10 2 Full Volume (PDF) - Journal of Cell and Molecular Biology ...

•Circadian rhythm genes in cancer 

•Tunneling nanotubes 

Journal of Cell and 

Molecular Biology 

•Genetic screening of Turkish barley genotypes 

•Strontium ranelate induces genotoxicity 

Volume 10 · No 2 · December 2012 

http://jcmb.halic.edu.tr



Volume 10 · Number 2 

December 2012 

İstanbul-TURKEY

Haliç University 

Faculty of Arts and Sciences 

Journal of Cell and Molecular Biology 

Founder 

Gündüz GEDİKOĞLU 

Our Children Leukemia Foundation 

Rights held by 

A. Sait SEVGENER 

Rector 

Correspondence Address: 


Haliç Üniversitesi 

Fen-Edebiyat Fakültesi, 

Sıracevizler Cad. No:29 Bomonti 34381 Şişli 

İstanbul-Turkey 

Phone: +90 212 343 08 87 

Fax: +90 212 231 06 31 

E-mail: jcmb@halic.edu.tr 

Journal of Cell and Molecular Biology is 

indexed in 

ULAKBIM, EBSCO, 

DOAJ, EMBASE, 

CAPCAS, EMBiology, 

Socolar, Index COPERNICUS, 

Open J-Gate, Chemical Abstracts 

and 

Genamics JournalSeek 

ISSN 1303-3646 

Printed at MART Printing House 

Editor-in-Chief 

Nagehan ERSOY TUNALI 

Editorial Board 

M. Baki YOKEŞ 

Kürşat ÖZDİLLİ 

Nural BEKİROĞLU 

Emel BOZKAYA 

M.Burcu IRMAK YAZICIOĞLU 

Mehmet OZANSOY 

Editorial Assistance 

Ozan TİRYAKİOĞLU 

Özlem KURNAZ 

Advisory Board 

A. Nur BUYRU, İstanbul, Turkey 

Adil Meriç ALTINÖZ, Istanbul, Turkey 

Adile ÇEVİKBAŞ, İstanbul, Turkey 

Aglaia ATHANASSIADOU, Patras, Greece 

Aglika EDREVA, Sofia, Bulgaria 

Anne FRARY, İzmir, Turkey 

Asım KADIOĞLU, Trabzon, Turkey 

Ayla ÇELİK, Mersin, Turkey 

Ayşe ÖZDEMİR, İstanbul, Turkey 

Beyazıt ÇIRAKOĞLU, İstanbul, Turkey 

Canan ARKAN, Munich, Germany 

E. Zerrin BAĞCI, Tekirdağ, Turkey 

Fatma Neşe KÖK, İstanbul, Turkey 

Ferruh ÖZCAN, İstanbul, Turkey 

Fevzi DALDAL, Pennsylvania, USA 

Gizem DİNLER DOĞANAY, İstanbul, Turkey 

Hande ÇAĞLAYAN, İstanbul, Turkey 

Hande GÜRER ORHAN, İzmir, Turkey 

İlhan YAYLIM ERALTAN, İstanbul, Turkey 

İsmail ÇAKMAK, İstanbul, Turkey 

İsmail TÜRKAN, İzmir, Turkey 

Kemal BÜYÜKGÜZEL, Zonguldak, Turkey 

Maria V. KALEVITCH, Pennsylvania, USA 

Mehmet TOPAKTAŞ, Adana, Turkey 

Meral KENCE, Ankara, Turkey 

Meral ÜNAL, İstanbul, Turkey 

Müge TÜRET SAYAR, İstanbul, Turkey 

Mustafa DJAMGÖZ, London, UK 

Nermin GÖZÜKIRMIZI, İstanbul, Turkey 

Nevin Gül KARAGÜLER, İstanbul, Turkey 

Nihat BOZCUK, Ankara, Turkey 

Pınar SAİP, Istanbul, TURKEY 

Rezan FAHRİOĞLU YAMACI, Nicosia, Cyprus 

Şehnaz BOLKENT, İstanbul, Turkey 

Selma YILMAZER, İstanbul, Turkey 

Sevtap SAVAŞ, Toronto, Canada 

Uğur ÖZBEK, İstanbul, Turkey 

Ünal EGELİ, Bursa, Turkey 

Valentine KEFELİ, Pennsylvania, USA 

Zihni DEMİRBAĞ, Trabzon, Turkey 

Ziya ZİYLAN, İstanbul, Turkey


CONTENTS 

Volume 10 · Number 2 · December 2012 

Review Articles 

Transforming acidic coiled-coil proteins and spindle assembly 

S. TRIVEDI 

Marker Systems and Applications in Genetic Characterization Studies 

Y. ÖZŞENSOY, E. KURAR 

Research Articles 

COX5B and COX2 gene expressions in Multiple Sclerosis 

N. SAFAVIZADEH, S. A. RAHMANI , M. ZAEFIZADEH 

Curcumin rendered protection against cadmium chloride induced 

testicular damage in Swiss albino mice 

P. SINGH, K. DEORA, V. SANKHLA, P. MOGRA 

Study of Klebsiella pneumoniae isolates with ESBL activity, from ICU 

and Nurseries, on the island of Mauritius 

S.K. MUNGLOO-RUJUBALI, M.I. ISSACK, Y. JAUFEERALLY-FAKIM 

HIV-1 reverse transcriptase inhibition by Vitex negundo L. leaf extract 

and quantification of flavonoids in relation to anti-HIV activity 

M. KANNAN, P. RAJENDRAN, V. VEDHA, G. ASHOK, S. ANUSHKA, 

P. CHANDRAN RAMACHANDRAN NAIR 

Genetic characterization and bottleneck analysis of Korki Jonub 

Khorasan goats by microsatellite markers 

B. MAHMOUDI, O. ESTEGHAMAT, A. SHARIYAR. M.Sh. BABAYEV 

Low-Stringency Single-Specific-Primer PCR as a tool for detection of 

mutations in the matK gene of Phaseolus vulgaris exposed to 

paranitrophenol 

Mohamed R. ENAN 

Short Communication 

Characterization of Paenibacillus larvae isolates from Brazil 

S.S. CHAGAS, R.A. VAUCHER, A. BRANDELLI 

Guidelines for Authors 

1 

11 

21 

31 

39 

53 

61 

71 

79 

83

Front cover image: “Cell division” 

Shutterstock image ID: 4099351

Journal of Cell and Molecular Biology 10(2):1-10, 2012 Review Article 1 

Haliç University, Printed in Turkey. 

http://jcmb.halic.edu.tr 


Seema TRIVEDI* 

(* author for correspondence; svtrived@hotmail.com) 

Received: 2 January 2012; Accepted: 5 November 2012 

Abstract 

Transforming acidic coiled-coil proteins (TACC) are essential for mitosis not only by their association 

with the centrosome and assembly of spindle microtubules, but also by involvement in cell cycle 

checkpoints. In order to stabilize spindle fibers, TACCs interact with other microtubule-associated 

proteins (MAPs). Dysregulation of TACCs may lead to abnormal cell division that may result in 

chromosomal abnormality or tumorigenesis. This review focuses on facts known so far regarding 

TACC proteins, their interactions and their involvement in spindle microtubule stability in higher 

eukaryotes. 

Keywords: Cancer, microtubules, centrosome, spindle fibers, transforming acidic coiled-coil proteins 

Özet 

Dönüştürücü asidik sarmalanmış sarmal proteinleri ve iğ iplikçiğinin birleşmesi 

Dönüştürücü asidik sarmalanmış sarmal proteinleri (TACC) sadece sentrozomlarla ve iğ iplikçiği 

mikrotübülleriyle birleşmesiyle olan ilişkileri açısından değil, ayrıca hücre döngüsü kontrol 

noktalarına dahil olmaları açısından da mitoz için gereklidir. İğ iplikçiklerini stabilize etmek amacıyla, 

TACC’ler diğer mikrotübül ilişkili proteinlerle (MAP) etkileşime girer. TACC’lerin yanlış 

düzenlenmesi kromozomal anormallikler ya da tümörigenez ile sonuçlanan anormal hücre 

bölünmelerine neden olabilir. Bu derleme, bugüne kadar TACC proteinleri, etkileşimleri ve yüksek 

ökaryotlarda iğ iplikçiği kararlılığına katkıları ile ilgili bilinen gerçekler üzerinde durmaktadır. 

Anahtar Kelimeler: Kanser, Mikrotübüller, Sentrozom, İğ iplikçikleri, Dönüştürücü asidik 

sarmalanmış sarmal proteinleri 

Abbreviations 

TACC = Transforming Acidic Coiled-coil, MAP = Microtubule Associated Protein, Msps = Mini 

spindles, MT = Microtubule, ch-TOG = Colonic–hepatic Tumour-Overexpressed Gene, AAK = 

Aurora A Kinase 

Introduction 

Transforming acidic coiled-coil protein (TACC) is 

a family of the microtubule associated proteins 

(MAPs) that is crucial for spindle assembly, 

maintaining bipolarity and microtubule (MT) 

stability during mitosis (Still et al., 2004; Brittle 

and Ohkura, 2005; Pearson et al., 2005). TACCs 

are even important in acentrosomal (acentriolar or 

anastral) meiosis in females of many animal 

species where spindle formation is 

chromosome centric (Pearson et al., 2005). 

TACCs do not have microtubule 

stabilizing activity on their own. Instead, 

they form complexes with other MAPs to 

stabilize spindle fibers. TACC/MAP 

complex provides stable association of MTs 

with centrosomes at the minus end (Albee 

and Wiese, 2008) possibly after release from

2 Seema TRIVEDI 

the nucleation site from kinetochores (reviewed in 

Raff, 2002). The complex associates at the plus 

ends of the MTs growing out from the centrosome 

during nucleation (reviewed in Raff, 2002). 

However, the exact mechanism by which TACC 

interacts with other MAPs and recruits them to the 

centrosome is not clearly understood. In 

Drosophila, D-TACC recruits Mini spindles protein 

(Msps; a conserved family of MAP) (reviewed in 

Raff, 2002) and in Xenopus, maskin (TACC3) form 

a complex with XMAP215 (Albee and Wiese, 

2008). However, the XMAP215 complex may 

associate with both plus and minus ends of the MT. 

Similarly, human TACCs and ch-TOG (colonic– 

hepatic tumour-overexpressed gene) (homologue of 

Msps) possibly form a structural lattice at 

centrosomes to maintain the integrity of spindle 

poles and to stabilize spindle MTs (reviewed in 

Raff, 2002; Gergely et al., 2003). However, it is not 

known why in cultured human cells TACC3 and, in 

Drosophila D-TACC, these proteins are apparently 

not essential for recruitment of XMAP215 analogue 

(Brittle and Ohkura, 2005). This review focuses on 

genomic locations, protein characteristics and 

interactions of TACC proteins in humans and 

general aspects of role of TACC proteins in spindle 

dynamics in higher eukaryotes. 

TACC genes and proteins 

Three TACC proteins have been identified in 

humans, namely TACC1, 2 and 3. The three human 

TACCs are related by ~200-amino-acid C-terminal 

region (the ‘TACC domain’), which is predicted to 

form a coiled coil domain (reviewed in Raff, 2002). 

Besides TACC domain, these proteins share 

homology (except Drosophila D-TACC) in the 

SDP domain as well (Lauffart et al., 2002; Still et 

al., 2004). SDP domain is composed of functionally 

conserved repeats of 33 amino acids, though the 

numbers of repeats are different in different TACC 

proteins. Interaction of SDP domain with 

transcription factor GAS41/NuBI1 (also known as 

YEATS4) has been established (Lauffart et al., 

2002) but this interaction possibly does not directly 

affect spindle formation. 

Genomic locations of human TACC 

reference gene sequences as per NCBI and 

details of proteins obtained from SwissProt 

are given in Table 1. 

Though implicated in several cancers, no 

mutations have been reported in the TACC1 

gene (Still et al., 2008). TACC1 mRNA 

exon 3 contains a predicted nuclear 

localization signal (Still et al., 2008), shows 

ubiquitous expression and encodes a 

cytoplasmic protein which is mainly 

perinuclear protein (molecular mass of 125 

kDa) (Conte et al., 2002) but different 

isoforms in different cells may be localized 

in the cytoplasm as well (Lauffart et al., 

2006). 

TACC1 protein does not show 

compositional bias whereas TACC2 has 

poly-lysine and poly-proline rich regions 

and TACC3 has poly-serine regions (Table 

1). In addition, different sites in the TACC 

proteins show post translational covalent 

modifications (Table 2). Phosphotyrosine is 

seen only in TACC1, while N6-acetyl lysine 

is seen only in TACC3 and 

phosphothreonine is not seen in TACC1. It 

is also pertinent to note that TACC1 

phosphorylation varies in different isoforms 

(Still et al., 2008). 

TACC2 concentration at the centrosome 

has been observed even during interphase 

unlike TACC1 and TACC3 proteins 

(Gergley et al., 2000a). TACC3, also known 

as ERIC1 (Still et al., 2004; Eslinger et al., 

2009) a non-motor MAP, was also identified 

as an ARNT interacting protein (Aint1) in 

mice (Aitola et al., 2003) and is expressed in 

proliferative tissues (Aitola et al., 2003; 

reviewed in Hood and Royle, 2011). During 

mitosis, TACC3 is localized to centrosome 

but during interphase, TACC3 is seen in 

cytoplasmic or perinuclear regions (Piekorz 

et al., 2002). The TACC3 gene has five 

reported mutations: CAG to CGG, TCG to 

TTG, CGT to TGT, CAG to TAG and TCA 

to TTA (Eslinger et al., 2009).

TACC proteins in spindles 3 

Table 1. Human TACC Genomic Location (as per NCBI + ), Introns, mRNA And Splice Variants (as per NCBI AceView + ) 

and Protein Details (as per SwissProt * ). 

Official Symbol TACC1 TACC2 TACC3 

Genomic Location 8p11.22 10q26 4p16.3 

Genomic Sequence 

NC_000008.10 

38585704..38710546 

NC_000010.10 

123748689..124014057 

NC_000004.11 

1723266..1746898 

Number of Introns + 44 49 23 

mRNA + 38 (7 unspliced) 35 (7 unspliced) 16 (3 unspliced) 

Protein * 

TACC1 (O75410 

TACC1_HUMAN) 

TACC2 (O95359 

TACC2_HUMAN) 

TACC3 (Q9Y6A5 

TACC3_HUMAN) 

Length (number of amino acids) 805 2948 838 

Number of Isoforms + 27 26 15 

Features Description 

Coiled coil Potential 

Compositional 

bias 

Domain 

Motif 

Region 

TACC1 

610 - 805 

Position 

TACC2 TACC3 

2675 - 2703 637 - 837 

2746 - 2947 

Poly-Lys 2420 - 2423 

Poly-Ser 155 - 160 

Pro-rich 1956 - 2016 

482 - 549 

SPAZ 2315 - 2403 

SPAZ 1 215 - 297 

SPAZ 2 359 - 507 

Bipartite 

nuclear 

localization 

226 - 241 

signal 1 

Potential 

Bipartite 

nuclear 

localization 

455 - 471 

signal 2 

Potential 

Interaction 

with CH-TOG 

Interaction 

with LSM7 

and SNRPG 

Interaction 

with TDRD7 

Interaction 

with YEATS4 

701 - 805 

1 - 55 

152 - 259 

206 - 427 

+ Thierry-Mieg and Thierry-Mieg 2006, AceView-Dec 2009


Table 2. Modification types and positions of modifications in TACC proteins as per SwissProt.* 

Protein Position 

TACC1 

TACC2 

TACC3 

44 

50 

52 

54 

55 

57 

228 

276 

406 

533 

197 

201 

493 

571 

575 

758 

962 

1025 

1267 

1313 

1426 

1562 

1946 

1949 

2072 

2073 

2226 

2246 

2256 

2317 

2321 

2359 

2389 

2390 

2392 

2394 

2403 

2512 

2884 

N6-acetyl 

lysine 

Phosphoserine Phosphothreonine Phosphotyrosine 

25 

59 

71 

175 

317 

434 

558 

*Grey cells indicate presence and blank cells indicate absence or not known. 

Spindle assembly and TACC proteins 

TACC proteins interact with MTs (particularly at 

the minus end) and are mainly associated with 

centrosome (Gergely et al., 2000a and 2000b). The 

distribution and concentrations of TACC proteins 

during spindle formation vary. TACC1 

concentration at centrosome is weak and is seen 

only during mitosis. TACC2 concentration is strong 

at centrosome throughout the cell cycle. TACC3 is 

strongly concentrated in a more diffused region 

around 

centrosomes (during G2 phase) at the minus 

end of spindle MTs (Gergely et al., 2000a; 

Gergely et al., 2000b; Barr et al., 2010). 

Once the spindle has formed, TACC3 

protein is not found at astral MTs (reviewed 

in Raff, 2002; Hood and Royle, 2011). 

TACC3 protein is localized at centrosomes 

with γ-tubulin and spindle MTs with αtubulin 

(Piekorz et al., 2002, reviewed in 

(Raff, 2002; Hood and Royle, 2011), 

particularly during S, G2 and M phases of 

cell cycle (Piekorz et al., 2002). TACC3/ch-

TOG/clathrin complex increases the stability of Kfibers 

during early mitosis. This is achieved by 

reduction in MT catastrophe by anchoring to the 

spindle and establishing short bridges. Involvement 

of TACC proteins in formation of long bridges is 

not known but possibly HURP and the kinesinrelated 

protein HSET/KIFC1 may be involved in 

longer bridges (Booth et al., 2011). 

TACC3 depleted cells do not show proper 

metaphase alignment; therefore it is possible that 

TACC3 protein may be essential for chromosome 

alignment (Gregely et al., 2003). TACC3 may also 

affect early mitotic checkpoint by associating with 

pS939-TSC2 (tuberous sclerosis complex 2) and 

regulating its localization at spindle poles and also 

possibly affect nuclear envelope (Gomez-Baldo et 

al., 2010). TACC3 affects spindle checkpoint by 

affecting SAC (spindle assembly checkpoint 

assembly) by stabilizing spindle and is important 

for microtubule-kinetochore interaction. Depletion 

of TACC3 results in activation of the SAC (spindle 

assembly checkpoint protein), which prevents 

degradation of cyclin B1 and anaphase transition. 

Cyclin B1 is present in cells from late G2 to 

metaphase and is degraded prior to anaphase. 

TACC3 depletion increases the levels of cyclin B1 

but not cyclin A (S/G2) (Schneider et al., 2007), 

thus presence of TACC3 would affect degradation 

of cyclin B1 and help in anaphase transition. 

These observations indicate differences in roles 

of different types of TACC proteins during mitosis. 

For proper assembly and stability of spindle 

fibers and minus end of centrosome associate MT, 

phosphorylation of TACC is essential which is 

mediated by mitotic kinases (e.g. Aurora A kinase 

i.e. AAK) (Barros et al., 2005, Peset et al., 2005). 

Absence of phosphorylated TACC may result in 

either shorter centrosomal MT or absence of these 

spindle fibers (Peset et al., 2005, Kinoshita et al., 

2005). Phosphorylation occurs at different sites in 

different animals. In Xenopus TACC3/Maskin, at 

least two residues (main site is Ser626) are 

phosphorylated; in Drosophila D-TACC Ser863 is 

phosphorylated exclusively at centrosomes and in 

human Ser558 is phosphorylated in TACC3 

(reviewed in Raff, 2002; Brittle and Ohkura, 2005; 

LeRoy et al., 2007). Phosphorylation of TACCs 

may also help G2/M checkpoint by proper 

microtubule assembly, thus the control of mitosis 

by affecting G2/M transition (Conte et al., 2002; 

reviewed in Bettencourt-Dias and Glover, 2007), 


particularly via spindle checkpoint 

(Schneider et al., 2007). 

However, AAK itself must be activated 

prior to being able to phosphorylate the 

TACC proteins. In humans, AAK is 

activated by binding with TPX2 [Targeting 

Protein for Xklp2 (Xenopus plus enddirected 

kinesin-like protein)]. AAK-TPX2 

binding is activated by HURP (Human 

hepatoma up-regulated protein) which is a 

MAP protein that can also bind directly to 

MTs. However, HURP itself needs 

activation by Ran (RAs-related Nuclear 

protein) (Sato et al., 2009; Sato and Toda, 

2010). 

On the other hand, dephosphorylation of 

TACC proteins may also affect spindle 

stability. In this regard, Mars (a D. 

melanogaster sequence homologue of 

HURP) mediates spatially controlled 

dephosphorylation of TACC for spindle 

stability, perhaps only at the centrosome. 

Dephosphorylated TACC establishes lateral 

interactions with MT or with plus ends 

which may be impaired due to TACC 

phosphorylation at Ser863 (Tan et al., 

2008). 

Spindle fibers and proteins interacting 

with TACC proteins 

Minimal interactions of TACCs with other 

proteins or ligands were determined using 

the STRING web interface (Jensen et al., 

2009), and are shown in Figure1. As 

previously stated, TACC1 and TACC3 bind 

with ch-TOG (clathrin, colonic and hepatic 

tumor overexpressed gene) (Conte et al., 

2002; Lauffart et al., 2002); however, from 

the interaction shown in Figure 1 it appears 

that all three TACC proteins interact with 

CKAP5 (homologue XMAP215 or ch- 

TOG). The other two common interactions 

of the three TACC proteins are YEATS4 

(also called YAF9; GAS41; NUBI-1) 

(transcription factor, protein located in 

nucleoli) and LSM7 (a conserved subfamily 

of Sm-like small proteins). LSM7 associates 

with U6 snRNPs and plays a role in several 

aspects of mRNA processing (Conte et al., 

2002; Lauffart et al., 2002).


TACC1 may also be involved in gene regulation by 

affecting mRNA translation by interaction with 

TDRD7 (tudor domain containing 7) (Figure 1). 

TDRD7 protein is a part of cytoplasmic RNA 

granules involved in mRNA regulation. It is not 

known whether the involvement of TACCs in RNA 

processing or interaction with transcription factors 

has any role in MT dynamics during cell division. 

As per Figure 1, TACC1 and 3 also interact 

with AURKB and AURKA. These two proteins 

also interact with Cyclin B1 (which controls entry 

in mitosis) (Conte et al., 2002). Studies have shown 

that TACC3 is involved in localization of the 

mitotic kinase Aurora B and the checkpoint protein 

BubR1 at kinetochores thus affecting MT 

attachment (Schneider et al., 2007). 

TACC2 protein also directly interacts with 

SMYD2 (SET- and MYND-containing protein 2) 

(Figure 1). SMYD2 activates TACC2 gene by 

methylation of H3K4 in the promoter region of 

TACC2 gene besides the involvement of SMYD2 

in some protein-protein interactions. These protein 

interactions may have roles in centrosomal MT 

formation (Abu-Farha et al., 2008) but apparently 

not by directly interacting with TACC2 protein. 

Phosphorylated TACC3 also directly interacts 

with clathrin heavy chain (CLTC) that promotes 

accumulation of other complex members at the 

mitotic spindle (reviewed in Hood and Royle, 

2011). Another direct interaction of TACC3 protein 

with septin-7 (SEPT7, CDC10 protein homolog) is 

shown in Figure 1. SEPT7 associates with the 

mitotic spindle and the kinetochore. It has also been 

shown that SEPT7 is needed for stable localization 

of CENP-E (centromere-associated protein E) at 

kinetochore besides affecting spindle checkpoint 

(Zhu et al., 2008). Association of SEPT7 and 

MAPs, particularly MAP4, in MT dynamics both 

during interphase and mitosis has been established 

(Silverman-Gavrila et al., 2008), and it is possible 

that similar interaction of SEPT7 with TACC 

proteins may affect MT stability. 

Expression of TACC3 is high in hematopoietic 

tissue unlike TACC1 and TACC2. Apparently 

higher levels of TACC3 proteins are not for 

proliferation of tissue but for direct or indirect 

regulation of p53 levels to prevent apoptosis 

although not true for other tissue (Piekorz et al., 

2002). Other study confirmed direct interaction of 

TACC3 with p53 (that is also concentrated at 

centrosomes) possibly to keep it inactive during 

mitosis (reviewed in Raff, 2002) (not seen in 

Figure 1). 

TACC3 is necessary for proper 

localization of phosphorylated TSC2 

(Tuberous sclerosis proteins, tuberin) to the 

mitotic apparatus and cytokinetic structures. 

This interaction may be through the TSC2- 

HBD domain (TSC2 hamartin-binding 

domain) and result in promotion of 

cytoskeletal remodeling (Gómez-Baldó et 

al., 2010). 

Though little is known about the factors 

that control or regulate length of spindle 

fibers, TACC3 may be one of the proteins 

that control length of MTs and time for 

chromosome alignment at metaphase plate 

(reviewed in Raff, 2002). AAK may also 

regulate MT length, as seen in Drosophila 

embryos, where AAK function disturbance 

leads to abnormal shortening of centrosomal 

MTs. This disturbance also leads to 

inefficient concentration of D-TACC at 

centrosomes (reviewed in Raff, 2002). 

TACCs dysregulation and cancer 

Human TACC 1, 2 and 3 are present in 

genomic regions that are rearranged in 

certain cancer cells (reviewed in Raff, 2002; 

Stewart et al., 2004; Still et al., 1999). 

Aberrations of TACC genes (TACC3 in 

particular) contribute to 

tumorigenesis/cancer (reviewed in Raff, 

2002; Lauffart et al., 2005). 

Since TACC proteins are also involved 

in centrosomal dynamics, cell cycle 

checkpoints (Schneider et al., 2007) and can 

form multiple complexes, any dysregulation 

in these proteins may be important during 

tumorigenesis (Lauffart et al., 2002). It has 

been noted that increase or decrease in 

levels of the TACCs can lead to impairment 

of spindle functions (reviewed in Raff, 

2002). Disruption of spindle function can 

then lead to misalignment of chromosomes 

and or abnormalities in chromosome 

separation. Altered levels of TACC proteins 

can lead to abnormal mitosis although next 

p53 dependent checkpoint should eliminate 

such cells. However, if there is simultaneous 

alteration in TACC levels and p53 is either 

absent or depleted, then such cells would not


Figure 1. Predicted functional partnes (minimum interaction) of the three TACC proteins (as per 

STRING Jensen et al., 1999) 

undergo elimination, resulting in genetic instability 

that could contribute to the development of cancer 

(reviewed in Raff, 2002). 

Some studies show that TACC3 may enhance 

stability of tumors. This can be achieved by 

TACC3 and ch-TOG in clustering of multipolar 

spindles in tumor cells into two poles that may lead 

to somewhat ‘normal’ division (reviewed in Hood 

and Royle, 2011). However, TACC2 may be a 

potential tumour suppressor (reviewed in Raff, 

2002) contrary to studies that suggest no role of 

TACC2 in tumor suppression (Schuendeln et al., 

2004). 

Unanswered questions 

Though much is known regarding TACC function 

in spindle and microtubule dynamics, there are few 

aspects that still remain unknown. These are 

summarized below: 

Roles of TACCs in regulation/control of 

spindle fiber lengths are not fully 

understood. Though the levels of TACC and 

particularly roles of TACC3 and AAK are 

indicated in control of MT length (reviewed 

in Raff, 2002), the precise mechanism by 

which this is achieved is not known. 

Though TACC proteins are present in 

cytoplasm during interphase, their fate at the 

end of mitosis is not known with respect to 

their redistribution to cytoplasm of the 

daughter cells. If there is 

exclusion/reduction in amount of TACC 

proteins from nucleoplasm, the mechanism 

remains elusive. Further, it is not known 

whether destruction/recycling/decrease in


expression of all TACCs (like cyclins) is important 

for ending anaphase. 

It is known that TACC3 associates with 

kinetochore MTs (K fibers), but association with 

interpolar MTs (reviewed in Hood and Royle, 

2011) or astral MTs is not confirmed. It is also not 

known whether all three TACCs associate with 

kinetochore MTs (K fibers), interpolar MTs and 

astral MTs or there are different TACC for each 

fiber type. 

If different TACCs are involved in K-fibers, 

interpolar and astral MTs; it is not known how this 

association difference is achieved. 

Different interaction partners at different 

subcellular locations of each splice variant of 

TACC1 protein have been reported during different 

stages of embryonic development. This may be 

possible due to retention of coiled coil domain in 

each splice variant but there are differences in 

interaction motifs at N-terminus (Lauffart et al., 

2006). However, it is not known whether different 

isoforms of TACC proteins have different roles in 

spindle assembly during mitosis. 

Conclusion 

It is known that TACCs are important in 

maintaining bipolarity and stability of spindle fibers 

through their association with other 

binding/interacting partners. TACCs also play a 

role in cell cycle checkpoints due to their 

association with centrosomes and p53. However, 

there are many unresolved functional and structural 

aspects of the three TACC proteins. Further 

advancement in studies with respect to the unsolved 

facets of these proteins may help in enhancing basic 

understanding of spindle MT dynamics and related 

disorders. 

Acknowledgements 

I am extremely indebted to Prof. S. D. Kapoor, 

former Head, Department of English, JN Vyas 

University, Jodhpur (Raj.) and Emeritus Fellow of 

UGC (University Grants Commission) of India, for 

correcting the language and expression in the 

manuscript. 

References 

Aitola M, Sadek CM, Gustafsson JA, Pelto-Huikko 

M. Aint/Tacc3 is highly expressed in 

proliferating mouse tissues during development, 

spermatogenesis, and oogenesis. J 

Histochem Cytochem. 51(4): 455-69, 

2003. 

Albee AJ, Wiese C. Xenopus 

TACC3/maskin is not required for 

microtubule stability but is required for 

anchoring microtubules at the 

centrosome. Mol Biol Cell. 19(8): 3347- 

56, 2008. 

Barr AR, Kilmartin JV, Gergely F. 

CDK5RAP2 functions in centrosome to 

spindle pole attachment and DNA 

damage response. J Cell Biol. 189(1): 

23–39, 2010. 

Barros TP, Kinoshita K, Hyman AA, Raff 

JW. Aurora A activates D-TACC-Msps 

complexes exclusively at centrosomes to 

stabilize centrosomal microtubules. J 

Cell Biol. 170(7): 1039-46, 2005. 

Bettencourt-Dias M and Glover DM. 

Centrosome biogenesis and function: 

centrosomics brings new understanding. 

Nat Rev Mol Cell Bio. 8(6):451-63, 

2007. 

Booth DG, Hood FE, Prior IA, Royle SJ. A 

TACC3/ch-TOG/clathrin complex 

stabilises kinetochore fibers by intermicrotubule 

bridging. EMBO J. 30(5): 

906-19, 2011. 

Brittle AL, Ohkura H. Centrosome 

maturation: Aurora lights the way to the 

poles. Curr Biol. 15(21): R880-2, 2005. 

Conte N, Charafe-Jauffret E, Delaval B, 

Adélaïde J, Ginestier C, Geneix J, 

Isnardon D, Jacquemier J, Birnbaum D. 

Carcinogenesis and translational 

controls: TACC1 is down-regulated in 

human cancers and associates with 

mRNA regulators. Oncogene. 21(36): 

5619-30, 2002. 

Eslinger MR, Lauffart B, Still IH. 2009. 

TACC3 (transforming, acidic coiled-coil 

containing protein 3). Atlas Genet 

Cytogenet Oncol Haematol. Retrieved 

December 25, 2011 from 

http://AtlasGeneticsOncology.org/Genes 

/TACC3ID42458ch4p16.html

Gergely F, Draviam VM, Raff JW. The ch- 

TOG/XMAP215 protein is essential for spindle 

pole organization in human somatic cells. Genes 

Dev. 17(3): 336-41, 2003. 

Gergely F, Karlsson C, Still I, Cowell J, Kilmartin 

J, Raff JW. The TACC domain identifies a 

family of centrosomal proteins that can interact 

with microtubules. Proc Natl Acad Sci USA. 

97(26): 14352-7, 2000a. 

Gergely F, Kidd D, Jeffers K, Wakefield JG, Raff 

JW. D-TACC: a novel centrosomal protein 

required for normal spindle function in the early 

Drosophila embryo. EMBO J. 19(2): 241-52, 

2000b. 

Gómez-Baldó L, Schmidt S, Maxwell CA, Bonifaci 

N, Gabaldón T, Vidalain PO, Senapedis W, 

Kletke A, Rosing M, Barnekow A, Rottapel R, 

Capellá G, Vidal M, Astrinidis A, Piekorz RP, 

Pujana MA. TACC3-TSC2 maintains nuclear 

envelope structure and controls cell division. 

Cell Cycle. 9(6): 1143-55, 2010. 

Hood FE, Royle SJ. Pulling it together: The mitotic 

function of TACC3. Bioarchitecture. 1(3):105- 

109, 2011. 

Jensen LJ, Kuhn M, Stark M, Chaffron S, Creevey 

C, Muller J, Doerks T, Julien P, Roth A, 

Simonovic M, Bork P, von Mering C. STRING 

8--a global view on proteins and their functional 

interactions in 630 organisms. Nucleic Acids 

Res. 37(Database issue): D412-6, 2009. 

Lauffart B, Dimatteo A, Vaughan MM, Cincotta 

MA, Black JD, Still IH. Temporal and spatial 

expression of TACC1 in the mouse and human. 

Dev Dyn. 235(6):1638-47, 2006. 

Lauffart B, Sondarva GV, Gangisetty O, Cincotta 

M, Still IH. Interaction of TACC proteins with 

the FHL family: implications for ERK 

signaling. J Cell Commun Signal. 1(1):5-15, 

2007. 

Lauffart B, Vaughan MM, Eddy R, Chervinsky D, 

DiCioccio RA, Black JD, Still IH. Aberrations 

of TACC1 and TACC3 are associated with 

ovarian cancer. BMC Womens Health. 5: 8, 

2005. 

LeRoy PJ, Hunter JJ, Hoar KM, Burke KE, Shinde 

V, Ruan J, Bowman D, Galvin K, Ecsedy JA. 

Localization of human TACC3 to mitotic 


spindles is mediated by phosphorylation 

on Ser558 by Aurora A: a novel 

pharmacodynamic method for measuring 

Aurora A activity. Cancer Res. 67(11): 

5362-70, 2007. 

Pearson NJ, Cullen CF, Dzhindzhev NS, 

Ohkura H. A pre-anaphase role for a 

Cks/Suc1 in acentrosomal spindle 

formation of Drosophila female meiosis. 

EMBO Rep. 6(11): 1058-63, 2005. 

