June 09-41-2.indd - Kma.org.kw

Vol. 41 No. 1KUWAIT MEDICAL JOURNALC O N T E N T SContinued from coverJUNE 2009SELECTED ABSTRACTS OF ARTICLES PUBLISHED ELSEWHERE BYAUTHORS IN KUWAIT 166FORTHCOMING CONFERENCES AND MEETINGS 170WHO-FACTS SHEET 1801. Childhood Diarrhea2. Addressing Mental Disorders in Children3. More people dying from TB are HIV-infected4. Drug Resistance Could Set Back Malaria Successes5. Climate Change Global Risks, Challenges and DecisionsERRATUMSurveillance of Healthcare-Associated Infections in Adult Patients with Leukemia in KuwaitCancer Control Center 184❈ ❈ ❈Open access for articles at: www.kma.org.kw/KMJIndexed and abstracted in:EMBASE (The Excerpta Medica Database)Science Citation Index Expanded (also known as SciSearch®)Journal Citation Reports/Science EditionIMEMR Current Contents (Index Medicus for the Eastern Mediterranean Region;available online at: www.emro.who.int/EMRJorList/online.aspxTHE PUBLICATION OF ADVERTISEMENTS IN THE KUWAIT MEDICAL JOURNAL DOES NOT CONSTITUTE ANY GUARANTEE OR ENDORSEMENT BY THE KUWAITMEDICAL ASSOCIATION OR THE EDITORIAL BOARD OF THIS JOURNAL, OF THE ADVERTISED PRODUCTS, SERVICES, OR CLAIMS MADE BY THE ADVERTISERS.THE PUBLICATION OF ARTICLES AND OTHER EDITORIAL MATERIAL IN THE JOURNAL DOES NOT NECESSARILY REPRESENT POLICY RECOMMENDATIONS ORENDORSEMENT BY THE ASSOCIATION.PUBLISHER: The Kuwait Medical Journal (KU ISSN-0023-5776) is a quarterly publication of THE KUWAIT MEDICAL ASSOCIATION.Address: P.O. Box 1202, 13013 Safat, State of Kuwait; Telephone: 25316023, 25317972 Fax: 25312630, 25333276. E-mail : kmj @kma.org.kwCOPYRIGHT: The Kuwait Medical Journal. All rights reserved. No part of this publication may be reproduced without writtenpermission from the publisher. Printed in Kuwait.INSTRUCTIONS FOR AUTHORS: Authors may submit manuscripts prepared in accordance with the Uniform Requirements forManuscripts Submitted to Biomedical Journals. These Requirements are published in each issue of the Kuwait Medical Journal.CHANGE OF ADDRESS: Notice should be sent to the Publisher six weeks in advance of the effective date. Include old and newaddresses with mail codes.KUWAIT MEDICAL JOURNAL is added to the list (The Journal of the Kuwait Medical Association) of journals adhering to the“Uniform Requirements for Manuscripts Submitted to Biomedical Journals”, American College of Physicians, Independence Mall West,Sixth Street at Race, Philadelphia, PA 19106-1572, USA, and can be located at http://www.icmje.org/jrnlist.html

Kuwait Medical Journal (KMJ)Published by the Kuwait Medical AssociationPreviously known as The Journal of the Kuwait Medical Association (Est. 1967)Honorary President: Abdulaziz Al-BabtainEDITORIAL BOARDEditor-in-Chief:Editor:International Editor:Associate Editors:Fuad Abdulla M Hasan, KuwaitAdel Khader Ayed, KuwaitPawan K Singal, CanadaAdel A Alzayed, KuwaitIgnacio Rodriguez, USAMichael Redmond, USAMousa Khoursheed, KuwaitMustafa M Ridha, KuwaitNasser Behbehani, KuwaitNoura Al-Sweih, KuwaitAnanda S Prasad, USAAnders Lindstrand, SwedenAndrew J Rees, UKBelle M Hegde, IndiaBengt Jeppsson, SwedenCharles A Dinarello, USAChristian Imielinski, PolandElizabeth Dean, CanadaFiona J Gilbert, UKFrank D Johnston, UKGeorge Russell, UKGraeme RD Catto, UKINTERNATIONAL ADVISORY BOARDGiuseppe Botta, ItalyJames W Roach, USAJan T Christenson, SwitzerlandJasbir S Bajaj, IndiaJohn V Forester, UKJulian Little, CanadaKostadin L Karagiozov, JapanLewis D Ritchie, UKMohammed Zayer, SwedenNeva E Haites, UKNirmal K Ganguli, IndiaOleg Eremin, UKPeter RF Bell, UKPhilip M Moody, USARaymond M Kirk, UKSamuel Dagogo-Jack, USAS Muralidharan, IndiaStig Bengmark, SwedenTulsi D Chugh, IndiaWilliam A Tweed, CanadaWilliam B Greenough, USAZoheir Bshouty, CanadaAbdulla BehbehaniAbeer K Al-BahoAlexander E OmuAli Al-MukaimiAli Al-SayeghAsmahan Al-ShubailiChacko MathewEiman M MokaddasFaisal A Al-KandariREGIONAL ADVISORY BOARDHabib AbulJohn F GreallyJoseph C LongeneckerKamal Al-ShoumerKefaya AM AbdulmalekKhalid Al-JarallahMazen Al EssaMohamed AA MoussaMousa KhadadahMustafa Al-MousawiNasser J HayatNebojsa RajacicSami AsfarSoad Al-BaharSukhbir Singh UppalWaleed AlazmiWaleed A AldhahiEDITORIAL OFFICEEditorial Manager : Babichan K ChandyLanguage Editor : Abhay U PatwariEDITORIAL ADDRESSP.O. Box: 1202, 13013-Safat, KuwaitTelephone: (00-965) 25316023, 25317972, 25333920 - Fax: (00-965) 25312630, 25333276E-mail: kmj@kma.org.kwWebsite: www.kma.org.kw/KMJ

KUWAIT MEDICAL JOURNALKUWAIT MEDICAL JOURNAL (KMJ)Instructions for AuthorsINTRODUCTIONFormerly known as ‘The Journal of the KuwaitMedical Association’, the Kuwait Medical Journal(KMJ) was established in the year 1967. It is the officialpublication of the Kuwait Medical Association andpublished quarterly and regularly in March, June,September and December.AIMS AND SCOPEKMJ aims to publish peer-reviewed manuscriptsof international interest. Submissions on clinical,scientific or laboratory investigations of relevance tomedicine and health science come within the scopeof its publication. Original articles, case reports, briefcommunications, book reviews, insights and lettersto the editor are all considered. Review articles aresolicited. Basic medical science articles are publishedunder the section ‘Experimental Medicine’.GENERALThe Kuwait Medical Journal is a signatory journal tothe Uniform Requirements for Manuscripts Submittedto Biomedical Journals, the fifth (1997) revision of adocument by the international Committee of MedicalJournal Editors. A description of important featuresof this document is available on the Lancet website athttp://www.thelancet.com. Alternatively, you mayconsult the following: N Engl J Med 1997; 336:307-315 or order the leaflet “Uniform Requirements forManuscripts Submitted to Biomdical Journals” bywriting to the Editor of the British Medical Journal(BMJ), BMA House, Tavistock Square, London WC1H9JR, UK.To present your original work for consideration,one complete set of the manuscript, written in English(only), accompanied by tables, and one set of figures(if applicable), should be submitted to the Editor.Authors should also provide the manuscript on anIBM compatible medium such as floppy, CD (in MSword format) or pen-drive, if not submitted throughe-mail. The KMJ editorial office uses Microsoft ‘Office2007’ word processing and ‘Excel’ programs. Details ofthe type of computer used, the software employed andthe disk system, if known, would be appreciated.ELECTRONIC SUBMISSIONSA manuscript could be submitted through e-mailas an attached word-document (.doc), together witha scanned copy of the signed consent letter of theauthor(s). The consent letter could otherwise be faxedto the journal office at (00965) 25312630 or 25333276.Figures, if any, need to be in .jpg/.jpeg/.bmp formatwith 300 dpi resolution and illustrations such asdrawings, charts, Excel presentation, etc. shall besubmitted as separate attachments. Incomplete/improper submissions will not be processed, and willbe returned.Following a peer review process, the correspondingauthor will be advised of the status; acceptance/recommendation for revision or rejection of the paper,in a formal letter sent through post and/or e-mail. Agalley proof will be forwarded to the correspondingauthor through e-mail before publication of theaccepted papers which must be returned to the journaloffice within 48 hours with specific comments, if any.Corrections in the galley proof, in case any, must belimited to typographical errors, or missing contentsonly.ETHICAL CONSIDERATIONSWhere human investigations or animal experimentsare part of the study, the design of the work has tobe approved by local ethics committee. A relevantstatement of approval should be added in the ‘Subjectsand Methods’ section of the manuscript.PREPARATION OF THE MANUSCRIPTThe manuscript should be typed as ‘normal text’with no hyphenation and no hard returns withinparagraphs (use automatic wordwrap) on one side ofA4 size (29.7 x 21 cm) paper in single column format,preferably in font size no.12. No artwork and/or specialeffects are acceptable for the text and/or table(s).Italics should not be used other than for foreign/Latin expressions and/or special terminologies suchas names of micro organisms. Maintain a minimumof 2 cm margin on both sides of the text and a 3 cmmargin at the top and bottom of each page. No partof the text other than abbreviations and/or subtitlesshall be written in upper case (ALL capital). Header/foot notes, end notes, lines drawn to separate theparagraphs or pages etc. are not acceptable.THE ORDER OF THE TEXTOriginal Articles: Title page, Abstract (in structuredformat for original articles) of no more than 250words, Key Words (no more than five), followed byIntroduction, Subjects (or Materials) and methods,Results, Discussion, Conclusion, Acknowledgment/s(if any), References, Legends to figures, Tables, andFigures. Each section should begin on a new page.Review Articles (solicited): Title Page, Abstract ofno more than 250 words, Key Words (no more thanfive), followed by Introduction, Methods/History(if applicable), Literature Review, Conclusion,i

AN ADDED FEATHER TO THE KMJ’S CAPWe are glad to inform all our valued patrons, subscribers and readers that theKuwait Medical Journal (KMJ) has been selected for coverage in ThomsonReuter’s products and custom information services.Commencing with Volume 40 (1) 2008, this publication has been indexed andabstracted in the following:❖Science Citation Index Expanded (also known as SciSearch®)❖Journal Citation Reports/Science EditionWe are sure that this accreditation will better meet the requirements of thescientific and scholarly research community besides enhancing the value oftheir submissions published in this journal.While I thank you all, on behalf of the Editorial Board, for your valuablecontributions and patronage, look forward to your continued support andcooperation to achieve further heights through publishing the valuable andadvanced outcome of your research studies and practices that would enlightenthe community and serve the entire humanity.Congratulations and best wishes to all our contributors and collaborators.Professor Adel Kahader AyedEditor

June 2009KUWAIT MEDICAL JOURNAL 91EditorialSecret of Healthy Living in a Hostile WorldBelle M Hegde*The Journal of the Science of Healing Outcomes, Maryland, USA and Mangalore, India**Manipal University, Manipal India#London University, UK##Northern Colorado University, USAKuwait Medical Journal 2009; 41 (2): 91-92“The greatest truths are the simplest, and so arethe greatest men.”JC and AW HareWhen one ponders over the multitude of riskfactors in and around us in this hostile world, onewonders as to how we are alive at all. Medicalclaptrap informs us day in and day out about themultitude of potions-chemical drugs, surgeries,special foods, tonics etc, to keep us alive. The truthis that most, if not all, of those heavily advertiseditems damage the system further than helpingus. The truth is that there is a very complicated,yet simple system inside each of the one hundredthousand billion cells inside the human body whichfunction better than a super computer to computeall the internal and external inputs through multiplesources to transduce them into coherent methodsto eventually put in place two fascinating energysystems, a low energy and high energy system, tokeep us going [1] .Let us first examine this nature’s computerinside every cell which existed for nearly a billionand half years before the first nerves ever appearedin Jellyfish. It took another half a billion years forcranial nerves and brain to appear in organismsincluding man. The myth that the brain and thenervous systems alone keep us going has to giveplace to a more holistic view that there are manyother important systems that help keep man alive.Then we will progress further in our understandingof human physiology and pathology. Life is acomplicated system of individual cell function inthe body in an interdependent manner to keep usalive and healthy. If the ten thousand odd proteinsthat are present inside each one of the trillions ofcells in our bodies do not work well we will havedisease states. For recovery from any illness, bodycells will have to function normally again [2] .Our approach in the “so-called” evidence basedmodern medicine is to try and correct those changes(not knowing what they are) in disease states usingchemicals or surgery. As a quick-fix, apparently,they help some people some times but all of themdamage some part of the human system almostalways, some times as late as five years after theevent. One good example is a pain killer trasylolwhich is now known to kill the recipient as lateas five years after he/she had it! What happenedto another pain killer wyoxx is now commonknowledge. These measures have now resulted inconsiderable misery for mankind. To quote the mostauthentic scientific body of the USA : “The NationalAcademy’s data attributes 100,000 deaths per yearto physicians’ errors, added to well over 100,000deaths due to severe drug interactions and another100,000 fatalities from hospital-based-infections.(For a detailed analysis, see Death By Medicine, byGary S. Null, et al)”. This is from a country with lessthan one third the population of India. Thank God,we do not have statistics like this for India [3] .What is the remedy? We must get to know thetrue physiology of cell function and try and seehow we could restore that in the unlikely event ofdisease in a more natural way rather than inflictingchemical and surgical damage to the cells wherepossible. The fruitless research of modern medicineis based on statistical science and not true hardscience. The “failure of millions of dollars spenton AIDS vaccine, failure of interferon as a wonderdrug for cancer management with the latter stillAddress correspondence to:Professor B. M. Hegde, Manjunath, Pais Hills, Bijai, Mangalore 575004, India. Tel: +91 824221 7575, E-mail: hegdebm@gmail.com;web: www.bmhegde.com*Editor in Chief, The Journal of the Science of Healing Outcomes, Maryland, USA and Mangalore, India**Vice Chancellor (Retd), Manipal University, Manipal India#Former Visiting Professor of Cardiology, London University, UK##Affiliate Professor of Human Health, Northern Colorado University, USA

92 Secret of Healthy Living in a Hostile WorldJune 2009eluding a cure despite billions being wasted oncancer research and cancer screening (the latterhas been shown to be useless and dangerous), andthe ravages caused by drugs like thalidomide andthorazine,” are there for all of us to see.We need to arrange an urgent marriage betweenthe beneficial remedies in modern medicine “like theexcellent emergency care methods, brilliant surgicalsuccesses, time tested and harmless pharmaceuticalsas also the newer life style changes” with thebest and scientifically authenticated multitudeof methods in many other systems of medicineinto a judicious integrated system of medical carethat is inexpensive, safe, and effective under allcircumstances. Unfortunately, the vested interestsin modern medicine are scuttling every effort inthis field by hitting those efforts with an old but,effective whip “there is no evidence base” in othersystems of medical care. This is the biggest lie.Let us examine how we can use natural methodsto get the damaged cells back to normalcy. The tenthousand odd proteins in each cell are functionallybetter than our supercomputers. They have twoenergy systems- the Low energy system and theHigh energy system. Initially, the proteins processall the information they collect from the body as alsothe outside world into a low energy informationsystem which primes the other proteins to a highenergy functional system that could power the bodyas a whole. In this milieu there are certain specificproteins that do the directing or chaperoning jobvery effectively. One such chaperone protein is theHeat Shock Protein, HSP 70. It is otherwise calledStress Responsive Protein (SRP 70) as it responds toevery kind of stress in the cells [4] .The HSP 70 protein is supervised by the HSP 70gene. HSP 70 protein could be re-primed by heatingthe cell to 47 O C but, that can never be done in thehuman body. The other method is to use somekind of natural energy to do the job. In health thecell uses the energy coming from the main source,sunlight, as also the magnetic energy generated bylightening throwing a halo of Schuman energy fieldaround the earth (Schumann effect). All proteins arebut carbon, hydrogen, nitrogen and oxygen as in theDNA along with amino-acids that come from food.The electromagnetic energy used by the cell proteinsare then transduced to fire the mitochondria insideevery cell to produce energy needed for life [5] .Glen Gordon was one of NIH’s brilliant youngscientists, 4th in hierarchy at one stage. He was apioneer in this field of trying to regenerate thedamaged (ischemic) cells back to normal. This madethe American Medical Association to file a law suitagainst him, which did not materialize at the end. Helost his entire grant support, though. He would notrelent. He has come up with a small Pulsed Electro-Magnetic Field (PEMF) generator powered by abattery to stimulate and up-regulate the depressedHSP 70 protein and thereby regenerate the cellsagain. My own initial enthusiasm with this toy ofhis is exciting. Time is not ripe to disclose the finaldata as the study is ongoing but the preliminaryreports are very encouraging indeed. None theless, the results are an opening for us to look moredeeply into many such natural methods of makingthe sick cells (individuals) to regain their strengthand health without any long term detriment to theowner in the bargain [6-8] .The marriage between the best in both theworlds, as suggested above, is our only solutionin this dangerous state in which modern medicalclaptrap and statistical science have landed us. Weneed a holistic approach to human, nay, all problemsof this world.“And all the loveliest things there beCome simply, so it seems to me.”Edna St. Vincent MillayACKNOWLEDGEMENTThanks to Glen Gordon for his inputs, help withgadgets and love. To Professor Rustum Roy of Penn.State, for many things that cannot be enumerated.REFERENCES1. Carson R. Silent Spring. Boston, Houghton Mifflin,1962; 147.2. Fried S. Bitter Pills: Inside the hazardous world oflegal drugs. New York, Bantam Books, 1998.3. Gordon GA. Extrinsic electromagnetic fields, lowfrequency (Phonon) vibrations, and control of cellfunction: A non-linear resonance system. J BiomedicalScience and Engineering 2008; 1:152-156.4. George I, Geddis MS, Lill Z, et al. Myocardial functionimproved by electromagnetic field induction ofstress protein HSP 70. J Cell Physiol 2008; 216: 816-823.5. Goodwin T. Physiologic and molecular geneticeffects of time varying electromagnetic fields onhuman neuronal cells. NASA TP 2003/212054,NASA Technical and Scientific Library, JohnsonSpace Center, Houston TX.6. Eichwald C, Walleczek J. Model for magnetic fieldeffects on radical pair recombination in enzymekinetics. Biophys J 1996; 71:623-631.7. Aarons R. Tissue healing, EMFRAPID Symposium 3.NIEHS 1998.8. Grant G, Cadossi R, Steinberg G. Protection againstfocal cerebral ischemia following exposure to apulsed electromagnetic field. Bioelectromagnetics1994; 15: 205-216.

June 2009KUWAIT MEDICAL JOURNAL 93Review ArticleThe Immune System in Pregnancy: Friend or Foe?Raj RaghupathyDepartment of Microbiology, Faculty of Medicine, Kuwait University, KuwaitABSTRACTKuwait Medical Journal 2009; 41 (2): 93-102Pregnancy is an intriguing immunological paradox; howdoes an allogeneic fetus survive despite a potentiallyantagonistic maternal immune system, while tissue allograftssuccumb to rapid immunological rejection? While severalhypothetical models have been proposed in the last fivedecades to explain the immunological success of pregnancy,the model that has survived the test of experimentationis the one that proposes a state of immunomodulationduring pregnancy. Several factors appear to prevent therejection of the fetus. Yet, pregnancy can be compromisedby a variety of complications such as recurrent spontaneousmiscarriage, preeclampsia and preterm delivery. Researchin the field of immunology of pregnancy has opened up thepossibility of cellular immune effectors that might underliethese pregnancy complications. Particularly interesting arethe effects that pro-inflammatory and anti-inflammatorycytokines have on the conceptus and thus on the success andfailure of pregnancy. This review focuses on the associationbetween some cytokines and successful pregnancy on theone hand, and between other cytokines and complications ofpregnancy as also the possible pathways of effector functionof cytokines in pregnancy loss. This review proceeds todiscuss the therapeutic redirection of cytokine profilestowards one that is favorable to the success of pregnancy.KEY WORDS: allogeneic fetus, cellular immune effectors, immunomodulation in pregnancyINTRODUCTIONOne of the basic tenets of immunology is thatthe host immune system recognizes anything that isforeign or “non-self”, mounts an immune responseagainst it and then eliminates it. Thus, pathogens,toxins and foreign antigens in general are recognizedand eliminated. This holds true for foreign cells andtissues as well, which is why tissues from otherindividuals are recognized as foreign and thenrejected. How then is the fetus not rejected? Thefetus is derived from both paternal and maternalgenes, thus the fetus expresses both paternal andmaternal antigens. Paternal antigens, such as thestrongly antigenic human leukocyte antigens (HLA)could well be foreign to the maternal host and couldstimulate maternal immune responses which couldpotentially lead to the immunological rejection ofthe fetus. The fact that pregnancy does succeed haslong been considered an immunological paradox,a puzzle of sorts, which prompted the Britishimmunologist Peter Medawar more than 55 yearsago to ask “How does the mother contrive to nourishwithin herself an antigenically foreign fetus?”Medawar went on to propose several mechanismsfor the protection of the fetus from maternal immunerejection; one of these was that pregnancy induces astate of immunosuppression in the mother becauseof which rejection reactions are either not inducedor are not effective [1] . Subsequent experimentationhas demonstrated the lack of a generalized,systemic state of immunosuppression, though asort of immunomodulation, or manipulation ofmaternal immunity towards a less harmful andmore conducive status seems to be in effect. In fact,some immune system factors actually act as positivegrowth factors for the placenta, as we shall see later;thus, the maternal immune system may actuallycontribute to nurturing the conceptus and to thesuccess of pregnancy.The Maternal Immune System during NormalPregnancyEvidence from animal experiments and clinicalevidence from humans indicate that humoralresponses are enhanced during pregnancy [2] . On theother hand, cell-mediated immune reactions such asdelayed-type hypersensitivity, natural killer (NK)activity, cellular responses to intracellular infectionsand the course of cell-mediated autoimmunedisorders are downregulated. These observationsAddress Correspondence to:Dr Raj Raghupathy, PhD, FRCPath, Department of Microbiology, Faculty of Medicine, Kuwait University, P.O. Box 24923, Safat 13110, Kuwait.Tel: 25319602, Fax: 25332719, E-mail: raj@hsc.edu.kw

94The Immune System in Pregnancy: Friend or Foe?June 2009suggest that there is a downregulation ofTh1-type immunity and upregulation of Th2-type immunity during pregnancy [2] . Th1-typeimmunity is primarily mediated by Th1 cells andTh2-type immunity is induced by Th2 cells. Th1and Th2 cells are the two major subsets of CD4 +T helper cells; these two subsets have differentpatterns of cytokine production and differentroles in immune responses. Each subset inducesimmune responses that are effective at handlingcertain types of pathogens, but can be ineffective,or even pathological if made in response to othertypes of pathogens [3,4] . Th1 cells secrete the proinflammatorycytokinesinterferon-γ(IFN-γ), tumornecrosis factor-β (TNFβ), interleukin (IL)-2 andTNFα; these Th1 cytokines activate macrophagesand cell-mediated reactions important in resistanceto infection with intracellular pathogens, andin cytotoxic and delayed-type hypersensitivity(DTH) reactions. Th2 cells secrete IL-4, IL-5, IL-6,IL-10 and IL-13; these Th2-type cytokines inducestrong antibody production and are thereforecommonly found in association with strongantibody responses that are important in combatinginfections with extracellular organisms. Whichtype of reactivity, Th1 or Th2, is activated first mayinfluence the subsequent outcome; if a particularT cell subset is activated first or preferentially ina response, it can suppress the development ofthe other subset. The overall effect is that certainresponses are dominated by either humoral (Th2)or cell-mediated (Th1) immunity [3,4] . Furthermore,Th1 cytokines such as IL-2, TNF-α and IFN-γgenerally tend to provoke inflammatory cellularimmune reactions and are thus also referred to aspro-inflammatory cytokines, while Th2 cytokinessuch as IL-10, IL-13 and IL-4 are consideredanti-inflammatory cytokines as they tend todownregulate inflammatory reactions.What is the Th1/Th2 status during normalpregnancy? Pregnancy seems to bring about ashift towards Th2 bias. Th2 cytokines have beendetected in post-partum human placental tissue [5] ,amniotic fluid [6] , endometrium and decidua ofearly pregnancy [7] , and in supernatants fromcultures of endometrial cells, decidual stroma [7] ,cytotrophoblast [5] and amnion epithelial cells.Piccinni et al [8] demonstrated significantlyhigher levels of IL-4- and IL-10-producing T cellclones from the decidua of women with normalpregnancy than from women with unexplainedrecurrent spontaneous miscarriage (RSM). SomeTh2 cytokines have been shown to be expressedin the human placenta; IL-10 is synthesized by thedecidua, chorion and amnion cells of the placenta [9] ,IL-4 is expressed by the decidua, amniochorionicmembranes, cytotrophoblast and both maternaland fetal endothelial cells [10] .IL-13, an anti-inflammatory Th2 cytokine hasthe capacity to limit inflammatory reactions thatmay arise locally at the site of implantation andwithin the placenta during pregnancy. Dealtryet al [11] demonstrated the expression of IL-13 byhuman trophoblast cells and suggested that IL-13 may play important roles in this dialogue thataids in the establishment and maintenance of theplacenta. There are reports of significantly higherIL-10 production by mitogen-activated PBMC inpregnant women as compared with non-pregnantwomen [12] . Using a sensitive on-line quantitativeRT-PCR Kruse et al [13] reported significantly reducedexpression of Th1 cytokine mRNA during normalhuman pregnancy. Th1/Th2 ratios revealed ashift to a pronounced Th2 status. Significantlyincreased IL-4-producing CD4 + and CD8 + T cellswere demonstrated in normal pregnant womenas compared to non-pregnant women. In contrast,Th1 cytokine-producing T cells were significantlyreduced in pregnancy, which is suggestive of a Th2shift in pregnancy [14] . Th2-type cytokine productionreportedly predominates in the second and thirdtrimesters of pregnancy [15,16] leading to a hypothesisthat successful pregnancy is correlated with andperhaps depends on the preferential stimulation ofTh2 cytokine-producing T cells.Besides an anti-inflammatory effects mediatedby Th2 cytokines, several other non-Th2 cytokineshave positive influences on the conceptus;cytokines such as IL-3, granulocyte-macrophagecolony-stimulating factor (GM-CSF) and colonystimulatingfactor-1 (CSF-1) have been shown to actas growth factors for the placenta [2] .Thus, we can view normal, successful pregnancyas a situation in which the maternal immune systemacts in a “friendly” manner, either not generatingstrong rejection reactions or keeping such reactionsunder check. We can view this as a sort of a“friendly”, protective role of the immune system innurturing the conceptus and ensuring the successof pregnancy.Maintenance of a Protective Th2 Status duringPregnancyIf pregnancy brings about a protective Th2-bias,how is this bias maintained? Cytokines, hormonesand other molecules appear to play critical roles indirecting the immune reactivity towards a Th2 biasand then maintaining it that way. The Th2-inducingeffect of IL-4 predominates over other cytokines,so that if IL-4 levels reach a given threshold,differentiation of Th cells into the Th2 phenotypeoccurs.

June 2009KUWAIT MEDICAL JOURNAL 95One of the most vital cytokines that helpsmaintain a Th2 bias, once initiated, is IL-10; thisanti-inflammatory, immunosuppressive cytokineinterferes with antigen presentation, downregulatescytokine production by Th1 cells and directly orindirectly inhibits NK responses [3,4] . Trophoblastcells produce IL-10 in a gestational age-dependentmanner [12] . Chaouat and colleagues [17] have reportedhigh expression of IL-10 on murine and humantrophoblast and describe the placenta as a “strongTh2 cytokine shield”. Evidence for possibly crucialroles for IL-10 came from the studies of Chaouat etal [18] in which the administration of IL-10 to abortionpronemice was shown to reverse the high rate offetal resorption in these mice. Likewise, Rivera’sgroup showed that the increased uterine TNFα,release of nitric oxide and apoptosis of uterineepithelia that followed administration of LPS wereall normalized upon injection of IL-10 [19] .Hormones have been shown to have importantroles in promoting the differentiation of Th cells orin favoring the shifting of already differentiatedTh cells from one cytokine profile to another.Progesterone at concentrations comparable tothose present at the maternofetal interface, favorsthe development of human T cells producingTh2-type cytokines [20] . Thus, Piccinni proposesthat the high levels of progesterone present atthe maternofetal interface during gestation maycontribute, at least in part, to the development of aprevalent Th2-type profile which allows successfulpregnancy [21] . Progesterone may therefore beresponsible at least in part for a Th1→Th2 switchat the maternal-fetal interface. Hill’s laboratory [22]and our laboratory [23,24] have demonstrated thatthe production of Th1 cytokines by trophoblastantigen-activated peripheral blood mononuclearcells (PBMC) cultures was significantly inhibitedby co-culture with progesterone.Besides bringing about a skew towards Th2reactivity, progesterone has an indirect and veryinteresting mediatory role in influencing theTh1/Th2 balance; Szekeres-Bartho et al havelymphocytes from pregnant females, when exposedto progesterone, produce an immunomodulatoryfactor, the progesterone-induced blocking factor(PIBF). This protein suppresses various cell-mediatedimmune reactions [25,26] . In mice [27] and in humans [28]PIBF upregulates Th2 cytokine production andthus brings about a shift in the Th1 to Th2 cytokinebias. PIBF is proposed to play an important role inpregnancy by helping the conceptus escape immunesurveillance. Thus, priming and maturation of T cellsin pregnancy would seem to occur in an environmentthat is gradually progesterone-enriched. This wouldresult in T cell priming, activation and differentiationin the presence of lower levels of the Th1 cytokinesIL-2 and IFNγ and higher levels of the Th2 cytokinesIL-4 and IL-10, an environment that has been shownto favor the development of Th2 cells [20] . The highlevels of progesterone secreted at the beginning ofpregnancy may well be necessary for the orientationof the maternal immune response against theconceptus towards a Th2-like pattern; these Th2cytokines downregulate the potentially antagonisticTh1 response, thus preventing fetal rejection.It is likely that prostaglandin E (PGE) playsuseful roles in this immunomodulation given itsability to inhibit IL-2 production, to inactivate Th1cells and to inhibit cytotoxic activity of NK cells [29] ;PGE may serve as one of the factors that skew thebalance in favor of Th2 responses. Glucocorticoidsenhance Th2 activity, and synergize with IL-4 [30] ;thus the steroid alterations that occur in pregnancymay influence decidual lymphocytes in favor of aTh2 response.CYTOKINES AND PREGNANCY COMPLICATIONSWe have seen how some cytokine patterns (i.e.,anti-inflammatory Th2 cytokines) are conduciveto successful pregnancy; evidence accruing fromexperiments on animal models and humanssupports the contention that some cytokines aredetrimental to the success of the conceptus. Theactivation of some forms of maternal cellularimmunity is potentially hazardous for fetaldevelopment [31] . Cellular immunity mediated byeffector cells and/or cytokines released by themhave been shown to have significant deleteriouseffects on the conceptus [32,33] . The pro-inflammatory,Th1 cytokines TNFα, IFNγ and IL-2 contributeadversely to the survival of the conceptus. Theinjection of TNFα, IFNγ and IL-2 into pregnant micecauses abortions while the injection of antibodiesto TNFα results in a reduction in abortion ratesin a murine model of natural, immunologicallymediatedabortion [34] . TNFα and IFNγ inhibit theoutgrowth of human trophoblast cells in vitro [35]and synergistically stimulate the programmeddeath of human primary villous trophoblastcells [36] .Gradually, substantial evidence was obtainedto demonstrate an interesting connection betweenTh1 cytokines and pregnancy loss [33,37,38] just asresearchers observed interesting connectionsbetween successful pregnancy and Th2 immunity.How are cytokines associated with clinicalcomplications of pregnancy? Most laypersonsmay think of pregnancy as a very successfulphenomenon, but it is not nearly as successful asone might think; the actual rate of early pregnancyloss after implantation may be as high as 31% [39] .

96The Immune System in Pregnancy: Friend or Foe?June 2009About 15-20% of fertilized embryos are lost withinthe first 2 weeks of fertilization and another 10-15% are lost during the next 12 weeks of gestation.A variety of conditions threaten the success ofthe fetus; these include spontaneous miscarriage,pre-term delivery, pre-eclampsia and prematurerupture of membranes. For these conditions, not allcases can be attributed to the so called “known” or“explained” causes such as chromosomal anomalies,endocrinologic abnormalities, infections, anatomicproblems and humoral factors. For example, asmany as 60% of the cases of RSM are consignedto “unknown” or “unexplained” etiology [40] . Theexistence of such a large proportion of cases withunidentified etiologies has inspired interest in theinvestigation of possible immunologic etiologies ofpregnancy failure.Cytokine Patterns in Recurrent SpontaneousMiscarriageRSM is one of the most common and challengingcomplications of pregnancy faced by obstetricians.Spontaneous miscarriage is defined as a clinicallydetectable pregnancy loss prior to 20 weeks ofgestation; one of every four pregnant womensuffers from one or more pregnancy losses. Onlyabout 40-50% of RSM, defined as the occurrenceof three or more pregnancy losses before the 20thweek of gestation, is attributable to the so called“known” causes such as chromosomal anomalies,endocrinologic abnormalities, infections, anatomicproblems and humoral factors, with as much as60% relegated to “unknown” or “unexplained”etiology [40] . Thus, the causes of RSM remain“unexplained” in the majority of women.Extensive research into immunologic etiologiesand pathogenesis of RSM has shown that theconceptus appears to be fairly impervious toattack by humoral immunity except for antiphospholipidantibodies [41] . This then raised thepossibility of cell-mediated immune effectors aspossible etiologic agents for RSM. This includescellular immunity mediated by effector cells and/or cytokines released by them, and these have beenshown to have significant deleterious effects on theconceptus.Most studies to date suggest that women withRSM have a greater Th1-type or pro-inflammatorycytokine bias as compared to normal pregnantwomen. Hill and colleagues have shown that PBMCof women with a history of RSM when stimulatedwith a human trophoblast antigen extract producehigher levels of the Th1 cytokines and embryotoxicactivity as compared to normal pregnancy [38] .They concluded that Th1 immunity to trophoblastantigens is associated with recurrent miscarriageand may play a role in reproductive failure whileTh2 immunity may be the natural response to thetrophoblast, in contributing to normal, successfulpregnancy [42] .We have published convincing evidence for aclear Th1 cytokine bias in RSM. Peripheral bloodlymphocytes from normal pregnant women at theend of the first trimester and at delivery, and fromrecurrent aborters at the time of abortion, werestimulated with a mitogen and the supernatantstested for Th1 and Th2 cytokines. Levels of severalTh2 cytokines were higher at the end of the firsttrimester and at delivery in normal pregnancy thanin RSM, while the levels of pro-inflammatory Th1cytokines were uniformly higher in RSM than innormal pregnancy [43,44] . This was substantiated bystudies on specific maternal immunity to placentalantigens assessed by co-culturing maternallymphocytes with autologous placental cells andexposing maternal lymphocytes to a trophoblastantigen preparation [45] . Since the absoluteconcentrations of secreted cytokines may not reveala Th1- or Th2-bias per se, we analysed the ratios ofTh1 to Th2 cytokines in the various permutations.In every combination of Th1 to Th2 cytokines, theratios were higher in the RSM group as comparedto the normal pregnancy group, indicating a greaterTh1-bias in RSM and a greater Th2-bias in normalpregnancy.Decreased production of Th2 cytokines andincreased production of Th1 cytokines by antigenstimulatedlymphocytes were demonstratedin women with RSM as opposed to those fromnormal pregnancy [46] . Piccinni et al demonstratedsignificantly higher levels of Th2 cytokineproducingT cell clones from the decidua of womenwith normal pregnancy than from women withunexplained RSM [8] . Most reports thus support thecontention that women with recurrent miscarriageexhibit a predominantly Th1 cytokine pattern,whereas healthy women exhibited decreased Th1cytokines and increased Th2 cytokines; there is thusan increased pro-inflammatory cytokine bias inrecurrent miscarriage [42-48] .How might Th1 cytokines bring aboutspontaneous miscarriage? Several mechanismsinvolving natural killer (NK) cells, activatedmacrophages and direct apoptosis have beensuggested as being responsible for Th1 cytokinemediated effects. Increased NK activity in the bloodand uterus has been linked to miscarriage; in fact,elevated NK levels in the blood has been shown tobe predictive of RSM [49] . While direct cell-mediatedlysis of trophoblast cells by NK cells has not beendemonstrated, it has been proposed that NK cells,like activated Th1 cells, could release inflammatory

June 2009KUWAIT MEDICAL JOURNAL 97cytokines that are harmful to the trophoblast. Hilland Choi speculate that cells in the decidua respondto trophoblast invasion by generating a Th1-dominated response which could be detrimentalto early placental growth and may be toxic to thedevelopment of the embryo [50] . Alternatively Th1cytokines may convert NK cells to lymphokineactivatedkiller (LAK) cells that have been shownto lyse trophoblast cells; levels of LAK cells in theblood correlate with high miscarriage rates [51] .Decidual NK cells are not cytolytic, but produce IFNγwhich activates decidual macrophages which thensecrete toxic levels of nitric oxide [51] . For their part,activated macrophages may bring about damage tothe conceptus not by direct lysis of trophoblast cells,but via the production of nitric oxide and TNFα [52] .The role of Th1 cytokines in this scenario would beto activate such cellular effectors and to also causeapoptotic damage to the placenta.Th1 cytokines, such as TNFα and IFNγ, maydirectly damage the conceptus by apoptosis oftrophoblast cells [37] and by inhibiting the secretionof the growth-stimulating GM-CSF from the uterineepithelium [36] . Clark et al propose that maternal“rejection” of the implanted conceptus may bedue to the process of what they term “cytokinetriggeredvascular autoamputation” which involvesthe activation of coagulation mechanisms, leadingto vasculitis affecting maternal blood supply to theimplanted embryo [53] .Cytokine Patterns in Preterm DeliveryPreterm delivery (PTD) is an important cause ofperinatal morbidity and mortality and a conditionfor which there is a dearth of treatment modalities [54] .It occurs at a rate of 12.5%. Preterm labor is believedto be initiated by inappropriately early activationof elements that initiate normal parturition atterm. Factors that predispose to preterm labor andpreterm delivery include premature rupture of fetalmembranes, pregnancy-induced hypertension,amniotic fluid infection, faulty placentation, seriousmaternal disease and genetic factors. Several factorssuch as changes in the levels of progesterone,oxytocin, relaxin, prostaglandins, cortisol, andcorticosteroids have been studied in relation to theonset of PTD; however, the etiology of many casesof PTD is unexplained [55] .There is strong evidence available to suggestthat pro-inflammatory cytokines are involved inthe sequence of events leading to preterm labourand delivery associated with intrauterine infection.Increased levels of the pro-inflammatory cytokinesIL-1, TNFα, IL-6 and IL-8 have been found inthe amniotic fluid of women with infectionassociatedpreterm labor [56] . Higher levels of IFNγin cervicovaginal fluid, IL-1, TNFα and IL-6 inplacental cells and IL-1β, IL-6 and IL-8 in amnioticand chorionic-decidual tissues and in cervicalsecretions [57] are found in PTD as compared to normalterm delivery. Indeed Romero et al propose thatpreterm labor in the setting of infection results fromthe actions of pro-inflammatory cytokines secretedas part of the fetal and/or maternal host responseto microbial invasions and suggest that a fetal proinflammatorycytokine response is followed by theonset of spontaneous preterm parturition [58] . Dudleysuggests that pre-term labor associated with subclinicalinfection may trigger a dysregulation of alocal inflammatory response leading to a so called“intra-uterine inflammatory response syndrome”leading to pre-term labor and delivery [59] . Even inthe absence of intrauterine infection, pre-term laborhas been shown to be associated with enhancedplacental cytokine production; elevated levels ofIL-1, IL-6 and IL-8 have been demonstrated inpremature parturition with no signs of infection [60] .We have demonstrated that higher levels ofthe Th1 cytokines IL-2 and IFNγ are producedby women with unexplained PTD, while greaterconcentrations of the Th2 cytokines IL-4, IL-5and IL-10 are produced by mitogen-stimulatedperipheral blood lymphocytes from women withnormal pregnancy [61] . Furthermore, the ratios ofTh1 to Th2 cytokines in PTD versus normal termdelivery are indicative of a bias toward strongerpro-inflammatory cytokine reactivity in PTD. Theseobservations support the existence of a so-calledintrauterine cytokine-based inflammatory responsesyndrome which may account for preterm laborwith both infectious and non-infectious etiologies,suggesting that the production of inflammatorycytokines may form the pathophysiologic basis forthis association.Thus, we can view the positive and negativeinfluences of the immune system on pregnancy asa sort of balancing act that needs to be performed toensure the success of pregnancy (Fig. 1).Based on these observations, therapies thatdown-regulate Th1 cytokine reactivity may well bevaluable in the clinical management of recurrentmiscarriage and premature labour and delivery witha predominant Th1 cytokine bias. Various strategiesare worth pursuing; these include the downregulationof Th1 cytokines, the neutralization of Th1cytokines and the upregulation of Th2 cytokines.MODULATION OF CYTOKINE RESPONSESTOWARDS A PREGNANCY-FRIENDLY PATTERNThe demonstration of an association betweenconditions such as RSM and PTD and maternal Th1cytokine bias on the other, has led to research on

98The Immune System in Pregnancy: Friend or Foe?June 2009Fig. 1: The possible influences of maternal Th1 and Th2 immunereactivity on pregnancy. Th1-type cytokines acting directly andvia effector cells such as activated macrophages, activated natural(NK) cells and lymphokine-activated killer (LAK) cells may lead topregnancy complications and pregnancy loss. On the other hand,Th2 cytokines, progesterone, progesterone-induced blockingfactor (PIBF), cytokines such as IL-3, GM-CSF and CSF-1 that haveplacental growth-promoting properties help prevent Th1-mediateddeleterious effects on the conceptus.manipulating the cytokine balance so as to downregulatepro-inflammatory cytokines such as IFNγand TNFα; this is expected to create an environmentthat is more conducive to the success of pregnancy.One approach would be to use a hormone suchas progesterone, which has been shown to haveanti-inflammatory and immunosuppressiveproperties [62] . Piccinni and colleagues demonstratedthat progesterone induces the development ofhuman T cells producing Th2 cytokines [20] . Theypropose that as the Th1 cytokines IFNγ and TNFαmay compromise pregnancy, the production of Th1-inibitory Th2-type cytokines may allow allografttolerance and fetus survival and that progesteronemediatedimmunosuppression is needed for the“natural” maintenance of normal gestation.These observations inspired us to investigatedydrogesterone (6-dehydro-9β, 10α-progesterone)for potential immunomodulatory properties.Dydrogesterone is a potent orally-administeredprogestogen, similar to endogenous progesterone inits molecular structure and pharmacological effects,with a high affinity for the progesterone receptor.We exposed lymphocytes from women with RSM orwith PTD to the progestogens, dydrogesterone andprogesterone, and observed that dydrogesteronebrings about a significantly reduced secretionof the Th1 cytokines IFN-γ and TNF-α, as doesprogesterone. On the contrary, levels of IL-4 and IL-6,both Th2 cytokines, are significantly elevated in thepresence of dydrogesterone or progesterone. Thus,the levels of Th1 cytokines decreased significantlywhile levels of Th2 cytokines increased significantlywhen cells were exposed to dydrogesterone orprogesterone [23] . We found a marked reductionin the ratios of Th1 to Th2 cytokines indicating adecrease in Th1 cytokine bias in lymphocytes fromboth women with RSM [23] and with PTD [24] .In order to ascertain whether dydrogesterone andprogesterone mediate their cytokine-modulatingeffects via the progesterone receptor, we tested theinfluence of the progesterone-receptor antagonist,RU486 on cytokine modulation by dydrogesteroneand progesterone. Since RU486 competes withprogesterone (and dydrogesterone) for theprogesterone-receptor, if the addition of RU486reverses the effects of these substances, it wouldindicate that dydrogesterone and progesterone haveto interact with the progesterone-receptor in orderto affect cytokine production. When PBMC fromsubjects with unexplained RSM were cultured withdydrogesterone or progesterone in the presence orabsence of RU486, we observed increased levels ofIFN-γ and TNF-α which are otherwise suppressedby dydrogesterone and progesterone, and decreasedlevels of IL-4 and IL-6 which are otherwiseupregulated by dydrogesterone and progesterone.Thus RU486 reverses the effects of dydrogesteroneindicating that the effect of dydrogesterone andprogesterone is mediated via the progesteronereceptor [23] .Our data based on laboratory studies indicatethat significantly lower levels of the Th1-typecytokines IFN-γ and TNF-α are produced bylymphocytes exposed to dydrogesterone. Thesetwo cytokines have been shown to deter embryodevelopment, implantation events and proliferationof the trophoblast [54] and to have apoptotic effectson human trophoblast cells [36] . In animals, thesecytokines bring about fetal demise when injectedduring gestation [34] . Furthermore, IFN-γ and TNF-αmay mediate placental / fetal damage via activationof NK activity and macrophages [52] , both of whichin their activated states have been shown to havedeleterious effects on the embryo. Thus, studiesdemonstrating an association between high levelsof these Th1 cytokines and unexplained RSMindicate a potential benefit in down-regulating theirproduction.We found that IL-4 and IL-6, both Th2 cytokines, areupregulated in the presence of dydrogesterone [23,24] .Increased production of IL-4 has been shown to favorfurther Th2 bias which would affect the eventualoutcome of Th1/Th2 dichotomy [3,4] . It is relevant tonote that progesterone has been shown to promotethe differentiation of T cells into Th2 effectors and is

June 2009KUWAIT MEDICAL JOURNAL 99proposed to be responsible for a Th2 switch at thematernal-fetal interface during normal, successfulgestation [20] . In our studies, progesterone wastested at a concentration (10 -5 mol/l) that is similarto that achieved at maternal-fetal tissues. Thusthe increased production of the Th2 cytokine IL-4and the decreased production of the Th1 cytokinesIFN-γ and TNF-α together could well result in asubstantial swing in Th1/Th2 reactivity towardsthe pregnancy-conducive Th2 profile and awayfrom the potentially harmful Th1 profile.In summary, considering that inflammatorycytokines such as IFN-γ and TNF-α may have effectsthat are detrimental to pregnancy and may lead tomiscarriage, a shift in cytokine production patternsaway from a predominance of these cytokines maywell lead to the prevention of pregnancy loss due tomiscarriage.As far as PTD is concerned, a number of recentpublications by several investigators supports theidea that progesterone should be considered forpreventive therapy in women with a history ofspontaneous preterm delivery. Several promisingclinical studies have been reported on the use of 17 α-hydroxyprogesterone caproate (17P), a progestogenthat is structurally related to progesterone anddydrogesterone and that has been used for recurrentmiscarriage and various menstrual disorders inwomen presenting with a history of spontaneousPTD. Administration of 17P in a clinical trial resultedin a significantly lower occurrence of PTD as wellas a reduction in the risk of low birth weight [63] .A recent double-blind, placebo-controlled trial inwomen with a history of spontaneous PTD showedthat weekly injections of 17P led to a substantialdecrease in the rate of recurrent PTD as well as areduction in the likelihood of perinatal mortalityand very low birth weight infants [63] . Furtheranalysis of this data revealed that the use of 17P notonly reduces the overall risk of preterm deliverybut also reduces the risk of preterm birth in womenwith a history of PTD [64] .A recent meta-analysis of randomized controlledtrials concluded that patients treated with 17Phad lower rates of PTD. Administration of 17P orprogesterone suppositories in a clinical trial led toa significant protective effect against PTD in six outof seven published clinical trials [65] . Taken together,these results suggest that patients who have had aprior spontaneous preterm birth may benefit fromprogesterone therapy.Progesterone reduces intracellular calciumlevels and reducing uterine contractility, andpromotes myometrial relaxation, thus sustaininguterine quiescience. This relaxant effect ofprogesterone on the uterus in addition to its abilityto inhibit the oxytocin effect of prostaglandinand stimulation of alpha-adrenergic receptorsmay explain its ability to prevent preterm laborand delivery; our studies described here suggesta possible additional, non-mutually-exclusivemechanism to elucidate the protective effectof progestogens in preterm delivery. Based onevidence that indicates an inflammatory bias inpreterm labour and delivery, shifting the cytokineproduction profile away from an inflammatorybias in the uterus may well lead to the preventionof preterm labour and delivery.Hill et al propose that potentially immunosuppressivedoses of progesterone which hasbeen termed “nature’s immunosuppressant” maybenefit individuals in whom the etiology of RSMrelated to maternal Th1 cytokine predominance [22] .However, progesterone administered orally ispoorly absorbed, is subject to first-pass mechanism,has a short biologic half life [66] , loses much of itsbioactivity [67] and is rapidly cleared [68] . Therefore theorally-active progestogen dydrogesterone is quiteattractive from this perspective.Our data indicates that dydrogesterone, a progestogencurrently indicated for progesterone-related pregnancydisorders, has an immunomodulatory capability – in vitroit appears to be able to induce a maternal cytokine shiftfrom Th1 cytokine dominance towards a Th2 bias, whichhas been described as being conducive to successfulpregnancy [23,24,69] . Our observations are based on in vitrostudies; if clinical trials confirm the immunomodulatory,cytokine-redirecting capability of dydrogesterone,then this molecule may well serve as an effective, safeand orally-administered therapeutic intervention inunexplained RSM and PTD.In summary, it appears that there are very stronginteractions between the immune system and thereproductive system; cross-talk between these twosystems seem to be both positive and negative. Thematernal immune system seems to contribute tothe success of pregnancy, by stimulating responsesthat protect, rather than harm, the fetus. However,inappropriate maternal immune responses seemto be capable of compromising pregnancy. Muchof this cross-talk between the immune system andthe conceptus is done by cytokines, with the Th2type of cytokine pattern nurturing the conceptusand the Th1 type of pattern having deleteriouseffects on the conceptus. Future studies will nodoubt focus on the development of modalities forpreventing and treating such cytokine-mediatedcomplications.ACKNOWLEDGEMENTSThis study was supported by Kuwait UniversityResearch Administration Grant MI02/05.

