Vol 44 # 4 December 2012 - Kma.org.kw

VOLUME 44 NUMBER 4 

KMJ 

KUWAIT MEDICAL JOURNAL 

DECEMBER 2012 

The Official Journal of The Kuwait Medical Association 

EDITORIAL 

Bariatric Surgery and Hypoglycemia 274 

Bijan Ahrari, Samuel Dagogo-Jack 

REVIEW ARTICLE 

Asthma During Pregnancy: An Immunologic Perspective 277 

Fawaz Azizieh, Raj Raghupathy 

ORIGINAL ARTICLES 

Intravenous Labetalol versus Oral Nifedipine in the Treatment of Severe Hypertension in Pregnancy 287 

Ronita Devi Mayanglambam, Tempe Anjali 

Total Hip Replacement in Nigeria: A Preliminary Report 291 

Nwadinigwe Cajetan Uwatoronye, Anyaehie Udo Ego, Katchy Uchenna Amaechi 

Towards Prevention of Diabetes in Offsprings of Type 2 Diabetic Patients 297 

Amal I El-Sharakawy, Abdulrahman A Abdulla, Fatimah Bendhifari 

Stereotactic Surgery: Diagnostic and Therapeutic Role in the Management of Brain Disorders and Our Experience 

at Ibn Sina Hospital 303 

Hasan Khajah, Aftab Khan, Yousaf Al Awadi, Abbas Ramadan 

Synergy between Dendritic Cell-Based Vaccine and Anti-CD137 Monoclonal Antibody in the Treatment of Mouse 

Renal Cell Carcinoma 308 

Si-Ming Wei, Zhi-Zhong Yan, Jian Zhou 

The Effect of Gene Polymorphisms (ENOS G894T, PON1 and Catalase -262C→T) on Fertility and Sperm Parameters 

in Turkish Men with Clinical Varicocele: A Pilot Study 316 

Cavit Ceylan, Gulay G Ceylan, Hakan Artas, Erdogan Aglamıs, Can Ates, Huseyin Yuce 

INSIGHT 

Ward Mechanical Ventilation (WMV) Audit 322 

Sulaiman Khadadah, Maryam Al-Ali, Mohamed Bahzad 

CASE REPORTS 

Unusual Presentation of Duplex Collecting System: A Case Report 326 

Mukesh Kumar Vijay, Preeti Vijay, Pramod Kumar Sharma 

Double Appendix: Report of a Case 329 

Naorem Gopendro Singh, Hisham Kantoush, Mirza Kahvic 

Oncocytic and Clear Cell Areas in a Solid Pseudopapillary Tumor of the Pancreas: A Case Report 332 

Anuradha C K Rao, Manna Valiathan, Padmapriya Jaiprakash 

Celiac Disease as Uncommon Cause of Death in Type 1 Diabetes Mellitus: A Case Study 335 

Yasser Mohamed Abd Elraouf Ibrahim 

Squamous Cell Carcinoma of the Penis: Magnetic Resonance Imaging Findings 338 

Ibrahim Hamed, Hasan Almutairi, Muneera Al-Adwani 

Unstable Carpometacarpal Dislocation of Ulnar Four Fingers – An Easily Overlooked Injury 341 

Kumar Ashok, Singh Pritish, Badole Chandrashekhar 

Prostatic Adenocarcinoma and Chronic Lymphocytic Leukemia: A Case Report 344 

Abdul-Razzaq A Wraikat, Tariq N Aladily 

KU ISSN 0023-5776 

Continued inside

Vol. 44 No. 4 

C O N T E N T S 

DECEMBER 2012 


Continued from cover 

LETTER TO THE EDITOR 

Individual Cyclooxygenase-2 Inhibitors on the Risk of Peptic Ulcer Disease: A Population-Based Cohort in Taiwan 347 

Shih-Wei Lai, Kuan-Fu Liao, Hsueh-Chou Lai, Chih-Hsin Muo, Fung-Chang Sung, Pei-Chun Chen 

SELECTED ABSTRACTS OF ARTICLES PUBLISHED ELSEWHERE BY 

AUTHORS IN KUWAIT 349 

FORTHCOMING CONFERENCES AND MEETINGS 353 

WHO-FACTS SHEET 362 

1. Diabetes 

2. Epilepsy 

3. Maternal Mortality 

4. Diarrheal Disease 

YEARLY TITLE INDEX 368 

YEARLY AUTHOR INDEX 370 

❈ ❈ ❈ 

Open access for articles at: www.kma.org.kw/KMJ 

Indexed and abstracted in: 

EMBASE (The Excerpta Medica Database) 

Science Citation Index Expanded (also known as SciSearch®) 

Journal Citation Reports/Science Edition 

IMEMR Current Contents (Index Medicus for the Eastern Mediterranean Region; 

available online at: www.emro.who.int/EMRJorList/online.aspx 

THE PUBLICATION OF ADVERTISEMENTS IN THE KUWAIT MEDICAL JOURNAL DOES NOT CONSTITUTE ANY GUARANTEE OR ENDORSEMENT BY THE KUWAIT 

MEDICAL ASSOCIATION OR THE EDITORIAL BOARD OF THIS JOURNAL, OF THE ADVERTISED PRODUCTS, SERVICES, OR CLAIMS MADE BY THE ADVERTISERS. 

THE PUBLICATION OF ARTICLES AND OTHER EDITORIAL MATERIAL IN THE JOURNAL DOES NOT NECESSARILY REPRESENT POLICY RECOMMENDATIONS OR 

ENDORSEMENT BY THE ASSOCIATION. 

PUBLISHER: The Kuwait Medical Journal (KU ISSN-0023-5776) is a quarterly publication of THE KUWAIT MEDICAL ASSOCIATION. 

Address: P.O. Box 1202, 13013 Safat, State of Kuwait; Telephone: 1881181 Fax: 25317972, 25333276. E-mail : kmj@kma.org.kw 

COPYRIGHT: The Kuwait Medical Journal. All rights reserved. No part of this publication may be reproduced without written 

permission from the publisher. Printed in Kuwait. 

INSTRUCTIONS FOR AUTHORS: Authors may submit manuscripts prepared in accordance with the Uniform Requirements for 

Manuscripts Submitted to Biomedical Journals. These Requirements are published in each issue of the Kuwait Medical Journal. 

CHANGE OF ADDRESS: Notice should be sent to the Publisher six weeks in advance of the effective date. Include old and new 

addresses with mail codes. 

KUWAIT MEDICAL JOURNAL (previously The Journal of the Kuwait Medical Association) is added to the list of journals adhering to 

the “Uniform Requirements for Manuscripts Submitted to Biomedical Journals”, American College of Physicians, Independence Mall 

West, Sixth Street at Race, Philadelphia, PA 19106-1572, USA, and can be located at http://www.icmje.org/jrnlist.html

Kuwait Medical Journal (KMJ) 

Published by the Kuwait Medical Association 

Previously known as The Journal of the Kuwait Medical Association (Est. 1967) 

Honorary President: Abdulaziz Al-Babtain 

Ananda S Prasad, USA 

Anders Lindstrand, Sweden 

Andrew J Rees, UK 

Belle M Hegde, India 

Bengt Jeppsson, Sweden 

Charles A Dinarello, USA 

Christian Imielinski, Poland 

Elizabeth Dean, Canada 

Fiona J Gilbert, UK 

Frank D Johnston, UK 

George Russell, UK 

Graeme RD Catto, UK 

EDITORIAL BOARD 

Editor-in-Chief: 

Editor: 

International Editor: 

Associate Editors: 

Fuad Abdulla M Hasan, Kuwait 

Adel Khader Ayed, Kuwait 

Pawan K Singal, Canada 

Adel A Alzayed, Kuwait 

Ignacio Rodriguez, USA 

Michael Redmond, USA 

Mousa Khoursheed, Kuwait 

Mustafa M Ridha, Kuwait 

Nasser Behbehani, Kuwait 

Noura Al-Sweih, Kuwait 

INTERNATIONAL ADVISORY BOARD 

Giuseppe Botta, Italy 

James W Roach, USA 

Jan T Christenson, Switzerland 

Jasbir S Bajaj, India 

John V Forester, UK 

Julian Little, Canada 

Kostadin L Karagiozov, Japan 

Lewis D Ritchie, UK 

Mechael M Meguid, USA 

Mohammed Zayer, Sweden 

Neva E Haites, UK 

Nirmal K Ganguli, India 

Oleg Eremin, UK 

Peter RF Bell, UK 

Philip M Moody, USA 

Raymond M Kirk, UK 

Samuel Dagogo-Jack, USA 

S Muralidharan, India 

Stig Bengmark, Sweden 

Tulsi D Chugh, India 

William A Tweed, Canada 

William B Greenough, USA 

Zoheir Bshouty, Canada 

Abdulla Behbehani 

Abeer K Al-Baho 

Alexander E Omu 

Ali Al-Mukaimi 

Ali Al-Sayegh 

Asmahan Al-Shubaili 

Chacko Mathew 

Eiman M Mokaddas 

Faisal A Al-Kandari 

REGIONAL ADVISORY BOARD 

Habib Abul 

John F Greally 

Joseph C Longenecker 

Kamal Al-Shoumer 

Kefaya AM Abdulmalek 

Khalid Al-Jarallah 

Mazen Al Essa 

Mohamed AA Moussa 

Mousa Khadadah 

Mustafa Al-Mousawi 

Nasser J Hayat 

Nawaf Al-Mutairi 

Nebojsa Rajacic 

Sami Asfar 

Soad Al-Bahar 

Sukhbir Singh Uppal 

Waleed Alazmi 

Waleed A Aldhahi 

EDITORIAL OFFICE 

Editorial Manager : Babichan K Chandy 

Language Editor : Abhay U Patwari 

EDITORIAL ADDRESS 

P.O. Box: 1202, 13013-Safat, Kuwait 

Telephone: (00-965) 1881181(Ext. 201) - Fax: (00-965) 25317972, 25333276 

E-mail: kmj@kma.org.kw 

Website: www.kma.org.kw/KMJ


KUWAIT MEDICAL JOURNAL (KMJ) 

Instructions for Authors 

INTRODUCTION 

Formerly known as ‘The Journal of the Kuwait 

Medical Association’, the Kuwait Medical Journal 

(KMJ) was established in the year 1967. It is the official 

publication of the Kuwait Medical Association and 

published quarterly and regularly in March, June, 

September and December. 

AIMS AND SCOPE 

KMJ aims to publish peer-reviewed manuscripts of 

international interest. Submissions on clinical, scientific 

or laboratory investigations of relevance to medicine and 

health science come within the scope of its publication. 

Original articles, case reports, brief communications, 

book reviews, insights and letters to the editor are 

all considered. Review articles are solicited. Basic 

medical science articles are published under the section 

‘Experimental Medicine’. 

GENERAL 

The Kuwait Medical Journal is a signatory journal to 

the Uniform Requirements for Manuscripts Submitted 

to Biomedical Journals, the fifth (1997) revision of a 

document by the international Committee of Medical 

Journal Editors. A description of important features 

of this document is available on the Lancet website at 

http://www.thelancet.com. Alternatively, you may 

consult the following: N Engl J Med 1997; 336:307-315 or 

order the leaflet “Uniform Requirements for Manuscripts 

Submitted to Biomdical Journals” by writing to the 

Editor of the British Medical Journal (BMJ), BMA House, 

Tavistock Square, London WC1H 9JR, UK. 

To present your original work for consideration, 

one complete set of the manuscript, written in English 

(only), accompanied by tables, and one set of figures 

(if applicable), should be submitted to the Editor. 

Authors should also provide the manuscript on an IBM 

compatible medium such as floppy, CD (in MS word 

format) or pen-drive, if not submitted through e-mail. 

The KMJ editorial office uses Microsoft ‘Office 2007’ 

word processing and ‘Excel’ programs. Details of the 

type of computer used, the software employed and the 

disk system, if known, would be appreciated. 

ELECTRONIC SUBMISSIONS 

A manuscript could be submitted through e-mail 

as an attached word-document (.doc), together with 

a scanned copy of the signed consent letter of the 

author(s). The consent letter could otherwise be faxed 

to the journal office at (00965) 25317972 or 25333276. 

Figures/photographs, photomicrogrphs etc, if any, need 

to be in .jpg/.jpeg/.bmp format with 300 dpi resolution 

and illustrations such as drawings, charts etc., as Excel 

files. All the figures including illustrations should be 

saved as Fig. 1, Fig. 2, etc in running sequence and 

submitted as seperate attachments along with the 

manuscript. Incomplete/improper submissions will not 

be processed, and will be returned. 

Following a peer review process, the corresponding 

author will be advised of the status; acceptance/ 

recommendation for revision or rejection of the paper, in 

a formal letter sent through post and/or e-mail. A galley 

proof will be forwarded to the corresponding author 

through e-mail before publication of the accepted papers 

which must be returned to the journal office within 48 

hours with specific comments, if any. Corrections in the 

galley proof, in case any, must be limited to typographical 

errors, or missing contents only. 

ETHICAL CONSIDERATIONS 

Where human investigations or animal experiments 

are part of the study, the design of the work has to 

be approved by local ethics committee. A relevant 

statement of approval should be added in the ‘Subjects 

and Methods’ section of the manuscript. 

PREPARATION OF THE MANUSCRIPT 

The manuscript should be typed as ‘normal text’ in 

single column, with no hyphenation and no hard returns 

within paragraphs (use automatic word wrap) on A4 size 

(29.7 x 21 cm) paper in single column format, preferably 

in font size no.12. Cell format for paragraphs, artwork 

and/or special effects for the text and/or table(s) are 

not acceptable. Italics shall be used only for foreign/ 

Latin expressions and/or special terminologies such as 

names of micro organisms. Maintain a minimum of 2 cm 

margin on both sides of the text and a 3 cm margin at the 

top and bottom of each page. No part of the text other 

than abbreviations and/or subtitles shall be written in 

upper case (ALL capital). Header/foot notes, end notes, 

lines drawn to separate the paragraphs or pages etc. are 

not acceptable. Do not submit articles written/saved in 

‘Track-change’ mode 

THE ORDER OF THE TEXT 

Original Articles: Title page, Abstract (in structured 

format for original articles) of no more than 250 words, 

Key Words (no more than five), followed by Introduction, 

Subjects (or Materials) and methods, Results, Discussion, 

Conclusion, Acknowledgment/s (if any), References, 

Legends to figures, Tables, and Figures. Each section 

should begin on a new page. 

Review Articles (solicited): Title Page, Abstract of 

no more than 250 words, Key Words (no more than 

five), followed by Introduction, Methods/History 

i

Instructions for Authors 

(if applicable), Literature Review, Conclusion, 

Acknowledgment/s (if any), References, Legends to 

figures (if applicable), Tables, and Figures. Each section 

should begin on a new page. 

Case Studies: Title page followed by Abstract (a 

short summary of not more than 200 words), Key 

Words, Introduction, Case history/report, Discussion, 

Conclusion, Acknowledgment/s (if any), References, 

Legends to figures (if applicable), Tables, and Figures. 

Manuscript should not be paginated Manually, 

instead to use 'insert page number' to the document 

commencing the title page. Main headings, 

introduction, subjects and methods, etc., should be 

placed on separate lines. 

THE TITLE PAGE 

Title page of the submitted manuscript should 

provide a clear title of the study followed by full 

names of all authors, the highest academic degree 

and affiliations if any, the name and address of the 

institution/s where the work was done including 

the department, the name and complete address 

of the corresponding author to whom proofs and 

correspondences shall be sent, duly supported with 

contacts such as telephone, mobile/cell, fax and e- 

mail address. 

STRUCTURED ABSTRACT 

A structured abstract of no more than 250 words 

is required for studies under the section “Original 

Articles”. It must provide an overview of the entire 

paper, and should contain succinct statements on 

the following, where appropriate: Objective(s), 

Design, Setting, Subjects, Intervention(s), Main 

Outcome Measure(s), Result(s), and Conclusion(s). 

(See: Haynes RB, Mulrow CD, Huth AJ, Altman DG, 

Gardner MJ. More informative abstracts revisited. 

Annals of Internal Medicine 1990; 113:69-76). Abstract 

for all other category of submissions shall be a short 

summary not more than 200 words followed by Key 

words and the report or review. 

KEY WORDS 

Key Words should be preferably MeSH terms, and 

shall not duplicate words already in the manuscript 

title; MesH terms can be checked at: . 

TABLES 

Tables typed on separate pages using table format 

should follow the list of references. All tables must be 

numbered consecutively and provided with appropriate 

titles. Contents of the table should be simple, and 

information therein not duplicated, but duly referred 

to, in the main text. Tables recording only a few values 

are not appreciated, since such information can be 

more accurately, usefully and concisely presented as a 

sentence or two in the text. 

DESIGN OF THE WORK 

This should be stated clearly. The rationale behind 

the choice of sample size should be given. Those about 

to begin randomized controlled studies may wish to 

study the CONSORT statement (JAMA 1996; 276:637- 

639). 

ILLUSTRATIONS 

Photographs, Photomicrographs, line drawings, 

transparencies, etc. must be of high quality and supplied 

in original (not photocopies or laser prints) of size 10 x 

15 cm (4” x 6”). Regarding scanned image requirements, 

see ‘Electronic Submissions’. Photographs should fit 

within a print area of 164 x 235 mm. All the figures must 

be numbered serially (Fig 1, Fig 2 etc.) and the figure 

number written on the back side of each (in case of hard 

copy submission) and an arrow drawn to indicate the top 

edge. Figures where patient’s identity is not concealed, 

authors need to submit a written consent of the patient 

or of the patient’s guardian, in case of minors. Figure 

legends/titles should be listed separately after the 

‘References’ section. If any of the tables, illustrations 

or photomicrographs have been published elsewhere 

previously, a written consent for re-production is required 

from the copyright holder along with the manuscript. 

Charts and drawings must be professionally done, duly 

titled and submitted in Excel format as separate files. 

When charts are submitted, the numerical data on which 

they were based should be supplied. 

ABBREVIATIONS 

Except for units of measurement, abbreviations 

should be defined on first use and then applied 

consistently throughout the article. Non-standard 

abbreviations or those appearing fewer than three times 

are not accepted. Use abbreviated units of measure, 

only when used with numbers. Abbreviations used as 

legends in tables and/or figures should be duly defined 

below the respective item. 

NUMBERS AND UNITS 

Measurements of length, height, weight and 

volume must be reported in metric units (meter, 

kilogram, liter etc.) or their decimal multiples. 

Temperature should be given in degrees Celsius. 

Blood pressure in mm Hg, and hematological and 

biochemical measurements in Système International 

(SI) units. For decimal values, use a point, and not a 

comma, e.g., 5.7. Use a comma for numbers > 10,000 

(i.e., 10 3 ) and for numbers < 9999, do not use a comma 

(e.g., 6542). 

DRUG NAMES 

Non-proprietary (generic) names of product 

should be employed. If a brand name for a drug is 

used, the British or international non-proprietary 

(approved) name should be given in parentheses. The 

source of any new or experimental preparation should 

also be given. 

ii


REFERENCES 

Indicate references in the text in sequence using 

Arabic numerals within square brackets and as 

superscripts (e.g., [1, 3-5] etc). Do not quote additional 

data (like part of the title, year of publication etc.) 

from the references with citations in the text, unless 

very important. In the References section, list them 

in the same sequence as they appeared in the text. 

Include the names and initials of all authors if not 

more than six (≤ 6); when authorship exceeds six, use 

et al after three author names. Do not use automatic 

numbering, end notes or footnotes for references. 

References to manuscripts either in preparation or 

submitted for publication, personal communications, 

unpublished data, etc. are not acceptable. 

The author’s name should be followed by the title 

of the article, the title of the journal abbreviated in the 

style of the Index Medicus, the year of publication, the 

volume number and the first and last page numbers. 

References to books should give the title of the book, 

followed by the place of publication, the publisher, the 

year and the relevant pages. Journal titles should be 

abbreviated according to the style in Index Medicus. 

References should be limited to those relating directly 

to the contents of the paper and should be set out in 

Vancouver style, as shown in the examples below. 

EXAMPLES 

Article 

Burrows B, Lebowitz MD. The ß agonists dilemma 

(editorial). N Engl J Med 1992; 326:560-561. 

Book 

Roberts NK. The cardiac conducting system and 

His bundle electrogram. New York, Appleton-Century- 

Crofts, 1981; 49-56. 

Book chapter 

Philips SJ, Whisnam JP. Hypertension and stroke, 

In: Laragh JH, Bremner BM, editors. Hypertension: 

pathophysiology, diagnosis, and management. 2 nd Ed. 

New York: Raven Press; 1995. p 465-478. 

Weblinks 

U.S. positions on selected issues at the third 

negotiating session of the Framework Convention on 

Tobacco Control. Washington, D.C.: Committee on 

Government Reform, 2002. (Accessed June 4, 2003, at 

http://www.house.gov/reform/min/inves.tobacco/ 

index_accord.htm.) 

AUTHORSHIP AND CONSENT FORM 

All authors must give their signed consent for 

publication in a letter of submission, which should 

accompany the manuscript. This letter should contain 

the statement that “This manuscript (write the title) 

is an unpublished work which is not under consideration 

elsewhere and the results contained in this paper have 

not been published previously in whole or part, except in 

abstract form. In consideration of the KMJ accepting my/our 

submission for publication, the author(s) undersigned hereby 

assign all copyrights ownership to the KMJ and shall have 

no right to withdraw its publication. It is expressly certified 

that I/we, have done/actively participated in this study and 

agree to the accuracy of contents of this manuscript. It was 

conducted in accordance with current ethical considerations 

and meets with the committee’s approval. I/all of us agree to 

its publication in KMJ and to the authorship as expressed in 

this declaration and in the title page of our manuscript”. The 

participation of the authors must include: conception, 

design, analysis, interpretation, or drafting the article 

for critically important intellectual content. A change 

in authorship after initial submission of a manuscript 

should be duly supported with a documented request 

from the main author, duly endorsed by the author 

removed and/or-added. No changes in authorship 

will be permitted after acceptance for publication of a 

manuscript. 

More than six authors are not appreciated for an 

article and if listed, the authors may be asked to justify 

the contribution of each individual author. For case 

reports, not more than three authors are acceptable. 

Regarding contributions of authors over the limit 

mentioned above, read the ‘Acknowledgment’ 

section. 

ACKNOWLEDGMENT 

The objective of this section is to disclose affiliations 

with or association of any organization with a direct 

financial interest in the study. Otherwise, it will be 

considered as having no such interests. Contributions 

of others who have involved in the study, such as 

statisticians, radiologists etc. and/or those who have 

assisted in the preparation of the manuscript submitted 

could also be included in this section. 

COPY RIGHT 

The publisher reserves copyright on the Journal’s 

contents. No part may be reproduced, translated or 

transmitted in any form by any means, electronic 

or mechanical, including scanning, photocopying, 

recording or any other information storage and retrieval 

system without prior permission from the publisher. 

The publisher shall not be held responsible for any 

inaccuracy of the information contained therein. 

SUBMISSION OF A MANUSCRIPT 

Manuscripts to be submitted to: 

The Editor 

Kuwait Medical Journal 

P.O. Box: 1202 

Code-13013-Safat 

Kuwait 

Telephone (965) 1881181(Ext. 201) 

Fax (965) 25317972; 25333276 

E-mail: kmj@kma.org.kw 

Website: www.kma.org.kw/KMJ 

iii

December 2012 

KUWAIT MEDICAL JOURNAL 274 

Editorial 

Bariatric Surgery and Hypoglycemia 

Bijan Ahrari, Samuel Dagogo-Jack 

Department of Medicine, Division of Endocrinology, Diabetes and Metabolism, University of Tennessee Health Science 

Center, Memphis, Tennessee, USA 

Kuwait Medical Journal 2012; 44 (4): 274 - 276 

Obesity is a major public health problem in the 

developed and developing regions of the world. 

Using a body mass index (weight in kg divided by 

height in meter squared) of 30 kg/m 2 or greater as the 

cut-off, recent estimates indicate that 36% of adults 

in the United States are obese [1] . The prevalence of 

severe or morbid obesity defined as BMI greater 

than 40 kg/m 2 is rising twice as fast as that of obesity 

and is currently close to 6% of US adult population. 

Obesity is associated with increased risk of morbidity 

and mortality from cardiovascular disease, diabetes, 

respiratory diseases, musculoskeletal disorders and 

neoplastic diseases, among others [2] . Management of 

obesity continues to be challenging, and traditional 

options based on dietary and lifestyle modifications 

seldom result in sustained weight loss. Compared 

with the proliferation of agents for diabetes therapy, 

the pace of drug development for obesity has been 

markedly slower. Moreover, the available agents are 

of limited efficacy [3] , especially with regard to making 

an impact on morbid obesity. 

Superficial interventions such as liposuction 

and removal of subcutaneous abdominal adipose 

tissue do not alter cardio-metabolic risks [4] . By 

contrast, gastric bypass surgery offers long-term 

weight loss associated with significant reduction 

of comorbidities associated with morbid obesity [5] . 

Complete resolution of diabetes occurs in 80% of 

patients while an additional number of patients see 

significant improvement in diabetes [6,7] . This happens 

through both weight-dependent as well as weightindependent 

mechanisms including alteration in 

bile flow, reduction of gastric size, anatomical gut 

rearrangement, vagal manipulation, and alterations 

in enteric hormones [6] . In addition, hyperlipidemia, 

hypertension and obstructive sleep apnea improve in 

70%, 62% and 84% of patients respectively [8] . A large 

cohort study showed a 40% reduction in mortality 

from all causes associated with bariatric surgery [9] . 

Unfortunately, the cosmetic and cardio-metabolic 

benefits of bariatric surgery are achieved at a price of 

significant post-operative morbidity and sometimes 

mortality. However, the outcomes of bariatric surgery 

are generally improving over time with the use of more 

advanced surgical procedures, more careful selection 

of surgical candidates, and the use of specialized 

surgery centers. The overall 30-day mortality 

for bariatric surgical procedures is less than one 

percent [8] . Some of the more common complications of 

bariatric surgery include ventral and internal hernias, 

metabolic and nutritional derangements, marginal 

ulcers, short bowel syndrome, dumping syndrome 

and cholelithiasis [10] . 

An uncommon but potentially serious adverse effect 

of bariatric surgery is recurrent severe hypoglycemia. 

As is well-known, hypoglycemia is rare among nondiabetic 

persons [11] . Although mild asymptomatic 

hypoglycemia can be as seen in up to 50% of postbypass 

patients, severe hypoglycemia accompanied by 

neuroglycopenic symptoms occurs in less than 1% of 

bariatric surgery patients [6,12] . The presentation of mild 

episodes of hypoglycemia is similar to that of the late 

phase of dumping syndrome and usually responds to 

dietary modifications [5] . Although much less frequent, 

episodes of severe hypoglycemia can have dramatic 

clinical presentations, including confusion, seizure 

and coma. Impaired cognitive function, altered 

neuromuscular reflexes, and diminished capacity for 

judgment resulting from neuroglycopenia can lead 

to automobile accidents and machinery injuries. In 

a nationwide Swedish case-control study (one case 

for every 10 matched population control subjects) 

of persons who had undergone gastric bypass (n = 

5,040), vertical banded gastroplasty (n = 4,366), or 

Address correspondence to: 

Samuel Dagogo-Jack, MD, University of Tennessee Health Science Center, 920 Madison Avenue, Suite 300A, Memphis, TN 38163, USA. Tel: 

901-448-5318, Fax: 901-448-5332, E-mail: sdj@uthsc.edu

275 Bariatric Surgery and Hypoglycemia 


gastric banding (n = 2,917) for obesity, the relative 

risk of severe hypoglycemia was five-fold higher in 

the gastric bypass patients compared with controls [12] . 

However, it is noteworthy (and reassuring) that the 

absolute rate of post-bariatric hypoglycemia was 

low (< 1%). Furthermore, the Roux-en-Y gastric 

bypass procedure was more frequently associated 

with hypoglycemia than other forms of bariatric 

surgery, including vertical banding gastroplasty and 

gastric banding [12] . The median time from surgery to 

hypoglycemic symptoms in the Swedish survey was 

2.7 years, consistent with the post-operative latency 

of 1 - 5 years reported in other series [5,13-15] . Of note, 

the frequency of accidental deaths was higher in postbariatric 

surgery patients than in reference cohorts, 

which may indicate undiagnosed hypoglycemia and 

possible underestimation of the number of patients 

with hypoglycemia [12] . 

Classically, hypoglycemia in post-gastric 

bypass patients occurs postprandially or during 

the postabsorptive period (as opposed to during 

fasting). Post-gastric bypass hypoglycemia usually is 

associated with the concurrence of low serum glucose 

levels (typically < 60 mg/dl) and inappropriately 

elevated or measurable levels of insulin and C- 

peptide. The mechanisms behind post-gastric 

bypass hyperinsulinemic hypoglycemia are not 

well-understood. In 2005, Service et al reported a 

series of six patients with symptomatic postprandial 

hyperinsulinemic hypoglycemia that developed on 

average 30 months after gastric bypass surgery [16] . 

Insulinoma was ruled out using imaging studies and 

selective arterial calcium stimulation test [16] . These 

patients then underwent either extensive or spleenpreserving 

distal pancreatectomy, and islet specimens 

were obtained for histological study. The pancreatic 

islet sections obtained from the patients reported by 

Service et al showed evidence of nesidioblastosis 

(hypertrophic beta cells, with enlarged or normalappearing 

islets; small scattered clusters of endocrine 

cells; and ductuloinsular complexes) [16] . The authors 

thus concluded that insulin hypersecretion from 

nesidioblasts was responsible for post-gastric bypass 

hypoglycemia in their patients [16] . However, reexamination 

of the pancreatic histology by Meier 

et al raised doubts about the presence of true 

nesidioblasts [17] . Instead, evidence of increased beta 

cell nuclear diameter was observed in post-gastric 

bypass patients compared with controls [17] . Thus, the 

hypoglycemia in such patients could have arisen from 

a combination of exaggerated “dumping” syndrome 

and increased insulin secretion per beta cell. 

Another mechanism proposed for the insulin 

hypersecretion and possible islet cell proliferation was 

enhanced glucagon-like peptide 1 (GLP-1) secretion 

from L cells in distal ileum, resulting from the rapid 

transit of nutrients following gastric bypass surgery [16] . 

Indeed, studies identifiedexaggeratedGLP-1response 

and attendant insulinotropic and glucagonostatic 

effects as mechanisms for post-gastric bypass 

hypoglycemia [18,19] . Since the mechanisms underlying 

post-bariatric hypoglycemia are not fully understood, 

a standard approach to management has not yet been 

developed. Mild hypoglycemia may be evaluated 

and treated in an outpatient setting. However severe 

hypoglycemia likely requires hospitalization and 

evaluation to rule out etiologies such as insulinoma. 

Without randomized controlled studies, the 

therapeutic approach to severe post-bariatric surgery 

hypoglycemia has been empirical. Management 

usually begins with dietary modification, including 

frequent small meals with low carbohydrate content. 

Pharmacological approaches that have had variable 

success include diazoxide, acarbose, octreotide, and 

calcium channel blockers [6, 13, 20] . For patients with 

refractory hypoglycemia, surgical intervention may 

be warranted, either to reverse the gastric restriction 

procedure or reduce the mass of insulin-secreting 

pancreatic tissue [5- 7, 14- 16] . 

In summary, severe hyperinsulinemic hypoglycemia 

is a rare but serious sequel of gastric bypass surgery. 

It usually presents a few years after the surgery and is 

accompanied by neuroglycopenic symptoms including 

confusion, seizure, syncope or coma. Future studies 

should be directed at unraveling the mechanisms, 

identifying risk factors, and developing optimal 

surveillance and management strategies for post-gastric 

bypass hypoglycemia. While awaiting the results of 

definitive studies on the subject, clinicians should be 

cognizant of the risk of hypoglycemia, educate gastric 

bypass patients on the warning symptoms of impending 

hypoglycemia and appropriate corrective measures. 

REFERENCES 

1. Ogden C, Carroll M, Kit B, Flegal K. Prevalence of 

obesity in the United States, 2009 - 2010. NCHS Data 

Brief 2012; 82:1-7. 

2. Haslam DW, James WP. Obesity. Lancet 2005; 366:1197- 

1209. 

3. Rucker D, Padwal R, Li SK, Curioni C, Lau DC. Long 

term pharmacotherapy for obesity and overweight: 

updated meta-analysis. BMJ 2007; 335:1194-1199. 

4. Klein S, Fontana L, Young VL, et al. Absence of an effect 

of liposuction on insulin action and risk factors for 

coronary heart disease. N Engl J Med 2004; 350:2549- 

2557. 

5. Ritz P, Hanaire H. Post-bypass hypoglycaemia: a review 

of current findings. Diabetes Metab 2011; 37:274-281. 

6. Ashrafian H, Athanasiou T, Li JV, et al. Diabetes 

resolution and hyperinsulinaemia after metabolic 

Roux-en-Y gastric bypass. Obes Rev 2011; 12:257-272.



7. Patti ME, Goldfine AB. Hypoglycaemia following 

gastric bypass surgery-diabetes remission in the 

extreme? Diabetologia 2010; 53:2276-2279. 

8. Buchwald H, Avidor Y, Braunwald E, et al. Bariatric 

surgery: a systematic review and meta-analysis. JAMA 

2004; 292:1724-1737. 

9. Adams TD, Gress RE, Smith SC, et al. Long-term 

mortality after gastric bypass surgery. N Engl J Med 

2007; 357:753-761. 

10. Higa KD, Boone KB, Ho T. Complications of the 

laparoscopic Roux-en-Y gastric bypass: 1,040 patients 

- what have we learned? Obes Surg 2000; 10:509-513. 

11. Dagogo-Jack S. Hypoglycemia in type 1 diabetes 

mellitus: pathophysiology and prevention. Treat 

Endocrinol 2004; 3:91-103. 

12. Marsk R, Jonas E, Rasmussen F, Näslund E. Nationwide 

cohort study of post-gastric bypass hypoglycaemia 

including 5,040 patients undergoing surgery for obesity 

in 1986-2006 in Sweden. Diabetologia 2010; 53:2307- 

2311. 

13. Kellogg TA, Bantle JP, Leslie DB, et al. Post-gastric 

bypass hyperinsulinemic hypoglycemia syndrome: 

characterization and response to a modified diet. Surg 

Obes Relat Dis 2008; 4:492-499. 

14. Patti ME, McMahon G, Mun EC, et al. Severe 

hypoglycaemia post-gastric bypass requiring partial 

pancreatectomy: evidence for inappropriate insulin 

secretion and pancreatic islet hyperplasia. Diabetologia 

2005; 48:2236-2240. 

15. Z’graggen K, Guweidhi A, Steffen R, et al. Severe 

recurrent hypoglycemia after gastric bypass surgery. 

Obes Surg 2008; 18:981-988. 

16. Service GJ, Thompson GB, Service FJ, et al. 

Hyperinsulinemic hypoglycemia with nesidioblastosis 

after gastric-bypass surgery. N Engl J Med 2005; 353:249- 

254. 

17. Meier JJ, Butler AE, Galasso R, Butler PC. 

Hyperinsulinemic hypoglycemia after gastric bypass 

surgery is not accompanied by islet hyperplasia or 

increased beta-cell turnover. Diabetes Care 2006; 

29:1554-1559. 

18. Salehi M, Prigeon RL, D’Alessio DA. Gastric bypass 

surgery enhances glucagon-like peptide 1-stimulated 

postprandial insulin secretion in humans. Diabetes 

2011; 60:2308-2314. 

19. Rabiee A, Magruder JT, Salas-Carrillo R, et al. 

Hyperinsulinemic hypoglycemia after Roux-en-Y 

gastric bypass: unraveling the role of gut hormonal 

and pancreatic endocrine dysfunction. Surg Res 2011; 

167:199-205. 

20. Won JG, Tseng HS, Yang AH, et al. Clinical features and 

morphological characterization of 10 patients with noninsulinoma 

pancreatogenous hypoglycaemia syndrome 

(NIPHS). Clin Endocrinol (Oxf) 2006; 65:566-578.

277 



Review Article 

Asthma during Pregnancy: An Immunologic Perspective 

Fawaz Azizieh 1 , Raj Raghupathy 2 

1 

Department of Mathematics and Natural Sciences, Gulf University for Science and Technology, Kuwait 

2 

Department of Microbiology, Faculty of Medicine, Kuwait University, Kuwait 


ABSTRACT 

Asthma is one of the most common medical conditions 

to complicate pregnancy and represents a significant 

public health issue. Increased maternal complications 

and adverse fetal outcomes are associated with asthma 

during pregnancy. Since asthma can adversely affect the 

outcome of pregnancy, it is important for us to understand 

the mechanisms underlying asthma during pregnancy. 

In general, asthma is characterized by an up-regulated 

systemic production of T-helper 2 (Th2) cytokines. 

Pregnancy also brings about changes in maternal immune 

status making it polarized towards the Th2 phenotype. 

Based on these considerations, we hypothesize that 

pregnancy-induced immune alterations may modify 

allergic mechanisms of asthma and that systemic Th2 

cytokine and chemokine polarization does occur among 

asthmatics to a greater extent during pregnancy. We 

suggest that this is associated with exacerbation of asthma 

during pregnancy. The pathophysiology of asthma during 

pregnancy and the interrelationship between these two 

conditions are reviewed here. 

KEY WORDS: allergy, cytokines, Th1, Th2 

INTRODUCTION 

Asthma is one of the most common medical 

conditions in the world. It is also the most common 

condition affecting the lungs during pregnancy. 

About 7-12% of pregnant women may be affected by 

asthma, making asthma one of the most important 

medical conditions complicating pregnancy [1-3] . 

Asthma influences the outcome of pregnancy; it is 

considered to be a risk factor for several maternal and 

fetal complications, such as asthma exacerbations, 

hospitalizations because of asthma attacks, preeclampsia, 

preterm delivery, cesarean delivery, 

gestational hypertension, low birth weight and a higher 

risk of perinatal mortality [4,5] . Conversely, pregnancy 

also influences the severity of asthma; during 

pregnancy, approximately one third of asthmatic 

women experience exacerbation of their symptoms [6,7] . 

Women who have more severe asthma before 

pregnancy appear more likely to experience worsening 

asthma during pregnancy [8,9] ; prospective studies have 

shown that asthma is more likely to deteriorate during 

pregnancy in women with severe asthma than in those 

with mild asthma [1, 10] . Maintenance of optimal asthma 

control during pregnancy reduces maternal and fetal 

risk for complications [1] . 

Two questions about the interaction of asthma and 

pregnancy are raised by clinicians and patients alike: 

(i) How does pregnancy affect asthma? (ii) How does 

asthma affect the outcome of pregnancy? Asthma is 

an immunologic disease, and pregnancy brings about 

changes in the immune system. Thus, it is of interest to 

view asthma during pregnancy from an immunologic 

perspective. 

While the underlying immunologic mechanisms 

of the interactions between asthma and pregnancy are 

not fully understood, this review summarizes current 

knowledge about the immunology of asthma and 

the immunology of pregnancy, and suggests possible 

mechanisms for immunological interactions between 

asthma and pregnancy. 

ASTHMA 

The immune system surely does a splendid job 

of protecting us from infectious diseases (much of 

the time!). However, inappropriate responses of this 

system can lead to disease. Allergies and asthma are 

common among the outcome of immune dysfunction. 

Discomfort or even distress from common allergies 

may seem minor compared to life-threatening 

problems such as cancer or cardiovascular diseases, 


Raj Raghupathy, PhD, FRCPath, Department of Microbiology, Faculty of Medicine, Kuwait University, Kuwait. Tel: +965 24986527, 

Fax: +965 25332719, E-mail: raj@hsc.edu.kw



but asthma is a serious problem that can cause severe 

difficulties in breathing. The real significance of 

asthma is demonstrated by the number of visits to 

the doctor and to the emergency room and days spent 

in the hospital [11] ; in fact, the number of visits to the 

doctor for hypertension or for pregnancy or general 

examination is each fewer than the number of visits 

for asthma. Indeed, the single most common reason for 

a visit to the emergency room in the Western world is 

an asthma attack. 

Asthma is a worldwide disease and a common one. 

With about 5% of the population in Western countries 

affected, there is no reason to assume that the incidence 

of asthma is lower in Kuwait and the Arabian Gulf. 

In fact, despite low allergen exposure, the pattern of 

childhood asthma in Kuwait follows that described 

in Western communities [12,13] . In Kuwait, the average 

annual admission rate for asthma per 100,000 people 

was 217 in the 1992-1994 period and the mean annual 

death rate per 100,000 people was about 1.6. The 

number of Kuwaiti patients being admitted for asthma 

has increased [13] . A survey made by the Asthma Insights 

and Reality in the Gulf and Near East (AIRGNE) of 

Jordan, Kuwait, Lebanon, Oman and the UAE in 2009 

showed that the comparative population prevalence of 

diagnosed current asthma was high, ranging from 23% 

in Kuwait to 32% in Lebanon [14] . 

IMMUNOPATHOGENESIS OF ASTHMA 

Asthma, also known as reversible obstructive airway 

disease, is characterized by hyperresponsiveness 

of the tracheobronchial tree to respiratory irritants 

and bronchoconstrictor chemicals producing attacks 

of wheezing, dyspnea, chest tightness and cough. 

This chronic respiratory disease is characterized by 

episodes of inflammation and narrowing of small 

airways in response to triggers of asthma. Asthma can 

be triggered by a variety of factors including allergens, 

infections, exercise, abrupt changes in the weather and 

exposure to airway irritants such as tobacco smoke. 

Asthma attacks can vary from mild to life-threatening. 

Asthma can be due to either an allergic response 

or a non-allergic response. Asthma due to an allergic 

response is also known as allergic asthma, extrinsic 

asthma, atopic asthma or immunologic asthma. 50% of 

asthma cases are “allergic-asthma” [4] . Allergic asthma 

is triggered by air-borne or blood-borne allergens 

such as pollen, dust, fumes, insect products or viral 

products. Non-allergic asthma, also known as intrinsic 

or idiopathic asthma, is induced by cold or exercise, 

apparently independently of allergens. However, 

regardless of the presence or absence of allergy, all 

asthmatic patients have the cardinal features of airway 

hyperreactivity, airway obstruction and eosinophilia. 

Allergic asthma in genetically susceptible 

individuals is a result of dysregulated immune 

responses to common environmental antigens. The 

pathogenesis of asthma involves cytokine production 

from T helper 2 (Th2) lymphocytes that in turn 

orchestrate the allergic inflammatory response. Upon 

recognition of an allergen, Th2 cells produce cytokines 

that induce IgE synthesis, activate eosinophils and mast 

cells, and up-regulate expression of adhesion molecules 

on endothelial and epithelial cells. Eosinophils are 

a key component of chronic allergic disease and 

contribute to many of the pathological processes of 

asthma producing molecules that stimulate vasomotor 

activity, bronchoconstriction and mucus secretion. They 

also produce a variety of pro-inflammatory cytokines 

such as tumor necrosis factor (TNF) α, interleukin 

(IL)-1 and IL-6. Anti-allergen IgE antibodies first bind 

to mast cells; subsequent exposure to the allergen 

triggers an IgE-mediated release of mediators that 

may cause an asthmatic attack. IgE-sensitized mast 

cells and basophils secrete several mediators such as 

histamine, leukotrienes and prostaglandins which 

lead to bronchoconstriction, vasodilation and buildup 

of mucus. Subsequently, other mediators including 

eosinophil-chemotactic factor, platelet-activating factor 

and the cytokines IL-4, IL-5 and TNFα are released; 

these mediators increase endothelial cell adhesion 

and recruit inflammatory cells such as eosinophils and 

neutrophils into the bronchial tissue. 

As Th2 reactivity is critical to the development 

of asthma, it is pertinent to elaborate on Th1/Th2 

dichotomy at this point. 

Th1 AND Th2 REACTIVITY 

One of the most significant advances in our 

understanding of immune responses has been the 

delineation of the Th1/Th2 paradigm, which provides 

a framework for understanding how the immune 

system directs responses to different types of pathogens 

and antigens. The two major subsets of CD4 + T helper 

cells, Th1 and Th2, have different patterns of cytokine 

production and different roles in immune responses. 

Each subset induces functions that are effective at 

handling certain types of pathogens, but can be 

ineffective, or may even have pathological effects if 

made in response to other types of pathogens [15, 16] . 

Th1 cells secrete IFNγ, TNFβ, IL-2 and TNFα, the so 

called Th1-type cytokines. Th1-type cytokines activate 

cell-mediated reactions important in resistance to 

infection by intracellular pathogens, and in cytotoxic 

and delayed-type hypersensitivity (DTH) reactions. 

Th2 cells, on the other hand, secrete IL-4, IL-5, IL-6, IL- 

10 and IL-13; these Th2-type cytokines promote robust 

antibody production and are therefore commonly 

found in association with strong antibody responses 

that are important in combating infections with 

extracellular organisms. Which type of reactivity, Th1 

or Th2 is activated first may influence the subsequent

279 



Fig. 2: Role of IL-4 in the development of Th2 reactivity and 

activation of mast cells 

Fig. 1: Cells and cytokines involved in the activation of IgE 

production and activation of mast cells and eosinophils 

outcome; if a particular T cell subset is activated first 

or preferentially in a response, it can suppress the 

development of the other subset. The overall effect is 

that responses are often dominated by either humoral 

(Th2) or cell-mediated (Th1) immunity [15,16] . 

ASTHMA IS A Th2-MEDIATED REACTIVITY 

The generation of Th2 cells and the development 

of Th2-type reactivity are crucially dependent on the 

cytokine IL-4 [15,16] . Th2 development is greatly favored 

once a threshold level of IL-4 is reached. Th2 cells 

provide help to B cells and promote the production 

of relatively large amounts of IgE, IgM and noncomplement 

fixing IgG. In addition, Th2 cells cause 

mast cell growth via the production of IL-4, IL-10 and 

IL-13 and stimulate eosinophil activation via IL-5 [17] . It 

should be emphasized that Th2 cells support allergic 

reactions via the production of the quintessential Th2 

cytokines, IL-4 and IL-5 [17] and also IL-13 [18] . The coculture 

of CD4 + T cells with peripheral blood monocytes 

from atopic asthmatic subjects results in enhanced 

production of IL-4 and IL-5 [19] . The Th2 cytokine IL- 

4 thus plays prominent and indispensable roles in at 

least two stages of an allergic response – first, during 

the development of Th2 cells from its precursor (Fig. 

1) and second, during the activation of mast cells by 

Th2 cells (Fig. 2). The Th2 cytokine IL-13 induces IgE 

production by B cells. 

IL-4 [20] and IL-13 [21] both provide an essential first 

signal for an IgG → IgE switch in B cells. The Th2 

cytokines IL-5 and IL-6 enhance IgE production. 

Interestingly enough, the opposing or antagonistic 

natures of Th1 and Th2 cells ensure that Th1 cells 

do not support IgE synthesis [22] . Furthermore, the 

Th1 cytokines IFNγ and TNFα and the inflammatory 

cytokines IL-8 and IL-23 are inhibitory to IgE 

production. Thus there is clear evidence linking 

activation of allergen-specific Th2 cells to pathology in 

atopic allergic disease [23] and clearly allergic asthma is 

a Th2 phenomenon [24, 25] , while Th1 reactivity actually 

inhibits the development of allergy by inhibiting Th2 

development. As shown in Fig. 1, the Th2 cytokines IL- 

4, IL-5 and IL-10 are involved in the initial sequence of 

steps activating the production of IgE antibodies and 

subsequently in the activation of mast cells to produce 

other mediators which actually bring about allergic 

manifestations. Just as IL-4 is intimately involved in 

the development of Th2 reactivity, it also plays critical 

roles in the activation of mast cells as shown in Fig. 2. 

Levels of the Th2 cytokine IL-13 are increased in 

the airway mucosa of patients with asthma [26] and 

challenge with allergen results in increased levels of 

IL-13 in addition to IL-4. The administration of IL-13 

to mice increases airway eosinophilia and bronchial 

hyperresponsiveness. IL-13 induces inflammation 

by stimulating the expression of chemokines (i.e., 

cytokines that are chemotactic for immune cells) such 

as eotaxin from cells in the airways and also induces 

airway hyperresponsiveness and hypersecretion of 

mucous in the airway epithelium [27] . Atopic asthma 

is characterized by increased production of Th2 

cytokines [1, 28] ; some studies have also reported upregulation 

of systemic Th2 cytokine production 

associated with increased symptoms of allergy [1] . 

Allergy is thus a Th2 phenomenon, and Th2 cytokines 

are intimately involved in the stimulation of allergy 

(Fig. 1 and 2) while Th1 cytokines are actually 

antagonistic to allergy. 

In addition to Th2-type cytokines, other cytokines 

such as IL-8 are also implicated in the development 

of asthma and in the chronic inflammatory 

processes of asthma by contributing to the release of 

inflammatory mediators such as histamine, airway 

remodeling, bronchoconstriction and bronchial 

hyperresponsiveness [29] . Chemokines are important in 

asthma, as they are involved in attracting leukocytes 

from the circulation into the airways [30, 31] . Particularly 

important among these are the chemokines RANTES,



Fig. 3: Etiologies of asthma and the status of asthma during 

pregnancy 

eotaxin and IP-10. RANTES is a powerful eosinophil 

chemoattractant [32] and induces respiratory burst in 

eosinophils [33] . In addition, RANTES is a very effective 

basophil attractant [34] . Eotaxin, a Th2 chemokine, is 

elevated in individuals with asthma and eosinophilia, 

and many studies have evaluated its role in local 

tissues [35] . 

DOES ASTHMA GET BETTER OR WORSE 

DURING PREGNANCY? 

Asthma is the most common chronic condition 

to complicate pregnancy. During pregnancy, 

approximately one third of asthmatic women 

experience an exacerbation [6,7] . Women who have more 

severe asthma before pregnancy appear more likely 

to experience worsening asthma symptoms during 

pregnancy [8,9] ; prospective studies have shown that 

asthma is more likely to deteriorate during pregnancy 

in women with severe asthma (52 - 65%) than in those 

with mild asthma (8 - 13%) [10,36] . 

What happens to asthmatic women when they 

get pregnant? Do the symptoms get better or do they 

get worse? The consensus is that one-third of females 

experience a worsening of asthma during pregnancy, 

one-third improve and one-third remain unchanged [9,37- 

39] 

(Fig. 3). It is unclear whether this is due to changes 

in asthma severity, changes in asthma control or 

exacerbations during pregnancy. A variety of methods 

have been used to obtain this data. Most studies have 

used subjective questionnaires to ascertain the global 

change in asthma experienced during pregnancy, while 

a few studies have obtained data from daily recordings 

of symptom or changes in treatment requirements. 

However, even though only a few studies have 

examined objective measures such as lung function by 

peak spirometry or airway hyperresponsiveness, the 

general trend seems to support the notion that asthma 

symptoms worsen in about 24 - 43% of asthmatic 

women during pregnancy, improve in about 14 - 42% 

of women and are unchanged in 24 - 43% of women. 

For example, Williams examined hospital records 

and reported that asthma gets worse in 24% of 

pregnant women, remains the same in 34% and 

symptoms improve in 42% of pregnant women [40] . 

Similarly, Schatz et al evaluated asthma in 336 pregnant 

women based on the daily symptoms diaries as well 

as by subjective classification of overall changes and 

reported that asthma became worse in 35% of women, 

unchanged in 33% and improved in 28% [38] . The same 

evaluation based on the same criteria was reported more 

recently and the percentages were 36%, 26% and 34% 

respectively [41] . Based on questionnaires on symptoms 

and self-report of overall changes in breathing, many 

others reported that asthma in pregnant women got 

worse in 34 - 41%, remained the same in 24 - 31% and 

improved in 28 - 35% [3,42] . 

