10 1 Full Volume (PDF)(jcmb.halic.edu.tr) - Journal of Cell and ...
Journal of Cell and
Molecular Biology
• Sulfabenzamide promotes autophagy through p53/ DRAM pathway
MGP polymorphisms in ischemic stroke
http://
Survivin -625G/C polymorphism in non-small cell lung cancer
Journal of Cell and
Molecular Biology
June 2012
İstanbul-TURKEY
Haliç University
Faculty of Arts and Sciences
Journal of Cell and Molecular Biology
Founder
Gündüz GEDİKOĞLU
Our Children Leukemia Foundation
Rights held by
A. Sait SEVGENER
Rector
Correspondence Address:
Journal of Cell and Molecular Biology
Haliç Üniversitesi
Fen-Edebiyat Fakültesi,
Sıracevizler Cad. No:29 Bomonti 34381 Şişli
İstanbul-Turkey
Phone: +90 212 343 08 87
Fax: +90 212 231 06 31
E-mail:
Journal of Cell and Molecular Biology is
indexed in
ULAKBIM, EBSCO,
DOAJ, EMBASE,
CAPCAS, EMBiology,
Socolar, Index COPERNICUS,
Open J-Gate, Chemical Abstracts
and
Genamics JournalSeek
ISSN 1303-3646
Printed at MART Printing House
Editor-in-Chief
Nagehan ERSOY TUNALI
Editorial Board
M. YOKEŞ
Baki
ÖZDİLLİ
Kürşat
Nural BEKİROĞLU
Emel BOZKAYA
M.Burcu IRMAK YAZICIOĞLU
Mehmet OZANSOY
Aslı BAŞAR
Editorial Assistance
Ozan TİRYAKİOĞLU
Özlem KURNAZ
Advisory Board
A.Meriç ALTINÖZ, Istanbul, Turkey
Tuncay ALTUĞ, İstanbul, Turkey
Canan ARKAN, Munich, Germany
Aglaia ATHANASSIADOU, Patras, Greece
E. Zerrin BAĞCI, Tekirdağ, Turkey
Şehnaz BOLKENT, İstanbul, Turkey
Nihat BOZCUK, Ankara, Turkey
A. Nur BUYRU, İstanbul, Turkey
Kemal BÜYÜKGÜZEL, Zonguldak, Turkey
Hande ÇAĞLAYAN, İstanbul, Turkey
İsmail ÇAKMAK, İstanbul, Turkey
Ayla ÇELİK, Mersin, Turkey
Adile ÇEVİKBAŞ, İstanbul, Turkey
Beyazıt ÇIRAKOĞLU, İstanbul, Turkey
Fevzi DALDAL, Pennsylvania, USA
Zihni DEMİRBAĞ, Trabzon, Turkey
Gizem DİNLER DOĞANAY, İstanbul, Turkey
Mustafa DJAMGÖZ, London, UK
Aglika EDREVA, Sofia, Bulgaria
Ünal EGELİ, Bursa, Turkey
Anne FRARY, İzmir, Turkey
Hande GÜRER ORHAN, İzmir, Turkey
Nermin GÖZÜKIRMIZI, İstanbul, Turkey
Ferruh ÖZCAN, İstanbul, Turkey
Asım KADIOĞLU, Trabzon, Turkey
Maria V. KALEVITCH, Pennsylvania, USA
Nevin Gül KARAGÜLER, İstanbul, Turkey
Valentine KEFELİ, Pennsylvania, USA
Meral KENCE, Ankara, Turkey
Fatma Neşe KÖK, İstanbul, Turkey
Uğur ÖZBEK, İstanbul, Turkey
Ayşe ÖZDEMİR, İstanbul, Turkey
Pınar SAİP, Istanbul, TURKEY
Sevtap SAVAŞ, Toronto, Canada
Müge TÜRET SAYAR, İstanbul, Turkey
İsmail TÜRKAN, İzmir, Turkey
Mehmet TOPAKTAŞ, Adana, Turkey
Meral ÜNAL, İstanbul, Turkey
İlhan YAYLIM ERALTAN, İstanbul, Turkey
Selma YILMAZER, İstanbul, Turkey
Ziya ZİYLAN, İstanbul, Turkey
Journal of Cell and Molecular Biology
CONTENTS
Review Article
Production and industrial applications of laccase enzyme
M. IMRAN, M.J. ASAD, S.H. HADRI, S. MEHMOOD
Research Articles
Isolation and biochemical identification of Escherichia coli from
wastewater effluents of food and beverage industry
T. FARASAT, Z. BILAL, F. YUNUS
Investigation of the MGP promoter and exon 4 polymorphisms in
patients with ischemic stroke in the Ukrainian population
A.V. ATAMAN, V.Y. GARBUSOVA, Y.A. ATAMAN, O.I. MATLAJ,
O.A. OBUCHOVA
Investigation of the association of survivin gene -625G/C polymorphism
in non-small cell lung cancer
Survivin geni -625G/C polimorfizminin Küçük Hücreli Dışı Akciğer
Kanseri ile ilişkisinin araştırılması
E. AYNACI, E. COŞKUNPINAR, A. EREN, O. KUM, Y. M. OLTULU, N.
AKKAYA, A. TURNA, İ. YAYLIM, P. YILDIZ
Effects of prenatal and neonatal exposure to lead on white blood cells in
Swiss mice
R. SHARMA, K. PANWAR, S. MOGRA
Sulfabenzamide promotes autophagic cell death in T-47D breast cancer
cells through p53/ DRAM pathway
R. MOHAMMADPOUR, S. SAFARIAN, S. FARAHNAK, S.
HASHEMINASL, N. SHEIBANI
Media optimization for amylase production in solid state fermentation
of wheat bran by fungal strains
M. IRFAN, M. NADEEM, Q. SYED
Guidelines for Authors
Front cover image: “DNA strands on abstract”
Shutterstock image ID: 704
1
13
19
27
33
41
55
65
Journal of Cell and Molecular Biology
Haliç University, Printed in Turkey.
http://
Production and industrial applications of laccase enzyme
Muhammad IMRAN *1,2 , Muhammad J. ASAD 1 , Saqib H. HADRI 1 and Sajid
MEHMOOD 2
1 Department of Biochemistry, Pir Mehr Ali Shah Arid Agriculture University, Rawalpindi, Pakistan
2 Department of Biochemistry and Biotechnology, University of Gujrat, Pakistan
(* author for correspondence; mirzaimran42@gmail.com)
Received: 22 April 2011; Accepted: 15 May 2012
Abstract
Laccase is an enzyme that has potential ability of oxidation. It belongs to those enzymes, which have innate
properties of reactive radical production, and its utilization in many fields has been ignored because of its
unavailability in the commercial field. There are diverse sources of laccase producing organisms like
bacteria, fungi and plants. Textile, pulp and paper industries discharge a huge quantity of waste in the
environment, and the disposal of this waste is a big problem. To solve this problem, work has done to
discover such an enzyme, which can detoxify these wastes and is not harmful to the environment. Laccases
use oxygen and produce water as by product. They can degrade a range of compounds including phenolic and
non-phenolic compounds. They also have ability to detoxify a range of environmental pollutants. Their
property to act on a range of substrates and also to detoxify a range of pollutants have made them to be
usable for several purposes in many industries including paper, pulp, textile and petrochemical industries.
Keywords: Laccase, solid state fermentation, oxidation, enzyme, fungi.
Lakkaz enziminin üretimi ve endüstriyel uygulamaları
Özet
Lakkaz, potansiyel oksidasyon yeteneği olan bir enzimdir. Reaktif radikal üretim özelliği olan enzimlere
dahildir ve birçok alandaki kullanımı, ticari alanda uygun olmaması nedeniyle göz ardı edilmektedir. Bakteri,
mantar ve bitki gibi lakkaz üreten çeşitli organizma kaynakları vardır. Tekstil, kağıt hamuru ve kağıt
endüstrisi çevreye büyük miktarda atık salmaktadır ve bu atıkların uzaklaştırılması büyük bir problemdir. Bu
sorunu çözmek üzere, atıkları detoksifiye eden ve çevreye zararlı olmayan bir enzim keşfetmek için
çalışmalar yapılmıştır. Bu enzim oksijen kullanır ve yan ürün olarak su üretir. Lakkaz, fenolik ve fenolik
olamayan bileşikleri içeren bir dizi bileşiği parçalayabilir. Ayrıca, bir dizi çevresel kirleticiyi detoksifiye
etme yeteneği vardır. Çeşitli substratlar üzerine etki etme ve ayrıca bir dizi kirliliği detoksifiye etme özelliği,
bu enzimleri çeşitli amaçlarla tekstil, kâğıt hamuru, kâğıt ve petrokimya endüstrisini kapsayan birçok
endüstride kullanılabilir kılmaktadır.
Anahtar kelimeler: Lakkaz, katı hal fermentasyonu, oksidasyon, enzim, mantarlar.
Introduction
Laccase was first discovered in the sap of the
Japanese lacquer tree Rhus vernicifera, and its
characteristic as a metal containing oxidase was
discovered by Bertrand in 1985 (Giardina et al.,
20
various basidiomycetous and ascomycetous fungi
and thus far fungal laccases have accounted for the
most important group of multicopper oxidases
(MCOs) with respect to number and extent of
characterization (Giardina et al., 20
The large quantity of laccases have been widely
reported inside white-rot fungi. A number of
2Muhammad IMRAN et al.
laccase genes have been isolated and distinguished
for this purpose (Mayer and Staples, 2002). The
improvement in laccase appearance, characterized
by an increase in protein and mRNA level, was
illustrated with Picnoprus cinnabarinus, Pleurotus
sajor caju and Trametes versicolor (Eggert et al.
1996, Solden and Dobson 2001, Collins and
Dobson 1997).
A number of species of genus Pleurotus have
been explained as manufacturers of laccase
(Leonowicz et al. 2001). We freshly reported that a
strain of P. pulmonarius produce laccase as the
main ligninolytic enzymes while cultured on wheat
bran solid state medium (Souza et al. 2002). In the
current study, numerous phenolic and aromatic
compounds structurally related to lignin were
calculated for their capability to arouse laccase
production by P. pulmonarius. (Solden and
Dobson, 2001).
P. pulmonarius was proficient of mounting on a
wide variety of phenolic and aromatic compounds.
Laccase production by P. pulmonarius could be
considerably improved by including an equimolar
combination of ferulic acid and vanillin as inducer.
The construction of different laccase isoform in
reply to phenolics implicates a possible task of this
enzyme in the detoxification processes (Souza et
al., 2002)
Numerous white-rot fungi, counting Trametes
versicolor, make extra cellular copper-containing
phenol oxidases (E C 1.
(Birhanli and Yesilada, 2006). The two major likely
natural functions attributed to fungal laccases are,
first, their participation in lignin degradation,
mutually with supplementary ligninolytic enzymes
such as peroxidases, and second, their function in
fungal virulence as key cause in pathogenesis in
opposition to plant hosts (Gianfreda et al., 1999).
As well, laccases display in vivo other functions
that are the foundation of several industrial
applications. For instance, in Aspergillus nidulans,
laccases take action on pigment development in
fungal spores (Smith et al., 1997). A number of
fungi also ooze laccases to take away either
potentially toxic phenols released through lignin
degradation or toxins formed by others organisms.
As a result, the enzyme has probable applications in
the textile industries, dye, as well as for the
degradation of a variety of xenobiotics, which are
recognized as ecological pollutants (Rama et al.
1998, Jolivalt et al. 1999, Mougin et al., 2000).
Laccase-producing fungi have also been
reported to be helpful apparatus for xenobiotic
removal in liquid effluents as well as in soil
bioremediation (Gianfreda et al. 1999, Jolivalt et al.
2000). Our outcomes demonstrate that the resulting
alteration products themselves are likely to
encourage biological effects moreover on
degrading or non-target organisms. So, an entire
characterization of these compounds is essential for
an entire assessment of the remediation processes
(Souza et al., 2002).
Laccase represents a family of coppercontaining
polyphenol oxidases (PPO) & are
usually called multicopper oxidases (MCO)
(Birhanli and Yesilada, 2006; Arora and Sharma,
20
oxidation of various substituted phenolic
compounds by using molecular oxygen as the
electron acceptor (Sharma et al., 2007). These
enzymes have less substrate specificity and have
the ability to degrade a range of xenobiotics
including industrial colored wastewaters (Souza et
al., 2006).
Laccases exhibit broad substrate range, which
varies from one laccase to another. Although it is
known to be diphenol oxidase, monophenols like 2,
6-dimethoxy phenol or guaiacol are better
substrates than phenols (e.g., catechol or
hydroquinone) (Baldrian, 2006; Arora and Sharma,
20
Laccases catalyze monoelectronic oxidation of
molecules to corresponding reactive radicals with
the help of four copper atoms, which form the main
catalytic core of the laccase, accompanied with the
diminution of oxygen to water molecules and
simultaneous oxidation of substrate to produce
radicals (Arora and Sharma, 20
cannot be directly oxidized by laccases, either
because of their large size which restricts their
penetration into the enzyme active site or because
of their particular high redox potential. To
overcome this hindrance, suitable chemical
mediators are used which are oxidized by the
laccase and their oxidized forms are then able to
interact with high redox potential substrate targets
(Arora and Sharma, 20
In fungi, laccases carry out a variety of
physiological roles including morphogenesis,
fungal plant pathogen/host interaction, stress
defense, and lignin degradation (Gianfreda et al.,
1999; Giardina et al., 20
found in nearly all woodrotting fungi analyzed so
far (Heinzkill and Messner, 1997; Giardina et al.,
20
have been isolated from plants, from some kinds of
bacteria, and from insects too (Enguita et al., 2003;
Sharma et al., 2007; Giardina et al., 20
Laccase has many applications in other fields,
like medical diagnosis, pharmaceutical industry.
Laccase has also applications in the agriculture area
by clearing herbicides, pesticides and some
explosives in soil. It is also used in the preparation
of some important drugs, like anticancer drugs, and
added in some cosmetics to r
Laccase also has the ability to form polymers of
value able importance (Couto and Herrera, 2006).
Solid state fermentation (SSF) is a technique in
which fungi are grown on solid substrate or
substrate moistened with a low quantity of mineral
salt solution and it has a great potential to produce
enzyme especially where the fermented raw
materials are used as a source of nutrients for the
fungi. The enzymes produced by this method have
several applications in several fields including food
and fermentation industry. These enzymes are also
used to prepare several bioactive compounds. SSF
system is much better than the submerged system
because a number of reasons. The benefits of SSF
over SMF include the high production of the
enzyme, and fewer effluent generation. Moreover,
comparably simple equipment is required for SSF
(Pandey, 1994).
Neurospora is a genus of kingdom fungi that
has become a popular experimental model
organism (Davis et al., 2002). Laccases have
copper atoms at their catalytic sites and are
oxidative enzymes (EC 1.
found in many species of fungi, where they are
involved in lignin degradation, in higher plants
where they are involved in biosynthesis of lignin
(Mayer and Staples, 2002; Sharma and Kuhad,
2008), in bacteria (Claus, 2003; Liers et al., 2007),
and in insects (Litthauer et al., 2007). Some species
of fungi and insects produce laccases as
intracellular proteins, but most of the laccases are
produced as extracellular proteins by all other types
of producers (Arora and Sharma, 20
Laccase production in various organisms
Production of laccase in fungi
Laccase production occurs in various fungi over a
wide range of taxa. Fungi from the deuteromycetes,
ascomycetes (Aisemberg et al., 1989) as well as
basidiomycetes are the known producers of laccase
(Sadhasivam et al., 2008). Among them,
basidiomycetes are considered efficient laccase
producers, especially white rot fungi (Revankar and
lele, 2006; Sadhasivam et al., 2008). Laccase
production has not been reported in lower fungi,
Production and industrial applications of laccase 3
i.e., Zygomycetes and Chytridiomycetes. However,
these groups have not yet been studied in detail
(Arora and Sharma, 20
Trametes versicolor, Chaetomium
thermophilum and Pleurotus eryngii are well
known producers of laccase. It has been reported
that some Trichoderma species, including T.
harzianum has the ability to produce polyphenol
oxidases (Kiiskinen et al., 2004; Sadhasivam et al.,
2008).
Laccase has been produced by many species of
soft, white rot fungi, geophilous saprophytic fungi.
Laccase has also been produced by many edible
mushrooms including the oyster mushroom
Pleurotus ostreatus, the rice mushroom Lentinula
edodes and champignon Agaricus bisporus. Other
laccase producers of wood-rotting fungi include T.
hirsuta (C. hirsutus), T. villosa, T. gallica, Cerrena
maxima, Lentinus tigrinus, T. ochracea, Pleurotus
eryngii, Trametes (Coriolus) versicolor,
Coriolopsis polyzona, etc. (Morozova et al., 2007).
In fungal physiology, laccases are involved in plant
pathogenesis, pigmentation, detoxification, lignin
degradation (Sadhasivam et al., 2008) and also in
development of morphogenesis of fungi (Baldrian,
2006; Morozova et al., 2007).
Laccases of wood-colonizing basidiomycetes
(white rot fungi) have been thoroughly studied (not
least also with respect to laccase-mediator
interaction), and many of them purified and
characterized on the protein and gene level (Liers et
al., 2007).
Mishra et al. (2008) have used cyanobacterial
biomass of water bloom, groundnut shell (GNS)
and dye effluent as culture medium for the
production of laccase by Coriolus versicolor. They
found the laccase production to be
U/ml in the medium having groundnut shell and
cyanobacterial bloom in a ratio of 9:1 (dry weight
basis) at initial pH 5.0 and 28±2 o C temperature.
Half life of enzyme was 74 min at 60 o C. Kinetic
analysis of laccase with ABTS were also
determined, Km and Vmax were found to be 0.29mM
and 9.49mol/min respectively. Azide and
hydroxylamine exerted significant inhibition on
production of thermostable laccase.
It is reported that Phanerochaete chrysosporium
NCIM 1197 also secretes extracellular laccase.
They also studied effect of several inducers on the
production of laccase. Among several inducers
tested copper sulphate has the greatest tendency to
enhance the produce of laccase. Laccase production
increased 3.5 fold in the presence of copper sulfate
4Muhammad IMRAN et al.
as compared to control. Laccase production under
SSF, batch fermentation in a laboratory scale
bioreactor and static liquid culture was also
compared. The maximum production of laccase
was achieved after five days and it was found to be
48.89±1.82 U/L, 30.21±1.66 and 22.56±1.22 U/L,
respectively (Gnanamani et al., 2006).
The white-rot fungus Trametes pubescens MB
89 is a source of the laccase production at industrial
level. Extracellular laccase formation is
considerably enhanced by the addition of Cu (II) in
the low quantities in the simple glucose medium.
When using glucose, a typically repressing
substrate, as the main carbon source, significant
laccase formation by T. pubescens only started
when glucose was completely consumed from the
culture medium. In addition, the nitrogen source
employed had an important effect on laccase
synthesis. When using an optimized medium
containing glucose (40 g/L), peptone from meat (
g/L), and MgSO4.7H2O and stimulating enzyme
formation by the addition of 2.0 mM Cu, maximal
laccase activities obtained in a batch cultivation
were approximately 330 U ml – l (Galhaup et al.,
2002).
Production of laccase in plants
Laccases are a diverse group of multi-copper
proteins with broad substrate specificity, originally
discovered in the exudates of Rhus vernicifera, the
Japanese lacquer tree and subsequently
demonstrated as a fungal enzyme as well (Sharma
and Kuhad, 2008). The plants in which the laccase
enzyme has been detected include lacquer, mango,
mung bean, peach, pine, prune, and sycamore
(Arora and Sharma, 20
being developed to express laccase in the crop
plants. Recently, laccase has been expressed in the
embryo of maize (Zea mays) seeds (Bailey et al.,
2004; Arora and Sharma, 20
Laccase is envolved in polymerization of lignin
units; p coumaryl, coniferyl, sinapyl alcohols and in
the synthesis of lignin in the plants (Morozova et
al., 2007). If the comparison between plant and
fungal laccases is taken up, the former takes part in
radical-based polymerization of lignin (Ranocha et
al., 2002; Arora and Sharma, 20
laccase contributes to lignin biodegradation due to
which it has gained considerable significance in
green technology (Arora and Sharma, 20
Production of laccase in bacteria
Laccase in bacteria is present intracellularly and as
periplasmic protoplast (Claus, 2003; Arora and
Sharma, 20
found in the plant root associated bacterium,
Azospirillum lipoferum (Givaudan et al., 1993;
Sharma et al., 2007; Sharma and Kuhad, 2008),
where it was shown to be involved in melanin
formation (Faure et al., 1994; Sharma and Kuhad,
2008). Laccase has been discovered in a number of
bacteria including Bacillus subtilis, Bordetella
compestris, Caulobacter crescentus, Escherichia
coli, Mycobacterium tuberculosum, Pseudomonas
syringae, Pseudomonas aeruginosa, and Yersinia
pestis (Alexandre and Zhulin, 2000; Enguita et al.,
2003; Arora and Sharma, 20
Stenotrophomonas maltophilia strain was found to
be laccase producing, which was used to degrade
synthetic dyes (Galai et al., 2008; Arora and
Sharma, 20
Laccase containing six putative copper binding
sites were discovered in marine bacterium
Marinomonas mediterranea, but no functional role
was assigned to this enzyme (Amat et al., 2001;
Sharma and Kuhad, 2008). Some of the reported
laccases have the ability to perform the activity at
very crucial conditions like in the presence of high
conc. of Cl - 1 and Cu +2 and even at neutral pH
values. The enzyme produced by Sinorhizobium
meliloti is a one of the examples of such enzymes
and is a protein having two subunits with pI 6.2 and
the molecular weight of the subunits is 45 kDa each
(Morozova et al., 2007), whereas laccase produced
by Pseudomonas putida is also an example of such
enzyme and is a single subunit 59 kDa protein
which works well at pH 7.0 (Morozova et al.,
2007). Both enzymes can oxidize syringaldazine.
Niladevi et al. (2009) used response surface
methodology for the optimization of different
nutritional and physical parameters for the
production of laccase by the filamentous bacteria
Streptomyces psammoticus MTCC 7334 in
submerged fermentation. Incubation temperature,
incubation period, agitationrate, concentrations of
yeast extract, MgSO4.7H2O, and trace elements
were found to influence laccase production
significantly.
A new laccase gene (cotA) was cloned from
Bacillus licheniformis and expressed in Escherichia
coli. The recombinant protein CotA was purified
and showed spectroscopic properties typical for
blue multi-copper oxidases. The enzyme has a
molecular weight of ~65kDa and demonstrates
activity towards canonical laccase substrates 2, 2’azino-bis
(3-ethylnenzothiazoline-6sulphonic acid)
(ABTS), syringaldazine (SGZ) and 2, 6-
dimethoxyphenol (2, 6-DMP). Kinetic constants Km
and kcat for ABTS were of 6.5±0.2 µM and 83s -1 ,
for SGZ of 4.3+0.2 µM and
DMP of 56.7+1.0 µM and 28 s -1 . Highest oxidizing
activities towards ABTS were obtained at 85 o C
(Koschorreck et al., 2009).
Production of laccase in insects
The laccase enzyme has also been characterized in
different insects, e.g., Bombyx, Calliphora,
Diploptera, Drosophila, Lucilia, Manduca, Musca,
Orycetes, Papilio, Phormia, Rhodnius,
Sarcophaga, Schistocerca, and Tenebrio (Arora
and Sharma, 20
In insects, laccases have been suggested to be
active in cuticle sclerotization (Dittmer et al., 2004;
Sharma and Kuhad, 2008). Recently, two isoforms
of laccase 2 gene have been found to catalyse
larval, pupal, and adult cuticle tanning in Tribolium
castaneum (Arakane et al., 2005; Sharma and
Kuhad, 2008)
Applications of laccase
Laccases have many biotechnological applications
because of their oxidation ability towards a broad
range of phenolic and non-phenolic compounds
(Figure 1) (Mohammadian et al., 20
Other applications of laccase include the
cleaning the industrial effluents, mostly from
industries like paper industry, pulp, textile &
petrochemical industries. Laccase are also used in
the medical diagnostics and for cleaning herbicides,
pesticides and some explosives in soil. Laccase has
many applications in agricultural, medicinal and
industrial areas (Arora and Sharma, 20
Laccases are also to clean the water in many
purification systems. It has also applications in
medical side to prepare certain drugs like anticancer
drugs and it is added in cosmetics to
minimize their toxic effects. Laccase has the
enormous ability to remove xenobiotic substances
and produce polymeric products and that is why
they are being used for many bioremediation
purposes (Couto and Herrera, 2006).
Now researchers are working on enzymatic
synthesis of organic compounds, laccase-based
biooxidation, and biotransformation and biosensor
development. The yield of laccase can be increased
by optimizing different cultural conditions (Arora
and Sharma, 20
Production and industrial applications of laccase 5
Figure 1. Scheme of applications of laccase
(Morozova et al., 2007)
Applications of laccase in food industries
Wine stabilization
Laccase is used to improve the quality of drinks
and for the stabilization of certain perishable
products containing plant oils (Morozova et al.,
2007). In food industry, wine stabilization is the
main application of laccase (Duran and Esposito,
2000; Rosana et al., 2002).
Polyphenols have undesirable effects on wine
production and on its organoleptic characteristics,
so their removal from the wine is very necessary
(Rosana et al., 2002). Many innovative treatments,
such as enzyme inhibitors, complexing agents, and
sulfate compounds, have been proposed for the
removal of phenolics responsible for discoloration,
haze, and flavor changes but the possibility of using
enzymatic laccase treatments as a specific and mild
technology for stabilizing beverages against
discoloration and clouding represents an attractive
alternative (Cantarelli et al., 1989; Arora and
Sharma, 20
allowed as a food additive, the use of immobilized
laccase might be a suitable method to overcome
such legal barriers as in this form it may be
classified as technological aid. So laccase could
find application in preparation of must, wine and in
fruit juice stabilization (Minussi et al., 2002; Arora
and Sharma, 20
Baking industry
In the bread-making process laccases affix bread
and/or dough-enhancement additives to the bread
dough, these results in improved freshness of the
bread texture, flavour and the improved
machinability (Minussi et al., 2002).
Laccase is also one of the enzymes used in the
baking industry. Laccase enzyme is added in the
6Muhammad IMRAN et al.
baking process which results in the oxidizing effect,
and also improves the strength of structures in
dough and/or baked products. Laccase imparts
many characteristics to the baked products
including an improved crumb structure, increased
softness and volume. A flour of poor quality can be
also used in this process using laccase enzyme
(Minussi et al., 2002).
Applications of laccase in textile industry
Synthetic dyes are widely used in such industries as
textile, leather, cosmetics, food and paper printing
(Forgacsa et al., 2004). Reactive dyes are coloured
molecules used to dye cellulose fibres (Tavares et
al., 2009). These dyes result in the production of
large amounts of high-colored wastewater. A
special problem is found in the application of
synthetic dyes that they are resistant to
biodegradation (Wesenberg et al., 2003, Moilanen
et al., 20
Normally, from
load will be present in the dyebath effluent, giving
rise to a highly coloured effluent (Vandevivere et
al., 1998; Moilanen et al., 20
treatment of industrial effluents containing
aromatic compounds is necessary prior to final
discharge to the environment (Khlifia et al., 20
Nowadays, environmental regulations in most
countries require that wastewater must be
decolorized before its discharge (Moilanen et al.,
20
the effluent (Tavares et al., 2009). A wide range of
physicochemical methods has been developed for
the degradation of dye-containing wastewaters
(Vandevivere et al., 1998; Tavares et al., 2009).
Wastewaters from textile dying process are usually
treated by physical or chemical processes, which
include physical–chemical processes electrokinetic
coagulation, electrochemical destruction,
irradiation, precipitation, ozonation, or the Katox
method that involves the use of active carbon and
the mixture of certain gases (air) (Banat et al.,
1996, Khlifia et al., 20
However, due to the chemical nature, molecular
size and structure of the reactive dyes these
classical processes can cause a problem in the
environment and better treatments can be obtained
using bioprocesses (Tavares et al., 2009). Recently,
enzymatic treatments have attracted much interest
in the decolourization/degradation of textile dyes in
wastewater as an alternative strategy to
conventional chemical and physical treatments,
which present serious limitations (Cristovao et al.,
2008, Tavares et al., 2009).
Five indigenous fungi P. ostreatus IBL-02, P.
chrysosporium IBL-03, Coriolus versicolor IBL-
04, G. lucidum IBL-05 and S. commune IBL-06
were screened for decolorization of four vat dyes,
Cibanon red 2B-MD, Cibanon golden-yellow PK-
MD, Cibanon blue GFJ-MD and Indanthrene direct
black RBS. The screening experiment was run for
alkaline Kirk’s basal nutrient medium in triplicate
(250 ml flasks). Every 48 h samples were read on
their respective wavelengths to determine the
percent decolorization. It was observed that C.
versicolor IBL-04 could effectively decolorized all
the four vat dyes at varying incubation times but
best results were shown on Cibanon blue GFJ-MD
(90.7%) after 7 days, followed by golden yellow
(88%), Indanthrene direct black (79.7%) and
Cibanon red (74%). P. chrysosporium also showed
good decolorization potential on Cibanon blue
(87%), followed by Cibanon golden-yellow
(74.8%), Red (71%), and Indanthrene direct black
(54.6%) (Asghar et al., 2008).