Peset I, Seiler J, Sardon T, Bejarano LA, 

Rybina S, Vernos I. Function and 

regulation of Maskin, a TACC family 

protein, in microtubule growth during 

mitosis. J Cell Biol. 170(7):1057-66, 

2005 

Piekorz RP, Hoffmeyer A, Duntsch CD, 

McKay C, Nakajima H, Sexl V, Snyder 

L, Rehg J, Ihle JN. The centrosomal 

protein TACC3 is essential for 

hematopoietic stem cell function and 

genetically interfaces with p53-regulated 

apoptosis. EMBO J. 21(4): 653-64, 2002. 

Raff JW. Centrosomes and cancer: lessons 

from a TACC. Trends Cell Biol. 12(5): 

222-5, 2002. 

Sato M, Okada N, Kakui Y, Yamamoto M, 

Yoshida M, Toda T. Nucleocytoplasmic 

transport of Alp7/TACC organizes 

spatiotemporal microtubule formation in 

fission yeast. EMBO Rep. 10(10): 1161- 

7, 2009. 

Sato M, Toda T. Space shuttling in the cell: 

Nucleocytoplasmic transport and 

microtubule organization during the cell 

cycle. Nucleus. 1(3): 231-6, 2010. 

Schneider L, Essmann F, Kletke A, Rio P, 

Hanenberg H, Wetzel W, Schulze- 

Osthoff K, Nürnberg B, Piekorz RP. The 

transforming acidic coiled coil 3 protein 

is essential for spindle-dependent 

chromosome alignment and mitotic 

survival. J Biol Chem. 282(40): 29273- 

83, 2007. 

Schuendeln MM, Piekorz RP, Wichmann C, 

Lee Y, McKinnon PJ, Boyd K, 

Takahashi Y, Ihle JN. The centrosomal,

10 Seema TRIVEDI 

putative tumor suppressor protein TACC2 is 

dispensable for normal development, and 

deficiency does not lead to cancer. Mol Cell 

Biol. 24(14):6403-9, 2004. 

Silverman-Gavrila RV, Silverman-Gavrila LB. 

Septins: new microtubule interacting partners. 

Scientific World Journal. 8:611-20, 2008. 

Stewart JP, Thompson A, Santra M, Barlogie B, 

Lappin TR, Shaughnessy J Jr: Correlation of 

TACC3, FGFR3, MMSET and p21 expression 

with the t(4;14)(p16.3;q32) in multiple 

myeloma. British J Haematology. 126(1): 72- 

76, 2004. 

Still I, Eslinger MR, Lauffart B. TACC1 

(transforming, acidic coiled-coil containing 

protein 1). Atlas Genet Cytogenet Oncol 

Haematol. December 2008. Retrieved 

December 25, 2011 URL: 

http://AtlasGeneticsOncology.org/Genes/TACC 

1ID42456ch8p11.html 

Still IH, Hamilton M, Vince P, Wolfman A, Cowell 

JK. Cloning of TACC1, an embryonically 

expressed potentially transforming coiled coil 

containing gene from the 8p11 breast cancer 

amplicon. Oncogene. 18(27): 4032-4038, 1999. 

Still IH, Vettaikkorumakankauv AK, 

DiMatteo A, Liang P. Structure-function 

evolution of the transforming acidic 

coiled coil genes revealed by analysis of 

phylogenetically diverse organisms. 

BMC Evol Biol. 4: 16, 2004. 

Tan S, Lyulcheva E, Dean J, Bennett D. 

Mars promotes dTACC 

dephosphorylation on mitotic spindles to 

ensure spindle stability. J Cell Biol. 

182(1): 27-33, 2008. 

Thierry-Mieg D, Thierry-Mieg J. AceView: 

a comprehensive cDNA-supported gene 

and transcripts annotation, Genome Biol, 

7(Suppl 1):S12, 2006. 

Zhu M, Wang F, Yan F, Yao PY, Du J, Gao 

X, Wang X, Wu Q, Ward T, Li J, Kioko 

S, Hu R, Xie W, Ding X, Yao X. Septin 

7 interacts with centromere-associated 

protein E and is required for its 

kinetochore localization. J Biol Chem. 

283(27):18916-25, 2008.

Journal of Cell and Molecular Biology 10(2):11-19, 2012 Review Article 11 



Markör Sistemleri ve Genetik Karakterizasyon Çalışmalarında 

Kullanımları 

Marker Systems and Applications in Genetic Characterization 

Studies 

Yusuf ÖZŞENSOY* 1,2 , Ercan KURAR 2 

1 Bitlis Eren Üniversitesi Sağlık Yüksekokulu, 13000, Bitlis 

2 Selçuk Üniversitesi Veteriner Fakültesi Genetik Anabilim Dalı, 42031, Konya 

(* author for correspondence; yusufozsensoy@yahoo.com) 

Received: 18 September 2012; Accepted: 20 December 2012 

Abstract 

Nowadays, owing to the developments in molecular biology, genetic markers are generally used to 

describe specific regions of the genome. Three different marker systems, namely, protein and DNA 

markers, are used in genome analyses and in various genetic studies. Following the discovery of 

polymerase chain reaction (PCR), PCR-based marker systems are widely preferred in genetic studies. 

Genetic characterization studies are critically important to determine the level of genetic diversity 

between and within populations, origin of domestication and migration and development of 

conservation programs. Different biochemical marker systems, alloenzymes, mitochondrial DNA and 

Y chromosome are used for genetic characterization studies. DNA markers, especially the 

polymorphic microsatellite markers, are the most preferable marker systems in PCR applications. 

Recent progresses in molecular biology techniques allow rapid and economical identification of single 

nucleotide polymorphisms analyses and their applications along with microsatellites. 

Keywords: Genetic Characterization; Marker systems, Microsatellite, SNP, RFLP 

Özet 

Moleküler biyoloji alanındaki gelişmeler sonucunda günümüzde markörler genel olarak genomun 

özgün bir bölgesini tanımlamak amacıyla kullanılmaktadır. Genom analizleri ve genetik çalışmalarda 

morfolojik, protein ve DNA markörleri olmak üzere üç tip markör kullanılmaktadır. Polimeraz zincir 

reaksiyonunun (PZR) keşfinden sonra genetik çalışmalarda PZR-temelli markörler daha fazla tercih 

edilmeye başlanmıştır. Genetik karakterizasyon çalışmaları, popülasyon içi ve popülasyonlar arası 

genetik çeşitlilik seviyesinin belirlenmesi, koruma programlarının geliştirilmesi, evcilleştirilme ve göç 

yollarının tespiti gibi çalışmalar için oldukça önemlidir. Genetik karakterizasyon çalışmalarında farklı 

biyokimyasal markör sistemleri, alloenzimler, mitokondriyal DNA ve Y kromozomuna özgün 

markörler kullanılmaktadır. DNA markörleri, özellikle polimorfik mikrosatellit markörleri, PZR 

uygulamalarında en çok tercih edilen markör sistemini oluşturmaktadır. Son zamanlarda geliştirilen 

yeni moleküler biyoloji teknikleri tek nükleotid polimorfizmleri analizinin daha hızlı ve ekonomik 

olarak yapılabilmesine ve mikrosatellitler ile birlikte kullanılmasına olanak sağlamaktadır. 

Anahtar Kelimeler: Genetik karakterizasyon, Markör Sistemleri, Mikrosatellit, SNP, RFLP 

GİRİŞ 

Genomun özgün bir bölgesini tanımlamak amacıyla 

birçok markör sistemi kullanılmaktadır. Genom 

analizleri ve genetik çalışmalar başta olmak 

üzere moleküler çalışmalarda morfolojik,

12 Yusuf ÖZŞENSOY ve Ercan KURAR 

protein ve DNA markörleri olmak üzere 3 tip 

markör kullanılmaktadır (Liu, 1998). 

Morfolojik Markörler 

Çok sayıdaki morfolojik markör insan, hayvan ve 

bitki genetik çalışmalarında kullanılmaktadır. 

Genler ve kromozomlar hakkındaki bilgi 

eksikliğinden dolayı ilk çalışmalar, göz rengi, kanat 

yapısı, boynuzluluk, deri rengi gibi basit Mendel 

kalıtımı gösteren özellikler üzerinde yapılmıştır. Bu 

gibi morfolojik karakterler, özgün genler için 

güvenilir indikatörler olarak kullanılabilirler ve bu 

özellikleri kodlayan genlerin kromozom üzerinde 

yerlerinin tanımlanmasında faydalı olmaktadırlar. 

Morfolojik markörlerin gözlenmesi kolay olmasına 

rağmen alel sayılarının nispeten az olmasından 

dolayı kullanımı kısıtlı kalmaktadır (Liu, 1998). 

Protein Markörleri 

Amino asit bileşimi, moleküler ağırlıkları ve 

antikor-antijen ilişkilerindeki farklılıklar nedeniyle 

proteinler için farklı aleller bulunabilmektedir. 

Moleküler büyüklük ve amino asit bileşimi 

farklılıklardan dolayı proteinler, jel elektroforez 

yöntemi kullanılarak kolaylıkla ortaya çıkarılabilir 

ve genetik markör olarak kullanılabilirler. Genetik 

çalışmalarda ilk zamanlarda protein 

polimorfizmlerinin araştırılması amacıyla kan 

antijenleri ve izoenzim markörleri yaygın olarak 

kullanılmıştır. İzoenzimler, bir enzimin alternatif 

bir formudur ve aynı enzim aktivitesine sahip 

olmalarına rağmen elektroforetik hareketleri 

farklılık göstermektedir (Liu, 1998). Genetik 

çalışmalarda kan ve doku proteinleri markör olarak 

yaygın bir şekilde kullanılmaktadır. Fakat özellikle 

kan grubu ve protein markör sistemlerinin genomun 

bazı bölgelerinde toplanmış bulunmaları, 

polimorfizm değerlerinin nispeten düşük olması, 

özgün olarak kan örneklerine gereksinim 

duyulması, iş yükünün ağır olması ve analizlerin 

uzun zaman alması nedeniyle ve moleküler 

biyolojideki gelişmelere bağlı olarak yerini DNA 

temelli markörlere bırakmıştır (Kurar, 2001). 

DNA Temelli Markörler 

DNA markörleri, bir tür içerisindeki farklı 

bireylerde dizi polimorfizmi gösteren DNA 

bölgeleridir ve varyasyonun belirlenmesinde 

günümüzde en sık kullanılan yöntemdir (Liu, 

1998). Polimeraz Zincir Reaksiyonunun (PZR) 

keşfinden sonra genetik çalışmalarda PZR temelli 

markörler daha çok tercih edilmeye 

başlanmıştır. Karry Mullis tarafından 1985 

yılında ilk kez ortaya konulan bu teknoloji 

sayesinde genomun özgün bölgelerinin in 

vitro şartlarda çoğaltılabilmesi ve 

elektroforez teknikleri ile görüntülenmesi 

mümkün hale gelmiştir. DNA teknolojisi ve 

moleküler biyolojideki hızlı gelişmeye 

paralel olarak daha ekonomik, kolay ve 

polimorfik olmalarından dolayı özellikle 

PZR temelli DNA markör sistemleri (RFLP, 

RAPD, EST, STS, SSCP, AFLP, STR ve 

SNP) genetik çalışmalarda daha yaygın 

olarak kullanılmaya başlanmıştır (Weber 

and May, 1989; Liu, 1998). 

Restriksiyon parça uzunluk 

polimorfizmleri 

Restriksiyon endonükleaz (RE) enzim 

kesimleri ile oluşturulan farklı DNA parça 

uzunlukları restriksiyon parça uzunluk 

polimorfizmleri (RFLP-“Restriction 

fragment length polymorphism”) olarak 

adlandırılmaktadır. RE’leri, DNA 

diziliminde belirli sırayla bulunan 

nükleotidlerden kendisine özgü özel tanıma 

dizilimi bölgelerini tanıyarak bu dizilimin 

belli bir noktasından keserek DNA’yı ikiye 

ayırmaktadır. Her bir RE’nin kendisine özel 

kesim bölgeleri bulunmaktadır. 

RFLP teknolojisi ile DNA dizisinde 

bulunan dizilim farklılıkları kolayca tespit 

edilebilmektedir. RFLP’lerin 

belirlenmesinde DNA öncelikle bir RE 

enzimi ile kesilerek DNA parçacıkları 

agaroz jel elektroforezinde ayrıştırılır. DNA 

dizilim farklılıklarına göre genom 

bölgesinde farklı RE kesim alanları ve 

dolayısıyla bireyler arasında farklı DNA 

fragman profilleri oluşacaktır. Alkali jelde 

denatüre olmuş DNA fragmanları Southern 

blot yöntemi ile nitroselüloz kâğıdı üzerine 

alınır. Radyoaktif işaretli bir DNA probu 

kullanılarak özgün DNA fragmanları ve 

profili tespit edilebilir (Botstein et al., 

1980). 

RFLP markörlerin en önemli avantajı 

özgün dizi bilgisine ihtiyaç bulunmamasıdır. 

RFLP yöntemi, türler, cinsler hatta büyük 

popülasyonların analizinde 

kullanılabilmektedir. Polimorfizm oranı çok

yüksek olmasından dolayı aile ağacı ve haritalama 

analizlerinde tercih edilen markör sistemi olmuştur. 

RFLP markör sisteminin dezavantajları ise; analizin 

yapılabilmesi için yeterli miktarda DNA’ya ihtiyaç 

duyulması ile birlikte teknolojik olarak pahalı, uzun 

ve yorucu bir yöntem olmasıdır (Botstein et al., 

1980). 

Tek zincir konformasyon polimorfizmleri 

Tek zincir konformasyon polimorfizmi (SSCP- 

“Single-strand conformational polymorphism”) 

markörleri, bir DNA dizilim bölgesindeki (1000 

baz çiftinden daha kısa) dizi varyantları ve 

mutasyonları (özellikle nokta mutasyonları) 

belirlemede kullanılan bir markör sistemidir (Orita 

et al., 1989). PZR ile çoğaltılan bir genom bölgesi, 

uygun ısıda denatürasyona tabi tutularak mutasyon 

bölgesinde II. ve III. DNA konformasyonlarının 

oluşturulması esasına dayanmaktadır. Varyasyona 

bağlı olarak oluşan II. ve III. konformasyondaki 

DNA molekülleri jel elektroforezinde farklı bant 

profilleri oluşturarak varyantların tespitine olanak 

sağlamaktadır. Teknoloji olarak basit olmasına 

rağmen, her bir mutasyon için farklı ortamların 

oluşturulması gerekliliği, bu tekniğin uygulamasını 

kısıtlayan en önemli etkendir (Liu, 1998). 

Rastgele çoğaltılmış polimorfik DNA 

Rastgele çoğaltılmış polimorfik DNA (RAPD- 

“Randomly amplified polymorphic DNA”) 

markörleri, PZR tabanlı olup ilk kez Williams et 

al., (1990) tarafından geliştirilmiştir. Rastgele 

nükleotid dizilimine sahip olan tek bir primerin 

kullanılmasıyla DNA parçaları çoğaltılmakta ve 

oluşan farklı bant profiline göre DNA polimorfizmi 

tespit edilebilmektedir. Bu markör kullanılarak 

yapılan çalışmalarda, aynı lokustaki iki farklı alel 

belirli büyüklükteki bantların varlığıyla ya da 

yokluğuyla ayırt edilebilmektedir (Liu, 1998). 

RAPD markörlerinin avantajları, DNA dizi 

bilgisine ihtiyacın olmaması, diğer markörlere göre 

ucuz ve daha az miktarda DNA ile kısa sürede 

sonuçlar alınabilmesi olması rağmen en önemli 

dezavantajı diğer markörlere göre özelliklede 

RFLP’ye göre güvenilirliğinin düşük olmasıdır. 

Bundan dolayı genellikle RFLP ile birlikte 

değerlendirmeye alınırlar (Williams et al., 1990). 

Çoğaltılmış parça uzunluk polimorfizmi 

Çoğaltılmış parça uzunluk polimorfizmi (AFLP- 

“Amplified fragment length polymorphism”) 

Markör Sistemleri 13 

tekniği, RE enzimleri ile kesilmiş genomik 

DNA parçalarının seçici PZR ile 

çoğaltılması temeline dayanmaktadır. Bu 

teknik, DNA’nın enzimlerle kesilmesi ve 

oligonükleotid adaptörlerin bağlanması, 

kesilen bölgelerin seçici PZR yöntemiyle 

çoğaltılması ve çoğalan bölgenin 

poliakrilamid jelde analiz edilmesi olmak 

üzere 3 temel aşamadan meydana 

gelmektedir. RE ile kesilen parça bölgeleri 

nükleotid dizilimi bilinmeden jel 

elektroforez yöntemi ile 

görüntülenebilmektedir. Parmak izi 

analizlerinde ağırlıklı olarak kullanılan 

AFLP markör sistemi, RFLP markörüne 

benzer özelliklere sahip olmakla birlikte 

RFLP’ye göre analizi daha kolaydır ve daha 

az miktarda DNA’ya gereksinim 

duymaktadır (Vos et al., 1995). 

Tek nükleotid polimorfizmleri 

Tek nükleotid polimorfizmleri (SNP-“Single 

nucleotide polymorphism”) genomun 

herhangi bir bölgesindeki tek nükleotid 

dizilim farklılıklarıdır. Genomda oldukça 

yaygın bulunan bu markörlere intron ve 

ekzon bölgelerinde, 500–1000 bç sıklıkta 

rastlanılabilir (Wang et al., 1998). 

Genellikle iki alele sahip olan SNP 

markörlerinin polimorfizmleri daha düşük 

kalmakta, veri tabanı katalog bilgisine ve 

polimorfizm dizi bilgisine ihtiyaç 

duyulmaktadır (Smigielski et al., 2000). 

SNP’ler araştırmacıların ihtiyaçlarına göre 

çalışmaları kolaylaştırmak için dizi konumu, 

fonksiyonu, türler arası homoloji ve 

heterozigotluk derecesi olmak üzere 4 büyük 

bilgi ekseni tek veya daha fazlası bir arada 

olmak üzere düzenlenebilmektedir 

(Smigielski et al., 2000). Genomda bilinen 

1.42 milyon SNP’nin her 1.91 Kbç başına 1 

SNP yoğunlukta bulunduğu bilinmekle 

birlikte ekson gen bölgelerinde 60 000 SNP 

bulunduğu ve eksonun %85’inin SNP’nin 5 

Kbç yakınında yer aldığı belirlenmiştir (The 

International SNP Map Working Group, 

2001). SNP bilgilerine ulaşmak için; 

GenBank, PubMed, LocusLink ve Genome 

Sequence gibi kaynak bilgiler ile NCBI veri 

tabanındaki bilgiler kullanılmaktadır 

(Smigielski et al., 2000). Geliştirilen yeni


moleküler biyoloji teknikleri (mikrodizin, gerçek 

zamanlı PCR) ile çok sayıda SNP’nin analizi daha 

hızlı ve ekonomik olarak yapılabilmektedir. 

SNP’ler genetik çeşitlilik, popülasyon yapısı, 

kantitatif özellik lokusları (QTL), markör destekli 

seleksiyon (MAS) çalışmalarında ve ailesel 

ilişkilerin araştırılmasında yaygın kullanılmaktadır. 

Mitokondriyal DNA 

Maternal kalıtım gösteren mitokondrial DNA 

(mtDNA), çift zincirli, halkasal yapıda ve aerobik 

solunumu destekleyen genleri içermektedir. 

mtDNA toplam genetik materyalin %0.3’ünü 

oluşturmaktadır (Rokas et al., 2003; Başaran, 

2004). Tipik bir somatik hücre 500-1000 

mitokondri içermektedir (Rokas et al., 2003). 

mtDNA’da gözlenen mutasyon oranı nükleer 

DNA’ya (nDNA) göre daha hızlıdır. Bu durumun 

sebebi olarak, mtDNA’da meydana gelen 

mutasyonların nDNA’da meydana gelen 

mutasyonlardan yaklaşık 10–20 kat daha fazla 

olması ve mtDNA’nın tamir mekanizmasının 

bulunmaması olduğu gösterilmektedir. Sonuçta 

oluşan mutasyon oranı, mtDNA’nın baz diziliminde 

çok farklı varyasyonların oluşmasına yol 

açmaktadır (Başaran, 2004). mtDNA, canlıların 

orjinleri, göç haritalarının çıkarılması, adli tıp, 

dejeneratif hastalıkların sebebinin araştırılmasında 

ve kanser çalışmalarında kullanılmaktadır. mtDNA, 

rekombinasyon eksikliğinin tespiti ve genetik 

olarak klonlanan canlıların kalıtımının tespit 

edilmesinde yaygın kullanılmaktadır (Rokas et al., 

2003). mtDNA’nın kodlanan bölgesindeki 

varyasyonun iyi anlaşılması popülasyonların 

genetik sonucunun (filogenetik geçmişinin) 

belirlenmesinde yararlı olacaktır (Finnilä et al., 

2001). 

Mikrosatellitler 

Genomda bir lokusta arka arkaya gelen rastgele 

tekrar dizilerine kısa ardışık tekrarlar (STR-“Short 

Tandem Repeat”) denilmektedir. STR’lerin 1–6 bç 

tekrarlarından oluşmuş markörlere mikrosatellit 

markörler veya basit dizi tekrarları (SSR-“Simple 

Sequence Repeat”) olarak isimlendirilmektedir 

(Weber and May, 1989; Liu, 1998). Genomda 9– 

100 bç arasında değişen rastgele dizi tekrarları ise 

minisatellit markörler veya değişken ardışık 

nükleotid tekrarlar (VNTR-“Variable Number of 

Tandem Repeats) olarak tanımlanmaktadır. 

Mikrosatellitlerin tekrar sayısı genelde 100’den, 

minisatellitlerin tekrar sayısı ise 1000’den 

daha azdır (Liu, 1998). Mikrosatellitler 

prokaryot ve ökaryot genomun herhangi bir 

bölgesinde bulunabilmektedir. 

Prokaryotlarda birçok biyolojik fonksiyona 

sahip olduğu halde ökaryot hücrelerde rolü 

tam olarak bilinmemektedir (Bennett, 2000). 

Mikrosatellit markörler, yaygın olarak 2 

nükleotidli tekrarlardan [(CA)n] oluşmakla 

birlikte farklı formlarda da (AC, AT, AAC, 

AAT, CCG vb) bulunabilmektedir (Ellegren 

et al., 1997; Orti et al., 1997; Bruford et al., 

2003). 

STR markörleri, PZR teknolojisinin 

yardımıyla genetik çalışmalarda en çok 

tercih edilen markör sistemini 

oluşturmaktadır (Weber and May, 1989; 

Liu, 1998). Mikrosatellitlerde tekrar 

bölgelerini kuşatan DNA dizileri bir türün 

bireylerinde aynı olmasına rağmen tekrar 

dizilim sayıları bireyler hatta bireyin 

homolog kromozomları arasında dahi 

farklılık gösterebilmektedir. Üç nükleotid 

tekrarlı mikrosatellit bölgelerinin %60 

oranında polimorfik olduğu, 2 bç tekrarlı 

mikrosatellitlerin ise %100 polimorfik 

özelliğe sahip olduğu belirlenmiştir (Metta 

et al., 2004). Mikrosatellitler, genomda 

yaygın olarak bulunmaları, polimorfizm 

oranının yüksek olması ve kullanımının 

kolay olması nedeniyle birçok moleküler 

biyoloji çalışmasında rahatlıkla kullanımı 

tercih edilmektedir. 

GENETİK ÇEŞİTLİLİK VE GENETİK 

KARAKTERİZASYON 

Hayvansal üretimde genetik çeşitlilik, ıslah 

programlarının temelini oluşturmaktadır. 

Genetik çeşitlilik, belli bir coğrafik bölgeye 

uyum sağlamış, ilgili bölgede yaygın olarak 

yetiştirilen canlı türlerinin, bu türlere ait 

ırkların genetik niteliklerini (kalıtsal bilginin 

zenginliğini) ve içinde yaşadıkları 

ekosistemde birbirleri ile ilişkilerinin 

niteliğini ifade eder. Evcil hayvanlarda 

genetik çeşitlilik, ırk içi ve ırklar arası olmak 

üzere iki çeşittir. 

Genetik karakterizasyon çalışmaları, 

ırklar arası ve ırk içi genetik çeşitliliğin 

belirlenmesi ve ırkların tanımlanması 

amacıyla önemli bir yere sahiptir. Dünyada

ve Türkiye’de 1980’li yıllarda yerli ırkların genetik 

yapıları ve bazı verim özellikleri ile olan ilişkileri 

kan ve süt protein polimorfizmi (Ceriotti et al., 

2003; Ibeagha-Awemu and Erhardt, 2005) 

kullanılarak incelenirken en son gelişmelerle 

birlikte mikrosatellit markörler ve SNP’ler (Cañón 

et al., 2001; Li et al., 2006; McKay et al., 2008; 

Kang et al., 2009; Molaee et al., 2009) daha yaygın 

olarak kullanılmaya başlanmıştır. 

Irkların kökeni ve evcilleştirilme bölgelerinin 

tespit edilmesi amacıyla genetik karakterizasyon ve 

arkeolojik çalışmalar yapılmaktadır. Avrupa 

ırklarının göç yollarının Tuna Nehri boyunca 

Kuzeyden Merkezi Avrupa’ya ve Akdeniz kıyısı 

boyunca olmak üzere iki farklı göç yolu izlediği, 

sığır, koyun, keçi, domuz ve mandanın iki farklı 

Asya Bölgesi’nde ilk evcilleştirilmeye başlandığı 

bildirilmektedir (Bruford et al., 2003). Bu 

merkezlerden en eski olanı Doğu-Güneydoğu 

Anadolu bölgesini kapsamaktadır ve ırkların bu 

bölgeden tüm Dünya’ya özellikle Anadolu’dan 

Avrupa’ya yayıldığı belirtilmektedir (Loftus et al., 

1994; 1999; Luikart et al., 2001; Troy et al., 2001; 

Hiendleder et al., 2002; Cymbron et al., 2005). 

Genetik karakterizasyon çalışmalarında 

mikrosatellitler, insan (Bowcock et al., 1994; Deka 

et al., 1995), sığır (MacHugh et al., 1997; Loftus et 

al., 1999; Edwards et al., 2000; Cañón et al., 2001), 

keçi (Luikart et al., 2001; Maudet et al., 2002), 

koyun (Mukesh et al., 2006; Lawson Handley et 

al., 2007; Molaee et al., 2009), köpek (Boyko et al., 

2009; Kang et al., 2009), at (Luís et al., 2007), eşek 

(Aranguren-Méndez et al., 2002), domuz (Behl et 

al., 2006; Sollera et al., 2009), manda (Flamand et 

al., 2003) ve diğer birçok hayvan türlerinde (Cosse 

et al., 2007; Vijh et al., 2007; Li et al., 2009) 

kullanılmaktadır. 

Genetik karakterizasyon çalışmalarında 

mikrosatellitler dışında farklı biyokimyasal markör 

sistemleri de (Moazami-Goudarzi et al., 1997; 

Kantanen et al., 1999; 2000; Ceriotti et al., 2003; 

Ibeagha-Awemu and Erhardt, 2005) kullanılmıştır. 

AFLP (Negrini et al., 2007), mtDNA (Loftus et al., 

1994; Bradley et al., 1996; Finnilä et al., 2001; 

Mannen et al., 2004), Y kromozomuna özgün 

mikrosatellitler (Edwards et al., 2000; Cai et al., 

2006; Li et al., 2007; Kantanen et al., 2009) 

ağırlıklı olarak kullanılmakla birlikte SNP (Li et 

al., 2006; McKay et al., 2008) markörleri de 

kullanılmaya başlanmıştır. Ayrıca genetik 

karakterizasyon çalışmalarında markör sistemleri 


dışında aile ağacı kayıtlarından da 

yararlanılmaktadır (Trinderup et al., 1999; 

Honda et al., 2006). 

Sığır ırkları üzerinde yapılan 

mikrosatellit markörler ile yapılan 

analizlerinde Taurin ve Zebu karışımı 

bulunmamışken diğer markör sistemlerinden 

olan Y kromozomu ve mtDNA ile yapılan 

çalışmalar birlikte değerlendirildiği zaman Y 

kromozomu markörü verilerinde bu ırklarda 

Zebu karışımının olduğu belirlenmiştir 

(Lirón et al., 2006). 

SNP’ler ise bitkiler, deniz ürünleri ve 

birçok hayvan türünde moleküler 

çalışmalarda aynı anda sayıca fazla miktarda 

kullanılmaktadır (Muir et al., 2008; 

Matukumalli et al., 2009; Yan et al., 2009; 

Zhu et al., 2012). 

Sonuç olarak markör sistemlerinde PZR 

teknolojisi öncesi birçok markör sistemi 

kullanılırken, PZR teknolojisi ile birlikte 

mikrosatellitler ağırlıklı kullanılmaya 

başlanmıştır. Son yıllarda ise SNP 

markörleri üzerinde çalışmalar artmış ve 

SNP çipleri oluşturulmaya başlanmıştır. 

KAYNAKLAR 

Aranguren-Méndez J, Jordana J, Gomez M. 

Genetic conservation of five endangered 

Spanish donkey breeds. J Anim Breed 

Genet. 119(4): 256–263, 2002. 

Başaran A. Tıbbi biyoloji ders kitabı. Güneş 

& Nobel Tıp Kitapevleri, 7. Baskı. 

Bursa. 2004. 

Behl R, Sheoran N, Behl J, Vijh RK. 

Genetic analysis of Ankamali pigs of 

India using microsatellite markers and 

their comparison with other 

domesticated Indian pig types. J Anim 

Breed Genet. 123(2): 131–135, 2006. 

Bennett P. Demystified… Microsatellites. 

Journal of Clinical Pathology. Mol 

Pathol. 53: 177–183, 2000. 

Botstein D, White RL, Skolnick M, Davis 

RW. Construction of a genetic linkage 

map in man using restriction fragment


length polymorphisms. Am J Hum Genet. 32: 

314–331, 1980. 

Bowcock AM, Ruiz-Linares A, Tomfohrde J, 

Minch E, Kidd JR, Cavalli-Sforza LL. High 

resolution of human evolutionary trees with 

polymorphic microsatellites. Nature. 368(6470): 

455–457, 1994. 

Boyko AR, Boyko RH, Boyko CM, Parker HG, 

Castelhano M, Corey L, Degenhardt JD, Auton 

A, Hedimbi M, Kityo R, Ostrander EA, 

Schoenebeck J, Todhunter RJ, Jones P, 

Bustamante CD. Complex population structure 

in African village dogs and its implications for 

inferring dog domestication history. Proc Natl 

Acad Sci USA. 106(33): 13903–13908, 2009. 

Bradley DG, MacHugh DE, Cunningham P, Loftus 

RT. Mitochondrial diversity and the origins of 

African and European cattle. Proc Natl Acad 

Sci USA. 93(10): 5131–5135, 1996. 

Bruford MW, Bradley DG, Luikart G. DNA 

markers reveal the complexity of livestock 

domestication. Nat Rev Genet. 4(11): 900–910, 

2003. 

Cai X, Chen H, Wang S, Xue K, Lei C. 

Polymorphisms of two Y chromosome 

microsatellites in Chinese cattle. Genet Sel 

Evol. 38: 525–534, 2006. 

Cañón J, Alexandrino P, Bessa I, Carleos C, 

Carretero Y, Dunner S, Ferran N, Garcia D, 

Jordana J, Laloë D, Pereira A, Sanchez A, 

Moazami-Goudarzi K. Genetic diversity 

measures of local European beef cattle breeds 

for conservation purposes. Genet Sel Evol. 

33(3): 311–332, 2001. 

Ceriotti G, Caroli A, Rizzi R, Crimella C. Genetic 

relationships among taurine (Bos taurus) and 

zebu (Bos indicus) populations as revealed by 

blood groups and blood proteins. J Anim Breed 

Genet. 120: 57–67, 2003. 

Cosse M, González S, Maldonado JE. Crossamplification 

tests of ungulate primers in the 

endangered Neotropical pampas deer 

(Ozotoceros bezoarticus). Genet Mol 

Res. 6(4): 1118–1122, 2007. 

Cymbron T, Freeman AR, Isabel Malheiro 

M, Vigne JD, Bradley DG. 

Microsatellite diversity suggests 

different histories for Mediterranean and 

Northern European cattle populations. 

Proc Biol Sci. 272(1574): 1837–1843, 

2005. 

Deka R, Jin L, Shriver MD, Yu LM, DeCroo 

S, Hundrieser J, Bunker CH, Ferrell RE, 

Chakraborty R. Population genetics of 

dinucleotide (dC-dA)n.(dG-dT)n 

polymorphisms in world populations. 

Am J Hum Genet. 56(2): 461–474, 1995. 

Edwards CJ, Gaillard C, Bradley DG, 

MacHugh DE. Y-specific microsatellite 

polymorphisms in a range of bovid 

species. Anim Genet. 31: 127–130, 2000. 

Ellegren H, Moore S, Robinson N, Byrne K, 

Ward W, Sheldon BC. Microsatellite 

evolution-a reciprocal study of repeat 

lengths at homologous loci in cattle and 

sheep. Mol Biol Evol. 14(8): 854–860, 

1997. 

Finnilä S, Lehtonen MS, Majamaa K. 

Phylogenetic Network for European 

mtDNA. Am J Hum Genet. 68: 1475– 

1484, 2001. 

Flamand JRB, Vankan D, Gairhe KP, 

Duong H, Barker JSF. Genetic 

identification of wild Asian water 

Buffalo in Nepal. Anim Cons. 6: 265– 

270, 2003. 

Hiendleder S, Kaupe B, Wassmuth R, Janke 

A. Molecular analysis of wild and 

domestic sheep questions current 

nomenclature and provides evidence for 

domestication from two different 

subspecies. Proc Biol Sci. 269(1494): 

893–904, 2002.

Honda T, Fujii T, Nomura T, Mukai F. Evaluation 

of genetic diversity in Japanese Brown cattle 

population by pedigree analysis. J Anim Breed 

Genet. 123: 172–179, 2006. 

Ibeagha-Awemu EM, Erhardt G. Genetic structure 

and differentiation of 12 African Bos indicus 

and Bos taurus cattle breeds, inferred from 

protein and microsatellite polymorphisms. J 

Anim Breed Genet. 122(1): 12–20, 2005. 

Kang BT, Kim KS, Min MS, Chae YJ, Kang JW, 

Yoon J, Choi J, Seong JK, Park HC, An J, Lee 

MH, Park HM, Lee H. Microsatellite loci 

analysis for the genetic variability and the 

parentage test of five dog breeds in South 

Korea. Genes Genet Syst. 84(3): 245–251, 2009. 

Kantanen J, Olsaker I, Adalsteinsson S, Sandberg 

K, Eythorsdottir E, Pirhonen K, Holm LE. 