In subjects whose asthma worsened, a significant 

increase has been reported in the number of days of 

wheezing and interference with sleep and activity 

between 25 - 32 weeks gestation [38] . In asthmatic 

subjects who felt their asthma improved overall, 

there was a decrease in wheezing with little change 

in interference with sleep or activity between 25 - 32 

weeks gestation. Most subjects who felt their asthma 

worsened during pregnancy actually improved postpartum, 

with significantly fewer days of wheezing 

at 5 - 12 weeks post-partum compared with 29 - 32 

weeks of gestation. Conversely, most subjects who 

felt their asthma improved during pregnancy later 

worsened after delivery, with significantly more days 

of interference of activity in this period compared with 

29 - 36 weeks of gestation. In general, increased asthma 

severity during pregnancy is associated with greater 

morbidity in the mother and newborn [38] . 

In summary then, the paradigm has remained for 

decades that during pregnancy, asthma will worsen in 

one-third of women, remain the same in one-third and 

improve in one-third. 

MECHANISMS OF PREGNANCY-INDUCED 

CHANGES IN ASTHMA 

The mechanisms that contribute to changes in 

asthma during pregnancy are not well understood, 

although increases in maternal circulating hormones, 

altered 2-adrenoreceptor responsiveness or fetal sex 

have been suggested to be involved (Fig. 4). One 

could postulate that elevations in both estrogen 

and progesterone that occur particularly during 

the first trimester may contribute to the severity of 

asthma during pregnancy. Evidence for this can be 

found from the multiple studies that have reported 

associations between higher levels of hormones 

and asthma symptoms. For example, more frequent

281 



Fig. 4: Possible effects of asthma on the outcome of pregnancy 

asthma symptoms have been reported in association 

with menstruation [43] and in association with hormone 

replacement therapy [44,45] . Increased progesterone 

levels, in both animals [46] and humans [44,45] , have 

been associated with worsening asthma symptoms 

in several, but not all studies [47] . Both estrogen and 

progesterone have been shown to up-regulate Th2 

cytokine production both in vitro [48,49] and in vivo [50] . 

The pregnancy-associated rise in serum-free cortisol 

may contribute to improvements in asthma during 

pregnancy [51] , since cortisol has anti-inflammatory 

properties. In addition, estradiol and progesterone 

concentrations increase significantly during 

pregnancy [51] . Progesterone is known to contribute to 

increased ventilation during normal pregnancy [52] and 

is also a potent smooth muscle relaxant [53] and may, 

therefore, be expected to contribute to improved asthma 

during pregnancy. On the other hand, progesterone 

has been shown to induce Th2-type reactivity [54-56] and 

thus pregnancy-associated increase in progesterone 

levels may be postulated to result in an increased Th2- 

bias and thus increased severity of asthma. 

Changes in β2-adrenoreceptor responsiveness 

and airway inflammation as a result of circulating 

progesterone may also contribute to worsening asthma 

during pregnancy [52] . Alterations in asthma associated 

with changes in sex steroid production during the 

menstrual cycle have previously been observed [57] , 

with up to 40% of females experiencing an exacerbation 

around the time of menstruation when progesterone 

and estradiol levels are low [58] . 

The season of pregnancy or delivery was not 

found to affect asthma progression [38] , suggesting 

that allergen exposure may not play a role in asthma 

alterations with pregnancy. Kircher et al [41] suggest 

that factors, such as IgE, which affect both the upper 

and lower airways, may be important in changes that 

occur in asthma during pregnancy. Early studies by 

Gluck and Gluck [37] also showed a correlation between 

increased serum IgE and deteriorating asthma during 

pregnancy. 

An observation that is worth mentioning here in 

terms of mechanisms and clinical relevance, is pertinent 

to the course of asthma during pregnancy. More severe 

asthma tends to worsen during pregnancy, whereas 

less severe asthma tends to remain unchanged or 

tends to improve [38] . The relationship between asthma 

severity classification and subsequent changes in 

asthma during pregnancy was assessed in a study 

on 1,700 pregnant asthmatics [7] . Exacerbations of 

asthma occurred in over half of all severe asthmatics, 

while only 12% of patients with mild asthma had 

exacerbations during pregnancy. 

It is tempting to suggest that perhaps maternal 

immune factors, such as the prevailing Th2 versus 

Th1 cytokine profile, may be one of the determinants 

of whether an asthmatic woman will get better or 

worse when she gets pregnant. Is this possibly due to 

an already heavily Th2-biased immune system tilting 

towards a stronger Th2 bias during pregnancy? 

IMPACT OF ASTHMA ON PREGNANCY 

In addition to the observed effects of pregnancy 

on asthma, it is also well-recognized that women 

with asthma are at increased risk of poor pregnancy 

outcomes [59] . Cases of severe life-threatening asthma 

requiring first trimester termination of pregnancy have 

been reported and an improvement in maternal asthma 

within 24 hours of termination has been observed [60] . 

Epidemiological studies have demonstrated that 

asthmatic females are at increased risk of many poor 

outcomes of pregnancy. Uncontrolled asthma in 

pregnant women can result in perinatal complications 

and exacerbations which can be life-threatening for 

the mother and fetus [37] . 

Increased maternal complications, including 

pre-eclampsia [61] , gestational diabetes [62] , preterm 

labor [63] , intrauterine growth restriction [59] , vaginal 

hemorrhage [64] , placenta previa [65] and cesarean 

delivery [65] have been described. Adverse fetal 

outcomes include increased risk of perinatal 

mortality [66] , intrauterine growth restriction [59] and 

low birth weight [62] . As early as in 1970, Gordon et 

al [66] reported a relatively large number of maternal 

or perinatal deaths in asthmatic patients, which were 

more likely to occur in severe asthmatics. A Californian 

perinatal database study comparing asthmatics to 

controls showed that asthmatics were more at risk 

of cesarean section, pre-term labour or delivery and 

pre-term premature rupture of the membranes. A 

cohort of almost 25,000 pregnant females in Canada 

found a significant association between pre-eclampsia 

and asthma [67] . Greenberger and Patterson [68] found



that those who had been hospitalized with status 

asthmaticus delivered neonates of reduced birth weight 

compared with those who were not hospitalized for 

asthma, suggesting that an acute attack of asthma may 

put the fetus at additional risk, particularly of intrauterine 

growth restriction (IUGR). 

However, it must be conceded that a few studies 

have not found such correlations. Apter et al [69] found 

no evidence of an increased rate of pre-eclampsia, 

pre-term delivery or IUGR in asthmatic adolescents 

compared with general estimates for adolescent 

pregnancies. However, these researchers did report 

that IUGR was significantly more likely in females 

with moderate or severe asthma, who required 

hospitalization during pregnancy, compared to 

subjects with mild asthma, who were not hospitalized 

for asthma during pregnancy. Similarly, Mabie et al [70] 

reported no increased rate of pre-term delivery or low 

birth weight among asthmatic females compared with 

general population rates, which were very high (17.7 

and 6.3%, respectively). Likewise, Tata et al [71] reported 

an increase in risks of miscarriage and cesarean section 

in women with more severe asthma and previous 

asthma exacerbation, but not other complications. 

Despite the few studies showing a lack of 

adverse consequences, a majority of the studies have 

demonstrated associations between asthma and preeclampsia, 

and asthma and low birth weight by both 

historical or prospective cohort and case-control 

studies. A meta-analysis of the association between 

asthma in pregnancy and low birth weight babies 

showed that there was a significantly increased risk of 

low birth-weight babies in asthmatic pregnancies and 

that there was no significant increase in the risk of low 

birth weight with asthma when inhaled corticosteroids 

(ICS) were used [59] . 

There is therefore, a general agreement that severe 

asthma requiring corticosteroid therapy is associated 

with an increased incidence of low birth-weight 

babies and of preterm births [72-74] . Asthma, when 

not treated with inhaled steroids during pregnancy 

was associated with changes in placental function 

that affect fetal development which includes the 

hypothalamic-pituitary axis and growth [16] . In general, 

published data suggest that asthma severity, especially 

with suboptimal control, is associated with adverse 

pregnancy outcomes (Fig. 4) [74] . 

PREGNANCY: A Th2-TYPE SITUATION 

The fetus can be viewed as a sort of a semiallogeneic 

allograft that expresses paternally-derived 

antigens, which under non-pregnant circumstances 

would result in the activation of a “rejection reaction”. 

However, it is postulated that a number of processes 

are activated in concert to protect the fetus and thus 

ensure its survival. These include the separation 

of the maternal and fetal circulations, masking of 

paternal antigens on the trophoblast, endocrinological 

inhibition of adverse maternal immune reactions and 

production of immunomodulatory factors by both the 

mother and fetus. In 1993, Wegmann et al proposed that 

a shift towards Th2-mediated immunity particularly at 

uterine sites during pregnancy inhibits Th1 immune 

responses and prevents the rejection of the fetus by the 

maternal immune system [75] . 

Humoral immune responses are enhanced during 

pregnancy, while cell-mediated immune responses 

and the course of cell-mediated autoimmune disorders 

are down-regulated. Clinical evidence indicates that 

pregnant women undergo immunological changes 

consistent with a weakening of Th1 responses and 

strengthening of Th2 responses [75,76] leading to the 

contention that successful pregnancy probably 

depends on preferential stimulation of Th2 cytokineproducing 

cells. Experiments on mice and evidence in 

humans indicate that humoral responses are enhanced 

during pregnancy, but that there is a down-regulation 

of cell-mediated reactivity, responses to intracellular 

infections and the course of cell-mediated autoimmune 

disorders. These observations are consistent with a 

dampening of pro-inflammatory or Th1 reactivity and 

augmentation of anti-inflammatory or Th2 immunity 

during pregnancy. 

Dudley et al [77] found that cytokine responses by 

activated lymphocytes from pregnant mice are marked 

by a progressive decline in the production of the Th1 

cytokine IL-2 and a concomitant increase in the levels 

of the Th2 cytokine IL-4. In humans, there are reports 

of significantly higher production of IL-10 (a Th2 

cytokine) by mitogen-activated PBMC in pregnant 

women as compared with non-pregnant women [78] . 

Kruse et al [79] reported significantly reduced IL-2 

and IFNγ mRNA expression during normal human 

pregnancy and a shift to a pronounced Th2 status. 

Using flow cytometric techniques on a single cell, 

significantly increased IL-4-producing CD4 + and CD8 + 

T cells were demonstrated in normal pregnant women 

as compared to non-pregnant women. In contrast, 

IFNγ- and IL-2-producing CD4 + and CD8 + T cells were 

significantly reduced in pregnancy, which is suggestive 

of a Th2 shift in pregnancy [80] . Thus, pregnancy is indeed 

a Th2-type phenomenon as proposed by Wegmann et 

al [75] and pregnancy seems to engender a shift towards 

Th2 bias [76] . 

Thus, the two broad lines of evidence described 

above show that both asthma and pregnancy are 

indeed Th2-type situations. Th2 cells and cytokines 

stimulate IgE production and are responsible for the 

activation of mast cells and inflammatory responses in 

asthma [17-21,23-26] . Likewise, pregnancy is associated with 

a dominance of Th2 reactivity and at the same time Th2 

reactivity is conducive to successful pregnancy [75,76] .

283 



Interestingly, immune mechanisms involved in the 

maintenance of asthma-related symptoms are regulated 

by Th2-mediated mechanisms as in normal pregnancy 

which leads us to propose that pregnancy may worsen 

asthma by bringing about a stronger bias towards Th2 

reactivity. However this rather simplistic notion is 

complicated by the fact that the disease becomes worse 

in only about a third of the patients and, not as one 

might predict, in all the patients. 

IMMUNE STATUS IN ASTHMATIC WOMEN WHO 

BECOME PREGNANT 

Pregnancy is proposed to be a state of wide-spread 

lymphocyte activation, but at the same time it may 

blunt lymphocyte activation which characterizes 

bronchial asthma [81] . However, immunological 

changes in asthmatic women during pregnancy are 

not well elucidated. Tamasi et al [82] reported signs of 

pregnancy-induced attenuation of allergic responses 

in asthmatic pregnant women. Activated pools within 

CD4 + and CD8 + T cells were larger, and the number 

of natural killer T (NK-T) cells was increased both 

in non-pregnant asthmatic and in healthy pregnant 

subjects (compared to non-pregnant healthy controls), 

but in well-controlled pregnant asthmatics no further 

lymphocyte activation was observed, suggesting 

that the immunosuppressive effect of uncomplicated 

pregnancy may dull lymphocyte activation which 

characterizes asthma. In addition, as a sign of an 

enhanced T cell apoptosis, higher numbers of cytotoxic 

T cells was detected in healthy pregnant women than in 

healthy non-pregnant women, together with a positive 

correlation between cytotoxic T cell counts and birth 

weights in healthy but not in asthmatic pregnancies. On 

the other hand, in another study on poorly-controlled 

asthmatic pregnant women, a substantial number of 

peripheral IFN-γ-producing cells were detected, and a 

significant negative correlation was revealed between 

the number of IFN-γ-positive T cells and birth weight 

of newborns, suggesting that intrauterine growth 

restriction can be related to active, asthma-associated 

maternal immune reactions [82] . 

Bohacs et al [81] reported an increased prevalence 

of regulatory T (Treg) cells in peripheral blood of 

healthy pregnant women but a lower prevalence of 

Treg cells and an elevated prevalence of NK-T cells 

in pregnant asthmatic women compared to healthy 

pregnant women. They also reported lower effector / 

mem¬ory ratios and higher naive T cell prevalence in 

asthmatic pregnant patients compared to non-pregnant 

asthmatics [83] . 

Analysis of immune cells in the maternal circulation 

indicates that circulating white cells are altered in 

asthmatics when compared to non-asthmatics and that 

these alterations may contribute to worsening asthma 

during pregnancy. Maternal circulating monocyte 

populations were significantly increased in pregnant 

asthmatic women not using inhaled steroids for the 

treatment of their disease [84] . Monocytes play important 

inflammatory roles in asthma, as the precursors to 

macrophages and also through their interaction with 

Th2 lymphocytes, eosinophils and mast cells within 

the lung. Murphy et al [84] examined placental Th2:Th1 

cytokine mRNA ratios and found a significant increase 

in placental Th2:Th1 cytokine mRNA ratios in females, 

as assessed by measuring TNFα (Th1) and IL-5 (Th2) 

mRNA. 

A CYTOKINE LINK BETWEEN ASTHMA AND 

PREGNANCY 

As pregnancy is a Th2-type situation, it is tempting 

to predict that symptoms in asthmatic women may 

become worse when they get pregnant, because 

asthma is also a Th2-type situation. It is a sort of 

an “immunological double whammy”! One might 

speculate that the Th2 predominance seen in pregnancy 

might worsen asthma situations; by corollary then, 

all asthmatic women should have worsened asthma 

symptoms when they become pregnant. However, 

this is not the case; the dogma holds that only about 

33% of asthmatic women have worsened symptoms 

during pregnancy, while approximately 33% actually 

get better! 

There is a lack of studies on longitudinal assessment 

of cytokine bias during and after pregnancy in 

asthmatics that become pregnant as also possible effects 

of changes in cytokine patterns on asthma symptoms 

during pregnancy. Rastogi et al [85] reported a nonsignificant 

trend towards decreased intracytoplasmic 

levels of IFNγ and increased IL-4 levels in pregnant 

asthmatics. Non-asthmatic pregnant women were not 

studied. Interestingly, these researchers demonstrated 

a decline in IP-10/eotaxin ratio over the course of 

pregnancy; this ratio was also shown to be associated 

with worse asthma symptoms. The levels of other 

cytokines were not estimated in this study. Clearly this 

aspect needs to be investigated further. 

Tamasi et al [86] demonstrated increased levels of 

IFNγ-producing T cells in pregnant asthmatics as 

compared to non-pregnant asthmatics. IL-4-producing 

T cells were also increased in number though to a much 

lower extent, leading these researchers to conclude 

that pregnancy in asthmatics leads to a dominant 

IFNγ response. While these results are interesting, it 

should be noted that pregnant non-asthmatics were 

not compared, nor were other cytokines tested. 

CONCLUSION 

The jury is still out; as asthma is characterized 

by increased Th2 polarization, we suggest that 

pregnancy-associated Th2 polarization may contribute 

mechanistically to worse birth outcomes. Our



hypothesis is that asthmatic women who get worse 

during pregnancy have a different cytokine profile 

as compared to asthmatic women who get better 

during pregnancy. We suggest that some asthmatic 

women develop a substantially stronger Th2-bias 

during pregnancy as compared to other asthmatic 

women; and that the former subgroup would have 

worsened asthma symptoms than the latter due to 

the stronger Th2-bias. Further studies are needed to 

elucidate the relationship between immunological 

alterations in Th2 polarization and asthma symptoms 

during and following pregnancy. Closer monitoring 

with early identification and perhaps treatment of 

Th2 polarization may in turn lead to reduced asthma 

symptomatology and perhaps prevention of asthmarelated 

adverse effects on the fetus. 

ACKNOWLEDGMENTS 

Supported by Kuwait University Research grant 

No. MI02/10 

REFERENCES 

1. Leonard C, Tormey V, Burke C, Poulter LW. Allergeninduced 

cytokine production in atopic disease and its 

relationship to disease severity. Am J Respir Cell Mol 

Biol 1997; 17:368-375. 

2. Kwon HL, Belanger K, Bracken MB. Asthma 

prevalence among pregnant and childbearing-aged 

women in the United States: estimates from national 

health surveys. Ann Epidemiol 2003; 13:317-324. 

3. Kurinczuk JJ, Parsons DE, Dawes V, Burton PR. The 

relationship between asthma and smoking during 

pregnancy. Women Health 1999; 29:31-47. 

4. National Center for Health Statistics (NCHS). 

Morbidity and Mortality Report. US Centers for 

Disease Control 2003. 

5. National Center for Health Statistics (NCHS). New 

Asthma Estimates: Tracking Prevalence, Health 

Care and Mortality. Centers for Disease Control and 

Prevention 2001. 

6. Schatz M. The efficacy and safety of asthma 

medications during pregnancy. Semin Perinatol 2001; 

25:145-152. 

7. Murphy VE, Clifton VL, Gibson PG. Asthma 

exacerbations during pregnancy: incidence and 

association with adverse pregnancy outcomes. Thorax 

2006; 61:169-176. 

8. Beck SA. Asthma in the female: hormonal effect and 

pregnancy. Allergy Asthma Proc 2001; 22:1-4. 

9. Fischer JE, Schatz ME. Adverse pregnancy outcomes 

in asthmatic women: A research synthesis from 

published data. J Allergy Clin Immunol 2000; 105: 

S95. 

10. Murphy VE, Gibson P, Talbot PI, Clifton VL. Severe 

asthma exacerbations during pregnancy. Obstet 

Gynecol 2005; 106:1046-1054. 

11. Akinbami LJ, Moorman JE, Liu X. Asthma prevalence, 

health care use, and mortality: United States, 2005- 

2009. Natl Health Stat Report 2011; 32:1-14. 

12. Al-Mousawi MS, Lovel H, Behbehani N, Arifhodzic N, 

Woodcock A, Custovic A. Asthma and sensitization in 

a community with low indoor allergen levels and low 

pet-keeping frequency. J Allergy Clin Immunol 2004; 

114:1389-1394. 

13. Abul AT, Nair PC, Behbehani NA, Sharma PN. Hospital 

admissions and death rates from asthma in Kuwait 

during pre- and post-Gulf War periods. Ann Allergy 

Asthma Immunol 2001; 86:465-468. 

14. Khadadah M, Mahboub B, Al-Busaidi NH, Sliman N, 

Soriano JB, Bahous J. Asthma insights and reality in 

the Gulf and the near East. Int J Tuberc Lung Dis 2009; 

13:1015-1022. 

15. Mosmann TR, Sad S. The expanding universe of T-cell 

subsets: Th1, Th2 and more. Immunol Today 1996; 

17:138-146. 

16. Romagnani S. Human TH1 and TH2 subsets. Eur 

Cytokine Netw 1994; 5:7-12. 

17. Kay AB. The cells and mediators of allergic inflammation. 

Clinical & Experimental Allergy Reviews 2002; 2:8-12. 

18. Punnonen J, Yssel H, de Vries JE. The relative 

contribution of IL-4 and IL-13 to human IgE synthesis 

induced by activated CD4+ or CD8+ T cells. J Allergy 

Clin Immunol 1997; 100:792-801. 

19. Tang CRJ, Li X, Ward C, Bish R, Walters EH. Alveolar 

macrophages from atopic asthmatics, but not atopic 

nonasthmatics, enhance interleukin-5 production by 

CD4+ T cells. Am J Respir Crit Care Med 1998; 57:1120- 

1126. 

20. Del Prete G, Maggi E, Parronchi P, et al. IL-4 is an 

essential factor for the IgE synthesis induced in vitro by 

human T cell clones and their supernatants. J Immunol 

1988; 140:4193-4198. 

21. Larche M. Regulatory T cells in allergy and asthma. 

Chest 2007; 132:1007-1014. 

22. Pene J, Rousset F, Briere F, et al. IgE production by 

normal human lymphocytes is induced by interleukin 

4 and suppressed by interferons gamma and alpha 

and prostaglandin E2. Proc Natl Acad Sci U S A 1988; 

85:6880-6884. 

23. Vercelli D, Jabara HH, Arai K, Yokota T, Geha RS. 

Endogenous interleukin 6 plays an obligatory role in 

interleukin 4-dependent human IgE synthesis. Eur J 

Immunol 1989; 19:1419-1424. 

24. Ozdemir C, Akdis M, Akdis CA. T regulatory cells and 

their counterparts: masters of immune regulation. Clin 

Exp Allergy 2009; 39:626-639. 

25. El Biaze M, Boniface S, Koscher V, et al. T cell activation, 

from atopy to asthma: more a paradox than a paradigm. 

Allergy 2003; 58:844-853. 

26. Humbert M, Durham SR, Kimmitt P, et al. Elevated 

expression of messenger ribonucleic acid encoding 

IL-13 in the bronchial mucosa of atopic and nonatopic 

subjects with asthma. J Allergy Clin Immunol 1997; 

99:657-665. 

27. Kuperman DA, Huang X, Koth LL, et al. Direct effects 

of interleukin-13 on epithelial cells cause airway 

hyperreactivity and mucus overproduction in asthma. 

Nat Med 2002; 8:885-889. 

28. Cho SH, Stanciu LA, Holgate ST, Johnston SL. Increased 

interleukin-4, interleukin-5, and interferon-gamma in 

airway CD4+ and CD8+ T cells in atopic asthma. Am J 

Respir Crit Care Med 2005; 171:224-230.

285 



29. Chung KF, Barnes PJ. Cytokines in asthma. Thorax 

1999; 54:825-857. 

30. Barnes PJ. The cytokine network in asthma and chronic 

obstructive pulmonary disease. J Clin Invest 2008; 

118:3546-3556. 

31. Lukacs NW, Hogaboam CM, Kunkel SL. Chemokines 

and their receptors in chronic pulmonary disease. Curr 

Drug Targets Inflamm Allergy 2005; 4:313-317. 

32. Kameyoshi Y, Dorschner A, Mallet AI, Christophers E, 

Schroder JM. Cytokine RANTES released by thrombinstimulated 

platelets is a potent attractant for human 

eosinophils. J Exp Med 1992; 176:587-592. 

33. Rot A, Krieger M, Brunner T, Bischoff SC, Schall TJ, 

Dahinden CA. RANTES and macrophage inflammatory 

protein 1 alpha induce the migration and activation of 

normal human eosinophil granulocytes. J Exp Med 

1992; 176:1489-1495. 

34. Kuna P, Reddigari SR, Schall TJ, Rucinski D, Viksman 

MY, Kaplan AP. RANTES, a monocyte and T lymphocyte 

chemotactic cytokine releases histamine from human 

basophils. J Immunol 1992; 149:636-642. 

35. Nakayama S, Mukae H, Ishii H, et al. Comparison of 

BALF concentrations of ENA-78 and IP10 in patients 

with idiopathic pulmonary fibrosis and nonspecific 

interstitial pneumonia. Respir Med 2005; 99:1145-1151. 

36. Leonard C, Tormey V, Faul J, Burke CM, Poulter LW. 

Allergen-induced CD30 expression on T cells of atopic 

asthmatics. Clin Exp Allergy 1997; 27:780-786. 

37. Gluck JC, Gluck PA. Asthma controller therapy during 

pregnancy. Am J Obstet Gynecol 2005; 192:369-380. 

38. Schatz M, Harden K, Forsythe A, et al. The course of 

asthma during pregnancy, post partum, and with 

successive pregnancies: a prospective analysis. J Allergy 

Clin Immunol 1988; 81:509-517. 

39. Lao TT, Huengsburg M. Labour and delivery in mothers 

with asthma. Eur J Obstet Gynecol Reprod Biol 1990; 

35:183-190. 

40. Williams DA. Asthma and pregnancy. Acta Allergol 

1967; 22:311-323. 

41. Kircher S, Schatz M, Long L. Variables affecting 

asthma course during pregnancy. Ann Allergy Asthma 

Immunol 2002; 89:463-466. 

42. Beecroft N, Cochrane GM, Milburn HJ. Effect of sex of 

fetus on asthma during pregnancy: blind prospective 

study. BMJ 1998; 317:856-857. 

43. Haggerty CL, Ness RB, Kelsey S, Waterer GW. The 

impact of estrogen and progesterone on asthma. Ann 

Allergy Asthma Immunol 2003; 90:284-291; quiz 91-93, 

347. 

44. Lange P, Parner J, Prescott E, Ulrik CS, Vestbo J. 

Exogenous female sex steroid hormones and risk of 

asthma and asthma-like symptoms: a cross sectional 

study of the general population. Thorax 2001; 56:613- 

616. 

45. Barr RG, Wentowski CC, Grodstein F, et al. Prospective 

study of postmenopausal hormone use and newly 

diagnosed asthma and chronic obstructive pulmonary 

disease. Arch Intern Med 2004; 164:379-386. 

46. Hellings PW, Vandekerckhove P, Claeys R, Billen J, 

Kasran A, Ceuppens JL. Progesterone increases airway 

eosinophilia and hyper-responsiveness in a murine 

model of allergic asthma. Clin Exp Allergy 2003; 

33:1457-1463. 

47. Xu B, Pekkanen J, Husman T, Keski-Nisula L, Koskela P. 

Maternal sex hormones in early pregnancy and asthma 

among offspring: a case-control study. J Allergy Clin 

Immunol. 2003; 112:1101-1104. 

48. Piccinni MP, Romagnani S. Regulation of fetal allograft 

survival by a hormone-controlled Th1- and Th2-type 

cytokines. Immunol Res 1996; 15:141-150. 

49. Salem ML. Estrogen, a double-edged sword: 

modulation of TH1- and TH2-mediated inflammations 

by differential regulation of TH1/TH2 cytokine 

production. Curr Drug Targets Inflamm Allergy 2004; 

3:97-104. 

50. Giltay EJ, Fonk JC, von Blomberg BM, Drexhage HA, 

Schalkwijk C, Gooren LJ. In vivo effects of sex steroids 

on lymphocyte responsiveness and immunoglobulin 

levels in humans. J Clin Endocrinol Metab 2000; 85:1648- 

1657. 

51. Nelson-Piercy C. Asthma in pregnancy. Thorax 2001; 

56:325-328. 

52. Tan KS, Thomson NC. Asthma in pregnancy. Am J Med 

2000; 109:727-733. 

53. Lye SJ, Porter DG. Demonstration that progesterone 

‘blocks’ uterine activity in the ewe in vivo by a direct 

action on the myometrium. J Reprod Fertil 1978; 52:87-94. 

54. Piccinni MP, Giudizi MG, Biagiotti R, et al. Progesterone 

favors the development of human T helper cells 

producing Th2-type cytokines and promotes both 

IL-4 production and membrane CD30 expression in 

established Th1 cell clones. J Immunol 1995; 155:128- 

133. 

55. Choi BC, Polgar K, Xiao L, Hill JA. Progesterone 

inhibits in-vitro embryotoxic Th1 cytokine production 

to trophoblast in women with recurrent pregnancy loss. 

Hum Reprod 2000; 15:46-59. 

56. Raghupathy R, Al Mutawa E, Makhseed M, Azizieh F, 

Szekeres-Bartho J. Modulation of cytokine production 

by dydrogesterone in lymphocytes from women with 

recurrent miscarriage. BJOG 2005; 112:1096-1101. 

57. Vrieze A, Postma DS, Kerstjens HA. Perimenstrual 

asthma: a syndrome without known cause or cure. J 

Allergy Clin Immunol 2003; 112:271-282. 

58. Tan KS. Premenstrual asthma: epidemiology, 

pathogenesis and treatment. Drugs 2001; 61:2079-2086. 

59. Murphy VE, Gibson PG, Smith R, Clifton VL. Asthma 

during pregnancy: mechanisms and treatment 

implications. Eur Respir J 2005; 25:731-750. 

60. Shanies HM, Venkataraman MT, Peter T. Reversal 

of intractable acute severe asthma by first-trimester 

termination of pregnancy. J Asthma 1997; 34:169-172. 

61. Martel MJ, Rey E, Beauchesne MF, et al. Use of inhaled 

corticosteroids during pregnancy and risk of pregnancy 

induced hypertension: nested case-control study. BMJ 

2005; 330:230. 

62. Kallen B, Rydhstroem H, Aberg A. Asthma during 

pregnancy - a population based study. Eur J Epidemiol 

2000; 16:167-171. 

63. Schatz M, Dombrowski MP, Wise R, et al. Spirometry is 

related to perinatal outcomes in pregnant women with 

asthma. Am J Obstet Gynecol 2006; 194:120-126.



64. Alexander S, Dodds L, Armson BA. Perinatal outcomes 

in women with asthma during pregnancy. Obstet 

Gynecol 1998; 92:435-440. 

65. Demissie K, Breckenridge MB, Rhoads GG. Infant and 

maternal outcomes in the pregnancies of asthmatic 

women. Am J Respir Crit Care Med 1998; 158:1091- 

1095. 

66. Gordon M, Niswander KR, Berendes H, Kantor AG. 

Fetal morbidity following potentially anoxigenic 

obstetric conditions. VII. Bronchial asthma. Am J Obstet 

Gynecol 1970; 106:421-429. 

67. Lehrer S, Stone J, Lapinski R, et al. Association between 

pregnancy-induced hypertension and asthma during 


68. Greenberger PA, Patterson R. The outcome of pregnancy 

complicated by severe asthma. Allergy Proc 1988; 9:539- 

543. 

69. Apter AJ, Greenberger PA, Patterson R. Outcomes of 

pregnancy in adolescents with severe asthma. Arch 

Intern Med 1989; 149:2571-2575. 

70. Mabie WCB, Wasserstrum N, Sebai BM. Clinical 

observations on asthma and pregnancy. J Matern Fetal 

Med 1992; 1:45-50. 

71. Tata LJ, Lewis SA, McKeever TM, et al. A comprehensive 

analysis of adverse obstetric and pediatric complications 

in women with asthma. Am J Respir Crit Care Med 

2007; 175:991-997. 

72. Bracken MB, Triche EW. Asthma during pregnancy. 

Obstet Gynecol 2004; 103:1001-1002; author reply 2. 

73. Rey E, Boulet LP. Asthma in pregnancy. BMJ 2007; 

334:582-585. 

74. Wendel PJ, Ramin SM, Barnett-Hamm C, Rowe TF, 

Cunningham FG. Asthma treatment in pregnancy: a 

randomized controlled study. Am J Obstet Gynecol 

1996; 175:150-154. 

75. Wegmann TG, Lin H, Guilbert L, Mosmann TR. 

Bidirectional cytokine interactions in the maternalfetal 

relationship: is successful pregnancy a TH2 

phenomenon? Immunol Today 1993; 14:353-356. 

76. Raghupathy R. Pregnancy: success and failure within 

the Th1/Th2/Th3 paradigm. Semin Immunol 2001; 

13:219-227. 

77. Dudley DJ, Chen CL, Mitchell MD, Daynes RA, 

Araneo BA. Adaptive immune responses during 

murine pregnancy: pregnancy-induced regulation of 

lymphokine production by activated T lymphocytes. 

Am J Obstet Gynecol 1993; 168:1155-1163. 

78. Hanna N, Hanna I, Hleb M, et al. Gestational agedependent 

expression of IL-10 and its receptor in 

human placental tissues and isolated cytotrophoblasts. 

J Immunol 2000; 164:5721-5728. 

79. Kruse N, Greif M, Moriabadi NF, Marx L, Toyka KV, 

Rieckmann P. Variations in cytokine mRNA expression 

during normal human pregnancy. Clin Exp Immunol 

2000; 119:317-322. 

80. Reinhard G, Noll A, Schlebusch H, Mallmann P, Ruecker 

AV. Shifts in the TH1/TH2 balance during human 

pregnancy correlate with apoptotic changes. Biochem 

Biophys Res Commun 1998; 245:933-938. 

81. Bohacs A, Pallinger E, Tamasi L, et al. Surface markers of 

lymphocyte activation in pregnant asthmatics. Inflamm 

Res 2010; 59:63-70. 

82. Tamasi L, Horvath I, Bohacs A, Muller V, Losonczy 

G, Schatz M. Asthma in pregnancy--immunological 

changes and clinical management. Respir Med. 2011; 

105:159-164. 

83. Bohacs A, Cseh A, Stenczer B, et al. Effector and 

regulatory lymphocytes in asthmatic pregnant women. 

Am J Reprod Immunol 2010; 64:393-401. 

84. Murphy VE, Gibson PG, Giles WB, et al. Maternal 

asthma is associated with reduced female fetal growth. 

Am J Respir Crit Care Med 2003; 168:1317-1323. 

85. Rastogi D, Wang C, Lendor C, Rothman PB, Miller RL. 

T-helper type 2 polarization among asthmatics during 

and following pregnancy. Clin Exp Allergy 2006; 36:892- 

898. 

86. Tamasi L, Bohacs A, Pallinger E, et al. Increased 

interferon-gamma- and interleukin-4-synthesizing 

subsets of circulating T lymphocytes in pregnant 

asthmatics. Clin Exp Allergy 2005; 35:1197-1203.

287 



Original Article 

Intravenous Labetalol versus Oral Nifedipine in the 

Treatment of Severe Hypertension in Pregnancy 

Ronita Devi Mayanglambam 1 , Tempe Anjali 2 

1 

Department of Obstetrics and Gynecology, Jawaharlal Nehru Institute of Medical Sciences, Porompat, Imphal, Manipur, India 

2 

Department of Obstetrics and Gynecology, Maulana Azad Medical College and Lok Nayak Hospital, New Delhi, India 


ABSTRACT 

Objective: To evaluate the efficacy of intravenous labetalol 

versus oral nifedipine in the treatment of severe hypertension 

with pregnancy 

Design: Prospective, non-randomized 

Setting: Department of Obstetrics and Gynecology, Maulana 

Azad Medical College and Lok Nayak Hospital, New Delhi, 

India 

Subjects and Methods: Fifty pregnant patients with severe 

hypertension (blood pressure ≥ 160/110 mmHg). 

Intervention: The patients were consecutively given either 

intravenous labetalol or oral nifedipine. 

Main Outcome Measures: The speed and adequacy of 

control of blood pressure was compared in both groups 

Results: Both drugs were effective in the control of blood 

pressure, but nifedipine caused significant reduction of blood 

pressure in 20 minutes with a single dose i.e., with the first 

dose (p = 0.03). The diastolic blood pressure reduction was 

also significant with nifedipine (15.1 ± 6 Vs 8.3 ± 2 mmHg) (p 

= 0.03). Average time required was also less with nifedipine 

(24 ± 8.2 Vs 44.21 ± 26.31 minutes, p = 0.006). 

Conclusions: Both drugs effectively controlled the blood 

pressure in severe hypertension in pregnancy. However, 

nifedipine faired better than labetalol in time taken, 

reduction of diastolic blood pressure and number of patients 

responding with first dose (i.e., in 20 minutes). 

KEY WORDS: eclampsia, hypertension, pregnancy, proteinuria 

INTRODUCTION 

Hypertension in pregnancy is one of the main 

causes of maternal deaths in both developed and 

developing countries [1] . The main goal of treatment of 

hypertension in pregnancy is to safeguard the mother 

from the development of acute complications like 

cererbro-vascular accidents, eclampsia, target organ 

damage and maternal mortality while delivering a 

healthy infant [2,3] . According to the consensus report 

on high blood pressure, the ideal antihypertensive 

drug should be potent and safe, rapidly acting, 

controllable and without detrimental maternal or 

fetal side effects [4] . Labetalol, an α and β adrenergic 

blocker, produces rapid dose dependant reduction in 

blood pressure by decreasing the peripheral vascular 

resistance without causing reflex tachycardia and 

fetal distress [5-7] . Labetalol does not reduce cerebral 

perfusion and utero-placental blood flow, it has an 

anti-platelet aggregation property [8] and a fetal lung 

maturation accelerating influence [9] and it also decreases 

proteinuria. American College of Obstetricians and 

Gynecologists currently recommend labetalol as one 

of the first line antihypertensive medications in preeclampsia 

[10] . Intravenous labetalol has been available 

in India only recently. 

On the other hand, nifedipine (calcium channel 

blocker) is easily available in India and a less expensive 

drug which can also be used in the treatment of severe 

hypertension in pregnancy. However, concomitant use 

of nifedipine and magnesium sulphate is supposed 

to cause neuromuscular blockade [11] , maternal 

hypotension and fetal distress. Additionally, nifedipine 

has tocolytic effect and reflex tachycardia. 

The present study was undertaken to compare 

the efficacy of intravenous labetalol for the treatment 

of severe hypertension in pregnancy, with nifedipine 

administered orally. 

SUBJECTS AND METHODS 

After institutional and ethical committee approval, a 

non-randomized trial was conducted in the Department 

of Obstetrics and Gynecology, Maulana Azad Medical 


Dr Ronita Devi Mayanglambam, Room No 28, Ladies Hostel, JNIMS, Imphal 795005, Manipur, India. Mobile: 91-9774492758, 

91-9856540896, E-mail: mronitadevi@rediffmail.com



College and associated Lok Nayak Hospital, New 

Delhi from December 2006 and December 2008. 

The study included patients selected according to 

the criteria given below. Fifty patients were included 

in the study. 

Inclusion criteria 

Pregnancy more than or equal to 20 weeks of 

gestation, having severe hypertension i.e., systolic 

blood pressure (SBP) of at least 160 mmHg and / or 

diastolic blood pressure (DBP) of at least 110 mmHg 

with or without proteinuria were included. 

Exclusion criteria 

Patients with cardiac failure, history of bronchial 

asthma, bradycardia (pulse rate < 60 beats per minute), 

allergic diathesis and eclampsia were excluded. 

After taking history, doing a complete examination 

and taking informed consent, either intravenous 

labetalol or oral nifedipine were given to the patients 

consecutively. Patients were divided into two groups 

(i.e., group A - labetalol and group B - nifedipine). 

Group A: Twenty fivepatientsreceivedintravenous 

labetalol (n = 25), 20 mg intravenous bolus dose 

initially, (if not effective within 20 minutes) followed 

by escalating doses of 40 mg (2 nd dose), 80 mg (3 rd 

dose), 80 mg (4 th dose), and then 80 mg (5 th dose) 

every 20 minutes until the therapeutic blood pressure 

goal of SBP < 160 mmHg and DBP < 110 mmHg was 

achieved or up to a maximum dose of 300 mg or five 

doses (Fig. 1). 

Group B: Twenty five patients received oral 

nifedipine (n = 25), 10 mg oral dose initially, with 

repeated doses of 20 mg every 20 minutes until the 

therapeutic goal (SBP < 160 mmHg and DBP of < 110 

mmHg) was achieved or up to a maximum dose of 

90 mg or five doses (Fig. 1). 

The patients were then put on oral maintenance 

dose of either oral labetalol 100 mg twice daily or 

oral nifedipine 10 mg twice daily in addition to a 

fixed dose of 250 mg thrice daily of α-methyl dopa 

to start with. The dose of labetalol and nifedipine 

were titrated to a maximum of 1200 mg of labetalol 

or 60 mg of nifedipine in divided doses in the two 

groups respectively. 

The outcome measures were assessed in terms of 

the control of the blood pressure i.e., SBP < 160 mmHg 

and DBP < 110 mmHg. The time taken for the control 

of blood pressure, the number of doses required was 

noted and the patients were observed during the first 

two hours. 

Statistical analysis 

Student’s t test was applied for comparing age, 

fall in diastolic blood pressure, fall in systolic blood 

pressure and average time required to control blood 

pressure between the two groups. Fisher’s Z-test 

was used for comparing the proportion of blood 

pressure controlled in the two groups by single dose 

of individual drug. A p-value of < 0.05 was regarded 

as statistically significant 

RESULTS 

Table 1 shows the demographic data of the two 

treatment groups. There were no significant differences 

in ages between the two groups. The mean age at 

presentation was 24.5 years in group A and 25.35 years 

in group B. Seventy five per cent of patients were 

Table 1: Demographic data 

Patient classification 

Group A 

(Labetalol) 

n = 25 

Group B 

(Nifedipine) 

n = 25 

Fig. 1: Flow chart showing methodology 

Mean age (years) 

Parity 

Nullipara 

Para 1 

Para 2 

Booked/Unbooked 

Booked 

Unbooked 

Type of Severe Hypertension 

Gestational hypertension 

Pre-eclampsia 

Chronic hypertension 

Chronic hypertension with 

Superimposed pre-eclampsia 

24.50 ± 3.017 

18 

2 

5 

5 

20 

4 

19 

1 

1 

25.35 ± 3.74 

10 

12 

3 

4 

21 

5 

17 

2 

1

289 

Intravenous Labetalol versus Oral Nifedipine in the Treatment of Severe Hypertension ... 


Table 2: Effects of drugs on blood pressure 

Table 3: Average time for control of blood pressure in minutes 

Group A 

(Labetalol) 

n = 25 

Group B 

(Nifedipine) 

n = 25 

Group 

Number of 

Patients who got 

BP controlled 

Mean 

(minutes) 

Blood Pressure Control 

Adequate 

Not adequate 

Doses required to get the 

therapeutic blood pressure goal 

1 st dose 

2 nd dose 

3 rd dose 

4 th dose 

5 th dose 

Successful treatment with first 

dose 

Amount of drug required (mg) 

Fall in blood pressure in first 20 

minutes 

Systolic BP (mmHg) 

Diastolic BP (mmHg) 

24/25 

1/25 

nulliparous in the group A and 45% of patients were 

para 1 in the group B. Most of the patients in both 

the groups were unbooked. Nineteen patients (76%) 

of group A and 17 patients (68%) of group B were 

pre-eclamptic patients (Table 1). The blood pressure 

control was achieved in both the groups fairly well. 

In nifedipine group, the control of blood pressure was 

achieved in all the patients. In labetalol group, blood 

pressure was controlled in 24 out of 25 patients, one 

patient who was not controlled with full dose, received 

nitroglycerin for control of hypertension. However, 

the number of patients controlled with the first dose of 

the drug was lower in labetalol group as compared to 

nifedipine group (10 / 25 Vs 20 / 25, p = 0.03). Mean 

doses requirement of labetalol and nifedipine were 

113.4 ± 20 mg and 20.5 ± 10 mg respectively. Mean 

SBP reduction of labetalol and nifedipine at first 20 

minutes were 14.4 ± 6 mmHg and 18.3 ± 5 mmHg 

respectively and there was no significant difference (p 

= 0.257) in SBP reduction in both the groups. There was 

significant difference (p = 0.03) in reduction of DBP in 

first 20 minutes between nifedipine (15.1 ± 6 mmHg) 

and labetalol (8.3 ± 2 mmHg) groups (Table 2). The 

average time required for control of blood pressure 

was 44.2 ± 26.31 and 24 ± 8.2 minutes in labetalol 

and nifedipine groups respectively and there was 

significant difference in between the two groups (p = 

0.006) (Table 3). 

DISCUSSION 

Hypertension is one of the most common problems 

arising during the pregnancy complicating up to 

15% of all pregnancies, and within this disorder, 

approximately one in four patients will experience 

an episode of severe hypertension [12] . Treatment of 

10 

5 

4 

3 

3 

10 

113.4 ± 20 

14.4 ± 6 

8.3 ± 2 

25/25 

0 

20 

5 

0 

0 

0 

20 (p = 0.03) 

20.5 ± 10 (p = 0.0007) 

18.3 ± 5 (p = 0.257) 

15.1 ± 6 (p = 0.03) 

Group A (Labetalol) n = 25 

Group B (Nifedipine) n =25 

severe hypertension in pregnancy is mandatory as 

it decreases the incidence of maternal intracranial 

hemorrhage, hypertensive encephalopathy, abruptio 

placentae and maternal mortality. The maternal 

mortality from hypertensive disease has been studied 

for its attributing factors [13] . There is general agreement 

that rapid lowering of high blood pressure can reduce 

the maternal risk [14-16] . 

Labetalol and nifedipine, both are found to be 

safe drugs for the treatment of severe hypertension 

in pregnancy from the previous studies [17-20] . Previous 

reports [21,22] have indicated that there was apprehension 

in nifedipine use as the sublingual variety caused more 

sudden decrease in blood pressure, resulting thereby 

in overshoot hypotension and ischemia there upon. 

The oral variety does not seem to have this [23] effect as 

found in our study. There were minimal side effects in 

our patients with the use of either drug. No patient had 

sudden hypotension below 100 mmHg systolic during 

the initial two hours of treatment. Nifedipine achieved 

adequate control of blood pressure with only one dose 

in 20 / 25 patients whereas in the labetalol group only 

10 / 25 patients achieved the control of blood pressure 

with one dose, and this difference was statistically 

significant (p = 0.03). Both drugs lowered the SBP in the 

first 20 minutes by 14.4 ± 6 mmHg and18.3 ± 5 mmHg in 

labetalol and nifedipine group respectively and there 

was no statistically significant difference between the 

two groups. However, there was significant fall in the 

blood pressure particularly diastolic with nifedipine 

as compared to labetalol in the first 20 minutes. This 

is substantiated in other studies by Vermillion et al [20] 

and by Raheem et al [24] ; these authors found that the 

use of nifedipine was associated with increase in urine 

output in addition to rapid control over blood pressure 

as compared to labetalol. Whether rapid fall in blood 

pressure is beneficial or not is unclear, particularly if 

it is not causing cerebral hypoperfusion or overshoot 

hypotension or any other adverse effects on the fetus 

or the mother. 

Nevertheless, the importance of close monitoring 

of blood pressure every 20 minutes or earlier as need 

arises has to be emphasized as the patient can have 

hypotension if the drugs are not adequately titrated. 

If the trends of blood pressure over two hours 

are carefully observed, it is evident that both drugs 

achieved fair control of blood pressure in our study. 

24 

25 

44.21 ± 26.3 

24 ± 8.2 (p = 0.006)



Therefore, either drug can be used successfully in 

the control of hypertension in pregnancy. The use 

of nifedipine for control of severe hypertension in 

pregnancy had been proven in earlier studies [25-30] 

as well. However, labetalol may be advantageous in 

delirious patient because of its intravenous route. 

CONCLUSION 

Both drugs effectively controlled the blood pressure 

in severe hypertension in pregnancy. However, 

nifedipine faired better than labetalol in time taken, 

reduction of DBP and number of patients responding 

with first dose (i.e, in 20 minutes). 

REFERENCES 

1. Van Schie DL, De Jeu RM, Steyn DW, Odendaal HJ, 

Geijn HPV. The optimal dosage of ketanserin for 

patients with severe hypertension in pregnancy. Eur J 

Obstet Gynecol Rprod Biol 2002; 102:161-166 . 

2. Bolte AC, Geijn HPV, Dekker GA. Pharmacological 

treatment of severe hypertension in pregnancy and 

the role of serotonin -2 receptor blockers. Eur J Obstet 

Gynecol Rprod Biol 2001; 95:22-36. 

3. Redman CWG. Drugs, hypertension and pregnancy. In: 

Studd J, editor. Progress in Obstetrics and Gynaecology. 

Vol. 9. Edinburgh: Churchill Livingstone; 1991. p. 83- 

97. 

4. Bolte AC, Geijn HPV, Dekker GA. Management and 

monitoring of severe preeclampsia. Eur J Obstet 

Gynecol Reprod Biol 2001; 96:8-20. 

5. Johansen PL. Pharmacology of combined alpha-beta 

blockade.II. Hemodynamic effects of labetalol. Drugs 

1984; 28:35-50. 

6. Mabie WC, Gonzalez AR, Sibai BM, Amon E. A 

comparative trial of labetalol and hydralazine in the 

acute management of severe hypertension complicating 

pregnancy. Obstet Gynecol 1987; 70:328-333. 

7. Mahmoud TZ, Bjornsson S, Calder AA. Labetalol 

therapy in pregnancy induced hypertension: the effects 

on fetoplacental circulation and fetal outcome. Eur J 

Obstet Gynecol Reprod Biol 1993; 50:109-113. 

8. Greer IA, Walker JJ, Mc Laren M, Calder AA, Forbes CD. 

A comparative study of the effects of adrenoreceptor 

antagonists on platelet aggregation and thromboxane 

generation. Thromb Haemost 1985; 54:480-484. 

9. Michael CA. Early fetal lung maturation associated 

with labetalol therapy. Singapore J Obstet Gynaecol 

1980; 11:2-5. 

10. Management of preeclampsia, ACOG Technical 

Bulletin No.219, February, 1996. The American College 

of Obstetricians and Gynecologists, Washington, DC. 

11. Ales K. Magnesium plus nifedipine. Am J Obstet 

Gynecol 1990; 162:288. 

12. Brown MA, Buddle ML. Hypertension in pregnancy: 

maternal and fetal outcomes according to laboratory 

and clinical features. Med J Aust 1996; 165:360-365. 

13. Lewis G, Drife J. Why Mothers Die 1997-1999: The 

fifth report of the Confidential Enquiries into Maternal 

Deaths in the United Kingdom. London: RCOG Press, 

2001. 

14. Rey E, Lelorier J, Burgess E, Lange IR, Leduce L. Report 

of the Canadian Hypertension Society Consensus 

Conference: Pharmacologic treatment of hypertensive 

disorders in pregnancy. CMAJ 1997; 157:1245-1254. 

15. Report of the National High Blood Pressure Education 

Program Working Group on High Blood Pressure in 

Pregnancy. Am J Obstet Gynecol 2000; 183:S1- S22. 

16. Brown MA, Hague WM, Higgins J, et al. Australian 

Society for the Study of Hypertension in Pregnancy. 

The detection, investigation and management of 

hypertension in pregnancy: executive summary. Aust 

NZ J Obstet Gynecol 2000; 40:133-138. 

17. Michael CA. Intravenous labetalol and intravenous 

diazoxide in severe hypertension complicating 

pregnancy. Aust NZ J Obstet Gynecol 1986; 26:26-29. 

18. Michael CA. Use of labetalol in the treatment of severe 

hypertension during pregnancy. Br. J Clin Pharmacol 

1979; 8:211S-215S. 

19. Aali BS, Nijad SS. Nifedipine or hydralazine as a 

first line agent to control hypertension in severe preeclampsia. 

Acta Obstet Gynecol Scand 2002; 81:25 -30. 

20. Vermillion ST, Scardo JA, Newsman RB, Chauhan SP. 

A randomized, double blind trial of oral nifedipine and 

intravenous labetalol in hypertensive emergencies of 


21. Wachter RM. Symptomatic hypotension induced by 

nifedipine in the acute treatment of severe hypertension. 

Arch Intern Med 1987; 147:556-558. 

22. O’ Malia JJ, Sander GE, Giles TD. Nifedipine associated 

myocardial ischemia or infarction in the treatment of 

severe hypertension. Arch Intern Med 1987; 147:556- 

558. 

23. Scardo JA, Vermillion ST, Newman RB, Chauhan SP, 

Hogg BB. A randomized, double-blind, hemodynamic 

evaluation of nifedipine and labetalol in pre-eclamptic 

hypertensive emergencies. Am J Obstet Gynecol 1999; 

181:862-866. 

