TESIS NOEMI HERRERO.pdf - Consejo Superior de Investigaciones ...

More documents

Recommendations

Info

Apéndice gcggttgatggtgatctactatactactggaaggagaatttaactcttttcggctgcggc acatacttactaacggaagattactacaacgctgtgcagttgatggctttagtgacggca ccaggctacagtgacaatgagataagcgagcgattagcatactacgcgactgcgcttgct aacagcaatatgatgaattactagagcgtcatagtgcgaagacaggaattcaaaagaatt tctacc --- Codón de inicio --- Codón de parada ORF 1 – RNA polimerasa dependiente de RNA (RdRp) 46 atggctattaaattttctacggctagcgcgttctcagaacagaaa M A I K F S T A S A F S E Q K 91 gcaacaatgggtgcatcgtacattggtgagccgtcaggcgcaggc A T M G A S Y I G E P S G A G 136 acactattgatgccaaatgagcgagaaaggatcggggtcggcaaa T L L M P N E R E R I G V G K 181 cttcacatgcatgcagttgtgctgccagtgttatgcggaaagagt L H M H A V V L P V L C G K S 226 ctgatgtgccacaagttcagtggatatgacattgacgacatcgtg L M C H K F S G Y D I D D I V 271 gtgaatgaggaagcattcaagtgcgatcaagagtgggaagagatg V N E E A F K C D Q E W E E M 316 attgacgcacgggaacggggctatttcggtggcgataactccggc I D A R E R G Y F G G D N S G 361 tacctcacatcaaatcgcataatgctacggcgggcgcgtaggttt Y L T S N R I M L R R A R R F 406 ttcgacttgtttgtgggggatggcaacgcgcctgtgttatacgtg F D L F V G D G N A P V L Y V 451 caaacagccgagatggcagaggcacttggagcagagatcatctat Q T A E M A E A L G A E I I Y 496 gtgggtagtgttgctcgtggagtggccgcggcgacgccacgttat V G S V A R G V A A A T P R Y 541 caggcactgtctgacgaggagcaacgtttgatgctgaagcttctg Q A L S D E E Q R L M L K L L 586 atagagcaggacaatgctaatgaggtgtattgcgcacgacacgga I E Q D N A N E V Y C A R H G 631 ctacagtatgacggcatatctaacggttacgaggtacaggcacaa L Q Y D G I S N G Y E V Q A Q 676 cgtgtatcggaacggttgcgtcgctgcggtttgaacgcattgacg R V S E R L R R C G L N A L T 721 tcagcatcgcaagacgcgcttgacaggctataccttgagacttct S A S Q D A L D R L Y L E T S 766 tttcgtgggcggctgaatcaatcatgtgcgattgcatgtaacgca F R G R L N Q S C A I A C N A 811 gagttaactgggtgggtcagggctgtggccgcccgtgaggcgcaa E L T G W V R A V A A R E A Q 856 gtgcttgtcggcgctgcgttaccacaaggtgcgggccaagtgcat V L V G A A L P Q G A G Q V H 901 aatcatgtgcgatgggctcgagtgatacacgctctggaacagcat N H V R W A R V I H A L E Q H 946 gcactagcagttgttccgggccctaagcctgtgcgcaccagatgg A L A V V P G P K P V R T R W 991 agcgagaagtttccatacggaccagggaatgctaaattcgctctc S E K F P Y G P G N A K F A L 1036 gccaagataggtgactttctcgaatccgtatcggagagggattat A K I G D F L E S V S E R D Y 1081 caaaatgggtacgcgtggttccggcaactactgaaccgtgatgat 144
Q N G Y A W F R Q L L N R D D 1126 tgctcgtatgaacgcgcattgtgccacttgattatgggtgatgtt C S Y E R A L C H L I M G D V 1171 tggtgctatgtcgcccccgagttgaaaccgctcgtggaaagtctc W C Y V A P E L K P L V E S L 1216 agaataggcggcttagctccattggtgttcgctgaggtgtgtaaa R I G G L A P L V F A E V C K 1261 gggattcacacattggtccgcgacactaagtcgatgctcggtgcg G I H T L V R D T K S M L G A 1306 gctctaaacactcatggactagcgctgtgtacgtacttcgattgt A L N T H G L A L C T Y F D C 1351 ctcgctggccgctacttcggtgaaggcgatatagagaaggagata L A G R Y F G E G D I E K E I 1396 catgaccgtacggtgtcgcttgagcctcggcactttataatgcct H D R T V S L E P R H F I M P 1441 