Temporal changes in genetic variation of north 

European cattle breeds. Anim Genet. 30(1): 16– 

27, 1999. 

Kantanen J, Olsaker I, Holm LE, Lien S, Vilkki J, 

Brusgaard K, Eythorsdottir E, Danell B, 

Adalsteinsson S. Genetic diversity and 

population structure of 20 North European 

cattle breeds. J Hered. 91(6): 446–457, 2000. 

Kantanen J, Edwards CJ, Bradley DG, Viinalass H, 

Thessler S, Ivanova Z, Kiselyova T, Cinkulov 

M, Popov R, Stojanović S, Ammosov I, Vilkki 

J. Maternal and paternal genealogy of Eurasian 

taurine cattle (Bos taurus). Heredity. 103(5): 

404–415, 2009. 

Kurar E. Comparative physical and linkage 

mapping of bovine chromosome 24 with human 

chromosome 18. Doktora Tezi (PhD Thesis). 

University of Wisconsin-Madison, 2001. 

Lawson Handley L-J, Byrne K, Santucci F, 

Townsend S, Taylor M, Bruford MW, Hewitt 

GM. Genetic structure of European sheep 

breeds. Heredity. 99: 620–631, 2007. 

Li J, Wang G, Bai Z. Genetic variability in four 

wild and two farmed stocks of the Chinese 


freshwater pearl mussel (Hyriopsis 

cumingii) estimated by microsatellite 

DNA markers. Aquaculture. 287: 286– 

291, 2009. 

Li MH, Adamowicz T, Switonski M, 

Ammosov I, Ivanova Z, Kiselyova T, 

Popov R, Kantanen J. Analysis of 

population differentiation in North 

Eurasian cattle (Bos taurus) using single 

nucleotide polymorphisms in three genes 

associated with production traits. Anim 

Genet. 37(4): 390–392, 2006. 

Li MH, Zerabruk M, Vangen O, Olsaker I, 

Kantanen J. Reduced genetic structure of 

north Ethiopian cattle revealed by Ychromosome 

analysis. Heredity. 98: 

214–221, 2007. 

Lirón JP, Peral-Garcia P, Giovambattista G. 

Genetic characterization of Argentine 

and Bolivian Creole cattle breeds 

assessed through microsatellites. J 

Hered. 97(4): 331–339, 2006. 

Liu BH. Statistical genomics: Linkage, 

mapping, and QTL analysis. CRC Press 

LLC, Boca Raton New York. 1998. 

Loftus RT, MacHugh DE, Bradley DG, 

Sharp PM, Cunningham P. Evidence for 

two independent domestications of 

cattle. Proc Natl Acad Sci USA. 91(7): 

2757–2761, 1994. 

Loftus RT, Ertuğrul O, Harba MH, El- 

Barody AA, MacHugh DE, Park SDE, 

Bradly DG. A microsatellite survey of 

cattle from a centre of origin: The Near 

East. Mol Ecol. 8: 2015–2022, 1999. 

Luikart G, Gielly L, Excoffier L, Vigne JD, 

Bouvet J, Taberlet P. Multiple maternal 

origins and weak phylogeographic 

structure in domestic goats. Proc Natl 

Acad Sci USA. 98(10): 5927–5932, 2001.


Luís C, Juras R, Oom MM, Cothran EG. Genetic 

diversity and relationships of Portuguese and 

other horse breeds based on protein and 

microsatellite loci variation. Anim Genet. 38(1): 

20–27, 2007. 

MacHugh DE, Shriver MD, Loftus RT, 

Cunningham P, Bradley DG. Microsatellite 

DNA variation and the evolution, domestication 

and phylogeography of taurine and zebu cattle 

(Bos taurus and Bos indicus). Genetics. 146(3): 

1071–1086, 1997. 

Mannen H, Kohno M, Nagata Y, Tsuji S, Bradley 

DG, Yeo JS, Nyamsamba D, Zagdsuren Y, 

Yokohama M, Nomura K, Amano T. 

Independent mitochondrial origin and historical 

genetic differentiation in North Eastern Asian 

cattle. Mol Phylogenet Evol. 32(2): 539–544, 

2004. 

Matukumalli LK, Lawley CT, Schnabel RD, Taylor 

JF, Allan MF, Heaton MP, O'Connell J, Moore 

SS, Smith TPL, Sonstegard TS, Van Tassell CP. 

Development and characterization of a high 

density SNP genotyping assay for cattle. PLoS 

One. 4(4): e5350, 2009. 

Maudet C, Miller C, Bassano B, Breitenmoser- 

Würsten C, Gauthier D, Obexer-Ruff G, 

Michallet J, Taberlet P, Luikart G. 

Microsatellite DNA and recent statistical 

methods in wildlife conservation management: 

Applications in Alpine ibex [Capra ibex(ibex)]. 

Mol Ecol. 11(3): 421–436, 2002. 

McKay SD, Schnabel RD, Murdoch BM, 

Matukumalli LK, Aerts J, Coppieters W, Crews 

D, Dias Neto E, Gill CA, Gao C, Mannen H, 

Wang Z, Van Tassell CP, Williams JL, Taylor 

JF, Moore SS. An assessment of population 

structure in eight breeds of cattle using a whole 

genome SNP panel. BMC Genetics. 9: 37. 2008 

from http://www.biomedcentral.com/1471– 

2156/9/37 

Metta M, Kanginakudru S, Gudiseva N, Nagaraju J. 

Genetic characterization of the Indian cattle 

breeds, Ongole and Deoni (Bos indicus), using 

microsatellite markers – a preliminary study. 

BMC Genetics. 5(16): 2004 from 

http://www.biomedcentral.com/1471– 

2156/5/16 

Moazami-Goudarzi K, Laloë D, Furet JP, 

Grosclaude F. Analysis of genetic 

relationships between 10 cattle breeds 

with 17 microsatellites. Anim Genet. 

28(5): 338–345, 1997. 

Molaee V, Osfoori R, Eskandari Nasab MP, 

Qanbari S. Genetic relationships among 

six Iranian indigenous sheep populations 

based on microsatellite analysis. Small 

Rum Res. 84: 121–124, 2009. 

Muir WM, Wong GKS, Zhang Y, Wang J, 

Groenen MAM, Crooijmans RPMA, 

Megens HJ, Zhang H, Okimoto R, 

Vereijken A, Jungerius A, Albers GAA, 

Lawley CT, Delany ME, MacEachern S, 

Cheng HH. Genome-wide assessment of 

worldwide chicken SNP genetic 

diversity indicates significant absence of 

rare alleles in commercial breeds. Proc 

Natl Acad Sci USA. 105(45): 17312- 

17317, 2008. 

Mukesh M, Sodhi M, Bhatia S. 

Microsatellite-based diversity analysis 

and genetic relationships of three Indian 

sheep breeds. J Anim Breed Genet. 

123(4): 258–264, 2006. 

Negrini R, Nijman IJ, Milanesi E, Moazami- 

Goudarzi K, Williams JL, Erhardt G, 

Dunner S, Rodellar C, Valentini A, 

Bradley DG, Olsaker I, Kantanen J, 

Ajmone-Marsan P, Lenstra JA, European 

Cattle Genetic Diversity Consortium. 

Differentiation of European cattle by 

AFLP fingerprinting. Anim Genet. 38(1): 

60–66, 2007. 

Orita M, Iwahana H, Kanazawa H, Hayashi 

K, Sekiya T. Detection of 

polymorphisms of human DNA by gel 

electrophoresis as single-strand 

conformation polymorphisms. Proc Natl 

Acad Sci USA. 86: 2766–2770, 1989.

Orti G, Pearse DE, Avise JC. Phylogenetic 

assessment of length variation at a 

microsatellite locus. Proc Natl Acad Sci USA. 

94(20): 10745–10749, 1997. 

Rokas A, Ladoukakis E, Zouros E. Animal 

mitochondrial DNA recombination revisited. 

Trends Ecol Evol. 18(8): 411-417, 2003. 

Smigielski EM, Sirotkin K, Ward M, Sherrry ST. 

dbSNP: a database of single nucleotide 

polymorphisms. Nucl Acids Res. 28(1): 352- 

355, 2000. 

Sollera BP, Paiva SR, Faria DA, Guimarães SEF, 

Castro STR, Egito AA, Albuquerque MSM, 

Piovezan U, Bertani GR, Mariante AD. Genetic 

diversity of Brazilian pig breeds evidenced by 

microsatellite markers. Livest Sci. 123: 8–15, 

2009. 

The International SNP Map Working Group. A 

map of human genome sequence variation 

containing 1.42 million single nucleotide 

polymorphisms. Nature. 409: 928-933, 2001. 

Trinderup M, Jørgensen JN, Hansen M. 

Conservation considerations on Danish 

Shorthorn Cattle using pedigree analysis. AGRI. 

26: 27–33, 1999. 

Troy CS, MacHugh DE, Bailey JF, Magee DA, 

Loftus RT, Cunningham P, Chamberlain AT, 

Sykes BC, Bradley DG. Genetic evidence for 

Near-Eastern origins of European cattle. Nature. 

410(6832): 1088–1091, 2001. 

Vijh RK, Tantia MS, Mishra B, Kumar ST. Genetic 

diversity and differentiation of dromedarian 

camel of India. Anim Biotechnol. 18(2): 81–90, 

2007. 

Vos P, Hogers R, Bleeker M, Reijans M, van de 

Lee T, Hornes M, Frijters A, Pot J, Peleman J, 

Kuiper M, Zabeau M. AFLP: A new technique 

for DNA fingerprinting. Nucl Acids Res. 23(21): 

4407–4414, 1995. 


Wang DG, Fan JB, Siao CJ, Berno A, 

Young P, Sapolsky R, Ghandour G, 

Perkins N, Winchester E, Spencer J, 

Kruglyak L, Stein L, Hsie L, Topaloglou 

T, Hubbell E, Robinson E, Mittmann M, 

Morris MS, Shen N, Kilburn D, Rioux J, 

Nusbaum C, Rozen S, Hudson TJ, 

Lipshutz R, Chee M, Lander ES. Largescale 

identification, mapping, and 

genotyping of single-nucleotide 

polymorphisms in the human genome. 

Science. 280(5366): 1077–1082, 1998. 

Weber JL, May PE. Abundant class of 

human DNA polymorphisms which can 

be typed using the polymerase chain 

reaction. Am J Hum Genet. 44: 388–396, 

1989. 

Williams JGK, Kubelik AR, Livak KJ, 

Rafalski JA, Tingey SV. DNA 

polymorphisms amplified by arbitrary 

primers are useful as genetic markers. 

Nucl Acids Res. 18(22): 6531–6535, 

1990. 

Yan J, Shah T, Warburton ML, Buckler ES, 

McMullen MD, Crouch J. Genetic 

characterization and linkage 

disequilibrium estimation of a global 

maize collection using SNP markers. 

PLoS One. 4(12): e8451, 2009. 

Zhu C, Cheng L, Tong J, Yu X. 

Development and Characterization of 

New Single Nucleotide Polymorphism 

Markers from Expressed Sequence Tags 

in Common Carp (Cyprinus carpio). Int 

J Mol Sci. 13(6): 7343-7353, 2012.

Journal of Cell and Molecular Biology 10(2):21-30, 2012 Research Article 21 




Naeimeh SAFAVIZADEH 1 , Seyed Ali RAHMANI 1 , Mohamad ZAEFIZADEH 2* 

1 Department of Science, Ahar Branch, Islamic Azad University- Ahar- Iran. 

2 Department of Science, Ardabil Branch, Islamic Azad University- Ardabil- Iran. 

(* author for correspondence; m.zaefi@gmail.com) 

Received: 8 June 2012; Accepted: 14 August 2012 

Abstract 

Multiple Sclerosis (MS) is an autoimmune inflammatory disease which affects the Central Nervous 

System (CNS) and leads to the destruction of myelin and atrophy of the axons. Genetic factors, in 

addition to environmental ones, seem to play a role in MS. Numerous studies have reported 

mitochondrial defects including a reduction in COX complex function related to the decrease of 

mitochondrial gene expression in the cortex tissue of MS patients. This study aimed to assess COX5B 

and COX2 gene expression in MS patients and controls. By using Real-Time PCR method, expression 

levels of the COX5B and COX2 were determined, with reference to ß-actin and GAPDH. The results 

showed that COX5B gene expression is significantly reduced in MS patients compared to control 

(P

22 Naeimeh SAFAVIZADEH et al. 

Introduction 

Multiple Sclerosis (MS) is an inflammatory 

demyelinating disease of the central nervous system 

with axonal degeneration (Frohman et al., 2006). 

The loss of myelin in MS may be the result of 

direct damage to myelin through immune mediated 

processes and dysfunction of oligodendrocytes 

(Vercellino et al., 2009). Approximately 15–20% 

of MS patients have a family history of MS, but 

large extended pedigrees are uncommon, with most 

MS families having no more than two or three 

affected individuals. Studies in twins (Calabresi, 

2007) and conjugal pairs indicate that much of this 

familial clustering was the result of shared genetic 

risk factors, while studies of migrants 

(Ramagopalan et al., 2010) and apparent epidemics 

(Koch et al., 2008) indicated a clear role for 

environmental factors. Mitochondrial defects are 

known to occur during aging, cancer, heart disease, 

and a wide variety of degenerative diseases, such as 

Alzheimer’s disease (AD), Parkinson’s disease 

(PD), Huntington’s Disease (HD) and MS 

(Henchcliffe et al., 2008). Mitochondria contain the 

respiratory chain where energy in the form of ATP 

is most efficiently produced (Damiano et al., 2010). 

The mitochondrial respiratory chain is located in 

the inner mitochondrial membrane and consists of 

four complexes (complexes I–IV), whilst complex 

V is directly involved in ATP synthesis. The 

complexes of the mitochondrial respiratory chain 

include multiple subunits; all but complex II (which 

is entirely encoded by nuclear DNA) contain 

proteins encoded by nuclear and mitochondrial 

DNA (mtDNA). The final respiratory chain 

complex [complex IV or cytochrome-c oxidase 

(COX)] is the site at which over 90% of oxygen is 

consumed. This complex is also involved in proton 

pumping, essential for ATP synthesis (Alston et al., 

2011). The mammalian COX is composed of 13 

subunits, of which the three largest are encoded by 

the mtDNA and form the catalytic core of the 

enzyme. The remaining ten, evolutionary younger, 

nuclear-encoded subunits are involved in assembly 

and regulation of the enzyme (Zee et al., 2006). 

The function of mammalian COX can be 

physiologically modulated and the enzyme 

represents one of the key regulatory sites of energy 

metabolism (Fernandes-Vizarra et al., 2009). COX 

transfers electrons from cytochrome-c to molecular 

oxygen, which is reduced to water. The electrons 

pass from cytochrome-c, binding at subunit II, 

through Cu (A) and heme as cofactors, to 

the binuclear center buried inside subunit I 

and composed of heme a3 and Cu (B), where 

the incoming four electrons together with 

four protons from the matrix are sequentially 

used for oxygen reduction. This exergonic 

redox reaction is coupled with proton 

pumping across the inner mitochondrial 

membrane, but the coupling of the two 

processes (H + /e - stoichiometry) can be 

modulated. In addition to Mitchell’s 

chemiosmotic theory, a “second mechanism 

of respiratory control” has been proposed 

that involves the binding of adenine 

nucleotides to nuclear-encoded COX 

subunits. The key event is the 

phosphorylation of subunit IV. Activity of 

phosphorylated COX is regulated by 

ATP/ADP ratio and respiratory rate is 

precisely controlled according to the ATP 

utilization. The membrane potential is kept 

low (100-150 mV) and COX works at high 

efficiency of proton translocation (H + /e - = 1). 

The COX biosynthesis and assembly is 

timely and complicated process involving 

several rate-limiting steps reflecting the 

sequential incorporation of the subunits 

from either the cytosol (nuclearly coded 

subunits) or from the mitochondrial matrix 

(subunits I, II and III). The majority of COX 

defects thus originate from mutations in 

nuclear genes (Acin-Perez et al., 2009). 

Mutations in the genes encoding several 

COX assembly factors have been described 

as a frequent cause of mitochondrial 

diseases and have been assigned with 

specific clinical symptoms. The dysfunction 

of COX in these cases is mostly caused by 

structural changes rather than by the changes 

in amount of the enzyme (Galati et al., 

2009). Cytochrome-c oxidase subunit II, 

abbreviated as CoxII, is the second subunit 

of cytochrome-c oxidase subunit 2 (CO II) 

transfers the electrons from cytochrome-c to 

the catalytic subunit 1. It contains two 

adjacent transmembrane regions in its Nterminus 

and the major part of the protein is 

exposed to the periplasmic or to the 

mitochondrial intermembrane space, 

respectively. CO II provides the substratebinding 

site and contains a Cu centre called

Cu(A), probably the primary acceptor in 

cytochrome-c oxidase. An exception is the 

corresponding subunit of the cbb3-type oxidase 

which lacks the Cu(A) redox-centre. Several 

bacterial CO II have a C-terminal extension that 

contains a covalently bound heme c (Barrientos et 

al., 2009). Subunit Vb of mammalian cytochrome c 

oxidase is encoded by a nuclear gene and 

assembled with the other 12 COX subunits encoded 

in both mitochondrial and nuclear DNA. This gene 

located on chromosome 2, region cen-q13 

(Williams et al., 2005). There is a common 

symptom of MS with mitochondrial diseases such 

as AD and PD, and also the point mutations in 

mtDNA can cause damage to the myelin (DiMauro 

et al., 2008). In this study, we compared COX5B 

and COX2 gene expression among MS patients 

with controls. In regard to the importance of 

mitochondria in MS, we mainly centralized our 

study on quantifying the expressions of COX5B 

and COX2 using Real-Time PCR. 

Materials and Methods 

Subjects 

Thirty-six patients (16 male, 20 female) and 30 

controls (14 male, 16 female) took part in this 

study. Written informed consent was obtained from 

each individual. Peripheral blood samples (5ml) 

were obtained from the cubital vein and collected in 

cell preparation tubes containing an anticoagulant 

(EDTA). Peripheral blood mononuclear cells 

(PBMC) were isolated by EDTA density 

centrifugation. 

Table 1. Sequences of the primers used for RT-PCR 

Gene name Primer sequence 

COX5B 

COX2 

GAPDH 

ß-actin 

Cox Expression in MS 23 

RNA Extraction 

Total RNA was isolated by using a 

RNAeasy kit from Roche (Germany), 

according to the manufacturer’s 

recommendations. The RNAsamples were 

incubated with RNAse-free DNAse I at 

37°C for 15 min. RNA samples were 

purified with a RNAeasy kit. It is possible to 

preserve extracted RNA for months under 

−80 °C. Total RNA quality and quantity 

were assessed in 2 ways. In the first method, 

we estimated the RNA concentration by 

ultraviolet absorbance at 260 nm (1 

absorbance unit at 260 nm = 40 ng/μL RNA) 

and the RNA purity by measuring the ratio 

of absorbance at 260 nm and 280 nm (1.8 < 

A260/A280


cDNA Synthesis 

Total RNA from each sample was used to generate 

cDNA with a Reverse Transcriptase cDNA 

synthesis kit (Roche, Germany) with oligo (dT) 

primers, according to the manufacturer’s protocol. 

Briefly RNA and 1 μL oligo (dT) were mixed and 

then heated at 70°C for 5 min. They were chilled on 

ice until the other components were added. Then, 

we added 2μL dNTP, 4 μL of buffer, and 1 μL of 

ribolack (RNase inhibition). The samples were 

mixed and incubated at 37°C for 5 min. Then 1 μL 

of Reverse Transcriptase was added, and the 

samples were mixed and incubated at 42°C for 60 

min. The reaction was inactivated at 70°C for 10 

min. Finally, cDNA was stored at -20°C. 

Quantitative Real-Time PCR 

Amplification was performed over 30 cycles on the 

MJ Research PTC-200 Gradient Cycler (MJ 

Research, Waltham Mass, USA). The annealing 

temperature was 54°C, extension occurred at 72°C, 

and denaturation occurred at 94°C. After 

completion of PCR, the product was separated by 

electrophoresis in 1% agarose gel and detected by 

ethidium bromide staining. cDNAs testing positive 

for ß-actin and GAPDH expression was used in the 

Real-Time PCR. Relative expressions of COX2 and 

COX5B in the blood samples was carried out by 

Real-Time PCR analysis using the ABI PRISM 

7700 Sequence Detection System (Applied 

Biosystems, Darmastadt, Germany) and the SYBR 

Green PCR Kit (Qiagene). The data were evaluated 

by the CT method, which measures the 

expression level of the target genes normalized to a 

reference gene and relative to the expression of the 

genes in the calibrator samples. After efficiency 

testing, ß-actin and GAPDH were chosen as the 

reference housekeeping genes and the same primer 

pairs used for the standard PCR were utilized for 

the Real-Time PCR. Amplification was performed 

over 45 cycles. The annealing temperature was 

54°C, extension occurred at 70°C, and denaturation 

occurred at 94°C. Every cDNA samples were 

measured in four separate preparations to correct 

for minor variations. Melting curve analyses were 

carried out after completion to confirm the presence 

of single amplified species. The transcript levels of 

COX2 and COX5B in the samples were normalized 

to the transcriptional level of the housekeeping 

genes ß-actin and GAPDH, and calculated relative 

to the expression levels of the target genes in a 

calibrator blood samples. The arithmetic 

mean of the relative expression levels of 

COX2 and COX5B for each group of 

patients and controls were calculated. 

Statistical analysis 

Statistically significant differences were 

calculated by the Student’s t-test, using the 

SPSS 18.0 and Excel. Finally a Pvalue0.05 

was accepted as the level of significance. 

Results 

To determine the role of mitochondriaencoded 

gene and nuclear-encoded gene in 

MS pathogenesis, using quantitative Real- 

Time PCR analysis with SYBR-Green 

fluorescent dye, we calculated the mRNA 

fold change for one mitochondria-encoded 

gene in complex IV (COX2) and one 

nuclear-encoded gene in complex IV 

(COX5B) of oxidative phosphorylation. 

Real-Time PCR data analysis for genes 

expression 

Quantitative measurement of (COX2, 

COX5B) gene expression was investigated 

in 36 MS patients. Five different standard 

concentrations were used to draw a standard 

curve (Figure 1). Quantitative measurement 

of gene expressions, achieved in the PCR of 

the cycles, was done in the progressive 

phase. Real-Time PCR Software can 

determine the threshold cycle automatically 

(Figure 2). In addition, due to temperature 

changes in the melting curve analysis, there 

is only one peak associated with the COX5B 

and COX2 genes, which is a symptom of 

lack of cases such as nonspecific products 

and primer dimer (Figure 3). Then PCR, 

standard curve, as a template standard DNA 

of successive dilutions, was plotted for the 

COX5B and COX2 genes (Figure 4). 

Standard curve for the COX5B gene stands 

for index (R 2 )=0.98 and also standard curve 

of obtained COX2 gene stands for index 

(R 2 )=0.95.

Figure 1. Amplification plots for MS COX5B 

Figure 2. Ct values of COX5B in subjects 

Cox expression in MS 25 

Figure 3. Melting curve for COX 5b gene 

Figure 4. Standard curve for COX5B gene 

(determination of index R 2 =0.98).

26 Naeimeeh 

SAFAVIZAADEH 

et al. 

Standarddized 

results Ct 

Accordinng 

to the studiies 

that were ddone 

after Real 

Time PCRR 

test, the aveerage 

of standdardized 

Ct in 

regard to the state of -actin 

and GAPDH 

genes in 

COX5B among controol 

and patientts 

affected with 

MS are 6.21, 6.71 aand 

3.95, 5.446 

respectiveely 

(Figures 55). 

In additionn, 

the average of standardizzed 

Ct in regard 

to state oof 

-actin andd 

GAPDH gennes 

in COX2 among controls 

and patiennts 

affected with 

MS are 4.86, 

4.38 and 4.84, 4.12 resspectively. 

Figure 5. 

The Ct COOX5B 

gene, staandardized 

wiith 

ß-actin 

Table 

2. COX55B 

and COX22 

genes expresssion 

(Ct) on n based of B-aactin 

referencee 

gene 

GGene 

CCompare 

COOX5B 

CCOX2 

Taable 

3. COX5BB 

and COX2 ggenes 

expresssion 

(Ct) on based b of GAPPDH 

referencee 

gene. 

Gene 

COX5BB 

COX22 

Patieent 

Vs Controll 

6.71 

Patieent 

vs Controll 

4.38 

Compare 

Patiient 

vs Controol 

Patiient 

vs Controol 

Means (Ct) 

Std. Er rror mean d 

6.21 

4.86 

Comp parison betweeen 

the statisttical 

analysis 

of CO OX5B t-test annd 

the resultss 

showed that 

there are meaningfful 

differencees 

in COX5B 

gene (P0.05). Onn 

the other hannd, 

decreased 

gene expression iin 

COX5B wwas 

observed 

amon ng MS patiennts 

rather thhan 

controls, 

howe ever, the resullts 

showed noo 

meaningful 

differ rences for the COX2 gene. For equality 

of va ariances, t-tesst 

and Levenee’s 

test were 

perfo ormed. The results 

showed that the data 

relate ed to Ct was not significanntly 

different 

COX X5B gene amoong 

patients and control. 

Ct comparison c was 

performed with t-test in 

patien nts and contrrols. 

The ressults 

showed 

that th he measured t is significantt 

for COX5B 

gene (Pvalue=0.0168) 

and (PPvalue=0.005), 

while e the data related too 

Ct has 

signif ficantly diffferent 

COX22 

gene in 

patien nts and contrrol. 

Ct commparison 

was 

perfo ormed with t-teest 

in pateintss 

and control. 

The results showwed 

that meeasured 

t is 

signif ficant for COOX2 

gene ( (Pvalue=0.117) 

and (Pvalue=0.124) 

( 

(Table 2, 3) ). Generally, 

the re esults showedd 

that actin aand 

GAPDH 

genes s are similaar 

among ccontrol 


patien nts. 

0.1 19746 

0. 1314 

0.88 0 

Means 

(Ct) Std.Error S meean 

df Tva 

5.46 

3.95 

4.12 

4.84 

1.6 

0.89 

0.78 

1.44 

0.69 

df Tvalue 

664 

2.69 00.0168 

664 

-1.67 

Pvalue 

0.117 

alue 

Pvalue 

64 2.991 

0.005 

64 -1. 52 0.124

Determination of changes in gene expression 

levels 

To determine changes in the expressions COX5B 

and COX2 genes Livak formula was used (Livak 

and Schmittgen, 2001). 

-actin gene: COX5B = 2 -CT = 2 -(6.21- 6.71) = 2 0.5 = 

1.41 

COX2 = 2 -CT = 2 -(4.86-4.38) = 2 -0.48 

GAPDH gene: COX5B = 2 -CT = 2 -(3.95 - 5.46) = 2 1.51 = 

2.84 

COX2 = 2 -CT = 2 -(4.84-4.12) = 2 -0.72 

Total results of the Real-Time PCR 

According to the results obtained, it seems that 

COX2 gene has no effect on MS patients; but 

COX5B gene expression was decreased in MS 

patients and this gene could play an important role 

in neurodegenerative diseases. Correlation between 

COX5B and COX2 gene expression turned out to 

be R=0.92 in control. This correlation was R=0.84 

in patients, who, despite being significant, was 

lower compare to control. This difference, if 

verified with further subjects and studies, can be 

considered as a hypothesis about this disease. 

Discussion 

In this study, the expression levels of COX5B and 

COX2 genes in MS patients and controls were 

compared. The results showed that COX5B gene 

expression in MS patients was significantly lower 

compared to controls (P=0.0168) and (P=0.005). In 

the case of Cox5B gene expression, a highly 

significant difference between controls and 

patients, despite the low number of samples, 

indicates the role of this gene in patients, but it is 

not clear that reduced expression of this gene is one 

of the causes of disease, or when the disease 

induces, the gene expression will be reduced. While 

there was no significant differences in the COX2 

gene expression between controls and patients, 

differences between P=0.117 and P=0.124 was not 

significant. One of the reasons that Cox2 gene is 

not significant, it can be due to the low number of 

samples and low df, it is necessary to consider the 

mentioned term to report the more accurate results. 

Degeneration of chronically demyelinated axons is 

a major cause of the continuous, irreversible 

neurological disability that occurs in the chronic 

stages of MS (Aschrafi et al., 2008). Microarray 

studies from cortical and white matter tissue of 


patients with progressive MS showed upregulation 

of genes involved in hypoxic 

preconditioning and decreased expression of 

mRNA for mitochondrial proteins (Lin et 

al., 2006). The dominant loss of small axons 

in MS lesions suggests energy deficiency as 

a major mechanism included in axonal 

degeneration (Stys, 2005). The newly 

reported research provides evidence that 

neurons in MS are respiratory-deficient due 

to mtDNA deletions, which are extensive in 

GM and may be induced by inflammation. 

They propose induced multiple deletions of 

mtDNA as an important contributor to 

neurodegeneration in MS (Campbell et al., 

2010). This presents a unique challenge to 

neurologists wanting to identify, diagnose, 

and manage patients and families with 

mitochondrial disease (Druzhyna et al., 

2008). Clonally expanded multiple deletions 

of mtDNA causing respiratory deficiency 

are well recognized in neurodegenerative 

disorders and aging. Given the vulnerability 

of mtDNA to oxidative damage and the 

extent of inflammation in MS, often starting 

with a preclinical phase and remaining 

throughout the disease course, mtDNA 

deletions might be expected in MS 

(Nicholas et al., 2009). Repair of damaged 

mtDNA rather than oxidative damage to 

mtDNA per se is the most likely mechanism 

by which mtDNA deletions are formed, and 

clonal expansion is regarded as the 

mechanism responsible for causing 

respiratory deficiency. Where respiratory 

deficiency is caused by induced multiple 

DNA deletions, cells will have initially 

contained deletions with different 

breakpoints, one of which then clonally 

expands to high levels over time (Krishnan 

et al., 2008). Clonally expanded multiple 

deletions of mtDNA are reported in 

inclusion body myositis, a condition 

associated with chronic inflammation. 

Decrease in density of respiratory-deficient 

neurons in lesions is a likely reflection of 

mtDNA deletion-mediated cell loss as well 

as increase in susceptibility to other insults 

because of the clonally expanded mtDNA 

deletions. The extent of mtDNA deletions 

identified using long-range PCR on a global


scale regardless of cell type, and even in neurons 

with intact complex IV activity, reflects the 

potential of cells in MS to become respiratory 

deficient through clonal expansion over the course 

of the disease. By isolating individual neurons at a 

single time point we identified high levels of 

multiple mtDNA deletions within respiratorydeficient 

cells. In contrast, mtDNA deletions 

detected by long range PCR within respiratoryefficient 

neurons in MS and controls were not 

expanded to high levels (Micu et al., 2006). 

Mitochondrial defects are increasingly recognized 

to play a role in the pathogenesis of MS. Energy in 

the form of ATP is most efficiently produced by 

mitochondria, which also play a role in calcium 

handling, production of reactive oxygen species 

(ROS), and apoptosis (Lin et al., 2006). It is known 

that mitochondria are intrinsically involved in the 

cellular production of oxygen radicals and are 

believed to play an important part in oxygen 

radical-mediated cell damage in neurodegenerative 

diseases. The investigations are in complete 

agreement with the occurrence of activity defects of 

COX in single muscle fibres. The mitochondrial 

impairment is not to age or denervation-associated 

muscular changes since the functional impairment 

of mitochondria (Dutta et al., 2006). While 

numerous pathogenetic mutations are routinely 

detected in isolated COX deficiencies, the protocols 

for characterizing the functional impact of these 

mutations are still in early stages of development. 

The integrative approach combining multiple 

bioenergetic analyses performed in whole cells is 

particularly promising, as the best way to 

investigate the resulting pathogenetic changes 

occurring in situ. The general severity of the 

functional changes in COX defects suggests that 

the development of effective drugs is very unlikely, 

and that only gene therapy might lead to efficient 

treatment of these diseases in the future (Smith et 

al., 2005). Measurement of the threshold for 

specific mtDNA mutations has been performed in 

cultured cells elsewhere. The microphotometric 

enzyme–assay system for measurement of COX 

activity within individual muscle fibers is used in 

conjunction with demonstration of myofibrillar 

ATPase in serial sections, so that a normal range of 

COX activity in individual muscle fibers of each 

fiber type is defined in control samples. In previous 

studies, a good correlation between 

microphotometric enzyme analysis and biochemical 

studies has been shown in patients with 

Leigh syndrome (Ogbi et al., 2006). The 

newly reported four proteins in particular 

were responsible for distinguishing diseased 

from healthy. Peptide fingerprint mapping 

unambiguously identified these 

differentially expressed proteins. Three 

proteins identified are involved in 

respiration including cytochrome c oxidase 

subunit 5b (COX5b), the brain specific 

isozyme of creatine kinase and hemoglobin 

β-chain (Horváth et al., 2005). In previous 

studies six genes, involved in energy 

metabolism pathways, also had increased 

transcript levels in the skeletal muscle of CR 

rats compared with muscle of control rats. 

These include genes associated with 

mitochondrial ATP production, such as six 

subunits of cytochrome c oxidase (COX I, 

II, III, IV, Va, and VIII) and NADH 

dehydrogenase (Kalman et al., 2007). All 

mitochondria of the progeny are inherited 

from the mother; and all 13 polypeptides 

encoded by the mitochondrial genome are 

located in the respiratory chain (complexes 

I, III, IV and V). These biological principles 

are helpful in understanding the clinical 

syndromes and patterns of inheritance 

associated with the mitochondrial 

myopathies and encephalomyopathies 

(Broadwater et al., 2011). Cellular injury 

often has been associated with disturbances 

in mitochondrial function. Interestingly, our 

analysis indicated a pronounced increase in 

the expression of mitochondrial cytochrome 

c oxidase subunits IV and Vb, a finding that 

was validated further by RT PCR. 

Cytochrome c oxidase has been used 

frequently as a marker for neuronal 

metabolic activity, especially in pathological 

conditions involving oxidative stress. 

Neurons subject to oxidative damage show 

abnormalities in mitochondrial dynamics 

even in the absence of any apparent 

indication of degeneration (Hamblet et al., 

2006). Elevations in cytochrome c oxidase 

expression or function in vulnerable 

neuronal subpopulations in AD, following 

traumatic brain injury and preceding 

apoptotic death of spinal cord motor neurons 

after sciatic nerve avulsion, have been

eported. Thus, an increase in cytochrome c oxidase 

expression may reflect aberrant energy metabolism 

and oxidative damage in the spinal cord during 

EAE (Fukui et al., 2007). 

