TESIS NOEMI HERRERO.pdf - Consejo Superior de Investigaciones ...

More documents

Recommendations

Info

Capítulo V Table 4. EMBL nucleotide database accession numbers of members of the family Totiviridae used for phylogenetic analysis. Virus Short name Accession number Armigeres subalbatus totivirus AsTV EU715328 Beauveria bassiana RNA virus 1 BbRV1 unpublished Botryotinia fuckeliana totivirus 1 BfV1 CAM33265.1 Chalara elegans RNA virus 1 CeRV1 AY561500 Coniothyrium minitans RNA virus CmRV AAO14999.1 Drosophila melanogaster totivirus DTV GQ342961 Epichloë festucae vírus 1 EfV 1 CAK02788.1 Giardia lamblia virus GLV L13218 Gremmeniella abietina RNA virus-L1 GaRV-L1 AF337175 Gremmeniella abietina RNA virus-L2 GaRV-L2 AY615210 Helicobasidium mompa totivirus 1-17 HmV-17 BAC81754.1 Helminthosporium victoriae virus 190S Hv-190SV AAB94791.2 Infectious myonecrosis virus IMNV EF061744 Leishmania RNA virus 1-1 LRV 1-1 M92355 Leishmania RNA virus 2-1 LRV 2-1 U32108 Leishmania RNA virus 1-4 LRV 1-4 U01899 Magnaporthe oryzae virus 2 MoV-2 BAF98178.1 Omono River virus-AK4 OMRV-AK4 AB555544 Omono River virus-Y61 OMRV-Y61 AB555545 Saccharomyces cerevisiae virus LA ScV L-A J04692 Saccharomyces cerevisiae virus L-BC ScV L-BC U01060 Sphaeropsis sapinea RNA virus 1 SsRV 1 AAD11601.1 Sphaeropsis sapinea RNA virus 2 SsRV 2 AAD11603.1 Tolypocladium cylindrosporum virus 1 TcV 1 FR750562 Trichomonas vaginalis virus 2 TVV AF127178 Ustilago maydis virus H1 UmV-H1 U01059 Transmission of dsRNA elements to asexual spores Strain B123, which harboured ten different dsRNA elements, was used to study the efficiency of transmission of its dsRNA elements to asexual spores. This was done by analyzing the dsRNAs present in monosporic isolates derived from single conidia produced by strain B123. To obtain monosporic isolates, conidia were washed from PDA cultures of strain B123 with water containing 0.001% Tween 80 and a glass rod. The conidial suspension was centrifuged for 5 minutes at 800 x g. The pellet was resuspended in 200 µl of water, and different dilutions from this suspension were made and added to water agar plates. Single germinating conidia were observed under the microscope, collected with a needle, and transferred to PDA plates to obtain the monosporic isolates. To check the presence of dsRNA elements in the different monosporic cultures, dsRNA was purified and visualized as explained before. 102
Results 103 Capítulo V Incidence and patterns of dsRNA elements Eighty five B. bassiana isolates were analyzed to study the incidence of mycoviruses among isolates collected in different habitats (soil, phylloplane of holm oak and associated adventitious plants, and internal tissues of grass leaves) in Spain and Portugal (Tables 1-3). Fifty of these isolates (58.8%) harboured dsRNA elements. Mycovirus incidence was also analyzed separately according to the habitat and extent of the area from which the strains were isolated. Twenty nine out of fifty four (53.7%) strains collected from soils of natural and cultivated areas throughout Spain and Portugal harboured dsRNA elements (Figs. 1-2). The mycovirus incidence found in this group was the lowest, while that found among B. bassiana isolates sampled in the same geographical point from the soil, phylloplane and adventitious plants associated to a single holm oak (Quercus ilex) was the highest, 68.8% of the sixteen analyzed strains harboured dsRNA elements (Figs. 3-4). Two thirds (66.7%) of the fifteen endophytic isolates obtained from grasses were infected by viruses (Fig. 5). The differences found in the percentages of incidence in the three analyses were not large. In fact, the dsRNA incidences among endophytic isolates and those collected in the same sampling point were very similar. Fig. 1. Electrophoretic banding patterns of dsRNA elements isolated from different strains of B. bassiana. Letters on the top indicate different isolates: A=Bb 01/39; B=Bb 01/75; C=Bb 01/33; D=Bb 01/132; E=Bb 06/02; F=Bb 06/03; G=Bb 09/03; H=Bb 09/08; I=Bb 00/08; J=Bb 00/11; K=Bb 01/15; L=Bb 01/35; M=Bb 01/110; N=Bb 09/07; O=Bb 01/88; P=Bb 08/09; Q=Bb 09/09; R=Bb 01/103. Lane MW contains a size marker and numbers on the left indicate kbp. MW A B C D E F G H I J K L M N O P Q R 10.0 8.0 6.0 5.0 4.0 3.0 2.5 2.0 1.5 1.0 0.75