24. Raheem IA, Saaid R, Omar SZ, Tan PC. Oral nifedipine 

versus intravenous labetalol for acute blood pressure 

control in hypertensive emergencies of pregnancy: a 

randomized trial. Br J Obstet Gynecol 2012; 119:78-85. 

25. Papatsonis DN, Lok CA, Bos JM, Geijn HP, Dekker 

GA. Calcium channel blockers in the management of 

preterm labor and hypertension in pregnancy. Eur J 

Obstet Gynecol Reprod Biol 2001; 97:122-140. 

26. Borgi C, Esposti DD, Cassani A, Immordino V, Bovicelli 

L, Ambrosioni E. The treatment of hypertension in 

pregnancy. J Hypertens Suppl 2002; 20:S52-56. 

27. Magee LA, Miremadi S, Li J, et al. Therapy with both 

magnesium sulphate and nifedipine does not increase 

the risk of serious magnesium related maternal side 

effects in women with preeclampsia. Am Obstet 

Gynecol 2005; 193:153-163. 

28. Magee LA, von Dadelszen P. The management of severe 

hypertension. Semin Perinatol 2009; 33:138-142. 

29. Podymow T, August P. Hypertension in pregnancy. 

Adv Chronic Kidney Dis 2007; 14:178-190. 

30. Podymow T, August P. Antihypertensive drugs in 

pregnancy. Semin Nephrol 2011; 31:70-85.

291 




Total Hip Replacement in Nigeria: A Preliminary Report 

Nwadinigwe Cajetan Uwatoronye, Anyaehie Udo Ego, Katchy Uchenna Amaechi 

National Orthopedic Hospital, Enugu (NOHE), Nigeria 


ABSTRACT 

Objectives: The first total hip replacement (THR) in Nigeria 

was performed in 1974. But due to infrastructural decay in 

public institutions, arthroplasty outcome was poor. National 

Orthopedic Hospital, Enugu (NOHE) - a regional trauma 

and orthopedic centre took the initiative in 2008. This paper 

presents our preliminary results and lists our challenges in 

establishing this service in a resource- constrained economy. 

Design: Prospective 

Setting: NOHE, Nigeria 

Subjects: Fifty-two patients who had primary hip arthroplasty 

between November 2008 and November 2010 

Method: Details of demographic data, joints affected, 

etiology, co-morbidities, anesthesia, postoperative treatment, 

complications, and follow-up were recorded, analyzed and 

challenges noted 

Intervention : Total hip replacement 

Main Outcome Measures: Improvement in patient’s function 

and re-operation rate 

Result: Fifty-four THRs were done in fifty-two patients. 

Twenty nine (53.7%) patients were male. The mean age 

was 52 ± 2.4 years. Two patients had staged bilateral hip 

replacement. Twenty five (48.1%) patients had primary 

osteoarthritis. The commonest complaint at presentation 

was incapacitating hip pain. Half of the patients 26 (49.9%) 

had this pain for over four year. Trauma related secondary 

arthritis was responsible for 21 cases and old unreduced hip 

dislocation in five (9.6%) patients. Six patients had previous 

hip surgeries. Implant dislocation occurred in three (5.5%) 

patients. The functional status improved in all patients as 

shown by Harris Hip scores. 

Conclusion: There is an absolute need to develop arthroplasty 

service in Nigeria. A good number of the cases were complex 

primary arthroplasties. Most of the patients were relatively 

young and will outlive their implant. 

KEY WORDS: depressed economy, hip arthroplasty, Nigeria 

INTRODUCTION 

Total hip replacement (THR) is undoubtedly the 

most successful procedure in orthopedics [1] . It brings 

a new lease of life by pain relief and improvement in 

hip function in patients with advanced ostheoarthritis 

when conservative management has failed. 

Since the work of Sir John Charnley on the hip 

arthroplasty in 1960’s, a lot of advances have been seen 

in this field of orthopedics [2,3] . The first THR in Nigeria 

was performed in 1974 at the University of Nigeria 

Teaching Hospital, Enugu. But due to sustained 

infrastructural decay in public institutions, the specialty 

of arthroplasty was poorly developed even though 

indications were there. Hitherto, few patients (who 

could afford it) were referred abroad. This practice over 

the years was associated with many problems; huge 

capital flight, poor patient follow-up and persistent 

underdevelopment of the specialty. The vast majority 

of patients with end stage osteoarthritis (OA) were 

either left to live with their pain and deformity or were 

offered arthrodesis or excision arthroplasty. 

National Orthopedic Hospital, Enugu (NOHE) - a 

regional trauma and orthopedic training center took 

the initiative in 2008. To the best of our knowledge, no 

coordinated institutional arthroplasty center exists in 

Nigeria. The objectives of this paper were to present 

our preliminary results and to share our challenges 

in establishing this service in a resource- constrained 

economy. 


This was a prospective study of 54 consecutive 

THRs done from November 2008 to November 2010. 

Details such as demographic data, joints affected, 

etiology, co-morbidities, anesthesia, postoperative 

treatment, complications, and follow-up were collected 

prospectively. The functional level of each patient 

was assessed pre and postoperatively, at six months 


Dr C U Nwadinigwe, FWACS (Orth), P O Box 927 Enugu, 400001, Enugu State, Nigeria. Tel: +2348037083917, 

E-mail: cunwadinigwe@yahoo.co.uk



and one year using Harris hip score. All patients had 

preoperative and immediate postoperative X-ray 

evaluation. The preoperative X-rays were classified 

based on Kellgren and Lawrence scale for primary 

osteoarthritis and Ficat and Arlet for avascular 

necrosis (AVN). The X-ray evaluation was repeated 

at three months, six months and one year follow-up 

as the case may be. All the operations were through 

anterolateral approach. The implant consisted of 

hydroxyapetite coated titanium femoral stem, 28 mm 

cobalt based alloy head and 28 mm UHMWP on 

metal shell (Corail Duraloc, DePuy International). All 

patients received prophylatic antibiotics - ceftriazone 

and metronidazole. Enoxaparin 40 mg daily for five 

days and compression bandaging were used for 

deep vein thrombosis (DVT) prophylaxis and the 

patients were mobilized on the first day post surgery. 

The major outcome measures were improvement in 

patient’s function and reoperation rate. Data analysis 

was done with SPSS software version 11. Descriptive 

statistics are provided. The study was approved by 

ethical committee of the hospital. 

Table 1: Duration of symptoms 

Duration of symptom 

Pain < 1 year 

Pain 1 - 3 years 



Pain > 10 years 

Frequency 

n (%) 

3 (5.8) 

23 (44.2) 

10 (19.2) 

11 (21.1) 

5 (9.6) 

bilateral total hip replacements within three months. 

Twenty-nine (53.7%) were male while 25 (46.2%) were 

female, giving a male to female ratio of 1.2:1 (Fig. 1). 

Their ages ranged from 18 to 78 years with an overall 

mean of 52 ± 2.4 years (Table1). Twenty-four were on 

the left side and 30 on the right side. 

The most common complaint at presentation was 

incapacitating joint pain. About half the patients (26, 

49.9%) had this pain for over four years (Table 1). 

Table 2: Etiology 

Diagnosis 

Frequency 

n (%) 

Primary osteoarthritis 

Post-traumatic fracture 

Unreduced dislocation 

Dysplastic hip 

Sickle cell disease with avascular necrosis of head 

of femur 

Total 

25 (48.1) 

16 (30.8) 

5 (9.6) 

2 (3.8) 

4 (7.7) 

52 

Fig. 1: Genderwise distribution of patients 

RESULTS 

A total of 54 total hip replacement surgeries were 

done in 52 patients in two years. All the patients were 

pooled in a unit to create volume. Two patients had 

Twenty-five (48.1%) patients had primary 

osteoarthritis that had progressed to advanced stage 4 

(Kellgen and Lawrence scale) (Fig. 2). Trauma related 

secondary arthritis was responsible for 21 (40.4%) 

cases with poorly managed hip fractures accounting 

for 16 (30.8%) cases and old unreduced hip dislocation 

accounting for five (9.6%) cases (Table 2). Three of 

the patients with poorly managed hip fractures had 

failed angle blade plates. A total of six patients had 

previous hip surgeries (Table 3). The five patients 

Fig. 2a, b: Bilateral severe OA hip 

a 

b

293 



Table 3: Previous interventions 

Procedure 

Girdlestone excision arthroplasty 

Angle blade plating 

Hemiarthroplasty 

Frequency 

(n) 

2 

3 

1 

Fig. 3a: SCD with bilateral AVN: pre-operative X-ray 

Fig. 3b: SCD with bilateral AVN (immediate post-operative X- 

ray) 

with old unreduced posterior hip dislocation had 

posterior wall defect and false acetabulum. All cases 

presented to our center more than one year after initial 

injury and treatment by traditional bone setters with 

uncontained femoral heads; all underwent one-stage 

total hip arthroplasty. This group of patients was also 

younger with a mean age of 42 ± 2.3 years. 

Avascular necrosis of the head of femur from sickle 

cell disease was noted in four (7.7%) patients. They 

were all stage IV (Ficat and Arlet staging, Fig. 3). Their 

mean age was 28 ± 3.4 years. All the sicklers had dense 

bone sclerosis and near obliteration of the proximal 

femoral medullary canal intraoperatively. One patient 

had femoral perforation during reaming. We did not 

observe painful postoperative sickling crises. All 

patients had oxygen saturation monitored during the 

surgery. 

Patients had an average pre-operative Harris hip 

score of 45 (range of 35 - 47). Twenty-three patients had 

co-morbidities. The most common associated medical 

problem was uncontrolled hypertension in 14 patients. 

The others were diabetes mellitus in four, asthma in 

one and peptic ulcer disease in four patients. All the 

co-morbidities were well-controlled with medication 

before the THR. 

Regional block was employed in all the surgeries 

except in five cases of failed spinal which were then 

converted to general anesthesia. Intra-operative blood 

loss varied from 400 ml – 1000 ml (mean blood loss 

800 ml). Five patients received intraoperative blood 

transfusion, while seven others had postoperative 

blood transfusion in the ward. 

All the patients were given intravenous antibiotics, 

ceftriaxone and metronidazole for five days. They 

also received parenteral analgesics for 48 hours before 

shifting to oral drugs. Enoxaparin 40 mg daily was 

given for five days and compression bandaging was 

used for DVT prophylaxis and the patients were 

mobilized on the first day post surgery. 

The most important complication observed was 

implant dislocation in three (5.5%) patients. This 

was due to component mal-positioning. Two hips 

dislocated while in the hospital and one at home. Three 

of them had component repositioning and remained 

stable (Table 4). 

Table 4: Complications 

Complications 

Post spinal headache 

Superficial wound infection- stitch sinus 

Dislocated implant 

Trochanteric fracture 

Pneumonia 

Frequency 

n (%) 

10 (18.5) 

4 (7.4) 

3 (5.6) 

1 (1.9) 

2 (3.7) 

Thirty one patients were discharged in the second 

week after surgery while the remaining twenty-one 

were discharged in the third week. In this group of 

patients, due to a longstanding pathology, rehabilitation



was slow. They were discharged on partial weight 

bearing with bilateral axillary crutches. 

Follow up is on-going. Harris hip score at six 

months and one year post surgery improved to 90 in 

thirty five patients and 80 - 89 in seventeen patients. 

Most of them were satisfied with their progress so far. 

There was no mortality recorded. 

DISCUSSION 

Total joint replacement is a well-established 

procedure for the hip joint in the developed world. 

Although other joints have been replaced with variable 

outcome, hip replacement has been adjudged the most 

successful orthopedic operation [1] . 

In Nigeria, THR is at its infancy [4] although the first 

THR in Nigeria was done in 1974. The subspecialty 

could not advance due to sustained infrastructural 

decay in public institutions and the huge capital 

overlay made it an impossible venture for most private 

practitioners. Nigeria is a country of 150 million people 

with varying health needs. In this study, our patient 

population was a mixed bag of primary osteoarthritis 

(OA), post- traumatic secondary OA, sickle cell disease 

(SCD) etc., and they were relatively young. 

We found the mean age of our patients to be 52 ± 

2.4 years (range 18 - 78 years) .The import of having 

relatively younger patients is that many of them will 

outlive their implant and require revision. It has been 

shown that patients younger than 50 years at the time 

of surgery have a greater chance of requiring a revision 

than of dying; those around 58 years of age have a 

50:50 chance of needing a revision and in those older 

than 62 years the prosthesis will normally outlast the 

patient. Patients over 77 years old have a greater than 

90% chance of dying than requiring a revision whereas 

those around 47 years are on an average twice more 

likely to require a revision than die [5] . What this means 

for our region is that revision surgery should develop 

alongside primary arthroplasty. 

Trauma is a known cause of morbidity and mortality 

in people under sixty years of age. In our environment 

there are many confounding factors to effective trauma 

care. Topmost among them are poverty, influence 

of traditional bone setters and faith healers. These 

were major reasons why hip dislocations were left 

unreduced for a reasonable length of time as observed 

in the study (Fig. 4). 

SCD is prevalent in Nigeria [6] . Children with SCD 

were hitherto regarded as curse from the ‘spirit world’ 

and therefore were not adequately cared for. But with 

better understanding and awareness of genetic basis 

for this condition and improvement in their care 

some are surviving into adulthood. For these young 

SCD patients, development of AVN of the hip is one 

of the most limiting factors in their lives in terms of 

pain, level of activity, and function. We observed this 

in our cases. The treatment of these young patients is 

therefore, particularly important not only for socioeconomic 

and humanitarian reasons, but also because 

of their improved life expectancy [7,8] . The cases in this 

study had severe adductor contractures. In addition, 

sclerotic proximal femur made reaming very difficult 

and could hardly accept anything above size 8 stem. 

Those who may have this patient population must 

be aware of this and make adequate arrangement for 

different implant sizes. 

Primary OA was a common etiological factor, but 

not as common as in studies from the western world [8] . 

A number of factors may be responsible for this; 

Nigeria, although an oil producing country ranks low 

in human development index - life expectancy is low 

(47.56 years), and far below the usual age for primary 

osteoarthritis; high illiteracy rate results in lack of 

awareness about availability of service and low gross 

Fig. 4a & b: Old unreduced hip dislocation

295 



national income per capita of $2,069 compared to the 

cost of arthroplasty [9] . These factors either collectively 

or singly may account for the low number. Some of the 

patients with primary OA have some features of AVN 

from prolonged steroid ingestion to relieve pain. 

We observed male preponderance in this study. 

This is different from reports in literatures which show 

female preponderance [8] . There is scepticism on the 

part of our female folks on new procedures especially 

when it entails excision of a part and replacement with 

a foreign material. 

Pain relief is the primary indication for THR [4] . In 

this study, pain was the most common indication for 

surgery. Most of our patients were virtually on daily 

non-steriodal anti-inflammatory drugs for over four 

years. This was at a great cost for the four patients that 

developed peptic ulcer disease. 

Simultaneous arthroplasties are increasingly being 

performed during one single anesthetic event [10] . Two 

patients in this study had bilateral arthroplasty as 

staged operations. We were particularly worried about 

the effect of prolonged anesthesia and wound infection. 

The interval between the operations was three months. 

This was particularly beneficial to the patients who 

paid out of their pockets. 

Regional (spinal) anesthesia was generally welltolerated. 

This is particularly useful in the resourcescarce 

environment that we worked in; however, the 

incidence of post-spinal headache was high. This is 

similar to other reports [11] . 

We gave all our patients extended antibiotic therapy 

for two reasons. We were ‘paranoid’ about infection. 

Our theatre does not have laminar air- flow system and 

the same theatre is used for routine clean orthopedic 

cases. We believe that in addition to the general 

measures of ensuring clean theatre environment, 3 - 4 

days antibiotic therapy is necessary until the procedure 

is well-standardized and facilities upgraded. No case 

of serious infection was observed in the cases so far. 

Also, the length of hospital stay was long. A number 

of reasons were responsible for this. We were unsure of 

the home environment for most patients. The team of 

physiotherapists needed the time to guide the patients 

before discharge. Secondly, some of the difficult case 

had marked muscle wasting and required considerable 

time for rehabilitation post operation. 

The need for deep vein thrombosis (DVT) 

surveillance and prophylaxis is well established in 

THR. However, the critical issue is the duration [12] . We 

gave our patients enoxaparin 40 mg daily for five days 

and continued with compression bandaging and lowdose 

aspirin. This corresponds to the time most of them 

were fully ambulant. The reason for this short duration 

regime was cost. We observed no case of overt DVT. 

This was surprisingly similar to the low incidence 

reported in other studies with extended duration of 

treatment [13] , but quite different from studies in the 

African-Americans [14] . References on the incidence of 

venous thrombo-embolism (VTE) among the blacks are 

commonly taken from studies on African- Americans, 

because there is dearth of studies among the native 

sub-Saharan black Africans. Our observation may be 

due to a number of factors. Immobility remains one 

of the most important factors for the development 

of DVT. Preoperatively, all our patients maintained 

their mobility despite extreme pathology and they 

were able to mobilize within the first two days post 

surgery. Secondly, most of our patients continued with 

low dose aspirin and compression bandaging even 

after enoxaparin was discontinued. Although there 

is strong evidence that the prevalence of VTE varies 

significantly among different ethnic / racial groups, 

the genetic, physiologic and clinical basis for these 

differences remain largely undefined [15] . Our finding 

supports the need to determine gene polymorphisms 

associated with VTE in Africans [16] . 

Posterior implant dislocation was the only major 

adverse event recorded and the only reason for reoperation 

in two patients and re-admission and reoperation 

in one patient. It was noted that the patients 

whose implants dislocated were those that had old 

unreduced posterior dislocation of the hip with 

posterior wall defect and false acetabulum as well. No 

mortality was recorded in this study supporting the 

low mortality rate associated with this procedure [17] . 

Technical difficulties encountered were due to 

the fact that our patients presented very late and so 

had bone defects, contractures about the joint, disuse 

muscles atrophy, limb length discrepancy, etc. The 

contractures make for difficult surgery with need to 

do a lot of soft tissue releases, thereby increasing post 

operative blood loss and operating time. 

Some patients who had prior surgeries like 

girdlestone arthroplasty or had hardware in situ 

following a failed internal fixation of proximal femoral 

fracture presented a lot of surgical challenges. Indeed, 

some of these cases qualify for revision or complex 

primary arthroplasty. As reported by Sathappan, 

complex primary total hip arthroplasty (THA) is 

defined as primary THA in patients with compromised 

bony or soft-tissue states, including but not limited 

to dysplastic hip, ankylosed hip, prior hip fracture, 

protrusio acetabuli, certain neuromuscular conditions, 

skeletal dysplasia, and previous bony procedures 

about the hip [18] . 

For the conversion of Girdlestone excision 

arthroplasty to THR, locating the original acetabulum 

without image intensifier was technically challenging. 

The dense fibrous tissue was also very bloody. This 

could therefore, be regarded as a revision hip. 

Conversion to total hip arthroplasty is generally 

accepted as the most successful procedure for failure



of fixation devices in hip fractures [19] . All the affected 

patients had a one stage procedure: implant removal 

and THR. 

Some of the cases had major bone defect that 

required bone grafting. In absence of a bone bank, we 

overcame this problem by morselizing whatever is left 

of the femoral head, which in some cases was badly 

degenerated and collapsed. 

Blood loss during surgery is often related to the 

difficulties encountered. Significant proportion of 

our cases was complex primary and six of them had 

previous surgical intervention with dense fibrosis. 

The average blood loss (both intra-operative and postoperative 

period) for our patients was 800 ml. This 

compares favourably with values in the literature [20] . 

CONCLUSION 

There is an absolute need to sustain the development 

of arthroplasty service in Nigeria as shown by the 

variety of cases presented. A good number of the 

cases are complex primary arthroplasty and most of 

the patients are relatively young and will outlive their 

implant and therefore, require revision. Therefore, 

in addition to development of primary procedures, 

investment in capacity building for revision procedures 

should be started now to bridge the gap. 


The authors are grateful to the Medical Director, Dr 

CB Eze, who made it possible for the development of 

this new speciality at the NOHE. Also, we own a debt of 

gratitude to Dr Sam Orakwe, Dr Ike Nwachukwu and 

Johnson & Johnson for providing the initial technical 

support. 

Conflict of interest: The authors do not have any 

financial relationship with any of the companies 

manufacturing any of the products mentioned in this 

study. It was not supported by external funding of any 

sort. 

REFERENCES 

1. Berry DJ, Harmsen WS, Cabanela ME, Morrey BF. 

Twenty-five year survivorship of two thousand 

consecutive primary Charnley total hip replacements: 

Factors affecting survivorship of acetabular and femoral 

components. J Bone Joint Surg Am 2002; 84:171-177. 

2. HarrisWH. Advances in total hip arthroplasty: 

The metal-backed acetabular component.Clinical 

Orthopedics & Related Research 1984; 18:4-11. 

3. Seyler TM, Cui Q, Mihalko WM, Mont MA, Saleh 

KJ. Advances in hip arthroplasty in the treatment of 

osteonecrosis. Instr Course Lect 2007; 56:221-33. 

4. Ugbeye ME, Odunubi OO. Knee Replacement: a 

preliminary report of thirteen (13) cases at NOHI. 

Nigerian Journal of Orthopedics and Trauma: 2009; Vol 

8(2). Available at http://www.ajol.info/index.php/ 

njotra/article/view/48304 

5. Wainwright C, Theis JC, Garneti N, Melloh M. Age at hip 

or knee joint replacement surgery predicts likelihood of 

revision surgery. J Bone Joint Surg 2011; 93:1411-1415. 

6. Akinyoola AL, Adediran IA, Asaleye CM. Avascular 

necrosis of the femoral head in sickle cell disease in 

Nigeria: a retrospective study. Nig Postg Med J 2007; 

14:217-220. 

7. Hernigou P, Zilber S, Filippini P, Mathieu G, Poignard A, 

Galacteros F. Total THA in adult osteonecrosis related to 

sickle cell disease. Clin Orthop Relat Res 2008; 466:300- 

308. 

8. Liu Y E B, Hu S, Chan S P, Sathappan SS. The 

epidemiology and surgical outcomes of patients 

undergoing primary total hip replacement: an Asian 

perspective. Singapore Med J 2009; 50: 15. 

9. International Human Development Indicators – United 

Nations Development Programme. Available at: http:// 

hdrstats.undp.org/en/countries/profiles/NGA.html 

10. Huotari K, Lyytikäinen O, Seitsalo S. Patient outcomes 

after simultaneous bilateral total hip and knee joint 

replacements J Hosp Infect 2007; 65:219-225. 

11. Macfarlane AJR, Prasad GA, Chan VWS, Brull R. Does 

regional anaesthesia improve outcome after total hip 

arthroplasty? A systematic review. Br J Anaesth 2009; 

103;335-345. 

12. Turpie AG. Extended duration of thromboprophylaxis 

in acutely ill medical patients: optimizing therapy? J 

Thromb Haemost 2007; 5:5-11. 

13. Jain V, Dhaon B, Jaiswal A, Nigam V, Singla J. Deep 

vein thrombosis after total hip and knee arthroplasty in 

Indian patients. Postgrad Med J 2004; 80:729-731. 

14. Heit JA, Beckman MG, Bockenstedt PL, et al. Comparison 

of characteristics from white and black Americans with 

venous thromboembolism: a cross-sectional study. Am 

J Hematol 2010; 85:467-471. 

15. Dowling NF, Austin H, Dilley A, Whitsett C, Evatt 

BL Hooper WC. The epidemiology of venous 

thromboembolism in Caucasians and African- 

Americans: the GATE Study. J Thromb Haemost 2003; 

1:80-87. 

16. White RH, Keenan CR. Effects of race and ethnicity on 

the incidence of venous thromboembolism. Thromb 

Res 2009; 123:S11-17. 

17. Hamel MB, Toth M, Legedza A, Rosen MP. Joint 

replacement surgery in elderly patients with severe 

osteoarthritis of the hip or knee: Decision making, 

postoperative recovery, and clinical outcomes. Arch 

Intern Med 2008; 168:1430-1440. 

18. Sathappan SS, Strauss EJ, Ginat D, Upasani V, Di Cesare 

PE. Surgical challenges in complex primary total hip 

arthroplasty. Am J Orthop (Belle Mead NJ) 2007; 36:534- 

5341. 

19. Winemaker M, Gamble P, Petruccelli D, Kaspar S, de 

Beer J. Short term outcomes of total hip arthroplasty 

after complications of open reduction internal fixation 

of hip fracture. J Arthroplasty 2006; 21:682-688. 

20. Sehat KR, Evans R L, Newman JH. Hidden blood 

loss following hip and knee arthroplasty: Correct 

management of blood loss should take hidden loss into 

account. J Bone Joint Surg (Br) 2004; 86:561-565.

297 




Towards Prevention of Diabetes in Offsprings 

of Type 2 Diabetic Patients 

Amal I El-Sharakawy, Abdulrahman A Abdulla, Fatimah Bendhifari 

Al-Yarmouk Health Center, Kuwait 


ABSTRACT 

Objectives: To reveal the extent of advice given about 

prevention of diabetes by diabetic parents to their children 

who had not developed diabetes yet, and reveal its relation 

to risk perception, and other parental factors related to 

diabetes 

Design: Observational cross-sectional prospective 

Setting: Al-Yarmouk Primary Health Care Center, Kuwait 

Subjects and Methods: Two hundred type 2 diabetic patients 

with non-diabetic children were recruited for this study. A 

self-administered questionnaire was used to collect data. 

Main Outcome Measure: The nature of advice given by 

diabetic parents to their non-diabetic children about adopting 

a healthy lifestyle to prevent or delay onset of diabetes 

Results: Only 40.5% of diabetic patients advised their children 

to adopt a healthy behavior that may prevent development 

of type 2 diabetes. Giving advice was significantly associated 

with young age, not suffering from complications related to 

diabetes, recognizing the importance of giving advice and 

identifying unbalanced diet as a risk for diabetes. More than 

half the studied group recognized lack of exercise (63%), 

overeating (70%), and heredity (56.5%) as etiological factors 

for diabetes, while 48% recognized unbalanced diet, and only 

3% could recognize the risk of diabetes among offspring. 

Conclusion: A comprehensive behavioral, social, and physical 

environment approach is required to improve risk perception 

of etiological factors of type 2 diabetes especially unbalanced 

diet, to enable parents to provide an advice to their children 

about healthy behavior needed to prevent diabetes. 

KEY WORDS: healthy behavior, obesity, parent-child-relation, primary prevention 

INTRODUCTION 

Diabetes (DM) is considered a major public health 

problem not only because of its association with 

multiple medical complications, but also because of 

a continuously alarming rise in prevalence rate [1] . Its 

impact extends beyond the individual to affect health 

systems, social systems, and greatly undermines the 

economic resources of the whole country. The highest 

increase in the rates of the disease is observed mainly 

in the rapidly developing countries as the disease is 

mainly associated with changes in lifestyles, economic 

development and population growth [2] . Recent studies 

in Kuwait reveal a prevalence rate of 14.6%. During 

2010, Kuwait ranked seventh for diabetes prevalence 

among the 216 countries for which data are available 

all over the world [3] . What adds to the complexity of 

the problem is the reported finding by the International 

Diabetes Federation (IDF) that an estimated 93.9% 

increase in the rates of DM in the Middle East-North 

Africa region during the period 2010-2030 is expected [3] . 

The high prevalence of type 2 diabetes in Kuwait, as 

well as other countries of Co-operation Council for 

the Arab States of the Gulf (GCC), is associated with 

higher prevalence of risk factors for this disease. 

Multiple risk factors interact to lead to development 

of type 2 diabetes. These factors involve mainly genetic 

and environmental factors. One primary risk factor is 

a family history of diabetes. A considerable amount 

of evidence demonstrated that familial aggregation 

of diabetes is associated with an inherited defective 

gene that renders the individuals at a higher risk of 

diabetes [4] . Other environmental and behavioral risk 

factors suggested by the IDF include physical activity 

that is closely linked to overweight and obesity. Other 

non-modifiable factors included age, race, ethnicity, 

and gestational diabetes [5] . 

Efforts directed towards prevention or delaying 

onset of diabetes among the high-risk group depends 

mainly on changing or controlling the modifiable 

behavioral risk factors of type 2 diabetes, namely, 

amount of daily activity or exercise, balanced eating, 

and amount of daily consumed food [6] . Diabetic 


Amal El-Sharkawy, MRCGP, Al-Yarmouk Health Center, Kuwait. Tel: 96647465 (M), E-mail: mottazsharkawi2002@hotmail.com



parents can play an important role in implementing 

the preventive programs dealing with these risk factors 

through communicating the concepts and importance 

of adopting these healthy behaviors to their children 

who are actually at a higher risk of developing type 2 

diabetes [7] . However, they have first to recognize the 

etiological factors of type 2 diabetes and then advise 

their children to adopt these behaviors [8] . Review 

of the available literature did not reveal any studies 

carried out in Kuwait on this subject. Thus the current 

study was planned to reveal the extent of giving advice 

about prevention of diabetes given by diabetic parents 

to their children who had not developed diabetes yet, 

and reveal its relation to recognizing the etiological 

risk factors, risk perception, and other parental factors 

related to diabetes. 

Study hypothesis 

Recognition by diabetic parents of etiological 

factors of diabetes and their risk perception as well as 

their physical health status would affect their ability to 

advise their children about adopting a healthy lifestyle 

to avoid development of diabetes. 


An observational cross-sectional study design was 

adopted for this purpose. The study was carried out 

at the Al-Yarmouk Health Center, Kuwait. All patients 

with type 2 diabetes aged less than 75 years and having 

non-diabetic children aged between 20 and 50 years 

were candidates for this study. Those suffering from 

mental retardation were excluded. Out of all diabetic 

patients attending the health center, only those fulfilling 

the entry criteria were included. A total of 231 eligible 

diabetic patients were recruited during the study period. 

Out of these, 31 patients refused to share in the study 

giving a response rate of 86.6%. The study covered the 

period from December 2011 to April 2012. 

Tools of the study 

A specially designed questionnaire was prepared 

for this study. It consisted of three parts. Part one dealt 

with socio-demographic characteristics of patients 

and included: age, sex, nationality, educational level, 

family history of diabetes, and living with offspring in 

the same house. Part two consisted of four questions 

in addition to measuring weight and height and 

calculation of body mass index. These four questions 

covered the physical status of the patient, namely, 

duration of diabetes, type and form of treatment, 

whether suffering from complications of diabetes, 

and hospitalization related to the disease. Part three 

of the questionnaire dealt with risk perception about 

diabetes. Four questions dealt with recognizing 

etiological factors of diabetes, namely, inactivity (lack 

of exercise), overeating, unbalanced diet and heredity. 

In addition one question dealt with risk of suffering 

from diabetes for offsprings with diabetic or nondiabetic 

parents. The main outcome question of this 

study was whether the parents actually advised their 

children to adopt a healthy lifestyle behavior. Their 

opinion about the necessity of giving their children 

an advice about adopting healthy behavior was also 

verified. 

A pilot study was carried out on 20 diabetic patients 

(not included in the final study) to test the clarity and 

applicability of the study tools. 

Data Management 

A pre-coded sheet was used. Data were fed to 

the computer directly from the questionnaire. The 

Excel program was used for data entry. Data entry 

was verified before analysis. Body mass index was 

calculated according to the following formula: weight 

[kg] / (height [meter]) 2 . The WHO recommendation for 

classification of BMI was adopted with the following 

cut off points: < 18.5 (underweight), 18.5 < 25 (normal 

weight), 25 < 30 (overweight), ≥ 30 (obese) [9] . 


Before analysis; data were imported to the 

Statistical Package for Social Sciences (SPSS) version 

17 which was used for both data analysis and tabular 

presentation. The following statistical measures were 

utilized: 

Descriptive measures: count, percentage, 

arithmetic mean, and standard deviation 

Analytic measures: Mann-Whitney test was used 

for quantitative variables with non-normal distribution 

Table 1: Characteristics of studied diabetic patients 

Characteristics 

Sex 

Male 

Female 

Nationality 

Kuwaiti 

Non-Kuwaiti 

Educational certificate 

Less than secondary 

Secondary 

University 

Postgraduate (master/doctorate) 

Under insulin treatment 

Experiencing complications of diabetes 

Hospital admission related to diabetes 

Family history of diabetes 

Living with their offspring 

Mean (SD) 

Age in years 

Body mass index (kg/m 2 ) 

Duration of diabetes in years 

n (%) 

84 (42.0) 

116 (58.0) 

151 (75.5) 

49 (24.5) 

83 (41.5) 

42 (21.0) 

70 (35.0) 

5 (2.5) 

45 (22.5) 

127 (63.5) 

44 (22.0) 

159 (79.5) 

162 (81.0) 

56.4 (10.7) 

31.2 (6.6) 

8.6 (7.6)

299 

Towards Prevention of Diabetes in Offsprings of Type 2 Diabetic Patients 


Table 2: Attitude of diabetics and their actual provision of advice on diabetes prevention 

Attitude 

Is it necessary to advice offsprings on diabetes? 

Have you actually given advice about diabetes to your offspring? 

Yes 

n (%) 

133 (66.5) 

81 (40.5) 

No 

n (%) 

67 (33.5) 

119 (59.5) 

while Student t test was used for quantitative variables 

with normal distribution. Odds ratio (OR), 95% CI 

(confidence interval), and Mantel Haenszel Chi square 

were used for studying association. Also Chi square 

was used to compare qualitative variables of sociodemographic 

characteristics. Multiple logistic regression 

technique was used to identify significant predictors of 

advising offspring after adjusting for the confounding 

effect of other variables. The level of significance selected 

for this study was a p-value of ≤ 0.05. 

All the necessary approvals for carrying out the 

research were obtained. The Ethical Committee of the 

Kuwaiti Health Science Center and Kuwait Institute 

for Medical Specializations (KIMS) approved the 

research. 

RESULTS 

Table 1 shows characteristics of the studied 

population. The majority were female (58.0%), 

Kuwaiti (75.5%) holding less than a university 

certificate (65.6%). The mean age of the whole group 

was 56.4 ± 10.7 years, with a mean body mass index 

indicating obesity (31.2 + 6.6 kg/m 2 ), and suffering 

from diabetes for a mean period of 8.6 + 7.6 years. 

Most of the studied diabetics were living with their 

offspring (81.0%) and had a positive family history 

of diabetes (79.5%). Although, only 22.0% were 

receiving insulin yet 63.5% suffered from one or more 

complications of diabetes. Those admitted to hospital 

due complications of diabetes constituted 22.0% of 

the sample. 

Table 3: Relationship between giving advice about diabetes to offspring and parental factors 

Parental factors 

Yes 

n (%) 

No 

n (%) 

OR (95% CI) 

p-value 

Sex 

Male 

Female 

Nationality 

Kuwait 

Non-Kuwaiti 

Education 

University + 

< University 

Obese 

Yes 

No 

Under insulin treatment 

Yes 

No 

Experiencing complications of diabetes 

Yes 

No 

Hospital admission related to diabetes 

Yes 

No 

Family history of diabetes 

Yes 

No 

Living with their offspring 

Yes 

No 

Mean ± SD 

Age 

Duration of diabetes 

39 (46.4) 

42 (36.2) 

63 (41.7) 

18 (36.7) 

38 (50.7) 

43 (34.4) 

40 (38.1) 

41 (43.2) 

22 (48.9) 

59 (38.1) 

31 (24.4) 

50 (68.5) 

16 (36.4) 

65 (41.7) 

57 (35.8) 

24 (58.5) 

67 (41.4) 

14 (36.8) 

52.2 ± 8.7 

8.5 ± 7.7 

45 (53.6) 

74 (63.8) 

88 (58.3) 

31 (63.3) 

37 (49.3) 

82 (65.6) 

65 (61.9) 

54 (56.8) 

23 (51.1) 

96 (61.9) 

96 (75.6) 

23 (31.5) 

28 (63.6) 

91 (58.3) 

102 (64.2) 

17 (41.5) 

95 (58.6) 

24 (63.2) 

59.2 ± 11.1 

8.7 ± 7.6 

1.53 (0.86 - 2.71) 

- 

1.23 (0.63 - 2.39) 

- 

1.96 (1.09 - 3.51) 

- 

0.81 (0.46 - 1.43) 

- 

1.56 (0.79 - 3.04) 

- 

0.15 (0.08 - 0.28) 

- 

0.80 (0.40 - 1.59) 

- 

0.39 (0.19 - 0.79) 

- 

1.20 (0.58 - 2.51) 

- 

- 

- 

0.1471 

0.5376 

0.0236* 

0.4675 

0.1939 

< 0.001* 

0.5279 

0.0085* 

0.6107 

< 0.001 

0.959 

* Significant : p ≤ 0.05; OR = Odds ratio; CI = Confidence interval



Table 4: Relationship between giving advice about diabetes to offspring and recognition of etiological factors 

Recognition of etiological factors 

Yes 

n (%) 

No 

n (%) 

OR (95% CI) 

p- value 

Lack of exercise 

Yes 

No 

Overeating 

Yes 

No 

Unbalanced diet 

Yes 

No 

Heredity 

Yes 

No 

Risk perception and advising 

Risk perception 

Yes 

No 

Necessary to give advice 

Yes 

No 

61 (48.4) 

20 (27.0) 

60 (42.9) 

21 (35.0) 

36 (37.5) 

21 (20.2) 

60 (53.1) 

28 (32.2) 

5 (85.7) 

75 (38.9) 

79 (59.4) 

2 (3.0) 

65 (51.6) 

54 (73.0) 

80 (57.1) 

39 (65.0) 

60 (62.5) 

83 (79.8) 

53 (46.9) 

59 (67.8) 

1 (14.3) 

118 (61.1) 

54 (40.6) 

65 (97.0) 

2.53 (1.36 - 4.71) 

- 

1.39 (0.74 - 2.61) 

- 

2.37 (1.26 - 4.46) 

- 

2.39 (1.33 - 4.27) 

- 

7.87 (0.90 - 68.66) 

- 

47.55 (11.16 - 202.49) 

- 

0.0030* 

0.3008 

0.0069* 

0.0032* 

0.0291* 

< 0.001* 

* Significant : p ≤ 0.05, OR = Odds ratio; CI = Confidence interval 

Table 2 reveals attitude of diabetics and their actual 

provision of advice to their offspring about prevention 

of diabetes. Just a total of 81 (40.5%) out of the studied 

diabetic subjects actually advised them about how to 

adopt preventive measures, while two thirds (66.5%) 

recognized that it is necessary to give advice to their 

offsprings. 

Table 3 portrays the relationship between giving 

advice about diabetes to offspring and parental 

factors. Those holding a university or higher certificate 

were more significantly likely to give advice to their 

offspring (OR = 1.96, 95% CI = 1.09 – 3.51, p = 0.0236). 

Those experiencing diabetic complications significantly 

tended not to advice their offspring as only 24.4% of 

them passed on this advice compared with 68.5% of 

those without complications (OR = 0.15, 95% CI = 

0.08 – 0.28, p < 0.001). The same trend was noticed for 

those with positive family history of diabetes as only 

35.8% of those with positive family history advised 

their offspring about diabetes prevention compared 

with 58.5% of those with negative family history of 

diabetes (OR = 0.39, 95% CI = 0.19 – 0.79, p = 0.0085). 

Diabetic patients giving advice to their offspring were 

significantly younger than those not giving advice 

(52.2 ± 8.7 compared with 59.2 ± 11.1 years, p < 0.001). 

Sex, obesity, regimen of treatment, hospital admission 

related to diabetes, living with offspring and duration 

of diabetes were not significantly associated with 

advising offspring about prevention of development 

of diabetes. 

Table 4 reveals the relationship between actually 

advising children about prevention of and recognition 

of etiological factors of diabetes. Univariate analysis 

showed that recognizing lack of exercise (OR = 2.53, 

95% CI = 1.36 – 4.71, p = 0.003), unbalanced diet (OR = 

2.37, 95% CI = 1.26 – 4.46, p = 0.0069), risk perception 

of diabetes (OR = 7.87, 95% CI = 0.90 – 68.66, p = 

0.0291), and necessity of giving advice about diabetes 

prevention to offspring (OR = 47.55, 95% CI = 11.16 

– 202.49, p < 0.001) are significantly associated with 

actually advising offsprings about diabetes. The only 

etiological factor that was not significantly associated 

with offspring advising was overeating (OR = 1.39, 955 

CI = 0.74 – 2.61, p = 0.3008). 

Table 5: Significant predictors of giving advice to offspring using stepwise forward likelihood multiple logistic regression 

Factor 

β Coefficient 

OR 

95% CI 

p-value 

Necessary to give advice to offspring 

Diabetes related complications 

Etiological recognition (Unbalanced diet) 

Age 

Constant 

23.60 

-1.48 

1.24 

-0.05 

-0.15 

23.60 

0.23 

3.46 

0.96 

- 

5.25 – 106.09 

0.10 – 0.50 

1.59 – 7.55 

0.91 – 0.99 

- 

< 0.001 

< 0.001 

0.002 

0.036 

0.915 

OR = Odds ratio; CI = Confidence interval 

The model could correctly classify 81.5%, with correction prediction ratio of those giving advice of 67% and 96% of those not giving advice.

301 

Towards Prevention of Diabetes in Offsprings of Type 2 Diabetic Patients 


Table 5 shows significant predictors of giving 

advice to offspring using stepwise forward likelihood 

multiple logistic regression. The first step for 

identifying the significant predictors was entering all 

the independent variables to the model. In the second 

step, all variables with 0.10 or less p- value were entered 

into a stepwise forward likelihood multiple logistic 

regression model. After adjusting for the confounding 

factors, only four factors proved to be significantly 

predicting advising offspring about diabetes. These 

factors included recognizing the importance of giving 

the advice as well as unbalanced diet as an etiological 

factor of diabetes. Young age and not suffering from 

diabetes complications proved to be significantly 

associated with advising offspring after adjusting for 

the confounding factors. 

DISCUSSION 

The growing diabetes pandemic that is spreading 

all over the world necessitates more attention and 

rapid effective programs to control its impact. A 

wide spectrum of interventions to prevent diabetes 

or delay its onset as well as control its complications 

is available. The feasibility and effectiveness of these 

interventions varies widely. Although communicating 

the potential risks of diabetes and recognition of the 

behavioral factors that may be closely linked to the 

disease is the main responsibility of the primary health 

care staff, parents can play an active role to educate 

their children who are at higher risk for developing 

type 2 diabetes [10] . Recent studies have illustrated the 

potential for intervention in persons with impaired 

glucose tolerance to reduce progression to type 2 

diabetes. A study in the United States showed that 

lifestyle intervention (diet and exercise) reduced the 

risk of this progression by 58% [11] . Two other large-scale 

studies from China [12] , and Finland [13] demonstrated 

effects similar to the American study. In the Finnish 

study, the cumulative incidence of diabetes after four 

years was 11% in the intervention group and 23% in the 

control group. During the trial, the risk of diabetes was 

reduced by 58% (p < 0.001) in the intervention group, 

and was directly associated with changes in lifestyle. 

Proper risk perception of diabetic parents and 

adopting a positive attitude toward prevention of 

diabetes among their offspring can urge them to educate 

their children and guide them to adopt a healthy 

behavior. Thus, the current study was formulated to 

investigate the factors that can stimulate parents to 

advise their offsprings about diabetes prevention and 

the factors affecting the giving of this advice. Several 

studies were carried out in Kuwait to reveal knowledge 

of diabetic patients about etiological risk factors and 

management procedures to deal with the disease. One 

study revealed that mean score for the total knowledge 

test was 58.9% [14] . Knowledge deficits were apparent in 

the questions related to diet and self-care. 

One study carried out in Japan revealed that 

diabetic disease status was related to giving advice. 

Use of insulin or oral treatment and the presence 

of complications were related to giving advice [7] . 

However, the results of this study revealed that 

patients with complications were less likely to advise 

their children (OR = 0.15, 95% CI =0.08-0.28). The same 

trend was noticed for family history as those with 

positive family history were also less likely to advise 

their children (OR = 0.39, 95% CI = 0.19-0.79). The 

absence of complications might be due to adopting 

effective techniques and behavior that might stimulate 

them to advise their children to adopt these successful 

lifestyles. Also, a negative family history which means 

that the diabetic parent is the only person in the family 

with diabetes might make them feel that they have a 

greater responsibility toward advising their children. 

Delaying the onset of type 2 diabetes depends 

essentially on implementing successful lifestyle 

intervention strategies [15] . Cognitive and behavioral 

strategies have been used to reduce weight through 

dietary restriction and increased physical activity [16] . 

However, to be able to implement these healthy 

behaviors; diabetic patients must first recognize 

the importance as well as the role of these factors in 

preventing diabetes. However, the association between 

risk perception and behavior has been inconsistent; 

while some studies revealed a positive association 

between risk perception and health behaviors [17] , other 

studies failed to demonstrate this association [18] . This 

might be attributed to the poorly specified relationship 

between behavior and risk perception. Also, other 

factors may affect relationship such as knowledge of 

diabetes factors, perceived personal control, or the 

degree to which one believes that risk is modified by 

one’s action, and optimistic bias, or one’s assessment 

of their risk compared with others like them [19] . 

One finding about risk perception revealed by this 

study is the very low recognition of the probability 

of children to develop type 2 diabetes in presence of 

positive family history when compared with negative 

history. Similar findings were revealed by a Korean 

study among offspring of diabetic parents where only 

9.9% of the study children could correctly perceive 

their risk of developing diabetes [20] . 

Multiple logistic regression revealed that young 

age, not experiencing complication related to diabetes, 

and recognizing the importance of the role of healthy 

behavior in preventing diabetes development as well 

as specifically recognizing the role of unbalanced 

diet are significant predictors for advising children. 

In Japan, a similar study dealing with passing of 

advice to children revealed that being male, living 

with offspring, hospitalizations related to diabetes, 

suffering from complications, risk perception, and



recognizing the role of lack of exercise as an etiological 

factor for diabetes proved to be significantly associated 

with giving advice to children in the multiple logistic 

regression [7] . The differences between the two studies 

might be attributed to the difference in culture and 

the high prevalence of factors such lack of activity and 

obesity. 

Although this study dealt with a relatively large 

number and a high response rate, yet, due to the 

nature of the study, some limitations can be identified. 

These limitations include dealing only with a sample 

from one primary health care center which might 

undermine generalization of the results. The study is 

a cross-sectional one, while perception of risk would 

be more appropriately a longitudinal study. Thus, it 

is recommended that a large study sample involving 

diabetic patients representing the whole state of 

Kuwait be undertaken in order to confirm the results 

of this study. 

CONCLUSION 

The findings of the current study illustrate the 

need to improve the knowledge and perception of 

type 2 diabetic patients about the etiological factors of 

diabetes as well as perception of risk of development 

of diabetes among their offsprings. It is essential 

to encourage parents to advise their children to 

adopt healthy lifestyle behavior. In this context, a 

comprehensive approach that addresses behavioral, 

social, and physical environment interventions is 

expected to achieve the required outcomes. Proper risk 

communication from primary health care workers to 

parents and their children needs more attention in the 

primary health care units. 

REFERENCES 

1. Hivert MF, Grant RW, Warner AS, Meigs JB, Shrader P. 

Diabetes risk perception and intention to adopt healthy 

lifestyles among primary care patients. Diabetes Care 

2009; 32:1820-1822. 

2. Wild S, Roglic G, Green A, Sicree R, King H. Global 

prevalence of diabetes: estimates for the year 2000 and 

projections for 2030. Diabetes Care 2004; 27:1047-1053. 

3. International Diabetes Federation. IDF Diabetes Atlas. 

4th edn. Brussels: IDF, 2009. 

4. Jermendy G, Horváth T, Littvay L, et. al. Effect of genetic 

and environmental influences on cardiometabolic risk 

factors: a twin study. Cardiovasc Diabetol 2011; 3:10:96. 

5. Alhyas L, McKay A, Balasanthiran A, Majeed A. 

Prevalences of overweight, obesity, hyperglycaemia, 

hypertension and dyslipidaemia in the Gulf: systematic 

review. J R Soc Med Sh Rep 2011; 2:55-70. 

6. Knowler WC, Barrett-Connor E, Fowler SE, Hamman 

RF, Lachin JM, Walker EA. Diabetes Prevention Research 

Group. Reduction in the incidence of type 2 diabetes 

with lifestyle intervention or metformin. N Engl J Med 

2002; 346:393-403. 

7. Nishigaki M, Kobayashi K, Kato N, et al. Preventive 

advice given by patients with type 2 diabetes to their 

offspring. Br J Gen Pract 2009; 59:37-42. 

8. Gustafson PE. Gender differences in risk perception: 

theoretical and methodological perspectives. Risk Anal 

1998; 18:805-811. 

9. World Health Organization. Obesity: preventing and 

managing the global epidemic. WHO Technical Report 

Series 2000; 894:1-253. 

10. Brekke HK, Sunesson A, Axelsen M, Lenner RA. 

Attitudes and barriers to dietary advice aimed at 

reducing risk of type 2 diabetes in first-degree relatives 

of patients with type 2 diabetes. J Hum Nutr Diet 2004; 

17:513-521. 

11. Larkin M. Diet and exercise delay onset of type 2 

diabetes, say US experts. Lancet 2001; 358:565. 

12. Pan XR, Li GW, Hu YH, et al. Effects of diet and exercise 

in preventing NIDDM in people with impaired glucose 

tolerance. The Da Qing IGT and Diabetes Study. 

Diabetes Care 1997; 20:537-544. 

13. Tuomilehto J, Lindstrom J, Eriksson JG, et al. Prevention 

of type 2 diabetes mellitus by changes in lifestyle among 

subjects with impaired glucose tolerance. N Engl J Med 

2001; 344:1343-1350. 

14. Al-Adsani AM, Moussa MA, Al-Jasem LI, Abdella NA, 

Al-Hama NM. The level and determinants of diabetes 

knowledge in Kuwaiti adults with type 2 diabetes. 

Diabetes Metab 2009; 35:121-128. 

15. Gillies CL, Abrams KR, Lambert PC, et al. 

Phar¬macological and lifestyle interventions to 

pre¬vent or delay type 2 diabetes in people with 

impaired glucose tolerance: systematic review and 

meta-analysis. BMJ 2007; 334:299. 

16. Marrero DG, Ackermann RT. Providing long-term 

support for lifestyle changes: A key to success in 

diabetes prevention. Diabetes Spectrum 2007; 20:205- 

209. 

17. Benner JS, Cherry SB, Erhardt L, et al. Rationale, design, 

and methods for the risk evaluation and communication 

health outcomes and utilization trial (REACH OUT). 

Contemp Clin Trials 2007; 28:662-673. 

18. Koelewijn-van Loon MS, van Steenkiste B, Ronda G, 

et al. Improving patient adherence to lifestyle advice 

(IMPALA): a cluster-randomised controlled trial on 

the implementation of a nurse-led intervention for 

cardiovascular risk management in primary care 

(protocol). Health Serv Res 2008; 8:9-23. 

19. Benner JS, Erhardt L, Flammer M, et al. A novel 

programme to evaluate and communicate 10-year risk 

of CHD reduces predicted risk and improves patients’ 

modifiable risk factor profile. Int J Clin Pract 2008; 

62:1484-1498. 

20. Kim J, Choi S, Kim CJ, Oh Y, Shinn SH. Perception 

of risk of developing diabetes in offspring of type 2 

diabetic patients. Korean J Intern Med 2002; 17:14-18.

303 




Stereotactic Surgery: Diagnostic and Therapeutic 

Role in the Management of Brain Disorders 

and Our Experience at Ibn Sina Hospital 

Hasan Khajah, Aftab Khan, Yousaf Al Awadi, Abbas Ramadan 

Department of Neurological Surgery, Ibn Sina Hospital, Kuwait 


ABSTRACT 

Objectives: To present the results of our experience with 

stereotactic surgery, which is a safe and minimally invasive 

technique, in the field of neurosurgery. 