With due attention to the results of correlation 

between COX2 and COX5B gene expressions with 

nuclear DNA and mitochondrial DNA source, we 

can claim that there is an interaction between two 

COX gene expressions of genome and 

mitochondria source and the effectiveness is of 

COX enzymes in the MS patients. While the 

number of selected samples were not more than 36, 

the state of COX5B between patient and control 

groups was meaningful. This means that in a group 

of a number of members, there is no impact on its 

meaninglessness. In COX2, the main reason for 

meaninglessness may relate to the low number of 

samples. Therefore, it would be better to reproduce 

the experiments with an expanded sample size. 

References 

Acin-Perez R, Salazar E, Kamenetsky M, Buck J, 

Levin LR, Manfredi G. Cyclic AMP Produced 

inside Mitochondria Regulates Oxidative 

Phosphorylation. Cell Metabolism. 9: 265-76, 

2009. 

Alston LC, He L, Morris A, Hughes I, Taylor R, et 

al. Maternally inherited mitochondrial DNA 

disease in consanguineous families. European 

Journal of Human Genetics. 19: 1226-29, 2011. 

Aschrafi A, Schwechter AD, Mameza MG, Natera- 

Naranjo O, Gioio EA, Kaplan BB. MicroRNA- 

338 regulates local cytochrome c oxidase IV 

mRNA levels and oxidative phosphorylation in 

the axons of sympathetic neurons. J Neurosci. 

28: 12581-90, 2008. 

Barrientos A, Gouget K, Horn D, Soto IC, 

Fontanesi F. Suppression mechanisms of COX 

assembly defects in yeast and human: insights 

into the COX assembly process. Biochim 

Biophys Acta. 1793: 97-107, 2009. 

Broadwater L, Pandit A, Clements R, Azzam S, et 

al. Analysis of the mitochondrial proteome in 

multiple sclerosis cortex. Biochem Biophys 

Acta. 1812(5): 630-41, 2011. 

Calabresi P. Multiple sclerosis and demyelinating 

conditions of the central nervous system. In: 

Goldman L, Ausiello D, eds. Cecil Medicine. 


23rd ed. Philadelphia, Pa: Saunders 

Elsevier chap 436, 2007. 

Campbell GR, Ziabreva I, Reeve AK, 

Krishnan KJ, et al. Mitochondrial DNA 

deletions and neurodegeneration in 

multiple sclerosis. Ann Neurol. 69: 481- 

92, 2010. 

Damiano M, Galvan L, Deglon N, Brouillet 

E. Mitochondria in Huntington’s disease. 

Biochim Biophys Acta. 1802: 52-61, 

2010. 

DiMauro S, Schon EA. Mitochondrial 

disorders in the nervous system. Annu 

Rev Neurosci. 31: 91-123, 2008. 

Druzhyna NM, Wilson GL, LeDoux SP. 

Mitochondrial DNA repair in aging and 

disease. Mech Ageing Dev.129: 383-90, 

2008. 

Dutta R, McDonough J, Yin X, Peterson J, 

Chang A, Torres T, et al. Mitochondrial 

dysfunction as a cause of axonal 

degeneration in multiple sclerosis 

patients. Ann Neurol. 59: 478-89, 2006. 

Fernandez-Vizarra E, Tiranti V, Zeviani M. 

Assembly of the oxidative 

phosphorylation system in humans: what 

we have learned by studying its defects. 

Biochim Biophys Acta. 1793: 200-11, 

2009. 

Frohman EM, Racke MK, Raine CS. 

Multiple sclerosis–the plaque and its 

pathogenesis. N Engl J Med. 354: 942- 

55, 2006. 

Fukui H, Diaz F, Garcia S, Moraes CT. 

Cytochrome c oxidase deficiency in 

neurons decreases both oxidative stress 

and amyloid formation in a mouse model 

of Alzheimer's disease. Proc Natl Acad 

Sci USA. 104:14163-8, 2007. 

Galati G, Srinivasan S, Raza H, Prabu SK, 

Hardy M, Chandran K, Lopez M, 

Kalyanaraman B, Avadhani NG. Role of 

nuclear-encoded subunit Vb in the 

assembly and stability of cytochrome c 

oxidase complex: implications in 

mitochondrial dysfunction and ROS


production. Biochem J. 420: 439-49, 2009. 

Hamblet NS, Ragland B, Ali M, Conyers B, 

Castora FJ. Mutations in mitochondrial-encoded 

cytochrome c oxidase subunits I, II, and III 

genes detected in Alzheimer's disease using 

single-strand conformation polymorphism. 

Electrophoresis. 27: 398-408, 2006. 

Henchcliffe C, Beal MF. Mitochondrial biology 

and oxidative stress in Parkinson disease 

pathogenesis. Nat Clin Pract Neurol. 4: 600-09, 

2008. 

Horváth R, Schoser BG, Müller-Höcker J, Völpel 

M, Jaksch M, Lochmüller H. Mutations in 

mtDNA-encoded cytochrome c oxidase subunit 

genes causing isolated myopathy or severe 

encephalomyopathy. Neuromuscular Disorders. 

15: 851-57, 2005. 

Kalman B, Laitinen K, Komoly S. The involvement 

of mitochondria in the pathogenesis of multiple 

sclerosis. J Neuroimmunol. 188: 1-12, 2007. 

Koch M, Uyttenboogaart M, van Harten A, De 

Keyser J. Factors associated with the risk of 

secondary progression in multiple sclerosis. 

Multiple Sclerosis. 14: 799-803, 2008. 

Krishnan KJ, Reeve AK, Samuels DC, et al. What 

causes mitochondrial DNA deletions in human 

cells? Nat Genet. 40: 275-79, 2008. 

Lin MT, Beal MF. Mitochondrial dysfunction and 

oxidative stress in neurodegenerative diseases. 

Nature. 443: 787-95, 2006. 

Livak KJ, Schmittgen TD. Analysis of relative gene 

expression data using real-time quantitative 

PCR and the 2(-Delta DeltaC(T)) Method. 

Methods. 25(4): 402-8, 2001. 

Micu I, Jiang Q, Coderre E, et al. NMDA receptors 

mediate calcium accumulation in myelin during 

chemical ischaemia. Nature. 439: 988-92, 2006. 

Nicholas A, Kraytsberg Y, Guo X, Khrapko K. On 

the timing and the extent of clonal expansion of 

mtDNA deletions: evidence from singlemolecule 

PCR. Exp Neurol. 218: 316-19, 

2009. 

Ogbi M, Johnson JA. Protein kinase 

Cepsilon interacts with cytochrome c 

oxidase subunit IV and enhances 

cytochrome c oxidase activity in 

neonatal cardiac myocyte 

preconditioning. Biochem J. 393: 191-9, 

2006. 

Ramagopalan SV, Dobson R, Meier UC, 

Giovannoni G. Multiple sclerosis: risk 

factors, prodromes, and potential causal 

pathways. Lancet Neurol. 9: 727-39, 


Smith D, Gray J, Mitchell L, Antholine WE, 

Hosler JP. Assembly of Cytochrome-c 

Oxidase in the Absence of Assembly 

Protein Surf1p Leads to Loss of the 

Active Site Heme. J Biol Chem. 280: 

17652-56, 2005. 

Stys PK. General mechanisms of axonal 

damage and its prevention. J NeurolSci. 

233: 3-13, 2005. 

Vercellino M, Romagnolo A, Mattioda A, 

Masera S, et al. Multiple sclerosis 

relapses: a multivariable analysis of 

residual disability determinants. Acta 

Neurologica Scandinavica. 119(2): 126- 

30, 2009. 

Williams JC, Sue C, Banting GS, Yang H, 

Glerum DM, Hendrickson WA, Schon 

EA. Crystal structure of human SCO1: 

implications for redox signaling by a 

mitochondrial cytochrome c oxidase 

"assembly" protein. J Biol Chem. 280: 

15202-11, 2005. 

Zee JM, Glerum DM. Defects in cytochrome 

oxidase assembly in humans: lessons 

from yeast. Biochem Cell Biol. 84:859- 

69, 2006.




Curcumin rendered protection against cadmium chloride induced 

testicular damage in Swiss albino mice 

Preeti SINGH * , Kanchan DEORA, Vandana SANKHLA, Priya MOGRA 

Department of Zoology, College of Science, M.L.S. University, Udaipur-Rajasthan, 313001 India. 

(* author for correspondence; priti1960@yahoo.co.in ) 

Received: 04 August 2011; Accepted: 01 November 2012 

Abstract 

Fertility interference, regulation and control have become a matter of global concern in order to maintain adequate, 

sustainable and healthy population. Cadmium is known to interfere with reproductive physiology and adversely 

affects the process of spermatogenesis, whereas curcumin is known to be a potent, protective herbal derivative, 

which renders protection at the physiological, metabolic and cellular levels against numerous toxicants. In the 

present research, four groups of Swiss albino mice, each group consisting of six mice, were treated with cadmium 

chloride and curcumin. Group 1 was the control group, where mice were administered only vehicle. In the second 

group, mice were administered only curcumin. In the third group mice were administered single oral dose of CdCl2, 

50mg/kg/animal/day, for a day and were left for 15 days. The fourth group was pre-treated with curcumin 

(10mg/animal/day) for 15 days and on the 16 th day they were administered with single oral dose of CdCl2 

(50mg/kg/animal). In animals administered only cadmium, significant perturbations were observed in the process of 

spermatogenesis. In the seminiferous tubules there is loss of cellular contact and associations, as manifested by loss 

of germ cells. In organisms pre-treated with curcumin, marked decline in histopathological damage was observed, 

where the loss of germ cells was not so pronounced. Hence, the present research categorically elucidates the 

protective effect of curcumin against a single high dose of cadmium chloride induced perturbation in the process of 

spermatogenesis . 

Keywords: Curcumin, cadmium chloride, testicular damage, spermatogenesis, reproduction 

Özet 

Zerdeçal Swiss albino farelerde kadmiyum klorür ile indüklenmiş testiküler hasara karşı 

koruma sağlar 

Fertilitenin engellenmesi, düzenlenmesi ve kontrolü, syeterli, devamlı ve sağlıklı bir populasyonun sağlanması için 

dünyanın ilgilendiği bir sorun haline gelmektedir. Kadmiyumun üreme fizyolojisini engellediği ve spermatogenez 

sürecini ters olarak etkilediği bilinirken, fizyolojik, metabolik ve hücresel, seviyelerde pek çok toksik maddeye karşı 

koruyucu olan zerdeçalın güçlü, koruyucu bir bitki türevi olduğu bilinmektedir. Bu araştırmada, her bir grupta altı 

fare bulunan dört grup Swiss albino fareye kadmiyum klorür ve zerdeçal uygulanmıştır. Sadece distile su verilen 

Grup1, kontrol grubunu oluşturmaktadır. İkinci grupta farelere sadece zerdeçal verilirken üçüncü gruptaki farelere 

bir gün için 50mg/kg/hayvan/gün CdCl2 tek doz oral olarak uygulanmış ve 15 gün boyunca beklenmiştir. Dördüncü 

gruba önceden 15 gün boyunca (10mg/hayvan/gün) zerdeçal uygulanmış ve 16. günde farelere tek doz oral olarak 

50mg/kg/hayvan CdCl2 uygulanmıştır. Sadece kadmiyum uygulanan hayvanlarda spermatogenez sürecinde belirgin 

bir düzensizlik gözlenmiştir ve germ hücre hasarıyla açıkça gösterildiği gibi seminifer tübüllerde hücresel iletişim ve 

birliktelik kaybı gözlenmiştir. Önceden zerdeçal uygulanan organizmalarda germ hücre hasarının bildirilmediği 

yerlerde histopatolojik hasarlarda belirgin bir düşüş görülmüştür. Bunun sonucu olarak bu araştırma çalışması 

yüksek tek doz kadmiyum klorürün spermatogenez sürecindeki düzensizliği indüklemesine karşın, zerdeçalın 

koruyucu etkisini kategorik olarak açığa kavuşturmaktadır. 

Anahtar Kelimeler: Zerdeçal, kadmiyum klorür, testiküler hasar, spermatogenez, üreme

32 Preeti SINGH et al. 

Introduction 

In order to maintain adequate, sustainable and 

healthy population; fertility interference, regulation 

and control have become a matter of global 

concern. Exposure to metals is a common 

phenomenon due to their environmental 

pervasiveness. Some metals are essential for life, 

others have unknown biological functions, either 

favorable or toxic, and some others have the 

potential to cause toxicity (Col et al., 1999; Benoff 

et al., 2000; Suwazono et al., 2000). Overexposure 

of metals is in fact, one of the oldest environmental 

problems since they are widely distributed in the 

environmental workplace. Heavy metals are 

persistent environmental contaminants since they 

cannot be degraded or destroyed easily. These are 

chemical elements capable of spreading in the 

environmental compartments and circulating 

between them. These metals are emitted in to the 

atmosphere with the composition of fine particles 

or in the gaseous form and are transported by 

atmospheric fluxes to considerable distances where 

they enter ecosystems of remote regions. However, 

many heavy metals are urgently necessary for 

functioning of the human body and other living 

organisms in small amounts and belong to the range 

of nutrients. Others, when passed on to the living 

organisms cause poisoning or death (Danielyan, 

2010). Some toxic heavy metals are cadmium (Cd), 

arsenic (As), nickel (Ni), mercury (Hg), lead (Pb), 

zinc (Zn), chromium (Cr) etc. A substantial number 

of couples seek fertility treatment due to poor 

semen quality and there is evidence in the literature 

that male reproductive function seems to have 

deteriorated considerably in the past four-five 

decades due to multifaceted reasons being 

psychological, physical , physiological, or due to 

the effect of certain hazardous substances. One of 

the hazardous substances is cadmium, the 48 th 

element in the periodic table with an atomic weight 

of 112.4 and is present in all components of our 

environment viz. air, water and soil. It is used in 

various industrial processes as an anti-corrosive 

agent stabilizer in PVC products, as a color 

pigment, and in fabrication of nickel-cadmium 

batteries (Friberg et al., 1974; Fox, 1983; Elinder, 

1985; Morrow, 1990). It serves no physiological 

function within the mammalian system. The 

Agency for Toxic Substances and Disease Registry 

(ATSDR) has listed cadmium as number 7 in its top 

20 list of hazardous substances and International 

Agency for Research on Cancer (IARC) has 

classified cadmium as a group 1 carcinogen. It has 

extremely long biological half-life in mammals, 

which is estimated to be about 17 years or longer in 

humans (Nordberg, 1972; IARC, 1992) 

Cadmium is highly toxic to various biological systems, 

e.g. kidney (Friberg et al., 1974; Buchet et al., 1980; 

Goyer, 1991), male and female reproductive systems 

(Ferm and Carpenter, 1967; Massanyi et al., 2007; Wu et 

al., 2008; Monsefi et al., 2010), brain (Beton et al., 1966; 

Taylor et al., 1984; Bernard and Lauwerys,1986), 

gastrointestinal tract (Sugawara and Sugawara, 1974), 

liver , circulatory system (Stowe et al., 1972) and skeletal 

system (Kawamura et al., 1978; Blumenthal et al., 1995; 

Staessen et al.,1999). Due to the rapid industrialization and 

overgrowing urbanization, the toxic effects of cadmium on 

male reproduction is to be assessed and monitored and an 

effort has to be made to check, counter balance or nullify 

its toxicity . 

India has a rich history of using plants for 

medicinal purposes. Turmeric derived from Curcuma as a 

medicine is used as home remedy for various diseases 

(Ammon and Wahl, 1991; Eigner and Scholz, 1999). 

Curcumin has been considered as a potent healing herbal 

formulation, a strong antioxidant, which has been 

considered to be more than three hundred times more 

potent than vitamin E (Rao et al., 1982; Dikshit et al., 

1995). Curcumin is also reported to have anti-bacterial, 

anti-amoebic, antifungal, anti-viral and anti-HIV activities 

(Ammon et al., 1992; Azuine and Bhide, 1992; Ruby and 

Kuttan, 1995 and Mortellini et al., 2000). 

Hence, in the present study an effort has been made to 

assess and monitor cadmium-induced reproductive toxicity 

as after one single chance exposure and to observe whether 

curcumin, derived from Curcuma longa has the potential 

to protect and prevent testes from such toxicity. 

Materials and methods 

32-50 days old adult Swiss albino mice, weighing around 

30-40 g, were maintained in plastic cages under controlled 

lighting conditions (12 h light/12 h dark regime), relative 

humidity (50 ± 5%) and temperature (37 ± 2°C). The 

animals were fed on standard mice feed. Food and water 

were given ad libitum. Each batch comprised of 6 mice 

and their dose protocol was as follows- 

Group 1 - Mice were administered the vehicle (distilled 

water) for 16 days. 

Group 2- Mice were administered curcumin 10mg/animal 

for 16 days. 

Group 3- Mice were administered single oral dose of 

CdCl2 50mg/kg/animal/day for a day and left for 15 days. 

Group 4- Mice were pretreated with curcumin 

(10mg/animal/day) for 15 days and on the 16 th day mice 

were administered with single oral dose of CdCl2 

(50mg/kg/animal). 

Twenty-four hours after administration of the last dose, 

control and experimental animals were sacrificed. Testes 

were excised and subsequently fixed in Bouins solutions. 

After fixation testes were processed, wax blocks were 

made. Wax sections were cut and slides were prepared,

then stained in haematoxylin and eosin for 

histopathological studies (Kiernan, 2008). 

For statistical evaluation of significance, 100 

seminiferous tubules (‘a’ and ‘c’), per group were 

assessed and X 2 (Chi Square) test was conducted 

using the formula as per the two by two table. 

Results 

In the present study the testes of cadmium and 

curcumin treated animals were assessed using the 

following parameters: Changes in morphology, 

testicular pathology, and cytostatic and cytotoxic 

changes in the germ and Leydig cells. 

The testes of control group mice administered only 

vehicle showed normal pathology with distinct 

seminiferous tubules undergoing different stages of 

spermatogenesis. The interstitium was compact 

with distinct Leydig cells (Fig.1). Spermatogonial 

mother cells, primary and secondary spermatocytes, 

maturing spermatids and spermatozoons embedded 

in Sertoli cells were clearly visible (Fig.2). 

Histopathological evaluation of only curcumin 

treated mice testes showed normal structures 

similar to control group. Testes of the cadmium 

treated animals exhibited hemorrhage of its 

vasculature, but the overall shape was not altered. 

Seminiferous tubules appeared to lose their typical 

spherical shape and tunica propria manifested 

thickening and was irregularly and randomly 

broken at places. Leydig cells were entrapped in the 

degenerated interstitium (Fig. 3). There was general 

derangement of morphology of spermatogonia, 

Curcumin protects against cadmium chloride 33 

where ‘b’ the Observed Frequency for category ‘a’ 

‘d’ is the Expected Frequency in the corresponding 

category ‘c’ 

This experimental study was done after taking approval 

from the Institutional Animal Ethics Committee 

(No.Cs\Res\07\759). 

a b a+b 

c d c+d 

a+c b+d N 

; 

X 2 = N (ad-bc) 2 

(a+c ) ( b+d) ( a+b) (c+d) 

spermatocytes and differentiating spermatids in the 

seminiferous tubules (Fig. 4). In most of the peripheral 

seminiferous tubules, the germ cells were seen to break 

free end appeared in the lumen as puffs (Fig. 5). The cell 

types which appeared to be most affected were 

spermatocytes and spermatids. Tubular lumens were filled 

with degenerated germ cells and multinucleated spermatid 

aggregates (Fig. 3). Vacuolization of the seminiferous 

epithelium was also observed (Fig. 6). The results show 

that a single dose of cadmium causes a sudden increase in 

testicular damage, apparently overpowering this tissue’s 

natural defenses. Also, most of the seminiferous tubules of 

testes in this group showed complete absence of primary 

spermatocytes, secondary spermatocytes, spermatids and 

spermatozoa and loss of spermatogenesis process (Fig. 6) 

in comparison with normal structure of seminiferous 

tubules in control mice. The seminiferous tubules of 

experimental group animals pre-treated with curcumin for 

15 days and cadmium chloride on 16 th day showed very 

slight histopathological damage in the peripheral tubules 

and the inner tubules appeared to be normal showing all 

stages of spermatogenesis viz. spermatoginal mother cells, 

primary and secondary spermatocytes, maturing 

spermatids and spermatozoons embedded in Sertoli cells 

(Fig.7 and 8).


Figure 1. 1) Photomicrograph of testis of control group mice administered only vehicle. Normal seminiferous 

tubules (ST) and Leydig cell (LC) are clearly visible (20X). 2) Testis of control group mice administered only 

vehicle. Seminiferous tubule with distinct spermatogonial mother cells (SMC), primary spermatocyte (PS), 

secondary spermatocytes (SS), maturing spermatids (MS) and spermatozoa (S) are seen (40X). 3) Testis of cadmium 

chloride (50mg/kg) treated group mice. Degenerate seminiferous tubules(ST) are clearly visible (20x). 4) Testis of 

cadmium chloride(50mg/kg) treated group mice. Degenerated germ cells in lumen of seminiferous tubules are 

clearly evident (40x). 5) Testis of cadmium chloride(50mg/kg) treated mice showing exfoliated germ cells(GC) in 

tubular lumen (100x). 6) Testis of cadmium chloride (50mg/kg) treated mice. Seminiferous tubules are left with only 

vacuolised spermatogonial mother cells (SMC) and Sertoli cell (SC) (100x). 7) Testis of group pre-treated with 

curcumin(10mg/kg for 15 days) and then administered cadmium chloride(50mg/kg). Seminiferous tubules (ST) 

showing stages of spermatogenesis and pyknotic nuclei in Leydig cells (LC) are clearly evident (40x). 8) Testis of 

group pre-treated with curcumin (10mg/kg for 15 days) and then administered cadmium chloride(50mg/kg). 

Maturing spermatids (MS) and adhered germ cells are visible (100x)

Discussion 

The management of infertility problems is the need 

of time. The importance of drugs from plant origin, 

as fertility regulating agents for the males has long 

been recognized. Medicinal plants present a 

repertoire capable of providing varied constituents 

which could be helpful in infertility management. 

Curcumin, a potent antioxidant compound derived 

from turmeric, has been used for centuries as a 

natural dye, seasoning and medicine (Huang et al, 

1988). In Ayurveda, a 5000 year old system of 

medicine originating in India, curcumin in turmeric 

has been used to treat dozens of common 

conditions. Hence, in the present experiment an 

effort has been made to observe ameliorative effect 

of curcumin on testicular damage induced by 

cadmium chloride. The evidence of the past twenty 

years have shown a disturbing trend in male 

reproductive health hazards due to careless use of 

certain chemicals cadmium being one of them 

,which causes detrimental effects on different 

organs. Broad-spectrum irreversible toxic actions of 

cadmium at the cellular and molecular levels have 

been observed mainly on the reproductive system 

of humans and experimental animals, by a number 

of researchers (Batra et al., 2001; Chowdhury, 

2004; Massanyi et al., 2007; Burukog and Bayc, 

2008; Almansour, 2009; Obianime and Roberts, 

2009). Cadmium has also been reported to cause 

testicular damage in Leydig cells and seminiferous 

tubules (Massanyi et al., 2007; Burukog and Bayc, 

2008; Almansour, 2009; Obianime and Roberts, 

2009; De Souza Predes et al., 2009 and Al attar 


2011). These observations are similar to the results of the 

present study, which has revealed that cadmium chloride 

induced severe alterations in histopathological profile of 

testes as manifested by disarrangement of morphology of 

Leydig cells and 100% seminiferous tubular damage 

within which spermatogonia, spermatocytes and 

differentiating spermatids were severely affected and were 

lost in the luminal space of the tubules culminating in total 

suppression of spermatogenesis. There was induction of 

azoospermia. The results of present experiment also 

correlate well with other reports where cadmium has been 

shown to induce testicular damage in rat and mice (Gunn 

et al., 1970., Herranz et al., 2010; and Mathur et al., 

2010). Our observations are also similar to the 

observations of Monsefi et al., 2008; Chowdhury, 2009 

and Adamkovicova et al., 2010 where, similar to our 

results cadmium chloride has shown to cause rapid 

testicular edema, haemorrhage, necrosis and degeneration 

of testicular membrane tissue. Adaikpoh and Obi (2009) 

have reported that cadmium increased total cholesterol 

levels in the testes and prostate of rats, which affects 

Leydig cell function negatively. In the present 

experimental design administration of curcumin protected 

testis of mice exposed to cadmium as evidenced by 

appearance of about 75% normal structures of 

seminiferous tubule of testis showing the ongoing process 

of spermatogenesis as evidenced by the presence of 

spermatids and spermatozoon, and lack of exfoliated cells 

in the luminal space. Additionally, the present study 

indicated that the exposure to heavy metals produce 

testicular damage, which leads to spermatogenic arrest 

which is rectified and prevented by curcumin intake. 

Table 1. Alterations in the seminiferous germ cells of Swiss albino mice challenged with cadmium chloride and 

curcumin 

S. No. 

Experimental Protocol 

1. Control (distilled water as a 

vehicle for 16 days) 

2. Curcumin (10 mg/animal/day 

for 16 days) 

3. Cadmium Chloride(50 

mg/kg/animal/day for 15 days) 

4. Curcumin (10 mg/animal/day 

for 16 days) +Cadmium 

Chloride(50 mg/kg/animal/day 

for 15 days) 

Types Of Germ Cells Present (P) And Exfoliated (E) 

SMC S C P Sp S Sp S S Z Se C 

P P P P P P P 

Total 

number of 

germ cell 

layers 

9-11 

P P P P P P P 9-11 

P P E E E E P 2-3* 

Χ 2 =4.241 

P=0.04 

P P E E P E P 6-10 

Χ 2 =0.204 

P=0.65 

SMC – Spermatogonial Mother Cells; SC – Spermatogonial cells ; PSp- Primary Spermatocytes; SSp- Secondary 

Spermatocytes; S- Spermatids; SZ- Spermatozoa; SeC- Sertoli Cells *Χ 2 significant at P ≤0.05


References 

Adaikpoh M A and Obi F O. Prevention of 

cadmium –induced alteration in rat testes and 

prostrate lipid patterns by ɑ-tocopherol. African 

Journal of Biochemistry. 3 (10): 321-325, c 

2009. 

Adamkovicova M, Toman R, and Cabaj M. 

Diazinon and cadmium acute testicular toxicity 

in rats examined by histopathological and 

morphometrical methods. Slovak J Anim Sci. 

43. (3): 134-140, 2010. 

Almansour M I. Histological alterations induced by 

lead in the testes of the quail Coturnix coturnix. 

Res. J. Environ. Toxicol. 3:24-30, 2009. 

Ammon HPT and Wahl M A. Pharmacology of 

Curcuma longa. Planta Med.57: 1–7, 1991. 

Ammon HPT, Anazodo MI, Safayhi H and Dhawan 

BN. Curcumin a potent inhibitor of leukotriene 

B4 formation in rat polymorphonuclear 

neutrophils (PMNL). Planta Med. 67: 1-6, 

1992. 

Al-Attar AM. Antioxidant effect of vitamin E 

treatment on some heavy metals-induced renal 

and testicular injuries in male mice. Saudi 

Journal of Biological Sciences. 18, 63–72, 

2011. 

ATSDR (Agency for Toxic Substances and Disease 

Registry). Toxicological profile for Cadmium. 

ATSDR / US department of Health and Human 

Services, Atlanta/, US, 1999. 

Azuine M, Bhide S. Chemo preventive effect of 

turmeric against stomach and skin tumors 

induced by chemical carcinogens in Swiss mice. 

Nutr Cancer. 17:77-83,1992. 

Batra N, Nehru B, and Bansal M P. Influence of 

lead and zinc on rat male reproduction at 

‘biochemical and histopathological levels’. J 

Appl Toxicol. 21: 507–512,2001. 

Benoff S, Jacob A and Hurley I R. Male infertility 

and environmental exposure to lead and 

cadmium. Hum Reprod. 6: 107-21. Update 

2000. 

Bernard A and Lauwerys R. Effects of cadmium exposure 

in humans. In: Foulkes, E.C. ed. Handbook of 

experimental pharmacology. 80:135-177, 1986. 

Beton DC, Andrews GS, Davies HJ, et al. Acute cadmium 

fume poisoning. Five cases with one death from renal 

necrosis. Br J Ind Med. 23:292-301,1966. 

Blumenthal NC, Cosma V, Skyler D, LeGeros J, and 

Walters M. The effect of cadmium on the formation 

and properties of hydroxyl apatite in vitro and its 

relationto cadmium toxicity in the skeletal system. 

Calcif Tissue Int. 56 (4): 316-22,1995. 

Buchet JP, Roels H, Bernard A, et al. Assessment of 

renal function of workers exposed to inorganic lead, 

cadmium or mercury vapor. J Occup Med. 22: 741- 

748,1980. 

Burukoglu D and Baycu C. Protective effects of zinc on 

testes of cadmium-treated rats. Bull Environ Contam. 

81: 521–524, 2008. 

Chowdhury AR. Recent Advances in Heavy Metals 

Induced Effect on Male Reproductive Function-A 

Retrospective. Al Ameen J Med Sci. 2(2): 37 -42, 

2009. 

Chowdhury AR. Male reproductive toxicity-new 

perspective in life science. Chatterjee P and Chanda 

AK (Ed). Life Science in Modern Perspective. 

University of Calcutta. 97–10,2004. 

Col M, Col C, Soran A, et al. Arsenic related Bowen’s 

disease, Palmer keratosis, and skin cancer. Environ 

Health Perspect. 107:687-9,1999. 

Danielyan A. The problem of pollution with heavy metals 

and possible risks related to that in watersheds with the 

developed metallurgical industry. In: BALWOIS 2010 

Conference. Ohrid, Republic of Macedonia. pp. 1–9, 


De Souza Predes F , Diamante MAS and Dolder H. 

Testis response to low doses of cadmium in Wistar 

rats. Int J Exp Path, 91: 125–131,2009. 

Dikshit M, Rastogi L, Shukla R and Srimal RC. 

Prevention of ischaemia-induced biochemical changes 

by curcumin and quinidine in the cat heart. Indian J 

Med Res. 101: 31 - 35, 1995.

Eigner D and Scholz D. Ferula asa-foetida and 

Curcuma longa in traditional medicinal 

treatment and diet in Nepal. J Ethnopharmacol. 

67: 1–6,1999. 

Elinder CG. Cadmium: uses, occurrence and intake. 

In: Cadmium and Health: A Toxicological and 

Epidemiological Appraisal. Vol I: Exposure, 

Dose, and Metabolism. Effects and Response 

(Friberg L, Elinder CG, Kjellstrom T, Nordberg 

GF, eds). Boca Raton, FL: CRC Press, 23-64, 

1985. 

Ferm VH and Carpenter SJ. Teratogenic effect of 

cadmium and its inhibition by zinc. Nature. 

216: 1123, 1967. 

Fox MRS. Cadmium bioavailability. Federation 

Proc. 42: 1726-1729, 1983. 

Friberg L, Piscator M, Nordberg G, and Kjellström 

T. Cadmium in the environment, 2nd ed., 

Cleveland, Ohio, CRC Press. 248, 1974. 

Goyer R. Toxic effects of metals. In: Amdur, MO, 

JD Doull, C.D. Klaassen, Eds. Casarett and 

Doull's Toxicology. 4th ed. Pergamon Press, 

New York. 623-680, 1991. 

Gunn SA, Gould TC and Anderson WAD. 

Maintenance of the structure and function of the 

cauda epididymidis and contained spermatozoa 

by testosterone following cadmium-induced 

testicular necrosis in the rat. J reprod Fert. 

21:443-448,1970. 

Herranz LM, Tebaz F, Martin R, et al. Quantitative 

Changes in rat Seminiferous Epithelium After 

Chronic Administration of low Doses of 

Cadmium and Zinc: A sterological study. The 

open Andrology Journal. 2:27-36, 2010. 

Huang M, Smart RC, Wong C, and Conney AH. 

Inhibitory Effect of Curcumin, Chlorogenic 

Acid, Caffeic Acid, and Ferulic Acid on Tumor 

Promotion in Mouse Skin by 12-O- 

Tetradecanoylphorbol-13-acetate. CANCER 

RESEARCH 48, 5941-5946,1988. 

International Agency for the Research on Cancer 

(IARC). Cadmium in the human environment: 

toxicity and carcinogenicity. IARC Scientific 

publications. No 118. Lyon.1992. 


Kawamura J, Yoshida O, Nishino K and Itokawa Y. 

Disturbances in kidney functions and calcium and 

phosphate metabolism in cadmium-poisoned rats. 

Nephrology. 20:101-110,1978. 

Kiernan JA. Histological and Histochemical Methods: 

Theory and Practice. 4th ed. Bloxham, UK: Scion, 

(2008) 

Massanyi P, Lukac N, Slivkova J, et al. Mercuryinduced 

alterations in rat kidneys and testes in vivo. J 

Environ Sci Health A Tox Hazard Subst Environ 

Eng. 42:865–870,2007. 

Mathur N, Pandey G and Jain GC. Male Reproductive 

toxicity of Some Selected Metals :A Review Journal of 

biological sciences.10(5):396-404,2010. 

Kamel MM , Abd El Razek AH, Ahmed KA and Kamel 

GM. Exposure of Adult Male Rats to Cadmium: 

Assessment of Sexual Behaviour, Fertility, Aggression 

as well as Anxiety like Behaviour with Special 

Reference to Biochemical and Pathological 

Alterations.Life Science Journal, 2011;8(2) 

Monsefi M, Alaee S, Moradshahi A, and Rohani 

L.Cadmium-Induced Infertility in Male Mice., 2008. 

Monsefi M, Alaee S, Moradshahi A, and Rohani L. 

Cadmium-induced infertility in male mice. Environ 

Toxicol. 25 (1):94-102, 2010. 

Morrow H. Cadmium (Cd), Metals Handbook, 10th 

Edition, Volume 2, ASM International, Metals Park, 

Ohio, 1990. 

Mortellini R, Foresti R, Bassi R, and Green C J. 

Curcumin, an antioxidant and anti-inflammatory agent, 

induces heme oxygenase-1 and protects endothelial 

cells against oxidative stress. Free Radic Biol Med. 28: 

1303-1312, 2000. 

Nordberg G. Cadmium metabolisms and toxicity. Environ 

Physiol Biochem. 2: 7-36, 1972. 

Obianime AW and Roberts II . Antioxidants, cadmiuminduced 

toxicity, serum biochemical and the 

histological abnormalities of the kidney and testes of 

the male Wistar rats. Niger. J Physiol Sci. 24: 177–185, 

2009. 

