10 1 Full Volume (PDF)(jcmb.halic.edu.tr) - Journal of Cell and ...

Journal of Cell and 

Molecular Biology 

• Sulfabenzamide promotes autophagy through p53/ DRAM pathway 

MGP polymorphisms in ischemic stroke 

<strong>Volume</strong> <strong>10</strong> · No 1· June 2012 

http://<strong>jcmb</strong>.<strong>halic</strong>.<strong>edu</strong>.tr 

Survivin -625G/C polymorphism in non-small cell lung cancer



<strong>Volume</strong> <strong>10</strong> · Number 1 

June 2012 

İstanbul-TURKEY

Haliç University 

Faculty of Arts and Sciences 

Journal of Cell and Molecular Biology 

Founder 

Gündüz GEDİKOĞLU 

Our Children Leukemia Foundation 

Rights held by 

A. Sait SEVGENER 

Rector 

Correspondence Address: 


Haliç Üniversitesi 

Fen-Edebiyat Fakültesi, 

Sıracevizler Cad. No:29 Bomonti 34381 Şişli 

İstanbul-Turkey 

Phone: +90 212 343 08 87 

Fax: +90 212 231 06 31 

E-mail: <strong>jcmb</strong>@<strong>halic</strong>.<strong>edu</strong>.tr 

Journal of Cell and Molecular Biology is 

indexed in 

ULAKBIM, EBSCO, 

DOAJ, EMBASE, 

CAPCAS, EMBiology, 

Socolar, Index COPERNICUS, 

Open J-Gate, Chemical Abstracts 

and 

Genamics JournalSeek 

ISSN 1303-3646 

Printed at MART Printing House 

Editor-in-Chief 

Nagehan ERSOY TUNALI 

Editorial Board 

M. YOKEŞ 

Baki 

ÖZDİLLİ 

Kürşat 

Nural BEKİROĞLU 

Emel BOZKAYA 

M.Burcu IRMAK YAZICIOĞLU 

Mehmet OZANSOY 

Aslı BAŞAR 

Editorial Assistance 

Ozan TİRYAKİOĞLU 

Özlem KURNAZ 

Advisory Board 

A.Meriç ALTINÖZ, Istanbul, Turkey 

Tuncay ALTUĞ, İstanbul, Turkey 

Canan ARKAN, Munich, Germany 

Aglaia ATHANASSIADOU, Patras, Greece 

E. Zerrin BAĞCI, Tekirdağ, Turkey 

Şehnaz BOLKENT, İstanbul, Turkey 

Nihat BOZCUK, Ankara, Turkey 

A. Nur BUYRU, İstanbul, Turkey 

Kemal BÜYÜKGÜZEL, Zonguldak, Turkey 

Hande ÇAĞLAYAN, İstanbul, Turkey 

İsmail ÇAKMAK, İstanbul, Turkey 

Ayla ÇELİK, Mersin, Turkey 

Adile ÇEVİKBAŞ, İstanbul, Turkey 

Beyazıt ÇIRAKOĞLU, İstanbul, Turkey 

Fevzi DALDAL, Pennsylvania, USA 

Zihni DEMİRBAĞ, Trabzon, Turkey 

Gizem DİNLER DOĞANAY, İstanbul, Turkey 

Mustafa DJAMGÖZ, London, UK 

Aglika EDREVA, Sofia, Bulgaria 

Ünal EGELİ, Bursa, Turkey 

Anne FRARY, İzmir, Turkey 

Hande GÜRER ORHAN, İzmir, Turkey 

Nermin GÖZÜKIRMIZI, İstanbul, Turkey 

Ferruh ÖZCAN, İstanbul, Turkey 

Asım KADIOĞLU, Trabzon, Turkey 

Maria V. KALEVITCH, Pennsylvania, USA 

Nevin Gül KARAGÜLER, İstanbul, Turkey 

Valentine KEFELİ, Pennsylvania, USA 

Meral KENCE, Ankara, Turkey 

Fatma Neşe KÖK, İstanbul, Turkey 

Uğur ÖZBEK, İstanbul, Turkey 

Ayşe ÖZDEMİR, İstanbul, Turkey 

Pınar SAİP, Istanbul, TURKEY 

Sevtap SAVAŞ, Toronto, Canada 

Müge TÜRET SAYAR, İstanbul, Turkey 

İsmail TÜRKAN, İzmir, Turkey 

Mehmet TOPAKTAŞ, Adana, Turkey 

Meral ÜNAL, İstanbul, Turkey 

İlhan YAYLIM ERALTAN, İstanbul, Turkey 

Selma YILMAZER, İstanbul, Turkey 

Ziya ZİYLAN, İstanbul, Turkey


CONTENTS 

<strong>Volume</strong> <strong>10</strong> · Number 1 · June 2012 

Review Article 

Production and industrial applications of laccase enzyme 

M. IMRAN, M.J. ASAD, S.H. HADRI, S. MEHMOOD 

Research Articles 

Isolation and biochemical identification of Escherichia coli from 

wastewater effluents of food and beverage industry 

T. FARASAT, Z. BILAL, F. YUNUS 

Investigation of the MGP promoter and exon 4 polymorphisms in 

patients with ischemic stroke in the Ukrainian population 

A.V. ATAMAN, V.Y. GARBUSOVA, Y.A. ATAMAN, O.I. MATLAJ, 

O.A. OBUCHOVA 

Investigation of the association of survivin gene -625G/C polymorphism 

in non-small cell lung cancer 

Survivin geni -625G/C polimorfizminin Küçük Hücreli Dışı Akciğer 

Kanseri ile ilişkisinin araştırılması 

E. AYNACI, E. COŞKUNPINAR, A. EREN, O. KUM, Y. M. OLTULU, N. 

AKKAYA, A. TURNA, İ. YAYLIM, P. YILDIZ 

Effects of prenatal and neonatal exposure to lead on white blood cells in 

Swiss mice 

R. SHARMA, K. PANWAR, S. MOGRA 

Sulfabenzamide promotes autophagic cell death in T-47D breast cancer 

cells through p53/ DRAM pathway 

R. MOHAMMADPOUR, S. SAFARIAN, S. FARAHNAK, S. 

HASHEMINASL, N. SHEIBANI 

Media optimization for amylase production in solid state fermentation 

of wheat bran by fungal strains 

M. IRFAN, M. NADEEM, Q. SYED 

Guidelines for Authors 

Front cover image: “DNA strands on abstract” 

Shutterstock image ID: 704<strong>10</strong>25 

1 

13 

19 

27 

33 

41 

55 

65

Journal of Cell and Molecular Biology <strong>10</strong>(1): 1-11, 2012 Review Article 1 

Haliç University, Printed in Turkey. 



Muhammad IMRAN *1,2 , Muhammad J. ASAD 1 , Saqib H. HADRI 1 and Sajid 

MEHMOOD 2 

1 Department of Biochemistry, Pir Mehr Ali Shah Arid Agriculture University, Rawalpindi, Pakistan 

2 Department of Biochemistry and Biotechnology, University of Gujrat, Pakistan 

(* author for correspondence; mirzaimran42@gmail.com) 

Received: 22 April 2011; Accepted: 15 May 2012 

Abstract 

Laccase is an enzyme that has potential ability of oxidation. It belongs to those enzymes, which have innate 

properties of reactive radical production, and its utilization in many fields has been ignored because of its 

unavailability in the commercial field. There are diverse sources of laccase producing organisms like 

bacteria, fungi and plants. Textile, pulp and paper industries discharge a huge quantity of waste in the 

environment, and the disposal of this waste is a big problem. To solve this problem, work has done to 

discover such an enzyme, which can detoxify these wastes and is not harmful to the environment. Laccases 

use oxygen and produce water as by product. They can degrade a range of compounds including phenolic and 

non-phenolic compounds. They also have ability to detoxify a range of environmental pollutants. Their 

property to act on a range of substrates and also to detoxify a range of pollutants have made them to be 

usable for several purposes in many industries including paper, pulp, textile and petrochemical industries. 

Keywords: Laccase, solid state fermentation, oxidation, enzyme, fungi. 

Lakkaz enziminin üretimi ve endüstriyel uygulamaları 

Özet 

Lakkaz, potansiyel oksidasyon yeteneği olan bir enzimdir. Reaktif radikal üretim özelliği olan enzimlere 

dahildir ve birçok alandaki kullanımı, ticari alanda uygun olmaması nedeniyle göz ardı edilmektedir. Bakteri, 

mantar ve bitki gibi lakkaz üreten çeşitli organizma kaynakları vardır. Tekstil, kağıt hamuru ve kağıt 

endüstrisi çevreye büyük miktarda atık salmaktadır ve bu atıkların uzaklaştırılması büyük bir problemdir. Bu 

sorunu çözmek üzere, atıkları detoksifiye eden ve çevreye zararlı olmayan bir enzim keşfetmek için 

çalışmalar yapılmıştır. Bu enzim oksijen kullanır ve yan ürün olarak su üretir. Lakkaz, fenolik ve fenolik 

olamayan bileşikleri içeren bir dizi bileşiği parçalayabilir. Ayrıca, bir dizi çevresel kirleticiyi detoksifiye 

etme yeteneği vardır. Çeşitli substratlar üzerine etki etme ve ayrıca bir dizi kirliliği detoksifiye etme özelliği, 

bu enzimleri çeşitli amaçlarla tekstil, kâğıt hamuru, kâğıt ve petrokimya endüstrisini kapsayan birçok 

endüstride kullanılabilir kılmaktadır. 

Anahtar kelimeler: Lakkaz, katı hal fermentasyonu, oksidasyon, enzim, mantarlar. 

Introduction 

Laccase was first discovered in the sap of the 

Japanese lacquer tree Rhus vernicifera, and its 

characteristic as a metal containing oxidase was 

discovered by Bertrand in 1985 (Giardina et al., 

20<strong>10</strong>). Since then, laccases have also been found in 

various basidiomycetous and ascomycetous fungi 

and thus far fungal laccases have accounted for the 

most important group of multicopper oxidases 

(MCOs) with respect to number and extent of 

characterization (Giardina et al., 20<strong>10</strong>). 

The large quantity of laccases have been widely 

reported inside white-rot fungi. A number of

2Muhammad IMRAN et al. 

laccase genes have been isolated and distinguished 

for this purpose (Mayer and Staples, 2002). The 

improvement in laccase appearance, characterized 

by an increase in protein and mRNA level, was 

illustrated with Picnoprus cinnabarinus, Pleurotus 

sajor caju and Trametes versicolor (Eggert et al. 

1996, Solden and Dobson 2001, Collins and 

Dobson 1997). 

A number of species of genus Pleurotus have 

been explained as manufacturers of laccase 

(Leonowicz et al. 2001). We freshly reported that a 

strain of P. pulmonarius produce laccase as the 

main ligninolytic enzymes while cultured on wheat 

bran solid state medium (Souza et al. 2002). In the 

current study, numerous phenolic and aromatic 

compounds structurally related to lignin were 

calculated for their capability to arouse laccase 

production by P. pulmonarius. (Solden and 

Dobson, 2001). 

P. pulmonarius was proficient of mounting on a 

wide variety of phenolic and aromatic compounds. 

Laccase production by P. pulmonarius could be 

considerably improved by including an equimolar 

combination of ferulic acid and vanillin as inducer. 

The construction of different laccase isoform in 

reply to phenolics implicates a possible task of this 

enzyme in the detoxification processes (Souza et 

al., 2002) 

Numerous white-rot fungi, counting Trametes 

versicolor, make extra cellular copper-containing 

phenol oxidases (E C 1.<strong>10</strong>.3.2), named laccases 

(Birhanli and Yesilada, 2006). The two major likely 

natural functions attributed to fungal laccases are, 

first, their participation in lignin degradation, 

mutually with supplementary ligninolytic enzymes 

such as peroxidases, and second, their function in 

fungal virulence as key cause in pathogenesis in 

opposition to plant hosts (Gianfreda et al., 1999). 

As well, laccases display in vivo other functions 

that are the foundation of several industrial 

applications. For instance, in Aspergillus nidulans, 

laccases take action on pigment development in 

fungal spores (Smith et al., 1997). A number of 

fungi also ooze laccases to take away either 

potentially toxic phenols released through lignin 

degradation or toxins formed by others organisms. 

As a result, the enzyme has probable applications in 

the textile industries, dye, as well as for the 

degradation of a variety of xenobiotics, which are 

recognized as ecological pollutants (Rama et al. 

1998, Jolivalt et al. 1999, Mougin et al., 2000). 

Laccase-producing fungi have also been 

reported to be helpful apparatus for xenobiotic 

removal in liquid effluents as well as in soil 

bioremediation (Gianfreda et al. 1999, Jolivalt et al. 

2000). Our outcomes demonstrate that the resulting 

alteration products themselves are likely to 

encourage biological effects moreover on 

degrading or non-target organisms. So, an entire 

characterization of these compounds is essential for 

an entire assessment of the remediation processes 

(Souza et al., 2002). 

Laccase represents a family of coppercontaining 

polyphenol oxidases (PPO) & are 

usually called multicopper oxidases (MCO) 

(Birhanli and Yesilada, 2006; Arora and Sharma, 

20<strong>10</strong>; Giardina et al., 20<strong>10</strong>). Laccases catalyze the 

oxidation of various substituted phenolic 

compounds by using molecular oxygen as the 

electron acceptor (Sharma et al., 2007). These 

enzymes have less substrate specificity and have 

the ability to degrade a range of xenobiotics 

including industrial colored wastewaters (Souza et 

al., 2006). 

Laccases exhibit broad substrate range, which 

varies from one laccase to another. Although it is 

known to be diphenol oxidase, monophenols like 2, 

6-dimethoxy phenol or guaiacol are better 

substrates than phenols (e.g., catechol or 

hydroquinone) (Baldrian, 2006; Arora and Sharma, 

20<strong>10</strong>). 

Laccases catalyze monoelectronic oxidation of 

molecules to corresponding reactive radicals with 

the help of four copper atoms, which form the main 

catalytic core of the laccase, accompanied with the 

diminution of oxygen to water molecules and 

simultaneous oxidation of substrate to produce 

radicals (Arora and Sharma, 20<strong>10</strong>). All substrates 

cannot be directly oxidized by laccases, either 

because of their large size which restricts their 

penetration into the enzyme active site or because 

of their particular high redox potential. To 

overcome this hindrance, suitable chemical 

mediators are used which are oxidized by the 

laccase and their oxidized forms are then able to 

interact with high redox potential substrate targets 

(Arora and Sharma, 20<strong>10</strong>). 

In fungi, laccases carry out a variety of 

physiological roles including morphogenesis, 

fungal plant pathogen/host interaction, stress 

defense, and lignin degradation (Gianfreda et al., 

1999; Giardina et al., 20<strong>10</strong>). Laccases have been 

found in nearly all woodrotting fungi analyzed so 

far (Heinzkill and Messner, 1997; Giardina et al., 

20<strong>10</strong>) and are almost ubiquitary enzymes as they 

have been isolated from plants, from some kinds of 

bacteria, and from insects too (Enguita et al., 2003; 

Sharma et al., 2007; Giardina et al., 20<strong>10</strong>).

Laccase has many applications in other fields, 

like medical diagnosis, pharmaceutical industry. 

Laccase has also applications in the agriculture area 

by clearing herbicides, pesticides and some 

explosives in soil. It is also used in the preparation 

of some important drugs, like anticancer drugs, and 

added in some cosmetics to r<strong>edu</strong>ce their toxicity. 

Laccase also has the ability to form polymers of 

value able importance (Couto and Herrera, 2006). 

Solid state fermentation (SSF) is a technique in 

which fungi are grown on solid substrate or 

substrate moistened with a low quantity of mineral 

salt solution and it has a great potential to produce 

enzyme especially where the fermented raw 

materials are used as a source of nutrients for the 

fungi. The enzymes produced by this method have 

several applications in several fields including food 

and fermentation industry. These enzymes are also 

used to prepare several bioactive compounds. SSF 

system is much better than the submerged system 

because a number of reasons. The benefits of SSF 

over SMF include the high production of the 

enzyme, and fewer effluent generation. Moreover, 

comparably simple equipment is required for SSF 

(Pandey, 1994). 

Neurospora is a genus of kingdom fungi that 

has become a popular experimental model 

organism (Davis et al., 2002). Laccases have 

copper atoms at their catalytic sites and are 

oxidative enzymes (EC 1.<strong>10</strong>.3.2) which are widely 

found in many species of fungi, where they are 

involved in lignin degradation, in higher plants 

where they are involved in biosynthesis of lignin 

(Mayer and Staples, 2002; Sharma and Kuhad, 

2008), in bacteria (Claus, 2003; Liers et al., 2007), 

and in insects (Litthauer et al., 2007). Some species 

of fungi and insects produce laccases as 

intracellular proteins, but most of the laccases are 

produced as extracellular proteins by all other types 

of producers (Arora and Sharma, 20<strong>10</strong>). 

Laccase production in various organisms 

Production of laccase in fungi 

Laccase production occurs in various fungi over a 

wide range of taxa. Fungi from the deuteromycetes, 

ascomycetes (Aisemberg et al., 1989) as well as 

basidiomycetes are the known producers of laccase 

(Sadhasivam et al., 2008). Among them, 

basidiomycetes are considered efficient laccase 

producers, especially white rot fungi (Revankar and 

lele, 2006; Sadhasivam et al., 2008). Laccase 

production has not been reported in lower fungi, 

Production and industrial applications of laccase 3 

i.e., Zygomycetes and Chytridiomycetes. However, 

these groups have not yet been studied in detail 

(Arora and Sharma, 20<strong>10</strong>). 

Trametes versicolor, Chaetomium 

thermophilum and Pleurotus eryngii are well 

known producers of laccase. It has been reported 

that some Trichoderma species, including T. 

harzianum has the ability to produce polyphenol 

oxidases (Kiiskinen et al., 2004; Sadhasivam et al., 

2008). 

Laccase has been produced by many species of 

soft, white rot fungi, geophilous saprophytic fungi. 

Laccase has also been produced by many edible 

mushrooms including the oyster mushroom 

Pleurotus ostreatus, the rice mushroom Lentinula 

edodes and champignon Agaricus bisporus. Other 

laccase producers of wood-rotting fungi include T. 

hirsuta (C. hirsutus), T. villosa, T. gallica, Cerrena 

maxima, Lentinus tigrinus, T. ochracea, Pleurotus 

eryngii, Trametes (Coriolus) versicolor, 

Coriolopsis polyzona, etc. (Morozova et al., 2007). 

In fungal physiology, laccases are involved in plant 

pathogenesis, pigmentation, detoxification, lignin 

degradation (Sadhasivam et al., 2008) and also in 

development of morphogenesis of fungi (Baldrian, 

2006; Morozova et al., 2007). 

Laccases of wood-colonizing basidiomycetes 

(white rot fungi) have been thoroughly studied (not 

least also with respect to laccase-mediator 

interaction), and many of them purified and 

characterized on the protein and gene level (Liers et 

al., 2007). 

Mishra et al. (2008) have used cyanobacterial 

biomass of water bloom, groundnut shell (GNS) 

and dye effluent as culture medium for the 

production of laccase by Coriolus versicolor. They 

found the laccase production to be <strong>10</strong>.15±2.21 

U/ml in the medium having groundnut shell and 

cyanobacterial bloom in a ratio of 9:1 (dry weight 

basis) at initial pH 5.0 and 28±2 o C temperature. 

Half life of enzyme was 74 min at 60 o C. Kinetic 

analysis of laccase with ABTS were also 

determined, Km and Vmax were found to be 0.29mM 

and 9.49mol/min respectively. Azide and 

hydroxylamine exerted significant inhibition on 

production of thermostable laccase. 

It is reported that Phanerochaete chrysosporium 

NCIM 1197 also secretes extracellular laccase. 

They also studied effect of several inducers on the 

production of laccase. Among several inducers 

tested copper sulphate has the greatest tendency to 

enhance the produce of laccase. Laccase production 

increased 3.5 fold in the presence of copper sulfate


as compared to control. Laccase production under 

SSF, batch fermentation in a laboratory scale 

bioreactor and static liquid culture was also 

compared. The maximum production of laccase 

was achieved after five days and it was found to be 

48.89±1.82 U/L, 30.21±1.66 and 22.56±1.22 U/L, 

respectively (Gnanamani et al., 2006). 

The white-rot fungus Trametes pubescens MB 

89 is a source of the laccase production at industrial 

level. Extracellular laccase formation is 

considerably enhanced by the addition of Cu (II) in 

the low quantities in the simple glucose medium. 

When using glucose, a typically repressing 

substrate, as the main carbon source, significant 

laccase formation by T. pubescens only started 

when glucose was completely consumed from the 

culture medium. In addition, the nitrogen source 

employed had an important effect on laccase 

synthesis. When using an optimized medium 

containing glucose (40 g/L), peptone from meat (<strong>10</strong> 

g/L), and MgSO4.7H2O and stimulating enzyme 

formation by the addition of 2.0 mM Cu, maximal 

laccase activities obtained in a batch cultivation 

were approximately 330 U ml – l (Galhaup et al., 

2002). 

Production of laccase in plants 

Laccases are a diverse group of multi-copper 

proteins with broad substrate specificity, originally 

discovered in the exudates of Rhus vernicifera, the 

Japanese lacquer tree and subsequently 

demonstrated as a fungal enzyme as well (Sharma 

and Kuhad, 2008). The plants in which the laccase 

enzyme has been detected include lacquer, mango, 

mung bean, peach, pine, prune, and sycamore 

(Arora and Sharma, 20<strong>10</strong>). Techniques are also 

being developed to express laccase in the crop 

plants. Recently, laccase has been expressed in the 

embryo of maize (Zea mays) seeds (Bailey et al., 

2004; Arora and Sharma, 20<strong>10</strong>). 

Laccase is envolved in polymerization of lignin 

units; p coumaryl, coniferyl, sinapyl alcohols and in 

the synthesis of lignin in the plants (Morozova et 

al., 2007). If the comparison between plant and 

fungal laccases is taken up, the former takes part in 

radical-based polymerization of lignin (Ranocha et 

al., 2002; Arora and Sharma, 20<strong>10</strong>), whereas fungal 

laccase contributes to lignin biodegradation due to 

which it has gained considerable significance in 

green technology (Arora and Sharma, 20<strong>10</strong>). 

Production of laccase in bacteria 

Laccase in bacteria is present intracellularly and as 

periplasmic protoplast (Claus, 2003; Arora and 

Sharma, 20<strong>10</strong>). The first bacterial laccase was 

found in the plant root associated bacterium, 

Azospirillum lipoferum (Givaudan et al., 1993; 

Sharma et al., 2007; Sharma and Kuhad, 2008), 

where it was shown to be involved in melanin 

formation (Faure et al., 1994; Sharma and Kuhad, 

2008). Laccase has been discovered in a number of 

bacteria including Bacillus subtilis, Bordetella 

compestris, Caulobacter crescentus, Escherichia 

coli, Mycobacterium tuberculosum, Pseudomonas 

syringae, Pseudomonas aeruginosa, and Yersinia 

pestis (Alexandre and Zhulin, 2000; Enguita et al., 

2003; Arora and Sharma, 20<strong>10</strong>). Recently, 

Stenotrophomonas maltophilia strain was found to 

be laccase producing, which was used to degrade 

synthetic dyes (Galai et al., 2008; Arora and 

Sharma, 20<strong>10</strong>). 

Laccase containing six putative copper binding 

sites were discovered in marine bacterium 

Marinomonas mediterranea, but no functional role 

was assigned to this enzyme (Amat et al., 2001; 

Sharma and Kuhad, 2008). Some of the reported 

laccases have the ability to perform the activity at 

very crucial conditions like in the presence of high 

conc. of Cl - 1 and Cu +2 and even at neutral pH 

values. The enzyme produced by Sinorhizobium 

meliloti is a one of the examples of such enzymes 

and is a protein having two subunits with pI 6.2 and 

the molecular weight of the subunits is 45 kDa each 

(Morozova et al., 2007), whereas laccase produced 

by Pseudomonas putida is also an example of such 

enzyme and is a single subunit 59 kDa protein 

which works well at pH 7.0 (Morozova et al., 

2007). Both enzymes can oxidize syringaldazine. 

Niladevi et al. (2009) used response surface 

methodology for the optimization of different 

nutritional and physical parameters for the 

production of laccase by the filamentous bacteria 

Streptomyces psammoticus MTCC 7334 in 

submerged fermentation. Incubation temperature, 

incubation period, agitationrate, concentrations of 

yeast extract, MgSO4.7H2O, and trace elements 

were found to influence laccase production 

significantly. 

A new laccase gene (cotA) was cloned from 

Bacillus licheniformis and expressed in Escherichia 

coli. The recombinant protein CotA was purified 

and showed spectroscopic properties typical for 

blue multi-copper oxidases. The enzyme has a 

molecular weight of ~65kDa and demonstrates 

activity towards canonical laccase substrates 2, 2’azino-bis 

(3-ethylnenzothiazoline-6sulphonic acid) 

(ABTS), syringaldazine (SGZ) and 2, 6-

dimethoxyphenol (2, 6-DMP). Kinetic constants Km 

and kcat for ABTS were of 6.5±0.2 µM and 83s -1 , 

for SGZ of 4.3+0.2 µM and <strong>10</strong>0s -1 , and for 2, 6- 

DMP of 56.7+1.0 µM and 28 s -1 . Highest oxidizing 

activities towards ABTS were obtained at 85 o C 

(Koschorreck et al., 2009). 

Production of laccase in insects 

The laccase enzyme has also been characterized in 

different insects, e.g., Bombyx, Calliphora, 

Diploptera, Drosophila, Lucilia, Manduca, Musca, 

Orycetes, Papilio, Phormia, Rhodnius, 

Sarcophaga, Schistocerca, and Tenebrio (Arora 

and Sharma, 20<strong>10</strong>). 

In insects, laccases have been suggested to be 

active in cuticle sclerotization (Dittmer et al., 2004; 

Sharma and Kuhad, 2008). Recently, two isoforms 

of laccase 2 gene have been found to catalyse 

larval, pupal, and adult cuticle tanning in Tribolium 

castaneum (Arakane et al., 2005; Sharma and 

Kuhad, 2008) 

Applications of laccase 

Laccases have many biotechnological applications 

because of their oxidation ability towards a broad 

range of phenolic and non-phenolic compounds 

(Figure 1) (Mohammadian et al., 20<strong>10</strong>). 

Other applications of laccase include the 

cleaning the industrial effluents, mostly from 

industries like paper industry, pulp, textile & 

petrochemical industries. Laccase are also used in 

the medical diagnostics and for cleaning herbicides, 

pesticides and some explosives in soil. Laccase has 

many applications in agricultural, medicinal and 

industrial areas (Arora and Sharma, 20<strong>10</strong>). 

Laccases are also to clean the water in many 

purification systems. It has also applications in 

medical side to prepare certain drugs like anticancer 

drugs and it is added in cosmetics to 

minimize their toxic effects. Laccase has the 

enormous ability to remove xenobiotic substances 

and produce polymeric products and that is why 

they are being used for many bioremediation 

purposes (Couto and Herrera, 2006). 

Now researchers are working on enzymatic 

synthesis of organic compounds, laccase-based 

biooxidation, and biotransformation and biosensor 

development. The yield of laccase can be increased 

by optimizing different cultural conditions (Arora 



Figure 1. Scheme of applications of laccase 

(Morozova et al., 2007) 

Applications of laccase in food industries 

Wine stabilization 

Laccase is used to improve the quality of drinks 

and for the stabilization of certain perishable 

products containing plant oils (Morozova et al., 

2007). In food industry, wine stabilization is the 

main application of laccase (Duran and Esposito, 

2000; Rosana et al., 2002). 

Polyphenols have undesirable effects on wine 

production and on its organoleptic characteristics, 

so their removal from the wine is very necessary 

(Rosana et al., 2002). Many innovative treatments, 

such as enzyme inhibitors, complexing agents, and 

sulfate compounds, have been proposed for the 

removal of phenolics responsible for discoloration, 

haze, and flavor changes but the possibility of using 

enzymatic laccase treatments as a specific and mild 

technology for stabilizing beverages against 

discoloration and clouding represents an attractive 

alternative (Cantarelli et al., 1989; Arora and 

Sharma, 20<strong>10</strong>). Since such an enzyme is not yet 

allowed as a food additive, the use of immobilized 

laccase might be a suitable method to overcome 

such legal barriers as in this form it may be 

classified as technological aid. So laccase could 

find application in preparation of must, wine and in 

fruit juice stabilization (Minussi et al., 2002; Arora 


Baking industry 

In the bread-making process laccases affix bread 

and/or dough-enhancement additives to the bread 

dough, these results in improved freshness of the 

bread texture, flavour and the improved 

machinability (Minussi et al., 2002). 

Laccase is also one of the enzymes used in the 

baking industry. Laccase enzyme is added in the


baking process which results in the oxidizing effect, 

and also improves the strength of structures in 

dough and/or baked products. Laccase imparts 

many characteristics to the baked products 

including an improved crumb structure, increased 

softness and volume. A flour of poor quality can be 

also used in this process using laccase enzyme 

(Minussi et al., 2002). 

Applications of laccase in textile industry 

Synthetic dyes are widely used in such industries as 

textile, leather, cosmetics, food and paper printing 

(Forgacsa et al., 2004). Reactive dyes are coloured 

molecules used to dye cellulose fibres (Tavares et 

al., 2009). These dyes result in the production of 

large amounts of high-colored wastewater. A 

special problem is found in the application of 

synthetic dyes that they are resistant to 

biodegradation (Wesenberg et al., 2003, Moilanen 

et al., 20<strong>10</strong>). 

Normally, from <strong>10</strong> to 50% of the initial dye 

load will be present in the dyebath effluent, giving 

rise to a highly coloured effluent (Vandevivere et 

al., 1998; Moilanen et al., 20<strong>10</strong>). Therefore, the 

treatment of industrial effluents containing 

aromatic compounds is necessary prior to final 

discharge to the environment (Khlifia et al., 20<strong>10</strong>). 

Nowadays, environmental regulations in most 

countries require that wastewater must be 

decolorized before its discharge (Moilanen et al., 

20<strong>10</strong>) to r<strong>edu</strong>ce environmental problems related to 

the effluent (Tavares et al., 2009). A wide range of 

physicochemical methods has been developed for 

the degradation of dye-containing wastewaters 

(Vandevivere et al., 1998; Tavares et al., 2009). 

Wastewaters from textile dying process are usually 

treated by physical or chemical processes, which 

include physical–chemical processes electrokinetic 

coagulation, electrochemical destruction, 

irradiation, precipitation, ozonation, or the Katox 

method that involves the use of active carbon and 

the mixture of certain gases (air) (Banat et al., 

1996, Khlifia et al., 20<strong>10</strong>, Tavares et al., 2009). 

However, due to the chemical nature, molecular 

size and structure of the reactive dyes these 

classical processes can cause a problem in the 

environment and better treatments can be obtained 

using bioprocesses (Tavares et al., 2009). Recently, 

enzymatic treatments have attracted much interest 

in the decolourization/degradation of textile dyes in 

wastewater as an alternative strategy to 

conventional chemical and physical treatments, 

which present serious limitations (Cristovao et al., 

2008, Tavares et al., 2009). 