Design: Prospective study 

Settings: Department of Neurosurgery, Ibn Sina Hospital, 

Kuwait 

Subjects and Methods: Forty patients underwent stereotactic 

surgery for diagnostic and therapeutic purposes during 

the five years between 2006 and 2011. There were 26 male 

and 14 female patients with a mean age of 47 years (range 

9 – 70 yrs). Twenty seven (67.5%) patients had diagnostic 

brain procedures and 13 (32.5%) had diagnostic as well 

as therapeutic procedures. The stereotactic surgery was 

carried out with the help of computerized tomography (CT) 

- guided Leksell stereotactic frame® and Leksell SurgiPlan® 

software. 

Intervention: Stereotactic surgery 

Main Outcome Measures: Outcome of surgery and 

complications 

Results: Stereotactic biopsies confirmed 28 (70%) patients 

with brain tumors; six (14%) with cerebral infections, four 

(10%) with multiple sclerosis and one with cerebral infarction. 

Stereotactic aspirations were performed in nine patients; 

four with cystic brain tumors and five with brain abscesses. 

Stereotactic insertion of Ommaya reservoir was performed in 

four patients with cystic brain lesions. Complication, related 

to the procedure was observed only in one patient and was 

managed conservatively. No other morbidity or mortality 

was noted. 

Conclusions: Stereotactic surgery is a minimal invasive 

technique that helps the neurosurgeon in further planning 

of an appropriate treatment after tissue biopsy. It can also 

be used as primary mode of treatment in patients with brain 

abscesses, cysts and intracranial hematomas. 

KEY WORDS: brain abscess, brain tumors, minimally invasive surgery, stereotactic surgery 

INTRODUCTION 

Most neurosurgical patients can be diagnosed 

correctly on the basis of the natural history of their brain 

disorders and after clinical, laboratory and imaging 

findings but in some cases, diagnosis is difficult and 

the treatment is based on presumptive diagnosis. 

Stereotactic surgery is an image-guided technique 

which is used to detect the nature of lesion and decide 

about the appropriate treatment plan. This technique 

is used for an accurate localization of anatomical or 

pathological brain structures in three-dimensional (3- 

D) space. 

Leksell stereotactic system is unique for its 

simplicity, accuracy and versatility [1] . It is light weight 

frame and all three (x, y and z) coordinates can be 

calculated quickly from a 2-dimensional image 

without a computer. Stereotactic biopsy is used as 

a diagnostic tool to obtain tissue samples that are 

suspicious for tumors, infections, infarctions or other 

brain pathologies like neurodegenerative disease. 

This is the most accurate method of taking biopsies 

in deep or highly functional areas of the brain and in 

patients with multiple brain lesions or in medically 

compromised patients with minimal morbidity and 

mortality [2-4] . 

Stereotactic aspiration is a valuable procedure in 

this field for the primary treatment of different brain 

tumors like gliomas (cystic part), craniopharyngiomas [5] 

and colloid cysts [6-7] . 

Stereotactic drainage is also a treatment of choice 

for brain abscesses. Kondziolka et al [8] treated 16 

patients with deeply located brain abscesses using this 


Dr Hasan Khajah MD, Department of Neurosurgery, Ibn Sina Hospital, P O Box 25427, Safat 13115, Kuwait. Tel: +965 2484-0300, ext 5577, Fax : +965 

2484-9226, E-mail : haskhajah@yahoo.se



technique for diagnosis and abscess drainage. Lunsford 

et al [9] reported good results with overall bacteriologic 

identification of 97% and cure rates of 72% in patients 

with brain abscesses. Stereotactic aspirations of 

intracerebral hypertensive hemorrhages (acute or 

subacute) have shown encouriging results [10] . Catheter 

reservoirs may be implanted into the hematoma, 

followed with streptokinase or tissue plasminogen 

activator injections to lyse the clot [11] . 

Although it is a minimally invasive technique, yet 

complications have been reported. Sometimes, sample 

of the brain tissue taken for biopsy may be nondiagnostic 

and may warrant a repeat biopsy. Other 

risks include intracranial hemorrhage, infection or 

seizures. 

Appuzo et al [12] reported 1% morbidity (intracranial 

hemorrhage, infection, increased neurological deficit 

and seizures) and 0.2 % mortality. Lunsford et al [13] 

reported postoperative complications in 2.9% (77) 

patients in a series of 2651 patients who underwent 

different stereotactic procedures. Out of those, 

intracranial hemorrhage occurred in 55 (2.07%) 

patients; 11 (0.41%) had local infections at pin sites; 

11 (0.41%) patients had post-procedural seizures. 

Two (0.075%) patients died from the complications of 

the procedure. Although some centers are currently 

migrating to frameless stereotactic procedures, their 

complication rates are yet to be reported [13] . 

PATIENTS AND METHODS 

Between 2005 and 2011, we have managed 40 

patients with stereotactic surgery. The patients were 

selected on the basis of following diagnostic and 

therapeutic indications. 

Diagnostic 

1. Tumors not correlating with their natural history 

2. Multiple brain lesions 

3. Small and deeply located tumors 

4. Patients in good clinical condition (Karnofsky score 

> 70) 

Therapeutic 

5. Cystic lesions that need aspiration 

6. Intracranial abscesses 

The mean age of the patients was 47 years (range 9 

- 70 years). There were 26 male and 14 female patients. 

Most of the patients presented with occasional 

headaches followed by nausea. Five patients 

presented with focal seizures and 12 with neurological 

deficits. Twenty patients had lesions, located in the 

supratentorial region, 12 in the thalamic and basal 

ganglia area, two in the suprasellar region and seven 

had multiple intracranial lesions. Stereotactic surgery 

was performed with computed tomography (CT)/ 

magnetic resonance imaging (MRI) - guided Leksell 

stereotactic system® and Leksell SurgiPlan® software 

v2.20. The procedure started with fixation of Leksell 

frame to the head after conscious sedation and local 

anesthesia (Fig. 1). All the patients underwent CT 

scan with contrast after the attachment of the fiducial 

box to the frame. All the brain images were exported 

to the computer workstation through Dicom system. 

Fig.1: Application of Leksell frame and the arc in a 45 years old 

patient who underwent stereotactic biopsy for the suspected tumor 

Coordinates (x, y, z) were calculated with the help 

of Leksell surgiplan® software v2.20. Under general 

anesthesia, the patient’s head was fixed onto the 

Mayfield skull clamp. An arc of the stereotactic system 

was attached to the base ring of Leksell frame and 

positioned according to the calculated coordinates 

so that its center coincides with the selected brain 

target. The choice of entry point is free and can be 

reached from any direction without the need of 

computer calculation (Fig. 2). It depends upon the 

location, size, and consistency and the intervening 

neural and vascular structures. The entry point should 

minimize the length of passage through the brain 

and avoid eloquent areas. At the point of entry, a 

small skin incision is given, a burr hole is made and 

the dura opened to allow visualization of the cortex. 

It provides complete freedom of choice of trajectory 

and entry point selection. The specimen is taken from 

the selected target with the help of biopsy needle and 

stored in a bottle with formalin solution and sent for 

histopathology. The frame is removed and the patient 

is sent for CT scan of brain to rule out any postoperative 

complication like hemorrhage and is then transferred 

to the recovery room. 

RESULTS 

Stereotactic biopsy established brain tumors in 

28 (70%) patients, brain abscesses in five (12.5%) and

305 

Stereotactic Surgery: Diagnostic and Therapeutic Role in the Management of Brain ... 


Fig. 2: Stereotactic SurgiPlan of a 60-year-old female patient with a large cystic glioma 

neurodegenerative diseases (multiple sclerosis) in four 

(10%) patients. One had fungal infection (Aspergilliosis) 

and another had brain infarction (Stroke). The biopsy 

was negative in one patient and was not repeated due 

to refusal by the relatives (Fig. 1). Patients with stroke 

and multiple sclerosis were referred to neurology 

for their management. Patients with pyogenic brain 

abscesses were treated by stereotactic aspiration along 

Table 1: Results of stereotactic biopsy of 28 patients with brain 

tumors done at Ibn Sina Hospital. 

Histological diagnosis 

Patients 

(n = 28) 

Gliomas (N = 21 patients) 

Pilocytic Astrocytomas (WHO* Grade I) 4 

Anaplastic Astrocytomas (WHO Grade III) 2 

Glioblastoma Multiforme (WHO Grade IV) 14 

Anaplastic Ganglioglioma 1 

Others (N = 7 patients) 

Lymphomas 2 

Tuberculoma 1 

Brain Metastasis (Lung Carcinoma) 1 

Malignant Melanoma 1 

Craniopharyngiomas 2 

* WHO- World Health Organization 

with administration of adequate antibiotics (Fig. 3a & 

3b). All these patients recovered and are doing well 

at two to five years follow-up. Patient with cerebral 

fungal infection was managed conservatively with 

antifungal drugs and recovered. Among 28 patients 

with brain tumors, 21 were diagnosed with gliomas 

of different grades according to World Health 

Organization (WHO) grading system; (4 patients with 

Grade 1; 3 patients with Grade III; 14 patients with 

Grade IV). The other pathologies were lymphoma 

in two, craniopharyngioma in two, brain metastasis 

(from lung carcinoma) in one, malignant melanoma in 

one and tuberculoma in one patient (Table 1). Out of 28 

patients with brain tumors, eight (28.6%) patients were 

managed with stereotactic therapeutic procedures. 

Stereotactic aspiration of the cystic part of the tumor 

was performed in four patients (2 patients with 

GBM; one with pilocytic astrocytoma and one with 

malignant glioma) and insertion of Ommaya reservoir 

was done in four patients (2 in pilocytic astrocytomas; 

one in GBM and one in recurrent craniopharyngioma). 

After the procedure, all the patients were referred for 

chemotherapy and radiation therapy. All the patients 

with GBM, lymphoma, recurrent craniopharyngioma, 

malignant melanoma were without mass effect



Fig. 3: MRI of the patient with brain abscess, showing pre (3a) and 

post-radiosurgery imaging (3b) 

and were referred for chemotherapy and radiation 

therapy. The patient with brain metastasis was further 

investigated and his origin of the primary disease was 

found to be in the lungs. The patient was referred to 

radiation oncologist for further management. 

Stereotactic drainage of the intracranial abscess 

was performed in five patients. Pus was sent for 

culture sensitivity and postoperatively, patients 

were managed conservatively with antibiotics. 

Post surgical imaging showed reduction in size of 

the abscess cavities and clinically all the patients 

improved. 

Post-operative complication occurred in one 

patient. This was asymptomatic hemorrhage after 

tissue biopsy which was managed conservatively. 

There was no other procedure-related morbidity or 

mortality. 

DISCUSSION 

Stereotactic surgery has been recognized since 

many decades after the use of freehand biopsy 

techniques resulted in too many postoperative 

complications [14-16] . 

Stereotactic surgery either for diagnosis or 

treatment provides us precision, accuracy and safety 

to localize the target in the brain. Stereotactic biopsy 

stresses the importance of histological diagnosis 

with low morbidity and zero mortality. Many reports 

are published in the literature on the safe use of this 

technique and a tissue diagnosis is always required 

prior to treatment for most cerebral lesions. In their 

early experience, Lunsford et al [17] published results of 

102 patients with brain disorders who were referred 

to University of Pittsburgh for surgical exploration, 

using CT-guided stereotactic system. All the patients 

were referred because of critical size and location of 

the lesions in brain. Diagnostic stereotactic biopsy 

demonstrated diagnosis in 98 (96.1%) patients. 

Direct therapeutic intervention using this technique 

was possible in 26 (25.5%) patients. There was no 

morbidity and mortality seen in this early series. 

According to them, histological diagnosis must be 

sought in all patients with symptomatic brain lesions 

regardless of their size or location and “Empiric” 

forms of therapy are no longer justified in the age 

of CT scanning. Lunsford et al[ 18] reported another 

series of 39 patients with craniopharyngiomas who 

underwent multimodality stereotactic techniques. 

Cystic craniopharyngiomas were treated successfully 

with stereotactic implantation of radioactive P32 in 

the cystic cavity of the tumor. The success rate was 

96%. Kondziolka et al [9] reported a series of 29 patients 

with brain abscess. Out of these, 22 (76%) patients had 

stereotactic abscess drainage with purulent centers 

and seven (24%) patients underwent lesion biopsy 

for diagnosis. Twelve patients with large abscesses of 

diameter > 3 cm, underwent stereotactic insertion of 

drainage catheters. Long-term clinical and imaging 

follow-up confirmed disease resolution in 21 patients 

(72%) and eventual abscess resolution occurred 

in an additional six patients (21%), who required 

multiple procedures. Lakecivic et al [19] published an 

article to differentiate the results of survival and 

outcome of patients with malignant brain gliomas 

who were treated by different modes. The control 

group of 21 patients had undergone craniotomy and 

surgical excision, followed by oncological protocol 

while the case group of 11 patients underwent 

stereotactic biopsy followed by oncological protocol. 

The majority of patients diagnosed by a stereotactic 

biopsy survived for more than two years. The 

survival and outcome for the patients in whom a 

stereotactic biopsy was performed were notably 

better compared to the patients who were diagnosed 

after surgical excision. Consequently, it appears 

that a stereotactic biopsy is a better option for 

primary treatment of patients with malignant brain 

gliomas when the survival and quality of life are 

concerned. Broggi et al [20] published their experience 

in 35 patients who underwent stereotactic biopsy 

for deeply located lesions. According to them, the 

biopsies confirmed the diagnosis based on clinical 

and imaging findings in 25 patients but in 10 patients 

the histological diagnosis was different from the 

presumptive one. The treatment option was changed 

in these ten patients. Ostertag et al [4] reported their 

experience with 302 cases of stereotactic biopsy and 

advocated that exploratory craniotomies, risky freehand 

punctures and aspirations deep in the brain 

should not be done without prior diagnosis. 

Our report emphasises the importance of 

histological diagnosis to avoid the hazards of 

treatments based on clinical and radiological 

findings. Only one of 40 patients had complication, 

which shows safety profile of frame based stereotactic 

surgery.

307 

Stereotactic Surgery: Diagnostic and Therapeutic Role in the Management of Brain ... 


CONCLUSION 

Results of our study showed that stereotactic surgery 

is a safe and accurate technique which is introduced 

and applied safely in Kuwait for the management of 

different brain disorders. 

REFERENCES 

1. Leksell L. A stereotactic apparatus for intracranial 

surgery. Acta Chir Scand 1949; 99:229-233. 

2. Gildenberg PL, Kaufman HH, Murthy KSK. Calculation 

of stereotactic coordinates from the computed 

tomographic scan. Neurosurgery 1982; 10:580-586. 

3. Kelly PJ, Earnest F, Kall BA, Goerss SJ, Scheithauer B. 

Surgical options for patients with deep-seated brain 

tumors: computer-assisted stereotactic biopsy. Mayo 

Clin Proc 1985; 60:223-229. 

4. Ostertag CB, Mennel HD, Kiessling M. Stereotactic 

biopsy of brain tumors. Surg Neurol 1980; 14:275-283. 

5. Lunsford LD. Stereotactic treatment of 

craniopharyngioma: intracavitary irradiation and 

radiosurgery. Cont Neurosurg 1989; 11:1-6. 

6. Hall, WA, Lunsford LD. Stereotactic management of 

colloid cysts. Factors predicting success. J Neurosurg 

1991; 75:45-51. 

7. Kondziolka D, Lunsford LD. Stereotactic techniques 

for colloid cysts: roles of aspiration, endoscopy, and 

microsurgery. Acta Neurochir Suppl 1994; 61:S76-78. 

8. Kondziolka D, Duma CM, Lunsford LD. Factors 

that enhance the likelihood of successful stereotactic 

treatment of brain abscesses. Acta Neurochir 1994; 

127:85-90. 

9. Lunsford LD. Stereotactic drainage of brain abscesses. 

Neurol Res 1987; 9: 270-274. 

10. Backlund EO, Von Holst H. Controlled subtotal 

evacuation of intracerebral hematoma by stereotactic 

technique. Surg. Neurol 1978; 9:99-101. 

11. Broseta J, Gonzales-Darder J, Barcia-Salorio JL. 

Stereotactic evacuation of intracerebral hematomas. 

Appl Neurophysiol. 1982; 45:443-448. 

12. Apuzzo ML, Chandrasoma PT, Cohen D, Zee CS, 

Zelman V. Computed imaging stereotaxy: experience 

and perspective related to 500 procedures applied to 

brain masses. Neurosurgery 1987; 20:930-937. 

13. Lunsford DL, Niranjan A, Khan A, Kondziolka D. 

Establishing a benchmark for complications using 

frame-based stereotactic surgery. Stereotact Funct 

Neurosurg 2008; 86:278-287. 

14. Spiegel, EA, and Wycis, HT. Stereoencephalotomy. 

Grune & Stratton 1962 

15. Leksell L. The stereotaxic apparatus for intracranial 

neurosurgery. Acta Chir Scand 1949; 99:229-253. 

16. Backlund EO: A new instrument for stereotaxic brain 

tumor biopsy: technical note. Acta Chir Scand 1971; 

137:825-827. 

17. Lunsford LD, Martinez AJ. Stereotactic exploration 

of the brain in the era of computed tomography. Surg 

Neurol 1984; 22:222-230. 

18. Lunsford LD, Pollock BE, Kondziolka DS, Levine G, 

Flickinger JC. Stereotactic options in the management of 

craniopharyngioma. Pediatr Neurosurg 1994; 21:90-97. 

19. Lakicević G, Splavski B, Brekalo Z. The value of 

stereotactic biopsy in improving survival and quality of 

life for malignant brain glioma patients. Coll Antropol 

2010; 34:S93-97. 

20. Broggi G, Franzini A. Value of serial stereotactic 

biopsies and impedance monitoring in the treatment 

of deep brain tumors. J Neurol Neurosurg Psychiatry 

1981; 44:397-401.




Synergy between Dendritic Cell-Based Vaccine 

and Anti-CD137 Monoclonal Antibody in the 

Treatment of Mouse Renal Cell Carcinoma 

Si-Ming Wei 1,2 , Zhi-Zhong Yan 3 , Jian Zhou 4 

1 

Department of Surgery, Zhejiang Medical College, Hangzhou City, Zhejiang, China 

2 

Department of Urology, Third Affiliated Hospital, Zhejiang Chinese Medical University, Hangzhou City, Zhejiang, China 

3 

Department of Reproductive Medicine, Red Cross Hospital, Hangzhou City, Zhejiang, China 

4 

Department of Surgery, First Affiliated Hospital, Zhejiang Chinese Medical University, Hangzhou City, Zhejiang, China 


ABSTRACT 

Objective: Therapeutic efficacy of dendritic cell-based 

vaccine for renal cell carcinoma remains limited. In this study, 

we investigated whether anti-CD137 monoclonal antibody is 

capable of potentiating anti-tumor effect of dendritic cellbased 

vaccine. 

Design: Experimental study 

Setting: Research laboratory 

Subjects: Balb/c mice (8-10 weeks old) 

Interventions: A renal cell carcinoma model was established by 

subcutaneous injection of Renca tumor cells into Balb/c mice 

on day 0. After three days, tumor-bearing mice were treated 

with Renca tumor lysate-pulsed dendritic cells (i.e., dendritic 

cell-based vaccine), anti-CD137 monoclonal antibody, or 

combination of Renca tumor lysate-pulsed dendritic cells with 

anti-CD137 monoclonal antibody. Mice were killed on day 20 

after tumor cell inoculation, and spleens were harvested for 

analysis of anti-tumor immune responses. 

Main Outcome Measures: The anti-tumor immune responses 

were analyzed by measuring proliferation and activity of T 

cells, which have the ability to kill tumor cells. The anti-tumor 

effect was assessed by measuring tumor size. 

Results: The combination therapy with Renca tumor lysatepulsed 

dendritic cells and anti-CD137 antibody significantly 

increased T-cell proliferation and activity, and significantly 

inhibited tumor growth, compared with a single treatment 

with Renca tumor lysate-pulsed dendritic cells or anti-CD137 

antibody. 

Conclusion: These results suggest that combination therapy 

can enhance anti-tumor effect by increasing T-cell proliferation 

and activity. 

KEY WORDS: CD137, dendritic cell vaccine, immunotherapy, mouse tumor models, renal cell carcinoma 

INTRODUCTION 

Human renal cell carcinoma accounts for 

approximately 2 - 3% of all adult cancers [1] . It has 

the third highest mortality rate among genitourinary 

malignancies, with an estimated 12,000 deaths per 

year [1,2] . Incidence rates for renal cell carcinoma have 

been increasing continuously by 2 - 3% per year [1,2] . 

More than 30% of renal cell carcinoma patients have 

metastatic disease at the time of diagnosis, thereby 

losing the chance of an operation [3] . In addition, 30% 

of patients with primary localized renal cell carcinoma 

will subsequently develop metastatic spread after 

radical nephrectomy [4] . Metastatic renal cell carcinoma 

is resistant to conventional therapies, such as 

chemotherapy and radiotherapy [5] . As a result, these 

patients with metastatic renal cell carcinoma have a 

poor prognosis with 2-year survival rate of < 20% [6] . 

The spontaneous regression of metastases has been 

reported in 1 - 6% of metastatic renal cell carcinoma 

patients [7] . Furthermore, many studies have revealed 

infiltration of renal cell carcinoma tissue with T 

lymphocytes and dendritic cells [8] . These findings 

suggest that immune system plays an important role in 

controlling renal cell carcinoma growth. Therefore, the 

present treatment strategy for renal cell carcinoma is to 

stimulate the patient’s immune system to increase antitumor 

immune response by using immunostimulatory 

cytokines, such as interferon-α and interleukin-2 [9] . 

Clinical trials have shown that cytokine therapy with 

interferon-α and interleukin-2 can produce objective 


Si-Ming Wei, MD, PhD, Department of Surgery, Zhejiang Medical College, Hangzhou City, Zhejiang Province, 310053, China. Tel: +86 571 81710893, 

E-mail: wsm1971@hotmail.com

309 

Synergy between Dendritic Cell-Based Vaccine and Anti-CD137 Monoclonal ... 


responses in 10 - 15% of patients, but is associated with 

severe toxicity [4,10] . Hence, new immunotherapeutic 

approaches with more effective anti-tumor activity 

and less toxicity are urgently required. 

The recent trend in cancer immunotherapy has been 

directed toward dendritic cell-based vaccine. It can 

induce anti-tumor immune response by activation of 

tumor-specific T lymphocytes [11] . In 14 clinical studies, 

197 patients with metastatic renal cell carcinoma 

underwent therapy with dendritic cell-based vaccine [12] . 

According to the World Health Organization criteria, 

clinical responses to vaccine are defined as follows [13] . 

Complete response means complete disappearance 

of tumor; partial response means ≥ 50% decrease in 

tumor size without the appearance of new metastases; 

stable disease means < 50% decrease or < 25% increase 

in tumor size; and progressive disease means ≥ 25% 

increase in tumor size or the appearance of new 

metastases. Out of the 197 patients, 73 (37%) had clinical 

response with four complete responses, eight partial 

responses and 61 disease stabilizations [12] . Only mild 

side-effects, such as low-grade fever, fatigue, diarrhea, 

flulike symptoms, and local reactions around the 

injection site, were observed in these patients. Though 

dendritic cell-based vaccine had encouraging results 

in the treatment of metastatic renal cell carcinoma, 

clinical response rate remained limited. Dendritic cellbased 

vaccine was administered in combination with 

interleukin-2 to treat patients with metastatic renal 

cell carcinoma in order to improve vaccine efficacy [14] . 

However, clinical response rate was 40%, similar to 

single treatment with dendritic cell vaccine. Therefore, 

new approaches to significantly increase vaccine effect 

are needed. 

The CD137 (4-1BB), a member of tumor necrosis 

factor receptor (TNFR) superfamily, is an inducible costimulatory 

molecule expressed primarily on activated 

T cells [15] . Ligation of CD137 by anti-CD137 monoclonal 

antibody delivers a potent co-stimulatory signal to T 

cells, and enhances proliferation and activity of T cells, 

which have the ability to kill tumor cells [16] . Previous 

study has demonstrated that treatment of tumorbearing 

mice with anti-CD137 antibody can result in 

T cell-mediated tumor rejection [17] . We hypothesized 

that anti-CD137 antibody may potentiate anti-tumor 

effect of dendritic cell-based vaccine. The reason is as 

follows. Treatment with dendritic cell-based vaccine 

induces up-regulation of CD137 expression on T cells 

by activating T cells. Subsequent administration of anti- 

CD137 antibody further increases T cell proliferation 

and activity through ligation of CD137 on T cells, 

thereby strengthening anti-tumor effect. To confirm 

this hypothesis, we investigated the combined effect of 

dendritic cell-based vaccine with anti-CD137 antibody 

in renal cell carcinoma mouse model. 

MATERIALS AND METHODS 

Animals 

Balb/c mice, 8 - 10 weeks of age, were obtained 

from Shanghai Laboratory Animal Center (Shanghai 

City, China) and maintained under specific pathogenfree 

conditions. They were provided with sterilized 

food and water ad libitum. All animal experiments 

were conducted in accordance with the US National 

Institutes of Health guidelines for appropriate use 

of experimental animals and approved by Animal 

Research and Care Committee at our university. 

Preparation of dendritic cell-based vaccine 

Dendritic cell-based vaccine was prepared as 

described by Lim et al [18] . In brief, bone marrow cells 

of Balb/c mice were cultured in complete medium 

supplemented with 10 ng/ml recombinant mouse 

granulocyte macrophage colony-stimulating factor 

(R & D Systems, Minneapolis, MN, USA) and 10 ng/ml 

recombinant mouse interleukin-4 (R&D Systems, 

Minneapolis, MN, USA). Complete medium consisted 

of RPMI-1640 containing 10% heated-inactivated fetal 

bovine serum, 2 mmol/l L-glutamine, 100 units/ml 

penicillin and 100 μg/ml streptomycin (all from Life 

Technologies, Grand Island, NY, USA). On day two, 

suspended cells were removed and adherent cells 

were cultured in fresh complete medium containing 

cytokines. Half of the medium was replaced with 

fresh medium containing cytokines every other day. 

On day seven, nonadherent and loosely adherent cells 

(i.e., immature dendritic cells) were harvested. The 

Balb/c-derived renal cell carcinoma cell line (Renca) 

was obtained from American Type Culture Collection 

(Manassas, VA, USA) and suspended in phosphatebuffered 

saline. Renca tumor cell lysate was prepared 

by four rapid freeze-thaw cycles (liquid nitrogen, 

37 °C water bath). In order to induce dendritic cell 

maturation, immature dendritic cells were incubated 

with Renca tumor cell lysate at the ratio of three tumor 

cells lysate to one dendritic cell in complete medium. 

After 8 hours, 10 ng/ml recombinant mouse tumor 

necrosis factor-α (R & D Systems, Minneapolis, MN, 

USA) and 10 ng/ml recombinant mouse interferon-γ (R 

& D Systems, Minneapolis, MN, USA) were added 

to induce dendritic cell further maturation. After 

incubation for 16 hours, Renca tumor lysate-pulsed 

dendritic cells (i.e., mature dendritic cells) were 

harvested and used as dendritic cell-based vaccine in 

our study. Dendritic cells were evidenced by phenotype 

analysis. 

Phenotype analysis of dendritic cells 

Immature and mature dendritic cells were 

harvested, stained with fluorescein isothiocyanatelabeled 

anti-CD11c (dendritic cell marker) monoclonal



antibody (BD PharMingen, San Diego, CA, USA) 

and phycoerythrin-labeled anti-CD83 (maturation 

marker of dendritic cells) monoclonal antibody (BD 

PharMingen, San Diego, CA, USA), and then analyzed 

by flow cytometry for expressions of CD11c and CD83 

on the cell surface. 

Analysis of CD137 expression on T cells 

Spleens from Balb/c mice were prepared as cell 

suspensions. T cells were isolated from splenocytes 

by the use of T cell separation reagents (Miltenyi 

Biotec,Auburn, CA, USA). Purified T cells (1 × 10 5 / 

well) were cultured alone or with Renca tumor lysatepulsed 

dendritic cells (1 × 10 4 /well) in round-bottom 

96-well plates, harvested at 24-hour intervals for 7 days, 

and stained with fluorescein isothiocyanate-labeled 

anti-CD3 (T-cell marker) monoclonal antibody (BD 

PharMingen, San Diego, CA, USA) and phycoerythrinlabeled 

anti-CD137 monoclonal antibody (BD 

PharMingen, San Diego, CA, USA). CD137 expression 

on T cells was analyzed by flow cytometry. 

Tumor implantation and treatment 

The Balb/c mice were inoculated subcutaneously 

in the right flank with 5 × 10 5 Renca tumor cells on day 

0. After three days, tumor-bearing mice were randomly 

divided into four groups. Control group received no 

treatment. In dendritic cell-treated group, mice were 

immunized subcutaneously in the left flank with 

Renca tumor lysate-pulsed dendritic cells (1 × 10 6 ) on 

days 3 and 10 [18] . Mice in antibody-treated group were 

injected intraperitoneally with anti-CD137 monoclonal 

antibody (100 μg; R & D Systems, Minneapolis, MN, 

USA) on days 3 and 10. Combination therapy group 

received both subcutaneous injection of Renca tumor 

lysate-pulsed dendritic cells (1 × 10 6 ) on days 3 and 

10, and intraperitoneal administration of anti-CD137 

monoclonal antibody (100 μg) on days 6 and 13. The 

maximal perpendicular diameters of tumor were 

measured using a caliper twice a week, and tumor size 

was recorded as tumor area (mm 2 ). 

Assessment of T cell proliferation 

Control and differently treated mice were killed 

20 days after tumor implantation, and spleens were 

harvested. T cells were isolated from splenocytes by 

the use of T cell separation reagents (Miltenyi Biotec, 

Auburn, CA, USA). Purified T cells (1 × 10 5 /well) 

were co-cultured with Renca tumor lysate-pulsed 

dendritic cells (1 × 10 4 /well) in 96-well plates. On day 

five, cultures were pulsed with 1 μCi [3H]thymidine 

(PerkinElmer, Waltham, MA, USA) per well for 16 

hours. The cells were collected on glass microfiber 

filters with a cell harvester. T cell proliferation was 

evaluated by measuring [3H]thymidine incorporation 

in a liquid scintillation counter. Results were expressed 

as counts per minute (cpm). 

Cytotoxicity assay 

A standard 51 Cr release assay was used to measure 

cell-mediated cytotoxicity [19] . In brief, Renca tumor cells 

were used as target cells. Target cells were labeled with 

51 

Cr (PerkinElmer, Waltham, MA, USA) for one hour 

at 37 °C and washed three times before use. Spleens 

were harvested from control and differently treated 

mice 20 days after tumor implantation. CD8 + T cells 

were isolated from splenocytes by the use of CD8 + T 

cell separation reagents (Miltenyi Biotec, Auburn, CA, 

USA), and stimulated in vitro with Renca tumor lysatepulsed 

dendritic cells at a 10:1 ratio. After five days, 

the primed CD8 + T cells (effector cells) were harvested, 

washed twice, and co-incubated with 51 Cr-labeled 

Renca tumor cells (target cells) at effector / target cell 

ratio of 100:1 in round-bottom 96-well plates. After 

four hours of incubation at 37 °C, culture supernatants 

were collected and 51 Cr release was measured using a 

gamma counter. The percentage of target cell specific 

lysis was calculated using the following formula: 

[(experimental 51 Cr release - spontaneous 51 Cr release) 

/ (maximal 51 Cr release - spontaneous 51 Cr release)] × 

100 [20] . Spontaneous release of 51 Cr was determined by 

incubating target cells alone. Maximal 51 Cr release was 

obtained by incubating target cells with 1% Triton X- 

100 (Sigma-Aldrich, St. Louis, MO, USA). 

Measurement of interferon-γ production 

Twenty days after tumor implantation, spleens from 

control and differently treated mice were harvested. 

CD4 + T cells were isolated from splenocytes by the use 

of CD4 + T cell separation reagents (Miltenyi Biotec, 

Auburn, CA, USA), and stimulated with Renca tumor 

lysate-pulsed dendritic cells at a ratio of 10:1 in vitro. 

After 24 hours, culture supernatants were collected and 

determined for interferon-γ content by enzyme-linked 

immunosorbent assay (ELISA) kit (BD PharMingen, 

San Diego, CA, USA). 


The data were presented as mean ± standard 

deviation (SD). Two-tailed Student’s t-test was used 

for data analysis. A p-value of less than 0.05 was 

considered statistically significant. GraphPad Prism 

software (GraphPad Software Inc, San Diego, CA, 

USA) was used for all statistical analysis. 

RESULTS 

Characteristics of dendritic cells 

As shown in Fig. 1, cultured cells highly expressed 

CD11c (dendritic cell marker), suggesting that these 

cells were dendritic cells. Renca tumor lysate-pulsed

311 



Fig. 1: Phenotype of dendritic cells. The dendritic cells were cultured as described in the methods. Immature and mature dendritic cells 

were harvested, stained with fluorescein isothiocyanate-labeled anti-CD11c (dendritic cell marker) monoclonal antibody and phycoerythrinlabeled 

anti-CD83 (maturation marker of dendritic cells) monoclonal antibody, and then analyzed by flow cytometry. Expression rates of 

CD11c and CD83 in unpulsed dendritic cells (i.e., immature dendritic cells) and Renca tumor lysate-pulsed dendritic cells (i.e., mature 

dendritic cells) were 85.9% (i.e., 3.6% + 82.3%) and 3.6%, and 87.1% (i.e., 71.5% + 15.6 %) and 71.5%, respectively. 

dendritic cells (i.e., mature dendritic cells) expressed 

higher level of CD83 (maturation marker of dendritic 

cells), compared with unpulsed dendritic cells (i.e., 

immature dendritic cells). 

Tumor lysate-pulsed dendritic cells up-regulate 

CD137 expression on T cells 

CD137 expression on T cells was measured before 

and after stimulation of T cells with Renca tumor 

lysate-pulsed dendritic cells. As shown in Fig. 2, 

unstimulated T cells showed low expression of CD137. 

At three days after stimulation with Renca tumor 

lysate-pulsed dendritic cells, T cells increased the 

expression of CD137. 

Anti-CD137 antibody potentiates the anti-tumor 

efficacy of tumor lysate-pulsed dendritic cells 

We tested the anticancer effect of tumor lysatepulsed 

dendritic cells and anti-CD137 antibody, alone 

or in combination, in the subcutaneous Renca tumor 

mouse model. As shown in Fig. 3, tumor lysate-pulsed 

dendritic cells or anti-CD137 antibody treatment 

significantly suppressed tumor growth compared 

with control (untreated) group (p < 0.05). However, 

the combination therapy with tumor lysate-pulsed 

dendritic cells and anti-CD137 antibody resulted in 

the greatest inhibition of tumor growth (p < 0.05), 

indicating a synergistic anticancer effect of the 

combined treatment. 

Combination of tumor lysate-pulsed dendritic 

cells with anti-CD137 antibody augments T-cell 

proliferation 

T cells isolated from splenocytes of control 

and differently treated mice were assayed for cell 

proliferation in response to Renca tumor lysate-pulsed 

dendritic cells. As shown in Fig. 4, mice treated with 

tumor lysate-pulsed dendritic cells or anti-CD137 

antibody alone showed a significant increase in T-cell 

proliferation, compared with control group (p < 0.05). 

However, co-administration of tumor lysate-pulsed 

dendritic cells with anti-CD137 antibody resulted in 

stronger cell proliferation than any other groups (p < 

0.05). 

Combination therapy improves cytotoxic T- 

lymphocyte activity 

CD8 + T cells isolated from splenocytes of control 

and differently treated mice were stimulated in vitro by 

co-culture with Renca tumor lysate-pulsed dendritic 

cells and analyzed for cytotoxic T-lymphocyte activity. 

The cytotoxic T-lymphocyte activity in tumor lysatepulsed 

dendritic cells or anti-CD137 antibody-onlytreated 

mice was significantly increased in comparison 

with control (untreated) mice (p < 0.05) (Fig. 5). The 

combination treatment with tumor lysate-pulsed 

dendritic cells and anti-CD137 antibody caused a 

much higher cytotoxic T-lymphocyte activity than 

either monotherapy (p < 0.05) (Fig. 5).



Fig. 2 A: Up-regulation of CD137 expression on T cells induced by Renca tumor lysate-pulsed dendritic cells. T cells isolated from splenocytes 

of Balb/c mice were cultured alone or with Renca tumor lysate-pulsed dendritic cells. At 24-hour intervals for seven days after culture, T cells 

were harvested, stained with fluorescein isothiocyanate-labeled anti-CD3 (T-cell marker) monoclonal antibody and phycoerythrin-labeled 

anti-CD137 monoclonal antibody, and then analyzed by flow cytometry for expression of CD137. (A) CD137 expression on T cells three days 

after culture. Approximately 0.9% of unstimulated T cells expressed CD137. However, 35.2% of T cells expressed CD137 three days after 

stimulation with Renca tumor lysate-pulsed dendritic cells. Data were representative of three independent experiments. 

Fig. 2 B: Expression kinetics of CD137 on T cells. CD137 expression 

peaked on T cells 3 days after stimulation of T cells with Renca 

tumor lysate-pulsed dendritic cells. 

Tumor lysate-pulsed dendritic cells and anti-CD137 

antibody synergistically enhance interferon-γ 

production 

CD4 + T cells isolated from splenocytes of 

control and differently treated mice were assayed 

for interferon-γ production in response to Renca 

tumor lysate-pulsed dendritic cells. Interferon-γ 

production is shown in Fig. 6. Therapy with tumor 

lysate-pulsed dendritic cells or anti-CD137 antibody 

significantly increased interferon-γ production (p < 

0.05), with the highest increase in the combination 

treatment (p < 0.05). 

Fig. 3: Renca tumor growth in mice treated with tumor lysatepulsed 

dendritic cells and anti-CD137 antibody. Balb/c mice 

were challenged with a subcutaneous injection of 5 × 10 5 Renca 

tumor cells. After three days, tumor-bearing mice were randomly 

divided into 4 groups. Each group contained 10 mice. Control 

group received no treatment. In dendritic cell-treated group, 

mice were immunized subcutaneously with tumor lysate-pulsed 

dendritic cells on days 3 and 10. Mice in antibody-treated group 

were injected intraperitoneally with anti-CD137 antibody on days 

3 and 10. Combination therapy group received both subcutaneous 

injection of tumor lysate-pulsed dendritic cells on days 3 and 10, 

and intraperitoneal administration of anti-CD137 antibody on days 

6 and 13. After tumor cell injection, tumor size was measured twice 

a week and recorded as tumor area (mm 2 ). *p < 0.05 versus control 

group; **p < 0.05 versus all other groups.

313 



Fig. 4: Effect of tumor lysate-pulsed dendritic cells and anti-CD137 

antibody on T-cell proliferation. T cells isolated from splenocytes of 

Renca tumor-bearing mice (10 per group), which were not treated 

or treated with tumor lysate-pulsed dendritic cells, anti-CD137 

antibody, or combination of tumor lysate-pulsed dendritic cells with 

anti-CD137 antibody, were stimulated in vitro with Renca tumor 

lysate-pulsed dendritic cells for five days. These cells were pulsed 

with [3H]thymidine for additional 16 hours. T-cell proliferation 

was evaluated by measuring [3H]thymidine incorporation. Results 

were expressed as counts per minute (cpm). *p < 0.05 versus control 

group; **p < 0.05 versus all other groups. 

Fig. 6: Enhancement of interferon-γ production by treatment with 

tumor lysate-pulsed dendritic cells and anti-CD137 antibody. CD4 + 

T cells isolated from splenocytes of Renca tumor-bearing mice (10 

per group), which were not treated or treated with tumor lysatepulsed 

dendritic cells, anti-CD137 antibody, or combination of 

tumor lysate-pulsed dendritic cells with anti-CD137 antibody, were 

stimulated in vitro with Renca tumor lysate-pulsed dendritic cells 

for 24 hours. Culture supernatants were collected and determined 

for interferon-γ content by enzyme-linked immunosorbent assay. *p 

< 0.05 versus control group; **p < 0.05 versus all other groups 

DISCUSSION 

Dendritic cells, the most potent antigen-presenting 

cells, have the ability to process and present tumor 

antigen to both CD4 + and CD8 + T cells [21] . The 

interaction between dendritic cells and T cells induces 

Fig. 5: Evaluation of cytotoxic T-lymphocyte activity in tumor lysatepulsed 

dendritic cells + anti-CD137 antibody-treated mice. Renca 

tumor-bearing mice (10 per group) were not treated or treated with 

tumor lysate-pulsed dendritic cells, anti-CD137 antibody, or tumor 

lysate-pulsed dendritic cells plus anti-CD137 antibody. CD8 + T cells 

(effector cells) isolated from splenocytes of untreated and differently 

treated mice were stimulated in vitro with Renca tumor lysatepulsed 

dendritic cells for five days, and reacted with 51 Cr-labeled 

Renca tumor cells (target cells) at effector/target cell ratio of 100 : 1 

for 4 hours at 37°C. Cytotoxic T-lymphocyte activity against Renca 

tumor cells was measured by a standard 51 Cr release assay. Results 

were expressed as the percentage of target cell lysis. *p < 0.05 versus 

control group; **p < 0.05 versus all other groups 

proliferation and activation of T cells [11] . Activated 

CD8 + T cells become cytotoxic T lymphocyte with 

the ability to kill tumor cells [22] . Activated CD4 + T 

cells have been shown to provide help for CD8 + T cell 

activation by releasing cytokines, such as interferon-γ 

and interleukin-2 [23] . Dendritic cell-based vaccines have 

been applied clinically for the treatment of metastatic 

renal cell carcinoma [12, 24] . However, a number of clinical 

studies have displayed limited success [12, 24] . The 

CD137 is expressed predominantly on activated CD4 + 

and CD8 + T cells [15] . Ligation of CD137 by anti-CD137 

monoclonal antibody increases T-cell proliferation 

and activation [16] , and prevents activation-induced 

death of T cells [25] . It has been reported that treatment 

with anti-CD137 antibody leads to regression of wellestablished 

tumors in animal models [17, 26] . On the 

basis of the reason as mentioned in the introduction, 

we postulated that anti-CD137 antibody may enhance 

the anti-tumor effect induced by dendritic cell-based 

vaccine. Our study showed that T cells up-regulated 

CD137 expression after stimulation by tumor lysatepulsed 

dendritic cells (i.e., dendritic cell-based 

vaccine) (Fig. 2). The result provided scientific basis 

for subsequent application of anti-CD137 antibody. 

In the present study, we found that combination 

therapy with tumor lysate-pulsed dendritic cells and



anti-CD137 antibody significantly inhibited tumor 

growth, compared with a single treatment with tumor 

lysate-pulsed dendritic cells or anti-CD137 antibody 

(Fig. 3). These data suggest that anti-CD137 antibody 

administration improves anti-tumor efficacy of tumor 

lysate-pulsed dendritic cells. In addition, we have not 

observed apparent side effects in mice treated with 

tumor lysate-pulsed dendritic cells and anti-CD137 

antibody. The result suggests that combination therapy 

is safe. 

The anti-tumor immune responses can be 

monitored by T-cell proliferation assay, cytotoxicity 

test, and cytokine secretion assay [13] . In the present 

study, mice immunized with tumor lysate-pulsed 

dendritic cells plus anti-CD137 antibody showed 

a stronger T-cell proliferation compared with mice 

immunized with tumor lysate-pulsed dendritic cells 

or anti-CD137 antibody alone (Fig. 4). These findings 

indicate that combination treatment promotes T- 

cell proliferation. Moreover, cytotoxic T-lymphocyte 

activity was higher in mice receiving combination 

treatment than in mice treated with tumor lysatepulsed 

dendritic cells or anti-CD137 antibody alone 

(Fig. 5), suggesting that combination therapy increases 

CD8 + T cell activity to kill tumor cells. In cytokine 

secretion assay, significantly higher interferon-γ levels 

were observed in mice that received combination 

therapy than those treated with tumor lysate-pulsed 

dendritic cells or anti-CD137 antibody alone (Fig. 6), 

implying that combination therapy enhances CD4 + T 

cell activity to secrete interferon-γ. The interferon-γ has 

been demonstrated to activate CD8 + T cells [23] . After 

considering all these results, we think that combination 

therapy may augment anti-tumor effect by enhancing 

T-cell proliferation and activity. 

Tumor cells are known to secrete transforming 

growth factor-β (TGF-β), vascular endothelial growth 

factor (VEGF), and interleukin-10 (IL-10) [18] . These 

tumor-related cytokines can suppress maturation of 

dendritic cells in vivo, leading to impaired antigen 

presentation and T-cell stimulation, and finally failure 

to induce a full anti-tumor immune responses [18, 27, 28] . 

As a result, we used in vitro cultured dendritic cells in 

the present study. The immature dendritic cells can be 

produced in vitro by differentiation of bone marrow 

cells by addition of granulocyte macrophage colonystimulating 

factor and interleukin-4 for six days [18] . 

They can be further differentiated into mature dendritic 

cells by addition of maturation stimuli such as tumor 

lysate, tumor necrosis factor-α, and interferon-γ [18,29] . 

In our study, cultured cells were characterized as 

dendritic cells based on high expression of CD11c, 

which is a typical dendritic cell marker (Fig. 1). In 

clinical trials, immature or mature dendritic cells have 

been used for the treatment of renal cell carcinoma [12] . 

Recent clinical studies have showed that the use of 

mature dendritic cells can generate a better antitumor 

efficacy [12] . Thus, we used mature dendritic 

cells (i.e., Renca tumor lysate-pulsed dendritic cells) 

in our experiment. The mature dendritic cells were 

characterized by high expression of CD83 (maturation 

marker of dendritic cells) (Fig. 1). 

Dendritic cells pulsed with tumor antigens, such 

as tumor lysate, defined tumor-associated peptides, 

apoptotic or necrotic tumor cells, and tumor RNA 

or DNA, are able to induce specific T-cell responses 

against tumor cells [30] . The most commonly used tumor 

antigen in the clinical studies is tumor lysate [12] . We also 

used tumor lysate as tumor antigen in our study. The 

use of tumor lysate has unique advantages. It provides 

entire repertoire of tumor-associated antigens, thereby 

decreasing possibility of tumor escape. In addition, 

it also removes the requirement to identify tumorassociated 

antigens. 

We found that CD137 expression on T cells 

reached a peak three days after stimulation of T 

cells with tumor lysate-pulsed dendritic cells (Fig. 

2B). For this reason, in combination therapy group, 

we injected anti-CD137 antibody three days after 

treatment with tumor lysate-pulsed dendritic cells. 

Some studies have shown that anti-CD137 antibody 

at a dose of 100 μg is effective in treating tumors in 

mice, such as breast cancer, melanoma, mastocytoma 

and myeloma [31, 32] . Consequently, we chose this dose 

in renal cell carcinoma mouse model. 

CONCLUSION 

Our findings present the first evidence that 

dendritic cell-based vaccine in combination with anti- 

CD137 antibody can enhance anti-tumor effect in 

mice bearing renal cell carcinoma by increasing T-cell 

proliferation and activity. We propose that combination 

therapy may have the clinical applicability in patients 

with renal cell carcinoma. Additional clinical trials will 

be required to address this issue. 


This work was supported by grants from the 

Qianjiang Talent Project Foundation of Zhejiang 

Province (2009-194), and the Scientific Foundation 

of Education Department of Zhejiang Province 

(Y200805942), China. 

REFERENCES 

1. Jemal A, Siegel R, Ward E, et al. Cancer statistics, 2008. 

CA Cancer J Clin 2008; 58:71-96. 

2. Rini BI, Campbell SC, Rathmell WK. Renal cell 

carcinoma. Curr Opin Oncol 2006; 18:289-296. 

3. McLaughlin JK, Lipworth L. Epidemiologic aspects of 

renal cell cancer. Semin Oncol 2000; 27:115-123. 

4. Motzer RJ, Bander NH, Nanus DM. Renal-cell 

carcinoma. N Engl J Med 1996; 335:865-875.

315 



5. Glaspy JA. Therapeutic options in the management of 

renal cell carcinoma. Semin Oncol 2002; 29:41-46. 

6. Tani K, Azuma M, Nakazaki Y, et al. Phase I study of 

autologous tumor vaccines transduced with the GM- 

CSF gene in four patients with stage IV renal cell cancer 

in Japan: clinical and immunological findings. Mol Ther 

2004; 10:799-816. 

7. Snow RM, Schellhammer PF. Spontaneous regression 

of metastatic renal cell carcinoma. Urology 1982; 20:177- 

181. 

8. Verra N, de Jong D, Bex A, et al. Infiltration of activated 

dendritic cells and T cells in renal cell carcinoma 

following combined cytokine immunotherapy. Eur 

Urol 2005; 48:527-533. 

9. Atzpodien J, Kirchner H, Jonas U, et al. Interleukin-2- 

and interferon alfa-2a-based immunochemotherapy 

in advanced renal cell carcinoma: a prospectively 

randomized trial of the German Cooperative Renal 

Carcinoma Chemoimmunotherapy Group (DGCIN). J 

Clin Oncol 2004; 22:1188-1194. 

10. Mulders P, Figlin R, deKernion JB, et al. Renal cell 

carcinoma: recent progress and future directions. 

Cancer Res 1997; 57:5189-5195. 

11. Kübler H, Vieweg J. Vaccines in renal cell carcinoma. 

Semin Oncol 2006; 33:614-624. 

12. Berntsen A, Geertsen PF, Svane IM. Therapeutic 

dendritic cell vaccination of patients with renal cell 

carcinoma. Eur Urol 2006; 50:34-43. 

13. Kim JH, Lee Y, Bae YS, et al. Phase I/II study of 

immunotherapy using autologous tumor lysate-pulsed 

dendritic cells in patients with metastatic renal cell 

carcinoma. Clin Immunol 2007; 125:257-267. 

14. Wierecky J, Müller MR, Wirths S, et al. Immunologic 

and clinical responses after vaccinations with peptidepulsed 

dendritic cells in metastatic renal cancer patients. 

Cancer Res 2006; 66:5910-5918. 

15. Pollok KE, Kim YJ, Zhou Z, et al. Inducible T cell antigen 

4-1BB. Analysis of expression and function. J Immunol 

1993; 150:771-781. 

16. Kim JA, Averbook BJ, Chambers K, et al. Divergent 

effects of 4-1BB antibodies on anti-tumor immunity and 

on tumor-reactive T-cell generation. Cancer Res 2001; 

61:2031-2037. 

17. Miller RE, Jones J, Le T, et al. 4-1BB-specific monoclonal 

antibody promotes the generation of tumor-specific 

immune responses by direct activation of CD8 T cells in 

a CD40-dependent manner. J Immunol 2002; 169:1792- 

1800. 

18. Lim DS, Kim JH, Lee DS, Yoon CH, Bae YS. DC 

immunotherapy is highly effective for the inhibition 

of tumor metastasis or recurrence, although it is not 

efficient for the eradication of established solid tumors. 

Cancer Immunol Immunother 2007; 56:1817-1829. 

19. Sievers E, Dreimuller P, Haferkamp A, et al. 

Characterization of primary renal carcinoma cultures. 

Urol Int 2007; 79:235-243. 

20. Lu ZY, Condomines M, Tarte K, et al. B7-1 and 4-1BB 

ligand expression on a myeloma cell line makes it 

possible to expand autologous tumor-specific cytotoxic 

T cells in vitro. Exp Hematol 2007; 35:443-453. 

21. Ranieri E, Gigante M, Storkus WJ, Gesualdo L. 

Translational mini-review series on vaccines: Dendritic 

cell-based vaccines in renal cancer. Clin Exp Immunol 

2007; 147:395-400. 