Rao TS, Basu N and Siddiqui H. Anti-inflammatory 

activity of curcumin analogues. Indian J Med Res.


75:574-8, 1982. 

Ruby AJ, and Kuttan G. Anti-tumour and 

antioxidant activity of natural curcuminoids. 

Cancer Lett .94:79-8, 1995. 

Staessen J A, Roels H A, Emelianov D, et al. 

Environmental exposure to cadmium, forearm 

bone density, and risk of fractures: Prospective 

Population study. Lancet, 353:1140-1144, 1999. 

Stowe H D, Wilson M and Goyer R A. Clinical 

and morphological effects of oral cadmium 

toxicity in rabbits. Arch Pathol. 94: 389-405, 

1972. 

Sugawara C and Sugawara N. Cadmium toxicity 

for rat intestine, especially on the absorption of 

calcium and phosphorous. Jpn J Hyg. 28: 511-516, 

1974. 

Suwazono Y, Kobayashi E, Okubo Y, et al. Renal effects 

of cadmium exposure in cadmium non polluted areas in 

Japan. Environ Res. 84:44-45, 2000. 

Taylor A, Jackson MA, Patil D, et al. Poisoning with 

cadmium fumes after smelting lead. Br Med J. 

288:1270-1271, 1984. 

Wu HM, Lin-Tan DT, Wang ML, et al. Cadmium level in 

seminal plasma may affect the pregnancy rate for 

patients undergoing infertility evaluation and 

treatment. Reproductive Toxicology. 25(4), 481-484, 

2008.




Study of Klebsiella pneumoniae isolates with ESBL activity, 

from ICU and Nurseries, on the island of Mauritius 

Salima Khurshid MUNGLOO-RUJUBALI 1 , Mohamed Iqbal ISSACK 2 , Yasmina 

JAUFEERALLY-FAKIM 1* 

1 

Department of Biotechnology, University of Mauritius, Reduit, Mauritius. 

2 

Victoria Hospital, Ministry of Health and Quality of Life, Mauritius. 

(* author for correspondence; yasmina@uom.ac.mu) 

Received: 11 August 2011, Accepted: 2 November 2012 

Abstract 

Klebsiella pneumoniae with extended spectrum beta lactamase activity circulate widely among 

nosocomial environments. Isolates were collected from hospitalised patients in ICU and nursery units 

on the island of Mauritius, over a two year period. They were tested for their resistance/susceptibility 

to various antibiotics using the double disc diffusion assay. Following the API biochemical assay their 

genus/species were confirmed. Their genetic diversity was determined using RAPD, REP and BOX- 

PCR. Among fifty isolates, most were highly diverse by these methods with a clustering into three 

groups. No correlation was found among isolates of the same hospital or unit or with dates of 

collection. Sequence analysis of parts of the TEM, SHV and CTX-M beta lactamase genes confirmed 

the beta lactamase domain and the presence of SHV-11 and SHV-28. CTX-M 15 was found in some 

isolates. Furthermore, integrase was PCR-amplified from a few isolates, showing the presence of an 

integron-borne gene cassette. This study shows diverse clones of Klebsiella pneumoniae circulating 

with ESBL activity. 

Keywords: Klebsiella pneumoniae, ESBL, TEM, SHV, genetic diversity, beta lactamase 

Özet 

Mauritius adasında kreş ve yoğun bakım ünitesinden elde edilen ESBL aktiviteli 

Klebsiella pneumoniae izolatlarının çalışması 

Geniş spektrumlu beta laktamaz aktivitesi olan Klebsiella pneumoniae nosokomiyal çevrelerde büyük 

ölçüde bulunmaktadır. İzolatlar, Mauritius adasındaki yoğun bakım ünitesinde yatan hastalardan ve 

kreşlerden iki yıl boyunca toplanmıştır. Çift disk difüzyon testi kullanılarak izolatların çeşitli 

antibiyotikler için dirençleri/duyarlılıkları incelenmiştir. Sonrasında API biyokimyasal test ile cins/tür 

teyidi yapılmıştır. Genetik farklılıkları RAPD, REP ve BOX-PCR kullanılarak belirlenmiştir. Test 

edilen elli kadar izolatın çoğu, üç grupta sınıflandırılan bu metodlar tarafından oldukça farklı 

bulunmuştur. Aynı hastane, birimler, ya da aynı tarihlerde toplanan izolatlar arasında herhangi bir 

korelasyon bulunmamıştır. TEM, SHV ve CTX-M beta laktamaz genlerinin dizi analizleri beta 

laktamaz domeynini ve SHV-11 ile SHV-28 varlığını onaylamıştır. Bazı izolatlarda CTX-M 15 

bulunmuştur. Bundan başka, birkaç izolattan PCR-amplifikasyonu yapılmış olan integraz ile, integronkaynaklı 

gen kasetinin bulunduğu gösterilmiştir. Bu çalışma ESBL aktivitesiyle dolaşan Klebsiella 

pneumoniae’nın farklı klonlarını göstermektedir. 

Anahtar Kelimeler: Klebsiella pneumoniae, ESBL, TEM, SHV, genetik çeşitlilik, beta-laktamaz

40 Salima Khurshid MUNGLOO-RUJUBALI et al. 

Introduction 

Klebsiella pneumoniae is a very common source of 

infections in hospital environments and are 

particularly of threat to immune-compromised 

patients. It is a gram-negative bacillus of the 

Enterobacteriaceae family. It is mostly treated with 

beta lactams and fluoroquinolones, but over the 

years the bacteria have accumulated significant 

resistance to many of those. Beta lactamases, 

encoded in bacterial sequences, are able to 

efficiently hydrolyse the beta lactams of many 

antibiotics, thus rendering them inactive. A large 

number of studies have demonstrated their wide 

occurrence and rapid spread during the era of 

widespread antibiotic use for medical applications 

culminating in the appearance of extended 

spectrum beta lactamases (ESBLs), which are 

resistant to third generation cephalosporins 

(Nteimam, 2005). 

The mode of action of beta lactamases relies on 

their ability to bind to enzymes of the bacterial cell 

wall biosynthesis process, thereby killing the cells. 

They have an active site serine residue. They act on 

peptidases that cross-link the penultimate D-alanine 

of one peptidoglycan unit to a free amino acid of 

diamino pimelic acid (gram negative) or a lysine 

residue (Gram positive). The D-alanine-D-alanine 

substrate of the peptidoglycan unit has a similar 

stereochemistry to the beta lactam moiety thus 

competing for binding at the active site of the 

peptidases. TEM and SHV beta lactamases were 

characterised first, followed by CTX-M. They are 

of the Class A enzymes (Ambler, 1980). According 

to Hall and Barlow (2004), TEM enzymes have 

experienced larger phenotypic evolution, than SHV 

and CTX-M. CTX-M ESBLs provide resistance to 

Cefotaxime, but usually not to Ceftazidime. The 

double disc synergy method using Cefotaxime and 

Ceftazidime for detection of ESBLs is the 

recommended one by the British Society for Anti 

Microbial Chemotherapy (BSAC). ESBLs can 

hydrolyse the so-called modern β-lactams that are 

cefotaxime, cefuroxime, aztreonam and 

ceftazidime. 

The last two decades have seen the appearance 

of a large number of mutant forms of beta 

lactamase genes from diverse organisms. Most 

importantly, there seems to be a positive selection 

for non-synonymous point mutations, which alter 

the binding affinity of the enzyme for its 

substrate. Key amino acid substitutions 

bring changes in the substrate and inhibitor 

binding affinities. Sequence comparisons of 

the genes have identified the homology 

within the TEM or within the SHV groups 

and revealed codon alterations which lead to 

different phenotypic profiles. Structural 

comparison is useful in understanding the 

outcome of nucleotide changes on the 3dimensional 

features of the protein. Alleles 

TEM 1A and 1F differ by silent mutations; 

however derivative variants can arise by 

further point mutations or by crossing-over 

between two alleles. Examples of 

substitutions can be found at www.lahey.org 

which lists all the reported variants and their 

codon differences. Recent work has 

identified key amino acid replacements 

which are responsible for phenotypic 

changes. Mutations that cause the ESBL 

phenotype are known to be R164H (Arg to 

His), R164S (Arg to Ser) and G238S (Gly to 

Ser). TEM-68, which has a decreased 

sensitivity to inhibitors, has a R275L (Arg to 

Leu) replacement compared to TEM-1. 

Similarly other mutations lead to modulating 

effects such as increasing or decreasing 

MIC’s (minimum inhibitory concentrations). 

β -lactam antibiotics penetrate the outer 

membrane of many gram-negative bacteria 

through porins, hence antibiotic resistance 

can also result from porin loss or deficiency 

(Nikaido, 1989). Several reports have 

demonstrated that beta lactamase expression 

is not the only form of resistance in ESBL 

bacteria. Other mechanisms such as porin 

loss have been described in many species 

(Tsu-Lan et al., 2001). 

An understanding of the bacterial 

populations carrying ESBLs is essential to 

characterise the molecular features 

associated with the genes for β-lactamases 

and understand their evolution. This study 

describes the characterisation of Klebsiella 

pneumoniae isolates from hospital sources 

to assess their ESBL phenotype and identify 

the corresponding gene sequences. The 

genetic diversity of the strains carrying this 

phenotype was determined to gauge the

extent of occurrence of the ESBL feature. 


Isolation and characterisation of K. pneumoniae 

About fifty isolates of K. pneumoniae were 

obtained between March 2003 and January 2005 

from six different hospitals (Table 1). These were 

collected by the Central Analytical Laboratory of 

Table 1. List of K.pneumoniae isolates 

K. pneumonia isolates with ESBL activity 41 

the Ministry of Health, Mauritius. They 

were pre-selected for their ESBL phenotype 

by double disk assay. An enlargement of the 

inhibition zone of 5 mm in the presence of 

clavulanic acid is a confirmation of an ESBL 

presence. The isolates were characterised 

biochemically using the Analytical Profile 

Index (API) system. 

ISOLATE DATE ISOLATED SEX AGE HOSPITAL WARD SOURCE 

SS01 2.06.04 M 36 A ICU BLOOD 

SS02 28.08.04 M 37 A ICU BLOOD 

SS03 11.11.04 F 5 DAYS D 2-3 N/A 

SS04 3.08.04 M 37 A ICU BLOOD 

SS05 9.11.04 F 73 B D4 N/A 

SS06 5.12.04 M NEWBORN A NURSERY BLOOD 

SS07 23.08.04 F 60 C MICU BLOOD 

SS08 27.01.04 F 69 C 1-3 N/A 

SS09 14.11.04 F 4 DAYS A NURSERY N/A 

SS10 26.03.03 NEONATES E NURSERY N/A 

SS11 9.11.04 M 15 DAYS C NICU RECTALS 

SS12 9.09.03 F 3 WEEKS C NICU N/A 

SS13 24.10.04 NEONATES D NURSERY N/A 

SS14 6.02.04 A NURSERY ENV(SINK) 

SS15 29.11.04 F 6 DAYS A NURSERY N/A 

SS16 23.06.04 M 29 B 04 BLOOD 

SS17 19.11.04 M 62 B D4 N/A 

SS18 20.10.04 M 11 B RDU VAS.CAT.FLUID 

SS19 14.02.04 F 2 C S21 N/A 

SS20 28.02.03 7 DAYS F N/A 

SS21 22.11.02 4 DAYS B NICU N/A 

SS22 3.06.04 M 40 A ICU URINE 

SS23 3.06.04 M 40 A ICU URINE


SS24 4.06.04 M 40 A ICU URINE 

SS25 29.10.03 M 59 ICU CSF 

SS26 19.09.04 M 53 D 4 N/A 

SS27 11.11.04 M 5 DAYS C NICU RECTALS 

SS28 27.10.03 M 67 ICU CSF 

SS29 23.01.04 F 15 A ICU N/A 

SS30 1.09.04 F 53 E DIALYSIS BLOOD 

SS31 31.07.04 M 50 C MICU ET-SECRETION 

SS32 26.11.04 F 11 DAYS A NURSERY BLOOD 

SS33 14.01.05 M 44 A 2-4 BLOOD 

SS34 19.02.04 F 61 E F69 BLOOD 

SS35 10.12.04 F 5 WEEKS D NURSERY N/A 

SS36 27.09.04 M 37 A 2-4 BLOOD 

SS37 26.11.04 F 2 DAYS NURSERY N/A 

SS38 14.01.05 M 57 E B1 BLOOD 

SS39 20.09.04 M 53 D 4 BLOOD-DIALYSIS 

SS40 22.10.03 M 50 C ICU BLOOD 

SS41 2.10.03 M 42 C N/A 

SS42 21.06.04 F 58 A 1-2 BLOOD 

SS 43 18.11.03 F 68 B ICU BURN UNIT N/A 

SS44 13.03.03 F 12 DAYS B NURSERY CSF 

SS45 27.09.03 F 56 C ICU BLOOD 

SS46 21.06.04 F 3 WEEKS D NURSERY BLOOD 

SS47 16.06.04 M 44 C MICU N/A 

SS48 4.10.04 C CARDIAC ICU ET SECRETION 

SS49 30.11.04 M 34 A ICU BLOOD 

SS50 29.07.04 M 34 D 1-3 BLOOD 

RDU: Renal Dialysis unit, NICU: Neurological intensive care unit, MICU: Medical Intensive care 

unit CSF: Cerebro spinal fluid , ET: endotracheal secretion; N/A: Not available 

Their sensitivity to the following antibiotics either 

alone or in the presence of clavulanic acid was 

assessed on Mueller-Hinton agar using the pairs of 

Oxoid combination discs: (ceftazidime-30 

µg and ceftazidime/clavulanate-30/10 µg; 

cefotaxime-30 µg and

cefotaxime/clavulanate - 30/10 µg; cefpodoxime-30 

µg and cefpodoxime/clavulanate-30/10µg; 

cefpirome-30 µg and cefpirome/clavulanate- 

30/10µg). 

BOX-PCR and RAPD PCR amplification 

For the BOX-PCR, the primer 5’- 

CTACGGCAAGGCGACGCTGACG-3’ (Martin et 

al, 1992) was used. PCR was carried out in a total 

reaction mixture of 25 µl, containing 50 mM buffer, 

2 mM MgCl2, 200 µM each deoxynucleoside 

triphosphate, 25 pmol of primer, 25 ng of template 

DNA and 1 U of Taq DNA polymerase . 

Amplifications were performed with a DNA 

thermocycler (BIO-RAD) as follows: 1 cycle of 95º 

C for 4 minutes, 30 cycles of 94º C for 30 s, 92º C 

for 30 s, 50º C for 1 minute, 65º C for 8 minutes 

and 1 cycle of 65º C for 8 minutes. The PCR 

Table 2. List of primer sequences 


products were run in 1.5 % agarose gel 

stained with EtBr and observed to score for 

markers. 

Similar reaction was set up for RAPD 

except that the annealing temperature was 

32º C. 

The gel banding patterns were scored and 

the data was analysed by NTSYS; and the 

tree was generated with Darwin 5.0. 

Amplification and sequence analysis of 

TEM, SHV and CTX-M genes 

Standard PCR reactions were done for the 

amplification of beta-lactamase genes using 

published primer sequences (Table 2). 

Products were purified after amplification 

and sequenced. Sequence results were 

manually checked and edited. 

Primer Name Primer Sequence Reference 

SHV A 5- ACT GAA TGA GGC GCT TCC-3 

SHV B 

SHV A1 

5- ATC CCG CAG ATA AAT CAC C-3 

5- TCA GCG AA AAC ACC TTG-3 

Babini & Livermore, 2000 

SHV A2 5 –TCC CGC AGA TAA ATC ACC A-3 

SHV A11 5- ATG CGT TAT ATT CGC CTG TG-3 

SHV A12 5- GTT AGC GTT GCC AGT GCT CG-3 

SHV S1 

5- TGG TTA TGC GTT ATA TTC GCC- 

3 

Gniadkowski et al., 1998 

SHV S2 5- GGT TAG CGT TGC CAG TGC T-3 

SHV B1 5-ATG CGT TAT ATT CGC CTG TG-3 

SHV B2 5- GTT AGC GTT GCC AGT GCT CG-3 

TEM D1 

5- GGG AAT TCT CGG GGA AAT 

GTG CGC GGA AC-3 

TEM D2 

5- GGG ATC CGA GTA AAC TTG GTC 

TGA CAG-3 

Bou et al., 2000 

TEM A1 5- TAA AAT TCT TGA AGA CG-3 

TEM A2 5- TTA CCA ATG CTT AAT CA-3 

CTX-M1 

CTX-M2 

5- CGC TTT GCG ATG TGC AG-3 

5- ACC GCG ATA TCG TTG GT-3 

Jungmin Kim et al., 2005 

INT 2F 

INT 2R 

5-TCTCGGGTAACATCAAGG -3 

5- AAGCAGACTTGACCTGA -3 

Mazel et al., 2000 

Sequence Analysis 

SHV, TEM and CTX-M homologue DNA 

sequences were identified with tblastx 

(www.ncbi.nlm.nih.gov/blast) search of the nonredundant 

National Center for Biotechnology 

Information (NCBI) sequence database. First of all 

the nucleotide sequence were converted into 

contigs using the following web page 

http://pbil.univ-lyon1.fr/cap3.php. Tblastx 

was carried out with the contigs in NCBI. 

The contigs were translated into amino 

acids by using the following program: 

http://www.biochem.ucl.ac.uk/cgi-

44 Salima Khurshid MUNNGLOO-RUJUUBALI 

et al. 

bin/mcdoonald/cgina2aaa.pl 

The aamino 

acid seequence 

with no stop coddon 

was seleected. 

This wwas 

then aliigned 

with tthe 

corresponnding 

sequence 

that blasteed 

well withh 

a 

low E-value. 

The aamino 

acid seequences 

of SSHV, 

TEM aand 

CTX-M and their hoomologs 

werre 

aligned with 

MultAliggn. 

Results 

Biochemmical 

characteerisation 

The API 20E system indicated thaat 

45g negatiive 

isolates wwere 

identifieed 

as Klebsiellla 

pneumoniaae, 

however these isolates could be classsified 

into thrree 

groups baased 

on the prrofile 

obtainedd: 

Group I: Profile 52157773 

Group II: : Profile 52153373 

Group IIII: 

Profile 52077773 

Group IVV: 


Group V: Profile 52557773 

Group VII: 


ESBL acctivity 

Four out of fifty isolatees 

were ESBLL 

negative. Thhey 

were isolates 

SS22, SSS42, 

SS45 and SS47. TThe 

differencee 

in the zone of inhibition was less thann 

5 

mm for each one oof 

them. Thee 

remaining 46 

isolates wwere 

confirmed 

as ESBL producers. 

The ddouble 

disc asssay 

revealed, tthat 

except for 

a 

few, mosst 

of the isolaates 

produced evidence of an 

extended spectrum beta lacctamase; 

with 

Cefot taxime, isolates 

SS 35 andd 

SS 42 were 

susce eptible with a zone of iinhibition 

of 

about t 20 mm and 25 mm, resppectively, 


an in ncrease of thiss 

zone by > 5 mm in the 

prese ence of clavullanate. 

Three isolates, SS 

17, SS S 31 and SSS 

42 were suusceptible 

to 

Cefta azidime with nno 

increase inn 

diameter in 

the presence of inhibiitor. 

With 

Cefpo odoxime, SS 442, 

SS 45 andd 

SS 47 were 

susce eptible, whilee 

with Cefpirrome 

SS 42 

and SS S 09 showedd 

some susceeptibility 


just a slight inccrease 

of 4 mm in the 

prese ence of inhibittor 

clavulanatte. 

Isolate SS 

42 wa as considered a non-ESBL. 

BOX X and RAPD PPCR 

BOX X-PCR is commonly used for 

fingerprinting 

baacterial 

genoomes 

using 

prime ers targeting repetitive elements in 

interg genic regionns. 

The oveerall 

results 

show wed that isolaates 

SS49, SSS42, 

SS45, 

SS43, 

SS44, SS48, , SS46, SS47, , SS50 which 

were isolated duriing 

the same year, but in 

differ rent hospitalss, 

were groupped 

into one 

cluste er (Figures 1, 2, 3). Isoolates 

SS42, 

SS44 4, SS45, SS477, 

SS48, SS449 

and SS50 

also shared s the samme 

API profilee 

i.e profile 1 

(Figu ures 2 and 5). 

Figure 1. 

DNA fingerrprint 

analysiss 

of K pneumooniae 

by BOX X-PCR. Lane 42: SS42, Lanne 

43: SS43, 

Lane 44: SS44, Lane 445: 

SS45, Lanne 

46: SS46, LLane 

47: SS47 7, Lane 48: SS48, 

Lane 49: 

SS49, Lane 

50: SS50. 

C: Control, HH: 

Hyperladdeer 

(11) Biolinne.

K. K pneumonia issolates 

with ESBL 

activity 45 

Figure 2. 

Dendogram generated froom 

BOX-PCRR 

based on Di ice similarity coefficient annd 

neighbour 

joining cllustering 

for tthe 

50 isolatess 

of Klebsiellaa 

pneumoniae e with a copheenetic 

correlattion 

(r) value 

of 0.95299. 

Figure 3. . RAPD fingeerprint 

of K. pneumoniae 

with 

primer OP PA12. Lane 1: SS01, Lane 22:SS02, 

Lane 

3: SS03, Lane 4: SS004, 

Lane 5: SS05, 

Lane6: SS06, Lane 7: 7 SS07, Lanee 

8: SS08, Laane 

9: SS09, 

Lane10: SS10, Lane 11: SS11, Laane12: 

SS12, Lane13: SS1 13, Lane14: SSS14, 

Lane 115: 

SS15. C: 

control, HH:Hyperladderr(11) 

Bioline

46 Salima Khurshid MUNNGLOO-RUJUUBALI 

et al. 

Figure 4. 

RAPD fingeerprint 

of K .ppneumoniae 

wwith 

primer OPB O 01. Lane442: 

SS42, Lanne 

43: SS43, 

Lane 44: SS44, Lane455: 

SS45, Lanee 

46: SS46, Laane47: 

SS47, Lane48: SS488, 

Lane 49: SSS49, 

Lane50: 

SS50.C: ccontrol, 

H:Hyyperladder(1) 

BBioline. 

Figure 5. 

Dendogram generated froom 

RAPD-PCRR 

based on Dice D similarity coefficient annd 

neighbour 

joining cllustering 

of RRAPD 

for the 550 

isolates of f Klebsiella pn neumonia. Forr 

both sets of data with the 

BOX andd 

RAPDs, the clustering of iisolates 

was nnearly 

the sam me, with three ddiscernable 

grroups.

TEM, SHHV 

and CTX-M 

amplificaation 


with ESBL 

activity 47 

Differentt 

size productss 

were obtaineed 

for each set 

of primers. The T TEM A1/ /A2 gave prodducts 

slightly 

longer thaan 

1 kb. The CCTX-M 

primeers 

amplified a product of 585 5 bp. Both ssets 

of SHV AA11 

and A12, 

and SHVV 

B1 and B2 ggave 

a producct 

of 865 bp. AAmplification 

n were detecteed 

for thirty seven 

isolates 

for SHV A11 and SHVV 

A12; twentyy 

two isolates for SHVB1 and a SHVB2, reespectively. 

AAmplification 

was achieeved 

with twenty-one 

isolaates 

for TEMM 

A1/A2 and twenty eight isolates for TTEM 

D1/D2. 

There weere 

only twelve 

isolates, whhich 

amplified with CTX-M M to give a product 

of 585 bpp. 

Figure 6. . Protein blastt 

of translated product fromm 

isolate SS11 with primer SSHV 

A11/A122 

Figure 7. . Alignment oof 

amino acid sequence fromm 

isolate SS11 

with SHV-228. 

The same wwas 

obtained 

with isolaate 

SS25. Amiino 

acid sequeence 

from isollate 

SS47 alig gned well withh 

CTX-M 15.


For one isolate, the presence of integrons was assessed using integrase specific primers. It was found 

that the INT amplicon from isolate SS02 had the sequence for integrase. The BLAST result returned a 

match with Corynebacterium diphtheriae integrase. 

The results for integrase from isolate SS02 are shown below. 

>2R.INT 

QAMKT 

ATAPLPPLRS VKVLDQLRER IRYLHYSLRT EQAYVHWVRA FIRFHGVRHP 

ATLGSSEVEA FLSWLANERK VSVSTHRQAL AALLFFYGKV LCTDLPWLQE 

IGRPRPSRRL PVVLTPDEVV RILGFLEGEH RLFAQLLYGT GMRISEGLQL 

RVKDLDFDHG TII 

ref|NP_940279.1| integrase [Corynebacterium diphtheriae NCTC ... 331 2e-89 

REFSEQ: accession NC_002935.2 

KEYWORDS complete genome. 

SOURCE Corynebacterium diphtheriae NCTC 13129 

ORGANISM Corynebacterium diphtheriae NCTC 13129 

PUBMED 14602910 

Amino acid sequence 

>2int 

mktataplpp lrsvkvldql rerirylhys lrteqayvhw vrafirfhgv rhpatlgsse 

veaflswlan erkvsvsthr qalaallffy gkvlctdlpw lqeigrprps rrlpvvltpd 

evvrilgfle gehrlfaqll ygtgmriseg lqlrvkdldf dhgtiivreg kgskdralml 

peslapslre qlsrglcckd wrqsevgcrs apirrllrng g

Figuree 

8. Conserveed 

domain of integrases. 

Discussioon 

The Klebbsiella 

pneumooniae 

isolates 

were analyssed 

to determmine 

their geenetic 

relateddness 

and moost 

came from 

ICU (42% %). These isolaates 

were testted 

by classiical 

biochemiical 

(growth on media, AAPI 

identificaation 

and Oxoiid 

Combinatioon 

disk test) aand 

DNA- ba ased methods. . Biochemicall 

profiles by tthe 

API 20 E system identiified 

two grouups. 

The pphenotypic 

chaaracterisation 

of sensitivity to 

the anti-microbials 

inndicated 

thatt 

most of tthe 

isolates thhat 

were colleected 

and pree-screened, 

weere 

in fact EESBLs. 

API confirmed thheir 

identity as 

Klebsiellaa 

pneumoniaee. 

There are nno 

reports of tthe 

recent sittuation 

regardding 

the extent 

of spread of 

ESBL froom 

Klebsiellaa 

pneumoniaae 

or any othher 

resistant bbacterial 

pathogens 

in Mauuritius. 

OPB 01, OPL 07 and OPA12 wwere 

the RAPPD 

primers ( (Fig 3&4), chhosen 

from thee 

twenty five or 

so primeers 

that weree 

screened. PPrimer 

OPA 12 

producedd 

more polymoorphic 

profilees 

than the othher 

two and aall 

the isolates 

were differeent. 

With primmer 

OPL 07 tthe 

same profiile 

was obtainned 

from isolattes 

SS40, SSS41, 

SS42, SS43, 

SS44, SS445, 

SS46, SS447, 

SS48, SSS49, 

and SS500. 

They all haad 

only 3 bannds 

of sizes ssizes 

700bp, 1000 bp and 1200 bp. Theese 

same isollates 

gave diffferent 

patternns 

with the othher 

two primmers. 

The denndrograms 

obbtained 

with tthe 

results oof 

BOX-PCRR 

and that oof 

RAPD booth 

producedd 

three groups. 

Several of thhem 

were in tthe 

same grouup 

for both mmethods. 

No coorrelation 

wass 

found betweeen 

hospitals aand 

dates of f isolation suuggesting 

thaat 

the ESBLL 

- 


with ESBL 

activity 49 

carrying 

strains hhad 

originatedd 

from very 

diverse 

sources. Siimilarly, 

theree 

was little or 

no co orrelation fouund 

among sammples 

of the 

same hospitals, pprobably 

inddicating 

that 

there had not beeen 

significannt 

spread of 

ESBL L carrying sstrains 

withinn 

the same 

centre e, although thhe 

sampling wwas 

primarily 

done from patientss. 

RAPD andd 

PFGE have 

been used for typing of f Klebsiella 

pneum moniae (Thouuraya 

et al., 2003). Both 

PFGE E typing and RAPDD 

produced 

conco ordant resullts 

and diiscrimination 

betwe een groups off 

epidemiologiically 

related 

strain ns could be maade. 

Th he presence oof 

the beta-lacttamase 

genes 

were detected by PCR amplifiication 

using 

specific 

primers fo for TEM, SHVV 

and CTX- 

M. All A fifty isolates 

amplifieed 

the TEM 

and/o or SHV gennes 

while oonly 

twelve 

produ uced a prodduct 

with tthe 

CTX-M 

specific 

primerss 

(data noot 

shown). 

Ampl licons were purified andd 

sequenced. 

BLAST 

results inddicated 

that isolates 

SS11 

and SS25 carried SHV 28 whhereas 

SS27 

harbo oured SHV 11. 

For isolatees 

S01, S02, 

S25 and S41-49, CTX-M 15 was present. 

This variant is kknown 

to bee 

commonly 

found d worldwide. There are fivve 

groups of 

CTX-M 

enzymes, namely CTXX-M 

1, 2,3, 4 

and 25. ESBLL 

carrying strains of 

entero obacteria arre 

resistant to third 

gener ration cephhalosporins 

such as


cefotaxime, cefdazidime and ceftriaxone; and are 

important threats. These enzymes do not affect 

cephamycins or imipenems. CTX-M is widely 

found in E. coli and Klebsiella isolates worldwide. 

CTX-M 15 in Salmonella enterica has also been 

shown to be present in stool samples of patients 

suffering from acute diarrhoea (Rotimi et al., 

2008). The CTX-M 15 is encoded on large 

incompatibility plasmids of sizes varying between 

145,5 and 242,5 kb. Many are found as IncFII 

together with IncFIA and IncFIB, with one report 

showing IncFI not associated with any IncFII 

(Mshana et al., 2009). This suggests that the 

plasmids contribute to the lateral transfer of the 

resistance genes. CTX-M ESBL hydrolyse 

cefepime more efficiently than other ESBLs 

(Mendonca et al., 2007). 

TEM and SHV enzymes have evolved 

significantly over the last decade or so and there is 

some evidence of positive selection. A list of over 

hundred different combinations of amino acid 

substitutions have been reported for the 278 long 

polypeptide. It is likely that the evolution of the 

protein is directed towards finding the mutants that 

have enhanced catalytic efficiency and can better 

compete with others. Experimental prediction of 

how resistance genes evolve in response to 

selection pressure has shown that alleles of the 

genes will mutate in a similar way as in nature. 

Several in vitro experiments using gene shuffling, 

or mutagenesis with Taq Polymerase under errorprone 

or the use of nucleoside analogs have led to 

the appearance of mutants with extreme resistance 

(> 64X or to beta-lactamase inhibitor). Interestingly 

these in vitro experiments have recovered amino 

acid substitutions that are naturally found among 

the TEM beta-lactamases. Hall and Barlow (2002) 

have used error-prone PCR for assessing the 

evolution of TEM-1 under selection pressure. 

Mutations were introduced into the genes and the 

mutated genes cloned into E.coli. Growth in 

increasing concentrations of antibiotic led to the 

identification of mutations in the resistance genes 

which allowed survival in the highest antibiotic 

concentrations. The cycles of mutations and 

selection are repeated until there is no further 

increase in resistance. 

The Barlow-Hall in vitro method recovered 

seven out of the nine amino acid substitutions that 

had arisen in nature. The same approach has been 

used to isolate an allele giving a resistance with a 

MIC of 256 µg/ml compared to 0.5 µg ml 

for reported, natural form of TEM. Those 

resistant alleles had between 2 to 6 amino 

acid substitutions. Three of these were 

identified that increased the MIC from 0.5 to 

2 µg /ml then to 32 µg /ml and finally from 

32 µg /ml to 256µg /ml. This would strongly 

suggest that there is a “natural evolutionary” 

series of replacement leading to the most 

resistant allele (Ford and Avison, 2004). 

Analysis of a K. pneumoniae genome 

sequence (strainMGH78578) reported two 

chromosomal blaSHV genes. Closer 

comparison of the surrounding sequence 

(GC content and other genes) of the two 

genes indicated that one had evolved from 

within that strain itself. On the other hand 

the second one was accompanied by 

insertion sequences IS26 suggesting that it 

was mobilised most likely from a different 

K. pneumoniae strain. Nucleotide sequence 

comparison and amino acid replacement at 

the active site have pointed to convergent 

evolution of ESBLs during the period of 

intense cefotaxime use and later that of 

ceftazidime. 

Beta lactamase genes have been shown 

to be vehicled as gene cassettes within 

integron sequences. VEB-1 (Vietnamese 

Extended Spectrum) and GES-1 (Guyanese 

Extended Spectrum) were first described 

associated with the intI1 integrase (Poirel et 

al 1999., 2000). Being part of the integron 

ensures that the resistance genes are rapidly 

mobilised for lateral transfer intra- and interspecies. 

In this study, one CTX-M 15 from 

isolate SS02, was found together with an 

integrase (Figure 3c). This could explain its 

rapid spread since it was first described. 

References 

Ambler RP. The structure of betalactamases. 

Philosophical Transactions 

of the Royal Society of London. Series B: 

Biological Sciences. 289: 321–331, 

1980. 

Babini G and Livermore DM. Are SHV beta 

lactamases universal in Klebsiella 

pneumonia. Antimicrobial Agents and 

Chemotherapy. 44(8): 2230-2230, 2000.

Barlow M and Hall BG. Predicting evolutionary 

potential: in vitro evolution accurately 

reproduces natural evolution of the TEM - 

lactamase. Genetics. 160: 823–832, 2002. 

German B and Martinez-Beltran J. Cloning, 

Nucleotide Sequencing, and Analysis of the 

Gene Encoding an AmpC b-Lactamase in 

Acinetobacter baumannii. Antimicrobial Agents 

and Chemotherapy. 44(2): 428–432, 2000. 

Ford PJ and Avison MB. Evolutionary mapping of 

the SHV b-lactamase and evidence for two 

separate IS26-dependent blaSHV mobilization 

events from the Klebsiella pneumoniae 

chromosome. Journal of Antimicrobial 

Chemotherapy. 54: 69 – 75, 2004. 

Gniadkowski M, Schneider I, Jungwirth R, et al. 

Ceftazidime Resistant Enterobacteriaceae 

isolates from three Polish Hospitals: 

Identification of three novel TEM- and SHV-5 

type Extended Spectrum Beta Lactamases. 

Antimicrobial Agents and Chemotherapy. 42(3): 

514-520, 1998. 

