University of Veterinary Medicine Hannover Institute of Parasitology ...

University of Veterinary Medicine Hannover 

Institute of Parasitology 

Fish Disease Research Unit 

Epidemiological Study on Yersinia ruckeri Isolates from Rainbow Trout 

(Oncorhynchus mykiss, Walbaum) in North West Germany 

THESIS 

Submitted in partial fulfillment of the requirements for the degree 

DOCTOR OF PHILOSOPHY (PhD) 

Awarded by the University of Veterinary Medicine Hannover 

by 

Yidan Huang 

Chengdu, P.R. China 

Hannover, Germany [2013]

Supervisor: 

Prof. Dr. Dieter Steinhagen 


Institute of Parasitology 

University of Veterinary Medicine Hannover, Foundation, Germany 

Supervision Group: 

Prof. Dr. Lothar Kreienbrock 

Institute for Biometry, Epidemiology and Information Processing 

University of Veterinary Medicine Hannover, Foundation, Germany 

Prof. Dr. Martin Runge 

Lower Saxony State Office for Consumer Protection and Food safety 

(LAVES) 

Food and Veterinary Institute Braunschweig/Hannover, Germany 

External Referee 

Prof. Dr. Claus-Peter Czerny 

Department of Animal Sciences, Microbiology and Animal Hygiene 

Georg-August-University of Göttingen, Germany 

Date of final exam: 31.10.2013 

Sponsorship: Yidan Huang held the scholarship offered by China Scholarship Council.

To my Family

Publications during the PhD program: 

Yidan Huang, Martin Ryll, Charles Walker, Arne Jung, Martin Runge, Dieter 

Steinhagen. 

Fatty acid composition of Yersinia ruckeri isolates from aquaculture ponds in North West 

Germany (Berliner Münchener Tierärztliche Wochenschrift 127, Heft 1/2(2014), 10-15). 

Yidan Huang, Martin Runge, Geovana Brenner Michael, Stefan Schwarz, Arne Jung, 

Dieter Steinhagen. 

Biochemical and Molecular Heterogeneity among Isolates of Yersinia ruckeri from Rainbow 

Trout (Oncorhynchus mykiss, Walbaum) in North West Germany (BMC Veterinary Research, 

2013, 9:215). 

Yidan Huang, Geovana Brenner Michael, Roswitha Becker, Heike Kaspar, Joachim 

Mankertz, Stefan Schwarz, Martin Runge, Dieter Steinhagen 

Pheno- and genotypic analysis of antimicrobial resistance properties of Yersinia ruckeri from 

fish (accepted by Veterinary Microbiology) 

Posters and oral presentation in national or international conferences: 

Yidan Huang , Stefan Schwarz , Silke Braune , Martin Runge, Dieter Steinhagen 

Poster: Biochemical and Molecular Differences of Yersinia ruckeri isolates from Rainbow 

trout (Oncorhynchus mykiss, Walbaum) in Northwestern Germany (The 3 rd 

poster 

prize).Tagung der DVG-Fachgruppe "Bakteriologie und Mykologie", Leipzig, Germany, 

2012 

Yidan Huang, Martin Runge, Stefan Schwarz, Silke Braune, Dieter Steinhagen 

Poster: Epidemiological Study on Yerinia ruckeri Isolates from Trout Hatcheries in 

Northwestern Germany. XIV. Gemeinschaftstagung der Deutschen, Österreichischen und 

Schweizer Sektionen der EAFP, Bautzen, Germany, 2012. 

Yidan Huang, Geovana Brenner Michael, Stefan Schwarz, Silke Braune, Martin Ryll, 

Martin Runge, Dieter Steinhagen

Oral presentation: Investigation on Genetic Diversity of Yersinia ruckeri Isolates from Trout 

Hatcheries in Northwestern Germany. 16 th Intern. Symposium of the World Association of 

Veterinary Laboratory Diagnosticians, Berlin, Germany, 2013 

Yidan Huang, Geovana Brenner Michael, Heike Kaspar, Stefan Schwarz, Martin 

Runge, Dieter Steinhagen. 

Poster: Analysis of Resistance Pheno- and Genotypes of Yersinia ruckeri Isolated from 

Diseased Fish. 5 th 

Symposium on Antimicrobial Resistance in Animals and the 

Environment ARAE, Gent, Belgium, 2013.

Tables of Content 

CHAPTER 1. INTRODUCTION............................................................................................................. 1 

CHAPTER 2. 

BIOCHEMICAL AND MOLECULAR HETEROGENEITY AMONG ISOLATES OF 

YERSINIA RUCKERI FROM RAINBOW TROUT (ONCORHYNCHUS MYKISS, WALBAUM) IN 

NORTH WEST GERMANY ............................................................................................................................ 35 

CHAPTER 3. 

FIELD STUDY ON YERSINIA RUCKERI ISOLATES FROM TROUT 

HATCHERIES IN NORTH WEST GERMANY .............................................................................................. 47 

CHAPTER 4. 

FATTY ACID COMPOSITION OF YERSINIA RUCKERI ISOLATES FROM 

AQUACULTURE PONDS IN NORTH WEST GERMANY ............................................................................ 65 

CHAPTER 5. 

IN VITRO CYTOTOXICITY AND MULTIPLEX PCR DETECTION OF 

VIRULENCE FACTORS OF YERSINIA RUCKERI ISOLATED FROM RAINBOW TROUT IN NORTH 

WEST GERMANY………………………………………… ........ ………………………………………………81 

CHAPTER 6. 

PHENO- AND GENOTYPIC ANALYSIS OF ANTIMICROBIAL RESISTANCE 

PROPERTIES OF YERSINIA RUCKERI FROM FISH ................................................................................... 109 

CHAPTER 7. GENERAL DISCUSSION ............................................................................................ 135 

CHAPTER 8. SUMMARY .................................................................................................................. 149 

CHAPTER 9. ZUSAMMENFASSUNG .............................................................................................. 153 

ACKNOWLEDGEMENT............................................................................................................................... 157

Chapter 1. Introduction 

1

Chapter 1 Introduction 

1 Fisheries and Aquaculture 

Fisheries and aquaculture contribute greatly to the world‟s food supply, with about 148 

million tonnes of fish in 2010 and 154 million in 2011 (FAO, 2012). Fishery products are 

among the most traded food commodities worldwide, and the trading of those products 

reached a new peak in 2011. Different aquatic species are farmed worldwide, using freshwater, 

brackish water and marine water. Some species are successful internationally introduced, 

including tilapias, Chinese carps, Atlantic salmon, Pangasius catfishes, largemouth black bass, 

turbot, piarapatinga, pacu, and rainbow trout. 

1.1 Rainbow trout aquaculture 

Rainbow trout (Oncorhynchus mykiss, Walbaum) belongs to salmonid species and has been 

introduced for food and sport to different countries. The first rainbow trout hatchery was 

established in the US in the 1870s. Since the 1950s, as the requirement grew rapidly, rainbow 

trout production is on the third place for the whole diadromous fish production (Fig.1-1 ). 

Particularly in Europe, the production of rainbow trout has increased more and more to supply 

domestic markets in the countries such as Italy, France, Germany, Denmark, Spain and so on 

(FAO, 2009). 

Fig.1-1 Production of major diadromous fish species in 2010 (taken from FAO, 2012) 

Rainbow trout is one of the traditional aquaculture species in Germany. They are farmed in 

earthen ponds, raceways and other modern indoor and outdoor facilities(ROSENTHAL and 

HILGE 2000). Since 1880, when rainbow trout was first introduced to Germany from North 

2


America, it has become the most important farmed species in Germany. The development of 

artificial food, flow-through-systems, artificial oxygen enrichment of production water and 

effective disease control have boosted the production. Therefore, the production figures for 

this species have increased annually. At present, some small-scale producers still operate 

earthen ponds, but the most of trout are reared in flow through units made of concrete or 

plastic at a higher density level. 

3


2. Common Salmonid bacterial diseases 

No matter among the cultured or wild population, salmonids can be infected by different 

bacteria, including enteric redmouth (Yersinia ruckeri), bacteria gill disease (Flavobacterium 

branchiophilum), furunculosis (Aeromonas salmonicida), vibriosis (Vibrio anguillarum and 

Vibrio salmonicida), bacterial kidney disease (Renibacterium salmoninarum), bacterial 

cold-water disease (F. psychrophilum), etc.(FARALDO-GOMEZ and SANSON 2003). In the 

following chapter, enteric redmouth disease will be discussed mainly. 

2.1 Enteric Redmouth Disease (ERM) 

2.1.1 Epidemiological facts 

Enteric redmouth disease (ERM), reported in Idaho, USA, as early as 1950s(RUCKER 1966), 

is one of the important diseases of aquatic animals. Subsequently, in the late 1970s to the 

early 1980s, it was first introduced to Europe from the USA (HORNE and BARNES 1999). 

Recently, it is proposed that Yersinia ruckeri, the aetiological agent of ERM, was introduced 

separately into the UK and mainland Europe and subsequent cross-border transfer of UK and 

European isolates has been limited(WHEELER et al. 2009). 

Since ERM was first reported, knowledge of the host and geographic ranges has increased. So 

far, there are many reports about ERM, especially in European countries, ranging from 

different hosts (Table1-1). And now, it is one of the most important infectious diseases in 

rainbow trout (Oncorhynchus mykiss) aquaculture in Europe. 

Table1-1 Worldwide reports of Yersinia ruckeri outbreaks 

Country Species Years of Publication References 

Chile Carp 1987 (ENRIQUEZ and 

ZAMORA 1987) 

Canada Burbot 1987 (DWILOW et al. 

1987) 

Germany Rainbow trout 1994 (FUHRMANN and 

BOEHM 1983; 

KLEIN et al. 1994) 

U.K. Otter, Arctic char 1996 (CLLINS et al. 

4


1996) 

Rainbow trout 2003 (FRERICHS et al. 

1985; D A AUSTIN 

et al. 2003) 

Peru Rainbow trout 2004,2011 (BRAVO and 

KOJAGURA 2004; 

BASTARDO et al. 

2011b) 

Spain Rainbow trout 2006,1986 (CRUZ et al. 1986; 

FOUZ et al. 2006) 

Turkey Black sea salmon 2006 (SAVAS et al. 

2006) 

Rainbow trout 2004 (KARATAS et al. 

2004) 

Czechoslovakia Rainbow trout 1990 (VLADIK and 

PROUZA 1990) 

France Sturgeon 1987 (VUILLAUME et 

al. 1987) 

Italy Rainbow trout 1985 (GIORGETTI et al. 

1985) 

Finland 

Perch, brown trout 

rainbow trout and 

white fish 

1992 (VALTONEN et al. 

1992) 

USA Channel catfish 1999 (DANLEY et al. 

1999) 

P.R. China 

Channel catfish 

Amur Sturgeon 

2009,2013 (K Y WANG et al. 

2009; LI et al. 2013) 

Switzerland Rainbow trout 1986 (MEIER 1986) 

Denmark Norwegian salmon 1986 (SPARBOE et al. 

1986) 

Turkey Rainbow trout 2011 (ONUK et al. 2011) 

5


2.1.2 Clinical and Pathological facts 

Clinical signs of infected rainbow trout may include dark coloration, hemorrhages in the 

mouth, the presence of pale soft liver and kidney, muscle degradation, swollen abdomen and 

gastro-enteritis. Clinical infection can also be characterized by a yellow discharge from the 

vent. Y. ruckeri has also been isolated from freshwater invertebrates (DULIN et al. 1976), and 

therefore, it probably persists in the environment of ponds which were previously stocked 

with infected fish populations(BERGH 2008). On the histopathological level, several changes 

were observed in infected fish, including bacteremia with inflammation, glomerulonephritis 

and necrotic foci in kidney, necrosis in liver, telangiectasis in spleen, hemorrhages and 

hyperemia in the intestinal mucosa, myocardial degeneration, atrophy and edema in the heart, 

atrophy of pancreatic tissues and melanophore hyperplasia in the skin (MAHJOOR and 

AKHLAGHI 2012). 

In Europe, the bacterium is endemic in many trout farms and can cause severe losses. The 

disease most commonly affects younger rainbow trout at temperatures above 10 °C. 

Outbreaks are often related to adverse situations or stressed carrier fish which initiate the 

infection. Protection is provided by commercially available vaccines, which reduce losses to a 

large extent(ROBERTS 2001; BERGH 2008). 

6


3 General background of Yersinia ruckeri 

3.1 Taxonomic position 

In Bergey‟s Manual of Determinative Bacteriology, (8th ed) (BUCHANAN and GIBBONS 

1974), the genus Yersinia is placed in the family Enterobacteriaceae, in which Y. ruckeri has 

been proposed, but this has not been accepted generally. Ewing et al (EWING et al. 1978) 

found that Y. ruckeri strains were about 30% related to species of both Serratia and Yersinia, 

and the G+C contents of this bacteria were approximately 47.5 to 48.5%, which were similar 

to those of Yersinia but markedly different from those of Serratia. Austin et al (B AUSTIN et 

al. 1982) discovered that a number of phenotypic traits of Y. ruckeri are not consistent with 

the inclusion of this organism in the genus Yersinia. A similar result could be seen in the 

research of Green and Austin (GREEN and AUSTIN 1983), emphasizing that comparatively 

few phenotypic traits distinguished Y. ruckeri from Salmonella arizonae. According to the 

results of multilocus sequence typing (MLST) and 16S rRNA analysis, Y. ruckeri was the 

most distant species within the genus Yersinia (KOTETISHVILI et al. 2005). 

Basing on the genomic characterization, Y. ruckeri has the smallest genome (3.7 Mb), 

although it shares the same core set of approximately 2,500 genes with the other members of 

the genus, whose genomes range in size from 4.3 to 4.8 Mb (CHEN et al. 2010). Romalde et 

al(ROMALDE et al. 1991b) mentioned that the chromosome size of Y. ruckeri was about 

4460 to 4770 kbp, so that the different chromosome size with the other Yersinia species 

indicated again that the controversial taxonomic position of Y. ruckeri should be reconsidered. 

And unlike most other Yersinia species, Y. ruckeri was found missing the mtnKADCBEU 

gene cluster (CHEN et al. 2010). Méndez et al (M NDEZ et al. 2009) found a component of 

type IV secretion systems (T4SS), which is absent from human pathogenic Yersinia, is 

associated with the virulence of Y. ruckeri, which proved again, that Y. ruckeri is a very 

homogeneous species that is quite different from the other members of the genus Yersinia. 

Nevertheless, in Bergey‟s Manual of Systematic Bacteriology in 2005 (BOTTONE et al. 

2005), Y. ruckeri is still included in the family Enterobacteriaceae, the genus Yersinia. 

Therefore, the taxonomic standing of Y. ruckeri may need to be reevaluated, perhaps as a new 

genus within the Enterobacteriaceae. 

7


3.2 Isolation, Identification and Biochemical Properties 

3.2.1 Morphology and Biochemical Properties 

As the etiological agent of ERM, Y. ruckeri is a gram-negative, rod-shaped, 1.0×2.0-3.0 μm in 

size, oxidase-negative, peritrichous, fermentative bacterium with facultative-aerobic 

metabolism (ROSS et al. 1966; SCHÄPERCLAUS 1991; STRÖM-BESTOR et al. 2010). A 

positive result can be observed in the methyl red test and voges-proskauer reaction; gelatin is 

degraded, but not aesculin, chitin, DNA, elastin, pectin, tributyrin or urea; it can grow in 0-3% 

(w/v) sodium chloride, and utilize sodium citrate; Y. ruckeri can also use maltose, fructose, 

trehalose, mannitol and glucose to produce acid, but cannot use inositol, lactose, raffinose, 

salicin or sucrose; it could produce catalase, β-galactosidase, but not H 2 S, indole, oxidase 

phenylalanine deaminase or phosphatase (B AUSTIN and AUSTIN 1999). The motility of Y. 

ruckeri depends upon the temperature of incubation and the biotypes. Cultures in the log 

phase of growth are motile between 18-27 °C, although the optimum temperature for the 

growth of Y. ruckeri is 22 - 25 °C (EWING et al. 1978). Biotype 2 strains are non-motile 

because of the lacking of flagella and were isolated first by Davis and Frerichs (DAVIES and 

FRERICHS 1989) in the 1980s. More and more attention was paid to this kind of strains since 

it can cause disease to vaccinated fish and caused outbreaks in 2003 (D A AUSTIN et al. 

2003). It was later proved that biotype 2 strains had come out, because the population 

structure in the natural environment has changed, instead of a direct vaccination-induced 

mutation (JOHN TINSLEY 2010). 

3.2.2 Isolation and Identification 

Y.ruckeri grows well on trypticase soy agar (TSA) and brain heart infusion agar (BHI agar), 

forming colonies of 1-2 mm in diameter, smooth, round, raised, white cream in color, 

translucent and which exhibit a butyrous type of growth with entire edges(FURONES et al. 

1993b). On deoxycholate-citrate-mannitol agar, Y. ruckeri forms typical red to magenta 

colonies (HUNTER et al. 1980). A selective medium developed by Waltman and Shotts 

(WALTMAN and SHOTTS 1984) containing Tween 80, sucrose, and bromothymol blue was 

used for the isolation of Y. ruckeri colonies, which are green with a zone of Tween 80 

hydrolysis. However, one problem of this selective medium is that it is limited to isolate 

biotype 2 (BT2) strains, which are Tween80-negative and non-motile(DAVIES and 

FRERICHS 1989). Rodger (B AUSTIN et al. 1982) described a ribose ornithine deoxycholate 

8


citrate (ROD) medium, which is both selective and differential for Y. ruckeri according to 

yellow deposits surrounding the colony. However, Furones et al (FURONES 1990; 

FURONES et al. 1993a) found that not all Y. ruckeri strains, especially HSF- strains, produce 

the characteristic yellow deposit on ROD medium. Basing on the ROD medium, Furones et al 

(FURONES et al. 1993a) simplified it by supplying TSA with 1% (w/v) SDS, to differentiate 

isolates of Y. ruckeri, and discovered that Y. ruckeri produces a creamy deposit around the 

colonies on this medium. Furthermore, they added 100μg/ml of coomassie brilliant blue into 

TSA-SDS medium and made it simpler and more economic to screen for virulent serotype I 

(HSF+) strains of Y. ruckeri (FURONES et al. 1993a). 

Bacterial sensitivity to bacteriophages provides the possibility of using phage typing as an 

epidemiological tool and as a tool for rapid diagnosis. Therefore, Stevenson and Airdrie 

(STEVENSON and AIRDRIE 1984b) screened eight bacteriophages against Y. ruckeri, which 

have a potential value for fish health-monitoring programs. Noga et al (E J NOGA et al. 1988) 

found that the sensitivity and specificity of kidney biopsy were high and that there were no 

significant differences between results from both kidney biopsy and necropsy, suggesting a 

non-lethal way to diagnose Y. ruckeri infection. 

Due to its relative cheap price and simplicity for operation, the API-20E system is used in 

aquaculture for rapid diagnosis of fish diseases. This test was initially designed for the 

identification of members of the family Enterobacteriaceae. Y. ruckeri can be correctly 

identified by profiles 1104100 and 5104100 (SANTOS et al. 1993). Isolates in Chile shared 

the profile numbers 5107100, 5307100, 5107500 and 5105500(BASTARDO et al. 2011a). 

The profile number 51051010 cannot discriminate between Y. ruckeri and Hafnia alvei, and 

can misidentify isolates of Y. ruckeri as H. alvei (SANTOS et al. 1993; DANLEY et al. 1999). 

However, this problem can be solved by performing supplementary test to determine 

xylose-fermenting ability: Y. ruckeri is negative, whereas H. alvei is positive for xylose 

fermentation (BULLER 2004). 

Based on 16S ribosomal DNA (rDNA) polymorphism, Waren et al (WARSEN et al. 2004) 

developed a DNA microarray suitable for simultaneous detection and discrimination between 

multiple bacterial species, including Y. ruckeri, and this methodology permitted 100% 

specificity for 15 fish pathogens, which means it is suitable for detection and surveillance for 

commercially important fish pathogens. Seker et al (SEKER et al. 2012) established a 

9


species-specific PCR for rapid identification of Y. ruckeri. Yugueros et al (YUGUEROS et al. 

2001) found that only the Y. ruckeri strains presented identical RFLPs (two fragments of 900- 

and 265-bp), which can be used as a tool of identification and differentiation of at least three 

Yersinia spp., as well as E. coli and S. enteritidis (YUGUEROS et al. 2001). Wortberg et al 

characterized Y. ruckeri by Fourier transform infrared spectroscopy (FT-IR) and found, 

although it was not successful to identify the motility of Y. ruckeri, this method was still a 

powerful, economic, fast and reliable tool for the identification of Y. ruckeri (WORTBERG et 

al. 2012). 

Souza et al (SOUZA et al. 2010)compared four molecular typing methodologies, 

Enterobacterial Repetitive Intergenic Consensus PCR (ERIC-PCR), Pulsed-Field Gel 

Electrophoresis (PFGE), 16S rRNA gene sequencing and Multilocus Sequence Analysis 

(MLSA), for identifying species among Yersinia isolates, and found ERIC-PCR, 16S rRNA 

gene sequencing and MLSA seem to be valuable techniques for use in taxonomic and 

identification studies of the genus Yersinia, whereas PFGE does not. Recently, a novel assay 

was developed to identify and differentiate Y. ruckeri BT2 strains, basing on the mutant 

allele-specific changes in restriction enzyme cleavage sites(WELCH 2011). Bastardo et al. 

(BASTARDO et al. 2012)used MLST and identified 30 different STs, separated into two 

clonal complexes, indicating the genotypic diversity present in Y. ruckeri. In the same study, it 

was suggested that initial steps of Y. ruckeri clonal diversification may have occurred by 

recombination(BASTARDO et al. 2012). 

3.3 Serological Studies and Distribution 

Y. ruckeri can be distinguished by serotypes, biotypes and outer membrane protein 

(OMP)-types. Different types are associated with different virulence. In the early 1980s, using 

the whole-cell antigens conjugated with unabsorbed and cross-absorbed whole-cell antisera, 

six serotypes (I-VI) were distinguished by Stevenson and Airdrie (STEVENSON and 

AIRDRIE 1984a) and Daly et al (DALY et al. 1986).However, Davies (DAVIES 1990) 

suggested a classification, which did not correspond with that suggested by the authors 

mentioned above. In Davies‟ classification, Y. ruckeri isolates are divided by heat-stable 

O-antigens into five serotypes, designated serotypes O1, O2, O5, O6 and O7, with different 

outer-membrane protein types (OMP-types) separately (Table1-2)(DAVIES 1990, 1991a). 

From the serotype O1, OMP-type 3 isolates are virulent, so-called „Hagerman‟ 

10


isolates(DAVIES 1991a). All five O-serotypes were present in north America, whereas only 

serotype O1 isolates were identified in Australia and South Africa(DAVIES 1990). In 

European countries, serotype O1 isolates accounted for 91% of the European isolates; while 

serotype O2 isolates were common and widely distributed in France, Norway, Great Britain 

and West Germany; Serotype O5 and O7 isolates were obtained from Great Britain, Poland 

and Denmark respectively, whereas serotype O6 isolates occurred in Finland and West 

Germany(DAVIES 1990; PĘKALA et al. 2010). However, so far, there is no uniform 

classification for O-serotypes. One of the most accepted to date is proposed by Romalde et 

al(ROMALDE et al. 1993), who distinguished four different O-serotypes: Serotype O1 can be 

divided into two subgroups O1a (serovar I) and O1b (serovar III) and serotype O2 (serovar II) 

into three subgroups O2a, O2b and O2c. The other two are serotype O3 (serovar V) and 

serotype O4 (serovar VI) (ROMALDE et al. 1993). 

Besides, Y. ruckeri can be defined as two biotypes: biotype 1 is motile and positive for 

phospholipase activity and Tween 80 hydrolysis; while biotype 2 is non-motile and negative 

for the two tests above(DAVIES and FRERICHS 1989). 

Table1-2 Serotypes, OMP-types and Biotypes of Yersinia ruckeri according to Davies 

(DAVIES 1991a) 

Serotypes OMP-types Biotypes 

O1 1,2,3,4 1,2 

O2 1,2 1,2 

O5 1,2 1 

O6 1,2 1 

O7 1,5 1 

3.4 Pathogenesis 

Despite the importance and extensive knowledge of Yersinia species in pathogenesis of 

mammals, the precise mechanisms of virulence are practically unknown. Recent reports about 

the pathogenesis of Y. ruckeri are mainly concentrating on host factors, mechanisms of 

11


invasion and research on possible bacterial virulent factors. 

3.4.1 Host factor 

Y. ruckeri can affect salmonids and other fish in both freshwater and seawater, persists in the 

fish farm which suffers from an outbreak of ERM and has a high ability to adhere on 

materials commonly found in fish farm tanks (L COQUET et al. 2002a; L COQUET et al. 

2002b). Rainbow trout are especially susceptible, but steelhead, lake, cutthroat, brown and 

brook trout, and coho, sockeye, Chinook and Atlantic salmon are also affected(EDWARD J 

NOGA 2010). In the epidemiological investigation performed by Good et al (GOOD et al. 

2001) from 1981 to 1997, Brook trout (S. fontinalis), Lake trout (S. namaycush), Rainbow 

trout (O. mykiss) and Splake (S. fontinalis×S. namatcysh) were found positive for Y. ruckeri. 

Although any age salmonid is susceptible, the early-production lots (< 6 months) were 

significantly more likely to be positive for Y. ruckeri(GOOD et al. 2001). 

3.4.2 Route of infection 

Y. ruckeri first adheres to gill mucus and thereafter invades the branchial vasculature leading 

rapidly to septicemia and colonization of the internal organs(TOBBACK et al. 2009). 

However, some bacteria were noted in the intestinal crypts, indicating that these bacteria 

evaded the first line of host defenses in the gut mucosa (TOBBACK et al. 2009), which need 

further studies to prove the role of skin and gut as portals of entry. Only virulent strains are 

probably able to defeat the host‟s immune mechanisms(TOBBACK et al. 2009), which 

indicate that immune evasion is a major virulence property of Y. ruckeri. Survival and growth 

in macrophages is the first step for Y. ruckeri to invade the host and trout macrophages 

provide a safe niche for Y. ruckeri(RYCKAERT et al. 2010). Y. ruckeri lacks urease, 

methionine salvage genes, and B12-related metabolism and there may be an alternative mode 

of infection for Y. ruckeri(CHEN et al. 2010). Some other findings suggested that serum 

resistance plays a role in the pathogenesis of Y. ruckeri infections, which is probably 

important in the extracellular survival of the pathogen in the host (DAVIES 1991b; 

TOBBACK et al. 2010) 

12


3.4.3 Virulence factors 

Previously, genes associated with invasion in two other members of Yersinia, inv from Y. 

pseudotuberculosis (ISBERG and FALKOW 1985)and ail from Y. enterocolitica(MILLER 

and FALKOW 1988), were described. However, there is no evidence for inv or ail 

homologues in Y. ruckeri (KAWULA et al. 1996), which proved that Y. ruckeri use a cell 

invasion pathway that is distinct from that used by the other pathogenic Yersinia. Due to this 

difference, since then, searching for the main virulence factors of Y. ruckeri became one 

major part of pathogenicity researches. 

3.4.3.1 Extracellular Products 

The extracellular products of Y. ruckeri, which are strongly toxic for fish, include lipase, 

protease, and cytotoxic and hemolytic activities, and reproduce some characteristic symptoms, 

such as hemorrhage in the mouth and intestine(ROMALDE and TORANZO 1993). The 

extracellular serralysin metalloprotease Yrp1 was identified in some Y. ruckeri isolates, 

leading to the classification of two different groups: Azo + (presence of the Yrp1 proteolytic 

activity) and Azo - ( absence of the Yrp1 proteolytic activity)(SECADES and GUIJARRO 

1999). Subsequently, it was found that the yrp1 operon in an Azo - strain was blocked at the 

transcriptional level rather than its absence in this group(FERNANDEZ et al. 2003). The 

Yrp1 protein contains a ZnMc superfamily conserved domain which is associated to 

virulence(K WANG et al. 2012). Fernández et al (FERNANDEZ et al. 2002) showed that the 

gene encoding Yrp1 is part of an operon containing a type I ABC transporter involved in 

protein secretion, encoded by three genes (yrpD, yrpE, and yrpF), together with gene inh, that 

encodes a protease inhibitor. As Yrp1 protease can hydrolyze laminin, this degradation may 

be the cause of membrane alterations leading to erosion and pores in capillary vessels, which 

results in the hemorrhages in mouth and intestines(FERNANDEZ et al. 2003). A trout model 

was used to study the participation of the protease in pathogenesis and it was shown that 

inactivation of either yrp1 or yrpE lead to a significant increase in the 50% lethal 

dose(FERNANDEZ et al. 2002), indicating the protease being involved in virulence. 

Moreover, Fernandez et al (FERNANDEZ et al. 2007) detected other genes relative to 

hemolysin and found that the gene YhlB precedes another ORF (Yhl A) encoding a 

Serratia-type hemolysin, and in the LD50 experiment, the value of the mutant strains 

150RyhlA was approximately 100-fold higher than that of the parental strain, which 

suggested that Yhl A is another virulence factor of Y. ruckeri (FERNANDEZ et al. 2007). 

13


3.4.3.2 Flagella and Type three secretion system (T3SS) 

Genetic studies on bacterial virulence factors demonstrated that pathogens posses specific 

pathogenic genes. These clusters of genes can be transferred even horizontally, which leads to 

pathogens with distant relationships carrying similar virulence genes. This kind of view has 

become particularly obvious for a set of approximately 20 genes which together encode a 

pathogenic mechanism called type III secretion system (T3SS) (HUECK 1998). Type three 

secretion systems have been found in various Gram-negative bacteria to transport proteins 

from the cytoplasm to the external environment(G P SALMOND and REEVES 1993), and 

have been proved to be essential for bacterial pathogenesis(CORNELIS 2002; TOBE et al. 

2006; VILCHES et al. 2009). A T3SS is mainly composed of four different parts: 

transcriptional regulators, chaperones, the components of the secretion apparatus, and the 

components of an extracellular filamentous organelle, ranging from a short needle complex to 

flagellar hooks and filaments (HUECK 1998; KNUTTON et al. 1998; FRANCIS et al. 2002; 

PAGE and PARSOT 2002). Pallen et al(PALLEN et al. 2005) suggested to divide the T3SS 

into two different groups: flagellar T3SS and Non-flagellar T3SS, the former associated with 

flagellum biosynthesis and the latter mediate the interactions between bacteria and eukaryotic 

cells. As the following Fig.1-2 shows, flagella are connected, or related to the type three 

injectisome, which is a complex nanomachine ensuring Gram-negative bacteria to deliver 

effector proteins into host cells (CORNELIS 2006). Non-flagellar T3SS (NF-T3SS), also 

called as injectisome, attracted attention for the first time, because it plays a important role in 

the pathogenesis of many diseases(G P SALMOND and REEVES 1993; HUECK 1998). 

NF-T3SS is homogenous to the flagellar T3SS, for examples, FliFHIKNPQR and FlhAB 

(flagellar secrection apparatus) in flagellar T3SS are homologous to the components in the 

non-flagellar T3SS, but more structural data is still needed (DESVAUX et al. 2006; 

ERHARDT et al. 2010). YscJLNPRSTUV in the Ysc-Yop system of Yersinia species share 

homology with flagellar components(DESVAUX et al. 2006). The internal part of the Ysc 

injectisome, found in Yersinia species contains some proteins which have counterparts in the 

basal body of the flagellum, suggesting that these two organelles share the same evolutionary 

origin(CORNELIS 2002). 

14


Fig.1-2 Type III secretion systems. (a) A translocation-associated type III secretion system 

(T3aSS) from the Ysc–Yop system found in Yersinia species. (b) The bacterial flagellum 

(T3bSS). Export and assembly hook and filament rely on a dedicated flagellar type III 

secretion system that is associated with the basal body (DESVAUX et al. 2006). 

The tool used by bacteria to move in their environment is the flagellum, which is a rigid, 

helical filament (BERG and ANDERSON 1973), composed of about 25 different proteins 

(CHEVANCE and HUGHES 2008). The ancestor of all T3SS was recognized to be the 

flagellar T3SS, which is present in both Gram-positive and Gram-negative bacteria, and it 

was suggested that the type 3 secretion needed for pathogenesis evolved from 

flagellar-specific T3SS(HUECK 1998; MACNAB 2004). 

Milton et al (MILTON et al. 1996) found that a flagellin gene flaA is needed for crossing the 

fish integument and may play a role in virulence after invasion of the host. The aflagellate 

mutant of Y. enterocolitica decreased its ability to invade cultured epithelial cells and to 

colonize the porcine intestinal tissue in vitro, and could survive within cultured human 

macrophages over 3 h (MCNALLY et al. 2007), which proved again the importance of 

flagella to motile bacteria. Flagella contribute to the virulence of Y. ruckeri, but at best only in 

a marginal way and at the early stage when the pathogen in the environment first contacts the 

host and begins to invade(KIM 2000). However, the Y. ruckeri strains isolated from outbreaks 

in Southern England are belonging to biotype 2 and lacking both flagellar motility and 

15


secreted lipase activity(D A AUSTIN et al. 2003). Recently, Evenhuis et al (EVENHUIS et al. 

2009) constructed a mutation flhA::Tn5, lacking of both motility and secreted lipase activity, 

and proved that flagellar secretion is unnecessary for virulence in this organism, including 

early steps in the process of infection. Moreover, it was found that all serogroups and biotypes 

were virulent to rainbow trout, suggesting flagellin may not be required for rainbow trout 

proinflammatory innate immune response(JOHN TINSLEY 2010). 

Three pathogenic Yersinia spp., Y. pestis, Y. enterocolitica and Y. pseudotuberculosis, exhibit 

the ability to resist the host‟s primary immune defense, most notably by inhibiting their own 

uptake by professional phagocytes(BURROWS and BACON 1956). The antiphagocytic 

effect is mediated by the Yersinia type III secretion system and specifically requires a protein 

called YopH(ANDERSSON et al. 1996). Mills et al (MILLS et al. 1997) showed that Y. 

enterocolitica induces apoptosis in macrophages, which requires type III secretion and 

depends on YopP, which appears to be a novel effector. Y. enterocolitica maintains three 

different pathways for type three protein secretions, Ysa T3SS, Ysc T3SS, and flagellar 

T3SS(M B YOUNG and YOUNG 2002). As the proteins secreted by Ysc T3SS referred to as 

Yops (Yersinia outer proteins), those extracellular proteins secreted by Ysa T3SS are called 

Ysps (Yersinia secreted proteins). It was found that the flagellar defect didn‟t affect the 

production of Ysps or Yops(M B YOUNG and YOUNG 2002). Phospholipase YplA, which 

has been implicated in Y. enterocolitica virulence, can be a substrate for the Ysc, Ysa, and 

flagellar T3SSs(M B YOUNG and YOUNG 2002), indicating that the sharing of substrates by 

different T3SSs of Y. enterocolitica may be important during the course of an infection. 

