Ipomoea (Sweetpotato/Kumara) Post-Entry Quarantine Testing Manual

More documents

Recommendations

Info

Table 3: PCR primers used for the detection of regulated pests of I. batatas and I. setosa, and plant internal controls Target organism Bacterium Dickeya chrysanthemi (Use both assays to detect all pathovars) Phytoplasma Sweetpotato little leaf phytoplasma Viruses Sweetpotato chlorotic stunt virus (Use both assays to detect East & West African strains) Sweetpotato leaf curl virus 1 Sweetpotato mild speckling virus and Sweetpotato vein mosaic virus Primer name ADE1 ADE2 recAF recAR P1 P7 R16F2 R16R2 Phyto-F Phyto-R Phyto-P 2 SPCSV-F SPCSV-R SPCSV-P 2 EASPCSV-38F EASPCSV-126R EASPCSV-67P 2 SPG1 SPG2 SPLCV-F SPLCV-R SPLCV-P 2 Oligo1n Oligo2n Tobacco streak virus IlarlF5 IlarlR7 Internal Control Plant DNA control Gd1 Berg54 Plant RNA control Nad5-s Nad5-as Plant NA control COX-F COX-R COX- P 2 Ipomoea Post-Entry Quarantine Testing Manual · November 2012 Sequence (5´-3´) TM (ºC) GATCAGAAAGCCCGCAGCCAGAT CTGTGGCCGATCAGGATGGTTTTGT CGTGC GGTAAAGGGTCTATCATGCG CCTTCACCATACATAATTTGGA AAGAGTTTGATCCTGGCTCAGGATT CGTCCTTCATCGGCTCTT ACGACTGCTAAGACTGG TGACGGGCGGTGTGTACAAACCCCG CGTACGCAAGTATGAAACTTAAAG GA TCTTCGAATTAAACAACATGATCCA FAM-TGACGGGACTCCGCACAAGCG -NFQ 3 CGAATCAACGGATCGGAATT CCACCGACTATTACATCACCACTCT (MGB)FAM-ATCCCAACGTGTTTATCT A-NFQ 3 GGAGTTTATTCCCACCTGTYTATCT GTAATTGCGAAGAATCYAAAACCT FAM-CGGCTACAGGCGACGTGGTTG TTG-NFQ 3 ATCCVAAYWTYCAGGGAGCTAA CCCCKGTGCGWRAATCCAT GGCGCCTAAGTATGGCTGAA AACCGTATAAAGTATCTGGGAGT GGT (MGB)FAM-GTGGGACCCTTTGC- NFQ 3 ATGGTHTGGTGYATHGARAAYGG TGCTGCKGCYTTCATYTG GCNGGWTGYGGDAARWCNAC AMDGGWAYYTGYTYNGTRTCACC ACGGAGAGTTTGATCCTG AAAGGAGGTGATCCAGCCGCACCTT C GATGCTTCTTGGGGCTTCTTGTT CTCCAGTCACCAACATTGGCATAA CGTCGCATTCCAGATTATCCA CAACTACGGATATATAAGAGCCAA AACTG FAM-TGCTTACGCTGGATGGAATG CCCT- NFQ 3 Band (bp) Reference 72 420 Nassar et al., 1996 47 760 Waleron et al., 2002 53 1800 Deng & Hiruki, 1991; Schneider et al., 1995 50 1248 Lee et al., 1993 60 75 Christensen et al., 2004 60 71 Kokkinos & Clark, 2006 60 90 N. Boonham (Unpublished) 58 934 Li et al., 2004 66 60 Kokkinos & Clark, 2006 50 327 Marie-Jeanne et al., 2000 48 300 Untiveros et al., 2010 50-62 1500 Andersen et al., 1998 50-60 180 Menzel et al., 2002 60 74 Weller et al., 2000 1 Single stranded DNA virus; 2 Real-time probe; 3 NFQ = Non-fluorescent quencher. 13
7.1.3.2.1 Virus reverse transcription-PCR Recommended method for RNA viruses: conventional RT-PCR 1. Extract total RNA from leaf tissue according to a standard protocol. Successful RT-PCR amplification can be achieved using the following RNA extraction procedures: (a) Qiagen RNeasy ® Plant Mini Kit (Qiagen Cat. No. 74904); or (b) a silica-based method as described by Menzel et al. (2002); or (c) InviMag® Plant Mini Kit (Invitek Cat. No. 243711300) used in a Kingfisher mL workstation. Commercial kits are used as described by the manufacturer. See Appendix 3 for details of other extraction methods. Alternative methods may also be used after validation. 2. Optional: Perform a one-step RT-PCR on the RNA with the Nad5 internal control primers (Table 3) using the components and concentrations listed in Table 4 and cycle under the conditions listed in Table 6. The Nad5 primers amplify mRNA from plant mitochondria. 