jours avant l'éruption, des tâches de Koplik apparaissent sur la muqueuse

buccale et persistent un ou deux jours après l'éruption. Cette dernière, de type érythémateux

maculo-papulaire, apparaît généralement 14 jours après l'infection initiale. Elle apparaît

d'abord derrière les oreilles, sur le front, à la racine des cheveux. L'éruption descend ensuite

vers le visage, le cou, les extrémités des membres supérieurs et le tronc, et continue jusqu'aux

pieds. L'éruption s'efface dans l'ordre d'apparition à partir du troisième jour, laissant des zones

brunes décolorées certainement dues à une capillarité purpurique. Bien que la pathologie de la

rougeole soit connue depuis longtemps, il existe encore des incompréhensions quant à la

18


I.Le virus de la rougeole

6. Pathologie

distribution cellulaire du virus dans l’organisme du malade et la distribution des récepteurs

cellulaires de la rougeole.

Différentes études des récepteurs utilisés par les souches vaccinales et sauvages du

virus de la rougeole correspondent à la pathologie et au tropisme soulignés ci-dessus pour la

plupart des observations effectuées. Le récepteur CD46 est exprimé de façon ubiquitaire,

tandis que SLAM (CDw150) (Tatsuo et al., 2000) a été observé seulement sur les cellules B et

T activées et sur les cellules dendritiques (Cocks et al., 1995 ; Tangye et al., 2000). Si SLAM

est le seul récepteur identifié pour les souches sauvages, sa distribution tissulaire n’explique

pas le tropisme observé chez les enfants infectés. Parmi les anomalies, on peut noter le fait

que les sites précoces de l’infection sont les cellules épithéliales respiratoires. Plus tard, on

retrouve le virus dans d’autres cellules épithéliales, ainsi que dans les cellules endothéliales.

La présence de la molécule SLAM n’a jamais été rapportée dans de telles cellules. Parmi les

explications possibles, il y a le fait que SLAM serait induit au cours de l’infection.

Récemment, il a été montré que bien que les monocytes n’expriment pas SLAM, ils peuvent

être infectés, l’infection pouvant être bloquée par un anticorps anti-SLAM (Minagawa et al.,

2001). De plus, pendant l’infection des monocytes, il y a une régulation positive de

l’expression de SLAM. D’autres possibilités pourraient inclure le fait que les cellules

infectées peuvent adhérer aux cellules épithéliales et endothéliales en utilisant des lectines qui

sont des molécules d’adhésion aidant à la transmission cellule-à-cellule de l’infection.

L’infection des lignées cellulaires de monocytes et de macrophages par le virus de la rougeole

induit l’expression de LFA-1, une molécule d’adhésion qui favorise l’adhésion aux cellules

endothéliales et contribuerait à la dissémination du virus (Attibele et al., 1993 ; Hummel et

al., 1998). Il a aussi été montré que le VIH incorpore des molécules de la cellule hôte telles

que ICAM-1, CD44, dans la particule virale (Fortin et al., 1997), élargissant ainsi la variété de

cellules infectables par le virus. Cependant, bien qu’il ait été rapporté que le virus de la

rougeole peut incorporer des protéines cellulaires dans le virion (Fagraeus et al., 1978), il est

peu probable qu’elles soient utilisées in vivo puisqu’on n'observe pas de virus libre dans la

phase virémique. D’autres possibilités incluraient la présence d’autres récepteurs et l’entrée

du virus par un mécanisme ne nécessitant pas de récepteur telle que la micropinocytose

comme il l’a été rapporté pour le VIH (Hioe et al., 2001).

19


I.Le virus de la rougeole

6. Pathologie

I.6.1. Réponses immunitaires

Les réponses immunitaires au virus de la rougeole sont importantes pour l’élimination

du virus et la guérison. Elles sont responsables des manifestations cliniques de la rougeole. La

nature de la réponse immunitaire protectrice a été étudiée dans les modèles animaux mais

aussi en observant les réponses immunes chez les enfants. Il est clair que l’on peut prévenir

l’infection par le virus de la rougeole par une administration passive de globulines

(Krugman, 1963). Cependant, des enfants souffrant d’hypogammaglobulinémie guérissent

normalement, alors que ceux qui souffrent d’anomalies congénitales ou acquises de

l’immunité cellulaire développent une maladie progressive. Il est probable que les anticorps

représentent une première barrière contre l’infection mais qu’une immunité à médiation

cellulaire est essentielle pour l’élimination du virus.

I.6.1.a. Réponses immunes cellulaires

Les principales actions dans la réponse immune non-spécifique précoce sont

l’induction d’interférons (IFN) et l'activation du complément, l’activation des

macrophages et des cellules « natural killer », et la production d’IFN et d’IL-12. Bien qu’il

ait été montré que l’infection de lignées cellulaires par le virus de la rougeole induit la

production d'interféron (Volckaert-Vervliet & Billiau, 1977), les résultats concernant

l’infection par le virus sauvage in vivo sont contradictoires et non concluants. Le virus de la

rougeole ne paraît pas gêner l’activation du complément in vitro, ni la production d’IFN in

vivo (Griffin et al., 1990). Naniche et al. (2000) ont montré que, bien que l’infection des

lymphocytes avec les souches vaccinales induise l’IFN ce n’est pas le cas avec les souches

sauvages. De plus, une pré-infection avec une souche sauvage bloque l’induction de

l’interféron par une souche vaccinale. Ainsi, la souche sauvage du virus de la rougeole est

capable de supprimer la synthèse des médiateurs précoces de l’immunité antivirale.

Les CTL (Cytotoxic T-Lymphocytes) CD8+, spécifiques de la rougeole, sont

détectables dans le sang au moment de l’éruption et dans les lavages bronchioalvéolaires au

cours de la pneumopathie et persistent pendant des mois après l’infection. Le CD8 soluble, un

sous-produit de l’interaction des cellules TCD8+ activées avec les cellules cibles, et la

microglobuline 2, un composant du CMH I qui présente l’antigène aux cellules CD8+, sont

également augmentés dans le sang. Il a été montré qu’il y a une augmentation de l’expression

du CMH I grâce à la production d’IFN au cours de l’infection des cellules in vitro par le

20


I.Le virus de la rougeole

6. Pathologie

virus de la rougeole. Si ce processus avait lieu in vivo, il augmenterait la reconnaissance des

cellules infectées par les cellules T CD8+ impliquées dans leur destruction.

Les cellules T CD4+ sont aussi activées en réponse à l’infection par le virus de la

rougeole. Le taux de cytokines circulantes produit par les cellules T et les macrophages

augmente. Les cytokines produites par les cellules T CD4+ déterminent leurs fonctions. Ainsi,

les cellules T CD4+ de type I produisent l’IFN qui active les macrophages et l’interleukine

(IL-2) qui induit la prolifération des cellules T. Les cellules T CD4+ de type II produisent

l’IL-4, l’IL-5, l’IL-10 qui jouent un rôle important dans la prolifération et la différenciation

des cellules B.

En ce qui concerne la production de cytokines pendant la rougeole, on constate que

pendant la phase des prodromes, les niveaux d’IFN de néoptérine (un produit d’activation

des macrophages) et du récepteur de l’IL-2 augmentent dans le sang. Ceci est suivi d’une

augmentation d’IL-2 et de CD4 soluble pendant l’éruption (Griffin et al., 1989). Au fur et à

mesure que disparaît l’éruption, le taux d’IL-4 augmente et cette augmentation persiste chez

certains malades pendant des semaines. En résumé, ce profil de production de cytokines

suggère que différentes cellules du système immunitaire seraient activées dans un ordre bien

précis au cours de l’infection. Il y aurait d’abord l'activation précoce de cellules CD8+ (IFN )

pendant les prodromes, puis l’activation de cellules CD4+ de type 1 (IFN et IL-2) pendant

l’éruption, suivie de l’activation de cellules CD4+ de type 2 (IL-4) pendant la convalescence.

I.6.1.b. Réponse humorale

Les anticorps sont détectables dans le sérum et les sécrétions dès l’apparition de

l’éruption et persistent pendant plusieurs années après la guérison. Les IgM sont produites en

premier et leur présence indique une primo-infection (par une souche sauvage ou vaccinale),

suivies des IgG et des IgA. Des anticorps dirigés contre la plupart des protéines spécifiques du

virus de la rougeole sont produits. La proportion de chaque anticorps est corrélée au taux de

protéine virale correspondante synthétisée. Ces anticorps sont par conséquent principalement

dirigés contre la protéine N. La contribution des différents anticorps à la neutralisation et à la

protection a été montrée in vitro et dans les modèles animaux. Les anticorps dirigés contre la

protéine H ou F neutralisent le pouvoir infectant du virus (Giraudon & Wild, 1981 ; Varsanyi

et al., 1984) et lorsqu’ils sont administrés de façon passive protègent l’animal d’une épreuve

mortelle (Giraudon & Wild, 1985 ; Malvoisin & Wild, 1990). En revanche, les anticorps

contre les autres protéines ne possèdent aucune de ces fonctions. Il existe en général une

21


I.Le virus de la rougeole

6. Pathologie

bonne corrélation entre la protection et les taux d’anticorps neutralisants circulants. Tous ces

changements s’accompagnent d’un état d’immunodéficience, qui, bien que réversible, peut

persister pendant des mois, augmentant ainsi la susceptibilité du malade à des infections

opportunistes.

I.6.2. Immunosuppression

L’immunosuppression a été décrite pour la première fois il y a environ cent ans, au

cours des infections par le virus de la rougeole (Von Pirquet, 1908). Si la rougeole est

l’infection virale responsable de la majorité des cas de mortalité et de morbidité chez les

enfants dans le monde, c’est le phénomène de l’immunosuppression conduisant à des

infections secondaires virales et bactériennes qui fait le plus de victimes. L’état

d’immunosuppression peut persister plusieurs semaines voire plusieurs mois, en particulier

chez les enfants soufrant de malnutrition. Le paradoxe ici est que, malgré cette attaque sur le

système immunitaire, le virus de la rougeole induit une excellente réponse immune

conduisant à une immunité à vie. Par contre, les souches vaccinales induisent une

immunosuppression moyenne et les réponses humorales sont moins importantes et seraient de

plus courte durée (Fireman et al., 1969 ; Hussey et al., 1996). Les mécanismes impliqués dans

l’immunosuppression n’ont pas été élucidés, mais les études de certains laboratoires suggèrent

que plusieurs voies du système immunitaire seraient impliquées. Il est actuellement

impossible d’évaluer si l’une d’elles contribue de façon majoritaire. Parmi les meilleures

approches, on peut citer le fait que :

i) Bien que moins de 1% des lymphocytes B et T circulants soient infectés, on

observe une lymphopénie transitoire chez les enfants infectés. Le rapport

CD4/CD8 est maintenu (Arneborn & Biberfeld, 1983 ; Griffin et al., 1986).

ii) L’infection des monocytes par le virus inhibe la synthèse d’IL-12, une cytokine

importante dans l’immunité à médiation cellulaire. Ces études montrent que cette

régulation négative se fait via l’interaction avec CD46 et donc serait limitée aux

souches vaccinales (Karp, 1999).

iii) Les cellules B et T infectées par le virus de la rougeole sécrètent un facteur soluble

qui bloque la prolifération des cellules B non infectées (Fujinami et al., 1998 ; Sun

et al., 1998). De même, l’interaction des PBLs infectés par le virus de la rougeole

inactivé aux UV avec les lymphocytes sains bloque le cycle cellulaire de ces

22


I.Le virus de la rougeole

6. Pathologie

derniers en phase G1. Dans ce cas, la présence des deux glycoprotéines H et F est

nécessaire (Engelking et al., 1999 ; Naniche et al., 1999).

iv) La nucléoprotéine du virus de la rougeole est la plus abondante des protéines

virales. Elle a la capacité d’interagir avec le récepteur Fc . In vitro, ceci conduit à

l’inhibition de la synthèse d’anticorps (Ravanel et al., 1997) et in vivo, à la

réduction de la réaction d’hypersensibilité retardée qui s’explique par une

incapacité des cellules dendritiques à activer correctement les lymphocytes T. Ces

même cellules inhibent la production d’IL-12 (Marie et al., 2001).

v) Le virus de la rougeole peut infecter les cellules dendritiques immatures qui

entament donc leur processus de maturation. Normalement, les cellules

dendritiques matures migrent vers les ganglions lymphatiques périphériques ou les

antigènes sont présentés aux cellules T. Au cours de l’infection par le virus de la

rougeole, il semble que les cellules dendritiques perdent leurs fonctions de

présentation (Grosjean et al., 1997).

I.6.3. Complications de la rougeole

Chez les personnes présentant déjà un terrain d’immunodéficience, l’absence d’une

réponse immune cellulaire adéquate favorise l’établissement des infections persistantes telles

que l'encéphalite aiguë retardée qui se manifeste par des troubles moteurs et sensoriels

environ six mois après la rougeole , le virus associé est le plus souvent génétiquement altéré

(Baczko et al., 1988 ; Cattaneo et al., 1987b) et la MIBE (measles inclusion body

encephalitis), qui est caractérisé par la présence de corps d’inclusions dans les neurones La

maladie évolue vers une forme aiguë ou subaiguë en envahissant le cerveau. Deux autres

perturbations neurologiques sont observées suite à la rougeole :

- L’encéphalomyélite post-infectieuse qui est une maladie démylinisante autoimmune. Elle

se produit dans un cas de rougeole sur mille, principalement chez les individus plus âgés. On

l’observe environ deux semaines après l’éruption. Cette maladie est associée à une réponse

autoimmune à l’un des composants protéiques de la myéline (Johnson et al., 1984). Ces

patients présentent des taux élevés et persistants d’IgE et des taux faibles de récepteurs d’IL-2

soluble dans le sang (Griffin et al., 1985). L’activation immune et le dysfonctionnement du

système immunitaire pourraient jouer un rôle dans l’induction de cette maladie.

- La panencéphalite sclérosante subaiguë (PESS) est une complication tardive de la

rougeole. Touchant environ un cas sur un million, elle est inévitablement fatale. La période

23


I.Le virus de la rougeole

6. Pathologie

d’incubation de la maladie est de plusieurs années (>2ans) après l’infection initiale. Des crises

d’épilepsie seraient l’une des manifestations cliniques révélatrices des cas de PESS (Kissani

et al., 2001). Ces crises apparaîtraient dès la première année d’évolution de la maladie qui est

caractérisée par la présence d’antigènes viraux dans le noyau et le cytoplasme des neurones et

des cellules gliales. Le taux d’anticorps sériques contre le virus de la rougeole est élevé et des

anticorps sont présents dans le liquide céphalorachidien, avec une réaction inflammatoire

considérable dans le système nerveux central (Tourtellotte et al., 1981). On ne sait ni

comment, ni où le virus persiste entre la période d’infection aiguë et le début de la phase

clinique, ni comment il pénètre dans le cerveau. Le virus responsable de cette maladie est

défectif et contient des mutations dans son génome qui bloquent la production de virus

infectieux (Baczko et al., 1986 ; Cattaneo et al., 1988). Ces mutations se situent

principalement au niveau des gènes H, F et M. Celles qui concernent la protéine F sont

localisées dans la région cytoplasmique. Les mutations dans le gène M conduisent à la fin

prématurée de la protéine ou à des formes conformationnellement non fonctionnelles.

Certaines mutations dans la protéine H peuvent entraîner une interaction moins efficace avec

la protéine F dans le processus de fusion.

Le virus de la rougeole a été associé à d’autres manifestations cliniques comme la

maladie de Crohn qui se caractérise par une réaction granulomateuse des macrophages

(Wakefield et al., 1997), la maladie de Paget qui est due à un dysfonctionnement des

ostéoclastes (Reddy et al., 1999) et certains cas d’inflammation intestinale chronique

(Kawashima et al., 2000). Mais à ce jour, il n’y a aucune preuve formelle que le virus de la

rougeole soit la cause de ces maladies.

24


CHAPITRE II. LA VACCINATION

25


II. La vaccination

1. Les vaccins inactivés

L’immunité induite par l’infection naturelle protège l’hôte à deux niveaux : i) les

cellules infectées peuvent être éliminées par les CTLs ; ii) l’anticorps peut soit bloquer

l’entrée de l’agent pathogène, soit réduire la charge virale une fois l’infection commencée.

Les vaccins vivants atténués miment l’infection naturelle et induisent ainsi le même

type de réponse immune, c'est-à-dire qu’une réponse de type Th2 suit une réponse de type

Th1. Par contre, les vaccins inactivés sont non-réplicatifs et sont de ce fait vus par le système

immunitaire comme exogènes. Ceci ne peut pas normalement induire une réponse Th1. Le

type d’immunité requise pour la protection varie en fonction de l’agent pathogène. Le

poliovirus, un pathogène de l’intestin peut passer dans le cerveau et engendrer une

poliomyélite. L’induction d’anticorps antipoliovirus dans le sérum avec un vaccin inactivé est

suffisante pour la protection contre les manifestations cliniques, mais ne protège pas contre

l’infection dans l’intestin. Les tentatives récentes de production d’un vaccin contre le VIH ont

souligné des lacunes dans la compréhension des principes immunologiques de l’induction des

réponses protectrices. Basées sur le nombre d’ « erreurs » de vaccination survenues dans les

années 1960, quelques règles ont été développées pour ce groupe de virus. Comme mentionné

ci-dessus, au cours d’une infection naturelle, une réponse Th1 est suivie par une réponse Th2.

La vaccination avec une préparation inactivée induit seulement le système Th2 qui

reste «fixé » dans la mémoire immunologique de l’hôte. Cependant, avec la diminution de

l’immunité, l’hôte devient susceptible et si l’infection survient, le virus induit un «cocktail»

de cytokines (Th1 + Th2) qui conduit à un déséquilibre immunologique. Dans le cas des

vaccins inactivés contre les paramyxovirus, ceci a entraîné une forme très sévère de la

maladie. Ainsi, la vaccination contre ces virus doit respecter certaines règles immunologiques.

II.1 LES VACCINS INACTIVES

Ils sont produits à partir d’agents pathogènes dont l’infectivité a été détruite par un

agent chimique dénaturant comme le formol, la -propiolactone ou par la chaleur. Cette

méthode fut utilisée pour la première fois dans les années 50 par Jonas Salk pour la mise au

point du vaccin contre la poliomyélite. L’utilisation de ce vaccin a considérablement réduit le

nombre de cas de poliomyélite dans le monde. D’autres vaccins à virus inactivés comme le

vaccin contre la grippe, la rage, l’encéphalite japonaise et la méningo-encéphalite à tiques

d’Europe centrale (Tick born encephalitis virus) sont aussi disponibles sur le marché. Malgré

26


II. La vaccination

1. Les vaccins inactivés

leur efficacité irréfutable, ces vaccins présentent dans certains cas quelques désavantages en

terme d’immunité :

- leur caractère non-réplicatif ne permet pas la persistance de l’antigène dans

l’organisme et de ce fait, la protection est de courte durée,

- ils ne sont pas aussi efficaces que les virus vivants car ils n’induisent pas

d’immunité muqueuse (IgA),

- cette méthode ne convient pas à tous les virus car la dénaturation entraîne dans

certains cas la perte d’antigénicité comme c’était le cas pour le vaccin contre la rougeole.

Au début des années 1960, le vaccin inactivé préparé à partir de la souche Edmonston traitée

au formol, a été introduit aux Etats-Unis et en Europe. Ce vaccin induit des anticorps

neutralisants et protège contre l’infection. Cependant, l’immunité est de courte durée (Carter

et al., 1962 ; Guinee et al., 1966). Parmi les enfants ayant reçu ce vaccin, 15 à 50% qui par la

suite ont été infectés par le virus de la rougeole, ont développé une forme sévère de maladie

appelé rougeole atypique. Cette forme de rougeole était caractérisée par une fièvre soutenue et

prolongée, une éruption de type vésiculaire qui commence par les extrémités des membres,

contrairement à l’éruption maculopapulaire, caractéristique de la rougeole classique qui

commence sur la face et le tronc, une pneumonie sévère nécessitant le plus souvent une

hospitalisation. Des douleurs abdominales, un dysfonctionnement du foie, des maux de têtes,

des effusions pleurales, l’éosinophilie et des oedèmes ont aussi été décrits (CDC, 1976 ;

Fulginiti et al., 1967). Des observations similaires ont été faites pendant la même période chez

des enfants ayant reçu le vaccin inactivé contre le virus respiratoire syncytial (RSV), le virus

parainfluenza et le virus des oreillons. Ces vaccins n’étaient pas protecteurs et des maladies

sévères se développaient chez les enfants exposés au virus sauvage (Kim & al., 1968).

Plusieurs hypothèses ont été émises pour expliquer cette maladie, focalisées sur la

possibilité de l’induction d’une hypersensibilité retardée spécifique de la rougeole qui serait

anormale (Fulginiti & Arthur, 1969). Mais la théorie la plus acceptée fut celle selon laquelle

la rougeole atypique serait due à un déséquilibre dans la réponse anticorps dirigée contre les

glycoprotéines virales H et F, à cause de l’altération de la protéine F dans le vaccin inactivé

(Norrby et al., 1975). Cependant, une étude plus récente, dans laquelle la rougeole atypique a

été établie chez le singe Rhésus macaque, montre que la maladie atypique serait due à une

réponse anticorps non protectrice à laquelle s’ajoute une production exagérée de cytokines de

type 2 (Polack et al., 1999).

27


II. La vaccination

2. Les vaccins vivants atténués

II.2 LES VACCINS VIVANTS ATTENUES

Ce sont des virus à pathogénicité réduite, capables de se multiplier dans l’organisme et

d’induire une réponse immunitaire comparable à l’infection naturelle sans manifestations

cliniques. L’atténuation est causée par l’induction de mutations dans l’agent pathogène

conduisant à la limitation de sa virulence chez le sujet vacciné. L’atténuation est obtenue par

passages successifs en culture sur plusieurs types de cellules telles que les cellules

amniotiques et les fibroblastes de poulet, les cellules de rein de mouton, de singe, de cochon,

ou d’homme, et les cellules amniotiques humaines. Plusieurs vaccins à virus vivants atténués,

tels que le vaccin contre la rubéole, les oreillons, la fièvre jaune, et la rougeole sont

actuellement utilisés. Bien que ces vaccins soient de bons immunogènes, ils présentent

certains désavantages liés à :

- leur instabilité biochimique (virus vivant), d'où la nécessité d’utiliser des stabilisants

qui peuvent être des sources de contamination et de respecter la chaîne de froid pour

leur conservation

- leur instabilité génétique qui expose le patient aux risques de réversion de la virulence

- leur utilisation déconseillée chez certains sujet à risque telles que les femmes enceintes

et les personnes immunodéprimées chez lesquels ils pourraient entraîner des maladies

graves.

De plus, le développement de vaccins vivants atténués efficaces contre certains virus

s’avère très difficile. C’est le cas pour :

- le virus de la grippe où les problèmes les plus couramment rencontrés sont l’existence

de plusieurs sérotypes et de variations antigéniques. Cependant un vaccin vivant

atténué efficace contre la grippe a été mis au point aux Etats-Unis (Nichol, 2001).

- le VIH où le développement d’un vaccin rencontre des problèmes d’éthique

- le papillomavirus qui ne pousse pas sur les cellules en culture.

Ceci dit, le vaccin actuellement utilisé contre la rougeole est un vaccin vivant atténué qui

jusqu’ici a été d’une efficacité indéniable. Depuis son utilisation dans les programmes élargis

de vaccination, le nombre de cas de décès associés à la rougeole est passé de huit millions à

moins d’un million par an dans le monde.

A la fin des années 50, les travaux d’Enders et de son groupe ont abouti au

développement d’un vaccin rougeoleux vivant atténué après 24 passages de la souche

Edmonston sur des cultures primaires de cellules rénales humaines suivis de 28 passages

28


II. La vaccination

2. Les vaccins vivants atténués

supplémentaires sur cellules amniotiques humaines et de six passages sur embryon de poulet,

avant l’adaptation du virus sur culture de fibroblastes de poulet. Le vaccin initial Edmonston

B breveté en 1963 était réactogène, donnant de la fièvre et des éruptions. Ces symptômes ont

été réduits dans environ 50% des cas par l’administration concomitante de globulines. Après

d’autres passages de la souche Edmonston sur des fibroblastes de poulet, une souche plus

atténuée (Schwartz) fut obtenue et brevetée en 1965. Par la suite, les Etats-Unis, le Japon, la

Yougoslavie, l’ex-URSS, et la Chine ont développé de nouvelles souches vaccinales hyperatténuées

en utilisant les mêmes stratégies et avec des résultats similaires. Ces vaccins ont été

mis au point soit à partir de souches Edmonston (AIK-C), Edmonston A (Schwartz),

Edmonston B (Moraten, Edmonston-Zageb) ou à partir de nouvelles souches (Leningrad 16,

CAM-70, Shanghai-191,TD-97) (Figure 6). Bien que la vaccination avec les souches hyperatténuées

induise des taux d’anticorps plus bas qu’avec le vaccin Edmonston B ou l’infection

naturelle, l’incidence des réactions cliniques est plus faible et ils ont donc été adoptés pour

une large utilisation.

L’utilisation de ces vaccins protège de façon efficace contre la rougeole. Cependant,

certaines observations rendent nécessaire le développement de nouveaux vaccins :

i) Les vaccins actuellement disponibles ne parviennent pas à bloquer complètement

la transmission du virus dans la population.

ii) On ne peut pas vacciner les enfants avant l’âge de neuf mois car la présence

d’anticorps maternels réduit l’efficacité de la vaccination (Siber et al., 1993).

Si de nouveaux vaccins sont mis au point, ils doivent non seulement résoudre ces deux

problèmes mais aussi éviter de créer des formes aberrantes de la maladie qui s’observent dans

le cas de l’administration de vaccins inactivés (Norrby et al., 1975) ou fortement dosés

(Halsey, 1993).

29


Figure 6 : Souches vaccinales utilisées pour la production de vaccin vivant atténué contre la rougeole, méhodes d ’atténuation et vaccin

fabriqué par différents producteurs de vaccins en 1994 (adapté de Markowitz & Katz, 1994)

Souche

Souche

RH

AH

AH

RM

FEP

AIK- C

Institut Kitatsato, Japon

Institut nationa , Japon

FEP

Edmonston A

FEP

SCHWARZ

AH FEP

FEP

DH

CIAEP

FEP

CIAEP

FEP

Edmonston B

AIK- HDC

Institut Razi, Iran

Pasteur-Mérieux MSD, France

Evans, Royaume-Uni

Sclavo, Italie

Institut de sérums et vaccins,

Tchécoslovaquie

Institut Cantacuzino, Roumanie

Takeda, Japon

Connaught

Laboratoires Connaught, Canada

Institut National de la Santé, Pakistan

Moraten

Merck,Sharpe and Dowe, USA

RIVM, Pays-Bas

Edmonston Zagreb

Institut Suisse de Sérums et de Vaccins, Suisse

Institut Indien de Sérum, Inde

Institut d ’immunologie, Croatie

Smith Kline et Beecham, Belgique

FEP

SCHWARZ F88

Institut Suisse de Sérums et de Vaccins,

Autres souches

Souche

Souche SHANGAI

Souche TANABE

RCG

CJ

RH

AH

FEP

RS

RH

CIAEP

MCP

FEP

RS

RH

CIAEP

RCG

LENINGRAD 16

SHANGAI 191

CAM-70 TD-97

D.Mazai, Russie

Institut de Rech. Mal. Inf.Parasit., Bulgarie

Institut Shangai, Chengdu, Lanzhou et Wuhan, Chine Biomanghuinos, Brésil

Chiba Sérum, Japon

Perum biofarma, Indonésie

Fondation Rech. Mal. Microb.,

En italique : Noms des producteurs et

Type de cellules utilisées pour l ’atténuation du virus : AH(amnios humain), CIAEP(Cavité intra-amniotique de l ’embryon de poulet), CJ (caille japonaise), DH (cellules diploïdes humaine)

FEP (fibroblastes d ’embryon de poulet), MCP (membrane chorioallantoïque de poulet), RCG (Rein de cochon de Guinée), RH (rein humain), RM (rein de mouton), RS (rein de singe)


II. La vaccination

3. Les nouvelles aproches de vaccination

II.3 LES NOUVELLES APPROCHES DE VACCINATION

II.3 1. Le vaccin actuel : quelques difficultés rencontrées

Le problème de mortalité croissante due à la rougeole observée chez les nourrissons dans

les pays en développement, a stimulé les efforts de lutte contre l’action négative des anticorps

maternels sur la vaccination. En effet, les anticorps maternels empêchent la réponse anticorps

en bloquant les sites antigéniques de la souche vaccinale. Afin de résoudre ce problème,

différentes approches ont été considérées :

- La vaccination par aérosol. Le vaccin vivant atténué a été administré par voie

muqueuse ou respiratoire sous forme d’aérosol. En fait, les anticorps maternels étant

plutôt sériques, très peu sont présents sur les surfaces des muqueuses. On espérait

alors que le vaccin vivant administré par aérosol aurait un certain avantage. Bien que

les études de vaccination par aérosol aient rencontré des problèmes pratiques pour

l’administration du vaccin (Cutts et al., 1997), des résultats intéressants ont été

obtenus dans la majorité des cas. Une étude réalisée en Afrique du Sud a montré que

le taux de séroconversion après vaccination avec la souche Edmonton-Zagreb

administrée par aérosol (85%) était supérieur à celui obtenu avec la même souche

administrée par voie sous-cutanée (79%) (Dilraj et al., 2000). Des résultats similaires

ont été obtenus dans d'autres études réalisées aux Etats-Unis (Sabin, 1983 ; Sabin et

al., 1985). La vaccination par aérosol a été utilisée avec succès dans de grandes

campagnes de vaccination au Mexique (Fernandez-de-Castro et al., 1997). Mais tous

ces résultats seraient dépendants du type d’appareil employé. Dans les études décrites

ci-dessus, le vaccin reconstitué a été utilisé, ce qui pose le problème de maintien de la

chaîne de froid. La recherche actuelle est orientée vers le développement d’un appareil

permettant d’utiliser directement le vaccin lyophilisé et facile à manipuler sur le

terrain (LiCalsi et al., 1999).

- Les vaccins à hauts titres. Le vaccin standard contient environ 10 3 à 10 4 unités

infectieuses par dose. Il a été proposé et approuvé par l’OMS (WHO, 1990) que des

doses de vaccins à hauts titres (10 4.0 à 10 5.0 ) soient administrées aux enfants dès l’âge

de 6 mois. On espérait ainsi pouvoir lutter contre l’effet inhibiteur des anticorps

maternels dans la réponse immunitaire. Les vaccins à hauts titres ont été utilisés pour

immuniser des enfants âgés de 4 à 6 mois dans plusieurs pays dont le Sénégal, la

31


II. La vaccination

3. Les nouvelles aproches de vaccination

Guinée-Bissau, Haïti, la Gambie, le Mexique et le Pérou. La majorité des études

montrent que, par rapport au vaccin standard, les vaccins à hauts titres augmentent les

taux de séroconversion. En Gambie, où des doses de vaccins contenant 4.10 4 unités

infectieuses ont été utilisées chez les enfants de 4 à 6 mois, on a obtenu un taux de

séroconversion de 100% (Whittle et al., 1984). Cependant, en Guinée-Bissau, on

n’observe pas de différence significative entre les vaccins Schwarz standard et hauts

titres (Aaby et al., 1996). Cependant, un suivi à long terme montre un taux élevé de

mortalité chez les enfants ayant reçu le vaccin à hauts titres. En effet, une étude menée

au Sénégal montre que par comparaison aux enfants ayant reçu le vaccin standard, le

risque de décès est de 1,51 et 1,80 chez les enfants ayant reçu respectivement le vaccin

Schwarz et Edmonston-Zagreb à hauts titres (Garenne et al., 1991). Des résultats

similaires ont été obtenus en Haïti (Halsey, 1993). En revanche, ce phénomène n’a pas

été observé en Gambie, ni au Mexique ou au Pérou (Halsey, 1993). A ce jour, aucun

lien de cause à effet n’a été démontré entre ce vaccin et les décès observés.

Un autre problème majeur du vaccin contre la rougeole est celui de la stabilité du vaccin.

Avant 1980, les vaccins rougeoleux étaient thermolabiles ce qui rendait leur emploi difficile

dans les régions tropicales (Hendrickse & Montefiore, 1975). La mise au point de stabilisants

et la formulation des exigences de l’OMS à propos de la stabilité thermique des vaccins

rougeoleux lyophilisés (WHO, 1981), ont considérablement amélioré la qualité des vaccins

depuis 1980. Cependant, les vaccins reconstitués perdent rapidement leur activité à

température ambiante entre 22°C et 25°C (environ 50% de leur activité en une heure).

Normalement, le vaccin lyophilisé, une fois reconstitué, doit être utilisé rapidement. Ceci

entraîne non seulement un problème de gaspillage sur le terrain, pendant les grandes

campagnes où les vaccins sont conditionnés par ampoules de plusieurs doses, mais aussi un

problème de stockage, surtout dans les pays en développement où la chaîne de froid n’est pas

toujours maintenue. A cause de ces problèmes, l’OMS s’intéresse désormais aux techniques

d’administration directe du vaccin lyophilisé non reconstitué, soit par aérosol directement

dans les cavités nasales ou orales, soit avec un appareil à pression pour administrer le vaccin

dans la peau. Ces nouvelles approches pourraient résoudre non seulement le problème de la

stabilité du vaccin, mais, seraient aussi un moyen d’éviter l’utilisation des seringues, qui sont

une source de contamination et posent un problème de traitement des déchets dans les pays en

développement.

32


II. La vaccination

3. Les nouvelles aproches de vaccination

II.3 2. Les nouveaux vaccins

Les différentes approches utilisées jusqu’ici n’ayant pas été suffisamment crédibles, il est

question aujourd'hui de développer un vaccin qui puisse être utilisé pour éradiquer la

rougeole. Dans le cadre du programme d’éradication du virus de la poliomyélite, qui avance

avec beaucoup de succès, deux types de vaccins sont disponibles. Un vaccin atténué qui est

utilisé pour l’éradication des souches sauvages et un vaccin inactivé qui sera utilisé après

l’éradication des souches sauvages. Par contre, dans le programme de vaccination contre la

rougeole, il n’y a qu’un seul type de vaccin. De plus, il y a un nombre croissant d’enfants

immunodéprimés qui développeraient des complications liées à l’utilisation de vaccin vivant.

En suivant l’exemple de la lutte contre la poliomyélite, une nouvelle génération de vaccins

contre la rougeole pourrait être utilisée une fois l’éradication achevée, pour stimuler la

mémoire immunologique pendant la phase finale. Conjointement à la mise au point de

nouveaux vaccins, on doit accéder à une meilleure compréhension des mécanismes

immunitaires fondamentaux nécessaires à la protection ou responsables de l’induction d’une

réponse immune aberrante.

Les nouveaux vaccins ont pour caractéristique principale l’utilisation de quelques

protéines de l’agent pathogène pour la fabrication du vaccin. Afin de fabriquer des vaccins qui

contiennent seulement une partie du spectre des protéines virales, il est nécessaire de

connaître celles qui sont importantes pour la protection. Plusieurs études ont montré que :

- l’administration passive des anticorps protège les enfants contre la rougeole

(Krugman, 1963). Il a été montré dans un modèle animal murin que les anticorps

monoclonaux dirigés contre l’une des glycoprotéines, l’hémagglutinine ou la protéine

de fusion protègeraient in vivo (Giraudon & Wild, 1985 ; Malvoisin & Wild, 1990)

- l’immunité cellulaire aurait un rôle important dans la protection puisque les enfants

déficients en cellules T présentent des complications au cours de l’infection par le

virus de la rougeole (Lipsey et al., 1967)

- les cellules T cytotoxiques (CTL) sont présentes chez les enfants après l’infection par

le virus de la rougeole (van-Binnendijk et al., 1990). De plus, il a été montré dans le

modele animal que l’immunisation avec un épitope de CTL protège contre la rougeole

(Beauverger et al., 1996)

Un vaccin efficace contre la rougeole qui remplirait les critères ci-dessus devrait contenir

au moins les deux glycoprotéines virales afin d’induire les anticorps neutralisants. Il devrait

33


II. La vaccination

3. Les nouvelles aproches de vaccination

probablement contenir aussi la nucléoprotéine puisqu’elle est responsable, dans la plupart des

cas, de la forte réponse CTL.

Plusieurs catégories de vaccins ont été ou sont actuellement développées : les vaccins utilisant

les vecteurs viraux, les ISCOM (Immunes-Stimulating Complex), et les vaccins ADN.

II.3 2.a. Les vaccins utilisant les vecteurs viraux

L’idée est d’insérer les gènes viraux dans un autre virus atténué pour présenter

l’antigène au système immunitaire. Parmi ces vecteurs, on peut citer les poxvirus tels que le

virus de la vaccine qui présente l’avantage d’être infectieux pour tous les mammifères, ou

encore les poliovirus (hôtes naturels de l’intestin) et les adénovirus (hôtes de l’appareil

respiratoire suppérieur) qui sont intéressants pour la vaccination par voie muqueuse. Les

rétrovirus sont également utilisés en thérapie génique.

Les vaccins recombinants de la vaccine contre la rougeole induisent des réponses

immunes chez les animaux. Des souris immunisées avec des recombinants exprimant soit

l’une des protéines (H, F ou N) du virus de la rougeole, soit les trois protéines contenues dans

le même recombinant, induisent à la fois des anticorps neutralisants (H et F) et des CTL (H et

N) (Wild et al., 1992 ; Beauverger et al., 1993). Des résultats similaires ont été obtenus chez

le singe (van Binnendijk et al., 1997). Dans les deux modèles, la présence d’anticorps

administrés passivement supprime la réponse humorale mais pas la réponse CTL (Galletti et

al., 1995).

L’un des problèmes de l’utilisation de la vaccine comme vecteur est le risque qu’il soit

pathogène chez les personnes immunodéprimées. Pour résoudre ce problème, un pox virus

aviaire (ALVAC) a été utilisé comme vecteur (Taylor et al., 1992). Ce dernier possède une

infection défectueuse dans les cellules de mammifères. Les virus recombinants ALVACrougeole

induisent une réponse immunitaire dans les modèles animaux, mais cette réponse est

fonction de la dose de vaccin utilisée à cause de la nature de l’infection (Taylor et al., 1992).

Avec un second vecteur NYVAC, obtenu à partir de la souche New-York du virus de la

vaccine, dans laquelle les gènes de virulence ont été supprimés et dont la réplication est

défectueuse dans les cellules humaines, on a obtenu des résultats similaires à ceux observés

avec ALVAC.

34


II. La vaccination

3. Les nouvelles aproches de vaccination

II.3 2.b. Les ISCOMs

Les ISCOMs (Immune-Stimulating Complex) sont constitués d’une matrice lipidique

dans laquelle sont introduites des protéines membranaires. La matrice est composée d’un

mélange de lipides tels que le QuilA qui est une saponine possédant des propriétés adjuvantes,

de cholestérol et d’autres lipides. Les protéines membranaires, après solubilisation par un

détergent sont incorporées dans la matrice grâce à des interactions hydrophobes. L’utilisation

des ISCOMS comme technique de présentation antigénique des protéines membranaires dans

la vaccination a été développée dans les années 1980 (Morein et al., 1984) et est actuellement

utilisée pour certains vaccins vétérinaires.

Il a été montré que les ISCOMs contenant les deux glycoprotéines du virus de la

rougeole induisent des taux élevés d’anticorps chez le singe. Contrairement à ce qui se passe

avec le pox virus comme vecteur, la réponse humorale n’est pas affectée par la présence

d’anticorps administrés passivement (van Binnendijk et al., 1997). Bien que le taux initial

d’anticorps ne soit pas maintenu, les singes sont encore protégés un an après l’immunisation.

Ce type de vaccins, bien que plus efficaces que les précédents, est recommandé pour des cas

exceptionnels seulement, car leur coût de production reste élevé.

II.3 2.c. La vaccination ADN

Le vaccin ADN est constitué d’un vecteur d’expression plasmidique qui contient le

gène codant pour la protéine d’intérêt. Après inoculation in vivo, cette protéine est exprimée

et permet l’induction d’une réponse immunitaire spécifique. La vaccination ADN est l’une

des approches récentes dans la lutte contre la rougeole.

Il a été montré que les plasmides contenant les ADN complémentaires de H,F et N,

exprimés à partir d’un promoteur du CMV (cytomégalovirus), induisent une bonne réponse

humorale et CTL chez la souris (Cardoso et al., 1998). Les mécanismes immunologiques de

base impliqués dans la vaccination ADN ne sont pas bien connus. Ainsi, l’administration de

l’ADN et son expression dans les tissus appropriés seront fondamentales pour l’induction

d’une bonne réponse immune. Il a été montré que :

- l’inoculation intramusculaire de l’ADN induit une réponse Th1 mais requiert jusqu'à

100g d’ADN par souris (Cardoso et al., 1996)

35


II. La vaccination

4. Position actuelle de l'OMS

- l’inoculation intradermique de l’ADN précipité sur des billes d’or à l’aide d’un

pistolet à particules ou « gene-gun » augmente l’efficacité de cent fois mais

malheureusement, la réponse immune cellulaire induite est plutôt de type Th2.

Il serai intéressant dans le futur de cibler les tissus appropriés, où la protéine sera

efficacement exprimée et présentée aux cellules du système immunitaire afin d’obtenir une

réponse immune cellulaire correcte (Th1).

Bien que le vaccin ADN soit l’un des meilleurs espoirs du domaine de la vaccination, il

est tout de même important de signaler que le problème de sécurité du vecteur lui-même n’est

pas encore résolu et que jusqu’ici, aucun vaccin ADN n’est prêt à être approuvé par les

autorités (Cichutek, 2000).

II.4. POSITION ACTUELLE DE L’OMS : STRATEGIE DE VACCINATION

La rougeole est considérée comme une maladie éradicable pour plusieurs raisons :

- il existe un seul sérotype du virus de la rougeole, ce qui est un atout par rapport au

virus de la poliomyélite qui compte trois sérotypes mais qui est pourtant en voie de

disparition

- il existe un seul réservoir naturel qui est l’homme

- la rougeole a une expression clinique très marquée

- il existe un vaccin efficace contre la rougeole

Cependant, la rougeole s’avère difficile à contrôler à cause de sa nature très contagieuse,

de sa ressemblance avec des maladies causées par d’autres agents tels que le virus de la

Dengue, le virus d’Epstein Barr, les parvovirus et bien d’autres virus (Nur et al., 1999). Ces

problèmes peuvent être surmontés et plusieurs efforts sont actuellement dirigés vers

l’élimination de la rougeole. L’élimination est définie comme une interruption soutenue de la

transmission du virus dans une zone géographique donnée, tout en se protégeant de la

réintroduction du virus grâce au maintien de la vaccination.

Le vaccin actuel est efficace à 95 % quand il est administré dans les conditions optimales.

Ceci suggère qu’en utilisant une seule dose de vaccin, il y aura accumulation d’enfants

susceptibles dans la population, même lorsque tous les enfants auront été vaccinés. L’OMS

recommande de vacciner les enfants entre 9 et 15 mois. Dans les pays industrialisés, les

enfants sont vaccinés entre 12 et 15 mois, l’efficacité de la vaccination dans cette tranche

d’âge est de 90 à 95 % . Par contre, dans les pays en voie de développement où les enfants

sont exposés très tôt à la maladie, il est conseillé d’administrer le vaccin à l’âge de 9 mois

36


II. La vaccination

4. Position actuelle de l'OMS

(WHO, 1986). Or l’efficacité de la vaccination à cet âge n’est que de 85% (Huang et al.,

1990), ce qui augmente le nombre d’enfants susceptibles dans ces populations. Pour résoudre

ce problème, plusieurs pays ont opté pour l’administration de deux doses de vaccins, la

première entre 9 et 15 mois, et la deuxième à l’âge scolaire. Ceci a permis à plusieurs pays

donc la Finlande et les Etats-Unis d’éradiquer le virus sauvage.

La stratégie adoptée par l’OMS pour lutter contre la rougeole comprend trois phases : une

phase de contrôle, une phase de prévention des épidémies et une phase d’élimination.

La phase de contrôle consiste en une réduction significative de cas de rougeole et de

mortalité associée, grâce à l’augmentation de la couverture vaccinale.

La phase de prévention des épidémies est basée sur l’accentuation de la surveillance,

afin de détecter des changements épidémiologiques de la maladie, comme par exemple

le changement de la tranche d’âge où les enfants sont atteints de rougeole

(augmentation des cas de rougeole chez les enfants plus âgés), les changements dans

la fréquence des épidémies (durée entre deux épidémies rallongée par rapport à la

période pré-vaccinale) et l’identification des populations à haut risque afin de les

immuniser. Pour réaliser ce travail, le programme d’immunisation doit être complété

par les journées de vaccination nationales où les enfants sont vaccinés quel que soit

leur statut vaccinal initial.

La phase d’élimination consiste à maintenir le nombre d’individus susceptibles en

dessous du seuil critique requis pour soutenir la transmission du virus. La maintenance

d’un taux d’incidence bas à l’intérieur d’un pays pourra conduire à une éventuelle

suppression des infections naturelles.

L’expérience américaine constitue une preuve que l’éradication de la rougeole est

faisable. En effet, au début des années 90, la rougeole était encore endémique en Amérique du

Sud. Les campagnes soutenues de vaccination ont permis une baisse historique du nombre de

cas de rougeole si bien qu’en 1996, il n’y avait plus de rougeole en Amérique du Sud.

Cependant, en 1997 on constatait une recrudescence des cas de rougeole due à des souches

importées. Ces observations suggèrent que pour qu’un programme régional soit complètement

efficace, il est important qu’un effort global et concerté soit mis en place. La campagne

actuelle de lutte contre la rougeole devrait tirer des leçons de cette expérience américaine.