Five indigenous fungi P. ostreatus IBL-02, P. 

chrysosporium IBL-03, Coriolus versicolor IBL- 

04, G. lucidum IBL-05 and S. commune IBL-06 

were screened for decolorization of four vat dyes, 

Cibanon red 2B-MD, Cibanon golden-yellow PK- 

MD, Cibanon blue GFJ-MD and Indanthrene direct 

black RBS. The screening experiment was run for 

<strong>10</strong> days with 0.01% dye solutions prepared in 

alkaline Kirk’s basal nutrient medium in triplicate 

(250 ml flasks). Every 48 h samples were read on 

their respective wavelengths to determine the 

percent decolorization. It was observed that C. 

versicolor IBL-04 could effectively decolorized all 

the four vat dyes at varying incubation times but 

best results were shown on Cibanon blue GFJ-MD 

(90.7%) after 7 days, followed by golden yellow 

(88%), Indanthrene direct black (79.7%) and 

Cibanon red (74%). P. chrysosporium also showed 

good decolorization potential on Cibanon blue 

(87%), followed by Cibanon golden-yellow 

(74.8%), Red (71%), and Indanthrene direct black 

(54.6%) (Asghar et al., 2008). 

Decolourization and detoxification of a textile 

industry effluent by laccase from Trametes trogii in 

the presence and the absence of laccase mediators 

had been investigated. It was found that laccase 

alone was not able to decolourize the effluent 

efficiently even at the highest enzyme 

concentration tested: less than <strong>10</strong>% decolourization 

was obtained with 9 U/mL reaction mixtures. To 

enhance effluent decolourization, several potential 

laccase mediators were tested at concentrations 

ranging from 0 to 1mM. Most potential mediators 

enhanced decolourization of the effluent, with 1hydroxybenzotriazol 

(HBT) being the most 

effective (Khlifia et al., 20<strong>10</strong>). 

Moilanen et al. (20<strong>10</strong>) used the crude laccases 

from the white-rot fungi Cerrena unicolor and 

Trametes hirsuta for their ability to decolorize 

simulated textile dye baths. The dyes used were 

Remazol Brilliant Blue R (RBBR) (<strong>10</strong>0 mg/L), 

Congo red (12.5 mg/L), Lanaset Grey (75 mg/L) 

and Poly R-478 (50 mg/L). They assessed the effect 

of redox mediators on dye decolorization by 

laccases. The result was that C. unicolor laccase 

was able to decolorize all the dyes tested. It was 

especially effective towards Congo red and RBBR 

with 91 and 80% of color removal in 19.5 h despite 

the fact that simulated textile dye baths were used. 

Applications in pharmaceutical industry 

Laccases have been used for the synthesis of 

several products of pharmaceutical industry (Arora 

and Sharma, 20<strong>10</strong>). The first chemical of the

pharmaceutical importance that has been prepared 

using laccase enzyme is actinocin that has been 

prepared from 4-methyl-3-hydroxyanthranilic acid. 

This compound has anticancer capability and works 

by blocking the transcription of DNA from the 

tumor cell (Burton, 2003). 

Another example of the anticancer drugs is 

Vinblastine, which is useful for the treatment of 

leukemia. The plant Catharanthus roseus naturally 

produces vinblastine. This plant produces small 

amount of this compound. Katarantine and 

vindoline are the precursors of this 

pharmaceutically important compound. These 

precursors are produced in higher quantities and are 

easy to purifiy. Laccase is used to convert these 

precursors into vinblastine. A 40% conversion of 

these precursors into the final product has been 

obtained using laccase (Yaropolov et al., 1994). 

The use of laccase in such conversion reactions has 

made the preparation of several important 

compounds with useful properties, like antibiotics, 

possible (Pilz et al., 2003). 

Catechins have the antioxidant ability and 

Laccases can oxidize catechins. These catechins 

consist of small units of tannins and these are 

important antioxidants found in tea, herbs and 

vegetables. Catechins have the tendency to hunt 

free radicals and their property makes them useful 

in preventing several diseases including cancer, 

inflammatory and cardiovascular diseases. The 

catechins have less antioxidant ability; this property 

can be increased by using laccase and has resulted 

in the conversion of catechins in several products 

with enhanced antioxidant capability (Kurisawa et 

al., 2003). 

Laccase has applications in the synthesis of 

hormone derivatives. Intra et al. (2005) and Nicotra 

et al. (2004) have reported that laccase has the 

ability to seperate innovative dimeric derivatives of 

the β-estradiol and of the phytoalexin resveratrol. 

Isoeugenol oxidation coniferyl alcohol and totarol 

gave new dimeric derivatives (Ncanana et al., 

2007) and a mixture of dimeric and tetrameric 

derivatives (Shiba et al., 2000) respectively, 

whereas the oxidation of substituted imidazole has 

resulted in the production of even more complex 

substrances. These new formed imidazoles or 

oligomerization products (2–4) can be used for 

pharmacological purposes (Kurisawa et al., 2003). 

Aromatic and aliphatic amines can be converted 

into 3-(3, 4-dihydroxyphenyl)-propionic acid using 

laccase based oxidation. The derivatives have the 

antiviral natural activity and can be used for 


pharmaceutical purposes (Ncanana et al., 2007). 

Conclusion 

Laccases are produced by various sources like 

fungi, bacteria and insects. They have many 

industrial applications because of their innate 

ability of oxidation of a broad range of phenolic 

and non-phenolic compounds. Laccase is utilized in 

drink industry to improve the quality of drinks and 

for stabilization of some perishable products having 

plant oils. Laccases have the potential for the 

synthesis of several useful drugs in pharmaceutical 

industry because of their high value of oxidation 

potential. Laccases have also tremendous ability of 

oxidation of harmful and industrial products and 

belongs to those enzymes, which have instinctive 

properties of immediate radical production. Laccase 

enzyme has the property to act on a range of 

substrates and to detoxify a range of pollutants, 

which have made them to be useful in many 

industries including paper, pulp, textile and 

petrochemical industries. 

References 

Aisemberg GO, Grorewold E, Taccioli GE, 

Judewicz N. A major transcript in the response 

of Neurospora crassa to protein synthesis 

inhibition by cycloheximide. Exp Mycol. 13: 

121–128, 1989. 

Alexandre G, and Zhulin IB. Laccases are wide 

spread in bacteria. Trends in Biotech. 18: 41– 

42, 2000. 

Amat AS, Elio PL, Fernandez E, Borron JCG, 

Solano F. Molecular cloning and functional 

characterization of a unique multipotent 

polyphenol oxidase from Marinomonas 

mediterranea. Biochem Biophys Acta. 1547: 

<strong>10</strong>4–116, 2001. 

Arakane Y, Muthukrishnan S, Beeman RW, Kanost 

MR, Kramer KJ. Laccase 2 is the phenoloxidase 

gene required for beetle cuticle tanning. PNAS. 

<strong>10</strong>2: 11337-11342, 2005. 

Arora DS, Sharma RK. Ligninolytic Fungal 

Laccases and Their Biotechnological 

Applications. Appl Biochem Biotechnol. 160: 

1760–1788, 20<strong>10</strong>.


Asghar M, Batool S, Bhatti HN, Noreen R, Rahman 

SU, Asad MJ. Laccase mediated decolorization 

of vat dyes by Coriolus versicolor IBL-04. Int 

Biodet Biodeg. 62: 465-470, 2008. 

Bailey MR, Woodard SL, Callawy E, Beifuss K, 

Lundback MM, Lane J. Improved recovery of 

active recombinant laccase from maize seed. 

Appl Microbiol Biotechnol. 63: 390–397, 2004. 

Baldrian P. Fungal laccases occurrence and 

properties. FEMS Microbiol Rev. 30: 215–242, 

2006. 

Banat IM, Nigam P, Singh D, Marchnt R. 

Microbial decolorization of textile dye 

containing effluent: a review. Bioresour 

Technol. 58: 217–227, 1996. 

Birhanli E and Yesilada O. Increased production of 

laccase by pellets of Funalia trogii ATCC 

200800 and Trametes versicolor ATCC 200801 

in repeated-batch mode. Enzy Microb Technol. 

39: 1286–1293, 2006. 

Burton S. Laccases and phenol oxidases in organic 

synthesis. Curr Org Chem. 7: 1317-1331, 2003. 

Cantarelli C, Brenna O, Giovanelli G, Rossi M. 

Beverage stabilization through enzymatic 

removal of phenolics. Food Biotechnol. 3: 203– 

214, 1989. 

Claus H. Laccases and their occurrence in 

prokaryotes. Arch Microbiol. 179: 145–150, 

2003. 

Collins PJ and Dobson ADW. Regulation of 

laccase gene transcription in Trametes 

versicolor. Appl Environ Microbiol. 63: 3444– 

3450, 1997. 

Couto SR and Herrera JLT. Industrial and 

biotechnological applications of laccases: A 

review. Biotechnol Advances. 24: 500–513, 

2006. 

Cristovao RO, Tavares APM, Ribeiro A, Loureiro 

JM, Boaventura RAR, Macedo EA. Kinetic 

modelling and simulation of laccase catalyzed 

degradation of reactive textile dyes. Biores 

Technol. 99: 4768–4774, 2008. 

Davis RH and Perkins DD. Timeline: Neurospora: 

a model of model microbes. Nat Rev Genet. 3: 

397–403, 2002. 

Dittmer NT, Suderman RJ, Jiang H, Zhu YC, 

Gorman MJ, Kramer KJ, Kanost MR. 

Characterization of cDNA encoding putative 

laccase-like multicopper oxidases and 

developmental expression in the tobacco 

hornworm, Manduca sexta, and the malaria 

mosquito, Anopheles gambiae. Insect Biochem 

Mol Biol. 34: 29–41, 2004. 

Duran N and Esposito E. Potential applications of 

oxidative enzymes and phenoloxidase-like 

compounds in wastewater and soil treatment: a 

review. Appl Cataly Env. 28: 83–99, 2000. 

Eggert C, Temp U, Eriksson KE. The ligninolytic 

system of the white rot fungus Pycnoporus 

cinnabarinus: purification and characterization 

of the laccase. Appl Environ Microbiol. 62: 

1151–1158, 1996. 

Enguita FJ, Martins LO, Henriques AO, Carrondo 

MA. Crystal structure of a bacterial endospore 

coat component. A laccase with enhanced 

thermostability properties. J Biol Chem. 278: 

19416–19425, 2003. 

Faure D, Bouillant ML, Bally R. Isolation of 

Azospirillum lipoferum 4T Tn5 mutants affected 

in melanization and laccase activity. Appl 

Environ Microbiol. 60, 3413–3415, 1994. 

Forgacsa E, Cserhatia T, Oros G. Removal of 

synthetic dyes from wastewaters: a review. 

Environ Int. 30: 953–971, 2004. 

Galai S, Limam F, Marzouki MN. A new 

Stenotrophomonas maltophilia strain producing 

laccase. Use in decolorization of synthetic dyes. 

Appl Biochem Biotechnol. 158(2): 416-431 

2009. 

Galhaup C, Wagner H, Hinterstoisser B, Haltrich 

D. Increased production of laccase by the wooddegrading 

basidiomycetes Trametes pubescens. 

Enz Microb Technol. 30: 529–536, 2002.

Gianfreda L, Xu F, Bollag JM. Laccases: a useful 

group of delignification and possible industrial 

applications. Multi-Copper Oxidases. 

Messerschmidt A (Ed). Singapore: World 

Scientific. 201–224, 1999. 

Giardina P, Faraco V, Pezzella C, Piscitelli A, 

Vanhulle S, Sannia G. Laccases: a never-ending 

story. Cell Mol Life Sci. 67: 369–385, 20<strong>10</strong>. 

Givaudan A, Effose A, Faure D, Potier P, Bouillant 

ML, Bally R. Polyphenol oxidase in 

Azospirillum lipoferum isolated from rice 

rhizosphere: evidence for laccase activity in 

non-motile strains of Azospirillum lipoferum. 

FEMS Microbiol Lett. <strong>10</strong>8: 205–2<strong>10</strong>, 1993. 

Gnanamani A, Jayaprakashvel M, Arulmani M, 

Sadulla S. Effect of inducers and culturing 

processes on laccase synthesis in 

Phanerochaete chrysosporium NCIM 1197 and 

the constitutive expression of laccase isozymes. 

Enz Microb Technol. 38: <strong>10</strong>17-<strong>10</strong>21, 2006. 

Heinzkill M, Messner K. The ligninolytic system of 

fungi. Fungal biotechnology. Anke T (Ed). 

Chap Hall Weinheim. 213–226, 1997. 

Intra A, Nicotra S, Riva S, Daniel B. Significant 

and unexpected solvent influence on the 

selectivity of laccase-catalyzed coupling of 

tetrahydro-2-naphthol derivatives. Adv Synth 

Catal. 347: 973-977, 2005. 

Jolivalt C, Brenon S, Caminade E, Mougin C, 

Pontie M. Immobilization of laccase from 

Trametes versicolor on a modified PVDF 

microfiltration membrane: characterization of 

the grafted support and application in removing 

a phenylurea pesticide in wastewater. J Membr 

Sci. 180: <strong>10</strong>3–113, 2000. 

Jolivalt C, Raynal A, Caminade E, Kokel B, Le 

Goffic F, Mougin C. Transformation of N,N 

dimethyl-N-(hydroxyphenyl)ureas by laccase 

from the white rot fungus Trametes versicolor. 

Appl Microbiol Biotechnol. 51: 676–681, 1999. 

Khlifia R, Belbahria L, Woodwarda S, Ellouza M, 

Dhouiba A, Sayadia S, Mechichia T. 


Decolourization and detoxification of textile 

industry wastewater by the laccase-mediator 

system. J Hazard Mater. 175: 802–80, 20<strong>10</strong>. 

Kiiskinen LL, Ratto M, Kruus K. Screening for 

novel laccase-producing microbes. J Appl 

Microbiol. 97: 640–646, 2004. 

Koschorreck K, Schmid RD, Urlacher VB. 

Improving the functional expression of a 

Bacillus licheniformis laccase by random and 

site-directed mutagenesis. J Biotechnol. 9(12): 

1-<strong>10</strong>, 2009. 

Kurisawa M, Chung JE, Uyama H, Kobayashi S. 

Laccase-catalyzed synthesis and antioxidant 

property of poly(catechin). Macromol Biosci. 3: 

758-764, 2003. 

Leonowicz A, Cho NS, Luterek J, Wilkolazka A, 

Wotjas-Wasilewska M, Matuszewska A, 

Hofrichter M, Wesenberg D, Rogalski J. Fungal 

laccase: properties and activity on lignin. J Bas 

Microbiol. 41: 185–227, 2001. 

Liers C, Ullrich R, Pecyna M, Schlosser D, 

Hofrichter M. Production, purification and 

partial enzymatic and molecular 

characterization of a laccase from the woodrotting 

ascomycete Xylaria polymorpha. Enz 

Microb Technol. 41: 785–793, 2007. 

Mayer AM. Polyphenol oxidases in plant: recent 

progress. Phytochem. 26: 11–20, 1987. 

Mayer AM, Staples RC. Laccase: new functions 

for an old enzyme. Phytochem. 60: 551–565, 

2002. 

Minussi RC, Pastore GM, Duran N. Potential 

applications of laccase in the food industry. 

Trends in Food Scien Technol. 13: 205–216, 

2002. 

Mishra A, Kumar S, Kumar S. Application of Box- 

Benhken experimental design for optimization 

of laccase production Coriolus versicolor 

MTCC138 in solid-state fermentation. J Sci 

Indust Res. 67: <strong>10</strong>98-1<strong>10</strong>7, 2008.

<strong>10</strong>Muhammad IMRAN et al. 

Mohammadian M, Roudsari MF, Mollania N, 

Dalfard AB, Khajeh K. Enhanced expression of 

a recomninant bacterial laccase at low 

temperature and microacrobic conditions: 

purification and biochemical characterization. J 

Ind Microbiol Biotechnol. 5: 41-45, 20<strong>10</strong>. 

Moilanen U, Osma JF, Winquist E, Leisola M, 

Couto SR. Decolorization of simulated textile 

dye baths by crude laccases from Trametes 

hirsute and Cerrena unicolor. Eng Life Sci. 

<strong>10</strong>(3): 1–6, 20<strong>10</strong>. 

Morozova OV, Shumakovich GP, Gorbacheva MA, 

Shleev SV, Yaropolov AI. “Blue” Laccases. J 

Biochem. 72(<strong>10</strong>): 1136-1150, 2007. 

Mougin, C., Boyer, F. D., Caminade, E., Rama, R. 

Cleavage of the diketonitrilederivative of the 

herbicide isoxaflutole by extra cellular fungal 

oxidases. J Agric Food Chem. 48: 4529–4534, 

2000. 

Ncanana S, Baratto L, Roncaglia L, Riva S, Burton 

SG. Laccase mediated oxidation of totarol. Adv 

Synth Catal. 349 : 1507-1513, 2007. 

Nicotra S, Cramarossa MR, Mucci A, Pagnoni UM, 

Riva S, Forti L. Biotransformation of 

resveratrol: synthesis of trans-dehydrodimers 

catalyzed by laccases from Myceliophtora 

thermophyla and from Trametes pubescens. 

Tetrahedron. 60: 595-600, 2004. 

Niladevi KN, Sukumaran RK, Jacob N, Anisha GS, 

Prema P. Optimization of laccase production 

from a novel strain-Streptomyces psammoticus 

using response surface methodology. Microbiol 

Res. 164: <strong>10</strong>5-113, 2009. 

Pandey A. Solid State Fermentation. Pandey A 

(Ed). Wiley Eastern Publishers, New Delhi. 3– 

<strong>10</strong>, 1994. 

Pilz R, Hammer E, Schauer F, Krag U. Laccasecatalyzed 

synthesis of coupling products of 

phenolic substrates in different reactors. Appl 

Microbiol Biotechnol. 60: 708-712, 2003. 

Rama R, Mougin C, Boyer FD, Kollmann A, 

Malosse C and Sigoillot JC. Biotransformation 

of benzo[a]pyrene in bench scale reactor using 

laccase of Pycnoporus cinnabarinus. Biotechnol 

Lett. 20: 1<strong>10</strong>1–1<strong>10</strong>4, 1998. 

Ranocha P, Chabannes M, Chamayou S, Danoun S, 

Jauneau A, Boudet AM. Laccase downregulation 

causes alteration in phenolic 

metabolism and cell wall structure in poplar. 

Plant Physiol. 129:1–11, 2002. 

Rosana C, Minussi Y, Pastore GM, Durany N. 

Potential applications of laccase in the food 

industry. Trends in Food Sci Technol. 13: 205- 

216, 2002. 

Savoie JM, Mata G, Billette C. Extracellular 

laccase production during hyphal interactions 

between Trichoderma sp. and Shiitake, 

Lentinula edodes. Appl Microbiol Biotechnol. 

49: 589-593, 1998. 

Sadhasivam S, Savitha S, Swaminathan K, Lin FH. 

Production, purification and characterization of 

mid-redox potential laccase from a newly 

isolated Trichoderma harzianum WL1. Process 

Biochem. 43: 736-742, 2008. 

Sharma KK and Kuhad RC. Laccase: enzyme 

revisited and function redefined. Ind J 

Microbiol. 48: 309–316, 2008. 

Sharma P, Goel R, Caplash N. Bacterial laccases. 

World J Microbiol Biotechnol. 23: 823-832, 

2007. 

Shiba T, Xiao L, Miyakoshi T, Chen CL. Oxidation 

of isoeugenol and coniferyl alcohol catalyzed 

by laccase isolated from Rhus vernicifera 

Stokes and Pycnoporus coccineus. J Mol Catal 

Enzym. <strong>10</strong>: 605-615, 2000. 

Smith M, Thurston F, Wood DA. Fungal laccases: 

role in oxidor<strong>edu</strong>ctive enzymes. Bioremed J. 3: 

1–25, 1997. 

Solden DM and Dobson DW. Differential 

regulation of laccase gene expression in 

Pleurotus sajor-caju. Microbiol. 147: 1755– 

1763, 2001. 

Souza D and Peralta RM. Production of laccase

isoforms by Pleurotus pulmonarius in response 

to presence of phenolic and aromatic 

compounds. J Basic Microbiol. 44(2): 129–136, 

2004. 

Souza CGM, Zilly A, Peralta RM. Production of 

laccase as the sole phenoloxidase by a Brazilian 

strain of Pleurotus pulmonarius in solid state 

fermentation. J Bas Microbiol. 42: 83–90, 2002. 

Souza DDT, Tiwari R, Sah AK, Raghukumara C. 

Enhanced production of laccase by a marine 

fungus during treatment of colored effluents and 

synthetic dyes. Enz Microb Technol. 38: 504- 

511, 2006. 

Tavares APM, Cristovao RO, Gamelas JAF, 

Loureiro JM, Boaventuraa RAR, Macedoa EA. 

Sequential decolourization of reactive textile 

dyes by laccase mediator system. J Chem 

Technol Biotechnol. 84: 442–446, 2009. 

Vandevivere PC, Bianchi R, Verstraete W. 

Treatment and reuse of wastewater from the 

textile wet-processing industry: review of 

emerging technologies. J Chem Technol 

Biotechnol. 72: 289–302, 1998. 

Wesenberg D, Kyriakides I, Agathos N. White-rot 

fungi and their enzymes for the treatment of 

industrial dye effluents. Biotechnol Adv. 22: 

161–187, 2003. 

Yaropolov AI, Skorobogatko OV, Vartanov SS, 

Varfolomeyev SD. Laccase: Properties, 

catalytic mechanism and applicability. Appl 

Biochem Biotechnol. 49: 257–280, 1994. 

Production and industrial applications of laccase 11

Journal of Cell and Molecular Biology <strong>10</strong>(1):13-18, 2012 Research Article 13 



Isolation and biochemical identification of Escherichia coli from 

wastewater effluents of food and beverage industry 

Tasnim FARASAT*, Zubia BILAL, Fakhar-un-Nisa YUNUS 

Department of Zoology, Lahore College for Women University, Lahore, Pakistan. 

(* author for correspondence; tasnimfarasat@hotmail.com) 

Received: 20 May 2011; Accepted: 11 May 2012 


The aim of this study was the isolation and biochemical identification of E. coli from industrial wastewater 

effluents. Sixty samples were collected from different sources in Lahore. The results revealed that E.coli was 

found in higher concentration in wastewater of food and beverage industries. Wastewater is an important 

reservoir for E.coli and presented significant acute toxicity if released into the receiving water body without 

being adequately treated. Results revealed the presence of both gram negative and positive bacteria. There 

was nonsignificant variation among all the samples of wastewater. The highest concentration of E.coli was 

observed in wastewater of food industry Site A (Rettigon road) and beverage industry Site F (Wahdat road). 

Biochemical and serological tests confirmed the presence of E.coli. 

Keywords: E .coli, wastewater, food industry, beverage industry, effluent. 

Yiyecek ve içecek endüstrisi atıksu deşarjlarından Escherichia coli eldesi ve biyokimyasal 

tanımlanması 

Özet 

Bu çalışmanın amacı endüstriyel atıksu deşarjlarından E. coli eldesi ve biyokimyasal tanımlanmasıdır. 

Lahor’da farklı kaynaklardan 60 örnek toplandı. Sonuçlar yiyecek ve içecek endüstrisi atıksularında daha 

fazla konsantrasyonda E. coli bulunduğunu gösterdi. Atıksu önemli bir E.coli deposudur ve yeterli olarak 

muamele edilmeden alıcı su kaynağına salınırsa ileri derecede toksik olabilir. Sonuçlar hem gram pozitif, 

hem de gram negatif bakteri varlığını gösterdi. En yüksek E. coli konsantrasyonu A bölgesi (Rettigon yolu) 

yiyecek endüstrisinin ve F bölgesi (Wahdat yolu) içecek endüstrisinin atıksularında gözlemlendi. Biyolojik 

ve serolojik testler E. coli varlığını doğruladı. 

Anahtar kelimeler: E.coli, atıksu, yiyecek endüstrisi, içecek endüstrisi, atıksu deşarjı. 


Industrial waste is the most common source of 

water pollution in the present day (Ogedengbe and 

Akinbile, 2004) and it increases yearly due to the 

fact that industries are increasing as most countries 

are getting industrialized. Industries produce wastes 

which are peculiar in terms of type, volume and 

frequency depending on the type of industry and 

population that uses the product (Odumosu, 1992). 

Water and wastewater management constitutes a 

practical problem for the food and beverage 

industry. In spite of significant improvement over 

the last 20 years, water consumption and disposal 

remain critical from environmental and economic 

standpoint (Fillaudeau et al., 2005). 

A food processing industry is involved with the 

total environment from the farm to the customer. 

Water is absolutely necessary for many steps in the 

food processing industry. At present, there is no 

economical substitute of water. Consequently water 

conservation and water reuse are necessary. By

14 Tasnim FARASAT et al. 

practicing conservation and reuse, the amount of 

liquid waste and pollution potential from the food 

processing is r<strong>edu</strong>ced (Mercer, 1964). 

On a global scale, contamination of drinking 

water by pathogenic bacteria causes the most 

significant health risk to humans, and there have 

been countless numbers of disease outbreaks and 

poisonings resulting from exposure to untreated or 

poorly treated drinking water. However, significant 

risks to human health may also result from 

exposure to toxic contaminants that are often 

globally ubiquitous in waters from which drinking 

water is derived. The presence of E. coli is a 

definite indication of fecal contamination (WHO, 

2004). Some E. coli strains can cause a wide variety 

of intestinal and extra-intestinal diseases, such as 

diarrhea, urinary tract infections, septicemia, and 

neonatal meningitis (Orskov and Orskov, 1992). 

The magnitude of the problem of bacterial 

contamination deserves more elaborative studies 

from the point of production of waste effluents to 

the point of consumption at all intermediary levels. 

The aim of the present research was isolation and 

biochemical identification of E.coli from industrial 

effluents of food and beverage industries in Lahore. 

Material and methods 

Sample collection 

Sampling was completed in two successive months 

from March to April for the microbial assessment 

of waste effluents from food and beverage 

industries. Total of sixty samples were collected. In 

March, effluents of food industries were collected 

from industries near Rettigon road, Township 

industrial area, Township industrial estate. In April, 

effluents of beverage industries were collected from 

industries near Multan road and Wahdat road. Data 

from each sample was collected and recorded in the 

data book. Samples were collected in hermetically 

sealed, sterilized falcon tubes and were kept at 4ºC 

until analysis. 

Sample processing 

The technique described by Theodor Escherich, 

1885 was used for isolation of E.coli (Escherich, 

1885). To prevent contamination, the area was 

swabbed with 70% ethanol prior to opening any 

sample container. Samples (0.5 ml) were taken in 

<strong>10</strong> ml LB (Luria Bertani) broth medium in test 

tube, and vortexed for one minute and left for thirty 

minutes at room temperature. Then supernatant 

(1ml) was taken from this test tube and a 2-fold 

serial dilution was prepared (Reddy, 2007). After 

this, 500 ml from the final dilution tube was 

spreaded on the petri dishes (Pyrex) of MacConkey 

medium and LB medium. Petri dishes were kept in 

the incubator for 24 hours at 37ºC (Hajna and 

Perry, 1939). After 24 hours, plates were studied 

for the colonies of microbes grown on the media. 

Microorganisms grown on MacConkey agar are 

capable of metabolizing lactose which produces 

acid by-products that lower the pH of the media 

which causes the neutral red indicator to turn red, 

and if sufficient acid is produced, a zone of 

precipitated bile develops around the colony 

(Koneman, 2005). Different biochemical tests 

(Werkman, 1930; O'Meara, 1931; Vaughn et al., 

1939; Silva et al., 1980) were performed for the 

identification of E. coli in the waste effluents of 

food and beverage industry (Table 1). 

Serological tests 

Commercial latex kits are available for O157, O26, 

and H7 strains of E. coli. O157 antiserum has been 

shown to cross-react with other organisms 

including E. hermanii (frequently found in foods) 

(Hopkins and Hilton, 2000; Law, 2000). Tests 

incorporated positive and negative control 

organisms and control latex. Test was performed by 

a slide agglutination test using somatic (O) or 

flagella (H) antisera. Some pathogenic bacteria 

were nonmotile. 

Results 

E. coli was cultured on LB medium and 

MacConkey medium for morphological 

characterization. After 24 hrs, two types of colonies 

were isolated under microscopic examination. All 

the isolated colonies were pink on MacConkey 

medium, while creamy yellow on LB medium. 

E. coli was observed in highest concentration 

from wastewater samples of industry (Site A) 

whereas in wastewater samples of industry (Site B) 

six samples indicated the presence of E. coli which 

was confirmed by biochemical and serological test. 

Four samples were of gram positive bacteria which 

may be Bacillus subtilus or Bacillus thuringiensis. 

In industrial effluent (Site C) eight samples were of 

gram negative while two samples were of gram 

positive bacteria. It was observed that waste 

effluents of food industry (Site A) revealed greater 

percentage of gram negative bacteria. 

In wastewater samples of industry (Site D) five 

were gram negative, while five were gram positive 

bacteria. Six samples in industrial effluent (Site E)

Samples 

Sources 

Industrial 

effluent (A) 


effluent(B) 


effluent(C) 


effluent(D) 


effluent(E) 


effluent(F) 

Identification of E. coli from wastewater 15 

Table 1. Biochemical identification of E. coli in industrial wastewaters 

Indole 

Test 

Spot 

Indole 

Test 

Kovacs 

Indole 

Test 

Methyl Red 

Test 

Voges 

Proskeur 

Test 

Ammonium 

acetate Test 

Simmon's Test 

Ammonium 

Citrate Test 

+ + + + - + - 

+ + + + - + - 

+ + + + - + - 

+ + + + - + - 

+ + + + - + - 

+ + + + - + - 

were gram negative and four were gram positive 

bacteria. In the wastewater samples of beverage 

industry (Site F) all samples were of gram negative 

bacteria (Figure 1 and 2). 

The average value of gram negative bacteria in 

wastewater of food industry (Site A) was 5.<strong>10</strong> ± 

0.34. The average value of gram negative bacteria 

in wastewater of food industry (Site B) was 4.66 ± 

0.66 while in wastewater of food industry (Site C) 

was 4.50 ± 0.50. The average value of gram 

negative bacteria in wastewater of beverage 

industry (Site D) was 5.0 ± 0.70, whereas in the 

wastewater of beverage industry (Site E) was 3.8 ± 

0.60 and in the wastewater of beverage industry 

(Site F) was 4.0 ± 0.33. Student’s t-test revealed a 

non significant difference (P >0.05) between gram 

positive and gram negative bacteria. 

Figure 1. Percentage of gram negative bacteria in all industrial wastewater samples. Food Industry A: 

Rettigon road; Food Industry B: Township industrial area; Food Industry C: Township industrial estate; 

Beverage industry D: Multan Road; Beverage industry E: Multan road; Beverage industry F: Wahadat road


Figure 2. Number of E.coli colonies (mean ±SE) in wastewater samples of industries. Sites A, B, C: Food 

industries at Rettigon road, Township industrial area, Township industrial Estate Sites D, E, F: Beverage 

industries at Multan Road and Wahadat road. 

Discussion 

The bacterium E. coli is one of the best and most 

thoroughly studied free-living organisms. It is also 

a remarkably diverse species because some E.coli 

strains live as harmless commensals in animal 

intestines. E. coli is a widely used indicator of fecal 

contamination in water bodies. External contact and 

subsequent ingestion of bacteria from fecal 

contamination can cause detrimental health effects 

(Money et al., 2009). 