Recently, an Ysa (Yersinia secretion apparatus) -like T3SS, different from other human 

pathogenic Yersinia species, was found to be present in Y. ruckeri (GUNASENA et al. 2003). 

Additionally, more research is needed to reveal the presence and the function of the Ysa T3SS 

in Y. ruckeri. 

3.4.3.3 Ruckerbactin 

Iron is necessary for bacterial growth, because it is essential for enzymatic 

reactions(CASTIGNETTI and SMARRELLI-JR. 1986). Iron uptake is essential for successful 

colonization and invasion by many microbial pathogens and therefore they developed high 

affinity iron transport systems to compete for iron with the host (FARALDO-GOMEZ and 

SANSON 2003). It is believed that the production of hemolysin is helpful to provide iron 

16


from red blood cells(MARTINEZ et al. 1990). Counterparts of the loci fct, entC, fepDGC, 

fepB, entS, and exbB, all involved in iron piracy, were identified in Y. ruckeri, confirming that 

Y. ruckeri produces a catechol siderophore (ruckerbactin)(ROMALDE et al. 1991a; 

FERNANDEZ et al. 2004). It is proved that this iron uptake system ruckerbactin is involved 

in the virulence of Y. ruckeri(FERNANDEZ et al. 2004). 

3.4.3.4 Type Four Secretion System (T4SS) 

Type Four secretion systems, built from core components of conjugation machines and 

transport proteins or protein-DNA complexes, have been demonstrated to be involved in 

virulence in other microorganisms (G P C SALMOND 1994; ZINK et al. 2002). Two loci, 

iviXII and iviXIII, were detected; the former shows homology with the lipoproteins TraI and 

DotC, involved in secretion systems of this type; the latter is associated with the tight 

adherence properties (FERNANDEZ et al. 2004). These proteins have been proposed to 

compose a new subfamily of type IV secretion systems (BHATTACHARJEE et al. 2001). 

Recently, the tra operon was initially identified as an ivi gene, and a traI mutant strain, which 

showed a significantly lower recovery in vivo competition experiments, was approximately 10 

times more attenuated than the parental strain(MENDEZ et al. 2009). It is proved that the tra 

operon, as a component of a T4SS, contributes to the virulence of Y. ruckeri(MENDEZ et al. 

2009). 

3.4.3.5 ZnuABC Operon and BarA-UvrY two-component system 

As a tool for investigating bacterial virulence genes, signature-tagged mutagenesis is used to 

indentify mutants that can survive in vitro but not in the host fish. Dahiya and Stevenson 

(DAHIYA and STEVENSON 2010b) applied this method on the study of virulence factors of 

Y. ruckeri and found different factors including the genes with sequence homologies to genes 

for ZnuA, a periplasmic zinc-binding protein of the ZnuABC transporter, and the UvrY 

response regulator of the BarA-UvrY two-component system. Furthermore, they studied the 

ZnuABC operon and found the ΔznuABC mutant was unable to compete with the parental 

strain and survived poorly in rainbow trout kidney in a competitive challenge by 

immersion(DAHIYA and STEVENSON 2010c), indicating that the ZnuABC transporter 

plays a role in establishing and maintaining a rainbow trout infection by Y. ruckeri. The 

function of the BarA-UvrY two-component system was also investigated by the same 

authors(DAHIYA and STEVENSON 2010a), which showed that the BarA–UvrY TCS 

contributes to the pathogenesis of Y. ruckeri in its natural host rainbow trout, possibly by 

17


regulating the invasion of epithelial cells and the sensitivity to oxidative stress induced by 

immune cells. 

3.4.3.6 Other factors 

Y. ruckeri has a preference for different cell lines. It can adhere to and invade fish derived 

cultured cells, such as rainbow trout kidney (RTPK) or rainbow trout gonad (RTG)cell, and 

has strongly preference for fathead minnow epithelial (FHM), but not human derived Hep-2 

cells(KAWULA et al. 1996). Romalde and Toranzo(ROMALDE and TORANZO 1993) 

proved the ability of Y. ruckeri to adhere to and effectively invade fish cell lines cultured in 

vitro. However, the virulence of Y. ruckeri for rainbow trout does not seem to correlate with in 

vitro invasiveness of cell lines(ROMALDE and TORANZO 1993). It is obvious that 

colchicines and cytochalasin-D could be used to reduce the ability of Y. ruckeri to invade 

cultured cell lines (FERNANDEZ et al. 2002). It is believed that microtubules and 

microfilaments play a role in in vitro invasion, but there was no clear relation with the 

virulence found, due to cell type and strain-dependent internalization mechanisms triggered 

by Y. ruckeri(TOBBACK et al. 2010). 

3.5 Control 

As aquaculture is getting increasingly expanding and intensified, infectious diseases are 

always a major issue and can cause great losses and problems. Although probiotics, essential 

oils and phage therapy were brought up as alternatives methods (IMBEAULT et al. 2006; 

YEH et al. 2009; SUN et al. 2010), the main treatment of bacterial diseases are still relying on 

antimicrobial compounds and vaccines. Antibiotics are usually used either prophylactically or 

therapeutically. In aquaculture, broad-spectrum antibiotics are generally used. Licensed 

agents vary from country to country. The antibiotics licensed to treat food animals in 

European Union were according to VO(EU) 37/2010. Table1-3 showed an overview of the 

most important antibiotics used in the aquaculture industry. 

18


Table1-3 

2005) 

Examples of antibiotics used in aquaculture(LALUMERA et al. 2004; SERRANO 

Antibiotics Classification Route of administration 

Amoxicillin Beta-lactams Oral 

Florfenicol 

Florfenicol(Fluorinated Oral 

derivative of thiamphenicol) 

Erythromycin Macrolides Oral/Bath/Injection 

Streptomycin Spectinomycin Bath 

Neomycin Aminoglycosides Bath 

Oxolinic acid Quinolones Oral 

Enrofloxacine 

Oral/Bath 

Flumequine Flumequine Oral/Bath/Injection 

Oxytetracycline Tetracycline Oral/Bath/Injection 

Tetracycline 

Oral/Bath/Injection 

Doxycycline 

Oral 

Chlortetracycline Chlortetracycline Oral/Bath/Injection 

Sulfachlorpyridazine Sulphonamides Oral 

Sulfadimethoxine 

Sulfamethazine 

Sulfanilamide 

Sulfaquinoxaline 

Sulfathiazole 

However, as the usage of antibiotics spreads in aquaculture, increasing problems are arising, 

such as drug residue and antibiotic resistance. Guichard and Licek (GUICHARD and LICEK 

2006) detected the agents which were licensed by various countries contained in fish products, 

including oxytetracycline, first-generation quinolones, potentiated sulphonamides, florfenicol, 

and amoxicillin. A growing number of antibiotic resistant bacteria were recently found in 

aquaculture (SON et al. 1997; SCHMIDT et al. 2000; AKINBOWALE et al. 2006; KADLEC 

et al. 2011). 

3.5.1 Antimicrobial susceptibility of Y. ruckeri 

The use of antimicrobial compounds in aquaculture remains emotive, because of the 

possibility of residues in fish tissues and environment, as well as sustained increasing of 

19


bacterial resistance. General methods for using antimicrobial compounds comprise the oral 

route, bath, dip, injection, bioencapsuation and flush. In rainbow trout aquaculture, several 

antimicrobial compounds are applied to deal with ERM, for example, chloramphenicol, 

flumequine, oxolinic acid, oxytetracycline, potentiated sulphonamide and tiamulin (B 

AUSTIN and AUSTIN 2007). 

Compared with Flavobacterium psychrophilum, Y. ruckeri still remained higher sensitivity to 

antimicrobial substances(SCHMIDT et al. 2000). In 1983, Bosse et al. (BOSSE and POST 

1983) showed that Tribrissen (trimethoprim and sulphadiazine) and Tiamulin could be used to 

control ERM effectively, at a dosis of 1.0mg of Tribrissen/kg fish/day and 5.0 mg of 

tiamulin/kg fish/day, respectively. However, in 2006, it was reported that some Y. ruckeri 

isolates were resistant to trimethoprim and sulphamethaxazole (KIRKAN et al. 2006). Tinsley 

(JOHN TINSLEY 2010) used different serotypes and biotypes of Y. ruckeri to test for 

antibiotic sensitivity and found all isolates were resistant to sulphatriad and cephalothin, but 

sensitive to tetracycline and cotrimoxazole. A 36-MDa plasmid found in some Y. ruckeri 

isolates carried the resistant determinants to tetracycline and sulfonamide(DE-GRANDIS and 

STEVENSON 1985). It was also shown that all serovar Ⅱ, Ⅲ and Ⅴ isolates exhibited a 

high resistance to polymyxin B(DE-GRANDIS and STEVENSON 1985). Shah et al(SHAH et 

al. 2012) found that quinolone resistant Y. ruckeri strains from Norway revealed a single bp 

mutation by replacing serine by arginine at position 83 in the GyrA protein. Streptomycin and 

tetracycline resistant genes, strAB and tetDCAR were discovered on plasmid pYR1 of Y. 

ruckeri (NCBI Reference Sequence: NC_009139.1). 

3.5.2 Vaccination 

Y. ruckeri is an opportunistic pathogen commonly present in water and antibiotic treatments 

would be problematic as they induce antibiotic resistance. Consequently, the best way to deal 

with the infection is vaccination. Formalin killed cells (FKC) and O-Antigen (Ag-O) of Y. 

ruckeri can significantly increase the immune indicators of rainbow trout, and in particular, 

directly activate phagocyte activity, such as phagocytosis(ISPIR et al. 2009). So far, a certain 

progress has been achieved with the control of infections caused by Y. ruckeri. Particularly, 

ERM may be controlled effectively by inactivated whole cell vaccines(ROSS et al. 1966), 

which are available commercially and are considered to be successful(TEBBIT et al. 1981). 

20


Field trials with an existing commercially available ERM vaccine were reported from 

Germany, prior to registration and licensing of the vaccine(SCHLOTFELDT et al. 1986). 

Vaccines for ERM have been used successfully for nearly three decades and consist of 

immersion-applied, killed whole-cell preparations of motile serovar 1 Y. ruckeri 

strains(STEVENSON 1997). Raida und Buchmann(RAIDA and BUCHMANN 2008) found 

that temperature played an significant role in affecting the results of vaccination, namely, no 

protective effects of vaccination were detected in rainbow trout reared at 5 and 25 ℃ after 

bath with a bacterin of Y. ruckeri O1. 

Recently, ERM outbreaks have been reported in vaccinated fish at trout farms in the United 

Kingdom(D A AUSTIN et al. 2003), Spain(FOUZ et al. 2006), and the United States(ARIAS 

et al. 2007). The Y. ruckeri strains isolated from the outbreaks in Southern England are 

atypical serovar 1 isolates lacking both flagellar motility and secreted lipase activity(D A 

AUSTIN et al. 2003). These Y. ruckeri biotype 2 (BT2) variants are believed to have a 

reduced sensitivity to immersion vaccination (D A AUSTIN et al. 2003). It was hypothesized 

that vaccination exerted a selective pressure that enabled the emergence of non-motile strains 

that are resistant to the commercial vaccines. Therefore, there is a high risk that these 

non-motile vaccine-resistant strains spread and originate severe outbreaks of disease in trout 

farms. From this reason, new approaches based on subunit or DNA vaccines could be used as 

an additional way to eliminate or minimize these outbreaks. Nonetheless, DNA vaccines 

could not be used together with the original vaccines, because Lorenzen et al (LORENZEN et 

al. 2009) described that intraperitoneal injection of a commercial vaccine against ERM made 

from formalin-killed bacteria immediately followed by a DNA-vaccine against viral 

hemorrhagic septicemia virus (VHSV), reduced the protective effect of the DNA-vaccine 

against challenge with VHSV. Fernández et al (FERNANDEZ et al. 2003) found the relative 

percent survival of the Yrp1 toxoid-treated fish was 79%, confirming the role of the Yrp1 

toxoid as a subunit immunogen. It is hopefully that, in the near future, with further research of 

the pathogenesis of different Y. ruckeri strains, several new generations of vaccines, such as 

genetic engineered vaccines, would be developed to control ERM. 

4 The Aim of the Research 

Recently, since vaccine resistant strains of Y. ruckeri were isolated on some incidents from 

trout hatcheries in North West Germany, an epidemiological survey on the occurrence and 

21


phenotypic/molecular characterization of Y. ruckeri strains from trout hatcheries in North 

West Germany was planned. 

The aims of the study are: 

To provide data on the distribution of Y. ruckeri strains in rainbow trout hatcheries and 

correlate this to outbreaks of ERM in the farms. 

To study the diversity of both biochemical and molecular characteristics of Y. ruckeri isolates 

from North West Germany. 

To find out the relationship between the fatty acid composition of Y. ruckeri isolates and the 

epidemiological characters 

To detect in vitro cytotoxicity of both motile and non-motile strains of Y. ruckeri under 

different conditions, e.g. temperature and time. 

To study virulence factor genes and their expression in collected Y. ruckeri isolates which 

would provide a basic virulent background of these North West Germany isolates. 

To test the antimicrobial susceptibility of collected isolates and offer more data on 

antimicrobial resistant Y. ruckeri isolates. 

It would allow the development of a concept for strategic, preventive health monitoring in 

fish farms on the basis of risk analysis. It would be also helpful with identifying and 

characterizing pathogenic Y. ruckeri strains and examine the distribution of these strains in the 

field as a basis for preventive disease monitoring plans. 

22


References 

AKINBOWALE, O. L., H. PENG and M. D. BARTON (2006): 

Antimicrobial resistance in bacteria isolated from aquaculture sources in Australia. 

J Appl Microbiol 100, 1103-1113 

ANDERSSON, K., N. CARBALLEIRA, K. E. MAGNUSSON, C. PERSSON, O. STENDAHL, H. 

WOLF-WATZ and M. F LLMANN (1996): 

YopH of Yersinia pseudotuberculosis interrupts early phosphotyrosine signalling associated with phagocytosis. 

Mol. Microbiol. 20, 1057-1069 

ARIAS, C. R., O. OLIVARES-FUSTER, K. HAYDEN, C. A. SHOEMAKER, J. M. GRIZZLE and P. H. 

KLESIUS (2007): 

First report of Yersinia ruckeri biotype 2 in the USA. 

J Aquat Anim Health 19, 35-40 

AUSTIN, B. and D. A. AUSTIN (1999): 

Bacterial Fish Pathogens: Disease of Farmed and Wild Fish. 

Praxis Publishing Ltd., Chichester, UK 

AUSTIN, B. and D. A. AUSTIN (2007): 

Bacterial Fish Pathogens: Diseases of Farmed and Wild Fish Praxis Publishing, Chichester, UK 

AUSTIN, B., M. GREEN and C. J. RODGERS (1982): 

Morphological diversity among strains of Yersinia ruckeri. 

Aquaculture 27, 73-78 

AUSTIN, D. A., P. A. W. ROBERTSON and B. AUSTIN (2003): 

Recovery of a new biogroup of Yersinia ruckeri from diseased rainbow trout(Oncorhynchus mykiss, Walbaum). 

Syst Appl Microbiol 26, 127-131 

BASTARDO, A., H. BOHLE, C. RAVELO, A. E. TORANZO and J. L. ROMALDE (2011a): 

Serological and molecular heterogenetity among Yersinia ruckeri strains isolated from farmed Atlantic salmon 

Salmo salar in Chile. 

Dis Aqua Organ 93, 207-214 

BASTARDO, A., C. RAVELO and J. L. ROMALDE (2012): 

Multilocus sequence typing reveals high genetic diversity and epidemic population structure for the fish 

pathogen Yersinia ruckeri. 

Environ microbiol 14, 1888-1897 

BASTARDO, A., V. SIERRALTA, J. LEON, C. RAVELO and J. L. ROMALDE (2011b): 

Phenotypical and genetic characterization of Yersinia ruckeri strains isolated from recent outbreaks in farmed 

rainbow trout Oncorhynchus mykiss (Walbaum) in Peru. 


BERG, H. C. and R. A. ANDERSON (1973): 

Bacteria weim by rotating their flagellar filaments. 

Nature 245, 380-382 

BERGH, O. (2008): 

Bacterial disease of fish. 

Science Publishers, Enfield, NJ 

BHATTACHARJEE, M. K., S. C. KACHLANY, D. H. FINE and D. H. FIGURSKI (2001): 

Nonspecific adherence and fibril biogenesis by Actinobacillus actinomycetemcomitans:TadA protein is an 

ATPase. 

J. Bacteriol. 183, 5927-5936 

23


BOSSE, M. P. and G. POST (1983): 

Tribrissen and tiamulin for control of enteric redmouth disease. 

J Fish Dis 6, 27-32 

BOTTONE, E. J., H. BERCOVIER and H. H. MOLLARET (2005): 

Genus. XLI. Yersinia. 

In: Bergey‟s Manual of Systematic Bacteriology 

Springer-Verlag, New York, S. 838-848 

BRAVO, S. and V. KOJAGURA (2004): 

First Isolation of Yersinia ruckeri from rainbow trout (Oncorhynchus mykiss) in Peru. 

Bull Eur Assn Fish P 24, 104-108 

BUCHANAN, R. E. and N. E. GIBBONS (1974): 

Bergey‟s manual of determinative bacteriology. 

The Williams & Wilkins Co., Baltimore 

BULLER, N. B. (2004): 

Interpretation of Biochemical Identification Tests and Sets. 

In: Bacteria from Fish and Other Aquatic Animals: A Practical Identification Manual 

CABI Publishing, London, UK, S. 117-136 

BURROWS, T. and G. A. BACON (1956): 

The basis of virulence in Pasteurella pestis: an antigen determinig virulence. 

Br J Exp Pathol. 37, 481-493 

CASTIGNETTI, D. and J. SMARRELLI-JR. (1986): 

Siderophores, the iron nutrition of plants, and nitrate reductase. 

FEMS Microbiol Lett 209, 147-151 

CHEN, P. E., C. COOK, A. C. STEWART, N. NAGARAJAN, D. D. SOMMER, M. POP, B. THOMASON, M. 

P. K. THOMASON, S. LENTZ, N. NOLAN, A. SULAKVELIDZE, A. MATECZUN, L. DU, M. E. ZWICK 

and T. D. READ (2010): 

Genomic characterization of the Yersinia genus. 

Genome Biology 11, R1 

CHEVANCE, F. F. V. and K. T. HUGHES (2008): 

Coordinating assembly of a bacterial macromolecular machine. 

Nat Rev Microbiol 6, 455-465 

CLLINS, R. O., G. FOSTER and H. M. ROSS (1996): 

Isolation of Yersinia ruckeri from an otter and salmonid fish from adjacent freshwater catchments. 

Vet Rec 139, 169 

COQUET, L., P. COSETTE, G.-A. JUNTER, E. BEUCHER, J.-M. SAITER, T. JOUENNE and J.-M. S. D 

(2002a): 

Adhesion of Yersinia ruckeri to fish farm materials:influence of cell and material surface properties. 

Colloids and surfaces B 26, 373-378 

COQUET, L., P. COSETTE, L. QUILLET, F. PETIT, G. A. JUNTER and T. JOUENNE (2002b): 

Occurrence and phenotypic charaterization of Yersinia ruckeri strains with biofilm-forming capacity in a 

rainbow trout Farm. 

Appl Environ Microbiol 68, 470-475 

CORNELIS, G. R. (2002): 

Yersinia type III secretion: send in the effectors. 

J Cell Biol 158, 401-408 

24


CORNELIS, G. R. (2006): 

The type III secretion injectisome. 

Nat Rev Microbiol 4, 811-825 

CRUZ, J. A. D. L., A. RODRIGUEZ, C. TEJEDOR, E. D. LUCAS and L. R. OROZCO (1986): 

Isolation and identification of Yersinia ruckeri, causal agent of enteric redmouth disease (ERM), for the first time 

in Spain. 


DAHIYA, I. and R. M. W. STEVENSON (2010a): 

The UvrY response regulator of the BarA–UvrY two-component system contributes to Yersinia ruckeri infection 

of rainbow trout(Oncorhynchus mykiss). 

Arch. Microbiol. 192, 541-547 

DAHIYA, I. and R. M. W. STEVENSON (2010b): 

Yersinia ruckeri genes that attenuate survival in rainbow trout(Oncorhynchus mykiss) are identified using 

signature-tagged mutants. 

Vet Microbiol 144, 399-404 

DAHIYA, I. and R. M. W. STEVENSON (2010c): 

The ZnuABC operon is important for Yersinia ruckeri infections of rainbow trout, Oncorhynchus mykiss 

(Walbaum). 

J Fish Dis 33, 331-340 

DALY, J. G., B. LINDVIK and R. M. W. STEVENSON (1986): 

Serological heterogeneity of recent isolates of Yersinia ruckeri from Ontario and British Columbia. 


DANLEY, M. L., A. E. GOODWIN and H. S. KILLIAN (1999): 

Epizootics in farm-raised channel catfish, Ictalurus punctatus(Rafinesque), caused by the enteric redmouth 

bacterium Yersinia ruckeri. 

J Fish Dis 22, 451-456 

DAVIES, R. L. (1990): 

O-Serotyping of Yersinia ruckeri with Special Emphasis on European Isolates. 


DAVIES, R. L. (1991a): 

Clonal analysis of Yersinia ruckeri based on biotypes, serotypes and outer membrane protein-types. 

J Fish Dis 14, 221-228 

DAVIES, R. L. (1991b): 

Virulence and serum-resistance in different clonal groups and serotypes of Yersinia ruckeri. 


DAVIES, R. L. and G. N. FRERICHS (1989): 

Morphological and biochemical differences among isolates of Yersinia ruckeri obtained from wide geographical 

areas. 

J Fish Dis 12, 357-365 

DE-GRANDIS, S. A. and R. M. W. STEVENSON (1985): 

Antimicrobial susceptibility patterns and R plasmid-mediated resistance of the fish pathogen Yersinia ruckeri. 

Antimicrob Agents Ch 27, 938-942 

DESVAUX, M., M. HEBRAUD, I. R. HENDERSON and M. J. PALLEN (2006): 

Type III secretion: what's in a name? 

Trends in Microbiology 14, 157-160 

DULIN, M. P., T. HUDDLESTON, R. E. LARSON and G. W. KLONTZ (1976): 

Enteric redmouth disease. 

25


University of Idaho, College of Forestry, Wild and Range Science Bulletin No 8 Moscow, ID 8:15pp 

DWILOW, A. G., B. W. SOUTER and K. KNIGHT (1987): 

Isolation of Yersinia ruckeri from burbot, Lota Lota (L), from the mackenzie river, Canada. 

Journal of Fish Disease 10, 315-317 

ENRIQUEZ, R. and J. ZAMORA (1987): 

Isolation of Yersinia ruckeri from Carps (Cyprinus carpio) in Valdiva. 

Archivos Se Medicina Veterinaria 19, 33-36 

ERHARDT, M., K. NAMBA and K. T. HUGHES (2010): 

Bacterial nanomachines: The flagellum and type III injectisome. 

Cold Spring Harb Perspect Biol 2, a000299 

EVENHUIS, J. P., S. E. LAPATRA, D. W. VERNER-JEFFREYS, I. DALSGAARD and T. J. WELCH (2009): 

Identification of Flagellar Motility Genes in Yersinia ruckeri by Transposon Mutagenesis. 


EWING, W. H., A. J. ROSS, D. J. BRENNER and G. R. FANNING (1978): 

Yersinia ruckeri sp. nov., the Redmouth (RM) Bacterium. 

International Journal of Systematic Bacteriology 28, 37-44 

FARALDO-GOMEZ, J. and S. P. SANSON (2003): 

Acquisition of siderophores in Gram-negative bacteria. 

National Review 4, 105-116 

FERN NDEZ, L., J. R. L PEZ, P. SECADES, A. MEN NDEZ, I. M RQUEZ and J. A. GUIJARRO (2003): 

In vitro and in vivo studies of the Yrp1 protease from Yersinia ruckeri and its role in protective immunity against 

enteric redmouth disease of salmonids. 

Appl. Environ. Microbiol. 69, 7328-7335 

FERN NDEZ, L., I. M RQUEZ and J. A. GUIJARRO (2004): 

Identification of Specific In Vivo-Induced (ivi) Genes in Yersinia ruckeri and Analysis of Ruckerbactin, a 

Catecholate Siderophore Iron Acquisition System. 


FERN NDEZ, L., M. PRIETO and J. A. GUIJARRO (2007): 

The iron- and temperature-regulated haemolysin YhlA is a virulence factor of Yersina ruckeri. 

Microbiology 153, 483-489 

FERN NDEZ, L., P. SECADES, J. R. LOPEZ, I. MARQUEZ and J. A. GUIJARRO (2002): 

Isolation and analysis of a protease gene with an ABC transport system in the fish pathogen Yersinia ruckeri: 

insertional mutagenesis and involvement in virulence. 

Microbiology 148, 2233-2243 

FOUZ, B., C. ZARZA and C. AMARO (2006): 

First description of non-motile Yersinia ruckeri serovar I strains causing disease in rainbow trout, Oncorhynchus 

mykiss (Walbaum), cultured in Spain. 

J Fish Dis 29, 339-346 

FRANCIS, M. S., H. WOLF-WATZ and A. FORSBERG (2002): 

Regulation of type III secretion systems. 

Current Opinnion in Microbiology 5, 166-172 

FRERICHS, G. N., J. A. STEWART and R. O. COLLINS (1985): 

Atypical infection of rainbow trout, Salmo gairdneri Richardson, with Yersinia ruckeri. 

J Fish Dis 8, 383-387 

FUHRMANN, H. and K. H. BOEHM (1983): 

An outbreak of enteric redmouth disease in West Germany. 

J Fish Dis 6, 309-311 

26


FURONES, M. D. (1990) 

Factors affecting the pathogenicity of Yersinia ruckeri. 

Plymouth, UK, 

FURONES, M. D., M. L. GILPIN and C. B. MUNN (1993a): 

Culture media for the differentiation of isolates of Yersinia ruckeri, based on detection of a virulence factor. 

J Appl Microbiol 74, 360-366 

FURONES, M. D., C. J. RODGERS and C. B. MUNN (1993b): 

Yersina ruckeri, the causal agent of enteric redmouth disease(ERM) in fish. 

Annu Rev Fish Dis 105-125 

GOOD, C. M., M. A. THORBURN and R. M. W. STEVENSON (2001): 

Host factors associated with the detection of Aeromonas salmonicida and Yersinia ruckeri in Ontario, Canada 

government fish hatcheries. 

Prev Vet Med 49, 165-173 

GREEN, M. and B. AUSTIN (1983): 

The identification of Yersinia ruckeri and its relationship to other representatives of the enterobacteriaceae. 


GUICHARD, B. and E. LICEK (2006): 

A comparative study of antibiotics registered for use in farmed fish in European countries. 

Poster presented at the First OIE Global Conference on Aquatic Animal Health 10 October, Bergen, Norway 

GUNASENA, D., J. KOMROWER and S. MACINTYRE (2003): 

The Fish Pathogen Yersinia ruckeri Possesses a TTS System. 

In: The Genus Yersinia: Entering the Functional Genomic Era 

Kluwer Academic/Plenum Publishers, New York, USA, S. 105-107 

HORNE, M. T. and A. C. BARNES (1999): 

Enteric redmouth disease (Yersinia ruckeri). 

In: Fish diseases and disorders 

CABI Publishing, Wallingford, S. 445-477 

HUECK, C. J. (1998): 

Type III Protein Secretion Systems in Bacterial Pathogens of Animals and Plants. 

Microbiology and Molecular Biology Reviews 62, 379-433 

HUNTER, V. A., M. D. KNITTEL and J. L. FRYER (1980): 

Stress-induced transmission of Yersinia ruckeri infection from carriers to recipient steelhead trout Salmo 

gairdneri Richardson. 

J Fish Dis 3, 467-472 

IMBEAULT, S., S. PARENT, M. LAGACE, C. F. UHLAND and J.-F. BLAIS (2006): 

Using bacteriophages to prevent furunculosis caused by Aeromonas salmonicida in farmed brook trout. 

J Aqua Anim Health 18, 203-214 

ISBERG, R. R. and S. FALKOW (1985): 

A single genetic locus encoded by Yersinia psuedotuberculosis permits invasion of cultured animal cells by 

Escherichia coli K-12. 

Nature 317, 262-264 

ISPIR, U., H. B. GOKHAN, M. OZCAN, M. DORUCU and N. SAGLAM (2009): 

Immune Response of Rainbow Trout (Oncorhynchus mykiss) to Selected Antigens of Yersinia ruckeri. 

Acta Vet. Brno 78, 145-150 

27


KADLEC, K., E. V. CZAPIEWSKI, H. KASPAR, J. WALLMANN, G. B. MICHAEL, U. STEINACKER and S. 

SCHWARZ (2011): 

Molecular basis of sulfonamide and trimethoprim resistance in fish-pathogenic Aeromonas isolates. 


KARATAS, S., A. CANDAN and D. DEMIRCAN (2004): 

Enteric Red Mouth Disease in Cultured Rainbow trout (Oncorhynchus Mykiss) on the black sea coast of Turkey. 

Isr J Aquacult-Bamid 56, 226-231 

KAWULA, T. H., M. J. LELIVELT and P. E. ORNDORFF (1996): 

Using a new inbred fish model and cultured fish tissue cells to study Aeromonas hydrophila and Yersinia ruckeri 

pathogenesis. 

Microb Pathogenesis 20, 119-125 

KIM, W. (2000) 

Investigation of the role of flagella in the virulence of Yersinia ruckeri. 

Canada, 

KIRKAN, S., E. Ö. G KSOY, O. KAYA and S. TEKBIYIK (2006): 

In-vitro antimicrobial susceptibility of pathogenic bacteria in rainbow trout (Oncorhynchus mykiss, Walbaum). 

Turkish Journal of Veterinary and Animal Sciences 30, 337-341 

KLEIN, B. U., D. W. KLEINGELD and K. H. BOHM (1994): 

First isolation of a non-motile/tween 80 negative Yersinia ruckeri strain in Germany. 


KNUTTON, S., I. ROSENSHINE, M. J. PALLEN, I. NISAN and B. C. NEVES (1998): 

A novel EspA-associated surface organelle of enteropatogenic Escherichia coli involved in protein translocation 

into epithelial cells. 

The EMBO Journal 17, 2166-2176 

KOTETISHVILI, M., A. KREGER, G. WAUTERS, J. G. JR. MORRIS, A. SULAKVELIDZE and O. C. STINE 

(2005): 

Multilocus Sequence Typing for Studying Genetic Relationships among Yersinia Species. 

American Society for Microbiology 43, 2674-2684 

LALUMERA, G. M., D. CALAMARI, P. GALLI, S. CASTIGLIONI, G. CROSA and R. FANELLI (2004): 

Preliminary investigation on the enviromental occurrence and effects of antibiotics used in aquaculture in Italy. 

Chemosphere 54, 661-668 

LI, S., D. WANG, H. LIU and T. LU (2013): 

Isolation of Yersinia ruckeri strain H01 from farm-raised Amur Sturgeon Acipenser schrencki in China. 


M NDEZ, J., L. FERN NDEZ, A. MEN NDEZ, P. REIMUNDO, D. P REZ-PASCUAL, R. NAVAIS and J. A. 

GUIJARRO (2009): 

A Chromosomally Located traHIJKCLMN Operon Encoding a Putative Type IV Secretion System Is Involved 

in the Virulence of Yersinia ruckeri. 


MACNAB, R. M. (2004): 

Type III flagellar protein export and flagellar assembly. 

Biochemica et Biophysica Acta 1694, 207-217 

MAHJOOR, A. A. and M. AKHLAGHI (2012): 

A pathological study of rainbow trout organs naturally infected with enteric redmouth disease. 

Asian Journal of Animal Sciences 6, 147-153 

MARTINEZ, J. L., A. DELGADO-IRIBARREN and F. BAQUERO (1990): 

Mechanisms of iron acquisition and bacteril virulence. 

FEMS Microbiology Reviews 75, 

28


MCNALLY, A., R. M. L. RAGIONE, A. BEST, G. MANNING and D. G. NEWELL (2007): 

An aflagellate mutant Yersinia enterocolitica biotype 1A strain displays altered invasion of epithelial cells, 

persistence in macrophages, and cyokine secretion profiles in vitro. 

J Med Microbiol 153, 1339-1349 

MEIER, W. (1986): 

Enteric redmouth disease: outbreak in rainbow trout in Switzerland. 


MILLER, V. L. and S. FALKOW (1988): 

Evidence for two genetic loci from Yersinia enterocolitica that can promote invasion of epithelial cells. 

Infect Immun 56, 1242-1248 

MILLS, S. D., A. BOLAND, M. P. SORY, P. VAN DER SMISSEN, C. KERBOURCH, B. B. FINLAY and G. 

R. CORNELIS (1997): 

Yersinia enterocolitica induces apoptosis in macrophages by a process requiring functional type III secretion and 

translocation mechanisms and involving YopP, presumably acting as an effector protein. 

Proc Natl Acad Sci USA 94, 12638-12643 

MILTON, D. L., R. O'TOOLE, P. HORSTEDT and H. WOLF-WATZ (1996): 

Flagellin A is essential for the virulence of Vibrio anguillarum. 

J Bacteriol 178, 1310-1319 

NOGA, E. J. (2010): 

Fish Disease: Diagnosis and Treatment 

Wiley-Blackwell, Iowa 

NOGA, E. J., J. F. LEVINE, K. TOWNSEND, R. A. BULLIS, C. P. CARLSON and W. T. CORBETT (1988): 

Kidney biopsy: a nonlethal method for diagnosing Yersinia ruckeri infection (enteric redmouth disease) in 

rainbow trout (Salmo gairdneri). 

Am J Vet Res 49, 363-365 

ONUK, E. E., A. CIFTCI, A. FINDIK, G. CIFTCI, S. ALTUN, F. BALTA, S. OZER and A. Y. COBAN (2011): 

Phenotypic and molecular characterization of Yersinia ruckeri isolates from Rainbow trout (Oncorhynchus 

mykiss, Walbaum,1792) in Turkey. 

Berliner und Münchener Tierärztliche Wochenschrift 124, 320-328 

PAGE, A. L. and C. PARSOT (2002): 

Chaperones of the type III secretion pathway: jacks of all trades. 