37


CHAPITRE III. ETUDES EPIDEMIOLOGIQUES

DE LA ROUGEOLE

38


III. Etudes épidémiologiques

1. Infection au sein d'une population non vaccinée

III.1. PROPAGATION DE L’INFECTION AU SEIN D’UNE POPULATION NON

VACCINEE

Dans une population non vaccinée, le virus de la rougeole se propage avec des

conséquences plus ou moins importantes en fonction de la durée et de la fréquence de contact

entre le contaminant et le contaminé.

III.1.1. Niveau d’exposition bas

Dans les pays industrialisés, où de bonnes conditions socio-économiques permettent

d’éviter la promiscuité, les cas de rougeole sont rares. La distribution des cas par groupe d'âge

montre que la maladie survient d'abord chez les enfants en âge pré-scolaire et s'étend au reste

de la population. En effet, au cours de l'épidémie de rougeole survenue aux Etats-Unis en

1986, on a constaté que la fréquence d'attaque était élevée chez les enfants de moins d'un an et

décroissait avec l'âge : 40% des cas étaient observés chez les enfants de moins de 16 mois

parmi lesquels 65% des cas chez les enfants de moins de 12 mois (Markowitz et al., 1989). De

plus, la fréquence d'attaque de la maladie était 16 fois plus élevée chez les enfants vivant dans

les cités ou les conditions socio-économiques sont médiocres, par rapport aux enfants de

familles aisées. Ces observations montrent que la maladie sévit chez les jeunes enfants

n'ayant pas atteint l'âge de la vaccination et dans les populations n'ayant pas accès aux

services de santé. Les malades développent une rougeole d’évolution favorable comme nous

l’avons décrit dans le paragraphe I.6. (pathologie). En général, le système immunitaire

élimine l'infection de l'organisme, ce qui n’est pas le cas dans les pays en développement où

la promiscuité augmente le taux de mortalité due à la rougeole.

III.1.2. Niveau d’exposition élevé

A la fin du siècle dernier, le taux de mortalité associé à la rougeole était élevé en

Europe et aux Etats unis. En 1897, D. Williams remarque que les causes majeures de cette

mortalité sont la promiscuité et une ventilation insuffisante (Williams, 1897). Dans les pays

en développement où la mortalité due à la rougeole reste encore un problème de santé, des

études de communauté montrent que la promiscuité et l’intensité d’exposition au virus de la

rougeole sont des déterminants majeurs de cette mortalité (Aaby et al., 1984).

39


III. Etudes épidémiologiques

1. Infection au sein d'une population non vaccinée

En effet, une étude menée en Guinée-Bissau montre que la disposition des habitations

de familles Africaines favorise la promiscuité, surtout dans les familles polygamiques où la

concentration de plusieurs cas de rougeole dans la même case entraîne des taux élevés de

mortalité. De telles observations ont été faites dans les institutions surpeuplées (Godfred,

1928), dans les camps de concentration et les camps de réfugiés (Ryan, 1976) et dans les

campements militaires (Picken, 1921).

Dans ces différentes études, on a constaté que la rougeole est plus sévère dans les cas

secondaires que dans les cas index (cas index = premier cas de rougeole survenu dans une

population donnée ; cas secondaire = cas de rougeole survenu dans les 6 jours après

identification du cas index et ayant eu un contact avec l’index). En fait, le cas secondaire

reçoit une forte dose de virus à cause du contact étroit avec le cas index. La maladie dans ce

cas évolue alors différemment. On observe notamment :

i) Une diminution de la période d’incubation. L’expérimentation animale avec le virus

de la rougeole montre qu’une forte dose de virus entraîne une diminution de la

période d’incubation et un taux de mortalité élevé chez la souris (Wear et al., 1968).

De même, les expériences de dosage de virus dans la vaccination contre la rougeole

ont montré que la durée de la période d’incubation est inversement proportionnelle à

la dose de virus utilisée (McCrumb et al., 1961).

ii) Une augmentation du taux de complications. En fait, il est possible que le cas index

transmette d’autres agents pathogènes en plus du virus de la rougeole, ce qui entraîne

des complications. De plus, les cas secondaires reçoivent de fortes doses de virus. En

effet il a été suggéré que de fortes doses de virus dans le vaccin contre la rougeole

induiraient l’immunosuppression (Holt et al., 1993), ce qui expliquerait le taux de

décès élevé observé chez les enfants ayant reçu des vaccins à hauts titres. Dans le

même ordre d’idées, il a été montré que la rougeole atypique était due à une

production exagérée de cytokines de type 2 entraînant un déséquilibre de cytokynes

au cours d'une infection subséquente (Polack et al., 1999). Ces observations

pourraient expliquer le fait que la maladie soit plus sévère chez les cas secondaires.

Ces observations montrent une ressemblance entre les conditions actuelles dans

certains pays en développement et les pays industrialisés au début du siècle où régnait la

promiscuité et où le taux de mortalité dû à la rougeole était élevé. Cependant, les différences

liées au fait que la polygamie et de larges habitations familiales n’ont jamais existé en Europe

et aux Etats-Unis pourraient expliquer pourquoi la rougeole est plus sévère chez les enfants

40


III. Etudes épidémiologiques

2. Propagation au sein d'une population vaccinée

africains. Il ressort de ces observations que pour mener une lutte efficace contre la rougeole

dans les pays en développement, en plus de la vaccination, il est primordial d’entraver la

forte exposition au virus et la transmission de la maladie à l’intérieur des maisons.

III.2. PROPAGATION DE LA ROUGEOLE AU SEIN D’UNE POPULATION VACCINEE

La stratégie utilisée au Etats-Unis dans les années 1980 pour éliminer le virus

endogène était basée sur le principe qu’il ne peut y avoir d’épidémie quand 99% d’enfants de

moins de 18 ans ont reçu une dose de vaccin (Frank et al., 1985). Cependant, plusieurs études

ont rapporté des cas d’épidémies de rougeole dans des populations vaccinées.

Une épidémie de rougeole s’est déclarée au Etats Unies dans une population où 99%

des enfants avaient été vaccinés (Gustafson et al., 1987). Des observations similaires ont été

faites au Sénégal dans une population ayant une couverture vaccinale de 81% (Whittle et al.,

1999b), ainsi qu’au Texas où 95% des enfants étaient vaccinés (Edmonson et al., 1990). Ces

observations montrent que le petit nombre d’individus non vaccinés présents dans ces

populations est capable de soutenir la transmission du virus chez plusieurs personnes. Le fait

que le virus se propage dans une population ayant une couverture vaccinale aussi élevée

pourrait s’expliquer par un échec primaire de vaccination (Cherry et al., 1973),

particulièrement quand le vaccin a été ;

- administré en présence des anticorps contre la rougeole (Barrata et al., 1970).

- stocké et administré dans de mauvaises conditions (Wyll & Witte, 1971)

- administré aux enfants de moins de 12 mois (Shaby et al., 1977)

Du point de vue clinique, la rougeole qui sévit dans les populations vaccinées est

différente de la rougeole classique. Bien que le plus souvent asymptomatique, elle présente

parfois des signes cliniques atténués. Dans les cas de rougeole cliniquement atténués, la phase

des prodromes est plus courte, la toux, le coryza et la fièvre sont minimisés. On n’observe pas

de taches de Köplick et l’éruption ne s’étend pas sur tout le corps (Cherry et al., 1973). Dans

ce cas, le diagnostic clinique s’avère très difficile, ce qui augmente considérablement le

nombre de personnes malades qui échappent au diagnostic clinique. Par conséquent, le virus

de la rougeole peut circuler sans être détecté dans une population vaccinée, ce qui augmente

faussement l’estimation de l’efficacité de la vaccination (Orenstein et al., 1988).

Heureusement, les tests sérologiques en laboratoire, qui permettent de mettre en évidence la

41


III. Etudes épidémiologiques

2. Propagation au sein d'une population vaccinée

présence d’anticorps dans le sérum, et le développement des techniques de biologie

moléculaire (PCR, séquençage) permettant de mettre en évidence la présence d’ARN viral

dans les lymphocytes de patients asymptomatiques aident à remédier aux problèmes cliniques

(Chen et al., 1990 ; Sonoda & Nakayama, 2001). Bien que les tests sérologiques soient

utilisés régulièrement dans la confirmation des cas de rougeole, les techniques de biologie

moléculaire qui nécessitent un équipement coûteux ne sont pas encore utilisées dans la routine

et restent inaccessibles dans les pays en développement.

Du point de vue épidémiologique, la rougeole est connue comme une maladie infantile

dont la cible est le plus souvent le nourrisson. Cependant, dans une population vaccinée, on

constate que les premiers cas de rougeole se déclarent chez les adolescents, puis la maladie

s’étend aux plus jeunes. Le fait que la rougeole se propage chez des adolescents pourrait

s’expliquer par le fait que :

les adolescents transmettent plus efficacement l’infection que les nourrissons. En

effet, étant donné que le virus se transmet par les gouttelettes de sécrétion

respiratoire, il a été suggéré que la mobilité élevée des adolescents, les activités

sportives et extrascolaires (soirées dansantes) auraient un rôle important dans la

transmission de la maladie dans cette tranche d’âge (Gustafson et al., 1987).

l’immunité aurait disparu avec le temps (échec secondaire de la vaccination). En

effet, plusieurs études mettent en évidence une diminution significative du taux

d’anticorps avec le temps (Weiner et al., 1977 ; Christenson & Bottiger, 1994).

Cependant, l'incidence due à la rougeole est plus faible dans les populations vaccinées

que dans les populations non vaccinées (Gustafson et al., 1987), ce qui suggère qu’une

immunité cellulaire résiduelle induite par la vaccination persiste après la disparition des

anticorps.

On se trouve ici face à un paradoxe entre la grande efficacité du vaccin contre la

rougeole et l’apparition des épidémies soutenues au sein des populations vaccinées. Ce

problème peut être résolu soit en augmentant l’efficacité du vaccin et de la couverture

vaccinale par rapport à ce qui a été précédemment estimé (Markowitz et al., 1989), soit en

appliquant une stratégie de vaccination à deux doses.

Ces observations ont amené les Etats-Unis et plusieurs pays Européens à opter pour

une stratégie de vaccination à deux doses, la première à 15 mois et la deuxième à l’âge

scolaire. Depuis, les cas de rougeole dans la population vaccinée sont rares dans ces pays

(Chen et al., 1990). Par contre, en Afrique, où les enfants reçoivent une seule dose de vaccin

42


III. Etudes épidémiologiques

3. Efficacité de la vaccination contre la rougeole

en bas âge, les cas de rougeole restent fréquents dans les populations vaccinées (Samb et al.,

1995 ; Whittle et al., 1999b).

L’occurrence simultanée des cas de rougeole atténués et d’échecs secondaires de la

vaccination suggère que l’efficacité de la vaccination serait suffisamment faible pour qu’il y

ait des épidémies dans les populations vaccinées, ce qui remet en cause les facteurs permettant

d’apprécier l’efficacité de la vaccination.

III.3. EFFICACITE DE LA VACCINATION CONTRE LA ROUGEOLE

L’infection naturelle par le virus de la rougeole confère une immunité à vie, comme il

a été montré dans les îles Féroe, quand seuls les habitants ayant contractré la rougeole au

cours d’une épidémie 65 ans auparavant ont échappé à l’infection (Panum, 1940). Cependant,

l’hypothèse selon laquelle le vaccin vivant atténué induirait une protection à vie (Krugman,

1983) a été remise en question après les épidémies de rougeole survenues chez des enfants

ayant été vaccinés 15 ans auparavant (Gustafson et al., 1987 ; Samb et al., 1995).

La vaccination contre la rougeole induit à la fois l’immunité cellulaire et l’immunité

humorale. Bien que l’immunité à médiation cellulaire ait un rôle important dans l’élimination

des cellules infectées, l’évaluation de l’efficacité de la vaccination est plutôt basée sur le

dosage des anticorps, ceci à cause de la difficulté technique à examiner l’immunité cellulaire.

III.4. REPONSE A LA VACCINATION : PRODUCTION D’ANTICORPS

La réponse à la vaccination dépend de plusieurs facteurs. Certains sont liés à l’hôte,

tels que l’âge de l’hôte, son état nutritionnel et son état de santé. D'autres sont plutôt associés

au vaccin tels que la souche de virus utilisée, la dose de vaccin, le mode d’administration et le

programme de vaccination.

III.4.1. Facteurs d’hôte

III.4.1.a. Age de l’hôte

L’un des problèmes rencontrés actuellement avec le vaccin contre la rougeole est qu’il

n’est pas efficace quand il est administré aux enfants en dessous d’un certain âge. Cette

réponse en fonction de l’âge dépend essentiellement des anticorps maternels pré-vaccinaux.

En effet, il a été montré que les enfants possédant des anticorps maternels ont de plus faibles

43


III. Etudes épidémiologiques

4. Réponse à la vaccination

taux d’anticorps post-vaccinaux que les enfants ne possédant pas d’anticorps maternels

(Markowitz et al., 1990).

Les premières études sur la décroissance des anticorps maternels ont suggéré que

ceux-ci disparaissaient vers l’âge d'un an aux Etats-Unis (Krugman et al., 1965) et vers l’âge

de six mois dans les pays en développement (MOH, 1977). Par la suite, l’emploi de tests plus

sensibles ont permis de montrer que ces anticorps persistaient plusieurs mois de plus chez

certains enfants et diminuaient l’efficacité de la vaccination (Albrecht et al., 1977). Les profils

d’anticorps maternels des nourrissons varient selon :

La durée de la gestation. Il a été montré que la grande partie du transfert

d’anticorps maternels via le placenta se fait au cours des dernières semaines de

grossesse (Toivanen et al., 1968). De ce fait, le taux d’anticorps maternels chez les

nouveau-nés est directement proportionnel à la durée de la gestation. Une étude

réalisée récemment en Inde a montré que le taux d’anticorps maternels dirigés

contre le virus de la rougeole, à la naissance, est faible chez les enfants prématurés.

De plus, ces enfants perdent plus vite leurs anticorps maternels que les enfants nés

à terme (Rau et al., 2002). Dans cette étude, tous les enfants nés avant terme

étaient séro-négatifs à l’âge de 5 mois. Une autre étude réalisée en Gambie a

montré que la prématurité est directement liée à la réduction du transfert

d’anticorps maternels contre le virus de la rougeole et d’autres agents pathogènes,

tels que le virus de la varicelle, le virus respiratoire syncytial et l’herpes simplex

virus de type 1 (Okoko et al., 2001). A cause de cette réduction du transfert

d’anticorps maternels, les enfants prématurés sont vulnérables et prédisposés aux

infections virales très tôt dans leur vie, c'est-à-dire avant l’âge de 6 mois dans le

cas de la rougeole.

Les régions géographiques. On a observé que le taux de décroissance des anticorps

maternels dans différentes populations est inversement corrélé au niveau socioéconomique

(Black et al., 1986). Ce déclin précoce des anticorps maternels dans

les pays en développement s’explique par un catabolisme accru des anticorps

passifs dû aux fréquentes infections touchant les nourrissons, une perte des

anticorps dans la lumière intestinale lors des diarrhées, de faibles taux d’anticorps

chez les mères et une moindre efficacité du passage transplacentaire des IgG

antirougeoleuses maternelles (Black, 1989). En effet, une étude comparative des

nouveau-nés allemands et des nouveau-nés nigérians a montré que le transfert des

IgG maternelles totales et spécialement le transfert d’IgG antirougeoleuses à

44


III. Etudes épidémiologiques

4. Réponse à la vaccination


l’enfant est plus efficace chez les Allemands que chez les Nigérians. Le taux

d’anticorps dirigés contre le virus de la rougeole est deux fois plus élevé chez les

enfants allemands que chez les enfants nigérians (Hartter et al., 2000). De plus, les

anticorps maternels disparaissent plus vite chez les nigérians si bien qu’à l’âge de

quatre mois, seulement 17% d’enfants nigérians sont encore protégés contre la

rougeole.

L’âge et le statut sérologique de la mère. A cause de l’utilisation de la vaccination

à grande échelle, on observe dans la population des mères qui ont une immunité

induite soit par la vaccination, soit par une infection naturelle (Kacica et al., 1995).

Il a été montré que la vaccination induit un taux d’anticorps plus faible par rapport

à l’infection naturelle (Krugman et al., 1965). Les mères immunisées par

l’infection naturelle sont en général nées avant l’introduction de la vaccination,

elles sont donc plus âgées et possèdent un taux d’anticorps élevé. Par contre, les

mères immunisées par la vaccination sont plus jeunes, ont peu d’anticorps et sont

donc prédisposées à transmettre un faible taux d’anticorps à leurs enfants

(Markowitz et al., 1996 ; Zanetta et al., 2002). En effet, des études réalisées en

Turquie ont montré que la durée de protection de l’enfant par les anticorps

maternels est proportionnellement liée au taux d’anticorps de la mère (Mentitas et

al., 2002). D’autres études réalisées sur les taux d’anticorps dans le cordon

ombilical et chez les enfants ont permis de montrer que les anticorps maternels

diminuent rapidement avec la jeunesse et le faible taux d’anticorps de la mère

(Pabst et al., 1992 ; Maldonado et al., 1995),ce qui suggère que les enfants nés de

mères vaccinées perdent plus tôt leurs anticorps maternels et sont donc

susceptibles à un très jeune âge.

Ces observations nous permettent de réaliser que le programme de lutte contre la

rougeole dans les pays en développement se trouve confronté à un réel dilemme : maintenir la

vaccination à un âge précoce, avec pour conséquence la perte de l’immunité, ou augmenter

l’efficacité du vaccin en augmentant l’âge de la vaccination, avec pour risque d’augmenter la

mortalité liée à la rougeole chez les nourrissons. Ce dilemme est de plus aggravé par la

diminution du taux d’anticorps chez les enfants nés de mères immunisées par la vaccination et

chez les enfants prématurés.

45


III. Etudes épidémiologiques

4. Réponse à la vaccination

III.4.1.b. Etat nutritionnel de l’hôte

Bien que Wesley et al., (1978) aient montré un retard de la réponse à la vaccination

contre la rougeole chez les enfants sous-alimentés, plusieurs études ont mis en évidence des

taux de séroconversion au moins aussi élevés chez les enfants souffrant de malnutrition que

chez les enfants ayant une bonne alimentation (PAHO, 1982 ; Halsey et al., 1985), ce qui veut

dire que l’état nutritionnel n’affecte pas le taux de séroconversion. Il est d’ailleurs conseillé de

vacciner en priorité les enfants sous-alimentés (WHO, 1986) car la rougeole entraîne le risque

de complications et aggrave l’état nutritionnel. En effet, il a été montré qu’il y a une perte

appréciable de protéines au niveau de l’intestin chez des enfants souffrant de malnutrition,

atteints de rougeole (Axton, 1975).

III.4.1.c. Etat de santé de l’hôte

Selon une étude réalisée aux Etats-Unis, la vaccination rougeole-oreillons-rubéole

(ROR) induit des taux de séroconversion plus faible chez des enfants âgés de 15 à 18 mois,

enrhumés, par rapport à des enfants non enrhumés (Krober et al., 1991). Ces résultats

s’opposent à ceux d’études réalisées dans les pays en développement qui montrent que la

vaccination antirougeoleuse des enfants souffrant de maladies à caractère aigu est efficace et

sans danger. En Haïti, on a constaté un taux de séroconversion chez 81% de nourrissons

enrhumés et 78% de nourrissons non enrhumés (Halsey et al., 1985) et au Rwanda, on a

observé une séroconversion chez 81% des jeunes enfants malades et 80% des nourrissons en

bonne santé (Ndikuyeze et al., 1988). On a constaté au cours d'enquêtes effectuées en Afrique

du Sud (Harris, 1979) et au Costa Rica (De-Coto, 1983) que la vaccination des enfants

malades hospitalisés a considérablement réduit l’incidence de la rougeole nosocomiale. Il est

donc conseillé de vacciner les enfants souffrant de maladies aiguës, ce qui n’est pas le cas

pour les personnes souffrant d’immunodéficience.

En effet, la vaccination antirougeoleuse est généralement contre indiquée chez les

personnes immunodéprimées à cause du risque de graves complications (ACIP, 1989),

exception faite pour les enfants infectés par le virus de l’immunodéficience humaine (VIH).

Les études de vaccination antirougeoleuse chez des sujets infectés par le VIH dans les pays en

développement à l’âge de neuf mois (Oxtoby et al., 1989), à un âge plus avancé aux Etats-

Unis (Onorato et al., 1988), et chez des adultes (Wallace et al., 1994) montrent que la réponse

anticorps est plus faible par rapport à celle des sujets sains. Cependant, aucun effet indésirable

n’ayant été constaté chez ces sujets après la vaccination, il est recommandé de vacciner les

46


III. Etudes épidémiologiques

4. Réponse à la vaccination

enfants infectés par le VIH en deux fois. La première dose à l’âge de 6 mois et la seconde à 9

mois, afin de les protéger le plus tôt possible (WHO/UNICEF, 1989).

III.4.2. Facteurs génétiques

Plusieurs études ont montré que des facteurs génétiques spécifiques affecteraient la

réponse immunitaire suite à la vaccination. Une étude comparative réalisée au Canada entre

les communautés Innu, Inuit (natifs du Canada) et les Caucasiens montre qu’après vaccination

avec une dose de ROR (Rougeole, Oreillons, Rubéole), les enfants natifs du Canada ont un

taux de séropositivité (83%) nettement supérieur à celui des Caucasiens (76%) (Poland et al.,

1999). L’hypothèse émise pour expliquer cette différence est qu’il est probable que les natifs

du Canada aient une origine immunogénétique différente et porteraient des gènes spécifiques

du complexe majeur d’histocompatibilité associés à des taux élevé d’anticorps dirigés contre

la rougeole (Poland, 1999).

Il a été montré que la capacité de chaque individu à établir une réponse immunitaire à

un antigène dépend de l’interaction entre les molécules HLA (Human Leucocyte Antigen) et

l’antigène en question (Huston, 1997). Compte-tenu du fait que des allèles différentes de la

molécule HLA se lient à différents antigènes, le polymorphisme génétique des molécules

HLA va par conséquent influencer de façon spécifique la réponse immunitaire. En effet, des

allèles spécifiques de HLA classe I et II (HLA-DRB, -DQA, -DPA et TAT) associés aux taux

d’anticorps dirigés contre la rougeole ont été définis (Hayney et al., 1996,1997). Les gènes

HLA-DPA1*0201 et HLA-DRB*03 sont fortement associés à la séronégativité (Poland et al.,

1999) tandis que les allèles HLA-B7 et –B51 sont associés à une très forte réponse au vaccin

antirougeoleux (Poland et al., 2002).

Des études similaires ont montré que les allèles HLA spécifiques ont une influence

significative sur la réponse immunitaire au vaccin contre l’hépatite B (Kruskall et al., 1992

;Davenport et al., 1995). En particulier, les allèles HLA-DR3 et HLA-B8 sont très représentés

chez les non-répondeurs au vaccin contre le virus de l’hépatite B (Vingershoets et al., 1995).

III.4.3. Facteurs associés au vaccin

La capacité du vaccin contre la rougeole à induire une réponse immunitaire varie selon

plusieurs critères dont les principaux sont la souche vaccinale et la dose de vaccin.

47


III. Etudes épidémiologiques

4. Réponse à la vaccination

III.4.3.a. La souche

Les souches vaccinales utilisées dans différentes études dérivent toutes de la souche

Edmonston (Figure 6).

- La souche Edmonston-Zagreb (EZ) a été obtenue après plusieurs passages de la

souche Edmonston B sur des cellules diploïdes humaines.

- La souche Schwarz quant à elle dérive de la souche Edmonston A après passages

supplémentaires sur des fibroblastes de poulet.

- La souche AIK-C a été obtenue après plusieurs passages de la souche Edmonston sur

les cellules d’amnios humains, les cellules de rein de mouton et sur les fibroblastes de

poulet.

Plusieurs études ont permis de comparer l’effet d’une même dose de vaccins

Edmonston-Zagreb (EZ) et Schwarz administrée par voie sous-cutanée au même âge. Elles

ont montré que le vaccin EZ induit des taux de séroconversion plus élevés que le vaccin

Schwarz (Markowitz et al., 1990, Whittle et al., 1988b). La comparaison du vaccin AIK-C

avec les vaccins EZ et Schwarz a montré que les vaccins AIK-C et EZ sont plus efficaces

chez les jeunes enfants que la souche Schwarz. En effet, les réponses sérologiques induites

par les vaccins AIK-C et EZ chez les enfants âgés de 5 mois sont identiques à celles induite

par Schwarz à l’âge de 9 mois (Tidjani et al., 1989). D’autres études réalisées en Guinée-

Bissau montrent que la souche EZ induit une bonne réponse anticorps en présence comme en

l’absence d’anticorps maternels. Tandis qu’avec la souche Schwarz, bien qu’on obtienne les

taux les plus élevés d’anticorps chez les enfants de plus de 9 mois, la réponse anticorps

induite est moins bonne en présence d’anticorps maternels (Garly et al., 2001). De plus, après

une revaccination avec la souche EZ, la réponse anticorps est augmentée, alors qu’avec la

souche Schwarz, la réponse reste inchangée. Si les souches EZ et AIK-C donnent de meilleurs

résultats, c’est peut-être parce-qu’elles ont subi des passages supplémentaires sur des cellules

humaines, ce qui n’est pas le cas pour la souche Schwarz qui a été maintenue sur des cellules

de poulet (Figure 6). D’autres études suggèrent l’existence possible d’une différence entre des

vaccins produits à partir d’une même souche par différents producteurs. Il a été montré que le

vaccin EZ produit au Mexique induisait des taux d’anticorps plus faibles que le vaccin produit

à Zagreb (Markowitz et al., 1990).

48


III. Etudes épidémiologiques

4. Réponse à la vaccination

III.4.3.b. La dose

Des études réalisées chez des nourrissons possédant encore des anticorps maternels

ont montré que les taux de séroconversion augmentent avec la dose de vaccin. Dans une

étude réalisée en Gambie, l’utilisation de vaccins contenant 4.10 4 pfu par dose a entraîné un

taux de séroconversion de 100%. Par contre, avec un vaccin contenant seulement 10 4 pfu par

dose, on a un taux d’échec de 25% (Whittle et al., 1988a). Cependant, l’effet d’augmentation

de la séroconversion est moins marqué avec le vaccin Schwarz qu’avec le vaccin EZ (Whittle

et al., 1988b ; Markowitz et al., 1990).

III.4.3.c. Le mode d’administration

Bien que la mémoire systémique soit de longue durée, la mémoire immunologique

muqueuse est par contre de plus courte durée. De ce fait, l'infection des voies muqueuses est

possible malgré l'existence d'une immunité systémique chez un sujet vacciné. Le vaccin actuel

est administré par voie sous-cutanée et se trouve confronté aux anticorps maternels.

L’administration du vaccin par voie nasale ou en aérosol pourrait en principe stimuler de

façon plus efficace la production d’IgA sécrétoires assurant une immunité locale en cas

d’infection (Ogra et al., 1980). Dans la plupart des études, l’administration du vaccin en

aérosol a entraîné des taux de séroconversion identiques à ceux qui sont obtenus avec une

vaccination par voie sous-cutanée (Whittle et al., 1984).

L’administration du vaccin par voie nasale a donné de bons résultats en Yougoslavie

(Beck et al., 1986), en revanche, lors d’une étude réalisée au Kenya, elle a entraîné de faibles

taux de séroconversion (Kok et al., 1983). La vaccination par voie sous-cutanée reste à ce jour

le seul mode de vaccination conseillé.

III.4.4. Facteurs liés au programme de vaccination

La faible efficacité du vaccin pourrait dans certains cas être due à un mauvais maintien

de la chaîne de froid (Cutts et al., 1990b). De même, les variations de volumes de vaccin

administré avec les injecteurs à air comprimé peuvent aussi réduire l’efficacité du vaccin

(Wassilak et al., 1985).

Ces différents facteurs diminuent ou inhibent la production d’anticorps. Cependant,

dans le cas où il y aurait production d’anticorps, on peut se poser la question de savoir si la

production d’anticorps chez un individu signifie qu'il est protégé. Si oui quelle est la durée de

la protection?

49


III. Etudes épidémiologiques

5. Protection conférrée par la vaccination

III.5. PROTECTION CONFEREE PAR LA VACCINATION

Pour évaluer l’efficacité de la vaccination contre la rougeole, on regarde la proportion

de personnes vaccinées protégées contre la maladie et la durée de cette protection. Pour

définir la protection contre la maladie, on tient compte de deux aspects :

- l’aspect sérologique, où l'on considère la séroconversion qui suit la vaccination

comme équivalente à la protection contre la maladie.

- l’aspect épidémiologique, où l'on estime l’efficacité du vaccin comme le pourcentage

de réduction de l’incidence de la maladie pouvant être imputé à la vaccination.

Des études sérologiques ont mis en évidence des taux de séroconversion allant de 95 à

98% (Yeager et al., 1977). Certaines études sur le terrain concernant l’efficacité du vaccin

estiment que la protection est de 85% environ (Hull et al., 1983). Elle est encore plus faible

lorsque l’on constate de mauvaises pratiques de vaccination (Cutts et al., 1990a). Ces résultats

sont inférieurs aux taux de séroconversion cités ci-dessus et aux estimations de l’efficacité du

vaccin (Davis et al., 1987). Au vu de ces résultats, nous pouvons dire que séroconversion

n’est pas synonyme de protection. Il existerait un taux protecteur d’anticorps en dessous

duquel l'individu n’est pas protégé.

III.5.1. Taux protecteur d’anticorps

Les anticorps produits après immunisation sont dirigés contre différents antigènes. Les

anticorps dirigés contre les protéines F et H sont neutralisants et sont donc directement liés au

niveau de protection. Cependant, comme la protéine N est la plus abondante et est très

antigénique, le taux d’anticorps dirigé contre cette protéine est en général plus élevé, mais ces

anticorps ne sont pas protecteurs contre l’infection.

Différents tests sérologiques ont été développés pour déterminer le taux d’anticorps

protecteur. Le test d’inhibition de l’hémagglutination, le plus communément utilisé, s’est

avéré peu sensible et pas adapté à un grand nombre d’échantillon (Enders-Ruckle, 1965). Le

test de neutralisation des plaques et le test ELISA sont plus sensibles que le premier (Albrecht

et al., 1981 ; Kirsten et al., 1984) et sont de plus en plus utilisés. Bien que le test ELISA soit

plus facile, rapide (résultats dans les 3 heures qui suivent la réception du sérum) et moins

cher, il est cependant moins spécifique et risque d’avoir moins de corrélation avec la

protection.. En effet, le test ELISA mesure l’ensemble des anticorps dirigés contre toutes les

protéines virales et reflète donc l’abondance des anticorps dirigés contre la protéine N. Ce test

50


III. Etudes épidémiologiques

5. Protection conférrée par la vaccination

indique la présence d’une réponse humorale, mais ne reflète pas directement le niveau de

protection. Par contre, le test de neutralisation mesure spécifiquement le taux d’anticorps

neutralisants, mais ce test présente des inconvénients car il requiert un laboratoire adapté pour

les cultures cellulaires et de ce fait n’est pas pratique pour les pays en développement. De plus

il faut au minimum 10 jours pour obtenir des résultats.

Le taux d’anticorps protecteur varie en fonction de la technique utilisée, ce qui cause

un problème de standardisation. Des études utilisant le test de neutralisation des plaques

suggèrent qu’un titre en anticorps inférieur à 120 ne serait peut-être pas protecteur (Chen et

al., 1990). Afin de faciliter la normalisation des tests sérologiques, le PEV recommande

d’analyser en parallèle les sérums à tester et les sérums de référence étalonnés avec le sérum

antirougeoleux de référence international. On pourra ainsi convertir les résultats du test en

unités internationales. Le développement de tests de plus en plus sensibles a soulevé le

problème de la signification clinique des faibles taux d’anticorps. Des études ont mis en

évidence, avec le test de neutralisation des plaques, des taux d’anticorps avant exposition au

virus significativement plus faibles chez des personnes présentant quelques symptômes

(fièvre, toux) que chez celles qui en avaient aucun. Ces résultats suggèrent qu’un certain taux

d’anticorps avant exposition protégerait contre la rougeole classique, mais pas contre la

rougeole atténuée ou cliniquement silencieuse (Chen et al., 1990).

III.5.2. Durée de la protection

Plusieurs enquêtes prospectives ont analysé la persistance des anticorps après la

vaccination rougeoleuse et ont permis de montrer que plus de 85% des personnes vaccinées

possédaient des anticorps 8 à 16 ans après la vaccination (Krugman, 1983 ; Dai et al., 1991).

Cependant, le taux d’anticorps diminuerait avec le temps (Christenson & Bottiger, 1994). En

effet, lors d’une étude effectuée en Chine, on a observé une diminution des anticorps pendant

les quatre années suivant l’administration du vaccin. Huit ans après la vaccination, 12,9% des

sujets n’avaient pas d’anticorps détectables (Xiang & Chen, 1983). La durée de protection

dépend de plusieurs facteurs tels que le taux d’anticorps post-vaccinal, la région

géographique, le niveau de restimulation du système immunitaire.

La diminution du taux d’anticorps serait plus ou moins accentuée en fonction de la

région géographique. Des études ont montré un déclin précoce du taux d’anticorps chez les

Africains, notamment dans les zones où la malaria est endémique. Les avis sont mitigés sur le

rôle de la malaria dans le déclin des anticorps. Il a été montré que la malaria diminue la

51


III. Etudes épidémiologiques

5. Protection conférrée par la vaccination

réponse à la vaccination (Greenwood & Whittle, 1981) et que la durée de vie des globulines

est plus courte chez les Gambiens que chez les enfants en Europe (Cohen et al., 1961). Par

contre, Whittle et al., (1999a) ont montré que le taux d’anticorps contre la rougeole 5 à 7 ans

après la vaccination varie en fonction de la saison pendant laquelle les prélèvements sanguins

sont effectués. Il augmente en saison de pluies et diminue en saison sèche, ce qui laisse penser

que la malaria et les autres infections fréquentes auraient un rôle dans cette fluctuation de la

réponse anticorps. En effet, il a été montré que la réponse anticorps au vaccin contre la

rougeole augmente chez les enfants infectés par le plasmodium falciparum (Smedman et al.,

1986).

Il est possible que la diminution des anticorps évolue jusqu'à la disparition de ceux-ci,

laissant le sujet à nouveau susceptible à l’infection. Il a été rapporté des cas cliniques de

rougeole chez des individus présentant une séroconversion après la vaccination. On parle dans

ce cas d’échecs secondaires de la vaccination (Reyes et al., 1987 ;Mathias et al., 1989). Si des

cas d’échec secondaires de la vaccination sont rapportés un peu partout dans le monde, leur

proportion en revanche paraît faible : 2% lors d’une étude en Chine (Zhuji, 1987) et 5% lors

d’une étude au Canada (Mathias et al., 1989). Les échecs secondaires de la vaccination

seraient plus fréquents chez ceux qui ne développent que de faibles taux d’anticorps après la

vaccination. En effet des études menés aux Etats-Unis ont permis de montrer que l’échec

secondaire de la vaccination était plus fréquent parmi les enfants vaccinés avant l’âge d’un an

que chez les enfants vaccinés plus tard (Smith et al., 1982).

La durée de l’immunité varie en fonction de la stimulation du système immunitaire.

Lorsque les titres d’anticorps contre la rougeole deviennent faibles, une nouvelle exposition

aux virus (sauvage ou vaccinal) stimule les cellules B mémoires. Celles-ci sont la base de la

mémoire humorale de longue durée (Jerne, 1984). Il a été suggéré qu’une stimulation

antigénique régulière est nécessaire pour la mémoire à long-terme des cellules B (Gray &

Skarvall, 1988). Suite à la stimulation, les cellules B se différencient en plasmocytes qui

synthétisent et sécrètent les anticorps. Il se produit alors une réponse immunitaire spécifique

de la rougeole, lors de laquelle les concentrations en IgG s’élèvent rapidement et atteignent un

maximum environ 12 jours après la réinfection (Schluederberg et al., 1973). Il existe plusieurs

types de stimulations ;

- La stimulation naturelle qui se produit lorsque des personnes ayant un faible taux

d’anticorps sont exposées au virus sauvage. Dans la majorité des cas, la réinfection par

le virus sauvage se traduit seulement par une stimulation de la production d’anticorps

sans manifestations cliniques (Krugman, 1983 : Whittle et al., 1999b). Ce type de

52


III. Etudes épidémiologiques

5. Protection conférrée par la vaccination

stimulation est le plus fréquent dans les pays en développement où la population est en

contact permanent avec le virus sauvage. L’immunité persiste probablement au moins

durant la période où le risque de mortalité est le plus important.

- La revaccination introduite suite à l’apparition des épidémies fréquentes de rougeole

dans la population vaccinée. Elle est pratiquée dans les pays industrialisés où le virus

sauvage se fait de plus en plus . La durée de cette seconde réponse immunitaire n’est

pas connue. Cependant, des études montrent que chez des personnes ayant déjà été

victimes d’une chute du taux d’anticorps, le taux d’anticorps retrouve son niveau

initial un an après la revaccination (Deseda-Tous et al., 1978).

- La stimulation du système immunitaire par d'autres virus. La réponse cellulaire des

lymphocytes T est limitée à un certain nombre de cellules. Les cellules T mémoires

pour un virus donné seront réduites suite à l'infection par un virus différent (Selin et

al., 1999). Par contre, l'infection par un virus apparenté augmente la mémoire T. Il

apparaît ainsi qu'un système immunitaire efficace est capable de maintenir un

équilibre en partageant l'espace entre deux mécanismes : soit la délétion d'une portion

de cellules T CD8 mémoires, soit la préservation des cellules T CD8 mémoires crossréactives.

La stimulation naturelle serait plus efficace que la revaccination qui n’induit qu’une

réponse de courte durée spécialement chez les enfants qui ont été vaccinés très tôt dans

l’enfance (Stetler et al., 1986). Dans l’un et l’autre cas, la réponse à la stimulation est

inversement proportionnelle au taux d’anticorps préexistants (Christenson & Bottiger, 1994).

Au regard de toutes ces études,nous pouvons dire que l’immunité acquise par le vaccin

contre la rougeole semble être un continuum, allant d’une protection totale et durable à une

protection minimale ou nulle, en passant par une protection partielle ou temporaire. Cette

flexibilité de la réponse immunitaire est responsable de la circulation occulte du virus de la

rougeole dans la population vaccinée. Ce virus qui se propage sans donner de signes cliniques

a probablement subi une immunosélection et contribue à la diversité antigénique et génétique

du virus de la rougeole.

53


IV. Epidémiologie moléculaire du VR

1. Variabilité antigénique du VR

CHAPITRE IV. EPIDEMIOLOGIE

MOLECULAIRE DU VIRUS DE LA ROUGEOLE

IV.1. VARIABILITE ANTIGENIQUE DU VIRUS DE LA ROUGEOLE

Le virus de la rougeole est considéré comme antigéniquement stable. Du point de vue

sérologique, le virus est monotypique puisqu'une seule infection induit une immunité à vie.

Les sérums des personnes infectées des décennies plus tôt conservent leur capacité à

54


IV. Epidémiologie moléculaire du VR

1. Variabilité antigénique du VR

neutraliser les différentes souches de virus sauvages. De même, le sérum de personnes

infectées récemment neutralise les souches vaccinales et les souches sauvages. Cependant, le

virus de la rougeole est un virus à ARN simple brin. La réplication du génome qui se fait via

une ARN polymérase est un processus qui comporte un taux d’erreurs élevé et ne possède

aucune capacité de correction (Holland et al., 1982). De ce fait, il est possible qu’il y ait un

certain degré de mutations. En effet, des variations ont été décrites dans les gènes N, H et F

grâce à l’utilisation des anticorps monoclonaux (Sheshberadaran & Norrby, 1986 ; Giraudon

et al., 1988 ;Fayolle et al., 1999).

La protéine N du virus de la rougeole possède des hétérogénéités antigéniques. Il a été

rapporté des variations antigéniques au niveau de la protéine N entre la souche vaccinale

Rouvax et des souches sauvages isolées en Afrique (Giraudon et al., 1988). Ces variations

seraient situées dans la partie C-terminale de la protéine.

Les glycoprotéines de surface du virus de la rougeole ont des propriétés biologiques et

immunologiques importantes : la protéine H est responsable de l’attachement du virus à la

cellule-hôte et la protéine F joue un rôle dans la fusion des membranes cellulaires et virales,

permettant l’entrée du virus dans la cellule-hôte (Wild et al., 1994 ; Wild & Buckland, 1995).

Les anticorps dirigés contre ces protéines sont indispensables pour la protection contre

l’infection (Varsanyi et al., 1987). Il a été montré que les anticorps murins dirigés contre ces

deux protéines neutralisent l’infectivité du virus in vitro et protègent passivement in vivo

(Malvoisin & Wild, 1990 ; Giraudon & Wild, 1985). De même, les sérums de patients

convalescents ont des activités neutralisantes dirigées contre ces deux antigènes (Sato et al.,

1989). Ainsi, pour échapper au système immunitaire, le virus doit être muté au niveau de ces

deux antigènes.

- La protéine F est connue comme étant la protéine la plus stable. Des mutations ont été

rapportées au niveau de trois acides aminés seulement pendant 40 ans (Rota et al.,

1992). Cependant, des mutations antigéniques ont récemment été décrites dans la

protéine F d’une souche sauvage isolée chez un patient après un séjour en Afrique de

l’Ouest (Fayolle et al., 1999). Cette variation se situe au niveau d’un épitope majeur

localisé sur le fragment F2 de la protéine. Les résultats de cette étude suggèrent qu’il y

aurait une pression immuno-sélective qui favoriserait l’émergence des virus mutés dans la

protéine F, ce qui permettrait l'infection par le virus en présence d’anticorps induits par la

vaccination. Cette observation étant un cas unique, des études supplémentaires sont

requises pour voir si de telles souches sont spécifiques à l’Afrique où si elles sont plus

globalement réparties.

55


IV. Epidémiologie moléculaire du VR

2. Variations génétiques du VR

- La protéine H est, contrairement à la protéine F, l’une des protéines du virus de la

rougeole pour laquelle des mutations antigéniques sont régulièrement décrites

(Sheshberadaran & Norrby, 1986 ; Tamin et al., 1994). Compte-tenu de son rôle dans

le cycle viral, c’est probablement la première protéine sujette à une modulation

immunologique. Des études de vaccination expérimentales avec les recombinants de

la vaccine ont permis de montrer que des mutations d’acides aminés sont responsables

des changements de propriétés antigéniques du virus (Drillien et al., 1988).

La contribution des variations antigéniques dans l’épidémiologie de la rougeole n’est

pas bien connue. Il a été suggéré que les souches de virus antigéniquement différentes

émanent d’une sélection immune au cours de la réplication du virus chez des enfants

partiellement protégés (Fayolle et al., 1999). D’après Webster & Laver, (1980), la sélection

immunologique de variants résistant à la neutralisation est responsable des mutations

antigéniques du virus influenza A dans la population humaine.

Il est possible que les changements antigéniques associés aux échecs de la vaccination

favorisent l’augmentation de l’infection et la transmission de la rougeole au sein de la

population vaccinée. Il est impératif d’approfondir les études sur les réponses

immunologiques et les changements au cours de l’infection induits par les variations

antigéniques. Ces données seront indispensables dans l’orientation future de la stratégie de

vaccination.

IV.2. VARIATIONS GENETIQUES DU VIRUS DE LA ROUGEOLE

Si l’on estime qu’il n’existe qu’un seul sérotype de virus de la rougeole, le séquençage

a toutefois montré que des lignées distinctes de virus sauvages existent et co-circulent (WHO,

1998). Parmi les 6 gènes que compte le génome viral, les gènes H et N sont les plus variables.

La variabilité nucléotidique atteint 7% pour les gènes H et N. Cependant, la région la plus

variable du génome du virus de la rougeole est la séquence de 456 nucléotides codant pour

l’extrémité C-terminale de la protéine N, dans laquelle la variabilité nucléotidique est parfois

voisine de 13,6% d’un virus sauvage à l’autre (Mulders et al., 2001). Le séquençage de

plusieurs virus sauvage a été réalisé, ce qui a permis de les classer dans divers groupes

génétiques.

56


IV. Epidémiologie moléculaire du VR

3. Classification génétique du VR

IV.3. CLASSIFICATION GENETIQUE DU VIRUS DE LA ROUGEOLE

La classification génétique du virus de la rougeole était jusqu’ici basée soit sur les 456

nucléotides de la partie C-terminale du gène de la nucléoprotéine, soit sur le gène entier de

l’hémagglutinine. Actuellement, l’OMS exige que la classification soit obligatoirement basée

sur les deux gènes (WHO, 2001a). Le choix de ces deux gènes pour la classification est non

seulement basé sur le fait que ce sont les gènes les plus variables, mais aussi sur le fait que la

topologie de l’arbre phylogénétique obtenu est analogue pour les gènes H et N. Les

différentes souches de virus ont été classifiées en huit clades. Les clades sont désignés par les

lettres A à H. Ces clades sont subdivisés en génotypes, il existe actuellement 21 génotypes

(tableau génotypes). Certains clades ne comportent qu’un seul génotype et la désignation du

clade et du génotype est alors identique (clade A= génotype A). D’autres, comme le clade D,

sont représentés par plusieurs génotypes désignés par la lettre du clade suivie d’un numéro

pour le génotype (D1, D2,…). Une souche de référence a été assignée à chaque génotype et

représente le premier isolat de chaque génotype.

La définition des génotypes et la démarcation entre différents clades sont basées sur la

divergence génétique entre les différents groupes. La divergence génétique dans la partie C-

terminale de la protéine N est comprise entre 1,7% pour les virus du clade A et 9,6% pour les

virus des clades C et D. La variation à l’intérieur d’un génotype varie entre 1,7% pour le

génotype A et 6% pour le génotype C1 (Mulders et al., 2001). L’OMS a récemment établi des

critères que devront remplir les nouveaux génotypes. Il en ressort qu’une différence

nucléotidique minimale de 2,5% pour la partie C-terminale de la protéine N et de 2% pour le

gène H entier, par rapport à la souche la plus étroitement apparentée, est requise pour la

désignation de nouveaux génotypes (WHO, 2001a).

