2007-DevelopmentalBiology.pdf

Abstract 

Genomes & Developmental Control 

Wnt/β-catenin signaling controls Mespo expression to regulate 

segmentation during Xenopus somitogenesis 

Jinhu Wang 1 , Shangwei Li 1 , Yuelei Chen, Xiaoyan Ding ⁎ 

Laboratory of Molecular Cell Biology, Key Laboratory of Stem Cell Biology, Institute of Biochemistry and Cell Biology, 

Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 320 Yue Yang Road, Shanghai 200031, China 

Graduate School of Chinese Academy of Sciences, 320 Yue Yang Road, Shanghai 200031, China 

Received for publication 12 May 2006; revised 17 November 2006; accepted 14 December 2006 

Available online 21 December 2006 

The vertebral column is derived from somites, which are transient segments of the paraxial mesoderm that are present in developing vertebrates. 

The strict spatial and temporal regulation of somitogenesis is of crucial developmental importance. Signals such as Wnt and FGF play roles in 

somitogenesis, but details regarding how Wnt signaling functions in this process remain unclear. In this study, we report that Wnt/β-catenin 

signaling regulates the expression of Mespo, a basic–helix–loop–helix (bHLH) gene critical for segmental patterning in Xenopus somitogenesis. 

Transgenic analysis of the Mespo promoter identifies Mespo as a direct downstream target of Wnt/β-catenin signaling pathway. We also 

demonstrate that activity of Wnt/β-catenin signaling in somitogenesis can be enhanced by the PI3-K/AKT pathway. Our results illustrate that Wnt/ 

β-catenin signaling in conjunction with PI3-K/AKT pathway plays a key role in controlling development of the paraxial mesoderm. 

© 2007 Published by Elsevier Inc. 

Keywords: AKT; Paraxial mesoderm; PI3-K; Wnt; Xenopus laevis 

Introduction 

During vertebrate embryogenesis, the paraxial mesoderm 

separates into somites, a metameric series of homologous 

subunits, which bud off sequentially from the rostral end of the 

presomitic mesoderm (PSM) at regular intervals along the 

anterior–posterior (AP) axis. The process in which the 

segmental or metameric pattern is established accompanying 

the constant posterior elongation of the embryo body axis is 

termed somitogenesis (Weisblat et al., 1994). Somitogenesis 

occurs in a strict spatial and temporal progression (Dubrulle 

et al., 2001; Pourquie, 2003). 

The molecular nature of the signals responsible for 

controlling somitogenesis remains elusive. One potential 

candidate for regulating this process is Wnt/β-catenin signaling 

(Aulehla et al., 2003; Yamaguchi et al., 1999). Previous studies 

have shown that Wnt/β-catenin signaling is implicated in 

⁎ Corresponding author. Fax: +86 21 34230165. 

E-mail address: xyding@sunm.shcnc.ac.cn (X. Ding). 

1 These authors contributed equally to this work. 

0012-1606/$ - see front matter © 2007 Published by Elsevier Inc. 

doi:10.1016/j.ydbio.2006.12.034 

Developmental Biology 304 (2007) 836–847 

www.elsevier.com/locate/ydbio 

controlling the development of paraxial mesoderm (Aulehla 

et al., 2003; Galceran et al., 2004; Hofmann et al., 2004; 

Pourquie, 2001). In mouse embryos, Wnt3a is expressed in the 

primitive streak during gastrulation and in the tailbud during the 

later stages of mouse development. Animals homozygous for 

null alleles of Wnt3a lack somites posterior to the forelimbs 

(Ikeya and Takada, 2001; Takada et al., 1994; Wilson et al., 

1993). The double mutant harboring mutations in lef1 and tcf1, 

identified as nuclear mediators of Wnt/β-catenin signaling that 

activate Wnt-responsive genes by associating with β-catenin, 

results in lack of paraxial mesoderm resembling the Wnt3a null 

mutation (Galceran et al., 1999). In chick embryos, it has been 

shown that altering Wnt/β-catenin signaling activity in the PSM 

causes defects in somite formation (Aulehla et al., 2003). 

However, the exact molecular nature of Wnt/β-catenin signaling 

in somitogenesis is not fully understood, and whether Wnt/ 

β-catenin signaling is involved in somitogenesis of the lower 

vertebrates such as Xenopus is still questionable. 

The FGF signaling pathway also participates in somitogenesis 

(Delfini et al., 2005; Dubrulle et al., 2001; Moreno and Kintner, 

2004). Fgf8 mRNA forms a gradient along the PSM in mouse

embryos (Delfini et al., 2005; Dubrulle et al., 2001). Altering the 

activity of FGF signaling in the PSM resulted in segmental defects 

(Dubrulle et al., 2001). These data demonstrate that FGF signaling 

is required for somitogenesis. It has been proposed that FGF 

signaling may act through the PI3-K/AKT pathway in the PSM to 

participate in somitogenesis (Dubrulle and Pourquie, 2004). Since 

PI3-K/AKT signaling can enhance accumulation of β-catenin by 

inhibiting GSK-3β during cardiomyocyte growth (Haq et al., 

2003), it may regulate Wnt/β-catenin activity in the segmentation 

process by a similar mechanism. 

Somite formation and patterning are thought to be controlled 

by Mespo, a member of the basic–helix–loop–helix (bHLH) 

transcription factor family (Moreno and Kintner, 2004; Yoon 

et al., 2000; Yoon and Wold, 2000). Mespo expression 

encompasses the entire caudal PSM of Xenopus embryos, and 

its expression is reduced when the PSM cells enter the 

segmentation process (Joseph and Cassetta, 1999; Kim et al., 

2000; Moreno and Kintner, 2004). Gain of function experiments 

showed that Mespo can induce expression of paraxial mesoderm 

marker genes (Yoon et al., 2000). Mespo null mouse embryos 

exhibited no identifiable somites or segmental patterning in the 

trunk posterior to forelimbs, and severe disruption of gene 

expressions in posterior paraxial mesoderm (Yoon and Wold, 

2000). These results suggest that Mespo plays essential roles in 

somitogenesis. The phenotypic resemblance between Mespo 

and Wnt3a mutant mouse embryos provides a strong hint that 

Wnt/β-catenin signaling regulates the expression of Mespo 

during paraxial mesoderm development. However, whether 

Mespo expression is regulated by Wnt/β-catenin signaling in the 

PSM remains unclear. 