Mol Microbiol 46, 1-11 

PALLEN, M. J., S. A. BEATSON and C. M. BAILEY (2005): 

Bioinformatics, genomics and evolution of non-flagellar type-III secretion systems: a Darwinian perpective 

FEMS Microbiology Reviews 29, 201-229 

PĘKALA, A., A. KOZIŃSKA and J. ANTYCHOWICZ (2010): 

Serological Variation Among Polish Isolates of Yersinia ruckeri. 

Bull Vet Inst Pulawy 54, 305-308 

RAIDA, M. K. and K. BUCHMANN (2008): 

Bath vaccination of rainbow trout (Oncorhynchus mykiss Walbaum) against Yersinia ruckeri: Effects of 

temperature on protection and gene expression. 

Vaccine 26, 1050-1062 

ROBERTS, R. J. (2001): 

Fish Pathology. 

WB Sauners, London 

ROMALDE, J. L., R. F. CONCHAS and A. E. TORANZO (1991a): 

Evidence that Yersinia ruckeri possesses a high affinity iron uptake system. 

29



ROMALDE, J. L., I. ITEMAN and E. CARNIEL (1991b): 

Use of pulsed field gel electrophoresis to size the chromosome of the bacterial fish pathogen Yersinia ruckeri 


ROMALDE, J. L., B. MARGARINOS, J. L. BARJA and A. E. TORANZO (1993): 

Antigenic and molecular characterization of Yersinia ruckeri Proposal for a new intraspecies classification. 


ROMALDE, J. L. and A. E. TORANZO (1993): 

Pathological activities of Yersinia ruckeri, the enteric redmouth (ERM) bacterium. 


ROSENTHAL, H. and V. HILGE (2000): 

Aquaculture production and environmental regulations in Germany. 

J appl Ichthyol 16, 163-166 

ROSS, A. J., R. R. RUCKER and W. H. EWING (1966): 

Description of a bacterium associated with redmouth disease of rainbow trout (Salmo Gairdneri). 

Can J Microbiol 12, 763-770 

RUCKER, R. R. (1966): 

Redmouth disease of rainbow trout (Salmo gairdner). 

Bull off int Epizoot. 65, 825-830 

RYCKAERT, J., P. BOSSIER, K. D. HERDE, A. DIEZ-FRAILE, P. SORGELOOS, F. HAESEBROUCK and F. 

PASMANS (2010): 

Persistence of Yersinia ruckeri in trout macrophages. 

Fish Shellfish Immun 29, 648-655 

SALMOND, G. P. and P. J. REEVES (1993): 

Membrane Traffic Wardens and Protein Secretion in Gram-negative Bacteria. 

Trends in Biochemical Sicences 18, 7-12 

SALMOND, G. P. C. (1994): 

Secretion of extracellular virulence factors by plant pathogenic bacteria. 

Annu Rev Phytopathol 32, 181-200 

SANTOS, Y., J. L. ROMALDE, I. BANDIN, B. MAGARIFIOS, S. NUIIEZ, J. L. BARJA and A. A. E. 

TORANZO (1993): 

Usefulness of the API-20E system for the identification of bacterial fish pathogens. 


SAVAS, H., I. ALTINOK, E. CAKMAK and S. FIRIDIN (2006): 

Isolation of Renibacterium salmoninarum from cultured Black Sea salmon (Salmo trutta labrax): first report in 

Turkey. 


SCH PERCLAUS, W. (1991): 

Special Part A. Diseases caused by pathogens. 

In: Fish Diseases 

Amerind Publishing Co. Pvt. Ltd, New Delhi, S. 531 

SCHLOTFELDT, H. J., K. H. B HM, F. PFORTM LLER and K. PFORTM LLER (1986): 

Enteric redmouth disease/ERM of trout and other farmed fish in northwest Germany. 

Fischkrankheiten 37, 66-70 

SCHMIDT, A. S., M. S. BRUUN, I. DALSGAARD, K. PEDERSEN and J. L. LARSEN (2000): 

30


Occurence of antimicrobial resistance in fish-pathogenic and enviromental bacteria associated with four Danish 

rainbow trout farms. 


SECADES, P. and J. A. GUIJARRO (1999): 

Purification and characterization of an extracellular protease from the fish pathogen Yersinia ruckeri and effect 

of culture conditions on production. 


SEKER, E., M. KARAHAN, U. ISPIR, B. CATINKAYA, N. SAGLAM and M. SARIEYYUPOGLU (2012): 

Investigation of Yersinia ruckeri infection in rainbow trout (Oncorhynchus mykiss Walbaum 1792) farms by 

polymerase chain reaction (PCR) and bacteriological culture. 

Kafkas Universitesi Veteriner Fakultesi Dergisi 18, 913-916 

SERRANO, P. H. (2005): 

Responsible use of antibiotics in aquaculture. 

FAO Fisheries Technical Paper 469, 97 

SHAH, S. Q. A., S. KARATAS, H. NILSEN and T. M. STEINUM (2012): 

Characterization and expression of the gyrA gene from quinolone resistant Yersinia ruckeri strains isolated from 

Atlantic salmon (Slamo salar L.) in Norway. 

Aquaculture 350-353, 37-41 

SON, R., G. RUSUL, A. M. SAHILAH, A. ZAINURI, A. R. RAHA and I. SALMAH (1997): 

Antibiotic resistance and plasmid profile of Aeromonas hydrophila isolates from cultured fish, Telapia (Telapia 

mossambica). 

Lett Appl Microbiol 24, 479-482 

SOUZA, R. A., A. PITONDO-SILVA, D. P. FALC O and J. P. FALC O (2010): 

Evaluation of four molecular typing methodologies as tools for determining taxonomy relations and for 

identifying species among Yersinia isolates. 

J Microbiol Meth 82, 141-150 

SPARBOE, O., C. KOREN, T. HAASTEIN, T. POPPE and H. STENWIG (1986): 

The first isolation of Yersinia ruckeri from farmed Norwegian salmon. 


STEVENSON, R. M. W. (1997): 

Immuniztion with bacterial antigens: yersiniosis. 

Dev Biol Stand 90, 117-124 

STEVENSON, R. M. W. and D. E. AIRDRIE (1984a): 

Serological variation among Yersinia ruckeri strains. 

J Fish Dis 7, 247-254 

STEVENSON, R. M. W. and D. W. AIRDRIE (1984b): 

Isolation of Yersinia ruckeri bacteriophages. 


STR M-BESTOR, M., N. MUSTAM KI, S. HEINIKAINEN, V. HIRVEL -KOSKI, D. VERNER-JEFFREYS 

and T. WIKLUND (2010): 

Introduction of Yersinia ruckeri biotype 2 into Finnish fish farms. 


SUN, Y. Z., H. L. YANG, R. L. MA and W. Y. LIN (2010): 

Probiotic applications of two dominant gut Bacillus strains with antagonistic activity improved the growth 

performance nd immune responses of grouper Epinephelus coioides. 


TINSLEY, J. (2010) 

31


Studies on the pathogenicity of Yersinia ruckeri biotype 2 to rainbow trout (Oncorhynchus mykiss, Walbaum) 

Edinburgh, UK School of Life Sciences 

TOBBACK, E., A. DECOSTERE, K. HERMANS, J. RYCKAERT, L. DUCHATEAU, F. HAESEBROUCK 

and K. CHIERS (2009): 

Route of entry and tissue distribution of Yersinia ruckeri in experimentally infected rainbow trout Oncorhynchus 

mykiss. 


TOBBACK, E., A. DECOSTERE, K. HERMANS, W. VAN DEN BROECK, F. HAESEBROUCK and K. 

CHIERS (2010): 

In vitro markers for virulence in Yersinia ruckeri. 

J Fish Dis 33, 197-209 

TOBE, T., S. A. BEASON, H. TANIGUCHI, H. ABE, C. M. BAILEY, A. FIVIAN, R. YOUNIS, S. 

MATTHEWS, O. MARCHES, G. FRANKEL, T. HAYASHI and M. J. PALLEN (2006): 

An extensive repertoire of type III secretion effectors in Escherichia coli O157 and the role of lambdoid phages 

in their dissemination. 

Proceedings of the National Academy of Sciences of the United States of America 103, 14941-14946 

VALTONEN, E. T., P. RINTAMAKI and M. KOSKIVAARA (1992): 

Occurrence and pathogenicity of Yersinia ruckeri at fish farms in northern and central Finland. 

J Fish Dis 15, 163-171 

VILCHES, S., N. JIMENEZ, J. M. TOM S and S. MERINO (2009): 

Aeromonas hydrophila AH-3 Type III Secretion System Expression and Regulatory Network. 


VLADIK, P. and A. PROUZA (1990): 

The Finding of Yersinia ruckeri in rainbow trout in Czechoslovakia. 

Veterinarni Medicina 35, 437-442 

VUILLAUME, A., R. BRUN, P. CHENE, E. SOCHON and R. LESEL (1987): 

First isolation of Yersinia ruckeri from sturgeon, Acipenser baeri Brandt, in south west of France. 


WALTMAN, W. D. and E. B. SHOTTS (1984): 

A medium for the isolation and differentiation of Yersinia ruckeri. 

Can J Fish Aquat Sci 41, 804-806 

WANG, K., H. LIAN, D. CHEN, J. HUANG, J. WANG and Q. MOU (2012): 

Cloning, identification and molecular characteristics analysis of p1 gene of Yersinia ruckeri isolated from 

channel catfish (Ictalurus punctatus). 

Asian Journal of Animal and Veterinary Advances 7, 1067-1078 

WANG, K. Y., F. L. FAN, X. L. HUANG, Y. GENG, D. F. CHEN and J. L. HUANG (2009): 

Occurrence and treatment of a channel catfish(Ictalurus punctatus(Rafinesque)) disease, caused by Yersinia 

ruckeri. 

Scientific Fish Farming 5, 50-51 

WARSEN, A. E., M. J. KRUG, S. LAFRENTZ, D. R. STANEK, F. J. LOGE and D. R. CALL (2004): 

Simultaneous siscrimination between 15 fish pathogens by using 16S ribosomal DNA PCR and DNA 

microarrays. 


WELCH, T. J. (2011): 

Rapid genotyping assays for the identification and differentiation of Yersinia ruckeri biotype 2 strains. 

Lett Appl Microbiol 53, 383-385 

WHEELER, R. W., R. L. DAVIES, I. DALSGAARD, J. GARCIA, T. J. WELCH, S. WAGLEY, K. S. 

BATEMAN and D. W. VERNER-JEFFREYS (2009): 

32


Yersinia ruckeri biotype 2 isolates from mainland Europe and the UK represent different clonal groups. 


WORTBERG, F., E. NARDY, M. CONTZEN and J. RAU (2012): 

Identification of Yersinia ruckeri from diseased salmonid fish by fourier transform infrared spectroscopy. 

J Fish Dis 35, 1-10 

YEH, R. Y., Y. L. SHIU, S. C. SHEI, S. C. CHENG, S. Y. HUANG, J. C. LIN and C. H. LIU (2009): 

Evaluation of the antibacterial activity of leaf and twig extracts of stout camphor tree, Cinnamomun kanehirae, 

and the effects on immunity and disease resistance of white shrimp, Litopenaeus vannamei. 


YOUNG, M. B. and G. M. YOUNG (2002): 

YplA Is Exported by the Ysc, Ysa, and Flagellar Type III Secretion Systems of Yersinia enterocolitica. 

J Bacteriol 184, 1324-1334 

YUGUEROS, J., A. TEMPRANO, J. M. LUENGO and G. NAHARRO (2001): 

Molecular cloning of Yersinia ruckeri aroA gene: a useful taxonomic tool. 

J Fish Dis 24, 383-390 

ZINK, S. D., L. PEDERSEN, N. P. CIANCIOTTO and Y. A. KWAIK (2002): 

The Dot/Icm type IV secretion system of Legionella pneumophila is essential for the induction of apoptosis in 

human macrophages. 

Infect Immun 70, 1657-1663 

33

Chapter 2. 

Biochemical and Molecular Heterogeneity among 

Isolates of Yersinia ruckeri from Rainbow Trout 

(Oncorhynchus mykiss, Walbaum) in North West 

Germany 

Yidan Huang, Martin Runge, Geovana Brenner Michael, 

Stefan Schwarz, Arne Jung, Dieter Steinhagen 

BMC Veterinary Research, 2013, 9:215 

35

The extent of Yidan Huang‟s contribution to the article is evaluated according to the 

following scale: 

A. has contributed to collaboration (0-33%). 

B. has contributed significantly (34-66%). 

C. has essentially performed this study independently (67-100%). 

1. Design of the project including design of individual experiments: B 

2. Performing of the experimental part of the study: C 

3. Analysis of the experiments: B 

4. Presentation and discussion of the study in article form: C 

36

Chapter 2 Biochemical and Molecular Heterogeneity of Y. ruckeri 

37


38


39


40


41


42


43


44


45

Chapter 3. 

Field study on Yersinia ruckeri isolates from trout 

hatcheries in North West Germany 

Yidan Huang, Arne Jung, Geovana Brenner Micheal, 

Martin Runge, Stefan Schwarz, Dieter Steinhagen 

47







2. Performing of the experimental part of the study: B 

3. Analysis of the experiments: C 


48

Chapter 3 Field study on Y. ruckeri in North West Germany 

Field study on Yersinia ruckeri isolates from trout hatcheries in North 

West Germany 

Yidan Huang 1 , Arne Jung 2 , Geovana Brenner Michael 3 , Martin Runge 4 , Stefan Schwarz 3 , Dieter 

Steinhagen 1 

1 Fish Disease Research Unit, University of Veterinary Medicine Hannover, Germany 

2 Clinic for Poultry, University of Veterinary Medicine Hannover, Foundation, Hannover, Germany 

3 Institute of Farm Animal Genetics, Friedrich-Loeffler-Institut (FLI), Neustadt-Mariensee, Germany 

4 Lower Saxony State Office for Consumer Protection and Food Safety (LAVES), Food and Veterinary Institute Braunschweig/Hannover, Germany 

ABSTRACT: Enteric Redmouth Disease (ERM), caused by Yersinia ruckeri, is one of the most 

important infectious diseases in rainbow trout (Oncorhynchus mykiss) aquaculture in Europe. Our 

aim was to analyse the distribution of Y. ruckeri in North West Germany, as well as the variation of 

their biochemical and molecular characteristics as a basis for strain differentiation. During different 

seasons from June 2011 until June 2012, samples were taken from different rainbow trout hatcheries. 

12 rainbow trout hatcheries were visited during the sampling period. Y. ruckeri was isolated 

frequently from rainbow trouts of about 21-30cm length. 48 isolates were collected during this field 

study in North West Germany and 33 strains were obtained from LAVES, Hannover and LHL 

Hessen strain collection. 92% of the isolates from the field study were non-motile. Moreover, during 

the sampling period in winter and early spring, all the isolates recovered from the field were 

non-motile. In several trout farms, more than two isolates with different genetic features were present. 

Isolates from one designated typing group were obtained in field study during every sampling 

campaign throughout the year, while motile isolates from another typing group were present only 

during summer and autumn samplings. Our results will provide data on identifying and 

characterizing pathogenic Y. ruckeri strains and examining the distribution of these strains in the 

field as a basis for preventive disease monitoring plans. 

KEY WORDS: Epidemiology, Sampling, Distribution, Variation, Enteric redmouth disease 

INTRODUCTION 

Enteric Redmouth Disease (ERM) was reported in Idaho, USA, as early as 1950s (Rucker 

1966). Subsequently, in the late 1970s to the early 1980s, it was first introduced to Europe from 

the USA (Horne & Barnes 1999). So far, most of European countries have reported ERM cases 

49


in aquaculture (Lesel & Lesel 1983, Valtonen et al. 1992, Oraić et al. 2002), ranging from 

different hosts (Valtonen et al. 1992, Danley et al. 1999, Noga 2000), but rainbow trout 

(Oncorhynchus mykiss) is especially susceptible. Today ERM is one of the important diseases 

of aquatic animals. Since Yersinia ruckeri is the causative pathogen of ERM, many biochemical 

and molecular methods are applied to detect and identify this bacteria (Gibello et al. 1999, 

Altinok et al. 2001, Saleh et al. 2008, Glenn et al. 2011), so that the protection and treatment of 

ERM can be applied as quickly as possible. 

In order to control ERM, commercial vaccines made from inactivated whole cells of Y. 

ruckeri were developed (Ross et al. 1966), and the vaccines are considered to be successful 

(Tebbit et al. 1981). However, the usage of vaccines and the treatment with antibiotics may 

cause a selective pressure on Y. ruckeri and it could be the reason for recent outbreaks caused by 

non-motile strains of Y. ruckeri, which seems to be not sensitive to several vaccines made for 

motile Y. ruckeri (Austin et al. 2003, Fouz et al. 2006). In 1994, Klein et al. (Klein et al. 1994) 

reported the first isolation of a non-motile strain of Y. ruckeri in Germany. Furthermore, the 

outbreak of ERM was not any more constrained by lower temperature. Outbreaks were 

observed even in winter when the temperature is lower than 10°C. Therefore, an 

epidemiological study of Y. ruckeri in North West Germany was performed, in order to provide 

data on the diversity of Y. ruckeri in this region. 

MATERIALS AND METHODS 

Sample collection and bacteria isolation 

Rainbow trouts (Oncorhynchus mykiss) were sampled from keeping units of 12 different trout 

farms in the German federal state North Rhine-Westphalia (NRW) during the four seasons of 

2011-2012. Farms ranged from concrete tanks to flow-through units. The freshwater was supplied 

from different rivers, including the River Spring, River Rur, River Lambach and others, with water 

temperature varying from 4℃ in winter to 18℃ in summer during sampling time. From the ponds, 

fish with clinical signs indicating a bacterial infection were selected. In the farms MU and MS, 

where diseased fish were not present, fish were randomly sampled from ponds. An overview of 

50


visited farms, sampled keeping units and collected trout is given in Table 1. Y. ruckeri isolates were 

obtained from liver and kidney of sampled trout. 

Other isolates used in this study were obtained from the strain collection of LAVES, Food and 

Veterinary Institute Braunschweig/Hannover, and the fish disease service of Hessen at Giessen. 

Samples from LAVES, Hannover, originated mainly from the federal state of Lower Saxony and 

were collected in 2004 to 2009 from fish with clinical signs of disease. The isolates from Hessen 

were isolated from 2010 to 2011 from diseased rainbow trout without detailed data about the original 

geographic sites. The isolates were kept at -80℃. 

Identification of Isolates 

All isolates were examined for the Gram-staining and cytochrome oxidase reaction, and were 

biochemically characterized by API 20E tests (Biomerieux, France). Five isolates were identified by 

both the API 20E system and 16s rDNA sequencing. 

Typing of Isolates 

For typing, API 20E profiles of the isolates were recorded, four repetitive sequence-based PCRs 

were performed, including BOX-A1R-based repetitive extragenic palindromic-PCR (BOX-PCR), 

(GTG) 5 -PCR, enterobacterial repetitive intergenic consensus (ERIC-PCR) and repetitive extragenic 

palindromic (REP-PCR) and pulsed-field electrophoresis was performed as described previously 

(Huang et al. 2013b). 

RESULTS 

Bacteria isolates 

In total 81 Y. ruckeri isolates were obtained, including 48 isolates from the field study performed 

in trout hatcheries of NRW, 33 isolates from LAVES, Food and Veterinary Institute 

Braunschweig/Hannover and the fish disease service of Hessen at Giessen. One non-motile strain 

isolated also in NRW in 2008 was offered by Dr. Gould from MSD Animal Heath and a reference 

strain DSM 18506 was included. The isolates were identified as Y. ruckeri by API 20E. Five isolates 

were identified by 16S rDNA sequencing, additionally. In Fig. 1, the geographic origins of isolates 

were marked in red; the locations of the different sample collection sites in NRW were labelled with 

the acronyms for the different fish farms (Fig.1). No detailed information was received about the 

geographic origins of isolates from Hessen. 

51


Sample collection in North Rhine-Westphalia 

During the different seasons from June 2011 until June 2012, 12 rainbow trout hatcheries were 

visited and rainbow trout were sampled from different 91 keeping units including ponds and 

raceways. Y. ruckeri could be isolated from 39 keeping units from 9 trout hatcheries. Rainbow trout 

collected from 3 hatcheries were not infected by Y. ruckeri (see table 2). In infected ponds, the 

prevalence of the infection ranged from 100% (12 infected from 12 individuals examined) to 12% (3 

infected from 25 examined individuals). During the whole sampling period two farms (SR and P) 

had high positive rates of Y. ruckeri infections. Y. ruckeri could be isolated from 46 out of 76 trouts 

(60.5%), and 30 out of 46 trouts examined (65.2 %), respectively (Table 3), while three other farms 

(FR, MU and MS) were not harbouring infected rainbow trouts. However, all farms except FR, MU 

and MS had experienced ERM outbreaks before. 

During the different seasons of the sampling period, the overall prevalence of Y. ruckeri isolation 

ranged from 61.9 % (60 out of 97 trout examined) in June 2011 and 17.3 % (14 out of 81 trout 

examined) in July 2012. In ponds sampled in February, an overall prevalence of Y .ruckeri of 25.0 % 

(15 out of 60 individuals sampled) was recorded, while in September and April the bacterium was 

detected in 31.9 % (15 out of 47) and 31.6 % (12 out of 38) of the rainbow trout sampled (Table 3). 

The outbreak peak of ERM was mainly in summer and early autumn (Table 3). In winter and early 

spring, the water temperatures were below 10 °C , however, positive isolates could also be 

recovered from some fish farms, and the isolates were proved non-motile in further tests. 

Y. ruckeri was detected in rainbow trout from all size groups examined, from smaller than 5 cm up 

to 36 cm body length. However, most infections were recorded from trout in the size range of 21-25 

cm and 26-30 cm body length (Fig. 2). 

Distribution of non-motile strains 

About 60% of the isolates collected from Lower Saxony and Hessen were non-motile; while over 

90% of the isolates collected during the field study performed in trout hatcheries in NRW were 

non-motile (Fig. 3). During the field study, non-motile strains were dominant during the whole 

sampling year, but were especially isolated in the cold seasons, in February and April, when water 

temperature was below 10 °C (Fig.4). 

52


Variation of Y. ruckeri 

According to the results of API 20E, PFGE and the repetitive sequence-based PCR assays, the 

isolates could be divided into 27 different typing groups (Huang et al. 2013b) (Table 4). Most of the 

isolates belonged to tp2. In 5 fish farms, isolates of at least two different typing groups were present; 

in farm SR isolates from six different typing groups were present, in farm B isolates from five, and in 

farm KP isolates from four typing groups (Table 4). Farms where isolate tp 2 and tp8 were present 

had a selling and purchasing relationship with each other. However, no correlations were found 

among the farms where tp20 was present. In 4 farms, Y. ruckeri from a single typing group were 

isolated (Table 4). In different months, isolates from three or more different typing groups were 

recovered (Table 4). In the same fish farm, isolates from two or more typing groups could be 

recovered at the same time; and isolates from typing group 20 were obtained in samples collected at 

every sampling time (Table 4). Additionally, eight typing groups were found only in Lower Saxony, 

two typing groups were found only in Hessen, and 10 typing groups only in NRW. Two typing 

groups (Tp2 and Tp6) were distributed in all federal states investigated. 

DISCUSSIONS 

Since Y. ruckeri isolates was reported for the first time in the USA (Rucker 1966) and then 

introduced to Europe (Horne & Barnes 1999), it has become an important infectious disease in trout 

hatcheries (Busch 1978, Fuhrmann & Boehm 1983a, Roberts 1983). In infected rainbow trout 

populations, up to 25 % of the fish might carry the bacterium (Busch 1978). The bacterium was also 

recorded from biofilms of tanks in trout farms (Coquet et al. 2002) which could serve as a source for 

disease outbreaks. In the current study, rainbow trout from ponds in 12 trout hatcheries located in 

NRW, North West Germany, were examined for the presence of Y. ruckeri. From these nine farms 

had repeated outbreaks with ERM over several years, while 3 farms had no history with this 

infection. In the current study, Y. ruckeri was present in rainbow trout from all farms, which had 

previous ERM outbreaks, but not in the farms which previously were free of ERM. Overall, 82 Y. 

ruckeri isolates were recorded from the farms in the region of North West Germany, which according 

to biochemical and molecular identification methods could be divided into 26 different typing groups 

(Huang et al. 2013b). In the majority of the farms, which were repeatedly sampled, bacteria from 

53


different typing groups were found, and on several occasions, bacteria of different typing groups 

were simultaneously present in rainbow trout from the same farm. 

In previous studies, mainly motile strains of Y. ruckeri were found associated with clinical 

infections of ERM in rainbow trout (Meier 1986), but non-motile isolates were increasingly 

recognized as causative agents for disease outbreaks (Giorgetti et al. 1985, Fouz et al. 2006). In the 

current study, isolates from most trout farms were non-motile, which might indicate that after the 

first detection of a non-motile isolate in Germany in 1994 (Klein et al. 1994), non-motile bacteria 

were distributed over several farms in North West Germany. In particular bacteria from the typing 

groups 2 (which were found most frequently) and 8 were isolated from 5 farms. These farms had a 

trading relationship between each other, which could facilitate the distribution of particular types of 

the pathogens. In addition, bacteria from typing group 20 were found in several farms, which 

however had no obvious trading relation. It is accepted that Y. ruckeri outbreaks in farms can 

originate from latently infected rainbow trout (Rodgers 1992), or from environmental samples 

(Romalde et al. 1994, Coquet et al. 2002) but its transmission was also related to wild fish or aquatic 

invertebrates as putative vectors (McDanniel 1971, Fuhrmann & Boehm 1983b, Willumsen 1989). A 

transmission by birds could also be possible (Bangert et al. 1988). Thus the distribution of Y. ruckeri 

by such possible vectors has to be considered, but in the current study, those farms, which had no 

previous history with Y. ruckeri infection, did not experience an ERM outbreak throughout the 

observation period. This might emphasise the importance of latent infections with Y. ruckeri in 

farmed carrier fish or survival in biofilms of the farm for the spreading of the disease. This view 

could be supported by the findings of the present study. In farms with repeated outbreaks of ERM, Y. 

ruckeri from the same or from genetically similar typing groups (Huang et al. 2013b) were isolated. 

Outbreaks of ERM were usually associated with challenging environmental conditions, such as 

poor water quality, excessive stocking densities, and high water temperature (Horne & Barnes 1999). 

In this study, outbreaks were mainly observed in summer and early autumn, at a water temperature 

between 10 °C and 18 °C. In particular outbreaks caused by the motile bacteria from typing group 16 

were observed during this period of time, supporting the hypothesis that motile strains are more 

active during warmer seasons (Huang et al. 2013a). In the farms, rainbow trout ranging from 5 cm to 

54


36 cm body length were found to be infected, but ongrowing rainbow trout at a body length of 21cm 

to 30cm were mostly affected. Fish under the length of 5cm could also be infected. Kawula et al used 

Y. ruckeri to infect platy fish and found that this small fry died without clinical signs (Kawula et al. 

1996). From June 2011 to July 2011, the rate of Y. ruckeri positive rainbow trout decreased from 

61.2% to 17.3%, as a result from the usage of vaccines and antibiotic treatments. However, these 

measures could not provide 100% of protection, and that may be why the positive rate increased 

back to 31.9% in September 2011. In some ponds, outbreaks of ERM, were even observed during 

February and April, when the water temperature was below 10°C. These outbreaks were associated 

with non-motile Y. ruckeri strains, which previously were found to be more active at lower 

temperature (Huang et al. 2013a). Wheeler et al. (Wheeler et al. 2009) discovered that Y. ruckeri was 

introduced separately into the UK and Europe from the USA and these isolates from the UK and 

mainland Europe may represent different clonal groups. In this study, each federal state in North 

West Germany had its own array of typing groups of Y. ruckeri, however, two typing groups could 

be found in farms from all three states. In a previous study (Huang et al. 2013b), 35.4% of 82 isolates 

were associated with these two groups. This result suggested the bacteria might share a common 

origin but subsequently developed independently in different geographic regions. 

CONCLUSIONS 

Y. ruckeri could be isolated from rainbow trout all around the year. Non-motile strains were 

dominant in North West Germany, especially in winter and early spring when water temperature was 

below 10 °C. Our results will provide data on identifying and characterizing pathogenic Y. ruckeri 

strains and examining the distribution of these strains in the field as a basis for preventive disease 

monitoring plans. 

ACKNOWLEDGEMENTS 

We thank Dr. S. Braune (LAVES, Hannover), Dr. C. Gould (MSD Animal Health) and Dr. A Nilz 

(LHL Hessen) for the generous provision of isolates that used in this study. Dr. W. Schäfer and D. 

Mock (LANUV, Albaum) gave support during the field sampling. Dr. G. Brenner Michael, R. 

Becker (FLI, Mariensee) and S. Baumann (LAVES) provided valuable technical assistance. This work 

was supported by Landesamt für Natur, Umwelt und Verbraucherschutz Nordrhein-Westfalen (LANUV). 

55


REFERENCES 

Altinok I, Grizzle JM, Liu Z (2001) Detection of Yersinia ruckeri in rainbow trout blood by use of the 

polymerase chain reaction. Dis Aquat Organ 44:29-34 

Austin DA, Robertson PAW, Austin B (2003) Recovery of a New Biogroup of Yersinia ruckeri from 

Diseased Rainbow Trout(Oncorhynchus mykiss, Walbaum). Systematic and Applied Microbiology 

Bangert 26:127-131 RL, Ward AC, Stauber EH, Cho BR, Widders PR (1988) A survey of the aerobic bacteria in the feces 

of captive raptors. Avian Dis 32:53-62 

Busch RA (1978) Enteric redmouth disease(Hagerman strain). Marine Fisheries Review 40:42-51 

Coquet L, Cosette P, Quillet L, Petit F, Junter GA, Jouenne T (2002) Occurrence and phenotypic 

charaterization of Yersinia ruckeri strains with biofilm-forming capacity in a rainbow trout Farm. 

Appl Environ Microbiol 68:470-475 

Danley ML, Goodwin AE, Killian HS (1999) Epizootics in farm-raised channel catfish, Ictalurus 

punctatus(Rafinesque), caused by the enteric redmouth bacterium Yersinia ruckeri. Journal of Fish 

Diseases 22:451-456 

Fouz B, Zarza C, Amaro C (2006) First description of non-motile Yerinia ruckeri serovar I strains causing 

disease in rainbow trout, Oncorhynchus mykiss (Walbaum), cultured in Spain. Journal of Fish Disease 

29:339-346 

Fuhrmann H, Boehm KH (1983a) An outbreak of enteric redmouth disease in West Germany. J Fish Dis 

6:309-311 

Fuhrmann H, Boehm KH (1983b) An outbreak of enteric redmouth disease in West Germany. Journal of Fish 

Diseases 6:309-311 

Gibello A, Blanco MM, Moreno MA, Cutuli MT, Domenech A, Moniguez L, Fernandez-Garayzabal JF (1999) 

Development of a PCR Assay for Detection of Yersinia ruckeri in Tissues of Inoculated and Naturally 

Infected Trout. Applied and Enviromental Microbiology 65:346-350 

Giorgetti G, Ceschia G, Bovo G (1985) First isolation of Yersinia ruckeri in farmed rainbow trout in Italy. In: 

Ellis AE (ed) Fish and shellfish pathology Proceedings of the European Association of Fish 

Pathologists, Plymouth 

Glenn RA, Taylor PW, Hanson KC (2011) The use of a real-time PCR primer/probe set to observe infectivity 

of Yersinia ruckeri in Chinook salmon, Oncorhynchus tshawytscha (Walbaum), and steelhead trout, 

Oncorhynchus mykiss (Walbaum). Journal of Fish Disease 34:783-791 

Horne MT, Barnes AC (1999) Enteric redmouth disease (Yersinia ruckeri). In: Woo PTK, Bruno DW (eds) 

Fish diseases and disorders, Book 3. CABI Publishing, Wallingford 

Huang Y, Adamek M, Walker C, Runge M, Steinhagen D (2013a) In vitro cytotoxicity and multiplex PCR 

detection of virulence factors of Yersinia ruckeri isolated from rainbow trout in North West Germany. 

Berliner Münchener Tierärztliche Wochenschrift (submitted for publicaiton, Chapter 5) 

Huang Y, Runge M, Michael GB, Schwarz S, Jung A, Steinhagen D (2013b) Biochemical and Molecular 

Heterogeneity among Isolates of Yersinia ruckeri from Rainbow Trout (Oncorhynchus mykiss, 

Walbaum) in North West Germany. BMC Veterinary Research 9:215 

Kawula TH, Lelivelt MJ, Orndorff PE (1996) Using a new inbred fish model and cultured fish tissue cells to 

study Aeromonas hydrophila and Yersinia ruckeri pathogenesis. Microbial Pathogenesis 20:119-125 

Klein BU, Kleingeld DW, Bohm KH (1994) First isolation of a non-motile/tween 80 negative Yersinia ruckeri 

strain in Germany. Bulletin of the European Association of Fish Pathologists 14:165-166 

56


Lesel R, Lesel M (1983) Outbreak of enteric redmouth disease in rainbow trout, Salmo gairdneri Richardson, 

in France. Journal of Fish Diseases 6:385-387 

McDanniel DW (1971) Hagerman redmouth. American Fishes US Trout News 15:14-28 

Meier W (1986) Enteric redmouth disease: outbreak in rainbow trout in Switzerland. Diseases of Aquatic 

Organisms 2:81-82 

Noga EJ (2000) Enteric Redmouth Disease(ERM, Redmouth, Yersiniosis, Blood Spot, Yersinia Ruckeri 

Infection), Vol. Iowa State University Press, Ames 

Oraić D, Zrnčić S, Šoštarić B, Bažulić D, Lipej Z (2002) Occurrence of enteric redmouth disease in rainbow 

trout(Oncorhynchus Mykiss) on Farms in Croatia. Acta Veterinaria Hungarica 50:283-291 

Roberts MS (1983) A report of an epizootic in hatchery-reared rainbow trout, Salmo gairdneri Richardson, at 

an English trout farm, caused by Yersinia ruckeri. Journal of Fish Diseases 6:551-552 

Rodgers CJ (1992) Development of a selective-differential medium for the isolation of Yersinia ruckeri and its 

application in epidemiological studies. Journal of Fish Disease 15:243-254 

Romalde JL, Magarinos B, Pazos F, Silva A, Toranzo AE (1994) Incidence of Yersinia ruckeri in two farms in 

Galicia (NW Spain) during a one-year period. Journal of Fish Disease 17:533-539 

Ross AJ, Rucker RR, Ewing WH (1966) Description of a bacterium associated with redmouth disease of 

rainbow trout (Salmo Gairdneri). Can J Microbiol 12:763-770 

Rucker RR (1966) Redmouth disease of rainbow trout (Salmo gairdneri). Bull off int Epizoot 65:825-830 

Saleh M, Soliman H, El-Matbouli M (2008) Loop-mediated isothermal amplification as an emerging 

technology for detection of Yersinia ruckeri the causative agent of enteric red mouth disease in fish. 

