10 1 Full Volume (PDF)(jcmb.halic.edu.tr) - Journal of Cell and ...

jcmb.halic.edu.tr

10 1 Full Volume (PDF)(jcmb.halic.edu.tr) - Journal of Cell and ...

Journal of Cell and

Molecular Biology

• Sulfabenzamide promotes autophagy through p53/ DRAM pathway

MGP polymorphisms in ischemic stroke

trong>Volumetrong> trong>10trong> · No 1· June 2012

http://trong>jcmbtrong>.trong>halictrong>.trong>edutrong>.tr

Survivin -625G/C polymorphism in non-small cell lung cancer


Journal of Cell and

Molecular Biology

trong>Volumetrong> trong>10trong> · Number 1

June 2012

İstanbul-TURKEY


Haliç University

Faculty of Arts and Sciences

Journal of Cell and Molecular Biology

Founder

Gündüz GEDİKOĞLU

Our Children Leukemia Foundation

Rights held by

A. Sait SEVGENER

Rector

Correspondence Address:

Journal of Cell and Molecular Biology

Haliç Üniversitesi

Fen-Edebiyat Fakültesi,

Sıracevizler Cad. No:29 Bomonti 34381 Şişli

İstanbul-Turkey

Phone: +90 212 343 08 87

Fax: +90 212 231 06 31

E-mail: trong>jcmbtrong>@trong>halictrong>.trong>edutrong>.tr

Journal of Cell and Molecular Biology is

indexed in

ULAKBIM, EBSCO,

DOAJ, EMBASE,

CAPCAS, EMBiology,

Socolar, Index COPERNICUS,

Open J-Gate, Chemical Abstracts

and

Genamics JournalSeek

ISSN 1303-3646

Printed at MART Printing House

Editor-in-Chief

Nagehan ERSOY TUNALI

Editorial Board

M. YOKEŞ

Baki

ÖZDİLLİ

Kürşat

Nural BEKİROĞLU

Emel BOZKAYA

M.Burcu IRMAK YAZICIOĞLU

Mehmet OZANSOY

Aslı BAŞAR

Editorial Assistance

Ozan TİRYAKİOĞLU

Özlem KURNAZ

Advisory Board

A.Meriç ALTINÖZ, Istanbul, Turkey

Tuncay ALTUĞ, İstanbul, Turkey

Canan ARKAN, Munich, Germany

Aglaia ATHANASSIADOU, Patras, Greece

E. Zerrin BAĞCI, Tekirdağ, Turkey

Şehnaz BOLKENT, İstanbul, Turkey

Nihat BOZCUK, Ankara, Turkey

A. Nur BUYRU, İstanbul, Turkey

Kemal BÜYÜKGÜZEL, Zonguldak, Turkey

Hande ÇAĞLAYAN, İstanbul, Turkey

İsmail ÇAKMAK, İstanbul, Turkey

Ayla ÇELİK, Mersin, Turkey

Adile ÇEVİKBAŞ, İstanbul, Turkey

Beyazıt ÇIRAKOĞLU, İstanbul, Turkey

Fevzi DALDAL, Pennsylvania, USA

Zihni DEMİRBAĞ, Trabzon, Turkey

Gizem DİNLER DOĞANAY, İstanbul, Turkey

Mustafa DJAMGÖZ, London, UK

Aglika EDREVA, Sofia, Bulgaria

Ünal EGELİ, Bursa, Turkey

Anne FRARY, İzmir, Turkey

Hande GÜRER ORHAN, İzmir, Turkey

Nermin GÖZÜKIRMIZI, İstanbul, Turkey

Ferruh ÖZCAN, İstanbul, Turkey

Asım KADIOĞLU, Trabzon, Turkey

Maria V. KALEVITCH, Pennsylvania, USA

Nevin Gül KARAGÜLER, İstanbul, Turkey

Valentine KEFELİ, Pennsylvania, USA

Meral KENCE, Ankara, Turkey

Fatma Neşe KÖK, İstanbul, Turkey

Uğur ÖZBEK, İstanbul, Turkey

Ayşe ÖZDEMİR, İstanbul, Turkey

Pınar SAİP, Istanbul, TURKEY

Sevtap SAVAŞ, Toronto, Canada

Müge TÜRET SAYAR, İstanbul, Turkey

İsmail TÜRKAN, İzmir, Turkey

Mehmet TOPAKTAŞ, Adana, Turkey

Meral ÜNAL, İstanbul, Turkey

İlhan YAYLIM ERALTAN, İstanbul, Turkey

Selma YILMAZER, İstanbul, Turkey

Ziya ZİYLAN, İstanbul, Turkey


Journal of Cell and Molecular Biology

CONTENTS

trong>Volumetrong> trong>10trong> · Number 1 · June 2012

Review Article

Production and industrial applications of laccase enzyme

M. IMRAN, M.J. ASAD, S.H. HADRI, S. MEHMOOD

Research Articles

Isolation and biochemical identification of Escherichia coli from

wastewater effluents of food and beverage industry

T. FARASAT, Z. BILAL, F. YUNUS

Investigation of the MGP promoter and exon 4 polymorphisms in

patients with ischemic stroke in the Ukrainian population

A.V. ATAMAN, V.Y. GARBUSOVA, Y.A. ATAMAN, O.I. MATLAJ,

O.A. OBUCHOVA

Investigation of the association of survivin gene -625G/C polymorphism

in non-small cell lung cancer

Survivin geni -625G/C polimorfizminin Küçük Hücreli Dışı Akciğer

Kanseri ile ilişkisinin araştırılması

E. AYNACI, E. COŞKUNPINAR, A. EREN, O. KUM, Y. M. OLTULU, N.

AKKAYA, A. TURNA, İ. YAYLIM, P. YILDIZ

Effects of prenatal and neonatal exposure to lead on white blood cells in

Swiss mice

R. SHARMA, K. PANWAR, S. MOGRA

Sulfabenzamide promotes autophagic cell death in T-47D breast cancer

cells through p53/ DRAM pathway

R. MOHAMMADPOUR, S. SAFARIAN, S. FARAHNAK, S.

HASHEMINASL, N. SHEIBANI

Media optimization for amylase production in solid state fermentation

of wheat bran by fungal strains

M. IRFAN, M. NADEEM, Q. SYED

Guidelines for Authors

Front cover image: “DNA strands on abstract”

Shutterstock image ID: 704trong>10trong>25

1

13

19

27

33

41

55

65


Journal of Cell and Molecular Biology trong>10trong>(1): 1-11, 2012 Review Article 1

Haliç University, Printed in Turkey.

http://trong>jcmbtrong>.trong>halictrong>.trong>edutrong>.tr

Production and industrial applications of laccase enzyme

Muhammad IMRAN *1,2 , Muhammad J. ASAD 1 , Saqib H. HADRI 1 and Sajid

MEHMOOD 2

1 Department of Biochemistry, Pir Mehr Ali Shah Arid Agriculture University, Rawalpindi, Pakistan

2 Department of Biochemistry and Biotechnology, University of Gujrat, Pakistan

(* author for correspondence; mirzaimran42@gmail.com)

Received: 22 April 2011; Accepted: 15 May 2012

Abstract

Laccase is an enzyme that has potential ability of oxidation. It belongs to those enzymes, which have innate

properties of reactive radical production, and its utilization in many fields has been ignored because of its

unavailability in the commercial field. There are diverse sources of laccase producing organisms like

bacteria, fungi and plants. Textile, pulp and paper industries discharge a huge quantity of waste in the

environment, and the disposal of this waste is a big problem. To solve this problem, work has done to

discover such an enzyme, which can detoxify these wastes and is not harmful to the environment. Laccases

use oxygen and produce water as by product. They can degrade a range of compounds including phenolic and

non-phenolic compounds. They also have ability to detoxify a range of environmental pollutants. Their

property to act on a range of substrates and also to detoxify a range of pollutants have made them to be

usable for several purposes in many industries including paper, pulp, textile and petrochemical industries.

Keywords: Laccase, solid state fermentation, oxidation, enzyme, fungi.

Lakkaz enziminin üretimi ve endüstriyel uygulamaları

Özet

Lakkaz, potansiyel oksidasyon yeteneği olan bir enzimdir. Reaktif radikal üretim özelliği olan enzimlere

dahildir ve birçok alandaki kullanımı, ticari alanda uygun olmaması nedeniyle göz ardı edilmektedir. Bakteri,

mantar ve bitki gibi lakkaz üreten çeşitli organizma kaynakları vardır. Tekstil, kağıt hamuru ve kağıt

endüstrisi çevreye büyük miktarda atık salmaktadır ve bu atıkların uzaklaştırılması büyük bir problemdir. Bu

sorunu çözmek üzere, atıkları detoksifiye eden ve çevreye zararlı olmayan bir enzim keşfetmek için

çalışmalar yapılmıştır. Bu enzim oksijen kullanır ve yan ürün olarak su üretir. Lakkaz, fenolik ve fenolik

olamayan bileşikleri içeren bir dizi bileşiği parçalayabilir. Ayrıca, bir dizi çevresel kirleticiyi detoksifiye

etme yeteneği vardır. Çeşitli substratlar üzerine etki etme ve ayrıca bir dizi kirliliği detoksifiye etme özelliği,

bu enzimleri çeşitli amaçlarla tekstil, kâğıt hamuru, kâğıt ve petrokimya endüstrisini kapsayan birçok

endüstride kullanılabilir kılmaktadır.

Anahtar kelimeler: Lakkaz, katı hal fermentasyonu, oksidasyon, enzim, mantarlar.

Introduction

Laccase was first discovered in the sap of the

Japanese lacquer tree Rhus vernicifera, and its

characteristic as a metal containing oxidase was

discovered by Bertrand in 1985 (Giardina et al.,

20trong>10trong>). Since then, laccases have also been found in

various basidiomycetous and ascomycetous fungi

and thus far fungal laccases have accounted for the

most important group of multicopper oxidases

(MCOs) with respect to number and extent of

characterization (Giardina et al., 20trong>10trong>).

The large quantity of laccases have been widely

reported inside white-rot fungi. A number of


2Muhammad IMRAN et al.

laccase genes have been isolated and distinguished

for this purpose (Mayer and Staples, 2002). The

improvement in laccase appearance, characterized

by an increase in protein and mRNA level, was

illustrated with Picnoprus cinnabarinus, Pleurotus

sajor caju and Trametes versicolor (Eggert et al.

1996, Solden and Dobson 2001, Collins and

Dobson 1997).

A number of species of genus Pleurotus have

been explained as manufacturers of laccase

(Leonowicz et al. 2001). We freshly reported that a

strain of P. pulmonarius produce laccase as the

main ligninolytic enzymes while cultured on wheat

bran solid state medium (Souza et al. 2002). In the

current study, numerous phenolic and aromatic

compounds structurally related to lignin were

calculated for their capability to arouse laccase

production by P. pulmonarius. (Solden and

Dobson, 2001).

P. pulmonarius was proficient of mounting on a

wide variety of phenolic and aromatic compounds.

Laccase production by P. pulmonarius could be

considerably improved by including an equimolar

combination of ferulic acid and vanillin as inducer.

The construction of different laccase isoform in

reply to phenolics implicates a possible task of this

enzyme in the detoxification processes (Souza et

al., 2002)

Numerous white-rot fungi, counting Trametes

versicolor, make extra cellular copper-containing

phenol oxidases (E C 1.trong>10trong>.3.2), named laccases

(Birhanli and Yesilada, 2006). The two major likely

natural functions attributed to fungal laccases are,

first, their participation in lignin degradation,

mutually with supplementary ligninolytic enzymes

such as peroxidases, and second, their function in

fungal virulence as key cause in pathogenesis in

opposition to plant hosts (Gianfreda et al., 1999).

As well, laccases display in vivo other functions

that are the foundation of several industrial

applications. For instance, in Aspergillus nidulans,

laccases take action on pigment development in

fungal spores (Smith et al., 1997). A number of

fungi also ooze laccases to take away either

potentially toxic phenols released through lignin

degradation or toxins formed by others organisms.

As a result, the enzyme has probable applications in

the textile industries, dye, as well as for the

degradation of a variety of xenobiotics, which are

recognized as ecological pollutants (Rama et al.

1998, Jolivalt et al. 1999, Mougin et al., 2000).

Laccase-producing fungi have also been

reported to be helpful apparatus for xenobiotic

removal in liquid effluents as well as in soil

bioremediation (Gianfreda et al. 1999, Jolivalt et al.

2000). Our outcomes demonstrate that the resulting

alteration products themselves are likely to

encourage biological effects moreover on

degrading or non-target organisms. So, an entire

characterization of these compounds is essential for

an entire assessment of the remediation processes

(Souza et al., 2002).

Laccase represents a family of coppercontaining

polyphenol oxidases (PPO) & are

usually called multicopper oxidases (MCO)

(Birhanli and Yesilada, 2006; Arora and Sharma,

20trong>10trong>; Giardina et al., 20trong>10trong>). Laccases catalyze the

oxidation of various substituted phenolic

compounds by using molecular oxygen as the

electron acceptor (Sharma et al., 2007). These

enzymes have less substrate specificity and have

the ability to degrade a range of xenobiotics

including industrial colored wastewaters (Souza et

al., 2006).

Laccases exhibit broad substrate range, which

varies from one laccase to another. Although it is

known to be diphenol oxidase, monophenols like 2,

6-dimethoxy phenol or guaiacol are better

substrates than phenols (e.g., catechol or

hydroquinone) (Baldrian, 2006; Arora and Sharma,

20trong>10trong>).

Laccases catalyze monoelectronic oxidation of

molecules to corresponding reactive radicals with

the help of four copper atoms, which form the main

catalytic core of the laccase, accompanied with the

diminution of oxygen to water molecules and

simultaneous oxidation of substrate to produce

radicals (Arora and Sharma, 20trong>10trong>). All substrates

cannot be directly oxidized by laccases, either

because of their large size which restricts their

penetration into the enzyme active site or because

of their particular high redox potential. To

overcome this hindrance, suitable chemical

mediators are used which are oxidized by the

laccase and their oxidized forms are then able to

interact with high redox potential substrate targets

(Arora and Sharma, 20trong>10trong>).

In fungi, laccases carry out a variety of

physiological roles including morphogenesis,

fungal plant pathogen/host interaction, stress

defense, and lignin degradation (Gianfreda et al.,

1999; Giardina et al., 20trong>10trong>). Laccases have been

found in nearly all woodrotting fungi analyzed so

far (Heinzkill and Messner, 1997; Giardina et al.,

20trong>10trong>) and are almost ubiquitary enzymes as they

have been isolated from plants, from some kinds of

bacteria, and from insects too (Enguita et al., 2003;

Sharma et al., 2007; Giardina et al., 20trong>10trong>).


Laccase has many applications in other fields,

like medical diagnosis, pharmaceutical industry.

Laccase has also applications in the agriculture area

by clearing herbicides, pesticides and some

explosives in soil. It is also used in the preparation

of some important drugs, like anticancer drugs, and

added in some cosmetics to rtrong>edutrong>ce their toxicity.

Laccase also has the ability to form polymers of

value able importance (Couto and Herrera, 2006).

Solid state fermentation (SSF) is a technique in

which fungi are grown on solid substrate or

substrate moistened with a low quantity of mineral

salt solution and it has a great potential to produce

enzyme especially where the fermented raw

materials are used as a source of nutrients for the

fungi. The enzymes produced by this method have

several applications in several fields including food

and fermentation industry. These enzymes are also

used to prepare several bioactive compounds. SSF

system is much better than the submerged system

because a number of reasons. The benefits of SSF

over SMF include the high production of the

enzyme, and fewer effluent generation. Moreover,

comparably simple equipment is required for SSF

(Pandey, 1994).

Neurospora is a genus of kingdom fungi that

has become a popular experimental model

organism (Davis et al., 2002). Laccases have

copper atoms at their catalytic sites and are

oxidative enzymes (EC 1.trong>10trong>.3.2) which are widely

found in many species of fungi, where they are

involved in lignin degradation, in higher plants

where they are involved in biosynthesis of lignin

(Mayer and Staples, 2002; Sharma and Kuhad,

2008), in bacteria (Claus, 2003; Liers et al., 2007),

and in insects (Litthauer et al., 2007). Some species

of fungi and insects produce laccases as

intracellular proteins, but most of the laccases are

produced as extracellular proteins by all other types

of producers (Arora and Sharma, 20trong>10trong>).

Laccase production in various organisms

Production of laccase in fungi

Laccase production occurs in various fungi over a

wide range of taxa. Fungi from the deuteromycetes,

ascomycetes (Aisemberg et al., 1989) as well as

basidiomycetes are the known producers of laccase

(Sadhasivam et al., 2008). Among them,

basidiomycetes are considered efficient laccase

producers, especially white rot fungi (Revankar and

lele, 2006; Sadhasivam et al., 2008). Laccase

production has not been reported in lower fungi,

Production and industrial applications of laccase 3

i.e., Zygomycetes and Chytridiomycetes. However,

these groups have not yet been studied in detail

(Arora and Sharma, 20trong>10trong>).

Trametes versicolor, Chaetomium

thermophilum and Pleurotus eryngii are well

known producers of laccase. It has been reported

that some Trichoderma species, including T.

harzianum has the ability to produce polyphenol

oxidases (Kiiskinen et al., 2004; Sadhasivam et al.,

2008).

Laccase has been produced by many species of

soft, white rot fungi, geophilous saprophytic fungi.

Laccase has also been produced by many edible

mushrooms including the oyster mushroom

Pleurotus ostreatus, the rice mushroom Lentinula

edodes and champignon Agaricus bisporus. Other

laccase producers of wood-rotting fungi include T.

hirsuta (C. hirsutus), T. villosa, T. gallica, Cerrena

maxima, Lentinus tigrinus, T. ochracea, Pleurotus

eryngii, Trametes (Coriolus) versicolor,

Coriolopsis polyzona, etc. (Morozova et al., 2007).

In fungal physiology, laccases are involved in plant

pathogenesis, pigmentation, detoxification, lignin

degradation (Sadhasivam et al., 2008) and also in

development of morphogenesis of fungi (Baldrian,

2006; Morozova et al., 2007).

Laccases of wood-colonizing basidiomycetes

(white rot fungi) have been thoroughly studied (not

least also with respect to laccase-mediator

interaction), and many of them purified and

characterized on the protein and gene level (Liers et

al., 2007).

Mishra et al. (2008) have used cyanobacterial

biomass of water bloom, groundnut shell (GNS)

and dye effluent as culture medium for the

production of laccase by Coriolus versicolor. They

found the laccase production to be trong>10trong>.15±2.21

U/ml in the medium having groundnut shell and

cyanobacterial bloom in a ratio of 9:1 (dry weight

basis) at initial pH 5.0 and 28±2 o C temperature.

Half life of enzyme was 74 min at 60 o C. Kinetic

analysis of laccase with ABTS were also

determined, Km and Vmax were found to be 0.29mM

and 9.49mol/min respectively. Azide and

hydroxylamine exerted significant inhibition on

production of thermostable laccase.

It is reported that Phanerochaete chrysosporium

NCIM 1197 also secretes extracellular laccase.

They also studied effect of several inducers on the

production of laccase. Among several inducers

tested copper sulphate has the greatest tendency to

enhance the produce of laccase. Laccase production

increased 3.5 fold in the presence of copper sulfate


4Muhammad IMRAN et al.

as compared to control. Laccase production under

SSF, batch fermentation in a laboratory scale

bioreactor and static liquid culture was also

compared. The maximum production of laccase

was achieved after five days and it was found to be

48.89±1.82 U/L, 30.21±1.66 and 22.56±1.22 U/L,

respectively (Gnanamani et al., 2006).

The white-rot fungus Trametes pubescens MB

89 is a source of the laccase production at industrial

level. Extracellular laccase formation is

considerably enhanced by the addition of Cu (II) in

the low quantities in the simple glucose medium.

When using glucose, a typically repressing

substrate, as the main carbon source, significant

laccase formation by T. pubescens only started

when glucose was completely consumed from the

culture medium. In addition, the nitrogen source

employed had an important effect on laccase

synthesis. When using an optimized medium

containing glucose (40 g/L), peptone from meat (trong>10trong>

g/L), and MgSO4.7H2O and stimulating enzyme

formation by the addition of 2.0 mM Cu, maximal

laccase activities obtained in a batch cultivation

were approximately 330 U ml – l (Galhaup et al.,

2002).

Production of laccase in plants

Laccases are a diverse group of multi-copper

proteins with broad substrate specificity, originally

discovered in the exudates of Rhus vernicifera, the

Japanese lacquer tree and subsequently

demonstrated as a fungal enzyme as well (Sharma

and Kuhad, 2008). The plants in which the laccase

enzyme has been detected include lacquer, mango,

mung bean, peach, pine, prune, and sycamore

(Arora and Sharma, 20trong>10trong>). Techniques are also

being developed to express laccase in the crop

plants. Recently, laccase has been expressed in the

embryo of maize (Zea mays) seeds (Bailey et al.,

2004; Arora and Sharma, 20trong>10trong>).

Laccase is envolved in polymerization of lignin

units; p coumaryl, coniferyl, sinapyl alcohols and in

the synthesis of lignin in the plants (Morozova et

al., 2007). If the comparison between plant and

fungal laccases is taken up, the former takes part in

radical-based polymerization of lignin (Ranocha et

al., 2002; Arora and Sharma, 20trong>10trong>), whereas fungal

laccase contributes to lignin biodegradation due to

which it has gained considerable significance in

green technology (Arora and Sharma, 20trong>10trong>).

Production of laccase in bacteria

Laccase in bacteria is present intracellularly and as

periplasmic protoplast (Claus, 2003; Arora and

Sharma, 20trong>10trong>). The first bacterial laccase was

found in the plant root associated bacterium,

Azospirillum lipoferum (Givaudan et al., 1993;

Sharma et al., 2007; Sharma and Kuhad, 2008),

where it was shown to be involved in melanin

formation (Faure et al., 1994; Sharma and Kuhad,

2008). Laccase has been discovered in a number of

bacteria including Bacillus subtilis, Bordetella

compestris, Caulobacter crescentus, Escherichia

coli, Mycobacterium tuberculosum, Pseudomonas

syringae, Pseudomonas aeruginosa, and Yersinia

pestis (Alexandre and Zhulin, 2000; Enguita et al.,

2003; Arora and Sharma, 20trong>10trong>). Recently,

Stenotrophomonas maltophilia strain was found to

be laccase producing, which was used to degrade

synthetic dyes (Galai et al., 2008; Arora and

Sharma, 20trong>10trong>).

Laccase containing six putative copper binding

sites were discovered in marine bacterium

Marinomonas mediterranea, but no functional role

was assigned to this enzyme (Amat et al., 2001;

Sharma and Kuhad, 2008). Some of the reported

laccases have the ability to perform the activity at

very crucial conditions like in the presence of high

conc. of Cl - 1 and Cu +2 and even at neutral pH

values. The enzyme produced by Sinorhizobium

meliloti is a one of the examples of such enzymes

and is a protein having two subunits with pI 6.2 and

the molecular weight of the subunits is 45 kDa each

(Morozova et al., 2007), whereas laccase produced

by Pseudomonas putida is also an example of such

enzyme and is a single subunit 59 kDa protein

which works well at pH 7.0 (Morozova et al.,

2007). Both enzymes can oxidize syringaldazine.

Niladevi et al. (2009) used response surface

methodology for the optimization of different

nutritional and physical parameters for the

production of laccase by the filamentous bacteria

Streptomyces psammoticus MTCC 7334 in

submerged fermentation. Incubation temperature,

incubation period, agitationrate, concentrations of

yeast extract, MgSO4.7H2O, and trace elements

were found to influence laccase production

significantly.

A new laccase gene (cotA) was cloned from

Bacillus licheniformis and expressed in Escherichia

coli. The recombinant protein CotA was purified

and showed spectroscopic properties typical for

blue multi-copper oxidases. The enzyme has a

molecular weight of ~65kDa and demonstrates

activity towards canonical laccase substrates 2, 2’azino-bis

(3-ethylnenzothiazoline-6sulphonic acid)

(ABTS), syringaldazine (SGZ) and 2, 6-


dimethoxyphenol (2, 6-DMP). Kinetic constants Km

and kcat for ABTS were of 6.5±0.2 µM and 83s -1 ,

for SGZ of 4.3+0.2 µM and trong>10trong>0s -1 , and for 2, 6-

DMP of 56.7+1.0 µM and 28 s -1 . Highest oxidizing

activities towards ABTS were obtained at 85 o C

(Koschorreck et al., 2009).

Production of laccase in insects

The laccase enzyme has also been characterized in

different insects, e.g., Bombyx, Calliphora,

Diploptera, Drosophila, Lucilia, Manduca, Musca,

Orycetes, Papilio, Phormia, Rhodnius,

Sarcophaga, Schistocerca, and Tenebrio (Arora

and Sharma, 20trong>10trong>).

In insects, laccases have been suggested to be

active in cuticle sclerotization (Dittmer et al., 2004;

Sharma and Kuhad, 2008). Recently, two isoforms

of laccase 2 gene have been found to catalyse

larval, pupal, and adult cuticle tanning in Tribolium

castaneum (Arakane et al., 2005; Sharma and

Kuhad, 2008)

Applications of laccase

Laccases have many biotechnological applications

because of their oxidation ability towards a broad

range of phenolic and non-phenolic compounds

(Figure 1) (Mohammadian et al., 20trong>10trong>).

Other applications of laccase include the

cleaning the industrial effluents, mostly from

industries like paper industry, pulp, textile &

petrochemical industries. Laccase are also used in

the medical diagnostics and for cleaning herbicides,

pesticides and some explosives in soil. Laccase has

many applications in agricultural, medicinal and

industrial areas (Arora and Sharma, 20trong>10trong>).

Laccases are also to clean the water in many

purification systems. It has also applications in

medical side to prepare certain drugs like anticancer

drugs and it is added in cosmetics to

minimize their toxic effects. Laccase has the

enormous ability to remove xenobiotic substances

and produce polymeric products and that is why

they are being used for many bioremediation

purposes (Couto and Herrera, 2006).

Now researchers are working on enzymatic

synthesis of organic compounds, laccase-based

biooxidation, and biotransformation and biosensor

development. The yield of laccase can be increased

by optimizing different cultural conditions (Arora

and Sharma, 20trong>10trong>).

Production and industrial applications of laccase 5

Figure 1. Scheme of applications of laccase

(Morozova et al., 2007)

Applications of laccase in food industries

Wine stabilization

Laccase is used to improve the quality of drinks

and for the stabilization of certain perishable

products containing plant oils (Morozova et al.,

2007). In food industry, wine stabilization is the

main application of laccase (Duran and Esposito,

2000; Rosana et al., 2002).

Polyphenols have undesirable effects on wine

production and on its organoleptic characteristics,

so their removal from the wine is very necessary

(Rosana et al., 2002). Many innovative treatments,

such as enzyme inhibitors, complexing agents, and

sulfate compounds, have been proposed for the

removal of phenolics responsible for discoloration,

haze, and flavor changes but the possibility of using

enzymatic laccase treatments as a specific and mild

technology for stabilizing beverages against

discoloration and clouding represents an attractive

alternative (Cantarelli et al., 1989; Arora and

Sharma, 20trong>10trong>). Since such an enzyme is not yet

allowed as a food additive, the use of immobilized

laccase might be a suitable method to overcome

such legal barriers as in this form it may be

classified as technological aid. So laccase could

find application in preparation of must, wine and in

fruit juice stabilization (Minussi et al., 2002; Arora

and Sharma, 20trong>10trong>).

Baking industry

In the bread-making process laccases affix bread

and/or dough-enhancement additives to the bread

dough, these results in improved freshness of the

bread texture, flavour and the improved

machinability (Minussi et al., 2002).

Laccase is also one of the enzymes used in the

baking industry. Laccase enzyme is added in the


6Muhammad IMRAN et al.

baking process which results in the oxidizing effect,

and also improves the strength of structures in

dough and/or baked products. Laccase imparts

many characteristics to the baked products

including an improved crumb structure, increased

softness and volume. A flour of poor quality can be

also used in this process using laccase enzyme

(Minussi et al., 2002).

Applications of laccase in textile industry

Synthetic dyes are widely used in such industries as

textile, leather, cosmetics, food and paper printing

(Forgacsa et al., 2004). Reactive dyes are coloured

molecules used to dye cellulose fibres (Tavares et

al., 2009). These dyes result in the production of

large amounts of high-colored wastewater. A

special problem is found in the application of

synthetic dyes that they are resistant to

biodegradation (Wesenberg et al., 2003, Moilanen

et al., 20trong>10trong>).

Normally, from trong>10trong> to 50% of the initial dye

load will be present in the dyebath effluent, giving

rise to a highly coloured effluent (Vandevivere et

al., 1998; Moilanen et al., 20trong>10trong>). Therefore, the

treatment of industrial effluents containing

aromatic compounds is necessary prior to final

discharge to the environment (Khlifia et al., 20trong>10trong>).

Nowadays, environmental regulations in most

countries require that wastewater must be

decolorized before its discharge (Moilanen et al.,

20trong>10trong>) to rtrong>edutrong>ce environmental problems related to

the effluent (Tavares et al., 2009). A wide range of

physicochemical methods has been developed for

the degradation of dye-containing wastewaters

(Vandevivere et al., 1998; Tavares et al., 2009).

Wastewaters from textile dying process are usually

treated by physical or chemical processes, which

include physical–chemical processes electrokinetic

coagulation, electrochemical destruction,

irradiation, precipitation, ozonation, or the Katox

method that involves the use of active carbon and

the mixture of certain gases (air) (Banat et al.,

1996, Khlifia et al., 20trong>10trong>, Tavares et al., 2009).

However, due to the chemical nature, molecular

size and structure of the reactive dyes these

classical processes can cause a problem in the

environment and better treatments can be obtained

using bioprocesses (Tavares et al., 2009). Recently,

enzymatic treatments have attracted much interest

in the decolourization/degradation of textile dyes in

wastewater as an alternative strategy to

conventional chemical and physical treatments,

which present serious limitations (Cristovao et al.,

2008, Tavares et al., 2009).