June 2009KUWAIT MEDICAL JOURNAL 101and trophoblast. J Reprod Immunol 1997; 33:181-187.30. Rook GA, Hernandez-Pando R, Lightman SL.Hormones, peripherally activated prohormones andregulation of the Th1/Th2 balance. Immunol Today1994; 15:301-303.31. Raghupathy R. Pregnancy: success and failure withinthe Th1/Th2/Th3 paradigm. Semin Immunol 2001;13:219-227.32. Clark DA, Arck PC, Chaouat G. Why did yourmother reject you? Immunogenetic determinantsof the response to environmental selective pressureexpressed at the uterine level. Am J Reprod Immunol1999; 41: 5-22.33. Hill JA, Polgar K, Harlow BL, Anderson DJ. Evidenceof embryo- and trophoblast-toxic cellular immuneresponse(s) in women with recurrent spontaneousabortion. Am J Obstet Gynecol 1992; 166:1044-1052.34. Chaouat G, Menu E, Clark DA, Dy M, MinkowskiM, Wegmann TG. Control of fetal survival inCBAxDBA/2 mice by lymphokine therapy. J ReprodFertil 1990; 89:447-458.35. Haimovici F, Hill JA, Anderson DJ. The effects ofsoluble products of activated lymphocytes andmacrophages on blastocyst implantation events invitro. Biol Reprod 1991; 44:69-75.36. Smith SC, Guilbert LJ, Yui J, Baker PN, Davidge ST.The role of reactive nitrogen/oxygen intermediatesin cytokine-induced trophoblast apoptosis. Placenta1999; 20:309-315.37. Arck P, Dietl J, Clark D. From the decidual cellinternet: trophoblast-recognizing T cells. Biol Reprod1999; 60:227-233.38. Hill JA, Polgar K, Anderson DJ. T- helper 1-typecellular immunity to trophoblast in women withrecurrent spontaneous abortions. JAMA 1995;273:1933-1936.39. Li TC, Makris M, Tomsu M, Tuckerman E, Laird S.Recurrent miscarriage: aetiology, management andprognosis. Hum Reprod Update 2002;8:463-481.40. Carrington B, Sacks G, Regan L. Recurrentmiscarriage: pathophysiology and outcome. CurrOpin Obstet Gynecol 2005; 17:591-597.41. Rote NS. Antiphospholipid antibodies other thanlupus anticoagulant and anticardiolipin antibodiesin women with recurrent pregnancy loss, fertilecontrols and antiphospholipid syndrome. ObstetGynecol 1997; 90:642-644.42. Polgar K, Hill JA. Identification of the white bloodcell populations responsible for Th1 immunity totrophoblast and the timing of the response in womenwith recurrent pregnancy loss. Gynecol Obstet Invest2002; 53:59-64.43. Makhseed M, Raghupathy R, Azizieh F, Al-AzemiMM, Hassan NA, Bandar A. Mitogen-inducedcytokine responses of maternal peripheral bloodlymphocytes indicate a differential Th-type biasin normal pregnancy and pregnancy failure. Am JReprod Immunol 1999; 42:273-281.44. Raghupathy R, Makhseed M, Azizieh F, Omu A,Gupta M, Farhat R. Cytokine production by maternallymphocytes during normal human pregnancy andin unexplained recurrent spontaneous abortion.Hum Reprod 2000; 15:713-718.45. Raghupathy R, Makhseed M, Azizieh F, Hassan N,Al-Azemi M, Al-Shamali E. Maternal Th1- and Th2-type reactivity to placental antigens in normal humanpregnancy and unexplained recurrent spontaneousabortions. Cell Immunol 1999; 196:122-130.46. Marzi M, Vigano A, Trabattoni D, et al. Characterizationof type 1 and type 2 cytokine production profile inphysiologic and pathologic human pregnancy. ClinExp Immunol 1996; 106:127-133.47. Jenkins C, Roberts J, Wilson R, MacLean MA,Shilito J, Walker JJ. Evidence of a Th1 type responseassociated with recurrent miscarriage. Fertil Steril2000; 73:1206-1208.48. Lim KJ, Odukoya OA, Ajjan RA, Li TC, Weetman AP,Cooke ID. The role of T-helper cytokines in humanreproduction. Fertil Steril 2000; 73:136-142.49. Coulam CB, Goodman C, Roussev RG, ThomasonEJ, Beaman KD. Systemic CD56+ cells can predictpregnancy outcome. Am J Reprod Immunol 1995;33:40-46.50. Hill JA 3rd, Choi BC. Immunodystrophism: evidencefor a novel alloimmune hypothesis for recurrentpregnancy loss involving Th1-type immunity totrophoblast. Semin Reprod Med 2000; 18:401-405.51. Loke YW, King A. Decidual natural-killer-cellinteraction with trophoblast: cytolysis or cytokineproduction? Biochem Soc Trans 2000; 28:196-198.52. Baines MG, Duclos AJ, Antecka E, Haddad EK.Decidual infiltration and activation of macrophagesleads to early embryo loss. Am J Reprod Immunol1997; 37:471-477.53. Knackstedt M, Ding JW, Arck PC, et al. Activationof the novel prothrombinase, fg12, as a basis for thepregnancy complications spontaneous abortion andpre-eclampsia. Am J Reprod Immunol 2001; 46:196-21054. Iams JD, Creasy RK. Maternal-Fetal Medicine, In:Creasy RK, Iams JD, Resnik R, editors. Philadelphia:WB Saunders; 2004. p 623-661.55. Cunningham FG, Leveno KJ, Gilstrap LC, Hauth JC,Wenstrom KD, Bloom SL. Williams Obstetrics. NewYork, McGraw-Hill Education, 2005.56. Keelan JA, Blumenstein M, Helliwell RJ, Sato TA,Marvin KW, Mitchell MD. Cytokines, prostaglandinsand parturition- a review. Placenta 2003; 24:S33-S46.57. Keelan JA, Marvin KW, Sato TA, Coleman M,McCowan LM, Mitchell MD. Cytokine abundancein placental tissues: evidence of inflammatoryactivation in gestational membranes with term andpreterm parturition. Am J Obstet Gynecol 1999;181:1530-1536.58. Romero R, Espinoza J, Goncalves LF, KusanovicJP, Friel L, Hassan S. The role of inflammation andinfection in preterm birth. Semin Reprod Med 2007;25:21-39.59. Dudley DJ. Pre-term labor: an intra-uterineinflammatory response syndrome? J ReprodImmunol 1997; 36:93-109.60. Arntzen KJ, Kjollesdal AM, Halgunset J, VattenL, Austgulen R. TNF, IL-1, IL-6, IL-8 and solubleTNF receptors in relation to chorioamnionitis andpremature labor. J Perinat Med 1998; 26:17-26.

June 2009KUWAIT MEDICAL JOURNAL 103Original ArticleComparative Efficacy of Two Methods ofSkin Preparation of the Perineal and GenitalSkin of Male Urological PatientsElijah O Kehinde 1 , Wafaa Jamal 2 , Yousif Ali 1 , Fathima Khodakhast 2 , Mohammed Sahsah 1 , Vincent O Rotimi 21Departments of Surgery (Division of Urology) and 2 Microbiology, Faculty of Medicine, Kuwait University, KuwaitABSTRACTKuwait Medical Journal 2009; 41 (2): 103-107Objective: To compare the efficacy of two methods of skinantiseptic preparations of the genitalia and perineum inmale urological patientsDesign: Prospective studySetting: Mubarak Hospital, KuwaitSubjects: Adult male patients of two study groupsnumbering 114 (group-1) and 117 (group-2) admitted forcystoscopic proceduresIntervention: The perineum and genitalia of patients inboth groups were prepared by applying chlorhexidinecetrimidemixture (CCM) and CCM plus povidone-iodinesolution respectively.Main Outcome Measures: Swab specimens were obtained fromthe perineum and genitalia, before cleaning and disinfection(specimen A), after disinfection and draping (specimen B) andafter the completion of the operative procedure (specimenC). Specimens were cultured on appropriate media andrepresentative colonies identified by standard methods.Results: In groups 1 and 2, the A specimen yielded bacterialgrowth in 35.1 and 63% of patients, respectively. Thecommonest isolates in both groups were Gram-positivebacteria (89.2%) while Gram-negative bacteria accounted foronly 10.8%. The B and C specimens in group-1 yielded positivebacterial culture in 7.1 and 11.4% patients respectively. Ingroup-2, specimens B and C yielded bacterial growth in 5.1and 2.6% patients respectively. In both groups, there wasa significant reduction of patients with culture-positive Bspecimens after skin disinfection (p < 0.001). The isolationrate of bacteria in specimen C in group-2 was significantlylower than group-1 patients (p < 0.001).Conclusion: The addition of povidone-iodine to the CCMbased regimen of perineal skin antiseptic preparation isassociated with longer and more effective skin disinfectionin male urological patients.KEY WORDS: antiseptics, bacterial flora, male patients, perineum, skin preparationINTRODUCTIONThe perineal route is increasingly being usedin male urological patients for diagnostic andtherapeutic procedures. These procedures rangefrom transperineal prostate biopsy to insertion ofartificial urinary sphincter (AUS) for stress urinaryincontinence [1] . Although it is generally assumedthat the perineum is often heavily contaminatedwith microorganisms derived from the rectum, thereis paucity of information in the literature regardinginfectious complications after performing diagnosticor therapeutic maneuvers via the percutaneoustransperineal route. With increasing use of theperineal route in urological practice, it is essentialto study the resident bacterial flora of the maleperineum so as to provide baseline data that couldhelp in predicting the causative agents in post-operative perineal infections and possibly helpin developing a policy for appropriate antibioticprophylaxis or empirical treatment of such infections.This is extremely important when implants like AUSare inserted in the perineum. It has been shown thatinfection of the prosthetic implant is almost alwaysdue to organisms that are part of the patient’s skinflora, with Staphylococcus spp. being the commonestinfecting organisms [1-4] . The prevention of surgical siteinfections (SSIs) has helped to revolutionize surgeryfrom a practice plagued by frequent infections anddeath into one that is more acceptable in the disciplinetoday. However, infections related to surgery continueto remain a problem [5,6] .Data from the USA Center for Disease Control andPrevention (CDC), through the National NosocomialInfections Surveillance (NNIS) System, indicate thatAddress correspondence to:Prof Elijah O Kehinde, MBBS, FRCS, MD, Department of Surgery (Division of Urology), Faculty of Medicine, Kuwait University, P.O. Box24923, Safat - 13110, Kuwait. Tel: 00 965 2531 9475, Fax: 00 965 2531 9597, E-mail: ekehinde@hsc.edu.kw

104Comparative Efficacy of Two Methods of Skin Preparation of the Perineal and Genital Skin ...June 2009SSIs are the third most common infection reported,accounting for 14-16% of all nosocomial infections [5,6] .Evidence also shows that SSIs are the most commonnosocomial infection in surgical patients [7] . In addition,apart from costlier hospital stay, patients who developSSIs carry an overall two-fold higher mortality rate,which is independent of their initial surgical risk andother survival predictors [8-11] . Thus, the preventionof this surgical complication represents a significantimpact not only on cost and quality of life but also onmortality.The goal of surgical prophylaxis is not to sterilizea patient but rather to decrease the bacterial burdenat the surgical site. Prophylaxis augments the host’snatural immune defense mechanisms by increasingthe magnitude of a bacterial inoculum needed tocause an infection [12] . Since the cause of post-operativeinfection can be multifactorial, so the preventionefforts should be multifactorial as well. Apart fromthe appropriate use of prophylactic antibiotics toreduce SSIs, other factors that are important includeunderstanding the microbiology of the surgical siteand resultant infections [13] . In most instances of SSIs,the patient’s endogenous flora is largely the mainetiological factor [13] . Theoretically, the combinationof surgical site disinfection and appropriate systemicprophylactic antibiotics should decrease the chancesof wound infection. However, the use of pre-operativecleansing with an antibacterial solution, such aschlorhexidine or other antiseptics has been shown todecrease the bacterial burden of normal skin flora [5,6] .Unfortunately, this has not been definitely shown totranslate into decreased rates of SSIs [5] . Hence, the aimof this study was to compare the efficacy of a singleantiseptic versus combined antiseptic on perinealskin preparation.SUBJECTS AND METHODSThe PatientsBetween 2003 and 2007, all consecutive malepatients undergoing in-patient cystoscopic proceduresincluding transurethral resection of the prostate(TURP) and transurethral resection of bladder tumor(TURBT) in the urology unit of our hospital wereincluded in this study. Informed consent was obtainedfrom each patient after careful explanation of thescope of the study. In addition, approval was obtainedfrom the local Ethics Committee. The biodata of eachpatient, including age and underlying diseases, werecarefully recorded in a protocol sheet. Adult malein-patients undergoing cystoscopic procedures wererandomized into two groups for perineal and genitalskin disinfection. Patients were anesthetized and thenplaced in the lithotomy position on the operating table.In group-1 patients, the perineal and genital areas wasscrubbed three times using savlon® (chlorhexidinecetrimide mixture [CCM]) only. In group-2 patients,the area was scrubbed twice initially using savlon ®and a third time with betadine® (povidone-iodinesolution).The SpecimensBefore scrubbing the perineum and genitals withantiseptics described above, specimens were takenfrom a midline perineum between the root of the penisand 5 cm from the anal orifice using commerciallyavailable albumin-coated sterile cotton wool swab(Medical Wire and Equipment Co Ltd, Corsham,Wilshire, England). The perineum was rubbed upand down 4-6 times with the same swab and thendipped into semisolid Amies’ transport medium.This first swab specimen was labeled specimenA. After application of the antiseptic regimen anddraping of the patient, a second specimen labeledB was obtained. On completion of the surgicalprocedure and after removal of all drapes, but beforethe patients limbs were removed from the stirrups, athird swab specimen labeled C was taken. All swabspecimens were taken in duplicates. Time takento complete the surgical procedure was carefullyrecorded. All patients received antibiotic prophylaxisprior to undergoing surgical procedures. Thisconsisted of intravenous amikacin 500 mg in patientswith normal renal function or ceftriaxone 2 g in thosewith significant renal impairment (serum creatinine> 250 µmol/l). All specimens were transportedimmediately to the Anerobic Reference and HospitalInfection Laboratory (Department of Microbiology,Kuwait University, Kuwait) and processed withinone hour of collection.The temperature chart of patients was checked 24and 48 hours after the surgical procedures. Patientswith temperature > 38 o C had urine and blood culturestaken and were treated using appropriate antibiotics.Microbiologic InvestigationIn the laboratory one of the duplicate swabs wasplaced in 2 ml sterile thioglycolate broth (Oxoid,Basingstoke, Hampshire, UK) in sterile universalbottles and vigorously vortexed. Viable count wasperformed on the eluted suspension by serial 10-folddilutions of 100 µl samples in sterile Eppendorf tubescontaining 900 µl of appropriate sterile broth with afinal dilution ranging from 10 -1 to 10 -8 . Dried agar plateswere marked into six sectors, and three 10 µl aliquots ofeach dilution were plated onto the three sectors. Oncedry, plates were incubated in appropriate incubatorsovernight at 37 o C. Colonies were counted in sectorscontaining a measurable number in triplicate and thenumber of colony forming units per millilitre (cfu/ml)calculated. The other swab was routinely streaked ontoa set of selective and non-selective media includingMacConkey agar (Oxoid, Basingstoke, UK), Brucellaagar (Oxoid) supplemented with 5% horse blood,

June 2009KUWAIT MEDICAL JOURNAL 105Table 1: Clinical characteristics of patients in the studyBiodataClinical CharacteristicsIndications for cystoscopyPCa + BPH **TCC BladderCheck cystoscopyURS + DormiaJ stent InsertUnderlying diseasesNoneDiabetesCreatinine > 250 µmol/LUrethral catheter ***Post renal TPXPrevious hospital admissionNone< 7 days8-15 days> 15 daysPost-op septicemiaPatient CatagoryGroup - 1(n = 114)Age* (Mean)yrs: 54Range: 13-85n %364513119713271356429201831.639.511.49.77.962.328.16.111.44.456.125.417.50.97.1Group 2(n = 117)Age* (Mean)yrs: 55.3Range: 20-79n %p-valueBlood agar (Oxoid) supplemented with gentamicin75 ug/ml, vitamin K1 1 µg/ml, haemin 1 µg/ml andL-cysteine HCL 5 µg/ml and plain Blood agar (Bloodagar base, [Oxoid], plus 5% blood). The second swabwas inoculated onto the surface of similar media.A set of inoculated Brucella agar, gentamicin Bloodagar and plain Blood agar plates were incubatedfor 2-5 days anerobically in jars rendered anerobicusing the Anoxomat WS 8000 machine (MARTMicrobiology, Holland). The MacConkey andanother Blood agar were incubated in air at 37 o C for24 hour. Representative colonies were gram-stainedand identified by the automated VITEK ID system(BioMerieux Inc., Hazelwood, MO, USA) and API20A (BioMerieux, Inc., Marcy Etiole, France). Sterileculture meant no growth. Swab colonization wasdefined as a colony count ≥ 10 per plate. Significantbacterial colonization of the perineum was definedas positive culture with greater than 10 2 cfu/ml oforganisms [14] .Statistical AnalysisThe data were analyzed using the statisticalsoftware SPSS for Windows version 12.0.The chi square (χ 2 ) test was used to examine theassociation between two categorical variables, andthe normal Z test was used to assess the differencebetween two proportions. A p-value of < 0.05 was used404311158773291436923223334.236.89.412.86.865.827.47.712.02.659.019.718.82.62.6 0.01* Our unit does not operate on pediatric patients (age < 12 years);** For either channel TURP for prostate cancer (PCa) or TURPfor BPH; *** Some patients had systemic diseases and were onurethral cathetersas a cut- off level for statistical significance. A p-valuefor trend was also calculated where appropriate.RESULTSA total of 231 patients, randomly assigned intogroup-1 (114 patients) and group-2 (117 patients),were enrolled for this study. The results of the biodataanalysis are shown in Table 1. There was nostatistically significant difference in the distribution ofpatients, indications for surgery, presence of systemicdiseases and previous hospital admissions betweenthe two groups. The average ages were 54 years ingroup-1 and 55.3 years in group-2. There were higherand significant number of patients who developedbacteremia / septicemia in group-1 (8; 7.1%) versus(3; 2.6%) in group-2, (p < 0.01).Tables 2 and 3 show the results of cultured swabspecimens obtained from the two groups of patients.Culture of specimens A obtained from 40 (35.1%) outof 114 patients in group-1 and 74 (63%) out of 117patients in group-2 yielded positive bacterial growth.In contrast, specimen B cultures yielded positivegrowth only in 8 (7%) and 6 (5.1%) patients in groups 1and 2, respectively, a statistically significant reductionin the number of patients with persistent bacterialflora in the perineum post-antiseptic disinfection(p < 0.001). All these specimens also yielded morethan 3 log10 cfu/ml reduction in colony counts (p

106Comparative Efficacy of Two Methods of Skin Preparation of the Perineal and Genital Skin ...June 2009Table 3: The bacteria isolates from all patients in Groups 1 and 2(N = 231).Micro-organisms No. of patients (N = 231) %Gram -veE. coliKlebs. pneumoniaeProteus mirabilisPseudomonas sppE. faecalis *Sub TotalGram +veS. haemolyticusS. epidermidisS. hominisS. warneriOthersSub TotalGross TotalGoup - 1n = 63513121028104295363Goup - 2n = 76Gross Totaln = 139DISCUSSIONThe ideal antiseptic is one that is rapidly lethalto all forms of bacteria and their spores, capableof bactericidal activity for a prolonged period,has no injurious effects on wound tissues or skin,delineates the operation site and is easily applied andremoved [15] . The antiseptic used in skin preparationsand the sequence in which they are used is a matterof individual surgeon’s preference with variationsfrom unit to unit and even within the same surgicalunit as shown by McGrath and McCory [16] in asurvey of pre-operative skin preparation practicesin surgical units and among surgeons in NorthernIreland. The outcome of our current study seemsto justify our unit’s policy of using Savlon® as theantiseptic of choice for perineal skin disinfectionprior to endoscopic procedures as its use wasassociated with significant reduction in the numberof patients with culture-positive bacteria as well as inthe quantity of the bacterial isolates as demonstratedin specimens B compared with samples A in bothgroups of patients. Our study further demonstratedthat instead of using Savlon® alone to clean threetimes, the addition of an iodine-based antisepticagent like Betadine® appears to guarantee betterand more efficient disinfection. The use of Savlon®twice followed by further disinfection with Betadinereduced positive microbiological culture rate to 2.6%in swab C of group-2 patients, compared to 11.4% ingroup-1 (p < 0.001). This is because iodine containingantiseptics like Betadine®, in addition to havingstrong bacteriostatic activity are also known to kill040105281546871765532215563588171241393.63.62.21.41.410.840.325.25.85.812.289.2100Over all positive culture 139/231 (60.2%) patients* Two patients had E. faecalis + E.coli isolated from the perinealswab. Both patients were on urethral catheter for more than 28days before surgeryTable 4: Distribution of bacterial isolates before and after skinpreparation with antisepticsBacterial isolatesGram +veS. haemolyticusS. epidermidisS. hominisS. warneriOthersGram –veE. coli *Klebsiella sppProteus mirabilisPsuedomonas sppE. faecalis*Total no.of patientsTotal (%)No. of patients with positive culture in specimensGroup - 1 (n = 114) Group - 2 (n = 117)A B C A B C1783155020243(35.1)10012011107(7.1)bacteria, fungi, viruses and spores [17,18] . The bacteriaisolation rates from the specimens of the two patientgroups were significantly reduced (p < 0.001) postdisinfectionof the perineum and genitalia.In this study, our patients had about six-foldhigher isolation rates of Gram-positive bacteriathan the Gram-negative bacteria, a finding that wasstatistically significant (p < 0.001). Of these Grampositivebacteria, S.haemolyticus was by far the isolatemost frequently present in the perineum of thesepatients, including those with or without underlyingco-morbidity. This finding is essentially similar to thereports of Magera et al [1] and Larson et a l[19] which alsofound S.haemolyticus as the commonest isolate in theirpatients compared with S. hominis in controls. The nextfairly common isolate was S.epidermidis but we did notisolate S. hominis or S.aureus from any of the patientswhich essentially also supports earlier report [19] . Ofparticular concern are the high isolation rates of thecoagulase-negative staphylococci (CoNS) whichare increasingly becoming important in nosocomialinfections and infections in immunosuppressedindividuals.Post-operative septicemia occurred in morepatients in group-1 compared to group-2, althoughthe difference was not statistically significant. Allthe patients had endoscopic procedures; thereforethey would be expected to have a low septicemiarate. Importantly, the efficacy of adding Betadineto the perineal skin antiseptic preparation regimenis demonstrated by the drastic reduction in thenumber of patients with positive perineal cultureand the bacterial load post-disinfection as well as thesignificant lower septicemia rate in group B patients.1021000000013(11.4)281546190401076(63)32001000006(5.1)11001000003(2.6)*E. faecalis and E. coli isolated from the perineal swabs of twopatients who were on indwelling urethral catheter for more than28 days prior to surgery

June 2009KUWAIT MEDICAL JOURNAL 107CONCLUSIONBoth methods of perineal and genital skindisinfection resulted in a significant reduction ofbacterial isolates in specimen B compared to specimenA (p < 0.001). Group-2 patients had lower bacteriaisolation rate from specimen C compared to group-1 patients (p < 0.01). These data demonstrate thatthe addition of Betadine® to the regimen of perinealand genital skin antiseptic preparation promoteslonger and a more effective perineal and genital skindisinfection in adult male urological patients.REFERENCES1. Magera JS Jr, Inman BA, Elliott DS. Does preoperativetopical antimicrobial scrub reduce positive surgicalsite culture rates in men undergoing artificial urinarysphincter placement? J Urol 2007; 178:1328-1332.2. Darouiche RO. Device-associated infections: amacroproblem that starts with microadherence. ClinInfect Dis 2001; 33:1567-1572.3. Vinh DC, Embil JM. Device- related infections: areview. J Long Term Eff Med Implants 2005; 15:467-488.4. Montague DK. Periprosthetic infections. J Urol 1987;138:68-69.5. Mangram AJ, Horan TC, Pearson ML, Silver LC,Jarvis WR. Guideline for prevention of surgical siteinfection, 1999. Hospital Infection Control PracticesAdvisory Committee. Infect Control Hosp Epidemiol1999; 20:250-278.6. Emori TG, Gaynes RP. An overview of nosocomialinfections, including the role of the microbiologylaboratory. Clin Microbiol Rev 1993; 6:428-442.7. National Nosocomial Infections Surveillance [NNIS]System report, data summary from October 1986- April 1998, issued June 1998. Am J Infect Control1998; 26:522-533.8. Akalin HE. Surgical prophylaxis: the evolution ofguidelines in an era of cost containment. J Hosp Infect2002; 50: S3-S7.9. Kirkland KB, Briggs JP, Trivette SL, Wilkinson WE,Sexton DJ. The impact of surgical-site infections inthe 1990’s: attributable mortality, excess length ofhospitalization, and extra costs. Infect Control HospEpidemiol 1999; 20:725-730.10. Whitehouse JD, Friedman ND, Kirkland KB,Richardson WJ, Sexton DJ. The impact of surgicalsiteinfections following orthopedic surgery at acommunity hospital and a university hospital:adverse quality of life, excess length of stay and extracost. Infect Control Hosp Epidemiol 2002; 23:183-189.11. Poulsen KB, Wachmann CH, Bremmelgaard A,Sorensen AI, Raahave D, Petersen JV. Survival ofpatients with surgical wound infection: A case-controlstudy of common surgical interventions. Br J Surg1995; 82:208-209.12. Houang ET, Ahmet Z. Intraoperative woundcontamination during abdominal hysterectomy. JHosp Infect 1991; 19:181-189.13. Nguyen HH, Cohen SH. Prevention of surgical-siteinfections, In: Lubin MF, editor. Medical managementof the surgical patients. A text book of preoperativemedicine. 4th ed. UK: Cambridge University Press;2006. p 287-306.14. Sanderson PJ, Rawal P. Contamination of theenvironment of spinal cord injured patients byorganisms causing urinary- tract infection. J HospInfect 1987; 10:173-178.15. Connell JF Jr, Rousselot LM. Povidone-iodine.Extensive surgical evaluation of a new antisepticagent. Am J Surg 1964; 108:849 - 855.16. McGrath DR, McCrory D. An audit of pre-operativeskin preparative methods. Ann R Coll Surg Engl 2005;87:366-368.17. Zintel HA. Asepsis and antisepsis. Surg Clin NorthAm 1956; 36: 257-271.18. Lowbury EJ, Lilly HA, Bull JP. Disinfection of the skinof operation sites. Br Med J 1960; 2:1039-1044.19. Larson EL, McGinley KJ, Foglia AR, Talbot GH,Leyden JJ. Composition and antimicrobic resistanceof skin flora in hospitalized and healthy adults. J ClinMicrobiol 1986; 23:604-608.

108KUWAIT MEDICAL JOURNAL June 2009Original ArticleThe Results of Thoracoscopic Surgery for SecondarySpontaneous PneumothoraxAdel K Ayed 1 , Chazian Chandrasekran 21Department of Surgery, Faculty of Medicine, Kuwait University, and 1,2 Chest Diseases Hospital, KuwaitKuwait Medical Journal 2009; 41 (2): 108-111ABSTRACTObjective: To review our experience of video-assistedthoracoscopic surgery for the treatment of secondaryspontaneous pneumothorax caused by bullousemphysemaDesign: Prospective studySetting: Chest Diseases Hospital, KuwaitSubjects: Forty-six consecutive patients who underwentthoracoscopy for secondary spontaneous pneumothoraxby a single surgeon during a five year periodIntervention: Video-assisted thoracoscopic bullectomyand pleural symphysis procedureMain Outcome Measure: Resolution of pneumothoraxResults: Mean age of patients was 49.3 years (range :38 - 70 years), and 44 were men (96%). All patients hadbullous emphysema; their mean preoperative forcedexpiratory volume in one second (FEV1) was 54.4% ofpredicted and mean forced vital capacity (FVC), 66.9%of predicted. Persistent pneumothorax was the mostfrequent indication for surgery, occurring in 35 patients(76%). The most common method of management wasstapling of an identified bulla, which was done in allpatients. Pleurodesis was achieved by gauze abrasion(n = 23) and apical pleurectomy (n = 23). Postoperativeprolonged air leak occurred in seven patients (15%),six in the pleural abrasion group and one in theapical pleurectomy group (p = 0.04). The mean (± SD)postoperative hospital stay was 5.7 ± 4.5 days. Meanfollow-up is 42 months (range = 36 - 54 months) for allpatients. Pneumothorax recurred in three patients (6.5%)in whom pleural abrasion was done. The recurrencesoccurred in the first six months of follow-up.Conclusions: Video-assisted thoracoscopic surgery isa safe procedure in the treatment of select secondaryspontaneous pneumothorax caused by bullousemphysema. Apical pleurectomy is a more effective wayof producing pleural symphysis.KEY WORDS: pleurodesis, spontaneous pneumothorax, thoracoscopic surgeryINTRODUCTIONSpontaneous pneumothorax (SP) can be divided intoprimary SP resulting from rupture of subpleural blebs,and secondary SP, which is related to the presence ofan underlying lung disease(e.g., bullous emphysema,tuberculosis). The indications for surgical treatmentinclude persistent air leak, recurrent SP, contralateral SP,and SP in a high-risk occupation, such as pilot or diver [1] .The aims of surgical treatment are to close the site of theair leak, to allow full re-expansion of the lung, and toprevent future recurrence [1] . The use of video-assistedthoracoscopic surgery (VATS) has been advocated andused as an alternative to thoracotomy in the treatmentof primary SP [2-4] . The standard surgical treatment forsecondary SP is through a thoracotomy approach,with very low recurrence rate [1] . Surgical interventionby means of thoracotomy in the setting of secondarySP is associated with a much higher morbidity than inthe setting of primary SP [5] . The role of VATS and itslong-term results for patients with secondary SP is stillunclear [2,6,7] . The aim of this study was to describe ourexperience in Kuwait and to report on the long-termfollow-up of 46 consecutive patients with secondary SPcaused by bullous emphysema.SUBJECTS AND METHODSThe study was conducted at the Chest DiseasesHospital, which is the only center for the surgicaltreatment of chest disorders in Kuwait. From January2002 to December 2005, 46 patients with persistent orrecurrent secondary SP were treated by VATS; thesepatients comprise the study subjects. Preoperativeinvestigations included a chest radiograph, a computedtomography of the chest, complete blood count, serumAddress correspondence to:Dr. Adel K. Ayed, Professor, Department of Surgery, Faculty of Medicine, Kuwait University, P.O. Box: 24923, 13110 - Safat, Kuwait. Tel: 965-5319475, Fax: 965-5319597, E-mail: adel@hsc.edu.kw

June 2009KUWAIT MEDICAL JOURNAL 109electrolytes, renal function tests, and spirometry. Thestudy was approved by the local ethical committee.Operative Technique of VATSThe patient was administered general anesthesiausing a double-lumen endotracheal tube to allowsingle lung ventilation. The patient was placed ina posterolateral thoracotomy position. A 10-mmtrocar was introduced through 1.5-cm skin incisionin the eighth intercostal space at midaxillaryline for insertion of a 0° videothoracoscope (KarlStorz; Tuttlingen, Germany). Two additional portswere then inserted under direct vision: a 12-mmtrocar through the fifth intercostal space on theanterior axillary line, and a 12-mm posterior trocarthrough the fifth intercostal space near the tip ofthe scapula. The bulla was identified and graspedwith empty sponge stick. The excision was done byusing an ENDO-GIA stapling device (Auto SutureCompany; United States Surgical Corp; Northwalk,CT). Then, a parietal pleural abrasion by gauze orapical pleurectomy was performed. Pleurectomywas performed with a hook electrocautery; thelongitudinal limit of the resection ran in an apicaldirection along the sympathetic trunk to the heightof the left subclavian artery or the brachiocephalictrunk on the right side. The pleura was incised atleast one cm away from the sympathetic trunk.Then it was grasped with the endograsper, raised,and divided with the dissector. Once the plane wasdeveloped pleural stripping was achieved by liftingthe pleural flap with the aid of a gauze pledget. Thearea of pleurectomy requires precise hemostasis.None of the patients had bleeding complications.A 28 F chest tube was inserted through the inferiorincision in the eighth intercostal space and connectedto underwater seal suction with a negative pressureof 20 cm H 2O.Postoperative CareAll patients were extubated in the operating roomand transferred to the thoracic surgery ward. Antibioticin the form of cefoxitin was give to all patients. Ananalgesic, pethidine, was administered IM every 4 to6 h according to patient request, and an oral analgesic(acetaminophen) was given as needed. The intercostaldrain was removed when the underlying lung wasfully expanded with no air leakage and < 100 mlpleural fluid drained through the tube for 24 h. Allpatients were discharged the day after removal of thechest tube.Postoperative AssessmentData recorded for all patients included the numberof episodes of pneumothorax, and the operative time.The output and the duration of the pleural drainageafter operation, the amount of analgesia given inthe first 24 h after the operation, length of hospitalstay, postoperative air leak, and recurrences werealso recorded. The follow-up chest radiograph wasdone at intervals of one week, one month, and threemonths, and then the patients were followed upwith a telephone communication for this study. Therecurrence was proved by chest radiography duringfollow-up period.Statistical AnalysisData were expressed as mean ± SD. Data analyseswere made using SPSS software windows version-8 package (SPSS, Chicago, IL). The cut-off level forstatistical significance was a p-value of less than0.05. The unpaired Student’s t test was used to assessthe significance between means of variables in thegroups. The Pearson χ 2 test was used to ascertain thesignificance of association between two categoricalvariables. The χ 2 test was replaced by Fisher’s exacttest if the cell frequencies of any of the 2 χ 2 contigencytables went below five.RESULTSThis series included 44 male and two femalepatients (mean age, 49.3 ± 10.3 years, range 38 to 70years). In all cases , secondary SP was diagnosed onthe basis of the existence of emphysematous bullousdisease confirmed by chest radiographic appearance,computed tomography of the chest, and preoperativespirometry; the mean forced expiratory volume atone second FEV1) was 54.4% of predicted ( range, 43- 110%); and the forced vital capacity (FVC) was 66.9%of predicted ( range, 47 - 110%).Thirty-five patients (76%) were operated uponwhen they had persistent air leak more than sevendays. In eleven patients (24%), VATS was done becauseof a recurrent episode of SP. VATS was unilateral in allcases and all procedures were performed by the samesurgeon, on the right side in 35 cases (76%) and onthe left side in 11 cases (24%). Extension of the trocarincisions was necessary in three patients because ofadhesions.The operative time was 62.3 ± 9.8 minutes (range,40 - 90 minutes). Pleural procedures performedincluded gauze abrasion in 23 cases (50%) and apicalpleurectomy in 23 cases (50%). The clinical data onthese procedures are shown in Table 1.All patients were extubated at the end of theoperation, and no patient required mechanicalventilation during the postoperative period.The mean amount of postoperative analgesia in theform of pethidine was 101.9 ± 26.8 mg in the first 24 h.The duration of chest tube drainage was 4.8 ± 4.5days (range, 2-22 days). Seven patients (15%) had anair leak lasting more than five days. These patients

110The Results of Thoracoscopic Surgery for Secondary Spontaneous PneumothoraxJune 2009Table 1: Results in patients with secondary SP treated by pleuralabrasion or apical pleurectomyParametersOperative time (min)Postoperative pleuraldrainage (ml)Analgesia requirement(mg)Chest tube duration(days)Hospital stay (days)Postoperative air leak:n (%)Recurrence: n (%)PleuralAbrasion*(n = 23)58.8 ± 9.2338.2 ± 106.494.3 ± 22.35.3 ± 5.56.3 ± 5.56 (26)3 (13)* Data presented as mean ± SD or n (%)ApicalPleurectomy*(n = 23)66.7 ± 8.5370.4 ± 98.6109.5 ± 29.13.8 ± 2.44.7 ± 2.41 (4)0p-value0.001required prolonged pleural drainage for 7 to 22 days,and none required a re-operation. Air leak occurred insix patients after pleural abrasion procedures and oneoccurred after apical pleurectomy. The difference isstatistically significant (p = 0.04). Air leak occurred insix out of 22 patients in whom multiple bullous diseasewas identified. Air leak occurred in one out of 24patients with single bulla. The difference is statisticallysignificant (p = 0.02).The postoperative hospital stay ranged from threeto 23 days (mean, 5.7 ± 4.5 days). There were no deathsin this series, and no patients required monitoring inthe ICU.All patients in this study were followed regularly(mean follow-up time, 42 months; range from 36 - 54months). Recurrent ipsilateral pneumothorax occurredafter three of the 46 procedures (6.5%). These occurredat four, 16, and 24 weeks after the original procedure.All these recurrences had occurred after pleuralabrasion procedures and in patients with multiplebullous disease. Two patients underwent a re-operationby thoracotomy; excision of the air leak site and partialpleurectomy was performed. One patient who hadrecurrence at 24 weeks after the original procedurehealed by chest drainage and chemical pleurodesis.DISCUSSIONVideothoracoscopy is a rapidly developingtechnique that allows many surgical procedures tobe performed without the need for thoracotomy.VATS allows inspection of the entire lung,identification of bullae, and resection of bullousdisease. Previous reports of the use of VATS haveconcentrated on its use in the treatment of primarySP. VATS has become the surgical approach ofchoice in the management of select primary SP [3,4,8] .VATS bullectomy and mechanical pleurodesiscarry long-term results that are comparable withthose of thoracotomy [4] . For secondary SP, becausepatients are generally older and ill, the role of VATS0.20.050.20.20.040.07approach is still unclear [7,9,10] . VATS for secondarySP has been shown to be associated with a highermorbidity [9] . Therefore, careful patient selectionand improvement of the surgical technique areimportant factors for ensuring optimal outcome.In this series, we have successfully treated 46patients with secondary SP caused by bullousemphysema using VATS procedure. This grouprepresents a population with minimal co-morbiditywho can tolerate selective one-lung ventilationand general anesthesia. However, problems withintraoperative desaturation were encountered.Two-lung ventilation was then necessary, but, toenable the procedure to continue, low-tidal-volumemanual ventilation was employed while dissectionor manipulation was performed. VATS causes lessrespiratory dysfunction than thoracotomy, thusimproving postoperative recovery.Short term results from this series werecomparable with those reported in the literature [11-13] .The duration of postoperative chest tube drainage isdetermined by the presence of complete expansionof the lung and the absence of air leak. In theliterature, the duration of postoperative drainageis variable. Waller et al [9] reported a mean durationof 6.3 days, Andres et al [12] reported 5.4 days, andPasslick et al [10] reported five days. We report a meanof 4.8 days (range, 2 - 21 days).The postoperative hospital stay is determinedmainly by the duration of pleural drain. Other factorsof importance are postoperative pain and earlymobilization. We have reported a mean hospitalstay of 5.7 days (range, 3 - 23 days). The use of smallincisions of VATS procedure has shown a trend towardshorter hospital stay. Passlick et al [10] have reported amean hospital stay of 12.5 days, Andres et al reported7.7 days, and Waller et al [9] reported nine days.There were no intraoperative or postoperativedeaths in this series. The most frequent postoperativecomplications was prolonged air leak lasting morethan five days [10,12] . Seven patients (15%) in this serieshad prolonged air leak. Andres et al [12] have reported25% incidence. Passlick and colleagues [10] found that16.6% had prolonged air leak and all required a secondintervention by lateral thoracotomy. The cause ofthe air leak problem is either an air leak on the rawsurface of staples or missed bullous areas. Thus, theresection of the bullous area has to be done with care,and the entire lung should be inspected for otherbullae. Passlick et al [10] have reported that incompletepleurodesis without an obvious air leak is anotherfactor for prolonged air leak. We have encounteredthe problem of postoperative air leak after bullectomyin emphysematous lung with patients who havemultiple bullae, particularly on more than one lobeand in a position which are not easily dealt with using

June 2009KUWAIT MEDICAL JOURNAL 111endoscopic stapling. Many surgical techniques havebeen described for resecting the bullae. One wayis wedge resection using an endoscopic stapler [3,14] .Other methods, such as endoscopic stapling devicethat does not excise the bulla [9] , electrocoagulation,laser coagulation of bulla, or a combination of differentmethods, are favored by different authors [8,14] . Ogawaet al and colleagues have devised a method of sprayingthe staple line with aerosolized fibrin glue to seal theair leak sites [15] .Our long term recurrence rate is three out of 46patients (6.5%). All these recurrences occurred withinsix months after the intervention and two required are-operation. One reason for recurrence is failure torecognize the site of the leak in the absence of bullousdisease. Unrecognized bullae or inadequate resectionof the diseased portion of the lung may also contribute.Another factor is inadequate pleurodesis, especially inbetween the trocar sites. These failures suggest thatgauze pleural abrasion is probably less effective thanapical pleurectomy. Like Tanaka et al, we found that therecurrences were more frequent in patients in whommultiple bullous disease was identified [5] . It is for suchpatients for that apical pleurectomy may be indicated,and this will probably provide more pleural adhesionwith a decreased subsequent recurrence rate. It is nottime-consuming, difficult to achieve or a source ofpostoperative bleeding as others have suggested, andis, therefore, preferred to pleural abrasion which hasbeen associated with a higher recurrence rate [16] . Ourrecurrence rate is comparable to that reported in theliterature after thoracoscopy, which varies from fourto 8.6% [11,12,17] .CONCLUSIONSVATS procedure can be done safely in the treatmentof selected group of patients with secondary SP whoare in good general condition. The procedure is welltolerated and allows early discharge usually within fivedays. It is now our procedure of choice and has becomethe routine approach for the treatment of bullousdisease of the lung. Because of its less invasiveness,reduced morbidity and shortened postoperative stay,we tended to intervene slightly earlier in patientswith persistent air leaks and even during the firstepisode of pneumothorax. VATS wedge excision andapical pleurectomy represent a satisfactory treatmentmodality in patients with bullous emphysema andsecondary SP.REFERENCES1. Parry GW, Juniper ME, Dussek JE. Surgicalintervention in spontaneous pneumothorax. RespMed 1992; 86:1-2.2. Mouroux J, Elkaim D, Padovani B, et al. Video-assistedthoracoscopic treatment of spontaneous pneumothorax:technique and results of one hundred cases. J ThoracCardiovasc Surg 1996; 112:385-391.3. Ayed AK, Al-Din HJ. The results of thoracoscopicsurgery for primary spontaneous pneumothorax.Chest 2000; 118:235-238.4. Yim AP, Ng CS. Thoracoscopy in the managementof pneumothorax. Curr Opin Pulm Med 2001; 7:210-214.5. Tanaka F, Itoh M, Esaki H, Isobe J, Ueno Y, Inoue R.Secondary spontaneous pneumothorax. Ann ThoracSurg 1993; 55:372-376.6. Waller DA, Forty J, Morritt GN. Video-assistedthoracoscopic surgery versus thoracotomy forspontaneous pneumothorax. Ann Thorac Surg 1994;58:372-376.7. Bertrand PC, Regnard JF, Spaggiari L, et al. Immediateand long-term results after surgical treatment ofprimary spontaneous pneumothorax by VATS. AnnThorac Surg 1996; 61:1641-1645.8. Liu HP, Lin PJ, Hsieh MJ, Chang JP, Chang CH.Thoracoscopic surgery as a routine procedure forspontaneous pneumothorax: Results from 82 patients.Chest 1995; 107:559-562.9. Waller DA, Forty J, Soni AK, Conacher ID, MorrittGN. Videothoracoscopic operation for secondaryspontaneous pneumothorax. Ann Thorac Surg 1994;57:1612-1615.10. Passlick B, Born C, Haussinger K, Thetter O. Efficiencyof video-assisted thoracic surgery for primary andsecondary spontaneous pneumothorax. Ann ThoracSurg 1998; 65:324-327.11. Waller DA. Video-assisted thoracoscopic surgeryfor spontaneous pneumothorax- a 7-year learningexperience. Ann R Coll Surg Engl 1999; 81:387-392.12. Andres B, Lujan J, Robles R, Aguilar J, Flores B, ParrillaP. Treatment of primary and secondary spontaneouspneumothorax using videothoracoscopy. SurgLaparosc Endosc 1998; 8:108-112.13. Menconi GF, Melfi FM, Mussi A, Palla A, AmbrogiMC, Angeletti CA. Treatment by VATS of giantbullous emphysema: results. Eur J Cardiothorac Surg1998;13:66-70.14. Inderbitzi RG, Leiser A, Furrer M, Althaus U. Threeyears’ experience in video-assisted thoracic surgery(VATS) for spontaneous pneumothorax. J ThoracCardiovasc Surg 1994; 107:1410-1415.15. Ogawa J, Inoue H, Koide S, Shohtsu A. Newlydevised instrument for spraying aerosolized fibringlue in thoracoscopic operations. Ann Thorac Surg1993; 55:1595-1596.16. Berrisford RG, Page RD. Video assisted thoracicsurgery for spontaneous pneumothorax. Thorax 1996;51:S 23-28.17. Hatz RA, Kaps MF, Meimarakis G, Loehe F, MullerC, Furst H. Long-term results after video-assistedthoracoscopic surgery for first-time and recurrentspontaneous pneumothorax. Ann Thorac Surg 2000;70:253-257.