57


IV. Epidémiologie moléculaire du VR

3. Classification génétique du VR

Tableau 2 : Souches de référence utilisées pour l'analyse phylogénétique des souches sauvages du

virus de la rougeole.

Génotype Etat Souches de référence (MVI) a Numéro d'accès à Genbank

Gène H Gène N

A Actif Edmonston-wt.USA/54 U03669 U01987

B1 Actif Yaounde.CAE/12.83 "Y14" AF079552 U01998

B2 Actif Libreville.GAB/84 "R96" AF079551 U01994

B3 Actif New York.USA/94 L46752 L46753

Ibandan.NIE/97/1 AJ239133 AJ232203

C1 Actif Tokyo.JPN/84/K AY047365 AY043459

C2 Actif Maryland.USA/77 "JM" M81898 M89921

Erlangen.DEU/90 "WTF" Z80808 X84872

D1 Inactif Bristol.UNK/74 (MVP) Z80805 D01005

D2 Actif Johannesburg.SOA/88/1 AF085198 U64582

D3 Actif Illinois.USA/89/1 "Chicago-1) M81895 U01977

D4 Actif Montreal.CAN/89 AF079554 U01976

D5 Actif Palau.BLA/93 L46757 L46758

Bangkok.THA/93/1 AF009575 AF079555

D6 Actif New Jersey.USA/94/1 L46749 L46750

D7 Actif Victoria.AUS/16.85 AF247202 AF243450

Illinois.USA/50.99 AY043461 AY037020

D8 Actif Manchester.UNK/30.94 U29285 AF280803

E Inactif Goettingen.DEU/71 "Braxator" Z80797 X84879

F Inactif MVs/Madrid.SPA/94 PESS Z80830 X84865

G1 Inactif Berkeley.USA/83 AF079553 U01974

G2 Actif Amsterdam.NET/49.97 AF171231 AF171232

g3 b Actif MVs/Victoria.AUS/24.99 AF353621 AF353622

H1 Actif Hunan.CHN/93/7 AF045201 AF045212

H2 Actif Beijing.CHN/94/1 AF045203 AF045217

a Désignation OMS. Les autres désignations utilisées dans les publications sont indiquées entre guillemets.

b Nouveau génotype proposé dans l'attente de l'isolement de la souche de référence.

58


IV. Epidémiologie moléculaire du VR

4. Distribution géographique des génotypes

IV.4. DISTRIBUTION GEOGRAPHIQUE DES DIFFERENTS GENOTYPES

Bien que certains génotypes soient localisés dans une région géographique déterminée,

d’autres en revanche circulent partout dans le monde. Le clade A est constitué des souches

vaccinales et des souches sauvages dont elles dérivent (Rota et al., 1994). Ce fut

probablement le génotype majeur connu avant l’introduction de la vaccination dans les années

60. Des virus appartenant au clade A ont récemment été isolés aux Etats-Unis (Rota et al.,

1994), en Angleterre (Outlaw & Pringle, 1995), en Afrique du Sud (Kreis et al., 1997) et en

Russie (Santibanez et al., 1999), suggérant que ce génotype a circulé de façon continue

pendant plusieurs décennies. Le clade B comprend les génotypes B1, B2 et B3 et les isolats

appartenant à ce clade sont retrouvés uniquement en Afrique Centrale et en Afrique de

l’Ouest (Taylor et al., 1991 ; Hanses et al., 1999). Le Clade C constitué des génotypes C1 et

C2 est présent en Europe et au Japon (Hanses et al., 2000, Rima et al., 1997). Les virus du

clade D sont retrouvés dans plusieurs continents. Ce clade est subdivisé en génotypes D1 à

D8. Le génotype D1 est inactif (il n'a plus été retrouvé depuis 1974). Bien que les génotypes

D2 et D4 soient les génotypes les plus fréquemment détectés dans les parties australe et

orientale du continent africain (Kreis et al., 1997), des virus appartenant au génotype D2 ont

été détectés récemment en Irlande et le génotype D4 a été associé à des cas de rougeole

importés d’Inde (Truong et al., 2001). Les clades E et F sont inactifs. Le Clade G a aussi été

considéré comme inactif jusqu'à ce que récemment, des virus appartenant aux génotypes G2

et G3 soient isolés en Indonésie et en Malaisie (Rota et al., 2000 ; Truong et al., 2001). Les

virus appartenant au clade H sont le plus souvent retrouvés en Chine. La diversité des

génotypes est plus élevée dans les régions où la transmission du virus s’est interrompue

comme aux Etats-Unis.

IV.5. L’EPIDEMIOLOGIE MOLECULAIRE COMME OUTIL DE CONTROLE DE LA

STRATEGIE DE VACCINATION

L’épidémiologie moléculaire se définit comme l’analyse comparative de séquences

appliquée à l’étude de la propagation d’une maladie au sein de la population. L’étude de

l’épidémiologie moléculaire du virus de la rougeole a apporté une contribution importante aux

efforts de lutte contre la rougeole en offrant un moyen :

59


IV. Epidémiologie moléculaire du VR

5. Epidémiologie moléculaire : outil de contrôl

- d’identifier la source et les voies de transmission du virus

- d’observer les modifications des génotypes viraux au cours du temps dans une région

donnée

- de documenter l’interruption de la transmission du virus de la rougeole

- d’évaluer l’efficacité des programmes de vaccination

Dans le cadre de la lutte contre la rougeole, la surveillance virologique a permis de

constater, qu’avec le temps, les génotypes régionaux ou endémiques changent à cause d’une

réintroduction continue du virus de la rougeole dans les régions où le virus endogène a été

éliminé. Il en résulte une diversité de génotypes comme c’est les cas aux Etats-Unis et en

Europe (Rima et al., 1995).

Dans les pays où les campagnes de vaccination soutenues ont permis d’éliminer ou de

réduire considérablement les cas de rougeole, l’épidémiologie moléculaire permet de faire la

différence entre les cas de rougeole causés par un virus endémique et ceux qui sont causés par

un virus importé. L’étude des souches de virus responsables de l’épidémie de rougeole

survenue au Luxembourg en 1996 a montré qu’ils appartenaient au génotype C2. La

comparaison des séquences de la partie C-terminale de la protéine N a montré une variabilité

nucléotidique de 0,2% (Hanses et al., 2000) parmi ces virus. Cependant, en 1997 il y a eu

plusieurs cas sporadiques de rougeole dans ce pays, laissant croire que le virus continue de

circuler de façon persistante dans la population. Bien que les virus responsables des cas

sporadiques appartiennent au même génotype que ceux de l’année précédente, la variabilité

nucléotidique entre les échantillons de 1996 et 1997 était 4 fois supérieure à celle qui a été

observée parmi les virus de 1996. Ce qui veut dire que les virus responsables des épidémies

de 1996 n’étaient pas impliqués dans l’apparition des cas sporadiques de 1997. Il apparaît que

la circulation des virus responsables de l’épidémie de 1996 s’est arrêtée et que les cas de

rougeole sporadiques étaient dus à une réintroduction du virus.

Aux Etats-Unis où le virus de la rougeole est devenu rare à cause des efforts de

vaccination intenses, la surveillance des cas de rougeole entre 1994 et 2000 n’a pas permis de

détecter de transmission d’un génotypesauvage. Par contre, la diversité des génotypes détectés

au cours de ces 7 dernières années (11 génotypes) indique l’existence de multiples sources

d’importation du virus (WHO, 2001b). Parmi les 100 cas de rougeoles rapportés aux Etats-

Unis en 1999, 66 ont été identifiés comme des cas importés (CDC, 2000). Grâce à

l’épidémiologie moléculaire, l’origine des virus impliqués dans les épidémies de rougeole

survenus aux Etats-Unis en 1994 a pu être identifiée. Il a été montré que ces virus provenaient

60


IV. Epidémiologie moléculaire du VR

6. Application des campagnes de vaccination

de différentes origines parmi lesquelles l’Angleterre, le Japon, le Kenya. Ce qui explique la

diversité génétique observée (5 génotypes) (Rota et al., 1996). De même, la diversité des

génotypes détectés en Australie, au Canada, et au Royaume-Uni est analogue à celle qui est

observée au Etats-Unis ce qui laisse supposer des importations fréquentes et l’absence de

souches endémiques (WHO, 2001b).

Dans les pays où la rougeole est endémique, l’épidémiologie moléculaire s’avère être

un outil majeur de suivi de l’impact des campagnes de vaccination. En effet, l’interruption de

la circulation du virus grâce aux campagnes de vaccination peut être démontrée en comparant

les séquences des virus isolés avant les campagnes de vaccination avec celles des isolats

obtenus après la vaccination. L’OMS recommande donc de procéder à une surveillance

virologique en toutes régions, avant de mettre en œuvre des programmes de vaccination

accélérés. L’épidémiologie moléculaire donne la possibilité de savoir s'il y a un lien

épidémiologique entre les cas de rougeole et si le virus continue à être transmis dans les

régions couvertes par la campagne de vaccination ou alors si les cas de rougeole sont

indépendants et dus à une réintroduction du virus. Contrairement aux Etats-Unis où l'on

observe une diversité génétique élevée, la surveillance virologique dans les pays où la

transmission de la rougeole est endémique indique la présence d’un nombre limité de

génotypes endémiques (WHO, 2001b). En Afrique Centrale et Afrique de l’Ouest, seuls les

virus appartenant au clade B ont été détectés depuis 20 ans.

IV.6. APPLICATION DES CAMPAGNES INTENSIVES DE VACCINATION

Il y a 15 ans, la rougeole était l’agent pathogène le plus meurtrier dans le monde avec

3 millions de morts par an. De nos jours, elle reste l’une des causes majeures de mortalité et

de morbidité chez les enfants. On estime qu’environ 880000 enfants sont décédés de suites de

rougeole en l’an 2000 (GAVI, 2000). Le but principal du programme de lutte contre la

rougeole est d’éliminer la circulation du virus dans la population. Cependant, un objectif

intermédiaire est de réduire la transmission du virus de manière à empêcher les épidémies.

Les stratégies mises en place pour atteindre ces objectifs varient, allant de l’augmentation des

services de vaccination de routine aux campagnes spéciales de vaccination de masse. Ces

différentes stratégies ont été appliquées par plusieurs pays. Les expériences de la Gambie, des

Etats-Unis et de Cuba font partie des premiers succès de lutte contre la rougeole.

61


IV. Epidémiologie moléculaire du VR

6. Application des campagnes de vaccination

IV.6.1. La Gambie

La Gambie, pays d’Afrique de l’Ouest, fut le premier pays au monde à interrompre la

transmission de la rougeole. La campagne de vaccination fut introduite pour la première fois

en 1967 en tant que partie intégrante du programme ouest-africain d’éradication de la variole

(Foster & Pifer, 1971). La stratégie de la campagne incluait des programmes de vaccination

village après village menés par des équipes mobiles. Tous les enfants âgés de 6 mois à 4 ans

furent vaccinés. Des campagnes supplémentaires permirent de vacciner les enfants ayant

échappé à la vaccination. La couverture vaccinale atteignait 96% et la transmission de la

rougeole fut interrompue dans l’année suivant le début du programme. Aucun cas de rougeole

n’a été signalé de 1968 à 1970 (Foege, 1971).

Malheureusement, le programme de contrôle de la rougeole n’a pas été maintenu,

favorisant la réintroduction de la rougeole à partir des pays voisins et elle s’installa comme

maladie endémique en 1972 (Williams & Hull, 1983 ; Thacker & Millar, 1991). Trois causes

majeures sont attribuées à cet échec : i) le manque d’infrastructure hospitalière pour identifier

et immuniser de nouveaux individus susceptibles ; ii) le manque de personnel pour maintenir

les opérations sur le terrain ; iii) l’approvisionnement inadéquat du vaccin.

Dans les années qui ont suivi, la Gambie a développé un service intensif de santé

mère-enfant. Dix-huit centres fixes et environ cent cliniques ont été créés, avec pour but de

diminuer la morbidité et la mortalité infantile. Grâce à ces efforts, les cas de rougeole ont

considérablement diminué. Entre 1977 et 1979, 6.110 cas de rougeole ont été rapportés. En

1981, il y a eu seulement 274 cas, soit une réduction de 86,5%. La Gambie a été le premier

pays à montrer que l’élimination de la rougeole est techniquement faisable.

IV.6.2. Les Etats-Unis

L’utilisation du vaccin contre la rougeole aux Etats-Unis débute en 1963. La

population adopte facilement le vaccin et il est utilisé à large échelle. Bien que les cas de

rougeole aient diminué dans la population, on compte de 1970 à 1975, 36000 hospitalisations

de cas de rougeole (Hinman et al., 1983).

En 1978, les Etats-Unis déclarent comme objectif l’élimination de la transmission du

virus endogène pour 1982 (Hinman et al., 1979). La stratégie de base consiste à augmenter la

couverture vaccinale avec une seule dose de vaccin, ainsi que la surveillance de la rougeole, et

à contrôler les épidémies. De plus, la vaccination est obligatoire pour l’entrée à l’école.

Cependant, plusieurs enfants en âge préscolaire, surtout ceux qui vivent dans les quartiers

62


IV. Epidémiologie moléculaire du VR

6. Application des campagnes de vaccination

pauvres, n’ont pas été vaccinés. Bien que le nombre de cas de rougeole ait diminué, la

maladie continue à sévir aussi bien chez les enfants non vaccinés que chez les enfants ayant

eu un échec de vaccination.

Entre 1989 et 1991, une grande épidémie de rougeole survient aux Etats-Unis, 55000

cas et 123 décès sont rapportés (Atkinson et al., 1992). En réponse à cette reprise de la

maladie, plusieurs changements ont lieu dans la stratégie de lutte contre la rougeole ;

- 1989 : introduction d’une seconde dose de vaccin afin d’éviter des cas de rougeole

dans la population scolaire vaccinée (CDC, 1989)

- 1990 : augmentation des services de vaccination pour les enfants en âge pré-scolaire

vivant dans les cités pauvres, afin d’éviter les cas de rougeole dans ces populations

(NVAC, 1991)

La mise en œuvre du plan de vaccination à deux doses et l’augmentation de la

couverture vaccinale pour les enfants en âge pré-scolaire a conduit à l’augmentation de

l’immunité dans la population. Il en résultent une diminution du nombre de cas de rougeole, si

bien qu’en 1993, seulement 312 cas de rougeole furent rapportés. C’est le nombre de cas de

rougeole le plus bas jamais rapporté depuis le début de la surveillance de la rougeole aux

Etats-Unis en 1912. Vers la fin de l’année 1993, aucun cas de rougeole n’a été rapporté

pendant 6 semaines consécutives (CDC, 1993). Cependant, en 1994 on observa une

augmentation des cas de rougeole (958 cas). L’épidémiologie moléculaire a révélé que les

virus qui circulaient en 1994 étaient importés et étaient différents de ceux qui circulaient entre

1989 et 1990 (Rota et al., 1996). Ces résultats suggèrent que la transmission de la rougeole a

été interrompue aux Etats-Unis en 1993.

IV.6.3. L’Amérique du Sud

Plusieurs pays d’Amérique du Sud ont appliqué des campagnes de vaccination

similaires pour lutter contre la rougeole.

A Cuba, la stratégie de contrôle de la rougeole a été appliquée pour la première fois

entre 1971 et 1979. Elle consistait à vacciner les enfants âgés de 6 mois à 5 ans, mais la

couverture vaccinale était faible et plusieurs épidémies se sont déclarées pendant cette

période. De 1980 à 1985, la stratégie fut modifiée et la nouvelle stratégie consistait en la

vaccination des enfants âgés de 9 mois à 14 ans (Molinert et al., 1993). Une couverture

vaccinale de 77 % fut atteinte, mais les épidémies continuèrent avec plus de 23000 cas de

rougeole en 1983.

63


IV. Epidémiologie moléculaire du VR

6. Application des campagnes de vaccination

En 1986, une nouvelle stratégie basée sur l’expérience de la Gambie fut lancée à Cuba.

Une campagne de vaccination de masse fut conduite, ciblant tous les enfants de 1 à 14 ans

sans tenir compte de leur statut vaccinal, ni de l’existence d’une rougeole préalable. Une

couverture vaccinale de 98% fut atteinte et le nombre de cas de rougeole diminua rapidement.

Entre 1989 et 1992, seulement 20 cas de rougeole furent rapportés par an (PAHO, 1995).

D’autres pays d’Amérique du Sud ont suivi Cuba. Au Chili, une campagne de

vaccination de masse fut conduite en 1992, ciblant les enfants âgés de 9 mois à 15 ans

(Jimérez-de-la-Jara et al., 1995). La couverture vaccinale fut de 99%. Un système de

surveillance fut établi avec un rapport hebdomadaire des cas de rougeole. En 1993, un seul

cas de rougeole importé du Venezuela a été rapporté. Entre 1993 et 1996, aucun cas de

rougeole n’a été rapporté au Chili. Une stratégie similaire a été appliquée au Brésil en 1992,

où les enfants âgés de 1 à 14 ans furent ciblés. La couverture vaccinale atteignit 95%, ce qui

conduisit à une diminution drastique de l’incidence de la rougeole. En 1996, seulement 36 cas

de rougeole furent rapportés au Brésil.

64


CHAPITRE V. LA ROUGEOLE EN AFRIQUE

V.1. LA ROUGEOLE AU CAMEROUN

65


V. La rougeole en Afrique 1. La rougeole au Cameroun

V.1.2. Situation géographique du Cameroun

Le Cameroun est un pays d’Afrique centrale dont la capitale est Yaoundé. Il compte

environ 14 millions d’habitants. Les pays limitrophes du Cameroun sont le Nigeria à l’ouest,

le Tchad au nord , La République Centrafricaine à l’est, la Guinée Equatoriale, le Gabon et le

Congo au sud.

V.1.3. Historique de la vaccination au Cameroun

Les activités de surveillance de la rougeole ont commencé à Yaoundé en 1966

(Heymann et al., 1983). Les campagnes de vaccination de masse avaient alors lieu tous les

deux ans, juste avant la période de forte propagation de la rougeole. Pendant ces campagnes,

les enfants âgés de 6 à 36 mois recevaient une dose de vaccin antirougeoleux. Cependant, la

vaccination des enfants âgés de 6 à 12 mois avait lieu une fois par mois à la PMI, en

association avec la vaccination contre la variole.

En 1970, en plus de ces campagnes périodiques de vaccination, des sessions de

vaccination avaient lieu deux fois par mois dans les centres de santé mère-enfant. Cependant,

en 1973, en dépit du nombre élevé de vaccins administrés (78% d’enfants âgés de 6 à 36 mois

à Yaoundé furent vaccinés), le nombre de cas de rougeole restait élevé, 40% des cas étant

observés chez les enfants de moins de 12 mois, 80% chez les enfants de moins de 24 mois et

90% chez les enfants de moins de 36 mois (Guyer & McBean, 1981). Ces observations ont pu

être expliquées par le fait que la majorité des vaccins administrés était inefficace. Cette

inefficacité était due soit à la présence d’anticorps maternels, soit à l’utilisation d’un vaccin

devenu inactif à cause des conditions de stockage inappropriées.

Grâce à ces observations, plusieurs changements sont survenus en 1974 dans le

programme de vaccination à Yaoundé ;

- Les conditions de stockage et d’administration du vaccin ont été améliorées.

- Les campagnes de vaccination de masse ont été remplacées par des vaccinations

quotidiennes dans les centres de santé.

- L’âge minimum de vaccination passa de 6 à 9 mois.

Des études effectuées par Heymann et al., (1983) montrent qu’il y a eu une diminution

de plus de 44% du nombre de cas de rougeole entre 1976 et 1979. La plus forte baisse de

66


V. La rougeole en Afrique 1. La rougeole au Cameroun

l’incidence de la rougeole a été observée chez les enfants âgés de 0 à 8 mois (51,3%) en

1976, c’est-à-dire un an après le changement de l’âge de la vaccination. Cette baisse du

nombre de cas de rougeole et de décès associés a été attribuée à la protection des enfants de

plus de 8 mois par la vaccination. D’autre part, la diminution de la fréquence d’attaque parmi

les enfants de moins de 9 mois (enfants non vaccinés) a été attribuée au fait que le risque

d’exposition au virus de la rougeole a diminué à cause de la réduction de la circulation du

virus chez les autres contacts à la maison ou dans les lieux publics comme les hôpitaux et le

marché.

V.1.4. Epidémies saisonnières de rougeole au Cameroun

Au Cameroun, il y a 4 saisons, la grande saison sèche qui s’étend du mois de

novembre au mois de mars, la petite saison des pluies qui va d’avril à mai, la petite saison

sèche qui couvre les mois de juin et juillet, la grande saison des pluies qui s’étend d’août à

octobre.

La rougeole est une maladie endémique au Cameroun et des cas de rougeole sont

rapportés pendant toute l’année. Cependant, dans les zones urbaines, on observe une épidémie

annuelle de rougeole qui commence pendant la saison sèche vers la fin du mois de novembre,

puis, s’étend et atteint un pic au mois mars (Figure 7). Par la suite, l’épidémie disparaît

rapidement avec l’arrivée de la saison des pluies au mois d’avril. La corrélation entre les

saisons et l’épidémie a été attribuée à un mouvement saisonnier de la population entre les

zones rurales et urbaines, ce qui suggère que des raisons sociales et agricoles génèrent le

déplacement des populations et favorisent le contact entre un nombre suffisant d’enfants

susceptibles pour maintenir la transmission d’une épidémie de rougeole.

Les études menées dans la région de Yaoundé montrent que la grande saison des

pluies commence au mois d’août et se termine en octobre. Les plants semés pendant cette

période sont récoltés au mois de novembre. Pendant cette période, malgré une augmentation

de la population susceptible, le nombre suffisant pour soutenir une épidémie de rougeole n’est

pas atteint. La grande saison sèche s’installe vers la fin du mois de novembre. Avec les fêtes

musulmanes et chrétiennes du mois de décembre, on observe un déplacement de la population

de la ville vers les villages pour passer les fêtes en famille. L’activité agricole est réduite

pendant cette période.

67


V. La rougeole en Afrique 1. La rougeole au Cameroun

Au mois de janvier, avec la rentée scolaire, la population retourne dans les villes. Cette

immigration inclut un grand nombre d’enfants susceptibles parmi lesquels les enfants

résidants régulièrement en ville et qui ont été temporairement dans les villages, de même que

les enfants résidant régulièrement dans les villages. En effet, les mères de ces derniers sont

des agricultrices qui profitent de cette période d’inactivité dans le cycle d’agriculture pour

aller passer un moment dans les villes. Cette immigration augmente le nombre d’enfants

susceptibles dans la population urbaine, qui atteint une concentration suffisante pour

maintenir une épidémie de rougeole. L’épidémie s’étend jusqu'au mois d’avril et disparaît

rapidement avec l’arrivée des pluies. En effet, ce déclin de l’épidémie correspond à la saison

des semis quand les mères agricultrices quittent les villes pour aller cultiver leurs champs

dans les villages. La disparition de l’épidémie est accélérée par cette grande vague de départ

d’enfants susceptibles avec leurs mères vers les villages.

Figure 7 : Courbe épidémiologique de la

rougeole au Cameroun (2001)

7000

6000

5000

4000

3000

2000

1000

0

Oct Nov Dec Jan Fév Mar Avr Mai Juin Juil Aôut Sep

Mois

68


V. La rougeole en Afrique 1. La rougeole au Cameroun

V.1.5. Incidence et létalité de la rougeole

Au Cameroun, la vaccination contre la rougeole fait partie du programme élargi de

vaccination depuis 1976. D’après les données obtenues ces huit dernières années, la

couverture vaccinale est passée de 32% en 1993 à 49% en 2000. Malgré cet effort de

vaccination, la maladie sévit dans tout le pays. Le nombre annuel de cas rapportés au PEV

entre 1993 et 2001 varie entre 5535 et 23934 (Tableau 2). On remarque une baisse drastique

du nombre de cas de rougeole entre 1993 et 1995. Ceci s’explique par l’augmentation de la

couverture vaccinale qui est passée de 32% en 1993 à 46% en 1995. En revanche, malgré

l’augmentation de la couverture entre 1999 (46%) et 2000 (49%), il y a une forte

augmentation du nombre de cas de rougeole dans l’année 2000 (14.629 cas) par rapport à

1999 (10.894 cas). Ceci s’explique par le fait qu’un système de surveillance accentué de la

rougeole a été mis en place par l’OMS au Cameroun au début de l’année 2000 dans le cadre

du projet d’éradication de la rougeole prévue pour l’année 2013 en Afrique. Les données de

l’année 2001 font état d’un nombre de cas de rougeole 1,5 fois supérieur à celui de l’année

précédente. Ce qui suggère que le système de surveillance fonctionne de mieux en mieux.

Cependant, on déplore la baise de la couverture vaccinale qui est passée de 49% en 2000 à

47% en 2001 (Tableau 4), ce qui suggère une absence de corrélation entre le système de

surveillance et le système de vaccination.

Au Cameroun, l’incidence de la rougeole varie d’une province à l’autre. La maladie

sévit le plus dans la partie septentrionale du pays où la province de l’extrême nord est la plus

touchée (Figure 8, Tableau 3). Elle compte à elle seule presque la moitié des cas (6 328 cas) et

des décès (170 décès) déclarés dans tout le pays dans l’année 2000 (14629 cas et 350 décès).

Ces donnés reflètent celles de 1999 où la province de l’Extrême nord comptait 8343 cas et

178 décès parmi les 10894 cas et 248 décès déclarés dans tout le pays. En 2001, on note une

forte augmentation du nombre de cas de rougeole par rapport à l’an 2000 dans toutes les

provinces, excepté la province de l’extrême nord, ce qui montre que la surveillance s’est

accentuée en même temps dans presque toutes les régions du pays. Il est probable que la

campagne de surveillance soit moins efficace dans la province de l’Extrême nord. Le nombre

de cas rapporté dans cette province pourait également reflèter le nombre de cas survenus

effectivement dans cette région.

Le taux de létalité au niveau national est de 2,3 % pour l’année 2000. Bien que la

province de l’Extrême nord soit celle qui compte le plus de cas, le taux de létalité y est

69


V. La rougeole en Afrique 1. La rougeole au Cameroun

semblable à la moyenne nationale. C’est la province de l’Adamaoua qui a le taux de létalité le

plus élevé (4,2%).

Ces données sont basées sur la déclaration du personnel sanitaire et comme seule une

partie de la population consulte, ces donnés sous-estiment l’incidence de la maladie. Les cas

rapportés sont probablement les cas les plus sévères. Cependant, ces données révèlent le fait

que la région du grand nord, comprenant les provinces de l’Adamaoua, du Nord, et de

l’Extrême nord, est la plus touchée. Ceci peut s’expliquer par :

Une insuffisance de centres de santé. Le nord Cameroun est la région qui souffre

le plus d’une insuffisance d’institutions sanitaires au Cameroun. De plus, les

centres de santé existants sont sous-utilisés par la population comme on l’a

constaté dans d’autres pays africains (Edmunds et al., 2001).

Le manque d’information de la population. Une étude réalisée dans la région du

nord ouest du Nigeria (voisin direct du nord Cameroun) montre que seulement 1%

des mères de cette région savaient que la rougeole peut être prévenue par la

vaccination (Ambe et al., 2001). En Afrique en général, la mère est responsable

du suivi de la santé des enfants. Un minimum d’alphabétisation est nécessaire pour

comprendre l’importance de la vaccination et faire vacciner ses enfants. Or la

région du nord Cameroun a le taux d’analphabétisme chez les filles le plus élevé

du pays. De plus, la population de cette région étant musulmane, l’ignorance des

femmes y est accentuée par le fait que, de par leur religion, elles sont astreintes à

vivre retirées du monde.

Certaines croyances des populations peuvent expliquer la réticence des mères à

emmener leurs enfants dans les centres de santé. En effet, l’étude réalisée au

Nigeria montre que 46% des mères pensent que la rougeole a une cause

surnaturelle. Selon ces mères, la rougeole serait l’œuvre de sorcières et de mauvais

esprits (Ambe et al., 2001).

70


V. La rougeole en Afrique 1. La rougeole au Cameroun

Tableau 3 : Cas et Décès de la rougeole par province en 1999,

2000 et 2001 au Cameroun

Provinces

Années

1999 2000

2001

Cas Décès Cas Décès Cas Décès

Adamaoua 358 12 701 30 1597 59

Centre 76 1 970 18 4432 47

Est 198 3 82 2 1811 17

Ext. Nord 8343 178 6328 170 6380 118

Littoral 226 2 1210 12 1493 9

Nord 460 22 2104 61 3087 47

Nord Ouest 488 10 463 24 758 7

Ouest 340 3 1631 19 2262 21

Sud 104 0 945 4 1589 21

Sud ouest 301 17 195 10 525 6

Total 10894 248 14629 350 23934 352

Tableau 4 : Evolution de la couverture vaccinale et de l'incidence de la rougeole au Cameroun de

1993 à 2001

Année 1993 1994 1995 1996 1997 1998 1999 2000 2001

Couverture

Vaccinale

Cas de

rougeole

32% 38% 46% 39% 43% 47% 46% 49% 47%

14171 6712 5535 11770 7210 10731 10894 14629 23934

71


Figure 8: Répartition des cas de rougeole au Cameroun (année 2000)

1 point = 1 cas

Extrême Nord

Nord

Nord Ouest

Adamaoua

Sud Ouest

Ouest

Centre

Littoral

Est

Sud


V. La rougeole en Afrique 2. La rougeole dans le continent africain

V.2. LA ROUGEOLE DANS LE CONTINENT AFRICAIN

Malgré les efforts croissants de lutte contre la rougeole, cette maladie reste encore

responsable de plus de 800 000 décès chez les enfants dans le monde, dont plus de la moitié

en Afrique subsaharienne. Au Niger, 44513 cas et 237 décès ont été rapportés au cours du

premier semestre de l’année 2001. Plusieurs raisons peuvent expliquer ces observations :

i) Une faible couverture vaccinale. Bien que certains pays comme la Gambie aient

des taux de couverture vaccinale élevés pour les maladies infantiles, d’autres, en

particulier les pays d’Afrique de l’ouest et d’Afrique centrale, ont des taux de

couverture vaccinale faible. En effet, en 1999, 14 pays au monde ont signalés une

couverture vaccinale contre la rougeole inférieure à 50%. A part l’Afghanistan,

tous sont africains. Outre le Niger, on trouve le Burkina Faso, le Burundi, le

Cameroun, le Congo, Djibouti, le Libéria, Madagascar, la République

démocratique du Congo, le Sénégal, la Somalie et le Togo (WHO/UNICEF, 2001).

ii) Une sous-utilisation des services de santé. A cause des problèmes de mauvaise

gestion et de logistique, on constate qu’il y a plusieurs occasions manquées de

vaccination. Des études menées en République Centrafricaine et en Guinée

montrent que la couverture vaccinale peut être augmentée de 20% tout

simplement en s ‘assurant que les enfants éligibles sont vaccinés quand ils sont en

contact avec les services de santé (Cutts et al., 1991, Kahn et al., 1995).

iii) Un accès difficile aux services de santé. La longue distance entre le centre de santé

et les habitations est un facteur qui aggrave la sous-utilisation des centres de santé

et la mortalité infantile en Afrique. En effet, une étude menée au Niger montre que

seulement 40% de la population a accès facilement aux centres de santé censés

couvrir les besoins médicaux de la population vivant dans un rayon de 5 km

(Chatain, 2001).

iv) Une instabilité politique dans plusieurs pays. Les conflits en Afrique ont contribué

à la baisse de la couverture vaccinale en entraînant de grands déplacements de

population.

v) Taux d’abandon élevé du vaccin contre la rougeole. Compte-tenu du fait que la

vaccination contre la rougeole occupe la dernière place dans le calendrier de

vaccination (tableau 5), on constate que le taux d’abandon est élevé par rapport au

autres vaccins. En effet, une étude réalisée en Afrique à partir des données de 1998

73


V. La rougeole en Afrique 2. La rougeole dans le continent africain

montre que la couverture vaccinale pour la rougeole est d’au moins 10% inférieure

à celle du BCG (Edmunds et al., 2001). Cette différence atteint 40 à 50% dans

certains pays comme la Mauritanie. D’après ce taux d’abandon, on estime que

dans l’année 2002, environ 3 millions d’enfants africains ayant accès aux services

de vaccination ne seront pas vaccinés contre la rougeole (Edmunds et al., 2001).

Au vu de ces donnés, il ressort que le problème de la rougeole en Afrique est le résultat

d’un manque d’information et de formation sanitaire dans la communauté africaine. Bien que

la plupart des mères ignorent les effets bénéfiques de la vaccination, le petit nombre qui

connaît les bienfaits de la prévention d’une maladie se voit le plus souvent interdire par leurs

époux d’emmener leurs enfants à l’hôpital (Ambe et al., 2001). L’éducation sanitaire doit

donc se faire au niveau de toutes les couches de la société. Les chefs traditionnels et religieux

et surtout les pères de famille devraient être impliqués dans les campagnes de vaccination. En

plus de cette grande mobilisation sociale, des journées de vaccination nationale devraient être

régulièrement organisées afin de rattraper les enfants qui n’ont pas été vaccinés et de corriger

les problèmes d’échecs de la vaccination régulièrement observés chez certains enfants en

Afrique.

Tableau 5 : Calendrier de vaccination infantile recommandé par le PEV

dans les pays en développement

Schéma A

Naissance BCG, VPO 0 HB 1

Schéma B

6 semaines DTC-1, VPO 1 HB 2 HB 1

10 semaines DTC-2, VPO 2 HB 2

14 semaines DTC-3, VPO 3 HB 3 HB 3

9 mois

Age

vaccins

Rougeole ,

fièvre jaune*

Vaccin anti-hépatite B**

* Dans les pays où il existe un risque de fièvre jaune

** Le schéma A est recommandé dans les pays où la transmission périnatale du virus

de l'hépatite B est fréquente ( Asie du Sud -Est par exemple). Le schéma B est utilié

dans les pays où elle est moins courante (Afrique subsaharienne par exemple)

74


CHAPITRE VI. ETUDE DES SOUCHES

AFRICAINES DU VIRUS DE LA ROUGEOLE

75


VI. Etude des souches Africaines du virus de la rougeole

1. Interaction virus-cellules

VI.1 INTERACTION VIRUS-CELLULES

VI.1.1. Approche d’un virologiste à l’épidémiologie moléculaire

La vaccination contre la rougeole a été intensifiée dans les pays en développement

pendant ces dix dernières années. Si l'infection naturelle procure une protection à vie,

plusieurs études montrent que le virus de la rougeole peut infecter des enfants vaccinés, sans

entraîner de manifestations cliniques (Gustafson et al., 1987 ; Whittle et al., 1999b). La

mémoire immunologique au niveau de la surface des muqueuses étant de courte durée,

l'infection s'établit au niveau des cellules épithéliales du pharynx et stimule ainsi le système

immunitaire qui élimine l'infection. Le passage du virus de la rougeole dans les populations

vaccinées exposerait le virus à une immunosélection et à la production de variants qui seraient

éventuellement moins efficacement neutralisés par l'immunité induite par le vaccin.

L’objectif général de notre travail est d’étudier la diversité génétique du virus de la

rougeole au cours du temps, en Afrique Centrale et en Afrique de l’Ouest. Ayant établi la

première banque d’isolats de virus de la rougeole avec des échantillons obtenus dans ces pays

en 1983/1984 et, grâce à plusieurs collaborations, nous avons analysé des isolats de plusieurs

pays s’étendant de la Gambie jusqu’au Soudan, en passant par le Nigeria et le Cameroun.

Afin de compléter nos études, nous sommes retournés au Cameroun en 2001 pour comparer

les souches de virus ayant circulé pendant une période de 18 années.

Jusqu’en 1996, l’OMS recommandait que le virus de la rougeole soit isolé sur les

cellules Véro (cellules épithéliales de reins de singe). Avec ces cellules, il fallait effectuer

plusieurs passages et attendre environ 4-5 semaines pour observer les effets cytopathiques.

Depuis qu’il a été montré que des isolats cliniques se développent rapidement (4 jours) dans

la lignée cellulaire B95a (lignée cellulaire B de singe), 10 000 fois plus sensibles que les

cellules Véro (Kobune et al., 1990), l’OMS recommande maintenant les cellules B95a pour

l’isolement viral. Cependant, les virus isolés sur les cellules B95a ont des propriétés

biologiques différentes de ceux isolés sur les cellules Véro :

- Au niveau de leur virulence. Les virus isolés sur les cellules B95a retiennent leur

virulence. En effet, il a été montré que les singes infectés avec les virus isolés sur

B95a développent des signes cliniques tels que l’éruption cutanée, la perte de poids,

les tâches de Köplick, la leucopénie, semblables à ceux qu’on observe pendant la

76


VI. Etude des souches Africaines du virus de la rougeole

1. Interaction virus-cellules

rougeole chez l’homme. Par contre, les virus isolés sur les cellules Véro ont un

phénotype atténué chez le singe (Kobune et al., 1996).

- Au niveau de leur antigénicité. Des différences antigéniques entre les virus isolés sur

les cellules B95a et ceux isolés sur les cellules Véro ont été trouvées au niveau des

protéines N et F (Kobune et al., 1990).

En vue de l’étude comparative que nous voulions réaliser, il était nécessaire de vérifier

que l’isolement sur ces différentes lignées cellulaires n’introduisait pas de modifications dans

les gènes H et N utilisés pour l’étude phylogénétique.

77


VI. Etude des souches Africaines du virus de la rougeole

1. Interaction virus-cellules

VI.1.2. Résumé de l’article 1

Le virus de la rougeole isolé pour la première fois en 1953 , a subi plusieurs passages

sur les cellules de rein humain et sur des fibroblastes de poulet jusqu'à ce qu'il ait un

phénotype atténué, avant d'être utilisé comme vaccin. Pendant cette adaptation, plusieurs

mutations ont été introduites dans le génome du virus (Parks et al., 2001). L'une des propriétés

associées à la souche vaccinale est sa capacité à se répliquer dans les lignées cellulaires

épithéliales et fibroblastiques humaines et simiennes, due en partie à sa capacité à utiliser la

molécule CD46 comme récepteur cellulaire (Dorig et al., 1993 ; Naniche et al., 1993a).

Récemment, il a été montré que la molécule SLAM est un récepteur cellulaire pour les

souches sauvages et vaccinales du virus de la rougeole (Tatsuo et al., 2000 ; Hsu et al., 2001 ;

Ono et al., 2001a).

Après adaptation aux cellules Véro, les souches sauvages de virus de la rougeole

devraient induire la formation de syncytia similaires à ceux observés dans les cellules

infectées par les souches vaccinales. Ceci est en général corrélé à l'introduction de certaines

mutations dans le gène H et spécialement au niveau de l'acide aminé 481 où l'asparagine de

départ est remplacée par une tyrosine pour que le virus induise la fusion cellulaire

(Lecouturier et al., 1996 ; Hsu et al., 1998).

Le but de ce travail était d'examiner les propriétés d’une souche de virus de la

rougeole au cours de son adaptation aux cellules B95a ou aux cellules Véro. Pour ce faire,

nous avons utilisé la souche G954 isolée en Gambie en 1993 au cours d'une épidémie de

rougeole.

Le virus G954 sauvage (G954-PBL) a été maintenu dans les PBLs par infection de

ceux–ci après stimulation avec la PHA. Par contre, le virus adapté (G954 Vp10) a été obtenu

après 10 passages successifs dans les cellules Véro.

Les effets cytopathiques et notamment la formation des syncytia ont été examiné.

Les cellules Véro et B95a ont été infectées avec ;

i) le virus G954-PBL. Dans les cellules B95a, on a pu observer au bout de 24h la

formation des syncytia qui s'étendent rapidement aux autres cellules. Dans les cellules

Véro par contre, après deux passages à 5 jours d'intervalles, les cellules gonflent mais ne

fusionnent pas.

ii) le virus G954-Vp10. On constate que même après adaptation, ce virus n’induit toujours

pas de fusion dans les cellules Véro ; de plus, au cours de l'adaptation, il perd sa capacité

à induire la fusion dans les cellules B95a.

78


VI. Etude des souches Africaines du virus de la rougeole

1. Interaction virus-cellules

Compte-tenu du rôle de l'hémagglutinine et de la protéine de fusion dans le processus

de fusion cellulaire, l'expression des glycoprotéines à la surface cellulaire a été examinée.

Les résultats montrent une bonne expression des deux glycoprotéines à la surface cellulaire.

Afin de déterminer si l'absence de fusion dans les cellules Véro infectées par la souche G954-

Vp10 était due à des modifications de structure des glycoprotéines, l'ARNm a été extrait a

partir de PBL infectés avec la souche G954, de B95a infectées avec la souche G954-PBL, et

de cellules Véro infectées avec G954-Vp10. L’ADN obtenu après RT-PCR et PCR a été

séquencé (Annexe 1). Les résultats montrent qu’un seul nucléotide change dans le gène H,

mais cette mutation est silencieuse. La même mutation est observée pour le virus adapté aux

cellules B95a et aux cellules Véro.

La protéine F est synthétisée sous forme de polyprotéine inactive qui est ensuite clivée

en deux formes biologiquement actives. Afin de s’assurer que la protéine F est

fonctionnelle, les extraits de cellules Véro infectées par G954-Vp10 ou la souche Hallé

(souche de type vaccinale : il est important de noter ici qu'il a été montré par Rima et al. 1995,

suite à une étude phylogénétique, que la souche Hallé, longtemps considérée comme une

souche de SSPE appartient au génotype A qui regroupe toutes les souches vaccinales) ont été

déposés sur un gel de polyacrylamide. Après transfert sur membrane de nitrocellulose, la

protéine F a été révélée avec un anticorps monoclonal (Ost-2) dirigé contre sa queue

cytoplasmique et, de ce fait, reconnaît les formes F0 et F1 de la protéine. Les résultats

(Annexe 2) montrent que la protéine F de la souche G954-Vp10 est aussi bien clivée que celle

de la souche contrôle Hallé et est donc potentiellement fonctionnelle.

Afin de déterminer les mécanismes par lesquels la souche G954 entre dans les cellules,

l’interaction du virus avec les récepteurs cellulaires CD46 et SLAM a été examinée. Pour

ce faire, les cellules B95a et Véro ont été infectées et une étude comparative de la modulation

de SLAM et CD46 à la surface cellulaire a été réalisée. La molécule CD46 présente dans les

cellules B95a comporte une délétion au niveau du SCR1 et de ce fait, n’est pas fonctionnelle

comme récepteur pour la rougeole. Par contre, les cellules Véro n’expriment que CD46 et pas

SLAM. L’infection des cellules B95a avec les souches Hallé et G954-Vp10 entraîne une

régulation négative de SLAM, tandis que la molécule CD46 non fonctionnelle n’est pas

modifiée. Par contre, l’infection des cellules Véro avec G954-Vp10 ne modifie pas le niveau

de CD46, ce qui suggère que l’hémagglutinine de G954-Vp10 n’interagit pas avec CD46.

Cependant, après infection avec le virus Hallé, la présence de CD46 n’est plus détectable avec

l’anticorps monoclonal (13/42) dirigé contre le SCR1 de la molécule CD46. En revanche,

l’utilisation de l’anticorps dirigé contre le SCR4 (10/88) montre seulement une petite

79


VI. Etude des souches Africaines du virus de la rougeole

1. Interaction virus-cellules

diminution de CD46, ce qui suggère que l’absence de CD46 est due au fait que son site est

masqué suite à l’interaction avec la protéine H.

La capacité de G954-Vp10 à utiliser CD46 comme G954 a été étudiée. Pour cela,

des cellules M12-CD46 (lignée cellulaire murine transfectée avec la molécule CD46 humaine)

ont été infectées avec les souches G954-Vp10 et Edmonston (souche de type vaccinal).

L’expression de la protéine H à la surface des cellules montre que seule la souche Edmonston

est capable d’infecter ces cellules.

Afin d’étudier la contribution de la molécule SLAM à la biologie des infections, les

cellules Véro et Véro-SLAM (cellule Véro transfectées avec la molécule SLAM humaine),

ont été infecté avec la souche G954-Vp10. Dans les cellules Véro-SLAM, la synthèse du

virus est rapide et on observe le phénomène de fusion dès 24 heures après l’infection,

conduisant à la destruction de la couche cellulaire au bout de 5 jours. De plus, la présence de

SLAM est régulée négativement à cause de l’expression de la protéine H à la surface de ces

cellules. Par contre, dans les cellules Véro, la synthèse du virus est lente, avec de faibles

quantités de virus au départ, mais, en l’absence de fusion, le virus infectieux atteint au bout de

7 jours des quantités 10 fois supérieures à celles présentent dans les cellules Véro exprimant

SLAM. Ces observations montrent que l’infection des cellules par la souche G954-Vp10 est

accélérée par la molécule humaine SLAM, ce qui entraîne la fusion.

Dans cette étude, nous avons analysé un certain nombre de paramètres associés à

l’adaptation du virus sauvage de la rougeole aux cellules en culture. Bien que le virus adapté

aux B95a induise la formation des syncytia, le virus adapté aux cellules Véro quant à lui ne

donne pas de fusion, mais produit de grandes quantités de virus sur une longue période. Nous

avons montré que l’absence de fusion n’est pas due au blocage du processus de clivage de la

protéine de fusion de G954-Vp10, cette dernière étant aussi bien clivé que la protéine de

fusion de la souche Hallé. Les études d’adaptation des souches de virus de la rougeole aux

cellules Véro ont montré que cette adaptation était accompagnée d’une atténuation de la

virulence chez le singe (Kobune et al., 1996). Il a été montré que cette atténuation suite à

l’adaptation du virus aux cellules Véro est associée à des mutations au niveau des gènes P et

L ou P/V/C et M (Takeda et al., 1998 ; Takeuchi et al., 2000 ). Ainsi, si le virus entre dans les

cellules, sa réplication serait limitée par le complexe transcriptase/réplicase. Les souches

sauvages du virus de la rougeole utilisent CD150 (SLAM) comme récepteur, alors que les

souches vaccinales peuvent en plus utiliser CD46. Notre étude sur les cellules Véro a montré

que la souche sauvage G954-Vp10 du virus de la rougeole n’utilise pas CD46 ce qui confirme

les résultats du séquençage c’est-à-dire aucun changement d’acide aminé dans la séquence de

80


VI. Etude des souches Africaines du virus de la rougeole

1. Interaction virus-cellules

la protéine H. Etant donné que CD150 n’est pas exprimé sur les cellules Véro, le virus

entrerait dans ces cellules soit par un troisième récepteur soit par un autre mécanisme.