Stomach cramps, nausea and vomiting are the 

symptoms caused by E. coli, however serious 

complications can also occur. Water samples were 

the only nonfecal samples that tested positive for E. 

coli. Water has been implicated in human outbreaks 

and the studies revealed that water may be an 

important source of 0157:H7 on farms (Karmali, 

1989). 

The present research work was conducted to 

isolate E. coli from food and beverage industrial 

effluents. Effluents are good primary reservoir for 

E. coli. Sixty different samples from food and 

beverage industries were processed for the isolation 

of E. coli. The food and beverage industries uses 

large volume of water as it is suitable, clean, and a 

quite inexpensive resource, both as a constituent of 

many products, and for other production 

requirements. Microbial growth in drinks due to 

contaminated water supplies or sugar syrups can 

cause discoloration, off flavors and shortened shelflife, 

as well as increasing the risk of infection to 

consumers (Noronha et al., 2002). 

However, selective media are universally used 

in water monitoring and were employed in the 

United States Environmental Protection Agency 

epidemiological investigations, suggesting that 

culturable fecal indicator counts are valid predictors 

of disease risk (Sinton et al., 1994). Sewage can 

serve as a vehicle for entering into human and 

nonhuman hosts either by direct contact or through 

contamination of drinking water supplies (Boczek 

et al., 2007). 

The results revealed that the highest percentage 

of E. coli was observed in the waste effluents of 

industries (A and F). ANOVA showed non 

significant (P > 0.05) variation. Student’s t-test also 

revealed non significant difference between gram 

positive and gram negative bacteria. 

According to Boczek and colleagues (2007) the 

occurrence of clonal group in wastewater 

demonstrates a potential mode for the dissemination 

of this clonal group in the environment, with 

possible secondary transmission to human or 

animal hosts. Chalmers and colleagues (2000) 

demonstrated that the effluent had a significant 

pollution potential, mainly due to the low pH and 

high concentration of E. coli. The results also

demonstrated that the wastewater presented 

significant acute toxicity, and could cause diseases 

if released into the receiving body without being 

adequately treated. This represents a dangerous 

public health risk, which needs future evaluation 

and control. Culture-independent analysis in 

various environmental samples has been used to 

catalog this species and also to assess the impact of 

human activity and interactions with microbes on 

natural microbial communities. 

According to Barreto-Rodrigues and colleagues 

(2008), the objective of the work was to 

characterize the effluent originating from a 

Brazilian TNT production industry. Analyses were 

performed using physical, chemical, spectroscopic 

and ecotoxicological assays, which demonstrated 

that the effluent had a significant pollution 

potential, mainly due to the low pH and high 

concentration of TNT (156 ± <strong>10</strong> mg L −1 ). The 

results also demonstrated that the effluent causes 

significant acute toxicity, and could cause countless 

damages if released into the rivers without being 

properly treated. The observed pollution potential 

justifies studies to evaluate treatment technologies 

or recover the residue generated in the TNT 

industry. From a total of 149 E. coli strains, 87 E. 

coli strains were from raw wastewater and 62 

strains from treated wastewater by stabilization 

ponds. Within these strains two and four positive 

serological reaction to E. coli 0157 were found for 

raw and treated wastewater, respectively. 

In the same direction, Muller and his colleagues 

(2001) carried out a study on E.coli 0157:H7 strains 

in water sources in South Africa and they did not 

find any evidence of EHEC 0157 while virulence 

factors present in the 96% of analyzed samples 

(196), however 8 isolates from 8 samples 

demonstrated the presence of Stx1 and Stx2. 

References 

Barreto-Rodrigues M, Silva FT, Paiva TCB. 

Characterization of wastewater from the 

Brazilian TNT industry. J Haz Mat. 164: 385- 

388, 2008. 

Boczek LA, Rice EW, Johnston B, Johnson JR. 

Occurrence of antibiotic-resistant uropathogenic 

Escherichia coli clonal group A in wastewater 

effluents. Appl Environ Microbiol. 73: 4180- 

4184, 2007. 

Identification of E. coli from wastewater 17 

Chalmers RM, Aird H, Bolton FJ. Waterborne 

Escherichia coli 0157. J Appl Microbiol. 88: 

124-132, 2000. 

Escherich T. Die Darmbakterien des Neugeboren 

und Sauglings Fortschr. Med. 3: 515-522, 1885. 

Fillaudeau L, Blanpain-Avet P, Daufin G. Water, 

wastewater and waste management in brewing 

industries. J Cle Pro. 14: 463-471, 2005. 

Hajna AA, Perry CA. Optimum Temperature for 

Differentiation of Escherichia coli from Other 

Coliform Bacteria. J Bacteriol. 38: 275-283, 

1939. 

Hopkins KL, Hilton AC. Methods available for the 

sub-typing of Escherichia coli O157. World J 

Microbiol Biotechnol. 16: 741-748, 2000. 

Karmali MA. Infection by verocytotoxin-producing 

Escherichia coli. Clin Microbiol Rev. 2: 15-38, 

1989. 

Koneman EW. Color Atlas and Textbook of 

Diagnostic Microbiology, Lippincott, JB. (Ed), 

Philadelphia. 313-317, 2005. 

Law D. Virulence factors of Escherichia coli O157 

and other Shiga toxin-producing E. coli. J Appl 

Microbiol. 88: 729-745, 2000. 

Mercer WA. Physical Characteristics of 

Recirculated Water as Related to Sanitary 

Conditions. Food Technol. 335: 111-115, 1964. 

Money ES, Carter GP, Serre ML. Modern 

space/time geo statistics using river distances: 

data integration of turbidity and Escherichia 

coli measurements to assess fecal contamination 

along the Raritan River in New Jersey. Environ 

Sci Technol. 43: 3736-3742, 2009. 

Müller EE, Ehlers MM, Grabow, WOK. The 

occurrence of E. coli 0157:H7 in South Africa 

water sources intended for direct and indirect 

human consumption. Wat Res. 35: 3085 -3088, 

2001.


Noronha M, Britz T, Mavrov V, Janke HD, Chmiel 

H. Treatment of spent process water from a fruit 

juice company for purposes of reuse: hybrid 

process concept and on-site test operation of a 

pilot plant. Desalination. 143: 183-196, 2002. 

Odumosu AOT. Management of liquid industrial 

waste. Ind Waste Manage. 55: 6-7, 1992. 

Ogedengbe K, Akinbile CO. Impact of industrial 

pollutants on quality of ground and surface 

waters at Oluyole Industrial Estate, Ibadan, 

Nigeria. J Technol Develop. 4: 139-144, 2004. 

O'Meara RAQ. A simple delicate and rapid method 

of detecting the formation of acetylmethylcarbinol 

by bacteria fermenting 

carbohydrate. J Pathol Bacteriol. 34: 401-406, 

1931. 

Orskov F, Orskov I. Escherichia coli serotyping 

and disease in man and animals. J Microbiol. 

38: 699-704, 1992. 

Reddy CA. Methods for general and molecular 

microbiology (Ed). ASM Press, Washington. 

447-521, 2007. 

Silva RM, Toledo MR, Trabulsi LR. 

Biochemical and cultural characteristics of 

invasive Escherichia coli. J Clin Microbiol. 11: 

441- 444, 1980. 

Sinton LW, Davies-Colley RJ, Bell RG. 

Inactivation of enterococci and fecal coliforms 

from sewage and meatworks effluents in 

seawater chambers. Appl Environ Microbiol. 

60: 2040-2048, 1994. 

Vaughn RH, Mitchell, NB, Levine, M. The Voges- 

Proskauer and methyl red reactions in the coliaerogenes 

group. J Am Water Works Assoc. 31: 

993-<strong>10</strong>01, 1939. 

Werkman CH. An improved technic for the Voges- 

Proskauer test. J Bacteriol. 20: 121-125, 1930. 

World Health Organization- WHO. Guidelines for 

Drinking Water Quality: Recommendations 

(Ed). Switzerland. 1: 229-243, 2004.




Investigation of the MGP promoter and exon 4 polymorphisms in 

patients with ischemic stroke in the Ukrainian population 

Alexander V. ATAMAN *1, Victoria Y. GARBUSOVA 2 , Yuri A. ATAMAN 3 , Olga I. 

MATLAJ 4 , Olga A. OBUCHOVA 1 

1 Sumy State University, Department of Physiology, Pathophysiology and Medical Biology, Sumy, Ukraine 

2 Sumy State University, Scientific Laboratory of Molecular Genetic Research, Sumy, Ukraine 

3 Sumy State University, Department of Internal Medicine, Sumy, Ukraine 

4 

Sumy Clinical Hospital No.5, Sumy, Ukraine 

(*author for correspondence; ataman_av@mail.ru ) 

Received: 13 February 2012; Accepted: 18 May 2012 


Matrix γ-carboxyglutamic acid protein (MGP) is a vitamin K-dependent protein playing a pivotal role in 

preventing arterial calcification. In the present study, we aimed to investigate the relation between three 

single nucleotide polymorphisms of MGP gene and ischemic stroke (IS) in the Ukrainian population. 170 IS 

patients and 124 healthy controls were recruited to the study. MGP SNPs were examined by PCR-RFLP 

methodology. The distribution of homozygous carriers of the major allelic variant, and heterozygous and 

homozygous minor allele variants of the T-138C MGP promoter polymorphism (rs1800802) in patients with 

IS was 61.2%, 31.2% and 7.6%, respectively. The corresponding distributions of the variants in the control 

group were 59.7%, 35.6%, 4.8%. With regard to the G-7A promoter polymorphism (rs1800801), the 

respective distributions were 35.9%, 48.8% and 15.3%, compared to 43.5%, 50% and 6.5% in the control 

group. Finally, the respective distributions according to the Thr83Ala exon 4 polymorphism (rs4236) were 

39.4%, 48.8% and 11.8%, compared to 34.7%, 53.2% and 12.1% in the control group. Using logistic 

regression analysis, it was estimated that A/A genotype (G-7A polymorphism) was significantly (P=0.016) 

associated with IS (OR=2.943; 95% CI: 1.218–7.<strong>10</strong>9) in the Ukrainian population. A-allele homozygotes of 

female sex had a risk of IS more than 7 times higher compared with carriers of G/G genotype. 

Keywords: Matrix Gla protein, single nucleotide polymorphism, ischemic stroke, arterial calcification, 

Ukrainian population. 

Ukrayna popülasyonunda iskemik inme hastalarında MGP promotör ve ekzon 4 

polimorfizminin araştırılması 

Özet 

Matris γ–karboksiglutamik asit proteini (MGP) vitamin-K bağımlı protein olup arteriyal kalsitleşmeyi 

önlemede önemli rol oynar. Bu çalışmada, MGP geninin üç tek nükleotit polimorfizmi (TNP) ile Ukrayna 

popülasyonunda iskemik inme (İİ) arasındaki ilişkiyi araştırmayı hedefledik. Çalışmaya 170 İİ hastası ve 124 

sağlıklı kontrol katıldı. MGP TNP’leri PCR-RFLP metodolojisi ile test edildi. İH hastalarında T-138C MGP 

promoter polimorfizminin (rs1800802) majör alel varyantının homozigot taşıyıcılarının ve heterozigot ve 

homozigot minör alel varyantlarının dağılımları sırası ile, %61.2, %31.2 ve %7.6’dır. Kontrol grubunda ilgili 

varyant dağılımları %59.7, %35.6 ve %4.8’dir. G-7A promoter polimorfizminde (rs1800801) ise ilgili 

dağılımlar %43.5, %50 ve %6.5 olan kontrol grubu ile karşılaştırıldığında %35.9, %48.8 ve %15.3’dir. Son 

olarak, Thr83Ala ekzon 4 polimorfizmine (rs4236) göre dağılımlar %34.7, %53.2 ve %12.1 olan kontrol 

grubu ile karşılaştırıldığında %39.4, %48.8 ve %11.8’dir. Lojistik regresyon analizi kullanarak, Ukrayna 

popülasyonunda İİ ile A/A genotipinin (G-7A polimorfizmi) anlamlı (P=0.016) olarak ilişkili olduğu 

(OR=2.943; 95% CI: 1.218–7.<strong>10</strong>9) tahmin edilmiştir. 

Anahtar kelimeler: Matris Gla protein, tek nükleotid polimorfizmi, iskemik inme, arteriyal kalsifikasyon, 

Ukrayna popülasyonu.

20 Alexander V. ATAMAN et al. 


Ischemic stroke (IS) is, in many instances, the 

consequence of a thrombus forming on a ruptured 

atherosclerotic plaque. Extracellular matrix 

calcification is considered to be a novel marker of 

atherosclerosis and related to both coronary artery 

and cerebrovascular disease. It has been shown that 

arterial calcification in major vessel beds is 

associated with vascular brain disease (Bos et al., 

2011). 

Recent studies suggest that in addition to 

modifiable risk factors, such as hypertension, 

hyperlipidemia, and cigarette smoking, there is a 

strong genetic component to the development of 

arterial calcification. For instance, the heritability 

of the presence of coronary artery calcification has 

been estimated to be up to 50% (Post et al., 2007). 

Key genes known to be involved in the 

regulation of the complex process of ectopic soft 

tissue mineralization are those acting as 

calcification inhibitors such as matrix γcarboxyglutamic 

acid protein (MGP), osteocalcin 

(BGP), osteoprotegerin (Opg), and fetuin (Abedin 

et al., 2004; Doherty et al., 2004; Giachelli, 2004; 

Guzman, 2007; Weissen-Plenz et al., 2008). 

Among those, MGP, a vitamin K-dependent 

protein, is widely accepted as playing a pivotal role 

in preventing local mineralization of the vascular 

wall (Luo et al., 1997; Schurgers et al., 2005; 

Proudfoot and Shanahan, 2006). It has been shown 

that the anticalcifying activity of MGP depends 

upon the γ-carboxylation of specific glutamic acid 

(Glu) residues in MGP. This vitamin K-dependent 

reaction yields γ-carboxyglutamic acid (Gla) 

residues, which are then able to bind calcium 

(Murshed et al., 2004). 

The human MGP gene is located on 

chromosome 12p (Cancela et al., 1990). Among the 

large number of identified MGP single nucleotide 

polymorphisms (SNPs) eight are under the most 

intensive investigation: two SNPs are located in 

exons, and six in the upstream region of the MGP 

gene. In vitro studies suggest that SNPs in MGP are 

associated with altered promoter activity 

(Herrmann et al., 2000; Farzaneh-Far et al., 2001; 

Kobayashi et al., 2004). In addition, there is some 

evidence that MGP SNPs are associated with 

arterial calcification (Herrmann et al., 2000; 

Brancaccio et al., 2005; Crosier et al., 2009), 

although these results are not consistent (Kobayashi 

et al., 2004; Taylor et al., 2005). 

There are a large number of studies in which the 

association of varies gene polymorphisms with IS 

has been investigated (Kubo, 2008; Debette and 

Seshadri, 2009; Matarin et al., 2009; Wang et al., 

2009; Low et al., 2011), but only in one of them the 

MGP SNPs were a subject of interest (del Rio- 

Espinola et al., 20<strong>10</strong>). 

The purpose of the present study was to 

investigate the association of three MGP SNPs (T- 

138C, G-7A, Thr83Ala) with IS in the Ukrainian 

population. 

Materials and methods 

Study groups 

The study recruited 170 IS patients (57,6% men 

and 42,4% women) 40 to 85 years of age (mean age 

[± SE] 64,7±0,7) admitted to Sumy Clinical 

Hospital No.5. A final diagnosis of IS was 

established on the basis of clinical, computed 

tomography and magnetic resonance imaging 

examinations. Each case of IS was assessed 

according to TOAST criteria (Adams et al., 1993). 

The patients with IS of cardioembolic origin and 

undetermined etiology were excluded from the 

study group. The control group consisted of 124 

clinically healthy individuals with the absence of 

cardio- and cerebrovascular pathologies, as 

confirmed by medical history, ECG, and 

measurement of arterial pressure and biochemical 

data. The study had been previously approved by 

the Ethic Committee of the Medical Institute of 

Sumy State University. Appropriate informed 

consent was obtained from all patients and control 

subjects. The participants were unrelated Ukrainian 

people from the northeastern region of Ukraine. 

Blood sampling for genotyping was performed 

under sterile conditions into 2.7 ml tubes (S- 

Monovette [Sarstedt, Germany]) containing EDTA 

potassium salt as an anticoagulant, samples were 

frozen and stored at -20ºC. 

Genotyping of SNPs 

DNA for genotyping was extracted from the venous 

blood using commercially available kits (Isogene 

Lab Ltd, Russia) according to the manufacturer’s 

protocol. To identify MGP SNPs the polymerase 

chain reaction (PCR) with subsequent restriction 

fragment length polymorphism (RFLP) analysis 

was performed as previously described (Garbuzova 

et al., 2012). Briefly, specific regions of the MGP 

gene were amplified using pairs of specific primers.

For T-138C polymorphism (rs1800802) they 

were (F) 5`- 

AAGCATACGАТGGCCAAAACTTCTGCA-3` 

and (R) 5`- 

GAACTAGCAТТGGAACTTTTCCCAACC-3`; 

for G-7A polymorphism (rs1800801): (F) 5`- 

CTAGTTCAGTGCCAACCCTTCCCCACC-3` 

and (R) 5`- 

TAGCAGCAGTAGGGAGAGAGGCTCCCA-3`; 

for Thr83Ala polymorphism (rs4236): (F) 5`- 

TCAATAGGGAAGCCTGTGATG-3` and (R) 5`- 

AGGGGGATACAAAATCAGGTG -3`. PCR 

products were digested using restriction enzymes: 

BseNI (for T-138C), NcoI (for G-7A), and Eco477 

(for Thr83Ala). The restriction fragments were 

separated by electrophoresis and analysed on an 

ethidium bromide-stained 2.5% agarose gel 

visualized using ultraviolet transillumination. 

Statistical analysis 

Using the Pearson χ 2 test, allelic frequencies in 

healthy controls and IS patients were found to be in 

Hardy-Weinberg equilibrium. Statistical analysis 

was performed to assess the independent main and 

Genotype Control group 

(n=124) 

MGP polymorphisms in ischemic stroke 21 

joint effects of all analyzed SNPs. To detect the 

strongest main effect of three MGP SNPs the 

logistic regression method was applied by using 

SPSS 17.0. A comparison of variables between the 

IS subgroups was performed using ANOVA. 

Differences were considered statistically significant 

with a P-value < 0.05. 

Results 

Genotypes of three studied MGP polymorphisms 

are summarized in Table 1. As shown, major allele 

homozygous and heterozygous, and minor allele 

homozygous T-138C polymorphisms of the MGP 

promoter were detected in 61.2%, 31.2% and 7.6% 

of the IS group, respectively (control group: 59.7, 

35.5% and 4.8%). Analysis of the G-7A promoter 

polymorphism yielded respective figures of 35.9%, 

48.8% and 15.3% (control group: 43.5%, 50% and 

6.5%). The distribution of genotypes when 

analyzing Thr83Ala polymorphism (exon 4) was 

39.4%, 48.8% and 11.8% in IS group (control 

group: 34.7%, 53.2% and 12.1). 

Table 1. Genotypes of MGP polymorphisms in patients with ischemic stroke (IS) and control subjects. Data 

presented as n (%). A – major allele; a – minor allele 

Promoter T-138C Promoter G-7A Exon 4 Thr83Ala 

IS group 

(n=170) 

Control group 

(n=124) 

IS group 

(n=170) 

Control group 

(n=124) 

IS group 

(n=170) 

AA 74 (59.7) <strong>10</strong>4 (61.2) 54 (43.5) 61 (35.9) 43 (34.7) 67 (39.4) 

Aa 44 (35.5) 53 (31.2) 62 (50.0) 83 (48.8) 66 (53.2) 83 (48.8) 

aa 6 (4.8) 13 (7.6) 8 (6.5) 26 (15.3) 15 (12.1) 20 (11.8) 

The differences in the distribution of allelic 

variants between the control and IS groups were 

close to the level of statistical significance only for 

the G-7A promoter polymorphism (P=0,051). In 

women, but not in men, the differences between G- 

7A genotypes frequency in IS and controls were 

significant as shown in Table 2. 

Using logistic regression analysis (Table 3), it 

was estimated that A/A genotype (G-7A 

polymorphism) was significantly (P=0.016) 

associated with IS (OR=2.943; 95% CI, 1.218 – 

7.<strong>10</strong>9). Respective analysis for male and female 

subjects is presented in Table 4. Women who were 

minor A-allele homozygotes had a risk of IS more 

then 7 times higher compared with female carriers 

of G/G genotype. 

Some clinical characteristics of IS patients with 

various MGP genotypes are presented in Table 5. 

There were no differences in the studied parameters 

between major allele homozygotes, heterozygotes, 

and minor allele homozygotes for all three 

polymorphisms (with the exception of sex 

distribution for G-7A polymorphism).


Table 2. Genotypes of G-7A MGP promoter polymorphism in female and male patients with ischemic 

stroke (IS) and control subjects. Data presented as n (%). 

Table 3. Results of logistic regression analysis of association between MGP polymorphisms and ischemic 

stroke.Homozygotes by major allele were considered as a reference group. SE – standard error, OR – odds 

ratio, CI – confidential interval 

SNP Genotype 

Women Men 

Genotype Control IS Control IS 

Coefficient of 

regression 

SE 

Wald 

statistic 

Pvalue 

OR 

%95 CI 

Lower 

%95 CI 

Upper 

Promoter T/C -0.186 0.258 0.521 0.470 0.830 0.500 1.377 

T-138C C/C 0.382 0.526 0.527 0.468 1.465 0.522 4.<strong>10</strong>7 

Promoter G/A 0.193 0.253 0.584 0.445 1.213 0.739 1.991 

G-7A A/A 1.079 0.450 5.752 0.016 2.943 1.218 7.<strong>10</strong>9 

Exon 4 Thr/Ala -0.235 0.259 0.824 0.364 0.790 0.476 1.313 

Thr83Ala Ala/Ala -0.265 0.402 0.435 0.5<strong>10</strong> 0.767 0.349 1.687 

Discussion 

Arterial calcification is an abnormal process that 

can greatly increase morbidity and mortality (Lehto 

et al., 1996). MGP is considered one of the most 

relevant physiological inhibitors of soft tissue 

mineralization known today. In mice, targeted 

deletion of the MGP gene causes extensive 

calcification of the elastic lamellae of the 

abdominal aorta (Luo et al., 1997). Extensive 

vascular calcification is also induced when γcarboxylation 

of MGP is inhibited using the 

vitamin K-antagonist, warfarin (Price et al., 1998). 

In the present study, we explored association 

between genetic variation in the MGP gene and the 

risk of IS development. Analysing MGP SNPs, we 

found the G-7A promoter polymorphism to be 

associated with IS in Ukrainian population. We did 

not revealed statistically significant relation 

between the other two studied polymorphisms (T- 

138C, Thr83Ala) and IS. 

Published data on the MGP SNPs association 

with MGP serum concentration and artery 

calcification, and the consequences of 

G/G 18 (40.0) 21 (29.2) 36 (45.6) 40 (40.8) 

G/A 25 (55.6) 34 (47.2) 37 (46.8) 49 (50.0) 

A/A 2 (4.4) 17 (23.6) 6 (7.6) 9 (9.2) 

Total 45 72 79 98 

P-value 0.022 0.798 

atherosclerosis (myocardial infarction in 

particularly) are contradictory. 

Farzaneh et al. (2001) did not find any 

relationship between the G-7A polymorphism and 

serum MGP level in healthy persons (Netherlands), 

but did detect the significant association of T-138C 

polymorphism with above-mentioned parameter. 

The highest level of serum MGP was revealed in 

the C/C homozygotes and the lowest one – in T/T 

homozygotes. 

In contrast to the above study, Crosier et al. 

(2009) found no association of the T-138C 

polymorphism with serum MGP concentration, but 

they showed a significant relationship between the 

other two polymorphisms (G-7A, Tht83Ala) and 

serum MGP levels in the healthy men and women 

(USA). In minor allele homozygotes, the serum 

MGP concentration was the lowest, in major allele 

homozygotes the highest, in heterozygotes the 

intermediate values were registered. 

In the same study, it was shown that all three 

MGP SNPs (T-138C, G-7A, Thr83Ala) are related 

to the coronary artery calcification (CAC) in men, 

but not in women (Crosier et al., 2009).


Table 4. Logistic regression analysis of association between G-7A MGP promoter polymorphism and 

ischemic stroke in male and female subjects. OR – odds ratio, CI – confidential interval 

Sex Allele OR (CI) P-value 

Women A/A vs. G/G 7.286 (1.479-35.895) 0.015 

G/A vs. G/G 1.166 (0.516-2.632) 0.712 

Men A/A vs. G/G 1.350 (0.437-4.166) 0.602 

G/A vs. G/G 1.192 (0.641-2.217) 0.579 

Table 5. Clinical characteristics of ischemic stroke patients with respect to genotypes. Data are mean ± SE. 

A/A A/a a/a P 

T-138C polymorphism 

n <strong>10</strong>4 53 13 

Age, years 65.4±0.92 63.0±1.39 64.7±2.13 0.288 

Gender, M/F 58/46 35/18 5/8 0.162* 

BMI (M), kg/m 2 27.8±0.56 27.4±0.64 28.1±1.22 0.862 

BMI (F), kg/m 2 29.1±0.74 29.4±0.93 29.0±1.17 0.789 

Systolic BP, mmHg 168±2.9 165±3.6 168±9.8 0.780 

Diastolic BP, mmHg 96±1.7 94±1.8 93±3.8 0.628 

Fasting glucose, mmol/L 5.9±0.15 5.9±0.2 6.1±0.53 0.916 

G-7A polymorphism 

n 61 83 26 

Age, years 63.0±1.15 65.3±1.04 66.8±2.09 0.164 

Gender, M/F 40/21 49/34 9/17 0.026* 

BMI (M), kg/m 2 27.2±0.45 27.9±0.68 28.6±1.53 0.536 

BMI (F), kg/m 2 28.3±0.8 29.9±0.86 28.2±1.13 0.315 



Fasting glucose, mmol/L 5.8±0.18 6.0±0.17 6.2±0.35 0.481 

Thr83Ala polymorphism 

n 67 83 20 

Age, years 65.1±1.2 64.4±1.0 64.7±2.1 0.912 

Gender, M/F 44/23 45/38 9/11 0.176* 

BMI (M), kg/m 2 27.6±0.47 27.6±0.67 28.3±1.9 0.891 

BMI (F), kg/m 2 29.4±0.84 28.6±0.78 29.9±1.53 0.668 



Fasting glucose, mmol/L 5.9±0.2 6.0±0.17 5.9±0.3 0.859


In some studies, MGP polymorphisms were 

also shown to be associated with arterial 

calcification and myocardial infarction (MI) 

(Herrmann et al., 2000; Brancaccio et al., 2005), 

while in others (Kobayashi et al., 2004; Taylor et 

al., 2005) no association between MGP SNPs and 

cardiovascular events was found. Moreover, in the 

studies in which such associations were reported, 

the relationship between the type of MGP 

polymorphism and arterial calcification was 

different. For example, in the AXA study, the 

minor alleles -7A and 83Ala were associated with 

increased femoral artery calcification (Herrmann et 

al., 2000), while in the above-mentioned study by 

Crosier et al. (2009), the same alleles were linked 

to a decreased level of CAC. 

It should be noted that the majority of studies 

cited here was devoted to the relation of MGP to 

CAC and MI. As to cerebral artery atherosclerosis 

and its severe events such as IS, the role of arterial 

calcification in this disease and the association of 

MGP with cerebrovascular pathology were the 

subject of investigation and discussion only in a 

few publications. In particular, Bos et al. (2011) 

established a close relationship between 

calcification in the various vessel beds outside the 

brain and imaging markers of vascular brain 

disease. Calcification in each vessel bed was 

shown to be associated with the presence of 

cerebral infarcts and with larger volume of white 

matter lesions (WMLs). The most prominent 

associations were found between the intracranial 

carotid calcification and WML volume and 

between the extracranial carotid calcification and 

infarcts. 

Acar et al. (2012) studied a relationship of 

serum MGP levels to the development of 

intracerebral hemorrhages (ICH) and found that in 

patients with ICH, serum MGP concentration was 

much lower than in control group. Moreover, in the 

non-survivors, the serum MGP levels were 

statistically significantly lower in comparison to the 

survivors. According to the authors, measurement 

of this parameter may be of value to estimate 

mortality. 

At present, there are only a few publications 

concerning relation of the MGP SNPs to 

cerebrovascular disease. Analysing 236 

polymorphisms, del Rio-Espinola et al. (20<strong>10</strong>) 

showed that only two of them (G-7A of MGP and 

T-1C of CD40) were related to the brain vessel 

reocclusion after fibrinolysis in IS patients. In our 

study, it was shown that the G-7A polymorphism of 

MGP was associated with IS. In our previous 

investigation (Harbusova et al., 2011), this variant 

of the MGP promoter polymorphism was found to 

be in association with the acute coronary syndrome 

(ACS). Minor allele homozygotes (A/A) had 

significantly higher risk of ACS as well as IS. This 

could means that there are some common 

mechanisms of pathogenesis in both ACS and IS 

concerning to MGP. Those may be atherosclerosis, 

arterial calcification, and thrombosis. 

The relation of MGP to blood vessels 

calcification is well known (see above). With 

respect to coagulation and thrombi formation, it can 

be suggested that MGP is somehow connected with 

these processes (Krueger et al., 2009). Such an 

assumption is based on the fact that MGP belongs 

to vitamin K-dependent proteins, a large number of 

which are procoagulants (prothrombin, factor V, 

etc) and can influence blood clotting and thrombi 

formation in the coronary and cerebral arteries. In 

some papers (Wallin et al., 2008), an antagonistic 

relationship between calcification and coagulation 

is discussed. Therefore, MGP can be considered as 

a connecting link between these two processes. 

Certainly, this assumption requires experimental as 

well as clinical proofs, and research in this 

direction should be continued. 

References 

Abedin M, Tintut Y, Demer LL. Vascular 

calcification. Mechanisms and clinical 

ramifications. Arterioscler Thromb Vasc Biol. 

24: 1161-1170, 2004. 

Acar A, Cevik MU, Arıkanoglu A, Evliyaoglu 

O, Basarılı MK, Uzar E, Ekici F, Yucel 

Y, Tasdemir N. Serum levels of calcification 

inhibitors in patients with intracerebral 

hemorrhage. 

232, 2012. 

Int J Neurosci. 122: 227- 

Adams HP, Bendixen BH, Kappelle LJ, Biller 

J, Love BB, Gordon DL, Marsh EE. 

Classification of subtype of acute ischemic 

stroke. Definitions for use in a multicenter 

clinical trial. TOAST. Trial of Org <strong>10</strong>172 in 

Acute Stroke Treatment. Stroke. 24: 35-41, 

1993. 

Bos D, Ikram MA, Elias-Smale SE, Krestin 

GP, Hofman A, Witteman JC, van der Lugt 

A, Vernooij MW. Calcification in major vessel 

beds relates to vascular brain disease. 

Arterioscler Thromb Vasc Biol. 31: 2331-2337, 

2011.

Brancaccio D, Biondi ML, Gallieni M, Turri O, 

Galassi A, Cecchini F, Russo D, Andreucci V, 

Cozzolino M. Matrix Gla protein gene 

polymorphisms: clinical correlates and 

cardiovascular mortality in chronic kidney 

disease patients. Am J Nephrol. 25: 548-552, 

2005. 