Five indigenous fungi P. ostreatus IBL-02, P.

chrysosporium IBL-03, Coriolus versicolor IBL-

04, G. lucidum IBL-05 and S. commune IBL-06

were screened for decolorization of four vat dyes,

Cibanon red 2B-MD, Cibanon golden-yellow PK-

MD, Cibanon blue GFJ-MD and Indanthrene direct

black RBS. The screening experiment was run for

trong>10trong> days with 0.01% dye solutions prepared in

alkaline Kirk’s basal nutrient medium in triplicate

(250 ml flasks). Every 48 h samples were read on

their respective wavelengths to determine the

percent decolorization. It was observed that C.

versicolor IBL-04 could effectively decolorized all

the four vat dyes at varying incubation times but

best results were shown on Cibanon blue GFJ-MD

(90.7%) after 7 days, followed by golden yellow

(88%), Indanthrene direct black (79.7%) and

Cibanon red (74%). P. chrysosporium also showed

good decolorization potential on Cibanon blue

(87%), followed by Cibanon golden-yellow

(74.8%), Red (71%), and Indanthrene direct black

(54.6%) (Asghar et al., 2008).

Decolourization and detoxification of a textile

industry effluent by laccase from Trametes trogii in

the presence and the absence of laccase mediators

had been investigated. It was found that laccase

alone was not able to decolourize the effluent

efficiently even at the highest enzyme

concentration tested: less than trong>10trong>% decolourization

was obtained with 9 U/mL reaction mixtures. To

enhance effluent decolourization, several potential

laccase mediators were tested at concentrations

ranging from 0 to 1mM. Most potential mediators

enhanced decolourization of the effluent, with 1hydroxybenzotriazol

(HBT) being the most

effective (Khlifia et al., 20trong>10trong>).

Moilanen et al. (20trong>10trong>) used the crude laccases

from the white-rot fungi Cerrena unicolor and

Trametes hirsuta for their ability to decolorize

simulated textile dye baths. The dyes used were

Remazol Brilliant Blue R (RBBR) (trong>10trong>0 mg/L),

Congo red (12.5 mg/L), Lanaset Grey (75 mg/L)

and Poly R-478 (50 mg/L). They assessed the effect

of redox mediators on dye decolorization by

laccases. The result was that C. unicolor laccase

was able to decolorize all the dyes tested. It was

especially effective towards Congo red and RBBR

with 91 and 80% of color removal in 19.5 h despite

the fact that simulated textile dye baths were used.

Applications in pharmaceutical industry

Laccases have been used for the synthesis of

several products of pharmaceutical industry (Arora

and Sharma, 20trong>10trong>). The first chemical of the


pharmaceutical importance that has been prepared

using laccase enzyme is actinocin that has been

prepared from 4-methyl-3-hydroxyanthranilic acid.

This compound has anticancer capability and works

by blocking the transcription of DNA from the

tumor cell (Burton, 2003).

Another example of the anticancer drugs is

Vinblastine, which is useful for the treatment of

leukemia. The plant Catharanthus roseus naturally

produces vinblastine. This plant produces small

amount of this compound. Katarantine and

vindoline are the precursors of this

pharmaceutically important compound. These

precursors are produced in higher quantities and are

easy to purifiy. Laccase is used to convert these

precursors into vinblastine. A 40% conversion of

these precursors into the final product has been

obtained using laccase (Yaropolov et al., 1994).

The use of laccase in such conversion reactions has

made the preparation of several important

compounds with useful properties, like antibiotics,

possible (Pilz et al., 2003).

Catechins have the antioxidant ability and

Laccases can oxidize catechins. These catechins

consist of small units of tannins and these are

important antioxidants found in tea, herbs and

vegetables. Catechins have the tendency to hunt

free radicals and their property makes them useful

in preventing several diseases including cancer,

inflammatory and cardiovascular diseases. The

catechins have less antioxidant ability; this property

can be increased by using laccase and has resulted

in the conversion of catechins in several products

with enhanced antioxidant capability (Kurisawa et

al., 2003).

Laccase has applications in the synthesis of

hormone derivatives. Intra et al. (2005) and Nicotra

et al. (2004) have reported that laccase has the

ability to seperate innovative dimeric derivatives of

the β-estradiol and of the phytoalexin resveratrol.

Isoeugenol oxidation coniferyl alcohol and totarol

gave new dimeric derivatives (Ncanana et al.,

2007) and a mixture of dimeric and tetrameric

derivatives (Shiba et al., 2000) respectively,

whereas the oxidation of substituted imidazole has

resulted in the production of even more complex

substrances. These new formed imidazoles or

oligomerization products (2–4) can be used for

pharmacological purposes (Kurisawa et al., 2003).

Aromatic and aliphatic amines can be converted

into 3-(3, 4-dihydroxyphenyl)-propionic acid using

laccase based oxidation. The derivatives have the

antiviral natural activity and can be used for

Production and industrial applications of laccase 7

pharmaceutical purposes (Ncanana et al., 2007).

Conclusion

Laccases are produced by various sources like

fungi, bacteria and insects. They have many

industrial applications because of their innate

ability of oxidation of a broad range of phenolic

and non-phenolic compounds. Laccase is utilized in

drink industry to improve the quality of drinks and

for stabilization of some perishable products having

plant oils. Laccases have the potential for the

synthesis of several useful drugs in pharmaceutical

industry because of their high value of oxidation

potential. Laccases have also tremendous ability of

oxidation of harmful and industrial products and

belongs to those enzymes, which have instinctive

properties of immediate radical production. Laccase

enzyme has the property to act on a range of

substrates and to detoxify a range of pollutants,

which have made them to be useful in many

industries including paper, pulp, textile and

petrochemical industries.

References

Aisemberg GO, Grorewold E, Taccioli GE,

Judewicz N. A major transcript in the response

of Neurospora crassa to protein synthesis

inhibition by cycloheximide. Exp Mycol. 13:

121–128, 1989.

Alexandre G, and Zhulin IB. Laccases are wide

spread in bacteria. Trends in Biotech. 18: 41–

42, 2000.

Amat AS, Elio PL, Fernandez E, Borron JCG,

Solano F. Molecular cloning and functional

characterization of a unique multipotent

polyphenol oxidase from Marinomonas

mediterranea. Biochem Biophys Acta. 1547:

trong>10trong>4–116, 2001.

Arakane Y, Muthukrishnan S, Beeman RW, Kanost

MR, Kramer KJ. Laccase 2 is the phenoloxidase

gene required for beetle cuticle tanning. PNAS.

trong>10trong>2: 11337-11342, 2005.

Arora DS, Sharma RK. Ligninolytic Fungal

Laccases and Their Biotechnological

Applications. Appl Biochem Biotechnol. 160:

1760–1788, 20trong>10trong>.


8Muhammad IMRAN et al.

Asghar M, Batool S, Bhatti HN, Noreen R, Rahman

SU, Asad MJ. Laccase mediated decolorization

of vat dyes by Coriolus versicolor IBL-04. Int

Biodet Biodeg. 62: 465-470, 2008.

Bailey MR, Woodard SL, Callawy E, Beifuss K,

Lundback MM, Lane J. Improved recovery of

active recombinant laccase from maize seed.

Appl Microbiol Biotechnol. 63: 390–397, 2004.

Baldrian P. Fungal laccases occurrence and

properties. FEMS Microbiol Rev. 30: 215–242,

2006.

Banat IM, Nigam P, Singh D, Marchnt R.

Microbial decolorization of textile dye

containing effluent: a review. Bioresour

Technol. 58: 217–227, 1996.

Birhanli E and Yesilada O. Increased production of

laccase by pellets of Funalia trogii ATCC

200800 and Trametes versicolor ATCC 200801

in repeated-batch mode. Enzy Microb Technol.

39: 1286–1293, 2006.

Burton S. Laccases and phenol oxidases in organic

synthesis. Curr Org Chem. 7: 1317-1331, 2003.

Cantarelli C, Brenna O, Giovanelli G, Rossi M.

Beverage stabilization through enzymatic

removal of phenolics. Food Biotechnol. 3: 203–

214, 1989.

Claus H. Laccases and their occurrence in

prokaryotes. Arch Microbiol. 179: 145–150,

2003.

Collins PJ and Dobson ADW. Regulation of

laccase gene transcription in Trametes

versicolor. Appl Environ Microbiol. 63: 3444–

3450, 1997.

Couto SR and Herrera JLT. Industrial and

biotechnological applications of laccases: A

review. Biotechnol Advances. 24: 500–513,

2006.

Cristovao RO, Tavares APM, Ribeiro A, Loureiro

JM, Boaventura RAR, Macedo EA. Kinetic

modelling and simulation of laccase catalyzed

degradation of reactive textile dyes. Biores

Technol. 99: 4768–4774, 2008.

Davis RH and Perkins DD. Timeline: Neurospora:

a model of model microbes. Nat Rev Genet. 3:

397–403, 2002.

Dittmer NT, Suderman RJ, Jiang H, Zhu YC,

Gorman MJ, Kramer KJ, Kanost MR.

Characterization of cDNA encoding putative

laccase-like multicopper oxidases and

developmental expression in the tobacco

hornworm, Manduca sexta, and the malaria

mosquito, Anopheles gambiae. Insect Biochem

Mol Biol. 34: 29–41, 2004.

Duran N and Esposito E. Potential applications of

oxidative enzymes and phenoloxidase-like

compounds in wastewater and soil treatment: a

review. Appl Cataly Env. 28: 83–99, 2000.

Eggert C, Temp U, Eriksson KE. The ligninolytic

system of the white rot fungus Pycnoporus

cinnabarinus: purification and characterization

of the laccase. Appl Environ Microbiol. 62:

1151–1158, 1996.

Enguita FJ, Martins LO, Henriques AO, Carrondo

MA. Crystal structure of a bacterial endospore

coat component. A laccase with enhanced

thermostability properties. J Biol Chem. 278:

19416–19425, 2003.

Faure D, Bouillant ML, Bally R. Isolation of

Azospirillum lipoferum 4T Tn5 mutants affected

in melanization and laccase activity. Appl

Environ Microbiol. 60, 3413–3415, 1994.

Forgacsa E, Cserhatia T, Oros G. Removal of

synthetic dyes from wastewaters: a review.

Environ Int. 30: 953–971, 2004.

Galai S, Limam F, Marzouki MN. A new

Stenotrophomonas maltophilia strain producing

laccase. Use in decolorization of synthetic dyes.

Appl Biochem Biotechnol. 158(2): 416-431

2009.

Galhaup C, Wagner H, Hinterstoisser B, Haltrich

D. Increased production of laccase by the wooddegrading

basidiomycetes Trametes pubescens.

Enz Microb Technol. 30: 529–536, 2002.


Gianfreda L, Xu F, Bollag JM. Laccases: a useful

group of delignification and possible industrial

applications. Multi-Copper Oxidases.

Messerschmidt A (Ed). Singapore: World

Scientific. 201–224, 1999.

Giardina P, Faraco V, Pezzella C, Piscitelli A,

Vanhulle S, Sannia G. Laccases: a never-ending

story. Cell Mol Life Sci. 67: 369–385, 20trong>10trong>.

Givaudan A, Effose A, Faure D, Potier P, Bouillant

ML, Bally R. Polyphenol oxidase in

Azospirillum lipoferum isolated from rice

rhizosphere: evidence for laccase activity in

non-motile strains of Azospirillum lipoferum.

FEMS Microbiol Lett. trong>10trong>8: 205–2trong>10trong>, 1993.

Gnanamani A, Jayaprakashvel M, Arulmani M,

Sadulla S. Effect of inducers and culturing

processes on laccase synthesis in

Phanerochaete chrysosporium NCIM 1197 and

the constitutive expression of laccase isozymes.

Enz Microb Technol. 38: trong>10trong>17-trong>10trong>21, 2006.

Heinzkill M, Messner K. The ligninolytic system of

fungi. Fungal biotechnology. Anke T (Ed).

Chap Hall Weinheim. 213–226, 1997.

Intra A, Nicotra S, Riva S, Daniel B. Significant

and unexpected solvent influence on the

selectivity of laccase-catalyzed coupling of

tetrahydro-2-naphthol derivatives. Adv Synth

Catal. 347: 973-977, 2005.

Jolivalt C, Brenon S, Caminade E, Mougin C,

Pontie M. Immobilization of laccase from

Trametes versicolor on a modified PVDF

microfiltration membrane: characterization of

the grafted support and application in removing

a phenylurea pesticide in wastewater. J Membr

Sci. 180: trong>10trong>3–113, 2000.

Jolivalt C, Raynal A, Caminade E, Kokel B, Le

Goffic F, Mougin C. Transformation of N,N

dimethyl-N-(hydroxyphenyl)ureas by laccase

from the white rot fungus Trametes versicolor.

Appl Microbiol Biotechnol. 51: 676–681, 1999.

Khlifia R, Belbahria L, Woodwarda S, Ellouza M,

Dhouiba A, Sayadia S, Mechichia T.

Production and industrial applications of laccase 9

Decolourization and detoxification of textile

industry wastewater by the laccase-mediator

system. J Hazard Mater. 175: 802–80, 20trong>10trong>.

Kiiskinen LL, Ratto M, Kruus K. Screening for

novel laccase-producing microbes. J Appl

Microbiol. 97: 640–646, 2004.

Koschorreck K, Schmid RD, Urlacher VB.

Improving the functional expression of a

Bacillus licheniformis laccase by random and

site-directed mutagenesis. J Biotechnol. 9(12):

1-trong>10trong>, 2009.

Kurisawa M, Chung JE, Uyama H, Kobayashi S.

Laccase-catalyzed synthesis and antioxidant

property of poly(catechin). Macromol Biosci. 3:

758-764, 2003.

Leonowicz A, Cho NS, Luterek J, Wilkolazka A,

Wotjas-Wasilewska M, Matuszewska A,

Hofrichter M, Wesenberg D, Rogalski J. Fungal

laccase: properties and activity on lignin. J Bas

Microbiol. 41: 185–227, 2001.

Liers C, Ullrich R, Pecyna M, Schlosser D,

Hofrichter M. Production, purification and

partial enzymatic and molecular

characterization of a laccase from the woodrotting

ascomycete Xylaria polymorpha. Enz

Microb Technol. 41: 785–793, 2007.

Mayer AM. Polyphenol oxidases in plant: recent

progress. Phytochem. 26: 11–20, 1987.

Mayer AM, Staples RC. Laccase: new functions

for an old enzyme. Phytochem. 60: 551–565,

2002.

Minussi RC, Pastore GM, Duran N. Potential

applications of laccase in the food industry.

Trends in Food Scien Technol. 13: 205–216,

2002.

Mishra A, Kumar S, Kumar S. Application of Box-

Benhken experimental design for optimization

of laccase production Coriolus versicolor

MTCC138 in solid-state fermentation. J Sci

Indust Res. 67: trong>10trong>98-1trong>10trong>7, 2008.


trong>10trong>Muhammad IMRAN et al.

Mohammadian M, Roudsari MF, Mollania N,

Dalfard AB, Khajeh K. Enhanced expression of

a recomninant bacterial laccase at low

temperature and microacrobic conditions:

purification and biochemical characterization. J

Ind Microbiol Biotechnol. 5: 41-45, 20trong>10trong>.

Moilanen U, Osma JF, Winquist E, Leisola M,

Couto SR. Decolorization of simulated textile

dye baths by crude laccases from Trametes

hirsute and Cerrena unicolor. Eng Life Sci.

trong>10trong>(3): 1–6, 20trong>10trong>.

Morozova OV, Shumakovich GP, Gorbacheva MA,

Shleev SV, Yaropolov AI. “Blue” Laccases. J

Biochem. 72(trong>10trong>): 1136-1150, 2007.

Mougin, C., Boyer, F. D., Caminade, E., Rama, R.

Cleavage of the diketonitrilederivative of the

herbicide isoxaflutole by extra cellular fungal

oxidases. J Agric Food Chem. 48: 4529–4534,

2000.

Ncanana S, Baratto L, Roncaglia L, Riva S, Burton

SG. Laccase mediated oxidation of totarol. Adv

Synth Catal. 349 : 1507-1513, 2007.

Nicotra S, Cramarossa MR, Mucci A, Pagnoni UM,

Riva S, Forti L. Biotransformation of

resveratrol: synthesis of trans-dehydrodimers

catalyzed by laccases from Myceliophtora

thermophyla and from Trametes pubescens.

Tetrahedron. 60: 595-600, 2004.

Niladevi KN, Sukumaran RK, Jacob N, Anisha GS,

Prema P. Optimization of laccase production

from a novel strain-Streptomyces psammoticus

using response surface methodology. Microbiol

Res. 164: trong>10trong>5-113, 2009.

Pandey A. Solid State Fermentation. Pandey A

(Ed). Wiley Eastern Publishers, New Delhi. 3–

trong>10trong>, 1994.

Pilz R, Hammer E, Schauer F, Krag U. Laccasecatalyzed

synthesis of coupling products of

phenolic substrates in different reactors. Appl

Microbiol Biotechnol. 60: 708-712, 2003.

Rama R, Mougin C, Boyer FD, Kollmann A,

Malosse C and Sigoillot JC. Biotransformation

of benzo[a]pyrene in bench scale reactor using

laccase of Pycnoporus cinnabarinus. Biotechnol

Lett. 20: 1trong>10trong>1–1trong>10trong>4, 1998.

Ranocha P, Chabannes M, Chamayou S, Danoun S,

Jauneau A, Boudet AM. Laccase downregulation

causes alteration in phenolic

metabolism and cell wall structure in poplar.

Plant Physiol. 129:1–11, 2002.

Rosana C, Minussi Y, Pastore GM, Durany N.

Potential applications of laccase in the food

industry. Trends in Food Sci Technol. 13: 205-

216, 2002.

Savoie JM, Mata G, Billette C. Extracellular

laccase production during hyphal interactions

between Trichoderma sp. and Shiitake,

Lentinula edodes. Appl Microbiol Biotechnol.

49: 589-593, 1998.

Sadhasivam S, Savitha S, Swaminathan K, Lin FH.

Production, purification and characterization of

mid-redox potential laccase from a newly

isolated Trichoderma harzianum WL1. Process

Biochem. 43: 736-742, 2008.

Sharma KK and Kuhad RC. Laccase: enzyme

revisited and function redefined. Ind J

Microbiol. 48: 309–316, 2008.

Sharma P, Goel R, Caplash N. Bacterial laccases.

World J Microbiol Biotechnol. 23: 823-832,

2007.

Shiba T, Xiao L, Miyakoshi T, Chen CL. Oxidation

of isoeugenol and coniferyl alcohol catalyzed

by laccase isolated from Rhus vernicifera

Stokes and Pycnoporus coccineus. J Mol Catal

Enzym. trong>10trong>: 605-615, 2000.

Smith M, Thurston F, Wood DA. Fungal laccases:

role in oxidortrong>edutrong>ctive enzymes. Bioremed J. 3:

1–25, 1997.

Solden DM and Dobson DW. Differential

regulation of laccase gene expression in

Pleurotus sajor-caju. Microbiol. 147: 1755–

1763, 2001.

Souza D and Peralta RM. Production of laccase


isoforms by Pleurotus pulmonarius in response

to presence of phenolic and aromatic

compounds. J Basic Microbiol. 44(2): 129–136,

2004.

Souza CGM, Zilly A, Peralta RM. Production of

laccase as the sole phenoloxidase by a Brazilian

strain of Pleurotus pulmonarius in solid state

fermentation. J Bas Microbiol. 42: 83–90, 2002.

Souza DDT, Tiwari R, Sah AK, Raghukumara C.

Enhanced production of laccase by a marine

fungus during treatment of colored effluents and

synthetic dyes. Enz Microb Technol. 38: 504-

511, 2006.

Tavares APM, Cristovao RO, Gamelas JAF,

Loureiro JM, Boaventuraa RAR, Macedoa EA.

Sequential decolourization of reactive textile

dyes by laccase mediator system. J Chem

Technol Biotechnol. 84: 442–446, 2009.

Vandevivere PC, Bianchi R, Verstraete W.

Treatment and reuse of wastewater from the

textile wet-processing industry: review of

emerging technologies. J Chem Technol

Biotechnol. 72: 289–302, 1998.

Wesenberg D, Kyriakides I, Agathos N. White-rot

fungi and their enzymes for the treatment of

industrial dye effluents. Biotechnol Adv. 22:

161–187, 2003.

Yaropolov AI, Skorobogatko OV, Vartanov SS,

Varfolomeyev SD. Laccase: Properties,

catalytic mechanism and applicability. Appl

Biochem Biotechnol. 49: 257–280, 1994.

Production and industrial applications of laccase 11


Journal of Cell and Molecular Biology trong>10trong>(1):13-18, 2012 Research Article 13

Haliç University, Printed in Turkey.

http://trong>jcmbtrong>.trong>halictrong>.trong>edutrong>.tr

Isolation and biochemical identification of Escherichia coli from

wastewater effluents of food and beverage industry

Tasnim FARASAT*, Zubia BILAL, Fakhar-un-Nisa YUNUS

Department of Zoology, Lahore College for Women University, Lahore, Pakistan.

(* author for correspondence; tasnimfarasat@hotmail.com)

Received: 20 May 2011; Accepted: 11 May 2012

Abstract

The aim of this study was the isolation and biochemical identification of E. coli from industrial wastewater

effluents. Sixty samples were collected from different sources in Lahore. The results revealed that E.coli was

found in higher concentration in wastewater of food and beverage industries. Wastewater is an important

reservoir for E.coli and presented significant acute toxicity if released into the receiving water body without

being adequately treated. Results revealed the presence of both gram negative and positive bacteria. There

was nonsignificant variation among all the samples of wastewater. The highest concentration of E.coli was

observed in wastewater of food industry Site A (Rettigon road) and beverage industry Site F (Wahdat road).

Biochemical and serological tests confirmed the presence of E.coli.

Keywords: E .coli, wastewater, food industry, beverage industry, effluent.

Yiyecek ve içecek endüstrisi atıksu deşarjlarından Escherichia coli eldesi ve biyokimyasal

tanımlanması

Özet

Bu çalışmanın amacı endüstriyel atıksu deşarjlarından E. coli eldesi ve biyokimyasal tanımlanmasıdır.

Lahor’da farklı kaynaklardan 60 örnek toplandı. Sonuçlar yiyecek ve içecek endüstrisi atıksularında daha

fazla konsantrasyonda E. coli bulunduğunu gösterdi. Atıksu önemli bir E.coli deposudur ve yeterli olarak

muamele edilmeden alıcı su kaynağına salınırsa ileri derecede toksik olabilir. Sonuçlar hem gram pozitif,

hem de gram negatif bakteri varlığını gösterdi. En yüksek E. coli konsantrasyonu A bölgesi (Rettigon yolu)

yiyecek endüstrisinin ve F bölgesi (Wahdat yolu) içecek endüstrisinin atıksularında gözlemlendi. Biyolojik

ve serolojik testler E. coli varlığını doğruladı.

Anahtar kelimeler: E.coli, atıksu, yiyecek endüstrisi, içecek endüstrisi, atıksu deşarjı.

Introduction

Industrial waste is the most common source of

water pollution in the present day (Ogedengbe and

Akinbile, 2004) and it increases yearly due to the

fact that industries are increasing as most countries

are getting industrialized. Industries produce wastes

which are peculiar in terms of type, volume and

frequency depending on the type of industry and

population that uses the product (Odumosu, 1992).

Water and wastewater management constitutes a

practical problem for the food and beverage

industry. In spite of significant improvement over

the last 20 years, water consumption and disposal

remain critical from environmental and economic

standpoint (Fillaudeau et al., 2005).

A food processing industry is involved with the

total environment from the farm to the customer.

Water is absolutely necessary for many steps in the

food processing industry. At present, there is no

economical substitute of water. Consequently water

conservation and water reuse are necessary. By


14 Tasnim FARASAT et al.

practicing conservation and reuse, the amount of

liquid waste and pollution potential from the food

processing is rtrong>edutrong>ced (Mercer, 1964).

On a global scale, contamination of drinking

water by pathogenic bacteria causes the most

significant health risk to humans, and there have

been countless numbers of disease outbreaks and

poisonings resulting from exposure to untreated or

poorly treated drinking water. However, significant

risks to human health may also result from

exposure to toxic contaminants that are often

globally ubiquitous in waters from which drinking

water is derived. The presence of E. coli is a

definite indication of fecal contamination (WHO,

2004). Some E. coli strains can cause a wide variety

of intestinal and extra-intestinal diseases, such as

diarrhea, urinary tract infections, septicemia, and

neonatal meningitis (Orskov and Orskov, 1992).

The magnitude of the problem of bacterial

contamination deserves more elaborative studies

from the point of production of waste effluents to

the point of consumption at all intermediary levels.

The aim of the present research was isolation and

biochemical identification of E.coli from industrial

effluents of food and beverage industries in Lahore.

Material and methods

Sample collection

Sampling was completed in two successive months

from March to April for the microbial assessment

of waste effluents from food and beverage

industries. Total of sixty samples were collected. In

March, effluents of food industries were collected

from industries near Rettigon road, Township

industrial area, Township industrial estate. In April,

effluents of beverage industries were collected from

industries near Multan road and Wahdat road. Data

from each sample was collected and recorded in the

data book. Samples were collected in hermetically

sealed, sterilized falcon tubes and were kept at 4ºC

until analysis.

Sample processing

The technique described by Theodor Escherich,

1885 was used for isolation of E.coli (Escherich,

1885). To prevent contamination, the area was

swabbed with 70% ethanol prior to opening any

sample container. Samples (0.5 ml) were taken in

trong>10trong> ml LB (Luria Bertani) broth medium in test

tube, and vortexed for one minute and left for thirty

minutes at room temperature. Then supernatant

(1ml) was taken from this test tube and a 2-fold

serial dilution was prepared (Reddy, 2007). After

this, 500 ml from the final dilution tube was

spreaded on the petri dishes (Pyrex) of MacConkey

medium and LB medium. Petri dishes were kept in

the incubator for 24 hours at 37ºC (Hajna and

Perry, 1939). After 24 hours, plates were studied

for the colonies of microbes grown on the media.

Microorganisms grown on MacConkey agar are

capable of metabolizing lactose which produces

acid by-products that lower the pH of the media

which causes the neutral red indicator to turn red,

and if sufficient acid is produced, a zone of

precipitated bile develops around the colony

(Koneman, 2005). Different biochemical tests

(Werkman, 1930; O'Meara, 1931; Vaughn et al.,

1939; Silva et al., 1980) were performed for the

identification of E. coli in the waste effluents of

food and beverage industry (Table 1).

Serological tests

Commercial latex kits are available for O157, O26,

and H7 strains of E. coli. O157 antiserum has been

shown to cross-react with other organisms

including E. hermanii (frequently found in foods)

(Hopkins and Hilton, 2000; Law, 2000). Tests

incorporated positive and negative control

organisms and control latex. Test was performed by

a slide agglutination test using somatic (O) or

flagella (H) antisera. Some pathogenic bacteria

were nonmotile.

Results

E. coli was cultured on LB medium and

MacConkey medium for morphological

characterization. After 24 hrs, two types of colonies

were isolated under microscopic examination. All

the isolated colonies were pink on MacConkey

medium, while creamy yellow on LB medium.

E. coli was observed in highest concentration

from wastewater samples of industry (Site A)

whereas in wastewater samples of industry (Site B)

six samples indicated the presence of E. coli which

was confirmed by biochemical and serological test.

Four samples were of gram positive bacteria which

may be Bacillus subtilus or Bacillus thuringiensis.

In industrial effluent (Site C) eight samples were of

gram negative while two samples were of gram

positive bacteria. It was observed that waste

effluents of food industry (Site A) revealed greater

percentage of gram negative bacteria.

In wastewater samples of industry (Site D) five

were gram negative, while five were gram positive

bacteria. Six samples in industrial effluent (Site E)


Samples

Sources

Industrial

effluent (A)

Industrial

effluent(B)

Industrial

effluent(C)

Industrial

effluent(D)

Industrial

effluent(E)

Industrial

effluent(F)

Identification of E. coli from wastewater 15

Table 1. Biochemical identification of E. coli in industrial wastewaters

Indole

Test

Spot

Indole

Test

Kovacs

Indole

Test

Methyl Red

Test

Voges

Proskeur

Test

Ammonium

acetate Test

Simmon's Test

Ammonium

Citrate Test

+ + + + - + -

+ + + + - + -

+ + + + - + -

+ + + + - + -

+ + + + - + -

+ + + + - + -

were gram negative and four were gram positive

bacteria. In the wastewater samples of beverage

industry (Site F) all samples were of gram negative

bacteria (Figure 1 and 2).

The average value of gram negative bacteria in

wastewater of food industry (Site A) was 5.trong>10trong> ±

0.34. The average value of gram negative bacteria

in wastewater of food industry (Site B) was 4.66 ±

0.66 while in wastewater of food industry (Site C)

was 4.50 ± 0.50. The average value of gram

negative bacteria in wastewater of beverage

industry (Site D) was 5.0 ± 0.70, whereas in the

wastewater of beverage industry (Site E) was 3.8 ±

0.60 and in the wastewater of beverage industry

(Site F) was 4.0 ± 0.33. Student’s t-test revealed a

non significant difference (P >0.05) between gram

positive and gram negative bacteria.

Figure 1. Percentage of gram negative bacteria in all industrial wastewater samples. Food Industry A:

Rettigon road; Food Industry B: Township industrial area; Food Industry C: Township industrial estate;

Beverage industry D: Multan Road; Beverage industry E: Multan road; Beverage industry F: Wahadat road


16 Tasnim FARASAT et al.

Figure 2. Number of E.coli colonies (mean ±SE) in wastewater samples of industries. Sites A, B, C: Food

industries at Rettigon road, Township industrial area, Township industrial Estate Sites D, E, F: Beverage

industries at Multan Road and Wahadat road.

Discussion

The bacterium E. coli is one of the best and most

thoroughly studied free-living organisms. It is also

a remarkably diverse species because some E.coli

strains live as harmless commensals in animal

intestines. E. coli is a widely used indicator of fecal

contamination in water bodies. External contact and

subsequent ingestion of bacteria from fecal

contamination can cause detrimental health effects

(Money et al., 2009).

Stomach cramps, nausea and vomiting are the

symptoms caused by E. coli, however serious

complications can also occur. Water samples were

the only nonfecal samples that tested positive for E.

coli. Water has been implicated in human outbreaks

and the studies revealed that water may be an

important source of 0157:H7 on farms (Karmali,

1989).