BMC Veterinary Research 4 

Tebbit GL, Erickson JD, Water RBvd (1981) Development and use of Yersinia ruckeri bacterins to control 

enteric redmouth disease. In: International symposium on fish biologies: serodiagnostics and vaccines, 

Book 49. Dev Biol Stand 

Valtonen ET, Rintamaki P, Koskivaara M (1992) Occurrence and pathogenicity of Yersinia ruckeri at fish 

farms in northern and central Finland. J Fish Dis 15:163-171 

Wheeler RW, Davies RL, Dalsgaard I, Garcia J, Welch TJ, Wagley S, Bateman KS, Verner-Jeffreys DW 

(2009) Yersinia ruckeri biotype 2 isolates from mainland Europe and the UK represent different 

clonal groups. Diseases of Aquatic Organisms 84:25-33 

Willumsen B (1989) Birds and wild fish as potential vectors of Yersinia ruckeri. Journal of Fish Disease 

12:275-277 

57


Fig.1 Geographic origins of isolates 

Table 1 Overview fish species as host for Yersinia ruckeri in fish farms in North West Germany and year of isolation 

(82 isolates without the reference strain) 

Fish Species 

Sampling year 

2004 2005 2006 2007 2008 2009 2010 2011 2012 unknown Total 

Rainbow trout 3 6 7 1 2 7 33 16 75 

Brown trout 1 1 

Koi 1 1 

Pike 1 1 

Trout 1 1 2 

Not specified 1 1 2 

58


Table 2 Overview of rainbow trout farms, rearing units and rainbow trout populations sampled in North Rhine-Westphalia, Germany 

Given is the body length of fish (cm). 

Fish Farms Unit June 

2011 

Unit July 2011 Unit September 

2011 

Unit February 

2012 

Unit April 

2012 

Unit 

June 

2012 

SR H 28-30 + T 6 18-22 ON 11-13 T 23 22-24 T 23 12-15 

T 7 25-28 T 3 25-30 T10 26-30 T 4 23-25 T 6 21-23 

T 11 18-20 FT 25-28 T 2 22-24 T 8 10-12 

T 21 18-20 T14 18-22 

K1 28-30 

L 1 25-28 T 4 12-16 T 2 10-12 20-22 

T 10 20 T 3 13 

T 13 22-26 T 12 19-22 

FR 22-25 T 5 15-18 23-25 

T 13 18-20 

KP T 1 28 GT 21-26 T 1 22-24 L 3 30-32 B 2-4 

T 6 24-26 ST 32-35 T 3 23-25 K 25-27 T 3 6-8 

L 3 28-30 L 3 26-28 2-3 T 2 2-3 

L 2 25-27 L 1 25 

5-9 6-8 

H 30 

F 28-30 31-35 

P T 1 15-20 T 25-30 T 15-18 PZ2 28-30 T 12-15 TZ3 10-16 

T 2 22-24 T 2 28 T W 29-30 25 T L 29-31 

T 3 28-30 24-30 B3 34-36 

59


B 20-22 18-22 18-26 16-20 12-28 16-22 

7-9 

MU 1 45 B6 24-26 T 30-36 

2 20 H 31-33 

3 31-32 

4 6-7 

MS D3 26 B 10-12 

A3 7-8 TA1 11-13 

H 5-6 B3 12-14 

N N4 28-30 

N11 23-25 

T 23 19-21 

A + 

S 8-10 22-24 

Total 1 13/16 7/21 6/17 3/10 3/9 7/18 

+ No detailed information about the fish size of positive samples. 

1 Positive population/total populations sampled 

Size range in Bold indicated the positive samples found in the size group. 

Table 3 Rates of Yersinia ruckeri positive rainbow trout in different farms from North Rhine-Westphalia, Germany during the sampling time 

Fish Farms 

06.2011 

12-15°C 

07.2011 

15-18°C 

09.2011 

10-15°C 

02.2012 

4-5°C 

04.2012 

6-8°C 

06.2012 

8-12°C 

Total 

60


SR 81.0%(17/21) × 1 33.3%(3/9) 50.0%(7/14) 56.3%(9/16) 62.5%(10/16) 60.5%(46/76) 

L 57.1%(8/14) 22.2%(2/9) 33.3%(2/6) 0(0/3) 37.5%(12/32) 

FR 0%(0/17) 0%(0/10) 0%(0/10) 0%(0/37) 

KP 60.9%(14/23) 12.0%(3/25) 0%(0/6) 17.7%(3/17) 0%(0/21) 1 21.7%(20/92) 

F 0%(0/3) 60.0%(3/5) 37.5%(3/8) 

P 100%(12/12) 100%(4/4) 55.6%(5/9) 0%(0/4) 0%(0/5) 75%(9/12) 65.2% (30/46) 

B 81.8%(9/11) 62.5%(5/8) 37.5%(3/8) 41.7%(5/12) 33.3%(3/9) 0%(0/11) 42.4%(25/59) 

MU 0%(0/8) 0%(0/8) 0%(0/5) 0%(0/21) 

MS 0%(0/17) 0%(0/32) 0%(0/49) 

N 33.3%(2/6) 33.3%(2/6) 

A × 1 

S 0%(0/3) × 1 0%(0/3) 

Total 61.9%(60/97) 17.3%(14/81) 31.9%(15/47) 25.0%(15/60) 31.6%(12/38) 21.0%(22/102) 31.9%(137/429) 

1 Positive isolates were obtained before the sampling period. 

Table 4 Different genetic groups of Yersinia ruckeri present in rainbow trout farms in North Rhine-Westphalia, Germany 

Fish Farms 06.2011 07.2011 09.2011 02.2012 04.2012 06.2012 Total 

SR tp2, tp19,tp20 tp3 1 ,tp20 1 tp2 tp6 tp2 tp2,tp8 tp2,3,6,8,19,20 

L tp16 tp16 tp16 - tp16 

FR - - - - 

KP tp2 tp2 - tp7,tp8 - tp26 1 tp2,7,8,26 

F - - tp20 tp20 

P tp6,tp15 tp2 tp2,tp22 - - tp2 tp2,6,15,22 

61


B tp17 tp4 tp20 tp20 tp20 - tp4,17,20 

MU - - - - 

MS - - - 

N tp21 tp21 

A tp2 1 ,tp20 1 tp2,20 

S - tp8 1 tp8 

Total 

tp2,6,15,16,17, tp1,2,3,4,16,20 tp2,5,16,20,21,22 tp6,7,8,20 tp2,8,20 tp2,8,20,26 

19,20 

1 Positive isolates were obtained before the sampling period. 

18 

16 

14 

12 

10 

8 

6 

4 

2 

0 

No. of pos. cases 

No. of neg. cases 

Fig. 2 Infection of rainbow trout with Yersinia ruckeri: Distribution of positive and negative cases in rainbow trout of different sizes 

62


100% 

80% 

60% 

40% 

20% 

LS & H (Before 

2012) 

NRW (2011- 

2012) 

0% 

LS & H (Before 

2012) 

NRW (2011- 

2012) 

Fig.3 Distribution of non-motile strains in different sample collections. LS: Lower Saxony, H: 

Hessen, NRW: North Rhein-Westphalia 

Fig.4 Distribution of non-motile strains in field study 

63

Chapter 4. 

Fatty acid composition of Yersinia ruckeri isolates from 

aquaculture ponds in North West Germany 

Yidan Huang, Martin Ryll, Charles Walker, Arne Jung, 

Martin Runge, Dieter Steinhagen 

Berliner Münchener Tierärztliche Wochenschrift 2014,127 (1/2):10-15 

65










66

Chapter 4 Fatty Acid composition of Y. ruckeri in North West Germany 

Short communication 

Fish Disease Research Unit, University of Veterinary Medicine Hannover, Germany 1 

Clinic for Poultry, University of Veterinary Medicine Hannover, Germany 2 

School of Life Science, Keele University, Staffordshire, UK 3 

Lower Saxony State Office for Consumer Protection and Food Safety (LAVES), Food and 

Veterinary Institute Braunschweig/Hannover, Germany 4 

Fatty acid composition of Yersinia ruckeri isolates from aquaculture ponds in North 

West Germany 

Fettsäure-Profile von Yersinia ruckeri-Isolaten aus Fischteichen in Nord-Westdeutschland 

Yidan Huang 1 , Martin Ryll 2 , Charles Walker 1,3 , Arne Jung 2 , Martin Runge 4 , Dieter 

Steinhagen 1 

Abstract 

Enteric Redmouth Disease (ERM), caused by Yersinia (Y.) ruckeri is one of the most 

important diseases in salmonid aquaculture. Outbreaks of ERM were controlled by vaccines 

directed against motile strains of the bacterium, until recently non-motile vaccine-resistant 

strains evolved and caused severe outbreaks. Non-motile isolates were found widespread in 

aquaculture populations in North West Germany. In the present study, 82 Y. ruckeri isolates 

were isolated from trout hatcheries in North Rhine Westfalia, Lower Saxony and Hessen and 

only 20 % of them were motile. In order to further characterise the Y. ruckeri isolates from 

fish aquaculture populations in North West Germany, the fatty acid compositions of 82 Y. 

ruckeri field isolates from this area and of the Y. ruckeri reference strain DSM18506 were 

analysed by gas chromatography. All Y. ruckeri isolates exhibited 15 major fatty acids, 

including 12:0, 13:0, 13.957 (equivalent chain length, ECL unknown), 14:0, 14.502 (ECL 

unknown), 15:0, 16:1ω5c, 16:0, 17:1ω8c, 17:0 CYCLO, 17:0, 16:1 2OH, 18:1ω9c, 18:1ω7c 

and 18:0. From a dendrogram, all isolates were close to one another, clustering together; 

while slight differences were detected among the isolates and the reference strain DSM18506. 

Compared to their epidemiological and biochemical characteristics, there was no relationship 

found between the fatty acid profiles, API 20E profiles, motility and geographic distribution. 

67


Our results show that the fatty acid composition of Y. ruckeri isolates from North West 

Germany is highly homogenous. 

Keywords: Enteritic red mouth disease, rainbow trout, homogeneity, motility, identification 

Zusammenfassung 

Die von Yersinia ruckeri verursachte Rotmaulseuche (engl. „enteritic red mouth disease“, 

ERM) ist eine der wichtigsten Erkrankungen in der Aquakultur von Salmoniden. Ausbrüche 

von ERM wurden durch den Einsatz von Vakzinen, die gegen motile Stämme des 

Bakteriums gerichtet sind, sicher bekämpft, bis sich vakzin-resistente, unbewegliche Stämme 

entwickelten, die dann schwere Krankheitsausbrüche verursachten. Nicht bewegliche Isolate 

von Yersinia ruckeri wurden in einigen Forellenpopulationen aus Teichwirtschaften in 

Nord-Westdeutschland nachgewiesen. In der vorliegenden Studie wurden Forellen aus 

Teichwirtschaften in Nordrhein-Westfalen, Niedersachsen und Hessen auf Yersinia ruckeri 

untersucht. Lediglich 20 % der isolierten Y. ruckeri waren beweglich. Um die in der 

Feldstudie erhaltenen Isolate weitergehend zu charakterisieren, wurden Fettsäureprofile von 

den 82 Y. ruckeri Isolaten aus Forellenbeständen in Nord-Westdeutschland und vom 

Referenzstamm DSM 18506 mittels Gaschromatographie bestimmt. Alle Isolate von Y. 

ruckeri wiesen 15 charakteristische Fettsäuren auf, darunter 12:0, 13:0, 13,957 („equivalent 

chain lenght“, ECL unbekannt), 14:0, 14,502 (ECL ungekannt), 15:0, 16:1ω5c, 16:0, 17:1ω8c, 

17:0 CYCLO, 17:0, 16:1 2OH, 18:1ω9c, 18:1ω7c und 18:0. Der Vergleich der 

Fettsäureprofile in einem Dendrogram zeigte die Ähnlichkeit der Isolate. Die Isolate aus 

Nord-Westdeutschland bildeten hier einen homogenen Ast. Davon abgesetzt zeigte sich der 

Referenzstamm DSM 18506. Wurden epidemiologische und biochemische Charakteristika 

der Isolate mit den Fettsäureprofilen verglichen, ließ sich keine Beziehung zwischen den 

Fettsäuremustern, den API 20E Profilen, Beweglichkeit und geographischer Herkunft 

erkennen. Unsere Ergebnisse zeigen eine hohe Homogenität im Fettsäuremuster von Yersinia 

ruckeri-Isolaten aus Nord-Westdeutschland. 

Schlüsselwörter: Rotmaulseuche; Regenbogenforellen, Homogenität, Beweglichkeit, 

Identifizierung 

Introduction, Material and Methods 

68


Enteric redmouth Disease (ERM) was reported in Idaho, USA, as early as in the 1950s 

(Rucker, 1966). Subsequently, in the late 1970s to the early 1980s, the disease caused by the 

enterobacterium Yersinia (Y.) ruckeri was first introduced to Europe from the USA (Horne 

and Barnes, 1999). In Rainbow trout the disease is associated with a swollen abdomen, small 

haemorrhages in the mouth corners, the gum, palate, tongue (red mouth) and the paired fins. 

The gill operculum can turn red and haemorrhages can be seen in the eye (Schlotfeldt et al., 

1995). The disease causes significant economic losses in freshwater aquaculture worldwide 

and is one of the most important diseases of aquatic animals (Austin and Austin, 2007). In 

addition to salmonids, Y. ruckeri infects different fish species, including catfish, carp, pike 

and even freshwater crayfish (Coquet et al., 2002; Karatas et al., 2004; Lesel and Lesel, 1983; 

Oraić et al., 2002; Ross et al., 1966; Valtonen et al., 1992; Wang et al., 2009). 

Initially, Y. ruckeri was considered a phenotypically homogenous species (Arias et al., 2007), 

but later on in an extensive study on Y. ruckeri isolates from different geographical origins, 

approximately 20 % of the isolates were found non-motile and negative for Tween hydrolysis 

(Davies and Frerichs, 1989). These isolates were assigned as Y. ruckeri biotype 2 strains 

(Davies and Frerichs, 1989), and in subsequent years were found to be responsible for 

diseases outbreaks in rainbow trout (Oncorhynchus (O.) mykiss), despite them having been 

vaccinated with a commercial vaccine against the typical motile biotype 1 strains. After the 

first detection of these strains in rainbow trout aquaculture in England (Austin et al., 2003), 

biotype 2 strains caused ERM outbreaks in Spain (Fouz et al., 2006), the US (Arias et al., 

2007) as well as in Germany. 

The most common way to diagnose a Y. ruckeri infection is identified by biochemical tests, 

such as API 20E, and, further considering of outer membrane protein and lipopolysaccharide 

profiles (Tinsley et al., 2011). In addition to a biochemical identification of the bacterium, 

further diagnostic methods were developed, including the identification of Y. ruckeri 

bacteriophages (Stevenson and Airdrie, 1984), DNA microarray technology (Warsen et al., 

2004), species-specific PCR (Seker et al., 2012), or Fourier transform infrared spectroscopy 

(FT-IR) (Wortberg et al., 2012). 

The determination of the whole cell fatty acid composition by gas chromatography (GC) has 

been described as a simple way to identify and classify bacteria as early as 1963 (Abel et al., 

1963). Canonica and Pisano (1985) suggested the use of gas-liquid chromatographic analysis 

for classifying motile Aeromonas strains of clinical origin from nonclinical strains according 

to their fatty acid methyl ester (FAME) profiles (Canonica and Pisano, 1985). Leclercq et al. 

(2000) found the composition of Y. pestis fatty acid was highly uniform (Leclercq et al., 2000), 

69


and subsequently it was possible to differentiate Y. pestis from various outbreaks of plague 

from Y. pseudotuberculosis according to characteristic major cellular fatty acid (CFA) profiles 

(Tan et al., 2010). In addition to API 20E, the analysis of the composition of cellular fatty 

acids was also proposed as one of the phenotypic characteristics for the identification of Y. 

ruckeri (Arias et al., 2007). 

The current study was undertaken in order to analyse the heterogeneity of Y. ruckeri present in 

fish populations from aquaculture ponds in North West Germany. In this study, 82 Y. ruckeri 

field isolates including both motile and non-motile strains from populations with different 

epidemiological characteristics and a reference strain were analysed. In addition to 

conventional biochemical testing, cellular fatty acids profiles were assessed in order to 

explore whether differences in biotype or epidemiological characteristics would be correlated 

with altered fatty acid composition as an additional phenotypic trait of Y. ruckeri. 

From the 82 isolates of Y. ruckeri used, 48 isolates were collected from Rainbow trout (O. 

mykiss) in a field survey, performed during 2011-2012 in trout hatcheries in the German 

federal state North-Rhine-Westphalia. Additional 34 isolates were obtained from the strain 

collections of LAVES Niedersachsen, Food and Veterinary Institute Braunschweig/Hannover, 

the fish disease service at Landesbetrieb Hessisches Landeslabor (LHL) in Giessen and of 

MSD Animal Heath, who kindly provided the non-motile isolate G1S1, which was isolated 

from a trout hatchery in North-Rhine-Westphalia. These isolates were obtained from different 

fishes suffering from disease, mainly from rainbow trout during 2004 and 2009 (Tab. 1). The 

reference strain DSM 18506 was offered by the Clinic for Poultry, University of Veterinary 

Medicine, Hannover. All strains were previously identified as Y. ruckeri by biochemical 

testing using the API 20E test at 25°C for 48h (BioMerieux, France). Six isolates with an 

uncertain identification on the basis of their API profiles were confirmed further by using 16S 

rDNA gene sequencing. In biochemical identification, some variation was observed among 

the isolates, which resulted in 8 different numeric profiles, with the API 20E profiles 5107100 

(27 isolates), 5306100 (23 isolates) and 5307100 (20 isolates) were most abundant. Motility 

was checked by phase-contrast microscopy (1000x). To confirm the motility, bacteria were 

stab inoculated with a needle into the bottoms of API M medium (bioMérieux).and incubated 

at 25°C for 24 h. From the 82 field isolates tested, 16 isolates were motile and able to 

hydrolyse Tween 20/80 and thus were assigned as typical biotype I isolates. The general 

characteristics of the isolates used are shown in Table 1. Additionally, three Y. enterocolitica 

reference strains (DSM 11502, DSM 11503, DSM 11504), three Y. enterocolitica field 

70


isolates, the Y. pseudotuberculosis reference strain DSM 8992 and the Y. ruckeri reference 

strain DSM 18506 were included in the analysis. 

Bacteria were inoculated on Columbia blood agar using the quadrant streak pattern and grown 

for 24 hours at 25 °C (Y. ruckeri) or at 35 °C (Y. enterocolitica and Y. pseudotuberculosis). 

Bacteria in quadrant 3 (approx. 40 mg) were harvested. Cellular fatty acids were extracted and 

transformed into fatty acid methyl esters (FAMEs) according to the procedures outlined in the 

Sherlock microbial identification systems (MIS) operating manual (version 4.0, Microbial 

IDentification Inc, Delaware, USA). After the extraction, FAMEs were injected into a HP 

5890A gas chromatograph equipped with an automatic injector (injector HP 7673), sample 

controller, a gas chromatograph capillary column (Ultra 2, crosslinked 5% phenyl methyl 

silicone, 25 m x 0.2mm x 0.11µm film thickness) and a flame ionizations detector (FID). 

Fatty acids with up to 20 carbon atoms (C-9 to C-20) were measured in a hydrogen phase. A 

calibration mix (Hewlett Packhard) was included in every run as an internal reference. For 

data analysis, we used the CLIN40 method (Sherlock MIS Version 4.0, Microbial 

IDentification Inc., USA). A library validation report was generated by the MIDI procedure 

using the Sherlock MIS operating system (Version 4.0, Microbial IDentification Inc, USA). A 

dendrogram for possible biotype tracking was generated by the same system. 

Results and Discussion 

A phenotypic characterisation of Y. ruckeri strains isolated from fish in North West Germany 

was carried out by comparing different FAME profiles. The following 15 fatty acids were 

found as most abundant (>3% of the total amount) in all isolates: 12:0 (dodecanoic acid), 13:0 

(tridecanoic acid), 13.957 (ECL unknown), 14:0 (tetradecanic acid), 14.502 (ECL unknown), 

15:0 (pentadecanoic acid), 16:1ω5c, 16:0 (hexadecanoic acid), 17:1ω8c, 17:0 CYCLO 

(methylenhexadecanoic acid), 17:0 (heptadecanoic acid), 16:1 2OH, 18:1ω9c, 18:1ω7c 

(octadecenoic acids) and 18:0 (octadecanoic acid). Table 2 displays the relative amounts of 

these fatty acids detected in the isolates of Y. ruckeri. Between the isolates, only slight 

qualitative and quantitative differences were observed. There were no differences between 

motile and non-motile isolates. In a dendrogram displaying the relatedness among the isolates 

studied (Fig. 1), most Y. ruckeri isolates formed a large cluster which included motile and 

non-motile strains from various locations within the studied geographic area, and which, in 

addition to isolates from rainbow trout (RT) also comprised isolates from brown trout and koi 

carp with different API 20E profiles. Within this group, the Euclidian distance between Y. 

ruckeri isolates was not larger than 3.75. The Euclidean distance is often used to compare 

71


profiles of respondents across variables. A distance of 1 or less then suggests the bacterial 

clusters were not well separated (Barshick et al., 1999) and a distance of 10 or less indicates 

all the isolates belong to the same species (Hallaksela and Niemostö, 1998). In the 

dendrogram a second cluster comprising motile and non-motile isolates from RT could be 

seen. However, the Euclidian distance to the first group was less than 5. One Y. ruckeri isolate 

from pike was separated by a Euclidian distance of about 5, and the reference strain, obtained 

from the Leibniz-Institute DSMZ-German Collection of Microorganisms and Cell Cultures, 

separated with a Euclidian distance of approx. 7.5 (Fig. 1). The clear separation of 

DSM18506 from other Y. ruckeri strains in the dendrogram was reflected in slight differences 

in the pattern of cellular fatty acids (Tab. 2). In Figure 1, it is shown that Y. ruckeri isolates 

were well separated from other Yersinia species, with an Euclidian distance of 15 to Y. 

pseudotuberculosis and of 35 to Y. enterocolitica, respectively. This confirmed a high 

phylogenetic difference among Yersinia species. 

When our results were compared to previous reports on FAME composition of Y. ruckeri 

isolates from the USA (Arias et al., 2007), the fatty acids 12:0, 14:0, 15:0, 16:0, 17:0 CYCLO, 

17:0 and 18:1ω7c were found as main components in both studies. 

Jantzen and Lassen (1980) observed that strains from Y. enterocolitica, Y. pseudotuberculosis 

and Y. pestis all exhibited a similar fatty acid composition of 3-OH-14:0, 16:1, 16:0,17:0 

CYCLO and 18:1, and 16:0 was the most prominent fatty acid present in Y. pestis and Y. 

pseudotuberculosis (Tan et al., 2010). In the present study and in the study performed by 

Arias et al. (2007), 16:0 and 17:0 CYCLO were present in Y. ruckeri as well, with 16:0 as the 

most abundant fatty acid, but in contrast to Arias et al. (2007), in our isolates the level of 17:0 

CYCLO was relatively low compared to other Yersinia species (Jantzen and Lassen, 1980). 

While Arias et al. (2007) in their isolates found a clear distinction by FAME between 

non-motile Y. ruckeri and biotype I strains, in our analysis, motile and non-motile isolates 

clustered together. While the survey performed by Arias et al. (2007) mainly concentrated on 

an analysis of non-motile, biotype 2 strains, our material included a large array of field 

isolates from both biotypes. FAME profiles from other Yersinia species, in particular Y. pestis, 

were also found as highly conserved under standard preparation and analysis methods, even 

though samples from a wide geographical and temporal range were analyzed (Leclercq et al., 

2000). In our study, the Euclidian distance between the main clusters of Y. ruckeri from the 

dendrogram was as low as 5 and the distance of these Y. ruckeri isolates to the Y. ruckeri 

reference strain was 7.5. The DSM reference strain and the Y. ruckeri isolate from pike were 

different from the majority of the isolates from RT, which in our study clustered together 

72


(Fig. 1). However, the Euclidian distance of Y. ruckeri isolates to the main clusters is lower 

than 10, indicating a high homogeneity of Y. ruckeri isolates from North West Germany based 

on FAME profiles, which not reflected differences in motility, host species, geographic 

distribution and API 20E profiles. Whether this phenotypic homogeneity is found in genetic 

traits as well will be analysed in further molecular studies. 

Acknowledgments 

We acknowledge the generous support provided during sample collection in aquaculture 

ponds by Dr. W. Schäfer and D. Mock from the Fish Health Service, North Rhine Westphalia. 

Dr. S. Braune (LAVES Niedersachsen), Dr. A. Nilz (LHL, Giessen) and Dr. C. Gould (MSD 

Animal Health) provided Yersinia ruckeri samples from their collection of fish pathogenic 

bacteria. We thank Prof. Atanassova (Institute of Food Quality) for providing Y. 

enterocolitica and Y. pseudotuberculosis isolates. This study was financially supported by the 

Landesamt für Natur, Umwelt und Verbraucherschutz Nordrhein-Westfalen (LANUV). Y. H. 

received a scholarship from the China Scholarship Council. 

Conflicts of interest 

None of the authors had a financial or personal relationship with other people or organisations 

that can inappropriately influence or bias the content of this communication. 

References 

Abel K, Schmertzing HD, Peterson JI (1963): Classification of microorganisms by analysis 

of chemical composition. I . Feasibility of utilizing gas chromatography. J Bacteriol 85: 

1039–1044. 

Arias CR, Olivares-Fuster O, Hayden K, Shoemaker CA, Grizzle JM, Klesius PH (2007): 

First report of Yersinia ruckeri biotype 2 in the USA. J Aquat Anim Health 19: 35–40. 

Austin B, Austin DA (2007): Bacterial fish pathogens: Diseases of farmed and wild fish 

Praxis Publishing, Chichester, UK. 

Austin DA, Robertson PAW, Austin B (2003): Recovery of a new biogroup of Yersinia 

ruckeri from diseased rainbow trout(Oncorhynchus mykiss, Walbaum). Syst Appl 

Microbiol 26: 127–131. 

Barshick SA, Wolf DA, Vass AA (1999): Differentiation of microorganisms based on 

Pyrolysis-Ion trap mass spectrometry using chemical ionization. Anal Chem 71: 633–641. 

73


Canonica FP, Pisano MA (1985): Identification of hydroxy fatty acids in Aeromonas 

hydrophila, Aeromonas sobria and Aeromonas caviae. J Clin Microbiol 22: 1061–1062. 

Coquet L, Cosette P, Quillet L, Petit F, Junter GA, Jouenne T (2002): Occurrence and 

phenotypic charaterization of Yersinia ruckeri strains with biofilm-forming capacity in a 

rainbow trout Farm. Appl Environ Microbiol 68: 470–475. 

Davies RL, Frerichs GN (1989): Morphological and biochemical differences among isolates 

of Yersinia ruckeri obtained from wide geographical areas. J Fish Dis 12: 357–365. 

Fouz B, Zarza C, Amaro C (2006): First description of non-motile Yersinia ruckeri serovar I 

strains causing disease in rainbow trout, Oncorhynchus mykiss (Walbaum), cultured in 

Spain. J Fish Dis 29: 339–346. 

Hallaksela A-M, NiemostöP (1998): Stem discoloration of planted silverbirth. Scan J Forest 

Res 13: 169–176. 

Horne MT, Barnes AC (1999): Enteric redmouth disease (Yersinia ruckeri). In: Woo PTK, 

Bruno DW (eds.), Fish diseases and disorders. CABI Publishing, Wallingford, p. 445–477. 

Jantzen E, Lassen J (1980): Characterization of Yersinis species by analysis of whole-cell 

fatty acid. Int J Syst Bacteriol 30: 421–428. 

Karatas S, Candan A, Demircan D (2004): Enteric red mouth disease in cultured rainbow 

trout (Oncorhynchus mykiss) on the black sea coast of Turkey. Isr J Aquacult-Bamidgeh 56: 

226–231. 

Leclercq A, Guiyoule A, Lioui ME, Carniel E, Decallonne J (2000): High homogeneity of 

the Yersinia pestis fatty acid composition. J Clin Microbiol 38: 1545–1551. 

Lesel R, Lesel M (1983): Outbreak of enteric redmouth disease in rainbow trout, Salmo 

gairdneri Richardson, in France. J Fish Dis 6: 385–387. 

Oraić D, Zrnčić S, Šoštarić B, Bažulić D, Lipej Z (2002): Occurrence of enteric redmouth 

disease in rainbow trout (Oncorhynchus mykiss) on farms in Croatia. Acta Vet Hung 50: 

283–291. 

Ross AJ, Rucker RR, Ewing WH (1966): Description of a bacterium associated with 

redmouth disease of rainbow trout (Salmo gairdneri). Can J Microbiol 12: 763–770. 

Rucker RR (1966): Redmouth disease of rainbow trout (Salmo gairdneri). Bull Off Int 

Epizoot 65: 825–830. 

Schlotfeldt H-J, Alderman DJ, Baudin-Laurencin F, Bernoth EM, Bruno DW (1995): 

What should I do? : a practical guide for the fresh water fish farmer. Bull Eur Ass Fish 

Pathol 15: suppl. 

74


Seker E, Karahan M, Ispir U, Catinkaya B, Saglam N, Sarieyyupoglu M (2012): 

Investigation of Yersinia ruckeri infection in rainbow trout (Oncorhynchus mykiss 

Walbaum 1792) farms by polymerase chain reaction (PCR) and bacteriological culture. 

Kafkas Univ Vet Fak Derg 18: 913–916. 

Stevenson RMW, Airdrie DW (1984): Isolation of Yersinia ruckeri bacteriophages. Appl 

Environ Microbiol 47: 1201–1205. 

Tan Y, Wu M, Liu H, Dong X, Guo Z, Song Z, Li Y, Cui Y, Song Y, Du Z, Yang R 

(2010): Cellular fatty acids as chemical markers for differentiation of Yersinia pestis and 

Yersinia Pseudotuberculosis. Lett Appl Microbiol 50: 104–111. 

Tinsley JW, Austin DA, Lyndon AR, Austin B (2011) Novel non-motile phenotypes of 

Yersinia ruckeri suggest expansion of the current clonal complex theory. J Fish Dis 34: 

311–317. 

Valtonen ET, Rintamaki P, Koskivaara M (1992): Occurrence and pathogenicity of 

Yersinia ruckeri at fish farms in northern and central Finland. J Fish Dis 15: 163–171. 

Wang KY, Fan FL, Huang XL, Geng Y, Chen DF, Huang JL (2009): Occurrence and 

treatment of a channel catfish(Ictalurus punctatus (Rafinesque)) disease, caused by 

Yersinia ruckeri. Scientific Fish Farming 5: 50–51. 

Warsen AE, Krug MJ, LaFrentz S, Stanek DR, Loge FJ, Call DR (2004): Simultaneous 

siscrimination between 15 fish pathogens by using 16S ribosomal DNA PCR and DNA 

microarrays. Appl Environ Microbiol 70: 4216–4221. 

Wortberg F, Nardy E, Contzen M, Rau J (2012): Identification of Yersinia ruckeri from 

diseased salmonid fish by fourier transform infrared spectroscopy. J Fish Dis 35: 1–10. 

Address for correspondence 




Bünteweg 17, 

30559 Hannover 

Germany 

dieter.steinhagen@tiho-hannover.de 

TABLE 1: Characteristics of Yersinia ruckeri isolates from Northern Germany used for 

cellular fatty acid analysis 

75


Isolate No. Host Isolation Motility API20E Isolate Host Isolation Motility API20E 

year 

Profile No. 

year 

Profile 

DSM18506 RT 1961 + g L-1 RT 2011 + c 

* 

194-1 RT 2004 - a K1 RT 2011 - a 

204-1 Trout 2004 + b lay3 RT 2011 - b 

205-1 RT 2004 - d P2 RT 2011 - b 

275-1 RT 2004 - a P1 RT 2011 - a 

70-1 Koi 2005 + a LT13-1 RT 2011 + c 

72-2 RT 2005 + b P1-1 RT 2011 - b 

101-1 RT 2005 - a KPST3-1 RT 2011 - b 

111-1 - 2005 + e KPL1-1 RT 2011 - b 

115-1 RT 2005 - a B1-1 RT 2011 - d 

178-1 B 2005 + e B1-2 RT 2011 - a 

182-1 RT 2005 - b SRF1-1 RT 2011 - c 

285-1 Pike 2005 + f SRHK1-4 RT 2011 - c 

287-1 RT 2005 + b N1 RT 2011 - a 

339-1 RT 2005 - a AT7-2 RT 2011 - b 

317-1 Trout 2006 - a LT12-1 RT 2011 + c 

01-1 RT 2007 - b P2-1 RT 2011 - c 

16-1 RT 2007 + b AT7-1 RT 2011 - b 

20-1 RT 2007 + a B3-1-1 RT 2011 - c 

157-1 RT 2007 + g N2 RT 2011 - a 

337-1 RT 2007 - b AVTA1 RT 2011 - b 

365-1 RT 2007 - b SFFT2 RT 2011 - b 

494-1 RT 2007 - a B5-2 RT 2011 - h 

201-1 RT 2008 + g ST1 RT 2011 - c 

109-2 RT 2009 - h PT2-2 RT 2011 - b 

87-1 RT 2009 - a KPK1 RT 2012 - c 

1024 RT 2010 - b KPK2 RT 2012 - b 

3279 RT 2010 - c SRON1 RT 2012 - a 

2846 RT 2010 - a B4-1 RT 2012 - c 

2946 RT 2010 - a G1S1 RT 2008 - c 

1521 RT 2011 + e SRT2-2 RT 2012 - c 

3484 RT 2010 - b B1-5 RT 2012 - c 

3554 RT 2010 - a STR3 RT 2012 - c 

2948 RT 2010 - a SRT13-1 RT 2012 - c 

21-1 RT 2011 - a SRT14-1 RT 2012 - c 

11-1 RT 2011 - b KP6-1 RT 2012 + e 

kp6 RT 2011 - b SRT23-1 RT 2012 - b 

kp1 RT 2011 - b PB3-1 RT 2012 - b 

B1 RT 2011 - d PZ3-2 RT 2012 - b 

P3 RT 2011 - a F1-1 RT 2012 - c 

HK1 RT 2011 - c SRT6-1 RT 2012 - c 

HK2 RT 2011 - a 

76


RT: Rainbow trout. B: Brown trout. API profiles: a 5306100, b 5107100, c 5307100, d 5106100, e 5307500, f 5305700, g 5304100, h 5104100. 

