Bax and APPL1 are involved in DCC-ADD induced colorectal ...

Gene Therapy and Molecular Biology Vol 14, page 56
56
Gene Ther Mol Biol Vol 14, 56-61, 2012
Bax and APPL1 are involved in DCC-ADD induced
colorectal carcinoma cells apoptosis
Research Article
Xuhao Zhang 1,2, *, Baofeng Guo 3, *, Haizhan Jiao 2 , Yaran Wu 2 , Jiaqi Xu 4 , Jing
Sun 2 , Yulai Zhou 1,2 , Qingwei Zhou 5 , Zhongyi Cong 1,2
1 The Key Laboratory of Pathobiology, Ministry of Education
2 Department of Regenerative Medicine, School of Pharmaceutical Science
3 Department of Emergency Medicine, China-Japan Union Hospital of Jilin University
4 Department of Pharmacy, School of Pharmaceutical Science
5 Department of Biochemistry, Institute of Regenerative Medical Sciences, Jilin University, Changchun 130021, China
*These two authors contributed equally to this work.
*Correspondence: Zhongyi Cong, the Key Laboratory of Pathobiology, Ministry of Education, and Department of Regenerative
Medicine, School of Pharmaceutical Science, Jilin University, Changchun 130021, China. Tel: 86-431-85619715; E-mail:
congzhy@jlu.edu.cn
Qingwei Zhou, Department of Biochemistry, Institute of Regenerative Medical Sciences, Jilin University, Changchun 130021, China.
Tel: 86-431-85619386; E-mail: zhouqw@jlu.edu.cn
Keywords: DCC (deleted in colorectal carcinoma); colorectal carcinoma; apoptosis; Bax; APPL1
Received: 9 May 2012; Revised: 12 July 2012
Accepted: 16 July 2012; electronically published: 18 July 2012
Summary
DCC (deleted in colorectal carcinoma) is a tumor suppressor whose expression is significantly reduced or absent in
most advanced colorectal carcinoma. DCC is a transmembrane receptor for netrin-1 functioning as a dependence
receptor that triggers apoptosis in the absence of netrin-1. The addiction dependence domain (ADD) that located in
the intercellular region of DCC is prerequisite for the pro-apoptotic activity, which is released when DCC is cleaved
by caspase3 and interacts with caspase9 and activates downstream caspases. However, the concrete molecular
mechanism is not very clear. In the present study, we constructed the recombinant plasmid pIRES2-EGFP-ADD,
and transfected it into human colorectal carcinoma cells SW1116. We investigated the cell proliferation and
apoptosis through CCK-8 cell proliferation assay, AO/EB fluorescence staining assay and TUNEL assay. And the
expression of Bax and APPL1 was detected through immunocytochemistry method and flow cytometry. The results
revealed that DCC-ADD gene transfection significantly inhibited SW1116 cells proliferation (P

I. Introduction
Deleted in colorectal carcinoma (DCC) is a
tumor suppressor, which was discovered in rectal
carcinoma tissues in the early 1990s. DCC gene
locates on chromosome 18q21.3 and spans 1.4 Mb
encoding a transmembrane protein composed of 1447
amino acids (Fearon ER, et al., 1990). The
extracellular region of DCC is a receptor for netrin-1
containing four immunoglobulin domains and six
fibronectin type III domains. And the transmembrane
and cytoplasmic region of DCC contains an addiction
dependence domain (ADD), which introduces signals
into cytoplasm (Bernet A, et al., 2007). Expression of
DCC is markedly reduced in more than 50% of
colorectal tumors, as well as in many other neoplasms
(Horstmann MA, et al., 1997; Mehlen, P, et al.,
2004). And loss of DCC is associated with poor
prognosis and potentially decreased response to
adjuvant chemotherapy in colorectal cancer patients
(Gal R, et al., 2004; Shibata D, et al., 1996; Saito M,
et al.,1999; Banerjee AK, 1997). The Rat-1 cell line
with high levels of DCC antisense RNA expression
showed a faster growth rate, and had tumorigenicity
in nude mice (Narayanan R, et al., 1992). While
restoration of DCC expression can suppress
tumorigenic growth properties in vitro and in nude
mice (Goyette MC, et al., 1992; Tanaka K, et al.,
1991; Mehlen, P, et al., 2004).
