Protein Engineering Protocols - Mycobacteriology research center

210 Sidhu et al.sites (Pro6, Lys8, Asn12, Ser13, Gln15, Ala16, and Ser17), at which mutationsare most likely to result in improved protein display (Fig. 1). Completerandomization of seven sites within a protein results in approx 10 9 uniqueamino acid combinations, and this level of diversity can be readily coveredby the library diversities (~10 10 ) that can be obtained with the methodsdescribed herein.3.2. Library ConstructionLibraries of P8 variants are constructed using an optimized version (2) of apreviously described oligonucleotide-directed mutagenesis method (13). First,a mutagenic oligonucleotide (sequence: GCCGAGGGTGACGATTAAG-CATAAGCGGCCTTTTAATAACTGTAATAATAAGCGACCGAATATATC) isused to introduce stop codons at the sites to be randomized; oligonucleotidedirectedsite-specific mutagenesis protocols are provided in Subheading 3.2.2.and can be adapted for small-scale mutagenesis to introduce the stop codons(see Note 1). The resulting “stop template” phagemid can be used as the templatefor library construction because the presence of stop codons eliminates wtprotein display. Uracil-containing (dU) single-stranded (ss)DNA stop template(purified from an E. coli dut – /ung – host) is then annealed to a mutagenicoligonucleotide (sequence: GCCGAGGGTGACGATNNKGCANNKGCGGC-CTTTNNKNNKCTGNNKNNKNNKGCGACCGAATATATC) designed toreplace the stop codons with NNK (N = A/G/C/T, 25% each; K = G/T, 50%each) degenerate codons that encode all 20 natural amino acids. The mutagenicoligonucleotide is used to prime the synthesis of a complementary DNA strandthat is ligated to form a covalently closed circular (CCC), double-stranded(ds)DNA heteroduplex. To complete the library construction, the CCC-dsDNAheteroduplex is introduced into an E. coli dut + /ung + host by electroporation, andthe mismatch is repaired to either the wt or mutant sequence. In an ung + strain,the dU template strand is preferentially inactivated and the synthetic, mutantstrand is replicated, thus, resulting in efficient mutagenesis (>50%). The use ofa template with stop codons at all of the sites to be randomized ensures that onlyfully mutagenized clones contain open-reading frames that can be displayed onphage. The library members can be packaged into phage particles by coinfectionof the E. coli host with a helper phage.3.2.1. Purification of dU-ssDNA TemplateMutagenesis efficiency depends on template purity, and, thus, the use ofhigh-purity dU-ssDNA is critical for successful library construction. We usethe Qiagen QIAprep Spin M13 Kit for dU-ssDNA purification, and the followingis a modified version of the Qiagen protocol. It yields at least 20 µg of dUssDNAfor a medium copy number phagemid (e.g., pS1607, which contains