Cancela L, Hsiehg CL, Francket U, Price PA. 

Molecular structure, chromosome assignment, 

and promoter organization of the human matrix 

Gla protein gene. J Biol Chem. 265: 15040- 

15048, 1990. 

Crosier MD, Booth SL, Peter I, Dawson-Hughes B, 

Price PA, O'Donnell CJ, Hoffmann U, 

Wiilliamson MK, Ordovas JM. Matrix Gla 

protein polymorphisms are associated with 

coronary artery calcification. J Nutr Sci 

Vitaminol. 55: 59-65, 2009. 

Debette S, Sechardi S. Genetics of 

atherothrombotic and lacunare stroke. Circ 

Cardiovasc Gen. 2: 191-198, 2009. 

del Río-Espínola A, Fernández-Cadenas I, Rubiera 

M, Quintana M, Domingues-Montanari S, 

Mendióroz M, Fernández-Morales J, Giralt D, 

Molina CA, Alvarez-Sabín J, Montaner J. 

CD40-1C>T polymorphism (rs1883832) is 

associated with brain vessel reocclusion after 

fibrinolysis in ischemic stroke. 

Pharmacogenomics. 11: 763-772, 20<strong>10</strong>. 

Doherty TM, Fitzpatrick LA, Inoue D, Qiao JH, 

Fishbein MC, Detrano RC, Shah PK, 

Rajavashisth TB. Molecular, endocrine, and 

genetic mechanisms of arterial calcification. 

Endocrine Rev. 25: 629-672, 2004. 

Farzaneh-Far A, Davies JD, Braam LA, Spronk 

HM, Proudfoot D, Chan SW, O'Shaughnessy 

KM, Weissberg PL, Vermeer C, Shanaham CM. 

A polymorphism of the human matrix γcarboxyglutamic 

acid protein promoter alters 

binding of an activating protein-1 complex and 

is associated with altered transcription and 

serum levels. J Biol Chem. 276: 32466-32473, 

2001. 

Garbuzova VYu, Gurianova VL, Story DA, 

Dosenko VE, Parkhomenko AN, Ataman AV 

Association of matrix Gla protein gene allelic 

polymorphisms (G -7 →A, T -138 →C and 

Thr83→Ala) with acute coronary syndrome in 

the Ukrainian population. Exp Clin Cardiol. 17: 

30-33, 2012. 


Giachelli CM. Vascular calcification mechanisms. 

J Am Soc Nephrol. 15: 2959-2964, 2004. 

Guzman RJ. Clinical, cellular, and molecular 

aspects of arterial calcification. J Vasc Surg. 45 

(Suppl A): A57-A63, 2007. 

Harbusova VYu, Hurianova VL, Parkhomenko 

OM, Dosenko VE, Ataman OV. The frequency 

of allelic polymorphism of matrix Gla-protein 

gene in acute coronary syndrome patients. 

Fiziol Zh. 57: 16-24, 2011. 

Herrmann SM, Whatling C, Brand E, Nikaud V, 

Gariepy J, Simon A, Evans A, Ruidavets LB, 

Arveiler D, Luc G, Tiret L, Henney A, Cambien 

F. Polymorphisms of the human matrix Gla 

protein (MGP) gene, vascular calcification, and 

myocardial infarction. Arterioscler Thromb 

Vasc Biol. 20: 2386-2393, 2000. 

Kobayashi N, Kitazawa R, Maeda S, Schurgers LJ, 

Kitazawa S. T-138C polymorphism of matrix 

Gla protein promoter alters its expression but is 

not directly associated with atherosclerotic 

vascular calcification. Kobe J Med Sci. 50: 69- 

81, 2004. 

Krueger T, Westenfeld R, Schurgers LJ, 

Brandenburg VM. Coagulation meets 

calcification: The vitamin K system. Int J Artif 

Organs. 32: 67-74, 2009. 

Kubo M. Genetic risk factors 

of ischemic stroke identified by a genome-wide 

association study. Brain Nerve. 60: 1339-1346, 

2008. 

Lehto S, Niskanen L, Suhonen M, Rönnemaa T, 

Laasko M. Medial artery calcification. A 

neglected harbinger of cardiovascular 

complications in non-insulin-dependent diabetes 

mellitus. Arterioscler Thromb Vasc Biol. 16: 

978-988, 1996. 

Low HQ, Chen CP, Kasiman K, Thalamuthu A, Ng 

SS, Foo JN, Chang HM, Wong MC, Tai ES, Liu 

J. A comprehensive association analysis of 

homocysteine metabolic pathway genes in 

Singaporean Chinese with ischemic stroke. 

PLoS One. 6: e24757, 2011. 

Luo G, Ducy P, McKee MD, Pinero GJ, Loyer E, 

Behringer RR, Karsenty G. Spontaneous 

calcification of arteries and cartilage in mice 

lacking matrix Gla protein. Nature. 386: 78-81, 

1997.


Matarin M, Brown WM, Dena H, Britton A, De 

Vrieze FW, Brott TG, Brown RD, Worrall BB, 

Case LD, Chanock SJ, Metter EJ, Ferruci L, 

Gamble D, Hardy JA, Rich SS, Singleton A, 

Meschia JF. Candidate gene polymorphisms for 

ischemic stroke. Stroke. 40: 3436-3442, 2009. 

Murshed M, Schinke T, McKee MD, Karsenty G. 

Extra cellular matrix mineralization is regulated 

locally: different roles of two Gla-containing 

proteins. J Cell Biol. 165: 625-630, 2004. 

Post W, Bielak LF, Ryan KA, Cheng YC, Shen H, 

Rumberger JA, Sheedy PF, Shuldiner AR, 

Peyser PA, Mitchell BD. Determinants of 

coronary artery and aortic calcification in the 

Old Order Amish. Circulation. 115: 717-724, 

2007. 

Price PA, Faus SA, Williamson MK. Warfarin 

causes rapid calcification of the elastic lamellae 

in rat arteries and heart valves. Arterioscler 

Thromb Vasc Biol. 18: 1400-1407, 1998. 

Proudfoot D, Shanahan CM. Molecular 

mechanisms mediating vascular calcification: 

role of matrix Gla protein. Nephrology 

(Carlton). 11: 455-461, 2006. 

Schurgers LJ, Teunissen KJF, Knapen MHJ, 

Kwaijtaal M, van Diest R, Appels A, 

Reutelingsperger CP, Cleutjens JPM, Vermeer 

C. Novel conformation-specific antibodies 

against matrix gamma-carboxyglutamic acid 

(Gla) protein. Arterioscler Thromb Vasc Biol. 

25: 1629-1633, 2005. 

Taylor BC, Schreiner PJ, Doherty TM, Fornage M, 

Carr JJ, Sidney S. Matrix Gla protein and 

osteopontin genetic associations with coronary 

artery calcification and bone density: the 

CARDIA study. Hum Genet. 116: 525-528, 

2005. 

Wallin R, Schurgers L, Wajih N. Effects of the 

blood coagulation vitamin K as an inhibitor of 

arterial calcification. Thromb Res. 122: 411- 

417, 2008. 

Wang X, Cheng S, Brophy VH, Erlich HA, 

Mannhalter C, Berger K, Lalouschek W, 

Browner WS, Shi Y, Ringelstein EB, Kessler C, 

Luedemann J, Lindpaintner K, Liu L, Ridker 

PM, Zee RY, Cook NR. A meta-analysis of 

candidate gene polymorphisms and ischemic 

stroke in 6 study populations: association of 

lymphotoxin-alpha in nonhypertensive patients. 

Stroke. 40: 683-695, 2009. 

Weissen-Plenz G, Nitschke Y, Rutsch F. 

Mechanisms of arterial calcification: spotlight 

on the inhibitors. Adv Clin Chem. 46: 263-293, 

2008.




 

Survivin geni -625G/C polimorfizminin Küçük Hücreli Dışı Akciğer 

Kanseri ile ilişkisinin araştırılması 

Engin AYNACI 1 , Ender COŞKUNPINAR 2 , Ayşe EREN 2 , Onur KUM 1 , Yasemin 

MÜŞTERİ OLTULU 2 , Nergiz AKKAYA 2 , Akif TURNA 3 , İlhan YAYLIM 2 , Pınar 

YILDIZ *1 . 

1 Yedikule Chest Diseases and Thoracic Surgery Training Hospital, Istanbul, Turkey 

2 Department of Molecular Medicine, Institute of Experimental Medicine, Istanbul University, Istanbul, 

Turkey 

3 Cerrahpaşa Medicine Faculty, Department of Thoracic Surgery, Istanbul University, Istanbul, Turkey 

(*author for correspondence; pinary70@yahoo.com) 

Received: 14 February 2012; Accepted: 21 May 2012 

Özet 

Akciğer kanseri tüm kanser türleri arasında görülme sıklığı olarak ikinci sırada, kanser sebepli ölümler 

arasında ise ilk sırada gelmektedir. Survivin geni 17q25 kromozomal bölgesinde lokalizedir ve 142 amino 

asitten oluşan bir protein kodlar. Survivin (BIRC5) apoptozu düzenleyen önemli bir protein ailesi olan 

apoptoz proteinlerinin inhibitörü (IAPs) olarak ilk bulunan inhibitörlerden biridir ve özellikle kanser 

hücrelerinde ifadesi gerçekleşir. Survivin genindeki polimorfizm survivin üretimi ve aktivitesine etki 

edebilir, bu nedenle akciğer kanserine hassasiyet sağlar. Survivin genindeki aşırı ifadenin çok çeşitli 

maligniteleri içeren kanser türlerinde hastalık gelişimi, nüksü ve prognozu ile ilişkili olduğu bilinmektedir. 

Bu çalışmada bir Türk popülasyonunda survivin geni promotör bölgesi üzerinde bulunan -625G/C gen 

polimorfizmi ile küçük hücreli dışı akciğer kanseri arasında, hastalığın gelişimi ile ilgili olası ilişkilerin 

araştırılması amaçlandı. Çalışmaya 146 hasta, 98 kontrol olgu dahil edildi. Yöntem olarak PCR-RFLP tekniği 

kullanıldı. Sonuç olarak survivin -625G/C genotip dağılımları incelendiğinde hasta ve kontrol grupları 

arasında istatistiksel olarak anlamlı fark olmadığı tespit edilmiştir. 

Anahtar kelimeler: Küçük hücreli dışı akciğer kanseri, survivin, gen polimorfizmi, PCR-RFLP, biyobelirteç. 

Investigation of the association of survivin gene -625G/C polymorphism in non-small cell 

lung cancer 


Lung cancer is the second most common cancer type diagnosed and first in cancer related deaths among all 

cancers worldwide. The survivin gene is located on human chromosome 17q25, encoding a protein consisting 

of 142 amino acids. Survivin is one of the first reported inhibitors of apoptosis proteins, which is an 

important family of proteins that regulate apoptosis. Survivin gene polymorphism may affect the survivin 

production and activity, thus providing sensitivity for the development of lung cancer. The overexpression of 

survivin gene was found to be associated with disease development, recurrence and prognosis in various 

malignancies, including cancers. In this study the demonstration of the prognosis related associations 

between the -625G/C gene polymorphism located on the survivin promoter region and non small cell lung 

cancer in a Turkish population was aimed. 146 patients and 98 control subjects included to the study. PCR- 

RFLP technique was used as the method. According to survivin -625G/C genotype distribution analysis, no 

statistically significant difference between patients and controls were found. 

Keywords: Non small cell lung cancer, survivin, gene polymorphism, PCR-RFLP, biomarker.

28 Engin AYNACI et al. 

Giriş 

Akciğer kanseri tüm dünyada kansere bağlı 

ölümlerin önde gelen sebebi olarak bilinmektedir. 

Bununla birlikte özellikle Amerika’da kansere bağlı 

ölüm oranları arasında akciğer kanseri sıklığı 

gitgide azalmakta, fakat Çin gibi sigara tüketiminin 

özellikle son 20 yılda arttığı bazı ülkelerde akciğer 

kanseri sebepli ölüm oranının arttığı 

gözlenmektedir. Amerika’da 2008 yılında 215.020 

yeni vaka belirlenirken, 161.840 kişinin bu hastalık 

sebebiyle öldüğü, kayıtlarda yer almaktadır. 

Akciğer kanserinin küçük hücreli (KHAK) ve 

küçük hücreli dışı (KHDAK) olmak üzere iki tipi 

vardır. Son 60 yıldır akciğer kanserinde hastalık 

gelişiminin kalıtsal bir temele oturduğu 

belirtilmektedir. (Julian et al., 2008). 

Programlanmış hücre ölümü olarak bilinen apoptoz, 

önemli bir hücre büyüme kontrol mekanizmasıdır 

(Yuan-Hung et al., 2009; Thompson, 1995). 

Survivin (BIRC5 olarak da bilinir) apoptozu 

düzenleyen önemli bir protein ailesi olan apoptoz 

proteinlerinin inhibitörü (IAP) olarak ilk bulunan 

inhibitörlerden biridir ve özellikle kanser 

hücrelerinde ifadesi gerçekleşir (Reed,1997). 

Survivin terminal tetikleyici kaspaz-3 ve kaspaz-9 

aktivitesini inhibe ederek her iki apoptoz yolunun 

baskılanmasını bloke eder (Nicholson and 

Thornberry, 1997). Ayrıca survivin apoptotik 

uyarıcıyla indüklenen interlökin (IL-3), Fas 

(CD95), Bax, tümör nekroz faktörü α, kaspazlar ve 

antikanser ilaçlarınının etkisini yok eder (Chan et 

al., 2009; Yun-Hong et al., 2004). Mitozda 

düzenleyici rol oynadığı da çeşitli yayınlarda (Chan 

et al., 2009) bildirilmiş olan survivin geni 17q25 

kromozomal bölgesinde lokalizedir ve 142 amino 

asitten oluşan bir protein kodlar (Chiou et al., 2003; 

Deveraux et al., 1997; Uren et al., 1998). 

Survivin ayrıca mikrotübül dinamiklerinin 

düzenlenmesinde de önemli rol oynar (Li et al., 

1998; Li and Altieri, 1999; Altieri, 2006; Giodini et 

al., 2002). Survivin geni promotör bölgesindeki 

polimorfizmler genin transkripsiyonuna etki ettiği 

için gen aktivitesini ve ekspresyonunu değiştirerek 

akciğer kanserine yatkınlık sağlayabilir (Jin Sung et 

al., 2008). 

Survivin hücre döngüsünde G2/M fazında bol 

miktarda eksprese olur ve G1 fazında hızlı 

regülasyon sergiler (Li et al., 1998). Bu durum 

transkripsiyonel basamakta kontrol edilir ve hücre 

döngüsüne bağlı elementler (CDE) ve hücre 

döngüsü homoloji bölgeleri (CHR) survivin 

promotörünün proksimal bölgesinde lokalize olur 

(Masayuki et al., 2000; Li and Altieri, 1999). 

Survivin geni ekspresyon düzeylerindeki artışın 

bazı hastalıklar için prognostik belirteç olabileceği 

düşünülmektedir (Chun-Hua et al., 20<strong>10</strong>). Survivin 

genellikle embriyonik dokularda ifade olur ve 

görülen homozigot mutasyonların erken 

embriyonik dönemde ölümle sonuçlanması bu gen 

ailesinin hücre gelişimi, farklılaşması ve homeostaz 

sürecinde çok önemli rol oynadığını göstermektedir 

(Chan et al., 2009). 

Çeşitli tek-nükleotit polimorfizmleri survivin 

gen bölgesi promotöründe tespit edilmiştir. 

Bunlardan en çok bilineni ve literatürde en fazla 

çalışması yapılmış olan CDE/CHR reseptör 

bağlayıcı bölgede lokalize olan -31G/C gen 

polimorfizmidir. Survivin geninin promotör 

bölgesindeki bu mutasyon sonucu hücre 

döngüsünden bağımsız olarak genin 

transkripsiyonu ve bunun sonucunda da aşırı ifadesi 

görülür (Xu et al., 2004). 

Bu çalışmada KHDAK hastalarında PCR-RFLP 

tekniği kullanılarak survivin geni promotör 

bölgesindekiki -625G/C (rs8073069) 

polimorfizminin bir Türk popülasyonunda KHDAK 

hastalığına yatkınlığı araştırılmıştır. 

Akciğer kanseri ile ilgili olarak eldeki verilerin 

doğru olarak kullanılması ve buna ek olarak 

hastalık oluşumu ya da gelişiminin anlaşılmasına 

yönelik belirteçlerin ve genetik mekanizmaların 

anlaşılması özellikle hastalığın erken tanısı ve 

tedavi sürecinde bu hastalar için anlamlı olacaktır. 

Materyal ve metod 

Örneklerin tanımı 

Çalışma ile ilgili olarak öncelikle İstanbul 

Üniversitesi İstanbul Tıp Fakültesi Etik 

Değerlendirme Komisyonu’ndan 09.06.20<strong>10</strong> tarih 

ve 20<strong>10</strong>/228-36 dosya numarası ile etik kurul onayı 

alındı. Çalışmaya Yedikule Göğüs Hastalıkları ve 

Göğüs Cerrahisi Eğitim ve Araştırma Hastanesi 3. 

Klinikte ve İstanbul Üniversitesi Cerrahpaşa Tıp 

Fakültesi Göğüs Cerrahisi Kliniğinde tanı konulan 

toplam 146 KHDAK olgusu ile yine aynı 

kliniklerde tetkik edilen ve kronik hastalık veya 

malignite bulgusu saptanmayan 98 sağlıklı kontrol 

olgusu alındı. Çalışmaya girmeyi kabul edenlere 

gönüllü olur imzaladıktan sonra 1 adet EDTA’lı 

tüpe <strong>10</strong> ml kanları alınarak soğuk zincirle 

laboratuvara ulaştırıldı. 

DNA izolasyonu 

Gönüllülerden alınan kanlardan High Pure PCR 

Template Preparation Kit (Roche, Manheim) 

protokolüne uygun olarak genomik DNA

izolasyonu yapıldı ve daha sonra Nano Drop 

Spektrofotometre kullanılarak, elde edilen 

DNA’ların konsantrasyonları ölçüldü. DNA’lar 

konsantrasyonları <strong>10</strong>0 ng/μl olacak şekilde 

seyreltildi. 

PCR 

Survivin geni promotör bölgesindeki -625G/C 

polimorfizmine özgü primerler (Tablo 1) dizayn 

edildi. PCR, total hacim 25 µl ve <strong>10</strong>X PCR Buffer 

(MBI Fermentas), 1mM MgCl2, 0.2 mM dNTP, 

 

KHDAK’de survivin polimorfizmi 29 

0.375 mM her bir primer, <strong>10</strong>0 ng genomik DNA ve 

1 U Taq DNA polimeraz (MBI Fermentas) olacak 

şekilde dizayn edildi. Amplifikasyon şartları, 

95°C’de <strong>10</strong> dakika ilk denatürasyondan sonra 

95°C’de 45 saniye, 72°C’de 60 saniye 5 döngü, 

takiben 94°C’de 45 saniye, 60°C’de 45 saniye ve 

72°C’de 60 saniye 30 döngü, uzama aşamasında da 

<strong>10</strong> dakika 72°C’de olacak şekilde düzenlendi. 

Optimum amplifikasyon şartları sağlanarak PCR 

ürünleri %2 lik agaroz jel elektroforezinde 

yürütüldü. 

Tablo 1. Survivin geni promotör -625 G/C bölgesi primerleri (FP: İleri Primer, RP: Geri Primer) 

Polimorfizm Primer Dizileri PCR Ürün boyu 

-625C/G 

(rs8073069) 

Restriksiyon analizi 

FP: 5’-TGTTCATTTGTCCTTCATGCGC-3’ 

RP: 5’-CCAGCCTAGGCAACAAGAGCAA-3’ 

Amplifiye olan PCR ürünleri BstUI restriksiyon 

enzimi ile uygun tamponu içeren karışım 

hazırlandıktan sonra 37°C de 4 saat inkübe edildi. 

Kesim ürünleri % 3’lük agaroz jelde <strong>10</strong>0 volt 

elektrik altında, 20 dakika yürütüldükten sonra UV 

altında incelenerek genotipler tespit edildi. 

İstatistiksel analiz 

AJJC tarafından yayınlanmış olan evrelendirme 

sistemine göre tümör evrelendirmesi yapılan hasta 

olguları ve kontrollere ait veriler SPSS 15.0 

programına yüklendi ve kategorik verilerin 

karşılaştırılmasında ki-kare testi ve parametrik ttesti 

kullanıldı. 

Şekil 1. Survivin geni -625 G/C bölgesi PCR 

görüntüsü 

Sonuçlar 

125 bç 

BstUI kesimi sonrası 

ürün boyları 

CC: 125 

CG: 125/<strong>10</strong>4/21 

GG: <strong>10</strong>4/21 

Çalışmaya 146 KHDAK hastası ve 98 kontrol olgu 

dahil edildi. Hastaları yaş ortalaması 60,41 yaş 

(±9,71), kontrol olgularının yaş ortalaması 55,23 

yaş (±8,8.) di. Çalışmaya dahil edilen hastalardan 

132’si erkek (%90,4), 14’ü kadın (%9,6), kontrol 

grubu olgularının ise 56’sı erkek (%57,1), 42’si 

kadındı (%42,9). Hasta ve kontrol grubuna ait 

genotip ve alel dağılımları Tablo 2’de verilmiştir. 

PCR sonucu elde edilen bant boyu 125 baz çifti 

büyüklüğünde (Şekil 1); BstUI restriksiyon enzimi 

kesimi sonucu elde edilen bant büyüklükleri ise 

125, <strong>10</strong>4 ve 21 baz çifti olarak görüntülendi (Şekil 

2). 

Şekil 2. BstUI kesimi %3’lük 

jel elektroforezi görüntüsü. M: 50 bp DNA markörü


 

Tablo 2. Hasta ve kontrol grubuna ait genotip ve alel dağılımları 

Genotipler ve Alel 

dağılımları 

Kontrol 

Grubu 

N=98 

Hasta 

Grubu 

N=146 

-625G/C N % N % 

GG 56 57.1 72 49.3 

GC 32 32.7 57 39.1 

CC <strong>10</strong> <strong>10</strong>.2 17 11.6 

Aleller 

P değeri χ2 

0.484 1.45 

tamamlamış 

yapmış 

yapmış 

G 

C 

144 

52 

56.06 

43.94 

201 

91 

58.59 

41.41 

0.27 1.21 

Tartışma 

düzeyindeki artışın -31G/C polimorfizmi ile ilişkili 

olduğunu ve bu artışın hem mRNA düzeyinde hem 

de protein düzeyinde meydana geldiğini 

Kanser oluşumunda apoptoz mekanizmasındaki 

bozukluklar önemli rol oynamaktadır. Apoptoz, 

farklı inhibe ve aktive edici ajanlar tarafından 

kontrol altında tutulan önemli bir olaydır. Kanserde 

apoptozun çeşitli anti-apoptotik proteinler 

tarafından inhibisyonu söz konusudur. 

Survivin, hücre döngüsünün düzenlenmesinde 

temel rol oynayan başlıca anti-apoptotik faktördür. 

Ayrıca survivinin Bcl-2 ve diğer IAPlerin aksine 

farklılaşmasını normal dokularda 

anlatımı olmayan ancak çeşitli kanser tiplerinde 

ifade edilen bir protein olduğu bilinmektedir. Bu 

durum survivin genindeki anormal ifadenin 

transkripsiyonel regülasyon bozukluğuna sebep 

olduğunun açık bir göstergesidir. Apoptozu inhibe 

eden diğer proteinlerde de bulunan BIR 

(“Baculovirus IAP Repeat”) bölgesi ile kaspazlara 

bağlanarak etkisini göstermektedir. Dai ve ark. 

20<strong>10</strong> yılında yaptıkları çalışmada survivin geni 

promotor bölgesindeki polimorfizmlerin 

KHDAK’de gen modifikasyonuna neden 

olabileceğini ileri sürmüşlerdir. 

Jang ve ark. tarafından yapılan çalışmada -31 G 

alelinin -31 C aleline göre önemli derecede düşük 

transkripsiyonel aktiveye sahip olduğu ve bu 

durumun -31G/C polimorfizminden etkilenerek 

ortaya çıktığı ve buna bağlı olarak -31G/C 

polimorfizminin akciğer kanserine yatkınlıkta 

önemli bir rolü olduğu belirtilmektedir. (Jang et al., 

2008). Xu ve ark. kanser hücre hatları ile 

oldukları bir çalışmada survivin gen ifadesi 

. 

bildirmişlerdir. 

Klinik perspektiften bakıldığında kişisel 

paternlerle klinik özelliklerin öngörülmesinde 

hastaların genetik parmak izinde survivin geni 

ifadesi düzeylerinde ve genetik varyantlarda oluşan 

değişikliklerin olası tedaviye yanıtta erken bir 

belirteç olabileceğini söylemek mümkündür. 

Örneğin plevral efüzyondaki yüksek survivin 

düzeylerinin kötü prognoz göstergesi olduğu Lan 

ve ark. 20<strong>10</strong> yılındaki yayınında gösterilmiştir. 

Yang ve ark 2009 yılında özefagus kanserli 

hastalarda yaptıkları bir çalışmada C alleline sahip 

olmanın hastalık riskini 1.4 kat arttırdığını 

söylemektedirler. Özefagus kanseri hastalarında 

survivin -625G/C promotor polimorfizminin p53 

düzeyine bağlı olan survivin yüksek ifadesi 

olasılığını artırdığı düşünülmektedir. 

Sonuç olarak bir Türk popülasyonu üzerinde 

olduğumuz bu çalışmada survivin geni -625 

G/C bölgesi (rs8073069) polimorfizminin küçük 

hücreli dışı akciğer kanseri hastalığına yatkınlık 

sağladığına dair herhangi bir bulgu elde edilemedi. 

Ancak olgu sayısının artırılması ve polimorfik 

bölgenin özellikle transkripsiyonun aktivitesine etki 

eden promotör bölgesinde olmasından dolayı 

yapılabilecek ekspresyon çalışmaları ile özellikle 

tanı öncesi ve sonrası gen anlatım ifadesine bağlı 

değişikliklerin öngörülmesine yardımcı olabilecek 

daha anlamlı sonuçlara ulaşılabileceği 

kanaatindeyiz.

Kaynaklar 

Altieri DC. Survivin apoptosis: an interloper 

between cell death and proliferation in cancer. 

Lab Invest. 79: 1327-1333, 1999. 

Altieri DC. The case for survivin as a regulator of 

microtubule dynamics and cell-death decisions. 

Curr Opin Cell Biol. 18: 609-615, 2006. 

Chan H. Han, Qingyi Wei, Karen K. Lu, 

Zhensheng Liu, Gordon B. Mills, Li-E Wang. 

Polymorphisms in the survivin promoter are 

associated with age of onset of ovarian cancer. 

Int J Clin Exp Med. 2: 289-299, 2009. 

Chiou SK, Jones MK, Tarnawski AS. Survivin an 

anti-apoptosis protein: its biological roles and 

implications for cancer and beyond. Med Sci 

Monit. 9:I25-I29, 2003. 

Chun-Hua Dai, Jian Li, Shun- Bing Shi, Li- Chao 

Yu, Li-Ping Ge, Ping Chen, Survivin and Smac 

Gene Expressions but not Livin Are Predictors 

of Prognosis in Non-small Cell Lung Cancer 

Patients Treated with Adjuvant Chemotherapy 

Following Surgery. Jpn J Clin Oncol. 2-9, 

20<strong>10</strong>. 

Dai J, Jin G, Dong J, Chen Y, Xu L, Hu Z, Shen H. 

Prognostic significance of survivin 

polymorphisms on non-small cell lung cancer 

survival. J Thorac Oncol. 20<strong>10</strong> 

Nov;5(11):1748-54. PubMed PMID: 20881643. 

Deveraux QL, Takahashi R, Salvesen GS and Reed 

JC. X-linked IAP is a direct inhibitor of celldeath 

proteases. Nature. 388: 300-304, 1997. 

Giodini A, Kallio MJ, Wall NR, Gorbsky GJ, Tognin 

S, Marchisio PC, Symons M and Altieri 

DC. Regulation of microtubule stability and 

mitotic progression by survivin. Cancer Res. 

62: 2462-2467, 2002. 

Jang JS, Kim KM, Kang KH, Choi JE, Lee WK, 

Kim CH, Kang YM, Kam S, Kim IS, Jun JE, 

Jung TH, Park JY. Polymorphisms in the 

survivin gene and the risk of lung cancer. Lung 

Cancer. Apr;60(1):31-9, 2008. 

Jin Sung Jang,,Kyung Mee Kim, Kyung Hee Kang, 

Jin Eun Choi, Won Kee Lee, Chang Ho Kim, 

Young Mo Kang, Sin Kam, In-San Kim, Jae 

Eun Jun, Tae Hoon Jung, Jae Young Park. 

Polimorphizms in the survivin gene and the risk 

of lung cancer. Lung Cancer. 60:31-39, 2008. 

KHDAK’de survivin polimorfizmi 31 

Julian R. Molina, Ping Yang, Stephen D. Cassivi, 

Steven E. Schild,, Alex A. Adjei, Non–Small 

Cell Lung Cancer: Epidemiology, Risk Factors, 

Treatment, and Survivorship. Mayo Clin 

Proc.83(5): 584–594.,2008. 

Lan CC, Wu YK, Lee CH, Huang YC, Huang CY, 

Tsai YH, Huang SF, Tsao TC. Increased 

survivin mRNA in malignant pleural effusion is 

significantly correlated with survival. Jpn J Clin 

Oncol. Mar;40(3):234-40, 20<strong>10</strong>. 

Li F, Ambrosini G, Chu EY, Plescia J, Tognin S, 

Marchisio PC and Altieri DC. Control of 

apopto-sis and mitotic spindle checkpoint by 

survivin. Nature. 396: 580-584, 1998. 

Li F.,Altieri DC. The cancer antiapoptosis mouse 

survivin gene: characterization of locus and 

transcriptional requirements of basal and cell 

cycle-dependent expression. Cancer Res.59: 

3143-3151, 1999. 

Masayuki Otaki, Masahiko Hatano, Koichi 

Kobayashi, Takeshi Ogasawara, Takayuki 

Kuriyama, Takeshi Tokuhisa Cell cyledependent 

regulation of TIAP/m-survivin 

expression. Biochim Biophys Acta. 1493:188- 

194, 2000. 

Nicholson DW,Thornberry NA. Caspase:killer 

proteases. Trends Biochem Sci. 22:299-306, 

1997. 

Reed JC. X-linked IAP is a direct inhibitor of celldeath 

proteases. Nature. 388: 300-304, 1997. 

Thompson CB. Apoptosis is the pathogenesis and 

treatment of disease. Science. 5267:1456-1462, 

1991. 

Uren AG, Coulson EJ and Vaux DL. Conserva-tion 

of baculovirus inhibitor of apoptosis repeat 

proteins (BIRPs) in viruses, nematodes, vertebrates 

and yeasts. Trends Biochem Sci. 23: 159- 

162, 1998. 

Xu Y, Fang F, Ludewig G, Jones G, Jones D. A 

mutation found in promoter region of the human 

survivin gene is correlated to overexpression of 

survivin in cancer cells. DNA Cell Biol. 

23:419-429, 2004. 