112KUWAIT MEDICAL JOURNAL June 2009Original ArticleExpression of NC-2 Receptor on MCL Cells and ItsNatural Cytotoxicity Against Cancer CellsHedayatollah Shirzad, Behnam Zamanzad, Ghorbanali ShahabiDepartment of Microbiology and Immunology, Cellular and Molecular Research Center, Shahrekord University ofMedical Sciences, Shahrekord, IranABSTRACTKuwait Medical Journal 2009; 41 (2): 112-116Objectives: To identify the expression of NC-2 onan interleukin-3 dependent mast cell line (MCL) andinvestigate the activity of this receptor against tumorcellsDesign: Laboratory studySetting: Cellular and Molecular Center, Shahrekord, IranSubjects and Methods: The MCL cells were stained withD9 monoclonal antibody (anti-NC-2) and analysed by flowcytometry. This was confirmed by immunoperoxidasestaining. The cytotoxicity assay was performed to showthe cytotoxic activity of MCL cells against 51Cr-labelledWEHI-164 tumor cells.Intervention: The expression of NC-2 on MCL cells, andthe anti-tumor activity of this receptor were investigated.Main Outcome Measure(s): Flow cytometric analysisand in vitro experiments were performed for showing theactivity of NC-2 against cancer.Results: NC-2 receptor was expressed on more than95% of MCL cells. Pretreatment with D9 monoclonalantibody resulted in about 63% reduction in naturalcytotoxicity of MCL cells against WEHI-164 tumortarget cells.Conclusions: NC-2 is also one of the receptors expressedon MCL and utilized for WEHI-164 tumor cell killing.KEY WORDS: monoclonal antibody, natural cytotoxicity, receptor, tumorINTRODUCTIONNatural cell-mediated cytotoxicity (NCMC) isa major component of innate cellular immunityagainst cancer and infection. NCMC is mediatedprimarily by leucocytes which perform naturalkilling (NK) and natural cytotoxicity (NC) withoutthe requirement for prior sensitization and there isno immunological memory associated with this typeof responses. This mechanism is characteristicallyand functionally different from the cell-mediatedcytotoxicity of cytotoxic T lymphocytes. Cellsmediating NK and NC are two distinct andprobably related NCMC effector mechanismswhich are distinguishable from each other by thetime differences required to mediate their killing, aswell as the kinetics of their appearance and declinein mice [1-3] .Natural killer (NK) cells belong to an importantlymphocyte population that eliminates transformedcells and invading viral pathogens without any priorsensitization. These cells possess not only naturalkilling activity against non-self and altered-self cellsbut also exhibit cytokine production and antibodydependentcell-mediated cytotoxicity (ADCC) [4] .It has been shown that NK cells might not servemerely as cytotoxic lymphocytes combating viralpathogens and malignant tumors, but must also beconsidered as important immunoregulatory cellswith a significant influence on adaptive immunity [5] .The effector’s functions of NK cells are regulated byintegrated signals across the array of stimulatoryand inhibitory receptors engaged upon interactionwith target cell surface ligands [6] . Intensive researchduring the 1990s has defined a large number ofactivating and inhibitory receptors [7-9] . NK cellsare heterogeneous in their receptor repertoire,in the sense that different cells express differentcombinations of activating and inhibitory receptors.In addition, a functional heterogeneity is emerging,at least in the human. The majority of blood NK cellsexpress moderate levels of CD56 in combination withvarious molecules of killer cell immunoglobulinreceptor (KIR) family [10] . In addition, there is a smallsubpopulation of blood NK cells that express highlevels of CD56 in combination with the inhibitoryreceptor NKG2A, and no receptors of the KIR family.This subset has low perforin levels and seems to bespecialized for high cytokine secretion rather thanAddress correspondence to:Dr Behnam Zamanzad, MD, PhD, Departement of Microbiology and Immunology, Shahrekord University of Medical Sciences, Shahrekord, Iran.Fax: +98-381-333491, E-mail: Bzamanzad@yahoo.com

June 2009KUWAIT MEDICAL JOURNAL 113direct killing. The latter subset may be the only NKcells present in the lymph nodes, an organ that wasinitially thought to be completely devoid of NKcells [11] . Human NK cells can be divided into twofunctional subsets based on their surface expressionof CD56; CD56 (bright) immunoregulatory cellsand CD56 (dim) cytotoxic cells. The importanceof early hematopoietic growth factors, such as c-kit ligand and flt-3 ligand, and their synergy withIL-15 in the development of human NK cells in thebone marrow has permitted the investigation ofnovel cytokine combinations for optimizing in vivoexpansion of NK cell in the clinic. The importanceof lymph nodes as a site for NK cell developmenthas recently been elucidated [12] .The major differences between NK and NCare the receptors and mechanisms involved incytotoxicity [13-15] . The initial step in the mechanismof cytotoxicity of NK and NC is the recognitionand binding of effector cells to tumor cells viareceptor-ligand interactions. A number of thesereceptors have been identified on human androdent leucocytes mediating NK cytotoxicity. Todate, however, only two such receptors, NC-1.1 andNC-2 were recognized [16,17] . NC-1.1 was identifiedby a mouse anti-mouse monoclonal antibody(mAb) 1C4 (anti-NC-1.1). It is a monomericphosphoprotein of 45,000 MW expressed on thesurface of predominantly large and granularleucocytes of different hemopoietic cell lineages [16] .Flow cytometric analysis showed that NC-1.1 isexpressed on less than 5% of fresh CBA mouse spleencells and 20-50% of CBA- interleukin-3 cells. In vitrotreatment of spleen cells from a number of inbredmouse strains with anti-NC-1.1 (1C4), markedlydecreased NC activity of spleen cells against 51CrlabeledWEHI-164 targets [16] . Administration of asingle dose of 1C4 in a number of mouse strainsdepletes NC activity from the spleens of mice for atleast one week, with the maximal effect occurring24 hours after treatment [18] . NC-2 was identifiedby a rat anti-mouse monoclonal antibody D9 (anti-NC-2). It is a 50,000 MW molecule expressed on thesurface of mainly large and granular leucocytes inmice. This receptor is expressed on < 6% of splenicleukocytes of different inbred mouse strains.Pretreatment of (CBA × C57BL/6) F1 mouse spleencells with different doses of mAb D9 in vitro blockedNC against WEHI-164, whereas NK activity againstYAC-1 was not affected [17] . By culturing CBAmouse spleen cells in interleukin-3 conditionedmedia, a stable cell line called mast cell line (MCL)was generated [19] . It has been shown that this cellline has high natural cytotoxicity against WEHI-164tumor target cells and was used as a NC like cell lineto characterize natural cytotoxic cells. These cellsexpressed NC-1.1 receptor but not characteristic cellsurface markers of T, B lymphocytes, macrophages,or NK cell. Pretreatment of MCL cells with anti-NC1.1 antibody blocked the NC activity of thesecells by approximately 70% [19,20] .This article reports the expression of NC-2 onMCL cells, and the investigation of the activity ofthis receptor.MATERIAL AND METHODSTissue culture medium (TCM)The study was conducted in the cellular andmolecular research center at Sharekord Universityof Medical Sciences, Iran. Approval of the ethicalcommittee was obtained. Dulbecco’s modificationof eagles medium (CSL, Melbourne, Victoria,Australia) was supplemented with 20 mm HEPES,2 mM L- glutamine, 50 µM 2-mercaptoethanol,0.15% sodium bicarbonate, 50 µg/ml gentamicinand 10% fetal calf serum (FCS). The supplementedTCM was then further conditioned either with IL-3for growth of MCL or with IL-2 for C57BL/6 IL-2 dependent cell lines. Cell lines and monoclonalantibodies.NK-like MCL and NK-like C57BL/6-interleukin-2 (IL-2) dependent cell lines were generated [19,20] .WEHI-164 (a BALB/c fibrosarcoma) was providedby Walter and Elisa Hall Institute, Melbourne,Australia. The mAbs used were anti-NC-2 mAb D9(rat IgG2a) and anti–CD32/CD16 (rat IgG2b; clone2.4G2, anti-Fc gamma receptor RII/RIII).Flow cytometric analysisMCL (NC like) and C57BL/6-IL2 (NK like) cellswere harvested and washed in PBS containing 1% FCSat 5x10 5 cells/ml. One hundred micro liter of each cellsuspension were aliquoted into each staining tubes.After blocking Fc receptors with 2.4G2 mAb, thecells were incubated either with 100 µl biotinylatedD9 mAb and rat IgG2a isotype control mAb for 30min on ice, followed by a further incubation withstreptavidin–fluoroscein isothiocyanate (FITC)complex (Amersham, Buckinghamshire, UK). Aftertwo washes, the cells were re-suspended in 250µlPBS and analyzed in the FACScan automated flowcytometer using the CELL QUEST software (BectonDickinson Immunocytometry Systems, San Jose,CA). Five thousand cells were acquired for analysisin flow cytometer [20] .Immunoperoxidase Staining techniquesFresh MCL cells were cytocentrifuged ontogelatin coated slides. The specimens were airdried and fixed in acetone for 10 minutes. Thefixed cells were incubated with 100 µl of pretitredanti-Fc gamma receptor (2.4G2) for 30 minutes.

114Expression of NC-2 Receptor on MCL Cells and Its Natural Cytotoxicity Against Cancer CellsJune 2009((((Fig. 1: Flow cytometric analysis showing expression of NC-2 receptor on (A) MCL (NC like) but not on (B) C57BL/6-IL2 (NK like)cell line. The cells were first incubated with mAb 2.4G2 (anti-CD32/CD16) and then with mAb D9 (anti-NC-2). (...) fluorescencehistograms of cells stained with rat IgG2a isotype mAb and ( ) cells stained with mAb D9.The slides were washed with PBS pH 9.6 andincubated with 100 µl of pretitered mAb D9 in ahumid box at room temperature for 30 minutes.Endogenous peroxidase activity was quenchedin a 2% w/v hydrogen peroxidase/methanolbath for 10 minutes. The specimen were thenincubated with 100 µl strepavidin-conjugatedHorse-Radish-Peroxidase conjugate (Amersham,Buckinghamshire, UK), followed by reaction with3,3-diaminobenzidine tetrahydrochloride (DAB)(Sigma, St Louis, MO,USA) for not more than 10minutes. The cells were washed with tap waterand counter stained with Carazzi,s hematoxylin(Histo-Lab Fronine, NSW, Australia) withreplacement of slides into Carazzi,s hematoxylinfor two minutes, followed by rinsing in tap water.The slides were then dipped in 1% acid alcoholfor five seconds and then transferred into Scott'stap water for two minutes. The slides were thendehydrated through three lots of 70% and twoof 100% ethanol and then mounted with naturalmounting medium (Ajax Chemicals, Australia)for microscopic analysis.Cytotoxicity assayNC activity was assayed by in vitro lysis of 51 CrlabelledWEHI-164, as previously described [19] .The experiment was conducted in quadruplicatein 200 µl TCM in 96-well micro-titer trays. Briefly,MCL cells were incubated with 51 Cr-labelledtargets at effector / target (E : T) ratios in therange of 100:1-12.5:1. The cells were incubated at37 o C / 5% CO 2for 18 hr. Supernatants (100 µl)from each well were harvested and the level ofradioactivity was measured in a COBRA gammacounter(Packard Instrument CO., Downer’sGrove, Illinois). The results were first calculatedas percentage specific lysis:Percent specific lysis = CPM (Sample) - CPM (Background) × 100CPM (Total Release) - CPM (Background)Background count per million (CPM) was obtainedfrom wells containing target cells alone and totalrelease was determined by counting 51Cr-labelledtarget cells. Lytic units (LU) were calculated from thelinear portion of a graph of percentage specific lysisversus E:T ratios. One LU is herein defined as thenumber of effector cells which mediate 20% specificlysis of the target cells. Results are expressed eitheras LU per 10 8 MCL or percentage reductions in LUaccording to the following formula:Percent reduction in LU = LU (control)- LU (D9 treated) × 100LU (control)For antibody blocking studies, the MCL cellswere pretreated with mAb D9 or isotype matchedmAb, washed and resuspended to the originalvolume prior to use in the cytotoxicity assay [21] .RESULTSTo show the expression of NC-2 on MCLand NK-like C57BL/6-IL2 cells, flow cytometricanalysis was performed. Results showed thatmAb D9 (anti NC-2 receptor) bound to more than

June 2009KUWAIT MEDICAL JOURNAL 115((((Fig. 2: Immunoperoxidase staining of MCL cells: CytocentrifugedMCL cells were stained with either IgG2a Isotype matched mAb(A) or mAb D9 (B).95% of NC-like MCL cells, but not to the NK- likeC57BL/6-IL2 NK-like cells (Fig. 1). To confirmthe flowcytomery finding, immunoperoxidasestaining technique was carried out on fresh MCLcells; results approved the flow cytometric finding(Fig. 2).Natural cytotoxic activity of MCL cells wasassayed by in vitro lysis of 51 Cr-labelled WEHI-164cells (NC tumor target). Results demonstrated themaximal lysis of WEHI-164 target at 18 hours inthe cytotoxicity assay. The lytic units of MCL cellswere reduced by approximately 63% followingpretreatment of cells with mAb D9 compared to thecontrol cells treated with IgG2a isotype matchedmAb (Fig. 3).DISCUSSIONOur flow cytometry results showed that NC-2receptor is expressesd on about 95% of MCL cells,this was confirmed by immunoperoxidase stainingtechnique. Furthemore, in a 51 Cr-release assay, anti-NC-2 antibody (D9) blocked 63% of NC activityin vitro. Previous study showed that NC-2 isexpressed on about 6% of (C57BL/6 × CBA) F1 andBALB/c and about 4% of C57BL/6 and CBA micespleen cells. Anti-NC2 antibody blocked 60% of NCactivity of splenic leukocytes in a cytotoxicity assay[17]. It has been previously reported that NC-1.1 isa molecule expressed on spleen cells of differentmouse strains [14,16] and as reported in our previouspublication the NC-1.1 receptor is also presents onMCL cell line [19] . Further studies showed additionaleffects of anti-NC-2 (D9) and anti-NC-1.1 (1C4) oncytotoxicity of mice spleen cells and suggested thatNC-1.1 and NC-2 are two different receptors onmouse spleen cells. Western blot analysis of affinitypurified NC-1.1 and NC-2 indicated that thereceptor identified by mAb D9 (anti-NC-2) is notthe previously described NC-1.1 [17] . Co-expressionof NC-1.1 and NC-2 on granular splenic leukocytesFig. 3: Effect of in vitro treatment of mAb D9 on the NC activity ofMCL cells: Cytotoxic activity of MCL cells was assayed by in vitrolysis of 51 Cr-labelled WEHI-164 cells. The lytic units of MCL cellswere reduced by approximately 63% following pretreatment ofcells with mAb D9 compared to the control cells treated withIgG2a isotype matched mAb.of (C57BL/6 X CBA) F1 mice was examined by dualcolor flow cytometry. Results showed that all NC-2 +granular leukocytes co-expressed NC-1.1 whereasthe converse was not true [17] . Our present findingsuggests that, similar to previous reports ondifferent inbred mouse strains, NC-1.1 and NC-2are two distinct receptors which are expressed onMCL cells. Furthermore, it is possible that in MCLcells population there is a group of cells which mayhave both the receptors, which in turn probablyabrogates the cytotoxicity of each individualreceptor [22] .Recent studies on NK cells have identifiedmultiple receptors which recognize ligands on thesurface of target cells. These receptors belong totwo multi-gene families, NKR-P1 and Ly-46, whichdisplay either activation or inhibition effects onnatural killing [13] . Upon ligation to its specific ligandthe receptor either transduces a positive signal tothe effectors to kill the target cell or a negative signalto turn off the killing thus providing a delicateregulatory mechanism to control cytotoxicity [14] .Phosphorylation studies of NC-1.1 showedthat key intracellular signaling pathway involvingprotein kinase C (PKC) and protein kinase G (PKG)interact to effect a coordinated control of NC. Thefact that increase in phosphorylation up-regulatesNC argues for NC-1.1 to be an activated receptor [14] .Biochemical studies to determine whether NC-2 is

116Expression of NC-2 Receptor on MCL Cells and Its Natural Cytotoxicity Against Cancer CellsJune 2009also a signaling receptor are in progress, and datato date suggest that NC-2, like NC-1.1, may alsobe an activation receptor. In order to achieve abalanced control in the regulation of NC, it is likelythat inhibitory receptors also exist on leukocytesmediating natural cytotoxicity.ACKNOWLEDGMENTSWe gratefully acknowledge the academicsupport of Dr. Chang Smart from the Universityof Newcastle, Australia and financial support of theShahrekord University of Medical Sciences, Iran.REFERENCES1. Waldhauer I, Steinle A. NK cells and cancerimmunosurveillance. Oncogene 2008; 27:5932-5943.2. Kiessling R, Haller O. Natural killer cells inthe mouse:an alternative immune surveillancemechanism?. Contemp Top Immunobiol 1978;8:171-201.3. Stutman O, Paige CJ, Figarella EF. Natural cytotoxiccells against solid tumors in mice. I. Strain and agedistribution and target cell susceptibility. J Immunol1978; 121:1819-1826.4. Iizuka S, Kaifu T, Nakamura A, Obinata M, TakaiT. Establishment and functional characterizationof novel natural killer cell lines derived froma temperature-sensitive SV40 large T antigentransgenic mouse. J Biochem 2006; 140:255-265.5. Woo CY, Clay TM, Lyerly HK, Morse MA, Osada T.Role of natural killer cell function in dendritic cellbasedvaccines. Expert Rev Vaccines 2006; 5:55-65.6. Zhang C, Zhang J, Wei H, Tian Z. Imbalance ofNKG2D and its inhibitory counterparts: howdoes tumor escape from innate immunity? IntImmunopharmacol 2005; 5:1099-1111.7. Cooper MA, Fehniger TA, Caligiuri MA. Thebiology of human natural killer-cell subsets. TrendsImmunol 2001; 22:633-640.8. Ferlazzo G, Thomas D, Lin SL, et al. The abundant NKcells in human secondary lymphoid tissues requireactivation to express killer cell Ig-like receptors andbecome cytolytic. J Immunol 2004; 172:1455-1462.9. Moretta A, Vitale M, Bottino C, et al. P58 moleculesas putative receptors for major histocompatibilitycomplex (MHC) class I molecules in human naturalkiller (NK) cells. Anti -p58 antibodies reconstitutelysis of MHC class I-protected cells in NK clonesdisplaying different specificities. J Exp Med 1993;178:597-604.10. Moretta A, Bottino C, Vitale M, et al. Activatingreceptors and co receptors involved in human naturalkiller cell – mediated cytolysis. Annu Rev Immunol2001; 19:197-233.11. Yokoyama WM, Plougastel BF. Immune functionsencoded by natural killer gene complex. Nat RevImmunol 2003; 3:304-316.12. Farag SS, Caligiuri MA. Human natural killer celldevelopment and biology. Blood Rev 2006; 20:123-137.13. Yokoyama WM. Recognition structures on naturalkiller cells. Curr Opin Immunol 1993; 5:67-73.14. Holmgreen SP, Wang X, Clarke GR, et al.Phosphorylation of the NC-1.1 receptor andregulation of natural cytotoxicity by protein kinase Cand cyclic GMP-dependent protein kinase. J Immunol1997; 158:2035-2041.15. Porgador A. Natural cytotoxicity receptors:patternrecognition and involvement of carbohydrates.Scientific World Journal 2005; 5:151-154.16. Smart YC, Stevenson KL, Farrelly ML, Brien JH,Burton RC. Production of a monoclonal allo-antibodyto murine natural cytotoxic cells. Immunol Cell Biol1990; 68:277-284.17. Shirzadeh H, Burton RC, Brien JH, Smart YC.Monoclonal antibody anti-NC-2 identifies a secondreceptor on cells mediating natural cytotoxicity inmice. Immunology 1998; 93:122-128.18. Smart YC, Farrelly ML, Burton RC. Correlation ofgrowth of tumors in NC-cell-depleted mice withNC- and NK-cell-mediated lysis in vitro. Int J Cancer1992; 50:817- 821.19. Shirzadeh H, Clarke GR, McNeil HP, Wang H, BurtonRC, Smart YC. An IL-3 induced splenic NC-1.1+ mastcell line mediates natural cytotoxicity independent ofTNF-alpha. Cell Immunol 1996; 174:147-154.20. Brien JH, Smart YC, Farrelly ML, Burton RC.Phenotype and morphology of murine NC-1.1+natural cytotoxic cells. Immunol Cell Biol 1994;72:161-168.

June 2009KUWAIT MEDICAL JOURNAL 117Original ArticleHeat Treatment of Bacteria: A Simple Method ofDNA Extraction for Molecular TechniquesAli A Dashti 1 , Mehrez M Jadaon 1 , Abdulsamad M Abdulsamad 2 , Hussein M Dashti 31Department of Medical Laboratory Sciences, Faculty of Allied Health Sciences, Health Science Center, Kuwait University, Kuwait2Department of Surgery, Amiri Hospital, Kuwait3Department of Surgery, Faculty of Medicine, Health Science Center, Kuwait University, KuwaitABSTRACTKuwait Medical Journal 2009; 41 (2): 117-122Objective: To evaluate the efficacy of two simplemethods involving use of heat for extraction ofbacterial deoxyribonucleic acid (DNA) be used inmolecular techniques like polymerase chain reaction(PCR), restriction fragments length polymorphism(RFLP) and DNA sequencing and compare themwith DNA extraction using commercial kits.Design: DNA extraction by improved alternativemethods and commercial kit.Setting: Microbiology Research Laboratory, Facultyof Allied Health Sciences, Kuwait University,KuwaitMaterial: Forty isolates of Klebsiella pneumoniaeIntervention: DNA was extracted from isolatesby either boiling for 10 minutes or microwaveirradiation for 10 seconds. For comparison, DNAwas also extracted using a commercial kit. Allextracted DNA samples were analyzed by PCR,RFLP and / or DNA sequencing of TEM and SHVgenes of the bacteria.Main Outcome Measures: Successful extraction ofDNAResults: PCR, RFLP and DNA sequencing gave theexpected results in all the DNA samples extractedby all the three methods (boiling, microwaveirradiation and the commercial kit). The resultswere qualitatively equivalent in all methods.Conclusion: Heat may be used to extract DNA fromK. pneumoniae which can be utilized successfully inperforming PCR, RFL and DNA sequencing.KEY WORDS: bacteria DNA extraction, DNA sequencing, PCR, RFLPINTRODUCTIONThe science of molecular biology has become anintegral part of all medical research fields includingbacteriology. Techniques including polymerasechain reaction (PCR), restriction fragment lengthpolymorphism (RFLP), hybridization techniquesand DNA sequencing are being extensively usedin identification and classification of differentbacterial species and subspecies. In fact, manybacterial strains are now classified based solely onmolecular characteristics [1-2] . Molecular techniquesin bacteriology usually start with bacterial DNAextraction and purification. A large number ofDNA extraction methods (performed manuallyor by automation) have been and are still beingdeveloped, each of which has its own advantages anddisadvantages. Many of these methods are based onthe traditional phenol-chloroform extraction method,which needs a variable number of reagents andequipment [3-4] . Moreover, several trials have beenmade to simplify the procedure for bacterial DNAextraction and purification. These methods tried tobreak the cells and release the DNA using certain lysingagents containing different chemicals like lysosyme,proteinase K, TWEEN20, sodium hydroxide/sodium dodecyl sulfate, guanidine isothiocyanate,and Triton X-100 [5-14] . In addition to chemical agents,physical factors have also been attempted includingheating, cooling, freezing, microwave irradiation,beads beating, magnetic field capturing, binding toglass beads, the use of ultrasound waves and passingthrough heat-exchanger coils and nylon filters [5-18] .Address correspondence to:Prof. Hussein M Dashti, Department of Surgery, Faculty of Medicine, PO Box 24923, 13110, Safat, Kuwait. Tel: (965)5319475, Fax: 965-25333098, E-mail: aad@hsc.edu.kw

118Heat Treatment of Bacteria: A Simple Method of DNA Extraction for Molecular TechniquesJune 2009Many have also used combinations of chemical andphysical methods [5-19] . Still, most of these methodsare laborious, time consuming and costly. In thelast two decades, many commercial kits have beendeveloped to extract bacterial DNA using simplersteps and a shorter time frame. Although they madethe DNA extraction process quicker, such methodsare costly and require several steps and reagents,and sometimes special equipment, to obtain thetarget DNA [14,20] .In this study, the authors have tried two verysimple methods that may be used to extractbacterial DNA using heat only in a very simplemanner. Using heat for bacterial DNA extractionis not new. High temperature exposure is knownto cause damage to cell membranes and cellwalls [14,16,20-22] . Jose and Brahmadathan reportedthat heating at 94 °C for two minutes was enoughto denature cell walls [16] . Low temperatureswere also observed to destroy cell walls andmembranes. Freezing induces crystallization ofwater inside cells which leads to destruction ofcytoplasmic structures [12,16,20] . In fact, Tell et al usedcycles of freezing and thawing to obtain bacterialDNA [12] . In practice, heating bacterial materialfor DNA extraction purposes was performed byboiling in a water bath or on hot blocks, or usingmicrowave ovens [5-16] . Microwaves can cause manydifferent biological effects; these are mainly dueto the heating process (thermal effects) but thereare also athermal effects on cellular material,which were thought to be due to acceleration andcollision of ions with other molecules, partitioningof ions, or altering the polarity of molecules inalternating electric fields [22-24] . In this study, theuse of heat has been improved in two simplifiedways to extract DNA from bacteria. To assess thesuitability of the extracted DNA for performingmolecular biology techniques, the extractedbacterial DNA was processed by polymerasechain reaction (PCR), restriction fragment lengthpolymorphism (RFLP) and DNA sequencing. Forcomparison, a commercial DNA extraction kitwas also used. These two methods, as well as thecommercial kit, were tried on Klebsiella pneumoniaeisolates harboring extended spectrum ß-lactamase(ESBL). ESBLs are mainly derived from TEM,SHV or CTX-M β-lactamases that have mutated toexpand their spectrum of activity to include thirdgeneration cephalosporins [1,25] . Although theywere first reported in Klebsiella species [26] , ESBLsare now also commonly found in Escherichia coliand they have also been found in other species ofEnterobacteriaceae [1] . To date, more than 130 TEMand more than 104 SHV derivatives have beenfound [1,2,25] .MATERIAL AND METHODSThe study was conducted in the microbiologyresearch laboratary of the faculty of Allied HealthSciences, Kuwait University. Approval of the localethical committee was obtained.SamplesForty strains of Klebsiella pneumoniae wereincluded in this study. These strains were isolatedfrom a variety of clinical specimens submitted tothe clinical bacteriology laboratories in Al-AmiriHospital. They were flagged as ESBL-positive bythe Vitek 2 GNI and AST-N020 cards (Bio Merieux,Marcy L’Etoile, France). Samples were grown at 37 °Con Luria Bertani (LB) media (from GIBCO, BRI, LifeTechnologies, UK), before extracting their DNA.Methods for DNA extractionIn the first method, two colonies of overnightgrowth bacteria were used. The colonies were putin a test tube containing one ml of distilled waterand boiled for 10 minutes in a water bath, and thenwere centrifuged for five minutes at 1000 rpm. Fivemicroliters of the supernatant were used for the PCR.The second method was based on using a Nationalmicrowave oven (Matsushita Electric IndustrialCompany, Japan) to heat the bacterial colonies (twocolonies dissolved in 500 μl distilled water) for 10seconds, followed by centrifugation for two minutesat 1000 rpm. Similarly, 5 μl of the supernatant wereused for the PCR.Commercial Kits for DNA extractionGenomic DNA from the same bacterial isolateswas extracted for PCR by using Gentra PuregeneDNA isolation kit (QIAGEN Inc., Valencia, CA,USA) according to the manufacturer’s instructions.DNA samples were tested by spectophotometery atdual UV light (260/280) and the ratio was 1.7-1.9 forall samples.PCRPCR was performed on all the DNA samplesextracted using the two methods and the commercialkit. Five microliters of the DNA were mixed with 45 μlof pre-aliquoted Reddy-Load PCR Mix (from ABgene,UK) containing 1.25 units of Taq DNA polymerase,75 mM Tris-HCl (pH 8.8), 20 mM (NH 4) 2SO 4, 1.5mM MgCl 2, 0.01% (v/v) Tween 20, 0.2 mM of eachof the four deoxynucleotide triphosphates (dATP,dCTP, dGTP and dTTP) and 100 pmol of each of theprimers indicated in Table 1. The expected sizes ofPCR products for the two sets of primers were 308and 858 base-pairs (bp), respectively (Table 1). ForSHV primers, the PCR mixture was incubated for fiveminute at 95 °C as an initial denaturation step, followed

June 2009KUWAIT MEDICAL JOURNAL 119Table 1: The sequence of primers used in the project to amplify regions of the blaSHV and blaTEM ESBL genes, as well as the expectedsizes of the PCR ampliconsPrimer Sequence Gene Expected size of PCR productSHV-1SHV-2TEM-1TEM-25’ –CTGGGAAACGGAACTGAATG– 3’5’ –GGGGTATCCCGCAGATAAAT– 3’5’ –ATGAGTATTCAACATTTCCG– 3’5’ –CCAATGCTTATTCAGTGAGG– 3’blaSHVblaTEM308 bp858 bpby 32 cycles of successive alternating temperatures asfollows: denaturation step at 94 °C for one minute,annealing step at 57 °C for one minute, and extensionstep at 70 °C for one minute. A final extension stepat 72 °C for 10 minutes was allowed. On the otherhand, and for the TEM primers, the PCR mixturewas incubated for five minute at 95 °C as an initialdenaturation step, followed by 30 cycles of successivealternating temperatures as follows: denaturation stepat 94 °C for 30 seconds, annealing step at 55 °C for oneminute, and extension step at 70 °C for one minute. Afinal extension step at 75 °C for 10 minutes was alsoallowed. The PCR reaction for both sets of primerswas performed in a programmable PCR ThermalCycler (Perkin Elmer, Wellesley, MA, USA).RFLPTEM-specific PCR products were digestedby Sau3AI endonuclease using 10 μl of the PCRproduct without purification, according to therecommendation of the restriction endonucleasesuppliers (Promega, Ltd, UK). The followingamounts were used: 5 μl of restriction buffer (10 mMTris-HCL, pH 7.5, 60 mM NaCl, 7 mM MgCl2), 1 μlof BSA (0.1mg/l), 1 μl of restriction enzyme and 4 μlof sterile distilled water. Digestion was carried outfor four hours at 37 °C. For SHV, PCR products weredigested with 10 U/μl of NheI restriction enzyme(Promega, Ltd, UK), 5 μl of restriction buffer (10mM Tris-HCL, pH 7.5, 60 mM NaCl, 7 mM MgCl2),1 μl of BSA (0.1mg/l), 4 μl of sterile distilled waterand 40 μl of the amplified PCR product. Digestionwas carried out for a maximum of four hours at37 °C. Restriction pattern of PCR products forboth sets of primers were analyzed by agarose gelelectrophoresis, using 2% agarose in 1X Tris acetateEDTA (TAE) buffer, which were then stained withethidium bromide and visualized by exposureto UV light in a gel documentation system (UVPCompany, Upland, CA, USA). A DNA marker fromSigma (Sigma-Aldrich, Inc., Saint Louis, MI, USA)was run on the gel along with the PCR amplicons toidentify the sizes of these amplicons.DNA sequencingDNA sequencing was performed on 10randomly selected bacterial isolates out of the 40isolates included in this project as representativesof the whole group PCR products for the SHVgene, obtained from the PCR step above and weretaken for sequencing. These products were firstcleaned by ethanol precipitation; 25 μl of templatesuppression reagent (TSR) was added to the pellet,mixed, and finally heated for two minutes at 95 o C.For sequencing PCR, one microliter of each PCRproduct from the previous step was mixed with3.2 picomol of either a forward (5’-CTG GGA AACGGA ACT GAA TG-3’) or a reverse primer (5’-GGGGTA TCC CGC AGA TAA AT-3’), and 8 μl of a dyeterminator ready sequence reaction mix (Prism TMReady Reaction Dye-Deoxy TM Terminator CycleSequencing Kit, Perkin Elmer, Wellesley, MA, USA).The sequencing PCR reaction was then carried outin the Thermal Cycler programmed to 30 cycles of96 o C for 20 seconds, 50 o C for 20 second, and 60 o Cfor four minutes. The products were cleaned again asmentioned above, and the products were kept on icetill the sequencing was run on an automated DNAsequencer (AB13100, Applied Biosystem, Foster City,CA, USA). Sequences results were analysed by theBLAST online search engine (http://www.ncbi.nih.gov/cgi-bin/BLAST), with the susceptible strainssequences in the database.RESULTSPCR amplicons were produced successfullyin all DNA samples included in this project. Theamplified products obtained with primers specificfor both blaTEM and blaSHV were 858 bp and 308bp, respectively, which were the expected productsizes of the amplified gene with the set of primersused. That was true whether the DNA was extractedby the two simple methods described here, or usingthe commercial kit. Figure 1 shows a photograph ofagarose gel electrophoresis of these PCR amplicons.In the RFLP step, NheI restriction endonucleasewas used to cleave the SHV-specific PCR product,while Sau3AI restriction endonuclease was used tocleave the TEM-specific PCR. The results of all therestricted PCR products (SHV or/and TEM) were asexpected for each restriction enzyme. The patterns ofcutting were similar whether the DNA was extractedby the two methods introduced by the authors, orusing the commercial kit (Fig. 2 and 3).

120Heat Treatment of Bacteria: A Simple Method of DNA Extraction for Molecular TechniquesJune 2009Fig. 1: Agarose gel electrophoresis showing the 858-bp and 308-bp PCR amplicons for TEM and SHV, respectively. Lanes 7 and 8show positive and negative PCR amplicons for TEM, respectively,while lanes 5 and 4 show positive and negative PCR ampliconsfor SHV, respectively. Lanes 9 and 3 shows PCR products for TEMand SHV, respectively, from DNA extracted using microwavemethod. Lanes 10 and 2 show PCR products for TEM and SHV,respectively, from DNA extracted using boiling method. Lanes11 and 1 show PCR amplicons for TEM and SHV, respectively,from DNA extracted using the commercial kit. Lane 6 has a DNAmarker.Fig. 2: Digestion of TEM PCR products with Sau3AI endonuclease.Sau3AI cuts the 858-bp amplicons into fragments with thefollowing sizes: 341, 258, 105, 46, 37, 36, 18 and 17 bp. Sizes lessthan 50-bp could not be demonstrated on the agarose gel usedhere. Lane 6 show digestion of TEM PCR amplicon from DNAextracted using the microwave irradiation method. Lanes 4 and5 show digestion of TEM PCR amplicons from DNA extractedusing the boiling method. Lane 3 shows digestion of TEM PCRamplicons from DNA extracted using the commercial kit. Lane2 contains a positive control, while lane 1 has a 100-bp DNAmarker.Fig. 3: Digestion of SHV PCR products with NheI endonuclease.The presence of Gly238Ser mutation creates a restriction site forthe NheI, cutting the PCR amplicons (308-bp) into 218- and 90-bp fragments. Lanes 7 to 9 contain PCR amplicons from DNAsamples extracted using the microwave irradiation method.Lanes 4 to 6 contain PCR amplicons from DNA samples extractedusing the boiling method. Lane 3 contains a PCR amplicon from aDNA sample extracted using the commercial kit. Lane 2 containsa positive control, while lane 1 has a 100-bp DNA marker.The automated analysis of the sequenced SHVPCR products showed the expected nucleotidesequences in all the 10 representative bacterial isolates.Moreover, four out of the 10 isolates were found tohave a Gly238Ser mutation that is characteristic ofSHV-2 ESBL; while the rest of the isolates harbouredthe Gly238Ser mutation as well as a Glu240Lysmutation; presence of both is characteristic of SHV-5 ESBL (Fig. 4). That was true in all the three DNAextraction methods used in this project.DISCUSSIONMolecular biology techniques to study bacterialDNA (like PCR, RFLP, and DNA sequencing) usuallyneed DNA extraction and purification from thebacteria with a high quality for perfect performance.However, present DNA purification procedures,especially the commercial ones, are costly, laboriousFig. 4: DNA sequencing results showing the SHV2 and SHV5mutations (Gly238Ser and Gly238Ser + Glu240Lys, respectively).and need a large number of reagents and equipment.Several researchers have tried to liberate DNA frombacterial cells by breaking bacterial cell walls usingcertain reagents, especially by enzymatic treatmentwith lysosymes and proteases [5,7,9,10-14] . However,Agersborg reported that lysozyme and proteinaseK treatment, was not always sufficient to hemolysecertain cells [7] . On the other hand, Merk et al foundprotienase K to be superior to other methods inextracting DNA [14] . Other researchers have tried othersynthetic lysing solutions like SDS (sodium dodecylsulfate), TWEEN20 [8] , Triton X-100 [7] and guanidineisothiocyanate (GITC) [5,10,14] . GITC was reported tobe able to damage cells with hard walls like fungi.Besides chemical methods, several researchers havesuccessfully extracted bacterial DNA using physicalpower; for example, forceful rupture of cells wasachieved by vortexing suspensions of cells [8] , orbeating cells with beads [12] or ultrasound waves [27] .Moreover, certain glass or iron beads were used tocapture DNA molecules, which could later be elutedand separated [9,17-18] . Other physical powers werealso used, like high or low temperatures. Heating

June 2009KUWAIT MEDICAL JOURNAL 121cells, such as boiling or microwave irradiation, waswidely used to extract DNA molecules [5,7,9,10-13] .Still, many of the previous methods were eitherfollowed or preceded by enzymatic or detergenttreatment to obtain DNA for molecular techniques.Many companies have utilized the previousconcepts in producing commercial kits that couldbe used in extracting DNA from a variety of cellularmaterial [14,19] . Although providing simpler DNAextraction methods, such kits added extra costs toexperiments needing DNA extraction.In this study, simplified DNAextraction methods toproduce bacterial DNA samples were evaluated. Theaim was to minimize the time and the need for reagents,while still not affecting the quality of DNA extractedand the productivity of the subsequent moleculartechniques. The methods were based on using heatwithout adding any reagent. Heating bacterial material(suspended in distilled water without any otheradditions) was achieved by boiling for 10 minutes ormicrowave irradiation for 10 seconds. It was shownthat these two methods have provided enough DNAmolecules to perform subsequent molecular biologytechniques. The methods were tried on ESBL genes ofKlebsiella pneumoniae. The ESBL genes were detected byPCR amplification of the DNA sequences coding forblaTEM and blaSHV ESBL genes. PCR was successfulin all cases, giving the expected PCR amplicons. Thatwas additionally verified by performing the same PCRprotocol on DNA samples extracted from the samebacterial samples using a commercial DNA extractionkit. PCR amplicons were qualitatively equivalentin all experiments. Furthermore, and in the RFLPexperiment, digestion of TEM and SHV PCR productswith Sau3AI and NheI endonucleases, respectively,showed the same fragments and results in all the testedsamples whether the DNA used for PCR was extractedby the two methods introduced by the authors or usingthe commercial kit. Finally, DNA sequencing was alsosuccessful in all DNA extraction methods used in thisproject, giving the expected sequences.To compare with the work of this study, a limitednumber of researchers have also used boiling and/ or microwave irradiation to extract DNA withoutany reagents added. However, most of theseresearchers have boiled their samples or exposedthem to microwave irradiation for a time longerthan the presented method in this paper [14-15] orhave subjected their samples to multiple microwaveirradiation [6,15] . To the best of the authors’ knowledge,the report by Merk et al was the only one in whichthe samples were boiled for 10 minutes like in ourstudy [14] . Unlike this paper, their samples were bloodand lung tissue which were artificially infected withBurkholderia cepacia. In addition, their extracted DNAwas processed by PCR only. The present paper maybe the first to report using a 10-minute boiling, or asshort as 10-second microwave irradiation to extractbacterial DNA suitable to perform three essentialmolecular biology techniques; namely PCR, RFLPand DNA sequencing.CONCLUSIONIn conclusion, the presented methods (heattreatmentof bacteria) are very simple, cheap, quickand successful methods for DNA extraction frombacteria in order to be used directly in moleculartechniques, yielding excellent results as othermore complicated methods for DNA extractionand purification. The findings of this study mayprobably encourage trying the procedure on othertypes of biological specimens such as whole blood,culture cells, body fluids and hair.ACKNOWLEDGEMENTThe authors wish to thank the Shared FacilitiesLaboratory of the Health Sciences Center, KuwaitUniversity (project number GM 01/01), forperforming DNA sequencing for this project.REFERENCES1. Bradford PA. Extended-spectrum beta-lactamasesin the 21 st century: characterization, epidemiologyand detection of this important resistance threat. ClinMicrobiol Rev 2001; 14:933-951.2. Jacoby G, Bush K. Amino Acid Sequences for TEM, SHVand OXA Extended-spectrum and inhibitor resistant ß-lactamases. Lahey Clinic. (Accessed January 1, 2008 athttp://www.lahey.org/Studies/)3. Gross-Bellard M, Oudet P, Chambon P. Isolation ofhigh- molecular-weight DNA from mammalian cells.Eur J Biochem 1973; 36:32-38.4. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning:A Laboratory Manual. New York, Cold Spring HarborLaboratory Press, 1989.5. Porteous LA, Armstrong JL, Seidler RJ, Watrud LS. Aneffective method to extract DNA from environmentalsamples for polymerase chain reaction amplificationand DNA fingerprint analysis. Curr Microbiol 1994;29:301-307.6. Herman LM, De Block JH, Waes GM. A direct PCRdetection method for Clostridium tyrobutyricumspores in up to 100 milliliters of raw milk. Appl EnvironMicrobiol 1995; 61:4141-4146.7. Agersborg A, Dahl R, Martinez I. Sample preparationand DNA extraction procedures for polymerase chainreaction identification of Listeria monocytogenes inseafoods. Int J Food Microbiol 1997; 35:275-280.8. Marra MA, Kucaba TA, Hillier LW, Waterston RH.High-throughput plasmid DNA purification for 3 centsper sample. Nucleic Acids Res 1999; 27:e37.9. Skowronski EW, Armstrong N, Andersen G, Macht M,McCready PM. Magnetic, microplate-format plasmidisolation protocol for high-yield, sequencing-gradeDNA. Biotechniques 2000; 29:786-788,790,792.