Here, we report that Wnt/β-catenin signaling directly 

regulates the expression of Mespo, and this regulation is 

enhanced by PI3-K/AKT signaling. These results demonstrate 

that Wnt/β-catenin signaling plays a key role in controlling 

somitogenesis by regulating Mespo gene expression, and that 

PI3-K/AKT signaling is also involved in this process. 

Materials and methods 

Embryo manipulations, drug treatment 

Preparation and injection of Xenopus embryos were carried out as previously 

described (Ding et al., 1998). Embryos were staged according to Nieuwkoop 

and Faber (1967). LY294002 (Calbiochem) was used at 100 μM. Chemicals 

were dissolved in DMSO and then diluted into 0.1× MMR. In each case, about 

20 embryos were examined per condition per probe. Each experiment was 

repeated three times independently. 

Morpholino oligomer and in vitro translation 

The 25-bp morpholino antisense oligomer for Xenopus Mespo was obtained 

from Gene Tools and consisted of the following sequence: 

MespoMO: GGGATGGTGCAGAGTCTCCATCAGT 

Morpholino was dissolved in water to a concentration of 1 mM, which was 

then further diluted to a give a working solution of 0.3 mM. For the rescue assay, 

we generated a mutated Mespo cDNA (mMespo) differed in seven bases 

(underlined) from Mespo: 5′-CTACTATGGAGACTCTGCACCATCCCCT. 

J. Wang et al. / Developmental Biology 304 (2007) 836–847 

The in vitro transcription/translation of Mespo was performed according to 

the protocol of TNT coupled reticulocyte lysate system (Promega, L4610). 

In situ hybridization, immunocytochemistry 

Whole-mount in situ hybridization was performed as previously described 

(Harland, 1991) using DIG-labeled probes. For bleaching of wild-type embryos, 

hybridized embryos were treated with bleaching solution (0.5× SSC with 1% 

hydrogen peroxide and 5% formamide) under a fluorescent light. The following 

plasmid templates were linearized, and DIG-labeled antisense RNA probes were 

made using either T7 or SP6 RNA polymerase: Thylacine1 (Sparrow et al., 

1998); Mespo (Joseph and Cassetta, 1999); GFP (Geng et al., 2003); Xwnt8 

(Kazanskaya et al., 2004) and Dkk1 (Glinka et al., 1998); Paraxis (a PCRamplified 

full-length cDNA of Paraxis was cloned into pCS2+); AKT (a PCRamplified 

coding region of Xenopus AKT was cloned into pCS2+); PAPC (Kim 

et al., 2000); XBra (Smith et al., 1991). 

To visualize somite size, embryos were fixed in 2% paraformaldehyde, 2% 

glutaraldehyde in PBS, and stained with the muscle-specific monoclonal antibody 

12/101 (Kintner and Brockes, 1985). Then embryos were post-fixed in MEMFA 

(0.1 M MOPS pH 7.4, 2 mM EGTA, 1 mM MgSO4, 3.7% formaldehyde), 

embedded in paraffin, sectioned at 10 μm, and stained with DAPI. 

Mutagenesis and transgenesis 

The Exsite PCR-based site-directed mutagenesis system (Stratagene, cat. 

200502-5) was used to generate the mutants of site L, p-4317mLuc and p-511m. 

The primers are shown below (nucleotides altered shown in bold): 5′- 

AGGAGACAGCAAGGTGTTAACATG-3′ (reverse) and 5′-CTAGACTCC- 

TCCATTAAAACGCCCACT-3′ (forward). 

Transgenic Xenopus embryos were generated as described previously (Kroll 

and Amaya, 1996). Plasmids used for transgenesis assays were linearized by 

NotI digestion. Three independent rounds of transgenesis were performed for 

each plasmid. 

Western blot 

For measuring phospho-Akt levels, the caudal region of Xenopus embryos at 

stage 23 were divided into three equal parts corresponding to the caudal domain, 

the rostral domain of the PSM and a region including the last formed somites. In 

these experiments, 100 embryos were used. The samples were lysed in EDTAfree 

RIPA (0.1% NP40, 20 mM Tris–HCl pH 8, 10% glycerol) with cocktail 

protease inhibitors (Bio Basics) and Na 3VO 4. 

For measuring accumulation of β-catenin in the nucleus and cytosol, the 

caudal domain of the PSM was dissected and cultured in 1× MMR containing 

LY294002 at 100 μM or DMSO for 2 h. Then β-catenin in either nucleus or 

cytosol was extracted according to PIERCE protocol (NE-PER nuclear and 

cytoplasmic extraction reagents, 78833). 

All the samples were quantitated by Bradford assay and adjusted to equal 

concentration before loading. Western blot was performed as described (He 

et al., 2005). Polyclonal antibody P14L was used to visualize β-catenin (dilution 

1:2000), and anti-phospho-Akt polyclonal antibodies (dilution 1:2000; Cell 

Signaling Technology) were used to detect endogenous Akt and phospho-Akt. 

For a loading control, equal volume of proteins were separated by SDS–PAGE 

and visualized with Coomassie Blue. 

Chromatin immunoprecipitation (ChIP) 

Chromatin immunoprecipitation (ChIP) assay was performed, with modifications, 

according to the method described previously (Sachs and Shi, 2000). 

100 Xenopus embryos were selected at stage 13 from embryos injected with 

appropriate plasmids, and crosslinked with 1% formaldehyde at room 

temperature for 20 min. Following treatment with 0.125 M glycine, embryos 

were washed and resuspended in 200 μl ChIP lysis buffer. The lysates were 

sonicated on ice to obtain DNA fragments on an average around 500 bp and 

immunoprecipitated with anti-HA monoclonal antibody (dilution 1:3000; 

Sigma). DNA fragments were washed, eluted and recovered from the immunoprecipitated 

complex. PCR was performed under an optimized condition: 94 °C 

837

838 J. Wang et al. / Developmental Biology 304 (2007) 836–847 

for 30 s, 58 °C for 30 s, and 72 °C for 30 s, for 30–35 cycles. Primer sequences are 

as follows: Mespo promoter upstream 5′-TGAAAGCCAATTTAGCTGAAGG- 

3′, downstream 5′-GCTGGCAAAGTTCCATGTGAG-3′; ODC upstream 5′- 

GATCATGCACATGTCAAGCC-3′, downstream 5′-CAGGGAGAATGC- 

CATGTTCT-3′; pGL3-Basic upstream 5′-CAGGGGATAACGCAGGAAA-3′, 

downstream 5′-AAGGGAGAAAGGCGGACA G-3′. 