DCC functions as a tumor suppressor via its
ability to trigger tumor cell apoptosis (Castets M, et
al., 2011). By functioning as a dependence receptor,
DCC induces apoptosis unless engaged by its ligand,
netrin-1. Over expression of the DCC ligand netrin-1
in the digestive tract has been shown to result in the
inhibition of epithelial cell death and the promotion of
tumor progression. The pro-apoptotic signaling
induced by DCC requires its intracellular domain
cleavage by caspase3 after Asp 1290 (Mazelin L, et
al., 2004; Mehlen P, et al., 1998). The mutation of
Asp 1,290 to Asn inhibits the cleavage and suppresses
the pro-apoptotic activity of DCC. The residues 1243-
1264 of DCC exposed by cleavage were ascertained
to be the very domain required to induce apoptosis.
This domain, named ADD, interacts with caspase9
and activates downstream caspases, by which the
apoptotic signal is amplified and induces cell
apoptosis (Mehlen P, et al., 1998; Forcet C, et al.,
2001). Although some studies had shown that the
interaction with caspases might be the mechanism of
DCC-induced apoptosis, whether other apoptosis
signal pathway is involved has not been affirmed. In
the present study, we found that the expression of Bax
and APPL1 in colorectal cancer cells SW1116 is
evidently increased after the transfection of DCC-
ADD gene, indicating that both Bax and APPL1 are
closely related to the pro-apoptotic activity of DCC.
Gene Therapy and Molecular Biology Vol 14, page 59
57
II. Materials and Methods
2.1 Vector construction
The coding sequence of DCC-ADD (NM_005215.3,
3,727-3,792 bp) was obtained by annealing of the following
two oligodeoxynucleotides (synthesized by Sangon Biotech
Co., Ltd, China) at 55 o C for 1 min following denaturating
at 94 °C for 30 s. The sense strand was 5'-
CTAGCGCCACCATGAACAATCCTGCTGTCGTGAGC
GCCATCCCGGTGCCAACGCTAGAAAGTGCCCAGTA
CCCAGGAATCTGAC-3', and the anti-sense strand was 5'-
TCGAGTCAGATTCCTGGGTACTGGGCACTTTCTAG
CGTTGGCACCGGGATGGCGCTCACGACAGCAGGA
TTGTTCATGGTGGCG-3'. (The underlined letters were
cohesive end sites of restriction enzyme XhoI and NdeI, and
the italic letters were Kozak sequence). The ADD sequence
was then ligated with XhoI and NdeI digested plasmid
vector pIRES2-EGFP. The recombined plasmid was
transformed into E.coli JM109 competent cells. After
screening, amplifying, extracting and purifying, the
recombinant plasmid pIRES2-EGFP-ADD was used for
transfection.
2.2 Cell culture and transfection
Human colorectal carcinoma cells SW1116 were at
37 o C in a 5% CO 2 humidified incubator and maintained in
Dulbecco’s modified Eagle’s medium (DMEM)
supplemented with 10% heat-inactivated fetal bovine serum
(FBS, GIBCO) and antibiotics (100 IU/mL of penicillin and
100 IU/mL of streptomycin).
The SW1116 cells were seeded into 96, 24 or 6-well
plates (5×10 3 , 1×10 4 or 2×10 5 cells/well) and cultured for
12 hours to confluence. The plasmid pIRES2-EGFP-ADD
or pIRES2-EGFP was then transfected into SW1116 cells
with Lipofectamine 2000 (Invitrogen, USA) according to
the manufacturer’s instruction, and the ratio of
Lipofectamine 2000 (μL) to DNA (μg) was 5:2.
2.3 Cell count kit-8 (CCK-8) cell
proliferation assay
The SW1116 cells were seeded into a 96-well plate
and cultured for 12 hours to confluence followed by
trasfection. Each group comprised 10 wells. 36 h post
transfection, 10 μL of CCK-8 solution (Dojindo, Japanese)
was added into each well, which contained 100 μL of
medium. After incubation for 3 h at 37 o C, the amount of
generated formazan was measured for absorbance at a
wavelength of 450 nm. The optical density (OD) values
recorded represented the proliferation of cells, and were
used to calculate the growth inhibition rate by the formula:
Inhibition rate = (1 - OD value of transfection group/OD
value of medium group) × 100%. All the above experiments
were performed in triplicate.
2.4 Acridine orange/ethidium bromide
(AO/EB) fluorescence staining assay
Little coverslips were putted into each well of a
24-well plate before seeding SW1116 cells into it. The
cells were cultured for 12 hours to confluence followed
by transfection. 24 h post transfection, the coverslips
were took out for AO/EB fluorescence staining.

