Bax and APPL1 are involved in DCC-ADD induced colorectal ...

More documents

Recommendations

Info

I. Introduction Deleted in colorectal carcinoma (DCC) is a tumor suppressor, which was discovered in rectal carcinoma tissues in the early 1990s. DCC gene locates on chromosome 18q21.3 and spans 1.4 Mb encoding a transmembrane protein composed of 1447 amino acids (Fearon ER, et al., 1990). The extracellular region of DCC is a receptor for netrin-1 containing four immunoglobulin domains and six fibronectin type III domains. And the transmembrane and cytoplasmic region of DCC contains an addiction dependence domain (ADD), which introduces signals into cytoplasm (Bernet A, et al., 2007). Expression of DCC is markedly reduced in more than 50% of colorectal tumors, as well as in many other neoplasms (Horstmann MA, et al., 1997; Mehlen, P, et al., 2004). And loss of DCC is associated with poor prognosis and potentially decreased response to adjuvant chemotherapy in colorectal cancer patients (Gal R, et al., 2004; Shibata D, et al., 1996; Saito M, et al.,1999; Banerjee AK, 1997). The Rat-1 cell line with high levels of DCC antisense RNA expression showed a faster growth rate, and had tumorigenicity in nude mice (Narayanan R, et al., 1992). While restoration of DCC expression can suppress tumorigenic growth properties in vitro and in nude mice (Goyette MC, et al., 1992; Tanaka K, et al., 1991; Mehlen, P, et al., 2004). DCC functions as a tumor suppressor via its ability to trigger tumor cell apoptosis (Castets M, et al., 2011). By functioning as a dependence receptor, DCC induces apoptosis unless engaged by its ligand, netrin-1. Over expression of the DCC ligand netrin-1 in the digestive tract has been shown to result in the inhibition of epithelial cell death and the promotion of tumor progression. The pro-apoptotic signaling induced by DCC requires its intracellular domain cleavage by caspase3 after Asp 1290 (Mazelin L, et al., 2004; Mehlen P, et al., 1998). The mutation of Asp 1,290 to Asn inhibits the cleavage and suppresses the pro-apoptotic activity of DCC. The residues 1243- 1264 of DCC exposed by cleavage were ascertained to be the very domain required to induce apoptosis. This domain, named ADD, interacts with caspase9 and activates downstream caspases, by which the apoptotic signal is amplified and induces cell apoptosis (Mehlen P, et al., 1998; Forcet C, et al., 2001). Although some studies had shown that the interaction with caspases might be the mechanism of DCC-induced apoptosis, whether other apoptosis signal pathway is involved has not been affirmed. In the present study, we found that the expression of Bax and APPL1 in colorectal cancer cells SW1116 is evidently increased after the transfection of DCC- ADD gene, indicating that both Bax and APPL1 are closely related to the pro-apoptotic activity of DCC. Gene Therapy and Molecular Biology Vol 14, page 59 57 II. Materials and Methods 2.1 Vector construction The coding sequence of DCC-ADD (NM_005215.3, 3,727-3,792 bp) was obtained by annealing of the following two oligodeoxynucleotides (synthesized by Sangon Biotech Co., Ltd, China) at 55 o C for 1 min following denaturating at 94 °C for 30 s. The sense strand was 5'- CTAGCGCCACCATGAACAATCCTGCTGTCGTGAGC GCCATCCCGGTGCCAACGCTAGAAAGTGCCCAGTA CCCAGGAATCTGAC-3', and the anti-sense strand was 5'- TCGAGTCAGATTCCTGGGTACTGGGCACTTTCTAG CGTTGGCACCGGGATGGCGCTCACGACAGCAGGA TTGTTCATGGTGGCG-3'. (The underlined letters were cohesive end sites of restriction enzyme XhoI and NdeI, and the italic letters were Kozak sequence). The ADD sequence was then ligated with XhoI and NdeI digested plasmid vector pIRES2-EGFP. The recombined plasmid was transformed into E.coli JM109 competent cells. After screening, amplifying, extracting and purifying, the recombinant plasmid pIRES2-EGFP-ADD was used for transfection. 2.2 Cell culture and transfection Human colorectal carcinoma cells SW1116 were at 37 o C in a 5% CO 2 humidified incubator and maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS, GIBCO) and antibiotics (100 IU/mL of penicillin and 100 IU/mL of streptomycin). The SW1116 cells were seeded into 96, 24 or 6-well plates (5×10 3 , 1×10 4 or 2×10 5 cells/well) and cultured for 12 hours to confluence. The plasmid pIRES2-EGFP-ADD or pIRES2-EGFP was then transfected into SW1116 cells with Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s instruction, and the ratio of Lipofectamine 2000 (μL) to DNA (μg) was 5:2. 2.3 Cell count kit-8 (CCK-8) cell proliferation assay The SW1116 cells were seeded into a 96-well plate and cultured for 12 hours to confluence followed by trasfection. Each group comprised 10 wells. 