The present research work was conducted to

isolate E. coli from food and beverage industrial

effluents. Effluents are good primary reservoir for

E. coli. Sixty different samples from food and

beverage industries were processed for the isolation

of E. coli. The food and beverage industries uses

large volume of water as it is suitable, clean, and a

quite inexpensive resource, both as a constituent of

many products, and for other production

requirements. Microbial growth in drinks due to

contaminated water supplies or sugar syrups can

cause discoloration, off flavors and shortened shelflife,

as well as increasing the risk of infection to

consumers (Noronha et al., 2002).

However, selective media are universally used

in water monitoring and were employed in the

United States Environmental Protection Agency

epidemiological investigations, suggesting that

culturable fecal indicator counts are valid predictors

of disease risk (Sinton et al., 1994). Sewage can

serve as a vehicle for entering into human and

nonhuman hosts either by direct contact or through

contamination of drinking water supplies (Boczek

et al., 2007).

The results revealed that the highest percentage

of E. coli was observed in the waste effluents of

industries (A and F). ANOVA showed non

significant (P > 0.05) variation. Student’s t-test also

revealed non significant difference between gram

positive and gram negative bacteria.

According to Boczek and colleagues (2007) the

occurrence of clonal group in wastewater

demonstrates a potential mode for the dissemination

of this clonal group in the environment, with

possible secondary transmission to human or

animal hosts. Chalmers and colleagues (2000)

demonstrated that the effluent had a significant

pollution potential, mainly due to the low pH and

high concentration of E. coli. The results also


demonstrated that the wastewater presented

significant acute toxicity, and could cause diseases

if released into the receiving body without being

adequately treated. This represents a dangerous

public health risk, which needs future evaluation

and control. Culture-independent analysis in

various environmental samples has been used to

catalog this species and also to assess the impact of

human activity and interactions with microbes on

natural microbial communities.

According to Barreto-Rodrigues and colleagues

(2008), the objective of the work was to

characterize the effluent originating from a

Brazilian TNT production industry. Analyses were

performed using physical, chemical, spectroscopic

and ecotoxicological assays, which demonstrated

that the effluent had a significant pollution

potential, mainly due to the low pH and high

concentration of TNT (156 ± trong>10trong> mg L −1 ). The

results also demonstrated that the effluent causes

significant acute toxicity, and could cause countless

damages if released into the rivers without being

properly treated. The observed pollution potential

justifies studies to evaluate treatment technologies

or recover the residue generated in the TNT

industry. From a total of 149 E. coli strains, 87 E.

coli strains were from raw wastewater and 62

strains from treated wastewater by stabilization

ponds. Within these strains two and four positive

serological reaction to E. coli 0157 were found for

raw and treated wastewater, respectively.

In the same direction, Muller and his colleagues

(2001) carried out a study on E.coli 0157:H7 strains

in water sources in South Africa and they did not

find any evidence of EHEC 0157 while virulence

factors present in the 96% of analyzed samples

(196), however 8 isolates from 8 samples

demonstrated the presence of Stx1 and Stx2.

References

Barreto-Rodrigues M, Silva FT, Paiva TCB.

Characterization of wastewater from the

Brazilian TNT industry. J Haz Mat. 164: 385-

388, 2008.

Boczek LA, Rice EW, Johnston B, Johnson JR.

Occurrence of antibiotic-resistant uropathogenic

Escherichia coli clonal group A in wastewater

effluents. Appl Environ Microbiol. 73: 4180-

4184, 2007.

Identification of E. coli from wastewater 17

Chalmers RM, Aird H, Bolton FJ. Waterborne

Escherichia coli 0157. J Appl Microbiol. 88:

124-132, 2000.

Escherich T. Die Darmbakterien des Neugeboren

und Sauglings Fortschr. Med. 3: 515-522, 1885.

Fillaudeau L, Blanpain-Avet P, Daufin G. Water,

wastewater and waste management in brewing

industries. J Cle Pro. 14: 463-471, 2005.

Hajna AA, Perry CA. Optimum Temperature for

Differentiation of Escherichia coli from Other

Coliform Bacteria. J Bacteriol. 38: 275-283,

1939.

Hopkins KL, Hilton AC. Methods available for the

sub-typing of Escherichia coli O157. World J

Microbiol Biotechnol. 16: 741-748, 2000.

Karmali MA. Infection by verocytotoxin-producing

Escherichia coli. Clin Microbiol Rev. 2: 15-38,

1989.

Koneman EW. Color Atlas and Textbook of

Diagnostic Microbiology, Lippincott, JB. (Ed),

Philadelphia. 313-317, 2005.

Law D. Virulence factors of Escherichia coli O157

and other Shiga toxin-producing E. coli. J Appl

Microbiol. 88: 729-745, 2000.

Mercer WA. Physical Characteristics of

Recirculated Water as Related to Sanitary

Conditions. Food Technol. 335: 111-115, 1964.

Money ES, Carter GP, Serre ML. Modern

space/time geo statistics using river distances:

data integration of turbidity and Escherichia

coli measurements to assess fecal contamination

along the Raritan River in New Jersey. Environ

Sci Technol. 43: 3736-3742, 2009.

Müller EE, Ehlers MM, Grabow, WOK. The

occurrence of E. coli 0157:H7 in South Africa

water sources intended for direct and indirect

human consumption. Wat Res. 35: 3085 -3088,

2001.


18 Tasnim FARASAT et al.

Noronha M, Britz T, Mavrov V, Janke HD, Chmiel

H. Treatment of spent process water from a fruit

juice company for purposes of reuse: hybrid

process concept and on-site test operation of a

pilot plant. Desalination. 143: 183-196, 2002.

Odumosu AOT. Management of liquid industrial

waste. Ind Waste Manage. 55: 6-7, 1992.

Ogedengbe K, Akinbile CO. Impact of industrial

pollutants on quality of ground and surface

waters at Oluyole Industrial Estate, Ibadan,

Nigeria. J Technol Develop. 4: 139-144, 2004.

O'Meara RAQ. A simple delicate and rapid method

of detecting the formation of acetylmethylcarbinol

by bacteria fermenting

carbohydrate. J Pathol Bacteriol. 34: 401-406,

1931.

Orskov F, Orskov I. Escherichia coli serotyping

and disease in man and animals. J Microbiol.

38: 699-704, 1992.

Reddy CA. Methods for general and molecular

microbiology (Ed). ASM Press, Washington.

447-521, 2007.

Silva RM, Toledo MR, Trabulsi LR.

Biochemical and cultural characteristics of

invasive Escherichia coli. J Clin Microbiol. 11:

441- 444, 1980.

Sinton LW, Davies-Colley RJ, Bell RG.

Inactivation of enterococci and fecal coliforms

from sewage and meatworks effluents in

seawater chambers. Appl Environ Microbiol.

60: 2040-2048, 1994.

Vaughn RH, Mitchell, NB, Levine, M. The Voges-

Proskauer and methyl red reactions in the coliaerogenes

group. J Am Water Works Assoc. 31:

993-trong>10trong>01, 1939.

Werkman CH. An improved technic for the Voges-

Proskauer test. J Bacteriol. 20: 121-125, 1930.

World Health Organization- WHO. Guidelines for

Drinking Water Quality: Recommendations

(Ed). Switzerland. 1: 229-243, 2004.


Journal of Cell and Molecular Biology trong>10trong>(1):19-26, 2012 Research Article 19

Haliç University, Printed in Turkey.

http://trong>jcmbtrong>.trong>halictrong>.trong>edutrong>.tr

Investigation of the MGP promoter and exon 4 polymorphisms in

patients with ischemic stroke in the Ukrainian population

Alexander V. ATAMAN *1, Victoria Y. GARBUSOVA 2 , Yuri A. ATAMAN 3 , Olga I.

MATLAJ 4 , Olga A. OBUCHOVA 1

1 Sumy State University, Department of Physiology, Pathophysiology and Medical Biology, Sumy, Ukraine

2 Sumy State University, Scientific Laboratory of Molecular Genetic Research, Sumy, Ukraine

3 Sumy State University, Department of Internal Medicine, Sumy, Ukraine

4

Sumy Clinical Hospital No.5, Sumy, Ukraine

(*author for correspondence; ataman_av@mail.ru )

Received: 13 February 2012; Accepted: 18 May 2012

Abstract

Matrix γ-carboxyglutamic acid protein (MGP) is a vitamin K-dependent protein playing a pivotal role in

preventing arterial calcification. In the present study, we aimed to investigate the relation between three

single nucleotide polymorphisms of MGP gene and ischemic stroke (IS) in the Ukrainian population. 170 IS

patients and 124 healthy controls were recruited to the study. MGP SNPs were examined by PCR-RFLP

methodology. The distribution of homozygous carriers of the major allelic variant, and heterozygous and

homozygous minor allele variants of the T-138C MGP promoter polymorphism (rs1800802) in patients with

IS was 61.2%, 31.2% and 7.6%, respectively. The corresponding distributions of the variants in the control

group were 59.7%, 35.6%, 4.8%. With regard to the G-7A promoter polymorphism (rs1800801), the

respective distributions were 35.9%, 48.8% and 15.3%, compared to 43.5%, 50% and 6.5% in the control

group. Finally, the respective distributions according to the Thr83Ala exon 4 polymorphism (rs4236) were

39.4%, 48.8% and 11.8%, compared to 34.7%, 53.2% and 12.1% in the control group. Using logistic

regression analysis, it was estimated that A/A genotype (G-7A polymorphism) was significantly (P=0.016)

associated with IS (OR=2.943; 95% CI: 1.218–7.trong>10trong>9) in the Ukrainian population. A-allele homozygotes of

female sex had a risk of IS more than 7 times higher compared with carriers of G/G genotype.

Keywords: Matrix Gla protein, single nucleotide polymorphism, ischemic stroke, arterial calcification,

Ukrainian population.

Ukrayna popülasyonunda iskemik inme hastalarında MGP promotör ve ekzon 4

polimorfizminin araştırılması

Özet

Matris γ–karboksiglutamik asit proteini (MGP) vitamin-K bağımlı protein olup arteriyal kalsitleşmeyi

önlemede önemli rol oynar. Bu çalışmada, MGP geninin üç tek nükleotit polimorfizmi (TNP) ile Ukrayna

popülasyonunda iskemik inme (İİ) arasındaki ilişkiyi araştırmayı hedefledik. Çalışmaya 170 İİ hastası ve 124

sağlıklı kontrol katıldı. MGP TNP’leri PCR-RFLP metodolojisi ile test edildi. İH hastalarında T-138C MGP

promoter polimorfizminin (rs1800802) majör alel varyantının homozigot taşıyıcılarının ve heterozigot ve

homozigot minör alel varyantlarının dağılımları sırası ile, %61.2, %31.2 ve %7.6’dır. Kontrol grubunda ilgili

varyant dağılımları %59.7, %35.6 ve %4.8’dir. G-7A promoter polimorfizminde (rs1800801) ise ilgili

dağılımlar %43.5, %50 ve %6.5 olan kontrol grubu ile karşılaştırıldığında %35.9, %48.8 ve %15.3’dir. Son

olarak, Thr83Ala ekzon 4 polimorfizmine (rs4236) göre dağılımlar %34.7, %53.2 ve %12.1 olan kontrol

grubu ile karşılaştırıldığında %39.4, %48.8 ve %11.8’dir. Lojistik regresyon analizi kullanarak, Ukrayna

popülasyonunda İİ ile A/A genotipinin (G-7A polimorfizmi) anlamlı (P=0.016) olarak ilişkili olduğu

(OR=2.943; 95% CI: 1.218–7.trong>10trong>9) tahmin edilmiştir.

Anahtar kelimeler: Matris Gla protein, tek nükleotid polimorfizmi, iskemik inme, arteriyal kalsifikasyon,

Ukrayna popülasyonu.


20 Alexander V. ATAMAN et al.

Introduction

Ischemic stroke (IS) is, in many instances, the

consequence of a thrombus forming on a ruptured

atherosclerotic plaque. Extracellular matrix

calcification is considered to be a novel marker of

atherosclerosis and related to both coronary artery

and cerebrovascular disease. It has been shown that

arterial calcification in major vessel beds is

associated with vascular brain disease (Bos et al.,

2011).

Recent studies suggest that in addition to

modifiable risk factors, such as hypertension,

hyperlipidemia, and cigarette smoking, there is a

strong genetic component to the development of

arterial calcification. For instance, the heritability

of the presence of coronary artery calcification has

been estimated to be up to 50% (Post et al., 2007).

Key genes known to be involved in the

regulation of the complex process of ectopic soft

tissue mineralization are those acting as

calcification inhibitors such as matrix γcarboxyglutamic

acid protein (MGP), osteocalcin

(BGP), osteoprotegerin (Opg), and fetuin (Abedin

et al., 2004; Doherty et al., 2004; Giachelli, 2004;

Guzman, 2007; Weissen-Plenz et al., 2008).

Among those, MGP, a vitamin K-dependent

protein, is widely accepted as playing a pivotal role

in preventing local mineralization of the vascular

wall (Luo et al., 1997; Schurgers et al., 2005;

Proudfoot and Shanahan, 2006). It has been shown

that the anticalcifying activity of MGP depends

upon the γ-carboxylation of specific glutamic acid

(Glu) residues in MGP. This vitamin K-dependent

reaction yields γ-carboxyglutamic acid (Gla)

residues, which are then able to bind calcium

(Murshed et al., 2004).

The human MGP gene is located on

chromosome 12p (Cancela et al., 1990). Among the

large number of identified MGP single nucleotide

polymorphisms (SNPs) eight are under the most

intensive investigation: two SNPs are located in

exons, and six in the upstream region of the MGP

gene. In vitro studies suggest that SNPs in MGP are

associated with altered promoter activity

(Herrmann et al., 2000; Farzaneh-Far et al., 2001;

Kobayashi et al., 2004). In addition, there is some

evidence that MGP SNPs are associated with

arterial calcification (Herrmann et al., 2000;

Brancaccio et al., 2005; Crosier et al., 2009),

although these results are not consistent (Kobayashi

et al., 2004; Taylor et al., 2005).

There are a large number of studies in which the

association of varies gene polymorphisms with IS

has been investigated (Kubo, 2008; Debette and

Seshadri, 2009; Matarin et al., 2009; Wang et al.,

2009; Low et al., 2011), but only in one of them the

MGP SNPs were a subject of interest (del Rio-

Espinola et al., 20trong>10trong>).

The purpose of the present study was to

investigate the association of three MGP SNPs (T-

138C, G-7A, Thr83Ala) with IS in the Ukrainian

population.

Materials and methods

Study groups

The study recruited 170 IS patients (57,6% men

and 42,4% women) 40 to 85 years of age (mean age

[± SE] 64,7±0,7) admitted to Sumy Clinical

Hospital No.5. A final diagnosis of IS was

established on the basis of clinical, computed

tomography and magnetic resonance imaging

examinations. Each case of IS was assessed

according to TOAST criteria (Adams et al., 1993).

The patients with IS of cardioembolic origin and

undetermined etiology were excluded from the

study group. The control group consisted of 124

clinically healthy individuals with the absence of

cardio- and cerebrovascular pathologies, as

confirmed by medical history, ECG, and

measurement of arterial pressure and biochemical

data. The study had been previously approved by

the Ethic Committee of the Medical Institute of

Sumy State University. Appropriate informed

consent was obtained from all patients and control

subjects. The participants were unrelated Ukrainian

people from the northeastern region of Ukraine.

Blood sampling for genotyping was performed

under sterile conditions into 2.7 ml tubes (S-

Monovette [Sarstedt, Germany]) containing EDTA

potassium salt as an anticoagulant, samples were

frozen and stored at -20ºC.

Genotyping of SNPs

DNA for genotyping was extracted from the venous

blood using commercially available kits (Isogene

Lab Ltd, Russia) according to the manufacturer’s

protocol. To identify MGP SNPs the polymerase

chain reaction (PCR) with subsequent restriction

fragment length polymorphism (RFLP) analysis

was performed as previously described (Garbuzova

et al., 2012). Briefly, specific regions of the MGP

gene were amplified using pairs of specific primers.


For T-138C polymorphism (rs1800802) they

were (F) 5`-

AAGCATACGАТGGCCAAAACTTCTGCA-3`

and (R) 5`-

GAACTAGCAТТGGAACTTTTCCCAACC-3`;

for G-7A polymorphism (rs1800801): (F) 5`-

CTAGTTCAGTGCCAACCCTTCCCCACC-3`

and (R) 5`-

TAGCAGCAGTAGGGAGAGAGGCTCCCA-3`;

for Thr83Ala polymorphism (rs4236): (F) 5`-

TCAATAGGGAAGCCTGTGATG-3` and (R) 5`-

AGGGGGATACAAAATCAGGTG -3`. PCR

products were digested using restriction enzymes:

BseNI (for T-138C), NcoI (for G-7A), and Eco477

(for Thr83Ala). The restriction fragments were

separated by electrophoresis and analysed on an

ethidium bromide-stained 2.5% agarose gel

visualized using ultraviolet transillumination.

Statistical analysis

Using the Pearson χ 2 test, allelic frequencies in

healthy controls and IS patients were found to be in

Hardy-Weinberg equilibrium. Statistical analysis

was performed to assess the independent main and

Genotype Control group

(n=124)

MGP polymorphisms in ischemic stroke 21

joint effects of all analyzed SNPs. To detect the

strongest main effect of three MGP SNPs the

logistic regression method was applied by using

SPSS 17.0. A comparison of variables between the

IS subgroups was performed using ANOVA.

Differences were considered statistically significant

with a P-value < 0.05.

Results

Genotypes of three studied MGP polymorphisms

are summarized in Table 1. As shown, major allele

homozygous and heterozygous, and minor allele

homozygous T-138C polymorphisms of the MGP

promoter were detected in 61.2%, 31.2% and 7.6%

of the IS group, respectively (control group: 59.7,

35.5% and 4.8%). Analysis of the G-7A promoter

polymorphism yielded respective figures of 35.9%,

48.8% and 15.3% (control group: 43.5%, 50% and

6.5%). The distribution of genotypes when

analyzing Thr83Ala polymorphism (exon 4) was

39.4%, 48.8% and 11.8% in IS group (control

group: 34.7%, 53.2% and 12.1).

Table 1. Genotypes of MGP polymorphisms in patients with ischemic stroke (IS) and control subjects. Data

presented as n (%). A – major allele; a – minor allele

Promoter T-138C Promoter G-7A Exon 4 Thr83Ala

IS group

(n=170)

Control group

(n=124)

IS group

(n=170)

Control group

(n=124)

IS group

(n=170)

AA 74 (59.7) trong>10trong>4 (61.2) 54 (43.5) 61 (35.9) 43 (34.7) 67 (39.4)

Aa 44 (35.5) 53 (31.2) 62 (50.0) 83 (48.8) 66 (53.2) 83 (48.8)

aa 6 (4.8) 13 (7.6) 8 (6.5) 26 (15.3) 15 (12.1) 20 (11.8)

The differences in the distribution of allelic

variants between the control and IS groups were

close to the level of statistical significance only for

the G-7A promoter polymorphism (P=0,051). In

women, but not in men, the differences between G-

7A genotypes frequency in IS and controls were

significant as shown in Table 2.

Using logistic regression analysis (Table 3), it

was estimated that A/A genotype (G-7A

polymorphism) was significantly (P=0.016)

associated with IS (OR=2.943; 95% CI, 1.218 –

7.trong>10trong>9). Respective analysis for male and female

subjects is presented in Table 4. Women who were

minor A-allele homozygotes had a risk of IS more

then 7 times higher compared with female carriers

of G/G genotype.

Some clinical characteristics of IS patients with

various MGP genotypes are presented in Table 5.

There were no differences in the studied parameters

between major allele homozygotes, heterozygotes,

and minor allele homozygotes for all three

polymorphisms (with the exception of sex

distribution for G-7A polymorphism).


22 Alexander V. ATAMAN et al.

Table 2. Genotypes of G-7A MGP promoter polymorphism in female and male patients with ischemic

stroke (IS) and control subjects. Data presented as n (%).

Table 3. Results of logistic regression analysis of association between MGP polymorphisms and ischemic

stroke.Homozygotes by major allele were considered as a reference group. SE – standard error, OR – odds

ratio, CI – confidential interval

SNP Genotype

Women Men

Genotype Control IS Control IS

Coefficient of

regression

SE

Wald

statistic

Pvalue

OR

%95 CI

Lower

%95 CI

Upper

Promoter T/C -0.186 0.258 0.521 0.470 0.830 0.500 1.377

T-138C C/C 0.382 0.526 0.527 0.468 1.465 0.522 4.trong>10trong>7

Promoter G/A 0.193 0.253 0.584 0.445 1.213 0.739 1.991

G-7A A/A 1.079 0.450 5.752 0.016 2.943 1.218 7.trong>10trong>9

Exon 4 Thr/Ala -0.235 0.259 0.824 0.364 0.790 0.476 1.313

Thr83Ala Ala/Ala -0.265 0.402 0.435 0.5trong>10trong> 0.767 0.349 1.687

Discussion

Arterial calcification is an abnormal process that

can greatly increase morbidity and mortality (Lehto

et al., 1996). MGP is considered one of the most

relevant physiological inhibitors of soft tissue

mineralization known today. In mice, targeted

deletion of the MGP gene causes extensive

calcification of the elastic lamellae of the

abdominal aorta (Luo et al., 1997). Extensive

vascular calcification is also induced when γcarboxylation

of MGP is inhibited using the

vitamin K-antagonist, warfarin (Price et al., 1998).

In the present study, we explored association

between genetic variation in the MGP gene and the

risk of IS development. Analysing MGP SNPs, we

found the G-7A promoter polymorphism to be

associated with IS in Ukrainian population. We did

not revealed statistically significant relation

between the other two studied polymorphisms (T-

138C, Thr83Ala) and IS.

Published data on the MGP SNPs association

with MGP serum concentration and artery

calcification, and the consequences of

G/G 18 (40.0) 21 (29.2) 36 (45.6) 40 (40.8)

G/A 25 (55.6) 34 (47.2) 37 (46.8) 49 (50.0)

A/A 2 (4.4) 17 (23.6) 6 (7.6) 9 (9.2)

Total 45 72 79 98

P-value 0.022 0.798

atherosclerosis (myocardial infarction in

particularly) are contradictory.

Farzaneh et al. (2001) did not find any

relationship between the G-7A polymorphism and

serum MGP level in healthy persons (Netherlands),

but did detect the significant association of T-138C

polymorphism with above-mentioned parameter.

The highest level of serum MGP was revealed in

the C/C homozygotes and the lowest one – in T/T

homozygotes.

In contrast to the above study, Crosier et al.

(2009) found no association of the T-138C

polymorphism with serum MGP concentration, but

they showed a significant relationship between the

other two polymorphisms (G-7A, Tht83Ala) and

serum MGP levels in the healthy men and women

(USA). In minor allele homozygotes, the serum

MGP concentration was the lowest, in major allele

homozygotes the highest, in heterozygotes the

intermediate values were registered.

In the same study, it was shown that all three

MGP SNPs (T-138C, G-7A, Thr83Ala) are related

to the coronary artery calcification (CAC) in men,

but not in women (Crosier et al., 2009).


MGP polymorphisms in ischemic stroke 23

Table 4. Logistic regression analysis of association between G-7A MGP promoter polymorphism and

ischemic stroke in male and female subjects. OR – odds ratio, CI – confidential interval

Sex Allele OR (CI) P-value

Women A/A vs. G/G 7.286 (1.479-35.895) 0.015

G/A vs. G/G 1.166 (0.516-2.632) 0.712

Men A/A vs. G/G 1.350 (0.437-4.166) 0.602

G/A vs. G/G 1.192 (0.641-2.217) 0.579

Table 5. Clinical characteristics of ischemic stroke patients with respect to genotypes. Data are mean ± SE.

A/A A/a a/a P

T-138C polymorphism

n trong>10trong>4 53 13

Age, years 65.4±0.92 63.0±1.39 64.7±2.13 0.288

Gender, M/F 58/46 35/18 5/8 0.162*

BMI (M), kg/m 2 27.8±0.56 27.4±0.64 28.1±1.22 0.862

BMI (F), kg/m 2 29.1±0.74 29.4±0.93 29.0±1.17 0.789

Systolic BP, mmHg 168±2.9 165±3.6 168±9.8 0.780

Diastolic BP, mmHg 96±1.7 94±1.8 93±3.8 0.628

Fasting glucose, mmol/L 5.9±0.15 5.9±0.2 6.1±0.53 0.916

G-7A polymorphism

n 61 83 26

Age, years 63.0±1.15 65.3±1.04 66.8±2.09 0.164

Gender, M/F 40/21 49/34 9/17 0.026*

BMI (M), kg/m 2 27.2±0.45 27.9±0.68 28.6±1.53 0.536

BMI (F), kg/m 2 28.3±0.8 29.9±0.86 28.2±1.13 0.315

Systolic BP, mmHg 167±3.7 167±3.3 167±5.2 0.996

Diastolic BP, mmHg 97±2.0 94±1.8 97±2.4 0.593

Fasting glucose, mmol/L 5.8±0.18 6.0±0.17 6.2±0.35 0.481

Thr83Ala polymorphism

n 67 83 20

Age, years 65.1±1.2 64.4±1.0 64.7±2.1 0.912

Gender, M/F 44/23 45/38 9/11 0.176*

BMI (M), kg/m 2 27.6±0.47 27.6±0.67 28.3±1.9 0.891

BMI (F), kg/m 2 29.4±0.84 28.6±0.78 29.9±1.53 0.668

Systolic BP, mmHg 163±3.7 171±3.0 163±6.6 0.252

Diastolic BP, mmHg 95±1.8 96±1.7 95±4.4 0.812

Fasting glucose, mmol/L 5.9±0.2 6.0±0.17 5.9±0.3 0.859


24 Alexander V. ATAMAN et al.

In some studies, MGP polymorphisms were

also shown to be associated with arterial

calcification and myocardial infarction (MI)

(Herrmann et al., 2000; Brancaccio et al., 2005),

while in others (Kobayashi et al., 2004; Taylor et

al., 2005) no association between MGP SNPs and

cardiovascular events was found. Moreover, in the

studies in which such associations were reported,

the relationship between the type of MGP

polymorphism and arterial calcification was

different. For example, in the AXA study, the

minor alleles -7A and 83Ala were associated with

increased femoral artery calcification (Herrmann et

al., 2000), while in the above-mentioned study by

Crosier et al. (2009), the same alleles were linked

to a decreased level of CAC.

It should be noted that the majority of studies

cited here was devoted to the relation of MGP to

CAC and MI. As to cerebral artery atherosclerosis

and its severe events such as IS, the role of arterial

calcification in this disease and the association of

MGP with cerebrovascular pathology were the

subject of investigation and discussion only in a

few publications. In particular, Bos et al. (2011)

established a close relationship between

calcification in the various vessel beds outside the

brain and imaging markers of vascular brain

disease. Calcification in each vessel bed was

shown to be associated with the presence of

cerebral infarcts and with larger volume of white

matter lesions (WMLs). The most prominent

associations were found between the intracranial

carotid calcification and WML volume and

between the extracranial carotid calcification and

infarcts.

Acar et al. (2012) studied a relationship of

serum MGP levels to the development of

intracerebral hemorrhages (ICH) and found that in

patients with ICH, serum MGP concentration was

much lower than in control group. Moreover, in the

non-survivors, the serum MGP levels were

statistically significantly lower in comparison to the

survivors. According to the authors, measurement

of this parameter may be of value to estimate

mortality.

At present, there are only a few publications

concerning relation of the MGP SNPs to

cerebrovascular disease. Analysing 236

polymorphisms, del Rio-Espinola et al. (20trong>10trong>)

showed that only two of them (G-7A of MGP and

T-1C of CD40) were related to the brain vessel

reocclusion after fibrinolysis in IS patients. In our

study, it was shown that the G-7A polymorphism of

MGP was associated with IS. In our previous

investigation (Harbusova et al., 2011), this variant

of the MGP promoter polymorphism was found to

be in association with the acute coronary syndrome

(ACS). Minor allele homozygotes (A/A) had

significantly higher risk of ACS as well as IS. This

could means that there are some common

mechanisms of pathogenesis in both ACS and IS

concerning to MGP. Those may be atherosclerosis,

arterial calcification, and thrombosis.

The relation of MGP to blood vessels

calcification is well known (see above). With

respect to coagulation and thrombi formation, it can

be suggested that MGP is somehow connected with

these processes (Krueger et al., 2009). Such an

assumption is based on the fact that MGP belongs

to vitamin K-dependent proteins, a large number of

which are procoagulants (prothrombin, factor V,

etc) and can influence blood clotting and thrombi

formation in the coronary and cerebral arteries. In

some papers (Wallin et al., 2008), an antagonistic

relationship between calcification and coagulation

is discussed. Therefore, MGP can be considered as

a connecting link between these two processes.

Certainly, this assumption requires experimental as

well as clinical proofs, and research in this

direction should be continued.

References

Abedin M, Tintut Y, Demer LL. Vascular

calcification. Mechanisms and clinical

ramifications. Arterioscler Thromb Vasc Biol.

24: 1161-1170, 2004.

Acar A, Cevik MU, Arıkanoglu A, Evliyaoglu

O, Basarılı MK, Uzar E, Ekici F, Yucel

Y, Tasdemir N. Serum levels of calcification

inhibitors in patients with intracerebral

hemorrhage.

232, 2012.

Int J Neurosci. 122: 227-

Adams HP, Bendixen BH, Kappelle LJ, Biller

J, Love BB, Gordon DL, Marsh EE.

Classification of subtype of acute ischemic

stroke. Definitions for use in a multicenter

clinical trial. TOAST. Trial of Org trong>10trong>172 in

Acute Stroke Treatment. Stroke. 24: 35-41,

1993.

Bos D, Ikram MA, Elias-Smale SE, Krestin

GP, Hofman A, Witteman JC, van der Lugt

A, Vernooij MW. Calcification in major vessel

beds relates to vascular brain disease.

Arterioscler Thromb Vasc Biol. 31: 2331-2337,

2011.


Brancaccio D, Biondi ML, Gallieni M, Turri O,

Galassi A, Cecchini F, Russo D, Andreucci V,

Cozzolino M. Matrix Gla protein gene

polymorphisms: clinical correlates and

cardiovascular mortality in chronic kidney

disease patients. Am J Nephrol. 25: 548-552,

2005.