This method was based on the differential uptake of
fluorescent DNA binding dye AO (green fluorescence)
and EB (red fluorescence) and applied to investigate cell
apoptosis. Briefly, 2 μL of a mixture of 10 μg/mL of AO
and 10 μg/mL of EB (v/v, 1:1) was added to the cells.
And the cells were observed under a fluorescence
microscope at 510 nm.
2.5 Terminal dexynucleotidyl transferasemediated
dUTP nick end labeling (TUNEL) assay
Little coverslips were putted into each well of a
24-well plate before seeding SW1116 cells into it. The cells
were cultured for 12 hours to confluence followed by
transfection. 24 h post transfection, the coverslips were
taken out for TUNEL assay using an in situ cell death
detection kit (Keygen, China) as described by manufacturer.
Briefly, the cell samples were treated with 4%
paraformaldehyde for 30 min and soaked in PBS for 5 min
at room temperature, followed by permeabilized with 0.2%
TritonX-100 for 20 min and blocked with 3% hydrogen
dioxide. Then the cell samples were incubated with 50 μL
of a mixture of terminal deoxynucleotidyl transferase (Tdt)
and labeled dUTP at 37 o C for 1 h in dark. And 50 μL of
streptavidin-HRP were then added to the cell samples
followed by incubated the cell samples with
diaminobenzidine (DAB) for 5 min in dark. At last the cell
samples were counterstained by hematoxylin for 20 min.
After washed with PBS, the samples were observed under a
microscope.
2.6 Immunocytochemistry assay
Little coverslips were putted into each well of a
24-well plate before seeding SW1116 cells into it. The cells
were cultured for 12 hours to confluence followed by
transfection. 20 h post transfection, the coverslips were
taken out for immunocytochemistry assay. The cell samples
were treated with 4% paraformaldehyde for 30 min and
washed with PBS for 5 min. Then the cell samples were
permeabilized with 0.2% TritonX-100 for 20 min, after
which treated with 3% hydrogen dioxide for 10 min, and
blocked with 1% normal mouse serum for 2 h. The cell
samples were then incubated overnight at 4 o C with mouse
anti-human Bax monoclonal antibodies or mouse antihuman
APPL1 monoclonal antibodies (Santa Cruz
Biotechnology, USA), and washed with PBS for 5 min.
Then the cell samples were incubated with horseradish
peroxidase (HRP)-labeled goat anti-mouse IgG polyclonal
antibodies for 30 min followed by washed for 5 min. The
cell samples were then incubated with diaminobenzidine
(DAB) for 10 min in dark and washed. At last, the cell
samples were counterstained by hematoxylin for 20 min
and observed under a microscope.
2.7 Flow cytometry assay
The SW1116 cells were seeded in 6-well plates
and cultured for 12 hours to confluence followed by
transfection. 20 h post transfection, the cells were collected
and washed with PBS containing 1% FBS. Then the cells
were treated with 4% of paraformaldehyde and washed with
PBS containing 1% FBS. The cells were resuspended in
500 μL of 0.1% TritonX-100 for 30 min followed by
blocked with PBS containing 1% FBS for 1 h. Then the
cells were incubated with 1:200 diluted mouse anti-human
Bax monoclonal antibodies (Santa Cruz Biotechnology,
USA) at 4 °C for 1 h followed by washed twice with PBS
Gene Therapy and Molecular Biology Vol 14, page 58
58
containing 1% FBS. Then the cells were incubated with
1:40 diluted of FITC-labeled goat anti-mouse IgG
polyclonal antibodies for 30 min in dark except the negative
control group followed by washed twice with PBS. Then
the cells were resuspended with 400 μL of PBS binding
buffer and analyzed using a flow cytometry.
2.8 Statistical analysis
All numerical data were expressed in the form of
means ± standard deviation (SD), and statistical difference
between groups were evaluated by analysis of variance
(ANOVA) and SNK-q test using SPSS11.5 statistics
software. Significance was defined as P

III. Discussion
The pro-apoptotic activity of DCC-ADD has long
been discussed. In the present study, we constructed the
recombinant plasmid pIRES2-EGFP-ADD, and transfected
it into human colorectal cancer cells SW1116. The results
from precise methods of CCK-8 cell proliferation assay,
AO/EB fluorescence staining assay and TUNEL assay
confirm that point once again.