22. Uemura H, De Velasco MA. Tumor vaccines in renal cell 

carcinoma. World J Urol 2008; 26:147-154. 

23. Sun Y, Chen JH, Fu Y. Immunotherapy with agonistic 

anti-CD137: two sides of a coin. Cell Mol Immunol 

2004; 1:31-36. 

24. Kraemer M, Hauser S, Schmidt-Wolf IG. Long-term 

survival of patients with metastatic renal cell carcinoma 

treated with pulsed dendritic cells. Anticancer Res 2010; 

30:2081-2086. 

25. Hurtado JC, Kim SH, Pollok KE, Lee ZH, Kwon BS. 

Potential role of 4-1BB in T cell activation. Comparison 

with the costimulatory molecule CD28. J Immunol 1995; 

155:3360-3367. 

26. Houot R, Goldstein MJ, Kohrt HE, et al. Therapeutic 

effect of CD137 immunomodulation in lymphoma 

and its enhancement by Treg depletion. Blood 2009; 

114:3431-3438. 

27. Kobie JJ, Wu RS, Kurt RA, et al. Transforming growth 

factor beta inhibits the antigen-presenting functions 

and anti-tumor activity of dendritic cell vaccines. 

Cancer Res 2003; 63:1860-1864. 

28. Lyakh LA, Sanford M, Chekol S, Young HA, Roberts 

AB. TGF-beta and vitamin D3 utilize distinct pathways 

to suppress IL-12 production and modulate rapid 

differentiation of human monocytes into CD83+ 

dendritic cells. J Immunol 2005; 174:2061-2070. 

29. Nestle FO, Farkas A, Conrad C. Dendritic-cell-based 

therapeutic vaccination against cancer. Curr Opin 

Immunol 2005; 17:163-169. 

30. Siders WM, Vergilis KL, Johnson C, Shields J, Kaplan 

JM. Induction of specific anti-tumor immunity in the 

mouse with the electrofusion product of tumor cells 

and dendritic cells. Mol Ther 2003; 7:498-505. 

31. Murillo O, Arina A, Hervas-Stubbs S, et al. Therapeutic 

anti-tumor efficacy of anti-CD137 agonistic monoclonal 

antibody in mouse models of myeloma. Clin Cancer 

Res 2008; 14:6895-6906. 

32. Narazaki H, Zhu Y, Luo L, Zhu G, Chen L. CD137 agonist 

antibody prevents cancer recurrence: contribution of 

CD137 on both hematopoietic and nonhematopoietic 

cells. Blood 2010; 115: 1941-1948.




The Effect of Gene Polymorphisms (ENOS G894T, PON1 

and Catalase -262C→T) on Fertility and Sperm Parameters 

in Turkish Men with Clinical Varicocele: A Pilot Study 

Cavit Ceylan 1 , Gülay G Ceylan 2 , Hakan Artas 3 , Erdogan Aglamıs 4 , Can Ates 5 , Huseyin Yuce 6 

1 

3 rd Clinic of Urology, Türkiye Yüksek Ihtisas Training and Research Hospital, Ankara, Turkey 

2 

Clinic of Genetics, Ankara Atatürk Training and Research Hospital, Ankara, Turkey 

3 

3 rd Clinic of Radıology, Elazığ Training and Research Hospital, Elazığ, Turkey 

4 

3 rd Clinic of Urology, Elazığ Training and Research Hospital, Elazığ, Turkey 

5 

Department of Biostatistics, Faculty of Medicine, University of Ankara, Ankara, Turkey 

6 

Department of Genetics, Faculty of Medicine, University of Elazığ, Elazığ, Turkey 


ABSTRACT 

Objective: Scrotal varicocele is found to be associated with 

increased spermatozoal reactive oxygen species (ROS) 

production and decreased seminal plasma antioxidant 

activity. Our objective was to search for an association 

between male infertility and gene polymorphisms (PON1, 

ENOS G894T and Catalase -262C→T). 

Design: Controlled prospective study 

Setting: Ataturk and Yuksek Ihtisas Education and Training 

Hospitals, Ankara, Turkey 

Subjects: Forty primary infertile men and forty healthy men 

were included in the study. Patients with clinical varicocele 

in the study group had no endocrinopathy, no surgery for 

varicocele / inguinal hernia, and / or no leukospermia. They 

were non-smokers. 

Intervention: Doppler ultrasonography (USG) was 

performed for the patients. For genetic analysis, 5 ml of 

venous blood was drawn into tubes containing EDTA from 

each patient. 

Main Outcome Measures: Gene polymorphism, progressive 

sperm motion and vein diameter 

Results: Existence of gene polymorphisms was statistically 

important in patients who had clinical varicocele with affected 

progressive forward motion. We determined statistically 

significant rate of gene polymorphisms in enzymatic 

antioxidant defence systems in patients with clinical varicocele, 

with a diameter of spermatic vein above 2.2 mm and forward 

progressive sperm motion below 32% (p < 0.001). 

Conclusions: These polymorphisms might represent risk 

factors for Turkish men with clinical varicocele and forward 

progressive sperm motion defect. This is a pilot study. We 

intend to continue these studies with larger sample sizes to 

confirm these findings. 

Key words: gene polymorphism, male infertility, oxidative stress, varicocele 

INTRODUCTION 

Varicocele is an abnormal dilatation of the 

spermatic vein, and it is observed in around 30 - 50% 

of men in infertile couples [1] . A considerable number 

of infertile men have no known mechanism for their 

infertility [2] . Several mechanisms which involve the 

pathophysiology of testicular dysfunction in the 

population with varicocele have been defined. The 

other pathophysiological mechanisms of varicocele are 

Leydig cell and germinal cell dysfunction due to small 

vessel occlusion, testicular hypoxia due to venous stasis, 

retrograde flow of adrenal and renal metabolites from 

the renal vein into the spermatic vein, increased scrotal 

and testicular temperature and decreased secretion of 

gonadotropins and androgens [3] . In addition to these, 

varicocele also reduces both the seminal and blood 

plasma antioxidant defenses [4] . Scrotal varicocele is 

found to be associated with increased spermatozoal 

reactive oxygen species (ROS) production and 

decreased seminal plasma antioxidant activity [5] . Excess 

ROS leads to DNA damage and oxidation of lipoprotein 

components at the cellular and subcellular level. 

Oxidative stress (OS) adversely affects sperm function 

by changing membrane fluidity and permeability, and 


Gulay G.Ceylan, MD, Department of Medical Genetics, Ankara Atatürk Training and Research Hospital, Ankara, Turkey. Tel: +90 0532 377 87 

18, Fax: +90 0312 2912728, E-mail: nil_cey@yahoo.com

317 

The Effect of Gene Polymorphisms (ENOS G894T, PON1 and Catalase -262C→T) ... 


impairs sperm functional competence [6] . We searched 

for an association between polymorphisms of different 

plasma enzymatic antioxidants (PON1, ENOS G894T 

and Catalase -262C→T gene polymorphisms) in a 

Turkish male population with fertility and varicocele, 

based on the impairment of spermatozoa functions 

related with increased ROS. This study also aims to 

examine, if there is an association between different 

plasma enzymatic antioxidants (PON1, ENOS G894T 

and Catalase -262C→T gene polymorphisms) and 

idiopathic male infertility. 


Population of the Study 

Forty male patients with primary infertility with a 

mean age of 36.8 ± 6.91 years and forty healthy men 

with a mean age of 41.2 ± 7.63 years were included 

in the study. The patients were included in the study 

after physical examination by an urologist. Patients, 

in whom left-sided grade 2 varicocele was detected, 

were evaluated radiologically with scrotal coloured 

doppler ultrasonography (USG). After evaluation 

with scrotal doppler [7] , patients with clinical varicocele 

who had varicose vein with reflux and diameter above 

2.2 mm were included in the study group. Patients 

were included in the study after 3 - 5 days of sexual 

abstinence. Two different laboratory examinations 

were performed, at least 15 days apart, and the 

sperm parameters were evaluated according to WHO 

guidelines [8] . Fertile men were included in the study as 

control group. The patients had sperm profiles with a 

count of 5 - 55 million/ml, a viscosity with a volume of 

2 – 5 ml, normal pH values, and no leukospermia. The 

motility was classified as motile a (rapid progressive 

motion), motile b (slow progressive motion), motile c 

(non-progressive motion), motile d (non-motile sperm 

percentiles), motile a + b (32%; progressive sperm 

motion) and motile a + b + c (40%; total motion) [8] . The 

patients with clinical left-sided varicocele in study 

group had no endocrinopathy, no previous surgery 

for varicocele or inguinal hernia and no leukospermia. 

They were also non-smokers. The study group 

consisted of patients who had no child despite regular 

sexual intercourse for at least a year. Fertile men were 

included in the control group. Informed consent forms, 

compatible with the Helsinki declaration, were taken 

from the patients and the Institutional Review Board 

approved the study. 

Genotyping For eNOS G894T Polymorphism 

For genetic analysis, 5 ml of blood was drawn into 

tubes containing EDTA from each patient. DNA was 

extracted using a commercial kit (QIAamp DNA mini 

kit; Qiagen, Hilden, Germany). In this study, for the 

detection of G894T polymorphism on ENOS gene, we 

used primer pairs to amplify a part of the ENOS gene 

containing exon 7, by polymerase chain reaction (PCR) 

with the following flanking intronic primers: sense 

5’CATGAGGCTCAGCCCCAGAAC-3’ and antisense 

5’AGTCAATCCCTTTGGTGCTCAC-3’, followed by 

Mbo I restriction endonuclease digestion for 16h at 37 °C 

and resolution by electrophoresis on 3% agarose gel. 

The resulting 206 bp PCR product was cleaved into 

two smaller fragments of 119 and 87 bp in the presence 

of a T nucleotide at 894 (corresponding to Asp 298) but 

not in its absence. Digested fragments were visualized 

after ethidium bromide staining under UV light. 

Genotyping For Paraoxonase 192 Polymorphism 

PON1 genotypes were determined by PCR 

according to previously published protocols [9,10] . 

For paraoxonase 192 polymorphism, a sense primer 

5’TATTGTTGCTGTGGGACCTGAG3’ and antisense 

primer 5’ CACGCTAAACCCAAATACATCTC 3’, 

which encompasse the 192 polymorphic region of 

the human PON1 gene, were used. The PCR reaction 

mixture contained 100 ng DNA template, 0.5 M of 

each primer, 1.5 mM MgCl2, 200 mM dNTPs and 

1 U Taq DNA polymerase (MBI Fermentas). After 

denaturing the DNA for 5 min at 94 °C, the reaction 

mixture was subjected to 35 cycles of denaturation 

for one min at 95 °C, one min annealing at 60 °C and 

one min extension at 72 °C, for the 192 genotype. 

The 99 bp PCR product was digested with 8U BspI 

restriction endonuclease (MBI Fermentas, Lithuania) 

overnight at 55 °C, the digested products separated 

by electrophoresis on a 4% metaphore agarose gel and 

visualized using ethidium bromide. The B-genotype 

(arginine) contains a unique BspI restriction site which 

results in 66- and 33-bp products and the A genotype 

(glutamine) cannot be cut, allowing the PON1 192 

genotype to be determined. 

Genotyping for catalase - 262C→T polymorphism 

Genotyping for the CAT - 262C→T polymorphism 

was conducted according to the method described 

by Forsberg et al with modifications [11] . PCR 

amplification of the associated region of the CAT 

gene promotor site was performed using the primers 

5’-AGAGCCTCGCCCCGCCGGACCG-3’ (antisense) 

and 5’-TAAGAGCTGAGAAAGCATAGCT -3’ (sense) 

with a touch-down program designed as follows: 94°C 

for 30 s, 68 °C for 45 s, 72 °C for one min, -0.5 °C/cycle, 

19 times, then 94 °C for 30 s, 58 °C for 45 s, 72°C for 

one min, 25 times. The final elongation step was 10 

min at 72 °C. Each reaction mixture (25 ml) contained 

approximately 50 ng of DNA template, five units of 

Taq DNA polymerase, 1 mM of each primer, 200 mM 

dNTPs, 20 mM Tris–HCl (pH 8.4), 50 mM KCl and 1.5 

mM MgCl2. For restriction digestion with SmaI, 15 ml 

were withdrawn from the amplification mixture and 

incubated with five units of the enzyme in the presence



Table 1: Distribution as per age, sperm motility and varicose vein diameter in study and control groups 

Demographic features Patient (n = 40) Control (n = 40) 

M ± SD Median M ± SD Median p- value 

(Min - Max) 

(Min-Max) 

Age 36.8 ± 6.91 36 (22 - 49) 41.2 ± 7.63 42 (28 - 56) 0.006** 

motile a 16.3 ± 7.99 16 (2 - 35 ) 34.3 ± 16.58 31.5 (11 - 70)

319 



Table 4: Distribution of PON1, ENOS G894T and Catalase - 

262C → T gene polymorphisms in fertile and infertile groups 

Polymorphism 

and group 

PON1 Polymorphism 

Infertile 

Fertile 

Normal 

n (%) 

23 (28.8) 

25 (31.2) 

ENOS G894T Polymorphism 

Infertile 

Fertile 

24 (30) 

29 (36.2) 

CATALASE -262C→T Polymorphism 

Infertile 

Fertile 

*p > 0.05 

21 (26.2) 

24 (30) 

Polymorphism 

n (%) 

17 (21.2) 

15 (18.8) 

16 (20) 

11 (13.8) 

19 (23.8) 

16 (20) 

p- value 

0.648 * 

0.237 * 

0.499 * 

of spermatic vein between the infertile and fertile 

groups included in the study (p < 0.05, Table 1). The 

rates of sperm motility in the patients were 16.32 

± 7.99% at a motile sperm, 25.65 ± 6.21% at b motile 

sperm, 41.97 ± 10.88% at a + b motile sperm, 17.12 ± 

9.21% at c motile sperm and 41.40 ± 12.48% at d motile 

sperm. The diameter of scrotal doppler varicose vein 

for the patients in study group was 2.81 ± 0.39 mm, it 

was 2.1 ± 0.60 mm in the control group (Table 1). The 

incidence of PON1, ENOS G894T and Catalase -262C→ 

T gene polymorphisms were studied in peripheral 

blood from all the study participants. PON1 gene 

polymorphism was detected in 27 of 80 participants 

(33.7%). 16 of them were infertile, 11 of them were 

fertile. ENOS gene polymorphism was detected in 32 

participants (40%) (17 infertile and 15 fertile). Catalase 

- 262C → T gene polymorphism was detected in 35 

participants (43.7%). 19 of them were infertile and 16 

were fertile (Table 2). The study group consisted of 

40 infertile patients with varicocele and the control 

group consisted 40 fertile patients. All of the study 

group patients had varicocele, but only 12 patients in 

control group had varicocele. The distribution of gene 

polymorphism in infertile and fertile participants with 

varicocele is shown in Table 3. There was no statistically 

significant difference in terms of gene polymorphism 

(PON1, ENOS G894T and Catalase - 262C → T gene 

polymorphisms) between the infertile and fertile 

groups (p > 0.05, p-value was 0.648, 0.237 and 0.499 

respectively) (Table 4). Similarly, total sperm motion 

in all the patients between above 40% and below 

40% were compared and no statistically significant 

difference was found in terms of gene polymorphisms 

(p-value was 0.920, 0.901 and 0.641 respectively) 

(Table 5). But, when progressive sperm motion with a 

motility above 32% and below 32% were compared in 

all of the patients, there was a statistically significant 

difference in terms of the three gene polymorphisms 

(p-value was 0.001, 0.001 and 0.020 respectively)(Table 

5). Spermatic vein diameters of all of the patients 

were classified and evaluated. According to this 

evaluation, when spermatic vein diameters above 2.20 

mm and below 2.20 mm were compared, there was a 

statistically significant difference in terms of the gene 

polymorphisms (p-value was 0.001, 0.001 and 0.003, 

respectively) (Table 5). 

DISCUSSION 

Oxidative stress results from an imbalance between 

production and removal of ROS, leading to both a 

steady state concentration of reactive intermediates 

higher than normal and to increased cellular 

damage. Several studies have shown that there is a 

correlation between oxidative stress and impaired 

sperm function [12-15] . Although ROS play important 

roles in the promotion of spermatozoa capacitation, 

hyperactivation, and fusion [16-19] , they must be 

controlled to avoid harmful effects [20] . To accomplish 

this control, seminal plasma possesses an array of 

enzymatic and non-enzymatic defense mechanisms. 

Increased ROS generation was reported in 40% of 

the general infertile population, compared to 80% in 

the infertile varicocele population [21-25] . Despite these 

results in the literature, in our study, we determined 

that antioxidant gene polymorphisms are associated 

with varicose vein diameter and forward progressive 

sperm motion rather than fertility (Table 4 and 5). A 

relationship has also been detected between oxidative 

Table 5: Distribution of gene polymorphisms on progressive sperm motion (32%), total sperm motion (40%) and varicose vein diameter 

(> 2.20 mm) 

Varicose 

vein 

diameter 

≤ 32 

> 32 

≤ 40 

> 40 

≤ 2.20 

> 2.20 

PON 1 Polymorphism 

n (%) 

ENOS Polymorphism 

n (%) 

Catalase Polymorphism 

n (%) 

Normal Polymorphism p-value Normal Polymorphism p-value Normal Polymorphism p-value 

28 (35) 

20 (25) 

14 (17.5) 

34 (42.5) 

25 (31.2) 

23 (28.8) 

30 (37.5) 

2 (2.5) 

9 (11.2) 

23 (28.8) 

9 (11.2) 

29 (36.2) 

0.001 

0.920 


stress, semen characteristics and clinical diagnosis in 

investigated infertile patients. It is reported that the 

total antioxidant levels in patients with idiopathic 

infertility, varicocele, vasectomy reversal and infection 

with varicocele were significantly less than those in 

the fertile control group [26] . The association between 

varicocele and infertility is well-known. Frequently, 

men with varicocele have an abnormal spermiogram 

that usually improves after repair [27,28] . ROS production 

is usually high in those with a varicocele and improves 

after varicocelectomy [26,29] . In addition, exposure to 

cigarette smoke, a source of free radicals, contributes 

to a deterioration of the spermiogram in patients with 

a varicocele [30] . The total antioxidant capacity might 

also contribute strongly to the pathophysiology of 

male infertility, irrespective of the clinical diagnosis. 

Many findings support that male infertility associated 

with scrotal varicocele is at least in part related to 

oxidative stress. Varicocele patients were detected to 

have decreased antioxidant defenses both at the local 

(seminal plasma) and systemic (blood plasma) levels [21] . 

Barbieri et al measured the total antioxidant potential 

defenses, not individually, of varicocele patients in both 

seminal plasma and in systemic circulation. They report 

that the antioxidant defenses decrease in both of them. 

They conclude that varicocele-associated oxidative 

stress is evident not only at the local site but also at the 

systemic levels [21] . According to Ichioka et al, individual 

susceptibility to varicocele-induced ROS may depend 

on one or more of these genetic polymorphisms and 

that the outcome of varicocelectomy may be influenced 

by an individual’s genetic susceptibility to ROS [31] . 

In our study, there was no statistically significant 

difference for gene polymorphisms between study 

and control group (Table 4), but it was significant in 

patients with varicocele who had a vein diameter of 

above 2.2 mm and forward progressive sperm motion 

below 32% (Table 5). Increased ROS production can 

deplete the defenses present in the testes and in 

seminal plasma. For example, it has been reported 

that total reactive antioxidant potential (TRAP) in the 

internal spermatic vein (measured during surgery) 

is significantly lower than in a peripheral vein [32] . 

Varicocele reduces both the seminal and blood 

plasma antioxidant defenses. In order to further 

stress the relationship between local and systemic 

defenses depletion, average values are plotted for the 

different groups. One study shows that there is a good 

correlation between both sets of values. This is the 

first instance in which it is established that a systemic 

decrease in antioxidant defenses is present in those 

with a varicocele [33] . It is difficult to determine if the 

systemic decrease is reflected in the seminal levels or 

in systemic circulation [33,34] . Increased reactive oxygen 

radicals in systematic circulation cause negative 

effects on sperm function. This implies that significant 


antioxidant consumption at the testis level can be 

related to the increased ROS production [21] . The results 

discussed above suggest that antioxidant defenses 

could be depleted both locally and systemically in 

varicocele patients. In particular, it was considered 

important to establish if oxidative stress indicators 

are modified and non-enzymatic antioxidants are 

depleted in seminal and blood plasma of varicocele 

patients [32] . In our study, we used peripheral blood 

both in the study group (infertile patients) and the 

control group (fertile group), because using the 

specimen from the varicose vein of the control group 

was an ethical concern. We determined statistically 

significant rate of gene polymorphism in enzymatic 

antioxidant defence systems in patients with clinical 

varicocele, with a diameter of spermatic vein above 2.2 

mm and forward progressive sperm motion below 32%. 

But, we could not determine any significant difference 

in terms of gene polymorphisms in our infertile study 

group compared to fertile control group. There was 

also no statistically significant difference in patients 

with total sperm motion (below and above 40%). This 

is a controlled prospective study and it is also the 

first study which searches the association between 

infertility and gene polymorphism of enzymatic 

antioxidant defense system. Although our patient and 

control group is small, this is the first pilot study which 

includes patients with fertility and infertility, their 

sperm features (progressive and total sperm motion) 

and spermatic vein diameter (with and without 

varicocele) in literature. We want to continue the study 

with larger groups in future. Perhaps then, we will 

also find a relationship between infertility and gene 

polymorphism as the number of the patients increase. 

CONCLUSION 

Antioxidant gene polymorphisms can be detected 

in fertile and infertile men with varicocele. It would be 

important to investigate whether these polymorphisms 

can take place in fertile and / or infertile men with 

varicocele. These polymorphisms might represent 

a risk factor for Turkish men with clinical varicocele 

and forward progressive sperm motion. This is a pilot 

study. We intend to continue these studies with a larger 

sample size to confirm these findings. 

Declaration: The authors had no conflict of interest. 

REFERENCES 

1. Jarow JP, Coburn M, Sigman M. Incidence of varicoceles 

in men with primary and secondary infertility. Urology 

1996; 47:73. 

2. Safarinejad MR, Shafiei N, Safarinejad S. The role of 

endothelial nitric oxide synthase (eNOS) T-786C, G894T, 

and 4a/b gene polymorphisms in the risk of idiopathic 

male infertility. Mol Reprod Dev 2010; 77:720-727.

321 



3. Pryor JL, Howards SS. Varicocele. Urol Clin North Am 

1987; 14:499. 

4. Nagler HM, Luntz RK, Martinis FG. Varicocele. In: 

Lipshultz LI, Howards SS, editors. Infertility in the 

male. 1997 Mosby, St. Louis, p 336. 

5. Ross JA, Watson NE Jr, Jarow JP. The effect of varicoceles 

on testicular blood flow in man. Urology 1994; 44:535. 

6. Shamsi MB, Venkatesh S, Kumar R, Gupta NP, Malhotra 

N, Singh N. Antioxidant levels in blood and seminal 

plasma and their impact on sperm parameters in 

infertile men. Indian J Biochem Biophys 2010; 47:38-43. 

7. Hamm B, Fobbe F, Sorensen R, Felsenberg D. Varicoceles: 

Combined sonography and thermography in diagnosis 

and post therapeutic evaluation. Radiology 1986; 

160:419-422. 

8. World Health Organization (2010) Laboratory manual 

for the examination and processing of human semen, 

5th ed. Geneva: WHO Press. 

9. Humbert R, Adler DA, Disteche CM, Hassett C, 

Omiecinski CJ, Furlong CE. The molecular basis of the 

human serum paraoxonase activity polymorphism. 

Nature Genet 1993; 3:73-76. 

10. Adkins S, Gan KN, Mody M, La Du BN. Molecular 

basis for the polymorphic forms of human serum 

paraoxonase/arylesterase glutamine or arginine at 

position 191, for the respective A or B allozymes. Am J 

Hum Genet 1993; 52:598-608. 

11. Forsberg L, Lyrenas, L, de Faire U, Morgenstern R. A 

common functional C-T substitution polymorphism 

in the promoter region of the human catalase gene 

influences transcription factor binding, reporter gene 

transcription and is correlated to blood catalase levels, 

Free Radic Biol Med 2001; 30:500-505. 

12. Mazzilli F, Rossi T. Marchesini M. Superoxide anion 

in human semen related to seminal parameters and 

clinical aspects. Fertil Steril 1994; 62:862-868. 

13. Zini A, de Lamirande E. Gagnon C. Reactive oxygen 

species in semen of infertile patients: levels of superoxide 

dismutase-and catalase-like activities in seminal plasma 

and spermatozoa. Int J Androl 1993; l6:183-188. 

14. Agarwal A, Ikemoto Y, Loughlin KR. Relationship of 

sperm parameters with levels of reactive oxygen species 

in semen specimens. J Urol 1994;152:107-110. 

15. Aitken J. A free radical theory of male infertility. J 

Reprod Fertil Rev 1994; 6:19-24. 

16. Aitken I, Fisher H. Reactive oxygen species generation 

and human spermatozoa: the balance of benefit and 

risk. BioEssays 1994; 16:259-267. 

17. Griveau JF, Renard P, LeLannou D. An in vitro 

promoting role for hydrogen peroxide in human sperm 

capacitation. Int J Androl 1994; 17:300-307. 

18. de Lamirande E, Gagnon C. Capacitation-associated 

production of superoxide anion by human spermatozoa. 

Free Rad Biol Med 1995; 18:4871-4895. 

19. de Lamirande E, Gagnon C. Paradoxical effect of 

reagents for suifflydryl and disulfide groups on human 

sperm capacitation and superoxide production. Free 

Rad Biol Med 1998; 25:803-817. 

20. Pasqualotto FF, Sharma RK, Nelson DR, Thomas AJ, 

Agarwal A. Relationship between oxidative stress, 

semen characteristics, and clinical diagnosis in men 

undergoing infertility investigation. Fertil Steril 2000; 

73:459-464. 

21. Barbieri ER, Hidalgo ME, Venegas A, Smith R, Lissi 

EA. Varicocele- associated decrease in antioxidant 

defenses. J Androl 1999; 20:713-717. 

22. Lewis SE, Boyle PM, McKinney KA, Young IS, 

Thompson W. Total antioxidant capacity of seminal 

plasma is different in fertile and infertile men. Fertil 

Steril 1995; 64:868-870. 

23. Thiele JJ, Freisleben Hi, Fuchs I, Ochsendorf FR. Ascorbic 

acid and urate in human seminal plasma: determination 

and interrelationships with chemiluminescence in 

washed semen. Hum Reprod 1995; 10:110-115. 

24. Smith R, Vantman D, Ponce J, Escobar J, Lissi E. Total 

antioxidant capacity of human seminal plasma. Hum 

Reprod 1996; 11:1655-1660. 

25. Mancini A, Conte G, Milardi D, De Marinis L, Littarru 

GP. Relationship between sperm cell ubiquinone 

and seminal parameters in subject with and without 

varicocele. Andrologia 1998; 30:1-4. 

26. Schlesinger MH, Wilts IE, Nagler HM. Treatment 

outcome after varicocelectomy. A critical analysis. Urol 

Clin N Am 1994; 21:517-529. 

27. Vazquez-Levin MH, Friedmann F, Goldberg SI, Medley 

NE, Nagler HM. Response of routine semen analysis 

and critical assessment of sperm morphology by 

Kruger classification to therapeutic varicocelectomy. J 

Urol 1997; 158:1804-1807. 

28,. Weese DL, Peaster ML, Kyle KH, Leach GE, Lad PM, 

Zimmern PE. Stimulated reactive oxygen species 

generation by the spermatozoa of infertile men. J Urol 

1993; l49:64-67. 

29. Chia SE. Xu B. Ong CN, Tsakok FHM, Lee ST. Effect 

of cadmium and cigarette smoking on human semen 

quality. Int J Fertil Menopausal Stud 1994; 39:292-298. 

30. Hendin BN, Kolettis PN, Sharma RK, Thomas AJ Jr, 

Agarwal A. Varicocele is associated with elevated 

spermatozoal reactive oxygen species production and 

diminished seminal plasma antioxidant capacity. J Urol 

1999; 161:1831-1834. 

31. Ichioka K, Nagahama K, Okubo K, Soda T, Ogawa O, 

Nishiyama H. Genetic polymorphisms in glutathione 

S-transferase T1 affect the surgical outcome of 

varicocelectomies in infertile patients. Asian J Androl 

2009; 11:333-341. 

32. Lissi EA, Salim-Hanna M, Pascual C, del Castillo MD. 

Evaluation of total antioxidant potential (TRAP) and 

total antioxidant reactivity from luminol enhanced 

chemiluminescence measurements. Free Rad Biol Med 

1995; 2:153-158. 

33. Brichta M, Lutz H, Ploese J, Kappus H. Beneke R. 

Behn C. Lipid peroxide- related hemodilution during 

repetitive hyperbaric oxygenation. Adv Exp Med Biol 

1994; 345:189-194. 

34. Mulholland CW, Strain JJ. Total radical-trapping 

antioxidant potential (TRAP) of plasma. effects of 

supplementation of young healthy volunteers with 

large doses of alpha- tocopherol and ascorbic acid. Int J 

Vitam Nutr Res 1993; 63:27-32.



Insight 

Ward Mechanical Ventilation (WMV) Audit 

Sulaiman Khadadah 1 , Maryam Al-Ali 1 , Mohamed Bahzad 2 

1 

Department of Medicine, Mubarak Hospital, Ministry of Health, Kuwait 

2 

Department of Anesthesia and Intensive care, Mubarak Hospital, Ministry of Health, Kuwait 

ABSTRACT 


Objective: To look at the characteristics and mortality of 

mechanically ventilated patients on a general medical ward. 

The purpose of this audit is to evaluate this practice and 

also help clarify the need for “do not resuscitate” orders in 

Kuwait. 

Design: Prospective, observational audit 

Setting: Mubarak Al-Kabeer Hospital, Ministry of Health, 

Kuwait 

Subjects: Mechanically ventilated patients on medical wards 

in Mubarak Al-Kabeer Hospital over a six-month period 

Intervention: Mechanical ventilation 

Main Outcome Measures: Primary outcome was death and 

secondary outcome was extubation 

Results: Eighty-one patients met the inclusion criteria. Most 

patients had over three medical problems with a high number 

of patients having brain dysfunction, cancer and end-stage 

diseases. The mortality rate was 95%. 

Conclusion: There is great need to further look into this 

practice which appears to be highly fatal. There is evidence 

for the need to introduce a “do not resuscitate” policy in 

Kuwait, which is an ethical necessity in the practice of 

medicine. 

KEY WORDS: mechanical ventilation, medical ward, resuscitation 

INTRODUCTION 

Ever since the creation of the first positive pressure 

mechanical ventilator in the 19 th century there has been 

a constant demand for it in hospitals around the world. 

The number of patients requiring such devices has also 

grown exponentially since that time. The outcome of 

patients on mechanical ventilation even in specialized 

centers, like the Intensive Care Unit (ICU) has been 

inconsistent due to a variety of causes [1] . 

Due to limited resources and the increasing demand 

for ICU beds with no “do not resuscitate (DNR)” policy, 

for the past 10 years in Kuwait, we have selectively 

placed some patients on mechanical ventilators in 

the general medical wards. Most of these patients 

are usually those on medical grounds “should not 

have been resuscitated or intubated” due to predicted 

poor prognosis. The aim of this audit was to look at 

the mortality of these patients who are mechanically 

ventilated in the medical wards in Mubarak Al-Kabeer 

Hospital, Kuwait (MKH). 

MKH is a secondary referral hospital servicing 

approximately one third of the population of Kuwait 

(1 million inhabitants). It has a total of 450 beds of 

which 186 are allocated to adult medical patients. To 

the best of our knowledge, there are very few countries 

in the world that do not have a DNR policy and 

selectively place poor prognosis patients on invasive 

mechanical ventilation in the general medical ward. 

This is the first time in Kuwait that the mortality and 

characteristics of such patients has been reviewed 

systematically. 


We collected data from the general medical wards 

in MKH over a six-month period starting from 1 st May 

to 31 st October, 2010. The need for written consent 

and ethical approval was waived by the local hospital 

administration due to the observational nature of the 

study. Mechanical ventilation (MV) was either through 

a tracheostomy or an endotracheal tube. 

We included all patients that were placed on 

mechanical ventilation in the medical wards that 

survived at least two hours from onset of MV. Since all 

patients unselectively receive CPR and are intubated 

during the process, we chose two hours as the minimal 

survival time post MV. This is to ensure that we are 

measuring the mortality of patients on MV in the ward 

rather than the mortality of cardiac arrest patients 

in the hospital, who are usually intubated during 

resuscitation. 


Sulaiman Khadadah, MB Bch, BAO, Department of Medicine, Mubarak Al-Kabeer Hospital, Kuwait. P O Box 15081 Al-Daeyah, Kuwait. 

Tel: +1 514 880 7484, E-mail: Khadadas@tcd.ie

323 



The following exclusion criteria were used: 

1. Patient on home mechanical ventilator admitted to 

hospital 

2. Patients on MV in the ward prior to 1 st May 2010 

3. Patients transferred to ICU or CCU (coronary care 

unit) within 48 hours 

The decision to transfer a patient to the ICU or 

keep him in the ward was made by the ICU doctors 

on call for that evening, and was based on the patient's 

previous medical history and the perceived benefit 

from MV, resuscitation or further ICU management. 

By visiting the wards every 48 hours and reviewing 

the patient’s charts, we collected data about the age, 

reason for MV and admission, number of days on 

MV and number of days to onset of MV, past medical 

history, and location of patients. The reason for 

admission was recorded as per the admission sheet. 

The reason for MV was recorded as the reason written 

at the time of intubation. If the reason for MV was 

changed to a more specific one during follow-up, the 

reason for MV was changed accordingly. The primary 

outcome was death. The secondary outcome was 

extubation, which was defined as being disconnected 

from mechanical ventilation for a two-week period. If 

the patient was reconnected to a ventilator during the 

course of the same admission, the period of mechanical 

ventilation was considered as one prolonged period. 

Unfortunately the final cause of death was not recorded 

due to great uncertainty in the cause of death in 

many of these patients as well as lack of post-mortem 

examination. Therefore, this data was not collected. 

The investigators had no input regarding any aspect 

of management of the patients. 

RESULTS 

Over the six-month period, 81 patients were placed 

on MV in the ward that met the inclusion criteria. 

Complete data were collected for all patients. The 

background medical history was grouped into related 

diseases for ease of collection and to compare patient’s 

characteristics. 

Out of the 81 patients that were reviewed, only 

four had met the survival criteria achieving an overall 

survival of 5% and a mortality of 95% for patients on 

MV in the medical ward. Two of the survivors died 

during the course of the same admission. Twenty-five 

patients survived less than 48 hours (31% of patients), 

and 56 survived over 48 hours (69%). 

The patients were almost equally divided between 

the medical wards. The ratio of male to female patients 

was 1:1 (40 patients). The average age of patients was 

70.9 years with over 80% of patients being over 60 

years (age range 15 – 92 years). The mean number 

of medical co-morbidities between male and female 

patients was four (mode 5, median 4). 61% of patients 

had four or more medical conditions (Fig. 1). All the 

Fig. 1: Percentage of patients and associated number of medical 

conditions. This bar chart shows the percentage of patients and 

their associated number of diseases. Most patients had four or more 

diseases. 

survivors had three or less medical conditions. The 

commonest diseases were hypertension (68%) and 

diabetes (60%), both present in over 60% of patients. 

Chronic kidney disease (CKD), ischemic heart disease 

(IHD), chronic obstructive pulmonary disease (COPD), 

interstial lung disease (ILD), stroke, and cancer were 

also found to be present in many of the patients (Fig. 

2). The commonest reason for MV was cardiac arrest 

followed by decreased level of consciousness and then 

desaturation (Table 1). 

Table 1: Indication for mechanical ventilation 

Indication for MV Patients % 

Cardiac arrest 24 29.6 

Decreased level of consciousness 19 23.5 

Desaturation 14 17.3 

Pneumonia 8 10.0 

Septic shock 6 7.4 

Left ventricular failure 3 3.7 

Dyspnea 1 1.2 

Pulmonary embolus 1 1.2 

Myocardial infarction 1 1.2 

Gastrointestinal bleed 1 1.2 

Fit 1 1.2 

Surgery 1 1.2 

Unknown 1 1.2 

The mean length of MV was 20 days and the mean 

time to onset of MV from admission was 18 days. 

There were 61 (75%) patients in cubicles (a four-bed 

room with no door and glass windows on either side 

that lets the nurses see the patient from the corridor) 

and 30 (25%) patients in private rooms. 

Cost analysis for the 81 patients for one year 

was estimated at over a quarter of a million Kuwaiti



Fig. 2: Prevalence of medical conditions excluding HTN and DM. 

This bar chart shows the prevalence of each disease among the 

study population. 

dinars / year. Average cost of running a mechanical 

ventilation bed on the general medical floor was 

calculated to be approximately 85 KD / day which 

is only 5 KD over the average cost of normal general 

medical bed. Also included into the calculation was 

the average cost of expected laboratory and imaging 

investigations over that period. This is considered to 

be a large underestimate, given the fact that cost of 

manpower, medication and the cost of redirection and 

utilization of other resources for other patients that 

need medical beds was not taken into account in this 

estimation. 

DISCUSSION 

There is very little literature that evaluates the 

mortality of patients on mechanical ventilation outside 

specialized units like the ICU and CCU. This is mainly 

due to the rarity of this clinical scenario in the world 

and the general consensus that mechanically ventilated 

patients need a higher degree of specialized care. 

The mortality rate obtained in this audit was 

staggering. At first glance, it seems that mechanically 

ventilating a patient on the ward is almost a sure death 

sentence for the patient, especially when compared 

to the mortality of medical patients that received 

mechanical ventilation in the ICU (30%, obtained form 

the ICU, MKH mortality census for May to October of 

the same year). Looking at the number of the medical 

conditions the ventilated patients in the ward had, it 

was found that over 84% of them had three or more 

medical conditions with a high percentage having 

brain dysfunction (dementia, mental retardation or 

stroke), cancer and end-stage diseases. These figures 

raise many questions and concerns. Why is the 

mortality rate of these patients so high? Could it be 

due to suboptimal quality of care received by these 

patients, our very aggressive resuscitation efforts, 

lack of a DNR policy or any selection bias by ICU not 

admitting patients they thought will not survive. 

Through literature search, we found two articles 

that examined at similar problems [2,3] . In both studies, 

the authors compared the mortality rate of patients 

on invasive MV in the ICU and in the general medical 

ward. They showed significant difference in mortality 

/ survival of ICU to non-ICU ventilated patients in 

favor of ventilation in the ICU. 

We compared the care that our patients received 

to the care received in the study by Lieberman et al [2] . 

The patients in the general medical ward in MKH are 

generally examined three times per day. Only one time 

a day are they seen by the ICU personnel, who are 

trained to deal with mechanically ventilated patients 

and can adjust the ventilator to meet the patient’s 

needs. The rest of the visits, if any, are done by medical 

personnel who have limited experience in dealing with 

mechanical ventilators. With regard to nursing care, 

the nurse assigned to each patient is looking after 3 

- 4 other patients at the same time. They have minimal 

expertise in dealing with mechanically ventilated 

patients. The patients were also placed in different 

rooms including private rooms that are isolated 

from the nurse’s station. Lieberman and colleagues [2] 

reported a mortality of 68% in patients who were 

ventilated in the ward. Their patients were seen five to 

six times per day including a visit at night by personnel 

who were skilled in managing ventilator patients and 

the patients were cared for in one room with a nurse 

skilled in their management. Therefore, it seems that 

care might have contributed to our higher mortality 

outcome and although our audit was observational 

and not designed specifically to detect difference in 

the outcome based on care, it seems unlikely that this 

difference in mortality can be explained by quality of 

care alone especially when looking at Lieberman [2] , 

and Hersch [3] patient exclusion criteria. 

In contrast to our audit, both studies of Lieberman [2] , 

and Hersch [3] excluded DNR patients and those who 

are unlikely to survive over six months. On the other 

hand, our study sample was almost entirely made up 

of patients who on medical grounds, as judged by ICU 

doctors, should not have been resuscitated. Examples 

are stroke patients, patients with metastatic cancers, 

end-stage heart and lung diseases, which contributed 

to our much higher mortality rate. Currently in 

Kuwait, we have no DNR orders and when these 

patients deteriorate, they are resuscitated for purely 

medico-legal or religious purposes. This we deem as a 

highly unethical practice. 

One could also argue that there is obvious selection 

bias of leaving patients that were perceived “will do 

worst” to the ward, therefore increasing the mortality 

rate in the ward, which is true especially because

325 



the method of selection was not standardized in the 

hospital and was left to the discretion of the ICU 

doctor. The counter argument to that is, selection was 

based on medical judgment of futility and not only on 

resource allocation, and therefore, ICU doctors were 

correct 95% of the time in selecting patients that were 

judged not to benefit from initial resuscitation and 

transfer to the ICU. 

It is likely that both suboptimal care and aggressive 

resuscitation contributed to the high mortality rate 

obtained in this audit. The results of this audit cannot 

with certainty determine the exact cause of this high 

mortality, because our data was very heterogeneous 

and will not allow firm conclusions to be made. 

However, the data obtained in this audit is a very 

strong proof that we are not benefiting these patients by 

resuscitating them and leaving them on the ward. On 

the contrary, we are simply prolonging the inevitable 

and causing the patient a great deal of harm through the 

process of ventilation. Also, it results with a negative 

psychological impact on the family by allowing them to 

see their relatives in this situation while they are being 

falsely reassured that their relative will become better. 

There are also obvious massive economic implications 

associated with this practice. 

Through the decades, physicians have come to 

recognize their limitations. They look at the quality of 

life of patients that have end-stage disease rather than 

simply ensuring that patients have a heart beat and 

a recordable blood pressure. Around the world, the 

laws have adopted these changes, but unfortunately 

in Kuwait, we are still lagging behind in this very 

crucial matter due to medical, social and especially 

religious misconceptions. Religion has been a powerful 

driving force influencing enactment of many polices 

in Kuwait. Although it is not in our ability to make 

recommendations about religious aspects of ‘end 

of life’ policies, it would make sense that the role of 

religion is to empower doctors to make a decision for 

or against DNR and we have found that, contrary to 

popular societal beliefs, Islam does indeed support 

the practice of DNR [4] . Patients family and doctors 

are paying the price, not only through spending our 

limited resources, but also by patient's losing faith in 

local medical practice. This loss in faith has resulted 

in large number of people looking for medical care 

outside Kuwait. 

CONCLUSION 

It is clear from this audit that ventilating a patient 

out of the ICU in our hospital is fatal. Although the 

exact reasons for this high mortality rate cannot be 

determined from our data, there is overwhelming 

evidence that we need to update our laws regarding 

DNR (medical, legal, and religious cooperation). Lastly, 

we need to further study the characteristics of these 

patients who end up ventilated on the general medical 

ward in order to make the proper recommendations on 

how to improve their survival. 

REFERENCES 

1. Task Force of the American College of Critical Care 

Medicine, Society of Critical Care Medicine. Guidelines 

for intensive care unit admission, discharge, and triage. 

Crit Care Med 1999; 27:633-638. 

2. David Lieberman, Liat Nachshon, Oleg Miloslavsky, et 

al. Elderly patients undergoing mechanical ventilation 

in and out of intensive care units: a comparative, 

prospective study of 579 ventilations. Critical Care 

Forum 2010. 

3. Moshe Hersch, Moshe Sonnenblick, Alexander Karlic, 

et al. Mechanical ventilation of patients hospitalized 

in medical wards Vs the intensive care unit - an 

observational, comparative study. J Crit Care 2007; 

22:13-17. 

4. Fatwa # (12086) the Saudi Committee for Fatwa & 

Islamic Affairs 2000, http://www.ispub.com/journal/ 

the_internet_journal_of_health/volume_7_number_1_ 

5/article/an_islamic_medical_and_legal_prospective_ 

of_do_not_resuscitate_order_in_critical_care_ 

medicine.html



Case Report 

Unusual Presentation of Duplex Collecting 

System: A Case Report 

Mukesh Kumar Vijay, Preeti Vijay, Pramod Kumar Sharma 

Department of Urology, IPGME & R, 242 AJC Bose Road, Kolkata, West Bengal, India 


ABSTRACT 

Duplex collecting systems (also known as duplicated 

collecting systems) can be defined as renal units containing 

two pyelo-caliceal systems that are associated with a single 

ureter or double ureters. The two ureters empty separately 

into the bladder or fuse to form a single ureteral orifice. We 

came across a case in which the diagnosis was in dilemma 

until actual surgery when it was finally diagnosed as a case 

of duplex collecting system. 

KEY WORDS: duplicated collecting system, reterograde pyelogram 

INTRODUCTION 

Complete duplication of ureters occurs in 0.2% of 

live births; the chance of occurrence is 12% in firstdegree 

relatives of persons with this condition. The 

prevalence of partial duplication found on urograms is 

0.6% [1] . We encountered such a case that was initially 

diagnosed as infection of the upper urinary tract. 

However, subsequent investigation diagnosed it as a 

case of complex renal cyst. Finally, intra-operatively the 

case could be correctly diagnosed as a case of duplex 

collecting system. 

CASE HISTORY 

A 40-year-old patient presented to our outpatient 

department with complaints of dull aching 

pain occurring in the right flank region since the 

last six months. There was no history of hematuria. 

On examination the right kidney was palpable. An 

ultrasound examination of the patient revealed a 

single, irregular shaped cyst of size 104.2 x 66.1 mm 

with echogenic fluid in the lumen, in upper cortex 

of the right kidney. Intravenous urography showed 

the upper and middle calyx of the right kidney to be 

displaced in an arc-like fashion, suggestive of a cyst / mass 

lesion of the right kidney (Fig. 1). Keeping a provisional 

diagnosis of renal cyst in mind the patient was advised 

a contrast enhanced CT scan of the abdomen and pelvis 

which showed a thick walled, lobulated cystic lesion 

with thin peripheral calcification and few internal 

septa, measuring 82.5 x 64.77 x 100 mm arising from 

the anterior aspect of the right kidney (Fig. 2). The 

wall of the cyst and the internal septa were seen to 

enhance post- contrast. With the diagnosis of complex 

renal cyst (Bosnaick’s type 3) the patient was posted 

for partial / radical nephrectomy. A reterograde 

pyelogram done during the operation showed upper 

calyx of the right kidney to be arc-like, besides a 

faintly opacified grossly dilated pelvi-calyceal system 

inferior to the arched upper calyx (Fig. 3). It was at 

this time that the possibility of a duplex renal system 

occurred to us. On exploration the patient was found 

to have a duplicated pelvi-calyceal system with 

duplex upper ureter (Fig. 4). The lower system had a 

very short ureter along with obstruction of the pelviureteric 

junction. The lower pelvi- calyceal system 

was grossly dilated. However, the upper system was 

not dilated. The narrowed pelvi-ureteric junction and 

the short lower ureter were excised and the pelvis of 

the lower system was anastomosed in an end to side 

fashion to the ureter of the upper system. Postoperative 

recovery was uneventful and the patient was found 

to be progressing well during follow-up. 

Differential diagnoses considered in this case 

were: 

Complex renal cyst (Bosnaick’s type 3) 

Infected cyst ( abcess or antibioma) 

Duplex kidney with non-functioning lower pole 


Dr Mukesh kumar Vijay, M ch, Asst. Professor, IPGMER & SSKM Hospital, 242 AJC Bose Road, Kolkata, India 700020. E-mail: 

drmukeshpreeti@gmail.com, drmukeshpreeti@rediffmail.com

327 

Unusual Presentation of Duplex Collecting System: A Case Report 


Fig. 1: Intravenous urography showing the upper and middle calyx 

of the right kidney displaced in an arc-like fashion, suggestive of a 

cyst / mass lesion 

Fig. 3: Reterograde pyelogram showing upper calyx of the right 

kidney to be arc-like. This is besides a faintly opacified grossly 

dilated pelvi-calyceal system inferior to the arched upper calyx. 

Fig. 2: NCCT scan showing a thick walled, lobulated cystic lesion 

with thin peripheral calcification and few internal septa in right 

kidney 

DISCUSSION 

Duplicated collecting systems (also known as 

duplex collecting systems) can be defined as renal 

units containing two pyelo-caliceal systems that are 

associated with a single ureter or double ureters. The 

prevalence of partial duplication found is 0.6% [2] . 

When a single ureteral bud bifurcates before the 

ampulla bifurcates, a duplex kidney with a bifid renal 

pelvis or bifid ureter results [1] . 

Fig. 4: Intra-operative image showing the lower system having 

a very short ureter along with obstruction of the pelvi-ureteric 

junction



Most patients are asymptomatic, with genitourinary 

tract abnormalities being detected incidentally on 

imaging studies performed for other reasons. Urinary 

tract infection and parenchymal scarring is increased 

in patients with a duplex collecting system; patients 

can present with pyrexia, pain and dysuria. Ureteropelvic 

junction obstruction is more common when a 

duplex kidney exists [2] . Giant hydronephrosis in a 

duplex kidney can manifest as an extremely large 

abdominal and retroperitoneal mass; in rare cases, it 

can cause hypertension. 

During ultrasonography, the duplex kidney appears 

as two central echo complexes with intervening renal 

parenchyma. Hydronephrosis at one pole is suggestive 

of a duplex kidney [3] . Although hydronephrosis can 

occur at either pole, it is more common in the upper 

one. The ultrasonographic appearance of a duplex 

kidney is specific but not sensitive. Differentiating 

an atrophied lower pole moiety of a duplex kidney 

(nubbin) from other renal masses is difficult [4] . 

With excretory urography, duplex kidney is 

usually longer than the non-duplex kidney. Calyces 

are asymmetric. Ectopic, upper pole ureteric insertion 

can produce a non-opacified segment. This mass effect 

results in the “drooping lily” sign with the depression 

of the lower pole pelvi-caliceal system. If the lower 

pole of the duplex kidney is functioning poorly or 

not at all, the lower pole collecting system may not 

opacify, and no discernible parenchyma will surround 

it (Nubbin sign). The appearance of the kidney may 

consequently resemble that of a non-duplex kidney 

with a lower polar mass or renal infarct. 

In computed tomography, the intervening renal 

parenchyma in a duplex kidney lacks a collecting 

system and major vessels. It is described as having a 

“faceless kidney” appearance, the collecting system in 

the nubbin or the mass effect of tissue at the pole [4] . 

Additional relevant findings include focal infarcts, 

cortical scars and atrophic scarred kidney. CT scan is 

superior to ultrasonography and excretory urography 

in diagnosing the lower pole nubbin [5] . In addition, the 

modality is helpful when function is poor or absent. 

CONCLUSION 

Careful history, examination and investigation may 

not rule out congenital abnormality of the kidneys like 

duplex collecting system. It may require a high index 

of suspicion as well as some invasive investigation 

to reach a final diagnosis. However, intra-operative 

findings can still surprise us with an entirely different 

diagnosis. 

REFERENCES 

1. Bruno D, Delvecchio FC, Preminger GM. Successful 

management of lower-pole moiety ureteropelvic 

junction obstruction in a partially duplicated collecting 

system using minimally invasive retrograde endoscopic 

techniques. J Endourol 2000; 14:727-730. 

2. Glassberg KI, Braren V, Duckett JW, et al. Suggested 

terminology for duplex systems, ectopic ureters and 

ureteroceles. J Urol 1984; 132:1153-1154. 

3. Horst M, Smith GH. Pelvi-ureteric junction obstruction 

in duplex kidneys. BJU Int 2008; 101:1580-1584 

4. Morgan CL, Grossman H, Trought WS, et al. Ultrasonic 

diagnosis of obstructed renal duplication and 

ureterocele. South Med J 980; 73:1016-1019. 