Cancela L, Hsiehg CL, Francket U, Price PA.

Molecular structure, chromosome assignment,

and promoter organization of the human matrix

Gla protein gene. J Biol Chem. 265: 15040-

15048, 1990.

Crosier MD, Booth SL, Peter I, Dawson-Hughes B,

Price PA, O'Donnell CJ, Hoffmann U,

Wiilliamson MK, Ordovas JM. Matrix Gla

protein polymorphisms are associated with

coronary artery calcification. J Nutr Sci

Vitaminol. 55: 59-65, 2009.

Debette S, Sechardi S. Genetics of

atherothrombotic and lacunare stroke. Circ

Cardiovasc Gen. 2: 191-198, 2009.

del Río-Espínola A, Fernández-Cadenas I, Rubiera

M, Quintana M, Domingues-Montanari S,

Mendióroz M, Fernández-Morales J, Giralt D,

Molina CA, Alvarez-Sabín J, Montaner J.

CD40-1C>T polymorphism (rs1883832) is

associated with brain vessel reocclusion after

fibrinolysis in ischemic stroke.

Pharmacogenomics. 11: 763-772, 20trong>10trong>.

Doherty TM, Fitzpatrick LA, Inoue D, Qiao JH,

Fishbein MC, Detrano RC, Shah PK,

Rajavashisth TB. Molecular, endocrine, and

genetic mechanisms of arterial calcification.

Endocrine Rev. 25: 629-672, 2004.

Farzaneh-Far A, Davies JD, Braam LA, Spronk

HM, Proudfoot D, Chan SW, O'Shaughnessy

KM, Weissberg PL, Vermeer C, Shanaham CM.

A polymorphism of the human matrix γcarboxyglutamic

acid protein promoter alters

binding of an activating protein-1 complex and

is associated with altered transcription and

serum levels. J Biol Chem. 276: 32466-32473,

2001.

Garbuzova VYu, Gurianova VL, Story DA,

Dosenko VE, Parkhomenko AN, Ataman AV

Association of matrix Gla protein gene allelic

polymorphisms (G -7 →A, T -138 →C and

Thr83→Ala) with acute coronary syndrome in

the Ukrainian population. Exp Clin Cardiol. 17:

30-33, 2012.

MGP polymorphisms in ischemic stroke 25

Giachelli CM. Vascular calcification mechanisms.

J Am Soc Nephrol. 15: 2959-2964, 2004.

Guzman RJ. Clinical, cellular, and molecular

aspects of arterial calcification. J Vasc Surg. 45

(Suppl A): A57-A63, 2007.

Harbusova VYu, Hurianova VL, Parkhomenko

OM, Dosenko VE, Ataman OV. The frequency

of allelic polymorphism of matrix Gla-protein

gene in acute coronary syndrome patients.

Fiziol Zh. 57: 16-24, 2011.

Herrmann SM, Whatling C, Brand E, Nikaud V,

Gariepy J, Simon A, Evans A, Ruidavets LB,

Arveiler D, Luc G, Tiret L, Henney A, Cambien

F. Polymorphisms of the human matrix Gla

protein (MGP) gene, vascular calcification, and

myocardial infarction. Arterioscler Thromb

Vasc Biol. 20: 2386-2393, 2000.

Kobayashi N, Kitazawa R, Maeda S, Schurgers LJ,

Kitazawa S. T-138C polymorphism of matrix

Gla protein promoter alters its expression but is

not directly associated with atherosclerotic

vascular calcification. Kobe J Med Sci. 50: 69-

81, 2004.

Krueger T, Westenfeld R, Schurgers LJ,

Brandenburg VM. Coagulation meets

calcification: The vitamin K system. Int J Artif

Organs. 32: 67-74, 2009.

Kubo M. Genetic risk factors

of ischemic stroke identified by a genome-wide

association study. Brain Nerve. 60: 1339-1346,

2008.

Lehto S, Niskanen L, Suhonen M, Rönnemaa T,

Laasko M. Medial artery calcification. A

neglected harbinger of cardiovascular

complications in non-insulin-dependent diabetes

mellitus. Arterioscler Thromb Vasc Biol. 16:

978-988, 1996.

Low HQ, Chen CP, Kasiman K, Thalamuthu A, Ng

SS, Foo JN, Chang HM, Wong MC, Tai ES, Liu

J. A comprehensive association analysis of

homocysteine metabolic pathway genes in

Singaporean Chinese with ischemic stroke.

PLoS One. 6: e24757, 2011.

Luo G, Ducy P, McKee MD, Pinero GJ, Loyer E,

Behringer RR, Karsenty G. Spontaneous

calcification of arteries and cartilage in mice

lacking matrix Gla protein. Nature. 386: 78-81,

1997.


26 Alexander V. ATAMAN et al.

Matarin M, Brown WM, Dena H, Britton A, De

Vrieze FW, Brott TG, Brown RD, Worrall BB,

Case LD, Chanock SJ, Metter EJ, Ferruci L,

Gamble D, Hardy JA, Rich SS, Singleton A,

Meschia JF. Candidate gene polymorphisms for

ischemic stroke. Stroke. 40: 3436-3442, 2009.

Murshed M, Schinke T, McKee MD, Karsenty G.

Extra cellular matrix mineralization is regulated

locally: different roles of two Gla-containing

proteins. J Cell Biol. 165: 625-630, 2004.

Post W, Bielak LF, Ryan KA, Cheng YC, Shen H,

Rumberger JA, Sheedy PF, Shuldiner AR,

Peyser PA, Mitchell BD. Determinants of

coronary artery and aortic calcification in the

Old Order Amish. Circulation. 115: 717-724,

2007.

Price PA, Faus SA, Williamson MK. Warfarin

causes rapid calcification of the elastic lamellae

in rat arteries and heart valves. Arterioscler

Thromb Vasc Biol. 18: 1400-1407, 1998.

Proudfoot D, Shanahan CM. Molecular

mechanisms mediating vascular calcification:

role of matrix Gla protein. Nephrology

(Carlton). 11: 455-461, 2006.

Schurgers LJ, Teunissen KJF, Knapen MHJ,

Kwaijtaal M, van Diest R, Appels A,

Reutelingsperger CP, Cleutjens JPM, Vermeer

C. Novel conformation-specific antibodies

against matrix gamma-carboxyglutamic acid

(Gla) protein. Arterioscler Thromb Vasc Biol.

25: 1629-1633, 2005.

Taylor BC, Schreiner PJ, Doherty TM, Fornage M,

Carr JJ, Sidney S. Matrix Gla protein and

osteopontin genetic associations with coronary

artery calcification and bone density: the

CARDIA study. Hum Genet. 116: 525-528,

2005.

Wallin R, Schurgers L, Wajih N. Effects of the

blood coagulation vitamin K as an inhibitor of

arterial calcification. Thromb Res. 122: 411-

417, 2008.

Wang X, Cheng S, Brophy VH, Erlich HA,

Mannhalter C, Berger K, Lalouschek W,

Browner WS, Shi Y, Ringelstein EB, Kessler C,

Luedemann J, Lindpaintner K, Liu L, Ridker

PM, Zee RY, Cook NR. A meta-analysis of

candidate gene polymorphisms and ischemic

stroke in 6 study populations: association of

lymphotoxin-alpha in nonhypertensive patients.

Stroke. 40: 683-695, 2009.

Weissen-Plenz G, Nitschke Y, Rutsch F.

Mechanisms of arterial calcification: spotlight

on the inhibitors. Adv Clin Chem. 46: 263-293,

2008.


Journal of Cell and Molecular Biology trong>10trong>(1):27-32, 2012 Research Article 27

Haliç University, Printed in Turkey.

http://trong>jcmbtrong>.trong>halictrong>.trong>edutrong>.tr


Survivin geni -625G/C polimorfizminin Küçük Hücreli Dışı Akciğer

Kanseri ile ilişkisinin araştırılması

Engin AYNACI 1 , Ender COŞKUNPINAR 2 , Ayşe EREN 2 , Onur KUM 1 , Yasemin

MÜŞTERİ OLTULU 2 , Nergiz AKKAYA 2 , Akif TURNA 3 , İlhan YAYLIM 2 , Pınar

YILDIZ *1 .

1 Yedikule Chest Diseases and Thoracic Surgery Training Hospital, Istanbul, Turkey

2 Department of Molecular Medicine, Institute of Experimental Medicine, Istanbul University, Istanbul,

Turkey

3 Cerrahpaşa Medicine Faculty, Department of Thoracic Surgery, Istanbul University, Istanbul, Turkey

(*author for correspondence; pinary70@yahoo.com)

Received: 14 February 2012; Accepted: 21 May 2012

Özet

Akciğer kanseri tüm kanser türleri arasında görülme sıklığı olarak ikinci sırada, kanser sebepli ölümler

arasında ise ilk sırada gelmektedir. Survivin geni 17q25 kromozomal bölgesinde lokalizedir ve 142 amino

asitten oluşan bir protein kodlar. Survivin (BIRC5) apoptozu düzenleyen önemli bir protein ailesi olan

apoptoz proteinlerinin inhibitörü (IAPs) olarak ilk bulunan inhibitörlerden biridir ve özellikle kanser

hücrelerinde ifadesi gerçekleşir. Survivin genindeki polimorfizm survivin üretimi ve aktivitesine etki

edebilir, bu nedenle akciğer kanserine hassasiyet sağlar. Survivin genindeki aşırı ifadenin çok çeşitli

maligniteleri içeren kanser türlerinde hastalık gelişimi, nüksü ve prognozu ile ilişkili olduğu bilinmektedir.

Bu çalışmada bir Türk popülasyonunda survivin geni promotör bölgesi üzerinde bulunan -625G/C gen

polimorfizmi ile küçük hücreli dışı akciğer kanseri arasında, hastalığın gelişimi ile ilgili olası ilişkilerin

araştırılması amaçlandı. Çalışmaya 146 hasta, 98 kontrol olgu dahil edildi. Yöntem olarak PCR-RFLP tekniği

kullanıldı. Sonuç olarak survivin -625G/C genotip dağılımları incelendiğinde hasta ve kontrol grupları

arasında istatistiksel olarak anlamlı fark olmadığı tespit edilmiştir.

Anahtar kelimeler: Küçük hücreli dışı akciğer kanseri, survivin, gen polimorfizmi, PCR-RFLP, biyobelirteç.

Investigation of the association of survivin gene -625G/C polymorphism in non-small cell

lung cancer

Abstract

Lung cancer is the second most common cancer type diagnosed and first in cancer related deaths among all

cancers worldwide. The survivin gene is located on human chromosome 17q25, encoding a protein consisting

of 142 amino acids. Survivin is one of the first reported inhibitors of apoptosis proteins, which is an

important family of proteins that regulate apoptosis. Survivin gene polymorphism may affect the survivin

production and activity, thus providing sensitivity for the development of lung cancer. The overexpression of

survivin gene was found to be associated with disease development, recurrence and prognosis in various

malignancies, including cancers. In this study the demonstration of the prognosis related associations

between the -625G/C gene polymorphism located on the survivin promoter region and non small cell lung

cancer in a Turkish population was aimed. 146 patients and 98 control subjects included to the study. PCR-

RFLP technique was used as the method. According to survivin -625G/C genotype distribution analysis, no

statistically significant difference between patients and controls were found.

Keywords: Non small cell lung cancer, survivin, gene polymorphism, PCR-RFLP, biomarker.


28 Engin AYNACI et al.

Giriş

Akciğer kanseri tüm dünyada kansere bağlı

ölümlerin önde gelen sebebi olarak bilinmektedir.

Bununla birlikte özellikle Amerika’da kansere bağlı

ölüm oranları arasında akciğer kanseri sıklığı

gitgide azalmakta, fakat Çin gibi sigara tüketiminin

özellikle son 20 yılda arttığı bazı ülkelerde akciğer

kanseri sebepli ölüm oranının arttığı

gözlenmektedir. Amerika’da 2008 yılında 215.020

yeni vaka belirlenirken, 161.840 kişinin bu hastalık

sebebiyle öldüğü, kayıtlarda yer almaktadır.

Akciğer kanserinin küçük hücreli (KHAK) ve

küçük hücreli dışı (KHDAK) olmak üzere iki tipi

vardır. Son 60 yıldır akciğer kanserinde hastalık

gelişiminin kalıtsal bir temele oturduğu

belirtilmektedir. (Julian et al., 2008).

Programlanmış hücre ölümü olarak bilinen apoptoz,

önemli bir hücre büyüme kontrol mekanizmasıdır

(Yuan-Hung et al., 2009; Thompson, 1995).

Survivin (BIRC5 olarak da bilinir) apoptozu

düzenleyen önemli bir protein ailesi olan apoptoz

proteinlerinin inhibitörü (IAP) olarak ilk bulunan

inhibitörlerden biridir ve özellikle kanser

hücrelerinde ifadesi gerçekleşir (Reed,1997).

Survivin terminal tetikleyici kaspaz-3 ve kaspaz-9

aktivitesini inhibe ederek her iki apoptoz yolunun

baskılanmasını bloke eder (Nicholson and

Thornberry, 1997). Ayrıca survivin apoptotik

uyarıcıyla indüklenen interlökin (IL-3), Fas

(CD95), Bax, tümör nekroz faktörü α, kaspazlar ve

antikanser ilaçlarınının etkisini yok eder (Chan et

al., 2009; Yun-Hong et al., 2004). Mitozda

düzenleyici rol oynadığı da çeşitli yayınlarda (Chan

et al., 2009) bildirilmiş olan survivin geni 17q25

kromozomal bölgesinde lokalizedir ve 142 amino

asitten oluşan bir protein kodlar (Chiou et al., 2003;

Deveraux et al., 1997; Uren et al., 1998).

Survivin ayrıca mikrotübül dinamiklerinin

düzenlenmesinde de önemli rol oynar (Li et al.,

1998; Li and Altieri, 1999; Altieri, 2006; Giodini et

al., 2002). Survivin geni promotör bölgesindeki

polimorfizmler genin transkripsiyonuna etki ettiği

için gen aktivitesini ve ekspresyonunu değiştirerek

akciğer kanserine yatkınlık sağlayabilir (Jin Sung et

al., 2008).

Survivin hücre döngüsünde G2/M fazında bol

miktarda eksprese olur ve G1 fazında hızlı

regülasyon sergiler (Li et al., 1998). Bu durum

transkripsiyonel basamakta kontrol edilir ve hücre

döngüsüne bağlı elementler (CDE) ve hücre

döngüsü homoloji bölgeleri (CHR) survivin

promotörünün proksimal bölgesinde lokalize olur

(Masayuki et al., 2000; Li and Altieri, 1999).

Survivin geni ekspresyon düzeylerindeki artışın

bazı hastalıklar için prognostik belirteç olabileceği

düşünülmektedir (Chun-Hua et al., 20trong>10trong>). Survivin

genellikle embriyonik dokularda ifade olur ve

görülen homozigot mutasyonların erken

embriyonik dönemde ölümle sonuçlanması bu gen

ailesinin hücre gelişimi, farklılaşması ve homeostaz

sürecinde çok önemli rol oynadığını göstermektedir

(Chan et al., 2009).

Çeşitli tek-nükleotit polimorfizmleri survivin

gen bölgesi promotöründe tespit edilmiştir.

Bunlardan en çok bilineni ve literatürde en fazla

çalışması yapılmış olan CDE/CHR reseptör

bağlayıcı bölgede lokalize olan -31G/C gen

polimorfizmidir. Survivin geninin promotör

bölgesindeki bu mutasyon sonucu hücre

döngüsünden bağımsız olarak genin

transkripsiyonu ve bunun sonucunda da aşırı ifadesi

görülür (Xu et al., 2004).

Bu çalışmada KHDAK hastalarında PCR-RFLP

tekniği kullanılarak survivin geni promotör

bölgesindekiki -625G/C (rs8073069)

polimorfizminin bir Türk popülasyonunda KHDAK

hastalığına yatkınlığı araştırılmıştır.

Akciğer kanseri ile ilgili olarak eldeki verilerin

doğru olarak kullanılması ve buna ek olarak

hastalık oluşumu ya da gelişiminin anlaşılmasına

yönelik belirteçlerin ve genetik mekanizmaların

anlaşılması özellikle hastalığın erken tanısı ve

tedavi sürecinde bu hastalar için anlamlı olacaktır.

Materyal ve metod

Örneklerin tanımı

Çalışma ile ilgili olarak öncelikle İstanbul

Üniversitesi İstanbul Tıp Fakültesi Etik

Değerlendirme Komisyonu’ndan 09.06.20trong>10trong> tarih

ve 20trong>10trong>/228-36 dosya numarası ile etik kurul onayı

alındı. Çalışmaya Yedikule Göğüs Hastalıkları ve

Göğüs Cerrahisi Eğitim ve Araştırma Hastanesi 3.

Klinikte ve İstanbul Üniversitesi Cerrahpaşa Tıp

Fakültesi Göğüs Cerrahisi Kliniğinde tanı konulan

toplam 146 KHDAK olgusu ile yine aynı

kliniklerde tetkik edilen ve kronik hastalık veya

malignite bulgusu saptanmayan 98 sağlıklı kontrol

olgusu alındı. Çalışmaya girmeyi kabul edenlere

gönüllü olur imzaladıktan sonra 1 adet EDTA’lı

tüpe trong>10trong> ml kanları alınarak soğuk zincirle

laboratuvara ulaştırıldı.

DNA izolasyonu

Gönüllülerden alınan kanlardan High Pure PCR

Template Preparation Kit (Roche, Manheim)

protokolüne uygun olarak genomik DNA


izolasyonu yapıldı ve daha sonra Nano Drop

Spektrofotometre kullanılarak, elde edilen

DNA’ların konsantrasyonları ölçüldü. DNA’lar

konsantrasyonları trong>10trong>0 ng/μl olacak şekilde

seyreltildi.

PCR

Survivin geni promotör bölgesindeki -625G/C

polimorfizmine özgü primerler (Tablo 1) dizayn

edildi. PCR, total hacim 25 µl ve trong>10trong>X PCR Buffer

(MBI Fermentas), 1mM MgCl2, 0.2 mM dNTP,


KHDAK’de survivin polimorfizmi 29

0.375 mM her bir primer, trong>10trong>0 ng genomik DNA ve

1 U Taq DNA polimeraz (MBI Fermentas) olacak

şekilde dizayn edildi. Amplifikasyon şartları,

95°C’de trong>10trong> dakika ilk denatürasyondan sonra

95°C’de 45 saniye, 72°C’de 60 saniye 5 döngü,

takiben 94°C’de 45 saniye, 60°C’de 45 saniye ve

72°C’de 60 saniye 30 döngü, uzama aşamasında da

trong>10trong> dakika 72°C’de olacak şekilde düzenlendi.

Optimum amplifikasyon şartları sağlanarak PCR

ürünleri %2 lik agaroz jel elektroforezinde

yürütüldü.

Tablo 1. Survivin geni promotör -625 G/C bölgesi primerleri (FP: İleri Primer, RP: Geri Primer)

Polimorfizm Primer Dizileri PCR Ürün boyu

-625C/G

(rs8073069)

Restriksiyon analizi

FP: 5’-TGTTCATTTGTCCTTCATGCGC-3’

RP: 5’-CCAGCCTAGGCAACAAGAGCAA-3’

Amplifiye olan PCR ürünleri BstUI restriksiyon

enzimi ile uygun tamponu içeren karışım

hazırlandıktan sonra 37°C de 4 saat inkübe edildi.

Kesim ürünleri % 3’lük agaroz jelde trong>10trong>0 volt

elektrik altında, 20 dakika yürütüldükten sonra UV

altında incelenerek genotipler tespit edildi.

İstatistiksel analiz

AJJC tarafından yayınlanmış olan evrelendirme

sistemine göre tümör evrelendirmesi yapılan hasta

olguları ve kontrollere ait veriler SPSS 15.0

programına yüklendi ve kategorik verilerin

karşılaştırılmasında ki-kare testi ve parametrik ttesti

kullanıldı.

Şekil 1. Survivin geni -625 G/C bölgesi PCR

görüntüsü

Sonuçlar

125 bç

BstUI kesimi sonrası

ürün boyları

CC: 125

CG: 125/trong>10trong>4/21

GG: trong>10trong>4/21

Çalışmaya 146 KHDAK hastası ve 98 kontrol olgu

dahil edildi. Hastaları yaş ortalaması 60,41 yaş

(±9,71), kontrol olgularının yaş ortalaması 55,23

yaş (±8,8.) di. Çalışmaya dahil edilen hastalardan

132’si erkek (%90,4), 14’ü kadın (%9,6), kontrol

grubu olgularının ise 56’sı erkek (%57,1), 42’si

kadındı (%42,9). Hasta ve kontrol grubuna ait

genotip ve alel dağılımları Tablo 2’de verilmiştir.

PCR sonucu elde edilen bant boyu 125 baz çifti

büyüklüğünde (Şekil 1); BstUI restriksiyon enzimi

kesimi sonucu elde edilen bant büyüklükleri ise

125, trong>10trong>4 ve 21 baz çifti olarak görüntülendi (Şekil

2).

Şekil 2. BstUI kesimi %3’lük

jel elektroforezi görüntüsü. M: 50 bp DNA markörü


30 Engin AYNACI et al.


Tablo 2. Hasta ve kontrol grubuna ait genotip ve alel dağılımları

Genotipler ve Alel

dağılımları

Kontrol

Grubu

N=98

Hasta

Grubu

N=146

-625G/C N % N %

GG 56 57.1 72 49.3

GC 32 32.7 57 39.1

CC trong>10trong> trong>10trong>.2 17 11.6

Aleller

P değeri χ2

0.484 1.45

tamamlamış

yapmış

yapmış

G

C

144

52

56.06

43.94

201

91

58.59

41.41

0.27 1.21

Tartışma

düzeyindeki artışın -31G/C polimorfizmi ile ilişkili

olduğunu ve bu artışın hem mRNA düzeyinde hem

de protein düzeyinde meydana geldiğini

Kanser oluşumunda apoptoz mekanizmasındaki

bozukluklar önemli rol oynamaktadır. Apoptoz,

farklı inhibe ve aktive edici ajanlar tarafından

kontrol altında tutulan önemli bir olaydır. Kanserde

apoptozun çeşitli anti-apoptotik proteinler

tarafından inhibisyonu söz konusudur.

Survivin, hücre döngüsünün düzenlenmesinde

temel rol oynayan başlıca anti-apoptotik faktördür.

Ayrıca survivinin Bcl-2 ve diğer IAPlerin aksine

farklılaşmasını normal dokularda

anlatımı olmayan ancak çeşitli kanser tiplerinde

ifade edilen bir protein olduğu bilinmektedir. Bu

durum survivin genindeki anormal ifadenin

transkripsiyonel regülasyon bozukluğuna sebep

olduğunun açık bir göstergesidir. Apoptozu inhibe

eden diğer proteinlerde de bulunan BIR

(“Baculovirus IAP Repeat”) bölgesi ile kaspazlara

bağlanarak etkisini göstermektedir. Dai ve ark.

20trong>10trong> yılında yaptıkları çalışmada survivin geni

promotor bölgesindeki polimorfizmlerin

KHDAK’de gen modifikasyonuna neden

olabileceğini ileri sürmüşlerdir.

Jang ve ark. tarafından yapılan çalışmada -31 G

alelinin -31 C aleline göre önemli derecede düşük

transkripsiyonel aktiveye sahip olduğu ve bu

durumun -31G/C polimorfizminden etkilenerek

ortaya çıktığı ve buna bağlı olarak -31G/C

polimorfizminin akciğer kanserine yatkınlıkta

önemli bir rolü olduğu belirtilmektedir. (Jang et al.,

2008). Xu ve ark. kanser hücre hatları ile

oldukları bir çalışmada survivin gen ifadesi

.

bildirmişlerdir.

Klinik perspektiften bakıldığında kişisel

paternlerle klinik özelliklerin öngörülmesinde

hastaların genetik parmak izinde survivin geni

ifadesi düzeylerinde ve genetik varyantlarda oluşan

değişikliklerin olası tedaviye yanıtta erken bir

belirteç olabileceğini söylemek mümkündür.

Örneğin plevral efüzyondaki yüksek survivin

düzeylerinin kötü prognoz göstergesi olduğu Lan

ve ark. 20trong>10trong> yılındaki yayınında gösterilmiştir.

Yang ve ark 2009 yılında özefagus kanserli

hastalarda yaptıkları bir çalışmada C alleline sahip

olmanın hastalık riskini 1.4 kat arttırdığını

söylemektedirler. Özefagus kanseri hastalarında

survivin -625G/C promotor polimorfizminin p53

düzeyine bağlı olan survivin yüksek ifadesi

olasılığını artırdığı düşünülmektedir.

Sonuç olarak bir Türk popülasyonu üzerinde

olduğumuz bu çalışmada survivin geni -625

G/C bölgesi (rs8073069) polimorfizminin küçük

hücreli dışı akciğer kanseri hastalığına yatkınlık

sağladığına dair herhangi bir bulgu elde edilemedi.

Ancak olgu sayısının artırılması ve polimorfik

bölgenin özellikle transkripsiyonun aktivitesine etki

eden promotör bölgesinde olmasından dolayı

yapılabilecek ekspresyon çalışmaları ile özellikle

tanı öncesi ve sonrası gen anlatım ifadesine bağlı

değişikliklerin öngörülmesine yardımcı olabilecek

daha anlamlı sonuçlara ulaşılabileceği

kanaatindeyiz.


Kaynaklar

Altieri DC. Survivin apoptosis: an interloper

between cell death and proliferation in cancer.

Lab Invest. 79: 1327-1333, 1999.

Altieri DC. The case for survivin as a regulator of

microtubule dynamics and cell-death decisions.

Curr Opin Cell Biol. 18: 609-615, 2006.

Chan H. Han, Qingyi Wei, Karen K. Lu,

Zhensheng Liu, Gordon B. Mills, Li-E Wang.

Polymorphisms in the survivin promoter are

associated with age of onset of ovarian cancer.

Int J Clin Exp Med. 2: 289-299, 2009.

Chiou SK, Jones MK, Tarnawski AS. Survivin an

anti-apoptosis protein: its biological roles and

implications for cancer and beyond. Med Sci

Monit. 9:I25-I29, 2003.

Chun-Hua Dai, Jian Li, Shun- Bing Shi, Li- Chao

Yu, Li-Ping Ge, Ping Chen, Survivin and Smac

Gene Expressions but not Livin Are Predictors

of Prognosis in Non-small Cell Lung Cancer

Patients Treated with Adjuvant Chemotherapy

Following Surgery. Jpn J Clin Oncol. 2-9,

20trong>10trong>.

Dai J, Jin G, Dong J, Chen Y, Xu L, Hu Z, Shen H.

Prognostic significance of survivin

polymorphisms on non-small cell lung cancer

survival. J Thorac Oncol. 20trong>10trong>

Nov;5(11):1748-54. PubMed PMID: 20881643.

Deveraux QL, Takahashi R, Salvesen GS and Reed

JC. X-linked IAP is a direct inhibitor of celldeath

proteases. Nature. 388: 300-304, 1997.

Giodini A, Kallio MJ, Wall NR, Gorbsky GJ, Tognin

S, Marchisio PC, Symons M and Altieri

DC. Regulation of microtubule stability and

mitotic progression by survivin. Cancer Res.

62: 2462-2467, 2002.

Jang JS, Kim KM, Kang KH, Choi JE, Lee WK,

Kim CH, Kang YM, Kam S, Kim IS, Jun JE,

Jung TH, Park JY. Polymorphisms in the

survivin gene and the risk of lung cancer. Lung

Cancer. Apr;60(1):31-9, 2008.

Jin Sung Jang,,Kyung Mee Kim, Kyung Hee Kang,

Jin Eun Choi, Won Kee Lee, Chang Ho Kim,

Young Mo Kang, Sin Kam, In-San Kim, Jae

Eun Jun, Tae Hoon Jung, Jae Young Park.

Polimorphizms in the survivin gene and the risk

of lung cancer. Lung Cancer. 60:31-39, 2008.

KHDAK’de survivin polimorfizmi 31

Julian R. Molina, Ping Yang, Stephen D. Cassivi,

Steven E. Schild,, Alex A. Adjei, Non–Small

Cell Lung Cancer: Epidemiology, Risk Factors,

Treatment, and Survivorship. Mayo Clin

Proc.83(5): 584–594.,2008.

Lan CC, Wu YK, Lee CH, Huang YC, Huang CY,

Tsai YH, Huang SF, Tsao TC. Increased

survivin mRNA in malignant pleural effusion is

significantly correlated with survival. Jpn J Clin

Oncol. Mar;40(3):234-40, 20trong>10trong>.

Li F, Ambrosini G, Chu EY, Plescia J, Tognin S,

Marchisio PC and Altieri DC. Control of

apopto-sis and mitotic spindle checkpoint by

survivin. Nature. 396: 580-584, 1998.

Li F.,Altieri DC. The cancer antiapoptosis mouse

survivin gene: characterization of locus and

transcriptional requirements of basal and cell

cycle-dependent expression. Cancer Res.59:

3143-3151, 1999.

Masayuki Otaki, Masahiko Hatano, Koichi

Kobayashi, Takeshi Ogasawara, Takayuki

Kuriyama, Takeshi Tokuhisa Cell cyledependent

regulation of TIAP/m-survivin

expression. Biochim Biophys Acta. 1493:188-

194, 2000.

Nicholson DW,Thornberry NA. Caspase:killer

proteases. Trends Biochem Sci. 22:299-306,

1997.

Reed JC. X-linked IAP is a direct inhibitor of celldeath

proteases. Nature. 388: 300-304, 1997.

Thompson CB. Apoptosis is the pathogenesis and

treatment of disease. Science. 5267:1456-1462,

1991.

Uren AG, Coulson EJ and Vaux DL. Conserva-tion

of baculovirus inhibitor of apoptosis repeat

proteins (BIRPs) in viruses, nematodes, vertebrates

and yeasts. Trends Biochem Sci. 23: 159-

162, 1998.

Xu Y, Fang F, Ludewig G, Jones G, Jones D. A

mutation found in promoter region of the human

survivin gene is correlated to overexpression of

survivin in cancer cells. DNA Cell Biol.