122Heat Treatment of Bacteria: A Simple Method of DNA Extraction for Molecular TechniquesJune 200910. Agarwal A, Kumar C, Goel R . Rapid extraction of DNAfrom diverse soils by guanidine thiocyanate method.Indian J Exp Biol 2001; 39:906-910.11. Orsini M, Romano-Spica V. A microwave-based methodfor nucleic acid isolation from environmental samples.Lett Appl Microbiol 2001; 33:17-20.12. Tell LA, Foley J, Needham ML, Walker RL. Comparisonof four rapid DNA extraction techniques forconventional polymerase chain reaction testing of threeMycobacterium spp. that affect birds. Avian Dis 2003;47:1486-1490.13. Zhu K, Jin H, Ma Y, et al. A continuous thermal lysisprocedure for the large-scale preparation of plasmidDNA. J Biotechnol 2005; 118:257-264.14. Merk S, Meyer H, Greiser-Wilke I, Sprague LD,Neubauer H. Detection of Burkholderia cepacia DNAfrom artificially infected EDTA-blood and lung tissuecomparing different DNA isolation methods. J Vet MedB Infect Dis Vet Public Health 2006; 53:281-285.15. Lou YK, Qin H, Molodysky E, Morris BJ. Simplemicrowave and thermal cycler boiling methods forpreparation of cervicovaginal lavage cell samples priorto PCR for human papillomavirus detection. J VirolMethods 1993; 44:77-81.16. Jose JJ, Brahmadathan KN. Evaluation of simplifiedDNA extraction methods for emm typing of group Astreptococci. Indian J Med Microbiol 2006; 24:127-130.17. Elkin CJ, Richardson PM, Fourcade HM, et al.High-throughput plasmid purification for capillarysequencing. Genome Res 2001;11:1269-1274.18. Dederich DA, Okwuonu G, Garner T, et al. Glassbead purification of plasmid template DNA for highthroughput sequencing of mammalian genomes.Nucleic Acids Res 2002; 30:e32.19. Smith K, Diggle MA, Clarke SC. Comparison ofcommercial DNA extraction kits for extraction ofbacterial genomic DNA from whole-blood samples. JClin Microbiol 2003; 41:2440-2443.20. Strus M. Action of physical agents on microorganisms.Rocz Panstw Zakl Hig 1997; 48:263-268.21. Goodwin DC, Lee SB. Microwave miniprep of totalgenomic DNA from fungi, plants, protists andanimals for PCR. Biotechniques 1993; 15:438, 441-442, 444.22. Höfler G. Detection of bacterial DNA using thepolymerase chain reaction (PCR). Verh Dtsch GesPathol 1994; 78:104-110.23. Banik S, Bandyopadhyay S, Ganguly S. Bioeffects ofmicrowave - a brief review. Bioresour Technol 2003;87:155-159.24. Woo IS, Rhee IK, Park HD. Differential damage inbacterial cells by microwave radiation on the basisof cell wall structure. Appl Environ Microbiol 2000;66:2243-2247.25. Turner PJ. Extended-spectrum beta-lactamases. ClinInfect Dis 2005; 41:S273-S275.26. Kliebe C, Nies BA, Meyer JF, Tolxdorff-Neutzling RM,Wiedemann B. Evolution of plasmid-coded resistanceto broad-spectrum cephalosporins. Antimicrob AgentsChemother 1985; 28:302-307.27. Picard C, Ponsonnet C, Paget E, Nesme X, Simonet P.Detection and enumeration of bacteria in soil by directDNA extraction and polymerase chain reaction. ApplEnviron Microbiol 1992; 58:2717-2722.

June 2009KUWAIT MEDICAL JOURNAL 123Original ArticleEvaluation of Problem Based Learning by Tutors andStudents in a Medical Faculty of TurkeyErol Gurpinar, Yesim Senol, Mehmet R AktekinDepartment of Medical Education, Akdeniz University Faculty of Medicine, Antalya, TurkeyKuwait Medical Journal 2009; 41 (2): 123-127ABSTRACTObjectives: To determine the opinion of tutors and studentsin charge of problem-based learning (PBL) courses during theacademic year of 2006-2007 about the extent of contributionof PBL to certain skills in comparison with conventionaleducation and to clarify whether or not they are content withPBLDesign: Cross sectional researchSetting: Akdeniz University Faculty of Medicine, Antalya,TurkeySubjects and Methods: One hundred and fifty three tutorsin charge of PBL courses during the academic year of 2006-2007 and all of the first year medical students (n = 170) wereincluded. A questionnaire was sent to the study populationin June 2007.Intervention: Analysis of completed questionnaireMain Outcome Measure: Independent sample t-test analysiswas used to determine whether mean scores were differentin two groups.Results: Majority of the tutors (87.5%) and students (97.1%)responded to the questionnaire. The question “Is PBL anapplication that is in general beneficial to the student?” wasanswered as “yes” by 66.9% of the tutors. The question “Areyou content with PBL?” was answered as “yes” by 54.9% ofthe tutors. On the other hand, 74.5% of the students answered“yes” to this second question.Conclusion: Our results show that PBL is well received bytutors and students and they think that PBL offers significantcontribution to the students in areas that are considered tobe superior aspects of PBL when compared to conventionaleducation.KEY WORDS: evaluation, medical education, medical students, problem based learning, tutorINTRODUCTIONProblem based learning (PBL) was introducedinto medical school curricula by McMasterUniversity in 1969 and has since been adopted bymany medical schools worldwide [1,2] . PBL is botha method and philosophy involving problem-firstlearning via work in small groups and independentstudy [3] .In a PBL program, the students use a seven-stepprocedure to structure their activities. This procedureconsists of clarifying vague phrases and concepts inthe problem, defining the problem, analysing theproblem on the basis of prior knowledge, arrangingthe proposed explanations, formulating learningobjectives, trying to fill in the knowledge gaps bymeans of self study and finally reporting the finding inthe groups [4-13] . Such learning is based on adult learningmodel, with emphasis on self-directed learning.The first applications of PBL began in 1997 inTurkey. Until today, four medical schools have beenperforming their education programs completelybased on PBL while most of the remaining medicalschools in Turkey have adopted the hybrid educationmodel [14] . We, Akdeniz University Faculty of Medicine(AUFM), are one of the faculties that have beenimplementing the hybrid education model since theacademic year of 2002-2003.The faculty members (tutors) and studentsconstitute the most crucial points in PBL [15,16] . We believethat soliciting the opinion of both the tutors and thestudents may be extremely beneficial for evaluation ofPBL. Moreover, it is also important for the detection andthe subsequent improvement of the shortages of theeducation program. When we reviewed the literature,it was seen that there are many studies about PBL.However, only a limited number of studies have beenperformed for investigating the opinion and thoughtsof the tutors and the students together [17-20] .Thus, the aim of the present study was todetermine the opinion of tutors in charge of PBLAddress correspondence to:Erol Gurpinar, MD, Department of Medical Education, Akdeniz University School of Medicine, Dumlupinar Bulvari Campus, 07040 Antalya,Turkey. Tel: 90 242 2496189 , Fax: 90 242 2274482, E-mail: erolgurpinar@akdeniz.edu.tr

124Evaluation of Problem Based Learning by Tutors and Students in a Medical Faculty of TurkeyJune 2009Table 1: Answers of tutors to the question “Is PBL a beneficial practice for the students in general?” according to their departmentsDepartments of tutorsBasic sciencesMedical sciencesSurgical sciencesTotalIs PBL a beneficial practice for the students in general?Yes I am indecisive No Totaln % n % n % n %2537278980.664.960.066.961272519.421.115.618.80811190.014.024.414.3315745133100.0100.0100.0100.0PBL = Problem based learningcourses during the academic year of 2006-2007 andtheir students about the extent of the contributionof PBL to learning certain skills in comparison withconventional education and clarify whether or notthey are content with PBL.SUBJECTS AND METHODSThis is a cross-sectional and descriptive study.PBL Setting in CurriculumBasic medical sciences are being taught in anintegrated program composed of five thematicblocks during first two years in AUFM. The coursesof different disciplines are integrated on the organsystem based themes in these blocks. The durationof each block is eight weeks and the first week isallocated to PBL modules. A case-based scenario isused in PBL sessions. Our students are expected toachieve relevant learning objectives while trying tosolve the problems they face in the scenario. Problemsolving is only a part of the PBL module. PBL weekis entirely devoted to PBL activities and free of othertraditional classes. Throughout this week, in threehalf-day time period, PBL small group discussionsessions, laboratory and field studies, clinical skillpractices, and supportive theoretical conferencestake place.Participants and Collection of the dataThe research population consisted of 153 tutorsand all the students enrolled in first years (n = 170).Before taking charge in a PBL module, the tutors ofAUFM had participated in the PBL courses supportedby the faculty developmental program. PBL courseis a part of faculty developmental program whichis obligatory for faculty members participating inteaching and tutoring activities. This PBL coursetakes three days. In the first two days theoreticalinformation is provided to the participants. Afterthat, two sample PBL sessions among participantsare carried out and all participant tutors take part inthese sessions as both students and tutors. After thecourse, all participants observe a real PBL module(three full discussion sessions) and are certified tobe a tutor for PBL module.In this study, a questionnaire was sent to thestudy population in June 2007, which is the finalmonth of the term. Questions included in thequestionnaire aimed to determine the departmentof the tutor, whether he / she thinks that PBL isa beneficial application for students, and finallywhether he / she is content with PBL. Additionally,a literature review was performed to determineareas which are accepted as better improved by PBLrather than by conventional education [2-7] . Twelvesubject headings were determined and questionsrelated to these subject headings were included inthe questionnaire. In both questionnaires for tutorsand for students, the participants were asked toanswer the questions using a 5-point Likert scale (1- it did not contribute at all, 5 - it contributed wellenough).Statistical AnalysisData analysis was carried out using SPSS packageversion 13.0. Independent sample t-test analysiswas used. P-values less than 0.5 were consideredstatistically significant.Table 2: Answers of tutors to the question “Are you content with PBL?” according to their departmentsDepartments of tutors Are you content with PBL?Basic sciencesMedical sciencesSurgical sciencesTotalPBL = Problem based learningYes I am indecisive No Totaln % n % n % n %2330207374.252.644.454.9511102616.119.322.219.531615349.728.133.325.6315745133100.0100.0100.0100.0

June 2009KUWAIT MEDICAL JOURNAL 125Table 3: Responses of both tutors and students to the question “Are you content with PBL?”Research populationTutorsStudentsAre you content with PBLYes I am indecisive No Totaln % n % n % n %7311754.974.5262319.514.6341725.610.8133157100.0100.0PBL = Problem based learningRESULTSMajority of the tutors (87.5%) and students (97.1%)responded to the questionnaire. 66.9% tutors answered“yes” to the question, “Is PBL an application that is ingeneral beneficial to the student?”. When the answerwas evaluated according to the departments, it wasdetermined that this answer was mostly given bythe tutors employed in departments of basic sciences(80.6%, Table 1).The question, “Are you content with PBL?” wasanswered as “yes” by 54.9% tutors. When the answerwas evaluated with regards to the tutors’ departments, itwas determined, once again, that the answer “yes” wasmostly given by tutors employed in the departmentsof basic sciences (74.2%, Table 2). 74.5% students alsoanswered “yes” to this question (Table 3).Among the close-ended questions those aimedat determining the opinion of tutors and studentsabout the extent of PBL’s contribution to certainsubject headings, “it contributed” response was tickedby most of the tutors and students for statements,“interpersonal relationships, adaptation to teamwork”and “developing communicational skills”, respectively(Table 4).When the mean scores obtained from the responsesto the above-mentioned questions were compared, asignificant difference was observed between the meanscores given by the tutors and the students. It wasdetermined that the students gave higher scores to thesix items given in Table 5 (p < 0.05).DISCUSSIONIt was observed that similar results have beenobtained with studies in the literature which aim todetermine opinion of tutors and students about PBLapplication in medical education [17-21] . Our studyrevealed that the majority of the tutors in charge ofPBL sessions felt that PBL was a beneficial applicationfor the students and that they were content with PBL.Additionally, it was found that a great majority of tutorsfelt that PBL offers significant contribution to studentsin areas, which were considered as the superior aspectsof PBL when compared to conventional education.It was a striking finding that the number of tutorswho were content with PBL and thought that PBLwas beneficial to the students were higher in thedepartments of basic sciences when compared to theother departments. Since PBL is an education modelthat is used in basic sciences in medical education,the answers given by the tutors employed in thesedepartments become more important. Additionally,the high rate of students (74.5%) who are contentwith PBL is an eminently important finding. Whenthe mean scores of the study groups given to itemsaimed to determine skills that are better acquiredthrough PBL than through conventional educationwere compared, it was found that the mean scoresgiven by the students were higher for eight items. Thisfinding shows that the students feel that PBL makespositive contributions in terms of skills mentioned inthose items. In the light of these findings, it may beTable 4: The percentage of tutors and students who said “it contributed” and “it contributed well enough” with PBL’s contributionin certain subject headingsSubject headingsInterpersonal relationships, adaptation to teamworkSkill of telling the information gained to othersDeveloping the skill of communicationSelf-directed learning and use of resourceDeveloping the skill logical thinkingUsing the information sources like library and internet for access to informationProblem solving skillDeveloping the skill of decision-takingIntegrating obtained knowledgeSkill of selecting useful information among information sourcesIncreasing the motivation for learningThe development of the skill of approaching the patient as a biopsychosocial wholeTutorsStudentsn % n %95958886818080706664635771.471.466.764.761.460.660.652.650.048.547.742.91051161231061231011211221118111411761.868.272.462.472.460.171.271.865.348.268.368.8

126Evaluation of Problem Based Learning by Tutors and Students in a Medical Faculty of TurkeyJune 2009Table 5: Mean scores obtained from responses of both tutors and students to the suggestions of PBL’s contribution in certain subjectheadingsSubject headingsInterpersonal relationships, adaptation to teamworkSkill of telling the information gained to the othersDeveloping the skill of communicationSelf-directed learning and use of resource tutorsDeveloping the skill logical thinkingUsing the information sources like library and internet for accessto informationProblem solving skillDeveloping the skill of decision-takingIntegrating obtained knowledgeSkill of selecting useful information among information sourcesIncreasing the motivation for learningThe development of the skill of approaching the patient as abiopsychosocial wholeTutors Students Statistical analysesMean SD Mean SD p-value t*3.813.793.723.613.573.603.613.433.333.343.403.291.080.930.940.910.950.990.970.941.010.941.011.023.703.743.953.633.853.573.883.873.713.193.813.831.051.051.051.181.061.130.990.971.101.281.081.080.340.650.050.890.010.810.010.000.000.2430.000.00-0.95-0.451.960.132.35-0.232.423.923.12-1.163.374.37* Independent sample t-testconcluded that PBL is useful in teaching especiallyof basic sciences in medical education and it helpsthe students to acquire skills which are crucialcomponents of education.On the other hand, it is an interesting findingthat the tutors employed in surgical sciences werethose who were least content with PBL. When theresponses of this group to the open-ended questionsaimed at determining the opinion and suggestionsabout PBL were examined, it was determined thatsome problems were mentioned in their answers.These problems were the time-consuming natureof PBL, the difficulty of allocating time for PBLwhile being busy with the routine tasks, the burdenof acting as orientators for a topic in which they arenot competent, and the lack of their faith in PBL. Inorder to solve these problems, attempts were madeto assign the tutors to PBL sessions once in everyterm and particularly to modules that are closelyrelevant to their branches.The part of the questionnaire entitled “Youropinion and suggestions about PBL” helpeddetermine points on which the tutors and studentswould like to see the greatest improvement.According to this part of the questionnaire, thetutors asked for the selection of topics that aresusceptible to self-directed learning and convenientto be discussed comprehensively and demandedbetter construction of scenarios. The students, onthe other hand, requested tutors to attend the PBLmodules well-prepared and have a participationstandard. Moreover, they have requested betterselection of PBL topics. All these requests are andwill be taken into consideration in the processof planning and developing educational andinstructional activities.CONCLUSIONOur results show that PBL is well received by thetutors and students in AUFM and PBL is acceptablein a Turkish setting of undergraduate medicaleducation in our faculty.ACKNOWLEDGMENTSThe authors thank the Akdeniz UniversityResearch Fund for financial support.REFERENCES1. Finucane P, Nichols F, Gannon B, Runciman S, PrideauxD, Nicholas T. Recruiting problem based- learning(PBL) tutors for a PBL-based curriculum: the FlindersUniversity experience. Med Educ 2001; 35:56-61.2. Elliott M. Are we going in the right direction? Asurvey of the undergraduate medical education inCanada, Australia and the United Kingdom from ageneral practice perspective. Med Teach 1999; 21:53-60.3. Maudsley G. Do we all mean the same thing by“problem-based learning”? A review of the conceptsand a formulation of the ground rules. Acad Med1999;74:178-185.4. Coles CR. Differences between conventional andproblem-based curricula in their students’ approachesto studying. Med Educ 1985; 19:308-309.5. Newble DI, Clarke RM. The approaches to learning ofstudents in a traditional and in an innovative problembasedmedical school. Med Educ 1986; 20:267-273.6. Dolmans D, Schmidt H. The advantages of problembasedcurricula. Postgrad Med J 1996; 72:535-538.7. Blumberg P, Michael JA. Development of self-directedlearning behaviours in a partially teacher-directed,problem-based learning curriculum. Teach LearnMed 1992; 4:3-8.8. Hill J, Rolfe IE, Pearson SA, Heathcote A. Do juniordoctors feel they are prepared for hospital practice?

June 2009KUWAIT MEDICAL JOURNAL 127A study of graduates from traditional and nontraditionalmedical schools. Med Educ 1998; 32:19-24.9. Moore GT, Block SD, Style CB, Mitchell R. Theinfluence of the New Pathway curriculum on Harvardmedical students. Acad Med 1994; 69:983-989.10. Senok AC, Pipan C, Edan Y, Botta GA. Internet andcomputer use by medical students in traditionaland problem based learning systems. KMJ 2008;40:196-201.11. Dolmans DH, Gijselaers WH, Moust JH, de GraveWS, Wolfhagen IH, van der Vleuten CP. Trends inresearch on the tutor in problem-based learning:conclusions and implications for educational practiceand research. Med Teach 2002; 24:173-180.12. Davis MH, Harden RM. AMEE Medical EducationGuide No.15: Problem-based learning: a practicalguide. Med Teach 1999; 21:130-140.13. Barrows HS. A specific, problem-based, self-directedlearning method designed to teach medical problemsolvingskills, and enhance knowledge retentionand recall. In: Schmidt HG, De Volker ML, editors.Tutorials in Problem-Based Learning. Assen: VanGorcum; 1984. p 16-32.14. Norman GR, Schmidt HG. The psychological basisof problem-based learning: a review of the evidence.Acad Med 1992; 67:557-565.15. Azer SA. Challenges facing PBL tutors: 12 tips forsuccessful group facilitation. Med Teach 2005; 27:676-681.16. Dolmans DH, Ginns P. A short questionnaire toevaluate the effectiveness of tutors in PBL: validityand reliability. Med Teach 2005; 27:534-538.17. Vernon DT. Attitudes and opinions of faculty tutorsabout problem-based learning. Acad Med 1995;70:216-223.18. Vernon DT, Blake RL. Does problem-based learningwork? A meta-analysis of evaluative research. AcadMed 1993; 68:550-563.19. Khoo HE, Chhem RK, Gwee MC, BalasubramaniamP. Introduction of problem-based learning in atraditional medical curriculum in Singapore--students’ and tutors’ perspectives. Ann Acad MedSingapore 2001; 30:371-374.20. O’Neill PA, Morris J, Baxter CM. Evaluation of anintegrated curriculum using problem-based learningin a clinical environment: the Manchester experience.Med Educ 2000; 34:222-230.21. Kaufman DM, Holmes DB. Tutoring in problembasedlearning: perceptions of teachers and students.Med Educ 1996; 30:371-377.

128KUWAIT MEDICAL JOURNAL June 2009Original ArticleImpaired Holter-Derived Variables of ParasympatheticActivity in Diabetic Patients with Daily-LifeSilent Myocardial IschemiaAhmad Ali Al-Dousary 1 , Saleh El-Enezy 1 , Mousa AJ Akbar 2 , Ali Mohamad Hegazy 11Department of Medicine, Farwania Hospital, Kuwait2Department of Medicine, Sabah Hospital, KuwaitABSTRACTKuwait Medical Journal 2009; 41 (2): 128-133Objective: To evaluate Holter-derived variables of impairedparasympathetic activity in diabetic patients with silentmyocardial ischemiaDesign: Cross sectional nature cohort studySetting: Department of Medicine, Farwania Hospital,KuwaitSubjects: One hundred and sixty patients with diabetesmellitusInterventions: 24-hour Holter electrocardiography (ECG)monitoring was used for heart rate variability and silentmyocardial ischemiaResults: Predictive indices revealed that Holter derivedvariables of parasympathetic activity (p-NN50, rMMD,SDANN-i) are considered as indicators for predictionof likelihood of daily life silent myocardial ischemia indiabetic patients. Sensitivity was 86, 85, 82%, specificity =88, 89, 81%, accuracy = 87, 86, 87%, positive predictive value= 89, 90, 86% and negative predictive value = 84, 83, 81%respectively. Multivariate analysis revealed that duration ofdiabetes status and serum level of HbA1c, as independentvariables were associated with likelihood of daily lifesilent myocardial ischemia (p < 0.05). Receiver operatingcharacteristic (ROC) curve data revealed that the best cutoffvalue of p-NN50 was 8% with sensitivity = 86% andfalse positive = 16%, (rMMD) = 26 msec with sensitivity =85% and false positive =15% and (SDANN-i) = 96 msec withsensitivity = 81% and false positive = 21% for prediction oflikelihood of daily life silent myocardial ischemia in diabeticpatients.Conclusion: Silent myocardial ischemia in diabetic patientsprovides statistically significantly association with impairedparasympathetic activity.KEY WORDS: diabetes mellitus, parasympathetic nervous systemINTRODUCTIONCoronary artery disease is the ultimate causeof death in more than half of diabetic patients andfrequently manifests itself silently and prematurely [1,2] .Previous studies among patients with known coronaryartery disease indicate that those with diabetes havemore frequent silent myocardial infarction and silentmyocardial ischemia during exercise testing andambulatory electrocardiographic monitoring thannon diabetic patients [3] .Because diabetics are predisposed to a higherincidence of coronary artery disease and autonomicneuropathy, they present a unique opportunity tostudy the pathophysiology of silent myocardialischemia [4] . Diabetic autonomic neuropathy mayinvolve the cardiac afferent sympathetic systemwhich is a part of the pain perception pathway frommyocardial pain receptors to the cerebral cortex. It ispossible that the development of myocardial ischemiain patients with such a neuropathy may be associatedwith more frequent silent myocardial ischemia [5-9] .Parasympathetic and sympathetic afferents arethought to convey sensory data from the heart tomodulate homeostasis and regulate cardiac functionthrough cardiocardiac reflexes [10] . In humanssympathetic afferent nerves are also thought to conveythe symptom of angina in patients with ischemic heartdisease and evidence for this is provided by findingsthat surgical rhizotomy (cervical sympathectomy)abolished angina in patients with ischemic heartdisease [11,12] .At present, several simple tests are available suchas the heart rate response to the Valsalva maneuver,deep breathing and standing. Individual results areAddress correspondence to:Dr Ahamad Al-Dousary, Department of Medicine, Farwania Hospital , P O Box 18373, Kuwait - 81004, Tel : +965 24888000 / 5497, E-mail:aldousai@hotmail.com

June 2009KUWAIT MEDICAL JOURNAL 129sometimes difficult to interpret as measurements aremade only over very short spans and a single test maygive an atypical result owing to natural variability [13] .The aim of this study was to evaluate Holterderivedvariables of impaired parasympathetic activityin diabetic patients with silent myocardial ischemia.SUBJECTS AND METHODSOne hundred and sixty diabetic patients wereincluded in the study. All patients were evaluatedclinically by looking at history, physical examination,12-leads ECG, plain chest X-ray and routine laboratoryinvestigations.Exclusion criteria included patients withhypertension, renal failure, acute myocardialinfarction, and left ventricular failure. Exclusion wasbased on medical history, physical examination and12-lead electrocardiogram.This study was approved by the hospital ethicalcommitteeTransthoracic echocardiographyIt was performed for all patients in the study withthe use of Toshiba Power Vision or GE vivid 7 and a3.5 MHZ phased array transducer to exclude patientswith segmental wall motion abnormalities and toassess left ventricular systolic and diastolic function.This study was approved by the hospital ethicalcommittee.Cardiac autonomic function tests [7]1. Resting heart rate: A heart rate greater than 100beats/minute was considered abnormal.2. Postural hypotension: It was as defined as a fallin systolic blood pressure greater than or equalto 30 mmHg immediately upon standing fromsupine position.3. Abnormal heart rate variation with deepbreathing: It was defined as a change in heartrate of less than 10 beats/minute in a supinepatient breathing at six breaths/minute.4. Abnormal heart rate variation with Valsalvamaneuver: The patient blew into a manometerhose and maintained a pressure of 40 mmHgfor 15 seconds. The longest R-R interval afterthe Valsalva strain divided by the shortest RRinterval during the maneuver was defined as theValsalva ratio. An abnormal ratio is less than orequal 1.10.5. Sustained (isometric) hand grip testing: Thedifference in diastolic blood pressure wasmeasured after the subject was asked to maintaina hand grip at 50% of maximal voluntarycontraction with a hand grip sphygmomanometerfor a maximum of five minutes. The normalresponse is an increase of 16 mmHg.24-hour Holter monitoring and heart ratevariabilityDuring analysis, only cycles in which beatshad normal morphologic characteristics and werewithin 25% of the preceding cycle length, wereselected for calculation for heart rate variability.Time domain measurements were obtained fromnormal to normal sinus beats including the meanRR interval and its SD (SDNN), the average valueof the five minute standard deviations for selectedintervals (SDNN-i), the percentage of successiveRR interval that deviated by > 50% from the priorRR interval (p-NN50), the root mean square ofsuccessive RR interval differences (rMMD) andSD of the average of RR intervals in 5-minutesegments of the 24 hour recording (SDANN-i) [14] .24-hour Holter monitoring and daily-life silentmyocardial ischemia1. Ischemic episodes: ST segment depression1 mm or more occurred 80 msec after J pointlasting one minute or more and separatedfrom other significant episodes by oneminute or more. For each patient, totalnumber of ischemic episodes/24 hours andtotal duration of ischemic episodes (msec)were calculated.2. Non-ischemic episodes: were defined as noischemic ST segment depression while, thepatients having the same heart rate with onsetof ischemic episodes and presented within1 - 2 hours before or after onset of ischemicepisodes in the same patients [15] .Study DesignThere were two main groups in the study.Control group: included 50 non diabeticsubjects.Patient sample: included 160 diabetic patientswho were stratified into:Group I: included 87 diabetic patients withsilent myocardial ischemia.Group II: included 73 diabetic patients withoutsilent myocardial ischemia.Statistical analysisContinuous variables are summarized as amean ± standard deviation (SD). Comparisonbetween two groups was performed with t-testfor continuous variables and chi-square test forcategorical variables. A p- value < 0.05 wasconsidered statistically significant and a p-value

130Impaired Holter-Derived Variables of Parasympathetic Activity in Diabetic Patients ...June 2009Table 1: Mean and standard deviation of time domain heart rate variability Holter derived variables in all groups of the studyVariables Control Group Group I Group II F Value CG Vs G I CG Vs G II G I Vs G IISDNN (msec)SDNN-i (msec)SDANN-i (msec)r-MSSD (msec)pNN50 (%)154.84 ± 9.5271.40 ± 5.31130.34 ± 7.7342.79 ± 4.6714.93 ± 5.71112.47 ± 5.2754.72 ± 6.4197.2 ± 5.7125.13 ± 4.678.16 ± 5.76140.31 ± 6.8367.52 ± 3.66121.26 ± 4.1537.11 ± 2.7213.91 ± 3.614.9633.7193.8735.1654.619< 0.05< 0.05< 0.05< 0.01< 0.01NSNSNSNSNS< 0.05< 0.05< 0.05< 0.05< 0.05CG: control group; G I: group I; G II: group II; SDNN: standard deviation of all selected RR intervals; SDNN-i: the average value of the 5minute standard deviations for selected intervals (SDNN index); SDANN-i: the standard deviation of the 5 minute average for selectedintervals (SDNN index); r-MSSD: square root of the mean of the squared successive differences in RR intervals; pNN50: the percentageof intervals that are at least 50 msec different from the previous intervalischemia. The strength of the association withimpaired Holter derived parasympathetic activityis presented as 95% confidence intervals. Potentialconfounding of clinical variables was entered asindependent variables.The validity of Holter derived parasympatheticactivity variables to predict the likelihood of dailylife silent myocardial ischemia was assessedby estimating the predictive indices. Predictiveindices: True positive (TP), true negative (TN),false positive (FP), false negative (FN), sensitivity,specificity, accuracy, positive predictive value andnegative predictive value were calculated.Receiver operating characteristic (ROC) curve(grade of sensitivity versus false positive) wasused to identify the sensitivity and false positive ofcertain value of the variable with area under curveand probability of error with sensitivity 100% todetect usefulness of Holter derived variables ofparasympathetic activity in the diabetic patientsfor prediction of likelihood of daily life silentmyocardial ischemia. ROC was calculated usinglikelihood ratio method. Likelihood ratio +ve =sensitivity/1-specificity and likelihood ratio -ve= 1-sensitivity /specificity. The best cut off pointshould be close to the top left hand corner of thegraph: high detection rate with low false positiverate.RESULTSClinical characteristicsWith regards to the age and gender of thepatients, there was no significant differencebetween group I and II (52.42 ± 4.11 versus47.5 ± 4.03 years, (p = NS), 77 (88.5%) versus 66(90.4%) male, (p = NS) and 10 (11.5%) versus 7(9.6%) female, (p = NS), respectively). There wasno significant difference between group I and IIregarding a percentage of patients with history ofsmoking [43 (49.4%) versus 40 (54.6%) patients, (p= NS)]. There was no significant difference in theheart rate, systolic and diastolic blood pressurebetween patients from the control group andstudy sample (78.15 ± 5.64 versus 80.52 ± 6.82beat/minute, p = NS, 119.61 ± 6.62 versus 122.19 ±5.91 mmHg, p = NS and 76.41 ± 5.30 versus 78.43± 4.54 mmHg, respectively, p = NS). There was asignificantly more increased duration of diabetesand level of HbA1c in patients from group Ithan those of group II (8.94 ± 1.62 versus 4.11 ±2.43 years and 9.34 ± 1.23 versus 5.91 ± 1.16 %,respectively, p < 0.05).Echocardiography and Doppler studyIn the control group, the median value of (Evelocity) = 9 cm/sec, median value of (A velocity)= 8.3 cm/sec and median value of Em / Am ratio=1.56.There was a significantly more decreased (Evelocity) and Em / Am ratio in patients of groupI than those from group II (7.2 ± 1.6 versus 9.8± 2.4 cm/sec and 0.59 ± 0.23 versus 0.93 ± 0.16,respectively, p < 0.05), but there was a significantlymore increased (A velocity) in patients of group Ithan those of group II (9.2 ± 1.1 versus 6.7 ± 2.1cm/sec, p < 0.05).Table 2: Predictive indices of values from Holter derived variables of parasympathetic activity for prediction of likelihood of Holterderiveddaily life silent myocardial ischemiaSDNN (msec)SDNN -i (msec)SDANN -i (msec)r-MSSD (msec)pNN50 (%)Variables TP TN FP FN Sen % Spec % Acc % PPV % NPV %70697174736665636566121311891213151312TP: true positive, TN: true negative, FN: false negative, FP: false positive, Sen: sensitivity, Spec: specificity, Acc: accuracy, PPV: positivepredictive value, NPV: negative predictive value85848285868483818988858787868785848690898484818384

June 2009KUWAIT MEDICAL JOURNAL 131Table 3: Receiver operating characteristic curve data to define the ideal cut off values of the Holter derived variables of parasympatheticactivity for prediction of likelihood of Holter-derived daily life silent myocardial ischemiaVariables Ideal cut-off values Sensitivity % Specificity % False +ve %SDNNSDNN-iSDANN-ir-MSSDpNN50110 msec51 msec96 msec26 msec8 %818381858682817985841819211516Likelihoodratio +ve3.832.923.614.844.72Likelihoodratio -ve0.1580.1970.1630.1780.189The ideal cut off value = high detection rate (sensitivity) with low false positive, false positive = 1- specificity24-hour Holter monitoring and heart ratevariabilityTable 1 shows that there was a significantlymore decreased 24-hour Holter monitoringderived time domain variables (SDNN, SDNN-i,SDANN-i, p < 0.05) and a highly significantly moredecreased (r-MSSD, pNN50, p < 0.01) in patients ofgroup I than control group and those of group II, butthere was a non significant difference between controlgroup and those of group II (p = NS).Validity and reliabilityThe predictive indices showed that Holter derivedvariables of parasympathetic activity (SDNN,SDNN-i, SDANN-i, r-MSSD, pNN50), are valid forprediction of diabetic patients with likelihood ofHolter derived daily life silent myocardial ischemia(Table 2).Receiver operating characteristic (ROC) curveTable 3 shows the ideal cut off value (highdetection rate (sensitivity) with low false positive)of the Holter derived variables of parasympatheticactivity (SDANN-i, r-MSSD, pNN50), with positiveand negative likelihood ratio. The best cut-off valueof (SDANN-i) to predict diabetic patients withlikelihood of daily life silent myocardial ischemia was96 msec at 81% sensitivity and 79% specificity (themaximum sensitivity and maximum specificity nearto the left diagonal), with 29% probability of errorat 100% sensitivity and the area under curve was0.897. The ideal cut-off value of (r-MSSD) to predictdiabetic patients with likelihood of daily life silentmyocardial ischemia was 26 msec at 85% sensitivityand 85% specificity with 32% probability of errorat 100% sensitivity and the area under curve was0.778. The ideal cut-off value of (pNN50) to predictdiabetic patients with likelihood of daily life silentmyocardial ischemia was 8% at 86% sensitivity and84% specificity, with 27% probability of error at 100%sensitivity and the area under curve was 0.814.Forward stepwise logistic analysisMultivariate analysis revealed that duration ofdiabetes status (OR = 2.789, 95% CI =1.541 - 4.196),Table 4: Stepwise logistic multivariate analysis of patients withversus without Holter-derived daily life silent myocardial ischemiawith regard to independent variables of clinical dataIndependentvariablesAgeGenderSmokingBody Mass IndexHypercholesterolemiaHypertriglyceridemiaDuration of diabetesstatusLevel of HbA1cRegressioncoefficient0.03830.06290.04180.07630.06290.00180.19190.1954p-valueNSNSNSNSNSNS< 0.05< 0.05Oddsratio0.8350.6270.7510.7280.6290.7842.7891.794HR: heart rate, BP: blood pressure, SBP: systolic blood pressure95%Confidenceinterval0.234 - 1.7780.474 - 1.4310.325 - 1.2140.078 - 1.6370.174 - 1.1310.325 - 1.9141.541 - 4.1961.326 - 3.416level of HBA1c (OR = 1.954, 95% CI = 1.326 - 3.416),autonomic function tests as postural hypotension(OR = 1. 861, 95% CI =1.374 - 2.931), abnormal heartrate variation with deep breath (OR = 2.297, 95% CI=1.541 - 4.196) and sustained hand grip testing (OR =1.729, 95% CI =1.674 - 3.131) as independent variableswere associated with likelihood of daily life silentmyocardial ischemia (p < 0.05). However, there wasno significant association as regards the age, gender,smoking, body mass index, hypercholestrolemia,hypertriglyceridemia, resting heart rate > 100 beatper minute and abnormal heart rate variation withValsalva maneuver (p = NS, Tables 4 and 5).DISCUSSIONAmbulatory ECG monitoring was used to detectdaily life silent ischemic episodes as well as heart ratevariability in patients from our study. Zharov et al [16]used 24 hours monitoring and reported its usefulnessto detect silent myocardial ischemia as comparedwith echocardiography segmental wall motionabnormalities. Hikita et al [17] found that ambulatoryECG monitoring is more sensitive for detection ofsilent myocardial ischemia than treadmill exerciseECG testing. Goseki et al [15] used ambulatory ECGmonitoring to detect silent myocardial ischemia andheart rate variability before the occurrence of silentischemia as a non-invasive parameter of autonomicnervous system activity.

132Impaired Holter-Derived Variables of Parasympathetic Activity in Diabetic Patients ...June 2009Table 5: Stepwise logistic multivariate analysis of patients withversus without Holter-derived daily life silent myocardial ischemiawith regard to independent variables of cardiac autonomic functiontestsIndependentvariablesRegressioncoefficientp-valueOddsratio95%ConfidenceintervalResting heart rate> 100 beat/minute 0.0284 NS 0.891 0.234 - 1.778Posturalhypotension > 30mmHg 0.1527

June 2009KUWAIT MEDICAL JOURNAL 1334. Valensi P, Sachs RN, Harfouche B, et al. Predictive valueof cardiac autonomic neuropathy in diabetic patientswith or without silent myocardial ischemia. DiabetesCare 2001; 24:339-343.5. Gupta SB, Pandit RB. Silent myocardial ischaemia andcardiac autonomic neuropathy in diabetics. IndianHeart J 1992; 44:227-229.6. Jermendy G, Davidovitz Z, Khoor S. Connectionbetween painless abnormal ST- deflection andautonomic neuropathy in diabetes mellitus. Orv Hetil1993; 134:65-69.7. Langer A, Freeman MR, Josse RG, Steiner G, ArmstrongPW. Detection of silent myocardial ischemia in diabetesmellitus. Am J Cardiol 1991; 67:1073-1078.8. Melina D, Colivicchi G, Melina G, Pristipino C.Prevalence of silent ST segment depression duringlong term ambulatory electrocardiographic monitoringin asymptomatic diabetic patients with essentialhypertension. Minerva Med 1993; 84:301-305.9. Vaishnav S, Stevenson R, Merchant B, Lagi K,Ranjadayalan K, Timmis AD. Relation between heartrate variability early after acute myocardial infarctionand long-term mortality. Am J Cardiol 1994; 73:653-657.10. Dellborg M, Emanuelsson H, Swedberg K. Silentmyocardial ischemia during coronary angioplasty.Cardiology 1993; 82:325-334.11. Chierchia S, Muiesan L, Davies A, Balasubramian V,Gerosa S, Raftery EB. Role of the sympathetic nervoussystem in the pathogenesis of chronic stable angina.Implications for the mechanism of action of betablockers.Circulation 1990; 82:SII:71-81.12. White JC. Cardiac pain: anatomic pathways andphysiologic mechanisms. Circulation 1957; 16:644-655.13. McAreavey D, Neilson JM, Ewing DJ, Russell DC.Cardiac parasympathetic activity during the earlyhours of acute myocardial infarction. Br Heart J 1989;62:165-170.14. Stein PK, Bosner MS, Kleiger RE, Conger BM. Heartrate variability: a measure of cardiac autonomic tone.Am Heart J 1994; 127:1376-1381.15. Goseki Y, Matsubara T, Takahashi N, Takeuchi T,Ibukiyama C. Heart rate variability before the occurrenceof silent myocardial ischemia during ambulatorymonitoring. Am J Cardiol 1994; 73:845-849.16. Zharov E, Kazankov IuN, Grigor’ev MIu. Silentmyocardial ischemia in patients with diabetes mellituswithout the clinical manifestation of ischemic heartdisease. Kardiologiia 1993; 33:16 -18.17. Hikita H, Kurita A, Takase B, et al. Usefulness of plasmabeta endorphin level, pain threshold and autonomicfunction in assessing silent myocardial ischemia inpatients with and without diabetes mellitus. Am JCardiol 1993; 72:140-143.18. O ́Brien IA, O ́Hare JP, Lewin IG, Corrall RJ. Theprevalence of autonomic neuropathy in insulindependentdiabetes mellitus: a controlled study basedon heart rate variability. Q J Med 1986; 61: 957-967.19. Quek DK, Khor PG, Ong SB. Association of diabeticautonomic neuropathy with painless myocardialischaemia induced by exercise. Singapore Med J 1992;33:177-181.20. Lund DD, Subieta AR, Pardini BJ, Chang KS.Alterations in cardiac parasympathetic indices in STZinduceddiabetic rats. Diabetes 1992; 41:160-166.21. Malliani A, Lombardi F, Pagani M. Power spectrumanalysis of heart rate variability: a tool to exploreneural regulatory mechanisms. Br Heart J 1994; 71:1-2.22. Risk M, Bril V, Broadbridge C, Cohen A. Heart ratevariability measurement in diabetic neuropathy:review of methods. Diabetes Technol Ther 2001; 3:63-76.23. Biagini E, Schinkel AF, Bax JJ, et al. Long term outcomein patients with silent versus symptomatic ischaemiaduring dobutamine stress echocardiography. Heart2005; 91:737-742.24. Shakespeare CF, Katritsis D, Crowther A, Cooper IC,Coltart JD, Webb-Peploe MW. Differences in autonomicnerve function in patients with silent and symptomaticmyocardial ischaemia. Br Heart J 1994; 71:22-29.25. Valensi P, Paries J, Attali JR. French group forResearch and Study of Diabetic Neuropathy. Cardiacautonomic neuropathy in diabetic patients: influenceof diabetes duration, obesity and the microangiopathiccomplications - the French multicenter study.Metabolism 2003; 52:815-820.