gatggcagcaaatccgaggctgagtttgacatgcggttcaagaat D G S K S E A E F D M R F K N 1486 gctgtagctgatgtgttgcactccacactagttgacggtggtgct A V A D V L H S T L V D G G A 1531 cgcatattacgagccagcaaaataacaaagagctttgacacgttc R I L R A S K I T K S F D T F 1576 ttggagcaccgtaaagcgtgggtgaggcctgggtctgtaactggc L E H R K A W V R P G S V T G 1621 agcccgaaaactgatgtgtatatcaaggtggtcggtgatagagag S P K T D V Y I K V V G D R E 1666 atggggatacgcgaggttgcggatgatctgcatatgatgggtacg M G I R E V A D D L H M M G T 1711 tatgtgctatctagagttagacttaacaaggctgctacctttgag Y V L S R V R L N K A A T F E 1756 tttgagaagtttccggaactggtgcgcgattgcataggtgattac F E K F P E L V R D C I G D Y 1801 gtgcccaatagcttcacacgacacttcataaagaacgagattgcg V P N S F T R H F I K N E I A 1846 aaagtgaagggtcgagcattgttcccgtctcacgttgtgcactac K V K G R A L F P S H V V H Y 1891 atcgttgggacatatgtgctccaactactcatgaaggcagcgcct I V G T Y V L Q L L M K A A P 1936 attgaacacgcacgactgataccggatgaggcaacaccgagagac I E H A R L I P D E A T P R D 1981 gagcactggatgtggatggaagcgcgtgacttcaccgtagggctg E H W M W M E A R D F T V G L 2026 atgctcgattacgacgacttcaacgaaagccacgaaattcgcgac M L D Y D D F N E S H E I R D 2071 atgcagatgattattaattcgcttaagggcgtttaccgcagggcg M Q M I I N S L K G V Y R R A 2116 ggtgctttaagccccgatctgtcggctatgatagattgggtggtg G A L S P D L S A M I D W V V 2161 gaagcgtacgaaaagatggtgtttgaattcgacgggaagcagtac E A Y E K M V F E F D G K Q Y 2206 cacttcctgcatggcatgctgtcagggcaagcacctacgtcaatg H F L H G M L S G Q A P T S M 2251 ataaacacagtcatcaacaccgcaaacaaaagggttatccgcgag I N T V I N T A N K R V I R E 2296 caaatatttgcgctatttggtgagagcgtgatgacaaaaaggact Q I F A L F G E S V M T K R T 2341 tcagggggcgacgatgttgctgcggagacatatgatgttttccag S G G D D V A A E T Y D V F Q 2386 gcagcgatgatagtgaaagtcggggagatgatgggcttcgcgttc A A M I V K V G E M M G F A F 2431 agcacacacaagcagttgataagcacgagtgattacgagttcttc 145 Apéndice
Page 1:
UNIVERSIDAD DE SALAMANCA FACULTAD D
Page 5:
DR. ÍÑIGO ZABALGOGEAZCOA GONZÁLE
Page 9:
DR. ÁNGEL DOMÍNGUEZ OLAVARRI, DIR
Page 13:
A mi familia: Mil gracias a mis pad
Page 17 and 18:
Página 1. INTRODUCCIÓN GENERAL
Page 19:
1. INTRODUCCIÓN GENERAL
Page 22 and 23:
Introducción general como ocurre e
Page 24 and 25:
Introducción general a hongos endo
Page 26 and 27:
Introducción general El proceso de
Page 28 and 29:
Introducción general Beauveria es
Page 30 and 31:
Introducción general micovirus dat
Page 32 and 33:
Introducción general Los micovirus
Page 35:
2.OBJETIVOS, METODOLOGÍA, RESULTAD
Page 38 and 39:
Objetivos, metodología, resultados
Page 40 and 41:
Capítulo I Objetivos 1. Estudio de
Page 43 and 44:
Brief Report 25 Capítulo I Mycovir
Page 45 and 46:
27 Capítulo I treated with DNase I
Page 47 and 48:
29 Capítulo I Torrubiella confrago
Page 49 and 50:
31 Capítulo II CAPITULO II. Patoge
Page 51:
33 Capítulo II 2. Efecto de la tem
Page 54 and 55:
Capítulo II Introduction The funga
Page 56 and 57:
Capítulo II Materials and methods
Page 58 and 59:
Capítulo II 10 7 spores from each
Page 60 and 61:
Capítulo II Fig. 1. Dendrogram bui
