Vol 9 No1 - Journal of Cell and Molecular Biology - Haliç Üniversitesi

22 Sazia SHARMIN et al.
2005; Yan et al. 2005) based on their mode of
function. Identification of these genes may lead to
the development of commercial crops, which are
better suited to grow in a particular unfavourable
condition. Due to cross-species transferability of
gene functions, this improvement can be achieved
in non-source plant species as well.
Jute (Corchorus olitorius L.) is the most
important bast fibre producing plant (Kundu, 1956).
It is the major fibre producing plant of Bangladesh
(Hossain et al. 2003) and one of the major fibre
crops of the Indian subcontinent (Basu et al. 2004).
The production quality and yield of this
economically important crop is affected by several
biotic e.g. fungi, pest, insect, nematode, virus, mite
(BBS, 2004; Ghosh, 1983; Keka et al. 2008) and
abiotic factors e.g. salinity, submergence and low
temperature (Hossain et al. 2003; Samira et al.
2010). Thus, development of jute varieties with
increased resistance to both biotic and abiotic stress
conditions have considerable economic importance.
In spite of its enormous commercial value, only
a few genes or part of genes from jute have been
identified or sequenced (Ahmed et al. 2009; Alam
et al. 2010; Islam et al. 2005; Mahmood et al.
2010; Samira et al. 2010; Wazni et al. 2007). Here
we report a novel transcript from Corchorus
olitorus var. 9897 responsive to dehydration stress.
Search for known homologues failed to identify
functionally characterized counterparts in any other
plant species.
Materials and methods
Stress treatment of plant seedlings
Plant seeds were incubated at room temperature in
the absence of light for two days in petri dishes in
the presence of water only. Germinated plant
seedlings were subjected to different stress
conditions such as low temperature, dehydration,
fungus and abscisic acid (ABA) beginning third
day of their germination according to methods
described by Alam and co-workers (Alam et al.
2010). Fungus treatment was done by spraying
suspension of Macrophomina phaseolina on the
plate with germinated seedlings (Alam et al. 2010;
Mahmood et al. 2010). For dehydration treatment,
the seedlings were treated with 50 mM manitol to
create an environment similar to water deficit
condition. The concentration of manitol was
increased to 100 mM on day 5 (Alam et al. 2010).
Salt stress was applied by adding 50 mM NaCl to
the plate on day 3. The concentration was increased
by 50 mM per day, reaching to 150 mM NaCl on
day 5 (Alam et al. 2010). Low temperature
treatment was carried out by growing the seedlings
at 14 O C in an incubator from day 3 (Alam et al.
2010).
Isolation of DNA and RNA
Genomic DNA from different Corchorus species
was isolated using the CTAB method (Murray and
Thompson, 1980). RNA was isolated using
TRIZOL reagent (Invitrogen) according to the
provided manual. For tissue specific RNA isolation,
leaf, stem and root was cut into pieces, ground in
liquid N2. RNA was isolated from ground tissue
using TRIZOL reagent (Invitrogen) as per
manufacturer’s instruction
Identification of the dehydration responsive
transcript
The transcript was identified as an additional band
while carrying out RT (Reverse Transcriptase)-
PCR of a cold stress responsive gene, LDLP (Low
density lipoprotein like protein) from C. olitorius
using the primer RevP (unpublished result). RT-
PCR was carried out using RNA isolated from C.
olitorius grown under normal condition. This
additional band was extracted from agarose gel
using QIAGEN MinElute Gel Extraction Kit and
sequenced (1 st Base PTE Singapore) using ForP
and RevP as primers. Gene specific primers
(GSPF1, GSPR1 and GSPR2) for the transcript was
designed using Primer3Plus (Untergasser et al.
2007). Sequences of primers are given in Table 1.
These primers were used to sequence partial CDS
(coding sequence) of drp from C. capsularis, C.
tridens, C. aestuans, C. pseudo-olitorius, C.
trilocularis.
Table 1. Primers used in the study
Primer Sequence
ForP 5’- ATACTTATGGGAGAATGAAAG -3’
RevP 5’- TACAGGTAAAATGTCACCAA -3’
GSP-R1 5’- GAGGCTTTTCTTGGAAC -3’
GSP-R2 5’- GTCCCGATCCCTTGAATTAC -3’
GSP-F1 5’- CTTAATCGGAGCAGGGTGAG -3’