Yang X, Xiong G, Chen X, Xu X, Wang K, Fu Y, 

Yang K, Bai Y. Polymorphisms of survivin 

promoter are associated with risk of esophageal 

squamous cell arcinoma. J Cancer Res Clin 

Oncol. Oct;135(<strong>10</strong>):1341-9, 2009.


Yang X, Xiong G, Chen X, Xu X, Wang K, Fu Y, 

Yang K, Bai Y. Survivin expression in 

esophageal cancer: correlation with p53 

mutations and promoter polymorphism. Dis 

Esophagus. 2009;22(3):223-30. 

Yuan-Hung Wang, Hung-Yi Chiou, Chang-Te Lin, 

Hsiao-Yen Hsieh, Chia-Chang Wu, Cheng-Da 

Hsu, Cheng-Huang Shen. Association Between 

Survivin Gene Promoter -31C/G Polymorphism 

and Urothelial Carcinoma Risk in Taiwanese 

Population. Urology. 73 (3):670-674, 2009. 

Yun-Hong Li, Chen Wang, Kui Meng, Long-Bang 

Chen, Xiao-Jun Zhou, İnfluence of survivin and 

caspase-3 on cell apoptosis and prognosis in 

gastric carcinoma. World J Gastroenterol. 

<strong>10</strong>(13):1984-1988, 2004




Effects of prenatal and neonatal exposure to lead on white blood 

cells in Swiss mice 

Ragini SHARMA*, Khushbu PANWAR, Sheetal MOGRA 

Environmental and Developmental Toxicology Research Lab, Department of Zoology, M. L. S. University, 

Udaipur- 313001 Rajasthan, India 

(* author for correspondence; taurasragini@yahoo.com) 

Received: 27 August 2011; Accepted: 25 May 2012 


Lead exposure is one of the major environmental issues for children and women of child bearing age. It 

crosses the placental barrier and its greater intestinal absorption in fetus results in developmental defects. 

Lead, as one of the environmental pollutants, can threat the lives of animals and human beings in many ways; 

especially during developing stages. The present study was carried out to study the alterations in different 

types of white blood cells (WBC) due to chronic lead acetate toxicity in neonates, which passes from adult 

pregnant female during gestation and lactation. Lead acetate was administered orally at 8, 16, 32 mg /kg/BW 

to pregnant Swiss mice from <strong>10</strong>th day of gestation to 21th day of lactation. Hematopathological and 

numerical alterations in the WBCs were examined in the neonates after birth at postnatal days 1, 7, 14 and 

21. Blood smears examined illustrate that lead induces disturbances in the development of different types of 

WBCs during postnatal development and lead to an abrupt neutrophilic degeneration, immature cells, 

abnormal neutrophils, reactive and plasmacytoid lymphocytes. The results of the present study emphasize 

that prenatal lead exposure is extremely dangerous to developing fetus. 

Keywords: Lead acetate, Swiss albino mice, prenatal, neonatal, white blood cells. 

Swiss farelerde prenatal ve yenidoğan kurşun maruziyetinin beyaz kan hücreleri üzerine 

etkileri 

Özet 

Kurşun maruziyeti çocuklar ve çocuk doğurma çağındaki kadınlar için majör çevresel konulardan birisidir. 

Plasental bariyeri geçer ve fetusta barsaklardan emilimi, gelişimsel defektlerle sonuçlanır. Çevresel 

kirliliklerden biri olan kurşun, birçok yönden özellikle gelişim çağı boyunca insan ve hayvan hayatını tehdit 

etmektedir. Bu çalışma, yetişkin hamile dişilerden gebelik ve laktasyon süresince yenidoğanlara geçen 

kurşun asetatın yarattığı kronik toksisite sebebiyle lökositlerin farklı tiplerindeki değişimleri incelemek için 

yapılmıştır. Kurşun asetat, hamile Swiss farelere gebeliğin <strong>10</strong>. gününden laktasyonun 21. gününe kadar ağız 

yoluyla 8, 16, 32 mg /kg//BW şeklinde uygulanmıştır. Yenidoğanlarda doğumdan sonraki 1, 7, 14 ve 21. 

günlerde beyaz kan hücrelerindeki hematopatolojik ve sayısal değişiklikler incelenmiştir. Kurşunun doğum 

sonrası gelişim sırasında lökositlerin farklı tiplerinin gelişimindeki bozuklukları indüklediğini ve ani 

nötrofilik olgunlaşmamış dejenerasyona, hücreler, anormal nötrofillere, reaktif ve plazmasitoid lenfositlere 

neden olduğunu göstermek için kan yaymaları incelenmiştir. Bu çalışmanın sonuçları prenatal kurşun 

maruziyetinin gelişen fetus için son derece tehlikeli olduğunu vurgulamaktadır. 

Anahtar kelimeler: Kurşun asetat, Swiss albino fare, prenatal, yenidoğan, lökosit.

34Ragini SHARMA et al. 


Lead has been recognized as a biological toxicant 

and different doses have been used to study leadinduced 

alterations Prenatal exposure to lead 

produces toxic effects in the human fetus, including 

increased risk of preterm delivery, low birth 

weight, and impaired mental development; because 

during the period of early organogenesis the onset 

of greatest susceptibility to teratogenesis occurs 

(Falcon et al., 2003). This highly sensitive or 

critical period is the time during which a small dose 

of a teratogen produces high percentage of fetuses 

that exhibit malformations of the organ in question 

(Wilson, 1973; Desesso et al., 1996). 

Pregnancy and breastfeeding can cause a state 

of physiological stress that increases bone turnover 

of lead. Lead stored in the bone moves into the 

blood, increasing the mother’s blood lead level and 

passing to the fetus, affecting fetal development. 

Lead is tightly bound to red blood cells, enhancing 

transfer from maternal circulation through the 

placenta to the fetus. Fetus is more sensitive to lead 

because the fetal blood-brain barrier is more 

permeable. The toxic effects of lead on blood 

indices are well known. 

Lead potentially induces oxidative stress and 

evidence is accumulating to support the role of 

oxidative stress in the pathophysiology of lead 

toxicity. Lead is capable of inducing oxidative 

damage to brain, heart, kidneys, and reproductive 

organs. The mechanisms for lead-induced oxidative 

stress include the effects of lead on membranes, 

DNA, and antioxidant defense systems of cells 

(Ahamed and Siddiqui, 2007). Lead interferes with 

a variety of body processes and is toxic to the body 

systems including cardiovascular, reproductive, 

hematopoietic, gastrointestinal and nervous systems 

(Kosnett, 2006), renal functions (Patocka and 

Cerny, 2003) and release of glutamate (Xu et al., 

2006). It affects the hematological system even at 

concentrations below <strong>10</strong>μg/dl (ATSDR, 2005). 

Many reports are available regarding lead 

toxicity and its deleterious effects in various 

species of animals and there has been lot of work 

carried out on pharmacokinetics and genotoxicity 

but very few researchers tried to correlate 

haematopathological alterations of lead acetate in 

different white blood cells at different dose levels 

in laboratory animals, especially in mice. 

Therefore the current study was performed to 

clarify the lead induced hematological changes, 

especially those related to white blood cells, during 

gestational and lactational exposure to lead in 

Swiss mice. 


Sexually mature random bred Swiss mice with the 

age of 5-6 weeks, weighing 25-30 gm was used for 

this study. During the entire experimental period, 

the animals were fed on a standard diet and water 

ad libitum. Mice were kept in the ratio of 1:4 males 

and females, respectively, and females showing 

vaginal plugs were separated in the control and lead 

treated group. Lead acetate solution was prepared 

by dissolving 4gm lead acetate in 12ml distilled 

water. Pregnant Swiss mice were given lead acetate 

at a concentration of 8, 16 and 32 mg (266.66, 

533.33, and <strong>10</strong>66.66 mg/kg/bodyweight) from <strong>10</strong> th 

day of gestation to 21 st day of lactation. Blood 

samples were obtained from the tail of pups from 

each litter at days 1,7,14 and 21 day after birth. The 

tip of the tail was cleaned with spirit before being 

cut with a sharp blade and was not squeezed to 

avoid dilution of blood by tissue fluid. 

Blood cells were studied in smears prepared by 

spreading a drop of blood thinly over a clean and 

sterilized microscopic slide with the help of another 

slide moved over the first at the angle of 45ᵒ after 

discarding first drop of blood. These blood films 

were air-dried and fixed in absolute methanol for 

15 minutes by dipping the film briefly in a Coplin 

jar containing absolute methanol. After fixation the 

slides were removed and air-dried. Afterward blood 

smears were stained with freshly made Giemsa 

stain diluted with water buffered to pH 6.8 or 7.0 

(1:9) stain and buffer respectively. The slides were 

washed by briefly dipping the slide in and out of a 

Coplin jar of buffered water and air dried again for 

taking observations. The erythrocytes appear pink 

to purple, whereas leukocytes turned blue black in 

color. All the experimental work was approved by 

the Institutional Animal Ethics Committee. 

No./CS/Res/07/759. 

Group 1- Control (distilled water only). 

Group 2- Exposure to 8 mg lead acetate (266.66 

mg/kg BW) from <strong>10</strong>th day of gestation up to 21st 

day of lactation. 

Group 3- Exposure to 16 mg lead acetate 

(533.33 mg/kg BW) from <strong>10</strong>th day of gestation up 

to 21st day of lactation. 

Group 4- Exposure to 32 mg lead acetate 

(<strong>10</strong>66.66 mg/kg BW) from <strong>10</strong>th day of gestation up 

to 21st day of lactation. 

The statistical analysis was performed following 

t-test for the comparison of data between different 

experimental groups. The data was calculated using

prism software to calculate the p values. <strong>10</strong>0 WBC 

from each group were counted at different weeks, 

different cell types were identified and % ratio was 

calculated. For numerical observation highest dose 

level was selected. 

Results 

In the control group all the WBCs showed normal 

appearance. The neutrophils in control group were 

examined by a very characteristic nucleus with 

condensed chromatin. It is divided into 3-5 lobes 

(Fig.1A, 1, 2, 5 and 6) at birth which was observed 

with an increase by 5 to 6 lobes (Fig.1B, 1 and 3) at 

the termination of lactation, connected by thin 

strands of chromatin. Lymphocytes were round or 

ovoid at the time of birth (Fig. 1A, 3 and 4) but 

further on they were found notched or slightly 

indented (Fig. 1B, 5 and 6). The chromatin was 

generally diffusely dense. Ordinarily, nucleoli were 

not visible. A perinuclear clear zone surrounding 

the nucleus was visible after first week of lactation 

in some cells. The cytoplasm stained light blue and 

ranges from sparse to moderately abundant in 

amount. The monocyte in control group were round 

with smooth margins, the nucleus was oval, 

indented and slightly folded (Fig.1B, 4). The 

chromatin material was moderately clumped and 

relatively less dense compared to that of 

neutrophils or lymphocytes. There was no visible 

nucleolus with abundant cytoplasm. 

The administration of lead acetate altered the 

appearance and caused structural changes. The 

following hematological observations were taken 

during postnatal period from birth till the 

termination of the lactation period upon exposure 

of different doses of lead acetate: 

1. At the time of birth (PND1) 

Abnormal neutrophils: In lead treated groups 

the neutrophils showed structural abnormalities in 

their nucleus including improper segmentation and 

lesser condensation of nucleus. At a lower dose the 

chromatin material was condensed, all the lobes 

were interconnected with each other and form a 

nodule like structure at one side (Fig.1C, 1). 

Degeneration: In lead treated group most of the 

neutrophils appeared in degenerating state in which 

the chromatin material was very less condensed, 

fused and there was no sign of clear lobulization 

and segmentation (Fig. 1C, 2). 

Immature cells: In lead treated group the 

number of immature cells was increased (Fig. 1C, 

3). 

Prenatal and neonatal exposure to lead 35 

Ring shaped: In lead treated groups, some 

neutrophils showed abnormal ring like appearance 

and diffuse chromatin material, with unclear 

cytoplasm. In 32 mg lead treated group 

vacuolization in chromatin material was also 

observed ((Fig. 1C, 4).). 

Lymphocyte: Reactive (Fig. 1C: 5 and 6) and 

cleaved (Fig. C, 5) types of lymphocytes were 

observed in lead treated groups. 

Monocytes: At postnatal day 1 we cannot 

identify any structural change in shape and size of 

monocyte as observed on postnatal day 21. 

2. During first and second week of postnatal period 

(PND7&14) 

The following observations were taken at first to 

second week after birth: 

Degenerated neutrophils: In lead treated group 

overall numbers of neutrophils were increased 

particularly with degenerated neutrophils, however, 

their number was less than postnatal day 1. In 16 

mg lead group on postnatal day 7 the nuclear 

material of neutrophil was less condensed and 

nucleus was divided into 2-3 unequal lobes. The 

cytoplasm of neutrophil appeared colorless. At the 

dose of 32mg lead at postnatal day 7, this severity 

of degeneration was very much increased so that 

the lobes were broken into many small fragments. 

No sign of lobulization and appropriate 

segmentation of neutrophils were found (Fig. 1D, 

1). 

Ring shaped neutrophils: In contrast to 

postnatal day 1, ring like nucleus was not observed 

in lead treated group at postnatal day 7. 

Different types of neutrophils: At higher dose 

32 mg lead treated groups apoptotic or necrotic 

neutrophils were more prominent. These 

neutrophils were characterized by 3-4 separate and 

equal lobes with less condensed chromatin and 

diffuse cytoplasmic region (Fig. 1D, 2). 

Immature cells: Review of the lead treated 

smear revealed that most of the leukocytes were 

myelocytes, bands, myeloblast and other immature 

and unidentified white blood cells with left shift in 

leucocytes. A left shift is an increase in the number 

of band neutrophils and other immature cell of the 

granulocytic lineage in the peripheral blood (Fig. 

1D, 3). 

Various lymphocytes: Administration of lead 

acetate produced great variation in lymphocyte 

structurally as well as numerically. Various types of 

lymphocytes such as plasmacytoid, reactive, oval, 

irregular, binucleated and cleaved lymphocytes 

were identified, whereas only reactive and cleaved


lymphocytes were seen in postnatal day 1, 

exclusively in lead treated group. 

Lead treated group with 16 mg lead acetate 

produced large lymphocytes and most of the 

lymphocytes were having irregular; clumpy and 

smudgy chromatin material with very dense 

nucleus (Fig. 1D, 4). The cytoplasm appeared 

completely absent as the nucleus reached its largest 

size and covered all the cytoplasmic area. Overall, 

number of lymphocytes decreased in most of the 

groups. At higher dose (32 mg lead) the 

plasmacytoid lymphocytes (eccentric nucleus and 

intensely blue / basophilic cytoplasm) (Fig. 1D, 6) 

and reactive lymphocytes were observed. Reactive 

lymphocyte was characterized by relatively very 

large, irregular but flattened nucleus with fine 

chromatin and agranular light blue stained 

cytoplasm (Fig. 1D, 5). 

3. At the end of lactation period (PND21) 

Abnormal nuclear segmentation: It includes 

abnormal segmentation of nucleus, in which the 

nuclear lobes were connected with each other. It 

gave abnormal appearance of nucleus and 

chromatin condensation in most of the neutrophils 

(Fig. 1E, 1). 

Degeneration: In lower doses of lead diffuse 

appearance of chromatin material was observed in 

neutrophils and the lobes were fused with each 

other as any segmentation was not observed, 

whereas in higher lead treated group the neutrophils 

presented fragmented chromatin material and very 

less condensation of nucleus which finally leads to 

cell lysis (Fig. 1E, 2). The nuclear arrangement was 

distorted, as appear that all the lobes were 

intermingled with each other and in some cases 

form a nodule at one side known as sessile nodule 

appeared like hypersegmentation (Fig. 1E, 3). 

Immature cells: In lead treated group the 

numbers of immature cells were increased. A left 

shift i.e. presence of immature neutrophils, bands, 

metamyelocytes, myelocytes and other unidentified 

immature cells were observed (Fig. 1F, 1 to 6). 

Lymphocytes: As the dose level increased the 

number of lymphocytes decreased. In higher dose 

lead treated group the lymphocyte appeared large in 

size with higher volume of cytoplasm. The shape of 

the nucleus also vary from round to elliptical in 

structure, termed as reactive lymphocyte (Fig. 1E, 

4). Some lymphocytes transformed into 

plasmocytoid lymphocyte in which the lymphocyte 

contains basophilic cytoplasm and eccentric 

nucleus (Fig. 1E, 5). 

Monocytes: In lead treated groups the shape and 

structure of the monocyte were modified and the 

shape of the nucleus was also altered from the 

normal reniform (kidney shaped) nucleus. The 

indentation of the nucleus became larger and 

deeper from periphery to center. At higher dose 

level intensity of the indentation was increased so 

that the normal range of nucleo-cytoplasmic ratio 

was disturbed (Fig. 1E, 6). Numerical changes in 

different types of WBC and percent variations in 

different types are incorporated in Table 1 and 2 

respectively. In present investigation, after 

evaluating all the cell types, we can conclude that 

lead acetate at PND 1 and 14 caused significant 

increase in number of neutrophils and decrease in 

lymphocytes, while there was no significant 

difference in the number of neutrophils and 

lymphocytes at PND 7 and 21. 

Table 1. Various types of WBCs at different postnatal days treated with lead acetate. 

Groups Neutrophils Lymphocytes Monocytes 

Control at PND 1 59.25±1.70 38.5±1.29 2.25±1.70 

Lead acetate at PND1 66.00±2.16** 28.25±2.06** 5.75±1.70* 


Lead acetate at PND7 61.75±3.5 37.5±2.88 0.75±0.95 

Control at PND 14 55.25±3.40 44.5±3.<strong>10</strong> 0.25±0.5 

Lead acetate at PND14 61.25±1.70** 37.75±1.70** 1.00±0.81 


Lead acetate at PND21 52.25±4.57 44.00±2.26 3.75±2.75 

Values were expressed as means ± S.D.; 4 animals /group;*=p


Table 2. Percent variation in different types of WBCs in lead treated groups 

Lead acetate at PND1 




Neutrophils Lymphocytes Monocytes 

Normal 12.3% 

Degenerated 12.1% 

Ring shaped 8.2% 

Immature 4.1% 

Abnormal <strong>10</strong>.4% 

Normal 12.6% 

Degenerated 8.4% 

Abnormal 16.8% 

Immature <strong>10</strong>.8% 

Ring shaped 6% 

Normal 19.2% 

Degenerated 19% 

Abnormal 9.6% 

Immature 6.4% 

Apoptotic 6.4% 

Normal 6.18% 

Degenerated18.5% 

Ring shaped 1.5% 

Abnormal 17% 

Immature 7.4% 

Normal 13% 

Reactive 17.33% 

Cleaved 8.6% 

Normal 12.2% 

Plasmacytoid 7.4% 

Reactive 9.8% 

Binucleated 2.4% 

Large 4.2% 

Normal 4% 

Plasmacytoid 4% 

Reactive 12.3% 

Binucleated 8.2% 

Large 4% 

Irregular 2% 

Oval 2% 

Normal <strong>10</strong>% 


Plasmacytoid1.4% 

Reactive 4.4% 

Large 5.8% 

Irregular 5.86% 

Normal 2.0% 

Abnormal 3.7% 


Abnormal 1% 

Normal 2% 

Abnormal 1.7% 

Figure 1. A: Peripheral blood smear of control group showing neutrophil (1-2), lymphocytes (3-4), at the time of birth, 

neutrophils (5-6) during second and third week of lactation. B: Control group showing neutrophil (1), lymphocyte (2), 

during second and third week of lactation, and, neutrophil (3), lymphocytes (4-5) and monocyte (6) at the termination of 

lactation. C: Peripheral blood smear of lead treated group showing abnormal neutrophil (1), degenerated neutrophil (2), 

immature cell (3), ring like neutrophil (4), 5 – cleaved (upper WBC) (5) and reactive (lower WBC) lymphocyte (5 and 6) 

at the time of birth. D: Lead treated group showing degenerated neutrophil (1), necrotic (2), immature cell (3), large 

lymphocyte (4), reactive (5) and plasmacytoid lymphocyte (6) During first and second week of postnatal period. E: Lead 

treated group showing - abnormal neutrophil (1), degenerated neutrophil (2), hypersegmented neutrophil (3), reactive 

lymphocyte (4), plasmacytoid lymphocyte (5) and reactive monocyte (6) at the termination of lactation. F: Lead treated 

group showing different immature cells at the termination of lactation (1- 6). (All Giemsa stain, 450x).


Discussion 

Changes in leukocyte parameters are often one of 

the hallmarks of infection. These include changes 

in number and in cellular morphology. Review of 

the peripheral blood smear can provide significant 

insight into the possible presence of infection. Early 

changes during infection may include an increase in 

the number of bands, even before the development 

of leukocytosis. A great shift to immaturity (left 

shift) may occur when infection is severe, with 

metamylocytes or even earlier forms present on the 

peripheral blood smear. There are many evidences 

of studies conducted on adults and RBC concerning 

lead toxicity, but very few reports are available 

regarding haematopathological alterations of lead 

acetate in different white blood cells. Significant 

decrease in RBC count, hematocrit (Hct) and 

hemoglobin (Hb) were seen in rats and human with 

high blood lead levels. (Alexa et al., 2002; Noori et 

al., 2003; Othman et al., 2004; Toplan et al., 2004) 

In our study the control groups showed all the 

leukocytes in normal appearance. Still some altered 

types of WBCs were also observed. The 

administration of lead acetate alters the structure 

and number of WBCs. The nuclear arrangement 

was also distorted. In lead treated groups the shape 

and structure of the monocyte was also altered with 

reniform (kidney shaped) nucleus. At higher dose 

level this intensity of indentation was increased so 

that the normal range of nucleo-cytoplasmic ratio is 

disturbed and appeared as reactive monocytes. Our 

findings are also in support of DeNicola et al. 

(1991) with the evidence of reactive monocytes 

enclosing the cytoplasm became more intensely 

basophilic and vacuolated. This usually indicates a 

chronic inflammatory process or may be seen with 

hemoplasmas in the cat. 

Toxicity in neutrophils is defined by the 

presence of Döhle bodies (small, basophilic 

aggregates of RNA in the cytoplasm), diffuse 

cytoplasmic basophilia etc. In our study each lead 

treated group in neonatal period, represents 

increased number of degenerated neutrophils 

particularly at birth. In the 16 mg lead exposed 

group, during first week of lactation, the nuclear 

material of cell was less condensed and nucleus 

was divided into 2-3 unequal lobes with colorless 

cytoplasm. At higher dose of 32 mg lead, this 

severity of degeneration was very much increased 

with many small fragments of nuclear material and 

no sign of lobulization and appropriate 

segmentation of neutrophils were observed. 

In a study performed on young dogs, 

development of anemia, leukocytosis, 

monocytopenia, polychromato-philia, glycosuria, 

increased serum urobilinogen, and hematuria has 

been reported (Zook, 1972). Lead suppresses bone 

marrow hematopoiesis, probably through its 

interaction with the enteric iron absorption (Klader, 

1779; Chnielnika, 1994). In some reports, 

leukocytosis has been attributed to the lead-induced 

inflammation (Yagminas et al., 1990). 

Hogan and Adams, (1979) reported a threefold 

increase in neutrophil and monocyte count along 

with severe leukocytosis in the young rats that were 

exposed to lead. The present investigation revealed 

that administration of lead acetate alters the 

appearance and cause structural changes. The 

nuclear arrangement was distorted with 

intermingled lobes and in some cases formed a 

sessile nodule. 

Controversies exist about monocytes; since in 

some studies lead-induced monocytopenia 

(Xintaras, 1992) and in others significant increases 

in monocyte count have been reported (Yagminas 

et al., 1990). The reason for such difference is 

probably due to the extent of lead-induced 

inflammation. 

Mugahi et al. (2003) investigated additional 

hematotoxic effects of lead on the erythroid cell 

lineage and leukocytes following long-term 

exposure in rats. Wahab et al. (20<strong>10</strong>) showed that 

lead caused a significant decrease in hematocrit, 

RBC, WBC, hemoglobin concentration, mean 

corpuscular hemoglobin, mean corpuscular 

hemoglobin concentration and lymphocyte and 

monocyte count; and significant increase in 

neutrophil count. The results of the present study 

are also parallel to the above findings. In lead 

exposed pups there was significant increase in the 

number of neutrophils at different weeks after birth, 

but decrease in the number of lymphocytes. The 

shortened life span of erythrocytes is due to 

increased fragility of the blood cell membrane and 

r<strong>edu</strong>ced hemoglobin production is due to decreased 

levels of enzymes involved in hemesynthesis 

(Guidotti et al., 2008). It has long been known that 

hematopoiesis and heme synthesis affected by lead 

poisoning (Doull et al., 1980). 

In our study reactive and cleaved type of 

lymphocyte were observed at the time of birth in 

lead treated groups which were reinstated by 

increased number of plasmacytoid, reactive, large, 

oval, irregular, binucleated and cleaved 

lymphocytes in further days of lactation. In the 

current investigation at higher dose (32 mg) we

found apoptotic or necrotic neutrophils were more 

prominent in the first and second week of lactation. 

These neutrophils were characterized by 3-4 

separate and equal lobes with less condensed 

chromatin and diffuse cytoplasmic region. 

Lead treated group at the termination of 

lactation, include abnormal nuclear segmentation, 

giving abnormal appearance of nucleus and 

chromatin condensation in most of the neutrophils 

and forming a ring like nucleus in some 

neutrophils. Villagra et al., (1997) also postulates 

that lead exposure doubles total and segmented 

neutrophils in both estrogens treated and untreated 

rats but causes a three-fold increase in band 

neutrophils in animals without estrogen treatment, 

but not in animals treated with estrogen. With a 

disappearance of non-degranulated eosinophils, the 

decrease in non-degranulated eosinophils was 

under the effect of lead exposure. He also 

demonstrates that prepubertal rat exposure to lead 

affects blood neutrophil and eosinophil leukocyte 

levels and induces eosinophil degranulation. 

Vyskocil et al., (1991) discovered the effect of 

lead on band neutrophils reveals an increased 

neutrophilopoiesis rather than release from 

intravascularly sequestered forms in lead-exposed 

animals. 

In lead treated group from birth till the 

termination of lactation, the number of immature 

cells was increased. There was asynchrony of 

maturation between nucleus and cytoplasm. During 

normal granulocytopoiesis the lengthening and 

pinching of the nucleus were coordinated with 

progressive condensation of the chromatin with 

accelerated maturation nuclear division may be skip 

and cells retain immature features, because toxic 

changes of lead accompanies a left shift i.e. 

presence of immature neutrophils, bands, 

metamyelocytes, myelocytes and other unidentified 

immature cells. White Blood Cells generally 

increase as compared to the control level. The 

increase in WBC count indicates the activation of 

defense mechanism and immune system of gasoline 

workers (Whitby, 1980). These findings are also in 

confirmations, with our results. 

In conclusion, lead exposure leads to various 

hematological disorders in white blood cells 

including neutrophilic degeneration, immature 

cells, abnormal neutrophils, reactive and 

plasmacytoid lymphocyte, reactive monocyte etc. 

The present study indicates that after administration 

of 266.66, 533.33 and <strong>10</strong>66.66 mg/kg/body weight 

doses of lead acetate WBCs show structural 

abnormalities in their nucleus and cytoplasm 


including improper segmentation and lesser 

condensation of nucleus. Lead causes fluctuations 

in the number of various cell types at different 

stages of postnatal development. The exposure to 

lead possesses the potentials to induce hazardous 

biological effects during pre and postnatal 

development in Swiss mice. 

References 

Ahamed M and Siddiqui MKJ. Low level lead 

exposure and oxidative stress: Current opinions. 

Clinica Chimica Acta. 383: 57–64, 2007. 

Alexa ID, Mihalache IL, Panaghiu L, Palade F. 

Chronic lead poisoning- a" forgotten” cause of 

anemia. Rev Med Chir Soc Med Nat Iasi. 

<strong>10</strong>6(4):825-8, 2002. 

Chmielnika J, Zareba G, Nasiadek M. Combined 

effect of tin and lead on heme biosynthesis in 

rats. Ecotox Environm Safety. 29: 165-173, 

1994. 

DeNicola D, Giger U, MacWilliams P and 

Wamsley H. Hematologic Evaluation of Cats 

and Dogs. IDEXX Laboratories. (HO-30b)1991. 

Desesso JJ and Harris SB. Principles underlying 

development toxicity. Toxicology and Risk 

Assesment. 1996. 

Doull J, Klaassen CD and Amdur MO. Casaratt 

and Doulls Toxicology. 2 nd ed. Macmillan 

Publishing Co, New York. 415–421, 1980. 

Falcon M, Vinas P and Luna A. Placental lead and 

outcome of pregnancy. Toxicology. 185 (1- 

2):59-66, 2003. 

Guidotti TL, McNamara J, Moses MS. The 

interpretation of trace elements analysis in body 

fluids. Indian J Med Res.128:524-53, 2008. 

Hogan GR and DP Adams. Lead induced 

leukocytosis in Female mice. Archive of 

Toxicol. 41:295-300, 1979. 

Isha BARBER, Ragini SHARMA, Sheetal 

MOGRA, Khushbu PANWAR and Umesh 

GARU. Lead induced alterations in blood cell 

counts and hemoglobin during gestation and 

lactation in Swiss albino mice. J of Cell and 

Mol Biol. 9(1):69-74, 2011. 

Klauder DS and Petering HG. Anemia of lead 

intoxication: A role of Copper. J Nutr. 

<strong>10</strong>7(<strong>10</strong>):1779-85, 1977.


Kosnett. Global approach to r<strong>edu</strong>cing Lead 

exposure and poisoning. Mutation Research. 

659(1-2): 166-175, 2006. 

Mugahi MN, Heiadari Z, Sagheb HM and 

Barbarestani M. Effects of chronic lead acetate 

intoxication in blood indices of male adult rat. 

Daru. 11;4: 2003. 

Noori MM, Heidari Z, Sagheb H and Barbarestani 

M. Effects of chronic lead acetate intoxication 

on blood indices of male adult rat. Daru Pharm 

J, 11(4): 147-51, 2003. 

Othman AI, Sharawy S and El-Missiry MA. Role 

of melatonin in ameliorating lead induced 

haematotoxicity. Pharmacol Res. 50(3):301-7, 

2004. 

Patocka J, Cerný K. Inorganic lead toxicology. Acta 

Medica (Hradec Kralove). 46(2):65-72, 2003. 

Toplan S, Ozcelik D, Gulyasar T and Akyolcu MC. 

Changes in hemorheological parameters due to 

lead exposure in female rats. J Trace Elem Med 

Biol. 18(2):179-82, 2004. 

Villagra R, Tchernitchin NN and Tchernitchin AN. 

Effect of Subacute Exposure to Lead and 

Estrogen on Immature Pre-Weaning Rat 

Leukocytes Bull. Environ Contam Toxicol. 

58:190-197, 1997. 

Vyskocil A, Fiala Z, Tejnorova I, Tusi M. Stress 

reaction in developing rats exposed to 1% lead 

acetate. Sb Ved Pr Lek Karlovy University 

Hradci Kralove. 34:287-295, 1991. 

Wahab AA, Joro JM, Mabrouk MA, Oluwatobi SE, 

Bauchi ZM and John AA. Ethanolic extract of 

Phoenix dactylifera L. prevents lead induced 

hematotoxicity in rats. Continental J 

Biomedical Sciences. 4: <strong>10</strong> - 15, 20<strong>10</strong>. 