134KUWAIT MEDICAL JOURNAL June 2009Preliminary ReportEffects of Visual Feedback Balance Training byUsing Computerized Dynamic Posturographyin Patients with Multiple SclerosisMaria Kondeva Ivanova, Mohieldin M Ahmed, Doahoo Mosalem M, Waleed Ahmed Al-BusairiPhysical Medicine and Rehabilitation Hospital, Ministry of Health, KuwaitKuwait Medical Journal 2009; 41 (2): 134-139ABSTRACTObjectives: To study the effects of the visual feedback balancetraining on the Berg Balance Scale (BBS) under static anddynamic conditions, the somatosensory, visual and vestibularsystems by dynamic posturography before and after trainingprogram in patients with multiple sclerosis (MS)Design: Retrospective case training studySetting: Physical Medicine and Rehabilitation Hospital,Ministry of Health, KuwaitSubjects and Methods: A total of 23 patients with MS wererecruited.Intervention: All patients were evaluated using both the BBSand the sensory organization test (SOT) using computerizeddynamic posturography (CDP) before and three months afterthe training program. The SOT consists of six conditions andcomposite equilibrium score (CES).Main Outcome Measures: CES (%) and SOT werecalculatedResults: Before training, all patients had a reduction of BBSSand parameters of the SOT. After training, a significantincrease of BBS (p < 0.05), all parameters of the SOT (p

June 2009KUWAIT MEDICAL JOURNAL 135Table 1: Demographic data and principal characteristics of 23 patientswith multiple sclerosisCharacteristics Cases n (%) Mean ± (SD)Age (years)Disease duration (years)EDSSTherapy with interferonClinical course of MS:Relapsing-remittingSecondary progressivePrimary progressiveProgressive relapsingDysarthriaCerebellar lesionBrainstem lesionPyramidal lesionSensory lesionBladder lesionMental lesion21 (91.3)21 (91.3)2 (8.7)——16 (69.7)14 (60.87)3 (13.1)17 (79.9)11 (73.9)2 (8.9)—EDSS : Expanded Disability Status Scale45.2 ± 7.616.8423 ± 5.82.3 ± 0.1balance training on static and dynamic conditionsand the somatosensory, visual and / or vestibularsystems by computerized dynamic posturographybefore and after rehabilitation program inmoderately disabled persons with MS in Kuwait.SUBJECTS AND METHODSA total of 23 female Kuwaiti patients with MSwere recruited for this study and selected fromthe out-patient clinic in the Physical Medicineand Rehabilitation Hospital, Kuwait. All patientswere evaluated clinically with a brief neurologicalexamination. All patients underwent image studiessuch as brain computed tomography or magneticresonance imaging to confirm their diagnosis.The diagnosis of MS is generally made by reviseddiagnostic criteria for multiple sclerosis [10] . Theassessment of neurological impairment of MS wasdone using the Kurtzke Expanded Disability StatusScale (EDSS) [11] . Formal consent was taken from allthe patients.Inclusion criteria were the following: (1)ambulatory patients with ability to ambulate 25 ftindependently; and (2) mild or moderate MS deficitsdefined by an EDSS of ≤ 2.3. Those with severe MS,severe spasticity or cognitive deficit, peripheralneuropathy or significant visual field problems wereexcluded. The patients gave informed voluntaryconsent to participate in the study according to theprotocol approved by the local ethics committeeand in accordance with the ethical standards of theHelsinki declaration.Balance functional impairment was done by usingthe BBS. The maximum score for this assessment is 56.Based on clinical experience, Berg et al contend thatscores below 45 indicate that someone is impaired,with an increased risk for falls [12] .Table 2: Mean ± SD of Berge Balance Scale and parameters of sensoryorganization test (SOT) before and after training in MS patientsParameters (mean ± SD)Berge Balance ScaleComposite Equilibrium Score %TotalSOT 1SOT 2SOT 3SOT 4SOT 5SOT 6Sensory analysis scores %SOM (somatosensory ratio)VIS (visual ratio)VEST (vestibular ratio)PREF (preference score)Beforetraining42.3 ± 4.849.5 ± 3.882.9 ± 7.174.2 ± 6.668.9 ± 12.955.2± 2.537.6 ± 2.746.7 ± 2.372.3 ± 1.868.6 ± 3.054.4 ± 9.450.0 ± 2.6Aftertraining51.4 ± 3.9*68.3 ± 4.2**87.1 ± 6.0*81.4 ± 8.7*83.0 ± 3.5*77.3 ± 5.4*62.4 ± 1.9*73.7 ± 3.3*93.1 ± 2.6*78.5 ± 2.5#66.9 ± 3.0#61.9 ± 9.3#p-value< 0.05< 0.001< 0.05< 0.05< 0.05< 0.05< 0.05< 0.05< 0.05The paired-sample Student’s t test, * = Significant, ** = Highlysignificant, # = non-Significant.The SOT was used for balance assessment. Itincluded six test conditions. The firstthreeconditionsinclude SOT 1 (eyes open), SOT 2 (eyes closed), SOT3 (sway-referenced vision with standing on a fixedplatform called static posturography. The secondthree conditions include SOT 4 (eyes open), SOT 5(eyes closed), SOT 6 (sway-referenced vision withstanding on a moving platform called dynamicposturography. Composite Equilibrium Score (CES%) was calculated that describes the overall level ofperformance under the six conditions. Scores rangefrom 0 to 100, with 0 representing a fall and 100representing perfect stability [9] .The sensory analysis scores represent the influenceof each sensory system on the individual’s stability,and quantify the relative difference in scores betweenconditions. The somatosensory ratio comparescondition 2 to condition 1 and measures posturalstability when vision is removed. The visual ratiocompares condition 4 to condition 1 and measuresthe ability of the visual system to function whensomatosensory input is altered by sway-referencing.The vestibular ratio compares condition 5 to condition1, assessing the stability of the individual when bothsomatosensory and visual input have been alteredby sway-referencing or eye closure, respectively. Avision preference score, an indication of whether theparticipant is overly reliant on visual information, isalso calculated using the ratio of the sum of conditions3 and 6 to the sum of conditions 2 and 5 [9] .All patients received complex training coursefor three months including visual feedback balancetraining (once weekly) by using computerizeddynamic posturography and conventional physicaltherapy (three times weekly). All patients wereevaluated in a study of postural stability by the BBS

136Effects of Visual Feedback Balance Training by Using Computerized Dynamic Posturography...June 2009Fig. 1: Represents dynamic posturography before treatment in MS patients (CES = 37%)and computerized dynamic posturography (CDP)before and three months after the training program.Statistical analysisStudy data were analyzed using the SPSS statisticalpackage. The paired-sample Student’s t test indicatesthe magnitudes of the differences of means betweenthe BBS, ES and SOT scores before and after treatmentin MS patients. A p-value of < 0.05 was consideredas significant. This study was approved by the hospitalethical committee.RESULTSTable 1 represents characteristics of patients withmultiple sclerosis. Table 2 shows results of BBS, CESand six tests conditions and sensory analysis scoresbefore as compared to results after training of MSpatients. Fig. 1 and 2 represent CDP before and aftertreatment in MS patients.There was statistically significant increase of mean(SD) of BBS after treatment (51.4 ± 3.9) as comparedwith results before training (42.3 ± 4.8) (p < 0.05). Therewas an increase of mean (SD) of CES after treatment(68.3 ± 4.2) as compared to results before training (49.5± 3.8, p < 0.001). Moreover, a statistically significantincrease was observed for the static and dynamicbalance after treatment as compared to results beforetraining (p < 0.05).According to the sensory analysis scores, a significantincrease was observed for the somatosensory ratioscore after treatment (93.1 ± 2.6) as compared to resultsbefore training (72.3 ± 1.8, p < 0.05). However , therewas a statistically non-significant difference in visualratio score, vestibular ratio score and preference scorebefore as compared with results after training (p >0.05). The data suggest that there is an impairment ofthe somatosensory system, rather than a specific lesionof vestibular and/or visual systems.

June 2009KUWAIT MEDICAL JOURNAL 137Fig. 2: Represents dynamic posturography after treatment in MS patients (CES = 60%).DISCUSSIONBalance problems and falls are common inpeople with MS but their cause and nature are notwell understood. It is known that MS affects manyareas of the central nervous system that can impactpostural responses to maintain balance, includingthe cerebellum and the spinal cord [13] . Ambulatorypatients with MS frequently present with poorbalance [14] .Our data demonstrate that there was a statisticallysignificant increase of BBS and CES after treatmentas compared to results before treatment. Also, astatistically significant increase in static and dynamicbalance functions was observed after treatment ascompared to results before treatment. These datasuggest that good balance control after treatmentcould be explained by changes of the somatosensorysystem rather than vestibular and/or visual systemsand the CDP can provide a useful tool for quantitativedetection of imbalance in patients with MS.This study agrees with other studies. Cha et alreported that BBS showed statistically significantimprovement in functional status in patientswith MS [15] . Dalla et al studied treatment that wasbased on postural feedback on standing balanceplatform. After rehabilitative treatment the clinicaland functional finding and standing balance wasimproved [16] . CDP facilitates measurement ofstanding balance and permits a quantificationof the role of proprioception, vision and thevestibular system in the maintenance of standingbalance [17] .Jackson et al studied twenty-seven patients withmild MS by CDP. They found poor performance ofbalance which probably indicates a disruption of theintegration of visual, vestibular, and somatosensoryinformation in MS. Although patients with earlyMS and patients with purely vestibular disordersoften have similar complaints, they have quitedifferent profile of abnormalities in posturographytesting [18] .

138Effects of Visual Feedback Balance Training by Using Computerized Dynamic Posturography...June 2009Balance deficits in people with MS appear tobe caused by somatosensory and not by cerebellarinvolvement in some MS patients [13] . Some MSpatients had a vestibular dysfunction pattern ora combined visual-vestibular or somatosensoryvestibularimpairment. Posturography mightserve as one method to evaluate the functionalconsequences of a vestibular deficit in patients withMS [19] .In our study, we found impaired balance inpatients with relapsing remitting multiple sclerosis(RRMS). But other authors found that balance in MSpatients is impaired in RRMS, secondary progressiveMS (SPMS) and primary progressive MS (PPMS).There were some differences of balance betweenprevious groups in all the balance tests [20] .Some authors found balance impairmentsincluding minimal balance deficits of the BBS andimpaired center of pressure displacement duringstanding in MS [7] . Achiemere suggests that dynamicposturography can provide useful diagnosticinformation in patients with balance disturbances inMS patients [21] .In contrast to our results, Frzovic et al. reportedthat there were no differences between MS and controlgroups on the ability to maintain standing balance.There was little change in balance from morningto afternoon in participants with MS, despite anincrease in self-rated fatigue [6] . Some authors foundthe MS patients had a vestibular dysfunction patternor a combined visual-vestibular or somatosensoryvestibularimpairment [19] . There is a disruption of theintegration of visual, vestibular, and somatosensoryinformation in patients with early MS and patientswith purely vestibular disorders in posturographytesting in MS [18] .One possible explanation for our findings is thatthe CNS damage, caused by MS is supposed to reflectsome change in the structure of the posture controlsystem such as the impairment of the somatosensorysystem, rather than a specific lesion of vestibularand / or visual modalities [22] . Jackson et al foundpoor performance of balance and abnormalities inposturography testing which indicates a disruptionof the integration of somatosensory, visual orvestibular information in MS [18] .This study briefly describes the results of ourexperience in visual feedback training by usingthe dynamic posturography for MS patients. Thisstudy also represents the first attempt in Kuwait touse the dynamic posturography equipment as anassessment tool to study the effect of visual feedbacktraining in MS patients. Further research in use of theposturography equipment is needed to study variousmechanisms of balance dysfunction in patients withMS.LimitationsThe small number of the study subjects may havesome influence on the outcome and the authors arecontinuing the study by adding more subjects.ACKNOWLEDGMENTSWe acknowledge the help of our colleagues inthe Physical Medicine and Rehabilitation Hospital,Kuwait for their assistance in this study.REFERENCES1. Williams NP, Roland PS, Yellin W. Vestibularevaluation in patients with early multiple sclerosis.Am J Otol 1997; 18:93-100.2. Noseworthy JH, Lucchinetti C, Rodriguez M,Weinshenker BG. Multiple sclerosis. N Engl J Med2000; 343:938-952.3. Shumway-Cook A, Woollacott M. Motor Control:Theory and practical applications. Baltimore,Lippincott Williams and Wilkins, 2001; p163-191.4. Lanska DJ, Goetz CG. Romberg’s sign: development,adoption, and adaptation in the 19th century.Neurology 2000; 55:1201-1206.5. Lipsitz LA, Jonsson PV, Kelley MM, Koestner JS.Causes and correlates of recurrent falls in ambulatoryfrail elderly. J Gerontol 1991; 46:114-122.6. Frzovic D, Morris ME, Vowels L. Clinical tests ofstanding balance: performance of persons withmultiple sclerosis. Arch Phys Med Rehabil 2000;81:215-221.7. Karst GM, Venema DM, Roehrs TG, Tyler AE. Centerof pressure measures during standing tasks inminimally impaired persons with multiple sclerosis.J Neurol Phys Ther 2005; 29:170-180.8. Nashner LM, Peters JF. Dynamic posturography inthe diagnosis and management of dizziness andbalance disorders. Neurol Clin 1990; 8:331-349.9. Chaudhry H, Findley T, Quigley KS, et al. Measuresof postural stability. J Rehabil Res Dev 2004; 41:713-720.10. Poser CM, Brinar VV. Diagnostic criteria for multiplesclerosis. Clin Neurol Neurosurg 2001; 103:1-11.11. Kurtzke JF. Rating neurologic impairment in multiplesclerosis: an expanded disability status scale (EDSS).Neurology 1983; 33:1444-1452.12. Bogle Thorbahn LD, Newton RA. Use of the BergBalance Test to predict falls in elderly persons. PhysTher 1996; 76:576-583.13. Cameron MH, Horak FB, Herndon RR, Bourdette D.Imbalance in multiple sclerosis: a result of slowedspinal somatosensory conduction. Somatosens MotRes 2008; 25:113-122.14. Tesio L, Perucca L, Franchignoni FP, Battaglia MA.A short measure of balance in multiple sclerosis:validation through Rasch analysis. Funct Neurol1997; 12:255-265.15. Cha E, Castro HK, Provance P, Finkelstein J.Acceptance of home telemanagement is high inpatients with multiple sclerosis. AMIA Annu SympProc 2007; 11:893.

June 2009KUWAIT MEDICAL JOURNAL 13916. Dalla Toffola E, Albasi G, Serra E, Losio L, AlfonsiE, Citterio A. Rehabilitation in multiple sclerosis:clinico-instrumental correlations. G Ital Med Lav1996; 18:135-138.17. Parker SW. Vestibular evaluation-electronystagmography,rotational testing, and posturography. ClinElectroencephalogr 1993; 24:151-159.18. Jackson RT, Epstein CM, De l’Aune WR. Abnormalitiesin posturography and estimations of visual verticaland horizontal in multiple sclerosis. Am J Otol 1995;16:88-93.19. Nelson SR, Di Fabio RP, Anderson JH. Vestibularand sensory interaction deficits assessed bydynamic platform posturography in patients withmultiple sclerosis. Ann Otol Rhinol Laryngol 1995;104:62-68.20. Soyuer F, Mirza M, Erkorkmaz U. Balanceperformance in three forms of multiple sclerosis.Neurol Res 2006; 28:555-562.21. Achiemere G. Examination of the vestibular systemin multiple sclerosis. Cas Lek Cesk 2006; 145:905-906.22. Corradini ML, Fioretti S, Leo T, Piperno R. Earlyrecognition of postural disorders in multiple sclerosisthrough movement analysis: a modeling study. : IEEETrans Biomed Eng 1997; 44:1029-1038.

140KUWAIT MEDICAL JOURNAL June 2009Case ReportImmune Associated Complication in MeningococcalDisease: A Report of Two CasesHanan Y Al-Qattan, Osama AEF El-Hashash, Nabila A AbulDepartment of Pediatrics, Farwaniya Hospital, KuwaitABSTRACTKuwait Medical Journal 2009; 41 (2): 140-142Meningococcal disease is one of the most feared infections inchildren. In recent years, little attention has been focused onthe complications of meningococcal disease in the sub-acutephase, the so-called immune associated complications. Itsmain features are arthritis, vasculitis, episcleritis, pericarditisand very rarely nephritis. We report two siblings withmeningococcal disease. The first developed arthritis andvasculitis while the younger sister developed only arthritisof the right ankle. To the best of our knowledge this is thefirst case report to be published in Kuwait.KEY WORDS: arthritis, immune associated complications (IAC), meningococcal septicemia, vasculitisINTRODUCTIONReports of illnesses resembling meningococcaldisease date back to the 16 th century. The descriptionreported by Viesseux in 1805 is generally thought tobe the first definitive identification of the disease. Thecausative organism; Neisseria meningitidis was firstisolated in 1887 [1] . It is one of the most feared infectionsin children due to its possible rapidly fatal course [2]and relatively high incidence of sequelae in survivors.Despite treatment with the appropriate antimicrobialagents and optimal care, the overall case fatality rateshave remained relatively stable over the past 20 yearsat a 9-12% reaching a rate of up to 40% amongst thepatients with meningococcemia [3] . Between 11-19%of survivors of meningococcal disease have sequelaesuch as hearing loss, neurological disability or lossof a limb [4,5] .Most of the research that has been done inrecent years was directed at the pathophysiologicalmechanisms in the acute phase. However, relativelylittle is known about the complications occurringin the sub-acute phase (4-10 days after the initialantibiotic treatment); the so-called type 3 immunecomplex hypersensitivity reactions according to Gelland Coombs [2] .In meningococcal disease type 3 reaction, furthercalled immune associated complication (IAC), canoccur as arthritis, vasculitis, episcleritis, pericarditisor rarely nephritis [2] . More than one complication canoccur concurrently in some patients. We describe twosiblings in this case study. One developed arthritisand the other had arthritis and vasculitis in thesubacute phase of meningococcemia.CASE PRESENTATIONCase OneA nine-year old girl, second in order of siblingsof six children, was admitted with complaintsof fever, headache, vomiting and a skin rash. Onexamination she looked ill with altered level ofconsciousness, had signs of meningeal irritation aswell as purpuric and ecchymotic skin rash all overher body. Intravenous ceftriaxone (100 mg/kg/day) was commenced following admission with aclinical diagnosis of meningococcemia. Completeblood count showed white blood cell of 5.2 x 10 9 /l ,neutrophils 86%, hemoglobin 117 g/l, platelet 267 x10 9 /l. Erythrocyte sedimentation rate (ESR) was 38mm/h and C- reactive protein (CRP) was 259 mg/l. Latex agglutination test for blood and urine aswell as blood cultures were all positive for Neisseriameningitidis serogroup W 135. Complement 3 and 4levels (C3, C4) were 0.241 g/l (0.88-2.01) and 0.179g/l (0.16-0.4) respectively. Parents declined lumbarpuncture. She improved clinically over the first threedays. She became more conscious on the second day,afebrile after about 36 hours and was moving aboutfreely in her room. On the fourth day she developed asecondary rise of temperature which was associatedwith arthritis of the right shoulder and left knee.Tender subcutaneous nodular lesions consistent withvasculitis were seen on both thighs. ESR rose to 80Address correspondence to:Dr.Hanan Y. Al-Qattan, MPPCH, Kuwaiti Board (Ped), Department of Pediatrics, Farwaniya Hospital, Kuwait. Al-Surra, P.O. Box: 61, Postalcode 45701, Kuwait. Tel: (00965) 5212142, Mobile: 9638863, Fax: (00965) 5212142, E-mail: alkatan_07@hotmail.com

June 2009KUWAIT MEDICAL JOURNAL 141mm/h on the fifth day. CRP dropped to 60 mg/l onday three and showed secondary rise to 76.2 mg/l onthe fifth day. Intravenous dexamethasone in a doseof 0.4 mg/kg/day for three days and 0.2 mg/kg/day for the next four days as well as oral ibuprofen(40 mg/kg/day) were added to her treatment. Sheshowed remarkable improvement 24 hours later. Shewas discharged after completing 10 days of antibiotictreatment and remained well on follow up after 9 and12 months. Her C3 and C4 levels on follow up afternine months were less than 0.0583 g/l (0.88-2.01) and0.162 g/l (0.16-0.4) respectively. All her contacts exceptthe youngest sister (case 2) received oral antibioticprop hylaxis (rifampicin) and the quadrivalentmeningococcal vaccine.Case twoThis eight month-old girl, the youngest sisterof case one received neither prophylactic antibioticnor meningococcal vaccine. This infant developedfever, vomiting and skin rash four days followingthe onset of her sister’s illness. It was proven to bemeningococcemia with positive blood culture ofN.meningitidis serogroup W135. Complete bloodcount showed white cells of 7.5 x 10 9 /l, neutrophils60%, platelets 230 x 10 9 /l and ESR 25 mm/h. HerC3 and C4 were 0.3 (0.88-2) and 0.152 (0.16-0.4)respectively. She was treated with ceftriaxoneintravenously at a dose of 100 mg/kg/day for 10days. The infant showed initial improvement buton the fifth day she developed arthritis of the rightankle associated with secondary rise of temperatureand raised ESR of 70 mm/h. This was managed byibuprofen with a clinical diagnosis of an immuneassociatedarthritis.She was discharged home after 10 days andremained well on follow up after 9 and 12 months.Her C3 and C4 were 0.06 g/l and 0.166 g/l after ninemonths.DISCUSSIONA recent large study of meningococcal diseasein children showed that 15.3% of the patients hadIAC [2] . However, it is surprising that only 16 caseswere reported in the period between 1960 and 2003.The authors concluded that the incidence of IAC hasnot declined over the past 20 years [2] .IAC can present as arthritis, vasculitis, episcleritis,pericarditis or rarely nephritis. Risk factors for thedevelopment of IAC are severe disease, age of thepatient (being more common in adolescents oradults) [2] , serogroup W135 [6] and group C [7] .The two patients in our report had more than oneof these risk factors. Both of them had severe disease(meningococcemia), the organism was serogroupW135 and the older patient is a pre-adolescent.IAC usually develops 4-10 days after the onsetof meningococcal infection and presents with localmanifestations and a secondary rise in temperatureassociated with secondary increase in ESR andCRP [2] . This was well documented in our twopatients.Differential diagnosis should include secondaryinfection, subdural effusion, persistent infection,primary meningococcal arthritis and allergicreaction to medications.Careful and thorough physical examination willgive clues that aid in the diagnosis of the diseasewithout the necessity of extensive additionalinvestigations [2] .Case one developed arthritis of the rightshoulder and the left knee as well as vasculitisinvolving both thighs on day four with secondaryrise of temperature. There was no evidence ofsubdural effusion such as convulsions, headache orvomiting. There were no itchy skin rashes, no edemaor puffiness of eyelids. A second blood culture andsensitivity on the fifth day showed no growth.Case two developed meningococcemia most probablybecause she did not receive chemoprophylaxis. In factboth patients appeared to be more prone to developmeningococemia in view of their hypocomplementemicstate.Meningococcal vaccine was not given to casetwo considering that it is not immunogenic belowthe age of two years.Treatment of IAC depends on the site involved.Specific treatment for arthritis is generally notindicated except for pain relief and the prognosisis excellent. Pericarditis has a significant mortalityrate related to cardiac tamponade. The effusion oftenrequires treatment but occasionally it may resolvespontaneously. Therapy consists of salyicylates,steroids, pericardiocentesis, or a combination ofthese [2] . Cutaneous digital vasculitis associated withischemia can be treated with prostacycline analogueto obviate the need for amputation [8] .Both our cases were treated with nonsteroidalanti-inflammatory drugs (ibuprofen) for arthritis.However, dexamethasone was added to case one, asshe had cutaneous vasculitis in addition to arthritis.Both of them improved without complications whenreviewed at nine months and one year follow-up.CONCLUSIONDespite the lack of recent publications,IAC remains a well-defined complication ofmeningococcal infection. Arthritis is the mostcommon manifestation of IAC. In addition tolocal clinical manifestations, IAC presents withsecondary fever and secondary increased ESR andCRP. Thorough physical examination with minimal

142Immune Associated Complication in Meningococcal Disease: A Report of Two CasesJune 2009additional investigations will give clues to thediagnosis.ACKNOWLEDGMENTWe would like to thank Dr. Essam Abdul Rahim,Consultant Pediatrician at Farwaniya hospital, forthe helpful discussion and critical review of themanuscript.REFERENCES1. Rosenstein NE, Perkins BA, Stephens DS, Popovic T,Hughes JM. Meningococcal disease. N Engl J Med 2001;344:1378-1388.2. Goedvolk CA, von Rosenstiel IA, Bos AP. Immunecomplex associated complications in the subacute phaseof meningococcal disease: incidence and literaturereview. Arch Dis Child 2003; 88: 927-930.3. Rosenstein NE, Perkins BA. Update on Haemophilusinfuenza serotype b and meningococcal vaccines.Pediatr Clin North Am 2000; 47:337-352.4. Kirsch EA, Barton RP, Kitchen L, Giroir BP.Pathophysiology, treatment and outcome ofmeningococcemia: a review and recent experience.Pediatr Infect Dis J 1996; 15:967-978.5. Edwards MS, Baker CJ. Complications and sequelaeof meningococcal infections in children. J Pediatr 1981;99:540-545.6. Faye A, Mariani-Kurkdjian P, Taha MK, et al. Clinicalfeature and outcome of pediatric Neisseria meningitidisserogroup W135 infection: a report of 5 cases. Clin InfectDis 2004; 38:1635-1637.7. Finkelstein Y, Adler Y, Nussinovitch M, Varsano I, AmirJ. A new classification for pericarditis associated withmeningococcal infection. Eur J Pediatr 1997; 156:585-588.8. Siddiqui K, Razak AR, Kneafsey B , Delanty N. Use ofprostacyclin (iloprost) in digital vasculitis secondaryto meningococcaemia. J Neurol Neurosurg Psychiatry2004; 75:506.

June 2009KUWAIT MEDICAL JOURNAL 143Case ReportPneumatosis Intestinalis of Small Bowelin an Adult: A Case ReportRajan Arora 1 , Amany Abd El-Hameed 1 , Obaid Al Harbi 21Department of Pathology and 2 Department of Surgery, Al Farwaniya Hospital, KuwaitABSTRACTKuwait Medical Journal 2009; 41 (2): 143-145Pneumatosis Intestinalis (PI) is rare in adults although itcan be seen in the pediatric population as a complicationof necrotizing enterocolitis. We report a case of PI affectingthe small bowel in a 27-year-old patient who presentedwith signs and symptoms of acute abdomen due toperforated duodenal ulcer. Histopathologic findings aredemonstrated and the pathogenesis is discussed with theobjective of highlighting that PI is not a diagnosis but afinding which needs further evaluation and managementin view of the underlying etiology.KEY WORDS: gastrointestinal, necrotizing enterocolitis, small bowelINTRODUCTIONPneumatosis intestinalis (PI) defined as gaswithin the wall of gastrointestinal (GI) tract, isnot a diagnosis but a physical or radiologicalfinding. It is secondary to an underlying diseaseprocess in 85% of cases which include obstructivepulmonary disease [1] , cystic fibrosis [2] , obstructiveGI disease (e.g., volvulus [3] and intussusception [4] ),gastroduodenal ulcer, ulcerative colitis, necrotizingenterocolitis [5,6] , acquired immunodeficiencysyndrome, and trauma [7] . Secondary form typicallyinvolves the small bowel but may occur throughoutthe GI tract. Since the etiology is so varied, the courseand outcome varies from benign self resolving tofatal depending on the underlying disease process.The primary form which accounts for 15%of cases is a benign idiopathic condition usuallyaffecting the colon [8] . Histopathologic findingsin both are usually the same but pathogenesisis complex depending on interaction of manyfactors like mucosal integrity [5] , intraluminalpressure [7] , bacterial flora [9] , and intraluminalgas [10] . Management depends on treating theunderlying cause and surgery is indicated whenacute complications appear such as perforationand peritonitis.CASE REPORTClinical findingsA 27-year-old male was admitted to surgicalcasualty with signs and symptoms of acuteabdomen. Radiological investigations revealed gasunder the diaphragm (indicative of perforation)as well as air in relation to bowel wall on plainradiograph. Computerized tomographic scan couldnot be done due to the nature of the emergency, andlaparotomy was performed.Operative findingsA perforated duodenal ulcer was found whichwas closed by patch omentoplasty. The terminal180 cm of the small bowel all the way to theileocecal junction showed multiple thin walled,tense, air filled cysts on the serosal surface (fewwere perforated and collapsed). The cecum andcolon were not involved. The small bowel proximalto the involved portion was distended. A limitedright colectomy and resection of the involvedsmall bowel was done. After resection, the patientwas managed in the intensive care unit and wasdischarged from the hospital after 10 days. He is onfollow up and is in good health till date.Pathological findingsGross features: The specimen (comprising ofterminal ileum, cecum with appendix, and partof ascending colon) was received in 10% neutralbuffered formalin. It was floating in the containerdue to buoyancy of the air. Outer surface of wholelength of small bowel (180 cm) showed congestionand multiple cysts in grape like manner (Fig. 1).On cut section, the mucosa showed cobblestoneAddress correspondence to:Dr. Rajan Arora, Senior Registrar, Department of Pathology, Farwaniya Hospital, PO Box : 18373, Farwaniya 81004, Kuwait. (F) 00965-4893078, E-mail: arorarajan73@rediffmail.com, drrajarora@yahoo.com

144Pneumatosis Intestinalis of Small Bowel in an Adult: A Case ReportJune 2009Fig. 1: Outer surface of small bowel showing multiple air filledcysts (pneumocysts) in grape like mannerFig. 2: Mucosal surface showing “cobblestone” appearanceFig. 3: Pneumocysts in the bowel wallappearance (Fig. 2) with numerous air filled cysts(pneumocysts) in the wall (Fig. 3). The cysts variedin size from 0.2 to 2 cm in diameter. No mass,polyp, diverticula, volvulus, or intussuception wasidentified.Microscopic features: The cysts identifiedgrosslyin small bowel were located in the submucosal(Fig. 4), and subserosal region. They were linedby mostly multinucleated giant cells. No truelining epithelium was seen. There were no featuresof any granulomatous inflammation, necrosis,inflammatory bowel disease, or malignancy.Moderate to severe serositis was observed. Specialstains (Periodic acid-Schiff, Grocott’s methaminesilver, and Gram’s stain) for micro-organisms werenegative.DISCUSSIONPI is rare and preliminary diagnosis depends onclinical and radiological findings. Computerizedtomographic scan is the best imaging modalityFig. 4: Photomicrograph showing submucosal air-filled cysts(H&E, x 40)although plain radiograph also shows characteristicfindings. The pathogenesis has been debated foryears and various explanations have been suggestedby various authors [5,7,9,10] . However the spectrum ofdiseases which underlie the development of thesecysts point toward a multifaceted phenomenon.Two most crucial considerations are: (a) from wherethe gas came, and (b) how it got into the bowel wall.Three possible sources of bowel gas are intraluminalgas, bacterial production of gas, and pulmonary gas.Intraluminal gas can leak to the bowel wall due toincreased intraluminal pressure and mucosal injury,either of them occurring singly [5,6] , or together invarious conditions, e.g., GI obstruction, and ulcerativecolitis [3-5,10] . Bacterial production of gas has beensuggested as an inciting factor for PI and is supportedby the fact that gas disappears after antimicrobialdrug treatment [9] . The original theory of pulmonarygas leaking as a result of alveolar rupture leadingto dissection along vascular planes to mediastinumand then tracing caudally to retroperitoneum

June 2009KUWAIT MEDICAL JOURNAL 145appears logical [1] , but lack of interstitial emphysemawithin lungs or mesentry in many of these patientsseems to contradict the original explanation [2,9,10] ,and association of pulmonary disease with PI maybe simply due to fluctuations in intra-abdominalpressure by pulmonary obstruction [5] .Duodenal perforation leading to extravasationof its content including air causing peritonitis anddissection of air along mesenteric vessels appearsto be the most logical explanation underlyingformation of pneumocysts in our case, sinceserositis and subserosal cysts were predominantfindings.CONCLUSIONThis case demonstrates the classicalhistopathological findings of PI and stresses onthe fact that PI is not a disease but a finding whichneeds further evaluation to discover the etiology.Treatment of the underlying disease process shouldbe the focus of treatment. Surgery is indicated inpatients with signs and symptoms of perforation,peritonitis (like the present case), or abdominalsepsis. When PI is associated with conditions inwhich surgical treatment has no role or no otherdefinitive treatment exists, use of inspired oxygenmay be beneficial.ACKNOWLEDGEMENTWe are deeply thankful to Dr Tareq Al-Ajrawi forhis constant support and advice in the preparationof this manuscript.REFERENCES1. Keyting WS, McCarver RR, Kovarik JL, Daywitt AL.Pneumatosis intestinalis: a new concept. Radiology1961; 76:733-741.2. Wood RE, Herman CJ, Johnson KW, di Sant’ AgnesePA. Pneumatosis coli in cystic fibrosis: clinical,radiological, and pathological features. Am J DisChild 1975; 129:246-248.3. Azimuddin K, Bourne R. Pneumatosis cystoidesintestinalis in a case of sigmoid volvulus. Br J HospMed 1997; 57:468-469.4. Fahal AH, Baraka OZ, el-Lider AM. Pneumatosiscystoid intestinalis: a case report. East Afr Med J1994; 71:401-402.5. Gagliardi G, Thompson IW, Hershman MJ, Forbes A,Hawley PR, Talbot IC. Pneumatosis coli: a proposedpathogenesis based on study of 25 cases and reviewof literature. Int J Colorectal Dis 1996; 11:111-118.6. Berdon WE, Grossman H, Baker DH, Mizrahi A,Barlow O, Blanc WA. Necrotizing enterocolitis in thepremature infant. Radiology 1964; 83:879-887.7. Shuck JM, Malan LJ, Hammar MD. Pneumatosiscystoides intestinalis due to blunt abdominal trauma.J Trauma 1974; 14:435-440.8. Smith BH, Welter LH. Pneumatosis intestinalis. AmJ Clin Pathol 1967; 48:455-465.9. Yale CE, Balish E, Wu JP. The bacterial etiology ofpneumatosis cystoides intestinalis. Arch Surg 1974;109:89-94.10. Koss LG. Abdominal gas cysts ( pneumatosiscystoides intestinorum hominis); an analysis with areport of a case and a critical review of the literature.AMA Arch Pathol 1952; 53:523- 549.

146KUWAIT MEDICAL JOURNAL June 2009Case ReportIdiopathic Pulmonary HemosiderosisAbdullah Almutairi 1 , Nasser Behbehani 1 , Tareq MMA Mohammed 21Department of Medicine, Mubarak Alkabeer Hospital, Kuwait2Department of Pathology, Mubarak Alkabeer Hospital, KuwaitABSTRACTIdiopathic pulmonary hemosiderosis (IPH) is a raredisorder that is usually characterized by the triad ofbilateral pulmonary infiltrates, hemoptysis and irondeficiency anemia. The disease is well known to affectthe pediatric age group with conflicting treatmentKuwait Medical Journal 2009; 41 (2): 146-148trials. We report a case of a 19 year- old girl withIPH and respiratory failure who had excellent initialresponse to systemic steroids. To the best of ourknowledge this is the first reported case in this agegroup in the region.KEY WORDS: anemia, hemoptysis, immunosuppressive agents, steroidINTRODUCTIONIdiopathic pulmonary hemosiderosis (IPH)is a rare disorder, which affects children in themajority of cases [1] . There are several reportedcases in the adult population. Typically, intensivesearch for aetiology ends up negative. Patientsusually present with cough and hemoptysis,but iron deficiency anemia could be the solepresentation [2,3] . This presentation in an adultmakes the diagnosis more difficult as other causesof alveolar hemorrhage need to be carefullyexcluded. We report the case of a 19 year-oldgirl who presented to Mubarak Hospital withhemoptysis and respiratory failure followed by areview of relevant literature.CASE REPORTMs. F is a 19-year-old girl, who was transferredto Mubarak hospital from another institutionwith respiratory failure. Her illness started fivedays prior to her presentation with fever, coughand shortness of breath. She described episodesof hemoptysis during her illness with few bloodclots occasionally. On further questioning, shedescribed similar attack three years ago, whereshe had been coughing streaks of blood and wasfebrile. This was followed by a protracted course ofmild hemoptysis for almost one year followed byspontaneous resolution. Since then she continued tofeel short of breath on exertion, but attributed it tothe iron deficiency anemia that she suffered from.Her anemia was severe enough to require bloodtransfusion twice. She denied any skin rash, jointpain or swelling, mouth or genital ulcers.On admission to the referring hospital, she wasfebrile, tired and short of breath. Her initial chestX-ray showed bilateral alveolar infiltrates (Fig. 1).She was initially managed as community acquiredpneumonia. Soon after admission, her conditiondeteriorated with marked hypoxemia requiring 70%inspired oxygen. CT chest revealed bilateral diffuseinfiltrates, mixed alveolar opacities and interstitialinfiltrates.She was then transferred to our facility forfurther workup and management. On arrival shewas significantly hypoxic, but hemodynamicallystable. On a FIO 2of 0.7 her O 2saturation was only91%. She was admitted to the intensive care unit andstarted on broad spectrum antibiotics (maxipimeand intravenous erythromycin). Bronchoscopywas performed and transbronchial biopsies weretaken. Her bronchoalveolar lavage done prior to thebiopsy was consistently bloody. Full immunologicalinvestigations were sent to exclude any pulmonaryvasculitis including: ANA, C and P ANCA, Anti-GBM, complements and rheumatoid factor. Thesewere all negative except for a non-specific weakpositive C ANCA and ANA. The transbronchialbiopsy showed extensive hemosiderin in the tissueas well as hemosiderin laden macrophages (Fig. 2).There was also marked interstitial fibrosis with noevidence of vasculitis or capillaritis.Address correspondence to:Dr Abdullah Almutairi, Department of Medicine, Mubarak Alkabeer Hospital, Al-Jabriyah, Kuwait. E-mail: doctorq8@gmail.com

June 2009KUWAIT MEDICAL JOURNAL 147Fig. 1: CXR on presentation showing diffuse bilateral airspaceinfiltratesFig. 2: The transbronchial biopsy showing extensive hemosiderinin the tissue as well as hemosiderin laden macrophagesDuring her admission she had a 2D echo whichwas normal. On reviewing her old chest X-Raydone in 2003 (Fig. 3), it did show a large air spacelesion on the right lower lung zone (which inretrospect could represent alveolar hemorrhage).She was started on systemic steroid at a dose ofprednisolone 40 mg daily with complete resolutionfrom a radiological as well as clinical aspect. Hermaintenance treatment consisted of steroids withchloroquine.When her steroids were tapered down to 10 mgover four months, she started to experience multipleepisodes of minor hemoptysis, none of which wasclinically significant. Currently, azathioprine hasbeen added as steroid sparing agent.Fig. 3: CXR three years ago showing bilateral airspace infiltratesDISCUSSIONIPH is a rare disease with an estimated incidenceof 0.24 -1.23 cases per million in the pediatricspopulation [4] . It is usually diagnosed aftercombining clinical and radiological parameterswith exclusion of more common disorders thatleads to pulmonary hemorrhage. Clinically IPHmanifest with a triad of pulmonary infiltrates, irondeficiency anemia, and hemoptysis. An absoluterequirement for the diagnosis is identificationof hemosiderin laden macrophages in sputum,bronchoalveolar lavage, lung biopsy specimensand gastric washings [5] . Multiple blood transfusionfor severe anemia in IPH patients has beenreported in the literatures [6] . Our patient waslabeled as iron deficiency anemia and requiredblood transfusion twice. The exact etiology of IPHis unknown, although most therapeutic attemptsused immunosuppressive agents for treatment [7] .Treatment is based on case series, but in theinitial phase of presentation, steroids in high dose(e.g., prednisone 2 - 5 mg/kg/d or equivalent) areconsidered the treatment of choice [4,8] . This hasproven to control the acute bleeding episode anddecrease the frequency of pulmonary hemorrhage.However, the long term benefit is still controversial.A retrospective review of 23 children diagnosedwith IPH in whom steroids in low-dose havebeen tried after initial high-dose on presentation,showed prevention of crises and milder diseasecourse [6] . However, there are some patients who failto respond to steroids alone and in whom anotherform of immunosuppression has been tried.Such therapies include azathioprine,chloroquine, or cyclophosphamide. There areseveral case reports and retrospective studies thatshowed beneficial effect of azathioprine in long

148Idiopathic Pulmonary HemosiderosisJune 2009term control of symptoms and as a steroid sparingagent [5,9,10] . However, mortality benefits are difficultto prove in such types of publications. The usualstarting dose varies from 1 to 2 mg/kg daily or onalternative days. Chloroquine has long been thefavored immunosuppressive therapy of choice dueto acceptable side effects profile. There are severalcase reports of the effectiveness of chloroquine,where it has been used for long term control ofpulmonary hemorrhage [11,12] . The reported dosageranged from 200 to 400 mg daily, but retinalchanges were detected in one patient on 400 mg ofchloroquine, which resolved after discontinuationof the drug. Cyclophosphamide, on the other hand,is the least used immunosuppressive therapyreported [7] . The range of dosage in these reportswas from 1.5 to 2.5 mg/kg/d.Given all these data, the main concern inchoosing between the different regimens ofimmunosuppression would be the side effectprofile of the drug and patient tolerance. The fiveyears survival of IPH has been recently reported tobe 86%, in contrast to previous reports of 2.5 yearsaverage survival [10] . There are different reportsof favorable survival factors but with conflictingresults.Lastly, the presence of c-ANCA in low titre inthe serum of our patient, although not associatedwith systemic or pathological manifestation ofvasculitis, has been reported in the literature [13] .It has been linked to classifying IPH according toseverity, and was thought to represent a prognosticvalue. This, though has not been consistent throughthe literature.REFERENCES1. Pinto M, Correia J, Leal I, et al. Idiopathic pulmonaryhemosiderosis. Acta Med Port 1996; 9:41-44.2. Chen KC, Hsiao CC, Huang SC, Ko SF, Niu CK. Anemiaas the sole presenting symptom of idiopathic pulmonaryhemosiderosis: report of two cases. Chang Gung Med J2004; 27:824-829.3. Derbent M, Ozcay F, Saatci U, Ozbek N. Severe irondeficiency anemia in a child with idiopathic pulmonaryhemosiderosis: a case report. Turk J Pediatr 2002; 44:258-260.4. Kjellman B, Elinder G, Garwicz S, Svan H. Idiopathicpulmonary haemosiderosis in Swedish children. ActaPaediatr Scand 1984; 73: 584-588.5. Kabra SK, Bhargava S, Lodha R, Satyavani A, Walia M.Idiopathic pulmonary hemosiderosis: clinical profile andfollow up of 26 children. Indian Pediatr 2007; 44:333-338.6. Kiper N, Gocmen A, Ozcelik U, Dilber E, Anadol D.Long-term clinical course of patients with idiopathicpulmonary hemosiderosis (1979-1994): prolongedsurvival with low-dose corticosteroid therapy. PediatrPulmonol 1999; 27:180-184.7. Huang SH, Lee PY, Niu CK. Treatment of pediatricidiopathic pulmonary hemosiderosis with low-dosecyclophosphamide. Ann Pharmacother 2003; 37:1618-1621.8. Chryssanthopoulos C, Cassimos C, Panagiotidou C.Prognostic criteria in idiopathic pulmonary hemosiderosisin children. Eur J Pediatr 1983; 140:123-125.9. Airaghi L, Ciceri L, Giannini S, Ferrero S, Meroni PL,Tedeschi A. Idiopathic pulmonary hemosiderosis in anadult. Favourable response to azathioprine. MonaldiArch Chest Dis 2001; 56:211-213.10. Saeed MM, Woo MS, MacLaughlin EF, Margetis MF,Keens TG. Prognosis in pediatric idiopathic pulmonaryhemosiderosis. Chest 1999; 116:721-725.11. Almeida MP, Reis G, Guedes M. Hydroxychloroquinein pediatric idiopathic pulmonary hemosiderosis: a casereport. Rev Port Pneumol 2006; 12:79-84.12. Zaki M, al Saleh Q, al Mutari G. Effectiveness ofchloroquine therapy in idiopathic pulmonaryhemosiderosis. Pediatr Pulmonol 1995; 20:125-126.13. Blanco A, Solis P, Gomez S, Valbuena C, Telleria JJ.Antineutrophil cytoplasmic antibodies (ANCA) inidiopathic pulmonary hemosiderosis. Pediatr AllergyImmunol 1994; 5:235-239.