5. Blair D, Rigsby C, Rosenfield AT. The nubbin sign on 

computed tomography and sonography. Urol Radiol 

1987; 9:149-151.

329 



Case Report 

Double Appendix: Report of a Case 

Naorem Gopendro Singh 1 , Hisham Kantoush 2 , Mirza Kahvic 1 

1 

Department of Pathology and 2 Surgery, Al-Jahra Hospital, Kuwait 


ABSTRACT 

A 30-year-old female presented to the surgery outpatient 

department with complaint of pain in right iliac fossa of 

one day duration. The pain was associated with nausea and 

vomiting. On examination, there was localized tenderness 

and rigidity in the right iliac fossa with positive rebound 

tenderness. Multiple pigmentation of skin in the abdomen, 

accessory nipple and scoliosis were also noted. Laboratory 

investigation revealed neutrophilic leukocytosis. Ultrasound 

abdomen showed an appendix measuring 4 cm in length and 

a fibroid uterus. Diagnostic laparoscopy revealed an inflamed 

appendix with a small blind structure in continuity with the 

cecum. Operative diagnosis of double appendix was made. 

Microscopic examination confirmed double appendix with 

features of appendicitis and periappendicitis in the bigger 

appendix. We report this case because of it rarity. The surgical 

resident should be aware of this rare congenital anomaly 

to avoid missing the other appendix in appendectomy 

procedures and avoid its medico-legal consequences. 

KEY WORDS: appendicitis, congenital anomaly, double appendix 

INTRODUCTION 

Despite the notorious range of variation in 

character and position natural to the human vermiform 

appendix, the extremes of variation (absence or 

duplication) affect this organ so very rarely that they 

are worth mentioning and recording. Duplication of 

vermiform appendix is rare with reported incidence of 

0.004% [1] and may be associated with other congenital 

duplications or other anomalies [2] . Doubled appendix 

is usually asymptomatic. When symptomatic, they are 

usually the result of obstruction and inflammation. 

Majority of the cases are diagnosed at surgery or on 

postmortem examination. Some of them can be picked 

up preoperatively on barium enema. The clinical 

presentation can vary according to the location of the 

appendices [3] . Here we report a case of double appendix 

because of its extreme rarity and discuss its etiology 

and different types of anatomic presentation. 

CASE REPORT 

A 30-year-old female patient presented with 

right lower abdominal pain of one day duration 

with associated nausea and vomiting. She gave no 

history of change in bowel habits, urinary symptoms, 

menstrual disturbance or similar previous attacks. 

On examination she was afebrile. There was localized 

tenderness and rigidity with positive rebound 

tenderness in right iliac fossa. Multiple pigmentation 

of skin especially in the abdomen, accessory nipple 

(polythelia) and scoliosis were noted. No mass could 

be felt. Her pelvic examination did not reveal any 

positive findings. Laboratory investigations revealed a 

total white blood count of 24.8 x 10 9 cells per liter with 

neutrophilia (72%). Other laboratory investigations 

including blood urea, creatinine and liver function 

test were unremarkable. Ultrasound abdomen showed 

an appendix measuring 4 cm in length and a fibroid 

uterus with minimal localized collection of fluid, in the 

right iliac fossa. 

With a presumptive diagnosis of acute appendicitis, 

diagnostic laparoscopy was performed on the day of 

admission with insufflation of CO 2 gas and insertion 

of three trocars, two 10 mm ports and one 5 mm 

port. There was minimal fluid in the pelvis with an 

inflamed appendix, which could be easily identified. 

No evidence of perforation or mass formation was 

noted. However, another blind structure was seen 

in continuity with the cecum and was incidentally 

discovered during dissection of mesoappendix (Fig. 1). 

An operative diagnosis of double appendix was made. 

The operation was terminated after retrieval of the 

appendices with endopouch and exploration of rest 

Adress correspondence to: 

Naorem Gopendro Singh, MD, Department of Pathology, Al-Jahra Hospital, P O Box 62276, Jahra 02153, Kuwait. Tel: + 965-97128990, Fax: + 

965-24582628, E-mail: gopen71@yahoo.co.in



Fig. 1: Laparoscopic photograph showing the base of double 

appendix (arrows) and attached mesoappendix in-between 

Fig. 3: Photomicrograph showing the two separate mucosas (arrows) 

of the double appendix with two separate muscle coats and both 

muscular walls separated by meso-appendicular fibroadipose tissue 

( H & E stain X20) 

of small and large bowels, which ruled out any other 

associated congenital anomaly. Her postoperative 

course was uneventful and she was discharged on 

postoperative day five. 

Gross pathological examination of the specimen 

showed duplex vermiform appendix (Fig. 2). The 

bigger appendix measured 5.1 cm and the small one 

measured 1.5 in length. Both the appendices were 

attached to mesoappendix in close proximity. The 

specimen displayed focal congestion in the serosal 

aspect of the bigger appendix. Microscopic examination 

revealed two lumina of appendices having two separate 

muscle coats and lymphoid follicles in the mucosa 

(Fig. 3). The bigger and longer appendix revealed 

mixed acute and chronic inflammatory infiltrate in 

the mucosa as well as in the muscle coat showing 

features of acute appendicitis with periappendicitis. 

The small one showed regular morphology without 

any inflammation. Thus the operative diagnosis of 

Fig. 2: Gross photograph of the double appendix. Arrow pointing 

the small appendix 

double appendix was microscopically confirmed with 

one appendix showing features of acute appendicitis. 

DISCUSSION 

Duplication of the vermiform appendix, originally 

described in 1930, is rare with a reported incidence of 

0.004% [1] . The etiology of double appendix is unknown, 

but the most rational explanation was offered by Kelly 

and Hurdon who examined 54 human embryos to 

explain the origin and development of the appendix [4] . 

They described a minute budding “transient 

appendix” on the tip of the cecum in a 6-week-old 

embryo [4] . This small “transient appendix” usually 

atrophied or disappeared in the 8-week-old embryo [4] . 

Hence “transient appendix” is a definite potential 

for the embryological origin for the development of 

a supernumerary appendix and the most plausible 

explanation of the appendix duplex. Cave [5] classified 

three types of appendicular duplication as: 

Type A: Single cecum with one appendix exhibiting 

partial duplication 

Type B: Single cecum with two obviously separate 

appendices (complete duplicity) 

Type C: Duplication of cecum with each cecum bearing 

its proper appendix 

The simplest illustrations of the first type are those 

curious specimens of ‘double-barrelled’ appendix 

wherein the single organ presents two distinct 

lumina throughout either length or throughout only 

a part thereof [5] . The second type was first recorded by 

Paterson and Emrys-Robert (1906) wherein a full-term 

fetus, the subject of ectopia viscerum, spina bifida and 

other congenital anomalies showed a small ‘sacculated 

and curved appendix’ lying on each side of the ileocecal 

junction [5] . Type C was first reported by Greig 

(1934) in which the whole bowel duplicates distal to 

the site of Meckel’s diverticulum; two separate ceca 

were present, each bearing its proper vermiform 

appendix [5] .

331 

Double Appendix: Report of a Case 


Wallbridge [6] modified Cave’s [5] original 

classification of duplicated vermiform appendix into 

three types as follows: 

A: Partial duplication of the appendix on a single 

cecum 

B: Single cecum with two completely separate 

appendices 

B1: “Bird-like appendix” called so because of its 

resemblance to the normal arrangement in birds, 

where there are two appendices symmetrically 

placed on either side of the ileo-cecal valve 

B2: One appendix arises from the usual site on the 

cecum, with another rudimentary appendix arising 

from the cecum along the line of the tenia at varying 

distance from the first 

C: Two ceca, each bearing its own appendix 

Though majority of the cases are diagnosed at 

surgery or on postmortem examination, some of the 

cases can be picked up preoperatively on barium enema. 

Peddu et al reported an incidental finding of Type B1 

double appendix by barium enema in a 73-year-old 

man who was investigated for the rectal bleeding [7] . 

In such cases the patient may be informed about the 

abnormality; however the role of conventional / 

laparoscopic appendectomy for the removal of the 

asymptomatic double appendix has not been welldefined. 

Although preoperative diagnosis could be 

made with the aid of radiological studies such as a 

barium enema, in cases associated with duplication 

of colon, the majority of cases have been diagnosed at 

surgery or upon pathological examination [8] . 

The present case represents type B2 of appendicular 

duplication, thought to represent the persistence of the 

“transient appendix”. Duplication of the vermiform 

appendix must be distinguished from a solitary 

diverticulum of the cecum [5,6] . True double appendices 

have lymphoid tissue and muscular walls, but a cecal 

diverticulum does not contain lymphoid tissue and is 

merely an out-pouching of mucosa and submucosa 

through a muscular defect [5,6] . In the current case, there 

were two separate appendices which were proved 

microscopically. 

Some cases of double appendix are associated with 

intestinal, genitor-urinary or vertebral malformation [8,9] . 

We should be aware of these possible malformations 

and the patient should be explored for the same at 

time of operation. The risk of associated malformation 

seems to be greater in young children, especially those 

with type B1 and C malformations [9] . In our present 

case, double appendix was incidentally found while 

performing laparoscopic appendectomy and we did 

not find any other gastrointestinal congenital anomalies 

like intestinal duplications that were commonly 

associated with double appendix. But she had other 

anomalies like scoliosis and skin lesions which were 

recorded for further notification with double appendix 

in the future. Kothari et al [3] reported duplex appendix 

in association with imperforate anus [3] . 

In patients with double appendix, when only a 

single appendix is found to be inflamed on exploration 

or laparoscopy, both the appendices should be 

removed so as to avoid diagnostic confusion that may 

arise on removal of a single appendix [10] . To the best of 

our knowledge, surgical management for the double 

appendix is same as the conventional / laproscopic 

appendectomy. No literature describes any unique 

technique for double appendix differently. However, 

one should explore for the possible associated 

malformation. In the current case, only the bigger and 

longer appendix was inflamed, however we removed 

both the appendices including the smaller noninflamed 

one. 

CONCLUSION 

Double appendix is extremely rare. Surgical 

residents should be aware of the possibility of 

duplication of appendix to avoid missing double 

appendix and its medico-legal consequences. 

REFERENCES 

1. Chew DK, Borromeo JR, Gabriel YA, Holgersen LO. 

Duplication of the vermiform appendix. J Pediatr Surg 

2000; 35:617-618. 

2. McNeill SA, Rance CH, Stewart RJ. Fecolith impaction in 

a duplex vermiform appendix: An unusual presentation 

of colonic duplication. J Pediatr Surg 1996; 31:1435- 

1437. 

3. Kothari AA, Yagnik KR, Hathila VP. Duplication of 

vermiform appendix. J Postgrad Med 2004; 50:285-286. 

4. Kelly HA, Hurdon E. Anatomy: The vermiform appendix 

and its diseases. Philadelphia: WB Saunders 1905:55-74. 

5. Cave AJ. Appendix vermiformis duplex. J Anat 1936; 

70:283-292. 

6. Wallbridge PH. Double appendix. Br J Surg 1962; 50:346- 

347. 

7. Peddu P, Sidhu PS. Appearance of a Type B duplex 

appendix on barium enema. Br J Radiol 2004; 77:248- 

249. 

8. Kabay S, Yucel M, Yaylak F, et al. Combined duplication 

of the colon and vermiform appendix in an adult patient. 

World J Gastroenterol 2008; 14:641-643. 

9. Gilchrist BF, Scriven R, Nguyen M, Nguyen V, Klotz 

D, Ramenofsky ML. Duplication of the vermiform 

appendix in gastroschisis. J Am Coll Surg1999; 189:426. 

10. Lin BC, Chen RJ, Fang JF, Lo TH, Kuo TT. Duplication of 

the vermiform appendix. Eur J Surg 1996; 162:589-591.



Case Report 

Oncocytic and Clear Cell Areas in a Solid Pseudopapillary 

Tumor of the Pancreas: A Case Report 

Anuradha C K Rao, Manna Valiathan, Padmapriya Jaiprakash 

Department of Pathology, Kasturba Medical College, Manipal, Karnataka, India 


ABSTRACT 

Solid pseudopapillary tumor (SPT) of pancreas is a rare, 

distinct, low-grade malignant neoplasm. Variable areas 

like clear cell foci can exist in this tumor, which can easily 

mislead the pathologist. Diagnosis of the same is important 

to distinguish from other clear cell lesions in the pancreas. 

Oncocytoid differentiation is rarer still and can raise doubts 

about the diagnosis, especially on trucut biopsies. Herein, 

we discuss a case of SPT of the pancreas exhibiting variable 

cellular morphology, of which very few cases have been 

reported in world literature. 

KEY WORDS: oncocytic, pancreas, solid pseudopapillary tumor 

INTRODUCTION 

Solid pseudopapillary tumor (SPT) is an uncommon, 

low-grade malignant neoplasm accounting for 1% of 

all exocrine pancreatic tumors. Exact histogenesis of 

this tumor remains uncertain [1] . As the various names 

for the tumor suggest, it is a solid and cystic pancreatic 

neoplasm with characteristic pseudopapillae and sheets 

of intermediate and small sized polygonal cells with 

minimal morphological deviation. Herein, we report a 

case of oncocytic variant of this tumor on account of its 

rarity and the few cases reported till date. 

CASE HISTORY 

A 29-year-old lady presented to the surgical outpatient 

department, with a history of swelling in the 

upper abdomen of one month duration, which was not 

associated with pain, vomiting or abdominal distention. 

Patient had a past history of exploratory laparotomy 

10 years ago, for palliative gastrojejunostomy and 

enterostomy in view of biopsy reported as suspected 

neuroendocrine tumor of pancreas, which, however, 

was not removed. On examination, a firm to hard mass 

of 10 x 7 cm, moving with respiration was palpated 

in the left hypochondrial region. All routine laboratory 

investigations were within normal range except an ESR 

of 40. Ultrasound abdomen was normal and upper GI 

endoscopy revealed extraluminal compression on 

stomach. A CT-scan revealed a cystic neoplasm arising 

from the head of pancreas and a clinical diagnosis 

of cystic neoplasm of mucinous origin of pancreas 

was made, in view of which the patient underwent 

Whipple’s pancreatectomy. Post-operative period 

was uneventful and the patient was discharged on 

the tenth post-operative day. The patient had no fresh 

complaints on follow-up after two months. However, 

she presented with amenorrhea after four months, 

post-operatively. On ultrasonography, polycystic 

ovaries were detected and she was advised for weight 

reduction. The patient was lost to follow-up after that. 

Pathological findings 

Gross: The tumor was well-demarcated, nodular and 

unencapsulated, weighing 911 grams and measuring 

16 x 11 x 10 cm. Cut section showed a multiloculated 

cystic tumor with variegated appearance comprising 

grey-white, friable irregular solid areas, yellow areas 

and hemorrhagic foci and peripheral rim of pancreatic 

tissue. 

Microscopy: Sections showed a well demarcated 

but unencapsulated tumor composed of sheets and 

trabeculae of loosely cohesive polygonal cells with 

central ovoid nuclei, few with eccentrically placed 

nuclei and finely stippled or granular chromatin. 

Focal clear cell areas (Fig. 1) were identified with 

abundant cytoplasmic, PAS and mucicarmine negative 

vacuoles and rare mitotic figures, separated by bands 

of hyalinised fibrous tissue with myxoid changes. 

Areas showing solid nests of polygonal cells with 

abundant eosinophilic granular cytoplasm and central 

vesicular nucleus with prominent nucleolus were 


Dr Padma Priya J, Assistant Professor, Department of Pathology, Basic Sciences Block, Kasturba Medical College, Manipal 576104, Karnataka, 

India. E-mail: padmapriya.j@gmail.com

333 

Oncocytic and Clear Cell Areas in a Solid Pseudopapillary Tumor of the Pancreas... 


Fig. 1: Clear cell areas (H&E, x100) 

Fig. 2: Sheets and solid nests of polygonal cells with abundant 

eosinophilic granular cytoplasm and central vesicular nucleus with 

prominent nucleous (H & E, x 100, inset: H & E, x 400) 

cyclin D1, all of which were positive, thus confirming 

our diagnosis (Fig. 4). 

Fig. 3: Classical areas composed of pseudopapillae lined by loosely 

cohesive polygonal cells with central ovoid nuclei, few with 

eccentrically placed nuclei and finely stippled or granular chromatin 

(H & E, x 100) 

seen (Fig. 2). Extensive cystic degeneration with 

classical pseudopapillae were seen, which helped 

clinch the diagnosis (Fig. 3). Immunohistochemistry 

(IHC) performed revealed tumor cells to be positive 

for vimentin, and negative for endocrine markers 

(synaptophysin, chromogranin) and the epithelial 

marker, cytokeratin. Further immunohistochemical 

markers were later done, including CD117, CD10 and 

DISCUSSION 

The first cases of SPT of the pancreas were 

described by Frantz [2] . Various synonyms include solid 

and papillary neoplasm, solid and papillary epithelial 

neoplasm, papillary-cystic carcinoma, solid and cystic 

acinar cell tumor of the pancreas relating to gross 

features and most obvious histological pattern. WHO, 

in 1996, proposed the name ‘solid-pseudopapillary 

neoplasm to encompass the two most conspicuous 

histological features [3] . They account for < 1% of all 

pancreatic neoplasms [4] . It is most common in women 

(82%) about 30 years of age but, occasionally, the tumor 

occurs in older women, men or children [5] . 

Although the pathogenesis is so far unknown, 

studies have thrown new insights regarding the same, 

the most acceptable being of pancreatic duct origin 

due to the related strong expression of galectin-3 by 

the neoplastic cells [6] . 

SPT on fine needle aspiration (FNA) and trucut 

biopsy samples can often mimic neuroendocrine 

Fig. 4a: Immunohistochemisty showing 

strong nuclear Cyclin D1 positivity 

Fig. 4b: Immunohistochemisty showing 

membrane positivity with CD10 

Fig. 4c: Immunohistochemisty showing 

CD117: cytoplasmic granules



tumors [7] , especially if the classical areas have not been 

sampled, as may have been the case in this patient, 

who was earlier misdiagnosed. 

Microscopically, classical areas are characterized by 

pseudopapillae and solid sheets of medium to small 

sized polygonal cells with vesicular nucleus and rare 

mitotic figures. This case was distinguished by the 

presence of focal areas with large polygonal cells with 

abundant eosinophilic granular cytoplasm and few 

with prominent nucleoli, along with areas showing 

multiple cytoplasmic vacuoles of varying sizes in many 

neoplastic cells. The vacuoles did not contain glycogen 

or mucin. Clear cells with cytoplasmic vacuoles are 

seen as a focal change in the classical form of SPT. They 

are formed by dilatation of the smooth endoplasmic 

reticulum and mitochondria [1] . Another source of clear 

cells is foamy macrophages. The differential diagnosis 

included clear cell endocrine pancreatic neoplasms 

with small lipid droplets and chromogranin positive 

neurosecretory granules [7] . Clear cell variant of 

ductal carcinoma of pancreas is distinguished by the 

presence of malignant cells with stromal desmoplasia, 

cytologic atypia, increased mitotic activity and areas 

of mucin-producing ductal carcinoma. Although 

serous cystadenoma is composed of clear cells, they 

contain glycogen and line small or large cystic spaces. 

Metastatic renal cell carcinoma should be considered 

in older individuals with cells showing lipid. 

Oncocytic areas in SPT have been recently described. 

Oncocytic changes may mean a favorable prognosis 

in neoplasms. It is seen in pancreatic neoplasms, 

and has been reported in acinar cell carcinoma, 

pancreatoblastoma, and intraductal oncocytic papillary 

neoplasm of the pancreas [8] . Oncocytic acinar cell 

carcinomas are usually solid, do not have a papillary 

and / or glandular component and are clinically 

aggressive [8] . Intraductal oncocytic papillary neoplasm 

of the pancreas is composed of cystically dilated ducts 

with long, thick papillae with fibrovascular cores, 

lined by cells with eosinophilic granular cytoplasm, 

and single eccentric nuclei [8] . Other unusual cell types 

described in SPT include pleomorphic spindle cells 

and cells with melanocytic differentiation [1] . 

IHC shows strong vimentin and CD10 positivity 

of SPT tumor cells, negativity for chromogranin, and 

weak or focal positivity for epithelial markers. Of late, 

SPT has been found to be positive for CD117 and cyclin 

D1 [9] . The clinical features, gross characteristics and 

immunoprofile of all the variants are similar to those 

of the classical SPT. 

CONCLUSION 

This is an interesting case of SPT of the pancreas 

with oncocytoid and clear cell areas posing 

diagnostic difficulty, especially on trucut biopsies. 

Clinicopathological correlation, microscopic pattern, 

extensive search for classical, non-oncocytic areas of 

the tumor with immunohistochemical stains help to 

arrive at an accurate diagnosis in this scenario. 

REFERENCES 

1. Albores-Saavendra J, Slimpson KW, Bilello SJ. The clear 

cell variant of solid pseudopapillary tumor of pancreas: 

A previously unrecognized pancreatic neoplasm. Am J 

Surg Pathol 2006; 30:1237-1242. 

2. Frantz VK. Tumors of the Pancreas. In: Anonymous 

Atlas of Tumor Pathology, Section 7, Fascicles 27 and 

28. Washington DC, USA: Armed Forces Institute of 

Pathology, 1959; 32-33. 

3. Kloppel G. Luttges J, Kllimstra D, Hruban R, Kern S, 

Adler G. Tumours of the exocrine pancreas. In: Hamilton 

SR, Aaltonen LA, editors. World Health Organization 

Classification of Tumours. Pathology and Genetics of 

Tumours of the Digestive System. IARC Press: Lyon 

2000. 

4. Martin RC, Klimstra DS, Brennan MF, et al. Solid 

pseudopapillary tumor of the pancreas: a surgical 

enigma? Ann Surg Oncol 2002; 9:35-40. 

5. Santini D, Poli F, Lega S. Solid-Papillary Tumors of the 

Pancreas: Histopathology. J Pancreas (Online) 2006; 

7:131-136. 

6. Geers C, Pierre M, Jean-Fancois G, et al. Solid and 

pseudopapillary tumor of the pancreas - review and 

new insights into pathogenesis. Am J Surg Pathol 2006; 

30:1243-1249. 

7. Hoang MP, Hruban RH, Albores-Saavendra J. Clear 

cell endocrine pancreatic tumor mimicking renal cell 

carcqinoma. Am J Surg Pathol 2001; 25:602-609. 

8. Liszka L, Pajak J, Zielinska-Pajak E, et al. Intraductal 

oncocytic papillary neoplasms of the pancreas and bile 

ducts: a description of five new cases and review based 

on a systematic survey of the literature. J Hepatobiliary 

Pancreat Sci 2010; 17:246-261. 

9. Adsay NV. Cystic lesions of the pancreas. Modern 

Pathology 2007; 20: S71–S93.

335 



Case Report 

Celiac Disease as Uncommon Cause of Death in 

Type 1 Diabetes Mellitus: A Case Study 

Yasser Mohamed Abd Elraouf Ibrahim 

Department of Internal Medicine, Al Sabah Hospital, Ministry of Health, Kuwait 


ABSTRACT 

Celiac disease (CD) is one of the most common immune 

mediated diseases. This disease is triggered by ingestion of 

wheat gluten and related other cereal proteins, particularly 

those in rye and barley. The prevalence of CD in type 1 

diabetes in children is 1:6 to 1:103 and in adults 1:16 to 

1:76. In-spite of that, there is no current clinical evidence 

supporting routine screening of adult type 1 diabetic patients 

for CD. Most patients who have diabetes and CD have nonclassic 

forms of CD, with various presentations such as short 

stature, sideropenic anemia, or hypertransaminasemia; in 

many cases, patients are totally symptom free. CD elevates 

the mortality risks of a wide array of diseases in CD patients. 

This case had an atypical presentation of CD, and died 

unexpectedly because of the disease. We report this case to 

emphasize on the value of high index of suspicion of CD in 

type 1 diabetes mellitus. 

KEY WORDS: diet, gluten free, immune-mediated diseases, tissue, transglutaminase 

INTRODUCTION 

Celiac disease (CD) is one of the most common 

immune-mediated diseases [1] . Atypical asymptomatic 

form and absent gastrointestinal manifestations, are 

common, and a case may be discovered on duodenal 

biopsy for any other reason or immunology screening [2] . 

Studies in the United States and Europe show the 

prevalence of the disease approaching 1% [3,4] . 

Based on small bowel biopsy diagnosis, the 

prevalence of CD in type 1 diabetes in children is 1:6 

to 1:103 and in adults 1:16 to 1:76 [5] . CD is most often 

present before the onset of diabetes. Most patients who 

have both diabetes and CD have non-classic forms of 

CD, with various presentations such as short stature, 

sideropenic anemia, or hypertransaminasemia; in many 

cases, patients are totally symptom free [6] . In-spite of 

that, there is no current clinical evidence supporting 

routine screening of an adult type 1 diabetic patient for 

CD [7] . 

CASE HISTORY 

A twenty-two-year old Kuwaiti single female 

presented to us in the outpatient department with 

abdominal pain, bilateral lower limb edema and skin 

pigmentation of two months duration. She was known 

case of type 1 diabetes mellitus for 13 years on intensive 

insulin regimen, but non-compliant to her medication 

and with poor glycemic control. She had irregular 

menstruation and good scholastic performance. Her 

body weight was 42 kg, height was 158 cm and body 

mass index was 16.8 kg/m 2 . On clinical examination, 

she was conscious, alert and oriented. Her BP was 

110/70 mmHg, pulse rate was 75 bpm, temperature 

was 36.8 ºC and respiratory rate was 22/min. General 

examination revealed bilateral lower limb pitting 

edema with brownish, patchy and scaly pigmentation 

on the extremities but without pruritus. There was 

neither lymphadenopthy nor thyroid enlargement. 

Examination of the chest, heart, abdomen and CNS 

was unremarkable. Routine urine examination was 

unremarkable. Liver function tests showed an elevation 

of ALT ( 85 IU/l, normal up to 45 IU/l), AST ( 58 IU/ 

l, normal up to 40 IU/l) and ALP (181 IU/l, normal 

up to 132 IU/l), with decreased plasma albumin to (18 

g/l, normal 35 - 50 g/l). Total bilirubin was 11 μmol/ 

l (normal upto 17 μmol/l) and direct bilirubin was 3 

μmol/l (normal upto 5 μmol/l). INR was elevated to 

2.3. 24-hour urinary protein was normal (160 mg/day). 

Complete blood picture showed a hemoglobin level of 

123 g/l (normal female range 135 - 150 g/l), WBC count 

was 7400/mm 3 (normal range 4000 – 11,000/mm 3 ) and 

platelets were 230,000/mm 3 (normal range 150,000 – 

450,000/mm 3 ). Abdomen and pelvic ultrasonography 

was unremarkable, Investigations for hepatitis A, B 


Dr Yasser Mohamed Abd Elraouf Ibrahim, MD, Department of Internal Medicine, Tanta Faculty of Medicine, Tanta, Egypt. Tel: 0020409115886, 

Mob: 0020102717656, E-Mail: masyasser@yahoo.com



and C, antinuclear antibodies and anti-double strand 

antibodies were negative. α -1 antitrypsin and serum 

ceruloplasmin were within normal limits. Serum 

protein electrophoresis was normal. Further enquiry 

into patient’s history, revealed that the patient had 

frequent attacks of diarrhea over the previous three 

months. 

The common association of CD with type 1 diabetes 

mellitus attracted our attention to the possibility of 

this disorder as a cause of the presenting picture of 

this patient. Anti-gliadin antibodies were evaluated 

together with anti-endomysial antibodies and tissue 

transglutaminase antibodies (tTGA). Anti-gliadin 

antibodies were elevated (IgA 62 u/l, normal < 5 u/l) 

IgG was 69 u/l (normal < 7 u/l), anti-endomysial 

antibodies were positive and tTGA were elevated (IgA 

was > 120 u/l, normal < 7 u/l). These findings were 

highly suggestive of CD. We proceeded for upper 

gastrointestinal endoscopy with duodenal biopsy for 

histopathology which showed nearly complete villous 

atrophy with intraepithelial lymphocytic infiltration. 

The patient was diagnosed to have CD with elevated 

liver enzymes as a result. Further investigations showed 

decreased level of vitamin D (41.45 nmol/l, normal 

50 - 80 nmol/l) and serum iron (3 μmol/l, normal 6 

– 7 μmol/l). A dietitian and gastroenterologist were 

consulted and gluten free diet (GFD) was started for the 

patient with multivitamin supplementation including 

vitamin D, K, folic acid, and iron. 

Four weeks later, although liver enzymes became 

normal, we were informed by the mother that her 

daughter was poorly compliant for GFD. 

Five weeks after diagnosis, the patient was admitted 

to the hospital because of urinary tract infection, 

diarrhea and increasing lower limb edema. Clinical 

examination was unremarkable except for bilateral 

lower limb pitting edema and brownish patchy scaly 

skin pigmentation on the extremities. Plasma albumin 

was as low as 15g/dl. Random blood sugar was 12.7 

mmol/l with no acetone in urine and blood pH was 

7.39. CBC showed Hb of 12.1g/dl WBCs 15,000/mm 3 

(85% were polymorhs) and platelets were 235,000/mm 3 . 

Urine culture and sensitivity were sent. Empirical 

antibiotic ciprofloxacin 500 mg BD was started and this 

choice was confirmed by the result of urine culture and 

sensitivity test. IV albumin 20 g twice daily was started 

with intensive insulin regimen. 

The patient became distressed after six days of 

admission with a temperature of 38.1 ºC and hypoxia. 

X-Ray chest showed bilateral bronchopneumonia. 

Patient was shifted to the ICU and ventilated as her 

respiratory rate had reached 35/min. Antibiotics 

were modified to Tazocin 4.5 g/6 hourly and IV 

clarithromycin 500 mg BD. Tracheal aspirate was 

sent for culture and sensitivity test along with blood 

culture and sensitivity. The patient did not respond 

well to antibiotics, and deteriorated within two days 

and died. Result of tracheal aspirate and blood culture 

showed Klebsiella pneumoniae. 

DISCUSSION 

CD is triggered by ingestion of wheat gluten 

and related other cereal proteins, particularly 

those in rye and barley. These molecules induce an 

inflammatory response in the small intestine, resulting 

in villous atrophy, crypt hyperplasia and lymphocytic 

infiltration [1] . CD is sometimes divided into clinical 

subtypes. The terms classic apply to cases which 

meet the classic features of CD, which include chronic 

diarrhea, abdominal distension and pain, weakness 

and sometimes malabsorption. In contrast in atypical 

asymptomatic form, no gastrointestinal manifestations 

are present, but features such as anemia, osteoporosis, 

short stature, infertility and neurological problems are 

common, and a case may be discovered on duodenal 

biopsy for any other reason or immunology screening. 

Nevertheless, the disease remains widely underrecognized 

[2] . 

Studies in the United States and Europe show the 

prevalence of the disease approaching 1% [3,4] . Based 

on small bowel biopsy diagnosis, the prevalence of 

CD in type 1 diabetes in children is 1:6 to 1:103 and in 

adults is 1:16 to 1:76 [5] . CD is most often present before 

the onset of diabetes [6] . The association between the 

development of both diseases may be explained by 

the inheritance of common major histocompatibility 

complex immunogenotypes that influence the 

presentation of auto antigens to CD4 + T-Cells [7] . 

In adults with CD, hypertransaminasemia is 

frequent and normalizes with gluten free diet. If not, 

liver biopsy should be done to rule out autoimmune 

hepatitis and primary billiary cirrhosis [8] . Isolated 

elevation of ALP (alkaline phosphatase) is less 

common and may reflect presence of secondary 

hyperparathyroidism (bone-specific form). 

Hypoalbuminemia and prolonged prothrombin time 

may indicate severe form of malabsorption [9] . 

The American Gastroenterological Association 

(AGA) Institute recommended that testing for CD 

should be considered in symptomatic patients who are 

at particular risk. These include those with unexplained 

iron deficiency anemia, premature osteoporosis, Down 

syndrome, unexplained hypertransaminasemia, 

autoimmune hepatitis and primary billiary cirrhosis. 

The diagnostic tests for CD widely used now 

include IgA antiendomysial antibodies and IgA tTGA 

(sensitivity - 90% and specificity - 95%), but distal 

duodenal biopsy remains the gold standard diagnostic 

method (showing total or partial villous atrophy, 

crypt lengthening and increased lymphocytes in 

lamina propria and intraepithelial region). Biopsy is 

indicated even if serology is negative and CD is still

337 

Celiac Disease as Uncommon Cause of Death in Type 1 Diabetes Mellitus: A Case Study 


highly suspected. Compliance with GFD is likely to 

be protective against development of non-Hodgkin 

lymphoma and dermatitis herpitiformis in CD. It 

can improve nutritional status, body mass index, 

increase insulin requirement in type 1 diabetes, but no 

convincing change in diabetes control [10] . 

CD patients have overall, two-fold increased 

mortality risk compared with the general population. 

CD elevates the mortality risks of a wide array of 

diseases in CD patients, including non-Hodgkin 

lymphoma (SMR 11.4), small intestinal cancer (SMR 

m 17.3), autoimmune diseases as rheumatoid arthritis 

(SMR 7.3) and diffuse disease of connective tissue (SMR 

17.0), allergic disorders such as bronchial asthma (SMR 

2.8), inflammatory bowel disease including ulcerative 

colitis and Crohn’s disease (SMR 70.9), diabetes 

mellitus (SMR 3.0), disorders of immune-deficiency 

(SMR 20.9), tuberculosis (SMR 5.9), pneumonia (SMR 

2.9) and nephritis (SMR 5.4) [11] . 

CONCLUSION 

It is important to have a high index of suspicion 

for CD in adult patients with type 1 diabetes mellitus, 

in view of the common association between these two 

diseases and the elevated mortality risks for a wide 

array of diseases in CD patients. 

REFERENCES 

1. Green PH, Jabri B. Coeliac disease. Lancet 2003; 362:383- 

391. 

2. Armin A, Peter HR. Narrative review: Celiac Disease: 

Understanding a complex autoimmune disorder. Ann 

Intern Med 2005; 142: 289-298. 

3. Fasano A, Berti I, Gerarduzzi T, et al. Prevalence of celiac 

disease in at-risk and not-at-risk groups in the United 

States: a large multicenter study. Arch Intern Med 2003; 

163:286-292 

4. Tommasini A, Not T, Kiren V, et al. Mass screening 

for coeliac disease using antihuman transglutaminase 

antibody assay. Arch Dis Child 2004; 89:512-515 

5. Holmes GK. Coeliac disease and type 1 diabetes mellitus 

- the case for screening. Diabet Med 2001; 18:169-177. 

6. Noel P, Françoise B, Charlotte B, et al. The temporal 

relationship between the onset of type 1 diabetes and 

celiac disease: A study based on immunoglobulin A 

antitransglutaminase screening. Pediatrics 2004; 113: 

e418-e422. 

7. Frank W, Aonghus O, Fidelma D. Gluten and glucose 

management in type 1 diabetes. B J Diab Vasc Dis 2008; 

8:67-71. 

8. Maria T, Mirella F, Maurizio Q, Nicoletta I, Paolo B, 

Dario C. Prevalence of hypertransaminasemia in adult 

celiac patients and effect of gluten-free diet. Hepatology 

1995; 22:833-836. 

9. Alberto Rub, Joseph A. The liver in celiac disease. 

Hepatology 2007; 46:1650-1658. 

10. Rostom A, Murray JA, Kagnoff MF. American 

Gastroenterological Association (AGA) Institute 

technical review on the diagnosis and management of 

celiac disease. Gastroenterology 2006; 131:1981-2002. 

11. Peters U, Askling J, Gridley G, Ekbom A, Linet M. 

Causes of death in patients with celiac disease in a 

population-based Swedish cohort. Arch Intern Med 

2003; 163:1566-1572.



Case Report 

Squamous Cell Carcinoma of the Penis: 

Magnetic Resonance Imaging Findings 

Ibrahim Hamed, Hasan Almutairi, Muneera Al-Adwani 

Department of Clinical Radiology, Al-Jahra Hospital, Kuwait 


ABSTRACT 

Most primary penile malignancies are squamous cell 

carcinoma (SCC) and occur most often during the 6 th and 7 th 

decades of life. Uncircumcised men are more often affected, 

probably because of the chronic irritative effect of smegma. An 

association between human papilloma viruses 16 and 18 and 

SCC of the penis has also been reported. We describe a case of 

a 43-year-old uncircumcised Asian male patient who presented 

with an ulcerating penile mass. MRI images were helpful in 

making a preoperative diagnosis of penile cancer. MR imaging 

can play an important role in the evaluation of a penile mass. 

KEY WORDS: penile mass, penile SCC, MRI of penis 

INTRODUCTION 

Squamous cell carcinoma (SCC) of the penis usually 

begins on the glans as a focal epithelial thickening 

with or without ulceration [1] . The lesions are generally 

not painful, and affected patients often delay seeking 

medical attention [2] . After penectomy with 2 cm 

margins, patients with tumors that have not invaded 

the corpora cavernosa have a greater than 95% 3-year 

survival rate [3] . Survival decreases markedly with 

cavernosal invasion or with spread to regional lymph 

nodes [4] . Although not often performed in the acute 

setting, MR imaging can play an important role in the 

evaluation of penile mass [5] . Ultrasound (US) can help 

detect solid penile mass in the majority of patients [6] . 

CASE HISTORY 

An Indian uncircumcised male patient aged 43 

years presented with a painless penile mass of sixmonth 

duration. The clinical examination revealed 

a solid mass lesion underneath the foreskin and the 

patient was referred to our department for an MRI. MRI 

revealed a solid isointense to low signal intensity mass 

lesion both on T1-wieghted (Fig. 1) and T2-wieghted 

(Fig. 2) images, mainly located at the left lateral aspect 

of the glans of the penis extending to its dorsal aspect 

with a definite invasion of the hypointense adjacent 

tunica albuginea (Fig. 3). However, the urethra was not 

compromised (Fig. 3). After Gd-chelate agent injection, 

homogenous enhancement pattern was elicited with 

multiple signal void foci that were confirmed to be 

hypervascular on color Doppler study (Fig. 3 and 

Fig. 4). The clinical examination revealed a solid mass 

lesion underneath the foreskin (Fig. 5) with concealed 

external meatus and with discharge from cutaneous 

fistula from the foreskin. 

Diagnosis and Treatment: Circumcision with 

excisional biopsy was done and histopathological 

examination confirmed penile SCC. So the patient 

underwent partial penectomy with 2 cm safety margin. 

The patient was planned for bilateral ilio-inguinal 

lymph node dissection. 

DISCUSSION 

Carcinoma of the urethra and penis is extremely 

rare, accounting for less than 1% of genitourinary 

cancers in males [7] . Histological examination reveals 

SCC in more than 95% of cases of penile carcinoma [8] . 

At MR imaging, SCC is usually hypointense relative 

to the corpora on both T1- (Fig. 1) and T2- (Fig. 2) 

weighted images. At contrast-enhanced imaging, these 

lesions do increase in signal intensity but less so than 

the normal corporal bodies. Although neither MR nor 

other imaging is generally needed for diagnosis (the 

tumor is usually visible at physical examination), MR 

imaging may be performed for staging purposes. In the 

commonly used Jackson staging system, stage I lesions 

are confined to the glans or prepuce, stage II lesions 


Ibrahim Mohamed Ali Hamed, MD, Department of Clinical Radiology, Al-Jahra Hospital (MoH),Jahra Central, PO Box 1807, Jahra 01020, Kuwait. 

Fax: 24577198, 97341802 (M), E-mail: imah_77@hotmail.com, mun.adw@windowslive.com

339 

Squamous Cell Carcinoma of the Penis: Magnetic Resonance Imaging Findings 


Fig. 1: Coronal T1WI: Hypointense mass is seen relative to corpora 

Fig. 2: Axial T2WI : Hyperintense pattern of the mass, compared to 

the corpora 

Fig. 3: Post-contrast axial WI: Homogenously enhanced mass 

Fig. 4: Post-contrast coronal T1WI: Multiple signal void foci represent 

hypervascularity 

involve the penile shaft (Fig.3, and 4 post-contrast 

images), stage III extend to inguinal nodes, and stage 

IV involve deep pelvic nodes or distant metastases [9] . 

Both computed tomography (CT) and MR imaging 

depict pelvic lymphadenopathy, but MR imaging is 

superior for evaluation of the primary lesion [10] . 

Fig. 5: Exploration of the mass before operation 

CONCLUSION 

Regardless of the organ of origin, MRI aids in 

the delineation of the extent of tumor dissemination, 

enabling detection of invasion into the corpora 

cavernosa or tunica albuginea. As mentioned previously, 

surgical treatment of carcinoma of the penis consists of 

either partial or total penectomy. Follow-up physical 

examination to look for local recurrence is limited in 

allowing the detection of pelvic lymphadenopathy and



deep recurrence. Therefore, cross-sectional imaging is 

often performed. In addition to identification of sites 

of tumor recurrence, MR imaging can be helpful in 

the identification of normal post-surgical findings. 

Complications of surgery of the lower urinary tract can 

also be shown clearly with MR imaging. 

REFERENCES 

1. Pretorius ES, Siegelman ES, Ramchandani P, Banner 

MP. MR imaging of the penis. Radiographics 2001; 

S283-S299. 

2. Mardi K, Sharma J, Gupta S. Gastric collision tumor: 

A rare case of an adenocarcinoma and carcinoid 

tumor. The Internet Journal of Gastroenterology 2009 

Volume 7 Number 2. DOI: 10.5580/1e0b Available at: 

http://www.ispub.com/journal/the-internet-journalof-gastroenterology/volume-7-number-2/gastriccollision-tumor-a-rare-case-of-an-adenocarcinomaand-carcinoid-tumor.html 

3. Burgers JK, Badalament RA, Drago JR. Penile cancer. 

Urol Clin North Am 1992; 19:247-256. 

4. Landis SH, Murray T, Bolden S, Wingo PA. Cancer 

statistics. Cancer J Clin 1999; 49:8-31. 

5. Oto A, Meyer J. MR appearance of penile epithelioid 

sarcoma. Am J Roentgenol 1999; 172:555-556. 

6. Sirikci A, Bayram M, Demirci M, Bakir K, Sarica K. 

Penile epithelioid sarcoma: MR imaging findings. Eur 

Radiol 1999; 9:1593-1595. 

7. Hricak H, Marotti M, Gilbert TJ. Normal penile 

anatomy and abnormal penile conditions: evaluation 

with magnetic resonance imaging. Radiology 1988; 

169:683-690. 

8. John H, Kacl GM, Lehmann K, Debatin JF, Hauri D. 

Clinical value of pelvic and penile magnetic resonance 

angiography in preoperative evaluation of penile 

revascularization. Int J Impotence Res 1999; 11:83-86. 

9. Sica GT, Teeger S. MR imaging of scrotal, testicular, and 

penile diseases. MRI Clin North Am 1996; 4:545-563. 

10. Kaneko K, De Mouy E H, Lee BE. Sequential contrastenhanced 

MR imaging of the penis. Radiology 1994; 

191:75-77.

341 



Case Report 

Unstable Carpometacarpal Dislocation of Ulnar 

Four Fingers – An Easily Overlooked Injury 

Kumar Ashok, Singh Pritish, Badole Chandrashekhar 

Department of Orthopedics and Traumatology, Mahatma Gandhi Institute of Medical Sciences, Sewagram, Maharashtra, India 


ABSTRACT 

Multiple carpometacarpal (CMC) joint dislocations are 

rare. These clinical entities require significant amount of 

force to produce dislocation at this inherently stable joint 

level. We present a case of unstable dorsal dislocation 

of ulnar four carpometacarpal joints without associated 

fractures which was fixed with multiple K-wires with good 

functional outcome. Although carpometacarpal dislocations 

are uncommon entities, the case is reported here not just by 

virtue of its rarity but also because of a tendency for such 

injuries to be overlooked by surgeons with resultant delay in 

diagnosis and treatment. 

KEY-WORDS: internal fixation, k-wire 

INTRODUCTION 

Carpometacarpal (CMC) dislocations other than 

thumb are uncommon injuries accounting for less 

than 1% of hand injuries. It is rare for multiple CMC 

dislocations to occur without associated fractures [1,2] . 

Disability is significantly severe in untreated cases and 

initially neglected cases. The dislocation of multiple 

joints at CMC junction is not an anticipated diagnosis 

in cases of polytrauma with hand swelling. The injury 

is often missed or overlooked owing to many factors, 

both on the surgeon’s side and patient’s side [3] . 

CASE HISTORY 

A 26-year-old male presented to the emergency 

department after riding his motorbike into a roadside 

vehicle with gross swelling on the dorsum of the 

right hand and inability to move the wrist. The 

wrist movements were grossly restricted but finger 

movements were elicitable with pain. Distal hand 

perfusion was adequate. 

After adequate first aid measures, an X-ray of 

the hand in antero-posterior and oblique plane 

was ordered. Hand radiographs primarily revealed 

no bony injury as screened by emergency medical 

officer against awaited metacarpal fracture. A dorsal 

splint was applied taking cognizance of severe hand 

contusion. Screening of radiographs by consultants 

gave a clue to missed diagnosis of CMC dislocation. 

There was overlapping of joint surface of metacarpal 

bases over carpals. The lateral view hand radiograph 

promptly clarified diagnosis of CMC dislocation of 

ulnar four fingers. Lateral radiograph revealed a 

significant dorsal offset of metacarpal complex over 

carpals. There was no associated fracture of adjacent 

CMC entities (Fig. 1A, B) 

An unsuccessful closed reduction with slab 

application was attempted with linear traction along 

line of fingers. The reduction could only be maintained 

with multiple trans-CMC Kirschner wires (K-wires) 

(Fig. 1C). Postoperatively, wrist was splinted on dorsal 

side for six weeks; K-wires were removed at the end of 

six weeks. Reduction was satisfactorily sustained after 

slab removal as confirmed by check radiographs. Full 

range of motion of hand was regained with support 

of active hand-specific physiotherapy in the early 

convalescent period showing excellent functional 

result (Fig. 2A, B). 

DISCUSSION 

Less commonly encountered injury of CMC 

dislocation gains importance in emergency scenarios 

by virtue of it getting overlooked and a resultant 

delayed diagnosis. The delayed diagnosis and 

consequent delayed treatment of this joint dislocation 

has implications in functional outcome of wrist [4] . 

Many factors play a role in such uninvited 

overlook. Occurrence in settings of polytrauma, 

primary management by junior ranks, customary less 


Dr. Ashok Kumar, MS, Associate Professor, Department of Orthopedics and Traumatology, Mahatma Gandhi Institute of Medical sciences, Sewagram 

442102, Wardha, Maharashtra, India. Tel: 0919850394016, E-mail ID: drashokbagotia@gmail.com



Fig. 1: (A) Initial X-rays showing dorsal dislocation of ulnar four metacarpal bases with overlapping of joint surfaces; (B) Lateral X-ray 

showing dorsal offset of metacarpal complex; (C) postoperative radiograph showing satisfactory reduction and stabilization of joint with 

multiple Kirschner wires 

Fig. 2: (A) Radiograph at four weeks post injury after removal of K-wire showing satisfactory healing and congruent reduction of joint 

surfaces; (B) Post-rehabilitation photographs showing gradual improvement in hand function from four weeks to eight weeks 

revealing antero-posterior and oblique radiographs of 

hand, gross swelling of hand are incriminating factors. 

Literature also suggests repeated mistakes with this 

diagnosis even by experts [3] . 

Multiple CMC dislocations are often a high energy 

trauma often occurring in motorcyclists and boxers. 

Deduced pathway of injury appears to be forceful 

impact on metacarpal bases with a closed fist [5] . The 

patient will often have a diffuse swelling of dorsum of 

hand and distal forearm. It may be fluctuant depicting 

a hematoma collection. The characteristic hump of 

dislocation at root of hand is often masked by swelling 

of hand and forearm. 

Routinely ordered X-rays in antero-posterior 

and oblique plane suggest the diagnosis. Lateral 

projection radiograph will confirm the multiple CMC 

dislocations in suspicious cases [6] . Often dislocation 

is dorsal. There can be associated fracture of adjacent 

carpal or metacarpal bones. The clues for such an 

obscure diagnosis are loss of parallelism between joint 

spaces at base of metacarpals and carpals. There will 

be an overlap of joint surfaces of base of metacarpals 

over carpus. There can be appreciable offset of fifth 

metacarpal base as in our case [3,7] . A lateral radiograph 

will affirm the misalignments of metacarpals over 

carpus.

343 

Unstable Carpometacarpal Dislocation of Ulnar Four Fingers – An Easily Overlooked Injury 


Dislocation at CMC level essentially needs emergent 

reduction as soon as it is diagnosed. Failure to do so 

may result in impaired functional ability of hand, 

impaired grip, loss of transverse and longitudinal 

arches of hand and stiffness of hand. Danger of ulnar 

nerve injury in proximity of 5 th CMC joint and reflex 

sympathetic dystrophy will always be there [3,8] . 

Closed reduction is successful in fresh dislocations 

less than 10 days old. It can be maintained in plaster 

cast in majority cases. Intraoperatively ascertained 

unstable dislocations can be supplemented with trans- 

CMC K-wires along with external immobilisation. Late 

presentations and irreducible dislocations will require 

open relocation [1,7,9] . Removal of external splint and 

K - wires can be done as early as six weeks. An early 

physiotherapy will hasten rehabilitation of hand. Good 

functional results can be expected in properly treated 

cases with anatomical reduction. 

CONCLUSION 

Diagnosis of CMC dislocation requires a high 

index of suspicion, careful examination and good 

radiography. Otherwise, the outcome will be inferior. 

The treatment will require a relocation of joint 

structures on emergency basis and its maintenance to 

ensure a favourable outcome. 

REFERENCES 

1. Hsu JD, Curtis RM. Carpometacarpal dislocations on 

the ulnar side of the hand. J Bone Joint Surg Am 1970; 

52:927-930. 

2. Bergfield TG, Dupuy TE, Aulicino PL. Fracture 

dislocations of all five carpometacarpal joints – a case 

report. J Hand Surg 1985; 10:76-78. 

3. Henderson JJ, Arafa MA. Carpometacarpal dislocation: 

An easily missed diagnosis. J Bone Joint Surg Br 1987; 

69:212-214. 

4. Imbriglia JE. Chronic dorsal carpometacarpal 

dislocation of the index, middle, ring, and little fingers: 

a case report. J Hand Surg 1979; 4:343-345. 

5. Kneife F. Simultaneous dislocations of the five 

carpometacarpal joints. Injury 2002; 33:846-848. 

6. Parkinson RW, Paton RW. Carpometacarpal dislocation: 

an aid to diagnosis. Injury 1992; 23:187-188. 

7. Pankaj A, Malhotra R, Bhan S. Isolated dislocation of 

the four ulnar carpometacarpal joints. Arch Orthop 

Trauma Surg 2005; 125:541-544. 

8. Lawlis JF, Gunther SF. Carpometacarpal dislocations. 

Long-term follow-up. J Bone Joint Surg Am 1991; 73:52- 

59. 

9. Kumar R, Malhotra R. Divergent fracture dislocation of 

the second carpometacarpal joint and the three ulnar 

carpometacarpal joints. J Hand Surg 2001; 26:123-129.


KUWAIT MEDICAL JOURNAL 344 

Case Report 

Prostatic Adenocarcinoma and Chronic 

Lymphocytic Leukemia: A Case Report 

Abdul-Razzaq A Wraikat 1 , Tariq N Aladily 2 

1 

Department of Hematopathology, Jordan University Hospital, Amman, Jordan 

2 

Department of Pathology, Jordan University Hospital, Amman, Jordan 

Kuwait Medical Journal 2012; 44 (4): 344 - 346 

ABSTRACT 

We report a rare case of a collision tumor. Our patient was 

found to have prostatic adenocarcinoma colliding with 

chronic lymphocytic leukemia, with no previous risk factors 

or even a clinical suspicion. We review the literature for 

similar cases and make an attempt to address the possible 

shared risk factors. 