23:419-429, 2004.

Yang X, Xiong G, Chen X, Xu X, Wang K, Fu Y,

Yang K, Bai Y. Polymorphisms of survivin

promoter are associated with risk of esophageal

squamous cell arcinoma. J Cancer Res Clin

Oncol. Oct;135(trong>10trong>):1341-9, 2009.


32 Engin AYNACI et al.

Yang X, Xiong G, Chen X, Xu X, Wang K, Fu Y,

Yang K, Bai Y. Survivin expression in

esophageal cancer: correlation with p53

mutations and promoter polymorphism. Dis

Esophagus. 2009;22(3):223-30.

Yuan-Hung Wang, Hung-Yi Chiou, Chang-Te Lin,

Hsiao-Yen Hsieh, Chia-Chang Wu, Cheng-Da

Hsu, Cheng-Huang Shen. Association Between

Survivin Gene Promoter -31C/G Polymorphism

and Urothelial Carcinoma Risk in Taiwanese

Population. Urology. 73 (3):670-674, 2009.

Yun-Hong Li, Chen Wang, Kui Meng, Long-Bang

Chen, Xiao-Jun Zhou, İnfluence of survivin and

caspase-3 on cell apoptosis and prognosis in

gastric carcinoma. World J Gastroenterol.

trong>10trong>(13):1984-1988, 2004


Journal of Cell and Molecular Biology trong>10trong>(1):33-40, 2012 Research Article 33

Haliç University, Printed in Turkey.

http://trong>jcmbtrong>.trong>halictrong>.trong>edutrong>.tr

Effects of prenatal and neonatal exposure to lead on white blood

cells in Swiss mice

Ragini SHARMA*, Khushbu PANWAR, Sheetal MOGRA

Environmental and Developmental Toxicology Research Lab, Department of Zoology, M. L. S. University,

Udaipur- 313001 Rajasthan, India

(* author for correspondence; taurasragini@yahoo.com)

Received: 27 August 2011; Accepted: 25 May 2012

Abstract

Lead exposure is one of the major environmental issues for children and women of child bearing age. It

crosses the placental barrier and its greater intestinal absorption in fetus results in developmental defects.

Lead, as one of the environmental pollutants, can threat the lives of animals and human beings in many ways;

especially during developing stages. The present study was carried out to study the alterations in different

types of white blood cells (WBC) due to chronic lead acetate toxicity in neonates, which passes from adult

pregnant female during gestation and lactation. Lead acetate was administered orally at 8, 16, 32 mg /kg/BW

to pregnant Swiss mice from trong>10trong>th day of gestation to 21th day of lactation. Hematopathological and

numerical alterations in the WBCs were examined in the neonates after birth at postnatal days 1, 7, 14 and

21. Blood smears examined illustrate that lead induces disturbances in the development of different types of

WBCs during postnatal development and lead to an abrupt neutrophilic degeneration, immature cells,

abnormal neutrophils, reactive and plasmacytoid lymphocytes. The results of the present study emphasize

that prenatal lead exposure is extremely dangerous to developing fetus.

Keywords: Lead acetate, Swiss albino mice, prenatal, neonatal, white blood cells.

Swiss farelerde prenatal ve yenidoğan kurşun maruziyetinin beyaz kan hücreleri üzerine

etkileri

Özet

Kurşun maruziyeti çocuklar ve çocuk doğurma çağındaki kadınlar için majör çevresel konulardan birisidir.

Plasental bariyeri geçer ve fetusta barsaklardan emilimi, gelişimsel defektlerle sonuçlanır. Çevresel

kirliliklerden biri olan kurşun, birçok yönden özellikle gelişim çağı boyunca insan ve hayvan hayatını tehdit

etmektedir. Bu çalışma, yetişkin hamile dişilerden gebelik ve laktasyon süresince yenidoğanlara geçen

kurşun asetatın yarattığı kronik toksisite sebebiyle lökositlerin farklı tiplerindeki değişimleri incelemek için

yapılmıştır. Kurşun asetat, hamile Swiss farelere gebeliğin trong>10trong>. gününden laktasyonun 21. gününe kadar ağız

yoluyla 8, 16, 32 mg /kg//BW şeklinde uygulanmıştır. Yenidoğanlarda doğumdan sonraki 1, 7, 14 ve 21.

günlerde beyaz kan hücrelerindeki hematopatolojik ve sayısal değişiklikler incelenmiştir. Kurşunun doğum

sonrası gelişim sırasında lökositlerin farklı tiplerinin gelişimindeki bozuklukları indüklediğini ve ani

trofilik olgunlaşmamış dejenerasyona, hücreler, anormal nötrofillere, reaktif ve plazmasitoid lenfositlere

neden olduğunu göstermek için kan yaymaları incelenmiştir. Bu çalışmanın sonuçları prenatal kurşun

maruziyetinin gelişen fetus için son derece tehlikeli olduğunu vurgulamaktadır.

Anahtar kelimeler: Kurşun asetat, Swiss albino fare, prenatal, yenidoğan, lökosit.


34Ragini SHARMA et al.

Introduction

Lead has been recognized as a biological toxicant

and different doses have been used to study leadinduced

alterations Prenatal exposure to lead

produces toxic effects in the human fetus, including

increased risk of preterm delivery, low birth

weight, and impaired mental development; because

during the period of early organogenesis the onset

of greatest susceptibility to teratogenesis occurs

(Falcon et al., 2003). This highly sensitive or

critical period is the time during which a small dose

of a teratogen produces high percentage of fetuses

that exhibit malformations of the organ in question

(Wilson, 1973; Desesso et al., 1996).

Pregnancy and breastfeeding can cause a state

of physiological stress that increases bone turnover

of lead. Lead stored in the bone moves into the

blood, increasing the mother’s blood lead level and

passing to the fetus, affecting fetal development.

Lead is tightly bound to red blood cells, enhancing

transfer from maternal circulation through the

placenta to the fetus. Fetus is more sensitive to lead

because the fetal blood-brain barrier is more

permeable. The toxic effects of lead on blood

indices are well known.

Lead potentially induces oxidative stress and

evidence is accumulating to support the role of

oxidative stress in the pathophysiology of lead

toxicity. Lead is capable of inducing oxidative

damage to brain, heart, kidneys, and reproductive

organs. The mechanisms for lead-induced oxidative

stress include the effects of lead on membranes,

DNA, and antioxidant defense systems of cells

(Ahamed and Siddiqui, 2007). Lead interferes with

a variety of body processes and is toxic to the body

systems including cardiovascular, reproductive,

hematopoietic, gastrointestinal and nervous systems

(Kosnett, 2006), renal functions (Patocka and

Cerny, 2003) and release of glutamate (Xu et al.,

2006). It affects the hematological system even at

concentrations below trong>10trong>μg/dl (ATSDR, 2005).

Many reports are available regarding lead

toxicity and its deleterious effects in various

species of animals and there has been lot of work

carried out on pharmacokinetics and genotoxicity

but very few researchers tried to correlate

haematopathological alterations of lead acetate in

different white blood cells at different dose levels

in laboratory animals, especially in mice.

Therefore the current study was performed to

clarify the lead induced hematological changes,

especially those related to white blood cells, during

gestational and lactational exposure to lead in

Swiss mice.

Materials and methods

Sexually mature random bred Swiss mice with the

age of 5-6 weeks, weighing 25-30 gm was used for

this study. During the entire experimental period,

the animals were fed on a standard diet and water

ad libitum. Mice were kept in the ratio of 1:4 males

and females, respectively, and females showing

vaginal plugs were separated in the control and lead

treated group. Lead acetate solution was prepared

by dissolving 4gm lead acetate in 12ml distilled

water. Pregnant Swiss mice were given lead acetate

at a concentration of 8, 16 and 32 mg (266.66,

533.33, and trong>10trong>66.66 mg/kg/bodyweight) from trong>10trong> th

day of gestation to 21 st day of lactation. Blood

samples were obtained from the tail of pups from

each litter at days 1,7,14 and 21 day after birth. The

tip of the tail was cleaned with spirit before being

cut with a sharp blade and was not squeezed to

avoid dilution of blood by tissue fluid.

Blood cells were studied in smears prepared by

spreading a drop of blood thinly over a clean and

sterilized microscopic slide with the help of another

slide moved over the first at the angle of 45ᵒ after

discarding first drop of blood. These blood films

were air-dried and fixed in absolute methanol for

15 minutes by dipping the film briefly in a Coplin

jar containing absolute methanol. After fixation the

slides were removed and air-dried. Afterward blood

smears were stained with freshly made Giemsa

stain diluted with water buffered to pH 6.8 or 7.0

(1:9) stain and buffer respectively. The slides were

washed by briefly dipping the slide in and out of a

Coplin jar of buffered water and air dried again for

taking observations. The erythrocytes appear pink

to purple, whereas leukocytes turned blue black in

color. All the experimental work was approved by

the Institutional Animal Ethics Committee.

No./CS/Res/07/759.

Group 1- Control (distilled water only).

Group 2- Exposure to 8 mg lead acetate (266.66

mg/kg BW) from trong>10trong>th day of gestation up to 21st

day of lactation.

Group 3- Exposure to 16 mg lead acetate

(533.33 mg/kg BW) from trong>10trong>th day of gestation up

to 21st day of lactation.

Group 4- Exposure to 32 mg lead acetate

(trong>10trong>66.66 mg/kg BW) from trong>10trong>th day of gestation up

to 21st day of lactation.

The statistical analysis was performed following

t-test for the comparison of data between different

experimental groups. The data was calculated using


prism software to calculate the p values. trong>10trong>0 WBC

from each group were counted at different weeks,

different cell types were identified and % ratio was

calculated. For numerical observation highest dose

level was selected.

Results

In the control group all the WBCs showed normal

appearance. The neutrophils in control group were

examined by a very characteristic nucleus with

condensed chromatin. It is divided into 3-5 lobes

(Fig.1A, 1, 2, 5 and 6) at birth which was observed

with an increase by 5 to 6 lobes (Fig.1B, 1 and 3) at

the termination of lactation, connected by thin

strands of chromatin. Lymphocytes were round or

ovoid at the time of birth (Fig. 1A, 3 and 4) but

further on they were found notched or slightly

indented (Fig. 1B, 5 and 6). The chromatin was

generally diffusely dense. Ordinarily, nucleoli were

not visible. A perinuclear clear zone surrounding

the nucleus was visible after first week of lactation

in some cells. The cytoplasm stained light blue and

ranges from sparse to moderately abundant in

amount. The monocyte in control group were round

with smooth margins, the nucleus was oval,

indented and slightly folded (Fig.1B, 4). The

chromatin material was moderately clumped and

relatively less dense compared to that of

neutrophils or lymphocytes. There was no visible

nucleolus with abundant cytoplasm.

The administration of lead acetate altered the

appearance and caused structural changes. The

following hematological observations were taken

during postnatal period from birth till the

termination of the lactation period upon exposure

of different doses of lead acetate:

1. At the time of birth (PND1)

Abnormal neutrophils: In lead treated groups

the neutrophils showed structural abnormalities in

their nucleus including improper segmentation and

lesser condensation of nucleus. At a lower dose the

chromatin material was condensed, all the lobes

were interconnected with each other and form a

nodule like structure at one side (Fig.1C, 1).

Degeneration: In lead treated group most of the

neutrophils appeared in degenerating state in which

the chromatin material was very less condensed,

fused and there was no sign of clear lobulization

and segmentation (Fig. 1C, 2).

Immature cells: In lead treated group the

number of immature cells was increased (Fig. 1C,

3).

Prenatal and neonatal exposure to lead 35

Ring shaped: In lead treated groups, some

neutrophils showed abnormal ring like appearance

and diffuse chromatin material, with unclear

cytoplasm. In 32 mg lead treated group

vacuolization in chromatin material was also

observed ((Fig. 1C, 4).).

Lymphocyte: Reactive (Fig. 1C: 5 and 6) and

cleaved (Fig. C, 5) types of lymphocytes were

observed in lead treated groups.

Monocytes: At postnatal day 1 we cannot

identify any structural change in shape and size of

monocyte as observed on postnatal day 21.

2. During first and second week of postnatal period

(PND7&14)

The following observations were taken at first to

second week after birth:

Degenerated neutrophils: In lead treated group

overall numbers of neutrophils were increased

particularly with degenerated neutrophils, however,

their number was less than postnatal day 1. In 16

mg lead group on postnatal day 7 the nuclear

material of neutrophil was less condensed and

nucleus was divided into 2-3 unequal lobes. The

cytoplasm of neutrophil appeared colorless. At the

dose of 32mg lead at postnatal day 7, this severity

of degeneration was very much increased so that

the lobes were broken into many small fragments.

No sign of lobulization and appropriate

segmentation of neutrophils were found (Fig. 1D,

1).

Ring shaped neutrophils: In contrast to

postnatal day 1, ring like nucleus was not observed

in lead treated group at postnatal day 7.

Different types of neutrophils: At higher dose

32 mg lead treated groups apoptotic or necrotic

neutrophils were more prominent. These

neutrophils were characterized by 3-4 separate and

equal lobes with less condensed chromatin and

diffuse cytoplasmic region (Fig. 1D, 2).

Immature cells: Review of the lead treated

smear revealed that most of the leukocytes were

myelocytes, bands, myeloblast and other immature

and unidentified white blood cells with left shift in

leucocytes. A left shift is an increase in the number

of band neutrophils and other immature cell of the

granulocytic lineage in the peripheral blood (Fig.

1D, 3).

Various lymphocytes: Administration of lead

acetate produced great variation in lymphocyte

structurally as well as numerically. Various types of

lymphocytes such as plasmacytoid, reactive, oval,

irregular, binucleated and cleaved lymphocytes

were identified, whereas only reactive and cleaved


36Ragini SHARMA et al.

lymphocytes were seen in postnatal day 1,

exclusively in lead treated group.

Lead treated group with 16 mg lead acetate

produced large lymphocytes and most of the

lymphocytes were having irregular; clumpy and

smudgy chromatin material with very dense

nucleus (Fig. 1D, 4). The cytoplasm appeared

completely absent as the nucleus reached its largest

size and covered all the cytoplasmic area. Overall,

number of lymphocytes decreased in most of the

groups. At higher dose (32 mg lead) the

plasmacytoid lymphocytes (eccentric nucleus and

intensely blue / basophilic cytoplasm) (Fig. 1D, 6)

and reactive lymphocytes were observed. Reactive

lymphocyte was characterized by relatively very

large, irregular but flattened nucleus with fine

chromatin and agranular light blue stained

cytoplasm (Fig. 1D, 5).

3. At the end of lactation period (PND21)

Abnormal nuclear segmentation: It includes

abnormal segmentation of nucleus, in which the

nuclear lobes were connected with each other. It

gave abnormal appearance of nucleus and

chromatin condensation in most of the neutrophils

(Fig. 1E, 1).

Degeneration: In lower doses of lead diffuse

appearance of chromatin material was observed in

neutrophils and the lobes were fused with each

other as any segmentation was not observed,

whereas in higher lead treated group the neutrophils

presented fragmented chromatin material and very

less condensation of nucleus which finally leads to

cell lysis (Fig. 1E, 2). The nuclear arrangement was

distorted, as appear that all the lobes were

intermingled with each other and in some cases

form a nodule at one side known as sessile nodule

appeared like hypersegmentation (Fig. 1E, 3).

Immature cells: In lead treated group the

numbers of immature cells were increased. A left

shift i.e. presence of immature neutrophils, bands,

metamyelocytes, myelocytes and other unidentified

immature cells were observed (Fig. 1F, 1 to 6).

Lymphocytes: As the dose level increased the

number of lymphocytes decreased. In higher dose

lead treated group the lymphocyte appeared large in

size with higher volume of cytoplasm. The shape of

the nucleus also vary from round to elliptical in

structure, termed as reactive lymphocyte (Fig. 1E,

4). Some lymphocytes transformed into

plasmocytoid lymphocyte in which the lymphocyte

contains basophilic cytoplasm and eccentric

nucleus (Fig. 1E, 5).

Monocytes: In lead treated groups the shape and

structure of the monocyte were modified and the

shape of the nucleus was also altered from the

normal reniform (kidney shaped) nucleus. The

indentation of the nucleus became larger and

deeper from periphery to center. At higher dose

level intensity of the indentation was increased so

that the normal range of nucleo-cytoplasmic ratio

was disturbed (Fig. 1E, 6). Numerical changes in

different types of WBC and percent variations in

different types are incorporated in Table 1 and 2

respectively. In present investigation, after

evaluating all the cell types, we can conclude that

lead acetate at PND 1 and 14 caused significant

increase in number of neutrophils and decrease in

lymphocytes, while there was no significant

difference in the number of neutrophils and

lymphocytes at PND 7 and 21.

Table 1. Various types of WBCs at different postnatal days treated with lead acetate.

Groups Neutrophils Lymphocytes Monocytes

Control at PND 1 59.25±1.70 38.5±1.29 2.25±1.70

Lead acetate at PND1 66.00±2.16** 28.25±2.06** 5.75±1.70*

Control at PND 7 57.75±2.21 41.75±2.21 0.75±0.95

Lead acetate at PND7 61.75±3.5 37.5±2.88 0.75±0.95

Control at PND 14 55.25±3.40 44.5±3.trong>10trong> 0.25±0.5

Lead acetate at PND14 61.25±1.70** 37.75±1.70** 1.00±0.81

Control at PND 21 47.75±2.5 47.75±2.21 4.5±2.38

Lead acetate at PND21 52.25±4.57 44.00±2.26 3.75±2.75

Values were expressed as means ± S.D.; 4 animals /group;*=p


Prenatal and neonatal exposure to lead 37

Table 2. Percent variation in different types of WBCs in lead treated groups

Lead acetate at PND1

Lead acetate at PND7

Lead acetate at PND14

Lead acetate at PND21

Neutrophils Lymphocytes Monocytes

Normal 12.3%

Degenerated 12.1%

Ring shaped 8.2%

Immature 4.1%

Abnormal trong>10trong>.4%

Normal 12.6%

Degenerated 8.4%

Abnormal 16.8%

Immature trong>10trong>.8%

Ring shaped 6%

Normal 19.2%

Degenerated 19%

Abnormal 9.6%

Immature 6.4%

Apoptotic 6.4%

Normal 6.18%

Degenerated18.5%

Ring shaped 1.5%

Abnormal 17%

Immature 7.4%

Normal 13%

Reactive 17.33%

Cleaved 8.6%

Normal 12.2%

Plasmacytoid 7.4%

Reactive 9.8%

Binucleated 2.4%

Large 4.2%

Normal 4%

Plasmacytoid 4%

Reactive 12.3%

Binucleated 8.2%

Large 4%

Irregular 2%

Oval 2%

Normal trong>10trong>%

Abnormal 16.4%

Plasmacytoid1.4%

Reactive 4.4%

Large 5.8%

Irregular 5.86%

Normal 2.0%

Abnormal 3.7%

Abnormal 0.75%

Abnormal 1%

Normal 2%

Abnormal 1.7%

Figure 1. A: Peripheral blood smear of control group showing neutrophil (1-2), lymphocytes (3-4), at the time of birth,

neutrophils (5-6) during second and third week of lactation. B: Control group showing neutrophil (1), lymphocyte (2),

during second and third week of lactation, and, neutrophil (3), lymphocytes (4-5) and monocyte (6) at the termination of

lactation. C: Peripheral blood smear of lead treated group showing abnormal neutrophil (1), degenerated neutrophil (2),

immature cell (3), ring like neutrophil (4), 5 – cleaved (upper WBC) (5) and reactive (lower WBC) lymphocyte (5 and 6)

at the time of birth. D: Lead treated group showing degenerated neutrophil (1), necrotic (2), immature cell (3), large

lymphocyte (4), reactive (5) and plasmacytoid lymphocyte (6) During first and second week of postnatal period. E: Lead

treated group showing - abnormal neutrophil (1), degenerated neutrophil (2), hypersegmented neutrophil (3), reactive

lymphocyte (4), plasmacytoid lymphocyte (5) and reactive monocyte (6) at the termination of lactation. F: Lead treated

group showing different immature cells at the termination of lactation (1- 6). (All Giemsa stain, 450x).


38Ragini SHARMA et al.

Discussion

Changes in leukocyte parameters are often one of

the hallmarks of infection. These include changes

in number and in cellular morphology. Review of

the peripheral blood smear can provide significant

insight into the possible presence of infection. Early

changes during infection may include an increase in

the number of bands, even before the development

of leukocytosis. A great shift to immaturity (left

shift) may occur when infection is severe, with

metamylocytes or even earlier forms present on the

peripheral blood smear. There are many evidences

of studies conducted on adults and RBC concerning

lead toxicity, but very few reports are available

regarding haematopathological alterations of lead

acetate in different white blood cells. Significant

decrease in RBC count, hematocrit (Hct) and

hemoglobin (Hb) were seen in rats and human with

high blood lead levels. (Alexa et al., 2002; Noori et

al., 2003; Othman et al., 2004; Toplan et al., 2004)

In our study the control groups showed all the

leukocytes in normal appearance. Still some altered

types of WBCs were also observed. The

administration of lead acetate alters the structure

and number of WBCs. The nuclear arrangement

was also distorted. In lead treated groups the shape

and structure of the monocyte was also altered with

reniform (kidney shaped) nucleus. At higher dose

level this intensity of indentation was increased so

that the normal range of nucleo-cytoplasmic ratio is

disturbed and appeared as reactive monocytes. Our

findings are also in support of DeNicola et al.

(1991) with the evidence of reactive monocytes

enclosing the cytoplasm became more intensely

basophilic and vacuolated. This usually indicates a

chronic inflammatory process or may be seen with

hemoplasmas in the cat.

Toxicity in neutrophils is defined by the

presence of Döhle bodies (small, basophilic

aggregates of RNA in the cytoplasm), diffuse

cytoplasmic basophilia etc. In our study each lead

treated group in neonatal period, represents

increased number of degenerated neutrophils

particularly at birth. In the 16 mg lead exposed

group, during first week of lactation, the nuclear

material of cell was less condensed and nucleus

was divided into 2-3 unequal lobes with colorless

cytoplasm. At higher dose of 32 mg lead, this

severity of degeneration was very much increased

with many small fragments of nuclear material and

no sign of lobulization and appropriate

segmentation of neutrophils were observed.

In a study performed on young dogs,

development of anemia, leukocytosis,

monocytopenia, polychromato-philia, glycosuria,

increased serum urobilinogen, and hematuria has

been reported (Zook, 1972). Lead suppresses bone

marrow hematopoiesis, probably through its

interaction with the enteric iron absorption (Klader,

1779; Chnielnika, 1994). In some reports,

leukocytosis has been attributed to the lead-induced

inflammation (Yagminas et al., 1990).

Hogan and Adams, (1979) reported a threefold

increase in neutrophil and monocyte count along

with severe leukocytosis in the young rats that were

exposed to lead. The present investigation revealed

that administration of lead acetate alters the

appearance and cause structural changes. The

nuclear arrangement was distorted with

intermingled lobes and in some cases formed a

sessile nodule.

Controversies exist about monocytes; since in

some studies lead-induced monocytopenia

(Xintaras, 1992) and in others significant increases

in monocyte count have been reported (Yagminas

et al., 1990). The reason for such difference is

probably due to the extent of lead-induced

inflammation.

Mugahi et al. (2003) investigated additional

hematotoxic effects of lead on the erythroid cell

lineage and leukocytes following long-term

exposure in rats. Wahab et al. (20trong>10trong>) showed that

lead caused a significant decrease in hematocrit,

RBC, WBC, hemoglobin concentration, mean

corpuscular hemoglobin, mean corpuscular

hemoglobin concentration and lymphocyte and

monocyte count; and significant increase in

neutrophil count. The results of the present study

are also parallel to the above findings. In lead

exposed pups there was significant increase in the

number of neutrophils at different weeks after birth,

but decrease in the number of lymphocytes. The

shortened life span of erythrocytes is due to

increased fragility of the blood cell membrane and

rtrong>edutrong>ced hemoglobin production is due to decreased

levels of enzymes involved in hemesynthesis

(Guidotti et al., 2008). It has long been known that

hematopoiesis and heme synthesis affected by lead

poisoning (Doull et al., 1980).

In our study reactive and cleaved type of

lymphocyte were observed at the time of birth in

lead treated groups which were reinstated by

increased number of plasmacytoid, reactive, large,

oval, irregular, binucleated and cleaved

lymphocytes in further days of lactation. In the

current investigation at higher dose (32 mg) we


found apoptotic or necrotic neutrophils were more

prominent in the first and second week of lactation.

These neutrophils were characterized by 3-4

separate and equal lobes with less condensed

chromatin and diffuse cytoplasmic region.

Lead treated group at the termination of

lactation, include abnormal nuclear segmentation,

giving abnormal appearance of nucleus and

chromatin condensation in most of the neutrophils

and forming a ring like nucleus in some

neutrophils. Villagra et al., (1997) also postulates

that lead exposure doubles total and segmented

neutrophils in both estrogens treated and untreated

rats but causes a three-fold increase in band

neutrophils in animals without estrogen treatment,

but not in animals treated with estrogen. With a

disappearance of non-degranulated eosinophils, the

decrease in non-degranulated eosinophils was

under the effect of lead exposure. He also

demonstrates that prepubertal rat exposure to lead

affects blood neutrophil and eosinophil leukocyte

levels and induces eosinophil degranulation.

Vyskocil et al., (1991) discovered the effect of

lead on band neutrophils reveals an increased

neutrophilopoiesis rather than release from

intravascularly sequestered forms in lead-exposed

animals.

In lead treated group from birth till the

termination of lactation, the number of immature

cells was increased. There was asynchrony of

maturation between nucleus and cytoplasm. During

normal granulocytopoiesis the lengthening and

pinching of the nucleus were coordinated with

progressive condensation of the chromatin with

accelerated maturation nuclear division may be skip

and cells retain immature features, because toxic

changes of lead accompanies a left shift i.e.

presence of immature neutrophils, bands,

metamyelocytes, myelocytes and other unidentified

immature cells. White Blood Cells generally

increase as compared to the control level. The

increase in WBC count indicates the activation of

defense mechanism and immune system of gasoline

workers (Whitby, 1980). These findings are also in

confirmations, with our results.

In conclusion, lead exposure leads to various

hematological disorders in white blood cells

including neutrophilic degeneration, immature

cells, abnormal neutrophils, reactive and

plasmacytoid lymphocyte, reactive monocyte etc.

The present study indicates that after administration

of 266.66, 533.33 and trong>10trong>66.66 mg/kg/body weight

doses of lead acetate WBCs show structural

abnormalities in their nucleus and cytoplasm

Prenatal and neonatal exposure to lead 39

including improper segmentation and lesser

condensation of nucleus. Lead causes fluctuations

in the number of various cell types at different

stages of postnatal development. The exposure to

lead possesses the potentials to induce hazardous

biological effects during pre and postnatal

development in Swiss mice.

References

Ahamed M and Siddiqui MKJ. Low level lead

exposure and oxidative stress: Current opinions.

Clinica Chimica Acta. 383: 57–64, 2007.

Alexa ID, Mihalache IL, Panaghiu L, Palade F.

Chronic lead poisoning- a" forgotten” cause of

anemia. Rev Med Chir Soc Med Nat Iasi.

trong>10trong>6(4):825-8, 2002.

Chmielnika J, Zareba G, Nasiadek M. Combined

effect of tin and lead on heme biosynthesis in

rats. Ecotox Environm Safety. 29: 165-173,

1994.

DeNicola D, Giger U, MacWilliams P and

Wamsley H. Hematologic Evaluation of Cats

and Dogs. IDEXX Laboratories. (HO-30b)1991.

Desesso JJ and Harris SB. Principles underlying

development toxicity. Toxicology and Risk

Assesment. 1996.

Doull J, Klaassen CD and Amdur MO. Casaratt

and Doulls Toxicology. 2 nd ed. Macmillan

Publishing Co, New York. 415–421, 1980.

Falcon M, Vinas P and Luna A. Placental lead and

outcome of pregnancy. Toxicology. 185 (1-

2):59-66, 2003.

Guidotti TL, McNamara J, Moses MS. The

interpretation of trace elements analysis in body

fluids. Indian J Med Res.128:524-53, 2008.

Hogan GR and DP Adams. Lead induced

leukocytosis in Female mice. Archive of

Toxicol. 41:295-300, 1979.

Isha BARBER, Ragini SHARMA, Sheetal

MOGRA, Khushbu PANWAR and Umesh

GARU. Lead induced alterations in blood cell

counts and hemoglobin during gestation and

lactation in Swiss albino mice. J of Cell and

Mol Biol. 9(1):69-74, 2011.

Klauder DS and Petering HG. Anemia of lead

intoxication: A role of Copper. J Nutr.

trong>10trong>7(trong>10trong>):1779-85, 1977.


40Ragini SHARMA et al.

Kosnett. Global approach to rtrong>edutrong>cing Lead

exposure and poisoning. Mutation Research.

659(1-2): 166-175, 2006.

Mugahi MN, Heiadari Z, Sagheb HM and

Barbarestani M. Effects of chronic lead acetate

intoxication in blood indices of male adult rat.

Daru. 11;4: 2003.

Noori MM, Heidari Z, Sagheb H and Barbarestani

M. Effects of chronic lead acetate intoxication

on blood indices of male adult rat. Daru Pharm

J, 11(4): 147-51, 2003.

Othman AI, Sharawy S and El-Missiry MA. Role

of melatonin in ameliorating lead induced

haematotoxicity. Pharmacol Res. 50(3):301-7,

2004.

Patocka J, Cerný K. Inorganic lead toxicology. Acta

Medica (Hradec Kralove). 46(2):65-72, 2003.

Toplan S, Ozcelik D, Gulyasar T and Akyolcu MC.

Changes in hemorheological parameters due to

lead exposure in female rats. J Trace Elem Med

Biol. 18(2):179-82, 2004.

Villagra R, Tchernitchin NN and Tchernitchin AN.

Effect of Subacute Exposure to Lead and

Estrogen on Immature Pre-Weaning Rat

Leukocytes Bull. Environ Contam Toxicol.

58:190-197, 1997.

Vyskocil A, Fiala Z, Tejnorova I, Tusi M. Stress

reaction in developing rats exposed to 1% lead

acetate. Sb Ved Pr Lek Karlovy University

Hradci Kralove. 34:287-295, 1991.