Hall BG and Barlow M. Evolution of the serine 

beta-lactamases: past, present and future. Drug 

Resistance Update.7: 111–123, 2004. 

Kim J, Lim Y, Jeong Y and Seol S. Occurrence of 

CTX-M-3, CTX-M-15, CTX-M-14, and CTX- 

M-9 Extended-Spectrum Beta Lactamases in 

Enterobacteriaceae Clinical Isolates in Korea. 

Antimicrob Agents Chemother. 49(4): 1572– 

1575, 2005. 

Mazel D, Dychinco B, Webb VA, and J. Davies. 

Antibiotic resistance in the ECOR collection: 

integrons and identification of a novel aad gene. 

Antimicrob Agents Chemother. 44:1568–1574. 

2000. 

Mshana SE, Imirzalioglu C, Hossain H, et al. 

Conjugative IncFI plasmids carrying CTX-M- 

15 among Escherichia coli ESBL producing 

isolates at a University hospital in Germany. 

BioMedCentral (BMC) Infectious Diseases. 9: 

97, 2009. 

Mendonça N, Leitão J, Manageiro V, et al. Spread 

of extended spectrum b-lactamase CTX-M- 


producing Escherichia coli clinical 

isolates in community and nosocomial 

environments in Portugal. Antimicrob 

Agents Chemother. 51:1946-1955, 2007. 

Nikaido H. Outer membrane barrier as a 

mechanism of antimicrobial resistance. 

Antimicrob Agents Chemother. 33:1831- 

1836, 1989. 

Jonathan N. Screening for Extended- 

Spectrum Beta-Lactamase-Producing 

Pathogenic Enterobacteria in District 

General Hospitals. J Clin Microbiol. 43: 

1488–1490, 2005. 

Poirel L, Naas T, Guibert M, et al. 

Molecular and biochemical 

characterization of VEB-1, a novel class 

A extended-spectrum b-lactamase 

encoded by an Escherichia coli integron 

gene. Antimicrob Agents Chemother. 

43:573–581, 1999. 

Poirel L, Le Thomas I, Naas T, et al. 

Biochemical sequence analyses of GES- 

1, a novel class A extended-spectrum blactamase, 

and the class 1 integron In52 

from Klebsiella pneumoniae. Antimicrob 

Agents Chemother. 44: 622–632, 2000. 

Rotimi V, Jamal W, Pal T, et al. Emergence 

of CTX-M-15 type extended-spectrum blactamase-producing 

Salmonella spp. in 

Kuwait and the United Arab Emirates. J 

Med Microbiol. 57: 881–886, 2008. 

Ben-Hamouda T, Foulon T, Ben cheikh- 

Masmoudi A, et al. Molecular 

epidemiology of an outbreak of multi 

resistant Klebsiella pneumoniae in a 

Tunisian neonatal ward. Journal of 

Medical Microbiology. 52(5): 427-433, 

2003. 

Wu TL, Siu LK, Su LH, et al. Outer 

membrane protein change combined 

with co-existing TEM-1 and SHV-1 beta 

lactamases lead to false identification of 

ESBL producing Klebsiella pneumoniae. 

J Antimicrob Chemother. 47:755-761, 

2001.




HIV-1 reverse transcriptase inhibition by Vitex negundo L. leaf 

extract and quantification of flavonoids in relation to anti-HIV 

activity 

Mohan KANNAN 1* , Paramasivam RAJENDRAN 2 , Veerasami VEDHA 3 , 

Gnanasekaran ASHOK 3 , Shanmugam ANUSHKA 3 , Pratap CHANDRAN 

RAMACHANDRAN NAIR 1 

1 Department of Biotechnology and Research, K.V.M. College of Engineering and Information 

Technology, Kokkothamangalam, Cherthala, Kerala, India. 

2 Department of Microbiology, Sri Ramachandra Medical College & Research Institute, Sri 

Ramachandra University, Porur, Chennai – 600 116, Tamilnadu, India. 

3 Department of Microbiology, Post Graduate Institute of Basic Medical Sciences, University of 

Madras, Taramani Campus, Chennai – 600 113, Tamilnadu, India. 

(*author for correspondence; kannan.am@gmail.com) 

Received: 22 September 2011, Accepted: 08 November 2012 

Abstract 

This study aimed to determine the activity of ethanolic leaf extract of Vitex negundo L. against HIV-1 

Reverse Transcriptase (RT) and to identify and quantify the flavonoids present. The effects of 

ethanolic (85%) leaf extract of Vitex negundo L. on RT activity in vitro were evaluated with 

recombinant HIV-1 enzyme, using a non-radioactive HIV-RT colorimetric ELISA kit. In addition, 

identification and quantification of flavonoids such as Rutin, Luteolin, Myricetin, Quercetin, 

Kaempherol, Isorhamnetin and Quercetagetin were analysed using HPLC. The plant Vitex negundo L. 

ethanolic leaf extract exhibited the most notable activity of 92.8% against HIV-1 RT at 200 µg/ml 

concentration. Phytochemical analysis revealed the presence of steroids, triterpenes, alkaloids, 

flavanoids, antroquinone glycosides and amino acids. Among 7 flavonoids tested, 6 were identified in 

the decreasing order of quantity as Kaempherol, Myricetin, Quercetin, Quercetagetin, Isorhamnetin 

and Luteolin. The study revealed that the plant Vitex negundo L. leaf possess anti-RT substances and 

probably the flavonoids act as anti-virus agents. 

Keywords: Vitex negundo, flavonoids, HIV-1 reverse transcriptase, phytochemical, anti-HIV activity. 

Özet 

Vitex negundo L. yaprak özütüyle HIV-1 ters transkriptaz inhibisyonu ve anti- 

HIV aktivitesiyle ilişkili flavonoidlerin kantifikasyonu üzerine bir çalışma 

Bu çalışmada HIV-1 ters transkriptaza karşı Vitex negundo L. etanolik yaprak özütünün aktivitesini 

tespit etmek ve flavonoidlerin varlığını ölçmek amaçlanmıştır. Vitex negundo L. etanolik (%85) 

yaprak özütünün in vitro RT aktivitesi üzerinde etkileri, rekombinant HIV-1 enzimi ile radyoaktif 

olmayan HIV-RT kolorimetrik ELISA kiti kullanarak ölçülmüştür. Ayrıca, Rutin, Luteolin, Myricetin, 

Quercetin, Kaempherol, Isorhamnetin ve Quercetagetin gibi flavonoidlerin tanımlanması ve 

kantifikasyonu HPLC kullanılarak analiz edilmiştir. Vitex negundo etanolik yaprak özütü 200 µg/ml 

konsantrasyonda HIV-1 RT’e karşı %92,8 aktivite göstermiştir. Fitokimyasal analizler steroidlerin, 

triterpenlerin, alkoloidlerin, flavonoidlerin, antrokinon glikoitlerin ve aminoasitlerin varlığını açığa

54 Mohan KANNAN et al. 

çıkartmaktadır. Test edilen 7 flavonoidden altısı, azalan miktarlarına göre Kaempherol, Myricetin, 

Quercetin, Quercetagetin, Isorhamnetin ve Luteolin olacak şekilde belirlenmiştir. Bu çalışma, Vitex 

negundo bitki yaprağının anti-ters transkriptaz özelliği bulunduğunu ve flavonoidlerin retrovirüslere 

karşı muhtemelen antivirüs ajan olarak rol oynadıkları ortaya çıkarmaktadır. 

Anahtar kelimeler: Vitex negundo, flavonoidler, HIV-1 ters transkriptaz, fitokimyasal, anti-HIV 

aktivitesi. 

Introduction 

Acquired immunodeficiency syndrome (AIDS), 

caused by the human immunodeficiency virus 

(HIV), results in life-threatening opportunistic 

infections and malignancies. HIV leads to the 

destruction and functional impairment of the 

immune system, subsequently destroying the 

body’s ability to fight against infections (Kanazawa 

and Matija, 2001). Moreover, the standard antiviral 

therapies are too expensive for a common man. In 

order to manage this condition alternative 

treatments are explored. 

Vitex negundo L., a member of Verbenaceae 

family, an important medicinal plant is found 

throughout India. Though almost all plant parts are 

used, the extract from leaves and the roots is the 

most important in the field of medicine and is sold 

as drugs. The leaf extract is used in Ayurvedic and 

Unani systems of medicine for treatment of various 

ailments (Kapur et al., 1994). It also has mosquito 

repellent activity (Hebbalkar et al., 1992), antiarthritic 

effect on rats (Tamhankar et al., 1994), 

analgesic activity on mice (Gupta et al., 1999), 

hepatoprotective activity (Kapur et al., 1994), antiinflammatory 

and anti-allergic activity (Chawla et 

al., 1992; Jana et al., 1999). Besides being used as 

a traditional medicine, its antiviral property, 

especially against HIV, has not yet been explored 

much. 

Flavonoids have been proven to display a wide 

range of biochemical and pharmacological actions 

such as anti-carcinogenic, anti-viral, anti-microbial, 

anti-thrombotic, anti-inflammatory, and antimutagenic 

activities. In addition, flavonoids can act 

as free radical scavengers and terminate the radical 

chains reaction that occurs during the oxidation of 

triglycerides in food system (Turkoglu et al., 2007). 

Moreover flavonoid compounds represent an 

important natural source of anti-retrovirals for 

AIDS therapy due to their significant anti-HIV-1 

activity and low toxicity. 

One of the possible approaches is the 

screening of plants based on their 

ethnomedicinal data for inhibition (Vlietinck 

et al., 1998). Current strategies for anti-HIV 

chemotherapy involve inhibition of virus 

adsorption, virus-cell fusion, reverse 

transcription, integration, translation, 

proteolytic cleavage, glycosylation, 

assembly, or release (Moore and Stevenson, 

2000; Miller and Hazuda, 2001). Reverse 

transcriptase is an enzyme that reads the 

sequence of HIV RNA that has entered the 

host cell and transcribes the sequence into 

complementary DNA. Without reverse 

transcriptase, the viral genome cannot be 

incorporated into the host cell and as a result 

a virus will not replicate. Reverse 

transcriptase is therefore the principal target 

enzyme of antiretroviral drugs such as 

Nevarapine and Delavirpine that are used to 

treat HIV infected patients (De Clercq, 

2007; Woradulayapinji et al., 2005). 

Therefore this study has been designed to 

explore the possible anti-HIV activity by RT 

enzyme inhibition assay and to quantify the 

flavonoids from the leaves of Vitex negundo. 


Plant material and extraction 

The leaves of Vitex negundo L. were 

collected from Kolli hills adjoining 

downstream areas of Namakkal district, 

Tamil Nadu, India and authenticated 

(PARC/2010/587) by Dr. Jayaraman, Plant 

Anatomy Research Centre, National 

Institute of Herbal Science, Chennai, India. 

The plant samples were washed, shadedried, 

powdered and extracted in 85% 

ethanol and filtered. The extracts were then 

concentrated to dryness under reduced 

pressure and the residue was freshly 

dissolved in appropriate buffer on each day

of experiment for the assays. Depending on the 

assay, extract that could not dissolve in appropriate 

buffer were dissolved in DMSO and later diluted to 

different concentration needed for a particular 

assay. 

HIV-1 RT assay 

The effect of the plant extract on RT activity in 

vitro was evaluated with recombinant HIV-1 

enzyme, using a non-radioactive HIV-1 RT 

colorimetric ELISA kit (Roche) (Ayisi, 2003; 

Harnett et al., 2005). The concentration of extract 

used was 200µg/ml. The extracts, which reduced 

activity by at least 50%, were considered as active 

Percentage of Inhibition = 100 - 

Preliminary phytochemical analysis 

The ethanolic leaf extract was subjected to 

preliminary phytochemical screening as per the 

procedures of Harborne, 1998 and Kokate, 2003. 

Quantitative analysis of flavonoids using HPLC 

The procedure as described by Lawrence Evans 

(2007) was used for the determination of flavonoids 

in the plant extracts. The flavonoid standard used in 

the study includes Rutin, Luteolin, Myricetin, 

Quercetin, Kaempferol, Isorhamnetin and 

Quercetagetin (Sigma Chemicals, USA) and were 

prepared at 1 mg/ml in methanol. A total of 1g of 

plant extract was extracted with 78 ml of extraction 

solvent (methanol, water and hydrochloric acid; 

50:20:8). Extract was then refluxed at 90 ◦ C for 2 h. 

Then extract was cooled and latter 20 ml of 

methanol was added and sonicated for 30 minutes. 

All solutions were filtered through a 0.45µM 

cellulose acetate membrane filter (Paul, USA) 

before being injected into the HPLC. Aliquots of 

the filtrate (20µl) were injected on to an HPLC 

(Lachrom L-7000) column using C18 (Merck) (25 

X 0.4 cm, 5µm) separately and eluted with mobile 

phase solvent mixture comprising Water: 

Methanol: Phosphoric acid (100:100:1, v:v:v) with 

a flow rate at 1.5 ml/min. The UV detection was 

Anti-HIV property of Vitex negundo L 55 

(Woradulayapinji et al., 2005). 

Azidothymidine (AZT) was used as a 

positive control at 100 µg/ml. The control 

(1) only contained the buffer and reaction 

mixture (no enzyme and extracts were 

added). For the control (2) the enzyme and 

reaction mixture were added for the reaction 

to take place. The absorbance was read on a 

microtitre plate reader at 405 nm with a 

reference wavelength of 490 nm. The mean 

of the triplicate absorbance were analysed 

using the formula: 

Mean Sample absorbance X 100 

Mean Control-2 absorbance 

carried out at 270 nm. The chromatograms 

were recorded and the areas measured for 

the major peak to quantify the flavonoids in 

the tested plant sample. 

Results 

The results shown in Table 1 indicates the 

inhibition percentage of ethanolic leaf 

extract of Vitex negundo L. against the 

reverse transcriptase (RT) enzyme. The most 

notable activity of about 92.8% was detected 

against RT at 200µg/ml. The phytochemical 

analysis of the plant extract revealed the 

presence of steroids, triterpenes, alkaloids, 

flavanoids, antroquinone glycosides and 

aminoacids. In this study, flavonoids content 

of the ethanolic extract of Vitex negundo L. 

leaves were evaluated. The HPLC 

chromatogram of the flavonoid standard 

used and the chromatogram of the tested 

plant extract is shown in Figure 1 & 2. 

Results revealed that the extract consisted of 

different amount of various flavonoid types. 

As shown in Figure 1, the retention times of 

Rutin, Quercetin, Kaempherol Luteolin, 

Isorhamnetin , Myricetin, and Quercetagetin 

were at 19.40, 24.80 29.70, 33.80, 38.70, 

41.26 and 43.8 min, respectively.


Table 1. Effect of ethanolic leaf extract of Vitex negundo L. on the activity of recombinant HIV-1 

reverse transcriptase 

Extract/Control Mean absorbance ± SD Percentage of Inhibition 

Control 1 0.003 ± 0.01 100 

Control 2 1.32 ± 0.01 0 

AZT 0.193 ± 0.00 85.37 

V. negundo L. 0.094 ± 0.01 92.8 

Control 1- buffer and reaction mixture (no enzyme and extract); Control 2- enzyme and reaction 

mixture (no extract); AZT – Azidothymidine (Positive control). The plant extract showing percentage 

of inhibition greater than 50% has been considered as positive in inhibiting recombinant HIV-1 

reverse transcriptase enzyme. 

Figure 1. HPLC Chromatogram of the flavonoid standards used in the study. 1. Rutin 2. Quercetin, 

3.Kaempherol, 4. Luteolin, 5.Isorhamnetin, 6.Myricetin, 7.Quercetagetin. 

Figure 2 exhibits the presence of Quercetin, Kaempherol, Luteolin, Isorhamnetin, Myricetin and 

Quercetagetin in Vitex negundo leaf extract as per the retention time. The flavonoid Rutin was not 

identified in the chromatogram of the plant sample showing its absence in the plant extract. Amount 

of tested flavonoid compounds in the extract were calculated by measuring the area obtained for the 

peaks and in the order as Kaempherol (20.61 mg/g) > Myricetin (18.75 mg/g) > Quercetin (14.73 

mg/g) > Quercetagetin (12.13 mg/g) > Isorhamnetin (11.01 mg/g) > Luteolin (6.40 mg/g).


Figure 2. HPLC chromatogram of Vitex negundo leaves. Probable flavonoids quantity as per area and 

Retention time compared with the standard HPLC chromatogram: 1. Kaempherol ; 2. Myricetin ; 3. 

Quercetin ; 4. Quercetagetin ; 5. Isorhamnetin ; 6. Luteolin. 

Discussion 

For centuries water extract of fresh mature leaves 

are used in Ayurveda medicine as antiinflammatory, 

analgesic and anti-itching agents 

internally and externally. However the ethanolic 

extract of V. negundo leaves resulted in the 

isolation of a new flavones glycoside along with 

five known compounds which were evaluated for 

their antimicrobial activities by Sathyamoorthy et 

al., (2007). However studies on anti-HIV activity of 

V.negundo are few. For example the water extracts 

of Vitex negundo (aerial part) was shown to have 

HIV-1 RT inhibition ratio (% IR) higher than 90% 

at a 200µg/ml concentration (Woradulayapinij et 

al., 2005). Similarly the present study also showed 

that the polar solvent extract of ethanolic leaf 

extract of Vitex negundo L. had 92.8% inhibition of 

recombinant HIV-1 reverse transcriptase enzyme at 

200µg/ml. Previous phytochemical studies on V. 

negundo L. had revealed the presence of volatile 

oil, triterpenes, diterpenes, sesquiterpenes, lignan, 

flavonoids, flavones glycosides, iridoid glycosides, 

and steroids as physiologically active compounds 

(Azhar and Abdul, 2004; Mukherjee et al., 1981). 

For centuries, preparations that contain 

flavonoids as the principal physiologically active 

constituents have been used by physicians and lay 

healers in attempts to treat human diseases 

(Havsteen, 1983). Flavonoids are the largest 

classes of naturally-occurring polyphenolic 

compounds (Geissman and crout, 1969). 

Evidence has been presented that substances 

closely related to flavonoids inhibit the 

fusion of the viral membrane with that of the 

lysosome (Miller and Lenard, 1981). 

Therefore the many claims from lay medical 

practitioners of the prophylactic effects of 

flavonoids against viral attack have 

substantial support (Beladi et al., 1977). 

Although the mechanism of the inhibition 

remains unclear, it seems that prostaglandins 

participate in the fusion of cell membranes. 

Since flavonoids inhibit their formation, a 

rationale can be constructed for the 

protective effect of flavonoids against viral 

diseases (Nagai et al., 1995a, 1995b; 

Carpenedo et al., 1969). Moreover from the 

previous reports it is clear that certain 

naturally occurring flavonoids can inhibit 

reverse transcriptases of different origins 

(Spedding et al., 1989) From the above 

reviews it is clear that the flavonoids have 

anti-microbial activity, particularly the 

antiviral. Therefore the present study is 

focused particularly on flavonoids among 

other phytochemicals. Moreover the choice


of flavonoid standards used in this study was based 

on those commonly found in herbs and vegetables 

which have been studied earlier and evidenced to 

possess anti-HIV activity. 

Schinazi et al. (1997) showed that the flavonols 

such as quercetin, myricetin, and quercetagetin, 

which was used as standard control in this study, 

have earlier been reported to inhibit certain viruses 

in vitro, including the Rauscher murine leukemia 

virus and the HIV virus. Among the 17 flavonols 

tested by Schinazi et al. (1997) only 3-O-glucosides 

of kaempherol, quercetin, and myricetin caused 

significant inhibition of HIV-1 at nontoxic 

concentrations. At the same time other comparative 

studies with other flavonoids revealed that the 

presence of both the double bond between positions 

2 and 3 of the flavonoids pyrone ring, and the three 

hydroxyl groups introduced on positions 5,6 and 7 

(ie, baicalein) were a prerequisite for the inhibition 

of RT-activity. Removal of the 6-hydroxyl group of 

bacalein required the introduction of three 

additional hydroxyl groups at position 3,3’ and 4’ 

(quercetin) to afford a compound still capable of 

inhibiting the RT-activity. Quercetagetin which 

contains the structures of both baicalein and 

quercetin with an additional hydroxyl group on the 

5’ position also proved strong inhibitors of RT 

activity (Ono et al., 1990). Thus the activity of 

Vitex negundo leaf extract against HIV-1 RT in the 

present study might be due to the presence of above 

mentioned flavonoids particularly due to the 

presence of high quantity of Kaempherol, myricetin 

and quercetin. However this needs to be explored 

and confirmed. Probably this is the first report from 

India confirming the possible anti-HIV activity of 

Vitex negundo L. 

Acknowledgement 

We would like to thank Dr. Hannah Raichel 

Vasanthi, Former in-charge of Herbal Indian 

Medicinal Research laboratory, Sri Ramachandra 

Medical College & Research Institute for providing 

sophisticated lab facility for successful completion 

of this work. 

References 

Ayisi NK and Nyadedzor C. Comparitive in vitro 

effects of AZT and extracts of Ocimum 

gratissium, Ficus polita, Clausena arisata, 

Alchornea cordifolia and Elaeophorbia 

drupifera against HIV-1 and HIV-2 

infections. Antiviral Research. 13: 2559- 

2562, 2003. 

Azhar UH and Abdul M. Enzymes 

Inhibiting Lignans from Vitex negundo, 

Chemical and Pharmaceutical Bulletin. 

52(11):1269-1272, 2004. 

Beladi I, Pusztai R, Mucsi I, et al. Activity 

of some flavonoids against viruses. 

Annuals of the New York Academy of 

Sciences. 284: 358–364, 1977. 

Carpenedo F, Bortignon C, Bruni A and 

Santi R. Effect of quercetin on 

membrane-linked activities. Biochem 

Pharmacol. 18: 1495– 1500, 1969. 

Chawla AS, Sharma AK, Ha SS and Dhar 

KL. Chemical investigation and antiinflammatory 

activity of Vitex negundo 

seeds. J Natl Prod. 55: 163-167, 1992. 

De clercq E. Anti HIV drugs. 

Verhandelingen-Koninklijke Academie 

Geneeskdunde van Belgie. 69: 81-104, 

2007. 

Spedding G, Ratty A, Middleton E. 

Inhibition of reverse transcriptase by 

flavonoids. Antiviral Research. 12: 99- 

110, 1989. 

Geissman TA and Crout DHG. Organic 

chemistry of secondary plant 

metabolism. Freeman, Cooper & 

Company, San-Francisco. 183-230, 

1969. 

Gupta M, Mazumber UK and Bhawal RS. 

CNS activity of vitex negundo Linn. In 

mice. Indian J Exptl Biol. 37: 143-146, 

1999. 

Harborne JB. Phytochemical Methods: A 

Guide to Modern Techniques of Plant 

Analysis. 3 rd (Ed). Chapman and Hall 

Co, New York. 1-302, 1998. 

Harnett SM, Oosthuizen V and Van De 

Venter M. Anti-HIV activities of organic 

and aqueous extracts of Sutherlandia 

frutescens and Lobostemon trigonus. 

Journal of Ethanopharmacology. 96: 

113-119, 2005.

Havsteen B. Flavonoids, a class of natural products 

of high pharmacological potency. Biochem 

Pharmacol. 32: 1141–1148, 1983. 

Hebbalkar DS, Hebbalkar GD and Sharma RN. 

Mosquito repellent activity of oils from Vitex 

negundo Linn. Leaves. Indian J Med Res. 95: 

200-203, 1992. 

Jana U, Chattopadhyay RN and Shaw B. 

Preliminary studies on anti-inflammatory 

activity of Zingiber officinale Rose, Vitex 

negundo Linn. and Tinospora cordifolia 

(Willid) Miers in albino rats. Indian J 

Pharmacol. 31: 232-233, 1999. 

Kanazawa S and Matija PB. Repression of MHC 

determinants in HIV infection. Microbes Infect. 

3: 467–473, 2001. 

Kapur V, Pillai KK, Hussain SZ and Balani DK. 

Hepatoprotective activity of ‘JIGRINE’ (An 

Unani polypharmaceutical herbal formulation 

on liver damage and lipid peroxidation caused 

by alcohol-carbon tetrachloride and paracetamol 

in rats. Indian J Pharm Sci. 56: 160, 1994. 

Kokate CK, Purohit AP and Gokhale SB. 

Pharmacognosy. Pune. 1-624, 2003. 

Lawrence Evans. Pharmacopeial Forum. 28(5): 

1545, 2007. 

Miller DK and Lenard J. Antihistaminics, local 

anaesthetics and other amines as antiviral 

agents. Proc Natl Acad Sci. 78: 3605– 3609, 

1981. 

Miller MD and Hazuda DJ. New antiretroviral 

agents: Looking beyond protease and reverse 

transcriptase. Curr Opin Microbiol. 4: 535–539, 

2001. 

Moore JP and Stevenson M. New targets for 

inhibitors of HIV-1 replication. Nat Rev Mol 

Cell Biol. 1: 40–49, 2000. 

Mukherjee KS and Badruddoza S. Chemical 

constituents of Dillenia indica Linn. And Vitex 

negundo Linn. J Indian Chem Soc. 58: 97, 

1981. 

Nagai T, Moriguchi R, Suzuki Y, et al. Mode of 

action of the anti-influenza virus activity of 

plant flavonoid, 5,7,40-trihydroxy-8methoxyflavone, 

from the roots of Scutellaria 

baicalensis. Antiviral Res 1995a; 26: 11– 25. 


Nagai T, Suzuki Y, Tomimori T and 

Yamada H. Antiviral activity of plant 

flavonoid, 5,7,40-trihydroxy-8methoxyflavone, 

from the roots of 

Scutellaria baicalensis against influenza 

A (H3N2) and B viruses. Biol Pharm 

Bull. 18: 295–299, 1995b. 

Ono K, Nakane H, Fukushima M, Chermann 

JC and Barre-Sinoussi F. Differential 

inhibitory effects of various flavonoids 

on the activities of reverse transcriptase 

and cellular DNA and RNA polymerases 

Eur J Biochem. 190: 469-476, 1990. 

Sathiamoorthy B, Prasoon Gupta, Manmeet 

Kumar, Ashok K, Chaturvedi and Shukla 

PK. New antifungal flavonoid glycoside 

from Vitex negundo. Bioorganic & 

Medicinal Chemistry Letters. 17: 239– 

242, 2007. 

Schinazi RF, Hughes SH and Chen FC. In 

vitro anti-HIV activity of biflavonoids 

isolated from Rhus succedanea and 

Garcinia multiflora. J Nat Prod. 60: 

884-888, 1997. 

Tamhankar CP and Saraf MN. Anti-arthritic 

activity of V. Negundo L. Indian J 

Pharm Sci. 56: 154-160, 1994. 

Turkoglu A, Duru ME, Mercan N, et al. 

Antioxidant and antimicrobial activities 

of Laetiporus sulphureous (Bull.) 

Murrill. Food Chem. 101(1):267–73, 

2007. 

Vlietinck, AJ, De Bruyne T, Apers S and 

Pieters LA. Plant derived leading 

compounds for chemotherapy of human 

immunodeficiency virus (HIV) infection. 

Planta Med. 64: 97–109, 1998. 

Woradulayapinij W, Soonthornchareonnon 

N, Wiwat C. In vitro HIV type 1 reverse 

transcriptase inhibitory activities of Thai 

medicinal plants and Canna indica L. 

rhizomes. Journal of 

Ethnopharmacology. 101: 84-89, 2005.




Genetic characterization and bottleneck analysis of Korki 

Jonub Khorasan goats by microsatellite markers 

Bizhan MAHMOUDI* 1 , Orang ESTEGHAMAT 2 , Ahmad SHAHRIYAR 1 and 

Majnun Sh. BABAYEV 3 

1 Islamic Azad University, Meshkinshahr Branch, Meshkinshahr, Ardabil, Iran 

2 Department of Animal Sciences, Islamic Azad University, Astara Branch, Astara, Gilan, Iran 

3 Department of Genetic, Faculty of Biology, Baku State University, Baku, Azerbaijan 

(*author for correspondence: bizhan.mahmoudi@gmail.com) 

Received: 19 March 2012, Accepted: 14 November 2012 

Abstract 

The present study was undertaken for population genetic analysis at molecular level to exploit the 

breed for planning sustainable improvement, conservation and utilization, which subsequently can 

improve the livelihood of its stake holders. Iranian goat populations are recognized as an invaluable 

component of the world’s goat genetic resources. The genetic characterization and bottleneck analysis 

in Korki Jonub Khorasan (KJK) was analyzed using 13 microsatellite markers. The observed number 

of alleles ranged from 3 (OarAE133) to 11 (TGLA122) with a total of 98 alleles and mean of 7.54 

alleles across loci. The overall heterozygosity, PIC and Shannon index values were 0.845, 0.76 and 

1.759 indicating high genetic diversity. Only 4 out of 13 loci were in Hardy-Weinberg equilibrium. 

The mean Fis was -0.059.Only 3 loci had positive Fis values and 10 loci had negative values. Genetic 

bottleneck hypotheses were also explored. Our data suggest that the KJK goats have not experienced a 

genetic bottleneck in the recent past. 

Keywords: Bottleneck, Genetic Diversity, Microsatellites, Korki Jonub Khorasan, Fis. 

Özet 

Korki Jonub Horasan keçisinin mikrosatellit markörleriyle darboğaz analizi ve 

genetik tanımlanması 

Bu çalışmada sahiplerinin geçimini arttıracak soyların sürdürülebilir gelişiminin planlanması, 

korunması ve faydalanılması için moleküler düzeyde popülasyon genetik analizi yapılması 

üstlenilmiştir. İran keçisi popülasyonu dünyanın keçi genetik kaynaklarının çok değerli bir parçası 

olarak kabul edilmektedir. Korki Jonub Horasan (KJK)’da genetik tanımlama ve darboğaz analizi 13 

mikrosatellit markör kullanılarak yapılmıştır. Gözlemlenen allel sayısı toplam 98 allelden 

3(OarAE133) -11(TGLA122) arasında değişmektedir ve lokuslar genelinde ortalama 7,54 allel vardır. 

Heterozigotluk, PIC ve Shannon indeks değerleri 0,845, 0,76 ve 1,759 olup yüksek genetik çeşitliliği 

işaret etmektedir. 13 lokustan 4’ü Hardy-Weinberg dengesindedir. Ortalama Fis -0,059’dur. Sadece 3 

lokusun pozitif ve 10 lokusun negatif Fis değeri vardır. Genetik darboyun analizi ayrıca incelenmiştir. 

Verilerimiz KJK keçilerinin yakın geçmişte genetik bir darboğaz ile karşılaşılmadığını öne 

sürmektedir. 

Anahtar Kelimeler: Darboğaz, Genetik çeşitlilik, Mikrosatellitler, Horasan keçisi, Fis.

62 Bizhan MAHMOUDI et al. 

Introduction 

Genetic diversity, the primary component of 

adaptive evolution, is essential for the long-term 

survival probability of a population (Avise, 1995; 

Coltman et al., 1998; Harley et al., 2002). Genetic 

diversity within domesticated species depends on 

several factors such as changing agricultural 

practices, breed replacement and cross breeding. 

Genetic diversity has been analyzed by using 

protein polymorphism, mitochondrial diversity and 

microsatellite marker in both domestic and wild 

species (Harley et al., 2002;Li and Valenti, 2004; 

Tapiio et al., 2006; Pastor et al., 2004; Barker et 

al., 2001; Li et al., 2002; Joshi et al., 2004, Rout et 

al., 2008). The domestic goat (Capra hircus) is 

known for its ability to thrive on paltry fodder and 

to with stand harsh environments. From an 

agricultural standpoint, the world’s 700 million 

goats provide reliable access to meat, milk, skin, 

and fiber for small farmers particularly in some 

countries like Iran. Iran is bestowed with 8% of 

total world’s goat population comprised of 8 

recognized and many non-descript populations. 

Among them, Korki Jonub Khorasan (KJK) is the 

major goat population of Khorasane Jonobi 

province and is known for fiber quality, meat and 

milk production. 

There are several studies on genetic diversity 

of goats, based on microsatellite markers, such as 

Swiss breeds (Saitbekova et al., 1999), Chinese 

indigenous populations (Li et al., 2002), goats from 

Europe (includingalso the breeds represented here) 

and Middle East (Canon et al., 2006), Mehsana 

goat (Aggarwal et al., 2007), Indian domestic goats 

(Rout et al., 2008), Barbari goats (Ramamoorthi et 

al., 2009) and Iranian native goats (Mahmoudi et 

al., 2011). 

Microsatellites have been used successfully to 

define genetic relationships among different breeds 

in Iran. Microsatellites display higher levels of 

variation, and consequently, enable population 

differentiation to be found more efficiently, so as to 

help breeders to implement rational decisions for 

conservation and improvement of valuable 

germplasm (Mahmoudi et al., 2011). 

Bottleneck analysis of KJK population has not been 

carried out. Hence, it is essential to genetically 

characterize and unfold the genetic diversity of 

indigenous breeds. 

The aim of our pervious study was to analyze 

the genetic diversity and calculation of genetic 

distance of three Iranian native goat 

populations (Raeini, Korki Jonub Khorasan 

and Lori) through the use of microsatellite 

markers. Our pervious study demonstrates 

that the closest distance was observed 

between Raeini and KJK (D = 0.4891) and 

the largest between Raeini and Lori (D = 

0.6298). The UPGMA tree shows that two 

goat populations (KJK and Raeini) are 

distinct from the other goat population 

(Lori) (Mahmoudi et al., 2011). 

But in this study, Microsatellite analysis 

was carried out to test for signatures of 

recent population bottlenecks in Korki 

Jonub Khorasan goat. This analysis was 

carried out on 51 DNA samples with 13 

microsatellite markers. For these loci, 

genetic variation was quantified using 

measures of the total number of alleles, 

number of polymorphic loci, observed and 

expected heterozygosity per locus and allelic 

richness. We tested the Hardy-Weinberg 

(HW) equilibrium and also calculated the 

values of Fis (inbreeding coefficient). 


51 blood samples were collected in 12 

villages in which the population has a major 

concentration. Samples were collected from 

the individuals exhibiting typical population 

characteristics and at least two samples were 

collected from each village of Khorasane 

Jonobi province in Iran. An effort was made 

to collect samples from unrelated 

individuals based on information provided 

by farmers. Blood samples were collected 

from each animal using EDTA vacutainer 

and stored at –20 ºC till further use. 

Blood samples (5–6 ml) were collected 

from the jugular vein of the animal in 

vacutainers containing EDTA as 

anticoagulant. DNA was extracted from 

whole blood using standard protocols 

(Sambrook et al., 1989). The DNA isolation 

procedure involved lysis of RBCs, digestion 

of protein using proteinase K, and 

precipitation of protein using phenol: 

chloroform: isoamyl alcohol with 25: 24: 1 

ratio. 