June 2009KUWAIT MEDICAL JOURNAL 149Case ReportScrub Typhus Associated with Systemic LupusErythematosus: A Case ReportMohsen Nasr 1 , Mohamed Mostafa Abdelwahab Mostafa 1 , Soondal Koomar Surrun 21Department of Internal Medicine, Al-Jahra Hospital, Kuwait2Department of Internal Medicine, Singapore General Hospital, SingaporeABSTRACTKuwait Medical Journal 2009; 41 (2): 149-151The etiology of systemic lupus erythematosus (SLE) islargely unknown and there is a probable contribution ofgenetic, hormonal, immunological and environmentalfactors for its manifestation. The widespreadimmunological destruction of many organs in SLE andthe associated decreased immunity increase the riskof infections. Steroids and other immunosuppressantare important in the treatment of SLE, but they furtherincrease the risk of infections, and sometimes with rareorganisms. We present a case of an adolescent girl withprolonged fever, joint pains and without skin rashes. Theinitial diagnosis was SLE. She was treated with steroidswith improvement in her general condition and relief ofjoint pains. However the fever persisted and subsequentinvestigations revealed an associated scrub typhus. Thefever subsided after treatment with oral tetracycline.There were no complications of scrub typhus. Sincescrub typhus infection is not common in the ArabianPeninsula the disease was not initially thought of. In theinvestigation of prolonged fever in SLE, viral, bacterial,protozoal as well as rickettsial diseases should be bornein mind.KEY WORDS: pyrexia of unknown origin, scrub typhus, systemic lupus erythematosusINTRODUCTIONSystemic lupus erythematosus (SLE) may presentclinically in many subtle ways. Initial presentationas prolonged fever is common. The course of SLE issometimes punctuated by infections, sometimes withrare organisms [1] . Infections remain a major causeof morbidity and mortality in SLE. When a patientwith SLE becomes infected with scrub typhus, theassociated infection may not be entertained initially,especially in non-endemic regions leading to delayin investigations and diagnosis. The typical escharmay be absent, and other skin lesions of scrubtyphus may be mistaken for other febrile illnessesincluding SLE [2] . Scrub typhus infection is endemicin Asia, the Pacific islands including northernAustralia and New Zealand. It is a zoonosis thatis transmitted by mites and before the advent ofantibiotics the disease was occasionally fatal. Aswith SLE, fever is a common presenting symptomin scrub typhus. Additionally, lymphadenopathy,an eschar or skin rashes may also be present.During the Second World War scrub typhus was adreaded disease causing substantial morbidity andoccasional deaths. Nowadays, it occasionally occursoutside the endemic areas and rarely in the ArabianPeninsula.CASE HISTORYA 17-year-old girl was admitted with easy fatigue,recurrent bouts of fever, painful wrists and elbowsand loss of hair of two months’ duration. The painoccurred simultaneously in the affected joints, wascontinuous and partially relieved by paracetamol.She did not notice any loss of weight or dryness ofthe mouth, and there was no morning stiffness. Shewas previously in good health and had no majormedical or surgical problems.On examination she was pale, without jaundiceor cyanosis. There were no skin rashes or nailchanges. There was no discoid alopecia. Hertemperature was 38.8 o C, pulse 80 beats per minuteand blood pressure 110/80 mm Hg. There wasno generalized lymphadenopathy. Both elbowsand wrists were swollen and red, with impairedextension of the elbows. Movement of the wriststhough painful was full. There was no wasting ofthe interossei, thenar or hypothenar eminences.Examination of the eyes was normal. HeartAddress correspondence to:Dr. Mohsen Nasr, PhD, Department of Internal Medicine, Al-Jahra Hosptial, PO Box 3038, Kuwait 01032. E-mail: mohsennasr@hotmail.com

150 Scrub Typhus Associated with Systemic Lupus Erythematosus: A Case Reportsounds were normal and there were no murmurs.The chest examination was normal. There was nohepatosplenomegaly and neurological examinationwas normal.Hematological tests showed hemoglobin of 8.4gm/dl, white blood cell count of 2.2 x 10 9 /ml anda platelet count of 230 x 10 9 /ml. ESR was 118 mm/hr, CRP negative, coagulation profile normal andCoomb’s test negative. Serum iron was 5 µmol/l,bilirubin was normal with an AST of 151 iu/l, ALT of87 iu/l and ALP of 423 iu/l. Urine microscopy wasnormal, the pH 5 and the 24-hour urine protein was0.19 g/day. Complement tests showed a C3 of 78(normal range 75-135) mg/dl and C4 of 16 (normalrange 12-72) mg/dl. Hepatitis profile, monospottest, brucella antigen test and Widal test werenegative. Chest radiograph, the abdomen and pelvicultrasound were normal. The rheumatoid factor(RF) IgM titer was 26 µmol/ml (n < 20), RF IgG 14µmol/ml (n < 20), RF IgA 10 µmol/ml (n < 15), ANA1/320 (speckled pattern), and anti-dsDNA antibody76 IU/L. A clinical diagnosis of SLE was made andprednisolone was started at a dose of 40 mg per day.The patient felt well, the pain in the joints improvedbut the fever persisted. White blood cell count roseto 14.4 x 10 9 /ml, liver enzymes remained high andthe CRP became positive on repeated examination.An associated infective process was then consideredand a diagnosis of pyrexia of unknown origin wasentertained.Repeated chest radiographs and blood cultureswere normal. Further blood investigations werenegative for HIV, toxoplasma, parvovirus andfungus. Gallium scan was negative. However,Weil-Felix reaction was positive for OX-K proteusantigen with a titer of 1/320, rising to 1/640 afterthree days.A definitive diagnosis of scrub typhuscomplicating SLE was made. The patient wasprescribed 500 mg of oral tetracycline every sixhours by the medical on-call team. The fever abatedwithin two days and the patient felt much better.On clinical grounds the treating team preferred notto change tetracycline to doxycycline. The generalcondition of the patient continued to improve andthe white blood cell and liver function tests becamenormal. She was discharged on oral prednisolone40 mg daily and tetracycline 500 mg qds for atotal of two weeks. On review the patient wasasymptomatic and well.DISCUSSIONSLE presenting as prolonged fever is a wellknownclinical entity. When classical clinicalsymptoms and signs are present and the appropriatelaboratory investigations are positive the diagnosisis usually straightforward. However borderlineJune 2009cases may take some time as the laboratoryinvestigations, ANA and anti-dsDNA antibody maynot be positive at the beginning of the disease [3,4] .When the diagnosis of SLE is definitive and thedisease is treated with adequate dose of steroidsand other immunosuppressant the fever settlesquickly and skin rashes gradually fade or disappearaltogether.If fever does not settle quickly or if prolongedfever occurs, the diagnosis of an associated infectionshould be entertained. In our patient, when thediagnosis of SLE was made and oral steroidsprescribed, joint pains were relieved but feverpersisted. As the ESR remained elevated, the CRPbecame positive and the liver enzymes remainedhigh, we investigated for a possible infectivecause. Serological tests revealed an associatedinfection with scrub typhus. Isolation of Orientiatsutsugamushi (O. tsutsugamushi) was not attempted.With the appropriate dose of tetracycline the patientpromptly responded and the fever abated.Many major infections complicate the course ofSLE, and scrub typhus is rarely incriminated. Scrubtyphus is a mite-borne infectious disease caused byO. tsutsugamushi. The organism is a gram-negativecoccobacillus that is antigenically distinct fromthe typhus group rickettsiae, which is distributedthroughout the Asia Pacific rim. Scrub typhus isendemic in South East Asia, Australia but found onrare occasions in the Arabian Peninsula.Patients with scrub typhus develop high fever,generalized headache, diffuse myalgia with thepresence of a skin rash or a typical necrotic lesioncalled an eschar. Sometimes there is also generalizedlymphadenopathy and splenomegaly [5] . Laboratoryfindings include leucopenia or leucocytosis,elevation of hepatic enzymes and bilirubin [5] .The pathological hallmark of scrub typhus is alymphohistiocytic vasculitis seen on biopsy of theeschar or skin rashes [6] . It is difficult to culture O.tsutsugamushi and this is done only in specializedlaboratories. Scrub typhus lasts for 14 to 21 dayswithout treatment. Severe infections may becomplicated by interstitial pneumonia, pulmonaryedema, congestive heart failure, circulatory collapse,and a wide array of signs and symptoms of centralnervous system dysfunction, including delirium,confusion, and seizures. These complications maylead to death, usually late in the second week ofthe illness. Fortunately none of these complicationswere noted in our patient who responded quicklyto tetracycline.As scrub typhus is not endemic in the ArabianPeninsula and the patient did not travel abroad,the diagnosis of scrub typhus was not consideredinitially. Furthermore, she did not rememberbeing bitten by a mite and there were no skin

June 2009KUWAIT MEDICAL JOURNAL 151lesions. It is known however, that patients withscrub typhus may not show the typical eschar orskin rashes. In our patient, even if there were skinlesions, they could have been attributed to the skinmanifestations of SLE, but the presence of an escharwould have pointed to an earlier diagnosis. Theraised liver enzymes associated with scrub typhuswere also present in this patient [7] . Though thedrug of choice in the treatment of scrub typhus isdoxycycline 100 mg orally or intravenously twicedaily, tetracycline 500 mg four times daily has alsobeen used with success, and chloramphenicol is stillcommonly used in some endemic areas. Tetracyclinewas initially prescribed for the patient. Changingtetracycline to doxycycline was considered buteventually not done as she had improved markedlywithin 48 hours. The drug was prescribed for twoweeks to reduce the risk of relapse. No vaccine ispresently available and chemoprophylaxis witha weekly dose of 200 mg of doxycycline is highlyeffective when used by non-immune individualsvisiting or working in endemic areas.This case report highlights the fact that scrubtyphus may rarely occur in non-endemic areasand that prolonged fever in SLE should be fullyinvestigated for associated viral, bacterial, protozoal,fungal and rickettsial diseases.CONCLUSIONSLE sometimes presents as unexplainedprolonged fever. But, if fever persists inspite of adequate dose of steroids and otherimmunosuppressants in a patient with SLE, thepossibility of an associated infection should beseriously considered and detailed investigationsperformed. Scrub typhus may rarely complicatethe course of SLE. In our patient, the diagnosisof the associated scrub typhus infection wasslightly delayed but the infection was quicklycontrolled with tetracycline and there were nocomplications.REFERENCES1. Lee PP, Lee TL, Ho MH, Wong WH, Lau YL. Recurrentmajor infections in juvenile-onset systemic lupuserythematosus - a close link with long-term diseasedamage. Rheumatology (Oxford) 2007; 46:1290-1296.2. Ogawa M, Hagiwara T, Kishimoto T, et al. Scrubtyphus in Japan: epidemiology and clinical featuresof cases reported in 1998. Am J Trop Med Hyg 2002;67:162-165.3. Swaak AJ, van de Brink H, Smeenk RJ, et al. Incompletelupus erythematosus: results of a multicentre studyunder the supervision of the EULAR StandingCommittee on International Clinical Studies IncludingTherapeutic Trials (ESCISIT). Rheumatology (Oxford)2001; 40:89-94.4. Isenberg DA, Manson JJ, Ehrenstein MR, RahmanA. Fifty years of anti-ds DNA antibodies: are weapproaching journey’s end? Rheumatology (Oxford)2007; 46:1052-1056.5. Sirisanthana V, Puthanakit T, Sirisanthana T.Epidemiologic, clinical and laboratory features ofscrub typhus in thirty Thai children. Pediatr InfectDis J 2003; 22:341-345.6. Liu YX, Cao WC, Gao Y, et al. Orientia tsutsugamushiin eschars from scrub typhus patients. Emerg InfectDis 2006; 12:1109-1112.7. Hu ML, Liu JW, Wu KL, et al. Short report: Abnormalliver function in scrub typhus. Am J Trop Med Hyg2005; 73:667-668.

152KUWAIT MEDICAL JOURNAL June 2009Case ReportA Case of Severe Primary Hyperthyroidism, SecondaryHyperparathyroidism, Adrenal Insufficiency andOsteoporosis with Multiple FracturesRamen C Basak, Manas Chatterjee, Mahmoud W RassemDepartment of Internal Medicine, King Khaled General Hospital, Hafr Al Batin, Kingdom of Saudi ArabiaABSTRACTOsteoporosis is generally known to be one of the most seriousadverse effects of long-term corticosteroid administration.Recently it was discovered that corticosteroid-inducedosteoporosis occurs not only in trabecular bone but alsoin cortical bone, leading to the reduction in the strength ofbones and subsequent fracture. We report a case of severeKuwait Medical Journal 2009; 41 (2): 152-155hyperthyroidism, secondary hyperparathyroidism, adrenalinsufficiency and osteoporosis with multiple fractures (mostlikely collectively due to chronic steroid intake because ofsteroid dependant bronchial asthma, hyperparathyroidismand hyperthyroidism) which was treated appropriately andmade an uneventful recovery.KEY WORDS: corticosteroid therapy, hyperparathyroidism, hyperthyroidism, osteoporosisINTRODUCTIONBone loss and relevant pathological fracturesare major serious adverse effects of long-termcorticosteroid therapy [1] . It has been well documentedthat trabecular bone injury predominates,especially in this entity [1] and few studies havefocused on the cortical bone too [2] . Alendronate,one of the bisphosphonates, has been reported tobe effective in prevention and treatment of steroidinducedosteoporosis [3] . The active vitamin Dmetabolites (alfacalcidol, 1-hydroxyvitamin D3,calcitriol, 1, 25 dihydroxy vitamin D3) have alsobeen reported to be beneficial but these are inferiorto bisphosphonates [4] . Furthermore, the combineduse of both drugs was shown to be more effectivethan either alone [5] . Parathormone (PTH) analogue(teriparatide) is superior to bisphosphonatesnot only in terms of increasing bone density andreducing fracture risk in vertebrae but also effectiveat non-vertebral sites [6] . Recently it is approved byFDA though long term safety is yet to be established.Osteoporosis induced fractures frequently involvethe spine, hip and wrist. The best screening test isdual energy X-ray absorptiometry (DEXA) which isquick, simple and yields accurate result. It measuresthe density of bones in these areas and accuratelyfollows the changes over time.CASE HISTORYThis 26-year-old female, married, havingregular menstruation, was a known asthmatic onprednisolone 10 mg daily for about 10 years. Shewas admitted in the medical department of KingKhaled General Hospital, KSA with suspecteddeep vein thrombosis (DVT). In the course of herinvestigation DVT was ruled out but she was foundto have severe hyperthyroidism though clinicallymildly symptomatic. She had severe osteopenia withmultiple pathological fractures with sign of healingover the shaft of both fibulae and femur bilaterally,detected on plain X-ray (Fig. 1 and Fig. 2).Examination revealed a conscious and orientedpatient. Pulse and BP were 120/min and 90/60 mmHgrespectively. She had mild diffuse goiter withoutbruit, fine tremor and no ophthalmopathy or pre-tibialmyxedema. The proximal muscles were weak withtenderness in thigh muscles on both sides. She couldbarely stand with support and hence postural drop ofblood pressure could not be assessed. Other systemicexamination revealed no significant abnormalities.Laboratory evaluation depicted that she had primaryhyperthyroidism as her FT 3was 30.19 pmol/l (N= 2.8 – 7.1 pmol/l), FT 457.70 pmol/L (N = 12 – 22pmol/l), and TSH 0.006 µU/ml (N = 0.27 - 4.2 µU/ml). Secondary hyperparathyroidism was diagnosedAddress correspondence to:Dr Ramen Chandra Basak, MD, Endocrinologist, King Khaled General Hospital, PO Box. 591, Hafr-Al-Batin, KSA. Tel: 037228179, Mobile:0551106087, E-mail: basakrc@yahoo.com

June 2009KUWAIT MEDICAL JOURNAL 153Fig. 1: X-ray showing fracture of the both femurs with signs ofhealingas her Ca was 7.4 mg% (N = 8 - 10.5 mg%) and PTH152 pg/ml (upper limit 62 pg/ml) with PO 42.3 mg%(N = 2.5 - 5 mg%), alkaline phosphatase 378 U/l (N =40 - 230 U/l) and normal albumin. Secondary adrenalinsufficiency was diagnosed as her cortisol was low,165.17 nmol/l (N ≥ 550 nmol/l) one hour after ACTHstimulation with normal electrolytes. Level of 25-hydroxy vitamin D and 1, 25-dihydroxy vitamin Dwere also normal. She had severe osteoporosis asrevealed by DEXA (T score = -3). Other investigationsshowed normal CBC, mild microcytic hypochromicanemia with normal ESR, renal and hepatic functions.Doppler sonography of the left leg was normal. Theultrasonography of thyroid showed right lobe 6 x 1.4x 3 mm and left lobe 6.9 x 1.7 x 2.2 mm with no focallesion. The plain X-ray of bilateral fibulae and femurrevealed multiple healing fractures. ECG showedsinus tachycardia.The patient was managed conservativelyby the orthopedic team. She was started onalendronate 70 mg weekly, alfacalcidol 1 µg dailyand calcium carbonate (CaCo 3) 600 mg thrice aday. Her fractures healed completely within fourmonths. Initially, her heart rate was controlled bypropranolol without compromising her asthmaticstate under the coverage of steroid which wasdiscontinued eventually. She was also subjectedto propylthiouracil therapy for hyperthyroidism.The follow up after six months revealed her to bein euthyroid state clinically and biochemically withcontrolled asthma.Fig. 2: X-ray showing fracture of the right fibula with signs ofhealingDISCUSSIONOsteoporosis represents a major and emergingpublic health problem with the aging population.Major clinical consequences and economic burdenof the disease pertain to the ensuing fractures.Many risk factors are associated with these fracturesincluding low bone mass, hormonal disorders namelyhyperparathyroidism and hyperthyroidism, thin built,use of certain drugs (e.g., glucocorticoids), cigarettesmoking, excessive intake of alchohol, low physicalactivity, vitamin D insufficiency and low intake ofcalcium [7] . Osteoporosis and thyroid dysfunction areboth common in older women. Eight to 13% of womenolder than 50 years of age have biochemical evidenceof thyroid dysfunction [8] and 30% are osteoporoticaccording to the bone density criteria [9] . The osteoporoticfractures have long been associated with floridhyperthyroidism [10] although the relationship betweenbiochemical evidence of excess thyroid hormone andfracture risk is not known [11] . The risk for hip fractureis more than threefold and that of nonspine fractureis twofold higher among women with low TSH levelsthan those with normal TSH levels [12] . Biochemicalmarkers of bone turnover are elevated in women withlow TSH levels supporting the view that low TSHlevels reflect excessive thyroid hormone, which inturn increases skeletal remodeling [12] . All patients withhyperparathyroid disease will eventually developosteoporosis regardless of their age or sex. Womentend to develop osteoporosis from parathyroid diseasefaster than men [13] . Osteoporosis is a well-recognized

154A Case of Severe Primary Hyperthyroidism, Secondary Hyperparathyroidism, Adrenal ...June 2009adverse effect of corticosteroid therapy. The bone lossis most marked during the first six to 12 months oftreatment. Corticosteroids affect both bone formationand bone resorption. A decrease in bone formationhas been attributed to a decrease in osteoblast activity,number and life span (apoptosis). Corticosteroids altergonadal sex steroid production through straight actionand inhibition of gonadotrophin secretion and suppressadrenal androgen production, resulting in decreasedbone formation [14] . They also increase the rate of boneresorption by stimulating the formation and actionof osteoclasts [15] . The increase in bone resorption alsomay be explained, in part, by increased parathyroidhormone (PTH) mediated activation of osteoblastshaving PTH receptors which osteoclasts are lacking.PTH-mediated stimulation of osteoclasts is believed tobe indirect, acting in part through cytokines releasedfrom osteoblasts to activate them [16] . The secondaryhyperparathyroidism results from reduced intestinal aswell as renal tubular calcium absorption by steroid [17] .Patient receiving glucocorticoids chronically mayhave depressed circulating level of 1, 25 dihydroxyvitamin D; the mechanism being unknown [18] .However, other studies show no consistentabnormalities in vitamin D, PTH, or calcitoninlevels in glucocorticoid-treated patients [19] . Commonosteoporotic fracture sites include the vertebrae, thehip, the distal radius of the forearm with an incidenceof 32, 16 and 15 percent respectively [20] . Osteoporoticbones are ten times more susceptible to fracture thannormal [13] which often does not become clinicallyapparent until a fracture occurs. The best screeningtest is dual energy X-ray absorptiometry (DEXA)which is quick, simple and precise. It measuresthe density of bones in the areas most likely to beaffected and accurately follows the changes inthese bones over time [21] . Recently, many studiesshowed the need to administer vitamin D 800 IU oralfacalcidol 1 µg or calcitriol 0.5 µg/day in treatmentof osteoporosis. Active vitamin D 3analogues, suchas calcitriol and alfacalcidol, stimulate the formationand action of osteoblasts [21] leading to increased boneformation [22] . Effects of vitamin D resulted in lowerrisk of fractures and falls, as well as improvementof neuromuscular performances. In more than tenyears of practice and several short and long termclinical studies, alendronate 70 mg/week loweredthe risk of vertebral and extra-vertebral fracturesand improved bone mineral density (BMD) of allmeasured sites in both sexes with osteoporosis. Thepositive results of alendronate were demonstratedin different entities like persons of various agesand grades of lower BMD or patients withglucocorticoid-induced osteoporosis. Combinationof vitamin D with efficacious antiresorptive drug likealendronate maintains all pharmacological featuresand demnstrates the clinical effects of weeklyalendronate [23] . PTH analogue seems superior inprevention of vertebral fractures although their longterm safety needs to be established.We report a case of severe primary hyperthyroidism,secondary hyperparathyroidism, adrenal insufficiency,and osteoporosis with multiple fractures, most likely dueto chronic steroid intake because of steroid dependentbronchial asthma. Secondary hyperparathyroidismin our patient may be explained by hypocalcemiaresulting from decreased intestinal absorption andincrease renal excretion of calcium due to decreasedtubular reabsorption by steroid. Adrenal insufficiencyresulted from chronic steroid administration.CONCLUSIONThe atypical presentation (uncommon early age -osteoporosis and unusual site of fracture) is probablymultifactorial. The treatment was directed towardsthe etiology and consequences of the diseases,leading to uneventful recovery. In such a patientpresenting with osteoporosis even with subtlesymptoms of thyrotoxicosis, thyroid hormonalevaluation is warranted. Furthermore, parathyroidhormone assay is indeed one of the most importantbiochemical markers in an osteoporotic subject.REFERENCES1. Adinoff AD, Hollister JR. Steroid-induced fracturesand bone loss in patients with asthma. N Engl J Med1983; 309:265-268.2. Recommendation for the prevention and treatmentof glucocorticoid-induced osteoporosis. AmericanCollege of Rheumatology Task Force on OsteoporosisGuidelines. Arthritis Rheum1996; 39:1791-1801.3. de Nijs RN, Jacobs JW, Lems WF, et al. Alendronate oralfacalcidol in glucocorticoid-induced osteoporosis. NEngl J Med 2006; 355:675-684.4. Ringe JD, Coster A, Meng T, Schacht E, Umbach R.Treatment of glucocorticoid-induced osteoporosis withalfacalcidol/calcium versus vitamin D/calcium. CalcifTissue Int 1999; 65:337-340.5. Recommendations for the prevention and treatmentof glucocorticoid-induced osteoporosis: 2001 update.American College of Rheumatology Ad Hoc Committeeon Glucocorticoid-induced Osteoporosis. ArthritisRheum 2001; 44:1496-1503.6. Saag KG, Shane E, Boonen S, et al. Teriparatide oralendronate in glucocorticoid-induced osteoporosis. NEngl J Med 2007; 357:2028-2039.7. Cummings SR, Melton LJ. Epidemiology and outcomesof osteoporotic fractures. Lancet 2002; 359:1761-1767.8. Sawin CT, Geller A, Hershman JM, Castelli W, BacharachP. The aging thyroid. The use of thyroid hormone inolder persons. JAMA 1989; 261:2653-2655.9. Melton LJ 3 rd , Chrischilles EA, Cooper C, Lane AW,Riggs BL. Perspective. How many women haveosteoporosis? J Bone Miner Res 1992; 7:1005-1010.

June 2009KUWAIT MEDICAL JOURNAL 15510. Fraser SA, Anderson JB, Smith DA, Wilson GM.Osteoporosis and fractures following thyrotoxicosis.Lancet 1971; 1:981-983.11. Cummings SR, Nevitt MC, Browner WS, et al. Riskfactors for hip fracture in white women. Study ofOsteoporotic Fractures Research Group. N Engl J Med1995; 332:767-773.12. Bauer DC, Ettinger B, Nevitt MC, Stone KL. Studyof Osteoporotic Fractures Research Group. Risk forfracture in women with low serum levels of thyroidstimulatinghormone. Ann Intern Med 2001; 134:561-568.13. Osteoporosis and parathyroid disease. (AccessedNovember 8, 2008 at http:// www. parathyroid.com)14. Yeap SS, Hosking DJ. Management of corticosteroidinducedosteoporosis. Rheumatology (Oxford) 2002;41:1088-1094.15. Canalis E, Delany AM. Mechanisms of glucocorticoidaction in bone. Ann N Y Acad Sci 2002; 966:73-81.16. Potts JT Jr. Diseases of the parathyroid gland andother hyper- and hypocalcaemia disorders, In: DennisL Kasper, Eugene Braunwald, Stephen Hauser et al,editors. Harrison’s principles of internal medicine. 16thed. New York: McGraw-Hill; 2005. p 2151-2171.17. Reid IR, Ibbertson HK. Evidence for decreased tubularreabsorption of calcium in glucocorticoid-treatedasthmatics. Horm Res 1987; 27:200–204.18. Holic FH, Krane SM. Rickets and osteomalacia,In: Dennis L Kasper, Eugene Braunwald, StephanHauser et al, editors. Harrison’s principles of internalmedicine, 16 th ed. New York: McGraw-Hill; 2005. p2201-2205.19. Seeman E, Kumar R, Hunder GG, Scott M, Heath H 3 rd ,Riggs BL. Production, degradation and circulating levelsof 1,25-dihydroxy vitamin D in health and in chronicglucocorticoid excess. J Clin Invest 1980; 66:664-669.20. Brunader R, Shelton DK. Radiologic bone assessmentin the evaluation of osteoporosis. Am Fam Physician2002; 65:1357-1364.21. Sato F, Ouchi Y, Okamoto Y, et al. Effects of vitamin D2analogs on calcium metabolism in vitamin D-deficientrats and in MC3T3-E1 osteoblastic cells. Res Exp Med(Berl) 1991; 191:235-242.22. Grampp S, Steiner E, Imhof H. Radiological diagnosisof osteoporosis. Eur Radiol 1997; 7:11-1923. Hajcsar EE, Hawker G, Bogoch ER. Investigation andtreatment of osteoporosis in patients with fragilityfractures. CMAJ 2000; 163:819-822.

156KUWAIT MEDICAL JOURNAL June 2009Case ReportChronic Inflammatory DemyelinatingPolyradiculoneuropathy in Two ChildrenMaliha Askar Soud Al-Bloushi, Yousif Kassim Habeeb, Eman Sadiq Al-JumahDepartment of Pediatrics, Neurology Unit, Mubarak Al-Kabeer Hospital, KuwaitABSTRACTChronic inflammatory demyelinating polyradiculoneuropathy(CIDP) is relatively rare in children. We report two casesdiagnosed over a thirteen year period. One patient had aKuwait Medical Journal 2009; 41 (2): 156 -161KEY WORDS: CIDP, children, neuropathymonophasic course resulting in complete recovery whilethe other case had a slowly progressive relapsing coursewith significant morbidity.INTRODUCTIONChronic inflammatory demyelinatingpolyradiculoneuropathy (CIDP) is relatively rarein children [1,2] . It is a chronic, potentially treatable,paralytic disorder of the peripheral nervous systemdeveloping over at least two months [3] . Musclestretch reflexes are either absent or depressed.Cerebrospinal fluid shows cytoalbuminologicdissociation. Demyelination is shown in bothelectrophysiological and pathologic studies. Patientscan be classified into two groups; those with completerecovery after a monophasic course and those withprolonged disability and morbidity after a protractedor relapsing course [2,4-6] . Intravenous immunoglobulin(IVIg) and corticosteroids are the first line treatment [7] .In progressive or treatment resistant cases other optionsshould be considered like plasma exchange (PE) andvarious immunosuppressive drugs. We report twocases diagnosed over a thirteen year period; one withmonophasic course resulting in complete recovery andone with slowly progressive relapsing course withsignificant morbidity.CASE REPORTA previously healthy 34-month-old girlpresented with a two month history of progressivegait disturbance after achieving normal walkingat the age of one year. She had frequent falls withdifficulty in standing from sitting position and goingup the stairs. There was no associated upper limbweakness. She had difficulties with chewing andswallowing but no visual or respiratory symptoms.There was no history of skin rash or joint pain. Shehad uneventful prenatal and perinatal periods. Herfamily history was unremarkable for neurologicaldiseases.Examination on presentation revealed a wellchild with wide based waddling gait and mildlumbar lordosis. She had atrophy of quadricepsmuscle with normal sensation and tone. There wasweakness in lower limbs (4/5) but no weaknessin upper limbs, face or eye movement. Knee andankle tendon reflexes were absent. Romberg signwas positive. Sensory examination was normal.Her other systems examination was normal. Over aperiod of three months the course was progressivewith weakness of her lower limbs (3/5) and mildweakness of upper limbs (4/5).Investigations were normal including: creatinekinase, complete blood count, ESR, renal profile,liver profile, lipid profile, calcium, lead, serumimmunoglobulin, X-ray hips and spine, computedtomography of brain, magnetic resonance imaging(MRI) of brain and lower spine. Muscle biopsyshowed non-specific atrophic changes withno inflammatory changes. Cerebrospinal fluidanalysis showed increased protein (862 mg/l) withno cells.Her electrodiagnostic study showed signs ofdenervation affecting lower limbs more than upperlimbs. Motor conduction velocity (CV) in mediannerve was 36 m/s (normal range for age is 53.7 ± 4.70m/s) [8] and pernoneal motor CV was 39 m/s (normalrange for age is 48.7 ± 4.86 m/s) [8] .CIDP was considered and the child receivedher first intravenous immunoglobulin (IVIg)Address correspondence to:Dr Maliha A AL-Bloushi, Neurology Unit, Department of Pediatrics, Mubarak Al-Kabeer Hospital, Kuwait. Tel: 25318 502, E- mail: dr_askar@hotmail.com

June 2009400 mg/kg/day for five days followed byinfusions of IVIg (1 g/kg for two days) once permonth for three months. Then oral prednisolone,2 mg/kg /day, was introduced due to inadequateresponse to IVIg. She showed marked improvementclinically (independent ambulation, going up thestairs and normal chewing). Steroids were reducedto 25 mg every other day two months later. On thisdose she had slight deterioration necessitating IVIgdose (1 g/kg for two days). She was back to normaland steroids were stopped after fifteen months oftreatment. At four years and nine months of ageher motor CV in median nerve was 40 m/s (normalrange for age is 55.0 ± 5.20 m/s) [8] and 40 m/s intibial nerve (normal range for age : 48.6 ± 4.25 m/s) [8] .She had no more relapses and remained well overnine years of follow up.The second case presented at the age of three andhalf years with a three month history of progressivelower limb weakness manifested initially asfrequent falls, inability to go up the stairs andunsteady gait. Later she was unable to walk andwas unable to carry objects. There was no historyof limb pain or skin rash. She was born at full termby cesarian section due to prolonged labor. Shehad an uneventful neonatal period. Parents wereneurologically normal. The family history wasnegative of neuromuscular disorders.On examination she was hypotonic with absentdeep tendon reflexes in all limbs. She had weaknessin limbs and trunk. She was unable to sit up fromlying position with positive Gower sign. Powergrade was 3/5 in upper and lower limbs. She hadno sensory or cranial nerve deficit.Blood investigations were normal including;creatine kinase, liver function test, renal profile,complete blood count, lactate and ammonia. MotorCV was extremely low: 9 m/sec in the median nerve(normal range for age 55.0 ± 5.20 m/s) and 6.7 m/secin tibial nerve (normal range for age 48.6 ± 4.25 m/s),prolonged motor terminal latencies and very lowM wave amplitude. There was marked temporaldispersion with proximal conduction block and nosensory responses. The finding was of demylinativeperipheral neuropathy. Nerve conduction study forparents was normal.Diagnosis of CIDP was made and treatmentbegun with IVIg, 2 g/kg over two days, withmild improvement. The second dose of IVIG wasgiven (400 mg/kg for five days) two weeks laterwithout noticeable effect. Due to failure of IVIg, oralprednisolone was introduced at a dose 1.5 mg/kg (25mg per day). She showed impressive improvementwith power grade of 4/5 after which she almostcompletely recovered. Her motor CV showedimprovement with motor CV in median nerve of29 m/s and 21 m/s in tibial nerve.KUWAIT MEDICAL JOURNAL 157After four months of recovery gradual taperingof steroids was done with no deterioration in hermotor power. Four weeks later she suffered herfirst relapse necessitating oral steroids. Againshe responded well. After tapering the dose to 10mg alternate day oral prednisolone, she suffereda second relapse and the dose was increased to20 mg daily in addition to IVIg infusion. She hadher third relapse four months later and regularIVIg infusions, 2 g/kg over five days, were givenmonthly for six months in addition to her steroids30 mg on alternate days but only with partialimprovement.In an attempt to reduce the dose of prednisolone,azathioprine was introduced at a dose of 1-3 mg/kg/day. After three months she had a fourth relapsewith worsening of NCS: motor CV in median nervewas 6 m/sec (normal range for age 57.2 ± 3.71 m/s) [8] and 11 m/sec in tibial nerve (normal range forage 48.2 ± 2.76 m/s) [8] and steroids were switched todaily regimen while azathioprine was discontinuedafter a trial period of three years. Cyclosporine wasadded initially 25 mg twice per day and dose wasincreased to 100 mg twice per day without noticeableeffect and was discontinued after 16 months.High dose intravenous pulse methylprednisoneof 10 mg/kg/day for three consecutive days wasgiven with partial improvement.At the age of eleven years, due to her progressiverelapsing course, the patient was wheel chair boundwith severe weakness in her upper limbs. Shewas assessed in USA where she had nerve biopsywhich showed severe demyelinative inflammatoryprocess. She was placed on additional monthlycyclophosphamide for six months while on dailyoral steroids of 12.5 mg. Due to failure of previoustreatment options and the need for long term dailysteroids, plasma exchange was arranged with mildimprovement in her upper limb power (2/5). Therewas difficulty with maintaining her central line withrepeated obstructions. Other treatment options beingconsidered included methotrexate and interferonbeta. This young girl is now severely disabled,totally dependent and requires constant attention.DISCUSSIONHereditary causes of childhood chronicneuropathies are more common than acquiredones [2,9] and among the latter, acute neuropathiesare by far the commonest presentation [10,11] . CIDPis relatively rare in children with an estimatedprevalence of 1-1.9 per 100,000 persons in adultscorresponding to childhood prevalence of 0.48 per100,000 [1] . Initial presentation may occur as earlyas infancy. Male predominance in both adults andchildren was noted though female predominancewas also reported [6] . 93% of childhood cases

158Chronic Inflammatory Demyelinating Polyradiculoneuropathy in Two ChildrenJune 2009presented for neurologic evaluation within sixmonths of onset (mean 3.4 months). Prodromalevents were noted in 20-57% of patients [6,9] . Thereare no reported cases of an underlying medicalcondition in children with CIDP in contrast toadults [12] .The diagnosis is according to the criteria of theAd Hoc Subcommittee of the American Societyof Neurology [13] which have been revised forthe clinical diagnosis by the members of the 88 thEuropean neuromuscular center internationalworkshop in 2000 (appendix 1) [3] with the majorchange being in defining the mandatory clinicalfeature as progression of weakness in proximaland distal muscles over at least four weeks oralternatively when rapid progression (GBS-likepresentation) is followed by relapsing or protractedcourse (more than one year) [11] .Cardinal clinical symptoms and signs of CIDPare progressive or relapsing motor and sensorydysfunction affecting both proximal and distalmuscles of two months duration and reduced orabsent muscle stretch reflexes [1] . Gait disturbancedue to lower limb weakness is the universalpresentation in children [1,3,9] . Initial presentationmay mimic Gullain-Barre’ syndrome [2,9,14,15] orrarely multiple sclerosis [16] .Distal sensory loss is often difficult to elicit. Painis more common than parasthesiae. Infrequentneurologic findings occur including facial nerveinvolvement, diplopia and papilledema [6] . Rarelypatients needed mechanical ventilation [6,17] .Laboratory and Radiological StudiesAn elevated CSF protein (more than 35 mg/dl) without pleoctyosis (less than 10 cells /mm3)i.e., albuminocytologic dissociation is observed in90-100% of adult and childhood CIDP. Generally,blood laboratory studies are unremarkable butautoantibodies have been reported in subsets ofadult but not pediatric CIDP patients [2] .MRI documented enhancement and/orenlargement of spinal nerve roots [18] . This findingwas not found to correlate with either diseaseactivity or severity [3,6,19] .Electrophysiologic studies play an importantrole in both detection and characterization ofpolyneuropathies [10] . It helps in differentiatingchildren with CIDP from those with inheritedneuropathies [2] . Polat et al reported five differentelectrophysiologic patterns of childhoodpolyneuropathies and found childhood CIDP inonly 4% of 74 children studied. The predominantchanges seen indicate demyelination but axonalinjury may occur presumably secondary todemyelination [2] . Evidence of demyelination onNCS must demonstrate at least three out of fourmajor abnormalities in motor nerve: Slowing ofmotor conduction velocities to < 60% of normalvalues, dispersion of the compound muscle actionpotential, prolonged distal latencies in more thantwo nerves and absent or prolonged F-wave minimallatencies. These do not distinguish acquired frominherited demyelinating polyneuropathies butthe finding of non-uniform slowing, conductionblock at sites not prone to entrapment which is thehallmark for focal demyelination [9] , or abnormaltemporal dispersion favors an acquired ratherthan an inherited etiology [3] . Treatment should notbe withheld, if a patient does not meet these criteriaas many patients with clinical CIDP do not fulfillthese criteria. Serial NCS cannot be used to guidetherapy or determine prognosis [6] .Nerve biopsy may be necessary to assistdifferentiating acquired from hereditarypolyneuropathies but it has been replaced bymolecular and genetic testing [10] . It is not a requiredmandatory criteria in definite CIDP cases [1,3] asthere is no additional diagnostic value of suralnerve biopsy in the diagnosis of CIDP [20] . The mostimportant pathologic features are inflammatoryinfiltrate around epineural blood vessels,onion bulbs, which are concentric Schwann cellproliferation secondary to continued cycle ofdemylination and remyelination [2,3] .PathogenesisThe understanding of molecular and cellularmechanisms resulting in inflammatory damageof the peripheral nervous system has beenconsiderably studied. It is an autoimmune diseasethat targets the myelin sheath of peripheralnerves [1] . The target antigen and the role of humoraland cell mediated immunity remain unclear [17] . It isa heterogeneous syndrome with many parallels tomultiple sclerosis.TreatmentAlthough 20% of patients with CIDP are children,there are no control studies of the efficacy of differentimmunomodulating therapies. Several therapeuticoptions are used in immune neuropathies withsimilar efficacy including steroids, IVIg and PEwhich are the three most frequently used and wellstudied therapies for CIDP in a predominantlyadult population [1,17,21] . The initial response to eachof these therapies in adult CIDP is 60% comparedto 80-100% initial response rates in children [1,17,22] .It is unclear which treatment, IVIg or oral steroidsshould be used as initial therapy [7,23] . PE is effectivein adults but has little place in childhood CIDPand only considered as third option.IVIg is an effective first line treatment inchildhood CIDP [2,17,23] . It is safely used in children

June 2009KUWAIT MEDICAL JOURNAL 159with other autoimmune disorders [23] . There isclearly class I evidence for IVIg as standardtherapy for CIDP but most studies have only beenmade for induction therapy rather than at longterm therapy. Factors in favor of the use of IVIgover steroids includes safer long term profile andease of use (it can be given at home but not in thiscountry) while factors in favor of steroids includethe lower cost, availability worldwide and theease of administration whether intravenous ororal.The main drawbacks of IVIg are higher costand sometimes availability. Minor side effectssuch as rash, headache, fever and chills may beminimized by slowing infusion rate and using antiinflammatorypremedication. Serious side effectsincluding allergic reactions, aseptic meningitis andthromboembolic events occur in less than 5% ofinfusions [1] .There are different therapeutic regimens as todosage and duration of IVIg [24] . One gram/kg/day for two days may induce faster improvementthan 0.4 gram/kg/day for five consecutive days [3] .A dose of 0.4 g/kg body weight was superior to0.2 g/kg when given over five days. It can begiven as 2 g/kg over 2-5 days or 0.4 g/kg weeklyor every other week or every 28 days. The routinecycle of IVIg given over five days results in clinicalimprovement within 7-10 days in 56-79% of adultpatients. The mean half life of IVIg is 18 - 32 days.Therefore, periodic maintenance infusions atintervals of four weeks are needed [22,23,24] . Morethan 40% of patients need at least 1 g/kg every2-8 weeks to prevent further relapses. After 3-6months consider beginning gradual wean off bydecreasing frequency of treatment and loweringthe dose and later trail off the IVIG.Prednisolone is an effective alternative toIVIg as two thirds respond to either treatment.Family must be made aware of potential acuteand chronic risks of corticosteroids. The dose of1-2.5 mg /kg per day is usually used for at leastfour weeks followed by slow tapering. Relapseswere common when dose was lowered. There aremany potential adverse effects for corticosteroidstherapy (both acute and chronic) including weightgain, osteopenia, altered growth (occurred in our2 nd case), hypertension, susceptibity to infectionsand cataracts. These side effects may be minimizedby administering the medication on an alternateday basis or in pulse treatments.Children like adults demonstrate initialimprovement in two thirds of cases [1,7] afterinitiating treatment with prednisolone but childrenrequire continued high dose therapy as on taperingrelapses are frequent. This was evident in our2 nd case. If steroids are needed for more than oneyear, complete withdrawal is often very difficult.Attempts to reduce the dose without addition ofan immunosuppressive medication often lead tounnecessary relapses.The use of high dose pulse methylprednisolonehas been suggested with similar efficacy to IVIgand oral steroids [6,24] but physicians should beaware of possible significant clinical deteriorationafter high dose intravenous methylprednisoloneas reported by Rostasy et al [25,26] .PE is considered as a third option [22] andtrials comparing IVIg with PE did not findsignificant difference in short term effect of thesetwo treatments [1,17,23] . Although 60% of patientsrespond to PE, it is less often used in childrenbecause of technical difficulties with installationof central catheters which may account for itslimited use in young children [1] . In addition totechnical difficulties, there are potential infectious,thrombotic and hemodynamic complications ofthe treatment itself. The effect lasts only few weekswith over two thirds having a relapse or end ofdose effect after two weeks making it unsuitablefor long term treatment. It is usually administered2-3 times per week for 6-10 treatments and maybe tapered slowly. Improvement may beginwithin days but it is temporary and relapsesand even rebound phenomenon are commonwhen treatment is terminated. PE is an effectivetemporary or adjuvant therapy for CIDP butimmunosuppressive drug treatments are requiredfor long term management.The short term effects of initial treatment withIVIg and PE, in addition to the serious side effectsof prolonged use of steroids necessitates the use ofseveral immunosuppressive agents as adjunctivetherapy to reduce the dose of steroids or the frequencyof IVIg and PE courses [23,27] . In these treatment resistantcases, different immunosuppressant includingazathioprine, methotrexate [27] , cyclosporine A [28] ,cyclophosphamide [6] , mycophenolate [29] , interferon-αand β-Ia, can be used but the evidence is insufficientto recommend one over the other [1,14] .PrognosisThe prognosis in children is generally morefavorable than adults with complete remissionor minimal weakness in 70-100% cases [1,2,3,9] . Incomparison, adults exhibit moderate to severesequelae in 30-40% of cases. A small number ofchildren respond poorly to all treatment modalitiesor develop significant side effects to protractedimmunosuppression resulting in moderate tosevere neurological disability. Pain at onset andinfectious prodromal illness predicts a betteroutcome while axonal loss on electrodiagnosticstudies predicts a poor prognosis [2] .