Results 

MO-based Mespo depletion caused defects of somite formation 

Previous analysis of the morphological defects in Mespo 

knockout mouse suggests that Mespo plays a role in somitogenesis 

(Yoon and Wold, 2000). In Xenopus, Mespo 

expression is firstly detected in ventrolateral mesoderm but is 

absent from dorsal mesoderm in gastrulae, and is localized to 

the most caudal (unsegmented) paraxial mesoderm in neurulae 

and tailbud stage (Joseph and Cassetta, 1999; Yoon et al., 

2000). To test whether Mespo contributes to Xenopus 

somitogenesis, we used antisense morpholino oligonucleotides 

(MO) to deplete Mespo. We designed a Mespo MO that spans 

the ATG initiation codon (Fig. 1A). This MO inhibits 

translation of recombinant Mespo RNA in an in vitro 

transcription/translation reaction (Fig. 1B). To disrupt endogenous 

Mespo expression we injected Mespo MO into the 

ventral marginal zone (VMZ) of one blastomere at four-cell 

stage, with the uninjected side serving as a control. The somite 

morphology of the injected embryos was then examined at 

tadpole stage by whole-mount immunostaining with 12/101 (a 

monoclonal antibody specifically recognizes differentiated 

muscle cells). While control MO-injected embryos exhibit no 

morphological defects in somite formation (Fig. 1C), embryos 

injected with Mespo MO show remarkable malformation of 

Fig. 1. Antisense MO against Mespo depletes Mespo protein and causes somite formation defects. (A) Sequence of Mespo MO aligned with the 5′-untranslated region 

(UTR) of Mespo RNA. (B) In vitro transcription/translation of Mespo is inhibited by Mespo MO. Arrow indicates the band corresponding to Mespo protein. (C, D) 

Whole mount immunostaining with 12/101, a muscle-specific antibody, shows that the segmental pattern of somites in Mespo MO-injected embryos (D) is disrupted 

and the somite size is irregular (compared with control MO-injected embryo in panel C). Bracket in panel D marks the malformed somites. (E–H) Embryos injected 

with Mespo MO (F, H) or control MO (E, G) stained with 12/101, then sectioned longitudinally and labeled with DAPI. Panels E, G and Panels F, H are the same view 

of one embryo, respectively. Embryos injected with Mespo MO panel F, H show the disorganization of segmental pattern, based on myotomal morphology (panel F, 

compared with panel E) and the arrangement of somatic nuclei panel H, compared with G). Bracket in panel H marks the malformed somites.

somites. The defects include disrupted somite boundaries and 

irregular somite size (79%, N=100, Fig. 1D). The malformation 

of somites in Mespo MO-injected embryos is shown more 

clearly on frontal sections stained with 12/101 or with DAPI 

staining of nuclei. Compared with the uninjected side, somites 

in Mespo MO-injected side are poorly defined, with no 

metameric shape typical for this tissue. Also, somite nuclei 

are abnormally aligned, indicating that the patterning of somite 

is severely disrupted (67%, N=30, Figs. 1F, H). As a control, 

the somite morphology in control MO-injected embryos 

remains identical to that in the uninjected side, with regularly 

arranged allied cells (Figs. 1E, G). 

Aiming to verify that the phenotype described above is due to 

specific depletion of Mespo, we carried out rescue experiments. 

We prepared a mutated Mespo (mMespo) cDNA, which codes 

for the same polypeptide as the Mespo protein but differs from 

Mespo cDNA by seven bases. Injection of the resulting pCS– 

mMespo plasmid effectively rescues the phenotypic defects 

caused by Mespo MO in 85% (N=100) of the injected embryos 

(Supplemental Fig. 1). We also injected Mespo MO into DMZ 

of four-cell-stage embryos, where Mespo is not expressed, and 

found no effect on embryo development (data not shown). 

These results indicate that the effect of Mespo MO is specific. 

Taken together, our results indicate that depletion of Mespo 

caused the morphological defects of somite patterning. 

Depleting Mespo disrupts expression of genes in the PSM 

The results described above indicate that lacking of Mespo in 

embryos causes segmentation defects. In Xenopus, several 

molecules have been demonstrated to play roles in segmentation 

process, including PAPC (Kim et al., 2000), Thylacine1 (Thy) 

(Sparrow et al., 1998) and XDelta-1 (Pourquie, 2003). To 

evaluate whether depleting Mespo interferes the expression of 

segmental marker genes, we examined the expression of genes 

such as PAPC, Thy and XDelta-1 in embryos injected with 

Mespo MO. Compared with the uninjected side, the expression 

of PAPC is lost in Mespo MO-injected side (85%, N=78, Fig. 

2B). The loss of PAPC expression in embryos injected with 

Mespo MO is specific since it could be rescued by coinjecting 

with pCS–mMespo (70%, N=60, Fig. 2C). The segmental 

expression of Thy in somitomeres is severely disrupted (87%, 

N=65, Fig. 2E), and it was observed that the somitomeric 

expression pattern of XDelta-1 is also perturbed (80%, N=81, 

Fig. 2G). As a control, injection of a mixture of pCS–LacZ and 

control MO resulted in no difference in the expression level and 

pattern of PAPC, Thy or XDelta-1 in both injected and 

uninjected sides (Figs. 2A, D, F). These results indicate that 

depletion of Mespo profoundly changes the expression of 

PAPC, Thy and XDelta-1 in the PSM, suggesting that Mespo 

acts in the PSM to control segmental patterning. Since XDelta-1 

is a component of the Notch/Delta pathway, these results 

suggest that Mespo controls segmental patterning by regulating 

Notch/Delta signaling (Pourquie, 2003). 

To gain further insight into the cause of somite defects in 

embryos lacking Mespo function, we examined the expression 

of XBra that plays major roles in development of paraxial 


mesoderm (Conlon and Smith, 1999). We found that in embryos 

depleted for Mespo, the expression of XBra is increased in the 

Mespo MO-injected side (67%, N=90, Fig. 2I), as compared 

to the control side, indicating that XBra expression is negatively 

regulated by Mespo, a phenomenon also observed in Mespo 

null mutant mouse (Yoon and Wold, 2000). XBra expression is 

not changed in control MO-injected embryos (Fig. 2H). 

Interestingly, in embryos injected with Mespo MO, Mespo 

mRNA is expressed at levels higher than the control side (78%, 

N=78, Fig. 2K). Expression of Mespo is not changed in the 

control MO-injected embryos (Fig. 2J). This result implies that 

Mespo has a negative regulatory effect on its own mRNA 

expression in the PSM. 

Taken together, we provide evidence here that Mespo is 

responsible not only for segmental specific gene expression, but 

is also involved in regulating Xbra and Mespo expression. Thus 

we conclude that Mespo is essential for somitogenesis. 