In this study, 13 microsatellite primer 

pairs were used, including MAF64,

BM4621, BM121, LSCV36, TGLA122, 

OarJMP23, OarFCB304, OarAE133, ILSTS005, 

ILSTS022, ILSTS029, ILSTS033 and ILSTS034. 

Most of primers used were independent and 

belonged to different chromosomes. Typical 

polymerase chain reaction (PCR) testing was 

carried out under these conditions: 60 ng of target 

DNA was used in 25-μl PCR reaction containing 

1×PCR buffer, 50 ng of each primer, 200 μM of 

dNTPs, 0.5 units of Taq DNA Polymerase and 1.5 

mMMgCl2. A Common “Touchdown” PCR profile 

included 3 cycles of 45 sec at 95°C, 1 min at 60°C; 

3 cycles of 45 sec at 95°C, 1 min at 57°C; 3 cycles 

of 45 sec at 95°C, 1 min at 54°C; 3 cycles of 45 sec 

at 95°C, 1 min at 51°C and 20 cycles of 45 sec at 

92°C, 1 min at 48°C. In all cycles elongation 

temperature and time were 72°C and 1 min, 

respectively. Alleles were scored using unlabeled 

primers with products visualized by silver staining 

(Bassam et al., 1991). Genotype of individual 

animal at 13 microsatellite loci was recorded by 

direct counting.Genotypic data were analyzed using 

POPGENE (Yeh and Boyle, 1997) and GenAlex 

(Peakall and Smouse, 2006) to calculate the 

observed number of alleles, effective number of 

alleles, observed heterozygosity, expected 

heterozygosity, and to test for Hardy–Weinberg 

equilibrium (HWE).Allelic frequencies were 

utilized for assessing polymorphic information 

content (PIC), a measure of informativeness of a 

marker, calculated according to Botstein et al. 

(1980) using the given formula, 

Where k is the number of alleles and xi and xj are 

the frequencies of the ith and jth alleles 

respectively. 

Heterozygote deficiencies were estimated as Fis = 

(Ho −He)/He, where Ho and He are the observed 

and expected frequency of heterozygotes 

respectively. 

The bottlenecks program (Piry et al., 

1999) was used as an alternative measure of genetic 

bottlenecks to test for excess gene diversity relative 

to that expected under mutation-drift equilibrium. 

The heterozygosity excess method exploits the fact 

that allele diversity is reduced faster than 

heterozygosity during a bottleneck, because rare 

alleles are lost rapidly and have little effect on 

Bottleneck analysis of KJH goats 63 

heterozygosity, thus producing a transient 

excess in heterozygosity relative to that 

expected in a population of constant size 

with the same number of alleles (Cornuet 

and Luikart, 1996; Piry et al., 1999). To 

determine the population ‘‘genetic reduction 

signatures’’ characteristic of recent 

reductions in effective population size (Ne), 

the Wilcoxon’s heterozygosity excess test 

(Piry et al., 1999) , standard differential test, 

sign test and the allele frequency 

distribution mode shift analysis(Luikart et 

al., 1998) were performed using 

BOTTLENECK (Piry et al., 1999). The 

heterozygosity excess method was used to 

analyzed the population and the data for the 

heterozygosity excess test were examined 

under the two-phased model (TPM; 

95%stepwise mutation model with 5% 

multi-step mutations and a variance among 

multiple steps of 12), which is considered 

best for microsatellite data (Piry et al., 1999; 

Di Rienzo et al., 1994). We also analyzed 

the allele frequency distribution for gaps. 

Aqualitative descriptor of allele frequency 

distribution (the mode-shift indicator),is 

reported to discriminate between 

bottlenecked and stable population (Luikart 

et al.,1998). 

Results 

In order to maintain genetic diversity, 

breeding strategies that increase effective 

population size minimizing genetic drift 

effect should be implemented. Microsatellite 

markers in combination with recent 

statistical methodologies represent a useful 

tool for the conservation and management of 

endangered breeds. In the present work, the 

actual situation concerning genetic diversity 

and population structure of this breed has 

been evaluated using the molecular 

information derived from 13 microsatellites 

loci and the use of clustering methods. 

13 pairs of highly polymorphic 

microsatellite markers were chosen based on 

their genomic location (Table 1).Various 

measures of genetic variation are presented 

in the Table 2. The F-statistics estimates are 

presented in Table3. The number of alleles 

observed across the microsatellite loci


studied varied from 3(OarAE133) to 11 

(TGLA122) with an overall mean of 7.54 (Table 2). 

The observed number of alleles across the loci was 

more than the effective number of alleles (2.355 to 

6.973). The Shannon information index (I) and 

polymorphic Information Content (PIC) showed 

that most of the loci were highly informative 

indicating the high polymorphism across the loci 

with an overall mean of 1.759 and 0.76 

Table 1. Details of the microsatellite used in the study 

Locus Primer sequence 

BM121 

BM4621 

ILSTS005 

ILSTS022 

ILSTS029 

ILSTS033 

ILSTS034 

LSCV36 

MAF64 

OarAE133 

OarFCB304 

OarJMP23 

TGLA122 

respectively. The average observed 

heterozygosity was more than the expected 

(Table 3). The average expected gene 

diversity (Nei, 1973) ranged from 0.581 

(OarAE133) to 0.865 (TGLA122) with an 

overall mean of 0.798. Nine out of total 13 

loci studied showed significant deviations 

from Hardy Weinberg Equilibrium. 

Type of 

repeat 

Chromosome 

No. 

TGGCATTGTGAAAAGAAGTAAAA 

CTAGCACTATCTGGCAAGCA 

CAAATTGACTTATCCTTGGCTG 

(TC)18 16 

TGTAACATATGGGCTGCATC 

GGAAGCAATGAAATCTATAGCC 

(CA)14 6 

TGTTCTGTGAGTTTGTAAGC 

AGTCTGAAGGCCTGAGAACC 

(nn)39 10 

CTTACAGTCCTTGGGGTTGC 

TGTTTTGATGGAACACAGCC 

(GT)21 3 

TGGATTTAGACCAGGGTTGG 

TATTAGAGTGGCTCAGTGCC 

(CA)19 3 

ATGCAGACAGTTTTAGAGGG 

AAGGGTCTAAGTCCACTGGC 

(CA)12 12 

GACCTGGTTTAGCAGAGAGC 

GCACACACATACACAGAGATGCG 

(GT)29 5 

AAAGAGGAAAGGGTTATGTCTGGA 

AATAGACCATTCAGAGAAACGTTGAC 

(CA)16 19 

CTCATCGAATCAGACAAAAGGTAGG 

AGCCAGTAGGCCCTCACCAGG 

(TG)13 1 

CCAACCATTGGCAGCGGGAGTGTGG 

CCCTAGGAGCTTTCAATAAAGAATCGG 

(TG)24 Ann 

CGCTGCTGTCAACTGGGTCAGGG 

GTATCTTGGGAGCCTGTGGTTTATC 

(CT)11(CA)15 19 

GTCCCAGATGGGAATTGTCTCCAC 

AATCACATGGCAAATAAGTACATAC 

- 27 

CCCTCCTCCAGGTAAATCAGC (CA)21 21

Within population inbreeding estimate (Fis) for 

the investigated loci was -0.059. The estimates for 

each locus are presented in Table 3. The values 

ranged from –0.158 (TGLA122) to 0.047 

(ILSTS05). Ten loci revealed negative Fis values. 

The heterozygote deficiency may be a result of 

inbreeding. The high genetic diversity observed in a 

breed could be explained by overlapping 

generations, mixing of populations from different 

geographical locations, natural selection favoring 

heterozygosity or subdivision accompanied by 

genetic drift. Isolation, founder effects, genetic drift 

and different selection pressures realized by 

farmers in each population may have played major 

role in differentiation of Iranian goats. 

Any population that experienced a recent 

bottleneck will show higher than expected 

(equilibrium) heterozgosity for a large number of 

loci. Microsatellite data were also subjected to 

statistical analysis to test whether the populations 

have undergone recent genetic bottleneck. Because 

historical population sizes and levels of genetic 

variation are seldom known, methods for detecting 

bottlenecks in the absence of historical data would 

be useful. Cornuet and Luikart, (1996) described 

the quantitative methods suitable for analysis of 

microsatellite data for detection of recent 

bottlenecks in (100-200) generations. 

Table 2. Number of alleles (Observed and 

effective), Shannon's Information index and 

Polymorphic Information Content for KJK goats 

Locus name Na Ne I PIC 

BM121 8 6.375 1.944 0.82 

BM4621 9 6.007 1.969 0.81 

ILSTS005 8 4.42 1.729 0.75 

ILSTS022 7 4.321 1.606 0.73 

LSTS029 7 4.579 1.702 0.75 

ILSTS033 8 5.742 1.9 0.8 

ILSTS034 7 6.267 1.89 0.82 

LSCV36 9 6.367 1.988 0.82 

MAF64 4 3.272 1.262 0.64 

OarAE133 3 2.355 0.929 0.48 

OarFCB304 9 6.391 2.014 0.83 

OarJMP23 8 4.751 1.775 0.76 

TGLA122 11 6.973 2.164 0.84 

Mean 7.538 5.217 1.759 0.76 

Na: Observed number of alleles; Ne: Effective number of 

alleles; I: Shannon's Information index; PIC: 

Polymorphic Information Content. 


To determine whether a population exhibits 

a significant number of loci with gene 

diversity excess, there are three tests, 

namely a "sign test", a "standardized 

differences test" (Cornuet and Luikart, 

1996) and a "Wilcoxon sign-rank test" 

(Luikart et al., 1997). 

Table 3. Observed and expected 

heterozygosity with p-value, Fis value for 

each microsatellite locus and mean estimate 

of different parameters for KJK goats 

Locus 

Ho He Fis HWE 

name 

BM121 0.902 0.852 -0.06 *** 

BM4621 0.804 0.842 0.045 *** 

ILSTS005 0.745 0.781 0.047 NS 

ILSTS022 0.863 0.776 -0.113 NS 

ILSTS029 0.902 0.789 -0.144 *** 

ILSTS033 0.902 0.834 -0.082 *** 

ILSTS034 0.941 0.849 -0.11 *** 

LSCV36 0.843 0.851 0.01 *** 

MAF64 0.725 0.701 -0.035 NS 

OarAE133 0.667 0.581 -0.149 NS 

FCB304 0.882 0.852 -0.036 *** 

OarJMP23 0.804 0.797 -0.008 *** 

TGLA122 1 0.865 -0.158 *** 

Mean 0.845 0.798 -0.059 

NS: Not Significant; ***: Significant at the 

0.1% level 

All the three models of microsatellite 

evaluation Infinite Allele Model (IAM), 

Stepwise Mutation Model (SPM) and Two 

Phase Model (TPM) were utilized for the 

purpose. In a population at mutation-drift 

equilibrium (i.e., the effective size of which 

has remained constant in the recent past), 

there is approximately an equal probability 

that a locus shows gene diversity excess or a 

gene diversity deficit. The first test suffers 

from low statistical power. The second test 

is not very useful since it requires at least 20 

polymorphic loci. The Wilcoxon test 

provides relatively high power and it can be 

used with as few as four polymorphic loci 

and any number of individuals (15-40 

individuals and 10-15 polymorphic loci is 

recommend to achieve high power. So, the 

null hypothesis was again rejected under 

IAM for the sign test. Standard difference


test (T2 statistics) in this population provided the 

significant (p

standardized difference test and Wilcoxon rank test 

indicated heterozygosity excess in KJK population. 

The Mode-shift indicator test was also utilized as a 

second method to detect potential bottlenecks, as 

the non-bottleneck populations that are near 

mutation-drift equilibrium are expected to have a 

large proportion of alleles with low frequency. This 

test discriminates many bottlenecked populations 

from stable populations (Luikart et al., 1998; 

Luikart and Cornuet, 1997). The distribution 

followed the normal L-shaped form. The alleles 

with low frequencies (0.01–0.1) are the most 

numerous and proportion of alleles showed a 

normal ‘L’ shaped distribution (figure 1) This 

distribution clearly show that the studied population 

has not experienced a recent bottleneck. 

Figure 1. L-shaped mode-shift graph showing lack 

of recent genetic bottleneck in KJK population 

Severely bottlenecked populations are important 

to identify for conservation, as they are likely to 

suffer from inbreeding depression, loss of genetic 

variation, fixation of deleterious alleles as well as 

increased demographic stochasticity, any of which 

can ultimately reduce adaptive potential and the 

probability of population persistence (Frankham, 

1995). 

Li et al. (2002) studied the genetic equilibrium 

of 12 Chinese goat population's using17 

microsatellite loci, all except three Tibetan 

populations showed deviation from the equilibrium. 

Tantia et al. (2004) reported heterozygosity excess 

and genetic bottleneck in the Indian goat breeds 

(Chegu and Black Bengal). Deviation from 

mutation-drift equilibrium has been reported in 

several populations; however they were mainly 

associated with heterozygosity deficiency viz., in 

Mehsani goats (Aggarwal et al., 2007). Among all 

the seven population of Baltic sheep only Estonian 


Ruhnu population showed a slight distortion 

in distribution of allelic frequency 

(Grigaliunaite et al., 2003). 

Discussion 

In conclusion, there was substantial genetic 

variation and polymorphism across studied 

loci in the KJK goat. And this population 

was not in Hardy-Weinberg equilibrium at 

most of the studied loci. The strong 

inference that the KJK of goat has not 

undergone bottleneck, as it suggests that any 

unique alleles present in this breed may not 

have been lost. Therefore, it can be 

recommended that within breed diversity is 

actively maintained to enable these 

extensively unmanaged stocks to adapt to 

future demands and conditions and there is 

ample scope for further improvement in its 

productivity through appropriate breeding 

strategies. 

Acknowledgments 

This work was support by the Islamic Azad 

University, Meshkinshahr Branch, Iran. 

References 

Aggarwal RAK, Dixit SP, Verma NK, et al. 

Population genetic analysis of Mehsana goat 

based on microsatellite markers. Current 

Science. 92 (8):1133–1137, 2007. 

Avise JC. Mitochondrial DNA 

polymorphism and a connection between 

genetics and demography of relevance to 

conservation. Conservation Biology. 9: 686– 

690, 1995. 

Barker JSF, Tan SG, Moore SS, et al. 

Genetic variation within and relationship 

among populations of Asian goats (Capra 

hircus). J Anim Breed Genet. 118:213-233, 

2001. 

Bassam BJ, Caetano-Anolles G, Gresshoff 

M. Fast and sensitive silver staining of DNA 

in polyacrylamide gels. Anal Biochem. 

196:80-83, 1991.


Botstein D, White RL, Skolnick M, Davis RW. 

Construction of a genetic linkage map in man using 

restriction fragment length polymorphisms. Am. J. 

Hum Genet 32:314–331, 1980. 

Coltman DW, Bowen WD, Wright JM. Birth 

weight and neonatal survival of harbour seal pups 

are positively correlated with genetic variation 

measured by microsatellites. Proceeding Royal 

Society of London (Biological Sciences) 265:803– 

809, 1998. 

Cornuet JM and Luikart G. Description and power 

analysis of two tests for detecting recent population 

bottlenecks from allele frequency data. Genetics 

144: 2001–2014, 1996. 

Di Rienzo A, Peterson AC, Garza JC, et al. 

Mutational processes of simple-sequence repeat 

loci in human populations. Proceeding of National 

Academy of Sciences USA. 91:3166–3170, 1994. 

Frankham R. Effective population size/adult 

population size ratios in wildlife: a review. Genet. 

Res. 66:95–107, 1995. 

Grigaliunaite I, Haldja MT, Grislis VZ, et al. 

Microsatellite variation in the Baltic Sheep breeds. 

Veterinarija Ir Zootechnika. 21: 66-73, 2003. 

Harley EH. AGARST, version 2.8, a program for 

calculating allele frequencies, GST and RST from 

microsatellite data. Wild life Genetics Unit, 

University of Care Town, South Africa, 2002. 

Joshi MB, Rout PK, Mandal A, et al. 

Phylogeography and origin of Indian domestic 

goats. Molecular Biology Evolution. 21: 454–462, 

2004. 

Li MH, Wang HS, Wei H, et al. Genetic 

relationship among 12 Chinese indigenous goat 

populations based on microsatellite analysis. 

Genetic Selection and Evolution. 34:729- 744, 

2002. 

Li SL and Valenti A. Genetic diversity of Chinese 

indigenous goat breeds based on microsatellite 

markers. J Anim Breed Genet. 121: 350–55, 2004. 

Luikart G and Cornuet JM. Empirical 

evaluation of a test for identifying recently 

bottlenecked populations from allele 

frequency data. Conservation Biology. 12: 

228-237,1997. 

Luikart GL, Allendorf FW, Cornuet JM, 

Sherwin WB. Distortion of allele frequency 

distributions provides a test for recent 

population bottlenecks. Journal of Heredity. 

89:238–247, 1998. 

Mahmoudi B, Babayev M Sh, Hayeri 

Khiyavi F, Pourhosein A and Daliri M. 

Breed characteristics in Iranian native goat 

populations. Journal of Cell and Animal 

Biology. 5: 129-134, 2011. 

Nei M. Analysis of gene diversity in 

subdivided populations. Proc. Natl. Acad. 

Sci. USA 70:3321-3323, 1973. 

Piry S, Luikart G, Cornuet JM. 

BOTTLENECK: A program for detecting 

recent effective population size reductions 

from allele frequency data. Journal of 

Heredity. 90: 502–503, 1999. 

Peakall R and Smouse PE. GENALEX 6: 

genetic analysis in Excel. Population genetic 

software for teaching and research. 

Molecular Ecology Notes. 6: 288-295, 2006. 

Ramamoorthi J, Thilagam K, Sivaselvam 

SN, Karthickeyan AMK. Genetic 

characterization of Barbari goats using 

microsatellite markers. Journal of 

Veterinary Science. 10:72–76, 2009. 

Rout PK, Joshi MB, Mandal A, et al. 

Microsatellite-based phylogeny of Indian 

domestic goats.BMC Genetics. 9:11, 2008. 

Saitbekova N, Gaillard C, Obexer-Ruff G, 

Dolf G. Genetic diversity in Swiss goat 

breeds based on microsatellite analysis. 

Animal Genetics. 30: 36–41, 1999.

Sambrook J, Fritsch EF, Maniatis T. Molecular 

cloning: a laboratory manual, 2nd edition. Cold 

Spring Harbor LaboratoryPress, Cold Spring 

Harbor. 1989. 

Tantia MS, Behl R, Sheoran N, et al. Microsatellite 

data analysis for conservation of two goat breeds. 

Ind J Ani Sci. 74: 761-767, 2004. 

Tapiio S, Bennewitz J, Maleviciute E, et al. 

Prioritization for Conservation of Northern 


European Cattle Breeds Based 468 on 

Analysis of Microsatellite Data. 

Conservation Biology. 20: 1768–1779, 

2006. 

Yeh FC and Boyle TJB. Population genetic 

analysis of co-dominant and dominant 

markers and quantitative traits. Belg. J. Bot. 

129: 157, 1997




Low-Stringency Single-Specific-Primer PCR as a tool for 

detection of mutations in the matK gene of Phaseolus vulgaris 

exposed to paranitrophenol 


Agricultural Genetic Engineering Research Institute (AGERI), Agricultural Research Center (ARC), 

Giza, Egypt 

(author for correspondence; mohamed.enan@uaeu.ac.ae) 

Received: 26 April 2012; Accepted: 08 December 2012 

Abstract 

Low-stringency single specific primer polymerase chain reaction (LSSP)-PCR was assessed for its 

suitability in detecting the genotoxic effect of paranitrophenol (PNP) in the dwarf bean (Phaseolus 

vulgaris) exposed to different concentrations of PNP. DNA was extracted from both PNP-treated and 

non-treated shoots that was amplified by specific PCR, using universal primers of maturase K 

chloroplast DNA. PCR products of approximately 776 bp were subsequently used as a template for 

LSSP-PCR analysis. We detected the genotoxic effect based on LSSP-PCR profiles of the DNA 

generated in PNP-treated over the non-treated control of bean shoots. A complex electrophoretic 

pattern consisting of many bands was obtained from control and treated samples. Surprisingly, DNA 

sequencing data revealed that the homology among the maturase gene amplified from PNP-treated vs. 

non-treated samples of dwarf beans are comparable. These results showed that the use of LSSP-PCR 

analysis is not a proper tool to detect genotoxic effect in bean, at least in bean shoots that were 

exposed to PNP. 

Keywords: Genotoxicity, LSSP-PCR, Paranitrophenol, Phaseolus vulgaris, maturase K. 

Özet 

Paranitrofenole maruz kalan Phaseolus vulgaris’te matK geni mutasyonlarının 

tespitinde bir araç olarak Düşük Kesinlikte Tek-Özgün Primerli PCR kullanımı 

Düşük kesinlikte tek özgün primer lipolimeraz zincir reaksiyonunun (LSSP-PCR), paranitrofenolün 

(PNP) sebep olduğu genotoksik etki tespitindeki uygunluğu farklı konsantrasyonlarda PNP’ye maruz 

bırakılan bodur fasülyede (Phaseolus vulgaris) değerlendirildi. PNP ile muamele edilmiş veya 

edilmemiş filizlerden izole edilen DNA, maturaz K kloroplast DNA’sının evrensel primerleri 

kullanılarak özgün PCR ile çoğaltıldı. Hemen akabinde, 776 bç’lık PZR ürünleri LSSP-PCR analizi 

için kalıp DNA olarak kullanıldı. PNP ile işlenmiş fasülye filizinden elde edilen DNA üzerindeki 

genotoksik etkilerin PNP ile işlenmemiş kontrollere olan kıyasını LSSP-PCR profiline dayanarak 

tespit ettik. Kontrol ve işlenmiş örneklerde birçok banttan oluşan karmaşık elektroforetik motifler elde 

edildi. Şaşırtıcı bir şekilde DNA dizi analizi verileri PNP ile işlenmiş ve işlenmemiş bodur fasülye 

örneklerinde çoğaltılan maturaz geni homolojisinin kıyaslanabilir olduğunu gösterdi. Bu sonuçlar, 

LSSP-PCR analizinin fasülyede, en azından PNP ile işlenmiş filizlerde, genotoksik etkinin tespitinde 

uygun bir araç olmadığını gösterdi. 

Anahtar Kelimeler: Genotoksisite, LSSP-PCR, Paranitrofenol, Phaseolus vulgaris, maturaz K.

72 Mohamed R. ENAN 

Introduction 

Maturase K (matK) is a chloroplast-encoded gene 

which is nested between the 5’ and 3’ exons of 

trnK, tRNA-lysine (Sugita et al., 1985). Sequence 

analysis indicated that this region displayed 

homology to domain X of mitochondrial group II 

intron maturases (Sugita et al., 1985; Neuhaus and 

Link, 1987). Although maturase K gene (matK) 

contains many indels (insertions and deletions) 

throughout its reading frame, yet domain X lacks 

any of these indels (Hilu and Liang, 1997; Hilu and 

Alice, 1999; Hilu et al., 2003). Maturase K is the 

only gene found in the chloroplast genome of 

higher plants that contains this putative maturase 

domain X in its protein (Neuhaus and Link, 1987). 

Maturases are considered as splicing factors 

because of their ability to splice and fold group II 

introns. The coding region of matK is generally 

located within intron of the chloroplast trnK gene 

(Vogel et al., 1997). matK is very useful in DNA 

barcoding to genetically identify plant families (Qiu 

et al., 1999; Li and Zhou, 2007). 

Genotoxic compounds are those which cause 

damage to DNA. Para-nitrophenol is a synthetic 

chemical that is used to manufacture drugs, 

fungicides, insecticides (Yang et al., 2010). 

Pesticides, such as parathion and methyl parathion, 

are hydrolyzed and transformed to PNP; which in 

turn these pesticides are considered as the main 

source of PNP that is released to the environment 

(Kitagawa et al., 2004). In vitro assay using CHO 

cell PNP was positive for chromosome aberration 

at levels of 100 µg/ml (Ohno et al., 2005), proving 

the hypothesis that PNP induces chromosomal 

aberrations. 

The LSSP-PCR is a simple technique that 

permits detection of single or multiple mutations in 

gene-sized fragments (Pena et al., 1994). This 

sensitive and rapid method uses PCR amplification 

of a single oligonucleotide primer "driver" that is 

specific to one of the extremities of the fragment, 

under very low stringency conditions (Pena et al., 

1994). In a sequence-dependent manner, the driver 

hybridizes both to the highly specific 

complementary extremity, and to the low 

specificity of multiple sites within the fragment. 

The reaction thus yields a large number of products 

that can be resolved by polyacrylamide gel 

electrophoresis to give rise to a multiband DNA 

fragment "signature" that reflects the underlying 

sequence. Changes as small as single base 

mutations can drastically alter the multiband 

pattern, which ultimately produce new 

signatures. LSSP-PCR has been broadly 

used for the detection of mutations in human 

genetic diseases (Pena et al., 1994), 

sequence variations in human mitochondrial 

DNA (Barreto et al., 1996) and for genetic 

typing of infectious agents such as 

papillomavirus (HPV; Villa et al., 1995), 

Trypanosoma cruzi (Vago et al., 2006), 

Trypanosoma rangeli (Marquez et al., 

2007), and Leishmania infantum (Alvarenga 

et al., 2012). The objective of this study was 

to describe the potential use of LSSP-PCR 

as a molecular biomarker to detect DNA 

mutation in maturase K gene in dwarf bean 

tissues exposed to paranitrophenol. 

Materials and methods 

Plant growth and treatment conditions 

The dwarf bean (Phaseolus vulgaris) was 

used as the plant material in this study. The 

selected seeds were sterilized with 75% 

(v/v) ethanol for 2 min, followed by 20% 

(v/v) sodium hypochlorite for 10 min and 

were washed five times in sterile distilled 

water. Uniformly three plant seedlings were 

transferred to a Magenta box containing MS 

(Murashige and Skoog, 1962) liquid 

medium (control) or supplemented with 

different concentrations of PNP (20, 40, 80, 

160, 320, and 640 µg/ml). PNP-treated 

seedlings were grown for 10 days in the 

growth chamber. Plant growth conditions 

was previously described (Enan, 2006). 

DNA isolation 

DNA was extracted from fresh plant shoots 

using DNeasy plant minikit (Qiagen, USA), 

following the instruction of the 

manufacturer. The final DNA concentration 

was determined by agarose gel 

electrophoresis against known standards 

(Invitrogen, USA). 

Specific PCR amplification of matK 

fragments 

To eliminate any possibility of bacterial 

contamination due to the very low-

stringency conditions of the LSSP-PCR reaction, 

all experiments were carried out with extreme 

precautions. PCR reactions were performed with 

specific primers matK472F (5′- 

CCCRTYCATCTGGAAATCTTGGTTC-3′) and 

matK1248R (5′- 

GCTRTRATAATGAGAAAGATTTCTGC-3′) as 

described by Yu et al. (2011). Amplification of 

specific PCR products was carried out in a volume 

of 25 μl containing 30 ng of genomic DNA and a 

master mix containing 1.5 mM MgCl2, 200 μM of 

each deoxynucleotide (dNPTs), 20 pmol of each 

primer, 1.0 U Taq DNA polymerase (Invitrogen- 

BRL), in 10 mM Tris–HCl [pH 8.0] and 50 mM 

KCl. After an initial denaturation step of 94 °C for 

5 min, the specific PCR program consisted of 35 

cycles of 94 °C for 30 s, 56 °C for 1 min and 72 °C 

for 1 min. The last cycle consisted of an extension 

step at 72 °C for 5 min. The PCR products were run 

on ethidium bromide-stained gel and the bands 

corresponding to the specific fragment (876bp) 

generated by universal specific primers were 

purified using Purelink PCR purification Kit 

(Invitrogen, USA). 

LSSP-PCR analysis 

For the production of LSSP-PCR signatures, 

previously amplified matk fragments were purified 

used as a template in the LSSP-PCR (Pena et al., 

1994). LSSP-PCR was also carried out in a 25μl 

volume containing 5ng of DNA template, 1.5 mM 

MgCl2, 200 μM of the four deoxynucleotide 

triphosphates, 120 pmol of matK472F or 

matK1248R primer 4.0 U Taq DNA polymerase in 

10 mM Tris–HCl [pH 8.0] and 50 mM KCl. After a 

denaturation step at 94 °C for 5 min the LSSP-PCR 

program consisted of 35 cycles of denaturation at 

94 °C for 1 min, annealing at 30 °C for 1 min and 

extension at 72 °C for 1 min. Ten microliters of 

LSSP-PCR products were analyzed by 

electrophoresis on 8% (w/v) polyacrylamide gels 

followed by ethidium bromide. The similarity 

among the LSSP-PCR profiles of control and those 

obtained with the DNA of PNP-treated samples 

was analyzed accordingly. 

DNA sequencing of PCR products 

In order to determine the nucleotide sequence of the 

776 fragments generated with universal specific 

primers, PCR products of control and PNP-treated 

samples were purified and sequenced by Source 

BioScience (Nottingham, UK) according to Sanger 

matK mutations in Phaselous vulgaris 73 

et al. (1977). The sequence was analyzed for 

homology with database sequences with 

Multiple Sequence Alignment by MultiAlin 

(Corpet, 1988). 

Results 

We used the LSSP-PCR method to detect 

mutations in matK gene of dwarf bean 

tissues. DNA was amplified (first step) 

using universal primers to produce 776 bp 

fragments containing the maturase K region 

(Figure 1). 

Each fragment was isolated by 

electroelution and subjected to a second 

PCR amplification (second step) using a 

single primer annealed under low-stringency 

conditions. The generated profiles of the 

PCR products of each sample were resolved 

and analyzed by non-denaturing 

polyacrylamide gel. A complex pattern 

consisting of many bands was obtained 

which was different depending on the 

concentration of PNP. We showed the 

LSSP-PCR profiles of DNA obtained from 

PNP-treated or PNP-untreated samples 

amplified with either matk742 forward 

primer (Figure 2) or matk1248R reverse 

primer matK1248R primer (Figure 3). 

Figure 1. Agarose gel electrophoresis of 

PCR amplification of matk fragment with 

776 bp obtained in control and treated 

samples. Lane M: 100 bp DNA ladder; Lane 

C: untreated sample (control); lanes 1-6: 

plant samples treated with 20, 40, 80, 160, 

320 and 640 µg/ml PNP, respectively.


Figure 2. Ethidium bromide-stained 

polyacrylamide gel electrophoresis showing gene 

signatures obtained by LSSP-PCR with matk742 

forward primer. Lanes M: 100 bp DNA ladder; 

Lane C: untreated sample; lanes 1-6: plant samples 

treated with 20, 40, 80, 160, 320 and 640 µg/ml 

PNP, respectively. 

Figure 3. Ethidium bromide-stained 

polyacrylamide gel showing gene signatures 

obtained by LSSP-PCR with matk1248 reverse 

primer. Lane M: 100 bp DNA ladder; Lane C: 

untreated sample; lanes 1-6: plant samples treated 

with 20, 40 80 160, 320 and 640 µg/ml PNP, 

respectively. 

The LSSP-PCR profiles were unique for each 

treatment, suggesting that this technique may be 

applicable for the detection of genotoxic impact of 

environmental contaminants. The sequence of the 

maturase K gene was deposited in Genbank 

(accession numbers JQ403111). We also 

determined whether these sequence 

identities showed similarities between the 

different samples treated with PNP (Figure 

4). Our sequence alignment data obtained by 

MultiAlin indicated that the sequence 

identities of all treated samples shared 100% 

homology with sequences of untreated 

samples (Figure 4). This suggests that a 

mutation in the matK gene as a hotspot gene 

is not induced by treatment with PNP. 

Discussion 

To our knowledge, this is the first study to 

employ LSSP-PCR for monitoring 

biological effects of pollution. Molecular 

biomarkers are effective early warning 

signals of adverse biological effects. The 

purpose of this study was to evaluate the 

performance of LSSP-PCR method in the 

detection of genotoxic effect of 

paranitrophenol (PNP) on dwarf beans 

(Phaseolis vulgaris). In the past 25 years, 

numerous biomarkers have been developed 

with the objective to apply them for 

environmental biomonitoring (Sanchez and 

Porcher, 2009). Molecular marker 

techniques have provided new tools of 

detection of mutations in DNA in response 

to chemical pollution using DNA sequence 

and structure. The alterations in genomic 

DNA induced by genotoxic pollutants can 

be monitored using different biomarkers’ 

assays both at the biochemical and the 

molecular levels. In the past few years, 

several of techniques revealed that 

mutations in DNA could be generated and 

identified mostly by the polymerase chain 

reaction (PCR). Some of the examples of 

PCR assays were utilized to detect genotoxic 

effects of environmental pollutants arbitraryprimed 

PCR (AP-PCR; Welsh and 

McClelland, 1990) and randomly amplified 

polymorphic DNA (RAPD) (Williams et al., 

1990). One of the main advantages of using 

LSSP-PCR for studies related to 

genotoxicity is that the signatures were not 

unduly sensitive to the concentration of 

DNA template.


Figure 4. DNA sequences of the matK genes from untreated and PNP-treated plant samples aligned 

by using MultiAlin.


In the present study, genotoxic effect of PNP 

was performed using LSSP-PCR that can detect 

single or multiple mutations in gene-size DNA 

fragments. The chloroplast maturase K gene 

(matK) is one of the most variable coding genes of 

angiosperms, which has been suggested to be a 

“barcode” for land plants (Yu et al., 2011). Good 

reproducibility as a solution in the LSSP-PCR 

profiles using both forward and reverse primers 

was obtained. However, we observed that many of 

these bands are larger than the template. Our results 

confirm the data obtained from other studies that 

PCR products of the first few cycles may 

themselves act as primers in further rounds of 

amplification (Barreto et al., 1996). In the current 

study, the sequenced PCR products of matK 

fragment confirmed the results of the specific PCR 

(Figure 1). On the other hand, unexpectedly, the 

data of sequence alignment quite contradicts that of 

the LSSP-PCR signatures. Sequence alignment of 

all PNP-treated samples of dwarf bean with the 

untreated control samples indicated that there is no 

any nucleotide substitution in the matK sequence. 