Wahab AA, Joro JM, Mabrouk MA, Oluwatobi SE,

Bauchi ZM and John AA. Ethanolic extract of

Phoenix dactylifera L. prevents lead induced

hematotoxicity in rats. Continental J

Biomedical Sciences. 4: trong>10trong> - 15, 20trong>10trong>.

Whitby LG, Rercy-Robb IW and Smith AF.

Chapter 9. Lecture Notes on Clinical Chemistry.

2nd ed. Blackwell Scientific Publications,

Oxford London Edinburgh Melbourne. 167-

187, 1980.

Wilson JG. Environments and birth defects.

Academic Press, New York. 1973.

Xintaras C. Impact of Lead contaminated soil on

Public Health. Public Health Service. Agency

for toxic substances and Disease Registry,

1992.

Xu HH, Chen ZP and Shen Y. Meta analysis for

effect of lead on male reproductive function. J

of Industrial hygiene and occupational disease.

24(trong>10trong>): 634-36, 2006.

Yagminas AP, Franklin CA, Villeneuve DC,

Gilman AP, Little PB and Valli VE. Subchronic

oral toxicity of triethyl lead in the male

weanling rat: Clinical, biochemical,

hematological, and histopathological effects.

Fundam Appl Toxicol. 15: 580-596, 1990.

Zook BC. Lead poisoning in dogs. Am J Vet Res.

33: 981-902, 1972.


Journal of Cell and Molecular Biology trong>10trong>(1): 41-54, 2012 Research Article 41

Haliç University, Printed in Turkey.

http://trong>jcmbtrong>.trong>halictrong>.trong>edutrong>.tr

Sulfabenzamide promotes autophagic cell death in T-47D breast

cancer cells through p53/ DRAM pathway

Raziye MOHAMMADPOUR 1 , Shahrokh SAFARIAN *1 , Soroor FARAHNAK 1 , Sana

HASHEMINASL 1 , Nader SHEIBANI 2

1

School of Biology, College of Science, University of Tehran, Tehran, Iran

2

Department of Ophthalmology and Visual Sciences, School of Medicine and Public Health, University of

Wisconsin, Madison, USA

(* author for correspondence; safarian@ibb.ut.ac.ir )

Received: 26 March 2012; Accepted: 29 May 2012

Abstract

Sulfonamides exhibit their antitumor effects through multiple mechanisms including inhibition of membrane

bound carbonic anhydrases, prevention of microtubule assembly, cell cycle arrest, and inhibition of angiogenesis.

Here, sulfabenzamide’s mechanisms of action on T-47D breast cancer cells were determined. Cells incubated with

sulfabenzamide exhibited negligible levels of apoptosis, necrosis and cell cycle arrest when compared to untreated

cells. These results were confirmed by morphological examinations, DNA fragmentation assays, flow cytometric

and real time RT-PCR analysis. Surprisingly, despite negligible detection of DNA fragmentation, a considerable

increase in caspase-3 activity was observed in cells incubated with sulfabenzamide. The increased expression ratio

of DFF-45/DFF-40 indicated that caspase-3-related DNA fragmentation was blocked and apoptosis symptoms

could not be seen. However, the effects of caspase-3 for PARP1 and DNA-PK deactivation resulted in autophagy

induction. The overexpression of critical genes involved in autophagy, including ATG5, p53 and DRAM, indicated

that in T-47D cells sulfabenzamide-induced antiproliferative effect was mainly exerted through induction of

autophagy. Furthermore, downregulation of AKT1 and AKT2 as well as over expression of PTEN resulted in

attenuation of AKT/mTOR survival pathway showing that death autophagy should be occurred in sulfabenzamide

treatment.

Keywords: Sulfabenzamide, breast cancer, autophagy, apoptosis, p53.

Sülfobenzamid, T-47D meme kanseri hücrelerinde p53/DRAM yolağı aracılığıyla otofajik hücre ölümünü

teşvik eder

Sülfonamidler, membrana bağlı karbonik anhidraz inhibisyonunu, mikrotubül toplanmasının engellenmesini, hücre

siklusunun durdurulmasını ve anjiyogenez inhibisyonunu içeren çoklu mekanizmalarla antitümör etkilerini

göstermektedirler. Burada, T-47D meme kanser hücreleri üzerinde sülfobenzamid mekanizmasının etkisi

belirlenmiştir. Sülfobenzamid ile inkübe edilen hücreler yapılmamış uygulama hücrelerle karşılaştırıldıklarında

önemsenmeyecek seviyede apoptoz, nekroz ve hücre siklusunun durmasını ortaya koymuştur. Bu sonuçlar

morfolojik incelemelerle, DNA fragmantasyon analizleriyle, flow sitometrik ve gerçek zamanlı RT-PCR

analizleriyle doğrulanmıştır. Şaşırtıcı bir şekilde, DNA fragmantasyonunun ihmal edilebilecek tespitine rağmen,

sülfobenzamidle edilmiş inkübe hücrelerde kaspaz 3 aktivitesinde dikkate değer artış bir gözlenmiştir. DFF-45/

DFF-40’ artmış ın ekspresyon oranı, kaspaz 3 ile ilişkili DNA fragmantasyonunun durdurulduğunu ve apoptoz

belirtilerinin görülemeyeceğini işaret etmektedir. Bununla birlikte PARP1 ve DNA-PK deaktivasyonu için kaspaz

3’ün etkileri otofaji indüklenmesiyle sonuçlanmaktadır. ATG5, p53 ve DRAM gibi otofajide yer alan kritik

genlerin aşırı ekspresyonu T-47D sülfobenzamid-indüklenmiş hücrelerinde antiproliferatif etkinin çoğunlukla

otofaji indüksiyonu aracılığıyla uygulandığını belirtmektedir. Ayrıca, PTEN aşırı ekspresyonu gibi AKT1 ve

AKT’’nin azalarak düzenlenmesi, otofaji ölümünün sülfobenzamid uygulamasıyla meydana geldiğini gösteren

sağ AKT1/mTOR kalım yolağının etkisinin azalmasıyla sonuçlanmaktadır.

Anahtar kelimeler: sülfobenzamid, meme kanseri, otofaji, apoptoz, p53.


42 Raziye MOHAMMADPOUR et al.

Introduction

Sulfonamides are synthetic antibacterial agents

with diverse pharmacological effects including

antibacterial, antiviral, antidiabetic, antithyroid, and

diuretic. Their antibacterial effects are contributed

to the interfering with enzyme activities responsible

for folic acid synthesis by competing for para

aminobenzoic acid. These drugs are selectively

toxic for prokaryotes (Owa et al., 1999; Fukuoka et

al., 2001; Yokoi et al., 2002; Supuran 2003). Two

novel sulfonamides, E7070 and E70trong>10trong>, are potently

effective against cancer cells via inhibition of

tubulin polymerization and proliferation. The

matrix metalloprotease (MMP) inhibitory effects of

sulfonamides have been evaluated for treatment of

arthritis and cancer (Fukuoka et al., 2001; Ozawa et

al., 2001; Supuran et al., 2003; Mohan et al., 2006).

Sulfabenzamide, 4-Amino-N-benzoyl-benzenesulfonamide,

is a sulfonamide derivative used for

treatment of specific vaginal infections in

combination with sulfathiazole and sulfacetamide

(Valley and Balmer, 1999).

Knowledge regarding alterations in signaling

pathways and the type of cell death induced by

chemotherapeutic drugs is the first and most

important step in design of effective treatments.

Furthermore, manipulation of autophagy has the

potential to improve anticancer therapeutics.

Studies have shown that autophagy protects cancer

cells against antitumor effects of some drugs by

blocking the apoptotic pathway and maintaining

ATP levels. In contrast, other cancer cells undergo

autophagic cell death (ACD or type II programmed

cell death, PCDII) after anticancer therapies

(Kondo et al., 2005; Kondo and Kondo, 2006).

Various anticancer drugs that activate ACD in

breast cancer cells have been reported including

vitamin D analog, EBtrong>10trong>89, Tamoxifen and other

antiestrogen agents (Hoyer-Hansen et al., 2005).

Tamoxifen induced autophagic pathway occurs

through down regulation of AKT activity

(Yokoyama et al., 2009). The 3'-methoxylated

analogue isocannflavin B (IsoB) exhibits an

inhibitory effect on T-47D cell proliferation, which

is accompanied by the appearance of an intense

intracytoplasmic vacuolization of autophagic origin

(Brunelli et al., 2009).

Here, we choose sulfabenzamide for assessing

its antitumor activity in T-47D breast cancer cell

line. Our main objective was to determine whether

this drug can be used as an antitumor drug in

medicine. From this point of view, we could

ascertain that there is a correlation between the

expression level of some critical genes and

induction of death autophagy in T-47D cells.

Materials and methods

Reagents

Culture medium, RPMI 1640, and fetal bovine

serum were from Gibco (England); penicillin

streptomycin solution, DNA laddering kit,

Annexin-V-FLOUS Staining Kit, Propidium

Iodide (PI) kit, caspase-3 fluorometric

immunosorbent enzyme assay kit, 4',6- Diamidino -

2-phenylindole (DAPI) kit were all acquired from

Roche (Germany); MTT was from Sigma

(England); sulfabenzamide and doxorubicin were

from Sina Darou (Iran) and Ebewe Pharma

(Austria), respectively. QuantiFast SYBR Green

PCR master mix and RNeasy plus Mini kit were

provided from Qiagen (USA). RevertAidTM M-

MuLV reverse transcriptase and random hexamer

were purchased from Fermentas (Germany).

Cell culture

Epithelial tumor cell line, T-47D, stemmed from

human ductal breast tissue, was provided from

National Cell Bank of Pasteur Institute (Tehran,

IRAN; ATCC number HTB-133). Cells were

maintained in RPMI 1640 medium supplemented

with heat-inactivated (35 min, 56°C) fetal bovine

serum (trong>10trong>% v/v) and penicillin streptomycin

solution (1% v/v) and incubated in humidified

condition; 95% air and 5% CO2 at 37°C.

Drug preparation and treatments

Regarding the obtained results from MTT assays,

LC50 for sodium sulfabenzamide and doxorubicin

after 48 h were estimated at trong>10trong>.8 and 0.337×trong>10trong> -3

mM, respectively. After reaching confluency (~

80%), cells were incubated with freshly prepared

drugs at the LC50 concentrations, harvested by

trypsin-EDTA, washed three times by phosphatebuffered

saline, and stored at -70°C.

Cytotoxicity/Viability assay

In brief, trong>10trong> 4 cells/well were seeded in a 96 well

culture plate and incubated with different

concentrations of drugs for 24, 48 and 72 h. MTT

was then added to the wells (4 mg/ml or trong>10trong>0

µg/well) and the produced formazan was

systematically assessed using Elisa micro plate


eader at the wavelength of 570 nm. The percent of

cell viability related to each drug concentration was

estimated in relation to the untreated sample. All

assays were done at least three times unless stated

otherwise.

Apoptosis quantification

After washing trong>10trong> 6 cells with PBS, cell pellets were

re-suspended in trong>10trong>0 µl of ready to use Annexin/PI

buffer (20 µl of each Annexin and PI buffer in 1 ml

incubation buffer) for trong>10trong>-15 min at 25˚C. Samples

were then diluted in 500 µl of incubation buffer and

analyzed by flow cytometry (Partech Pass, USA)

using FloMax software.

Cell cycle analysis

trong>10trong> 5 drug treated cells were incubated with DAPI

solution (trong>10trong> µg/ml and 6% Triton X-trong>10trong>0 in PBS)

for 30 min in the dark at 4ºC. Using a flow

cytometer fluorescent emission of applied indicator

was detected (excitation and emission wavelength

of 359 nm and 461 nm, respectively) and the

analysis was performed using FloMax software.

Morphological studies of the apoptotic cells

Cells were cultured on cover slips coated with Poly

L-lysine and exposed to drugs for 48 h. Following

staining with Annexin V-FITC (20 µg/ml) and PI

(20 µg/ml) in the dark for trong>10trong>-15 min, samples were

examined using a fluorescent microscope (Carl

Zeiss-Germany) using 450-500 nm excitation and

515-565 nm emission filters.

Measurement of caspase-3 activity

Following drug treatments, cells were harvested

and incubated in lysis buffer on ice for 1 minute.

After centrifugation, sample supernatants were used

for caspase-3 activity measurements using AC-

DEVED-AFC fluorescent substrate as

recommended by the supplier. The concentration of

enzyme-released AFC was estimated using

fluorospectrophotometer (HITACHI model MPF4-

Japan) at 400 nm excitation and 505 nm emission

wavelengths.

DNA laddering assay

trong>10trong> 6 drug treated cells were lysed with an equal

volume of binding/lysis buffer for trong>10trong> minutes at 15-

25 º C. The obtained extract was processed as

recommended by the supplier. Electrophoresis of

the samples in 1% agarose gel at 75 volt for 90

minutes revealed DNA cleavage pattern of cells

Sulfabenzamide promotes autophagic cell death 43

relative to positive control (DNA extracted

prepared from U937 cells incubated 3h with 4 µM

camptothecin).

Preparation of total RNA, cDNA synthesis and real

time RT-PCR

Total RNA was purified using the RNeasy Qiagen

kit according to the manufacturer’s

recommendation. First strand cDNA was generated

using RevertAidTM M-MuLV reverse transcriptase

and 5µg of RNA with random hexamer primers.

Real time quantitative RT-PCR was performed

using the QuantiFast SYBR Green PCR Master

Mix under the following program: 95˚C for 5 min

followed by 40 cycles (95˚C for trong>10trong> sec, annealing

for 25 sec and extension at 72˚C for 30 sec).

Analysis was done using Corbett rotor-gene 6000

software based on the comparative Ct method (or

ΔΔCt method). The relative amount of target

materials was quantified compared to the reference

gene (GAPDH). Primers were prepared by TAG

(Copenhagen, Denmark) and were used to amplify

specific regions of cDNA as listed in Table1.

Statistical analysis

For all methods statistical analysis were performed

by the SPSS version 16 and Excel 2007 softwares.

Statistical analysis for MTT assay, flow cytometry,

caspase-3 activity were performed by one way

ANOVA and real time RT-PCR methods were

carried out by t-test. All results are presented as

mean ± standard deviation (p< 0.05 was considered

statistically significant).

Results

Sulfabenzamide inhibits the proliferation of T-47D

cells

The MTT assay was used to evaluate the viability

of T-47D cells incubated with different

concentrations of sulfabenzamide (0.0-20 mM) or

doxorubicin (0.0-0.6 µM) after 24, 48 and 72 h

(chemical structures are shown in Figure 1A). We

checked toxic effects of doxorubicin on T-47D

since it had been reported that its anticancer effects

on different cell types exerts through distinct

cellular processes (apoptosis or cell cycle arrest).

Thus, it could be utilized as a control in our

experiments. The 50% growth inhibition (LC50)

concentration for sulfabenzamide and doxorubicin

after 48 h, were calculated as trong>10trong>.8 mM and 0.33

µM, respectively, and utilized in the following

experiments (Figure 1B).


44 Raziye MOHAMMADPOUR et al.

Table 1. List of primers. Forward and reverse primer pairs for PTEN gene were designed to amplify a region which could

not anneal to PTEN pseudogene. Primer for p53 was designed for the mutant form present in T-47D cells.

Gene Accession number primers

F: CCAGGTGGTCTCCTCTGACTTCAACAG

PCR product(bp)

GAPDH NC_000012.11

R: AGGGTCTCTCTCTTCTTCCTCTTGTGCTCT

F: GTGAGATATGGTTTGAATATGAAGGC

218

ATG5 NC_000006.11

R: CTCTTAAAATGTACTGTGATGTTCCAA

F: GGAGAGGAGCCATTTATTGAAACT

122

beclin1 NC_000017.trong>10trong>

R: AGAGTGAAGCTGTTGGCACTTTCTG

F: CTTGGATTGGTGGGATGTTTC

trong>10trong>4

DRAM NC_000012.11

R: GATGATGGACTGTAGGAGCGTGT

F: CCAGATGGAAAGACGTTTTTGTG

135

AKT1 NC_000014.8

R: GAGAACAAACTGGATGAAATAAA

F: CTGCGGAAGGAAGTCATCATTGC

trong>10trong>6

AKT2 NC_000019.9

R: CGGTCGTGGGTCTGGAAGGCATAC

F: CAAACTTTTTCAGAGGGGATCG

125

caspase-3 NC_000004.11

R: GCATACTGTTTCAGCATGGCAC

F: AAGAAGCTGAGCGAGTGTC

261

bax NC_000019.9

R: GGCCCCAGTTGAAGTTGC

F: ATGGAACTAACTATGTTGGACTATG

157

cyclinB1 NC_000005.9

R: AGTATATGACAGGTAATGTTGTAGAGT

F: AGGGGGAAACACCAGAATCAAGTG

138

bcl-2 NC_000018.9

R: CCCAGAGAAAGAAGAGGAGTTATAA

F: GGTCTTGTGGACAGTAGTTTGCC

113

AIF NC_000023.trong>10trong>

R: TCTCACTCTCTGATCGGATACCA

F:CCTGTGCAGCTGTGGGTTGATTT

115

p53 NC_000017.trong>10trong>

R: AGGAGGGGCCAGACCATCGCTAT

F: TTGGAGTCCCGATTTCAGAG

150

DFF40 NC_000001.trong>10trong>

R: CTGTCGAAGTAGCTGCCATTG

F:TTCTGTGTCTACCTTCCAATACTA

194

DFF45 NC_000001.trong>10trong>

R:CTGTCTGTTTCATCTACATCAAAG

F: TAACATTAGTCTGGATGGTGTAGA

127

PARP1 NC_000001.trong>10trong>

R: TTACCTGAGCAATATCATAGACAAT

F: TGGCATTACAGACATCTTTAGTTT

113

DNA-PK NC_000008.trong>10trong>

R: ACTTTAGGATTTCTTCTCTACATTCA

F: TGGCTAAGTGAAGATGACAATCATG

111

PTEN NC_0000trong>10trong>.trong>10trong>

R: GCACATATCATTACACCAGTTCGT

81


Sulfabenzamide promotes autophagic cell death 45

Figure 1. A) Chemical structure of sulfabenzamide and doxorubicin. B) Viability curve of sodium

sulfabenzamide and doxorubicin treated T-47D cells. Percent viability of cells incubated with sodium

sulfabenzamide and doxorubicin was calculated relative to the related untreated controls after 24, 48 and 72

h. Each point relates to the mean value of at least three independent experiments. The related correlation

coefficient (r 2 ) was adjusted until the best fit for the selected mathematical function was used to interpolate

the experimental points.

T-47D cells do not exhibit DNA fragmentation and

apoptotic morphology in the presence of

sulfabenzamide or doxorubicin

Unlike DNA fragmentation patterns observed in

DNA extracted from U937 cells incubated with

camptothecin (as a positive control of DNA

laddering kit), the gel electrophoresis of DNA

prepared from cells incubated with sulfabenzamide

(trong>10trong>.8 mM) or doxorubicin (0.33 µM) showed no

DNA ladder or smear pattern confirming lack of

apoptosis or necrosis in these cells (Figure 2A).

Morphological analysis of sulfabenzamide and

doxorubicin treated cells, double stained with

Annexin-FITC and PI, evaluated by fluorescent

microscopy and confirmed the results of DNA

laddering analysis. There were few cells having

morphological characteristics of apoptotic and

necrotic cells (Figures 2B, 2C). Early (young)

apoptotic cells have rounded shape and shiny green

membrane because PI cannot penetrate into the

cells and Annexin-FITC binds to the externally

membrane-exposed phosphatidylserines (Figures

2B, 2C). Late apoptotic and necrotic cells have

membrane permeability for PI so their nuclei are

stained red (Figure 2C). The main difference

between necrotic and late apoptotic cells is the

potency of late apoptotic cells for simultaneous

staining of nuclei and membrane-exposed

phosphatidylserines with PI and Annexin-FITC,

respectively. Membrane blebbing, which is a

common feature of apoptotic cells was seen in

Figure 2B. Evidently, healthy cells cannot be seen

under fluorescent microscope since they were not

stained with either of the fluorescent dyes (Figure

2E).


46 Raziye MOHAMMADPOUR et al.

Figure 2. A) DNA laddering analysis. 1-3 µg DNA prepared from 2×trong>10trong> 6 cells was resolved by

electrophoresis in a 1% agarose gel. DNA fragmentation was observed only in positive control (camptothecin

treated) cells, but it was not detected in control or cells incubated with doxorubicin or sodium

sulfabenzamide. B) Observation of the morphology of early apoptotic cells using fluorescent microscopy

following double staining with Annexin V-FITC and PI. Morphological characteristics of early apoptotic

cells (rounded green shiny cells showing membrane blebbing) in sulfabenzamide treated cells. C)

Observation of the morphology of late apoptotic and necrotic cells using fluorescent microscopy following

double staining with Annexin V-FITC and PI. Morphological characteristics of late apoptotic (flattened green

shiny cells showing red dense nuclei) and necrotic cells (red dense spheres lacking green shiny membrane) in

sulfabenzamide treated cells. Similar results were observed for doxorubicin (not shown). Living cells due to

lack of staining with dyes are not detectable in fluorescent visual field (E) but are visible using phase contrast

microscopy (D).


Sulfabenzamide promotes autophagic cell death 47

Figure 3. Caspase-3 activity was increased in cells incubated with sulfabenzamide or doxorubicin. Enzyme

activity in the control, sodium sulfabenzamide, or doxorubicin treated cells were 1.308±0.115, 2.07±0.08,

and 2.496±0.11 nM.h -1 , respectively. Standard curve based on emission (Y axis) of different concentration of

free AFC (nM) is plotted (inset). Diagram of free AFC is plotted in 400 nm excitation and 505 nm emission

wavelengths.

Table 2. Numerical results of flow cytometry analysis. Results are the mean value ± SD for at least three

replicated experiments. Each column named with Qi which includes data related to the quadrant that are Q1

(PI + and Annexin V-FITC - ) or Q1+Q2 (Q2 is the region for PI + and Annexin V-FITC + ) indicated percent value

of necrotic cells, and columns Q4 (PI - and Annexin V-FITC + ) or Q2+Q4 show percent values of apoptotic cells

(see text). Column Q3 (PI - and Annexin V-FITC - ) indicates percent value of normal cells. Column of G1, S

and G2/M represent the percent value of the cells placed in each related phase of cell cycle. NC, Dox and SU

are abbreviations for Negative Control, Doxorubicin and Sulfabenzamide, respectively.

Treated

cells

Q3 Q1 Q2 Q4 Q1+Q2 Q2+Q4 G1

S G2

NC 98.94±0.72 0.90±0.46 0.05±0.04 0.35±0.09 0.96±0.50 0.40±0.11 67.06±5.79 16.39±4.27 16.54±3.20

DOX 97.60±1.12 1.33±0.68 0.015±0.02 1.05±0.90 1.34±0.67 1.06±0.90 30.58±1.14 40.55±4.65 28.86±3.51

SU 98.58±0.56 0.27±0.19 0.09±0.08 0.86±0.57 0.37±0.1 0.96±0.54 48.80±4.28 27.47±4.39 22.70±3.79


48 Raziye MOHAMMADPOUR et al.

Caspase-3 activity was increased in the

sulfabenzamide and doxorubicin treated cells

Using caspase-3 specific substrate, subsequent

releasing of the fluorescent product (AFC) was

measured and average enzymatic velocity was

calculated (three independent experiments) as

16.6±1.42, 26.2±1.3 and 38.3±0.85 (∆F.h -1 , ∆F

means fluorescent intensity alteration) for untreated

cell, sulfabenzamide or doxorubicin treated cells,

respectively. Using the standard curve of free AFC,

enzymatic activity was calculated as 1.308±0.115,

2.07± 0.08 and 2.496± 0.11nM.h -1 , respectively

(Figure 3).

Comparing with untreated cells, caspase-3

activity was increased in drug treated samples.

Elevated activity of caspase-3, which is a sign of

apoptosis induction, is in contrast with the DNA

laddering results and is further discussed below.

Sulfabenzamide did not induce apoptosis but

induced a minimal shift from G1 to S and G2/M

phases of the cell cycle

Using flow cytometric analysis and Annexin-FITC

and PI staining, the incidence of apoptosis and

necrosis in untreated, sulfabenzamide, or

doxorubicin treated cells were quantified (Figure

4A and Table 2).

Congruent with graph interpretation methods

applied in most publications, the sum of cell

populations in regions Q2 (PI + and Annexin V-

FITC + ) and Q4 (PI - and Annexin V-FITC + ) were

considered as early and late apoptotic cells (Hsu et

al., 2006; Tyagi et al., 2006; Dowejko et al., 2009;

LaPensee et al., 2009). In addition, regions Q1 (PI +

and Annexin V-FITC - ) and Q3 (PI - and Annexin V-

FITC - ) indicated necrotic and unscathed

populations, respectively. In some publications, cell

percentages located in Q1 and Q2 (Q2 is the region

for PI + and Annexin V-FITC + ) quarters are

considered as necrotic cells (Davis et al., 2000). In

these studies, Q4 quarter (PI - and Annexin V-

FITC + ) represented the percentage of apoptotic

cells. Therefore, in Table 2 determination of

necrotic cells was performed separately via Q1, as

well as Q1+Q2, and the estimation for apoptotic

cells was carried out as Q2+Q4 as well as Q4, in

order to indicate that the low percentages of

apoptotic and necrotic cells observed was not

influenced by the applied analytical methods.

Flow cytometry is useful for calculating the

percentages of cells existing in various stages of the

cell cycle including G1, S and G2/M. To make a

practical use of this technique, cells were stained

with DAPI, which enters the nucleus and binds to

DNA and emanates fluorescent emission.

Although, no significant change in the normal

pattern of cell distribution throughout the cell cycle

was observed for sulfabenzamide treated cells (18%

shift from G1 to S and G2/M) a considerable

transition (37%) was detected from G1 to S (main

transition) and G2/M in cells incubated with

doxorubicin as positive control (Figure 4B and

Table 2).

Alterations in expression of proapoptotic,

prosurvival and autophagic genes in

sulfabenzamide and doxorubicin treated cells

The changes in expression level of apoptotic, cell

survival and autophagic genes were evaluated using

real time RT-PCR. With respect to the results

shown in Figure 5 as well as its insets it can be seen

that in sulfabenzamide treatments some apoptotic

genes (DFF-45 and DNA-PK ) were over expressed

while some others were down regulated (PARP1,

Bax, Bcl-2 and AIF) or retained their expression

level in a constant condition (DFF-40 and caspase-

3). Moreover, some critical genes which are

important in cell survival pathway were also down-

regulated (AKT1 and AKT2) or over expressed

(PTEN). Alterations in gene expression were

evaluated for some autophagic genes such as

ATG5, p53 and DRAM indicating higher amounts

of the related transcripts in drug treated cells

relative to the untreated ones. In doxorubicin

treated cells some apoptotic genes were focused

and their alterations including over expression of

caspase-3, DNA-PK, DFF-45 and Bax; down

regulation of DFF-40 and constant expression of

AIF and PARP1 were evaluated (Figure 5).


Sulfabenzamide promotes autophagic cell death 49

Figure 4. A) Two dimensional plots of Annexin V-FITC against PI related to the flow cytometric

experiments. Two dimensional diagrams from flow cytometric studies showed that the percentage of

apoptotic cells (cells located in the Q4 area or total cells in Q2 + Q4) and necrosis (cell located in Q1 or in

Q1+Q2) do not show dramatic differences compared with control cells. B) Effects of sodium sulfabenzamide

and doxorubicin on the cell cycle distribution. FL4-A indicates the area under the registered electrical signal

of each stained cell. The curves from left to right relate to G1, S, G2/M phases of the cell cycle in control,

doxorubicin or sodium sulfabenzamide treated samples.


50 Raziye MOHAMMADPOUR et al.

Figure 5. Quantitative real time RT-PCR analysis histograms. Real time RT-PCR for the selected genes for

sulfabenzamide (A) and Doxorubicin (B) treated T-47D cells were determined as described in Methods. The

relative amount of target material was quantified compared to the reference gene using the comparative Ct

(ΔΔCt) method. The statistical significant differences are indicated with * and ** for 0.01


independent of changes in the related mRNA level

(Figures 3 and 5). The increased activity of

caspase-3 was negated via overexpression of DFF-

45. DFF-45 is the natural inhibitor of DFF-40

(CAD) (Liu et al., 1997). In addition, the increased

expression of DFF-45, along with a modest

increase (for sulfabenzamide) and a significant

decrease (for doxorubicin) in DFF-40 expression

(Figure 5), indicated that the increased activity of

caspase-3 could be blocked by the increased

expression ratio of DFF-45/DFF-40. This rtrong>edutrong>ces

the level of active DFF-40 to trigger DNA

fragmentation and appearance of apoptotic

symptoms. Furthermore, it has been reported that

caspases are activated during autophagy in dying

cells and are suppressed for apoptosis induction

(Martin et al., 2004; Yu et al., 2004). Therefore, it

can be dtrong>edutrong>ced that during autophagy, the effects

of activated caspase-3 on their downstream

substrates (like DFF-40) should be suppressed by

special factors (e.g. DFF-45 in T-47D cells) only in

those cellular routes which are involved in the

appearance of apoptosis symptoms (e.g. DNA

fragmentation).

Cell cycle arrest, an important cellular target

affected by sulfabenzamide and doxorubicin, was

analyzed using flow cytometry. Incubation of T-

47D cells with 0.33 µM doxorubicin resulted in a

significant accumulation of cells in S phase, and to

a lesser extent in G2/M phase of the cell cycle

(Figure 4B and Table 2). Thus, doxorubicin exerts

its antiproliferative action mainly through cell cycle

arrest. Induced mitotic catastrophe following

increased activation of cyclinB1/Cdc2 may occur

while cells are delayed, particularly in G2 phase of

the cell cycle (Lindqvist et al., 2007). The induced

G2/M arrest along with down regulation of

cyclinB1 expression confirmed that anticancer

activity of doxorubicin is not via mitotic

catastrophe (Figure 5 and Table 2). In contrast to

doxorubicin, minimal cell cycle arrest in S and

G2/M phases (totally 18%) was observed in T-47D

cells incubated with trong>10trong>.8 mM sulfabenzamide

(Figure 4B and Table2). Thus, cell cycle arrest

could not be mainly responsible for a 50%

rtrong>edutrong>ction in cell viability in the presence of

sulfabenzamide.