Le mécanisme d’entrée du virus dans les cellules reste à être élucidé. Ceci devrait

aider à expliquer un certain nombre d’ambiguïtés observées dans le tropisme du virus de la

rougeole. CD150 est présent dans les cellules T et B activées et les cellules dendritiques

(Cocks et al., 1995 ; Tangye et al., 2000). Toutefois, on trouve des antigènes rougeoleux dans

une variété de cellules, parmi lesquelles les cellules épithéliales et endothéliales où

l’expression de CD150 n’a pas été montrée. Si les souches sauvages de virus de la rougeole

utilisent CD150, elles utiliseraient soit un autre mécanisme pour infecter ces cellules, soit la

molécule CD150 serait induite dans ces cellules au cours de l’infection.

VI.1.3 Travaux additionnels à l’article

Etant donné que la protéine M interagit avec les queues cytoplasmiques des

glycoprotéines (Tyrell & Ehrnst, 1979), un changement de structure dans cette protéine

pourrait affecter la fusion. Les séquences de la protéine M montrent une différence d’un acide

aminé en position 89 entre le virus cultivé sur B95a (glu) et le virus adapté aux cellules Véro

(lys) (Annexe 3).

L’alignement des deux séquences de la protéine M de la souche G954 avec d’autres

séquences présentes dans la base de données montre que la mutation introduite dans la

protéine M après adaptation aux cellules Véro (lys en position 89) se retrouve dans les

souches vaccinales. Par contre, la séquence de la protéine M obtenue après passage sur les

cellules B95a est proche des séquences des souches sauvages ce qui suggère que cet acide

aminé aurait un rôle dans l’atténuation des souches de virus de la rougeole.

81


VI.1.4. Article 1 : Adaptation des souches sauvages du virus de la rougeole

aux cellules en culture

82


JOURNAL OF VIROLOGY, Feb. 2002, p. 1505–1509 Vol. 76, No. 3

0022-538X/02/$04.000 DOI: 10.1128/JVI.76.3.1505–1509.2002

Copyright © 2002, American Society for Microbiology. All Rights Reserved.

NOTES

Adaptation of Wild-Type Measles Virus to Tissue Culture

Diane Waku Kouomou and T. Fabian Wild*

INSERM U 404, CERVI, 69365 Lyon Cedex 07, France

Received 31 July 2001/Accepted 24 October 2001

Measles has a host range restricted to humans and monkeys in captivity. Fresh measles virus (MV) isolates

replicate readily in several human and simian B-cell lines but need a period of adaptation to other types of

cells. The identification of CD46 and CD150 (SLAM) as cellular receptors for MV has helped to clarify certain

aspects of the immunobiology of MV infections. We have examined the properties of an MV wild-type strain

grown in the epithelial cell line Vero. After adaptation, this virus expressed high levels of both the viral

glycoproteins (hemagglutinin and fusion protein) but did not induce fusion (syncytia). No changes in the amino

acid sequence were found in either of the viral glycoproteins. Using several approaches, the Vero-adapted virus

could not be shown to interact with CD46 either in the initiation or during the course of infection. The presence

of human SLAM expressed in the Vero cells rapidly gave rise to fusion and lower yields of infectious virus.

Despite the availability of an efficient vaccine, measles remains

one of the major causes of infant mortality. Molecular

epidemiological studies have established that despite the monotypic

status, measles viruses (MVs) from geographically different

regions can be differentiated by nucleic acid sequence

analysis (20); however, the biological significance of these observations,

if any, remains to be established. MV was first

isolated in 1953 and was initially passaged in primary embryo

human kidney cells and then serially passaged in chicken embryo

fibroblasts until it had an attenuated phenotype when

reinoculated into children. During this adaptation, there were

a number of mutations introduced into the MV genome (14).

Among the properties associated with the vaccine virus was the

ability to replicate in human and monkey epithelial and fibroblastic

cell lines. This has been shown to be due in part to the

ability of the vaccine virus to use the molecule CD46 as a cell

receptor (1, 10). During MV replication the expression of the

MV hemagglutinin (HA) at the surface of the cells leads to the

down-regulation of the CD46 (11), which is one of the proteins

responsible for protecting the cell from complement lysis, and

this leads to an increased susceptibility to lysis by complement

factors (16). It has been proposed that this may be an attenuating

property.

Whereas the virus can be rapidly isolated from clinical specimens

in both human and monkey B-cell lines (6), isolation on

epithelial cells such as Vero cells can take weeks and several

blind passages. Recently it was shown that freshly isolated MV

could attach to the cellular receptor CD150 (SLAM) and the

vaccine strain could use either this molecule or CD46 (5, 12,

19).

After adaptation to Vero cells, the virus may induce syncytia

similar to those in cells infected by the vaccine strain. This is

* Corresponding author. Mailing address: INSERM U 404, CER

VI - 21, Avenue Tony Garnier, 69365 Lyon Cedex 07, France. Phone:

33 4 37 28 23 92. Fax: 33 4 37 28 23 91. E-mail: wild@cervi-lyon.inserm

.fr.

usually correlated to the introduction of certain mutations in

the HA, especially at position 481, where the wild-type amino

acid, which is normally Asn, may be mutated to Tyr in order to

become syncytial (4, 7). Our studies have established that the

amino acid at 481 and to a lesser extent that at amino acid 451

govern the ability of the virus to efficiently use CD46 as a

receptor and also its ability to down-regulate this molecule

from the cell surface (8). In monkey models, MVs isolated in

B-cell lines retain their virulent pathogenic phenotype, in contrast

to viruses isolated in Vero cells, which become attenuated

(17). Sequence studies have identified differences in the HA,

P/V/C, M, and L genes between the virulent and attenuated

strains (17, 18).

In the present study we have examined the properties of

an MV isolate during its adaptation to B95a (monkey B-cell

line) or Vero (monkey epithelial) cell lines. We show that

after adaptation to Vero cells, this virus is unable to induce

fusion. The amino acid sequences of the HA and fusion (F)

proteins are unchanged, and the F protein precursor, F0, is

cleaved into the potentially biologically active subunits F1

and F2. Further, we show that the Vero-adapted virus does

not enter the cell by CD46. As Vero cells do not express

SLAM, this poses the question of how the virus infects Vero

cells.

MV adaptation to B95a and Vero cells. An MV isolate,

G954, which had been maintained by infection of phytohemagglutinin-stimulated

peripheral blood lymphocyte (PBL) cultures

was used to infect B95a and Vero cells. In B95a cells

syncytia were observed within 24 h, rapidly extending to the

majority of the cells. In contrast, a cytopathic effect or fusion

was not observed in the Vero cells. These cells were passaged

twice at 5-day intervals before detecting MV antigen-positive

cells. In this case the cells became enlarged but did not display

classical fusion. This virus (freeze-thawed cells) was serially

passaged 10 times in Vero cells, and at this point the adapted

virus, G954.V10, was further characterized.

Infection of either B95a or Vero cells with G954.V10

1505


1506 NOTES J. VIROL.

FIG. 1. MV infection of Vero and B95a cells. (A) Flow cytometry

analysis of MV G954.V10 infected cells. The cells were stained with

anti-HA, monoclonal antibody 55 (2), or anti-F monoclonal antibody

263 (9). Continuous lines represent infected cells, and the dotted lines

represent the uninfected control cells. (B) Morphology (fusion) of

MV-infected Vero and B95a cells. Cells were infected at 1 PFU/cell for

G954.V10 and Hallé and 0.1 PFU/cell for G954-PBL. Photographs

were taken 48 h after infection.

showed that although there was a high expression of both

viral glycoproteins at the cell surface as shown by FACScan

analysis (Fig. 1A), no fusion was observed. In control cultures,

infection of Vero or B95a cells with Hallé (vaccinelike)

or B95a cells with G954-PBL induced fusion (Fig. 1B).

To study whether the lack of fusion in the Vero-adapted

G954 virus was due to modifications in the structure of

either of the glycoproteins, the mRNA from PBLs and B95a

and Vero cells infected with the corresponding virus were

subjected to reverse transcription-PCR and the DNA was

sequenced with the Big Dye terminator system (accession

no. for H and F, AY059391 and AY059392, respectively). A

single nucleotide change in the HA was found at position

7278 in the genome (A3G) but did not lead to a change in

the amino acid sequence. The same change was observed

when the virus was adapted to either Vero or B95a cells.

MV-F protein is synthesized as the precursor F0, which is

cleaved into the biologically active form F1 plus F2. Although

the sequence is unaltered, we examined the possibility

that the F expressed in Vero cells by G954.V10 was not

cleaved. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis

and Western blotting of the virus-infected cell ex-


VOL. 76, 2002 NOTES 1507

FIG. 2. Flow cytometry analysis of the cell surface expression of CD46 and SLAM in MV infection. B95a and Vero cells infected with either

Hallé or G954.V10 were stained either with anti-CD46 monoclonal antibodies 13/42 and 10/88 (J. Schneider-Schaulies, Würzburg, Germany) or

anti-SLAM IPO3 (Biodesign International). Continuous lines represent MV-infected cells. Dotted lines represent control uninfected cells.

tracts showed that F was cleaved to the same extent in both

viruses (results not shown).

CD46 and SLAM as cell receptors. The interaction of MV

HA with its cellular receptors initiates the infection. Later

during the virus cycle when this viral glycoprotein is expressed

at the surface of the cell, it can interact with the receptors on

neighboring cells. It has been reported that MV lymphotropic

strains use SLAM whereas vaccine strains can also use CD46.

To investigate the mechanism(s) by which G954.V10 enters

cells, we infected B95a and Vero cells and compared the modulations

of CD46 and/or SLAM at the cell surface. In B95a

cells, CD46 lacks SCR-1 and so is nonfunctional as an MV

receptor (3). Infection by either Hallé or G954.V10 downregulated

SLAM, whereas the nonfunctional CD46 in B95a

cells was not modified (Fig. 2). Vero cells express only CD46

and not SLAM. Infection with G954.V10 did not alter the

levels of CD46 even though high levels of the HA were expressed.

In contrast, after infection with Hallé the presence of

CD46 was undetectable with an anti-CD46 monoclonal antibody

directed to the SCR-1 (13/42,) but when an antibody to

SCR-4 (10/88) was used the level of CD46 was only slightly

reduced. This may suggest that the lack of detection with 13/42

is due to the masking of the site caused by the interaction with

the HA. Thus, either G954.V10 HA does not interact with

CD46 or its interaction is of an affinity too low to be detected

by this method.

To compare the ability of Edmonston and G954.V10 to use

CD46 as a receptor we infected a murine cell line (M12-CD46)

which was transfected with the human CD46 (10). As measured

by the expression of the HA at the cell surface, only the

Edmonston strain could infect these cells (Fig. 3). We confirmed

that infection of the cells was via CD46, as preincubation

with the monoclonal anti-CD46 antibody 13/42 blocked

infection (results not shown). These studies suggest that MV

G954 in adapting to Vero cells does not use CD46, although

when SLAM is available it can still use it.

G954 adapted to grow in Vero retains its ability to interact

(down-regulation) with simian SLAM but not to induce fusion.


1508 NOTES J. VIROL.

FIG. 3. Flow cytometry analysis of MV-infected M12-CD46 cells. M12-CD46 cells were infected with Edmonston or G954.V10 (1 PFU/cell).

At 72 h postinfection, cells were analyzed for HA (monoclonal antibody 55) and F (monoclonal antibody 263) expression. Continuous lines

represent the infected cells. Dotted lines represent the uninfected control cells.

In contrast, infection of Vero cells expressing human SLAM

induced syncytia. To study the contribution of SLAM to the

biology of the infections, Vero and Vero-SLAM cells were

infected with G954.V10 virus and the virus synthesis and fusion

properties were examined. In the Vero-SLAM cultures, fusion

was initiated within 24 h, leading to the destruction of the cell

monolayer by 5 days. In contrast, infection of Vero cells initially

yielded lower levels of virus, but in the absence of fusion,

the infectious virus yield eventually rose to more than 10 times

that of the SLAM expressing cells (7 days) (Fig. 4).

In our studies, we examined the adaptation of a wild-type

MV to replicate in Vero cells. After a period of adaptation the

virus grew to high titers without inducing fusion. As the predicted

amino acid sequence of the two viral glycoproteins was

unchanged, this suggests that the ability to replicate in Vero

cells was not at the receptor level. This was substantiated by

showing that the virus did not use CD46 as a receptor, which is

in agreement with a lack of Tyr at position 481 for CD46 usage

(7). However, as Vero cells do not express SLAM, the mechanism

by which the virus infects the cell remains to be determined.

In human immunodeficiency virus infections, the virus

can incorporate cellular proteins which can attach to their

corresponding ligands on host cells (reviewed in references

13 and 15). However, in our system, anti-Vero sera failed to

neutralize G954.V10 infection of Vero cells (T. F. Wild, unpublished

results). In the present study, we have analyzed a

number of the parameters displayed by wild-type MV when

adapted to tissue culture. MV can enter such cells and following

a period grows to high titers without giving classical fusion.

These observations may be relevant to the in vivo situation in

which viral antigen is found in cells which are not known to

express the MV wild-type receptor SLAM. It remains to be

established if these cells become infected by a mechanism

similar to the present studies or via a third MV cell receptor.

We thank Bernadette Maret for editorial assistance and H. Whittle

(Gambia) for lymphocytes from measles patients.

This work was supported by a grant (no. HHC02F) from the Rhône-

Alpes Région. D. Waku Kouomou was supported by a scholarship

from the Ministry of Foreign Affairs and Cooperation.

FIG. 4. Comparison of MV G954.V10 growth cycles in Vero and

Vero-SLAM cells. Vero and Vero-SLAM cells were infected with

G954.V10 (0.1 PFU/cell). The yield of virus (cells plus supernatant)

was titrated on Vero-SLAM cells.

REFERENCES

1. Dorig, R. E., A. Marcil, A. Chopra, and C. D. Richardson. 1993. The human

CD46 molecule is a receptor for measles virus (Edmonston strain). Cell

75:295–305.


VOL. 76, 2002 NOTES 1509

2. Giraudon, P., and T. F. Wild. 1985. Correlation between epitopes on hemagglutinin

of measles virus and biological activities: passive protection by

monoclonal antibodies is related to their hemagglutination inhibiting activity.

Virology 144:46–58.

3. Hsu, E. C., R. E. Dörig, F. Sarangi, A. Marcil, C. Iorio, and C. D. Richardson.

1997. Artificial mutations and natural variations in the CD46 molecules

from human and monkey cells define regions important for measles virus

binding. J. Virol. 71:6144–6154.

4. Hsu, E. C., F. Sarangi, C. Iorio, M. S. Sidhu, S. A. Udem., D. L. Dillehay, W.

Xu, P. A. Rota, W. J. Bellini, and C. D. Richardson. 1998. A single amino

acid change in the hemagglutinin protein of measles virus determines its

ability to bind CD46 and reveals another receptor on marmoset B cells.

J. Virol. 72:2905–2916.

5. Hsu, E. C., C. Iorio, F. Sarangi, A. A. Khine, and C. D. Richardson. 2001.

CDw150 (SLAM) is a receptor for a lymphotropic strain of measles virus and

may account for the immunosuppressive properties of this virus. Virology

279:9–21.

6. Kobune, F., H. Sakata, and A. Sugiura. 1990. Marmoset lymphoblast cells as

a sensitive host for isolation of measles virus. J. Virol. 64:700–705.

7. Lecouturier, V., J. Fayolle, M. Caballero, J. Carabana, M. L. Celma, R.

Fernandez-Munoz, T. F. Wild, and R. Buckland. 1996. Identification of two

amino acids in the hemagglutinin glycoproteins of measles virus (MV) that

govern hemadsorption, HeLa cell fusion and C46 downregulation: phenotypic

markers that differentiate vaccine and wild-type MV strains. J. Virol.

70:4200–4204.

8. Lecouturier, V., A. Rizzitelli, J. Fayolle, L. Daviet, T. F. Wild, and R. Buckland.

1999. Interaction of measles virus (Hallé strain) with CD46: evidence

that a common binding site on CD46 facilitates both CD46 downregulation

and MV infection. Biochem. Biophys. Res. Commun. 264:268–275.

9. Malvoisin, E., and T. F. Wild. 1990. Contribution of measles virus fusion

protein in protective immunity: anti-F monoclonal antibodies neutralize

virus infectivity and protect mice against challenge. J. Virol. 64:5160–5162.

10. Naniche, D., G. Varior-Krishnan, F. Cervoni, T. F. Wild, B. Rossi, C. Rabourdin-Combe,

and D. Gerlier. 1993. Human membrane cofactor protein

(CD46) acts as a cellular receptor for measles virus. J. Virol. 67:6025–6032.

11. Naniche, D., T. F. Wild, C. Rabourdin-Combe, and D. Gerlier. 1993. Measles

virus haemagglutinin induces down regulation of gp57/67, a molecule involved

in virus binding. J. Gen. Virol. 74:1073–1079.

12. Ono, N., H. Tatsuo, Y. Hidaka, T. Aoki, H. Minagawa, and Y. Yanagi. 2001.

Measles virus on throat swabs from measles patients use signaling lymphocytic

activation molecule (CDw150) but not CD46 as a cellular receptor.

J. Virol. 75:4399–4401.

13. Ott, D. E. 1997. Cellular proteins in HIV virions. Rev. Med. Virol. 7:167–

180.

14. Parks, C. L., R. A. Lerch, P. Walpita, H. P. Wang, M. S. Sidhu, and S. A.

Udem. 2001. Comparison of predicted amino acid sequences of measles virus

strains in the Edmonston vaccine lineage. J. Virol. 75:910–920.

15. Roberts, B. D., and S. T. Butera. 1999. Host protein incorporation is conserved

among diverse HIV-1 subtypes. AIDS 13:425–427.

16. Schnorr, J. J., L. M. Dunster, R. Nanan, J. Schneider-Schaulies, S. Schneider-Schaulies,

and V. ter Meulen. 1995. Measles virus-induced down-regulation

of CD46 is associated with enhanced sensitivity to complement-mediated

lysis of infected cells. Eur. J. Immunol. 25:976–984.

17. Takeda, M., A. Kato, F. Kobune, H. Sakata, Y. Li, T. Shioda, Y. Sakai, M.

Asakawa, and Y. Nagai. 1998. Measles virus attenuation associated with

transcriptional impediment and a few amino acid changes in the polymerase

and accessory proteins. J. Virol. 72:8690–8696.

18. Takeuchi, K., N. Miyajima, F. Kobune, and M. Tashiro. 2000. Comparative

nucleotide sequence analyses of the entire genomes of B95a cell-isolated and

vero cell-isolated measles viruses from the same patient. Virus Genes 20:

253–257.

19. Tatsuo, H., N. Ono, K. Tanaka, and Y. Yanagi. 2000. SLAM (CDw150) is a

cellular receptor for measles virus. Nature 406:893–897.

20. World Health Organization. 1998. Expanded Programme on Immunization

(EPI). Standardization of the nomenclature for describing the genetic characteristics

of wild-type measles viruses. Wkly. Epidemiol. Rec. 73:265–272.


VI. Etude des souches Africaines du virus de la rougeole

2. Etudes épidémiologiques

VI.2. ETUDES EPIDEMIOLOGIQUES

VI.2.1. Historique de la surveillance du virus de la rougeole en Afrique

L’Afrique reste l’un des réservoirs majeurs de la rougeole dans le monde avec plus de

500.000 décès par an dus à la rougeole. Cependant, la maladie y étant endémique, la diversité

génétique des souches de virus de la rougeole est restreinte actuellement à 3 clades (A, B, D).

Les premières souches africaines de virus de la rougeole ont été isolées à Yaoundé au

Cameroun en 1983 par le Dr. Fabian WILD. Ces isolats forment actuellement le génotype B1

(Taylor et al., 1991). Les souches isolées au Gabon en 1984 se sont révélées assez différentes

de celles isolées l’année précédente au Cameroun pour former le génotype B2. Par la suite,

d’autres virus ont été isolés dans plusieurs pays africains (Tableau 6), notamment en Afrique

du sud, où on a trouvé des virus appartenant aux génotypes A et D2, au Kenya et en Ethiopie,

où circulent les virus du génotype D4. En Gambie et au Ghana, on trouve les virus du

génotype B3.2, tandis qu’au Soudan on a le génotype B3.1. En revanche, au Nigeria, les

génotypes B3.1 et B3.2 co-circulent.

La répartition des différents génotypes sur le continent Africain montre que les virus

appartenant au clade B sont le plus souvent retrouvés en Afrique de l’Ouest et en Afrique

Centrale, tandis que les virus du clade D se trouvent le long de la côte Est et au Sud (Figure

9). Le génotype A retrouvé en Afrique du sud reste le seul cas en Afrique. Etant donné que les

clades A et D sont également retrouvés en Europe, ces virus auraient été importés pendant la

colonisation.

Dans le cadre de la lutte contre la rougeole lancée par l’OMS, les campagnes de

vaccination de masse sont mises en œuvre dans plusieurs pays d’Afrique. Une surveillance

virologique avant la vaccination de masse est fondamentale en ce sens qu’elle permettra

d’évaluer les programmes de vaccination. Le continent Africain représente aujourd’hui une

région idéale pour suivre l’évolution de la lutte contre la rougeole par l’épidémiologie

moléculaire.

Pour cette étude, nous avons choisi deux sites :

- Le Cameroun, où la couverture vaccinale est inférieure à 50 %. Le tourisme n’y étant

pas très développé, les risques d’importation de virus sont limités. Nous avions au

laboratoire des souches de virus isolés au Cameroun en 1983.

- La Gambie, où la couverture vaccinale élevée a été maintenue au dessus de 84%

pendant ces 10 dernières années. Ce pays est situé sur la côte Ouest et ancré dans le

88


VI. Etude des souches Africaines du virus de la rougeole

2. Etudes épidémiologiques

Sénégal qui est un pays très touristique, les échanges internationaux y sont très

fréquents.

Tableau 6 : Isolement des souches de virus de la rougeole en Afrique par ordre

chronologique (1983-2000).

Année(s)

d'isolement

Pays Génotypes Références

1983 Cameroun B1 Taylor et al., 1991

1984 Gabon B2 Taylor et al., 1991

1986-1989 Afrique du Sud D2, A Kreis et al., 1997

1991 Gambie B3.2 Outlaw et al., 1997

1994 Kenya (USA)* D4 Bellini & Rota, 1998

1997-1998 Nigéria , Ghana B3.1, B3.2 Hanses et al., 1999

1998-1999 Ethiopie D4 Nigatu et al., 2001

1997-2000 Soudan B3.1 El Mubarak et al., 2002

* Virus isolé aux Etats-Unies sur un patient arrivant du Kenya

89


Figure 9 : Répartition géographique des différents génotypes du virus de la

rougeole en Afrique

Gambie

B3

B3.1 et

B3.2

B3.2

Ghana

Nigéria B1

Cameroun

Gabon

B2

B3.1

Soudan

D4

Ethiopie

D4

Kenya

A et D

Afrique du Sud


VI. Etude des souches Africaines du virus de la rougeole

2. Etudes épidémiologiques

VI.2.2. Résumé de l'article 2

Bien que le virus de la rougeole ait toujours été considéré comme sérologiquement

monotypique, la diversité génétique des isolats obtenus de différentes régions géographiques

ces dernières décennies a permis de les classer en 8 clades (Rima et al., 1995 ; WHO, 2001a).

Cette classification est basée sur les séquences nucléotidiques du gène H entier et la partie C-

terminale du gène N. Cependant, très peu d’informations sont disponibles quant à la variété

des souches de virus circulant au cours d’une même épidémie et/ou entre plusieurs épidémies

sur un même site géographique.

Des études réalisées récemment au Soudan ont montré une variation des 0-0,5% entre

les gènes H des souches isolées entre 1997 et 2000 (El-Mubarak et al., 2002). Par contre, les

études réalisées au Nigeria ont montré que deux génotypes différents du virus de la rougeole

co-circulaient à Lagos et Ibadan en 1998 (Hanses et al., 1999). Une autre étude réalisée en

Australie sur des échantillons isolés sur une période de 25 ans (1973-1998) a monté une

succession de différents génotypes de virus de la rougeole au cours du temps à Victoria

(Chibo et al., 2000).

Le but de cette étude est d’évaluer la diversité des souches de virus de la rougeole au

cours de la même épidémie et entre différentes épidémies en Afrique centrale et en Afrique de

l’ouest. Pour ce faire, nous disposions au laboratoire des souches de virus de la rougeole

isolées au Cameroun en 1983 et en Gambie en 1993. Nous avions besoin de souches récentes

et je me suis rendue à Yaoundé au Cameroun au début de l’année 2001 pour isoler les souches

de virus de la rougeole circulant au Cameroun (voir paragraphe VI.3.) afin de les analyser et

de les comparer à celles qui y avaient été isolées 18 ans auparavant, et aux souches de Gambie

(1993).

Afin d’étudier les caractéristiques génétiques de ces virus, le génome viral a été extrait

et soumis à une RT-PCR. Le gène H entier et la partie C-terminale du gène N ont été

amplifiés par PCR et séquencés.

Pour établir la variabilité des virus circulant au cours d’une même épidémie, nous

avons séquencé les gènes H et N de 3 isolats provenant de Gambie (1993) et 4 autres du

Cameroun (2001). Les résultats montrent qu’il y a une différence de 2 nucléotides (mutations

silencieuses) au niveau du gène H entre les isolats de Gambie (1993) (Annexe 4) et de 3

nucléotides entre les isolats du Cameroun (2001) dont un est responsable du changement d’un

acide aminé dans la souche CR 83 (Valine ->glycine en position 269). Par contre, aucune

91


VI. Etude des souches Africaines du virus de la rougeole

2. Etudes épidémiologiques

différence n’a été détecté dans le gène N (Annexe 5) . Ces résultats montrent qu'il y a une

forte homogénéité entre les virus de la même épidémie.

La variabilité du virus de la rougeole entre différentes épidémies survenues sur

le même site (Yaoundé) à 18 années d’écarts a été étudiée. La comparaison des séquences

des gènes H et N des souches isolées en 2001 avec celles des souches isolées en 1983 indique

une différence de 7 acides aminés dans la protéine H (Annexe 6).

L’étude phylogénétique effectuée à partir des séquences des gènes H et N montre que

les isolats de Yaoundé 2001 appartenaient au génotype B3.1 circulant au Nigeria et au Soudan

(El-Mubarak et al., 2002, Hanses et al., 1999) et non pas au génotype B1 isolé au Cameroun

en 1983. Etant donné que :

- les séquences des gènes H et N de la souche de référence pour le génotype B1 (Y14)

avaient été obtenues à partir d’un clone et n’étaient donc peut être pas représentatives

des virus circulant à Yaoundé pendant cette période.

- nous observons une grande différence entre la souches de 2001 et celles de 1983

Pour lever toute ambiguïté, nous avons séquencé à nouveau les gènes H des souches

Y14 et Y22 isolées en 1983 à partir de produit PCR direct. La séquence de Y14 que nous

avons obtenue est identique à la séquence de référence, par contre elle diffère de Y22 par 2

acides aminés seulement (Annexe 6). Les isolats de Gambie quant à eux appartenaient au

génotype B3.2 circulant au Ghana (Hanses et al., 1999). Contrairement au observations

précédentes, ces résultats montrent une grande hétérogénéité entre les virus de différentes

épidémies.

Afin de mieux établir la distribution des virus africains, nous avons séquencé un

isolat obtenu à Lyon en 1994 (Lys-1) sur un patient qui avait contracté la rougeole au cours de

son séjour en Gambie. La comparaison de la souche Lys-1 avec les souches de Gambie de

1993, indique une différence de 8 nucléotides dans le gène H (Annexe 7) et 2 dans le gène N.

Aucun changement d'acides aminés n'a été noté, ce qui confirme son origine et sa stabilité

génétique. De plus, l’analyse phylogénétique montre que la souche lys-1 appartient au

génotype B3.2 comme les souches gambiennes (1993).

Il a été montré que la souche Lys-1 comporte une mutation (Arginine->Lysine en

position 70) dans le site antigénique majeur de la protéine F (Fayolle et al., 1999). Cette

mutation a été identifiée par l’absence de réactivité de la souche Lys-1 avec l’anticorps

monoclonal dirigé contre la protéine F (F186), qui réagit avec la souche vaccinale et d’autres

souches sauvages. Etant donné que la souche Lys-1 appartient au génotype B3.2, nous avons

voulu savoir si cette mutation était spécifique à la souche Lys-1 où si elle était étendue à

92


VI. Etude des souches Africaines du virus de la rougeole

2. Etudes épidémiologiques

d’autres souches. Pour ce faire, nous avons analysé plusieurs souches de virus d’origines

différentes, appartenant au génotype B3. Les résultats montrent que toutes les souches du

génotype B3.1 réagissent à l’anticorps F186, tandis que celles du génotype B3.2 ne sont pas

reconnues par cet anticorps. L’analyse des séquences de trois souches de Gambie (génotype

B3.2) a permis de confirmer la présence de la même mutation en position 70 de la protéine F

(annexe 8).

Il a été montré que les virus du génotype B3.1 peuvent être distingués des virus du

génotype B3.2 par des tests de neutralisation avec l’anticorps BH30 dirigé contre

l’hémagglutinine. Seuls les virus du génotype B3.1 sont neutralisés par cet anticorps (Hanses

et al., 1999 ; Truong et al., 1999). Nous avons utilisé cet anticorps afin d’examiner par

cytométrie en flux sa réactivité vis-à-vis de différentes souches du génotype B3. Les résultats

montrent que l’anticorps BH30 s’attache avec la même affinité aux souches du génotype B3.1

et aux souches vaccinales. Par contre, il s’attache aux souches du génotype B3.2 avec une

affinité 10 fois inférieure à celle des souches vaccinales. L'alignement des séquences d'acides

aminés de la protéine HA des virus des génotypes B3.1 et B3.2 montre une différence de 4

acides aminés entre les deux groupes. Etant donné que seul l'acide aminé 471 est différent

entre la souche vaccinale et les virus B3.2, il est probable que cet acide aminé joue un rôle

crucial dans la reconnaissance de l'anticorps BH30.

Dans cette étude, nous avons montré que les virus appartenant au génotype B3.2

peuvent être distingués au niveau antigénique des virus appartenant au génotype B3.1 et des

souches vaccinales. L'anticorps monoclonal dirigé contre la protéine F (F186) réagit avec les

souches vaccinales et les virus des génotypes B3.1, mais ne reconnaît pas les virus du

génotype B3.2. De plus, l'anticorps monoclonal dirigé contre la protéine H (BH30) réagit avec

une moindre affinité avec les virus du génotype B3.2. L'analyse phylogénétique a permis de

montrer que les souches B3.2 circulent en Afrique de l'ouest, tandis que les virus B3.1

circulent en Afrique centrale et au Soudan. De plus nous avons montré que les souches

circulant actuellement au Cameroun (B3.1) sont différentes de celles isolées sur le même site

il y a 18 ans (B1). Il est possible que les virus isolés en 1983 n'aient pas été représentatifs des

virus circulant à cette époque, ce qui expliquerait l'absence de virus appartenant au génotype

B1 parmi les souches du Cameroun (2001) que nous avons analysées. Il est aussi possible que

les virus du génotype B3.1 aient été importés du Nigeria où les virus appartenant à ce

génotype ont été isolés (Hanses et al., 1999). Les virus B3.1 auraient été sélectivement

avantagés, à cause des campagnes de vaccination au cours desquelles les virus B1 ont été

réduits, ce qui a permis aux souches importées de mieux s'implanter au Cameroun.

93


VI. Etude des souches Africaines du virus de la rougeole

2. Etudes épidémiologiques

Cependant, la couverture vaccinale étant inférieure à 50% au Cameroun, il est possible que

d’autres facteurs soient impliqués dans la survie des souches B3.1 dans la population.

La majorité des souches appartenant au génotype B3.2 circulent en Gambie où la

couverture vaccinale a été maintenue élevée pendant ces 10 dernières années (>84%). Par

contre, les virus appartenant au génotype B3.1 circulent dans les pays où la couverture

vaccinale est faible (


VI.2.3. Article 2 : Etude des souches du virus de la rougeole circulant en

Afrique Centrale et en Afrique de l’Ouest : répartition géographique des

souches appartenant au génotype B3

95


Measles virus strains circulating in Central and West Africa: Geographical distribution

of two B3 genotypes

D. Waku Kouomou 1 , E. Nerrienet 2 , J. Mfoupouendoun 2 , G. Tene 3 , H. Whittle 4 ,

and T.F. Wild 1

1 INSERM U404, CERVI, 69365 Lyon Cedex 07, France

2 Centre Pasteur du Cameroun, BP. 1274, Yaoundé, Cameroon

3 Hôpital Central de Yaoundé, Fondation Chantal Biya, - Centre mère-enfant, BP. 87,

Yaoundé, Cameroon

4 MRC Laboratories, Fajara, PO Box 273, Banjul, The Gambia.

Short title : Epidemiology of measles in Africa

Key words : epidemiology, Cameroon, vaccination

Correspondence to : Dr T.F. Wild,

INSERM U. 404 – Immunity and Vaccination

CERVI

21, Avenue Tony Garnier,

69365 Lyon Cédex 03

France

Tel. 33 (0)4 37 28 23 92

Fax. 33 (0)4 37 28 23 91

e-mail : wild@cervi-lyon.inserm.fr

96


ABSTRACT

Africa remains one of the major reservoirs of measles infection. Molecular

epidemiological studies have permitted different measles virus isolates to be grouped into

clades and genotypes and the major group which has been identifed as indigenous to Africa is

the clade B. We have analysed the viruses from epidemics in the Gambia (1993) and in the

Cameroon (2001). In both studies, the homogeneity of the virus isolates within the epidemic

as shown by sequence analysis revealed less than 0.2% variation of nucleotides between

isolates. The measles viruses isolated in 1983 in Yaoundé, Cameroon, were designated as the

B1 genotype. However, in 2001 only viruses belonging to the B3 genotype were found in this

city. The viruses in the Gambia (1993) were also of the B3 genotype. However, these viruses

could be distinguished from each other at the antigenic level and by comparative sequence

analysis. The B3 Cameroon (2001) viruses were related to the proposed B3.1 subgroup,

whereas the Gambian (1993) isolates corresponded to the B3.2 subgroup. The geographical

distribution for the period 1993-2001 of these two viruses shows that B3.1 is found from the

Sudan to Nigeria and Ghana extending south to the Cameroon, whereas the B3.2 genotype is

found in West Africa. In Nigeria and Ghana the viruses co-circulate. The identification of

these viruses will permit more meaningful epidemiological studies following the proposed

increased measles vaccination coverage.

INTRODUCTION

Epidemiological studies are essential for the successful planning and application of

vaccination programs. The aim may be simply to reduce the disease burden or target

eradication. Measles ranks as one of the most infectious diseases and although a vaccine

exists for more than 30 years, measles is still responsible for the deaths of approximately 1

million children each year. Under optimum conditions the vaccine has a sero-conversion rate

of over 95%, but this is lower in children under 12 months of age due to the immaturity of the

immune system and the presence of maternal antibody (Gans et al., 1998). Although natural

infection gives a life-long immunity, vaccination has been shown to induce lower immune

responses (Markowitz et al, 1990) and there are a number of reports showing subsequent

infection when confronted by circulating measles viruses (Edmonson et al., 1990 ; Gustafson

et al., 1987 ; Mathias et al., 1989 ; Pedersen et al., 1989 ; Whittle et al., 1999). These may

range from silent infections to clinically diagnosed measles. Despite these reservations,

intensive vaccination campaigns in the South American continent eliminated the endogenous

virus (de Quadros et al., 1996). However, it is probable that re-introduction from outside was

the source of further epidemics in Brazil (Siqueira et al., 2001).

Measles virus is considered to be a single serotype. Over the past 20 years a number of

virus isolates have been obtained from geographically distinct regions (Rima et al., 1995 ;

Rota et al., 1996). Nucleotide sequence analysis of the different viral genes has shown that

most variation is found in the haemagglutinin (HA) and the carboxy region of the

nucleoprotein (NP). Sequence analysis of these two viral genes from different viruses has

provided a classification in which isolates are separated into 8 clades (A-H) each containing

variants or genotypes (WHO, 1998). This molecular epidemiological approach enables the

origins of the measles viruses to be traced.

Only limited information is available on the stability of measles viruses within and

between epidemics. Further the increase in vaccine coverage may impose an immunoselection

on the circulating viruses. El Mulbarak et al. (2002) have shown very little sequence

variation in the HA (0-0.5%) in measles viruses isolated in the Sudan between 1997-2000. In

contrast, Hanses et al. (1999) suggested that there were two measles virus strains cocirculating

in epidemics in Nigeria and Ghana in 1998.

97


In 1983, measles viruses isolated in Yaoundé, Cameroon. These viruses became the

reference strains for the new genotype B1. The following year (1984), measles viruses

circulating in the neighbouring Gabon were classified into a subsequent genotype, B2.

Viruses isolated in the 1990s in West Africa by several laboratories were sufficiently distant

from the previous viruses to classify them as B3 (Hanses et al., 1999). In the present study,

measles viruses circulating in the Cameroon in 2001 were compared with the strains isolated

18 years previously. It was shown that the B1 genotype was replaced by B3. Further, studies

of a number of B3 isolates from countries situated to the north of the Cameroon confirmed the

proposed heterogeneity in the B3 genotype. The viruses in the Cameroon (2001) were closely

related to the B3 isolates in the Sudan and Nigeria and differed from those found in the more

westerly situated countries.

MATERIALS AND METHODS

Patients and virus isolation

Viruses were isolated in Febuary-March 2001 from blood of patients with clinically

diagnosed measles living in Yaoundé, Cameroon. Samples were taken within 6 days after the

onset of the rash. Peripheral blood mononuclear cells were isolated by ficoll gradient

centrifugation and co-cultivated with B95a cells (Kobune et al., 1990) in DMEM

supplemented with 2% FCS. Cells were cultured for up to 10 days, but cytopathic effects

could be normally observed within 7 days. The isolated viruses were stored at – 80°C.

Viruses

Further measles virus strains representing isolates from Nigeria (1998) were obtained

from C. Muller, Luxembourg and the Sudan (1997-2000) from R. de Swart, Rotterdam. These

viruses were isolated in B95a cells and were received at the 2-3 cell passage level. Sudan –

MVi/Khartoum.SUD/36. 97/2 (SM42), MVi/Khartoum.SUD.28. 00/6 (SM00-6) (El Mubarak

et al., 2002). Nigeria MVi/Ibadan.NIE/9.98/3, NIE/10.98/3, NIE/11.98, NIE/8.98/10 (Hanses

et al., 1999). Viruses from an epidemic in the Gambia in 1993 were received as infected

lymphocytes and were subsequently co-cultivated with B95a cells (G943, G945, G954). The

Lys-1 measles virus strain was isolated from a patient in Lyon (1994) after vacationing in

West Africa (Fayolle et al., 1999). The viruses isolated and sequenced in the present study

and those obtained from other laboratories are shown with their accession numbers in Table 1.

ELISA

Measles virus specific serum IgM was determined using the Enzygnost anti-measles

virus/IgM test (Dade Behring Marburg GmbH).

RT-PCR and PCR

Total RNA was extracted from infected cells using RNA Now kit (OZYME)

according to supplier’s protocol. Specific cDNAs of NP and HA genes were synthesized by

reverse transcription at 55°C for 30 min followed immediately by amplification by PCR in the

same tube using SuperScript One-Step RT-PCR with platinum Taq (Life Technologies).

The NP gene, primers MVNPCR2 (nt 975-996,

5’GCTGGTGAGTTATCCACACTTG3’) and MVNPCR4 (nt 1701-1722,

5’GTAGGCGGATGTTGTTCTGGTC3’) were used to amplify a 747pb fragment. The PCR

cycling program consisted of denaturation for 4 min at 94°C followed by 35 cycles of 30 s at

94°C, 45 s at 55°C, 45 s at 72°C with final extension for 7 min at 72°C. All products were

held at 4°C. The HA gene was amplified as two fragments of 1247pb and 914 pb using

98


primers gHA004 (nt7254-7278, 5’GTGCAAGATCATCCACAATGTCACC3’) with

mHA1251 (nt8480-8501, 5’CGTATGAAGGAATCCTGTTATC3’), and gHA1029 (nt8258-

8278, 5’CCAACCGACATGCAATCCTGG3’) with mHA1922 (nt9151-9172,

5’GTATGCCTGATGTCTGGGTGAC3’) respectively. The PCR cycling program consisted

of denaturation for 4 min at 94°C followed by 35 cycles of 30 s at 94°C, 45 s at 57°C, 1 min

30 s at 72°C with final extension for 7 min at 72°C. All products were held at 4°C. PCR

products were electrophoresed on a 1.2% agarose gel then purified using a QUIAquick Gel

Extraction Kit (Quiagen) following the manufacturer’s instructions.

Nucleotide Sequence Determination

Purified PCR products were sequenced using a cycle sequencing reaction with ABI

Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kit (PE Biosystems). The

reaction products were analyzed on an ABI Prism automatic sequencer (Perkin Elmer).

Multiple alignment of nucleotide sequences and construction of phylogenetic trees were

carried out using the clustal X program version 1.81 (Jeanmougin et al,. 1998) and confirmed

with 1000 bootstrap replicates.

Flow cytometry

Vero-slam cells (Waku & Wild, 2002) were infected (0.1 pfu/cell) with the different

measles virus isolates. At 48 h after infection, cells were incubated for 30 min on ice with

anti-measles virus HA Mabs 55 (Giraudon & Wild, 1985) and BH30 (gift from C. Muller,

Luxembourg), anti-measles virus F Mabs 263 and 186 (Malvoisin & Wild, 1990), then

washed once with PBS, and incubated with anti-mouse immunoglobulin G-fluorescein

isothiocyanate (DAKO) for 30min on ice. After two washes with PBS, the cells were analysed

by FACScan (Becton Dickinson) analysis.

RESULTS

Measles in the Cameroon 2001

During a measles epidemic occurring in Yaoundé, Cameroon, in February-March of

2001, blood samples from children with clinically diagnosed measles were analysed. The

samples were initially examined for measles virus specific IgM and those which were positive

were subjected to virus isolation (Table 2). Of the 38 cases of measles diagnosed clinically,

measles virus specific IgM was found in 35 (92%). Twenty-one of the cases were studied for

virus isolation leading to 17 isolates (81%). The age distribution of the laboratory confirmed

cases (Table 2) showed the majority (62%) to be in the 1-5 year-old group. Amongst the

measles confirmed patients (IgM+) 57% had a vaccination history (immunised between 9-13

months) and so can be considered as primary vaccine failures.

To characterize the viruses, the entire HA gene and the 456 nucleotides of the –COOH

terminus of the NP of four isolates were analysed by RT-PCR and sequencing the resulting

products. Comparison of the nucleotide and predicted amino acid sequences showed there

was little variation in the HA, three nucleotide differences among the four viruses with only

one amino acid change in CR83 (Valine -> glycine, position 269). There were no nucleotide

differences in the NP sequence.

Phylogenetic analysis using either the HA and NP sequences, Figure 1, showed that

the Yaoundé measles virus isolates were related closely to the B3 genotype (Hanses et al.,

1999) and not to the B1 genotype isolated originally in Yaoundé in1983. These observations

were reconfirmed by resequencing the HA gene of the original and one additional isolate

(Y14, and Y22) from the 1983 epidemic using the same RT-PCR techniques. The sequences

99


obtained for the two 1983 isolates were identical and the same as that of the reference

sequence (data not shown).

B3 genotypes

Measles viruses belonging to the B3 genotype have been isolated in West Africa and

in the Sudan (Truong et al., 1999 ; El Mubarak et al,. 2002). From sequencing studies it has

been suggested that these viruses are heterogeneous and could be sub-divided into 2 groups

B3.1 and B3.2 (Hanses et al., 1999). The latter group being found to the West and the B3.1

viruses in the Sudan. Both viruses where identified in Nigeria and Ghana (Hanses et al.,

1999). The nucleotide sequence analysis of the 2001 Cameroon strains shows that they are

closely related to the B3.1 subgroup.

To substantiate further the geographical distribution of the B3 genotypes, an isolate

obtained in Lyon in 1994 (Lys-1) from a patient who had contracted measles in the Gambia

and also isolates in an epidemic occurring in the Gambia in 1993 were sequenced. The Lys-1

isolate only varied from the 1993 viruses by 8 nucleotides in the HA and NP confirming both

the origin of the Lyon virus and its genetic stability. Further, amongst three isolates examined

from the 1993 epidemic, there were a maximum of 2 nucleotides changes in the HA sequence

between isolates and in each case these were silent. Comparative analyses of the Gambian

viruses showed they were in the B3.2 subgroup.

It was observed previously that the measles virus strain Lys-1 had a mutation in the

dominant antigenic site of the F protein, arginine -> lysine at position 70 (Fayolle et al.,

1999). This was identified by the non-reactivity with an anti-F monoclonal antibody, F186

which reacts with the F protein of the vaccine strain and many other wild-type strains. Using

FACScan analysis we examined the B3 strains from a number of sources for their ability to

react with F186 (Figure 2, Table 3). These results show that all the B3.1 strains reacted with

F186, whereas B3.2 viruses were negative by FACScan analysis with this monoclonal

antibody. Sequence analysis of the F gene of 3 measles virus isolates (B3.2) from the Gambia

(1993) confirmed the same mutation at position 70 that we had previously reported ( data not

shown).