Wnt/β-catenin signaling in the PSM 

Observations from studies on mouse embryos have demonstrated 

that Wnt/β-catenin signaling is involved in somitogenesis 

(Aulehla et al., 2003). Regional similarity between 

expression patterns of Wnts and Mespo in mouse embryos, as 

well as the phenotypic similarities of Wnt and Mespo null 

mutant mouse (Takada et al., 1994; Yoon and Wold, 2000), 

raises a possibility that Wnt signaling regulates Mespo 

expression in somitogenesis. 

However, the existence of Wnt signaling in Xenopus PSM 

has not been documented. We performed whole-mount in situ 

hybridization to analyze Wnt gene expression in the PSM. Like 

in other vertebrates, Xenopus PSM is subdivided into two 

distinct regions featured by expression pattern of the bHLH 

family genes (Fig. 3K) (Kim et al., 2000; Pourquie, 2003). In 

the caudal domain of the PSM, Mespo is expressed in the entire 

region referred as the tailbud domain (TBD) (Figs. 3I, J). Thy 

transcripts are restricted in the rostral region of the PSM and 

localized to the anterior half of somitomeres (Figs. 3G, H, I, J). 

At the neurula stage, XWnt8 is expressed at high level in the 

TBD (Figs. 3A, B, E, F, G, H), whereas Wnt antagonist Dkk1 is 

uniformly expressed in somitomeres (Figs. 3C, D, E, F). The 

expression patterns of these genes indicate that Wnt signals 

exist in the TBD and support that Wnt/β-catenin signaling is 

involved in Xenopus somitogenesis. 

Altering Wnt/β-catenin signaling activity affects expression of 

Mespo 

To test whether Wnt/β-catenin signaling regulates Mespo 

expression, pCS–Lef1–VP16 (a dominant active form of Lef1) 

DNA was injected into VMZ of one cell of four-cell-stage 

embryos and Mespo expression was examined at stage 19. 

Mespo expression in the injected side is increased compared 

with the control side (75%, N=70, Fig. 4B). When embryos 

were injected with pCS–β-catenin DNA, Mespo expression is 

also increased (Supplemental Fig. 2B). In contrast, injection of 

pCS–Lef1–EnR (a dominant negative form of Lef1) DNA 

839


Fig. 2. Expression patterns of genes responsible for segmental patterning are altered in embryos lacking Mespo function. For all embryos, anterior is to the left. (A–K) 

One VMZ cell of four-cell-stage embryos injected with control MO (A, D, F, H and J), or Mespo MO (B, E, G, I and K) or Mespo MO plus 35 pg pCS–mMespo (C) 

and the embryos were fixed at neurula stage for in situ hybridization to detect the PSM marker gene expression: (A–C) PAPC, (D, E) Thy, (F,G)XDelta-1, (H, I) 

XBra, (J, K) Mespo. Bracket in panels B and E indicates the disruption of segmental expression of PAPC and Thy, respectively. Bracket in panel C indicates the 

rescue of PAPC expression by coinjecting Mespo MO with pCS–mMespo. Arrowhead in panel G indicates the disruption of segmental expression of XDelta-1. 

Arrowhead in panel I indicates the increase of XBra expression. Arrowhead in panel K indicates the increase of Mespo expression. 

results in the opposite effect where Mespo expression is 

markedly reduced (56%, N=65, Fig. 4C). We also observed 

that Mespo expression is decreased at stage 10 when injecting 

embryos with lef1–EnR mRNA at four-cell stage (Supplemental 

Fig. 2D). These changes are tightly associated with the 

changing of Wnt/β-catenin signaling activity, because the

Fig. 3. Wnt/β-catenin signaling in the PSM. (A–J) The neurula stage embryos 

were stained by whole-mount in situ hybridization for Xwnt8 (A, B, arrowhead), 

Dkk1 (C, D, arrow), Xwnt8 and Dkk1 (E, F, arrowhead indicates XWnt8 and 

arrow indicates DKK1), Xwnt8 and Thy (G, H, arrowhead indicates XWn8 and 

arrow indicates Thy), or Mespo and Thy (I, J, arrowhead indicates Mespo and 

arrow indicates Thy). Embryos in panels A, C, E, G and I are oriented with 

anterior to the left and shown in lateral views. Embryos in panels B, D, F, H and 

J show posterior–dorsal view. (K) Schematic diagram (adapted from Kim et al., 

2000) illustrates gene expression patterns related to somite formation in the PSM 

of Xenopus embryos. 

expression patterns of Mespo or Paraxis are un-changed in 

control embryos or control side (Figs. 4A, D, E, F). 

These results indicate that the activity of Wnt/β-catenin 

signaling is responsible for Mespo expression in the PSM. 


Mespo is a direct downstream target of Wnt/β-catenin 

signaling cascade 

To experimentally determine how Wnt/β-catenin signaling 

regulates Mespo expression, we identified a 4.3 kb Mespo 

promoter that is able to recapitulate the endogenous Mespo 

expression from gastrulae to tailbud stage (Wang and Ding, 

2006) and used it for further analysis. We first tested whether 

pCS–Lef1–VP16 could induce the expression of a luciferase 

reporter controlled by the 4.3 kb Mespo promoter (p-4317Luc) 

in animal caps. A 10-fold induction of the reporter activity is 

observed (Fig. 5B). 

To investigate whether Mespo is a direct target of Wnt/ 

β-catenin signaling, we examined the Mespo promoter for 

LEF/TCF binding sites. A perfectly conserved LEF/TCF 

binding site (site L) was found (van de Wetering et al., 

1991), at position −73 to −67 relative to the transcription start. 

In a search of GenBank database for the 5′ regulatory regions 

of homologous Mespo promoters in zebrafish and chick, we 

found that this LEF/TCF binding site is conserved in zMespo 

(the zebrafish Mespo homolog) and cMespo-1 (the chick Mespo 

homolog) (Fig. 5A). The conservation within the 

regulatory regions among these vertebrates suggests that this 

LEF/TCF binding site plays an important role in the regulation 

of Mespo expression. We then generated a mutation in site L 

and examined the activity of the mutant promoter in animal 

cap assay. The results show that the mutant promoter construct 

(p-4317mLuc) has similar activity as the p-4317Luc (Fig. 5C). 

However, when coinjected with pCS–Lef1–VP16, the luciferase 

activity of the p-4317mLuc plasmid is significantly 

reduced as compared to that of the p-4317Luc plasmid (Fig. 