As we know, when apoptosis is blocked or

delayed autophagy triggered and vice versa. These

possibilities are consistent with our findings

regarding lack of apoptosis in drug treated cells and

induction of autophagy. The induced

overexpression of ATG5 supported that autophagy

Sulfabenzamide promotes autophagic cell death 51

triggered in the presence of sulfabenzamide (Figure

5). This could be probably occurred through the

increase in Bax activity working on mitochondrial

membrane to result in activation of caspase-3 for

PARP1 and DNA-PK deactivation and autophagy

induction. It has been reported that induction of

autophagy by PUMA (the p53-inducible BH3-only

protein) depends on Bax/Bak and can be

reproduced by overexpression of Bax (Yee et al.,

2009). Here, in doxorubicin treatment, increase in

Bax activity could be occurred in parallel with the

increment of Bax transcripts affecting on the cells

for caspase-3 activation and changing the cell's

destiny toward autophagy (Figure 5). This notion

could be also supplied in sulfabenzamide treatment

aside from the mild decrease in Bax expression

because activation of the existed Bax molecules in

the cells could be happened for caspase-3 activation

and autophagy induction (Figure 5). It has been

also reported that proteolytic cleavage of PARP1,

performed by caspase-3, produces specific

proteolytic cleavage fragments which are involved

in the cell’s decision to change its fate from

apoptosis toward autophagy (Munoz-Gamez et al.,

2009; Chaitanya et al., 20trong>10trong>). Induction of

autophagic cell death is dependent on DNA-PK

inhibition (Daido et al., 2005). Thus, the increased

activity of caspase-3 could finally deactivate

PARP1 (has a decreased and constant expression

level in sulfabenzamide and doxorubicin

treatments, respectively) and DNA-PK (has an

increased and invariable expression level in

sulfabenzamide and doxorubicin treatments,

respectively) until apoptosis was blocked and

autophagy induced (Figures 3 and 5).

Despite the existence of some controversies

regarding the possible role of autophagy in tumor

progression by promoting cell survival, autophagy

can exist as a backup mechanism promoting

cellular death when other mortality mechanisms are

not functional. Hyperactivation of autophagy above

the threshold point leads to unlimited self-eating of

the cells causing autophagy or type II programmed

cell death (Hoyer-Hansen et al., 2005; Maiuri et al.,

20trong>10trong>). Based on our data, downregulation of AKT1

and AKT2 as well as upregulation of PTEN in

sulfabenzamide treated cells indicated that cell

survival pathways were slowed down (Figure 5). In

addition, down regulation of bcl-2 was happened

along with the induction of autophagy (Figure 5). It

has been reported that targeted silencing of bcl-2

expression (an anti-autophagic gene) in human

breast cancer cells with RNA-interference has


52 Raziye MOHAMMADPOUR et al.

promoted autophagic cell death and thus presents a

therapeutic potential (Akar et al., 2008).

p53 is involved in decreasing cell survival

potency through inactivation of AKT/mTOR

pathways, and stimulation of autophagy via

transactivation of DRAM (Maiuri et al., 2007).

Thus, the observed increased expression level of

DRAM and p53 genes support our conclusion that

the repression of AKT/mTOR survival pathway

(via p53 overexpression) and autophagy induction

(via increased DRAM transcripts) are responsible

for rtrong>edutrong>ced viability of T-47D cells and induction

of death inducing autophagy in the presence of

sulfabenzamide (Figure 5). T -47D cells contain

only a single copy of the p53 missense mutation

(Schafer et al., 2000). It has been reported by

various studies that mutant p53 may lose its natural

antitumor activity (Lim et al., 2009). Interestingly,

in the presence of sulfabenzamide the antitumor

activities of mutant form of p53 should return to the

normal activities of the wild type form to induce

autophagic cell death. This is very similar to the

mechanism of action for some antitumor drugs

reactivating mutant p53 to kill cancerous cells

(Lambert et al., 2009).

Evidently, checking of the protein expression

levels using other supplementary methods such as

western blotting could provide us better documents

to support the presented real time RT-PCR data.

But, in our work, we found that the registered

alterations for the level of RNA transcripts were in

a good consistence with the expected cellular

behaviors when the proteins' expression levels or

their activities were theoretically going to become

changed in parallel with the RNA levels in the

cells. Therefore, regardless of some exceptions,

evaluating RNA transcripts could provide us an

adequate image illustrating the changes in the

proteins’ expression levels in the cells.

Conclusions

In summary, we showed that cell cycle arrest (and

possibly autophagy) may play a role in action of

doxorubicin on T-47D cells. However, the

contribution of apoptosis and cell cycle arrest

antiproliferative effect of sulfabenzamide on T-47D

cells is minimal. These observations are in contrast

to many reports in which the mechanism of action

of sulfonamide derivatives on cancer cells

attributed to the conventional processes of

apoptosis and cell cycle arrest. We believe that

induction of autophagic cell death in T-47D cells is

triggered through p53/DRAM pathway (occurred

along with decreasing of Akt/mTOR pathway) and

this is a reasonable cellular axis to justify our

results.

Abbreviations

AKT: v-akt murine thymoma viral oncogene

homolog, mTOR: Mechanistic Target Of

Rapamycin, PTEN: Phosphatase and Tensin

homolog, DRAM: Damage Regulated Autophagy

Modulator, ATG5:Autophagy related gene 5,

Beclin1: Bcl2 Interacting protein 1, PARP1: Poly

ADP-Ribose Polymerase 1, DFF-40/CAD: DNA

Fragmentation Factor 40/ Caspase-Activated

DNase, Bax: Bcl2-Associated X protein, Bcl-2: B-

Cell Lymphoma 2, AIF: Apoptosis Inducing

Factor, DFF-45/iCAD: DNA Fragmentation

Factor 45/inhibitor of Caspase-Activated DNase,

Cdc2: Cell Division Cycle protein 2, ARF: ADP

Ribosylation Factor, GAPDH: Glyceraldehyde-3-

Phosphate Dehydrogenase, ACD: Autophagic Cell

Death, PCDII: type II Programmed Cell Death,

RPMI: Roswell Park Memorial Institute.

Conflict of interest

The authors declare that they have no competing

interest.

Authors' contributions

SS designed the study and experiments, analyzed

and interpreted data and also prepared the

manuscript. RM carried out the experiments and

participated in data analysis as well as writing the

initial draft of the manuscript. SH and SF

participated in performing the experiments. NS

contributed on giving scientific comments and also

carried out final editing of the manuscript.

Acknowledgements

Iran National Science Foundation (INSF) and

Research Council of University of Tehran have

been gratefully appreciated by the authors because

of their foundational supports for this work.

References

Akar U, Chaves-Reyez A, Barria M, Tari A,

Sanguino A, Kondo Y, et al. Silencing of Bcl-2

expression by small interfering RNA induces

autophagic cell death in MCF-7 breast cancer

cells. Autophagy. 4: 669–679, 2008.

Alberts B, Johnson A, Lewis J, Raff M, Roberts K,

Walter P. Molecular Biology of the Cell.


Garland science Taylor & Francis Group, LLC,

UK, 1115-1130, 2008.

Brunelli E, Pinton G, Bellini P, Minassi A,

Appendino G, Moro L. Flavonoid-induced

autophagy in hormone sensitive breast cancer

cells. Fitoterapia. 80: 327-332, 2009.

Chaitanya GV, Steven AJ, Babu PP. PARP-1

cleavage fragments: signatures of cell-death

proteases in neurodegeneration. Cell Commun

Signal. 8:31-41, 20trong>10trong>.

Daido S, Yamamoto A, Fujiwara K, Sawaya R,

Kondo S, Kondo Y. Inhibition of the DNAdependent

protein kinase catalytic subunit

radiosensitizes malignant glioma cells by

inducing autophagy. Cancer Res. 65: 4368-

4375, 2005.

Davis JW, Melendez K, Salas VM, Lauer FT,

Burchiel SW. 2,3,7,8-Tetrachlorodibenzo-pdioxin

(TCDD) inhibits growth factor

withdrawal-induced apoptosis in the human

mammary epithelial cell line, MCF-trong>10trong>A.

Carcinogenesis. 21: 881-886, 2000.

Dowejko A, Bauer RJ, Muller-Richter UDA,

Reichert TE. The human homolog of the

Drosophila headcase protein slows down cell

division of head and neck cancer cells.

Carcinogenesis. 30: 1678-1685, 2009.

Fukuoka K, Usuda J, Iwamoto Y, Fukumoto H,

Nakamura T, Yoneda T, et al. Mechanisms of

action of the novel sulfonamide anticancer

agents E7070 on cell cycle progression in

human non-small cell lung cancer cells. Inves

New Drugs. 19: 219-227, 2001.

Hoyer-Hansen M, Bastholm L, Mathiasen IS,

Elling F, Jaattela M. Vitamin D analog EBtrong>10trong>89

triggers dramatic lysosomal changes and Beclin

1-mediated autophagic cell death. Cell Death

Differ. 12: 1297–1309, 2005.

Hsu CL, Yen GC. Induction of cell apoptosis in

3T3-L1 pre-adipocytes by flavonoids is

associated with their antioxidant activity. Mol

Nutr Food Res. 50: trong>10trong>72-trong>10trong>79, 2006.

Kondo Y, Kanzawa T, Sawaya R, Kondo S. The

role of autophagy in cancer development and

response to therapy. Nat Rev Mol Cell Biol. 5:

726-734, 2005.

Kondo Y, Kondo S. Autophagy and cancer therapy.

Autophagy. 2: 85-90, 2006.

Sulfabenzamide promotes autophagic cell death 53

Lambert JMR, Gorzov P, Veprintsev DB,

Söderqvist M, Segerbäck, D, Bergman J et al.

PRIMA-1 reactivates mutant p53 by covalent

binding to the core domain. Cancer Cell. 15:

376-388, 2009.

LaPensee EW, Schwemberger SJ, LaPensee CR,

Bahassi E, Afton SE, Ben-Jonathan N. Prolactin

confers resistance against cisplatin in breast

cancer cells by activating glutathione-Stransferase.

Carcinogenesis. 30: 1298-1304,

2009.

Lim LY, Vidnovic N, Ellisen LW, Leong C-O.

Mutant P53 mediates survival of breast cancer

cells. Brit J Cancer. trong>10trong>1: 1606 – 1612, 2009.

Lindqvist A, Van Zon W, Karlsson Rosenthal C,

Wolthuis RMF. Cyclin B1–Cdk1 activation

continues after centrosome separation to control

mitotic progression. PLoS Biol. 5: 1127-1137,

2007.

Liu X, Zou H, Slaughter C, Wang X. DFF, a

heterodimeric protein that functions

downstream of caspase-3 to trigger DNA

fragmentation during apoptosis. Cell. 8: 175-

184, 1997.

Maiuri MC, Galluzzi L, Morselli E, Kepp O, Malik

SA, Kroemer G. Autophagy regulation by p53.

Curr Opin Cell Biol. 22: 181–185, 20trong>10trong>.

Maiuri MC, Zalckvar E, Kimchi A, Kroemer G.

Self-eating and self-killing: crosstalk between

autophagy and apoptosis. Nat Rev Mol Cell

Biol. 8: 741-752, 2007.

Martin DN, Baehrecke E. Caspases function in

autophagic programmed cell death in

Drosophila. Development. 131: 275- 284, 2004.

Mohan R, Banerjee M, Ray A, Manna T, Wilson L,

Owa T et al. Antimitotic sulfonamides inhibit

microtubule assembly dynamics and cancer cell

proliferation. Biochemistry. 45: 5440-5449,

2006.

Munoz-Gamez A, Rodriguez-Vargas JM, Quiles-

Perez R, Aguilar-Quesada R, Martin-Oliva D,

de Murcia G et al. PARP-1 is involved in

autophagy induced by DNA damage.

Autophagy. 5: 61-74, 2009.

Owa T, Yoshino H, Okauchi T, Yoshimatsu K,

Ozawa Y, Sugi NH, et al. Discovery of novel

antitumor sulfonamides targeting G1 phase of


54 Raziye MOHAMMADPOUR et al.

the cell cycle. J Med Chem. 42:3789-3799,

1999.

Ozawa Y, Sugi NH, Nagasu T, Owa T, Watanabe

T, Koyanagi N et al. E7070, a novel

sulphonamide agent with potent antitumour

activity in vitro and in vivo. Eur J Cancer. 37:

2275-2282, 2001.

Schafer JM, Lee ES, O'Regan RM, Yao K, Jordan

VC. Rapid development of tamoxifenstimulated

mutant p53 Breast Tumors (T47D) in

athymic mice. Clin Cancer Res. 6: 4373-4380,

2000.

Supuran CT, Casini A, Scozzafava A. Protease

inhibitors of the sulfonamide type: Anticancer,

antiinfammatory, and antiviral agents. Med Res

Rev. 23: 535-558, 2003.

Supuran CT. Indisulam: an anticancer sulfonamide

in clinical development. Expert Opin Investig

Drugs. 12: 283-287, 2003.

Tyagi A, Singh RP, Agarwal C, Agarwal R.

Silibinin activates p53-caspase2 pathway and

causes caspase-mediated cleavage of Cip1/p21

in apoptosis induction in bladder transitionalcell

papilloma RT4 cells: evidence for a

regulatory loop between p53 and caspase 2.

Carcinogenesis. 27: 2269-2280, 2006.

Valley AW, Balmer CM. Pharmacotherapy: A

Pathophysiologic Approach. Appleton &

Lange, CT. 1957-2012, 1999.

Yee KS, Wilkinson S, James J, Ryan KM, Vousden

KH. PUMA and Bax-induced autophagy

contributes to apoptosis. Cell Death Differ. 16:

1135–1145, 2009.

Yokoi A, Kuromitsu J, Kawai T, Nagas T, Sugi

NH, Yoshimatsu K, et al. Profiling novel

sulfonamide antitumor agents with cell-based

phenotypic screens and array-based gene

expression analysis. Mol Cancer Ther. 1: 275-

286, 2002.

Yokoyama T, Kondo Y, Bogler O, Kondo S. Drug

Resistance in Cancer Cells (Mehta, K. and

Siddik, Z.H., eds). Springer Science+Business

Media, LLC: PA. 53-71, 2009.

Yu L, Lenardo MJ, EH Baehrecke Autophagy and

caspases: a new cell death program. Cell Cycle.

3:1124-1126, 2004.

Yu SW, Wang H, Poitras MF, Coombs C, Bowers

WJ, Federoff HJ et al. Mediation of poly (ADPribose)

polymerase-1-dependent cell death by

apoptosis-inducing factor. Science. 297: 259-63,

2002.


Journal of Cell and Molecular Biology trong>10trong>(1): 55-64, 2012 Research Article 55

Haliç University, Printed in Turkey.

http://trong>jcmbtrong>.trong>halictrong>.trong>edutrong>.tr

Media optimization for amylase production in solid state

fermentation of wheat bran by fungal strains

Muhammad IRFAN*, Muhammad NADEEM, Quratualain SYED

Food & Biotechnology Research Center (FBRC), Pakistan Council of Scientific & Industrial Research

(PCSIR) Laboratories Complex, Ferozpure Road Lahore, Pakistan.

(* author for correspondence; mirfanashraf@yahoo.com)

Received: 02 April 2012; Accepted: 30 May 2012

Abstract

The present study is concerned with the optimization of environmental and cultural conditions for the

production of α-amylase from wheat bran in solid state fermentation by locally isolated strains of Aspergillus

niger- ML-17 and Rhizopus oligosporus-ML-trong>10trong> . The whole fermentation process was carried out in 250 ml

Erlenmeyer flask. Different parameters were optimized for each strain to obtain maximum enzyme yield. For

Aspergillus niger-ML-17, incubation period of 96 h, initial diluent pH of 5.0, 30°C incubation temperature,

inoculum size of 5% were found to be optimum for the production of α-amylase. Amylase production was

enhanced from 2.3 ± 0.014 IU to 4.4 ± 0.042 IU by supplementing the fermentation media with maltose

(0.25%), yeast extract (0.25%), NaNO3 (0.25%), MgSO4 (0.2%), NaCl (0.5%), Tween-80 (0.001%) and

Asparginine (0.0001%) . In case of Rhizopus oligosporus-ML-trong>10trong>, the optimized cultural conditions for the

production of 2.5 ±0.023 IU were inoculum size of trong>10trong>%, initial pH of the diluent 6.0, incubation temperature

of 35 o C for 96h. Further addition of maltose (25%), yeast extract (0.25%), NH4NO3 (0.25%), MgSO4 (0.2%),

NaCl (0.75%), Tween soluble starch (0.001%) and asparginine (0.0001%) to the medium significantly

enhance the enzyme production up to 3.2 ± 0.027 IU.

Keywords: Amylase, wheat bran, A.niger, R.oligosporus, solid state fermentation

Buğday kepeği katı hal fermentasyonunda mantar suşlarıyla amilaz üretimi için besiyeri

optimizasyonu

Özet

Bu çalışma yerel olarak izole edilen Aspergillus niger- ML-17 ve Rhizopus oligosporus-ML-trong>10trong> suşları

tarafından buğday kepeği katı hal fermentasyonunda amilaz üretimi için çevre ve kültür koşullarının

optimizasyonuyla ilgilidir. Tüm fermentasyon süreci 250 ml erlende yapılmıştır. Maksimum enzim ürünü

elde etmek amacıyla her suş bir için farklı parametreler optimize edilmiştir. Aspergillus niger- ML-17 için 96

saat inkübasyon süresi, çözücünün başlangıç pH’sı olarak 5.0, 30°C inkübasyon sıcaklığı, % 5 ekim

büyüklüğü α- amilaz üretimi için optimum bulunmuştur. Amilaz üretimi fermentasyon ortamına maltoz

(%0,25), maya özütü (% 0,25), NaNO3 (% 0,25), MgSO4 (% 0,2), NaCl (% 0,5), Tween-80 (% 0,001) ve

asparajin (% 0,0001) eklenmesiyle 2,3 ± 0,014 IU’ dan 4,4 ± 0,042 IU’ ya artmıştır. Rhizopus oligosporus-

ML-trong>10trong> için ise; 2,5 ± 0,023 IU üretim için optimize edilen kültür koşulları %trong>10trong> ekim büyüklüğü, çözücünün

başlangıç pH’sı 5,0, inkübasyon sıcaklığı 35°C, 96 saat olacak şekildedir. Besiyerine maltoz (25%), maya

özütü (0.25%), NH4NO3 (0.25%), MgSO4 (0.2%), NaCl (0.75%), Tween çözünür nişasta (0.001%) ve

Asparginine (0.0001%) eklenmesi enzim üretimini önemli ölçüde artırarak 3.2 ± 0.027 IU seviyesine

ulaştırmıştır.

Anahtar kelimeler: Amilaz, buğday kepeği, A.niger, R.oligosporus, katı hal fermentasyonu


56 Muhammad IRFAN et al.

Introduction

Amylases are a group of hydrolases that can

specifically cleave the O-glycosidic bonds in

starch. Two important groups of amylases are

glucoamylase and α-amylase. Glucoamylase (exo-

1,4-α-D-glucan glucanohydrolase, E.C. 3.2.1.3)

hydrolyzes single glucose units from the nonrtrong>edutrong>cing

ends of amylose and amylopectin in a

stepwise manner (Anto et al., 2006). Whereas αamylases

(endo-1,4-α-D-glucan glucohydrolase,

E.C. 3.2.1.1) are extracellular enzymes that

randomly cleave the 1,4-α-D-glucosidic linkages

between adjacent glucose units inside the linear

amylose chain (Anto et al., 2006, Castro et al.,

20trong>10trong>, Pandey et al., 2005).

Alpha-amylases are widely distributed in nature

and can be derived from various sources such as

plants, animals and microorganisms (Pandey et al.,

2005, Reddy et al., 2003 3-4). However, fungal and

bacterial amylases have predominant applications

in the industrial sector. Major advantage of using

fungi for the production of amylases is the

economical bulk production capacity and ease of

manipulation. Many species of Aspergillus and

Rhizopus are used as a source of fungal α-amylase

(Pandey et al., 2005).

Usually amylase production from fungi has

been carried out using well defined chemical media

by submerged fermentation (SMF) and solid state

fermentation (SSF) in recent times (Miranda et al.,

1999). The economics of enzyme production using

inexpensive raw materials can make an industrial

enzyme process competitive (Couto and Sanroman,

2006).

For the microbial α-amylase production, two

types of fermentation methods are mainly used i.e.

submerged and solid state (Norouzian et al., 2006).

Submerged fermentation (SmF) is comparatively

advanced and commercially important enzymes are

traditionally produced by this method (Hashemi et

al., 20trong>10trong>). Whereas, solid state fermentation (SSF)

is an old technology and has been used since 2600

BC. However, in recent year SSF has emerged as a

well developed biotechnological tool for the

production of enzymes (Bhatnagar et al., 20trong>10trong>).

Nowadays, spectrum of applications of αamylase

is also extending in many other areas such

as analytical chemistry, clinical and medicinal

diagnosis e.g. diagnosis of acute inflammation of

pancreas, macroamylasemia, perforated pelvic ulcer

and mumps (Anto et al., 2006, Nimkar et al., 20trong>10trong>,

Chimata et al., 20trong>10trong>, Muralikrishna et al., 2005).In

this study we reported here the process

optimization for amylase production from two

fungal species i.e. Aspergillus niger-ML-17 and

Rhizopus oligosporus-ML-trong>10trong> using wheat bran as a

solid substrate fermentation.

Materials and Methods

Substrate

Wheat bran was procured from local market of

Lahore city and was used as a substrate for amylase

production in solid state fermentation.

Microorganism and culture maintenance

Fungal strain of Aspergillus niger-ML-17 and

Rhizopus oligosporus-ML-trong>10trong> was obtained from

the Microbiology Laboratory of Food and

Biotechnology Research Center (FBRC), PCSIR

Laboratories Complex, Lahore. The culture was

maintained on Potato-Dextrose-Agar (PDA) slants.

The slants were grown at 30°C for 5 days and

stored at 4°C.

Inoculum preparation

trong>10trong> mL of sterilized distilled water was added to a

sporulated 5 days old PDA slant culture. An

inoculum needle was used to dislodge the spore

clusters under sterilized conditions and then it was

shaken thoroughly to prepare homogenized spore

suspension.

Solid-state fermentation

trong>10trong> g wheat bran amended with trong>10trong> mL of mineral

salt solution containing (g/L) KH2PO4 trong>10trong>, MgSO4 2,

NaCl 2 and MnSO4 0.5 was taken in 250 mL cotton

plugged Erlenmeyer flask, mixed homogenously

and sterilized at 121°C for 15 min in an autoclave.

Thereafter, the flask material was cooled at room

temperature and inoculated with 1 mL spore

suspensions of Aspergillus niger-ML-17 and

Rhizopus oligosporus-ML-trong>10trong>. The flasks were then

incubated at 30°C for 5 days.

Optimization of cultural and nutritional parameters

Various process parameters were optimized for

maximal enzyme production such as fermentation

period (24-168 h), incubation temperature (20-

40°C), initial pH (4-8), inoculum size (2, 5, 7, trong>10trong>,

13, 15, 17%). Experiments were also performed to

evaluate the influence of different carbon sources

(maltose, glucose, galactose, lactose, sucrose,

arabinose, cellulose, soluble starch) and nitrogen

sources (yeast extract, peptone, tryptone, urea,


ammonium citrate, ammonium phosphate,

NH4NO3, (NH4)2SO4, NH4Cl and NaNO3) different

metal salts (MnCl2, ZnCl2, CaCl2, MgSO4, FeSO4),

NaCl concentration (0.25-2.0%), surfactants

(Tween-80, Triton-X-trong>10trong>0, sodium dodecyl

sulphate, sodium lauryl sulphate) and different

amino acids (asparginine, aspartic acid, proline,

cystine, arginine ) on α-amylase production under

the optimized fermentation conditions.

Recovery of enzyme

After the specified incubation period (in each case),

50 mL of distilled water was added in each flask

containing fermented mash and placed on a shaker

at 200 rpm for 60 min. Afterward, the mixture was

filtered and centrifuged at 8,000 rpm for 15 min at

4°C to remove the fungal spores and unwanted

particles. The clear supernatant thus obtained after

centrifugation was used as a source of crude

enzyme.

Alpha amylase activity

The activity of α-amylase was assayed as described

earlier (Irfan et al., 2011) by incubating 0.5 mL of

the diluted enzyme with 0.5 mL soluble starch (0.5

%, w/v) prepared in 0.1 M sodium Phosphate

buffer, pH= 7. After incubation at 60 ºC for trong>10trong>

minutes the reaction was stopped and the rtrong>edutrong>cing

sugars released were assayed colorimetrically by

the addition of 1 mL of 3-5-dinitrosalicylic acid

reagent. One enzyme activity unit (U) was defined

as the amount of enzyme releasing 1 µmol of

maltose from the substrate in 1 minute at 60 ºC.

Statistical analysis

All the data was statistically (SD) analyzed by

using Microsoft excel computer programme.

Results

Amylase production in solid state fermentation 57

The most widely used enzyme in the industry for

starch hydrolysis is α-amylase. These enzymes

account for 65 % of enzyme market in the world

(Muralikrishna et al., 2005). For the production of

commercially important enzymes, selection of a

particular strain remains a tedious task. Amylolytic

enzymes are commonly produced by filamentous

fungi preferably from species of Aspergillus and

Rhizopus (Pandey et al., 2005).

Time course study for the production of αamylase

Figure 1 depicts the time course study (24-120 h)

for the production of α-amylase by Aspergillus

niger-ML-17 and Rhizopus oligosporus-ML-trong>10trong>

using solid state fermentation. Optimum

fermentation period of 96 h was best for both

Aspergillus niger-ML-17 (4.7 ±0.14 IU) and

Rhizopus oligosporus-ML-trong>10trong> (2.7 ±0.08 IU) in

solid state fermentation. Further increase in the

incubation period decreased the enzyme secretion.

Therefore, incubation time of 96 h was selected as

optimum time for the production of α-amylase in

the subsequent experimental work. Maximum

accumulation of α-amylase occurs during stationary

phase. Further increase in incubation period

decreased the production of α-amylase. It might be

due to the deficiency of nutrients, accumulation of

toxic substances and proteolysis of α-amylase as

interpreted by many workers (Chamber et al., 1999,

Shafique et al., 2009). Abu et al., (2005) also

reported maximum α-amylase production by

Aspergillus niger after an incubation period of 96 h.

Figure 1. Time course study of amylase production (Error bars represent the SD among replicates).


58 Muhammad IRFAN et al.

Effect of initial pH of diluent on α-amylase

production

The effect of different initial pH (4-6.5) of the

diluent on α-amylase production by Aspergillus

niger-ML-17 and Rhizopus oligosporus-ML-trong>10trong>

using SSF is shown in figure 2. Enzyme production

was maximum (3.7±0.015 IU) when initial pH of

the diluent was adjusted at 5.0 using strains of

A.niger-ML-17 in SSF. When strain of

R.ologosporus –ML-trong>10trong> was employed for amylase

production, it gave better yield (2.7 ± 0.016 IU) at

6.0 initial pH of the diluent. Further increase in the

initial pH of the diluent resulted decreased in the

enzyme activity. It is due to the fact that fungal

growth was optimum at this pH and hence the

enzyme production. Initial pH of the medium is

known to affect the synthesis and secretion of αamylase.

Alpha amylase production by microbial

strains strongly depends on the extracellular pH as

it influences many enzymatic reactions as well as

the transport of various components across the cell

membrane (Ellaiah et al., 2002). In contrast to the

present findings, Alva et al. (2007) achieved the

optimal α-amylase production at initial pH 5.8 by

Aspergillus sp. Conversely, this might be because

the requirement of slightly acidic pH for optimum

growth of fungi (Liu et al., 2008, Sun et al., 2009).

Figure 2. Effect of initial pH of diluents on amylase production (Error bars represent the SD among

replicates)

Effect of temperature on the production of αamylase

Figure 3 showed the effect of varying incubation

temperature (20-40ºC) on the production of αamylase

by Aspergillus niger-ML-17 and

R.oligosporus-ML-trong>10trong> using SSF. Maximal enzyme

production (3.5 ±0.034 IU) was obtained in

fermentation flask that was incubated at 30ºC after

the conidial inoculation of A.niger-ML-17. On the

other hand R.oligosporus-ML-trong>10trong> gave better

enzyme production (2.5 ±0.023 IU) at 35 o C. All the

other flasks that were incubated on temperatures

other than these gave comparatively less production

of α-amylase. Alpha amylase production by fungi is

related to the growth which sequentially depends

upon the incubation temperature. Many other

researchers have also reported 30°C as optimum

temperature for the fungal growth and enzyme

production. This is because the enzyme production

is growth associated and 30°C is optimum

temperature for fungi and subsequently α-amylase

production (Shafique et al., 2009, Dakhmouche et

al., 2006).


Amylase production in solid state fermentation 59

Figure 3. Effect of incubation temperature on amylase production (Error bars represent the SD among

replicates).

Effect of inoculum size on the production of αamylase

Effect of inoculum size was checked by varying the

concentration of spores of A.niger-ML-17 and

R.oligosporus-ML-trong>10trong> in solid state fermentation of

wheat bran. Optimum inoculum size of 5% (3.5

±0.014 IU) and trong>10trong>% (2.9 ±0.011 IU) of A.niger-

ML-17 and R.oligosporus-ML-trong>10trong> gave highest

yield of enzyme production respectively as shown

in figure 4. By increasing the size of inoculum

resulted in decreased enzyme production. Increased

inoculum size resulted in increases moisture level

which ultimately decreased the fungal growth and

enzyme production (Sharma et al., 1996). Ammar

and El-Safey (2003) obtained highest yield of

amylase production from A. flavus var columnaris

using inoculum size of 0.0637 x trong>10trong> 6 /ml -1 . In

another study 5 x trong>10trong> 6 spores per flask gave

maximum enzyme production by Aspergillus niger

ATCC 16404 (Dakhmouche et al., 2006). Zambare

(20trong>10trong>) obtained highest enzyme production (1672-

1693 U/gdfs) at inoculum level of 5-8% (v/w) in

solid state fermentation using strain of A.oryzae.