The possible mechanism of DCC-induced
apoptosis is related to the cleavage of DCC at Asp1290 by
caspase3 leading to the exposure of ADD, which activates
caspase9 and the downstream apoptotic signals (Mehlen P,
et al., 1998).
Bax is a member of the Bcl-2 family and plays a
central role in the mitochondria-dependent apoptotic
pathway. When receiving a death signal, Bax can promote
the release of cytochrom c from mitochondria, which can
combine with Apaf-1 and activate caspase9 (Lalier L, et al.,
2007; Renault TT, et al., 2011). Our datas revealed that the
Bax expression of colorectal carcinoma cells was increased
obviously post DCC-ADD gene transfection, which gives
new clues that DCC may induce apoptosis through the
mitochondria-dependent apoptotic pathway.
Gene Therapy and Molecular Biology Vol 14, page 59
59
It has been demonstrated that APPL1 (also called
DCC-interacting protein-13, DIP13) can mediate the proapoptotic
activity of DCC through the interaction between
its DCC-interacting domain and DCC-ADD. Co-expression
of DCC and APPL1 can increase DCC induced apoptosis
obviously. And removal of the DCC-interacting domain on
APPL1 or inhibition of APPL1 expression blocks DCCinduced
apoptosis (Liu J, et al., 2002).
In the present study, the result showed that DCC-
ADD gene transfection induced colorectal carcinoma cells
apoptosis and enhanced the expression level of APPL1.
ADD can interact with initiator of caspase9 and promote the
activation of caspases leading to cell apoptosis (Mehlen P,
et al., 1998; Forcet C, et al., 2001). As the adapter protein
between ADD and caspase9, APPL1 plays an important
role in DCC-induced apoptosis (Liu J, et al., 2002).
In summary, we surmise the pathway of DCC inducing
apoptosis may due to its ADD being exposed by cleavage
of caspase3. And Bax and APPL1 mediate the activating of
caspase9 by ADD, which promotes the apoptosis cascade at
last. Among them, the expression and activity changes of
the caspase9 need further experimental validation.

Cong et al: Bax and APPL1 are involved in DCC-ADD induced colorectal carcinoma cells apoptosis
Figure 1: ADD gene transfection inhibits SW1116 cells proliferation and induces apoptosis.
(a) Obtaining ADD-coding sequence and constructing recombinant plasmid pIRES2-EGFP-ADD. Lane 1 and 2: ADDcoding
sequence obtained by denaturating and annealing of its sense strand and anti-sense strand oligodeoxynucleotides; lane 3:
restriction enzyme XhoI and NdeI-digested recombinant plasmid pIRES2-EGFP-ADD.
(b) Plasmid pIRES2-EGFP-ADD transfection inhibits SW1116 cells proliferation. Cell proliferation was detected through
CCK-8 cell proliferation assay at 36 h post transfection. Each symbol represents the mean OD values ± SD of cell proliferation.
(c) Plasmid pIRES2-EGFP-ADD transfection induces SW1116 cells apoptosis detected through AO/EB staining assay at 24
h post transfection. The arrows indicate the apoptotic cells in red fluorescence. Magnification, ×200.
(d) Plasmid pIRES2-EGFP-ADD transfection induces SW1116 cells apoptosis detected through TUNEL assay at 24 h post
transfection. The arrows indicate the brown-stained apoptotic cells. Magnification, ×200.
Figure 2: Bax and APPL1 expression increases in ADD gene-transfected SW1116 cells.
(a) Bax and APPL1 expression detected by immunocytochemical method at 20 h post plasmid pIRES2-EGFP-ADD transfection.
The arrows indicate the brown-stained positive cells. Magnification, ×200.
(b) Bax expression detected by flow cytometry at 20 h post transfection.
60

Acknowledgement
This study was supported by the National Natural
Science Foundation of China (No. 30801354 and
References
Banerjee AK. DCC expression and prognosis in colorectal
cancer. Lancet. 1997 Apr 5;349(9057):968.
Bernet A, Mehlen P. Dependence receptors: when apoptosis
controls tumor progression. Bull Cancer. 2007
Apr;94(4):E12-7.
Castets M, Broutier L, Molin Y, Brevet M, Chazot G, Gadot N,
Paquet A, Mazelin L, Jarrosson-Wuilleme L,
Scoazec JY, Bernet A, Mehlen P. DCC constrains
tumour progression via its dependence receptor
activity. Nature. 2011 Dec 11;482(7386):534-7.