KEYWORDS: collision tumors, multiple primaries, 

INTRODUCTION 

Synchronous involvement of the same tissue by two 

different tumors is rare, but has been well-reported [1] . 

Many examples of collision tumors having either prostatic 

adenocarcinoma or chronic lymphocytic leukemia were 

described, but only very rarely showed both neoplasms 

colliding together. Being a curious phenomenon which 

causes confusion in the diagnosis and treatment for 

physicians, with an ominous effect on the patient, we 

report this case in order to look for possible common risk 

factors and a proposed way of treatment. 

CASE REPORT 

A 76-year-old man, presented to the Jordan 

University Hospital in December, 2008 complaining of 

fatigue and weight loss of two months duration. He was 

a known case of diabetes mellitus. Physical examination 

demonstrated hepatosplenomegaly, but no enlarged 

lymph nodes. No urological findings were evident in 

history or physical examination. The initial workup 

showed abnormal complete blood count numbers. 

Hemoglobin concentration was 8.5 g/dl and the packed 

cell volume (PCV) was 25%. The white blood count 

was 22,000, out of which 77% were lymphocytes, while 

neutrophils formed 21% of blood cells. Platelet count was 

normal. The peripheral blood film showed microcytic 

hypochromic anemia, abnormal lymphocytes and 

normal platelets. Kidney and liver function tests were 

normal, with the exception of mild hypoproteinemia. 

Guaiac stool hemoccult test was negative. Urinalysis 

was normal. 

The peripheral blood film showed diffuse 

lymphocytosis. The lymphocytes were small and 

mature with numerous smudge cells and minimal 

atypia. Astonishingly, a bone marrow trephine biopsy 

demonstrated the same neoplastic lymphocytes 

intermingling with aggregates of large epithelioid cells 

(Fig. 1). Immunohistochemical study revealed the latter to 

be of prostatic origin (Fig. 2). Flow cytometry confirmed 

the diagnosis of chronic lymphocytic leukemia (CLL) 

(Fig. 3). 

The patient was retrospectively investigated for 

prostatic carcinoma. Serum total prostate specific antigen 

(PSA) was highly elevated (100), and pelvic magnetic 

resonance image (MRI) scan detected a prostatic mass 

and liver metastasis. 

DISCUSSION 

A collision tumor is defined as the co-existence of 

two adjacent but histologically different malignant 

neoplasms occurring in the same organ without 

histological admixture or an intermediate cell 

population zone [1] . It is termed collision tumor when 

the components are present in the originating organ 

and collision metastasis when they collide in a distant 

site discontinuous from the original organ. When 

both tumors fuse and intermingle to the extent that it 

is difficult to distinguish between them, the process 

then is called a composite tumor [1,2] . Another similar 

phenomenon is the hybrid tumor, which is composed 

of two different tumor entities, each of which conforms 

with an exactly defined tumor category and has 

an identical origin within the same topographical 

area [3] . This is different from multiphasic tumor 

which corresponds to one tumor entity with different 

morphological patterns. Discordant tumors are two 


Tariq Aladily, MD, Department of Pathology, Jordan University Hospital, Amman, Jordan. PO Box 142725, Amman, Jordan 11814. Tel: 

+962798837525, Fax: + 9626 5353388 E-mail: Tariq_nb@yahoo.com

345 

Prostatic Adenocarcinoma and Chronic Lymphocytic Leukemia: A Case Report 


Fig. 1: The bone marrow is diffusely replaced by two populations of 

cells. Aggregates of large epithelioid cells with clear cytoplasm and 

vesicular nuclei (arrow) are fused with sheets of well-differentiated, 

small, round lymphocytes of minimal atypia (star). 

Fig. 2: Immunohistochemical stains for leukocyte common antigen 

(LCA) and Prostate Specific Antigen (PSA) are positive in the 

colliding tumor cells. 

different types of tumors occurring far from each 

other [4] . Examples are illustrated in Table 1. 

Inherited cancer syndromes are examples of 

conditions where patients develop multiple different 

tumors and might have collision or composite 

phenomena. However, in sporadic cases, the tumors 

are unpredictable and might be causatively unrelated. 

Being an interesting phenomenon, with a confusing 

Fig. 3: Flow cytometry of peripheral blood. The gated lymphocytes 

are positive for CD19, CD23, CD5, CD79B and negative for FMC7. 

They show Lambda surface immunoglobulin restriction.



Table 1: The differences between collision tumor and other similar phenomena 

Phenomenon Example Explanation 

Collision tumor 

Collision metastasis 

Composite tumor 

Hybrid tumor 

Multiphasic tumor 

Endometrial carcinoma and adjacent endocervical 

carcinoma 

Axillary lymph node showing breast and ovarian 

carcinomas 

A lymph node containing classic Hodgkin’s lymphoma and 

T-cell lymphoma 

Concomitant basal cell adenoma and canalicular adenoma 

of the parotid 

Wilm’s tumor 

Two tumors with different cell origin arise 

proximal to each other 

The two tumors meet outside their primary 

organs 

Two different tumors fuse and intermingle 

between each other 

Two tumor entities share a similar cellular origin 

A single tumor entity with different morphologic 

patterns 

impact on the diagnosis and modality of treatment, 

dozens of cases of collision tumors have been reported. 

Besides, an attempt to discover a relationship between 

the originating tumors is usually made. 

Our case does not fall under any definition, as 

it includes one primary and one metastatic tumor. 

However, as there is no strict definition for this situation 

in the literature, we prefer to consider it as collision 

tumor, and to restrict “collision metastasis” to cases 

when both tumors collide outside their primaries [4] . 

Prostatic carcinoma occurring together with CLL was 

reported in the literature [5-8] , but with different clinical 

scenarios. None of the previously reported cases showed 

a collision metastasis between prostatic carcinoma and 

CLL. We are unaware of a similar reported case where 

collision metastasis was the first hint for the presence of 

two hidden neoplasms. 

It was demonstrated that patients with CLL are 

susceptible to develop other primary malignancies. In 

the large study carried out by Hisada et al, 2% of patients 

with CLL developed prostate carcinoma, with a relative 

risk of 1.01 [9] . The study did not specify the relationship 

between the two neoplasms or the common risk factors 

between them. However, the relative increased incidence 

of both neoplasms in older ages, with the relative 

indolent course of CLL, may suggest this occurrence. 

The immune derangement status, believed to occur in 

CLL [7,9] would predispose to a second malignancy, though 

this relation is not well proved in prostatic carcinoma. A 

recent finding showed that deletion at 13q14 occurs in 

60% of prostatic carcinoma and more than 50% of CLL, 

suggesting a shared pathway at the molecular level [10] . 

Our patient received hormonal therapy for prostate 

carcinoma. He was unfit for chemotherapy for CLL. 

Unfortunately, the patient had tumor progression and 

died seven months later from extensive metastasis. 

CONCLUSION 

We conclude that a collision tumor of both CLL and 

prostate carcinoma exists, although rare. Physicians 

should be aware of the possible second malignancy in 

patients with CLL, and should not stop at peripheral 

blood smear findings alone. 


Conflict of interest: none 

REFERENCES 

1. Brahmania M, Kanthan CS, Kanthan R. Collision tumor 

of the colonic adenocarcinoma and ovarian granulosa cell 

tumor. World J Surg Oncol 2007; 5:118. 

2. Mardi K, Sharma J, Gupta S. Gastric collision tumor: A 

rare case of an adenocarcinoma and carcinoid tumor. 

The Internet Journal of Gastroenterology 2009 Volume 

7 Number 2. DOI: 10.5580/1e0b Available at: http:// 

www.ispub.com/journal/the-internet-journal-ofgastroenterology/volume-7-number-2/gastric-collisiontumor-a-rare-case-of-an-adenocarcinoma-and-carcinoidtumor.html 

3. Seifert G, Donath K. Hybrid tumours of salivary glands. 

Definition and classification of five rare cases. Eur J 

Cancer B Oral Oncol 1996; 32:251-259. 

4. Cossman J, Schnitzer B, Deegan MJ. Coexistence of two 

lymphomas with distinctive histologic, ultrastructural, and 

immunologic features. Am J Clin Pathol 1978; 70:409-415. 

5. Molero T, Lemes A, de la lglesia S, Gomez Casares MT, del 

Mar Perera M, Jimenez S. Acute promyelocytic leukemia 

developing after radiotherapy for prostate cancer in a 

patient with chronic lymphocytic leukemia. Cancer Genet 

Cytogenet 2001; 131:141-143. 

6. Fehr M, Templeton A, Cogliatti S, et al. Primary 

manifestation of small lymphocytic lymphoma in the 

prostate. Onkologie 2009; 32:586-588. 

7. Nestler U, Deinsberger W, Grumbrecht S, Kuchelmeister 

K, Böker DK. CLL cells in a brain metastasis of bronchial 

adenocarcinoma in a patient with three different 

neoplasms: case report. Zentralbl Neurochir 2001; 62:57- 

61. 

8. Ballario R, Beltrami P, Cavalleri S, Ruggera L, Zorzi 

MG, Artibani W. An unusual pathological finding of 

chronic lymphocytic leukemia and adenocarcinoma of 

the prostate after transurethral resection for complete 

urinary retention: case report. BMC Cancer 2004; 4:95. 

9. Hisada M, Biggar RJ, Greene MH, Fraumeni JF Jr, Travis 

LB. Solid tumors after chronic lymphocytic leukemia. 

Blood 2001; 98:1979-1981. 

10. Calin GA, Dumitru CD, Shimizu M, et al. Frequent 

deletions and down-regulation of micro- RNA genes 

miR15 and miR16 at 13q14 in chronic lymphocytic 

leukemia. Proc Natl Acad Sci USA 2002; 99:15524-15529, 

Epub 2002 Nov 14.

347 



Letter to the Editor 

Individual Cyclooxygenase-2 Inhibitors on the Risk of 

Peptic Ulcer Disease: A Population-Based Cohort in Taiwan 

Shih-Wei Lai 1,2 , Kuan-Fu Liao 3-5 , Hsueh-Chou Lai 6,7 , Chih-Hsin Muo 8,9 , Fung-Chang Sung 8,9 , Pei-Chun Chen 10 

1 

School of Medicine, 3 Graduate Institute of Integrated Medicine, 6 School of Chinese Medicine, and 

8 

Department of Public Health, China Medical University, Taichung, Taiwan 

2 

Department of Family Medicine, 7 Department of Internal Medicine, 9 Management Office for Health Data, 

China Medical University Hospital, Taichung, Taiwan 

4 

Department of Internal Medicine, Taichung Tzu Chi General Hospital, Taichung, Taiwan 

5 

Department of Health Care Administration, Central Taiwan University of Science and Technology, Taichung, Taiwan 

10 

Graduate Institute of Epidemiology and Preventive Medicine, College of Public Health, National Taiwan University , 

Taipei, Taiwan 


To date, little evidence is available about the 

association between peptic ulcer disease and 

commercially available cyclooxygenase-2 inhibitors 

(COX-2 inhibitors) in Taiwan. Therefore, we conducted 

this population-based cohort study from the National 

Health Insurance (NHI) program in Taiwan to directly 

compare the effects of individual COX-2 inhibitors on 

the risk of peptic ulcer disease. The details of insurance 

program can be found in previous studies [1-4] . This 

study consisted of 1388 patients aged 20 years or older 

who had ever used COX-2 inhibitors (770 men and 

618 women, mean age 51.4 years, standard deviation 

18.5 years), and 5403 subjects who never used COX- 

2 inhibitors (3080 men and 2323 women, mean age 

50.6 years, standard deviation 18.2 years), frequency 

matched with sex, age, and index year for comparison, 

from 2000 to 2006. The incidence of peptic ulcer disease 

(based on International Classification of Diseases 

9th Revision - Clinical Modification, ICD-9 531, 532, 

533, and 534) at the end of 2009 was determined. An 

index date for patients with peptic ulcer disease was 

defined as their date of diagnosis. Subjects diagnosed 

with peptic ulcer disease before the index date were 

excluded from the study. The subjects, who had ever 

used combination of COX-2 inhibitors, or ever used 

aspirin, or other non-steroidal anti-inflammatory 

drugs (NSAIDs), were excluded from this study. Other 

co-morbidities before the index date were defined as 

follows: Helicobacter pylori infection (ICD-9 041.86), 

tobacco use (ICD-9 305.1), and alcoholism (ICD-9 303, 

305.00, 305.01, 305.02, 305.03 and V11.3, and A-code 

A215). The potentially related medications included 

were as follows: proton pump inhibitor, histamine-2 

receptor antagonist, clopidogrel, ticlopidine, systemic 

corticosteroid, warfarin, and heparin. 

We found that the incidence of peptic ulcer disease 

was 3.26-fold higher in the COX-2 inhibitors group, 

compared with the non-COX-2 inhibitors group 

(19.28 per 1000 person-years Vs 5.91 per 1000 personyears, 

95% confidence interval - CI = 2.63 - 4.04). After 

controlling for variables that were significantly related 

to COX-2 inhibitors found in the Chi-square test, the 

multivariable Cox proportional hazard regression 

showed use of COX-2 inhibitors was substantially 

associated with increased risk of peptic ulcer disease 

(hazard ratio - HR = 3.23, 95% CI = 2.59 - 4.04). In 

sub-analysis, individual COX-2 inhibitors, including 

celecoxib (HR = 3.29, 95%CI = 2.00 - 5.39), meloxicam 

(HR = 3.19, 95%CI = 2.33 - 4.36), nabumetone (HR = 

3.19, 95% CI = 2.39 - 4.25), and nimesulide (HR = 2.21, 

95% CI = 1.08-4.52), would substantially increase the 

risk of peptic ulcer disease, respectively. 

Previous studies have reported that COX-2 

inhibitors can reduce the risk of upper gastrointestinal 

ulcers, compared with non-selective NSAIDs [5, 6] . In 

Rostom et al’s systematic review [7] , COX-2 inhibitors 

correlate with lower risk of upper gastrointestinal 

ulcers (relative risk, 0.26 - 0.39), compared with 

non-selective NSAIDs. An observational study by 

Hsiang et al in Taiwan [8] , the annual incidence of 


Pei-Chun Chen, Ph.D., MSPH, Projected-appointed Assistant Professor, Graduate of Epidemiology and Preventive Medicine, National Taiwan University 

College of Public Health, No.17, Xu-Zhou Road, Taipei, 10020, Taiwan. Tel: 886-2-33668021, E-mail: eliz0118@gmail.com



upper gastrointestinal ulcers in patients using COX-2 

inhibitors was 4.6%. In this present study, the overall 

risk of peptic ulcer disease was 3.23-fold higher in 

patients using COX-2 inhibitors, compared with nonuse 

of COX-2 inhibitors. In sub-analysis, patients who 

used celecoxib, meloxicam, or nabumetone for less 

than three months were at higher risk of peptic ulcer 

disease. As reported in the literature, celecoxib is more 

selective and safe than the other non-specific NSAIDs [5] . 

However, this present study showed that use of 

celecoxib had the highest risk of peptic ulcer disease. 

Because this is an observational study, we do not have 

a plausible explanation for this phenomenon. 

It is widely established that COX-2 inhibitors are 

only relatively rather than absolutely safe. These 

findings further alert clinicians about the risk of peptic 

ulcer disease when prescribing COX-2 inhibitors. 

Funding 

This study was supported in part by grants from 

Taiwan Department of Health, Clinical Trial and 

Research Center of Excellence (DOH101-TD-B-111- 

004), the Cancer Research Center of Excellence (DOH 

101-TD-C-111-005), and the National Science Council 

(NSC 100-2621-M-039-001), and China Medical 

University Hospital (1MS1). The funding agencies did 

not influence the study design, data collection and 

analysis, decision to publish, or preparation of the 

manuscript. 

ACKNOWLEDGEMENT 

The authors thank the National Health Research 

Institute in Taiwan for providing the insurance claims 

data. 

Authorship: The first two authors contributed equally 

to this study. 

Conflict of Interest : The authors disclose no conflicts 

of interest. 

REFERENCES 

1. Lai SW, Muo CH, Liao KF, Sung FC, Chen PC. Risk of 

acute pancreatitis in type 2 diabetes and risk reduction 

on anti-diabetic drugs: a population-based cohort study 

in Taiwan. Am J Gastroenterol 2011; 106:1697-1704. 

2. Lai SW, Chen PC, Liao KF, Muo CH, Lin CC, Sung FC. 

Risk of hepatocellular carcinoma in diabetic patients 

and risk reduction associated with anti-diabetic therapy: 

a population-based cohort study. Am J Gastroenterol 

2012; 107:46-52. 

3. Lai SW, Liao KF, Chen PC, Tsai PY, Hsieh DP, Chen CC. 

Antidiabetes drugs correlate with decreased risk of 

lung cancer: a population-based observation in Taiwan. 

Clin Lung Cancer 2012; 13:143-148. 

4. Liao KF, Lai SW, Li CI, Chen WC. Diabetes mellitus 

correlates with increased risk of pancreatic cancer: 

A population-based cohort study in Taiwan. J 

Gastroenterol Hepatol 2012; 27:709-713. 

5. Goldstein JL, Silverstein FE, Agrawal NM, et al. Reduced 

risk of upper gastrointestinal ulcer complications with 

celecoxib, a novel COX-2 inhibitor. Am J Gastroenterol 

2000;95:1681-1690. 

6. Hunt RH, Harper S, Watson DJ, et al. The gastrointestinal 

safety of the COX-2 selective inhibitor etoricoxib 

assessed by both endoscopy and analysis of upper 

gastrointestinal events. Am J Gastroenterol 2003; 

98:1725-1733. 

7. Rostom A, Muir K, Dube C, et al. Gastrointestinal 

safety of cyclooxygenase-2 inhibitors: a Cochrane 

Collaboration systematic review. Clin Gastroenterol 

Hepatol 2007; 5:818-828, 828 e811-815; quiz 768. 

8. Hsiang KW, Chen TS, Lin HY, et al. Incidence and 

possible risk factors for clinical upper gastrointestinal 

events in patients taking selective cyclooxygenase-2 

inhibitors: A prospective, observational, cohort study 

in Taiwan. Clin Ther 2010; 32:1294-1303.

349 



Selected Abstracts of Articles Published 

Elsewhere by Authors in Kuwait 

Kuwait Medical Journal 2012, 44 (4): 349 - 352 

Risk Factors for Multiple Sclerosis in Kuwait: 

A Population-Based Case-Control Study 

Hanan H Al-Afasy, Mohammed A Al-Obaidan, Yousef A Al-Ansari, Sarah A Al-Yatama, Mohammed S Al-Rukaibi, 

Nourah I Makki, Anita Suresh, Saeed Akhtar 

Department of Community Medicine and Behavioural Sciences, Faculty of Medicine, Kuwait University, Jabriya, 

Kuwait. E-mail: saeed.akhtar@hsc.edu.kw 

Neuroepidemiology 2013; 40:30-35 (DOI: 10.1159/000341240) 

Multiple sclerosis (MS) is a chronic and progressively disabling inflammatory autoimmune disorder of 

the central nervous system. MS has a multifactorial etiology and is triggered by environmental factors 

in individuals with complex genetic risk profiles. The epidemiology of MS changes with the spatial and 

temporal distribution of these genetic and nongenetic risk factors. This population-based matched casecontrol 

study aimed to determine the risk factors for MS in Kuwait. From May 2 to 9, 2010, we enrolled 101 

confirmed MS cases using the list frame maintained by the Multiple Sclerosis Association of Kuwait. For 

each case, two population controls individually matched for age (± 2 years), gender and nationality were 

selected. Data on demographic, socioeconomic variables, potential genetic and environmental factors were 

collected using a structured questionnaire. For a case, the questions were directed to the period that preceded 

the recognition of the disease, while for each of the two matched controls, a date of ‘pseudodiagnosis’ of 

MS was established, i.e. the date on which the control subject was of the same age as his/her matched case 

was at MS diagnosis and accordingly questions were directed to the preceding period. The multivariable 

conditional logistic regression model showed that compared with controls, the cases were significantly more 

likely to have a family history of MS [matched odds ratio (OR) adj 

= 6.7; 95% confidence interval (95% CI): 2.5 

- 18.0; p < 0.001] or have suffered from a head trauma in the past before MS diagnosis (matched OR adj 

= 2.6; 

95% CI: 1.2 - 5.5; p = 0.014). Furthermore, compared with controls, cases were significantly more likely to 

have stayed in Kuwait during the Iraqi invasion of 1990 (matched OR adj 

= 1.8; 95% CI: 1.1 - 3.5; p = 0.022). 

This study showed that a family history of MS, a history of head injury, and presence in Kuwait at the time of 

the Iraqi invasion of 1990 were associated with a significantly increased MS risk. Future retrospective cohort 

studies by using existing biological and epidemiological databases may provide a clue to MS etiology. 

Rhizoremediation of Oil-Contaminated Sites: A Perspective on the Gulf 

War Environmental Catastrophe on the State of Kuwait 

Yateem A 

Biotechnology Department, Kuwait Institute for Scientific Research, P.O. Box 24885, 13109, Safat, Kuwait. E-mail: 

ayateem@kisr.edu.kw 

Environ Sci Pollut Res Int. 2012 Sep 23. DOI 10.1007/s11356-012-1182-8 

The Gulf War brought about to the State of Kuwait some of the worst environmental pollution as a result of 

oil spill. Since 1995, research programs have been initiated to avoid further damage to the Kuwaiti desert 

and marine environment and to restore and rehabilitate the polluted land, water, and air ecosystems. 

During the following 15 years, different bioremediation methods both on laboratory and small field scales 

were tested and evaluated. The findings of these studies were implemented to establish a bio-park in 

which ornamental shrubs and trees were grown in bioremediated soil. This review will focus on Kuwait’s 

experience in rhizoremediation and its positive impacts on oil-contaminated sites.



Some Epidemiological Measures of Cancer in Kuwait: 

National Cancer Registry Data from 2000 -2009 

El-Basmy A, Al-Mohannadi S, Al-Awadi A 

Cancer Epidemiology and Registration Unit, Ministry of Heath, State of Kuwait. E-mail: elbasmy@yahoo.com 

Asian Pac J Cancer Prev 2012; 13:3113-3118 

Introduction: Cancer is the second cause of death in Kuwaiti people after cardiovascular diseases. 

This study is the first in the country to describe epidemiological measures related to cancer in this 

population. 

Methods: Data obtained from the Kuwait cancer registry included all Kuwaiti patients between years 

2000 - 2009. Analyses were conducted using age-specific rates, the age-standardization-direct method, 

95% confidence intervals (95% CI), cumulative risk by the age of 74 years, limited-duration prevalence, 

mortality and forecasting to year 2029. 

Results: It was noted that the commonest cancer sites were colorectal with an age standardized incidence 

rate (ASIR) of 16.1/100,000 in males and breast (49.4/100,000) in the female population. The trend of cancer 

incidence (1974 - 2009) showed no statistically significant change. First causes of death due to cancer were 

female breast 8(6.4 - 9.6)/100,000 and lung (males) 8.1/100,000 (6.6 - 10.0). The risk of developing cancer 

by the age of 74 was 13.4% (1/8) and 14.3% (1/7) in males and females respectively, and the risk of dying 

from cancer in the same age group was 1/17 and 1/23. By the end of 2009, prevalent cases represented 

0.52% of the Kuwaiti population. In the year 2029, the total number of cancer cases is expected to reach 

1200 cases compared to 889 cases in 2009. 

Conclusions and recommendations: The most common cancers in Kuwait (breast, colorectal and lung) 

are largely preventable. Prompt and effective interventional prevention programs that vigorously involve 

diet, anti-smoking and physical activity for both sexes are urgently required. 

Clinical Audits in a Postgraduate General Practice Training 

Program: An Evaluation of 8 Years’ Experience 

Al-Baho A, Serour M, Al-Weqayyn A, Alhilali M, Sadek AA 

Department of Health Promotion, Ministry of Health, Kuwait City, Al-Kuwait, Kuwait 

PLoS One 2012; 7(9):e43895. Epub 2012 Sep 10 

Background: Clinical audit can be of valuable assistance to any program which aims to improve the 

quality of health care and its delivery. Yet without a coherent strategy aimed at evaluating audits’ 

effectiveness, valuable opportunities will be overlooked. Clinical audit projects are required as a part of 

the formative assessment of trainees in the Family Medicine Residency Program (FMRP) in Kuwait. This 

study was undertaken to draw a picture of trainees’ understanding of the audit project with attention to 

the knowledge of audit theory and its educational significance and scrutinize the difficulties confronted 

during the experience. 

Methodology/Principal Findings: The materials included the records of 133 audits carried out by 

trainees and 165 post course questionnaires carried out between 2004 and 2011. They were reviewed and 

analyzed. The majority of audit projects were performed on diabetic (44.4%) and hypertensive (38.3%) 

care. Regarding audits done on diabetic care, they were carried out to assess doctors’ awareness about 

screening for smoking status (8.6%), microalbuminuria (19.3%), hemoglobin A1c (15.5%), retinopathy 

(10.3%), dyslipidemia (15.8%), peripheral neuropathy (8.8%), and other problems (21.7%). As for audits 

concerning hypertensive care, they were carried out to assess doctors’ awareness about screening for 

smoking status (38.0%), obesity (26.0%), dyslipidemia (12.0%), microalbuminuria (10.0%) and other 

problems (14.0%). More than half the participants (68.48%) who attended the audit course stated that they

351 

Selected Abstracts of Articles Published Elsewhere by Authors in Kuwait December 2012 

‘definitely agreed’ about understanding the meaning of clinical audit. Most of them (75.8%) ‘definitely 

agreed’ about realizing the importance of clinical audit in improving patients’ care. About half (49.7%) of 

them ‘agreed’ that they can distinguish between ‘criteria’ and ‘standards’. 

Conclusion: The eight years of experience were beneficial. Trainees showed a good understanding of the 

idea behind auditing the services provided. They demonstrated their ability to improve the care given in 

health centers in which these projects were undertaken. 

Hospitalization Patterns and Outcomes of 

Infants with Influenza A(H1N1) in Kuwait 

Husain EH, Alkhabaz A, Al-Qattan HY, Al-Shammari N, Owayed AF 

Faculty of Medicine, Kuwait University, Kuwait. E-mail: ehusain@hsc.edu.kw 

J Infect Dev Ctries 2012; 6:632-236. doi: 10.3855/jidc.2339 

Introduction: Infants represent an important risk group for influenza associated hospitalizations and 

mortality. This study evaluated the clinical presentations, hospitalization course and outcome of infants 

hospitalized with the pandemic influenza AH1N1 [Influenza A(H1N1)pdm09] in relation to their previous 

health status. 

Methodology: We conducted a retrospective chart review of hospitalized infants with laboratoryconfirmed 

Influenza A(H1N1)pdm09 infection in two hospitals in Kuwait. Demographic characteristics, 

pre-existing high-risk medical conditions, clinical presentations, complications and mortality were 

analyzed. Previously healthy infants’ data were compared with infants with pre-existing high-risk medical 

conditions for severity of the illness and outcome. 

Results: We identified 62 infants comprising 32% of all admissions with Influenza A(H1N1)pdm09. 

The median age ± SD was 7 ± 4 months. Nineteen (31%) had pre-existing high-risk medical conditions. 

Complications were documented in 53% of previously healthy infants compared to 47% in high-risk 

infants. Mean duration of hospitalization was 4.9 days in healthy infants and 6.7 for infants with highrisk 

medical conditions. Bacterial pneumonia complicated 7% of previously healthy infants compared to 

26% with high-risk conditions (P = 0.03). Four infants (6.5%) required admission to the intensive care unit 

(ICU), of whom three had high risk medical condition. 

Conclusion: The majority of hospitalized infants with Influenza A(H1N1)pdm09 were previously healthy. 

Prolonged hospitalization, ICU admission and mortality were more observed in infants with high-risk 

medical conditions. According to the latest Advisory Committee on Immunization Practices (ACIP) 

recommendations, annual influenza vaccination is recommended for any child six months of age and 

older, particularly those with risk factors. 

Pre-hypertension and Hypertension in College 

Students in Kuwait: A Neglected Issue 

Al-Majed HT, Sadek AA 

Department of Applied Medical Sciences, College of Health Sciences, Public Authority of Applied 

Education and Training, Kuwait. E-mail: almajed777@hotmail.com 

J Family Community Med 2012; 19:105-112 

Objective: To determine the proportion of pre-hypertension and hypertension in college students in 

Kuwait and their related risk factors.



Materials and Methods: A total of 803, randomly selected students aged 17 to 23 years (346 male, 457 

female) from different colleges in Kuwait, were included in the study between 2009 and 2010. Systolic and 

diastolic blood pressure measurements were taken by trained personnel. Pre-hypertension was defined as 

systolic pressure between 120 and 139 mm Hg or diastolic pressure between 80 and 89 mm Hg. Risk factor 

measurements that were determined, included smoking, body mass index (BMI), and family history of 

hypertension. Blood samples were collected and impaired glucose tolerance (IGT) and lipid profile levels 

were determined. 

Results: There were no hypotensive students. Normotensives constituted 53.5% (n = 430), pre-hypertensives 

formed 39.5% (n = 317), and hypertensive students comprised of 7% (n = 56). The overall proportions 

of hypertension and pre-hypertension were higher among male students (85.7 and 64.4%) than female 

students (14.3 and 35.6%), respectively. Hypertensive and pre-hypertensive students versus normotensive 

students had significantly higher levels of BMI-based obesity, smoking, glycated hemoglobin (HbA1c), 

and IGT. Also, hypertensive and pre-hypertensive, compared to normotensive students, had significantly 

higher proportions (21.4, 18.3, and 4.0%, respectively) of risky high-density lipoprotein (HDL) level 

(< 1 mg / dL), cholesterol (7.1, 3.8, and 1.4%, respectively), and triglycerides (TG) (17.9, 9.1, and 7.9%, 

respectively) where p was< 0.001, 0.016, and 0.051, respectively. 

Conclusion: Hypertensive and pre-hypertensive students showed elevated levels of lipids and BMIbased 

obesity more than normotensive students. TG, HDL, HbA1c, and cholesterol appeared to influence 

pre-hypertension. 

Closed Reduction and Percutaneous Cannulated Screws Fixation 

of Displaced Intra-Articular Calcaneus Fractures 

Foot Ankle Surg 2012; 18:164-179 

Abdelgaid SM 

AL-Razi Orthopedic Hospital, Kuwait. E-mail: Sherifmaa@yahoo.com 

Background: Displaced intra-articular calcaneal fractures remain a therapeutic challenge due to fracture 

complexity and different treatment options. One of the adverse effects of operative treatment is secondary 

damage to soft tissues. To avoid soft tissue complications, several less invasive procedures have been 

introduced. The most frequently used minimally invasive technique is closed reduction of fracture and 

percutaneous cannulated screws fixation. 

Method: This study evaluates the medium-term outcome of a new technique of percutaneous treatment in 

60 cases operated in Al-Razi orthopedic hospital in Kuwait in the period from 2007 to 2009. The described 

technique applies the principle of closed manipulation with new reduction method using a medial 

subperiosteal tunnel to manipulate the fragments. The technique involves new method of distribution of 

screws required to fix the fracture. 

Results: According to the American Orthopedic Foot and Ankle Society Hind foot Score, 38.3% of all cases 

(22 cases) had excellent results, 41% good (25 cases), fair results in 15% (9 cases), and poor results in 5% (4 

cases). The overall satisfactory results (excellent and good) were 79.3%. 

Conclusion: The technique is suitable for most types of intra-articular fractures especially in patients with 

compromised soft tissues in which open reduction and internal fixation is contraindicated.

353 



Forthcoming Conferences and Meetings 

Compiled and edited by 

Babichan K Chandy 


Internal Medicine for Primary Care: Gastro/Endo/ 

Neuro 

Dec 28 - 30, 2012 

United States / New York 

Contact: Medical Education Resources 

Tel: 303-798-9682; Fax: 303-798-5731 

Email: info@mer.org 

Primary Care Guide to Emergencies 

Dec 28 - 29, 2012 

United Kingdom / London 

Contact: Anthone Nancy, Medical-Credits by MedCW 

Tel: 011-32-1-643-8402 

Email: nancy.anthone@medical-credits.com 

Medical CBT: Ten-Minute Techniques For Real Doctors 

(Cognitive Behavior Therapy) 

Jan 3 - 5, 2013 

British Columbia / Whistler 

Contact: Greg Dubord, MD, CME Director, CBT 

Canada 

Tel: 877-466-8228 

Email: registrar@cbt.ca 

Breast Imaging From A - Z 

Jan 4 - 6, 2013 

United States / California / Pebble Beach 

Contact: Wendy Ryals, Office Manager, IICME 

Tel: 205-467-0290; Fax: 205-467-0195 

Email: wryals@iicme.net 

13 th Annual Multi-Specialty Conference on Medical 

Negligence & Risk Management 

Jan 5 - 8, 2013 

United States / Hawaii / Kauai 

Contact: Boston University School of Medicine, 

Continuing Medical Education 

Tel: 800-688-2475; Fax: 617-638-4905 

Primary Care - Topics in Mental Health 

Jan 5 - 12, 2013 

United States / Florida / Fort Lauderdale 

Contact: Continuing Education, Inc., Meeting Planner, 

Continuing Education, Inc. 

Tel: 800-422-0711 or 727-526-1571; Fax: 727-522-8304 

Email: contactus@continuingeducation.net 

Drug Development, Pharmacokinetics and Imaging 

Jan 7 - 11, 2013 

United Kingdom / Oxford 

Contact: Sarah Kelly, Department for Continuing 

Education, University of Oxford 

Tel: 011-44-18-6528-6955 

Email: expther@conted.ox.ac.uk 

Core Skills in Hand Surgery 

Jan 8 - 10, 2013 


Contact: Royal College of Surgeons of England 


Email: education@rcseng.ac.uk 

Intermediate Cardiac Surgery 

Jan 8 - 9, 2013 





8 th Medical Dermatology Conference 

Jan 10, 2013 


Contact: Chris Garrett, British Association of 

Dermatologists 

Email: conference@bad.org.uk 

Pathogenic Processes in Asthma And COPD 

Jan 10 - 15, 2013 

New Mexico / Santa Fe 

Contact: , Keystone Symposia on Molecular and 

Cellular Biology 

Tel: 800-253-0685 or 970-262-1230; Fax: 970-262-1525 

Email: info@keystonesymposia.org 

6 th Imaging & Physiology Summit / 7 th Chronic Total 

Occlusion Live 2013 

Jan 11 - 12, 2013 

South Korea / Seoul 

Contact: Secretariat, CardioVascular Research 

Foundation (CVRF) 

Fax: 011-82-2-475-6898 

Email: cvrf@summitMD.com



FRCS (Tr and Orth) Viva Course for Orthopaedic 

Surgeons 

Jan 11 - 12, 2013 

United Kingdom 




6 th International Hokkaido Trauma Conference 

Jan 13 - 18, 2013 

Japan / Rusutsu 

Tel: 011-61-3-9342-7540 

Fax: 011-61-3-9342-8623 

Advances in Tropical Medicine 

Jan 13 - 15, 2013 

Tanzania / Moshi 

Contact: Meeting Department, American Academy of 

Dermatology 

Fax: 847-330-1090 

Email: moshi@aad.org 

Hematopoiesis 

Jan 14 - 19, 2013 

United States / Colorado / Steamboat 

Contact: Keystone Symposia on Molecular and Cellular 

Biology 

Tel: 800-253-0685 or 970-262-1230 

Fax: 970-262-1525 


Pediatric Infectious Diseases: An Evidence-Based 

Approach 

Jan 14 - 18, 2013 

United States / Florida / Sarasota 

Contact: Trish or Tara, American Medical Seminars, 

Inc. 

Tel: 866-267-4263 or 941-388-1766; Fax: 941-365-7073 

Email: tkeeton@ams4cme.com 

Amputations 

Jan 15 - 16, 2013 





Intermediate Skills in ENT 

Jan 15 - 16, 2013 





2 nd ESCMID Conference on Invasive Fungal 

Infections 

Jan 16 - 18, 2013 

Italy / Rome 

Contact: Marco Moschin, Conference Secretariat, ICO 

Tel: 011-39-41-526-2530; Fax: 011-39-41-527-1129 

Advanced Cognitive Therapy Studies - An Introduction 

to Service Development 

Jan 16 - Mar 20, 2013 

United Kingdom / Oxford 

Contact: Department for Continuing Education, 

University of Oxford 


Email: octc@oxfordhealth.nhs.uk 

2013 ICJR 5 th Annual Winter Hip & Knee Course 

Jan 17 - 20, 2013 

United States / Colorado / Vail 

Contact: ICJR 

Tel: 760-942-7859; Fax: 760-942-1140 

Email: info@icjr.net 

2013 National Conference of Urological Society Of 

India 

Jan 17 - 20, 2013 

India / Pune 

Contact: Dr. Jaydeep Date, Organising Secretary, 

Lokmanya Hospital 

Email: usicon2013@gmail.com 

5 th Breast Gynecological International Cancer 

Conference 

Jan 17 - 18, 2013 

Egypt / Cairo 

Contact: Prof. Hesham El Ghazaly, Professor of Clinical 

Oncology, Head of Oncology Department [GOTHI], 

BGICS President, BGICS 

Tel: 011-20-100-130-0236 

Email: bgicc2010@gmail.com 

Controversies and Updates in Vascular Surgery 

(CACVS) 2013 

Jan 17 - 19, 2013 

France / Paris 

Contact: Michèle Caboste, divine [id] 

Fax: 011-33-4-9157-1961 

Email: mcaboste@divine-id.com 

Current Topics in Anesthesia 

Jan 17 - 20, 2013 

United States / Florida / Duck Key 

Contact: Northwest Anesthesia Seminars, Conference/ 

Meetings, Northwest Anesthesia Seminars, Inc. 

Tel: 800-222-6927; Fax: 509-547-1265 

Email: info@nwas.com

355 

Forthcoming Conferences and Meetings December 2012 

Advances in Thyroid Cancer Diagnosis and Therapy 

Jan 18 - 19, 2013 

United States / Arizona / Phoenix 

Contact: Beverly Hastings, American Association of 

Clinical Endocrinologists 

Tel: 904-404-4162 

Email: bhastings@aace.com 

Controversies & Updates in Venous Disease 

Jan 18 - 19, 2013 


Contact: Michèle Caboste, divine [ID] 

Fax: 011-33-4-9157-1961 

Email: mcaboste@divine-id.com 

Essential Obstetric Ultrasound Course 

Jan 18, 2013 


Contact: Royal College of Obstetricians and 

Gynaecologists 

Email: events@rcog.org.uk 

Cardiology, Endocrinology + Infectious Diseases: 

South East Asia CME Cruise 

Jan 20 - Feb 3, 2013 

Singapore / Singapore 

Contact: Sea Courses Cruises 

Tel: 888-647-7327; Fax: 888-547-7337 

Email: cruises@seacourses.com 

Malaria 

Jan 20 - 25, 2013 

United States / Louisiana / New Orleans 


Biology 

Tel: 800-253-0685 or 970-262-1230; Fax: 970-262-1525 


22 nd Annual Musculoskeletal MR Course 

Jan 21 - 25, 2013 

United States / Florida / Palm Beach 

Contact: Wendy Ryals, Office Manager, IICME 

Tel: 205-467-0290 ext. 1; Fax: 205-467-0195 

Email: wryals@iicme.net 

Delayed Effects of Disease & Treatment on Individuals 

Who Have Had Head & Neck Cancer 

Jan 21, 2013 


Contact: Royal Marsden 


Email: conferencecentre@rmh.nhs.uk 

MRI of the Joints 

Jan 21 - 25, 2013 

Slovenia / Ljubljana 

Contact: Jana Schiro 

Tel: 011-386-1-522-8530; Fax: 011-386-1-522-2497 

Email: emricourse.lj@gmail.com 

4 th Advanced Course on Knee Surgery 

Jan 22 - 27, 2013 

France / Val D’isere 

Contact: Advanced Course on Knee Surgery 

Tel: 011-33-4-7906-2123; Fax: 011-33-4-7906-1904 

Email: knee2012@valdisere-congres.com 

Operative Skills in Urology: Modules 1 And 2 

Jan 22 - 23, 2013 





Advanced Cardiovascular Intervention 

Jan 23 - 25, 2013 


Contact: Millbrook Medical Conferences 

Tel: 011-44-14-5555-2559; Fax: 011-44-14-5555-7377 

Email: ACI2013@millbrookconferences.co.uk 

Case Studies in Structural Heart Disease And 

Intervention 

Jan 24 - 27, 2013 

United States / Florida / Miami Beach 

Contact: Sheila Fick, Meeting Specialist, Mayo Clinic 

Tel: 507-284-0536; Fax: 507-266-7403 

Email: fick.sheila@mayo.edu 

20 th International Symposium on Pancreatic and 

Biliary Endoscopy 

Jan 25 - 27, 2013 

United States / California / Los Angeles 

Contact: Lalita Gupta, Continuing Medical Education, 

Cedars - Sinai Medical Center 

Tel: 310-423-5548; Fax: 310-423-8596 

Email: cme@cshs.org 

Cardio/Pulmonary Medicine for Primary Care 

Jan 25 - 27, 2013 

United States / Nevada / Las Vegas 


Tel: 303-798-9682; Fax: 303-798-5731 


Fetal/Neonatal Imaging 2013 

Jan 25 - 27, 2013 

United States / Florida / Orlando 

Contact: Society for Pediatric Radiology 

Tel: 703-648-0680 ext. 4691; Fax: 703-648-1863 

Email: sprmeetings@acr.org 

Advanced Suturing and Wound Repair 

Jan 26 - 27, 2013 

United States / Texas / San Antonio 

Contact: Julie Woods, Registration and Product 

Coordinator, National Procedures Institute 

Tel: 800-674-2631; Fax: 512-329-0442 

Email: julie@npinstitute.com



Melanoma 2013: 23 rd Annual Cutaneous Malignancy 

Update 

Jan 26 - 27, 2013 

United States / California / San Diego 

Contact: Scripps Health 

Tel: 858-652-5400; Fax: 858-652-5565 

Email: med.edu@scrippshealth.org 

Society of Thoracic Surgeons 49 th Annual Meeting 

Jan 26 - 30, 2013 


Contact: Society of Thoracic Surgeons 

Tel: 312-202-5800; Fax: 312-202-5801 

14 th International Colorectal Forum 

Jan 27 - 29, 2013 

Switzerland / Verbier 

Contact: M & S Event Services 

Tel: 011-41-27-771-8585; Fax: 011-41-27-771-8586 

Email: icf@ms-event.ch 

Cancer Immunology and Immunotherapy 

Jan 27 - Feb 1, 2013 

British Columbia / Vancouver 


Biology 

Tel: 800-253-0685 or 970-262-1230; Fax: 970-262-1525 


Arrhythmias and the Heart: A Cardiology Update 

Jan 28 - Feb 1, 2013 

Hawaii / Maui 

Contact: Mayo Clinic in Rochester 

Tel: 507-284-2509 

Fax: 507-284-0532 

Geriatrics: A Primary Care Approach to the Aging 

Population 

Jan 28 - Feb 1, 2013 

United States / Florida / Sarasota 

Contact: Trish or Tara, American Medical Seminars, 

Inc. 

Tel: 866-267-4263 or 941-388-1766; Fax: 941-365-7073 

Email: tkeeton@ams4cme.com 

32 nd Annual Advanced Nephrology: Nephrology for 

the Consultant 

Jan 31 - Feb, 2013 

United States / California / San Diego 

Contact: Bermellyn Imamura, Continuing Medical 

Education, UC San Diego 

Tel: 619-543-7602 

Email: ocme@ucsd.edu 

School Mental Health: Treating Students K - 12 

Feb 1 - 2, 2013 

United States / Massachusetts / Boston 

Contact: Continuing Medical Education, Harvard 

Medical School 

Tel: 617-384-8600; Fax: 617-384-8686 

Email: hms-cme@hms.harvard.edu 

3 rd World Congress of Regional Anaesthesia and Pain 

Therapy 

Feb 3 - 7, 2013 

Australia / Sydney 

Contact: Secretariat, SAPMEA 

Tel: 011-61-8-8274-6048; Fax: 011-61-8-8274-6000 

Email: wcrapt@sapmea.asn.au 

Mitochondria, Metabolism & Myocardial Function 

– Basic Advances to Translational Studies 

Feb 3 - 8, 2013 

United States / Colorado / Keystone 


Biology 

Tel: 800-253-0685 or 970-262-1230; Fax: 970-262-1525 


New Frontiers in Neurodegenerative Disease 

Research 

Feb 3 - 8, 2013 

New Mexico / Santa Fe 


Biology 

Tel: 800-253-0685 or 970-262-1230; Fax: 970-262-1525 


Head and Neck Imaging 

Feb 4 - 8, 2013 

Austria / Vienna 

Contact: Ines Fischer 

Fax: 011-43-1-40400-4898 

Email: ines.fischer@meduniwien.ac.at 

24 th International Congress on Anti-Cancer Treatment: 

ICACT 2012 

Feb 5 - 7, 2013 


Contact: Valérie Caillon, International Medical Events 

(IME) 

Tel: 011-33-1-4743-5084; Fax: 011-33-1-4743-2226 

Email: valerie.caillon@im-events.com 

2 nd World Congress of Cutaneous Lymphomas (Wccl) 

Feb 6 - 9, 2013 

Germany / Berlin 

Contact: Legal Organizer (PCO), MCI Deutschland 

GmbH 

Tel: 011-49-30-204-590; Fax: 011-49-30-204-5950 

Email: lymphomas2013@mci-group.com

357 


Infant, Child, and Adolescent Medicine 

Feb 6 - 9, 2013 

United States / Florida / Orlando 

Contact: American Academy of Family Physicians 

Tel: 800-274-2237 or 913-906-6000; Fax: 913-906-6075 

Operative Skills in Neonatal and Paediatric Surgery 

Feb 6 - 7, 2013 





AAOS Total Ankle Arthroplasty 

Feb 7 - 9, 2013 

United States / Illinois / Rosemont 

Contact: Customer Service Department, American 

Association of Orthopaedic Surgeons 

Tel: 800-626-6726 (US and Canada) or 847-823-7186 

Email: custserv@aaos.org 

Emirates Surgical Pathology Conference 2013 

Feb 7 - 9, 2013 

United Arab Emirates / Abu Dhabi 

Contact: Sujatha Kristensen, Project Co-ordinator, 

Meeting Minds: Experts 

Tel: 011-97-14-427-0492; Fax: 011-97-14-427-0493 

Email: pco@espc2013.com 

Meniscus 2 nd International Meeting 

Feb 7 - 9, 2013 

France / Versailles Orthopedics 

Contact: Viviane Barbarisi, MCO Congres 

Fax: 011-33-4-9509-3801 

Email: viviane.barbarisi@mcocongres.com 

BRONCOCON 2013: 18 th Annual Conference of Indian 

Association for Bronchology 

Feb 8 - 10, 2013 

India / Vadodara 

Contact: Dr. Anand K. Patel, Conference Secretariat, 

Global Meridian Hospital 

Tel: 011-91-98-7977-1079 

Email: dranandkpatel@gmail.com 

Toronto Cataract Course 2013 

Feb 9, 2013 

Canada / Ontario / Toronto 

Contact: Continuing Education and Professional 

Development, University of Toronto 

Tel: 416-978-2719 

Email: info-opt1301@cepdtoronto.ca 

Cardiology Update 2013 

Feb 10 - 15, 2013 

Switzerland / Davos 

Contact: Zurich Heart House 

Tel: 011-41-44-250-4080; Fax: 011-41-44-250-4090 

Email: contact@zhh.ch 

33 rd Annual Meeting of The Society of Maternal-Fetal 

Medicine (SMFM): The Pregnancy Meeting 

Feb 11 - 16, 2013 

United States / California / San Francisco 

Contact: SMFM 

Tel: 202-863-2476; Fax: 202-554-1132 

Transcranial Doppler Course 

Feb 13 - 15, 2013 


Contact: Karen Einstein, Office of Continuing Medical 

Education, UC Los Angeles 

Tel: 310-206-0626 

36 th Annual Advanced Ultrasound Seminar: Ob/Gyn 

Feb 14 - 16, 2013 

United States / Florida / Lake Buena Vista 

Contact: American Institute of Ultrasound in 

Medicine 

Tel: 800-638-5352 or 301-498-4100 

Fax: 301-498-4450 

Email: ddelanko@aium.org 

Sclerotherapy 

Feb 15 - 16, 2013 

United States / Tennessee / Nashville 

Contact: Julie Woods, Registration and Product 

Coordinator, National Procedures Institute 

Tel: 800-674-2631; Fax: 512-329-0442 

Email: julie@npinstitute.com 

2 nd American Society For Nutrition Middle East 

Congress 2012 (ASNME 2013) 

Feb 20 - 22, 2013 

United Arab Emirates / Dubai 

Contact: Pure Spot Congress and Event Organizers 

Tel: 011-20-2-267-2144 

Email: Info@EGYPURE.org 

8 th International Breast Cancer Congress 

Feb 20 - 22 , 2013 

Iran / Tehran 

Contact: Fatemeh Keshmir, Executive Manager, Cancer 

Research Center Shahid Beheshti University of Medical 

Sciences 

Tel: 011-98-21-2274-8001-2; Fax: 011-98-21-2274-8001-2 

Email: keshmirf@yahoo.com 

Asian Pacific Society of Cardiology 2013 

Feb 21 - 24 , 2013 

Thailand / Pataya 

Contact: Pattama Thuanchaisri, Project Manager, 

Kenes Asia 

Tel: 011-66-02-748-7881; Fax: 011-66-02-748-7880 

Email: apscoffice2013@apsc2013.org



8 th International Breast Cancer Congress 

Feb 22 - 24 

Iran / Tehran 

Tel: 011-98-21-2274-8001 ext. 2; Fax: 011-98-21-2274- 

8001 ext. 2 

Email: drakbari.drakbari@gmail.com 

Obstetric Ultrasound: Setting the Standard for 2013 

Feb 22 - 24, 2013 


Contact: Elizabeth Gan, CME Administrative Course 

Director, University of Toronto 

Tel: 416-586-4800 ext. 2489; Fax: 416-586-5958 

Email: egan@mtsinai.on.ca 

23 rd Annual Neuroscience Conference: Brain Plasticity 

& Neurorehabilitation 

Mar 4 - 6, 2013 


Contact: Paula Ferreira, Baycrest 

Tel: 416-785-2500 ext. 2363 

Email: PFerreira@baycrest.org 

11 th International Congress on Alzheimer’s And 

Parkinson’s Disease 

Mar 6 - 10 

Italy / Florence 

Contact: Kenes International, Media and Advertising , 

Kenes International 

Tel: 011-41-22-908-0488 

Fax: 011-41-22-908-9140 

Email: adpd@kenes.com 

3 rd Emirates Haematology Conference 

Mar 7 - 9, 2013 


Contact: Bahaa Eldin Okasha, Project Manager, Meeting 

Minds: Experts 

Tel: 011-97-1-4427-0492 

Email: pco@ehc2013.com 

6 th Dubai Anaesthesia 2013 

Mar 7 - 9, 2013 


Contact: Hana Holy, Project Manager, INDEX 

Conferences and Exhibitions Org. Est 

Tel: 011-971-4-362-4717 ext. 120; Fax: 011-971-4-362- 

4718 

Email: hana.holy@index.ae 

6 th International Conference on Ocular Infections 

(ICOI) 

Mar 7 - 10, 2013 

United States / California / Santa Monica 

Contact: Shirley Dinenson, Conference secretariat, 

Paragon Conventions 

Tel: 011-41-22-533-0948; Fax: 011-41-22-580-2953 

Email: sdinenson@paragon-conventions.com 

International Conference on Cerebral Palsy & 

Developmental Medicine 

Mar 8 - 10, 2013 

India / Lucknow 

Contact: R. P. Shah Memorial Trust for Children with 

Disabilities 

Tel: 011-91-930-554-2233 

Vascular Ultrasound Course 

Mar 12 - 13, 2013 

United Kingdom / Birmingham 

Contact: Secretariat, Wessex Scientific 

Fax: 011-44-13-8435-0132 

Email: info@wessexscientific.com 

7 th International Dip Symposium on Diabetes, 

Hypertension, Metabolic Syndrome & Pregnancy 

Mar 14 - 16, 2013 


Contact: Kenes International, Kenes International 

Tel: 011-41-22-908-0488; Fax: 011-41-22-906-9140 

Email: dip@kenes.com 

Essentials of Bronchoscopy 

Mar 14 - 15, 2013 

United States / Illinois / Northbrook 

Contact: American College of Chest Physicians 

Tel: 847-498-1400; Fax: 847-498-5460 

Neurology/Psychiatry for Primary Care Physicians 

Mar 15 - 17, 2013 



Tel: 303-798-9682; Fax: 303-798-5731 


Oncology 

Mar 15, 2013 

United Kingdom / Edinburgh 

Contact: Eileen Strawn, Symposium Co-ordinator, 

Royal College of Physicians of Edinburgh 

Tel: 011-44-13-1247-3619; Fax: 011-44-13-1220-4393 

Email: e.strawn@rcpe.ac.uk 

Endobronchial Ultrasound 

Mar 16 - 17, 2013 

United States / Illinois / Northbrook 

Contact: American College of Chest Physicians 

Tel: 847-498-1400; Fax: 847-498-5460 

Interdisciplinary Prostate Cancer Congress 

Mar 16, 2013 

United States / New York / New York 

Contact: Physicians’ Education Resource 

Tel: 609-451-0258; Fax: 609-257-0705 

Email: info@gotoper.com

359 


2013 Neonatal Ultrasound Course. Why, How and 

When an Ultrasound Image? 