3. Perform a one-step RT-PCR on the RNA with the pathogen-specific primers (Table 3) using the components and concentrations listed in Table 4 and cycle under the conditions listed in Table 6. The following controls must be included for each set of RT-PCR reactions: (a) positive control: RNA extracted from virus-infected leaf tissue or equivalent; and (b) no template control: water is added instead of RNA template. When setting up the test initially, it is advised that a negative control (RNA extracted from healthy Ipomoea leaf tissue) is included. Please note that the Nad5 internal control primers do not reliably amplify a product from RNA extracted from freeze-dried material. We therefore recommend mixing fresh healthy Ipomoea leaf material with freeze-dried positive control material (3:1 w/w) prior to carrying out the extraction. 4. Analyse the PCR products by agarose gel electrophoresis. Recommended method for DNA viruses: conventional PCR 1. Extract total DNA from leaf tissue according to a standard protocol. Successful PCR amplification can be achieved using (a) Qiagen DNeasy ® Plant Mini Kit (Qiagen Cat. No. 69104); or (b) InviMag® Plant Mini Kit (Invitek Cat. No. 243711300) used in a Kingfisher mL workstation. Commercial kits are used as described by the manufacturer. Alternative methods may also be used after validation. 2. Optional: Perform a PCR on the DNA with the Gd1/Berg54 internal control primers (Table 3) using the components and concentrations listed in Table 5 and cycle under the conditions listed in Table 6. The Gd1/Berg54 primers amplify the 16S rRNA gene from most prokaryotes as well as from chloroplasts. 3. Perform a PCR on the DNA with the pathogen-specific primers (Table 3) using the components and concentrations listed in Table 5 and cycle under the conditions listed in Table 6. The following controls must be included for each set of PCR reactions: (a) positive control: DNA extracted from virus-infected leaf tissue or equivalent; and (b) no template control: water is added instead of DNA template. When setting up the test initially, it is advised that a negative control (DNA extracted from healthy Ipomoea leaf tissue) is included. 4. Analyse the PCR products by agarose gel electrophoresis. Ipomoea Post-Entry Quarantine Testing Manual · November 2012 14
Page 1 and 2: Ipomoea (Sweetpotato/Kumara) Post-E
Page 3 and 4: 1.7 Dickeya chrysanthemi ..........
Page 5 and 6: The per capita income provided by s
Page 7 and 8: Viruses: Sweetpotato chlorotic flec
Page 9 and 10: 7. TESTING Each of the specific tes
Page 11 and 12: 7.1.1 Graft inoculation Each I. bat
Page 13 and 14: 7.1.2 Herbaceous indexing Each I. b
Page 15: Table 2: Source of antisera and pos
Page 19 and 20: Recommended method for RNA viruses:
Page 21 and 22: Positive control material, in the f
Page 23 and 24: The reaction and cycling conditions
Page 25 and 26: (a) Primers recAF/recAR (Waleron et
Page 27 and 28: 8. CONTACT POINT This manual was de
Page 29 and 30: Nassar, A; Darrasse, A; Lemattre, M
Page 31 and 32: . 1.5 Streptomyces ipomoea (a) (b)
Page 33 and 34: Appendix 2. Virus symptoms on graft
Page 35 and 36: Appendix 3. Protocols referenced in

Ipomoea (Sweetpotato/Kumara) Post-Entry Quarantine Testing Manual

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?