Figure 4. Effect of inoculum size on amylase production (Error bars represent the SD among replicates).

Effect of different carbon sources on the

production of α-amylase

Different carbon sources i.e. soluble starch,

glucose, galactose, lactose, arabinose, cellulose,

maltose and sucrose were also evaluated for the

production of α-amylase (Figure 5). A.niger-ML-

17 better used the maltose as a carbon source and

improved enzyme production (4.4 ± 0.042 IU) as

compared to control while soluble starch (3.2 ±

0.027 IU) was found best carbon source for

amylase production in case of R.oligosporus-ML-

trong>10trong>. All the other tested carbon sources gave

comparatively less enzyme production which is

supplemented to the fermentation medium at

concentration of 0.25% (w/v). Therefore, soluble

starch and maltose was optimized as a carbon

source in the further experimental work

R.oligosporus-ML-trong>10trong> and A.niger-ML-17

respectively. Many other workers also reported

starch as the best carbon source for the production

of alpha amylase (Gigras et al., 2002, Dharani

2004). It is because α-amylase is an extracellular

enzyme and its production is increased by its

substrate (Chimata et al., 20trong>10trong>; Varalakshmi et al.,

2009).


60 Muhammad IRFAN et al.

Figure 5. Effect of different carbon sources on amylase production (Error bars represent the SD among

replicates).

production by employing strains of A.niger-ML-17

Effect of different nitrogen sources on the

and R.oligosporus-ML-trong>10trong>. Thus, yeast extract was

production of α-amylase

used as an optimized organic nitrogen sources in

Figure 6 depicts the effect of nitrogen sources this further research. Hashemi et al., (20trong>10trong>) also

(peptone, urea, tryptone, casein, skimmed milk and obtained maximum α-amylase production (140

yeast extract NH4SO4, NH4NO3, NaNO3, U/g) with NH4NO3 but at a level of 1% (w/v).

ammonium citrate & ammonium phosphate) on the Amylase production is enhanced with the addition

production of α-amylase by Aspergillus niger-ML- of organic nitrogen sources (Hamilton et al., 1999,

17 and R.oligosporus-ML-trong>10trong> using SSF. Among all Hayashida et al., 1998 28,29). Many workers (Anto

the selected inorganic nitrogen sources maximum et al., 2006, Pederson and Neilson 2000, Oshoma et

amylase production (3.9 ±0.1IU) was obtained, al., 20trong>10trong>, Valaparla 20trong>10trong>) reported that yeast

when NaNO3 (0.25%, w/v) was used in medium extract as an organic nitrogen source produces

inoculated with spores of A.niger-ML-17 while the maximum amylase production. Pederson and

strain R.oligosporus-ML-trong>10trong> best utilized (2.6 ±0.08 Neilson (2000) optimized (NH4)2SO4 for maximum

IU) NH4NO3 at concentration of 0.25% for amylase amylase productivity by A. oryzae.

production. In case of organic nitrogen sources

yeast extract was found better for amylase

Figure 6. Effect of nitrogen sources on amylase production (Error bars represent the SD among replicates).

Effect of different metal salts on amylase

production in SSF

Different metal salts (MnCl2, ZnCl2, CaCl2, MgSO4

and FeSO4) were added to the fermentation

medium to enhance the amylase yield by A.niger-

ML-17 and R.oligosporus-ML-trong>10trong> in solid state

fermentation. Results (Fig. 7) revealed that addition

of MgSO4 at 0.1% concentration to the medium

favored the enzyme production by both tested

fungi. Of all the metal salts FeSO4 lowers the

enzyme production as compared to control.

Rameshkumar and Sivasudha (2011) reported that

supplementation of 0.1% CaCl2 as a mineral source

to the medium effectively increased the amylase

production by B.subtilis in solid state fermentation.

According to Negi and Banerjee (20trong>10trong>) addition of

HgCl2 to the medium increases the amylase

production up to 2.44 folds. Most of the study

indicated that the enzyme did not require a specific

ion for their proper functioning (Reyed 2007).

Sanghvi et al., (2011) produced amylase from

Chrysosporium asperatum in submerged

fermentation and reported that supplementation of

FeCl3 in the medium as a mineral source slightly

increased the amylase production.


Amylase production in solid state fermentation 61

Figure 7. Effect of different metal salts on amylase production (Error bars represent the SD among

replicates).

Effect of different concentration of NaCl on

amylase production in SSF

In this experiment, different concentrations of NaCl

(0.25-2.0 %) were employed to check the effect of

different concentration of NaCl on amylase

production by A.niger-ML-17 and R.oligosporus-

ML-trong>10trong>. Results indicated (Fig. 8) that A.niger-ML-

17 showed maximum (3.6 ±0.17 IU) enzyme

production at 0.5% concentration of NaCl in the

medium while R.oligosporus-ML-trong>10trong> gave

maximum titer of amylase (2.5± 0.13 IU) at 0.75%

concentration of NaCl. By increasing the NaCl

concentration beyond this decline in enzyme

production was observed. Kokab et al., (2003)

produced amylase from Bacillus subtilis in solid

state fermentation having medium containing 1.5%

concentration of NaCl. Patel et al., (2005) purified

and characterized the amylase enzyme from

A.oryzae in SSF having medium with 0.1%

concentration of NaCl.

Figure 8. Effect of different concentrations of NaCl on amylase production (Error bars represent the SD

among replicates).

Effect of surfactants on amylase production

Figure 9 illustrated the effect of different

surfactants on amylase production by A.niger –ML-

17 and R.oligosporus-ML-trong>10trong>. Result showed that

addition of Tween 80 (0.05 v/w) to the medium is

effective in enzyme production by both A.niger-

ML-17 (3.7 IU) and R.oligosporus-ML-trong>10trong> (2.5 IU)

in SSF. SDS and SLS had no strong influence on

enzyme production in solid state fermentation by

tested fungi. Negi and Banerjee (20trong>10trong>) reported

that Triton-X-trong>10trong>0 and sodium laurate sulphate are

the stimulator for enzyme production but sodium

laurate sulphate increased amylase production by

1.28 folds. Gupta et al. (2008) also reported that

different surfactants like Tween-80, Triton X-trong>10trong>0

and SDS had strong influence on amylase

production in submerged fermentation using

Aspergillus niger. Vu et al. (2011) stated that use of

Tween-80 as a surfactant effectively enhances the

cellulose production in solid state fermentation.

Production of hydrolytic enzymes can be enhanced

by the surfactants and fatty acids (Singh et al.,

1991). When surfactants are added, they enhance

the microbial growth in SSF by promoting the

penetration of water into the solid substrate matrix,

leading in an increase of surface area (Asgher et al.,

2006).


62 Muhammad IRFAN et al.

Figure 9. Effect of different surfactants on amylase production (Error bars represents the SD among

replicates).

Effect of different amino acids on amylase

production in SSF

To check the effect of different amino acids on

amylase production, various amino acids like

asparaginine, aspartic acid, praline, cysteine and

arginine were evaluated by A.niger –ML-17and

R.oligosporus-ML-trong>10trong> in SSF. Results (Fig. trong>10trong>)

revealed that supplementation of asparginine with

concentration of 0.0001% favored enzyme

production in solid state fermentation. Rest of the

amino acids showed no significant effect on

enzyme production.

Sidkey et al. (20trong>10trong>), isolated different strains

from natural environment and screened for amylase

production. Among various screened strains

Aspergillus flavus was found to be potent amylase

producer when supplementations of methionine as

an amino acid cotent to the medium. Some workers

(Moustafa, 2002; Sidkey et al., 1996) reported that

acidic amino acids like glutamic and aspartic acids

are the best inducers for amylase production.

Figure trong>10trong>. Effect of different amino acids on amylase production (Error bars represent the SD among

replicates).

References

Abu EA, Ado SA, James DB. Raw starch

degrading amylase production by mixed culture

of Aspergillus niger and Saccharomyces

cerevisiae grown on Sorghum pomace. Afr J

Biotechnol. 4(8): 785- 790, 2005.

Alva S, Anumpama J, Savla J, Chiu YY, Vyshali

P, Shruti M, Yogeetha BS, Bhavya D, Purvi J,

Ruchi K, Kumudini BS, Varalakshmi KN.

Production and characterization of fungal

amylase enzyme isolated from Aspergillus sp.

JGI 12 in solid state culture. Afri J Biotechnol.

6(5):576-581, 2007.

Ammar MS and El-Safey EM. Production of αamylase

enzyme produced by Aspergillus flavus

var. columnaris, S-9KP from maize meal and

rice husk under solid-state fermentation (SSF)

conditions in open air. International Conference

of Enzymes in the Environment, Activity,

Ecology and Applications, Praha, Czech

Republic, July 14-17, pp.33, 2003.

Anto H, Trivedi UB and Patel KC. Glucoamylase

production by solid-state fermentation using

rice flake manufacturing waste products as


substrate. Bioresource Technol. 97(trong>10trong>):1161-

1166, 2006.

Asgher M, Asad MJ, Legge RL. Enhanced lignin

peroxidase synthesis by Phanerochaete

chrysosporium in solid state bioprocessing of a

lignocellulosic substrate. World J Microb

Biotechnol. 22:449-53, 2006.

Bhatnagar D, Joseph L, Raj RP. Amylase and acid

protease production by solid state fermentation

using Aspergillus niger from mangrove swamp.

Indian J Fish. 57(1):45-51, 20trong>10trong>.

Castro AM, Carvalho DF, Freire DMG, Castilho

LR. Economic analysis of the production of

amylases and other hydrolases by Aspergillus

awamori in solid-state fermentation of babassu

cake. SAGE-Hindawi Access to Research

Enzyme Research, 1, 9, 20trong>10trong>.

Chamber R, Haddaoui E, Petitglatran MF, Lindy O,

Sarvas M. Bacillus subtilis α-amylase. The rate

limiting step of secretion is growth phase in

dependent. FEMS Microbiol Lett. 173 (1):127-

131, 1999.

Chimata MK, Sasidhar P, Challa S. Production of

extracellular amylase from agricultural residues

by a newly isolated Aspergillus species in solid

state fermentation. Afri J Biotechnol.

9(32):5162-5169, 20trong>10trong>.

Couto SR and Sanroman MA. Application of solidstate

fermentation to food industry. J Food Eng.

76:291-302, 2006.

Dakhmouche S, Gheribi-Aoulmi Z, Meraihi Z,

Bennamoun L. Application of a statistical

design to the optimization of culture medium

for a-amylase production by Aspergillus niger

ATCC 16404 grown on orange waste powder. J

Food Eng. 73 (2):190-197, 2006.

Dharani APV. Effect of C:N ratio on alpha amylase

production by Bacillus licheniformis SPT 27

Afr. J. Biotech., 3: 519-522, 2004.

Ellaiah PK, Adinarayana Y, Bhavani P and

Padmaja B. Optimization of process parameters

for glucoamylase production under solid state

fermentation by a newly isolated Aspergillus

species. Process Biochem. 38:615–620, 2002.

Gigras P, Sahai V, Gupta R. Statistical media

optimization and production of ITS alpha

amylase from Aspergillus oryzae in a

bioreactor. Current Microbiol. 45:203–208,

2002.

Amylase production in solid state fermentation 63

Gupta A, Gupta VK, Modi DR, Yadava LP.

Production and characterization of alpha

amylase from Aspergillus niger. Biotechnology.

7(3):551-556, 2008.

Hamilton LH, Kelly CT, Fogarty WM. Production

and properties of the raw starch-digesting αamylase

of Bacillus species IMD 435. Process

Biochem. 35(1–2):27–31, 1999.

Hashemi M, Shojaosadati SA, Razavi SH, Mousavi

SM, Khajeh K, Safari M. The efficiency of

temperature shift strategy to improve the

production of α-Amylase by Bacillus sp. in a

solid-state fermentation system. Food and

Bioprocess Technol. 5(3): trong>10trong>93-trong>10trong>99, 2012.

Hayashida S, Teamoto Y, Inove T. Production and

characteristics of raw potato Starch digesting

amylase from Bacillus subtilis. 65. Appl

Environ Microbiol. 54: 1516-1522, 1998.

Irfan M, Nadeem M, Syed Q, Baig S. Production

of thermostable α-amylase from Bacillus sp. in

solid state fermentation. J Appl Sci Res.

7(5):607-617, 2011.

Kokab S, Asghar M, Rehman K, Asad MJ, Adedyo

O. Bio-Processing of Banana Peel for α-

Amylase Production by Bacillus subtilis. Int J

Agr Biol. 5, 1, 2003.

Liu XD and Xu Y. A novel raw starch digesting αamylase

from a newly isolated Bacillus sp. YX-

1, Purification and characterization.

Bioresource Technol. 99: 4315-4320, 2008.

Miranda OA, Salgueiro AA, Pimental NCB,

Limafilho JJ, Melo EHM, Duran N. Lipase

production by a Brazilian strain of Penicillium

citrinium using industrial residue. Bioresource

Technology 69 : 145-149, 1999.

Moustafa OA. Thermostable alpha-amylase(s) from

irradiated microbial origin utilizing agricultural

and environmental wastes under solid state

fermentation conditions. M.Sc. Thesis. Al-Azhar

University, 2002.

Muralikrishna G and Nirmala M. Cereal αamylases-an

overview. Carbohydrate Polym.

60: 163-173, 2005.

Negi S and Banerjee R. Optimization of culture

parameters to enhance production of amylase

and protease from Aspergillus awamori in a

single fermentation. Afric J Biochem Res.

2(3):73-80, 20trong>10trong>.


64 Muhammad IRFAN et al.

Nimkar MD, Deogade NG, Kawale M. Production

of alpha-amylase from Bacillus subtilis &

Aspergillus niger using different agro waste by

solid state fermentation. Asiatic J Biotechnol

Res. 01:23-28, 20trong>10trong>.

Norouzan D, Akbarzadeh A, Scharer JM, Young

MM. Fungal glucoamylases. Biotechnol Adv.

24(1): 80-85, 2006.

Oshoma CE, Imarhiagbe EE, Ikenebomeh MJ,

Eigbaredon HE. Nitrogen supplements effect on

amylase production by Aspergillus niger using

cassava whey medium. Afri J Biotechnol. 9

(5):682-686, 20trong>10trong>.

Pandey A, Webb C, Soccol CR, Larroche C.

Enzyme Technology, New Delhi, Asiatech

publishers, Inc. 197, 2005.

Pederson H and Nielsen J. The influence of

nitrogen sources on the α-amylase productivity

of Aspergillus oryzae in continuous cultures.

Appl Microb Biotechnol. 53(3): 278-281, 2000.

Patel AK, Nampoothiri MK, Ramachandaran S.

Partial purification and characterization of αamylase

produced by Aspergillus oryzae using

spent brewing grains. Indian J Biotechnol.

4:336-341, 2005.

Rameshkumar A, Sivasudha T. Optimization of

Nutritional Constitute for Enhanced Alpha

amylase Production Using by Solid State

Fermentation Technology. Int J Microb Res. 2

(2):143-148, 2011.

Reddy AS, Jharat R, Byrne N. Purification and

properties of amylase from A review. J Food

Biochem. 21:281-302, 2003.

Reyed RM. Biosynthesis and properties of

extracellular amylase by encapsulation

Bifidobatrium bifidum in batch culture.

Australian J Basic Appl Sci. 1: 7-14, 2007.

Sanghvi GV, Rina DK, Kishore SR. Isolation,

Optimization, and Partial Purification of

Amylase from Chrysosporium asperatum by

Submerged Fermentation. J Microb Biotechnol.

21(5):470–476, 2011.

Shafique S, Bajwa R, Shafique S. Screening of

Aspergillus niger and A. flavus strains for extra

cellular α-amylase activity. Pak J Bot.

41(2):897-905, 2009.

Sharma DK, Tiwari M, Behere BK. Solid state

fermentation of new substrates for production of

cellulase and other biopolymer hydrolyzing

enzymes. Appl Biochem Biotechnol. 15:495-

500, 1996.

Sidkey NM, Abo-Shadi MA, Al-Mutrafy AM,

Sefergy F, Al-Reheily N. Screening of

Microorganisms Isolated from some Enviro-

Agro-Industrial Wastes in Saudi Arabia for

Amylase Product. J American Sci. 6(trong>10trong>):926-

939, 20trong>10trong>.

Sidkey NM, Shash SM, Ammar MS. Regulation of

α-amylase biosynthesis by Aspergillus sp. ,S-7

attaching the Nile Hyacinth homogenate

produced under laboratory scale fermentation

conditions. Al-Azhar Bullutin Sci. 7(1):437-488,

1996.

Singh A, Abidi AB, Darmwal NS, Agrawal AK.

Influence of nutritional factors of cellulase

production from natural lignocellulosic residues

by Aspergillus niger. Agri Biol Res. 7:19-27,

1991.

Sun H, Ge X, Wang L, Zhao P, Peng M.

Microbial production of raw starch digesting

enzymes. Afr J Biotechnol. 8 (9):1734-1739,

2009.

Varalakshmi KN, Kumudini BS, Nandini BN,

Solomon J, Suhas R, Mahesh B, Kavitha AP.

Production and characterization of α-amylase

from Aspergillus niger JGI 24 isolated in

Bangalore. Polish J Microbiol. 58: 29-36,

2009.

Valaparla VK. Purification and properties of a

thermostable α-amylase by Acremonium

Sporosulcatum. Int J Biotechnol Biochem.

6(1):25–34, 20trong>10trong>.

Vu VH, Pham TA, Kim K. Improvement of fungal

cellulase production by mutation and

optimization of solid state fermentation.

Mycobiology. 39(1): 20-25, 2011.

Zambare V. Solid state fermentation of Aspergillus

oryzae for Glucoamylase Production on Agro

residues. Int J Life Sci. 4:16-25, 20trong>10trong>.


Journal of Cell and Molecular Biology - GUIDELINES for AUTHORS

General

Journal of Cell and Molecular Biology

(JCellMolBiol) is an international journal which

covers original works in the field of cell biology,

molecular biology, genetics, microbiology,

neurobiology, bioinformatics and related topics.

The official language of the journal is English,

however manuscripts in Turkish are accepted as

well.

Conditions for publication

This journal publishes research articles, review

articles, short communications, book/software

reviews, case reports and letters to the editor.

Research articles: Only original contributions will

be accepted which have not been published

previously. Manuscripts should not exceed 15

papers of printed text, including tables, figures and

references

Review articles: Reviews of recent developments in

a research field and ideas will be accepted.

Manuscripts should not exceed 15 papers of printed

text. Illustrations are encouraged.

Short communications: These include small-scale

investigations or innovative methods, techniques,

clinical trials and epidemiological studies. It should

not exceed 3 pages.

Letters to editor: These include opinions, news and

suggestions. Letters should not exceed 2 papers of

printed text.

Case Reports: These include individual

observations based on small numbers of subjects.

This type of research cannot indicate causality but

may indicate areas for further research.

REVISED

December 2011

Manuscripts should be submitted by e-mail to:

Journal of Cell and Molecular Biology

Haliç Üniversitesi

Fen Edebiyat Fakültesi

Moleküler Biyoloji ve Genetik Bölümü

Sıracevizler Cad. No:29

Bomonti-Şişli 34381, İstanbul-TÜRKİYE

Tel: +90 212 343 08 87, Fax: +90 212 231 06 31

E-Mail: trong>jcmbtrong>@trong>halictrong>.trong>edutrong>.tr

65

Book/software reviews: Short but concise

description of the book/software, not exceeding a

page. Book/software reviews are not peer reviewed.

Presentation

Papers should be typed clearly, double-spaced with

3 cm wide margins.

Manuscripts should be prepared using Word

Processor.

Cover Letter: You may briefly explain your work

and its contribution to present knowledge.

Title Page: The first page of your manuscript

should be a title page containing the type of paper;

the title; all authors' full names, and affiliations;

and the corresponding author's contact address

(including phone and fax numbers) and e-mail

address. The title should be as short as possible, but

should give adequate information regarding the

contents. Authors should also state a running title

of no more than 50 characters including spaces.

All pages must be numbered.

trong>Fulltrong> Paper

The full paper should be divided into the following

parts in the order indicated:


66

Abstract: A brief, informative abstract, not

exceeding 200 words, should be provided in

English and in Turkish. For authors who are not

native Turkish speakers, JCellMolBiol can provide

the Turkish abstract.

Keywords: Immediately following the abstract,

authors should provide 5 keywords or phrases that

reflect the content of the article.

Introduction should include theory, hypotheses,

prior work

Material and methods may include subheadings

Results: If the study consists of different parts,

subheadings in this section should be consistent

with subheadings in the methods.

Discussion

Acknowledgements should precede the list of

references

References: Papers cited in the manuscript should

be listed in alphabetical order according to the first

author's surname.

Tables and Figures

• Tables and figures should both be embedded

within the text in their appropriate positions and be

submitted separately.

• Electronically submitted figures are preferred in

*.jpg or *.tiff (min. 300 dpi) formats. Bar scales

should be drawn directly on the figures when

necessary. Figure legends should not be included in

the *jpg or *tif files.

• Each table should be accompanied by a short

instructive title line plus an explanatory caption at

the top. Indicate footnotes within tables by

superscript letters and type footnotes below the

table.

• All the tables and figures must be referred to

within the text.

Units, Abbreviations and Scientific Names

• Only SI units should be used. Current

abbreviations can be used without explanation,

others must be explained.

• All acronyms/abbreviations must be explained

in parenthesis after their first occurrence. If many

unfamiliar acronyms/abbreviations are used, please

REVISED

December 2011

compile them in an "Abbreviations" section at the

end of the paper.

• Latin expressions should be typed in italics.

Referencing

• In the text, citations with two authors should

take the form: Smith and Robinson,1990. If several

papers are cited by the same author in the same

year, they should be lettered in sequence (1990a),

(1990b), etc. When papers are by more then two

authors they should be cited as Smith et al.,1990. In

cases where more than one reference is written for

the same sentence, they should appear in ascending

publication order, e.g. (Jones et al., 2005; Smith et

al., 2007; Brown et al., 2009).

• In the list, references must be placed in

alphabetical order. The following models for the

reference list cover all situations. The punctuation

given must be exactly followed. The journal titles

should be abbreviated appropriately.

Redford IR. Evidence for a general relationship

between the induced level of DNA double

strand breakage and cell killing after Xirradiation

of mammalian cells. Int J Radiat

Biol. 49: 611- 620, 1986.

Tccioli CE, Cottlieb TM, Blund T. Product of the

XRCCS gene and its role in DNA repair and

V(D)J recombination. Science. 265: 1442-1445,

1994

Ohlrogge JB. Biochemistry of plant acyl carrier

proteins. The Biochemistry of Plants: A

Comprehensive Treatise. Stumpf PK and Conn

EE (Ed). Academic Press, New York. 137-157,

1987.

Brown LA. How to cope with your supervisor. PhD

Thesis. University of New Orleans, 2005.

Web document with no author: Leafy seadragons

and weedy seadragons 2001. Retrieved

November 13, 2002, from http:// www.

windspeed.net.au/jenny/seadragons/

Web document with author: Dawson J, Smith L,

Deubert K. Referencing, not plagiarism.

Retrieved October 31, 2002 from http:

//studytrekk.lis.curtin.trong>edutrong>.au/

• Only papers published or in press should be

cited in the literature list. Unpublished results,

including submitted manuscripts and those in

preparation, should be indicated as unpublished

data in the text.


Submission Policies and Authorship

Upon submission of a manuscript, it is accepted

that all co-authors have approved the contents of

the manuscript and its submission by the

corresponding author, and that the corresponding

author is authorized to represent all co-authors in

pre-publication discussions with JCellMolBiol.

The corresponding author is responsible for

ensuring that all the contributors to the relevant

work are listed as authors and that all authors have

aggreed to the manuscript’s content and its

submission to the JCellMolBiol. In case the Journal

happens to be aware of an authorship dispute,

authorship must be approved in writing by all of the

parties.

Cost

There are no submission fees or page charges.

Criteria for the Selection of Manuscripts

Manuscripts should meet the following criteria: The

study conducted is material is original and ethical,

the writing is clear; the study methods are

appropriate, the data are valid, the conclusions are

reasonable and supported by the data; the

information is important; and the topic is

interesting to our readership.

Editorial Processes

Researchers may request informal feedback from

the editors in a particular manuscript. The

presubmission process aids in the submission

decision for authors.

When JCellMolBiol receives a manuscript, the

Editor-in-Chief will first decide whether the

manuscript meets the formal criteria specified with

“Guidelines for Authors” and whether it fits within

the scope of the Journal. In case of doubt on the

basis of initial review, the Editor-in-Chief will

consult other members of the Editorial Board.

Manuscripts that are found suitable for peer review

will be assigned to two expert reviewers. Reviewers

may either be Editorial/Advisory Board members

or external experts selected by the Editorial Board.

The corresponding author is notified by e-mail

when the editor decides to send a paper for review.

The reviewers will have up to three weeks to

review the submitted article. After peer review, the

editor will contact the author. If the author is

required to submit a revised version, the revised

version has to be submitted by the author within

REVISED

December 2011

67

two weeks. Otherwise, the manuscript will be

removed from the manuscript submission queue

and will be considered rejected.

In cases where the referees have requested welldefined

changes to the manuscript, editors may

request a revised manuscript that addresses to

referees’ concerns. The revised version is sent back

to the original referees for re-review. In cases

where the referees’ concerns are more wideranging,

editors may reject the manuscript. The

revised manuscript should be accompanied by a

cover letter that includes a point-by-point response

to referees’ comments and an explanation of how

the manuscript has been changed.

As a matter of policy, we do not suppress referees’

reports, any comments directed to authors are

transmitted regardless of what we may think of the

content. On rare occasions, we may edit a report to

remove offensive language or comments to reveal

confidentiality.

The final decision to accept or reject a manuscript

will be made by the Editor-in-Chief. If it becomes

apparent that there are serious problems with the

scientific content or with violations of our

publishing policies, the Editor-in-Chief also

reserves the right to reject a paper even after it has

been accepted.

After acceptance, the Editor-in-Chief may make

further changes to the text and figures so that the

manuscript is readable and clear. Page proofs will

be sent to the corresponding author via email for

checking before publication. Corresponding authors

are sent proofs and are welcome to discuss

proposed changes with the Editor-in-Chief, but

JCellMolBiol reserves the right to make the final

decision about the style. Corrected proofs should be

sent back within three days of receipt, otherwise the

Editor-in-Chief reserves the rights to correct the

proofs himself and to send the material for

publication. In cases where the authors do not

submit the appropriately signed Publication

Agreement Form, the manuscript is drawn from

publication process even if it is accepted.

Appeals

Authors have the right to ask the Editor-in-Chief to

reconsider a rejection decision, which is considered

an appeal. Decisions are reversed only if the Editor

is convinced that the original decision was a serious

mistake. If an appeal merits further consideration,

the Editor may send the author’s response or the

revised paper to one or more referees, or Editor


68

may ask one referee to comment on the concerns

raised by another referee.

Advance Online Publication

JCellMolBiol provides Advance Online Publication

of articles, which benefit authors with an earlier

publication date and allows the readers’ access to

accepted papers several weeks before they appear

in print

Ethical Issues

For manuscripts reporting experiments on live

vertebrates or higher invertebrates, authors must

declare that the study was approved by the

institutional ethics committee. Papers describing

investigations on human subjects must include a

statement that informed consent was obtained from

all subjects.

Plagiarism

If portions of the manuscript have already been

published by the author on other journals or

websites, JCellMolBiol Editorial Board needs to

know which portions of the manuscript have been

previously published and where. The author should

include a note in the cover letter indicating which

portions have been published elsewhere.

In case of any suspicion on scientific misconduct or

dishonesty in research, JCellMolBiol reserves the

right to forward any submitted manuscript to an

appropriate authority for investigation.

Copyright Notice

It is the responsibility of the submitting author to

ensure that the authorship of the paper reflects the

contributions of the authors to the work described,

and that all listed authors have agreed to the

submission of the manuscript in its current form.

Conditions of publication in JCellMolBiol are that

the paper has not already been published elsewhere;

that it is not currently being considered for

publication else-where; all persons designated as

authors should qualify for authorship, and all those

who qualify should be listed. If accepted, Haliç

University and JCellMolBiol have the exclusive

license to publish.

JCellMolBiol is freely available to individuals and

institutions. Copies of this Journal and articles in

this journal may be distributed for research or for

trong>edutrong>cational purposes free of charge. However,

REVISED

December 2011

commercial use of articles contained herein is

prohibited without the written consent of the

Editor-in-Chief.

Publication Agreement

The corresponing author is required to assign the

Publication Agreement Form in order to publish the

submitted manuscript in JCellMolBiol.


Journal of Cell and

trong>Volumetrong> trong>10trong> · No 1 · June 2012

Review Article

Molecular Biology

Production and industrial applications of laccase enzyme

M. IMRAN, M.J. ASAD, S.H. HADRI, S. MEHMOOD

Research Articles

Isolation and biochemical identification of Escherichia coli from wastewater effluents of food

and beverage industry

T. FARASAT, Z. BILAL, F. YUNUS

Investigation of the MGP promoter and exon 4 polymorphisms in patients with ischemic

stroke in the Ukrainian population

A.V. ATAMAN, V.Y. GARBUSOVA, Y.A. ATAMAN, O.I. MATLAJ, O.A. OBUCHOVA

Investigation of the association of survivin gene -625G/C polymorphism in non-small cell

lung cancer

E. AYNACI, E. COŞKUNPINAR, A. EREN, O. KUM, Y. M. OLTULU, N. AKKAYA, A.

TURNA, İ. YAYLIM, P. YILDIZ

Effects of prenatal and neonatal exposure to lead on white blood cells in Swiss mice

R. SHARMA, K. PANWAR, S. MOGRA

Sulfabenzamide promotes autophagic cell death in T-47D breast cancer cells through p53/

DRAM pathway

R. MOHAMMADPOUR, S. SAFARIAN, S. FARAHNAK, S. HASHEMINASL, N. SHEIBANI

Media optimization for amylase production in solid state fermentation of wheat bran by

fungal strains

M. IRFAN, M. NADEEM, Q. SYED

Guidelines for Authors

1

13

19

27

33

41

55

65

More magazines by this user
Similar magazines