Studies by the Muller laboratory (Hanses et al., 1999, Truong et al., 1999) showed that

both B3.1 and B3.2 viruses were circulating in Nigeria and Ghana in 1997 and 1998. An anti-

HA monoclonal antibody (BH30) was able to distinguish between these B3 groups on the

basis of virus neutralisation, only B3.1 being neutralised. This monoclonal antibody was used

to examine its activity with the different B3 isolates using FACSCan analysis (Table 3, Figure

2). In comparison with an anti-HA monoclonal antibody, Cl. 55 which recognises all measles

viruses studied (Giraudon & Wild, 1985), BH30 attached to the H antigen with an affinity

approximately ten-fold less to B3.2 viruses, but with equal affinity to B3.1 and vaccine strain

viruses. Alignment of the amino acid sequences of the B3.1 and B3.2 HA proteins showed

that the two groups could be differentiated by the amino acids at positions 240, 283, 303 and

471 (Table 4). It is probable as previously suggested by Truong et al. (1999) that amino acid

471 plays a role in the recognition by monoclonal BH30 as the other three amino acids of

B3.2 strains are the same as the vaccine strain.

100


DISCUSSION

The major features that make measles a target for eradication is that there is a single

serotype and the only natural host is man. Sequence analysis of the measles virus genes has

enabled the differentiation of measles virus isolates from geographically different origins into

8 clades and 21 genotypes (WHO, 2001). Although these viruses may have initially been

more restricted geographically, the advent of modern travel has led to a more global

distribution of the different genotypes. This is more evident in countries where there has been

intensive vaccination programs and the only subsequent measles cases were due to the

importation of the virus. This was the case in the South American continent (de Quadros et

al., 1996) and is still the situation in the USA (Bellini & Rota, 1998).

The African continent is one of the greatest challenges to the eradication campaign. As

it represents one of the largest reservoirs of endemic measles, it is important to establish the

epidemiology of both the transmission within and between epidemics and the virus strains

involved. The B clade viruses are found in regions of Central Africa and in countries from

West Africa to the Sudan. The clades A and D are found on the East coast stretching down to

South Africa (Kreiss et al., 1997 ; Nigatu et al., 2001). Apart from two exported isolated

infections, the B clade viruses have not been reported elsewhere. The first B clade viruses

(B1) were isolated in 1983 in the Cameroon and measles viruses isolated the following year

in the Gabon were sufficiently different to be designated as a B2 genotype. Subsequent

measles virus isolates in countries to the north (Gambia, Ghana, Nigeria : Hanses et al.,

1999 ; Truong et al., 1999 & the present paper) showed the viruses to be more heterogeneous

and has led to the suggested grouping as B3.1 and B3.2.

The vaccines used today whether they are based on the Edmonston strain which was

isolated in 1954 or other isolates are clade A viruses. Although it has been reported that there

are differences in the in vitro efficiency of virus neutralisation by serum from natural

infection and immunised individuals (Klingele et al., 2000 ), it is generally agreed that sera

from vaccinated children have lower levels of neutralising antibody than after natural

infection (Christenson et al., 1994). The efficiency of protection after vaccination varies with

a number of factors including age and time after immunisation (Christenson et al. 1994).

However, there are now a number of well documented studies showing that measles can

propagate in vaccinated populations giving rise to a range of conditions from silent infections

to clinical measles (Edmonson et al., 1990 ; Gustafson et al., 1987 ; Mathias et al,. 1989 ;

Pedersen et al., 1989 ; Whittle et al., 1999). Studies have established that although seroconversion

after vaccination can be > 95%, protection can decline to 66% over 10 years

(Samb et al., 1993 ; Cisse et al.,1999). This would have serious consequences in an

eradication campaign as not only are the children not protected long term, but it could

eventually lead to the immuno-selection of viruses which were less efficiently dealt with by

the present vaccine. Thus, in the present study one of our initial aims was to examine the

change in the endemic viruses over an 18 year period against known vaccination coverage.

However, the viruses we isolated in the Cameroon in 2001 belonged to the B3 genotype and

so had not been derived from the virus isolated 18 years previously, but presumably were

imported from neighbouring countries. Within the epidemic the viruses were extremely

stable diplaying a maximum of 3 nucleotides different in the HA and none in the NP. No

viruses related to the original B1 viruses were isolated.

Amongst possible explanations of our observations are that the B1 viruses isolated in

1983 were not representative of the majority of the measles viruses present in the Cameroon

at this time. Alternatively, after importation, the present B3 strain may have had a selective

advantage. This may be due to its arrival following vaccination campaigns in which the level

of circulating B1 was reduced or this virus strain may have a selective advantage for other

101


easons. The available data for measles vaccination in the Cameroon show that in 1993 only

32% of the children were vaccinated and by 2000 this only rose to 49%.

More detailed phylogenetic analysis of the 2001 Cameroon viruses showed they were

closely related to the B3 viruses isolated in the Sudan between 1997-2000 (El Mubarak et al.,

2002) and certain isolates from Nigeria and Ghana in 1998 (Hanses et al., 1999). It has been

previously proposed to separate the B3 viruses into the subgroups B3.1 and B3.2. As the

present analysis was extended to the study of B3 viruses from the Gambia in 1993 and 1994,

it was established that the B3.2 viruses are found in the more westerly countries and the B3.1

viruses in the Sudan. Both viruses were circulating in Ghana and Nigeria. The Cameroon

2001 viruses belonged to the B3.1 group. It was shown previously that the strain Lys-1 was

mutated in the dominant antigenic site on the F protein (Fayolle et al.,1999). In the present

study, we observed that this mutation was common to all B3.2 strains and that the B3.1

viruses did not have this mutation confirming the subgrouping of these viruses. Thus,

sequence analysis of the HA and NP genes, plus antigenic analysis of the F protein confirm

that the Cameroon 2001 viruses are closely related to the B3.1 viruses circulating in the

Sudan (1997-2000) and Nigeria (1998).

The present studies have shown that the B3.2 viruses could be distinguished from the

B3.1 and vaccine strains at the antigenic level. A monoclonal antibody against F (F 186)

reacted with the vaccine and B3.1 strains but not with B3.2. Further, an anti-HA monoclonal

had a greatly reduced affinity for B3.2 strains. The majority of these latter strains were

originally isolated in 1993 in the Gambia where high levels of vaccination had been

maintained (84%) over a 10 year period (Whittle et al.,1999). In contrast, the other countries

had much lower levels of vaccination. However, it may be fortuitous that these antigenic

markers are associated with these strains. It may therefore be important to monitor such

changes in these countries with the proposed increase in vaccination levels.

In the future the measles vaccine coverage in the African countries will be increased

in an effort to control the disease. The identification of the circulating virus strains during

this period will help to monitor the vaccine strategy in order to be most effective.

ACKNOWLEDGEMENTS

The studies were supported by a grant from the Région Rhône-Alpes. Diane Waku

Kouomou received scholarships from the French Foreign Ministry and Fondation pour la

Recherche Médicale. We would like to thank F. Pradel for advice in setting up the PCRsequencing,

L. Duret for an introduction to phylogenetic methods, C. Muller (Luxembourg)

for viruses, R. de Swart (Rotterdam) for viruses and access to sequence data prior to

publication and B. Maret for editorial assistance.

102


REFERENCES

Bellini WJ, Rota PA. 1998. Genetic diversity of wild-type measles viruses:

implications for global measles elimination programs. Emerg Infect Dis 4(1):29-35 .

Christenson B, Bottiger M. 1994. Measles antibody: comparison of long-term

vaccination titres, early vaccination titres and naturally acquired immunity to and booster

effects on the measles virus. Vaccine 12:129-133.

Cisse B, Aaby P, Simondon F, Samb B, Soumare M, Whittle H. 1999. The role of

schools in the transmission of measles in rural Senegal: implications for measles control in

developing countries. Am J Epidemiol 149(4):295-301.

de Quadros CA, Olivé JM, Hersh BS, Strassburg MA, Henderson DA, Brandling-

Bennett D, Alleyne, GAO. 1996. Measles elimination in the Americas. JAMA 275(3):224-

229.

Edmonson MB, Addiss DG, McPherson JT, Berg JL, Circo SR, Davis JP. 1990. Mild

measles and secondary vaccine failure during a sustained outbreak in a highly vaccinated

population. JAMA 263:2467-2471.

El Mubarak HS, van de Bildt MWG, Mustafa OA, Vos HW, Mukhtar MM, Ibrahim

SA, Andeweg AC, El Hassan AM, Osterhaus ADME, de Swart RL. 2002. Genetic

characterization of wild type measles viruses circulating in suburban Khartoum 1997-2000. J

Gen Virol (in press)

Fayolle J, Verrier B, Buckland R, Wild TF. 1999. Characterization of a natural

mutation in an antigenic site on the fusion protein of measles virus involved in neutralization.

J Virol 73(1): 787-790.

Gans HA, Arvin AM, Galinus J, Logan L, DeHovitz R, Maldonado Y. 1998.

Deficiency of the humoral immune response to measles in infants immunized at age 6

months. JAMA 280:527-532.

Giraudon P, Wild TF. 1985. Correlation between epitopes on hemagglutinin of

measles virus and biological activities: passive protection by monoclonal antibodies is related

to their hemagglutination inhibiting activity. Virology 144: 46-58.

Gustafson TL, Lievens AW, Brunell PA, Moellenberg RG, Buttery CM, Sehulster

LM. 1987. Measles outbreak in a fully immunized secondary-school population. N Engl J

Med 316:771-774.

Hanses F, Truong AT, Ammerlaan W, Ikusika O, Adu F, Oyefolu AO, Omilabu SA,

Muller CP. 1999. Molecular epidemiology of Nigerian and Ghanaian measles virus isolates

reveals a genotype circulating widely in western and central Africa J Gen Virol 80(4):871-

877.

Jeanmougin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ. 1998. Multiple

sequence alignment with Clustal X. Trends Biochem Sci 23 :403-405.

Klingele M, Hartter HK, Adu F, Ammerlaan W,. Ikusika W, Muller CP. 2000.

Resistance of recent measles virus wild-type isolates to antibody- mediated neutralization by

vaccinees with antibody. J Med Virol 62(1):91-98.

Kobune F, Sakata H, Sugiura A. 1990. Marmoset lymphoblastoid cells are a sensitive

host for isolation of measles virus. J Virol 64:700-705 .

Kreiss S, Vardas E, Whistler T 1997. Sequence analysis of the nucleocapsid gene of

meales virus isolates from South Africa identifies a new genotype. J Gen Virol 78 :1581-

1587.

103


Malvoisin E, Wild TF. 1990. Contribution of measles virus fusion protein in protective

immunity: Anti-F monoclonal antibodies neutralize virus infectivity and protect mice against

challenge. J Virol 64: 5160-5162.

Mathias R, Meekison JW, Arcand TA, Schlechter MT. 1989. The role of secondary

vaccine failures in measles outbreaks. Am J Pub Health 79 :475-478.

Markowitz LE, Preblud SR, Fine PEM, Orenstein WA. 1990. Duration of live measles

vaccine induced immunity. Pediatr Infect Dis J 9 : 101-110.

Nigatu W, Jin L, Cohen BJ, Nokes DJ, Etana M, Cutts, FT, Brown DWG. 2001.

Measles virus strains circulating in Ethiopia in 1998-1999 : Molecular characterisation using

oral fluid samples and identification of a new genotype. J Med Virol 65 :373-380.

Pedersen IR, Mordhorst CH, Glikmann G, von Magnus H. 1989. Subclinical measles

infection in vaccinated seropositive individuals in arctic Greenland. Vaccine 7 :345-348.

Rima BK, Earle JAP, Yeo RP, Herlihy L, Baczko K, ter Meulen J, Carabaña J,

Caballero M, Celma ML, Fernandez-Muñoz R. 1995. Temporal and geographical distribution

of measles virus genotypes. J Gen Virol 76:1173-1180.

Rota J, Heath JL, Rota PA, King GE, Celma LM, Carabaña J, Fernandez-Muñoz R,

Brown D, Jin L, Bellini WJ. 1996. Molecular epidemiology of measles virus: identification of

pathways of transmission and implications for measles elemination. J Inf Dis 173: 32-37.

Samb B, Aaby P, Whittle H, Coll Seck AM, Somondon F. 1993. Protective efficacy of

high-titre measles vaccines administered from the age of five months in rural Senegal. Tran R

Soc Trop Med Hyg 87: 697-701.

Siqueira MM, Castro-Silva R, Cruz C, Oliveira I.C, Cunha GM, Mello M, Rota PA,

Bellini WJ, Friedrich F. 2001. Genomic characterization of wild-type measles viruses that

circulated in different states in Brazil during the 1997 measles epidemic. J Med Virol

63(4):299-304.

Truong AT, Kreis S, Ammerlaan W, Hartter, HK, Adu F, Omilabu SA, Oyefolu AO,

Berbers GAM, Muller CP. 1999. Genotypic and antigenic characterization of hemagglutinin

proteins of African measles virus isolates. Virus Res 62 :89-95.

Waku Kouomou D., Wild TF. 2002. Adaptation of wild-type measles virus to tissue

culture. J Virol 76(3):1505-1509.

Whittle HC, Aaby P, Samb B, Jensen H, Bennett J, Simondon, F. 1999. Effect of

subclinical infection on maintaining immunity against measles in vaccinated children in West

Africa. Lancet 353(9147):98-102.

WHO. 1998. Expanded programme on immunization – standardization of the

nomenclature for describing the genetic characteristics of wild-type measles viruses. Weekly

Epidemiological Record 73:265-269.

WHO. 2001. Nomenclature for describing the genetic characteristics of wild-type

measles viruses (update). Weekly Epidemiological Record 76 :242-247.

104


A

)

Hunan.CHN/93/7

Beijing.CHN/94/1

Yaounde.CAE/9.01

0.01

Genotype

H1

H2

86

Yaounde.CAE/8.01

Yaounde.CAE/6.01

Yaounde.CAE/5.01

96

81

Ibadan.NIE/11.98

Ibadan.NIE/97/1

Ibadan.NIE/10.98/3

B3.

1

Khartoum.SUD/28.00/6

Khartoum.36.97/1

97

Ibadan.NIE/9.98/3

Ibadan.NIE/8.98/10

96

94

New York.USA/94

Gambia/93 (G954)

B3.

2

Lyon.FRA/94 (Lys-1)

Yaounde.CAE/83/14

B1

Libreville.GAB/84/96

MVs/Madrid.SPA/94-SSPE

Edmonston-wt.USA/54

B2

F

A

90

Madrid.SPA/79

“JM”USA/77

Braxator.DEU/71

Johannesburg.SOA/88/1

C1

C2

E

D2

80

Victoria.AUS/16.85

Manchester.UNK/30.94

Palau.BLA/93

Montreal.CAN/89

Chicago.USA/89/1

New-Jersey.USA/94/1

Bristol.UNK/74

Berkeley.USA/83

D7

D8

D5

D4

D3

D6

D1

G1

98

MVs.Victoria.AUS/24.99

Amsterdam.NET/49.97

g3

G2

Fig 1 : Phylogenetic analysis of African measles isolates based on NP gene (A) and HA gene (B).

Significant bootstrap values (>80%) are indicated.

105


106

0.005

100

82

100

86

98

New York.USA/94

91

98

98

100

98

98

100

93

100

100

100

97

88

Khartoum.SUD/28.00/6

Berkeley.USA/83

Hunan.CHN/93/7

Beijing.CHN/94/1

Bristol.UNK/74

Johannesburg.SOA/88/1

New-Jersey.USA/94/1

Chicago.USA/89/1

Palau.BLA/93

Montreal.CAN/89

Victoria.AUS/16.85

Manchester.UNK/30.94

Braxator.DEU/71

“JM”USA/77

Gambia/93 (G954)

Lyon.FRA/94 (LYS-1)

Ibadan.NIE/9.98/3

IbadanNIE/8.98/10

Yaounde.CAE/5.01

Yaounde.CAE/9.01

Yaounde.CAE/8.01

Yaounde.CAE/6.01

Ibadan.NIE/10.98/3

Ibadan.NIE/11.98

Khartoum.SUD/36.97/1

Yaounde.CEA/83/14

Libreville.GAB/84/96

Madrid.SPA/79

Edmonston-wt.USA/54

MVs/Madrid.SPA/94-SSPE

MVs.Victoria.AUS/24.99

Amsterdam.NET/49.97

Ibadan.NIE/97/1

B3.1

B3.2

B)

Genotype


F

HA

Halle

Clade B3.1

Clade B3.2

Fig 2 : Flow cytometry analysis of African measles virus infected Vero-SLAM cells.

The cells were stained with anti-F(mabs 263 and186) or anti-HA(mabs 55 and BH30).

The solid line is infected cells (mabs HA 55 and F263). Gray filled histograms are mabs

HA BH30 and F 186. Dotted line is non-infected control cells.

107


Table 1 : African measles strains used in this study.

Laboratory

name

Description

Accession number

HA gene NP gene

Y14 MVi/yaounde.CAE/83 AF079552 mvu01998

Lys-1 MVi/Lyon.FRA/94 AF484953* AF484944

G943 MVi/Gambia/93 AF484954 Not done

G945 MVi/Gambia/93 AF484955 Not done

G954 MVi/Gambia/93 AY059391 AF484943

SM42 MVi/Khartoum.SUD/36.97/2 K36972 AF311791

Nie 8 MVi/Ibadan.NIE/8.98/10 AJ239140 AJ232191

Nie 9 MVi/Ibadan.NIE/9.98/3 AJ239151 AJ232774

Nie 10 MVi/Ibadan.NIE/10.98/3 AJ239164 AJ232215

Nie 11 MVi/Ibadan.NIE/11.98 AJ239168 AJ232781

SM00-6 MVi/Khartoum.SUD/28.00/06 K28006 AF311819

CR67 MVi/yaounde.CAE/5.01 AF484949 AF484945

CR72 MVi/yaounde.CAE/6.01 AF484950 AF484946

CR82 MVi/yaounde.CAE/8.01 AF484951 AF484947

CR83 MVi/yaounde.CAE/9.01 AF484952 AF484948

* Sequences in bold were obtained in this work

TABLE 2 : Age distribution of clinicaly diagnosed and

laboratory confirmed measles cases

Age group

(years)

Clinicaly diagnosed

cases (%)

ELISA confirmed

(IgM) cases(%)

0 - 1 8 (21) 6 (17,1)

1 - 5 22 (57,8) 22 (62,8)

5 - 10 5 (13,1) 4 (11,4)

10 - 15 2 (5,2) 2 (5,7)

15+ 1 (2,6) 1 (2,8)

Total 38 35

108


Table 3 : FACScan analysis of measles virus strains using monoclonal antibodies to the HA and

F glycoproteins

Origin

Laboratory

name

F263 F186 HA 55 HA BH30 Genotype

Cameroon CR67 ++++* +++++ ++++ ++++ B3.1

Cameroon CR72 ++++ ++++ ++++ ++++ B3.1

Cameroon CR82 ++++ ++++ ++++ ++++ B3.1

Cameroon CR83 ++++ ++++ ++++ ++++ B3.1

Nigeria Nie 10 ++++ ++++ ++++ ++++ B3.1

Nigeria Nie 11 ++++ ++++ ++++ ++++ B3.1

Sudan SM00-6 ++++ ++++ ++++ ++++ B3.1

Sudan SM42 ++++ ++++ ++++ ++++ B3.1

Nigeria Nie 8 ++++ - ++++ ++ B3.2

Nigeria Nie 9 ++++ - ++++ ++ B3.2

France Lys-1 ++++ - ++++ ++ B3.2

Gambia G943 ++++ - ++++ ++ B3.2

Gambia G945 ++++ - ++++ ++ B3.2

Gambia G954 ++++ - ++++ ++ B3.2

Vaccine strain Halle ++++ ++++ ++++ ++++ A

* Intensity of recognition, see figure 2.

Table 4 : Comparison of amino acids within clade B isolates. Specific mutations in HA and NP genes for clades B3.1 and B3.2

Edmonston

Amino acid Clade B1

Clade B3.1

Clade B3.2

Vaccine

Position

strain

Y14 NIE 10 CR67 CR72 CR82 CR83 SM00-6 SM42 NIE 8 LYS-1 G954

HA gene

240 S S N N N N N N N S S S

283 D D G G G G G G G D D D

303 E E D D D D D D D E E E

471 E E E E E E E E E A A A

N gene

443 S S S S S S S S S G G G

451 Y Y H H H H H H H Y Y Y

509 G G D D D D D D D G G G

109


VI.3. LA ROUGEOLE AU CAMEROUN : ETUDE DE 38 CAS

CLINIQUES. DIAGNOSTIC SEROLOGIQUE, ISOLEMENTS VIRAUX

ET CARACTERISATION GENETIQUE

110


VI. Etude des souches Africaines duVR

3. La rougeole au Cameroun : Isolement viraux

VI.3.1 Introduction

La rougeole est une maladie endémique au Cameroun. Elle sévit pendant toute

l’année, mais on observe un pic épidémiologique pendant la saison sèche (mois de mars,

avril). En 2001, 23934 cas de rougeole, dont 352 décès, ont été déclarés au Cameroun. La

rougeole est donc un problème de santé publique dans ce pays.

L’OMS a lancé une campagne de surveillance des cas de rougeole et d’éradication

future de cette maladie au Cameroun. Etant donné qu’il est difficile de distinguer la rougeole

des autres maladies virales à exanthème (Cutts & Brown, 1995), il est conseillé de confirmer

les cas de rougeole par un test d’anticorps IgM spécifiques de la rougeole sur un prélèvement

sanguin effectué dans les 4 semaines qui suivent l’éruption. Pour ce faire, un réseau de

laboratoires a été mis en place dans plusieurs pays. Le Centre Pasteur de Yaoundé est le

Laboratoire de Référence National au Cameroun pour ce projet et dans ce contexte, le

diagnostic sérologique a été mis en place au laboratoire de virologie du Centre Pasteur de

Yaoundé en juin 2000.

Ce travail réalisé au Centre Pasteur de Yaoundé en février et mars 2001 a contribué à

mettre en place la technique d’isolement du virus de la rougeole au Cameroun, en

collaboration avec l’unité INSERM 404, Immunité et vaccination, un des Laboratoire de

Référence Mondiaux de OMS pour la rougeole en France.

VI.3.2. Objectif

L’objectif général de notre étude est d’aborder la problématique de la diversité

génétique du virus de la rougeole au Cameroun.

Les objectifs spécifiques viseront d’une part à mettre en place les techniques

d’isolements viraux en complément du sérodiagnostic déjà en place au laboratoire de

virologie au Centre Pasteur de Yaoundé. D’autre part, l’amplification des gènes des virus

isolés et leur analyse nucléotidique nous apporteront des premiers éléments d’information

quant à la circulation de différents génotypes à Yaoundé, et la présence éventuelle de

certaines mutations décrites dans la littérature. Nous étudierons par la suite la variabilité du

virus de la rougeole à l’intérieur d’une épidémie et entre différentes épidémies.

Enfin, ces donnés compléteront celles que nous avons obtenues avec les souches

rougeoleuses camerounaises isolées en 1983.

111


VI. Etude des souches Africaines duVR

3. La rougeole au Cameroun : Isolement viraux

VI.3.3. Stratégie expérimentale

Notre stratégie consiste à confirmer par sérologie IgM les cas cliniques suspects de

rougeole. A partir de prélèvements sanguins, les cellules mononucléées du sang périphérique

(PBMC) seront isolées sur gradient de ficoll. Pour isoler le virus, les PBMC activées avec la

PHA seront mises en coculture avec des cellules B95a (Kobune et al., 1990). Les gènes

codant pour l’hémagglutinine et la nucléoprotéine seront amplifiés par RT-PCR, puis

séquencés. Une étude phylogénétique sera réalisée par la suite.

112


VI. Etude des souches Africaines duVR

3. La rougeole au Cameroun : Isolement viraux

Figure 10 : Stratégie Expérimentale

Malade

Diagnostic

Clinique

Positif

Négatif

Diagnostic sérologique (Rougeole/Rubéole)

ELISA IgM

Positif

Négatif

Ficoll

PBMC

2 eme Prélèvement

B95a

6 jours

Analyses

Phylogénétiques

Positif

Négatif

Séquençage

Réinfection

des B95a

Extraction d’ARN

après 48h

RT-PCR

Gènes

amplifiés

Syncytia

113


VI. Etude des souches Africaines duVR

3. La rougeole au Cameroun : Isolement viraux

VI.3.4. Matériels et méthodes

VI.3.4.a. Patients

Le matériel clinique est prélevé sur des enfants présentant des signes cliniques de la

rougeole (fièvre, toux, conjonctivite, coryza, éruption cutanée). La collecte des échantillons

fait partie de la surveillance des cas de rougeole à Yaoundé, lancé par le PEV (Programme

élargi de vaccination) et l’OMS. Les échantillons collectés pendant les mois de février et mars

2001 sont présentés dans cette étude.

VI.3.4.b. Echantillons

Les prélèvements sanguins sont effectués sur des tubes citratés (environ 2-3ml). Les

cellules mononucléées du sang périphérique (PBMC) sont isolées sur gradient de ficoll, puis

stimulées avec de la phytohémagglutinine dans du RPMI contenant 10% de sérum de veau

fœtal (SVF) pendant 24h dans une étuve à 37°C contenant 5% de CO 2 .

VI.3.4.c. Sérologie

Les signes cliniques de la rougeole et de la rubéole étant très semblables, le test

sérologique est effectué pour la rougeole en parallèle avec celui de la rubéole. Le prélèvement

sanguin est décanté par centrifugation à 2500 rpm pendant 10mn à 20°C. Le taux d’IgM dans

le plasma est mesuré par ELISA. Le plasma est dilué au 1/21 e dans le tampon de dilution du

Kit Ezygnost Anti-Masern virus/IgM (DADE BEHRING). A 200l d’échantillon dilué, on

rajoute un volume égal de RF-absorbant (anticorps de mouton dirigés contre le fragment Fc

de l’IgG humaine). Ce mélange est incubé 15mn à température ambiante, puis 150l sont

rajoutés dans les puits des plaques ELISA contenant ou non l’antigène de la rougeole. Après

1h d’incubation à 37°C, les plaques sont lavées trois fois avec la solution de lavage

diluée, puis incubées avec le conjugué anti-IgM humaine. Après une autre heure d’incubation,

les plaques sont encore lavées et colorées en utilisant du Téraméthylbenzidine dichlorure

comme substrat. La réaction est arrêtée après 30mn d’incubation avec la solution d’arrêt

(acide sulfurique 0,5N). La densité optique est lue à 450nm.

114


VI. Etude des souches Africaines duVR

3. La rougeole au Cameroun : Isolement viraux

VI.3.4.d. Isolement du virus

Le virus de la rougeole est isolé à partir de PBMC (2x10 6 cellules) stimulées avec

1g/ml de PHA mises en co-culture avec des B95a (5x10 6 cellules) dans du milieu DMEM

contenant 2% de SVF. Dans les cas d’isolement positif, les effets cytophatiques (CPE) sont

observés après 4 à 7 jours de culture à 37°C. Dans ce cas, les cellules et le milieu de culture

sont mis à –80°C pendant 24h, puis centrifugés à 1500rpm pendant 10mn. Le surnageant

enrichi en virus est aliquoté et conservé à –80°C. Les cellules B95a (10x10 6 cellules) sont

réinfectées avec 1ml de ce surnageant pendant 3 heures à 37°C. L’extraction d’ARN a lieu 48

heures après.

VI.3.4.e. Extraction d’ARN

Les cellules B95a infectées sont lysées par addition de RNA Now (OZYME) à raison

de 1ml de réactif pour 5-10 x10 6 cellules. L’homogénat est aliquoté en volumes de 1ml auquel

on rajoute 0,2ml de chloroforme, puis on mélange par simple inversion de tube. Après 5mn

d’incubation sur la glace, l’échantillon est centrifugé à 13000 rpm pendant 10mn et la phase

acqueuse supérieure contenant l’ARN est récupérée. L’ARN est prépicité par addition d’un

volume égal d’isopropanol suivie d’une incubation d’une heure à –80°C. L’échantillon est

centrifugé à 13000rpm pendant 15mn. Le culot d’ARN est lavé deux fois avec de l’éthanol

70% et séché à température ambiante pendant 20mn. Le culot d’ARN est repris dans de l’eau

distillée stérile.

VI.3.4.f. RT-PCR

La présence de l’ARN viral dans l’échantillon d’ARN total est détectée par RT-PCR

en utilisant des amorces permettant d’amplifier les gènes qui codent pour l’hémagglutinine et

la nucléoprotéine. La séquence des amorces est déterminée en se basant sur la séquence

nucléotidique de la souche Edmonston. Les gènes sont amplifiés en utilisant le kit Superscript

one-step RT-PCR System (Life Technologies).

Pour amplifier un fragment (750 pb) du gène de la nucléoprotéine, nous avons utilisé les

amorces suivantes :

- MVNPCR2, 5’ GCTGGTGAGTTATCCACACTTG 3’ et

- MVNPCR4, 5’ GTAGGCGGATGTTGTTCTGGTC 3’

115


VI. Etude des souches Africaines duVR

3. La rougeole au Cameroun : Isolement viraux

Le brin de cDNA est d’abord synthétisé à 55°C pendant 30mn, puis le programme

d’amplification comporte une étape de dénaturation de 2mn à 94°C, suivie de 35 cycles de

30s à 94°C, 30s à 55°C, 30s à 72°C, avec une extension finale de 7mn à 72°C.

Pour obtenir le gène codant pour la protéine H, nous avons utilisé les amorces suivantes :

CRMHPCR1 : 5’ CTTAGGGTGCAGGATCCTCCACAATGTCACC 3’

CRMHPCR2 : 5’ TTAATTCTGATGTCGAATTCACACTAGTGGG 3’

Le brin de cDNA est d’abord synthétisé à 55°C pendant 30mn, puis le programme

d’amplification comporte une étape de dénaturation de 2mn à 94°C, suivie de 35 cycles de

30s à 94°C, 30s à 60°C, 2mn à 72°C, avec une extension finale de 7mn à 72°C.

Tous les produits PCR sont conservés à +4°C et séparés sur un gel d’agarose à 1,2%

contenant du bromure d’éthidium. Les bandes d’ADN sont observées sous lampe

ultraviolette.

VI.3.5. Resultats

VI.3.5.a. Diagnostic clinique

Les cas présentés dans cette étude nous ont été rapportés par le Pavillon Mère et

Enfant de la Fondation Chantal BIYA de l’Hôpital Central de Yaoundé. Les 38 patients

vivant en zone urbaine, âgés de 8 mois à 15 ans ont été cliniquement diagnostiqués comme

souffrant de la rougeole. Les prélèvements sanguins ont été effectués entre le 1 er et le 17 ème

jour après l’éruption. Notons que pour certains cas certaines informations ne sont pas

disponibles, notamment le sexe, l’âge, l’histoire de la vaccination. 20 patients parmi les 38

auraient déjà reçu au moins une dose de vaccin.

VI.3.5.b. Diagnostic sérologique

Le dosage des IgM contenues dans le plasma par ELISA a permis de confirmer 35 cas.

Les 3 autres cas étaient négatifs. Un deuxième prélèvement a été demandé pour confirmer les

cas négatifs. Un seul cas de rubéole a été diagnostiqué sérologiquement.

VI.3.5.c. Diagnostic virologique

En plus du diagnostic sérologique, l’isolement du virus de la rougeole a été réalisé à

partir de PBMC de patients. Comme le montre le tableau 7, parmi les 35 cas confirmés en

sérologie, 21 ont été testés en culture. Le virus a été isolé dans 17 cas, les 4 autres étant

négatifs. Les 14 autres cas n’ont pas encore été testés en culture.

116


VI. Etude des souches Africaines duVR

3. La rougeole au Cameroun : Isolement viraux

VI.3.5.d. RT-PCR

L’isolement de virus a été confirmé par RT-PCR en utilisant des amorces spécifiques

au virus de la rougeole. Le gène codant pour la nucléoprotéine a été amplifié pour les 8 cas

testés. Nous avons obtenu un fragment d’ADN de taille attendue (environ 750 pb) qui

correspond à la partie C-terminale du gène de la nucléoprotéine. Le gène codant pour

l’hémagglutinine a été amplifié pour les 8 cas testés. Nous avons obtenu un fragment d’ADN

de taille attendue (environ 2000 pb) qui contient le gène entier de l’hémagglutinine. Les 9

autres virus isolés n’ont pas encore été testés par RT-PCR.

117


VI. Etude des souches Africaines duVR

3. La rougeole au Cameroun : Isolement viraux

Tableau 7 : Résumé des données des patients et résultats de laboratoire

Numéro Sexe a Age

(mois)

Vaccin c Eruption d IgM R/r e

(plasma)

Isolement de Virus

(PBMC)

RT-PCR

(H et N)

R063 F 168 1 1j +/- + +

R064 F 32 0 2j +/- + NF

R065 F 12 0 5j +/- + NF

R066 F 48 1 3j +/- + +

R067 F 40 1 3j +/- + +

R068 F 76 1 4j +/- + +

R069 F 60 1 3j +/- + +

R070 M 19 0 9j +/- + NF

R071 M 8 0 4j +/- - NF

R072 F 8 0 6j +/- + +

R073 M 20 1 7j +/- - NF

R074 F 22 1 1j +/- - NF

R075 F 24 1 3j +/- - NF

R076 M 11 1 7j +/- + NF

R077 DND b 9 0 DND +/- + NF

R078 DND 48 0 DND +/- + NF

R079 F 14 0 4j +/- + NF

R080 F 18 0 DND +/- + NF

R081 F 42 0 9j +/- + NF

R082 F 8 0 1j +/- + +

R083 DND 60 DND DND +/+ + +

R084 DND 7 0 DND -/- NF f NF

R085 M 13 0 5j +/- NF NF

R086 F 11 0 DND +/- - NF

R087 F 36 1 8j +/- - NF

R088 M 181 DND 10j +/- - NF

R089 F 69 1 DND +/- NF NF

R090 F 92 1 11j +/- NF NF

R091 M 87 1 12j +/- NF NF

R092 F 36 2 11j +/- NF NF

R093 M 120 1 10j -/- NF NF

R094 F 24 2 17j +/- NF NF

R095 F 19 0 11j +/- NF NF

R096 M 9 1 16j -/- NF NF

R097 M 54 1 DND +/- NF NF

R098 F 30 1 DND +/- NF NF

R099 F 135 0 DND +/- NF NF

R100 M 23 1 DND +/- NF NF

a F, féminin ; M, masculin

b DND, donnée non disponible

c nombre de doses de vaccin reçues

d Jours après éruption

e R , Rougeole ; r, Rubéole

f NF, non fait

118


VI. Etude des souches Africaines duVR

3. La rougeole au Cameroun : Isolement viraux

VI.3.6. Discussion

Au cours de ce travail, nous avons analysé sérologiquement 38 cas cliniques de

rougeole à Yaoundé au Cameroun. La mesure du taux d’IgM a montré que dans 35 cas (92%),

la maladie est due à l’infection par le virus de la rougeole. Dans les trois autres cas (8%), la

maladie avait une autre cause. Les échecs de diagnostic (même effectué par des médecins

expérimentés) ont souvent été rapportés (Ferson et al., 1995). Il est connu que plusieurs autres

agents infectieux, comme le virus de la rubéole, l’adénovirus, le parvovirus B19, l’herpes

virus humain de type 6 (HHV6), entraînent des symptômes qui peuvent être confondus avec

la rougeole (Nur et al., 1999), d’où l’importance des techniques de diagnostic au laboratoire

dans la confirmation des cas de rougeole. Le diagnostic sérologique a permis de détecter dans

cette étude un cas de coinfection par le virus de la rougeole et le virus de la rubéole.

L’isolement viral est l’une des meilleures techniques de diagnostic pour les cas

suspects de rougeole (surtout chez des sujets immunodéprimés pour lesquels le diagnostic

clinique et sérologique sont difficiles). Cependant, cette méthode comporte certains aléas

puisque sur les 21 cas positifs en ELISA IgM qui ont été mis en culture, 17 virus (78%) ont

été isolés. Les 4 autres étaient négatifs. La discordance entre les tests IgM positifs et

l'isolement négatif du virus pourait être le signe d'une vaccination antérieure de quelques

semaines et l'éruption serait due à autre virus (adénovirus, HHV6 etc). Cette discordance

pourrait aussi être due à des problèmes pratiques liés :

- au volume de l’échantillon, le prélèvement sanguin est difficile à effectuer sur les enfants

et les nourrissons,

- au conditionnement de l’échantillon, le virus de la rougeole étant thermolabile,

l’échantillon doit être transporté rapidement au laboratoire,

- a la date du prélèvement ; en fait, pour optimiser l’isolement du virus, le prélèvement doit

être effectué dans les 4 jours qui suivent l’éruption.

Dans certains cas, le virus a été isolé à partir de prélèvements effectués 6, 7 voire

même 9 jours après l’éruption. Ceci peut s’expliquer par le fait que les parents ne retiennent

pas toujours la date exacte de l’éruption. On peut aussi penser à des patients immunodéprimés

qui n’arrivent pas à fabriquer les anticorps et qui n’éliminent pas facilement le virus. En effet

les travaux de Permar et al., (2001) montrent que l’ARN du virus de la rougeole est détectable

chez les enfants infectés par le VIH , 46 jours après l’éruption.

On constate aussi qu’il y a des patients qui consultent seulement 17 jours après

l’éruption. Ce qui veut dire que malgré la fièvre, la toux, la conjonctivite, il y a des parents

qui gardent leur enfant plus de deux semaines après l’éruption et ne le présentent au médecin

119


VI. Etude des souches Africaines duVR

3. La rougeole au Cameroun : Isolement viraux

que lorsque surviennent les problèmes de surinfection. Ce qui montre que la population n’est

pas assez sensibilisée en matière de santé.

Parmi les 35 cas confirmés par sérologie IgM, 20 cas (57,1%) sont des enfants qui

auraient déjà été vaccinés. Le vaccin de la rougeole est efficace à 95% quand il est administré

dans les conditions optimales, ce qui veut dire qu’avec une seule dose de vaccin, il y a une

accumulation d’enfants susceptibles même si tous les enfants ont été vaccinés (Wild, 1999).

L’échec de la vaccination dû à un conditionnement inadapté du vaccin (rupture de la chaîne

du froid) peut être une explication à ces observations. Notons aussi qu’il y a dans notre étude

des enfants infectés par le virus de la rougeole et qui auraient déjà reçu deux doses de vaccin.

Le pourcentage élevé d’enfants malades qui auraient été vaccinés est dû au fait que les carnets

de vaccination ne sont pas toujours présentés au médecin ; l’information ne peut pas donc être

vérifiée.

La RT-PCR est une technique de diagnostic qui n’est pas utilisée en routine.

L’amplification des gènes codant pour l’hémagglutinine et la nucléoprotéine a permis de

confirmer l’isolement du virus dans 9 cas testés. Une nomenclature unique des souches de

virus de la rougeole et une définition de leurs génotypes ont été proposées (WHO, 1998).

Suite à ces propositions, il a été décidé que les séquences des gènes codant pour

l’hémagglutinine et la nucléoprotéine seront utilisées pour les études phylogénétiques.

VI.3.7. Conclusions

Ce travail a permis de mettre en place la technique d’isolement du virus de la rougeole

au Centre Pasteur de Yaoundé. Nous avons isolé des souches de virus circulant à Yaoundé

pendant les mois de février et mars 2001. L’isolement a été confirmé par l’amplification des

gènes codant pour l’hémagglutinine et la nucléoprotéine par RT-PCR. Notre étude a montré

que toutes les tranches d’âges (des nourrissons jusqu’aux adolescents) étaient touchées par

cette maladie.

Au Cameroun on constate que le nombre de cas de rougeole déclaré en 2001 est élevé

par rapport à ceux des années antérieures, ceci grâce à la campagne de surveillance lancée par

l’OMS. Cependant il y a encore du travail à faire, notamment la sensibilisation de la

population à l’importance de la vaccination et une consultation rapide en cas de maladie. Il est

nécessaire que la formation du personnel médical soit approfondie pour le remplissage des

fiches de notifications. Il faudrait que ces fiches puissent comporter des donnés justifiées et

fiables surtout en ce qui concerne l’histoire de la vaccination des patients. Ces données sont

importantes pour l’étude de la propagation du virus au sein de la population vaccinée.

120


VI. Etude des souches Africaines duVR

3. La rougeole au Cameroun : Isolement viraux

Les souches qui ont été isolées seront séquencées, une analyse phylogénétique et des

études épidémiologiques seront par la suite effectuées. On pourra ainsi connaître l’origine de

ces souches, l’histoire de leurs transmission, ce qui pourra aider à mieux lutter contre leurs

propagation.

121


CHAPITRE VII. DISCUSSION

122


VII. Discussion

1. Interaction virus-cellule

VII.1. INTERACTION VIRUS-CELLULES

Alors que le vaccin contre la rougeole est disponible de manière généralisée depuis

plus de 30 ans, la rougeole reste une cause majeure de mortalité de l’enfant. On estime que le

nombre de cas de rougeole en 2000 se situait entre 30 et 40 millions et que le nombre de

décès atteignait 777 000 (WHO, 2002a). Le virus de la rougeole a été isolé pour la première

fois en 1953 et a subi plusieurs passages dans les cellules primaires de reins de singe et dans

les fibroblastes d’embryon de poulet jusqu'à l’obtention d’un phénotype atténué. Plusieurs

mutations ont été introduites dans le génome viral pendant cette adaptation (Parks et al.,

2001).

Les souches vaccinales ont la propriété de se répliquer facilement dans les cellules

épithéliales humaines et simiennes et dans les lignées cellulaires fibroblastiques. Ce ci est dû

en partie à leur capacité à utiliser la molécule CD46 comme récepteur cellulaire (Naniche et

al., 1993a). Il a été montré que l’utilisation CD46 est liée à la mutation d’une Asp en Tyr en

position 481 dans la protéine H (Hsu et al., 1998).

Nos travaux ont montré qu’après une période d’adaptation aux cellules Véro, la

souche G 954Vp10 n’utilise pas le récepteur CD46, mais elle se réplique et atteint un titre

élevé sans induire de fusion. La séquence en acide aminé des deux glycoprotéines de surface

est identique à celle du virus non adapté, cultivé dans les PBL. Ceci suggère que la capacité

de ce virus à se répliquer dans les cellules Véro ne dépend pas de l’interaction entre la

protéine H et le récepteur CD46. Dans la plupart des études portant sur l’adaptation des

souches de virus de la rougeole aux cellules Véro, les mutations N481Y et S 546G dans la

protéine H ont été observées (Buckland & Wild, 1997 ; Rima et al., 1997 ; Hsu et al., 1998).

Cependant, l’étude de Nielsen et al., (2001) publiée pendant la réalisation de nos travaux

rapporte comme nous des cas d’adaptation de virus de la rougeole aux cellules Véro sans

introduction de mutations dans la protéine H par rapport à la souche sauvage. De plus, ils

montrent que bien que certaines souches après adaptation aux cellules Véro n’aient pas acquis

la capacité à utiliser CD46 comme récepteur, elle se répliquent dans les cellules Véro avec

une efficacité équivalente à celles des souches ayant acquis cette capacité. Ce qui suggère que

l’adaptation des souches de virus de la rougeole aux cellules Véro ne requiert ni des

changements dans la protéine H, ni l’utilisation de CD46 comme récepteur cellulaire.

L’implication de la protéine H dans le tropisme cellulaire du virus de la rougeole est

très controversée. Lecouturier et al., (1996) ont montré que la protéine H joue un rôle crucial

dans la fusion des cellules HeLa et dans le tropisme du virus de la rougeole. En effet, ils ont

123


VII. Discussion

1. Interaction virus-cellule

montré que la protéine H de la souche vaccinale Hallé qui induit la fusion dans les cellules

HeLa, induit la fusion quand elle est co-exprimée avec la protéine F à partir de cDNA. Par

contre la protéine H de la souche sauvage Ma93F, qui ne donne pas de fusion dans les cellules

HeLa , n’induit pas de fusion quand elle est co-exprimée avec la protéine F à partir de cDNA.

Cette différence de comportement a été attribuée aux acides aminés 451 et 481 de la protéine

H. Par contre, des études plus récentes suggèrent que la protéine H du virus de la rougeole

n’est pas impliquée dans la détermination de la fusion cellulaire, ni dans la détermination de

la spécificité de l’hôte (Takeuchi et al., 2002). Ces auteurs ont montré que la co-expression de

la protéine H d’une souche vaccinale de virus de la rougeole Edmonston (Ed) avec la protéine

F induit la fusion dans les cellules Véro. Par contre, la co-expression de la protéine H d’une

souche sauvage de virus de la rougeole (IC-B) avec la protéine F ne donne pas de fusion dans

ces cellules. Afin de déterminer le rôle de la protéine H dans l’infection virale, un

recombinant IC-B contenant le cDNA de la protéine H de la souche Ed (IC/Ed-H) et un autre

recombinant Ed contenant le cDNA de la protéine H de la souche IC-B (Ed/IC-H) ont été

générés. Dans les deux cas, on observe la formation de syncytia dans les cellules Véro ce qui

suggère que d’autres protéines du virus de la rougeole que la protéine H déterminent le

tropisme cellulaire. De plus, dans cette étude, l’utilisation d’un anticorps monoclonal dirigé

contre CD46 ne bloque pas la réplication, ni la formation de syncytia par le recombinant

Ed/IC-H. La question relative au mode d’entrée du recombinant Ed/IC-H dans les cellules

Véro soulignée dans cette étude est similaire à celle que nous avons posée. Sachant que la

molécule SLAM n’est pas exprimée sur les cellules Véro, par quel mécanisme le recombinant

Ed/IC-H infecte t-il ces cellules ? Cette question vient conforter notre idée, à savoir la

présence éventuelle d’un troisième récepteur, non encore identifié, sur les cellules Véro, pour

certaines souches de virus de la rougeole.