5D). Based on the results obtained from animal cap assays, we 

injected reporter plasmids into the VMZ of both cells of 

embryos at four-cell stage to examine the function of the LEF/ 

TCF binding site (site L) in vivo. The results show that the 

luciferase activity of the p-4317mLuc plasmid is reduced to 

half of the p-4317Luc plasmid (Fig. 5E). The functional 

importance of site L was further confirmed by generating 

transgenic embryos with the 4.3 kb GFP construct carrying the 

site L mutation. When site L was mutated, GFP expression in 

the PSM is abolished in approximately 90% transgenic 

embryos (N=200, Fig. 5H) while the expression of GFP 

mRNA in approximately 51% p-4317GFP transgenic embryos 

(N=180, Fig. 5G) is detected in the PSM (Fig. 5I), strongly 

suggesting that the site L is indeed essential for Mespo 

expression in the PSM. 

LEF1 binds site L in vivo 

To examine whether Lef1 binds to site L, chromatin 

immunoprecipitation (ChIP) assay was performed as previously 

described (Sachs and Shi, 2000). HA-tagged Lef1 was coinjected 

with a truncated form of Mespo promoter, p-511, which 

comprised a proximal 511-bp region of the promoter, followed 

by precipitation of plasmid DNA bound to Lef1 with an anti- 

HA antibody. PCR amplification using specific primers 

flanking site L revealed that binding of Lef1 to wild type site 

841


Fig. 4. Wnt/β-catenin signaling regulates Mespo expression. For all embryos, anterior is to the left. Four-cell-stage embryos were injected in VMZ of one blastomere 

with lineage tracer pCS–LacZ as control (A, D), or together with pCS–Lef1–VP16 (B, E) or together with pCS–Lef1–EnR (C, F). At stage 19, whole mount in situ 

hybridization was performed for Mespo (A–C) or Paraxis (D–F), as indicated. Arrowhead in panel B shows the increase of Mespo expression. Arrowhead in panel C 

shows the decrease of Mespo expression. 

L is significantly stronger than that to the mutated one (Fig. 6A). 

We also examined whether the binding of Lef1 to the Mespo 

regulatory region can be detected in vivo. Indeed, when 

injecting HA-tagged Lef1 into both VMZ cells at four-cell 

stage, the binding of Lef1 to site L is detected (Fig. 6B). As a 

control, no binding of Lef1 is detected in the exon region of 

Mespo (Fig. 6B). 

These results indicate that Mespo is a direct downstream 

target of Wnt/β-catenin signaling in the PSM. 

PI3-K/AKT signaling regulates Mespo expression 

Recent work indicates that FGF signaling is involved in 

controlling somitogenesis through MKK1/ERK signaling pathway 

by regulating Mespo expression (Delfini et al., 2005; 

Moreno and Kintner, 2004). However, FGF signaling has other 

downstream effectors like PI3-K/AKT in the PSM (Dubrulle 

and Pourquie, 2004). This raises a question of whether PI3-K/ 

AKT-mediated FGF signaling contributes to the regulation of 

Mespo expression. 

In order to answer this question, we checked whether Akt is 

present in the PSM as the phosphorylated form. Results from 

Western blot show that both Akt and its phosphorylated form 

are detected in the caudal PSM (Fig. 7B). To evaluate whether 

PI3-K/AKT signaling contributes to the expression of Mespo, 

we treated embryos with LY294002 which is a specific PI3 

kinase inhibitor (Knight et al., 2006; Walker et al., 2000) and 

then dissected caudal PSM for analysis. Treating embryos with 

LY294002 causes a reduction of Akt phosphorylation (Fig. 

7C), and leads to a decreased Mespo expression (67%, N=55, 

Fig. 7E) as compared with the control (Fig. 7D). LY294002 or 

DMSO treatment causes no change in Paraxis expression 

(Figs. 7F, G). The decrease of Mespo expression was further 

confirmed by RT–PCR. As shown in Fig. 7H, Mespo mRNA 

is dramatically downregulated when the caudal PSM cells 

were treated with LY294002 (Fig. 7H). These results indicate 

that PI3-K/AKT signaling contributes to Mespo expression. 

Interaction of PI3-K/AKT and Wnt signaling on Mespo 

expression 

Since Wnt/β-catenin signaling directly regulates Mespo 

expression and blocking PI3-K/AKT pathway decreases 

Mespo expression, we reasoned that Wnt/β-catenin and 

PI3-K/AKT pathway might cooperate to regulate Mespo 

expression. To test this possibility, we examined whether the 

activity of Wnt/β-catenin signaling was affected when PI3-K/ 

AKT signaling was blocked. A sharp decrease of β-catenin 

protein in the nuclei of the caudal PSM cells was detected 

after a 2-h treatment with LY294002, and a decrease in 

cytosolic β-catenin was also observed (Fig. 8A). To test what 

led to the loss of β-catenin, we took advantage of a specific 

antibody, which only recognizes the phosphor-form of βcatenin 

that is phosphorylated by GSK-3β. Western blot using 

this antibody shows that when treating the PSM cells with 

LY294002 the phosphorylated form of β-catenin is significantly 

increased within 1.5 h, and decreased after 2.5 h (Fig. 

8B). This result indicates that the blocking of PI3-K/AKT 

pathway causes the phosphorylation and degradation of βcatenin 

via an Axin/GSK-3β-dependent mechanism (Aberle 

et al., 1997; Polakis, 2001). Therefore, PI3-K/AKT pathway 

affects the stability of β-catenin. On the other hand, when 

injecting embryos with pCS–Lef1–VP16 DNA to activate 

Wnt/β-catenin signaling, the injected side shows increased 

Mespo expression (79%, N =70, Fig. 8D). However, 

LY294002 treatment could not cause significant reduction of

the increased Mespo expression induced by injecting pCS– 

Lef1–VP16, while Mespo expression is clearly reduced in the 

uninjected side (61%, N=90, Fig. 8E). Thus injecting pCS– 

Lef1–VP16 expressing the constitutively active Lef1–VP16 

minimizes the effect of blocking the PI3-K/AKT pathway. 

Taken together, these results indicate that the PI3-K/AKT 

pathway participates in regulating Wnt/β-catenin signaling 

mediated Mespo expression, through the regulation of βcatenin 

stability. 