Decolourization and detoxification of a textile
industry effluent by laccase from Trametes trogii in
the presence and the absence of laccase mediators
had been investigated. It was found that laccase
alone was not able to decolourize the effluent
efficiently even at the highest enzyme
concentration tested: less than
was obtained with 9 U/mL reaction mixtures. To
enhance effluent decolourization, several potential
laccase mediators were tested at concentrations
ranging from 0 to 1mM. Most potential mediators
enhanced decolourization of the effluent, with 1hydroxybenzotriazol
(HBT) being the most
effective (Khlifia et al., 20
Moilanen et al. (20
from the white-rot fungi Cerrena unicolor and
Trametes hirsuta for their ability to decolorize
simulated textile dye baths. The dyes used were
Remazol Brilliant Blue R (RBBR) (
Congo red (12.5 mg/L), Lanaset Grey (75 mg/L)
and Poly R-478 (50 mg/L). They assessed the effect
of redox mediators on dye decolorization by
laccases. The result was that C. unicolor laccase
was able to decolorize all the dyes tested. It was
especially effective towards Congo red and RBBR
with 91 and 80% of color removal in 19.5 h despite
the fact that simulated textile dye baths were used.
Applications in pharmaceutical industry
Laccases have been used for the synthesis of
several products of pharmaceutical industry (Arora
and Sharma, 20
pharmaceutical importance that has been prepared
using laccase enzyme is actinocin that has been
prepared from 4-methyl-3-hydroxyanthranilic acid.
This compound has anticancer capability and works
by blocking the transcription of DNA from the
tumor cell (Burton, 2003).
Another example of the anticancer drugs is
Vinblastine, which is useful for the treatment of
leukemia. The plant Catharanthus roseus naturally
produces vinblastine. This plant produces small
amount of this compound. Katarantine and
vindoline are the precursors of this
pharmaceutically important compound. These
precursors are produced in higher quantities and are
easy to purifiy. Laccase is used to convert these
precursors into vinblastine. A 40% conversion of
these precursors into the final product has been
obtained using laccase (Yaropolov et al., 1994).
The use of laccase in such conversion reactions has
made the preparation of several important
compounds with useful properties, like antibiotics,
possible (Pilz et al., 2003).
Catechins have the antioxidant ability and
Laccases can oxidize catechins. These catechins
consist of small units of tannins and these are
important antioxidants found in tea, herbs and
vegetables. Catechins have the tendency to hunt
free radicals and their property makes them useful
in preventing several diseases including cancer,
inflammatory and cardiovascular diseases. The
catechins have less antioxidant ability; this property
can be increased by using laccase and has resulted
in the conversion of catechins in several products
with enhanced antioxidant capability (Kurisawa et
al., 2003).
Laccase has applications in the synthesis of
hormone derivatives. Intra et al. (2005) and Nicotra
et al. (2004) have reported that laccase has the
ability to seperate innovative dimeric derivatives of
the β-estradiol and of the phytoalexin resveratrol.
Isoeugenol oxidation coniferyl alcohol and totarol
gave new dimeric derivatives (Ncanana et al.,
2007) and a mixture of dimeric and tetrameric
derivatives (Shiba et al., 2000) respectively,
whereas the oxidation of substituted imidazole has
resulted in the production of even more complex
substrances. These new formed imidazoles or
oligomerization products (2–4) can be used for
pharmacological purposes (Kurisawa et al., 2003).
Aromatic and aliphatic amines can be converted
into 3-(3, 4-dihydroxyphenyl)-propionic acid using
laccase based oxidation. The derivatives have the
antiviral natural activity and can be used for
Production and industrial applications of laccase 7
pharmaceutical purposes (Ncanana et al., 2007).
Conclusion
Laccases are produced by various sources like
fungi, bacteria and insects. They have many
industrial applications because of their innate
ability of oxidation of a broad range of phenolic
and non-phenolic compounds. Laccase is utilized in
drink industry to improve the quality of drinks and
for stabilization of some perishable products having
plant oils. Laccases have the potential for the
synthesis of several useful drugs in pharmaceutical
industry because of their high value of oxidation
potential. Laccases have also tremendous ability of
oxidation of harmful and industrial products and
belongs to those enzymes, which have instinctive
properties of immediate radical production. Laccase
enzyme has the property to act on a range of
substrates and to detoxify a range of pollutants,
which have made them to be useful in many
industries including paper, pulp, textile and
petrochemical industries.
References
Aisemberg GO, Grorewold E, Taccioli GE,
Judewicz N. A major transcript in the response
of Neurospora crassa to protein synthesis
inhibition by cycloheximide. Exp Mycol. 13:
121–128, 1989.
Alexandre G, and Zhulin IB. Laccases are wide
spread in bacteria. Trends in Biotech. 18: 41–
42, 2000.
Amat AS, Elio PL, Fernandez E, Borron JCG,
Solano F. Molecular cloning and functional
characterization of a unique multipotent
polyphenol oxidase from Marinomonas
mediterranea. Biochem Biophys Acta. 1547:
Arakane Y, Muthukrishnan S, Beeman RW, Kanost
MR, Kramer KJ. Laccase 2 is the phenoloxidase
gene required for beetle cuticle tanning. PNAS.
Arora DS, Sharma RK. Ligninolytic Fungal
Laccases and Their Biotechnological
Applications. Appl Biochem Biotechnol. 160:
1760–1788, 20
8Muhammad IMRAN et al.
Asghar M, Batool S, Bhatti HN, Noreen R, Rahman
SU, Asad MJ. Laccase mediated decolorization
of vat dyes by Coriolus versicolor IBL-04. Int
Biodet Biodeg. 62: 465-470, 2008.
Bailey MR, Woodard SL, Callawy E, Beifuss K,
Lundback MM, Lane J. Improved recovery of
active recombinant laccase from maize seed.
Appl Microbiol Biotechnol. 63: 390–397, 2004.
Baldrian P. Fungal laccases occurrence and
properties. FEMS Microbiol Rev. 30: 215–242,
2006.
Banat IM, Nigam P, Singh D, Marchnt R.
Microbial decolorization of textile dye
containing effluent: a review. Bioresour
Technol. 58: 217–227, 1996.
Birhanli E and Yesilada O. Increased production of
laccase by pellets of Funalia trogii ATCC
200800 and Trametes versicolor ATCC 200801
in repeated-batch mode. Enzy Microb Technol.
39: 1286–1293, 2006.
Burton S. Laccases and phenol oxidases in organic
synthesis. Curr Org Chem. 7: 1317-1331, 2003.
Cantarelli C, Brenna O, Giovanelli G, Rossi M.
Beverage stabilization through enzymatic
removal of phenolics. Food Biotechnol. 3: 203–
214, 1989.
Claus H. Laccases and their occurrence in
prokaryotes. Arch Microbiol. 179: 145–150,
2003.
Collins PJ and Dobson ADW. Regulation of
laccase gene transcription in Trametes
versicolor. Appl Environ Microbiol. 63: 3444–
3450, 1997.
Couto SR and Herrera JLT. Industrial and
biotechnological applications of laccases: A
review. Biotechnol Advances. 24: 500–513,
2006.
Cristovao RO, Tavares APM, Ribeiro A, Loureiro
JM, Boaventura RAR, Macedo EA. Kinetic
modelling and simulation of laccase catalyzed
degradation of reactive textile dyes. Biores
Technol. 99: 4768–4774, 2008.
Davis RH and Perkins DD. Timeline: Neurospora:
a model of model microbes. Nat Rev Genet. 3:
397–403, 2002.
Dittmer NT, Suderman RJ, Jiang H, Zhu YC,
Gorman MJ, Kramer KJ, Kanost MR.
Characterization of cDNA encoding putative
laccase-like multicopper oxidases and
developmental expression in the tobacco
hornworm, Manduca sexta, and the malaria
mosquito, Anopheles gambiae. Insect Biochem
Mol Biol. 34: 29–41, 2004.
Duran N and Esposito E. Potential applications of
oxidative enzymes and phenoloxidase-like
compounds in wastewater and soil treatment: a
review. Appl Cataly Env. 28: 83–99, 2000.
Eggert C, Temp U, Eriksson KE. The ligninolytic
system of the white rot fungus Pycnoporus
cinnabarinus: purification and characterization
of the laccase. Appl Environ Microbiol. 62:
1151–1158, 1996.
Enguita FJ, Martins LO, Henriques AO, Carrondo
MA. Crystal structure of a bacterial endospore
coat component. A laccase with enhanced
thermostability properties. J Biol Chem. 278:
19416–19425, 2003.
Faure D, Bouillant ML, Bally R. Isolation of
Azospirillum lipoferum 4T Tn5 mutants affected
in melanization and laccase activity. Appl
Environ Microbiol. 60, 3413–3415, 1994.
Forgacsa E, Cserhatia T, Oros G. Removal of
synthetic dyes from wastewaters: a review.
Environ Int. 30: 953–971, 2004.
Galai S, Limam F, Marzouki MN. A new
Stenotrophomonas maltophilia strain producing
laccase. Use in decolorization of synthetic dyes.
Appl Biochem Biotechnol. 158(2): 416-431
2009.
Galhaup C, Wagner H, Hinterstoisser B, Haltrich
D. Increased production of laccase by the wooddegrading
basidiomycetes Trametes pubescens.
Enz Microb Technol. 30: 529–536, 2002.
Gianfreda L, Xu F, Bollag JM. Laccases: a useful
group of delignification and possible industrial
applications. Multi-Copper Oxidases.
Messerschmidt A (Ed). Singapore: World
Scientific. 201–224, 1999.
Giardina P, Faraco V, Pezzella C, Piscitelli A,
Vanhulle S, Sannia G. Laccases: a never-ending
story. Cell Mol Life Sci. 67: 369–385, 20
Givaudan A, Effose A, Faure D, Potier P, Bouillant
ML, Bally R. Polyphenol oxidase in
Azospirillum lipoferum isolated from rice
rhizosphere: evidence for laccase activity in
non-motile strains of Azospirillum lipoferum.
FEMS Microbiol Lett.
Gnanamani A, Jayaprakashvel M, Arulmani M,
Sadulla S. Effect of inducers and culturing
processes on laccase synthesis in
Phanerochaete chrysosporium NCIM 1197 and
the constitutive expression of laccase isozymes.
Enz Microb Technol. 38:
Heinzkill M, Messner K. The ligninolytic system of
fungi. Fungal biotechnology. Anke T (Ed).
Chap Hall Weinheim. 213–226, 1997.
Intra A, Nicotra S, Riva S, Daniel B. Significant
and unexpected solvent influence on the
selectivity of laccase-catalyzed coupling of
tetrahydro-2-naphthol derivatives. Adv Synth
Catal. 347: 973-977, 2005.
Jolivalt C, Brenon S, Caminade E, Mougin C,
Pontie M. Immobilization of laccase from
Trametes versicolor on a modified PVDF
microfiltration membrane: characterization of
the grafted support and application in removing
a phenylurea pesticide in wastewater. J Membr
Sci. 180:
Jolivalt C, Raynal A, Caminade E, Kokel B, Le
Goffic F, Mougin C. Transformation of N,N
dimethyl-N-(hydroxyphenyl)ureas by laccase
from the white rot fungus Trametes versicolor.
Appl Microbiol Biotechnol. 51: 676–681, 1999.
Khlifia R, Belbahria L, Woodwarda S, Ellouza M,
Dhouiba A, Sayadia S, Mechichia T.
Production and industrial applications of laccase 9
Decolourization and detoxification of textile
industry wastewater by the laccase-mediator
system. J Hazard Mater. 175: 802–80, 20
Kiiskinen LL, Ratto M, Kruus K. Screening for
novel laccase-producing microbes. J Appl
Microbiol. 97: 640–646, 2004.
Koschorreck K, Schmid RD, Urlacher VB.
Improving the functional expression of a
Bacillus licheniformis laccase by random and
site-directed mutagenesis. J Biotechnol. 9(12):
1-
Kurisawa M, Chung JE, Uyama H, Kobayashi S.
Laccase-catalyzed synthesis and antioxidant
property of poly(catechin). Macromol Biosci. 3:
758-764, 2003.
Leonowicz A, Cho NS, Luterek J, Wilkolazka A,
Wotjas-Wasilewska M, Matuszewska A,
Hofrichter M, Wesenberg D, Rogalski J. Fungal
laccase: properties and activity on lignin. J Bas
Microbiol. 41: 185–227, 2001.
Liers C, Ullrich R, Pecyna M, Schlosser D,
Hofrichter M. Production, purification and
partial enzymatic and molecular
characterization of a laccase from the woodrotting
ascomycete Xylaria polymorpha. Enz
Microb Technol. 41: 785–793, 2007.
Mayer AM. Polyphenol oxidases in plant: recent
progress. Phytochem. 26: 11–20, 1987.
Mayer AM, Staples RC. Laccase: new functions
for an old enzyme. Phytochem. 60: 551–565,
2002.
Minussi RC, Pastore GM, Duran N. Potential
applications of laccase in the food industry.
Trends in Food Scien Technol. 13: 205–216,
2002.
Mishra A, Kumar S, Kumar S. Application of Box-
Benhken experimental design for optimization
of laccase production Coriolus versicolor
MTCC138 in solid-state fermentation. J Sci
Indust Res. 67:
Mohammadian M, Roudsari MF, Mollania N,
Dalfard AB, Khajeh K. Enhanced expression of
a recomninant bacterial laccase at low
temperature and microacrobic conditions:
purification and biochemical characterization. J
Ind Microbiol Biotechnol. 5: 41-45, 20
Moilanen U, Osma JF, Winquist E, Leisola M,
Couto SR. Decolorization of simulated textile
dye baths by crude laccases from Trametes
hirsute and Cerrena unicolor. Eng Life Sci.
Morozova OV, Shumakovich GP, Gorbacheva MA,
Shleev SV, Yaropolov AI. “Blue” Laccases. J
Biochem. 72(
Mougin, C., Boyer, F. D., Caminade, E., Rama, R.
Cleavage of the diketonitrilederivative of the
herbicide isoxaflutole by extra cellular fungal
oxidases. J Agric Food Chem. 48: 4529–4534,
2000.
Ncanana S, Baratto L, Roncaglia L, Riva S, Burton
SG. Laccase mediated oxidation of totarol. Adv
Synth Catal. 349 : 1507-1513, 2007.
Nicotra S, Cramarossa MR, Mucci A, Pagnoni UM,
Riva S, Forti L. Biotransformation of
resveratrol: synthesis of trans-dehydrodimers
catalyzed by laccases from Myceliophtora
thermophyla and from Trametes pubescens.
Tetrahedron. 60: 595-600, 2004.
Niladevi KN, Sukumaran RK, Jacob N, Anisha GS,
Prema P. Optimization of laccase production
from a novel strain-Streptomyces psammoticus
using response surface methodology. Microbiol
Res. 164:
Pandey A. Solid State Fermentation. Pandey A
(Ed). Wiley Eastern Publishers, New Delhi. 3–
Pilz R, Hammer E, Schauer F, Krag U. Laccasecatalyzed
synthesis of coupling products of
phenolic substrates in different reactors. Appl
Microbiol Biotechnol. 60: 708-712, 2003.
Rama R, Mougin C, Boyer FD, Kollmann A,
Malosse C and Sigoillot JC. Biotransformation
of benzo[a]pyrene in bench scale reactor using
laccase of Pycnoporus cinnabarinus. Biotechnol
Lett. 20: 1
Ranocha P, Chabannes M, Chamayou S, Danoun S,
Jauneau A, Boudet AM. Laccase downregulation
causes alteration in phenolic
metabolism and cell wall structure in poplar.
Plant Physiol. 129:1–11, 2002.
Rosana C, Minussi Y, Pastore GM, Durany N.
Potential applications of laccase in the food
industry. Trends in Food Sci Technol. 13: 205-
216, 2002.
Savoie JM, Mata G, Billette C. Extracellular
laccase production during hyphal interactions
between Trichoderma sp. and Shiitake,
Lentinula edodes. Appl Microbiol Biotechnol.
49: 589-593, 1998.
Sadhasivam S, Savitha S, Swaminathan K, Lin FH.
Production, purification and characterization of
mid-redox potential laccase from a newly
isolated Trichoderma harzianum WL1. Process
Biochem. 43: 736-742, 2008.
Sharma KK and Kuhad RC. Laccase: enzyme
revisited and function redefined. Ind J
Microbiol. 48: 309–316, 2008.
Sharma P, Goel R, Caplash N. Bacterial laccases.
World J Microbiol Biotechnol. 23: 823-832,
2007.
Shiba T, Xiao L, Miyakoshi T, Chen CL. Oxidation
of isoeugenol and coniferyl alcohol catalyzed
by laccase isolated from Rhus vernicifera
Stokes and Pycnoporus coccineus. J Mol Catal
Enzym.
Smith M, Thurston F, Wood DA. Fungal laccases:
role in oxidor
1–25, 1997.
Solden DM and Dobson DW. Differential
regulation of laccase gene expression in
Pleurotus sajor-caju. Microbiol. 147: 1755–
1763, 2001.
Souza D and Peralta RM. Production of laccase
isoforms by Pleurotus pulmonarius in response
to presence of phenolic and aromatic
compounds. J Basic Microbiol. 44(2): 129–136,
2004.
Souza CGM, Zilly A, Peralta RM. Production of
laccase as the sole phenoloxidase by a Brazilian
strain of Pleurotus pulmonarius in solid state
fermentation. J Bas Microbiol. 42: 83–90, 2002.
Souza DDT, Tiwari R, Sah AK, Raghukumara C.
Enhanced production of laccase by a marine
fungus during treatment of colored effluents and
synthetic dyes. Enz Microb Technol. 38: 504-
511, 2006.
Tavares APM, Cristovao RO, Gamelas JAF,
Loureiro JM, Boaventuraa RAR, Macedoa EA.
Sequential decolourization of reactive textile
dyes by laccase mediator system. J Chem
Technol Biotechnol. 84: 442–446, 2009.
Vandevivere PC, Bianchi R, Verstraete W.
Treatment and reuse of wastewater from the
textile wet-processing industry: review of
emerging technologies. J Chem Technol
Biotechnol. 72: 289–302, 1998.
Wesenberg D, Kyriakides I, Agathos N. White-rot
fungi and their enzymes for the treatment of
industrial dye effluents. Biotechnol Adv. 22:
161–187, 2003.
Yaropolov AI, Skorobogatko OV, Vartanov SS,
Varfolomeyev SD. Laccase: Properties,
catalytic mechanism and applicability. Appl
Biochem Biotechnol. 49: 257–280, 1994.
Production and industrial applications of laccase 11
Journal of Cell and Molecular Biology
Haliç University, Printed in Turkey.
http://
Isolation and biochemical identification of Escherichia coli from
wastewater effluents of food and beverage industry
Tasnim FARASAT*, Zubia BILAL, Fakhar-un-Nisa YUNUS
Department of Zoology, Lahore College for Women University, Lahore, Pakistan.
(* author for correspondence; tasnimfarasat@hotmail.com)
Received: 20 May 2011; Accepted: 11 May 2012
Abstract
The aim of this study was the isolation and biochemical identification of E. coli from industrial wastewater
effluents. Sixty samples were collected from different sources in Lahore. The results revealed that E.coli was
found in higher concentration in wastewater of food and beverage industries. Wastewater is an important
reservoir for E.coli and presented significant acute toxicity if released into the receiving water body without
being adequately treated. Results revealed the presence of both gram negative and positive bacteria. There
was nonsignificant variation among all the samples of wastewater. The highest concentration of E.coli was
observed in wastewater of food industry Site A (Rettigon road) and beverage industry Site F (Wahdat road).
Biochemical and serological tests confirmed the presence of E.coli.
Keywords: E .coli, wastewater, food industry, beverage industry, effluent.
Yiyecek ve içecek endüstrisi atıksu deşarjlarından Escherichia coli eldesi ve biyokimyasal
tanımlanması
Özet
Bu çalışmanın amacı endüstriyel atıksu deşarjlarından E. coli eldesi ve biyokimyasal tanımlanmasıdır.
Lahor’da farklı kaynaklardan 60 örnek toplandı. Sonuçlar yiyecek ve içecek endüstrisi atıksularında daha
fazla konsantrasyonda E. coli bulunduğunu gösterdi. Atıksu önemli bir E.coli deposudur ve yeterli olarak
muamele edilmeden alıcı su kaynağına salınırsa ileri derecede toksik olabilir. Sonuçlar hem gram pozitif,
hem de gram negatif bakteri varlığını gösterdi. En yüksek E. coli konsantrasyonu A bölgesi (Rettigon yolu)
yiyecek endüstrisinin ve F bölgesi (Wahdat yolu) içecek endüstrisinin atıksularında gözlemlendi. Biyolojik
ve serolojik testler E. coli varlığını doğruladı.
Anahtar kelimeler: E.coli, atıksu, yiyecek endüstrisi, içecek endüstrisi, atıksu deşarjı.
Introduction
Industrial waste is the most common source of
water pollution in the present day (Ogedengbe and
Akinbile, 2004) and it increases yearly due to the
fact that industries are increasing as most countries
are getting industrialized. Industries produce wastes
which are peculiar in terms of type, volume and
frequency depending on the type of industry and
population that uses the product (Odumosu, 1992).
Water and wastewater management constitutes a
practical problem for the food and beverage
industry. In spite of significant improvement over
the last 20 years, water consumption and disposal
remain critical from environmental and economic
standpoint (Fillaudeau et al., 2005).
A food processing industry is involved with the
total environment from the farm to the customer.
Water is absolutely necessary for many steps in the
food processing industry. At present, there is no
economical substitute of water. Consequently water
conservation and water reuse are necessary. By
14 Tasnim FARASAT et al.
practicing conservation and reuse, the amount of
liquid waste and pollution potential from the food
processing is r
On a global scale, contamination of drinking
water by pathogenic bacteria causes the most
significant health risk to humans, and there have
been countless numbers of disease outbreaks and
poisonings resulting from exposure to untreated or
poorly treated drinking water. However, significant
risks to human health may also result from
exposure to toxic contaminants that are often
globally ubiquitous in waters from which drinking
water is derived. The presence of E. coli is a
definite indication of fecal contamination (WHO,
2004). Some E. coli strains can cause a wide variety
of intestinal and extra-intestinal diseases, such as
diarrhea, urinary tract infections, septicemia, and
neonatal meningitis (Orskov and Orskov, 1992).
The magnitude of the problem of bacterial
contamination deserves more elaborative studies
from the point of production of waste effluents to
the point of consumption at all intermediary levels.
The aim of the present research was isolation and
biochemical identification of E.coli from industrial
effluents of food and beverage industries in Lahore.
Material and methods
Sample collection
Sampling was completed in two successive months
from March to April for the microbial assessment
of waste effluents from food and beverage
industries. Total of sixty samples were collected. In
March, effluents of food industries were collected
from industries near Rettigon road, Township
industrial area, Township industrial estate. In April,
effluents of beverage industries were collected from
industries near Multan road and Wahdat road. Data
from each sample was collected and recorded in the
data book. Samples were collected in hermetically
sealed, sterilized falcon tubes and were kept at 4ºC
until analysis.
Sample processing
The technique described by Theodor Escherich,
1885 was used for isolation of E.coli (Escherich,
1885). To prevent contamination, the area was
swabbed with 70% ethanol prior to opening any
sample container. Samples (0.5 ml) were taken in
tube, and vortexed for one minute and left for thirty
minutes at room temperature. Then supernatant
(1ml) was taken from this test tube and a 2-fold
serial dilution was prepared (Reddy, 2007). After
this, 500 ml from the final dilution tube was
spreaded on the petri dishes (Pyrex) of MacConkey
medium and LB medium. Petri dishes were kept in
the incubator for 24 hours at 37ºC (Hajna and
Perry, 1939). After 24 hours, plates were studied
for the colonies of microbes grown on the media.
Microorganisms grown on MacConkey agar are
capable of metabolizing lactose which produces
acid by-products that lower the pH of the media
which causes the neutral red indicator to turn red,
and if sufficient acid is produced, a zone of
precipitated bile develops around the colony
(Koneman, 2005). Different biochemical tests
(Werkman, 1930; O'Meara, 1931; Vaughn et al.,
1939; Silva et al., 1980) were performed for the
identification of E. coli in the waste effluents of
food and beverage industry (Table 1).
Serological tests
Commercial latex kits are available for O157, O26,
and H7 strains of E. coli. O157 antiserum has been
shown to cross-react with other organisms
including E. hermanii (frequently found in foods)
(Hopkins and Hilton, 2000; Law, 2000). Tests
incorporated positive and negative control
organisms and control latex. Test was performed by
a slide agglutination test using somatic (O) or
flagella (H) antisera. Some pathogenic bacteria
were nonmotile.
Results
E. coli was cultured on LB medium and
MacConkey medium for morphological
characterization. After 24 hrs, two types of colonies
were isolated under microscopic examination. All
the isolated colonies were pink on MacConkey
medium, while creamy yellow on LB medium.
E. coli was observed in highest concentration
from wastewater samples of industry (Site A)
whereas in wastewater samples of industry (Site B)
six samples indicated the presence of E. coli which
was confirmed by biochemical and serological test.
Four samples were of gram positive bacteria which
may be Bacillus subtilus or Bacillus thuringiensis.
In industrial effluent (Site C) eight samples were of
gram negative while two samples were of gram
positive bacteria. It was observed that waste
effluents of food industry (Site A) revealed greater
percentage of gram negative bacteria.
In wastewater samples of industry (Site D) five
were gram negative, while five were gram positive
bacteria. Six samples in industrial effluent (Site E)
Samples
Sources
Industrial
effluent (A)
Industrial
effluent(B)
Industrial
effluent(C)
Industrial
effluent(D)
Industrial
effluent(E)
Industrial
effluent(F)
Identification of E. coli from wastewater 15
Table 1. Biochemical identification of E. coli in industrial wastewaters
Indole
Test
Spot
Indole
Test
Kovacs
Indole
Test
Methyl Red
Test
Voges
Proskeur
Test
Ammonium
acetate Test
Simmon's Test
Ammonium
Citrate Test
+ + + + - + -
+ + + + - + -
+ + + + - + -
+ + + + - + -
+ + + + - + -
+ + + + - + -
were gram negative and four were gram positive
bacteria. In the wastewater samples of beverage
industry (Site F) all samples were of gram negative
bacteria (Figure 1 and 2).
The average value of gram negative bacteria in
wastewater of food industry (Site A) was 5.
0.34. The average value of gram negative bacteria
in wastewater of food industry (Site B) was 4.66 ±
0.66 while in wastewater of food industry (Site C)
was 4.50 ± 0.50. The average value of gram
negative bacteria in wastewater of beverage
industry (Site D) was 5.0 ± 0.70, whereas in the
wastewater of beverage industry (Site E) was 3.8 ±
0.60 and in the wastewater of beverage industry
(Site F) was 4.0 ± 0.33. Student’s t-test revealed a
non significant difference (P >0.05) between gram
positive and gram negative bacteria.
Figure 1. Percentage of gram negative bacteria in all industrial wastewater samples. Food Industry A:
Rettigon road; Food Industry B: Township industrial area; Food Industry C: Township industrial estate;
Beverage industry D: Multan Road; Beverage industry E: Multan road; Beverage industry F: Wahadat road
16 Tasnim FARASAT et al.
Figure 2. Number of E.coli colonies (mean ±SE) in wastewater samples of industries. Sites A, B, C: Food
industries at Rettigon road, Township industrial area, Township industrial Estate Sites D, E, F: Beverage
industries at Multan Road and Wahadat road.
Discussion
The bacterium E. coli is one of the best and most
thoroughly studied free-living organisms. It is also
a remarkably diverse species because some E.coli
strains live as harmless commensals in animal
intestines. E. coli is a widely used indicator of fecal
contamination in water bodies. External contact and
subsequent ingestion of bacteria from fecal
contamination can cause detrimental health effects
(Money et al., 2009).
Stomach cramps, nausea and vomiting are the
symptoms caused by E. coli, however serious
complications can also occur. Water samples were
the only nonfecal samples that tested positive for E.
coli. Water has been implicated in human outbreaks
and the studies revealed that water may be an
important source of 0157:H7 on farms (Karmali,
1989).
The present research work was conducted to
isolate E. coli from food and beverage industrial
effluents. Effluents are good primary reservoir for
E. coli. Sixty different samples from food and
beverage industries were processed for the isolation
of E. coli. The food and beverage industries uses
large volume of water as it is suitable, clean, and a
quite inexpensive resource, both as a constituent of
many products, and for other production
requirements. Microbial growth in drinks due to
contaminated water supplies or sugar syrups can
cause discoloration, off flavors and shortened shelflife,
as well as increasing the risk of infection to
consumers (Noronha et al., 2002).