Page 1:
UNIVERSIDAD DE SALAMANCA FACULTAD D
Page 5:
DR. ÍÑIGO ZABALGOGEAZCOA GONZÁLE
Page 9:
DR. ÁNGEL DOMÍNGUEZ OLAVARRI, DIR
Page 13:
A mi familia: Mil gracias a mis pad
Page 17 and 18:
Página 1. INTRODUCCIÓN GENERAL
Page 19:
1. INTRODUCCIÓN GENERAL
Page 22 and 23:
Introducción general como ocurre e
Page 24 and 25:
Introducción general a hongos endo
Page 26 and 27:
Introducción general El proceso de
Page 28 and 29:
Introducción general Beauveria es
Page 30 and 31:
Introducción general micovirus dat
Page 32 and 33:
Introducción general Los micovirus
Page 35:
2.OBJETIVOS, METODOLOGÍA, RESULTAD
Page 38 and 39:
Objetivos, metodología, resultados
Page 40 and 41:
Capítulo I Objetivos 1. Estudio de
Page 43 and 44:
Brief Report 25 Capítulo I Mycovir
Page 45 and 46:
27 Capítulo I treated with DNase I
Page 47 and 48:
29 Capítulo I Torrubiella confrago
Page 49 and 50:
31 Capítulo II CAPITULO II. Patoge
Page 51:
33 Capítulo II 2. Efecto de la tem
Page 54 and 55:
Capítulo II Introduction The funga
Page 56 and 57:
Capítulo II Materials and methods
Page 58 and 59:
Capítulo II 10 7 spores from each
Page 60 and 61:
Capítulo II Fig. 1. Dendrogram bui
Page 62 and 63:
% mortality % morta li ty Capítulo
Page 64 and 65:
Capítulo II Fig. 4. A. Mortality (
Page 66 and 67:
Capítulo II tick species there wer
Page 68 and 69:
Capítulo II Table 5. T. cylindrosp
Page 70 and 71: Capítulo II not viable at 30 ºC.
Page 73 and 74: 55 Capítulo III CAPITULO III. Mico
Page 75: 57 Capítulo III 3. Curación de mi
Page 78 and 79: Capítulo III Introduction The asco
Page 80 and 81: Capítulo III Fig. 1. A. Electropho
Page 82 and 83: Capítulo III Table 1. EMBL nucleot
Page 84 and 85: Capítulo III Electron microscopy F
Page 86 and 87: Capítulo III Results Transmission
Page 88 and 89: Capítulo III ScV-LA and ScV-L BC (
Page 90 and 91: Capítulo III Fig. 3. A Phylogeneti
Page 92 and 93: Capítulo III A sucrose gradient vi
Page 94 and 95: Capítulo III High temperature did
Page 96 and 97: Capítulo III Therefore, TcV1 may a
Page 99 and 100: 81 Capítulo IV CAPITULO IV. Capaci
Page 101 and 102: 83 Capítulo IV Endophytic establis
Page 103 and 104: 85 Capítulo IV strains employed in
Page 105 and 106: 87 Capítulo IV To test whether the
Page 107 and 108: 89 Capítulo IV Both T. cylindrospo
Page 109 and 110: 91 Capítulo V CAPITULO V. Caracter
Page 111: 93 Capítulo V Por otro lado, la di
Page 114 and 115: Capítulo V Introduction Viruses ha
Page 116 and 117: Capítulo V Materials and Methods F
Page 118 and 119: Capítulo V Table 2. Isolates of B.
Page 122 and 123: Capítulo V Fig. 2. Dendrogram cons
Page 124 and 125: Capítulo V consisting of three ele
Page 126 and 127: Capítulo V Transmission of dsRNA e
Page 128 and 129: 53 44 Capítulo V Fig. 7. Neighbor-
Page 130 and 131: Capítulo V and 8). Mixed mycovirus
Page 132 and 133: Capítulo V cylindrosporum, another
Page 135: 3. DISCUSIÓN GENERAL
Page 138 and 139: Discusión general gramíneas podr
Page 140 and 141: Discusión general y de distintos h
Page 142 and 143: Discusión general luego TcV1 y BbR
Page 144 and 145: Discusión general 3.3. Naturaleza
Page 146 and 147: Discusión general al., 2006). No o
Page 149: 4.CONCLUSIONES
Page 152 and 153: Conclusiones 6. T. cylindrosporum e
Page 155 and 156: 137 Apéndice Apéndice 1. Secuenci
Page 157 and 158: 732 cgcggcggcgccgggctggtcgtcaacgctg
Page 159 and 160: 3279 aaggcccttggctggaactccactctcccc
Page 161 and 162: Apéndice 2. Secuencia completa de
Page 163 and 164: Q N G Y A W F R Q L L N R D D 1126
Page 165 and 166: 147 Apéndice Apéndice 3. Secuenci
Page 167 and 168: A A G R P I I V N A L G T F D 894 g
Page 169 and 170: P S K L T G E L I D V D P D T 3482
Page 171:
6.BIBLIOGRAFÍA
Page 174 and 175:
Bibliografía Bottacin, A.M., Léve
Page 176 and 177:
Bibliografía Ghabrial, S.A., Jiang
Page 178 and 179:
Bibliografía Jiang, D.H., Ghabrial
Page 180 and 181:
Bibliografía Park, Y.J., Chen, X.B
Page 182 and 183:
Bibliografía Segers, G. Zhang, X.
Page 184 and 185:
Bibliografía Wicklow, D.T., Roth,
show all

TESIS NOEMI HERRERO.pdf - Consejo Superior de Investigaciones ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?