TABLE 2: Major components of the cellular fatty acid profile of Yersinia ruckeri isolates from 

different fish species from North West Germany detected by the CLIN 40 method 

Feature Mean SD DSM18506 

12:0 4.66 0.19 4.75 

13:0 0.19 0.10 0.99 

ECL Unknown 13.957 0.69 0.03 0.76 

14:0 1.36 0.09 1.38 

ECL Unknown 14.502 0.70 0.11 0.58 

15:0 1.61 0.32 4.14 

16:1ω5c 0.27 0.05 0.30 

16:0 25.42 0.95 20.86 

16:1 2OH 0.06 0.08 - 

17:1ω8c 0.23 0.12 0.55 

17:0 CYCLO 5.88 1.34 2.89 

17:0 0.75 0.11 1.14 

18:1ω9c 1.53 0.23 1.36 

18:1ω7c 12.46 0.71 10.84 

18:0 0.89 0.14 0.72 

77


78


FIGURE 1: Dendrogram of Yersina ruckeri isolates 

* Motile isolates; B: Isolates from Brown trout; K: Isolates from Koi carp; T: Isolates from trout;P: 

Isolates from Pike; N: Isolates from non specific fish species; Other isolates were from rainbow trout. 

79

Chapter 5. 

In vitro cytotoxicity and multiplex PCR detection of 

virulence factors of Yersinia ruckeri isolated from 

rainbow trout in North West Germany 

Yidan Huang, Mikolaj Adamek, Charles Walker, Martin Runge, 

Dieter Steinhagen 

81








3. Analysis of the experiments: C 


82

Chapter 5 Cytotoxicity and multiplex PCR detection of virulence factors of Y. ruckeri 

Fish Disease Research Unit, University of Veterinary Medicine Hannover, Germany 1 

School of Life Science, Keele University, Staffordshire, UK 2 


Veterinary Institute Braunschweig/Hannover, Germany 3 

In vitro cytotoxicity and multiplex PCR detection of virulence factors of Yersinia ruckeri 

isolated from rainbow trout in North West Germany 

Untersuchungen zur in-vitro-Zytotoxizität und zum Nachweis von Virulenzfaktoren mittels 

multiplex- PCR bei Yersinia ruckeri-Isolaten aus Teichwirtschaften in Nord-Westdeutschland 

Yidan Huang 1 , Mikolaj Adamek 1 , Charles Walker 1, 2 , Martin Runge 3 , Dieter Steinhagen 1§ 

§Corresponding author 

Abstract The aim of this study was to investigate differences in presence and expression of virulence factors 

between biotype 1 and 2 strains of 82 Yersinia ruckeri isolates, collected from North West Germany during 

period of 2004-2012, and to analyze the cytotoxicity of these strains to different fish cell lines. The common 

virulence factor genes, such as yhlA and yhlB encoding for hemolysin YhlA, rucC and rupG encoding for 

ruckerbactin, yrp1 and yrpDEF for ABC exporter protein system, and two flagellar genes, including flgA for 

flagellar secretion chaperones and flhA for flagellar secretion apparatus, were found present in both biotype 1 

and 2 isolates of Y. ruckeri collected from North West Germany using multiplex PCR. mRNA expression of 

these genes was compared between the two biotypes of Y. ruckeri. There was no significant diversity (p>0.05) 

in the expression of these genes between biotype 1 and 2 strains. 27 Y. ruckeri isolates from different typing 

groups were analysed in cytotoxicity tests to common carp brain (CCB), epithelioma papulosum cyprini 

fathead minnow epithelial cell (FHM) and rainbow trout gonad-2 (RTG-2), respectively. In vitro cytotoxicity 

the isolates to CCB, EPC and FHM was higher than that to RTG-2 (p


however, after 48h, there was no significant difference (p>0.05) of cytotoxicity between those two biotypes. 

Our results suggest that biotype 2 strains from North West Germany are homogenous with biotype 1 strains on 

the basis of genetic virulence factor genes. At lower temperature non-motile Y. ruckeri isolates were found 

active than motile strains, which could explain why in winter non-motile strains were found more responsible 

for ERM outbreaks than motile strains. 

Key Words: Enteric red mouth disease, Biotype, cytotoxicity, mRNA expression, Flagellar genes, 


In der vorliegenden Studie wurden 82 Yersinia ruckeri Isolate, die 2004 bis 2012 von Fischen aus 

Teichwirtschaften in Nord-Westdeutschland isoliert wurden, auf Vorkommen und Expression von 

Virulenzfaktoren sowie auf Zytotoxizität gegenüber unterschiedlichen Fischzellen untersucht. Dabei sollten 

allem Unterschiede zwischen Isolaten aus den Biotypen 1 und 2 analysiert werden. Untersucht wurden Gene 

beschriebene Virulenzfaktoren: yhlA und yhlB, die das Hämolysin YhlA codieren, rucC und rupC, die das 

Ruckerbactin codieren, yrp1 und yrpDEF, die Elemente des ABC-Protein-Exkretionssystem codieren, sowie 

zwei Geißel-assoziierte Gene, flgA, das ein Sekretions-Chaperon codiert sowie flhA, das ein Protein des 

Geißel-assoziierten Sekretionsapparates codiert. Alle Gene ließen sich in allen untersuchten Isolaten aus 

Nord-Westdeutschland mittels multiplex PCR nachweisen. Zudem wurde die mRNA-Expression dieser Gene 

bei Isolaten aus beiden Biotypen von Y. ruckeri verglichen. Alle analysierten Gene waren bei den untersuchten 

Isolaten nicht unterschiedlich exprimiert. Des weiteren wurden 27 Y. ruckeri Isolate aus unterschiedlichen 

Typisierungsgruppen in vitro auf ihre Zytotoxizität auf die Fischzelllinen „common carp brain“ (CCB), 

Epithelioma papulosum cyprini (EPC), „fathead minnow epithelial cells“ (FHM), und „rainbow trout 

gonad-2“ (RTG-2) geprüft. Die Mehrzahl der Y. ruckeri Isolate wies eine geringe in vitro Zytotoxizität auf. 

Zytotoxizität war gegenüber den CCB, EPC und FHM Zellen höher als gegenüber RTG-2 Zellen (p< 0,05). 

15°C war nach 24 h Inkubation die maximale Zytotoxizität nicht motiler Y. ruckeri Isolate gegenüber EPC 

FHM Zellen höher als bei motilen Isolaten (p< 0,05). Nach 48 h Inkubationszeit war kein Unterschied 

Isolaten aus beiden Biotypen erkennbar. Unsere Ergebnisse lassen vermuten, dass bei Y. ruckeri Isolaten in 

Nord-Westdeutschland das Vorkommen von Virulenzfaktoren in beiden Biotypen einheitlich ist. Bei 

84


Temperaturen scheinen nicht motile Y. ruckeri Isolate eine höhere Zytotoxizität aufzuweisen, was erklären 

könnte, warum im Winter nicht motile Y. ruckeri Isolate häufiger für Ausbrücke der Rotmaulseuche 

verantwortlich waren, als motile Isolate. 

Schlüsselwörter: Rotmaulseuche, Biotyp, Zytotoxizität, mRNA-Expression, Geißel-assoziierte Gene 

Introduction 

Yersinia (Y.) ruckeri, the causative agent of enteric redmouth disease (ERM), is considered to be one of the 

important pathogens in trout aquaculture. Since this bacterium was first isolated from rainbow trout in the 

in 1950 (Rucker 1966), it has kept causing disease outbreaks in trout populations in various geographic 

although generally the disease can be well controlled by means of vaccination. Y. ruckeri comprises 2 biotypes 

(BT) and several serotypes (Romalde et al. 1993). Strains positive for motility and lipase activity are grouped 

into biotype 1, while biotype 2 strains are non-motile and exhibit no lipase activity. Biotype 2 strains were 

responsible of disease outbreaks also in rainbow trout populations, which had been vaccinated with a 

commercial vaccine against the typical biotype 1 strains (Davies and Frerichs 1989). 

The bacterium can infect salmonids and other fishes from both freshwater and marine environments; it persists 

in fish farms which suffer from ERM outbreaks and has a high biofilm- forming capability to adhere to 

commonly found in fish ponds or fish tanks (Coquet et al. 2002a, Coquet et al. 2002b). During the infection 

process, Y. ruckeri adheres first to mucus (Tobback et al. 2010a), subsequently to epithelial cells of the gills 

to the villi of intestinal enterocytes (Tobback et al. 2010b). The intestine, together with the gills are considered 

as important site of entry (Méndez and Guijarro 2013, Tobback et al. 2009), with a subsequent systemic 

dissemination of the pathogen (Méndez and Guijarro 2013). In infection experiments, using the immersion of 

juvenile rainbow trout into a suspension of Y. ruckeri, virulent strains induced mortality while avirulent strains 

did not cause mortality or persistent infection (Tobback et al. 2009, Tobback et al. 2010b). Both virulent and 

avirulent Y. ruckeri strains were able to cross the gill or intestinal epithelium(Tobback et al. 2010b). 

So far, differences in virulence could be identified by the induction of mortality in experimental 

infections(Davies 1991, Tobback et al. 2009). Up to now, only a few mechanisms related to the pathogenicity 

Y. ruckeri have been analysed (Fernández et al. 2007, Méndez and Guijarro 2013). Type III secretion systems 

85


(T3SS) have been proved to be essential for the pathogenesis of different bacterial organisms (Cornelis 2002, 

Tobe et al. 2006, Vilches et al. 2009). recently, a Ysa (Yersinia secretion apparatus) -like T3SS, which is 

different to the T3SS from human pathogenic Yersinia species, was found in Y. ruckeri (Gunasena et al. 2003). 

However, there is no detailed information about the structure of this Ysa-like T3SS. FlhA is an essential 

component of the flagellar secretion apparatus, and FlgA is one of the flagellar secretion chaperones 

and Hughes 2008). Since biotype 2 strains of Y. ruckeri are lacking both flagellar motility and secreted lipase 

activity(Austin et al. 2003), the question whether the presence or expression of flagellar genes in Y. ruckeri in 

North West Germany needs further consideration. 

Virulence factors of Yersinia species include genes encoding extracellular toxins and iron acquisition. 

and Toranzao (1993) reported that the injection of extracellular products of Y. ruckeri induced haemorrhages 

and necrotic areas at the injection site. The extracellular products had a cytotoxic and proteolytic activity. The 

responsible Yrp1 protease was found to be encoded by the gene yrp1, and requires three genes (yrpD, yrpE, 

yrpF) to be secreted (Fernández et al. 2002). Yrp1 can hydrolyze laminin, thus may cause membrane 

leading to erosion and pores in capillary vessels, which results in the hemorrhages in mouth and intestines 

(Fernández et al. 2003). Another virulence factor of Y. ruckeri, a Serratia-type hemolysin, is encoded by the 

open-reading frame Yhl A (Fernández, Prieto and Guijarro 2007). 

For successful colonization and invasion iron acquisition is essential for many microbial pathogens and 

therefore they developed high affinity iron transport systems(Faraldo-Gomez and Sanson 2003). In Yersinia 

ruckeri, the genes rucC and rupG were identified as putative counterparts of Escherichia coli entC and fepG. 

These genes are all involved in iron piracy, confirming that Y. ruckeri produces a catechol siderophore 

(ruckerbactin) (Fernández et al. 2004, Romalde et al. 1991a). 

So far, a limited number of motile and non-motile Y. ruckeri-strains were analysed for differences in the 

expression of genes encoding those virulence factors. In the present study, these genes were detected in the 82 

Y. ruckeri isolates collected from North West Germany and a reference strain by a multiplex PCR and for the 

first time their expression differences were checked between biotype 1 and 2 isolates. In addition, the 

cytotoxicity of selected the isolates to fish cells was analysed in an in vitro assay. 

Materials and Methods 

86


Bacteria 

A total of 83 Y. ruckeri isolates (including one reference strain DSM18506) were included in this study. From 

these 48 isolates were collected during a field study in rainbow trout populations in the German federal state 

North Rhine-Westphalia (NRW) with a history of ERM outbreaks, which took place during the four seasons 

of 2011-2012. Furthermore, 33 isolates from clinical cases of ERM were obtained from LAVES 

Niedersachsen, Food and Veterinary Institute Braunschweig/Hannover, Germany (Lower Saxony) and 

Landesbetrieb Hessisches Landeslabor (LHL) Giessen (Hessen), one non-motile strain previously isolated in 

NRW in 2008 was offered by Dr. Gould from MSD Animal Heath and the reference strain DSM 18506, was 

included in the analysis. All isolates were cultured on Tryptone soy agar (TSA) and incubated at 23±2 °C for 

24 h. All the isolates were identified as Y. ruckeri and differentiated according to motility and lipase activity in 

motile biotype 1 and non-motile biotype 2 isolates as well as by API 20 E profiles, repetitive sequence-based 

PCR and pulsed field electrophoresis. With these methods, 27 different typing groups could be recognized, 

including the reference strain DSZM 18506 as typing group (tp) 27. 

Analysis of flagellar genes and virulence factors 

All 82 isolates and the reference strain DSM 18506 were used for the detection of genes encoding virulence 

flagellar secretion system and factors using a multiplex PCR. Subsequently, 6 isolates from biotype 1 and 2 

respectively, including the reference strain DSM 18506 were chosen according to their epidemiological 

characteristics and used for RNA isolation and detection of gene expression. 

DNA isolation 

Bacterial cells were lysed and DNA was extracted following the manufacturer‟s protocol of the innuPREP 

Bacteria DNA Kit (Analytikjena, Germany). Yield and purity of isolated DNA was analysed by means of a 

NanoDrop spectrophotometer (Delaware, USA). The DNA was stored at -20°C until further use. 

RNA isolation 

12 Y. ruckeri isolates (6 isolates of biotype 1 and 6 isolates of biotype 2) were chosen according to their 

motility and geographic origins for RNA isolation. Total RNA was isolated using the TRI Reagent (Sigma, 

USA) according to the manufacturer‟s instructions. The total RNA pellet was air-dried and suspended in 

100μl sterile double distilled water. RNA concentration and purity were determined by a NanoDrop 

spectrophotometer (Delaware, USA). 

87


cDNA synthesis 

The RNA mix (600 ng) of each Y. ruckeri isolate, respectively, 1 μl of 10x buffer with MgCl 2 , 2 units of 

DNase Ⅰ, and 0.25 μl of ribolock RNase inhibitor (20 u) (Thermo Scientific, Germany) were incubated at 37 ℃ 

for 30 min. After incubation, the DNase Ⅰ was inactivated by adding 1 μl of 25 mM EDTA and incubating at 

65 ℃ for 10 min. Subsequently, cDNA was synthetized using Maxima Reverse Transcriptase (Fermentas, 

Germany) according to the manufacturer‟s instruction. 5 μl of the RNA samples after DNAse treatment were 

mixed with 0.25 μl random hexamer (100 pmol), 0.25 μl of Oligo dT (100 pmol), 1 μl of dNTPs (10 mM each) 

and nuclease-free water (until a total volume of 15 μl), and incubated at 65 ℃ for 5 min. Subsequently, the 

samples were mixed with 4 μl of 5x RT buffer, 0.5 μl ribolock (20 u), 0.5 μl of Maxima Reverse Transcriptase 

(100 u). The mixture was incubated for 10 minutes at 25 ℃, followed by 25 minutes at 50 ℃. Finally, the 

reaction was ended by heating at 85 ℃ for 5 minutes. Then the cDNA samples were diluted 1:20 and kept at 

-20 ℃ for further use. All non reverse transcribed samples were checked by PCR in order to confirm no 

contamination of genomic DNA. 

Primer design 

Genes encoding for hemolysin YhlA (yhlA and yhlB, NCBI Accession: AY576533.3), ruckerbactin (rucC and 

rupG, NCBI Accession: AY576531.1), ABC exporter protein system (yrp1 and yrpD, E, F, NCBI Accession: 

JQ890543.1), the two flagellar factors flagellar secretion chaperones FlgA (flgA,NCBI Accession: 

NZ_ACCC01000021.1) and the essential component of the flagellar secretion apparatus FlhA (flhA, NCBI 

Accession: NZ_ACCC01000021.1), were chosen to be analysed by multiplex PCR. Primers were designed 

according to related Y. ruckeri nucleotide sequences obtained from the NCBI data base. 

Primers were designed using the software Primer 3, available online at http://frodo.wi.mit.edu/. The melting 

temperature of the primers was calculated using the software of Integrated DNA technologies OligoAnalyzer 

3.1 available at http://eu.idtdna.com/. Primers with detailed information used in this study were listed in 

Table 1. 

Multiplex PCR 

88


Multiplex PCRs were performed in 25 μl volumes containing 0.5 μl of cDNA template, 0.2 mM 

concentrations of deoxynucleoside triphosphates, 5 μl of 5× reaction buffer A (PeQlab, Germany), the primer 

mixture containing 0.5 μl of each primer (10 μM) in the same group and 5 U of KAPA2G Robust DNA 

Polymerase (PeQlab, Germany). The reaction was performed in a Biometra T3000 thermocycler (Analytik 

Jena, Germany) with an initial denaturation cycle at 95°C for 3 min, followed by 30 cycles of amplification 

(denaturation at 95°C for 15 s annealing at 60°C for 30 s, and extension at 68°C for 1 min), and a final 

7-min-elongation at 72°C. The PCR products were detected by electrophoresis by using 1% agarose gels pre 

stained with GelRed (Biotium,USA). Images were captured under ultraviolet light by a digital camera system 

(INTAS Science Imaging Instruments GmbH, Göttingen, Germany). 

Detection of gene expressions 

For a transcription analysis of the genes encoding virulence factors, PCRs were performed for each gene 

separately in 25 μl volumes containing 5 μl of cDNA template, 0.2 mM concentrations of deoxynucleoside 

triphosphates, 5 μl of 5× reaction buffer A (PeQlab, Germany), 0.5 μl of each forward and reverse primer 

(10μM) and 5 U of KAPA2G Robust DNA Polymerase (PeQlab, Germany). 

The reaction conditions were 

the same as for the multiplex PCR described above, except the amplification cycles were 40 instead of 30. The 

expression of the 16S rRNA gene was used as reference gene. PCR products were detected by electrophoresis 

in 1% agarose gels pre stained with GelRed (Biotium, USA). Images were captured under ultraviolet light by 

a digital camera system (INTAS Science Imaging Instruments GmbH, Göttingen, Germany). 

Semi-quantitative analysis of PCR products 

The amount of PCR products was determined by densitometric analysis using a computerized image analysis 

system, CP ATLAS 2.0 Cross-platform Advanced Thin Layer and Gel analysis software. Grading the ratio 

between the densitometric results of the target genes and the 16S rRNA gene generated semiquantitative PCR 

results. 

In vitro- testing of isolates for cytotoxicity 

For an in vitro testing of isolates for cytotoxicity, 4 different fish cell lines were used: Common carp brain 

(CCB), epithelioma papulosum cyprini (EPC), fathead minnow epithelial cell (FHM) are derived from 

cyprinid fishes and rainbow trout gonad-2 (RTG-2) cells were of salmonid origin. 27 Y. ruckeri isolates were 

randomly selected from each of the different typing groups. From each isolate, 10 5 , 10 6 and10 7 bacterial cells 

89


per well were inoculated into the wells of a microtiter plate with a confluent monolayer of the cells. Thereafter, 

the plates were incubated at 15 °C for 6h, 24h and 48h as well as at 25 °C (20 °C for RTG-2 cells) for 2h, 6h, 

and 24h. Then the cell free supernatant was collected from the wells and used for the detection of cytotoxicity 

by means of a cytotoxicity detection kit (TaKaRa, Japan) on the basis of Lactate dehydrogenase (LDH) 

release from destructed cell. The measurement was done according to the manufacturer‟s instructions. 

Triplicate wells inoculated with bacteria and without a cell monolayer and triplicate wells with a cell 

monolayer treated with Triton X 100 served as low and high controls respectively. For wells inoculated with 

bacteria, the percentage of cytotoxicity was calculated according to the following equation: 

The ability of Y. ruckeri isolates to cause cytotoxicity was then grouped into four categories: cytotoxicity 

under 25%, 25%-50%, 50%-75 % and above 75%. 

Statistical analysis 

All data are presented as means±SD. Statistical significant differences between groups were determined by 

two way-ANOVA followed by multiple t-tests using Graphpad prism 6.0 software. Differences at p< 0.05 

were considered significant. 

Results 

Multiplex PCR 

A multiplex PCR was used to test Y. ruckeri isolates for the presence of the genes encoding virulence factors. 

All targeted genes were found to be present in all 83 Y. ruckeri isolates from fish populations in North West 

Germany. PCR products for all the genes under study could be detected in isolates in biotype 1 and 2, as well 

as in the reference strain from the DSMZ collection. 

Gne Transcription 

When the transcription of the flagellar and virulence factor genes was analysed, gene transcripts could be 

detected in motile and non-motile Y. ruckeri isolates. A semi-quantitative analysis of the level of gene 

transcripts of target genes in relation to the transcription of the 16S rRNA indicated a higher expression of 

most of the genes in biotype 1 (motile) isolates compared to the non-motile biotype 2 isolates (Fig 2). Slight 

differences were observed in the RNA expression between biotype 1 and biotype 2 isolates in all tested genes. 

These differences however, were not significant (p> 0.05). 

90


The flagellar genes flhA and flgA were expressed in isolates from both motile and non-motile biotypes (Fig. 2). 

In biotype 1 isolates, flhA expression (component of the flagellar secretion apparatus) was significantly higher 

than flgA (flagellar secretion chaperone) expression (P0.05, Fig. 2). 

There was no significant difference (p>0.05) in the expression of rucC and rupG genes, coding together for 

ruckerbactin, and of yhlA and yhlB genes, essential for the hemolysin YhlA (P>0.05) between isolates from 

biotype 1 or biotype 2. In all isolates, genes from the ABC reporter system (yrp1, yrpD, yrpE, yrpF) were 

differently expressed. In both biotype 1 and biotype 2isolates the expression of yrp1 was significantly (p


(Tab. 3). These differences in cytotoxicity were significantly different in experiments performed at 15 °C, but 

at 25 °C. Overall, cytotoxicity of Y. ruckeri isolates was significantly higher (p


species share homology with the flagellar T3SS such as FliFHIKNPQR and FlhAB (Desvaux et al. 2006). 

According the flagellar cascade theory in enterobacteria, the expression of the operon flhDC, a class 1 gene, 

ensures the expression of all subsequent genes, and the expression of class 2 genes results in the synthesis of 

the basal body-hook structure and the activator of class 3 genes (Gillen and Hughes 1991, Helmann 1991). 

The flhA gene, which was analysed here, is a flagellar class 1 gene and involved in type three export of 

flagellar components(Minamino and Macnab 2000). The flhA mutant of Bacillus thuringiensis had the ablity 

of synthesizing flagellin but was not able to export it (Ghelardi et al. 2002). In Y. ruckeri flagella contributed 

to the virulence during the early stage of infection, when the pathogen in the environment first contacts the 

host and begins to invade(Kim 2000). Recently, Evenhuis et al (Evenhuis et al. 2009) constructed a flhA::Tn5 

mutant of Y. ruckeri, which was lacking both motility and secreted lipase activity. The mutation loss of 

flagellar secretion was considered as a possible mechanism for the emergence of non-motile biotype 2 Y. 

ruckeri isolates, but it did not affect the virulence of the isolates in rainbow trout (Evenhuis et al. 2009). In our 

study, the flagellar genes flgA and flhA were detected in both motile and non-motile isolates of Y. ruckeri, and 

there were no differences in the expression of these genes between biotype1 and biotype 2 strains. The biotype 

2 isolates from our study were lacking a flagellum as confirmed by a flagellar silver-staining (unpublished 

observations), which confirms the findings of Evenhuis et al (Evenhuis et al. 2009) that a lack of flagellar 

motility in these biotype 2 strains, is not related to a complete absence of flgA and flhA genes. Welch et al 

(Welch et al. 2011) found mutations present in flhA and flhB genes from European strains of Y. ruckeri, 

therefore, it is believed that these mutations may lead to a functional suppression of these genes of the isolates 

from north west Germany as well. 

Extracellular products of Y. ruckeri are highly toxic to fish and were found to induce clinical signs of the 

disease like darkening of the skin and haemorrhages in a rainbow trout injection model (Romalde and Toranzo 

1993). An important component in these extracelluar products is the extracellular protease yrp1, which is 

secreted by a type 1 Gram-negative bacterial ABC exporter protein system, comprised of the genes yrpD, E, F 

and a protease inhibitor (Fernández et al. 2002). Site-directed insertion mutations of yrp1 and yrpE resulted in 

a loss of protease activity and decreased virulence of bacterial strains to rainbow trout (Fernández et al. 2002). 

In the present study, the genes encoding the protease and the protein exporter system were found in the 

genome of all the isolates tested. In these isolates, the expression of yrp1 and yrp F were relatively higher than 

93


the expression of the other two genes, suggesting that the expression of yrpF is highly required for the 

secretion of Yrp1 protease. Furthermore, a haemolysin YhlA and the activation of a protein (YhlB) associated 

with the secretion of this haemolysin were identified as additional virulence factors of Y. ruckeri (Fernández et 

al. 2007). The genes encoding these proteins were present in all isolates examined in the present study and the 

level of expression was similar between biotype 1 and biotype 2 isolates. The expression of YhlB was induced 

under iron-restricted conditions (Fernández et al. 2007), which could result in a higher iron release form 

erythrocytes by haemolysis. An important iron uptake system of Y. ruckeri is ruckerbactin which also was 

identified as virulence factor in the host (Fernández et al. 2004). The expression of rucC and rucG genes, 

encoding for ruckerbactin showed only slight differences in biotype 1 and biotype 2 strains, suggesting 

biotype 2 mutated from biotype 1 without changing the virulence factors at the genetic level. 

The presence of all genes encoding for different mechanisms involved in the virulence of Y. ruckeri in all 

isolates from North West Germany indicate a genetic homogeneity of this species in this geographic area, 

even though several different typing groups could be identified by pulsed field electrophoresis. This confirms 

the data from previous studies based on genetic fingerprinting (Romalde et al. 1993), multi-locus sequencing 

(Kotetishvili et al. 2005) and gene expression (Fernández et al. 2003, Fernández et al. 2007, Fernández et al. 

2002). Furthermore, the virulence associated genes were not differently transcribed between isolates from the 

two biotypes. 

In several fish pathogenic bacteria, including aeromonads, virulent bacterial strains also displayed an 

increased cytotoxicity towards fish cells in vitro (Burr et al. 2002, Burr et al. 2003, Wahli et al. 2005). In the 

present study, the cytotoxicity of Y. ruckeri was tested towards four different fish cell lines derived from 

cyprinids (CCB, EPC and FHM) and from rainbow trout (RTG-2) tissues. Most of the tested isolates (88.89%) 

exhibited some cytotoxicity to at least two of these fish cell lines, EPC and FHM cells were found more 

sensitive to Y. ruckeri isolates than CCB and RTG-2 cells. This confirms findings from previous studies in 

which Y. ruckeri adhered to and invaded several cultured cells derived from salmonid fishes, such as Chinook 

salmon embryo (CHSE-214), RTG, Rainbow trout kidney (RTPK), or Rainbow trout liver (R1) cells 

(Tobback 2009, Tobe et al. 2006), but exhibited a strong host cell preference to FHM cells (Kawula et al. 

1996) as observed in the present study. Y. ruckeri did not invade human derived Hep-2 cells(Kawula et al. 

1996). Several Y. ruckeri isolates were able to adhere to and to invade into CHSE 24 or R1 cells, but after 6 h 

94


of incubation showed a lower intracellular survival, suggesting Y. ruckeri may not be able to multiply or 

survive inside of these cultured cells (Tobback 2009). In our study, an obvious cytotoxicity could not be 

observed after an incubation time of just 6 h even when the cells were cultivated at 25℃. Increase cytotoxicity 

was seen after 24 h, indicating that intracellular survival was not crucial to Y. ruckeri isolates and that the 

bacterium could cause cytotoxicity to cultured cells even extracellular (Tobback 2009). Romalde and Toranzo 

(Romalde and Toranzo 1993) proved the ability of Y. ruckeri to adhere to and effectively invade fish cell lines 

cultured in vitro. However, the virulence of Y. ruckeri isolates to rainbow trout was not observed to correlate 

with their in vitro invasiveness in cell lines (Tobback et al. 2010a). In these studies (Kawula et al. 1996, 

Romalde et al. 1991b, Tobback et al. 2010a) a relatively high percentage of Y. ruckeri invaded and survived in 

FHM cells, which corresponds to findings in our study, where all isolates showed elevated cytotoxicity to 

FHM cells. Yersinia ruckeri strains are generally considered as poor producers of cytotoxins (Romalde and 

Toranzo 1993). This corresponds to observation in the present study where a large proportion of the isolates 

had a low cytotoxicity, in particular to CCB and RTG-2 cells. 

After incubation for 24 h at 15 ℃, non-motile strains caused a higher cytotoxicity than motile strains. This 

difference between strains from the two biotypes was not seen at 25 °C, suggesting that at low temperature 

non-motile strains were more active than motiles. It may explain why non-motile strains were more often 

found responsible for ERM outbreak in winter than motile strains. 

Conclusions 

Common virulence factor genes of Y. ruckeri, such as yhlA and yhlB encoding for the hemolysin YhlA, rucC 

and rupG encoding for ruckerbactin, yrp1 and yrpDEF for an ABC exporter protein system, and two flagellar 

genes, including flgA for flagellar secretion chaperones and flhA for flagellar secretion apparatus, were found 

present in all biotype 1 and 2 isolates of Y. ruckeri collected from North West Germany during the period of 

2004-2012. There was also no significant diversity (p>0.05) in the expression of these genes between biotype 

1 and 2 strains. Our results suggest that in biotype 2 strains, lack of flagellar motility, is not because of the 

absence of flgA and flhA genes, but probably results from the functional suppression of these genes. These 

data indicates that biotype 2 strains are homogenous with biotype 1 strains on the basis of genetic virulence 

factor genes expression. Y. ruckeri isolates could cause higher cytotoxicity to EPC and FHM cell lines than 

CCB and RTG-2. Non-motile strains were more active than motile strains when the temperature was low. 

95


Acknowledgement 

We acknowledge the generous support provided during sample collection in aquaculture ponds by Dr. W. 

Schäfer and D. Mock from the Fish Health Service, North Rhine Westphalia. Dr. S. Braune (LAVES 

Niedersachsen) and Dr. A. Nilz (LHL, Giessen) provided Yersinia ruckeri samples from their collection of 

fish pathogenic bacteria. This study was financially supported by the Landesamt für Natur, Umwelt und 

Verbraucherschutz Nordrhein-Westfalen (LANUV). 

References 

Austin DA, Robertson PAW, and Austin B (2003): Recovery of a new biogroup of Yersinia ruckeri from diseased 

rainbow trout(Oncorhynchus mykiss, Walbaum). Syst Appl Microbiol 26: 127-131. 

Burr SE, Stuber K, Wahli T, and Frey J (2002): Evidence for a type III secretion system in Aeromonas salmonicida 

subsp. salmonicida. J Bacteriol 184: 5966-5970. 

Burr SE, Wahli T, Segner H, Pugovkin D, and Frey J (2003): Association of type III secretion genes with virulence of 

Aeromonas salmonicida subsp. salmonicida. Dis Aquat Org 57: 167-171. 

Chevance FF, and Hughes KT (2008): Coordinating assembly of a bacterial macromolecular machine. Nat Rev 

Microbiol 6: 455-465. 

Coquet L, Cosette P, Junter G-A, Beucher E, Saiter J-M, Jouenne T, and D J-MS (2002a): Adhesion of Yersinia 

ruckeri to fish farm materials:influence of cell and material surface properties. Colloids Surf B 26: 373-378. 

Coquet L, Cosette P, Quillet L, Petit F, Junter GA, and Jouenne T (2002b): Occurrence and phenotypic 

charaterization of Yersinia ruckeri strains with biofilm-forming capacity in a rainbow trout Farm. Appl Environ 

Microbiol 68: 470-475. 

Cornelis GR (2002): Yersinia type III secretion: send in the effectors. J Cell Biol 158: 401-408. 

Davies RL (1991): Virulence and serum-resistance in different clonal groups and serotypes of Yersinia ruckeri. Vet 

Microbiol 29: 289-297. 

Davies RL, and Frerichs GN (1989): Morphological and biochemical differences among isolates of Yersinia ruckeri 

obtained from wide geographical areas. J Fish Dis 12: 357-365. 

Desvaux M, Hebraud M, Henderson IR, and Pallen MJ (2006): Type III secretion: what's in a name? Trends 

Microbiol 14: 157-160. 

96


Erhardt M, Namba K, and Hughes KT (2010): Bacterial nanomachines: The flagellum and type III injectisome. Cold 

Spring Harb Perspect Biol 2: a000299. 

Evenhuis JP, Lapatra SE, Verner-Jeffreys DW, Dalsgaard I, and Welch TJ (2009): Identification of Flagellar 

Motility Genes in Yersinia ruckeri by Transposon Mutagenesis. Antimicrob Agents Chemother 75: 6630-6633. 

Faraldo-Gomez J, and Sanson SP (2003): Acquisition of siderophores in Gram-negative bacteria. National Review 4: 

105-116. 

Fernández L, López JR, Secades P, Menéndez A, Márquez I, and Guijarro JA (2003): In vitro and in vivo studies of 

the Yrp1 protease from Yersinia ruckeri and its role in protective immunity against enteric redmouth disease of salmonids. 

Appl Environ Microbiol 69: 7328-7335. 

Fernández L, Márquez I, and Guijarro JA (2004): Identification of Specific In Vivo-Induced (ivi) Genes in Yersinia 

ruckeri and Analysis of Ruckerbactin, a Catecholate Siderophore Iron Acquisition System. Appl Environ Microbiol 70: 

5199-5207. 

Fernández L, Prieto M, and Guijarro JA (2007): The iron- and temperature-regulated haemolysin YhlA is a virulence 

factor of Yersina ruckeri. Microbiology 153: 483-489. 

Fernández L, Secades P, Lopez JR, Marquez I, and Guijarro JA (2002): Isolation and analysis of a protease gene with 

an ABC transport system in the fish pathogen Yersinia ruckeri: insertional mutagenesis and involvement in virulence. 