However, selective media are universally used
in water monitoring and were employed in the
United States Environmental Protection Agency
epidemiological investigations, suggesting that
culturable fecal indicator counts are valid predictors
of disease risk (Sinton et al., 1994). Sewage can
serve as a vehicle for entering into human and
nonhuman hosts either by direct contact or through
contamination of drinking water supplies (Boczek
et al., 2007).
The results revealed that the highest percentage
of E. coli was observed in the waste effluents of
industries (A and F). ANOVA showed non
significant (P > 0.05) variation. Student’s t-test also
revealed non significant difference between gram
positive and gram negative bacteria.
According to Boczek and colleagues (2007) the
occurrence of clonal group in wastewater
demonstrates a potential mode for the dissemination
of this clonal group in the environment, with
possible secondary transmission to human or
animal hosts. Chalmers and colleagues (2000)
demonstrated that the effluent had a significant
pollution potential, mainly due to the low pH and
high concentration of E. coli. The results also
demonstrated that the wastewater presented
significant acute toxicity, and could cause diseases
if released into the receiving body without being
adequately treated. This represents a dangerous
public health risk, which needs future evaluation
and control. Culture-independent analysis in
various environmental samples has been used to
catalog this species and also to assess the impact of
human activity and interactions with microbes on
natural microbial communities.
According to Barreto-Rodrigues and colleagues
(2008), the objective of the work was to
characterize the effluent originating from a
Brazilian TNT production industry. Analyses were
performed using physical, chemical, spectroscopic
and ecotoxicological assays, which demonstrated
that the effluent had a significant pollution
potential, mainly due to the low pH and high
concentration of TNT (156 ±
results also demonstrated that the effluent causes
significant acute toxicity, and could cause countless
damages if released into the rivers without being
properly treated. The observed pollution potential
justifies studies to evaluate treatment technologies
or recover the residue generated in the TNT
industry. From a total of 149 E. coli strains, 87 E.
coli strains were from raw wastewater and 62
strains from treated wastewater by stabilization
ponds. Within these strains two and four positive
serological reaction to E. coli 0157 were found for
raw and treated wastewater, respectively.
In the same direction, Muller and his colleagues
(2001) carried out a study on E.coli 0157:H7 strains
in water sources in South Africa and they did not
find any evidence of EHEC 0157 while virulence
factors present in the 96% of analyzed samples
(196), however 8 isolates from 8 samples
demonstrated the presence of Stx1 and Stx2.
References
Barreto-Rodrigues M, Silva FT, Paiva TCB.
Characterization of wastewater from the
Brazilian TNT industry. J Haz Mat. 164: 385-
388, 2008.
Boczek LA, Rice EW, Johnston B, Johnson JR.
Occurrence of antibiotic-resistant uropathogenic
Escherichia coli clonal group A in wastewater
effluents. Appl Environ Microbiol. 73: 4180-
4184, 2007.
Identification of E. coli from wastewater 17
Chalmers RM, Aird H, Bolton FJ. Waterborne
Escherichia coli 0157. J Appl Microbiol. 88:
124-132, 2000.
Escherich T. Die Darmbakterien des Neugeboren
und Sauglings Fortschr. Med. 3: 515-522, 1885.
Fillaudeau L, Blanpain-Avet P, Daufin G. Water,
wastewater and waste management in brewing
industries. J Cle Pro. 14: 463-471, 2005.
Hajna AA, Perry CA. Optimum Temperature for
Differentiation of Escherichia coli from Other
Coliform Bacteria. J Bacteriol. 38: 275-283,
1939.
Hopkins KL, Hilton AC. Methods available for the
sub-typing of Escherichia coli O157. World J
Microbiol Biotechnol. 16: 741-748, 2000.
Karmali MA. Infection by verocytotoxin-producing
Escherichia coli. Clin Microbiol Rev. 2: 15-38,
1989.
Koneman EW. Color Atlas and Textbook of
Diagnostic Microbiology, Lippincott, JB. (Ed),
Philadelphia. 313-317, 2005.
Law D. Virulence factors of Escherichia coli O157
and other Shiga toxin-producing E. coli. J Appl
Microbiol. 88: 729-745, 2000.
Mercer WA. Physical Characteristics of
Recirculated Water as Related to Sanitary
Conditions. Food Technol. 335: 111-115, 1964.
Money ES, Carter GP, Serre ML. Modern
space/time geo statistics using river distances:
data integration of turbidity and Escherichia
coli measurements to assess fecal contamination
along the Raritan River in New Jersey. Environ
Sci Technol. 43: 3736-3742, 2009.
Müller EE, Ehlers MM, Grabow, WOK. The
occurrence of E. coli 0157:H7 in South Africa
water sources intended for direct and indirect
human consumption. Wat Res. 35: 3085 -3088,
2001.
18 Tasnim FARASAT et al.
Noronha M, Britz T, Mavrov V, Janke HD, Chmiel
H. Treatment of spent process water from a fruit
juice company for purposes of reuse: hybrid
process concept and on-site test operation of a
pilot plant. Desalination. 143: 183-196, 2002.
Odumosu AOT. Management of liquid industrial
waste. Ind Waste Manage. 55: 6-7, 1992.
Ogedengbe K, Akinbile CO. Impact of industrial
pollutants on quality of ground and surface
waters at Oluyole Industrial Estate, Ibadan,
Nigeria. J Technol Develop. 4: 139-144, 2004.
O'Meara RAQ. A simple delicate and rapid method
of detecting the formation of acetylmethylcarbinol
by bacteria fermenting
carbohydrate. J Pathol Bacteriol. 34: 401-406,
1931.
Orskov F, Orskov I. Escherichia coli serotyping
and disease in man and animals. J Microbiol.
38: 699-704, 1992.
Reddy CA. Methods for general and molecular
microbiology (Ed). ASM Press, Washington.
447-521, 2007.
Silva RM, Toledo MR, Trabulsi LR.
Biochemical and cultural characteristics of
invasive Escherichia coli. J Clin Microbiol. 11:
441- 444, 1980.
Sinton LW, Davies-Colley RJ, Bell RG.
Inactivation of enterococci and fecal coliforms
from sewage and meatworks effluents in
seawater chambers. Appl Environ Microbiol.
60: 2040-2048, 1994.
Vaughn RH, Mitchell, NB, Levine, M. The Voges-
Proskauer and methyl red reactions in the coliaerogenes
group. J Am Water Works Assoc. 31:
993-
Werkman CH. An improved technic for the Voges-
Proskauer test. J Bacteriol. 20: 121-125, 1930.
World Health Organization- WHO. Guidelines for
Drinking Water Quality: Recommendations
(Ed). Switzerland. 1: 229-243, 2004.
Journal of Cell and Molecular Biology
Haliç University, Printed in Turkey.
http://
Investigation of the MGP promoter and exon 4 polymorphisms in
patients with ischemic stroke in the Ukrainian population
Alexander V. ATAMAN *1, Victoria Y. GARBUSOVA 2 , Yuri A. ATAMAN 3 , Olga I.
MATLAJ 4 , Olga A. OBUCHOVA 1
1 Sumy State University, Department of Physiology, Pathophysiology and Medical Biology, Sumy, Ukraine
2 Sumy State University, Scientific Laboratory of Molecular Genetic Research, Sumy, Ukraine
3 Sumy State University, Department of Internal Medicine, Sumy, Ukraine
4
Sumy Clinical Hospital No.5, Sumy, Ukraine
(*author for correspondence; ataman_av@mail.ru )
Received: 13 February 2012; Accepted: 18 May 2012
Abstract
Matrix γ-carboxyglutamic acid protein (MGP) is a vitamin K-dependent protein playing a pivotal role in
preventing arterial calcification. In the present study, we aimed to investigate the relation between three
single nucleotide polymorphisms of MGP gene and ischemic stroke (IS) in the Ukrainian population. 170 IS
patients and 124 healthy controls were recruited to the study. MGP SNPs were examined by PCR-RFLP
methodology. The distribution of homozygous carriers of the major allelic variant, and heterozygous and
homozygous minor allele variants of the T-138C MGP promoter polymorphism (rs1800802) in patients with
IS was 61.2%, 31.2% and 7.6%, respectively. The corresponding distributions of the variants in the control
group were 59.7%, 35.6%, 4.8%. With regard to the G-7A promoter polymorphism (rs1800801), the
respective distributions were 35.9%, 48.8% and 15.3%, compared to 43.5%, 50% and 6.5% in the control
group. Finally, the respective distributions according to the Thr83Ala exon 4 polymorphism (rs4236) were
39.4%, 48.8% and 11.8%, compared to 34.7%, 53.2% and 12.1% in the control group. Using logistic
regression analysis, it was estimated that A/A genotype (G-7A polymorphism) was significantly (P=0.016)
associated with IS (OR=2.943; 95% CI: 1.218–7.
female sex had a risk of IS more than 7 times higher compared with carriers of G/G genotype.
Keywords: Matrix Gla protein, single nucleotide polymorphism, ischemic stroke, arterial calcification,
Ukrainian population.
Ukrayna popülasyonunda iskemik inme hastalarında MGP promotör ve ekzon 4
polimorfizminin araştırılması
Özet
Matris γ–karboksiglutamik asit proteini (MGP) vitamin-K bağımlı protein olup arteriyal kalsitleşmeyi
önlemede önemli rol oynar. Bu çalışmada, MGP geninin üç tek nükleotit polimorfizmi (TNP) ile Ukrayna
popülasyonunda iskemik inme (İİ) arasındaki ilişkiyi araştırmayı hedefledik. Çalışmaya 170 İİ hastası ve 124
sağlıklı kontrol katıldı. MGP TNP’leri PCR-RFLP metodolojisi ile test edildi. İH hastalarında T-138C MGP
promoter polimorfizminin (rs1800802) majör alel varyantının homozigot taşıyıcılarının ve heterozigot ve
homozigot minör alel varyantlarının dağılımları sırası ile, %61.2, %31.2 ve %7.6’dır. Kontrol grubunda ilgili
varyant dağılımları %59.7, %35.6 ve %4.8’dir. G-7A promoter polimorfizminde (rs1800801) ise ilgili
dağılımlar %43.5, %50 ve %6.5 olan kontrol grubu ile karşılaştırıldığında %35.9, %48.8 ve %15.3’dir. Son
olarak, Thr83Ala ekzon 4 polimorfizmine (rs4236) göre dağılımlar %34.7, %53.2 ve %12.1 olan kontrol
grubu ile karşılaştırıldığında %39.4, %48.8 ve %11.8’dir. Lojistik regresyon analizi kullanarak, Ukrayna
popülasyonunda İİ ile A/A genotipinin (G-7A polimorfizmi) anlamlı (P=0.016) olarak ilişkili olduğu
(OR=2.943; 95% CI: 1.218–7.
Anahtar kelimeler: Matris Gla protein, tek nükleotid polimorfizmi, iskemik inme, arteriyal kalsifikasyon,
Ukrayna popülasyonu.
20 Alexander V. ATAMAN et al.
Introduction
Ischemic stroke (IS) is, in many instances, the
consequence of a thrombus forming on a ruptured
atherosclerotic plaque. Extracellular matrix
calcification is considered to be a novel marker of
atherosclerosis and related to both coronary artery
and cerebrovascular disease. It has been shown that
arterial calcification in major vessel beds is
associated with vascular brain disease (Bos et al.,
2011).
Recent studies suggest that in addition to
modifiable risk factors, such as hypertension,
hyperlipidemia, and cigarette smoking, there is a
strong genetic component to the development of
arterial calcification. For instance, the heritability
of the presence of coronary artery calcification has
been estimated to be up to 50% (Post et al., 2007).
Key genes known to be involved in the
regulation of the complex process of ectopic soft
tissue mineralization are those acting as
calcification inhibitors such as matrix γcarboxyglutamic
acid protein (MGP), osteocalcin
(BGP), osteoprotegerin (Opg), and fetuin (Abedin
et al., 2004; Doherty et al., 2004; Giachelli, 2004;
Guzman, 2007; Weissen-Plenz et al., 2008).
Among those, MGP, a vitamin K-dependent
protein, is widely accepted as playing a pivotal role
in preventing local mineralization of the vascular
wall (Luo et al., 1997; Schurgers et al., 2005;
Proudfoot and Shanahan, 2006). It has been shown
that the anticalcifying activity of MGP depends
upon the γ-carboxylation of specific glutamic acid
(Glu) residues in MGP. This vitamin K-dependent
reaction yields γ-carboxyglutamic acid (Gla)
residues, which are then able to bind calcium
(Murshed et al., 2004).
The human MGP gene is located on
chromosome 12p (Cancela et al., 1990). Among the
large number of identified MGP single nucleotide
polymorphisms (SNPs) eight are under the most
intensive investigation: two SNPs are located in
exons, and six in the upstream region of the MGP
gene. In vitro studies suggest that SNPs in MGP are
associated with altered promoter activity
(Herrmann et al., 2000; Farzaneh-Far et al., 2001;
Kobayashi et al., 2004). In addition, there is some
evidence that MGP SNPs are associated with
arterial calcification (Herrmann et al., 2000;
Brancaccio et al., 2005; Crosier et al., 2009),
although these results are not consistent (Kobayashi
et al., 2004; Taylor et al., 2005).
There are a large number of studies in which the
association of varies gene polymorphisms with IS
has been investigated (Kubo, 2008; Debette and
Seshadri, 2009; Matarin et al., 2009; Wang et al.,
2009; Low et al., 2011), but only in one of them the
MGP SNPs were a subject of interest (del Rio-
Espinola et al., 20
The purpose of the present study was to
investigate the association of three MGP SNPs (T-
138C, G-7A, Thr83Ala) with IS in the Ukrainian
population.
Materials and methods
Study groups
The study recruited 170 IS patients (57,6% men
and 42,4% women) 40 to 85 years of age (mean age
[± SE] 64,7±0,7) admitted to Sumy Clinical
Hospital No.5. A final diagnosis of IS was
established on the basis of clinical, computed
tomography and magnetic resonance imaging
examinations. Each case of IS was assessed
according to TOAST criteria (Adams et al., 1993).
The patients with IS of cardioembolic origin and
undetermined etiology were excluded from the
study group. The control group consisted of 124
clinically healthy individuals with the absence of
cardio- and cerebrovascular pathologies, as
confirmed by medical history, ECG, and
measurement of arterial pressure and biochemical
data. The study had been previously approved by
the Ethic Committee of the Medical Institute of
Sumy State University. Appropriate informed
consent was obtained from all patients and control
subjects. The participants were unrelated Ukrainian
people from the northeastern region of Ukraine.
Blood sampling for genotyping was performed
under sterile conditions into 2.7 ml tubes (S-
Monovette [Sarstedt, Germany]) containing EDTA
potassium salt as an anticoagulant, samples were
frozen and stored at -20ºC.
Genotyping of SNPs
DNA for genotyping was extracted from the venous
blood using commercially available kits (Isogene
Lab Ltd, Russia) according to the manufacturer’s
protocol. To identify MGP SNPs the polymerase
chain reaction (PCR) with subsequent restriction
fragment length polymorphism (RFLP) analysis
was performed as previously described (Garbuzova
et al., 2012). Briefly, specific regions of the MGP
gene were amplified using pairs of specific primers.
For T-138C polymorphism (rs1800802) they
were (F) 5`-
AAGCATACGАТGGCCAAAACTTCTGCA-3`
and (R) 5`-
GAACTAGCAТТGGAACTTTTCCCAACC-3`;
for G-7A polymorphism (rs1800801): (F) 5`-
CTAGTTCAGTGCCAACCCTTCCCCACC-3`
and (R) 5`-
TAGCAGCAGTAGGGAGAGAGGCTCCCA-3`;
for Thr83Ala polymorphism (rs4236): (F) 5`-
TCAATAGGGAAGCCTGTGATG-3` and (R) 5`-
AGGGGGATACAAAATCAGGTG -3`. PCR
products were digested using restriction enzymes:
BseNI (for T-138C), NcoI (for G-7A), and Eco477
(for Thr83Ala). The restriction fragments were
separated by electrophoresis and analysed on an
ethidium bromide-stained 2.5% agarose gel
visualized using ultraviolet transillumination.
Statistical analysis
Using the Pearson χ 2 test, allelic frequencies in
healthy controls and IS patients were found to be in
Hardy-Weinberg equilibrium. Statistical analysis
was performed to assess the independent main and
Genotype Control group
(n=124)
MGP polymorphisms in ischemic stroke 21
joint effects of all analyzed SNPs. To detect the
strongest main effect of three MGP SNPs the
logistic regression method was applied by using
SPSS 17.0. A comparison of variables between the
IS subgroups was performed using ANOVA.
Differences were considered statistically significant
with a P-value < 0.05.
Results
Genotypes of three studied MGP polymorphisms
are summarized in Table 1. As shown, major allele
homozygous and heterozygous, and minor allele
homozygous T-138C polymorphisms of the MGP
promoter were detected in 61.2%, 31.2% and 7.6%
of the IS group, respectively (control group: 59.7,
35.5% and 4.8%). Analysis of the G-7A promoter
polymorphism yielded respective figures of 35.9%,
48.8% and 15.3% (control group: 43.5%, 50% and
6.5%). The distribution of genotypes when
analyzing Thr83Ala polymorphism (exon 4) was
39.4%, 48.8% and 11.8% in IS group (control
group: 34.7%, 53.2% and 12.1).
Table 1. Genotypes of MGP polymorphisms in patients with ischemic stroke (IS) and control subjects. Data
presented as n (%). A – major allele; a – minor allele
Promoter T-138C Promoter G-7A Exon 4 Thr83Ala
IS group
(n=170)
Control group
(n=124)
IS group
(n=170)
Control group
(n=124)
IS group
(n=170)
AA 74 (59.7)
Aa 44 (35.5) 53 (31.2) 62 (50.0) 83 (48.8) 66 (53.2) 83 (48.8)
aa 6 (4.8) 13 (7.6) 8 (6.5) 26 (15.3) 15 (12.1) 20 (11.8)
The differences in the distribution of allelic
variants between the control and IS groups were
close to the level of statistical significance only for
the G-7A promoter polymorphism (P=0,051). In
women, but not in men, the differences between G-
7A genotypes frequency in IS and controls were
significant as shown in Table 2.
Using logistic regression analysis (Table 3), it
was estimated that A/A genotype (G-7A
polymorphism) was significantly (P=0.016)
associated with IS (OR=2.943; 95% CI, 1.218 –
7.
subjects is presented in Table 4. Women who were
minor A-allele homozygotes had a risk of IS more
then 7 times higher compared with female carriers
of G/G genotype.
Some clinical characteristics of IS patients with
various MGP genotypes are presented in Table 5.
There were no differences in the studied parameters
between major allele homozygotes, heterozygotes,
and minor allele homozygotes for all three
polymorphisms (with the exception of sex
distribution for G-7A polymorphism).
22 Alexander V. ATAMAN et al.
Table 2. Genotypes of G-7A MGP promoter polymorphism in female and male patients with ischemic
stroke (IS) and control subjects. Data presented as n (%).
Table 3. Results of logistic regression analysis of association between MGP polymorphisms and ischemic
stroke.Homozygotes by major allele were considered as a reference group. SE – standard error, OR – odds
ratio, CI – confidential interval
SNP Genotype
Women Men
Genotype Control IS Control IS
Coefficient of
regression
SE
Wald
statistic
Pvalue
OR
%95 CI
Lower
%95 CI
Upper
Promoter T/C -0.186 0.258 0.521 0.470 0.830 0.500 1.377
T-138C C/C 0.382 0.526 0.527 0.468 1.465 0.522 4.
Promoter G/A 0.193 0.253 0.584 0.445 1.213 0.739 1.991
G-7A A/A 1.079 0.450 5.752 0.016 2.943 1.218 7.
Exon 4 Thr/Ala -0.235 0.259 0.824 0.364 0.790 0.476 1.313
Thr83Ala Ala/Ala -0.265 0.402 0.435 0.5
Discussion
Arterial calcification is an abnormal process that
can greatly increase morbidity and mortality (Lehto
et al., 1996). MGP is considered one of the most
relevant physiological inhibitors of soft tissue
mineralization known today. In mice, targeted
deletion of the MGP gene causes extensive
calcification of the elastic lamellae of the
abdominal aorta (Luo et al., 1997). Extensive
vascular calcification is also induced when γcarboxylation
of MGP is inhibited using the
vitamin K-antagonist, warfarin (Price et al., 1998).
In the present study, we explored association
between genetic variation in the MGP gene and the
risk of IS development. Analysing MGP SNPs, we
found the G-7A promoter polymorphism to be
associated with IS in Ukrainian population. We did
not revealed statistically significant relation
between the other two studied polymorphisms (T-
138C, Thr83Ala) and IS.
Published data on the MGP SNPs association
with MGP serum concentration and artery
calcification, and the consequences of
G/G 18 (40.0) 21 (29.2) 36 (45.6) 40 (40.8)
G/A 25 (55.6) 34 (47.2) 37 (46.8) 49 (50.0)
A/A 2 (4.4) 17 (23.6) 6 (7.6) 9 (9.2)
Total 45 72 79 98
P-value 0.022 0.798
atherosclerosis (myocardial infarction in
particularly) are contradictory.
Farzaneh et al. (2001) did not find any
relationship between the G-7A polymorphism and
serum MGP level in healthy persons (Netherlands),
but did detect the significant association of T-138C
polymorphism with above-mentioned parameter.
The highest level of serum MGP was revealed in
the C/C homozygotes and the lowest one – in T/T
homozygotes.
In contrast to the above study, Crosier et al.
(2009) found no association of the T-138C
polymorphism with serum MGP concentration, but
they showed a significant relationship between the
other two polymorphisms (G-7A, Tht83Ala) and
serum MGP levels in the healthy men and women
(USA). In minor allele homozygotes, the serum
MGP concentration was the lowest, in major allele
homozygotes the highest, in heterozygotes the
intermediate values were registered.
In the same study, it was shown that all three
MGP SNPs (T-138C, G-7A, Thr83Ala) are related
to the coronary artery calcification (CAC) in men,
but not in women (Crosier et al., 2009).
MGP polymorphisms in ischemic stroke 23
Table 4. Logistic regression analysis of association between G-7A MGP promoter polymorphism and
ischemic stroke in male and female subjects. OR – odds ratio, CI – confidential interval
Sex Allele OR (CI) P-value
Women A/A vs. G/G 7.286 (1.479-35.895) 0.015
G/A vs. G/G 1.166 (0.516-2.632) 0.712
Men A/A vs. G/G 1.350 (0.437-4.166) 0.602
G/A vs. G/G 1.192 (0.641-2.217) 0.579
Table 5. Clinical characteristics of ischemic stroke patients with respect to genotypes. Data are mean ± SE.
A/A A/a a/a P
T-138C polymorphism
n
Age, years 65.4±0.92 63.0±1.39 64.7±2.13 0.288
Gender, M/F 58/46 35/18 5/8 0.162*
BMI (M), kg/m 2 27.8±0.56 27.4±0.64 28.1±1.22 0.862
BMI (F), kg/m 2 29.1±0.74 29.4±0.93 29.0±1.17 0.789
Systolic BP, mmHg 168±2.9 165±3.6 168±9.8 0.780
Diastolic BP, mmHg 96±1.7 94±1.8 93±3.8 0.628
Fasting glucose, mmol/L 5.9±0.15 5.9±0.2 6.1±0.53 0.916
G-7A polymorphism
n 61 83 26
Age, years 63.0±1.15 65.3±1.04 66.8±2.09 0.164
Gender, M/F 40/21 49/34 9/17 0.026*
BMI (M), kg/m 2 27.2±0.45 27.9±0.68 28.6±1.53 0.536
BMI (F), kg/m 2 28.3±0.8 29.9±0.86 28.2±1.13 0.315
Systolic BP, mmHg 167±3.7 167±3.3 167±5.2 0.996
Diastolic BP, mmHg 97±2.0 94±1.8 97±2.4 0.593
Fasting glucose, mmol/L 5.8±0.18 6.0±0.17 6.2±0.35 0.481
Thr83Ala polymorphism
n 67 83 20
Age, years 65.1±1.2 64.4±1.0 64.7±2.1 0.912
Gender, M/F 44/23 45/38 9/11 0.176*
BMI (M), kg/m 2 27.6±0.47 27.6±0.67 28.3±1.9 0.891
BMI (F), kg/m 2 29.4±0.84 28.6±0.78 29.9±1.53 0.668
Systolic BP, mmHg 163±3.7 171±3.0 163±6.6 0.252
Diastolic BP, mmHg 95±1.8 96±1.7 95±4.4 0.812
Fasting glucose, mmol/L 5.9±0.2 6.0±0.17 5.9±0.3 0.859
24 Alexander V. ATAMAN et al.
In some studies, MGP polymorphisms were
also shown to be associated with arterial
calcification and myocardial infarction (MI)
(Herrmann et al., 2000; Brancaccio et al., 2005),
while in others (Kobayashi et al., 2004; Taylor et
al., 2005) no association between MGP SNPs and
cardiovascular events was found. Moreover, in the
studies in which such associations were reported,
the relationship between the type of MGP
polymorphism and arterial calcification was
different. For example, in the AXA study, the
minor alleles -7A and 83Ala were associated with
increased femoral artery calcification (Herrmann et
al., 2000), while in the above-mentioned study by
Crosier et al. (2009), the same alleles were linked
to a decreased level of CAC.
It should be noted that the majority of studies
cited here was devoted to the relation of MGP to
CAC and MI. As to cerebral artery atherosclerosis
and its severe events such as IS, the role of arterial
calcification in this disease and the association of
MGP with cerebrovascular pathology were the
subject of investigation and discussion only in a
few publications. In particular, Bos et al. (2011)
established a close relationship between
calcification in the various vessel beds outside the
brain and imaging markers of vascular brain
disease. Calcification in each vessel bed was
shown to be associated with the presence of
cerebral infarcts and with larger volume of white
matter lesions (WMLs). The most prominent
associations were found between the intracranial
carotid calcification and WML volume and
between the extracranial carotid calcification and
infarcts.
Acar et al. (2012) studied a relationship of
serum MGP levels to the development of
intracerebral hemorrhages (ICH) and found that in
patients with ICH, serum MGP concentration was
much lower than in control group. Moreover, in the
non-survivors, the serum MGP levels were
statistically significantly lower in comparison to the
survivors. According to the authors, measurement
of this parameter may be of value to estimate
mortality.
At present, there are only a few publications
concerning relation of the MGP SNPs to
cerebrovascular disease. Analysing 236
polymorphisms, del Rio-Espinola et al. (20
showed that only two of them (G-7A of MGP and
T-1C of CD40) were related to the brain vessel
reocclusion after fibrinolysis in IS patients. In our
study, it was shown that the G-7A polymorphism of
MGP was associated with IS. In our previous
investigation (Harbusova et al., 2011), this variant
of the MGP promoter polymorphism was found to
be in association with the acute coronary syndrome
(ACS). Minor allele homozygotes (A/A) had
significantly higher risk of ACS as well as IS. This
could means that there are some common
mechanisms of pathogenesis in both ACS and IS
concerning to MGP. Those may be atherosclerosis,
arterial calcification, and thrombosis.
The relation of MGP to blood vessels
calcification is well known (see above). With
respect to coagulation and thrombi formation, it can
be suggested that MGP is somehow connected with
these processes (Krueger et al., 2009). Such an
assumption is based on the fact that MGP belongs
to vitamin K-dependent proteins, a large number of
which are procoagulants (prothrombin, factor V,
etc) and can influence blood clotting and thrombi
formation in the coronary and cerebral arteries. In
some papers (Wallin et al., 2008), an antagonistic
relationship between calcification and coagulation
is discussed. Therefore, MGP can be considered as
a connecting link between these two processes.
Certainly, this assumption requires experimental as
well as clinical proofs, and research in this
direction should be continued.
References
Abedin M, Tintut Y, Demer LL. Vascular
calcification. Mechanisms and clinical
ramifications. Arterioscler Thromb Vasc Biol.
24: 1161-1170, 2004.
Acar A, Cevik MU, Arıkanoglu A, Evliyaoglu
O, Basarılı MK, Uzar E, Ekici F, Yucel
Y, Tasdemir N. Serum levels of calcification
inhibitors in patients with intracerebral
hemorrhage.
232, 2012.
Int J Neurosci. 122: 227-
Adams HP, Bendixen BH, Kappelle LJ, Biller
J, Love BB, Gordon DL, Marsh EE.
Classification of subtype of acute ischemic
stroke. Definitions for use in a multicenter
clinical trial. TOAST. Trial of Org
Acute Stroke Treatment. Stroke. 24: 35-41,
1993.
Bos D, Ikram MA, Elias-Smale SE, Krestin
GP, Hofman A, Witteman JC, van der Lugt
A, Vernooij MW. Calcification in major vessel
beds relates to vascular brain disease.
Arterioscler Thromb Vasc Biol. 31: 2331-2337,
2011.
Brancaccio D, Biondi ML, Gallieni M, Turri O,
Galassi A, Cecchini F, Russo D, Andreucci V,
Cozzolino M. Matrix Gla protein gene
polymorphisms: clinical correlates and
cardiovascular mortality in chronic kidney
disease patients. Am J Nephrol. 25: 548-552,
2005.