Fig. 5. The LEF/TCF binding site is responsible for the expression of Mespo. (A) Schematic representation of Mespo promoters from various species with a conserved 

LEF/TCF binding site (red). The position of potential LEF/TCF binding site (box) in Xenopus Mespo 5′-upstream sequence is indicated. (B–D) Fold induction of 

pCS–Lef1–VP16 in pGL3basic and p-4317Luc reporter plasmids (B), luciferase activities of p-4317Luc and p-4317mLuc reporter plasmids (C) or fold induction of 

pCS–Lef1–VP16 in p-4317Luc and p-4317mLuc reporter plasmids (D) in animal cap assays. Plasmids were injected into the animal pole at the four-cell stage. Animal 

caps were dissected at stage 8.5 and luciferase activities were measured at stage 12.5. RLU, relative light units. (E) Luciferase activities of the indicated plasmids 

injected into both VMZ cells at four-cell stage and measured at stage 19. RLU, relative light units. (F) Expression of endogenous Mespo mRNA at the tailbud stage. 

(G–I) Expression of GFP mRNA in p-4317GFP transgenic embryos (G) or in p-4317mGFP transgenic embryos (H) at the tailbud stage. The percentages of transgenic 

embryos that show the PSM expression (purple), non-specific expression (brown), and no detected signal (white) are shown in panel I. 

Discussion 

Mespo is involved in segmental patterning during Xenopus 

somitogenesis 

Mespo knock out mouse shows severe defects in somitogenesis, 

including perturbation of segmental patterning. The mutant 

mice have no identifiable somites, and the expression of genes 

associated with somitogenesis like Mesp2 (the ortholog of 

843


Fig. 6. Lef1 binds to site L in the Mespo promoter in vivo. (A) ChIP assay of 

embryos injected with pCS–Lef1–HA and p-511, or pCS–Lef1–HA and p- 

511m in both VMZ cells at four-cell stage to detect the binding of Lef1 to site L. 

(B) ChIP assay detecting the binding of Lef1 to endogenous Mespo regulatory 

sequence. pCS–Lef1–HA was injected into both VMZ cells of embryos at fourcell 

stage. 

Xenopus Thy), PAPC and Dll-3 (the ortholog of XDelta-1) is 

abolished in absence of Mespo (Yoon and Wold, 2000). This 

phenotype implies that Mespo is involved in establishing 

segmental patterning in somitogenesis. Here, we report that in 

Xenopus embryos depleting Mespo by Mespo Mo causes 

disorder of somite cell arrangement. During Xenopus somitogenesis, 

the rostral PSM cells compact to form cell aggregates 

named somitomeres, which later separate from the PSM to form 

somites. The nuclei of somite cells line up in the middle of each 

somite, representing the well-organized segmental pattern. 

There is no such distinct morphological feature in Mespodepleting 

Xenopus embryos. Instead, nuclei are randomly 

distributed, indicating the disorganization of somite cells (Fig. 

1H). The expression patterns of genes associated with 

segmental patterning are also perturbed (Fig. 2). Thus, our 

data indicate that Mespo functions in establishing the segmental 

pattern by means of regulating the genes involved in Xenopus 

somitogenesis. 

Wnt/β-catenin signaling controls gene expressions in 

somitogenesis 

Previous studies have demonstrated that Wnt3a is involved 

in somitogenesis (Aulehla et al., 2003; Galceran et al., 2004; 

Hofmann et al., 2004; Ikeya and Takada, 2001). In chick 

embryos, increasing Wnt/β-catenin signaling activity by 

implanting beads covered with Wnt3a expressing cells induced 

smaller somites (Aulehla et al., 2003). In mouse embryos, it 

has been proposed that Wnt3a is involved in somitogenesis via 

Axin2 (Aulehla et al., 2003) and Wnt/β-catenin signaling 

controlled segmentation by directly regulating Dll1 expression 

(Galceran et al., 2004; Hofmann et al., 2004). However, the 

effect of Wnt/β-catenin signaling in somitogenesis has not 

been fully understood. Our study provides new information on 

the role of Wnt/β-catenin signaling in somitogenesis. We 

checked XWnt3a and XWnt8 expression in Xenopus embryos 

and found that XWnt3a expression is restricted in neural crest 

cells, while XWnt8 expression is detected in the caudal PSM 

(Figs. 3A, B, E–H). Furthermore, the Wnt antagonist Dkk1 is 

expressed in somitomeres (Figs. 3C–F). These observations 

suggested that the activity of Wnt/β-catenin signaling exists in 

Fig. 7. PI3-K/AKT signaling regulates Mespo expression. (A) Hatched lines 

indicate the three caudal regions (C, R, and S) used for western blot of Akt and 

phosphorylated Akt. (B) Western blot of Akt and phosphorylated Akt in 

different regions indicated in panel A. (C) Western blot of phosphorylated Akt in 

the caudal PSM equivalent to region C (illustrated in panel A) treated with either 

LY294002 or DMSO. (D–G) The neurula stage embryos were treated with 

either DMSO (D, F), or LY294002 (E, G) for 2 h, and then stained for Mespo 

and Paraxis as indicated. (H) RT–PCR of Mespo mRNA in the caudal PSM 

equivalent to region C (illustrated in panel A) treated with either DMSO or 

LY294002. The caudal PSM were dissected at stage 23 and treated with drugs 

for 2 h, then harvested for RT–PCR.

Xenopus PSM and is restricted in the caudal PSM. This Wnt/ 

β-catenin signaling activity is essential for Mespo expression. 

Increasing Wnt/β-catenin signaling activity by injecting pCS– 

Lef1–VP16 enhances Mespo expression in the PSM, and 

decreasing Wnt/β-catenin signaling activity by injecting pCS– 

Lef1–EnR downregulates Mespo expression (Fig. 4). We also 

found that Wnt/β-catenin signaling, acting upstream of Mespo, 

directly controls Mespo expression, based on the 

recruitment of Lef1 to the site in the Mespo 5′-regulatory 

region (Fig. 6B). Since Mespo expression is essential for 

segmental patterning, we concluded that Wnt/β-catenin 

signaling controls segmentation process by regulating Mespo 

expression. 


Fig. 8. Interaction between PI3-K/AKT and Wnt/β-catenin signaling in PSM. (A) Western blot of β-catenin in the nucleus and cytosol of the caudal PSM cells from 

embryos treated with either DMSO or LY294002 for 2 h. (B) Western blot of β-catenin, phosphorylated β-catenin, Akt and phosphorylated Akt in the caudal PSM 

cells treated with DMSO for 2.5 h, or LY294002 for 1.5 h or 2.5 h. (C–E) Four-cell-stage embryos were injected in VMZ of one cell with pCS–LacZ as control (C) or 

together with pCS–Lef1–VP16 (D, E). At the neurula stage, injected embryos were treated with DMSO (C, D) or LY294002 (E) for 2 h, then fixed, stained with X-gal 

to reveal the tracer (light blue) and analyzed by whole-mount in situ hybridization for Mespo. Arrow in panel D indicates the increase of Mespo expression in the 

injected side and arrowhead indicates the expression of Mespo in the uninjected side. Arrow in panel E indicates the increased Mespo expression in the injected side 

and arrowhead indicates the decrease of Mespo expression in the uninjected side. 