160CONCLUSIONChildhood CIDP is rare but potentially treatableand should be considered in any child withsubacute neuropathy, where hereditary causes areexcluded. Treatment should be initiated early inorder to minimize demyelination and secondaryaxonal loss.REFERENCESChronic Inflammatory Demyelinating Polyradiculoneuropathy in Two Children1. Rossignol E, D’Anjou G, Lapointe N, Haddad E,Vanasse M. Evolution and treatment of childhoodchronic inflammatory polyneuropathy. Pediatr Neurol2007; 36:88-94.2. Connolly AM. Chronic inflammatory demyelinatingpolyneuropathy in childhood. Pediatr Neurol 2001;24:177-182.3. Nevo Y, Topalogu H. 88 th ENMC International workshop:Childhood chronic inflammatory demyelinatingpolyneuropathy (including revised diagnostic criteria),Naarden, The Netherlands, December 8-10, 2000.Neuromuscul Disord 2002; 12:195-200.4. Rodriguez-Casero MV, Shield LK, Kornberg AJ.Subacute inflammatory demyelinating polyneuropathyin children. Neurology 2005; 64:1786-1788.5. Hattori N, Ichimura M, Aoki S, et al. Clinicopathologicalfeatures of chronic inflammatory demyelinatingpolyradiculoneuropathy in childhood. J Neurol Sci1998; 154:66-71.6. Rayan MM, Grattan-Smith PJ, Procopis PG, MorganG, Ouvrier RA. Childhood chronic inflammatorydemyelinating polyneuropathy: clinical course and longtermoutcome. Neuromuscul Disord 2000; 10:398-406.7. Korinthenberg R. Chronic inflammatory demyelinatingpolyradiculoneuropathy in children and their responseto treatment. Neuropediatrics 1999; 30:190-196.8. Cai F, Zhang J. Study of nerve conduction and lateresponses in normal Chinese infants, children andadults. J Child Neurol 1997; 12:13-18.9. Simmons Z, Wald JJ, Albers JW. Chronic inflammatorydemyelinating polyradiculoneuropathy in children:Presentation, electrodiagnostic studies and initialclinical course, with comparison to adults. MuscleNerve 1997; 20:1008-1015.10. Polat M, Tekgul H, Kilincer A, et al. Electrodiagnosticpattern approach for childhood polyneruopathies.Pediatr Neruol 2006; 35:11-17.11. Koul R, Chacko A, Javed H, et al. A profile of childhoodneuropathies at a university hospital in Oman. SaudiMed J 2002; 23:450-456.12. Cocito D, Durelli L, Isoardo G. Different clinical,electrophysiological and immunological features ofCIDP associated with paraproteinaemia. Acta NeurolScand 2003; 108:274-280.13. Research criteria for diagnosis of chronic inflammatorydemyelinating polyneuropathy (CIDP). Report froman Ad Hoc Subcommittee of the American Academy ofNeurology AIDS Task Force. Neurology 1991; 41:617-618.June 200914. Odaka M, Yuki N, Hirata K. Patients with chronicinflammatory demyelinating polyneuropathyinitially diagnosed as Guillain-Barre' syndrome. JNeurol 2003; 250:913-916.15. Mori K, Hattori N, Sugiura M, et al. Chronicinflammatory demyelinating polyneuropathypresenting with features of GBS. Neurology 2002;58:979-982.16. Rodriguez-Casero MV, Shield LK, Coleman LT,Kornberg AJ. Childhood chronic inflammatorydemyelinating polyneuropathy with central nervoussystem demyelination resembling multiple sclerosis.Neuromuscul Disord 2003; 13:158-161.17. Nobile-Orazio E, Terenghi F. IVIg in idiopathicautoimmune neuropathies: analysis in the light ofthe latest results. J Neurol 2005; 252 Supp1:I7-1318- Likasitwattanakul S, Visrutaratna P. Chronicinflammatory demyelinating polyneuropathy ina child: clinical-spinal MR imaging correlation.Singapore Med J 2004; 45:536-537.19. Midroni G, de Tilly LN, Gray B, Vajsar J. MRI of thecauda equina in CIDP: clinical correlations. J NeurolSci 1999; 170:36-44.20. Molenaar DS, Vermeulen M, de Haan R. Diagnosticvalue of sural nerve biopsy in chronic inflammatorydemyelinating polyneuropathy. J Neurol NeurosurgPsychiatry 1998; 64:84-89.21. van Schaik IN, Winer JB, de Haan R,Vermeulen M. Intravenous immunoglobulinfor chronic inflammatory demylinatingpolyradiculoneuropathy: a systematic review. LancetNeurol 2002; 1:491-498.22- Hughes RA. Systematic reviews of treatment forinflammatory demyelinating neuropathy. J Anat2002; 200:331-339.23. Nobile-Orazio E. Treatment of dys-immuneneuropathies. J Neurol 2005; 252:385-395.24. Gold R, Kieseier BC. Therapy of immuneneuropathies with intravenous immunoglobulin. JNeurol 2006; 253 Suppl 5 : V59-63.25. Lopate G, Pestronk A, Al-Lozi M. Treatment of chronicinflammatory demyelinating polyneuropathywith high-dose intermittent intravenousmethylprednisolone. Arch Neurol 2005; 62:249-254.26. Rostasy KM, Diepold K, Buckard J, Brockmann K,Wilken B, Hanefeld F. Progressive muscle weaknessafter high-dose steroids in two children with CIDP.Pediatr Neurol 2003; 29:236-238.27. Fialho D, Chan YC, Allen DC, Reilly MM, Hughes RA.Treatment of chronic inflammatory demyelinatingpolyradiculoneuopathy with methotrexate. J NeurolNeurosurg Psychiatry 2006; 77:544-547.28. Visudtibhan A, Chiemchanya S, Visudhiphan P.Cyclosporine in chronic inflammatorydemyelinatingpolyradiculoneuropathy. Pediatr Neurol 2005;33:368-372.29. Umapathi T, Hughes R. Mycophenolate in treatmentresistantinflammatory neuropathies. Eur J Neurol2002; 9:683-685.

June 2009KUWAIT MEDICAL JOURNAL 161Appendix 1: Revised diagnostic criteria for childhood CIDP [3]MANDATORY CLINICAL CRITERIA1. Progression of muscle weakness in proximal and distal muscles of upper and lower extremities over at least 4 weeks, oralternatively when rapid progression (GBS-like presentation) is followed by relapsing or protracted course (more than 1year)2. Areflexia or hyporeflexiaMajor laboratory featuresA - Electrophysiological criteriaMust demonstrate at least three of the following four major abnormalities in motor nerves (or 2 of the major plus 2 of thesupportive criteria):A-1 Major1. Conduction block or abnormal temporal dispersion in one or more motor nerves at sites not prone to compressioni. Conduction block: at least 50% drop in negative peak area or peak-to-peak amplitude of proximal compoundmuscle action potential (CMAP) if duration of negative peak of proximal CMAP is < 130% of distal CMAPdurationii. Temporal dispersion: abnormal if duration of negative peak of proximal CMAP is > 130%of distal CMAPdurationRecommendations: (a) Conduction block and temporal dispersion can be assessed only in nerves where amplitudeof distal CMAP is > 1 mV, (b) Supramaximal stimulation should always be used2. Reduction in conduction velocity (CV) in two or more nerves: < 75% of the mean minus 2 standard deviations (SD)CV value for age3. Prolonged distal latency (DL) in two or more nerves: > 130% of the mean + 2 SD DL value for age4. Absent F wave or prolonged F wave minimal latency (ML) in two or more nerves: > 130% of the mean + 2SD F waveML for age5. Recommendations: F wave study should include a minimum of 10 trialsA-2 Supportive1. When conduction block is absent, the following abnormal electrophysiological parameters are indicative of nonuniformslowing and thus of an acquired neuropathy:2. Abnormal median sensory nerve action potential (SNAP) while the sural nerve SNAP is normal3. Abnormal minimal latency index (TLI) [1]4. Difference of > 10 m/s in motor CVs between nerves of upper or lower limbs (either different nerves from same limbfor example left median versus left ulnar or the same nerve from different sides (for example left versus right ulnarnerves)B - Cerebrospinal fluid (CSF studies)1. CSF protein > 35 mg/dl2. Cell count < 10 cells/mm 3C - Nerve biopsy with predominant features of demyelinationEXCLUSION CRITERIA1. Clinical features or history of a hereditary neuropathy, other diseases or exposure to drugs or toxins that are known tocause peripheral neuropthy2. Laboratory findings (include nerve biopsy or DNA studies) that show evidence for different etiology other than CIDP3. Electrodiagnostic features of abnormal neuromuscular transmission, myopathy or anterior horn cell diseaseDIAGNOSTIC CRITERIA (MUST HAVE NO EXCLUSION CRITERIA)1. Confirmed CIDP(i) Mandatory clinical features(ii) Electrodiagnostic and CSF features2. Possible CIDP(ii) Mandatory clinical features(iii) One of the 3 laboratory findingsFrom 88 th ENMC International workshop: Childhood chronic inflammatory demyelinating polyneuropathy (including reviseddiagnostic criteria), Naarden, The Netherlands, December 8-10,2000. Neuromusc Disord 2002; 12:195-200. {3}

162KUWAIT MEDICAL JOURNAL June 2009Case ReportAtypical Progression of Thyrotoxic Manifestations whileAwaiting Laboratory ConfirmationVenkatesan Nagarajan, Asmahan Al-ShubailiDepartment of Neurology, Ibn Sina Hospital, KuwaitABSTRACTAn ill-nourished man, whose hyperthyroid statewas unmasked by respiratory infection, had morethan one attack of thyroid storm and rapidlywent through several unusual complicationswhich included thyrotoxic periodic paralysis,upper and lower motor neuron manifestations,neuropsychiatric and metabolic disturbances.Diagnosis of hyperthyroidism was established after14 days with the arrival of thyroid function test whichwas drawn on admission. Though his symptomsKuwait Medical Journal 2009; 41 (2): 162-165improved after initiating treatment, he continued tosuffer from thyroid associated ophthalmopathy andmyasthenia gravis. Although these manifestations ofhyperthyroidism are well known, their occurrencein a single patient is unusual. This report highlightsthe need for the physicians to be alert regardingthese rare manifestations of thyrotoxicosis in theirpatients and initiate treatment as it is difficult toobtain rapid laboratory confirmation in emergencydepartment.KEY WORDS: Basedow’s paraplegia, periodic paralysis, hyperthyroidism, thyroid storm, thyrotoxicosisINDRODUCTIONThyroid hormone plays an important role in thedevelopment and metabolism of almost every tissue [1] .So either high or low levels of thyroid hormone areexpected to produce diffuse systemic manifestations,but it is usually restricted to one or two organs. Wereport a case which did not show classical clinical signsof thyrotoxicosis at presentation. He was referred forrespiratory infection but slipped into thyroid stormand exhibited involvement of multiple organs. Evenafter the diagnosis was established, he continued todisplay uncommon complications of thyrotoxicosis.Occurrence of all these rare manifestation in a singlepatient is unusual.CASE HISTORYA 33-year-old thin Southeast Asian man, lookingill and tired, was brought into the emergencydepartment with history of breathing difficulty, chesttightness and generalized fatigue for several hours.His blood pressure was 130/90 mmHg, pulse 130per minute, regular and temperature was 37.2 o C.Cardiovascular and abdominal examinations werenormal. Chest examination revealed a pleural ruband few crackles over the right lower chest. Few nontendercervical lymph nodes were palpable.He was admitted with the diagnosis of pneumoniaand started on dextrose infusion intravenously as aroutine measure while being evaluated. Within a shorttime he became irritable, markedly breathless andcyanosed. The jugular veins became distended. Hisblood pressure increased to 190/110 mmHg and thepulse to 170/minute. He had a right ventricular gallop.He steadily deteriorated; oxygen saturation droppedand he was subsequently intubated. Decompensatedacute congestive cardiac failure was considered andhis condition stabilized with ventilation, intravenousfrusemide and antibiotics. His ECG showed sinustachycardia; cardiac enzymes and echocardiogramwere normal. On suspicion thyroid function tests(TFT) were sent. He was extubated on the next dayand through out the day he was fully oriented.Thirty hours after admission, he suddenlybecame restless. He later became agitated, confused,was sweating profusely and had shallow breathing.He brought out frothy secretions after incessantcoughing. Examination revealed bilateral cracklesand wheezes and generalized muscle weakness.Address for correspondence:Dr. Venkatesan Nagarajan, DM, MRCP, Consultant Neurologist, Department of Neurology, Ibn Sina Hospital, P.O. Box 25427, Code 13115,Safat,Kuwait. Tel: 00965-24840837 (O), +00965-99460164 (M), +00965-23733035 (H), Fax: 00965-4849226 (P.P), E-mail:nagarajanusharani@hotmail.com

June 2009KUWAIT MEDICAL JOURNAL 163He was reintubated and ventilated without musclerelaxant. Within two hours his sweating and basalcrackles disappeared. Chest CT showed increaseddensity of both lower lobes with alveolar infiltration,peribronchial thickening and sub-pleural cysticchanges.On the third day the patient was awake onventilator, but was confused and minimally responsiveto commands. The pupils were sluggishly reactive tolight and oculocephalic reflex and orbicularis oculimuscles were weak. There was generalized hypotoniaand weakness of all four limbs. The tendon reflexeswere absent with a mute plantar response. There wasno neck stiffness. Guillain-Barre syndrome (GBS)(acute polyradiculoneuropathy) was suspected and hewas started on IV immunoglobulin 25 gram daily forfivedays.Thoroughevaluationswerecarriedout.HIV,hepatitis, connective tissue and toxic drugs screeningwere negative. Brain CT, nerve conduction studies(NCS) and the cerebrospinal fluid (CSF) examinationswere normal. None of the investigations substantiatedthe diagnosis of GBS. Routine investigations showedhypercalcemia, hypomagnesemia, hypokalemia, andhypoalbuminemia. Persistent hypokalemia (3 mmol –normal range is 3.8-5.2 mmol) in spite of replacement,suggested the possibility of hypokalemic periodicparalysis. He was continued on symptomatic andreplacement therapies. His ventilatory support waswithdrawn on the eighth day. Even after extubationhe remained sleepy and confused most of the time.He had occasional high temperature.On the twelfth hospital day, neurologicalexamination showed that the patient was consciousbut drowsy, confused and confabulating. Visualacuity was reduced to 20/200 in both eyes and pupilswere dilated with a sluggish reaction. All extraoculareye movements were restricted. Hanging jaw withwasting of both masseters and temporalis muscleswas noted. The jaw jerk was absent. Weakness ofeye closure with positive Bell’s phenomenon andweakness of palatal muscles with absent gag reflexwere noted. He had difficulty in raising his head fromthe pillow and had slow tongue movements. Themotor system examination showed spastic weaknessof the muscles of all four limbs with predominantinvolvement of upper limbs and distal muscles.Now all the tendon reflexes were highly exaggeratedwith extensor plantar responses. Cerebellar andsensory system, first and eighth cranial nervesexamination were limited because of his confusion.The patient could not sit or stand without support.He was thought to have encephalomyeloradiculoneuropathy of uncertain origin because of confusion,upper motor neuron and lower motor neuron signs.Infective causes were ruled out by normal CSFstudy. Among non-infective causes Bickerstaff’sbrainstem encephalitis and combined central (acutedisseminated encephalomyelitis) and peripheraldemyelination (GBS) were actively pursued.His EEG was moderately abnormal with slowirregular basic activity and intermittent theta activityin posterior leads. The neurophysiological tests - NCS,EMG, facial conduction, blink reflex, repetitive nervestimulation and brainstem auditory evoked potentialwere normal. The patient was not co-operative forbrain MRI. As none of the investigations pinpointedany diagnosis, Wernicke’s encephalopathy wasput forward in view of cardiovascular as well asneurological involvement and in fact patient receivedone dose of parenteral thiamine without improvementbefore the TFT which took two weeks to arrive, sealedthe diagnosis.DiagnosisThyroid function test result was TSH < 0.005 mIU/l(0.270-4.20); FT4 > 100 pmol/l (12.00-22.00) and a firmdiagnosis of hyperthyroidism or thyrotoxicosis wasreached on the fourteenth day, which could explain allthe clinical features. Other thyroid related test resultswere thyroxine 324 nmol/l (49.0-141.9), thyroninuptake 44.4% (30.0-40.0), anti-thyroperoxidaseantibody 353 U/ml (< 60 for males and < 100 forfemales) and thyroglobulin antibodies 66 U/ml (

164Atypical Progression of Thyrotoxic Manifestations while Awaiting Laboratory ConfirmationJune 2009fatigability was noted in his ptosis. The tensilon test atbed side and repetitive nerve stimulation confirmedthe diagnosis myasthenia gravis (MG). There was nothymic enlargement in the CT mediastinum. He wasstarted on pyridostigmine and oral prednisolone.Once again all his symptoms started improving exceptmoderate restriction of eye movements. Presently heis doing well with additional medications.DISCUSSIONHyperthyroidism was first described by RobertJ Graves in 1835 [1] . Though most of the cases can bediagnosed clinically by its familiar presentation, thereis a wide variation of clinical signs and symptomsin unusual presentation. Even among generalpopulation with a prevalence of 1-2%, roughly0.5% of thyrotoxicosis remains undiagnosed [2] .Thyrotoxicosis is more common in women (2%) thanin men (0.2%) [1] . Our patient did not exhibit any ofthe classical signs of thyrotoxicosis - thyromegaly,tremors and staring look. Thyroid enlargement isusually diffuse and symmetrical in thyrotoxicosis butoccasionally it may not be palpable [2] . Though tremoris universal in thyrotoxicosis, it was not exhibited byour patient throughout the illness. The staring lookwas evident only in later part of his illness after hedeveloped corneal ulcer.Retrospective analysis suggests that respiratoryinfection unmasked his underlying thyrotoxicosis.Without being recognized he twice went into thyroidstorm requiring intubation, diagnosed as heart failureand recovered only with symptomatic treatment.Thyroid storm is a medical emergency with anincidence of 1-2% and carries a mortality of 10-75% [3] .Possibly his first storm was precipitated by palpatingthe gland while looking for cervical adenitis and thesecond one by the drugs given.Flaccid paralysis after the storm was thoughtto be due to GBS because of the absent jerks, facialweakness and respiratory failure. In thyrotoxicosisalso there may be flaccid paraplegia with absentjerks and without bladder involvement, called“Basedow’s paraplegia”. The incidence of thispolyneuropathy is around 19% [4] . Both possibilitieswere ruled out by normal nerve conduction studies.Next hypokalemic periodic palsy was considered.If such paralyses occur in thyrotoxicosis, it is calledThyrotoxic periodic paralysis. Its incidence is 10%and is most common in Asian males (M:F = 6:1)over 20 years of age. Attacks may be localized orgeneralized and each attack can last for minutes todays. Type of paralyses also differs during each attack.Except heart and sphincters, all other muscles canbe affected [5,6] . It differs from familial hypokalemicperiodic paralysis by the absence of familyhistory, older age of onset (> 20 years), worseningor precipitation of symptoms by acetazolamideand prevention of attacks by B-blockers [5] . Theflaccid paralysis responded to the replacement ofpotassium, respiratory support and B-blockerswhich are incidentally the treatment for thyrotoxicperiodic paralysis. Another possibility is thyroidmyopathy which can precede the thyrotoxicosissymptoms. It is more common in female in fifthdecade and is characterized mainly by proximalweakness. Wasting can occur especially in elderlyand weakness may involve bulbar, esophageal andrespiratory muscles. Serum creatinine kinase is notraised as a rule but electromyography is usuallyabnormal in 80% cases [6] .Hashimoto’s encephalopathy is usually associatedwith hypo rather than hyperthyroidism. Thissubacute encephalopathy has varied presentationand commonly affects females. Two less distinctpatterns of presentation are recognized. The vasculiticpresentation is like acute stroke associated with focalneurologic signs, seizures and multifocal myoclonus.Another pattern is diffuse slowly progressiveimpairment of mental function with confusion,somnolence, and psychosis [7] . Mostly there willbe raised CSF protein with occasional pleocytosis.In our patient the neuropsychiatric manifestationoccurred abruptly along with thyroid storm anddid not have myoclonus, seizures or abnormal CSF.Reversible pyramidal signs have been reported inthyrotoxicosis [8] . This patient also exhibited all themetabolic complications of thyrotoxicosis. They arehypercalcemia, hypomagnesemia, hypokalemia andhypoalbuminemia [9] .Thyroid associated ophthalmopathy (TAO) is anauto-immune disorder, with an incidence of 5% (butsub-clinical in 90%). It may precede (20%), concur(40%) or follow (40%) treatment for thyrotoxicosisand is independent of thyroid status [10] . There arefour subtypes depending upon the site of immuneattack [11] . Ocular myopathy type results fromsensitized T-lymphocytes targeting extra ocularmuscles. Congestive ophthalmopathy is due toantibodies cross reacting with orbital connectivetissue and fat to produce typical symptoms of TAO– watering, congestion and proptosis. Combinationof both is called mixed type and it is the commonestpresentation of TAO. The fourth type, chronic eyeliddisease is responsible for lid lag and corneal ulcer [7] . Inour patient, it started as acute ocular myopathy withabsent extraocular movements which was mistakenfor cranial nerve palsy or brainstem involvement.Subsequently he evolved into mixed and chronic eyelid disease type with the development of corneal ulcerwhich was conveniently labeled as exposure keratitisdue to bilateral facial palsy. The staring look wasevident later after initiating on anti-thyroid regimen.

June 2009KUWAIT MEDICAL JOURNAL 165Always suspect MG when a thyrotoxicosis patientwith lid retraction develops ptosis [12] . The historyof diurnal variation and clinically demonstrablefatigability will clinch the diagnosis. Apart fromtensilon test and repetitive nerve stimulation,acetylcholine receptor antibody and single fiberelectromyography are the other tests to confirm MG.This could not be done due to administrative reasons.Both MG and Graves’ disease are autoimmunedisorder against surface receptors with highprevalence and correlation [12] . Usually their responseto treatment with pyridostigmine will be dramatic.CONCLUSIONThis report highlights the need for physiciansto be alert regarding these rare manifestations ofthyrotoxicosis in their patients and initiate treatmentas it is difficult to obtain rapid laboratory confirmationin the emergency department.REFERENCES1. Boelaert K, Franklyn JA. Thyroid hormone in healthand disease. J Endocrinol 2005; 187:1-15.2. Cooper DS. Hyperthyroidism. Lancet 2003; 362:459-468.3. Wartofsky L. Thyrotoxic storm, In: BravermanLE, Utiger RD, editors. Werner and Ingbar’s ‘TheThyroid’. 7th ed. Philadelphia: Lippincott-Raven;1996. p 701-707.4. Duyff RF, Van den Bosch J, Laman DM, van LoonBJ, Linssen WH. Neuromuscular findings in thyroiddysfunction: a prospective clinical and electrodiagnosticstudy. J Neurol Neurosurg Psychiatry 2000; 68:750-755.5. Delong GR. Neuromuscular system and brain inthyrotoxicosis, In: Braverman LE, Utiger RD, editors.Werner and Ingbar’s ‘The Thyroid’. 7th ed. Philadelphia:Lippincott-Raven; 1996. p 645-652.6. Al-Shekhlee A, Kaminski HJ, Ruff RL. Endocrinemyopathies and muscle disorders related to electrolytedisturbance, In: Katiriji B, Kaminski HJ, Preston D,Shapiro B, Ruff RL, editors. Neuromuscular disordersin clinical practice. Boston: Butterworth-Heinemann;2002. p 1187-1204.7. Kothbauer-Margreiter I, Sturzenegger M, Komor J,Baumgartner R, Hess CW. Encephalopathy associatedwith Hashimoto thyroiditis: diagnosis and treatment. JNeurol 1996; 243:585-593.8. Newcomer J, Haire W, Hartman CR. Coma andthyrotoxicosis. Ann Neurol 1983; 14:689-690.9. Loeb JN. Metabolic changes in thyrotoxicosis, In:Braverman LE, Utiger RD, editors. Werner and Ingbar’s‘The Thyroid’. 7th ed. Philadelphia: Lippincott-Raven;1996. p 687-692.10. Jacobson DM. Dysthyroid orbitopathy. Semin Neurol2000; 20:43-54.11. Tani J, Wall JR. Autoimmunity against eyemuscleantigens may explain thyroid-associatedophthalmopathy. CMAJ 2006; 175:239.12. Abend WK, Tyler HR. Thyroid disease and nervoussystem, In: Aminoff MJ, editor. Neurology and generalmedicine. 2nd ed. New York: Churchill Livingston;1995. p 333-347.

166KUWAIT MEDICAL JOURNAL June 2009Selected Abstracts of Articles PublishedElsewhere by Authors in KuwaitKuwait Medical Journal 2009, 41 (2): 166-169Comparative Hydrocarbon Utilization by Hydrophobic and HydrophilicVariants of Pseudomonas AeruginosaObuekwe CO, Al-Jadi ZK, Al-Saleh ESMicrobiology Division, Department of Biological Sciences, Faculty of Science, Kuwait University, Safat, Kuwait City,Kuwait. E-mail: okey@kuc01.kuniv.edu.kwJ Appl Microbiol 2008; 105:1876-1887Aims: To investigate hydrocarbon degradation by hydrophobic, hydrophilic and parental strains ofPseudomonas aeruginosa.Methods and results: Partitioning of hydrocarbon-degrading P. aeruginosa strain in a solvent/aqueoussystem yielded hydrophobic and hydrophilic fractions. Exhaustive partitioning of aqueous-phase cellsyielded the hydrophilic variants (L), while sequential fractionation of the hydrophobic phase cells yieldedsuccessive fractions exhibiting increasing cell-surface hydrophobicity (CSH). In hydrocarbon adherenceassays (bacterial attachment to hydrocarbon), L had a value of 20%, which increased from 61.7% infirst hydrophobic fraction (H(1)) to 72.2% in the third (H(3)). Crude oil degradation by L was 70%, butincreased from 82% in H(1) to 93% in H(3). L variant produced most exopolysaccharides and reducedsurface tension from about 73 to 49 mN m(-1). Rhamnolipid production was highest in L, but was notdetected in all crude oil cultures.Conclusions: Hydrophobic subpopulations of hydrocarbon-degrading P. aeruginosa exhibited greaterhydrocarbon-utilizing ability than hydrophilic ones, or the parental strain.Significance and impact of the study: Results demonstrate that a population of P. aeruginosa consists ofcells with different CSH which affect hydrocarbon utilization. This potentially provides the populationwith the capacity to utilize different hydrophobic substrates found in petroleum. Judicious selection ofsuch hydrophobic subpopulations can enhance hydrocarbon pollution bioremediation.Survival of Male Breast Cancer Patients:Population-Based Cohort StudyThalib L, Hall PDepartment of Community Medicine and Behavioral Sciences (Biostatistics), Faculty of Medicine, KuwaitUniversity, PO BOX 24923, Safat 13110 KuwaitCancer Sci 2008 Dec 11 [Epub ahead of print]Little information is available on the survival of male breast cancer patients because the disease is extremelyrare in men. Moreover, previous reports on the prognosis of male breast cancer have been conflicting. Wetook advantage of a number of large, nationwide registries in Sweden to evaluate the prognostic valueof sex in breast cancer patients. A population-based cohort of 269 male and 30 011 female breast cancerpatients born after 1935 and diagnosed with primary breast cancer between 1970 and 1997 was generatedby linking a number of Swedish registries, including the Swedish Cancer Registry, the Cause of DeathRegistry, the Swedish Generation Registry, and the Registry of Population and Population Changes.

June 2009KUWAIT MEDICAL JOURNAL 167We used this cohort to quantify the association between the sex of the patient and breast cancer-specificmortality, using the Cox proportional hazards. The sex of the patient did not significantly influence theprognosis of breast cancer. Adjusting for age at diagnosis and calendar period did not alter the results.Nor did the results change when the analyses were repeated for all causes of morality. Our study, oneof the largest to date, failed to find evidence to support the proposed association between the sex ofbreast cancer patients and survival. Given the previous reports, which advocated that male breast cancerpatients have poorer survival and need aggressive treatment strategies, our findings are reassuring andclinically very important.Fine needle Aspiration Cytology of Breast Masses in Childrenand Adolescents: Experience with 1404 AspiratesKapila K, Pathan SK, Al-Mosawy FA, George SS, Haji BE, Al-Ayadhy BDepartment of Pathology, Faculty of Medicine, Kuwait University, and Cytology Laboratory, Mubarak Al-KabeerHospital, Safat, Kuwait. E-Mail: kkapila@yahoo.comActa Cytol 2008; 52:681-686Objective: To study the distribution and efficacy of fine needle aspiration cytology (FNAC) in the diagnosisof breast lesions in pediatric and adolescent patients.Study design: From January 1993 to December 2006, the cytology reports of 1404 breast aspirates (178males and 1226 females) performed on children and adolescents (ranging from 1 to 21 years) werereviewed. Of these 41, 179, 506 and 678 aspirates belonged to the age group 1-

168Selected Abstracts of Articles Published Elsewhere by Authors in Kuwait March 2009regarding monthly income of the chosen sample were collected from parents of those children. Theoverall prevalence of overweight and obesity in adolescent Kuwaiti children aged 10 to 14 years was30.7% and 14.6%, respectively. The overall prevalence of overweight and obesity among males was 29.3%and 14.9%, respectively (P < .001) and the prevalence of overweight and obesity among females was32.1% and 14.2%, respectively (P < .001). High daily caloric intake by the obese and overweight childrenand physical inactivity was reported among the majority of them. Health education programs should beconducted to control this syndrome in order to prevent future risk of obesity-related disease, and physicalactivity programs should be incorporated in the schools. Any management plan for overweight and obesechildren should include 3 major components: diets, exercise, and family-based behavior and they shouldnot be placed on restrictive diets because adequate calories are needed for proper growth.Antioxidant Therapy is Associated with a Reduction in the Serum Levelsof Mediators of Renal Injury following Lithotripsy for Renal CalculiKehinde EO, Al-Awadi KA, Al-Hunayan A, Mojiminiyi OA, Memon A, Abdul-Halim H, Fatinikun T.Department of Surgery (Division of Urology), Faculty of Medicine, Kuwait University, Safat, Kuwait. E-Mail:ekehinde@hsc.edu.kwJ Endourol 2008; 22:2537-2545Objective: To investigate the effects of antioxidant therapy on the levels of mediators of shock waveinduced renal injury in patients with renal calculi treated with extracorporeal shock wave lithotripsy(ESWL).Patients and methods: One hundred and twenty patients with renal calculi were divided into threetreatment groups: Group A patients (n = 39) served as a control group; Group B patients (n = 41) weregiven 2 capsules of Nature Made((R)) antioxidants 2 hours before, and 2 and 8 hours after ESWL andGroup C patients (n = 40) were given 2 capsules of the antioxidants at 2 and 8 hours after ESWL. Bloodand urine samples were obtained from all patients just before the start of treatment with ESWL, and at 2and 24 hours and on day 7 and 28 after ESWL. Levels of mediators of renal injury such as serum alkalinephosphatase (ALP), C-reactive protein (CRP) and lactate dehydrogenase (LDH) were measured. Urinarylevels of albumin and ALP were also determined as measures of renal tubular injury.Results: Patients given antioxidants had significantly reduced mean serum concentration of ALP (p

March 2009KUWAIT MEDICAL JOURNAL 169Materials and Methods: A questionnaire was distributed to 105 graduates of the Medical LaboratorySciences (MLS) Department, Faculty of Allied Health Sciences, Kuwait University from the years1982 to 2001 who are currently working in Ministry of Health hospitals. Of those, 85 questionnaireswere returned and this was a response rate of 80 percent.Results: Fifty-six percent of respondents were satisfied overall with their jobs, but 44% were notsatisfied. Overall job satisfaction was found to be associated with having the opportunity of applyingtheir academic knowledge and laboratory skills to their work when job conditions were conducive tothe work and there was collegiality in the laboratory. Reporting to only one supervisor also showeda positive relationship with overall job satisfaction. In contrast, perceptions of unhealthy workingconditions, where employees tended to be a hindrance to another employee, were associated withlower overall job satisfaction. Forty-nine percent of all respondents reported that they were notsatisfied with organizational practice, 44% were not satisfied with the work environment, and 39%were not satisfied with their autonomy and freedom to work.Conclusion: A high percentage of laboratory technologists were not satisfied overall with their jobsor with specific aspects of their jobs. Particularly important in this respect were whether technologistsfelt that their work appropriately used their knowledge, feelings of technical competency, workrelated rules/procedures, and presence of unhealthy competition. These issues of health workerdissatisfaction need to be addressed by the health authority managers responsible for these servicesand by academics who train MLS workers.Diarrhoeagenic Escherichia Coli are Not a Significant Cause ofDiarrhoea in Hospitalised Children in KuwaitBMC Microbiol 2009; 9:62Albert MJ, Rotimi VO, Dhar R, Silpikurian S, Pacsa AS, Molla AM, Szucs GBackground: The importance of diarrhoeagenic Escherichia coli (DEC) infections in the Arabian Gulfincluding Kuwait is not known. The prevalence of DEC enterotoxigenic [ETEC], enteropathogenic[EPEC], enteroinvasive [EIEC], enterohemorrhagic [EHEC] and enteroaggregative [EAEC]) wasstudied in 537 children [less than or equal to] 5 years old hospitalised with acute diarrhoea and 113matched controls from two hospitals during 2005-07 by PCR assays using E. coli colony pools.Results: The prevalence of DEC varied from 0.75% for EHEC to 8.4% for EPEC (mostly atypicalvariety) in diarrhoeal children with no significant differences compared to that in control children(P values 0.15 to 1.00). Twenty-seven EPEC isolates studied mostly belonged to non-traditionalserotypes and possessed beta and theta intimin subtypes. A total of 54 DEC isolates from diarrhoealchildren and 4 from controls studied for antimicrobial susceptibility showed resistance for olderantimicrobials, ampicillin (0 to 100%), tetracycline (33 to 100%) and trimethoprim (22.2 to 100%);43.1% of the isolates were multidrug-resistant (resistant to 3 or more agents). Six (10.4%) DEC isolatesproduced extended spectrum beta-lactamases and possessed genetic elements (blaCTX-M, blaTEMand ISEcp1) associated with them.Conclusion: We speculate that the lack of significant association of DEC with diarrhoea in childrenin Kuwait compared to countries surrounding the Arabian Gulf Region may be attributable to highenvironmental and food hygiene due to high disposable income in Kuwait.

170KUWAIT MEDICAL JOURNAL June 2009Forthcoming Conferences and MeetingsCompiled and edited byBabichan K ChandyKuwait Medical Journal 2009; 41 (2): 170-179Mammograms to MRI: Breast Imaging andInterventions 2009Jun 15 - 18, 2009Kiawah Island Resort, SC, United StatesContact: Office of Continuing Medical Education,Duke University School of Medicine, 3100 TowerBoulevard, Suite 1300, Durham, NC 27707Phone: 919-401-1200; Fax: 919-401-1213E-Mail: cme@mc.duke.eduMILAN Breast Cancer ConferenceJun 17 - 19, 2009Milan, ItalyContact: Cristina RaiPhone: 39-0-24-804-951; Fax: 39-0-243-911-650E-Mail: congress@cq-travel.com20 th Congress of the European Society of Paediatricand Neonatal Intensive Care ESPNICJun 17 - 20, 2009Verona, ItalyContact: Liraz BregmanPhone: 41-229-080-488; Fax: 41-227-322-850E-Mail: espnic@kenes.com8 th International Congress on Complications duringCoronary Intervention: Management and PreventionJun 17 - 19, 2009Lausanne, SwitzerlandContact: Kay Daniela SchulzPhone: 43-186-749-44-0; Fax: 43-186-749-44-9E-Mail: office@ee-pco.comAmerican College of Surgeons Oncology Group 2009Annual SymposiumJun 18 - 20, 2009Durham, NC, United StatesContact: Office of Continuing Medical Education,Duke University School of Medicine, 3100 TowerBoulevard, Suite 1300, Durham, NC 27707Phone: 919-401-1200; Fax: 919-401-1213E-Mail: cme@mc.duke.eduCongreso Oncologia - Habana 2009Jun 18 - 21, 2009Havana, CubaContact: Lic Elizabeth Alvarez VelazquezPhone: 53-7-838-2573E-Mail: rpinor@infomed.sld.cu12 th Annual Duke Cardiothoracic Update and TEEReviewJun 18 - 21, 2009Hilton Head, SC, United StatesContact: Office of Continuing Medical Education,Duke University School of Medicine, 3100 TowerBoulevard, Suite 1300, Durham, NC 27707Phone: 919-401-1200; Fax: 919-401-1213E-Mail: cme@mc.duke.eduThe 1 st World Congress on Controversies inPsychiatryJun18 - 21, 2009Berlin, GermanyContact: Organizing SecretariatPhone: 97-235-666-166E-Mail: copsy@comtecmed.com5 th World Congress of Paediatric Cardiology andCardiac SurgeryJun 21 - 26, 2009Cairns, QLD, AustraliaContact: ICMS Pty LtdPhone: 61-396-820-244; Fax: 61-396-820-288E-Mail: pccs2009@icms.com.auAutism, ADHD, and other Pediatric BehaviorDisordersJun 21 - June 28, 2009Rome, ItalyContact: Continuing Education, Inc.Phone: 1-800-422-0711; Fax: 727-522-8304E-Mail: sandra@continuingeducation.netCardiology Update in Primary Care Medicine: AnEvidence-Based ApproachJun 22 - 26, 2009Sarasota, FL, United StatesContact: Christy or CristinaPhone: 1-866-267-4263 / 1-941-388-1766; Fax: 1-941-365-7073E-Mail: mail@ams4cme.comBIT’s 2 nd World Cancer CongressJun 22 - 25, 2009Beijing, ChinaContact: Annie SunPhone: 0086-411-84-799-479; Fax: 0086-411-84-799-629E-Mail: annie@cancercon.com

June 2009KUWAIT MEDICAL JOURNAL 171British Association of Urological Surgeons 2009Annual MeetingJun 22 - 25, 2009Glasgow, Scotland, United KingdomContact: Meeting OrganiserPhone: 44-0-2-078-696-950; Fax: 44-0-2-074-045-048E-Mail: admin@baus.org.ukGastroenterology for the PCPJun 22 - Jul 04, 2009Harwich, England, United KingdomContact: Continuing Education, Inc.Phone: 1-800-422-0711; Fax: 727-522-8304E-Mail: sandra@continuingeducation.netLung Health and the Strengthening of HealthSystems in AfricaJun 24 - 26, 2009Ouagadougou, Burkina FasoContact: Conference SecretariatPhone: 22-650-304-346; Fax: 22-650-317-979E-Mail: ocarolineella@yahoo.fr2 nd World Psoriasis and Psoriatic Arthritis Confernce2009Jun 24 - 28, 2009Stockholm, SwedenContact: Veronika LindbergPhone: 46-855-610-910; Fax: 46-855-610-919E-Mail: I fpa@pso.seCardiology Essentials and Case StudiesJun 25 - Jul 08, 2009Amsterdam, NetherlandsContact: Eileen Tener, ACCPhone: 813-333-6878E-Mail: ETener@CruisersParadise.com12 th Annual Congress of the German Society forWound Healing and Wound CareJun 25 - 27, 2009Kassel, GermanyContact: Jana RauschPhone: 49-0-3-641-353-313; Fax: 49-0-36-413-533-272E-Mail: jana.rausch@conventus.deSociety for Neuroendocrinology (SBN) AnnualMeetingJun 25 - 27, 2009East Lansing, MI, United StatesContact: Society for Neuroendocrinology, 1100 E.Woodfield Road, Suite 520, Schaumburg, IL 60173Phone: 847-517-7225; Fax: 847-517-7229E-Mail: info@sbn.orgPACAAM - Panamerican Congress on Aesthetic andAnti-Aging MedicineJun25 - 27, 2009Montréal, QC, CanadaContact: Catherine DECUYPERPhone: 33-0-156-837-800; Fax: 33-0-156-837-805E-Mail: PACAAM09@euromedicom.com13 th Annual Clinical Magnetic Resonance SocietyMeetingJun 25 - 28, 2009Orlando, FL, United StatesContact: Heather LauroPhone: 813-806-1080; Fax: 813-806-1081E-Mail: hlauro@cmrs.comAmerican Academy of Dermatology and EuropeanAcademy of Dermatology & Venereology State of theArt in DermatologyJun 25 - 28, 2009Munich, GermanyContact: Meeting OrganiserPhone: 847-240-1485; Fax: 847-330-1135E-Mail: mstein@aad.orgUCSD Conference on Limb Salvage and FunctionalReconstruction: Orthopaedic, Vascular and WoundCare Team ApprovalJun 26 - 28, 2009Del Mar, CA, United StatesContact: Meeting OrganiserPhone: 858-534-3940 / 888-229-OCME (6263)E-Mail: ocme@ucsd.edu1 st Meeting of the European Academy ofOtorhinolaryngology and Head and Neck Surgery(EAORL-HNS)Jun 27 - 30, 2009Mannheim, GermanyContact: Frau GanthalerPhone: 43-0-158-804-224; Fax: 43-0-158-804-185E-Mail: ganthaler@mondial-congress.comMayo Clinic International Vascular SymposiumJune 27 - 30, 2009Budapest, HungaryContact: Mayo Clinic Medical Education OfficePhone: 904-953-7114 / 507-284-2509 / 480-301- 4580;Fax: 904-953-2954 / 507-284-0532 / 480-301-8323E-Mail: cme-jax@mayo.edu / cme@mayo.edu / mcs.cme@mayo.eduEuropean Society of Therapeutic Radiology andOncology (ESTRO) 2009 CourseJun 27- Jul 02, 2009Bali, IndonesiaContact: Meeting OrganiserPhone: 62-21-31-931-172; Fax: 62-21-31-931-172 / 62-21-55-960-179 ; E-Mail: estrobali@pharma-pro.com

172Forthcoming Conferences and Meetings March 2009European Society for Human Reproduction andEmbryology: 25 th Annual MeetingJun 28 - Jul 01, 2009Amsterdam, NetherlandsContact: ESHRE Central OfficePhone: 32-22-690-969; Fax: 32-22-695-600E-Mail: info@eshre.com9 th World Congress of Biological PsychiatryJun 28 - Jul 02, 2009Paris, FranceContact: Ms Gesche OhleE-Mail: GOhle@cpo-hanser.dePediatric UpdateJun 29 - Jul 02, 2009Hilton Head Island, SC, United StatesContact: Catherine BurrisonPhone: 1-800-335-2582E-Mail: cburrison@seapines.comOrthopaedics and Sports Medicine for Primary Careand Family PractitionersJul 02 - 12, 2009Copenhagen, DenmarkContact: Continuing Education, Inc.Phone: 1-800-422-0711; Fax: 727-522-8304E-Mail: sandra@continuingeducation.net4 th Europaediatrics 2009Jul 03 - 06, 2009Moscow, Russian FederationContact: Meeting OrganiserPhone: 302-106-889-100; Fax: 302-106-844-777E-Mail: europaediatrics2009@acnc.grWorld Glaucoma CongressJul 08 - 11, 2009Boston, MA, United StatesContact: Congress SecretariatPhone: 31-206-793-411; Fax: 31-206-737-306E-Mail: info@worldglaucoma.orgNorth American Clinical Dermatologic Society 50 thAnnual MeetingJul 08 - 18, 2009Boston, MA, United StatesContact: Meeting OrganiserPhone: 858-558-0677; Fax: 858-558-3077E-Mail: jakoperski@yahoo.com10 th Annual Update in Gastroenterology - 2009Jul 08 - 20, 2009Amsterdam, NetherlandsContact: Continuing Education, Inc.Phone: 1-800-422-0711; Fax: 727-522-8304E-Mail: sandra@continuingeducation.netSociety for Pediatric Dermatology 35 th Annual MeetingJul 09 - 12, 2009Philadelphia, PA, United StatesContact: Meeting OrganiserPhone: 317-202-0224; Fax: 317-205-9481E-Mail: spd@hp-assoc.comModern Endocrinology: An Update & Refresher forthe Primary Care PhysicianJul 10 - 17, 2009Seattle, WA, United StatesContact: Eileen Tener, ACCPhone: 813-333-6878E-Mail: ETener@CruisersParadise.comNorth American Society for Dialysis andTransplantation: 28 th Annual MeetingJul 12 - 16, 2009Maui, HI, United StatesContact: Meeting OrganiserPhone: 1-281-997-1944E-Mail: lbrazil@nasdat.orgSeminar on Legal-Medical IssuesJul 15 - 28, 2009Harwich, England, United KingdomContact: Eileen Tener, ACCPhone: 813-333-6878E-Mail: ETener@CruisersParadise.comXVII World Congress of Aesthetic MedicineJul 17 - 19, 2009Vancouver, BC, CanadaContact: Natalie LamppuPhone: 604-685-0450; Fax: 604-685-0451E-Mail: nlamppu@caam.caAnti Aging and Aesthetic Medicine Alaska CruiseJul 19 - 26, 2009Vancouver, AK, United StatesContact: Dr. Martin GerretsenPhone: 1-888-647-7327; Fax: 1-888-547-7337E-Mail: martin@seacourses.com5 th IAS Conference on HIV Pathogenesis, Treatmentand Prevention (IAS 2009)Jul 19 - 22, 2009Cape Town, South AfricaContact: Conference SecretariatE-Mail: registration@ias2009.orgWashington State Dermatology Association PacificNorthwest Dermatological Society 76 th AnnualMeetingJul 23 - 26, 2009Seaside, OR, United StatesContact: Meeting OrganiserPhone: 206-956-3038; Fax: 206-441-5863E-Mail: smc@wsma.org