Cancela L, Hsiehg CL, Francket U, Price PA.
Molecular structure, chromosome assignment,
and promoter organization of the human matrix
Gla protein gene. J Biol Chem. 265: 15040-
15048, 1990.
Crosier MD, Booth SL, Peter I, Dawson-Hughes B,
Price PA, O'Donnell CJ, Hoffmann U,
Wiilliamson MK, Ordovas JM. Matrix Gla
protein polymorphisms are associated with
coronary artery calcification. J Nutr Sci
Vitaminol. 55: 59-65, 2009.
Debette S, Sechardi S. Genetics of
atherothrombotic and lacunare stroke. Circ
Cardiovasc Gen. 2: 191-198, 2009.
del Río-Espínola A, Fernández-Cadenas I, Rubiera
M, Quintana M, Domingues-Montanari S,
Mendióroz M, Fernández-Morales J, Giralt D,
Molina CA, Alvarez-Sabín J, Montaner J.
CD40-1C>T polymorphism (rs1883832) is
associated with brain vessel reocclusion after
fibrinolysis in ischemic stroke.
Pharmacogenomics. 11: 763-772, 20
Doherty TM, Fitzpatrick LA, Inoue D, Qiao JH,
Fishbein MC, Detrano RC, Shah PK,
Rajavashisth TB. Molecular, endocrine, and
genetic mechanisms of arterial calcification.
Endocrine Rev. 25: 629-672, 2004.
Farzaneh-Far A, Davies JD, Braam LA, Spronk
HM, Proudfoot D, Chan SW, O'Shaughnessy
KM, Weissberg PL, Vermeer C, Shanaham CM.
A polymorphism of the human matrix γcarboxyglutamic
acid protein promoter alters
binding of an activating protein-1 complex and
is associated with altered transcription and
serum levels. J Biol Chem. 276: 32466-32473,
2001.
Garbuzova VYu, Gurianova VL, Story DA,
Dosenko VE, Parkhomenko AN, Ataman AV
Association of matrix Gla protein gene allelic
polymorphisms (G -7 →A, T -138 →C and
Thr83→Ala) with acute coronary syndrome in
the Ukrainian population. Exp Clin Cardiol. 17:
30-33, 2012.
MGP polymorphisms in ischemic stroke 25
Giachelli CM. Vascular calcification mechanisms.
J Am Soc Nephrol. 15: 2959-2964, 2004.
Guzman RJ. Clinical, cellular, and molecular
aspects of arterial calcification. J Vasc Surg. 45
(Suppl A): A57-A63, 2007.
Harbusova VYu, Hurianova VL, Parkhomenko
OM, Dosenko VE, Ataman OV. The frequency
of allelic polymorphism of matrix Gla-protein
gene in acute coronary syndrome patients.
Fiziol Zh. 57: 16-24, 2011.
Herrmann SM, Whatling C, Brand E, Nikaud V,
Gariepy J, Simon A, Evans A, Ruidavets LB,
Arveiler D, Luc G, Tiret L, Henney A, Cambien
F. Polymorphisms of the human matrix Gla
protein (MGP) gene, vascular calcification, and
myocardial infarction. Arterioscler Thromb
Vasc Biol. 20: 2386-2393, 2000.
Kobayashi N, Kitazawa R, Maeda S, Schurgers LJ,
Kitazawa S. T-138C polymorphism of matrix
Gla protein promoter alters its expression but is
not directly associated with atherosclerotic
vascular calcification. Kobe J Med Sci. 50: 69-
81, 2004.
Krueger T, Westenfeld R, Schurgers LJ,
Brandenburg VM. Coagulation meets
calcification: The vitamin K system. Int J Artif
Organs. 32: 67-74, 2009.
Kubo M. Genetic risk factors
of ischemic stroke identified by a genome-wide
association study. Brain Nerve. 60: 1339-1346,
2008.
Lehto S, Niskanen L, Suhonen M, Rönnemaa T,
Laasko M. Medial artery calcification. A
neglected harbinger of cardiovascular
complications in non-insulin-dependent diabetes
mellitus. Arterioscler Thromb Vasc Biol. 16:
978-988, 1996.
Low HQ, Chen CP, Kasiman K, Thalamuthu A, Ng
SS, Foo JN, Chang HM, Wong MC, Tai ES, Liu
J. A comprehensive association analysis of
homocysteine metabolic pathway genes in
Singaporean Chinese with ischemic stroke.
PLoS One. 6: e24757, 2011.
Luo G, Ducy P, McKee MD, Pinero GJ, Loyer E,
Behringer RR, Karsenty G. Spontaneous
calcification of arteries and cartilage in mice
lacking matrix Gla protein. Nature. 386: 78-81,
1997.
26 Alexander V. ATAMAN et al.
Matarin M, Brown WM, Dena H, Britton A, De
Vrieze FW, Brott TG, Brown RD, Worrall BB,
Case LD, Chanock SJ, Metter EJ, Ferruci L,
Gamble D, Hardy JA, Rich SS, Singleton A,
Meschia JF. Candidate gene polymorphisms for
ischemic stroke. Stroke. 40: 3436-3442, 2009.
Murshed M, Schinke T, McKee MD, Karsenty G.
Extra cellular matrix mineralization is regulated
locally: different roles of two Gla-containing
proteins. J Cell Biol. 165: 625-630, 2004.
Post W, Bielak LF, Ryan KA, Cheng YC, Shen H,
Rumberger JA, Sheedy PF, Shuldiner AR,
Peyser PA, Mitchell BD. Determinants of
coronary artery and aortic calcification in the
Old Order Amish. Circulation. 115: 717-724,
2007.
Price PA, Faus SA, Williamson MK. Warfarin
causes rapid calcification of the elastic lamellae
in rat arteries and heart valves. Arterioscler
Thromb Vasc Biol. 18: 1400-1407, 1998.
Proudfoot D, Shanahan CM. Molecular
mechanisms mediating vascular calcification:
role of matrix Gla protein. Nephrology
(Carlton). 11: 455-461, 2006.
Schurgers LJ, Teunissen KJF, Knapen MHJ,
Kwaijtaal M, van Diest R, Appels A,
Reutelingsperger CP, Cleutjens JPM, Vermeer
C. Novel conformation-specific antibodies
against matrix gamma-carboxyglutamic acid
(Gla) protein. Arterioscler Thromb Vasc Biol.
25: 1629-1633, 2005.
Taylor BC, Schreiner PJ, Doherty TM, Fornage M,
Carr JJ, Sidney S. Matrix Gla protein and
osteopontin genetic associations with coronary
artery calcification and bone density: the
CARDIA study. Hum Genet. 116: 525-528,
2005.
Wallin R, Schurgers L, Wajih N. Effects of the
blood coagulation vitamin K as an inhibitor of
arterial calcification. Thromb Res. 122: 411-
417, 2008.
Wang X, Cheng S, Brophy VH, Erlich HA,
Mannhalter C, Berger K, Lalouschek W,
Browner WS, Shi Y, Ringelstein EB, Kessler C,
Luedemann J, Lindpaintner K, Liu L, Ridker
PM, Zee RY, Cook NR. A meta-analysis of
candidate gene polymorphisms and ischemic
stroke in 6 study populations: association of
lymphotoxin-alpha in nonhypertensive patients.
Stroke. 40: 683-695, 2009.
Weissen-Plenz G, Nitschke Y, Rutsch F.
Mechanisms of arterial calcification: spotlight
on the inhibitors. Adv Clin Chem. 46: 263-293,
2008.
Journal of Cell and Molecular Biology
Haliç University, Printed in Turkey.
http://
Survivin geni -625G/C polimorfizminin Küçük Hücreli Dışı Akciğer
Kanseri ile ilişkisinin araştırılması
Engin AYNACI 1 , Ender COŞKUNPINAR 2 , Ayşe EREN 2 , Onur KUM 1 , Yasemin
MÜŞTERİ OLTULU 2 , Nergiz AKKAYA 2 , Akif TURNA 3 , İlhan YAYLIM 2 , Pınar
YILDIZ *1 .
1 Yedikule Chest Diseases and Thoracic Surgery Training Hospital, Istanbul, Turkey
2 Department of Molecular Medicine, Institute of Experimental Medicine, Istanbul University, Istanbul,
Turkey
3 Cerrahpaşa Medicine Faculty, Department of Thoracic Surgery, Istanbul University, Istanbul, Turkey
(*author for correspondence; pinary70@yahoo.com)
Received: 14 February 2012; Accepted: 21 May 2012
Özet
Akciğer kanseri tüm kanser türleri arasında görülme sıklığı olarak ikinci sırada, kanser sebepli ölümler
arasında ise ilk sırada gelmektedir. Survivin geni 17q25 kromozomal bölgesinde lokalizedir ve 142 amino
asitten oluşan bir protein kodlar. Survivin (BIRC5) apoptozu düzenleyen önemli bir protein ailesi olan
apoptoz proteinlerinin inhibitörü (IAPs) olarak ilk bulunan inhibitörlerden biridir ve özellikle kanser
hücrelerinde ifadesi gerçekleşir. Survivin genindeki polimorfizm survivin üretimi ve aktivitesine etki
edebilir, bu nedenle akciğer kanserine hassasiyet sağlar. Survivin genindeki aşırı ifadenin çok çeşitli
maligniteleri içeren kanser türlerinde hastalık gelişimi, nüksü ve prognozu ile ilişkili olduğu bilinmektedir.
Bu çalışmada bir Türk popülasyonunda survivin geni promotör bölgesi üzerinde bulunan -625G/C gen
polimorfizmi ile küçük hücreli dışı akciğer kanseri arasında, hastalığın gelişimi ile ilgili olası ilişkilerin
araştırılması amaçlandı. Çalışmaya 146 hasta, 98 kontrol olgu dahil edildi. Yöntem olarak PCR-RFLP tekniği
kullanıldı. Sonuç olarak survivin -625G/C genotip dağılımları incelendiğinde hasta ve kontrol grupları
arasında istatistiksel olarak anlamlı fark olmadığı tespit edilmiştir.
Anahtar kelimeler: Küçük hücreli dışı akciğer kanseri, survivin, gen polimorfizmi, PCR-RFLP, biyobelirteç.
Investigation of the association of survivin gene -625G/C polymorphism in non-small cell
lung cancer
Abstract
Lung cancer is the second most common cancer type diagnosed and first in cancer related deaths among all
cancers worldwide. The survivin gene is located on human chromosome 17q25, encoding a protein consisting
of 142 amino acids. Survivin is one of the first reported inhibitors of apoptosis proteins, which is an
important family of proteins that regulate apoptosis. Survivin gene polymorphism may affect the survivin
production and activity, thus providing sensitivity for the development of lung cancer. The overexpression of
survivin gene was found to be associated with disease development, recurrence and prognosis in various
malignancies, including cancers. In this study the demonstration of the prognosis related associations
between the -625G/C gene polymorphism located on the survivin promoter region and non small cell lung
cancer in a Turkish population was aimed. 146 patients and 98 control subjects included to the study. PCR-
RFLP technique was used as the method. According to survivin -625G/C genotype distribution analysis, no
statistically significant difference between patients and controls were found.
Keywords: Non small cell lung cancer, survivin, gene polymorphism, PCR-RFLP, biomarker.
28 Engin AYNACI et al.
Giriş
Akciğer kanseri tüm dünyada kansere bağlı
ölümlerin önde gelen sebebi olarak bilinmektedir.
Bununla birlikte özellikle Amerika’da kansere bağlı
ölüm oranları arasında akciğer kanseri sıklığı
gitgide azalmakta, fakat Çin gibi sigara tüketiminin
özellikle son 20 yılda arttığı bazı ülkelerde akciğer
kanseri sebepli ölüm oranının arttığı
gözlenmektedir. Amerika’da 2008 yılında 215.020
yeni vaka belirlenirken, 161.840 kişinin bu hastalık
sebebiyle öldüğü, kayıtlarda yer almaktadır.
Akciğer kanserinin küçük hücreli (KHAK) ve
küçük hücreli dışı (KHDAK) olmak üzere iki tipi
vardır. Son 60 yıldır akciğer kanserinde hastalık
gelişiminin kalıtsal bir temele oturduğu
belirtilmektedir. (Julian et al., 2008).
Programlanmış hücre ölümü olarak bilinen apoptoz,
önemli bir hücre büyüme kontrol mekanizmasıdır
(Yuan-Hung et al., 2009; Thompson, 1995).
Survivin (BIRC5 olarak da bilinir) apoptozu
düzenleyen önemli bir protein ailesi olan apoptoz
proteinlerinin inhibitörü (IAP) olarak ilk bulunan
inhibitörlerden biridir ve özellikle kanser
hücrelerinde ifadesi gerçekleşir (Reed,1997).
Survivin terminal tetikleyici kaspaz-3 ve kaspaz-9
aktivitesini inhibe ederek her iki apoptoz yolunun
baskılanmasını bloke eder (Nicholson and
Thornberry, 1997). Ayrıca survivin apoptotik
uyarıcıyla indüklenen interlökin (IL-3), Fas
(CD95), Bax, tümör nekroz faktörü α, kaspazlar ve
antikanser ilaçlarınının etkisini yok eder (Chan et
al., 2009; Yun-Hong et al., 2004). Mitozda
düzenleyici rol oynadığı da çeşitli yayınlarda (Chan
et al., 2009) bildirilmiş olan survivin geni 17q25
kromozomal bölgesinde lokalizedir ve 142 amino
asitten oluşan bir protein kodlar (Chiou et al., 2003;
Deveraux et al., 1997; Uren et al., 1998).
Survivin ayrıca mikrotübül dinamiklerinin
düzenlenmesinde de önemli rol oynar (Li et al.,
1998; Li and Altieri, 1999; Altieri, 2006; Giodini et
al., 2002). Survivin geni promotör bölgesindeki
polimorfizmler genin transkripsiyonuna etki ettiği
için gen aktivitesini ve ekspresyonunu değiştirerek
akciğer kanserine yatkınlık sağlayabilir (Jin Sung et
al., 2008).
Survivin hücre döngüsünde G2/M fazında bol
miktarda eksprese olur ve G1 fazında hızlı
regülasyon sergiler (Li et al., 1998). Bu durum
transkripsiyonel basamakta kontrol edilir ve hücre
döngüsüne bağlı elementler (CDE) ve hücre
döngüsü homoloji bölgeleri (CHR) survivin
promotörünün proksimal bölgesinde lokalize olur
(Masayuki et al., 2000; Li and Altieri, 1999).
Survivin geni ekspresyon düzeylerindeki artışın
bazı hastalıklar için prognostik belirteç olabileceği
düşünülmektedir (Chun-Hua et al., 20
genellikle embriyonik dokularda ifade olur ve
görülen homozigot mutasyonların erken
embriyonik dönemde ölümle sonuçlanması bu gen
ailesinin hücre gelişimi, farklılaşması ve homeostaz
sürecinde çok önemli rol oynadığını göstermektedir
(Chan et al., 2009).
Çeşitli tek-nükleotit polimorfizmleri survivin
gen bölgesi promotöründe tespit edilmiştir.
Bunlardan en çok bilineni ve literatürde en fazla
çalışması yapılmış olan CDE/CHR reseptör
bağlayıcı bölgede lokalize olan -31G/C gen
polimorfizmidir. Survivin geninin promotör
bölgesindeki bu mutasyon sonucu hücre
döngüsünden bağımsız olarak genin
transkripsiyonu ve bunun sonucunda da aşırı ifadesi
görülür (Xu et al., 2004).
Bu çalışmada KHDAK hastalarında PCR-RFLP
tekniği kullanılarak survivin geni promotör
bölgesindekiki -625G/C (rs8073069)
polimorfizminin bir Türk popülasyonunda KHDAK
hastalığına yatkınlığı araştırılmıştır.
Akciğer kanseri ile ilgili olarak eldeki verilerin
doğru olarak kullanılması ve buna ek olarak
hastalık oluşumu ya da gelişiminin anlaşılmasına
yönelik belirteçlerin ve genetik mekanizmaların
anlaşılması özellikle hastalığın erken tanısı ve
tedavi sürecinde bu hastalar için anlamlı olacaktır.
Materyal ve metod
Örneklerin tanımı
Çalışma ile ilgili olarak öncelikle İstanbul
Üniversitesi İstanbul Tıp Fakültesi Etik
Değerlendirme Komisyonu’ndan 09.06.20
ve 20
alındı. Çalışmaya Yedikule Göğüs Hastalıkları ve
Göğüs Cerrahisi Eğitim ve Araştırma Hastanesi 3.
Klinikte ve İstanbul Üniversitesi Cerrahpaşa Tıp
Fakültesi Göğüs Cerrahisi Kliniğinde tanı konulan
toplam 146 KHDAK olgusu ile yine aynı
kliniklerde tetkik edilen ve kronik hastalık veya
malignite bulgusu saptanmayan 98 sağlıklı kontrol
olgusu alındı. Çalışmaya girmeyi kabul edenlere
gönüllü olur imzaladıktan sonra 1 adet EDTA’lı
tüpe
laboratuvara ulaştırıldı.
DNA izolasyonu
Gönüllülerden alınan kanlardan High Pure PCR
Template Preparation Kit (Roche, Manheim)
protokolüne uygun olarak genomik DNA
izolasyonu yapıldı ve daha sonra Nano Drop
Spektrofotometre kullanılarak, elde edilen
DNA’ların konsantrasyonları ölçüldü. DNA’lar
konsantrasyonları
seyreltildi.
PCR
Survivin geni promotör bölgesindeki -625G/C
polimorfizmine özgü primerler (Tablo 1) dizayn
edildi. PCR, total hacim 25 µl ve
(MBI Fermentas), 1mM MgCl2, 0.2 mM dNTP,
KHDAK’de survivin polimorfizmi 29
0.375 mM her bir primer,
1 U Taq DNA polimeraz (MBI Fermentas) olacak
şekilde dizayn edildi. Amplifikasyon şartları,
95°C’de
95°C’de 45 saniye, 72°C’de 60 saniye 5 döngü,
takiben 94°C’de 45 saniye, 60°C’de 45 saniye ve
72°C’de 60 saniye 30 döngü, uzama aşamasında da
Optimum amplifikasyon şartları sağlanarak PCR
ürünleri %2 lik agaroz jel elektroforezinde
yürütüldü.
Tablo 1. Survivin geni promotör -625 G/C bölgesi primerleri (FP: İleri Primer, RP: Geri Primer)
Polimorfizm Primer Dizileri PCR Ürün boyu
-625C/G
(rs8073069)
Restriksiyon analizi
FP: 5’-TGTTCATTTGTCCTTCATGCGC-3’
RP: 5’-CCAGCCTAGGCAACAAGAGCAA-3’
Amplifiye olan PCR ürünleri BstUI restriksiyon
enzimi ile uygun tamponu içeren karışım
hazırlandıktan sonra 37°C de 4 saat inkübe edildi.
Kesim ürünleri % 3’lük agaroz jelde
elektrik altında, 20 dakika yürütüldükten sonra UV
altında incelenerek genotipler tespit edildi.
İstatistiksel analiz
AJJC tarafından yayınlanmış olan evrelendirme
sistemine göre tümör evrelendirmesi yapılan hasta
olguları ve kontrollere ait veriler SPSS 15.0
programına yüklendi ve kategorik verilerin
karşılaştırılmasında ki-kare testi ve parametrik ttesti
kullanıldı.
Şekil 1. Survivin geni -625 G/C bölgesi PCR
görüntüsü
Sonuçlar
125 bç
BstUI kesimi sonrası
ürün boyları
CC: 125
CG: 125/
GG:
Çalışmaya 146 KHDAK hastası ve 98 kontrol olgu
dahil edildi. Hastaları yaş ortalaması 60,41 yaş
(±9,71), kontrol olgularının yaş ortalaması 55,23
yaş (±8,8.) di. Çalışmaya dahil edilen hastalardan
132’si erkek (%90,4), 14’ü kadın (%9,6), kontrol
grubu olgularının ise 56’sı erkek (%57,1), 42’si
kadındı (%42,9). Hasta ve kontrol grubuna ait
genotip ve alel dağılımları Tablo 2’de verilmiştir.
PCR sonucu elde edilen bant boyu 125 baz çifti
büyüklüğünde (Şekil 1); BstUI restriksiyon enzimi
kesimi sonucu elde edilen bant büyüklükleri ise
125,
2).
Şekil 2. BstUI kesimi %3’lük
jel elektroforezi görüntüsü. M: 50 bp DNA markörü
30 Engin AYNACI et al.
Tablo 2. Hasta ve kontrol grubuna ait genotip ve alel dağılımları
Genotipler ve Alel
dağılımları
Kontrol
Grubu
N=98
Hasta
Grubu
N=146
-625G/C N % N %
GG 56 57.1 72 49.3
GC 32 32.7 57 39.1
CC
Aleller
P değeri χ2
0.484 1.45
tamamlamış
yapmış
yapmış
G
C
144
52
56.06
43.94
201
91
58.59
41.41
0.27 1.21
Tartışma
düzeyindeki artışın -31G/C polimorfizmi ile ilişkili
olduğunu ve bu artışın hem mRNA düzeyinde hem
de protein düzeyinde meydana geldiğini
Kanser oluşumunda apoptoz mekanizmasındaki
bozukluklar önemli rol oynamaktadır. Apoptoz,
farklı inhibe ve aktive edici ajanlar tarafından
kontrol altında tutulan önemli bir olaydır. Kanserde
apoptozun çeşitli anti-apoptotik proteinler
tarafından inhibisyonu söz konusudur.
Survivin, hücre döngüsünün düzenlenmesinde
temel rol oynayan başlıca anti-apoptotik faktördür.
Ayrıca survivinin Bcl-2 ve diğer IAPlerin aksine
farklılaşmasını normal dokularda
anlatımı olmayan ancak çeşitli kanser tiplerinde
ifade edilen bir protein olduğu bilinmektedir. Bu
durum survivin genindeki anormal ifadenin
transkripsiyonel regülasyon bozukluğuna sebep
olduğunun açık bir göstergesidir. Apoptozu inhibe
eden diğer proteinlerde de bulunan BIR
(“Baculovirus IAP Repeat”) bölgesi ile kaspazlara
bağlanarak etkisini göstermektedir. Dai ve ark.
20
promotor bölgesindeki polimorfizmlerin
KHDAK’de gen modifikasyonuna neden
olabileceğini ileri sürmüşlerdir.
Jang ve ark. tarafından yapılan çalışmada -31 G
alelinin -31 C aleline göre önemli derecede düşük
transkripsiyonel aktiveye sahip olduğu ve bu
durumun -31G/C polimorfizminden etkilenerek
ortaya çıktığı ve buna bağlı olarak -31G/C
polimorfizminin akciğer kanserine yatkınlıkta
önemli bir rolü olduğu belirtilmektedir. (Jang et al.,
2008). Xu ve ark. kanser hücre hatları ile
oldukları bir çalışmada survivin gen ifadesi
.
bildirmişlerdir.
Klinik perspektiften bakıldığında kişisel
paternlerle klinik özelliklerin öngörülmesinde
hastaların genetik parmak izinde survivin geni
ifadesi düzeylerinde ve genetik varyantlarda oluşan
değişikliklerin olası tedaviye yanıtta erken bir
belirteç olabileceğini söylemek mümkündür.
Örneğin plevral efüzyondaki yüksek survivin
düzeylerinin kötü prognoz göstergesi olduğu Lan
ve ark. 20
Yang ve ark 2009 yılında özefagus kanserli
hastalarda yaptıkları bir çalışmada C alleline sahip
olmanın hastalık riskini 1.4 kat arttırdığını
söylemektedirler. Özefagus kanseri hastalarında
survivin -625G/C promotor polimorfizminin p53
düzeyine bağlı olan survivin yüksek ifadesi
olasılığını artırdığı düşünülmektedir.
Sonuç olarak bir Türk popülasyonu üzerinde
olduğumuz bu çalışmada survivin geni -625
G/C bölgesi (rs8073069) polimorfizminin küçük
hücreli dışı akciğer kanseri hastalığına yatkınlık
sağladığına dair herhangi bir bulgu elde edilemedi.
Ancak olgu sayısının artırılması ve polimorfik
bölgenin özellikle transkripsiyonun aktivitesine etki
eden promotör bölgesinde olmasından dolayı
yapılabilecek ekspresyon çalışmaları ile özellikle
tanı öncesi ve sonrası gen anlatım ifadesine bağlı
değişikliklerin öngörülmesine yardımcı olabilecek
daha anlamlı sonuçlara ulaşılabileceği
kanaatindeyiz.
Kaynaklar
Altieri DC. Survivin apoptosis: an interloper
between cell death and proliferation in cancer.
Lab Invest. 79: 1327-1333, 1999.
Altieri DC. The case for survivin as a regulator of
microtubule dynamics and cell-death decisions.
Curr Opin Cell Biol. 18: 609-615, 2006.
Chan H. Han, Qingyi Wei, Karen K. Lu,
Zhensheng Liu, Gordon B. Mills, Li-E Wang.
Polymorphisms in the survivin promoter are
associated with age of onset of ovarian cancer.
Int J Clin Exp Med. 2: 289-299, 2009.
Chiou SK, Jones MK, Tarnawski AS. Survivin an
anti-apoptosis protein: its biological roles and
implications for cancer and beyond. Med Sci
Monit. 9:I25-I29, 2003.
Chun-Hua Dai, Jian Li, Shun- Bing Shi, Li- Chao
Yu, Li-Ping Ge, Ping Chen, Survivin and Smac
Gene Expressions but not Livin Are Predictors
of Prognosis in Non-small Cell Lung Cancer
Patients Treated with Adjuvant Chemotherapy
Following Surgery. Jpn J Clin Oncol. 2-9,
20
Dai J, Jin G, Dong J, Chen Y, Xu L, Hu Z, Shen H.
Prognostic significance of survivin
polymorphisms on non-small cell lung cancer
survival. J Thorac Oncol. 20
Nov;5(11):1748-54. PubMed PMID: 20881643.
Deveraux QL, Takahashi R, Salvesen GS and Reed
JC. X-linked IAP is a direct inhibitor of celldeath
proteases. Nature. 388: 300-304, 1997.
Giodini A, Kallio MJ, Wall NR, Gorbsky GJ, Tognin
S, Marchisio PC, Symons M and Altieri
DC. Regulation of microtubule stability and
mitotic progression by survivin. Cancer Res.
62: 2462-2467, 2002.
Jang JS, Kim KM, Kang KH, Choi JE, Lee WK,
Kim CH, Kang YM, Kam S, Kim IS, Jun JE,
Jung TH, Park JY. Polymorphisms in the
survivin gene and the risk of lung cancer. Lung
Cancer. Apr;60(1):31-9, 2008.
Jin Sung Jang,,Kyung Mee Kim, Kyung Hee Kang,
Jin Eun Choi, Won Kee Lee, Chang Ho Kim,
Young Mo Kang, Sin Kam, In-San Kim, Jae
Eun Jun, Tae Hoon Jung, Jae Young Park.
Polimorphizms in the survivin gene and the risk
of lung cancer. Lung Cancer. 60:31-39, 2008.
KHDAK’de survivin polimorfizmi 31
Julian R. Molina, Ping Yang, Stephen D. Cassivi,
Steven E. Schild,, Alex A. Adjei, Non–Small
Cell Lung Cancer: Epidemiology, Risk Factors,
Treatment, and Survivorship. Mayo Clin
Proc.83(5): 584–594.,2008.
Lan CC, Wu YK, Lee CH, Huang YC, Huang CY,
Tsai YH, Huang SF, Tsao TC. Increased
survivin mRNA in malignant pleural effusion is
significantly correlated with survival. Jpn J Clin
Oncol. Mar;40(3):234-40, 20
Li F, Ambrosini G, Chu EY, Plescia J, Tognin S,
Marchisio PC and Altieri DC. Control of
apopto-sis and mitotic spindle checkpoint by
survivin. Nature. 396: 580-584, 1998.
Li F.,Altieri DC. The cancer antiapoptosis mouse
survivin gene: characterization of locus and
transcriptional requirements of basal and cell
cycle-dependent expression. Cancer Res.59:
3143-3151, 1999.
Masayuki Otaki, Masahiko Hatano, Koichi
Kobayashi, Takeshi Ogasawara, Takayuki
Kuriyama, Takeshi Tokuhisa Cell cyledependent
regulation of TIAP/m-survivin
expression. Biochim Biophys Acta. 1493:188-
194, 2000.
Nicholson DW,Thornberry NA. Caspase:killer
proteases. Trends Biochem Sci. 22:299-306,
1997.
Reed JC. X-linked IAP is a direct inhibitor of celldeath
proteases. Nature. 388: 300-304, 1997.
Thompson CB. Apoptosis is the pathogenesis and
treatment of disease. Science. 5267:1456-1462,
1991.
Uren AG, Coulson EJ and Vaux DL. Conserva-tion
of baculovirus inhibitor of apoptosis repeat
proteins (BIRPs) in viruses, nematodes, vertebrates
and yeasts. Trends Biochem Sci. 23: 159-
162, 1998.