Microbiology 148: 2233-2243. 

Ghelardi E, Celandroni F, Salvetti S, Beecher DJ, Gominet M, Lereclus D, Wong ACL, and Senesi S (2002): 

Requirment of flhA for swarming differentiation, flagellin export, and secretion of virulence-associated proteins in 

Bacillus thuringiensis. J Bacteriol 184: 6424-6433. 

Gibello A, Blanco MM, Moreno MA, Cutuli MT, Domenech A, Moniguez L, and Fernandez-Garayzabal JF (1999): 

Development of a PCR Assay for Detection of Yersinia ruckeri in Tissues of Inoculated and Naturally Infected Trout. 

Appl Environ Microbiol 65: 346-350. 

Gillen KL, and Hughes KT (1991): Negative regulatory loci coupling flagellin synthesis to flagellar assembly in 

Salmonella typhimurium. J Bacteriol 173: 2301-2310. 

Gunasena D, Komrower J, and Macintyre S (2003): The Fish Pathogen Yersinia ruckeri Possesses a TTS System. In: 

Skurnik M, Benoechea JA, and Granfors K (eds.), The Genus Yersinia: Entering the Functional Genomic Era. Kluwer 

Academic/Plenum Publishers, New York, USA, p. 105-107. 

97


Helmann JD (1991): Alternative sigma factors and the regulation of flagellar gene expression. Mol Microbiol 5: 

2875-2882. 

Kawula TH, Lelivelt MJ, and Orndorff PE (1996): Using a new inbred fish model and cultured fish tissue cells to 

study Aeromonas hydrophila and Yersinia ruckeri pathogenesis. Microb Pathog 20: 119-125. 

Kim W (2000): Investigation of the role of flagella in the virulence of Yersinia ruckeri. Canada, The University of 

Guelph. 

Kotetishvili M, Kreger A, Wauters G, Jr. Morris JG, Sulakvelidze A, and Stine OC (2005): Multilocus Sequence 

Typing for Studying Genetic Relationships among Yersinia Species. J Clin Microbiol 43: 2674-2684. 

Méndez J, and Guijarro JA (2013): In vivo monitoring of Yersinia ruckeri in fish tissues: progression and virulence 

gene expression. Environ Microbiol Rep 5: 179-185. 

Minamino T, and Macnab RM (2000): Interaction among components of the Samonella flagellar export apparatus and 

its substrates. Mol Microbiol 35: 1052-1064. 

Romalde JL, Conchas RF, and Toranzo AE (1991a): Evidence that Yersinia ruckeri possesses a high affinity iron 

uptake system. FEMS Microbiol Lett 80: 121-126. 

Romalde JL, Iteman I, and Carniel E (1991b): Use of pulsed field gel electrophoresis to size the chromosome of the 

bacterial fish pathogen Yersinia ruckeri FEMS Microbiology Letters 84: 217-226. 

Romalde JL, Margarinos B, Barja JL, and Toranzo AE (1993): Antigenic and molecular characterization of Yersinia 

ruckeri Proposal for a new intraspecies classification. System Appl Microbiol 16: 411-419. 

Romalde JL, and Toranzo AE (1993): Pathological activities of Yersinia ruckeri, the enteric redmouth (ERM) 

bacterium. FEMS Microbiol Lett 112: 291-300. 

Rucker RR (1966): Redmouth disease of rainbow trout (Salmo gairdneri). Bull off int Epizoot 65: 825-830. 

Salmond GP, and Reeves PJ (1993): Membrane Traffic Wardens and Protein Secretion in Gram-negative Bacteria. 

Trends Bioch Sci 18: 7-12. 

Tobback E (2009): Early pathogenesis of Yersinia ruckeri infections in rainbow trout (Oncorhynchus mykiss, Walbaum) 

Ghent, Ghent University. 

Tobback E, Decostere A, Hermans K, Ryckaert J, Duchateau L, Haesebrouck F, and Chiers K (2009): Route of 

entry and tissue distribution of Yersinia ruckeri in experimentally infected rainbow trout Oncorhynchus mykiss. Dis 

Aquat Org 84: 219-228. 

98


Tobback E, Decostere A, Hermans K, Van den Broeck W, Haesebrouck F, and Chiers K (2010a): In vitro markers 

for virulence in Yersinia ruckeri. J Fish Dis 33: 197-209. 

Tobback E, Hermans K, Decostere A, Van-den-Broeck W, Haesebrouck F, and Chiers K (2010b): Interactions of 

virulent and avirulent Yersinia ruckeri strains with isolated gill arches and intestinal explants of rainbow trout 

Oncorhynchus mykiss. Dis Aquat Org 90: 175-179. 

Tobe T, Beason SA, Taniguchi H, Abe H, Bailey CM, Fivian A, Younis R, Matthews S, Marches O, Frankel G, 

Hayashi T, and Pallen MJ (2006): An extensive repertoire of type III secretion effectors in Escherichia coli O157 and 

the role of lambdoid phages in their dissemination. Proc Nat Acad Sci U S A 103: 14941-14946. 

Vilches S, Jimenez N, Tomás JM, and Merino S (2009): Aeromonas hydrophila AH-3 Type III Secretion System 

Expression and Regulatory Network. Appl Environ Microbiol 75: 6382-6392. 

Wahli T, Burr SE, Pugovkin D, Mueller O, and Frey J (2005): Aeromonas sobia, a causative agent of disease in 

farmed perch, Perca fluviatilis L. J Fish Dis 28. 

Welch TJ, Verner-Jeffreys DW, Dalsgaard I, Wiklund T, Evenhuis JP, Cabrera JAG, Hinshaw JM, Drennan JD, 

and LaPatra SE (2011): Independent emergence of Yersinia ruckeri biotype 2 in th United States and Europe. Appl 

Environ Microbiol 77: 3493-3499. 

Address of correspondence 




Buenteweg 17, 

30559 Hannover 

Germany 

dieter.steinhagen@tiho-hannover.de 

99


TABLE 1: PCR primers for the analysis of Yersinia ruckeri virulence factor targets 

PCR 

Target 

Function 

Primer 

Sequence(5'→3') 

Ampliconsize 

References 

Name 

Gene 

Name 

(bp) 

16S 

16S 

Identification YER8 GCGAGGAGGAAGGGTTAAGTG 575 (Gibello et 

rRNA 

rRNA 

YER10 

GAAGGCACCAAGGCATCTCTG 

al. 1999) 

Multiplex 

flgA 

flagellar 

flgA fw GTGCCGCTGACAATCTGG 217 This study 

PCR 

secretion 

Group 1 

chaperones 

flgA rv 

CCAAGGGAACTCTGGCTTTG 

rucC ruckerbactin rucCfw CGAAAGGCTCCAACTGACTG 414 This study 

rucCrv 

CAGAAGGCGGTGTTTTGCTC 

rupG ruckerbactin rupGfw AGTGCCGCTTCCAGTGATG 510 This study 

rupGrv 

GCCTCGCAGTGTATGGGTATG 

yhlB hemolysin yhlBfw CGCCTGACCAATGAACTGAC 744 This study 

yhlBrv 

GAGTGTGGGGCTGCTGATAC 

flhA 

flagellar 

flhA fw TATGCCGGGTAAACAGATGG 809 This study 

secretion 

apparatus 

flhA rv 

TGCCAATTTCAACCCCTTTC 

yhlA hemolysin yhlA CGGCTAACACCCACACAATC 990 This study 

100


fw 

yhlArv 

CGTTGGCTGCATCTTGTTTC 

Multiplex 

yrpE 

ABC 

yrpEfw CAGTTGGCCGAGTTACAGTCC 209 This study 

PCR 

exporter 

yrpErv 

ACCCGTGCATCAACAAACAG 

Group 1 

yrpF protein yrpFfw CGGTCTTGTCTTTGCGTCAG 364 This study 

system 

yrpFrv 

CGGCCAATAATGTTTTCCAG 

yrp1 yrp1fw ATTACCCGCACCAACCAAAC 609 This study 

yrp1rv 

GGCCCCGTACAAATGCTG 

yrpD yrpDfw TTTGATGCGCCTTGGTTTC 799 This study 

yrpDrv 

TTCATATCGGCACCATCCAG 

TABLE 2: Mean and maximum cytotoxicity of Yersinia ruckeri (10 7 cells/ well) to different fish cell lines (%) 

Temperature 

(℃) 

Time 

(h) 

CCB EPC FHM RTG-2 

mean Max. mean Max. mean Max. mean Max. 

15 6 0.1 1.16 0.41 6.67 0.43 3.47 0.23 2.42 

24 7.21 41.84 3.83 20.28 6.45 69.52 4.84 48.93 

48 49.26 64.89 50.23 82.39 55.41 88.3 43.85 87.07 

25/20 2 0.02 0.32 0.67 9.49 0.45 5.04 0.58 6.09 

6 1.25 8.06 4.23 16.55 1.97 9.15 1.6 11.45 

101


24 31.63 57.76 56.9 87.41 58.3 95.23 13.48 52.67 

TABLE 3: Yersinia ruckeri isolates from North West Germany: Comparison of molecular typing and in vitro cytotoxicity 

Typing 

Group 

(tp) No. 

Incubation time and temperature 

24 h at 25 ℃/20 ℃* 48 h at 15 ℃ 

CCB EPC FHM RTG2 CCB EPC FHM RTG2 

tp1 + ++ ++ - + + +++ ++ 

tp2 - - - - ++ - +++ ++ 

tp3 - ++ ++ - + +++ +++ - 

tp4 - - +++ - ++ ++ +++ ++ 

tp5 + ++ ++ - ++ ++ +++ ++ 

tp6 + ++ ++ + ++ ++ ++ ++ 

tp7 + ++ +++ + + ++ +++ - 

tp8 + ++ - - - ++ + - 

tp9 - +++ +++ - + ++ +++ - 

tp10 - + +++ - ++ ++ +++ ++ 

tp11 ++ ++ +++ - ++ ++ ++ +++ 

102


tp12 - +++ + - ++ - + ++ 

tp13 ++ ++ +++ - ++ ++ ++ +++ 

tp14 - - - - - - - ++ 

tp15 + ++ +++ - ++ ++ ++ ++ 

tp16 + +++ - - ++ + - + 

tp17 + - - - - - - - 

tp18 + + +++ ++ + ++ +++ - 

tp19 - - - - ++ + + - 

tp20 ++ ++ +++ - ++ ++ ++ ++ 

tp21 - - - - - - - - 

tp22 + ++ +++ - ++ +++ +++ - 

tp23 + +++ +++ - ++ ++ +++ ++ 

tp24 + +++ +++ - ++ + + ++ 

tp25 - +++ - - ++ - - - 

tp26 + +++ +++ - ++ ++ ++ ++ 

tp27 ++ +++ +++ - ++ ++ ++ ++ 

Note: RTG-2 cells were tested at 20 ℃, instead of 25 ℃. „-‟: cytotoxicity was lower than 25%; „+‟: cytotoxicity was between 25% and 50%; „++‟: 

cytotoxicity was between 50% and 75%; „+++‟: cytotoxicity was above 75%. 

103


TABLE 4: Mean and maximum cytotoxicity of Yersinia ruckeri isolates at 15℃ to different cell lines (%) 

Motility 

Incubation time 

24h 

48h 

CCB EPC FHM RTG2 CCB EPC FHM RTG2 

mean max mean max mean max mean max mean max mean max mean max mean max 

Motile 4.14 11.04 3.36 11.98 0.64 3.78 1.01 9.08 62.04 71.08 43.05 70.38 44.97 87.43 48.05 66.8 

Non-motile 8.75 41.84 4.07 20.28 9.35 69.52 6.76 48.93 42.7 64.89 53.81 77.72 60.63 88.3 41.74 94.26 

104


M 1 2 3 4 5 6 7 8 9 10 

yhlA 

flhA 

yhlB 

rupG 

rucC 

yrpD 

yrp1 

yrpF 

flgA 

yrpE 

FIGURE 1: 

Detection of virulence factor genes in Yersinia ruckeri isolated from fish in aquaculture 

populations from North West Germany by multiplex PCR. It showed the results from 4 Y. ruckeri isolates 

including the reference strain DSM 18506 as an example. DSM 18506 (lanes 1, 6) and isolate 111-1 (lanes 

4, 9) were motile strains, while G1S1 (lanes 2, 7) and KP6-2 (lanes 3, 8) were non-motile strains. In PCR 1 

(lanes 1-4), six bands present for six different genes were detected and in PCR 2 (lanes 5-9) four bands with 

products of different sizes present different genes were detected. M: Maker, Lane 1-5 Multiplex PCR group 

1: Lane 1 DSM 18506, Lane 2 G1S1, Lane 3 KP6-2, Lane 4 111-1, Lane 5 negative control; Lane 6-10 

Multiplex PCR group 2: Lane 6 DSM 18506, Lane 7 G1S1, Lane 8 KP6-2, Lane 9 111-1, Lane 10 negative 

control (without DNA template). 

105

Number of isolates 



FIGURE 2: Relative expression of different virulence factor genes in Yersinia ruckeri isolates from biotype 1 

and biotype 2. 

24h 25℃ 48h 15℃ 

C 

30 

30 

C 

B 

25 

20 

15 

10E5 

10E6 

10E7 

25 

20 

15 

10E5 

10E6 

10E7 

10 

10 

5 

5 

0 

Below 25% 25%-50% 50%-75% Above 75% 

Cytotoxicity 

0 

Below 25% 25%-50% 50%-75% Above 75% 

Cytotoxicity 

106








E 

25 

25 

P 

C 

20 

15 

10 

10E5 

10E6 

10E7 

20 

15 

10 

10E5 

10E6 

10E7 

5 

5 

0 

Below 25% 25%-50% 50%-75% Above 75% 

Cytotoxicity 

0 

Below 25% 25%-50% 50%-75% Above 75% 

Cytotoxicity 

F 

H 

M 

25 

20 

15 

10 

5 

0 

Below 25% 25%-50% 50%-75% Above 75% 

Cytotoxicity 

10E5 

10E6 

10E7 

30 

25 

20 

15 

10 

5 

0 

Below 25% 25%-50% 50%-75% Above 75% 

Cytotoxicity 

10E5 

10E6 

10E7 

R 

30 

25 

T 

G- 

2 

25 

20 

15 

10 

5 

10E5 

10E6 

10E7 

20 

15 

10 

5 

10E5 

10E6 

10E7 

0 

Below 25% 25%-50% 50%-75% Above 75% 

Cytotoxicity 

0 

Below 25% 25%-50% 50%-75% Above 75% 

Cytotoxicity 

FIGURE 3: Cytotoxicity of Yersinia ruckeri isolates to different fish cell lines after incubation for 24h 

at 25℃ (20℃ for RTG-2 cells) and at 48 h at 15 ℃. 10E5, 10E6 and 10E7: bacterial concentration of 

10 5 cells/ well, 10 6 cells/well and 10 7 cells/well. 

107

108

Chapter 6. 

Pheno- and genotypic analysis of antimicrobial resistance 

properties of Yersinia ruckeri from fish 

Yidan Huang, Geovana Brenner Michael, Roswitha Becker, 

Heike Kaspar, Joachim Mankertz, Stefan Schwarz, 

Martin Runge, Dieter Steinhagen 

Accepted by Veterinary Microbiology 

109

The extent of Yidan Huang‟s contribution to the article is evaluated according to the following 

scale: 







4. Presentation and discussion of the study in article form: B 

110

Chapter 6 Pheno- and genotypic analysis of antimicrobial resistance properties of Y. ruckeri 

Pheno- and genotypic analysis of antimicrobial resistance properties 

of Yersinia ruckeri from fish 

Yidan Huang a , Geovana Brenner Michael b , Roswitha Becker b , Heike Kaspar c , 

Joachim Mankertz c , Stefan Schwarz b , Martin Runge d , Dieter Steinhagen a,§ 

a 

Fish Disease Research Unit, University of Veterinary Medicine Hannover, Foundation, Germany 

b 

Institute of Farm Animal Genetics, Friedrich-Loeffler-Institut (FLI), Neustadt-Mariensee, 

Germany 

c 

Federal Office of Consumer protection and Food safety (BVL), Berlin, Germany 

d 


Veterinary Institute Braunschweig/Hannover, Germany 

Short title: Antimicrobial resistance of Yersinia ruckeri 

Keywords: minimal inhibitory concentration, antimicrobial susceptibility testing, target site 

mutation, plasmid, gene cassette 

111


§ Corresponding author: Tel: +49 511 953-8560. Fax: +49 511 953-8587 

E-mail address: dieter.steinhagen@tiho-hannover.de 

Abstract 

Enteric red-mouth disease, caused by Yersinia ruckeri, is an important disease in rainbow trout 

aquaculture. Antimicrobial agents are frequently used in aquaculture, thereby causing a selective pressure 

on bacteria from aquatic organisms under which they may develop resistance to antimicrobial agents. In 

this study, the distribution of minimal inhibitory concentrations (MICs) of antimicrobial agents for 83 

clinical and non-clinical epidemiologically unrelated Y. ruckeri isolates from North West Germany was 

determined. Antimicrobial susceptibility was conducted by broth microdilution at 22 ± 2 °C for 24, 28 and 

48 h. Incubation for 24 h at 22 ± 2 °C appeared to be suitable for susceptibility testing of Y. ruckeri. In 

contrast to other antimicrobial agents tested, enrofloxacin and nalidixic acid showed a bimodal 

distribution of MICs, with one subpopulation showing lower MICs for enrofloxacin (0.008-0.015 µg/mL) 

and nalidixic acid (0.25-0.5 µg/mL) and another subpopulation exhibiting elevated MICs of 0.06-0.25 and 

8-64 µg/mL, respectively. Isolates showing elevated MICs revealed single amino acid substitutions in the 

quinolone resistance-determining region (QRDR) of the GyrA protein at positions 83 (Ser83-Arg or -Ile) 

or 87 (Asn87-Tyr), which raised the MIC values 8- to 32-fold for enrofloxacin or 32- to 128-fold for 

nalidixic acid. An isolate showing elevated MICs for sulfonamides and trimethoprim harbored a ~8.9 kb 

plasmid, which carried the genes sul2, strB and a dfrA14 gene cassette integrated into the strA gene. These 

observations showed that Y. ruckeri isolates were able to develop mutations that reduce their 

susceptibility to (fluoro)quinolones and to acquire plasmid-borne resistance genes. 

112


1. Introduction 

Yersinia ruckeri is a Gram-negative rod-shaped bacterium which belongs to the family 

Enterobacteriaceae and is the causative agent of enteric red mouth disease (ERM). Several fish species 

can be infected by Y. ruckeri, especially rainbow trout (Oncorhynchus mykiss) (Noga, 2010). Because of 

the economic losses, ERM is one of the most important diseases in trout aquaculture in Europe. To 

harmonize antimicrobial susceptibility testing of bacteria from aquatic animals and to make the obtained 

results more comparable, two documents have been published by the Clinical and Laboratory Standards 

Institute (CLSI): VET03-A (CLSI, 2006a) for susceptibility testing by agar disk diffusion and VET04-A 

for susceptibility testing by broth dilution methods (CLSI, 2006b). In addition, a third CLSI document, 

VET03/VET04-S1 (CLSI, 2010) that contains the first clinical breakpoints and also epidemiological 

cut-off values applicable to Aeromonas salmonicida has been published. While clinical breakpoints are 

important to predict the clinical outcome of an antimicrobial treatment (Bywater et al., 2006; Schwarz et 

al., 2010), epidemiological cut-off values only differentiate between a wildtype and a non-wildtype 

population, the latter of which usually has acquired resistance mechanisms. In aquaculture, 

agents, such as quinolones, sulfonamides and trimethoprim, were used to treat fish diseases (Angulo, 

2000; Rigos and Troisi, 2005), thereby furthering the development of antimicrobial resistance among 

bacteria of aquatic organisms. As little information about the antimicrobial susceptibility of Y. ruckeri is 

currently available (reviewed in Rodgers, 2001), we investigated Y. ruckeri isolates obtained from 

different fish species in North West Germany for their minimal inhibitory concentrations (MICs) for 

different antimicrobial agents. Furthermore, selected Y. ruckeri isolates, that showed distinctly higher 

113


MIC values for specific antimicrobial agents than the remaining isolates, were investigated for the 

presence of resistance-mediating mutations or resistance genes. 

2. Materials and Methods 

2.1 Bacterial cultures 

Eighty-two Y. ruckeri isolates collected from different fish species, including rainbow trout 

(Oncorhynchus mykiss), brown trout (Salmo trutta), koi (Cyprinus carpio) and pike (Esox lucius) by 

field and monitoring studies in the period from 2004 to 2012 in North West Germany in the federal 

states Lower Saxony (n=25), Hessen (n=8) and North Rhine-Westphalia (n=49) were investigated. 

Among them, 33 clinical isolates were obtained from diseased rainbow trout suffering from ERM. 

These isolates were provided by the Lower Saxony State Office for Consumer Protection and Food 

Safety (LAVES), the Food and Veterinary Institute Braunschweig/Hanover and the fish disease service 

at the Landesbetrieb Hessisches Landeslabor. The remaining 49 isolates were obtained from rainbow 

trout during different ERM outbreaks in the federal state North Rhine-Westphalia. In addition, the type 

strain Y. ruckeri DSM 18506 (ATCC ® 29473) provided by the Clinic for Poultry at the University of 

Veterinary Medicine Hannover, Foundation was included in this study. In a previous study, all these 

isolates were identified as Y. ruckeri and were investigated for their phenotypic and genomic 

relationships (Huang et al., 2013). The Y. ruckeri isolates were maintained on tryptone soy agar (TSA, 

Sigma-Aldrich, Taufenkirchen, Germany) and incubated at 25 °C. 

2.2 Antimicrobial susceptibility testing 

114


Susceptibility tests were performed by broth microdilution according to the CLSI guideline 

VET04-A (CLSI, 2006b) and recommendations of Miller and colleagues (Miller et al., 2003; 2005). 

Custom-made microtiter plates (MCS Diagnostics, Swalmen, The Netherlands) served to test a total of 

24 antimicrobial agents or combinations. The antimicrobial agents tested and the test ranges 

corresponded to those previously described by Feßler et al. (2012). E. coli ATCC ® 25922 served as a 

quality control strain. All plates were incubated at 22 ± 2 °C and the results were read at 24, 28 and 48h 

(CLSI, 2006b; Miller et al., 2005). 

2.3 Molecular analysis of antimicrobial resistance of selected Y. ruckeri isolates 

Based on previously described epidemiological characteristics, motility and pulsed-field gel 

electrophoresis (PFGE) patterns (Huang et al., 2013), ten representative isolates that showed elevated 

MICs for enrofloxacin and nalidixic acid, and three isolates with low MICs (control isolates) were 

investigated for mutations in the QRDR of the target gene gyrA. All selected isolates originated from 

different ERM outbreaks. An internal part of the gyrA gene was amplified by PCR (Shah et al., 2012) 

and the amplicon sequenced (Eurofins MWG Operon, Germany). 

The unique isolate 1521, that showed elevated MICs for the sulfonamide sulfamethoxazole and 

the combination sulfamethoxazole/trimethoprim, was investigated by PCR assays for the presence of 

sulfonamide resistance genes sul1, sul2 and sul3 (Kehrenberg and Schwarz, 2001, Grape et al., 2003), 

various trimethoprim resistance genes (dfrA1, dfrA5, dfrA7 and dfrA14-A17) (Kadlec et al., 2005), 

streptomycin resistance genes strA and strB (Kehrenberg and Schwarz, 2001; Gebreyes and Althier, 

115


2002) and for the linkage of sul2 and strA (Kehrenberg and Schwarz, 2001). In addition, this isolate was 

investigated for the presence of class 1 and 2 integrons (Kadlec et al., 2005). 

2.4 Plasmid transformation, analysis and sequencing 

The plasmid of Y. ruckeri isolate 1521 was isolated by anion-exchange chromatography on 

NucleoBond Xtra Midi columns (Macherey-Nagel, Düren, Germany). Plasmids of Escherichia coli 

V517 served as size standards (Macrina et al., 1978). An additional size estimation of the plasmid was 

done by summing up the sizes of fragments obtained with the restriction enzymes DraI, EcoRI, EcoRV, 

HindIII or PstI. 

The plasmid of isolate 1521 was transformed into E. coli JM107 by the CaCl 2 method as 

described elsewhere (Kehrenberg and Schwarz, 2001). Luria-Bertani (LB) agar plates supplemented 

with trimethoprim (30 µg/mL) were used to select for transformants. Transformants were checked for 

their plasmid content and their antimicrobial susceptibility profile. Moreover, the aformentioned PCR 

assays were applied for the detection of sulfonamide, streptomycin and trimethoprim resistance genes. 

For the characterization of the resistance region, a 5,021 bp segment of the transformed plasmid (named 

pYR1521) was sequenced by primer-walking starting in the dfrA14 gene. The segment was deposited at 

the EMBL database under accession no. HG423538. Comparative analysis of nucleotide and amino acid 

sequences was performed using BLAST at the National Center for Biotechnology Information (NCBI) 

site (www.ncbi.nlm.nih.gov/BLAST/). 

116


3. Results 

3.1 Distribution of MIC values among Y. ruckeri isolates 

According to the recommendations given in the CLSI guideline VET04-A (CLSI, 2006b), the 

microtitre plates should be incubated at 22 2 °C and the results should be read after either 24-28 h or 

after 44-48 h. As far as CLSI-approved QC ranges for the antimicrobial agents tested were available, the 

MICs obtained for the QC strain E. coli ATCC ® 25922 were within these QC ranges (Supplemental 

table S1). A trend towards higher MICs after prolonged incubation for 48 h was observed for most of 

the antimicrobial agents tested (Table 1). Since only a slight increase – if at al – was seen in the MIC 

values after 28 h in comparison to those read after 24 h, the MIC data for the 28 h incubation are not 

shown in Table 1. Table 1 also shows the calculated MIC 50 and MIC 90 after 24 h and 48 h. The lowest 

MICs were found for cefquinome, cefotaxime and enrofloxacin. For most of the antimicrobial agents 

tested, a unimodal distribution of MICs was observed. In contrast, for enrofloxacin and nalidixic acid a 

bimodal MIC distribution was observed with one subpopulation (n=11) showing low enrofloxacin and 

nalidixic acid MICs of 0.008-0.015 µg/mL and 0.25-0.5 µg/mL, respectively, and a larger subpopulation 

(n=72) exhibiting elevated enrofloxacin and nalidixic acid MICs of 0.06-0.25 µg/mL and 8-64 µg/mL, 

respectively. All isolates that showed low MICs for enrofloxacin also showed low MICs for nalidixic 

acid. Only a single isolate, no. 1521, which was isolated from rainbow trout with clinical signs of ERM 

in 2011 in Hessen, exhibited elevated MICs for sulfamethoxazole ( 1024 µg/mL) and for the 

combination sulfamethoxazole/trimethoprim ( 32/608 µg/mL). Three isolates showed increased MICs 

of ≥ 32 µg/mL for colistin. 

117


3.2 Analysis of the quinolone resistance-determining region (QRDR) of the gyrA gene 

Thirteen Y. ruckeri isolates were chosen according to motility, fish and geographic origins, year of 

isolation and PFGE patterns. Sequences of the QRDR of the gyrA gene of these 13 isolates revealed that 

the subpopulation (n=3) with lower (fluoro)quinolone MICs showed the non-mutated gyrA wildtype 

QRDR sequence. In contrast, four different single bp mutations were identified among the ten 

representative isolates of the subpopulation with the elevated (fluoro)quinolone MICs (Table 2). Three 

single bp mutations resulted in single amino acid substitutions at position 83 of the GyrA protein 

(according to E. coli numbering). Two of them resulted in the same amino acid substitutions: AGC 

CGC or AGC AGA (Ser83 Arg83). The third mutation, AGCATC, resulted in a Ser83 Ile83 

exchange. A fourth mutation (GAC TAC) led to a substitution at position 87 (Asp87 Tyr87). 

Depending on the mutation, the MICs increased 8- to 32-fold for enrofloxacin or 32- to 128-fold for 

nalidixic acid (Table 2). 

3.3 Detection of plasmid-borne antimicrobial resistance genes and sequence analysis 

The resistance genes sul2, strB and dfrA14 and a larger amplicon for the strA gene were detected 

in Y. ruckeri isolate 1521. Linkage PCR assays suggested the insertion of the dfrA14 gene into the strA 

gene of a sul2-strA-strB gene cluster. The same PCR results and sulfamethoxazole MIC 1024 µg/mL 

and sulfamethoxazole/trimethoprim MIC 32/608 µg/mL were obtained for both the Y. ruckeri 1521 

isolate and the E. coli JM107 transformant that carried plasmid pYR1521. The size of this plasmid was 

estimated to be ~8.9 kb. Sequence analysis of the 5,021-bp segment confirmed the insertion of a 568 bp 

dfrA14 gene cassette into the strA gene, which accounted for the larger amplicons detected by the PCR 

118


assays for the strA gene and the linkage of the genes sul2-strA. The strA-strB genes encode 

aminoglycoside phosphotransferases which confer resistance to streptomycin. This has also been 

confirmed by disc diffusion with a 10 µg streptomycin disc (data not shown). However, in this case due 

to the inactivation of the strA gene by the insertion of dfrA14 gene cassette this resistance phenotype 

was not expressed. The sul2 gene encodes a sulfonamide-resistant dihydropteroate synthase and the 

dfrA14 gene a trimethoprim-resistant dihydrofolate reductase. Further sequence analysis identified, 

upstream of sul2, the partial sequence of a repC gene for a replication initiation protein. Downstream of 

the strB gene, an inverted repeat (IR R ) of transposon Tn5393 and the rcr2 gene for a remnant of a 

truncated replication protein of the common region element ISCR2 (formerly designated CR2 element) 

were found (Yau et al. 2010; Anantham and Hall, 2012). The partial sequence of pYR1521 (from 

position 1 to 3,810) including the genes sul2, strA, dfrA14, strB and the IR R of Tn5393 showed 

99-100 % identity to sequences previously found in plasmids from E. coli obtained in Nigeria 

(pSTOJO1, accession number AJ313522.1), Kenya (accession number AJ884725.1), Australia 

(pCERC1, accession number JN012467.1), and in a plasmid of an uncultured bacterium from a 

wastewater treatment plant in Germany (pRSB206, accession number JN102344) (Fig. 1). The 100 % 

identity was seen with the sequence of E. coli plasmid pCERC1, but according to the sequences flanking 

this 3810-bp segment, the plasmids pYR1521 and pCERC1 do not seem to be related otherwise. 

Plasmid pYR1521 seems to be more related to the Salmonella Typhimurium plasmid pSCR15 

(accession number GQ379901) which, however, lacks the insertion of the dfrA14 gene cassette into the 

strA gene. 

119


4. Discussion 

The CLSI guideline VET04-A (CLSI, 2006b) states that in general antimicrobial susceptibility 

testing of bacteria from aquatic animals should be performed either at 22 2 °C with a reading of the 

results after 24-28 h or after 44-48 h. In case an isolate shows poor growth at 22 2 °C, incubation at 28 

2 °C with a reading of the results after 24-28 h is also an approved alternative. In the case of Y. ruckeri, 

we observed good growth after incubation of the inoculated microtitre plates for 24 h at 22 2 °C. The 

MIC values changed only marginally – if at all – when the incubation time was extended by 4 h whereas 

more pronounced changes in the MICs were seen for most antimicrobial agents tested after incubation 

for 48 h. As such, a suggestion is made that Y. ruckeri should be tested at 22 2 °C – which also more 

closely resembles the real life situation than 28 2 °C – and that incubation times longer than 24 h are 

not necessary. 

Although the Y. ruckeri isolates included in this study have been collected during several years 

from a large number of geographically different locations in North West Germany and their molecular 

and phenotypic analysis identified distinct differences (Huang et al., 2013), they showed unimodal MIC 

distributions and low MICs for most of antimicrobial agents tested. However, due the lack of clinical 

breakpoints applicable to Y. ruckeri (CLSI, 2010), the isolates cannot be assigned to any of the three 

categories „susceptible‟, „intermediate‟ or „resistant‟. Nevertheless, the data presented in this study may 

be used in the future to establish epidemiological cut-off values for Y. ruckeri. For this, a larger number 

of isolates obtained from different countries, and tested following the same standardized methodology 

will be necessary. 

120


Three isolates showing elevated colistin MICs belonged to the typing groups 25 and 26, as they 

clustered into PFGE pattern B and showed different band patterns in repetitive sequence-based PCR and 

API 20E profiles, compared other isolates in previous study. (Huang et al., 2013). A clear bimodal 

distribution of the MICs was observed for (fluoro)quinolones, as well as sulfamethoxazole and 

sulfamethoxazole/trimethoprim. The isolates of the subpopulation with the higher MICs were likely to 

harbor acquired or mutational resistance mechanisms to the aforementioned antimicrobial agents. This 

assumption was confirmed by the molecular analysis of representative isolates for resistance-mediating 

mutations or resistance genes. Resistances are known to develop quickly under the selective pressure 

imposed by the application of the respective antimicrobial agents. This can occur either by mutational 

changes in the target genes or by the acquisition of mobile genetic elements that carry resistance genes. 

It has been reported that quinolones and sulfonamides have been used for the treatment of ERM 

outbreaks in aquaculture (Bosse and Post 1983; Bullock et al., 1983; Horsberg et al., 1997; 

Treves-Brown, 2000). 

Gibello and colleagues (2004) described the first substitution in the QRDR region of the GyrA 

protein in Y. ruckeri isolates. It was a single amino acid substitution, Ser-83 Arg-83 (E. coli 

numbering) and the isolates exhibited reduced susceptibility to nalidixic acid and oxolinic acid. 

Recently, the same mutation was observed with of Y. ruckeri in Norway. However, no mutations were 

found in QRDR of other target genes, such as gyrB, parC and parE (Shah et al., 2012). Substitutions in 

QRDR at position 83 and 87 of the GyrA protein have been commonly reported in other Gram-negative 

bacteria. Such substitutions are usually related to reduced susceptibility to fluoroquinolones (Eaves et al., 

2004; Sihvonen et al., 2011). The substitution Ser-83 Arg-83, found in this study, has already been 

121


reported in Y. ruckeri (Shah et al., 2012) and Y. enterocolitica (Sihvonen et al., 2011). However, this is, 

to the best of our knowledge, the first description of the substitution Asp87 Tyr87 in Y. ruckeri. 