L’idée de l’existence d’un troisième récepteur pour le virus de la rougeole est de plus

en plus présente et plusieurs autres études en font allusion. En effet, Hashimoto et al., (2002)

ont généré un virus recombinant MV(IC 323-EGFP) qui exprime une protéine fluorescente à

partir de la souche sauvage de la rougeole IC-B. Leur étude montre que ce virus recombinant

infecte non seulement les cellules exprimant la molécule SLAM (B95a, Véro/SLAM), mais

aussi les cellules SLAM-négatives (Véro/Néo, Jurkat). Bien que l’infection des cellules

SLAM-négatives par ce virus recombinant puisse être bloqué par les anticoprs dirigés contre

l’hémagglutinine et la protéine de fusion, les anticorps dirigés contre la molécule CD46 quant

à eux, ne bloquent pas l’infection. Ces résultats indiquent que ce virus recombinant utilise un

récepteur autre que CD46 et SLAM. Dans le même ordre d’idée, les études de Manchester et

124


VII. Discussion

1. Interaction virus-cellule

al., (2002) montrent que des cellules humaines CD34 + obtenues à partir de sang de cordon

ombilical sont bien infectées in vitro par la souche sauvage MV-JW du virus de la rougeole.

Les auteurs ont montré que plus de 98% des cellules CD34 + expriment CD46 et moins de 2%

expriment SLAM. Un suivi de l’expression des récepteurs à la surface cellulaire pendant 5

jours après l’infection montre que l’expression de CD46 reste constante et que SLAM est très

peu ou pas exprimée. L’utilisation des anticorps dirigés contre ces deux récepteurs (anti CD46

(MCI20.6) et anti SlAM IPO-3) ne bloquent pas l’infection des cellules CD34 + . Ceci suggère

également l’existance d’un troisième récepteur non identifié, utilisé par le virus de la rougeole

pour infecter les cellules CD34 + .

Une autre explication possible au fait que certaines cellules SLAM-négatives soient

infectées par le virus de la rougeole est qu’un récepteur serait induit au cours de l’infection

des cellules Véro comme c’est les cas dans les monocytes. En effet, les travaux de Minagawa

et al., (2001) ont montré que les monocytes, qui normalement n’expriment pas SLAM,

deviennent positifs pour SLAM après incubation avec une souche sauvage de virus de la

rougeole. De plus, ils ont montré que l’infection de ces monocytes se fait via SLAM car

l’utilisation d’un anticorps dirigé contre SLAM (IPO3) bloque efficacement l’infection des

monocytes par une souche sauvage. Par contre, l’infection avec la souche vaccinale

Edmonston n’est pas bloqué, ce qui indique que l’inhibition de l’infection des monocytes par

la souche sauvage est due à au blocage de l’interaction entre le virus et le récepteur SLAM.

La présence de SLAM jusqu’ici détecté sur les lymphocytes T et B activés et sur les cellules

dendritiques activées s’est ainsi élargie aux monocytes.

Bien que la molécule SLAM soit connue comme récepteur pour les souches sauvages

de virus de la rougeole, son rôle dans la biologie de l’infection est encore mal connu. Nos

travaux ont montré que le virus G954 Vp10 interagit avec la molécule SLAM simienne, mais

n’induit pas de fusion dans les cellules B95a. De même, ce virus infecte les cellules Véro sans

induire de fusion. Par contre, lorsqu’on infecte des cellules Véro exprimant la molécule

SLAM humaine, cette souche induit la fusion. Ce qui indique que la présence de SLAM dans

les cellules Véro favorise le processus de fusion et donc la propagation rapide de l’infection à

d’autre cellules. Il est possible que la présence de SLAM joue sur l’interaction entre les

glycoprotéines H et F d’une façon analogue aux épitopes Tag ajoutés sur la protéine H dans

l’étude de Plemper et al., (2002). En effet, ces auteurs ont montré qu’un virus modifié par

l’ajout d’un épitope Tag constitué de 8 acides aminés au niveau de la queue cytoplasmique de

la protéine H possède une infectivité par particule plus élevé et induit des syncytia plus large

125


VII. Discussion

1. Interaction virus-cellule

que le virus non modifié. Ce changement dans la cytopathogénicité du virus a été attribué à la

modification de la stabilité du complexe H/F suite à l’ajout des épitopes Tag.

Des études supplémentaires sur la fonction et la distribution de la molécule SLAM

dans les cellules cibles du virus de la rougeole, comme les cellules épithéliales et

endothéliales, les cellules du système nerveux central, devraient aider à approfondir nos

connaissances sur la pathogenèse de la rougeole.

126


VII. Discussion

2. Epidémiologie

VII.2. EPIDEMIOLOGIE

Depuis l’introduction de la vaccination contre la rougeole, la mortalité et la morbidité

ont été réduites de façon drastique. Dans certaines régions du monde (par exemple les Etats-

Unis) les souches endogènes ont été éradiquées et ceci constitue une étape importante vers

l’éradication globale de la rougeole dans le monde. Cependant, pour interrompre la

transmission du virus, plus de 95% de la population devrait être protégée. Il s’est avéré

impossible d’atteindre des niveaux élevés de protection avec la vaccination de routine. De ce

fait, dans plusieurs régions, la vaccination de routine à l’âge de 9 mois a été supplémentée par

une seconde dose à un âge tardif. D’autres pays ont opté pour des campagnes de vaccination

de masse, au cours desquelles tous les enfants sont vaccinés sans tenir compte de l’histoire de

leur vaccination.

Notre étude réalisée sur des souches de virus de la rougeole isolées en Afrique de

l’Ouest et en Afrique Centrale se situe juste avant la mise en œuvre de ces grandes campagnes

de vaccination dans les pays africains. Bien que la diversité génétique entre les isolats obtenus

de différentes régions géographiques soit établie, il existe par contre très peu d’informations

quant à la variété du virus de la rougeole au cours de la même épidémie.

Notre étude a montré qu’il y avait une forte homogénéité entre les virus isolés pendant les

épidémies de rougeole en Afrique. En effet, les séquences de trois souches isolées en Gambie

(1993) montrent une différence de trois nucléotides au niveau du gène H. Toutes ces

mutations sont silencieuses. De même, l’analyse des séquences de quatre autres souches

isolées au Cameroun (2001) indique une différence de trois nucléotides dans le gène H dont

une seule entraîne un changement d’acide aminé dans la souche CR83. Ces résultats

concordent avec les données obtenues en Corée, au Japon. En effet, les travaux de Na et al.,

(2001) montrent que les séquences de gènes H et N des souches de virus de la rougeole

isolées pendant l’épidémie de 2000 ont un degré d’homologie supérieur à 99,8%. Ces souches

appartiennent toutes au génotype H1. Des résultats similaires ont été obtenus avec les souches

circulant au Brésil pendant l’épidémie de 1997. L’analyse des séquences des gènes N de 8

souches isolées pendant cette période montre qu’elles sont identiques et appartiennent toutes

au génotype D6 (Siqueira et al., 2001). De même, les résultats obtenus (El-Mubarak et al.,

2002) sur les souches isolées au Soudan montrent une homologie de séquences dans le gène N

avec une divergence nucléotidique inférieure à 1,3% sur une période de 3 ans (1997-2000).

Toutes ces souches appartenaient au génotype B3.1.

127


VII. Discussion

2. Epidémiologie

Cependant, des études réalisées au Nigeria ont montré que les virus circulant à Lagos en

1998 étaient hétérogènes, avec une différence nucléotidique atteignant 3,7% dans le gène N,

et appartenaient à deux génotypes différents (B3.1 et B3.2) (Hanses et al., 1999). Bien que ces

virus soient différents, ils appartiennent tous au clade B. Ceci suggère qu’ils ont évolués au

cours du temps suite à des pressions naturelles à partir du même virus. Ce type

d’hétérogénéité est tout à fait différent de la diversité de virus de la rougeole observée aux

Etats-Unis pendant l’épidémie de 1994. En fait, il a été montré que les virus impliqués dans

cette épidémie appartenaient à 5 génotypes différents (Rota et al., 1996). Cette diversité a été

attribuée à des origines d’importation différentes.

L’un des avantages de l’épidémiologie moléculaire est de pouvoir suivre la variabilité du

virus au cours du temps sur le même site géographique. Notre étude menée sur le site de

Yaoundé au Cameroun a permis de comparer les souches de virus de la rougeole isolées en

1983 avec des souches isolées en 2001 (18 années d’écart). Cette étude montre que les

souches de 2001 appartiennent au génotype B3.1, qui est différent du génotype B1 qui

circulait à Yaoundé en 1983. Cette observation suggère que les virus B3.1 auraient été

importés du Nigeria ou des autres pays voisins.

L’analyse phylogénétique des souches isolées en Gambie en 1993 a montré qu’elles

appartenaient au génotype B3.2, ce qui concorde avec l’étude de Hanses et al., (1999) qui ont

trouvé le génotype B3.2 au Ghana. Ces résultats indiquent que les virus du génotype B3.2

circulent en Afrique de l’Ouest tandis que les virus du génotype B3.1 se trouvent en Afrique

Centrale et au Soudan. Le Nigeria ayant une position charnière entre ces deux régions, cela

peux expliquer pourquoi les génotypes B3.1 et B3.2 y co-circulent (Figure 11).

Les travaux de Chibo et al., (2000), réalisés à Victoria en Australie sur des souches isolées

entre 1973 et 1998, juste après les campagnes de vaccination, ont montré une succession de 6

génotypes au cours de 25 années. Le génotype D1, ayant circulé de 1973 à 1985 a été

remplacé par le génotype D7 (1986-1989), suivi du génotype C2 (1990-1991) et du génotype

H en 1993. Les génotypes D4 et D5 auraient co-circulé en 1998. Il ressort de cette étude que

le génotype D1 représenterait le virus endogène et que les 5 autres proviendraient de

l’importation. Cependant, aucune souche de virus n’ayant été isolée a Victoria avant les

campagnes de vaccination de masse, il est difficile d’affirmer que D1 est bien le génotype

endogène. A ce jour, notre étude sur les souches de virus de la rougeole isolées à Yaoundé est

la première à avoir examiné la diversité du virus de la rougeole dans un site géographique, sur

une période aussi longue avant l’introduction des campagnes de vaccination.

128


VII. Discussion

2. Epidémiologie

Des efforts considérables ont été déployés dans le monde entier pour lutter contre ce fléau

qu’est la rougeole. Depuis 1995, près de 25 million d’enfants ont été vaccinés dans le cadre

des campagnes de rattrapage dans 7 pays d’Afrique Australe (Afrique du Sud, Botswana,

Lesotho, Malawi, Namibie, Swaziland et Zimbabwe). Il en résulte une diminution

spectaculaire des cas de rougeole passant de plus de 50 000 par an avant les campagnes de

vaccination à 100 cas en 1999. Les décès dus à la rougeole ont été ramenés d’un nombre

estimé à 3 700 avant ces campagnes, à 2 en 1999 et à zéro en 2000 (WHO, 2002a). Malgré

ces efforts, l’Afrique continue de signaler les taux de couverture vaccinales les plus faibles et

les taux d’incidence les plus élevés. On estime que la majorité (>90%) des décès liés à la

rougeole survient en Asie du Sud-Est et en Afrique (WHO, 2002b). Ceci peut s’expliquer par

le fait que :

La vaccination de routine ne couvre pas toute la population ciblée ; de plus, la majorité

des pays africains ne proposent pas de deuxième dose de vaccin qui permettrait de

rattraper les enfants ayant échappé à la première vaccination et de corriger les échecs

primaires de vaccination chez ceux qui ont été vaccinés.

Plusieurs régions en Afrique sont accablées par la forte prévalence de l’infection par le

VIH. Bien que les études de Moss et al., (2002) aient montré que la réplication du VIH

est supprimée au cours de la rougeole, on ne peut pas en dire autant quant à l’impact

du VIH sur la pathologie de la rougeole. Plusieurs facteurs suggèrent que l’épidémie

de VIH augmente la transmission du virus de la rougeole et empiète sur les efforts

d’éradication de cette maladie :

- la prévention est entravée par l’immunogénicité réduite du vaccin contre la

rougeole chez les personnes infectées par le VIH. En effet, une étude réalisée au Zaire

montre que la vaccination contre la rougeole induit une faible réponse anticorps chez

les personnes infectées par le VIH par rapport à des personnes saines (Oxtoby et al.,

1989).

- la période de contagion est rallongée chez les sujets immunodéprimés. Chez

les sujets normaux infectés par le virus de la rougeole, le virus peut être isolé à partir

de PBMC dans les 4 jours suivant l’éruption. Or les travaux de Permar et al., (2001)

ont montré que l’ARN du virus de la rougeole est encore présent chez les personnes

infectées par le VIH 46 jours après l’éruption. Ce qui suggère que ces personnes

excrètent le virus de la rougeole pendant longtemps et augmentent ainsi la

transmission du virus de la rougeole. Ces résultats offrent une explication possible au

129


VII. Discussion

2. Epidémiologie

fait que pendant nos travaux effectués à Yaoundé, le virus de la rougeole a été isolé

dans certains cas 9 jours après l’éruption.

Plusieurs études ont noté l’existence d’une différence d’antigénicité entre certaines

souches sauvages africaines et les souches vaccinales de virus de la rougeole.

Notre étude montre que, contrairement à la souche vaccinale Hallé, les souches de

virus appartenant au génotype B3.2 ne sont pas reconnues par l’anticorps F186

dirigé contre la protéine F du virus de la rougeole. De plus, un autre anticorps

BH30 dirigé contre l’hémagglutinine, se lie à ces virus avec une efficacité 10 fois

inférieure à celle de la souche vaccinale. Les études réalisées dans le laboratoire de

Muller ont donné des résultats qui vont dans le même sens que notre étude. En

effet, des tests de neutralisation effectués avec une série d’anticorps monclonaux et

polyclonaux montre que toutes les souches vaccinales sont neutralisées par tous les

anticorps monoclonaux, tandis que certaines souches sauvages sont neutralisées

par seulement 60% des anticorps monoclonaux (Muller, 2001). Ces résultats

suggèrent qu’il existe une différence d’antigénicité significative entre certaines

souches sauvages et les souches vaccinales, qui rend les premières plus résistantes

aux anticorps induits par la vaccination. De telles souches seraient à l’origine de

l’infection observée dans les populations vaccinées.

130


Figure 11 : Situation actuelle de la répartition géographique des différents

génotypes de virus de la rougeole en Afrique

Gambie

B3.2 (1993)

B3.2

B3.2

B3.1 et

B3.2

Ghana

Nigeria

Cameroun

Gabon

B1? (1983),

B3.1(2001)

B2

B3.1

B3.1

Soudan

D4

Ethiopie

D4

Kénya

A et D

Afrique du Sud

Les génotypes identifiés dans cette étude sont indiqués en marron. Les hypotèses de circulation du virus de

la rougeole en Afrique de l’ouest et en Afrique centrale sont indiquées en Rouge.


CHAPITRE VIII. CONCLUSION ET

PERSPECTIVES

132


VIII. Conclusions et perspectives

L’OMS estime qu’il y a environ 800 000 morts par an dans le monde dus à la

rougeole. L’Afrique sub-Saharienne compte à elle seule plus de la moitié de ce chiffre. La

réduction de la mortalité associée à la rougeole est un problème prioritaire de santé public

dans les pays en développement. L’éradication de la rougeole est théoriquement possible car

aucun réservoir animal n’est connu et le vaccin contre la rougeole est efficace. En pratique, la

rougeole est une maladie très contagieuse, ce qui rend son éradication difficile. L’interruption

de la transmission nécessite que plus de 95% de la population soit vaccinée. La difficulté à

atteindre la couverture vaccinale requise dans les pays en développement et le fait que le

public dans les pays industrialisés ne soit pas conscient de l’impact de la rougeole sur la santé

ne facilitent pas la lutte contre cette maladie. Cependant, le succès des programmes de lutte

contre la rougeole aux Etats-Unis et en Amérique du Sud a montré que la rougeole peut être

éliminée. Mais la réintroduction du virus importé a fait prendre conscience que la lutte contre

la rougeole devrait être effectuée en même temps dans toutes les régions du monde. Les

campagnes de vaccination lancées par l’OMS sont actuellement mises en place dans le monde

entier.

L’épidémiologie moléculaire est un outil indispensable au suivi de l’impact de ces

campagnes sur l’épidémiologie de la rougeole. Elle a permis de montrer une diversité

génétique parmi les différentes souches de virus de la rougeole. Pour faciliter ces études, une

banque de séquences a été mise en place par l’OMS. Cependant, plusieurs études ayant

montré des différences antigéniques entre les souches vaccinales et certaines souches

sauvages, il serait intéressant d’établir une banque d’anticorps qui permettrait de faire la

différence entre les génotypes. La technique de marquage avec les anticorps est plus rapide et

facile à réaliser dans les laboratoires des pays en développement que la technique de

séquençage qui nécessite un équipement onéreux.

Les études d’adaptation du virus de la rougeole aux cellules en culture a permis de

suggérer qu’il y aurait des récepteurs autres que SLAM pour les souches sauvages du virus de

la rougeole. L’identification de ces récepteurs permettra de mieux comprendre les

observations faites sur la pathologie de la rougeole où l’on constate qu’il y a des différences

entre la distribution tissulaire du virus et la distribution des récepteurs à la surfaces des

cellules.

133


ANNEXES

134


Consensus ATGTCACCRC AACGAGACCG GATAAATGCC TTCTACAAAG ATAACCCTTA TCCCAAGGGA AGTAGGATAG TTATTAACAG AGAACATCTT ATGATTGACA 100

HA 954_véro ........G. .......... .......... .......... .......... .......... .......... .......... .......... .......... 100

HA 954_PBL ........A. .......... .......... .......... .......... .......... .......... .......... .......... .......... 100

HA 954_B95a ........G. .......... .......... .......... .......... .......... .......... .......... .......... .......... 100

Consensus GACCTTATGT TTTGCTGGCT GTTCTGTTCG TCATGTTTCT GAGCTTGATC GGGTTGCTGG CCATTGCAGG CATTAGACTT CATCGGGCAG CCATCTACAC 200

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 200

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 200

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 200

Consensus CGCGGAGATC CATAAAAGCC TCAGCACCAA TCTAGATGTA ACTAACTCAA TCGAGCATCA GGTCAAGGAC GTGCTGACAC CACTCTTTAA AATCATCGGG 300

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 300

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 300

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 300

Consensus GATGAAGTGG GCCTGAGAAC ACCTCAGAGA TTCACTGACC TAGTGAAATT CATCTCTGAC AAGATTAAAT TCCTTAATCC GGATAGGGAG TACGACTTCA 400

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 400

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 400

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 400

Consensus GAGATCTCAC TTGGTGTATC AACCCGCCAG AGAGAATCAA ACTGGATTAT GATCAATACT GTGCAGATGT GGCTGCTGAA GAGCTCATGA ATGCATTGGT 500

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 500

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 500

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 500

Consensus GAACTCAACT CTACTGGAGA CCAGAACAAC CAATCAGTTC CTAGCTGTCT CAAAGGGAAA CTGCTCAGGG CCCACTACAA TCAGAGGTCA ATTCTCAAAC 600

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 600

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 600

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 600

Consensus ATGTCGCTGT CCTTATTGGA CCTGTACTTA GGTCGGGGTT ACAATGTGTC ATCTATAGTC ACTATGACAT CCCAGGGAAT GTATGGGGGA ACCTACTTAG 700

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 700

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 700

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 700

Consensus TGGAAAAGCC TAATCTGAGC AGCAAAGGGT CAGAGTTGTC ACAACTGAGC ATGTACCGAG TGTTTGAAGT AGGTGTTATC AGAAACCCGG GTTTGGGGGC 800

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 800

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 800

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 800

Consensus TCCGGTGTTC CATATGACAA ACTATTTTGA GCAACCAGTC AGTAATGATC TCGGCAACTG TATGGTAGCT TTGGGGGAGC TCAAACTCGC AGCCCTTTGT 900

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 900

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 900

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 900

Consensus CACGGGGAAG ATTCTATCAC AATTCCCTAT CAGGGATCAG GGAAAGGTGT CAGCTTCCAG CTCGTCAAGC TAGGTGTCTG GAAATCCCCA ACCGACATGC 1000

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1000

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1000

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1000

Consensus AATCCTGGGT CCCCTTATCA ACGGATGATC CAGTGGTAGA CAGGCTTTAC CTCTCATCTC ACAGAGGTGT CATCGCTGAC AATCAAGCAA AATGGGCTGT 1100

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1100

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1100

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1100

Consensus CCCGACAACA CGAACAGATG ACAAGTTGCG AATGGAGACA TGCTTCCAGC AGGCGTGTAA AGGTAAAATC CAAGCACTCT GCGAGAATCC CGAGTGGGCA 1200

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1200

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1200

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1200

Consensus CCATTGAAGG ATAACAGGAT TCCTTCATAC GGGGTCCTGT CTGTTGATCT GAGTCTGACA GTTGAGCTTA AAATCAAGAT TGCTTCGGGA TTCGGACCAT 1300

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1300

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1300

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1300

Consensus TGATTACGCA CGGCTCAGGG ATGGACCTAT ACAAATCCAA CCGCAACAAT GTGTATTGGC TGACTATCCC GCCAATGAGG AATCTAGCCT TAGGTGTAAT 1400

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1400

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1400

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1400

Consensus CAACACATTG GCGTGGATAC CGAGATTCAA GGTTAGTCCC AACCTCTTCA CTGTCCCAAT TAAGGAAGCA GGCGAAGACT GCCATGCCCC AACATACCTA 1500

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1500

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1500

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1500

Consensus CCTGCGGAGG TGGACGGTGA TGTCAAACTC AGTTCCAATC TGGTGATTCT ACCTGGTCAA GATCTCCAAT ATGTTTTGGC AACCTACGAT ACTTCCAGGG 1600

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1600

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1600

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1600

Consensus TTGAACATGC TGTGGTTTAT TACGTTTACA GCCCAAGCCG CTCATTTTCT TACTTTTATC CTTTTAGGTT GCCTATAAAG GGGGTCCCAA TCGAATTACA 1700

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1700

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1700

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1700

Consensus AGTGGAATGC TTCACATGGG ACCAAAAACT CTGGTGCCGT CACTTCTGTG TGCTTGCGGA CTCGGAATCC GGTGGACATA TCACTCACTC TGGGATGGTG 1800

HA 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1800

HA 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1800

HA 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1800

Consensus GGCATGGGAG TCAGCTGCAC AGCCACCCGG GAAGATGGGA CCAATCGCAG ATAG 1854

HA 954_véro .......... .......... .......... .......... .......... .... 1854

HA 954_PBL .......... .......... .......... .......... .......... .... 1854

HA 954_B95a .......... .......... .......... .......... .......... .... 1854

Annexe 1: Comparaison des séquences des gène H et F de la souche G954 après passage dans

les cellules Véros, les PBLet les cellules B95a.


Consensus ATATCCATCA TGGGTCTCAA GGTGAACGTC TCTGCCATAT TCATGGCAGT ACTGTTAACT CTCCAAACAC CCGCCGGTCA AATCCATTGG GGCAATCTCT 100

F 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 100

F 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 100

F 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 100

Consensus CTAAGATAGG GGTAGTAGGA ATAGGAAGTG CAAGCTACAA AGTTATGACT CGTTCCAGCC ATCAATCATT AGTCATAAAA TTAATGCCCA ATATAACTCT 200

F 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 200

F 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 200

F 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 200

Consensus CCTCAATAAC TGCACGAAGG TAGAGATTGC AGAGTACAGG AGACTACTAA GAACAGTTCT GGAACCAATT AGAGATGCAC TTAATGCAAT GACCCAGAAC 300

F 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 300

F 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 300

F 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 300

Consensus ATAAGGCCGG TTCAGAGCGT AGCTTCAAGT AGGAGACACA AGAGATTTGC GGGAGTAGTC CTGGCAGGTG CGGCCCTAGG CGTTGCCACA GCTGCTCAGA 400

F 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 400

F 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 400

F 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 400

Consensus TAACAGCCGG CATTGCACTT CACCGGTCCA TGCTGAACTC TCAAGCCATC GACAATCTGA GAGCGAGCCT GGAAACTACT AATCAGGCAA TTGAGGCAAT 500

F 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 500

F 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 500

F 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 500

Consensus CAGACAAGCA GGGCAGGAGA TGATCTTGGC TGTTCAGGGT GTCCAAGACT ACATCAATAA TGAGCTGATA CCATCTATGA ACCAGCTATC TTGTGATTTA 600

F 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 600

F 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 600

F 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 600

Consensus ATCGGCCAGA AGCTCGGGCT CAAATTGCTC AGATACTATA CAGAAATCCT GTCATTATTT GGCCCCAGCC TACGAGACCC CATATCTGCG GAGATATCTA 700

F 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 700

F 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 700

F 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 700

Consensus TCCAGGCTTT GAGCTATGCA CTTGGAGGAG ATATCAATAA GGTGTTAGAA AAGCTCGGAT ACAGTGGAGG CGATTTACTG GGCATCTTAG AGAGCAGAGG 800

F 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 800

F 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 800

F 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 800

Consensus AATAAAGGCT CGGATAACTC ACGTCGACAC AGAGTCCTAC TTCATTGTCC TCAGTATAGC CTATCCGACA CTGTCCGAGA TTAAGGGGGT GATTGTCCAC 900

F 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 900

F 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 900

F 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 900

Consensus CGGCTAGAGG GGGTCTCGTA CAACATAGGC TCTCAAGAGT GGTATACCAC TGTGCCCAAG TATGTTGCAA CCCAAGGGTA CCTTATCTCG AATTTTGATG 1000

F 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1000

F 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1000

F 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1000

Consensus AGTCATCGTG TACCTTCATG CCAGAGGGGA CTGTGTGCAG CCAAAATGCC TTGTACCCGA TGAGTCCTCT GCTCCAAGAA TGCCTCCGGG GGTCCACCAA 1100

F 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1100

F 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1100

F 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1100

Consensus GTCCTGTGCT CGTACACTCG TATCCGGGTC TTTTGGGAAC CGGTTCATTT TATCACAAGG GAACCTAATA GCCAATTGTG CATCAATTCT TTGCAAGTGT 1200

F 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1200

F 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1200

F 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1200

Consensus TACACAACAG GAACGATCAT TAATCAAGAC CCTGACAAGA TCCTAACATA CATCGCTGCC GATCGCTGCC CGGTAGTCGA GGTAAACGGC GTGACCATCC 1300

F 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1300

F 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1300

F 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1300

Consensus AAGTCGGGAG CAGGAGGTAT CCAGACGCTG TGTATTTGCA CAGAATTGAC CTCGGTCCTC CCATATCATT GGAGAGGTTG GACGTAGGGA CAAATCTGGG 1400

F 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1400

F 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1400

F 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1400

Consensus GAATGCAATT GCCAAATTGG AGGATGCCAA GGAATTGTTG GAGTCATCGG ACCAGATATT GAGGAGTATG AAAGGTTTAT CGAGCACTAG CATAGTCTAC 1500

F 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1500

F 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1500

F 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1500

Consensus ATCCTGATTG CAGTGTGTCT TGGAGGGCTG ATAGGGATCC CCACTTTAAT ATGTTGCTGC AGGGGGCGTT GTAACAAAAA GGGAGAACAA GTTGGTATGT 1600

F 954_véro .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1600

F 954_B95a .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1600

F 954_PBL .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1600

Consensus CAAGACCAGG CCTAAAGCCT GATCTTACAG GAACATCAAA ATCCTATGTA AGGTCGCTTT GA 1662

F 954_véro .......... .......... .......... .......... .......... .......... .. 1662

F 954_B95a .......... .......... .......... .......... .......... .......... .. 1662

F 954_PBL .......... .......... .......... .......... .......... .......... .. 1662

Annexe 1: suite


Véro

G954

Véro

Hallé

Véro

F0 (60kDa)

F1 (40kDa)

Annexe 2 : Marquage de la protéine F par Western Blot des extraits de cellules

Véros infectées par la souche G954 ou par la souche Hallé


Consensus MTEIYDFDKS AWDIKGSIAP IQPTTYSDGR LVPQVRVIDP GLGDRKDECF MYMFLLGVVE 60

Trans of M G954/B95 .......... .......... .......... .......... .......... .......... 60

Trans of M Edmonsto .......... .......... .......... .......... .......... .......... 60

Trans of M G954/ver .......... .......... .......... .......... .......... .......... 60

89

Consensus DSDPLGPPIG RAFGSLPLGV GRSTAKPEKL LKEATELDIV VRRTAGLNEK LVFYNNTPLT 120

Trans of M G954/B95 .......... .......... ........E. .......... .......... .......... 120

Trans of M Edmonsto .......... .......... .......... .......... .......... .......... 120

Trans of M G954/ver .......... .......... .......... .......... .......... .......... 120

Consensus LLTPWRKVLT TGSVFNANQV CNAVNLIPLD TPQRFRVVYM SITRLSDNGY YTVPRRMLEF 180

Trans of M G954/B95 .......... .......... .......... .......... .......... .......... 180

Trans of M Edmonsto .......... .......... .S........ .......... .......... .......... 180

Trans of M G954/ver .......... .......... .......... .......... .......... .......... 180

Consensus RSVNAVAFNL LVTLRIDKAI GPGKIIDNTE QLPEATFMVH IGNFRRKKSE VYSADYCKMK 240

Trans of M G954/B95 .......... .......... .......... .......... .......... .......... 240

Trans of M Edmonsto .......... .......... .......... .......... .......... .......... 240

Trans of M G954/ver .......... .......... .......... .......... .......... .......... 240

Consensus IEKMGLVFAL GGIGGTSLHI RSTGKMSKTL HAQLGFKKTL CYPLMDINED LNRLLWRSRC 300

Trans of M G954/B95 .......... .......... .......... .......... .......... .......... 300

Trans of M Edmonsto .......... .......... .......... .......... .......... .......... 300

Trans of M G954/ver .......... .......... .......... .......... .......... .......... 300

Consensus KIVRIQAVLQ PSVPQEFRIY DDVIINDDQG LFKVL 335

Trans of M G954/B95 .......... .......... .......... ..... 335

Trans of M Edmonsto .......... .......... .......... ..... 335

Trans of M G954/ver .......... .......... .......... ..... 335

Annexe 3 : Comparaison des séquences de la protéine M de la souche G954 dans les cellules B95a et

après adaptation aux cellules Véro avec celle de la souche vaccinale Edmonston. La mutation au

niveau de la position 89 est indiquée.


Consensus ATGTCACCRC AACGAGACCG GATAAATGCC TTCTACAAAG ATAACCCTTA TCCCAAGGGA AGTAGGATAG TTATTAACAG AGAACATCTT 90

HA G954 ........G. .......... .......... .......... .......... .......... .......... .......... .......... 90

HA G943 ........A. .......... .......... .......... .......... .......... .......... .......... .......... 90

HA G945 ........G. .......... .......... .......... .......... .......... .......... .......... .......... 90

Consensus ATGATTGACA GACCTTATGT TTTGCTGGCT GTTCTGTTCG TCATGTTTCT GAGCTTGATC GGGTTGCTGG CCATTGCAGG CATTAGACTT 180

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... 180

HA G943 .......... .......... .......... .......... .......... .......... .......... .......... .......... 180

HA G945 .......... .......... .......... .......... .......... .......... .......... .......... .......... 180

Consensus CATCGGGCAG CCATCTACAC CGCGGAGATC CATAAAAGCC TCAGCACCAA TCTAGATGTA ACTAACTCAA TCGAGCATCA GGTCAAGGAC 270

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... 270

HA G943 .......... .......... .......... .......... .......... .......... .......... .......... .......... 270

HA G945 .......... .......... .......... .......... .......... .......... .......... .......... .......... 270

Consensus GTGCTGACAC CACTCTTTAA AATCATCGGG GATGAAGTGG GCCTGAGAAC ACCTCAGAGA TTCACTGACC TAGTGAAATT CATCTCTGAC 360

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... 360

HA G943 .......... .......... .......... .......... .......... .......... .......... .......... .......... 360

HA G945 .......... .......... .......... .......... .......... .......... .......... .......... .......... 360

Consensus AAGATTAAAT TCCTTAATCC GGATAGGGAG TACGACTTCA GAGATCTCAC TTGGTGTATC AACCCGCCAG AGAGAATCAA ACTGGATTAT 450

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... 450

HA G943 .......... .......... .......... .......... .......... .......... .......... .......... .......... 450

HA G945 .......... .......... .......... .......... .......... .......... .......... .......... .......... 450

Consensus GATCAATACT GTGCAGATGT GGCTGCTGAA GAGCTCATGA ATGCATTGGT GAACTCAACT CTACTGGAGA CCAGAACAAC CAATCAGTTC 540

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... 540

HA G943 .......... .......... .......... .......... .......... .......... .......... .......... .......... 540

HA G945 .......... .......... .......... .......... .......... .......... .......... .......... .......... 540

Consensus CTAGCTGTCT CAAAGGGAAA CTGCTCAGGG CCCACTACAA TCAGAGGTCA ATTCTCAAAC ATGTCGCTGT CCTTATTGGA CCTGTACTTA 630

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... 630

HA G943 .......... .......... .......... .......... .......... .......... .......... .......... .......... 630

HA G945 .......... .......... .......... .......... .......... .......... .......... .......... .......... 630

Consensus GGTCGGGGTT ACAATGTGTC ATCTATAGTC ACTATGACAT CCCAGGGAAT GTATGGGGGA ACCTACYTAG TGGAAAAGCC TAATCTGAGC 720

HA G954 .......... .......... .......... .......... .......... .......... ......T... .......... .......... 720

HA G943 .......... .......... .......... .......... .......... .......... ......C... .......... .......... 720

HA G945 .......... .......... .......... .......... .......... .......... ......C... .......... .......... 720

Consensus AGCAAAGGGT CAGAGTTGTC ACAACTGAGC ATGTACCGAG TGTTTGAAGT AGGTGTTATC AGAAACCCGG GTTTGGGGGC TCCGGTGTTC 810

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... 810

HA G943 .......... .......... .......... .......... .......... .......... .......... .......... .......... 810

HA G945 .......... .......... .......... .......... .......... .......... .......... .......... .......... 810

Consensus CATATGACAA ACTATTTTGA GCAACCAGTC AGTAATGATC TCGGCAACTG TATGGTAGCT TTGGGGGAGC TCAAACTCGC AGCCCTTTGT 900

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... 900

HA G943 .......... .......... .......... .......... .......... .......... .......... .......... .......... 900

HA G945 .......... .......... .......... .......... .......... .......... .......... .......... .......... 900

Consensus CACGGGGAAG ATTCTATCAC AATTCCCTAT CAGGGATCAG GGAAAGGTGT CAGCTTCCAG CTCGTCAAGC TAGGTGTCTG GAAATCCCCA 990

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... 990

HA G943 .......... .......... .......... .......... .......... .......... .......... .......... .......... 990

HA G945 .......... .......... .......... .......... .......... .......... .......... .......... .......... 990

Consensus ACCGACATGC AATCCTGGGT CCCCTTATCA ACGGATGATC CAGTGGTAGA CAGGCTTTAC CTCTCATCTC ACAGAGGTGT CATCGCTGAC 1080

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1080

HA G943 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1080

HA G945 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1080

Consensus AATCAAGCAA AATGGGCTGT CCCGACAACA CGAACAGATG ACAAGTTGCG AATGGAGACA TGCTTYCAGC AGGCGTGTAA AGGTAAAATC 1170

HA G954 .......... .......... .......... .......... .......... .......... .....C.... .......... .......... 1170

HA G943 .......... .......... .......... .......... .......... .......... .....C.... .......... .......... 1170

HA G945 .......... .......... .......... .......... .......... .......... .....T.... .......... .......... 1170

Consensus CAAGCACTCT GCGAGAATCC CGAGTGGGCA CCATTGAAGG ATAACAGGAT TCCTTCATAC GGGGTCCTGT CTGTTGATCT GAGTCTGACA 1260

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1260

HA G943 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1260

HA G945 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1260

Consensus GTTGAGCTTA AAATCAAGAT TGCTTCGGGA TTCGGACCAT TGATTACGCA CGGCTCAGGG ATGGACCTAT ACAAATCCAA CCGCAACAAT 1350

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1350

HA G943 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1350

HA G945 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1350

Consensus GTGTATTGGC TGACTATCCC GCCAATGAGG AATCTAGCCT TAGGTGTAAT CAACACATTG GCGTGGATAC CGAGATTCAA GGTTAGTCCC 1440

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1440

HA G943 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1440

HA G945 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1440

Consensus AACCTCTTCA CTGTCCCAAT TAAGGAAGCA GGCGAAGACT GCCATGCCCC AACATACCTA CCTGCGGAGG TGGACGGTGA TGTCAAACTC 1530

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1530

HA G943 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1530

HA G945 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1530

Consensus AGTTCCAATC TGGTGATTCT ACCTGGTCAA GATCTCCAAT ATGTTTTGGC AACCTACGAT ACYTCCAGGG TTGAACATGC TGTGGTTTAT 1620

HA G954 .......... .......... .......... .......... .......... .......... ..T....... .......... .......... 1620

HA G943 .......... .......... .......... .......... .......... .......... ..C....... .......... .......... 1620

HA G945 .......... .......... .......... .......... .......... .......... ..C....... .......... .......... 1620

Consensus TACGTTTACA GCCCAAGCCG CTCATTTTCT TACTTTTATC CTTTTAGGTT GCCTATAAAG GGGGTCCCAA TCGAATTACA AGTGGAATGC 1710

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1710

HA G943 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1710

HA G945 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1710

Consensus TTCACATGGG ACCAAAAACT CTGGTGCCGT CACTTCTGTG TGCTTGCGGA CTCGGAATCC GGTGGACATA TCACTCACTC TGGGATGGTG 1800

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1800

HA G943 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1800

HA G945 .......... .......... .......... .......... .......... .......... .......... .......... .......... 1800

Consensus GGCATGGGAG TCAGCTGCAC AGCCACCCGG GAAGATGGGA CCAATCGCAG ATAG 1854

HA G954 .......... .......... .......... .......... .......... .... 1854

HA G943 .......... .......... .......... .......... .......... .... 1854

HA G945 .......... .......... .......... .......... .......... .... 1854

Annexe 4 : Comparaison des séquences de gène H des souches G954, G943,

G945 isolées en Gambie en 1993.


Consensus ATGTCACCGC AACGAGACCG GATAAATGCC TTCTACAAAG ATAACCCTTA TCCCAAGGGA AGTAGGATAG TTATTAACAG AGAACATCTT ATGATTGACA GACCCTATGT TCTGCTGGCT 120

HA R83 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 120

HA R72 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 120

HA R82 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 120

HA R67 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 120

Consensus GTTCTGTTCG TCATGTTTCT GAGCTTGATC GGATTGCTGG CAATTGCAGG CATTAGACTT CATCGGGCAG CCATCTACAC CGCGGAGATC CATAAAAGCC TCAGTACCAA TCTAGATGTG 240

HA R83 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 240

HA R72 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 240

HA R82 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 240

HA R67 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 240

Consensus ACTAACTCAA TCGAGCATCA GGTCAAGGAC GTGCTGACAC CACTCTTTAA AATCATCGGG GATGAAGTGG GCCTGAGAAC ACCTCAGAGA TTCTCTGACC TAGTGAAATT CATCTCTGAC 360

HA R83 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 360

HA R72 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 360

HA R82 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 360

HA R67 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 360

Consensus AAGATTAAAT TCCTTAATCC GGATAGGGAG TACGACTTCA GAGATCTCAC TTGGTGCATC AACCCGCCAG AGAGGATCAA ACTAGATTAT GATCAATACT GTGCAGATGT GGCTGCTGAA 480

HA R83 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 480

HA R72 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 480

HA R82 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 480

HA R67 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 480

Consensus GAGCTCATGA ATGCATTGGT GAACTCAACT CTACTGGAGA CCAGAACAAC CAATCAGTTC CTAGCTGTCT CAAAGGGAAA CTGCTCAGGG CCCACTACAA TCAGAGGTCA ATTCTCAAAC 600

HA R83 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 600

HA R72 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 600

HA R82 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 600

HA R67 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 600

Consensus ATGTCGCTGT CCTTGTTGGA CTTGTACTTA GGTCGAGGTT ACAATGTGTC ATCTATAGTC ACTATGACAT CCCAGGGAAT GTATGGGGGA ACCTACCTAG TTGAAAAGCC TAATCTGAAC 720

HA R83 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 720

HA R72 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 720

HA R82 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 720

HA R67 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 720

Consensus AGCAAAGGGT CAGAGTTGTC ACAACTGAGC ATGTACCGAG TGTTTGAAGT AGGTGTTATC AGAAACCCGG GTTTGGGGGC TCCGGKGTTC CATATGACAA ACTATTTTGA GCAACCAGTC 840

HA R83 .......... .......... .......... .......... .......... .......... .......... .......... .....G.... .......... .......... .......... 840

HA R72 .......... .......... .......... .......... .......... .......... .......... .......... .....T.... .......... .......... .......... 840

HA R82 .......... .......... .......... .......... .......... .......... .......... .......... .....T.... .......... .......... .......... 840

HA R67 .......... .......... .......... .......... .......... .......... .......... .......... .....T.... .......... .......... .......... 840

Consensus AGTAATGGTC TCGGCAACTG TATGGTGGCT TTGGGGGAGC TCAAACTCGC AGCCCTTTGT CACGGGGACG ATTCTATCAC AATTCCCTAT CAGGGRTCAG GGAAAGGTGT CAGCTTCCAG 960

HA R83 .......... .......... .......... .......... .......... .......... .......... .......... .......... .....A.... .......... .......... 960

HA R72 .......... .......... .......... .......... .......... .......... .......... .......... .......... .....G.... .......... .......... 960

HA R82 .......... .......... .......... .......... .......... .......... .......... .......... .......... .....A.... .......... .......... 960

HA R67 .......... .......... .......... .......... .......... .......... .......... .......... .......... .....A.... .......... .......... 960

Consensus CTCGTCAAGC TGGGTGTCTG GAAATCCCCA ACCGACATGC AATCCTGGGT CCCCTTATCA ACGGATGATC CAGTGGTAGA CAGGCTTTAC CTCTCATCTC ACAGAGGTGT CATCGCTGAC 1080

HA R83 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1080

HA R72 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1080

HA R82 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1080

HA R67 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1080

Consensus AATCAAGCAA AATGGGCTGT CCCGACAACA CGAACAGATG ACAAGTTGCG AATGGAGACA TGCTTCCAGC AGGCGTGTAA GGGTAAAATC CAAGCACTCT GCGAGAATCC CGAGTGGGCA 1200

HA R83 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1200

HA R72 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1200

HA R82 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1200

HA R67 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1200

Consensus CCATTGAAGG ATAACAGGAT TCCTTCATAC GGGGTCTTGT CTGTTGATCT GAGTCTGACA GTTGAGCTTA AAATCAAAAT TGCTTCGGGA TTCGGGCCAT TGATCACACA CGGCTCAGGG 1320

HA R83 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1320

HA R72 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1320

HA R82 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1320

HA R67 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1320

Consensus ATGGACCTAT ACAAATCCAA CCGCAACAAT GTGTATTGGC TGACTATCCC GCCAATGAGA AATCTAGCCT TAGGCGTAAT CAACACATTG GAGTGGATAC CGAGATTCAA GGTTAGTCCC 1440

HA R83 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1440

HA R72 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1440

HA R82 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1440

HA R67 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1440

Consensus AACCTCTTCA CTGTCCCAAT TAAGGAAGCA GGCGAAGACT GCCATGCCCC AACATACCTA CCTGCGGAGG TGGACGGTGA TGTCAAACTC AGTTCCAACC TGGTGATTCT ACCTGGTCAA 1560

HA R83 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1560

HA R72 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1560

HA R82 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1560

HA R67 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1560

Consensus GATCTCCAAT ATGTTTTGGC AACCTACGAT ACCTCCAGGG TTGAGCATGC TGTGGTTTAT TACGTTTACA GCCCAAGCCG CTCATTTTCT TACTTTTATC CTTTTAGGTT GCCTATAAAG 1680

HA R83 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1680

HA R72 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1680

HA R82 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1680

HA R67 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1680

Consensus GGGGTCCCAA TCGAACTACA AGTGGAATGC TTCACATGGG ACCAAAAACT CTGGTGCCGT CACTTCTGTG TGCTTGCGGA CTCARAATCC GGTGGACATA TCACTCACTC TGGGATGGTG 1800

HA R83 .......... .......... .......... .......... .......... .......... .......... .......... ....G..... .......... .......... .......... 1800

HA R72 .......... .......... .......... .......... .......... .......... .......... .......... ....G..... .......... .......... .......... 1800

HA R82 .......... .......... .......... .......... .......... .......... .......... .......... ....A..... .......... .......... .......... 1800

HA R67 .......... .......... .......... .......... .......... .......... .......... .......... ....G..... .......... .......... .......... 1800

Consensus GGCATGGGAG TCAGCTGCAC AGCCACCCGG GAAGATGGAA CCAATCGCAG ATAG 1854

HA R83 .......... .......... .......... .......... .......... .... 1854

HA R72 .......... .......... .......... .......... .......... .... 1854

HA R82 .......... .......... .......... .......... .......... .... 1854

HA R67 .......... .......... .......... .......... .......... .... 1854

Annexe 5: comparaison des séquences des gènes H des souches CR67, CR72, CR82, CR83

isolées au Cameroun en 2001.