Mar 18 - 21, 2013 


Contact: Organizing Secretariat, AIM Group 

International 

Tel: 011-39-55-23-388 ext.1; Fax: 011-39-55-248-0246 

Email: ultrasound2013@aimgroup.eu 

Epidemiology & Prevention | Nutrition, Physical 

Activity & Metabolism 2013 Scientific Sessions 

Mar 19 - 22, 2013 

United States / Louisiana / New Orleans 

Contact: American Heart Association 

Tel: 888-242-2453 or 214-570-5935 

Email: scientificconferences@heart.org 

Specialty Skills in Coloproctology Stage 1 (ST3-5) 

Mar 19 - 20, 2013 





Website: http://www.rcseng.ac.uk/courses/coursesearch/colorectal-surgery-stage-i 

11 th European Meeting on Hiv & Hepatitis: Treatment 

Strategies & Antiviral Drug Resistance 

Mar 20 - 22, 2013 

Italy / Rome 

Contact: Wilco Keulen, Virology Education B.V. 

Tel: 011-31-30-230-7140; Fax: 011-31-30-230-7148 

Email: wilco.keulen@vironet.com 

CIT 2013: China Interventional Therapeutics 

Mar 20 - 23 

China / Beijing 

Contact: Lifeng Dai, International Registration, Chinese 

Medical Association 

Tel: 011-86-10-8515-8473 

Email: lfdai@citmd.com 

Monitoring of Airway Diseases 

Mar 21 - 23, 2013 

Belgium / Liege 

Contact: European Respiratory Society 

Fax: 011-41-21-213-0100 

Email: school@ersnet.org 

Specialty Skills in Coloproctology Stage 2 (St6-8) 

Mar 21 - 22, 2013 





21 st National Association for Study of the Liver 

Mar 22 - 24, 2013 

India / Hyderabad 

Contact: Ritu Saigal, APM, Kenes India 

Tel: 011-91-11-4519-9100; Fax: 011-91-11-2551-3052 

Email: inasl2013@gmail.com 

Adult Infectious Diseases: Evidence Based Primary 

Prevention and Treatment 

Mar 25 - 27, 2013 

United States / California / Anaheim 

Contact: Orly Light, Director of MCE Conferences, 

MCE Conferences 

Tel: 888-533-9031; Fax: 858-777-5588 

Email: info@mceconferences.com 

Thyroid and Parathyroid Masterclass 

Mar 25, 2013 





17 th Pan Arab Conference on Diabetes 

Mar 26 - 29, 2013 

Egypt / Cairo 

Contact: Conference Secretariat, Pure Spot Congress 

and Event Organizers 

Tel: 011-20-2-2672-1944; Fax: 011-20-2-2671-8421 

Email: pure@onlinediabetes.net 

Head and Neck Surgical Anatomy: ‘Hands On’ 

Cadaver Workshop 

Mar 26, 2013 

United Kingdom / York 

Contact: Hull York Medical School 

Email: postgraduate@hyms.ac.uk 

7 th Middle East Cardiovascular Conference: MECC 

2013 

Mar 30 - Apr 2, 2013 

Turkey / Istanbul 

Website: http://www.mecc.ir/ 

Nuclear Receptors & Friends: Roles in Energy 

Homeostasis & Metabolic Dysfunction 

Apr 3 - 8, 2013 

Austria / Alpbach 


Biology 

Tel: 800-253-0685 or 970-262-1230; Fax: 970-262-1525 


Specialty Skills in Oncoplastic and Breast 

Reconstruction Surgery Level I 

Apr 3 - 4, 2013 




Email: education@rcseng.ac.uk



Controversies in Rheumatology & Autoimmunity 

2013 

Apr 4 - 6, 2013 

Hungary / Budapest 

Contact: Ronit Eisenbach, APM, Kenes International 

Tel: 011-41-22-908-0488; Fax: 011-41-22-906-9140 

Email: cora@kenes.com 

Society for Emergency Medicine In Singapore Annual 

Scientific Meeting 2013 

Apr 6 - 7, 2013 

Singapore / Singapore 

Contact: SEMS ASM 2013 , Society for Emergency 

Medicine in Singapore 

Email: semsasm2013@gmail.com 

Intermediate Skills In Laparoscopic Surgery 

Apr 9 - 10, 2013 





7 th World Congress on Controversies in Neurology 

(CONY) 

Apr 11 - 14, 2013 

Turkey / Istanbul 

Contact: Congress Secretariat, ComtecMED 

Tel: 011-972-3-566-6166; Fax: 011-972-3-566-6177 

Email: cony@comtecmed.com 

Advances in Diabetes and Insulin Therapy - Adit 2013 

Apr 11 - 14, 2013 

Bulgaria / Sofia 

Contact: Rok Bolcina, Registration and Housing 

Manager, POTNIK d.o.o. 

Email: info@adit-conf.org 

22 nd Biennial Congress of the South African 

Arthroplasty Society 

Apr 17 - 20, 2013 

South Africa / Winterton 

Contact: Congress Secretariat, ICE Solution 

Tel: 011-27-11-911-1921;Fax: 011-27-11-911-1939 

Email: tracey@icesolution.co.za 

Annual Paediatric Update Conference 2013: Operative 

Skills In Neurosurgery 

Apr 17 - 19, 2013 





2013 World Congress on Osteoarthritis 

Apr 18 - 21, 2013 

United States / Pennsylvania / Philadelphia 

Contact: Annemarie Kehler, Meeting & Registration 

Coordinator, Osteoarthritis Research Society 

International 

Tel: 856-642-4429; Fax: 856-439-0525 

Email: akehler@oarsi.org 

5 th Pan Arab Congress of Sexual Health 

Apr 18 - 20, 2013 


Contact: Adel Zakaria, Congress Organizer, Charisma 

Travel 

Tel: 011-21-2-2216-3858; Fax: 011-20-2-2418-4645 

Email: mohamedtarekanis@gmail.com 

Comprehensive Colposcopy 

Apr 18 - 21, 2013 

United States / Georgia / Atlanta 

Contact: American Society for Colposcopy and Cervical 

Pathology 

Tel: 301-733-3640; Fax: 301-733-5775 

Update in General Surgery 2013 

Apr 18 - 20, 2013 

Ontario / Toronto 



Tel: 416-978-2719 

Email: info-sur1304@cepdtoronto.ca 

Emergency Radiology in Burgundy 

Apr 20 - 26, 2013 

France / Beaune 

Contact: Joanne Porter, Joint Department of Medical 

Imaging, University of Toronto 

Tel: 416-340-4800 ext. 8921; Fax: 416-340-3900 

Email: joanne.porter@uhn.ca 

International Society for Neurochemistry / American 

Society for Neurochemistry 2013 Meeting 

Apr 20 - 24, 2013 

Mexico / Cancun 

Contact: Sheilah Jewart, ISN-ASN Cancun 2013 

Email: SJewart@isn-asncancun2013.org 

Musculoskeletal Ultrasound Course for 

Rheumatologists - Fundamentals 

Apr 20 - 21, 2013 

United States / Illinois / Chicago 

Contact: American College of Rheumatology 

Tel: 800-636-4766 (US & Canada) or 415-979-2265; Fax: 

415-293-5231 

Email: ACRProfMtgs@cmrus.com

361 


Nephrology 2013 

Apr 21 - 26, 2013 

United States / Massachusetts / Boston 

Contact: Harvard Medical School, Department of 

Continuing Education, Agri Meetings 

Tel: 617-384-8600 

Email: hms-cme@hms.harvard.edu 

14 th International Workshop on Clinical Pharmacology 

of HIV Therapy 

Apr 22 - 24, 2013 

United Kingdom / Liverpool 

Contact: Wilco Keulen, Virology Education B.V 

Tel: 011-31-30-230-7140; Fax: 011-31-30-230-7148 

Email: wilco.keulen@vironet.com 

1 st International Pediatric Psycho-Oncology Workshop 

Apr 22 - 25, 2013 

Egypt / Cairo 

Contact: Dr. Mohammad ElShami, Director of the 

psychiatric department, Children Cancer Hospital 

Egypt 57357 

Tel: 011-20-2-2535-1500 

Email: mohammad.elshami@57357.com 

Hot Topics In Anesthesia + ACLS + NRP + PALS 

Apr 22 - 25, 2013 


Contact: Northwest Anesthesia Seminars, Inc. 

Tel: 509-547-7065; Fax: 509-547-1265 

Email: info@nwas.com 

Malaria Vaccines for the World 

Apr 22 - 24, 2013 

Switzerland / Lausann 

Contact: John Herriot, Meetings Management 

Tel: 011-44-1483-427-440; Fax: 011-44-1483-428-516 

Email: jherriot@meetingsmgmt.u-net.com 

Angioplasty Summit TCTAP 2013 

Apr 23 - 26, 2013 

South Korea / Seoul 

Contact: Harim Jin, Summit MD 

Email: cvrf@summitmd.com 

34 th Annual Advances in Infectious Diseases: New 

Directions for Primary Care 

Apr 24 - 26, 2013 

United States / California / San Francisco 

Contact: Office of Continuing Medical Education, 

UCSF CME Registration Office 

Tel: 415-476-5808; Fax: 415-502-1795 

Email: info@ocme.ucsf.edu 

International Society for Heart & Lung Transplantation 

(ISHLT) 33rd Annual Meeting & Scientific Sessions 

Apr 24 - 27, 2013 

Canada, Quebec / Montreal 

Contact: ISHLT 

Tel: 972-490-9495; Fax: 972-490-9499 

Email: meetings@ishlt.org 

8 th International Congress on Vascular Access 

Apr 25 - 27, 2013 

Czech Republic / Prague 

Contact: Congress Secretariat, GUARANT 

International 

Tel: 011-420-284-001-444; Fax: 011-420-284-001-448 

Bit’s 4 th Annual World DNA and Genome Day (WDD- 

2013) 

Apr 25 - 27, 2013 

China / Nanjing 

Contact: Jessica Tong , WDD-2013, BIT Congress, Inc. 

Tel: 011-86-411-8479-9609 ext. 801; Fax: 011-86-411- 

8479-9629 

Email: Jessica@dnaday.com 

Geriatric Medicine 

Apr 25 - 27, 2013 

New Mexico / Albuquerque 

Contact: American Academy of Family Physicians 

Tel: 800-274-2237 or 913-906-6000; Fax: 913-906-6075 

43 rd Annual Aesthetic Plastic Surgery Symposium 

2013 

Apr 26 - 27 

Canada, Ontario / Toronto 



Tel: 416-978-2719 

Email: info.cepd@utoronto.ca 

23 rd European Congress of Clinical Microbiology And 

Infectious Diseases 

Apr 27 - 30, 2013 

Germany / Berlin 

Contact: Congrex Switzerland Ltd. 

Tel: 011-41-61-686-7777; Fax: 011-41-61-686-7788 

Email: basel@congrex.com 

5 th International Conference: Advances in Orthopaedic 

Osseointegration 

May 1 - 31, 2013 

Sweden / Gothenburg Orthopedics 

Contact: , Office of Continuing Medical Education, 

UCSF CME Registration Office 

Tel: 415-476-5808; Fax: 415-502-1795 

Email: info@ocme.ucsf.edu



WHO-Facts Sheet 

1. Diabetes 

2. Epilepsy 

3. Maternal Mortality 

4. Diarrheal Disease 

Compiled and edited by 

Babichan K Chandy 


1. DIABETES 

What is diabetes? 

Diabetes is a chronic disease that occurs either 

when the pancreas does not produce enough insulin 

or when the body cannot effectively use the insulin it 

produces. Insulin is a hormone that regulates blood 

sugar. Hyperglycaemia, or raised blood sugar, is a 

common effect of uncontrolled diabetes and over time 

leads to serious damage to many of the body’s systems, 

especially the nerves and blood vessels. 

KEY FACTS 

• 346 million people worldwide have diabetes. 

• In 2004, an estimated 3.4 million people died from 

consequences of high blood sugar. 

• More than 80% of diabetes deaths occur in low- and 

middle-income countries. 

• WHO projects that diabetes deaths will double 

between 2005 and 2030. 

• Healthy diet, regular physical activity, maintaining 

a normal body weight and avoiding tobacco use 

can prevent or delay the onset of type 2 diabetes. 

Type 1 diabetes 

Type 1 diabetes (previously known as insulindependent, 

juvenile or childhood-onset) is 

characterized by deficient insulin production and 

requires daily administration of insulin. The cause of 

type 1 diabetes is not known and it is not preventable 

with current knowledge. 

Symptoms include excessive excretion of urine 

(polyuria), thirst (polydipsia), constant hunger, weight 

loss, vision changes and fatigue. These symptoms may 

occur suddenly. 

Type 2 diabetes 

Type 2 diabetes (formerly called non-insulindependent 

or adult-onset) results from the body’s 

ineffective use of insulin. Type 2 diabetes comprises 

90% of people with diabetes around the world, and is 

largely the result of excess body weight and physical 

inactivity. 

Symptoms may be similar to those of Type 1 

diabetes, but are often less marked. As a result, the 

disease may be diagnosed several years after onset, 

once complications have already arisen. 

Until recently, this type of diabetes was seen only in 

adults, but it is now also occurring in children. 

Gestational diabetes 

Gestational diabetes is hyperglycaemia with onset 

or first recognition during pregnancy. 

Symptoms of gestational diabetes are similar to 

Type 2 diabetes. Gestational diabetes is most often 

diagnosed through prenatal screening, rather than 

reported symptoms. 

Impaired glucose tolerance (IGT) and impaired 

fasting glycaemia (IFG) 

Impaired glucose tolerance (IGT) and impaired 

fasting glycaemia (IFG) are intermediate conditions in 

the transition between normality and diabetes. People 

with IGT or IFG are at high risk of progressing to type 

2 diabetes, although this is not inevitable. 

What are common consequences of diabetes? 

Over time, diabetes can damage the heart, blood 

vessels, eyes, kidneys, and nerves. 

• Diabetes increases the risk of heart disease 

and stroke. 50% of people with diabetes die of 

cardiovascular disease (primarily heart disease and 

stroke). 

• Combined with reduced blood flow, neuropathy 

in the feet increases the chance of foot ulcers and 

eventual limb amputation. 


Office of the Spokesperson, WHO, Geneva. Tel.: (+41 22) 791 2599; Fax (+41 22) 791 4858; Email: inf@who.int; Web site: http://www.who.int/

363 

WHO-Facts Sheet December 2012 

• Diabetic retinopathy is an important cause of 

blindness, and occurs as a result of long-term 

accumulated damage to the small blood vessels in 

the retina. After 15 years of diabetes, approximately 

2% of people become blind, and about 10% develop 

severe visual impairment. 

• Diabetes is among the leading causes of kidney 

failure. 10-20% of people with diabetes die of 

kidney failure. 

• Diabetic neuropathy is damage to the nerves as a 

result of diabetes, and affects up to 50% of people 

with diabetes. Although many different problems 

can occur as a result of diabetic neuropathy, 

common symptoms are tingling, pain, numbness, 

or weakness in the feet and hands. 

• The overall risk of dying among people with 

diabetes is at least double the risk of their peers 

without diabetes. 

What is the economic impact of diabetes? 

Diabetes and its complications have a significant 

economic impact on individuals, families, health 

systems and countries. 

How can the burden of diabetes be reduced? 

Prevention 

Simple lifestyle measures have been shown to be 

effective in preventing or delaying the onset of type 

2 diabetes. To help prevent type 2 diabetes and its 

complications, people should: 

• achieve and maintain healthy body weight; 

• be physically active – at least 30 minutes of regular, 

moderate-intensity activity on most days. More 

activity is required for weight control; 

• eat a healthy diet of between three and five servings 

of fruit and vegetables a day and reduce sugar and 

saturated fats intake; 

• avoid tobacco use – smoking increases the risk of 

cardiovascular diseases. 

Diagnosis and treatment 

Early diagnosis can be accomplished through 

relatively inexpensive blood testing. 

Treatment of diabetes involves lowering blood 

glucose and the levels of other known risk factors that 

damage blood vessels. Tobacco use cessation is also 

important to avoid complications. 

Interventions that are both cost saving and feasible 

in developing countries include: 

• moderate blood glucose control. People with type 1 

diabetes require insulin; people with type 2 diabetes 

can be treated with oral medication, but may also 

require insulin; 

• blood pressure control 

• foot care 

Other cost saving interventions include: 

• screening and treatment for retinopathy (which 

causes blindness) 

• blood lipid control (to regulate cholesterol levels) 

• screening for early signs of diabetes-related kidney 

disease. 

These measures should be supported by a healthy 

diet, regular physical activity, maintaining a normal 

body weight and avoiding tobacco use. 

For more information, please contact: 

WHO Media centre, Telephone: +41 22 791 2222. E- 

mail: mediainquiries@who.int 

2. EPILEPSY 

What is epilepsy? 

Epilepsy is a chronic disorder of the brain that affects 

people in every country of the world. It is characterized 

by recurrent seizures. Seizures are brief episodes of 

involuntary shaking which may involve a part of the 

body (partial) or the entire body (generalized) and 

sometimes accompanied by loss of consciousness and 

control of bowel or bladder function. The episodes are a 

result of excessive electrical discharges in a group of brain 

cells. Different parts of the brain can be the site of such 

discharges. Seizures can vary from the briefest lapses 

of attention or muscle jerks, to severe and prolonged 

convulsions. Seizures can also vary in frequency, from 

less than one per year to several per day. 

One seizure does not signal epilepsy (up to 

10% of people worldwide have one seizure during 

their lifetimes). Epilepsy is defined by two or more 

unprovoked seizures. Epilepsy is one of the world’s 

oldest recognized conditions. Fear, misunderstanding, 

discrimination and social stigma have surrounded 

epilepsy for centuries. Some of the stigma continues 

today in many countries and can impact the quality of 

life for people with the disorder and their families. 

KEY FACTS 

• Epilepsy is a chronic noncommunicable disorder of 

the brain that affects people of all ages 

• Around 50 million people worldwide have 

epilepsy 

• Nearly 80% of the people with epilepsy are found 

in developing regions. 

• Epilepsy responds to treatment about 70% of the 

time, yet about three fourths of affected people in 

developing countries do not get the treatment they 

need. 

• People with epilepsy and their families can suffer 

from stigma and discrimination in many parts of 

the world



Signs and symptoms 

Characteristics of seizures vary and depend on 

where in the brain the disturbance first starts, and how 

far it spreads. Temporary symptoms can occur, such as 

loss of awareness or consciousness, and disturbances 

of movement, sensation (including vision, hearing and 

taste), mood or mental function. 

People with seizures tend to have more physical 

problems (such as fractures and bruising), as well as 

higher rates of other diseases or psychosocial issues 

and conditions like anxiety and depression. 

Rates of disease 

The estimated proportion of the general population 

with active epilepsy (i.e. continuing seizures or the 

need for treatment) at a given time is between 4 - 10 

per 1000 people. However, some studies in developing 

countries suggest that the proportion is between 6 - 10 

per 1000. Around 50 million people in the world have 

epilepsy. 

In developed countries, annual new cases are 

between 40 to 70 per 100,000 people in the general 

population. In developing countries, this figure is 

often close to twice as high due to the higher risk of 

experiencing conditions that can lead to permanent 

brain damage. Close to 80% of epilepsy cases worldwide 

are found in developing regions. The risk of premature 

death in people with epilepsy is two to three times 

higher than it is for the general population. 

Causes 

The most common type – for six out of ten people 

with the disorder – is called idiopathic epilepsy and 

has no identifiable cause. In many cases, there is an 

underlying genetic basis. 

Epilepsy with a known cause is called secondary 

epilepsy, or symptomatic epilepsy. The causes of 

secondary (or symptomatic) epilepsy could be: 

• brain damage from prenatal or perinatal injuries 

(a loss of oxygen or trauma during birth, low birth 

weight) 

• congenital abnormalities or genetic conditions with 

associated brain malformations 

• a severe blow to the head 

• a stroke that starves the brain of oxygen 

• an infection of the brain such as meningitis, 

encephalitis, neurocysticercosis 

• certain genetic syndromes 

• a brain tumor 

Treatment 

Recent studies in both developed and developing 

countries have shown that up to 70% of newly 

diagnosed children and adults with epilepsy can be 

successfully treated (i.e. their seizures completely 

controlled) with anti-epileptic drugs (AEDs). After 

two to five years of successful treatment, drugs can be 

withdrawn in about 70% of children and 60% of adults 

without relapses. 

• In developing countries, three fourths of people 

with epilepsy may not receive the treatment they 

need. 

• About 9 out of 10 people with epilepsy in Africa go 

untreated. 

• In many low- and middle-income countries, there 

is low availability and AEDs are not affordable and 

this may act as a barrier to accessing treatment. 

A recent study found the average availability of 

generic antiepileptic medicines in the public sector 

to be less than 50%. 

• Surgical therapy might be beneficial to patients 

who respond poorly to drug treatments. 

Prevention 

Idiopathic epilepsy is not preventable. However, 

preventive measures can be applied to the known 

causes of secondary epilepsy. 

• Preventing head injury is the most effective way to 

prevent post-traumatic epilepsy. 

• Adequate perinatal care can reduce new cases of 

epilepsy caused by birth injury. 

• The use of drugs and other methods to lower the 

body temperature of a feverish child can reduce the 

chance of subsequent convulsions. 

• Central nervous system infections are common 

causes of epilepsy in tropical areas, where many 

developing countries are concentrated. Elimination 

of parasites in these environments and education 

on how to avoid infections would be effective ways 

to reduce epilepsy worldwide, for example due to 

neurocysticercosis. 

Social and ecomomic impacts 

Epilepsy accounts for 0.5% of the global burden of 

disease, a time-based measure that combines years of 

life lost due to premature mortality and time lived in 

states of less than full health. Epilepsy has significant 

economic implications in terms of health-care needs, 

premature death and lost work productivity. An Indian 

study calculated that the total cost per epilepsy case 

was US$ 344 per year (or 88% of the average income 

per capita). The total cost for an estimated five million 

cases in India was equivalent to 0.5% of gross national 

product. 

Although the social effects vary from country to 

country, the discrimination and social stigma that 

surround epilepsy worldwide are often more difficult 

to overcome than the seizures themselves. People 

with epilepsy can be targets of prejudice. The stigma 

of the disorder can discourage people from seeking 

treatment for symptoms and becoming identified with 

the disorder.

365 


Human rights 

People with epilepsy experience reduced access 

to health and life insurance, a withholding of the 

opportunity to obtain a driving license, and barriers to 

enter particular occupations, among other limitations. 

In many countries, legislation reflects centuries of 

misunderstanding about epilepsy. For example: 

• In both China and India, epilepsy is commonly 

viewed as a reason for prohibiting or annulling 

marriages. 

• In the United Kingdom, a law forbidding people 

with epilepsy to marry was repealed only in 1970. 

• In the United States, until the 1970s, it was legal to 

deny people with seizures access to restaurants, 

theatres, recreational centres and other public 

buildings. 

Legislation based on internationally accepted 

human rights standards can prevent discrimination 

and rights violations, improve access to health care 

services and raise quality of life. 

3. MATERNAL MORTALITY 

Maternal mortality is unacceptably high. About 

800 women die from pregnancy- or childbirth-related 

complications around the world every day. In 2010, 

287,000 women died during and following pregnancy 

and childbirth. Almost all of these deaths occurred 

in low-resource settings, and most could have been 

prevented. 

KEY FACTS 

• Every day, approximately 800 women die from 

preventable causes related to pregnancy and 

childbirth. 

• 99% of all maternal deaths occur in developing 

countries. 

• Maternal mortality is higher in women living in 

rural areas and among poorer communities. 

• Young adolescents face a higher risk of 

complications and death as a result of pregnancy 

than older women. 

• Skilled care before, during and after childbirth can 

save the lives of women and newborn babies. 

• Between 1990 and 2010, maternal mortality 

worldwide dropped by almost 50% 

Progress towards achieving the fifth Millennium 

Development Goal 

Improving maternal health is one of the eight 

Millennium Development Goals (MDGs) adopted by 

the international community in 2000. Under MDG5, 

countries committed to reducing maternal mortality 

by three quarters between 1990 and 2015. Since 1990, 

maternal deaths worldwide have dropped by 47%. 

In sub-Saharan Africa, a number of countries have 

halved their levels of maternal mortality since 1990. In 

other regions, including Asia and North Africa, even 

greater headway has been made. However, between 

1990 and 2010, the global maternal mortality ratio (i.e. 

the number of maternal deaths per 100, 000 live births) 

declined by only 3.1% per year. This is far from the 

annual decline of 5.5% required to achieve MDG5. 

Where do maternal deaths occur? 

The high number of maternal deaths in some areas 

of the world reflects inequities in access to health 

services, and highlights the gap between rich and poor. 

Almost all maternal deaths (99%) occur in developing 

countries. More than half of these deaths occur in sub- 

Saharan Africa and almost one third occur in South 

Asia. 

The maternal mortality ratio in developing countries 

is 240 per 100,000 births versus 16 per 100,000 in 

developed countries. There are large disparities between 

countries, with few countries having extremely high 

maternal mortality ratios of 1000 or more per 100, 000 live 

births. There are also large disparities within countries, 

between people with high and low income and between 

people living in rural and urban areas. 

The risk of maternal mortality is highest for 

adolescent girls under 15 years old. Complications in 

pregnancy and childbirth are the leading cause of death 

among adolescent girls in most developing countries. 

Women in developing countries have on average 

many more pregnancies than women in developed 

countries, and their lifetime risk of death due to 

pregnancy is higher. A woman’s lifetime risk of 

maternal death – the probability that a 15 year old 

woman will eventually die from a maternal cause – is 

one in 3800 in developed countries, versus one in 150 

in developing countries. 

Why do women die? 

Women die as a result of complications during 

and following pregnancy and childbirth. Most of 

these complications develop during pregnancy. Other 

complications may exist before pregnancy but are 

worsened during pregnancy. The major complications 

that account for 80% of all maternal deaths are: 

• severe bleeding (mostly bleeding after childbirth) 

• infections (usually after childbirth) 

• high blood pressure during pregnancy (preeclampsia 

and eclampsia) 

• unsafe abortion. 

The remainder are caused by or associated with 

diseases such as malaria, and AIDS during pregnancy. 

Maternal health and newborn health are closely



linked. More than three million newborn babies die 

every year, and an additional 2.6 million babies are 

stillborn. 

How can women’s lives be saved? 

Most maternal deaths are avoidable, as the healthcare 

solutions to prevent or manage complications are 

well known. All women need access to antenatal care in 

pregnancy, skilled care during childbirth, and care and 

support in the weeks after childbirth. It is particularly 

important that all births are attended by skilled health 

professionals, as timely management and treatment 

can make the difference between life and death. 

Severe bleeding after birth can kill a healthy woman 

within two hours if she is unattended. Injecting oxytocin 

immediately after childbirth effectively reduces the 

risk of bleeding. 

Infection after childbirth can be eliminated, if good 

hygiene is practiced, and if, early signs of infection are 

recognized and treated in a timely manner. 

Pre-eclampsia should be detected and appropriately 

managed before the onset of convulsions (eclampsia) 

and other life-threatening complications. Administering 

drugs such as magnesium sulfate for pre-eclampsia 

can lower a woman’s risk of developing eclampsia. 

To avoid maternal deaths, it is also vital to prevent 

unwanted and too-early pregnancies. All women, 

including adolescents, need access to family planning, 

safe abortion services to the full extent of the law, and 

quality post-abortion care. 

Why do women not get the care they need? 

Poor women in remote areas are the least likely to 

receive adequate health care. While levels of antenatal 

care have increased in many parts of the world during 

the past decade, only 46% of women in low-income 

countries benefit from skilled care during childbirth. 

This means that millions of births are not assisted by 

a midwife, a doctor or a trained nurse. In high-income 

countries, virtually all women have at least four 

antenatal care visits, are attended by a skilled health 

worker during childbirth and receive postpartum 

care. In low-income countries, just over a third of 

all pregnant women have the recommended four 

antenatal care visits. 

Other factors that prevent women from receiving 

or seeking care during pregnancy and childbirth are: 

• poverty 

• distance 

• lack of information 

• inadequate services and 

• cultural practices. 

To improve maternal health, barriers that limit 

access to quality maternal health services must be 

identified and addressed at all levels of the health 

system. 

For more information contact: 

WHO Media centre. Telephone: +41 22 791 2222. E-mail: 

mediainquiries@who.int 

4. DIARRHEAL DISEASE 

Definition 

Diarrhea is defined as the passage of three or 

more loose or liquid stools per day (or more frequent 

passage than is normal for the individual). Frequent 

passing of formed stools is not Diarrhea, nor is the 

passing of loose, “pasty” stools by breastfed babies. 

Diarrhea is usually a symptom of an infection in the 

intestinal tract, which can be caused by a variety of 

bacterial, viral and parasitic organisms. Infection is 

spread through contaminated food or drinking-water, 

or from person-to-person as a result of poor hygiene. 

Diarrheal disease is treatable with a solution of clean 

water, sugar and salt, and with zinc tablets. 

Diarrheal disease is the second leading cause 

of death in children under five years old, and is 

responsible for killing 1.5 million children every year. 

Diarrhea can last several days, and can leave the body 

without the water and salts that are necessary for 

survival. Most people who die from Diarrhea actually 

die from severe dehydration and fluid loss. Children 

who are malnourished or have impaired immunity are 

most at risk of life-threatening diarrhea. 

KEY FACTS 

• Diarrheal disease is the second leading cause of 

death in children under five years old. It is both 

preventable and treatable. 

• Diarrheal disease kills 1.5 million children every 

year. 

• Globally, there are about two billion cases of 

Diarrheal disease every year. 

• Diarrheal disease mainly affects children under 

two years old. 

• Diarrhea is a leading cause of malnutrition in 

children under five years old. 

There are three clinical types of Diarrhea: 

- acute watery Diarrhea – lasts several hours or 

days, and includes cholera; 

- acute bloody Diarrhea – also called dysentery; 

and 

- persistent Diarrhea – lasts 14 days or longer. 

Scope of Diarrheal disease 

Every year, there are about two billion cases of 

Diarrheal disease worldwide. Diarrheal disease is a 

leading cause of child mortality and morbidity in the 

world, and mostly results from contaminated food and 

water sources. Worldwide, around 1 billion people 

lack access to improved water and 2.5 billion have no

367 


access to basic sanitation. Diarrhea due to infection is 

widespread throughout developing countries. 

In 2004, Diarrheal disease was the third leading 

cause of death in low-income countries, causing 6.9% 

of deaths overall. In children under five years old, 

Diarrheal disease is the second leading cause of death 

– second only to pneumonia. Out of the 1.5 million 

children killed by Diarrheal disease in 2004, 80% were 

under two years old. 

In developing countries, children under three years 

old experience on average three episodes of Diarrhea 

every year. Each episode deprives the child of the 

nutrition necessary for growth. As a result, Diarrhea 

is a major cause of malnutrition, and malnourished 

children are more likely to fall ill from Diarrhea. 

Dehydration 

The most severe threat posed by Diarrhea is 

dehydration. During a Diarrheal episode, water 

and electrolytes (sodium, chloride, potassium and 

bicarbonate) are lost through liquid stools, vomit, 

sweat, urine and breathing. Dehydration occurs when 

these losses are not replaced. 

The degree of dehydration is rated on a scale of 

three. 

• Early dehydration – no signs or symptoms. 

• Moderate dehydration: 

- thirst 

- restless or irritable behaviour 

- decreased skin elasticity 

- sunken eyes 

• Severe dehydration: 

- symptoms become more severe 

- shock, with diminished consciousness, lack of 

urine output, cool, moist extremities, a rapid 

and feeble pulse, low or undetectable blood 

pressure, and pale skin. 

Death can follow severe dehydration if body fluids 

and electrolytes are not replenished, either through the 

use of oral rehydration salts (ORS) solution, or through 

an intravenous drip. 

Causes 

Infection: Diarrhea is a symptom of infections 

caused by a host of bacterial, viral and parasitic 

organisms, most of which are spread by faecescontaminated 

water. Infection is more common when 

there is a shortage of clean water for drinking, cooking 

and cleaning. Rotavirus and Escherichia coli are the 

two most common causes of Diarrhea in developing 

countries. 

Malnutrition: Children who die from Diarrhea 

often suffer from underlying malnutrition, which 

makes them more vulnerable to Diarrhea. Each 

Diarrheal episode, in turn, makes their malnutrition 

even worse. Diarrhea is a leading cause of malnutrition 

in children under five years old. 

Source: Water contaminated with human faeces, 

for example, from sewage, septic tanks and latrines, 

is of particular concern. Animal faeces also contain 

microorganisms that can cause Diarrhea. 

Other causes: Diarrheal disease can also spread 

from person-to-person, aggravated by poor personal 

hygiene. Food is another major cause of Diarrhea 

when it is prepared or stored in unhygienic conditions. 

Water can contaminate food during irrigation. Fish 

and seafood from polluted water may also contribute 

to the disease. 

Prevention and treatment 

Key measures to prevent Diarrhea include: 

• access to safe drinking-water 

• improved sanitation 

• exclusive breastfeeding for the first six months of 

life 

• good personal and food hygiene 

• health education about how infections spread, and 

• rotavirus vaccination. 

Key measures to treat Diarrhea include the 

following. 

• Rehydration: Rehydration with intravenous fluids 

in case of severe dehydration or shock and/or oral 

rehydration salts (ORS) solution for moderate or no 

dehydration. ORS is a mixture of clean water, salt 

and sugar, which can be prepared safely at home. 

It costs a few cents per treatment. ORS is absorbed 

in the small intestine and replaces the water and 

electrolytes lost in the faeces. 

• Zinc supplements: Zinc supplements reduce the 

duration of a Diarrhea episode by 25% and are 

associated with a 30% reduction in stool volume. 

• Nutrient-rich foods: The vicious circle of 

malnutrition and Diarrhea can be broken by 

continuing to give nutrient-rich foods – including 

breast milk – during an episode, and by giving a 

nutritious diet – including exclusive breastfeeding 

for the first six months of life – to children when 

they are well. 

• Consulting a health worker, if there are signs of 

dehydration.



Yearly Title Index 


(KMJ) 2012; Volume 44 


A Case of Adult Botulism following Ingestion of 

Contaminated Egyptian Salted Fish (“Faseikh”). 44 (1) 63 

- 65 

A Comparison of Outcome of Open Transvesical 

Prostatectomy with or Without Bladder Neck Repair. 44 

(3) 211 - 214 

Acromioclavicular Joint Cyst-Pseudotumour of Shoulder. 

44 (3) 227 - 230 

Anterior Lateral Thigh Flap Salvage Reconstruction 

of Composite Defects after Recurrent Head and Neck 

Cancer: A Case Report. 44 (3) 231 - 234 

A Randomized Trial of Epidural Volume Extension by 

Sequential Combined Spinal Epidural Anaesthesia by 

Three Technique. 44 (1) 30 - 34 

A Solitary Hamartomatous Polyp of the Ileum Causing 

Adult Intussusception: A Case Report. 44 (3) 235 - 238 

Asthma During Pregnancy: An Immunologic Perspective. 

44 (4) 277 - 286 

A Young Male with Behcet’s Disease and Right Ventricular 

Thrombi. 44(1) 66 - 68 

Bariatric Surgery and Hypoglycemia. 44(4) 274 - 276 

Bilateral Diffuse Mucinous Cystic Adenocarcinoma of 

the Lungs Complicated by Recurrent Pneumothorax in a 

Pregnant Woman. 44 (1) 56 - 59 

Bilateral Massive Angiomyolipomatosis Associated with 

Tuberous Sclerosis. 44 (2) 149 - 153 

Can Science Teach a Thing or Two to Nature?. 44 (2) 90 

- 91 

Celiac Disease as Uncommon Cause of Death in Type 1 

Diabetes Mellitus, a Case Study. 44(4) 335 - 337 

Clinical and Bacteriologic Correlates of the PapG Alleles 

among Uropathogenic Escherichia Coli Strains Isolated 

from Cases of Adult Urinary Tract Infection. 44(1) 26 - 29 

Closed Reduction and Percutaneous Fixation of Lisfranc 

Joints Fracture Dislocation. 44 (3) 200 - 210 

Comparison of Changes in Body Image of Patients with 

Renal Calculi Treated by Pyelolithotomy or Percutaneuos 

Lithotripsy. 44 (2) 113 - 117 

Dengue Fever among Travelers. 44 (2) 146 - 148 

Determining the Effect of Sufentanil on Propofol Injection 

Pain. 44 (2) 121 - 124 

Diagnostic Computerized Tomography Sign in Peterson’s 

Space Hernia after Laparoscopic Roux-en-Y Gastric 

Bypass. 44 (1) 69 - 70 

Donohue Syndrome: A case report. 44 (3) 224 - 226 

Double Appendix: Report of a Case. 44 (4) 329-331 

Effect of Granulocyte Colony-Stimulating Factor on Liver 

Injury Induced by CCl4: A Correlation between Biochemical 

Parameters and Histopathology Results. 44 (1) 46 - 49 

Evaluation of Lamivudine Effect on Prevention of 

Hepatocellular Carcinoma Recurrence. 44 (2) 154 

Evaluating the Association Between Premenstrual 

Syndrome and Hematologic Parameters During the Early 

Follicular and Late Luteal Phases. 44 (2) 125 - 132 

Gaucher Disease Co-existing with Wilson Disease: A Case 

Report. 44 (2) 139 - 140 

Giant Retroperitoneal Leiomyoma: A Rare Presentation. 

44 (3) 239 - 243 

Good for Old As Well As Young; Oral Rehydration 

Therapy (ORT). 44 (1) 1 - 2 

Hypertension and Hypoglycemia in a Child with 

Hepatoblastoma: A Case Report. 44 (2) 133 - 134 

Impact of the Discovery of Human Zinc Deficiency. 44 (3) 

180 - 182 

Incomplete Small Bowel Obstruction Caused by Idiopathic 

Diaphragm Disease of the Proximal Ileum. 44 (2) 143 - 145 

Individual Cyclooxygenase-2 Inhibitors on the Risk of 

Peptic Ulcer Disease: A Population-Based Cohort in 

Taiwan. 44(4) 347 - 348

369 

Yearly Title Index 


Individual Statins on the Risk of Colorectal Cancer: A 

Population-Based Observation In Taiwan. 44 (3) 255 - 256 

Intravenous Labetalol versus Oral Nifedipine in the 

Treatment of Severe Hypertension in Pregnancy. 44 (4) 

287 - 290 

Is Medical Education Really Stressful? A Prospective 

Study in Selcuk University, Turkey. 44 (2) 104 - 112 

More Expensive Surfaces are Not Always Better. 44 (1) 40 

- 45 

Mucinous Cystadenoma in a Horse Shoe Kidney. Report 

of a Case with Review of Literature. 44 (1) 60 - 62 

Neonatal Cardiac Tamponade, What is the Cause?. 44 (2) 

141 - 142 

New Approaches in the Diagnosis and Treatment of 

Susceptible, Multidrug-Resistant and Extensively Drug 

Resistant Tuberculosis. 44 (1) 3 - 19 

Nosocomial Bacteria on Doctors Mobile Phones. 44 (2) 101 

- 103 

Obstetric Outcome of Teenage Pregnancies: A 5-Year 

Experience in a University Hospital. 44 (3)195 - 199 

Oncocytic and Clear Cell Areas in a Solid Pseudopapillary 

Tumor of the Pancreas: A Case Report. 44(4) 332 - 334 

Pedicled Seromuscular Flap for Inforcement of High Risk 

Intestinal Anastomoses. 44 (3) 190 - 194 

Percutaneous Fixation of Recent Scaphoid Fracture. 44 (3) 

219 - 223 

Persistent Junctional Reciprocating Tachycardia (PJRT). 

44 (1) 53 - 55 

Prostatic Adenocarcinoma and Chronic Lymphocytic 

Leukemia: a Case Report. 44(4) 344 - 346 

Proximal Tibial Osteotomy in Medial Compartment 

Osteoarthritis: How High is High?. 44 (2) 92 - 100 

Scaphoid Dislocation, either Isolated or Associated with 

Axial Carpal Dissociation: Three Cases Report. 44 (3) 244 

- 250 

Spinal Cord Demyelination in Biotinidase Deficiency; A 

Case Report. 44 (2) 135 - 138 

Spontaneous Hemorrhage in an Adrenal 

Pheochromocytoma. 44 (3) 251 - 254 

Squamous Cell Carcinoma of the Penis: Magnetic 

Resonance Imaging Findings. 44 (4) 338 - 340 

Stereotactic Surgery: Diagnostic and Therapeutic Role in 

the Management of Brain Disorders and Our Experience 

at Ibn Sina Hospital. 44(4) 303 - 307 

Subarachnoid Hemorrhage as a Rare Presentation of 

Cerebral Venous Sinus Thrombosis. 44 (1) 50 - 52 

Synergy Between Dendritic Cell-Based Vaccine and Anti- 

CD137 Monoclonal Antibody in the Treatment of Mouse 

Renal Cell Carcinoma. 44(4) 308 - 315 

The Effect of Gene Polymorphisms (ENOS G894T, PON1 

and Catalase -262C→T) on fertility and Sperm Parameters 

in Turkish Men with Clinical Varicocele: A Pilot Study. 

44(4) 316 - 321 

The Impact of Metabolic Risk Management on Recurrence 

of Urinary Stones. 44 (3) 215 - 218 

The Microbiology of Vaginal Discharge and the Prevalence 

of Bacterial Vaginosis in a Cohort of Non-pregnant women 

in Kuwait. 44 (1) 20 - 25 

The Prevalence and Route of Delivery of Prolonged 

Pregnancies. 44 (2) 118 - 120 

Total Hip Replacement after Hip Fracture. Primary or 

Secondary Surgery? A Comparison of Clinical and 

Radiological Results. 44 (1) 35 - 39 

Total Hip Replacement in Nigeria: A Preliminary Report. 

44(4) 291 - 296 

Towards Prevention of Diabetes in Offsprings of Type 2 

Diabetic Patients. 44(4) 297 - 302 

Unstable Carpometacarpal Dislocation of Ulnar Four 

Fingers – An Easily Overlooked Injury. 44 (4) 341 - 343 

Unusual Presentation of Duplex Collecting System: a Case 

Report. 44(4) 326 - 328 

Vitamin A and Zinc Alter the Immune Function in 

Tuberculosis. 44 (3) 183 - 189 

Ward Mechanical Ventilation (WMV) Audit. 44 (4) 322 - 

325



Yearly Author Index 


(KMJ) 2012; Volume 44 

Kuwait Medical Journal 2012, 44 (4): 370-371 

Abassi R ..................................................... 46 

Abbas A ...................................................... 190 

Abdelgaid SM .......................................... 200, 219 

Abdel-Malak F .......................................... 200 

Abdul-Azeem ME .................................... 244 

Abdulla AA .............................................. 297 

AbdulSalam SM ....................................... 146 

Acarturk O ................................................ 125 

Aglamis E .................................................. 113, 316 

Ahmad I ..................................................... 183 

Ahmad S .................................................... 3 

Ahrari B .................................................... 274 

Akin Y ....................................................... 215 

Amaechi KU ........................................... 291 

Alabad A ................................................... 135 

Aladily TN .............................................. 344 

Al-Adwani M ......................................... 338 

Al-Ali M .................................................. 322 

Al Awadi Y ............................................. 303 

Al-Duaij S ................................................ 50 

Aleinati T ................................................. 66 

Al-Fahdli M ............................................. 50 

Al-Hamdan R .......................................... 53 

AlHarbi O ................................................ 235 

Ali F .......................................................... 149 

Ali QE ....................................................... 30 

Ali W ......................................................... 183 

Al-Jama FE ............................................... 195 

Almasi V ................................................... 211 

AlMerri K ................................................. 66 

Almutairi H ............................................ 338 

AlMutairi M ............................................. 66 

Al Nassar M ............................................. 63 

AlOsaimi S ............................................... 235 

AlRashidi FM .......................................... 56 

Al-Shammari M ...................................... 101 

AlShalfan F .............................................. 146 

Al-Summait BAA .................................... 69 

Al-Jumah ES ............................................ 135 

Alqalaf F .................................................. 135 

Altinova S ............................................... 113 

Al-Tarrah MY .......................................... 146 

Altooky MH ............................................ 20 

Alwan MH .............................................. 251 

Al Zanki MBY ......................................... 227 

Andersen RE ........................................... 40 

Anjali T .................................................... 287 

Artas H .................................................... 316 

Ashok K .................................................. 341 

Asker W ................................................... 190 

Ates C ...................................................... 316 

Atici T ....................................................... 92 

Azab HS ................................................... 20 

Azizieh F ................................................. 277 

Babacan T ................................................. 125 

Bahzad M ................................................ 322 

Bal B .......................................................... 125 

Baykara M ................................................ 215 

Bendhifari F ............................................ 297 

Beytur A ................................................... 113 

Bhandari S ............................................... 30 

Bonajmah AA .......................................... 35 

Borazan H ............................................... 121 

Ceylan C .................................................. 113, 316 

Ceylan GG .............................................. 316 

Chakravorti ............................................. 224 

Chandrashekhar B ............................... 341 

Chen PC ................................................... 347 

Dagogo-Jack S ....................................... 274 

Danisman A ............................................ 215 

Dawoud I ................................................ 190 

DeMarco SL ............................................ 40 

Ego AU ................................................... 291 

Elaaser EM .............................................. 20 

Elkady AA .............................................. 20 

Ellatif MEA ............................................ 190 

El Morshidy AF .................................... 219, 244 

El-Sharakawy AI .................................. 297 

Erdogru T ............................................... 215 

Ermutlu C ............................................... 92 

Faeizi F .................................................... 46 

Feng J ....................................................... 239 

Gelidan A ................................................ 231 

Gibson S .................................................. 143 

Greenough WB ....................................... 1, 40 

Gupta MK ............................................... 183

371 

Yearly Author Index 


Habib SK ................................................. 30 

Haidari M ............................................... 211 

Halallkhor HTS ...................................... 46 

Haleem S ................................................. 30 

Hamed I .................................................. 338 

Hammoud MS ........................................ 141 

Hegde BM ............................................... 90 

Hutchinson IF ......................................... 143 

Ibrahim YMAE ...................................... 335 

Iskandar MM .......................................... 69 

Ismail ZA ................................................. 69 

Jaiprakash P ........................................... 332 

Jayant T M ............................................... 60 

Joshi R ...................................................... 101 

Kahvic M ................................................ 329 

Kantoush H ........................................... 329 

Kara I ....................................................... 121 

Karaoglu N .............................................. 104 

Karimi A .................................................... 26 

Khadadah S ............................................. 322 

Khajah H .................................................. 303 

Khan A ...................................................... 303 

Khan HA ................................................... 53 

Khalifa NM ............................................... 133 

Khalifa SO ................................................. 133 

Khalil MF .................................................. 141 

Khorramabadi MS ................................... 211 

Kose S ........................................................ 125 

Kushwaha RAS ........................................ 183 

Lai HC ....................................................... 255, 347 

Lai SW ....................................................... 154, 255, 347 

Liao KF ...................................................... 154, 255 , 347 

Liu J ........................................................... 239 

Mayanglambam RD .............................. 287 

Mehmood K ............................................. 53 

Memisoglu K ........................................... 92 

Menon V .................................................. 60 

Mittal R ..................................................... 133 

Mokaddas E ............................................. 3 

Mokhtar M ............................................... 63 

Mondal R .................................................. 139, 224 

Mothafar FJ ............................................... 56 

Muo CH ..................................................... 255, 347 

Muqim ....................................................... 56 

Muttikkal TJE ........................................... 149, 227 

Nafisi MR .................................................. 26 

Nandi M .................................................... 139, 224 

Nejad SP .................................................... 118 

Noor TA ..................................................... 35 

Otelcioglu S ............................................... 121 

Ozturk A .................................................... 92 

Parsian H ................................................... 46 

Pospula W ................................................. 35 

Prakash C .................................................. 35 

Prasad AS .................................................. 180 

Prasad KV ................................................ 60 

Prasad R .................................................... 183 

Pritish S .................................................... 341 

Qujeq D ..................................................... 46 

Rao ACK .................................................. 332 

Raina A ..................................................... 141 

Raghupathy R ........................................ 277 

Ramadan A ............................................. 303 

Rawdhan H ............................................. 101 

Rezanejad J .............................................. 211 

Ronald M ................................................. 251 

Rotimi VO ................................................ 63 

Saad E ....................................................... 235 

Sadeq FJAA .............................................. 149, 227 

Saha AK .................................................... 143 

Sahin N ..................................................... 92 

Salam SA .................................................. 50 

Salah M .................................................... 200 

Saleh AAM .............................................. 20 

Saleem M ................................................. 183 

Sanam M .................................................. 118 

Saritas TB ................................................. 121 

Sarkar S .................................................... 139 

Seker M ..................................................... 104 

Serefoglu EC ............................................. 113 

Shamsah M ............................................... 101 

Sharma D .................................................. 30 

Sharma PK ............................................... 326 

Shirzad H .................................................. 26 

Singh NG ................................................. 329 

Sung FC .................................................... 255, 347 

Tekin HS ................................................... 125 

Tuncer S .................................................... 121 

Uwatoronye NC .................................... 291 

Valiathan M ............................................ 332 

Varshney R ............................................... 30 

Valente SA ................................................ 40 

Vijay MK .................................................. 326 

Vijay P ...................................................... 326 

Wei SM...................................................... 308 

Wraikat AA ............................................. 344 

Yan ZZ...................................................... 308 

Yorulmaz H .............................................. 125 

Yuce H ...................................................... 316 

Yucel S ....................................................... 215 

Zakaria Y .................................................. 244 

Zamanzad B ............................................. 26 

Zhou S ....................................................... 239 

Zhou J ....................................................... 308 

Zinkhan S ................................................. 251

Vol 44 # 4 December 2012 - Kma.org.kw

Create successful ePaper yourself

Delete template?

Save as template?