Xu Y, Fang F, Ludewig G, Jones G, Jones D. A
mutation found in promoter region of the human
survivin gene is correlated to overexpression of
survivin in cancer cells. DNA Cell Biol.
23:419-429, 2004.
Yang X, Xiong G, Chen X, Xu X, Wang K, Fu Y,
Yang K, Bai Y. Polymorphisms of survivin
promoter are associated with risk of esophageal
squamous cell arcinoma. J Cancer Res Clin
Oncol. Oct;135(
32 Engin AYNACI et al.
Yang X, Xiong G, Chen X, Xu X, Wang K, Fu Y,
Yang K, Bai Y. Survivin expression in
esophageal cancer: correlation with p53
mutations and promoter polymorphism. Dis
Esophagus. 2009;22(3):223-30.
Yuan-Hung Wang, Hung-Yi Chiou, Chang-Te Lin,
Hsiao-Yen Hsieh, Chia-Chang Wu, Cheng-Da
Hsu, Cheng-Huang Shen. Association Between
Survivin Gene Promoter -31C/G Polymorphism
and Urothelial Carcinoma Risk in Taiwanese
Population. Urology. 73 (3):670-674, 2009.
Yun-Hong Li, Chen Wang, Kui Meng, Long-Bang
Chen, Xiao-Jun Zhou, İnfluence of survivin and
caspase-3 on cell apoptosis and prognosis in
gastric carcinoma. World J Gastroenterol.
Journal of Cell and Molecular Biology
Haliç University, Printed in Turkey.
http://
Effects of prenatal and neonatal exposure to lead on white blood
cells in Swiss mice
Ragini SHARMA*, Khushbu PANWAR, Sheetal MOGRA
Environmental and Developmental Toxicology Research Lab, Department of Zoology, M. L. S. University,
Udaipur- 313001 Rajasthan, India
(* author for correspondence; taurasragini@yahoo.com)
Received: 27 August 2011; Accepted: 25 May 2012
Abstract
Lead exposure is one of the major environmental issues for children and women of child bearing age. It
crosses the placental barrier and its greater intestinal absorption in fetus results in developmental defects.
Lead, as one of the environmental pollutants, can threat the lives of animals and human beings in many ways;
especially during developing stages. The present study was carried out to study the alterations in different
types of white blood cells (WBC) due to chronic lead acetate toxicity in neonates, which passes from adult
pregnant female during gestation and lactation. Lead acetate was administered orally at 8, 16, 32 mg /kg/BW
to pregnant Swiss mice from
numerical alterations in the WBCs were examined in the neonates after birth at postnatal days 1, 7, 14 and
21. Blood smears examined illustrate that lead induces disturbances in the development of different types of
WBCs during postnatal development and lead to an abrupt neutrophilic degeneration, immature cells,
abnormal neutrophils, reactive and plasmacytoid lymphocytes. The results of the present study emphasize
that prenatal lead exposure is extremely dangerous to developing fetus.
Keywords: Lead acetate, Swiss albino mice, prenatal, neonatal, white blood cells.
Swiss farelerde prenatal ve yenidoğan kurşun maruziyetinin beyaz kan hücreleri üzerine
etkileri
Özet
Kurşun maruziyeti çocuklar ve çocuk doğurma çağındaki kadınlar için majör çevresel konulardan birisidir.
Plasental bariyeri geçer ve fetusta barsaklardan emilimi, gelişimsel defektlerle sonuçlanır. Çevresel
kirliliklerden biri olan kurşun, birçok yönden özellikle gelişim çağı boyunca insan ve hayvan hayatını tehdit
etmektedir. Bu çalışma, yetişkin hamile dişilerden gebelik ve laktasyon süresince yenidoğanlara geçen
kurşun asetatın yarattığı kronik toksisite sebebiyle lökositlerin farklı tiplerindeki değişimleri incelemek için
yapılmıştır. Kurşun asetat, hamile Swiss farelere gebeliğin
yoluyla 8, 16, 32 mg /kg//BW şeklinde uygulanmıştır. Yenidoğanlarda doğumdan sonraki 1, 7, 14 ve 21.
günlerde beyaz kan hücrelerindeki hematopatolojik ve sayısal değişiklikler incelenmiştir. Kurşunun doğum
sonrası gelişim sırasında lökositlerin farklı tiplerinin gelişimindeki bozuklukları indüklediğini ve ani
nötrofilik olgunlaşmamış dejenerasyona, hücreler, anormal nötrofillere, reaktif ve plazmasitoid lenfositlere
neden olduğunu göstermek için kan yaymaları incelenmiştir. Bu çalışmanın sonuçları prenatal kurşun
maruziyetinin gelişen fetus için son derece tehlikeli olduğunu vurgulamaktadır.
Anahtar kelimeler: Kurşun asetat, Swiss albino fare, prenatal, yenidoğan, lökosit.
34Ragini SHARMA et al.
Introduction
Lead has been recognized as a biological toxicant
and different doses have been used to study leadinduced
alterations Prenatal exposure to lead
produces toxic effects in the human fetus, including
increased risk of preterm delivery, low birth
weight, and impaired mental development; because
during the period of early organogenesis the onset
of greatest susceptibility to teratogenesis occurs
(Falcon et al., 2003). This highly sensitive or
critical period is the time during which a small dose
of a teratogen produces high percentage of fetuses
that exhibit malformations of the organ in question
(Wilson, 1973; Desesso et al., 1996).
Pregnancy and breastfeeding can cause a state
of physiological stress that increases bone turnover
of lead. Lead stored in the bone moves into the
blood, increasing the mother’s blood lead level and
passing to the fetus, affecting fetal development.
Lead is tightly bound to red blood cells, enhancing
transfer from maternal circulation through the
placenta to the fetus. Fetus is more sensitive to lead
because the fetal blood-brain barrier is more
permeable. The toxic effects of lead on blood
indices are well known.
Lead potentially induces oxidative stress and
evidence is accumulating to support the role of
oxidative stress in the pathophysiology of lead
toxicity. Lead is capable of inducing oxidative
damage to brain, heart, kidneys, and reproductive
organs. The mechanisms for lead-induced oxidative
stress include the effects of lead on membranes,
DNA, and antioxidant defense systems of cells
(Ahamed and Siddiqui, 2007). Lead interferes with
a variety of body processes and is toxic to the body
systems including cardiovascular, reproductive,
hematopoietic, gastrointestinal and nervous systems
(Kosnett, 2006), renal functions (Patocka and
Cerny, 2003) and release of glutamate (Xu et al.,
2006). It affects the hematological system even at
concentrations below
Many reports are available regarding lead
toxicity and its deleterious effects in various
species of animals and there has been lot of work
carried out on pharmacokinetics and genotoxicity
but very few researchers tried to correlate
haematopathological alterations of lead acetate in
different white blood cells at different dose levels
in laboratory animals, especially in mice.
Therefore the current study was performed to
clarify the lead induced hematological changes,
especially those related to white blood cells, during
gestational and lactational exposure to lead in
Swiss mice.
Materials and methods
Sexually mature random bred Swiss mice with the
age of 5-6 weeks, weighing 25-30 gm was used for
this study. During the entire experimental period,
the animals were fed on a standard diet and water
ad libitum. Mice were kept in the ratio of 1:4 males
and females, respectively, and females showing
vaginal plugs were separated in the control and lead
treated group. Lead acetate solution was prepared
by dissolving 4gm lead acetate in 12ml distilled
water. Pregnant Swiss mice were given lead acetate
at a concentration of 8, 16 and 32 mg (266.66,
533.33, and
day of gestation to 21 st day of lactation. Blood
samples were obtained from the tail of pups from
each litter at days 1,7,14 and 21 day after birth. The
tip of the tail was cleaned with spirit before being
cut with a sharp blade and was not squeezed to
avoid dilution of blood by tissue fluid.
Blood cells were studied in smears prepared by
spreading a drop of blood thinly over a clean and
sterilized microscopic slide with the help of another
slide moved over the first at the angle of 45ᵒ after
discarding first drop of blood. These blood films
were air-dried and fixed in absolute methanol for
15 minutes by dipping the film briefly in a Coplin
jar containing absolute methanol. After fixation the
slides were removed and air-dried. Afterward blood
smears were stained with freshly made Giemsa
stain diluted with water buffered to pH 6.8 or 7.0
(1:9) stain and buffer respectively. The slides were
washed by briefly dipping the slide in and out of a
Coplin jar of buffered water and air dried again for
taking observations. The erythrocytes appear pink
to purple, whereas leukocytes turned blue black in
color. All the experimental work was approved by
the Institutional Animal Ethics Committee.
No./CS/Res/07/759.
Group 1- Control (distilled water only).
Group 2- Exposure to 8 mg lead acetate (266.66
mg/kg BW) from
day of lactation.
Group 3- Exposure to 16 mg lead acetate
(533.33 mg/kg BW) from
to 21st day of lactation.
Group 4- Exposure to 32 mg lead acetate
(
to 21st day of lactation.
The statistical analysis was performed following
t-test for the comparison of data between different
experimental groups. The data was calculated using
prism software to calculate the p values.
from each group were counted at different weeks,
different cell types were identified and % ratio was
calculated. For numerical observation highest dose
level was selected.
Results
In the control group all the WBCs showed normal
appearance. The neutrophils in control group were
examined by a very characteristic nucleus with
condensed chromatin. It is divided into 3-5 lobes
(Fig.1A, 1, 2, 5 and 6) at birth which was observed
with an increase by 5 to 6 lobes (Fig.1B, 1 and 3) at
the termination of lactation, connected by thin
strands of chromatin. Lymphocytes were round or
ovoid at the time of birth (Fig. 1A, 3 and 4) but
further on they were found notched or slightly
indented (Fig. 1B, 5 and 6). The chromatin was
generally diffusely dense. Ordinarily, nucleoli were
not visible. A perinuclear clear zone surrounding
the nucleus was visible after first week of lactation
in some cells. The cytoplasm stained light blue and
ranges from sparse to moderately abundant in
amount. The monocyte in control group were round
with smooth margins, the nucleus was oval,
indented and slightly folded (Fig.1B, 4). The
chromatin material was moderately clumped and
relatively less dense compared to that of
neutrophils or lymphocytes. There was no visible
nucleolus with abundant cytoplasm.
The administration of lead acetate altered the
appearance and caused structural changes. The
following hematological observations were taken
during postnatal period from birth till the
termination of the lactation period upon exposure
of different doses of lead acetate:
1. At the time of birth (PND1)
Abnormal neutrophils: In lead treated groups
the neutrophils showed structural abnormalities in
their nucleus including improper segmentation and
lesser condensation of nucleus. At a lower dose the
chromatin material was condensed, all the lobes
were interconnected with each other and form a
nodule like structure at one side (Fig.1C, 1).
Degeneration: In lead treated group most of the
neutrophils appeared in degenerating state in which
the chromatin material was very less condensed,
fused and there was no sign of clear lobulization
and segmentation (Fig. 1C, 2).
Immature cells: In lead treated group the
number of immature cells was increased (Fig. 1C,
3).
Prenatal and neonatal exposure to lead 35
Ring shaped: In lead treated groups, some
neutrophils showed abnormal ring like appearance
and diffuse chromatin material, with unclear
cytoplasm. In 32 mg lead treated group
vacuolization in chromatin material was also
observed ((Fig. 1C, 4).).
Lymphocyte: Reactive (Fig. 1C: 5 and 6) and
cleaved (Fig. C, 5) types of lymphocytes were
observed in lead treated groups.
Monocytes: At postnatal day 1 we cannot
identify any structural change in shape and size of
monocyte as observed on postnatal day 21.
2. During first and second week of postnatal period
(PND7&14)
The following observations were taken at first to
second week after birth:
Degenerated neutrophils: In lead treated group
overall numbers of neutrophils were increased
particularly with degenerated neutrophils, however,
their number was less than postnatal day 1. In 16
mg lead group on postnatal day 7 the nuclear
material of neutrophil was less condensed and
nucleus was divided into 2-3 unequal lobes. The
cytoplasm of neutrophil appeared colorless. At the
dose of 32mg lead at postnatal day 7, this severity
of degeneration was very much increased so that
the lobes were broken into many small fragments.
No sign of lobulization and appropriate
segmentation of neutrophils were found (Fig. 1D,
1).
Ring shaped neutrophils: In contrast to
postnatal day 1, ring like nucleus was not observed
in lead treated group at postnatal day 7.
Different types of neutrophils: At higher dose
32 mg lead treated groups apoptotic or necrotic
neutrophils were more prominent. These
neutrophils were characterized by 3-4 separate and
equal lobes with less condensed chromatin and
diffuse cytoplasmic region (Fig. 1D, 2).
Immature cells: Review of the lead treated
smear revealed that most of the leukocytes were
myelocytes, bands, myeloblast and other immature
and unidentified white blood cells with left shift in
leucocytes. A left shift is an increase in the number
of band neutrophils and other immature cell of the
granulocytic lineage in the peripheral blood (Fig.
1D, 3).
Various lymphocytes: Administration of lead
acetate produced great variation in lymphocyte
structurally as well as numerically. Various types of
lymphocytes such as plasmacytoid, reactive, oval,
irregular, binucleated and cleaved lymphocytes
were identified, whereas only reactive and cleaved
36Ragini SHARMA et al.
lymphocytes were seen in postnatal day 1,
exclusively in lead treated group.
Lead treated group with 16 mg lead acetate
produced large lymphocytes and most of the
lymphocytes were having irregular; clumpy and
smudgy chromatin material with very dense
nucleus (Fig. 1D, 4). The cytoplasm appeared
completely absent as the nucleus reached its largest
size and covered all the cytoplasmic area. Overall,
number of lymphocytes decreased in most of the
groups. At higher dose (32 mg lead) the
plasmacytoid lymphocytes (eccentric nucleus and
intensely blue / basophilic cytoplasm) (Fig. 1D, 6)
and reactive lymphocytes were observed. Reactive
lymphocyte was characterized by relatively very
large, irregular but flattened nucleus with fine
chromatin and agranular light blue stained
cytoplasm (Fig. 1D, 5).
3. At the end of lactation period (PND21)
Abnormal nuclear segmentation: It includes
abnormal segmentation of nucleus, in which the
nuclear lobes were connected with each other. It
gave abnormal appearance of nucleus and
chromatin condensation in most of the neutrophils
(Fig. 1E, 1).
Degeneration: In lower doses of lead diffuse
appearance of chromatin material was observed in
neutrophils and the lobes were fused with each
other as any segmentation was not observed,
whereas in higher lead treated group the neutrophils
presented fragmented chromatin material and very
less condensation of nucleus which finally leads to
cell lysis (Fig. 1E, 2). The nuclear arrangement was
distorted, as appear that all the lobes were
intermingled with each other and in some cases
form a nodule at one side known as sessile nodule
appeared like hypersegmentation (Fig. 1E, 3).
Immature cells: In lead treated group the
numbers of immature cells were increased. A left
shift i.e. presence of immature neutrophils, bands,
metamyelocytes, myelocytes and other unidentified
immature cells were observed (Fig. 1F, 1 to 6).
Lymphocytes: As the dose level increased the
number of lymphocytes decreased. In higher dose
lead treated group the lymphocyte appeared large in
size with higher volume of cytoplasm. The shape of
the nucleus also vary from round to elliptical in
structure, termed as reactive lymphocyte (Fig. 1E,
4). Some lymphocytes transformed into
plasmocytoid lymphocyte in which the lymphocyte
contains basophilic cytoplasm and eccentric
nucleus (Fig. 1E, 5).
Monocytes: In lead treated groups the shape and
structure of the monocyte were modified and the
shape of the nucleus was also altered from the
normal reniform (kidney shaped) nucleus. The
indentation of the nucleus became larger and
deeper from periphery to center. At higher dose
level intensity of the indentation was increased so
that the normal range of nucleo-cytoplasmic ratio
was disturbed (Fig. 1E, 6). Numerical changes in
different types of WBC and percent variations in
different types are incorporated in Table 1 and 2
respectively. In present investigation, after
evaluating all the cell types, we can conclude that
lead acetate at PND 1 and 14 caused significant
increase in number of neutrophils and decrease in
lymphocytes, while there was no significant
difference in the number of neutrophils and
lymphocytes at PND 7 and 21.
Table 1. Various types of WBCs at different postnatal days treated with lead acetate.
Groups Neutrophils Lymphocytes Monocytes
Control at PND 1 59.25±1.70 38.5±1.29 2.25±1.70
Lead acetate at PND1 66.00±2.16** 28.25±2.06** 5.75±1.70*
Control at PND 7 57.75±2.21 41.75±2.21 0.75±0.95
Lead acetate at PND7 61.75±3.5 37.5±2.88 0.75±0.95
Control at PND 14 55.25±3.40 44.5±3.
Lead acetate at PND14 61.25±1.70** 37.75±1.70** 1.00±0.81
Control at PND 21 47.75±2.5 47.75±2.21 4.5±2.38
Lead acetate at PND21 52.25±4.57 44.00±2.26 3.75±2.75
Values were expressed as means ± S.D.; 4 animals /group;*=p
Prenatal and neonatal exposure to lead 37
Table 2. Percent variation in different types of WBCs in lead treated groups
Lead acetate at PND1
Lead acetate at PND7
Lead acetate at PND14
Lead acetate at PND21
Neutrophils Lymphocytes Monocytes
Normal 12.3%
Degenerated 12.1%
Ring shaped 8.2%
Immature 4.1%
Abnormal
Normal 12.6%
Degenerated 8.4%
Abnormal 16.8%
Immature
Ring shaped 6%
Normal 19.2%
Degenerated 19%
Abnormal 9.6%
Immature 6.4%
Apoptotic 6.4%
Normal 6.18%
Degenerated18.5%
Ring shaped 1.5%
Abnormal 17%
Immature 7.4%
Normal 13%
Reactive 17.33%
Cleaved 8.6%
Normal 12.2%
Plasmacytoid 7.4%
Reactive 9.8%
Binucleated 2.4%
Large 4.2%
Normal 4%
Plasmacytoid 4%
Reactive 12.3%
Binucleated 8.2%
Large 4%
Irregular 2%
Oval 2%
Normal
Abnormal 16.4%
Plasmacytoid1.4%
Reactive 4.4%
Large 5.8%
Irregular 5.86%
Normal 2.0%
Abnormal 3.7%
Abnormal 0.75%
Abnormal 1%
Normal 2%
Abnormal 1.7%
Figure 1. A: Peripheral blood smear of control group showing neutrophil (1-2), lymphocytes (3-4), at the time of birth,
neutrophils (5-6) during second and third week of lactation. B: Control group showing neutrophil (1), lymphocyte (2),
during second and third week of lactation, and, neutrophil (3), lymphocytes (4-5) and monocyte (6) at the termination of
lactation. C: Peripheral blood smear of lead treated group showing abnormal neutrophil (1), degenerated neutrophil (2),
immature cell (3), ring like neutrophil (4), 5 – cleaved (upper WBC) (5) and reactive (lower WBC) lymphocyte (5 and 6)
at the time of birth. D: Lead treated group showing degenerated neutrophil (1), necrotic (2), immature cell (3), large
lymphocyte (4), reactive (5) and plasmacytoid lymphocyte (6) During first and second week of postnatal period. E: Lead
treated group showing - abnormal neutrophil (1), degenerated neutrophil (2), hypersegmented neutrophil (3), reactive
lymphocyte (4), plasmacytoid lymphocyte (5) and reactive monocyte (6) at the termination of lactation. F: Lead treated
group showing different immature cells at the termination of lactation (1- 6). (All Giemsa stain, 450x).
38Ragini SHARMA et al.
Discussion
Changes in leukocyte parameters are often one of
the hallmarks of infection. These include changes
in number and in cellular morphology. Review of
the peripheral blood smear can provide significant
insight into the possible presence of infection. Early
changes during infection may include an increase in
the number of bands, even before the development
of leukocytosis. A great shift to immaturity (left
shift) may occur when infection is severe, with
metamylocytes or even earlier forms present on the
peripheral blood smear. There are many evidences
of studies conducted on adults and RBC concerning
lead toxicity, but very few reports are available
regarding haematopathological alterations of lead
acetate in different white blood cells. Significant
decrease in RBC count, hematocrit (Hct) and
hemoglobin (Hb) were seen in rats and human with
high blood lead levels. (Alexa et al., 2002; Noori et
al., 2003; Othman et al., 2004; Toplan et al., 2004)
In our study the control groups showed all the
leukocytes in normal appearance. Still some altered
types of WBCs were also observed. The
administration of lead acetate alters the structure
and number of WBCs. The nuclear arrangement
was also distorted. In lead treated groups the shape
and structure of the monocyte was also altered with
reniform (kidney shaped) nucleus. At higher dose
level this intensity of indentation was increased so
that the normal range of nucleo-cytoplasmic ratio is
disturbed and appeared as reactive monocytes. Our
findings are also in support of DeNicola et al.
(1991) with the evidence of reactive monocytes
enclosing the cytoplasm became more intensely
basophilic and vacuolated. This usually indicates a
chronic inflammatory process or may be seen with
hemoplasmas in the cat.
Toxicity in neutrophils is defined by the
presence of Döhle bodies (small, basophilic
aggregates of RNA in the cytoplasm), diffuse
cytoplasmic basophilia etc. In our study each lead
treated group in neonatal period, represents
increased number of degenerated neutrophils
particularly at birth. In the 16 mg lead exposed
group, during first week of lactation, the nuclear
material of cell was less condensed and nucleus
was divided into 2-3 unequal lobes with colorless
cytoplasm. At higher dose of 32 mg lead, this
severity of degeneration was very much increased
with many small fragments of nuclear material and
no sign of lobulization and appropriate
segmentation of neutrophils were observed.
In a study performed on young dogs,
development of anemia, leukocytosis,
monocytopenia, polychromato-philia, glycosuria,
increased serum urobilinogen, and hematuria has
been reported (Zook, 1972). Lead suppresses bone
marrow hematopoiesis, probably through its
interaction with the enteric iron absorption (Klader,
1779; Chnielnika, 1994). In some reports,
leukocytosis has been attributed to the lead-induced
inflammation (Yagminas et al., 1990).
Hogan and Adams, (1979) reported a threefold
increase in neutrophil and monocyte count along
with severe leukocytosis in the young rats that were
exposed to lead. The present investigation revealed
that administration of lead acetate alters the
appearance and cause structural changes. The
nuclear arrangement was distorted with
intermingled lobes and in some cases formed a
sessile nodule.
Controversies exist about monocytes; since in
some studies lead-induced monocytopenia
(Xintaras, 1992) and in others significant increases
in monocyte count have been reported (Yagminas
et al., 1990). The reason for such difference is
probably due to the extent of lead-induced
inflammation.
Mugahi et al. (2003) investigated additional
hematotoxic effects of lead on the erythroid cell
lineage and leukocytes following long-term
exposure in rats. Wahab et al. (20
lead caused a significant decrease in hematocrit,
RBC, WBC, hemoglobin concentration, mean
corpuscular hemoglobin, mean corpuscular
hemoglobin concentration and lymphocyte and
monocyte count; and significant increase in
neutrophil count. The results of the present study
are also parallel to the above findings. In lead
exposed pups there was significant increase in the
number of neutrophils at different weeks after birth,
but decrease in the number of lymphocytes. The
shortened life span of erythrocytes is due to
increased fragility of the blood cell membrane and
r
levels of enzymes involved in hemesynthesis
(Guidotti et al., 2008). It has long been known that
hematopoiesis and heme synthesis affected by lead
poisoning (Doull et al., 1980).
In our study reactive and cleaved type of
lymphocyte were observed at the time of birth in
lead treated groups which were reinstated by
increased number of plasmacytoid, reactive, large,
oval, irregular, binucleated and cleaved
lymphocytes in further days of lactation. In the
current investigation at higher dose (32 mg) we
found apoptotic or necrotic neutrophils were more
prominent in the first and second week of lactation.
These neutrophils were characterized by 3-4
separate and equal lobes with less condensed
chromatin and diffuse cytoplasmic region.
Lead treated group at the termination of
lactation, include abnormal nuclear segmentation,
giving abnormal appearance of nucleus and
chromatin condensation in most of the neutrophils
and forming a ring like nucleus in some
neutrophils. Villagra et al., (1997) also postulates
that lead exposure doubles total and segmented
neutrophils in both estrogens treated and untreated
rats but causes a three-fold increase in band
neutrophils in animals without estrogen treatment,
but not in animals treated with estrogen. With a
disappearance of non-degranulated eosinophils, the
decrease in non-degranulated eosinophils was
under the effect of lead exposure. He also
demonstrates that prepubertal rat exposure to lead
affects blood neutrophil and eosinophil leukocyte
levels and induces eosinophil degranulation.
Vyskocil et al., (1991) discovered the effect of
lead on band neutrophils reveals an increased
neutrophilopoiesis rather than release from
intravascularly sequestered forms in lead-exposed
animals.
In lead treated group from birth till the
termination of lactation, the number of immature
cells was increased. There was asynchrony of
maturation between nucleus and cytoplasm. During
normal granulocytopoiesis the lengthening and
pinching of the nucleus were coordinated with
progressive condensation of the chromatin with
accelerated maturation nuclear division may be skip
and cells retain immature features, because toxic
changes of lead accompanies a left shift i.e.
presence of immature neutrophils, bands,
metamyelocytes, myelocytes and other unidentified
immature cells. White Blood Cells generally
increase as compared to the control level. The
increase in WBC count indicates the activation of
defense mechanism and immune system of gasoline
workers (Whitby, 1980). These findings are also in
confirmations, with our results.
In conclusion, lead exposure leads to various
hematological disorders in white blood cells
including neutrophilic degeneration, immature
cells, abnormal neutrophils, reactive and
plasmacytoid lymphocyte, reactive monocyte etc.
The present study indicates that after administration
of 266.66, 533.33 and
doses of lead acetate WBCs show structural
abnormalities in their nucleus and cytoplasm
Prenatal and neonatal exposure to lead 39
including improper segmentation and lesser
condensation of nucleus. Lead causes fluctuations
in the number of various cell types at different
stages of postnatal development. The exposure to
lead possesses the potentials to induce hazardous
biological effects during pre and postnatal
development in Swiss mice.
References
Ahamed M and Siddiqui MKJ. Low level lead
exposure and oxidative stress: Current opinions.
Clinica Chimica Acta. 383: 57–64, 2007.
Alexa ID, Mihalache IL, Panaghiu L, Palade F.
Chronic lead poisoning- a" forgotten” cause of
anemia. Rev Med Chir Soc Med Nat Iasi.
Chmielnika J, Zareba G, Nasiadek M. Combined
effect of tin and lead on heme biosynthesis in
rats. Ecotox Environm Safety. 29: 165-173,
1994.
DeNicola D, Giger U, MacWilliams P and
Wamsley H. Hematologic Evaluation of Cats
and Dogs. IDEXX Laboratories. (HO-30b)1991.
Desesso JJ and Harris SB. Principles underlying
development toxicity. Toxicology and Risk
Assesment. 1996.
Doull J, Klaassen CD and Amdur MO. Casaratt
and Doulls Toxicology. 2 nd ed. Macmillan
Publishing Co, New York. 415–421, 1980.
Falcon M, Vinas P and Luna A. Placental lead and
outcome of pregnancy. Toxicology. 185 (1-
2):59-66, 2003.
Guidotti TL, McNamara J, Moses MS. The
interpretation of trace elements analysis in body
fluids. Indian J Med Res.128:524-53, 2008.
Hogan GR and DP Adams. Lead induced
leukocytosis in Female mice. Archive of
Toxicol. 41:295-300, 1979.
Isha BARBER, Ragini SHARMA, Sheetal
MOGRA, Khushbu PANWAR and Umesh
GARU. Lead induced alterations in blood cell
counts and hemoglobin during gestation and
lactation in Swiss albino mice. J of Cell and
Mol Biol. 9(1):69-74, 2011.
Klauder DS and Petering HG. Anemia of lead
intoxication: A role of Copper. J Nutr.
40Ragini SHARMA et al.
Kosnett. Global approach to r
exposure and poisoning. Mutation Research.
659(1-2): 166-175, 2006.
Mugahi MN, Heiadari Z, Sagheb HM and
Barbarestani M. Effects of chronic lead acetate
intoxication in blood indices of male adult rat.
Daru. 11;4: 2003.
Noori MM, Heidari Z, Sagheb H and Barbarestani
M. Effects of chronic lead acetate intoxication
on blood indices of male adult rat. Daru Pharm
J, 11(4): 147-51, 2003.
Othman AI, Sharawy S and El-Missiry MA. Role
of melatonin in ameliorating lead induced
haematotoxicity. Pharmacol Res. 50(3):301-7,
2004.
Patocka J, Cerný K. Inorganic lead toxicology. Acta
Medica (Hradec Kralove). 46(2):65-72, 2003.
Toplan S, Ozcelik D, Gulyasar T and Akyolcu MC.