June 2009KUWAIT MEDICAL JOURNAL 173Urology Update for the Non-UrologistJuly 25 - Aug 01, 2009Miami, FL, United StatesContact: Eileen Tener, ACCPhone: 813-333-6878E-Mail:ETener@CruisersParadise.com3 rd Annual LAVA (Latest Advances in InterventionalTechniques)Jul 27 - 30, 2009Maui, HI, United StatesContact: Stanford Radiology CMEPhone: 650-473-5052 888-556-2230; Fax: 650-473-5062E-Mail: radiologycme@med.stanford.eAdvanced Topics in Multidetector CT ScanningJul 31 - Aug 02, 2009Seattle, WA, United StatesContact: Johns Hopkins University School ofMedicine, Thomas B. Turner Building, 720 RutlandAvenue, Room 20, Baltimore, Maryland 21205-2195Phone: 410-502-9634E-Mail: cmenet@jhmi.edu13 th World Conference on Lung CancerJul 31 - Aug 04, 2009San Francisco, CA, United StatesContact: RobertsonPhone: 1-604-681-2153; Fax: 1-604-681-1049E-Mail: wclc2009@meet-ics.com7 th Annual Comprehensive Pain Board ReviewSymposiumAug 03 - 07, 2009Madison, WI, United StatesContact: CME Office Fax: 608-262-8421 / 608-240-6040E-Mail: ocpd@mailplus.wisc.edu14 th Congress of Indonesian Society of Obstetricianand GynecologistsAug 03 - 09, 2009Surabaya, IndonesiaContact: Brahmana Askandar, MDPhone: 62-818-316-500E-Mail: Brahmana@kogi2009.comWorld Congress on Thyroid CancerAug 06- 10, 2009Toronto, ON, CanadaContact: Meeting OrganiserPhone: 416-978-2719 / 1-888-512-8173; Fax: 416-946-7028E-Mail: help-ENT0909@cmetoronto.caNeurology Conference CruiseAug 07 - 14, 2009Vancouver, BC, CanadaContact: Continuing Education, Inc.Phone: 1-800-422-0711; Fax: 727-522-8304E-Mail: Sandra@continuingeducation.netPediatrics Update 2009 - with a Focus onGastrointestinal DiseasesAug 08 - 15, 2009Seattle, WA, United StatesContact: Continuing Education, Inc.Phone: 1-800-422-0711; Fax: 727-522-8304E-Mail: Sandra@continuingeducation.netSports Medicine and Orthopaedics with Hands onSplinting/casting and Joint Injection ModelsAug 08 - 18, 2009Southampton, England, United KingdomContact: Continuing Education, Inc.Phone: 1-800-422-0711; Fax: 727-522-8304E-Mail: Sandra@continuingeducation.net2 nd International Congress of Respiratory Science(ICRS)Aug 09 - 13, 2009Bonn, GermanyContact: Steven PerryE- Mail: info@respiratory-science.orgSuccess with Failure: New Strategies for the Evaluationand Treatment of Congestive Heart FailureAug 09 - 12, 2009Whistler, BC, CanadaContact: Mayo Clinic Medical Education OfficePhone: 904-953-7114 / 507-284-2509 / 480-301- 4580;Fax: 904-953-2954 / 507-284-0532 / 480-301-8323E-Mail: -jax@mayo.edu / cme@mayo.edu / mcs.cme@mayo.edu23 rd Annual Echocardiographic SymposiumAug 09 - 13, 2009Vail, CO, United StatesContact: Mayo Clinic Medical Education OfficePhone: 904-953-7114 / 507-284-2509 / 480-301- 4580;Fax: 904-953-2954 / 507-284-0532 / 480-301-8323E-Mail: cme-jax@mayo.edu / cme@mayo.edu / mcs.cme@mayo.eduSkin Care Physicians Controversies and Conversationsin Laser and Cosmetic SurgeryAug 14 - 16, 2009Southampton, BermudaContact: Meeting OrganiserPhone: 617-731-1600E-Mail: controversies@skincarephysicians.netThe Bali Ophthalmology RetreatAug 14 - 16, 2009Bali, IndonesiaContact: Bali Ophthalmology Retreat 2009 SecretariatPhone: 62-215-646-688; Fax: 62-215-642-072E-Mail: Esti.Hastarini@klinikmatanusantara.com

174Forthcoming Conferences and Meetings March 2009American Dermatological Association 2009 AnnualMeetingAug 19 - 23, 2009Park City, UT, United StatesContact: Meeting OrganiserPhone: 954-452-1113; Fax: 305-945-7063E-Mail: ameriderm1930@aol.comEuropean Plastic Surgery Research CouncilAug 20 - 23, 2009Hamburg, GermanyContact: Lars SteinstraesserE-Mail: info@epsrc.euPsychiatry at Sea Cruise (to Alaska)Aug 22 - 29, 2009Vancouver, AK, United StatesContact: Dr Martin GerretsenPhone: 1-888-647-7327; Fax: 1-888-547-7337E-Mail: cruises@seacourses.com7 th Baltic Bone and Cartilage ConferenceAug 23 - 26, 2009Nyborg, DenmarkContact: Nanett MosumgaardPhone: 45-65-414-838 Fax: 45-65-919-653E-Mail: nanett.mosumgaard@ouh.regionsyddanmark.dkTrauma ConferenceAug 23 - 28, 2009Thredbo, NSW, AustraliaContact: Bron ChestermanPhone: 0-882-676-660; Fax: 0-882-676-668E-Mail: bron@learningandleisure.com.au20 th Annual Anesthesiology UpdateAug 28 - 30, 2009Napa Valley, CA, United StatesContact: Continuing Medical Education Office, 3560Business Drive, Suite 130, Sacramento, CA 95820Phone: 916-734-5390 / 866-263-4338 / 866-CME-4EDUE-Mail: cmereg@ucdavis.eduClinical Endocrinology for Primary Care PhysiciansAug 28 - 30, 2009Monterey, CA, United StatesContact: Linda MainPhone: 303-798-9682E-Mail: linda@mer.orgInternational Society for Hemodialysis & Hong KongSociety of Nephrology: 2nd Congress of InternationalSociety for Hemodialysis 2009Aug 28 - 30, 2009Hong Kong, Hong KongContact: ISHD 2009 Congress SecretariatPhone: 85-225-599-973; Fax: 85-225-479-528E-Mail: enquiry@ishd2009.orgCardiology, Infectious Diseases, and RespirologyCruiseAug 31 - Sep 13, 2009Athens, GreeceContact: Dr. Martin GerretsenPhone: 1-888-647-7327 Fax: 1-888-547-7337E-Mail: cruises@seacourses.comEBA 2009 - Europena Burns Association CongressSept 02 - 05, 2009Lausanne, SwitzerlandContact: Gerald HowardPhone: 41-0-223-399-635; Fax: 41-0-223-399-601E-Mail: gerald.howard@mci-group.comEuropean Society for Paediatric Nephrology: 42 ndAnnual Scientific Meeting ESPN 2009. A JointMeeting with the Renal AssociationSep 02 - 05, 2009Birmingham, EnglandUnited KingdomContact: ESPN Conference OfficePhone: 44-8-704-584-138; Fax: 44-8-704-429-940E-Mail: ESPN2009@mci-group.com6 th European Congress on Tropical Medicine andInternational HealthSep 06 - 10, 2009Verona, ItalyContact: Stephane TalboomPhone: 41-22-74-156-60; Fax: 41-22-74-156-64E-Mail: info@tropverona.orgInfectious Disease Conference CruiseSep 06 - 13, 2009Rome, ItalyContact: Continuing Education, Inc.Phone: 1-800-422-0711; Fax: 727-522-8304E-Mail: Sandra@continuingeducation.netPharmacokinetics for the Pharmaceutical andBiomedical ScientistalSep 06 - 15, 2009Msida, MaltaContact: NAPhone: +356 32902845; Fax: +356 320281E-Mail: janmif@um.edu.mtEuropean Surgical Institute: Minimally InvasiveTechniques in GynaecologySep 07 - 10, 2009Norderstedt, GermanyContact: European Surgical InstitutePhone: 49-0-4-052-973-200 Fax: 49-0-4-052-973-209E-Mail: info@esi-online.de

June 2009KUWAIT MEDICAL JOURNAL 175Australasian HIV/AIDS Conference 2009 - 21 stAustralasian Society for HIV Medicine ConferenceSep 09 - 12, 2009Brisbane, QLD, AustraliaContact: Australasian Society for HIV MedicinePhone: 61-282-040-770; Fax: 61-292-124-670E-Mail: conferenceinfo@ashm.org.auESRA- 28 th Annual ESRA Congress - EuropeanSociety of Regional Anaesthesia and Pain TherapySep 09 - 12, 2009Salzburg, AustriaContact: Liraz BregmanPhone: 41-229-080-488; Fax: 41-227-322-850E-Mail: esra2009@kenes.comEuropean Society for Dermatological Research 39 thAnnual ESDR MeetingSep 09 - 12, 2009Budapest, HungaryContact: Meeting OrganiserPhone: 41-223-214-890; Fax: 41-223-214-892E-Mail: office@esdr.orgPractical Surgical Pathology SymposiumSep 10 - 12, 2009Rochester, MN, United StatesContact: Mayo Clinic Medical Education OfficePhone: 904-953-7114 / 507-284-2509 / 480-301- 4580;Fax: 904-953-2954 / 507-284-0532 / 480-301-8323E-Mail: cme-jax@mayo.edu / cme@mayo.edu / mcs.cme@mayo.eduCardiothoracic Imaging UpdateSep 11 - 13, 2009Quebec City, QC, CanadaContact: Brenda LewickiPhone: 613-798-5555 ext 16-894E-Mail: info@ottawaradcme.comCalifornia Society of Dermatology & DermatologicSurgery 2009 CalDerm Annual Meeting Sep 11 - 13,2009San Diego, CA, United StatesContact: Meeting OrganiserPhone: 916-498-1712; Fax: 916-244-0330E-Mail: membership@calderm.org13 th Congress of the European Federation ofNeurological Societies - EFNS 2009Sep12 - 15, 2009Florence, ItalyContact: Liraz BregmanPhone: 41-229-080-488; Fax: 41-229-080-850E-Mail: efns09@kenes.com4 th All African Congress of AnaesthesiologistsSep 12- 17, 2009Nairobi, KenyaContact: Dr. Jane KabutuPhone: 254-0-202-738-327; Fax: 254-202-738-327E-Mail: jkabutu@aaackenya09.org2 nd European Congress of ImmunologySept 13 - 16, 2009Berlin, GermanyContact: Congress SecretariatE-Mail: eci2009registration@kit-group.org38 th Annual Meeting of the American College ofClinical PharmacologySept 13 - 15, 2009San Antonio, TX, United StatesContact: American College of Clinical Pharmacology,3 Ellinwood Court, New Hartford, NY 13413-1105Phone: 315-768-6117 Fax: 315-768-6119E-Mail: linda@accp1.org, tami@accp1.org19 th World Congress on Ultrasound in Obstetrics andGynecologySep 13 - 17, 2009Hamburg, GermanyContact: Congress SecretariatPhone: 44-0-2-074-719-955; Fax: 44-0-2-074-719-959E-Mail: congress@isuog.orgThe 8 th Congress of the Baltic Association ofDermatovenereologistsSept 17- 19, 2009Vilnius, LithuaniaContact: Vita GircytePhone: 37-0-52-051-350; Fax: 37-0-52-051-340E-Mail: info@aimbaltic.ltNICE Spine Course 2009Sep 17 - 19, 2009Nice, FranceContact: Christina LoichtPhone: 0-492-073-576; Fax: 0-492-073-586E-Mail: christina@impact-events.netEuropean Course on Laryngology and PhonosurgerySept 17 - 19, 2009Gießen, GermanyContact: HNO-Klinik Gießen, Klinikstrasse 29, 35390GießenPhone: -419-943-701; Fax 496-419-943-709E-Mail: christoph.arens@hno.med.uni-giessen.deThe 12 th International Congress of Pediatric Hepatology,Gastroenterology and NutritionSep 22 - 25, 2009Sharm El-Sheikh, EgyptContact: Mortada El-ShabrawiPhone: 20-123-133-705; Fax: 20-237-619-012E-Mail: mortada_elshabrawi@yahoo.com

176Forthcoming Conferences and Meetings March 2009Royan International Twin Congress. 10th Congress onReproductive Biomedicine5 th Congress on Stem Cell Biology and TechnologySep 23 – 25, 2009Tehran, IranContact: Congress SecretariatPhone: 98 21 22305236; Fax: 98 21 22306481E-Mail: congress@royaninstitute.org2009 - Primary Care Sports MedicineSep 23 - 25, 2009Burlington, VT, United StatesContact: Continuing Medical Education OfficePhone: 802-656-2292E-Mail: uvmcme@uvm.eduWorld Psychiatric Association Regional MeetingSep 24 - 26, 2009Abuja, NigeriaContact: Dr. Oye GurejeE-Mail: ogureje@comui.edu.ngThe 7 th Pediatric Intensive Review CourseSep 26 - Oct 01, 2009Riyadh, Saudi ArabiaContact: Dr. Abdullah Al-DowaishPhone: 966-1-442-7763; Fax: 966-1-442-7784E-Mail: mdatu@kfshrc.edu.saThe 7 th Greek Legal and Medical ConferenceSep 26 - Oct 02, 2009Komenno, Bay, GreeceContact: Miss Eugenia MitrakasPhone: 61-396-902-033; Fax: 61-396-962-937E-Mail: eugenia@greekconference.com.au35 th European Congress of CytologySep 27 - 30, 2009Lisbon, PortugalContact: Congress Secretariat c/o Forum d’IdeiasPhone: 351-212-189-393; Fax: 351-212-189-392E-Mail: cytologylisboa2009@forumdideias.com1 st PANARAB Conference on Thoracic, Cardiac andVascular SurgerySept 29 - Oct 01, 2009Amman, JordanContact: Abdullah Al-Qudah, MDPhone: 962-795-590-788; Fax: 96-264-652-723E-Mail: al_qudah_as@hotmail.com2009 Meeting of the International ContinenceSocietySept 30 - Oct 04, 2009San Francisco, CA, United StatesContact: Meeting OrganiserE-Mail: arstone@ucdavis.eduThe American Society of Dermatopathology ASDP46 th Annual MeetingOct 01- 04, 2009Chicago, IL, United StatesContact: Meeting OrganiserPhone: 847-400-5820; Fax: 847-480-9282E-Mail: ksantos@asdp.org4 th Annual AAOS Orthopaedic Practice ManagementCourseOct 02 - 04, 2009Rosemont, IL, United StatesContact: Customer ServicePhone: 1-800-626-6726/1-847-823-7186; Fax: 847-823-8125E-Mail: custserv@aaos.orgMichigan Ear Institute Temporal Bone SurgicalDissection CourseOct 05 - 09, 2009Farmington Hills, MI, United StatesContact: OrganiserPhone: 248-865-4444; Fax: 248-865-6161Endourological Society: 27 th World Congress onEndourology and SWL (WCE 2009)Oct 06 - 10, 2009Munich, GermanyContact: Meeting OrganiserPhone: 49-210-296-920; Fax: 492-102-969-230E-Mail: beate.ruloff@ruloff.de18 th Congress of the European Academy ofDermatology and Venerology (EADV)Oct 07 - 11, 2009Berlin, GermanyContact: EADV OfficePhone: 322-650-0090; Fax: 322-650-0098E-Mail: office@eadv.orgPediatric and Adolescent Medicine Update for thePrimary Care PhysicianOct 09 - 21, 2009Southampton, England, United KingdomContact: Eileen Tener, ACCPhone: 813-333-6878E-Mail: ETener@CruisersParadise.comThe 50 th Annual Meeting of the European Societyfor Pediatric Research - ESPR 2009Oct 09 - 12, 2009Hamburg, GermanyContact: Liraz BregmanPhone: 41-229-080-488; Fax: 41-227-322-850E-Mail:espr09@kenes.com

June 2009KUWAIT MEDICAL JOURNAL 177Allergy and Immunology Conference CruiseOct 10 - 17, 2009Honolulu, HI, United StatesContact: Continuing Education, Inc.Phone: 1-800-422-0711; Fax: 727-522-8304E-Mail: Sandra@continuingeducation.net8 th International Congress on Coronary ArteryDisease - ICCAD 2009Oct 11 - 14, 2009Prague, Czech RepublicContact: Liraz BregmanPhone: 41-229-080-488; Fax: 41-227-322-850E-Mail: coronary@kenes.com16 th International Meeting of the European Societyof Gynaecological Oncology: ESGO 2009Oct 11- 15, 2009Belgrade, SerbiaContact: Natalie ShabiPhone: 41-229-080-488; Fax: 41-227-322-850E-Mail: wccs2009@kenes.com37 th Annual Meeting of the International Societyfor Pediatric NeurosurgeryOct 11- 15, 2009Los Angeles, CA, United StatesContact: Gordon MccombE-Mail: gmcomb@chla.usc.eduThe 4 th International Congress on PulmonaryDiseases, Intensive Care and TuberculosisOct 12 - 15, 2009Tehran, Islamic Republic of IranContact : Maliheh BitarafPhone: 982-120-109-507; Fax: 982-120-109-484E-Mail: fic@nritld.ac.irChild Neurology Society (CNS) 38 th AnnualMeeting.Oct 14 - 17, 2009Loiusville, KY, United StatesContact: CNS National Office, 1000 West CountyRoad E, Suite 290 Saint Paul, MN 55126Phone: 651-486-9447; Fax: 651-486-9436E-Mail: nationaloffice@childneurologysociety.orgTwenty-First Century Obstetrics and Gynecology (InConjunction with the ACOG District I and III AnnualMeeting)Oct 16 - 18, 2009Orlando, FL, United StatesContact: American College of Obstetricians andGynecologists, 409 12th St., S.W., PO Box 9692Phone: 202-638-5577E-Mail: coding@acog.org / meetings@acog.org4 th Trends in Medical MycologyOct 18 - 21, 2009Athens, GreeceContact: Rob ZikkenheimerPhone: 31-736-901-415 Fax: 31-736-901-417E-Mail: r.zikkenheimer@congresscare.comInternational Workshop “Current Problems in AllergenVaccines Development and Manufacturing”Oct 18 - 23, 2009Varadero, CubaContact: Dr Alexis LabradaPhone: 53-47-682-441; Fax: 53-78-831-144E-Mail: labrada@biocen.cuBreast Imaging CairoOct 21- 24, 2009Cairo, EgyptContact: Dr Norran H SaidPhone: 20-123-938-584; Fax: 20-237-602-536E-Mail: contact@eswih.org3 rd Thyroid Neoplasms ConferenceOct 21 - 24, 2009Sante Fe, NM, United StatesContact: Conference ManagementPhone: 713-792-2223; Fax: 713-794-1724E-Mail: register@mdanderson.orgLymphoma and Myeloma 2009: An InternationalCongress on Hematologic MalignanciesOct 22 - 24, 2009New York, NY, United StatesContact: Customer ServicePhone: 770-751-7332; Fax: 770-751-7334E-Mail: meetings@imedex.com8 th Annual Symposium on Advances in Breast MRIOct 22 - 24, 2009Las Vegas, NV, United StatesContact: Stanford Radiology Continuing MedicalEducation Program 480 California Avenue, Suite 301,Palo Alto, CA 94306 USAPhone: 1-888-556-2230 / 1 650 473-5052; Fax: 1 650 473-5062E-Mail: radiologycme@med.stanford.eduAAOS Knee Arthroplasty: Uni, Total & RevisionInsights, New Techniques - What You Need toKnowOct 22 - 24, 2009Rosemont, IL, United StatesContact: Customer ServicePhone: 1-800-626-6726 / 1-847-823-7186; Fax: 847-823-8125E-Mail: custserv@aaos.org

178Forthcoming Conferences and Meetings March 20093 rd Annual Urology TodayOct 22 - 25, 2009City: Asheville, NC, United StatesContact: Office of Continuing Education, MedicalCenter Blvd, Winston-Salem, NC 27157Phone: 336-713-7755; Fax: 336-713-7702E-Mail: rnhoc@wfubmc.eduACG 2009: American College of GastroenterologyAnnual Scienitfic Meeting and PostgraduateCourseOct 23 - 28, 2009San Diego, CA, United StatesContact: ACG OfficePhone: 301-263-90002009 American Academy of Ophthalmology Jointmeeting with the Pan-American Association ofOphthalmology (PAAO)Oct 24 - 27, 2009San Francisco, CA, United StatesContact: American Academy of OphthalmologyPhone: 415-447-0320E-Mail: meetings@aao.orgThe 3 rd World Congress on Controversies inNeurologyOct 24 - 26, 2009Prague, Czech RepublicContact: Organizing SecretariatPhone: 00-97-235-666-166E-Mail: cony@comtecmed.com8 th International Congress on Endocrinology andMetabolismOct 27 - 30, 2009Tehran, IranContact: Dr.H.DelshadPhone: 98-2-122-418-931; Fax: 98-2-122-418-931E-Mail: info@endocrine.ac.ir20 th Annual Coronary InterventionsOctober 28, 2009 - October 30, 2009San Diego, CA, United StatesContact: Gretchen PloenPhone: 858-652-5400; Fax: 858-652-5565E-Mail: Med.edu@scrippshealth.orgJOPEOI European Indian Ocean PerinatologyCongress / Journées Obstétrico-Pédiatriques EuropeOcéan IndienOct 29 - 31, 2009Antananarivo, MadagascarContact: Dr. K. DE BARGOUPhone: 33-607-686-118; Fax: 33-143-839-985E-Mail: kambarg@orange.frMichigan Ear Institute Temporal Bone SurgicalDissection CourseNov 02 - 06, 2009Farmington Hills, MI, United StatesContact: Meeting OrganiserPhone: 248-865-4444; Fax: 248-865-6161American College of Phlebology 23 rd AnnualCongressNov 05 - 08, 2009Palm Desert, CA, United StatesContact: Meeting OrganiserPhone: 246-6800; Fax: 510-346-6808E-Mail: ddeponzi@acpmail.orgAAOS Spinal SurgeryNov 05 - 07, 2009Rosemont, IL, United StatesContact: Customer ServicePhone: 1-800-626-6726 / 1-847-823-7186; Fax: 847-823-8125E-Mail: custserv@aaos.orgInternational Society for Dermatologic Surgery 30 thAnnual Meeting of the ISDSNov 05 - 08, 2009Vienna, AustriaContact: Meeting OrganiserPhone: 49-61-519-518-892; Fax: 49-61-519-518-893E-Mail: info@isdsworld.com5 th International Congress on MyeloproliferativeDisorders and Myelodysplastic SyndromesNov 05 - 07, 2009New York, NY, United StatesContact: Customer ServicePhone: 770-751-7332; Fax: 770-751-7334E-Mail: meetings@imedex.com17 th Annual Trauma/Surgical Critical CareSymposiumNov 06- 09, 2009Indianapolis, IN, United StatesContact: Indiana University School of Medicine,Division of Continuing Medical Education, Attn:REGISTRAR, 714 N. Senate Ave, EF 200, Indianapolis,IN 46202Phone: 317-274-8353 / 888-615-8013; Fax: 317-274-4638E-Mail: marmin@iupui.eduAmerican College of Allergy, Asthma and ImmunologyAnnual Meeting 2009Nov 06 - 11, 2009Miami Beach, FL, United StatesContact: Meeting OrganiserPhone: 847-427-1294; Fax: 847-427-1200E-Mail:mail@acaai.org / meetings@acaai.org

June 2009KUWAIT MEDICAL JOURNAL 1793 rd Asia pacific Congress on Controversies in Obstetrics,Gynecology and infertilityNov 12- 15, 2009Bangkok, ThailandContact: Congress SecretariatPhone: 97-235-666-166E-Mail: cogi@comtecmed.comThe Arthroscopy Association of North America 2009 FallCourseNov 12 - 15, 2009Palm Desert, CA, United StatesContact: Arthroscopy Association of North AmericaPhone: 847-292-2262; Fax: 847-292-2268E-Mail: info@aana.org2 nd International Congress on Exacerbations of AirwayDisease (ICEAD2)Nov 13 - 15, 2009Los Cabos, MexicoContact: Cathryn MacraePhone: 212-988-7732; Fax: 212-717-1222E-Mail: themacraegroup@comcast.netEmergency Medicine UpdateNov 15 - 22, 2009Miami, FL, United StatesContact: Eileen Tener, ACCPhone: 813-333-6878E-Mail: ETener@CruisersParadise.comThe 3 th Iranian Asthma MeetingNov 17 - 19, 2009Tehran, IranContact: Iranian Society of Asthma & AllergyPhone: 982-166-938-545; Fax: 982-166-428-995E-Mail: isaacong@tums.ac.ir11 th World Congress on Pediatric Dermatology (WCPD2009)Nov 17 - 20, 2009Bangkok, ThailandContact: Liraz BregmanPhone: 00-41-229-080-488; Fax: 00-41-227-322-850E-Mail: wcpd@kenes.comAllergy, Asthma and Clinical Immunology SymposiumNov 17 - 18, 2009Riyadh, Saudi ArabiaContact: Ms Ghalya Al OtaibiPhone: 96-614-647-272 ext. 31-912; Fax: 96-614-424-153E-Mail: gotaibi@kfshrc.edu.sa40 th Union World Conference on Lung HealthDec 03 - 07, 2009Cancun, Quintana Roo, MexicoContact: Conference UnitPhone: 33-143-299-087; Fax: 33-153-108-554E-Mail: cancun2009@theunion.org Quintana RooPain Management Conference CruiseDec 05 - 12, 2009Honolulu, HI, United StatesContact: Continuing Education, Inc.Phone: 1-800-422-0711; Fax: 727-522-8304E-Mail: Sandra@continuingeducation.netXXI World Allergy CongressDec 06 - 10, 2009Buenos Aires, ArgentinaContact: Mariu DenoviPhone: 541-147-779-449; Fax: 541-147-711-536E-Mail: info@worldallergy2009.com2009 Annual Meeting of the American College ofNeuropsychopharmacologyDec 06 - 10, 2009Hollywood, FL, United StatesContact: American College of Neuropsychopharmacology,545 Mainstream Drive Suite 110, Nashville TN 37228Phone: 615-324-2360; Fax: 615-324-2361E-Mail: acnp@acnp.orgMayo Clinic 4 th Annual Practical Course in Dermoscopyand Update on Malignant MelanomaDec 04 - 06, 2009Scottsdale, AZ, United StatesContact: Meeting OrganiserPhone: 480-301-4580; Fax: 480-301-8323E-Mail: king.staci@mayo.edu26 th Annual Advances in Heart DiseaseDecember 11- 13, 2009San Francisco, CA, United StatesContact: UCSF Office of Continuing Medical Education,3333 California Street, Room 450, San Francisco, CA94118Phone: 415-476-4251 / 415-476-5808; Fax: 415-476-0318 /415-502-1795E-Mail: info@ocme.ucsf.eduRheumatology for the Primary Care PhysicianDec 12 - 20, 2009Fort Lauderdale, FL, United StatesContact: Eileen Tener, ACC Phone: 813-333-6878E-Mail:ETener@CruisersParadise.comThe 5 th International Conference on Ocular InfectionsFeb 18 - 21, 2010Palm Beach, FL, United StatesContact: Hila DayanPhone: 41-225-330-948E-Mail: hdayan@paragon-conventions.comMultidisciplinary Head and Neck Cancer SymposiumFeb 25 - 27, 2010Chandler, AZ, United StatesContact: Meeting OrganiserPhone: 703-502-1550; Fax: 703-502-7852

180KUWAIT MEDICAL JOURNAL June 2009WHO-Facts Sheet1. Childhood Diarrhea2. Addressing Mental Disorders in Children3. More People Dying from TB are HIV-infected4. Drug Resistance Could Set Back Malaria Successes5. Climate Change Global Risks, Challenges and DecisionsCompiled and edited byBabichan K ChandyKuwait Medical Journal 2009, 41 (2): 180-1841. CHILDHOOD DIARRHEAAn Inconvenience for Some, A Death Threat forMany; A Major Priority for ResearchThe World Health Organization (WHO), inconsultation with global experts, has identifiedpriorities for research on diarrhea - the cause of almost20% of child deaths globally. The list of researchquestions focus on how to make the best use ofinterventions that are available today, in order to makethe most difference, and ultimately save as manychildren’s lives as possible.Each year, nearly two million children die fromdiarrhea. If childhood diarrhea is not addressedurgently, the world will fail to achieve the fourthMillennium Development Goal (MDG4) target ofreducing child deaths by two-thirds by 2015.Despite the persistently high burden of disease,research into childhood diarrhea has been steadilydecreasing since the 1980s. Funds available for researchinto diarrhea are much lower than those devoted toother diseases that cause comparatively few deaths.While a lot is already known about effectivetreatments for diarrhea, we still lack critical knowledgeon how to make sure the children who need it mostget access to that treatment. WHO has led a processto identify which types of research are most neededand would have greatest impact on mortality. Theresulting top 20% of research questions are mainlytargeted at better understanding the barriers toimplementation, effectiveness and optimizing theuse of available interventions and programmes suchas Oral Rehydration Salts (ORS) and zinc, exclusivebreastfeeding and the integrated management ofchildhood illness. The life-saving treatment fordiarrhea is simple: (ORS) and zinc tablets. ORS isessentially a pinch of salt and a handful of sugar mixedwith clean water. The cost of treating a child with ORSand zinc is approximately US$0.30 (€0.25, £0.20).Children in poor countries get diarrhea on averagefour times per year - each of these episodes can be lifethreatening.ORS and zinc bring the risk of death downto almost zero. More than 50 million children’s liveshave been saved by ORS since its creation 25 years ago,which has meant a large chunk of the adult populationin developing countries is alive today as a result of thischeap, easily prepared solution. The great challengewe now face is how to reach all children who are stillsuffering and dying from diarrhea.For more information contact:Olivia Lawe-Davies,Communications Officer, Child and Adolescent Health andDevelopment, WHO, Geneva. Telephone: +41 22 791 1209;Mobile: +41 794 755 545; Email: lawedavieso@who.int2. ADDRESSING MENTALDISORDERS IN CHILDRENOn the occasion of World Autism Day on 2 nd April,the World Health Organization (WHO) reaffirmed itscommitment to provide technical assistance to memberstates to deliver integrated health services to peoplewith autism and other mental and developmentaldisorders of childhood.Dr Ala Alwan, WHO Assistant Director-Generalfor Noncommunicable Diseases and Mental Healthsaid “ It is a deep concern that the global burden ofdisease attributed to mental disorders continuesAddress correspondence to:Office of the Spokesperson, WHO, Geneva. Tel.: (+41 22) 791 2599; Fax (+41 22) 791 4858; Email: inf@who.int; Web site: http://www.who.int/

June 2009KUWAIT MEDICAL JOURNAL 181to grow, particularly in developing countries. It isessential to prioritize, implement and fund projects onautism spectrum disorders and other mental disordersin children in developing countries.”Currently, the vast majority of children with mentalhealth needs in developing countries do not receiveany treatment or care. The immediate challenge inthese countries is generating sufficient resources forprimary health care to ensure early identificationand treatment of mental disorders among children.These disorders are included as priority conditions inWHO’s Mental Health Gap Action Programme 2008-2013, launched in 2008.“A prioritized agenda for autism and other mentaldisorders in children should generate and strengthenthe evidence base for cost-effective prevention andcontrol strategies. Scaling up of services is the realneed. This will also improve educational attainmentsand will contribute to a better informed and healthiergeneration of children.” said Dr Benedetto Saracenos,Director, Mental Health and Substance Abuse atWHO.World autism awareness day:On 18 December 2007, the United Nations GeneralAssembly adopted resolution 62/139 which declaredApril 2, as World Autism Awareness Day.Autism spectrum disorders are characterized byvarying degrees of impairment in communicationskills and social interactions and in restricted, repetitivepatterns of behaviour. The condition causes disabilitiesthat can be lifelong. Emerging evidence indicates thatearly intervention results in improved outcomes.Autism spectrum disorders and other mentaldisorders among children bring significant economichardships to families, given the lack of health resourcesoften found in developing countries. The stigmatizationand discrimination associated with these illnessesalso remain substantial obstacles to diagnosis andtreatment. The absence of autism spectrum disordersand other mental disorders among children from listsof the leading causes of death has contributed to theirlong-term neglect by both public policy-makers indeveloping countries, as well as donors.UN Convention on the Rights of the Child 1990States parties• recognize that a mentally or physically disabledchild should enjoy a full and decent life, inconditions which ensure dignity, promoteself-reliance, and facilitate the child’s activeparticipation in the community (Article 23.1);• agree that the education of the child shall bedirected to: a. the development of the child’spersonality, talents and mental and physicalabilities to their fullest potential (Article 29 1.a);• shall take all appropriate measures to promotephysical and psychological recovery and socialreintegration of a child victim...re-integrationshall take place in an environment which fostersthe health, peer-respect and dignity of the child(Article 39)Some bare facts about mental disorders:• Mental, neurological and behavioural disordersare common to all countries and cause immensesuffering. People with these disorders are oftensubjected to social isolation, poor quality of lifeand increased mortality. These disorders are thecause of staggering economic and social costs.• Hundreds of millions of people worldwide areaffected by mental, behavioural, neurological andsubstance use disorders. For example, estimatesmade by WHO in 2002 showed that 154 millionpeople globally suffer from depression and 25million people from schizophrenia; 91 millionpeople are affected by alcohol use disordersand 15 million by drug use disorders. A recentlypublished WHO report shows that 50 millionpeople suffer from epilepsy and 24 million fromAlzheimer and other dementias.• In addition to the above figures, many otherdisorders affect the nervous system or produceneurological sequelae. Projections based on aWHO study show that worldwide in 2005, 326million people suffer from migraine; 61 millionfrom cerebrovascular diseases; 18 million fromneuroinfections or neurological sequelae ofinfections. Number of people with neurologicalsequelae of nutritional disorders and neuropathies(352 million) and neurological sequelae secondaryto injuries (170 million) also add substantially tothe above burden.• About 877,000 people die by suicide every year.• One in four patients visiting a health service hasat least one mental, neurological or behaviouraldisorder but most of these disorders are neitherdiagnosed nor treated.• Mental illnesses affect and are affected by chronicconditions such as cancer, heart and cardiovasculardiseases, diabetes and HIV/AIDS. Untreated, theybring about unhealthy behaviour, non-compliancewith prescribed medical regimens, diminishedimmune functioning, and poor prognosis.• Cost-effective treatments exist for most disordersand, if correctly applied, could enable most ofthose affected to become functioning members ofsociety.• Barriers to effective treatment of mental illnessinclude lack of recognition of the seriousness ofmental illness and lack of understanding aboutthe benefits of services. Policy makers, insurance

182WHO-Facts Sheet June 2009companies, health and labour policies, and thepublic at large – all discriminate between physicaland mental problems.• Most middle and low-income countries devoteless than 1% of their health expenditure to mentalhealth. Consequently mental health policies,legislation, community care facilities, andtreatments for people with mental illness are notgiven the priority they deserve.For more information please contact: Dr Shekhar Saxena,Programme Manager, Mental Health and SubstanceAbuse, WHO. Tel:+41.22.791.3625; Email: saxenas@who.int3. MORE PEOPLE DYING FROMTB ARE HIV-INFECTEDWorld TB Day and the launch of the WHO Global TBControl ReportThe total number of new tuberculosis (TB) casesremained stable in 2007, and the percentage ofthe world’s population becoming ill with TB hascontinued the slow decline that was first observed in2004, according to a new report released by the WorldHealth Organization (WHO) in March, 2009.However, Global TB Control Report also revealedthat one out of four TB deaths is HIV related, twice asmany as previously recognized. In 2007, there werean estimated 1.37 million new cases of tuberculosisamong HIV-infected people and 456,000 deaths. Thisfigure reflects an improvement in the quality of thecountry data, which are now more representativeand available from more countries than in previousyears.“These findings point to an urgent need to find,prevent and treat tuberculosis in people living withHIV and to test for HIV in all patients with TB in orderto provide prevention, treatment and care. Countriescan only do that through stronger collaborativeprogrammes and stronger health systems that addressboth diseases,” said Dr Margaret Chan, Director-General of WHO.The report revealed a sharp increase in HIV testingamong people being treated for TB, especially in Africa.In 2004, just 4% of TB patients in the region were testedfor HIV; in 2007 that number rose to 37%, with severalcountries testing more than 75% of TB patients fortheir HIV status.Because of increased testing for HIV amongTB patients, more people are getting appropriatetreatment though the numbers still remain a smallfraction of those in need. In 2007, 200 000 HIV-positiveTB patients were enrolled on co-trimoxazole treatmentto prevent opportunistic infections and 100,000 wereon antiretroviral therapy.“We have to stop people living with HIV fromdying of tuberculosis,” said Mr Michel Sidibe,Executive Director of UNAIDS. “Universal access toHIV prevention, treatment, care and support mustinclude TB prevention, diagnosis and treatment.When HIV and TB services are combined, they savelives.”TB/HIV co-infection and drug-resistant formsof tuberculosis present the greatest challenges, thereport says. In 2007, an estimated 500,000 people hadmultidrug-resistant TB (MDR-TB), but less than 1% ofthem were receiving treatments that was known to bebased on WHO’s recommended standards.Given the current financial crisis, the reportdocuments concerns over an increasing shortage infunding. Ninety-four countries in which 93% of theworld’s TB cases occur provided complete financialdata for the report. To meet the 2009 milestones inthe Stop TB Partnership’s Global Plan to Stop TB,the funding shortfall for these 94 countries has risento about US$ 1.5 billion. Full funding of the GlobalPlan will achieve its aim of halving TB prevalence anddeaths compared with 1990 levels by 2015.For more information contact: Glenn Thomas, WHOStop TB Department. Mobile: +41 795090677; E-mail:thomasg@who.int4. DRUG RESISTANCE COULD SETBACK MALARIA SUCCESSESThe World Health Organization (WHO) announcedin February, 2009 that the emergence of artemisininresistant parasites at the Thai-Cambodia border couldseriously undermine global malaria control effortsachieved.Surveillance systems and research studiessupported by WHO to monitor antimalarial drugefficacy in countries are providing new evidence thatparasites resistant to artemisinin have emerged alongthe border between Cambodia and Thailand whereworkers walk for miles every day to clear forests. Therisk that they may be infected with a drug-resistantform of malaria could set back recent successes tocontrol the disease.Huge strides have been made in the last ten years toreduce the burden of malaria, one of the world’s majorkiller diseases. Strong malaria control programs havehelped lower infection rates in several countries. Therecent shift from failing drugs to the highly effectiveartemisinin-based combination therapies (ACTs) hasbeen a breakthrough. Appropriate treatment withACTs succeeds in more than 90% of cases. However,malaria drug resistance now emerging along the Thai-Cambodia border threatens these gains.

June 2009KUWAIT MEDICAL JOURNAL 183With a US$ 22.5 million grant from the Bill &Melinda Gates Foundation, WHO will endeavour tocontain artemisinin resistant malaria parasites beforethey spread. Resistance along the Thai-Cambodiaborder started with chloroquine, followed by resistanceto sulfadoxine-pyrimethamine and mefloquine, drugsused in malaria control several years ago.Malaria poses a risk to half of the world’s populationand more than one million people die of the diseaseeach year. The malaria map, or the area where it isprevalent, has been reduced considerably over thepast fifty years, but the disease has defied eliminationin areas of intense transmission.Obstacles to malaria control include drug resistance inthe parasite that causes the disease, as well as resistanceof the vector mosquito to insecticides, environmentalfactors and counterfeit medicines. The likelihood ofdrug resistance is increased with the use of singledrug therapy for malaria, especially monotherapies ofartemisinin and its derivatives. Monotherapy fostersresistance because it is easier for the parasite to adaptand eventually overcome the obstacles presented bya single drug than a combination of drugs deliveredtogether. This makes it crucial for monotherapies to beremoved from the market. WHO treatment policy is totreat all cases of uncomplicated falciparum malaria withartemisinin combination therapy (ACTs).The grant will be used to meet the following keyobjectives:• Eliminate artemisinin tolerant parasites bydetecting all malaria cases in target areas andensuring effective treatment• Reduce exposure of the parasites to artemisinin tolimit emergence of resistance• Prevent transmission of artemisinin tolerantmalaria parasites through mosquito control andpersonal protection• Limit the spread of artemisinin tolerant malariaparasites by mobile populations• Support the containment and eliminationof artemisinin tolerant parasites throughcomprehensive behavior change, communication,community mobilization and advocacy• Undertake basic and operational research tofill knowledge gaps and ensure that strategiesapplied are evidence-based• Provide effective management, surveillance andcoordination to enable a rapid and high qualityimplementation of the strategy.For more information, please contact:Ravini Thenabadu, Communications Officer, GlobalMalaria Programme, WHO, Genev. Telephone:+41 22 791 2339, Mobile: +41 79 500 6549, Email:thenabadur@who.int5. CLIMATE CHANGE GLOBAL RISKS,CHALLENGES AND DECISIONSThe health impact of climate change is a criticalissue that policy makers should be aware of whilesetting priorities for action and investment to mitigatethe impact of global climate change. This was the keymessage that WHO experts delivered at the ClimateChange Global Risks, Challenges and Decisionsconference in Copenhagen. Building on research,WHO has identified three key health arguments forstronger climate change measures:1. Climate change has adverse consequences forhealth: as carbon goes up health goes downWHO and the International Panel on ClimateChange (IPCC) data identify risks to human healthas a serious signal of the consequences of climaticdisruption of this planet’s natural processes whichwe depend on for food, water, and physical safety.Health hazards from climate change are diverse,global and difficult to reverse over human time scales.They range from increased risks of extreme weatherevents, to effects on infectious disease dynamics andsea level rise leading to salinization of land and watersources.Based on WHO estimates around 150,000 deathsnow occur in low-income countries each year dueto climate change from four climate-sensitive healthoutcomes – crop failure and malnutrition, diarrhealdisease, malaria and flooding. Almost 85% of theseexcess deaths are in young children.2. Reducing green house gases emissions can bebeneficial to health: as carbon goes down healthgoes upFeasible improvements in environmental conditionscould reduce the global disease burden by more than25%. A large part of the current burden is linked toenergy consumption and transport systems. Changingthese systems to reduce climate change would have theadded benefit of addressing some major public healthissues, including outdoor air pollution (800 000 annualglobal deaths); traffic accidents (1.2 million annualdeaths); physical inactivity (1.9 million deaths); andindoor air pollution (1.5 million annual deaths).3. The health impacts of climate change are feltunequally: effective response requires global actionWhether it’s the 70,000 excess deaths from the heatwave in Europe in 2003, or new malarial deaths in thecentral African highlands, the people at greatest riskfor climate-related health disorders and prematuredeaths are the poor, the geographically vulnerable, thevery young, women and the elderly. The populationsconsidered to be at greatest risk are those living in

184WHO-Facts Sheet June 2009small island developing states, mountainous regions,water-stressed areas, megacities and coastal areas indeveloping countries (particularly the large urbanagglomerations in delta regions in Asia), and also poorpeople and those lacking access to health services.Putting these three health arguments at the centerof discussions at the forthcoming Conference of theParties (COP-15) in Copenhagen later this year wouldensure that in the new post-Kyoto agreement we willall share in the health and economic benefits that canaccrue from countering climate change.WHO will work to achieve four objectives:raising global awareness of these health arguments;making the health case for strong greenhouse gasreductions (mitigation) in all sectors (e.g., transport,housing, energy, agriculture) at national, regional andinternational levels; promoting and supporting thegeneration of scientific evidence; and strengtheninghealth systems to cope with the health threat posedby climate change, including emergencies related toextreme weather events and sea-level rise.WHO’s member States have highlighted theimportance of action to protect health from climatechange. Countries have asked WHO to step upsupport for national and international efforts assessand address the implications of climate change forhealth and health systems.For more information contact: Nada OSSEIRAN;Advocacy & Communications Officer, Public Health &Environment Dept. World Health Organization, Tel:+4122 7914475; Email osseirann@who.intErratumKuwait Medical Journal 2009; 41 (1):31-36Surveillance of Healthcare-Associated Infections in Adult Patients withLeukemia in Kuwait Cancer Control CenterAbeer Aly Omar 1 , Haifaa Al-Mousa 21Infection Control Office, Kuwait Cancer Control Center (KCCC), Ministry of Health, Kuwait2Infection Control Directorate, Ministry of Health, KuwaitThe above paper contained an error in Fig. 1 legends which is corrected as below. The Publisher regretsthe error.4035Number of isolates302520151050CiprofloxacinintermediateCiprofloxacinsensitiveCiprofloxacinresistantE - coliK - pneumoniaeP - aeruginosaP - mirabilisE - cloacaeC - freundiiA- baumanniiIsolated Gram-negative bacteriaB - cepaciaC.meningosepticumS-maltophiliaFig. 1: Susceptibilities of the isolated Gram- negative bacteria to ciprofloxacin. The only sensitive strain of E.coli was isolated fromSST infection