Whitby LG, Rercy-Robb IW and Smith AF. 

Chapter 9. Lecture Notes on Clinical Chemistry. 

2nd ed. Blackwell Scientific Publications, 

Oxford London Edinburgh Melbourne. 167- 

187, 1980. 

Wilson JG. Environments and birth defects. 

Academic Press, New York. 1973. 

Xintaras C. Impact of Lead contaminated soil on 

Public Health. Public Health Service. Agency 

for toxic substances and Disease Registry, 

1992. 

Xu HH, Chen ZP and Shen Y. Meta analysis for 

effect of lead on male reproductive function. J 

of Industrial hygiene and occupational disease. 

24(<strong>10</strong>): 634-36, 2006. 

Yagminas AP, Franklin CA, Villeneuve DC, 

Gilman AP, Little PB and Valli VE. Subchronic 

oral toxicity of triethyl lead in the male 

weanling rat: Clinical, biochemical, 

hematological, and histopathological effects. 

Fundam Appl Toxicol. 15: 580-596, 1990. 

Zook BC. Lead poisoning in dogs. Am J Vet Res. 

33: 981-902, 1972.

Journal of Cell and Molecular Biology <strong>10</strong>(1): 41-54, 2012 Research Article 41 



Sulfabenzamide promotes autophagic cell death in T-47D breast 

cancer cells through p53/ DRAM pathway 

Raziye MOHAMMADPOUR 1 , Shahrokh SAFARIAN *1 , Soroor FARAHNAK 1 , Sana 

HASHEMINASL 1 , Nader SHEIBANI 2 

1 

School of Biology, College of Science, University of Tehran, Tehran, Iran 

2 

Department of Ophthalmology and Visual Sciences, School of Medicine and Public Health, University of 

Wisconsin, Madison, USA 

(* author for correspondence; safarian@ibb.ut.ac.ir ) 

Received: 26 March 2012; Accepted: 29 May 2012 


Sulfonamides exhibit their antitumor effects through multiple mechanisms including inhibition of membrane 

bound carbonic anhydrases, prevention of microtubule assembly, cell cycle arrest, and inhibition of angiogenesis. 

Here, sulfabenzamide’s mechanisms of action on T-47D breast cancer cells were determined. Cells incubated with 

sulfabenzamide exhibited negligible levels of apoptosis, necrosis and cell cycle arrest when compared to untreated 

cells. These results were confirmed by morphological examinations, DNA fragmentation assays, flow cytometric 

and real time RT-PCR analysis. Surprisingly, despite negligible detection of DNA fragmentation, a considerable 

increase in caspase-3 activity was observed in cells incubated with sulfabenzamide. The increased expression ratio 

of DFF-45/DFF-40 indicated that caspase-3-related DNA fragmentation was blocked and apoptosis symptoms 

could not be seen. However, the effects of caspase-3 for PARP1 and DNA-PK deactivation resulted in autophagy 

induction. The overexpression of critical genes involved in autophagy, including ATG5, p53 and DRAM, indicated 

that in T-47D cells sulfabenzamide-induced antiproliferative effect was mainly exerted through induction of 

autophagy. Furthermore, downregulation of AKT1 and AKT2 as well as over expression of PTEN resulted in 

attenuation of AKT/mTOR survival pathway showing that death autophagy should be occurred in sulfabenzamide 

treatment. 

Keywords: Sulfabenzamide, breast cancer, autophagy, apoptosis, p53. 

Sülfobenzamid, T-47D meme kanseri hücrelerinde p53/DRAM yolağı aracılığıyla otofajik hücre ölümünü 

teşvik eder 

Sülfonamidler, membrana bağlı karbonik anhidraz inhibisyonunu, mikrotubül toplanmasının engellenmesini, hücre 

siklusunun durdurulmasını ve anjiyogenez inhibisyonunu içeren çoklu mekanizmalarla antitümör etkilerini 

göstermektedirler. Burada, T-47D meme kanser hücreleri üzerinde sülfobenzamid mekanizmasının etkisi 

belirlenmiştir. Sülfobenzamid ile inkübe edilen hücreler yapılmamış uygulama hücrelerle karşılaştırıldıklarında 

önemsenmeyecek seviyede apoptoz, nekroz ve hücre siklusunun durmasını ortaya koymuştur. Bu sonuçlar 

morfolojik incelemelerle, DNA fragmantasyon analizleriyle, flow sitometrik ve gerçek zamanlı RT-PCR 

analizleriyle doğrulanmıştır. Şaşırtıcı bir şekilde, DNA fragmantasyonunun ihmal edilebilecek tespitine rağmen, 

sülfobenzamidle edilmiş inkübe hücrelerde kaspaz 3 aktivitesinde dikkate değer artış bir gözlenmiştir. DFF-45/ 

DFF-40’ artmış ın ekspresyon oranı, kaspaz 3 ile ilişkili DNA fragmantasyonunun durdurulduğunu ve apoptoz 

belirtilerinin görülemeyeceğini işaret etmektedir. Bununla birlikte PARP1 ve DNA-PK deaktivasyonu için kaspaz 

3’ün etkileri otofaji indüklenmesiyle sonuçlanmaktadır. ATG5, p53 ve DRAM gibi otofajide yer alan kritik 

genlerin aşırı ekspresyonu T-47D sülfobenzamid-indüklenmiş hücrelerinde antiproliferatif etkinin çoğunlukla 

otofaji indüksiyonu aracılığıyla uygulandığını belirtmektedir. Ayrıca, PTEN aşırı ekspresyonu gibi AKT1 ve 

AKT’’nin azalarak düzenlenmesi, otofaji ölümünün sülfobenzamid uygulamasıyla meydana geldiğini gösteren 

sağ AKT1/mTOR kalım yolağının etkisinin azalmasıyla sonuçlanmaktadır. 

Anahtar kelimeler: sülfobenzamid, meme kanseri, otofaji, apoptoz, p53.

42 Raziye MOHAMMADPOUR et al. 


Sulfonamides are synthetic antibacterial agents 

with diverse pharmacological effects including 

antibacterial, antiviral, antidiabetic, antithyroid, and 

diuretic. Their antibacterial effects are contributed 

to the interfering with enzyme activities responsible 

for folic acid synthesis by competing for para 

aminobenzoic acid. These drugs are selectively 

toxic for prokaryotes (Owa et al., 1999; Fukuoka et 

al., 2001; Yokoi et al., 2002; Supuran 2003). Two 

novel sulfonamides, E7070 and E70<strong>10</strong>, are potently 

effective against cancer cells via inhibition of 

tubulin polymerization and proliferation. The 

matrix metalloprotease (MMP) inhibitory effects of 

sulfonamides have been evaluated for treatment of 

arthritis and cancer (Fukuoka et al., 2001; Ozawa et 

al., 2001; Supuran et al., 2003; Mohan et al., 2006). 

Sulfabenzamide, 4-Amino-N-benzoyl-benzenesulfonamide, 

is a sulfonamide derivative used for 

treatment of specific vaginal infections in 

combination with sulfathiazole and sulfacetamide 

(Valley and Balmer, 1999). 

Knowledge regarding alterations in signaling 

pathways and the type of cell death induced by 

chemotherapeutic drugs is the first and most 

important step in design of effective treatments. 

Furthermore, manipulation of autophagy has the 

potential to improve anticancer therapeutics. 

Studies have shown that autophagy protects cancer 

cells against antitumor effects of some drugs by 

blocking the apoptotic pathway and maintaining 

ATP levels. In contrast, other cancer cells undergo 

autophagic cell death (ACD or type II programmed 

cell death, PCDII) after anticancer therapies 

(Kondo et al., 2005; Kondo and Kondo, 2006). 

Various anticancer drugs that activate ACD in 

breast cancer cells have been reported including 

vitamin D analog, EB<strong>10</strong>89, Tamoxifen and other 

antiestrogen agents (Hoyer-Hansen et al., 2005). 

Tamoxifen induced autophagic pathway occurs 

through down regulation of AKT activity 

(Yokoyama et al., 2009). The 3'-methoxylated 

analogue isocannflavin B (IsoB) exhibits an 

inhibitory effect on T-47D cell proliferation, which 

is accompanied by the appearance of an intense 

intracytoplasmic vacuolization of autophagic origin 

(Brunelli et al., 2009). 

Here, we choose sulfabenzamide for assessing 

its antitumor activity in T-47D breast cancer cell 

line. Our main objective was to determine whether 

this drug can be used as an antitumor drug in 

medicine. From this point of view, we could 

ascertain that there is a correlation between the 

expression level of some critical genes and 

induction of death autophagy in T-47D cells. 


Reagents 

Culture medium, RPMI 1640, and fetal bovine 

serum were from Gibco (England); penicillin 

streptomycin solution, DNA laddering kit, 

Annexin-V-FLOUS Staining Kit, Propidium 

Iodide (PI) kit, caspase-3 fluorometric 

immunosorbent enzyme assay kit, 4',6- Diamidino - 

2-phenylindole (DAPI) kit were all acquired from 

Roche (Germany); MTT was from Sigma 

(England); sulfabenzamide and doxorubicin were 

from Sina Darou (Iran) and Ebewe Pharma 

(Austria), respectively. QuantiFast SYBR Green 

PCR master mix and RNeasy plus Mini kit were 

provided from Qiagen (USA). RevertAidTM M- 

MuLV reverse transcriptase and random hexamer 

were purchased from Fermentas (Germany). 

Cell culture 

Epithelial tumor cell line, T-47D, stemmed from 

human ductal breast tissue, was provided from 

National Cell Bank of Pasteur Institute (Tehran, 

IRAN; ATCC number HTB-133). Cells were 

maintained in RPMI 1640 medium supplemented 

with heat-inactivated (35 min, 56°C) fetal bovine 

serum (<strong>10</strong>% v/v) and penicillin streptomycin 

solution (1% v/v) and incubated in humidified 

condition; 95% air and 5% CO2 at 37°C. 

Drug preparation and treatments 

Regarding the obtained results from MTT assays, 

LC50 for sodium sulfabenzamide and doxorubicin 

after 48 h were estimated at <strong>10</strong>.8 and 0.337×<strong>10</strong> -3 

mM, respectively. After reaching confluency (~ 

80%), cells were incubated with freshly prepared 

drugs at the LC50 concentrations, harvested by 

trypsin-EDTA, washed three times by phosphatebuffered 

saline, and stored at -70°C. 

Cytotoxicity/Viability assay 

In brief, <strong>10</strong> 4 cells/well were seeded in a 96 well 

culture plate and incubated with different 

concentrations of drugs for 24, 48 and 72 h. MTT 

was then added to the wells (4 mg/ml or <strong>10</strong>0 

µg/well) and the produced formazan was 

systematically assessed using Elisa micro plate

eader at the wavelength of 570 nm. The percent of 

cell viability related to each drug concentration was 

estimated in relation to the untreated sample. All 

assays were done at least three times unless stated 

otherwise. 

Apoptosis quantification 

After washing <strong>10</strong> 6 cells with PBS, cell pellets were 

re-suspended in <strong>10</strong>0 µl of ready to use Annexin/PI 

buffer (20 µl of each Annexin and PI buffer in 1 ml 

incubation buffer) for <strong>10</strong>-15 min at 25˚C. Samples 

were then diluted in 500 µl of incubation buffer and 

analyzed by flow cytometry (Partech Pass, USA) 

using FloMax software. 

Cell cycle analysis 

5×<strong>10</strong> 5 drug treated cells were incubated with DAPI 

solution (<strong>10</strong> µg/ml and 6% Triton X-<strong>10</strong>0 in PBS) 

for 30 min in the dark at 4ºC. Using a flow 

cytometer fluorescent emission of applied indicator 

was detected (excitation and emission wavelength 

of 359 nm and 461 nm, respectively) and the 

analysis was performed using FloMax software. 

Morphological studies of the apoptotic cells 

Cells were cultured on cover slips coated with Poly 

L-lysine and exposed to drugs for 48 h. Following 

staining with Annexin V-FITC (20 µg/ml) and PI 

(20 µg/ml) in the dark for <strong>10</strong>-15 min, samples were 

examined using a fluorescent microscope (Carl 

Zeiss-Germany) using 450-500 nm excitation and 

515-565 nm emission filters. 

Measurement of caspase-3 activity 

Following drug treatments, cells were harvested 

and incubated in lysis buffer on ice for 1 minute. 

After centrifugation, sample supernatants were used 

for caspase-3 activity measurements using AC- 

DEVED-AFC fluorescent substrate as 

recommended by the supplier. The concentration of 

enzyme-released AFC was estimated using 

fluorospectrophotometer (HITACHI model MPF4- 

Japan) at 400 nm excitation and 505 nm emission 

wavelengths. 

DNA laddering assay 

2×<strong>10</strong> 6 drug treated cells were lysed with an equal 

volume of binding/lysis buffer for <strong>10</strong> minutes at 15- 

25 º C. The obtained extract was processed as 

recommended by the supplier. Electrophoresis of 

the samples in 1% agarose gel at 75 volt for 90 

minutes revealed DNA cleavage pattern of cells 

Sulfabenzamide promotes autophagic cell death 43 

relative to positive control (DNA extracted 

prepared from U937 cells incubated 3h with 4 µM 

camptothecin). 

Preparation of total RNA, cDNA synthesis and real 

time RT-PCR 

Total RNA was purified using the RNeasy Qiagen 

kit according to the manufacturer’s 

recommendation. First strand cDNA was generated 

using RevertAidTM M-MuLV reverse transcriptase 

and 5µg of RNA with random hexamer primers. 

Real time quantitative RT-PCR was performed 

using the QuantiFast SYBR Green PCR Master 

Mix under the following program: 95˚C for 5 min 

followed by 40 cycles (95˚C for <strong>10</strong> sec, annealing 

for 25 sec and extension at 72˚C for 30 sec). 

Analysis was done using Corbett rotor-gene 6000 

software based on the comparative Ct method (or 

ΔΔCt method). The relative amount of target 

materials was quantified compared to the reference 

gene (GAPDH). Primers were prepared by TAG 

(Copenhagen, Denmark) and were used to amplify 

specific regions of cDNA as listed in Table1. 


For all methods statistical analysis were performed 

by the SPSS version 16 and Excel 2007 softwares. 

Statistical analysis for MTT assay, flow cytometry, 

caspase-3 activity were performed by one way 

ANOVA and real time RT-PCR methods were 

carried out by t-test. All results are presented as 

mean ± standard deviation (p< 0.05 was considered 

statistically significant). 

Results 

Sulfabenzamide inhibits the proliferation of T-47D 

cells 

The MTT assay was used to evaluate the viability 

of T-47D cells incubated with different 

concentrations of sulfabenzamide (0.0-20 mM) or 

doxorubicin (0.0-0.6 µM) after 24, 48 and 72 h 

(chemical structures are shown in Figure 1A). We 

checked toxic effects of doxorubicin on T-47D 

since it had been reported that its anticancer effects 

on different cell types exerts through distinct 

cellular processes (apoptosis or cell cycle arrest). 

Thus, it could be utilized as a control in our 

experiments. The 50% growth inhibition (LC50) 

concentration for sulfabenzamide and doxorubicin 

after 48 h, were calculated as <strong>10</strong>.8 mM and 0.33 

µM, respectively, and utilized in the following 

experiments (Figure 1B).


Table 1. List of primers. Forward and reverse primer pairs for PTEN gene were designed to amplify a region which could 

not anneal to PTEN pseudogene. Primer for p53 was designed for the mutant form present in T-47D cells. 

Gene Accession number primers 

F: CCAGGTGGTCTCCTCTGACTTCAACAG 

PCR product(bp) 

GAPDH NC_000012.11 

R: AGGGTCTCTCTCTTCTTCCTCTTGTGCTCT 

F: GTGAGATATGGTTTGAATATGAAGGC 

218 

ATG5 NC_000006.11 

R: CTCTTAAAATGTACTGTGATGTTCCAA 

F: GGAGAGGAGCCATTTATTGAAACT 

122 

beclin1 NC_000017.<strong>10</strong> 

R: AGAGTGAAGCTGTTGGCACTTTCTG 

F: CTTGGATTGGTGGGATGTTTC 

<strong>10</strong>4 

DRAM NC_000012.11 

R: GATGATGGACTGTAGGAGCGTGT 

F: CCAGATGGAAAGACGTTTTTGTG 

135 

AKT1 NC_000014.8 

R: GAGAACAAACTGGATGAAATAAA 

F: CTGCGGAAGGAAGTCATCATTGC 

<strong>10</strong>6 

AKT2 NC_000019.9 

R: CGGTCGTGGGTCTGGAAGGCATAC 

F: CAAACTTTTTCAGAGGGGATCG 

125 

caspase-3 NC_000004.11 

R: GCATACTGTTTCAGCATGGCAC 

F: AAGAAGCTGAGCGAGTGTC 

261 

bax NC_000019.9 

R: GGCCCCAGTTGAAGTTGC 

F: ATGGAACTAACTATGTTGGACTATG 

157 

cyclinB1 NC_000005.9 

R: AGTATATGACAGGTAATGTTGTAGAGT 

F: AGGGGGAAACACCAGAATCAAGTG 

138 

bcl-2 NC_000018.9 

R: CCCAGAGAAAGAAGAGGAGTTATAA 

F: GGTCTTGTGGACAGTAGTTTGCC 

113 

AIF NC_000023.<strong>10</strong> 

R: TCTCACTCTCTGATCGGATACCA 

F:CCTGTGCAGCTGTGGGTTGATTT 

115 

p53 NC_000017.<strong>10</strong> 

R: AGGAGGGGCCAGACCATCGCTAT 

F: TTGGAGTCCCGATTTCAGAG 

150 

DFF40 NC_000001.<strong>10</strong> 

R: CTGTCGAAGTAGCTGCCATTG 

F:TTCTGTGTCTACCTTCCAATACTA 

194 

DFF45 NC_000001.<strong>10</strong> 

R:CTGTCTGTTTCATCTACATCAAAG 

F: TAACATTAGTCTGGATGGTGTAGA 

127 

PARP1 NC_000001.<strong>10</strong> 

R: TTACCTGAGCAATATCATAGACAAT 

F: TGGCATTACAGACATCTTTAGTTT 

113 

DNA-PK NC_000008.<strong>10</strong> 

R: ACTTTAGGATTTCTTCTCTACATTCA 

F: TGGCTAAGTGAAGATGACAATCATG 

111 

PTEN NC_0000<strong>10</strong>.<strong>10</strong> 

R: GCACATATCATTACACCAGTTCGT 

81


Figure 1. A) Chemical structure of sulfabenzamide and doxorubicin. B) Viability curve of sodium 

sulfabenzamide and doxorubicin treated T-47D cells. Percent viability of cells incubated with sodium 

sulfabenzamide and doxorubicin was calculated relative to the related untreated controls after 24, 48 and 72 

h. Each point relates to the mean value of at least three independent experiments. The related correlation 

coefficient (r 2 ) was adjusted until the best fit for the selected mathematical function was used to interpolate 

the experimental points. 

T-47D cells do not exhibit DNA fragmentation and 

apoptotic morphology in the presence of 

sulfabenzamide or doxorubicin 

Unlike DNA fragmentation patterns observed in 

DNA extracted from U937 cells incubated with 

camptothecin (as a positive control of DNA 

laddering kit), the gel electrophoresis of DNA 

prepared from cells incubated with sulfabenzamide 

(<strong>10</strong>.8 mM) or doxorubicin (0.33 µM) showed no 

DNA ladder or smear pattern confirming lack of 

apoptosis or necrosis in these cells (Figure 2A). 

Morphological analysis of sulfabenzamide and 

doxorubicin treated cells, double stained with 

Annexin-FITC and PI, evaluated by fluorescent 

microscopy and confirmed the results of DNA 

laddering analysis. There were few cells having 

morphological characteristics of apoptotic and 

necrotic cells (Figures 2B, 2C). Early (young) 

apoptotic cells have rounded shape and shiny green 

membrane because PI cannot penetrate into the 

cells and Annexin-FITC binds to the externally 

membrane-exposed phosphatidylserines (Figures 

2B, 2C). Late apoptotic and necrotic cells have 

membrane permeability for PI so their nuclei are 

stained red (Figure 2C). The main difference 

between necrotic and late apoptotic cells is the 

potency of late apoptotic cells for simultaneous 

staining of nuclei and membrane-exposed 

phosphatidylserines with PI and Annexin-FITC, 

respectively. Membrane blebbing, which is a 

common feature of apoptotic cells was seen in 

Figure 2B. Evidently, healthy cells cannot be seen 

under fluorescent microscope since they were not 

stained with either of the fluorescent dyes (Figure 

2E).


Figure 2. A) DNA laddering analysis. 1-3 µg DNA prepared from 2×<strong>10</strong> 6 cells was resolved by 

electrophoresis in a 1% agarose gel. DNA fragmentation was observed only in positive control (camptothecin 

treated) cells, but it was not detected in control or cells incubated with doxorubicin or sodium 

sulfabenzamide. B) Observation of the morphology of early apoptotic cells using fluorescent microscopy 

following double staining with Annexin V-FITC and PI. Morphological characteristics of early apoptotic 

cells (rounded green shiny cells showing membrane blebbing) in sulfabenzamide treated cells. C) 

Observation of the morphology of late apoptotic and necrotic cells using fluorescent microscopy following 

double staining with Annexin V-FITC and PI. Morphological characteristics of late apoptotic (flattened green 

shiny cells showing red dense nuclei) and necrotic cells (red dense spheres lacking green shiny membrane) in 

sulfabenzamide treated cells. Similar results were observed for doxorubicin (not shown). Living cells due to 

lack of staining with dyes are not detectable in fluorescent visual field (E) but are visible using phase contrast 

microscopy (D).


Figure 3. Caspase-3 activity was increased in cells incubated with sulfabenzamide or doxorubicin. Enzyme 

activity in the control, sodium sulfabenzamide, or doxorubicin treated cells were 1.308±0.115, 2.07±0.08, 

and 2.496±0.11 nM.h -1 , respectively. Standard curve based on emission (Y axis) of different concentration of 

free AFC (nM) is plotted (inset). Diagram of free AFC is plotted in 400 nm excitation and 505 nm emission 

wavelengths. 

Table 2. Numerical results of flow cytometry analysis. Results are the mean value ± SD for at least three 

replicated experiments. Each column named with Qi which includes data related to the quadrant that are Q1 

(PI + and Annexin V-FITC - ) or Q1+Q2 (Q2 is the region for PI + and Annexin V-FITC + ) indicated percent value 

of necrotic cells, and columns Q4 (PI - and Annexin V-FITC + ) or Q2+Q4 show percent values of apoptotic cells 

(see text). Column Q3 (PI - and Annexin V-FITC - ) indicates percent value of normal cells. Column of G1, S 

and G2/M represent the percent value of the cells placed in each related phase of cell cycle. NC, Dox and SU 

are abbreviations for Negative Control, Doxorubicin and Sulfabenzamide, respectively. 

Treated 

cells 

Q3 Q1 Q2 Q4 Q1+Q2 Q2+Q4 G1 

S G2 

NC 98.94±0.72 0.90±0.46 0.05±0.04 0.35±0.09 0.96±0.50 0.40±0.11 67.06±5.79 16.39±4.27 16.54±3.20 

DOX 97.60±1.12 1.33±0.68 0.015±0.02 1.05±0.90 1.34±0.67 1.06±0.90 30.58±1.14 40.55±4.65 28.86±3.51 

SU 98.58±0.56 0.27±0.19 0.09±0.08 0.86±0.57 0.37±0.1 0.96±0.54 48.80±4.28 27.47±4.39 22.70±3.79


Caspase-3 activity was increased in the 

sulfabenzamide and doxorubicin treated cells 

Using caspase-3 specific substrate, subsequent 

releasing of the fluorescent product (AFC) was 

measured and average enzymatic velocity was 

calculated (three independent experiments) as 

16.6±1.42, 26.2±1.3 and 38.3±0.85 (∆F.h -1 , ∆F 

means fluorescent intensity alteration) for untreated 

cell, sulfabenzamide or doxorubicin treated cells, 

respectively. Using the standard curve of free AFC, 

enzymatic activity was calculated as 1.308±0.115, 

2.07± 0.08 and 2.496± 0.11nM.h -1 , respectively 

(Figure 3). 

Comparing with untreated cells, caspase-3 

activity was increased in drug treated samples. 

Elevated activity of caspase-3, which is a sign of 

apoptosis induction, is in contrast with the DNA 

laddering results and is further discussed below. 

Sulfabenzamide did not induce apoptosis but 

induced a minimal shift from G1 to S and G2/M 

phases of the cell cycle 

Using flow cytometric analysis and Annexin-FITC 

and PI staining, the incidence of apoptosis and 

necrosis in untreated, sulfabenzamide, or 

doxorubicin treated cells were quantified (Figure 

4A and Table 2). 

Congruent with graph interpretation methods 

applied in most publications, the sum of cell 

populations in regions Q2 (PI + and Annexin V- 

FITC + ) and Q4 (PI - and Annexin V-FITC + ) were 

considered as early and late apoptotic cells (Hsu et 

al., 2006; Tyagi et al., 2006; Dowejko et al., 2009; 

LaPensee et al., 2009). In addition, regions Q1 (PI + 

and Annexin V-FITC - ) and Q3 (PI - and Annexin V- 

FITC - ) indicated necrotic and unscathed 

populations, respectively. In some publications, cell 

percentages located in Q1 and Q2 (Q2 is the region 

for PI + and Annexin V-FITC + ) quarters are 

considered as necrotic cells (Davis et al., 2000). In 

these studies, Q4 quarter (PI - and Annexin V- 

FITC + ) represented the percentage of apoptotic 

cells. Therefore, in Table 2 determination of 

necrotic cells was performed separately via Q1, as 

well as Q1+Q2, and the estimation for apoptotic 

cells was carried out as Q2+Q4 as well as Q4, in 

order to indicate that the low percentages of 

apoptotic and necrotic cells observed was not 

influenced by the applied analytical methods. 

Flow cytometry is useful for calculating the 

percentages of cells existing in various stages of the 

cell cycle including G1, S and G2/M. To make a 

practical use of this technique, cells were stained 

with DAPI, which enters the nucleus and binds to 

DNA and emanates fluorescent emission. 

Although, no significant change in the normal 

pattern of cell distribution throughout the cell cycle 

was observed for sulfabenzamide treated cells (18% 

shift from G1 to S and G2/M) a considerable 

transition (37%) was detected from G1 to S (main 

transition) and G2/M in cells incubated with 

doxorubicin as positive control (Figure 4B and 

Table 2). 

Alterations in expression of proapoptotic, 

prosurvival and autophagic genes in 

sulfabenzamide and doxorubicin treated cells 

The changes in expression level of apoptotic, cell 

survival and autophagic genes were evaluated using 

real time RT-PCR. With respect to the results 

shown in Figure 5 as well as its insets it can be seen 

that in sulfabenzamide treatments some apoptotic 

genes (DFF-45 and DNA-PK ) were over expressed 

while some others were down regulated (PARP1, 

Bax, Bcl-2 and AIF) or retained their expression 

level in a constant condition (DFF-40 and caspase- 

3). Moreover, some critical genes which are 

important in cell survival pathway were also down- 

regulated (AKT1 and AKT2) or over expressed 

(PTEN). Alterations in gene expression were 

evaluated for some autophagic genes such as 

ATG5, p53 and DRAM indicating higher amounts 

of the related transcripts in drug treated cells 

relative to the untreated ones. In doxorubicin 

treated cells some apoptotic genes were focused 

and their alterations including over expression of 

caspase-3, DNA-PK, DFF-45 and Bax; down 

regulation of DFF-40 and constant expression of 

AIF and PARP1 were evaluated (Figure 5).


Figure 4. A) Two dimensional plots of Annexin V-FITC against PI related to the flow cytometric 

experiments. Two dimensional diagrams from flow cytometric studies showed that the percentage of 

apoptotic cells (cells located in the Q4 area or total cells in Q2 + Q4) and necrosis (cell located in Q1 or in 

Q1+Q2) do not show dramatic differences compared with control cells. B) Effects of sodium sulfabenzamide 

and doxorubicin on the cell cycle distribution. FL4-A indicates the area under the registered electrical signal 

of each stained cell. The curves from left to right relate to G1, S, G2/M phases of the cell cycle in control, 

doxorubicin or sodium sulfabenzamide treated samples.


Figure 5. Quantitative real time RT-PCR analysis histograms. Real time RT-PCR for the selected genes for 

sulfabenzamide (A) and Doxorubicin (B) treated T-47D cells were determined as described in Methods. The 

relative amount of target material was quantified compared to the reference gene using the comparative Ct 

(ΔΔCt) method. The statistical significant differences are indicated with * and ** for 0.01

independent of changes in the related mRNA level 

(Figures 3 and 5). The increased activity of 

caspase-3 was negated via overexpression of DFF- 

45. DFF-45 is the natural inhibitor of DFF-40 

(CAD) (Liu et al., 1997). In addition, the increased 

expression of DFF-45, along with a modest 

increase (for sulfabenzamide) and a significant 

decrease (for doxorubicin) in DFF-40 expression 

(Figure 5), indicated that the increased activity of 

caspase-3 could be blocked by the increased 

expression ratio of DFF-45/DFF-40. This r<strong>edu</strong>ces 

the level of active DFF-40 to trigger DNA 

fragmentation and appearance of apoptotic 

symptoms. Furthermore, it has been reported that 

caspases are activated during autophagy in dying 

cells and are suppressed for apoptosis induction 

(Martin et al., 2004; Yu et al., 2004). Therefore, it 

can be d<strong>edu</strong>ced that during autophagy, the effects 

of activated caspase-3 on their downstream 

substrates (like DFF-40) should be suppressed by 

special factors (e.g. DFF-45 in T-47D cells) only in 

those cellular routes which are involved in the 

appearance of apoptosis symptoms (e.g. DNA 

fragmentation). 

Cell cycle arrest, an important cellular target 

affected by sulfabenzamide and doxorubicin, was 

analyzed using flow cytometry. Incubation of T- 

47D cells with 0.33 µM doxorubicin resulted in a 

significant accumulation of cells in S phase, and to 

a lesser extent in G2/M phase of the cell cycle 

(Figure 4B and Table 2). Thus, doxorubicin exerts 

its antiproliferative action mainly through cell cycle 

arrest. Induced mitotic catastrophe following 

increased activation of cyclinB1/Cdc2 may occur 

while cells are delayed, particularly in G2 phase of 

the cell cycle (Lindqvist et al., 2007). The induced 

G2/M arrest along with down regulation of 

cyclinB1 expression confirmed that anticancer 

activity of doxorubicin is not via mitotic 

catastrophe (Figure 5 and Table 2). In contrast to 

doxorubicin, minimal cell cycle arrest in S and 

G2/M phases (totally 18%) was observed in T-47D 

cells incubated with <strong>10</strong>.8 mM sulfabenzamide 

(Figure 4B and Table2). Thus, cell cycle arrest 

could not be mainly responsible for a 50% 

r<strong>edu</strong>ction in cell viability in the presence of 

sulfabenzamide. 

