- Page 1: UNIVERSIDAD DE SALAMANCA FACULTAD D
- Page 5: DR. ÍÑIGO ZABALGOGEAZCOA GONZÁLE
- Page 9: DR. ÁNGEL DOMÍNGUEZ OLAVARRI, DIR
- Page 13: A mi familia: Mil gracias a mis pad
- Page 17 and 18: Página 1. INTRODUCCIÓN GENERAL
- Page 19: 1. INTRODUCCIÓN GENERAL
- Page 22 and 23: Introducción general como ocurre e
- Page 24 and 25: Introducción general a hongos endo
- Page 26 and 27: Introducción general El proceso de
- Page 28 and 29: Introducción general Beauveria es
- Page 30 and 31: Introducción general micovirus dat
- Page 32 and 33: Introducción general Los micovirus
- Page 37 and 38: 19 Objetivos, metodología, resulta
- Page 39 and 40: 21 Capítulo I Capítulo I. Abundan
- Page 41: 23 Capítulo I aunque se necesitar
- Page 44 and 45: Capítulo I The associations betwee
- Page 46 and 47: Capítulo I Table 1. Endophyte taxa
- Page 48 and 49: Capítulo I similar dsRNA banding p
- Page 50 and 51: Capítulo II M. anisopliae o de hip
- Page 53 and 54: 35 Capítulo II Tick pathogenicity,
- Page 55 and 56: 37 Capítulo II humans (Vial, 2009)
- Page 57 and 58: 39 Capítulo II Growth response to
- Page 59 and 60: 41 Capítulo II RNA viruses can be
- Page 61 and 62: 43 Capítulo II concordance with it
- Page 63 and 64: % mo rta lity % m ortali ty 45 Cap
- Page 65 and 66: 47 Capítulo II Mortality was signi
- Page 67 and 68: 49 Capítulo II Presence of viruses
- Page 69 and 70: 51 Capítulo II T. cylindrosporum i
- Page 71: 53 Capítulo II in livestock (Polar
- Page 74 and 75: Capítulo III 4. Estudio de la infl
- Page 77 and 78: 59 Capítulo III Mycoviruses infect
- Page 79 and 80: 61 Capítulo III 2006; Herrero et a
- Page 81 and 82: 63 Capítulo III mixed virus infect
- Page 83 and 84: 65 Capítulo III (Zabalgogeazcoa et
- Page 85 and 86:
67 Capítulo III and the LSD proced
- Page 87 and 88:
69 Capítulo III The above results
- Page 89 and 90:
71 Capítulo III DsRNA3 had a lengt
- Page 91 and 92:
73 Capítulo III Fig. 4. Alignment
- Page 93 and 94:
75 Capítulo III DsRNA influence in
- Page 95 and 96:
77 Capítulo III substrate for coni
- Page 97:
79 Capítulo III a hypothetical mem
- Page 100 and 101:
Capítulo IV Resultados 1. Establec
- Page 102 and 103:
Capítulo IV study of this group of
- Page 104 and 105:
Capítulo IV temperatures that osci
- Page 106 and 107:
Capítulo IV of infected leaf piece
- Page 108 and 109:
Capítulo IV The results obtained d
- Page 110 and 111:
Capítulo V Resultados 1. Incidenci
- Page 113 and 114:
95 Capítulo V Molecular characteri
- Page 115 and 116:
97 Capítulo V (Meyling and Eilenbe
- Page 117 and 118:
99 Capítulo V Table 1. B. bassiana
- Page 119 and 120:
101 Capítulo V cDNA synthesis Stra
- Page 121 and 122:
Results 103 Capítulo V Incidence a
- Page 123 and 124:
105 Capítulo V The heterogeneity o
- Page 125 and 126:
107 Capítulo V strains collected f
- Page 127 and 128:
109 Capítulo V Fig. 6. Genome orga
- Page 129 and 130:
111 Capítulo V Fig. 8. Northern bl
- Page 131 and 132:
113 Capítulo V Spain and Portugal
- Page 133:
115 Capítulo V 2010; Wu et al., 20
- Page 137 and 138:
119 Discusión general 3.1. Inciden
- Page 139 and 140:
121 Discusión general La diversida
- Page 141 and 142:
123 Discusión general 2010). Como
- Page 143 and 144:
125 Discusión general En cuanto a
- Page 145 and 146:
127 Discusión general como B. bass
- Page 147:
129 Discusión general micovirus, p
- Page 151 and 152:
133 Conclusiones 1. Los micovirus s
- Page 153:
5. APÉNDICE
- Page 156 and 157:
Apéndice ctctccccggctcgatgctggttga
- Page 158 and 159:
Apéndice 2082 atcgaggtgggtcgtcctgt
- Page 160 and 161:
Apéndice 4629 ctccctccgcaacacaggga
- Page 162 and 163:
Apéndice gcggttgatggtgatctactatact
- Page 164 and 165:
Apéndice S T H K Q L I S T S D Y E
- Page 166 and 167:
Apéndice gtacgcgtcaatggtgttgaaggct
- Page 168 and 169:
Apéndice S V G R P Q G L A N G P S
- Page 170 and 171:
Apéndice S L L I A S S Y S K G L N
- Page 173 and 174:
155 Bibliografía Aarnio, T.H., Aga
- Page 175 and 176:
157 Bibliografía Eusebio-Cope, A.,
- Page 177 and 178:
159 Bibliografía Herrero, N., Pér
- Page 179 and 180:
161 Bibliografía Melzer, M.S., Ike
- Page 181 and 182:
163 Bibliografía Rodríguez, R.J.,
- Page 183 and 184:
165 Bibliografía Urayama, S., Kato
- Page 185:
167 Bibliografía Zhang, X, Nuss, D