Regulation of Mespo expression in the PSM 

The bHLH family member Mespo is a key regulator of genes 

associated with proper segmentation and successful somitogenesis 

(Yoon and Wold, 2000). FGF and RA signaling were proposed to 

act upstream of Mespo. It has been shown that blocking FGF 

signaling by SU5402 or increasing RA signaling by treating with 

RA caused a decrease of Mespo expression (Moreno and Kintner, 

2004). However, the molecular nature of how Mespo expression is 

regulated remains unclear. 

We show here that Wnt/β-catenin signaling is required for 

Mespo expression. Increasing Wnt/β-catenin signaling activity 

by overexpressing β-catenin or Lef1–VP16 increases the 

845


expression of Mespo (Fig. 4B and Supplemental Fig. 2B), and 

interfering Wnt/β-catenin signaling by overexpressing Lef1– 

EnR resulted in the opposite effect (Fig. 4C and Supplemental 

Fig. 2D). Our results also show that the PI3-K/AKT pathway 

participates in regulating Mespo expression (Fig. 7E). Since it 

has been proposed that MKK1/ERK signaling is involved in 

regulating Mespo expression (Moreno and Kintner, 2004), it 

seems that FGF signaling contributes to the expression of 

Mespo through PI3-K/AKT and MKK1/ERK pathway together. 

Thus, multiple signaling pathways regulate expression of 

Mespo that is a key regulator of somitogenesis. 

Interaction of signals in somitogenesis 

Previous studies have shown that FGF, Wnt and RA 

signaling are all involved in somitogenesis (Aulehla et al., 

2003; Dubrulle et al., 2001; Galceran et al., 2004; Hofmann et 

al., 2004; Vermot and Pourquie, 2005). However, whether or 

how these signals interact to precisely control somite formation 

is poorly understood. In this report, we have provided evidence 

that Wnt/β-catenin signaling is involved in controlling 

somitogenesis by interacting with FGF signaling. FGF 

signaling downstream effector PI3-K/AKT regulated the 

stability of β-catenin in the nucleus of the PSM cells (Fig. 

8A). Several lines have also shown that RA and FGF signaling 

interact to regulate somitogenesis. RA signaling may inhibit 

the MAPK/ERK pathway by activating the expression of 

MKP3, and FGF signaling seems to regulate RA signaling 

activity by regulating the expression of enzymes for RA 

production and degradation (Moreno and Kintner, 2004). 

Further experiments are needed to explore whether Wnt and 

RA signaling interact in somitogenesis. 

Acknowledgments 

The authors are grateful to Drs. D. Sparrow, E. Joseph, 

C. Niehrs and J.C. Smith for sharing plasmids, Dr. Schneider 

(Max-Planck-Institut fur Entwicklungsbiologie) for β-catenin 

antibody. We thank Drs. W. Wu and Q. Tao for discussion of the 

project. This work was supported by the National Natural 

Science Foundation of China (90408005, 30270650) and the 

National Key Project for Basic Science Research of China 

(2001CB509901, 2005CB522704) to X.D. We thank Dr. 

Dangsheng Li for his professional polish of the MS. 

Appendix A. Supplementary data 

Supplementary data associated with this article can be found, 

in the online version, at doi:10.1016/j.ydbio.2006.12.034. 

References 

Aberle, H., Bauer, A., Stappert, J., Kispert, A., Kemler, R., 1997. beta-Catenin is 

a target for the ubiquitin–proteasome pathway. EMBO J. 16, 3797–3804. 

Aulehla, A., Wehrle, C., Brand-Saberi, B., Kemler, R., Gossler, A., Kanzler, B., 

Herrmann, B.G., 2003. Wnt3a plays a major role in the segmentation clock 

controlling somitogenesis. Dev. Cell 4, 395–406. 

Conlon, F.L., Smith, J.C., 1999. Interference with brachyury function inhibits 

convergent extension, causes apoptosis, and reveals separate requirements in 

the FGF and activin signalling pathways. Dev. Biol. 213, 85–100. 

Delfini, M.C., Dubrulle, J., Malapert, P., Chal, J., Pourquie, O., 2005. Control of 

the segmentation process by graded MAPK/ERK activation in the chick 

embryo. Proc. Natl. Acad. Sci. U. S. A. 102, 11343–11348. 

Ding, X., Hausen, P., Steinbeisser, H., 1998. Pre-MBT patterning of early gene 

regulation in Xenopus: the role of the cortical rotation and mesoderm 

induction. Mech. Dev. 70, 15–24. 

Dubrulle, J., Pourquie, O., 2004. fgf8 mRNA decay establishes a gradient that 

couples axial elongation to patterning in the vertebrate embryo. Nature 427, 

419–422. 

Dubrulle, J., McGrew, M.J., Pourquie, O., 2001. FGF signaling controls somite 

boundary position and regulates segmentation clock control of spatiotemporal 

Hox gene activation. Cell 106, 219–232. 

Galceran, J., Farinas, I., Depew, M.J., Clevers, H., Grosschedl, R., 1999. 

Wnt3a−/−-like phenotype and limb deficiency in Lef1(−/−)Tcf1(−/−) 

mice. Genes Dev. 13, 709–717. 

Galceran, J., Sustmann, C., Hsu, S.C., Folberth, S., Grosschedl, R., 2004. LEF1mediated 

regulation of Delta-like1 links Wnt and Notch signaling in 

somitogenesis. Genes Dev. 18, 2718–2723. 

Geng, X., Xiao, L., Lin, G.F., Hu, R., Wang, J.H., Rupp, R.A., Ding, X., 2003. 

Lef/Tcf-dependent Wnt/beta-catenin signaling during Xenopus axis specification. 

FEBS Lett. 547, 1–6. 

Glinka, A., Wu, W., Delius, H., Monaghan, A.P., Blumenstock, C., Niehrs, C., 

1998. Dickkopf-1 is a member of a new family of secreted proteins and 

functions in head induction. Nature 391, 357–362. 

Haq, S., Michael, A., Andreucci, M., Bhattacharya, K., Dotto, P., Walters, B., 

Woodgett, J., Kilter, H., Force, T., 2003. Stabilization of beta-catenin by a 

Wnt-independent mechanism regulates cardiomyocyte growth. Proc. Natl. 