As we know, when apoptosis is blocked or 

delayed autophagy triggered and vice versa. These 

possibilities are consistent with our findings 

regarding lack of apoptosis in drug treated cells and 

induction of autophagy. The induced 

overexpression of ATG5 supported that autophagy 


triggered in the presence of sulfabenzamide (Figure 

5). This could be probably occurred through the 

increase in Bax activity working on mitochondrial 

membrane to result in activation of caspase-3 for 

PARP1 and DNA-PK deactivation and autophagy 

induction. It has been reported that induction of 

autophagy by PUMA (the p53-inducible BH3-only 

protein) depends on Bax/Bak and can be 

reproduced by overexpression of Bax (Yee et al., 

2009). Here, in doxorubicin treatment, increase in 

Bax activity could be occurred in parallel with the 

increment of Bax transcripts affecting on the cells 

for caspase-3 activation and changing the cell's 

destiny toward autophagy (Figure 5). This notion 

could be also supplied in sulfabenzamide treatment 

aside from the mild decrease in Bax expression 

because activation of the existed Bax molecules in 

the cells could be happened for caspase-3 activation 

and autophagy induction (Figure 5). It has been 

also reported that proteolytic cleavage of PARP1, 

performed by caspase-3, produces specific 

proteolytic cleavage fragments which are involved 

in the cell’s decision to change its fate from 

apoptosis toward autophagy (Munoz-Gamez et al., 

2009; Chaitanya et al., 20<strong>10</strong>). Induction of 

autophagic cell death is dependent on DNA-PK 

inhibition (Daido et al., 2005). Thus, the increased 

activity of caspase-3 could finally deactivate 

PARP1 (has a decreased and constant expression 

level in sulfabenzamide and doxorubicin 

treatments, respectively) and DNA-PK (has an 

increased and invariable expression level in 

sulfabenzamide and doxorubicin treatments, 

respectively) until apoptosis was blocked and 

autophagy induced (Figures 3 and 5). 

Despite the existence of some controversies 

regarding the possible role of autophagy in tumor 

progression by promoting cell survival, autophagy 

can exist as a backup mechanism promoting 

cellular death when other mortality mechanisms are 

not functional. Hyperactivation of autophagy above 

the threshold point leads to unlimited self-eating of 

the cells causing autophagy or type II programmed 

cell death (Hoyer-Hansen et al., 2005; Maiuri et al., 

20<strong>10</strong>). Based on our data, downregulation of AKT1 

and AKT2 as well as upregulation of PTEN in 

sulfabenzamide treated cells indicated that cell 

survival pathways were slowed down (Figure 5). In 

addition, down regulation of bcl-2 was happened 

along with the induction of autophagy (Figure 5). It 

has been reported that targeted silencing of bcl-2 

expression (an anti-autophagic gene) in human 

breast cancer cells with RNA-interference has


promoted autophagic cell death and thus presents a 

therapeutic potential (Akar et al., 2008). 

p53 is involved in decreasing cell survival 

potency through inactivation of AKT/mTOR 

pathways, and stimulation of autophagy via 

transactivation of DRAM (Maiuri et al., 2007). 

Thus, the observed increased expression level of 

DRAM and p53 genes support our conclusion that 

the repression of AKT/mTOR survival pathway 

(via p53 overexpression) and autophagy induction 

(via increased DRAM transcripts) are responsible 

for r<strong>edu</strong>ced viability of T-47D cells and induction 

of death inducing autophagy in the presence of 

sulfabenzamide (Figure 5). T -47D cells contain 

only a single copy of the p53 missense mutation 

(Schafer et al., 2000). It has been reported by 

various studies that mutant p53 may lose its natural 

antitumor activity (Lim et al., 2009). Interestingly, 

in the presence of sulfabenzamide the antitumor 

activities of mutant form of p53 should return to the 

normal activities of the wild type form to induce 

autophagic cell death. This is very similar to the 

mechanism of action for some antitumor drugs 

reactivating mutant p53 to kill cancerous cells 

(Lambert et al., 2009). 

Evidently, checking of the protein expression 

levels using other supplementary methods such as 

western blotting could provide us better documents 

to support the presented real time RT-PCR data. 

But, in our work, we found that the registered 

alterations for the level of RNA transcripts were in 

a good consistence with the expected cellular 

behaviors when the proteins' expression levels or 

their activities were theoretically going to become 

changed in parallel with the RNA levels in the 

cells. Therefore, regardless of some exceptions, 

evaluating RNA transcripts could provide us an 

adequate image illustrating the changes in the 

proteins’ expression levels in the cells. 

Conclusions 

In summary, we showed that cell cycle arrest (and 

possibly autophagy) may play a role in action of 

doxorubicin on T-47D cells. However, the 

contribution of apoptosis and cell cycle arrest 

antiproliferative effect of sulfabenzamide on T-47D 

cells is minimal. These observations are in contrast 

to many reports in which the mechanism of action 

of sulfonamide derivatives on cancer cells 

attributed to the conventional processes of 

apoptosis and cell cycle arrest. We believe that 

induction of autophagic cell death in T-47D cells is 

triggered through p53/DRAM pathway (occurred 

along with decreasing of Akt/mTOR pathway) and 

this is a reasonable cellular axis to justify our 

results. 

Abbreviations 

AKT: v-akt murine thymoma viral oncogene 

homolog, mTOR: Mechanistic Target Of 

Rapamycin, PTEN: Phosphatase and Tensin 

homolog, DRAM: Damage Regulated Autophagy 

Modulator, ATG5:Autophagy related gene 5, 

Beclin1: Bcl2 Interacting protein 1, PARP1: Poly 

ADP-Ribose Polymerase 1, DFF-40/CAD: DNA 

Fragmentation Factor 40/ Caspase-Activated 

DNase, Bax: Bcl2-Associated X protein, Bcl-2: B- 

Cell Lymphoma 2, AIF: Apoptosis Inducing 

Factor, DFF-45/iCAD: DNA Fragmentation 

Factor 45/inhibitor of Caspase-Activated DNase, 

Cdc2: Cell Division Cycle protein 2, ARF: ADP 

Ribosylation Factor, GAPDH: Glyceraldehyde-3- 

Phosphate Dehydrogenase, ACD: Autophagic Cell 

Death, PCDII: type II Programmed Cell Death, 

RPMI: Roswell Park Memorial Institute. 

Conflict of interest 

The authors declare that they have no competing 

interest. 

Authors' contributions 

SS designed the study and experiments, analyzed 

and interpreted data and also prepared the 

manuscript. RM carried out the experiments and 

participated in data analysis as well as writing the 

initial draft of the manuscript. SH and SF 

participated in performing the experiments. NS 

contributed on giving scientific comments and also 

carried out final editing of the manuscript. 

Acknowledgements 

Iran National Science Foundation (INSF) and 

Research Council of University of Tehran have 

been gratefully appreciated by the authors because 

of their foundational supports for this work. 

References 

Akar U, Chaves-Reyez A, Barria M, Tari A, 

Sanguino A, Kondo Y, et al. Silencing of Bcl-2 

expression by small interfering RNA induces 

autophagic cell death in MCF-7 breast cancer 

cells. Autophagy. 4: 669–679, 2008. 

Alberts B, Johnson A, Lewis J, Raff M, Roberts K, 

Walter P. Molecular Biology of the Cell.

Garland science Taylor & Francis Group, LLC, 

UK, 1115-1130, 2008. 

Brunelli E, Pinton G, Bellini P, Minassi A, 

Appendino G, Moro L. Flavonoid-induced 

autophagy in hormone sensitive breast cancer 

cells. Fitoterapia. 80: 327-332, 2009. 

Chaitanya GV, Steven AJ, Babu PP. PARP-1 

cleavage fragments: signatures of cell-death 

proteases in neurodegeneration. Cell Commun 

Signal. 8:31-41, 20<strong>10</strong>. 

Daido S, Yamamoto A, Fujiwara K, Sawaya R, 

Kondo S, Kondo Y. Inhibition of the DNAdependent 

protein kinase catalytic subunit 

radiosensitizes malignant glioma cells by 

inducing autophagy. Cancer Res. 65: 4368- 

4375, 2005. 

Davis JW, Melendez K, Salas VM, Lauer FT, 

Burchiel SW. 2,3,7,8-Tetrachlorodibenzo-pdioxin 

(TCDD) inhibits growth factor 

withdrawal-induced apoptosis in the human 

mammary epithelial cell line, MCF-<strong>10</strong>A. 

Carcinogenesis. 21: 881-886, 2000. 

Dowejko A, Bauer RJ, Muller-Richter UDA, 

Reichert TE. The human homolog of the 

Drosophila headcase protein slows down cell 

division of head and neck cancer cells. 


Fukuoka K, Usuda J, Iwamoto Y, Fukumoto H, 

Nakamura T, Yoneda T, et al. Mechanisms of 

action of the novel sulfonamide anticancer 

agents E7070 on cell cycle progression in 

human non-small cell lung cancer cells. Inves 

New Drugs. 19: 219-227, 2001. 

Hoyer-Hansen M, Bastholm L, Mathiasen IS, 

Elling F, Jaattela M. Vitamin D analog EB<strong>10</strong>89 

triggers dramatic lysosomal changes and Beclin 

1-mediated autophagic cell death. Cell Death 

Differ. 12: 1297–1309, 2005. 

Hsu CL, Yen GC. Induction of cell apoptosis in 

3T3-L1 pre-adipocytes by flavonoids is 

associated with their antioxidant activity. Mol 

Nutr Food Res. 50: <strong>10</strong>72-<strong>10</strong>79, 2006. 

Kondo Y, Kanzawa T, Sawaya R, Kondo S. The 

role of autophagy in cancer development and 

response to therapy. Nat Rev Mol Cell Biol. 5: 

726-734, 2005. 

Kondo Y, Kondo S. Autophagy and cancer therapy. 

Autophagy. 2: 85-90, 2006. 


Lambert JMR, Gorzov P, Veprintsev DB, 

Söderqvist M, Segerbäck, D, Bergman J et al. 

PRIMA-1 reactivates mutant p53 by covalent 

binding to the core domain. Cancer Cell. 15: 

376-388, 2009. 

LaPensee EW, Schwemberger SJ, LaPensee CR, 

Bahassi E, Afton SE, Ben-Jonathan N. Prolactin 

confers resistance against cisplatin in breast 

cancer cells by activating glutathione-Stransferase. 

Carcinogenesis. 30: 1298-1304, 

2009. 

Lim LY, Vidnovic N, Ellisen LW, Leong C-O. 

Mutant P53 mediates survival of breast cancer 

cells. Brit J Cancer. <strong>10</strong>1: 1606 – 1612, 2009. 

Lindqvist A, Van Zon W, Karlsson Rosenthal C, 

Wolthuis RMF. Cyclin B1–Cdk1 activation 

continues after centrosome separation to control 

mitotic progression. PLoS Biol. 5: 1127-1137, 

2007. 

Liu X, Zou H, Slaughter C, Wang X. DFF, a 

heterodimeric protein that functions 

downstream of caspase-3 to trigger DNA 

fragmentation during apoptosis. Cell. 8: 175- 

184, 1997. 

Maiuri MC, Galluzzi L, Morselli E, Kepp O, Malik 

SA, Kroemer G. Autophagy regulation by p53. 

Curr Opin Cell Biol. 22: 181–185, 20<strong>10</strong>. 

Maiuri MC, Zalckvar E, Kimchi A, Kroemer G. 

Self-eating and self-killing: crosstalk between 

autophagy and apoptosis. Nat Rev Mol Cell 

Biol. 8: 741-752, 2007. 

Martin DN, Baehrecke E. Caspases function in 

autophagic programmed cell death in 

Drosophila. Development. 131: 275- 284, 2004. 

Mohan R, Banerjee M, Ray A, Manna T, Wilson L, 

Owa T et al. Antimitotic sulfonamides inhibit 

microtubule assembly dynamics and cancer cell 

proliferation. Biochemistry. 45: 5440-5449, 

2006. 

Munoz-Gamez A, Rodriguez-Vargas JM, Quiles- 

Perez R, Aguilar-Quesada R, Martin-Oliva D, 

de Murcia G et al. PARP-1 is involved in 

autophagy induced by DNA damage. 

Autophagy. 5: 61-74, 2009. 

Owa T, Yoshino H, Okauchi T, Yoshimatsu K, 

Ozawa Y, Sugi NH, et al. Discovery of novel 

antitumor sulfonamides targeting G1 phase of


the cell cycle. J Med Chem. 42:3789-3799, 

1999. 

Ozawa Y, Sugi NH, Nagasu T, Owa T, Watanabe 

T, Koyanagi N et al. E7070, a novel 

sulphonamide agent with potent antitumour 

activity in vitro and in vivo. Eur J Cancer. 37: 

2275-2282, 2001. 

Schafer JM, Lee ES, O'Regan RM, Yao K, Jordan 

VC. Rapid development of tamoxifenstimulated 

mutant p53 Breast Tumors (T47D) in 

athymic mice. Clin Cancer Res. 6: 4373-4380, 

2000. 

Supuran CT, Casini A, Scozzafava A. Protease 

inhibitors of the sulfonamide type: Anticancer, 

antiinfammatory, and antiviral agents. Med Res 

Rev. 23: 535-558, 2003. 

Supuran CT. Indisulam: an anticancer sulfonamide 

in clinical development. Expert Opin Investig 

Drugs. 12: 283-287, 2003. 

Tyagi A, Singh RP, Agarwal C, Agarwal R. 

Silibinin activates p53-caspase2 pathway and 

causes caspase-mediated cleavage of Cip1/p21 

in apoptosis induction in bladder transitionalcell 

papilloma RT4 cells: evidence for a 

regulatory loop between p53 and caspase 2. 


Valley AW, Balmer CM. Pharmacotherapy: A 

Pathophysiologic Approach. Appleton & 

Lange, CT. 1957-2012, 1999. 

Yee KS, Wilkinson S, James J, Ryan KM, Vousden 

KH. PUMA and Bax-induced autophagy 

contributes to apoptosis. Cell Death Differ. 16: 

1135–1145, 2009. 

Yokoi A, Kuromitsu J, Kawai T, Nagas T, Sugi 

NH, Yoshimatsu K, et al. Profiling novel 

sulfonamide antitumor agents with cell-based 

phenotypic screens and array-based gene 

expression analysis. Mol Cancer Ther. 1: 275- 

286, 2002. 

Yokoyama T, Kondo Y, Bogler O, Kondo S. Drug 

Resistance in Cancer Cells (Mehta, K. and 

Siddik, Z.H., eds). Springer Science+Business 

Media, LLC: PA. 53-71, 2009. 

Yu L, Lenardo MJ, EH Baehrecke Autophagy and 

caspases: a new cell death program. Cell Cycle. 

3:1124-1126, 2004. 

Yu SW, Wang H, Poitras MF, Coombs C, Bowers 

WJ, Federoff HJ et al. Mediation of poly (ADPribose) 

polymerase-1-dependent cell death by 

apoptosis-inducing factor. Science. 297: 259-63, 

2002.

Journal of Cell and Molecular Biology <strong>10</strong>(1): 55-64, 2012 Research Article 55 



Media optimization for amylase production in solid state 

fermentation of wheat bran by fungal strains 

Muhammad IRFAN*, Muhammad NADEEM, Quratualain SYED 

Food & Biotechnology Research Center (FBRC), Pakistan Council of Scientific & Industrial Research 

(PCSIR) Laboratories Complex, Ferozpure Road Lahore, Pakistan. 

(* author for correspondence; mirfanashraf@yahoo.com) 

Received: 02 April 2012; Accepted: 30 May 2012 


The present study is concerned with the optimization of environmental and cultural conditions for the 

production of α-amylase from wheat bran in solid state fermentation by locally isolated strains of Aspergillus 

niger- ML-17 and Rhizopus oligosporus-ML-<strong>10</strong> . The whole fermentation process was carried out in 250 ml 

Erlenmeyer flask. Different parameters were optimized for each strain to obtain maximum enzyme yield. For 

Aspergillus niger-ML-17, incubation period of 96 h, initial diluent pH of 5.0, 30°C incubation temperature, 

inoculum size of 5% were found to be optimum for the production of α-amylase. Amylase production was 

enhanced from 2.3 ± 0.014 IU to 4.4 ± 0.042 IU by supplementing the fermentation media with maltose 

(0.25%), yeast extract (0.25%), NaNO3 (0.25%), MgSO4 (0.2%), NaCl (0.5%), Tween-80 (0.001%) and 

Asparginine (0.0001%) . In case of Rhizopus oligosporus-ML-<strong>10</strong>, the optimized cultural conditions for the 

production of 2.5 ±0.023 IU were inoculum size of <strong>10</strong>%, initial pH of the diluent 6.0, incubation temperature 

of 35 o C for 96h. Further addition of maltose (25%), yeast extract (0.25%), NH4NO3 (0.25%), MgSO4 (0.2%), 

NaCl (0.75%), Tween soluble starch (0.001%) and asparginine (0.0001%) to the medium significantly 

enhance the enzyme production up to 3.2 ± 0.027 IU. 

Keywords: Amylase, wheat bran, A.niger, R.oligosporus, solid state fermentation 

Buğday kepeği katı hal fermentasyonunda mantar suşlarıyla amilaz üretimi için besiyeri 

optimizasyonu 

Özet 

Bu çalışma yerel olarak izole edilen Aspergillus niger- ML-17 ve Rhizopus oligosporus-ML-<strong>10</strong> suşları 

tarafından buğday kepeği katı hal fermentasyonunda amilaz üretimi için çevre ve kültür koşullarının 

optimizasyonuyla ilgilidir. Tüm fermentasyon süreci 250 ml erlende yapılmıştır. Maksimum enzim ürünü 

elde etmek amacıyla her suş bir için farklı parametreler optimize edilmiştir. Aspergillus niger- ML-17 için 96 

saat inkübasyon süresi, çözücünün başlangıç pH’sı olarak 5.0, 30°C inkübasyon sıcaklığı, % 5 ekim 

büyüklüğü α- amilaz üretimi için optimum bulunmuştur. Amilaz üretimi fermentasyon ortamına maltoz 

(%0,25), maya özütü (% 0,25), NaNO3 (% 0,25), MgSO4 (% 0,2), NaCl (% 0,5), Tween-80 (% 0,001) ve 

asparajin (% 0,0001) eklenmesiyle 2,3 ± 0,014 IU’ dan 4,4 ± 0,042 IU’ ya artmıştır. Rhizopus oligosporus- 

ML-<strong>10</strong> için ise; 2,5 ± 0,023 IU üretim için optimize edilen kültür koşulları %<strong>10</strong> ekim büyüklüğü, çözücünün 

başlangıç pH’sı 5,0, inkübasyon sıcaklığı 35°C, 96 saat olacak şekildedir. Besiyerine maltoz (25%), maya 

özütü (0.25%), NH4NO3 (0.25%), MgSO4 (0.2%), NaCl (0.75%), Tween çözünür nişasta (0.001%) ve 

Asparginine (0.0001%) eklenmesi enzim üretimini önemli ölçüde artırarak 3.2 ± 0.027 IU seviyesine 

ulaştırmıştır. 

Anahtar kelimeler: Amilaz, buğday kepeği, A.niger, R.oligosporus, katı hal fermentasyonu

56 Muhammad IRFAN et al. 


Amylases are a group of hydrolases that can 

specifically cleave the O-glycosidic bonds in 

starch. Two important groups of amylases are 

glucoamylase and α-amylase. Glucoamylase (exo- 

1,4-α-D-glucan glucanohydrolase, E.C. 3.2.1.3) 

hydrolyzes single glucose units from the nonr<strong>edu</strong>cing 

ends of amylose and amylopectin in a 

stepwise manner (Anto et al., 2006). Whereas αamylases 

(endo-1,4-α-D-glucan glucohydrolase, 

E.C. 3.2.1.1) are extracellular enzymes that 

randomly cleave the 1,4-α-D-glucosidic linkages 

between adjacent glucose units inside the linear 

amylose chain (Anto et al., 2006, Castro et al., 

20<strong>10</strong>, Pandey et al., 2005). 

Alpha-amylases are widely distributed in nature 

and can be derived from various sources such as 

plants, animals and microorganisms (Pandey et al., 

2005, Reddy et al., 2003 3-4). However, fungal and 

bacterial amylases have predominant applications 

in the industrial sector. Major advantage of using 

fungi for the production of amylases is the 

economical bulk production capacity and ease of 

manipulation. Many species of Aspergillus and 

Rhizopus are used as a source of fungal α-amylase 

(Pandey et al., 2005). 

Usually amylase production from fungi has 

been carried out using well defined chemical media 

by submerged fermentation (SMF) and solid state 

fermentation (SSF) in recent times (Miranda et al., 

1999). The economics of enzyme production using 

inexpensive raw materials can make an industrial 

enzyme process competitive (Couto and Sanroman, 

2006). 

For the microbial α-amylase production, two 

types of fermentation methods are mainly used i.e. 

submerged and solid state (Norouzian et al., 2006). 

Submerged fermentation (SmF) is comparatively 

advanced and commercially important enzymes are 

traditionally produced by this method (Hashemi et 

al., 20<strong>10</strong>). Whereas, solid state fermentation (SSF) 

is an old technology and has been used since 2600 

BC. However, in recent year SSF has emerged as a 

well developed biotechnological tool for the 

production of enzymes (Bhatnagar et al., 20<strong>10</strong>). 

Nowadays, spectrum of applications of αamylase 

is also extending in many other areas such 

as analytical chemistry, clinical and medicinal 

diagnosis e.g. diagnosis of acute inflammation of 

pancreas, macroamylasemia, perforated pelvic ulcer 

and mumps (Anto et al., 2006, Nimkar et al., 20<strong>10</strong>, 

Chimata et al., 20<strong>10</strong>, Muralikrishna et al., 2005).In 

this study we reported here the process 

optimization for amylase production from two 

fungal species i.e. Aspergillus niger-ML-17 and 

Rhizopus oligosporus-ML-<strong>10</strong> using wheat bran as a 

solid substrate fermentation. 

Materials and Methods 

Substrate 

Wheat bran was procured from local market of 

Lahore city and was used as a substrate for amylase 

production in solid state fermentation. 

Microorganism and culture maintenance 

Fungal strain of Aspergillus niger-ML-17 and 

Rhizopus oligosporus-ML-<strong>10</strong> was obtained from 

the Microbiology Laboratory of Food and 

Biotechnology Research Center (FBRC), PCSIR 

Laboratories Complex, Lahore. The culture was 

maintained on Potato-Dextrose-Agar (PDA) slants. 

The slants were grown at 30°C for 5 days and 

stored at 4°C. 

Inoculum preparation 

<strong>10</strong> mL of sterilized distilled water was added to a 

sporulated 5 days old PDA slant culture. An 

inoculum needle was used to dislodge the spore 

clusters under sterilized conditions and then it was 

shaken thoroughly to prepare homogenized spore 

suspension. 

Solid-state fermentation 

<strong>10</strong> g wheat bran amended with <strong>10</strong> mL of mineral 

salt solution containing (g/L) KH2PO4 <strong>10</strong>, MgSO4 2, 

NaCl 2 and MnSO4 0.5 was taken in 250 mL cotton 

plugged Erlenmeyer flask, mixed homogenously 

and sterilized at 121°C for 15 min in an autoclave. 

Thereafter, the flask material was cooled at room 

temperature and inoculated with 1 mL spore 

suspensions of Aspergillus niger-ML-17 and 

Rhizopus oligosporus-ML-<strong>10</strong>. The flasks were then 

incubated at 30°C for 5 days. 

Optimization of cultural and nutritional parameters 

Various process parameters were optimized for 

maximal enzyme production such as fermentation 

period (24-168 h), incubation temperature (20- 

40°C), initial pH (4-8), inoculum size (2, 5, 7, <strong>10</strong>, 

13, 15, 17%). Experiments were also performed to 

evaluate the influence of different carbon sources 

(maltose, glucose, galactose, lactose, sucrose, 

arabinose, cellulose, soluble starch) and nitrogen 

sources (yeast extract, peptone, tryptone, urea,

ammonium citrate, ammonium phosphate, 

NH4NO3, (NH4)2SO4, NH4Cl and NaNO3) different 

metal salts (MnCl2, ZnCl2, CaCl2, MgSO4, FeSO4), 

NaCl concentration (0.25-2.0%), surfactants 

(Tween-80, Triton-X-<strong>10</strong>0, sodium dodecyl 

sulphate, sodium lauryl sulphate) and different 

amino acids (asparginine, aspartic acid, proline, 

cystine, arginine ) on α-amylase production under 

the optimized fermentation conditions. 

Recovery of enzyme 

After the specified incubation period (in each case), 

50 mL of distilled water was added in each flask 

containing fermented mash and placed on a shaker 

at 200 rpm for 60 min. Afterward, the mixture was 

filtered and centrifuged at 8,000 rpm for 15 min at 

4°C to remove the fungal spores and unwanted 

particles. The clear supernatant thus obtained after 

centrifugation was used as a source of crude 

enzyme. 

Alpha amylase activity 

The activity of α-amylase was assayed as described 

earlier (Irfan et al., 2011) by incubating 0.5 mL of 

the diluted enzyme with 0.5 mL soluble starch (0.5 

%, w/v) prepared in 0.1 M sodium Phosphate 

buffer, pH= 7. After incubation at 60 ºC for <strong>10</strong> 

minutes the reaction was stopped and the r<strong>edu</strong>cing 

sugars released were assayed colorimetrically by 

the addition of 1 mL of 3-5-dinitrosalicylic acid 

reagent. One enzyme activity unit (U) was defined 

as the amount of enzyme releasing 1 µmol of 

maltose from the substrate in 1 minute at 60 ºC. 


All the data was statistically (SD) analyzed by 

using Microsoft excel computer programme. 

Results 

Amylase production in solid state fermentation 57 

The most widely used enzyme in the industry for 

starch hydrolysis is α-amylase. These enzymes 

account for 65 % of enzyme market in the world 

(Muralikrishna et al., 2005). For the production of 

commercially important enzymes, selection of a 

particular strain remains a tedious task. Amylolytic 

enzymes are commonly produced by filamentous 

fungi preferably from species of Aspergillus and 

Rhizopus (Pandey et al., 2005). 

Time course study for the production of αamylase 

Figure 1 depicts the time course study (24-120 h) 

for the production of α-amylase by Aspergillus 

niger-ML-17 and Rhizopus oligosporus-ML-<strong>10</strong> 

using solid state fermentation. Optimum 

fermentation period of 96 h was best for both 

Aspergillus niger-ML-17 (4.7 ±0.14 IU) and 

Rhizopus oligosporus-ML-<strong>10</strong> (2.7 ±0.08 IU) in 

solid state fermentation. Further increase in the 

incubation period decreased the enzyme secretion. 

Therefore, incubation time of 96 h was selected as 

optimum time for the production of α-amylase in 

the subsequent experimental work. Maximum 

accumulation of α-amylase occurs during stationary 

phase. Further increase in incubation period 

decreased the production of α-amylase. It might be 

due to the deficiency of nutrients, accumulation of 

toxic substances and proteolysis of α-amylase as 

interpreted by many workers (Chamber et al., 1999, 

Shafique et al., 2009). Abu et al., (2005) also 

reported maximum α-amylase production by 

Aspergillus niger after an incubation period of 96 h. 

Figure 1. Time course study of amylase production (Error bars represent the SD among replicates).


Effect of initial pH of diluent on α-amylase 

production 

The effect of different initial pH (4-6.5) of the 

diluent on α-amylase production by Aspergillus 

niger-ML-17 and Rhizopus oligosporus-ML-<strong>10</strong> 

using SSF is shown in figure 2. Enzyme production 

was maximum (3.7±0.015 IU) when initial pH of 

the diluent was adjusted at 5.0 using strains of 

A.niger-ML-17 in SSF. When strain of 

R.ologosporus –ML-<strong>10</strong> was employed for amylase 

production, it gave better yield (2.7 ± 0.016 IU) at 

6.0 initial pH of the diluent. Further increase in the 

initial pH of the diluent resulted decreased in the 

enzyme activity. It is due to the fact that fungal 

growth was optimum at this pH and hence the 

enzyme production. Initial pH of the medium is 

known to affect the synthesis and secretion of αamylase. 

Alpha amylase production by microbial 

strains strongly depends on the extracellular pH as 

it influences many enzymatic reactions as well as 

the transport of various components across the cell 

membrane (Ellaiah et al., 2002). In contrast to the 

present findings, Alva et al. (2007) achieved the 

optimal α-amylase production at initial pH 5.8 by 

Aspergillus sp. Conversely, this might be because 

the requirement of slightly acidic pH for optimum 

growth of fungi (Liu et al., 2008, Sun et al., 2009). 

Figure 2. Effect of initial pH of diluents on amylase production (Error bars represent the SD among 

replicates) 

Effect of temperature on the production of αamylase 

Figure 3 showed the effect of varying incubation 

temperature (20-40ºC) on the production of αamylase 

by Aspergillus niger-ML-17 and 

R.oligosporus-ML-<strong>10</strong> using SSF. Maximal enzyme 

production (3.5 ±0.034 IU) was obtained in 

fermentation flask that was incubated at 30ºC after 

the conidial inoculation of A.niger-ML-17. On the 

other hand R.oligosporus-ML-<strong>10</strong> gave better 

enzyme production (2.5 ±0.023 IU) at 35 o C. All the 

other flasks that were incubated on temperatures 

other than these gave comparatively less production 

of α-amylase. Alpha amylase production by fungi is 

related to the growth which sequentially depends 

upon the incubation temperature. Many other 

researchers have also reported 30°C as optimum 

temperature for the fungal growth and enzyme 

production. This is because the enzyme production 

is growth associated and 30°C is optimum 

temperature for fungi and subsequently α-amylase 

production (Shafique et al., 2009, Dakhmouche et 

al., 2006).


Figure 3. Effect of incubation temperature on amylase production (Error bars represent the SD among 

replicates). 

Effect of inoculum size on the production of αamylase 

Effect of inoculum size was checked by varying the 

concentration of spores of A.niger-ML-17 and 

R.oligosporus-ML-<strong>10</strong> in solid state fermentation of 

wheat bran. Optimum inoculum size of 5% (3.5 

±0.014 IU) and <strong>10</strong>% (2.9 ±0.011 IU) of A.niger- 

ML-17 and R.oligosporus-ML-<strong>10</strong> gave highest 

yield of enzyme production respectively as shown 

in figure 4. By increasing the size of inoculum 

resulted in decreased enzyme production. Increased 

inoculum size resulted in increases moisture level 

which ultimately decreased the fungal growth and 

enzyme production (Sharma et al., 1996). Ammar 

and El-Safey (2003) obtained highest yield of 

amylase production from A. flavus var columnaris 

using inoculum size of 0.0637 x <strong>10</strong> 6 /ml -1 . In 

another study 5 x <strong>10</strong> 6 spores per flask gave 

maximum enzyme production by Aspergillus niger 

ATCC 16404 (Dakhmouche et al., 2006). Zambare 

(20<strong>10</strong>) obtained highest enzyme production (1672- 

1693 U/gdfs) at inoculum level of 5-8% (v/w) in 

solid state fermentation using strain of A.oryzae. 

Figure 4. Effect of inoculum size on amylase production (Error bars represent the SD among replicates). 