Resistance to both trimethoprim and sulfonamides is widely disseminated among all major species 

of bacteria. So far, many resistant bacteria have been reported worldwide, including various 

fish-pathogenic Aeromonas spp. (Kadlec et al., 2011) and Y. ruckeri isolates (De Grandis and Stevenson, 

1985; Welch et al., 2007). It has been reported that the sul2-strA-strB gene cluster arose from the 

transposition of transposon Tn5393 (harboring strA-strB gene cluster) in the ISCR2-sul2 region 

followed by a partial deletion of both Tn5393 and ISCR2 (Yau et al. 2010). Interestingly, the multidrug 

resistance plasmid pYR1 (accession number NC_009139.1) of Y. ruckeri YR71 harbors the strA-strB 

gene cluster (location 136,344 - 137,147 bp) and the ISCR2-sul2 configuration (32,085-33,635 bp) 

located about 102 kb apart from each other (Welch et al., 2007). So far, few reports described the 

dfrA14 gene cassette integrated into the strA gene and all these reports referred to Enterobacteriaceae or 

an uncultured bacterium (Ojo et al., 2002; Anantham and Hall, 2012; Eikmeyer et al., 2012). This is to 

the best of our knowledge, the first description of the presence of a dfrA14 gene cassette at this 

particular secondary site in Y. ruckeri. According to the sequence analysis, all of the 

non-integron-associated dfrA14 gene cassettes were integrated at a secondary site (GATAT) in the strA 

gene (Ojo et al., 2002; Kikuvi et al., 2007; Anantham and Hall, 2012; Eikmeyer et al., 2012). The highly 

conserved sequence of the dfrA14 gene, its 59-base element and the whole segment from sul2 gene to 

the IR R of Tn5393 (Fig. 1a-b) on unrelated plasmids from diverse bacteria and sources (clinical or 

non-clinical, human or animals) in different continents suggest a common origin and/or en bloc 

dissemination of the sul2-strA-dfrA14-strA-strB gene cluster. Noteworthy, in North West Germany 

122


this cluster was found on the small transferable plasmid pYR1521 from Y. ruckeri obtained in 2011 

from a rainbow trout and has been reported in 2012 to be located on the larger conjugative 

multi-resistance plasmid pRSB206 of an unculturable bacterium obtained from a wastewater treatment 

plant (Eikmeyer et al., 2012). 

5. Conclusion 

Incubation for 24 h at 22 ± 2 °C appears to be sufficient for susceptibility testing of Y. ruckeri. 

The largely unimodal MIC distribution suggests that most of the isolates tested represent the wildtype 

population that has not acquired resistance mechanisms. Exceptions were the isolates with elevated 

(fluoro)quinolone MICs that also had resistance-mediating mutations in the QRDR region of gyrA gene 

and a single isolate that carried plasmid-borne sul2, dfrA14, strA and strB genes. These observations 

confirmed that Y. ruckeri is able to develop mutations for reduced susceptibility to (fluoro)quinolone, 

but can also acquire plasmid-borne resistance genes. 

123



The authors acknowledge the generous support of Dr. W. Schäfer and D. Mock (Fish Health 

Service, North Rhine-Westphalia) during the sample collection in aquaculture ponds. Moreover, the 

authors thank Dr. S. Braune (LAVES, Lower Saxony), Dr. C. Gould (MSD Animal Heath, UK) and Dr. 

A. Nilz (LHL, Hessen) for providing Yersinia ruckeri isolates. 

Funding 

This study was financially supported by the Landesamt für Natur, Umwelt und Verbraucherschutz 

Nordrhein-Westfalen (LANUV, North Rhine-Westphalia). Y. Huang received a scholarship by the 

China Scholarship Council. 

Transparency declarations 

None to declare 

References 

Anantham, S., Hall, R.M., 2012. pCERC1, a small, globally disseminated plasmid carrying the dfrA 14 

cassette in the strA gene of the sul2-strA-strB gene cluster. Microb. Drug Resist. 18, 364-371. 

Angulo, F., 2000. Antimicrobial agents in aquaculture: protential impact on public health. APUA Newsl. 

18, 1-5. 

Barnard, F.M., Maxwell, A., 2001. Interaction between DNA gyrase and quinolones: effects of alanine 

mutations at GyrA subunit residues Ser83 and Asp87. Antimicrob. Agents Chemother. 45, 

1994-2000. 

124


Bosse, M.P., Post, G., 1983. Tribrissen and tiamulin for control of enteric redmouth disease. J. Fish Dis. 6, 

27-32. 

Bullock, G.L., Maestrone, G., Starliper, C., Schill, B., 1983. Potentiated sulfonamide therapy of enteric 

redmouth disease. Can. J. Fish. Aquat. Sci. 40, 101-102. 

Bywater, R., Silley, P., Simjee, S., 2006. Antimicrobial breakpoints – definitions and conflicting 

requirements. Vet. Microbiol. 118, 158-159. 

CLSI. 2006a. Methods for antimicrobial disk susceptibility testing of bacteria isolated from aquatic 

animals; approved guideline. CLSI document VET03-A. Clinical and Laboratory Standards 

Institute; Wayne, PA, USA. 

CLSI. 2006b. Methods for broth dilution susceptibility testing of bacteria isolated from aquatic animals; 

approved guideline. CLSI document VET04-A. Clinical and Laboratory Standards Institute; 

Wayne, PA, USA. 

CLSI. 2010. Performance standards for antimicrobial susceptibility testing of bacteria isolated from 

aquatic animals; first informational supplement. CLSI document VET03/VET04-S1. Clinical and 

Laboratory Standards Institute; Wayne, PA, USA. 

De Grandis, S.A., Stevenson, R.M.W., 1985. Antimicrobial susceptibility patterns and R 

plasmid-mediated resistance of the fish pathogen Yersinia ruckeri. Antimicrob. Agents Chemother. 

27, 938-942. 

Eaves, D.J., Randall, L., Gray, D.T., Buckley, A., Woodward, M.J., White, A.P., Piddock, L.J.V., 2004. 

Prevalence of mutations within the Quinolone Resistance-Determining Region of gyrA, gyrB, parC, 

and parE and association with antibiotic resistance in quinolone-resistant Salmonella enterica. 

Antimicrob. Agents Chemother. 48, 4012-4015. 

Eikmeyer, F., Hadiati, A., Szczepanowski, R., Wibberg, D., Schneiker-Bekel, S., Rogers, L.M., Brown, 

C.J., Top, E.M., Puhler, A., Schluter, A., 2012. The complete genome sequences of four new IncN 

plasmids from wastewater treatment plant effluent provide new insights into IncN plasmid 

diversity and evolution. Plasmid 68, 13-24. 

125


Feßler, A.T., Olde Riekerink, R.G., Rothkamp, A., Kadlec, K., Sampimon, O.C., Lam, T.J., Schwarz, S., 

2012. Characterization of methicillin-resistant Staphylococcus aureus CC398 obtained from 

humans and animals on dairy farms. Vet. Microbiol. 160, 77-84. 

Gebreyes, W.A., Altier, C., 2002. Molecular characterization of multidrug-resistant Salmonella enterica 

subsp. enterica serovar Typhimurium isolates from swine. J. Clin. Microbiol. 40, 2813-2822. 

Gibello, A., Porrero, M.C., Blanco, M.M., Vela, A.I., Liébana, P., Moreno, M.A., Fernández-Garayzábal, 

J.F., Domínguez, L., 2004. Analysis of the gyrA gene of clinical Yersinia ruckeri isolates with 

reduced susceptibility to quinolones. Appl. Environ. Microbiol. 70, 599-602. 

Grape, M., Sundström, L., Kronva, G., 2003. Sulphonamide resistance gene sul3 found in Escherichia 

coli isolates from human sources. J. Antimicrob. Chemother. 52, 1022-1024. 

Horsberg, T.E., Martinsen, B., Sandersen, K., Zernichow, L., 1997. Potentiated sulfonamides: In vitro 

inhibitory effect and pharmacokinetic properties in atlantic swalmon in seawater. J. Aqua. Ani. 

Health. 9, 203-210. 

Huang, Y., Runge, M., Michael, G.B., Schwarz, S., Jung, A., Steinhagen, D., 2013. Biochemical and 

molecular heterogeneity among isolates of Yersinia ruckeri from rainbow trout (Oncorhynchus 

mykiss, Walbaum) in North West Germany. BMC Vet. Res. 9, 

215; doi:10.1186/1746-6148-9-215 (published: 21 October 2013). 

Kadlec, K., Kehrenberg, C., Schwarz, S., 2005. Molecular basis of resistance to trimethoprim, 

chloramphenicol and sulphonamides in Bordetella bronchiseptica. J. Antimicrob. Chemother. 56, 

485-490. 

Kadlec, K., Czapiewski, E.v., Kaspar, H., Wallmann, J., Michael, G.B., Steinacker, U., Schwarz, S., 2011. 

Molecular basis of sulfonamide and trimethoprim resistance in fish-pathogenic Aeromonas isolates. 

Appl. Environ. Microbiol. 77, 7147-7150. 

126


Kehrenberg, C., Schwarz, S., 2001. Occurence and linkage of genes coding for resistance to 

sulphonamides, streptomycin and chloramphenicol in bacteria of the genera Pasteurella and 

Mannheimia. FEMS Microbiol. Lett. 205, 283-290. 

Kikuvi, G.M., Schwarz, S., Ombui, J.N., Mitema, E.S., Kehrenberg, C., 2007. Streptomycin and 

chloramphenicol resistance genes in Escherichia coli isolates from cattle, pigs, and chicken in 

Kenya. Microb. Drug Resist. Spring 13, 62-68. 

Macrina, F.L., Kopecko, D.J., Jones, D.J., Ayers, D.J., McCowen, S.M., 1978. A multiple 

plasmid-containing Escherichia coli strain: convenient source of size reference plasmid molecules. 

Plasmid 1, 417-420. 

Miller, R.A., Walker, R.D., Baya, A., Clemens, K., Coles, M., Hawke, J.P., Henricson, B.E., Hsu, H.M., 

Mathers, J.J., Oaks, J.L., Papapetropoulou, M., Reimschuessel, R., 2003. Antimicrobial 

susceptibility testing of aquatic bacteria: quality control disk diffusion ranges for Escherichia coli 

ATCC 25922 and Aeromonas salmonicida subsp. salmonicida ATCC 33658 at 22 and 28 C. J. 

Clin. Microbiol. 41, 4318-4323. 

Miller, R.A., Walker, R.D., Carson, J., Coles, M., Coyne, R., Dalsgaad, I., Gieseker, C., Hsu, H.M., 

Mathers, J.J., Papapetropoulou, M., Petty, B., Teitzel, C., Reimschuessel, R., 2005. Standardization 

of a broth microdilution susceptibility testing method to determine minimum inhibitory 

concentrations of aquatic bacteria. Dis. Aquat. Org. 64, 211-222. 

Noga, E.J., 2010. Fish Disease: Diagnosis and Treatment. 2. Edition. Wiley-Blackwell, Iowa, pp. 

197-199. 

Ojo, K.K., Kehrenberg, C., Schwarz, S., Odelola, H.A., 2002. Identification of a complete dfrA14 gene 

cassette integrated at a secondary site in a resistance plasmid of uropathogenic Escherichia coli 

from Nigeria. Antimicrob. Agents Chemother. 46, 2054-2055. 

Rigos, G., Troisi, G.M., 2005. Antibacterial agents in Mediterranean finfish farming: A synopsis of drug 

pharmacokinetics in important euryhaline fish species and possible environmental implications. 

Rev. Fish. Biol. Fisher. 15, 53-73. 

127


Rodgers, C.J., 2001. Resistance of Yersinia ruckeri to antimicrobial agents in vitro. Aquaculture. 196, 

325-345. 

Schwarz, S., Silley, P., Simjee, S., Woodford, N., van Duijkeren, E., Johnson, AP., Gaastra, W., 2010. 

Assessing the antimicrobial susceptibility of bacteria obtained from animals. Vet. Microbiol. 141, 

1-4. 

Shah, S.Q.A., Karatas, S., Nilsen, H., Steinum, T.M., 2012. Characterization and expression of the gyrA 

gene from quinolone resistant Yersinia ruckeri strains isolated from Atlantic salmon (Slamo salar 

L.) in Norway. Aquaculture 350, 37-41. 

Sihvonen, L.M., Toivonen, S., Haukka, K., Kuusi, M., Skurnik, M., Siitonen, A., 2011. Multilocus 

variable-number tandem-repeat analysis, pulsed-field gel electrophoresis, and antimicrobial 

susceptibility patterns in discrimination of sporadic and outbreak-related strains of Yersinia 

enterocolitica. BMC Microbiol. 11, 1-10. 

Treves-Brown, K.M., 2000. Applied Fish Pharmacology. Kluwer Academic publishers, London, pp.118. 

Welch, T.J., Fricke, W.F., McDermott, P.F., White, D.G., Rosso, M.L., Rasko, D.A., Mammel, M.K., 

Eppinger, M., Rosovitz, M.J., Wagner, D., Rahalison, L., Leclerc, J.E., Hinshaw, J.M., Lindler, 

L.E., Cebula, T.A., Carniel, E., Ravel, J., 2007. Multiple antimicrobial resistance in plague: an 

emerging public health risk. PLoS ONE 2, e309. 

Yau, S., Liu, X., Djordjevic, S.P., Hall, R.M., 2010. RSF1010-like plasmids in Australian Salmonella 

enterica serovar Typhimurium and origin of their sul2-strA-strB antibiotic resistance gene cluster. 

Microb. Drug Resist. 16, 249-252. 

128


Table 1: 

MIC distribution of antimicrobial agents, MIC 50 and MIC 90 values of Yersinia ruckeri isolates from North West Germany and the type 

strain Y. ruckeri DSM 18506 (n=83) after incubation times of 24 and 48 h at 22 ± 2 °C. The white area between the two grey-shaded 

areas indicates the range of test concentrations. The numbers in the right-hand grey-shaded area indicate the numbers of isolates that 

grew in the highest test concentration. 

Antimicrobial Incubation Number of isolates with MIC (µg/mL) of: 

MIC (µg/mL) 

Agent a time (h) ≤0.008 0.015 0.03 0.06 0.12 0.25 0.5 1 2 4 8 16 32 64 128 256 512 ≥1024 MIC 50 MIC 90 

NAL 24 9 2 3 65 4 16 16 

48 7 4 1 31 31 1 16 32 

ENR 24 8 3 18 52 2 0.12 0.12 

48 7 4 3 66 3 0.12 0.12 

SMX 24 82 1 16 16 

48 82 1 16 16 

SXT 24 29 49 4 1 0.06 0.06 

48 8 69 5 1 0.06 0.06 

APR 24 19 62 2 4 4 

48 7 48 27 1 4 8 

GEN 24 26 57 1 1 

48 14 50 20 1 2 

PEN 24 1 61 21 1 16 32 

48 9 71 3 32 32 

AMP 24 70 12 1 1 2 

48 22 59 2 2 2 

AUG 24 2 81 2 2 

129


48 62 21 2 4 

Antimicrobial Incubation Number of isolates with MIC (µg/mL) of: 

MIC (µg/mL) 

Agent a time (h) ≤0.008 0.015 0.03 0.06 0.12 0.25 0.5 1 2 4 8 16 32 64 128 256 512 ≥1024 MIC 50 MIC 90 

CEP 24 83 32 32 

48 73 10 32 32 

XNL 24 70 13 0.25 0.25 

48 11 70 2 0.5 0.5 

FOT 24 77 6 0.06 0.06 

48 27 55 1 0.12 0.12 

FOP 24 2 70 11 0.25 0.25 

48 1 31 49 2 0.5 0.5 

CEQ 24 3 76 4 0.06 0.06 

48 2 58 23 0.06 0.12 

IMP 24 83 0.12 0.12 

48 81 2 0.12 0.12 

TIA 24 53 25 5 16 32 

48 4 65 12 2 32 64 

SPI 24 48 29 6 64 128 

48 15 46 22 128 256 

TIL 24 36 42 4 1 64 64 

48 19 46 16 2 64 128 

TUL 24 6 62 10 5 16 32 

48 39 36 7 1 32 32 

CHL 24 11 72 4 4 

48 80 3 4 4 

FFN 24 71 11 1 2 2 

48 20 62 1 4 4 

130


COL 24 59 19 2 3 0.25 0.5 

48 58 20 2 3 0.25 0.5 

TET 24 21 62 1 1 

48 67 16 1 2 

DOX 24 26 57 0.5 0.5 

48 82 1 0.5 0.5 

a NAL: nalidixic acid, ENR: enrofloxacin, SMX: sulfamethoxazole, SXT: sulfamethoxazole/trimethoprim (19: 1), APR: apramycin, GEN: gentamicin, PEN: penicillin, 

AMP: ampicillin, AUG: amoxicillin/clavulanic acid (2:1), CEP: cefalotin, XNL: ceftiofur, FOT: cefotaxime, FOP: cefoperazone, CEQ: cefquinome, IMP: imipenem, 

TIA: tiamulin, SPI: spiramycin, TIL: tilmicosin, TUL: tulathromycin, CHL: chloramphenicol, FFN: florfenicol, COL: colistin, TET: tetracycline, DOX: doxycycline. 

131


Table 2: 

Characteristics of Y. ruckeri isolates, their (fluoro)quinolone 

MICs and their GyrA protein substitutions in the QRDR 

Isolate Fish species Isolation Origin of MIC (µg/mL) GyrA substitution e 

no. 

a 

(year) isolates b ENR c NAL d (gyrA mutations) 

111-1 NS 2005 LS ≤0.008 0.25 - 

L-1 RT 2011 NRW ≤0.008 0.25 - 

285-1 Pike 2005 LS 0.015 0.5 - 

115-1 RT 2005 LS 0.06 8 Asp87Tyr 

201-1 RT 2008 LS 0.06 32 Ser83Arg (CGC) 

72-2 RT 2005 LS 0.12 16 Ser83Arg (CGC) 

SRT2-2 RT 2012 NRW 0.12 16 Ser83Arg (CGC) 

3279 RT 2010 HS 0.12 32 Ser83Arg (AGA) 

339-1 RT 2005 LS 0.12 16 Ser83Arg (AGA) 

B1 RT 2011 NRW 0.12 32 Ser83Arg (AGA) 

lay3 RT 2011 NRW 0.12 16 Ser83Arg (AGA) 

204-1 Brown trout 2004 LS 0.25 32 Ser83Ile 

70-1 Koi 2005 LS 0.25 32 Ser83Ile 

a 

NS: not specified, RT: rainbow trout; b LS: Lower Saxony, NRW: North Rhine-Westphalia, 

HS: Hessen; c ENR: enrofloxacin; d NAL: nalidixic acid; e Numbering system according to 

Escherichia coli. 

132


(a) 

Integration site of dfrA14 gene cassette 

into the strA gene 

-G ATAT- 

pSCR15 

pYR1521 

sul2 strA 

strB rcr2 (5„ end) 

sul2 

strB 

rcr2 (5„ end) 

pCERC1 

sul2 

strB 

pSTOJO1 

rcr2 

(patial sequence) 

pRSB206 

sul2 

strB 

500 

(b) 

strA 

(5„ end) 

dfrA14 

strA 

(3„ end) 

2R 

GCAGCGATA-GTTAGC-GCC-TTTTTCC--GCATCACGCGC 

1R 

stop | ||||| |||||| ||| |||||| ||| | ||| T 

TTAACCCAGGATGAGAACCTTGAAA- -GGTTAACAAAGCTATGCAATCGACGGCAAAAAGCTTCGT--T-CGCT 

RBS start 

dfrA14 

1L 

2L 

59-base element 

dfrA14 gene cassette 

Fig 1. (a) Structural organization and alignment of segments of plasmids pSCR15 

(accession number GQ379901), pYR1521 (accession number HG423538), pCERC1 

(accession number JN012467.1), pSTOJO1 (accession number AJ313522.1) and pRSB206 

(accession number JN102344). The arrows represent the coding reading frames of genes 

sul2, strA, dfrA14, strB and rcr2. The arrowheads indicate the direction of transcription. 

The gray areas show matches between the segments, 99 or 100% identity was found in these 

areas. The vertical black bars represent the IR R of Tn5393. Sequence of strA gene (GATAT) 

involved in the integration of dfrA14 gene cassette. (b) Structure of the dfrA14 gene cassette 

inserted into the strA gene. Coding reading frames of dfrA14 gene is represented by an 

arrow. The ribosome biding site (RBS), start and stop codons are underlined. The 59-base 

element is shown in boldface and the integrase biding domains (1R, 2R, 2L and 1L) are 

indicated by arrows. 

133

134

Chapter 7. General Discussion 

135

Chapter 7 General discussion 

General Discussion 

This project investigated Yersinia ruckeri collected from trout hatcheries in North West 

Germany from 2004 to 2012 with regard to (1) their genetic and phenotypic diversity 

correlated with epidemiological factors, and (2) their resistance to antimicrobial substances. 

Since the first occurrence of non-motile Y. ruckeri isolates was reported (AUSTIN et al. 2003), 

isolates with this biological trait have already spread over most European countries (AUSTIN 

et al. 2003; FOUZ et al. 2006; BASTARDO et al. 2012), as well as in American countries, 

such as USA (ARIAS et al. 2007) and Chile(BASTARDO et al. 2011). In recent years, 

non-motile strains caused outbreaks of enteric redmouth disease in the winter period in North 

West Germany and attracted the attention of the local fish health department. 

7.1 Non-motile Yersinia ruckeri 

Y. ruckeri infection were usually caused by the motile „Hagerman‟ strain (DAVIES 1991). 

This „Hagerman‟ strain is belonged to serotype O1 (DAVIES 1991), and provided the basis 

for the development of successful vaccines since the 1970ies (STEVENSON 1997). These 

vaccines were used effectively to control outbreaks caused by motile Y. ruckeri for three 

decades, until the non-motile Y. ruckeri variant emerged and was reported have a reduced 

sensitivity to immersion vaccination (AUSTIN et al. 2003). The new non-motile variant, 

belonging to serotype O1 as well, established a new biotype for Y. ruckeri, biotype 2, and 

caused outbreaks in previously vaccinated ponds (AUSTIN et al. 2003). It was believed that 

the non-motile strain might have evolved from a related motile one (BASTARDO et al. 2012). 

Although the Hagerman strain and the non-motile variant belong to the same serotype, they 

made up different clonal groups, clone 2 for the non-motile variant and clone 5 for the 

Hagerman strain, on the basis of biotype and outer membrane protein (OMP) typing 

(DAVIES 1991). There was no report in the 1980s about non-motile isolates from other 

serotypes (DAVIES and FRERICHS 1989). However, recently, biotype 2 isolates were also 

identified within other seroptypes besides O1 (J W TINSLEY et al. 2011). Non-motile strains 

were dominant in North West Germany. In field study of the present investigation, motile 

strains were found present only in fish farm L. 

Bacteria from the non-motile strain, as the name indicates, are lacking motility due to the 

absence of flagella (AUSTIN et al. 2003). Unlike biotype 1, these biotype 2 isolates cannot 

hydrolyze tween 80 and tween 20 (DAVIES and FRERICHS 1989). Thus, tween 80 

136


hydrolysis is used as one of the methods to identify non-motile isolates. Moreover, the 

lipopolysaccharide (O antigen) type of non-motile variants was found different from other 

motile isolates (J W TINSLEY et al. 2011). 

7.2 Analysis of typing methods 

Different typing methods were applied in this study in order to analyse intraspecies diversity 

of Y. ruckeri isolates from North West Germany. 

The API system is a simplified biochemical identification kit for bacteria. Three API kits are 

available for identifying enterobacteria, namely, a screening kit of 10 tests (10S), a basic set 

of 20 tests (20E), and of 50 tests (50E)(HOLMES et al. 1978), among which the API 20E is 

used often for the identification of Y. ruckeri. Although the non-motile strain found in Spain 

shared the same API 20E profile of 5307100 (FOUZ et al. 2006) with some non-motile 

isolates in the study, it is difficult to separate non-motile strains from motile only according to 

API 20E profiles, because non-motile strains do not exhibit specific API 20E profiles (J W 

TINSLEY et al. 2011). In this study during biochemical identification, the API profile 

5307100 was exhibited by some motile isolates as well. Eight different numeric profiles were 

obtained from the North West German isolates with a discriminatory power of 0.763. 

PCR-based DNA fingerprinting methods for a differentiation of microorganisms have been 

established by using different primers. Repetitive-sequence-based PCRs (rep-PCR) are based 

on the binding of primers to specific regions of the DNA and when this binding happens in 

the right orientation with an optimum distance, species- or strain- specific amplicons could be 

generated and observed (MALATHUM et al. 1998). So far, different rep-PCRs were used in 

the evaluation of the intraspecific diversity of particular bacteria and were considered as a 

useful molecular technique (VERSALOVIC et al. 1991; MOHAPATRA and MAZUMDER 

2008). For instance, the repetitive extragenic palindromic-PCR coupled with (GTG) 5 primers 

[(GTG) 5 -PCR] was reported as a complementary molecular tool for the rapid determination of 

Escherichia coli (MOHAPATRA et al. 2008) and Enterococcus spp. (ŠVEC et al. 2005). 

Enterobacterial repetitive intergenic consensus sequences (ERIC-PCR) generate multiple 

distinct amplification products ranging from around 50bp to 3000bp (DI-GIOVANNI et al. 

1999) and the ERIC elements are distributed throughout the extragenic regions of many 

Gram-negative bacterial genomes (HULTON et al. 1991). Other two rep-PCRs used in this 

study to differentiate Y. ruckeri isolates were repetitive extragenic palindromic PCR 

137


(REP-PCR) and BOX-PCR, which was based on a 154-bp BOX element (KOETH et al. 

1995). REP and BOX elements may play an important role in the organization of the bacterial 

genome (KRAWIEC and RILEY 1990; LUPSKI and WEINSTOCK 1992). In this study, 

ERIC-PCR turned out to be the most effective rep-PCR to investigate Y. ruckeri isolates with 

several distinct bands. However, the discriminatory index of rep-PCRs was lower than 0.2, 

indicating the intraspecies diversity was not clearly shown via rep-PCRs. 

Although the sensitivity and the discriminatory power of pulsed-field electrophoresis (PFGE) 

rely on the bacterial species and the restriction enzyme used, it could permit PFGE to be a 

useful tool for clustering and differentiating many bacterial pathogens (SKOV et al. 1995; 

GARCIA et al. 2000; ARAL et al. 2007). Compared with rep-PCRs, pulsed-field 

electrophoresis with the restriction enzyme NotⅠ is a powerful tool to differentiate Y. ruckeri 

isolates. When all the typing methods combined together, a more systematic category was 

formed, including 27 different groups, providing the basis for the selection of isolates to be 

analysed for cytotoxicity in vitro. 

7.3 Relationship among phenotypic and genetic traits and epidemiological 

characteristics 

Biochemically, a fatty acid is an either saturated or unsaturated carboxylic acid with a long 

aliphatic chain. As one phenotypic trait, fatty acids of microorganisms are chemically 

complex and metabolically active (O'LEARY 1962). Although the fatty acid composition 

differs markedly between lab-cultured bacteria and those growing in the natural environment 

(O'LEARY 1962), it doesn‟t hinder the analysis of the fatty acid composition to become a tool 

to identify specific bacteria. There were several reports about bacterial identification on the 

basis of cellular fatty acid composition (CANONICA and PISANO 1985; OSTERHOUT et al. 

1991; SHOEMAKER et al. 2013). Leclercq et al (LECLERCQ et al. 2000) found that the 

fatty acid composition of Yersinia pestis is very homogeneous. Furthermore, the ratio for 

12:0/16:0 and 14:0/16:0 fatty acids could be used for differentiating pathogenic Yersinia 

enterocolitica isolates, and for separating Yersinia pseudotuberculosis and Y. pestis strains 

(LECLERCQ et al. 2000). It is interesting to study the fatty acid profiles of North West 

German Y. ruckeri isolates and its connection with epidemiological parameters. From 

obtained in the present study, Y. ruckeri isolates shared also homogeneous fatty acid profiles. 

Considering the biochemical traits and biotypes together with the fatty acid profiles, no 

138


specific relationship was found. Isolates positive for sorbitol fermentation were mainly 

obtained from other fish species rather than rainbow trout and all of these isolates were motile. 

There were only two isolates from rainbow trout found positive for sorbitol fermentation. One 

of these isolates was obtained during the field study and it shared the same biochemical and 

genetic traits as the one isolate obtained from a brown trout. Interestingly, brown trouts were 

also cultivated in the same farm. It was proven that Y. ruckeri isolates were not species 

specific for particular fish species. 

From previous results published on pulsotyping of Y. ruckeri, it is suggested that serotype O1 

isolates in UK and in mainland Europe were from different and non-overlapping 

subpopulations (WHEELER et al. 2009). Recently, one isolate from Germany was found 

dispersed from other two main clusters by using multilocus sequence typing (MLST) 

(BASTARDO et al. 2012), indicating that this German isolate might not be derived from the 

same clonal complexes as other isolates from different countries. In the present study, all 

isolates were local North West German ones, and variations among different isolates were 

still observed. There was no difference in pulsotype between biotype 1 and 2 strains. Isolates 

from rainbow trout clustered together in the PFGE dendrogram. Great differences were shown 

among isolates from different fish hosts. Most isolates in the same pulsotype distributed 

equally in North West Germany. When all the typing methods were combined together, two 

groups of isolates could be found in Lower Saxony, Hessen and North Rhine-Westphalia. 

7.4 Cytotoxicity and Virulence genes 

In vitro culture of fish cells can be traced back to the early 1960s, and cultivated cells were 

derived from rainbow trout, fathead minnow and blue-striped grunt (WOLF and QUIMBY 

1969). More fish cell lines were added to the list later (HIGHTOWER and RENFRO 1988; 

FRYER and LANNAN 1994; OTT 2004). Rachlin and Perlmutter (RACHLIN and 

PERLMUTTER 1968) investigated for the first time the use of cultured fathead minnow 

epithelial cells (FHM) in a cytotoxicity assay. Nonetheless, in vitro cytotoxicity is not 

comparable with in vivo data (BABICH and BORENFREUND 1991). It was reported in 

previous studies that in cytotoxicity tests Y. ruckeri isolates have a preference for particular 

cell lines, for instance a strong host cell preference for Fathead minnow epithelial (FHM) 

cells, but not for human derived Hep-2 cells (KAWULA et al. 1996). Y. ruckeri was reported 

to be able to adhere to and invade into cells from the chinook salmon embryo (CHSE-214) 

and rainbow trout liver cell lines (R1)(TOBBACK et al. 2010). In the present study, four 

139


common fish cell lines: common carp brain (CCB), epithelioma papulosum cyprini (EPC), 

FHM and rainbow trout gonad (RTG-2) cells, were used to perform cytotoxicity tests in vitro. 

Isolates from all 27 typing groups showed a strong preference for FHM and EPC cells. 

However, they caused a lower cytotoxicity to rainbow trout gonad cells. Since one trait of this 

non-motile strain is that it can cause ERM outbreaks even in winter, two incubation 

temperatures were tested in this study, and the results indicated that non-motile Y. ruckeri 

isolates were more active in the first 24 hours at lower temperature. The data also showed that 

non motile isolates had the same ability to cause cytotoxicity in vitro as motile isolates. The 

data also underlined that the flagellum is not necessary for Y. ruckeri virulence. 

Although it was reported earlier that flagellin may not be required for proinflammatory innate 

immune response in rainbow trout by Y. ruckeri (JOHN TINSLEY 2010), it is still interesting 

to study flagellar genes and their expression in non-motile isolates. Non-motile knock-out 

mutants of Y. ruckeri with the absence of specific flagellar genes were usually constructed to 

study gene function (YOUNG et al. 1999; EVENHUIS et al. 2009). However, in real 

non-motile strain, the flagellar genes were still present but stay unfunctional, and there was no 

great difference of flagellar gene expression between motile and non-motile strains. It was 

suggested that the lack of motility in biotype 2 strains may not just rely on the absence of 

certain flagellar genes, nor a lower expression of flagellar genes, but probably due to complex 

mechanisms. 

According to Secades and Guijarro, the extracellular serralysin metalloprotease Yrp1 was 

identified in some Y. ruckeri isolates, leading to the classification into two different groups: 

Azo + (presence of the Yrp1 proteolytic activity) and Azo - ( absence of the Yrp1 proteolytic 

activity)(SECADES and GUIJARRO 1999). All isolates from the present study were found 

positive for the yrp1 gene by means of PCR detection, indicating that they belong to the Azo + 

group. 

7.5 Antimicrobial resistance of Y. ruckeri 

In previous studies by Rucker (RUCKER 1966), sulphamethazine, chloramphenicol and 

oxytetracycline, followed by oxolinic acid (RODGERS and AUSTIN 1983) were 

recommended for the treatment of enteric redmouth disease, caused by Y. ruckeri. However, 

the potential risk of misuse of antimicrobial agents in treatment of ERM and the presence of 

resistant isolates could not be overlooked. As early as 1987, Post (POST 1987) already 

mentioned Y. ruckeri isolates which were resistant to the therapeutic level of both 

140


sulphamethazine and oxytetracycline. Rodgers (RODGERS 2001) found a potential ability of 

Y. ruckeri to be resistant to oxolinic acid, oxytetracycline and the potentiated sulphonamide 

after 15 subcultures. In the present study, for enrofloxacin and nalidixic acid, a bimodal MIC 

distribution was observed with one population showing MICs of 0.008-0.015 mg/L of 

enrofloxacin and 0.25-0.5 mg/L of nalidixic acid, respectively, and the other subpopulation 

exhibiting MICs of 0.06-0.25 mg/L of enrofloxacin and 8-64 mg/L of nalidixic acid, 

respectively. And a single isolate showed high MIC values for sulfamethoxazole and 

sulfamethoxazole/trimethoprim. 

7.5.1 Quinolone resistance 

For nalidixic acid, as a quinolone derivative, a bactericidal activity was first found in 1962 

(LESCHER et al. 1962). Since then, as a result of its wide spectrum of activity, several 

generations of quinolones were developed and used widely. In bacteria, there are two main 

chromosomal-mediated mechanisms of quinolone resistance: alterations in the targets of 

quinolones, and decreased accumulation inside the bacterial cell because of an impermeability 

of the membrane and/or an overexpression of afflux pump systems (RUIZ 2003). Generally, 

the quinolone target in Gram-negative bacteria is the DNA gyrase, encoded by gyrA and gyrB 

genes, and is topoisomerase Ⅳ (encoded by the parC and parE genes) in Gram-positive 

bacteria (RUIZ 2003). Nucleotide substitutions varied from different positions in the sequence 

of GyrA, and this section is recognized as quinolone resistance-determining region (QRDR) 

since 1990 (YOSHIDA et al. 1990). It is also reported that the presence of a single mutation 

of QRDR usually leads to a high-level resistance to nalidixic acid, but additional mutation(s) 

in the gyrA sequence is needed for a high level of resistance to fluoroquinolones (VILA et al. 