Changes in hemorheological parameters due to
lead exposure in female rats. J Trace Elem Med
Biol. 18(2):179-82, 2004.
Villagra R, Tchernitchin NN and Tchernitchin AN.
Effect of Subacute Exposure to Lead and
Estrogen on Immature Pre-Weaning Rat
Leukocytes Bull. Environ Contam Toxicol.
58:190-197, 1997.
Vyskocil A, Fiala Z, Tejnorova I, Tusi M. Stress
reaction in developing rats exposed to 1% lead
acetate. Sb Ved Pr Lek Karlovy University
Hradci Kralove. 34:287-295, 1991.
Wahab AA, Joro JM, Mabrouk MA, Oluwatobi SE,
Bauchi ZM and John AA. Ethanolic extract of
Phoenix dactylifera L. prevents lead induced
hematotoxicity in rats. Continental J
Biomedical Sciences. 4:
Whitby LG, Rercy-Robb IW and Smith AF.
Chapter 9. Lecture Notes on Clinical Chemistry.
2nd ed. Blackwell Scientific Publications,
Oxford London Edinburgh Melbourne. 167-
187, 1980.
Wilson JG. Environments and birth defects.
Academic Press, New York. 1973.
Xintaras C. Impact of Lead contaminated soil on
Public Health. Public Health Service. Agency
for toxic substances and Disease Registry,
1992.
Xu HH, Chen ZP and Shen Y. Meta analysis for
effect of lead on male reproductive function. J
of Industrial hygiene and occupational disease.
24(
Yagminas AP, Franklin CA, Villeneuve DC,
Gilman AP, Little PB and Valli VE. Subchronic
oral toxicity of triethyl lead in the male
weanling rat: Clinical, biochemical,
hematological, and histopathological effects.
Fundam Appl Toxicol. 15: 580-596, 1990.
Zook BC. Lead poisoning in dogs. Am J Vet Res.
33: 981-902, 1972.
Journal of Cell and Molecular Biology
Haliç University, Printed in Turkey.
http://
Sulfabenzamide promotes autophagic cell death in T-47D breast
cancer cells through p53/ DRAM pathway
Raziye MOHAMMADPOUR 1 , Shahrokh SAFARIAN *1 , Soroor FARAHNAK 1 , Sana
HASHEMINASL 1 , Nader SHEIBANI 2
1
School of Biology, College of Science, University of Tehran, Tehran, Iran
2
Department of Ophthalmology and Visual Sciences, School of Medicine and Public Health, University of
Wisconsin, Madison, USA
(* author for correspondence; safarian@ibb.ut.ac.ir )
Received: 26 March 2012; Accepted: 29 May 2012
Abstract
Sulfonamides exhibit their antitumor effects through multiple mechanisms including inhibition of membrane
bound carbonic anhydrases, prevention of microtubule assembly, cell cycle arrest, and inhibition of angiogenesis.
Here, sulfabenzamide’s mechanisms of action on T-47D breast cancer cells were determined. Cells incubated with
sulfabenzamide exhibited negligible levels of apoptosis, necrosis and cell cycle arrest when compared to untreated
cells. These results were confirmed by morphological examinations, DNA fragmentation assays, flow cytometric
and real time RT-PCR analysis. Surprisingly, despite negligible detection of DNA fragmentation, a considerable
increase in caspase-3 activity was observed in cells incubated with sulfabenzamide. The increased expression ratio
of DFF-45/DFF-40 indicated that caspase-3-related DNA fragmentation was blocked and apoptosis symptoms
could not be seen. However, the effects of caspase-3 for PARP1 and DNA-PK deactivation resulted in autophagy
induction. The overexpression of critical genes involved in autophagy, including ATG5, p53 and DRAM, indicated
that in T-47D cells sulfabenzamide-induced antiproliferative effect was mainly exerted through induction of
autophagy. Furthermore, downregulation of AKT1 and AKT2 as well as over expression of PTEN resulted in
attenuation of AKT/mTOR survival pathway showing that death autophagy should be occurred in sulfabenzamide
treatment.
Keywords: Sulfabenzamide, breast cancer, autophagy, apoptosis, p53.
Sülfobenzamid, T-47D meme kanseri hücrelerinde p53/DRAM yolağı aracılığıyla otofajik hücre ölümünü
teşvik eder
Sülfonamidler, membrana bağlı karbonik anhidraz inhibisyonunu, mikrotubül toplanmasının engellenmesini, hücre
siklusunun durdurulmasını ve anjiyogenez inhibisyonunu içeren çoklu mekanizmalarla antitümör etkilerini
göstermektedirler. Burada, T-47D meme kanser hücreleri üzerinde sülfobenzamid mekanizmasının etkisi
belirlenmiştir. Sülfobenzamid ile inkübe edilen hücreler yapılmamış uygulama hücrelerle karşılaştırıldıklarında
önemsenmeyecek seviyede apoptoz, nekroz ve hücre siklusunun durmasını ortaya koymuştur. Bu sonuçlar
morfolojik incelemelerle, DNA fragmantasyon analizleriyle, flow sitometrik ve gerçek zamanlı RT-PCR
analizleriyle doğrulanmıştır. Şaşırtıcı bir şekilde, DNA fragmantasyonunun ihmal edilebilecek tespitine rağmen,
sülfobenzamidle edilmiş inkübe hücrelerde kaspaz 3 aktivitesinde dikkate değer artış bir gözlenmiştir. DFF-45/
DFF-40’ artmış ın ekspresyon oranı, kaspaz 3 ile ilişkili DNA fragmantasyonunun durdurulduğunu ve apoptoz
belirtilerinin görülemeyeceğini işaret etmektedir. Bununla birlikte PARP1 ve DNA-PK deaktivasyonu için kaspaz
3’ün etkileri otofaji indüklenmesiyle sonuçlanmaktadır. ATG5, p53 ve DRAM gibi otofajide yer alan kritik
genlerin aşırı ekspresyonu T-47D sülfobenzamid-indüklenmiş hücrelerinde antiproliferatif etkinin çoğunlukla
otofaji indüksiyonu aracılığıyla uygulandığını belirtmektedir. Ayrıca, PTEN aşırı ekspresyonu gibi AKT1 ve
AKT’’nin azalarak düzenlenmesi, otofaji ölümünün sülfobenzamid uygulamasıyla meydana geldiğini gösteren
sağ AKT1/mTOR kalım yolağının etkisinin azalmasıyla sonuçlanmaktadır.
Anahtar kelimeler: sülfobenzamid, meme kanseri, otofaji, apoptoz, p53.
42 Raziye MOHAMMADPOUR et al.
Introduction
Sulfonamides are synthetic antibacterial agents
with diverse pharmacological effects including
antibacterial, antiviral, antidiabetic, antithyroid, and
diuretic. Their antibacterial effects are contributed
to the interfering with enzyme activities responsible
for folic acid synthesis by competing for para
aminobenzoic acid. These drugs are selectively
toxic for prokaryotes (Owa et al., 1999; Fukuoka et
al., 2001; Yokoi et al., 2002; Supuran 2003). Two
novel sulfonamides, E7070 and E70
effective against cancer cells via inhibition of
tubulin polymerization and proliferation. The
matrix metalloprotease (MMP) inhibitory effects of
sulfonamides have been evaluated for treatment of
arthritis and cancer (Fukuoka et al., 2001; Ozawa et
al., 2001; Supuran et al., 2003; Mohan et al., 2006).
Sulfabenzamide, 4-Amino-N-benzoyl-benzenesulfonamide,
is a sulfonamide derivative used for
treatment of specific vaginal infections in
combination with sulfathiazole and sulfacetamide
(Valley and Balmer, 1999).
Knowledge regarding alterations in signaling
pathways and the type of cell death induced by
chemotherapeutic drugs is the first and most
important step in design of effective treatments.
Furthermore, manipulation of autophagy has the
potential to improve anticancer therapeutics.
Studies have shown that autophagy protects cancer
cells against antitumor effects of some drugs by
blocking the apoptotic pathway and maintaining
ATP levels. In contrast, other cancer cells undergo
autophagic cell death (ACD or type II programmed
cell death, PCDII) after anticancer therapies
(Kondo et al., 2005; Kondo and Kondo, 2006).
Various anticancer drugs that activate ACD in
breast cancer cells have been reported including
vitamin D analog, EB
antiestrogen agents (Hoyer-Hansen et al., 2005).
Tamoxifen induced autophagic pathway occurs
through down regulation of AKT activity
(Yokoyama et al., 2009). The 3'-methoxylated
analogue isocannflavin B (IsoB) exhibits an
inhibitory effect on T-47D cell proliferation, which
is accompanied by the appearance of an intense
intracytoplasmic vacuolization of autophagic origin
(Brunelli et al., 2009).
Here, we choose sulfabenzamide for assessing
its antitumor activity in T-47D breast cancer cell
line. Our main objective was to determine whether
this drug can be used as an antitumor drug in
medicine. From this point of view, we could
ascertain that there is a correlation between the
expression level of some critical genes and
induction of death autophagy in T-47D cells.
Materials and methods
Reagents
Culture medium, RPMI 1640, and fetal bovine
serum were from Gibco (England); penicillin
streptomycin solution, DNA laddering kit,
Annexin-V-FLOUS Staining Kit, Propidium
Iodide (PI) kit, caspase-3 fluorometric
immunosorbent enzyme assay kit, 4',6- Diamidino -
2-phenylindole (DAPI) kit were all acquired from
Roche (Germany); MTT was from Sigma
(England); sulfabenzamide and doxorubicin were
from Sina Darou (Iran) and Ebewe Pharma
(Austria), respectively. QuantiFast SYBR Green
PCR master mix and RNeasy plus Mini kit were
provided from Qiagen (USA). RevertAidTM M-
MuLV reverse transcriptase and random hexamer
were purchased from Fermentas (Germany).
Cell culture
Epithelial tumor cell line, T-47D, stemmed from
human ductal breast tissue, was provided from
National Cell Bank of Pasteur Institute (Tehran,
IRAN; ATCC number HTB-133). Cells were
maintained in RPMI 1640 medium supplemented
with heat-inactivated (35 min, 56°C) fetal bovine
serum (
solution (1% v/v) and incubated in humidified
condition; 95% air and 5% CO2 at 37°C.
Drug preparation and treatments
Regarding the obtained results from MTT assays,
LC50 for sodium sulfabenzamide and doxorubicin
after 48 h were estimated at
mM, respectively. After reaching confluency (~
80%), cells were incubated with freshly prepared
drugs at the LC50 concentrations, harvested by
trypsin-EDTA, washed three times by phosphatebuffered
saline, and stored at -70°C.
Cytotoxicity/Viability assay
In brief,
culture plate and incubated with different
concentrations of drugs for 24, 48 and 72 h. MTT
was then added to the wells (4 mg/ml or
µg/well) and the produced formazan was
systematically assessed using Elisa micro plate
eader at the wavelength of 570 nm. The percent of
cell viability related to each drug concentration was
estimated in relation to the untreated sample. All
assays were done at least three times unless stated
otherwise.
Apoptosis quantification
After washing
re-suspended in
buffer (20 µl of each Annexin and PI buffer in 1 ml
incubation buffer) for
were then diluted in 500 µl of incubation buffer and
analyzed by flow cytometry (Partech Pass, USA)
using FloMax software.
Cell cycle analysis
5×
solution (
for 30 min in the dark at 4ºC. Using a flow
cytometer fluorescent emission of applied indicator
was detected (excitation and emission wavelength
of 359 nm and 461 nm, respectively) and the
analysis was performed using FloMax software.
Morphological studies of the apoptotic cells
Cells were cultured on cover slips coated with Poly
L-lysine and exposed to drugs for 48 h. Following
staining with Annexin V-FITC (20 µg/ml) and PI
(20 µg/ml) in the dark for
examined using a fluorescent microscope (Carl
Zeiss-Germany) using 450-500 nm excitation and
515-565 nm emission filters.
Measurement of caspase-3 activity
Following drug treatments, cells were harvested
and incubated in lysis buffer on ice for 1 minute.
After centrifugation, sample supernatants were used
for caspase-3 activity measurements using AC-
DEVED-AFC fluorescent substrate as
recommended by the supplier. The concentration of
enzyme-released AFC was estimated using
fluorospectrophotometer (HITACHI model MPF4-
Japan) at 400 nm excitation and 505 nm emission
wavelengths.
DNA laddering assay
2×
volume of binding/lysis buffer for
25 º C. The obtained extract was processed as
recommended by the supplier. Electrophoresis of
the samples in 1% agarose gel at 75 volt for 90
minutes revealed DNA cleavage pattern of cells
Sulfabenzamide promotes autophagic cell death 43
relative to positive control (DNA extracted
prepared from U937 cells incubated 3h with 4 µM
camptothecin).
Preparation of total RNA, cDNA synthesis and real
time RT-PCR
Total RNA was purified using the RNeasy Qiagen
kit according to the manufacturer’s
recommendation. First strand cDNA was generated
using RevertAidTM M-MuLV reverse transcriptase
and 5µg of RNA with random hexamer primers.
Real time quantitative RT-PCR was performed
using the QuantiFast SYBR Green PCR Master
Mix under the following program: 95˚C for 5 min
followed by 40 cycles (95˚C for
for 25 sec and extension at 72˚C for 30 sec).
Analysis was done using Corbett rotor-gene 6000
software based on the comparative Ct method (or
ΔΔCt method). The relative amount of target
materials was quantified compared to the reference
gene (GAPDH). Primers were prepared by TAG
(Copenhagen, Denmark) and were used to amplify
specific regions of cDNA as listed in Table1.
Statistical analysis
For all methods statistical analysis were performed
by the SPSS version 16 and Excel 2007 softwares.
Statistical analysis for MTT assay, flow cytometry,
caspase-3 activity were performed by one way
ANOVA and real time RT-PCR methods were
carried out by t-test. All results are presented as
mean ± standard deviation (p< 0.05 was considered
statistically significant).
Results
Sulfabenzamide inhibits the proliferation of T-47D
cells
The MTT assay was used to evaluate the viability
of T-47D cells incubated with different
concentrations of sulfabenzamide (0.0-20 mM) or
doxorubicin (0.0-0.6 µM) after 24, 48 and 72 h
(chemical structures are shown in Figure 1A). We
checked toxic effects of doxorubicin on T-47D
since it had been reported that its anticancer effects
on different cell types exerts through distinct
cellular processes (apoptosis or cell cycle arrest).
Thus, it could be utilized as a control in our
experiments. The 50% growth inhibition (LC50)
concentration for sulfabenzamide and doxorubicin
after 48 h, were calculated as
µM, respectively, and utilized in the following
experiments (Figure 1B).
44 Raziye MOHAMMADPOUR et al.
Table 1. List of primers. Forward and reverse primer pairs for PTEN gene were designed to amplify a region which could
not anneal to PTEN pseudogene. Primer for p53 was designed for the mutant form present in T-47D cells.
Gene Accession number primers
F: CCAGGTGGTCTCCTCTGACTTCAACAG
PCR product(bp)
GAPDH NC_000012.11
R: AGGGTCTCTCTCTTCTTCCTCTTGTGCTCT
F: GTGAGATATGGTTTGAATATGAAGGC
218
ATG5 NC_000006.11
R: CTCTTAAAATGTACTGTGATGTTCCAA
F: GGAGAGGAGCCATTTATTGAAACT
122
beclin1 NC_000017.
R: AGAGTGAAGCTGTTGGCACTTTCTG
F: CTTGGATTGGTGGGATGTTTC
DRAM NC_000012.11
R: GATGATGGACTGTAGGAGCGTGT
F: CCAGATGGAAAGACGTTTTTGTG
135
AKT1 NC_000014.8
R: GAGAACAAACTGGATGAAATAAA
F: CTGCGGAAGGAAGTCATCATTGC
AKT2 NC_000019.9
R: CGGTCGTGGGTCTGGAAGGCATAC
F: CAAACTTTTTCAGAGGGGATCG
125
caspase-3 NC_000004.11
R: GCATACTGTTTCAGCATGGCAC
F: AAGAAGCTGAGCGAGTGTC
261
bax NC_000019.9
R: GGCCCCAGTTGAAGTTGC
F: ATGGAACTAACTATGTTGGACTATG
157
cyclinB1 NC_000005.9
R: AGTATATGACAGGTAATGTTGTAGAGT
F: AGGGGGAAACACCAGAATCAAGTG
138
bcl-2 NC_000018.9
R: CCCAGAGAAAGAAGAGGAGTTATAA
F: GGTCTTGTGGACAGTAGTTTGCC
113
AIF NC_000023.
R: TCTCACTCTCTGATCGGATACCA
F:CCTGTGCAGCTGTGGGTTGATTT
115
p53 NC_000017.
R: AGGAGGGGCCAGACCATCGCTAT
F: TTGGAGTCCCGATTTCAGAG
150
DFF40 NC_000001.
R: CTGTCGAAGTAGCTGCCATTG
F:TTCTGTGTCTACCTTCCAATACTA
194
DFF45 NC_000001.
R:CTGTCTGTTTCATCTACATCAAAG
F: TAACATTAGTCTGGATGGTGTAGA
127
PARP1 NC_000001.
R: TTACCTGAGCAATATCATAGACAAT
F: TGGCATTACAGACATCTTTAGTTT
113
DNA-PK NC_000008.
R: ACTTTAGGATTTCTTCTCTACATTCA
F: TGGCTAAGTGAAGATGACAATCATG
111
PTEN NC_0000
R: GCACATATCATTACACCAGTTCGT
81
Sulfabenzamide promotes autophagic cell death 45
Figure 1. A) Chemical structure of sulfabenzamide and doxorubicin. B) Viability curve of sodium
sulfabenzamide and doxorubicin treated T-47D cells. Percent viability of cells incubated with sodium
sulfabenzamide and doxorubicin was calculated relative to the related untreated controls after 24, 48 and 72
h. Each point relates to the mean value of at least three independent experiments. The related correlation
coefficient (r 2 ) was adjusted until the best fit for the selected mathematical function was used to interpolate
the experimental points.
T-47D cells do not exhibit DNA fragmentation and
apoptotic morphology in the presence of
sulfabenzamide or doxorubicin
Unlike DNA fragmentation patterns observed in
DNA extracted from U937 cells incubated with
camptothecin (as a positive control of DNA
laddering kit), the gel electrophoresis of DNA
prepared from cells incubated with sulfabenzamide
(
DNA ladder or smear pattern confirming lack of
apoptosis or necrosis in these cells (Figure 2A).
Morphological analysis of sulfabenzamide and
doxorubicin treated cells, double stained with
Annexin-FITC and PI, evaluated by fluorescent
microscopy and confirmed the results of DNA
laddering analysis. There were few cells having
morphological characteristics of apoptotic and
necrotic cells (Figures 2B, 2C). Early (young)
apoptotic cells have rounded shape and shiny green
membrane because PI cannot penetrate into the
cells and Annexin-FITC binds to the externally
membrane-exposed phosphatidylserines (Figures
2B, 2C). Late apoptotic and necrotic cells have
membrane permeability for PI so their nuclei are
stained red (Figure 2C). The main difference
between necrotic and late apoptotic cells is the
potency of late apoptotic cells for simultaneous
staining of nuclei and membrane-exposed
phosphatidylserines with PI and Annexin-FITC,
respectively. Membrane blebbing, which is a
common feature of apoptotic cells was seen in
Figure 2B. Evidently, healthy cells cannot be seen
under fluorescent microscope since they were not
stained with either of the fluorescent dyes (Figure
2E).
46 Raziye MOHAMMADPOUR et al.
Figure 2. A) DNA laddering analysis. 1-3 µg DNA prepared from 2×
electrophoresis in a 1% agarose gel. DNA fragmentation was observed only in positive control (camptothecin
treated) cells, but it was not detected in control or cells incubated with doxorubicin or sodium
sulfabenzamide. B) Observation of the morphology of early apoptotic cells using fluorescent microscopy
following double staining with Annexin V-FITC and PI. Morphological characteristics of early apoptotic
cells (rounded green shiny cells showing membrane blebbing) in sulfabenzamide treated cells. C)
Observation of the morphology of late apoptotic and necrotic cells using fluorescent microscopy following
double staining with Annexin V-FITC and PI. Morphological characteristics of late apoptotic (flattened green
shiny cells showing red dense nuclei) and necrotic cells (red dense spheres lacking green shiny membrane) in
sulfabenzamide treated cells. Similar results were observed for doxorubicin (not shown). Living cells due to
lack of staining with dyes are not detectable in fluorescent visual field (E) but are visible using phase contrast
microscopy (D).
Sulfabenzamide promotes autophagic cell death 47
Figure 3. Caspase-3 activity was increased in cells incubated with sulfabenzamide or doxorubicin. Enzyme
activity in the control, sodium sulfabenzamide, or doxorubicin treated cells were 1.308±0.115, 2.07±0.08,
and 2.496±0.11 nM.h -1 , respectively. Standard curve based on emission (Y axis) of different concentration of
free AFC (nM) is plotted (inset). Diagram of free AFC is plotted in 400 nm excitation and 505 nm emission
wavelengths.
Table 2. Numerical results of flow cytometry analysis. Results are the mean value ± SD for at least three
replicated experiments. Each column named with Qi which includes data related to the quadrant that are Q1
(PI + and Annexin V-FITC - ) or Q1+Q2 (Q2 is the region for PI + and Annexin V-FITC + ) indicated percent value
of necrotic cells, and columns Q4 (PI - and Annexin V-FITC + ) or Q2+Q4 show percent values of apoptotic cells
(see text). Column Q3 (PI - and Annexin V-FITC - ) indicates percent value of normal cells. Column of G1, S
and G2/M represent the percent value of the cells placed in each related phase of cell cycle. NC, Dox and SU
are abbreviations for Negative Control, Doxorubicin and Sulfabenzamide, respectively.
Treated
cells
Q3 Q1 Q2 Q4 Q1+Q2 Q2+Q4 G1
S G2
NC 98.94±0.72 0.90±0.46 0.05±0.04 0.35±0.09 0.96±0.50 0.40±0.11 67.06±5.79 16.39±4.27 16.54±3.20
DOX 97.60±1.12 1.33±0.68 0.015±0.02 1.05±0.90 1.34±0.67 1.06±0.90 30.58±1.14 40.55±4.65 28.86±3.51
SU 98.58±0.56 0.27±0.19 0.09±0.08 0.86±0.57 0.37±0.1 0.96±0.54 48.80±4.28 27.47±4.39 22.70±3.79
48 Raziye MOHAMMADPOUR et al.
Caspase-3 activity was increased in the
sulfabenzamide and doxorubicin treated cells
Using caspase-3 specific substrate, subsequent
releasing of the fluorescent product (AFC) was
measured and average enzymatic velocity was
calculated (three independent experiments) as
16.6±1.42, 26.2±1.3 and 38.3±0.85 (∆F.h -1 , ∆F
means fluorescent intensity alteration) for untreated
cell, sulfabenzamide or doxorubicin treated cells,
respectively. Using the standard curve of free AFC,
enzymatic activity was calculated as 1.308±0.115,
2.07± 0.08 and 2.496± 0.11nM.h -1 , respectively
(Figure 3).
Comparing with untreated cells, caspase-3
activity was increased in drug treated samples.
Elevated activity of caspase-3, which is a sign of
apoptosis induction, is in contrast with the DNA
laddering results and is further discussed below.
Sulfabenzamide did not induce apoptosis but
induced a minimal shift from G1 to S and G2/M
phases of the cell cycle
Using flow cytometric analysis and Annexin-FITC
and PI staining, the incidence of apoptosis and
necrosis in untreated, sulfabenzamide, or
doxorubicin treated cells were quantified (Figure
4A and Table 2).
Congruent with graph interpretation methods
applied in most publications, the sum of cell
populations in regions Q2 (PI + and Annexin V-
FITC + ) and Q4 (PI - and Annexin V-FITC + ) were
considered as early and late apoptotic cells (Hsu et
al., 2006; Tyagi et al., 2006; Dowejko et al., 2009;
LaPensee et al., 2009). In addition, regions Q1 (PI +
and Annexin V-FITC - ) and Q3 (PI - and Annexin V-
FITC - ) indicated necrotic and unscathed
populations, respectively. In some publications, cell
percentages located in Q1 and Q2 (Q2 is the region
for PI + and Annexin V-FITC + ) quarters are
considered as necrotic cells (Davis et al., 2000). In
these studies, Q4 quarter (PI - and Annexin V-
FITC + ) represented the percentage of apoptotic
cells. Therefore, in Table 2 determination of
necrotic cells was performed separately via Q1, as
well as Q1+Q2, and the estimation for apoptotic
cells was carried out as Q2+Q4 as well as Q4, in
order to indicate that the low percentages of
apoptotic and necrotic cells observed was not
influenced by the applied analytical methods.
Flow cytometry is useful for calculating the
percentages of cells existing in various stages of the
cell cycle including G1, S and G2/M. To make a
practical use of this technique, cells were stained
with DAPI, which enters the nucleus and binds to
DNA and emanates fluorescent emission.
Although, no significant change in the normal
pattern of cell distribution throughout the cell cycle
was observed for sulfabenzamide treated cells (18%
shift from G1 to S and G2/M) a considerable
transition (37%) was detected from G1 to S (main
transition) and G2/M in cells incubated with
doxorubicin as positive control (Figure 4B and
Table 2).
Alterations in expression of proapoptotic,
prosurvival and autophagic genes in
sulfabenzamide and doxorubicin treated cells
The changes in expression level of apoptotic, cell
survival and autophagic genes were evaluated using
real time RT-PCR. With respect to the results
shown in Figure 5 as well as its insets it can be seen
that in sulfabenzamide treatments some apoptotic
genes (DFF-45 and DNA-PK ) were over expressed
while some others were down regulated (PARP1,
Bax, Bcl-2 and AIF) or retained their expression
level in a constant condition (DFF-40 and caspase-
3). Moreover, some critical genes which are
important in cell survival pathway were also down-
regulated (AKT1 and AKT2) or over expressed
(PTEN). Alterations in gene expression were
evaluated for some autophagic genes such as
ATG5, p53 and DRAM indicating higher amounts
of the related transcripts in drug treated cells
relative to the untreated ones. In doxorubicin
treated cells some apoptotic genes were focused
and their alterations including over expression of
caspase-3, DNA-PK, DFF-45 and Bax; down
regulation of DFF-40 and constant expression of
AIF and PARP1 were evaluated (Figure 5).
Sulfabenzamide promotes autophagic cell death 49
Figure 4. A) Two dimensional plots of Annexin V-FITC against PI related to the flow cytometric
experiments. Two dimensional diagrams from flow cytometric studies showed that the percentage of
apoptotic cells (cells located in the Q4 area or total cells in Q2 + Q4) and necrosis (cell located in Q1 or in
Q1+Q2) do not show dramatic differences compared with control cells. B) Effects of sodium sulfabenzamide
and doxorubicin on the cell cycle distribution. FL4-A indicates the area under the registered electrical signal
of each stained cell. The curves from left to right relate to G1, S, G2/M phases of the cell cycle in control,
doxorubicin or sodium sulfabenzamide treated samples.
50 Raziye MOHAMMADPOUR et al.
Figure 5. Quantitative real time RT-PCR analysis histograms. Real time RT-PCR for the selected genes for
sulfabenzamide (A) and Doxorubicin (B) treated T-47D cells were determined as described in Methods. The
relative amount of target material was quantified compared to the reference gene using the comparative Ct
(ΔΔCt) method. The statistical significant differences are indicated with * and ** for 0.01
independent of changes in the related mRNA level
(Figures 3 and 5). The increased activity of
caspase-3 was negated via overexpression of DFF-
45. DFF-45 is the natural inhibitor of DFF-40
(CAD) (Liu et al., 1997). In addition, the increased
expression of DFF-45, along with a modest
increase (for sulfabenzamide) and a significant
decrease (for doxorubicin) in DFF-40 expression
(Figure 5), indicated that the increased activity of
caspase-3 could be blocked by the increased
expression ratio of DFF-45/DFF-40. This r
the level of active DFF-40 to trigger DNA
fragmentation and appearance of apoptotic
symptoms. Furthermore, it has been reported that
caspases are activated during autophagy in dying
cells and are suppressed for apoptosis induction
(Martin et al., 2004; Yu et al., 2004). Therefore, it
can be d
of activated caspase-3 on their downstream
substrates (like DFF-40) should be suppressed by
special factors (e.g. DFF-45 in T-47D cells) only in
those cellular routes which are involved in the
appearance of apoptosis symptoms (e.g. DNA
fragmentation).
Cell cycle arrest, an important cellular target
affected by sulfabenzamide and doxorubicin, was
analyzed using flow cytometry. Incubation of T-
47D cells with 0.33 µM doxorubicin resulted in a
significant accumulation of cells in S phase, and to
a lesser extent in G2/M phase of the cell cycle
(Figure 4B and Table 2). Thus, doxorubicin exerts
its antiproliferative action mainly through cell cycle
arrest. Induced mitotic catastrophe following
increased activation of cyclinB1/Cdc2 may occur
while cells are delayed, particularly in G2 phase of
the cell cycle (Lindqvist et al., 2007). The induced
G2/M arrest along with down regulation of
cyclinB1 expression confirmed that anticancer
activity of doxorubicin is not via mitotic
catastrophe (Figure 5 and Table 2). In contrast to
doxorubicin, minimal cell cycle arrest in S and
G2/M phases (totally 18%) was observed in T-47D
cells incubated with
(Figure 4B and Table2). Thus, cell cycle arrest
could not be mainly responsible for a 50%
r
sulfabenzamide.