Effect of different carbon sources on the 

production of α-amylase 

Different carbon sources i.e. soluble starch, 

glucose, galactose, lactose, arabinose, cellulose, 

maltose and sucrose were also evaluated for the 

production of α-amylase (Figure 5). A.niger-ML- 

17 better used the maltose as a carbon source and 

improved enzyme production (4.4 ± 0.042 IU) as 

compared to control while soluble starch (3.2 ± 

0.027 IU) was found best carbon source for 

amylase production in case of R.oligosporus-ML- 

<strong>10</strong>. All the other tested carbon sources gave 

comparatively less enzyme production which is 

supplemented to the fermentation medium at 

concentration of 0.25% (w/v). Therefore, soluble 

starch and maltose was optimized as a carbon 

source in the further experimental work 

R.oligosporus-ML-<strong>10</strong> and A.niger-ML-17 

respectively. Many other workers also reported 

starch as the best carbon source for the production 

of alpha amylase (Gigras et al., 2002, Dharani 

2004). It is because α-amylase is an extracellular 

enzyme and its production is increased by its 

substrate (Chimata et al., 20<strong>10</strong>; Varalakshmi et al., 

2009).


Figure 5. Effect of different carbon sources on amylase production (Error bars represent the SD among 

replicates). 

production by employing strains of A.niger-ML-17 

Effect of different nitrogen sources on the 

and R.oligosporus-ML-<strong>10</strong>. Thus, yeast extract was 

production of α-amylase 

used as an optimized organic nitrogen sources in 

Figure 6 depicts the effect of nitrogen sources this further research. Hashemi et al., (20<strong>10</strong>) also 

(peptone, urea, tryptone, casein, skimmed milk and obtained maximum α-amylase production (140 

yeast extract NH4SO4, NH4NO3, NaNO3, U/g) with NH4NO3 but at a level of 1% (w/v). 

ammonium citrate & ammonium phosphate) on the Amylase production is enhanced with the addition 

production of α-amylase by Aspergillus niger-ML- of organic nitrogen sources (Hamilton et al., 1999, 

17 and R.oligosporus-ML-<strong>10</strong> using SSF. Among all Hayashida et al., 1998 28,29). Many workers (Anto 

the selected inorganic nitrogen sources maximum et al., 2006, Pederson and Neilson 2000, Oshoma et 

amylase production (3.9 ±0.1IU) was obtained, al., 20<strong>10</strong>, Valaparla 20<strong>10</strong>) reported that yeast 

when NaNO3 (0.25%, w/v) was used in medium extract as an organic nitrogen source produces 

inoculated with spores of A.niger-ML-17 while the maximum amylase production. Pederson and 

strain R.oligosporus-ML-<strong>10</strong> best utilized (2.6 ±0.08 Neilson (2000) optimized (NH4)2SO4 for maximum 

IU) NH4NO3 at concentration of 0.25% for amylase amylase productivity by A. oryzae. 

production. In case of organic nitrogen sources 

yeast extract was found better for amylase 

Figure 6. Effect of nitrogen sources on amylase production (Error bars represent the SD among replicates). 

Effect of different metal salts on amylase 

production in SSF 

Different metal salts (MnCl2, ZnCl2, CaCl2, MgSO4 

and FeSO4) were added to the fermentation 

medium to enhance the amylase yield by A.niger- 

ML-17 and R.oligosporus-ML-<strong>10</strong> in solid state 

fermentation. Results (Fig. 7) revealed that addition 

of MgSO4 at 0.1% concentration to the medium 

favored the enzyme production by both tested 

fungi. Of all the metal salts FeSO4 lowers the 

enzyme production as compared to control. 

Rameshkumar and Sivasudha (2011) reported that 

supplementation of 0.1% CaCl2 as a mineral source 

to the medium effectively increased the amylase 

production by B.subtilis in solid state fermentation. 

According to Negi and Banerjee (20<strong>10</strong>) addition of 

HgCl2 to the medium increases the amylase 

production up to 2.44 folds. Most of the study 

indicated that the enzyme did not require a specific 

ion for their proper functioning (Reyed 2007). 

Sanghvi et al., (2011) produced amylase from 

Chrysosporium asperatum in submerged 

fermentation and reported that supplementation of 

FeCl3 in the medium as a mineral source slightly 

increased the amylase production.


Figure 7. Effect of different metal salts on amylase production (Error bars represent the SD among 

replicates). 

Effect of different concentration of NaCl on 

amylase production in SSF 

In this experiment, different concentrations of NaCl 

(0.25-2.0 %) were employed to check the effect of 

different concentration of NaCl on amylase 

production by A.niger-ML-17 and R.oligosporus- 

ML-<strong>10</strong>. Results indicated (Fig. 8) that A.niger-ML- 

17 showed maximum (3.6 ±0.17 IU) enzyme 

production at 0.5% concentration of NaCl in the 

medium while R.oligosporus-ML-<strong>10</strong> gave 

maximum titer of amylase (2.5± 0.13 IU) at 0.75% 

concentration of NaCl. By increasing the NaCl 

concentration beyond this decline in enzyme 

production was observed. Kokab et al., (2003) 

produced amylase from Bacillus subtilis in solid 

state fermentation having medium containing 1.5% 

concentration of NaCl. Patel et al., (2005) purified 

and characterized the amylase enzyme from 

A.oryzae in SSF having medium with 0.1% 

concentration of NaCl. 

Figure 8. Effect of different concentrations of NaCl on amylase production (Error bars represent the SD 

among replicates). 

Effect of surfactants on amylase production 

Figure 9 illustrated the effect of different 

surfactants on amylase production by A.niger –ML- 

17 and R.oligosporus-ML-<strong>10</strong>. Result showed that 

addition of Tween 80 (0.05 v/w) to the medium is 

effective in enzyme production by both A.niger- 

ML-17 (3.7 IU) and R.oligosporus-ML-<strong>10</strong> (2.5 IU) 

in SSF. SDS and SLS had no strong influence on 

enzyme production in solid state fermentation by 

tested fungi. Negi and Banerjee (20<strong>10</strong>) reported 

that Triton-X-<strong>10</strong>0 and sodium laurate sulphate are 

the stimulator for enzyme production but sodium 

laurate sulphate increased amylase production by 

1.28 folds. Gupta et al. (2008) also reported that 

different surfactants like Tween-80, Triton X-<strong>10</strong>0 

and SDS had strong influence on amylase 

production in submerged fermentation using 

Aspergillus niger. Vu et al. (2011) stated that use of 

Tween-80 as a surfactant effectively enhances the 

cellulose production in solid state fermentation. 

Production of hydrolytic enzymes can be enhanced 

by the surfactants and fatty acids (Singh et al., 

1991). When surfactants are added, they enhance 

the microbial growth in SSF by promoting the 

penetration of water into the solid substrate matrix, 

leading in an increase of surface area (Asgher et al., 

2006).


Figure 9. Effect of different surfactants on amylase production (Error bars represents the SD among 

replicates). 

Effect of different amino acids on amylase 

production in SSF 

To check the effect of different amino acids on 

amylase production, various amino acids like 

asparaginine, aspartic acid, praline, cysteine and 

arginine were evaluated by A.niger –ML-17and 

R.oligosporus-ML-<strong>10</strong> in SSF. Results (Fig. <strong>10</strong>) 

revealed that supplementation of asparginine with 

concentration of 0.0001% favored enzyme 

production in solid state fermentation. Rest of the 

amino acids showed no significant effect on 

enzyme production. 

Sidkey et al. (20<strong>10</strong>), isolated different strains 

from natural environment and screened for amylase 

production. Among various screened strains 

Aspergillus flavus was found to be potent amylase 

producer when supplementations of methionine as 

an amino acid cotent to the medium. Some workers 

(Moustafa, 2002; Sidkey et al., 1996) reported that 

acidic amino acids like glutamic and aspartic acids 

are the best inducers for amylase production. 

Figure <strong>10</strong>. Effect of different amino acids on amylase production (Error bars represent the SD among 

replicates). 

References 

Abu EA, Ado SA, James DB. Raw starch 

degrading amylase production by mixed culture 

of Aspergillus niger and Saccharomyces 

cerevisiae grown on Sorghum pomace. Afr J 

Biotechnol. 4(8): 785- 790, 2005. 

Alva S, Anumpama J, Savla J, Chiu YY, Vyshali 

P, Shruti M, Yogeetha BS, Bhavya D, Purvi J, 

Ruchi K, Kumudini BS, Varalakshmi KN. 

Production and characterization of fungal 

amylase enzyme isolated from Aspergillus sp. 

JGI 12 in solid state culture. Afri J Biotechnol. 

6(5):576-581, 2007. 

Ammar MS and El-Safey EM. Production of αamylase 

enzyme produced by Aspergillus flavus 

var. columnaris, S-9KP from maize meal and 

rice husk under solid-state fermentation (SSF) 

conditions in open air. International Conference 

of Enzymes in the Environment, Activity, 

Ecology and Applications, Praha, Czech 

Republic, July 14-17, pp.33, 2003. 

Anto H, Trivedi UB and Patel KC. Glucoamylase 

production by solid-state fermentation using 

rice flake manufacturing waste products as

substrate. Bioresource Technol. 97(<strong>10</strong>):1161- 

1166, 2006. 

Asgher M, Asad MJ, Legge RL. Enhanced lignin 

peroxidase synthesis by Phanerochaete 

chrysosporium in solid state bioprocessing of a 

lignocellulosic substrate. World J Microb 

Biotechnol. 22:449-53, 2006. 

Bhatnagar D, Joseph L, Raj RP. Amylase and acid 

protease production by solid state fermentation 

using Aspergillus niger from mangrove swamp. 

Indian J Fish. 57(1):45-51, 20<strong>10</strong>. 

Castro AM, Carvalho DF, Freire DMG, Castilho 

LR. Economic analysis of the production of 

amylases and other hydrolases by Aspergillus 

awamori in solid-state fermentation of babassu 

cake. SAGE-Hindawi Access to Research 

Enzyme Research, 1, 9, 20<strong>10</strong>. 

Chamber R, Haddaoui E, Petitglatran MF, Lindy O, 

Sarvas M. Bacillus subtilis α-amylase. The rate 

limiting step of secretion is growth phase in 

dependent. FEMS Microbiol Lett. 173 (1):127- 

131, 1999. 

Chimata MK, Sasidhar P, Challa S. Production of 

extracellular amylase from agricultural residues 

by a newly isolated Aspergillus species in solid 

state fermentation. Afri J Biotechnol. 

9(32):5162-5169, 20<strong>10</strong>. 

Couto SR and Sanroman MA. Application of solidstate 

fermentation to food industry. J Food Eng. 

76:291-302, 2006. 

Dakhmouche S, Gheribi-Aoulmi Z, Meraihi Z, 

Bennamoun L. Application of a statistical 

design to the optimization of culture medium 

for a-amylase production by Aspergillus niger 

ATCC 16404 grown on orange waste powder. J 

Food Eng. 73 (2):190-197, 2006. 

Dharani APV. Effect of C:N ratio on alpha amylase 

production by Bacillus licheniformis SPT 27 

Afr. J. Biotech., 3: 519-522, 2004. 

Ellaiah PK, Adinarayana Y, Bhavani P and 

Padmaja B. Optimization of process parameters 

for glucoamylase production under solid state 

fermentation by a newly isolated Aspergillus 

species. Process Biochem. 38:615–620, 2002. 

Gigras P, Sahai V, Gupta R. Statistical media 

optimization and production of ITS alpha 

amylase from Aspergillus oryzae in a 

bioreactor. Current Microbiol. 45:203–208, 

2002. 


Gupta A, Gupta VK, Modi DR, Yadava LP. 

Production and characterization of alpha 

amylase from Aspergillus niger. Biotechnology. 

7(3):551-556, 2008. 

Hamilton LH, Kelly CT, Fogarty WM. Production 

and properties of the raw starch-digesting αamylase 

of Bacillus species IMD 435. Process 

Biochem. 35(1–2):27–31, 1999. 

Hashemi M, Shojaosadati SA, Razavi SH, Mousavi 

SM, Khajeh K, Safari M. The efficiency of 

temperature shift strategy to improve the 

production of α-Amylase by Bacillus sp. in a 

solid-state fermentation system. Food and 

Bioprocess Technol. 5(3): <strong>10</strong>93-<strong>10</strong>99, 2012. 

Hayashida S, Teamoto Y, Inove T. Production and 

characteristics of raw potato Starch digesting 

amylase from Bacillus subtilis. 65. Appl 

Environ Microbiol. 54: 1516-1522, 1998. 

Irfan M, Nadeem M, Syed Q, Baig S. Production 

of thermostable α-amylase from Bacillus sp. in 

solid state fermentation. J Appl Sci Res. 

7(5):607-617, 2011. 

Kokab S, Asghar M, Rehman K, Asad MJ, Adedyo 

O. Bio-Processing of Banana Peel for α- 

Amylase Production by Bacillus subtilis. Int J 

Agr Biol. 5, 1, 2003. 

Liu XD and Xu Y. A novel raw starch digesting αamylase 

from a newly isolated Bacillus sp. YX- 

1, Purification and characterization. 

Bioresource Technol. 99: 4315-4320, 2008. 

Miranda OA, Salgueiro AA, Pimental NCB, 

Limafilho JJ, Melo EHM, Duran N. Lipase 

production by a Brazilian strain of Penicillium 

citrinium using industrial residue. Bioresource 

Technology 69 : 145-149, 1999. 

Moustafa OA. Thermostable alpha-amylase(s) from 

irradiated microbial origin utilizing agricultural 

and environmental wastes under solid state 

fermentation conditions. M.Sc. Thesis. Al-Azhar 

University, 2002. 

Muralikrishna G and Nirmala M. Cereal αamylases-an 

overview. Carbohydrate Polym. 

60: 163-173, 2005. 

Negi S and Banerjee R. Optimization of culture 

parameters to enhance production of amylase 

and protease from Aspergillus awamori in a 

single fermentation. Afric J Biochem Res. 

2(3):73-80, 20<strong>10</strong>.


Nimkar MD, Deogade NG, Kawale M. Production 

of alpha-amylase from Bacillus subtilis & 

Aspergillus niger using different agro waste by 

solid state fermentation. Asiatic J Biotechnol 

Res. 01:23-28, 20<strong>10</strong>. 

Norouzan D, Akbarzadeh A, Scharer JM, Young 

MM. Fungal glucoamylases. Biotechnol Adv. 

24(1): 80-85, 2006. 

Oshoma CE, Imarhiagbe EE, Ikenebomeh MJ, 

Eigbaredon HE. Nitrogen supplements effect on 

amylase production by Aspergillus niger using 

cassava whey medium. Afri J Biotechnol. 9 

(5):682-686, 20<strong>10</strong>. 

Pandey A, Webb C, Soccol CR, Larroche C. 

Enzyme Technology, New Delhi, Asiatech 

publishers, Inc. 197, 2005. 

Pederson H and Nielsen J. The influence of 

nitrogen sources on the α-amylase productivity 

of Aspergillus oryzae in continuous cultures. 

Appl Microb Biotechnol. 53(3): 278-281, 2000. 

Patel AK, Nampoothiri MK, Ramachandaran S. 

Partial purification and characterization of αamylase 

produced by Aspergillus oryzae using 

spent brewing grains. Indian J Biotechnol. 

4:336-341, 2005. 

Rameshkumar A, Sivasudha T. Optimization of 

Nutritional Constitute for Enhanced Alpha 

amylase Production Using by Solid State 

Fermentation Technology. Int J Microb Res. 2 

(2):143-148, 2011. 

Reddy AS, Jharat R, Byrne N. Purification and 

properties of amylase from A review. J Food 

Biochem. 21:281-302, 2003. 

Reyed RM. Biosynthesis and properties of 

extracellular amylase by encapsulation 

Bifidobatrium bifidum in batch culture. 

Australian J Basic Appl Sci. 1: 7-14, 2007. 

Sanghvi GV, Rina DK, Kishore SR. Isolation, 

Optimization, and Partial Purification of 

Amylase from Chrysosporium asperatum by 

Submerged Fermentation. J Microb Biotechnol. 

21(5):470–476, 2011. 

Shafique S, Bajwa R, Shafique S. Screening of 

Aspergillus niger and A. flavus strains for extra 

cellular α-amylase activity. Pak J Bot. 

41(2):897-905, 2009. 

Sharma DK, Tiwari M, Behere BK. Solid state 

fermentation of new substrates for production of 

cellulase and other biopolymer hydrolyzing 

enzymes. Appl Biochem Biotechnol. 15:495- 

500, 1996. 

Sidkey NM, Abo-Shadi MA, Al-Mutrafy AM, 

Sefergy F, Al-Reheily N. Screening of 

Microorganisms Isolated from some Enviro- 

Agro-Industrial Wastes in Saudi Arabia for 

Amylase Product. J American Sci. 6(<strong>10</strong>):926- 

939, 20<strong>10</strong>. 

Sidkey NM, Shash SM, Ammar MS. Regulation of 

α-amylase biosynthesis by Aspergillus sp. ,S-7 

attaching the Nile Hyacinth homogenate 

produced under laboratory scale fermentation 

conditions. Al-Azhar Bullutin Sci. 7(1):437-488, 

1996. 

Singh A, Abidi AB, Darmwal NS, Agrawal AK. 

Influence of nutritional factors of cellulase 

production from natural lignocellulosic residues 

by Aspergillus niger. Agri Biol Res. 7:19-27, 

1991. 

Sun H, Ge X, Wang L, Zhao P, Peng M. 

Microbial production of raw starch digesting 

enzymes. Afr J Biotechnol. 8 (9):1734-1739, 

2009. 

Varalakshmi KN, Kumudini BS, Nandini BN, 

Solomon J, Suhas R, Mahesh B, Kavitha AP. 

Production and characterization of α-amylase 

from Aspergillus niger JGI 24 isolated in 

Bangalore. Polish J Microbiol. 58: 29-36, 

2009. 

Valaparla VK. Purification and properties of a 

thermostable α-amylase by Acremonium 

Sporosulcatum. Int J Biotechnol Biochem. 

6(1):25–34, 20<strong>10</strong>. 

Vu VH, Pham TA, Kim K. Improvement of fungal 

cellulase production by mutation and 

optimization of solid state fermentation. 

Mycobiology. 39(1): 20-25, 2011. 

Zambare V. Solid state fermentation of Aspergillus 

oryzae for Glucoamylase Production on Agro 

residues. Int J Life Sci. 4:16-25, 20<strong>10</strong>.

Journal of Cell and Molecular Biology - GUIDELINES for AUTHORS 

General 


(JCellMolBiol) is an international journal which 

covers original works in the field of cell biology, 

molecular biology, genetics, microbiology, 

neurobiology, bioinformatics and related topics. 

The official language of the journal is English, 

however manuscripts in Turkish are accepted as 

well. 

Conditions for publication 

This journal publishes research articles, review 

articles, short communications, book/software 

reviews, case reports and letters to the editor. 

Research articles: Only original contributions will 

be accepted which have not been published 

previously. Manuscripts should not exceed 15 

papers of printed text, including tables, figures and 

references 

Review articles: Reviews of recent developments in 

a research field and ideas will be accepted. 

Manuscripts should not exceed 15 papers of printed 

text. Illustrations are encouraged. 

Short communications: These include small-scale 

investigations or innovative methods, techniques, 

clinical trials and epidemiological studies. It should 

not exceed 3 pages. 

Letters to editor: These include opinions, news and 

suggestions. Letters should not exceed 2 papers of 

printed text. 

Case Reports: These include individual 

observations based on small numbers of subjects. 

This type of research cannot indicate causality but 

may indicate areas for further research. 

REVISED 

December 2011 

Manuscripts should be submitted by e-mail to: 


Haliç Üniversitesi 

Fen Edebiyat Fakültesi 

Moleküler Biyoloji ve Genetik Bölümü 

Sıracevizler Cad. No:29 

Bomonti-Şişli 34381, İstanbul-TÜRKİYE 

Tel: +90 212 343 08 87, Fax: +90 212 231 06 31 

E-Mail: <strong>jcmb</strong>@<strong>halic</strong>.<strong>edu</strong>.tr 

65 

Book/software reviews: Short but concise 

description of the book/software, not exceeding a 

page. Book/software reviews are not peer reviewed. 

Presentation 

Papers should be typed clearly, double-spaced with 

3 cm wide margins. 

Manuscripts should be prepared using Word 

Processor. 

Cover Letter: You may briefly explain your work 

and its contribution to present knowledge. 

Title Page: The first page of your manuscript 

should be a title page containing the type of paper; 

the title; all authors' full names, and affiliations; 

and the corresponding author's contact address 

(including phone and fax numbers) and e-mail 

address. The title should be as short as possible, but 

should give adequate information regarding the 

contents. Authors should also state a running title 

of no more than 50 characters including spaces. 

All pages must be numbered. 

<strong>Full</strong> Paper 

The full paper should be divided into the following 

parts in the order indicated:

66 

Abstract: A brief, informative abstract, not 

exceeding 200 words, should be provided in 

English and in Turkish. For authors who are not 

native Turkish speakers, JCellMolBiol can provide 

the Turkish abstract. 

Keywords: Immediately following the abstract, 

authors should provide 5 keywords or phrases that 

reflect the content of the article. 

Introduction should include theory, hypotheses, 

prior work 

Material and methods may include subheadings 

Results: If the study consists of different parts, 

subheadings in this section should be consistent 

with subheadings in the methods. 

Discussion 

Acknowledgements should precede the list of 

references 

References: Papers cited in the manuscript should 

be listed in alphabetical order according to the first 

author's surname. 

Tables and Figures 

• Tables and figures should both be embedded 

within the text in their appropriate positions and be 

submitted separately. 

• Electronically submitted figures are preferred in 

*.jpg or *.tiff (min. 300 dpi) formats. Bar scales 

should be drawn directly on the figures when 

necessary. Figure legends should not be included in 

the *jpg or *tif files. 

• Each table should be accompanied by a short 

instructive title line plus an explanatory caption at 

the top. Indicate footnotes within tables by 

superscript letters and type footnotes below the 

table. 

• All the tables and figures must be referred to 

within the text. 

Units, Abbreviations and Scientific Names 

• Only SI units should be used. Current 

abbreviations can be used without explanation, 

others must be explained. 

• All acronyms/abbreviations must be explained 

in parenthesis after their first occurrence. If many 

unfamiliar acronyms/abbreviations are used, please 

REVISED 

December 2011 

compile them in an "Abbreviations" section at the 

end of the paper. 

• Latin expressions should be typed in italics. 

Referencing 

• In the text, citations with two authors should 

take the form: Smith and Robinson,1990. If several 

papers are cited by the same author in the same 

year, they should be lettered in sequence (1990a), 

(1990b), etc. When papers are by more then two 

authors they should be cited as Smith et al.,1990. In 

cases where more than one reference is written for 

the same sentence, they should appear in ascending 

publication order, e.g. (Jones et al., 2005; Smith et 

al., 2007; Brown et al., 2009). 

• In the list, references must be placed in 

alphabetical order. The following models for the 

reference list cover all situations. The punctuation 

given must be exactly followed. The journal titles 

should be abbreviated appropriately. 

Redford IR. Evidence for a general relationship 

between the induced level of DNA double 

strand breakage and cell killing after Xirradiation 

of mammalian cells. Int J Radiat 

Biol. 49: 611- 620, 1986. 

Tccioli CE, Cottlieb TM, Blund T. Product of the 

XRCCS gene and its role in DNA repair and 

V(D)J recombination. Science. 265: 1442-1445, 

1994 

Ohlrogge JB. Biochemistry of plant acyl carrier 

proteins. The Biochemistry of Plants: A 

Comprehensive Treatise. Stumpf PK and Conn 

EE (Ed). Academic Press, New York. 137-157, 

1987. 

Brown LA. How to cope with your supervisor. PhD 

Thesis. University of New Orleans, 2005. 

Web document with no author: Leafy seadragons 

and weedy seadragons 2001. Retrieved 

November 13, 2002, from http:// www. 

windspeed.net.au/jenny/seadragons/ 

Web document with author: Dawson J, Smith L, 

Deubert K. Referencing, not plagiarism. 

Retrieved October 31, 2002 from http: 

//studytrekk.lis.curtin.<strong>edu</strong>.au/ 

• Only papers published or in press should be 

cited in the literature list. Unpublished results, 

including submitted manuscripts and those in 

preparation, should be indicated as unpublished 

data in the text.

Submission Policies and Authorship 

Upon submission of a manuscript, it is accepted 

that all co-authors have approved the contents of 

the manuscript and its submission by the 

corresponding author, and that the corresponding 

author is authorized to represent all co-authors in 

pre-publication discussions with JCellMolBiol. 

The corresponding author is responsible for 

ensuring that all the contributors to the relevant 

work are listed as authors and that all authors have 

aggreed to the manuscript’s content and its 

submission to the JCellMolBiol. In case the Journal 

happens to be aware of an authorship dispute, 

authorship must be approved in writing by all of the 

parties. 

Cost 

There are no submission fees or page charges. 

Criteria for the Selection of Manuscripts 

Manuscripts should meet the following criteria: The 

study conducted is material is original and ethical, 

the writing is clear; the study methods are 

appropriate, the data are valid, the conclusions are 

reasonable and supported by the data; the 

information is important; and the topic is 

interesting to our readership. 

Editorial Processes 

Researchers may request informal feedback from 

the editors in a particular manuscript. The 

presubmission process aids in the submission 

decision for authors. 

When JCellMolBiol receives a manuscript, the 

Editor-in-Chief will first decide whether the 

manuscript meets the formal criteria specified with 

“Guidelines for Authors” and whether it fits within 

the scope of the Journal. In case of doubt on the 

basis of initial review, the Editor-in-Chief will 

consult other members of the Editorial Board. 

Manuscripts that are found suitable for peer review 

will be assigned to two expert reviewers. Reviewers 

may either be Editorial/Advisory Board members 

or external experts selected by the Editorial Board. 

The corresponding author is notified by e-mail 

when the editor decides to send a paper for review. 

The reviewers will have up to three weeks to 

review the submitted article. After peer review, the 

editor will contact the author. If the author is 

required to submit a revised version, the revised 

version has to be submitted by the author within 

REVISED 

December 2011 

67 

two weeks. Otherwise, the manuscript will be 

removed from the manuscript submission queue 

and will be considered rejected. 

In cases where the referees have requested welldefined 

changes to the manuscript, editors may 

request a revised manuscript that addresses to 

referees’ concerns. The revised version is sent back 

to the original referees for re-review. In cases 

where the referees’ concerns are more wideranging, 

editors may reject the manuscript. The 

revised manuscript should be accompanied by a 

cover letter that includes a point-by-point response 

to referees’ comments and an explanation of how 

the manuscript has been changed. 

As a matter of policy, we do not suppress referees’ 

reports, any comments directed to authors are 

transmitted regardless of what we may think of the 

content. On rare occasions, we may edit a report to 

remove offensive language or comments to reveal 

confidentiality. 

The final decision to accept or reject a manuscript 

will be made by the Editor-in-Chief. If it becomes 

apparent that there are serious problems with the 

scientific content or with violations of our 

publishing policies, the Editor-in-Chief also 

reserves the right to reject a paper even after it has 

been accepted. 

After acceptance, the Editor-in-Chief may make 

further changes to the text and figures so that the 

manuscript is readable and clear. Page proofs will 

be sent to the corresponding author via email for 

checking before publication. Corresponding authors 

are sent proofs and are welcome to discuss 

proposed changes with the Editor-in-Chief, but 

JCellMolBiol reserves the right to make the final 

decision about the style. Corrected proofs should be 

sent back within three days of receipt, otherwise the 

Editor-in-Chief reserves the rights to correct the 

proofs himself and to send the material for 

publication. In cases where the authors do not 

submit the appropriately signed Publication 

Agreement Form, the manuscript is drawn from 

publication process even if it is accepted. 

Appeals 

Authors have the right to ask the Editor-in-Chief to 

reconsider a rejection decision, which is considered 

an appeal. Decisions are reversed only if the Editor 

is convinced that the original decision was a serious 

mistake. If an appeal merits further consideration, 

the Editor may send the author’s response or the 

revised paper to one or more referees, or Editor

68 

may ask one referee to comment on the concerns 

raised by another referee. 

Advance Online Publication 

JCellMolBiol provides Advance Online Publication 

of articles, which benefit authors with an earlier 

publication date and allows the readers’ access to 

accepted papers several weeks before they appear 

in print 

Ethical Issues 

For manuscripts reporting experiments on live 

vertebrates or higher invertebrates, authors must 

declare that the study was approved by the 

institutional ethics committee. Papers describing 

investigations on human subjects must include a 

statement that informed consent was obtained from 

all subjects. 

Plagiarism 

If portions of the manuscript have already been 

published by the author on other journals or 

websites, JCellMolBiol Editorial Board needs to 

know which portions of the manuscript have been 

previously published and where. The author should 

include a note in the cover letter indicating which 

portions have been published elsewhere. 

In case of any suspicion on scientific misconduct or 

dishonesty in research, JCellMolBiol reserves the 

right to forward any submitted manuscript to an 

appropriate authority for investigation. 

Copyright Notice 

It is the responsibility of the submitting author to 

ensure that the authorship of the paper reflects the 

contributions of the authors to the work described, 

and that all listed authors have agreed to the 

submission of the manuscript in its current form. 

Conditions of publication in JCellMolBiol are that 

the paper has not already been published elsewhere; 

that it is not currently being considered for 

publication else-where; all persons designated as 

authors should qualify for authorship, and all those 

who qualify should be listed. If accepted, Haliç 

University and JCellMolBiol have the exclusive 

license to publish. 

JCellMolBiol is freely available to individuals and 

institutions. Copies of this Journal and articles in 

this journal may be distributed for research or for 

<strong>edu</strong>cational purposes free of charge. However, 

REVISED 

December 2011 

commercial use of articles contained herein is 

prohibited without the written consent of the 

Editor-in-Chief. 

Publication Agreement 

The corresponing author is required to assign the 

Publication Agreement Form in order to publish the 

submitted manuscript in JCellMolBiol.


<strong>Volume</strong> <strong>10</strong> · No 1 · June 2012 

Review Article 



M. IMRAN, M.J. ASAD, S.H. HADRI, S. MEHMOOD 

Research Articles 

Isolation and biochemical identification of Escherichia coli from wastewater effluents of food 

and beverage industry 

T. FARASAT, Z. BILAL, F. YUNUS 

Investigation of the MGP promoter and exon 4 polymorphisms in patients with ischemic 

stroke in the Ukrainian population 

A.V. ATAMAN, V.Y. GARBUSOVA, Y.A. ATAMAN, O.I. MATLAJ, O.A. OBUCHOVA 

Investigation of the association of survivin gene -625G/C polymorphism in non-small cell 

lung cancer 

E. AYNACI, E. COŞKUNPINAR, A. EREN, O. KUM, Y. M. OLTULU, N. AKKAYA, A. 

TURNA, İ. YAYLIM, P. YILDIZ 

Effects of prenatal and neonatal exposure to lead on white blood cells in Swiss mice 

R. SHARMA, K. PANWAR, S. MOGRA 

Sulfabenzamide promotes autophagic cell death in T-47D breast cancer cells through p53/ 

DRAM pathway 

R. MOHAMMADPOUR, S. SAFARIAN, S. FARAHNAK, S. HASHEMINASL, N. SHEIBANI 

Media optimization for amylase production in solid state fermentation of wheat bran by 

fungal strains 

M. IRFAN, M. NADEEM, Q. SYED 

Guidelines for Authors 

1 

13 

19 

27 

33 

41 

55 

65

10 1 Full Volume (PDF)(jcmb.halic.edu.tr) - Journal of Cell and ...

Create successful ePaper yourself

Delete template?

Save as template?