1994; RUIZ et al. 2002). In this study, three different substitutions were found in QRDR at 

different positions, contributing to different quinolone susceptibility levels. It is suggested 

that the substitution of different amino acids may influence in various ways the affinity of the 

enzyme for the quinolone molecule, or even the interaction of this enzyme with quilonones by 

affecting the whole protein structure (RUIZ 2003). 

7.6.2 Trimethoprim/Sulfonamides resistance 

Sulfonamides are synthetic chemicals and were used effectively for the treatment of bacterial 

disease for a long period of time. Sulfamethoxazole, combined with trimethoprim is an 

example for the current generation of sulfa drugs. In contrary to eukaryotes, bacteria need to 

synthetise the folate skeleton de novo. Sulfonamides and trimethoprim play the role in 

141


blocking a step in folic acid metabolism by either acting as a competitive inhibitor of 

para-aminobenzoic acid (PABA) in dihydropteroate synthesis, or by blocking the enzymatic 

recycling of the folate coenzymes (NEU and GOOTZ 1996; BERMINGHAM and DERRICK 

2002). The resistance to both sulfonamides and trimethoprim is due to a horizontal and 

resistant gene flow among bacteria (SKOELD 2001). There are two types of resistance to 

sulfonamides and trimethoprim: plasmid-borne and a chromosomal mutation (SKOELD 

2001). The former was observed often in different cases (GALIMAND et al. 1997; 

PERRETEN and BOERLIN 2003). The plasmid-borne genes sul1 and sul2 are associated 

with the long known and very common sulfonamide resistance in Gram-negative bacteria 

(SKOELD 2001). In the present study, a ~8.9 kb plasmid was found in a single 

sulfonamides/trimethoprim resistant Y. ruckeri isolate, carrying the genes sul2, strB and a 

dfrA14 gene cassette integrated into the strA gene. The plasmid was transformable and the 

resistant traits could be inherited by recipient bacteria, indicating the potential risk of a wider 

spreading of sulfonamide/thrimethoprim resistant Y. ruckeri isolates. 

7.6 Conclusions 

In fishes from aquaculture ponds in North West Germany, non-motile strains of Y. ruckeri 

were dominant, especially in winter. Two or more different Y. ruckeri isolates were present in 

most farms visited in field study. Among the 27 typing groups of Y. ruckeri, only two groups 

were found distributed in the three federal states. The fatty acid composition of Y. ruckeri 

isolates was homogenous. Y. ruckeri isolates were more cytotoxic to EPC and FHM cells. 

There were no significant differences between non-motile and motile strains of Y. ruckeri on 

either the presence of virulence genes detected in this study or by the expression of these 

genes. Most of the isolates from North West Germany have not acquired resistance 

mechanisms. However, Y. ruckeri could still develop mutations for (fluoro) quinolone 

resistance, but is also able to acquire plasmid-borne resistance genes. 

142


References 

ARAL, H., Y. MORITA, S. IZUMI, T. KATAGIRI and H. KIMURA (2007): 

Molecular typing by pulsed-field gel electrophoresis of Flavobacterium psychrophilum isolates derived from 

Japanese fish. 

J Fish Dis 30, 345-355 

ARIAS, C. R., O. OLIVARES-FUSTER, K. HAYDEN, C. A. SHOEMAKER, J. M. GRIZZLE and P. H. 

KLESIUS (2007): 

First report of Yersinia ruckeri biotype 2 in the USA. 

J Aquat Anim Health 19, 35-40 

AUSTIN, D. A., P. A. W. ROBERTSON and B. AUSTIN (2003): 

Recovery of a New Biogroup of Yersinia ruckeri from Diseased Rainbow Trout(Oncorhynchus mykiss, 

Walbaum). 


BABICH, H. and E. BORENFREUND (1991): 

Cytotoxicity and genotoxicity assays with cultured fish cells: A review. 

Toxicol in Vitro 5, 91-100 

BASTARDO, A., H. BOHLE, C. RAVELO, A. E. TORANZO and J. L. ROMALDE (2011): 

Serological and molecular heterogenetity among Yersinia ruckeri strains isolated from farmed Atlantic salmon 

Salmo salar in Chile. 


BASTARDO, A., C. RAVELO and J. L. ROMALDE (2012): 

Multilocus sequence typing reveals high genetic diversity and epidemic population structure for the fish 

pathogen Yersinia ruckeri. 

Environ microbiol 14, 1888-1897 

BERMINGHAM, A. and J. P. DERRICK (2002): 

The folic acid biosynthesis pathway in bacteria: evaluation of potential for antibacterial drug discovery. 

BioEssays 24, 637-648 

CANONICA, F. P. and M. A. PISANO (1985): 

Identification of Hydroxy Fatty Acids in Aeromonas hydrophila, Aeromonas sobria and Aeromonas caviae. 

J clin Microbiol 22, 1061-1062 

DAVIES, R. L. (1991): 

Clonal analysis of Yersinia ruckeri based on biotypes, serotypes and outer membrane protein-types. 

J Fish Dis 14, 221-228 

DAVIES, R. L. and G. N. FRERICHS (1989): 

Morphological and biochemical differences among isolates of Yersinia ruckeri obtained from wide geographical 

areas. 

J Fish Dis 12, 357-365 

DI-GIOVANNI, G. D., L. S. WATRUD, R. J. SEIDLER and F. WIDMER (1999): 

Comparsion of parental and Transgenic alfalfa rhizosphere bacterial communities using biolog GN metabolic 

fingerprinting and enterobacterial repetitive intergenic consensus sequence-PCR (ERIC-PCR). 

Microbial Ecol 37, 129-139 

EVENHUIS, J. P., S. E. LAPATRA, D. W. VERNER-JEFFREYS, I. DALSGAARD and T. J. WELCH (2009): 

Identification of Flagellar Motility Genes in Yersinia ruckeri by Transposon Mutagenesis. 


FOUZ, B., C. ZARZA and C. AMARO (2006): 

First description of non-motile Yerinia ruckeri serovar I strains causing disease in rainbow trout, Oncorhynchus 

mykiss (Walbaum), cultured in Spain. 

J Fish Dis 29, 339-346 

143


FRYER, J. L. and C. N. LANNAN (1994): 

Three decades of fish cell culture: A current listing of cell lines derived from fishes. 

Journal of Tissue Culture Methods 16, 87-94 

GALIMAND, C., A. GUIYOULE, G. GERBAUD, B. RASOAMANANA, S. CHANTEAU, E. CARNIEL and 

P. COURVALIN (1997): 

Multidrug resistance in Yersinia pestis mediated by a transferable plasmid. 

the New England Journal of Medicine 337, 677-681 

GARCIA, J. A., J. L. LARSEN, I. DALSGAARD and K. PEDERSEN (2000): 

Pulsed-field gel electrophoresis analysis of Aeromonas salmonicida ssp. salmonicida. 

FEMS Microbiol Lett 190, 163–166 

HIGHTOWER, L. and E. RENFRO (1988): 

Recent applications of fish cell culture to biomedical research. 

Journal of Exp Zool 248, 290-302 

HOLMES, B., W. R. WILLCOX and S. P. LAPAGE (1978): 

Identification of Enterobacteriaceae by the API 20E system. 

J Clin Pathol 31, 22-30 

HULTON, C. S. J., C. F. HIGGINS and P. M. SHARP (1991): 

ERIC sequences: a novel family of repetitive elements in the genomes of Escherichia coli, Salmonella 

typhimurium and other enterobacteria. 

Mol Microbiol 5, 825-834 

KAWULA, T. H., M. J. LELIVELT and P. E. ORNDORFF (1996): 

Using a new inbred fish model and cultured fish tissue cells to study Aeromonas hydrophila and Yersinia ruckeri 

pathogenesis. 

Microb Pathogenesis 20, 119-125 

KOETH, T., J. VERSALOVIC and J. R. LUPSKI (1995): 

Differential subsequence conservation of interspersed repetitive Streptococcus pneumoniae BOX elements in 

diverse bacteria. 

Genome Res 5, 408-418 

KRAWIEC, S. and M. RILEY (1990): 

Organization of the bacterial chromosome. 

Microbiol Rev 54, 502-539 

LECLERCQ, A., A. GUIYOULE, M. E. LIOUI, E. CARNIEL and J. DECALLONNE (2000): 

High homogeneity of the Yersinia pestis fatty acid composition. 


LESCHER, G. Y., E. J. FROELICH, M. D. GRUETT, J. H. BAILEY and R. P. BRUNDAGE (1962): 

1,8-Naphthyridine derivatives: a new class of chemotherapy agents. 

Journal of Medicinal and Pharmaceutical Chemistry 5, 1063-1068 

LUPSKI, J. R. and G. M. WEINSTOCK (1992): 

Short, interspersed repetitive DNA sequence in prokaryotic genomes. 

J Bacteriol 174, 4525-4529 

MALATHUM, K., K. V. SINGH, G. M. WEINSTOCK and B. E. MURRAY (1998): 

Repetitive sequence-based PCR versus pulsed-field gel electrophoresis for typing of Enterococcus faecalis at the 

subspeces level. 


MOHAPATRA, B. R., K. BROERSMA and A. MAZUMDER (2008): 

144


Differentiation of fecal Escherichia coli form poultry and free-living birds by (GTG) 5 -PCR genomic 

fingerprinting. 

Int J Med Microbiol 298, 245-252 

MOHAPATRA, B. R. and A. MAZUMDER (2008): 

Comparative efficacy of five different rep-PCR methods to discriminate Escherichia coli populations in aquatic 

enviroments. 

Water Sci Technol 58, 537-547 

NEU, H. C. and T. D. GOOTZ (1996): 

Antimicrobial Chemotherapy. 

In: Medical Microbiology 

4, University of Texas Medical Branch at Galveston, Galveston, USA, S. 

O'LEARY, W. M. (1962): 

The fatty acids of bacteria. 

Bacteriol Rev 26, 421-447 

OSTERHOUT, C. J., V. H. SHULL and J. D. DICK (1991): 

Identification of clinical isolates of gram-negative nonfermentative bacteria by an automated cellular fatty acid 

identification system. 


PERRETEN, V. and P. BOERLIN (2003): 

A New Sulfonamide Resistance Gene (sul3) in Escherichia coli is widespread in the pig population of 

switzerland. 


POST, G. (1987): 

Enteric redmouth disease (Yersiniosis). 

TFH Publication, Neptune city, New Jersey, USA 

RACHLIN, J. W. and A. PERLMUTTER (1968): 

Fish cells in culture for study of aquatic toxicants. 

Water Res 2, 409-414 

RODGERS, C. J. (2001): 

Resistance of Yerisinia ruckeri to antimicrobial agents in vitro. 


RODGERS, C. J. and B. AUSTIN (1983): 

Oxolinic acid for control of enteric redmouth disease in rainbow trout. 

Vet Rec 112, 83 

RUCKER, R. R. (1966): 

Redmouth disease of rainbow trout (Salmo gairdner). 

Bull off int Epizoot. 65, 825-830 

RUIZ, J. (2003): 

Mechanisms of resistance to quinolones: target alterations, decreased accumulation and DNA gyrase protection. 

J Antimicrob Ch 51, 1109-1117 

RUIZ, J., J. G MEZ, M. M. NAVIA, A. RIBERA, J. M. SIERRA, F. MARCO, J. MENSA and J. VILA (2002): 

High prevalence of nalidixic acid resistant, ciprofloxacin susceptible phenotype among clinical isolates of 

Escherichia coli and other Enterobaceriaceae. 

Diagn Micr Infec Dis 42, 257-261 

SECADES, P. and J. A. GUIJARRO (1999): 

Purification and characterization of an extracellular protease from the fish pathogen Yersinia ruckeri and effect 

of culture conditions on production. 

145



SHOEMAKER, C. A., C. R. ARIAS, P. H. KLESIUS and T. L. WELKER (2013): 

Technique for identifying Flavobacterium columnare using whole-cell fatty acid profiles. 


SKOELD, O. (2001): 

Resistance to trimethoprim and sulfonamides. 

Vet Res 32, 261-273 

SKOV, M. N., K. PEDERSEN and J. L. LARSEN (1995): 

Comparison of pulsed-field gel electrophoresis, ribotyping, and plasmid profiling for typing of Vibrio 

anguillarum serovar O1. 

Appl Environ Microbiol 61, 1540–1545 

STEVENSON, R. M. W. (1997): 

Immuniztion with bacterial antigens: yersiniosis. 

Dev Biol Stand 90, 117-124 

ŠVEC, P., M. VANCANNEYT, M. SEMAN, C. SNAUWAERT, K. LEFEBVRE, I. SEDL CEK and J. 

SWINGS (2005): 

Evaluation of (GTG) 5 -PCR for identification of Enterococcus spp. 


TINSLEY, J. (2010) 

Studies on the pathogenicity of Yersinia ruckeri biotype 2 to rainbow trout (Oncorhynchus mykiss, Walbaum) 

Edinburgh, UK School of Life Sciences 

TINSLEY, J. W., D. A. AUSTIN, A. R. LYNDON and B. AUSTIN (2011): 

Novel non-motile phenotypes of Yersinia ruckeri suggest expansion of the current clonal complex theory. 

J Fish Dis 34, 311-317 

TOBBACK, E., A. DECOSTERE, K. HERMANS, W. VAN DEN BROECK, F. HAESEBROUCK and K. 

CHIERS (2010): 

In vitro markers for virulence in Yersinia ruckeri. 

J Fish Dis 33, 197-209 

VERSALOVIC, J., T. KOEUTH and J. R. LUPSKI (1991): 

Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. 

Nucleic Acids Res. 19, 6823-6831 

VILA, J., J. RUIZ, F. MARCO, A. BARCELO, P. GO I, E. GIRALT and T. JIMENEZ-DE-ANTA (1994): 

Association between double mutation in gyrA gene of ciprofloxacin-resistant clinical isolates of Escherichia coli 

and MICs. 


WHEELER, R. W., R. L. DAVIES, I. DALSGAARD, J. GARCIA, T. J. WELCH, S. WAGLEY, K. S. 

BATEMAN and D. W. VERNER-JEFFREYS (2009): 

Yersinia ruckeri biotype 2 isolates from mainland Europe and the UK represent different clonal groups. 


WOLF, K. and M. C. QUIMBY (1969): 

Fish cell and tissue culture. 

In: Fish Physiology 

Academic Press, New York, S. 253-305 

YOSHIDA, H., M. BOGAKI, M. NAKAMURA and S. NAKAMURA (1990): 

Quinolone resistance-determining region in the DNA gyrase gene of Escherichia coli. 


146


YOUNG, G. M., M. J. SMITH, S. A. MINNICH and V. L. MILLER (1999): 

The Yersinia enterocolitica motility master regulatory operon, flhDC, is required for flagellin production, 

swimming motility and swarming motility. 

J Bacteriol 181, 2823-2833 

147

148

Chapter 8. Summary 

149

Chapter 8 Summary 

Summary 

Epidemiological Study on Yersinia ruckeri isolates from Rainbow trout 

(Oncorhynchus mykiss, Walbaum) in North West Germany. Yidan Huang 

Yersinia ruckeri is the causative agent of Enteric Redmouth Disease, one of the most 

important infectious diseases in rainbow trout hatcheries in Europe. Although generally Y. 

ruckeri was well controlled by vaccination and antibiotic treatment, outbreaks of this disease 

were still periodically observed, especially in endemic areas. Moreover, some Y. ruckeri 

strains seem not to be affected by several of the commercial vaccines. All these strains were 

lacking motility, while strains from previous outbreaks were all motile. It was hypothesized 

that vaccination exerted a selective pressure that enabled the emergence of non-motile strains 

that are resistant to the commercial vaccines. Therefore, there is a high risk that these 

non-motile vaccine-resistant strains spread and originate severe outbreaks of disease in trout 

farms. The aim of this project was to investigate the genotypic and phenotypic diversity of Y. 

ruckeri isolates collected in North West Germany to figure out the relationship according to 

the colony development, compare intraspecies differences with in vitro cytotoxicity to 

different fish cell lines, and the expression of pathogenic factors, especially between motile 

and non-motile isolates, and study their susceptibility to different antimicrobial agents and the 

genetic determents of antimicrobial resistance to understand the situation trout farming in 

North Western Germany now is facing. 

Since 2011, 48 Y. ruckeri isolates were collected from 12 trout farms in 

North-Rheine-Westphalia during different seasons. Additional 33 isolates, offered by LAVES 

Hannover and the fish disease service of Hessen, were from clinical cases in Lower Saxony 

and Hessen. One Reference strain was provided by the Clinic for Poultry at the University of 

Veterinary Medicine, Hannover, and one typical non-motile strain was offered by Dr. Gould 

from MSD Animal Health. The isolates were characterized by biochemical tests, pulsed-field 

gel electrophoresis (PFGE) and repetitive sequence-based PCR assays, including 

(GTG)5-PCR, BOX-PCR, ERIC-PCR and REP-PCR. Whole cell fatty acid composition was 

analyzed by gas chromatography. Cytotoxicity assays were performed using Common carp 

brain (CCB), epithelioma papulosum cyprini (EPC), fathead minnow epithelial cell (FHM) 

and rainbow trout gonad-2 (RTG-2) cells at different incubation times and temperatures. A 

multiplex PCR was established to detect 10 virulence factor genes (hemolysin genes yhlAB, 

ruckerbactin genes rucC and rupG, ABC exporter protein system genes yrp1 and yrpDEF , 

150


flagellar secretion chaperones gene flgA, flagellar secretion apparatus gene flhA) found in Y. 

ruckeri. The expression of these genes was analyzed and compared by semi-quantitative PCR. 

Susceptibility tests to antimicrobial substances and genetic determents for a resistance to these 

substances were detected by microdilution test and PCR. 

Eight different API 20E profiles were obtained, which were different from that of the Y. 

ruckeri reference strain DSM18506. Five isolates were confirmed as Y. ruckeri by 16S rDNA 

sequencing. 17 isolates hydrolyzed Tween 80/20. All Y. ruckeri isolates exhibited 15 major 

fatty acids, including 12:0, 13:0, 13.957 (equivalent chain length, ECL unknown), 14:0, 

14.502 (ECL unknown), 15:0, 16:1ω5c, 16:0, 17:1ω8c, 17:0 CYCLO, 17:0, 16:1 2OH, 

18:1ω9c, 18:1ω7c and 18:0. In addition to 17 PFGE patterns, two different REP-PCR patterns, 

five ERIC-PCR patterns, four (GTG) 5 -PCR patterns and three BOX-PCR patterns were 

obtained. According to the results of API 20E, PFGE and the various PCR assays, the isolates 

could be divided into 27 different groups. In rainbow trout hatcheries, isolates from more than 

two different typing groups were present in the same fish farm. Two groups of isolates were 

found to be present in all three federal states in North West Germany. Non-motile strains were 

more active to cause in vitro cytotoxicity to fish cell lines than motile strain in the first 24 h, 

but without significant difference after longer incubation at the lower temperature. All studied 

virulence genes were found present in both motile and non-motile strains of Y. ruckeri. In 

addition, no significant differences were found in the expression of these genes. For most of 

the antimicrobial agents tested, a unimodal distribution of MIC values was observed. In 

general, the MIC values increased with the incubation time. For enrofloxacin and nalidixic 

acid, a bimodal MIC distribution was observed with one population showing MICs of 

0.008-0.015 mg/L of enrofloxacin and 0.25-0.5 mg/L of nalidixic acid, respectively, and the 

other subpopulation exhibiting MICs of 0.06-0.25 mg/L of enrofloxacin and 8-64 mg/L of 

nalidixic acid, respectively. While isolates (n=3) from the subpopulation with the lower 

(fluoro)quinolone MICs showed the non-mutated gyrA wildtype QRDR sequence, another ten 

isolates from the subpopulation with the higher (fluoro)quinolone MICs exhibited different 

single bp mutations that resulted in single amino acid substitutions in the GyrA protein: Ser 

Arg or Ser Ile (at position 83) or Asn Tyr (at position 87) [Escherichia coli 

numbering]. A single isolate showed high MIC values for sulfamethoxazole and 

sulfamethoxazole/trimethoprim. A ~8.9 kb plasmid was found in this isolate, which carried 

the genes sul2, strB and a dfrA14 gene cassette integrated into the strA gene. Neither class 1 

nor class 2 integrons were found in this isolate. 

151


In conclusion, there was a variety of Y. ruckeri isolates in North West German aquaculture, 

dominated by non-motile strain. In most farms from the field study, two or more different Y. 

ruckeri isolates were present. It was easier for non-motile strains to cause outbreaks in winter, 

since they were more active than motile strain at lower temperature. The fatty acid 

composition of Y. ruckeri isolates was homogenous and there was no obvious link between 

the fatty acid profiles and the epidemiological parameters. Non-motile strains of Y. ruckeri 

could not be differentiated from motile strains by either the presence of virulence genes 

detected in this study or by the expression of these genes. Incubation for 24h-28h at 22±2 °C 

appears to be sufficient for the testing of Y. ruckeri for susceptibility to antimicrobial 

substances. The largely unimodal MIC distribution suggests that most of the isolates tested 

represent the wildtype population that has not acquired resistance mechanisms. Exceptions 

were (i) the finding of isolates with elevated (fluoro)quinolone MICs that also had 

resistance-mediating mutations in the QRDR region of gyrA, and (ii) the single isolate that 

carried plasmid-borne sul2, dfrA14, ΔstrA and strB genes. This observation confirmed that Y. 

ruckeri is able to develop mutations for (fluoro)quinolone resistance, but can also acquire 

plasmid-borne resistance genes. 

152

Chapter 9. Zusammenfassung 

153

Chapter 9 Zusammenfassung 


Eine epidemiologische Studie an Yersinia ruckeri-Isolaten aus Regenbogenforellen 

(Oncorhynchus mykiss, Walbaum) in Nord-West Deutschland. Yidan Huang 

Yersinia ruckeri, der Erreger der Rotmaulseuche (Enteric Redmouth Disease,ERM), ist eine 

der bedeutendsten Infektionskrankheiten in der Regenbogenforellenzucht in Europa. Obwohl 

im allgemeinen Y. ruckeri gut durch Impfungen und Antibiotikabehandlungen kontrolliert 

werden konnte, waren Ausbrüche dieser Krankheit noch regelmäßig zu beobachten, vor allem 

in endemischen Gebieten. Darüber hinaus scheinen einige Y. ruckeri Stämme nicht auf 

bestimmte kommerzielle Impfstoffe zu reagieren. Alle diese Stämme waren unbeweglich, 

während in früheren Ausbrüchen isolierte Stämme von beweglich waren. Es wurde vermutet, 

dass die Impfung einen selektiven Druck auf die Bakterien ausübt, der das Entstehen von 

nicht beweglichen Stämmen ermöglichte, die gegen die kommerziellen Vakzine 

unempfindlich sind. Daher besteht ein hohes Risiko, dass sich diese nicht beweglichen 

Vakzine-resistenten Stämme ausbreiten und schwere Krankheitsausbrüche in Forellenfarmen 

verursachen können. Das Ziel dieses Projektes war, genotypische und phenotypische 

Unterschiede von Y. ruckeri Isolaten aus Nord-West Deutschland zu erfassen und zu 

analysiere. Es wurden unterschiedliches Koloniewachstum ermittelt, Intraspezies-Vergleiche 

in Hinblick auf in vitro Toxizität gegenüber verschiedenen Fischzelllinien, der Expression von 

Pathogenitätsfaktoren insbesondere zwischen beweglichen und unbeweglichen Isolaten 

angestellt und die Anfälligkeit von Isolaten gegenüber verschiedenen antimikrobiellen 

Substanzen sowie die genetischen Faktoren einer antimikrobiellen Resistenz untersucht. Ziel 

war es die Situation zu verstehen, mit der die Forellenzucht in Nord-West Deutschland jetzt 

konfrontiert ist. 

Seit 2011 wurden 48 Y ruckeri Isolate von 12 Forellenteichwirtschaften in 

Nordrhein-Westfalen während verschiedener Jahreszeiten gesammelt. Zusätzliche 33 Isolate 

wurden vom LAVES Hannover und dem Fischgesundheitsdienst Hessen aus klinischen 

Ausbrüchen von ERM in Niedersachsen und Hessen zur Verfügung gestellt. Ein 

Referenzstamm wurde von der Klinik für Geflügel der Tierärztlichen Hochschule Hannover 

und ein typischer nicht beweglicher Stamm wurde von Dr. Gould vom MSD Animal Health 

bereitgestellt. Alle Isolate wurden durch biochemische Tests, Puls-Feld-Gelelektrophorese 

(PFGE) und Repetitive Sequenz-basierte PCR Analysen, inklusive (GTG)5-PCR, BOX-PCR, 

ERIC-PCR und REP-PCR, charakterisiert. Die Fettsäuremuster der Isolate wurden mittels 

Gaschromatographie analysiert. Die Cytotoxicität wurde an „Common carp brain“ (CCB), 

„Epithelioma papulosum cyprini (EPC), „fathead minnow“ Epithelzellen (FHM) und 

154


„Rainbow trout gonad-2“ (RTG-2) Zellinien bei verschiedenen Inkubationszeiten und 

Temperaturen untersucht. Eine Multiplex PCR wurde etabliert, um 10 verschiedene 

Virulenzfaktor-Gene (Hämolysingene yhlAB, Ruckerbactingene rucC and rupG, Gene des 

ABC Proteinexportersystems yrp1 and yrpDEF, Flagellare Secretionschaperon- Gene flgA, 

Gene des Flagellaren Sekretionsapparates flhA) von Y. ruckeri zu detektieren. Die Expression 

dieser Gene wurde mit einer semi-quantitativen PCR analysiert und verglichen. 

Empfindlichkeitstests gegenüber antimikrobiellen Substanzen und genetischen Eigenschaften 

für eine Resistenz gegenüber diesen Substanzen wurde mittels eines Mikrodillutionstest und 

einer PCR untersucht. 

Aus den Isolaten konnten acht verschiedenen API 20E Profile erstellt werden, die sich vom Y. 

ruckeri Referenzstamm DSM 18506 unterschieden. Fünf Isolate wurden mittels 16s 

rDNA-Sequenzierung als Y. ruckeri bestätigt. 17 Isolate konnten Tween 80/20 hydrolisieren. 

Alle Y. ruckeri Isolate zeigten 15 wesentliche Fettsäuren, darunter 12:0, 13:0, 13.957 (Gleiche 

Kettenlänge, ECL unbekannt), 14:0, 14.502 (ECL unbekannt) 15:0 16:1ω5c, 16:0, 17:1ω8c, 

17:0 CYCLO, 17:0, 16:1 2OH, 18:1ω9c, 18:1ω7c und 18:0. Zusätzlich zu 17 verschiedenen 

Mustern der PFGE wurden 2 verschiedene REP-PCR, 5 verschiedene ERIC-PCR, vier 

(GTG) 5 –PCR und drei Muster in der BOX-PCR Analyse entdeckt. Entsprechend der 

Resultate aus API 20, PFGE und den verschiedenen PCR Analysen konnten die Isolate in 27 

verschiedene Gruppen unterteilt werden. In den Regenbogenforellen der meisten untersuchten 

Fischfarmen wurden Isolate aus mehr als zwei verschiedenen Typisierungs Gruppen isoliert. 

Es stellte sich heraus, dass zwei der Isolat-Gruppen in allen drei Bundesländern Nord-West 

Deutschlands nachgewiesen werden konnten. Nicht bewegliche Stämme haben auf 

Fischzelllinien in den ersten 24 Stunden eine höhere in vitro Zytotoxizität als bewegliche 

Stämme, aber nach längerer Inkubationszeit bei niedrigen Temperaturen gibt es keine 

signifikanten Unterschiede mehr. Alle untersuchten Virulenz-Gene wurden sowohl in den 

beweglichen sowie auch in den beweglichen Y. ruckeri Stämmen gefunden. Weiterhin 

konnten in der Expression dieser Gene keine signifikanten Unterschiede nachgewiesen 

werden. Für die meisten Antibiotika konnte eine unimodale Verteilung der MHK beobachtet 

werden. Im Allgemeinen stiegen die MHK mit der Inkubationszeit an. Für Enrofloxacin und 

Nalidixinsäure wurde eine bimodale Verteilung der MHK Werte festgestellt. Die eine 

Population zeigte MHK Werte von 0,008-0,015 mg/l bei Enrofloxacin und 0,25-0,5 mg/l bei 

Nalidixinsäure, während die andere Subpopulation MHK Werte von0,06-0,25 mg/l für 

Enrofloxacin und 8-64 mg/l für Nalidixinsäure zeigte. Während Isolate (n=3) aus der 

Subpopulation mit der niedrigeren MHK für (Fluor)chinolon eine nicht mutierte gyrA 

155


Wildtyp QRDR Gensequenz besaßen, zeigten (n=10) Isolate der Subpopulation mit der 

höheren MHK für (Fluor)chinolon eine Punktmutation eines Basenpaares in der gyrA 

Gensequenz. Dies resultiert in einer Änderung einer Aminosäure im GyrA Protein: Ser zu Arg 

oder Ser zu Ile (an Position 83) oder Asn zu Tyr (an Position 87) (Escherichia coli 

Nummerierung). Ein einzelnes Isolat zeigte hohe MHK für Sulfamethoxazol und 

Sulfamthoxazol/Trimethoprim. Ein etwa 8.9kb großes Plasmid wurde in diesem Isolat 

gefunden, dass die Gene sul2 strB und eine dfrA14 Genkasette die in das strA Gen integriert 

war aufwies. Weder Klasse 1 noch Klasse 2 Integrine konnten in diesen Isolaten gefunden 

werden. 

Schlussfolgernd hieraus kann gesagt werden, das es eine Vielzahl von Y. ruckeri Stämmen in 

Nordwest Deutschland gibt, die zu einem Großteil aus nicht motilen Stämmen bestehen. In 

den meisten Farmen aus der Feldstudie waren zwei oder mehr verschiedene Y. ruckeri Isolate 

vorhanden. Im Winter war es einfacher für nicht bewegliche Stämme Krankheitsausbrüche 

hervorzurufen, da sie bei niedrigeren Temperaturen aktiver als die beweglichen Stämme 

waren. Die Fettsäure Zusammensetzung von Y. ruckeri Isolaten war homogen und es gab 

keine offensichtliche Verbindung zwischen den Fettsäuremustern und den epidemiologischen 

Parametern. Bewegliche Stämme von Y. ruckeri konnten in dieser Studie von nicht 

beweglichen Stämmen weder durch die Präsenz von Virulenzantigenen noch durch die 

Expression dieser Gene unterschieden werden. Die Inkubation von 24-28 Stunden bei 

22+/-2°C scheint ausreichend zu sein, um die Empfindlichkeit von Y. ruckeri gegenüber 

antimikrobiellen Substanzen zu testen. Die große unimodale MHK Verteilung lässt vermuten, 

dass die meisten getesteten Isolate den Wildtyp repräsentieren, der keine 

Resistenzmechanismen erworben hat. Erwartungen waren (i) das Auffinden von Isolaten mit 

erhöhten MHK für (Fluor)chinolone die außerdem eine Resistenz vermittelnde Mutation in 

der QRDR Region des gyrA Gens, und (ii) Isolate, die Plasmidvermittelte sul2, dfrA14, ΔstrA 

und strB Gene tragen. Diese Untersuchungen bestätigten, dass Y. ruckeri fähig ist, Mutationen 

für eine Fluor)chinolon Resistenz zu entwickeln, aber ebenso Plasmid vermittelte Resistenzen 

zu erwerben. 

156



Firstly, I would like to thank my supervisor Prof. Dr. Dieter Steinhagen for his help and 

support during my three-year PhD work. I think I am lucky enough to meet him and to be 

supervised by him. Prof. Steinhagen is always nice to guide my work, patient to answer and 

explain all my questions, and gave me lots of great ideas. He encouraged me to be 

self-confident in my presentations, scientific work and daily life. 

Secondly, I want to thank other two members in my supervisor group, Prof. Dr. Martin Runge 

and Prof. Dr. Lothar Kreienbrock. It is helpful to have your guidance during my work. Thanks 

for the patience and comment for all my meetings, presentations and manuscripts. 

I am particularly grateful to Prof. Dr. Friedhelm Jaeger in the Ministry of the Climate 

Protection, Environment, Agriculture, Conservation and Consumer Protection of the State of 

North-Rhine Westphalia. He offered me the chance to study in Germany and gave me all 

kinds of help, concern and support in my project and my daily life. 

I really appreciate the help from Prof. Dr. Stefan Schwarz and his team in FLI Mariensee. 

Prof. Schwarz, Dr. Geovana Brenner Michael and Ms. Roswitha Becker helped me a lot with 

my work. With their expertise, my experience went well. Travelling to Mariensee and 

working with this group are great experience for my life in Germany. I have learnt a lot. I 

thank Dr. Arne Jung, Dr. Martin Ryll and all technicians in clinic for poultry in University of 

Veterinary Medicine, Hannover for the help of identification and fatty acid analysis. I also 

want to thank the people in LAVES, Hannover, especially Sabina, Sandra and Marie for all 

help and caring in my life. I thank everyone in our “fish group”: Patricia, Verena, Hamdan, 

John, Karina, Agnes, Marc, Birgit, Mikolaj, Graham, and Charlie for the technical support 

and valuable ideas for my experiment. It is really nice to work together as a big „fish family‟. 

I thank Mr. Dieter Mock and the whole group in LANUV, Albaum for assisting my field 

study. For the whole sampling year, Mr. Mock drove me to different fish farms in 

North-Rhine Westphalia and helped a lot with the sampling and isolation work. Special 

Thanks are given to Dr. Johannes-Werner Schaefer and his family: Berta, Katrin, Andrea and 

Sebastian. Thanks for the accommodation during my sampling time and the kind invitation 

157


for Christmas. It made me feel like home to stay with them. It is my sweet memories in my 

life. 

Many thanks to Dr. Silke Braune (LAVES Hannover), Dr. Chris Gould (MSD Animal Health) 

and Dr. Joachim Nilz (LHL Hessen) for providing me some Yersinia ruckeri isolates for my 

project. 

I would like to thank all my friends in Germany and China, especially Rindra, Natasha and 

Xin for the nice suggestions and help with my work, and all the encouragement and supports. 

It is great to spend time with you together and it is my precious memory. 

I owe my deepest gratitude to my parents. Thanks a lot for letting me pursue my dream freely, 

for the caring and supporting in my whole life. 

Finally, I want to thank China Scholarship Council for financial support during my stay in 

Germany. 

158

University of Veterinary Medicine Hannover Institute of Parasitology ...

Create successful ePaper yourself

Delete template?

Save as template?