36 h post transfection, 10 μL of CCK-8 solution (Dojindo, Japanese) was added into each well, which contained 100 μL of medium. After incubation for 3 h at 37 o C, the amount of generated formazan was measured for absorbance at a wavelength of 450 nm. The optical density (OD) values recorded represented the proliferation of cells, and were used to calculate the growth inhibition rate by the formula: Inhibition rate = (1 - OD value of transfection group/OD value of medium group) × 100%. All the above experiments were performed in triplicate. 2.4 Acridine orange/ethidium bromide (AO/EB) fluorescence staining assay Little coverslips were putted into each well of a 24-well plate before seeding SW1116 cells into it. The cells were cultured for 12 hours to confluence followed by transfection. 24 h post transfection, the coverslips were took out for AO/EB fluorescence staining.
This method was based on the differential uptake of fluorescent DNA binding dye AO (green fluorescence) and EB (red fluorescence) and applied to investigate cell apoptosis. Briefly, 2 μL of a mixture of 10 μg/mL of AO and 10 μg/mL of EB (v/v, 1:1) was added to the cells. And the cells were observed under a fluorescence microscope at 510 nm. 2.5 Terminal dexynucleotidyl transferasemediated dUTP nick end labeling (TUNEL) assay Little coverslips were putted into each well of a 24-well plate before seeding SW1116 cells into it. The cells were cultured for 12 hours to confluence followed by transfection. 24 h post transfection, the coverslips were taken out for TUNEL assay using an in situ cell death detection kit (Keygen, China) as described by manufacturer. Briefly, the cell samples were treated with 4% paraformaldehyde for 30 min and soaked in PBS for 5 min at room temperature, followed by permeabilized with 0.2% TritonX-100 for 20 min and blocked with 3% hydrogen dioxide. Then the cell samples were incubated with 50 μL of a mixture of terminal deoxynucleotidyl transferase (Tdt) and labeled dUTP at 37 o C for 1 h in dark. And 50 μL of streptavidin-HRP were then added to the cell samples followed by incubated the cell samples with diaminobenzidine (DAB) for 5 min in dark. At last the cell samples were counterstained by hematoxylin for 20 min. After washed with PBS, the samples were observed under a microscope. 2.6 Immunocytochemistry assay Little coverslips were putted into each well of a 24-well plate before seeding SW1116 cells into it. The cells were cultured for 12 hours to confluence followed by transfection. 20 h post transfection, the coverslips were taken out for immunocytochemistry assay. The cell samples were treated with 4% paraformaldehyde for 30 min and washed with PBS for 5 min. Then the cell samples were permeabilized with 0.2% TritonX-100 for 20 min, after which treated with 3% hydrogen dioxide for 10 min, and blocked with 1% normal mouse serum for 2 h. The cell samples were then incubated overnight at 4 o C with mouse anti-human Bax monoclonal antibodies or mouse antihuman APPL1 monoclonal antibodies (Santa Cruz Biotechnology, USA), and washed with PBS for 5 min. Then the cell samples were incubated with horseradish peroxidase (HRP)-labeled goat anti-mouse IgG polyclonal antibodies for 30 min followed by washed for 5 min. The cell samples were then incubated with diaminobenzidine (DAB) for 10 min in dark and washed. At last, the cell samples were counterstained by hematoxylin for 20 min and observed under a microscope. 2.7 Flow cytometry assay The SW1116 cells were seeded in 6-well plates and cultured for 12 hours to confluence followed by transfection. 20 h post transfection, the cells were collected and washed with PBS containing 1% FBS. Then the cells were treated with 4% of paraformaldehyde and washed with PBS containing 1% FBS. The cells were resuspended in 500 μL of 0.1% TritonX-100 for 30 min followed by blocked with PBS containing 1% FBS for 1 h. Then the cells were incubated with 1:200 diluted mouse anti-human Bax monoclonal antibodies (Santa Cruz Biotechnology, USA) at 4 °C for 1 h followed by washed twice with PBS Gene Therapy and Molecular Biology Vol 14, page 58 58 containing 1% FBS. Then the cells were incubated with 1:40 diluted of FITC-labeled goat anti-mouse IgG polyclonal antibodies for 30 min in dark except the negative control group followed by washed twice with PBS. Then the cells were resuspended with 400 μL of PBS binding buffer and analyzed using a flow cytometry. 2.8 Statistical analysis All numerical data were expressed in the form of means ± standard deviation (SD), and statistical difference between groups were evaluated by analysis of variance (ANOVA) and SNK-q test using SPSS11.5 statistics software. Significance was defined as P
Page 1: Gene Therapy and Molecular Biology
Page 5 and 6: Cong et al: Bax and APPL1 are invol

Bax and APPL1 are involved in DCC-ADD induced colorectal ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?