Consensus KVSSTLASEL GITAEDARLV SEIAMHTTED RISRAVGPRQ AQVSFLHGDQ 50

Trans of N CR83 .......... .......... .......... .......... .......... 50

Trans of N CR82 .......... .......... .......... .......... .......... 50

Trans of N CR72 .......... .......... .......... .......... .......... 50

Trans of N CR67 .......... .......... .......... .......... .......... 50

Consensus SENELPRLGG KEDRRVKQSR GEAGESHRET GPSRASDARA AHPPTGTPLD 100

Trans of N CR83 .......... .......... .......... .......... .......... 100

Trans of N CR82 .......... .......... .......... .......... .......... 100

Trans of N CR72 .......... .......... .......... .......... .......... 100

Trans of N CR67 .......... .......... .......... .......... .......... 100

Consensus IDTASEFSQD PQDSRRSADA LLRLQAMAGI SEEQDSDTDT PRVYNDRDLL 150

Trans of N CR83 .......... .......... .......... .......... .......... 150

Trans of N CR82 .......... .......... .......... .......... .......... 150

Trans of N CR72 .......... .......... .......... .......... .......... 150

Trans of N CR67 .......... .......... .......... .......... .......... 150

Consensus D 151

Trans of N CR83 . 151

Trans of N CR82 . 151

Trans of N CR72 . 151

Trans of N CR67 . 151

Annexe 5 (suite) : Comparaison des séquences de la partie C-terminale de la protéine N

des souches CR67, CR72, CR82, CR83 isolées au Cameroun en 2001.


Consensus MSPQRDRINA FYKDNPYPKG SRIVINREHL MIDRPYVLLA VLFVMFLSLI GLLAIAGIRL HRAAIYTAEI HKSLS 75

Trans of HA CR67 .......... .......... .......... .......... .......... .......... .......... ..... 75

Trans of HA CR72 .......... .......... .......... .......... .......... .......... .......... ..... 75

Trans of HA B1 .......... .......... .......... .......... .......... .......... .......... ..... 75

Trans of HA Y14 .......... .......... .......... .......... .......... .......... .......... ..... 75

Trans of HA Y22 .......... .......... .......... .......... .......... .......... .......... ..... 75

Consensus TNLDVTNSIE HQVKDVLTPL FKIIGDEVGL RTPQRFTDLV KFISDKIKFL NPDREYDFRD LTWCINPPER IKLDY 150

Trans of HA CR67 .......... .......... .......... ......S... .......... .......... .......... ..... 150

Trans of HA CR72 .......... .......... .......... ......S... .......... .......... .......... ..... 150

Trans of HA B1 .......... .......... .......... .......... .......... .......... .......... ..... 150

Trans of HA Y14 .......... .......... .......... .......... .......... .......... .......... ..... 150

Trans of HA Y22 .......... .......... .......... .......... .......... .......... .......... ..... 150

Consensus DQYCADVAAE ELMNALVNST LLETRTTNQF LAVSKGNCSG PTTIRGQFSN MSLSLLDLYL GRGYNVSSIV TMTSQ 225

Trans of HA CR67 .......... .......... .......... .......... .......... .......... .......... ..... 225

Trans of HA CR72 .......... .......... .......... .......... .......... .......... .......... ..... 225

Trans of HA B1 .......... .......... .......... .......... .......... .......... .......... ..... 225

Trans of HA Y14 .......... .......... .......... .......... .......... .......... .......... ..... 225

Trans of HA Y22 .......... .......... .......... .......... .......... .......... .......... ..... 225

Consensus GMYGGTYLVE KPNLSSKGSE LSQLSMYRVF EVGVIRNPGL GAPVFHMTNY FEQPVSNDLG NCMVALGELK LAALC 300

Trans of HA CR67 .......... ....N..... .......... .......... .......... .......G.. .......... ..... 300

Trans of HA CR72 .......... ....N..... .......... .......... .......... .......G.. .......... ..... 300

Trans of HA B1 .......... .......... .......... .......... .......... .......... .......... ..... 300

Trans of HA Y14 .......... .......... .......... .......... .......... .......... .......... ..... 300

Trans of HA Y22 .......... .......... ..H....... .......... .......... .......... .......... ..... 300

Consensus HGEDSITIPY QGSGKGVSFQ LVKLGVWKSP TDMQSWVPLS TDDPVIDRLY LSSHRGVIAD NQAKWAVPTT RTDDK 375

Trans of HA CR67 ..D....... .......... .......... .......... .....V.... .......... .......... ..... 375

Trans of HA CR72 ..D....... .......... .......... .......... .....V.... .......... .......... ..... 375

Trans of HA B1 .......... .......... .......... .......... .......... .......... .......... ..... 375

Trans of HA Y14 .......... .......... .......... .......... .......... .......... .......... ..... 375

Trans of HA Y22 .......... .......... .......... .......... .......... .......... .......... ..... 375

Consensus LRMETCFQQA CKGKIQALCE NPEWAPLKDN RIPSYGVLSV DLSLTVELKI KIASGFGPLI THGSGMDLYK SNHNN 450

Trans of HA CR67 .......... .......... .......... .......... .......... .......... .......... ..R.. 450

Trans of HA CR72 .......... .......... .......... .......... .......... .......... .......... ..R.. 450

Trans of HA B1 .......... .......... .......... .......... .......... .......... .......... ..... 450

Trans of HA Y14 .......... .......... .......... .......... .......... .......... .......... ..... 450

Trans of HA Y22 .......... .......... .......... .......... .......... .......... .......... ..... 450

Consensus VYWLTIPPMR NLALGVINTL EWIPRFKVSP NLFTVPIKEA GEDCHAPTYL PAEVDGDVKL SSNLVILPGQ DLQYV 525

Trans of HA CR67 .......... .......... .......... .......... .......... .......... .......... ..... 525

Trans of HA CR72 .......... .......... .......... .......... .......... .......... .......... ..... 525

Trans of HA B1 .......... .......... .......... .......... .......... .......... .......... ..... 525

Trans of HA Y14 .......... .......... .......... .......... .......... .......... .......... ..... 525

Trans of HA Y22 .......... .......... .......... .......... .......... .......... .......... ..... 525

Consensus LATYDTSRVE HAVVYYVYSP SRSFSYFYPF RLPIKGVPIE LQVECFTWDQ KLWCRHFCVL ADSESGGHIT HSGMV 600

Trans of HA CR67 .......... .......... .......... .......... .......... .......... .......... ..... 600

Trans of HA CR72 .......... .......... .......... .......... .......... .......... .......... ..... 600

Trans of HA B1 .......... .......... G......... .......... .......... .......... .......... ..... 600

Trans of HA Y14 .......... .......... G......... .......... .......... .......... .......... ..... 600

Trans of HA Y22 .......... .......... .......... .......... .......... .......... .......... ..... 600

Consensus GMGVSCTATR EDGTNRR 617

Trans of HA CR67 .......... ....... 617

Trans of HA CR72 .......... ....... 617

Trans of HA B1 .......... ....... 617

Trans of HA Y14 .......... ....... 617

Trans of HA Y22 .......... ....... 617

Annexe 6: Comparaison des séquences des protéines HA des souches du Cameroun ; Y14 et Y22 (1983),

CR67, CR72 (2001), B1 (référence clade B1).


Consensus ATGTCACCGC AACGAGACCG GATAAATGCC TTCTACAAAG ATAACCCTTA TCCCAAGGGA AGTAGGATAG TTATTAACAG AGAACATCTT ATGATTGACA 100

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 100

HA Lys .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 100

Consensus GACCTTATGT TTTGCTGGCT GTTCTGTTCG TCATGTTTCT GAGCTTGATC GGGTTGCTGG CCATTGCAGG CATTAGACTT CATCGGGCAG CCATCTACAC 200

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 200

HA Lys .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 200

Consensus CGCGGAGATC CATAAAAGCC TCAGCACCAA TCTAGATGTA ACTAACTCAA TCGAGCATCA GGTCAAGGAC GTGCTGACAC CACTCTTTAA AATCATCGGG 300

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 300

HA Lys .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 300

Consensus GATGAAGTGG GCCTGAGAAC ACCTCAGAGA TTCACTGACC TAGTGAAATT CATCTCTGAC AAGATTAAAT TCCTTAATCC GGATAGGGAG TACGACTTCA 400

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 400

HA Lys .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 400

Consensus GAGATCTCAC TTGGTGTATC AACCCGCCAG AGAGAATCAA ACTGGATTAT GATCAATACT GTGCAGATGT GGCTGCTGAA GAGCTCATGA ATGCATTGGT 500

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 500

HA Lys .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 500

Consensus GAACTCAACT CTACTGGAGA CCAGAACAAC CAATCAGTTC CTAGCTGTCT CAAAGGGAAA CTGCTCAGGG CCCACTACAA TCAGAGGTCA ATTCTCAAAC 600

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 600

HA Lys .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 600

Consensus ATGTCGCTGT CCTTATTGGA CCTGTACTTA GGTCGGGGTT ACAATGTGTC ATCTATAGTC ACTATGACAT CCCAGGGAAT GTATGGGGGA ACCTACYTAG 700

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... ......T... 700

HA Lys .......... .......... .......... .......... .......... .......... .......... .......... .......... ......C... 700

Consensus TGGAAAAGCC TAATCTGAGC AGCAAAGGGT CAGAGTTGTC ACAACTGAGC ATGTACCGAG TGTTTGAAGT AGGTGTTATC AGAAACCCGG GTTTGGGGGC 800

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 800

HA Lys .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 800

Consensus TCCGGTGTTC CATATGACAA ACTATTTTGA GCAACCAGTC AGTAATGATC TCGGCAACTG TATGGTAGCT TTGGGGGAGC TCAAACTCGC AGCCCTTTGT 900

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 900

HA Lys .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 900

Consensus CACGGGGAAG ATTCTATCAC AATTCCCTAT CAGGGATCAG GGAAAGGTGT CAGCTTCCAG CTCGTCAAGC TRGGTGTCTG GAAATCCCCA ACCGACATGC 1000

HA G954 .......... .......... .......... .......... .......... .......... .......... .A........ .......... .......... 1000

HA Lys .......... .......... .......... .......... .......... .......... .......... .G........ .......... .......... 1000

Consensus AATCCTGGGT CCCCTTATCA ACGGATGATC CAGTGGTAGA CAGGCTTTAC CTCTCATCTC ACAGAGGTGT CATCGCTGAC AATCAAGCAA AATGGGCTGT 1100

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1100

HA Lys .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1100

Consensus CCCGACAACA CGAACAGATG ACAAGTTGCG AATGGAGACA TGCTTCCAGC AGGCGTGTAA AGGTAAAATC CAAGCACTCT GCGAGAATCC CGAGTGGGCA 1200

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1200

HA Lys .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1200

Consensus CCATTGAARG ATAACAGGAT TCCTTCATAC GGGGTCCTGT CTGTTGATCT GAGTCTGACA GTTGAGCTTA AAATCAARAT TGCTTCGGGA TTCGGACCAT 1300

HA G954 ........G. .......... .......... .......... .......... .......... .......... .......G.. .......... .......... 1300

HA Lys ........A. .......... .......... .......... .......... .......... .......... .......A.. .......... .......... 1300

Consensus TGATYACGCA CGGCTCAGGG ATGGACCTAT ACAAATCCAA CCGCAACAAT GTGTATTGGC TGACTATCCC GCCAATGAGG AATCTAGCCT TAGGTGTAAT 1400

HA G954 ....T..... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1400

HA Lys ....C..... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1400

Consensus CAACACATTG GCGTGGATAC CGAGATTCAA GGTTAGTCCC AACCTCTTCA CTGTCCCAAT TAAGGAAGCA GGCGAAGACT GCCATGCCCC AACATACCTA 1500

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1500

HA Lys .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1500

Consensus CCTGCGGAGG TGGACGGTGA TGTCAAACTC AGTTCCAATC TGGTGATTCT ACCTGGTCAA GATCTCCAAT AYGTYTTGGC AACCTACGAT ACTTCCAGGG 1600

HA G954 .......... .......... .......... .......... .......... .......... .......... .T..T..... .......... .......... 1600

HA Lys .......... .......... .......... .......... .......... .......... .......... .C..C..... .......... .......... 1600

Consensus TTGAACATGC TGTGGTTTAT TACGTTTACA GCCCAAGCCG CTCATTTTCT TACTTTTATC CTTTTAGGTT GCCTATAAAG GGGGTCCCAA TCGAATTACA 1700

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1700

HA Lys .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1700

Consensus AGTGGAATGC TTCACATGGG ACCAAAAACT CTGGTGCCGT CACTTCTGTG TGCTTGCGGA CTCGGAATCC GGTGGACATA TCACTCACTC TGGGATGGTG 1800

HA G954 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1800

HA Lys .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... 1800

Consensus GGCATGGGAG TCAGCTGCAC AGCCACCCGG GAAGATGGRA CCAATCGCAG ATAG 1854

HA G954 .......... .......... .......... ........G. .......... .... 1854

HA Lys .......... .......... .......... ........A. .......... .... 1854

Annexe 7 : Comparaison des séquences des gènes HA de la souches G954

isolée en Gambie en 1993 et de la souche Lys-1 isolée à Lyon en 1994 sur un

patient arrivant de la Gambie


Consensus MGLKVNVSAI FMAVLLTLQT PAGQIHWGNL SKIGVVGIGS ASYKVMTRSS HQSLVIKLMP NITLLNNCTR VEIAE 75

Trans of F lys .......... .......... .......... .......... .......... ........I. .........K ..... 75

Trans of F G954 .......... .......... .......... .......... .......... .......... .........K ..... 75

Trans of F CR67 .........V .......... .......... .......... .......... .......... .......... ..... 75

Trans of F CR 72 .........V .......... .......... .......... .......... .......... .......... ..... 75

Trans of F Edmonsto .......... .......... .T........ .......... .......... .......... .......... ..... 75

Consensus YRRLLRTVLE PIRDALNAMT QNIRPVQSVA SSRRHKRFAG VVLAGAALGV ATAAQITAGI ALHRSMLNSQ AIDNL 150

Trans of F lys .......... .......... .......... ..M....... .......... .......... .......... ..... 150

Trans of F G954 .......... .......... .......... .......... .......... .......... .......... ..... 150

Trans of F CR67 .......... .......... .......... .......... .......... .......... .......... ..... 150

Trans of F CR 72 .......... .......... .......... .......... .......... .......... .......... ..... 150

Trans of F Edmonsto .......... .......... .......... .......... .......... .......... ...Q...... ..... 150

Consensus RASLETTNQA IEAIRQAGQE MILAVQGVQD YINNELIPSM NQLSCDLIGQ KLGLKLLRYY TEILSLFGPS LRDPI 225

Trans of F lys .......... .......... .......... .......... .......... .......... .......... ..... 225

Trans of F G954 .......... .......... .......... .......... .......... .......... .......... ..... 225

Trans of F CR67 .......... .......... .......... .......... .......... .......... .......... ..... 225

Trans of F CR 72 .......... .......... .......... .......... .......... .......... .......... ..... 225

Trans of F Edmonsto .......... .......... .......... .......... .......... .......... .......... ..... 225

Consensus SAEISIQALS YALGGDINKV LEKLGYSGGD LLGILESRGI KARITHVDTE SYFIVLSIAY PTLSEIKGVI VHRLE 300

Trans of F lys .......... .......... .......... .......... .......... .......... .......... ..... 300

Trans of F G954 .......... .......... .......... .......... .......... .......... .......... ..... 300

Trans of F CR67 .......... .......... .......... .......... .......... .......... .......... ..... 300

Trans of F CR 72 .......... .......... .......... .......... .......... .......... .......... ..... 300

Trans of F Edmonsto .......... .......... .......... .......... .......... .......... .......... ..... 300

Consensus GVSYNIGSQE WYTTVPKYVA TQGYLISNFD ESSCTFMPEG TVCSQNALYP MSPLLQECLR GSTKSCARTL VSGSF 375

Trans of F lys .......... .......... .......... .......... .......... .......... .......... ..... 375

Trans of F G954 .......... .......... .......... .......... .......... .......... .......... ..... 375

Trans of F CR67 .......... .......... .......... .......... .......... .......... .......... ..... 375

Trans of F CR 72 .......... ...P...... .......... .......... .......... .......... .......... ..... 375

Trans of F Edmonsto .......... .......... .......... .......... .......... .......... .......... ..... 375

Consensus GNRFILSQGN LIANCASILC KCYTTGTIIN QDPDKILTYI AADRCPVVEV NGVTIQVGSR RYPDAVYLHR IDLGP 450

Trans of F lys .......... .......... .......... .......... .......... .......... .......... ..... 450

Trans of F G954 .......... .......... .......... .......... .......... .......... .......... ..... 450

Trans of F CR67 .......... .......... .......... .......... .......... .......... .......... ..... 450

Trans of F CR 72 .......... .......... .......... .......... .......... .......... .......... ..... 450

Trans of F Edmonsto .......... .......... .......... .......... ...H...... .......... .......... ..... 450

Consensus PISLERLDVG TNLGNAIAKL EDAKELLESS DQILRSMKGL SSTSIVYILI AVCLGGLIGI PTLICCCRGR CNKKG 525

Trans of F lys .......... .......... .......... .......... .......... .......... .......... ..... 525

Trans of F G954 .......... .......... .......... .......... .......... .......... .......... ..... 525

Trans of F CR67 .......... .......... .......... .......... .......... .......... .......... ..... 525

Trans of F CR 72 .......... .......... .......... .......... .......... .......... .......... ..... 525

Trans of F Edmonsto .......... .......... .......... .......... .......... .......... .A........ ..... 525

Consensus EQVGMSRPGL KPDLTGTSKS YVRSL 550

Trans of F lys .......... .......... ..... 550

Trans of F G954 .......... .......... ..... 550

Trans of F CR67 .......... .......... ..... 550

Trans of F CR 72 .......... .......... ..... 550

Trans of F Edmonsto .......... .......... ..... 550


BIBLIOGRAPHIE

145


Aaby, P., Bukh, J., Lisse, I. M. & Smits, A. J. (1984). Overcrowding and intensive exposure

as determinants of measles mortality. Am J Epidemiol 120, 49-63.

Aaby, P., Samb, B., Simondon, F., Knudsen, K., Seck, A. M., Bennett, J., Markowitz, L. &

Whittle, H. (1996). A comparison of vaccine efficacy and mortality during routine use

of high-titre Edmonston-Zagreb and Schwarz standard measles vaccines in rural

Senegal. Trans R Soc Trop Med Hyg 90, 326-30.

(ACIP), Immunisation Practices Advisory Commitee (USA). (1989). Measles prevention.

MMWR 38 (S-9), 1-13.

Albrecht, P., Ennis, F. A., Saltzman, E. J. & Krugman, S. (1977). Persistence of maternal

antibody in infants beyond 12 months: mechanism of measles vaccine failure. J

Pediatr 91, 715-8.

Albrecht, P., Herrmann, K. & Burns, G. R. (1981). Role of virus strain in conventional and

enhanced measles plaque neutralization test. J Virol Methods 3, 251-60.

Alkhatib, G. & Briedis, D. J. (1986). The predicted primary structure of the measles virus

hemagglutinin. Virology 150, 479-90.

Alkhatib, G., Roder, J., Richardson, C., Briedis, D., Weinberg, R., Smith, D., Taylor, J.,

Paoletti, E. & Shen, S. H. (1994a). Characterization of a cleavage mutant of the

measles virus fusion protein defective in syncytium formation. J Virol 68, 6770-4.

Alkhatib, G., Shen, S. H., Briedis, D., Richardson, C., Massie, B., Weinberg, R., Smith, D.,

Taylor, J., Paoletti, E. & Roder, J. (1994b). Functional analysis of N-linked

glycosylation mutants of the measles virus fusion protein synthesized by recombinant

vaccinia virus vectors. J Virol 68, 1522-31.

Ambe, J. P., Omotara, B. A. & Mandu Baba, M. (2001). Perceptions, beliefs and practices of

mothers in sub-urban and rural areas towards measles and measles vaccination in

Northern Nigeria. Trop Doct 31, 89-90.

Arneborn, P. & Biberfeld, G. (1983). T-lymphocyte subpopulations in relation to

immunosuppression in measles and varicella. Infect Immun 39, 29-37.

Atkinson, W. L., Orenstein, W. A. & Krugman, S. (1992). The resurgence of measles in the

United States, 1989-1990. Annu Rev Med 43, 451-63.

146


Attibele, N., Wyde, P. R., Trial, J., Smole, S. C., Smith, C. W. & Rossen, R. D. (1993).

Measles virus-induced changes in leukocyte function antigen 1 expression and

leukocyte aggregation: possible role in measles virus pathogenesis. J Virol 67, 1075-9.

Axton, J. H. (1975). Measles: a protein-losing enteropathy. Br Med J 3, 79-80.

Baczko, K., Liebert, U. G., Billeter, M., Cattaneo, R., Budka, H. & ter Meulen, V. (1986).

Expression of defective measles virus genes in brain tissues of patients with subacute

sclerosing panencephalitis. J Virol 59, 472-8.

Baczko, K., Liebert, U. G., Cattaneo, R., Billeter, M. A., Roos, R. P. & ter Meulen, V. (1988).

Restriction of measles virus gene expression in measles inclusion body encephalitis. J

Infect Dis 158, 144-50.

Barrata, R., Ginter, M., Price, M. & al., e. (1970). Measles (rubeola) in previously immunized

children. Pediatrics 46, 397-402.

Beauverger, P., Buckland, R. & Wild, T. F. (1993). Measles virus antigens induce both typespecific

and canine distemper virus cross-reactive cytotoxic T lymphocytes in mice:

localization of a common Ld-restricted nucleoprotein epitope. J Gen Virol 74, 2357-

63.

Beauverger, P., Cardoso, A. I., Daviet, L., Buckland, R. & Wild, T. F. (1996). Analysis of the

contribution of CTL epitopes in the immunobiology of morbillivirus infection.

Virology 219, 133-9.

Beck, M., Smerdel, S., Dedic, I., Delimar, N., Rajninger-Miholic, M., Juzbasic, M.,

Manhalter, T., Vlatkovic, R., Borcic, B. & Mihajic, Z. (1986). Immune response to

Edmonston-Zagreb measles virus strain in monovalent and combined MMR vaccine.

Dev Biol Stand 65, 95-100.

Bellini, W. J., Englund, G., Rozenblatt, S., Arnheiter, H. & Richardson, C. D. (1985). Measles

virus P gene codes for two proteins. J Virol 53, 908-19.

Bellini, W. J. & Rota, P. A. (1998). Genetic diversity of wild-type measles viruses:

implications for global measles elimination programs. Emerg Infect Dis 4, 29-35.

Black, F. L. (1989). Measles active and passive immunity in a worldwide perspective. Prog

Med Virol 36, 1-33.

Black, F. L., Berman, L. L., Borgono, J. M., Capper, R. A., Carvalho, A. A., Collins, C.,

Glover, O., Hijazi, Z., Jacobson, D. L., Lee, Y. L. & et al. (1986). Geographic

variation in infant loss of maternal measles antibody and in prevalence of rubella

antibody. Am J Epidemiol 124, 442-52.

147


Bouteille, M., Fontaine C., Vedrenne C., Delarue J. (1965). Sur un cas d'encéphalite subaigü à

inclusion : étude anatomoclinique et ultrastructural. Rev Neurol 113, 454-58.

Buckland, R., Malvoisin, E., Beauverger, P. & Wild, F. (1992). A leucine zipper structure

present in the measles virus fusion protein is not required for its tetramerization but is

essential for fusion. J Gen Virol 73, 1703-7.

Buckland, R. & Wild, T. F. (1997). Is CD46 the cellular receptor for measles virus? Virus Res

48, 1-9.

Cardoso, A. I., Blixenkrone-Moller, M., Fayolle, J., Liu, M., Buckland, R. & Wild, T. F.

(1996). Immunization with plasmid DNA encoding for the measles virus

hemagglutinin and nucleoprotein leads to humoral and cell-mediated immunity.

Virology 225, 293-9.

Cardoso, A. I., Sixt, N., Vallier, A., Fayolle, J., Buckland, R. & Wild, T. F. (1998). Measles

virus DNA vaccination: antibody isotype is determined by the method of

immunization and by the nature of both the antigen and the coimmunized antigen. J

Virol 72, 2516-8.

Carter, C., Conway, T., Cornfeld, D. & al., e. (1962). Serologic response of children to

inactivated measles vaccine. JAMA 179, 848-853.

Cattaneo, R., Rebmann, G., Baczko, K., ter Meulen, V. & Billeter, M. A. (1987a). Altered

ratios of measles virus transcripts in diseased human brains. Virology 160, 523-6.

Cattaneo, R., Rebmann, G., Schmid, A., Baczko, K., ter Meulen, V. & Billeter, M. A.

(1987b). Altered transcription of a defective measles virus genome derived from a

diseased human brain. Embo J 6, 681-8.

Cattaneo, R., Schmid, A., Billeter, M. A., Sheppard, R. D. & Udem, S. A. (1988). Multiple

viral mutations rather than host factors cause defective measles virus gene expression

in a subacute sclerosing panencephalitis cell line. J Virol 62, 1388-97.

CDC, Centers for Disease Control. (1976). Atypical measles -California 1974-1975. Morb

Mort WeeKly Rep 25, 245-246.

CDC, Centers for Disease Control. (1989). Measles prevention: recommendation of the

Immunization Practices Advisory Commitee. Morb Mort WeeKly Rep 38, S-9.

CDC, Centers for Disease Control (1993). Absence of reported measles : United-States,

November 1993. Morb Mort WeeKly Rep 42, 925-926.

CDC, Centers for Disease Control. (2000). Measles-United States, 1999. Morb Mort WeeKly

Rep 49, 557-60.

Chatain, J. (2001). AFRIQUE Niger : La rougeole tue toujours. L'huma Quotidien.

148


Chen, R. T., Markowitz, L. E., Albrecht, P., Stewart, J. A., Mofenson, L. M., Preblud, S. R. &

Orenstein, W. A. (1990). Measles antibody: reevaluation of protective titers. J Infect

Dis 162, 1036-42.

Cherry, J., Feigin, R., Schackelford, P., Hinthorn, D. & Schimidt, R. (1973). A clinical and

serologic study of 103 children with measles vaccine failure. J Pediatr 82, 802-8.

Chibo, D., Birch, C. J., Rota, P. A. & Catton, M. G. (2000). Molecular characterization of

measles viruses isolated in Victoria, Australia, between 1973 and 1998. J Gen Virol

81, 2511-8.

Christenson, B. & Bottiger, M. (1994). Measles antibody: comparison of long-term

vaccination titres, early vaccination titres and naturally acquired immunity to and

booster effects on the measles virus. Vaccine 12, 129-33.

Cichutek, K. (2000). DNA vaccines: development, standardization and regulation.

Intervirology 43, 331-8.

Cocks, B. G., Chang, C. C., Carballido, J. M., Yssel, H., de Vries, J. E. & Aversa, G. (1995).

A novel receptor involved in T-cell activation. Nature 376, 260-3.

Cohen, S., McGregor, I. & Carington, S. (1961). g-globulin and acquired immunity to human

malaria. Nature 192, 733-87.

Cutts, F. & Brown, D. (1995). The contribution of field tests to measles surveillance and

control: a review of available methods. Reviews in Medical Virology 5, 35-40.

Cutts, F., Soares, A., Jecque, A. V., Cliff, J., Kortbeek, S. & Colombo, S. (1990a. The use of

evaluation to improve the Expanded Programme on Immunization in Mozambique.

Bull World Health Organ 68, 199-208.

Cutts, F. T., Smith, P. G., Colombo, S., Mann, G., Ascherio, A. & Soares, A. C. (1990b).

Field evaluation of measles vaccine efficacy in Mozambique. Am J Epidemiol 131,

349-55.

Cutts, F. T., Diallo, S., Zell, E. R. & Rhodes, P. (1991). Determinants of vaccination in an

urban population in Conakry, Guinea. Int J Epidemiol 20, 1099-106.

Cutts, F. T., Clements, C. J. & Bennett, J. V. (1997). Alternative routes of measles

immunization: a review. Biologicals 25, 323-38.

Dai, B., Chen, Z. H., Liu, Q. C., Wu, T., Guo, C. Y., Wang, X. Z., Fang, H. H. & Xiang, Y. Z.

(1991). Duration of immunity following immunization with live measles vaccine: 15

years of observation in Zhejiang Province, China. Bull World Health Organ 69, 415-

23.

149


Davenport, M. P., Quinn, C. L., Chicz, R. M., Green, B. N., Willis, A. C., Lane, W. S., Bell,

J. I. & Hill, A. V. (1995). Naturally processed peptides from two disease-resistanceassociated

HLA- DR13 alleles show related sequence motifs and the effects of the

dimorphism at position 86 of the HLA-DR beta chain. Proc Natl Acad Sci U S A 92,

6567-71.

Davis, R. M., Whitman, E. D., Orenstein, W. A., Preblud, S. R., Markowitz, L. E. & Hinman,

A. R. (1987). A persistent outbreak of measles despite appropriate prevention and

control measures. Am J Epidemiol 126, 438-49.

Dawson, J. (1933). Cellular inclusions in cerebral lesions of lethargie encephalitis. Am J

Pathol 9, 7-15.

De-Coto, E. (1983). Evolution of the measles vaccination program in Costa Rica. Rev Infect

Dis 38 (S-9), 1-13.

Deseda-Tous, J., Cherry, J. D., Spencer, M. J., Welliver, R. C., Boyer, K. M., Dudley, J. P.,

Zahradnik, J. M., Krause, P. J. & Walbergh, E. W. (1978). Measles revaccination.

Persistence and degree of antibody titer by type of immune response. Am J Dis Child

132, 287-90.

Dilraj, A., Cutts, F. T., de Castro, J. F., Wheeler, J. G., Brown, D., Roth, C., Coovadia, H. M.

& Bennett, J. V. (2000). Response to different measles vaccine strains given by

aerosol and subcutaneous routes to schoolchildren: a randomised trial. Lancet 355,

798-803.

Dorig, R. E., Marcil, A., Chopra, A. & Richardson, C. D. (1993). The human CD46 molecule

is a receptor for measles virus (Edmonston strain). Cell 75, 295-305.

Drillien, R., Spehner, D., Kirn, A., Giraudon, P., Buckland, R., Wild, F. & Lecocq, J. P.

(1988). Protection of mice from fatal measles encephalitis by vaccination with

vaccinia virus recombinants encoding either the hemagglutinin or the fusion protein.

Proc Natl Acad Sci U S A 85, 1252-6.

Edmonson, M. B., Addiss, D. G., McPherson, J. T., Berg, J. L., Circo, S. R. & Davis, J. P.

(1990). Mild measles and secondary vaccine failure during a sustained outbreak in a

highly vaccinated population. Jama 263, 2467-71.

Edmunds, W. J., Gay, N. J., Henao Restrepo, A. M., Olive, J. M. & Bele, O. (2001). Measles

vaccination in Africa: by how much could routine coverage be improved? Vaccine 20,

16-8.

150


El-Mubarak, H., Bildt, M. V. d., Mustafa, O., Vos, H., Mukhtar, M., Ibrahim, S., Hassan, A.

E., Osterhaus, A. & Swart, a. R. d. (2002). Genitic characterization of wild-type

measles viruses circulating in suburban Khartoum, 1997-2000. J Gen Virol 83, 1437-

43.

Enders, J. & Peebles, T. (1954). Propagation in tissue cultures of cytopathic agents from

patients with measles. Proc Soc Exp Biol Med 86, 277-286.

Enders-Ruckle, G. (1965). Methods of determining immunity, duration and character of

immunity resulting from measles. Arch. Virusforsch 16, 182-207.

Engelking, O., Fedorov, L. M., Lilischkis, R., ter Meulen, V. & Schneider-Schaulies, S.

(1999). Measles virus-induced immunosuppression in vitro is associated with

deregulation of G1 cell cycle control proteins. J Gen Virol 80, 1599-608.

Erlenhofer, C. Duprex, W. P. Rima, B. K. Ter Meulen, V. Schneider-Schaulies, J. (2002).

Analysis of receptor (CD46, CD150) usage by measles virus. J Gen Virol 83, 1431-

1436.

Evans, S. A., Belsham, G. J. & Barrett, T. (1990). The role of the 5' nontranslated regions of

the fusion protein mRNAs of canine distemper virus and rinderpest virus. Virology

177, 317-23.

Fagraeus, A., Tyrrell, D. L., Norberg, R. & Norrby, E. (1978). Actin filaments in

paramyxovirus-infected human fibroblasts studied by indirect immunofluorescence.

Arch Virol 57, 291-6.

Fayolle, J., Verrier, B., Buckland, R. & Wild, T. F. (1999). Characterization of a natural

mutation in an antigenic site on the fusion protein of measles virus that is involved in

neutralization. J Virol 73, 787-90.

Fernandez-de-Castro, J., Kumate, J., Sepulveda, J., Ramirez, J. & Valdespino, J. (1997). La

vacunacion antisarampionosa en Mexico por el methodo de aerosol. Salud Publica

Mex 39, 53-60.

Ferson, M. J., Young, L. C., Robertson, P. W. & Whybin, L. R. (1995). Difficulties in clinical

diagnosis of measles: proposal for modified clinical case definition. Med J Aust 163,

364-6.

Fireman, P., Friday, G. & Kumate, J. (1969). Effect of measles virus vaccine on immunologic

responsiveness. Pediatrics 43, 264-272.

151


Foege, W. (1971). Measles vaccination in Africa. In : Proceedings of the International

Conference on the Application of Vaccines Against Viral, rickettsial , and Bacterial

Diseases of Man. Washinton, DC: Pan American Health Organization; 1971, 207-

212. Scientific publication 226.

Fortin, J. F., Cantin, R., Lamontagne, G. & Tremblay, M. (1997). Host-derived ICAM-1

glycoproteins incorporated on human immunodeficiency virus type 1 are biologically

active and enhance viral infectivity. J Virol 71, 3588-96.

Foster, S. & Pifer, J. (1971). Mass measles control in west and central Africa. Afr J Med Sci 2,

151-158.

Frank, J. A., Jr., Orenstein, W. A., Bart, K. J., Bart, S. W., el-Tantawy, N., Davis, R. M. &

Hinman, A. R. (1985). Major impediments to measles elimination. The modern

epidemiology of an ancient disease. Am J Dis Child 139, 881-8.

Fujinami, R. S., Sun, X., Howell, J. M., Jenkin, J. C. & Burns, J. B. (1998). Modulation of

immune system function by measles virus infection: role of soluble factor and direct

infection. J Virol 72, 9421-7.

Fulginiti, V. A. & Arthur, J. H. (1969). Altered reactivity to measles virus. Skin test reactivity

and antibody response to measles virus antigens in recipients of killed measles virus

vaccine. J Pediatr 75, 609-16.

Fulginiti, V., Eller, J., Downie, A. & Kempe, C. (1967). Altered reactivity to measles virus:

atypical measles in children previously immunized with inactivated measles virus

vaccines. JAMA 202, 1075.

Galinski, M. & Wechsler, S. (1991). The molecular biology of the paramyxovirus genus. In:

Kingsbury DW, ed. The paramyxovituses.New York: Plenum, 41-82.

Galletti, R., Beauverger, P. & Wild, T. F. (1995). Passively administered antibody suppresses

the induction of measles virus antibodies by vaccinia-measles recombinant viruses.

Vaccine 13, 197-201.

Garenne, M., Leroy, O., Beau, J. P. & Sene, I. (1991). Child mortality after high-titre measles

vaccines: prospective study in Senegal. Lancet 338, 903-7.

Garly, M. L., Bale, C., Martins, C. L., Monteiro, M., George, E., Kidd, M., Dias, F., Aaby, P.

& Whittle, H. C. (2001). Measles antibody responses after early two dose trials in

Guinea-Bissau with Edmonston-Zagreb and Schwarz standard-titre measles vaccine:

better antibody increase from booster dose of the Edmonston-Zagreb vaccine. Vaccine

19, 1951-9.

GAVI (2000). Immunization focus. GAVI News, 1-9.

152


Gerlier, D., Loveland, B., Varior-Krishnan, G., Thorley, B., McKenzie, I. F. & Rabourdin-

Combe, C. (1994). Measles virus receptor properties are shared by several CD46

isoforms differing in extracellular regions and cytoplasmic tails. J Gen Virol 75, 2163-

71.

Giraudon, P. & Wild, T. F. (1981). Monoclonal antibodies against measles virus. J Gen Virol

54, 325-32.

Giraudon, P. & Wild, T. F. (1985). Correlation between epitopes on hemagglutinin of measles

virus and biological activities: passive protection by monoclonal antibodies is related

to their hemagglutination inhibiting activity. Virology 144, 46-58.

Giraudon, P., Jacquier, M. F. & Wild, T. F. (1988). Antigenic analysis of African measles

virus field isolates: identification and localisation of one conserved and two variable

epitope sites on the NP protein. Virus Res 10, 137-52.

Godfred, E. (1928). Measles in institution for children. J Prev Med 2, 251-72.

Gray, D. & Skarvall, H. (1988). B-cell memory is short-lived in the absence of antigen.

Nature 336, 70-3.

Greenwood, B. & Whittle, H. (1981). Immunology of medicine in the tropics. London :

Edward Arnold.

Griffin, D. (2001). Measles Virus. In : Knipe DM, Howley PM, Grifin DE, Martin MA, Lamb

RA, Roizman B, Straus SE, (eds) Fields Virology, 4th ed. Lippincott Williams &

Wilkins, Philadelphia., 1401-1441.

Griffin, D. & Bellini, W. J. (1996). Measles virus. In : BN Fields, Knipe DM, Howley PM et

al., (eds) Fields Virology, 3th ed. Lippincott-Raven publisers, Philadelphia., 1267-

1312.

Griffin, D. E., Cooper, S. J., Hirsch, R. L., Johnson, R. T., Lindo de Soriano, I., Roedenbeck,

S. & Vaisberg, A. (1985). Changes in plasma IgE levels during complicated and

uncomplicated measles virus infections. J Allergy Clin Immunol 76, 206-13.

Griffin, D. E., Moench, T. R., Johnson, R. T., Lindo de Soriano, I. & Vaisberg, A. (1986).

Peripheral blood mononuclear cells during natural measles virus infection: cell surface

phenotypes and evidence for activation. Clin Immunol Immunopathol 40, 305-12.

Griffin, D. E., Ward, B. J., Jauregui, E., Johnson, R. T. & Vaisberg, A. (1989). Immune

activation in measles. N Engl J Med 320, 1667-72.

153


Griffin, D. E., Ward, B. J., Jauregui, E., Johnson, R. T. & Vaisberg, A. (1990). Immune

activation during measles: interferon-gamma and neopterin in plasma and

cerebrospinal fluid in complicated and uncomplicated disease. J Infect Dis 161, 449-

53.

Grosjean, I., Caux, C., Bella, C., Berger, I., Wild, F., Banchereau, J. & Kaiserlian, D. (1997).

Measles virus infects human dendritic cells and blocks their allostimulatory properties

for CD4+ T cells. J Exp Med 186, 801-12.

Guinee, V. F., Henderson, D. A., Casey, H. L., Wingo, S. T., Ruthig, D. W., Cockburn, T. A.,

Vinson, T. O., Calafiore, D. C., Winkelstein, W., Jr., Karzon, D. T., Rathbun, M. L.,

Alexander, E. R. & Peterson, D. R. (1966). Cooperative measles vaccine field trial. I.

Clinical efficacy. Pediatrics 37, 649-65.

Gustafson, T. L., Lievens, A. W., Brunell, P. A., Moellenberg, R. G., Buttery, C. M. &

Sehulster, L. M. (1987). Measles outbreak in a fully immunized secondary-school

population. N Engl J Med 316, 771-4.

Guyer, B. & McBean, A. M. (1981). The epidemiology and control of measles in Yaounde,

Cameroun, 1968-1975. Int J Epidemiol 10, 263-9.

Halsey, N. A. (1993). Increased mortality after high titer measles vaccines: too much of a

good thing. Pediatr Infect Dis J 12, 462-5.

Halsey, N. A., Boulos, R., Mode, F., Andre, J., Bowman, L., Yaeger, R. G., Toureau, S.,

Rohde, J. & Boulos, C. (1985). Response to measles vaccine in Haitian infants 6 to 12

months old. Influence of maternal antibodies, malnutrition, and concurrent illnesses. N

Engl J Med 313, 544-9.

Hamaguchi, M., Yoshida, T., Nishikawa, K., Naruse, H. & Nagai, Y. (1983). Transcriptive

complex of Newcastle disease virus. I. Both L and P proteins are required to constitute

an active complex. Virology 128, 105-17.

Hanses, F., Truong, A. T., Ammerlaan, W., Ikusika, O., Adu, F., Oyefolu, A. O., Omilabu, S.

A. & Muller, C. P. (1999). Molecular epidemiology of Nigerian and Ghanaian measles

virus isolates reveals a genotype circulating widely in western and central Africa. J

Gen Virol 80, 871-7.

Hanses, F., van Binnendijk, R., Ammerlaan, W., Truong, A. T., de Rond, L., Schneider, F. &

Muller, C. P. (2000). Genetic variability of measles viruses circulating in the Benelux.

Arch Virol 145, 541-51.

Harris, M. F. (1979). The safety of measles vaccine in severe illness. S Afr Med J 55, 38.

154


Hartter, H. K., Oyedele, O. I., Dietz, K., Kreis, S., Hoffman, J. P. & Muller, C. P. (2000).

Placental transfer and decay of maternally acquired antimeasles antibodies in Nigerian

children. Pediatr Infect Dis J 19, 635-41.

Hashimoto, K. Ono, N. Tatsuo, H. Minagawa, H. Takeda, M. Takeuchi, K. Yanagi, Y. (2002).

SLAM (CD150)-Independent Measles Virus Entry as Revealed by Recombinant Virus

Expressing Green Fluorescent Protein. J Virol 76, 6743-6749.

Hayney, M. S., Poland, G. A., Jacobson, R. M., Schaid, D. J. & Lipsky, J. J. (1996). The

influence of the HLA-DRB1*13 allele on measles vaccine response. J Investig Med

44, 261-3.

Hayney, M. S., Poland, G. A., Dimanlig, P., Schaid, D. J., Jacobson, R. M. & Lipsky, J. J.

(1997). Polymorphisms of the TAP2 gene may influence antibody response to live

measles vaccine virus. Vaccine 15, 3-6.

Hendrickse, R. & Montefiore, D. (1975). Problems of future measles vaccination in

developing countries. Trans R Soc Trop Med Hyg 69.

Heymann, D. L., Mayben, G. K., Murphy, K. R., Guyer, B. & Foster, S. O. (1983). Measles

control in Yaounde: justification of a one dose, nine month minimum age vaccination

policy in tropical Africa. Lancet 2, 1470-2.

Hinman, A. R., Brandling-Bennett, A. D. & Nieburg, P. I. (1979). The opportunity and

obligation to eliminate measles from the United States. Jama 242, 1157-62.

Hinman, A. R., Orenstein, W. A., Bloch, A. B., Bart, K. J., Eddins, D. L., Amler, R. W. &

Kirby, C. D. (1983). Impact of measles in the United States. Rev Infect Dis 5, 439-44.

Hioe, C. E., Chien, P. C., Jr., Lu, C., Springer, T. A., Wang, X. H., Bandres, J. & Tuen, M.

(2001). LFA-1 expression on target cells promotes human immunodeficiency virus

type 1 infection and transmission. J Virol 75, 1077-82.

Hirano, A., Wang, A. H., Gombart, A. F. & Wong, T. C. (1992). The matrix proteins of

neurovirulent subacute sclerosing panencephalitis virus and its acute measles virus

progenitor are functionally different. Proc Natl Acad Sci U S A 89, 8745-9.

Hirano, A., Ayata, M., Wang, A. H. & Wong, T. C. (1993). Functional analysis of matrix

proteins expressed from cloned genes of measles virus variants that cause subacute

sclerosing panencephalitis reveals a common defect in nucleocapsid binding. J Virol

67, 1848-53.

Holland, J., Spindler, K., Horodyski, F., Grabau, E., Nichol, S. & VandePol, S. (1982). Rapid

evolution of RNA genomes. Science 215, 1577-85.

155


Holt, E. A., Moulton, L. H., Siberry, G. K. & Halsey, N. A. (1993). Differential mortality by

measles vaccine titer and sex. J Infect Dis 168, 1087-96.

Horta-Barbosa, L., Fuccillo, D. A., London, W. T., Jabour, J.T., Zeman, W., Sever, J. L.

Isolation of measles virus from brain cell cutltures of two patients with subacute

sclerosing panencephalitis. (1969). Proc. Soc. Exp. Biol. Med. 132, 272-277.

Hsu, E. C., Sarangi, F., Iorio, C., Sidhu, M. S., Udem, S. A., Dillehay, D. L., Xu, W., Rota, P.

A., Bellini, W. J. & Richardson, C. D. (1998). A single amino acid change in the

hemagglutinin protein of measles virus determines its ability to bind CD46 and reveals

another receptor on marmoset B cells. J Virol 72, 2905-16.

Hsu, E. C., Iorio, C., Sarangi, F., Khine, A. A. & Richardson, C. D. (2001). CDw150(SLAM)

is a receptor for a lymphotropic strain of measles virus and may account for the

immunosuppressive properties of this virus. Virology 279, 9-21.

Hu, A. & Norrby, E. (1995). Role of individual cysteines residues in the processing and

antigenicity of measles hemagglutinin protein. J Gen Virol 75, 2173-2181.

Huang, L. M., Lee, C. Y., Hsu, C. Y., Huang, S. S., Kao, C. L., Wu, F. F., Lee, C. C., Chang,

H. S. & Huang, L. Y. (1990). Effect of monovalent measles and trivalent measlesmumps-rubella

vaccines at various ages and concurrent administration with hepatitis B

vaccine. Pediatr Infect Dis J 9, 461-5.

Huber, M., Cattaneo, R., Spielhofer, P., Orvell, C., Norrby, E., Messerli, M., Perriard, J. C. &

Billeter, M. A. (1991). Measles virus phosphoprotein retains the nucleocapsid protein

in the cytoplasm. Virology 185, 299-308.

Hull, H. F., Williams, P. J. & Oldfield, F. (1983). Measles mortality and vaccine efficacy in

rural West Africa. Lancet 1, 972-5.

Hummel, K. B., Bellini, W. J. & Offermann, M. K. (1998). Strain-specific differences in

LFA-1 induction on measles virus- infected monocytes and adhesion and viral

transmission to endothelial cells. J Virol 72, 8403-7.