Acad. Sci. U. S. A. 100, 4610–4615. 

Harland, R.M., 1991. In situ hybridization: an improved whole-mount method 

for Xenopus embryos. Methods Cell Biol. 36, 685–695. 

He, Z., Li, J., Zhen, C., Feng, L., Ding, X., 2005. Knockdown of p53 by RNAi in 

ES cells facilitates RA-induced differentiation into muscle cells. Biochem. 

Biophys. Res. Commun. 335, 676–683. 

Hofmann, M., Schuster-Gossler, K., Watabe-Rudolph, M., Aulehla, A., 

Herrmann, B.G., Gossler, A., 2004. WNT signaling, in synergy with T/ 

TBX6, controls Notch signaling by regulating Dll1 expression in the 

presomitic mesoderm of mouse embryos. Genes Dev. 18, 2712–2717. 

Ikeya, M., Takada, S., 2001. Wnt-3a is required for somite specification along 

the anteroposterior axis of the mouse embryo and for regulation of cdx-1 

expression. Mech. Dev. 103, 27–33. 

Joseph, E.M., Cassetta, L.A., 1999. Mespo: a novel basic helix–loop–helix gene 

expressed in the presomitic mesoderm and posterior tailbud of Xenopus 

embryos. Mech. Dev. 82, 191–194. 

Kazanskaya, O., Glinka, A., del Barco Barrantes, I., Stannek, P., Niehrs, C., Wu, 

W., 2004. R-Spondin2 is a secreted activator of Wnt/beta-catenin signaling 

and is required for Xenopus myogenesis. Dev. Cell 7, 525–534. 

Kim, S.H., Jen, W.C., De Robertis, E.M., Kintner, C., 2000. The protocadherin 

PAPC establishes segmental boundaries during somitogenesis in Xenopus 

embryos. Curr. Biol. 10, 821–830. 

Kintner, C.R., Brockes, J.P., 1985. Monoclonal antibodies to the cells of a 

regenerating limb. J. Embryol. Exp. Morphol. 89, 37–55. 

Knight, Z.A., Gonzalez, B., Feldman, M.E., Zunder, E.R., Goldenberg, D.D., 

Williams, O., Loewith, R., Stokoe, D., Balla, A., Toth, B., Balla, T., Weiss, W. 

A., Williams, R.L., Shokat, K.M., 2006. A pharmacological map of the PI3-K 

family defines a role for p110alpha in insulin signaling. Cell 125, 733–747. 

Kroll, K.L., Amaya, E., 1996. Transgenic Xenopus embryos from sperm nuclear 

transplantations reveal FGF signaling requirements during gastrulation. 

Development 122, 3173–3183. 

Moreno, T.A., Kintner, C., 2004. Regulation of segmental patterning by retinoic 

acid signaling during Xenopus somitogenesis. Dev. Cell 6, 205–218. 

Nieuwkoop, P.D., Faber, J., 1967. Normal Table of Xenopus laevis. North 

Holland, Amsterdam. 

Polakis, P., 2001. More than one way to skin a catenin. Cell 105, 563–566. 

Pourquie, O., 2001. Vertebrate somitogenesis. Annu. Rev. Cell Dev. Biol. 17, 

311–350.

Pourquie, O., 2003. The segmentation clock: converting embryonic time into 

spatial pattern. Science 301, 328–330. 

Sachs, L.M., Shi, Y.B., 2000. Targeted chromatin binding and histone 

acetylation in vivo by thyroid hormone receptor during amphibian 

development. Proc. Natl. Acad. Sci. U. S. A. 97, 13138–13143. 

Smith, J.C., Price, B.M., Green, J.B., Weigel, D., Herrmann, B.G., 1991. 

Expression of a Xenopus homolog of brachyury (T) is an immediate-early 

response to mesoderm induction. Cell 67, 79–87. 

Sparrow, D.B., Jen, W.C., Kotecha, S., Towers, N., Kintner, C., Mohun, T.J., 

1998. Thylacine 1 is expressed segmentally within the paraxial mesoderm of 

the Xenopus embryo and interacts with the Notch pathway. Development 

125, 2041–2051. 

Takada, S., Stark, K.L., Shea, M.J., Vassileva, G., McMahon, J.A., McMahon, 

A.P., 1994. Wnt-3a regulates somite and tailbud formation in the mouse 

embryo. Genes Dev. 8, 174–189. 

van de Wetering, M., Oosterwegel, M., Dooijes, D., Clevers, H., 1991. 

Identification and cloning of TCF-1, a T lymphocyte-specific transcription 

factor containing a sequence-specific HMG box. EMBO J. 10, 123–132. 

Vermot, J., Pourquie, O., 2005. Retinoic acid coordinates somitogenesis and 

left–right patterning in vertebrate embryos. Nature 435, 215–220. 


Walker, E.H., Pacold, M.E., Perisic, O., Stephens, L., Hawkins, P.T., Wymann, 

M.P., Williams, R.L., 2000. Structural determinants of phosphoinositide 

3-kinase inhibition by wortmannin, LY294002, quercetin, myricetin, and 

staurosporine. Mol. Cell 6, 909–919. 

Wang, J., Ding, X., 2006. Cloning and analyzing of Xenopus Mespo promoter in 

retinoic acid regulated Mespo expression. Acta Biochim. Biophys. Sin. 38 

(11), 759–764 (Shanghai). 

Weisblat, D.A., Wedeen, C.J., Kostriken, R.G., 1994. Evolution of developmental 

mechanisms: spatial and temporal modes of rostrocaudal patterning. 

Curr. Top. Dev. Biol. 29, 101–134. 

Wilson, V., Rashbass, P., Beddington, R.S., 1993. Chimeric analysis of T 

(Brachyury) gene function. Development 117, 1321–1331. 

Yamaguchi, T.P., Takada, S., Yoshikawa, Y., Wu, N., McMahon, A.P., 1999. T 

(Brachyury) is a direct target of Wnt3a during paraxial mesoderm 

specification. Genes Dev. 13, 3185–3190. 

Yoon, J.K., Wold, B., 2000. The bHLH regulator pMesogenin1 is required for 

maturation and segmentation of paraxial mesoderm. Genes Dev. 14, 

3204–3214. 

Yoon, J.K., Moon, R.T., Wold, B., 2000. The bHLH class protein pMesogenin1 

can specify paraxial mesoderm phenotypes. Dev. Biol. 222, 376–391. 

847

2007-DevelopmentalBiology.pdf

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?