pGL3 Luciferase Reporter Vectors Technical Manual #TM033

More documents

Recommendations

Info

RVprimer35′ . . . CTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCTATCGATASV40PromoterGGTACCGAGCTCTTACGCGTGCTAGCCCGGGCTCGAGATCTGCGATCTAAGTAAGCTTGG . . .KpnIAcc65ISacIMluINheIXmaISmaIXhoIBglIIHindIIIluc+ Coding RegionStartSV40EnhancerCATTCCGGTACTGTTGGTAAAGCCACCATGGAAGACGCCAAAAACATAAAG . . . (1892bp) . . . GGATCCGTCGACNcoIGLprimer2 BamHI SalICGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTC . . . 3′RVprimer40756MA08_4AFigure 5. pGL3 Vector multiple cloning regions. Shown are the upstream anddownstream cloning sites and the locations of the sequencing primers (GLprimer2,RVprimer3 and RVprimer4). The large primer arrows indicate the direction ofsequencing. The positions of the promoter (in the pGL3-Promoter and pGL3-ControlVectors) and the enhancer (in the pGL3-Enhancer and pGL3-Control Vectors) areshown as insertions into the sequence of the pGL3-Basic Vector. (Note that thepromoter replaces four bases [AAGT] of the pGL3-Basic Vector.) The sequenceshown is of the DNA strand generated from the f1 ori.IV.Cloning MethodsIV.A. Cloning Strategies!The restriction sites for XhoI and SalI have compatible ends, as do BglII andBamHI. Therefore, cloning into the XhoI or BglII sites upstream of luc+, or thedownstream SalI or BamHI sites, allows easy interchange of DNA insertsbetween upstream and downstream positions relative to the luciferase reportergene. Thus, positional effects of a putative genetic element may be readilytested. Cloning fragments into a single site will generally yield both possibleorientations relative to the reporter gene, making these effects also readilytestable.The other upstream restriction sites may be used for cloning. However,note that some of the sites are required for generating nested deletions(see Section VIII.D). Specifically, the KpnI or SacI site is needed to generate a3´ overhang upstream of the insert.Please refer to Sections VIII.G–J for additional information on XhoI digestion.Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USAToll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPrinted in USA.Part# TM033Revised 9/07 Page 7
IV.B. Preparation of pGL3 Vectors and Insert DNA for CloningThe fragment and vector DNA should be digested with restriction enzymesthat will generate compatible ends for cloning. In some cases, the ends of theDNA fragment may require modification, either by using synthetic linkers, bya PCR amplification using primers containing sites for appropriate restrictionenzymes, or by filling in the restriction site overhangs. It may be advantageousto treat the vector DNA with calf intestinal alkaline phosphatase (CIAP; Cat.#M2825) or TSAP Thermosensitive Alkaline Phosphatase (Cat.# M9910) toremove 5´ phosphate groups, thus preventing reclosure of the vector on itselfwithout an insert. Sufficient DNA should be prepared to perform controlreactions for digestion, ligation and transformation steps.To ensure capture of the correct insert DNA, the desired restriction fragmentcan be purified by electrophoresis on an acrylamide or agarose gel and thenrecovered from the gel by one of several methods, such as using the Wizard ®PCR Preps DNA Purification System Technical Bulletin #TB118. Alternatively,unfractionated restriction fragments can be cloned into the target plasmid, andthe desired recombinant then can be identified by gel electrophoresis ofplasmid DNA.Protocols for restriction digestion, alkaline phosphatase treatment, linkerligation and transformation of competent cells can be found in MolecularCloning, A Laboratory Manual (1).IV.C. Transformation Protocols for pGL3 VectorsBecause the Luciferase Reporter Vectors are supplied as modified DNA, E. colihosts may be either restriction + or restriction –. The use of a recA host such asJM109 is preferred because this prevents undesirable recombination betweenthe insert and the host chromosomal DNA. A strain that has an F´ episome isrequired for ssDNA production.Grow JM109 on minimal plates (M-9) supplemented with 1.0mM thiamine-HCl prior to preparation of competent cells and transformation. This selectsfor the presence of the F´ episome.IV.D. Isolation of Plasmid DNAThe Wizard ® Plus SV Minipreps DNA Purification System (Cat.# A1340,A1470) may be used for small-scale preparation of plasmid DNA for screeningclones. DNA suitable for transfection may be purified using the PureYieldPlasmid Midipreps System (Cat.# A2492, A2495).Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USAToll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPart# TM033Printed in USA.Page 8 Revised 9/07
Page 1 and 2: Technical ManualpGL3 Luciferase Rep
Page 3 and 4: I. DescriptionThe pGL3 Luciferase R
Page 5 and 6: III.B. pGL3-Enhancer VectorThe pGL3
Page 7: III.D. pGL3-Control VectorThe pGL3-
Page 11 and 12: VI.Assay of Luciferase Activity (co
Page 13 and 14: VIII. AppendixVIII.A. Common Struct
Page 15: VIII.C. The pGL3 Vectors luc+ GeneM
Page 18 and 19: VIII.F. References1. Sambrook, J. e
Page 21: VIII.G. pGL3-Basic Vector Restricti
Page 25 and 26: VIII.I. pGL3-Promoter Vector Restri
Page 27: VIII.J. pGL3-Control Vector Restric
Page 30: pGL4 Luciferase VectorsProduct Size

pGL3 Luciferase Reporter Vectors Technical Manual #TM033

Create successful ePaper yourself

Delete template?

Save as template?