Hussey, G. D., Goddard, E. A., Hughes, J., Ryon, J. J., Kerran, M., Carelse, E., Strebel, P. M.,

Markowitz, L. E., Moodie, J., Barron, P., Latief, Z., Sayed, R., Beatty, D. & Griffin,

D. E. (1996). The effect of Edmonston-Zagreb and Schwarz measles vaccines on

immune response in infants. J Infect Dis 173, 1320-6.

Huston, D. P. (1997). The biology of the immune system. Jama 278, 1804-14.

Jerne, N. (1984). Idiotopic networks and other preconceived ideas. Immunol Rev 79, 5-24.

Jimérez-de-la-Jara, J., Fanta, E., Ajjan, N. & al., e. (1995). Control de Sarampion en Chile.

Santiago, Chile. Dolmen Ediciones.

156


Johnson, R. T., Griffin, D. E., Hirsch, R. L., Wolinsky, J. S., Roedenbeck, S., Lindo de

Soriano, I. & Vaisberg, A. (1984). Measles encephalomyelitis--clinical and

immunologic studies. N Engl J Med 310, 137-41.

Johnstone, R. W., Russell, S. M., Loveland, B. E. & McKenzie, I. F. (1993). Polymorphic

expression of CD46 protein isoforms due to tissue-specific RNA splicing. Mol

Immunol 30, 1231-41.

Kacica, M. A., Venezia, R. A., Miller, J., Hughes, P. A. & Lepow, M. L. (1995). Measles

antibodies in women and infants in the vaccine era. J Med Virol 45, 227-9.

Kahn, J. G., Mokdad, A. H., Deming, M. S., Roungou, J. B., Boby, A. M., Excler, J. L. &

Waldman, R. J. (1995). Avoiding missed opportunities for immunization in the

Central African Republic: potential impact on vaccination coverage. Bull World

Health Organ 73, 47-55.

Karp, C. L. (1999). Measles: immunosuppression, interleukin-12, and complement receptors.

Immunol Rev 168, 91-101.

Kawashima, H., Mori, T., Kashiwagi, Y., Takekuma, K., Hoshika, A. & Wakefield, A.

(2000). Detection and sequencing of measles virus from peripheral mononuclear cells

from patients with inflammatory bowel disease and autism. Dig Dis Sci 45, 723-9.

Kilby, J. M., Hopkins, S., Venetta, T. M., DiMassimo, B., Cloud, G. A., Lee, J. Y., Alldredge,

L., Hunter, E., Lambert, D., Bolognesi, D., Matthews, T., Johnson, M. R., Nowak, M.

A., Shaw, G. M. & Saag, M. S. (1998). Potent suppression of HIV-1 replication in

humans by T-20, a peptide inhibitor of gp41-mediated virus entry. Nat Med 4, 1302-7.

Kim, H. & al., (1968). Respiratory syncytial virus disease in infants despite prior

administration of antigenic inactivated vaccine. Am J Epidemiol 89, 422-434.

Kirsten, A., Weigle, M., Murphy, D. & Brunell, P. (1984). Enzyme-linked immunosorbent

assay for evaluation of immunity to measles virus. J. Clin. Microbiol 18, 376-379.

Kissani, N., Ouazzani, R., Belaidi, H., Ouahabi, H. & Chkili, T. (2001). [Epileptic seizures

and epilepsy in subacute sclerosing panencephalitis (report of 30 cases]. Neurophysiol

Clin 31, 398-405.

Kobune, F., Sakata, H. & Sugiura, A. (1990). Marmoset lymphoblastoid cells as a sensitive

host for isolation of measles virus. J Virol 64, 700-5.

Kobune, F., Takahashi, H., Terao, K., Ohkawa, T., Ami, Y., Suzaki, Y., Nagata, N., Sakata,

H., Yamanouchi, K. & Kai, C. (1996). Nonhuman primate models of measles. Lab

Anim Sci 46, 315-20.

157


Kok, P. W., Kenya, P. R. & Ensering, H. (1983). Measles immunization with further

attenuated heat-stable measles vaccine using five different methods of administration.

Trans R Soc Trop Med Hyg 77, 171-6.

Kreis, S., Vardas, E. & Whistler, T. (1997). Sequence analysis of the nucleocapsid gene of

measles virus isolates from South Africa identifies a new genotype. J Gen Virol 78,

1581-7.

Krober, M. S., Stracener, C. E. & Bass, J. W. (1991). Decreased measles antibody response

after measles-mumps-rubella vaccine in infants with colds. Jama 265, 2095-6.

Krugman, S. (1963). Medical progress: the clinical use of gamma globulin. N Engl J Med

269, 195-201.

Krugman, S. (1983). Further-attenuated measles vaccine: characteristics and use. Rev Infect

Dis 5, 477-81.

Krugman, S., Giles, J., Friedman, H. & al., e. (1965). Immunity to measles. J Pediatr 66,

471-488.

Kruskall, M. S., Alper, C. A., Awdeh, Z., Yunis, E. J. & Marcus-Bagley, D. (1992). The

immune response to hepatitis B vaccine in humans: inheritance patterns in families. J

Exp Med 175, 495-502.

Lamb, R. & Kolakofsky, D. (1996). Paramyxoviridae : The viruses and their replication. In :

BN Fields,Knipe DM, Howley PMet al., (eds) Fields Virology, 3th ed. Lippincott-

Raven publisers, Philadelphia., 1177-1204.

Lecouturier, V., Fayolle, J., Caballero, M., Carabana, J., Celma, M. L., Fernandez-Munoz, R.,

Wild, T. F. & Buckland, R. (1996). Identification of two amino acids in the

hemagglutinin glycoprotein of measles virus (MV) that govern hemadsorption, HeLa

cell fusion, and CD46 downregulation: phenotypic markers that differentiate vaccine

and wild-type MV strains. J Virol 70, 4200-4.

LiCalsi, C., Christensen, T., Bennett, J. V., Phillips, E. & Witham, C. (1999). Dry powder

inhalation as a potential delivery method for vaccines. Vaccine 17, 1796-803.

Lipsey, A., Kahn, M. & Bolande, R. (1967). Pathological variants of congenital

hypogammaglobulinemia: an analysis of three patients dying of measles. Pediatrics

69, 569-74.

Liston, P. & Briedis, D. J. (1994). Measles virus V protein binds zinc. Virology 198, 399-404.

Liszewski, M. K. & Atkinson, J. P. (1992). Membrane cofactor protein. Curr Top Microbiol

Immunol 178, 45-60.

158


Lucas, J. (1790). An account of uncommon symptoms succeeding the measles; with

additional remarks on the infection of measles and smallpox. London Med J 11, 325-

331.

Manchester, M. Smith, K. A. Eto, D. S. Perkin, H. B. Torbett, B. E. (2002).Targeting and

Hematopoietic Suppression of Human CD34(+) Cells by Measles Virus. J Virol 76,

6636-6642.

Maisner, A., Schneider-Schaulies, J., Liszewski, M. K., Atkinson, J. P. & Herrler, G. (1994).

Binding of measles virus to membrane cofactor protein (CD46): importance of

disulfide bonds and N-glycans for the receptor function. J Virol 68, 6299-304.

Maldonado, Y. A., Lawrence, E. C., DeHovitz, R., Hartzell, H. & Albrecht, P. (1995). Early

loss of passive measles antibody in infants of mothers with vaccine-induced immunity.

Pediatrics 96, 447-50.

Malvoisin, E. & Wild, F. (1990). Contribution of measles virus fusion protein in protective

immunity: anti-F monoclonal antibodies neutralize virus infectivity and protect mice

against challenge. J Virol 64, 5160-2.

Manchester, M., Liszewski, M. K., Atkinson, J. P. & Oldstone, M. B. (1994). Multiple

isoforms of CD46 (membrane cofactor protein) serve as receptors for measles virus.

Proc Natl Acad Sci U S A 91, 2161-5.

Marie, J. C., Kehren, J., Trescol-Biemont, M. C., Evlashev, A., Valentin, H., Walzer, T.,

Tedone, R., Loveland, B., Nicolas, J. F., Rabourdin-Combe, C. & Horvat, B. (2001).

Mechanism of measles virus-induced suppression of inflammatory immune responses.

Immunity 14, 69-79.

Markowitz, L. & Katz, S. (1994). Measles vaccine. In: Plotkin SA et Plotkin SL. Vaccines.

Editions Plotkin and mortimer. Philadelphia. WB Saunders, 2 è édition.

Markowitz, L. E., Preblud, S. R., Orenstein, W. A., Rovira, E. Z., Adams, N. C., Hawkins, C.

E. & Hinman, A. R. (1989). Patterns of transmission in measles outbreaks in the

United States, 1985-1986. N Engl J Med 320, 75-81.

Markowitz, L. E., Sepulveda, J., Diaz-Ortega, J. L., Valdespino, J. L., Albrecht, P., Zell, E.

R., Stewart, J., Zarate, M. L. & Bernier, R. H. (1990). Immunization of six-month-old

infants with different doses of Edmonston- Zagreb and Schwarz measles vaccines. N

Engl J Med 322, 580-7.

159


Markowitz, L. E., Albrecht, P., Rhodes, P., Demonteverde, R., Swint, E., Maes, E. F., Powell,

C. & Patriarca, P. A. (1996). Changing levels of measles antibody titers in women and

children in the United States: impact on response to vaccination. Kaiser Permanente

Measles Vaccine Trial Team. Pediatrics 97, 53-8.

Mathias, R. G., Meekison, W. G., Arcand, T. A. & Schechter, M. T. (1989). The role of

secondary vaccine failures in measles outbreaks. Am J Public Health 79, 475-8.

McCrumb, F., Kress, S., Saunders, E. & al., e. (1961). Studies with live attenuated measlesvirus

vaccine. Am J Dis Child 101, 45-63.

McNeil, W. (1976). Plagues and peoples. Garden city, NJ. Anchor Press/Doubleday, 329.

Mentitas, S., Akgun, Y., Arslantas, D., Kalyoncu, C. & Ucar, B. (2002). Decay of maternally

derived measles antibody in central Turkey. Public Health 116, 50-4.

Minagawa, H., Tanaka, K., Ono, N., Tatsuo, H. & Yanagi, Y. (2001). Induction of the

measles virus receptor SLAM (CD150) on monocytes. J Gen Virol 82, 2913-7.

Moebius, U., Clayton, L. K., Abraham, S., Harrison, S. C. & Reinherz, E. L. (1992). The

human immunodeficiency virus gp120 binding site on CD4: delineation by

quantitative equilibrium and kinetic binding studies of mutants in conjunction with a

high-resolution CD4 atomic structure. J Exp Med 176, 507-17.

MOH, Ministry of Heath Kenya and world Health Organisation. (1977). measles immunity in

the first year after birth and the optimum age for vaccination in Kenyan children. Bull

World Health Organ 55, 21-31.

Molinert, H., Rodriguez, R. & Galindo, M. (1993). Principales Aspectos Del Programa

Nacional de Immunizacion de la Republica de Cuba. Havana,Cuba: Ministry of

Health.

Morein, B., Sundquist, B., Hoglund, S., Dalsgaard, K. & Osterhaus, A. (1984). Iscom, a novel

structure for antigenic presentation of membrane proteins from enveloped viruses.

Nature 308, 457-60.

Moss, W. J., Ryon, J. J., Monze, M., Cutts, F., Quinn, T. C. & Griffin, D. E. (2002).

Suppression of human immunodeficiency virus replication during acute measles. J

Infect Dis 185, 1035-42.

Mulders, M. N., Truong, A. T. & Muller, C. P. (2001). Monitoring of measles elimination

using molecular epidemiology. Vaccine 19, 2245-9.

Muller, C. P. (2001). Measles elimination: old and new challenges? Vaccine 19, 2258-61.

160


Murray, K., Rogers, R., Selvey, L., Selleck, P., Hyatt, A., Gould, A., Gleeson, L., Hooper, P.

& Westbury, H. (1995). A novel morbillivirus pneumonia of horses and its

transmission to humans. Emerg Infect Dis 1, 31-3.

Na, B. K., Lee, J. S., Shin, G. C., Shin, J. M., Lee, J. Y., Chung, J. K., Ha, D. R., Lee, J. K.,

Ma, S. H., Cho, H. W., Kang, C. & Kim, W. J. (2001). Sequence analysis of

hemagglutinin and nucleoprotein genes of measles viruses isolated in Korea during the

2000 epidemic. Virus Res 81, 143-9.

Naniche, D., Varior-Krishnan, G., Cervoni, F., Wild, T. F., Rossi, B., Rabourdin-Combe, C.

& Gerlier, D. (1993a). Human membrane cofactor protein (CD46) acts as a cellular

receptor for measles virus. J Virol 67, 6025-32.

Naniche, D., Wild, T. F., Rabourdin-Combe, C. & Gerlier, D. (1992). A monoclonal antibody

recognizes a human cell surface glycoprotein involved in measles virus binding. J Gen

Virol 73, 2617-24.

Naniche, D., Wild, T. F., Rabourdin-Combe, C. & Gerlier, D. (1993b). Measles virus

haemagglutinin induces down-regulation of gp57/67, a molecule involved in virus

binding. J Gen Virol 74, 1073-9.

Naniche, D., Reed, S. I. & Oldstone, M. B. (1999). Cell cycle arrest during measles virus

infection: a G0-like block leads to suppression of retinoblastoma protein expression. J

Virol 73, 1894-901.

Naniche, D., Yeh, A., Eto, D., Manchester, M., Friedman, R. M. & Oldstone, M. B. (2000).

Evasion of host defenses by measles virus: wild-type measles virus infection interferes

with induction of Alpha/Beta interferon production. J Virol 74, 7478-84.

Ndikuyeze, A., Munoz, A., Stewart, J., Modlin, J., Heymann, D., Herrmann, K. L. & Polk, B.

F. (1988). Immunogenicity and safety of measles vaccine in ill African children. Int J

Epidemiol 17, 448-55.

Nichol, K. L. (2001). Live attenuated influenza virus vaccines: new options for the prevention

of influenza. Vaccine 19, 4373-7.

Nielsen, L., Blixenkrone-Moller, M., Thylstrup, M., Hansen, N. J. & Bolt, G. (2001).

Adaptation of wild-type measles virus to CD46 receptor usage. Arch Virol 146, 197-

208.

Nigatu, W., Jin, L., Cohen, B. J., Nokes, D. J., Etana, M., Cutts, F. T. & Brown, D. W.

(2001). Measles virus strains circulating in Ethiopia in 1998-1999: molecular

characterisation using oral fluid samples and identification of a new genotype. J Med

Virol 65, 373-80.

161


Norrby, E., Enders-Ruckles, G. & Meulen, V. t. (1975). Difference in appearence of

antibidies to structural components of measles virus after immunization with

innactivated and live virus. J Infect Dis 132, 262-9.

Nur, Y., Groen, J., Yusuf, M. & Osterhaus, A. (1999). IgM antibodies in hospitalized children

with febrile illness during an inter-epidemic period of measles in Somalia. J Clin Virol

12, 21-25.

NVAC, The National Vaccine Advisory Commitee (1991). The measles epidemic: The

problems, barriers and recommendations. JAMA 266, 1547-1552.

Ogra, P. L., Fishaut, M. & Gallagher, M. R. (1980). Viral vaccination via the mucosal routes.

Rev Infect Dis 2, 352-69.

Ogura, H., Sato, H., Kamiya, S. & Nakamura, S. (1991). Glycosylation of measles virus

haemagglutinin protein in infected cells. J Gen Virol 72, 2679-84.

Okoko, J. B., Wesumperuma, H. L. & Hart, C. A. (2001). The influence of prematurity and

low birthweight on transplacental antibody transfer in a rural West African population.

Trop Med Int Health 6, 529-34.

Ono, N., Tatsuo, H., Hidaka, Y., Aoki, T., Minagawa, H. & Yanagi, Y. (2001a). Measles

viruses on throat swabs from measles patients use signaling lymphocytic activation

molecule (CDw150) but not CD46 as a cellular receptor. J Virol 75, 4399-401.

Ono, N., Tatsuo, H., Tanaka, K., Minagawa, H. & Yanagi, Y. (2001b). V domain of human

SLAM (CDw150) is essential for its function as a measles virus receptor. J Virol 75,

1594-600.

Onorato, I. M., Jones, T. S. & Orenstein, W. A. (1988). Immunising children infected with

HIV. Lancet 1, 354-5.

Orenstein, W. A., Bernier, R. H. & Hinman, A. R. (1988). Assessing vaccine efficacy in the

field. Further observations. Epidemiol Rev 10, 212-41.

Outlaw, M. C. & Pringle, C. R. (1995). Sequence variation within an outbreak of measles

virus in the Coventry area during spring/summer 1993. Virus Res 39, 3-11.

Outlaw, M. C., Jaye, A., Whittle, H. C. & Pringle, C. R. (1997). Clustering of haemagglutinin

gene sequences of measles viruses isolated in the Gambia. Virus Res 48, 125-31.

Oxtoby, M., Ryder, R., Mvula, M. & al., e. (1989). Patterns of immunity to measles among

african children infected with the human immunodeficiency virus. In: Abstracs of the

Epidemic Intelligence Service Conference, Atlanta, USA, April 1989. Atlanta: US

Center for Disease Contol.

162


Pabst, H. F., Spady, D. W., Marusyk, R. G., Carson, M. M., Chui, L. W., Joffres, M. R. &

Grimsrud, K. M. (1992). Reduced measles immunity in infants in a well-vaccinated

population. Pediatr Infect Dis J 11, 525-9.

PAHO, Pan American Health Organization (1982). Serocnversion rates and measles

antibodies titer induced by measles vaccine in Latin American children 6-12 months of

age. Bull PAHO 16, 272-285.

PAHO, Pan American Health Organization (1995). Surveillance in the Americas. Wkly Bull 1.

Panum, P. (1938). Observations made during the epidemic of measles on the Faroe Islands in

the year 1846. Med Classics 3, 829-886.

Panum, P. (1940). Observations made during the epidemic of measles on the Faroe Islands in

the year 1846. New York: American Publishing Association.

Parks, C. L., Lerch, R. A., Walpita, P., Wang, H. P., Sidhu, M. S. & Udem, S. A. (2001).

Comparison of predicted amino acid sequences of measles virus strains in the

Edmonston vaccine lineage. J Virol 75, 910-20.

Payne F. E., Baublis J. V., Istabashi H. H.(1969). Isolation of measles virus from cell cultures

of brain from a patient with subacute sclerosing panencephalitis. N Engl J Med 281,

585.

Permar, S. R., Moss, W. J., Ryon, J. J., Monze, M., Cutts, F., Quinn, T. C. & Griffin, D. E.

(2001). Prolonged measles virus shedding in human immunodeficiency virus- infected

children, detected by reverse transcriptase-polymerase chain reaction. J Infect Dis 183,

532-8.

Picken, R. (1921). The epidemiology of measles in a rural and residential area. Lancet 1,

1349-53.

Plemper, R. K., Hammond, A. L., Gerlier, D., Fielding, A. K. & Cattaneo, R. (2002). Strength

of envelope protein interaction modulates cytopathicity of measles virus. J Virol 76,

5051-61.

Polack, F. P., Auwaerter, P. G., Lee, S. H., Nousari, H. C., Valsamakis, A., Leiferman, K. M.,

Diwan, A., Adams, R. J. & Griffin, D. E. (1999). Production of atypical measles in

rhesus macaques: evidence for disease mediated by immune complex formation and

eosinophils in the presence of fusion-inhibiting antibody. Nat Med 5, 629-34.

Poland, G. A. (1999). Immunogenetic mechanisms of antibody response to measles vaccine:

the role of the HLA genes. Vaccine 17, 1719-25.

163


Poland, G. A., Jacobson, R. M., Colbourne, S. A., Thampy, A. M., Lipsky, J. J., Wollan, P.

C., Roberts, P. & Jacobsen, S. J. (1999). Measles antibody seroprevalence rates among

immunized Inuit, Innu and Caucasian subjects. Vaccine 17, 1525-31.

Poland, G., Ovsyannikova, I., Jacobson, R., Vierkant, R., Jacobsen, S., Pankratz, V. & Schaid,

D. (2002). Identification of an association between HLA classII alleles and low

antibody levels after measles immunization. Vaccine 20, 430-438.

Rau, A. T., Dhulia, A., Wilson, C. G., Chopra, G. S. & Sarkar, P. K. (2002). Transplacentally

transmitted anti-measles antibodies in term and preterm infants. Indian Pediatr 39,

282-8.

Ravanel, K., Castelle, C., Defrance, T., Wild, T. F., Charron, D., Lotteau, V. & Rabourdin-

Combe, C. (1997). Measles virus nucleocapsid protein binds to FcgammaRII and

inhibits human B cell antibody production. J Exp Med 186, 269-78.

Reddy, S. V., Menaa, C., Singer, F. R., Cundy, T., Cornish, J., Whyte, M. P. & Roodman, G.

D. (1999). Measles virus nucleocapsid transcript expression is not restricted to the

osteoclast lineage in patients with Paget's disease of bone. Exp Hematol 27, 1528-32.

Reyes, M. A., de Borrero, M. F., Roa, J., Bergonzoli, G. & Saravia, N. G. (1987). Measles

vaccine failure after documented seroconversion. Pediatr Infect Dis J 6, 848-51.

Richardson, C., Hull, D., Greer, P., Hasel, K., Berkovich, A., Englund, G., Bellini, W., Rima,

B. & Lazzarini, R. (1986). The nucleotide sequence of the mRNA encoding the fusion

protein of measles virus (Edmonston strain): a comparison of fusion proteins from

several different paramyxoviruses. Virology 155, 508-23.

Rima, B. K., Earle, J. A., Yeo, R. P., Herlihy, L., Baczko, K., ter Meulen, V., Carabana, J.,

Caballero, M., Celma, M. L. & Fernandez-Munoz, R. (1995). Temporal and

geographical distribution of measles virus genotypes. J Gen Virol 76, 1173-80.

Rima, B. K., Earle, J. A., Baczko, K., ter Meulen, V., Liebert, U. G., Carstens, C., Carabana,

J., Caballero, M., Celma, M. L. & Fernandez-Munoz, R. (1997). Sequence divergence

of measles virus haemagglutinin during natural evolution and adaptation to cell

culture. J Gen Virol 78, 97-106.

Rota, J. S., Hummel, K. B., Rota, P. A. & Bellini, W. J. (1992). Genetic variability of the

glycoprotein genes of current wild-type measles isolates. Virology 188, 135-42.

Rota, J. S., Wang, Z. D., Rota, P. A. & Bellini, W. J. (1994). Comparison of sequences of the

H, F, and N coding genes of measles virus vaccine strains. Virus Res 31, 317-30.

164


Rota, J. S., Heath, J. L., Rota, P. A., King, G. E., Celma, M. L., Carabana, J., Fernandez-

Munoz, R., Brown, D., Jin, L. & Bellini, W. J. (1996). Molecular epidemiology of

measles virus: identification of pathways of transmission and implications for measles

elimination. J Infect Dis 173, 32-7.

Rota, P. A., Liffick, S., Rosenthal, S., Heriyanto, B. & Chua, K. B. (2000). Measles genotype

G2 in Indonesia and Malaysia. Lancet 355, 1557-8.

Russell, C. J., Jardetzky, T. S. & Lamb, R. A. (2001). Membrane fusion machines of

paramyxoviruses: capture of intermediates of fusion. Embo J 20, 4024-34.

Ryan, B. (1976). Severe measles in Vietnam. Med J Aust 1, 353-5.

Sabin, A. B. (1983). Immunization against measles by aerosol. Rev Infect Dis 5, 514-23.

Sabin, A. B., Albrecht, P., Takeda, A. K., Ribeiro, E. M. & Veronesi, R. (1985). High

effectiveness of aerosolized chick embryo fibroblast measles vaccine in seven-monthold

and older infants. J Infect Dis 152, 1231-7.

Samb, B., Aaby, P., Whittle, H. C., Seck, A. M., Rahman, S., Bennett, J., Markowitz, L. &

Simondon, F. (1995). Serologic status and measles attack rates among vaccinated and

unvaccinated children in rural Senegal. Pediatr Infect Dis J 14, 203-9.

Santibanez, S., Heider, A., Gerike, E., Agafonov, A. & Schreier, E. (1999). Genotyping of

measles virus isolates from central Europe and Russia. J Med Virol 58, 313-20.

Sato, T. A., Kohama, T. & Sugiura, A. (1989). Protective role of human antibody to the

fusion protein of measles virus. Microbiol Immunol 33, 601-7.

Schluederberg, A., Lamm, S., Landrigan, P. & al., e. (1973). Measles immunity in children

vaccinated before one year of age. Am J Epidemiol 97, 402-409.

Selin, L. K., Lin, M. Y., Kraemer, K. A., Pardoll, D. M., Schneck, J. P., Varga, S. M.,

Santolucito, P. A., Pinto, A. K. & Welsh, R. M. (1999). Attrition of T cell memory:

selective loss of LCMV epitope-specific memory CD8 T cells following infections

with heterologous viruses. Immunity 11, 733-42.

Sergiev, P., Ryazantseva, N. & Shroit, I. (1960). The dynamics of pathological processes in

experimental measles in monkeys. Acta Virol 4, 265-273.

Shaby, D., Shope, T., Downs, H. & al., e. (1977). Epidemic measles in highly vaccinated

population. N Engl J Med 296, 585-9.

Sheshberadaran, H. & Norrby, E. (1986). Characterization of epitopes on the measles virus

hemagglutinin. Virology 152, 58-65.

165


Siber, G. R., Werner, B. G., Halsey, N. A., Reid, R., Almeido-Hill, J., Garrett, S. C.,

Thompson, C. & Santosham, M. (1993). Interference of immune globulin with

measles and rubella immunization. J Pediatr 122, 204-11.

Siqueira, M. M., Castro-Silva, R., Cruz, C., Oliveira, I. C., Cunha, G. M., Mello, M., Rota, P.

A., Bellini, W. J. & Friedrich, F. (2001). Genomic characterization of wild-type

measles viruses that circulated in different states in Brazil during the 1997 measles

epidemic. J Med Virol 63, 299-304.

Smedman, L., Silva, M. C., Gunnlaugsson, G., Norrby, E. & Zetterstrom, R. (1986).

Augmented antibody response to live attenuated measles vaccine in children with

Plasmodium falciparum parasitaemia. Ann Trop Paediatr 6, 149-53.

Smith, F. R., Curran, A. S., Raciti, K. A. & Black, F. L. (1982). Reported measles in persons

immunologically primed by prior vaccination. J Pediatr 101, 391-3.

Sonoda, S. & Nakayama, T. (2001). Detection of measles virus genome in lymphocytes from

asymptomatic healthy children. J Med Virol 65, 381-7.

Staunton, D. E., Dustin, M. L., Erickson, H. P. & Springer, T. A. (1990). The arrangement of

the immunoglobulin-like domains of ICAM-1 and the binding sites for LFA-1 and

rhinovirus. Cell 61, 243-54.

Stetler, H. C., Orenstein, W. A., Bernier, R. H., Herrmann, K. L., Sirotkin, B., Hopfensperger,

D., Schuh, R., Albrecht, P., Lievens, A. W. & Brunell, P. A. (1986). Impact of

revaccinating children who initially received measles vaccine before 10 months of age.

Pediatrics 77, 471-6.

Sun, X., Burns, J. B., Howell, J. M. & Fujinami, R. S. (1998). Suppression of antigen-specific

T cell proliferation by measles virus infection: role of a soluble factor in suppression.

Virology 246, 24-33.

Suryanarayana, K., Baczko, K., ter Meulen, V. & Wagner, R. R. (1994). Transcription

inhibition and other properties of matrix proteins expressed by M genes cloned from

measles viruses and diseased human brain tissue. J Virol 68, 1532-43.

Takeda, M., Kato, A., Kobune, F., Sakata, H., Li, Y., Shioda, T., Sakai, Y., Asakawa, M. &

Nagai, Y. (1998). Measles virus attenuation associated with transcriptional

impediment and a few amino acid changes in the polymerase and accessory proteins. J

Virol 72, 8690-6.

Takeuchi, K., Miyajima, N., Kobune, F. & Tashiro, M. (2000). Comparative nucleotide

sequence analyses of the entire genomes of B95a cell-isolated and vero cell-isolated

measles viruses from the same patient. Virus Genes 20, 253-7.

166


Takeuchi, K., Takeda, M., Miyajima, N., Kobune, F., Tanabayashi, K. & Tashiro, M. (2002).

Recombinant wild-type and edmonston strain measles viruses bearing heterologous H

proteins: role of H protein in cell fusion and host cell specificity. J Virol 76, 4891-900.

Tamin, A., Rota, P. A., Wang, Z. D., Heath, J. L., Anderson, L. J. & Bellini, W. J. (1994).

Antigenic analysis of current wild type and vaccine strains of measles virus. J Infect

Dis 170, 795-801.

Tanaka, K., Minagawa, H., Xie, M. F. & Yanagi, Y. (2002). The measles virus hemagglutinin

downregulates the cellular receptor SLAM (CD150). Arch Virol 147, 195-203.

Tangye, S. G., Phillips, J. H. & Lanier, L. L. (2000). The CD2-subset of the Ig superfamily of

cell surface molecules: receptor-ligand pairs expressed by NK cells and other immune

cells. Semin Immunol 12, 149-57.

Tatsuo, H., Ono, N., Tanaka, K. & Yanagi, Y. (2000). SLAM (CDw150) is a cellular receptor

for measles virus. Nature 406, 893-7.

Taylor, M. J., Godfrey, E., Baczko, K., ter Meulen, V., Wild, T. F. & Rima, B. K. (1991).

Identification of several different lineages of measles virus. J Gen Virol 72, 83-8.

Taylor, J., Weinberg, R., Tartaglia, J., Richardson, C., Alkhatib, G., Briedis, D., Appel, M.,

Norton, E. & Paoletti, E. (1992). Nonreplicating viral vectors as potential vaccines:

recombinant canarypox virus expressing measles virus fusion (F) and hemagglutinin

(HA) glycoproteins. Virology 187, 321-8.

Thacker, S. B. & Millar, J. D. (1991). Mathematical modeling and attempts to eliminate

measles: a tribute to the late Professor George Macdonald. Am J Epidemiol 133, 517-

25.

Tidjani, O., Grunitsky, B., Guerin, N., Levy-Bruhl, D., Lecam, N., Xuereff, C. & Tatagan, K.

(1989). Serological effects of Edmonston-Zagreb, Schwarz, and AIK-C measles

vaccine strains given at ages 4-5 or 8-10 months. Lancet 2, 1357-60.

Toivanen, P., Mantyjarvi, R. & Hirvonen, T. (1968). Maternal antibodies in human foetal sera

at different stages of gestation. Immunology 15, 395-403.

Tourtellotte, W. W., Ma, B. I., Brandes, D. B., Walsh, M. J. & Potvin, A. R. (1981).

Quantification of de novo central nervous system IgG measles antibody synthesis in

SSPE. Ann Neurol 9, 551-6.

Truong, A. T., Kreis, S., Ammerlaan, W., Hartter, H. K., Adu, F., Omilabu, S. A., Oyefolu, A.

O., Berbers, G. A. & Muller, C. P. (1999). Genotypic and antigenic characterization of

hemagglutinin proteins of African measles virus isolates. Virus Res 62, 89-95.

167


Truong, A. T., Mulders, M. N., Gautam, D. C., Ammerlaan, W., de Swart, R. L., King, C. C.,

Osterhaus, A. D. & Muller, C. P. (2001). Genetic analysis of Asian measles virus

strains--new endemic genotype in Nepal. Virus Res 76, 71-8.

Tyrell, D. & Ehrnst, A. (1979). Transmembrane communication in cells chronically infected

with measles virus. J Cell Biol 81, 396-402.

Udem, S. A. & Cook, K. A. (1984). Isolation and characterization of measles virus

intracellular nucleocapsid RNA. J Virol 49, 57-65.

van-Binnendijk, R., Poelen, M., Kuijpers, K., Osterhaus, A. & Uytde-Haag, F. (1990). The

predominance of CD8 T-cells after infection with measles virus suggest a role for CD8

class1 MHC-restricted cytotoxic T-lymphocytes (CTL) in recovery from measles. J

Immunol 144, 2394-9.

van Binnendijk, R. S., Poelen, M. C., van Amerongen, G., de Vries, P. & Osterhaus, A. D.

(1997). Protective immunity in macaques vaccinated with live attenuated,

recombinant, and subunit measles vaccines in the presence of passively acquired

antibodies. J Infect Dis 175, 524-32.

van den Hoogen, B. G., de Jong, J. C., Groen, J., Kuiken, T., de Groot, R., Fouchier, R. A. &

Osterhaus, A. D. (2001). A newly discovered human pneumovirus isolated from

young children with respiratory tract disease. Nat Med 7, 719-24.

Varsanyi, T. M., Utter, G. & Norrby, E. (1984). Purification, morphology and antigenic

characterization of measles virus envelope components. J Gen Virol 65, 355-66.

Varsanyi, T. M., Morein, B., Love, A. & Norrby, E. (1987). Protection against lethal measles

virus infection in mice by immune- stimulating complexes containing the

hemagglutinin or fusion protein. J Virol 61, 3896-901.

Vingershoets, J., Goilav, C., Vanham, G. & al., e. (1995). Non response to a recombinant pre-

S2-containing hapatitis B vaccine : association with the HLA system. Annales de la

Société Belge Medécine Tropicale 75, 125-9.

Volckaert-Vervliet, G. & Billiau, A. (1977). Induction of interferon in human lymphoblastoid

cells by Sendai and measles viruses. J Gen Virol 37, 199-203.

Von Pirquet C. (1908). Verhalten der kutanen tuberkulin-reaktion wahrend der Masern. Dtsch

Med Wochenschr 34, 1297-1300.

Wakefield, A. J., Sim, R., Akbar, A. N., Pounder, R. E. & Dhillon, A. P. (1997). In situ

immune responses in Crohn's disease: a comparison with acute and persistent measles

virus infection. J Med Virol 51, 90-100.

168


Wallace, M. R., Hooper, D. G., Graves, S. J. & Malone, J. L. (1994). Measles seroprevalence

and vaccine response in HIV-infected adults. Vaccine 12, 1222-4.

Wang, L. F., Michalski, W. P., Yu, M., Pritchard, L. I., Crameri, G., Shiell, B. & Eaton, B. T.

(1998). A novel P/V/C gene in a new member of the Paramyxoviridae family, which

causes lethal infection in humans, horses, and other animals. J Virol 72, 1482-90.

Wassilak, S. G., Orenstein, W. A., Strickland, P. L., Butler, C. A. & Bart, K. J. (1985).

Continuing measles transmission in students despite school-based outbreak control

program. Am J Epidemiol 122, 208-17.

Wear, D., Rabin, E., Richardson, L. & al., e. (1968). Virus replication and ultrastructural

changes after induction of encephalitis in mice by measles virus. Exp Mole Pathol 9,

405-17.

Webster, R. G. & Laver, W. G. (1980). Determination of the number of nonoverlapping

antigenic areas on Hong Kong (H3N2) influenza virus hemagglutinin with monoclonal

antibodies and the selection of variants with potential epidemiological significance.

Virology 104, 139-48.

Weiner, L. B., Corwin, R. M., Nieburg, P. I. & Feldman, H. A. (1977). A measles outbreak

among adolescents. J Pediatr 90, 17-20.

Wesley, A., Coovadia, H. M. & Henderson, L. (1978). Immunological recovery after measles.

Clin Exp Immunol 32, 540-4.

Whittle, H. C., Rowland, M. G., Mann, G. F., Lamb, W. H. & Lewis, R. A. (1984).

Immunisation of 4-6 month old Gambian infants with Edmonston-Zagreb measles

vaccine. Lancet 2, 834-7.

Whittle, H., Hanlon, P., O'Neill, K., Hanlon, L., Marsh, V., Jupp, E. & Aaby, P. (1988a). Trial

of high-dose Edmonston-Zagreb measles vaccine in the Gambia: antibody response

and side-effects. Lancet 2, 811-4.

Whittle, H. C., Mann, G., Eccles, M., O'Neill, K., Jupp, L., Hanlon, P., Hanlon, L. & Marsh,

V. (1988b). Effects of dose and strain of vaccine on success of measles vaccination of

infants aged 4-5 months. Lancet 1, 963-6.

Whittle, H., Aaby, P., Samb, B., Cisse, B., Kanteh, F., Soumare, M., Jensen, H., Bennett, J. &

Simondon, F. (1999a). Poor serologic responses five to seven years after immunization

with high and standard titer measles vaccines. Pediatr Infect Dis J 18, 53-7.

Whittle, H. C., Aaby, P., Samb, B., Jensen, H., Bennett, J. & Simondon, F. (1999b). Effect of

subclinical infection on maintaining immunity against measles in vaccinated children

in West Africa. Lancet 353, 98-102.

169


WHO, World Health Organisation, Expanded Programme on Immunization. (1981). Stability

of freeze-dried measles vaccine. Weekly Epidemiol Rec 56, 177-184.

WHO, World Health Organisation, Expanded Programme on Immunization. (1986).

Immunization policy. Document WHO/EPI/GEN/86.7/Rev1: World Health

Organisation.

WHO, World Health Organisation Global Advisory Group. (1990). Expanded programme on

immunization. Weekly Epidemiol Rec 65, 5-11.

WHO, World Health Organisation. (1998). Expanded Programme on Immunisation. Weekly

Epidemiol Rec 73, 265-272.

WHO, World Health Organisation. (2001a). Nomenclature for describing the genetic

characteristics of wild-type measles viruses (Part I). Weekly Epidemiol Rec 76, 241-

248.

WHO, World Health Organisation. (2001b). Nomenclature for describing the genetic

characteristics of wild-type measles viruses (Part II). Weekly Epidemiol Rec 76, 249-

256.

WHO, World Health Organisation. (2002a). Global measles mortality reduction and regional

elimination, 2000-2001 (PartI). weekly Epidemiol Rec 77, 49-56.

WHO, World Health Organisation. (2002b). Global measles mortality reduction and regional

elimination, 2000-2001 (PartII). weekly Epidemiol Rec 77, 57-68.

WHO/UNICEF, Communiqué conjoint. (2001). Lancement d'un nouveau plan pour diminuer

de moitié la mortalité due à la rougeole, l'une des principales maladies de l'enfant.

communiqué de presse.

WHO/UNICEF, Global Programme on AIDS and Expanded Programme on Immunization.

(1989). Joint WHO/UNICEF statement on early immunisation for HIV-infected

children. Weekly Epidemiol Rec 64, 45.

Wild, T. F. (1999). Measles vaccines, new developments and immunization strategies.

Vaccine 17, 1726-9.

Wild, T. F. & Buckland, R. (1995). Functional aspects of envelope-associated measles virus

proteins. Curr Top Microbiol Immunol 191, 51-64.

Wild, T. F. & Buckland, R. (1997). Inhibition of measles virus infection and fusion with

peptides corresponding to the leucine zipper region of the fusion protein. J Gen Virol

78, 107-11.

Wild, T. F., Malvoisin, E. & Buckland, R. (1991). Measles virus: both the haemagglutinin and

fusion glycoproteins are required for fusion. J Gen Virol 72, 439-42.

170


Wild, T. F., Bernard, A., Spehner, D. & Drillien, R. (1992). Construction of vaccinia virus

recombinants expressing several measles virus proteins and analysis of their efficacy

in vaccination of mice. J Gen Virol 73, 359-67.

Wild, T. F., Fayolle, J., Beauverger, P. & Buckland, R. (1994). Measles virus fusion: role of

the cysteine-rich region of the fusion glycoprotein. J Virol 68, 7546-8.

Williams, D. (1897). Measles. In : Allbut TC, Rollestone HD eds. System of medecine.

London 1897, 99-117.

Williams, P. J. & Hull, H. F. (1983). Status of measles in The Gambia, 1981. Rev Infect Dis 5,

391-4.

Wyll, S. & Witte, J. (1971). Measles in previously vaccinated children: an epidemilogical

study. JAMA 216, 1306-10.

Xiang, J. Z. & Chen, Z. H. (1983). Measles vaccine in the People's Republic of China. Rev

Infect Dis 5, 506-10.

Yeager, A. S., Davis, J. H., Ross, L. A. & Harvey, B. (1977). Measles immunization.

Successes and failures. Jama 237, 347-51.

Young, J. K., Hicks, R. P., Wright, G. E. & Morrison, T. G. (1997). Analysis of a peptide

inhibitor of paramyxovirus (NDV) fusion using biological assays, NMR, and

molecular modeling. Virology 238, 291-304.

Zanetta, R., Amaku, M., Azevedo, R., Zanetta, D., Burattini, M. & Massad, E. (2002).

Optimal age for vaccination against measles in the State of Sâo Paulo, Brazil, taking

into account the mother serostatus. Vaccine 20, 226-234.

Zhuji measles vaccine study group (1987). Epidemiologic examination of immunity period of

measles vaccine (Chinese). Chin Med J 67, 19-22.

171


TABLE DES ILLUSTRATIONS

Figure 1. Représentation Schématique du virus de la rougeole…………………………… …6

Figure 2. Organisation et transcription du génome du virus de la rougeole…………………..6

Figure 3. Représentation schématique des récepteurs cellulaires du virus de la rougeole…..15

Figure 4. Processus de fusion membranaire…………………………………………………..16

Figure 5. Transcription et réplication du génome du virus de la rougeole………………...…17

Figure 6. Les vaccins ; Souches, méthodes d’atténuation, et producteurs……………………30

Figure 7. Courbe épidémiologique de la rougeole au Cameroun (année 2001)…………...…68

Figure 8. Répatition des cas de rougeole au Cameroun : année 2000………..………………72

Figure 9. Répartition géographique des différents génotypes de virus de la

rougeole en Afrique…………………………………………………………………………..90

Figure 10. Stratégie expérimentale…………………………………………………………113

Figure 11. Situation actuelle de la répartition géographique des différents génotypes

de virus de la rougeole en Afrique…………………………………………………………131

Tableau 1. Classification des paramyxovirus…………………………………………………4

Tableau 2. Souches de référence utilisées pour l’analyse phylogénétique des souches

sauvages du virus de la rougeole…………………………………………………….…….…8

Tableau 3. Cas et Décès de la rougeole par province en 1999, 2000 et 2001 au Cameron…..71

Tableau 4. Evolution de la couverture vaccinale et de l’incidence de la rougeole

au Cameroun de 1993 à 2001……………………………………………………. ………….71

Tableau 5. Calendrier de vaccination infantile recommandé par le PEV dans

les pays en développement……………………………………..……………………….…….74

Tableau 6. Isolement des souches de virus de la rougeole en Afrique par ordre

chronologique (19983-2001)…………………………………………………..……………..89

Tableau 7. Résumé des données des patients et résultats de laboratoire ………………..…118

172


TABLE DES ANNEXES

Annexe 1. Comparaison des séquences des gènes H et F de la souche G954 dans les

cellules Véro, les B95a et les PBL. …………………………………………………………135

Annexe 2. Détection de la protéine F par Western Blot………………………………...…..137

Annexe 3 . Comparaison des séquences de la protéine M de la souche G954 dans

les cellules Véro et B95a……………………………..…………………………………….138

Annexe 4. Comparaison des séquences de gènes H des souches G954, G943, G945

isolées en Gambie en 1993…………………………………………………………………139

Annexe 5. Comparaison des séquences des gènes H et de la partie C-terminale de

la protéine N des souches CR67, CR72, CR82, CR83 isolées au Cameroun en 2001. ……140

Annexe 6. Comparaison des séquences des gènes H des souches isolées au Cameroun ;

Y14 et Y22 (1983), la souche de référence du génotype B1, et CR67, CR72 (2001)……..142

Annexe 7. Comparaison des séquences des gènes H de la souche G954 (Gambie 1993)

et Lys-1 (Lyon-France, 1994)……………………………………………………………...143

Annexe 8 : Comparaison des séquences de la protéine F des souches appartenant au

génotype B3.1(CR 67, CR 72) avec les souches du génotype B3.2 (Lys, G954) et

la souche vaccinale Edmonston…………………………………………………………....144

173


Abstract

Despite the availability of an effective vaccine, measles still causes an important

mortality in developing countries. Improving the actual vaccine is necessary. This depends

upon a better knowledge of the genetic and antigenic variability of the measles virus (MV).

Furthermore, a better understanding of infection and attenuation mechanisms of measles virus

is required. The identification of CD46 and CD150 as cellular receptors for measles virus has

helped to clarify certain aspects of the immunobiology of MV infection.

In the first part of this study, we have examined the properties of a wild-type MV

strain (G954) grown in the epithelial cell line Vero. After adaptation, the wild-type did not

induce fusion (syncytia), but produced high levels of virus during long period. Sequence

analysis of the glycoprotein established there were no amino acid changes. Further, the F0

precursor was cleaved into the fusogenic form F1. Using several approaches, the Veroadapted

virus could not be shown to use CD46 as cell receptor. Knowing that there is no

CD150 on Vero cells, it remains to be established if these cells become infected via a third

cell receptor or by another mechanism.

In the second part of this study we have analysed the viruses from epidemics in the

Gambia (1993) and in the Cameroon (1983, 2001). Sequence analysis revealed less than 0,2%

variation of nucleotides in the H gene, between virus isolates within the same epidemic. The

MVs in 2001 in Yaoundé, Cameroon belongs to the B3.1 genotype and are different from

those isolated in the same region in 1983, that belong to genotype B1. The viruses isolated in

the Gambia correspond to the genotype B3.2. Using monoclonal antibodies against H and F

protein, we show that these African measles strains were antigenically different from each

other and from the vaccine strain. Based on the fact that the same vaccine has been used

during 30 years, antibodies induced by the vaccine strain can exerted a selective pressure on

circulating wild type virus with antigenic modulation.

Key words : measles virus, virus/cell interaction, adaptation, molecular epidemiology,

Cameroon, vaccination.

174

More magazines by this user
Similar magazines