As we know, when apoptosis is blocked or
delayed autophagy triggered and vice versa. These
possibilities are consistent with our findings
regarding lack of apoptosis in drug treated cells and
induction of autophagy. The induced
overexpression of ATG5 supported that autophagy
Sulfabenzamide promotes autophagic cell death 51
triggered in the presence of sulfabenzamide (Figure
5). This could be probably occurred through the
increase in Bax activity working on mitochondrial
membrane to result in activation of caspase-3 for
PARP1 and DNA-PK deactivation and autophagy
induction. It has been reported that induction of
autophagy by PUMA (the p53-inducible BH3-only
protein) depends on Bax/Bak and can be
reproduced by overexpression of Bax (Yee et al.,
2009). Here, in doxorubicin treatment, increase in
Bax activity could be occurred in parallel with the
increment of Bax transcripts affecting on the cells
for caspase-3 activation and changing the cell's
destiny toward autophagy (Figure 5). This notion
could be also supplied in sulfabenzamide treatment
aside from the mild decrease in Bax expression
because activation of the existed Bax molecules in
the cells could be happened for caspase-3 activation
and autophagy induction (Figure 5). It has been
also reported that proteolytic cleavage of PARP1,
performed by caspase-3, produces specific
proteolytic cleavage fragments which are involved
in the cell’s decision to change its fate from
apoptosis toward autophagy (Munoz-Gamez et al.,
2009; Chaitanya et al., 20
autophagic cell death is dependent on DNA-PK
inhibition (Daido et al., 2005). Thus, the increased
activity of caspase-3 could finally deactivate
PARP1 (has a decreased and constant expression
level in sulfabenzamide and doxorubicin
treatments, respectively) and DNA-PK (has an
increased and invariable expression level in
sulfabenzamide and doxorubicin treatments,
respectively) until apoptosis was blocked and
autophagy induced (Figures 3 and 5).
Despite the existence of some controversies
regarding the possible role of autophagy in tumor
progression by promoting cell survival, autophagy
can exist as a backup mechanism promoting
cellular death when other mortality mechanisms are
not functional. Hyperactivation of autophagy above
the threshold point leads to unlimited self-eating of
the cells causing autophagy or type II programmed
cell death (Hoyer-Hansen et al., 2005; Maiuri et al.,
20
and AKT2 as well as upregulation of PTEN in
sulfabenzamide treated cells indicated that cell
survival pathways were slowed down (Figure 5). In
addition, down regulation of bcl-2 was happened
along with the induction of autophagy (Figure 5). It
has been reported that targeted silencing of bcl-2
expression (an anti-autophagic gene) in human
breast cancer cells with RNA-interference has
52 Raziye MOHAMMADPOUR et al.
promoted autophagic cell death and thus presents a
therapeutic potential (Akar et al., 2008).
p53 is involved in decreasing cell survival
potency through inactivation of AKT/mTOR
pathways, and stimulation of autophagy via
transactivation of DRAM (Maiuri et al., 2007).
Thus, the observed increased expression level of
DRAM and p53 genes support our conclusion that
the repression of AKT/mTOR survival pathway
(via p53 overexpression) and autophagy induction
(via increased DRAM transcripts) are responsible
for r
of death inducing autophagy in the presence of
sulfabenzamide (Figure 5). T -47D cells contain
only a single copy of the p53 missense mutation
(Schafer et al., 2000). It has been reported by
various studies that mutant p53 may lose its natural
antitumor activity (Lim et al., 2009). Interestingly,
in the presence of sulfabenzamide the antitumor
activities of mutant form of p53 should return to the
normal activities of the wild type form to induce
autophagic cell death. This is very similar to the
mechanism of action for some antitumor drugs
reactivating mutant p53 to kill cancerous cells
(Lambert et al., 2009).
Evidently, checking of the protein expression
levels using other supplementary methods such as
western blotting could provide us better documents
to support the presented real time RT-PCR data.
But, in our work, we found that the registered
alterations for the level of RNA transcripts were in
a good consistence with the expected cellular
behaviors when the proteins' expression levels or
their activities were theoretically going to become
changed in parallel with the RNA levels in the
cells. Therefore, regardless of some exceptions,
evaluating RNA transcripts could provide us an
adequate image illustrating the changes in the
proteins’ expression levels in the cells.
Conclusions
In summary, we showed that cell cycle arrest (and
possibly autophagy) may play a role in action of
doxorubicin on T-47D cells. However, the
contribution of apoptosis and cell cycle arrest
antiproliferative effect of sulfabenzamide on T-47D
cells is minimal. These observations are in contrast
to many reports in which the mechanism of action
of sulfonamide derivatives on cancer cells
attributed to the conventional processes of
apoptosis and cell cycle arrest. We believe that
induction of autophagic cell death in T-47D cells is
triggered through p53/DRAM pathway (occurred
along with decreasing of Akt/mTOR pathway) and
this is a reasonable cellular axis to justify our
results.
Abbreviations
AKT: v-akt murine thymoma viral oncogene
homolog, mTOR: Mechanistic Target Of
Rapamycin, PTEN: Phosphatase and Tensin
homolog, DRAM: Damage Regulated Autophagy
Modulator, ATG5:Autophagy related gene 5,
Beclin1: Bcl2 Interacting protein 1, PARP1: Poly
ADP-Ribose Polymerase 1, DFF-40/CAD: DNA
Fragmentation Factor 40/ Caspase-Activated
DNase, Bax: Bcl2-Associated X protein, Bcl-2: B-
Cell Lymphoma 2, AIF: Apoptosis Inducing
Factor, DFF-45/iCAD: DNA Fragmentation
Factor 45/inhibitor of Caspase-Activated DNase,
Cdc2: Cell Division Cycle protein 2, ARF: ADP
Ribosylation Factor, GAPDH: Glyceraldehyde-3-
Phosphate Dehydrogenase, ACD: Autophagic Cell
Death, PCDII: type II Programmed Cell Death,
RPMI: Roswell Park Memorial Institute.
Conflict of interest
The authors declare that they have no competing
interest.
Authors' contributions
SS designed the study and experiments, analyzed
and interpreted data and also prepared the
manuscript. RM carried out the experiments and
participated in data analysis as well as writing the
initial draft of the manuscript. SH and SF
participated in performing the experiments. NS
contributed on giving scientific comments and also
carried out final editing of the manuscript.
Acknowledgements
Iran National Science Foundation (INSF) and
Research Council of University of Tehran have
been gratefully appreciated by the authors because
of their foundational supports for this work.
References
Akar U, Chaves-Reyez A, Barria M, Tari A,
Sanguino A, Kondo Y, et al. Silencing of Bcl-2
expression by small interfering RNA induces
autophagic cell death in MCF-7 breast cancer
cells. Autophagy. 4: 669–679, 2008.
Alberts B, Johnson A, Lewis J, Raff M, Roberts K,
Walter P. Molecular Biology of the Cell.
Garland science Taylor & Francis Group, LLC,
UK, 1115-1130, 2008.
Brunelli E, Pinton G, Bellini P, Minassi A,
Appendino G, Moro L. Flavonoid-induced
autophagy in hormone sensitive breast cancer
cells. Fitoterapia. 80: 327-332, 2009.
Chaitanya GV, Steven AJ, Babu PP. PARP-1
cleavage fragments: signatures of cell-death
proteases in neurodegeneration. Cell Commun
Signal. 8:31-41, 20
Daido S, Yamamoto A, Fujiwara K, Sawaya R,
Kondo S, Kondo Y. Inhibition of the DNAdependent
protein kinase catalytic subunit
radiosensitizes malignant glioma cells by
inducing autophagy. Cancer Res. 65: 4368-
4375, 2005.
Davis JW, Melendez K, Salas VM, Lauer FT,
Burchiel SW. 2,3,7,8-Tetrachlorodibenzo-pdioxin
(TCDD) inhibits growth factor
withdrawal-induced apoptosis in the human
mammary epithelial cell line, MCF-
Carcinogenesis. 21: 881-886, 2000.
Dowejko A, Bauer RJ, Muller-Richter UDA,
Reichert TE. The human homolog of the
Drosophila headcase protein slows down cell
division of head and neck cancer cells.
Carcinogenesis. 30: 1678-1685, 2009.
Fukuoka K, Usuda J, Iwamoto Y, Fukumoto H,
Nakamura T, Yoneda T, et al. Mechanisms of
action of the novel sulfonamide anticancer
agents E7070 on cell cycle progression in
human non-small cell lung cancer cells. Inves
New Drugs. 19: 219-227, 2001.
Hoyer-Hansen M, Bastholm L, Mathiasen IS,
Elling F, Jaattela M. Vitamin D analog EB
triggers dramatic lysosomal changes and Beclin
1-mediated autophagic cell death. Cell Death
Differ. 12: 1297–1309, 2005.
Hsu CL, Yen GC. Induction of cell apoptosis in
3T3-L1 pre-adipocytes by flavonoids is
associated with their antioxidant activity. Mol
Nutr Food Res. 50:
Kondo Y, Kanzawa T, Sawaya R, Kondo S. The
role of autophagy in cancer development and
response to therapy. Nat Rev Mol Cell Biol. 5:
726-734, 2005.
Kondo Y, Kondo S. Autophagy and cancer therapy.
Autophagy. 2: 85-90, 2006.
Sulfabenzamide promotes autophagic cell death 53
Lambert JMR, Gorzov P, Veprintsev DB,
Söderqvist M, Segerbäck, D, Bergman J et al.
PRIMA-1 reactivates mutant p53 by covalent
binding to the core domain. Cancer Cell. 15:
376-388, 2009.
LaPensee EW, Schwemberger SJ, LaPensee CR,
Bahassi E, Afton SE, Ben-Jonathan N. Prolactin
confers resistance against cisplatin in breast
cancer cells by activating glutathione-Stransferase.
Carcinogenesis. 30: 1298-1304,
2009.
Lim LY, Vidnovic N, Ellisen LW, Leong C-O.
Mutant P53 mediates survival of breast cancer
cells. Brit J Cancer.
Lindqvist A, Van Zon W, Karlsson Rosenthal C,
Wolthuis RMF. Cyclin B1–Cdk1 activation
continues after centrosome separation to control
mitotic progression. PLoS Biol. 5: 1127-1137,
2007.
Liu X, Zou H, Slaughter C, Wang X. DFF, a
heterodimeric protein that functions
downstream of caspase-3 to trigger DNA
fragmentation during apoptosis. Cell. 8: 175-
184, 1997.
Maiuri MC, Galluzzi L, Morselli E, Kepp O, Malik
SA, Kroemer G. Autophagy regulation by p53.
Curr Opin Cell Biol. 22: 181–185, 20
Maiuri MC, Zalckvar E, Kimchi A, Kroemer G.
Self-eating and self-killing: crosstalk between
autophagy and apoptosis. Nat Rev Mol Cell
Biol. 8: 741-752, 2007.
Martin DN, Baehrecke E. Caspases function in
autophagic programmed cell death in
Drosophila. Development. 131: 275- 284, 2004.
Mohan R, Banerjee M, Ray A, Manna T, Wilson L,
Owa T et al. Antimitotic sulfonamides inhibit
microtubule assembly dynamics and cancer cell
proliferation. Biochemistry. 45: 5440-5449,
2006.
Munoz-Gamez A, Rodriguez-Vargas JM, Quiles-
Perez R, Aguilar-Quesada R, Martin-Oliva D,
de Murcia G et al. PARP-1 is involved in
autophagy induced by DNA damage.
Autophagy. 5: 61-74, 2009.
Owa T, Yoshino H, Okauchi T, Yoshimatsu K,
Ozawa Y, Sugi NH, et al. Discovery of novel
antitumor sulfonamides targeting G1 phase of
54 Raziye MOHAMMADPOUR et al.
the cell cycle. J Med Chem. 42:3789-3799,
1999.
Ozawa Y, Sugi NH, Nagasu T, Owa T, Watanabe
T, Koyanagi N et al. E7070, a novel
sulphonamide agent with potent antitumour
activity in vitro and in vivo. Eur J Cancer. 37:
2275-2282, 2001.
Schafer JM, Lee ES, O'Regan RM, Yao K, Jordan
VC. Rapid development of tamoxifenstimulated
mutant p53 Breast Tumors (T47D) in
athymic mice. Clin Cancer Res. 6: 4373-4380,
2000.
Supuran CT, Casini A, Scozzafava A. Protease
inhibitors of the sulfonamide type: Anticancer,
antiinfammatory, and antiviral agents. Med Res
Rev. 23: 535-558, 2003.
Supuran CT. Indisulam: an anticancer sulfonamide
in clinical development. Expert Opin Investig
Drugs. 12: 283-287, 2003.
Tyagi A, Singh RP, Agarwal C, Agarwal R.
Silibinin activates p53-caspase2 pathway and
causes caspase-mediated cleavage of Cip1/p21
in apoptosis induction in bladder transitionalcell
papilloma RT4 cells: evidence for a
regulatory loop between p53 and caspase 2.
Carcinogenesis. 27: 2269-2280, 2006.
Valley AW, Balmer CM. Pharmacotherapy: A
Pathophysiologic Approach. Appleton &
Lange, CT. 1957-2012, 1999.
Yee KS, Wilkinson S, James J, Ryan KM, Vousden
KH. PUMA and Bax-induced autophagy
contributes to apoptosis. Cell Death Differ. 16:
1135–1145, 2009.
Yokoi A, Kuromitsu J, Kawai T, Nagas T, Sugi
NH, Yoshimatsu K, et al. Profiling novel
sulfonamide antitumor agents with cell-based
phenotypic screens and array-based gene
expression analysis. Mol Cancer Ther. 1: 275-
286, 2002.
Yokoyama T, Kondo Y, Bogler O, Kondo S. Drug
Resistance in Cancer Cells (Mehta, K. and
Siddik, Z.H., eds). Springer Science+Business
Media, LLC: PA. 53-71, 2009.
Yu L, Lenardo MJ, EH Baehrecke Autophagy and
caspases: a new cell death program. Cell Cycle.
3:1124-1126, 2004.
Yu SW, Wang H, Poitras MF, Coombs C, Bowers
WJ, Federoff HJ et al. Mediation of poly (ADPribose)
polymerase-1-dependent cell death by
apoptosis-inducing factor. Science. 297: 259-63,
2002.
Journal of Cell and Molecular Biology
Haliç University, Printed in Turkey.
http://
Media optimization for amylase production in solid state
fermentation of wheat bran by fungal strains
Muhammad IRFAN*, Muhammad NADEEM, Quratualain SYED
Food & Biotechnology Research Center (FBRC), Pakistan Council of Scientific & Industrial Research
(PCSIR) Laboratories Complex, Ferozpure Road Lahore, Pakistan.
(* author for correspondence; mirfanashraf@yahoo.com)
Received: 02 April 2012; Accepted: 30 May 2012
Abstract
The present study is concerned with the optimization of environmental and cultural conditions for the
production of α-amylase from wheat bran in solid state fermentation by locally isolated strains of Aspergillus
niger- ML-17 and Rhizopus oligosporus-ML-
Erlenmeyer flask. Different parameters were optimized for each strain to obtain maximum enzyme yield. For
Aspergillus niger-ML-17, incubation period of 96 h, initial diluent pH of 5.0, 30°C incubation temperature,
inoculum size of 5% were found to be optimum for the production of α-amylase. Amylase production was
enhanced from 2.3 ± 0.014 IU to 4.4 ± 0.042 IU by supplementing the fermentation media with maltose
(0.25%), yeast extract (0.25%), NaNO3 (0.25%), MgSO4 (0.2%), NaCl (0.5%), Tween-80 (0.001%) and
Asparginine (0.0001%) . In case of Rhizopus oligosporus-ML-
production of 2.5 ±0.023 IU were inoculum size of
of 35 o C for 96h. Further addition of maltose (25%), yeast extract (0.25%), NH4NO3 (0.25%), MgSO4 (0.2%),
NaCl (0.75%), Tween soluble starch (0.001%) and asparginine (0.0001%) to the medium significantly
enhance the enzyme production up to 3.2 ± 0.027 IU.
Keywords: Amylase, wheat bran, A.niger, R.oligosporus, solid state fermentation
Buğday kepeği katı hal fermentasyonunda mantar suşlarıyla amilaz üretimi için besiyeri
optimizasyonu
Özet
Bu çalışma yerel olarak izole edilen Aspergillus niger- ML-17 ve Rhizopus oligosporus-ML-
tarafından buğday kepeği katı hal fermentasyonunda amilaz üretimi için çevre ve kültür koşullarının
optimizasyonuyla ilgilidir. Tüm fermentasyon süreci 250 ml erlende yapılmıştır. Maksimum enzim ürünü
elde etmek amacıyla her suş bir için farklı parametreler optimize edilmiştir. Aspergillus niger- ML-17 için 96
saat inkübasyon süresi, çözücünün başlangıç pH’sı olarak 5.0, 30°C inkübasyon sıcaklığı, % 5 ekim
büyüklüğü α- amilaz üretimi için optimum bulunmuştur. Amilaz üretimi fermentasyon ortamına maltoz
(%0,25), maya özütü (% 0,25), NaNO3 (% 0,25), MgSO4 (% 0,2), NaCl (% 0,5), Tween-80 (% 0,001) ve
asparajin (% 0,0001) eklenmesiyle 2,3 ± 0,014 IU’ dan 4,4 ± 0,042 IU’ ya artmıştır. Rhizopus oligosporus-
ML-
başlangıç pH’sı 5,0, inkübasyon sıcaklığı 35°C, 96 saat olacak şekildedir. Besiyerine maltoz (25%), maya
özütü (0.25%), NH4NO3 (0.25%), MgSO4 (0.2%), NaCl (0.75%), Tween çözünür nişasta (0.001%) ve
Asparginine (0.0001%) eklenmesi enzim üretimini önemli ölçüde artırarak 3.2 ± 0.027 IU seviyesine
ulaştırmıştır.
Anahtar kelimeler: Amilaz, buğday kepeği, A.niger, R.oligosporus, katı hal fermentasyonu
56 Muhammad IRFAN et al.
Introduction
Amylases are a group of hydrolases that can
specifically cleave the O-glycosidic bonds in
starch. Two important groups of amylases are
glucoamylase and α-amylase. Glucoamylase (exo-
1,4-α-D-glucan glucanohydrolase, E.C. 3.2.1.3)
hydrolyzes single glucose units from the nonr
ends of amylose and amylopectin in a
stepwise manner (Anto et al., 2006). Whereas αamylases
(endo-1,4-α-D-glucan glucohydrolase,
E.C. 3.2.1.1) are extracellular enzymes that
randomly cleave the 1,4-α-D-glucosidic linkages
between adjacent glucose units inside the linear
amylose chain (Anto et al., 2006, Castro et al.,
20
Alpha-amylases are widely distributed in nature
and can be derived from various sources such as
plants, animals and microorganisms (Pandey et al.,
2005, Reddy et al., 2003 3-4). However, fungal and
bacterial amylases have predominant applications
in the industrial sector. Major advantage of using
fungi for the production of amylases is the
economical bulk production capacity and ease of
manipulation. Many species of Aspergillus and
Rhizopus are used as a source of fungal α-amylase
(Pandey et al., 2005).
Usually amylase production from fungi has
been carried out using well defined chemical media
by submerged fermentation (SMF) and solid state
fermentation (SSF) in recent times (Miranda et al.,
1999). The economics of enzyme production using
inexpensive raw materials can make an industrial
enzyme process competitive (Couto and Sanroman,
2006).
For the microbial α-amylase production, two
types of fermentation methods are mainly used i.e.
submerged and solid state (Norouzian et al., 2006).
Submerged fermentation (SmF) is comparatively
advanced and commercially important enzymes are
traditionally produced by this method (Hashemi et
al., 20
is an old technology and has been used since 2600
BC. However, in recent year SSF has emerged as a
well developed biotechnological tool for the
production of enzymes (Bhatnagar et al., 20
Nowadays, spectrum of applications of αamylase
is also extending in many other areas such
as analytical chemistry, clinical and medicinal
diagnosis e.g. diagnosis of acute inflammation of
pancreas, macroamylasemia, perforated pelvic ulcer
and mumps (Anto et al., 2006, Nimkar et al., 20
Chimata et al., 20
this study we reported here the process
optimization for amylase production from two
fungal species i.e. Aspergillus niger-ML-17 and
Rhizopus oligosporus-ML-
solid substrate fermentation.
Materials and Methods
Substrate
Wheat bran was procured from local market of
Lahore city and was used as a substrate for amylase
production in solid state fermentation.
Microorganism and culture maintenance
Fungal strain of Aspergillus niger-ML-17 and
Rhizopus oligosporus-ML-
the Microbiology Laboratory of Food and
Biotechnology Research Center (FBRC), PCSIR
Laboratories Complex, Lahore. The culture was
maintained on Potato-Dextrose-Agar (PDA) slants.
The slants were grown at 30°C for 5 days and
stored at 4°C.
Inoculum preparation
sporulated 5 days old PDA slant culture. An
inoculum needle was used to dislodge the spore
clusters under sterilized conditions and then it was
shaken thoroughly to prepare homogenized spore
suspension.
Solid-state fermentation
salt solution containing (g/L) KH2PO4
NaCl 2 and MnSO4 0.5 was taken in 250 mL cotton
plugged Erlenmeyer flask, mixed homogenously
and sterilized at 121°C for 15 min in an autoclave.
Thereafter, the flask material was cooled at room
temperature and inoculated with 1 mL spore
suspensions of Aspergillus niger-ML-17 and
Rhizopus oligosporus-ML-
incubated at 30°C for 5 days.
Optimization of cultural and nutritional parameters
Various process parameters were optimized for
maximal enzyme production such as fermentation
period (24-168 h), incubation temperature (20-
40°C), initial pH (4-8), inoculum size (2, 5, 7,
13, 15, 17%). Experiments were also performed to
evaluate the influence of different carbon sources
(maltose, glucose, galactose, lactose, sucrose,
arabinose, cellulose, soluble starch) and nitrogen
sources (yeast extract, peptone, tryptone, urea,
ammonium citrate, ammonium phosphate,
NH4NO3, (NH4)2SO4, NH4Cl and NaNO3) different
metal salts (MnCl2, ZnCl2, CaCl2, MgSO4, FeSO4),
NaCl concentration (0.25-2.0%), surfactants
(Tween-80, Triton-X-
sulphate, sodium lauryl sulphate) and different
amino acids (asparginine, aspartic acid, proline,
cystine, arginine ) on α-amylase production under
the optimized fermentation conditions.
Recovery of enzyme
After the specified incubation period (in each case),
50 mL of distilled water was added in each flask
containing fermented mash and placed on a shaker
at 200 rpm for 60 min. Afterward, the mixture was
filtered and centrifuged at 8,000 rpm for 15 min at
4°C to remove the fungal spores and unwanted
particles. The clear supernatant thus obtained after
centrifugation was used as a source of crude
enzyme.
Alpha amylase activity
The activity of α-amylase was assayed as described
earlier (Irfan et al., 2011) by incubating 0.5 mL of
the diluted enzyme with 0.5 mL soluble starch (0.5
%, w/v) prepared in 0.1 M sodium Phosphate
buffer, pH= 7. After incubation at 60 ºC for
minutes the reaction was stopped and the r
sugars released were assayed colorimetrically by
the addition of 1 mL of 3-5-dinitrosalicylic acid
reagent. One enzyme activity unit (U) was defined
as the amount of enzyme releasing 1 µmol of
maltose from the substrate in 1 minute at 60 ºC.
Statistical analysis
All the data was statistically (SD) analyzed by
using Microsoft excel computer programme.
Results
Amylase production in solid state fermentation 57
The most widely used enzyme in the industry for
starch hydrolysis is α-amylase. These enzymes
account for 65 % of enzyme market in the world
(Muralikrishna et al., 2005). For the production of
commercially important enzymes, selection of a
particular strain remains a tedious task. Amylolytic
enzymes are commonly produced by filamentous
fungi preferably from species of Aspergillus and
Rhizopus (Pandey et al., 2005).
Time course study for the production of αamylase
Figure 1 depicts the time course study (24-120 h)
for the production of α-amylase by Aspergillus
niger-ML-17 and Rhizopus oligosporus-ML-
using solid state fermentation. Optimum
fermentation period of 96 h was best for both
Aspergillus niger-ML-17 (4.7 ±0.14 IU) and
Rhizopus oligosporus-ML-
solid state fermentation. Further increase in the
incubation period decreased the enzyme secretion.
Therefore, incubation time of 96 h was selected as
optimum time for the production of α-amylase in
the subsequent experimental work. Maximum
accumulation of α-amylase occurs during stationary
phase. Further increase in incubation period
decreased the production of α-amylase. It might be
due to the deficiency of nutrients, accumulation of
toxic substances and proteolysis of α-amylase as
interpreted by many workers (Chamber et al., 1999,
Shafique et al., 2009). Abu et al., (2005) also
reported maximum α-amylase production by
Aspergillus niger after an incubation period of 96 h.
Figure 1. Time course study of amylase production (Error bars represent the SD among replicates).
58 Muhammad IRFAN et al.
Effect of initial pH of diluent on α-amylase
production
The effect of different initial pH (4-6.5) of the
diluent on α-amylase production by Aspergillus
niger-ML-17 and Rhizopus oligosporus-ML-
using SSF is shown in figure 2. Enzyme production
was maximum (3.7±0.015 IU) when initial pH of
the diluent was adjusted at 5.0 using strains of
A.niger-ML-17 in SSF. When strain of
R.ologosporus –ML-
production, it gave better yield (2.7 ± 0.016 IU) at
6.0 initial pH of the diluent. Further increase in the
initial pH of the diluent resulted decreased in the
enzyme activity. It is due to the fact that fungal
growth was optimum at this pH and hence the
enzyme production. Initial pH of the medium is
known to affect the synthesis and secretion of αamylase.
Alpha amylase production by microbial
strains strongly depends on the extracellular pH as
it influences many enzymatic reactions as well as
the transport of various components across the cell
membrane (Ellaiah et al., 2002). In contrast to the
present findings, Alva et al. (2007) achieved the
optimal α-amylase production at initial pH 5.8 by
Aspergillus sp. Conversely, this might be because
the requirement of slightly acidic pH for optimum
growth of fungi (Liu et al., 2008, Sun et al., 2009).
Figure 2. Effect of initial pH of diluents on amylase production (Error bars represent the SD among
replicates)
Effect of temperature on the production of αamylase
Figure 3 showed the effect of varying incubation
temperature (20-40ºC) on the production of αamylase
by Aspergillus niger-ML-17 and
R.oligosporus-ML-
production (3.5 ±0.034 IU) was obtained in
fermentation flask that was incubated at 30ºC after
the conidial inoculation of A.niger-ML-17. On the
other hand R.oligosporus-ML-
enzyme production (2.5 ±0.023 IU) at 35 o C. All the
other flasks that were incubated on temperatures
other than these gave comparatively less production
of α-amylase. Alpha amylase production by fungi is
related to the growth which sequentially depends
upon the incubation temperature. Many other
researchers have also reported 30°C as optimum
temperature for the fungal growth and enzyme
production. This is because the enzyme production
is growth associated and 30°C is optimum
temperature for fungi and subsequently α-amylase
production (Shafique et al., 2009, Dakhmouche et
al., 2006).
Amylase production in solid state fermentation 59
Figure 3. Effect of incubation temperature on amylase production (Error bars represent the SD among
replicates).
Effect of inoculum size on the production of αamylase
Effect of inoculum size was checked by varying the
concentration of spores of A.niger-ML-17 and
R.oligosporus-ML-
wheat bran. Optimum inoculum size of 5% (3.5
±0.014 IU) and
ML-17 and R.oligosporus-ML-
yield of enzyme production respectively as shown
in figure 4. By increasing the size of inoculum
resulted in decreased enzyme production. Increased
inoculum size resulted in increases moisture level
which ultimately decreased the fungal growth and
enzyme production (Sharma et al., 1996). Ammar
and El-Safey (2003) obtained highest yield of
amylase production from A. flavus var columnaris
using inoculum size of 0.0637 x
another study 5 x
maximum enzyme production by Aspergillus niger
ATCC 16404 (Dakhmouche et al., 2006). Zambare
(20
1693 U/gdfs) at inoculum level of 5-8% (v/w) in
solid state fermentation using strain of A.oryzae.
Figure 4. Effect of inoculum size on amylase production (Error bars represent the SD among replicates).