Fearon ER, Cho KR, Nigro JM, Kern SE, Simons JW, Ruppert
JM, Hamilton SR, Preisinger AC, Thomas G, Kinzler
KW, et al. Identification of a chromosome 18q gene
that is altered in colorectal cancers. Science. 1990
Jan 5;247(4938):49-56.
Forcet C, Ye X, Granger L, Corset V, Shin H, Bredesen DE,
Mehlen P. The dependence receptor DCC (deleted in
colorectal cancer) defines an alternative mechanism
for caspase activation. Proc Natl Acad Sci U S A.
2001 Mar 13;98(6):3416-21.
Gal R, Sadikov E, Sulkes J, Klein B, Koren R. Deleted in
colorectal cancer protein expression as a possible
predictor of response to adjuvant chemotherapy in
colorectal cancer patients. Dis Colon Rectum. 2004
Jul;47(7):1216-24.
Goyette MC, Cho K, Fasching CL, Levy DB, Kinzler KW,
Paraskeva C, Vogelstein B, Stanbridge EJ.
Progression of colorectal cancer is associated with
multiple tumor suppressor gene defects but inhibition
of tumorigenicity is accomplished by correction of
any single defect via chromosome transfer. Mol Cell
Biol. 1992 Mar;12(3):1387-95.
Horstmann MA, Pösl M, Scholz RB, Anderegg B, Simon P,
Baumgaertl K, Delling G, Kabisch H. Frequent
reduction or loss of DCC gene expression in human
osteosarcoma. Br J Cancer. 1997;75(9):1309-17.
Gene Therapy and Molecular Biology Vol 14, page 59
61
30970791) and the Fundamental Research Funds
(201103234) from Jilin University, China
Lalier L, Cartron PF, Juin P, Nedelkina S, Manon S, Bechinger
B, Vallette FM. Bax activation and mitochondrial
insertion during apoptosis. Apoptosis. 2007
May;12(5):887-96.
Liu J, Yao F, Wu R, Morgan M, Thorburn A, Finley RL Jr,
Chen YQ. Mediation of the DCC apoptotic signal by
DIP13 alpha. J Biol Chem. 2002 Jul
19;277(29):26281-5.
Mazelin L, Bernet A, Bonod-Bidaud C, Pays L, Arnaud S,
Gespach C, Bredesen DE, Scoazec JY, Mehlen P.
Netrin-1 controls colorectal tumorigenesis by
regulating apoptosis. Nature. 2004 Sep
2;431(7004):80-4.
Mehlen P, Rabizadeh S, Snipas SJ, Assa-Munt N, Salvesen
GS, Bredesen DE. The DCC gene product induces
apoptosis by a mechanism requiring receptor
proteolysis. Nature. 1998 Oct 22;395(6704):801-4.
Mehlen P, Fearon ER. Role of the dependence receptor DCC in
colorectal cancer pathogenesis. J Clin Oncol. 2004
Aug 15;22(16):3420-8.
Narayanan R, Lawlor KG, Schaapveld RQ, Cho KR,
Vogelstein B, Bui-Vinh Tran P, Osborne MP, Telang
NT. Antisense RNA to the putative tumor-suppressor
gene DCC transforms Rat-1 fibroblasts. Oncogene.
1992 Mar;7(3):553-61.
Renault TT, Manon S. Bax: Addressed to kill. Biochimie. 2011
Sep;93(9):1379-91.
Shibata D, Reale MA, Lavin P, Silverman M, Fearon ER,
Steele G Jr, Jessup JM, Loda M, Summerhayes IC.
The DCC protein and prognosis in colorectal cancer.
N Engl J Med. 1996 Dec 5;335(23):1727-32.
Saito M, Yamaguchi A, Goi T, Tsuchiyama T, Nakagawara G,
Urano T, Shiku H, Furukawa K. Expression of DCC
protein in colorectal tumors and its relationship to
tumor progression and metastasis. Oncology.
1999;56(2):134-41.
Tanaka K, Oshimura M, Kikuchi R, Seki M, Hayashi T,
Miyaki M. Suppression of tumorigenicity in human
colon carcinoma cells by introduction of normal
chromosome 5 or 18. Nature. 1991 Jan
24;349(6307):340-2.
Qingwei Zhou Ph.D Zhongyi Cong Ph.D