Page 62 and 63:
% mortality % morta li ty Capítulo
Page 64 and 65:
Capítulo II Fig. 4. A. Mortality (
Page 66 and 67:
Capítulo II tick species there wer
Page 68 and 69:
Capítulo II Table 5. T. cylindrosp
Page 70 and 71:
Capítulo II not viable at 30 ºC.
Page 73 and 74:
55 Capítulo III CAPITULO III. Mico
Page 75:
57 Capítulo III 3. Curación de mi
Page 78 and 79:
Capítulo III Introduction The asco
Page 80 and 81:
Capítulo III Fig. 1. A. Electropho
Page 82 and 83:
Capítulo III Table 1. EMBL nucleot
Page 84 and 85:
Capítulo III Electron microscopy F
Page 86 and 87:
Capítulo III Results Transmission
Page 88 and 89:
Capítulo III ScV-LA and ScV-L BC (
Page 90 and 91:
Capítulo III Fig. 3. A Phylogeneti
Page 92 and 93:
Capítulo III A sucrose gradient vi
Page 94 and 95:
Capítulo III High temperature did
Page 96 and 97:
Capítulo III Therefore, TcV1 may a
Page 99 and 100:
81 Capítulo IV CAPITULO IV. Capaci
Page 101 and 102:
83 Capítulo IV Endophytic establis
Page 103 and 104:
85 Capítulo IV strains employed in
Page 105 and 106:
87 Capítulo IV To test whether the
Page 107 and 108:
89 Capítulo IV Both T. cylindrospo
Page 109 and 110:
91 Capítulo V CAPITULO V. Caracter
Page 111: 93 Capítulo V Por otro lado, la di
Page 114 and 115: Capítulo V Introduction Viruses ha
Page 116 and 117: Capítulo V Materials and Methods F
Page 118 and 119: Capítulo V Table 2. Isolates of B.
Page 120 and 121: Capítulo V Table 4. EMBL nucleotid
Page 122 and 123: Capítulo V Fig. 2. Dendrogram cons
Page 124 and 125: Capítulo V consisting of three ele
Page 126 and 127: Capítulo V Transmission of dsRNA e
Page 128 and 129: 53 44 Capítulo V Fig. 7. Neighbor-
Page 130 and 131: Capítulo V and 8). Mixed mycovirus
Page 132 and 133: Capítulo V cylindrosporum, another
Page 135: 3. DISCUSIÓN GENERAL
Page 138 and 139: Discusión general gramíneas podr
Page 140 and 141: Discusión general y de distintos h
Page 142 and 143: Discusión general luego TcV1 y BbR
Page 144 and 145: Discusión general 3.3. Naturaleza
Page 146 and 147: Discusión general al., 2006). No o
Page 149: 4.CONCLUSIONES
Page 152 and 153: Conclusiones 6. T. cylindrosporum e
Page 155 and 156: 137 Apéndice Apéndice 1. Secuenci
Page 157 and 158: 732 cgcggcggcgccgggctggtcgtcaacgctg
Page 159 and 160: 3279 aaggcccttggctggaactccactctcccc
Page 161: Apéndice 2. Secuencia completa de
Page 165 and 166: 147 Apéndice Apéndice 3. Secuenci
Page 167 and 168: A A G R P I I V N A L G T F D 894 g
Page 169 and 170: P S K L T G E L I D V D P D T 3482
Page 171: 6.BIBLIOGRAFÍA
Page 174 and 175: Bibliografía Bottacin, A.M., Léve
Page 176 and 177: Bibliografía Ghabrial, S.A., Jiang
Page 178 and 179: Bibliografía Jiang, D.H., Ghabrial
Page 180 and 181: Bibliografía Park, Y.J., Chen, X.B
Page 182 and 183: Bibliografía Segers, G. Zhang, X.
Page 184 and 185: Bibliografía Wicklow, D.T., Roth,
show all

TESIS NOEMI HERRERO.pdf - Consejo Superior de Investigaciones ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?