Effect of different carbon sources on the
production of α-amylase
Different carbon sources i.e. soluble starch,
glucose, galactose, lactose, arabinose, cellulose,
maltose and sucrose were also evaluated for the
production of α-amylase (Figure 5). A.niger-ML-
17 better used the maltose as a carbon source and
improved enzyme production (4.4 ± 0.042 IU) as
compared to control while soluble starch (3.2 ±
0.027 IU) was found best carbon source for
amylase production in case of R.oligosporus-ML-
comparatively less enzyme production which is
supplemented to the fermentation medium at
concentration of 0.25% (w/v). Therefore, soluble
starch and maltose was optimized as a carbon
source in the further experimental work
R.oligosporus-ML-
respectively. Many other workers also reported
starch as the best carbon source for the production
of alpha amylase (Gigras et al., 2002, Dharani
2004). It is because α-amylase is an extracellular
enzyme and its production is increased by its
substrate (Chimata et al., 20
2009).
60 Muhammad IRFAN et al.
Figure 5. Effect of different carbon sources on amylase production (Error bars represent the SD among
replicates).
production by employing strains of A.niger-ML-17
Effect of different nitrogen sources on the
and R.oligosporus-ML-
production of α-amylase
used as an optimized organic nitrogen sources in
Figure 6 depicts the effect of nitrogen sources this further research. Hashemi et al., (20
(peptone, urea, tryptone, casein, skimmed milk and obtained maximum α-amylase production (140
yeast extract NH4SO4, NH4NO3, NaNO3, U/g) with NH4NO3 but at a level of 1% (w/v).
ammonium citrate & ammonium phosphate) on the Amylase production is enhanced with the addition
production of α-amylase by Aspergillus niger-ML- of organic nitrogen sources (Hamilton et al., 1999,
17 and R.oligosporus-ML-
the selected inorganic nitrogen sources maximum et al., 2006, Pederson and Neilson 2000, Oshoma et
amylase production (3.9 ±0.1IU) was obtained, al., 20
when NaNO3 (0.25%, w/v) was used in medium extract as an organic nitrogen source produces
inoculated with spores of A.niger-ML-17 while the maximum amylase production. Pederson and
strain R.oligosporus-ML-
IU) NH4NO3 at concentration of 0.25% for amylase amylase productivity by A. oryzae.
production. In case of organic nitrogen sources
yeast extract was found better for amylase
Figure 6. Effect of nitrogen sources on amylase production (Error bars represent the SD among replicates).
Effect of different metal salts on amylase
production in SSF
Different metal salts (MnCl2, ZnCl2, CaCl2, MgSO4
and FeSO4) were added to the fermentation
medium to enhance the amylase yield by A.niger-
ML-17 and R.oligosporus-ML-
fermentation. Results (Fig. 7) revealed that addition
of MgSO4 at 0.1% concentration to the medium
favored the enzyme production by both tested
fungi. Of all the metal salts FeSO4 lowers the
enzyme production as compared to control.
Rameshkumar and Sivasudha (2011) reported that
supplementation of 0.1% CaCl2 as a mineral source
to the medium effectively increased the amylase
production by B.subtilis in solid state fermentation.
According to Negi and Banerjee (20
HgCl2 to the medium increases the amylase
production up to 2.44 folds. Most of the study
indicated that the enzyme did not require a specific
ion for their proper functioning (Reyed 2007).
Sanghvi et al., (2011) produced amylase from
Chrysosporium asperatum in submerged
fermentation and reported that supplementation of
FeCl3 in the medium as a mineral source slightly
increased the amylase production.
Amylase production in solid state fermentation 61
Figure 7. Effect of different metal salts on amylase production (Error bars represent the SD among
replicates).
Effect of different concentration of NaCl on
amylase production in SSF
In this experiment, different concentrations of NaCl
(0.25-2.0 %) were employed to check the effect of
different concentration of NaCl on amylase
production by A.niger-ML-17 and R.oligosporus-
ML-
17 showed maximum (3.6 ±0.17 IU) enzyme
production at 0.5% concentration of NaCl in the
medium while R.oligosporus-ML-
maximum titer of amylase (2.5± 0.13 IU) at 0.75%
concentration of NaCl. By increasing the NaCl
concentration beyond this decline in enzyme
production was observed. Kokab et al., (2003)
produced amylase from Bacillus subtilis in solid
state fermentation having medium containing 1.5%
concentration of NaCl. Patel et al., (2005) purified
and characterized the amylase enzyme from
A.oryzae in SSF having medium with 0.1%
concentration of NaCl.
Figure 8. Effect of different concentrations of NaCl on amylase production (Error bars represent the SD
among replicates).
Effect of surfactants on amylase production
Figure 9 illustrated the effect of different
surfactants on amylase production by A.niger –ML-
17 and R.oligosporus-ML-
addition of Tween 80 (0.05 v/w) to the medium is
effective in enzyme production by both A.niger-
ML-17 (3.7 IU) and R.oligosporus-ML-
in SSF. SDS and SLS had no strong influence on
enzyme production in solid state fermentation by
tested fungi. Negi and Banerjee (20
that Triton-X-
the stimulator for enzyme production but sodium
laurate sulphate increased amylase production by
1.28 folds. Gupta et al. (2008) also reported that
different surfactants like Tween-80, Triton X-
and SDS had strong influence on amylase
production in submerged fermentation using
Aspergillus niger. Vu et al. (2011) stated that use of
Tween-80 as a surfactant effectively enhances the
cellulose production in solid state fermentation.
Production of hydrolytic enzymes can be enhanced
by the surfactants and fatty acids (Singh et al.,
1991). When surfactants are added, they enhance
the microbial growth in SSF by promoting the
penetration of water into the solid substrate matrix,
leading in an increase of surface area (Asgher et al.,
2006).
62 Muhammad IRFAN et al.
Figure 9. Effect of different surfactants on amylase production (Error bars represents the SD among
replicates).
Effect of different amino acids on amylase
production in SSF
To check the effect of different amino acids on
amylase production, various amino acids like
asparaginine, aspartic acid, praline, cysteine and
arginine were evaluated by A.niger –ML-17and
R.oligosporus-ML-
revealed that supplementation of asparginine with
concentration of 0.0001% favored enzyme
production in solid state fermentation. Rest of the
amino acids showed no significant effect on
enzyme production.
Sidkey et al. (20
from natural environment and screened for amylase
production. Among various screened strains
Aspergillus flavus was found to be potent amylase
producer when supplementations of methionine as
an amino acid cotent to the medium. Some workers
(Moustafa, 2002; Sidkey et al., 1996) reported that
acidic amino acids like glutamic and aspartic acids
are the best inducers for amylase production.
Figure
replicates).
References
Abu EA, Ado SA, James DB. Raw starch
degrading amylase production by mixed culture
of Aspergillus niger and Saccharomyces
cerevisiae grown on Sorghum pomace. Afr J
Biotechnol. 4(8): 785- 790, 2005.
Alva S, Anumpama J, Savla J, Chiu YY, Vyshali
P, Shruti M, Yogeetha BS, Bhavya D, Purvi J,
Ruchi K, Kumudini BS, Varalakshmi KN.
Production and characterization of fungal
amylase enzyme isolated from Aspergillus sp.
JGI 12 in solid state culture. Afri J Biotechnol.
6(5):576-581, 2007.
Ammar MS and El-Safey EM. Production of αamylase
enzyme produced by Aspergillus flavus
var. columnaris, S-9KP from maize meal and
rice husk under solid-state fermentation (SSF)
conditions in open air. International Conference
of Enzymes in the Environment, Activity,
Ecology and Applications, Praha, Czech
Republic, July 14-17, pp.33, 2003.
Anto H, Trivedi UB and Patel KC. Glucoamylase
production by solid-state fermentation using
rice flake manufacturing waste products as
substrate. Bioresource Technol. 97(
1166, 2006.
Asgher M, Asad MJ, Legge RL. Enhanced lignin
peroxidase synthesis by Phanerochaete
chrysosporium in solid state bioprocessing of a
lignocellulosic substrate. World J Microb
Biotechnol. 22:449-53, 2006.
Bhatnagar D, Joseph L, Raj RP. Amylase and acid
protease production by solid state fermentation
using Aspergillus niger from mangrove swamp.
Indian J Fish. 57(1):45-51, 20
Castro AM, Carvalho DF, Freire DMG, Castilho
LR. Economic analysis of the production of
amylases and other hydrolases by Aspergillus
awamori in solid-state fermentation of babassu
cake. SAGE-Hindawi Access to Research
Enzyme Research, 1, 9, 20
Chamber R, Haddaoui E, Petitglatran MF, Lindy O,
Sarvas M. Bacillus subtilis α-amylase. The rate
limiting step of secretion is growth phase in
dependent. FEMS Microbiol Lett. 173 (1):127-
131, 1999.
Chimata MK, Sasidhar P, Challa S. Production of
extracellular amylase from agricultural residues
by a newly isolated Aspergillus species in solid
state fermentation. Afri J Biotechnol.
9(32):5162-5169, 20
Couto SR and Sanroman MA. Application of solidstate
fermentation to food industry. J Food Eng.
76:291-302, 2006.
Dakhmouche S, Gheribi-Aoulmi Z, Meraihi Z,
Bennamoun L. Application of a statistical
design to the optimization of culture medium
for a-amylase production by Aspergillus niger
ATCC 16404 grown on orange waste powder. J
Food Eng. 73 (2):190-197, 2006.
Dharani APV. Effect of C:N ratio on alpha amylase
production by Bacillus licheniformis SPT 27
Afr. J. Biotech., 3: 519-522, 2004.
Ellaiah PK, Adinarayana Y, Bhavani P and
Padmaja B. Optimization of process parameters
for glucoamylase production under solid state
fermentation by a newly isolated Aspergillus
species. Process Biochem. 38:615–620, 2002.
Gigras P, Sahai V, Gupta R. Statistical media
optimization and production of ITS alpha
amylase from Aspergillus oryzae in a
bioreactor. Current Microbiol. 45:203–208,
2002.
Amylase production in solid state fermentation 63
Gupta A, Gupta VK, Modi DR, Yadava LP.
Production and characterization of alpha
amylase from Aspergillus niger. Biotechnology.
7(3):551-556, 2008.
Hamilton LH, Kelly CT, Fogarty WM. Production
and properties of the raw starch-digesting αamylase
of Bacillus species IMD 435. Process
Biochem. 35(1–2):27–31, 1999.
Hashemi M, Shojaosadati SA, Razavi SH, Mousavi
SM, Khajeh K, Safari M. The efficiency of
temperature shift strategy to improve the
production of α-Amylase by Bacillus sp. in a
solid-state fermentation system. Food and
Bioprocess Technol. 5(3):
Hayashida S, Teamoto Y, Inove T. Production and
characteristics of raw potato Starch digesting
amylase from Bacillus subtilis. 65. Appl
Environ Microbiol. 54: 1516-1522, 1998.
Irfan M, Nadeem M, Syed Q, Baig S. Production
of thermostable α-amylase from Bacillus sp. in
solid state fermentation. J Appl Sci Res.
7(5):607-617, 2011.
Kokab S, Asghar M, Rehman K, Asad MJ, Adedyo
O. Bio-Processing of Banana Peel for α-
Amylase Production by Bacillus subtilis. Int J
Agr Biol. 5, 1, 2003.
Liu XD and Xu Y. A novel raw starch digesting αamylase
from a newly isolated Bacillus sp. YX-
1, Purification and characterization.
Bioresource Technol. 99: 4315-4320, 2008.
Miranda OA, Salgueiro AA, Pimental NCB,
Limafilho JJ, Melo EHM, Duran N. Lipase
production by a Brazilian strain of Penicillium
citrinium using industrial residue. Bioresource
Technology 69 : 145-149, 1999.
Moustafa OA. Thermostable alpha-amylase(s) from
irradiated microbial origin utilizing agricultural
and environmental wastes under solid state
fermentation conditions. M.Sc. Thesis. Al-Azhar
University, 2002.
Muralikrishna G and Nirmala M. Cereal αamylases-an
overview. Carbohydrate Polym.
60: 163-173, 2005.
Negi S and Banerjee R. Optimization of culture
parameters to enhance production of amylase
and protease from Aspergillus awamori in a
single fermentation. Afric J Biochem Res.
2(3):73-80, 20
64 Muhammad IRFAN et al.
Nimkar MD, Deogade NG, Kawale M. Production
of alpha-amylase from Bacillus subtilis &
Aspergillus niger using different agro waste by
solid state fermentation. Asiatic J Biotechnol
Res. 01:23-28, 20
Norouzan D, Akbarzadeh A, Scharer JM, Young
MM. Fungal glucoamylases. Biotechnol Adv.
24(1): 80-85, 2006.
Oshoma CE, Imarhiagbe EE, Ikenebomeh MJ,
Eigbaredon HE. Nitrogen supplements effect on
amylase production by Aspergillus niger using
cassava whey medium. Afri J Biotechnol. 9
(5):682-686, 20
Pandey A, Webb C, Soccol CR, Larroche C.
Enzyme Technology, New Delhi, Asiatech
publishers, Inc. 197, 2005.
Pederson H and Nielsen J. The influence of
nitrogen sources on the α-amylase productivity
of Aspergillus oryzae in continuous cultures.
Appl Microb Biotechnol. 53(3): 278-281, 2000.
Patel AK, Nampoothiri MK, Ramachandaran S.
Partial purification and characterization of αamylase
produced by Aspergillus oryzae using
spent brewing grains. Indian J Biotechnol.
4:336-341, 2005.
Rameshkumar A, Sivasudha T. Optimization of
Nutritional Constitute for Enhanced Alpha
amylase Production Using by Solid State
Fermentation Technology. Int J Microb Res. 2
(2):143-148, 2011.
Reddy AS, Jharat R, Byrne N. Purification and
properties of amylase from A review. J Food
Biochem. 21:281-302, 2003.
Reyed RM. Biosynthesis and properties of
extracellular amylase by encapsulation
Bifidobatrium bifidum in batch culture.
Australian J Basic Appl Sci. 1: 7-14, 2007.
Sanghvi GV, Rina DK, Kishore SR. Isolation,
Optimization, and Partial Purification of
Amylase from Chrysosporium asperatum by
Submerged Fermentation. J Microb Biotechnol.
21(5):470–476, 2011.
Shafique S, Bajwa R, Shafique S. Screening of
Aspergillus niger and A. flavus strains for extra
cellular α-amylase activity. Pak J Bot.
41(2):897-905, 2009.
Sharma DK, Tiwari M, Behere BK. Solid state
fermentation of new substrates for production of
cellulase and other biopolymer hydrolyzing
enzymes. Appl Biochem Biotechnol. 15:495-
500, 1996.
Sidkey NM, Abo-Shadi MA, Al-Mutrafy AM,
Sefergy F, Al-Reheily N. Screening of
Microorganisms Isolated from some Enviro-
Agro-Industrial Wastes in Saudi Arabia for
Amylase Product. J American Sci. 6(
939, 20
Sidkey NM, Shash SM, Ammar MS. Regulation of
α-amylase biosynthesis by Aspergillus sp. ,S-7
attaching the Nile Hyacinth homogenate
produced under laboratory scale fermentation
conditions. Al-Azhar Bullutin Sci. 7(1):437-488,
1996.
Singh A, Abidi AB, Darmwal NS, Agrawal AK.
Influence of nutritional factors of cellulase
production from natural lignocellulosic residues
by Aspergillus niger. Agri Biol Res. 7:19-27,
1991.
Sun H, Ge X, Wang L, Zhao P, Peng M.
Microbial production of raw starch digesting
enzymes. Afr J Biotechnol. 8 (9):1734-1739,
2009.
Varalakshmi KN, Kumudini BS, Nandini BN,
Solomon J, Suhas R, Mahesh B, Kavitha AP.
Production and characterization of α-amylase
from Aspergillus niger JGI 24 isolated in
Bangalore. Polish J Microbiol. 58: 29-36,
2009.
Valaparla VK. Purification and properties of a
thermostable α-amylase by Acremonium
Sporosulcatum. Int J Biotechnol Biochem.
6(1):25–34, 20
Vu VH, Pham TA, Kim K. Improvement of fungal
cellulase production by mutation and
optimization of solid state fermentation.
Mycobiology. 39(1): 20-25, 2011.
Zambare V. Solid state fermentation of Aspergillus
oryzae for Glucoamylase Production on Agro
residues. Int J Life Sci. 4:16-25, 20
Journal of Cell and Molecular Biology - GUIDELINES for AUTHORS
General
Journal of Cell and Molecular Biology
(JCellMolBiol) is an international journal which
covers original works in the field of cell biology,
molecular biology, genetics, microbiology,
neurobiology, bioinformatics and related topics.
The official language of the journal is English,
however manuscripts in Turkish are accepted as
well.
Conditions for publication
This journal publishes research articles, review
articles, short communications, book/software
reviews, case reports and letters to the editor.
Research articles: Only original contributions will
be accepted which have not been published
previously. Manuscripts should not exceed 15
papers of printed text, including tables, figures and
references
Review articles: Reviews of recent developments in
a research field and ideas will be accepted.
Manuscripts should not exceed 15 papers of printed
text. Illustrations are encouraged.
Short communications: These include small-scale
investigations or innovative methods, techniques,
clinical trials and epidemiological studies. It should
not exceed 3 pages.
Letters to editor: These include opinions, news and
suggestions. Letters should not exceed 2 papers of
printed text.
Case Reports: These include individual
observations based on small numbers of subjects.
This type of research cannot indicate causality but
may indicate areas for further research.
REVISED
December 2011
Manuscripts should be submitted by e-mail to:
Journal of Cell and Molecular Biology
Haliç Üniversitesi
Fen Edebiyat Fakültesi
Moleküler Biyoloji ve Genetik Bölümü
Sıracevizler Cad. No:29
Bomonti-Şişli 34381, İstanbul-TÜRKİYE
Tel: +90 212 343 08 87, Fax: +90 212 231 06 31
E-Mail:
65
Book/software reviews: Short but concise
description of the book/software, not exceeding a
page. Book/software reviews are not peer reviewed.
Presentation
Papers should be typed clearly, double-spaced with
3 cm wide margins.
Manuscripts should be prepared using Word
Processor.
Cover Letter: You may briefly explain your work
and its contribution to present knowledge.
Title Page: The first page of your manuscript
should be a title page containing the type of paper;
the title; all authors' full names, and affiliations;
and the corresponding author's contact address
(including phone and fax numbers) and e-mail
address. The title should be as short as possible, but
should give adequate information regarding the
contents. Authors should also state a running title
of no more than 50 characters including spaces.
All pages must be numbered.
The full paper should be divided into the following
parts in the order indicated:
66
Abstract: A brief, informative abstract, not
exceeding 200 words, should be provided in
English and in Turkish. For authors who are not
native Turkish speakers, JCellMolBiol can provide
the Turkish abstract.
Keywords: Immediately following the abstract,
authors should provide 5 keywords or phrases that
reflect the content of the article.
Introduction should include theory, hypotheses,
prior work
Material and methods may include subheadings
Results: If the study consists of different parts,
subheadings in this section should be consistent
with subheadings in the methods.
Discussion
Acknowledgements should precede the list of
references
References: Papers cited in the manuscript should
be listed in alphabetical order according to the first
author's surname.
Tables and Figures
• Tables and figures should both be embedded
within the text in their appropriate positions and be
submitted separately.
• Electronically submitted figures are preferred in
*.jpg or *.tiff (min. 300 dpi) formats. Bar scales
should be drawn directly on the figures when
necessary. Figure legends should not be included in
the *jpg or *tif files.
• Each table should be accompanied by a short
instructive title line plus an explanatory caption at
the top. Indicate footnotes within tables by
superscript letters and type footnotes below the
table.
• All the tables and figures must be referred to
within the text.
Units, Abbreviations and Scientific Names
• Only SI units should be used. Current
abbreviations can be used without explanation,
others must be explained.
• All acronyms/abbreviations must be explained
in parenthesis after their first occurrence. If many
unfamiliar acronyms/abbreviations are used, please
REVISED
December 2011
compile them in an "Abbreviations" section at the
end of the paper.
• Latin expressions should be typed in italics.
Referencing
• In the text, citations with two authors should
take the form: Smith and Robinson,1990. If several
papers are cited by the same author in the same
year, they should be lettered in sequence (1990a),
(1990b), etc. When papers are by more then two
authors they should be cited as Smith et al.,1990. In
cases where more than one reference is written for
the same sentence, they should appear in ascending
publication order, e.g. (Jones et al., 2005; Smith et
al., 2007; Brown et al., 2009).
• In the list, references must be placed in
alphabetical order. The following models for the
reference list cover all situations. The punctuation
given must be exactly followed. The journal titles
should be abbreviated appropriately.
Redford IR. Evidence for a general relationship
between the induced level of DNA double
strand breakage and cell killing after Xirradiation
of mammalian cells. Int J Radiat
Biol. 49: 611- 620, 1986.
Tccioli CE, Cottlieb TM, Blund T. Product of the
XRCCS gene and its role in DNA repair and
V(D)J recombination. Science. 265: 1442-1445,
1994
Ohlrogge JB. Biochemistry of plant acyl carrier
proteins. The Biochemistry of Plants: A
Comprehensive Treatise. Stumpf PK and Conn
EE (Ed). Academic Press, New York. 137-157,
1987.
Brown LA. How to cope with your supervisor. PhD
Thesis. University of New Orleans, 2005.
Web document with no author: Leafy seadragons
and weedy seadragons 2001. Retrieved
November 13, 2002, from http:// www.
windspeed.net.au/jenny/seadragons/
Web document with author: Dawson J, Smith L,
Deubert K. Referencing, not plagiarism.
Retrieved October 31, 2002 from http:
//studytrekk.lis.curtin.
• Only papers published or in press should be
cited in the literature list. Unpublished results,
including submitted manuscripts and those in
preparation, should be indicated as unpublished
data in the text.
Submission Policies and Authorship
Upon submission of a manuscript, it is accepted
that all co-authors have approved the contents of
the manuscript and its submission by the
corresponding author, and that the corresponding
author is authorized to represent all co-authors in
pre-publication discussions with JCellMolBiol.
The corresponding author is responsible for
ensuring that all the contributors to the relevant
work are listed as authors and that all authors have
aggreed to the manuscript’s content and its
submission to the JCellMolBiol. In case the Journal
happens to be aware of an authorship dispute,
authorship must be approved in writing by all of the
parties.
Cost
There are no submission fees or page charges.
Criteria for the Selection of Manuscripts
Manuscripts should meet the following criteria: The
study conducted is material is original and ethical,
the writing is clear; the study methods are
appropriate, the data are valid, the conclusions are
reasonable and supported by the data; the
information is important; and the topic is
interesting to our readership.
Editorial Processes
Researchers may request informal feedback from
the editors in a particular manuscript. The
presubmission process aids in the submission
decision for authors.
When JCellMolBiol receives a manuscript, the
Editor-in-Chief will first decide whether the
manuscript meets the formal criteria specified with
“Guidelines for Authors” and whether it fits within
the scope of the Journal. In case of doubt on the
basis of initial review, the Editor-in-Chief will
consult other members of the Editorial Board.
Manuscripts that are found suitable for peer review
will be assigned to two expert reviewers. Reviewers
may either be Editorial/Advisory Board members
or external experts selected by the Editorial Board.
The corresponding author is notified by e-mail
when the editor decides to send a paper for review.
The reviewers will have up to three weeks to
review the submitted article. After peer review, the
editor will contact the author. If the author is
required to submit a revised version, the revised
version has to be submitted by the author within
REVISED
December 2011
67
two weeks. Otherwise, the manuscript will be
removed from the manuscript submission queue
and will be considered rejected.
In cases where the referees have requested welldefined
changes to the manuscript, editors may
request a revised manuscript that addresses to
referees’ concerns. The revised version is sent back
to the original referees for re-review. In cases
where the referees’ concerns are more wideranging,
editors may reject the manuscript. The
revised manuscript should be accompanied by a
cover letter that includes a point-by-point response
to referees’ comments and an explanation of how
the manuscript has been changed.
As a matter of policy, we do not suppress referees’
reports, any comments directed to authors are
transmitted regardless of what we may think of the
content. On rare occasions, we may edit a report to
remove offensive language or comments to reveal
confidentiality.
The final decision to accept or reject a manuscript
will be made by the Editor-in-Chief. If it becomes
apparent that there are serious problems with the
scientific content or with violations of our
publishing policies, the Editor-in-Chief also
reserves the right to reject a paper even after it has
been accepted.
After acceptance, the Editor-in-Chief may make
further changes to the text and figures so that the
manuscript is readable and clear. Page proofs will
be sent to the corresponding author via email for
checking before publication. Corresponding authors
are sent proofs and are welcome to discuss
proposed changes with the Editor-in-Chief, but
JCellMolBiol reserves the right to make the final
decision about the style. Corrected proofs should be
sent back within three days of receipt, otherwise the
Editor-in-Chief reserves the rights to correct the
proofs himself and to send the material for
publication. In cases where the authors do not
submit the appropriately signed Publication
Agreement Form, the manuscript is drawn from
publication process even if it is accepted.
Appeals
Authors have the right to ask the Editor-in-Chief to
reconsider a rejection decision, which is considered
an appeal. Decisions are reversed only if the Editor
is convinced that the original decision was a serious
mistake. If an appeal merits further consideration,
the Editor may send the author’s response or the
revised paper to one or more referees, or Editor
68
may ask one referee to comment on the concerns
raised by another referee.
Advance Online Publication
JCellMolBiol provides Advance Online Publication
of articles, which benefit authors with an earlier
publication date and allows the readers’ access to
accepted papers several weeks before they appear
in print
Ethical Issues
For manuscripts reporting experiments on live
vertebrates or higher invertebrates, authors must
declare that the study was approved by the
institutional ethics committee. Papers describing
investigations on human subjects must include a
statement that informed consent was obtained from
all subjects.
Plagiarism
If portions of the manuscript have already been
published by the author on other journals or
websites, JCellMolBiol Editorial Board needs to
know which portions of the manuscript have been
previously published and where. The author should
include a note in the cover letter indicating which
portions have been published elsewhere.
In case of any suspicion on scientific misconduct or
dishonesty in research, JCellMolBiol reserves the
right to forward any submitted manuscript to an
appropriate authority for investigation.
Copyright Notice
It is the responsibility of the submitting author to
ensure that the authorship of the paper reflects the
contributions of the authors to the work described,
and that all listed authors have agreed to the
submission of the manuscript in its current form.
Conditions of publication in JCellMolBiol are that
the paper has not already been published elsewhere;
that it is not currently being considered for
publication else-where; all persons designated as
authors should qualify for authorship, and all those
who qualify should be listed. If accepted, Haliç
University and JCellMolBiol have the exclusive
license to publish.
JCellMolBiol is freely available to individuals and
institutions. Copies of this Journal and articles in
this journal may be distributed for research or for
REVISED
December 2011
commercial use of articles contained herein is
prohibited without the written consent of the
Editor-in-Chief.
Publication Agreement
The corresponing author is required to assign the
Publication Agreement Form in order to publish the
submitted manuscript in JCellMolBiol.
Journal of Cell and
Review Article
Molecular Biology
Production and industrial applications of laccase enzyme
M. IMRAN, M.J. ASAD, S.H. HADRI, S. MEHMOOD
Research Articles
Isolation and biochemical identification of Escherichia coli from wastewater effluents of food
and beverage industry
T. FARASAT, Z. BILAL, F. YUNUS
Investigation of the MGP promoter and exon 4 polymorphisms in patients with ischemic
stroke in the Ukrainian population
A.V. ATAMAN, V.Y. GARBUSOVA, Y.A. ATAMAN, O.I. MATLAJ, O.A. OBUCHOVA
Investigation of the association of survivin gene -625G/C polymorphism in non-small cell
lung cancer
E. AYNACI, E. COŞKUNPINAR, A. EREN, O. KUM, Y. M. OLTULU, N. AKKAYA, A.
TURNA, İ. YAYLIM, P. YILDIZ
Effects of prenatal and neonatal exposure to lead on white blood cells in Swiss mice
R. SHARMA, K. PANWAR, S. MOGRA
Sulfabenzamide promotes autophagic cell death in T-47D breast cancer cells through p53/
DRAM pathway
R. MOHAMMADPOUR, S. SAFARIAN, S. FARAHNAK, S. HASHEMINASL, N. SHEIBANI
Media optimization for amylase production in solid state fermentation of wheat bran by
fungal strains
M. IRFAN, M. NADEEM, Q. SYED
Guidelines for Authors
1
13
19
27
33
41
55
65
![Download entire Journal volume [PDF] - Global and International ...](https://img.yumpu.com/21518781/1/190x245/download-entire-journal-volume-pdf-global-and-international-.jpg&quality=85)
![[PDF mobi ePub] Vittorio Storaro: Writing with Light: Volume 1: The Light Full PDF](https://documents.yumpu.com/000/064/057/592/edae0db39050fa84f9f3bfc141935e3d5832ee3d/303765417865457348677a51744858634e72493052413d3d/697a54476e486f675950394d6647476a56506f5371413d3d.jpg?AWSAccessKeyId=AKIAICNEWSPSEKTJ5M3Q&Expires=1619107200&Signature=ZRBC6%2F8WOyBYfP9V7xK9atGM8j4%3D)
Change language