In previous study, Oliveira et al. (2003) described 

that, very similar signatures were obtained with 

specific primers (G1 and G2) for identification of 

Leptospira interrogans serovars. Although the 

sequence data of the 285 bp fragments of the three 

serovars of L. interrogans indicated the presence of 

three nucleotide alterations in these fragments, they 

found that identical LSSP-PCR profiles were 

obtained for the three serovars with individual 

primers of G1 and G2. Barreto et al. (1996) 

reported that the variations observed in LSSP-PCR 

are attributed to several variables: (i ) the number 

of cycles has a marked effect on the signature up to 

35 cycles (ii) the ramping speed of thermocyclers ( 

type of thermo cyclers) had marked effect on the 

LSSP-PCR signatures and (iii) changes in the 

annealing temperature a range between 25-35◦C 

had no marked effect but Ta > 40◦C showed a 

deterioration of the signature. 

In conclusion, the chloroplast matk used in this 

study as a molecular biomarker gene to measure 

genotoxicity of PNP using LSSS-PCR, is not 

affected by PNP at DNA level but may be down 

regulated at transcriptional or post-transcriptional 

levels, which should be confirmed in further 

studies. 

Acknowledgment 

The author would like to thank a lot Dr 

Synan Abu Qamar, Ph.D, Purdue University 

for his critical revising and constructive 

comments on the manuscript. 

References 

Alvarenga JSC, Ligeiro CM, Gontijo CMF, 

et al. KDNA genetic signatures obtained 

by LSSP-PCR analysis of Leishmania 

(Leishmania) infantum isolated from the 

new and the old world. PLoS ONE 7: 

e43363, 2012 

Barreto G, Vago AR, Ginther C, et al. 

Mitochondrial D-loop ‘‘signatures’’ 

produced by low-stringency single 

specific primer PCR constitute a simple 

comparative human identity test. Am J 

Hum Gene.t 58: 609–616, 1966. 

Corpet F. Multiple sequence alignment with 

hierarchical clustering. Nucl Acids Res. 

16: 10881-10890, 1988 

Enan MR. Application of random amplified 

polymorphic DNA (RAPD) to detect the 

genotoxic effect of heavy metals. 

Biotechnol. Appl. Biochem. 43: 147–154, 

2006. 

Hilu KW and Alice LA. Evolutionary 

implications of matK indels in Poaceae. 

Am J Bot. 86: 1735-1741, 1999. 

Hilu KW, Borsch T, Muller K, et al. 

Angiosperm phylogeny based on matK 

sequence information. Am J Bot. 90: 

1758–1776, 2003. 

Hilu KW and Liang H. The matK gene: 

sequence variation and application in 

plant systematics. Am J Bot. 84: 830- 

839, 1997. 

Kitagawa W, Kimura N, Kamagata Y. A 

Novel p-nitrophenol degradation gene 

cluster from a gram-positive bacterium, 

Rhodococcus opacus SAO101. J 

Bacteriol. 186: 4894-4902, 2004. 

Li X-X and Zhou ZK. The higher-level 

phylogeny of monocots based on matK, 

rbcL and 18S rDNA sequences. Acta

Phytotaxonomica Sinica 45: 113–133, 2007. 

Murashige T and Skoog FA. A revised medium for 

rapid growth and bioassay with tobacco tissue 

cultures. Physiol Plant. 15: 473–479, 1962. 

Neuhaus H and Link G. The chloroplast tRNA Lys 

(UUU) gene from mustard (Sinapis alba) 

contains a class II intron potentially coding for a 

maturase-related polypeptide. Curr Genet. 11: 

251–257, 1987. 

Ohno K, Tanaka-Azuma Y, YonedaY, Yamada T. 

Genotoxicity test system based on p53R2 gene 

expression in human cells: Examination with 80 

chemicals. Mutat. Res. 588: 47-57, 2005. 

Oliveira MAA, Caballero OLSD, Vago AR, et al. 

Low-stringency single specific primer PCR for 

identification of Leptospira. J Med Microbiol. 

52: 127–135, 2003. 

Pena SDJ, Barreto G, Vago AR, et al. Sequencespecific 

‘gene signatures’ can be obtained by 

PCR with single specific primers at low 

stringency. Proc Natl Acad Sci USA, 91: 1946– 

1949, 1994. 

Qiu, Y L, Lee J, Bernasconi-Quadroni F, et al. The 

earliest angiosperms: evidence from 

mitochondrial, plastid, and nuclear genomes. 

Nature. 402: 404-407, 1999. 

Sanchez W and Porcher JM. Fish biomarkers for 

environmental monitoring within the Water 

Framework Directive of the European Union. 

TrAC Trends in Analytical Chemistry. 28: 150- 

158, 2009. 

Sanger F, Nicklen S, Coulson AR. DNA 

sequencing with chain-terminating inhibitors. 

Proc Natl. Acad. Sci. USA, 74: 5463–5467, 

1977. 

Sugita M, Shinozaki K, Sugiura M. Tobacco 

chloroplast tRNALys (UUU) gene contains a 


2.5-kilobase-pair intron: an open reading 

frame and a conserved boundary 

sequence in the intron. Proc Natl Acad 

Sci USA. 82:3557-3561, 1985. 

Vago AR, Macedo AM, Oliveira RP, et al. 

Kinetoplast DNA signatures of 

Trypanosoma cruzi strains obtained 

directly from infected tissues. Am J 

Pathol 149: 2153–2159, 2006. 

Villa LL, Caballero OL, Levi JE, et al. An 

approach to human papilloma virus 

identification using low-stringency 

single specific primer PCR. Mol Cell 

Probes. 9: 45-48, 1995. 

Vogel J, Hübschmann T, Börner T, Hess 

WR. Splicing and intron- internal RNA 

editing of trnK-matK transcripts in 

barley plastids: support for matK as an 

essential splicing factor. J Mol Biol. 270: 

179–187, 1997. 

Welsh J and McClelland M. Fingerprinting 

genomes using PCR with arbitrary 

primers. Nucleic Acids Res. 19: 861–866, 

1990. 

Williams JGK, Kubelik AR, Livak KJ, et al. 

DNA polymorphisms amplified by 

arbitrary primers are useful as genetic 

markers. Nucleic Acids Res. 18: 6531- 

6535, 1990. 

Yang L, Luo S, Li Y, et al. High efficient 

photocatalytic degradation of pnitrophenol 

on a unique Cu2O/TiO2 p-n 

heterojunction network catalyst. Environ 

Sci Technol. 44: 7641–7646, 2010. 

Yu J, Xue JH, Zhou SL. New universal 

matK primers for DNA barcoding 

angiosperms. J Syst Evol. 49: 176-181, 

2011.

Journal of Cell and Molecular Biology 10(2):79-83, 2012 Short Communication 79 




Sérgio Salla CHAGAS 1 , Rodrigo Almeida VAUCHER 2 , Adriano BRANDELLI 2,* 

1 

Laboratório Nacional Agropecuário (LANAGRO/RS), Estrada da Ponta Grossa 3036, Porto Alegre, 

Brazil. 

2 

Laboratório de Bioquímica e Microbiologia Aplicada, Instituto de Ciência e Tecnologia de 

Alimentos, Universidade Federal do Rio Grande do Sul, 91501-970 Porto Alegre, Brazil. 

(*author for correspondence: abrand@ufrgs.br) 

Received: 24 February 2012; Accepted:11 November 2012 

Abstract 

Paenibacillus larvae is the agent of American Foulbrood disease (AFB), causing the death of the hive 

and greatly affecting beekeeping. In Brazil, this bacterium was only isolated in the states of Rio 

Grande do Sul and Paraná. The present study aimed to characterize the strains isolated in Brazil, 

confirming its identification by molecular diagnosis. Eighty isolates from samples of honey, 

honeycomb and pollen collected between 2002 and 2007 from different regions were selected for 

analysis. Phenotypical characterization indicates that 77 strains were P. larvae but 3 strains showed 

inconclusive results. PCR protocols based on detection of 16S rDNA and metalloproteinase gene 

confirmed all strains being P. larvae. The PCR amplicon of 16S rDNA was sequenced, and 

phylogenetic analysis was performed. The results indicated that there is high homology among the 

strains isolated in Brazil. 

Keywords: Paenibacillus larvae, 16S rDNA, metalloproteinase, American foulbrood disease, 

phylogenetic analysis 

Özet 

Brezilya’dan Paenibacillus larvae izolatlarının karakterizasyonu 

Paenibacillus larvae kovanın ölümüne sebep olan ve büyük oranda arıcılığı etkileyen Amerikan yavru 

çürüklüğü hastalığının (AFB) etkenidir. Brezilya’da bu bakteri sadece Rio Grande do Sul ve Paraná 

eyaletlerinde izole edilmiştir. Bu çalışma moleküler tanı ile yapılan identifikasyonu doğrulayarak 

Brezilya’da izole edilen suşları karakterize etmeyi amaçlamıştır. Farklı bölgelerden 2002 ve 2007 

yılları arasında toplanan bal, petek ve polen örneklerinden elde edilen seksen izolat analiz için 

seçilmiştir. Fenotipik karakterizasyon 77 suşun P. larvae olduğunu, fakat 3 suşun yetersiz sonuç 

gösterdiğini belirtmektedir. Metalloproteinaz geni ve 16SrDNA’nın saptanmasına dayanan PCR 

protokolleri tüm suşların P. larvae olduğunu doğrulamaktadır. 16SrDNA PCR amplikonu 

dizilenmiştir ve filogenetik analiz yapılmıştır. Sonuçlar Brezilya’da izole edilen suşlar arasında 

yüksek homoloji olduğunu göstermektedir. 

Anahtar Kelimeler: Paenibacillus larvae, 16S rDNA; metalloproteinaz; Amerikan yavru çürüklüğü 

hastalığı, filogenetik analiz

80 Sérgio Salla CHAGAS et al. 

Introduction 

The American foulbrood (AFB) is a notifiable 

disease of high economic importance and 

significant international trade (OIE, 2009). Its 

causative agent, Paenibacillus larvae, attacks only 

the larval stage of the bee Apis mellifera and other 

Apis spp. (Genersch, 2010). P. larvae are only 

infective in the form of spores, which are extremely 

tenacious and can remain viable for many years 

(Genersch, 2008). Infection occurs by ingestion of 

spores that germinate and spread after 24 hours, 

producing septicemia and death (Allipi, 1992). The 

clinical symptoms are typical, and the larvae have 

affected to a dark and viscous form. Besides food 

with honey containing spores, the introduction of 

bees from hives infected and even beekeepers could 

help its spread (Genersh, 2010). 

In South America, the first isolation of P. larvae 

occurred in 1989 in Argentina (Allipi, 1992), and 

subsequently in Uruguay (Antunez et al., 2004). In 

Brazil, despite efforts to prevent its introduction, 

honey contaminated with P. larvae was found in 

the state of Rio Grande do Sul in 2002 (Schuch et 

al., 2003). More recently, the occurrence of P. 

larvae was reported in hives in the state of Paraná 

(MAPA, 2006). The aim of this work was to 

confirm the presence of P. larvae by molecular 

methods and to characterize the strains isolated in 

Brazil. 


This study used 80 isolates of P. larvae, originated 

from samples of honey, honeycomb and pollen 

collected from different Brazilian regions between 

May 2002 and June 2007 by Laboratório Nacional 

Agropecuário (LANAGRO/RS, Ministry of 

Agriculture, Brazil), for the microbiological 

analysis for the detection of spores (Schuch et al., 

2002). Of these 80 isolates, 30 were from suspected 

samples and 50 originated from the process of 

importation. Aliquots of 20 g of the various 

products were diluted to 40 ml of distilled water 

and centrifuged at 6000 g for 10 min. The pellet 

obtained was resuspended in 1 ml of distilled water, 

heated to 80°C for 10 min and seeded on selective 

P. larvae agar plates (Schuch et al., 2002). These 

plates were incubated at 35°C, and monitored for 5 

days. 

Isolated colonies were suspended in distilled 

water and subjected to bacterial DNA extraction 

using phenol-chloroform. P. larvae ATCC 9545 

was used as a positive control. Bacillus 

cereus ATCC 11778 and Paenibacillus alvei 

isolated by LANAGRO/RS (Porto Alegre, 

Brazil), were used as negative controls. The 

amplification of the 16S rDNA was through 

a nested PCR protocol, conducted in the 

GeneAmp PCR System 2400 equipment 

(Applied Biosystems, Foster City, CA, 

USA). The amplification was initially 

performed with external primers Ple(F) 

TCGAGCGGACCTTGTGT and Ple(R) 

CTATCTCAAAACCGCTCAGAG, and 

then with the external primers Pli (F) 

CTTCGCATGAAGAAGTCATC and 

Pli(R) TCAGTTATAGGCCAGAAAGC. 

The final concentrations of reagents were 

0.2 mM of each primer, 1.25 U Taq DNA 

polymerase, 0.2 mM dNTPs, 1.5 mM 

MgCl2, 5 μl of DNA (20 ng/μl) in a reaction 

volume of 25 μl (Lauro et al. 2003). The 

primers MpPl(F) 

CGGGCAGCAAATCGTATTCAG and 

MpPl(R) 

CCATAAAGTGTTGGGTCCTCTAAG 

were used for amplification of 

metalloproteinase gene. The final 

concentrations of reagents was 1 mM of 

each primer, 1 U Taq DNA polymerase, 0.2 

mM of dNTPs , 2.0 mM MgCl2, 5 μl of 

DNA (20 ng/μl) in a reaction volume of 25 

μl (Kilwinski et al., 2004). The amplified 

DNA was subjected to electrophoresis in 1% 

agarose gel stained with ethidium bromide. 

The PCR products obtained by 

amplification with primers Pli were purified 

using the kit PureLink Quick Gel Extraction 

(Invitrogen, Carlsbad, CA, USA) and 

sequenced. The reaction was carried out 

using the sequencing kit Big Dye 

Terminator (Applied Biosystems), according 

to the manufacturer’s instructions. The 

analysis was performed on a 16 capillary 

sequencer, model ABI 3130xl (Applied 

Biosystems). The sequences of the 16S 

rDNA were established, and the BLAST 

algorithm was used to find homologous 

sequences. The calculation of the distance 

and the construction of the phylogenetic tree 

were carried out by the neighbor-joining 

method, with the help of the software

MegaBACE version 3.1 (Kumar et al., 2004). 

Results 

When microbial growth was observed on selective 

medium, three colonies of each plate were selected 

on the basis of colony morphology (hyaline aspect, 

flat edges and flat center) and presence of a zone of 

Characterization of Paenibacillus larvae 81 

proteolysis for confirmatory tests (reaction 

to catalase and Gram stain). Most of the 

isolates were positive for P. larvae. Two 

isolates from honeycomb showed atypical 

colony morphology and one isolate from 

pollen showed positive catalase reaction and 

atypical morphology (Table 1). 

Table 1. Evaluation of Paenibacillus larvae isolated from honey, honeycomb and pollen samples 

(2002-2007). 

Sample n Typical colony 

Negative catalase 

morphology reaction 

Honey 37 37 37 37 

Honeycomb 35 33 35 35 

Pollen a 8 7 7 8 

Total 80 77 79 80 

a 

The same pollen sample showed atypical colony morphology and positive catalase reaction. 

The PCR protocols allowed definitive identification 

of P. larvae by observing the specific amplification 

of the 16S rDNA and metalloproteinase genes (Fig. 

1). All the 80 isolates responded to this approach, 

showing the presence of expected PCR fragments 

Positive PCR 

results 

with primers Ple (969 bp), Pli (572 bp) and 

MpPl (271 bp). The specificity of amplicons 

was checked by sequencing. Amplification 

was not observed in the samples of negative 

controls. 

Figure 1. Agarose gel electrophoresis of PCR products. Bacillus cereus ATCC 11778 (B,C, 16S 

rDNA; D, metalloproteinase); Paenibacillus larvae ATCC 9545 (E,F, 16S rDNA; G, 

metalloproteinase); Paenibacillus alvei (H, I, 16S rDNA; J, metalloproteinase); Paenibacillus larvae 

(K,L, 16S rDNA; M, metalloproteinase); A,N = 100 bp ladder.


The sequences were aligned with sequences 

obtained from the GenBank database (accession no. 

in parentheses) of the following strains: 

Paenibacillus brasiliensis (D78476), Paenibacillus 

glucanolyticus (D885140), Paenibacillus alvei 

(X60604), Paenibacillus koreensis (AF130254), 

Paenibacillus larvae (AY030079), Paenibacillus 

alginolyticus (D78465), Paenibacillus azotofixans 

(AJ 251192) and Paenibacillus polymyxa (AY 

3596370). All P. larvae isolates investigated in this 

study had >99% identity with the 16S rDNA 

sequence of P. larvae (AY030079). These results 

are the first sequencing of strains of P. larvae 

isolated in Brazil and show that these strains are 

highly correlated. 

Discussion 

Strains of P. larvae isolated from samples of honey, 

honeycomb and pollen in Brazil were 

characterized. Results from the microbiological 

investigation often confirmed the presence of P. 

larvae observed by growing in selective medium. 

The most common discrepancy was on colony 

morphology. Some degree of inconclusive results 

from phenotypical characteristics could be expected 

since different P. larvae genotypes may present 

differences in morphological and physiological 

characteristics (Genersch, 2010). 

Although the isolation of the microorganism of 

interest is often the gold standard for microbial 

identification, molecular diagnosis may permit an 

early detection of P. larvae, before the clinical 

signs of the disease, in time to implement proper 

control measures. In addition, some samples 

showed inconclusive results in microbiological 

testing, thus molecular verification may provide 

security to the diagnosis. As an example, PCR 

allowed to identify P. larvae in 91% of honey 

samples, against 57% observed by cultural methods 

(Lauro et al., 2003). 

The high similarity among isolates of P. larvae, 

together with the fact that until now there was only 

one record on the presence of P. larvae in the state 

of Rio Grande do Sul and one outbreak notification 

in the state of Paraná, may indicate that this 

pathogen was recently introduced in Brazil. 

Phenotypic and genotypic characterization of P. 

larvae isolated in the neighbor country Uruguay 

revealed high strain similarity (Antunez et al., 

2007), while samples from Austria and Germany 

show higher genetic diversity (Peters et al., 

2006; Loncaric et al., 2009). 

The evolution of the disease in South 

America (Allipi, 1992; Antunez et al., 2004) 

direct to the strong control health deployed 

to prevent the introduction of this pathogen 

and its spread in the Brazilian territory. The 

need for continuous surveillance indicates 

that PCR-based methods for rapid detection 

of P. larvae may be useful tools to be 

adopted by regulatory agencies. 

References 

Allipi AM. A comparison techniques for the 

detection of significant bacteria of the 

honey bee, Apis mellifera, in Argentina. 

J Apicult Res. 30: 75-80, 1992. 

Antunez K, D’Alessandro B, Piccini C, et 

al. Paenibacillus larvae spores in honey 

samples from Uruguay: a nationwide 

survey. J Invertebr Pathol. 86: 56-58, 

2004. 

Antunez K, Piccini C, Castro-Sowinski S, et 

al. Phenotypic and genotypic 

characterization of Paenibacillus larvae 

isolates. Vet Microbiol. 124: 178-183, 

2007. 

Genersh E. Paenibacillus larvae and 

American Foulbrood - long since known 

and still surprising. J Verbr Lebensm. 3: 

429-434, 2008. 

Genersh E. American Foulbrood in 

honeybees and its causative agent, 

Paenibacillus larvae. J Invertebr Pathol. 

103: S10-S19, 2010. 

Kilwinski J, Peters M, Ashiralieva A, 

Genersch E. Proposal to reclassify 

Paenibacillus larvae subsp. pulvifaciens 

DSM 3615 (ATCC 49843) as 

Paenibacillus larvae subsp. larvae. 

Results of a comparative biochemical 

and genetic study. Vet Microbiol. 104: 

31-42, 2004. 

Kumar S, Tamura K, Nei M. MEGA3: 

Integrated software for Molecular 

Evolutionary Genetics Analysis and 

sequence alignment. Brief Bioinformat. 

5: 150-163, 2004.


Lauro FM, Favaretto M, Covolo L, et al. Rapid 

detection of Paenibacillus larvae subsp. larvae 

from honey and hive samples with a novel 

nested PCR protocol. Int J Food Microbiol. 81: 

195-201, 2003. 

Loncaric I, Derakhshifar I, Oberlerchner JT, et al. 

Genetic diversity among isolates of 

Paenibacillus larvae from Austria. J Invertebr 

Pathol. 100: 44-46, 2009. 

MAPA. Nota técnica DSA nº52/2006. Ocorrência 

de “Cria Pútrida Americana” no município de 

Quatro Barra, estado do Paraná-Brasil. Ministry 

of Agriculture of Brazil, Brasília, 2006. 

OIE. American Foulbrood. Manual of standards for 

diagnostic tests and vaccines for lists A and B 

diseases of mammals, birds and bees. Office 

International des Epizooties, Paris. pp. 687-693, 

2009. 

Peters M, Kilwinski J, Beringhoff A, et al. 

American Foulbrood of the honey bee: 

occurrence and distribution of different 

genotypes of Paenibacillus larvae in the 

administrative district of Arnsberg (North 

Rhine-Westphalia). J Vet Med B. 53: 100-104, 

2006. 

Schuch DMT, Madden RH, Sattler A. An improved 

method for the detection and presumptive 

identification of Paenibacillus larvae subsp. 

larvae spores in honey. J Apicult Res. 40: 59- 

64, 2002. 

Schuch DMT, Tochetto LG, Sattler A. Relato do 

primeiro isolamento oficial de esporos de 

Paenibacillus larvae subsp. larvae no Brasil em 

colméia sem sinais clínicos de Cria Pútrida 

Americana. Pesq Agropec Bras. 38: 441-444, 

2003.

Journal of Cell and Molecular Biology - GUIDELINES for AUTHORS 

General 


(JCellMolBiol) is an international journal which 

covers original works in the field of cell biology, 

molecular biology, genetics, microbiology, 

neurobiology, bioinformatics and related topics. 

The official language of the journal is English, 

however manuscripts in Turkish are accepted as 

well. 

Conditions for publication 

This journal publishes research articles, review 

articles, short communications, book/software 

reviews, case reports and letters to the editor. 

Research articles: Only original contributions will 

be accepted which have not been published 

previously. Manuscripts should not exceed 15 

papers of printed text, including tables, figures and 

references 

Review articles: Reviews of recent developments in 

a research field and ideas will be accepted. 

Manuscripts should not exceed 15 papers of printed 

text. Illustrations are encouraged. 

Short communications: These include small-scale 

investigations or innovative methods, techniques, 

clinical trials and epidemiological studies. It should 

not exceed 3 pages. 

Letters to editor: These include opinions, news and 

suggestions. Letters should not exceed 2 papers of 

printed text. 

Case Reports: These include individual 

observations based on small numbers of subjects. 

This type of research cannot indicate causality but 

may indicate areas for further research. 

REVISED 

December, 2011 

Manuscripts should be submitted by e-mail to: 


Haliç Üniversitesi 

Fen Edebiyat Fakültesi 

Moleküler Biyoloji ve Genetik Bölümü 

Sıracevizler Cad. No:29 

Bomonti-Şişli 34381, İstanbul-TÜRKİYE 

Tel: +90 212 343 08 87, Fax: +90 212 231 06 31 

E-Mail: jcmb@halic.edu.tr 

83 

Book/software reviews: Short but concise 

description of the book/software, not exceeding a 

page. Book/software reviews are not peer reviewed. 

Presentation 

Papers should be typed clearly, double-spaced with 

3 cm wide margins. 

Manuscripts should be prepared using Word 

Processor. 

Cover Letter: You may briefly explain your work 

and its contribution to present knowledge. 

Title Page: The first page of your manuscript 

should be a title page containing the type of paper; 

the title; all authors' full names, and affiliations; 

and the corresponding author's contact address 

(including phone and fax numbers) and e-mail 

address. The title should be as short as possible, but 

should give adequate information regarding the 

contents. Authors should also state a running title 

of no more than 50 characters including spaces. 

All pages must be numbered. 

Full Paper 

The full paper should be divided into the following 

parts in the order indicated:

84 

Abstract: A brief, informative abstract, not 

exceeding 200 words, should be provided in 

English and in Turkish. For authors who are not 

native Turkish speakers, JCellMolBiol can provide 

the Turkish abstract. 

Keywords: Immediately following the abstract, 

authors should provide 5 keywords or phrases that 

reflect the content of the article. 

Introduction should include theory, hypotheses, 

prior work 

Material and methods may include subheadings 

Results: If the study consists of different parts, 

subheadings in this section should be consistent 

with subheadings in the methods. 

Discussion 

Acknowledgements should precede the list of 

references 

References: Papers cited in the manuscript should 

be listed in alphabetical order according to the first 

author's surname. 

Tables and Figures 

• Tables and figures should both be embedded 

within the text in their appropriate positions and be 

submitted separately. 

• Electronically submitted figures are preferred in 

*.jpg or *.tiff (min. 300 dpi) formats. Bar scales 

should be drawn directly on the figures when 

necessary. Figure legends should not be included in 

the *jpg or *tif files. 

• Each table should be accompanied by a short 

instructive title line plus an explanatory caption at 

the top. Indicate footnotes within tables by 

superscript letters and type footnotes below the 

table. 

• All the tables and figures must be referred to 

within the text. 

Units, Abbreviations and Scientific Names 

• Only SI units should be used. Current 

abbreviations can be used without explanation, 

others must be explained. 

• All acronyms/abbreviations must be explained 

in parenthesis after their first occurrence. If many 

unfamiliar acronyms/abbreviations are used, please 

compile them in an "Abbreviations" section at the 

end of the paper. 

• Latin expressions should be typed in italics. 

Referencing 

• In the text, citations with two authors should 

take the form: Smith and Robinson,1990. If several 

papers are cited by the same author in the same 

year, they should be lettered in sequence (1990a), 

(1990b), etc. When papers are by more then two 

authors they should be cited as Smith et al.,1990. In 

cases where more than one reference is written for 

the same sentence, they should appear in ascending 

publication order, e.g. (Jones et al., 2005; Smith et 

al., 2007; Brown et al., 2009). 

• In the list, references must be placed in 

alphabetical order. The following models for the 

reference list cover all situations. The punctuation 

given must be exactly followed. The journal titles 

should be abbreviated appropriately. 

Redford IR. Evidence for a general relationship 

between the induced level of DNA double 

strand breakage and cell killing after Xirradiation 

of mammalian cells. Int J Radiat 

Biol. 49: 611- 620, 1986. 

Tccioli CE, Cottlieb TM, Blund T. Product of the 

XRCCS gene and its role in DNA repair and 

V(D)J recombination. Science. 265: 1442-1445, 

1994 

Ohlrogge JB. Biochemistry of plant acyl carrier 

proteins. The Biochemistry of Plants: A 

Comprehensive Treatise. Stumpf PK and Conn 

EE (Ed). Academic Press, New York. 137-157, 

1987. 

Brown LA. How to cope with your supervisor. PhD 

Thesis. University of New Orleans, 2005. 

Web document with no author: Leafy seadragons 

and weedy seadragons 2001. Retrieved 

November 13, 2002, from http:// www. 

windspeed.net.au/jenny/seadragons/ 

Web document with author: Dawson J, Smith L, 

Deubert K. Referencing, not plagiarism. 

Retrieved October 31, 2002 from http: 

//studytrekk.lis.curtin.edu.au/ 

• Only papers published or in press should be 

cited in the literature list. Unpublished results, 

including submitted manuscripts and those in 

preparation, should be indicated as unpublished 

data in the text. 

Submission Policies and Authorship 

REVISED 

December, 2011

Upon submission of a manuscript, it is accepted 

that all co-authors have approved the contents of 

the manuscript and its submission by the 

corresponding author, and that the corresponding 

author is authorized to represent all co-authors in 

pre-publication discussions with JCellMolBiol. 

The corresponding author is responsible for 

ensuring that all the contributors to the relevant 

work are listed as authors and that all authors have 

aggreed to the manuscript’s content and its 

submission to the JCellMolBiol. In case the Journal 

happens to be aware of an authorship dispute, 

authorship must be approved in writing by all of the 

parties. 

Cost 

There are no submission fees or page charges. 

Criteria for the Selection of Manuscripts 

Manuscripts should meet the following criteria: The 

study conducted is material is original and ethical, 

the writing is clear; the study methods are 

appropriate, the data are valid, the conclusions are 

reasonable and supported by the data; the 

information is important; and the topic is 

interesting to our readership. 

Editorial Processes 

Researchers may request informal feedback from 

the editors in a particular manuscript. The 

presubmission process aids in the submission 

decision for authors. 

When JCellMolBiol receives a manuscript, the 

Editor-in-Chief will first decide whether the 

manuscript meets the formal criteria specified with 

“Guidelines for Authors” and whether it fits within 

the scope of the Journal. In case of doubt on the 

basis of initial review, the Editor-in-Chief will 

consult other members of the Editorial Board. 

Manuscripts that are found suitable for peer review 

will be assigned to two expert reviewers. Reviewers 

may either be Editorial/Advisory Board members 

or external experts selected by the Editorial Board. 

The corresponding author is notified by e-mail 

when the editor decides to send a paper for review. 

The reviewers will have up to three weeks to 

review the submitted article. After peer review, the 

editor will contact the author. If the author is 

required to submit a revised version, the revised 

version has to be submitted by the author within 

two weeks. Otherwise, the manuscript will be 

REVISED 


85 

removed from the manuscript submission queue 

and will be considered rejected. 

In cases where the referees have requested welldefined 

changes to the manuscript, editors may 

request a revised manuscript that addresses to 

referees’ concerns. The revised version is sent back 

to the original referees for re-review. In cases 

where the referees’ concerns are more wideranging, 

editors may reject the manuscript. The 

revised manuscript should be accompanied by a 

cover letter that includes a point-by-point response 

to referees’ comments and an explanation of how 

the manuscript has been changed. 

As a matter of policy, we do not suppress referees’ 

reports, any comments directed to authors are 

transmitted regardless of what we may think of the 

content. On rare occasions, we may edit a report to 

remove offensive language or comments to reveal 

confidentiality. 

The final decision to accept or reject a manuscript 

will be made by the Editor-in-Chief. If it becomes 

apparent that there are serious problems with the 

scientific content or with violations of our 

publishing policies, the Editor-in-Chief also 

reserves the right to reject a paper even after it has 

been accepted. 

After acceptance, the Editor-in-Chief may make 

further changes to the text and figures so that the 

manuscript is readable and clear. Page proofs will 

be sent to the corresponding author via email for 

checking before publication. Corresponding authors 

are sent proofs and are welcome to discuss 

proposed changes with the Editor-in-Chief, but 

JCellMolBiol reserves the right to make the final 

decision about the style. Corrected proofs should be 

sent back within three days of receipt, otherwise the 

Editor-in-Chief reserves the rights to correct the 

proofs himself and to send the material for 

publication. In cases where the authors do not 

submit the appropriately signed Publication 

Agreement Form, the manuscript is drawn from 

publication process even if it is accepted. 

Appeals 

Authors have the right to ask the Editor-in-Chief to 

reconsider a rejection decision, which is considered 

an appeal. Decisions are reversed only if the Editor 

is convinced that the original decision was a serious 

mistake. If an appeal merits further consideration, 

the Editor may send the author’s response or the 

revised paper to one or more referees, or Editor

86 

may ask one referee to comment on the concerns 

raised by another referee. 

Advance Online Publication 

JCellMolBiol provides Advance Online Publication 

of articles, which benefit authors with an earlier 

publication date and allows the readers’ access to 

accepted papers several weeks before they appear 

in print 

Ethical Issues 

For manuscripts reporting experiments on live 

vertebrates or higher invertebrates, authors must 

declare that the study was approved by the 

institutional ethics committee. Papers describing 

investigations on human subjects must include a 

statement that informed consent was obtained from 

all subjects. 

Plagiarism 

If portions of the manuscript have already been 

published by the author on other journals or 

websites, JCellMolBiol Editorial Board needs to 

know which portions of the manuscript have been 

previously published and where. The author should 

include a note in the cover letter indicating which 

portions have been published elsewhere. 

In case of any suspicion on scientific misconduct or 

dishonesty in research, JCellMolBiol reserves the 

right to forward any submitted manuscript to an 

appropriate authority for investigation. 

Copyright Notice 

It is the responsibility of the submitting author to 

ensure that the authorship of the paper reflects the 

contributions of the authors to the work described, 

and that all listed authors have agreed to the 

submission of the manuscript in its current form. 

Conditions of publication in JCellMolBiol are that 

the paper has not already been published elsewhere; 

that it is not currently being considered for 

publication else-where; all persons designated as 

authors should qualify for authorship, and all those 

who qualify should be listed. If accepted, Haliç 

University and JCellMolBiol have the exclusive 

license to publish. 

JCellMolBiol is freely available to individuals and 

institutions. Copies of this Journal and articles in 

this journal may be distributed for research or for 

educational purposes free of charge. However, 

REVISED 


commercial use of articles contained herein is 

prohibited without the written consent of the 

Editor-in-Chief. 

Publication Agreement 

The corresponing author is required to assign the 

Publication Agreement Form in order to publish the 

submitted manuscript in JCellMolBiol.


Volume 10 · No 2 · December 2012 

Review Articles 



S. TRIVEDI 

Marker Systems and Applications in Genetic Characterization Studies 

Y. ÖZŞENSOY, E. KURAR 

Research Articles 


N. SAFAVIZADEH, S. A. RAHMANI , M. ZAEFIZADEH 

Curcumin rendered protection against cadmium chloride induced testicular damage in 

Swiss albino mice 

P. SINGH, K. DEORA, V. SANKHLA, P. MOGRA 

Study of Klebsiella pneumoniae isolates with ESBL activity, from ICU and Nurseries, on the 

island of Mauritius 

S.K. Mungloo-RUJUBALI, M.I. ISSACK, Y. JAUFEERALLY-FAKIM 

HIV-1 reverse transcriptase inhibition by Vitex negundo L. leaf extract and quantification of 

flavonoids in relation to anti-HIV activity 

M. KANNAN, P. RAJENDRAN, V. VEDHA, G. ASHOK, S. ANUSHKA, P. CHANDRAN 

RAMACHANDRAN NAİR 

Genetic characterization and bottleneck analysis of Korki Jonub Khorasan goats by 

microsatellite markers 

B. MAHMOUDI, O. ESTEGHAMAT, A. SHARIYAR. M. Sh. BABAYEV 

Low-Stringency Single-Specific-Primer PCR as a tool for detection of mutations in the matK 

gene of Phaseolus vulgaris exposed to paranitrophenol 


Short Communication 


S.S. CHAGAS, R.A. VAUCHER, A. BRANDELLI 

Guidelines for Authors 83 

1 

11 

21 

31 

39 

53 

61 

71 

79

10 2 Full Volume (PDF) - Journal of Cell and Molecular Biology ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?